Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of colonic goblet cells in host defense against attaching and effacing bacterial pathogens Bergstrom, Kirk S. B. 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_bergstrom_kirk.pdf [ 16.29MB ]
Metadata
JSON: 24-1.0071540.json
JSON-LD: 24-1.0071540-ld.json
RDF/XML (Pretty): 24-1.0071540-rdf.xml
RDF/JSON: 24-1.0071540-rdf.json
Turtle: 24-1.0071540-turtle.txt
N-Triples: 24-1.0071540-rdf-ntriples.txt
Original Record: 24-1.0071540-source.json
Full Text
24-1.0071540-fulltext.txt
Citation
24-1.0071540.ris

Full Text

THE ROLE OF COLONIC GOBLET CELLS IN HOST DEFENSE AGAINST ATTACHING AND EFFACING BACTERIAL PATHOGENS by Kirk S. B. Bergstrom B.Sc. (Biology), The University of Northern British Columbia, 2001  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2010   Kirk S. B. Bergstrom, 2010  Abstract The non-invasive attaching and effacing (A/E) pathogens Enteropathogenic and Enterohemorrhagic Escherichia coli (EPEC and EHEC, respectively) are a prominent subgroup of diarrheagenic E. coli, and remain an important cause of morbidity and mortality worldwide.  A/E pathogens intimately attach to the surface of intestinal  epithelial cells, and efface or destroy their microvilli. The intestinal epithelium is the first line of defense against A/E and all pathogens, and evidence is implicating epithelial secretory cells as playing a key role in this regard. Goblet cells are specialized secretory epithelial cells that are the sole producers of the mucus barrier lining the intestinal tract through the release of the polymeric Muc2 mucin.  Goblet cells also secrete the small  peptide Resistin-like Molecule-{beta} (RELM), which plays a direct role in host defense against parasitic helminths. Despite the abundance of which these molecules are released, little is known of their role in host-protection against A/E pathogens.  I  hypothesized that goblet cells play a critical role in host defense against A/E bacteria by secretion of Muc2/mucus and RELM into the intestinal tract.  Using Citrobacter  rodentium, a murine A/E pathogen that is an established model of EPEC and EHEC, my results demonstrate that goblet cells are a critical component of innate host-defense against an A/E pathogen. Studies with Muc2-/- mice show that Muc2/mucus production was critical for limiting luminal burdens, and for flushing away pathogenic bacteria as well as commensal bacteria from the mucosa. Moreover, RELM was highly induced and secreted into the lumen during the first week of infection. Studies with Retnlb-/- mice demonstrated that RELM production limited cecal burdens, deep penetration of colonic crypts, and severe inflammatory damage following infection. Lastly, adaptive immunity ii  plays a role in modulating goblet cell function, by promoting a down-regulation of goblet cell-specific gene expression and protein production, including Muc2. This effect appears to reflect a generalized adaptive immunity-mediated epithelial proliferative response and is associated with clearance of surface-associated pathogens. Thus, goblet cells are critical for managing infection by an A/E bacterial pathogen. These studies highlight a novel and previously unappreciated function of goblet cells in host defense against enteric bacterial infection.  iii  Preface The studies presented in this thesis could not have been completed without the invaluable help from several contributors.  The specific roles of each of these individuals are  detailed below.  Chapter 2. I designed and conducted the experiments, analyzed all the corresponding data, and wrote the manuscript, with the assistance of my supervisor.  However, I did  receive assistance from the following individuals. Dr. Julian Guttman and Dr. A. Wayne Vogl took the transmission electron microscopy (TEM) pictures that demonstrated in part that C. rodentium could infect goblet cells in vivo. Dr. Mohammed Rumi assisted in the design of primers for Muc2 and -actin, which were necessary for the gene expression studies. Mrs. Caixia Ma helped with the infections and the RT-qPCR involved in the reconstitution experiments. Dr. Saied Bouzari and Dr. Mohammed Khan assisted in the bacterial culturing involved in some of the experiments. Dr. Deanna L. Gibson generated and optimized the TFF3 primers. These studies are published and are referenced by the following citation: Bergstrom, K.S.B., Guttman, J.A., Rumi, M.A., Ma, C., Bouzari, S., Khan, M.A., Gibson, D.L., Vogl, W.A., and Vallance, B.A. 2008. Modulation of intestinal goblet cell function during infection by an attaching and effacing bacterial pathogen. Infect. Immun. 76(2):796-811.   Chapter 3. I contributed to 80% of the experimental design and execution described in the chapter, and analyzed the data and wrote the manuscript under the direction of Bruce Vallance.  Ms. Vanessa Kissoon-Singh and her supervisor Dr. Kris Chadee were  instrumental in designing and carrying out the metabolic labeling experiments used to iv  quantify mucus release in vivo during C. rodentium infection and analyzing the data (Figure 3.7). Dr. Deanna L. Gibson and Dr. B. Brett Finlay contributed to establishing the protocols for SYBR staining to allow for quantification of total bacterial numbers in mouse colons, as well as the fluorescence in-situ hybridization (FISH) studies that I applied to demonstrate that commensal and pathogenic bacteria were associated with the tissues of Muc2-/- mice, presented in Figures 3.8 to 3.10. Ms. Natasha Ryz assisted in SYBR green based quantification and FISH staining described in the chapter to reproduce my original findings.  Dr. Mari Montero also assisted in FISH staining presented in  Figures 3.8 and 3.9. Caixia Ma conducted the initial infections and colonization studies (Figures 3.2 and 3.3) and assisted with RT-qPCR (Figure 3) as well as barrier function studies described in Figure 3.8A.  Ho Pan (Andy) Sham helped with culturing  experiments for the cecal loop surgeries described in Figure 3.5 and well as barrier function studies with Mrs. Caixia Ma. Tina Huang assisted with immunofluorescent staining described in Figure A2.1A. Lastly, Dr. Anna Velcich developed the original Muc2-/- mice. These studies are published and are referenced by the following citation: Bergstrom, K.S.B., Kissoon-Singh, V., Gibson, D. L., Ma, C., Montero, M. Sham, H. P., Ryz, N., Huang, J. T., Velcich, A., Finlay, B. B., Chadee, K., and Vallance, B. A. 2010. Muc2 Protects Against Lethal Infectious Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa. PLoS Pathog 6(5): e1000902. doi:10.1371/journal.ppat.1000902.  Chapter 4. I designed and conducted 80% of the studies described in the chapter, analyzed all the data, and wrote the manuscript under Dr. Vallance’s direction. Dr. David Artis. Dr. Colby Zaph, and Dr. Meera Nair were central for providing the RELMdeficient mice, as well as the original anti-RELM antibodies, which led to the data I  v  generated and presented in this chapter.  Ms. Jennifer Lau assisted in the bacterial  enumeration and qPCR studies described in Figures 4.4 and 4.5 was well as studies with the EspF mutant described in Figure 4.7. Mrs. Caixia Ma assisted with the barrier function study described in Figure 4.4E. Mr. Ho-Pan Sham helped with reproducing the Western Blot studies presented in Figure 4.2.  Ethics Approvals: The animal research presented in this thesis was not conducted without permission from the animal ethics authorities, namely the UBC Animal Care Committee (ACC), and the Canadian Council on Animal Care (CCAC). The pertinent animal care ethical approval certificates validated by the ACC and CCAC are: 1. Number: A07-0089 Title: Goblet cell mediators and their impact on mucosal protection and susceptibility to colitis  2. Number: A09-0604 (Breeding Program) Title: Goblet cell mediators and their impact on mucosal protection and susceptibility to colitis  vi  Table of Contents  Abstract......................................................................................................................... ii Preface.......................................................................................................................... iv Table of Contents ....................................................................................................... vii List of Tables ............................................................................................................. xiii List of Figures............................................................................................................ xiv List of Non-Standard Abbreviations ....................................................................... xix Acknowledgements..................................................................................................... xx Dedication .................................................................................................................. xxi Chapter 1. Introduction............................................................................................... 1 1.1 Attaching and effacing Escherichia coli and the molecular ecology of enteric bacterial infection....................................................................................................................................... 1 1.1.1 The intestinal ecosystem................................................................................................. 1 1.1.2 Perturbations in the intestinal ecosystem: enteric infectious diseases........................... 2 1.1.3 Attaching and effacing bacteria...................................................................................... 4 1.1.4 The Citrobacter rodentium mouse model of A/E bacterial infection........................... 15 1.1.5 The intestinal luminal microenvironment: understanding the impact of intestinal luminal secretions on A/E pathogenesis................................................................................ 20 1.2 The intestinal epithelium................................................................................................... 21 1.2.1 Architecture of the intestinal wall and origins of the gut epithelium ........................... 21 1.2.2 Epithelial lineages ........................................................................................................ 24 1.2.3 Signaling pathways determining cell fate decisions: The Notch and Wnt pathways... 26  vii  1.2.4 The role of the intestinal epithelium in host defense.................................................... 30 1.2.5 Bacterial subversion of epithelial cell function ............................................................ 41 1.2.6 Summary of Section 1.2 ............................................................................................... 43 1.3 Goblet cells: their role in gastrointestinal health and infectious disease ..................... 45 1.3.1 Ultrastructure and morphology of goblet cells............................................................. 45 1.3.2 The MUC2 mucin and the mucus layer: structure, synthesis, and properties .............. 47 1.3.3 Functional biology of Muc2 and the mucus layer ........................................................ 59 1.3.4 Regulation of mucin production................................................................................... 62 1.3.5 The role of Muc2/mucus production in host defense in the intestine........................... 65 1.3.6 Trefoil factor 3 (TFF3) and its role in host protection ................................................. 69 1.3.7 Resistin-like molecule-{beta} (RELM) and its role in host defense.......................... 72 1.4 General hypothesis............................................................................................................ 77 1.5 Literature cited ................................................................................................................. 78  Chapter 2: Modulation of Intestinal Goblet Cell Function During Infection by an Attaching and Effacing Bacterial Pathogen ............................................................ 93 2.1 Introduction........................................................................................................................ 93 2.2 Results ................................................................................................................................. 97 2.2.1 Depletion of mucus-containing goblet cells correlates with peak bacterial colonization during C. rodentium infection ............................................................................................... 97 2.2.2 Goblet cell-specific gene expression is reduced during infection .............................. 101 2.2.3 C. rodentium directly interacts with goblet cells in vivo ............................................ 104 2.2.4 C. rodentium predominantly associates with crypts that do not exhibit goblet cell depletion .............................................................................................................................. 107 2.2.5 Rag1-deficient mice do not suffer goblet cell depletion during C. rodentium infection ............................................................................................................................................. 109  viii  2.2.6 Pro-inflammatory cytokine expression in C57BL/6 and Rag1 KO mice during C. rodentium infection ............................................................................................................. 111 2.2.7 Adoptive transfer of T & B lymphocytes rescues the goblet cell depletion phenotype in Rag1 KO mice ..................................................................................................................... 114 2.2.8 The goblet cell depletion phenotype is strongly associated with immune mediated expansion of the transit amplifying zone............................................................................. 115 2.3 Discussion ......................................................................................................................... 118 2.4 Experimental methodology ............................................................................................. 123 2.5 Literature cited ................................................................................................................ 131  Chapter 3. Muc2 Protects Against Lethal Infectious Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa......................... 136 3.1 Introduction...................................................................................................................... 136 3.2 Results ............................................................................................................................... 140 3.2.1 C. rodentium penetrates the mucus layer during infection......................................... 140 3.2.2 Muc2-deficient mice exhibit heightened susceptibility to C. rodentium infection .... 141 3.2.3 Muc2-/- mice exhibit worsened mucosal damage and microcolony formation on their mucosal surface ................................................................................................................... 144 3.2.4 Muc2 deficiency renders mice more susceptible to attenuated C. rodentium strains, although susceptibility is T3SS dependent.......................................................................... 148 3.2.5 Muc2 limits initial colonization of the mucosal epithelia, but ultimately controls the levels of luminal bacteria loosely associated with the tissue .............................................. 149 3.2.6 The increased luminal C. rodentium burdens in Muc2-/- mice are not due to intrinsic defects in antimicrobial activity at their mucosal surface ................................................... 154 3.2.7 Mucus secretion is increased in response to C. rodentium infection ......................... 156  ix  3.2.8 Muc2 secretion regulates commensal and pathogen numbers in the large bowel lumen ............................................................................................................................................. 161 3.2.9 Exaggerated barrier disruption and translocation of pathogenic and commensal bacteria in infected Muc2-/- mice ......................................................................................... 164 3.2.10 Evidence that Muc2-deficiency reduces host-mediated pathogen clearance when commensal-dependent host colonization resistance is compromised ................................. 168 3.3 Discussion ......................................................................................................................... 171 3.4 Experimental methodology ............................................................................................. 181 3.5 Literature cited ................................................................................................................ 193  Chapter 4. The Role of Goblet Cell Derived Resistin-Like Molecule-{beta} During C. rodentium Infection.............................................................................................. 200 4.1 Introduction...................................................................................................................... 200 4.2 Results ............................................................................................................................... 204 4.2.1 RELM is highly induced during C. rodentium infection ......................................... 204 4.2.2 RELM expression is sustained at high levels during the course of infection .......... 206 4.2.3 RELM deficiency results in increased morbidity and mortality during C. rodentium infection............................................................................................................................... 207 4.2.4 Worsened cecitis and colitis in the absence of RELM............................................. 208 4.2.5 Severity of disease in the absence of RELM is associated with higher cecal burdens and deeper penetration of colonic crypts............................................................................. 212 4.2.6 Evidence for altered goblet cell responses in Retnlb-/- mice....................................... 215 4.2.7 Disease severity in Retnlb-/- mice is partially dependent on EspF production by C. rodentium............................................................................................................................. 217 4.3 Discussion ......................................................................................................................... 220 4.4 Experimental methodology ............................................................................................. 228  x  4.5 Literature cited ................................................................................................................ 233  Chapter 5. Conclusions............................................................................................ 236 5.1 From homeostasis to host defense: establishing a central role for goblet cells in mucosal protection ................................................................................................................. 236 5.2 The big picture: revealing the dynamic responses of goblet cells during infection and their biological significance................................................................................................... 239 5.2.1 Goblet cells are dynamic responders throughout the course of infection .................. 239 5.2.2 Goblet cells and Muc2/mucus production during A/E infection................................ 242 5.2.3 Co-operation of goblet cell-specific mediators during infection................................ 243 5.2.4 Goblet cells and immunomodulation ......................................................................... 244 5.2.5 Role of specific A/E virulence factors in disease....................................................... 247 5.3 Strengths and limitations of the thesis research conclusions ....................................... 250 5.3.1 Strengths of the thesis research .................................................................................. 250 5.3.2 Limitations of conclusions derived from thesis research ........................................... 252 5.4 Strategies to understand the potential of goblet cells to impact infectious and inflammatory diseases of the intestinal tract....................................................................... 253 5.4.1 Unlocking the mystery of mucins: toward a better understanding and utilization of mucin glycobiology ............................................................................................................. 254 5.4.2 Further exploration of goblet cell-pathogen interactions ........................................... 260 5.4.3 Dendritic cells and mucus .......................................................................................... 265 5.4.4 The role of non-mucin related goblet cell mediators in host-microbe interactions.... 265 5.4.5 Novel functions of innate defense: Do PRRs mediate goblet cell responses? ........... 267 5.4.6 Defining the role for MUC2 in host-commensal homeostasis in physiological and pathophysiological settings. ................................................................................................ 269 5.4.7 Goblet cells and inflammatory bowel disease ............................................................ 273  xi  5.5 Potential applications of thesis research findings ......................................................... 275 5.5.1 Non-invasive therapeutic and disease prevention strategies. ..................................... 275 5.6 Future directions.............................................................................................................. 280 5.6.1 Immediate goals ......................................................................................................... 280 5.6.2 Long term goals.......................................................................................................... 281 5.7 Final remarks ................................................................................................................... 282 5.7 Literature cited ................................................................................................................ 284 Appendix 1. Addendum to Chapter 2 .................................................................................... 294 Appendix 2. Addendum to Chapter 3 .................................................................................... 297 Appendix 3. Addendum to Chapter 4 .................................................................................... 300 Appendix 4. Publications Arising from Graduate Work........................................................ 302  xii  List of Tables Table 2.1 Goblet cell enumeration in the distal colon of C57BL/6 mice following C. rodentium infection ............................................................................................ 101 Table 2.2 Primer sets and PCR conditions used in chapter 2......................................... 126 Table 3.1 Primer sets and PCR conditions used in chapter 3......................................... 186  xiii  List of Figures CHAPTER 1 Figure 1.1 Factors involved in the evolution of pathogenic E. coli ................................... 3 Figure 1.2 A/E lesions........................................................................................................ 5 Figure 1.3 A/E lesion formation by EPEC......................................................................... 8 Figure 1.4 Colonoscopy of a patient infected with EHEC 0157:H7................................ 12 Figure 1.5 Structure and function of shiga toxin. ............................................................ 14 Figure 1.6 The C. rodentium model of enteric bacterial infection................................... 17 Figure 1.7 The colonic mucosa ........................................................................................ 23 Figure 1.8 Representative epithelial cell types of the intestinal tract .............................. 26 Figure 1.9 The role of Wnt and Notch signaling in epithelial fate decisions. ................. 29 Figure 1.10 Simplified model of signaling by TLRs/NLRs in intestinal epithelial cells. 32 Figure 1.11 The apical junctional complex...................................................................... 34 Figure 1.12 Epithelial passive defense............................................................................. 37 Figure 1.13 Manipulation of host cell pathways by EPEC and EHEC............................ 44 Figure 1.14 Intestinal goblet cells .................................................................................... 46 Figure 1.15 Muc2 structure and synthesis. ...................................................................... 49 Figure 1.16 Muc2 glycosylation. ..................................................................................... 52 Figure 1.17 Proposed mechanism for expansion of polymeric mucin............................. 54 Figure 1.18 Structure, function, and thickness of the mucus layer................................. 57 Figure 1.19 Dynamic equilibrium of the Muc2-rich mucus layer. .................................. 63 Figure 1.20 Structure and function of TFF3. ................................................................... 71 Figure 1.21 Structure of RELM..................................................................................... 73 xiv  CHAPTER 2 Figure 2.1 C. rodentium infection peaks at 10 DPI. ....................................................... 97 Figure 2.2 Depletion of mucus-containing goblet cells is observed in the distal colon and is pronounced when C. rodentium numbers peak..................................................... 99 Figure 2.3 C. rodentium infection results in reduction of Muc2 and Tff3 gene expression ................................................................................................................................. 103 Figure 2.4 C. rodentium directly infects colonic goblet cells in vivo. .......................... 105 Figure 2.5 C. rodentium associates with crypts that are strongly positive for Muc2 at 10 DPI. ......................................................................................................................... 108 Figure 2.6 C. rodentium infection does not result in goblet cell depletion in Rag1 KO mice......................................................................................................................... 110 Figure 2.7 Muc2 and Tff3 remain abundantly expressed in Rag1 KO mice following C. rodentium infection................................................................................................. 112 Figure 2.8 Cytokine gene expression during C. rodentium infection. ........................... 114 Figure 2.9 Adaptive transfer of T and B cells into Rag1 KO mice restores the goblet cell depletion phenotype during C. rodentium infection. .............................................. 117 CHAPTER 3 Figure 3.1 Citrobacter rodentium penetrates the colonic mucus layer in vivo. ............. 141 Figure 3.2 Muc2-/- mice exhibit dramatic susceptibility to C. rodentium-induced morbidity and mortality. ......................................................................................... 143 Figure 3.3 Heightened mucosal damage in Muc2-/- mice is associated with increased pathogen burdens and mucosa-associated bacterial overgrowths........................... 147  xv  Figure 3.4 Muc2 deficiency renders mice more susceptible to attenuated C. rodentium strains, but susceptibility is T3SS dependent.......................................................... 150 Figure 3.5 Muc2 limits initial pathogen colonization of the mucosal epithelia, but ultimately controls levels of luminal pathogen burdens. ........................................ 154 Figure 3.6 Evidence that Muc2-/- mice do not have intrinsic defects in anti- microbial activity at their mucosal surface. ............................................................................ 156 Figure 3.7 C. rodentium infection results in increased mucin secretion during infection. ................................................................................................................................. 159 Figure 3.8 Increased luminal load of both pathogenic and non-pathogenic bacteria in Muc2-/- mice during infection. ................................................................................ 162 Figure 3.9 Susceptibility of Muc2-/- mice to C. rodentium is associated with severe defects in intestinal barrier function and increased translocation of commensal and pathogenic bacteria. ................................................................................................ 166 Figure 3.10 Antibiotic induced commensal depletion enhances pathogen colonization but does not alter host pathology in Muc2-/- mice......................................................... 170 Figure 3.11 Proposed model of the role of Muc2 in the disassociation of A/E pathogenic and commensal bacteria from the large intestinal mucosa. .................................... 178 CHAPTER 4 Figure 4.1 RELM is highly induced during natural infection...................................... 205 Figure 4.2 Dynamics of RELM expression during C. rodentium infection. ............... 207 Figure 4.3 Retnlb-/- mice demonstrate greater morbidity and have higher mortality rates following C. rodentium infection............................................................................ 208  xvi  Figure 4.4 Retnlb-/- mice present with exaggerated inflammatory disease in the large intestine during infection. ....................................................................................... 211 Figure 4.5 Disease severity of Retnlb-/- mice is associated with higher cecal burdens and invasion of colonic crypts by C. rodentium. ........................................................... 214 Figure 4.6 Retnlb-/- mice display evidence of altered goblet cell responses during infection. ................................................................................................................. 216 Figure 4.7 Severity of C. rodentium-induced disease in Retnlb-/- mice is partially dependent on the virulence factor EspF.................................................................. 220 Figure 4.8 Model of potential role of RELM in protection against enteric bacterial infection. ................................................................................................................. 221 CHAPTER 5 Figure 5.1 Model figure summarizing dynamic goblet cell responses during enteric infection. ................................................................................................................. 241 Figure 5.2 Evidence for altered MUC2 glycosylation patterns during C. rodentium infection. ................................................................................................................. 259 Figure 5.3 Expression of RELM in C57BL/6 vs Myd88-/- mice.................................. 269 APPENDICES Figure A1.1 Adaptive immunity mediates goblet cell depletion phenotype by stimulating a robust proliferative response in colonic crypts. ................................................... 294 Figure A1.2 Hypothetical model of the temporal events underlying the goblet cell depletion phenotype during C. rodentium infection. .............................................. 295 Figure A2.1 Characterization of the inflammatory cell infiltrate within the colons of C. rodentium-infected WT and Muc2-/- mice............................................................... 297 xvii  Figure A2.2 Analysis of Muc family gene expression and overall mucin content in colorectal tissues of uninfected or C. rodentium-infected WT and Muc2-/- mice... 298 Figure A3.1 RELM expression in Muc2-/- mice before and after infection................ 300 Figure A3.2 Confirmation of the genotype of Retnlb-/- mice......................................... 301   xviii  List of Non-Standard Abbreviations A/E Agr2 BFP DBZ DPI EAF EPEC aEPEC EHEC Gb3 EspF HUS Fcgbp IFN IL iNOS KC LEE LPS MAMP mCRAMP mCLCA3 MUC/Muc MyD88 NICD NEMO NF-B NLR PAI RAG1 RDEC-1 RegIII RELM RBP-J STEC Stx TA T3SS TFF Th Tir TLR TNF  Attaching and Effacing Anterior gradient homolog 2 bundle-forming Pilus Dibenzazipene Days post-infection EPEC Adherence Factor Enteropathogenic Escherichia coli Atypical EPEC Enterohemmorhagic Escherichia coli Globotriaosylceramide (Gaba3) receptor E. coli secreted protein F Hemolytic Uremic Syndrome IgG Fc binding protein Interferon{gamma} Interleukin Inducible nitric oxide synthase Keratinocyte-derived chemokine Locus of enterocyte effacement Lipopolysaccharide Microbe-associated molecular pattern murine cathelicidin related antimicrobial peptide murine chloride activated calcium channel-3 Mucin Myeloid differentiation primary response gene (88) Notch intracellular domain NF-B essential modulator Nuclear factor {kappa}-B NOD-like Receptor Pathogenicity Island Recombination activating gene-1 Rabbit Diarrheagenic E. coli-1 Regenerating islet-derived III{gamma} Resistin-Like Molecule Recombining binding protein suppressor of hairless Shiga-toxin Producing E. coli Shiga-toxin Transit amplifying Type III secretion system Trefoil factor Helper T-cell Translocated intimin receptor Toll-like receptor Tumor necrosis factor{alpha} xix  Acknowledgements It is difficult to convey in words my depth of gratitude to my supervisor, Bruce Vallance for his tremendous support and exemplary mentorship over my PhD tenure. I could not have chosen a better lab with which to embark on this memorable and fulfilling journey. To also the Vallance lab members, both past and present: you have each contributed in unique and invaluable ways to my growth and maturation as a scientist and as a person. I will never forget you and I hope I have been an inspiration to you as you have been to me. Many thanks to my graduate supervisory committee, who have provided many helpful constructive criticisms and encouraging words throughout my studies.  I am  grateful to the labs that I have had the marvelous opportunity to visit, including those of Dr. Kris Chadee in Calgary, and Dr. David Artis in Philadelphia: my brief time working with each of you has left a lasting impression on me. My appreciation expressed thus far is utterly meaningless until I acknowledge my wonderful parents, whose support in every way has played a decisive role in the success of my PhD studies thus far, even on this very day I submit my dissertation. Thank you also to my brother Matthew and sister-in law Lisa who were always there to share in my joys and distresses, both of which were many in these latter incredible years.  And lastly to Katelin, who has so unexpectedly  come into my life in this final stretch; with you, my graduate journey is coming to a beautiful end; and with you, I hope to start an even more beautiful beginning.  xx  Dedication  To Christ: You are always on my mind; and to the patient scientists: I have much to learn from you as soon as possible.  xxi  Chapter 1. Introduction 1.1 ATTACHING AND EFFACING ESCHERICHIA COLI AND THE MOLECULAR ECOLOGY OF ENTERIC BACTERIAL INFECTION 1.1.1 The intestinal ecosystem It has been said we live in a microbial world [1]; indeed, prokaryotes have been the seeds of virtually all life as we know it. However it can also be said that a microbial world lives within us, in our genome in the form of non-retroviral RNA encoding genes [2] and as a relic in the form of cellular mitochondria [3]. In a more active sense, no more is this true than in our intestine, which harbors over 10 trillion microorganisms at any given time in a healthy individual [4]. While this vast microbial community contains viruses and members of all the domains of life, including archaea, and eurkaryota such as fungi, protists, and metazoans, it is primarily composed of the domain of bacteria [5]. Original estimates have enumerated the number of bacterial species to be approximately threehundred, however, the development of sophisticated culture-independent analysis tools such as deep sequencing of the 16S rRNA gene, estimates over one-thousand bacterial species [4].  Indeed, the density and richness of this microbiota has permitted the  intestinal tract to be called one of the most complex ecosystems in all of biology [6]. Despite its foreign status and immunogenic potential, the body as a whole not only tolerates the resident microbiota, but derives many benefits from its presence, including processes we have not had to evolve on our own [4]. These include greater efficency of energy extraction from our diets due to its rich repertoir of sacchrolyases that can digest otherwise undigestable nutrients, thereby freeing up short-chain fatty acids to be used as energy sources [5];  the proper development of the mucosal and systemic immune 1  system; host defense against opportunisitic pathogens through elaboration of antimicrobials and direct competition with the pathogens; and vitamin production [7]. In turn our microbes receive a stable enviroment and steady nutrient supply to create a powerful mutalistic relationship, to the extent that the intestinal microbiota have been declared a virtual organ [7].  Therefore, the status of the microbiota is potentially an  important variable to consider in the context of diseases of the intestinal tract. The composition at the Phylum level is dominated by members of the Bacteroidetes and Firmicutes, and to a lesser extent Proteobacter, but at the genus and species levels the diversity is much greater [8]. Among the most representative anaerobic species are Bacteroides thetaiotamicron, and B. fragilis [8], and the most common commensal facultative anaerobe is Escherichia coli [9]. 1.1.2 Perturbations in the intestinal ecosystem: enteric infectious diseases Although the consensus among microbiologists, immunologists, and gastroenterologists is that most members of the resident microbiota do not invade host tissues [10], situations arise where bacteria that have aquired genes from bacteriophages, horizontal transmission, and/or transposon insertion are enabled to adopt new spatial niches that are not already occupied by the resident microbiota [5,9,11] (Figure 1.1). These niches include the host tissues, within and outside of cells of the surface epithelium and/or the underlying tissues. Because the host is not adapted to having microbes inhabit these niches, and/or cannot neutralize their toxic gene products, this results in cell death, robust immune responses, tissue damage, and ultimately a pathological state. As a result, these microbes are called pathogens.  As our understanding of the role of the intestinal  microbiota increases, it is becoming more appreciated how such pathologies cause severe 2  disruptions in the intestinal ecosystem as a whole, due to the drastic shift from a quiescent to a hostile luminal microenvironment that resident microbiota are not adapted to [12]. The biological consequences of such perturbations are only now beginning to be explored. While many enteric pathogens are known, one large group of such pathogens is related to the resident microbial member, E. coli, and they include diarrheagenic strains of E. coli which as a whole continue to cause significant morbidity and mortality worldwide. Two important members of this group are Enteropathogenic E. coli (EPEC), and Enterohemorrhagic E. coli (EHEC), which belong to a specific class of lumendwelling epithelial adherent pathogens called attaching and effacing (A/E) bacteria [13].  Figure 1.1 Factors involved in the evolution of pathogenic E. coli. Acquisition of mobile genetic elements that contribute to the evolution of pathogenic organisms, in this case pathogenic E. coli. EIEC = Enteroinvasive E. coli; EPEC = Enterpathogenic E. coli, EHEC = Enterohemmorhagic E. coli, DAEC = Diffusely  3  Adherent E. coli; EAEC = Enteroaggregative E. coli; UPEC = Uropathogenic E. coli; MNEC = Meningitis/sepsis-associated E. coli. Image modified from ref. [9].  1.1.3 Attaching and effacing bacteria A/E bacteria and their representation in nature A/E bacteria are widespread in the animal kingdom, found in cattle, cats, dogs, horses, birds, sheep, and lambs with varying degrees of pathogenicity [14,15]. A/E bacteria are defined by their ability to form unique histopathological structures called attaching and effacing (A/E) lesions [13]. A/E lesions are characterized by intimate association of the pathogen to the apical plasma membrane of small intestinal or colonic epithelial cells, and localized destruction (i.e. flattening/effacement) of the cellular microvilli [14] (Figure 1.2). In addition to EPEC and EHEC, the other known A/E pathogen of humans is the diarrheagenic Hafnia alvei [13]. In animal species, there are only a few well characterized A/E pathogenic bacteria and these include Rabbit Diarrheagenic E. coli (RDEC-1), and C. rodentium [14]. Though distantly related, A/E pathogens are equipped with similar virulence factors that endow them with the ability to form the A/E lesion. The unique feature of the A/E lifestyle is that it confers a non-invasive lumen-dwelling existence to the pathogen while being directly attached to tissues. As such they are located away from direct contact of cells of the immune system. The degree of virulence of different A/E pathogens is also modified by their specific genome and plasmidencoded virulence factors. EPEC and EHEC are by far the most prevalent and studied A/E pathogens and will be the focus of the following discussion.  4  Figure 1.2 A/E lesions. Scanning electron micrograph (SEM) of A/E lesions caused by EPEC infection of human small intestinal explants. Bacteria can be seen “nested” within the cellular microvilli, through localized destruction or effacement of the microvilli underneath and surrounding the bacterium, and intimate attachment to the cell surface. Image reproduced from ref. [16].  Enteropathogenic E. coli, EPEC Typical vs atypical EPEC. EPEC can be divided into two groups: typical EPEC (tEPEC) and atypical EPEC (aEPEC) [17]. This distinction is based on the presence of the EPEC adherence factor (EAF) plasmid that contains a cluster of genes encoding for the Bundle Forming Pilus (BFP), a type IV adhesin that is found in tEPEC, but is absent in aEPEC [18,19]. This adhesin has been shown to be important for the initial virulence stages of tEPEC infection [13] as described below. For clarity, the discussion will focus on tEPEC-mediated diarhhea, since most work has been done on strains that belong to this  5  group, and since aEPEC cause diarrheal disease in people through similar mechanisms [20]. Thus, tEPEC will hereafter be called EPEC.  EPEC targets the proximal small intestine and the infection mainly leads to acute diarrhea [13]. However, chronic diarrheal disease can occur, frequently accompanied by fever and vomiting [13].  Although adults can be infected, EPEC is primarily considered a  pathogen of infants and children under two years of age [13].  The infectious dose  necessary to cause infection in adults is 108 colony forming units (CFU), but this is thought to be less for infants [13]. The main reservoir for typical EPEC is people, either other infected children, or adult carriers such as mothers and day-care workers who do not show symptoms [13]. (However, aEPEC can be found in human and animal species [18].) EPEC transmission is primarily through the fecal-oral route, via contaminated hands, infant nutritional products, or any object harboring the bacteria that the infant or potential carrier will come into contact with [13]. Epidemiological studies reveal that, although EPEC-induced infant diarrheal disease was once a significant cause of infant mortality in developed countries in the 1940s and 50s, it is now a greater problem in developing nations compared to developed countries [13]. In fact, between 30-40% of cases of infant diarrhea are attributed to EPEC in regions such as Brazil and South Africa [21], and up to a 30% mortality rate from these infections were observed in some developing countries [22]. (That said, recent reports have also shown that aEPEC is an emerging problem in developed countries [18].) The mechanism of diarrhea by either EPEC group is not fully elucidated, but appears to involve accelerated chloride secretion by intestinal epithelial cells, destruction of the villus microvilli (discussed below), altered  6  barrier function, and the influence of inflammatory mediators. In most cases, where possible, the infection is treated by oral hydration therapy to recover fluids and restore electrolyte balance [13].  Pathogenesis of EPEC. EPEC infection of intestinal epithelial cells is postulated to follow three major steps [9]. The first step is initial “non-intimate” attachment to the epithelial surface (Figure 1.3A). For typical EPEC, as mentioned above, this is largely carried out by the bundle forming pilus (BFP), that is encoded within the EAF plasmid [9]. The BFP acts as an adhesin that anchors EPEC to the cellular microvilli and promotes microcolony formation [13]. Although aEPEC does not produce this BFP, it is thought to attach to epithelial cells through an as-yet undescribed adhesin [20].  7  Figure 1.3 A/E lesion formation by EPEC. A. Initial non-intimate attachment and microcolony formation mediated by the EAF plasmid encoded bundle forming pilus (BFP). Image modified from ref. [23]. B. Model of the Type III secretion system (T3SS) used by EPEC to deliver chromosomeencoded effector proteins into the host cell cytoplasm. C. Sequence of events involved in EPEC infection of cells. (i) non-intimate attachment and expression of T3SS (BFP not shown). (ii) Alterations in cell function and signaling dynamics due to T3SS mediated-delivery of effector molecules necessary for cytoskeletal rearrangement; (iii) Intimate attachment via Tir/intimin interactions. Actin polymers form large bundles directly beneath the bacteria. Image modified from ref. [14]. 8  D. Confocal immunofluorescence image of actin-rich pedestals induced by EPEC, detailing the dramatic remodeling of the actin cytoskeleton (F-actin, red) directly beneath the bacterium (blue). Tir/intimin interactions (yellow) are shown on the tip of the pedestal. Image reproduced from ref. [24]. E. SEM of showing 3-dimensional structure of a pedestal characteristic of A/E lesions.  The second step involves EPEC-mediated alteration of signal transduction pathways within the infected cells. This is conferred by the presence of a 35kb pathogenicity island (PAI) in the EPEC chromosome called the locus of enterocyte effacement (LEE). Within the LEE lie several key virulence genes that encode for a type III secretion system (T3SS) and variety of other secreted proteins. When the T3SS is expressed, its function is analogous to a molecular syringe that penetrates the host plasma membrane, serving as a one-way conduit from the bacteria to the host cell cytoplasm (Figure 1.3B and C). Here the A/E pathogen delivers numerous effector proteins encoded within and outside the LEE PAI directly into the host cell [25]. Among the most important is the translocated intimin receptor (Tir), which inserts itself directly into the plasma membrane in a transmembrane fashion complete with intracellular and extracellular domains [26]. The intracellular domain becomes phosphorylated, inducing a variety of signaling events and cytoskeletal alterations, resulting in actin rearrangement and consequently collapse of the microvilli [9,26]. The actin re-polymerizes directly under the bacterium to form a pedestal like structure that can rise 10μm above the surface (Figure 1.3D). This leads to the third stage, intimate binding (Figure 3C, right panel). This is mediated by the extracellular domain of Tir, which binds to an outer membrane protein present on the surface of EPEC, called intimin, leading to intimate adherence of EPEC to the outer plasma membrane (Figure 1.3C, right panel) [9,26]. Thus EPEC exploits the landscape of the plasma membrane by inserting its own receptor needed for intimate association 9  (Figure 1.3D and E). Ultimately, it is still unclear how the A/E lesion itself specifically contributes to diarrheal disease. In EPEC infections, it is the loss of the microvillar surface area caused by formation of the A/E lesion that is thought to be a major contributor to the prolonged diarrhea due to the resultant decrease in luminal absorption [13]. The ability to form these lesions is important for disease, since intimin mutants (eae) are attenuated in virulence [13]. Enterohemmorhagic E. coli (EHEC) Shiga toxin-producing E. coli, EHEC and the epidemiology of EHEC infection. EHEC is one of many pathogenic strains grouped as Shiga Toxin producing E. coli (STEC) [9]. STEC strains are characterized by the their ability to produce Shiga-like toxins (Stxs), which are similar to that of another important human enteric pathogen Shigella flexneri. While there are several STEC strains that are associated with human disease, the major human pathogen of the STEC group is serotype O157:H7 (hereafter called EHEC), and is distinguished from other STEC by the presence of a LEE PAI [13]. In contrast to typical EPEC, EHEC is of limited importance in developing nations, but continues to be a significant cause of morbidity and mortality in developed countries [9]. EHEC has received much attention in Canada after the outbreak in Walkerton, Ontario in 2000, where contaminated water supplies lead to the infection of almost 50% of the population (2300 of 5000 residents), 7 deaths [27], and complications for those infected that have lasted for years after the initial outbreak [28,29].  However such outbreaks, though  posing a serious threat to communities, are rare, and sporadic infections are the main problem caused by these pathogens [13]. Unlike EPEC, the main reservoir of EHEC is cattle rather than people [11], although several animals can serve as carriers of other 10  potentially pathogenic STEC strains [13]. Transmission of EHEC occurs through direct inter-individual contact and through the ingestion of contaminated food products that have come into contact with ruminant fecal waste [13].  Although undercooked  contaminated beef is the major vehicle, vegetables (e.g. lettuce, radishes), juices, and water supplies that have come into contact with contaminated manure can also serve as vehicles, as tragically demonstrated in the Walkerton outbreak [27]. The infectious dose of EHEC is remarkably low, as approximately 100 EHEC microorganisms can cause a fulminate infection [13].  EHEC and hemolytic uremic syndrome. In contrast to EPEC, EHEC infects mainly the large bowel and can cause a very bloody diarrhea [13]. There is a spectrum of disease severity, with some individuals exhibiting no symptoms or mild non-bloody diarrhea, while others reach a stage where the stool contents have been clinically described as “as all blood, and no stool” (Figure 1.4) [30]. While EPEC infects mainly infants, sporadic EHEC infections and disease can occur in individuals of all ages [13].  However,  individuals, particularly young children, and the elderly, who suffer from bloody diarrhea are at risk for another major complication of EHEC infection, called Hemolytic Uremic Syndrome (HUS). HUS is defined as a triad of acute renal failure, thrombocytopenia (decreased platelet count), and microangiopathic hemolytic anemia (loss of localized blood supply due to damaged small blood vessels) [13]. Children under ten years and the elderly are at highest risk of developing HUS, and it is the most common cause of acute kidney failure in children [31]. Approximately 15% of children under ten years of age who develop EHEC-induced hemorrhagic colitis will develop HUS. Of these, up to 5%  11  of these children will succumb to this disease [13], and approximately 30% will have prolonged impairment of renal function and other sequelae after the infection is cleared [32].  Figure 1.4 Colonoscopy of a patient infected with EHEC 0157:H7. The left panel reveals mild colitis in the descending colon, however, there is massive hemorrhagic colitis in the ascending colon of the same patient (right panel), characterized by marked edema and severe bloody lesions in the mucosa. Image modified from ref. [33].  EHEC pathogenesis: A/E lesion formation and shiga-toxin production. Like EPEC, EHEC has a LEE pathogenicity island within its genome, encoding virulence genes that enable it to form A/E lesions on colonic epithelial cells.  The mechanism is less  characterized compared to EPEC, and involves some differences in molecular pathogenesis, but essentially follows similar steps as EPEC. For example, EHEC contains a Type IV pilus that can contribute to cell attachment, although this is distinct from the BFP of EPEC [34].  Moreover, EHEC utilizes T3SS-mediated delivery of several  virulence factors such as Tir, signal transduction, cytoskeletal re-arrangement, and intimate attachment [35]. However, Tir phosphorylation in EHEC-mediated A/E lesion formation does not occur [36]. In addition, EHEC intimin utilizes both Tir as well as the 12  host cell protein nucleolin as receptors to mediate intimate attachment [37]. It is notable the A/E lesions have not yet been observed in human biopsies of patients with EHECinduced hemorrhagic colitis (but have been observed in vivo in animals and in cell culture), but this is thought to be due to the fact that the disease is caught at a later stage following intimate attachment and the elaboration of specific cytotoxins produced by EHEC, primarily Shiga Toxin [13] (discussed below).  The striking difference in disease and organ involvement between EPEC and EHEC is largely due to the presence of the highly cytotoxic Shiga toxin (Stx) in EHEC. One of the most potent cytotoxins known [38], Stx consists of a 32 kDa enzymatically active A subunit bound to a pentamer of 7.5 kDa B subunits [39] (Figure 1.5A and B). EHEC 0157:H7 contains 2 Stx genes in its chromosome: Stx1 and Stx2, the latter being the most important for human infections [13].  Stx binds to the globotriaosylceramide (Gb3)  receptor present on endothelial cells, as well as mesangial and tubular epithelial cells [32].  This leads to endocytosis and transport of the Gb3:Stx2 complex to the Golgi  apparatus and then the endoplasmic reticulum (Figure 1.5C). The Stx A subunit is cleaved by furin (a calcium-dependent serum endoprotease expressed in the Golgi apparatus) to produce the A1 and A2 subunits (Figure 1.5B), and the StxA1 subunit ultimately ends up in the cytoplasm where it functions as an N-glycosidase that removes a specific adenosine residue from the 28S rRNA within ribosomes, leading to the cessation of protein synthesis and death of the cell expressing the Gb3 receptor [9] (Figure 1.5C). Bloody diarrhea is thought to result from Stx-mediated toxicity to Gb3expressing endothelial cells of the intestinal vascular system, and possibly to intestinal  13  epithelial cells themselves [13]. Stx elaborated by EHEC enters the blood stream through unclear mechanisms. In the circulation, Stx can bind to leukocytes such as PMNs, which are thought to carry the toxin throughout the body [32,38]. In the kidney, this has important consequences since the Gb3 receptor is highly expressed within the glomerular endothelium, resulting in the death of glomerular endothelial cells upon Stx binding. This causes extensive endothelial damage and the formation of a blot clot (thrombus) in the endothelial lumen due to extensive platelet and fibrin deposition, leading to thrombosis.  This in turn causes narrowing and occlusion of the glomerular capillaries,  thus severely reducing the glomerular filtration rate, and causing ischemia, tissue death and ultimately the kidney failure characteristic of the HUS sequelae [32].  Figure 1.5 Structure and function of shiga toxin. A. Schematic representation of Shiga Toxin produced by STEC strains including EHEC 0157:H7. The Toxin is composed of an A subunit attached to a pentamer of B subunits. B. 3-dimensional ribbon structure of the Shiga Toxin. The A fragment is cleaved at the furin cleavage site (top right), giving rise to the A1 and A2 fragments. The A1 fragment  14  acts as an N-glycosidase that cleaves the adenosine residue in the ribosomal RNA, inhibiting protein synthesis. Images from “A.” and “B.” are modified from ref. [39]. C. Model mechanism of Stx entry into host cell through Gb3-receptor mediated endocytosis and ultimately into the cytoplasm where it mediates its toxic activity. Image modified from ref. [40].  1.1.4 The Citrobacter rodentium mouse model of A/E bacterial infection Animal models of A/E bacterial infection Because EPEC and EHEC do not infect mice with great efficacy [41], most of our understanding of their pathogenisis has been derived from cell culture techniques using transformed human intestinal epithelial cell lines. These have undoubtedly aided in our understanding of the pathogenesis of infections by this unique class of pathogen as described above. However, due to the intrinsicially artificial and overly simplistic nature of these in-vitro systems, they can give only limited insight into an equally important aspect of this infection, namely the specific host responses that are required to clear these pathogens. Researchers have recognized this problem for over two decades and have attempted to circumvent it by turning to several in vivo systems, using EPEC/EHEC strains that can either infect other animals, or A/E bacterial pathogens related to EPEC/EHEC that are specific to animals [14]. These include Rabbit Diarheagenic E. coli. (RDEC-1) [42] and EPEC-infection of gnotobiotic piglets [14]. Such models have indeed been useful for describing the details of an in vivo infection and the importance of specific virulence factors [14]. However, the widespread use of these models are plagued by key disadvantages; namely the lack of genetic and biological tools (such as knockout or transgenic animals, antibodies, or other species-specific reagents), as well as the logistical and monetary barriers associated with establishing these large animal models in  15  an animal facility. Thus, these drawbacks have limited the degree to which we can dissect host responses in vivo with these models. For these reasons, the most widely used in vivo system for A/E bacteria is the Citrobacter rodetnium model [43]. C. rodentium is a natural A/E pathogen of mice, formally called C. freundii biotype 480 [14] and mouse pathogenic E. coli (MPEC) [44] by two independent groups that isolated the pathogen from separate severe outbreaks of diarrhea in mouse colonies [45]. C. rodentium has acquired a significant degree of genetic relatedness to EPEC and EHEC through convergent evolution [46]; this includes the presence of a LEE pathogenicty island which encodes virulence factors necessary to assemble the T3SS, as well as genes encoding numerous secreted effector proteins involved in other common aspects of A/E pathogensis [47,48]. As a result, C. rodentium causes A/E lesions in mice that are virtually indistinguishable from those caused by EPEC and EHEC in humans (Figure 1.6A).  16  Figure 1.6 The C. rodentium model of enteric bacterial infection. A. Transmission electron micrograph showing C. rodentium infecting the surface of murine colonocytes forming the characteristic A/E lesion. Image reproduced from ref. [49]. B. C. rodentium-induced disease. H&E staining showing colitis and hyperplasia of colonic crypts at 10 days following C. rodentium infection. This phenotype is termed transmissible murine colonic hyperplasia [44]. Original magnification, 200X. C. Dynamics of C. rodentium infection. C. rodentium infection lasts approximately 3-4 weeks and activates innate and adaptive immune responses.  C. rodentium infection dynamics The C. rodentium model is well characterized in the literature [43]. In C57BL/6 mice, orally gavaged C. rodentium transiently infects the follicle associated epithelium overlying the cecal patch within hours of oral infection [50] and then infects cecal 17  epithelial cells over the first 2-3 days. Although not yet entirely characterized, the infection progresses into the the large intestine, bypassing the proximal (ascending) colon and primarily colonizing the mouse descending colon and rectum (also called distal colon) for the remainder of the infection [50]. The peak of infection depends on several factors including genetic backgound [45], and the status of the resident intestinal microbiota, but in our hands the infection peaks at 8-10 days post-infection (p.i.), well within the range described by others [50]. In the colon, C. rodentium infects the surface of the mouse colonic epithelial cells, and rarely invades the mouse tissue [44]. In the first week of infection, C. rodentium essentially covers the surface of the mouse colon forming a pathogenic biofilm, and induces host innate immune responses [51,52]. After six to eight days, the adaptive immune response then becomes activated and CD4+ Th1 and Th17 cells and IgG production play the primary role in clearing the pathogen [53,54,55].  During this time, dramatic hyperplasia of epithelium, characterized by  tripling of the height of colonic crypts also takes place [44] (Figure 1.6B). By 14 days p.i., the infection begins to clear although the pathology is most dramatic in terms of mucosal thickening, and by day 21 p.i. bacterial burdens are barely detected. Typically the disease is resolved completely by day 28 p.i. and the mice are refractory to reinfection [45] (Figure 1.6C). The power of the C. rodentium model The C. rodentium model is a powerful tool to study host-pathogen interactions in vivo, allowing manipulation of both host (genetics), pathogen (virulence genes), and environment (diet, commensal bacteria, physiological stress), to determine how each contribute and interact to influence the initiation and/or resolution of enteric infectious 18  disease [56]. The model in recent years has given tremendous insight into the development and function of mucosal immune responses, including that of a recently described novel CD4+ helper T lymphocyte lineage, the Th17 cell [57]. The model has also expanded our knowledge of how infection-induced inflamamation can impact the intestinal ecosystem by altering resident commensal microbiota populations [58] and, conversely, how specific members of the microbiota can alter the course of infection [59]. Furthermore, studies with C. rodentium have identified the importance of genetic background in controlling the infection. For example, C3H/HeJ and C3HOu/J mice are exquisitely sensitive (i.e high mortality rate) to C. rodentium [60], whereas C57BL/6 mice are relatively resistant to infection (i.e. show low mortality rates), thus allowing for the identification of novel host susceptibililty genes. Additionally, the combination of conditional genetic knockouts with the model allows for the functional analysis of key genes implicated in the infection in a cell-type specific manner. The major drawback of this model is that it relies on a mouse pathogen rather than a human pathogen, so it is a step removed from direct clinical signifance. However this may also be an additional advantage: since the model is one of co-evolution, the net functional result of the evolution of the immune system and bacterial virulence in each others presence gives a more accurate assement of how enteric diesease develops in a context of “mutual familarity”, as would occur in natural EPEC & EHEC infections in humans, and thus bypassess potential artifacts resulting from using human pathogens in a non-adapted system. An additonal advantage is, unlike other infection models, there is no need to pretreat mice with antibiotics to induce infection, thus eliminating the variables  19  (commensal dysbiosis, immunological consequences) associated with the pretreatment [61]. 1.1.5 The intestinal luminal microenvironment: understanding the impact of intestinal luminal secretions on A/E pathogenesis The combination of in vitro and in vivo models of EPEC/EHEC and C. rodentium infection respectively have uncovered essential processes and provided key insights regarding mechanisms of infection, and host immune responses needed to control the pathogen [62]. However, one aspect of infection that has been largely overlooked is the complex luminal microenvironment, rich in products derived from the host, resident microbiota, and dietary content, that these pathogens must navigate through before they can reach the epithelium. While the majority of studies have not considered how this luminal microenvironment may impact the course of A/E infection, recent studies are now implicating the state of this microenvironment in the pathogenesis of enteric bacterial infections, including A/E bacteria. For example, the oxygen content of the intestinal lumen may modulate virulence of EHEC, which can sense minute oxygen levels directly adjacent to the epithelial surface thereby promoting expression and function of the T3SS and secreted effectors, priming EHEC for infection [63]. Similar effects on T3SS and virulence were observed for Shigella flexneri [64], while changes in pH levels affect S. Tyhimurium T3SS function [65].  Other significant modifiers of the luminal microenvironment include several types of molecules elaborated by the mucosa, including host defense peptides that have potent bacterial killing abilities [66,67], and large glycoprotein networks that give rise to  20  luminal mucus [68].  Not only must A/E pathogens encounter these molecules and  overcome them in order to access the underlying epithelium, but their lumen-dwelling nature places them in constant contact with these molecules during the course of infection. This contact may have major implications for how the host specifically manages these pathogens, since these bacteria do not extensively contact the underlying cells of the innate and adaptive immune systems. Despite this fact, surprisingly little is known of how these pathogens interact with and are impacted by these host-derived secretions, and what the consequences of these interactions are in the course of infectious disease. These mucosa-derived products are produced mainly by specialized secretory cells of the epithelium. Research over the last decade has provided evidence that these specialized secretory cells are critical in providing effective host defense against several types of prokaryotic and eukaryotic pathogens [66,69,70]. To this end, the following section will introduce the origin of epithelial cells and their specific lineages, and summarize the key findings that implicate epithelial cells, namely secretory cells, in host defense against lumen-dwelling pathogens such as A/E bacteria. 1.2 THE INTESTINAL EPITHELIUM 1.2.1 Architecture of the intestinal wall and origins of the gut epithelium The intestinal epithelium is made up of a single sheet of intimately linked highly specialized epithelial cells that line the lumen of the intestinal tract [71]. Intestinal epithelial cells originate from multipotent epithelial stem cells that reside at the base of epithelial glandular structures called crypts, which are embedded in the mucosal wall [72] (Figure 1.7A). The crypts are separated by the lamina propria, a tissue populated by  21  blood vessels, leukocytes, and non-hematopoietic cells such as myofibroblasts, the latter which form a niche around the epithelial stem cell [28,73]. Underneath the lamina propria is a muscle layer called the muscularis mucosae; collectively the epithelium, lamina propria, and muscularis mucusoa make up the intestinal mucosa (Figure 1.7A). The intestinal epithelial stem cells have recently been defined by the expression of the marker Leucine-rich-repeat domain containing G-protein coupled receptor-5 (Lgr5) [74,75]. These Lgr5+ stem cells divide by asymmetric division giving rise to a daughter stem cell, and to highly proliferative immature epithelial cell progenitor cells [72], which occupy a region in the bottom half of crypts called the transit amplifying (TA) zone [76]. In general, most of these progenitors migrate up the crypt toward the luminal surface and leave the TA zone (Figure 1.7B); as they do so, they cease proliferating, and terminally differentiate into either mature highly polarized absorptive or secretory cells [71]. In the small intestine, differentiated cells migrate up structures that extend out in finger-like projections called villi; in the colon, where there are no villi, they remain on the surface. Ultimately mature differentiated epithelium resides at locations that enable the primary functions of the intestinal tract: the digestion and absorption of nutrients, and the maintenance of homeostasis with a highly dynamic luminal environment [77]. Once they reach the tip of the villi, or the surface of the colon, they are exfoliated into the lumen and replaced by newly differentiated cells [74].  22  Figure 1.7 The colonic mucosa A. Schematic of the human colon showing the full thickness of the intestinal wall. Epithelial cells originate from stem cells at the base of crypts. The crypts are embedded in the lamina propria and are separated from the submucosa by the muscularis mucosae. The mucosa is made up of crypts, lamina propria and muscularis mucosae. The surface of the mucosa is scattered with the openings of crypts, which are continuous with the intestinal lumen. Image modified from ref. [78]. B. Schematic of cellular organization of the colonic crypts. The transit amplifying (TA) zone is found in the bottom portion of the crypts, and the upper half of the crypts are populated by non-proliferating, terminally differentiated cells. Model modified from ref. [79].  23  1.2.2 Epithelial lineages The four major differentiated epithelial lineages are the columnar cells, the enteroendocrine cells, the Paneth cells and the goblet cells [73,74,76] (Figure 1.8). Each cell type shows differential representation in number and function along the intestinal tract. Columnar cells (also called enterocytes in the small intestine, and colonocytes in the large intestine) are the primary absorptive cell type in the intestinal tract and are by far the most abundant epithelial cell, making up 70% of the total epithelial population in the small bowel, and 80% of the epithelial population in the large bowel [71,73]. Columnar cells have dense microvilli on their apical surface, forming the brush border, which collectively possesses enormous surface area to interact with luminal contents; as such these cells are responsible for maintaining electrolyte balance and absorbing nutrients (sugars, amino acids) to deliver to the underlying tissues [77]. Enteroendocrine cells elaborate peptide-hormones that influence gastrointestinal motility and many other functions [74].  They are the least represented, making up 0.4 – 1.0% of the epithelial  population [71], but are the most diverse, with approximately fifteen subtypes, defined by the profile of peptide-hormones that they produce [74]. Paneth cells are among the most studied, and are specialized for secreting granules containing an array of antimicrobial molecules including -defensins (called cryptdins in mice), lysozyme, phospholipase A2, and C-type lectins [68]. However, they are only found at the base of crypts in the small intestine, and in humans are found in small numbers in the ascending colon, but are otherwise absent from the large bowel under physiological conditions [74,76]. Goblet cells are the second most abundant cell type, and increase in number along the intestinal tract from the duodenum, where they make up to 4% of the total cells, to the descending 24  colon, where they make up 16 to 20% of the total epithelial cell population [71,74]. Goblet cells mainly secrete granules containing large glycoproteins called mucins that give rise to the mucus layer (discussed in depth below) [80]. The intestinal epithelial cells have high turnover rates, usually every 1-3 days depending on the cell type [74], although Paneth cells are longer lived, with a turnover rate of 15 days [71]. There are additional specialized cells such as the ill-defined Tuft cell, and the Microfold or M-cell [76] (Figure 1.8), which is in the follicle-associated epithelium found directly overlying immune structures called Peyer’s Patches or isolated lymphoid follicles, and play a role in the immunological sampling of luminal contents [50].  25  Figure 1.8 Representative epithelial cell types of the intestinal tract. Model diagram depicting the major lineages of intestinal tract. The Lgr5+ stem cells first give rise to highly proliferative immature epithelial progenitor cells that reside in the TA zone. These then begin a directed differentiated program, and mature into one of 6 known lineages as shown. The major lineages are indicated in the box, and the major cell types within the small and large bowel are indicated. Figure modified from ref. [76].  1.2.3 Signaling pathways determining cell fate decisions: The Notch and Wnt pathways Components of the Notch and Wnt pathways The signaling pathways that determine cell fate decisions are complex and beyond the scope of this thesis. However, there are key pathways that need to be considered in regards to goblet cell development, specifically the Wnt--catenin pathway, and the Notch pathway. The Wnt--catenin pathway is extremely well characterized [81]. In the absence of Wnt signaling, cytosolic -catenin is constitutively phosphorylated by specific  26  kinases within a multiprotein degradation complex, subsequently ubiquinated, and targeted for degradation by the proteosome (Figure 1.9A). However, when Wnt ligands bind to their receptors, Frizzled and low-density lipoprotein receptor-related protein (LRP), this inhibits the kinase activity of the -catenin degradation complex, leading to stabilization of cytosolic -catenin (Figure 1.9 A). Stabilized -catenin then translocates into the nucleus, where it binds to members of the TCF/LEF (T-cell factor/lymphoid enhancing factor) family of transcription factors (Figure 1.9A).  Here the -  catenin:TCF/LEF complex activates target genes such as the protooncogne c-myc, a potent inducer of cell proliferation, as well as genes that direct cellular differentiation (described below and Figure 1.9A) [81]. In regards to the Notch pathway, there are four known Notch receptors (Notch 1-4) and these signal through membrane-bound ligands (Delta-like-1, -3, -4, and Jagged-1, -2) expressed on the surface of neighboring cells [82]. Upon ligand-binding and Notch activation, -secretase activity by a multiprotein complex preoteolytically cleaves the intramembrane domain of the Notch receptor, freeing the Notch intracellular domain (NICD). NICD then translocates to the nucleus and binds the DNA-binding protein RBP-J (also called CSL or CBF), a transcription factor that activates target genes (Figure 1.9B). The best characterized of the Notch target genes is the basic Helix Loop Helix factor (bHLH) Hairy/ enhancer of Split-1 (Hes1), which is a potent transcriptional repressor [83]. Interaction of Notch and Wnt pathways during intestinal epithelial cell differentiation Cells in the transit amplifying zone are kept in a proliferative state via the dual action of Wnt and Notch signaling in the epithelium [84,85]. In addition, both the Notch and Wnt 27  pathways specify fate decisions of the epithelial stem cells [84]. If Wnt signaling is inhibited, the cells stop proliferating and differentiate primarily into the columnar (absorptive) cell lineage. However if Notch is inhibited (either through exogenous secretase inhibitors that prevent cleavage of the transmembrane domain [83], or though genetic deletion of Notch signaling components (RBP-J) [86] or target genes (Hes1) [87]), the cells undergo a reduction or total cessation of proliferation, and differentiate into secretory cells, mainly goblet cells [83,88].  While there are many cellular  components that are involved in the terminal differentiation of specific cell types [74], the balance between secretory and absorptive cell fate revolves around Hes1 and another bHLH factor called Math1 (mouse atonal homolog 1; orthologue to HATH1 in humans). Math1 is a transcription factor that is a crucial determinant of secretory cell fate decisions, as demonstrated in Math1-null mice, which have virtually no secretory cells represented in their intestinal epithelia [89].  Hes1 however is a potent repressor of  Math1 transcription, and by doing so is thought to drive immature progenitors to adopt an absorptive cell fate (Figure 1.9B and C) [84].  Wnt also activates the transcription  factors Spdef (SAM pointed domain-containing Ets transcription factor) which promotes secretory cell development downstream of Math1 [90], as well as Sox9, which promotes Paneth cell development [74].  Notch/Hes1 activation leads to E47-like factor 3 (Elf3)  and transforming growth factor  type II receptor (Tgf-RII) expression which together promote development of absorptive cells [74].  There is also evidence that hedgehog  signaling can repress Wnt signaling in the upper crypts to promote the terminal differentiation of intestinal epithelial cells (Figure 1.9C) [91]. This may explain why absorptive columnar cells make up the vast majority of epithelial cells in the intestinal  28  epithelium. Thus several pathways and molecules are crucial in the production of each of the major epithelial lineages.  Figure 1.9 The role of Wnt and Notch signaling in epithelial fate decisions. A. The canonical Wnt pathway. Details are described in the text. Image modified from ref. [74]. B. The canonical Notch signaling pathway. Details are described in the text. Image modified from ref. [82]. C. Interaction of Wnt and Notch Signaling during absorptive vs secretory cell fate specifications. Indian Hedgehog signaling may also influence Wnt mediated proliferation and differentiation.  29  1.2.4 The role of the intestinal epithelium in host defense As alluded to above, intestinal and colonic epithelial cells exist in the context of a very dynamic microenvironment, exposed to a complex mixture of dietary proteins, lipids, bile acids and a dense microbiota. These cells therefore have the tripartite role of absorbing nutrients from the diet, maintaining electrolyte balance, while providing an effective barrier against the passing dietary products and the antigenic luminal microbiota [92]. Research over the last two decades has provided a large body of evidence describing an additional role for intestinal epithelial cells in participating in host defense against an array of bacterial pathogens. Some of these roles are considered passive, through formation of structural and chemical barriers to pathogens; others are more active, where epithelial cells sense and respond to pathogens to promote their killing. However, it is important to note that this difference in reality is somewhat artificial, since there is a constitutive basal recognition of the normal resident microbiota [6], therefore intestinal epithelial cells are always “actively” responding to its luminal members to mediate “passive” defense. Thus, for the sake of discussion, passive defense will include those innate defense mechanisms that are in place under physiological conditions, which bacterial pathogens come into contact with before their active recognition by the host. Active defense will refer to an induced or dynamic modulation of cell responses that is different from what is observed under physiological conditions, and that is associated with clearing a specific microbial threat. Mounting evidence points to the importance of secretory cells such as Paneth and goblet cells in regulating interactions between pathogenic and commensal bacteria though both passive and active mechanisms.  30  Central mechanisms underlying the passive and active roles of epithelial cells in host defense Upon review of the literature, there are two key points that should be kept in mind when considering the role of intestinal epithelial cells in host defense. First, many but not all of the same mechanisms that regulate interactions with the resident microbiota are also involved in protecting against enteric pathogens. Second, the mechanisms that regulate these passive and active immune functions of epithelial cells, involve similar pathways, such as those mediated by innate pattern recognition receptors. Therefore, understanding host defense against pathogens cannot always be separated from our understanding of those factors that maintain beneficial host responses to commensal microbes. Pattern recognition receptor signaling in epithelial cells Like cells of the innate and the adaptive immune systems, the epithelium expresses an array of pattern recognition receptors (PRRs) that bind to microbial derived products called microbial associated molecular patterns (MAMPs) [93,94]. bacterial  lipopolysaccharide  (LPS),  peptidoglycan,  These include  muramyl-dipeptide  (MDP),  prokaryotic DNA, viral RNA and host of others (reviewed in [94]). The most extensively studied PRRs include the leucine-rich-repeat domain containing Toll-like Receptors (TLRs), but also include the Nod-Like Receptor (NLR) family. While the focus of this thesis is not on specific innate pathways, the centrality of these pathways in innate defense functions of the epithelium necessitates a brief summary of their role.  Thus,  these receptors bind to cognate microbial-derived ligands to activate a cascade of signaling events that culminate in the activation and nuclear translocation of the transcription factor Nuclear factor-{kappa}B (NFB). 31  For TLRs, a key regulator of  downstream signaling is the recruitment of the global TLR adaptor protein Myeloid differentiation factor-88 (MyD88) to the cytoplasmic domain of activated TLRs. For some NLRs, NFB activation is dependent on downstream kinases such as RIP2. Ultimately, NFB activation induces the expression of genes involved in activation of the innate immune response to a foreign invader, such as antimicrobial peptide production, and pro-inflammatory chemokine and cytokine production. This in turn unleashes a powerful antimicrobial response, as well as regulates many other aspects of mucosal immunity [93] (Figure 1.10).  Figure 1.10 Simplified model of signaling by TLRs/NLRs in intestinal epithelial cells. Intestinal epithelial cells contain functional representatives of the TLR and NLR family, whose activation by microbe-associated molecular patterns (MAMPs) induces intracellular signaling events that culminate in the activation and nuclear translocation of NFB. Expression of NFB target genes are involved in direct (antimicrobial activity) or indirect (inflammation) modes of host defense. Image reproduced from ref. [6].  32  Passive defense: formation of a dynamic defensive barrier The passive form of defense relies upon the formation of a multilayered physiochemical defensive barrier. The barrier capacity is critical, as this not only prevents excessive interactions of outer microbiota with host tissues, but it maintains a net beneficial relationship with the intestinal microbiota as whole, capitalizing on their ability to increase efficiency of energy acquisition from the diet, and out-compete opportunistic pathogens.  This epithelial barrier function is met in several ways.  First, the  establishment of subcellular structures collectively known as the apical junctional complex (AJC) is critical for regulating unrestricted access of water, solute and bacteria into the tissues [92] (Figure 1.11A).  The AJC is composed of three structures: tight  junctions (TJs), adherens junctions (AJs) and desmosomes [92]. TJs are comprised of members of a large family of transmembrane proteins called claudins, the peripheral membrane protein Zona-occludins (eg. ZO-1) and an additional transmembrane protein called occludin [95]. These molecules interact to create a nearly impermeable barrier that limits flux of luminal solutes across the epithelia [96]. There are 24 known claudin members, and the expression of specific members is cell-type dependent, and determines the degree of paracellular permeability.  Depending in part on the specific claudin  members involved, the paracellular pore sizes within the TJ can exclude particles ranging in size from whole bacteria to particles the size of 4 Angstroms (A°) [96]. The AJs are made up of cadherins (Eg. E-cadherin) and catenins (-or -catenin), and are critical for TJ assembly and intercellular contact [95]. The desmosomes are the most basolaterally located part of the AJC, and have functions similar to the AJ, facilitating cell-cell contact and communication, and they also mediate keratin filament attachment to the peripheral 33  plasma membrane [95]. The details of these structures are reviewed in depth in Turner et al [95]. Ultimately, they allow for an effective sealing of the epithelial wall (Figure 1.11B) and are highly regulated. Because of their role in barrier function, much research has been devoted towards understanding their complexity and functional modulation, which is under tight control by inflammatory mediators such as TNF and hormones [97]. Moreover, AJC function is regulated in part by the innate recognition of bacterial products by PRRs, as TLR signaling through TLR2 and MyD88 are important for proper assembly of ZO-1 with the TJ, and E-cadherin with the AJ, which is correlated with protection from chemically-induced intestinal injury [98].  Figure 1.11 The apical junctional complex. A. H&E staining of the surface epithelium and underlying lamina propria of the murine small intestinal mucosa. The epithelial cells are intimately associated with neighboring cells due to the action of complex molecular structures called tight junctions, adherens junctions, and desmosomes, which collectively make up the Apical Junctional Complex (AJC). Image reproduced from ref. [95]. B. TEM and corresponding artistic representation of two joined intestinal epithelial cells and the components of the AJC that mediate their attachment. As shown, most apically is the TJ, then directly below is the AJ, and most basolaterally is the desmosome. Image reproduced from ref. [95].  34  However, the epithelium does not rely on the TJs alone, but reinforces the epithelial barrier by abundantly producing and secreting products into the intestinal lumen, including antimicrobial peptides and mucins forming the dynamic physiochemical defense barrier [99,100]. Like that of the AJC, these functions are also regulated in large part by recognition of bacterial products derived from the commensal microbiota. For example, landmark studies revealed that mice deficient in MyD88 have defects in epithelial homeostasis [101]. Attenuation of NFB signaling specifically in colonic epithelial cells though conditional ablation of Inhibitory of kappa-B Kinase-gamma (IKK or NEMO), leads to decreased production of the antimicrobial beta-defensin-2, which was correlated with increased resident bacterial translocation into mucosal tissues, and increased sensitivity to TNF-dependent epithelial apoptosis and severe spontaneous inflammation and wasting disease [102].  Importantly, MAMP:PRR interactions in  secretory epithelial lineages mediate host defense responses to commensal and pathogenic bacteria.  TLR-signaling through the global TLR intracellular signaling  adaptor MyD88 specifically in Paneth cells leads to production of the microbicidal Ctype lectin RegIII, and provides protection against the translocation of commensal (Bacteroides) and pathogenic (Salmonella) bacteria into systemic tissues [103]. Similarly, the NLR NOD2 can upregulate alpha defensins HD-5 and cryptdin expression in Paneth cells of humans [104,105] and mice [106] respectively, and in mice it has thought to regulate host interactions with commensal and pathogenic bacteria [107].  The goblet cell-derived mucus layer has long been considered to be a major part of the passive defense barrier [100], but as described in section 1.3 below, recent studies have  35  more formally demonstrated, as well as have provided new insights, into its protective functions. Mucus is postulated to serve serveral important functions in the intestinal tract. First, its gel-like consistency may give the mucus layer the properties of lubricant, facilitating passage of luminal contents through the gut [80]. Second, as a physiochemical barrier, mucin glycoproteins may act as substrates for bacterial adhesins and glycosidases (oligosaccharide-degrading enzymes) that would otherwise target host cell surface glycoproteins [80]. Third, depending on the anatomical location, the mucus layer acts as a matrix to strategically postion antimicrobial peptides to control bacterial invasion [108]. Lastly, the glycan composition of the mucin oligosaccharides is believed to modulate the microbial ecology of the GI tract, by creating a more favorable environment for commensal microflora to colonize and establish themselves and outcompete pathogenic species [100]. Its production by goblet cells is not dependent on the presence of the resident microbiota since germ-free mice have mucus, but the microbiota can modify several of the biochemical properties of mucus [100,109]. The role of mucins is the least understood aspect of intestinal innate immunity, but evidence is suggesting it is one of the most important, in terms of host defense, as detailed in section 1.3.  To summarize, at the passive level, epithelial cells are thought to defend against pathogen and commensal invasion at three levels. First, mucus provides the first proposed physical barrier, which is considered to be an obstacle to limit access of pathogens and commensals to the tissues. Second, the secretion of antimicrobial peptides creates a chemical barrier that enables control of bacterial numbers near or at the mucosal surface.  36  The functions of these first two levels are highly integrated. Third, the apical junctional complex can prevent the bacteria that bypass the physical and chemical barriers from entering the underlying tissue (Figure 1.12).  Figure 1.12 Epithelial passive defense. Model of representative cell types of the epithelium that contribute to or are protected by passive defense. 1. Paneth cell containing secretory granules packed with antimicrobial molecules (defensins, lysozyme). 2. Enterocyte undergoing cell invasion by an invasive pathogen. 3. Columnar cell potentially protected from invasion by pathogenic bacteria through its overlying mucus layer. 4. Goblet cell having released its mucin contents, protecting the neighboring cells. 5. Another columnar cell in theory protected by an adjacent goblet cell 6. Enteroendocrine cell basolaterally secreting peptide-hormones. 7. Mucus filled goblet cell. Tight junctions are represented to further seal the epithelial layer. Image modified from ref. [99].  Active defense: direct and indirect roles for epithelial cells to combat pathogens Intestinal epithelial cells can actively respond to pathogenic bacteria and modulate their responses in ways that promote microbial clearance. This can be either direct, through promoting microbicidal activity, or indirect, by modulating immune responses.  37  Direct role of epithelial cells in host defense. Similar to cells under baseline conditions, epithelial cells can directly recognize and respond to bacterial pathogens and promote their killing.  For example, RegIII, a microbicidal lectin, is secreted by intestinal  epithelial cells and provides host defense against the Gram-positive pathogen L. monocytogenes in a MyD88-dependent manner [110], and protects against C. rodentiuminduced mortality in susceptible mice [111]. Bacterial products derived from a variety of pathogens including S. Typhimurium, can induce the secretion of active forms of cryptins from Paneth cells that directly kill bacteria. Mice that are unable to release active forms of cryptdins from Paneth Cells due to Matrilysin (also known as MMP7, which is responsible for proteolytic processing of cryptins into their active forms) deficiency are susceptible to S. Typhimurium infection [112]. Conversely, mice that transgenically overexpress the human alpha-defensin HD-5 are resistant to S. Typhimurium infection [113]. Enteroinvasive E.coli can induce production of the cathelicidin LL-37 from the human transformed colonic cell line HCA-7 and is susceptible to direct killing by this cathelicidin [114]. Moreover, the murine cathelicidin- related antimicrobial peptide mCRAMP (the murine orthologue of human LL-37), is induced in mouse colonic epithelial cells in vivo during C. rodentium infection, and can directly kill C. rodentium in vitro and control this pathogen in vivo [115]. Reactive nitrogen species such as nitric oxide production through intestinal epithelial-derived iNOS (inducible nitric oxide synthase) can also participate in host defense against C. rodentium [116], as well as EPEC and EHEC [113].  38  Other evidence implicating the direct role of intestinal epithelial cells, including secretory cells, in host defense are derived from other essential cell functions. The unfolded protein response (UPR), a highly orchestrated cell response to defective protein folding, promotes healthy Paneth cell function, as mice that cannot undergo the UPR in the intestinal epithelium have defective Paneth cell function that compromises the control of luminal burdens of L. monocytogenes [117].  The process of autophagy, which is an  essential cell process to degrade and recycle proteins and spent cell components [118], can also lead to the control of intracellular pathogens such as S. Typhimurium [119]. Mice defective in genes essential for autophagy in the epithelium also have defects in secretory function of Paneth cells although this has not been linked directly to defects in host defense to date [120]. Infected epithelia can also undergo apoptosis and be shed as a means to remove a population of infected cells and prevent further spread of the pathogen within the host [121], indicating a co-operative function of secretory cells and other epithelial cell functions in host defense.  Immune-mediated modulation of epithelial function. An important role of epithelial cells in active host defense is via modulation by the immune system, or immunomodulation. Cytokines elaborated from a variety of immune cells can modulate expression of hostdefense peptides that are directly antimicrobial to various pathogens. For example, IL-13 produced during Th2 responses directly activates epithelial cell turnover to remove worms that have embedded in the epithelium [122].  IL-13 also impacts on goblet cell  differentiation and goblet cell-specific gene expression in a manner that is thought to promote host defense against enteric parasites (discussed below). Moreover, IL-22  39  release from hematopoietic (Natural Killer, NK, and Th17) cells can stimulate RegIII- production from the colonic epithelium [123]. Th1 cells produced during C. rodentium infection can promote beta-defensin production from epithelial cells which is thought to mediate control of this pathogen in mice [124].  Thus epithelial cells can directly  function as effector cells through which components of the immune system control a microbial threat.  Indirect roles for epithelial cells in host defense: epithelial modulation of immune function.  While the epithelium can directly combat invading microbes, either  commensals that have inadvertently accessed the epithelium, or pathogens that actively invade the tissues, the epithelium indirectly contributes to host defense in numerous ways. Some of these functions are well characterized, such as the innate recognition of bacterial products through TLRs that leads to expression of chemokines including IL-8 that recruit phagocytic leukocytes (e.g. neutrophils) to the site of infection [125]. A recently described and highly unanticipated manner by which epithelia contributes to host defense resides in their ability to promote beneficial immune responses through production of immunoregulatory cytokines, which modulate the function of underlying antigen presenting cells by conditioning them to shape the adaptive immune response. For example, the cytokine thymic stromal lymphopoietin (TSLP) is secreted basolaterally by colonic epithelial cells, in an NFB dependent manner, to condition underlying dendritic cells to promote the development of adaptive Th2 responses during helminth infections [126]. Similar processes may also protect against Salmonella Typhimurium, as in vitro studies show that TSLP is important for shaping a protective dendritic cell  40  response against this pathogen [127]. In addition to TSLP, the intestinal epithelium also produces IL-25 and IL-33 which are important for Th2 development [128]. Intestinal epithelial cells can also secrete cytokines that modulate B-lymphocytes such as APRIL (A Proliferation Inducing Ligand [129] and BAFF (B-cell activating factor) [130], which influence IgA production from plasma cells [130]. Intestinal epithelial cells also express MHC Class II, although their role in antigen presentation is still unclear [70].  1.2.5 Bacterial subversion of epithelial cell function General principles of pathogen subversion While the above studies reveal the multiplicity of ways in which epithelia—particularly those of secretory lineages—contribute to host defense, an important aspect of any infection is how pathogens modulate and subvert host cell function in order to evade host defenses, and enhance colonization in a hostile environment [11]. During any enteric infection there is a dynamic crosstalk between host cells and the pathogen (and commensal bacteria). In a given infection therefore the overall host response including that of epithelial cells can be seen as a net response comprising host, pathogen, and commensal-mediated alterations of cell function.  It is therefore pertinent to briefly  discuss how pathogens, namely A/E bacteria, can potentially modulate cellular responses. The understanding of pathogen subversion of cell function has rapidly progressed due to discovery of the T3SS and T3SS-dependent effectors, and advancement in cellular biological techniques such as live cell imaging and the sequencing of pathogens, all of which have revealed the myriad ways by which bacterial pathogens can exploit cell dynamics. Most studies looking at Salmonella sp, Shigella sp, and Yersnia sp. describe 41  how these strategies come into play during cell invasion. Prototypical examples of these strategies are the ability of Salmonella Typhimurium to interfere with vesicular trafficking in macrophages via its T3SS (Salmonella Pathogenicity Island-2, SPI-2) to prevent fusion with the lysosome [131]. Similarly, the ability of L. monocytogenes to coopt the cytoskeletal actin to jettison between epithelial cells to propagate is another major example [132]. Other ways are being elucidated, such as the ability of Shigella flexneri effector OspF to modulate epigenetic pathways to limit inflammatory responses [133]. Such mechanisms are reviewed in depth in a recent review [134]). In contrast, A/E bacteria are non-invasive, but research has uncovered—and continues to do so—the variety of ways that these classes of pathogens similarly modulate cell processes. Subversion of epithelial function by A/E pathogens The formation of A/E lesions by A/E pathogens is not the only function of the LEE and the T3SS. As alluded to above, the LEE, as well as non-LEE chromosomal regions, encode a battery of effectors that interact directly with host proteins, organelles, and interfere with essential cell processes including survival, maintenance of permeability, proliferation, and innate defenses [11].  The function of many of these effectors is still  under investigation, but current studies have revealed pleiotropic functions for several effectors. These are reviewed extensively in ref. [134], but among the most notable so far include the LEE-encoded EPEC secreted protein (Esp)F. EspF appears to have multiple functions in host cells, among them being the ability to disrupt mitochondrial function and promote epithelial cell apoptosis through the mitochondrial death pathway [135]. EspF can also interfere with macrophage pinocytosis, and the function of ionpumps and glucose exchangers [136].  In addition, EspF disrupts tight junctions, causing 42  the epithelium to become more permeable [137]. EPEC and EHEC can affect cell cycle through the T3SS secretion of the phage (nonLEE)-encoded Cif (cycle inhibiting factor), a cyclomodulin which blocks the cell cycle by inhibiting the G2/M transition of the cell cycle[138]; Cif also may promote a prolonged process of cell death [139].  EspZ  secretion by EPEC can interact with CD98 and promote cell survival [140]. Mitochondrial associated protein (Map) localizes to the mitochondria and interferes with its respiratory function, as well as alters paracellular permeability [49], and promotes filopodia formation [141].  In addition to affecting cytoskeletal arrangements and  organelle function, these effectors can interfere with innate signaling pathways within intestinal epithelial cells, subverting innate immune responses to infection. For example, the suppression of innate defenses such as IL-8 production [142], and iNOS expression [113,116], although the mechanisms underlying these processes are still being elucidated. Bacterial endoxins such as cholera toxin from V. cholerae, and labile toxin from enterotoxigenic E. coli can repress expression of the host defense peptides hBD-1 and LL-37 from intestinal epithelial cells in vitro [143]. Such understanding is important to dissect which responses are mediated by the pathogen vs. the host, and correspondingly, which responses are beneficial for the host and which facilitate the propagation of the pathogen (Figure 1.13). 1.2.6 Summary of Section 1.2 The above studies collectively reveal the numerous ways by which epithelial cells cooperate and contribute to host-defense against maladaptive interactions with the intestinal microbiota, as well as enteric bacterial pathogens. Secretory cells have emerged as a key component of this host defense response, either through direct interactions with microbes, 43  or through modulation by the immune system. While Paneth cells have been the major focus, they are not represented in high numbers in the large bowel. In contrast, goblet cells are highly represented in the large bowel and constitute the major secretory cell in this region of the intestine. In fact, evidence is emerging that goblet cells play a major role in managing both commensal and pathogenic bacteria including A/E pathogens in the intestinal tract, by producing the intestinal mucus layer, and elaborating other secretory molecules.  Figure 1.13 Manipulation of host cell pathways by EPEC and EHEC. The ability of EPEC to subvert cell functions is better characterized than that of EHEC, however, both pathogens utilize similar effectors. Image reproduced from ref. [11].  44  1.3  GOBLET CELLS: THEIR ROLE IN GASTROINTESTINAL HEALTH AND INFECTIOUS DISEASE  1.3.1 Ultrastructure and morphology of goblet cells Goblet cells are unique both in their structure and function. The ultrastructure of mature goblet cells reveals a highly polarized morphology where the cell nucleus, and virtually all the cytoplasm and organelles are found compacted into a tapered basolateral compartment [80] (Figure 1.14A).  This is in contrast to absorptive enterocytes, which  have cytoplasm dispersed evenly throughout the cell. Directly above the nucleus and cytoplasm lies a prominent Golgi apparatus where large glycoproteins called mucins are glycosylated and packaged into secretory granules (discussed below).  The apical  compartment, known as the goblet cell theca, is packed with numerous secretory granules containing mostly mucins, but also other secretory factors [80]. The density and size of these mucin-filled granules are what give the apical domain its exaggerated swollen appearance and which ultimately gives goblet cells their characteristic “goblet” shape [80]. This also makes them readily identifiable by standard histological stains, where they appear as unstained cells since their theca contains little cytoplasm that can be stained by eosin (Figure 1.14B). However, goblet cells can also be readily observed through a variety of histochemical staining for mucins such as the commonly used periodic acid-Schiff PAS reagent, which stains mucins an intense magenta (Figure 1.14C).  45  Figure 1.14 Intestinal goblet cells. A. TEM showing the ultrastructure of a colonic goblet cell (GC) between two absorptive colonocytes (asterisks). The goblet cell theca is filled with granules containing large polymeric glycoproteins called mucins that form the mucus layer once released. The nucleus, cytoplasm and organelles are found at the base of the cell and beneath the Golgi apparatus. B. H&E stain of human colonic tissue section to show the swollen, unstained appearance of goblet cells in the normal colon (arrow). Image reproduced from ref. [144]. C. Histochemical staining of goblet cells in mouse colonic tissue, using Periodic acidSchiff (PAS) reagent. PAS stains goblet cell mucins an intense magenta. Original magnification 100X.  Like their highly distinct morphology, goblet cells are distinguished from other intestinal epithelial cells by their specific gene expression program. Three major goblet cellspecific proteins have been shown to be involved in various aspects of gastrointestinal health and disease.  These include the major colonic mucin macromolecule Mucin-2  (MUC2), the healing peptide Trefoil-Factor 3 (TFF3), and the Resistin-like Molecule family member, Resistin-Like Molecule-{beta} (RELM) [145,146,147]. As described below, each of these molecules is functionally and structurally unrelated, differentially regulated, and has unique and profound roles in gastrointestinal function in the context of normal physiological function, and in the face of specific intestinal insults. However, 46  remarkably, none of these molecules have been directly assessed for any potential role in host defense against enteric pathogens such as A/E bacteria. The following section provides a review of each of these mediators, and what is known of their function and proposed roles in host defense, and the implication of these roles for their potential impact on an infection by A/E bacteria. 1.3.2 The MUC2 mucin and the mucus layer: structure, synthesis, and properties Mucin-2 and mucus production Goblet cells are best defined by their role in producing abundant mucins that give rise to the mucus layer and all other forms of luminal mucus [148]. This is done by expressing the secretory mucin MUC2 (mouse, Muc2) [148] (Figure 1.15A). MUC2 belongs to the large mucin family of glycoproteins, containing sixteen known members in humans [149]. Mucin genes are expressed widely in the body, both in hematopoietic and nonhematopoietic cells [149]. While they have diverse functions, mucins can be broadly divided into secretory or membrane bound forms [149]. The secretory forms can further be subdivided into gel-forming or non-gel forming mucins, based on the ability to form polymers. There are currently four major gel-forming mucins in the GI tract: MUC2, MUC5AC, MUC5B, and MUC6, all located in a cluster at the chromosome locus 11p15.5 in humans [150]. However, studies have revealed MUC2 to be the major if not the sole small intestinal and colonic secretory mucin [148,151].  47  MUC2 structure and synthesis MUC2 is synthesized in a stepwise fashion, starting with the translation of its very large apomucin protein core, which is over 5100 amino acids in length [147]. The MUC2 protein core contains five unique domains, described in Figure 1.15B.  The largest  domain is one of two Variable Number of Tandem Repeats (VNTR), which contains approximately 50-100 regular repeats of a 23 amino acid consensus sequence that contains abundant proline, serine, and threonine residues (hence it is also called the PTS domain) [152]. These have a critical role in Muc2 function by serving as sites of O-linked glycosylation (Figure 1.15B) (described in detail below) [147,152,153]. After synthesis of its apoprotein core, MUC2 undergoes transport to the ER and forms head-to-head covalently linked dimers via disulfide bridges between the cysteine-knot domains on the C-terminus [154] (Figure 1.15C).  Muc2 apoprotein dimers are then transported to the  Golgi apparatus, where extenstive glycosylation takes place in the VNTR. In the Golgi, the molecule attains a mass of approximately 5MDa [154]. In the trans-Golgi, disulfide bridges are formed between the N-terminal D domains to form a net-like Muc2 polymer [154] (Figure 1.15C). MUC2 polymers are packaged into numerous granules and stored in the goblet cell theca creating the apical granule mass that gives the theca its swollen appearance [80,155]. Here the granules are poised for release into the intestinal lumen. Once released, polymeric MUC2 becomes highly hydrated and instantly expands in volume by 1000 fold [80], forming an organized sheet that serves as the structural basis of the intestinal mucus layer (Figure 1.15D) [154].  48  Figure 1.15 Muc2 structure and synthesis. A. Immunolocalization of Muc2 within goblet cells of the mouse descending colon. Muc2 is found in goblet cells from the crypt base to the surface epithelium. Original magnification, 200X. 49  B. Mature Muc2 Monomer showing domain structure of the protein core and “bottle brush” appearance. Image modified from ref. [156]. The 5 main domains are as follows: i. VNTR (Variable Number Tandem Repeat) also call the PTS domain (rich in Proline Threonine Serine residues). These domains are the major sites of O-linked glycosylation. ii. IR (Irregular Repeat) domain. Essentially a VNTR/PTS domain with less regular tandem repeats. IR domains are flanked on either side by CR domains. iii. Cysteine rich (CR) domain: these are rich in Cysteine residues and are sparsely glycosylated. iv. D domains (D1-4) are homologues in sequence with the domain in von Willerbrand factor (vWF) that mediates dimer formation. In MUC2, D domains D1-D3 are involved in MUC2 trimerization. The D4 domain contains an autocatalytic site. v. CK (Cysteine Knot) domain. A Cysteine-rich domain that mediates tail-to-tail dimerization of MUC2 monomers via covalent bonds from disulfide bridges between CK domains of other MUC2 molecules. C. Synthesis of mature Muc2 and formation of a polymeric Muc2 network giving rise to mucus. Image modified from ref. [154]. D. PAS staining of mucus layer (ML,white arrow) overlying the epithelium of a mouse colon. Image originally taken at 400X (left panel), and 1000X (right panel).  Muc2 glycosylation The glycosylation of mucins begins with the transfer of N-acetylgalactoseamine (GalNAc) from UDP-GalNAc to the hydroxyl-group (hence an O-glycosidic bond) of the serine  or  threonine  residues  in  the  VNTR  by  the  polypeptide-N-acetyl-  galactosaminyltransferase (ppGalNAcT), via an alpha () linkage [157]. The proline residues in the VNTR/PTS domain are thought to facilitate this reaction [157].  The  resulting glycan structure, GalNAcSer/Thr is antigenic, and is known as the Tn-antigen [157]. The second step uses the Tn –antigen as a foundation to build what are called core glycan structures. There are 8 known core structures, but cores #1 – 4 are the most common and widely utilized under physiological conditions [157]. These are made by the addition of key monosaccharides to the GalNac of the Tn antigen, through the action of specific glycosyltransferases. For example Core 1 glycosylaminyltransferase (C1GnT) 50  adds a Gal residue (via a beta()-1-3 linkage) to GalNAc to create the Core 1 structure (Gal1-3GalNAcSer/Thr), which is also called the T antigen. The core structures are summarized in Figure 1.16A.  Muc2 most likely contains primarily Core 3-derived  structures [158] catalyzed by the Core 3 1-3 N-acetylglucosaminyltransferase (C3GnT), which bonds N-acetylglucosamine (GlcNAc) to the GalNAc of the Tn antigen via a 1-3 linkage creating the Core 3 configuration GlcNAc1-3GalNAcSer/Thr (Figure 1.16A). The third step is the elongation of the core structures by the addition of Poly-Nacetyllactosamine extensions, which are chains made of repeating units of Nacetyllactosamines [Gal1–4GlcNAc1–3]n. These chains can be either type 1 chains characterized by repeating units of Gal1-3GlcNAc, or type II chains, made of Gal14NGlcNAc units [157]. These chains function as a “scaffold” upon which to add other sugars or modifiers. The fourth step is the addition of terminal sugars that cap the oligosaccharide side chains.  These sugars are typically fucose, sialic acid (a.k.a.  neuraminic acid), galactose and/or GalNAc (Figure 1.16A).  The addition of these  terminal sugars gives rise to antigenic epitopes that include the ABH antigens that characterize the ABO blood groups, the Lewis antigens, and several others, which in turn impart specific biological functions to the glycan [157]. The oligosaccharides can be further modified by the addition of sulfate groups, usually to Gal residues in the side chains (Figure 1.16A).  These latter modifications are mediated by specific  fucolsyltransferases (FUT1 and FUT2), sulfotransferases, and sialotransferases.  These  oligosaccharides constitute about 80% of the mass of the molecule [147] and also gives the molecule its characteristic “bottle brush” appearance that is characteristic of all mucins (Figure 1.15A) [156]. Mucin glycan composition can be detected histologically  51  by several methods, including via lectin-staining (Figure 1.16B) and other histochemical methods described in Figure 1.16C and D.  Figure 1.16 Muc2 glycosylation. A. Synthesis of oligosaccharides attached to Ser/Thr residues of VNTR regions of MUC2. Details described in text. The red arrows indicate the main path of MUC2 glycosylation through generation of Core-3 derived glycans. The enzymes represent the 52  relevant glysosyltransferases, sialyltransferases, and/or sulfotransferases at each step. Figure modified from ref. [157]. B. Epifluorescence staining using lectins that bind specific carbohydrate moieties abundant in mucus-producing goblet cells. UEA-1 (Ulex europaeus agglutinin-1 binds primarily fucosylated glycoproteins, and WGA (Wheat germ agglutinin) binds primarily sialic acid residues largely found in mucus, but also on the apical plasma membrane of IECs. Original magnification, 200X C. Alcian blue/periodic acid-Schiff (AB/PAS) staining differentiates between goblet cells that have neutral (pink), acidic (light blue) or both neutral and acidic mucins (purple). Original magnification, 400X. D. High iron diamine/alcian blue (HID/AB) staining differentiates between goblet cells that have predominantly sulfated mucins (black), sialated mucins (light blue), or both sialated and sulfated mucins (blue/black) Original magnification, 400X.  Expansion of the polymeric Muc2 granule Once Muc2 is polymerized and glysosylated, it is secreted into the lumen and undergoes dramatic expansion to form the mucus gel. In this regard, electrolyte secretion appears to be involved in the rapid expansion of the mucin granules. Muc2 is densely compacted in the mucin granule, despite its negative charge and presence of abundant intramolecular repulsive electrostatic forces within the polymer. The mucins are thought to be held in condensed form by the neutralizing effect of Ca2+ ions within the goblet cell granule, which reach an intragranular concentration of 200mM [159] (Figure 1.17). H+ ions are also abundant (pH <6), and thought to contribute to the shielding effect [159]. However, upon granule release, there is a rapid disassociation of Ca2+ (and H+) ions from the mucin granules, which then unmasks the polyanionic mucins, enabling the electrostatic repulsive forces to mediate rapid expansion of the mucin granules, and subsequent hydration to form the mucin gel [159].  The mechanisms underlying this crucial  disassociation event are not well defined, but are dependent upon CFTR and Bicarbonate (HCO3-) [160], whereby CFTR-dependent HCO3- secretion into the lumen by adjacent  53  epithelial cells is hypothesized to rapidly sequester Ca2+ (and H+) from the polymeric Muc2, enabling its subsequent expansion [160]. Interestingly, bestrotrophin-2, a putative calcium-dependent chloride channel, is expressed specifically in goblet cells on the basolateral membrane, and has recently been shown to mediate uptake of HCO3- by the epithelium [161]. This suggests bicarbonate transport by goblet cells is an important mechanism regulating mucin expansion and subsequent gel formation.  Figure 1.17 Proposed mechanism for expansion of polymeric mucin. In the mucin granules, highly negatively charged mucin polymers are kept in condensed form with the help of intragranular calcium (and protons, not shown), which shield the negative charges, countering the electrostatic repulsive forces. However upon secretion, bicarbonate release by adjacent epithelial cell is thought to rapidly sequester the Ca2+ ions, allowing the mucin polymers to expand and form a gel. Image modified from ref. [159].  Physical properties of the Muc2-rich mucus layer Structure of the mucus layer. The intestinal MUC2-rich mucus layer varies in structure along the length of the intestinal tract. In the small intestine, the layer is discontinuous [154] (Figure 1.18A), probably due to the reduced goblet cell density and larger surface area of the mucosa, suggesting a different function for mucus in the small bowel compared to the large bowel. However, in the large intestine, particularly within the 54  colon, the structure of mucus is more complex (Figure 1.18A). As described in Chapter 3, in the colon the mucus layer is composed of 2 distinct sublayers: a firmly adherent inner layer directly attached to the epithelium, and outer loosely adherent layer (Figure 1.18A). Interestingly, these observations were first observed in human colonic biopsies [162] (Figure 1.18B), however they have recently been characterized in depth by Gunnar Hanson’s group [152]. Muc2 has recently been shown to be the major if not sole secretory mucin to contribute to the formation of these layers in mice [152]. The inner layer contains approximately-four-fold more Muc2 than the outer layer, and it gives rise to the outer layer, probably through the actions of mainly host derived proteases, since germ-free mice also have both layers (Figure 1.18C) [152]. In humans and mice, these layers mediate diametrically opposed interactions with the luminal bacteria: whereas the outer layer is densely populated with luminal bacteria, the inner layer is nearly free of bacteria (Figure 1.18D) [152]. This has major implications for host-bacterial interactions in this site of the intestinal tract, especially the colon, where bacterial number, density and diversity is greatest (described below).  Thickness of the mucus layer. The mucus layer varies in thickness along the intestinal tract. Studies in human samples biopsies are not well characterized in the literature, but those that have been done show the mucus layer in healthy patients to be thinnest in the cecum, ranging from 26- 36 μm for the whole layer (inner layer, 5 μm), and ranging from 46 to 285 μm in the rectum (inner layer, average 12 μm) [162]. In rats, similar findings have been shown, with the mucus layer demonstrating greatest thickness in the colon; however this was measured to be much higher than that measured in humans, reaching an  55  average of approximately 800 um +/- 100 μm. (inner mucus layer >100 μm) [163] (Figure 1.18E). This disparity is likely due to differences in measurement methods, as in the human studies, the measurements were made on histologically preserved mucus layers [162], whereas the rat measurements were made directly by immersing a pipette onto the mucosal surface of rat intestinal tissues, and measuring depth of penetration from the layer to the surface [163]. In mice, the colonic mucus layer is about 150 μm (inner layer, 50 μm), which was also determined through pipette suctioning [152]. It is likely that the human colonic mucus layer thickness is grossly underestimated, due to unavoidable loss of mucus during tissue processing.  56  Figure 1.18 Structure, function, and thickness of the mucus layer. A. Illustration of variation in mucus structure along different regions of the intestinal tract. Image reproduced from ref. [154]. B. Carnoy’s Fixed human colon section with mucus layer (ML) preserved. Two layers are apparent, a loose outer layer, and a firm inner layer attached to the epithelium. Image reproduced from ref. [162]. C. Schematic model of the molecular changes in the polymeric Muc2 network involved in the transition of the dense firm inner layer of Muc2 into the loose outer layer. Image reproduced from ref. [154]. D. PAS (left) and FISH stain for commensal bacteria using the universal EUB338 DNA probe (right) showing that the inner mucus layer acts as an effective barrier to sterically  57  hinder commensal interactions with the underlying mucosa. Original magnification 100X. E. The differential thickness of the whole mucus layer (inner + outer layers) in the rat intestinal tract. Image reproduced from ref. [163].  Composition of the mucus layer. Analysis of mucus composition reveals mucus to be a rich biochemical matrix. In a recent and informative study, proteomic analysis of the mucus layer reveals colonic mucus contains hundreds of proteins [164]. Many of these were intracellular proteins, most likely derived from shed, apoptotic epithelial cells [164]. Others were plasma proteins, although it was uncertain whether these were derived from natural paracellular leakage from the mucosa or from contamination from tissue processing. However, over 40 were identified as secretory proteins from epithelial cells. Among the most notable were the IgG Fc binding protein (Fcgbp), and chloride channel calcium activated-3 (mCLCA3; aka Gob5), both of which are unrelated goblet-cell specific proteins [165,166].  The functions of these molecules in relation to their  localization in mucus are not clear, but Fcgbp is thought to strengthen the mucus layer [164], and perhaps bind and mediate IgG function [167]. mCLCA3 is hypothesized to not act as an anion channel to mediate calcium-activated chloride conductance, but rather to function as a secretory molecule [168,169] that can influence mucus secretion [170,171].  Interestingly, the inner and outer mucus layers had an almost identical  proteomic profile, although with fewer bacterial peptides in the inner mucus layer as expected [164]. Furthermore, antimicrobial peptides such as cathelicidins and -and defensins were not detected [164] despite the expression of some of these molecules under baseline conditions in colonic epithelial cells, such as -defensin-1 [172]. This finding is in contrast to small intestinal mucus where there is a rich abundance of many  58  Paneth cell-derived antimicrobial peptides [108]. That lack of antimicrobials in colonic mucus is consistent with the lack of Paneth cells in the large bowel, and the correspondingly increased total number of bacteria in the large intestine. However, this difference was also speculated to be the result of limitations of the analysis tools used in the colonic mucus study [164]. Consistent with this idea, high levels of Paneth cell defensins have recently been found in colonic lumen contents of mice (but not necessarily the mucus layer) via mass-spectrometry analysis, most likely carried downstream from small intestinal secretions [173].  Other proteins including IgA,  proteases as well as other molecules including lipids and electrolytes are also found in mucus [80], revealing further biochemical complexity of the Muc2-mediated mucus layer. 1.3.3 Functional biology of Muc2 and the mucus layer Role of Muc2/mucus in host protection: loss of function experiments While the consensus that mucus production by goblet cells is protective has been made for decades, the mechanism by, and the degree to which this is true in an in vivo mammalian system have only recently been demonstrated.  As described in chapter 3,  mice genetically deficient in Muc2 (Muc2-/-) completely lack an intestinal mucus layer, confirming the importance of goblet cells in the establishment of this feature of mucosal anatomy. Correspondingly, Muc2-deficient mice, as they age, exhibit profound defects in virtually every aspect of intestinal homeostasis. Host-commensal interactions are altered: there are much higher numbers of commensal bacteria associated with the surface epithelium and deep in the crypts in the absence of Muc2 [152].  59  Host epithelial  homeostasis is dramatically altered, with hyperplastic crypts evident by six weeks of age due to increased baseline cell proliferation and decreased epithelial apoptosis [155]. Immune homeostasis is altered as revealed by higher levels of pro-inflammatory cytokine gene expression at baseline [174], and likely many other as yet undescribed defects. The consequences of these disruptions are stunted growth, and the development of severe spontaneous inflammation in the large bowel [174]. As originally described with these mice, Muc2-deficiency can also lead to spontaneous colorectal cancer characterized by the development of large tumors in the rectum and small bowel, which can become malignant [155].  The disease is thought to be partially dependent on genetic  background, as the spontaneous inflammation was observed when Muc2-deficiency was introduced onto a 129/SvJ background [174], and colorectal cancer was observed in the absence of inflammation on a BL/6 background [155].  However, we have noticed  spontaneous inflammation in our Muc2-/- mice on a BL/6 background, likely indicating that an unidentified environmental component modulates the disease.  Regardless of  background, the disease is thought to result from uncontrolled bacterial contact with the mucosa, leading to altered epithelial and inflammatory changes which spawn a feedforward loop that culminates in spontaneous inflammation and (most likely inflammation-associated) carcinogenesis. However, it should be emphasized that the specific role of the commensal microbiota in these diseases has yet to be formally demonstrated, either through the use of broad-spectrum antibiotics, generation of germfree Muc2-/- mice, or Muc2-/- mice-also deficient in PRR signaling.  60  The findings that Muc2 deficiency disrupts intestinal homeostasis are further corroborated by other studies demonstrating that defects in mucus production via other mechanisms can predispose mice to intestinal disease. Mice lacking the enzyme Agr2, a protein disulfide isomerase that is thought to play a role in Muc2 processing, fail to produce Muc2 and secrete mucus [175]. As a result these mice have baseline disruption in immune hemeostasis, develop spontaneous colitis as they age, and are highly susceptible to DSS colitis [175]. Similar studies were shown in mice lacking the Core 3 1-3 N-acetylglucosaminyltransferase (C3GnT-1) required for generation of the Core 3 structure on Muc2, and therefore cannot undergo adequate glycosylation [158]. These mice have major defects in mucus production and are highly susceptible to DSS-induced colitis and azoxymethane-induced colorectal cancer [158].  An additional mechanism  may be through unregulated endoplasmic reticulum (ER) stress.  In a recent study,  Muc2 mutants were created by exposure of mice to the mutagen N-ethyl-N-nitrosourea (ENU). This in turn resulted in an accumulation of misfolded Muc2 and the lack of production of polymeric Muc2, leading to ER stress and ER-stress associated spontaneous inflammation [176]. Role of Muc2/Mucus in host protection: gain of function experiments While experimentally induced Muc2-deficiency is consistently a detrimental effect, Muc2 “gain of function” studies have mixed conclusions. For example, inhibition of Notch signaling by -secretase inhibitor dibenzazipene (DBZ) caused tumors cells in APC/min mice to stop proliferating and to differentiate into goblet cells [83]. In mouse models of IBD using DSS, the protective effect of DBZ was dependent on the stage of disease, but early stage blocking increased goblet cell number and inhibited the severity of DSS61  induced colitis [177].  This could be perhaps by increasing mucin content, since a  requirement for DSS to disrupt the mucus layer before causing disease has been recently demonstrated [178]. In later stages however, this protective effect was not observed [179]. The reasons for this lack of protection were not determined, but were likely due to interference with the (partially Notch-dependent) restitution process, which is required to re-establish the epithelial structural barrier [179] prior to epithelial differentiation. Interestingly, long-term inhibition of Notch signaling through epithelial-specific deletion of POFUT1 [protein O-fucosyltransferase 1], an enzyme responsible for a crucial fucosylation event in the EGF domain of the Notch receptor that is essential for its activation, lead to dysbiosis of the microbiota, which was associated with the development of spontaneous ileitis, and intestinal epithelial neoplasia [180].  These  results suggest that overactivation of goblet cells may be detrimental, although the nonmucin related effects of the various forms of Notch inhibition could also be contributing. 1.3.4 Regulation of mucin production Quantitative regulation of mucin expression and secretion These important discoveries raise questions about how mucus production is regulated. Muc2 production is in a state of dynamic equilibrium with its degradation (Figure 1.19) [147]. Numerous factors lead to mucus breakdown or loss including host proteases, sloughing from abrasive passing dietary contents, and microbial-mediated breakdown due to the action of bacterial mucolytic enzymes [100,147]. Conversely, mucin production by goblet cells can be modulated both quantitatively and qualitatively. Quantitatively, the amount of MUC2 that is produced is controlled at both the transcriptional and  62  translational level by a variety of stimuli, including exposure to microbes and their products, host immune responses [100], exogenous chemicals [181], and physical irritation [80].  Figure 1.19 Dynamic equilibrium of the Muc2-rich mucus layer. Figure depicting that the net thickness of the mucus layer is a determined by the rate of MUC2 production by goblet cells, and the rate of its degradation by a variety of host or bacterially-derived enzymatic activities and mechanical sloughing from sheer forces of passing dietary contents. Image reproduced from ref. [147].  In addition, the amount of MUC2-filled granules that are released by goblet cells can occur via two distinct mechanisms: constitutive secretion and accelerated secretion. During constitutive secretion, single granules along the periphery of the goblet cell theca are constantly released in a one-by–one fashion [182]. Constitutive secretion is not thought to be regulated by exogenous stimuli, but rather in part by microtubule-mediated movement of secretory granules through the cytoskeleton [80]. The main function of constitutive secretion is to maintain the mucus blanket [80]. In contrast, accelerated secretion, also called compound exocytosis, occurs when there is a near instant release of the centrally stored mucin granules [80]. This latter action is mediated by the action of a 63  variety of mucin secretagogues that are host or microbially derived. As described in Chapter 3, these include hormones, cytokines, bacterial cell wall components and many others [100,183] Qualitative regulation of mucin production Qualitatively, the biochemical properties of mucins, such as the degree of acidity, sulfation, or glycan composition, are highly regulated at the post-translational level through  the  actions  glycosyltransferases [147].  of  specific  sialotransferases,  sulfotransferases,  and  These are the most poorly understood post-translational  modifications of mucus, but are also thought to be the most critical, because they ultimately confer upon mucins their proposed biological functions. In some instances, mucins with differential biochemical properties can be selectively released from goblet cell populations, for example, sulfated mucins vs non-sulfated mucins, but the mechanisms underlying how goblet cells distinguish release of these mucin subtypes is still unknown, as is their function.  However, importantly, in response to bacterial  colonization of the gut [109], virus infection [184], or inflammatory/immune responses [185], there can be marked changes in mucin composition, manifested by altered glycan compositions or the degree of sialation or sulfation [100]. The potential importance of these changes are discussed below.  Another potentially important qualitative modification of Muc2 and mucus is its degree of viscosity, although this is a poorly understood property of mucus. There is evidence that mucus is of different viscosities at different sites along the intestinal tract, with increasing visocity from the proximal to the distal regions of the large intestine [186]. 64  This was inversly correlated with the proximity of bacterial interactions with the mucosa, as there was greater penetration of crypts of the ascending colon by commensal bacteria where mucus is relatively less viscous, and reduced bacterial interactions with the rectal mucosa, where Muc2-rich mucus is thought to be more viscous [186]. Mucus viscosity is thought to be regulated by anion and water exchange by adjacent epithelial cells [160]. Mice lacking the CFTR gene [160] and patients with cystic fibrosis [187] have an abudance of highly viscous mucous in the small bowel, which is correlated with small intestinal bacterial overgrowth in mice [188] and CF patients [189]. In mice, this mucusassoicated bacterial overgrowth was associated with enteric disease [188]; however, this has not been demonstrated in CF patients [190]. Thus, not only mucus production, and glycan compostion, but also viscosity affect the functional biology of Muc2 and the mucus layer. 1.3.5 The role of Muc2/mucus production in host defense in the intestine Ultimately the amount of energy put into mucus production, the chemical complexity of the resulting mucus layer, the elaborate regulatory elements all suggest production of Muc2 by goblet cells is of physiological importance. Indeed, in vivo data from Muc2deficient mice provide solid evidence to support this concept, with particular regard paid to maintaining homeostatic interactions with the luminal microbiota. However, whether this can be readily translatable to enteric pathogens is not well understood. Essentially the question is, if enteric pathogens are able to colonize the mucosa in the presence of mucus, what protective function if any, does mucus afford? As described below, prior to the studies described in this thesis, the evidence was largely correlative, with limited direct functional studies. 65  Evidence for a beneficial role of mucins in host defense There are numerous reports in the literature describing mucin responses from goblet cells in response to pathogenic bacteria; however, there are limited if any direct studies to demonstrate the biological significance of such responses. There is growing evidence that mucin family members, can provide host defense against enteric bacterial pathogens. For example, Muc1 (human, MUC1) is protective against Campylobacter jejuni by acting as a decoy molecule that binds C. jejuni, and then is subsequently shed from the epithelial membrane, ultimately decreasing the systemic dissemination of C. jejuni in mice [191]. Muc1 is thought to act in a similar fashion during Helicobacter pylori infection, reducing the degree to which H. pylori can infect the gastric mucosa [192]. In addition Muc1, a negative regulator of TLR signaling, can limit H. pylori-induced gastric inflammation [193]. Despite these protective functions, they cannot be direct evidence of a protective role of mucus production, since Muc1 is membrane bound and does not contribute to formation of the mucus gel [149].  Mucin secretion and glycosylation status have also  been implicated with host defense. L. monocytogenes toxin Listeriolysin O can stimulate mucin release and induce expression of surface mucins Muc4 and Muc12 from the mucin-producing HT-29MX intestinal epithelial cell line, which is thought to be a cellular response to protect against cell invasion by L. monocytogenes in a manner dependent upon mucin sialation [194].  Interestingly, mice lacking the 1,2  fucosyltransferase (FUT2), which is responsible for mucus fucosylation, are less susceptible to H. pylori infection [195]. Other direct evidence for a host defense role for secreted mucins is the production of an antibiotic secretory mucin that directly inhibits 66  cell wall synthesis of H. pylori [196].  In terms of pathogenic E. coli, such as  diarrheagenic E. coli, Lactobacillus can stimulate mucin expression from intestinal cells in culture, and this is correlated with decreased EPEC adherence [197]. However, whether other cell responses such as LL-37 production were also involved was not investigated. Lastly, purified rabbit intestinal mucin was shown to directly inhibit EPEC adherence to HEp-2 cells in a dose-dependent manner [198]. Evidence for a potentially maladaptive role of mucins in host defense While the above studies suggest a host defense function for mucins, there are many studies that question the contribution of mucins like Muc2 in host defense. In fact, many bacterial products can mimic the actions of host cytokines, raising the question as to what the contribution of these goblet cell responses are to the infection. For example, cholera toxin from Vibro cholerae can lead to compound exocytosis of mucus in cell lines [199], but whether this is beneficial for the host or bacteria is unclear. The protozoan parasite Entamoeba histolytica’s cysteine proteinase EP5 can cause compound exocytosis [200] and dissolve the mucus gel [153,201,202] presumably to gain access to the underlying epithelium, and this may be true also for V. cholerae. Campylobacter jejuni resides in mucus in chickens and does not typically cause disease, however it penetrates the mucus layer in humans suggesting mucus can control the pathogen invasion [203]. However, there is evidence that MUC2 alters the virulence of Campylobacter by directly inducing the expression of virulence genes [204].  Enteroaggregative E. coli (EAEC) can form  biofilms within mucus and seems to be associated with persistent infection [205]. Interestingly, in cystic fibrosis, the opportunistic pathogen Pseudomonas aeruginosa stimulates MUC2 expression in lung epithelial cells, and then forms biofilms in lung 67  mucus that is thought to correlate with persistent infection and mortality [206]. Furthermore, pathogenic bacteria can use mucins as binding sites. S. Typhimurium can bind to gel forming mucin with high affinity, which is thought to assist in its virulence [207]. Yersinia enterocolitica can also bind to secreted mucus [208]. In contrast to the protective role of Muc1 in H. pylori and Campylobacter infection, there is mounting evidence that Muc1 acts as a binding site for P.aeruginosa, which uses its flagellum as an adhesin [209].  Consistent with this, Muc1-deficient mice more rapidly cleared  P.aeruginosa [210]. These results suggest that although Muc1 limited inflammatory responses to both mucosal pathogens, its protective role is pathogen specific.  Lastly,  pathogenic bacteria, like commensal bacteria, can utilize mucins as an energy source [211]. This was demonstrated in vitro with Y. enterocolitica and purified secretory mucins, which also were efficiently broken down by this pathogen [211]. Interestingly, there is recent evidence that atypical EPEC strains can induce the expression and secretion of gel forming mucins MUC2 and MUC5AC, as well as expression of the cellsurface mucins MUC3 and MUC4 from HT-29 MX cells. This was not shown to inhibit binding of these pathogens to these cells, but rather promoted their growth [212]. Notably, typical EPEC did not induce these responses or undergo increased growth from these cells [212].  As discussed in chapter two, mucus therefore may not only be  subverted by pathogenic bacteria, but also may actually give pathogens an advantage by promoting their growth and increasing their virulence. Muc2/mucus production and A/E bacteria A/E bacteria provide an interesting case study. These pathogens infect the tissues, but their propensity to attach to the apical surface gives them a lumen-dwelling lifestyle, 68  constantly exposed to goblet cell derived products such as mucins.  Therefore, any  interaction and modification that occurs during infection, may impact on the pathogenesis of these pathogens. To date, surprisingly, although the mechanisms of cell attachment have been well defined, the mechanisms by which they migrate through the mucus and attach to epithelial cells are virtually unknown. In addition, how the virulence of this class of pathogens may be altered in the presence or absence of mucus is unexplored. 1.3.6 Trefoil factor 3 (TFF3) and its role in host protection The trefoil factor family Another important goblet cell-specific protein unrelated to MUC2 is Trefoil Factor 3 (TFF3; also known as intestinal trefoil factor, ITF). TFF3 belongs to a family of small secretory peptides that contain conserved cysteine residues involved in intrachain disulfide bonds, giving TFF members a uniquely folded three-looped trefoil (or P)domain that is resistant to proteases [213] (Figure 1.20A).  Other members of the TFF  family include TFF1 (aka pS2) and TFF2 (SP). These molecules are differentially expressed: Whereas TFF3 is mainly intestinal, TFF1 and TFF2 are expressed in the gastric epithelium, and TFF2 is also expressed in Brunner’s glands of the duodenum [145] . Role of TFF3 in host protection TFF3 is constitutively expressed by mature (terminally differentiated) goblet cells (i.e found in the upper third of intestinal crypts [214] (Figure 1.20B). The primary function of TFF3 to date is to promote epithelial restitution following mucosal injury by acting as a motogen (i.e. promotes cell migration but not cell division) [145,215] (Figure 1.20C). 69  This was demonstrated by studies looking at the rates of cell migration in vitro wounding assays in response to recombinant TFF3. A key in vivo study gave support to this function for TFF3, where TFF3-deficient mice failed to restore the epithelial barrier over ulcerated regions after DSS treatment, and suffered lethal ulcerative colitis as a result. TFF3 also interacts with intestinal mucins [216] and mucin-binding proteins like Fcgbp [217]. The functional significance of this binding is unclear, although the Tff3:mucus interactions are thought to enhance the ability of the the mucus layer to protect against epithelial barrier disruption caused by noxious stimuli (e.g. toxin A from C. difficile) [218].  Some additional studies have suggested TFF3 promotes cell survival by  upregulating antiapoptotic factors, which is hypothesized to be important for inhibiting anoikis induced by the transient separation from neighboring epithelial cells during the mobility process of restitution [219,220].  A recent study has shown an important role  for TFF3 in TLR2-mediated protection from injury through DSS. Here, TFF3 production was under TLR2 and MyD88 control, and promoted barrier function by inhibiting epithelial apoptosis [98]. Collectively, through these actions, TFF3 is thought to enhance the epithelial barrier by promoting rapid migration of colonocytes over wournds, increasing cell survival and boosting the protective barrier capacity of mucus. Despite these important findings, the role of TFF3 during enteric bacterial infections has not been addressed. Indeed, prior to the studies presented in this thesis, it was not known how TFF3 expression by goblet cells is altered during enteric infections in vivo, including those caused by A/E bacteria. Since TFF3 is secreted abundantly, it would likely play a defensive role in enteric bacterial infections by enhancing barrier function and promoting  70  healing of infection-induced intestinal lesions. However, it is also possible that TFF3 may have antimicrobial activity, although this has not been tested.  Figure 1.20 Structure and function of TFF3. A. Tertiary structure of TFF3, showing the disulfide bonds between cysteine residues (yellow) that give rise to the trefoil domain. Image reproduced from ref. [156]. B. Immunolocalization of Tff3 withn goblet cells of the mouse descending colon. Tff3 is mainly found in the upper half of crypts in terminally differentiated goblet cells. Original magnificaton, 200X. C. The process of epithelial restitution during wound healing. TFF3 is thought to act as a motogen to promote migration of cells over a site of injury to restore the epithelial barrier. Image modified from ref. [145].  71  1.3.7 Resistin-like molecule-{beta} (RELM) and its role in host defense Structure of RELM proteins RELM/FIZZ2 (Resistin-Like Molecule beta/Found in Inflammatory Zone 2) belongs to a recently characterized family of proteins called Resistin-Like Molecules, which are characterized by 9 conserved cysteine residues in its C-terminal region involved in specific disulphide bonds that confer a unique jellyroll globular head domain [221] (Figure 1.21A). There are four known members of this family, including RELM, RELM and RELM and the founding member resistin. RELM family members have to date not been found in invertebrates (e.g. Caenorhabditis elegans or Drosophila melanogaster) suggesting these genes may primarily be represented in more advanced organisms [222].  In humans there are orthologues to RELM and Resistin, but not  RELM and RELM [223]. However, Relm- is more closely homologous in sequence to human resistin [223]. RELM proteins are synthesized as 7 kDa protomers, which trimerize to form a functional monomer [221].  However, only RELM and resistin  contain an additional cysteine residue in the N-termunius which mediates tail-to-tail dimerization of the trimer units to ultimately form a hexameric trimer-dimer [221]. The functional significance of this dimerization is that the hexameric form has differential biological activity than the monomeric form and so cleavage of the N-terminal disuslphide bond may be a regulatory event in the function of these molecules [221].  72  Figure 1.21 Structure of RELM. A. RELM is synthesized as a protomer, forms a trimer, and then can form a hexameric trimer-dimer though disulfide bonds between cysteine residues located at the C-termini. Image modified from ref. [221]. B. Immunolocalization of RELM within goblet cells of the mouse descending colon. RELM is found predominantly in the upper 2/3 of the crypts but can also be found expressed in goblet cells at the base of crypts, albeit to a lesser extent. Original magnifcation, 200X.  Biological function of RELM family molecules The expression and biological function of some of the RELM family of molecules appears to be in part species-specific. Resistin in rodents was found to to be expressed highly by adipocytes in white adipose tissue, and was originally shown to disrupt glucose homeostasis and reduce insulin sensitivity, and therefore was postulated to be a link between obesity and diabetes [224].  However in humans, resistin was found to be  expressed primarily by hematopoietic cells such as monocytes and macrophages, with very little expression in adipocytes [225], and its major function appears to be proinflammatory [226]. RELM was similarly shown to be expressed under baseline conditions in the white adipose tissue, but also in the lung, tongue, mammary glands, and  73  near neuronal tissue in the colonic submuocsa [222,227]. Its function in this regard is unclear, as RELM-deficient mice physiological defects [228].  have not been reported to exhibit any obvious  However, under challenge with parasites, it is highly  induced in the lung of wildtype mice, where it is expressed predominantly by hematopoietic cells such as alternatively activated macrophages [228]. Here it plays a role in limiting Th2 type inflammatory responses [228,229], in part by directly acting on CD4+ Th2 cells to inhibit the production of Th2 cytokines such as IL-4, and IL-5 in a manner dependent on BTK (Bruton’s Tyrosine Kinase) signaling [228]. Little is known of RELM, but its expression is similarly broad to that of RELM although somewhat different, being found in the bone marrow, spleen, lung, and to a lesser extent in the liver [222,227].  It is induced in the gut during parasite infection, although its function is  unknown [230]. Expression of RELM in mice and humans In contrast to the other RELM family members, the expression of RELM in humans and mice under physiologic conditions is highly restricted to the intestinal tract, with highest expression in the colon [222] although this may be highly region-specific (that is expressed highly in some regions of the colon, but weakly in others) [227]. In situ hybridization studies have found murine RELM to be specifically expressed in the proliferative compartment of colonic crypts [222,227], whereas immunhistochemistry in mice has localized RELM specifically to goblet cells (Figure 1.21B) [231]. In humans, this baseline expression has been further confirmed by western-blotting of stool contents  74  [231]. These findings suggest that RELM may be playing similar roles in humans and mice, increasing the relevance of understanding the function of this molecule in vivo. Protective and pathological functions of RELM during mucosal challenge Similar to other RELM family members, studies are pointing to the different roles of RELM in diverse mucosal challenges. During allergen-induced challenge of the lung, RELM is highly induced in the lung epithelium in mice, where it has been shown to play a role in airway remodeling and fibrosis [232].  In humans with pulmonary  hypertension, RELM expression appears to be upregulated in the endothelium [233], although its function is not clear. In the intestinal tract in mice, RELM is upregulated by goblet cells during DSS-induced colitis where it has been demonstrated to have a proinflammatory function by stimulating TNF production by macrophages and exacerbating  inflammatory  damage  [234].  Other  studies  have  suggested  an  immunomodulatory function by upregulationg MHC class II and IL-12 expression in macrophages to enhance their ability to promote IFN prodction by CD4+ T cells [235]. Importantly, RELM has also been directly implicated in host defenses in the intestinal tract. Artis et al. (2004) demonstrated that during parasitic helminth infections, goblet cells selectively produced RELM in a Th2 response-driven manner, through IL-13mediated signaling [146], which was confirmed in a recent study [236]. Here, the role of RELM in host defense was pathogen specific, as Trichuris muris, and Trichonella spiralis were less pathogenic in RELM-deficient mice compared to WT mice [235]; whereas RELM-deficient mice were more susceptible to incresed worm burden by Nippostrongylus brasiliensis and Heligmosomoides polygyrus [236].  75  The current  evidence suggests that  RELM directly antagonizes these parasite infections by  interfering with nematode chemosensory apparatus [146], metabolism, and fecundity [236].  Collectively, these studies reveal RELM to be an important component of host  defense in the intestinal tract. RELM and host-bacterial interactions Interestingly, the early studies of RELM have suggested a role in host-bacterial interactions.  Germ-free mice have minimal expression of RELM by goblet cells;  however, after introducton of commensal bacteria, there is robust expression and production of RELM at the mRNA and protein levels [231]. The function of RELM in this regard is still undetermined, but recent studies have suggested that it may be involved in the modulation of the the compostion of the microflora, as RELM-deficient mice have a different microbiome profile based on 454 DNA pyrosequencing [237]. RELM has been implicated in host defense against bacteria indirectly, as its expression in the small intestine is MyD88- dependent [103] and RELM-deficient mice have reduced expression of the microbicidal C-type lectin RegIII [238], which has been implicated in protection against C. rodentium [123], and other bacterial pathogens [239]. Remarkably, the role of RELM in host defense against enteric bacterial pathogens has not been directly explored. The luminal secretory role of RELM may be particularly important to lumen-dwelling pathogens such as A/E bacteria that are in direct contact with goblet cells and their secretory products.  76  1.4 GENERAL HYPOTHESIS Goblet cells have long been thought of as key players in innate defenses to enteric pathogens via their role in production of the mucus barrier. However, there have been no formal demonstrations of the role of goblet cells in host defense in vivo. Based on the location of goblet cells, their secretory function, and evidence for a direct role in host defense against diverse enteric pathogens, my general hypothesis is that colonic goblet cells actively contribute to host defense and innate immunity against C. rodentium and EPEC through the release of mucins, and RELM. The major objective of this thesis is not only to test this hypotheisis through the use of the C. rodentium model, but to clarify how these important cell types respond to infection, and what these responses signify in terms of the initiation, control, and resolution of disease caused by a relevant enteric bacterial pathogen.  77  1.5 LITERATURE CITED 1. Liu CH, Lee SM, Vanlare JM, Kasper DL, Mazmanian SK (2008) Regulation of surface architecture by symbiotic bacteria mediates host colonization. Proc Natl Acad Sci U S A 105: 3951-3956. 2. Horie M, Honda T, Suzuki Y, Kobayashi Y, Daito T, et al. Endogenous non-retroviral RNA virus elements in mammalian genomes. Nature 463: 84-87. 3. Walden WE (2002) From bacteria to mitochondria: aconitase yields surprises. Proc Natl Acad Sci U S A 99: 4138-4140. 4. Xu J, Gordon JI (2003) Inaugural Article: Honor thy symbionts. Proc Natl Acad Sci U S A 100: 10452-10459. 5. Hooper LV (2009) Do symbiotic bacteria subvert host immunity? Nat Rev Microbiol 7: 367-374. 6. Artis D (2008) Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat Rev Immunol 8: 411-420. 7. O'Hara AM, Shanahan F (2006) The gut flora as a forgotten organ. EMBO Rep 7: 688693. 8. Duerkop BA, Vaishnava S, Hooper LV (2009) Immune responses to the microbiota at the intestinal mucosal surface. Immunity 31: 368-376. 9. Kaper JB, Nataro JP, Mobley HLT (2004) Pathogenic Escherichia coli. Nat Rev Micro 2: 123-140. 10. Swidsinski A, Loening-Baucke V, Theissig F, Engelhardt H, Bengmark S, et al. (2007) Comparative study of the intestinal mucus barrier in normal and inflamed colon. Gut 56: 343-350. 11. Croxen MA, Finlay BB Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol 8: 26-38. 12. PÈdron T, Sansonetti P (2008) Commensals, Bacterial Pathogens and Intestinal Inflammation: An Intriguing MÈnage ‡ Trois. Cell Host & Microbe 3: 344-347. 13. Nataro JP, Kaper JB (1998) Diarrheagenic Escherichia coli. Clin Microbiol Rev 11: 142-201. 14. Wales AD, Woodward MJ, Pearson GR (2005) Attaching-effacing bacteria in animals. J Comp Pathol 132: 1-26. 15. Wales AD, Pearson GR, Best A, Cookson AL, La Ragione RM, et al. (2005) Naturally acquired attaching and effacing Escherichia coli in sheep. Res Vet Sci 78: 109-115. 16. Knutton S (2004) Attaching and effacing lesions. Journal of Medical Microbiology 53: cover image. 17. Nataro JP (2006) Atypical enteropathogenic Escherichia coli: typical pathogens? Emerg Infect Dis 12: 696. 18. Trabulsi LR, Keller R, Tardelli Gomes TA (2002) Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8: 508-513. 19. Hernandes RT, Elias WP, Vieira MA, Gomes TA (2009) An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett 297: 137-149. 20. Cleary J, Lai L-C, Shaw RK, Straatman-Iwanowska A, Donnenberg MS, et al. (2004) Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal epithelial cells: 78  role of bundle-forming pili (BFP), EspA filaments and intimin. Microbiology 150: 527-538. 21. Gomes TA, Blake PA, Trabulsi LR (1989) Prevalence of Escherichia coli strains with localized, diffuse, and aggregative adherence to HeLa cells in infants with diarrhea and matched controls. J Clin Microbiol 27: 266-269. 22. Vidal JE, Canizalez-Roman A, Gutierrez-Jimenez J, Navarro-Garcia F (2007) [Molecular pathogenesis, epidemiology and diagnosis of enteropathogenic Escherichia coli]. Salud Publica Mex 49: 376-386. 23. Donnenberg MS, Kaper JB (1992) Enteropathogenic Escherichia coli. Infect Immun 60: 3953-3961. 24. Hayward RD, Leong JM, Koronakis V, Campellone KG (2006) Exploiting pathogenic Escherichia coli to model transmembrane receptor signalling. Nat Rev Micro 4: 358-370. 25. Vallance BA, Finlay BB (2000) Exploitation of host cells by enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A 97: 8799-8806. 26. Kenny B, DeVinney R, Stein M, Reinscheid DJ, Frey EA, et al. (1997) Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91: 511-520. 27. O'Conner THDR (2002) Report of the Walkerton Inquiry: The Events of May 2000 and Related Issues. Part One: A Summary. 28. Marshall JK (2009) Post-infectious irritable bowel syndrome following water contamination. Kidney Int Suppl: S42-43. 29. Marshall JK, Thabane M, Garg AX, Clark WF, Moayyedi P, et al. Eight year prognosis of postinfectious irritable bowel syndrome following waterborne bacterial dysentery. Gut 59: 605-611. 30. Yoon JW, Hovde CJ (2008) All blood, no stool: enterohemorrhagic Escherichia coli O157:H7 infection. J Vet Sci 9: 219-231. 31. Scheiring J, Rosales A, Zimmerhackl L Clinical practice. European Journal of Pediatrics 169: 7-13. 32. Tarr PI, Gordon CA, Chandler WL (2005) Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365: 1073-1086. 33. Shigeno T, Akamatsu T, Fujimori K, Nakatsuji Y, Nagata A (2002) The clinical significance of colonoscopy in hemorrhagic colitis due to enterohemorrhagic Escherichia coli O157:H7 infection. Endoscopy 34: 311-314. 34. Xicohtencatl-Cortes J, Monteiro-Neto Vr, Ledesma MA, Jordan DM, Francetic O, et al. (2007) Intestinal adherence associated with type IV pili of enterohemorrhagic Escherichia coli O157:H7. The Journal of Clinical Investigation 117: 3519-3529. 35. DeVinney R, Puente JL, Gauthier A, Goosney D, Finlay BB (2001) Enterohaemorrhagic and enteropathogenic Escherichia coli use a different Tirbased mechanism for pedestal formation. Molecular Microbiology 41: 1445-1458. 36. DeVinney R, Stein M, Reinscheid D, Abe A, Ruschkowski S, et al. (1999) Enterohemorrhagic Escherichia coli O157:H7 produces Tir, which is translocated to the host cell membrane but is not tyrosine phosphorylated. Infect Immun 67: 2389-2398.  79  37. Sinclair JF, O'Brien AD (2002) Cell surface-localized nucleolin is a eukaryotic receptor for the adhesin intimin-gamma of enterohemorrhagic Escherichia coli O157:H7. J Biol Chem 277: 2876-2885. 38. Karmali MA (2004) Infection by Shiga toxin-producing Escherichia coli: an overview. Mol Biotechnol 26: 117-122. 39. Johannes L, Romer W Shiga toxins--from cell biology to biomedical applications. Nat Rev Microbiol 8: 105-116. 40. Paton JC, Paton AW Shiga toxin /`goes retro/' in human primary kidney cells. Kidney Int 70: 2049-2051. 41. Mundy R, Girard F, FitzGerald AJ, Frankel G (2006) Comparison of colonization dynamics and pathology of mice infected with enteropathogenic Escherichia coli, enterohaemorrhagic E. coli and Citrobacter rodentium. FEMS Microbiol Lett 265: 126-132. 42. Karaolis DK, McDaniel TK, Kaper JB, Boedeker EC (1997) Cloning of the RDEC-1 locus of enterocyte effacement (LEE) and functional analysis of the phenotype on HEp-2 cells. Adv Exp Med Biol 412: 241-245. 43. Mundy R, MacDonald TT, Dougan G, Frankel G, Wiles S (2005) Citrobacter rodentium of mice and man. Cell Microbiol 7: 1697-1706. 44. Luperchio SA, Newman JV, Dangler CA, Schrenzel MD, Brenner DJ, et al. (2000) Citrobacter rodentium, the causative agent of transmissible murine colonic hyperplasia, exhibits clonality: synonymy of C. rodentium and mouse-pathogenic Escherichia coli. J Clin Microbiol 38: 4343-4350. 45. Luperchio SA, Schauer DB (2001) Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect 3: 333-340. 46. Petty NK, Bulgin R, Crepin VF, Cerdeno-Tarraga AM, Schroeder GN, et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol 192: 525-538. 47. Schauer DB, Falkow S (1993) Attaching and effacing locus of a Citrobacter freundii biotype that causes transmissible murine colonic hyperplasia. Infect Immun 61: 2486-2492. 48. Deng W, Li Y, Vallance BA, Finlay BB (2001) Locus of Enterocyte Effacement from Citrobacter rodentium: Sequence Analysis and Evidence for Horizontal Transfer among Attaching and Effacing Pathogens. Infect Immun 69: 6323-6335. 49. Ma C, Wickham ME, Guttman JA, Deng W, Walker J, et al. (2006) <i>Citrobacter rodentium</i> infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption <i>in vivo</i>: role of mitochondrial associated protein (Map). Cellular Microbiology 8: 1669-1686. 50. Wiles S, Pickard KM, Peng K, MacDonald TT, Frankel G (2006) In Vivo Bioluminescence Imaging of the Murine Pathogen Citrobacter rodentium. Infect Immun 74: 5391-5396. 51. Lebeis SL, Bommarius B, Parkos CA, Sherman MA, Kalman D (2007) TLR signaling mediated by MyD88 is required for a protective innate immune response by neutrophils to Citrobacter rodentium. J Immunol 179: 566-577. 52. Gibson DL, Ma C, Bergstrom KS, Huang JT, Man C, et al. (2008) MyD88 signalling plays a critical role in host defence by controlling pathogen burden and promoting  80  epithelial cell homeostasis during Citrobacter rodentium-induced colitis. Cell Microbiol 10: 618-631. 53. Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, et al. (2009) Differential Roles of Interleukin-17A and -17F in Host Defense against Mucoepithelial Bacterial Infection and Allergic Responses. Immunity 30: 108-119. 54. Bry L, Brigl M, Brenner MB (2006) CD4+-T-Cell Effector Functions and Costimulatory Requirements Essential for Surviving Mucosal Infection with Citrobacter rodentium. Infect Immun 74: 673-681. 55. Bry L, Brenner MB (2004) Critical Role of T Cell-Dependent Serum Antibody, but Not the Gut-Associated Lymphoid Tissue, for Surviving Acute Mucosal Infection with Citrobacter rodentium, an Attaching and Effacing Pathogen. J Immunol 172: 433-441. 56. Borenshtein D, McBee ME, Schauer DB (2008) Utility of the Citrobacter rodentium infection model in laboratory mice. Curr Opin Gastroenterol 24: 32-37. 57. Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, et al. (2006) Transforming growth factor-[beta] induces development of the TH17 lineage. Nature 441: 231-234. 58. Lupp C, Robertson ML, Wickham ME, Sekirov I, Champion OL, et al. (2007) Hostmediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2: 204. 59. Ivanov, II, Atarashi K, Manel N, Brodie EL, Shima T, et al. (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485-498. 60. Vallance BA, Deng W, Jacobson K, Finlay BB (2003) Host susceptibility to the attaching and effacing bacterial pathogen Citrobacter rodentium. Infect Immun 71: 3443-3453. 61. Wlodarska M, Finlay BB Host immune response to antibiotic perturbation of the microbiota. Mucosal Immunol 3: 100-103. 62. Sherman MA, Kalman D (2004) Initiation and resolution of mucosal inflammation. Immunol Res 29: 241-252. 63. Schuller S, Phillips AD Microaerobic conditions enhance type III secretion and adherence of enterohaemorrhagic Escherichia coli to polarized human intestinal epithelial cells. Environ Microbiol. 64. Marteyn B, West NP, Browning DF, Cole JA, Shaw JG, et al. Modulation of Shigella virulence in response to available oxygen in vivo. Nature 465: 355-358. 65. Yu XJ, McGourty K, Liu M, Unsworth KE, Holden DW pH sensing by intracellular Salmonella induces effector translocation. Science 328: 1040-1043. 66. Ouellette AJ (1997) Paneth cells and innate immunity in the crypt microenvironment. Gastroenterology 113: 1779-1784. 67. Salzman NH, Hung K, Haribhai D, Chu H, Karlsson-Sjoberg J, et al. Enteric defensins are essential regulators of intestinal microbial ecology. Nat Immunol 11: 76-82. 68. Ganz T (2000) Paneth cells--guardians of the gut cell hatchery. Nat Immunol 1: 99100. 69. Dharmani P, Srivastava V, Kissoon-Singh V, Chadee K (2009) Role of intestinal mucins in innate host defense mechanisms against pathogens. J Innate Immun 1: 123-135. 81  70. Artis D, Grencis RK (2008) The intestinal epithelium: sensors to effectors in nematode infection. Mucosal Immunol 1: 252-264. 71. Karam SM (1999) Lineage commitment and maturation of epithelial cells in the gut. Front Biosci 4: D286-298. 72. Barker N, van de Wetering M, Clevers H (2008) The intestinal stem cell. Genes Dev 22: 1856-1864. 73. Yen TH, Wright NA (2006) The gastrointestinal tract stem cell niche. Stem Cell Rev 2: 203-212. 74. van der Flier LG, Clevers H (2009) Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu Rev Physiol 71: 241-260. 75. Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, et al. (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449: 1003-1007. 76. Barker N, Clevers H Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells. Gastroenterology 138: 1681-1696. 77. Shen L (2009) Functional morphology of the gastrointestinal tract. Curr Top Microbiol Immunol 337: 1-35. 78. Colarado Uo (2007) Diagram of human large intestine. Pearson Education Inc. Publishing as Bejamin Cummings. 79. Willis ND, Przyborski SA, Hutchison CJ, Wilson RG (2008) Colonic and colorectal cancer stem cells: progress in the search for putative biomarkers. J Anat 213: 5965. 80. Specian RD, Oliver MG (1991) Functional biology of intestinal goblet cells. Am J Physiol 260: C183-193. 81. Pinto D, Clevers H (2005) Wnt control of stem cells and differentiation in the intestinal epithelium. Exp Cell Res 306: 357-363. 82. Bray SJ (2006) Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 7: 678-689. 83. van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, et al. (2005) Notch/[gamma]-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435: 959-963. 84. Nakamura T, Tsuchiya K, Watanabe M (2007) Crosstalk between Wnt and Notch signaling in intestinal epithelial cell fate decision. J Gastroenterol 42: 705-710. 85. Fre S, Pallavi SK, Huyghe M, Lae M, Janssen KP, et al. (2009) Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc Natl Acad Sci U S A 106: 6309-6314. 86. Fre S, Huyghe M, Mourikis P, Robine S, Louvard D, et al. (2005) Notch signals control the fate of immature progenitor cells in the intestine. Nature 435: 964-968. 87. Suzuki K, Fukui H, Kayahara T, Sawada M, Seno H, et al. (2005) Hes1-deficient mice show precocious differentiation of Paneth cells in the small intestine. Biochemical and Biophysical Research Communications 328: 348-352. 88. Milano J, McKay J, Dagenais C, Foster-Brown L, Pognan F, et al. (2004) Modulation of notch processing by gamma-secretase inhibitors causes intestinal goblet cell metaplasia and induction of genes known to specify gut secretory lineage differentiation. Toxicol Sci 82: 341-358.  82  89. Yang Q, Bermingham NA, Finegold MJ, Zoghbi HY (2001) Requirement of Math1 for Secretory Cell Lineage Commitment in the Mouse Intestine. Science 294: 2155-2158. 90. Gregorieff A, Stange DE, Kujala P, Begthel H, van den Born M, et al. (2009) The etsdomain transcription factor Spdef promotes maturation of goblet and paneth cells in the intestinal epithelium. Gastroenterology 137: 1333-1345 e1331-1333. 91. van den Brink GR, Bleuming SA, Hardwick JCH, Schepman BL, Offerhaus GJ, et al. (2004) Indian Hedgehog is an antagonist of Wnt signaling in colonic epithelial cell differentiation. Nat Genet 36: 277-282. 92. Marchiando AM, Graham WV, Turner JR Epithelial barriers in homeostasis and disease. Annu Rev Pathol 5: 119-144. 93. Kawai T, Akira S The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11: 373-384. 94. Takeuchi O, Akira S Pattern Recognition Receptors and Inflammation. Cell 140: 805820. 95. Turner JR (2009) Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 9: 799-809. 96. Shen L, Su L, Turner JR (2009) Mechanisms and functional implications of intestinal barrier defects. Dig Dis 27: 443-449. 97. Schulzke JD, Ploeger S, Amasheh M, Fromm A, Zeissig S, et al. (2009) Epithelial Tight Junctions in Intestinal Inflammation. Annals of the New York Academy of Sciences 1165: 294-300. 98. Podolsky DK, Gerken G, Eyking A, Cario E (2009) Colitis-associated variant of TLR2 causes impaired mucosal repair because of TFF3 deficiency. Gastroenterology 137: 209-220. 99. Lievin-Le Moal V, Servin AL (2006) The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota. Clin Microbiol Rev 19: 315-337. 100. Deplancke B, Gaskins HR (2001) Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am J Clin Nutr 73: 1131S-1141S. 101. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R (2004) Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118: 229-241. 102. Nenci A, Becker C, Wullaert A, Gareus R, van Loo G, et al. (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446: 557-561. 103. Vaishnava S, Behrendt CL, Ismail AS, Eckmann L, Hooper LV (2008) Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal hostmicrobial interface. Proc Natl Acad Sci U S A 105: 20858-20863. 104. Voss E, Wehkamp J, Wehkamp K, Stange EF, Schroder JM, et al. (2006) NOD2/CARD15 mediates induction of the antimicrobial peptide human betadefensin-2. J Biol Chem 281: 2005-2011. 105. Wehkamp J, Harder J, Weichenthal M, Schwab M, Schaffeler E, et al. (2004) NOD2 (CARD15) mutations in Crohn's disease are associated with diminished mucosal alpha-defensin expression. Gut 53: 1658-1664.  83  106. Kobayashi KS, Chamaillard M, Ogura Y, Henegariu O, Inohara N, et al. (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307: 731-734. 107. Petnicki-Ocwieja T, Hrncir T, Liu YJ, Biswas A, Hudcovic T, et al. (2009) Nod2 is required for the regulation of commensal microbiota in the intestine. Proc Natl Acad Sci U S A 106: 15813-15818. 108. Meyer-Hoffert U, Hornef MW, Henriques-Normark B, Axelsson LG, Midtvedt T, et al. (2008) Secreted enteric antimicrobial activity localises to the mucus surface layer. Gut 57: 764-771. 109. Freitas M, Axelsson LG, Cayuela C, Midtvedt T, Trugnan G (2002) Microbial-host interactions specifically control the glycosylation pattern in intestinal mouse mucosa. Histochem Cell Biol 118: 149-161. 110. Brandl K, Plitas G, Schnabl B, DeMatteo RP, Pamer EG (2007) MyD88-mediated signals induce the bactericidal lectin RegIII gamma and protect mice against intestinal Listeria monocytogenes infection. J Exp Med 204: 1891-1900. 111. Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, et al. (2008) IL-22 mediates mucosal host defense against Gram-negative bacterial pneumonia. Nat Med 14: 275-281. 112. Wilson CL, Ouellette AJ, Satchell DP, Ayabe T, Lopez-Boado YS, et al. (1999) Regulation of intestinal alpha-defensin activation by the metalloproteinase matrilysin in innate host defense. Science 286: 113-117. 113. Maresca M, Miller D, Quitard S, Dean P, Kenny B (2005) Enteropathogenic Escherichia coli (EPEC) effector-mediated suppression of antimicrobial nitric oxide production in a small intestinal epithelial model system. Cellular Microbiology 7: 1749-1762. 114. Hase K, Eckmann L, Leopard JD, Varki N, Kagnoff MF (2002) Cell differentiation is a key determinant of cathelicidin LL-37/human cationic antimicrobial protein 18 expression by human colon epithelium. Infect Immun 70: 953-963. 115. Iimura M, Gallo RL, Hase K, Miyamoto Y, Eckmann L, et al. (2005) Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J Immunol 174: 4901-4907. 116. Vallance BA, Deng W, De Grado M, Chan C, Jacobson K, et al. (2002) Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen citrobacter rodentium in infected mice. Infect Immun 70: 6424-6435. 117. Kaser A, Lee AH, Franke A, Glickman JN, Zeissig S, et al. (2008) XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell 134: 743-756. 118. Kelekar A (2005) Autophagy. Ann N Y Acad Sci 1066: 259-271. 119. Kuballa P, Huett A, Rioux JD, Daly MJ, Xavier RJ (2008) Impaired autophagy of an intracellular pathogen induced by a Crohn's disease associated ATG16L1 variant. PLoS One 3: e3391. 120. Cadwell K, Liu JY, Brown SL, Miyoshi H, Loh J, et al. (2008) A key role for autophagy and the autophagy gene Atg16l1 in mouse and human intestinal Paneth cells. Nature 456: 259-263.  84  121. Kim M, Ashida H, Ogawa M, Yoshikawa Y, Mimuro H, et al. Bacterial Interactions with the Host Epithelium. 8: 20-35. 122. Cliffe LJ, Humphreys NE, Lane TE, Potten CS, Booth C, et al. (2005) Accelerated intestinal epithelial cell turnover: a new mechanism of parasite expulsion. Science 308: 1463-1465. 123. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, et al. (2008) Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 14: 282-289. 124. Simmons CP, Goncalves NS, Ghaem-Maghami M, Bajaj-Elliott M, Clare S, et al. (2002) Impaired Resistance and Enhanced Pathology During Infection with a Noninvasive, Attaching-Effacing Enteric Bacterial Pathogen, Citrobacter rodentium, in Mice Lacking IL-12 or IFN-{gamma}. J Immunol 168: 1804-1812. 125. Leonard EJ, Yoshimura T (1990) Neutrophil attractant/activation protein-1 (NAP-1 [interleukin-8]). Am J Respir Cell Mol Biol 2: 479-486. 126. Zaph C, Troy AE, Taylor BC, Berman-Booty LD, Guild KJ, et al. (2007) Epithelialcell-intrinsic IKK-beta expression regulates intestinal immune homeostasis. Nature 446: 552-556. 127. Rimoldi M, Chieppa M, Salucci V, Avogadri F, Sonzogni A, et al. (2005) Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat Immunol 6: 507-514. 128. Swamy M, Jamora C, Havran W, Hayday A Epithelial decision makers: in search of the 'epimmunome'. Nat Immunol 11: 656-665. 129. He B, Xu W, Santini PA, Polydorides AD, Chiu A, et al. (2007) Intestinal bacteria trigger T cell-independent immunoglobulin A(2) class switching by inducing epithelial-cell secretion of the cytokine APRIL. Immunity 26: 812-826. 130. Xu W, He B, Chiu A, Chadburn A, Shan M, et al. (2007) Epithelial cells trigger frontline immunoglobulin class switching through a pathway regulated by the inhibitor SLPI. Nat Immunol 8: 294-303. 131. Valdez Y, Ferreira RB, Finlay BB (2009) Molecular mechanisms of Salmonella virulence and host resistance. Curr Top Microbiol Immunol 337: 93-127. 132. Pizarro-Cerdá J, Cossart P (2006) Subversion of cellular functions by Listeria monocytogenes. The Journal of Pathology 208: 215-223. 133. Arbibe L, Kim DW, Batsche E, Pedron T, Mateescu B, et al. (2007) An injected bacterial effector targets chromatin access for transcription factor NF-[kappa]B to alter transcription of host genes involved in immune responses. Nat Immunol 8: 47-56. 134. Bhavsar AP, Guttman JA, Finlay BB (2007) Manipulation of host-cell pathways by bacterial pathogens. Nature 449: 827-834. 135. Nougayrède JP, Donnenberg MS (2004) Enteropathogenic Escherichia coli EspF is targeted to mitochondria and is required to initiate the mitochondrial death pathway. Cellular Microbiology 6: 1097-1111. 136. Dean P, Maresca M, Schuller S, Phillips AD, Kenny B (2006) Potent diarrheagenic mechanism mediated by the cooperative action of three enteropathogenic Escherichia coli-injected effector proteins. Proc Natl Acad Sci U S A 103: 18761881.  85  137. Guttman JA, Li Y, Wickham ME, Deng W, Vogl AW, et al. (2006) Attaching and effacing pathogen-induced tight junction disruption <i>in vivo</i>. Cellular Microbiology 8: 634-645. 138. Marches O, Ledger TN, Boury M, Ohara M, Tu X, et al. (2003) Enteropathogenic and enterohaemorrhagic Escherichia coli deliver a novel effector called Cif, which blocks cell cycle G2/M transition. Mol Microbiol 50: 1553-1567. 139. Samba-Louaka A, Nougayrede JP, Watrin C, Oswald E, Taieb F (2009) The enteropathogenic Escherichia coli effector Cif induces delayed apoptosis in epithelial cells. Infect Immun 77: 5471-5477. 140. Shames SR, Deng W, Guttman JA, de Hoog CL, Li Y, et al. The pathogenic E. coli type III effector EspZ interacts with host CD98 and facilitates host cell prosurvival signalling. Cell Microbiol 12: 1322-1339. 141. Kenny B, Ellis S, Leard AD, Warawa J, Mellor H, et al. (2002) Co-ordinate regulation of distinct host cell signalling pathways by multifunctional enteropathogenic Escherichia coli effector molecules. Mol Microbiol 44: 10951107. 142. Khan MA, Bouzari S, Ma C, Rosenberger CM, Bergstrom KS, et al. (2008) Flagellin-dependent and -independent inflammatory responses following infection by enteropathogenic Escherichia coli and Citrobacter rodentium. Infect Immun 76: 1410-1422. 143. Chakraborty K, Ghosh S, Koley H, Mukhopadhyay AK, Ramamurthy T, et al. (2008) Bacterial exotoxins downregulate cathelicidin (hCAP-18/LL-37) and human -defensin 1 (HBD-1) expression in the intestinal epithelial cells. Cellular Microbiology 10: 2520-2537. 144. Willis DG Normal human colon mucosal crypts lined by simple columnar epithelium with mucin secreting goblet cells. Visuals Unlimited, Inc. 145. Taupin D, Podolsky DK (2003) Trefoil factors: initiators of mucosal healing. Nat Rev Mol Cell Biol 4: 721-732. 146. Artis D, Wang ML, Keilbaugh SA, He W, Brenes M, et al. (2004) RELMbeta/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract. Proc Natl Acad Sci U S A 101: 13596-13600. 147. Allen A, Hutton DA, Pearson JP (1998) The MUC2 gene product: a human intestinal mucin. The International Journal of Biochemistry & Cell Biology 30: 797-801. 148. van Klinken BJ, Einerhand AW, Duits LA, Makkink MK, Tytgat KM, et al. (1999) Gastrointestinal expression and partial cDNA cloning of murine Muc2. Am J Physiol 276: G115-124. 149. Linden SK, Sutton P, Karlsson NG, Korolik V, McGuckin MA (2008) Mucins in the mucosal barrier to infection. Mucosal Immunol 1: 183-197. 150. Escande F, Porchet N, Bernigaud A, Petitprez D, Aubert J-P, et al. (2004) The mouse secreted gel-forming mucin gene cluster. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1676: 240-250. 151. Tytgat KM, Buller HA, Opdam FJ, Kim YS, Einerhand AW, et al. (1994) Biosynthesis of human colonic mucin: Muc2 is the prominent secretory mucin. Gastroenterology 107: 1352-1363.  86  152. Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L, et al. (2008) The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci U S A 105: 15064-15069. 153. Moncada D, Keller K, Chadee K (2003) Entamoeba histolytica cysteine proteinases disrupt the polymeric structure of colonic mucin and alter its protective function. Infect Immun 71: 838-844. 154. Johansson ME, Holmen Larsson JM, Hansson GC Microbes and Health Sackler Colloquium: The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions. Proc Natl Acad Sci U S A. 155. Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, et al. (2002) Colorectal cancer in mice genetically deficient in the mucin Muc2. Science 295: 1726-1729. 156. Shirazi T, Longman RJ, Corfield AP, Probert CS (2000) Mucins and inflammatory bowel disease. Postgrad Med J 76: 473-478. 157. Brockhausen I SH, Stanley P. (2009) O-GalNAc Glycans. In: Varki A CR, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler ME, editor. Essentials of Glycobiology 2nd edition. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. 158. An G, Wei B, Xia B, McDaniel JM, Ju T, et al. (2007) Increased susceptibility to colitis and colorectal tumors in mice lacking core 3-derived O-glycans. J Exp Med 204: 1417-1429. 159. Quinton PM (2008) Cystic fibrosis: impaired bicarbonate secretion and mucoviscidosis. Lancet 372: 415-417. 160. Garcia MA, Yang N, Quinton PM (2009) Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. J Clin Invest 119: 2613-2622. 161. Yu K, Lujan R, Marmorstein A, Gabriel S, Hartzell HC Bestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon. J Clin Invest 120: 17221735. 162. Matsuo K, Ota H, Akamatsu T, Sugiyama A, Katsuyama T (1997) Histochemistry of the surface mucous gel layer of the human colon. Gut 40: 782-789. 163. Atuma C, Strugala V, Allen A, Holm L (2001) The adherent gastrointestinal mucus gel layer: thickness and physical state in vivo. Am J Physiol Gastrointest Liver Physiol 280: G922-929. 164. Johansson MEV, Thomsson KA, Hansson GC (2009) Proteomic Analyses of the Two Mucus Layers of the Colon Barrier Reveal That Their Main Component, the Muc2 Mucin, Is Strongly Bound to the Fcgbp Protein. Journal of Proteome Research 8: 3549-3557. 165. Kobayashi K, Ogata H, Morikawa M, Iijima S, Harada N, et al. (2002) Distribution and partial characterisation of IgG Fc binding protein in various mucin producing cells and body fluids. Gut 51: 169-176. 166. Leverkoehne I, Gruber AD (2002) The murine mCLCA3 (alias gob-5) protein is located in the mucin granule membranes of intestinal, respiratory, and uterine goblet cells. J Histochem Cytochem 50: 829-838.  87  167. Harada N, Iijima S, Kobayashi K, Yoshida T, Brown WR, et al. (1997) Human IgGFc binding protein (FcgammaBP) in colonic epithelial cells exhibits mucinlike structure. J Biol Chem 272: 15232-15241. 168. Mundhenk L, Alfalah M, Elble RC, Pauli BU, Naim HY, et al. (2006) Both cleavage products of the mCLCA3 protein are secreted soluble proteins. J Biol Chem 281: 30072-30080. 169. Gibson A, Lewis AP, Affleck K, Aitken AJ, Meldrum E, et al. (2005) hCLCA1 and mCLCA3 are secreted non-integral membrane proteins and therefore are not ion channels. J Biol Chem 280: 27205-27212. 170. Zhou Y, Shapiro M, Dong Q, Louahed J, Weiss C, et al. (2002) A calcium-activated chloride channel blocker inhibits goblet cell metaplasia and mucus overproduction. Novartis Found Symp 248: 150-165; discussion 165-170, 277182. 171. Young FD, Newbigging S, Choi C, Keet M, Kent G, et al. (2007) Amelioration of cystic fibrosis intestinal mucous disease in mice by restoration of mCLCA3. Gastroenterology 133: 1928-1937. 172. Ou G, Baranov V, Lundmark E, Hammarström S, Hammarström ML (2009) Contribution of Intestinal Epithelial Cells to Innate Immunity of the Human Gut – Studies on Polarized Monolayers of Colon Carcinoma Cells. Scandinavian Journal of Immunology 69: 150-161. 173. Mastroianni JR, Ouellette AJ (2009) Alpha-defensins in enteric innate immunity: functional Paneth cell alpha-defensins in mouse colonic lumen. J Biol Chem 284: 27848-27856. 174. Van der Sluis M, De Koning BA, De Bruijn AC, Velcich A, Meijerink JP, et al. (2006) Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 131: 117-129. 175. Park SW, Zhen G, Verhaeghe C, Nakagami Y, Nguyenvu LT, et al. (2009) The protein disulfide isomerase AGR2 is essential for production of intestinal mucus. Proc Natl Acad Sci U S A 106: 6950-6955. 176. Heazlewood CK, Cook MC, Eri R, Price GR, Tauro SB, et al. (2008) Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous inflammation resembling ulcerative colitis. PLoS Med 5: e54. 177. Misumi Shinoda MS-Y, Yuji Naito, Tsunao Kishida and Reiko Ito, et al. (2010) Early-stage blocking of Notch signaling inhibits the depletion of goblet cells in dextran sodium sulfate-induced colitis in mice. Journal of Gastroenterology 45: 608-617. 178. Johansson ME, Gustafsson JK, Sjoberg KE, Petersson J, Holm L, et al. Bacteria penetrate the inner mucus layer before inflammation in the dextran sulfate colitis model. PLoS One 5: e12238. 179. Okamoto R, Tsuchiya K, Nemoto Y, Akiyama J, Nakamura T, et al. (2009) Requirement of Notch activation during regeneration of the intestinal epithelia. Am J Physiol Gastrointest Liver Physiol 296: G23-35. 180. Guilmeau S, Flandez M, Bancroft L, Sellers RS, Tear B, et al. (2008) Intestinal deletion of Pofut1 in the mouse inactivates notch signaling and causes enterocolitis. Gastroenterology 135: 849-860, 860 e841-846.  88  181. Neutra MR, O'Malley LJ, Specian RD (1982) Regulation of intestinal goblet cell secretion. II. A survey of potential secretagogues. Am J Physiol 242: G380-387. 182. Oliver MG, Specian RD (1991) Cytoskeleton of intestinal goblet cells: role of microtubules in baseline secretion. Am J Physiol 260: G850-857. 183. Plaisancie P, Barcelo A, Moro F, Claustre J, Chayvialle J-A, et al. (1998) Effects of neurotransmitters, gut hormones, and inflammatory mediators on mucus discharge in rat colon. Am J Physiol Gastrointest Liver Physiol 275: G1073-1084. 184. Boshuizen JA, Reimerink JH, Korteland-van Male AM, van Ham VJ, Bouma J, et al. (2005) Homeostasis and function of goblet cells during rotavirus infection in mice. Virology 337: 210-221. 185. Kawai Y, Yamauchi J, Soga K, Yamada M, Uchikawa R, et al. (2007) T celldependent and -independent expression of intestinal epithelial cell-related molecules in rats infected with the nematode Nippostrongylus brasiliensis. APMIS 115: 210-217. 186. Swidsinski A, Sydora BC, Doerffel Y, Loening-Baucke V, Vaneechoutte M, et al. (2007) Viscosity gradient within the mucus layer determines the mucosal barrier function and the spatial organization of the intestinal microbiota. Inflamm Bowel Dis 13: 963-970. 187. Sinaasappel M (1992) Relationship between intestinal function and chloride secretion in patients with cystic fibrosis. Neth J Med 41: 110-114. 188. Norkina O, Burnett TG, De Lisle RC (2004) Bacterial Overgrowth in the Cystic Fibrosis Transmembrane Conductance Regulator Null Mouse Small Intestine. Infect Immun 72: 6040-6049. 189. Lisowska A, Wojtowicz J, Walkowiak J (2009) Small intestine bacterial overgrowth is frequent in cystic fibrosis: combined hydrogen and methane measurements are required for its detection. Acta Biochim Pol 56: 631-634. 190. Lisowska A, Madry E, Pogorzelski A, Szydlowski J, Radzikowski A, et al. Small intestine bacterial overgrowth does not correspond to intestinal inflammation in cystic fibrosis. Scand J Clin Lab Invest 70: 322-326. 191. McAuley JL, Linden SK, Png CW, King RM, Pennington HL, et al. (2007) MUC1 cell surface mucin is a critical element of the mucosal barrier to infection. J Clin Invest 117: 2313-2324. 192. Linden SK, Sheng YH, Every AL, Miles KM, Skoog EC, et al. (2009) MUC1 limits Helicobacter pylori infection both by steric hindrance and by acting as a releasable decoy. PLoS Pathog 5: e1000617. 193. McGuckin MA, Every AL, Skene CD, Linden SK, Chionh YT, et al. (2007) Muc1 Mucin Limits Both Helicobacter pylori Colonization of the Murine Gastric Mucosa and Associated Gastritis. Gastroenterology 133: 1210-1218. 194. Lievin-Le Moal V, Servin AL, Coconnier-Polter MH (2005) The increase in mucin exocytosis and the upregulation of MUC genes encoding for membrane-bound mucins induced by the thiol-activated exotoxin listeriolysin O is a host cell defence response that inhibits the cell-entry of Listeria monocytogenes. Cell Microbiol 7: 1035-1048. 195. Magalhaes A, Gomes J, Ismail MN, Haslam SM, Mendes N, et al. (2009) Fut2-null mice display an altered glycosylation profile and impaired BabA-mediated Helicobacter pylori adhesion to gastric mucosa. Glycobiology 19: 1525-1536. 89  196. Kawakubo M, Ito Y, Okimura Y, Kobayashi M, Sakura K, et al. (2004) Natural antibiotic function of a human gastric mucin against Helicobacter pylori infection. Science 305: 1003-1006. 197. Mack DR, Michail S, Wei S, McDougall L, Hollingsworth MA (1999) Probiotics inhibit enteropathogenic E.†coli adherence in vitro by inducing intestinal mucin gene expression. Am J Physiol Gastrointest Liver Physiol 276: G941-950. 198. Smith CJ, Kaper JB, Mack DR (1995) Intestinal mucin inhibits adhesion of human enteropathogenic Escherichia coli to HEp-2 cells. J Pediatr Gastroenterol Nutr 21: 269-276. 199. Lencer WI, Reinhart FD, Neutra MR (1990) Interaction of cholera toxin with cloned human goblet cells in monolayer culture. Am J Physiol Gastrointest Liver Physiol 258: G96-102. 200. Keller K, Olivier M, Chadee K (1992) The fast release of mucin secretion from human colonic cells induced by Entamoeba histolytica is dependent on contact and protein kinase C activation. Arch Med Res 23: 217-221. 201. Lidell ME, Moncada DM, Chadee K, Hansson GC (2006) Entamoeba histolytica cysteine proteases cleave the MUC2 mucin in its C-terminal domain and dissolve the protective colonic mucus gel. Proc Natl Acad Sci U S A 103: 9298-9303. 202. Moncada D, Keller K, Chadee K (2005) Entamoeba histolytica-secreted products degrade colonic mucin oligosaccharides. Infect Immun 73: 3790-3793. 203. Young KT, Davis LM, DiRita VJ (2007) Campylobacter jejuni: molecular biology and pathogenesis. Nat Rev Micro 5: 665-679. 204. Tu QV, McGuckin MA, Mendz GL (2008) Campylobacter jejuni response to human mucin MUC2: modulation of colonization and pathogenicity determinants. J Med Microbiol 57: 795-802. 205. Nataro JP, Steiner T, Guerrant RL (1998) Enteroaggregative Escherichia coli. Emerg Infect Dis 4: 251-261. 206. Landry RM, An D, Hupp JT, Singh PK, Parsek MR (2006) Mucin-Pseudomonas aeruginosa interactions promote biofilm formation and antibiotic resistance. Mol Microbiol 59: 142-151. 207. Vimal DB, Khullar M, Gupta S, Ganguly NK (2000) Intestinal mucins: the binding sites for Salmonella typhimurium. Mol Cell Biochem 204: 107-117. 208. Mantle M, Husar SD (1994) Binding of Yersinia enterocolitica to purified, native small intestinal mucins from rabbits and humans involves interactions with the mucin carbohydrate moiety. Infect Immun 62: 1219-1227. 209. Kato K, Lillehoj EP, Kai H, Kim KC MUC1 expression by human airway epithelial cells mediates Pseudomonas aeruginosa adhesion. Front Biosci (Elite Ed) 2: 6877. 210. Lu W, Hisatsune A, Koga T, Kato K, Kuwahara I, et al. (2006) Cutting Edge: Enhanced Pulmonary Clearance of Pseudomonas aeruginosa by Muc1 Knockout Mice. J Immunol 176: 3890-3894. 211. Mantle M, Rombough C (1993) Growth in and breakdown of purified rabbit small intestinal mucin by Yersinia enterocolitica. Infect Immun 61: 4131-4138. 212. Vieira MAM, Gomes TAT, Ferreira AJP, Knobl T, Servin AL, et al. Two Atypical Enteropathogenic Escherichia coli Strains Induce the Production of Secreted and  90  Membrane-Bound Mucins To Benefit Their Own Growth at the Apical Surface of Human Mucin-Secreting Intestinal HT29-MTX Cells. Infect Immun 78: 927-938. 213. Sands BE, Podolsky DK (1996) The Trefoil Peptide Family. Annual Review of Physiology 58: 253-273. 214. Podolsky DK, Lynch-Devaney K, Stow JL, Oates P, Murgue B, et al. (1993) Identification of human intestinal trefoil factor. Goblet cell-specific expression of a peptide targeted for apical secretion. J Biol Chem 268: 12230. 215. Dignass A, Lynch-Devaney K, Kindon H, Thim L, Podolsky DK (1994) Trefoil peptides promote epithelial migration through a transforming growth factor betaindependent pathway. J Clin Invest 94: 376-383. 216. Poulsom R, Wright NA (1993) Trefoil peptides: a newly recognized family of epithelial mucin-associated molecules. Am J Physiol Gastrointest Liver Physiol 265: G205-213. 217. Albert TK, Laubinger W, Muller S, Hanisch FG, Kalinski T, et al. Human intestinal TFF3 forms disulfide-linked heteromers with the mucus-associated FCGBP protein and is released by hydrogen sulfide. J Proteome Res 9: 3108-3117. 218. Kindon H, Pothoulakis C, Thim L, Lynch-Devaney K, Podolsky DK (1995) Trefoil peptide protection of intestinal epithelial barrier function: cooperative interaction with mucin glycoprotein. Gastroenterology 109: 516-523. 219. Kinoshita K, Taupin DR, Itoh H, Podolsky DK (2000) Distinct pathways of cell migration and antiapoptotic response to epithelial injury: structure-function analysis of human intestinal trefoil factor. Mol Cell Biol 20: 4680-4690. 220. Taupin DR, Kinoshita K, Podolsky DK (2000) Intestinal trefoil factor confers colonic epithelial resistance to apoptosis. Proc Natl Acad Sci U S A 97: 799-804. 221. Patel SD, Rajala MW, Rossetti L, Scherer PE, Shapiro L (2004) Disulfidedependent multimeric assembly of resistin family hormones. Science 304: 11541158. 222. Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, et al. (2001) A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci U S A 98: 502-506. 223. Nair MG, Guild KJ, Artis D (2006) Novel effector molecules in type 2 inflammation: lessons drawn from helminth infection and allergy. J Immunol 177: 1393-1399. 224. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, et al. (2001) The hormone resistin links obesity to diabetes. Nature 409: 307-312. 225. Yang R-Z, Huang Q, Xu A, McLenithan JC, Eison JA, et al. (2003) Comparative studies of resistin expression and phylogenomics in human and mouse. Biochemical and Biophysical Research Communications 310: 927-935. 226. Nagaev I, Bokarewa M, Tarkowski A, Smith U (2006) Human resistin is a systemic immune-derived proinflammatory cytokine targeting both leukocytes and adipocytes. PLoS One 1: e31. 227. Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, et al. (2000) FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J 19: 4046-4055. 228. Nair MG, Du Y, Perrigoue JG, Zaph C, Taylor JJ, et al. (2009) Alternatively activated macrophage-derived RELM-{alpha} is a negative regulator of type 2 inflammation in the lung. J Exp Med 206: 937-952. 91  229. Pesce JT, Ramalingam TR, Wilson MS, Mentink-Kane MM, Thompson RW, et al. (2009) Retnla (relmalpha/fizz1) suppresses helminth-induced Th2-type immunity. PLoS Pathog 5: e1000393. 230. Wang ML, Shin ME, Knight PA, Artis D, Silberg DG, et al. (2005) Regulation of RELM/FIZZ isoform expression by Cdx2 in response to innate and adaptive immune stimulation in the intestine. Am J Physiol Gastrointest Liver Physiol 288: G1074-1083. 231. He W, Wang ML, Jiang HQ, Steppan CM, Shin ME, et al. (2003) Bacterial colonization leads to the colonic secretion of RELMbeta/FIZZ2, a novel goblet cell-specific protein. Gastroenterology 125: 1388-1397. 232. Mishra A, Wang M, Schlotman J, Nikolaidis NM, DeBrosse CW, et al. (2007) Resistin-like molecule-beta is an allergen-induced cytokine with inflammatory and remodeling activity in the murine lung. Am J Physiol Lung Cell Mol Physiol 293: L305-313. 233. Angelini DJ, Su Q, Yamaji-Kegan K, Fan C, Teng X, et al. (2009) Resistin-like molecule-beta in scleroderma-associated pulmonary hypertension. Am J Respir Cell Mol Biol 41: 553-561. 234. McVay LD, Keilbaugh SA, Wong TMH, Kierstein S, Shin ME, et al. (2006) Absence of bacterially induced RELMŒ reduces injury in the dextran sodium sulfate model of colitis. The Journal of Clinical Investigation 116: 2914-2923. 235. Nair MG, Guild KJ, Du Y, Zaph C, Yancopoulos GD, et al. (2008) Goblet cellderived resistin-like molecule beta augments CD4+ T cell production of IFNgamma and infection-induced intestinal inflammation. J Immunol 181: 47094715. 236. Herbert DR, Yang JQ, Hogan SP, Groschwitz K, Khodoun M, et al. (2009) Intestinal epithelial cell secretion of RELM-beta protects against gastrointestinal worm infection. J Exp Med 206: 2947-2957. 237. Hildebrandt MA, Hoffmann C, Sherrill-Mix SA, Keilbaugh SA, Hamady M, et al. (2009) High-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity. Gastroenterology 137: 1716-1724.e1712. 238. Hogan SP, Seidu L, Blanchard C, Groschwitz K, Mishra A, et al. (2006) Resistinlike molecule beta regulates innate colonic function: barrier integrity and inflammation susceptibility. J Allergy Clin Immunol 118: 257-268. 239. Cash HL, Whitham CV, Behrendt CL, Hooper LV (2006) Symbiotic bacteria direct expression of an intestinal bactericidal lectin. Science 313: 1126-1130.  92  Chapter 2: Modulation of Intestinal Goblet Cell Function During Infection by an Attaching and Effacing Bacterial Pathogen1 2.1 INTRODUCTION Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) are food- and water-borne pathogens that belong to the family of attaching and effacing (A/E) bacteria, a non-invasive class of enteric bacterial pathogens [1]. These bacteria infect the apical surfaces of intestinal epithelial cells, causing a signature histopathology characterized by intimate attachment to the host plasma membrane, and localized effacement of the brush border immediately surrounding the attached bacteria [2,3]. As a result of this infection, and the resulting host inflammatory response, EPEC and EHEC cause severe diarrhea and other complications, leading to the deaths of hundreds of thousands of children worldwide each year [1,4,5].  Although these pathogens are  human-specific and thus difficult to model in vivo, Citrobacter rodentium is a natural A/E bacterial pathogen of mice that is closely related to EPEC and EHEC [6]. C. rodentium infections cause colonic epithelial cell proliferation and crypt elongation, as well as inflammation, and diarrhea [7,8]. Because C. rodentium produces A/E lesions that are virtually indistinguishable from that of EPEC and EHEC [7], it has been widely used as a model to study A/E bacterial pathogenesis in vivo [6,9,10,11].  1  A version of this chapter has been published as indicated by the following citation:  Bergstrom, K.S.B., Guttman, J.A., Rumi, M.A., Ma, C., Bouzari, S., Khan, M.A., Gibson, D.L., Vogl, W.A., and Vallance, B.A. 2008. Modulation of intestinal goblet cell function during infection by an attaching and effacing bacterial pathogen. Infect. Immun. 76(2):796-811. 93  During infection by several enteric bacterial pathogens, including A/E pathogens, intestinal epithelial cells can be subject to direct modulation by the offending pathogen [12,13,14,15]. A/E pathogens utilize a type III secretion system (T3SS) to secrete various bacterial effectors encoded within their genome (e.g. the transmembrane intimin receptor; Tir) [16,17], directly into host cells to cause disease. These virulence factors act in an orchestrated manner to subvert intracellular signaling pathways within host cells, altering various cellular processes including cytoskeletal [18], organelle [19,20], and barrier function [20,21,22]. This strategy allows the bacteria to not only intimately attach to and form A/E lesions on epithelial surfaces [23,24], but also suppress inflammatory responses and host defenses [25,26]. Through the release of various cytokines, host immune cells can also modulate intestinal epithelial function, by altering epithelial cell proliferation [27,28], migration [29], and permeability [30,31]. Such immunomodulation of epithelial function is thought to represent a critical effector mechanism by which the host is able to mediate clearance of invading enteric pathogens, as demonstrated with diverse classes of pathogens such as viruses [28] and helminthes [29,32,33]. However, while this is best characterized for parasitic infections, the role of immunomodulation of intestinal epithelial cells during enteric bacterial infections, including by A/E pathogens, remains largely undefined.  Infections by several enteric pathogens including C. rodentium lead to a dramatic reduction in the number of phenotypically distinct goblet cells, termed ”goblet cell depletion” [7]. Intestinal goblet cells are highly polarized secretory cells found throughout the intestinal tract, but most abundantly in the distal colon and rectum [34],  94  where they make up 16% of the total epithelial population in mice [35].  These  specialized epithelial cells are thought to play an important protective role in the intestine by synthesizing and secreting several mediators including the mucin MUC2 [36] as well as the small peptide trefoil factor (TFF)-3 [37].  MUC2 (mouse, Muc2) is a large  molecular weight glycoprotein that is stored within granules in the apical compartment of the cell. Under basal conditions, or under the influence of host or bacterial stimuli [38], goblet cells release MUC2-containing granules into the lumen, where they hydrate and form the structural basis for the mucus gel layer overlying the intestinal epithelium [39]. This mucus layer plays important physiological roles in the gut by simultaneously lubricating the intestinal surface, limiting passage of luminal molecules into the mucosa, functioning as a dynamic defensive barrier against enteric pathogens [34,38], and acting as a substrate and niche in which commensal flora can colonize and derive nutrients [40]. TFF3 (mouse, Tff3) is another goblet cell-derived molecule belonging to a family of small cysteine-rich secretory peptides that are expressed in a region specific manner throughout the GI tract [37]. A potent inducer of cell migration and an inhibitor of apoptosis [41], TFF3 plays a critical role in wound healing by promoting epithelial restitution following mucosal injury [42]. In addition, TFF3 is thought to synergize with colonic mucins to enhance the protective barrier properties of the mucus layer against bacterial toxins [43]. Evidence of the importance of goblet cells in maintaining overall health comes from studies of mice lacking either Muc2 or Tff3. These mice are highly susceptible to experimental colitis [42], or have profound defects in intestinal homeostasis under basal conditions [44].  95  Considering the critical role that goblet cells appear to play in providing host defense against enteric pathogens, the observation that these cells are depleted during C. rodentium infection may have important implications regarding the pathogenesis of this infection as well as infections by clinically important pathogens including Shigella [45,46] and Campylobacter [47], where the goblet cell depletion phenotype is also observed.  At present, whether the goblet cell depletion seen during C. rodentium  infection reflects the death or functional alteration of goblet cells is not clear, nor has the expression of goblet cell mediators been assessed in this model. Similarly, it is unclear if this pathology reflects direct infection and subversion of goblet cell function by C. rodentium, perhaps as an attempt to bypass mucosal defenses, or alternatively, the goblet cell depletion may be mediated by the host, as a currently cryptic form of host defense. I hypothesized that goblet cell function during C. rodentium infection is subject to modulation by both the pathogen as well as components of the host’s immune system. With this hypothesis in mind, the current study addresses the mechanisms underlying the intestinal goblet cell depletion that occurs during C. rodentium infection.  96  2.2 RESULTS 2.2.1 Depletion of mucus-containing goblet cells correlates with peak bacterial colonization during C. rodentium infection Previous studies have described C. rodentium infection as causing goblet cell depletion within the colons of infected mice [7], however the timing of this pathology as well as how these changes relate to C. rodentium colonization have not been addressed. To begin, I examined the time course and spatial characteristics of C. rodentium colonization in C57BL/6 (BL/6) mice (Figure 2.1). Assessing total pathogen burdens, C. rodentium was found to heavily colonize the colon by 6 days post-infection (DPI) with bacterial numbers peaking at 10 DPI. By 14 DPI C. rodentium numbers began to drop, and the infection essentially cleared by 21 DPI., with only a few thousand bacteria remaining. (Figure 2.1, and data not shown). In addition, consistent with recent studies of C. rodentium infection dynamics by other groups [48], I found that bioluminescent C. rodentium were predominantly localized to the caecum and distal half of the colon, with little infection detected in the proximal colon at 6 and 10 DPI (not shown).  Figure 2.1 C. rodentium infection peaks at 10 DPI. Bacterial counts show peak infection occurs at 10 DPI in C57BL/6 mice. Each data point represents the mean average from three independent infections, each containing 3 mice per time point. Error bars represent SD. 97  I next examined whether the localization of C. rodentium influenced colonic pathology and the reported goblet cell depletion by comparing tissue sections taken from the distal and proximal colons of uninfected and infected mice at 6 and 10 DPI. Using the periodic acid-Schiff (PAS) technique to stain for goblet cell mucins, only minimal changes in PAS staining were observed in any region of the caecum and colon at 6 DPI (data not shown) and there was little overt change in PAS staining of goblet cells in the caecum (data not shown) or in the proximal colon (Figure 2.2A & B) at 10 DPI. However a dramatic reduction in PAS staining was observed within tissue sections taken from the distal colon at 10 DPI (Figure 2.2C & D).  While a small number of crypts still contained  phenotypically mature mucin-filled goblet cells, characterized by a swollen (PAS stained) apical region, and a tapered basolateral compartment containing the nucleus, most colonic crypts suffered an almost complete loss of these cells (Figure 2.2E). However, examination under higher magnification revealed that these tissues still contained many cells that exhibited weak PAS staining in their apical compartments (Figure 2.2D). In contrast to the cells that stained strongly for PAS (Figure 2.2E), these weakly stained cells were smaller, and exhibited more of a columnar morphology (Figure 2.2F), reminiscent of the “hypotrophic” goblet cell phenotype observed in the IL-10 deficient mouse model of spontaneous colitis [49]. When I quantified the number of PAS-positive cells per 100 epithelial cells at 10 DPI, I observed a modest but statistically significant drop in the total PAS-positive population ( = 0.036) compared to  98  Figure 2.2 Depletion of mucus-containing goblet cells is observed in the distal colon and is pronounced when C. rodentium numbers peak. (A-F): PAS staining of formalin-fixed paraffin-embedded tissue sections taken from the proximal (A, B), and distal (C, D) colons from both naïve (uninfected) mice (A, C) and mice at 10 DPI (B, D). A reduction in overall PAS staining within many crypts is observed in distal colons at day 10 DPI, although scattered PAS-positive cells are still 99  evident (arrows, Panel D). Bar = 100 μm. DIS = distal colon; PROX = proximal colon. (E,F): Representative images of PAS-positive cells at 10 DPI exhibiting a large mucinfilled goblet cell morphology (E, arrows), or a mucin-depleted columnar morphology (F, arrows). Results are representative of at least 3 independent infections, with 2-3 mice per time point.  uninfected controls. However, when I quantified the number of cells possessing the phenotypically mature goblet cell morphology that stained strongly for PAS (as in Figure 2.2F), I found a substantially greater reduction in this population. (P = 0.002) (Table 2.1). As the infection progressed, the hypotrophic goblet cell phenotype was still predominant by 14 DPI, but the number of large mucin-filled goblet cells began to rebound again by 21 DPI (data not shown). Thus, my data indicate that C. rodentium infection leads to a reduction in PAS staining, potentially due to a decrease in mucin glycoprotein content in goblet cells, rather than an actual loss of the goblet cell lineage. As a result, I see only a modest decrease in total goblet cell numbers, with the dramatic reduction in the large mature appearing goblet cells explaining the previously described goblet cell depletion.  100  Table 2.1 Goblet cell enumeration in the distal colon of C57BL/6 mice following C. rodentium infection. Per 100 Epithelial Cells Phenotypically Days postinfection Mature Goblet Total PAS-Positive Cells (± SD) Cells (±SD) Uninfected Control 32.9 ± 7.9 17.9 ± 2.8 Day 6 28.1 ± 7.3 14.0 ± 4.6 Day 10 21.6 ± 7.3* 7.7 ± 3.2 * C. rodentium infection results in depletion of phenotypically mature goblet cells in the distal colon during times corresponding to peak infection. Enumeration was performed on PAS/hematoxylin-stained tissue sections of distal colons by counting distinctly PAS-positive cells, differentiating those that have a mature goblet phenotype, per 100 epithelial cells. Numbers represent the average numbers ± standard deviation (SD) from 3 independent infections, with each infection group containing 3 mice per time point. *=  < 0.05, Mann-Whitney t-test.  2.2.2 Goblet cell-specific gene expression is reduced during infection While infection led to a decrease in overall PAS staining and a reduction in the number of phenotypically mature goblet cells, it remained unclear whether this solely reflected a reduction in mucin expression and production, which directly impacts goblet cell morphology [44], or if this was also accompanied by altered production of additional goblet cell-specific mediators. To assess this, the expression of the major goblet cell mucin Muc2 as well as Tff3 was assayed by semi-quantitative RT-PCR. As assessed by densitometry of end-point PCR products represented in Figure 2.3A, there was a slight but non-significant reduction in expression of Muc2 and Tff3 mRNA by 6 DPI, but a notably larger and significant drop in Muc2 and especially Tff3 mRNA by 10 DPI (Figure 2.3A, graph). To determine whether C. rodentium infection impacted on Muc2 and Tff3 protein expression, I performed immunoperoxidase staining for Muc2 and Tff3 on formalin-fixed paraffin-embedded sections of distal colons from control and infected  101  mice. In control mice, Muc2 and Tff3 protein expression was abundant within goblet cells, although their expression patterns were distinct: While Muc2-positive cells were observed from the base to the luminal surface of colonic crypts (Figure 2.3B, upper left panel), Tff3-positive goblet cells were confined predominantly to the upper half of the crypts (Figure 2.3B, lower left panel), in agreement with previous reports [50]. However, consistent with infection causing the down-regulation of Muc2 and Tff3 mRNA, I observed a dramatic reduction in staining for both Muc2 and Tff3 protein at 10 DPI throughout crypts showing the depleted goblet cell phenotype (Figure 2.3B upper and lower right panels respectively), although Muc2 staining could still be seen faintly within scattered crypt cells. Thus, my data show that infection not only leads to reduced mucin (Muc2) expression and production, resulting in the decreased PAS staining, but also reduced production of the goblet cell specific mediator Tff3, which taken together suggests a profoundly altered goblet cell function during infection. Considering that this pathology was most pronounced in regions of the colon heavily infected by C. rodentium, I next addressed whether direct infection might play a role in this modulation of goblet cell function.  102  Figure 2.3 C. rodentium infection results in reduction of Muc2 and Tff3 gene expression (A) Representative RT- PCR analysis of Muc2 and Tff3 gene expression in distal colonic tissues of naïve C57BL/6 mice or at 6 and 10 DPI. -actin was used as a loading control. Differences in expression levels relative to naïve (uninfected) mice after normalization to -actin were determined by densitometric analysis as indicated in the graph on the right Bars represent the mean of 3 independently-infected mice per timepoint. Error bars represent ± 1 SEM (* =  < 0.05; ns= non-significant, [ > 0.05]; Student’s t-test). (B) Immunoperoxidase staining for Muc2 (upper panels) and Tff3 (lower panels) protein (brown) in serial sections of distal colons from either naive mice (left panels) or mice at 10 DPI (right panels). In control mice, Muc2-positive cells can be seen from the crypt base to the luminal surface, whereas Tff3 expression is restricted to the top half of the crypts (arrows). Arrowheads indicate cells that are co-expressing Muc2 and Tff3 protein. Note lack of staining in intact crypts at 10 DPI (arrows, left panel). Bar = 50 μm.  103  2.2.3 C. rodentium directly interacts with goblet cells in vivo It remains unclear whether C. rodentium are able to infect cells other than enterocytes in vivo, such as goblet cells. To address this question, I first assessed whether C. rodentium within the infected colons were in close proximity to or in contact with goblet cells. Here, I focused on 6 DPI, when colonization in the distal colon is established, but phenotypically distinct goblet cells are still relatively abundant (Table 2.1). To identify any potential C. rodentium – goblet cell interactions, I performed dual immunostaining to look for co-localization between Muc2-positive goblet cells, and the LEE-encoded virulence factor Tir, which is only expressed on the apical surface of cells following direct infection by C. rodentium [51]. As shown in Figure 2.4A, Tir staining was found on the surface epithelium and progressing down some crypts, where Muc2-positive goblet cells also resided. To confirm the co-localization of Tir with Muc2-positive cells, I examined tissues at higher magnification and found positive Tir staining on the apical surface of enterocytes as well as on cells that were positive for Muc2 (Figure 2.4B). Next myself and Dr. Julian Guttman examined whether C. rodentium were adherent to colonic goblet cells using transmission electron microscopy (TEM).  TEM analysis  showed C. rodentium adherent to the apical plasma membrane of goblet cells (Figure 2.4C &D).  Although goblet cells have a morphology and function very distinct from  their absorptive enterocytic counterparts, they still contain intact, albeit shortened and less dense, microvilli [52]. Notably, however, C. rodentium-associated goblet cells also exhibited evidence of microvillar effacement, a hallmark of A/E lesion formation (Figure 2.4C). Interestingly, I also occasionally observed bacteria within the apical granule mass of goblet cells suggesting that C. rodentium may be internalized by some goblet cells. 104  Figure 2.4 C. rodentium directly infects colonic goblet cells in vivo. (A) Immunofluorescence staining for the C. rodentium translocated effector Tir (red) goblet cell-specific Muc2 (green) and DNA (blue) in distal colonic tissues at 6 DPI. Tir staining is seen on Muc2-positive (arrowheads) and Muc2-negative cells within the surface epithelium and progressing down the length of some crypts (arrow). (B) Magnified image of Tir (red) staining (white arrows) on the apical surface of cells staining strongly for Muc2 (green) in the apical compartment and exhibiting distinct 105  goblet cell morphology. GA = goblet cell apical compartment; GN = goblet cell nucleus; E = enterocyte; L = lumen. Original magnification 1000x. (C-E) Transmission electron micrographs (TEM) of distal colons of C57BL/6 mice taken at 7 DPI (C) and 11 DPI (D) following infection with WT C. rodentium; and at 7 DPI following infection with escN C. rodentium (E). C. rodentium is observed in direct contact with goblet cells in Panels C and D (black arrows). In Panel C, effacement of microvilli (black arrows) on a goblet cell, as well as the internalization of bacteria into the apical granule mass of the goblet cell can be seen (white arrow). In Panel E, no infection of goblet cells and intact microvilli (dark arrow) can be seen following infection with escN C. rodentium. (F) Graph showing the proportion of Muc2-positive (goblet) cells and Muc2-negative (nongoblet) cells of the surface epithelia that were positive for Tir staining at 6 DPI. Results represent the average of 3 mice from two independent infections. Error bars represent ± 1 SEM (* =  < 0.05, Student’s t-test).  (Figure 2.4C).  In contrast, when mice were infected with escN C. rodentium, which  lacks a functional T3SS, no C. rodentium were found adherent to goblet cells, nor was any effacement of goblet cell (or enterocyte) microvilli observed in these mice (Figure 2.4E). To determine the frequency at which goblet cells were infected, I quantified the proportion of Muc2-positive (goblet) cells to Muc2-negative (enterocyte/non-goblet) cells that were positive for Tir staining upon the surface epithelium, where most C. rodentium were localized. My results show a moderate but significant difference in the proportion of infected Muc2-positive vs. infected Muc2-negative cells, in that fewer than 50% of Muc2-positive cells had associated Tir staining, whereas just over 60% of Muc2-negative cells were positive for Tir staining. (Figure 2.4F). These results clarify that along with colonocytes, goblet cells are also the subject of direct infection by A/E pathogens in vivo, although Muc2-negative cells are more frequently observed to be infected.  106  2.2.4 C. rodentium predominantly associates with crypts that do not exhibit goblet cell depletion My next goal was to examine the interactions of C. rodentium with colonic crypts at day 10 DPI, to determine whether C. rodentium could be directly mediating the loss of mature goblet cells. If this was the case, I would expect to find C. rodentium associated with hypotrophic goblet cells, which I tested by immunofluorescently staining for both Tir and Muc2.  Strikingly, only minimal Tir staining was associated with crypts exhibiting  hypotrophic goblet cells, and no C. rodentium were identified in proximity to these cells (Figure 2.5A). To clarify the relationship between C. rodentium infection and goblet cell depletion, I identified individual colonic crypts that were infected by C. rodentium (ie. Tir positive) and, as defined in section 2.4 “Experimental Methodology”, differentiated between crypts that exhibited a weak overall signal for Muc2, indicative of the goblet cell depletion phenotype and those crypts that displayed a strong signal for Muc2, indicating goblet cell depletion was not present. Interestingly, I found an over 3-fold lower proportion of crypts that were infected and exhibited goblet cell depletion, compared to crypts that did not display an overt loss of goblet cells (Figure 2.5B). This trend was even more dramatic at 14 DPI, when virtually all crypts were markedly reduced in Muc2 and had little if any associated Tir staining (data not shown). These results suggest a surprising inverse relationship between C. rodentium infection of crypts, and goblet cell depletion. It should be noted that I did observe 1-2 crypts per colonic section that were heavily invaded by C. rodentium and were strongly positive for Tir from the surface epithelium to the crypt base, yet were also depleted of Muc2 positive cells. However, unlike the typical goblet cell depleted crypts, these crypts invariably looked atrophic and/or necrotic, suggesting that the loss of Muc2 staining in these crypts was due to 107  destruction of the crypt epithelium, rather than modulation of goblet cell function. These data therefore demonstrate that aside from occasional crypt destruction, the widespread goblet cell depletion seen in colonic crypts during C. rodentium infection is independent of direct bacterial contact or infection of the altered goblet cells.  Figure 2.5 C. rodentium associates with crypts that are strongly positive for Muc2 at 10 DPI. (A) Dual immunofluoresence staining for C. rodentium Tir (red) and Muc2 (green) in distal colons at 10 DPI. Tir staining (white arrow) is associated with crypts strongly positive for Muc2 (white arrowhead), but little if any Tir staining (yellow arrow) is associated with crypts that are weakly positive for Muc2 (yellow arrowhead). Note the frequent co-localization of Tir with Muc2-postive cells and luminal Muc2. (B) Graph quantifying the proportion of crypts exhibiting depletion of Muc2-positive goblet cells that are positive for Tir, compared to crypts that are not depleted of Muc2-postive goblet  108  cells. Results represent the average (error bars, ±SD) of 30 crypts counted within colonic sections from two individual mice.  2.2.5 Rag1-deficient mice do not suffer goblet cell depletion during C. rodentium infection The above studies suggest that goblet cell depletion is not a result of direct infection, since it is frequently observed in uninfected crypts. Considering alternative mechanisms, the adaptive immune response has been shown to modulate goblet cell function during infections by intestinal helminths [32,33]. Moreover, as previous studies have found a robust adaptive immune response to C. rodentium infection occurring by 10 DPI [53], I tested whether the host adaptive immune response mediated the observed reduction in mature goblet cell numbers and Muc2 and Tff3 expression.  Thus, Rag1 KO mice  (lacking mature T & B lymphocytes) were infected and analyzed for their goblet cell responses at 10 DPI.  As with C57BL/6 mice, mucosal thickening associated with  epithelial hyperplasia was observed in Rag1 KO mice, consistent with previous reports [54]. However, compared with infected C57BL/6 mice (Figure 2.6B), no depletion in mature goblet cell numbers was observed in the Rag1 KO mice at 10 DPI as assessed by PAS staining (Figure 2.6D & E); in fact there was a modest trend toward increased numbers at day 10 DPI compared to uninfected controls (Figure 2.6E). Moreover, the majority of goblet cells in the Rag1 KO mice, both at the base and surface of the crypts, were highly differentiated in appearance, containing full mucin-filled apical granule masses that stained strongly for PAS (Figure 2.6D).  However, as observed in  immunocompetent mice in the aforementioned studies, I occasionally observed heavily infected and atrophic crypts that exhibited reduced PAS-staining (Figure 2.6D,  109  arrowheads).  The maintenance of overall goblet cell function within the colons of  infected Rag1 KO mice was further confirmed by immunostaining for Muc2 and Tff3 protein. Both proteins were detected at high levels in infected Rag1 KO mice at 10  Figure 2.6 C. rodentium infection does not result in goblet cell depletion in Rag1 KO mice. Histology showing PAS/Hematoxylin- stained distal colonic sections taken from (A) naive C57BL/6 mice; (B) C57BL/6 mice at 10 DPI; (C) naïve Rag1 KO mice; and (D) Rag1 KO mice 10 DPI. The PAS-positive cell population remains abundant in Rag1 KO mice at 10 DPI. Heavily infected mucin-depleted atrophic crypts are indicated with an 110  arrowhead. Original magnification 100x. Bar = 100 μm. (E) Quantitation of goblet cells in distal colons from naïve C57BL/6 and Rag1 KO mice, or at 10 DPI Each bar represents the mean number of goblet cells per 100 epithelial cells counted in PAS/Hematoxylin–stained sections of the distal colon. Error bars represent ± 1 SEM of at least three independent infections, with 1-3 mice per time point (* =  < 0.05). (F) Comparison of bacterial numbers in whole colons of C57BL/6 (black bars) and Rag1 KO mice (white bars) at 10 DPI. Each bar represents the mean average from three independent infections, each containing 2-3 mice per time point. Error bars represent SD (* =  < 0.05, Mann-Whitney t-test). DPI, with staining patterns similar to those found in uninfected colons (Figure 2.7A). In addition, there was no significant decrease in Muc2 or Tff3 gene expression at 10 DPI compared with C57BL/6 mice (Figure 2.7B). To determine how the preservation of mature goblet cells related to bacterial numbers, I quantified bacterial burdens at 6 and 10 DPI. Consistent with previous reports [54], Rag1 KO mice carried greater bacterial burdens than C57BL/6 mice at 10 DPI (Figure 2.6F), which indicates that the maintenance of goblet cells numbers and function in the Rag1 KO mice was not due to reduced bacterial numbers in these mice, and confirms that direct C. rodentium infection plays a minor role in the overall goblet cell depletion observed in C57BL/6 mice. These results strongly suggested the presence of T & B lymphocytes was involved in the loss of mature goblet cells during C. rodentium infection.  2.2.6 Pro-inflammatory cytokine expression in C57BL/6 and Rag1 KO mice during C. rodentium infection Because pro-inflammatory cytokines such as TNF- have been implicated in causing goblet cell depletion in the small intestine in a Salmonella typhimurium ligated ileal loop model [55], I compared the gene expression of TNF- in C57BL/6 and Rag1 KO mice to  111  begin to address which host molecules are responsible for the loss of mature goblet cells in the colon during infection. As shown in Figure 2.8, TNF- was induced in both  Figure 2.7 Muc2 and Tff3 remain abundantly expressed in Rag1 KO mice following C. rodentium infection. (A). Immunohistochemical staining for Muc2 (upper panels) and Tff3 (lower panels) in the distal colons of naïve (right panels) and infected mice (left panels). Note the abundance of Tff3 and Muc2 in crypts that are evidently undergoing hyperplasia, with staining patterns similar to naïve mice (arrows). Bar = 50 μm Original magnification taken at 200x. (B) Quantitative RT-PCR analysis of Muc2 and Tff3 gene expression in distal colons from naïve and infected C57BL/6 and Rag1 KO mice. Each bar represents the mean relative expression of 4 mice from three independent infections, compared to naïve mice of the respective strain, which are assigned an arbitrary expression value of 112  1.00. Genes encoding Muc2 and Tff3 are both expressed at significantly greater levels in Rag1 KO mice compared to C57BL/6 mice at 10 DPI. All samples were normalized to actin. Error bars represent ± 1 SEM (* =  < 0.05, Mann-Whitney t-test).  strains at 10 DPI but to a greater extent in C57BL/6 mice; however, this difference did not reach statistical significance (P = 0.0727). These results indicated that cytokines besides TNF- are probably involved in the observed changes in colonic goblet cells during C. rodenium infection. Our laboratory has previously shown that IFN expression is lower in Rag1 KO mice compared to C57BL/6 mice during infection [54], but recent studies have found that IL-17A (IL-17), a proinflammatory T cell-derived cytokine that is reported to directly affect intestinal epithelial function [27], is also upregulated in C. rodentium-induced colitis [56]. Therefore I compared IL-17 mRNA levels in C57BL/6 and Rag1 KO mice. As expected, I found that in infected C57BL/6 mice, IL-17 mRNA levels were significantly increased to over 100-fold greater levels than uninfected mice; in contrast, IL-17 expression in Rag1 KO mice did not increase to levels beyond that seen in uninfected C57BL/6 control mice (Figure 2.8), despite greater bacterial numbers in the Rag1 KO mice (Figure 2.6F). These results, coupled with those of previous reports [54], show that effector T-cell cytokines are highly expressed at times when goblet cell depletion is apparent, and may play a direct or indirect role in functional modulation of goblet cells during infection.  113  Figure 2.8 Cytokine gene expression during C. rodentium infection. Quantitative RT-PCR analysis of TNF- and IL-17 expression in distal colons taken from C57BL/6 and Rag1 KO at 10 DPI, following C. rodentium infection. Induction of TNF- is moderately increased in both strains at d10 DPI, with increased but non-significant ( = 0727) levels in C57BL/6 mice. However, IL-17 gene expression is significantly increased in infected C57BL/6 mice compared to the minimal IL-17 expression observed in infected Rag1 KO mice. All samples were normalized to -actin. Bars indicate the mean of a total n=8 for C57BL/6 mice and n=4 for Rag1 KO mice from three independent infections. Error bars represent ± 1 SEM (* =  < 0.05, Mann-Whitney t-test).  2.2.7 Adoptive transfer of T & B lymphocytes rescues the goblet cell depletion phenotype in Rag1 KO mice While the above results indicated that a functional adaptive immune system was important for meditating the observed goblet cell depletion phenotype, I tested this directly by reconstituting Rag1 KO mice with T & B lymphocytes isolated from spleens and MLNs of C57BL/6 mice (using PBS as a negative control), and subsequently challenging them with C. rodentium. At day 10 DPI, PBS-treated (non-reconstituted) or T & B lymphocyte-reconstituted mice were euthanized and distal colons were analyzed for the histological assessment of goblet cells via PAS staining, as well as the presence of infiltrating lymphocytes via CD3 (T cell) and B220 (B cell) staining. Consistent with the hypothesis that T and/or B cells were mediating the goblet cell depletion phenotype, I  114  observed reduced overall PAS staining within crypts of the reconstituted mice compared with non-reconstituted mice (Figure 2.9A and B). Examination of T and B lymphocyte populations within these tissues revealed that while B220-positive cells were mainly concentrated in isolated lymphoid follicles found only in reconstituted mice (data not shown), the goblet cell depletion seen in the reconstituted mice was associated with a prominent population of CD3-positive cells in the mucosa and submucosa of the reconstituted mice (Figure 2.9C), but not the non-reconstituted mice (Figure 2.9D). Moreover, this reduced PAS staining, and large CD3-positive cell population in distal colons of infected reconstituted mice at 10 DPI was also accompanied by a reduction in Muc2 mRNA, and a significant reduction in Tff3 mRNA expression when compared to infected non-reconstituted mice (Figure 2.9E). Lastly, similar to infected C57BL/6 mice, I saw a significantly greater expression of IL-17 mRNA, and a slight but non-significant increase in TNF- expression in reconstituted mice compared to infected nonreconstituted mice at day 10 DPI (Figure 2.9F). Together, these results show that the adaptive immune response, presumably through the actions of T lymphocytes, plays a central role in regulating goblet cell gene expression, with downstream effects on goblet cell function and morphology during infection by this non-invasive enteric pathogen. 2.2.8 The goblet cell depletion phenotype is strongly associated with immune mediated expansion of the transit amplifying zone The goblet cell depletion phenotype in C57BL/6 mice reflected a population of cells that adopted an immature, undifferentiated status. The absence of the goblet cell depletion phenotype in Rag1 KO mice, and its rescue in reconstituted Rag1 KO mice reflected the ability of T and B lymphocytes to affect goblet cell maturation.  115  I tested this by  immunostaining using the proliferation marker Ki67 on sections from uninfected or infected C57BL/6 and Rag1 KO mice, as well as infected Rag1 KO-reconstituted mice, at 10 DPI. The results show that under uninfected conditions, the proliferating cells were located in the bottom half of crypts in the transit amplifying zone in both C57BL/6 and Rag KO mice, showing immune status does not affect epithelial proliferative status and crypt architecture under physiological conditions (Figure A1.1). However, at 10 DPI, the TA zone was dramatically expanded in C57BL/6 mice, reaching 4/5 up the length of the crypts (Figure A1.1). In contrast, while there was clearly an expansion of proliferating cells in infected Rag1 KO mice compared to uninfected Rag1 KO and uninfected BL/6 mice, the TA zone remarkably did not expand past the bottom half of most crypts (Figure A1.1). The total cell counts between the uninfected and infected were not different suggesting a larger population of non-proliferating and therefore terminally differentiated cells (not shown). Importantly, reconstituted Rag1 KO mice showed a rescue of the TA zone expansion to a similar extent seen in the infected C57BL/6 mice, corresponding with the goblet cell depletion phenotype. Interestingly, consistent with Figure 2.6, I noted there were many more bacteria associated with the crypts of Rag1 KO mice, based on mild cross reactivity of the antibody to the bacteria. These results suggest that the adaptive immune system mediates the goblet cell depletion phenotype by stimulating epithelial proliferation, resulting in the expansion of the TA zone, and ultimately the inhibition of overall epithelial maturation. Moreover, this appears to be associated with a local reduction of epithelial-associated bacteria. (Figure A1.2).  116  Figure 2.9 Adaptive transfer of T and B cells into Rag1 KO mice restores the goblet cell depletion phenotype during C. rodentium infection. PAS staining of distal colons taken at 10 DPI from Rag1 KO mice that were reconstituted with T and B lymphocytes from naïve C57BL/6 mice (Recon) (A) or with PBS (nonreconstituted control) (B). Arrows indicate intact crypts exhibiting reduced PAS staining and numerous hypotrophic goblet cells. Asterisk indicates crypts magnified in insets. Note that the reduced PAS staining in PBS-treated mice (B) is associated mainly with crypts that are severely disrupted due to bacterial overload (arrowheads) which is not observed in infected reconstituted mice. Original magnification, 100x. Bar = 100 μm. (C – D): Anti-CD3 staining showing greater numbers of infiltrating CD3-positive cells within the lamina propria and submucosa of reconstituted Rag1 KO mice (white arrows) (C) compared to PBS-treated mice (D). Original magnification, 200x. Bar = 50 μm. (E F): Quantitative RT-PCR analysis of expression of genes encoding Muc2 and Tff3 (E) or TNF- and IL-17 (F) in distal colons of reconstituted or PBS-treated mice at day 10 p.i.. 117  All samples were normalized to -actin. Results represent the mean of n = 7 for reconstituted mice and n = 3 for non-reconstituted (PBS)-treated mice from 2 independent infections. Error bars represent ± 1 SEM (* =  < 0.05, Mann-Whitney ttest).  2.3 DISCUSSION While goblet cell depletion has been previously reported during C. rodentium infection [7], my studies are the first to directly characterize this pathology and specifically address the underlying mechanisms. I show that during C. rodentium-induced colitis, there is a significant reduction of the mature goblet cell population in the distal colon during periods corresponding to heavy pathogen burden, and this is associated with reduced expression of the goblet cell-specific genes encoding Muc2 and Tff3 at the mRNA and, histologically, at the protein level. I also demonstrate that beyond colonocytes, goblet cells represent an additional target of C. rodentium infection, with these bacteria directly interacting with and infecting goblet cells. However, I show that only a portion of goblet cells in the murine colon are infected, and it is likely the host adaptive immune system that mediates the majority of the goblet cell depletion that occurs during C. rodentium infection.  The relationship between the histological changes in the goblet cell population and the alterations in goblet cell-specific gene expression seen in this model was intriguing, and provides insight as to how the immune system modulates these cells during infection. While infection did lead to a significant reduction in the total number of PAS-stained mucin-containing cells relative to other non-carbohydrate producing cells, this in itself is unlikely to account for the dramatic reduction in Muc2 and Tff3 immunostaining that was 118  observed.  Rather, the prevalence of hypotrophic PAS-positive cells may reflect an  altered state of goblet cell function occurring in the distal colon during infection. As initially suggested by Mireille et al (2002) in another model of colitis showing goblet cell depletion [49], the reduced Muc2 protein expression may be directly responsible for the hypotrophic goblet cell phenotype I observed, since Muc2 is the main morphological determinant of goblet cell morphology [49,57]. In fact, mice genetically deficient in this mucin lack phenotypically distinct goblet cells, yet are strongly reactive for other goblet cell markers like Tff3 [44]. However, in addition to reduced Muc2 levels, I also report a marked reduction of Tff3 protein in C57BL/6 mice but not Rag1 KO mice. Because Tff3 is thought to be expressed primarily by mature goblet cells [58], this suggests that the modulation of goblet cell function may reflect an immune-mediated impairment in the ability of immature goblet cells to fully differentiate into mature goblet cells.  The biological consequences of the functional modulation of goblet cells are currently unclear. In some respects it is paradoxical that the host immune system would reduce expression of Muc2 and Tff3, considering the protective roles these goblet cell-derived proteins play in the intestine. Muc2 was recently shown to be important in maintaining overall mucosal homeostasis, ultimately suppressing spontaneous tumor growth [44], as well as colitis development [59]. In vitro studies have reported that intestinal mucins prevent EPEC attachment [60,61] to epithelial cells, as well as bacterial translocation [62] across epithelial cell monolayers.  Moreover, mice lacking Tff3 are impaired in their  ability to heal colonic injury induced by the cytotoxic agent dextran sodium sulfate, and  119  suffer an exaggerated and fatal colitis as a result [42]. Thus, down-regulating both these genes, could compromise host defense when challenged by an enteric bacterial pathogen.  On the other hand, the impact of the loss of these goblet cell-derived factors may be minimal, or even beneficial, to the host during enteric bacterial infections. For example, similar to commensal species [40], enteropathogenic bacteria such as Yersinia enterocoltica have been demonstrated to use carbohydrate-laden mucins as a food source [63], and Salmonella typhimurium is thought to bind to intestinal mucins to facilitate its colonization [64]. Thus, reducing mucin production might be important for reducing energy sources for the pathogenic bacteria, as well as potential anchoring sites required for initial colonization. Indeed, as C. rodentium constitutes approximately 90% of the bacterial flora at the peak of infection [7], reducing a potential nutrient source such as mucins may inhibit pathogen growth.  In this regard, the robust mature goblet cell  population observed within infected Rag1 KO mice may facilitate the increased bacterial burdens that are observed within the colons of these mice, and perhaps even the impaired clearance of the pathogen as previously described [54].  The mechanisms underlying the immune driven loss of mature Muc2 and Tff3-expressing goblet cells are currently unclear, however the goblet cell depletion phenotype has also been observed in human colonic tissues in association with hyperproliferation of colonic crypts, in a manner dependent upon activation of T cells within the lamina propria [65]. While infection-induced alterations in the turnover of the colonic epithelium may be involved in the observed goblet cell depletion, I observed that both C57BL/6 mice and  120  Rag1 KO mice showed evidence of colonic hyperplasia during infection, consistent with previous reports by our lab [54] and other groups [66]. I also found that epithelial cell numbers within elongated crypts were not significantly different between the two mouse strains following infection (unpublished observations). Indeed, the relationship between crypt hyperplasia and goblet cell depletion phenotypes as observed in other models of intestinal inflammation appears to be complex: for example, the immune mediated pathology that occurrs during murine helminth infections results in both crypt and goblet cell hyperplasia [32,67,68].  Moreover, in SAMP1/YitFc mice which develop  spontaneous Crohn’s Disease-like ileitis [69], inflammation-induced crypt elongation is associated with the expansion of secretory lineages including Paneth and goblet cells [69]. Taken together, these studies suggest that the mechanisms underlying the depletion of mature goblet cells during C. rodentium infection may involve processes that are independent of, but coordinated with the induction of crypt hyperplasia.  The concept of immunomodulation of goblet cells during enteric bacterial infection is intriguing in light of the role the immune system plays in modulating goblet cell function when faced with other intestinal challenges. For example, the robust Th2 response that typically accompanies intestinal nematode infections induces goblet cell hyperplasia [68] and induction of goblet cell-specific gene expression, which are thought to contribute to host defense [68,70]. In contrast, I observed the loss of the mature goblet cell phenotype. Given that Th1 [53], and more recently Th17 [56], responses are linked to C. rodentium infection, it is possible that these polarized T helper type responses are specifically responsible for mediating the loss of the goblet cell phenotype. In this regard, while I see  121  increased IL-17 expression during infection in immunocompenent mice relative to Rag1 KO mice, our lab has in previous studies observed a similar trend with IFN expression [54]. Therefore further studies are needed to address which T cell subsets and potentially which cytokine(s) are specifically responsible for the modulation of goblet cell function during C. rodentium infection.  In addition, my report of direct infection of goblet cells in vivo by C. rodentium reflects a novel and intriguing host-pathogen interaction in the intestine that may have consequences on local colonization by this pathogen. Given C. rodentium, like EPEC and EHEC, can subvert enterocyte function, it is tempting to speculate that these pathogens can also subvert the function of intestinal goblet cells; however this has yet to be explored in detail. Furthermore, the evidence of possible bacterial internalization within goblet cells is intriguing, although its significance and frequency of occurrence remains unclear. While it seems counterintuitive that cells so specialized for secretion as goblet cells could be involved in uptake of luminal contents, it is interesting to note rodent colonic goblet cells have been observed to internalize their apical membrane along with experimentally injected luminal cationic ferritin via endocytosis [71]. Clearly, the interactions between enteric pathogens like C. rodentium and goblet cells reflects a dynamic host-bacterial interaction, with goblet cells exposed to A/E effectors, and C. rodentium directly exposed to proteins secreted by the goblet cell.  In conclusion, I demonstrate that although goblet cells are infected by C. rodentium, they are also subject to functional modulation by the host immune system during in vivo  122  infection by this A/E bacterial pathogen.  As the host can utilize goblet cells for  protection against an array of challenges, understanding how the host modulates goblet cells during A/E and other bacterial challenges will help us determine what role these important cell types are playing during infectious colitis and during maladaptive responses against normal microflora, as observed during human IBD. 2.4 EXPERIMENTAL METHODOLOGY Mice 6 to 8 week old female C57BL/6 mice and Rag1 KO mice (on C57BL/6 background) were purchased from Jackson Laboratories (Bar Harbor, Maine). Mice were kept in sterilized, filter-topped cages, handled in tissue culture hoods and fed autoclaved food and water under specific pathogen free (SPF) conditions. Sentinel animals were routinely tested for common pathogens. The protocols employed were approved by the University of British Columbia’s Animal Care Committee and in direct accordance with guidelines drafted the Canadian Council on the Use of Laboratory Animals.  Bacterial Strains and Infection of Mice Mice were infected by oral gavage with 0.1 mL of an overnight culture of LB containing approximately 2.5 x 108 cfu of wild-type C. rodentium (formerly C. freundii biotype 4280, strain DBS100) [72]. For TEM studies, mice were also infected with the mutant escN C. rodentium strain lacking a functional T3SS [11].  123  Tissue Collection Uninfected control mice, or mice at 6 and 10 DPI were anesthetized with Halothane, killed by cervical dislocation, and colons were resected for further analysis: colons were divided in half to separate the proximal and distal portions. Tissues were immediately placed in 10% neutral buffered formalin (Fisher) for histological studies, or placed in RNA Later (Qiagen) and stored at -86 ºC for subsequent RNA extraction, or 4% paraformaldehyde (PFA) for subsequent freezing and cryosection. For the latter, PFAfixed tissues were washed in PBS, placed in 20% sucrose in PBS overnight at 4°C, and then embedded in Shandon Cryomatrix embedding medium (Thermoelectron Corporation), and the mold was frozen via partial immersion in liquid N2-pre-cooled 2methylbutane, and stored at -20°C until use.  Bacterial Counts Whole mouse colons, including stool were washed thoroughly in PBS (pH 7.4), placed in 1.5 mL of PBS and homogenized at 19 000 rpm for 45 seconds using a Polytron homogenizer (Kinematica). Tissues homogenates were serially diluted in PBS and plated on to MacConkey agar plates, incubated overnight at 37ºC, and bacterial colonies were enumerated the following day. C. rodentium was identified as small round red colonies with a white rim as validated previously [54].  RNA extraction and quantitative RT-PCR Colon tissues stored in RNAlater™ (Qiagen) at -86 ºC were thawed on ice, weighed, and total RNA was subsequently extracted using the Qiagen RNeasy kit following the  124  manufacturer’s instructions. Tissues were homogenized in 1 mL of Buffer RLT (supplied in Qiagen RNeasy kit), using a polytron homogenizer for 1 minute at 26,000 rpm. Total RNA was quantified using a BioRad SmartSpec (BioRad), and 1 – 2 μg of RNA was reverse-transcribed using a Qiagen Omniscript RT kit (Qiagen), according to manufacturer’s instructions. cDNA was diluted 1:25 in RNase/DNase free H2O and 5 μl was added to 15 μl PCR reaction mix. Conventional semi-quantitative PCR was carried out on an Eppendorf Mastercycler, using the primers for murine Muc2, Tff3, or -actin as a house-keeping control. The sequences for all primer sets used, PCR conditions, and cycle numbers are described in Table 2.2. Agarose gels were stained with SYBR Safe ™ DNA gel stain (Molecular Probes), and visualized with a Chemi Doc XRS system (BioRad). Densitometric analysis was carried out using ImageJ software 1.38x (downloaded  from  the  National  Institutes  of  Health  website:  http://rsb.info.nih.gov/ij/download.html). For quantitative PCR, BioRad Supermix was used at a 1:2 dilution, and real-time PCR was carried out using a BioRad MJ MiniOpticon. Quantitation was carried out using GeneEx Macro OM 3.0 software. Melting point analysis confirmed the specificity for each of the PCR reactions, and PCR efficiencies for each of the primer sets were incorporated into the final calculations.  125  Table 2.2 Primer sets and PCR conditions used in chapter 2. # of Cycles a  Target mRNA  PCR cycle conditionsb  (given for  denature/anneal/extend  endpoint PCR  Primer Sets  only) Fwd: 5’-CTGACCAAGAGCGAACACAA-3’  Muc2  94°C, 30s/ 55°C, 30s/ 72°C, 45s  23  94°C, 30s/ 60°C, 30s/ 72°C, 30s  30  94°C, 30s/ 59°C, 30s/ 72°C, 45s  n/a  94°C, 30s/ 60°C, 30s/ 72°C, 30s  n/a  94°C, 30s/ 55-60°C, 30s/ 72°C, 30s  23 or 30  Rev: 5’-CATGACTGGAAGCAACTGGA-3’ †  Fwd: 5’-CAGATTACGTTGGCCTGTCTCC-3’  Tff3 Rev: 5’-ATGCTTGCTACCCTTGGACCAC-3’  †  Fwd: 5’-ATGAGCACAGAAAGCATGATC-3’  TNF- Rev: 5’-TACAGGCTTGTCACTCGAATT-3’  †  Fwd: 5’-GCTCCAGAAGGCCCTCAGA-3’  IL-17A (IL-17) Rev: 5’-CTTTCCCTCCGCATTGACA-3’  -actin  Fwd: 5’-CAGCTTCTTTGCAGCTCCTT-3’ Rev: 5’-CTTCTCCATGTCGTCCCAGT-3’  a  The same primer sets were used for end-point and quantitative PCR experiments described in text.  b  All PCR experiments had an initial denaturing step of 95 °C for 5 mins before commencement of PCR cycling  conditions, and end-point PCR experiments had an extension step of 72°C for 10 mins after the final cycle. †  Tff3 primers from ref. [74]; TNF- primers, ref.[75]; and IL-17 primers, ref. [76].  Histological Staining Briefly, 5 μm paraffin sections were deparaffinized by heating at 55-65 ºC for 10 min, cleared with xylene, rehydrated through an ethanol gradient to water. For periodic acidSchiff (PAS) staining, standard histological techniques were performed. For immunostaining, the primary antibody, either rabbit polyclonal antisera that recognizes the murine colonic mucin Muc2 (a gift from Dr. Jan Dekker) (1:50), rabbit polycolonal antisera generated against rat Tff3 (a gift from Dr. D. Podolsky) (1:200), or rat antisera against C. rodentium Tir (a gift from Dr. W. Deng) (1:500) were used. 126  Primary  antibodies were diluted in PBS containing 1% BSA. For immunoperoxidase staining, antigen retrieval was performed by placing deparaffinized, rehydrated slides in 10mM citric acid pH 6.0 at 90-100 °C for 20 min, followed by cooling to room temperature. HRP-linked goat anti-rabbit IgG (1:200) (Genetex) was used as the secondary antibody. All antibody incubations were carried out in the presence of 0.2% Triton®X-100 (Sigma) to facilitate cell permeabilization. The immunoreaction was developed using SigmaFast DAB substrate (Sigma). Stained sections were washed in water and counterstained with Gill’s hematoxylin, dehydrated through ethanol, cleared in xylene, and mounted using Entellan (EM Biosciences). For double immunofluorescence studies with anti-Muc2 and anti-Tir, no permeabilization or antigen retrieval methods were used to minimize staining for untranslocated Tir still contained within the bacteria. For frozen sections, 6μm sections were cut and placed onto Superfrost/Plus slides (Fisher), and subsequently stained with rat anti-mouse CD3 (clone 17A2, 1:300, BioLegend) for overnight at 4°C, or with rat anti-mouse CD45R/B220 (clone RA3-6B2, 1:100, Becton Dickinson) for 1 hr at room temperature. Immunofluorescent labeling for all stains was carried out with the appropriate secondary antibody using AlexaFluor 488-conjugated goat anti-rat IgG, AlexaFluor 568-conjugated goat anti-rabbit IgG, or AlexaFluor 568-conjugated goat antirat IgG (Invitrogen). Tissues were mounted using ProLong Gold® Antifade (Invitrogen) that contains 4’,6’-diamidino-2-phenylindole (DAPI) for DNA staining. Sections were viewed at 350, 488, and 594 nm on a Zeiss AxioImager microscope. Images were obtained using a Zeiss AxioImager microscope equipped with an AxioCam HRm camera operating through AxioVision software (Version 4.4).  127  Quantitative Histological Studies Goblet Cell Enumeration. PAS/Haematoxylin stained sections at various time points were photographed and the total number of epithelial cells and PAS-positive cells were counted from 20-30 longitudinally-sectioned crypts per section. Goblet cell numbers were expressed as total number of PAS-positive cells per 100 epithelial cells. Phenotypically mature goblet cells were assessed based on intensity of staining, size of the apical region, location on the crypt base to surface axis, and morphology, similar to that described by Katz and co-workers (2002) [73].  Quantification of Infected Crypts.  For crypt infection studies involving double  immunostaining for Muc2 and Tir, crypts exhibiting goblet cell depletion were defined as those with less than 3 Muc2-positive phenotypically mature goblet cells and with little Muc2 within the crypt lumen. Crypts that did not exhibit goblet cell depletion were defined as those with 3 or greater strongly Muc2-positive phenotypically mature goblet cells with an intense secreted Muc2 signal within crypt lumen. Positively infected crypts were defined as those that were positive for Tir staining upon the cells of the surface epithelium and upon cells in the upper third of colonic crypts.  Transmission Electron microscopy Mouse colons were immersed for 3 h in a fixative containing 0.1 M sodium cacodylate, 1.5% paraformaldehyde, and 1.5% glutaraldehyde (pH 7.3). Following the fixation, the material was post-fixed for 1 h on ice in 1% osmium tetroxide in 0.1 M sodium cacodylate (pH 7.3), and stained with 0.1% uranyl acetate. The material was dehydrated  128  in an ascending alcohol series followed by incubation in propylene oxide. The blocks were then left in a 1:1 solution of propylene oxide:Polybed overnight. The material was embedded in 100% Polybed and the resin polymerized at 60°C for 24 h. Sections were viewed and photographed on a Philips 300 electron microscope operated at 60kV.  In vivo Imaging Bacterial strains and generation of bioluminescent C. rodentium.  Bioluminescent  strains of C. rodentium were constructed by introducing plasmid pT7 (Dr. E.A. Meighen, Department of Biochemistry McGill University) carrying the entire lux operon from Photorhabdus luminescens). Bioluminescent colonies were selected on Luria broth (LB) agar plates supplemented with 100 μg/ml of ampicillin and screened using a Model 1420 VICTOR3V Multilable Counter (PerkinElmer). For in vivo tissue imaging, at 6 and 10 days DPI with bioluminescent C. rodentium, mice were anaesthetized and then euthanized. The colons and caeca were removed and opened lengthways so that the lumen was exposed and the tissue was washed with sterile PBS. Tissues were then placed in a light-tight specimen chamber that forms part of the in vivo imaging system (IVIS; Xenogen, Almeda, Calif.).  The bacterial signals were quantified using the  software program LIVING IMAGE (Xenogen) as an overlay on Igor (Wavemetrics, Seattle, WA). For the anatomical location, a pseudocolor image representing light intensity (blue – least intense to red, most intense) was generated using LIVING IMAGE software and superimposed over the greyscale reference image.  129  Immune cell reconstitution of Rag1 KO mice The adaptive immune system was reconstituted into Rag1 KO mice using splenic and mesenteric lymph node (MLN) populations of T and B lymphocytes as previously described [54]. In brief, wild-type immunocompetent mice were euthanized, and their spleens and MLNs were aseptically removed. Spleens and MLNs were placed in RPMI medium with 10% fetal bovine serum, mashed to a pulp with the rubber end of the plunger from a 1.0 mL syringe, and then forced through a 70 μm pore size filter (BD Biosciences), generating a single-cell suspension. Cells were spun down and resuspended in red blood cell lysis buffer (155mM NH4Cl, 1 mM KHO3, 0.01 mM Na2EDTA-2H20, pH 7.4 ) for 5 minutes to lyse red blood cells. Following two washes with RPMI medium, cells were pelleted and then resuspended in phosphate-buffered saline (PBS). Cells were then counted and analyzed for viability by trypan blue exclusion. Recipient Rag1 KO mice were then injected via the tail vein with 2 x 108 viable mononuclear cells. Mice were left for 6 weeks and then tested for the success of reconstitution by staining colonic tissue sections with isolated lymphoid follicles for the presence of T lymphocytes using the marker CD3 and for B lymphocytes using the marker B220.  Statistical Analysis Statistical significance was calculated by using either a two-tailed Student’s t-test or the Mann-Whitney t-test as indicated, with assistance from GraphPad Prism Software Version 4.00 (GraphPad Software, San Diego California USA, www.graphpad.com). A P value of 0.05 was considered significant. The results are expressed as the mean value with standard error of the mean (SEM) or standard deviation (SD) as indicated.  130  2.5 LITERATURE CITED 1. Nataro JP, Kaper JB (1998) Diarrheagenic Escherichia coli. Clinical Microbiology Reviews 11: 142-201. 2. Wales AD, Woodward MJ, Pearson GR (2005) Attaching-effacing Bacteria in Animals. Journal of Comparative Pathology 132: 1-26. 3. Frankel G, Phillips AD, Rosenshine I, Dougan G, Kaper JB, et al. (1998) Enteropathogenic and enterohaemorrhagic Escherichia coli&nbsp;: more subversive elements. Molecular Microbiology 30: 911-921. 4. Clarke SC, Haigh RD, Freestone PPE, Williams PH (2003) Virulence of Enteropathogenic Escherichia coli, a Global Pathogen. Clin Microbiol Rev 16: 365-378. 5. Kaper JB (1998) Enterohemorrhagic Escherichia coli. Current Opinion in Microbiology 1: 103-108. 6. Deng W, Li Y, Vallance BA, Finlay BB (2001) Locus of Enterocyte Effacement from Citrobacter rodentium: Sequence Analysis and Evidence for Horizontal Transfer among Attaching and Effacing Pathogens. Infect Immun 69: 6323-6335. 7. Luperchio SA, Schauer DB (2001) Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes and Infection 3: 333-340. 8. Guttman JA, Samji FN, Li Y, Deng W, Lin A, et al. (2006) Aquaporins contribute to diarrhoea caused by attaching and effacing bacterial pathogens. Cell Microbiol 9: 131-141. 9. Guttman JA, Samji FN, Li Y, Vogl AW, Finlay BB (2006) Evidence that tight junctions are disrupted due to intimate bacterial contact and not inflammation during attaching and effacing pathogen infection in vivo. Infect Immun 74: 60756084. 10. Higgins LM, Frankel G, Connerton I, Gon, ccedil, et al. (1999) Role of Bacterial Intimin in Colonic Hyperplasia and Inflammation. Science 285: 588-591. 11. Deng W, Puente JL, Gruenheid S, Li Y, Vallance BA, et al. (2004) Dissecting virulence: Systematic and functional analyses of a pathogenicity island. PNAS 101: 3597-3602. 12. Handa Y, Suzuki M, Ohya K, Iwai H, Ishijima N, et al. (2007) Shigella IpgB1 promotes bacterial entry through the ELMOâ“Dock180 machinery. Nat Cell Biol 9: 121-128. 13. Boyle EC, Brown NF, Finlay BB (2006) Salmonella enterica serovar Typhimurium effectors SopB, SopE, SopE2 and SipA disrupt tight junction structure and function. Cell Microbiol 8: 1946-1957. 14. Vallance BA, Finlay BB (2000) Exploitation of host cells by enteropathogenic Escherichiacoli 10.1073/pnas.97.16.8799. PNAS 97: 8799-8806. 15. Nougayrede J-P, Fernandes PJ, Donnenberg MS (2003) Adhesion of enteropathogenic Escherichia coli to host cells. Cellular Microbiology 5: 359-372. 16. Gruenheid S, Sekirov I, Thomas NA, Deng W, O'Donnell P, et al. (2004) Identification and characterization of NleA, a non-LEE-encoded type III translocated virulence factor of enterohaemorrhagic Escherichia coli O157:H7. Molecular Microbiology 51: 1233-1249. 131  17. Kelly M, Hart E, Mundy R, Marches O, Wiles S, et al. (2006) Essential Role of the Type III Secretion System Effector NleB in Colonization of Mice by Citrobacter rodentium. Infect Immun 74: 2328-2337. 18. Stevens JM, Galyov EE, Stevens MP (2006) Actin-dependent movement of bacterial pathogens. Nat Rev Micro 4: 91-101. 19. Nagai T, Abe A, Sasakawa C (2005) Targeting of enteropathogenic Escherichia coli EspF to host mitochondria is essential for bacterial pathogenesis: critical role of the 16th leucine residue in EspF. J Biol Chem 280: 2998-3011. 20. Ma C, Wickham ME, Guttman JA, Deng W, Walker J, et al. (2006) Citrobacter rodentium infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption in vivo: role of mitochondrial associated protein (Map). Cellular Microbiology 8: 1669-1686. 21. Dean P, Kenny B (2004) Intestinal barrier dysfunction by enteropathogenic Escherichia coli is mediated by two effector molecules and a bacterial surface protein. Molecular Microbiology 54: 665-675. 22. Guttman JA, Li Y, Wickham ME, Deng W, Vogl AW, et al. (2006) Attaching and effacing pathogen-induced tight junction disruption in vivo. Cell Microbiol 8: 634-645. 23. Kenny B, Ellis S, Leard AD, Warawa J, Mellor H, et al. (2002) Co-ordinate regulation of distinct host cell signalling pathways by multifunctional enteropathogenic Escherichia coli effector molecules. Molecular Microbiology 44: 1095-1107. 24. Celli J, Deng W, Finlay BB (2000) Enteropathogenic Escherichia coli (EPEC) attachment to epithelial cells: exploiting the host cell cytoskeleton from the outside. Cellular Microbiology 2: 1-9. 25. Maresca M, Miller D, Quitard S, Dean P, Kenny B (2005) Enteropathogenic Escherichia coli (EPEC) effector-mediated suppression of antimicrobial nitric oxide production in a small intestinal epithelial model system. Cellular Microbiology 7: 1749-1762. 26. Vallance BA, Deng W, De Grado M, Chan C, Jacobson K, et al. (2002) Modulation of Inducible Nitric Oxide Synthase Expression by the Attaching and Effacing Bacterial Pathogen Citrobacter rodentium in Infected Mice. Infect Immun 70: 6424-6435. 27. Schwartz S, Beaulieu JF, Ruemmele FM (2005) Interleukin-17 is a potent immunomodulator and regulator of normal human intestinal epithelial cell growth. Biochemical and Biophysical Research Communications 337: 505-509. 28. Brand S, Beigel F, Olszak T, Zitzmann K, Eichhorst ST, et al. (2005) IL-28A and IL29 mediate antiproliferative and antiviral signals in intestinal epithelial cells and murine CMV infection increases colonic IL-28A expression. Am J Physiol Gastrointest Liver Physiol 289: G960-968. 29. Cliffe LJ, Humphreys NE, Lane TE, Potten CS, Booth C, et al. (2005) Accelerated Intestinal Epithelial Cell Turnover: A New Mechanism of Parasite Expulsion. Science 308: 1463-1465. 30. Heller, Florian, Bojarski, Richter, Christ, et al. (2005) Interleukin-13 Is the Key Effector Th2 Cytokine in Ulcerative Colitis That Affects Epithelial Tight Junctions, Apoptosis, and Cell Restitution. Gastroenterology 129: 550-564. 132  31. Wang F, Graham WV, Wang Y, Witkowski ED, Schwarz BT, et al. (2005) Interferon-{gamma} and Tumor Necrosis Factor-{alpha} Synergize to Induce Intestinal Epithelial Barrier Dysfunction by Up-Regulating Myosin Light Chain Kinase Expression. Am J Pathol 166: 409-419. 32. Khan WI, Collins SM (2004) Immune-mediated alteration in gut physiology and its role in host defence in nematode infection. Parasite Immunology 26: 319-326. 33. Nair MG, Guild KJ, Artis D (2006) Novel Effector Molecules in Type 2 Inflammation: Lessons Drawn from Helminth Infection and Allergy. J Immunol 177: 1393-1399. 34. Specian RD, Oliver MG (1991) Functional biology of intestinal goblet cells. Am J Physiol Cell Physiol 260: C183-193. 35. Karam SM (1999) Lineage commitment and maturation of epithelial cells in the gut. Front Biosci 4: D286-298. 36. Moncada DM, Kammanadiminti SJ, Chadee K (2003) Mucin and Toll-like receptors in host defense against intestinal parasites. Trends in Parasitology 19: 305-311. 37. Taupin D, Podolsky DK (2003) TREFOIL FACTORS: INITIATORS OF MUCOSAL HEALING. Nature Reviews Molecular Cell Biology 4: 721-732. 38. Deplancke B, Gaskins HR (2001) Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am J Clin Nutr 73: 1131S-1141. 39. Van Klinken BJ-W, Einerhand AWC, Duits LA, Makkink MK, Tytgat KMAJ, et al. (1999) Gastrointestinal expression and partial cDNA cloning of murine Muc2. Am J Physiol Gastrointest Liver Physiol 276: G115-124. 40. Sonnenburg JL, Xu J, Leip DD, Chen C-H, Westover BP, et al. (2005) Glycan Foraging in Vivo by an Intestine-Adapted Bacterial Symbiont. Science 307: 19551959. 41. Taupin DR, Kinoshita K, Podolsky DK (2000) Intestinal trefoil factor confers colonic epithelial resistance to apoptosis. PNAS 97: 799-804. 42. Mashimo H, Wu D-C, Podolsky DK, Fishman MC (1996) Impaired Defense of Intestinal Mucosa in Mice Lacking Intestinal Trefoil Factor. Science 274: 262265. 43. Kindon H, Pothoulakis C, Thim L, Lynch-Devaney K, Podolsky D (1995) Trefoil peptide protection of intestinal epithelial barrier function: Cooperative interaction with mucin glycoprotein. Gastroenterology 109: 516-523. 44. Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, et al. (2002) Colorectal Cancer in Mice Genetically Deficient in the Mucin Muc2. Science 295: 1726-1729. 45. Sachdev HP, Chadha V, Malhotra V, Verghese A, Puri RK (1993) Rectal histopathology in endemic Shigella and Salmonella diarrhea. J Pediatr Gastroenterol Nutr 16: 33-38. 46. Steinberg SE, Banwell JG, Yardley JH, Keusch GT, Hendrix TR (1975) Comparison of secretory and histological effects of shigella and cholera enterotoxins in rabbit jejunum. Gastroenterology 68: 309-317. 47. Lambert ME, Schofield PF, Ironside AG, Mandal BK (1979) Campylobacter colitis. Br Med J 1: 857-859. 48. Wiles S, Pickard KM, Peng K, MacDonald TT, Frankel G (2006) In Vivo Bioluminescence Imaging of the Murine Pathogen Citrobacter rodentium. Infect Immun 74: 5391-5396. 133  49. Mireille KM, Nicole MJS, Michael Mh, Jos AB, Ingrid BR, et al. (2002) Fate of Goblet Cells in Experimental Colitis. Digestive Diseases and Sciences V47: 22862297. 50. Renes IB, Verburg M, Van Nispen DJ, Taminiau JA, Buller HA, et al. (2002) Epithelial proliferation, cell death, and gene expression in experimental colitis: alterations in carbonic anhydrase I, mucin MUC2, and trefoil factor 3 expression. Int J Colorectal Dis 17: 317-326. 51. Deng W, Vallance BA, Li Y, Puente JL, Finlay BB (2003) Citrobacter rodentium translocated intimin receptor (Tir) is an essential virulence factor needed for actin condensation, intestinal colonization and colonic hyperplasia in mice. Molecular Microbiology 48: 95-115. 52. Specian RD, Neutra MR (1981) The surface topography of the colonic crypt in rabbit and monkey. Am J Anat 160: 461-472. 53. Higgins LM, Frankel G, Douce G, Dougan G, MacDonald TT (1999) Citrobacter rodentium Infection in Mice Elicits a Mucosal Th1 Cytokine Response and Lesions Similar to Those in Murine Inflammatory Bowel Disease. Infect Immun 67: 3031-3039. 54. Vallance BA, Deng W, Knodler LA, Finlay BB (2002) Mice Lacking T and B Lymphocytes Develop Transient Colitis and Crypt Hyperplasia yet Suffer Impaired Bacterial Clearance during Citrobacter rodentium Infection. Infect Immun 70: 2070-2081. 55. Arnold JW, Klimpel GR, Niesel DW (1993) Tumor Necrosis Factor (TNF[alpha]) Regulates Intestinal Mucus Production during Salmonellosis. Cellular Immunology 151: 336-344. 56. Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, et al. (2006) Transforming growth factor-[beta] induces development of the TH17 lineage. Nature 441: 231-234. 57. Vesterlund S, Paltta J, Karp M, Ouwehand AC (2005) Measurement of bacterial adhesion--in vitro evaluation of different methods. Journal of Microbiological Methods 60: 225-233. 58. Podolsky DK, Lynch-Devaney K, Stow JL, Oates P, Murgue B, et al. (1993) Identification of human intestinal trefoil factor. Goblet cell-specific expression of a peptide targeted for apical secretion. J Biol Chem 268: 6694-6702. 59. Van der Sluis M, De Koning BAE, De Bruijn ACJM, Velcich A, Meijerink JPP, et al. (2006) Muc2-Deficient Mice Spontaneously Develop Colitis, Indicating That MUC2 Is Critical for Colonic Protection. Gastroenterology 131: 117-129. 60. Smith CJ, Kaper JB, Mack DR (1995) Intestinal mucin inhibits adhesion of human enteropathogenic Escherichia coli to HEp-2 cells. J Pediatr Gastroenterol Nutr 21: 269-276. 61. Mack DR, Michail S, Wei S, McDougall L, Hollingsworth MA (1999) Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am J Physiol Gastrointest Liver Physiol 276: G941-950. 62. Gork AS, Usui N, Ceriati E, Drongowski RA, Epstein MD, et al. (1999) The effect of mucin on bacterial translocation in I-407 fetal and Caco-2 adult enterocyte cultured cell lines. Pediatr Surg Int 15: 155-159.  134  63. Mantle M, Rombough C (1993) Growth in and breakdown of purified rabbit small intestinal mucin by Yersinia enterocolitica. Infection and Immunity 61: 41314138. 64. Vimal D, Khullar M, Gupta S, Ganguly N (2000) Intestinal mucins: the binding sites forsalmonella typhimurium. Molecular and Cellular Biochemistry 204: 107-117. 65. Evans CM, Phillips AD, Walker-Smith JA, MacDonald TT (1992) Activation of lamina propria T cells induces crypt epithelial proliferation and goblet cell depletion in cultured human fetal colon. Gut 33: 230-235. 66. Simmons CP, Clare S, Ghaem-Maghami M, Uren TK, Rankin J, et al. (2003) Central Role for B Lymphocytes and CD4+ T Cells in Immunity to Infection by the Attaching and Effacing Pathogen Citrobacter rodentium. Infect Immun 71: 50775086. 67. Artis D, Potten CS, Else KJ, Finkelman FD, Grencis RK (1999) Trichuris muris: host intestinal epithelial cell hyperproliferation during chronic infection is regulated by interferon-gamma. Exp Parasitol 92: 144-153. 68. Khan WI, Blennerhasset P, Ma C, Matthaei KI, Collins SM (2001) Stat6 dependent goblet cell hyperplasia during intestinal nematode infection. Parasite Immunology 23: 39-42. 69. Vidrich A, Buzan JM, Barnes S, Reuter BK, Skaar K, et al. (2005) Altered epithelial cell lineage allocation and global expansion of the crypt epithelial stem cell population are associated with ileitis in SAMP1/YitFc mice. Am J Pathol 166: 1055-1067. 70. Artis D, Wang ML, Keilbaugh SA, He W, Brenes M, et al. (2004) RELM{beta}/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract. 10.1073/pnas.0404034101. PNAS 101: 13596-13600. 71. Colony PC, Specian RD (1987) Endocytosis and vesicular traffic in fetal and adult colonic goblet cells. Anat Rec 218: 365-372. 72. Khan MA, Ma C, Knodler LA, Valdez Y, Rosenberger CM, et al. (2006) Toll-Like Receptor 4 Contributes to Colitis Development but Not to Host Defense during Citrobacter rodentium Infection in Mice. Infect Immun 74: 2522-2536. 73. Katz JP, Perreault N, Goldstein BG, Lee CS, Labosky PA, et al. (2002) The zincfinger transcription factor Klf4 is required for terminal differentiation of goblet cells in the colon. Development 129: 2619-2628. 74. Hinz M, Schwegler H, Chwieralski CE, Laube G, Linke R, et al. (2004) Trefoil factor family (TFF) expression in the mouse brain and pituitary: changes in the developing cerebellum. Peptides 25: 827-832. 75. Sugawara I, Yamada H, Li C, Mizuno S, Takeuchi O, et al. (2003) Mycobacterial infection in TLR2 and TLR6 knockout mice. Microbiol Immunol 47: 327-336. 76. Happel KI, Lockhart EA, Mason CM, Porretta E, Keoshkerian E, et al. (2005) Pulmonary interleukin-23 gene delivery increases local T-cell immunity and controls growth of Mycobacterium tuberculosis in the lungs. Infect Immun 73: 5782-5788.  135  Chapter 3. Muc2 Protects Against Lethal Infectious Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa2 3.1 INTRODUCTION The attaching and effacing (A/E) bacteria Enteropathogenic Escherichia coli (EPEC) and Enterohemorrhagic E.coli (EHEC) are major contributors to the global disease burden caused by enteric bacterial pathogens [1]. EPEC infects the small bowel causing acute watery diarrhea, fever and nausea [1,2] and is an important cause of infant diarrheal disease in developing countries. EPEC infections lead to the deaths of hundreds of thousands of infants annually from dehydration and other complications [1,3]. In contrast, EHEC (O157:H7) infection is associated with sporadic outbreaks across industrialized countries, due to consumption of contaminated beef or water supplies [1,4]. EHEC colonizes the large bowel and secretes the highly cytotoxic Shiga Toxin (Stx), which can lead to severe hemorrhagic colitis and bloody diarrhea in people of all ages [5]. Children are at an additional risk of EHEC-induced Hemolytic Uremic Syndrome, a potentially fatal complication caused by Stx-mediated acute renal failure [6]. Both EPEC and EHEC are minimally invasive, as they intimately attach to the apical plasma membrane of intestinal epithelial cells via a Type 3 Secretion System (T3SS). Infection causes  2  A version of this manuscript has been published as indicated by the following citation:  Bergstrom, K.S.B., Kissoon-Singh, V., Gibson, D. L., Ma, C., Montero, M. Sham, H. P., Ryz, N., Huang, J. T., Velcich, A., Finlay, B. B., Chadee, K., and Vallance, B. A. 2010. Muc2 Protects Against Lethal Infectious Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa. PLoS Pathog 6(5): e1000902. doi:10.1371/journal.ppat.1000902.  136  localized destruction (effacement) of the epithelial microvilli to form the unique A/E lesion [7]. Significant advances have been made in delineating the mechanisms of A/E lesion formation and their requirement for disease [8]; however, the factors involved in host susceptibility to and defense against A/E pathogens remain ill defined.  As EPEC and EHEC are human-specific and do not cause relevant disease in animal models [7], our understanding of innate and adaptive immunity against these pathogens has come from studying related A/E bacteria that infect other mammals. Citrobacter rodentium is a natural A/E pathogen of mice that infects epithelial cells lining the cecum, descending colon and rectum of the murine large bowel [7,9]. C. rodentium infection leads to an acute colitis, mucosal hyperplasia, barrier disruption, and loose stools, but is resolved in 3-4 weeks in C57BL/6 mice [10]. Since C. rodentium uses similar virulence strategies to those employed by EPEC and EHEC to infect cells, including T3SSmediated intimate attachment and A/E lesion formation, it is widely used as an in vivo model of A/E bacterial infection [10].  The C. rodentium model also allows for  identification of the cells and mediators utilized by the host to control infections by A/E pathogens. While a robust adaptive immune response involving CD4+ T cells and B cells (via immunoglobulin G (IgG) secretion) is required for pathogen clearance [11,12], studies have shown epithelial cells to be important in limiting C. rodentium colonization [13,14]. In this regard, mounting evidence suggests epithelial-derived mucin production is an additional defense mechanism to manage enteric bacterial infections [15,16]. Mucins are high molecular weight glycoproteins characterized by extended serine, threonine, and proline-rich domains in the protein core, which are sites of extensive O-  137  linked glycosylation with oligosaccharides [17]. The mucin gene family contains 16 known members in humans that can be broadly divided into membrane bound or secretory forms [15]. The membrane-bound Muc1, which is produced by all intestinal epithelial cells, has been shown to play a role in host defense against Campylobacter jejuni in vivo, limiting disease and systemic spread [18]. Muc1 is also upregulated in C. rodentium infection [19], although its role in this infection is not known. However, membrane-bound MUC3 has been associated with decreased colonization of EPEC in vitro [20]. Collectively, these studies suggest that mucins may play a role in limiting the pathogenesis of A/E infections.  MUC2 (mouse, Muc2) is the major colonic secretory mucin in humans and mice [21,22]. In contrast to other epithelial mucins in the gut, MUC2 is synthesized specifically by goblet cells of the small and large intestine [22]. These cells constitutively produce MUC2 polymers, which are densely packaged into numerous apically-stored granules, and released into the intestinal lumen to form the structural basis of the mucus–gel layer [21,23]. This layer is a biochemically complex medium, rich in carbohydrates, antimicrobial peptides and other proteins, as well as lipids and electrolytes [23,24]. The depth of the mucus layer varies with the region of the intestinal tract, but is thickest in the colon and rectum, reaching over 800 μm in rodents [25]. Studies have revealed that Muc2-mediated mucus formation in the mammalian colon leads to 2 distinct sublayers; an inner layer that is firmly adherent to the intestinal mucosa, and an outer layer that can be washed off with minimal rinsing [26,27]. Interestingly, commensal bacteria heavily colonize the outer of these two layers, whereas the inner layer is virtually sterile [27]. The  138  mechanisms underlying the formation and function of these sublayers is still under investigation; however, studies in animal models have indicated that Muc2-dependent mucus production profoundly impacts intestinal physiology, as demonstrated in vivo with the generation of Muc2 deficient (Muc2-/-) mice [28], which lack a mucus layer [27]. Depending on their genetic background, aged Muc2-/- mice may develop colorectal cancer [28] and/or spontaneous colitis [29]. Although the exact mechanisms that lead to these intestinal disorders are still elusive, deficiency in mucus production appears to alter the normal localization of commensal microbiota within the colon [27] as well as disrupt the mechanisms that govern epithelial [28,30,31] and immune homeostasis [29,32].  Despite the role of Muc2 in regulating commensal and gut homeostasis, its role in host defense against epithelial-adherent pathogens such as A/E bacteria is not clear. In vitro studies have implicated MUC2 in limiting colonization of epithelial cells by EPEC [20], however the biological significance of this in vivo is undetermined. Indeed, considering that A/E pathogens colonize the mucosal surface and should therefore be constantly in contact with secreted Muc2, there is surprisingly little known about how these pathogens interact with Muc2 and the mucus layer in vivo. This is a critical question since the Muc2-dependent mucus layer is one of the first anatomical features bacteria such as A/E pathogens must encounter before reaching the intestinal epithelium [33]. Such early interactions could therefore profoundly influence the course of infection. The aim of my study was to use the C. rodentium model of A/E bacterial infection in Muc2-sufficient (wildtype) mice and Muc2-deficient (Muc2-/-) mice to understand how A/E bacteria interact with Muc2 and the mucus layer in vivo, and for the first time to assess the role of  139  these interactions in host defense against this important class of bacterial pathogens. My studies reveal novel yet fundamental insights into how Muc2 is used by the host to control infection by an A/E bacterial pathogen.  3.2 RESULTS 3.2.1 C. rodentium penetrates the mucus layer during infection While C. rodentium is known to infect the colonic mucosal surface by directly attaching to epithelial cells, its location with respect to the colonic mucus layer has not been previously assessed in situ. To study this, I infected C57BL/6 mice with a greenfluorescent protein (GFP)-expressing C. rodentium, and at 6 days post-infection (DPI) I euthanized mice and fixed large intestinal tissues in Carnoy’s fixative, which preserves the mucus layer [34]. To maximize my ability to visualize the bacteria, I conducted dual immunostaining for GFP to label C. rodentium, and murine Muc2 to label the inner and outer mucus layer. In uninfected tissues, no GFP-staining was observed, confirming the specificity of the GFP antibody (Figure 3.1, top panels). However, during infection, I found GFP-C. rodentium widely spread in the outer mucus layer, as well as interspersed throughout the normally sterile inner mucus layer often in proximity to infected epithelial cells (Figure 3.1, bottom panels). These are the first studies to definitively show C. rodentium within and ultimately crossing both colonic mucus layers in situ. Since C. rodentium is able to circumvent the mucus barrier, I sought to more clearly define whether this Muc2-rich layer actually protects the host, by infecting mice genetically deficient in Muc2.  140  3.2.2 Muc2-deficient mice exhibit heightened susceptibility to C. rodentium infection I first infected C57BL/6, Muc2+/+ mice and Muc2-/- mice with C. rodentium and monitored body weights and survival over the first 2 weeks of infection. Since I did not detect any significant phenotypic differences between C57BL/6 and Muc2+/+ mice  Figure 3.1 Citrobacter rodentium penetrates the colonic mucus layer in vivo. Dual staining for GFP-expressing C. rodentium and secreted Muc2 using antibodies that recognize either GFP (green), or murine Muc2 (red), with DAPI (blue) as a counterstain. No GFP-labeled C. rodentium can be seen in the mucus layers of uninfected mice (upper panels), but in infected mice, C rodentium is observed within the outer and inner mucus layer in regions where the underlying epithelium is infected (bottom panels). Right panels “a” and “b” are expanded images of corresponding boxed regions in left panels. o = outer mucus layer; i = inner mucus layer; Cr = C. rodentium; GC = goblet cell. Original magnification = 200X. Scale bar = 50 μm.  following infection, I will subsequently refer to these mice as wildtype (WT) mice. As shown in Figure 3.2A, infected WT mice displayed a slight drop in weight at 2 DPI, followed by recovery and a progressive weight gain over the following week. In contrast, Muc2-/- mice steadily lost weight as their infection progressed. By 6 to 10 DPI Muc2-/mice had lost on average over 15% of their initial body mass (Figure 3.2A). This was 141  associated with several clinical signs of morbidity, including hunched posture, bloody diarrhea, and inactivity, to the point where they became moribund and had to be euthanized. Ultimately, depending on the infection, 80-100% of Muc2-/- mice required euthanization, compared to only 0-20% of WT mice (Figure 3.2B).  I hypothesized that Muc2 secretion and mucus layer formation would limit C. rodentium colonization. Therefore, to address whether the mortality suffered by Muc2-/- mice was associated with increased C. rodentium burdens, I monitored bacterial levels first via bioluminescent imaging of live mice using a luciferase-expressing C. rodentium [35]. Significantly stronger overall signals (3 to 11 fold) were observed emanating from the abdomens of Muc2-/- mice at 4 DPI. (Figure 3.2C). To verify this by another method, I conducted colony counts on stool samples from mice following oral infection with a streptomycin-resistant strain of C. rodentium. My results showed significantly increased levels of C. rodentium in the stools of infected Muc2-/- mice, at levels 10 to 100 fold those found in WT mice starting at 2 DPI, and this significance was maintained at 4 and 6 DPI (Figure 3.2D). Thus, Muc2-/- mice were colonized at a faster rate and to a greater extent than WT mice.  142  Figure 3.2 Muc2-/- mice exhibit dramatic susceptibility to C. rodentium-induced morbidity and mortality. A. Body weights following C. rodentium infection of WT (n=10) and Muc2-/- (n=10) mice. Muc2-/- mice rapidly lose weight following C. rodentium infection. Results are representative of 2 independent experiments.  143  B. Survival curve of WT mice (n=10) and Muc2-/- mice (n=10) following C. rodentium infection. Results are representative of 3 independent infections, each with 5-10 mice per group. C. Bioluminescent imaging showing WT and Muc2-/- mice at 4 DPI with a luciferaseexpressing C. rodentium. The color bar is displayed on the left where red corresponds to the highest signal intensity and blue corresponds to the lowest signal intensity, with corresponding logarithmic units of light measurement (photons s-1 cm-2 seradian-1). Overall signal was significantly greater by 3-10 fold in the Muc2-/- mice vs. WT mice (*P = 0.039, students t-test, 3 mice per group). D. Enumeration of C. rodentium in stool at various times post-infection. Each data point represents one animal. Results are pooled from two separate infections. (2 DPI, *P = 0.013; 4 DPI, ***P < 0.0001; 6 DPI, ***P = 0.0004, Mann-Whitney test).  3.2.3 Muc2-/- mice exhibit worsened mucosal damage and microcolony formation on their mucosal surface Concomitant with the increased bacterial burdens were overt signs of worsened macroscopic damage to the large intestines of infected Muc2-/- mice. This was characterized macroscopically by a shrunken cecum, which in approximately () 60% of mice exhibited focal ulcerations (Figure 3.3A, arrow, right panel). There was thickening of the descending colon and rectum (colorectal tissue) of infected Muc2-/- mice (Figure 3.3A left panels), and in 40% of mice ulcers were also observed in these regions. Histological analysis of H&E stained sections confirmed the exaggerated damage in the infected Muc2-/- mice: In the cecum there was marked submucosal edema, extensive regions of mucosal hyperplasia, and increased cellular infiltrate throughout the cecal wall (Figure 3.3B, upper right panel). Similar features were seen in the descending colon and rectum; however, although edema was less overt, there was diffuse damage to the surface mucosa, including ulceration in this region (Figure 3.3C). The inflammatory cell infiltrate consisted primarily of neutrophils and macrophages as assessed by myeloperoxidase (MPO) and F4/80 staining, respectively (Figure A2.1A). In contrast, only minimal 144  pathology and reduced inflammatory cell recruitment was observed in infected WT mice (Figure 3.3A-C; Figure A2.1A)  The increased damage in infected Muc2-/- mice correlated with enhanced expression of genes encoding inflammatory markers including keratinocyte-derived cytokine (KC), monocyte chemoattractant protein-1 (MCP-1), interferon-{gamma} (IFN) and tumor necrosis factor-{alpha} (TNF) primarily in the cecum (Figure 3.3D), and in the colon (Figure A2.1B). I also assessed the expression of genes encoding colitis-associated cytokines that influence susceptibility to C. rodentium infection, including IL-17A and IL17F [36], IL-22 [37], and IL-23 [38]. The levels of these cytokines were up-regulated to a similar degree in infected WT and Muc2-/- compared to uninfected WT mice (Figure A2.1C). Additionally, the IL-22-regulated lectin regenerating islet-derived III gamma (RegIII-) which can prevent C. rodentium-induced mortality in susceptible mice [37], was also highly upregulated in both strains during infection, and elevated at baseline in uninfected Muc2-/- mice (Figure A2.1C).  Although the large intestinal inflammatory  tone (i.e. inflammatory gene expression) of Muc2-/- mice was elevated at baseline relative to uninfected WT mice (Figure 3.3D, and Figure A2.1B and C), this did not translate to any overt inflammatory cell infiltrate or mucosal damage as determined by histopathological scoring (Figure 3.3E); however it was accompanied by increased colonic crypt lengths compared to WT mice, as was previously reported [28] (Figure 3.3C upper left vs. lower left panel), giving rise to the higher score in uninfected Muc2-/vs. WT mice (Figure 3.3E). Overall, following infection, histological damage scores were significantly higher in Muc2-/- mice compared to all other groups (Figure 3.3E).  145  During my histological examinations, I also noticed focal aggregation of C. rodentium on the mucosal surface of colorectal tissues in Muc2-/- mice, giving rise to bacterial microcolonies, similar to those described by Bry and Brenner [39]. These C. rodentium microcolonies were frequently seen overlying ulcerated mucosal regions (Figure 3.3C, upper right panel), which were highly populated with neutrophils in direct contact with the microcolonies (Figure A2.1D). The ulcers also contained macrophages and necrotic epithelial cells (not shown).  These microcolonies and ulcers were not observed in  infected WT mice (Figure 3.3C, bottom right panel).  146  Figure 3.3 Heightened mucosal damage in Muc2-/- mice is associated with increased pathogen burdens and mucosa-associated bacterial overgrowths. A. Resected large intestines of uninfected and infected WT and Muc2-/- mice at 6 DPI. Note the shrunken, inflamed cecum of Muc2-/- mice compared to uninfected Muc2-/- mice, as well as the focal ulcers (arrow, right panel). 147  B. H&E stained cecal sections from uninfected and infected WT and Muc2-/- mice at 6 DPI. Inflammation is found throughout the mucosa and submucosa of Muc2-/- mice (top right panel). Original magnification = 100X. Scale bar = 100 μm. C. H&E stained sections of descending colons from uninfected and infected WT and Muc2-/- mice at 6 DPI. Diffuse damage is associated with the mucosa of infected Muc2-/mice. C. rodentium microcolonies can be seen associated with the mucosa in regions of ulceration (arrowhead, top right panel). Original magnification = 100X. Scale bar = 100 μm. D. Quantitative PCR results of pro-inflammatory chemokine and cytokine gene expression analysis in the ceca of uninfected or infected mice. Results represent the mean of the averages from 3 independent infections, each with 2-4 mice per group. Error bars = SEM. E. Cumulative histologic damage scores from colorectal tissues of WT vs Muc2-/- mice under uninfected and infected conditions. Scores were determined by two independent observers under blinded conditions. Results represent the means of 3-9 experiments with 2-4 mice per group. Error bars = SEM (*P < 0.05, **P < 0.005, *** P < 0.0001, Students t test).  3.2.4 Muc2 deficiency renders mice more susceptible to attenuated C. rodentium strains, although susceptibility is T3SS dependent I next asked whether the mucosal injury occurred through previously described virulence mechanisms. C. rodentium, as well as other A/E pathogens, is known to cause epithelial injury and apoptosis primarily through the actions of the translocated effector EspF [40,41]. This effector plays a critical role in causing ulcerations in other susceptible mouse strains [42], so I infected both WT and Muc2-/- mice with wildtpe (wt) or espF C. rodentium. As expected, the wt and espF mutant caused minimal morbidity to WT mice as assessed by measurement of weight loss (Figure 3.4A).  In contrast, there was  significant weight loss in the Muc2-/- mice infected with espF C. rodentium that was associated with 60% mortality rate, although there was a delay in the onset of these phenotypes compared to wt C. rodentium infection (Figure 3.4B). Moreover, consistent with these results, there were higher fecal espF C. rodentium burdens in Muc2-/- mice  148  compared to WT mice (Figure 3.4C). Interestingly, histology revealed that the espF C. rodentium strain also formed the same microcolonies as wt C. rodentium, in concert with focal mucosal ulcerations underlying these overgrowths (Figure 3.4D).  These data  indicate that these microcolony-associated ulcerations develop independently of the translocated effector EspF.  To further test the degree of susceptibility of Muc2-/- mice, I infected them with a C. rodentium strain, escN, which is unable to form a functional T3SS and is therefore severely impaired in virulence [43,44]. In contrast to the espF mutant, escN C. rodentium failed to induce weight loss in Muc2-/- mice, or colonize it to any significant degree (Figure 3.4E&F). Collectively these results show that Muc2-deficiency renders mice more susceptible to even attenuated A/E bacterial pathogens; however the susceptibility does not extend to strains lacking a functional T3SS. 3.2.5 Muc2 limits initial colonization of the mucosal epithelia, but ultimately controls the levels of luminal bacteria loosely associated with the tissue While my histological stains confirmed that C. rodentium crosses the mucus layer to infect the underlying epithelium, the analysis of fecal burdens suggested that Muc2 limits C. rodentium colonization of large bowel epithelium. Consistent with this idea, in vitro studies have shown that rabbit mucins can inhibit EPEC attachment to epithelial cells in  149  Figure 3.4 Muc2 deficiency renders mice more susceptible to attenuated C. rodentium strains, but susceptibility is T3SS dependent. A. Body weights following infection of WT and Muc2-/- mice with wt or espF C. rodentium. n=5 mice per group. Error bars = SEM. B. Survival curve of wt or espF C. rodentium infected WT (n=5) and Muc2-/- mice (n=5). espF C. rodentium infection results in comparable mortality to that of wt C. rodentium in Muc2-/- mice. C. Assessment of fecal burden of wt or espF C. rodentium. Each data point represents the value from one individual. Error bars = SEM (Muc2-/- + espF Cr vs. WT + espF Cr, *P = 0.0286; Muc2-/- + espF Cr vs. WT + wt Cr, *P = 0.0286, Mann-Whitney test).  150  D. Representative H&E staining of colorectal section from espF C. rodentium-infected Muc2-/- mice. Arrow points to espF C. rodentium microcolony on an ulcerated mucosal surface. Original magnification = 200X. Scale bar = 50 μm. E. Analysis of body weights of wt or escN C. rodentium infected Muc2-/- mice. Results are representative of 2 independent infections, with 2-3 mice per group. F. Assessment of fecal burdens of mice in E. Results are pooled from 2 individual experiments with 2-3 mice per group (**P = 0.005, Mann-Whitney test). culture [45]. These data collectively suggest mucus may play a role in innate host defense by acting as a physical barrier to limit pathogen access to the epithelium. I tested this using an in vivo colonization assay. This was performed through cecal loop surgery in WT and Muc2-/- mice, where the ascending colon was tied off with sutures and 1 x 108 C. rodentium were injected into the cecum (see also Section 3.4 “Experimental Methodology”). Ten hours later, when the mice were euthanized and the ceca were removed, thoroughly washed of their contents, homogenized and plated, I found significantly greater numbers of adherent bacteria attached to the ceca of Muc2-/- mice compared to WT mice (Figure 3.5A). These counts were supported by immunostaining for the C. rodentium-derived infection marker Tir (translocated intimin receptor) [46], where a greater mucosal surface area was positive for Tir in the Muc2-/- ceca, compared to WT ceca that exhibited only patchy Tir staining (Figure 3.5B). These results demonstrate that Muc2 production limits the rate of intestinal epithelial colonization by this A/E pathogen in vivo.  Despite these findings, it was unclear if a doubling in the colonization rate, as seen in the cecal loop model could explain the 10-100 fold increase in total pathogen burdens found in the orally infected Muc2-/- mice.  I therefore quantified intimately adherent (i.e.  directly infecting epithelial cells) versus luminal (non-infecting) C. rodentium in the cecal 151  and colorectal tissues of orally infected WT and Muc2-/- mice, focusing on 4 and 7 DPI, prior to when Muc2-/- mice become moribund. Unexpectedly, I found no significant difference at either time point in the number of intimately adherent C. rodentium in the large bowel of Muc2-/- mice compared to WT mice (Figure 3.5C). However there was a significant and dramatic 10-fold increase in the numbers of luminal C. rodentium recovered from Muc2-/- mice compared to WT mice (Figure 3.5C).  To clarify what these burdens meant with respect to how C. rodentium interacted with the mucosa in situ, I stained for C. rodentium lipopolysaccharide (LPS) as well as the infection marker Tir. Immunostaining at 4 DPI showed that in both strains, C. rodentium primarily infected the mucosal surface (Tir-positive), but did not invade the crypts (Figure 3.5D). Interestingly, while there was significantly more LPS staining in Muc2-/tissues, most of the staining was focused in patches where large numbers of C. rodentium accumulated on the mucosal surface, although only a small fraction of these bacteria expressed Tir and were thus directly attached to and infecting the epithelium (Figure 3.5D, bottom panels). These results indicate that Muc2 deficiency does not significantly impact the total number of bacteria that ultimately infect the tissue, but predisposes the large bowel to greater numbers of loosely (i.e. non-epithelial) adherent bacteria on the mucosal surface, giving rise to the increased overall luminal burdens. As the infection progressed to 6 DPI, when mice started to become moribund, it appeared that the microcolonies were more invasive, as they penetrated deeper into the crypts and were more frequently associated with ulcerated regions (not shown, and Figure 3.3). Thus the propensity to accumulate bacteria on the surface of a Muc2-deficient mucosa is likely a  152  key contributory factor to the ulcer development that occurs in these mice during infection.  153  Figure 3.5 Muc2 limits initial pathogen colonization of the mucosal epithelia, but ultimately controls levels of luminal pathogen burdens. A. Fold differences of intimately adherent C. rodentium numbers present in the ceca of WT vs Muc2-/- mice 10 hours post-injection of 1.5 x 108 CFU into cecal lumen in a cecal loop surgery experiment (see Material & Methods). Results are of data from a total of 5 mice per group pooled from 2 individual experiments. Error bars = SEM (*P = 0.0109, Mann-Whitney test). B. Representative immunostaining for the C. rodentium-specific effector Tir in ceca acquired from cecal loop surgery, 10 hrs post-injection. C. rodentium is found on the surface of Muc2-/- cecal mucosa in a continuous fashion compared to WT mice, where Tir staining is patchy amid long stretches of uncolonized surface epithelium (white arrows). Original magnification, 100X. Scale bar = 100μm. C. Quantification of luminal C. rodentium vs. intimately adherent C. rodentium attached to the cecal and colonic mucosa in WT vs. Muc2-/- mice at 4 and 7 DPI. Results represent the mean value pooled from 2 independent infections containing 3-4 mice per group. Error bars = SEM (*P = 0.0140; **P = 0.005, Mann-Whitney test). D. Visualization of C. rodentium infection by staining for LPS (green) and Tir (red; red arrowhead), with nuclei specific DAPI (blue).as a counterstain. Tir staining is localized to the surface epithelium in both WT and Muc2-/- mice indicating direct infection, but the majority of LPS-positive cells in Muc2-/- mice are not infecting (Tir-negative), yet are accumulating on the surface of the mucosa. Original magnification, 200X. Scale bar = 50μm.  3.2.6 The increased luminal C. rodentium burdens in Muc2-/- mice are not due to intrinsic defects in antimicrobial activity at their mucosal surface I have shown that the mucus layer provides a structural barrier that limits initial C. rodentium attachment in vivo; however, this barrier effect does not readily explain the accumulation of loosely adherent bacteria and microcolony formation at the mucosal surface of Muc2-/- mice. One plausible explanation for these overgrowths is an overall reduction in antimicrobial activity at the epithelial surface.  To assay antimicrobial  production in Muc2-/- mice, I first looked at the gene expression levels for epithelialderived murine cathelicidin-related antimicrobial peptide (mCRAMP) and inducible nitric oxide synthase (iNOS) whose products have been shown to play a role in controlling C. rodentium levels in vivo [13,47]. I did not see any significant differences 154  in the expression of cnlp (mCRAMP), between mouse strains however, and the expression of inos was higher in Muc2-/- mice (Figure 3.6A). These data were supported at the protein level by immunostaining (not shown), indicating that the loss of Muc2 does not result in overt defects in the expression or production of innate factors known to control this pathogen.  An alternative explanation could be that Muc2 is essential for controlling pathogen numbers on the colonic surface by mediating direct antibacterial activity as shown for gastric mucus against Helicobacter pylori [44], and/or indirect activity by acting as a matrix to strategically position host defense peptides, as recently shown for small bowel mucus [43]. To address this in the large bowel, I tested the antimicrobial activity of crude mucus isolated from the colorectal tissues of WT uninfected mice, in a manner similar to that described by Meyer-Hoffart et al [48]. Interestingly, I found no evidence that the crude colonic mucus had any antimicrobial activity against C. rodentium; instead, the addition of the mucus actually led to increased C. rodentium growth, likely by acting as a nutrient source (Figure 3.6B).  155  Figure 3.6 Evidence that Muc2-/- mice do not have intrinsic defects in anti- microbial activity at their mucosal surface. A. Quantitative PCR analysis of cnlp (encodes mCRAMP) and inos expression in the cecum and rectal tissues of WT and Muc2-/- mice. Results represent the means from 3 independent infections, each with 2-3 animals per group. Error bars = SEM. B. Titration curve from a microtitre assay showing crude mucin isolated from colorectal tissues of WT mice contains dose-dependent growth activity on C. rodentium. Assay was performed in duplicate for each dilution. Error bars = SEM. Results are representative of 2 independent experiments. 3.2.7 Mucus secretion is increased in response to C. rodentium infection In the absence of antimicrobial activity by the mucus layer, another mechanism by which Muc2 could limit luminal numbers of C. rodentium is by binding to and mechanically flushing C. rodentium out of the colon. It has already been shown that intestinal mucus binds with high affinity to pathogens [49] including C. rodentium [19], and that bacterial products [50] as well as host factors stimulate mucin release both in vitro and in vivo [51]. Therefore, I hypothesized that enhanced mucus secretion could be key to the rapid removal of loosely adherent C. rodentium from the mucosal surface. To determine if I could see evidence of this histologically, I first conducted periodic acid-Schiff (PAS) staining on Carnoy’s-fixed colorectal sections from uninfected and C. rodentium-infected mice at 6 DPI. As shown in Figure 3.7A, infected WT mice showed evidence of increased luminal mucus staining compared to uninfected mice.  156  To quantify this increased mucus production, I, (with the help of PhD candidate Ms. Vanessa Kissoon-Singh and Prof. Kris Chadee) conducted pulse-chase experiments using [3H]-glucosamine injections in mice to metabolically label glycoproteins such as mucins in uninfected and infected mice. Mucin secretion was analyzed at 6 DPI when bacteria exhibit uniform colonization of the distal colorectal mucosa. At 3.5 hrs post-injection of [3H]-glucosamine, we extracted total secretions from the entire colon of control and infected mice, and quantified the secretions via scintillation counting. I observed 30% higher total counts per minute (CPM) in secretions from infected vs. uninfected mice (Figure 7B). To determine how this related to mucin vs. non-mucin production, we subjected the [3H]-labeled secretions to fractionation on a Sepharose 4B column calibrated with blue dextran (fractions 17-22), and ovalbumin (fractions 30-35) where mucins are eluted in the void volumes (Vo) and non-mucin glycoproteins are eluted in later fractions (Vt) [52].  Graphical analysis of the fractions (Fraction # vs. CPM),  revealed a higher amplitude and larger breadth of the peak of the Vo fractions (#13-21) of D6-infected mice compared to uninfected controls (Figure 3.7C). This translated to an average 40 ± 10% increase in [3H]-labeled mucin in the pooled high molecular weight Vo fractions in infected mice (Figure 3.7D).  To visualize how mucus secretion specifically impacts host-pathogen interactions, I conducted dual epifluorescent staining for C. rodentium LPS and Ulex europaeus agglutinin UEA-1, which binds to fucosylated residues abundant in mucus. Staining was performed on colorectal tissues at 6 DPI in WT mice in heavily infected regions where  157  Muc2/mucus responses were underway. Supporting and extending the findings of previous reports [19,44] I identified a single layer of C. rodentium infecting the epithelium, with no signs of microcolony formation. Instead numerous individual C. rodentium were seen intermixed within the luminal mucus directly above but not in contact with intimately adherent bacteria (Figure 3.7E, left panel and inset). In stark contrast, when I conducted UEA-1/LPS staining in Muc2-/- mice (6 DPI) I found that, although there were UEA-1 positive hypotrophic goblet cells, the crypt lumens were devoid of mucus as expected, and the absent mucus was replaced by a C. rodentium microcolony on the surface epithelium (Figure 3.7E, right panel). These results strongly suggest that secretion of mucus is important for removing loosely associated bacteria from the mucosal surface.  158  Figure 3.7 C. rodentium infection results in increased mucin secretion during infection. A. Representative PAS/Haematoxylin staining of Carnoy’s fixed rectal sections from uninfected (left panel) and C. rodentium-infected mice (right panel). Arrow points to luminal mucus. Original magnification = 100X. Scale bar = 100μm. B. Total counts per minute (CPM) of [3H]-glucosamine labeled glycoproteins found in colorectal secretions 3.5 hrs post-injection from uninfected and infected (6 DPI) WT mice. Results are representative of 2 independent infections containing 5 mice per group. 159  C. Plot of liquid scintillation counts of fractions containing [3H] activity after total secretions were subjected to gel filtration on a Sepharose 4B chromatography column. This graph is representative of 2 independent infections with 5 mice per group. D. Graph of total CPMs of void volumes of S4B-fractionated mucins as described in D. Data represents the mean of the average of 2 independent experiments, each with 5 mice per group. Error bars = SEM. E. Combined epifluorescent staining for mucus using the lectin UEA-1 (red), and C.rodentium LPS (green), and cellular DNA (blue) using DAPI as a counterstain in heavily infected (6 DPI) regions of the colorectal mucosa from WT and Muc2-/- mice, as indicated. Individual C. rodentium (arrowhead, inset “a”) can be seen in mucus overlying a single layer of C. rodentium on the mucosal surface of a WT mouse. A C. rodentium microcolony (white arrow) can be seen in vicinity of a Muc2/mucus-deficient environment as indicated by the absence of mucus in the crypt lumens in Muc2-/- mice compared to WT mice (yellow arrow). Original magnification = 200X. Scale bar = 50μm. Although Muc2 is the major secreted mucin in human and mouse colon under baseline and inflammatory conditions [27,53,54], other intestinally expressed mucins may also contribute to the secreted mucin pool. I assessed the gene expression of several mucins that have been implicated in C. rodentium infection, and/or that are up-regulated in colitis, including the cell-surface mucins Muc1 and Muc3/17, and Muc13 [19], and the secreted non-gel forming mucin Muc4 that can be expressed by goblet cells [19,55]; I also looked mucins that have gel-forming capacity, including the secreted gel-forming salivary and gastric mucins Muc19 [56] and Muc6 [57] respectively. There were no major changes in any of these mucins except for Muc6 which was elevated in Muc2-/mice at baseline and also increased in WT mice during infection relative to uninfected WT controls (Appendix 2, Figure A2.2A). However, because PAS staining revealed a virtual absence of mucin-filled phenotypically distinct goblet cells, and luminal mucus, under uninfected and infected conditions in Muc2-/- mice compared to WT mice (Figure A2.2B), this suggests that the expression of other mucins, particularly secreted gel forming mucins, do not compensate for the loss of Muc2 during C. rodentium infection. 160  3.2.8 Muc2 secretion regulates commensal and pathogen numbers in the large bowel lumen Uninfected Muc2-/- mice have been shown to exhibit commensal bacteria interacting with their mucosal surfaces more frequently than WT mice [27]. Interestingly, following staining for C. rodentium LPS within the microcolonies, I noted numerous LPS-negative bacteria intermixed with the positively staining bacteria (Figure 3.8A), suggesting these microcolonies contained other bacterial species in addition to C. rodentium. To test this I conducted dual fluorescence in situ hybridization (FISH) staining on colorectal sections of infected Muc2-/- mice as well as WT mice after infection using a Texas-Red conjugated EUB338 probe that recognizes 99% of all bacteria, as well as an AlexaFluor 488-conjugated GAM42a probe that detects -Proteobacter, the class to which C. rodentium belongs [58]. My results show that in regions of microcolony formation in infected Muc2-/- mice, the majority of bacteria were EUB338+GAM42a+ (C. rodentium, yellow), but there were distinct clusters of EUB338+GAM42a (commensal, red) bacteria mixed in with the EUB338+GAM42a+ cells, confirming that these microcolonies contain non-C. rodentium bacterial species (Figure 3.8B, left panels).  Moreover, numerous  commensal species could be seen interacting with the epithelium in other regions (not  161  Figure 3.8 Increased luminal load of both pathogenic and non-pathogenic bacteria in Muc2-/- mice during infection. A. Immunofluorescence staining for C. rodentium LPS and DAPI in Muc2-/- at 4 DPI Notice DAPI-stained bacteria that are negative for LPS in the C. rodentium microcolonies (arrow). Original magnification = 200X. B. Dual FISH staining using DNA probes that label virtually all true bacteria (EUB338, red) and the -Proteobacter class to which C. rodentium belongs (GAM42a, green). Pathogenic bacteria (i.e. EUB338+/GAM42a+ cells) are yellow, and commensal bacteria (EUB338+/GAM42–) cells are red. Note the non-ulcer associated bacterial microcolony containing commensal bacteria (red) mixed in with pathogenic bacteria (yellow) in Muc2-/- mice (left panels). Such mixed microcolonies were not seen in WT mice, which show predominantly pathogenic bacteria intimately adherent to the mucosa (right panel). 162  Tissues were fixed in Carnoy’s fixative prior to processing. Original magnification = 200X. Scale bar = 100μm. C. SYBR green quantification of total bacterial burden per gram of colorectal lumen contents of WT vs. Muc2 -/- mice before infection and at 6 DPI. Results are presented as the means of a total of 5-7 mice per group pooled from 2 independent experiments. Error bars = SEM (**P = 0.0082, Mann-Whitney test). D. Graph illustrating the percent composition of -Proteobacter (EUB338+/GAM42a+ cells), which is primarily represented by C. rodentium, in colorectal luminal content from uninfected or infected WT vs. Muc2-/- mice. Results are the mean percentages from a total of 5-7 mice per group pooled from 2 independent experiments. ND, none detected. Error bars = SEM. E. FISH staining as described above, showing a thick biofilm of mostly pathogenic but also commensal bacteria on the mucosal surface in a colonic section from a moribund Muc2-/- mouse at 10 DPI (inset). Such phenotypes were not observed in WT mice. Original magnification = 200X. Scale bar = 50μm.  shown). In contrast, in WT mice (6 DPI) the epithelial surface was primarily colonized with EUB338+GAM42a+ cells as expected (Figure 3.8B, right panel); and while scattered EUB338+GAM42a bacteria were occasionally seen in the luminal mucus or near the surface, I did not observe them forming microcolonies with C. rodentium or interacting with the mucosal surface as I observed in Muc2-/- mice. The above results suggest that if Muc2 promotes host defense by flushing C. rodentium away from the mucosal surface and out of the colon, then most enteric microbes, including commensals, would be affected by such a response. Recent studies have shown that C. rodentium induced colitis causes dramatic, host-mediated changes in the commensal bacterial communities in the murine colon, including a significant reduction in total commensal numbers [58]. To test whether Muc2 plays a role in this response I measured bacterial numbers within the colorectal lumen via SYBR green staining in uninfected and infected WT and Muc2-/mice. My results show comparable bacterial densities in the colons of uninfected WT and Muc2-/- mice (Figure 3.8C). During infection of WT mice, the density of total luminal bacterial numbers began decreasing over the course of infection, with a 40% 163  reduction evident by 6 DPI, consistent with the findings of Lupp et al. [58]. In contrast, there was a 30% increase in the total luminal bacteria recovered from Muc2-/- mice, a density significantly greater than that recovered from WT mice (Figure 3.8C). Analysis of the colorectal luminal contents revealed that although the percent composition of Proteobacter, most of which are C. rodentium [58,59], in the Muc2-/- mice was slightly greater compared to WT mice (Figure 3.8D) the vast majority (97%) of the bacteria in both mouse strains were commensals. Thus, Muc2-/- mice do not undergo the commensal loss seen in the WT mice, and in fact, exhibit a trend toward increased numbers compared to uninfected controls, although this was not significant.  As the infection  progressed up to 10 DPI in the Muc2-/- mice, FISH staining revealed that the mucosa became covered with a thick biofilm of pathogenic microbes mixed in with commensal bacteria (Figure 3.8E), which was never observed in WT mice. These results collectively suggest that during infection, Muc2 plays a critical role in regulating both pathogen and commensal interactions at the mucosal surface. 3.2.9 Exaggerated barrier disruption and translocation of pathogenic and commensal bacteria in infected Muc2-/- mice Next, I examined the factors potentially responsible for the high mortality rates seen in infected Muc2-/- mice. I speculated that the increased numbers of luminal and surfaceassociated bacteria would not on their own cause the deaths of Muc2-/- mice, however the association of the loosely-associated overgrowths with superficial ulceration (Figure 3.3C) suggested that infection-induced epithelial barrier disruption and bacterial translocation might play a causal role in their mortality. To assess this potential, I infected WT and Muc2-/- mice, and at 5 DPI I orally gavaged the mice with fluorescein 164  isothiocyanate (FITC)-Dextran (4 kDa) (FD4) and assessed the translocation of FD4 from the gut lumen into the serum. My results showed a striking and significant increase in the amount of FD4 in the serum of infected Muc2-/- mice compared to infected WT mice and uninfected Muc2-/- mice (Figure 3.9A). These results demonstrate that C. rodentium infection leads to a dramatic increase in intestinal permeability in the absence of Muc2. As expected, I saw similar results in response to espF C. rodentium (not shown). To determine whether the exaggerated barrier disruption seen in Muc2-/- mice led to greater systemic pathogen burdens, I analyzed systemic sites, including the spleen, liver and mesenteric lymphnodes (MLNs) at 6 DPI. I found significantly higher C. rodentium burdens in the spleen, liver, and a trend toward higher burdens in the MLNs in infected Muc2-/- vs. WT mice (Figure 3.9B). I also found consistently higher colony forming units (CFUs) of C. rodentium isolated from whole blood of Muc2-/- mice that was plated directly after cardiac puncture (Figure 3.9C).  Since increased commensal numbers were observed loosely associated with the epithelial surface, I examined their interactions with the damaged tissue by FISH as above. When I stained the ulcerated regions, I observed EUB338+GAM42a (commensal) bacteria interacting with numerous invasive EUB338+GAM42a+ (C. rodentium) microcolonies, and both were found amidst a dense population of polymorphonuclear leukocytes  165  Figure 3.9 Susceptibility of Muc2-/- mice to C. rodentium is associated with severe defects in intestinal barrier function and increased translocation of commensal and pathogenic bacteria. Muc2-/- mice display increased FITC-dextran flux across the intestinal mucosa during C. rodentium infection. Uninfected or C. rodentium infected (5 DPI) WT and Muc2-/- mice were gavaged with FITC-dextran (4 kDa) and serum was taken by cardiac puncture 4 hrs later, as described in Section 3.4 “Experimental Methodology”. 166  A. Quantity of FD4 in serum from WT and Muc2-/- mice. Bars represent the average value of a total of 5-7 mice per group pooled from 2 individual experiments. Error bars = SEM (**P = 0.0051; ***P = 0.0006, Mann-Whitney test). B. Quantification of viable C. rodentium found in splenic, liver, and MLN compartments in WT and Muc2-/- mice at 7 DPI. Each data point represents one individual. Bars represent the means of 9 WT and 12 Muc2-/- mice pooled from 3 independent experiments. Error bars = SEM. C. Enumeration of live bacterial burdens cultured from the serum of Muc2-/- and WT mice at 6 DPI. Results represent the average of 8 WT and 12 Muc2-/- mice pooled from 3 independent experiments. Error bars = SEM. D. FISH staining showing invasive microcolonies within an ulcerated region in the descending colon of an infected Muc2-/- mouse. Pathogenic bacteria can be seen engulfed by PMNs that are attacking the microcolony (inset “a”, arrowheads). A commensal bacterial microcolony (red) can also be seen amongst the C. rodentium microcolonies and in contact with PMNs (inset “b”, arrow). Original magnification 200X. Scale bar = 100μm. E. Numerous -Proteobacter (C. rodentium, yellow; yellow arrowhead in inset) and non-Proteobacter (red; white arrowhead in inset) can be seen invading the lamina propria of infected Muc2-/- mice (6 DPI). Lu = gut lumen. LP = lamina propria; Original Magnification, 200X. Results are representative of 3 separate experiments.  (PMNs) (Figure 3.9D). Numerous bacteria were also seen within the cell bodies of PMNs (Figure 3.9D, insets “a” and “b”). At times of barrier disruption, large numbers of both C. rodentium and non--Proteobacter species could be found deep within the mucosa of infected Muc2-/- mice (Figure 3.9E). Rarely if ever were microbes observed in the mucosa of infected WT mice. These results strongly suggest that both pathogenic and commensal bacteria contribute to the disease and mortality suffered by Muc2-/- mice, since A/E bacterial infection-induced disruption of the epithelial barrier allows massive translocation of both pathogenic and commensal bacteria out of the intestinal lumen and into mucosal tissues, and pathogens into systemic compartments, leading to bacteremia.  167  3.2.10 Evidence that Muc2-deficiency reduces host-mediated pathogen clearance when commensal-dependent host colonization resistance is compromised The above data show commensal and pathogenic bacteria occupying intestinal niches in Muc2-/- mice that are not colonized in WT mice during infection. To attempt to elucidate the precise role of commensal bacteria during C. rodentium infection in Muc2-/- mice, I administered a high dose of the antibiotic streptomycin (20mg/mouse) by oral gavage to reduce the numbers of total commensals prior to infection. Stool was collected immediately prior to treatment and again 24 hrs later, and then stool bacteria was quantified as above to confirm commensal depletion. Streptomycin (strep) treatment resulted in a significant (average 10-20 fold) reduction in commensal bacterial numbers in both WT and Muc2-/- mice, while vehicle treatment did not cause any significant changes (Figure 3.10A). Neither treatment led to any inflammation or pathology on its own when assessed 7 days later (not shown). 24 hrs after treatment, strep- and vehicletreated WT and Muc2-/- mice were also gavaged with espF C. rodentiumStr (strepresistant), which was chosen instead of wt C. rodentium because it is less virulent. Colonization was assessed by plating stool contents every second day. The results show that at 2 DPI, strep-treated WT and Muc2-/- mice carried 10-50 fold higher bacterial burdens compared to infected vehicle-treated WT and Muc2-/- mice (Figure 3.10B). However by 4 and 6 DPI, while espF C. rodentiumStr burdens began to decline in infected strep-treated WT mice ultimately to levels similar to infected vehicle-treated WT mice (6 DPI), bacterial burdens in infected strep-treated Muc2-/- mice continued to increase to levels significantly higher than all other groups (Figure 3.10B). Moreover, burdens in infected vehicle-treated Muc2-/- mice also increased to levels that were higher  168  than infected strep-treated WT mice at 6 DPI. Although weight loss varied among both Muc2-/- groups, only WT mice tended to gain weight during infection (Figure 3.10C).  At 6 DPI, both cecal and colonic tissues were resected and assessed by histology. As shown by H&E (Figure 3.10D, bottom panels), strep-treatment led to increased edema and inflammation in WT ceca compared to vehicle-treated WT mice during infection; however in infected Muc2-/- tissues, there were no obvious differences in cecal and colonic inflammation between strep-and vehicle-treated groups (Figure 3.10D, top panels).  Overt ulceration was seen in the ceca of vehicle-treated Muc2-/- mice (Figure  3.10E), while ulcers were observed in the colons of strep-treated Muc2-/- mice (Figure 3.10F) Interestingly, FISH staining of cecal sections from infected vehicle-treated Muc2-/mice showed large numbers of commensals (EUB338+GAM42a, red) directly interacting with PMNs in ulcerated regions (Figure 3.10E, left panel). These interactions were seen at the mucosal surface of ulcers where there was little evidence of espF C. rodentium; however espF C. rodentiumStr could still be seen within the PMNs (Figure 10E, right panel, inset). In contrast, large invasive espF C. rodentiumStr microcolonies (EUB338+GAM42a+, yellow) could be seen associated with the ulcers in the colons of infected strep-treated Muc2-/- mice (Figure 3.10F, right panel).  Such pathology was  never observed in uninfected mice or in any of the infected WT groups.  Collectively,  these results indicate that (i) Muc2 promotes host-mediated colonization resistance when commensals are depleted; and (ii) commensals, although initially important in promoting colonization resistance in both strains, ultimately come into direct contact with large numbers of PMNs following the infection-induced ulceration that occurs in a Muc2-  169  deficient environment. Thus Muc2 is critical for managing commensal and pathogenic bacteria within the GI tract, particularly at mucosal surfaces during an enteric infection.  Figure 3.10 Antibiotic induced commensal depletion enhances pathogen colonization but does not alter host pathology in Muc2-/- mice. A. Quantification of DAPI stained bacteria from stools of WT and Muc2 -/- mice 24 hours following oral treatment with Streptomycin (20mg) or Vehicle (dH20). Streptomycin (strep) led to significantly reduced numbers of total bacteria within mouse stool. Results represent the means of 3-4 mice per group. Error bars = SEM (***P <0.001, unpaired t test). 170  B. Enumeration of espF C. rodentiumStr (strep-resistant) in stool of strep-or vehicletreated mice as indicated, at various times post-infection. Results represent the means of 3-4 mice per group. Error bars = SEM (*P  0.05, Mann-Whitney test, one-tailed). C. Body weights following infection of strep or vehicle treated WT and Muc2-/- mice with espF C. rodentiumStr. n=3-4 mice per group. Error bars = SEM. D. Representative histological sections of ceca from uninfected or infected (6 DPI) strepor vehicle-treated WT and Muc2-/- mice. Original magnification = 100X. Scale bar = 100 μm. E. H&E (Left panel) and FISH analysis (right panel) of an ulcer from espF C. rodentiumStr infected vehicle-treated Muc2-/- mouse cecum (6 DPI). Numerous commensals (EUB338+/GAM42– cells, red) can be seen overlying the ulcer in direct contact with PMNs (arrow), and both pathogen (EUB338+/GAM42a+ cells, yellow) and commensal (red) can be seen within the PMNs (arrow heads, inset). Original magnification = 200X. Scale bars = 100 μm. F. H&E and FISH analysis of an ulcer in the descending colon from an espF C. rodentiumStr infected strep-treated Muc2-/- mouse (6 DPI). Large pathogenic microcolonies (yellow) are associated with the ulcer (arrows), while commensals (red) can be seen in the lumen. Original magnification = 200X. Scale bars = 100 μm.  3.3 DISCUSSION The Muc2-rich mucus layer is the first host-defense barrier that noxious luminal agents contact in the intestine [33], and as such, it functions as the main interface between the host and its luminal microbiota. To my knowledge, this is the first study to formally demonstrate the importance of the major mucus glycoprotein Muc2 in host defense against an A/E bacterial pathogen in vivo. I show that the presence of Muc2 and hence the mucus layer is necessary to protect against severe mucosal damage and barrier dysfunction during infection. This was in part due to Muc2 functioning as a structural barrier to limit the rate of pathogen colonization of epithelial cells in the large bowel. However, Muc2 plays an additional role in host defense by controlling the pathogen burden that resides within the colonic lumen, primarily by removing loosely adherent bacteria and preventing bacterial accumulation and microcolony formation on the  171  colorectal surface. The inability to effect this removal likely contributes to the severe barrier dysfunction seen in Muc2-/- mice. I provide evidence that the ability of Muc2 to control luminal bacteria is most likely attributable to increased Muc2/mucus secretion during infection, which was demonstrated through metabolic labeling of mucin glycoproteins in WT mice. Moreover, I demonstrate that the ability of Muc2 to control luminal pathogens also impacts the resident commensal microbiota, as the microcolonies seen overlying the mucosa of infected Muc2-/- mice contained both C. rodentium as well as commensal microbes, and both types of bacteria were seen translocating across the colonic epithelium and into the lamina propria. These results ultimately reveal Muc2 production as a critical mechanism by which the host controls exposure to both pathogenic and commensal bacteria in vivo.  While I assumed that A/E pathogens such as C. rodentium would have to interact with the mucus layer during the course of infection, I demonstrate and characterize this interaction for the first time in situ. I show that C. rodentium colonizes the outer mucus layer in high numbers, and can also be found traversing the normally bacteria-free inner mucus layer to gain access to the underlying epithelial cells. These results raise the question of how A/E pathogens manage to circumvent the mucus layer. C. rodentium lacks a functional flagellum and is thus non-motile [60], and therefore likely utilizes specific mucinases or glycosidases to digest mucin in order to overcome the mucus barrier, although this has yet to be formerly demonstrated. Notably, EHEC has recently been shown to secrete the metalloprotease StcE that has apparent mucinase activity [61] suggesting A/E pathogens do employ this strategy. In contrast, despite their diversity and extreme density in  172  mammalian colon, commensal bacteria do not penetrate the inner mucus layer to any significant degree, probably because they are more adapted to the nutrient-rich luminal environment [62]. Ultimately, this suggests that colonizing the outer and inner mucus layer is a key step for the pathogenesis of A/E bacteria, therefore, the bacterial factors involved in crossing the mucus layer are likely critical for virulence.  My studies reveal an unexpected insight into how Muc2 mediates protection. Muc2 is widely presumed to act as a physicochemical barrier to limit access to epithelial tissues by luminal pathogens [17], including pathogens such as A/E bacteria. Several lines of evidence support this, such as the demonstration of mucins inhibiting EPEC adherence in vitro [20] and my in vivo cecal loop colonization assay described in this report. However, since the total numbers of bacteria that ultimately infected (i.e. became intimately adherent to) the tissue was not significantly different in a Muc2 deficient environment, the role of Muc2 as a defense barrier may be of only transient importance. Rather the major function played by Muc2, at least in response to A/E bacteria, appears to be to limit luminal burdens, mainly by preventing the accumulation of pathogens that are loosely associated with the tissue. These bacteria probably arise from replication of intimately-bound pathogens, as the T3SS mutant (escN C. rodentium) failed to efficiently colonize. This massive increase in the overall pathogen burden at the mucosal surface has important implications for downstream host responses. EPEC and EHEC both disrupt epithelial permeability in vitro [63], as does C. rodentium in vivo [64,65]. While intimately-adherent bacteria are firmly bound to the epithelia, the non-infecting, but loosely adherent bacteria are more likely to translocate into the mucosa, particularly  173  when faced with the mechanical pressures of dietary flow. Indeed, at times of severe barrier disruption I saw much higher systemic levels of C. rodentium in the Muc2-/- mice.  Although Muc2 deficiency did not ultimately impact on the numbers of intimatelyadherent C. rodentium, there was a striking increase in intestinal permeability in Muc2-/compared to WT mice. The susceptibility to ulcer formation in the Muc2-/- mice is probably a major contributor to the barrier dysfunction and morbidity seen in these mice since it was associated with greater systemic pathogen burdens. While the mechanisms are unclear, I suggest the accumulation of bacteria and microcolony formation on the epithelial surface in a Muc2-deficient environment is linked to either the development and/or maintenance of the ulceration, since most ulcers were associated with the microcolonies. It has been proposed that serum proteins released at ulcerated sites contribute to ulcer-associated C. rodentium overgrowth [66]; however the fact I saw microcolony formation also in non-ulcerated sites argues against this always being the case. Interestingly, past studies have shown that the A/E pathogen translocated effector EspF has been linked to epithelial barrier disruption [41,67] and ulcer-associated damage [42]. However, since ulcers, microcolony formation, and barrier disruption were also seen in mice infected with the espF strain, these data indicate that barrier disruption occurs through non-canonical pathways. I speculate that bacterial accumulation and microcolony formation at the surface adversely affects epithelial survival either directly, by producing a high local concentration of toxic metabolites; or indirectly, by causing the recruitment of large numbers of PMNs to the site of infection, where epithelial cell death is the result of collateral damage caused by neutrophils releasing cytotoxic mediators to  174  control the infection.  In fact, one can envision these microcolonies to be an  overwhelming burden to recruited phagocytes, perpetuating a vicious inflammatory cycle (Figure 3.10). Whatever the specific role of these invasive microcolonies, they likely exacerbate the focal damage and associated barrier defects, and thus have a severe impact on morbidity in the Muc2-/- mice.  Although I attribute the majority of the pathological phenotypes in infected Muc2-/- mice to result from C. rodentium, one of the striking features during the course of infection was the maintenance of commensal bacteria at the mucosal surface of the Muc2-/- mice. While I also found scattered commensal bacteria overlying the epithelium before infection [27], C. rodentium was clearly unable to totally displace them. This led to some intriguing phenotypes, including direct intimate interactions between commensal bacteria and the pathogen, where commensals were found intermixed with C. rodentium clusters to create multispecies microcolonies. Critically, commensal species could also be found translocating across the mucosal surface and into the lamina propria, where they were in direct contact with PMNs at sites of microcolony-associated ulceration, even forming microcolonies of their own. I explored whether these commensal bacteria contribute to the resulting colitis by transiently depleting them using the antibiotic streptomycin. While the depletion was successful, it also led to an exaggerated pathogen burden, confirming that commensal bacteria play an important host defense role by providing colonization resistance against C. rodentium. Although I did not identify overt differences in the resulting pathology in Muc2-/- mice following antibiotic pretreatment, I was unable to conclude to what degree commensal translocation might play in the resulting colitis,  175  considering the loss of commensals occurred concomitantly with increased pathogen burdens. However, the fact that infection-induced cecal ulceration in Muc2-/- mice led to large numbers of commensals that were directly interacting with PMNs points to a pathologic host-commensal interaction during infection. Therefore, while commensals are beneficial early during an infection by enhancing colonization resistance, their continued presence as the infection progresses likely plays a pathologic role. These studies are particularly interesting in light of the study by Lupp et al. [58] who described an overall reduction of commensal bacterial numbers after an established C. rodentium infection. It has been suggested this is a pathogenic strategy where pathogens exploit inflammation to suppress commensal growth and thereby reduce colonization resistance [68]. However, my findings strongly suggest that clearance of commensal microbes from the colon after an established C. rodentium infection may also benefit the host, by decreasing the total bacterial burden faced by the host at a time when its intestinal barriers are compromised.  I hypothesize that mucin secretion is the key mechanism by which Muc2 controls the levels of A/E bacteria, and commensal bacteria at the surface. Recent studies have suggested there is enhanced mucin secretion in the colon during C. rodentium infection [19]. I extend these findings through metabolic labeling to show at least a 40% increase in mucus secretion in response to infection, and specifically indentified C. rodentium within luminal mucus. This increase in mucin secretion is likely a gross underestimate of the local increase in mucin release, since in order to have sufficient quantities for analysis, I extracted mucus from the whole colon, and the increase in secretion is  176  expected to be focused in the descending colon and rectum where the infection occurs [69]. Due to the lack of antimicrobial activity I saw within the crude mucus, and the fact that it was recently shown by the McGuckin laboratory that C. rodentium directly binds to Muc2/mucus in vitro [19], I hypothesized that induced mucin secretion is an effective means for the host to bind and remove non-infecting, loosely adherent A/E bacteria that would otherwise accumulate on the surface and exacerbate disease (Figure 3.11). Although beyond the scope of the present study, an outstanding issue yet to be addressed is deciphering the precise molecules responsible for the induced Muc2 secretion in vivo. There are a plethora of candidates, including bacterial products, such as LPS [51,70], or host derived cytokines such as TNF [71], neuromodulators including vasoactive intestinal peptide [72], or neutrophils via elaboration of secretagogues such as neutrophil elastase [73], all of which have been shown to cause enhanced mucin release from goblet cells in tissue culture, and are present during C. rodentium infection [74,75,76]. Based on the data presented in my report, the elucidation of the specific host and/or microbial factors and molecular pathways that regulate mucus production during enteric bacterial infection constitutes a fertile area of research.  Importantly, while I ascribe the ability of intestinal mucus to flush away luminal bacteria from the mucosal surface to primarily reflect the actions of Muc2, there are likely other mucins, (potentially found in total secreted mucus) that may also contribute to the protective actions of the mucus. These include Muc1, a cell surface mucin that is upregulated in bacterial induced colitis [19] and potentially cleaved to release its subunit containing the extracellular mucin domain into the intestinal lumen, as seen  177  Figure 3.11 Proposed model of the role of Muc2 in the disassociation of A/E pathogenic and commensal bacteria from the large intestinal mucosa. A. In a Muc2-sufficient intestine, A/E bacteria such as C. rodentium (yellow) need to first traverse the outer and inner mucus layers to access the underlying epithelium. Following infection of epithelial cells, there is an enhancement in mucin secretion probably due to synergistic actions between bacterial products and host derived cytokines after innate recognition by pattern recognition receptors, and recruitment of inflammatory cells such as PMNs. In addition, there is moderate epithelial barrier dysfunction as a result of host and pathogen induced alteration of tight junctions. As the A/E pathogen replicates following intimate attachment, the secreted Muc2 binds newly reproduced bacteria and flushes them away from the surface to prevent microcolony formation on the surface and their translocation into the mucosa. 178  B. In a state of Muc2-deficiency the lack of mucus causes a more rapid infection and an accumulation of pathogens that are loosely associated with the mucosa, forming microcolonies. Commensal bacteria (red) can also be caught up in these pathogenic microcolonies, further increasing total burden at the surface and likelihood of direct and/or indirect epithelial damage. Following infection, severe barrier dysfunction occurs, mostly by altered tight junctions as well as overt epithelial cell death. As a result both the loosely-adherent pathogens and commensals leak across the epithelia and into the mucosa, overwhelming the phagocytes and perpetuating a vicious inflammatory cycle.  during H. pylori infection [77]; Muc4 which can be up-regulated during DSS-induced colitis [78]and be expressed by colonic goblet cells [55]; and the secreted gel-forming mucins Muc19 and Muc6, the latter being produced in Muc2-/- mice during colitis [29]. Even so, I maintain that Muc2 is the major protective mucin. This is in part based upon the phenotype of Muc2-/- mice (confirmed by my studies), where Muc2-deficiency leads to a virtual loss of mucin-filled phenotypically mature goblet cells within the large intestine, and a corresponding loss of both the inner and outer colonic mucus layers [24] and other forms of luminal mucus. Moreover, Muc2 is by far the major secretory mucin under both baseline (in mice and humans) [24,53] and inflammatory conditions in the colon [54]. However, I did see a modest up-regulation of Muc6 mRNA expression during infection of WT mice, and the impact of this expression is currently under investigation.  During the course of this article review, it was demonstrated by Hasnain et al. [79] that Muc2-deficiency renders mice more susceptible to intestinal nematode infections, suggesting Muc2 and mucus production can protect against diverse enteric pathogens. Muc2 production is clearly protective during A/E bacterial infection, but whether this is true for other enteric bacterial pathogens of the gut remains to be shown. Importantly,  179  since bacteria and other enteric pathogens have co-evolved with their hosts, many exhibit multiple strategies to subvert and exploit host defenses including mucus to promote colonization [80]. A well known motility factor is flagella, which is commonly utilized by pathogenic bacteria such Vibrio cholerae to migrate through mucus (reviewed in [33]).  In addition, Salmonella appears to anchor itself to mucus via specific adhesins  [81] to promote colonization [82], and exhibits resistance to small bowel mucus antimicrobial activity [48].  Yersinia enterocolitica has been shown to utilize  polysaccharides present in mucins like Muc2 to harvest energy and promote growth [83]. A similar observation has been shown for Salmonella Typhimurium, for which it has been proposed as a strategy to outcompete the commensal microbiota within an inflammatory niche [84]. Moreover, parasites such as Entamoeba histolytica stimulate mucin release to deplete the mucus layer [85], as well as proteolytically break down the polymeric structure of secreted Muc2 to facilitate access to the underlying epithelium [86,87]. Thus, whether Muc2 has evolved primarily to regulate interactions with normal microbiota and other luminal contents, or to provide adequate host defense against enteric pathogens has yet to be determined. However, because the commensal microbiota is a major variable in any enteric infection, particularly in the colon, it is likely that the presence of Muc2 allows for effective immunological management of the infectious agent by limiting commensal burdens at mucosal surfaces.  In conclusion, my studies have shown that Muc2 and the mucus layer are critical for host defense against an A/E bacterial pathogen. However, it is important to note that Muc2 can potentially be modulated in several ways either during infection, such as at the level  180  of gene expression, post-translational modification, or even at the level of secretion into the intestinal lumen. Each regulatory step may influence the biological function of Muc2, which in turn will influence how the host responds to enteric pathogens. Since Muc2 is an integral part of the colonic ecosystem, future studies are warranted to unravel precisely how intestinal mucus impacts the course of infectious disease. 3.4 EXPERIMENTAL METHODOLOGY Mice Six to eleven-week-old C57BL/6, Muc2+/+ and Muc2-/- mice (on C57BL/6 background) were purchased from the National Cancer Institute (NCI) or bred in our animal facility. Mice were kept in sterilized, filter-topped cages, handled in tissue culture hoods and fed autoclaved food and water under specific pathogen free (SPF) conditions. Sentinel animals were routinely tested for common pathogens. The protocols employed were approved by the University of British Columbia’s Animal Care Committee and in direct accordance with guidelines drafted by the Canadian Council on the Use of Laboratory Animals.  Bacterial Strains and Infection of Mice Mice were infected by oral gavage with 0.1 ml of an overnight culture of LB containing approximately 2.5 x 108 cfu of wt C. rodentium (formerly C. freundii biotype 4280, strain DBS100, the EspF mutant espF C.rodentium, or the T3SS mutant escN C. rodentium [88]. Bioluminescent strains of C. rodentium were constructed by introducing plasmid pT7 (E. A. Meighen, Department of Biochemistry, McGill University) carrying the entire lux operon from Photorhabdus luminescens. 181  For bacterial enumeration studies, a  streptomycin-resistant derivative of C. rodentium DBS100 was utilized.  For some  studies a streptomycin-resistant espF C.rodentium was utilized, and was constructed in our laboratory by routine procedures. GFP-C. rodentium was constructed within our laboratory by chromosomal insertion of gfp into C. rodentium DBS-100 via Red/ET Recombination, using a Quick & Easy E. coli Gene Deletion Kit (Gene Bridges) as per manufacturers instructions. The virulence of the GFP-C. rodentium was confirmed in preliminary studies. For commensal depletion studies, mice were pre-treated with 0.1 ml of 200mg/ml (20mg) streptomycin (or H20) 24 hrs prior to infection.  Tissue Collection Uninfected or infected mice were anesthetized with Halothane, killed by cervical dislocation, and their large intestines were resected and divided into cecum, ascending colon, descending colon, and rectum for further analysis. Tissues were immediately placed in 10% neutral buffered formalin (Fisher) (48 hrs, 4°C) or ice cold fresh Carnoy’s Fixative (2 hrs, 4°C) or 4% paraformaldehyde (1 hr, room temp) for histological studies, or placed in RNAlater (Qiagen) and stored at -86 ºC for subsequent RNA extraction.  Bacterial Counts For enumeration of bacteria within the tissue and luminal compartments, whole mouse ceca or colons were sliced open longitudinally, and their luminal contents were collected in a preweighed 2.0 ml microtube containing 1.0 ml of phosphobuffered saline (PBS) and a 5.0 mm steel bead (Qiagen). Cecal and colonic tissues were washed vigorously in PBS (pH 7.4), cut into several pieces, and also placed in a tube as above. Tissue and lumen  182  contents were weighed, and then homogenized in a MixerMill 301 bead miller (Retche) for a total of 6 mins at 30Hz at room temperature. Tissue homogenates were serially diluted in PBS and plated onto luria broth (LB) agar plates containing 100 mg/ml streptomycin, incubated overnight at 37ºC, and bacterial colonies were enumerated the following day, normalizing them to the tissue or stool weight (per gram). For fecal bacterial burden analysis, stool was collected from live mice at various times postinfection (described in text) and processed as described for luminal contents. For some studies with non-antibiotic resistant C. rodentium, plating was performed on MacConkey Agar (Difco), C. rodentium colonies were clearly identified by their unique characteristic of being round with red centre and a thin white rim. Colonies were confirmed to be C. rodentium by PCR for the C. rodentium T3SS translocator gene escN.  Histological Staining Briefly, 5 μm paraffin sections were deparaffinized by heating at 55-65ºC for 10 min, cleared with xylene, rehydrated through an ethanol gradient to water. Sections were blocked using the appropriate blocking buffer (either 2% Goat or Donkey Serum in PBS containing 1% bovine serum albumin (BSA), 0.1 % Triton-X100 (Sigma), and 0.05% Tween 20, and 0.05% sodium azide.  For detection of biotinylated targets, blocking of  endogenous biotin was carried out prior to blocking with serum, using the Endogenous Biotin Blocking kit (Molecular Probes). Primary antibodies or lectins were diluted in PBS containing 1% BSA, 0.1 % Triton-X100 (Sigma), and 0.05% Tween 20, and 0.05% sodium azide. The antibodies used were rat anti-F4/80 (1:8000; Serotec), rabbit antiMPO (1:100; NeoMarkers), rat antisera generated against C. rodentium specific Tir  183  (1:5K; gift from W. Deng), rabbit anti-E.coli Poly 8 LPS (1:500; Biotec Laboratories), biotinylated goat anti-GFP (1:100: GeneTex), polyclonal antisera that recognized the murine colonic mucin Muc2 (1:50; a gift from Jan Dekker). Staining for fucosylated mucins was carried out using biotinylated-Ulex europaeus agglutinin-1 (2ug/ml; Vector Labs). Antigen retrieval was used for F4/80 and MPO staining, and was performed prior to blocking and staining by placing deparaffinized, rehydrated slides in 10mM citric acid pH 6.0 at 90-100°C for 20 min, followed by cooling to room temperature. Preparation and staining of PFA-fixed frozen sections was performed as described previously [44]. For dual LPS/Tir staining, no detergents (TritonX-100 or Tween-20) were used in the dilution buffers, to avoid Tir staining within bacteria. Epifluorescent labeling for all stains was carried out with the appropriate secondary antibody using AlexaFluor 488conjugated goat (or donkey) anti-rabbit IgG, AlexaFluor 568-conjugated goat anti-rabbit IgG, AlexaFluor 568-conjugated goat anti-rat IgG (all 1:2000), or AlexaFluor 568conjugated Streptavidin (1:1000) (Molecular Probes/Invitrogen). Tissues were mounted using ProLong Gold Antifade (Molecular Probes/Invitrogen) that contains 4’,6’diamidino-2-phenylindole (DAPI) for DNA staining. Sections were viewed at 350, 488, and 594 nm on a Zeiss AxioImager microscope. Images were obtained using a Zeiss AxioImager microscope equipped with an AxioCam HRm camera operating through AxioVision software (Version 4.4).  RNA extraction and quantitative RT-PCR Colon tissues stored in RNAlater (Qiagen) at -86 ºC were thawed, weighed, and total RNA extracted using the Qiagen RNeasy kit following the manufacturer’s instructions.  184  Tissues were homogenized in a 2.0 ml microtube containing 0.6 ml of Buffer RLT (supplied in Qiagen RNeasy kit) and a 5.0 mm steel bead (Qiagen), and homogenized in a MixerMill 301 bead miller (Retche) for 4 minutes at 30Hz at room temperature. Total RNA was quantified using a NanoDrop Spectrophotometer (ND1000). 1-2 ug of RNA was reverse-transcribed using a Qiagen Omniscript RT kit (Qiagen), according to manufacturer’s instructions. For quantitative PCR, cDNA was diluted 1:5 in RNase/DNase free H2O and 5 μl was added to 15 μl PCR reaction mix. The final reaction volume was 20 uL, containing BioRad Supermix used at a 1:2 dilution, and primers at a final concentration of 0.6 uM each. qPCR was carried out using a BioRad Miniopticon or Opticon2. Melting point analysis confirmed the specificity for each of the PCR reactions. Quantitation was performed using GeneEx Macro OM 3.0 software. Primer sequences and reaction conditions for or all genes analyzed are given in Table-3.1. All mucin primers, and Reg3g primers were designed with Primer3 (Version 0.4.0).  Cecal loop model For cecal loop experiments, a 50 uL overnight inoculum of C. rodentium was placed in 3 mL Dulbecco’s modified eagle medium and incubated without shaking at 37 ºC, 5% CO2 for 3 hrs, to induce expression of the T3SS [89]. Cecal loop experiments were modified from those previously described for ileal loop experiments [90]. In brief, mice were anaesthetized by intraperitoneal injection of ketamine and xylazine. Following a midline  185  Table 3.1 Primer sets and PCR conditions used in chapter 3 Target PCR cycle conditionsb Primer Sets a denature/anneal/extend mRNA IFN-  Fwd: 5’- TCAAGTGGCATAGATGTGGAAGAA -3’ Rev: 5’-TGGCTCTGCAGGATTTTCATG -3’  95°C, 30s/ 60°C, 30s/ 72°C, 30s  TNF-  Fwd: 5’- CATCTTCTCAAAATTCGAGTGACAA -3’ Rev: 5’- TGGGAGTAGACAAGGTACAACCC-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Fwd: 5’- TGCACCCAAACCGAAGTCAT-3’ Rev: 5’- TTGTCAGAAGCCAGCGTTCAC-3’  94°C, 30s/ 57°C, 30s/ 72°C, 45s  KC MCP-1  c  iNOS mCRAMP  Fwd: 5’-TGCTACTCATTAACCAGCAAGAT -3’ Rev: 5’-TGCTTGAGGTGGTTGTGGAA -3’  94°C, 30s/ 59°C, 15s/ 72°C, 90s +78°C, 5s  Fwd: 5’- TGGGAATGGAGACTGTCCCAG-3’ Rev: 5’- GGGATCTGAATGTGATGTTTG-3’  94°C, 30s/ 60°C, 30s/ 72°C, 30s  Fwd: 5’- CTTCAACCAGCAGTCCCTAGACA-3’ Rev: 5’- TCCAGGTCCAGGAGACGGTA-3’  94°C, 30s/ 55°C, 30s/ 72°C, 30s  -actin  Fwd: 5’-CAGCTTCTTTGCAGCTCCTT-3’ Rev: 5’-CTTCTCCATGTCGTCCCAGT-3’  94°C, 30s/ 55-60°C, 30s/ 72°C, 30s  IL-17A  Fwd: 5’-GCTCCAGAAGGCCCTCAGA-3’ Rev: 5’-CTTTCCCTCCGCATTGACA-3’  94°C, 30s/ 60°C, 30s/ 72°C, 30s  IL-17F  Fwd: 5’-TGCTACTGTTGATGTTGGGAC-3’ Rev: 5’-AATGCCCTGGTTTTGGTTGAA-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Fwd: 5’-ACCTTTCCTGACCAAACTCA-3’ Rev: 5’AGCTTCTTCTCGCTCAGACG-3’  94°C, 30s/ 58°C, 30s/ 72°C, 30s  Fwd: 5’-TGGCTGTGCCTAGGAGTAGCA -3’ Rev: 5’-TTCATCCTCTTCTTCTCTTAGTAGATT -3’  94°C, 30s/ 60°C, 30s/ 72°C, 30s  IL-22 IL-23p19 RegIII-  Fwd: 5’-TGCCTATGGCTCCTATTGCT-3’ Rev: 5’-CACTCCCATCCACCTCTGTT-3’  94°C, 30s/ 58°C, 30s/ 72°C, 30s  Muc1  Fwd: 5’-AGGAGGTTTCGGCAGGTAAT-3’ Rev: 5’-TCCTTCTGAGAGCCACCACT-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Muc3/17  Fwd: 5’-TGAGCAAAGGCAGTATCGTG-3’ Rev: 5’-GCCTCCTTCTTGCATGTCTC-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Muc4  Fwd: 5’-GAAAAGCGTGTTGCCTCTTC-3’ Rev: 5’-AGAGGGAAATGCCCTGATCT-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Muc6  Fwd: 5’-TGCATGCTCAATGGTATGGT-3’ Rev: 5’-TGTGGGCTCTGGAGAAGAGT-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Muc13  Fwd: 5’-TCTGGACTCTGGCCACTCTT-3’ Rev: 5’-GAGGACAGAGCCAGTCCAAG-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  Muc19  Fwd: 5’-ACTGGAACCACAGCCAAATC-3’ Rev: 5’-CTACGGCCTGTTTTTCGGTA-3’  94°C, 30s/ 55°C, 30s/ 72°C, 45s  a  IFN- primers from ref. [94]; TNF- primers, ref.[95]; MCP-1 primers, ref. [96]; mCRAMP primers, ref.[13]; iNOS primers, ref.[97]; KC primers, ref.[98]; IL-17A and IL-23p19 ref.[99]; IL-17F primers ref.[36]; and IL-22 primers ref.[100]. b All PCR experiments had an initial denaturing step of 95 °C for 3-5 mins before commencement of PCR.  186  abdominal incision, the cecum and proximal colon were gently exteriorized, and the proximal colon at the cecal-colonic junction was ligated twice. 300 uL containing approximately 1 x 108 cfu of pre-activated C. rodentium was then slowly injected into the cecal lumen. The cecum and colon were then returned to the abdominal cavity and the incision closed with discontinuous sutures. At given time points, the mice were euthanized and tissues collected for bacterial enumeration and histology as described above.  Bioluminescent Imaging These studies were carried as described in Chapter 1 at the timepoints described in the text.  Metabolic Labeling Metabolic labeling was carried out as previously described [52] with slight modifications. Uninfected (LB treated) and C. rodentium-infected mice were injected intraperitoneally with 20 μCi of [3H]glucosamine (Amersham) in 0.3 ml of Dulbeccos(D)-PBS (pH 7.2) and left for 3.5 hrs to metabolically label the large intestinal mucin pool. The animals were euthanized, and the colons were excised and flushed with PBS, and opened with fine scissors into a Petri dish and the mucosal surface was scraped with a glass slide to remove the adherent mucus. Mucosal secretions were placed in 15-20 ml of D-PBS and vortexed at high speed for 10 min, and then the supernatant was clarified by centrifugation (1,000 g for 10 min).  The cell-free supernatant was reserved and  glycoproteins were precipitated with equal volumes of 10% trichloroacetic acid (TCA)  187  and 1% phosphotungstic acid (PTA) overnight at 4°C, solubilized in column buffer (8.06 mM Tris-HCL, 1.98 mM Tris- base, 0.001% sodium azide, pH 8.0) and neutralized to pH 7.0 –7.4 with 0.1 mol/l NaOH. 5 ml of scintillation cocktail (UniverSol) was added, and 3  H activity (a measure of mucus secretion) was determined in a scintillation counter. To  confirm the identity of the high-molecular-weight mucin following C. rodentium infection, the secreted [3H]glucosamine-labeled glycoproteins produced in response C. rodentium and untreated controls were subjected to Sepharose-4B (Sigma) column chromatography. To do this, the 10% TCA-1% PTA-precipitated glycoproteins were dissolved in column buffer and applied to a S4B column previously equilibrated with 0.01mol/l Tris HCl. Fractions (30–40 in total/ 0.4 ml each) were collected, and 3H activity of each fraction was determined by liquid scintillation counting. The results are expressed as total CPM recovered in each fraction. The column was calibrated using the following molecular weights standards: blue dextran (BD; 2,000 kDa), thyroglobulin (669 kDa) and BSA (67 kDa) (Amersham).  FITC-Dextran Intestinal Permeability Assay This assay was performed as previously described [75]. Uninfected or infected mice at 5 DPI were gavaged with 150 μl of 80 mg/ml 4 kDa FITC-dextran (Sigma; FD4) in PBS 4 hrs prior to sacrifice. Mice were anaesthetized and blood was collected by cardiac punctures, which was added immediately to a final concentration of 3% acid-citrate dextrose (20 mM citric acid, 100 nM sodium citrate, 5 mM dextrose) (Harald Schulze, Shivdasani Laboratory, DFCI). Plasma was collected and fluorescence was quantified  188  using a Wallace Victor (Perkin-Elmer Life Sciences, Boston, MA) at excitation 485 nm, emission 530 nm for 0.1 s.  Fluorescence in-situ Hybridization Formalin-fixed paraffin-embedded sections were deparaffinized and rehydrated as described above. Sections were incubated overnight at 37ºC in the dark with Texas redconjugated EUB338 general bacterial probe (5’-GCT GCC TCC CGT AGG AGT-3’) and an AlexaFluor 488 conjugated GAM42a probe (5’-GCC TTC CCA CAT CGT TT-3’) that recognizes bacteria that belong to the -Proteobacter class [58,91] diluted to a final concentration of 2.5ng/ul each in hybridization solution (0.9 M NaCL, 0.1 M TRIS pH 7.2, 30% Formamide, 0.1% SDS). Sections were then washed once in the dark with hybridization solution for 15 minutes with gentle shaking. This step was repeated once with wash buffer (0.9 M NaCL, 0.1 M TRIS pH 7.2), and sections were placed in dH2O, and then mounted using ProLong Gold Antifade with DAPI (Molecular Probes) and imaged as described above. For quantification studies, the methods were carried as previously described [58].  SYBR Green DNA Staining Large intestines were collected and prepared as described above for bacterial counts, except the lumen contents from the cecum and colon were separated.  After  homogenization, samples were diluted 1:10 in PBS, then 450ul of the 1:10 dilution was placed in 50ul 10% Neutral Buffered Formalin, vortexed briefly, and stored at 4C. 2-5ul of the 1:10 diluted sample stored in formalin was diluted in 1 ml PBS and filtered onto  189  Anodisc 25 filters (Whatman International Ltd) with a pore size of 0.2 μM and 2.5 cm diameter. The samples were allowed to thoroughly dry, and then were stained with 0.25 μl SYBR green (Invitrogen) in 100 μl PBS for 15 min in the dark. Alternatively, samples were filtered onto Nucleopore Track-Etch membranes (Whatman) for DAPI staining only.  The filters were air dried (in the dark for SYBR staining) and mounted on glass  slides with ProLong Gold Antifade with DAPI (Molecular Probes) and viewed as above. The mean number of cells counted in 3 to 6 randomly chosen fields per disc was determined.  Antimicrobial Assay Crude mucus was isolated from colorectal tissues in the same manner as described for the small intestine by by Meyer-Hoffert et al. [48]. Resected colons from WT mice were flushed gently with PBS using a pippette fitted to a syringe. Colons were then opened up longitudinally and placed in a Petri dish, mucosa side up. The round edge of forceps was then used to gently scrape off the inner colonic mucus layer with minimal damage to the epithelial surface. The mucus globule was placed in a tube, diluted 1:1 with PBS, and mixed well by vortexing and pipetting up-and-down, and then immediately placed on ice. For the antimicrobial assay I conducted assays described by Turner et al. [92] with slight modifications. An overnight culture of streptomycin-resistant C. rodentium grown in LB was diluted 1:1000 in Tryptic Soy Broth (TSB) and grown to mid log phase (OD620 0.61.0). The bacteria was washed by centrifugation (3000rpm, 4°C, 10mins) and removing the supernatant, and resuspending the pellet in ice cold 10mM sodium phosphate buffer (SPB) (pH 7.4). This step was repeated once. The washed sample was diluted to a final  190  OD620 of 0.7, diluted 1000x, and 5 uL of this dilution (containing 1x104 bacteria) were added to 25 ul 10mM SPB with 0.03% TSB containing 50ug/ml streptomycin +/- 20 ul of various dilutions of crude mucin as described in the text. For negative controls, only SPB + streptomycin was added. The total reaction volume was 50ul. Cultures were left for 3hrs at room temp, then serially diluted and plated on LB plates containing 50 ug/ml streptomycin, and incubated overnight at 37ºC incubator. Colonies were counted the next day.  Histopathological scoring To assess tissue pathology, I used a scoring system adapted from previously described scoring systems [88,93]. In brief, paraffin-embedded colonic tissue sections (5 μm) that had been stained with haematoxylin and eosin were examined by two blinded observers. Tissue sections were assessed for submucosal edema (0 = no change; 1 = mild; 2 = moderate; 3 = profound), epithelial hyperplasia (scored based on percentage above the height of the control where 0 = no change; 1 = 1–50%; 2 = 51–100%; 3 = > 100%), epithelial integrity (0 = no change; 1 = < 10 epithelial cells shedding per lesion; 2 = 11– 20 epithelial cells shedding per lesion; 3 = epithelial ulceration; 4 = epithelial ulceration with severe crypt destruction); neutrophil and mononuclear cell infiltration (0 = none; 1 = mild; 2 = moderate; 3 = severe). The maximum score that could result from this scoring was 15.  191  Statistical Analysis Statistical significance was calculated by using either a two-tailed Student’s t-test or the Mann-Whitney test unless otherwise indicated, with assistance from GraphPad Prism Software  Version  4.00  (GraphPad  Software,  San  Diego  California  USA,  www.graphpad.com). A P value of  0.05 was considered significant. The results are expressed as the mean value with standard error of the mean (SEM).  192  3.5 LITERATURE CITED 1. Nataro JP, Kaper JB (1998) Diarrheagenic Escherichia coli. Clin Microbiol Rev 11: 142-201. 2. Fagundes-Neto U, Andrade JABd (1999) Acute Diarrhea and Malnutrition: Lethality Risk in Hospitalized Infants. J Am Coll Nutr 18: 303-308. 3. Vilchez S, Reyes D, Paniagua M, Bucardo F, Mollby R, et al. (2009) Prevalence of diarrhoeagenic Escherichia coli in children from Leon, Nicaragua. J Med Microbiol 58: 630-637. 4. Gonzalez Garcia EA (2002) Animal health and foodborne pathogens: enterohaemorrhagic O157:H7 strains and other pathogenic Escherichia coli virotypes (EPEC, ETEC, EIEC, EHEC). Pol J Vet Sci 5: 103-115. 5. Karch H, Tarr PI, Bielaszewska M (2005) Enterohaemorrhagic Escherichia coli in human medicine. International Journal of Medical Microbiology 295: 405-418. 6. Yoon JW, Hovde CJ (2008) All blood, no stool: enterohemorrhagic Escherichia coli O157:H7 infection. J Vet Sci 9: 219-231. 7. Wales AD, Woodward MJ, Pearson GR (2005) Attaching-effacing bacteria in animals. J Comp Pathol 132: 1-26. 8. Vallance BA, Finlay BB (2000) Exploitation of host cells by enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A 97: 8799-8806. 9. Luperchio SA, Schauer DB (2001) Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect 3: 333-340. 10. Mundy R, MacDonald TT, Dougan G, Frankel G, Wiles S (2005) Citrobacter rodentium of mice and man. Cell Microbiol 7: 1697-1706. 11. Bry L, Brenner MB (2004) Critical Role of T Cell-Dependent Serum Antibody, but Not the Gut-Associated Lymphoid Tissue, for Surviving Acute Mucosal Infection with Citrobacter rodentium, an Attaching and Effacing Pathogen. J Immunol 172: 433-441. 12. Maaser C, Housley MP, Iimura M, Smith JR, Vallance BA, et al. (2004) Clearance of Citrobacter rodentium Requires B Cells but Not Secretory Immunoglobulin A (IgA) or IgM Antibodies. Infect Immun 72: 3315-3324. 13. Iimura M, Gallo RL, Hase K, Miyamoto Y, Eckmann L, et al. (2005) Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J Immunol 174: 4901-4907. 14. Vallance BA, Dijkstra G, Qiu B, van der Waaij LA, van Goor H, et al. (2004) Relative contributions of NOS isoforms during experimental colitis: endothelialderived NOS maintains mucosal integrity. Am J Physiol Gastrointest Liver Physiol 287: G865-874. 15. Linden SK, Sutton P, Karlsson NG, Korolik V, McGuckin MA (2008) Mucins in the mucosal barrier to infection. Mucosal Immunol 1: 183-197. 16. Dharmani P, Srivastava V, Kissoon-Singh V, Chadee K (2009) Role of Intestinal Mucins in Innate Host Defense Mechanisms against Pathogens. Journal of Innate Immunity 1: 123-135. 17. Lievin-Le Moal V, Servin AL (2006) The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota. Clin Microbiol Rev 19: 315-337. 193  18. McAuley JL, Linden SK, Png CW, King RM, Pennington HL, et al. (2007) MUC1 cell surface mucin is a critical element of the mucosal barrier to infection. J Clin Invest 117: 2313-2324. 19. Linden SK, Florin TH, McGuckin MA (2008) Mucin dynamics in intestinal bacterial infection. PLoS One 3: e3952. 20. Mack DR, Michail S, Wei S, McDougall L, Hollingsworth MA (1999) Probiotics inhibit enteropathogenic E.†coli adherence in vitro by inducing intestinal mucin gene expression. Am J Physiol Gastrointest Liver Physiol 276: G941-950. 21. Allen A, Hutton DA, Pearson JP (1998) The MUC2 gene product: a human intestinal mucin. The International Journal of Biochemistry & Cell Biology 30: 797-801. 22. Van Klinken BJ-W, Einerhand AWC, Duits LA, Makkink MK, Tytgat KMAJ, et al. (1999) Gastrointestinal expression and partial cDNA cloning of murine Muc2. Am J Physiol Gastrointest Liver Physiol 276: G115-124. 23. Specian RD, Oliver MG (1991) Functional biology of intestinal goblet cells. Am J Physiol 260: C183-193. 24. Johansson MEV, Thomsson KA, Hansson GC (2009) Proteomic Analyses of the Two Mucus Layers of the Colon Barrier Reveal That Their Main Component, the Muc2 Mucin, Is Strongly Bound to the Fcgbp Protein. Journal of Proteome Research 8: 3549-3557. 25. Atuma C, Strugala V, Allen A, Holm L (2001) The adherent gastrointestinal mucus gel layer: thickness and physical state in vivo. Am J Physiol Gastrointest Liver Physiol 280: G922-929. 26. Matsuo K, Ota H, Akamatsu T, Sugiyama A, Katsuyama T (1997) Histochemistry of the surface mucous gel layer of the human colon. Gut 40: 782-789. 27. Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L, et al. (2008) The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci U S A 105: 15064-15069. 28. Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, et al. (2002) Colorectal cancer in mice genetically deficient in the mucin Muc2. Science 295: 1726-1729. 29. Van der Sluis M, De Koning BA, De Bruijn AC, Velcich A, Meijerink JP, et al. (2006) Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology 131: 117-129. 30. Yang K, Popova NV, Yang WC, Lozonschi I, Tadesse S, et al. (2008) Interaction of Muc2 and Apc on Wnt signaling and in intestinal tumorigenesis: potential role of chronic inflammation. Cancer Res 68: 7313-7322. 31. Yang W, Velcich A, Lozonschi I, Liang J, Nicholas C, et al. (2005) Inactivation of p21WAF1/cip1 enhances intestinal tumor formation in Muc2-/- mice. Am J Pathol 166: 1239-1246. 32. Heazlewood CK, Cook MC, Eri R, Price GR, Tauro SB, et al. (2008) Aberrant mucin assembly in mice causes endoplasmic reticulum stress and spontaneous inflammation resembling ulcerative colitis. PLoS Med 5: e54. 33. Deplancke B, Gaskins HR (2001) Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am J Clin Nutr 73: 1131S-1141S. 34. Swidsinski A, Loening-Baucke V, Theissig F, Engelhardt H, Bengmark S, et al. (2007) Comparative study of the intestinal mucus barrier in normal and inflamed colon. Gut 56: 343-350. 194  35. Wiles S, Pickard KM, Peng K, MacDonald TT, Frankel G (2006) In Vivo Bioluminescence Imaging of the Murine Pathogen Citrobacter rodentium. Infect Immun 74: 5391-5396. 36. Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, et al. (2009) Differential Roles of Interleukin-17A and -17F in Host Defense against Mucoepithelial Bacterial Infection and Allergic Responses. Immunity 30: 108-119. 37. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, et al. (2008) Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 14: 282-289. 38. Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, et al. (2006) Transforming growth factor-[beta] induces development of the TH17 lineage. Nature 441: 231-234. 39. Bry L, Brigl M, Brenner MB (2006) CD4+-T-Cell Effector Functions and Costimulatory Requirements Essential for Surviving Mucosal Infection with Citrobacter rodentium. Infect Immun 74: 673-681. 40. Nagai T, Abe A, Sasakawa C (2005) Targeting of Enteropathogenic Escherichia coli EspF to Host Mitochondria Is Essential for Bacterial Pathogenesis: CRITICAL ROLE OF THE 16TH LEUCINE RESIDUE IN EspF. J Biol Chem 280: 29983011. 41. Torchinsky MB, Garaude J, Martin AP, Blander JM (2009) Innate immune recognition of infected apoptotic cells directs TH17 cell differentiation. Nature 458: 78-82. 42. Gibson DL, Ma C, Rosenberger CM, Bergstrom KS, Valdez Y, et al. (2008) Toll-like receptor 2 plays a critical role in maintaining mucosal integrity during Citrobacter rodentium-induced colitis. Cell Microbiol 10: 388-403. 43. Deng W, Puente JL, Gruenheid S, Li Y, Vallance BA, et al. (2004) Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc Natl Acad Sci U S A 101: 3597-3602. 44. Bergstrom KS, Guttman JA, Rumi M, Ma C, Bouzari S, et al. (2008) Modulation of intestinal goblet cell function during infection by an attaching and effacing bacterial pathogen. Infect Immun 76: 796-811. 45. Smith CJ, Kaper JB, Mack DR (1995) Intestinal mucin inhibits adhesion of human enteropathogenic Escherichia coli to HEp-2 cells. J Pediatr Gastroenterol Nutr 21: 269-276. 46. Deng W, Vallance BA, Li Y, Puente JL, Finlay BB (2003) Citrobacter rodentium translocated intimin receptor (Tir) is an essential virulence factor needed for actin condensation, intestinal colonization and colonic hyperplasia in mice. Mol Microbiol 48: 95-115. 47. Vallance BA, Deng W, De Grado M, Chan C, Jacobson K, et al. (2002) Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen citrobacter rodentium in infected mice. Infect Immun 70: 6424-6435. 48. Meyer-Hoffert U, Hornef MW, Henriques-Normark B, Axelsson LG, Midtvedt T, et al. (2008) Secreted enteric antimicrobial activity localises to the mucus surface layer. Gut 57: 764-771.  195  49. Mantle M, Husar SD (1993) Adhesion of Yersinia enterocolitica to purified rabbit and human intestinal mucin. Infect Immun 61: 2340-2346. 50. Lievin-Le Moal V, Servin AL, Coconnier-Polter MH (2005) The increase in mucin exocytosis and the upregulation of MUC genes encoding for membrane-bound mucins induced by the thiol-activated exotoxin listeriolysin O is a host cell defence response that inhibits the cell-entry of Listeria monocytogenes. Cell Microbiol 7: 1035-1048. 51. Enss ML, Muller H, Schmidt-Wittig U, Kownatzki R, Coenen M, et al. (1996) Effects of perorally applied endotoxin on colonic mucins of germfree rats. Scand J Gastroenterol 31: 868-874. 52. Caballero-Franco C, Keller K, De Simone C, Chadee K (2007) The VSL#3 probiotic formula induces mucin gene expression and secretion in colonic epithelial cells. Am J Physiol Gastrointest Liver Physiol 292: G315-322. 53. Tytgat KM, Buller HA, Opdam FJ, Kim YS, Einerhand AW, et al. (1994) Biosynthesis of human colonic mucin: Muc2 is the prominent secretory mucin. Gastroenterology 107: 1352-1363. 54. Tytgat KM, Opdam FJ, Einerhand AW, Buller HA, Dekker J (1996) MUC2 is the prominent colonic mucin expressed in ulcerative colitis. Gut 38: 554-563. 55. Rong M, Rossi EA, Zhang J, McNeer RR, van den Brande JM, et al. (2005) Expression and localization of Muc4/sialomucin complex (SMC) in the adult and developing rat intestine: implications for Muc4/SMC function. J Cell Physiol 202: 275-284. 56. Das B, Cash MN, Hand AR, Shivazad A, Grieshaber SS, et al. Tissue Distibution of Murine Muc19/Smgc Gene Products. J Histochem Cytochem 58: 141-156. 57. Escande F, Porchet N, Bernigaud A, Petitprez D, Aubert J-P, et al. (2004) The mouse secreted gel-forming mucin gene cluster. Biochimica et Biophysica Acta (BBA) Gene Structure and Expression 1676: 240-250. 58. Lupp C, Robertson ML, Wickham ME, Sekirov I, Champion OL, et al. (2007) Hostmediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2: 204. 59. Hoffmann C, Hill DA, Minkah N, Kirn T, Troy A, et al. (2009) Community-Wide Response of the Gut Microbiota to Enteropathogenic Citrobacter rodentium Infection Revealed by Deep Sequencing. Infect Immun 77: 4668-4678. 60. Khan MA, Bouzari S, Ma C, Rosenberger CM, Bergstrom KS, et al. (2008) Flagellindependent and -independent inflammatory responses following infection by enteropathogenic Escherichia coli and Citrobacter rodentium. Infect Immun 76: 1410-1422. 61. Grys TE, Walters LL, Welch RA (2006) Characterization of the StcE protease activity of Escherichia coli O157:H7. J Bacteriol 188: 4646-4653. 62. Hooper LV (2009) Do symbiotic bacteria subvert host immunity? Nat Rev Microbiol 7: 367-374. 63. Viswanathan VK, Koutsouris A, Lukic S, Pilkinton M, Simonovic I, et al. (2004) Comparative Analysis of EspF from Enteropathogenic and Enterohemorrhagic Escherichia coli in Alteration of Epithelial Barrier Function. Infect Immun 72: 3218-3227.  196  64. Gunning RF, Wales AD, Pearson GR, Done E, Cookson AL, et al. (2001) Attaching and effacing lesions in the intestines of two calves associated with natural infection with Escherichia coli O26:H11. Vet Rec 148: 780-782. 65. Ma C, Wickham ME, Guttman JA, Deng W, Walker J, et al. (2006) Citrobacter rodentium infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption in vivo: role of mitochondrial associated protein (Map). Cellular Microbiology 8: 1669-1686. 66. Dann SM, Spehlmann ME, Hammond DC, Iimura M, Hase K, et al. (2008) IL-6Dependent Mucosal Protection Prevents Establishment of a Microbial Niche for Attaching/Effacing Lesion-Forming Enteric Bacterial Pathogens. J Immunol 180: 6816-6826. 67. Guttman JA, Li Y, Wickham ME, Deng W, Vogl AW, et al. (2006) Attaching and effacing pathogen-induced tight junction disruption in vivo. Cellular Microbiology 8: 634-645. 68. Stecher Br, Robbiani R, Walker AW, Westendorf AM, Barthel M, et al. (2007) Salmonella enterica Serovar Typhimurium Exploits Inflammation to Compete with the Intestinal Microbiota. PLoS Biol 5: e244. 69. Wiles S, Pickard KM, Peng K, MacDonald TT, Frankel G (2006) In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun 74: 5391-5396. 70. Smirnova MG, Guo L, Birchall JP, Pearson JP (2003) LPS up-regulates mucin and cytokine mRNA expression and stimulates mucin and cytokine secretion in goblet cells. Cell Immunol 221: 42-49. 71. Iwashita J, Sato Y, Sugaya H, Takahashi N, Sasaki H, et al. (2003) mRNA of MUC2 is stimulated by IL-4, IL-13 or TNF-[alpha] through a mitogen-activated protein kinase pathway in human colon cancer cells. Immunol Cell Biol 81: 275-282. 72. Plaisancie P, Barcelo A, Moro F, Claustre J, Chayvialle J-A, et al. (1998) Effects of neurotransmitters, gut hormones, and inflammatory mediators on mucus discharge in rat colon. Am J Physiol Gastrointest Liver Physiol 275: G1073-1084. 73. Kim S, Nadel JA (2004) Role of neutrophils in mucus hypersecretion in COPD and implications for therapy. Treat Respir Med 3: 147-159. 74. Lebeis SL, Bommarius B, Parkos CA, Sherman MA, Kalman D (2007) TLR signaling mediated by MyD88 is required for a protective innate immune response by neutrophils to Citrobacter rodentium. J Immunol 179: 566-577. 75. Gibson DL, Ma C, Bergstrom KS, Huang JT, Man C, et al. (2008) MyD88 signalling plays a critical role in host defence by controlling pathogen burden and promoting epithelial cell homeostasis during Citrobacter rodentium-induced colitis. Cell Microbiol 10: 618-631. 76. Conlin VS, Wu X, Nguyen C, Dai C, Vallance BA, et al. (2009) Vasoactive Intestinal Peptide Ameliorates Intestinal Barrier Disruption Associated with Citrobacter rodentium-induced Colitis. Am J Physiol Gastrointest Liver Physiol. 77. Lind©n SK, Sheng YH, Every AL, Miles KM, Skoog EC, et al. (2009) MUC1 Limits Helicobacter pylori Infection both by Steric Hindrance and by Acting as a Releasable Decoy. PLoS Pathog 5: e1000617.  197  78. Hoebler C, Gaudier E, De Coppet P, Rival M, Cherbut C (2006) MUC Genes Are Differently Expressed During Onset and Maintenance of Inflammation in Dextran Sodium Sulfate-Treated Mice. Digestive Diseases and Sciences 51: 381-389. 79. Hasnain SZ, Wang H, Ghia J-E, Haq N, Deng Y, et al. Mucin Gene Deficiency in Mice Impairs Host Resistance to an Enteric Parasitic Infection. Gastroenterology In Press, Accepted Manuscript. 80. Shames SR, Auweter SD, Finlay BB (2009) Co-evolution and exploitation of host cell signaling pathways by bacterial pathogens. The International Journal of Biochemistry & Cell Biology 41: 380-389. 81. Chessa D, Winter MG, Jakomin M, B‰umler AJ (2009) Salmonella enterica serotype Typhimurium Std fimbriae bind terminal -03B1;(1,2)fucose residues in the cecal mucosa. Molecular Microbiology 71: 864-875. 82. Vimal DB, Khullar M, Gupta S, Ganguly NK (2000) Intestinal mucins: the binding sites for Salmonella typhimurium. Mol Cell Biochem 204: 107-117. 83. Mantle M, Rombough C (1993) Growth in and breakdown of purified rabbit small intestinal mucin by Yersinia enterocolitica. Infect Immun 61: 4131-4138. 84. Stecher Br, Barthel M, Schlumberger MC, Haberli L, Rabsch W, et al. (2008) Motility allows S. Typhimurium to benefit from the mucosal defence. Cellular Microbiology 10: 1166-1180. 85. Chadee K, Keller K, Forstner J, Innes DJ, Ravdin JI (1991) Mucin and nonmucin secretagogue activity of Entamoeba histolytica and cholera toxin in rat colon. Gastroenterology 100: 986-997. 86. Lidell ME, Moncada DM, Chadee K, Hansson GC (2006) Entamoeba histolytica cysteine proteases cleave the MUC2 mucin in its C-terminal domain and dissolve the protective colonic mucus gel. Proc Natl Acad Sci U S A 103: 9298-9303. 87. Moncada D, Keller K, Chadee K (2003) Entamoeba histolytica cysteine proteinases disrupt the polymeric structure of colonic mucin and alter its protective function. Infect Immun 71: 838-844. 88. Khan MA, Ma C, Knodler LA, Valdez Y, Rosenberger CM, et al. (2006) Toll-like receptor 4 contributes to colitis development but not to host defense during Citrobacter rodentium infection in mice. Infect Immun 74: 2522-2536. 89. Dean P, Maresca M, Schuller S, Phillips AD, Kenny B (2006) Potent diarrheagenic mechanism mediated by the cooperative action of three enteropathogenic Escherichia coli-injected effector proteins. Proc Natl Acad Sci U S A 103: 18761881. 90. Brown NF, Vallance BA, Coombes BK, Valdez Y, Coburn BA, et al. (2005) Salmonella Pathogenicity Island 2 Is Expressed Prior to Penetrating the Intestine. PLoS Pathog 1: e32. 91. Amann RI, Krumholz L, Stahl DA (1990) Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology. J Bacteriol 172: 762-770. 92. Turner J, Cho Y, Dinh NN, Waring AJ, Lehrer RI (1998) Activities of LL-37, a cathelin-associated antimicrobial peptide of human neutrophils. Antimicrob Agents Chemother 42: 2206-2214. 93. Barthel M, Hapfelmeier S, Quintanilla-Martinez L, Kremer M, Rohde M, et al. (2003) Pretreatment of mice with streptomycin provides a Salmonella enterica serovar 198  Typhimurium colitis model that allows analysis of both pathogen and host. Infect Immun 71: 2839-2858. 94. Rhee SJ, Walker WA, Cherayil BJ (2005) Developmentally Regulated Intestinal Expression of IFN-{gamma} and Its Target Genes and the Age-Specific Response to Enteric Salmonella Infection. J Immunol 175: 1127-1136. 95. Nenci A, Becker C, Wullaert A, Gareus R, van Loo G, et al. (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446: 557-561. 96. Marriott I, Gray DL, Rati DM, Fowler VG, Jr., Stryjewski ME, et al. (2005) Osteoblasts produce monocyte chemoattractant protein-1 in a murine model of Staphylococcus aureus osteomyelitis and infected human bone tissue. Bone 37: 504-512. 97. Sugawara I, Yamada H, Li C, Mizuno S, Takeuchi O, et al. (2003) Mycobacterial Infection in TLR2 and TLR6 Knockout Mice. MICROBIOLOGY and IMMUNOLOGY 47: 327-336. 98. Godinez I, Haneda T, Raffatellu M, George MD, Paixao TA, et al. (2008) T Cells Help To Amplify Inflammatory Responses Induced by Salmonella enterica Serotype Typhimurium in the Intestinal Mucosa. Infect Immun 76: 2008-2017. 99. Happel KI, Lockhart EA, Mason CM, Porretta E, Keoshkerian E, et al. (2005) Pulmonary Interleukin-23 Gene Delivery Increases Local T-Cell Immunity and Controls Growth of Mycobacterium tuberculosis in the Lungs. Infect Immun 73: 5782-5788. 100. Brand S, Beigel F, Olszak T, Zitzmann K, Eichhorst ST, et al. (2006) IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration. Am J Physiol Gastrointest Liver Physiol 290: G827-838.  199  Chapter 4. The Role of Goblet Cell Derived Resistin-Like Molecule-{beta} During C. rodentium Infection 4.1 INTRODUCTION Diarrheagenic Escherichia coli continue to cause significant morbidity and mortality worldwide [1]. Two important members of this group of pathogenic E. coli are Enteropathogenic E. coli (EPEC) and Enterohemmorhagic E. coli (EHEC). EPEC, a major problem in the developing world, infects the small bowel of infants and small children, leading to diarrhea and complications arising from a poverty stricken economy and lack of medical infrastructure [1]. EHEC is an ongoing problem in developed nations, and infects the large bowel of people of all ages, leading to hemorrhagic colitis and, in severe cases, kidney failure in children [2]. EPEC and EHEC belong to a class of pathogens called attaching and effacing (A/E) bacteria, that utilize a Type III secretion system (T3SS) to intimately attach to the apical plasma membrane of intestinal epithelial cells and cause localized destruction or effacement of the microvilli [3]. While much has been elucidated regarding the pathogenesis of many enteric bacterial pathogens, including Salmonella sp., E. coli sp., and Yersinia sp., as well as the innate and adaptive mechanisms that drive their clearance, much is still unknown, particularly regarding the initial host responses to infection and how they influence downstream immunity and clearance of the offender.  Citrobacter rodentium is a natural A/E pathogen of mice that has acquired many of the same virulence genes as EPEC and EHEC [4,5]. C. rodentium infects the mouse large intestine, primarily the colon and rectum, causing acute colitis, lasting 2-3 weeks in 200  C57BL/6 mice [6]. C. rodentium uses similar mechanisms to EPEC and EHEC to infect the surface of colonocytes, and has been used extensively to model A/E infections in vivo as well as the resulting downstream host innate and adaptive immune responses [4]. Intestinal epithelial cells provide the first defense to all mucosal pathogens, including A/E bacteria. While intestinal epithelial cells of the small bowel such as Paneth cells secrete host-defense peptides that are directly cytotoxic to intestinal bacteria [7], they are not found in the large bowel in large numbers [8].  However, goblet cells, which  represent the other major secretory epithelial lineage, populate the large intestine at high density, making up 16% of the total colonic epithelial cell population in humans and mice [8].  Goblet cells are highly specialized secretory cells whose major function is to secrete mucus into the intestinal lumen through production of the polymeric gel-forming mucin MUC2. MUC2 is the principle structural component of all intestinal mucus, including the recently characterized inner and outer mucus layers of the colon [9]. MUC2 production has been shown to be an essential homeostatic factor in the intestinal tract, likely by regulating interactions of the host with the trillions of microbes that reside within it [9,10]. Through this crucial function, Muc2/mucus production is critical for preventing spontaneous colitis and colorectal cancer [11,12]. Muc2 production has an important host defense role against intestinal parasites, as recently demonstrated by its role in reducing worm burden during gastrointestinal helminth infections [13]. I have recently shown that cecal and colonic goblet cells are also critical for host protection against C. rodentium [14]. The presence of this mucus layer prevents extensive mucosal  201  damage and mortality by this pathogen by limiting colonization rates of the mucosal surface, and secretion of this mucin by goblet cells reduces the accumulation and microcolony formation on the mucosal surface by these pathogens [14]. While Muc2 production is a major function of goblet cells, these cells have also been shown to secrete other non-mucin related factors such as Resistin-Like Molecule-Beta (RELM) [15] .  RELM belongs to a family of cysteine-rich secretory molecules that include three other known members, RELM, RELM, and the founding member Resistin.  Although  initially described to play a role in insulin resistance in rodents [16], RELM proteins have since been associated with mediating several important host processes, including modulation of inflammation and wound healing processes following injury to mucosal tissues. In the lung, RELM plays a role in tissue remodeling and fibrosis [17]. In the intestinal tract, RELM secretion by goblet cells has been associated specifically with promoting innate-driven colonic inflammation following chemical insult via dextransodium sulfate [18], by stimulating macrophage activation and production of proinflammatory cytokines such as TNF, IL-6, and RANTES [19]. Moreover, RELM expression is correlated with the initiating events of spontaneous ileitis in mouse models of Crohn’s Disease [19]. However, the role of RELM in inflammation may be model dependent as it was found to be protective during Trinitrobenze-sulfate (TNBS)-induced colitis [20], perhaps by stimulating mucus production by goblet cells [20].  Further studies have implicated a direct role for RELM in host defense against enteric parasites.  Th2 responses induced during helminth infections (Trichuris muris,  202  Trichinella spiralis, Nippostrongylus brasiliensis) led to massive production and secretion of RELM by goblet cells in a manner dependent on interleukin (IL)-4 and IL13/IL-4R interactions and AKT signaling [21,22]. In this context, RELM interacts directly with the parasite to either interfere with their chemosensory apparatus and disorient the worms [23], or through adversely affecting worm metabolism and fecundity to ultimately reduce worm burden [22]. This effect may be pathogen specific, as RELM has also been shown to enhance the ability of macrophages to promote IFN- production by CD4+ Th1 cells and prolong chronic worm infection by Trichuris muris and Trichinella spiralis [24]. Interestingly, it has been described several years ago that bacterial colonization of the intestinal tract leads to a rapid and significant upregulation of RELM gene expression [25], in a manner dependent on the transcription factor Cdx2 [26]. While this was dependent on a mechanism distinct from that of IL-4 and IL-13, its precise role in induction within the GI tract upon bacterial colonization remains unclear.  The induction of RELM following bacterial colonization, its role in host-defense against enteric pathogens and in immunomodulation led me to hypothesize that RELM may be important in the pathogenesis of enteric bacterial infections. The secretory role allowed me to predict that RELM was particularly important for lumen-dwelling pathogens. I hypothesized that epithelial adherent pathogens would modulate expression of RELM in epithelial cells. Moreover since C. rodentium is a strong inducer of Th1 cytokines, I further hypothesized that RELM- production would be important in host-defense against A/E bacterial pathogens.  203  4.2 RESULTS 4.2.1 RELM is highly induced during C. rodentium infection Because bacterial colonization of the intestinal tract is important for induction of RELM, I hypothesized that there would be a robust induction of RELM during C. rodentium infection.  I first looked at gene expression following natural  infection/transmission of mice with C. rodentium, using a method validated by Wiles et al [27]. In brief, a C57BL/6 (BL/6) mouse was first orally infected with C. rodentium, the infection was allowed to establish, and at 6 days post-infection (DPI) (108 cfu/g stool), this mouse was co-housed with a group of uninfected mice, and colonization was monitored in this group at 4 and 7 days post exposure (DPE). Exposed mice were robustly colonized by 4 and 7 DPE as confirmed by plating of stool contents (Figure 4.1A).  Stool contents were additionally taken at these timepoints and tissues were  harvested at 7 DPE for gene expression and protein analysis. I noticed a significant and robust (40-fold) induction of Retlnb gene expression at 7 DPE, corresponding with the high bacterial burden (Figure 4.1B). Western blotting of murine rectal tissues revealed a dramatic increase in RELM protein production at 7 DPE compared to uninfected mice, where there was virtually no signal (Figure 4.1C). Immunostaining of rectal tissues confirmed both the induction and its specificity to colonic goblet cells, where virtually only epithelial cells with goblet morphology were positive under infected conditions; in contrast, only scattered goblet cells were weakly positive under control conditions (Figure 4.1D). To test whether RELM, was secreted, I analyzed stool lysates at 4 and 7 DPE by western blotting, and found intense signals coming from the stool of infected 204  mice, especially at 7 DPI, while only a weak band was found in uninfected mice (Figure 4.1E). These are the first studies to definitively show RELM is induced de novo and released into the intestinal lumen during an enteric bacterial infection.  Figure 4.1 RELM is highly induced during natural infection. A. Colonization of C. rodentium at 4 and 7 days post exposure (DPE) to an orally infected mouse harboring 108 cfu/gram stool. C. rodentium is rapidly transmitted among a group of previously unexposed mice and colonizes with high efficiency. Each data point represents 1 mouse in which the infection was transmitted. B. qPCR of Retnlb gene expression in the rectal (distal colonic) tissues of uninfected (n=4) and infected (7 DPE; n=4) BL/6 mice. Results represent the mean of 4 mice per group. Error bars = SEM. (*P=<0.05, Mann-Whitney t-test). C. Western blot of RELM protein in rectal tissues of mice that were uninfected or infected at 7 DPE. Original magnification = 200X. Scale bar = 50 μm. D. Epifluorescent staining of RELM in tissues of uninfected or infected mice at 7 DPE. RELM is highly induced in goblet cells during infection. Results are representative of 4-5 mice per group. E. Western blot of RELM within stool following infection. Each lane represents mouse tracked at 0, 4 and 7 DPE. RELM is secreted abundantly in the stool following infection. 205  4.2.2 RELM expression is sustained at high levels during the course of infection To begin to assess the role of RELM in C. rodentium infection, I assessed the dynamics of RELM gene and protein expression in the distal colon (rectum) during the course of infection. Gene expression began to increase at 3 DPI when bacterial burdens were increasing, and remained at high levels between 6 and 10 DPI when bacterial burdens were sustained at levels up to 108 cfu. (Figure 4.2A and B). Between 14 and 21 DPI, C. rodentium was rapidly cleared from the intestine (Figure 4.2A); between these timepoints Retnlb expression peaked at 10 DPI, and began to decline at between 14 and 21 DPI to near basal levels by 28 DPI (Figure 4.2B). Analysis of RELM protein production and secretion revealed that a corresponding increase in tissue expression and luminal secretion occurred at 6 DPI (Figure 4.2C and D). However, although there was increased Retnlb gene expression at 10 and 14 DPI, RELM protein in tissues was reduced (Figure 4.2C) and less RELM was detected in the stool (Figure 4.2D). This is most likely linked to the proliferative status of the mucosa, where most of the epithelia are highly proliferative at these stages of infection [28] (see also Figure A1.1), and Retnlb gene expression is highest in proliferating cells [29]. Interestingly, when the other goblet cellspecific mediators Muc2 and Tff3 were assessed, they did not undergo an increase, but Tff3 underwent a decrease at 10 and 14 DPI as described previously [30], and increased to near baseline levels at 38 DPI (Figure 2B). These data reveal a highly dynamic and novel goblet cell response during infection.  206  Figure 4.2 Dynamics of RELM expression during C. rodentium infection. A. Enumeration of C. rodentium that is adherent to the tissues, and in the luminal compartment, over the course of infection following oral gavage. Between 14 and 21 DPI, C. rodentium is rapidly cleared from the mouse. Data are representative of three separate infections, with 3-4 mice per time point. Error bars = SEM. B. qPCR analysis of the dynamics of RELM, Muc2, and TFF3 mRNA expression in the distal colonic (rectal) tissues of BL/6 mice over the course of infection. Each data point represents the mean of 3 -4 mice per group. Error bars = SEM. C. Western Blot of RELM protein within rectal tissues over the course of infection. Maximal RELM protein production is seen in the first week of infection. Data are representative of three separate experiments. D. Western blot of RELM in mouse stool lysates as a result of secretion to the lumen following infection by C. rodentium. Luminal secretion parallels tissue protein expression, with maximal levels in the first week of infection. Results represent 3 individual experiments, with 3-4 mice per time point.  4.2.3 RELM deficiency results in increased morbidity and mortality during C. rodentium infection The dramatic increase of RELM expression led me to hypothesize that RELM induction may be an important host response during C. rodentium infection. To test this hypothesis, I infected mice genetically deficient in RELM (Retnlb-/-) and first assessed weight loss to test morbidity. Interestingly, I found that Retnlb-/- mice began to lose 207  weight starting at week 2 post-infection, where between 6 and 10 DPI there was an average of a 15-20% reduction in their initial weight. In contrast, BL/6 mice maintained their weight at these timepoints (Figure 4.3A). Furthermore, on average 30% of the Retnlb-/- mice exhibited clinical signs of morbidity including hunched posture and inactivity and had to be euthanized (Figure 4.3B). These results indicate that RELM- deficiency leads to susceptibility to A/E bacterial infection.  Figure 4.3 Retnlb-/- mice demonstrate greater morbidity and have higher mortality rates following C. rodentium infection. A. Body weights following infection of BL/6 (n=9) and Retnlb-/- mice (n=11). Retnlb-/mice lose weight in the second week of infection. Results are representative of 3 separate experiments with 4-6 mice per group. B. Survival curve of BL/6 mice (n=9) and Retnlb-/- mice (n=11) following C. rodentium infection. Results are representative of 3 independent infections, each containing 4-11 mice per group.  4.2.4 Worsened cecitis and colitis in the absence of RELM To better understand how the absence of RELM was contributing to the increased morbidity and mortality compared to BL/6 mice, I examined the mucosal tissues of uninfected and infected BL/6 vs. Retnlb-/- mice. Analysis of resected colons at 10 DPI 208  revealed a striking pathological phenotype, namely a shrunken, inflamed cecum that was devoid of normal cecal contents, as well as frequent ulceration in Retnlb-/- mice compared to BL/6 mice (Figure 4.4A lower left panel). This damage in the Retnlb-/- mice was also observed to a lesser extent at 6 DPI suggesting a progressive deterioration (Figure 4.4A, middle left panel). Histological characterization of the cecum demonstrated several key features that were exaggerated in the Retnlb-/- mice, including submucosal edema, and pronounced mucosal thickening, accompanied by crypt hyperplasia and a dramatic increase in inflammatory cells within the mucosa and submucosa. Moreover, overt and massive ulceration was observed in 50% of mice (Figure 4.4B, upper right panel). These results indicate that the absence of RELM leads to worsened cecitis in response to C. rodentium infection.  In colonic tissues, similar features were seen, although Retnlb-/- mice exhibited a range of severity. On average there was worsened edema and more inflammatory cells in the colons of Retnlb-/- mice as determined by histological analysis (Figure 4.4C). Although ulceration was not as frequent as in the cecum (20% of mice), the colons were large and swollen in the Retnlb-/- mice (Figure 4.4C). The most severe phenotype seen in these mice included pan-ulceration and massive dropout of crypts with pockets of C. rodentium deep in the mucosal tissues. In some cases the tissue was severely necrotic with the mucosa lacking both epithelial and lamina propria cells (Figure 4.4C). In contrast, the most severe damage in BL/6 mice was characterized by a small focal ulcer amidst a population of hyperplastic crypts (Figure 4.4C, far right panels).  Histological scoring  revealed an increase in the total colonic infection induced damage in Retnlb-/- vs. BL/6  209  mice, although this was non-significant. However, analysis of the individual parameters of disease revealed significantly higher disruption of epithelial integrity (Figure 4.4D). Analysis of pro-inflammatory cytokine gene expression in cecal and colonic tissues revealed heightened responses of TNF-, IL-1, and IL-6 and IFN in infected Retnlb-/vs. BL/6 mice, especially in cecal tissues (Figure 4.4E). To determine whether the infection-induced lesions in Retnlb-/- mice could have resulted in defects in intestinal barrier function, I performed an in vivo permeability assay as described in Chapter 3. Thus, at 7 DPI when weight loss was beginning to occur, I gavaged BL/6 and Retnlb-/mice with a 4kDa FITC Dextran probe (FD4), and measured its levels in the serum 4hrs later, which directly correlates with intestinal permeability [31]. Preliminary studies showed no differences in the serum levels of FD4 in uninfected mice of either strain (Figure 4.4F). However, while there were increases in the levels of FD4 in the serum of both strains after infection, there was 2-fold increase in the levels of FD4 in the serum of infected Retnlb-/- mice compared to infected BL/6 mice (Figure 4.4F). These results collectively show that absence of RELM renders mice more susceptible to infectiouscolitis caused by an A/E pathogen.  210  Figure 4.4 Retnlb-/- mice present with exaggerated inflammatory disease in the large intestine during infection. A. Resected large intestines of uninfected and infected WT and Retnlb-/- mice at 6 and 10 DPI. The cecum progressively becomes shrunken and inflamed in the Retnlb-/- mice as the infection ensues compared to infected BL/6 mice where only mild inflammation takes place. Results are representative of 3 experiments with 2-6 mice per group. 211  B. H&E stained cecal sections from uninfected and infected BL/6 and Retnlb-/- mice at 10 DPI. Pronounced cecitis including overt ulceration are readily observed in infected Retnlb-/- mice. Results are representative of 3 experiments with 2-6 mice per group. Original magnification = 100X. Scale bar = 100 μm. C. H&E stained colonic sections from Retnlb-/- mice at 10 DPI showing the range of disease severity from moderate to severe (exhibiting massive ulceration). An infected (10 DPI) BL/6 colonic section is shown for comparison. Original magnification = 100X. D. Cumulative histologic damage scores from rectal tissues of BL/6 and Retnlb-/- mice under uninfected and infected conditions. Scores were determined by two independent observers under blinded conditions. Results represent the means of 3-4 experiments with 2-5 mice per group. Error bars = SEM (*P < 0.0286). E. Quantitative PCR analysis of pro-inflammatory cytokine gene expression in the cecal and rectal tissues of uninfected or infected BL/6 and Retnlb-/- mice at 10 DPI. Results represent the mean of 5-9 per group, pooled from 2 separate infections. Error bars = SEM. F. Quantity of FD4 in serum from uninfected and infected Retnlb-/- mice at 7 DPI. Retnlb/mice display increased FITC-dextran flux across the intestinal mucosa during C. rodentium infection. Bars represent the average value of a total of 2-4 mice per group. Error bars = SEM.  4.2.5 Severity of disease in the absence of RELM is associated with higher cecal burdens and deeper penetration of colonic crypts. The severe damage suggested that the absence of RELM was impacting on bacterial burdens. To test whether this was the case, I analyzed bacterial burdens adherent to the cecal and colonic tissues, as well in their respective luminal compartments, of Retnlb-/mice and BL/6 mice at 4, 6, and 10 DPI, when RELM is highly expressed and secreted in BL/6 mice. The results reveal no significant differences in bacterial burdens in either cecal or colonic tissue or their luminal compartments, or between strains, at 4 DPI (Figure 4.5A). However, at 6 and 10 DPI while there were trends toward higher total burdens in the colons of Retnlb-/- mice, there were 10-100 fold greater levels of C. rodentium in the cecal tissues and lumens of Retnlb-/- mice compared to BL/6 mice at these timpoints (Figure 4.5A). To observe how the bacteria were interacting with the cecal and colonic tissues, I conducted immunostaining using an antibody that recognizes 212  C. rodentium LPS (described in Chapters 2 and 3). Analysis of cecal tissues confirmed that there were more C. rodentium adherent to the cecal epithelia in Retnlb-/- mice compared to BL/6 mice at 6 DPI (Figure 4.5B). In the colons, bacterial interactions with the mucosa were quite different. Here, C. rodentium could be seen penetrating the crypts at 6 DPI, adherent to epithelial cells along the length of the crypt. At 10 DPI, C. rodentium could be seen filling the entire crypt lumens all the way from the surface epithelia to the crypt base (Figure 4.5C, upper right panel). In contrast, while bacterial penetration of crypts was occasionally observed in BL/6 mice at these time points, they occurred at much less frequency (Figure 4.5D) and rarely if ever to the extent observed in Retnlb-/- mice.  To begin to understand how the higher cecal burdens might be contributing to the pathology, I looked closer at some of the severely damaged tissues. I found that there were several regions where crypts were heavily infected. Morphologically, these crypts were smaller and looked non-viable (Figure 4.5E). Directly adjacent to these crypts were highly inflamed regions completely devoid of crypts.  Interestingly, these regions  contained pockets of C. rodentium clusters deep in the lamina propria at a location corresponding to where a crypt base would be expected. The results suggest a link between the heavy infection of the crypts in Retnlb-/- mice and the severe damage associated with the tissue. Collectively, these results show that the absence of RELM renders tissues of the large bowel more susceptible to infection by an A/E pathogen, which may lead to severe mucosal damage.  213  Figure 4.5 Disease severity of Retnlb-/- mice is associated with higher cecal burdens and invasion of colonic crypts by C. rodentium. A. Enumeration of C. rodentium in the tissue and luminal compartments of the cecum and colon of Retlnb-/- and BL/6 mice at 4, 6, and 10 DPI. Each data point represents one animal. 214  B. Visualization of C. rodentium infection in PFA-fixed frozen cecal sections by staining for LPS (red) with nuclei specific DAPI (blue) as a counterstain. C. rodentium (arrow) caused a more widespread infection of cecal epithelial cells in Retnlb-/- mice compared to BL/6 mice. Results are representative of at least 2 separate infections with 2-4 mice per group. Original magnification = 200X. Scale bar = 100 μm. C. C. rodentium staining as in B, in formalin-fixed mouse rectal tissues at 6 and 10 DPI. C. rodentium (red) can be seen colonizing the crypt lumens, from the opening of the crypt surface right down to the base. Data is representative of 3 individual experiments, containing 2 – 6 mice per group. Original magnification = 200X. Scale bar = 100 μm. D. Quantitation of C. rodentium-filled crypts in Retnlb-/- and BL/6 mice at 10 DPI. Results represent the mean of the total crypts counted in rectal sections from individual mice of each strain, pooled from 2-6 mice per group. Error bars = SEM. E. H&E of a heavily ulcerated rectal tissue of an infected Retnlb-/- mouse at 10 DPI. Heavily infected crypts that look unhealthy (black arrows) are seen adjacent to severely damaged and ulcerated region that is completely devoid of epithelium. Focal clusters of bacteria can be seen deep in the lamina propria in these regions (white arrows), at locations where crypt bases would be found. These are representative of multiple infections. M = mucosa; SM = submucosa; MM = muscularis externae. Original magnification = 100X. Scale bar = 100 μm.  4.2.6 Evidence for altered goblet cell responses in Retnlb-/- mice In addition to the severe inflammation seen throughout the large bowel, Retnlb-/- mice exhibited signs of altered epithelial responses during infection. One salient feature was the presence of focal patches of goblet cell hyperplasia that occurred sporadically throughout the colorectal tissue. This was particularly evident in the proximal colon of Retnlb-/- mice compared to BL/6 mice, and was characterized by a visibly higher representation of goblet cells within the crypts, accompanied by clear alterations in their morphology, including a hypotrophic response, characterized by a marked expansion of the goblet cell theca housing the apical granule mass (Figure 4.6A). While infected BL/6 mice also showed a mild increase in goblet cell theca size, this was not to the degree seen in infected Retnlb-/- mice (Figure 4.6A). In the descending colon and rectum in regions of  215  heavy infection, goblet cell hyperplasia was also observed. To examine how these hyperplastic goblet cells may be responding to the infection in situ,  Figure 4.6 Retnlb-/- mice display evidence of altered goblet cell responses during infection. A. H&E highlight patches of goblet cell hyperplasia in Retnlb-/- vs. BL/6 mice at 10 DPI Boxes “i” to “iv” show magnification of corresponding boxed regions in images on the right. Arrows point to goblet cells. Results are representative of at least 3 independent infections. Original magnification = 200X. Scale bar = 100 μm. B. Periodic acid-Schiff staining of Carnoy’s-fixed colorectal tissues of BL/6 and Retnlb-/under uninfected or C. rodentium-infected (10 DPI) conditions. Patches of goblet cell 216  hyperplasia in Retnlb-/- mice lead to regions of mucin hypersecretion (arrow) during infection. This is Muc2 based on immunostaining (not shown). Original magnification = 100X. Scale bar = approx. 100 μm. C. Quantitation of mucus-filled crypts in Retnlb-/- vs BL/6 mice. Results represent the mean (+/- SEM) of 2-4 mice per group. I fixed tissues from infected Retnlb-/- and BL/6 mice with Carnoy’s fixative, which preserves luminal mucus [32], and stained the tissues with PAS to visualize mucin glycoprotein (described in Chapter 2). The results demonstrated that these hyperplastic patches were associated with a highly localized but massive mucus secretory response in heavily infected areas (Figure 4.6B). This is in contrast to infected BL/6 mice, which were exhibiting their characteristic signs of depletion of mature goblet cells [30] and contained fewer numbers of crypts with goblet cell hyperplasia and hypertrophy compared to Retnlb-/- mice, as determined by quantification of mucus-filled crypts (Figure 4.6C). These results suggest that the absence of RELM impacts on some aspects of goblet cell homeostasis in response to enteric infection. 4.2.7 Disease severity in Retnlb-/- mice is partially dependent on EspF production by C. rodentium. The susceptibility of some mouse strains to C. rodentium infection may or may not be dependent on the activity of specific virulence factors produced by these pathogens. EspF is a critical effector of EHEC/EPEC and C. rodentium, and an important modulator of disease during infection [33]. Our laboratory has shown that the susceptibility of Tlr2-/mice is heavily dependent on the virulence factor EspF [31]. However, in Muc2-/- mice, the susceptibility is mainly EspF-independent [14].  To understand whether the  susceptibility of Retnlb-/- mice to C. rodentium is dependent on specific virulence factors, I infected Retnlb-/- and BL/6 mice with either an espF C. rodentium or wildtype (wt) C. 217  rodentium, and assessed weight loss in the following days as an indicator of morbidity. I found that while wt C. rodentium infected Retnlb-/- mice lost the most weight (mean, 10%) by 10 DPI, espF C. rodentium-infected Retnlb-/- mice did not lose any weight during infection, nor did any BL/6 mice from either group (Figure 4.7A). At 10 DPI, the mice were euthanized and their large bowels were excised for further examination. Consistent with the weight loss, macroscopic analysis of the large bowels showed on average a reduced overt pathology in the espF C. rodentium-infected Retnlb-/- mice compared to wt C. rodentium-infected Retnlb-/- mice. The cecum revealed the greatest difference, from no overt changes to moderate inflammation in the espF C. rodentiuminfected Retnlb-/- mice (Figure 4.7B, upper left panel). In contrast, there was consistent shrinking of the cecum, progressing to total loss of cecal luminal content in wt C. rodentium-infected mice. Histologically, this manifested as more widespread mucosal thickening and inflammatory exudate in the cecal lumen of wt C. rodentium-infected Retnlb-/- mice compared with mice infected with the espF mutant (not shown). In the colons, the lumens were frequently devoid of stool and exhibited dramatic thickening, and consistently showed evidence of ulceration (Figure 4.7B). In espF C. rodentiuminfected Retnlb-/- mice, however, ulcers were observed in only 1/7 mice, and there was reduced colonic thickening (Figure 4.7B). Histologically, the rectal tissues of espF C. rodentium- infected Retnlb-/- mice exhibited hyperplasia, while wt C. rodentium-infected Retnlb-/- mice exhibited edema and marked mucosal erosion and patches of C. rodentium in the crypts and lamina propria (Figure 4.7C, upper