UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Latitudinal gradients in adaptive traits of Populus Soolanayakanahally, Raju 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2011_spring_soolanayakanahally_raju.pdf [ 2.44MB ]
JSON: 24-1.0071480.json
JSON-LD: 24-1.0071480-ld.json
RDF/XML (Pretty): 24-1.0071480-rdf.xml
RDF/JSON: 24-1.0071480-rdf.json
Turtle: 24-1.0071480-turtle.txt
N-Triples: 24-1.0071480-rdf-ntriples.txt
Original Record: 24-1.0071480-source.json
Full Text

Full Text

LATITUDINAL GRADIENTS IN ADAPTIVE TRAITS OF POPULUS  by  Raju Soolanayakanahally  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Forestry)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) November 2010 © Raju Soolanayakanahally, 2010  Abstract In an attempt to better understand adaptation to north-temperate and boreal environments, I have studied variation in phenology, ecophysiology and single nucleotide polymorphisms in an extensive range-wide collection of Populus balsamifera L. (balsam poplar) populations. Based on three years of observation, I infer that the differences in phenology between two common garden sites, with similar photoperiodic regimes but dramatically different climates, is based on differences in spring start date resulting in different dates of photoperiodic competency for height growth cessation and leaf senescence. Autumn phenophases in balsam poplar are primarily cued by the absolute photoperiod and do not respond to direction of change or climate warming. Interactions between photoperiod, climate and genotype can have large, heretofore unreported effects on root:shoot ratio. By comparison to P. tremula L. (European aspen) and published data for P. trichocarpa Torr. & Gray (black cottonwood), I found, in common garden conditions, a global tendency towards increasing photosynthetic rates with latitude. Height growth, being under photoperiodic control, follows the opposite pattern. When photoperiodic limitations were removed in a greenhouse experiment, higher photosynthesis in high latitude genotypes of balsam poplar was associated with greater height increment. Mesophyll conductance also varied clinally and accounts, in part, for higher photosynthesis in the northern balsam poplar genotypes. Phenotypic data presented in this thesis will ultimately be used for large-scale association genetics in the hopes of identifying candidate genes controlling adaptation to growing season length. As a step in this direction, we examined the comparative nucleotide diversity of the three above Populus species. We confirm that the closely related North American species (i.e., both within the section Tacamahaca) have lower nucleotide diversity than the more distantly related European aspen (section Populus). Divergence between the sections is estimated at about five million years ago, whereas P. balsamifera and P. trichocarpa diverged more recently (~0.8 million years ago). Linkage disequilibrium in balsam poplar decayed rapidly (within 400 bp).  ii  Preface This thesis is written as a series of manuscripts (four) with the intent of publication in peerreviewed journals. Chapter 1 provides the thesis framework, literature review and research objectives, while Chapter 6 discusses the salient findings and shortcomings and ends on future directions. All co-authors in this thesis declare no conflicts of interest.  Chapter 2: Dr. Robert Guy and Dr. Salim Silim conceived the study, advised on data interpretation and helped edit the manuscript. I took the lead in designing the experiments, standardizing the protocols, analyzing data, constructing figures & tables and completing the first draft manuscript. I helped in the original collection of some germplasm and, with assistance from Agri-Environment Services Branch – Agriculture Agri-Food Canada (AESB-AAFC), propagated the cuttings. I oversaw the installation of one common garden and assisted with the other. Dr. Minghua Song conducted the growth chamber study while I analyzed the data to compute age of competency.  Chapter 3: Dr. Robert Guy and Dr. Salim Silim conceived the study, advised on data interpretation and helped edit the manuscript. I designed the experiment, grew the trees and performed most of the gas exchange measurements. I also took the lead in analyzing the data, constructing figures & tables and completing the draft manuscript. Eric Drewes constructed the A-Ci curves while I applied the curve-fitting model to estimate mesophyll conductance. William Schroeder collected the germplasm and commented on the manuscript. A version is published in the journal Plant, Cell and Environment and reprinted with permission from Blackwell Publishing Ltd.  Chapter 4: I conceived and designed the study, did some of the gas exchange measurements in Canada and all of them in Sweden. Dr. Salim Silim oversaw the collection of the additional Canadian data.  I took the lead in analyzing the data, constructing figures & tables and  completing the draft manuscript. Dr. Robert Guy encouraged my exchange period in Sweden and provided previously published black cottonwood data. Dr. Nathaniel Street and Dr. Kathryn Robinson measured specific leaf area and monitored aspen phenology. Dr. Benedicte Albrectsen and Dr. Stefan Jansson were involved in collection and establishment of aspen germplasm and iii  funded the cost of the research in Sweden.  All co-authors equally helped to improve the  manuscript.  Chapter 5: Mohamed Ismail and I contributed equally in this manuscript which also forms a part of his PhD dissertation. I initiated the idea of doing the comparative study. We both conducted the experiment and jointly analyzed the data to produce tables and graphs leading to the draft manuscript. Mohamed Ismail did the divergence estimates. Dr. Pär Ingvarsson advised on data analysis and edited a major part of the manuscript. Dr. Robert Guy advised to estimate the age of SNPs among three Populus species and also to use two cottonwoods as a single species. Dr. Stefan Jansson provided DNA samples for aspen, while Dr. Salim Silim provided access to the balsam poplar. Dr. Yousry El-Kassaby oversaw the project and funded the sequencing. All coauthors equally helped to improve the manuscript.  iv  Table of Contents Abstract ……………………………………………………………………………………………………………. ii Preface……………………………………………………………………………………………………………...iii Table of Contents ....................................................................................................................... v List of Tables ........................................................................................................................... vii List of Figures........................................................................................................................... ix List of Abbreviations ................................................................................................................. xi Acknowledgements ................................................................................................................... xii Chapter 1. Literature review and research objectives ....................................................................... 1 1.1 Introduction ............................................................................................................................ 1 1.2 AgCanBaP germplasm .............................................................................................................. 2 1.3 Phenology and growth under global warming.................................................................................. 3 1.4 Adaptation to growing season length ............................................................................................ 3 1.5 Height growth, bud set and latitude .............................................................................................. 4 1.6 Photosynthesis and leaf lifespan .................................................................................................. 5 1.7 Water use efficiency, carbon isotope discrimination and mesophyll conductance ..................................... 7 1.8 Single nucleotide polymorphism diversity ...................................................................................... 8 1.9 Thesis objective ....................................................................................................................... 9 Chapter 2. Tree growth in an extended season: the opposite responses of spring and autumn phenophases to warmer climate ............................................................................................................. 13 2.1 Introduction .......................................................................................................................... 13 2.2 Materials and methods ............................................................................................................ 15 2.3 Results ................................................................................................................................ 18 2.4 Discussion............................................................................................................................ 21 2.5 Conclusions .......................................................................................................................... 26 Chapter 3. Enhanced assimilation rate and water use efficiency with latitude through increased photosynthetic capacity and internal conductance in balsam poplar (Populus balsamifera L.) .... 37 3.1 Introduction .......................................................................................................................... 37 3.2 Materials and methods ............................................................................................................ 39 3.3 Results ................................................................................................................................ 43 3.4 Discussion............................................................................................................................ 46 3.5 Conclusions .......................................................................................................................... 50 Chapter 4. Comparative physiology of allopatric Populus species: Geographic clines in photosynthesis, height growth and carbon isotope discrimination in common gardens .................................... 62 4.1 Introduction .......................................................................................................................... 62 4.2 Materials and methods ............................................................................................................ 65 4.3 Results ................................................................................................................................ 68 4.4 Discussion............................................................................................................................ 70 4.5 Conclusions .......................................................................................................................... 73  v  Chapter 5. Comparative nucleotide diversity across North American and European Populus species...... 85 5.1 Introduction .......................................................................................................................... 85 5.2 Materials and methods ............................................................................................................ 87 5.3 Results ................................................................................................................................ 91 5.4 Discussion............................................................................................................................ 93 5.5 Conclusions .......................................................................................................................... 97 Chapter 6. Thesis Conclusions ...................................................................................................107 6.1 Introduction ........................................................................................................................ 107 6.2 Phenology matters, a lot......................................................................................................... 107 6.3 Photosynthesis matters, a little ................................................................................................ 112 6.4 Variation behind the scene - comparative nucleotide diversity ......................................................... 113 6.5 Limitations of present work .................................................................................................... 114 6.6 Future research .................................................................................................................... 115 References..............................................................................................................................118  vi  List of Tables Table 1.1 Geographic coordinates of the AgCanBaP collection ................................................................. 10 Table 1.1 continued ........................................................................................................................ 11 Table 2.1 Three year means for all phenological events (Julian days) scored in both common gardens. Height growth duration and green-cover period are given in total number of days. ............................................... 28 Table 2.2 Biomass and root:shoot (R:S) ratios of Populus balsamifera populations excavated in both common gardens before the spring of 2009. ........................................................................................ 29 Table 3.1 Geoclimatic data for 21 provenances of the AgCanBaP collection of Populus balsamifera. ................. 51 Table 3.2 Pearson correlations (r) between geographic, climatic and physiological variables for all 210 genotypes.  .................................................................................................................................... 53 Table 3.3 Pearson correlations (r) among physiological variables for all 210 genotypes. ................................ 54 Table 3.4 Canonical structure between geoclimatic parameters and plant traits with their first two canonical variables, CLIM1 and CLIM2.............................................................................................. 55 Table 3.5 Fitted A-Ci curve parameters (±SE) estimated at 27ºC on populations representative of North (INU, DEN, KUU) and South (STL, FRE, MTN) geography. . ..................................................................... 56 Table 4.1 Geographic coordinates and mean elevation of origin for populations established in common gardens, by species. Latitude (° N), longitude (° W, North America and ° E, Europe), elevation (m). .................. 75 Table 4.2 Pearson‟s correlation coefficients among physiology, growth and geographic variables in P. balsamifera genotypes (n = 30, correlation for 13C is done on 75 genotypes). ................................................ 76 Table 4.3 Pearson correlation coefficients between geographic and physiological variables for all 116 aspen genotypes.. ..................................................................................................................... 77 Table 4.4 Comparative physiology among P. balsamifera, P. tremula and P. trichocarpa. Summary of correlations between physiological and morphological variables with latitude ................................................. 78 Table 5.1 Geographic locations of Populus populations used in this study. ................................................... 98 Table 5.2 Primer sequences and annealing temperatures for nine candidate gene loci used in the study. ............... 99 Table 5.3 Summary of single nucleotide polymorphisms for nine studied loci in three Populus species. ............ 100 Table 5.4 Summary of total nucleotide diversity (πT), and nucleotide diversity per site (θw) (x10-3) for nine studied loci in three Populus species. ............................................................................................. 101  vii  Table 5.5 McDonald-Kreitman test (MK), neutrality index (NI), and Fay and Wu‟s H in seven loci in P. balsamifera using P. tremula as an out-group. ....................................................................................... 102 Table 5.6 Within species number of haplotypes (H) and haplotype diversity (Hd) for nine examined gene loci. ... 103 Table 5.7 McDonald Kreitman test (MK), neutrality index (NI), and Fay and Wu‟s H in seven gene loci in P. trichocarpa using P. tremula as an out-group. ....................................................................... 104  viii  List of Figures Figure 1.1 Native wild-populations of Populus balsamifera L. collected through-out species natural range ......... 12 Figure 2.1 Natural range of Populus balsamifera (shaded area) and the geographic origins of 35 provenances planted in two common gardens...................................................................................................... 30 Figure 2.2 Clinal patterns with latitude of origin in Populus balsamifera populations for a) bud flush, b) bud set, and c) 50% leaf yellowing at Vancouver (open circles) and Indian Head (closed circles) common gardens. The dotted line indicates the summer solstice (June 21). .................................................................. 31 Figure 2.3 Dates of bud set for all genotypes within every population at Vancouver in 2008 (a), and % frequency of genotypes with lammas buds within each population (b). ........................................................... 32 Figure 2.4 Green-cover period ratio (post-bud set over pre-bud set) for Populus balsamifera populations at Vancouver (open circles) and Indian Head (closed circles). Exponential curve fit is plotted using latitude as the independent variable. ................................................................................................ 33 Figure 2.5 Shoot age at which height growth cessation occurs in response to a transfer to short photoperiod. The dashed lines indicate the minimum number of days (39) after bud flush for the new shoot to cease height growth. ......................................................................................................................... 34 Figure 3.1 Natural range of Populus balsamifera (shaded area) and provenances of 21 populations used in this study.  ........................................................................................................................................... 57 Figure 3.2 Mean values (±standard deviation) standard deviation for (a) height increment over 18 days during peak growth (b) assimilation rate (A) and (c) leaf mass per unit area (LMA) during free growth across 21 populations of Populus balsamifera. .................................................................................... 58 Figure 3.3 Mean values (±standard deviation) for intrinsic water use efficiency (WUEi) during free growth across 21 populations of Populus balsamifera. Provenances are arranged from left to right according to increasing frost-free days. ................................................................................................................. 59 Figure 3.4 Assimilation rate (A) as a function of Leaf N and frost-free days (FFDs) across all 210 genotypes of Populus balsamifera. . ....................................................................................................... 60 Figure 3.5 Carbon isotope discrimination calculated from δ13Cwood (□), δ13Cleaf (Δ) and intrinsic water use efficiency (○) across 21 populations of Populus balsamifera plotted against frost-free days. ............................. 61 Figure 4.1 Mean net assimilation rate (A) and leaf 13C (‰) across latitude of origin in P. balsamifera and P. tremula measured during active growth in common gardens. . ................................................................ 79 Figure 4.2 Mean height elongation duration (HED) and height growth across latitude in P. balsamifera and P. tremula used in this study. .................................................................................................. 80 Figure 4.3 Mean LMA, Leaf N density and CCI across latitude in P. balsamifera and P. tremula used in this study.  .................................................................................................................................... 81 Figure 4.4 Relationship between shoot biomass and height elongation duration (HED) among populations of P. balsamifera at the Indian Head common garden (50.33° N, 105.73o W). ........................................ 82 Figure 5.1 Synonymous (Ks) and nonsynonymous divergence (Ka) for seven loci in three Populus species. ........ 105  ix  Figure 5.2 Decay of linkage disequilibrium in three Populus species based on nonlinear regression of squared allele frequency (r2) versus distance (bp) using equation (1). ............................................................. 106 Figure 6.1 Expected effects of an early spring on bud phenology at Fort McMurray (56.56ºN)………………….. 109 Figure 6.2 Example of unusally early leaf senescence in northwestern P. balsamifera genotypes in 2010………. 110  x  List of Abbreviations 13  C  T w  A ADI AgCanBaP AST CCI CONT ELEV FFD GCP gm gs H h2 Hd HED HGC J LAD LAT LD Leaf N LMA LONG MAT MK test NI PNUE R:S Rd SD SDI TPU Vcmax WUE WUEi  carbon isotope discrimination (‰) carbon isotope composition (‰) total nucleotide diversity nucleotide diversity per site assimilation rate (µmol CO2 m-2 s-1) annual dryness index Agriculture Canada Balsam Poplar Collection average summer temperature (°C) chlorophyll content index continentality elevation (m) frost free days (days) green-cover period (days) internal (mesophyll) conductance (mol CO2 m-2 s-1) stomatal conductance (mol H2O m-2 s-1) haplotypes narrow-sense heritability haplotypes diversity height elongation duration (days) height growth cessation rate of photosynthetic electron transport leaf area duration (days) latitude (°N) linkage disequilibrium leaf nitrogen (µmol N cm-2) leaf mass area (mg cm-2) longitude (°W) mean annual temperature (°C) McDonald-Kreitman test neutrality index photosynthetic nitrogen use efficiency (µmol CO2 mol-1 N s-1) root:shoot ratio day respiration (µmol m-2 s-1) stomatal density (per mm-2) summer dryness index triose phosphate use maximum carboxylation rate of Rubisco water use efficiency intrinsic water use efficiency (µmol CO2 mmol-1 H2O)  xi  Acknowledgements This dissertation would not have been possible without the guidance and the help of several individuals who in one way or another contributed and extended their valuable assistance in the preparation and completion of this study. First and foremost, I am heartily thankful to my supervisor, Robert D. Guy, whose encouragement, guidance and support from the initial to the final level enabled me to develop an understanding of the subjects; especially phenology and mesophyll conductance. Without his encouragement and efforts, this thesis would not have been written crisply.  Rob‟s honest  scientific approach and his oasis of ideas (and, at times being very particular!!) inspired and enriched my growth as a student and as an aspiring researcher. Above all, he was always accessible and willing to help when I knocked on his door. I am very indebted to him. Salim N. Silim has made available his support in a number of ways from good advice and friendship at both academic and personal levels. I enjoyed his interest in my research as well as the fruitful discussions over phone. After all these years of working together as a team, we three (Rob, Salim & I) have raised interesting questions engaged in wild speculation about how things work in nature and why; while at other times focusing solely on tiny details of a manuscript. Furthermore, thanks to Sally Aitken, Quentin Cronk and Shawn Mansfield for accepting to be on my thesis committee and their interest in my research. I am very thankful to Quentin for helping me with Populus database and his suggestions on within population plasticity in phenology, to Sally for suggesting tying down Chapter 4 to Endler‟s hypothesis, and to Shawn for raising the primary metabolite question as a future research direction.  Thank you all for your  encouragement throughout the process. Special thanks to Stefan Jansson, Umeå University, Sweden for hosting me during the exchange program. I also extend my gratitude to Benedicte Albrectsen and Pär Ingvarsson for providing access to work with their groups. Thanks also to all my friends in Sweden for such a wonderful Swedish experience. Thanks to present and past lab-mates in the Tree Physiology Lab for assisting at various stages during my program. Special thanks to all the awesome summer students (Christiane Catellier, Keith Nichols, Carly Warnez, Amanda Dacyk, Félicia Corbeil, Melissa Mushanski, Megan xii  Shiplack, Luisa Muenter and Megumi Taguchi) both in Vancouver & Indian Head. I also thank Carol Ritland and Hesther Yueh, Genetic Data Centre for providing guidance with SNP work. I take this opportunity to especially thank Don Reynard who worked mostly behind the scene and just a call away for help. Thanks Don. I also extend my greetings to others at Indian Head (Bill Schroeder, Chris Stefner, Garth Inouye and Dan Walker). The Kort‟s family provided a home away from home during my stay at Indian Head. I acknowledge the Agri-Environmental Services Branch - Agriculture & Agri-Food Canada for providing financial support through Student Research Affiliated Program during the entire study period. This thesis was also supported by an NSERC Discovery Grant to Rob Guy.  xiii  Chapter 1. Literature review and research objectives 1.1 Introduction The genus Populus, because of its considerable economic importance coupled with favorable experimental characteristics has attracted the interest of many investigators of tree genetics and may truly be called the “guinea pig” of forest-tree breeding. Scott S. Pauley (1949), Harvard Forest, Petersham, Massachusetts1. So true. And, more than sixty years later, the genus Populus has also become a model to investigate the genetic basis of plant adaptation. Long-lived forest trees are especially suited to study natural evolutionary forces in shaping local adaptation among populations to heterogeneous environments. Members of the genus Populus (commonly known as poplars, cottonwoods and aspens) are also excellent model species to study tree responses to changing environments. The wide geographic distributions of various poplar species as dominant components of temperate and boreal forests, both in North America and Europe, present many advantages to researchers in uncovering the molecular-genetic basis for differences in physiological traits and their functional regulation (Jansson et al. 2010). With the availability of the complete genome sequence of Populus trichocarpa Torr. & Gray (Tuskan et al. 2006) poplars now serve as “sign posts” pointing the way towards an understanding of the molecular basis of population adaptive divergence in nature. It is often difficult to find explanations for species distribution patterns and this matter has been approached from the individual viewpoint of each of the ecological disciplines, which range from physiology, genetics and molecular ecology.  Pickett et al. (1994) stressed the need for  integration of the ecological disciplines to advance ecological theory to create a solid background to guide practical initiatives. The occurrence of broad-range species in the high latitudes could itself be a consequence of the impact of successive glaciations, leaving only the most adaptable species behind (Rohde 1996). This very occurrence of various Populus species across major climatic and/or photoperiodic regimes has tempted ecophysiologists and geneticists to examine possible local adaptation and genetic variations both within and among populations. To that end, researchers on both sides of the Atlantic have established well-documented repositories of native, 1  Scott S. Pauley (1949) Forest- tree genetics research: Populus L. Economic Botany 3: 299-330.  1  wild-type germplasm, collected prior to any significant human impact. Apart from evolutionary importance, these collections are of value towards intra- and inter-specific tree breeding. 1.2 AgCanBaP germplasm The importance of the Agriculture Canada Balsam Poplar (AgCanBaP) collection of Populus balsamifera is beginning to be recognized (Lascoux and Petit 2010) as Canada has an extremely wide range in climatic conditions, and commensurate with that, an extremely wide range of photoperiodic regimes.  In Canada, poplar genetic resources at Agri-Environment Services  Branch – Agriculture Agri-Food Canada (AESB-AAFC) are being managed mainly for two purposes: conservation and as a source of germplasm for cultivar development, to yield feedstock for multiple purposes. The current AESB-AAFC breeding program mainly uses balsam poplar (Populus balsamifera L.) and plains cottonwood (Populus deltoides L.) as parental species. However, little research has been done in balsam poplar to fully exploit its inherent genetic diversity as a breeding stock. This led to the recent establishment of the AgCanBaP collection to encompass the full geographic range of the species (Figure 1.1). As of 2010, the AgCanBaP collection has grown to 62 populations (Table 1.1), with 15 distinct trees per population collected without phenotypic bias so as to capture a high proportion of genetic variation. In North America, there are several additional existing provenance collections. For example in western Canada, in addition to the AgCanBaP collection, researchers at the British Columbia Ministry of Forests & Range have a large black cottonwood (Populus trichocarpa) collection (Xie et al. 2009), while researchers at University of Lethbridge have sampled narrow-leaf cottonwood (P. angustifolia James.) populations from Arizona to Alberta (Rood per. commn.). To the east, the NRCan Laurentian Forestry Centre has recently expanded their eastern cottonwood (P. deltoides v. deltoides) collection to include the plains cottonwood, a subspecies of P. deltoides, from the Canadian prairies. Researchers in Europe have established large collections of P. tremula L. (Hall et al. 2007) and P. nigra L. (Lefèvre et al. 1998) clones from different latitudes and climates. The very large number of available distinct native genotypes (among the closely related cottonwoods and the more distant aspens) is a valuable resource for researchers to identify the genes involved in adaptation and specific functional traits. Overall, these collections will yield not just information but also germplasm, suitable for many purposes under present and future conditions. 2  1.3 Phenology and growth under global warming Phenology, the study of the timing of yearly events, is the oldest branch of environmental science - the longest continuous phenological record dates back 1200 years (the blossoming of cherries in Japan). The founding fathers of modern plant phenology are the Swedish botanist, Carolus Linnaeus (1707-1778) and British landowner, Robert Marsham (1708-1797).  Phenological  events are highly correlated with seasonal changes in environment. The two main environmental cues that induce growth and dormancy in trees are temperature and day length (photoperiod). While the former shows considerable year-to-year variation, photoperiod remains invariant in timing over successive years and correlates perfectly with latitude where summer days are longest further north. Together, the two cues indicate the seasonal window of favorable growth conditions; temperature for marking the arrival of spring and photoperiod for indicating the end of summer. Photoperiod is not always a useful indication that winter has or has not passed, but in the autumn it protects perennial plants from the fatal consequences of a winter that is sure to come (Körner and Basler 2010). A steady lengthening of the green-cover period has been documented worldwide (Peñuelas et al. 2009), with a lengthening of the frost-free period at both ends of the growing season (McMahon et al. 2010). If trees are able to track adjustments in growing season length, the extended greencover period could lead to enhanced terrestrial carbon fixation. However, the extent to which life-history events are plastic to growing season length in different species is poorly understood. Although there is much discussion regarding natural and/or assisted migration resulting from, or in response to, changes in temperature (Aitken et al. 2008, Wang et al. 2010), it is equally important to consider the role of photoperiod in climate adaptation (Bradshaw and Holzapfel 2008). As trees are programmed internally to cease growth before the first frost in response to photoperiod, they might fail to effectively track the lengthening growing seasons of a warming world. Worrall (1999) cautioned that the mechanisms that link temperature and photoperiodic timing may not be straightforward. Worrall suggested that trees may not necessarily delay autumn leaf senescence because a warmer climate could accelerate leaf aging and actually cause them to fall early. 1.4 Adaptation to growing season length There is a global tendency for biodiversity to decrease and for the size of individual species ranges to increase at high latitudes, with strong local adaptation to differences in growing season 3  length (Crawford et al. 1995). Plant species adapt to contrasting habitats through morphological, behavioral, and (underlying) physiological polymorphisms (e.g., differences in signal perception, photosynthesis, respiration, water use, carbon partitioning, etc). Many plant and animal species display latitudinal clines in functional traits. For example, there are counter-gradient latitudinal differences in growth rates, an adaptation to growing season length (Conover and Present 1990). Campos et al. (2009) reported that a shrimp (Crangon carngon L.) population from high-latitude compensates for a shorter summer season by growing very fast, relative to a low-latitude population, when conditions are favorable. Studies have shown similar adaptation to growing seasons in various organisms (James et al. 1995, Oleksyn et al. 2002, Laugen et al. 2003). The occurrence of similar clines in different species occupying the same environmental gradient is strong evidence for the adaptive importance of the trait in question (Endler 1973). The same is implied by similar but geographically separated clines within a species (e.g., with elevation on separate mountains, or with latitude at widely different longitudes). Uncovering such functional traits is one of the goals of comparative physiology. 1.5 Height growth, bud set and latitude Plants are not affected by latitude per se, but rather by the complex mix of environmental variables that drive selection, such as growing season length, temperature, and water availability that are correlated with it.  These variables are of course also influenced by elevation,  continentality, physiography and local site conditions. Generally, when trees from northern provenances are transferred to the south they have a better chance of survival than do trees moved in the opposite direction, but they are also commonly dwarfed relative to southern populations. Sylven (1940) observed earlier height growth cessation in European aspen (Populus tremula) trees originating from high-latitudes than from low-latitudes when planted into a common garden. Pauley and Perry (1954) repeated the work of Sylven using latitudinally diverse populations of P. balsamifera, P. deltoides, P. trichocarpa and P. tremuloides. They reported that Populus continue to grow up until when the day length falls below a genotype-specific critical threshold. The timing of height growth cessation is inversely correlated with the latitude of origin. Farmer (1993), in his common garden studies, observed that P. balsamifera clones from 53°N latitude stopped growth in mid-July when planted at 45°N latitude, while local clones continued until September. Schnekenburger and Farmer (1989) suggested that photoperiodic response may be the only major adaptive mechanism responsible for genetic differentiation among trees along latitudinal gradients. The evidence for latitudinal clines in the date of bud set 4  triggered by short photoperiods had been reported for several trees species (Ekberg et al. 1979, Mikola 1982, Li et al. 2003, Ingvarsson et al. 2006). These findings underline the generality of the adaptation across latitudes. Howe et al. (1995) looked at the critical photoperiod for bud set and photoperiodic sensitivity in two “ecotypes” (34°N and 53°N) of P. trichocarpa grown in a greenhouse. In that experiment, the northern ecotype had a longer critical photoperiod and the highest sensitivity (i.e., it required fewer “inductive cycles” or days). Howe et al. (1998) took this further to look at the molecular genetic basis for the observed differences in bud set, and implicated the phytochrome gene family (PHYA and PHYB) in playing an important role in growth cessation, bud set and dormancy induction in trees. Yonovsky and Kay (2002) provided evidence that PHYA is involved in perceiving day length in the regulation of FLOWERING LOCUS T (FT) mRNA levels in Arabidopsis leaves through activation of CONSTANS (CO). In 2005, Huang et al. stated that FT mRNA moves from leaf to shoot through the phloem where it then induces flowering. A retraction was published in 2007 2 when it was discovered that the FT protein itself, and not its transcript, moves through the phloem to induce flowering. Meanwhile, Böhlenius et al. (2006) showed that FT is also involved in height growth cessation, whereby short days result in dramatically reduced FT transcription in aspen leaves, leading ultimately to bud set. 1.6 Photosynthesis and leaf lifespan Photosynthetic rates of tree canopies vary depending on physiological, structural, edaphic and climatic factors. Leaf nitrogen is an important determinant of maximum photosynthetic rate, whereas the availability of light and water often restrict this potential (Hungate et al. 2003). The economics of nitrogen and water use in photosynthesis are inextricably linked, owing to their mutual dependence on stomatal conductance. Stomatal closure, in addition to increasing wateruse efficiency (WUE), decreases the photosynthetic nitrogen-use efficiency (PNUE, photosynthetic rate per unit leaf nitrogen). In other words, there is a negative correlation or trade-off between WUE and PNUE (Field et al. 1983). Since about half of leaf nitrogen is invested in photosynthetic proteins, there is a strong correlation between the photosynthetic capacity (the light-saturated rate of photosynthesis at an ambient condition) and leaf nitrogen content per unit area (Evans 1989). Thus, to inherently  2  Retraction of Huang et al., Science 309: 1694 -1696 on April 20 2007; vol. 316 p. 367  5  possess high rates of photosynthesis, canopies should accumulate a large amount of nitrogen in their leaves (Hirose and Werger 1987). Speed is not everything, however. Small (1972) showed that deciduous species have a higher rate of photosynthesis, while evergreen species photosynthesize more slowly and utilize nitrogen for a longer period resulting, over time at least, in a higher efficiency of nitrogen use. Photosynthetic nitrogen-use efficiency tends to be lower in tree species compared to other plants (Hikosaka et al. 1998). Several ecological studies have shown that leaf lifespan tends to be greater in plants adapted to low-nutrient environments (see Aerts and Chapin 2000).  Likewise, numerous studies have  reported a negative relationship between photosynthetic rate and leaf lifespan at the species level.  For example, Johnson and Tieszen (1976) found that photosynthetic capacity was  inversely related to leaf lifespan among different species naturally occurring in Alaska.  A  similar relationship is seen between angiosperm and gymnosperm tree species (Reich et al. 1992, Gower et al. 1993). It is now widely accepted that there is a global convergence of leaf traits; species with a longer leaf lifespan have a lower photosynthetic capacity per unit area and a lower nitrogen concentration per unit mass irrespective of life form, phylogeny and biome (Wright et al. 2004). At the population level within species, a consistent trade-off between photosynthetic rate and leaf lifespan is not so clear. Benowicz et al. (2000) reported intraspecific variations in Sitka alder (Alnus sinuata Rydb.) and paper birch (Betula papyrifera Marsh.), indicating an inverse relationship between photosynthetic capacities per unit leaf area and growing season length (as indirectly implied by timing of frost hardiness development). Similarly Gornall and Guy (2007) assessed 20 black cottonwood clones from five well-separated populations and found strong latitudinal trends in photosynthetic rate, stomatal conductance, and stomatal density and distribution. In contrast, Ying and Bagley (1976) and Ager et al. (1993) found no relationship between leaf longevity and photosynthetic rate in eastern cottonwood and red alder (Alnus rubra Bong.), respectively. However, a study by Dang et al. (1994) using 40 populations of red alder from British Columbia showed a weak, but positive correlation between photosynthetic rates and latitude. The studies above were all common garden experiments, where germplasm from various locations is brought together to reduce environmental variation. Although the intent of common gardens is to eliminate environmental effects, a potential problem is that some genotypes will 6  naturally end up more out of range than others, resulting in more perturbation for some than for others.  For example, because photoperiod is growth-limiting for northern genotypes in a  southern garden, they may display lower photosynthesis because of a reduced sink demand. On the other hand, because they are smaller and less demanding of soil resources, their curtailed growth could permit better nutrition and enhanced photosynthesis. Ideally, reciprocal transplant experiments allow assessment of these varied transfer distances and responses, but are difficult to implement.  Although high latitude tree populations may display higher photosynthetic assimilation rates than low latitude populations, they accomplish less height growth in common gardens. In part the lower growth rate may reflect a shorter leaf lifespan. However, similar observations were also made by Oleksyn et al. (1992) in an evergreen conifer, Scots pine (Pinus sylvestris L.) populations, when grown under short days. When photoperiodic restrictions were removed under long days, the high-latitude Scots pine populations displayed the greatest height growth. 1.7 Water use efficiency, carbon isotope discrimination and mesophyll conductance The global warming expected by the end of the 21st century will produce larger vapour pressure deficits, a redistribution of precipitation (causing drought or flooding), and in general more frequent and severe extreme climatic events (Saxe et al. 2001). Plant WUE is an important ecological trait that can affect plant performance not only when water is a limiting resource, but also when the physiological costs of water uptake and transport limit stomatal opening (Comstock 2002, Sperry et al. 2002). Measurement of WUE is valuable because it can give an idea of variation amongst genotypes and their ability to produce biomass (Hubick et al. 1986). Both natural plant populations and crop varieties show a considerable range of genetically heritable differences in WUE (Geber and Dawson 1997). Water use efficiency can be defined at the single leaf level or the whole plant or stand level, and expressed as an instantaneous value or integrated over time. At the leaf or even stand level, WUE may be measured instantaneously as the amount of carbon dioxide fixed relative to water transpired (or, alternatively, the stomatal conductance). At the whole plant or crop level, it may be defined as biomass production per unit water consumed over the life of the plant, or used to grow the crop. Stable carbon isotope discrimination (Δ) connects instantaneous measurements of  7  WUE to more long-term, integrated measures of WUE, both in theory and in practice (Farquhar et al. 1982, Farquhar et al. 1988, Guy et al. 1988, Condon et al. 1990, Soolanayakanahally 2001). To gain insight into various functional aspects of plant biology, including photosynthetic metabolism and water use by individual plants and whole ecosystems, study of Δ, inferred from differences in the carbon isotope abundance parameter (δ 13C) of plant tissue, has become a commonplace approach (Dawson et al. 2002). Strong, positive correlations between δ 13C and WUE, at both individual leaf and whole plant levels, have been repeatedly shown in numerous species (e.g., Sun et al. 1996, Silim et al. 2001), including poplars (Pointeau 2008). Poplars are among the fastest growing trees and their high productivity is associated with large water requirements. As a consequence there is growing demand to develop drought tolerant genotypes or hybrids to meet future challenges. Photosynthesis can be impaired by depletion of CO2 at the carboxylation site, caused either by low stomatal conductance or a low mesophyll (internal) conductance (Flexas et al. 2008, Barbour et al. 2010). Recent studies have provided evidence for genetic and environmentally induced variation in mesophyll conductance (Evans and Vellen 1996, Warren et al. 2003, Lauteri et al. 2007). Any change in photosynthetic rate mediated by this trait must in turn affect both waterand nitrogen- use efficiency. 1.8 Single nucleotide polymorphism diversity Forest trees with large open-pollinated native populations and low levels of domestication display high levels of both genetic and phenotypic variation and are uesful organisms to look at adaptive divergence both within and among populations (González-Martínez et al. 2006).  Single  nucleotide polymorphisms (SNPs) represent the most widespread type of sequence variation in genomes, yet they have only emerged recently as valuable genetic markers for revealing particularly adaptation (Brumfield et al. 2003). Unlike microsatellites, which have mutation rates per generation of the order of 10−4, SNPs have relatively low mutation rates (10−8 - 10−9). The average pairwise nucleotide diversity in P. balsamifera is lower than in the Eurasian P. tremula (Breen et al. 2009), but quite similar to its sister species P. trichocarpa (Ismail 2010). At the same time, both the North American sister species also harbor lower silent site diversity ( s) and vary between 0.0029 and 0.0035 (Gilchrist et al. 2006; Breen et al. 2009).  With the  availability of a dense genome-wide map of SNPs for P. trichocarpa, a central issue in tree 8  genetics is whether it is now possible to use linkage disequilibrium (LD) to map genes that drive adaptation. For example, in P. balsamifera, Olson et al. (2010) found no evidence for decay of LD across 750 bp. This is consistent with low estimates of scaled recombination ( = 0.0092) in balsam poplar (Olson et al. 2010). 1.9 Thesis objective Canada will need to meet the long term challenges of climate change. As a result, there is considerable interest in Populus balsamifera within the Canadian Poplar Breeding Program. Hence, there is a strong need to understand the functional variation in ecophysiological and other adaptive traits over wide range of environmental conditions and latitudes. In this thesis, the following questions were investigated: 1. What is the extent of plasticity in phenology among AgCanBaP populations as a response to different climates? 2. Does Populus balsamifera display latitudinal clines in photosynthesis and other gas exchange-related variables (i.e., stomatal conductance, stomatal density, mesophyll conductance, NUE, WUE and δ13C)? 3. If so, are these clines simply common garden artifacts or are they maintained when environmental restrictions, such as photoperiod, are removed? 4. If there is a trade-off between growing season length and photosynthetic rate, is it a globally consistent pattern within Populus? 5. What is the extent of nucleotide diversity between Populus species for specific traits of interest?  9  Table 1.1 Geographic coordinates of the AgCanBaP collection Population  Latitude (°N)  Longitude (°W)  Elevation (m)  London New Glasgow Cape Breton Island North Bay Frederiction  43.18 45.40 46.08 46.35 46.40  81.35 62.23 61.18 79.53 67.25  338 35 58 800 147  Roseville Chaplean Fischells River Matapedia  47.33 47.50 48.15 48.22  64.37 83.25 58.42 67.18  25 444 77 98  Matane  48.57  67.35  119  Rouyn-Noranda Carnduff Manicougan Kapuskasing  48.60 49.18 49.30 49.37  78.67 101.83 68.32 83.15  310 558 180 230  Matagami Fort Walsh Cypress hills Elk water Portage Sioux Lookout Minnedosa Hawkes Bay Calgary Main Brook  49.47 49.58 49.65 49.67 49.95 50.08 50.32 50.37 50.82 51.10  77.33 109.92 109.48 110.22 98.30 91.90 99.85 57.10 113.42 56.02  268 1172 1182 1300 283 384 592 11 915 10  Outlook Mount Groulx Melville Gypsumville  51.17 51.33 51.35 51.77  106.27 68.13 102.62 98.62  600 452 541 253  Stettler Saskatoon Wadena Labrador City  52.35 52.37 52.37 52.93  112.73 106.42 104.27 67.25  795 518 543 554  Grand Rapids  53.20  99.35  254  10  Table 1.1 continued Population  Latitude (°N)  Longitude (°W)  Elevation (m)  Turtleford Goose Bay Radisson Edmonton Love  53.20 53.22 53.42 53.55 53.63  108.38 60.25 77.53 113.32 105.50  648 15 153 719 419  Cold Lake Boyle Grande Prairie La Ronge  54.22 54.55 54.75 54.75  110.07 112.65 118.63 105.55  548 649 769 471  Dunlop  54.85  98.58  223  South Reindeer Umiujaq Gillam Fort McMurray  56.27 56.32 56.35 56.92  104.23 76.25 94.63 111.50  419 45 126 338  Wollaston Lake Kuujjuaq Fort Nelson Stony Rapids Watson Lake Whitehorse Hay River Denali National Park Nome Galena  57.58 58.02 58.50 59.23 60.05 60.70 60.80 63.87 64.50 64.73  103.93 68.65 122.42 105.72 128.43 135.33 115.78 149.02 165.43 156.93  423 17 414 306 691 770 168 594 12 38  Cottonwood Fairbanks Norman Wells Inuvik  65.78 64.90 65.23 68.38  163.62 146.35 126.67 133.77  104 248 84 7  Ivishak  69.38  148.23  207  11  Figure 1.1 Native wild-populations of Populus balsamifera L. collected through-out species natural range  12  Chapter 2. Tree growth in an extended season: the opposite responses of spring and autumn phenophases to warmer climate 3 2.1 Introduction Trees from distinct climates adapt to their local environment by synchronizing their phenological processes to the changing seasons (Leith 1974, Cleland et al. 2007). Temperate perennial plants typically use photoperiod (the length of day, or more precisely, night) as the reliable consistent environmental cue to time their autumn phenophases such as height growth cessation (HGC), bud set, leaf senescence and leaf drop (Fracheboud et al. 2009). These photoperiodic responses have been under differential selection by the timing of the onset of cold temperatures in autumn (Bradshaw and Holzapfel 2001). A strong clinal gradient in the timing of summer and fall phenophases, which is correlated with the length of the growing period, therefore exists with latitude and altitude. The critical photoperiod (longest day-length that triggers a phenological shift) increases with latitude and altitude, while the growth period decreases. Timing of spring phenophases (such as flowering, bud burst, leaf unfolding and greening) on the other hand, while also synchronized with the native environment, is in most temperate and boreal trees largely a function of temperature. In particular, the chilling requirements (duration, hours, of exposure to temperatures between 0 and 5 ºC during dormancy) and heat sums (temperature accumulated above a certain threshold) (Kozlowski and Pallardy 2002, Howe et al. 2003). A clinal gradient in chilling requirements and possibly heat sums as well, also exists with latitude and altitude (Worrall 1983). Similar gradients in the timing of phenophases are also seen in other organisms (e.g., arthropods, birds, amphibians) with large latitudinal and altitudinal distributions (Bradshaw and Holzapfel 2008). The impacts of climate change on plant phenological processes has attracted much attention (e.g., Walther et al. 2002), partly because of the effects of phenology on population and species distributions, species interactions and ecosystem productivity. Phenological processes are also easily observable and perhaps the most sensitive traits to climate change. It is recognized that the growing season has increased at higher latitudes as a result of nascent global warming over the 3  A version of this chapter will be submitted for publication. Soolanayakanahally RY, Guy RD, Silim SN and Song M. Tree growth in an extended season: the opposite responses of spring and autumn phenophases to warmer climate.  13  last several decades because of earlier onset of spring (Post et al. 2009) and later termination of autumn (Myneni et al. 1997). In woody plants, flowering, bud burst and leaf unfolding are occurring earlier in spring (Menzel et al. 2006). Evidence for later onset of autumn phenophases is much weaker and appears to be species specific, and shifts do not occur or are not yet noticeable (Walther et al. 2002). Photoperiod, of course, does not change with climate warming. Although migration, natural or assisted may result in populations experiencing different photoperiods (Howe et al. 2003), the vast majority of studies examining the impacts of the extended growing season on trees have looked at spring phenology only, whereas the few (and more recent) studies looking at autumn phenophases concentrate on leaf senescence. We are not aware of any field studies that examine the impacts of increased temperature on other autumn phenophases such as HGC and bud set in woody plants. It is implicitly expected that HGC and autumn leaf colouring are correlated and thus, if a delayed autumn (as a result of a warmer climate) results in a longer retention of leaves, HGC is equally delayed. This would be true if the cue for both phenophases is the same and the traits display the same extent of plasticity to temperature. However, Fracheboud et al. (2009) have shown that this is not the case, and although HGC must precede leaf senescence, these events are independently cued. The timing of HGC and the duration of the green-cover period (both before and after HGC) will affect within tree carbon (C) allocation, above and below ground growth and overall ecosystem C storage. Here we report results from three-year observations of spring and autumn growth phenophases (stages of bud burst, leaf emergence, HGC, and leaf senescence) and the resultant biomass production in a range-wide collection of balsam poplar (Populus balsamifera L., Salicaceae) planted in two common gardens at similar latitudes, but with differing mean winter temperatures and growing season length. Balsam poplar is a transcontinental species in the boreal zone of North America (Fig. 2.1). The wide, continuous distribution range of balsam poplar represents a complex environmental gradient of temperature, photoperiod and growing season length. Highlatitude habitats and species are expected to experience particularly extreme temperature changes with climate change (IPCC 2007). To fully understand the impacts of climate warming on growth and productivity of trees in northern habitats, it is necessary to observe the complete growth phenology from bud burst to leaf senescence. For trees to effectively utilize the increasing growing season and compete effectively, an earlier growth initiation (bud flush, leaf unfolding or  14  greening) and later growth cessation and leaf senescence would be necessary. Because of their long-lived nature, a later occurrence of autumn phenophases would represent a shift to shorter critical night length in their lifetime in their current locales. This can only be possible if their autumn phenophases are sufficiently plastic to photoperiod. We, therefore, asked: i) to what extent are autumn phenophases, primarily photoperiod-driven processes, plastic to climate warming? ii) are growth cessation (bud set) and leaf senescence plastic to the same extent? and iii) if they are not, what is the impact of this uncoupling on biomass productivity and partitioning? We highlight how photoperiodically cued, but temperature selected, phenophases may influence tree species adaptation to climate warming.  In addition, we also introduce the concept of  photoperiodic competency, the ability of temperate and boreal woody plants to cease height growth in response to their critical photoperiod after certain age. This previously unreported phenological phenomenon may have a major impact on autumn phenology when spring growth starts early. 2.2 Materials and methods Common garden establishment The genetic material used in this study is a subset of a larger Agriculture Canada Balsam Poplar (AgCanBaP) collection representing 62 provenances composed of 15 distinct trees sampled per provenance. For more information on sampling procedure refer to Soolanayakanahally et al. (2009).  Details regarding the origin of the 35 populations used in this study are given in  Supplement 2.1 (see also Fig. 2.1). From each tree, dormant whips of 6-9 cm with a minimum of two buds were forced to root in book containers filled with a mixture of Sunshine-2 (Sun Gro Horticulture, Vancouver, Canada) growing mix (60%), peat moss (30%) and vermiculite (10%). The rooted cuttings were grown in a greenhouse during the spring of 2006 with natural light supplemented with artificial lighting by cool-white fluorescent lamps to provide a 21 h photoperiod and a minimum fluence of 400 μmol m-2 s-1 PPFD at plant level. Maximum day and night temperatures were maintained close to 25 and 18 °C, respectively. Upon flushing, the plants were well watered and fertilized with Hoagland‟s solution (Hoagland and Arnon 1950). In midJune, when all plants were approximately 30 centimeters tall, they were moved to a shade house. Common gardens were established at Vancouver, British Columbia (49.12 °N 123.10 °W) in June 2006, and before bud flush at Indian Head, Saskatchewan (50.33 °N 103.39 °W) in May 2007.  15  Because both sets of plants completed growth outdoors in their first year (2006), they were of comparable size across the two common gardens when phenology scoring began in early 2007. Fifteen genotypes from each provenance were planted in a group at 2m × 2m spacing and groups (provenances) were then randomized within blocks (i.e., two ramets per genotype at Vancouver and five ramets per genotype at Indian Head). Typical growing season length in Vancouver is longer by 110 days than at Indian Head (dates for Regina, Saskatchewan, 65 km to the east, was used)  (http://www.almanac.com/content/frost-chart-canada).  Maximal  photoperiods  for  Vancouver and Indian Head are 16 h 5 min and 16 h 12 min, respectively. Over the three years of this study, mean maximum summer temperatures were 20.5 °C and 21.8 °C and mean annual precipitation was 1277 mm and 447 mm, respectively, at Vancouver and Indian Head (both gardens were equipped with weather stations). The Vancouver common garden was sprinkler irrigated as necessary during the summer months. Phenological observations Spring and autumn phenology characterized by bud burst and bud set were monitored for three seasons (2007, 2008 & 2009) in the two common gardens. Leaf senescence was only scored in 2009. At each site the observations were recorded by the same personnel walking through the common garden twice a week (every Tuesday and Friday). A scale of 0 to 10 was used to describe the different phenological stages, where 0 represented a spring stage where the buds were still dormant and 10 an autumn stage when there was complete leaf senescence. During early spring, the developmental stage of the terminal buds of each tree was scored on a scale from 0 to 3 (0 = dormant bud, 1 = bud swollen, 2 = bud open with visible green tip, 3 = complete bud flush). This was immediately followed by recording leaf unfolding (very small leaves with visible petiole, stage 4) which here is considered as the first day of the green-cover period. Within a few weeks of leaf unfolding we began scoring the condition of the apical meristem of the current-year terminal shoot on a scale from 5 to 7 (5 = current terminal of the main stem actively growing, 6 = terminal bud beginning to form on shoot apex, 7 = terminal bud fully developed and covered by dark brown scales). Leaf senescence dates in autumn were recorded on a scale from 8 to 10, using the Swedish aspen senescence score card (Fracheboud et al. 2009), whereby 8 = ~25% of the leaves on the tree have turned yellow, 9 = ~50% of the leaves on the tree have turned  16  yellow, and 10 = 100% leaf drop. The tree-averaged green-cover period was calculated as the difference between Julian dates recorded for stages 4 and 9. In 2008, we also recorded lammas growth when it occurred, which is defined as a secondary midsummer flush from a newly formed bud before entering stage 7. Root:Shoot (R:S) ratio determination To better assess total plant growth and to estimate the R:S ratio, we harvested five to seven trees from seven populations representing two latitudinal transects (Supplement 2.1, populations marked by asterisk) in both common gardens before bud flush during the spring of 2009. The excavated roots and complete aboveground shoot of each tree were collected separately in brown paper bags and stored in cooler boxes for transfer to the laboratory. Most of the fine roots (< 1 mm diameter) were not recovered but enough care was taken to get close to 85 - 90% of the remaining roots from each tree. In the laboratory, roots were separated from the soil by washing manually under running tap water on a sieve (1 mm mesh). These roots were pressed in absorbent cloth to remove excess water and the fresh weight recorded. The shoot fresh weight was also taken before roots and shoots were oven dried at 70 °C to constant mass for computation of the R:S ratio. Growth chamber experiment To estimate the length of time needed for new growth to reach photoperiodic competency and then cease height growth in response to a change in photoperiod, we conducted a growth chamber experiment. A subset of six genotypes from six populations (Norman Wells, Kuujjuaq, Hay River, Fort McMurray, Love and Minnedosa; see Supplement 2.1 marked by §) covering a range of latitude from 65.23 °N to 46.40 °N were grown in two growth chambers having different photoperiods (20 h and 16 h). The temperature regime was the same in both chambers; day 25 °C and night 18 °C. Beginning four weeks after flushing (stage 3) under long photoperiod (20 h) one ramet from each of the three genotypes per population was moved to the short photoperiod (16 h) chamber at regular intervals. The experiment was terminated after 81 days growth. A set of controls from each population were also grown under both photoperiods. Height increments were recorded every second day throughout the experiment, and date of bud set (stage 7) was recorded.  17  Statistical analysis All statistical analyses used SAS version 9.1.3 (SAS 2003). Two-way analysis of variance (ANOVA) was performed to test for effects of provenance and differences between common garden sites using all genotypes. In most cases, however, it was not possible to bring data to conform to assumptions of normality and homogeneity of variance. Regression lines in figures are based on population means within each common garden. Common garden averages for each phenological event were calculated from pooled data across years. 2.3 Results Balsam poplar phenology Large differences in spring phenophases and smaller differences in autumn phenophases were observed between the two locations (Table 2.1).  Spring is later and relatively abrupt in  continental as compared to oceanic climates. Bud flush (stage 3) occurred 44 days in advance at the Vancouver common garden compared to the Indian Head common garden (P < 0.0001; Fig. 2.2a). There was also a significant garden×latitude interaction effect (P = 0.0005), whereby bud flush occurred over a longer period at Vancouver as compared to Indian Head (29 days vs. 17 days, respectively), reflecting the differences in speed of temperature increase between the two locations at the different times. Bud flush date and latitude of origin were well correlated (Vancouver: r = -0.692, P < 0.0001; Indian Head: r = -0.517, P = 0.001) but the slope of this relationship was not steep at either location, hence there is a weak clinal relationship between latitude of origin and date of bud flush in balsam poplar. The formation of a resting bud, containing leaf primordia for the next growing season, marks the end of height growth. Bud set (stage 7), therefore, is a good indicator of the timing of growth cessation. The average date of final bud set took place 28 days earlier in Vancouver, despite the longer growing period, than in Indian Head (P < 0.0001; Fig. 2.2b). Strong clinal variation in date of bud set with latitude of origin was seen at both locations (Vancouver: r = -0.938, P < 0.0001; Indian Head: r = -0.977, P < 0.0001). The higher the latitude of origin, the earlier the bud set. Indeed, in Vancouver (the warmer location) final bud set in most of the high-latitude populations (63.87°N to 68.38°N) occurred almost 2½ weeks before the summer solstice (June 21), while day length was still increasing (Fig. 2.2b). There was no garden×latitude interaction 18  effect (P = 0.07). The difference in date of bud set between the most northerly (Inuvik, 68.38°N) and southerly (Fredericton, 46.40°N) populations was approximately 88 days at both locations. Populations had, on average, an additional 14 days of height growth (calculated based on the difference between stages 7 and 4) in Vancouver compared to Indian Head. This contrasts with the overall difference in growing season length of about 110 days between the two locations (http://www.almanac.com/content/frost-chart-canada). Means plotted in Figure 2.2 obscure considerable within-population variation in bud phenology, particularly among the mid-latitude and some low-latitude populations growing in Vancouver. In addition to this variation, lammas growth, which is the premature flushing of new buds before they go fully dormant, occurred in many populations but in Vancouver only (Fig 2.3a). In these cases, renewed shoot growth continued for 3 to 12 weeks before a second and final bud set was recorded as stage 7. The frequency of lammas was particularly high in mid-latitude populations (Fig 2.3b). With the exception of the most southerly population (Fredericton), the usual pattern for low-latitude genotypes was to grow continuously from bud break in spring until bud set in late summer or autumn. Although the high latitude populations set bud much earlier, they did not lammas. Only one genotype out of 90 sourced from above 60ºN had a second flush. Many genotypes from other populations, however, tended to have an initial bud set just before or not long after the solstice, but would then flush and grow until setting bud again in mid-summer. In sharp contrast to final bud set dates, there was weak but significant reverse clinal pattern in date of lammas bud formation (r = 0.265, P = 0.001). In the majority of cases, buds that lammased were set prior to or near the solstice, but there seemed to be a second wave of lammas bud formation towards the end of July. In no case did an individual tree lammas more than once. Even among the low and mid-latitude populations there were some genotypes that behaved like the northern populations by prematurely setting final buds (near the solstice) that did not lammas (Supplement 2.2). For most of the remaining genotypes able to grow continuously through the solstice, the dates of bud set at Vancouver and at Indian Head were coincident. Likewise, second buds formed after lammas were set about the same time (not shown). There was a strong clinal pattern for leaf senescence with latitude of origin (Fig. 2.2c, Vancouver: r = -0.818, P < 0.0001; Indian Head: r = -0.934, P < 0.0001). Unlike bud flush and bud set,  19  however, leaf senescence was more coincident between the two common gardens, and there was also a strong garden×latitude interaction effect (P < 0.0001).  On average, stage 9 (50%  yellowing) occurred just 14 days earlier in Vancouver than in Indian Head. The difference was greater for low latitude populations than it was for the high latitude populations, which had similar dates of leaf senescence in both gardens. Although on average stage 3 started earlier in Vancouver by 44 days, complete leaf drop (stage 10) at both locations occurred more or less at the same time (Table 2.1). The green-cover period (i.e., the period between stage 4 and 9) averaged 26 days longer in Vancouver than at Indian Head. The average duration of the green-cover period occurring before bud set was 72 days at Vancouver and 102 days at Indian Head site while the average green-cover period that occurred after bud set was 81 days at Vancouver and just 25 days at Indian Head. Given data presented in Fig. 2.2, the pre- and post-bud set portions of the green-cover period must also vary with latitude of origin. These differences are expressed in Fig. 2.4 as a ratio of the number GCP (green-cover period) days that occur after final bud set over the number of GCP days that occur before final bud set (GCP ratio). The GCP ratio increased several-fold with latitude of origin (P < 0.0001), and was higher in Vancouver than in Indian Head (P = 0.0004). There was a significant garden×latitude interaction effect (P = 0.0034). Root:Shoot ratio There was clinal variation in biomass accretion (P < 0.0001; Table 2.2), but growth of all excavated genotypes was much greater (14-fold) at the Indian Head location (P < 0.0001). Indeed, even the smallest, high-latitude population (Norman Wells) was almost twice as large at Indian Head as the largest, low-latitude population (Fredericton) at Vancouver. However, R:S ratios were much higher across all but one population (Fredericton) in Vancouver than in Indian Head (P < 0.0001). The overall mean R:S ratio at Vancouver was 2.05 whereas at Indian Head it was 1.34. Clinal variation in R:S ratio was obvious at both gardens (P < 0.0001); for example, at Indian Head the R:S ratio for Norman Wells was 2.6× larger than for Fredericton, whereas at Vancouver it was 6.1× larger (Table 2.2).  20  Growth chamber experiment Shoot cuttings rooted in the growth chamber flushed at approximately 7 days, typically yielding 5-8 pre-formed leaves. Afterwards, shoots continued to grow indeterminately and produced numerous neoformed leaves until HGC. The long day treatment (20 h) was sufficiently long to maintain active growth in most but not all populations (e.g., Norman Wells). The short day treatment was sufficiently short to induce growth cessation in most ramets from Norman Wells, Hay River, Kuujjuaq, Fort McMurray and Love, but not in Minnedosa. Data in Fig. 2.5 are only for ramets where a 16 h photoperiod was sufficient to induce HGC.  On average, controls  maintained under 16 h from the beginning of the experiment ceased height growth 39 days after flushing, regardless of origin. Likewise, plants transferred from one chamber to the other were not competent to respond to a reduced day length until after this date. Once plants became responsive to photoperiod, height growth ceased within ~4 days of transfer, with prominent visible green buds formed after about 11 days. 2.4 Discussion Bud phenology in an extended season Extended growing season, evidenced by earlier occurrence of spring phenophases as a result of climate warming, is already occurring at higher latitudes (Stöckli and Vidale 2004, Piao et al. 2008, Morin et al. 2009, Post et al. 2009). The full impacts of this extended growing season on tree phenological processes and the impacts of these processes on tree growth and productivity, species interactions and ecosystem C accumulation and functions is only beginning to be understood. Here, we were interested in knowing the extent to which primarily photoperioddriven phenological processes, such as growth cessation and leaf senescence, are affected by an extended season (earlier spring and a later autumn). We also wanted to know the impacts of shifts in phenological processes on tree growth and productivity. Results from our studies with rangewide P. balsamifera populations grown at two locations with similar photoperiod regime but very different temperature regimes reveal a counterintuitive phenology-driven tree growth response to an extended growing period. While spring phenology, such as bud flush and crown greening (leaf unfolding) occurred sooner at the Vancouver site, autumn phenology (mean dates of bud set and, less so, leaf senescence) was also advanced at the Vancouver site.  21  Menzel (2003) reported that the most influential factor for a longer growing season is the warmer mean spring temperatures but not delayed autumn. Bud flush and leaf unfolding (and thus the beginning of the green-cover period) were advanced by approximately 44 days in balsam poplar trees at the Vancouver site compared to Indian Head. This is in accordance with an earlier spring (by ~1½ months) in Vancouver. Bud set, and thus HGC, however, also occurred earlier at the Vancouver site, by an average of 28 days across all populations. Thus, the extended autumn growing season available at the Vancouver site (also 1½ months) was not only unutilized for tree height growth but the earlier HGC partially negated the benefits of an earlier bud flush in spring. This, on average, resulted in an extension of height growth duration of only 2 weeks at the Vancouver site, a much shorter period than would be expected based on the frost free period available for growth.  Furthermore, for many genotypes, free growth was interrupted in  Vancouver by the formation of buds that later lammased. There were also many trees that had incipient growth cessation but did not come to a full stop to set a lammas bud before normal growth resumed again (not scored). Spring phenology In poplar, spring bud flush is not controlled by photoperiod and only occurs upon accumulation of a sufficient heat sum after bud dormancy has been broken by winter chilling (Wareing 1956). Chilling requirements were readily met by near freezing but not deeply cold winters at the Vancouver site. Spring arrives relatively early; heat sums are accumulated and bud flush is advanced. At both sites, however, genotypes from higher latitude flush before genotypes from lower latitudes. Northern genotypes may have a lower chilling requirement, a lower heat sum requirement, or, because of an earlier bud set in the preceding year, they fulfill these requirements in advance of southern genotypes. Clinal patterns of bud flush with latitude of origin have often been observed in many tree species (e.g., Kriebel and Wang 1962, Worrall 1983, Wuehlisch et al. 1995). But, tree species like Picea sitchensis exhibit no clines in bud flush (Mimura and Aitken 2007), hence low QST estimates for bud flush (Savolainen et al. 2007). Competence to respond New spring growth of indeterminate trees, such as Populus, is not sensitive to photoperiod until it is a few weeks old. If this were not the case, then shoots forced to break bud early in a warm  22  environment would begin to form bud scales immediately upon flushing, producing leaves only from predetermined primordia contained within the overwintering bud. Such behavior would be maladaptive in an early spring. We conducted a growth chamber experiment to determine the age at which new shoots become competent to respond to photoperiod. On average, HGC under an inductive photoperiod (16 h controls) did not occur earlier than 39 days after flushing. Plants moved from 20 h to 16 h prior to this age (developmental stage) did not respond to photoperiod immediately either, but afterwards they did. On average, it took 4 days for responsive plants to cease height growth after transfer to an inductive photoperiod. Therefore, we conclude that under our growth chamber conditions, competence to respond to photoperiod was attained after ~35 days of growth. Further work is needed to ascertain how genetics and environment (e.g., heat sum) might affect the progression towards this state of “physiological ripeness”. Lammas and seasonal growth cessation Mean date of final bud set varied latitudinally among balsam poplar populations, there being a difference of about 13 weeks between the high-latitude and low-latitude populations. Just as for bud flush, clinal variation in bud set has been reported in many other tree species (Nienstaedt & Olson, 1961, Heide 1974, Morgenstern 1978, Ingvarsson et al. 2006). Unlike most of these studies, however, the AgCanBaP collection includes a number of very high-latitude provenances with long summer days.  In Vancouver, these populations, as well as many mid-latitude  genotypes, were induced to begin HGC well before the summer solstice. They were therefore responding to the absolute length of the photoperiod (which, at the latitude of the common gardens, is always below the critical photoperiod) as they became competent to perceive it. Even in our Indian Head garden, HGC in the northern populations (>56°N) occurred well before normal, when they become competent. The direction of photoperiodic change (increasing vs. decreasing day length) is clearly not involved. This is unsurprising given that, in their native environments, spring arrives only a few weeks before the summer solstice. For the most northerly populations, by the time it is warm enough for bud flush, the days are already close or equal to 24 hours.  As a consequence, the growing shoots would normally experience only decreasing  photoperiods and there would be no selective pressure towards distinguishing the direction of change.  23  Premature bud set at or near the solstice was not restricted to the northern populations and was observed in many other genotypes. In some case, these buds entered dormancy and did not lammas, whereas the majority went through a second flush. Although, as noted above, the average date of HGC was earlier in Vancouver than at Indian Head, there was a much greater range of response within each population in Vancouver. The average standard deviation about each provenance mean in Vancouver was approximately twice that of Indian Head (±15.5 days versus ±8.49 days, respectively). Most genotypes that either lammased or remained unaffected by short days prior to the solstice, set bud around the same time in both gardens, responding in common to short days later in the growing season. A late July observed increase in frequency of bud formation in some genotypes in Vancouver remains unexplained. Leaf senescence, the green cover period and partitioning to root growth In comparison to HGC, leaf drop occurred over a much shorter period of time. There were, nonetheless, strong differences between sites and across populations, which interacted with each other. Although leaf senescence cannot precede HGC, the photoperiodic cueing of bud set and leaf senescence are separate events. Natural photoperiodic regimes demand that there be a greater difference in critical photoperiods for these two events at higher latitudes. Leaves obviously abscise nearer to the autumnal equinox than to the summer solstice in all populations. Because day length is the same at all latitudes at the equinox (12 h), critical photoperiods for leaf senescence are not as strongly differentiated. For northern genotypes in both common gardens, mid-summer photoperiods are too short to maintain height growth but are long enough to prevent leaf senescence until a date not much different than it would be in their native habitats. As a consequence, individual leaves live much longer than normal, and the green cover periods are greatly extended. On average, leaf senescence was earlier at the Vancouver location than at Indian Head despite the fact that Vancouver has over five weeks (39 days) more of favorable growing temperatures in autumn (http://www.almanac.com/content/frost-chart-canada).  As with HGC, two conditions  must be met to trigger senescence: leaves must be competent and daylength must be below the critical threshold.  Competence to respond to photoperiod for purposes of leaf senescence  presumably develops a few days after HGC (Fracheboud et al. 2009), but little information is  24  available on this point to date. Weather can also influence the date and speed of leaf senescence in many species. However, Fracheboud et al. (2009) noted that in a single well-studied P. tremula specimen, leaf senescence was triggered on the same day, year after year, regardless of weather. There is also an obvious effect of leaf age in Populus, whereby the oldest leaves yellow first while the youngest neoformed leaves towards the shoot tips yellow last. This may explain why 50% yellowing occurred earlier in Vancouver for southern genotypes, because average dates of bud set (and therefore the last dates of new leaf production) occurred earlier than in Indian Head. On the other hand, for the northern genotypes all leaves are over-mature by summer‟s end and it is clearly only daylength that delays leaf senescence; hence the timing of leaf senescence for these genotypes is more coincident across the garden sites. Even though there is an overall earlier start to leaf senescence in Vancouver than at Indian Head, the total green-cover period is longer because of the earlier spring. The longer green-cover period in Vancouver implies that there is an extended season for photosynthetic activity. However, because of the early HGC and bud set at Vancouver (occurring 28 days earlier), any further carbon fixed can clearly not be used towards height growth but might be redirected towards remaining active sinks, such as root growth. This would also be the situation where height growth was interrupted by lammas bud formation. If C allocation towards roots increases after bud set, then it should be consistent with trends in the GCP ratio, increasing with latitude of origin, but also higher in Vancouver than at Indian Head.  This was indeed the case. In other words,  conditions in Vancouver, most likely the post-HGC lengthening of the green-cover period, resulted in a substantially increased allocation of C to roots. The Fredericton population was the only exception, but it was also the only excavated population to have originated from a latitude south of Vancouver and the only one to have a lower GCP ratio. Similar to our observations for balsam poplar, Cannel and Willet (1976) reported that R:S ratios of black cottonwood (P. trichocarpa) increase with latitude of origin when planted into a common garden. They likewise ascribed this imbalance to premature cessation of height growth. In contrast to our observations, however, differences did not persist in black cottonwood because they were corrected each spring by proportionally greater shoot growth in the northern genotypes. For all excavated genotypes, biomass accretion after 4 years of growth was extremely poor in the Vancouver common garden, relative to Indian Head. Although the climate of Vancouver would  25  correspond to extreme climate change for most of the clones used in this study, it represents a reasonable future proxy for trees originating from the eastern maritime regions of Canada, and some of these (e.g., Fredericton) clearly also ran into difficulty. Poor growth in Vancouver might suggest other factors (water or nutrients) were limiting, but this common garden area also included native cottonwood (P. trichocarpa) and aspen (P. tremuloides) of approximately the same age, as well as hybrid poplars of various origin, and all of these grow very well on this site. One of the balsam poplar populations that we did not excavate (Roseville) also grows comparatively well in Vancouver. Heights for this population were similar in both common gardens at the end of four years (~3.1 meters, P = 0.503). Roseville is at approximately the same latitude as Fredericton, but is moderated by a more maritime climate and so this population is phenologically better suited to Vancouver. Only one out of 15 Roseville clones prematurely set bud (and later lammased) as compared to 10 out of 15 Fredericton clones. 2.5 Conclusions Implications of climate change We can account for most of the differences in bud phenology between the two common garden sites based on differences in spring start date, which in turn results in different dates of competency interacting with a fixed photoperiodic regime.  We conclude that autumn  phenophases are primarily photoperiod-driven in balsam poplar and do not respond directly to climate warming. Height growth cessation and, to a lesser extent, leaf senescence can be plastic but in a maladaptive direction, occurring earlier and not later. Early bud flush in a warming climate may pose a risk to balsam poplar and perhaps other boreal trees by severely curtailing height growth if competency is achieved before the solstice. Lammas growth can provide a margin of safety in the event of an early spring because the renewed shoot growth is presumably not competent to immediately respond to photoperiod. For northern genotypes, however, the margin of safety is narrower because of steep changes in photoperiod and the proximity of normal flush dates to the solstice. Within-population genetic variation in response to photoperiodic cueing has the potential to buffer climate change impacts on native stands, and should be a research priority.  26  Even in the absence of a premature bud set, tight photoperiodic control of HGC and leaf senescence will prevent balsam poplar and probably other hardwoods from exploiting an extended autumn. Although autumn temperatures may become favorable for continued photosynthesis, the absence of leaves precludes this option, whereas respiration continues and may even be stimulated.  It is possible that undesirable effects on R:S ratio or other manifestations of  phenological mismatch might be avoided by moving photoperiodically appropriate genotypes within narrow latitudinal limits along climate clines that have an east-west or elevational orientation. Piao et al. (2008) have reported a trend towards increased respiratory loss of CO2 from northern ecosystems during autumn. Enhanced carbon partitioning to roots may add to relative respiratory costs, influence drought response or have downstream effects on C cycling and other ecosystem level processes.  27  Table 2.1 Three year means for all phenological events (Julian days) scored in both common gardens across all genotypes. Height growth duration and greencover period are given in total number of days. Phenological event  Stage #  Vancouver  Indian Head  Bud flush  3  79  123  Absolute difference between sites 44  Leaf unfolding  4  90  132  42  Bud set  7  206  234  28  50% leaf yellow  9  243  259  16  100% leaf drop  10  270  277  7  Height growth duration  7-4  116  102  14  Green-cover period  9-4  153  127  26  28  Table 2.2 Biomass and Root:Shoot (R:S) ratios of Populus balsamifera populations excavated in both common gardens before the spring of 2009 (listed from north to south). The common garden averages are also presented. Location  Shoot weight (g)  Root weight (g)  Total biomass (g)  R:S ratio  Vancouver  Indian Head  Vancouver  Indian Head  Vancouver  Indian Head  Norman Wells  10.2  119.1  31.4  253.5  41.5  372.6  3.28  2.13  Hay River  22.4  312.4  47.6  428.5  70.0  740.9  2.10  1.37  Kuujjuaq  18.4  277.6  52.5  424.8  71.0  702.4  3.03  1.53  Fort McMurray  38.0  927.6  66.0  1058.6  104.0  1986.3  1.80  1.14  Love  34.8  6644.0  57.6  807.1  92.4  1471.1  1.86  1.22  Minnedosa  61.0  1272.0  94.1  1483.1  155.1  2755.1  1.78  1.17  Fredericton  132.0  1216.8  60.6  983.3  192.6  2200.0  0.54  0.81  Average  45.3  684.2  58.5  777.0  103.8  1461.2  2.05  1.34  0.0004  <0.0001  0.048  <0.0001  0.0081  <0.0001  0.0002  0.0013  ANOVA P value  29  Vancouver Indian Head  Figure 2.1 Natural range of Populus balsamifera (shaded area) and the geographic origins of 35 provenances planted in two common gardens (Vancouver and Indian Head, marked by stars).  30  Figure 2.2 Clinal patterns with latitude of origin in 35 Populus balsamifera populations for a) bud flush, b) bud set, and c) 50% leaf yellowing at Vancouver (open circles) and Indian Head (closed circles) common gardens. The dotted line indicates the summer solstice (June 21). Error bars omitted for clarity.  31  Figure 2.3 Dates of bud set for all genotypes within every population at Vancouver in 2008 (a), and % frequency of genotypes with lammas buds within each population (b).  32  Figure 2.4 Green-cover period ratio (post-bud set over pre-bud set) for Populus balsamifera populations at Vancouver (open circles) and Indian Head (closed circles). Exponential curve fit is plotted using latitude as the independent variable. Error bars omitted for clarity.  33  39 days  Figure 2.5 Shoot age at which height growth cessation occurs in response to a transfer to short photoperiod. The dashed lines indicate the minimum number of days (39) after bud flush for the new shoot to cease height growth. Height growth cessation cannot occur below the dotted line (i.e. before transfer).  34  Supplement 2.1 Latitude of origin of Populus balsamifera populations used in this study. Populations marked by asterisk are excavated from both common gardens to determine root:shoot ratio; § marked are used in growth chamber study. Provenance Fredericton* Roseville Matapedia Matane Rouyn-Noranda Carnduff Manicougan Portage Sioux Lookout Minnedosa* § Mount Groulx Melville Gypsumville Stettler Wadena Labrador City Grand Rapids Edmonton Love* § Boyle Grande Prairie La Ronge Dunlop South Reindeer Gillam Fort McMurray* § Wollaston Lake Kuujjuaq* § Stony Rapids Whitehorse Hay River* § Denali National Park Fairbanks Norman Wells* § Inuvik  Latitude (°N) 46.40 47.33 48.22 48.57 48.60 49.18 49.30 49.95 50.08 50.32 51.33 51.35 51.77 52.35 52.37 52.93 53.20 53.55 53.63 54.55 54.75 54.75 54.85 56.27 56.35 56.92 57.58 58.02 59.23 60.70 60.80 63.87 64.90 65.23 68.38  35  Longitude (°W)  Elevation (m)  67.25 64.37 67.18 67.35 78.67 101.83 68.32 98.30 91.90 99.85 68.13 102.62 98.62 112.73 104.27 67.25 99.35 113.32 105.50 112.65 118.63 105.55 98.58 104.23 94.63 111.50 103.93 68.65 105.72 135.33 115.78 149.02 146.35 126.67 133.77  147 25 98 119 310 558 180 283 384 592 452 541 253 795 543 554 254 719 419 649 769 471 223 419 126 338 423 17 306 770 168 594 248 84 7  Supplement 2.2 Dates of bud set for all genotypes that did not lammas in 2008, plotted according to provenance (latitude of origin) and common garden location (Vancouver, open circles; Indian Head, closed circles).  36  Chapter 3. Enhanced assimilation rate and water use efficiency with latitude through increased photosynthetic capacity and internal conductance in balsam poplar (Populus balsamifera L.) 4 3.1 Introduction Variation in geographically-widespread species is produced either by phenotypic plasticity (acclimation to environmental conditions) or by adaptation of genotypes to specific environmental conditions (Conover & Schultz, 1997). An understanding of these patterns has been advanced by numerous studies along resource gradients (Poorter 1999; Reich et al. 1999) and with latitude or altitude (see Farmer 1993; Howe et al. 1995; Jonas & Geber 1999). Most such studies are restricted to variation along a single transect or a limited number of populations. Species with extensive geographic range, however, have the potential to exhibit large intraspecific variation in physiology, morphology, phenology and growth rate, and thus constitute good models for the study of local and regional adaptation. In this regard there are numerous reports of differentiation in photosynthesis to contrasting environments in Populus species (e.g. Ceulemans et al. 1992). Such patterns have not, however, been explored in much detail in balsam poplar (Populus balsamifera L.), a transcontinental species with a wide range in the boreal zone across North America, from Colorado to Nunavut, and from Alaska to Newfoundland. Balsam poplar is very closely related to black cottonwood (P. trichocarpa Torr. & Gray); in fact, black cottonwood is considered to be a subspecies of P. balsamifera in many treatments. Black cottonwood is the first woody plant to have had its genome sequenced (Tuskan et al. 2006). Latitude represents a complex environmental gradient, along which photoperiod, temperature, growing season length (frost free days), moisture availability and soil nutrient status can all be expected to vary. Differences in growing season length have been reported to correlate with traits such as leaf nitrogen per area (Leaf N), specific leaf area and photosynthesis (see Reich, Walters & Ellsworth 1997; Diemer 1998). In a pot study using populations of Sitka alder (Alnus sinuata (Reg.) Rydb.) and paper birch (Betula papyrifera Marsh.) from British Columbia, Canada, Benowicz, Guy & El-Kassaby (2000b) found an intrinsic relationship between mid4  A version of this chapter has been published and reproduced with permission from Blackwell Publishing Ltd. Soolanayakanahally RY, Guy RD, Silim SN, Drewes EC and Schroeder WR. 2009. Enhanced assimilation rate and water use efficiency with latitude through increased photosynthetic capacity and internal conductance in balsam poplar (Populus balsamifera L.). Plant Cell and Environment 32: 1821-1832. 37  summer photosynthetic rate and subsequent levels of fall frost hardiness (since growing season length is reflected in date of hardiness development). Similarly, Gornall & Guy (2007) reported that photosynthetic rates (A) increased with latitude of origin in five provenances of black cottonwood along with an increase in Leaf N, stomatal density and stomatal conductance (gs), with no trend in leaf mass per area (LMA). Intrinsic water use efficiency (WUE i) and carbon isotope discrimination did not vary with latitude, implying a common internal conductance (gm) to the diffusion of CO2 from the intercellular space to the site of carboxylation, but this was not assessed. Flexas et al. (2007) emphasized that comparisons of gm in different natural plant populations, and its possible influence over efficiencies of water-use and nitrogen-use, should be a research priority. The trend towards increased photosynthesis with latitude may be a case of parallel evolution among deciduous trees.  Genotypic differences found in common garden environments  presumably reflect adaptive variation, but careful experimental work is necessary to distinguish traits under selection from other effects such as plasticity or artifacts of differential growth or demographic history and genetic drift. By and large, height increment is greater in low latitude populations than in high latitude populations when grown in a common garden. Such was the case in the study reported by Gornall & Guy (2007) - although the northern black cottonwood populations had the highest photosynthetic rates, they were also smaller in size, and it is possible that one result may have spawned the other. Photosynthetic rates may have declined in the larger low latitude trees because of increased self-shading, or because of higher rates of soil nitrogen depletion. Furthermore, if adaptation to shorter growing seasons has indeed resulted in higher rates of carbon assimilation, then there should be a similar effect on height increment when plants are kept free of other limitations, most particularly the short days (or long nights) that trigger the cessation of active shoot elongation. By making use of the extensive Agriculture Canada Balsam Poplar (AgCanBaP) collection we set out to test the hypothesis that during free growth (i.e., without photoperiod, nutrient and water limitations), genotypes native to regions with short growing seasons would grow more rapidly than genotypes adapted to longer growing seasons, commensurate with higher A. The study aimed to answer the following questions:  38  1. Do climate-related patterns in A and related ecophysiological variables occur under greenhouse conditions when all genotypes are of similar age and size, and are grown without resource limitation? 2. If population-level variation in A exists in balsam poplar, is it reflected in variation in height increment during free growth under extended days? 3. Are the proximal causes for population-level variation in A in balsam poplar the same as those previously reported for the closely related black cottonwood? 3.2 Materials and methods Plant material This study makes use of the AgCanBaP collection of the Agriculture and Agri-Food Canada (AAFC), Agroforestry Division, Indian Head, Canada. Balsam poplar stem whips were collected from 46 provenances throughout the species range. The collection was done from November to March, 2005-2006 from the upper crowns of dormant trees aged 15 to 30 years. Fifteen trees were randomly sampled without phenotypic selection from each population. Care was taken to reduce the possibility of sampling clones more than once by collecting individuals, at least 0.2 to 4 km apart. Branch cuttings were collected using a pole cutter, and stored at -4oC in black plastic bags. For all 690 sampled trees, geospatial coordinates and other site information were recorded (data provided upon request). For the present study, we used a subset of 10 clones from each of 21 provenances which differ widely with respect to environmental conditions (Fig. 3.1 and Table 3.1), for a total of 210 clones. Stem cuttings of 6-9 cm length with a minimum of two buds were rooted in 965 mL plastic containers filled with a mixture of Sunshine-2 (Sun Gro Horticulture, Vancouver, Canada) growing mix (60%), peat (30%) and vermiculite (10%). The rooted cuttings (stecklings) were grown in a greenhouse beginning the 2nd week of May under natural light supplemented by coolwhite fluorescent lamps to provide a 21 h photoperiod and a minimum PPFD of 400 μmol m-2 s-1 at plant level. Maximum day and night temperatures were maintained close to 25 and 18ºC, respectively, throughout the experimental period. The stecklings were kept well watered and fertilized using modified Hoagland‟s solutions (½ strength micronutrients and ¼ strength macronutrients) at a pH adjusted to 5.8–6.3 (Hoagland & Arnon 1950). The greenhouse was well ventilated and PPFD, humidity and air temperature were continuously monitored and recorded 39  (Delta T Logger, Delta T Devices, Cambridge, UK). The potted stecklings were re-randomized weekly to minimize positional effects. Standard gas exchange measurements A portable infra-red gas analyzer (LC Pro+, Analytical Development Co. Ltd., Hoddesdon, UK) was used for measuring gas exchange variables. Beginning 65 days after rooting, measurements were taken twice on all 210 clones: once during the third week of July and again during the first week of August. Measurements were made on two fully expanded mature leaves per steckling between 9:00 am and 11:30 am. This timing was based on a preliminary study of diurnal patterns in 45 clones (data not shown) that indicated maximum rates of A during the morning hours, declining uniformly across all populations in the afternoon (with some recovery in the evening). The CO2 concentration of the inlet air was set to 370-380 μL L-1 to achieve an ambient air CO 2 concentration (Ca) of ~345 μL L-1 inside the cuvette. Other conditions were set to: 25ºC chamber temperature, VPD at 1.9 kPa, and PPFD of 1000 μmol m-2 s-1 supplied by a mixed red/blue LED unit mounted on the top of the cuvette. Net CO2 assimilation rate (A), intercellular carbon dioxide concentration (Ci), and stomatal conductance (gs) were calculated according to von Caemmerer & Farquhar (1981). Intrinsic water use efficiency (WUE i) was calculated as A/gs (Farquhar, O'Leary & Berry, 1982). Chlorophyll content index (CCI) was determined following the gas exchange measurements with an Opti-Sciences (Hudson, NH, USA) CCM-200 meter. The CCM-200 uses calibrated light emitting diodes and receptors to calculate the CCI, which is defined as the ratio of percent transmission at 655-940nm through a leaf sample. Plant sampling and analysis Because net carbon isotope discrimination during photosynthesis is directly related to the diffusion gradient for CO2 from the bulk atmosphere to the sites of carboxylation, the carbon isotope ratio of plant tissue provides a proxy measure of water-use efficiency over the time when the carbon was fixed (Farquhar, O'Leary & Berry, 1982).  13  C/12C ratios are expressed as del (δ)  values in parts per mil (‰) with respect to the Vienna Peedee Belemnite (VPDB) carbonate standard: δ13C = ((13C/12C)sample - (13C/12C)VPDB) / (13C/12C)VPDB × 1000  40  (1)  Leaf punches were taken immediately after gas exchange measurements for δ 13C and nitrogen analysis; wood for δ13C was harvested at the end of experiment from the basal 10 cm of the shoots. Tissue samples were oven dried for 48 h at 70ºC to constant mass. After grinding to fine powder in liquid N2 with a mortar and pestle, 2–2.5 mg homogenized sub-samples were packed in tin capsules and sent to the University of California, Davis, Stable Isotope Facility. The samples were combusted in an online continuous flow dual analyzer coupled to an isotope ratio mass spectrometer (Europa Scientific Integra, Cheshire, England, UK). The overall sample preparation and analysis error between repeated analyses of the same ground tissue was less than ±0.11‰. Since the δ13C of air (δ13Cair) can vary, particularly under greenhouse and growth chamber conditions (Guy, Reid & Krouse 1986), we confirmed that the δ13Cair in the greenhouse was near ambient by simultaneously growing maize. The δ 13C of the maize was -11.6‰ ±0.01, which corresponds to an approximate δ 13Cair of -8.3‰ (Marino & McElroy 1991). discrimination against  13  Net  CO2 ( ) was calculated from tissue (both leaf and wood) δ 13C values  according to Farquhar, Ehleringer & Hubick (1989): Δ = (δ13Cair - δ13Ctissue)/(1000 + δ13Cair) × 1000  (2)  Expected discrimination based on gas exchange data ( i) was calculated following Evans & von Caemmerer (1996): i  = a + (b-a)Ci/Ca  (3)  where a is the fractionation occurring due to diffusion in air (4.4‰) and b is the net fractionation by ribulose 1.5-bisphosphate carboxylase/oxygenase (Rubisco) and phosphoenolpyruvate carboxylase, which is considered by various authors to be between 27–30‰ (Warren 2006), but is here taken to be 29‰ for purposes of calculation. Leaf nitrogen was calculated per unit leaf area (Leaf N, μmol N cm-2). The photosynthetic nitrogen-use efficiency (PNUE, μmol CO2 mol-1 N s-1) was calculated as the ratio of assimilation rate to Leaf N. Stomatal density (SD, per mm-2) was determined on fully expanded leaves on each clone by making impressions with a thin layer of clear nail polish applied to one side of the mid-rib near the middle of the abaxial and adaxial leaf surfaces (Gornall & Guy 2007). Dried nail-polish impressions were stripped from the leaves, mounted on a slide and viewed under a microscope at 150× magnification. Three randomly selected fields of view (300×300 µm each) were counted per leaf impression and averaged. Height was recorded on five dates, and is here 41  reported as the increment incurred over peak growth between days 57 and 70. Total leaf mass per unit area (LMA, mg cm-2) was determined at the end of the experiment. A-Ci curve measurements To gain better understanding of geographic trends in photosynthesis a subset of six populations was selected for A-Ci curve analysis. Two ramets for each of 10 clones (N=120) from the populations INU, DEN, KUU (northern) and STL, FRE and MTN (southern) were raised in pots in a greenhouse under extended 21 h days as described above. A-Ci curves were constructed for all individuals with a LI-6400 gas exchange system (LICOR Instruments, Lincoln, NE, USA) equipped with a red LED unit. With the leaf chamber temperature set to 25ºC and the initial reference CO2 at 400 μL L-1, PPFD was ramped up to 1000 μmol m-2 s-1 over a period of 10 minutes, maintaining the VPD inside the leaf chamber close to 1.5 kPa. The reference CO 2 was then changed in the following order: 400, 500, 630, 700, 800, 900, 1050, 1400, 1200, 970, 850, 750, 570, 450, 250, 100, 50, 200, and 370 μL L-1. These points were chosen to (a) minimize the number of readings that would lead to a Ci between 200 and 300 μL L-1, which are avoided in the curve-fitting procedure, as there is a transition from the Rubisco-limited state (~200 μL L-1) to the RuBP-regeneration-limited state (> 300 μL L-1) and (b) ensure that there was no temporal drift in precision occurring in the LI-6400. A and gs were allowed to stabilize between readings. The ACi curve fitting model described by Sharkey et al. (2007) was used to estimate the maximum carboxylation rate allowed by Rubisco (Vcmax), the rate of photosynthetic electron transport (J), triose phosphate utilization (TPU), day respiration (Rd), and internal conductance (gm). Climate data Climate Normals (1971-2000) for nearby stations were obtained from Environment Canada (http://www.climate.weatheroffice.ec.gc.ca/climate_normals/index_e.html) and, for locations in Alaska,  from  the  National  Climatic  Data  Center  (http://cdo.ncdc.noaa.gov/cgi-  bin/climatenormals/climatenormals.pl), to provide Frost Free Days (FFD, days), Mean Annual Temperature (MAT, ºC), Average Summer Temperature (AST, ºC), Mean Temperature of the Coldest Month (MTCM, ºC), Mean Temperature of the Warmest Month (MTWM, ºC), Mean Annual Precipitation (MAP, mm) and Mean Summer Precipitation (MSP, mm). The FFD is calculated based on number of days where minimum temperature was above zero, and is used here as a proxy for growing season length. Included in the analysis were indices of continentality (CONT), and annual (ADI) and summer (SDI) “dryness” (Guy & Holowachuk 2001): 42  CONT = MTWM – MTCM  (4)  ADI = (es[MAT] × 1000)/MAP  (5)  SDI = (es[MTWM] × 1000)/MSP  (6)  where precipitation is in millimeters, and es is the saturation vapor pressure in kilopascals at MAT and MTWM, respectively, calculated according to Buck (1981). Equations (5) and (6) are based on the knowledge that potential evapotranspiration is in large part determined by es, which is given by Yin (1998): es[T] = 0.61121 × (1.007 + [0.0000346 × P]) × exp([17.502 × T] / [240.97 + T])  (7)  In equation (7), T is temperature and P is atmospheric pressure in kilopascals calculated from elevation (m) after Yin (1998): P = exp(-ELEV/8000) × 100  (8)  Potential evapotranspiration over precipitation is the preferred measure of climate dryness, but the available data do not permit that calculation. Statistical analysis All statistical analyses used SAS version 9.1.3 (SAS 2003). Pearson‟s correlations (r) were calculated to determine relationships among all variables on 210 genotypes.  Canonical  correlation analysis was done between physiological and environmental variables. For A-Ci curve analysis, data were objectively screened by rejecting curves that did not yield a sum of squared deviations between observed and modeled points of <2. Screening caused the sample size to vary across populations; consequently, an unbalanced nested ANOVA was performed within the General Linear Model with population (random) nested within geography (fixed). 3.3 Results Several growth and physiological traits in P. balsamifera are strongly related to geographic and climatic variables (Table 3.2), which by nature co-vary over North America for physiographic reasons. Tree-line and the species range for P. balsamifera are at generally higher latitudes in the west (Fig. 3.1), resulting in similar relationships with longitude as with latitude. Geography is also confounded by elevation which tends to be greater for provenances from the west and 43  southwestern part of the range. In this context, the preferred measure for growing season length is FFD. Measures of temperature (MAT, AST) and CONT are generally consistent with FFD. Indices of annual and summer drought tend to be highest in the northwest of the species range because precipitation decreases towards the north and west (Table 3.1). During rapid growth in the greenhouse, plant height increment was positively correlated with both latitude and longitude of origin, along with CONT, ADI and SDI (Table 3.2). Similarly, height increment was negatively correlated with FFD and measures of temperature.  The  population KUU deviated from this pattern, for reasons unknown (Fig. 3.2a). Final height (not shown) had a similar pattern. Irrespective of their height increment, INU, KUU and DEN had the highest rates of photosynthesis (Fig. 3.2b). Variation in A was highly consistent with variation in LMA (Fig. 3.2c) and strongly correlated with Leaf N (r = 0.744, p = 0.0001). There was no relationship between A and FFD if photosynthesis was expressed relative to leaf mass (not shown).  Across all 210 genotypes, light-saturated photosynthetic assimilation (A) was  significantly correlated with FFD and several other co-varying climate parameters (Table 3.2). PNUE showed opposite correlations with geographic and climatic variables relative to A, LMA, Leaf N, WUEi and δ13C. Among the physiological variables considered (Table 3.3), A was positively correlated with gs, Leaf N and CCI, but was inversely correlated with stomatal density (SD). Even though SD was higher at lower latitudes, gs was not clearly related to any geographic or climatic variables (Table 3.2). In contrast, correlations between intrinsic water-use efficiency (WUEi) and the geographic and climatic variables closely paralleled A alone (Table 3.2), even though variation in both A and gs contributed strongly to WUEi (Table 3.3). Across all 210 genotypes, A and gs were also positively correlated with each other (r = 0.236, p < 0.001). Trends were different at the population level (not shown) in that gs was in this case not significantly correlated with WUEi, whereas A was (r = 0.831, p < 0.0007).  Consequently, population  differences in WUEi were largely determined by A. Population means for WUEi ranged from 28.6 to 39.0 μmol CO2 mmol-1 H2O (Fig. 3.3). Populations from the extreme northwest had higher WUEi than those from the southeast. For example, populations DEN and INU had greater WUEi (39.0 and 36.2 μmol CO2 mmol-1 H2O, respectively) than FRE (29.1 μmol CO2 mmol-1 H2O).  44  There was variation in δ13C among population means (~0.98‰: foliar, and ~1.1‰: wood). Wood and foliar δ13C values were correlated with FFD, LAT and LON, but not with summer temperature (Table 3.2). Wood and foliar δ13C were, as expected, strongly inter-correlated across all 210 genotypes (Table 3.3) and across populations (r = 0.799, p < 0.0007, not shown). In contrast, δ13C values were correlated with WUEi across all genotypes (Table 3.3), but not across populations (r = 0.185, not significant). A canonical structure for the provenances under study was obtained using nine geoclimatic and seven ecophysiological traits, including height increment (Table 3.4). Two significant canonical variables were extracted (CLIM1 and CLIM2) that explained 17% and 26% of the variance in plant traits, respectively, during redundancy analysis. All climate predictor variables loaded highly on CLIM1 along with latitude and longitude, whereas measures of summer temperature (AST and CONT) were most strongly related to CLIM2. The strongest canonical loadings were seen for height increment and leaf N on CLIM1 and for δ 13Cwood on CLIM2. PNUE had a negative loading on CLIM1 while, height increment, δ 13Cleaf and δ13Cwood were positively related to both CLIM1 and CLIM2. In contrast, although Leaf N, A, and WUEi were also positively related to CLIM1, they were negatively related to CLIM2. These tendencies indicate that trees from areas with short growing seasons and/or low summer temperatures had higher photosynthetic rates driven in part by elevated Leaf N. Figure 3.4 presents A as a function of FFD and Leaf N for all 210 genotypes. As shown by this figure, variation in Leaf N can account for considerable variation in A, both within and between populations, but FFD remains a significant predictor even when Leaf N is accounted for. The relationship between WUE as determined by gas exchange and WUE as indicated by δ 13C is related to the conductance of CO2 diffusion within the leaf (Evans & von Caemmerer 1996). Carbon isotope discrimination during photosynthesis calculated from both gas exchange data (Δ i) and from δ13C values of leaf (Δleaf) and wood (Δwood) tissue are plotted together in Fig. 3.5. Wood is typically more enriched in  13  C than leaf tissue, hence Δleaf and Δwood are not the same,  but parallel each other closely. They differ in elevation by roughly 0.5‰. In contrast, Δ i is ~2‰ greater than Δwood, but this difference depends largely on the value of b used in equation (3). Some offset is expected due to the diffusion gradient for CO2 from the intercellular space to the sites of carboxylation in the chloroplast, inversely proportional to the internal transfer conductance (gm). Regardless of the value chosen for b, there is a significant increase in Δi as a function of FFD, but not in Δwood and Δleaf, the latter determined on the exact same leaves as used 45  in the gas exchange analysis. Put another way, the discrepancy between predicted and observed isotope discrimination decreases with latitude.  The implication is that gm is increased in  populations adapted to shorter growing seasons. A-Ci curves were constructed for six of the populations shown in Fig. 3.5; three approaching the northern edge of the species range (≤ 122 FFD) and three from the south (≥ 161 FFD). Consistent with the previous gas exchange measurements, photosynthesis was higher in genotypes of northern provenance than in genotypes of southern provenance, a difference that was reflected in somewhat higher J and TPU, and possibly Vcmax and gs (Table 3.5). Day respiration did not differ. The most obvious contrast was a greater than twofold difference in gm, whereby increased gm was again associated with fewer FFD. Population differences in gm (nested within geography) were also nearly significant (p=0.0521, not shown). 3.4 Discussion Height growth and photosynthesis As commonly observed in many tree species when planted into outdoor common gardens (e.g., Acer saccharum Marsh. [Kriebel 1957], Salix pentandra L. [Junttila & Kaurin 1985] and Picea abies (L.) Karst. [Junttila & Skaret 1990]), balsam poplar genotypes originating from high latitude achieve much less height growth than those from low latitude. Similar trends in plant size with latitude are also commonly observed in herbaceous plants when grown outdoors (e.g., Carex aquatilis Wanlenb. ssp. aquatilis [Chapin & Chapin 1981], Verbascum thapsus L. [Reinartz 1984]) and in Arabidopsis in a greenhouse under short (12h) days (Li, Suzuki & Hara 1998). In balsam poplar during free growth under long days, however, plant height increment was positively correlated with latitude (r = 0.622, p < 0.0003, Table 3.2). Similarly, when growing 24 populations of Scots pine (Pinus sylvestris L.) under conditions mimicking changes in photoperiod at 50º and 60ºN, Oleksyn, Tjoelker & Reich (1992) found that secondary needle length, plant height and dry mass at harvest were greater under the longer photoperiod. Height growth rate was lowest among southern populations regardless of provenance photoperiod. Although trees representative of northern populations generally do not grow as much as those from the south over any given summer, they can in fact possess higher photosynthetic rates, even in outdoor common gardens. Despite a decline in plant height, Norway spruce from colder habitats had higher photosynthetic rates associated with higher leaf nitrogen concentrations 46  (Oleksyn et al. 1998). Likewise, latitudinal patterns in growth rate and photosynthesis are inversely related in paper birch (Benowicz et al. 2001; Benowicz, Guy & El-Kassaby, 2000b), Sitka alder (Benowicz et al. 2001, 2000a), black cottonwood (Gornall & Guy 2007) and Eurasian aspen (Populus tremula L.). In these studies, photosynthetic rate was always measured at the height of the growing season, well before buds had set. In the present study, bud set was avoided altogether by maintaining all clones under a uniform extended photoperiod. Higher rates of photosynthesis were then directly reflected by enhanced height increment. Growth, therefore, does not appear to be limited by photosynthesis in high latitude genotypes, but rather by the length of the realized growing season – that portion of the available growing season when extension growth is active. Gornall & Guy (2007) proposed that northern provenances may have inherently higher photosynthesis to compensate for shorter realized growing seasons. Intrinsic growth capacity varies inversely with realized growth across environmental gradients in many animal species, a phenomenon commonly called “counter-gradient variation” (Levins 1969). For example, in the fish species Menidia menidia L., high latitude genotypes grow more rapidly than low latitude genotypes within the brief period of the year when temperatures are favorable (Conover & Present 1990).  Growth occurs within similar thermal boundaries  independent of latitude, but it is the length of growing season that changes greatly with latitude. We find the same phenomenon in balsam poplar. Canonical correlation analysis, an efficient approach for dealing with large inter-correlated datasets, revealed how much of the variation in key traits may be attributed to geography and climate (Table 3.4). The two significant canonical variables we extracted describe somewhat different geoclimatic terms; CLIM1 may be seen as an index of overall “borealness”, while CLIM2 may account for further differences in “growing season heat”. Latitude and frost free days loaded very highly on CLIM1, explaining 94% of its variance.  Redundancy analysis  indicated that CLIM1 and CLIM2 together accounted for 43% of the variance in plant traits. Wright et al. (2004) examined leaf economics across 2548 species worldwide and concluded that climatic variables explain only a small portion of the overall variation, but this of course included very different co-occurring species.  Dang et al. (1994) studied geographic variation in  ecophysiological traits among 40 populations of red alder (Alnus rubra Bong.) in British Columbia. They found a weakly positive correlation between A and latitude, but the latter covaried with longitude and was confounded by elevation. In that study, however, canonical correlation analysis also established a clear relationship between photosynthetic capacity and 47  geography. The consistency of this pattern, whereby A increases with latitude of origin in at least seven tree species from three families, is strong evidence for its adaptive importance. Differences in Ci that result from variation in gs give rise to an inverse relationship between WUEi and PNUE (Field et al. 1983). In contrast, variation in gm should cause WUEi and PNUE to respond in parallel, in the same direction as gm. Consistent with the possibility of a trade-off, the efficiency of water-use decreased with provenance FFD while PNUE increased (Table 3.2), and there was a similar reverse trend on CLIM1 (Table 3.4). There was, however, no direct relationship between PNUE and any of our measures of WUE (Table 3.3), as might be expected if gm, gs, and other factors influencing A, vary independently. We found strong positive correlations between LMA, Leaf N and A (Table 3.3).  Positive  correlations between foliar N and rates of photosynthesis have been observed across many species. Reich & Oleksyn (2004) reported that, globally, Leaf N tends to vary inversely with mean annual temperature. A large proportion of foliar N is found in proteins involved in photosynthesis, not least of which is Rubisco. Higher A in balsam poplar populations originating from high latitudes or low FFD (Fig. 3.4) can therefore be ascribed in part to enhanced photosynthetic capacity per unit area. Consistent with this interpretation, the A-Ci curve analysis revealed that representative northern populations had significantly higher rates of photosynthetic electron transport (J) and triose phosphate utilization (TPU) than southern populations (Table 3.5). On the other hand, Vcmax did not differ significantly, though it may have been somewhat higher in the northern genotypes.  Increased photosynthetic demand was supported by an  increased supply of CO2 through both an increase in gs and, most particularly, an increase in gm. Although there was no significant relationship between gs and FFD, or indeed any of the geographic or climatic parameters listed in Table 3.2, we argue below that enhanced gm contributes to higher A in northern genotypes of balsam poplar. δ13C and internal conductance Because of a mutual dependence on the diffusion gradient for CO 2 into leaves, plant δ13C is widely used as a relative index of intrinsic water use efficiency. Foliar δ 13C integrates WUE during leaf formation and recent photosynthetic activity, but can be biased towards lighter values due to the foliar lipid content, which is depleted in  13  C relative to carbohydrate exported in the  13  phloem (Hobbie & Werner 2004). Wood δ C should provide a better indicator of WUE than δ13Cleaf not only because it is closer in isotopic composition to the whole plant, but also because it 48  integrates over the crown as well as the full interval of growth. Discrimination (Δ) can be calculated from either δ13Cleaf or δ13Cwood, but the true value for Δ during CO2 assimilation probably resides between the two. The δ 13C of both leaf and wood were well correlated with height increment and WUEi (Table 3.3). There was a tendency towards higher δ 13C values (reflecting higher WUE) towards the north, but not as strong as might be expected based on WUEi (Fig. 3.5). On-line isotope discrimination (Δobs), in comparison to gas exchange data, is often used to estimate gm. Although such estimates are very sensitive to the value chosen for b in equation (3), differences in Δi vs Δobs between different genotypes or treatment may be ascribed to differences in gm. Likewise, because trends in Δleaf and Δwood should reflect trends in Δobs, it is possible to compare these patterns with Δi calculated from the gas exchange data to explore putative patterns in gm. Because δ13Cleaf and δ13Cwood were highly correlated and trends in Δ leaf and Δwood were exactly parallel, we can ignore the possibility of variation in post-photosynthetic isotope fractionation. Figure 3.5 shows that Δi increases with FFD but that Δleaf and Δwood do not. This disparity indicates a tendency towards higher gm at low FFD, resulting in increased A and an enhancement of WUE not captured by Δ. Using three tree species, Warren and Adams (2006) demonstrated that Δ may vary by up to 3‰ at a common WUE. The corollary must also be true, as seen here in balsam poplar. We do not at this point know what accounts for the observed differences in gm. One possibility is that low latitude populations may invest in tougher leaves with thicker cell walls or other structural components that might increase path lengths or otherwise limit diffusion of CO 2 into chloroplasts (Warren 2008). This is in keeping with the observation that species with longer leaf longevity allocate more resources to structural components, as reflected by LMA, to provide physical resistance to abiotic and biotic stress factors (Wright, Westoby & Reich 2002; Wright et al. 2004). In contrast, however, within balsam poplar we find a strong tendency towards higher LMA in populations from high latitudes, where leaf longevity is comparatively brief. Other possibilities include the effects of aquaporins involved in CO2 transfer across cellular membranes (Terashima & Ono 2002; Flexas et al. 2006) or differences in cytoplasmic streaming and the positioning of chloroplasts within protoplasts (Tholen et al. 2008).  49  Trait convergence in Populus Balsam poplar and black cottonwood are very similar in many respects and hybridize extensively where their ranges overlap (Farrar 1995). It was surprising, therefore, that although they both show increased A and Leaf N with latitude of origin, they achieve an increase in leaf conductance in different ways. In black cottonwood, gs and SD co-varied with A and Leaf N, resulting in no apparent population differences in A/gs or δ13C (Gornall & Guy 2007). Higher SD in high latitude genotypes was fully accounted for by the appearance of stomata on the upper leaf surface. In contrast, our balsam poplar accessions are almost entirely hypostomatous regardless of origin, and their gs was not related to any of the geoclimatic variables. Consequently, in trees from regions with short growing seasons, water-use efficiency was enhanced in one species (balsam poplar) but not in the other (black cottonwood). Gornall & Guy (2007) did not assess gm in black cottonwood, but the absence of any change in gs in balsam poplar appears to be partially offset by enhanced gm, further contributing to a higher WUE. 3.5 Conclusions We conclude that climate-related patterns in photosynthesis are not artifacts of photoperiodic response and differential growth in common garden environments.  Rather, these patterns  represent true adaptive variation in response to growing season length. Commensurate with higher A, and contrary to the typical view that trees adapted to short growing seasons will exhibit lower growth rates, high latitude genotypes of balsam poplar are in fact capable of equal or greater growth than their low latitude counterparts when photoperiodic restrictions are removed. The proximal causes for population-level variation in A in balsam poplar appear to be similar to those previously reported for black cottonwood, at least in terms of investments in Leaf N and resulting photosynthetic capacity. In balsam poplar much of the increase in Leaf N can be attributed to higher LMA, whereas in black cottonwood LMA did not vary. Another difference is the means by which they supply their increased photosynthetic capacity with an enhanced CO 2 flux, in one case through gs (black cottonwood) and in the other through gm (balsam poplar); two convergent, but not equivalent solutions to the same problem.  50  Table 3.1 Geoclimatic data for 21 provenances of the AgCanBaP collection of Populus balsamifera. Provenances  LAT  Inuvik (INU)  LON  ELV  FFD  MAT  AST  MTCM  MTWM  MAP  MSP  CONT  ADI  SDI  68.38º 133.77º  7  107  -8.8  8.1  -27.6  14.2  249  115  41.8  1.28  1.42  Norman Wells (NWL)  65.23º 126.67º  84  133  -5.5  11.8  -26.5  17.0  291  161  43.5  1.41  1.22  Fairbanks (FBK)  64.90º 146.35º  248  125  -2.9  12.4  -23.2  16.9  263  167  40.1  1.89  1.16  Denali National Park (DEN)  63.87º 149.02º  594  122  -3.2  11.8  -22.3  16.1  235  159  38.4  2.08  1.16  Hay River (HAY)  60.80º 115.78º  168  144  -1.1  11.5  -23.1  15.9  321  183  39.0  1.78  1.00  Whitehorse (WHR)  60.70º 135.33º  770  138  -0.2  11.2  -18.4  14.8  283  157  33.2  2.14  1.08  Stony Rapids (STO)  59.23º 105.72º  306  153  -0.7  13.0  -20.4  16.9  452  293  37.3  1.29  0.66  Kuujjuaq (KUU)  58.02º  68.65º  17  115  -5.7  7.0  -24.3  11.5  527  243  35.8  0.77  0.56  Fort McMurray (FTM)  56.92º 111.50º  338  157  0.7  13.3  -18.8  16.8  456  308  35.6  1.43  0.63  Gillam (GIL)  56.35º  94.63º  126  129  -4.2  10.4  -25.8  15.3  499  289  41.1  0.91  0.61  Grande Prairie (GPR)  54.75º 118.63º  769  167  1.9  13.1  -15.0  15.9  447  283  30.9  1.58  0.64  Love (LOV)  53.63º 105.50º  419  157  0.7  14.0  -19.6  17.6  440  300  37.2  1.47  0.68  Stettler (STL)  52.35º 112.73º  795  161  3.0  13.5  -12.6  16.4  481  341  29.0  1.59  0.55  Mount Groulx (MGR)  51.33º  68.13º  452  152  -4.0  8.8  -23.3  13.2  790  443  36.5  0.58  0.35  Calgary (CGY)  50.82º 113.42º  915  170  4.1  13.2  -8.9  16.2  413  300  25.1  2.00  0.62  Sioux Lookout (SOU)  50.08º  91.90º  384  168  1.6  14.6  -18.6  18.6  716  424  37.2  0.97  0.51  Carnduff (CAR)  49.18º 101.83º  558  173  3.8  15.9  -14.8  19.5  527  321  34.3  1.53  0.71  Rouyn-Noranda (RNA)  48.60º  78.67º  310  150  0.7  13.0  -17.9  16.7  950  513  34.6  0.68  0.37  Matane (MTN)  48.57º  67.35º  119  192  3.9  14.4  -11.7  18.2  915  417  29.9  0.89  0.51  Roseville (ROS)  47.33º  64.37º  25  195  5.1  14.8  -8.5  18.6  1105  422  27.1  0.81  0.51  Fredericton (FRE)  46.40º  67.25º  147  195  5.6  15.8  -9.5  19.3  1124  461  28.8  0.82  0.49  51  LAT, latitude (ºN); LON, longitude (ºW); ELV, elevation (m); FFD, frost free days (days); MAT, mean annual temperature (ºC); AST, average summer temperature (ºC); MTCM, mean temperature of the coldest month (ºC); MTWM, mean temperature of the warmest month (ºC); MAP, mean annual precipitation (mm); MSP, mean summer precipitation (mm); CONT, continentality; ADI, annual dryness index; SDI, summer dryness index.  52  Table 3.2 Pearson correlations (r) between geographic, climatic and physiological variables for all 210 genotypes. [those that are significant are set in bold (p<0.05); bold* are significant after Bonferroni selection (p<0.0003)]. LAT  LON  ELV  FFD  MAT  AST  CONT  ADI  SDI  Height increment  0.622*  0.557*  -0.083  -0.501*  -0.486*  -0.254*  0.547*  0.309*  0.560*  A  0.361*  0.201  -0.090  -0.424*  -0.371*  -0.416*  0.167  0.152  0.317*  -0.059  -0.008  -0.005  0.010  -0.037  -0.069  -0.043  -0.094  gs  -0.028  WUEi  0.309*  0.225  -0.034  -0.328*  -0.295*  -0.289*  0.182  0.174  0.325*  Leaf N  0.465*  0.203  -0.210  -0.572*  -0.524*  -0.558*  0.308*  0.049  0.355*  PNUE  -0.432*  -0.263*  0.119  0.501*  0.435*  0.401*  -0.354*  -0.098  -0.312*  δ13Cleaf  0.234  0.207  -0.093  -0.153  -0.182  -0.028  0.296*  0.068  0.255*  δ13Cwood  0.247*  0.219  -0.091  -0.154  -0.171  -0.006  0.337*  0.100  0.224  SD  -0.206  -0.104  0.147  0.164  0.201  0.170  -0.151  -0.022  -0.221  CCI  0.248*  0.209  0.081  -0.303*  -0.220  -0.246*  0.111  0.190  0.226  LMA  0.501*  0.451*  -0.039  -0.494*  -0.446*  -0.317*  0.377*  0.261*  0.528*  Height increment (cm); A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mmol-1 H2O); Leaf N, leaf nitrogen content (μmol N cm-2); PNUE, photosynthetic nitrogen-use efficiency (μmol CO2 mol-1 N s-1); δ13C, carbon isotope composition for leaf and wood (‰); SD, stomatal density (per mm-2); CCI, chlorophyll content index; LMA, leaf mass area (mg cm-2); LAT, latitude (ºN); LON, longitude (ºW); ELV, elevation (m); FFD, frost free days (days); MAT, mean annual temperature (ºC); AST,  average  summer  temperature;  CONT,  continentality;  ADI,  53  annual  dryness  index;  SDI,  summer  dryness  index.  Table 3.3 Pearson correlations (r) among physiological variables for all 210 genotypes. [those that are significant are set in bold (p<0.05); bold* are significant after Bonferroni selection (p<0.001)].  Height increment A gs WUEi Leaf N  δ13Cleaf  δ13Cwood  SD  CCI  LMA  -0.199  0.439*  0.452*  -0.057  0.169  0.427*  0.533*  -0.104  0.031  -0.038  -0.144  0.390*  0.132  0.055  0.059  -0.277*  -0.401*  0.138  0.023  -0.233*  0.358*  -0.125  0.226*  0.300*  -0.208  0.267*  0.292*  1  -0.831*  -0.087  -0.050  -0.096  0.475*  0.488*  1  0.040  -0.063  -0.008  -0.354*  -0.464*  0.656*  -0.165  0.153  0.204  1  -0.089  0.085  0.242*  1  -0.063  -0.134  A  gs  WUEi  Leaf N  0.019  -0.106  0.105  0.107  0.236*  0.571*  1  -0.638*  1  1  PNUE  PNUE δ13Cleaf  1  δ13Cwood SD CCI  1  0.268*  Height increment (cm); A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mmol-1 H2O); Leaf N, leaf nitrogen content (μmol N cm-2); PNUE, photosynthetic nitrogen-use efficiency (μmol CO2 mol-1 N s-1); δ13C, carbon isotope composition for leaf and wood (‰); SD, stomatal density (per mm-2); CCI, chlorophyll content index; LMA, leaf mass area (mg cm-2).  54  Table 3.4 Canonical structure between geoclimatic parameters and plant traits with their first two canonical variables, CLIM1 and CLIM2. Geoclimatic variables  CLIM 1  CLIM 2  LAT  0.96  0.13  LON  0.72  0.39  Response variables  CLIM 1  CLIM 2  A  0.41  -0.34  WUEi  0.33  -0.18  13  ELV  -0.18  0.20  δ Cleaf  0.21  0.25  FFD  -0.94  0.09  δ13Cwood  0.19  0.35  MAT  -0.86  0.11  Leaf N  0.55  -0.32  AST  -0.68  0.44  PNUE  -0.49  0.03  CONT  0.72  0.35  Height increment  0.59  0.31  ADI  0.39  0.29  SDI  0.82  0.12  LAT, latitude (ºN); LON, longitude (ºW); ELV, elevation (m); FFD, frost free days (days); MAT, mean annual temperature (ºC); AST, average summer temperature; CONT, continentality; ADI, annual dryness index; SDI, summer dryness index; A, assimilation rate (μmol CO2 m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mmol-1 H2O); δ13C, carbon isotope composition for leaf and wood (‰); Leaf N, leaf nitrogen content  (μmol N  cm-2);  PNUE,  photosynthetic  nitrogen-use  efficiency (μmol CO2  55  mol-1  N  s-1);  height  increment  (cm)  Table 3.5 Fitted A-Ci curve parameters (±SE) estimated at 27ºC on populations representative of North (INU, DEN, KUU) and South (STL, FRE, MTN) geography. Values reported for A and gs are at ambient CO2 (380 μL L-1). p is the probability of a difference between North and South. Geography North South p  A  gs  Vcmax  J  TPU  Rd  gm  14.89±0.82 10.84±0.32  0.266±0.01 0.218±0.01  87.95±6.26 76.89±4.30  115.44±6.97 93.20±1.88  8.12±0.53 6.56±0.11  2.50±0.19 2.83±0.19  0.447±0.124 0.173±0.030  0.0833  0.0034  0.0037  0.1636  0.0097  0.0002  0.0274  A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); Vcmax, maximum carboxylation rate allowed by Rubisco; J, rate of photosynthetic electron transport (based on NADPH requirement); TPU, triose phosphate use; Rd, day respiration (μmol m-2 s-1); gm, internal conductance (mol CO2 m-2 s-1). INU, Inuvik; DEN, Denali National Park; KUU, Kuujjuaq; STL, Stettler; FRE, Fredericton; MTN, Matane.  56  Figure 3.1 Natural range of Populus balsamifera (shaded area) and provenances of 21 populations used in this study.  57  a Height increment (cm)  40  30  20  10  -2 -1 A ( mol CO2 m s )  20  b  18  16  14  12  c  10  LMA (mg cm-2)  9  8  7  FRE  ROS  CAR  MTN  SOU  CGY  STL  GPR  LOV  STO  FTM  RNA  MGR  HAY  WHR  GIL  NWL  FBK  DEN  INU  5  KUU  6  Figure 3.2 Mean values (±standard deviation) standard deviation for (a) height increment over 18 days during peak growth (b) assimilation rate (A) and (c) leaf mass per unit area (LMA) during free growth across 21 populations of Populus balsamifera. Provenances are arranged from left to right according to increasing frost-free days.  58  40  35  30  FRE  ROS  MTN  CAR  CGY  SOU  GPR  STL  LOV  FTM  STO  MGR  RNA  HAY  WHR  NWL  GIL  FBK  DEN  20  KUU  25  INU  WUEi ( mol CO2 mmol-1 H2O)  45  Figure 3.3 Mean values (±standard deviation) for intrinsic water use efficiency (WUE i) during free growth across 21 populations of Populus balsamifera. Provenances are arranged from left to right according to increasing frost-free days.  59  Figure 3.4 Assimilation rate (A) as a function of Leaf N and frost-free days (FFDs) across all 210 genotypes of Populus balsamifera. The dependent variable can be predicted from a linear combination of the independent variables using the equation A = 15.865 + (0.019 × Leaf N) - (0.019× FFD).  60  y = 0.0084x + 23.11 r2 = 0.375, p = 0.003  y = 0.0036x + 22.67 r2 = 0.108, p = 0.146  y = 0.0031x + 22.18 r2 = 0.087, p = 0.196  Figure 3.5 Carbon isotope discrimination calculated from δ 13Cwood (□), δ13Cleaf (Δ) and intrinsic water use efficiency (○) across 21 populations of Populus balsamifera plotted against frost-free days.  61  Chapter 4. Comparative physiology of allopatric Populus species: Geographic clines in photosynthesis, height growth and carbon isotope discrimination in common gardens 5 4.1 Introduction The „common garden‟ approach whereby samples of genotypes collected from different populations are directly compared under the same environmental conditions, either outdoors, in a greenhouse or a growth chamber, is widely used for the study of local adaptation (Kawecki and Ebert 2004). Since the late 18th century, field „provenance trials‟ have been used in forestry to assure sources of seed that give well-adapted, productive trees for reforestation or afforestation (Linhart and Grant 1996). Common garden experiments including provenance trials also provide material for tree breeding and ex-situ conservation.  Through association studies, common  gardens that include accessions from a large number of populations have become extremely useful in uncovering the molecular-genetic basis for differences in physiological traits and their functional regulation. They also yield invaluable data to model and predict tree responses to climate change (Wang et al. 2006, 2010), especially when replicated across the landscape (e.g., Rehfeldt et al. 1999). Phenotypic selection studies, including those that describe the relationship of plant physiological traits to provenance latitude, can be used not only to examine the evolution of particular traits but also to test adaptive hypotheses. Variations in growth rates and morphological characters have been well documented in latitudinally separated populations sampled or collected over vast geographic ranges and grown in common gardens. In this context, latitude is really a proxy for environmental factors that drive selection, such as length of growing season, photoperiod, temperature, and water availability that co-vary with latitude. The general understanding is that high latitude plants grow more slowly and are shorter in height compared to plants from low latitude (Moles et al. 2009). Differences in stature, however, may depend more on phenology and environment than on intrinsic growth potential. Indeed, we have shown that high latitude populations of balsam poplar (Populus balsamifera L., section Tacamahaca) are in fact capable 5  A version of this chapter will be submitted to publication. Soolanayakanahally RY, Guy RD, Street NR, Robinson K, Silim SN, Albrectsen BR and Jansson S. Comparative physiology of allopatric Populus species: Geographic clines in photosynthesis, height growth and carbon isotope discrimination in common gardens. 62  of higher rates of carbon assimilation (A) and height growth than their southern counterparts when relieved from photoperiodic restrictions (Soolanayakanahally et al. 2009). Ecophysiological attributes such as photosynthesis, respiration, leaf nitrogen (Leaf N) and growth phenology all vary with leaf lifespan (Wright et al. 2004a). Trait correlations across major plant functional groups strongly associate leaf lifespan and leaf mass per area (LMA) with climate variation (Wright et al. 2004b). Species with short-lived foliage have generally higher A, owing to trade-offs in carbon and nitrogen allocation between biochemical and structural components. A strong positive correlation between photosynthesis of a leaf and its nitrogen concentration is well recognized in plant species (Evans 1989). Even in deciduous trees, where the green-cover period is less than one year, there is a negative relationship between A and leaf lifespan both among (Reich et al. 1995) and within (e.g., Gornall and Guy 2007) species. Classic studies (Mooney and Billings 1961; Billings et al. 1971) of adaptive variation in Oxyria digyna indicated a latitudinal cline in photosynthesis towards higher A in arctic ecotypes. Multiple parallel clines within a species are also good evidence of adaptation. The existence of such clines independent of gene flow, especially when common to more than one species along the same or similar environmental gradient constitutes strong evidence for adaptive trait selection (Endler 1973). Global patterns in ecophysiological traits of vegetation are beginning to be recognized at species and community levels, but not-so-much within species, which can be at odds with higher levels of organization. For example, Soolanayakanahally et al. (2009) reported that LMA increases with latitude within P. balsamifera, whereas in a meta-analysis of data for 2548 species, Wright et al. (2004b) found the opposite trend across biomes. In this study, we examine intercontinental latitudinal patterns in photosynthesis, as an adaptation to growing season length, among allopatric species of Populus. The genus Populus presents many advantages to comparative physiologists seeking to understand the biological significance of physiological adaptation, including ease of propagation, access to large collections of native germplasm from temperate through sub-arctic habitats, and substantial genetic tools and resources. Stomata, an interface for the diffusion of CO2 into leaves and water vapor out, play an important role in plant productivity. By modulating transpiration and photosynthesis, stomata regulate instantaneous water-use efficiency (WUEi). Assimilation-averaged water-use efficiency can be estimated via its correlation with the stable carbon isotopic composition of plant tissues 63  (Farquhar et al. 1982). The carbon isotope ratio (δ 13C) of plant tissue provides an integrated measurement of internal plant physiological and external environmental properties influencing photosynthesis over time of carbon fixation (Anderson et al. 1996). Variation in WUEi and δ13C has been well characterized along moisture, temperature and nutrient gradients in many species. Geography-related variations in δ13C had adaptive significance in Pinus ponderosa Dougl. ex Laws. (Zhang et al. 1997), Chrysothamnus nauseosus (Donovan and Ehleringer 1994) and Pinus contorta Dougl. ex Loud. (Guy and Holowachuk 2001). Although species of different origin can display similar clines in phenotypic traits as a result of natural selection and convergent evolution, a preferred phenotype may be achieved by different combinations of underlying traits or genes. For example, latitudinal variation in A is associated with higher stomatal conductance (gs) among field-grown populations of black cottonwood (Populus trichocarpa Torr. & Gray, section: Tacamahaca) (Gornall and Guy 2007), but not in greenhouse-grown P. balsamifera (Soolanayakanahally et al. 2009), with consequent effects on respective trends in WUEi and δ13C. This is somewhat surprising given that these two North American species are very closely related and hybridize extensively where their ranges overlap (Farrar 1995).  Thus, we aimed to evaluate whether similar patterns in A, gs and related  ecophysiological traits would be found in a more disparate member of the genus, namely the Eurasian aspen (Populus tremula L., section: Populus). We compare data from independent common gardens in North America and Europe with previously published data on P. trichocarpa (Gornall and Guy 2007) and greenhouse-grown P. balsamifera (Soolanayakanahally 2009) to answer the following questions: 1. Do latitudinal clines exist in A among allopatric Populus species adapted to similar or overlapping environment envelopes on different continents when measured during active growth in common gardens? 2. Do clinal patterns in height growth depend more on bud phenology (bud set) and environment than on intrinsic growth potential? 3. Do variations in WUEi and δ13C follow similar patterns in outdoor and indoor common gardens?  64  4.2 Materials and methods Common gardens Populus balsamifera Balsam poplar has a continuous natural range from Alaska to Newfoundland and south to Michigan. The plant material used here is a subset of the larger Agriculture Canada Balsam Poplar (AgCanBaP) collection consisting of 62 provenances. For the present purposes, five populations (Table 4.1) with 15 genotypes per population were planted into an outdoor common garden at Indian Head (50.33º N 103.39º W), Saskatchewan, Canada in mid-August 2005. This location is near the southern edge of the species range where photoperiod is always limiting during summer for most of the high-latitude populations. Stem cuttings of 6-9 cm length with a minimum of two buds were rooted in Spencer-Lemaire RT 420A Rootrainer® containers (Beaver Plastics, Acheson, Canada) filled with a mixture of Sunshine-2 (Sun Gro Horticulture, Vancouver, Canada) growing mix (60%), peat (30%) and vermiculite (10%). The rooted cuttings were grown in a greenhouse with natural light supplemented by cool-white fluorescent lamps to provide a 19h photoperiod and a minimum PPFD of 400 μmol m-2 s-1 at plant level. Maximum day and night temperatures were maintained close to 25 and 18 ºC, respectively. Upon flushing the cuttings were kept well watered and fertilized weekly with ½-strength Hoagland‟s solution (Hoagland and Arnon 1950). When the plants were approximately 45 cm tall, they were moved to a shade house for a period of two weeks before planting in a complete block design with three replicates per genotype spaced two meters apart.  At the common garden site, maximal  photoperiod is 16 h 12 min, with mean annual precipitation of 435 mm and mean maximum and minimum temperatures during growing season (May-August) of 22 ºC and 8 ºC respectively. The year in which measurements were taken, 2007, was relatively wet. The common garden site is weeded annually. P. tremula Eurasian aspen is distributed throughout Europe from the Mediterranean to northern Scandinavia and eastwards to Siberia and central Asia.  We made use of the Swedish Aspen (SwAsp)  collection planted at Sävar (63.80º N 20.30º E) in June 2004. The SwAsp collection contains a total of 116 genotypes coming from 12 different localities in Sweden (Table 4.1, 10 genotypes 65  per population except for Luleå where only six genotypes were sampled). For more information on the collection and establishment of the common garden refer to Luquez et al. (2007). In contrast to balsam poplar, the aspen common garden is located close to the northern edge of the species range and photoperiod is not limiting during summer. At Sävar the maximal photoperiod is 20 h 53 min, with mean annual precipitation of 482 mm and mean maximum and minimum temperatures during growing season (May-August) of 23.5 ºC and 6.2 ºC respectively. Spot weeding is done annually within a 0.5 m perimeter around each tree. Gas exchange Measurements were taken during active growth (well before bud set) in both species in the absence of any water stress. For balsam poplar, measurements were made in the first two weeks of July 2007 on five populations (six trees per population; n = 30). For aspen, measurements were made on all 116 genotypes, from June 24 - July 10, 2008. Light-saturated net photosynthesis (A) and stomatal conductance (gs) were measured on clear, sunny days using a LC Pro+ portable gas exchange system (Analytical Development Co., Ltd., Hoddesdon, UK). Measurements were made on two fully expanded sun leaves per tree, between 9:00 and 12:00 h. Conditions inside the cuvette were set to: ambient μL L -1 CO2, 25º C leaf chamber temperature, 35% RH and PPFD of 1500 μmol m-2 s-1 supplied by a mixed red/blue LED unit mounted on the top of cuvette. After stabilization of the Ci, three measurements were recorded over a period of three minutes and averaged to determine A (μmol CO2 m-2 s-1) and gs (mol H2O m-2 s-1) following von Caemmerer and Farquhar (1981). The intrinsic water-use efficiency (WUEi), was calculated as the ratio of A to gs (i.e.,  mol CO2 mol-1 H2O). The  chlorophyll content index (CCI) was determined on six leaves per tree with an Opti-Sciences CCM-200 meter (Hudson, NH, USA) the day after gas exchange measurements were completed. The CCM-200 uses calibrated light emitting diodes and receptors to calculate the CCI, which is defined as the ratio of percent transmission at 940 nm to 655 nm through a leaf sample. The efficacy of CCI is well established for many forest tree species (van den Berg and Perkins 2004). Leaf tissue sampling Whole leaf samples for analysis of δ 13C and nitrogen content (Leaf N, μmol N cm-2) from 75 balsam poplar trees (i.e., 15 genotypes × 5 populations) and 348 aspen trees (i.e., 116 genotypes 66  × 3 ramets/genotype) were collected at the end of gas exchange measurements. Leaf tissue was oven dried at 70º C to constant mass and later ground to fine powder in liquid nitrogen using a mortar and pestle. Homogenized subsamples of ~2.5 mg were packed in tin capsules and sent to the University of California at Davis Stable Isotope Facility for combustion and analysis by an online continuous flow dual analyzer coupled to an isotope ratio mass spectrometer (Europa Scientific Integra, Cheshire, England, UK). The δ13C value of the leaf tissue is reported in per mil (‰) units relative to the arbitrary standard Vienna Pee Dee Belemnite: δ13C = [(13C/12C) Sample - (13C/12C) VPDB] / (13C/12C) VPDB × 1000 The overall, long-term sample preparation and analysis error between repeated analyses of the same ground tissue was less than ±0.11‰. Growth measurements Final height of all genotypes was measured after bud set in 2007 for P. balsamifera and 2008 for P. tremula. The 30 balsam poplar trees used for gas exchange measurements were harvested for shoot biomass determination at the end of the 2007 growing season. Numbers of leaves were counted for each tree and the leaf area measured using a LI-3100 leaf area meter (LI-COR Biosciences, Lincoln, NE, USA). Stems and leaves were oven-dried to constant weight and dry mass was recorded. LMA was expressed as the leaf mass to area ratio . Phenology In both species, spring and autumn phenology, characterized by dates of bud flush and bud set, respectively, were monitored twice weekly. Height elongation duration (HED) was calculated as the number of days available for height elongation between bud flush and bud set. For balsam poplar, the length of the green-cover period (GCP), defined as the number of days from bud flush to when 80% of the leaves had abscised, was also recorded. Statistical analysis Data analyses were conducted in SigmaStat version 2.03. Pearson‟s correlation coefficients (r) among physiology, growth and geographic variables were calculated to determine the relationships between all variables on genotypes. Multiple linear regressions were carried out on  67  the data to select latitude as a common descriptive denominator. The population means with standard error are reported.  4.3 Results For both of the collections used in this study, latitude, longitude and elevation of origin are confounded, particularly in balsam poplar (Table 4.1).  Although we report correlation  coefficients between physiological variables and all three geographic descriptors in tables 4.2 and 4.3, relationships with longitude and/or elevation were in every case not significant after latitude was accounted for in multiple linear regressions (not presented). In balsam poplar, the number of frost-free days (which would tend to include the independent effects of latitude and elevation on temperature and growing season length) is actually a marginally better predictor than latitude in several cases (also not presented). However, for comparison to the other data sets generated or used in this study, we focus solely on latitude. During active growth (i.e., before bud set) field gas exchange measurements showed higher A in populations coming from higher latitudes, compared with those from lower latitudes for both balsam poplar and aspen (Figs. 4.1a and 4.1b). Mean photosynthetic rate was higher in balsam poplar compared to aspen, but differences between populations (as a function of latitude of origin) were more pronounced in aspen. Variation in stomatal conductance (gs) as a function of geographic origin paralleled A in both species (Tables 4.2 and 4.3). The correlation between A and gs was very strong for both species (Supplement 4.1). Measures of water-use (WUEi and δ13C) were negatively related to latitude in both species, but more clearly in balsam poplar (Tables 4.2 and 4.3). Furthermore, in balsam poplar WUE i and δ13C correlated (Supplement 4.1). Changes in δ13 C as a function of latitude were similar in the two species (Figs. 4.1c and 4.1d). In balsam poplar, WUEi ranged from 57.91 to 69.26 mol CO2 mol-1 H2O among populations, whereas in aspen it ranged from 43.35 to 59.12 mol CO2 mol-1 H2O. The species difference in WUEi was also reflected in δ13C values, which ranged from 26.66 ‰ to -27.64 ‰ in balsam poplar, and -28.51 ‰ to -29.29 ‰ in aspen. Trees with more negative δ13C values (balsam poplar) or lower WUE i (balsam poplar and aspen) had higher gs (Supplement 4.1).  68  Leaf N density increased significantly with latitude, longitude and elevation in the balsam poplar. Both Leaf N density and LMA were strongly positively correlated with all three parameters (Table 4.2 and Fig. 4.3). Nitrogen per unit mass was quite stable (not presented). Therefore, enhanced A with latitude is in this case a function of increased Leaf N density and, more so, gs, consistent with a reduction in water-use efficiency (in contrast to previous greenhouse study, chapter 3). The overriding influence of gs was even more apparent in aspen, where Leaf N density decreased significantly with latitude (Table 4.3), while A was enhanced.  Again,  consistent with a reduced water-use efficiency. In sharp contrast to balsam poplar, however, LMA in aspen showed no correlation with latitude when calculated across all 116 genotypes (Table 4.3) or across the 12 population means (Fig. 4.3b). Luleå, a northern population in Sweden, seemed to have an anomalously low LMA. Leaf N density was positively correlated with δ13C in aspen genotypes, but not with δ13C in balsam poplar (Supplement 4.1). Although higher rates of A were not associated with higher foliar nitrogen in aspen (in contrast to balsam poplar), they were supported by higher chlorophyll per unit leaf area, as indicated by CCI. CCI was positively and significantly related to latitude (Figs. 4.3e and 4.3f), longitude and elevation in both species, and most particularly in balsam poplar (Tables 4.2 and 4.3). In both balsam poplar and aspen, HED and height had strong inverse relationships with latitude at the individual plant level (Tables 4.2 and 4.3) and across population means (Fig. 4.2). Regardless of provenance, buds flushed within a few days of each other as soon as spring temperatures permitted, whereas dates of bud set spanned a much greater range. For example, in 2007, the Whitehorse population set bud in the first week of August (  = Julian day 217), while the  Fredericton population set bud in the first week of September ( = Julian day 247). High-latitude populations set bud early compared to low-latitude populations and retained their ranks year-toyear in both common gardens (not shown). Balsam poplar shoot biomass at the end of the third growing season, like GCP and HED, was negatively correlated with latitude of origin (Table 4.2). HED (r2 = 0.902; n = 5) was a better predictor of shoot biomass than GCP (r2 = 0.637; n = 5) (Fig. 4.4). Because A decreases with HED while biomass increases, biomass and A were negatively correlated (r = -0.422, P < 0.05).  69  Mean shoot biomass was four-fold greater for the population from Fredericton (low-latitude) than for the population from Whitehorse (high-latitude) (r = -0.705, P < 0.001, Table 4.2). GCP exceeded HED by an average of 67 days, ranging from 50-78 days across populations with no clear latitudinal trend. 4.4 Discussion Photosynthesis in balsam poplar and European aspen Despite the relatively short photoperiods for the high latitude populations at the Indian Head common garden, and to a lesser extent at Sävar, all genotypes went through a period of free growth before they set bud. Photosynthetic rates measured during this period increased with increasing latitude of origin both in balsam poplar and in aspen. Previously, it was suggested (Benowicz et al. 2000, Gornall and Guy 2007 and Soolanayakanahally et al. 2009) that a greater rate of photosynthesis in high-latitude genotypes is an adaptation to short growing season length. A trend towards increasing rates of net photosynthesis in relation to increasing latitude of origin has been seen in several plant species (Reich et al. 1996, Schipperges et al. 1995). A similar relationship appears to exist with altitude. Ovaska (1988) found that mountain birch (Betula pubescens Ehrh.) populations from high altitude had greater leaf photosynthetic rates per unit area than those from low altitude. Likewise, Oleksyn et al. (1998) reported that high elevation populations of Norway spruce (Picea abies (L.) Karst.) had higher photosynthetic rates than did populations from lower elevation.  Higher A during active growth in short-growing season  genotypes does not necessarily persist beyond bud set. Johnsen et al. (1996) found that black spruce (Picea mariana (Mill) B.S.P.) trees from Yukon (63°N) had higher A than trees from Ontario (45°N) when measured in a 23-year-old common garden during the peak of summer (June-July), but this ranking was reversed when measurements were made later in the season (Sept-Oct; i.e., after bud set). Higher photosynthetic rates in high elevation populations of Norway spruce (Picea abies (L.) Karst.) were supported by higher % nitrogen in needles with no changes in LMA (Oleksyn et al. 1998). In contrast, in the present study and under greenhouse conditions (Soolanayakanahally et al. 2009), higher photosynthetic rates in high latitude populations of balsam poplar were supported by higher LMA, which increases Leaf N density but not % N. Aspen, on the other  70  hand, followed neither of these patterns. Although LMA and Leaf N density remain highly correlated across all genotypes, they do not increase with latitude nor do they correlate with trends in A. In aspen, higher photosynthetic rates in high latitude populations seem almost entirely due to higher gs. Variation in foliar nitrogen among different tree populations had no effect, was inconsistently correlated with photosynthesis in Pinus strobus L. (Reich and Schoettle 1988) and Pinus radiata D. Don. (Sheriff et al. 1986), which also appears to be the case in fieldgrown aspen. Growth phenology and height Although photosynthetic rates were higher in balsam poplar and aspen genotypes adapted to shorter growing seasons, they accrue less growth in their respective common gardens because of an earlier bud set. Enhanced A in balsam poplar was apparent only on an area, and not on a mass basis, in contrast to aspen. Populations of both species were not at all differentiated in terms of date of bud flush, but there was strong clinal variation in bud set. The initiation of bud formation is visually apparent within a few days of growth cessation. The period of height elongation duration (HED) is therefore well approximated by the number of days between the recorded dates of bud flush and bud set. When grown outside, the high latitude populations of balsam poplar and aspen accomplished less growth over any given summer. Plant height and shoot biomass were tightly related to HED. In contrast, when height growth cessation was avoided under extended days in a greenhouse, height increment paralleled A in 21 latitudinally different provenances of balsam poplar (Soolanayakanahally et al. 2009). Short-season genotypes appear to have higher peak rates of stem elongation during free growth even in outdoor common gardens (balsam poplar - pers. comm. Salim Silim, Sitka spruce - Mimura and Aitken 2007, 2010). Similarly, Mylecraine et al. (2005), showed faster spring growth rates among northern populations in Atlantic white-cedar (Chamaecyparis thyoides (L.) B.S.P.) in a provenance test encompassing its entire latitudinal range (29° N - 44° N). KÖrner and Renhardt (1987) suggested that high latitude herbaceous perennials invest more in root growth to protect their productivity in case of shoot loss caused by growing season frost events or during winter. It is possible that trees and shrubs may do likewise, reducing potential shoot growth in northern provenances. Latitudinal clines in height growth cessation in response to photoperiod were first documented in European aspen by Sylvén (1940, in Pauley 1949) and in 71  North American cottonwoods by Pauley and Perry (1954). Cannell and Willett (1976) studied carbon partitioning in potted black cottonwood seedlings from 46° N - 58° N, but they reported that all provenances had similar carbon partitioning between roots and shoots until height cessation. However, because carbon partitioning after bud set favors roots (Ledig et al. 1970), which continue to grow, black cottonwood from northern provenances finished the growing season with a higher root:shoot ratio.  Enhanced late-season partitioning to root growth,  compounded over years, might increase belowground respiratory costs to further impact relative rates of shoot growth.  Cannell and Willett (1976), however, reported that differences in  root:shoot ratio did not persist year-to-year because they were corrected each spring by proportionally greater shoot growth among northern genotypes. Comparative physiology of Populus For comparative purposes, Table 4.4 summarizes trends reported here in outdoor common gardens for P. balsamifera and P. tremula, as well as for P. trichocarpa from Gornall and Guy (2007). The table also presents data for P. balsamifera grown under extended photoperiod in an indoor common garden as reported by Soolanayakanahally et al. (2009). Across all studies, photosynthetic assimilation rates (A) were always measured during active growth irrespective of the growth conditions, and in all four cases A increased with latitude of origin. The consistency of this geographic cline, in allopatric Populus species, as well as other woody plants, is strong confirmation of its global adaptive significance. We have previously noted that this can be achieved in different ways, and is consistent among species. For example, Soolanayakanahally et al. (2009) found that higher internal (mesophyll) conductance, and not gs contributed to enhanced A in greenhouse-grown P. balsamifera, whereas higher gs was at play in field-grown P. trichocarpa (Gornall and Guy 2007). Mesophyll conductance was not estimated in the present study or by Gornall and Guy (2007), but gs increased with latitude in outdoor common gardens across all three species (Table 4.4) including P. balsamifera. Different trends in gs between the field- and the greenhouse-grown balsam poplars largely account for different trends in WUEi, which decreases with latitude of origin in the former but increases in the latter. Likewise, WUEi decreases with latitude of origin in field-grown aspen (Table 4.4).  No  latitudinal pattern in WUEi was observed in field-grown black cottonwood by Gornall and Guy  72  (2007) but, in a broader study involving more populations, WUE i decreases with latitude also in this species (pers. comm. Athena McKown). Trends in leaf  13  C were in full concurrence with WUEi (Table 4.4). The differences in δ13C  values among the P. balsamifera and P. tremula populations were small; nevertheless there was a significant cline with latitude of origin. In P. balsamifera, however, the cline was positive under greenhouse conditions (Soolanayakanahally et al. 2009), but negative in the outdoor common garden (this study). Several authors have described in situ variation in δ13C with latitude and altitude within species (Zhang et al. 1993). Such variation may be genetic, environmental or more likely both. However, growth in a common garden to assess the genetic component will not necessarily exclude the effects of genotype × environment interaction. As noted above, earlier height growth cessation in high latitude genotypes may favor increased investment into root growth and consequently a higher root:shoot ratio. Increased partitioning to roots might then permit access to water from a greater relative volume of soil resulting in higher gs, lower WUEi and increased isotope discrimination. Differences in LMA and Leaf N density accounted for most of the variation in A reported by Soolanayakanahally (2009) for balsam poplar populations under greenhouse conditions and, in the present study, in an outdoor common garden. Leaf N density, but not LMA, was also associated with enhanced A in black cottonwood (Gornall and Guy 2007). However, aspen showed no link between A and Leaf N or between A and LMA. CCI, on the other hand, paralleled A across all studies where it was assessed. As expected, final height was negatively correlated with latitude of origin across all three Populus species when grown outdoors under a natural photoperiodic regime. 4.5 Conclusions Latitudinal clines in A exist among allopatric Populus species adapted to similar environments on different continents. We interpret this as a common, and therefore an important, adaptation to short growing seasons. In fact, this appears to be a convergent trait in that the underlying physiological mechanisms responsible for higher A are not consistent across species. Despite intrinsically higher photosynthetic rates, high latitude populations consistently accomplish less height over any given season as a result of early bud set leading to growth cessation. A shortcoming of outdoor common gardens or provenance trails to assess growth rates for purposes 73  of tree improvement is the crucial role of photoperiod in limiting plant height. Because height growth is largely predetermined by phenological events, the effects of other important traits that determine performance are effectively obscured. Furthermore, secondary “knock-on” effects on growth complicate the interpretation of other important adaptive traits such as root:shoot ratio, WUEi and δ13C.  74  Table 4.1 Geographic coordinates and mean elevation of origin for populations established in common gardens, by species. Latitude (° N), longitude (° W, North America and ° E, Europe), elevation (m). Species  Population  Latitude  P. balsamifera (North America)  Fredericton (FRE) Rouyn Noranda (RNA) Love (LOV)  46.40 48.60 53.63  67.25 78.67 105.50  147 310 419  Grand Prairie (GPR) Whitehorse (WHR)  54.75 60.70  118.63 135.33  769 770  P. tremula  Ronneby  56.27  15.21  49  (Europe)  Simlång Ydre Vårgårda  56.71 57.79 57.99  13.25 15.28 12.93  173 219 158  Brunsberg Uppsala Älvdalen Delsbo  59.63 59.81 61.22 61.73  12.96 17.91 13.97 16.71  84 17 354 98  Umeå Dorotea Luleå  63.93 64.36 65.62  20.63 16.44 22.19  37 382 13  Arjeplog  66.20  18.43  445  75  Longitude  Elevation  Table 4.2 Pearson‟s correlation coefficients among physiology, growth and geographic variables in P. balsamifera genotypes (n = 30, correlation for 13C is done on 75 genotypes). Significant correlations are in bold (p<0.05); bold* are after Bonferroni correction (p < 0.0015). Variable  Latitude  Longitude  Elevation  A  0.525  0.532  0.507  gs WUEi 13 C Leaf N CCI  0.588* -0.497 -0.313 0.660* 0.742*  0.566* -0.466 -0.272 0.657* 0.745*  0.527 -0.423 -0.264 0.603* 0.729*  LMA GCP HED Height  0.825* -0.701* -0.869* -0.732*  0.813* -0.624* -0.846* -0.683*  0.753* -0.531 -0.757* -0.608*  Biomass  -0.705*  -0.698*  -0.626*  A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mol-1 H2 O); δ13C, carbon isotope composition of leaf (‰); Leaf N, leaf nitrogen density (μmol N cm-2); CCI, chlorophyll content index; LMA, leaf mass area (mg cm-2); GCP, green-cover period (days); HED, height elongation duration (days); height (cm) and biomass (g) .  76  Table 4.3 Pearson correlation coefficients between geographic and physiological variables for all 116 aspen genotypes [those that are significant are set in bold (p < 0.05); bold* are significant after Bonferroni selection (p < 0.0018)].  Variables  Latitude  Longitude  Elevation  A  0.510*  0.462*  0.139  gs  0.375*  0.309*  0.168  WUEi  -0.171  -0.124  -0.095  δ13Cleaf  -0.184  -0.108  -0.139  Leaf N  -0.293*  -0.179  -0.118  CCI  0.356*  0.301*  0.182  LMA  -0.084  -0.039  -0.072  HED  -0.848*  -0.567*  -0.376*  Height  -0.739*  -0.485*  -0.358*  A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mol-1 H2 O); δ13C, carbon isotope composition of leaf (‰); Leaf N, leaf nitrogen density (μmol N cm-2); CCI, chlorophyll content index; HED, height elongation duration (days); height (cm).  77  Table 4.4 Comparative physiology among P. balsamifera, P. tremula and P. trichocarpa. Summary of correlations between physiological and morphological variables with latitude Variables  A gs WUEi Leaf 13C  P. balsamifera  P. balsamifera  P. tremula  P. trichocarpa  greenhouse (Soolanayakanahally et al. 2009) n = 210  common garden (present study) n = 30  common garden (present study) n = 116  common garden (Gornall & Guy 2007) n = 30  + *** no change + *** + ***  + ** + *** ** **  + *** + *** * *  +* +* no change no change  Leaf N + *** + *** *** +* CCI + *** + *** + *** not available Final Height + *** *** *** * LMA + *** + *** no change no change * p < 0.05; ** p < 0.01; *** p < 0.001 A, assimilation rate (μmol CO2 m-2 s-1); gs, stomatal conductance (mol H2O m-2 s-1); WUEi, intrinsic water use efficiency (μmol CO2 mol1  H2O); δ13C, carbon isotope composition of leaf (‰); Leaf N, leaf nitrogen content (μmol N cm-2); CCI, chlorophyll content index;  final height (cm); LMA, leaf mass area (mg cm-2).  78  Populus balsamifera 25  Populus tremula 20  A  18  A ( mol CO2 m-2 s-1)  A ( mol CO2 m-2 s-1)  24  23  22  21  y = 0.2062x + 11.681  20  r2  16  14  12  y = 0.4353x – 11.142  10  r2 = 0.637, p = 0.001  = 0.727, p = 0.066  19  8  -26.4  -28.0  C  D -28.2  -26.8  -28.4  C (O/OO)  -26.6  -27.0  13  -27.2  Leaf  Leaf 13C (O/OO)  B  -27.4 -27.6  -28.6 -28.8 -29.0 -29.2  y = -0.0458x – 24.64  y = -0.042x – 26.226  -27.8  -29.4  r2 = 0.429, p = 0.231  r2 = 0.328, p = 0.05  -28.0  -29.6 46  48  50  52  54  56  58  60  56  Latitude (ON)  58  60  62  64  66  Latitude (ON)  Figure 4.1 Mean net assimilation rate (A) and leaf  13  C (‰) across latitude of origin in P.  balsamifera and P. tremula measured during active growth in common gardens. Error bars are ±SE of the means.  79  Populus balsamifera  130  Populus tremula  140  B  A 120  HED (days)  HED (days)  120  110  100  90  80  60  y = -2.3836x + 234.43 r2  100  y = -6.5007x + 493.66 r2 = 0.894, p < 0.0001  = 0.977, p = 0.0015 40  80 240  200  C  D 180  220  160  Height (cm)  Height (cm)  200  180  160  140 120 100 80  140  y = -4.915x + 439.59  y = -9.579x + 706.17 60  r2  r2 = 0.819, p < 0.0001  = 0.885, p = 0.017  120 46  48  50  52  54  56  58  40  60  56  Latitude (ON)  58  60  62  64  66  O  Latitude ( N)  Figure 4.2 Mean height elongation duration (HED) and height growth across latitude in P. balsamifera and P. tremula used in this study. Error bars are ±SE of the means.  80  Populus balsamifera  Populus tremula  16  10.0  B 9.5  14  9.0  LMA (mg cm-2)  LMA (mg cm-2)  A 15  13  12  y = 0.3004x – 3.189 r2 = 0.9989, p < 0.0001  11  y = -0.0473x + 11.671 r2 = 0.197, p = 0.1482  7.0  C  16  Leaf N density ( mol cm-2)  Leaf N density ( mol cm-2)  8.0  7.5  10 34  8.5  32 30 28 26 24  y = 0.5603x – 1.9387 r2 = 0.9375, p = 0.0068  22  D  15 14 13 12 11  y = -0.2539x + 29.504 r2 = 0.7547, p = 0.0002  10  20  16  E  F  50 14  CCI  CCI  40  30  12  10  20  8  y = 0.1.9094x – 65.177 r2 = 0.8861, p = 0.0169  10  6 46  48  50  52  54  56  58  60  y = 0.3162x – 8.3702 r2 = 0.579, p = 0.0040 56  58  60  62  64  66  Latitude (ON)  Latitude (ON)  Figure 4.3 Mean LMA, Leaf N density and CCI across latitude in P. balsamifera and P. tremula used in this study. Error bars are ±SE of the means.  81  1000  Shoot biomass (g)  800  600  400  r2 = 0.958, p = 0.0037 200 80  90  100  110  120  130  HED (days)  Figure 4.4 Relationship between shoot biomass and height elongation duration (HED) among populations of P. balsamifera at the Indian Head common garden (50.33° N, 105.73o W). The curve is fitted with equation 2, (Error bars standard errors of the means).  82  Supplement 4.1 Correlation coefficients among physiological variables for all genotypes. [Significant ones are set in bold (p < 0.05); bold* are significant after Bonferroni selection (p < 0.0024)]. P. balsamifera (n = 30)  gs  WUEi  A  0.816*  gs  1  WUEi 13  13  C  Leaf N  CCI  LMA  -0.505*  -0.439  0.398  0.328  0.407  -0.904*  -0.523*  0.352  0.438  0.453  1  0.446  -0.243  -0.369  -0.381  1  -0.060  -0.250  -0.158  1  0.335  0.902*  1  0.545*  C  Leaf N CCI  P. tremula (n = 116)  gs  WUEi  A  0.717*  gs  1  WUEi 13  13  C  Leaf N  CCI  LMA  -0.337*  -0.168  0.008  0.553*  0.109  -0.809*  -0.158  0.080  0.366*  0.206  1  0.154  -0.070  -0.103  -0.195  1  0.263  -0.058  0.006  1  0.056  0.824*  1  0.097  C  Leaf N CCI  83  Supplement 4.2 Correlation coefficients among growth variables in balsam poplar. [Significant are set in bold (p < 0.05); bold* are significant after Bonferroni selection (p < 0.0083)].  Biomass variables (n = 30)  HED  Height  Biomass  GCP  0.729*  0.723*  0.532*  HED  1  0.775*  0.759*  1  0.727*  Height  84  Chapter 5. Comparative nucleotide diversity across North American and European Populus species 5.1 Introduction Comparative genomics has been applied to several model organisms (e.g., Brassica: Kowalski et al. 1994; Arabidopsis: Wright 2003; Oryza: Jianxin and Bennetzen 2004). Genome comparison is an effective approach in addressing many biological and evolutionary questions at different hierarchical levels, such as among and within genera. Accordingly, it is of interest to use this approach to understand the different evolutionary forces acting on orthologous genes. In closely related species, comparative genomics can shed light on the similarities and differences in genomic regions, whereas the comparison of distantly related species can also reveal sequences underlining different selection mechanisms (Hardison 2003).  For instance, in species that  diverged less than 20 million years ago (e.g., Populus, Eckenwalder 1996) comparative genomics may explain the early evolutionary forces that shape related species and concurrently highlight the molecular changes associated with ancestral and/or newly derived changes within a single clade (Jackson et al. 2006). From an evolutionary perspective, comparisons among closely related species could be limited by a lack of sequence variation among recently diverged species; which further limits our ability to compare conserved and functional regions (Boffelli et al. 2003). Therefore, the inclusion of distantly related species in genomic comparisons is expected to provide a broader understanding of sequence divergence. Populus is a widely distributed tree genera, comprising ~29 species falling into six sections (Eckenwalder 1996). In North America, the section Tacamahaca includes two closely related cottonwoods (Populus trichocarpa Torr. & Gray and Populus balsamifera L., Eckenwalder 1996). Both taxa are still undergoing divergence as indicated by phylogenetic studies using morphological traits (Eckenwalder 1996) and nuclear markers (Hamzeh and Dayanandan 2004). Some authors consider them a single species (Brayshaw 1965). ______________________________ 6  A version of this chapter will be submitted for publication. Ismail M, Soolanayakanahally RY, Ingvarsson PK, Guy RD, Jansson S, Silim SN and El-Kassaby YA. Comparative nucleotide diversity across North American and European Populus species.  85  The limited fossil record for poplars makes it difficult to estimate the time of divergence between different poplar species. In addition, most of the early fossil records that were thought to belong to poplars have been shown to belong to other taxa (Eckenwalder 1996). Furthermore, the feasibility of using fossil records of highly similar species such as P. trichocarpa and P. balsamifera for evolutionary comparisons has been questioned (Eckenwalder 1977).  The  relationships among and within different Populus sections have been inferred using molecular data (Hamzeh and Dayanandan 2004, Cervera et al. 2005, Ingvarsson 2010); however, these studies did not focus on the time of diversification. The application of “molecular clock” calculations to estimate the time since divergence is widely used in different taxa, either with or without calibration (Hedges and Kumar 2003). For example, Ingvarsson (2008) used the silent site divergence rate to estimate the time of bottleneck events in Populus tremula L. Previous reports showed that P. trichocarpa and P. balsamifera usually form one clade isolated from Populus tremuloides Michx., the closest species to the Eurasian P. tremula (Eckenwalder 1996; Hamzeh and Dayanandan 2004; Hamzeh et al. 2006). This implies that the North American cottonwoods probably diverged long ago from aspens, resulting in development of different genetic backgrounds and life history traits (Eckenwalder 1996). In this study, we compare the level of nucleotide diversity among three Populus species; P. tremula, P. trichocarpa and P. balsamifera which are distributed across a similar range of latitudes (56-66 ºN, 32-62 ºN, and 42-68 °N, respectively) indicating their adaptability to a broad range of environments. All three species exist in the Northern hemisphere and probably are exposed to similar geoclimatic conditions. However, independent studies (e.g., Gilchrist et al. 2006, Ingvarsson et al. 2005, Olson et al. 2010) showed stark differences among the three species that might reflect different evolutionary history. Most of the genetic diversity investigations conducted in these species have focused on assessment of within-species genetic diversity (Gilchrist et al. 2006, Ingvarsson et al. 2005, Breen et al. 2009, Olson et al. 2010), and the lack of orthologous genes has hindered among species comparisons. Consequently, strong conclusions are not warranted in comparing the results from studies that used different targeted gene loci and/or a different number of genotypes. It is worthwhile to investigate sequence diversity and evolutionary patterns across species in a consistent set of loci that might be associated with their local adaptation.  86  Here, we hypothesize that the different evolutionary histories of these species have shaped their nucleotide diversity in spite of similar latitudinal climatic conditions. To do so, a common set of nuclear loci that are known to have a role in defense, housekeeping, stress response, photoperiodism and freezing tolerance are used to address the following questions: 1. What is the extent of nucleotide diversity within the studied loci for each species? 2. What is the approximate evolutionary average time for their most recent common ancestor (mrca)? 3. What is the rate of decay in linkage disequilibrium (LD) across the three species? 5.2 Materials and methods Plant material and DNA extraction P. trichocarpa samples were collected from a range-wide replicated clonal trial established by the British Columbia Ministry of Forests and Range (Xie et al. 2009). The sample consisted of five populations each represented by six clones (N = 30) originating from different latitudes west of the Rocky Mountains (Table 5.1).  Similarly, P. balsamifera samples represented by five  populations each consisted of six clones (N = 30) originated from east of the Rocky Mountains. While, only three populations with 10 clones per population (N = 30) were used in P. tremula (refer, Table 5.1).  During the winters of 2005 and 2006, dormant P. balsamifera and P.  trichocarpa whips were collected and later forced to flush in a growth chamber at 25°C (16 h photoperiod). Newly flushed buds were collected and stored at -80°C. DNA extraction followed the method described by Doyle and Doyle (1987). P. tremula total genomic DNA was extracted from frozen leaf tissues using the DNeasy plant mini prep kit (Qiagen Inc. Valencia, CA). Candidate gene selection and fragment amplification and sequencing Our main focus was to study multiple loci associated with diverse biological functions that have putative roles in tree response to biotic and abiotic stress and growth. The studied loci are well documented and characterized in different poplar species (Benedict et al. 2006, Major and Constable 2008, Auge et al. 2009) as 1) defence genes (wound-inducible Kunitz trypsin inhibitor (KTI) genes: TI-3, TI-4, and WIN3), 2) Stress response genes (Phenylalanine ammonia-lyase PAL, Dehydrin - Dhn), 3) Photoperiodism genes (GIGANTEA - GI, Phytochrome - PHYB2), and  87  4) freezing tolerance gene PtCBF2.  In addition a housekeeping gene Glyceraldehyde-3-  phosphate dehydrogenase (Gapdh) was also surveyed (Table 5.2). Specific primers for TI-3, TI-4, WIN3, GI, and PtCBF2 were designed using the online program Primer 3.0 (Rozen and Skaletsky 2000) from published sequences of gene bank accession numbers AY378088, AY378089, X15516, BU833698, and DQ354395, respectively (Table 5.2). Primers to amplify Dhn and PAL were obtained from Joseph and Lexer (2008). Part of the Gapdh gene was amplified in the three species using primers GPDX7F and GPDX9R from Strand et al. (1997). Finally, an unpublished primer pair was used to amplify part of PHYB2 (Ingvarsson, unpublished). Polymerase chain reaction (PCR) amplification was performed in 25 μL reaction volume consisting of 70 ng genomic DNA, 0.25 mM of dNTP, 4 μL reaction buffer containing: 50 mM KCl, 15 mM Tris-HCl and 2.5 mM MgCl2), 40 pmol each of forward and reverse primer, and one unit of AmpliTaq Gold DNA polymerase [Applied Bisoystems, Foster City, CA, USA (ABI)]. Amplifications were performed using a GeneAMP 9700 thermocycler (ABI) with the following PCR conditions: i) initial denaturation at 94°C for 3 min, ii) 30 cycles of 94°C for 30 s, [45, 58.5, 61or 65.5°C according to each primer pair, Table 5.2] and 72°C for 1 min, and iii) 4 min final extension at 72°C. No amplicons were obtained for GI and PTCBF2 in P. tremula. PCR products were then cleaned using Qiagen MinElute Kit (Qiagen, Valencia, CA, USA) before using in direct sequencing. PCR products were sequenced in both directions using the same primers used for loci amplifications and Big Dye Terminator v3.1 (Applied Biosystems, Foster City, CA) on 3730x1 DNA analyzer Applied Biosystems (ABI). Sequence analysis and SNP discovery Sequence alignment, editing, and SNP discovery were carried out using CodonCode Aligner 2.0.6 (CodonCode Corporation, Dedham, MA, USA). Raw sequences were base-called using Phred quality score > 30 (Ewing and Green 1998), implemented in CodonCode Aligner. All chromatograms were visually checked for base calling errors. Sequence ends were trimmed until the average Phred quality score was > 25 in a window of 10 bases. Heterozygous SNPs were scored using the „call second peaks‟ function in CodonCode Aligner with the minimum lower peak height set at 60% of the first peak and manually confirmed. Consensus sequences were assembled using Phrap as implemented in CodonCode Aligner. After construction of consensus sequences, all polymorphic sites were verified against the original chromatograms.  The  sequences were then blasted against the P. trichocarpa genome sequence for verification using 88  the JGI  database (DoE  Joint  Genome Institute and Poplar  Genome Consortium;  http://genome.jgi-psf.org/Poptr1/Poptr1.home.html). The same database was also used to identify exonic and intronic regions. The sequences are submitted to the European Molecular Biology Laboratory (EMBL)/GenBank nucleotide sequence database under accession numbers (FN669610 - FN669634). Nucleotide diversity and deviation from neutrality Total nucleotide diversity was estimated as π (Lynch and Crease 1990) and θw (Watterson 1975). Presence of non-neutral evolution for the studied loci was estimated according to Tajima‟s D (Tajima 1989) and Fay and Wu's H, HFay&Wu (Fay and Wu 2000) using DnaSP 4.9 (Rozas et al. 2003). Pairwise divergence between species was obtained for all combinations at silent and replacement sites, later to use in the McDonald-Kreitman (MK) test (McDonald and Kreitman 1991). The same was also used for the estimates of the neutrality index (NI; Rand and Kann 1996) as implemented in DnaSP. In order to investigate the deviation from neutrality across studied loci, a multilocus Hudson-Kreitman-Aguadé test (HKA, Hudson et al. 1987) as implemented in the program HKA (http://lifesci.rutgers.edu/~heylab) was applied. In this test, three different analyses were conducted: i) P. tremula used as an out-group with P. balsamifera sequence data, ii) P. trichocarpa used as an out-group with P. balsamifera sequence data and iii) P. tremula used as an out-group with P. trichocarpa sequence data. The GI and PtCBF2 loci were excluded from this analysis since no sequence data was available for P. tremula (as the two loci failed to amplify). Molecular clock and divergence time estimates In this analysis the concatenated sequences obtained from the consensus sequences for each locus were used. The concatenated sequence approach is expected to out-perform the use of individual loci in inferring diversification time estimates (Hedges and Kumar 2003, Battistuzzi et al. 2010). Additionally, sequence information from different loci that evolved independently is expected to provide a species tree that is similar to the gene tree, particularly in closely related species (Pamilo and Nei 1988). The concatenated sequence was obtained for each species using DnaSP. Only the common shorter fragments amplified across species were used to determine the  most  probable  nucleotide  substitution  model  using  (http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html).  Findmodel This  software software  implements different packages to obtain estimates for 28 or 12 different nucleotide substitution 89  models (see the program website for details). The selection of the best model that fits the data was based on Akaike Information Criterion (AIC) (Akaike 1974). The model with lowest AIC is considered to be the best fit to the data. Following model selection, the divergence times and substitution rates were estimated using the Bayesian approach implemented in BEAST 1.5.3 (Drummond and Rambaut 2007). The xml input file of the concatenated sequences was obtained using BEAUTi 1.5.3 (Rambaut and Drummond 2007a). Two different models were used to investigate the time-scale of diversification among the three Populus species; the relaxed molecular clock that assumes different evolutionary rates among lineages, and the strict molecular clock that assumes equal evolutionary rates among tree branches (Sanderson 1997). In both analyses, the HKY model (Hasegawa, Kishino and Yano; Hasegawa et al. 1985) of nucleotide substitution was used as suggested by Findmodel (see results). To calibrate the molecular clock, a calibration point of 5 million years (Ma) ± standard deviation of 1.2 Ma was imposed at the node connecting P. trichocarpa and P. tremula. The selection of this calibration point was based on a previously estimated time of divergence between P. tremula and P. trichocarpa (3.8-6.2 Ma, Ingvarsson 2005). The same calibration point was also used to estimate the mean substitution rate per site per unit time (Ma). The posterior distribution of parameter estimates was obtained by two independent runs of Markov Chain Monte Carlo simulation (MCMC), each consisting of 6 x 106 steps following a burn-in of 6 x 104 steps sampling every 300 generations. For each analysis the convergence of MCMC was confirmed using Tracer 1.5 (Rambaut and Drummond 2007b). Haplotype inference and linkage disequilibrium (LD) In each of the studied species, the haplotype phase for heterozygous alleles was inferred using PHASE 2.1.1 (Stephens et al. 2001, Stephens and Scheet 2005). The default model (-MR0) and the general model for recombination rate variation (Li and Stephens 2003) was used. A separate PHASE run was performed for each gene fragment. Each run had a burn-in of 100 followed by 10,000 iterations. Haplotypes were determined at a confidence probability of ≥ 95%. All indels were excluded from the analyses. Following haplotype phasing, the number of haplotypes (H) and haplotype diversity (Hd, Nei 1987) for each locus were estimated using DnaSP. The square of the correlation coefficient between pairs of segregating sites (r2, Weir 1990) at the studied loci in each species was obtained using DnaSP and statistical significance of the r2 values was determined using chi-squared test and Bonferroni corrections. The LD decay, with physical 90  distance in base pairs (bp) pooled across loci, was assessed between polymorphic sites using nonlinear regression analysis of r2 values (Remington et al. 2001, Ingvarsson 2005). The expected value of r2 under drift-recombination equilibrium is E(r2) = 1/(1+ρ), where ρ = 4Nc is the scaled recombination rate for the gene region, N is the effective population size, and c is the recombination rate between sites. When a low mutation rate is assumed, the expected decay of LD becomes  E (r 2 )  10 (2 )(11  )  1  (3  )(12 12 n( 2 )(11  2  )  )  (1)  (Hill and Weir 1988), where n is number of sampled sequences. Equation (1) was fitted using pooled r2 with PROCNLIN procedure of SAS software (version 9.1 SAS Institute).  The  nonlinear regression yields least-square estimates of ρ per base pair. Although this estimate may not be precise due to non-independence between linked sites (Remington et al. 2001), it is nonetheless still useful to illustrate the rate of LD decay with physical distance. 5.3 Results Comparative nucleotide diversity in Populus A total of 4.4, 4.0, and 3.7 kilobases (kb) were sequenced across studied loci in P. trichocarpa, P. balsamifera, and P. tremula, respectively (Table 5.3). The observed total number of SNPs ranged between 27 and 70 across species with the highest number observed for P. balsamifera. Overall, the average nucleotide diversity (πT) was highest for P. tremula (7.52 x 10-3) followed by P. balsamifera (5.34 x 10-3) and P. trichocarpa (3 x 10-3) (Table 5.4). A similar trend was observed for the nucleotide diversity per site (θw) with P. tremula showing the highest diversity (4.97 x 103  ), followed by P. balsamifera (4.48 x 10-3) and P. trichocarpa (2.51 x 10-3) (Table 5.4). Of the  locus sequenced, the Dhn locus had the highest nucleotide diversity (πT and θw) in P. tremula, while GI displayed the highest nucleotide diversity for P. balsamifera. Nucleotide diversity for PHYB2 was consistently low across all three species (Table 5.4). Neutrality tests Across the studied loci, TI-3 and WIN3 had slightly higher divergence at silent sites compared to the other loci in P. balsamifera when P. tremula was used as an out-group; however, only TI-4 had a Ka/Ks > 1 (Fig. 5.1a). Additionally, the MK test indicated that WIN3 had the highest level 91  of replacement mutations (NI = 0.750, P < 0.034, Table 5.5). On the other hand, Gapdh had only one fixed mutation at a replacement site. Significant departure from neutrality was observed only for WIN3 as indicated by Fay and Wu‟s H (-2.742, P < 0.05). As expected, the two North American species showed no signs of divergence at either synonymous or replacement sites (Fig. 5.1b). A similar lack of divergence was observed for WIN3 in P. trichocarpa when P. tremula was used as an out-group (Fig. 5.1c). Among all loci, only TI-4 in P. trichocarpa showed deviation from neutrality as indicated by Tajima‟s D (data not shown).  Additionally, no  deviation from neutrality was observed at the multilocus level when P. tremula (X 2 = 3.13, df = 6, P = 0.80) or P. trichocarpa (X 2 = 3.40, df = 6, P = 0.76) was used as an out-group. Divergence time estimates The concatenated sequence for the cross-amplified loci in all three species was 2.779 kb, obtained from TI-3, TI-4, WIN3, Dhn, Gapdh, PAL, and PHYB2. Results from Findmodel using the AIC indicated that HKY is the most appropriate evolutionary substitution model. Bayesian analysis estimates of the time to the most recent common ancestor (mrca) between P. tremula and North American species was 4.5 Ma (i.e., 3.7-6.5 Ma with a 95% confidence interval). This was consistent in both relaxed and strict clock models. The estimated time to mrca between North American species was slightly different among clocks; 0.76 and 0.83 Ma for the relaxed and strict models (with 95% confidence intervals of 0.15-2.52 and 0.39-1.35 Ma, respectively).  The  combined estimates of nucleotide substitution per Ma for the three species were 0.005 regardless of the model used. However, substitution rate varied among species. P. tremula showed a 0.02 per Ma average substitution estimate, whereas in the North American species substitution per Ma was 0.004. And, the estimated rates were consistent in both models. Haplotype structure and linkage disequilibrium The number of haplotypes (H) ranged from 1-36 across all loci. The total number of haplotypes varied among species and among loci within species. In total, P. tremula had 83 haplotypes compared to 86 and 39 for P. balsamifera and P. trichocarpa, respectively (Table 5.6). Haplotype diversity (Hd) varied substantially among species, ranging between 44-97 (P. tremula), 0.0-96 (P. balsamifera), and 0.0-88 (P. trichocarpa). Among the nine loci, the wound-inducible Kunitz trypsin inhibitor (TI-3) had haplotype diversity ≥ 85% across the three species, while no variation was observed in P. balsamifera for PHYB2 but was observed in the other species (Table 5.6). Linkage disequilibrium pooled across loci showed a similar pattern in the two North 92  American species, while P. tremula displayed a different pattern. The non-linear regression model for LD (r2) with distance (bp) showed rapid decay in the North American species with r2 declining to ~0.18 within < 400 bp (Fig. 5.2). 5.4 Discussion Comparative nucleotide diversity in Populus Nucleotide diversity per site θw was higher in P. tremula (0.005) compared to the two North American species (0.0025 - P. trichocarpa, 0.0045 - P. balsamifera). Our P. tremula results are comparable to a previous study using a set of 77 genes (θw = 0.0048, Ingvarsson 2008). In North America, P. balsamifera had a two-fold higher nucleotide diversity in comparison to P. trichocarpa (0.0045 vs. 0.0025). Our nucleotide diversity values in P. balsamifera were also two-fold greater than previous reports for the same species (θw = 0.0028; Breen et al. 2009, Olson et al. 2010). Breen et al. (2009) reported very similar nucleotide diversity values (θw = 0.003) in P. trichocarpa but, Gilchrist et al. (2006) reported much lower diversity studying nine loci. Among the studied species, P. tremula harbored the highest nucleotide diversity and this might indicate possible admixture from related species in the native range (Lexer et al. 2005) or the possibility of fewer bottleneck events.  Moreover, the demographic histories of population  expansion and contraction might have played another role in this pattern, leading to highly diverged P. tremula populations (Ingvarsson 2008), while the North American P. trichocarpa may still be undergoing range contraction and expansion following the ice sheet retreat (Ismail 2010), indicating the presence of fewer founder populations.  This discrepancy was also  prominent in Arabidopsis, where the European Arabidopsis lyrata ssp. petraea had higher diversity compared to the North American Arabidopsis lyrata ssp. lyrata (Wright et al. 2003). The higher nucleotide diversity observed in P. balsamifera probably reflects substantial demographic expansion compared to P. trichocarpa. P. balsamifera is thought to have undergone massive range expansion that initiated from a central admixed population towards northern and eastern North America (Keller et al. 2010). Although P. balsamifera populations used in the present study were sampled from the western part of the species range, these populations harbor substantial variability, which is in line with previous findings (Keller et al. 2010). On the other hand, P. trichocarpa expansion in the Pacific Northwest was limited to a narrow range (i.e., 15° in longitude and 30° in latitude) as opposed to P. balsamifera which extended over a much wider range (i.e., 110° in longitude and 26° in latitude), reflecting the latter species‟ adaptability to 93  diverse environmental conditions. In addition, P. trichocarpa is thought to have spread from two different glacial refugia (i.e., northern and southern) followed by bottleneck events (Ismail 2010). More interestingly, when analyzed as a single species (combining two North American species into one), the average nucleotide diversity (πT) was similar to that of P. balsamifera, but remained lower than that of P. tremula (data not shown). However, the nucleotide diversity per site (θw) was higher for the combined North American species as compared to individual species‟ estimate, although it was only slightly higher than that of P. tremula (data not shown). The observed lower nucleotide diversity in North American poplars compared to Eurasian aspen reflects one or more evolutionary forces that contributed to the discrepancy among species sharing similar geoclimatic conditions. Note they also belong to different sections of Populus (Eckenwalder 1996).  The multiple colonization routes from southern and western Europe  (Hewitt 2000, Petit et al. 2003), combined with admixture events in P. tremula with its relative P. alba (Lexer et al. 2007) might have played a significant role in the observed high nucleotide diversity in P. tremula compared to the North American cottonwoods. In addition, P. tremula appears to have a higher effective population size (Ingvarsson 2008) than P. balsamifera (Olson et al. 2010). During the Pleistocene glaciations, plant and animal populations in North America and Europe were affected to different degrees. The existence of the unglaciated areas in Asia probably prevented severe bottlenecks from occurring and hence maintained higher effective population size in P. tremula (Olson et al. 2010), whereas the two North American species probably underwent severe bottlenecks events. In the present study, very low fixed polymorphisms were observed in the P. trichocarpa and P. balsamifera samples (three fixed mutations, data not shown) indicating high sequence similarities. In fact, they share 25% of their ancestral polymorphisms (Olson et al. 2010). The two North American species commonly form a monophyletic group reflecting their genetic similarity (Hamzeh and Dayanandan 2004). On the other hand, the North American species showed a comparable level of fixed mutations with P. tremula, 95 in P. balsamifera and 83 in P. trichocarpa; indicating low shared polymorphism among the North American and Eurasian poplars, congruent with previous reports where only 3.9% of shared polymorphisms were observed between P. tremula and P. trichocarpa (Ingvarsson 2010).  94  Deviation from neutrality An excess of amino acid divergence (NI < 1) was observed at the three defence loci in P. balsamifera when P. tremula was used as an out-group; however, this excess was only significant for WIN3 (P < 0.05). In addition, the same locus showed a non-neutral evolution pattern as indicated by HFay&Wu. On the other hand, the same WIN3 locus showed a pattern of purifying selection in P. balsamifera when P. trichocarpa was used as an out-group (data not shown). Furthermore, the divergence at synonymous and nonsynonymous sites was similar among the North American species and for most loci. This probably indicates that the loci are highly conserved or evolving under neutral constraints. In contrast, only TI-4 in P. balsamifera showed higher nonsynonymous versus synonymous divergence when P. tremula was used as an outgroup (Fig. 5.1a), likely reflecting purifying selection at this locus in P. balsamifera. The deviation from neutrality observed at the WIN3 locus in P. balsamifera when P. tremula or P. trichocarpa was used as an out-group, which was not observed in P. trichocarpa in the opposite scenario, may reflect two possibilities: i) response to different herbivores (Hollick and Gordon 1993), hence maintaining diverse alleles, or ii) presence of purifying selection (i.e., Ka/Ks < 1). With the exception of WIN3, all studied loci showed no evidence of adaptive evolution, which was also supported by the multilocus HKA test. The lack of purifying selection was consistent for most loci and also across species. This can be explained by, i) lower effective population size attributable to North American cottonwoods compared to European aspen (species with lower effective population size are expected to show lower constraints of purifying selection, EyreWalkert et al. 2002), and/or ii) the loci studied are evolving under no functional constraints despite the differences in demographic histories for the studied species. Sequence divergence in Populus The estimated time to mrca between the North American and Eurasian poplars obtained in the current study was ~4.5 Ma. This value falls within the range initially suggested as the time of divergence between P. tremula and P. trichocarpa (3.8-6.2 Ma, Ingvarsson 2005). However, it was nearer the lower end of the estimated time when Populus emerged as a genus (5-10 Ma, Tuskan et al. 2006). As expected, the two North American species shared a recent common ancestry with estimated time ranging between 0.76-0.83 Ma (depending on the molecular clock 95  model assumed).  While, P. tremula showed a higher substitution per million years (0.02),  yielding an estimate of 2 x 10 -8 substitutions per site per year; the North American species had five-fold lower estimates (0.4 x 10-8). The lower substitution rate observed for the North American species compared to P. tremula is probably associated with the succession of glacial events (e.g., Pleistocene) in North America. During this time span, approximately half of North America was under the Laurentide ice sheet, which allowed fewer populations with lower genetic variability to survive (Comes and Kadereit 1998). This was reflected in P. balsamifera, where populations covering native range formed only three genetic groups (Keller et al. 2010) as compared to P. trichocarpa which appear to have expanded from two refugia (Ismail 2010).  Although the estimated substitution rate varied  between the North American and Eurasian Populus, the overall rate of nucleotide substitution per year across species was 0.5 x 10 -8. The synonymous substitution rate in Populus is thought to be 1/6th that of Arabidopsis (Tuskan et al. 2006). In the present study, the overall estimate of substitution rate (including synonymous and nonsynonymous sites) was only 1/3rd that of Arabidopsis (Koch et al. 2000), probably reflecting different substitution rates at nonsynonymous compared to synonymous sites. Linkage disequilibrium in Populus The LD decay observed in the present study is in sharp contrast to the previous reports for P. tremula (Ingvarsson 2005) and P. balsamifera (Olson et al. 2010). However, it was similar in P. trichocarpa (Gilchrist et al 2004, Ismail 2010). The rapid LD decay observed in North American species (r2 < 0.3 in < 400 bp) was comparable with other outcrossing species (Zea: GuilletClaude et al. 2004; Helianthus: Liu and Buker 2006; P. nigra: Chu et al. 2009). The disparity in LD decay observed for P. balsamifera (present study) compared to that reported by Olson et al. (2010) can be attributed to the loci surveyed. In our study a set of defence and stress response genes were used which might have undergone recombination resulting in rapid decay of LD. Similar observations of higher recombination events are reported for other disease resistance genes (Ellis et al. 2000, Rose et al. 2004). In contrast, the lack of LD decay observed in P. tremula was unexpected given the fact that this species has the higher effective population size and admixture compared to the North American species. Ingvarsson (2005) reported LD decay extended beyond 1 Kb in a single population of P. tremula, while for pooled data from several populations, LD decayed within 500 bp. So it is possible that the observed LD in the present 96  study for P. tremula is somewhat underestimated and longer fragments may be required for reasonable assessments of LD. 5.5 Conclusions Although P. balsamifera and P. trichocarpa are considered to be close relatives, the former showed greater nucleotide diversity than the latter. Similar divergence at synonymous and replacement sites was observed in the North American species. Consistent with other studies, P. tremula showed the highest nucleotide diversity which is likely attributable to admixture events and weak bottleneck effects. With the exception of the WIN3 locus in P. balsamifera, the studied loci did not deviate significantly from neutral expectations. These findings contribute to historical inferences regarding the genetic diversity between the two North American species and illustrate how different population history and life history traits can shape species genetic diversity despite sharing similar geo-climatic conditions. Broadly, the divergence between the two sections appears to be quite recent (5 Ma). However, the time to mrca in North Americas cottonwoods is more recent. LD decays within short distances and shows a similar magnitude in the North American species as compared to P. tremula, which did not show any decay with distance for the studied loci. This pattern may be associated with sampling schemes and the role of admixture in P. tremula lineages in Sweden, and calls for longer gene fragments for proper LD assessment.  97  Table 5.1 Geographic locations of Populus populations used in this study. Species  Population  P. trichocarpa  Chilliwack River West Klinakline River Dean River Nass River Taku River Cypress Hills Stettler Grand Prairie Whitehorse Denali National Park Svalöv Brunsberg Arjeplog  P. balsamifera  P. tremula  98  Latitude (°N) 49º 06´ 51º 26´ 52º 49´ 56º 34′ 58º 42´ 49º 04´ 52º 26´ 54º 45´ 60º 42´ 63º 39´ 56º 42´ 59º 37´ 66º 12´  Longitude (°W/°E) 121º 39´ 125º 37´ 126º 46´ 129º 49′ 133º 24´ 109º 28´ 112º 44´ 118º 53´ 135º 21´ 148º 51´ 13º 15´ 12º 57´ 18º 25´  Table 5.2 Primer sequences and annealing temperatures for nine candidate gene loci used in the study. Gene  Gene bank reference  LG Primer sequences (5'-3')  Ta  Product size (bp)  F: ATCGATGTCTTCGGTGA 45.0 474 R: AGAAGCTCTATCGGATGGTA F: CTTGACATTCAGGGCGAA TI-4 AY378089 IV 45.0 509 R: AACCACGAAAGGTGA F: CGATTTCTACGGTCGTGA WIN3 X15516 X 58.5 465 R: CGCATCCGGTTTAAACCTA F: ACTGCCATGATGAGCGAAGATG Dhn BU863852 IV 58.5 540 R: GGTGTGTACCTCAGCGGTCT X F: GATAGATTTGGAATTGTTGAGG Gapdh AJ843622 58.5 809 R: AAGCAATTCCAGCCTTGG F: TGGATTGCCATCAAATCTCA PAL EU603319 XVI 61.0 605 R: CTCTTGCGCTCTCAACCTCT X F: CGATTTCTACGGTCGTGA PHYB2 AF309807 65.5 797 R: CGCATCCGGTTTAAACCTA F: TAACATGGGAAGCCCATAGC GI BU833698 V 61.0 619 R: CTGAATGGGAAAAAGGGTCA F: CATTATCCGTGCCCAAAAGT PtCBF2 DQ354395 I 61.0 755 R: CACAACGACCAATCAGCATC TI-3, TI-4, WIN3, Kunitz trypsin inhibitors; Dhn, dehydrine; Gapdh,Glyceraldehyde-3-phosphate dehydrogenase; TI-3  AY378088  XIX  PAL, Phenylalanine ammonia-lyase; PHYB2, phytochrome; GI, GIGANTIA; PtCBF2, C-repeat binding factor; Ta, annealing temperature (ºC).  99  Table 5.3 Summary of single nucleotide polymorphisms for nine studied loci in three Populus species. Number of genotypes  P. trichocarpa P. balsamifera P. tremula  TI-3 21 23 26  Gene fragment size (bp)  P. trichocarpa P. balsamifera P. tremula  443 451 453  TI-4 19 23 30  WIN3 19 25 12  Dhn 21 18 28  Gapdh 22 24 27  PAL 24 22 27  PHYB2 23 20 27  GI 20 21 -a  328 434 300  439 431 466  446 471 685  723 256 654  406 522 526  553 544 687  512 348 -a  PtCBF2 Average 4 19 23 22 a 25  SNP numbers  634 635 -a  498 455 539  Total  4484 4092 3771  P. trichocarpa 8 12 0 4 1 0 1 1 0 3 27 P. balsamifera 17 8 9 5 2 4 0 23 2 8 70 a a P. tremula 16 2 16 20 11 3 1 10 69 TI-3, TI-4, WIN3, Kunitz trypsin inhibitors; Dhn, dehydrin; Gapdh Glyceraldehyde-3-phosphate dehydrogenase; PAL, Phenylalanine ammonia-lyase; PHYB2, phytochrome; GI, GIGANTIA; PtCBF2, C-repeat binding factor, a Data not available.  100  Table 5.4 Summary of total nucleotide diversity (πT), and nucleotide diversity per site (θw) (x10-3) for nine studied loci in three Populus species. πT  θw  P. trichocarpa P. balsamifera P. tremula  P. trichocarpa P. balsamifera P. tremula a Data not available.  TI-3 8.70 8.81 8.31  TI-4 14.32 4.70 3.38  WIN3 0.00 4.42 13.09  Dhn 2.40 2.11 18.60  Gapdh 0.29 2.65 6.15  PAL 0.00 1.47 2.44  PHYB2 1.13 0.00 0.64  GI 0.19 23.22 -a  PTCBF2 0.00 0.64 -a  Average 3.00 5.34 7.52  4.43 9.02 8.22  14.65 4.21 1.43  0.00 4.67 9.76  2.23 3.73 11.22  0.32 1.79 3.74  0.00 0.17 0.12  0.54 0.00 0.32  0.46 15.96 -a  0.00 0.73 -a  2.51 4.48 4.97  101  Table 5.5 McDonald-Kreitman test (MK), neutrality index (NI), and Fay and Wu‟s H in seven loci in P. balsamifera using P. tremula as an out-group. Gene TI-3  Synonymous Fixed Poly 7 7  Replacement Fixed Poly 13 11  MK (P-value)  NI  HFay & Wu (P-value)  0.059 (0.830)  0.846  -3.532 (0.066)  TI-4  2  2  10  4  0.535 (0.920)  0.400  0.843 (0.985)  WIN3  12  3  32  6  0.123 (0.034)*  0.750  -2.743 (0.048)*  Dhn  0  0  1  2  -  -  -0.318 (0.206)  Gapdh  0  0  1  0  -  -  0.098 (0.311)  PAL  3  1  9  3  0.000 (0.465)  1.00  0.254 (0.465)  PHYB2 *P < 0.05  3  0  2  0  -  -  -  102  Table 5.6 Within species number of haplotypes (H) and haplotype diversity (Hd) for nine examined gene loci.  H  P. trichocarpa P. balsamifera P. tremula  TI-3 14 31 13  Hd  P. trichocarpa P. balsamifera P. tremula  0.879 0.965 0.851  TI-4 9 9 4  WIN3 1 10 7  Dhn 7 5 36  Gapdh 2 3 16  PAL 1 3 5  PHYB2 2 1 2  GI 2 22 -  PtCBF2 1 2 -  Average  0.421 0.863 0.666  0.000 0.728 0.826  0.722 0.535 0.975  0.206 0.577 0.902  0.000 0.545 0.728  0.476 0.000 0.440  0.097 0.899 -  0.000 0.198 -  0.31 0.59 0.77  103  4.33 9.56 11.86  Total 39 86 83  Table 5.7 McDonald Kreitman test (MK), neutrality index (NI), and Fay and Wu‟s H in seven gene loci in P. trichocarpa using P. tremula as an out-group. Gene TI-3 TI-4 WIN3 Dhn Gapdh PAL PHYB2  Synonymous Fixed Poly 6 2 3 5 9 0 0 0 1 0 1 0 0 0  Replacement Fixed Poly 14 5 1 6 38 0 1 0 0 1 6 0 3 1  104  MK (P-value)  NI  HFay & Wu (P-value)  0.164 (0.685) 0.186 (0.666) -  1.071 3.600  -0.576 (0.250) 0.603 (0.460) -0.336 (0.100)  Figure 5.1 Synonymous (Ks) and nonsynonymous divergence (Ka) for seven loci in three Populus species.  105  Figure 5.2 Decay of linkage disequilibrium in three Populus species based on nonlinear regression of squared allele frequency (r2) versus distance (bp) using equation (1).  106  Chapter 6. Thesis Conclusions 6.1 Introduction Postpone the anatomy of summer, as The physical pine, the metaphysical pine. Let‟s see the very thing and nothing else. Let‟s see it with the hottest fore of sight. Burn everything not part of it to ash. extracted from Credences of Summer by Wallace Stevens (1947)7  According to Nicholas Battey (2003), through this poem and its reference to lammas growth, the poet, Wallace Stevens, indicates his “belief that life is lived in the mind; and that with age and experience this tendency becomes ever more pronounced.” Stevens also believed that plants should be appreciated as things in themselves. The poem credits pines with the ability, or the wantonness, to enjoy the summer while it lasts, without regard for the future. Battey notes that a tendency for lammas growth declines with tree age and suggests that the decline may result from experience, reflecting progressive “intelligent adaptation” during the life of a “learning tree”. To distinguish intelligent adaptation (the ability to acclimate to environment) from developmental pre-programming (genetically fixed) one needs to observe variation with individual history. This becomes possible with replicated common gardens. Intelligent adaptation, as suggested by behavioral or phenotypic plasticity, should result in increased fitness in challenging environmental situations (Trewavas 2002). There are, however, limits to how much acclimation is possible. 6.2 Phenology matters, a lot If climate change exceeds the plastic limits of forest trees their populations must then either adapt or migrate, or face extinction (Aitken et al. 2008). The annual life history characteristics of a species have evolved through natural selection to match the seasonal progression of environmental conditions through phenology (Futuyma 1998).  Phenological observation of  seasonally recurrent events can provide insight into species responses to anticipated climate change. Many such events, in both plants and animals, are controlled by photoperiod (Withrow 7  Stevens W (1955). The collected poems of Wallace Stevens. Copyright 1954 by Wallace Stevens and renewed 1982 by Holly Stevens. Used by permission of Alfred A. Knopf, a division of Random House, Inc. Published by permission of Faber & Faber Ltd., London. 107  1959). Brayshaw and Holzapfel (2008) have emphasized the role of photoperiodism and the timing of seasonal life histories in dictating genetic responses to climate. Results from my study with range-wide P. balsamifera populations grown in two common gardens with similar photoperiod regimes reveal a counterintuitive phenology-driven tree growth response to an extended growing period.  Temperature increase has a strong effect on bud burst and leaf unfolding date. We observed both events occurring well in advance at Vancouver in comparison to the Indian Head common garden.  Similar observations of temperature sensitivity towards spring bud burst and leaf  unfolding have been reported for several tree species (Sogaard et al. 2008, Vitasse et al. 2009). There are many models that can predict spring phenological events with reasonable accuracy based on heat sums and variously modified for particular situations (e.g., the prequisite for adequate winter chilling). The situation for height growth cessation, bud set and dormancy induction, and for leaf senescence, is less straightforward. For these events there is a general understanding that photoperiod (both the length and direction of change) is a kind of a “master controller” modified by temporal growth conditions (temperature, drought and nutrition). A role for leaf or shoot age is often implied but, again, as a modifier, and not as a prerequisite for photoperiodic competency. This is strange given the long established concept of “competency to respond” in the flowering literature (McDaniel et al. 1992). It is also obvious that a newly flushing shoot does not immediately respond to photoperiod for purposes of controlling vegetative growth (shoots can be “forced” in complete darkness), but the actual onset of the competency to do so seems totally ignored. This oversight may underlie some of the apparent variation in environmental cueing of fall phenology (and its subsequent interpretation) in northern hardwoods.  As explained in Chapter 2, by the time spring temperatures are permissive for growth at high latitudes, or for that matter, anywhere in Canada, it makes little difference what the day-length is or what direction it is changing because it exceeds the local critical photoperiod for height growth cessation. As explained in Figure 6.1, the time it takes to reach competency prevents premature bud set in unusually warm springs, and lammas growth can provide a further margin of safety. Climate change projected within just a few decades, however, may push even these limits and native trees may fail to utilize the best part of growing season. As a response to critical photoperiod, I observed strong clines for bud set in both common gardens among 108  Figure 6.1 Expected effects of an early spring on bud phenology at Fort McMurray (56.56°N). The length of day (h) at this location is plotted (solid green line) as a function of time of year (solar days). The dotted green line is the maximum day length on June 21 (solar day 183). The purple band represents the critical photoperiod (~15.30h) for the induction of height growth cessation (denoted by green arrow) in typical Fort McMurray genotypes of native balsam poplar. Spring flush coincides with the accumulation of ~80 degree-days (>5ºC) which, based on 1970-2000 Climate Normals, is achieved on average on May 6 (solar day 136; dashed blue line). Currently, leaf flush varies by up to 2 weeks on either side of this date, depending on the year. If competency is achieved after 35 days growth, then shoots will be responsive to photoperiod beginning June 10 (solar day 171, again ±2 weeks). Growth continues until the critical photoperiod is encountered near August 2 (solar day 232), and normal bud set occurs 4 days later (green arrow). With climate warming, if mean dates of spring flush advance by 4 weeks (red dashed line), then shoots become responsive to photoperiod beginning May 13 (solar day 143). This date is still safe as the photoperiod by this time is longer than critical. In a warm year, however, many trees may end up on the wrong side of this threshold and suffer pre-mature height growth cessation and spring bud set (red arrow). They may recover growth by lammasing. If mean dates of spring flush are advanced by 6 weeks (not shown), then most trees will be caught in most years, with many individuals entering dormancy and failing to even lammas.  109  AgCanBaP collections.  Evidence for such clines with latitude of origin was observed in  numerous gymnosperm tree species (Cannell and Willet 1975). However, mean bud set was early in the Vancouver common garden as shoots attain competency far too early. There was a strong pattern whereby plants either made it through the solstice to set bud at a more-or-less normal date, or they were “caught” on it. Leaf senescence, which requires shorter days than height growth cessation for all genotypes, was more coincident in both gardens. Not reported in Chapter 2 was the extreme behavior seen most recently, in spring 2010. Because of a very mild winter in Vancouver, flushing was considerably advanced and almost all genotypes set bud before the end of April (even those from southern latitudes). It was also a warm spring at Indian Head, and unlike in previous years, bud set was observed prior to the solstice in the most northerly genotypes, approximately 42 days after they flushed.  This period of growth is  comparable to the 39 days required to see bud set under chamber conditions (Chapter 2). In Vancouver, competency for leaf senescence was achieved in early May, and for high latitude genotypes the days were still short enough to trigger leaf senescence and abscission, four months earlier than previously observed. This response was stronger in genotypes from the northwest portion of the species range than in those from subarctic eastern Canada (Fig. 6.2), presumably because the latter have a shorter critical photoperiod for leaf senescence at their lower latitude.  Figure 6.2 Example of unusually early leaf senescence in northwestern P. balsamifera genotypes in 2010. The photo on the left (a) was taken May 11th 2010, while the photo on the right (b), of the same two plants, was taken July 8th 2010. The plant in the foreground is from Fairbanks (64.9 °N); the plant in the background is from Labrador City (52.9 °N).  110  Longer growing seasons as a result of increases in temperature both in spring (1.1°C) and autumn (0.8°C) over northern latitudes have already led to a lengthening of the green-cover period (Mitchell and Jones 2005). A longer growing season should boost net carbon fixation and overall tree growth. My work suggests, however, that extreme warming could reduce production because of extreme effects on tree phenology.  Although moderate warming may enhance  growth, it may still have unexpected impacts on shoot-to-root carbon partitioning at both tree and ecosystem levels. These effects are likely to be different for trees of deciduous vs evergreen habit. In deciduous boreal trees, such as balsam poplar, the leaves will senesce on schedule regardless of the weather, whereas evergreens may continue to fix carbon as long as the season permits. I defined the GCP ratio as the period (in days) available for photosynthesis after bud set relative to the total available for the entire year. This ratio may not change at any particular location if spring and autumn are extended equally relative to the date of bud set. If these effects are unequal, as must be the case for deciduous trees with fixed critical photoperiods for bud set and leaf senescence, then carbon partitioning will be affected. For such trees, a warming climate extends the spring but not the autumn, and so should lead to a lower root:shoot ratio. If climate warms to the point where there is premature bud set, then the trend in carbon partitioning should be dramatically reversed, as observed in the Vancouver common garden. In all cases, a longer and warmer autumn, with or without an extended season for photosynthesis, promotes carbon loss through respiration.  My results also have important implications for human-assisted migration as a climate adaptation scenario. For trees moved from low to high latitude, without a change in climate, the GCP ratio should decrease, leading to lower root:shoot ratios. As discussed in Chapter 2, it is possible that undesirable effects on R:S ratio or other manifestations of phenological mismatch might be avoided by moving photoperiodically appropriate genotypes along climate clines that have an east-west or elevational orientation.  Changes in carbon partitioning to root growth imply changes in partitioning to mycorrhizal fungi and other soil microbes. Apart from the effects of ecosystem C cycling, changes in R:S ratio might also influence water-use efficiency and drought tolerance. At this point, I do not have tangible data to support this argument. Generally speaking, an increase in R:S ratio in turn helps to harvest water from a greater relative volume of soil. Although extreme climate warming could severely impact tree growth and competitive ability because of premature bud set, it might 111  also promote survival during late summer drought if trees can avoid xylem cavitation as result of higher R:S ratio. On the other hand, over-aged leaves (as a result of early spring and a lack of neo-formed leaves after the solstice) may be more susceptible to disease (e.g., leaf rust) and insect pests. Acquiring better understanding of drought tolerance, disease and pest occurrence with advanced springs must be a research priority with any lengthening of the green-cover period. 6.3 Photosynthesis matters, a little A clear demonstration of the overwhelming importance of phenology in determining annual growth rate in trees adapted to different growing season lengths is obtained from their response to unconstrained conditions.  In Chapter 3, I examined variation in height increment and  ecophysiological traits in a range-wide collection of balsam poplar populations from 21 provenances.  Rooted cuttings, maintained without resource (photoperiod, water, nutrition)  limitation in a greenhouse for 90 days, displayed increasing height growth, photosynthetic rates, leaf mass per area (LMA), and leaf N per area with latitude while stomatal conductance (gs) showed no pattern.  Such observations among high-latitude deciduous trees, whereby they  display higher photosynthetic rates, are likely to be related to selection stemming from restrictions on growing season length (Benowicz et al. 2000, Gornall and Guy 2007). Biochemical (thylakoid membrane, enzyme activities) and biophysical (stomatal aperture, cell wall thickness, leaf density) properties differentially affect photosynthetic rates in different environments (Sharkey et al. 2007). Higher photosynthesis was associated with higher leaf N (implying greater enzyme activity), lower PNUE and higher WUE (and  13  C) in northern  genotypes. This is consistent with previous work describing in situ variation in  13  C with  latitude and altitude in Douglas-fir (Zhang et al. 1993). Although stomatal properties of balsam poplar did not show clinal variation, analysis of A-Ci curves for a subset of AgCanBaP populations showed that high-latitude genotypes had greater mesophyll conductance (gm) than low-latitude genotypes. To the best of my knowledge, this is the first demonstration of withinspecies variation in gm in an adaptive context. Improvements in gm should simultaneously enhance WUE and PNUE without trade-off, and so are of particular interest in breeding trees for resistance to the combined stresses of water and nitrogen limitation. This however, warrants investigation as, the observed differences in gm are probably linked to parallel differences in LMA and the amount of mesophyll cell wall area available for CO2 dissolution.  112  Based on data in Chapters 2 and 3, narrow-sense heritability (h 2) was very high (>0.7) for height increment and date of bud set, followed by LMA (Keller et al., in prep.). h  2  was much lower  (<0.3) for photosynthetic rate and leaf N, but still significant (P = 0.5). h 2 did not differ from zero for date of bud flush, WUE,  13  C, gs or stomatal density.  Looking at global patterns of Populus trait physiology in Chapter 4, I conclude that latitudinal clines in photosynthetic rates do exist among allopatric species adapted to similar environments on both sides of the Atlantic. However, the underlying physiological mechanisms responsible for higher photosynthetic rates appear to be different across species - a case of convergent evolution to achieve the same objective. By doing so, I also highlight a shortcoming of common garden experiments for purposes of tree improvement, as high-latitude populations accomplish less height growth primarily as a result of early bud set, and not because of any inherent lack of the capacity for growth. This conclusion is also consistent with the observations of Pointeau (2008) who found similar mean productivity in balsam poplar and black cottonwood when the two species were grown together without photoperiodic limitation in the greenhouse. In contrast, individual tree-to-tree (i.e., within population) differences in growth rate were substantial. 6.4 Variation behind the scene - comparative nucleotide diversity In many treatments, balsam poplar and black cottonwood are considered to be subspecies of a single species (Brayshaw 1965, Eckenwalder 1984).  They have few distinguishing  characteristics and hybridize extensively where their natural ranges overlap along the Rocky Mountains (Farrar 1995). Carpel number per pistil (2 vs. 3, respectively) is the only reliable morphological trait on which they can be separated. As shown in Chapter 5, there are high sequence similarities between the two species as a result of shared ancestral polymorphisms which diverged very recently (~0.8 Ma ago), but there are also contrasting patterns of nucleotide diversity. Balsam poplar has two-fold higher genetic variability for the studied loci compared to black cottonwood. Keller et al. (2010) provided evidence of post-glacial range expansion in balsam poplar towards the northwest and to the east from a central North American region (or deme) which presently harbors the highest amount of genetic diversity. Four out of the five balsam poplar populations analyzed in Chapter 5 come from this central deme. Based on his studies of 38 populations of black cottonwood from British Columbia, Canada, Ismail (2010) suggested that the lower genetic diversity in black cottonwood is a result of bottleneck events, with the species having origins from two major glacial refugia. 113  Consistent with Ingvarsson (2005, 2008), we found that European aspen has a higher nucleotide diversity than the North American cottonwoods. This may be due to high admixture in aspen with other related species in Europe (Lexer et al. 2005). In contrast to previous reports, we observed no decay in linkage disequilibrium (LD) in European aspen; while in the North American species LD declined within 400bp. The two sections, Populus and Tacamahaca, appear to have diverged ~5 Ma ago (Chapter 5).  6.5 Limitations of present work This study makes use of very good representation of native wild Populus germplasm from different latitudes and longitudes to address the questions from Chapter 1. Still, the study does have its limitations.  First of all, the common gardens used for purposes of addressing climate driven phenological plasticity are located at southern latitudes; where photoperiod is always below critical for most of the northern populations. It would be worthwhile to establish several common gardens at various latitudes (to cover different photoperiod regimes) and longitudes (to cover different growing season lengths). Originally, a third common garden using the same subset of the AgCanBaP collection was attempted at Love, Saskatchewan (53.63 °N), but it was not well tended and many trees died.  Recently, in collaboration with Matt Olson, University of  Fairbanks, a fourth common garden was established at Fairbanks, Alaska (64.90 °N). In coming years the AESB-AAFC plans to put together at least one more common garden in eastern Canada, to get a very concrete idea on the extent of plasticity in phenology traits.  A second shortcoming might have been the choice of European aspen instead of its close relative, the North American trembling aspen (P. tremuloides Michx.). Trembling aspen is sympatric with both balsam poplar and black cottonwood, and for this reason it might have been more appropriate, but a suitable common garden collection was simply not available.  Last, for purposes of comparative studies, a thorough assessment should include populations from throughout each species range. Only a very narrow range of P. tremula native to Sweden was available. Efforts should be made to include more populations from the southern and eastern range of this species, which extends far beyond Sweden. Similarly, for Chapter 5, almost 114  the entire species range of black cottonwood was represented, while for balsam poplar, only the western part of its range along the Rocky Mountains of Canada was sampled.  6.6 Future research Arising from my thesis are several thought-provoking questions that pave the way for future research.  Do similar latitudinal patterns in physiological traits exist in other tree species? Are these patterns comparable in nature? High latitude genotypes of both balsam poplar (Soolanayakanahally et al. 2009) and black cottonwood (Gornall and Guy 2007) achieve higher photosynthetic rates partly via an increase in leaf conductance, but at different locations in the diffusion pathway (gm in the former and gs in the latter). Because WUE is differentially affected, it may be that increased gs is the better “choice” where water is less likely to be limiting (e.g., temperate rainforest), while enhanced gm is better where water is more likely to be limiting (e.g., the continental interior). It will be worthwhile to look at this adaptation between coastal and inland populations in a species like paper birch (Betula papyrifera Marsh.) that has a natural range spreading across the continent on either side of the Rockies. What is the “missing link”? Wright et al. (2004) emphasized that LMA increases with leaf lifespan across species and biomes. These authors did not know what exactly accounted for this general pattern and so referred to it as the “missing link”. In contrast to their higher scale meta analysis, I found quite the opposite pattern working within a species, in that high-latitude balsam poplar populations had higher LMA despite shorter growing seasons (i.e., shorter leaf lifespan). It would be helpful to pinpoint what difference in leaf anatomy accounts for clinal variation in LMA in both cases. Possibilities include differences in leaf thickness, cell wall toughness (and nitrogen investment therein), leaf cell density, etc.  What accounts for genetic variation in internal conductance? Related to the above, I do not know at this point the physiological basis of observed differences in gm among AgCanBaP populations. The observed parallel changes in leaf anatomy may be 115  responsible, but there are other possibilities.  Future studies looking at gm must include  measurement of mesophyll cell volume, cell wall area and wall thickness.  In addition,  chloroplast movements and cyclosis (cytoplasmic streaming) influence CO 2 movement towards the sites of fixation at Rubisco. The role of aquaporins in controlling membrane permeability to CO2 needs deeper understanding (Evans et al. 2009).  Is there clinal variation in the capacity for diurnal cycling of starch reserves? Plant leaves accumulate starch during day to support carbon export and growth at night. Graf et al. (2010) showed the circadian control of starch degradation during night to maintain productivity while avoiding starch starvation. If this is true, then it‟s possible that high-latitude genotypes may be predisposed to accumulate less starch during the day compared to low-latitude genotypes. Lower intrinsic growth rates in low-latitude genotypes could be linked to their need to conserve starch for use during longer nights. Likewise, high latitude genotypes may not accumulate enough starch to thrive through a longer night (i.e., starch starvation), contributing to growth cessation. In addition to what Graf et al. (2010) have concluded, I think it‟s also very important to know how plants sense the starch content (internal signal) and the duration of night length (external signal) to “decide” the appropriate rate of starch degradation.  Diurnal  metabolite profiles of AgCanBaP populations during active growth and in response to variation in photoperiod (Hoffman et al. 2010) will improve our understanding of plant adaptation to high latitude environments.  Can intrinsic growth potential be uncoupled from phenology in intra-specific hybrids of balsam poplar? My findings (Soolanayakanahally et al. 2009) show northern provenances possess higher photosynthetic rates and shorter leaf area duration while southern provenances have lower photosynthetic rates and longer leaf area duration (LAD). The trade-off between photosynthetic rate and LAD might suggest that these two traits are incompatible. However, if there are no intrinsic physiological constraints that prevent a combination of high photosynthetic rate and long LAD, then such a combination to yield greater biomass accumulation should be possible through artificial breeding of northern and southern genotypes. Likewise, different combinations of critical photoperiods for height growth cessation vs. leaf drop, or heat sum requirements for bud break, might also be generated. Work in this direction is already in motion and the testing  116  these intra-specific hybrids in multi-location trials will help in the selection of superior clones for different locations that can adapt well to anticipated future climates. What genes are associated with clinal variation in balsam poplar phenology? Classical studies have revealed that photoperiod is the primary environmental cue that triggers growth cessation in trees at high latitudes (Pauley and Perry 1954). Many of the circadian clock genes involved in photoperiodic response in Arabidopsis have been identified to have similar function in Populus (Bohlenius et al. 2006). Association mapping of molecular genetic variants in circadian clock genes with phenological traits could assist the AESB-AAFC poplar breeding program. Work in this regard is in progress in balsam poplar involving several collaborators to associate single nucleotide polymorphisms with phenotypic traits like growth cessation and bud set, leading into dormancy. Parallel association genetics studies are also being conducted in other Populus species such as black cottonwood and European aspen, setting the stage for comparative-genomic research. Is variation observed at the phenotypic level due to genetic variation alone? Throughout this thesis I have made the implicit assumption that observed differences in phenotype are caused by differences in genotype, or, at least, the environment interacting with the genotype.  Lately it has become apparent that some “heritable” variation in plants is  environmental in origin.  For example, Johnsen et al. (2005a, b) have shown that that  environmental experience of a mother plant can be expressed in the behavior of its offspring, independent of its genetic origins. These observations imply a degree of epigenetic control over photoperiodic adaptation. Depending on its stability over time (years, decades?), the epigenetic control of phenology “passed down” through stem cuttings could increase apparent variation between populations of different origin. Likewise, epigenetic control of bud set could mask larger underlying genetic variation within populations (Henderson and Jacobsen 2007). Phenological observations in the common gardens established for this thesis should continue for a number of years with the aim of identifying a possible convergence of behavior indicative of the remarkable “learning tree” imagined by Wallace Stevens.  117  References Aerts R and Chapin FS III. (2000). The mineral nutrition of wild plants revisited: a re-evaluation of processes and patterns. Advances in Ecological Research 30: 1-67. Ager AA, Heilman PE and Stettler RF (1993). Genetic variation in red alder (Alnus rubra) in relation to climate and geography. Canadian Journal of Forest Research 23: 1930-1939. Aitken SN, Yeaman S, Holliday JS et al. (2008). Adaptation, migration or extirpation: climate change outcomes for tree populations. Evolutionary Applications 1: 95-111. Akaike H (1974). A new look at the statistical model identification. IEEE Trans Autom Control 19: 716-723. Anderson JE, Williams J, Kriedemann PE et al. (1996). Correlations between carbon isotope discrimination and climate of native habitats for diverse eucalypt taxa growing in a common garden. Australian Journal of Plant Physiology 23: 311-320. Auge GA, Perelman S, Crocco CD et al. (2009). Gene expression analysis of light-modulated germination in tomato seeds. New Phytologist 183: 301-314. Barbour MM, Warren CR, Farquhar GD et al. (2010). Variability in mesophyll conductance between barley genotypes, and effects on transpiration efficiency and carbon isotope discrimination. Plant, Cell and Environment 33: 1176-1185. Battistuzzi FU, Filipski A, Hedges SB et al. (2010). Performance of relaxed clock methods in estimating evolutionary divergence times and their credibility intervals. Molecular Biology and Evolution doi:10.1093/molbev/msq014. Benedict C, Skinner JS, Meng R et al. (2006). The CBF1- dependent low temperature signalling pathway, regulon, and increase in freeze tolerance are conserved in Populus spp. Plant, Cell and Environment 29: 1259-1272. Benowicz A, El-Kassaby YA, Guy RD et al. (2000a). Sitka alder (Alnus sinuata Rydb.) genetic diversity in germination, frost hardiness and growth attributes. Silvae Genetica 49: 206212. Benowicz A, Guy RD and El-Kassaby YA (2000b). Geographic pattern of genetic variation in photosynthetic capacity and growth in two hardwood species from British Columbia. Oecologia 123: 168-174. Benowicz A, Guy RD, Carlson MR et al. (2001). Genetic variation among paper birch (Betula papyrifera Marsh.) populations in germination, frost hardiness, gas exchange and growth. Silvae Genetica 50: 7-13. Billings WD, Godfrey PJ, Chabot BF et al. (1971). Metabolic acclimation to temperature in arctic and alpine ecotypes of Oxyria digyna. Arctic and Alpine Research 3: 277-289. Böhlenius H, Huang T, Charbonnel-Campaa L et al. (2006). CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312: 1040-1043. Bradshaw WE and Holzapfel CM (2001). Genetic shift in photoperiodic response correlated with global warming. Proceedings of the National Academy of Sciences of the United States of America 98: 14509-14511. Bradshaw WE and Holzapfel CM (2008). Genetic response to rapid climate change: it‟s seasonal timing that matters. Molecular Ecology 17: 157-166.  118  Brayshaw TC (1965). The status of the black cottonwood (Populus trichocarpa Torr. & Gray). Canadian Field-Naturalist 79: 91-95. Breen AL, Gelnn E, Yeager A et al. (2009). Nucleotide diversity among natural populations of a North American poplar (Populus balsamifera, Salicaceae). New Phytologist 182: 763773. Brumfield RT, Beerli P, Nickerson DA et al. (2003). The utility of single nucleotide polymorphisms in inferences of population history. Trends in Ecology and Evolution 18: 249-256. Buck AL (1981). New calculations for computing vapor pressure and enhancement factor. Journal of Applied Meteorology 20: 1527-1532. Campos J, Freitas V, Pedrosa C et al. (2009). Latitudinal variation in growth of Crangon crangon (L.): Does counter-gradient growth compensation occur? Journal of Sea Research 62: 229-237. Cannell MGR and Willet SC (1975). Rates and times at which needles are initiated in buds on differing provenances of Pinus contorta and Picea sitchensis in Scotland. Canadian Journal of Forest Research 5: 367-380. Cannell MGR and Willett SC (1976). Shoot growth phenology, dry matter distribution and root:shoot ratios of provenances of Populus trichocarpa, Picea sitchensis and Pinus contorta growing in Scotland. Silvae Genetica 25: 49-59. Cervera MT, Storme V, Soto A et al. (2005). Intraspecific and interspecific genetic and phylogenetic relationships in the genus Populus based on AFLP markers. Theoretical Applied Genetics 111: 1440-1456. Ceulemans R, Scarascia Mugnozza GT, Wiard BM et al. (1992). Production physiology and morphology of Populus species and their hybrids grown under short rotation. I. Clonal comparisons of 4-year growth and phenology. Canadian Journal of Forest Research 22: 1937-1948. Chapin FS III and Chapin MC (1981). Ecotypic differentiation of growth processes in Carex aquatilis along latitudinal and local gradients. Ecology 62: 1000-1009. Chu Y, Su X, Huang Q et al. (2009). Patterns of DNA sequence variation at candidate gene loci in black poplar (Populus nigra L.) as revealed by single nucleotide polymorphisms. Genetica 137: 141-150. Cleland EE, Chuine I and Menzel A et al. (2007). Shifting plant phenology in response to global change. Trends in Ecology and Evolution 22: 357-365. Comes HP and Kadereit W (1998). The effect of Quaternary climatic changes on plant distribution and evolution. Trends in Plant Science 3: 432-438. Comstock JP (2002). Hydraulic and chemical signaling in the control of stomatal conductance and transpiration. Journal of Experimental Botany 53: 195-200. Condon AG, Farquhar GD and Richard RA (1990). Genotypic variation in carbon isotope discrimination and transpiration efficiency in wheat. Leaf gas exchange and whole plant studies. Australian Journal of Plant Physiology 17: 9-22. Conover DO and Present TMC (1990). Countergradient variation in growth rate: compensation for length of the growing season among Atlantic silversides from different latitudes. Oecologia 83: 316–324. 119  Conover DO and Schultz ET (1997). Natural selection and the evolution of growth rate in the early life history: What are the trade-offs? Pp. 305–332 in Chambers RC and Trippel EA, eds. Early Life History and Recruitment in Fish Populations. Chapman and Hall, London. Crawford RMM, Chapman HM and Smith LC (1995). Adaptation to variation in growing season length in arctic populations of Saxifraga oppositifolia L. Botanical Journal of Scotland 47: 177-192. Dang QL, Xie CY, Ying C et al. (1994). Genetic variation of ecophysiological traits in red alder (Alnus rubra Bong.). Canadian Journal of Forest Research 24: 2150-2156. Dawson TE, Mambelli S, Plamboeck AH et al. (2002). Stable isotopes in plant ecology. Annual Review of Ecology and Systematics 33: 507-559. Diemer M (1998). Life span and dynamics of leaves of herbaceous perennials in high elevation environments: “news from the elephant‟s leg”. Functional Ecology 12: 413-425. Donovan LA and Ehleringer JR (1994). Carbon isotope discrimination, water-use efficiency, growth and mortality in a natural shrub population. Oecologia 100: 347-354. Doyle JJ and Doyle JL (1987). A rapid DNA isolation procedure from small quantities of fresh leaf tissues. Photochemical Bulletin 19: 11-15. Drummond AJ and Rambaut A (2007). BEAST. Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214-221. Eckenwalder JE (1977). North American cottonwoods (Populus, Salicaceae) of sections Abaso and Aigeiros. Journal of Arnold Arboretum 58: 193-208. Eckenwalder JE (1984). Natural intersectional hybridization between North American species of Populus (Salicaceae) in sections Aigerios and Tacamahaca. II. Taxonomy. Canadian Journal of Botany 62: 325-335. Eckenwalder JE (1996). Systematics and evolution of Populus. pp 7-32 in Stettler RF, Bradshaw HD Jr., Heilman PE, et al. (eds). Biology of Populus and its implications for management and conservation. NRC Research Press, Ottawa, Ontario, Canada. Ekberg I, Eriksson G and Dormling I (1979). Photoperiodic reactions in conifer species. Holarctic Ecology 2: 255-263. Ellis J, Dodds P and Pryor T (2000). Structure, function and evolution of plant disease resistance genes. Current Opinion in Plant Biology 3: 278-284. Endler JA (1973) Gene flow and population differentiation. Science 179: 243-250. Evans JR (1989). Photosynthesis and nitrogen relationships in leaves of C 3 plants. Oecologia 78: 9-19. Evans JR and Vellen L (1996). Wheat cultivars differ in transpiration efficiency and CO 2 diffusion inside their leaves. In Crop Research in Asia: Achievements and Perspective 9eds R. Ishii & T. Horie), Japan. pp. 326-329. Evans JR and von Caemmerer S (1996). Carbon dioxide diffusion inside leaves. Plant Physiology 110: 339-346. Evans JR, Kaldenhoff R, Genty B et al. (2009). Resistances along the CO2 diffusion pathway inside leaves. Journal of Experimental Botany 60: 2235–2248. Ewing B and Green P (1998). Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Research 8: 186-194. 120  Eyre-Walker A, Keightley PD, Smith NGC et al. (2002). Quantifying the slightly deleterious mutation model of molecular evolution. Molecular Biology and Evolution 19: 2142-2149. Farmer RE Jr. (1993). Latitudinal variation in height and phenology of balsam poplar. Silvae Genetica 42: 148-153. Farquhar GD, Ball MC, Von Caemmerer S et al. (1982). Effect of salinity and humidity on δ 13C value of halophytes: Evidence for diffusional isotope fractionation determined by the ratio of intercellular/atmospheric partial pressure of CO2 under different environmental conditions. Oecologia 58: 121-124. Farquhar GD, O'Leary MH and Berry JA (1982). On the relationship between carbon isotope discrimination and the intercellular carbon dioxide concentration in leaves. Australian Journal of Plant Physiology 9: 121-137. Farquhar GD, Hubick KT, Condon AG et al. (1988). Carbon-isotope fractionation and plant water use efficiency. In: Stable Isotopes in Ecological Research (eds. P.W. Rundel, J.R. Ehleringer and K.A. Nagy). Springer-Verlag, New York. pp. 21-40. Farquhar GD, Ehleringer JR and Hubick KT (1989). Carbon isotope discrimination and photosynthesis. Annual Review of Plant Physiology and Plant Molecular Biology 40: 503537. Farrar JL (1995). Trees in Canada. Fitzhenry and Whiteside Ltd., Markham ON. Fay J and Wu C-I (2000). Hitchhiking under positive Darwinian selection. Genetics 155: 14051413. Field C, Merino J and Mooney HA (1983). Compromises between water-use efficiency and nitrogen-use efficiency in five species of California evergreens. Oecologia 60: 384-389. Flexas J, Ribas-Carbó M, Hanson DT et al. (2006). Tobacco aquaporin NtAQP1 is involved in mesophyll conductance to CO2 in vivo. Plant Journal 48: 427-439. Flexas J, Ribas-Carbó M, Diaz-Espejo A et al. (2008). Mesophyll conductance to CO2: current knowledge and future prospects. Plant Cell and Environment 31: 602-621. Fracheboud Y, Luquez V, Björkén L et al. (2009). The control of autumn senescence in European aspens (Populus tremula). Plant Physiology 149: 1982-1991. Futuyma DJ (1998). Evolutionary Biology (Sinauer Sunderland, MA). Geber MA and Dawson TE (1997). Genetic variation in stomatal and biochemical limitations to photosynthesis in the annual plant, Polygonum arenastrum. Oecologia 109: 535-546. Gilchrist EJ, Haughn GW, Ying CC et al. (2006). Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa. Molecular Ecology 15: 1367-1378. González-Martínez SC, Krutovsky KV and Neale DB (2006). Forest-tree population genomics and adaptive evolution. New Phytologist 170: 227-238. Gornall JL and Guy RD (2007). Geographic variation in ecophysiological traits of black cottonwood (Populus trichocarpa). Canadian Journal of Botany 85: 1202-1213. Gower ST, Reich PB and Son Y (1993). Canopy dynamics and above-ground production of five tree species with different leaf longevities. Tree Physiology 12: 327-345. Graf A, Schlereth A, Stitt M et al. (2010). Circadian control of carbohydrate availability for growth in Arabidopsis plants at night. Proceedings of the National Academy of Sciences of the United States of America 107: 9458-9463. 121  Guillet-Claude C, Birolleau-Touchard C, Manicacci P et al. (2004). Nucleotide diversity of the ZmPox3 maize peroxidase gene: Relationships between a MITE insertion in exon 2 and variation in forage maize digestibility. BMC Genetics doi:10.1186/1471-2156-5-19. Guy RD, Reid DM and Krouse HR (1986). Factors affecting δ 13C/12C ratios of inland halophytes. I. controlled studies on growth and isotopic composition of Puccinellia nuttalliana (Schultes) Hitch. Canadian Journal of Botany 64: 2693-2699. Guy RD, Warne PG and Reid DM (1988). Stable carbon isotope ratio as an index of water-use efficiency in C3 halophytes-possible relationship to strategies for osmotic adjustment. In: Stable Isotopes in Ecological Research (eds. P.W. Rundel, J.R. Ehleringer and K.A. Nagy). Springer-Verlag, New York. pp. 55-75. Guy RD and Holowachuk DL (2001). Population differences in stable carbon isotope ratio of Pinus contorta Dougl. ex Loud.: relationship to environment, climate of origin, and growth potential. Canadian Journal of Botany 79: 274-283. Hall D, Luquez V, St. Onge KR et al. (2007). Adaptive population differentiation in bud phenology across a latitudinal gradient in European aspen (Populus tremula L., Salicaeae): a comparison of neutral markers, candidate genes and quantitative traits. Evolution 61: 2849-2860. Hamzeh M and Dayanandan S (2004). Phylogeny of Populus (Salicaceae) based on nucleotide sequences of chloroplast TRNT-TRNF region and nuclear rDNA. American Journal of Botany 91: 1398-1408. Hamzeh M, Perinet P, and Dayanandan S (2006). Genetic relationships among species of Populus (Salicaceae) based on nuclear genomic data. Journal of Torrey Bot. Society 133: 519-527. Hardison RC (2003). Comparative genomics. PLoS Biology doi: 10.1371/journal.pbio.0000058. Hasegawa M, Kishino H and Yano T (1985). Dating the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174. Hedges SB and Kumar S (2003). Genomic clocks and evolutionary timescales. Trends in Genetics 19: 200-206. Heide OM (1974). Growth and dormancy in Norway spruce (Picea abies). I. Interaction of photoperiod and temperature. Physiologia Plantarum 30: 1-12. Henderson IR and Jacobsen SE (2007). Epigenetic inheritance in plants. Nature 447: 418-424. Hewitt G (2000). The genetic legacy of the Quaternary ice ages. Nature 405: 907-913. Hikosaka K, Hanba YT, Hirose T et al. (1998). Photosynthetic nitrogen-use efficiency in woody and herbaceous plants. Functional Ecology 12: 896-905. Hill WG and Weir BS (1988). Variances and covariances of squared linkage disequilibria in finite populations. Theoretical Population Biology 33: 54-78. Hirose T and Werger MJA (1987). Maximizing daily canopy photosynthesis with respect to the leaf nitrogen allocation pattern in the canopy. Oecologia 72: 520-526. Hoagland DR and Arnon DJ (1950). The water culture method for growing plants without soil. California Agriculture Experimental Station Circular No. 347: 1-32. Hobbie EA and Werner RA (2004). Intramolecular, compound-specific and bulk carbon isotope patterns in C3 and C4 plants: a review and synthesis. New Phytologist 161: 371-385. 122  Hoffman DE, Jonsson P, Bylesjö M et al. (2010). Changes in diurnal patterns within the Populus transcriptome and metabolome in response to photoperiod variation. Plant, Cell and Environment 33: 1298-1313. Hollick JB and Gordon MP (1993). A poplar tree proteinase inhibitor-like gene promoter is responsive to wounding in transgenic tobacco. Plant Molecular Biology 22: 561-572. Howe GT, Hackett WP, Furnier GR et al. (1995). Photoperiodic responses of a northern and southern ecotype of black cottonwood. Physiologia Plantarum 93: 695-708. Howe GT, Bucciaglia PA, Hackett WP et al. (1998). Evidence that the phytochrome gene family in black cottonwood has one PHYA locus and two PHYB loci but lacks members of the PHYC/F and PHYE subfamilies. Molecular Biology and Evolution 15: 160-175. Howe GT, Aitken SN, Neale DB et al. (2003). From genotype to phenotype: unraveling the complexities of cold adaptation in forest trees. Canadian Journal of Botany 81: 12471266. Huang T, Böhlenius H, Eriksson S et al. (2005). The mRNA of the Arabidopsis gene FT moves from the leaf to shoot apex and induces flowering. Science 309: 1694-1696. Hubick KT, Farquhar GD and Shorter R (1986). Correlation between water use efficiency and carbon isotope discrimination in diverse peanut germplasm. Australian Journal of Plant Physiology 13: 803-814. Hudson RR, Kreitman M and Aguade M (1987). A test of neutral molecular evolution based on nucleotide data. Genetics 116: 153-159. Hungate BA, Dukes JS, Shaw MR et al. (2003). Nitrogen and climate change. Science 302: 15121513. Ingvarsson PK (2005). Nucleotide polymorphism and linkage disequilibrium within and among natural populations of European aspen (Populus tremula L., Salicaceae). Genetics 169: 945-953. Ingvarsson PK, Garcia MV, Hall D et al. (2006). Clinal variation in phyB2, a candidate gene for day-length-induced growth cessation and bud set, across a latitudinal gradient in European aspen (Populus tremula). Genetics 172: 1845-1853. Ingvarsson PK (2008). Multilocus patterns of nucleotide polymorphism and the demographic history of Populus tremula. Genetics 180: 329-340. Ingvarsson PK (2010). Nucleotide polymorphism, linkage disequilibrium and complex trait dissection in Populus. pp 91-111 in Jansson S, Bhalerao R and Groover A (eds). Genetics and Genomics of Populus. DOI: 10.1007/978-1-4419-1541-2-5, Springer, New York. IPCC (2007). Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. S. Solomon et al., Eds. (Cambridge University Press, Cambridge and New York). Ismail M (2010). Molecular genetic diversity among natural populations of Populus. PhD Thesis. University of British Columbia, Canada. Jackson S, Rounsley S and Purugganan M (2006). Comparative Sequencing of Plant Genomes: Choices to Make. The Plant Cell 18: 1100-1104. James AC, Azevedo RBR and Partridge L (1995). Cellular basis and developmental timing in a size cline of Drosophila melanogaster. Genetics 140: 659-666.  123  Jansson S, Bhalerao R and Groover A (2010). Genetics and genomics of Populus, Plant genetics and genomics: Crops and Models 8, DOI 10.1007/978-1-4419-1541-2. Springer New York. Jianxin MA and Bennetzen JL (2004). Rapid recent growth and divergence of rice nuclear genomes. Proceedings of the National Academy of Sciences of the United States of America 101: 12404-12410. Johnsen KH, Seiler JR, Major JE (1996). Growth, shoot phenology and physiology of diverse seed sources of black spruce .2. 23-year-old field trees. Tree Physiology 16: 375-380. Johnsen Ø, Fossdal CG, Nagy N et al. (2005a). Climatic adaptation in Picea abies progenies is affected by the temperature during zygotic embryogenesis and seed maturation. Plant, Cell and Environment 28: 1090-1102. Johnsen Ø, Daehlen OG, Østreng G et al. (2005b). Daylength and temperature during seed production interactively affect adaptive performance of Picea abies progenies. New Phytologist 168: 589-596. Johnson DA and Tieszen LL (1976). Aboveground biomass allocation, leaf growth and photosynthetic patterns in tundra plant forms in arctic Alaska. Oecologia 24: 159-173. Jonas CS and Geber MA (1999). Variation among populations of Clarkia unguiculata (Onagraceae) along altitudinal and latitudinal gradients. American Journal of Botany 86: 333-343. Joseph JA and Lexer C (2008). A set of novel DNA polymorphisms within candidate genes potentially involved in ecological divergence between Populus alba and P. tremula, two hybridizing European forest trees. Molecular Ecology Notes 8: 188-192. Junttila O and Kaurin Å (1985). Climatic control of apical growth cessation in latitudinal ecotypes of Salix pentandra L.; Plant production in the north. Proceedings from 'Plant adaptation workshop', Tromso, Norway, 4-9 Sept. 1983. Norwegian University Press 8391. Junttila O and Skaret G (1990). Growth and survival of seedlings of various Picea species under northern climatic conditions. Scandinavian Journal of Forest Research 5: 69-81. Kawecki TJ and Ebert D (2004). Conceptual issues in local adaptation. Ecology Letters 7: 1225– 1241. Keller SR, Olson MS, Silim SN et al. (2010). Genomic diversity, population structure, and migration following rapid range expansion in the balsam Poplar, Populus balsamifera. Molecular Ecology 19: 1212-1226. Klaus Rohde (1996). Rapoport‟s rule is a local phenomenon and cannot explain latitudinal gradients in species diversity. Biodiversity Letters 3: 10-13. Koch MA, Haubold B and Mitchell-Olds T (2000). Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related genera (Brassicaceae). Molecular Biology Evolution 17: 14831498. Körner C and Basler D (2010). Phenology under global warming. Science 327: 1461-1462. Körner Ch and Renhardt U (1987). Dry matter partitioning and root length/leaf area ratios in herbaceous perennial plants with diverse altitudinal distribution. Oecologia 74: 411-418.  124  Kowalski SP, Lan TH, Feldmann KA et al. (1994). Comparative mapping of Arabidopsis thaliana and Brassica oleracea chromosomes reveals islands of conserved organization. Genetics 138: 499-510. Kozlowski TT and Pallardy SG (2002). Acclimation and adaptive responses of woody plants to environmental stresses. Botanical Review 68: 270-334. Kriebel HB (1957). Patterns of genetic variation in sugar maple. Ohio Agricultural Experimental Station Research Bulletin 791: 1-56. Kriebel HB and Wang CW (1962). The interaction between provenance and degree of chilling in bud-break of sugar maple. Silvae Genetica 11: 125-130. Lascoux M and Petit RJ (2010) The „New Wave‟ in plant demographic inference: more loci and more individuals. Molecular Ecology 19: 1075-1078. Laugen AT, Laurila A, Räsänen et al. (2003). Latitudinal countergradient variation in the common frog (Rana temporaria) development rates – evidence for local adaptation. Journal of Evolutionary Biology 16: 996-1005. Lauteri M, Scartazza M, Guido MC et al. (1997). Genetic variation in photosynthetic capacity, carbon isotope discrimination and mesophyll conductance in provenances of Castanea sativa adapted to different environments. Functional Ecology 11: 675-683. Ledig FT, Bormann FH, Wenger FK (1970). The distribution of dry matter growth between shoots and roots in loblolly pine. Bot. Gaz. 131: 349-359. Lefèvre F, Légionnet A, Vries de S and Turok J (1998). Strategies for the conservation of a pioneer tree species, Populus nigra L., in Europe. Genetics Selection Evolution 30: 181196. Leith H (1974). Phenology and seasonality modeling Ecological Studies. Analysis and synthesis. Vol. 8. Springer Verlag. Berlin - New York. pp. 444. Levins R (1969). Thermal acclimation and heat resistance in Drosophila species. The American Naturalist 103: 483-499. Lexer C, Fay MF, Joseph JA et al. (2005). Barrier to gene flow between two ecologically divergent Populus species, P. alba (White Poplar) and P. tremula (European aspen): the role of ecology and life history in gene introgression. Molecular Ecology 14: 1045-1057. Lexer C, Buerkle CA, Joseph JA et al. (2007). Admixture in European Populus hybrid zones makes feasible the mapping of loci that contribute to reproductive isolation and trait differences. Heredity 98: 74-84. Li B, Suzuki JI and Hara T (1998). Latitudinal variation in plant size and relative growth rate in Arabidopsis thaliana. Oecologia 115: 293-301. Li C, Junttila O, Ernstsen A et al. (2003). Photoperiodic control of growth, cold acclimation and dormancy development in silver birch (Betula pendula) ecotypes. Physiologia Plantarum 117: 206-212. Linhart YB and Grant MC (1996). Evolutionary significance of local genetic differentiation in plants. Annual Review of Ecological Systems 27: 237-277. Liu AZ and Burke JM (2006). Patterns of nucleotide diversity in wild and cultivated sunflower. Genetics 173: 321-330. Luquez V, Hall D, Albrectsen BR et al. (2007). Natural phenological variation in aspen (Populus tremula): the SwAsp collection. Tree Genetics and Genomes 4: 279-292. 125  Lynch M and Crease TJ (1990). The analysis of population survey data on DNA sequence variation. Molecular Biology and Evolution 7: 377-394. Major IT and Constabel CP (2008). Functional analysis of the Kunitz trypsin inhibitor family in poplar reveals biochemical diversity and multiplicity in defense against herbivores. Plant Physiology 146: 888-903. Marino BD and McElroy MB (1991). Isotopic composition of atmospheric CO 2 inferred from carbon in C4 plant cellulose. Nature 349: 127-131. McDaniel CN, Singer SR and Smith SME (1992). Developmental states associated with the floral transition. Developmental Biology 153: 59-69. McDonald JH and Kreitman M (1991). Adaptive protein evolution at the Adh locus in Drosophila. Nature 351: 652-654. McMahon SM, Parker GG and Miller DR (2010). Evidence for a recent increase in forest growth. Proceedings of the National Academy of Sciences of the United States of America 107: 3611-3615. Menzel A (2003). Plant phenological anomalies in Germany and their relation to air temperature and NAO. Climate Change 57: 243-263. Menzel A, Sparks TH, Estrella N et al. (2006). European phenological response to climate change matches the warming pattern. Global Change Biology 12: 1969-1976. Mikola J (1982). Bud-set phenology as an indicator of climatic adaptation of Scots pine in Finland. Silva Fenn. 16: 178-184. Mimura M and Aitken SN (2007). Adaptive gradients and isolation-by-distance with postglacial migration in Picea sitchensis. Heredity 99:224–232. Mimura M and Aitken SN (2010). Local adaptation at the range peripheries of Sitka spruce. Journal of Evolutionary Biology 23: 249-258. Mitchell TD and Jones PD. (2005). An improved method of constructing a database of monthly climate observations and associated high-resolution grids. International Journal of Climatology 25: 693–712. Moles AT, Warton DI, Warman L et al. (2009). Global patterns in plant height. Journal of Ecology 97: 923-932. Mooney HA and Billings WD (1961). Comparative physiological ecology of arctic and alpine populations of Oxyria digyna. Ecological Monographs 31: 1-29. Morgenstern EK (1978). Range-wide genetic variation of black spruce. Canadian Journal of Forest Research 8: 463-473. Morin X, Lechowicz MJ, Augspurger C et al. (2009). Leaf phenology in 22 North American tree species during the 21st century. Global Change Biology 15: 961-975. Mylecraine KA, Kuser JE, Zimmermann GL et al. (2005). Rangewide provenance variation in Atlantic white-cedar (Chamaecyparis thyoides): early survival and growth in New Jersey and North Carolina plantations. Forest Ecology and Management 216: 91-104. Myneni RB, Keeling CD, Tucker CJ et al. (1997). Increased plant growth in the northern high latitudes from 1981 to 1991. Nature 386: 698-702. Nei M (1987). Molecular Evolutionary Genetics. Columbia University Press, New York.  126  Nicholas Battey (2003). Plant culture: thirteen seasonal pieces. Journal of Experimental Botany 54: 1797-1799. Nienstaedt H and Olson JS (1961). Effects of photoperiod and source on seedling growth of eastern hemlock. Forest Science 7: 81-96. Oleksyn J, Tjoelker MG and Reich PB (1992). Growth and biomass partitioning of populations of European Pinus sylvestris L. under simulated 50° and 60° N daylengths: evidence for photoperiodic ecotypes. New Phytologist 120: 561-574. Oleksyn J, Modrzynski J, Tjoelker MG et al. (1998). Growth and physiology of Picea abies populations from elevational transects: common garden evidence for altitudinal ecotypes and cold adaptation. Functional Ecology 12: 573-590. Olson MS, Robertson AL, Takebayashi N et al. (2010). Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera). New Phytologist 186: 526-536. Ovaska  J (1988). Hieskoivun (Betula pubescens Ehrh.) pohjoisten provenienssien fotosynteettinen adaptaatio. MSc Thesis.University of Turku, Department of Plant Physiology, Turku, 31 pp.  Pamilo P and Nei M (1988). Relationships between gene trees and species trees. Molecular Biology and Evolution 5: 568-583. Pauley SS (1949). Forest-Tree Genetics Research: Populus L. Economic Botany 3: 299-330. Pauley SS and Perry TO (1954). Ecotypic variation in the photoperiodic response in Populus. Journal of Arnold Arbor. Harvard University. 35: 167-188. Peñuelas J, Rutishauser T and Filella I (2009). Phenology feedbacks on climate change. Science 324: 887-888. Petit JR, Aguinagalde I, de Beaulieu J-L et al. (2003). Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300: 1563-1565. Piao S, Ciais P, Friedlingstein P et al. (2008). Net carbon dioxide losses of northern ecosystems in response to autumn warming. Nature 451: 49-52. Pickett STA, Kolasa J and Jones CG (1994). Ecological understanding. Academic, New York. Pointeau VM (2008). Water-use efficiency and productivity in native Canadian populations of Populus trichocarpa and Populus balsamifera. MSc Thesis. University of British Columbia, Canada. Poorter L (1999). Growth responses of 15 rain-forest tree species to a light gradient: the relative importance of morphological and physiological traits. Functional Ecology 13: 396-410. Post E, Forchhammer MC, Bret-Harte MS et al. (2009). Ecological dynamics across the arctic associated with recent climate change. Science 325: 1355-1358. Rambaut A and Drummond AJ (2007a). BEAUti v1.4.2. Bayesian Evolutionary Analysis Utility. Available from http://beast.bio.ed.ac.uk/BEAUti Rambaut A and Drummond AJ (2007b). http://tree.bio.ed.ac.uk/software/tracer/  Tracer  v1.3.  Available  from  Rand DM and Kann LM (1996). Excess amino acid polymorphism in mitochondrial DNA: contrasts among genes from Drosophila, mice, and humans. Molecular Biology and Evolution 13: 735-748.  127  Rehfeldt GE, Ying CC, Spittlehouse DL et al. (1999). Genetic responses to climate in Pinus contorta: niche breadth, climate change, and reforestation. Ecological Monographs 69: 375-407. Reich PB and Schoettle AW (1988). Role of phosphorus and nitrogen in photosynthetic and whole plant carbon gain and nutrient use efficiency in eastern white pine. Oecologia 77: 25-33. Reich PB, Walters WB and Ellsworth DS (1992). Leaf life-span in relation to leaf, plant and stand characteristics among diverse ecosystems. Ecological Monograms 62: 365-392. Reich PB, Walters MB, Kloeppel BD et al. (1995). Different photosynthesis-nitrogen relations in deciduous hardwood and evergreen coniferous tree species. Oecologia 104: 24-30. Reich PB, Oleksyn J, Tjoelker MG (1996). Needle respiration and nitrogen concentration in Scots Pine populations from a broad latitudinal range: a common garden test with fieldgrown trees. Functional Ecology 10: 768-776. Reich PB, Walters MB and Ellsworth DS (1997). From tropics to tundra: global convergence in plant functioning. Proceedings of the National Academy of Sciences of the United States of America 94: 13730-13734. Reich PB, Ellsworth DS, Walters MB et al. (1999). Generality of leaf trait relationships: a test across six biomes. Ecology 80: 1955-1969. Reich PB and Oleksyn J (2004). Global patterns of plant leaf N and P in relation to temperature and latitude. Proceedings of the National Academy of Sciences of the United States of America 101: 11001-11006. Reinartz JA (1984). Life history variation of common mullein (Verbascum thapsus). II. Plant size, biomass partitioning and morphology. Journal of Ecology 72: 913-925. Remington DL, Thornsberry JM, Matsuoka Y et al. (2001). Structure of linkage disequilibrium and phenotypic associations in the maize genome. Proceedings of the National Academy of Sciences of the United States of America 98: 11479-11484. Rose LE, Bittner-Eddy P, Langley CH et al. (2004). The maintenance of extreme amino acid diversity at the disease resistance gene, RPP13, in Arabidopsis thaliana. Genetics 166: 1517-1527. Rozas J, Sanchez-DelBarrio JC, Messeguer X et al. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other analyses. Bioinformatics 19: 2496-2497. Rozen S and Skaletsky H (2000). Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386. Sanderson M (1997). Nonparametric approach to estimating divergence times in the absence of rate constancy. Molecular Biology and Evolution 14: 1218-1231. SAS 2002/2003 software, release 9.1 Edition. SAS institute Inc., Cary, N.C., USA. Savolainen O, Pyhajarvi T and Knurr T (2007). Gene flow and local adaptation in trees. Annual Review of Ecology, Evolution, and Systematics 38:595-619. Saxe H, Cannell MGR, Johnson O et al. (2001). Tree and forest functioning in response to global warming. New Phytologist 149: 369-400. Schipperges B, Kappen L, Sonesson M (1995). Intraspecific variations of morphology and physiology of temperate to arctic populations of Cetraria nivalis. Lichenologist 27: 517529. 128  Schnekenburger F and Farmer RE Jr. (1989). Genetic variance in growth of balsam poplar under 16- and 8- hour photosynthetic periods. Forest Science 35: 903-919. Sharkey TD, Bernacchi CJ, Farquhar GD et al. (2007). Fitting photosynthetic carbon dioxide response curves for C3 leaves. Plant, Cell and Environment 30: 1035-1040. Sheriff DW, Nambiar KS and Fife DN (1986). Relationships between nutrient status, carbon assimilation and water use efficiency in Pinus radiata (D. Don) needles. Tree Physiology 2: 73-88. Silim SN, Guy RD, Patterson TB et al. (2001). Plasticity in water-use efficiency of Picea sitchensis, P. glauca and their natural hybrids. Oecologia 128: 317-325. Small E (1972). Photosynthetic rates in relation to nitrogen recycling as an adaptation to nutrient deficiency in peat bog plants. Canadian Journal of Botany 50: 2227-2233. Sogaard G, Johnsen O , Nilsen J et al. (2008). Climatic control of bud burst in young seedlings of nine provenances of Norway spruce. Tree Physiology 28: 311-320. Soolanayakanahally Y Raju (2001). Assessment of water use efficiency among filed grown cashew clones (Anacardium occidentale L.) based on carbon isotope discrimination ( 13C) and gas exchange measurements. MSc Thesis. University of Agricultural Sciences, Bangalore, India. Soolanayakanahally RY, Guy RD, Silim SN et al. (2009). Enhanced assimilation rate and water use efficiency with latitude through increased photosynthetic capacity and internal conductance in balsam poplar (Populus balsamifera L.). Plant, Cell and Environment 32: 1821-1832. Sperry JS, Hacke UG, Oren R et al. (2002). Water deficits and hydraulic limits to leaf water supply. Plant Cell and Environment 25: 251-263. Stephens M, Smith N and Donnelly P (2001). A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics 68: 978-989. Stephens M and Scheet P (2005). Accounting for decay of linkage disequilibrium in haplotype inference and missing data imputation. American Journal of Human Genetics 76: 449462. Stöckli R and Vidale PL (2004). European plant phenology and climate as seen in a 20 year AVHRR land-surface parameter dataset. International Journal of Remote Sensing 25: 3303-3330. Strand AE, Leebens-Mack J and Milligan GB (1997). Nuclear-DNA-based markers for plant evolutionary biology. Molecular Ecology 6: 113-118. Sun ZJ, Livingston NJ, Guy RD et al. (1996). Stable carbon isotopes as indicators of increased water-use efficiency and productivity in white spruce (Picea glauca (Moench) Voss) seedlings. Plant, Cell and Environment 19: 887-894. Sylven N (1940). Lang-och Kordagstyper av de svenska skogstraden. Sven. Papperstidn. 17-19. Tajima F (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595. Terashima I and Ono K (2002). Effects of HgCl 2 on CO2 dependence of leaf photosynthesis: evidence indicating involvement of aquaporins in CO2 diffusion across the plasma membrane. Plant and Cell Physiology 43: 70-78.  129  Tholen D, Boom C, Noguchi K et al. (2008). The chloroplast avoidance response decreases internal conductance to CO2 diffusion in Arabidopsis thaliana leaves. Plant Cell and Environment 31: 1688-1700. Trewavas A (2002). Mindless mastery. Nature 415: 841. Tuskan GA, DiFazio S, Jansson S et al. (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 1596-1604. Tuskan GA, DiFazio S, Jansson S et al. (2006). The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 1596-1604. van den Berg AK and Perkins TD (2004). Evaluation of a portable chlorophyll meter to estimate chlorophyll and nitrogen contents in sugar maple (Acer saccharum Marsh.) leaves. Forest Ecology and Management 200: 113-117. Vitasse Y, Delzon S, Dufrene E et al. (2009). Leaf phenology sensitivity to temperature in European trees: Do within-species populations exhibit similar responses? Agricultural and Forest Meteorology 149: 735-744. von Caemmerer S and Farquhar GD (1981). Some relationships between the biochemistry of photosynthesis and the gas exchange of leaves. Planta 153: 376-387. Walther GR, Post E, Convey P et al. (2002). Ecological responses to recent climate change. Nature 416: 389-395. Wang T, Hamann A, Yanchuk A et al. (2006). Use of response functions in selecting lodgepole pine populations for future climates. Global Change Biology 12: 2404-2416. Wang T, O‟Neill and Aitken SN (2010). Integrating environmental and genetic effects to predict responses of tree populations to climate. Ecological Applications 20: 153-163. Wareing PF (1956). Photoperiodism in woody plants. Annual Review of Plant Physiology 7: 191214. Warren CR, Ethier GJ, Livingston NJ et al. (2003). Transfer conductance in second growth Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) canopies. Plant, Cell and Environment 26: 1215-1227. Warren CR (2006). Estimating the internal conductance to CO 2 movement. Functional Plant Biology 33: 431-442. Warren CR and Adams MA (2006). Internal conductance does not scale with photosynthetic capacity: implications for carbon isotope discrimination and the economics of water and nitrogen use in photosynthesis. Plant Cell and Environment 29: 192-201. Warren CR (2008). Stand aside stomata, another actor deserves centre stage: the forgotten role of the internal conductance to CO2 transfer. Journal of Experimental Botany 59:1475-1487. Watterson GA (1975). On the number of segregating sites in genetical models without recombination. Theoretical Population Biology 7: 256-276. Weir BS (1990). Genetic data analysis: methods for discrete population genetic data. Sinauer Associates, Sunderland. Withrow RB (1959). Photoperiodism and related phenomena in plants and animals. American Association for the Advancement of Science. Washington, DC. Worrall J (1983). Temperature-bud burst relationships in Amabilis and Subalpine fir provenance tests replicated at different elevations. Silvae Genetica 32: 203-209. 130  Worrall J (1999). Phenology and the changing seasons. Nature 399: 101. Wright IJ, Westoby M and Reich PB (2002). Convergence towards higher leaf mass per area in dry and nutrient-poor habitats has different consequences for leaf life span. Journal of Ecology 90: 534-543. Wright IJ, Groom PK, Lamont BB et al. (2004a). Leaf trait relationships in Australian plant species. Functional Plant Biology 31: 551-558. Wright IJ, Reich PB, Westoby M et al. (2004b). The worldwide leaf economics spectrum. Nature 428: 821-827. Wright S, Lauga B and Charlesworth D (2003). Rates and patterns of molecular evolution in inbred and out-bred Arabidopsis. Molecular Biology and Evolution 19: 1407-1420. Wuehlisch G. von, Krusche D and Muhs HJ (1995). Variation in temperature sum requirement for flushing of beech provenances. Silvae Genetica 44: 343-346. Xie C-Y, Ying CC, Yanchuk AD et al. (2009). Ecotypic mode of regional differentiation caused by restricted gene migration: a case in black cottonwood (Populus trichocarpa) along the Pacific Northwest coast. Canadian Journal of Forest Research 39: 519-526. Yanovsky MJ and Kay SA (2002). Molecular basis of seasonal time measurement in Arabidopsis. Nature 419: 308-312. Ying CC and Bagley WT (1976). Genetic variation of eastern cotton-wood in an eastern Nebraska provenance study. Silvae Genetica 25: 67-73. Yin CC (1998). The albedo of vegetated land surfaces: systems analysis and mathematical modeling. Theoretical and Applied Climatology 60: 121-140. Zhang J, Marshall JD, Jaquish BC (1993). Genetic differentiation in carbon isotope discrimination and gas exchange in Pseudotsuga menziesii. Oecologia 93: 80-87. Zhang WJ, Feng Z, Cregg MB et al. (1997). Carbon isotopic composition, gas exchange, and growth of three populations of ponderosa pine differing in drought tolerance. Tree Physiology 17: 461-466.  131  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items