Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

ILK represses E-cadherin expression by regulating PARP-1 binding to the Snail promoter McPhee, Timothy Ryan 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2011_spring_mcphee_timothy.pdf [ 23.65MB ]
Metadata
JSON: 24-1.0071449.json
JSON-LD: 24-1.0071449-ld.json
RDF/XML (Pretty): 24-1.0071449-rdf.xml
RDF/JSON: 24-1.0071449-rdf.json
Turtle: 24-1.0071449-turtle.txt
N-Triples: 24-1.0071449-rdf-ntriples.txt
Original Record: 24-1.0071449-source.json
Full Text
24-1.0071449-fulltext.txt
Citation
24-1.0071449.ris

Full Text

ILK REPRESSES E-CADHERIN EXPRESSION BY REGULATING PARP-1 BINDING TO THE SNAIL PROMOTER  by TIMOTHY RYAN MCPHEE B.Sc., The University of Guelph, 2001  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  November 2010  ! Timothy Ryan McPhee, 2010  Abstract The loss of E-cadherin, a critical component of the adherence junctions, is implicated in the metastasis of carcinomas and correlates with tumour grade. Here we show that in PC3 cells loss of Integrin-Linked Kinase (ILK), AKT/PKB or Snail-1, results in the re-expression of E-cadherin at both the mRNA and protein level. We have previously shown that ILK is capable of transcriptionally regulating the E-cadherin repressor Snail-1, via a 65-bp ILK responsive element in the 5' promoter termed the Snail-1 ILK Responsive Element (SIRE). Using a SIRE oligonucleotide we identified three candidate SIRE binding proteins that demonstrate differential binding due to loss of ILK: Poly(ADP-ribose) polymerase-1 (PARP-1), Methyl-CpG domain binding protein 5 (MBD-5) and a fragment of Chromodomain-helicase-DNA-binding protein 8/Helicase with SNF2 domain 1 (CHD-8/HELSNF1). PARP-1, which bound the SIRE in the presence, but not the absence of ILK was further characterized in this study. Like ILK, AKT and Snail-1, PARP-1 siRNA treatment results in the upregulation of E-cadherin. Inhibition of the ADP-ribose polymerase activity of PARP-1 partially blocks the upregulation of E-cadherin in ILK siRNA treated cells. This suggests a mechanism in which ILK has a role in maintaining PARP-1 in an inactive state, repressing expression of E-cadherin. We demonstrate that in Scp2 cells ILK overexpression results in the induction of Snail-1 expression. We suggest a model in which ILK regulates E-cadherin by regulating PARP-1 enzymatic activity. The regulation of PARP-1 activity modulates its ability to bind to the Snail-1 promoter.  ii  Table of Contents Abstract ........................................................................................................................................................ ii Table of Contents ........................................................................................................................................ iii List of Tables ............................................................................................................................................... vi List of Figures ............................................................................................................................................. vii Abbreviations............................................................................................................................................... ix Acknowledgements ..................................................................................................................................... xi Dedication................................................................................................................................................... xii Co-Authorship Statement ...........................................................................................................................xiii Chapter 1: Literature Review.....................................................................................................................1 1.1 Introduction and Objectives ....................................................................................................................1 1.2 Epithelial to Mesenchymal Transition .....................................................................................................2 1.3 Cancer ....................................................................................................................................................4 1.3.1 Tissue Invasion and Metastasis .............................................................................................5 1.4 Fibrotic Disease......................................................................................................................................7 1.5 E-cadherin ..............................................................................................................................................7 1.5.1 Structure and Function ...........................................................................................................8 1.5.2 Signalling Function .................................................................................................................9 1.5.3 Transcriptional Regulation....................................................................................................13 1.6 Transcriptional Repressors of E-cadherin ............................................................................................14 1.6.1 The Snail Family...................................................................................................................14 1.6.2 Zeb Family............................................................................................................................16 1.7 Integrin-Linked Kinase..........................................................................................................................18 1.7.1 ILK and EMT ........................................................................................................................19 1.7.2 PI3-Kinase and ILK Kinase Activation..................................................................................20 1.7.3 PTEN....................................................................................................................................21 1.7.4 ILK Kinase Targets...............................................................................................................21 1.7.5 Regulation of AKT ................................................................................................................21 1.7.6 Regulation of GSK-3" ..........................................................................................................23 1.7.7 Adapter Function of ILK........................................................................................................23 1.8 PARP....................................................................................................................................................25  iii  1.8.1 Co-factor Function of PARP-1 in Transcriptional Repression and Activation of MASH1 ..........................................................................................................................................26 1.8.2 Co-factor Function of PARP-1 in "#catenin/TCF4 Transcriptional Activation......................27 1.8.3 Poly(ADP-Ribose) Polymerases ..........................................................................................28 1.8.4 Regulation of PARP-1 Polymerase Activity..........................................................................32 1.8.5 Inhibitors of PARP ................................................................................................................33 1.8.6 PARG ...................................................................................................................................34 1.9 Conclusion............................................................................................................................................35 1.10 References .........................................................................................................................................36 Chapter 2: Integrin-Linked Kinase regulates E-cadherin Expression through PARP-1 ....................47 2.1 Introduction...........................................................................................................................................47 2.2 Results..................................................................................................................................................49 2.3 Discussion ............................................................................................................................................66 2.4 Experimental Procedures .....................................................................................................................70 2.5 References ...........................................................................................................................................78 Chapter 3: Conclusions ...........................................................................................................................82 3.1 Introduction...........................................................................................................................................82 3.2 ILK and EMT.........................................................................................................................................83 3.3 PARP-1 a SIRE binding protein............................................................................................................85 3.4 PARP-1 binding sequence ...................................................................................................................89 3.5 Signalling downstream of ILK in PARP-1 regulation ............................................................................90 3.6 Post-translational regulation of Snail-1 by ILK......................................................................................92 3.7 Inhibition of PARP-1 enzymatic activity in ILK and PARP-1 siRNA treated cells .................................94 3.8 Transcriptional repressors of E-cadherin..............................................................................................97 3.9 MBD-6 and fragment of CHD-8 ............................................................................................................99 3.10 Hypothesized Mechanism ................................................................................................................100 3.11 Future Directions ..............................................................................................................................103 3.11.1 Development of shRNA Constructs..................................................................................103 3.11.2 Quantification of Promoter Activity of Snail and E-cadherin with Luciferase Reporter Constructs ...................................................................................................................................104 3.11.3 Identification of PARP-1 Binding Partners........................................................................105  iv  3.11.4 ILK’s Regulation of PARP-1 Polymerase Activity.............................................................106 3.12 References .......................................................................................................................................109 Appendix A: Protocol for biotin streptavidin chromatography to isolate DNA binding proteins ..................................................................................................................................................................112 Appendix B: siRNA Constructs.................................................................................................................114 Appendix C: qRT-PCR Primers ................................................................................................................115 Appendix D: Immunofluorescence............................................................................................................116  v  List of Tables Table 2.1 Sequence of trypsin digested fragments identified by mass spectrometry.................................59 Table 3.1 Alignment and homology of the SIRE sequence in human, mouse and rat ...............................86  vi  List of Figures Figure 1.1 Model of hypothesized role for EMT in metastasis and invasion ................................................3 Figure 1.2 Schematic of a cell-cell adherence junction ................................................................................8 Figure 1.3 Schematic of "-catenin signalling pathway ...............................................................................12 Figure 1.4 Schematic of PI3-kinase/ILK/AKT signalling axis......................................................................22 Figure 1.5 Addition of poly-ADP-ribose units to an acceptor protein..........................................................31 Figure 2.1 Expression of E-cadherin and Snail in Scp2 mouse mammary epithelial cell lines stably overexpressing ILK.....................................................................................................................................51 Figure 2.2 Effect of siRNA-mediated depletion of ILK or its downstream targets on E-cadherin expression in the PC3 human prostate carcinoma cell line........................................................................54 Figure 2.3 Identification of SIRE-binding proteins in PC3 cells transfected with ILK siRNA ......................57 Figure 2.4 Electromobility shift assay (EMSA) using nuclear extracts of PC3 cells and a Klenow 3' 32P-ATP  end-labelled SIRE oligonucleotide ...............................................................................................61  Figure 2.5 Effect of siRNA-mediated depletion of PARP-1 or ILK on E-cadherin and Snail expression in cancer cells ..........................................................................................................................64 Figure 3.1 Electromobility shift assay (EMSA) using nuclear extracts of PC3 cells and Scp2 stable cell lines and a Klenow 3' 32P-ATP end-labelled SIRE oligonucleotide ......................................................86 Figure 3.2 The effect of siRNA-mediated depletion of PTEN, ILK and/or PARP-1 on E-cadherin expression in HEK-293 cells.......................................................................................................................91 Figure 3.3 Effect of the LiCl GSK-3 inhibitor on E-cadherin expression induced by depletion of ILK or PARP-1 in PC3 cells ..............................................................................................................................94 Figure 3.4 Effect of the 3-AB poly(ADP-ribose)polymerase inhibitor on E-cadherin expression induced by depletion of ILK or PARP-1 in PC3 cells ..................................................................................96  vii  Figure 3.5 Schematic of proposed model of ILK’s regulation of E-cadherin via PARP-1 and Snail-1......102 Figure 3.6 Immunofluoresence of poly-ADP-ribose..................................................................................108  viii  Abbreviations EMT 3-AB ANK AP APC bHLH BM BRCA BRCT BSA CAM CaMK CH CH-ILKBP CHD ChIP CKII CoIP DBD EC ECM EMSA ETAR FAK GPI GRO GSK HEK HES HKC HSP ILK IRS LEF1 LiCL MASH MBD MET mRNA MUC NAD+ NCK NE  epithelial to mesenchymal transition 3-aminobenzamide ankyrin activator protein adenomatous polyposis coli basic helix-loop-helix basement membrane breast cancer gene BRCA C-terminal bovine serum albumin cell adhesion molecule calmodulin kinase calponin-homlogy calponin-homology-domain containing ILK binding protein chromodomain-helicase-DNA-binding protein chromatin immunopreciptation casein kinase II co-immunoprecipitation DNA binding domain extracellular cadherin extracellular matrix electro mobility shift assay endothelin A receptor focal adhesion kinase glycoprotein groucho glycogen synthase kinase human embryonic kidney hairy/enhancer of split human kidney cell heat shock protein integrin-linked kinase insulin receptor substrate lymphoid enhancing factor-1 lithium chloride mammalian achate schute homolog methyl CpG binding domain mesenchymal to epithelial transition messenger RNA mucin nicotinamide adenine dinucleotide non-catalytic region of tyrosine kinase nuclear extract  ix  NES NLS NSC NuRD p54nrb PAR PARG PARP PBS PDK PH PI3 PINCH PLC PTEN qPCR Rb RNAi RTK SILAC SIRE siRNA TAP TCF TGF TLE TNK  nuclear export signal nuclear localisation signal neural stem cell nucleosome remodelling and deacetylase p54 nuclear RNA binding protein poly(ADP-ribose) poly(ADP-ribose)-glycohydrolase Poly(ADP-ribose)-polymerase phosphate buffered saline protein dependent kinase plexrin homology phosphatidylinositol 3 particularly interesting new CIS-HIS protein phospholipase C phosphatase and tenison homologue quantitative PCR retinoblastoma RNA interference receptor tyrosine kinase stable isotope labelling with amino acids in cell culture Snail-1 ILK responsive element small interferring RNA tandem affinity purification T-cell factor transforming growth factor tranducer-like/enhancer of split tankeryase  x  Acknowledgements This work was supported by grants to SD from the Canadian Institutes of Health Research (CIHR), the National Cancer Institute of Canada (NCIC), with funds raised by the Canadian Cancer Society, and the Terry Fox Foundation Program Project in Prostate Cancer Progression. We thank Dr. I. Virtanen for providing the Snail antibody.  xi  Dedication This thesis is dedicated to my wife, Clare Gardiner, for her support, encouragement and patience. I would like to thank my entire family for their emotional and financial support. I would like to thank my many co-workers, peers and professors for their help both professionally and personally. Finally I would like to thank Dr. Shoukat Dedhar for providing me with this opportunity and his support.  xii  Co-Authorship Statement Mr. Timothy McPhee Mr. McPhee was involved in the design of the research program. The area of research was identified by the Supervising Scientist, Dr. Shoukat Dedhar. prior to Mr. McPhee’s entry into the laboratory. Mr. McPhee completed the experimental design with support of the Supervising Scientist. Mr. McPhee performed the experiments and conducted the data analysis for the figures presented in this thesis unless otherwise indicated. Mr. McPhee completed the writing of the thesis manuscript with support of the Supervising Scientist and Co-Authors. Dr. McDonald performed the figure optimization for submission of the manuscript and necessary revisions for resubmission. The western blot analysis and quantitative real-time PCR presented in Figure 2.5 was conducted by Dr. McDonald and Dr. Oloumi who completed the relevant discussion in the manuscript.  xiii  Chapter 1  Literature Review  1.1 Introduction and Objectives  The process of Epithelial to Mesenchymal Transition (EMT) is hypothesized to be involved in the invasion and metastasis of carcinomas. Critical in EMT is the downregulation of the cell adhesion molecule E-cadherin and a better understanding of the mechanisms that regulate the expression of E-cadherin is important for the identification of therapeutic targets for metastatic carcinomas. For this study we proposed a model in which integrin-linked kinase (ILK) signalling positively regulates the transcription of the Ecadherin repressor Snail-1, resulting in repression of E-cadherin transcription and induction of EMT. Previous data indicates that activation of Snail-1 transcription by ILK signalling is mediated, at least in part, by the Snail-1 ILK responsive element (SIRE) fragment located in the Snail-1 5' promoter. ILK is an important signalling kinase that has not been shown to have transcriptional or DNA binding activity, therefore its regulation of Snail-1 expression is hypothesized to be indirect via a transcription factor complex. In this study we propose to identify proteins whose binding to the SIRE fragment is regulated by ILK. Upon identification we proposed to validate their role as SIRE binding proteins and regulators of Snail1 and E-cadherin transcription. In this thesis we identify three candidate SIRE binding proteins that bind the SIRE in the presence, but not the absence, of ILK expression. We further characterized one of these proteins, poly(ADP-ribose)-polymerase (PARP)-1, to validate its function as a SIRE binding protein and its role in the regulation of E-cadherin. We also characterized the mechanism by which ILK regulates PARP-1 and hypothesize that ILK regulates the polymerase activity of PARP-1. We hypothesize that downstream of ILK signalling the polymerase activity of PARP-1 is inhibited allowing it to function as a co-factor in a  1  transcription factor complex that binds the SIRE fragment of the Snail-1 promoter. Binding of the PARP-1containing complex results in the expression of Snail-1, which results in an EMT characterized by the loss of E-cadherin expression. We were not able to determine if the PARP-1-containing complex functions as a positive transcription factor complex or displaces a transcriptional repressor complex. This thesis identifies PARP-1 as a new protein important in EMT.  1.2 Epithelial to Mesenchymal Transition  EMT is a process in which epithelial cells lose polarity, adherence junctions, tight junctions, desmosomes and cytokeratin intermediate filaments, and rearrange the actin cytoskeleton to form filopodia and lamellopodia[1]. It is a process that is critical during embryonic development and it is hypothesized that some of the key mechanisms of EMT are used by malignant carcinomas for invasion and metastasis[1-5] (Fig. 1.1).  2  Figure 1.1 Model of hypothesized role for EMT in metastasis and invasion adapted from Theiry 2002 [2]. A subset of epithelial cells that have progressed to a carcinoma in situ to acquire a mutation, which results in EMT. This phenotypic change allows the cell to migrate across the basement membrane to invade locally and ultimately enter blood or lymph vessels to travel to distance sites.  Epithelial cells are characterized by an apical-basal polarity, an inability to migrate, and close linkages to both adjacent cells and the extra-cellular matrix (ECM)[6, 7]. In contrast, mesenchymal cells are characterized by a front end-back end polarity, an ability to migrate through the ECM, and a lack of close linkages to the ECM or adjacent cells[2, 6]. During development EMT is a mechanism by which epithelial cells generated in a particular region can transform to a mesenchymal phenotype, dissociate from the epithelium and migrate to secondary sites[1, 3-5]. EMT is characterized by alterations in cell-cell adhesion, cell-ECM interactions, ECM degradation and cytoskeletal re-organization[1, 8, 9]. The process is critical  3  during gastrulation, organogenesis and the migration of neural crest cells[1, 2, 10-12]. Cells that undergo EMT may revert to an epithelial phenotype in a process termed mesenchymal to epithelial transition (MET), or may retain a mesenchymal phenotype[2, 13, 14]. Critical to the process of EMT is the downregulation of epithelial genes, in particular E-cadherin, and the upregulation of mesenchymal genes[1, 2, 15]. The systematic reorganization of the epithelial and mesenchymal gene profiles is what distinguishes EMT from cell scattering, another process in which cells depolarize and acquire a fibroblastic morphology[15].  1.3 Cancer  According to the National Cancer Institute of Canada: Canadian General Cancer Statistics for 2010, there will be an estimated 173 800 new cases of cancer and 75 500 deaths due to cancer in Canada in 2010. Cancer is a disease of dynamic changes in the genome that affects the proper function of genes leading to uncontrolled cell growth and tumour formation. Carcinomas are malignant cancers that arise from the epithelial tissues of the body. Carcinomas develop by “exaptation, a mechanism of economy by which cells reuse known physiologic processes to provide new function” [16]. In order to survive and proliferate carcinomas do not develop new cellular processes, but employ normal cellular processes aberrantly, which allows disease progression. This process is seen at an intracellular level in aberrant signalling and at the intercellular level where carcinomas co-opt normal tissue to support its growth. The process of tumourgenesis appears to involve multiple steps with a progressive transformation from a normal to a malignant phenotype. Supporting this hypothesis is the fact that the creation of transformed cells in vitro is a multistep process[17]. In their review Hanahan and Weinberg [18] propose a model in which a cell must achieve six hallmark characteristic to achieve a malignant phenotype. The six hallmarks are; self-sufficiency in growth signals, insensitivity to anti-growth signals, evasion of apoptosis, limitless replicative potential, sustained angiogenesis and tissue invasion and metastasis. Acquisition of  4  mutations, ranging from single nucleic acid changes to larger chromosomal changes, can modify the function of tumour suppressors and oncogenes, either directly or indirectly, resulting in the acquisition of one or more of the hallmarks. Pathological studies of organ sites have demonstrated the existence of pre-malignant lesions that represent intermediate steps in this process. The ability to invade and metastasize is believed to be one of the final steps in carcinogenesis and indicates a poor prognosis, yet this process is poorly understood. Elucidation of the genetic mutations that confer the ability to invade and metastasize is therefore critical in the diagnosis and treatment of cancer. The focus of this thesis is on the hallmark characteristic of invasion and metastasis, in particular the control of E-cadherin transcriptional expression.  1.3.1 Tissue Invasion and Metastasis  The defining characteristic of a malignant cancer is the ability to invade into local tissue and to distant secondary sites. Malignant cancers migrate through the basement membrane into surrounding tissue and can travel to distant sites. The processes of local invasion and metastasis are closely allied processes. It is these secondary growths and not the primary tumours that are usually fatal, causing 90% of human cancer related deaths [19], due to the interference with normal tissue function at the secondary site. The ability to invade and metastasize may be a property that is only transiently acquired by a cancer cell, which is then lost in cells that are able to colonize a secondary site[20]. Secondary tumours are usually clonal, derived from a single cell, therefore a metastatic cancer cell must possess all requirements for establishment of a secondary tumour. Both invasion and metastasis involve changing the physical coupling of cells to their microenvironment and activation of extracellular proteases. Cell-cell and cell-ECM interactions are important for maintaining tissue homeostasis. These interactions convey to the cell various regulatory  5  signals that affect proliferation and survival. Cell-cell interactions are mediated by cell adhesion molecules (CAMs) that are divided into five families: immunoglobulins superfamily, integrins, cadherins, selectins and lymphocyte homing receptors. The structure and function of cadherins will be discussed below. The integrin family of proteins mediate cell-ECM interactions. Integrins are transmembrane proteins that form a variety of heterodimers that have specific affinity for different ECM components. As they invade and metastasize, cells experience a changing microenvironment, therefore to be successful at distant and local secondary sites they must be able to adapt to the new complement of ECM components[21-23]. Invasive or metastatic carcinomas exhibit a change in integrin expression profiles, shifting from an integrin complement that favours an epithelial ECM to one that favours a degraded stromal cell ECM, which has been produced by the action of extracellular proteases (discussed below). The study of integrins in confounded by the large number of genes, a larger array of possible heterodimeric combinations and the complex signalling downstream of their cytoplasmic domains[24, 25]. Another important parameter for invasive and metastatic cancer is the expression or activation of extracellular proteases. Malignant cancers will upregulate proteases, downregulate protease inhibitors and/or activate pools of zymogens[26-29]. These extracellular proteases degrade ECM and basement membrane (BM) components allowing the malignant cells to migrate into nearby stroma, across blood or lymph vessels, through epithelial cell layers and invade distant sites. Other functions have be also been ascribed to proteases such as angiogenesis[28, 30] and the activation of growth factors that result in stimulatory signals[31-34]. Extracellular proteases are usually not expressed by epithelial cancer cells, but by stromal and inflammatory cells that are stimulated by the carcinoma[32]. Extracellular proteases and aberrant ECM deposition is also important in fibrotic diseases.  6  1.4 Fibrotic Disease  Fibrotic disease is characterized by the inappropriate deposition of collagens, elastin, tenacin and other matrix molecules by fibroblast cells[35]. Pathogenic fibrosis is implicated in pulmonary fibrosis[36], systemic sclerosis[37], liver cirrhosis[38, 39], kidney disease[40-43] and macular degeneration[44]. Fibrotic disease is due to overactive wound repair. There are two types of wound repair, the regenerative, in which injured cells are replaced by cells of the same type with no lasting evidence of damage and fibroplasia in which connective tissue replaces parenchymal tissue (reviewed in [45]). These processes are initially beneficial, but can become pathogenic if they continue and substantial remodelling of the ECM and formation of scar tissue occurs. In fibrotic disease the epithelial tissue is replaced by scar tissue, causing lose of morphologic dependent signals and ultimately organ failure of the affected tissue[35]. Pathological fibrosis typically results from chronic inflammation, which lasts weeks to months, that results in inflammation, destruction and repair of the tissue simultaneously[45]. It is hypothesized that in normal wound healing epithelial tissue undergoes EMT to produce fibroblasts that contribute to healing [46, 47], but that in fibrotic disease the accumulation of fibroblasts contributes to pathogenic fibrosis. The balance of collagen synthesis and catabolism is shifted in fibrotic disease, leading to its accumulation[48]. The excess of mesenchymal cells exacerbates this deposition contributing to fibrosis of the affected organ[45].  1.5 E-cadherin E-cadherin is a tumour suppressor that has emerged as one of the caretakers of the epithelial phenotype[2]. Its loss is hypothesized to be a critical, but not a sufficient step in the induction of EMT[49].  7  1.5.1 Structure and Function  E-cadherin is a type I classical cadherin that is specifically expressed on the surface of epithelial cells. It mediates homophilic, calcium-dependent cell-cell adhesion and is critical to the formation of adherin junctions[50-52] (Fig. 1.2). Formation and maintenance of adherin junctions are important in the development and maintenance of epithelial tissues[53-58], therefore the dysregulation of E-cadherin has profound effects on epithelial tissue structure and function. Figure 1.2 Schematic of a cell-cell adherence junction. E-cadherin forms a calcium dependent homophilic complex via its distal EC repeat. E-cadherin is connected to the actin cytoskeleton via the catenin family of proteins and !-actinin.  8  E-cadherin contains an extracellular domain that mediates the homophilic interaction, a single pass transmembrane domain and an intracellular region that mediates its interaction with the actin cytoskeleton[59-62]. The extracellular domain contains 5 extracellular cadherin (EC) repeats with a conserved HAV tripeptide motif in the most distal repeat[63]. The distal EC repeat of the type I classical cadherins mediate its homophilic interactions[63-65]. The cytoplasmic domain mediates the dynamic interaction with the actin cytoskeleton through various binding proteins, such as members of the catenin protein family. E-cadherin not only mediates cell-cell adhesion, but is also critical in the transfer of information intracellularly via its interactions with the actin cytoskeleton and various signalling molecules, such as "catenin. An understanding of the mechanisms that control the function and expression of E-cadherin is critical to understanding of the process of invasion, metastasis and EMT.  1.5.2 Signalling Function  In an adherence junction E-cadherin forms a complex with "-catenin and !-catenin to physically link the actin cytoskeletons of adjacent cells. E-cadherin binds directly to "-catenin, which subsequently binds the actin binding protein !-catenin[66]. "-catenin is not only a component of adherence junctions, but is also a critical component of the Wnt signalling pathway (see below). In addition to linking E-cadherin to the actin cytoskeleton, binding of "-catenin to the cytoplasmic domain of E-cadherin may be required for the proper targeting of E-cadherin to the plasma membrane[67]. It is not known if the increase in free "catenin levels due to Wnt signalling can regulate E-cadherin function, but the disruption or loss of Ecadherin does affect the levels of free "-catenin, which partially mimics or potentiates Wnt signalling[68]. Therefore there are multiple points of cross talk between E-cadherin adherin junctions and the Wnt  9  signalling pathway, providing various mechanisms by which the loss of E-cadherin can potentiate metastasis in carcinomas. In the Wnt signalling pathway "-catenin mediates the transcription of target genes[69-71] through its interaction with the T-cell factor (TCF)/Lymphoid enhancing factor (LEF)-1 family of co-activators[69, 72, 73]. In the absence of Wnt signalling a degradation complex composed primarily of Glycogen Synthase Kinase (GSK) 3", Casein kinase II (CKII), Axin and adenomatous polyposis coli (APC), phosphorylates "catenin, promoting its ubiquitination and subsequent degradation[74-81] (Fig. 1.3a). In the presence of Wnt signalling the degradation complex is disrupted; inhibiting the phosphorylation and degradation of "catenin, resulting in the stabilisation of its cytoplasmic pool, its translocation to the nucleus and the transcription of "-catenin/TCF target genes (Fig. 1.3b). Cytoplasmic pools of "-catenin can be stabilized in a Wnt independent manner due to disruption of Phosphatidylinositol 3 (PI3)-kinase/ILK/AKT pathway or components of the "-catenin degradation pathway. This results in activation of "-catenin/TCF target genes. This pathological "-catenin signalling has been shown in various carcinomas, in particular APC mutations in colon carcinomas[82, 83] and Phosphatase and Tenison Homologue (PTEN) mutations in breast carcinomas[84].  10  Figure 1.3 Schematic of Wnt signalling pathway. In the absense of Wnt signalling "-catenin is phosphorylated by GSK-3, which results in its ubiquitination and subsequent degredation (a). In the presence of Wnt or in pathogenic signalling GSK-3 is inhibited, resulting in the dissociation of the "-catenin phosphorylating complex and the stabilization of "-catenin cytoplasmic pools (b). "-catenin is able to bind TCF and mediate the transcription of its target genes.  11  12  1.5.3 Transcriptional Regulation  In a majority of carcinomas the loss of E-cadherin is not due to mutation, but due to dysregulation of transcription factors, or promoter hypermethylation[85-90]. Methylation of CpG dinucleotides is a common modification that is associated with gene silencing. Methylation of the E-cadherin promoter is associated with reduced E-cadherin expression, cancer progression and metastasis[91]. The loss of Ecadherin is beneficial to tumours for invasion and metastasis, but may also trigger apoptosis, therefore it may be beneficial to maintain a reversible mechanism of transcriptional control[92]. In epithelial cells the inactivation of retinoblastoma (Rb) by simian virus 40 large T antigen resulted in the downregulation of cMyc and EMT[93, 94]. Interestingly the ectopic expression of Rb or c-Myc resulted in an increase in Ecadherin and other epithelial markers in epithelial cells, but not in mesenchymal cells or fibroblasts[80], suggesting the presence of a dominant repression pathway. Analysis of somatic cell hybrids of E-cadherin positive and negative breast cancer cells suggests that the loss of E-cadherin expression in some breast cancers is also due to a dominant repression pathway and that this mechanism is trans acting[95]. These observations implicate transcriptional repressors as the mechanism that downregulates E-cadherin expression in mesenchymal cells, fibroblasts and some E-cadherin negative carcinomas. Transcription of E-cadherin is controlled by both positive and negative regulatory elements located in its 5' promoter region[88, 96-98]. The positive regulatory regions of E-cadherin consist of a CCAAT-box and a GC-rich region that contains two Activator Protein (AP)-2 binding sites[97]. The 5' promoter region also contains three E-box motifs, protein binding motifs with a core consensus sequence of CANNTG[8, 85, 96, 99, 100], which have both a negative and positive regulatory function. The E-box motifs function as negative regulators of E-cadherin in mesenchymal and transformed cells by binding transcriptional repressors, such as the Snail-1[8, 85, 96, 99, 101-103] and Zeb[8, 104] families of zinc-finger proteins. The E-box motifs are believed to have positive regulatory function in epithelial cells since deletion in an E-  13  cadherin luciferase reporter abolished transcription[88]. Basic helix-loop-helix (bHLH) transcription factors are known to bind E-box motifs and promote transcription[85]. The three E-box motifs present in the Ecadherin promoter are critical in transcriptional regulation[88].  1.6 Transcriptional Repressors of E-cadherin  The transcriptional repression of E-cadherin expression has emerged as an important hallmark of carcinogenesis. The 3 E-box motifs are critical in the repression of E-cadherin expression and a number of transcriptional repressor families that bind these motifs have been identified. The Snail, Zeb and Twist families have been shown to regulate E-cadherin expression and their expression has been correlated with both tumour grade and survival [105-111]. In this thesis I have focused on the Snail and Zeb transcription repressor families.  1.6.1 The Snail Family  The Snail family members are zinc-finger proteins that function as transcriptional repressors[112]. Snail family of proteins have a highly conserved C-terminus that contains four to six C2H2 type zinc-fingers, which mediate its DNA binding activity and are essential for its repressor activity[113]. The consensus DNA binding sequence of the Snail family proteins is the E-box motif CANNTG[85, 96, 112, 114-116]. The Snail protein superfamily is divided into 2 groups; the Snail group contains Snail-1, Slug/Snail-2 and Smuc and the second group contains the Scratch protein[112]. The overexpression of Snail-1 in epithelial cells results in the dramatic downregulation of Ecadherin concomitant with the conversion to a fibroblastic phenotype, and the acquisition of tumourgenic and invasive properties[85, 96, 112]. Conversely, high endogenous expression of Snail-1 is detected in  14  both mouse and human carcinoma cell lines that lack E-cadherin expression[85, 96, 112]. Snail-1 is an important factor in mouse development, where it is present in the undifferentiated mesoderm and in tissues undergoing EMT, which inversely correlates with the expression of E-cadherin[101]. The analysis of Snail-1 null mouse embryos demonstrated incomplete EMT and an inability to downregulate E-cadherin, which resulted in embryonic lethality[101]. In epithelial cells the exogenous expression of Snail-1 results in a mesenchymal phenotype and in addition to E-cadherin, Snail-1 regulates the expression of other epithelial and mesenchymal specific proteins. The epithelial markers desmoplakins[96], cytokeratin 18 and Mucin (MUC) 1[8] are downregulated and the expression of the mesenchymal markers LEF1[8], vimentin[96] and fibronectin[8, 96] are upregulated. Snail-1 expression results in the disruption of "-catenin distribution from the plasma membrane to the cytosol and nucleus[96], affecting "-catenin/TCF mediated transcription. Its expression also results in the upregulation of another E-cadherin transcriptional repressor, Zeb-1[8]. Snail-1 is capable of initiating complete EMT in vitro, is critical in developmental processes involving EMT and is therefore a strong candidate to contribute to EMT in the metastasis of carcinomas. Snail-1 has been shown to be regulated both at the transcriptional and post-translational level. A large number of transcription factor complexes and signalling pathways have been implicated in the positive and negative control of Snail-1 expression in various tissues. Snail-1 is repressed by the nucleosome remodelling and deacetylase (NuRD) complex, which functions downstream of the estrogen receptor, in human breast epithelial tissue[117]. It has been shown to be stimulated by Endothelian-1 (see below) in ovarian tissue[118], by Gli, a member of the Hedgehog pathway, in human basal cell carcinomas, human prostate cells and rat epithelial kidney cells[119], and by the "-catenin pathway in colorectal carcinoma cells[120]. It is likely that all these various pathways do have a role in control of Snail-1 expression in various cell types. Previously our laboratory demonstrated the modulation of Snail-1 expression by the ILK primarily though a responsive element within the Snail-1 promoter (see below). The  15  stability and cellular localization of Snail-1 is regulated by GSK-3 in a process similar to the regulation of "catenin[121]. GSK-3 directly phosphorylates Snail-1, on up to 7 serines, which results in their ubiquitination and subsequent degradation by the "-Trcp protease pathway[122].  Slug is another member of the Snail family that was first identified in chicken embryogenesis[112]. Slug is critical for the induction of EMT in chicken embryonic development, but this role is not maintained in all vertebrates. The expression of Slug does not correlate with EMT or the loss of E-cadherin expression during mouse embryogenesis[96, 123]. Unlike Snail-1, Slug null mice are viable and fertile, although they exhibit a post-natal growth deficiency[123]. In mice, Slug is not required for the generation, migration or development of the neural crest, the formation of the mesoderm, or the induction of EMT. Despite substantial evidence that, in mice, Slug is not involved in EMT during development, its expression has been correlated with the loss of E-cadherin in human breast carcinomas[99]. Overexpression of Slug in some epithelial cell lines resulted in the downregulation of E-cadherin[99]. In NBT-II rat bladder carcinoma cells the overexpression of Slug did not result in the loss of E-cadherin, but did downregulate components of the desmosomes, another cell-cell adhesion complex[113]. A role for Slug in EMT is probable although current evidence suggest that it is unlikely except in specific cellular contexts.  1.6.2 The Zeb Family  The Zeb family members are zinc-finger-homeodomain proteins that function as transcriptional repressors[8, 104, 124]. The Zeb family currently has two members, Zeb-1/dEF1 and Zeb-2/Sip-1 that have two clusters of zinc-fingers separated by a homeodomain[104, 125]. The amino-terminal cluster contains four zinc-fingers and the carboxy-terminal cluster contains three zinc-fingers, with each cluster being able  16  to independently bind to CACCT, a subset of the E-box motif[104, 125]. The repressor activity of the Zeblike proteins is mediated, at least in part, via its interaction with co-repressor C-terminal binding proteine (CtBP)[124, 126]. Zeb-1, like Snail-1, can repress both E-cadherin and MUC1 and its transcriptional repression is comparable to Snail-1, but requires 10-20 fold higher concentrations[8]. The co-expression of Zeb-1 with Snail-1 was observed in tumour cells with high E-cadherin repression[8] Zeb-1 and -2 are both expressed in normal E-cadherin negative tissues and are able to downregulate E-cadherin transcription in various epithelial cell lines[8, 104]. Zeb-1 is a transcriptional repressor that is important in the regulation of muscle and lymphoid differentiation[126-128]. It acts as a dominant repressor in muscle and lymphoid differentiation by competing with bHLH for E-box motifs in specific promoters. Zeb-1 and its Drosophila homolog zfh-1 are both regulated by Snail-1 in vivo, both show a temporal delay in expression and both persist after Snail-1 is downregulated[8, 124, 126]. Zeb-1 null mice are viable, but demonstrate skeletal deformities and severe T cell deficiency[124, 129, 130]. The expression of Zeb-1 is detectable in mesodermal tissue after the cells have undergone EMT and the outline of tissue has been established, implicating it in maintenance, but not induction of the EMT[124]. Zeb-2 was first identified based on its ability to bind to the transforming growth factor signal pathway components SMAD-1, -2, -3 and -5 via its MH2 domain[131-133]. Zeb-2 expression is upregulated by TGF-" treatment and may be important in TGF-" mediated EMT[104]. Both Zeb-1 and -2 are possible candidates for mediating EMT in carcinomas.  17  1.7 Integrin-Linked Kinase  ILK is a proto-oncogene that is an important component of the PI3-kinase signalling pathway, and mediates changes in a wide range of cellular processes. Aberrant ILK activation causes anchorage independent growth in soft agar [134], tumorigenicity in nude mice, cell cycle progression, and EMT [135137]. ILK is a PI3-kinase-dependent serine/threonine protein kinase[134, 138-141]. It is a 452 amino acid residue protein and has an apparent molecular mass of 59 KDa[140]. ILK was identified in a yeast-two hybrid screen as a protein that interacts with the cytoplasmic portion of "1 and "3 integrins and was confirmed by co-immunoprecipitation (CoIP) and immunostaining[134]. The integrin interacting domain is in the C-terminus of ILK, within the kinase catalytic domain[134]. Co-localization studies demonstrated that ILK was found with the "1 integrin at focal adhesion sites, but interestingly not at cell-cell adhesion sites, which also contain high levels of the "1 integrin[134]. ILK is expressed in virtually all mammalian cell types, with the highest expression in cardiac and skeletal muscle. ILK is evolutionarily conserved, with homologues identified in human, mouse, rat, Drosophila, and C. elegans [134, 142-145]. The mouse and human ILK genes are 99% identical[146]. ILK contains four ankyrin repeats in the N terminus, which mediate protein-protein interactions. Immediately C-terminal to the ANK domain is a sequence that is similar to a pleckstrin homology (PH) domain, which is involved in the binding of phosphoinositides. Finally, a serine/threonine kinase catalytic domain is located at the Cterminus[147, 148]. Sequence analysis of ILKs kinase domain reveals that it is an atypical kinase domain that diverges at three subdomains (I, VIB and VII) that are generally highly conserved[149]. These divergences from the typical kinase domain raise questions about ILKs identity as a bona fide protein kinase, however the ILK sequence does not show any variance in the other crucial subdomains, including  18  those necessary for ATP binding and furthermore, other true proteins kinases that diverge at subdomain I have been identified[138, 141, 149].  1.7.1 ILK and EMT  ILK induces complete EMT in some epithelial cell lines[135, 150]. Overexpression of ILK in the Scp2 mouse mammary epithelial cell line resulted in the induction of EMT[135]. Downregulation of cytokeratin 18[135], MUC1[8] and E-cadherin expression[8, 135, 150], stimulation of fibronectin matrix assembly[135, 150] and vimentin expression[135], redistribution of "-catenin to the cytoplasm and nucleus[84, 151], and the induction of "-catenin/LEF1 target gene transcription all characterize induction of ILK mediated EMT[84] [151-153]. Conversely, the inhibition of ILK activity with either a dominant negative ILK construct or a specific small molecule ILK inhibitor, in the low E-cadherin expressing SW480 human colon carcinoma cell line, resulted in upregulation of E-cadherin and downregulation of LEF1 expression[151]. Concomitant with upregulation of E-cadherin in SW480 cells was the downregulation of the transcriptional repressor Snail1[151]. The downregulation of Snail-1 expression is primarily mediated by the SIRE, which is located in the Snail-1 5' promoter. Overexpression of ILK in epithelial cells can induce EMT, likely via the transcriptional regulation of members of the Snail and Zeb families of transcriptional repressors. In ovarian cancer cells the Endothelin A receptors (ETAR)/Endothelin-1 axis can cause EMT in an ILK-dependent manner[118, 154-156]. The ETAR/ET-1 EMT is characterized by ILK-mediated activation of "-catenin/TCF, induction of Snail-1 expression and loss of E-cadherin expression[118]. This activation of ILK also inhibits the phosphorylation of GSK-3" on serine 9, resulting in the stabilization of both "-catenin and Snail-1.  19  ILK has been implicated in EMT resulting in the fibrosis of the renal tubular epithelium[157-159]. Transforming Growth Factor (TGF)-"1 stimulates the expression of ILK in renal tubular epithelium after chronic injury[157, 160]. In human kidney cells (HKC) treatment with TGF-"1 results in the Smaddependent upregulation of ILK expression[160]. Li et al demonstrated in this study that Snail-1 is not induced due to TGF-"1 treatment, however this conclusion must be carefully weighed since antibodies for Snail-1 have low sensitivity that may be masked by the strong positive control, which was the antigen used to generate the antibody ectopically expressed in a cell line. Western blots using a cell line which endogenously expresses Snail-1 as positive control, promoter activity studies using luciferase reporter constructs or messenger RNA (mRNA) quantification with quantitative PCR (qPCR) are needed to determine if Snail-1 lies downstream of TGF-"1 in HKC. Despite this the role for ILK in EMT resulting in fibrotic disease in the kidney is compelling.  1.7.2 PI3-Kinase and ILK Kinase Activation  ILK activity is PI3-kinase dependent and is rapidly and transiently activated by integrin engagement, growth factor stimulation or insulin stimulation. PI3-kinase is a receptor proximal intracellular effector that is activated by a variety of extracellular signals[161]. Upon activation, PI3-kinase phosphorylates the phospholipid phosphatidylinositol 4,5-bisphosphate (PIP2) converting it to phosphatidylinositol 3,4,5-triphosphate (PIP3), a second messenger that functions by recruiting proteins that contain PH domains, to the plasma membrane[161]. The activity of PI3-kinase is antagonized by the PI(3,4,5)P3 phosphatase tumour suppressor PTEN, which dephosphorylates PI(3,4,5)P3 back to PI(4,5)P2[161] (see below). PI3-kinase mediates changes in cell behaviour mainly via the activation of ILK,  20  AKT and p70S6-kinase, or the inhibition of GSK-3". PI3-kinase is proposed to activate ILK through the binding of PIP3 to ILKs PH-like domain, since PIP3 is also able to stimulate ILK kinase activity in vitro [162].  1.7.3 PTEN  PTEN is a critical tumour suppressor protein that is one of the most common mutations in sporadic human cancers (for review see [163]). It is a phospholipase that dephosphorylates PIP3 back to its PIP2 form, thus acting as an antagonist to PI3-kinase activity[164]. Both PI3-kinase and its product PIP3 positively regulate ILK activity, therefore PTEN acts to inhibit ILK activity[84, 165]. Prostate cancer cells, which lack PTEN, have constitutively high levels of ILK activity, resulting in the constitutive downstream activation of the AKT pathway[165]. PTEN is a critical regulator of numerous signalling pathways including the ILK/AKT pathway.  1.7.4 ILK Kinase Targets  A number of targets of ILKs kinase activity have been identified: AKT, GSK-3, myosin light chain kinase, the adaptor protein "-parvin/affixin and ILK itself[134, 141, 149, 162, 166]. The two key targets of ILKs kinase activity and downstream effectors are AKT and GSK-3.  1.7.5 Regulation of AKT  The protein kinase AKT is an important target of ILKs kinase activity. AKT becomes activated when it is phosphorylated on two conserved residues, threonine 308 and serine 473, by the PI3-kinase-  21  dependent protein kinases Protein Dependent Kinase (PDK)-1[167-170] and PDK-2 respectively[169]. ILK is a kinase that functions as a PDK-2 in some cellular contexts[84, 138, 149, 162, 165, 171, 172]. AKT mediates various cellular processes, such as cell survival, cell cycle progression and transcriptional regulation. AKT stimulates the transcriptional activity of "-catenin/LEF1 and AP-1 by inhibiting GSK-3" activity[151, 162, 173-178] (Fig. 1.4). AKT is a key component downstream of ILK signalling. Figure 1.4 Schematic of PI3-kinase/ILK/AKT signalling axis. The kinase activity of ILK is activated in a PI3kinase dependent manner downstream of integrins, RTK and G-coupled protein receptors. ILK signals downstream via AKT and GSK-3 to affect gene transcription.  22  1.7.6 Regulation of GSK-3"  ILK phosphorylates and inhibits GSK-3 activity directly and indirectly via activation of AKT, another GSK-3 kinase[151, 162, 171, 174, 175]. There are 2 distinct GSK-3 proteins, GSK-3! and GSK-3", which are partially redundant, that regulate both glycogen metabolism and cell proliferation[179, 180]. However GSK-3! is unable to substitute completely for GSK-3", as loss of GSK-3" is embryonic lethal[181]. GSK3! and GSK-3" activity is inhibited by the phosphorylation of serine 21 and serine 9, respectively. This results in stabilisation of several proteins, including "-catenin[74-81], cyclin D1, c-jun and Snail-1[122], and the activation or repression of target genes. GSK-3 is important in the regulation of the conatical Wnt signalling pathway (see above) via the regulation of "-catenin localization and stability. The dysregulation of the Wnt signalling pathway often contributes to oncogenesis. GSK-3 also regulates the Snail-1 (see above) and cyclin D1 proteins by a similar mechanism to that of "-catenin. Phosphorylation of GSK-3 by Akt or ILK inhibits its kinase activity, thereby increasing Snail-1 and cyclin D1 levels[121, 122, 182]. The regulation of Snail-1 and cyclin D1 impacts on gene expression, cell morphology and the cell cycle. Regulation of GSK-3 kinase activity is critical in epithelial homeostatsis and its dysregulation is important in many carcinomas.  1.7.7 Adapter Function of ILK  ILK not only functions as a kinase in the PI3-kinase signalling cascade, it also functions as an adapter proteins that links the integrin complexes, the RTK complexes and the actin cytoskeleton. Interacting proteins include Particularly Interesting New Cys-His protein (PINCH), !-parvin/ Calponinhomology-domain-containing ILK-binding protein (CH-ILKBP)/actopaxin[183, 184], "-parvin/Affixin[166] and  23  paxillin[143, 185]. The function of ILK as an adapter protein is not explored in this thesis and so details will only briefly be discussed here. The N-terminal ankyrin (ANK) domain of ILK has been shown to interact with the LIM1 domain of the adapter protein PINCH-1[186, 187]. Its interaction with PINCH-1 potentially provides a physical link between ILK, receptor tyrosine kinases (RTK) and PI3-kinase, via the PINCH-1 interacting protein Noncatalytic region of tyrosine kinase (NCK)-2[148, 188, 189] and Insulin Receptor Substrate (IRS)[190]. The ILK, PINCH-1 and NCK-2 protein complex may be important in the integrin and RTK clustering that occurs upon cell stimulation. PINCH-1 is also required for the localization of ILK to focal adhesion plaques. It exists in a ternary complex with ILK and !-parvin/CH-ILKBP/actopaxin [184, 186]. This complex is assembled and recruited to integrins upon cell adhesion, where it contributes to cell spreading[183]. ILK is also able to interact with PINCH-2 [183, 191]. It is hypothesized that PINCH-2 regulates binding of ILK to PINCH-1, as overexpression of PINCH-2 inhibits the PINCH-1/ILK interaction. The parvin family of proteins physically link ILK to the actin cytoskeleton. !-parvin is a calponin homology (CH) domain containing protein that forms a complex not only with ILK and PINCH-1, but also with ILK, paxillin and F-actin[192]. The interaction of !-parvin and ILK within the cytoskeletal fraction stimulates the kinase activity of ILK, which is regulated in a PI3-kinase dependent manner[193]. This demonstrates that the kinase and adapter functions of ILK are not mutually exclusive. Paxillin is an adaptor protein that interacts with the C-terminal domain of ILK. Paxillin is recruited to focal adhesion sites upon integrin engagement[194]. It also binds several focal adhesion proteins, including Focal Adhesion Kinase (FAK), vinculin, and !-parvin[143]. The interaction between ILK and paxillin is required for ILKs correct localization to focal adhesions[143]. Although the fuction of ILK as an adapter  24  protein is not explored in this thesis, the linking of RTK, integrins and the actin cytoskeleton likely has profound effects on EMT.  1.8 PARP  We identified the 116 kDa nuclear protein PARP-1, the prototypic member of the of the PARP family, as a SIRE binding protein that regulated the expression of Snail-1 downstream of ILK. The PARP family members all contain a PARP domain that is involved in catalysing the addition of poly(ADP-ribose) units onto target proteins. PARP-1 contains an N-terminal DNA binding Domain (DBD) that contains two zinc finger domains (reviewed in [195]). The DBD is able to bind to a variety of DNA structures: single and double strand breaks, crossovers, cruciforms, supercoils and specific DNA sequences[196]. The central region of the protein contains, from N-terminus to C-terminus, a Nuclear Localization Signal (NLS), a central automodification domain containing a Breast Cancer Gene (BRCA) 1 C-terminal (BRCT) motif and a WGR domain[195]. The automodification domain contains the majority of the 15 glutamic acid residues that are the acceptor sites for poly-ADP ribose polymers[195]. The WGR domain is named after the central conserved amino acids and has unknown function. The BRCT is found primarily in proteins involved in cell cycle checkpoints functions responsive to DNA damage[197]. The function of the BRCT domain is not fully understood, but has been shown to be a phospho-protein binding domain[198] and to mediate protein dimerization with other BRCT domain containing proteins, such as BRCA-1 and -2[199, 200]. This is particularly interesting as drugs targeting PARP-1 have been efficacious in BRCA-1 and -2 cancers (see below). The PARP motif is located at the C-terminus of the protein and in PARP-1 this domain is 100% conserved in vertebrates[201]. PARP-1 is known primarily for its role in sensing DNA damage and recruiting repair machinery, but a role for PARP-1 as a co-factor in transcriptional complexes has recently emerged. The mechanism of  25  how PARP-1 functions as a co-factor, and the role of its enzymatic activity, appears to be context dependent. In some transcription factor complexes inactive PARP-1 is important in the transcriptional repression of target genes, which then switches to a role in transcriptional activation upon polymerase activation. In others inactive PARP-1 is important in transcriptional activation of target genes, which then switches to a role in transcriptional repression upon polymerase activation. In addition poly(ADP)ribosylation may result in a more open chromatin due to the addition of the negatively charged ADP-ribose residues. This was identified in drosophila in which actively transcribed loci had local loosening of chromatin, termed puffs, which contained elevated levels of PARP and poly(ADP)-ribosylated proteins[202]. The role of PARP-1 in the regulation of transcription factors and structure of local chromatin may not be mutually exclusive. Here we provide two examples of PARP-1 functioning as a transcriptional co-factor to demonstrate the diverse mechanism of action.  1.8.1 Co-factor Function of PARP-1 in Transcriptional Repression and Activation of MASH1[203]  Differentiating neuronal stem cells (NSC) are maintained in a pluripotent state by the repression of genes such as mammalian achate schute homolog (MASH) 1, a bHLH transcription factor. MASH1 repression is maintained by the DNA binding protein Hairy/Enhancer of split (HES) 1. HES1 mediated repression is dependent upon interaction with the Groucho (Gro)/Transducin-like enhancer of split(TLE) 1 co-repressor complex. A proteomic study demonstrated that the functional TLE1 complex contains minimally TLE1, HES1, PARP-1, Topoisomerase IIb, RAD50, nucleolin, Heat shock protein (HSP) 70, non-muscle myosin II heavy chain, p54 nuclear RNA binding protein (p54nrb), "-actin and nucleophosmin, which are all transcribed in NSC and the brain. It was shown that PARP-1 activity was not required for the function of the TLE1 co-  26  repressor complex. Induction of MASH1 transcription results from the activation of Calmodulin kinase (CaMK) II# and dismissal of the TLE1 complex from HES1, with the exception of PARP-1 and p54nrb. MASH1 activation requires the poly-ADP ribosylation of components of the TLE1 complex, with the exception of p54nrb. This poly-ADP ribosylation is hypothesized to cause the dissociation of TLE1 complex from the MASH1 promoter. The polymerase activity of PARP-1 may be activated by phosphorylation catalyzed by CaMKII#. This study demonstrates that the modulation of PARP-1 activity is critical in the modulation of gene transcription. Unlike other studies on the role of PARP-1 in transcription, Ju et al. characterized the affects of not only inhibiting PARP-1 activity, but also the affect of stimulating PARP-1 activity had on transcription.  1.8.2 Co-factor Function of PARP-1 in "-catenin/TCF4 Transcriptional Activation[204]  In colorectal carcinoma the canotical "-catenin pathway is frequently dysregulated, resulting in the activation of the "-catenin/TCF transcription complex (see above). TCF4 is the only TCF gene that is commonly expressed in colorectal cancer cells [77, 79]. In colorectal cancer cells expression of a dominant negative TCF4 inhibits expression of proliferative and differentiation genes, restores epithelial polarity, and converts cells back to a single layer of columnar epithelium cells. PARP-1 appears to interact directly with TCF4 and indirectly with "-catenin via TCF4. This interaction has been shown to augment the activity of the "-catenin/TCF4 complex. PARP-1s ability to augment "-catenin/TCF4 transcriptional activity is dependent on "-catenin activation. The exact role of PARP-1 enzymatic activity in "-catenin/TCF4 transcription is currently unclear. PARP-1 mutants lacking the catalytic domain bind TCF4, but do not enhance "-catenin/TCF4 activity. TCF4 and "-catenin are not poly-ADP ribosylated and inhibition of PARP-1 activity did not affect their  27  transcriptional activity. However, the auto-modification of PARP-1 does interfere with its ability to interact with TCF4. Therefore PARP-1 binding to TCF4 is not sufficient to enhance "-catenin/TCF4 transcriptional activity. The catalytic domain of PARP-1, but not its enzymatic activity was required for the augmentation of "-catenin/TCF transcriptional activity. Activation of PARP-1 resulting in automodification could block its ability to interact with TCF4 and enhance "-catenin/TCF4 transcriptional activation. Further study is required to determine the role of PARP-1s enzymatic activity in the function of the "-catenin/TCF4 transcription factor complex.  1.8.3 Poly(ADP-Ribose) Polymerases  ADP-ribosylation involves the addition of a single ADP-ribose unit, mono-ADP-ribosylation, or multiple ADP-ribose units in linear or multi-branched polymers, poly-ADP-ribosylation, onto target proteins (Fig. 1.5). The addition of ADP-ribose units to target proteins is a post-translational modification that is emerging as a major signalling mechanism in a wide variety of cellular processes. ADP-ribosyltransferase activity was first discovered in the Diphtheria toxin and Pseudomonas exotoxin A[201]. Two families of toxin-related ADP-ribosylases have been identified in humans [201, 205, 206], the RT6 and PARP families. The RT6 family are Glycosylphosphatidylinositol-anchored and secretory mono(ADP-ribosyl)transferases, which catalyse the addition of single ADP-ribose units to cell surface and secretory proteins [201, 207]. The PARP family of proteins poly-ADP-ribosylates nuclear and cytoplasmic proteins[201]. Both enzymatic reactions use the biomolecule nicotinamide adenine dinucleotide (NAD+) as the substrate for the ADP-ribose moiety, meaning that their addition is an energetically expensive process. The presence of poly(ADP-ribose) polymerase activity is highly conserved, being detectable in organisms from archeabacteria to mammals, although surprisingly it is lacking in yeast[196]. In humans, 17  28  members of the PARP superfamily have been identified using amino acid similarity, intron positions and fused protein domains[201, 208]. Initially 18 members were identified[209], but further analysis of the high quality human genome sequence suggests that PARP-5c is a truncated cDNA from PARP-5b/Tankeryase (TNK)-2, as no distinct gene was identified[201]. The entire family of PARP proteins is highly conserved with orthologues for all members, except PARP-15, identified in mice and the pufferfish T. nigroviridis[201]. With the exception of yeast, all lower eukaryotes possess poly(ADP-ribose) polymerase activity, but have fewer PARP genes[201]. The PARP motif from the prototypic family member PARP-1 is 100% conserved in vertebrates[201] highlighting the importance of PARPs enzymatic activity. Not only is the core region of PARP-1 highly conserved, but the core region of other PARP members is also conserved. The conservation of the core region between humans and mice is 100% in TNK1, TNK2, PARP-11, PARP-7, PARP-6 and PARP-8, greater than 90% in PARP-2, PARP-3, PARP-4, PARP-10, PARP-12 and PARP-16, 82% in PARP-9 and PARP-14 and 70% in PARP-13[201]. Although all family members possess the PARP motif, it is unclear whether all members have retained ADP-ribose polymerase activity, due to varying sequence conservation[208]. Further investigation is required to determine if the various family members have retained any polymerase activity. Each ADP-ribose residue contains an adenosine moiety, capable of base stacking and hydrogen bonding, and two phosphate groups that carry a negative charge[196]. The addition of ADP-ribose polymers has profound affects on the function of the acceptor protein by positively or negatively altering its enzymatic activity and/or its ability to bind DNA, RNA or other proteins[196]. The modulation of the acceptor protein function may be due to steric hindrance, addition of negative charges or by physically blocking binding domains[196]. In addition it may provide new binding sites for specific proteins, as a poly-ADPribose binding motif of 20 amino acids and the Macrodomain of approximately 190 amino acids, have been  29  identified as domains that can bind to ADP-ribose polymers[196]. The DNA-binding domains of some proteins may even have a greater affinity for poly-ADP-ribose polymers than DNA[210]. The length of ADP-ribose polymers is heterogeneous. In vitro polymers as long as 200 units, with approximately one branch per 20-50 units, were observed[195, 196]. The length of individual polymers may depend on various factors, such as metabolic state of cell, cell type and signalling context. The larger polymers are formed due to DNA damage, which results in the global activation of PARP-1 polymerase activity[196]. However, the significance of the length and extent of branching is unknown, but may play a role in determining specific cellular responses in vivo. In particular it may determine whether the process of DNA repair or apoptosis is initiated[196]. It is hypothesized that subtle local activation of PARP-1 polymerase activity, which results in the formation of shorter polymers, may be important in the activity of various transcription factor complexes[211].  30  Figure 1.5 Molecular structure of a branched ADP-ribose polymer covalently attached to an acceptor protein. The addition of ADP-ribose units is catalyzed by PARP proteins using NAD+ as a substrate.  The addition of ADP-ribose polymers is a reversible modification, with the polymers being degraded by poly(ADP-ribose)glycohydrolase (PARG). PARG is an enzyme with both endo- and exonuclease activity that is capable of degrading the poly-ADP-ribose polymer[212]. The reversible addition of ADP-ribose to target proteins is similar to the addition of phosphate groups, a reversible post-translational protein modification that consumes the energetically expensive molecule ATP.  31  1.8.4 Regulation of PARP-1 Polymerase Activity  The regulation of PARP-1 polymerase activity is an important regulatory mechanism since the polyADP ribosylation of proteins can have dramatic effects on their function. In the TLE1 co-repressor complex, the phosphorylation of PARP-1 by CaMKII# appears to activate PARP-1 polymerase activity[203], however the mechanisms responsible for the regulation of PARP-1 polymerase activity in other transcription factor complexes are unknown. Various proteins have been shown to regulate PARP-1 polymerase activity in the context of DNA damage and neuron depolarization. In H2O2 induced DNA damage, PARP-1 polymerase activity is regulated by its phosphorylation by JNK1[213]. This phosphorylation results in prolonged PARP-1 polymerase activity, but did not affect the early peak of polymerase activity[213]. Two mechanisms of PARP-1 polymerase activation due to cortical neuron depolarization have been proposed, which may be mutually exclusive. In depolarized cortical neurons Phospholipase C (PLC)-dependent intracellular mobilization of Ca++, due to the depolarisation of neurons, results in the rapid dose-dependent activation of PARP-1[214]. This activation is dependent on the mobilization of extra-nuclear Ca++ by IP3, a product of PLC mediated hydrolysis of PIP2. PARP-1 activation due to Ca++ mobilization is not affected by the addition of calmodulin or by preventing Cacalmodulin binding to CaMKII. This suggests that the activation of PARP-1 in this context is independent of CaMKII activity. Secondly the activity of PARP-1 can be modulated by its interaction with Kinesin superfamily protein KIF4[215]. In resting neurons the C-terminal tail of KIF4 binds and inhibits PARP-1. The depolarisation of neurons results in the induction of calcium signalling, mediated by CaMKII. This activation of CaMKII causes the dissociation of KIF4 from PARP-1, allowing the activation of PARP-1 activity and neuron survival. A full characterisation of PARP-1 phosphorylation sites, their respective protein kinases  32  and the effect on PARP-1 function is important for determining the role of PARP-1 in various signalling events, cell types and disease progression.  1.8.5 Inhibitors of PARP  The majority of PARP inhibitors developed mimic the nicotinamide moiety of NAD+, the PARP substrate. Nicotinamide, benzamide and in particular substituted benzamides such as 3-aminobenzamide (3-AB) were early PARP inhibitors identified using a high-throughput screens over 30 years ago. 3-AB inhibits PARP activity by interfering with the binding of NAD+, reducing enzyme activity, and by binding directly to damaged DNA, preventing the activation of PARP[216]. These inhibitors were not amenable to use in the clinic as they were not very specific or potent, requiring millimolar concentrations that have a toxic effect[217]. Third generation PARP inhibitors have been designed based on the structure of 3-AB. They demonstrate greatly increased potency and favourable pharmokinetics. As PARP enzymatic activity is required to repair single strand breaks in DNA its inhibitors have shown a therapeutic benefit in combination with some DNA damaging chemotherapeutics, radiation therapy and in some patients whose cancers have deficiencies in other DNA repair pathways, such as BRCA1 and BRCA2[218-221]. The hypothesized mechanism is that inability to efficiently repair single strand breaks prior to DNA replication results in the accumulation of damage and results in apoptosis. A number of PARP inhibitors have begun clinical trials, primarily in combination with other chemotherapeutic agents, but also as single agents. Iniparib (BSI 201/4iodo-3-nitrobenzamide) is the first PARP inhibitor to entered phase III clinical trials. The phase III trials will follow up on the phase II studies that demonstrated iniparib, in combination with gencitabine and carboplatin, resulted in improved outcomes for patients with metastatic triple-negative breast cancer (cancers lacking expression of estrogen receptor, progesterone receptor and Her2/neu)[221]. Phase II  33  studies are also being conducted on iniparib as a single agent. Other inhibitors such as AG014699[222, 223], Olaparib[224, 225] and Veliparib (ABT-888)[226-233] have also entered clinical trials.  1.8.6 PARG  Although PARP family and PARP-1 specifically have been extensively studied, little is know about PARG. PARG has been a particularly difficult protein to study due to is high rate of proteolysis[234]. What is known is that there is only one gene for PARG, but due to alternative start sites and proteolysis, there are a number of different isoforms[235]. The 110 kDa nuclear isoform and 65 kDa mitochondrial isoform appear to be the 2 predominant isoforms[236], whereas the 102 kDa isoform, lacking exon 1, and 99 kDa isoform, lacking exons 1 and 2, appear to be minor products of alternative start sites or in vitro artefacts due to proteolysis[237]. The full-length 110 kDa isoform contains a catalytic domain, NLS, nuclear export signal (NES) and putative regulatory domains[237]. PARG knockout mice are embryonic lethal at about E3.5, which corresponds with elevated poly(ADP-ribose) levels[238]. PARG -/- trophoblast stem cells can be cultured if done so in the presence of benzamide, a PARP inhibitor[238]. Upon the removal of the PARP inhibitor poly(ADP-ribose) begins to accumulate. It is detectable as early as 12 hours and peaks at 4-6 days when the cells die[238]. The deletion of PARG results in hypersensitivity to cell stress and DNA damage, both in vivo and in vitro[238]. Therefore PARG is critical for the prevention of cell death by preventing the accumulation of poly(ADP-ribose) polymers in the cell[238]. The study of PARG is further confounded by the lack of inhibitors[238]. Early inhibitors of PARG were found to be highly non-specific; newer inhibitors show higher specificity, but are not cell-permeable[238].  34  1.9 Conclusion  In this study we hypothesize that ILK signalling positively regulates Snail-1 transcription, which results the in repression of epithelial genes, such as E-cadherin, expression of mesenchymal genes and ultimately the induction of EMT. Progressing on previous data from our laboratory that determined that Snail-1 transcription by ILK signalling is mediated, at least in part, by the SIRE fragment in the Snail-1 5promoter. The objective of this study is to identify proteins that bind the SIRE fragment which are regulated by ILK. We identified three candidate SIRE binding proteins that bound the SIRE in the presence but not the absence of ILK protein expression. We demonstrate that one of the identified SIRE binding proteins, PARP-1, is a SIRE binding protein and plays a role in the regulation of E-cadherin. We also characterized the mechanism by which ILK regulates PARP-1 and found that ILK signalling inhibits the polymerase activity of PARP-1 resulting in its association with the SIRE fragment. The results of this study identify PARP-1 as a new protein involved in the process of EMT in cancer progression.  35  1.10 References  1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.  Savagner, P., Leaving the neighborhood: molecular mechanisms involved during epithelialmesenchymal transition. Bioessays, 2001. 23(10): p. 912-23. Thiery, J.P., Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer, 2002. 2(6): p. 442-54. D'Assoro, A.B., et al., Abrogation of p53 function leads to metastatic transcriptome networks that typify tumor progression in human breast cancer xenografts. Int J Oncol, 2010. 37(5): p. 1167-76. Lin, K., et al., The Role of B-RAF Mutations in Melanoma and the Induction of EMT via Dysregulation of the NF-kappaB/Snail/RKIP/PTEN Circuit. Genes Cancer, 2010. 1(5): p. 409420. Kong, D., et al., Epithelial to mesenchymal transition is mechanistically linked with stem cell signatures in prostate cancer cells. PLoS One, 2010. 5(8): p. e12445. Kaartinen, V., et al., TGFbeta3-induced activation of RhoA/Rho-kinase pathway is necessary but not sufficient for epithelio-mesenchymal transdifferentiation: implications for palatogenesis. Int J Mol Med, 2002. 9(6): p. 563-70. Hay, E.D., An overview of epithelio-mesenchymal transformation. Acta Anat (Basel), 1995. 154(1): p. 8-20. Guaita, S., et al., Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem, 2002. 277(42): p. 39209-16. Bellusci, S., et al., A scatter factor-like factor is produced by a metastatic variant of a rat bladder carcinoma cell line. J Cell Sci, 1994. 107 ( Pt 5): p. 1277-87. Thiery, J.P., et al., Epithelial-mesenchymal transitions in development and disease. Cell, 2009. 139(5): p. 871-90. Ohta, S., G.C. Schoenwolf, and G. Yamada, The cessation of gastrulation: BMP signaling and EMT during and at the end of gastrulation. Cell Adh Migr, 2010. 4(3): p. 440-6. Acloque, H., et al., Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Invest, 2009. 119(6): p. 1438-49. Kuure, S., R. Vuolteenaho, and S. Vainio, Kidney morphogenesis: cellular and molecular regulation. Mech Dev, 2000. 92(1): p. 31-45. Barasch, J., Genes and proteins involved in mesenchymal to epithelial transition. Curr Opin Nephrol Hypertens, 2001. 10(3): p. 429-36. Janda, E., et al., Ras and TGF[beta] cooperatively regulate epithelial cell plasticity and metastasis: dissection of Ras signaling pathways. J Cell Biol, 2002. 156(2): p. 299-313. Gould, S.J. and E.S. Vrba, Exaptation; a missing term in the science of form. Paleobiology, 1982. 8(1): p. 4-15. Hahn, W.C., et al., Creation of human tumour cells with defined genetic elements. Nature, 1999. 400(6743): p. 464-8. Hanahan, D. and R.A. Weinberg, The hallmarks of cancer. Cell, 2000. 100(1): p. 57-70. Sporn, M.B., The war on cancer. Lancet, 1996. 347(9012): p. 1377-81. Eccles, S.A. and D.R. Welch, Metastasis: recent discoveries and novel treatment strategies. Lancet, 2007. 369(9574): p. 1742-57.  36  21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43.  Lukashev, M.E. and Z. Werb, ECM signalling: orchestrating cell behaviour and misbehaviour. Trends Cell Biol, 1998. 8(11): p. 437-41. Varner, J.A. and D.A. Cheresh, Integrins and cancer. Curr Opin Cell Biol, 1996. 8(5): p. 72430. Ning, S., et al., Anti-alphav integrin monoclonal antibody intetumumab enhances the efficacy of radiation therapy and reduces metastasis of human cancer xenografts in nude rats. Cancer Res, 2010. 70(19): p. 7591-9. Giancotti, F.G. and E. Ruoslahti, Integrin signaling. Science, 1999. 285(5430): p. 1028-32. Aplin, A.E., et al., Signal transduction and signal modulation by cell adhesion receptors: the role of integrins, cadherins, immunoglobulin-cell adhesion molecules, and selectins. Pharmacol Rev, 1998. 50(2): p. 197-263. Coussens, L.M. and Z. Werb, Matrix metalloproteinases and the development of cancer. Chem Biol, 1996. 3(11): p. 895-904. Chambers, A.F. and L.M. Matrisian, Changing views of the role of matrix metalloproteinases in metastasis. J Natl Cancer Inst, 1997. 89(17): p. 1260-70. Rose, A.A., et al., ADAM10 releases a soluble form of the GPNMB/Osteoactivin extracellular domain with angiogenic properties. PLoS One, 2010. 5(8): p. e12093. Yamada, T., et al., Overexpression of MMP-13 gene in colorectal cancer with liver metastasis. Anticancer Res, 2010. 30(7): p. 2693-9. Stetler-Stevenson, W.G., Matrix metalloproteinases in angiogenesis: a moving target for therapeutic intervention. J Clin Invest, 1999. 103(9): p. 1237-41. Bergers, G. and L.M. Coussens, Extrinsic regulators of epithelial tumor progression: metalloproteinases. Curr Opin Genet Dev, 2000. 10(1): p. 120-7. Werb, Z., ECM and cell surface proteolysis: regulating cellular ecology. Cell, 1997. 91(4): p. 439-42. McCready, J., et al., Secretion of extracellular hsp90alpha via exosomes increases cancer cell motility: a role for plasminogen activation. BMC Cancer, 2010. 10: p. 294. Kerk, N., et al., The mechanism of melanoma-associated thrombin activity and von Willebrand factor release from endothelial cells. J Invest Dermatol, 2010. 130(9): p. 2259-68. Wynn, T.A., Cellular and molecular mechanisms of fibrosis. J Pathol, 2008. 214(2): p. 199210. Strieter, R.M., B.N. Gomperts, and M.P. Keane, The role of CXC chemokines in pulmonary fibrosis. J Clin Invest, 2007. 117(3): p. 549-56. Varga, J. and D. Abraham, Systemic sclerosis: a prototypic multisystem fibrotic disorder. J Clin Invest, 2007. 117(3): p. 557-67. Bataller, R. and D.A. Brenner, Liver fibrosis. J Clin Invest, 2005. 115(2): p. 209-18. Albanis, E. and S.L. Friedman, Antifibrotic agents for liver disease. Am J Transplant, 2006. 6(1): p. 12-9. Remuzzi, G., P. Ruggenenti, and A. Benigni, Understanding the nature of renal disease progression. Kidney Int, 1997. 51(1): p. 2-15. Fine, L.G., A.C. Ong, and J.T. Norman, Mechanisms of tubulo-interstitial injury in progressive renal diseases. Eur J Clin Invest, 1993. 23(5): p. 259-65. Eddy, A.A., Molecular insights into renal interstitial fibrosis. J Am Soc Nephrol, 1996. 7(12): p. 2495-508. D'Amico, G., F. Ferrario, and M.P. Rastaldi, Tubulointerstitial damage in glomerular diseases: its role in the progression of renal damage. Am J Kidney Dis, 1995. 26(1): p. 12432.  37  44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63.  Rattner, A. and J. Nathans, Macular degeneration: recent advances and therapeutic opportunities. Nat Rev Neurosci, 2006. 7(11): p. 860-72. Wynn, T.A., Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J Clin Invest, 2007. 117(3): p. 524-9. Quan, T.E., S.E. Cowper, and R. Bucala, The role of circulating fibrocytes in fibrosis. Curr Rheumatol Rep, 2006. 8(2): p. 145-50. Yeh, Y.C., et al., Transforming growth factor-{beta}1 induces Smad3-dependent {beta}1 integrin gene expression in epithelial-to-mesenchymal transition during chronic tubulointerstitial fibrosis. Am J Pathol, 2010. 177(4): p. 1743-54. Pardo, A. and M. Selman, Matrix metalloproteases in aberrant fibrotic tissue remodeling. Proc Am Thorac Soc, 2006. 3(4): p. 383-8. Llorens, A., et al., Down-regulation of E-cadherin in mouse skin carcinoma cells enhances a migratory and invasive phenotype linked to matrix metalloproteinase-9 gelatinase expression. Lab Invest, 1998. 78(9): p. 1131-42. Shiozaki, H., et al., E-cadherin mediated adhesion system in cancer cells. Cancer, 1996. 77(8 Suppl): p. 1605-13. Perl, A.K., et al., A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature, 1998. 392(6672): p. 190-3. Vleminckx, K., et al., Genetic manipulation of E-cadherin expression by epithelial tumor cells reveals an invasion suppressor role. Cell, 1991. 66(1): p. 107-19. Wheelock, M.J. and P.J. Jensen, Regulation of keratinocyte intercellular junction organization and epidermal morphogenesis by E-cadherin. J Cell Biol, 1992. 117(2): p. 41525. Gumbiner, B.M., Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell, 1996. 84(3): p. 345-57. Riethmacher, D., V. Brinkmann, and C. Birchmeier, A targeted mutation in the mouse Ecadherin gene results in defective preimplantation development. Proc Natl Acad Sci U S A, 1995. 92(3): p. 855-9. Larue, L., et al., E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci U S A, 1994. 91(17): p. 8263-7. Levine, E., et al., Selective disruption of E-cadherin function in early Xenopus embryos by a dominant negative mutant. Development, 1994. 120(4): p. 901-9. Burdsal, C.A., C.H. Damsky, and R.A. Pedersen, The role of E-cadherin and integrins in mesoderm differentiation and migration at the mammalian primitive streak. Development, 1993. 118(3): p. 829-44. Takeichi, M., Morphogenetic roles of classic cadherins. Curr Opin Cell Biol, 1995. 7(5): p. 619-27. Adams, C.L. and W.J. Nelson, Cytomechanics of cadherin-mediated cell-cell adhesion. Curr Opin Cell Biol, 1998. 10(5): p. 572-7. Kemler, R., From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet, 1993. 9(9): p. 317-21. Tepass, U., et al., Cadherins in embryonic and neural morphogenesis. Nat Rev Mol Cell Biol, 2000. 1(2): p. 91-100. Renaud-Young, M. and W.J. Gallin, In the first extracellular domain of E-cadherin, heterophilic interactions, but not the conserved His-Ala-Val motif, are required for adhesion. J Biol Chem, 2002. 277(42): p. 39609-16.  38  64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83.  Nose, A., K. Tsuji, and M. Takeichi, Localization of specificity determining sites in cadherin cell adhesion molecules. Cell, 1990. 61(1): p. 147-55. Kitagawa, M., et al., Mutation analysis of cadherin-4 reveals amino acid residues of EC1 important for the structure and function. Biochem Biophys Res Commun, 2000. 271(2): p. 358-63. Halbleib, J.M. and W.J. Nelson, Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev, 2006. 20(23): p. 3199-214. Chen, Y.T., D.B. Stewart, and W.J. Nelson, Coupling assembly of the E-cadherin/betacatenin complex to efficient endoplasmic reticulum exit and basal-lateral membrane targeting of E-cadherin in polarized MDCK cells. J Cell Biol, 1999. 144(4): p. 687-99. Gottardi, C.J., E. Wong, and B.M. Gumbiner, E-cadherin suppresses cellular transformation by inhibiting beta-catenin signaling in an adhesion-independent manner. J Cell Biol, 2001. 153(5): p. 1049-60. Huber, O., et al., Nuclear localization of beta-catenin by interaction with transcription factor LEF-1. Mech Dev, 1996. 59(1): p. 3-10. Miller, J.R. and R.T. Moon, Signal transduction through beta-catenin and specification of cell fate during embryogenesis. Genes Dev, 1996. 10(20): p. 2527-39. Barth, A.I., et al., NH2-terminal deletion of beta-catenin results in stable colocalization of mutant beta-catenin with adenomatous polyposis coli protein and altered MDCK cell adhesion. J Cell Biol, 1997. 136(3): p. 693-706. Behrens, J., et al., Functional interaction of beta-catenin with the transcription factor LEF-1. Nature, 1996. 382(6592): p. 638-42. Molenaar, M., et al., XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell, 1996. 86(3): p. 391-9. Bienz, M., APC: the plot thickens. Curr Opin Genet Dev, 1999. 9(5): p. 595-603. Browne, S.J., et al., The adenomatous polyposis coli protein and retinoblastoma protein are cleaved early in apoptosis and are potential substrates for caspases. Cell Death Differ, 1998. 5(3): p. 206-13. Gumbiner, B.M., Propagation and localization of Wnt signaling. Curr Opin Genet Dev, 1998. 8(4): p. 430-5. Morin, P.J., et al., Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science, 1997. 275(5307): p. 1787-90. Hart, M.J., et al., Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr Biol, 1998. 8(10): p. 573-81. Korinek, V., et al., Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science, 1997. 275(5307): p. 1784-7. Batsche, E., et al., RB and c-Myc activate expression of the E-cadherin gene in epithelial cells through interaction with transcription factor AP-2. Mol Cell Biol, 1998. 18(7): p. 364758. Seidensticker, M.J. and J. Behrens, Biochemical interactions in the wnt pathway. Biochim Biophys Acta, 2000. 1495(2): p. 168-82. Munemitsu, S., et al., Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc Natl Acad Sci U S A, 1995. 92(7): p. 3046-50. Rubinfeld, B., et al., Association of the APC gene product with beta-catenin. Science, 1993. 262(5140): p. 1731-4.  39  84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94.  95. 96. 97. 98. 99. 100. 101. 102.  Persad, S., et al., Tumor suppressor PTEN inhibits nuclear accumulation of beta-catenin and T cell/lymphoid enhancer factor 1-mediated transcriptional activation. J Cell Biol, 2001. 153(6): p. 1161-74. Batlle, E., et al., The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol, 2000. 2(2): p. 84-9. Hennig, G., et al., Mechanisms identified in the transcriptional control of epithelial gene expression. J Biol Chem, 1996. 271(1): p. 595-602. Ji, X., et al., Transcriptional defects underlie loss of E-cadherin expression in breast cancer. Cell Growth Differ, 1997. 8(7): p. 773-8. Giroldi, L.A., et al., Role of E boxes in the repression of E-cadherin expression. Biochem Biophys Res Commun, 1997. 241(2): p. 453-8. Auerkari, E.I., Methylation of tumor suppressor genes p16(INK4a), p27(Kip1) and E-cadherin in carcinogenesis. Oral Oncol, 2006. 42(1): p. 5-13. Tryndyak, V.P., F.A. Beland, and I.P. Pogribny, E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drugresistant phenotypes in human breast cancer cells. Int J Cancer, 2009. 126(11): p. 2575-83. Strathdee, G., Epigenetic versus genetic alterations in the inactivation of E-cadherin. Semin Cancer Biol, 2002. 12(5): p. 373-9. Cheng, C.W., et al., Mechanisms of inactivation of E-cadherin in breast carcinoma: modification of the two-hit hypothesis of tumor suppressor gene. Oncogene, 2001. 20(29): p. 3814-23. Martel, C., et al., Inactivation of retinoblastoma gene product RB or an RB-related protein by SV40 T antigen in MDCK epithelial cells results in massive apoptosis. Cell Death Differ, 1996. 3(3): p. 285-98. Martel, C., et al., Inactivation of retinoblastoma family proteins by SV40 T antigen results in creation of a hepatocyte growth factor/scatter factor autocrine loop associated with an epithelial-fibroblastoid conversion and invasiveness. Cell Growth Differ, 1997. 8(2): p. 16578. Hajra, K.M., X. Ji, and E.R. Fearon, Extinction of E-cadherin expression in breast cancer via a dominant repression pathway acting on proximal promoter elements. Oncogene, 1999. 18(51): p. 7274-9. Cano, A., et al., The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol, 2000. 2(2): p. 76-83. Behrens, J., et al., The E-cadherin promoter: functional analysis of a G.C-rich region and an epithelial cell-specific palindromic regulatory element. Proc Natl Acad Sci U S A, 1991. 88(24): p. 11495-9. Ringwald, M., et al., The structure of the gene coding for the mouse cell adhesion molecule uvomorulin. Nucleic Acids Res, 1991. 19(23): p. 6533-9. Hajra, K.M., D.Y. Chen, and E.R. Fearon, The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res, 2002. 62(6): p. 1613-8. Perez-Moreno, M.A., et al., A new role for E12/E47 in the repression of E-cadherin expression and epithelial-mesenchymal transitions. J Biol Chem, 2001. 276(29): p. 27424-31. Carver, E.A., et al., The mouse snail gene encodes a key regulator of the epithelialmesenchymal transition. Mol Cell Biol, 2001. 21(23): p. 8184-8. Poser, I., et al., Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor Snail. J Biol Chem, 2001. 276(27): p. 24661-6.  40  103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123.  Chou, C.H., et al., Differential expression of hedgehog signaling components and Snail/Ecadherin in human brain tumors. Oncol Rep, 2010. 24(5): p. 1225-32. Comijn, J., et al., The two-handed E box binding zinc finger protein SIP1 downregulates Ecadherin and induces invasion. Mol Cell, 2001. 7(6): p. 1267-78. Kwok, W.K., et al., Up-regulation of TWIST in prostate cancer and its implication as a therapeutic target. Cancer Res, 2005. 65(12): p. 5153-62. Singh, M., et al., ZEB1 expression in type I vs type II endometrial cancers: a marker of aggressive disease. Mod Pathol, 2008. 21(7): p. 912-23. Spoelstra, N.S., et al., The transcription factor ZEB1 is aberrantly expressed in aggressive uterine cancers. Cancer Res, 2006. 66(7): p. 3893-902. Spaderna, S., et al., A transient, EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology, 2006. 131(3): p. 830-40. Sanchez-Tillo, E., et al., ZEB1 represses E-cadherin and induces an EMT by recruiting the SWI/SNF chromatin-remodeling protein BRG1. Oncogene, 2010. 29(24): p. 3490-500. Blanco, M.J., et al., Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene, 2002. 21(20): p. 3241-6. Heeboll, S., et al., Snail1 is over-expressed in prostate cancer. APMIS, 2009. 117(3): p. 196204. Nieto, M.A., The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol, 2002. 3(3): p. 155-66. Savagner, P., K.M. Yamada, and J.P. Thiery, The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelialmesenchymal transition. J Cell Biol, 1997. 137(6): p. 1403-19. Mauhin, V., et al., Definition of the DNA-binding site repertoire for the Drosophila transcription factor SNAIL. Nucleic Acids Res, 1993. 21(17): p. 3951-7. Nakayama, H., I.C. Scott, and J.C. Cross, The transition to endoreduplication in trophoblast giant cells is regulated by the mSNA zinc finger transcription factor. Dev Biol, 1998. 199(1): p. 150-63. Inukai, T., et al., SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol Cell, 1999. 4(3): p. 343-52. Fujita, N., et al., MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell, 2003. 113(2): p. 207-19. Rosano, L., et al., Endothelin-1 promotes epithelial-to-mesenchymal transition in human ovarian cancer cells. Cancer Res, 2005. 65(24): p. 11649-57. Li, X., et al., Snail induction is an early response to Gli1 that determines the efficiency of epithelial transformation. Oncogene, 2006. 25(4): p. 609-21. Yook, J.I., et al., Wnt-dependent regulation of the E-cadherin repressor snail. J Biol Chem, 2005. 280(12): p. 11740-8. Mishra, P., et al., Glycogen Synthase Kinase-3beta regulates Snail and beta-catenin during gastrin-induced migration of gastric cancer cells. J Mol Signal, 2010. 5: p. 9. Zhou, B.P., et al., Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol, 2004. 6(10): p. 931-40. Jiang, R., et al., The Slug gene is not essential for mesoderm or neural crest development in mice. Dev Biol, 1998. 198(2): p. 277-85.  41  124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144.  Postigo, A.A. and D.C. Dean, Differential expression and function of members of the zfh-1 family of zinc finger/homeodomain repressors. Proc Natl Acad Sci U S A, 2000. 97(12): p. 6391-6. Verschueren, K., et al., SIP1, a novel zinc finger/homeodomain repressor, interacts with Smad proteins and binds to 5'-CACCT sequences in candidate target genes. J Biol Chem, 1999. 274(29): p. 20489-98. Postigo, A.A. and D.C. Dean, ZEB represses transcription through interaction with the corepressor CtBP. Proc Natl Acad Sci U S A, 1999. 96(12): p. 6683-8. Postigo, A.A. and D.C. Dean, ZEB, a vertebrate homolog of Drosophila Zfh-1, is a negative regulator of muscle differentiation. Embo J, 1997. 16(13): p. 3935-43. Postigo, A.A., et al., c-Myb and Ets proteins synergize to overcome transcriptional repression by ZEB. Embo J, 1997. 16(13): p. 3924-34. Higashi, Y., et al., Impairment of T cell development in deltaEF1 mutant mice. J Exp Med, 1997. 185(8): p. 1467-79. Takagi, T., et al., DeltaEF1, a zinc finger and homeodomain transcription factor, is required for skeleton patterning in multiple lineages. Development, 1998. 125(1): p. 21-31. Remacle, J.E., et al., New mode of DNA binding of multi-zinc finger transcription factors: deltaEF1 family members bind with two hands to two target sites. Embo J, 1999. 18(18): p. 5073-84. Massague, J., TGF-beta signal transduction. Annu Rev Biochem, 1998. 67: p. 753-91. Derynck, R., Y. Zhang, and X.H. Feng, Smads: transcriptional activators of TGF-beta responses. Cell, 1998. 95(6): p. 737-40. Hannigan, G.E., et al., Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 1996. 379(6560): p. 91-6. Somasiri, A., et al., Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 2001. 114(Pt 6): p. 1125-36. Wu, C., et al., Integrin-linked protein kinase regulates fibronectin matrix assembly, Ecadherin expression, and tumorigenicity. J Biol Chem, 1998. 273(1): p. 528-36. Radeva, G., et al., Overexpression of the integrin-linked kinase promotes anchorageindependent cell cycle progression. J Biol Chem, 1997. 272(21): p. 13937-44. Maydan, M., et al., Integrin-linked kinase is a functional Mn2+-dependent protein kinase that regulates glycogen synthase kinase-3beta (GSK-3beta) phosphorylation. PLoS One, 2010. 5(8): p. e12356. Troussard, A.A., et al., Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem, 2003. 278(25): p. 22374-8. Hannigan, G.E. and S. Dedhar, Protein kinase mediators of integrin signal transduction. J Mol Med, 1997. 75(1): p. 35-44. Deng, J.T., et al., Ca2+-independent smooth muscle contraction. a novel function for integrin-linked kinase. J Biol Chem, 2001. 276(19): p. 16365-73. Li, F., et al., Identification and characterization of a mouse protein kinase that is highly homologous to human integrin-linked kinase. Biochim Biophys Acta, 1997. 1358(3): p. 21520. Nikolopoulos, S.N. and C.E. Turner, Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J Biol Chem, 2001. 276(26): p. 23499-505. Zervas, C.G., S.L. Gregory, and N.H. Brown, Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J Cell Biol, 2001. 152(5): p. 1007-18.  42  145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. 164.  Mackinnon, A.C., et al., C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Curr Biol, 2002. 12(10): p. 787-97. Hannigan, G., A.A. Troussard, and S. Dedhar, Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer, 2005. 5(1): p. 51-63. Dedhar, S., B. Williams, and G. Hannigan, Integrin-linked kinase (ILK): a regulator of integrin and growth-factor signalling. Trends Cell Biol, 1999. 9(8): p. 319-23. Wu, C., Integrin-linked kinase and PINCH: partners in regulation of cell-extracellular matrix interaction and signal transduction. J Cell Sci, 1999. 112 ( Pt 24): p. 4485-9. Persad, S., et al., Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrinlinked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem, 2001. 276(29): p. 27462-9. Novak, A., et al., Cell adhesion and the integrin-linked kinase regulate the LEF-1 and betacatenin signaling pathways. Proc Natl Acad Sci U S A, 1998. 95(8): p. 4374-9. Tan, C., et al., Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcfdependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 2001. 20(1): p. 133-40. Oloumi, A., T. McPhee, and S. Dedhar, Regulation of E-cadherin expression and βcatenin/Tcf transcriptional activity by the integrin-linked kinase. biochemica et Biophysica Acta, 2004. 1691(1): p. 1-15. Oloumi, A., S. Syam, and S. Dedhar, Modulation of Wnt3a-mediated nuclear beta-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene, 2006. 25(59): p. 7747-7757. Rosano, L., et al., Endothelin-1 is required during epithelial to mesenchymal transition in ovarian cancer progression. Exp Biol Med (Maywood), 2006. 231(6): p. 1128-31. Rosano, L., et al., Integrin-linked kinase functions as a downstream mediator of endothelin1 to promote invasive behavior in ovarian carcinoma. Mol Cancer Ther, 2006. 5(4): p. 833-42. Cianfrocca, R., et al., beta-arrestin-1 mediates the endothelin-1-induced activation of Akt and integrin-linked kinase. Can J Physiol Pharmacol, 2010. 88(8): p. 796-801. Rastaldi, M.P., Epithelial-mesenchymal transition and its implications for the development of renal tubulointerstitial fibrosis. J Nephrol, 2006. 19(4): p. 407-12. Li, Y., et al., PINCH-1 promotes tubular epithelial-to-mesenchymal transition by interacting with integrin-linked kinase. J Am Soc Nephrol, 2007. 18(9): p. 2534-43. Li, Y., et al., Inhibition of integrin-linked kinase attenuates renal interstitial fibrosis. J Am Soc Nephrol, 2009. 20(9): p. 1907-18. Li, Y., et al., Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest, 2003. 112(4): p. 503-16. Vivanco, I. and C.L. Sawyers, The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer, 2002. 2(7): p. 489-501. Delcommenne, M., et al., Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A, 1998. 95(19): p. 11211-6. Chu, E.C. and A.S. Tarnawski, PTEN regulatory functions in tumor suppression and cell biology. Med Sci Monit, 2004. 10(10): p. RA235-41. Stambolic, V., et al., Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell, 1998. 95(1): p. 29-39.  43  165. 166. 167. 168. 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184.  Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12. Yamaji, S., et al., A novel integrin-linked kinase-binding protein, affixin, is involved in the early stage of cell-substrate interaction. J Cell Biol, 2001. 153(6): p. 1251-64. Alessi, D.R., et al., Mechanism of activation of protein kinase B by insulin and IGF-1. Embo J, 1996. 15(23): p. 6541-51. Alessi, D.R., et al., 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase. Curr Biol, 1997. 7(10): p. 776-89. Alessi, D.R., et al., Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol, 1997. 7(4): p. 261-9. Stephens, L., et al., Protein kinase B kinases that mediate phosphatidylinositol 3,4,5trisphosphate-dependent activation of protein kinase B. Science, 1998. 279(5351): p. 710-4. Dedhar, S., Cell-substrate interactions and signaling through ILK. Curr Opin Cell Biol, 2000. 12(2): p. 250-6. McDonald, P.C., et al., Rictor and integrin-linked kinase interact and regulate Akt phosphorylation and cancer cell survival. Cancer Res, 2008. 68(6): p. 1618-24. Attwell, S., C. Roskelley, and S. Dedhar, The integrin-linked kinase (ILK) suppresses anoikis. Oncogene, 2000. 19(33): p. 3811-5. Troussard, A.A., et al., The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene, 2000. 19(48): p. 5444-52. Troussard, A.A., et al., Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol, 1999. 19(11): p. 7420-7. Boyle, W.J., et al., Activation of protein kinase C decreases phosphorylation of c-Jun at sites that negatively regulate its DNA-binding activity. Cell, 1991. 64(3): p. 573-84. Goode, N., et al., Differential regulation of glycogen synthase kinase-3 beta by protein kinase C isotypes. J Biol Chem, 1992. 267(24): p. 16878-82. Nikolakaki, E., et al., Glycogen synthase kinase 3 phosphorylates Jun family members in vitro and negatively regulates their transactivating potential in intact cells. Oncogene, 1993. 8(4): p. 833-40. Frame, S. and P. Cohen, GSK3 takes centre stage more than 20 years after its discovery. Biochem J, 2001. 359(Pt 1): p. 1-16. Doble, B.W. and J.R. Woodgett, GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci, 2003. 116(Pt 7): p. 1175-86. Hoeflich, K.P., et al., Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature, 2000. 406(6791): p. 86-90. Diehl, J.A., et al., Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev, 1998. 12(22): p. 3499-511. Zhang, Y., et al., Assembly of the PINCH-ILK-CH-ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci, 2002. 115(Pt 24): p. 4777-86. Tu, Y., et al., A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol, 2001. 153(3): p. 585-98.  44  185. 186. 187. 188. 189. 190. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204.  Nikolopoulos, S.N. and C.E. Turner, Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem, 2002. 277(2): p. 1568-75. Tu, Y., et al., The LIM-only protein PINCH directly interacts with integrin-linked kinase and is recruited to integrin-rich sites in spreading cells. Mol Cell Biol, 1999. 19(3): p. 2425-34. Li, F., Y. Zhang, and C. Wu, Integrin-linked kinase is localized to cell-matrix focal adhesions but not cell-cell adhesion sites and the focal adhesion localization of integrin-linked kinase is regulated by the PINCH-binding ANK repeats. J Cell Sci, 1999. 112 ( Pt 24): p. 4589-99. Wu, C., The PINCH-ILK-parvin complexes: assembly, functions and regulation. Biochim Biophys Acta, 2004. 1692(2-3): p. 55-62. Wu, C., PINCH, N(i)ck and the ILK: network wiring at cell-matrix adhesions. Trends Cell Biol, 2005. 15(9): p. 460-6. Tu, Y., F. Li, and C. Wu, Nck-2, a novel Src homology2/3-containing adaptor protein that interacts with the LIM-only protein PINCH and components of growth factor receptor kinasesignaling pathways. Mol Biol Cell, 1998. 9(12): p. 3367-82. Braun, A., et al., PINCH2 is a new five LIM domain protein, homologous to PINCHand localized to focal adhesions. Exp Cell Res, 2003. 284(2): p. 239-50. Nikolopoulos, S.N. and C.E. Turner, Actopaxin, a new focal adhesion protein that binds paxillin LD motifs and actin and regulates cell adhesion. J Cell Biol, 2000. 151(7): p. 1435-48. Attwell, S., et al., Integration of cell attachment, cytoskeletal localization, and signaling by integrin-linked kinase (ILK), CH-ILKBP, and the tumor suppressor PTEN. Mol Biol Cell, 2003. 14(12): p. 4813-25. Schaller, M.D., Paxillin: a focal adhesion-associated adaptor protein. Oncogene, 2001. 20(44): p. 6459-72. D'Amours, D., et al., Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem J, 1999. 342 ( Pt 2): p. 249-68. Kim, M.Y., T. Zhang, and W.L. Kraus, Poly(ADP-ribosyl)ation by PARP-1: 'PAR-laying' NAD+ into a nuclear signal. Genes Dev, 2005. 19(17): p. 1951-67. Bork, P., et al., A superfamily of conserved domains in DNA damage-responsive cell cycle checkpoint proteins. Faseb J, 1997. 11(1): p. 68-76. Yu, X., et al., The BRCT domain is a phospho-protein binding domain. Science, 2003. 302(5645): p. 639-42. Masson, M., et al., XRCC1 is specifically associated with poly(ADP-ribose) polymerase and negatively regulates its activity following DNA damage. Mol Cell Biol, 1998. 18(6): p. 356371. Zhang, X., et al., Structure of an XRCC1 BRCT domain: a new protein-protein interaction module. Embo J, 1998. 17(21): p. 6404-11. Otto, H., et al., In silico characterization of the family of PARP-like poly(ADPribosyl)transferases (pARTs). BMC Genomics, 2005. 6: p. 139. Tulin, A. and A. Spradling, Chromatin loosening by poly(ADP)-ribose polymerase (PARP) at Drosophila puff loci. Science, 2003. 299(5606): p. 560-2. Ju, B.G., et al., Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell, 2004. 119(6): p. 815-29. Idogawa, M., et al., Poly(ADP-ribose) polymerase-1 is a component of the oncogenic T-cell factor-4/beta-catenin complex. Gastroenterology, 2005. 128(7): p. 1919-36.  45  205. 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. 216. 217. 218. 219. 220. 221. 222. 223. 224. 225.  Domenighini, M. and R. Rappuoli, Three conserved consensus sequences identify the NADbinding site of ADP-ribosylating enzymes, expressed by eukaryotes, bacteria and T-even bacteriophages. Mol Microbiol, 1996. 21(4): p. 667-74. Bazan, J.F. and F. Koch-Nolte, Sequence and structural links between distant ADPribosyltransferase families. Adv Exp Med Biol, 1997. 419: p. 99-107. Seman, M., et al., Ecto-ADP-ribosyltransferases (ARTs): emerging actors in cell communication and signaling. Curr Med Chem, 2004. 11(7): p. 857-72. Schreiber, V., et al., Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol, 2006. 7(7): p. 517-28. Ame, J.C., C. Spenlehauer, and G. de Murcia, The PARP superfamily. Bioessays, 2004. 26(8): p. 882-93. Malanga, M., H.E. Kleczkowska, and F.R. Althaus, Selected nuclear matrix proteins are targets for poly(ADP-ribose)-binding. J Cell Biochem, 1998. 70(4): p. 596-603. Kraus, W.L. and J.T. Lis, PARP goes transcription. Cell, 2003. 113(6): p. 677-83. Lu, X.C., et al., Post-treatment with a novel PARG inhibitor reduces infarct in cerebral ischemia in the rat. Brain Res, 2003. 978(1-2): p. 99-103. Zhang, S., et al., c-Jun N-terminal kinase mediates hydrogen peroxide-induced cell death via sustained poly(ADP-ribose) polymerase-1 activation. Cell Death Differ, 2007. 14(5): p. 100110. Homburg, S., et al., A fast signal-induced activation of Poly(ADP-ribose) polymerase: a novel downstream target of phospholipase c. J Cell Biol, 2000. 150(2): p. 293-307. Midorikawa, R., Y. Takei, and N. Hirokawa, KIF4 motor regulates activity-dependent neuronal survival by suppressing PARP-1 enzymatic activity. Cell, 2006. 125(2): p. 371-83. Southan, G.J. and C. Szabo, Poly(ADP-ribose) polymerase inhibitors. Curr Med Chem, 2003. 10(4): p. 321-40. Milam, K.M. and J.E. Cleaver, Inhibitors of poly(adenosine diphosphate-ribose) synthesis: effect on other metabolic processes. Science, 1984. 223(4636): p. 589-91. Bryant, H.E., et al., Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADPribose) polymerase. Nature, 2005. 434(7035): p. 913-7. Tutt, A.N., et al., Exploiting the DNA repair defect in BRCA mutant cells in the design of new therapeutic strategies for cancer. Cold Spring Harb Symp Quant Biol, 2005. 70: p. 139-48. Farmer, H., et al., Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature, 2005. 434(7035): p. 917-21. BiPar Sciences presents interim phase 2 results for PARP inhibitor BSI-201 at San Antonio Breast Cancer Symposium. Cancer Biol Ther, 2009. 8(1): p. 2-3. Ali, M., et al., Vasoactivity of AG014699, a clinically active small molecule inhibitor of poly(ADP-ribose) polymerase: a contributory factor to chemopotentiation in vivo? Clin Cancer Res, 2009. 15(19): p. 6106-12. Plummer, R., et al., Phase I study of the poly(ADP-ribose) polymerase inhibitor, AG014699, in combination with temozolomide in patients with advanced solid tumors. Clin Cancer Res, 2008. 14(23): p. 7917-23. Audeh, M.W., et al., Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof-of-concept trial. Lancet, 2010. 376(9737): p. 245-51. Tutt, A., et al., Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet, 2010. 376(9737): p. 235-44.  46  226. 227. 228.  229. 230. 231. 232. 233. 234. 235. 236. 237. 238.  Reinhardt, S., et al., A rapid and sensitive method for determination of veliparib (ABT-888), in human plasma, bone marrow cells and supernatant by using LC/MS/MS. J Pharm Biomed Anal, 2010. 52(1): p. 122-8. Palma, J.P., et al., ABT-888 confers broad in vivo activity in combination with temozolomide in diverse tumors. Clin Cancer Res, 2009. 15(23): p. 7277-90. Horton, T.M., et al., Poly(ADP-ribose) polymerase inhibitor ABT-888 potentiates the cytotoxic activity of temozolomide in leukemia cells: influence of mismatch repair status and O6-methylguanine-DNA methyltransferase activity. Mol Cancer Ther, 2009. 8(8): p. 223242. Kummar, S., et al., Phase 0 clinical trial of the poly (ADP-ribose) polymerase inhibitor ABT888 in patients with advanced malignancies. J Clin Oncol, 2009. 27(16): p. 2705-11. Palma, J.P., et al., The PARP inhibitor, ABT-888 potentiates temozolomide: correlation with drug levels and reduction in PARP activity in vivo. Anticancer Res, 2008. 28(5A): p. 2625-35. Liu, X., et al., Potentiation of temozolomide cytotoxicity by poly(ADP)ribose polymerase inhibitor ABT-888 requires a conversion of single-stranded DNA damages to doublestranded DNA breaks. Mol Cancer Res, 2008. 6(10): p. 1621-9. Liu, S.K., et al., A novel poly(ADP-ribose) polymerase inhibitor, ABT-888, radiosensitizes malignant human cell lines under hypoxia. Radiother Oncol, 2008. 88(2): p. 258-68. Donawho, C.K., et al., ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin Cancer Res, 2007. 13(9): p. 2728-37. Lin, W., et al., Isolation and characterization of the cDNA encoding bovine poly(ADP-ribose) glycohydrolase. J Biol Chem, 1997. 272(18): p. 11895-901. Meyer, R.G., et al., Human poly(ADP-ribose) glycohydrolase (PARG) gene and the common promoter sequence it shares with inner mitochondrial membrane translocase 23 (TIM23). Gene, 2003. 314: p. 181-90. Davidovic, L., et al., Importance of poly(ADP-ribose) glycohydrolase in the control of poly(ADP-ribose) metabolism. Exp Cell Res, 2001. 268(1): p. 7-13. Meyer-Ficca, M.L., et al., Human poly(ADP-ribose) glycohydrolase is expressed in alternative splice variants yielding isoforms that localize to different cell compartments. Exp Cell Res, 2004. 297(2): p. 521-32. Koh, D.W., et al., Failure to degrade poly(ADP-ribose) causes increased sensitivity to cytotoxicity and early embryonic lethality. Proc Natl Acad Sci U S A, 2004. 101(51): p. 17699704.  47  Chapter 2  Integrin-Linked Kinase Regulates E-cadherin Expression through PARP-11  2.1 Introduction  Epithelial to mesenchymal transition (EMT) is a process by which epithelial cells acquire mesenchymal properties, dissociate from the epithelium and migrate to secondary sites [1]. As cells undergo EMT, cell-cell and cell-extracellular matrix (ECM) interactions are altered, the ECM is degraded and the cytoskeleton is re-organized [1]. Importantly, EMT is characterized by a switch from epithelial to mesenchymal gene expression [1, 2]. EMT is an essential process during early embryonic development, but is also associated with several fibrotic diseases [3] and with metastatic progression in many human cancers [1, 2]. Indeed, the metastatic propensity of malignant disease is a marker of poor prognosis [2, 4]. Therefore, a better understanding of the 1  A version of this chapter has been accepted for publication under the title “Integrin-Linked Kinase  regulates E-cadherin expression through PARP-1” in Developmental Dynamics 237:2737-2747, 2008. Authorship is Timothy R. McPhee 1, 2, Paul C. McDonald3*, Arusha Oloumi3*, Shoukat Dedhar 1, 2, 3 1  Genetics Graduate Program, University of British Columbia, Vancouver, British Columbia, Canada  2  Department of Biochemistry and Molecular Biology, University of British Columbia, Vancouver, British Columbia,  Canada 3  Department of Cancer Genetics and Developmental Biology, British Columbia Cancer Research Centre, British  Columbia Cancer Agency, Vancouver, British Columbia, Canada *These authors contributed equally to the manuscript  47  components and mechanisms of EMT is critical if we are to make meaningful advances in the development of efficacious treatment modalities for cancer. The loss of E-cadherin expression and the associated disruption of cell-cell junctions is a key step in the process of EMT, and is a marker of poor patient prognosis in many solid cancers [2, 5]. Loss of E-cadherin may result from genetic mutations, promoter hypermethylation or transcription factor dysregulation [6-9]. In particular, transcriptional repressor complexes are emerging as important regulators of E-cadherin expression. The Snail transcription factor is a known transcriptional repressor of E-cadherin and a well characterized inducer of EMT [6, 10, 11]. The expression of Snail is critical for EMT during embryonic development [12, 13] and its overexpression in epithelial cells results in downregulation of E-cadherin, conversion to a fibroblastic phenotype, and acquisition of tumorigenic and invasive properties [6, 11]. High Snail expression is also observed in recurrent human breast carcinomas [14] and can be used as an independent marker for both tumor grade and mortality [15]. Snail is transcriptionally silent in normal epithelial cells [16] and its expression is regulated at the level of transcription by several cell signaling effectors, including Akt [17], ET-1 [18], Gli [19] and Integrin Linked Kinase (ILK) [17, 20]. ILK is a multidomain protein that functions as a PI3-kinase (PI3K)-dependent serine/threonine protein kinase and a modular adaptor protein [21-23]. Importantly, ILK has been shown to induce EMT in some epithelial cell lines [17, 24, 25]. Overexpression of ILK in the Scp2 mouse mammary epithelial cell line, for example, results in the loss of E-cadherin, loss of polarity and induction of EMT [24]. Furthermore, introduction of PTEN, a tumour suppressor mutated in a variety of cancers [26], into PTEN-null PC3 prostate cancer cells results in the re-expression of Ecadherin, probably via the inhibition of ILK activity [27]. The mechanism by which ILK induces the loss of E-cadherin and the progression of EMT remains unclear, although current data suggest that ILK transcriptionally regulates Snail through an unknown mechanism [20, 28]. 48  We have previously demonstrated that ILK regulates Snail transcription in the SW480 colon carcinoma cell line and that this regulation is partially mediated by a 65 base pair (bp) region in the 5' promoter of Snail, termed the Snail ILK Responsive Element (SIRE) [20]. In this study, we use a SIRE oligonucleotide as bait in an affinity chromatography assay to identify candidate proteins that reside downstream of ILK in the regulation of Snail and, ultimately, E-cadherin. Using this assay, coupled with mass spectrometry, we have identified several candidate proteins that bind differentially to the SIRE of PC3 prostate cancer cells subsequent to siRNA-mediated disruption of the ILK signaling pathway. One of the identified proteins is Poly(ADP-ribose) polymerase-1 (PARP-1), an enzyme that catalyzes the addition of ADP-ribose chains to itself and to a number of target proteins. We further characterize the PARP-1-SIRE interaction and show that, together with ILK, PARP-1 mediates the expression of E-cadherin through Snail and ZEB1. Our data indicate that PARP-1 is a bona fide SIRE-binding protein and suggest that it is an interesting and critical component of the E-cadherin regulatory axis in the process of EMT.  2.2 Results  Overexpression of ILK in Scp2 mouse mammary epithelial cells results in upregulation of Snail  It has been reported that stable overexpression of ILK in the mouse mammary epithelial Scp2 cell line results in the loss of E-cadherin protein and induction of EMT [24]. In the present study, we observed that the stable overexpression of ILK in the Scp2 cell line (ILK-13-8) resulted not only in the loss of E-cadherin protein (Fig. 2.1A), but also mRNA (Fig. 2.1B). ILK overexpression also resulted in a substantial increase in the expression of Snail protein (Fig. 2.1A) 49  and mRNA (Fig. 2.1B). In contrast, Snail mRNA and protein levels in parental Scp2 cells were found to be low or undetectable. Stable transfection of a control, non-coding (i.e. anti-sense orientation) ILK construct (ILK-14-1) phenocopied the attributes of the parental line and had no effect on the expression of either Snail or E-cadherin.  50  Figure 2.1 Expression of E-cadherin and Snail in Scp2 mouse mammary epithelial cell lines stably overexpressing ILK. (A) Western blot analysis for protein expression. !-actin was used as a loading control. (B) qRT-PCR analysis of E-cadherin and Snail mRNA levels using SYBR Green methodology. Message levels for the genes of interest were normalized to !-actin mRNA levels and results are expressed as relative fold change compared to the parental Scp2 cell line.  51  52  siRNA-mediated knockdown of ILK, Akt and Snail, but not GSK-3!, results in upregulation of E-cadherin expression in PC3 cells  Next, we were interested in identifying a human cell model system that would allow us to elucidate the signaling pathways involved in the ILK-mediated control of Snail and E-cadherin. It has been shown previously that the ILK signaling pathway is constitutively active in the PC3 prostate cancer cell line due to the loss of PTEN expression, and that introduction of PTEN results in re-expression of E-cadherin[27]. Using RNA interference (RNAi) as a strategy for targeted depletion of gene expression, we examined the role of the PI3K-ILK-Akt axis in regulating Ecadherin expression in PC3 cells. The ILK and Akt siRNA constructs were highly efficacious, resulting in substantial, specific reduction of both protein (Fig. 2.2A) and mRNA (data not shown). siRNA-mediated knockdown of ILK or Akt resulted in an increase in E-cadherin expression at the level of protein (Fig. 2.2A) and mRNA (Fig. 2.2B). siRNA-mediated knockdown of GSK-3! did not alter E-cadherin expression (Fig. 2.2A). The expression of Snail in E-cadherin-negative PC3 cells (Fig. 2.2C) suggests the presence of Snail-mediated repression of E-cadherin in this model. Indeed, while siRNA-mediated knockdown of Snail resulted in a modest reduction in the levels of Snail expression (Fig. 2.2C, D), E-cadherin expression increased substantially (Fig. 2.2A, B), indicating that Snail is a sensitive regulator of E-cadherin in this system. Interestingly, siRNA-mediated knockdown of ILK and Akt did affect cellular distribution of Snail, substantially reducing its protein levels in the nucleus (Fig. 2.2C). Loss of Akt expression also resulted in a loss of Snail from the whole cell lysate (Fig. 2.2C).  53  Figure 2.2 Effect of siRNA-mediated depletion of ILK or its downstream targets on E-cadherin expression in the PC3 human prostate carcinoma cell line. (A) Western blot analysis for protein expression. Samples were assessed for efficacy and specificity of protein knockdown and for the impact of target depletion on the expression of E-cadherin. !-actin was used as a loading control. (B) qRT-PCR analysis using SYBR green methodology of the relative amounts of E-cadherin mRNA in PC3 cells transfected with the indicated siRNA constructs. Results were normalized to !-actin mRNA levels and are reported as fold change compared to cells transfected with control siRNA. (C) Western blot analysis of Snail protein levels present in nuclear extracts of PC3 cells transfected with the indicated siRNA constructs. Lamin A/C was used as a loading control. Analysis of whole cell lysates is provided for the purposes of comparison. (D) qRT-PCR analysis using SYBR green methodology of the relative amounts of Snail mRNA in PC3 cells transfected with Snail siRNA. Results were normalized to !-actin mRNA levels and are reported as fold change compared to cells transfected with control siRNA.  54  55  Isolation and identification of SIRE-interacting proteins that demonstrate differential binding due to loss of ILK expression  We next designed a strategy to identify candidate SIRE-binding proteins in the PC3 cell model to elucidate the mechanism by which ILK regulates Snail and, ultimately, E-cadherin. To isolate candidate proteins that bind the SIRE sequence in an ILK-dependent manner, we used a synthetic SIRE oligonucleotide as bait in an affinity chromatography assay. The oligonucleotide was biotinylated on the 5' end of the sense strand and immobilized on magnetic streptavidin beads. The beads were then exposed to nuclear extracts from either control siRNA- or ILK siRNA-treated PC3 cells. Protein fractions were eluted sequentially from the column using graded salt concentrations and separated by SDS-PAGE (Fig. 2.3A). Candidate SIRE-binding proteins were selected based on differential banding in the control versus the experimental sample. Selected bands were then excised and identified by mass spectrometry (Fig. 2.3B). Three candidate proteins bound to the SIRE sequence in the control siRNA-treated PC3 cells and demonstrated reduced binding in the absence of ILK expression (Fig. 2.3, Table 2.1). These proteins were identified as Methyl-CpG domain binding protein 5 (MDB-5), a chromodomain-helicase-DNAbinding protein 8/Helicase with SNF2 domain 1 (CHD-8/HELSNF1) fragment and Poly(ADP-ribose) polymerase-1 (PARP-1). Owing to limited availability of high quality tools and reagents, MBD-5 and the fragment of CHD-8 were not investigated further. The third protein, PARP-1, was validated and further characterized in this study.  56  Figure 2.3 Identification of SIRE-binding proteins in PC3 cells transfected with ILK siRNA. (A) Proteins binding the SIRE were isolated using a biotin/streptavidin chromatography column and eluted using an increasing salt gradient. Eluted proteins were separated by SDSPAGE (10%) and visualized with Sypro-Ruby® stain on a Typhoon Scanner. Bands demonstrating patterns of differential staining intensity are highlighted in boxes. (B) Inset showing the three proteins of interest based on differential banding patterns. These bands were excised and identified by mass spectrometry to be MBD-5, a fragment of CHD-8 and PARP-1. Method in Appendix A.  57  58  Table 2.1 Sequence of trypsin digested fragments identified by mass spectrometry. Protein Size  Peptide Sequence Determined  120 kDa  Corresponding position in: PARP-1  MAIMVQSPM TLGDFAAEY GFSLLATED ELLIFNK QQVPSGESA VVSEDFLQD MIFDVESMK AMVEYEIDL GGSDDSSKD TTNFAGILS IAPPEAPVT GIYFADMVS 162 kDa NLDHGKNVNEG 51 kDa VDGTLLVGEDA  34-42 108-116 182-190 262-268 269-277 452-460 674-682 684-692 779-787 865-873 878-886 893-901 MBD-5 1169-1179 CHD-8 (Fragment)  Reference Sequence # NM_001618 P09874  NM_018328 Q9P267 NM_020920 Q6P440  197-207  ILK-dependent formation of a PARP-1-containing complex with SIRE  To further characterize PARP-1 as a SIRE-interacting protein, we performed a series of electromobility shift assays (EMSA) using the SIRE sequence and nuclear extracts from untreated and siRNA-treated PC3 cells. First, we showed that nuclear extracts from untreated PC3 cells resulted in an upward shift in the electrophoretic mobility of the labeled SIRE sequence (Fig. 2.4A). We further demonstrated that the binding of proteins present in the nuclear compartment to the SIRE sequence was specific by disengaging the labeled probe with an excess of cold SIRE  59  competitor (Fig. 2.4A). Non-specific cold competitor was used as a control. We were also able to disrupt the nuclear protein-SIRE interaction with a mutant cold SIRE competitor in which the E-box sequence was changed from CACCTG to AACCTA (Fig. 2.4A). Next, we used nuclear extracts from ILK siRNA-treated PC3 cells in the EMSA assay and observed a reduction in the signal of one of the shifted oligonucleotide bands (Fig. 2.4B). Finally, nuclear extracts from PARP-1 siRNAtreated cells were used and a reduction in signal intensity of the same band identified in cells depleted of ILK was observed (Fig. 2.4B). Other protein complexes were found to bind the SIRE oligonucleotide (Fig. 2.4B), but were not modulated by depletion of ILK or PARP-1, providing an internal control for specificity.  60  Figure 2.4 Electromobility shift assay (EMSA) using nuclear extracts of PC3 cells and a Klenow 3' 32P-ATP  end-labelled SIRE oligonucleotide. (A) PC3 nuclear extract (NE) resulted in the  presence of a shifted band (arrow). The shifted bands were out-competed with a cold SIRE oligonucleotide and a cold mutated-SIRE, in which the E-box motif was mutated, but not a non-specific oligonucleotide. (B) EMSA conducted with nuclear extracts of PC3 cells depleted of ILK or PARP-1. The reduction of a shifted band (arrow) was observed due to siRNA-mediated depletion of ILK or PARP-1.  61  62  siRNA-mediated knock-down of PARP-1 or ILK results in suppression of E-cadherin transcriptional repressors and upregulation of E-cadherin expression  Next, we performed experiments to determine whether PARP-1 is involved in the regulation of E-cadherin. siRNA-mediated knockdown of PARP-1 in PC3 cells resulted in substantial reduction of PARP-1 protein and mRNA (Fig 2.5Ai, Bi), and concomitant, significant upregulation of E-cadherin expression compared to control cultures (Fig. 2.5Ai, Bii). A similar pattern of expression was observed in cells depleted of ILK (Fig. 2.5Aii, C). The dramatic increase in E-cadherin expression subsequent to depletion of PARP-1 or ILK was coupled with a significant decline in Snail mRNA (Fig. 2.5Bi, Ci). It is interesting that the effect of PARP-1 knockdown on Snail mRNA levels in PC3 cells, while statistically significant compared to control cells (Fig. 2.5Bi), was substantially less than that observed with depletion of ILK (Fig. 2.5Ci). Furthermore, the mRNA level for ZEB1, another E-cadherin repressor, was reduced when PARP-1 or ILK expression was inhibited (Fig. 2.5Bi, Ci). The loss of PARP-1 expression had little effect on ILK protein levels and loss of ILK expression had no effect on PARP-1 protein levels (Fig 2.5A), demonstrating the target specificity of the siRNA. To confirm these findings, we knocked down PARP-1 in the MDA-MB-435-LCC6 cell line, an aggressive mesenchymal cancer cell line with robust Snail expression. Depletion of PARP-1 in these cells resulted in significant downregulation of Snail mRNA (Fig. 2.5Di). siRNA-mediated depletion of Snail also resulted in dramatic inhibition of Snail mRNA levels, as expected (Fig. 2.5D). As a control, suppression of PARP-1 strongly inhibited PARP-1 mRNA expression, while siRNA-mediated knockdown of Snail did not affect levels of PARP-1 (Fig. 2.5D).  63  Figure 2.5 Effect of siRNA-mediated depletion of PARP-1 or ILK on E-cadherin and Snail expression in cancer cells. (A) Western blot analysis for protein expression. Samples were assessed for efficacy and specificity of protein knockdown and for the impact of target depletion on the expression of E-cadherin. siRNA constructs were used at 100 nM. !-actin is provided as a loading control. Knockdown of ILK (A, ii) is included as a control to demonstrate that the effects of PARP-1 (A, i) are not secondary to inhibition of ILK expression. (B-D) qRTPCR analysis of mRNA expression using Roche UPL technology. All samples were assessed for the effect of PARP-1 or ILK knockdown on the regulation of Snail, ZEB1 and E-cadherin. Results were normalized to !-actin mRNA levels and are reported as fold change compared to siRNA-treated cells. The relative amounts of E-cadherin, Snail and ZEB1 mRNA were assessed in PC3 cells transfected with either PARP-1 (B, i and ii) or ILK (C, i and ii) siRNA. (D) MDA-MB-435-LCC6 cells transfected with either PARP-1 (D, i) or Snail (D, ii) siRNA also show a marked decrease in Snail mRNA upon PARP-1 inhibition. Statistical analysis was done using Student’s t-test; *p ! 0.02, **p! 0.002. Experiments for this figure completed by Dr. Paul McDonald and Dr. Arusha Oloumi.  64  65  2.3 Discussion  The data presented in this study expand on the observation that overexpression of ILK in Scp2 mouse mammary epithelial cells results in the loss of E-cadherin expression and initiation of EMT [24]. The loss of E-cadherin at the level of transcription and the upregulation of Snail in the ILK overexpressing Scp2 cell line suggest that loss of E-cadherin transcription in these cells is mediated, at least in part, by Snail. These data provide evidence supporting the hypothesis that Snail is a major effector downstream of ILK in loss of E-cadherin and induction of EMT. We further identify PARP-1 as a SIRE-binding protein using an in vitro binding assay. Our data support the suggestion that PARP-1 binds the SIRE in an ILK-dependent manner. Finally, we find that inhibition of PARP-1 expression in PC3 cells results in a concomitant decrease in Snail and ZEB1 expression, leading to re-expression of E-cadherin. The PI3K-ILK-Akt axis has an evidence-based role in the regulation of EMT [17, 18, 20, 25] and ILK, in particular, is known to impact various signaling pathways important for the regulation of epithelial and mesenchymal genes [20, 29-34]. Thus, we examined ILK-mediated control of Snail and E-cadherin in PC3 cells, a tumor cell model that has undergone EMT, and in which the PI3K-ILK-Akt signaling pathway is constitutively active. Importantly, PC3 cells are unable to form adherence junctions due to the loss of "-catenin [35] as well as E-cadherin. As formation of adherence junctions alone can result in the modulation of epithelial and mesenchymal genes [24], these cells allow us to study the initial steps in reversion to an epithelial phenotype. siRNA-mediated knockdown of ILK or Akt resulted in a transcriptionally regulated increase in E-cadherin protein expression in PC3 cells. These data demonstrate that, in the PC3 cell line, repression of E-cadherin expression is mediated, at least in part, by the ILK/Akt signaling axis.  66  Furthermore, siRNA-mediated knockdown of Snail resulted in a moderate reduction in Snail mRNA and protein levels, but a substantial increase in E-cadherin mRNA and protein. These findings suggest that, in PC3 cells, Snail is partially responsible for the loss of E-cadherin expression and that even subtle modulation of Snail levels has a profound effect on E-cadherin. Indeed, recent findings indicate that Snail has a threshold effect. In transgenic mice, low levels of Snail expression cause a high rate of cancer development, but, unlike high levels of Snail expression, do not induce an EMT or migration in carcinomas [16]. To interrogate the mechanism by which ILK may modulate Snail transcription, we developed a strategy to identify proteins capable of binding the SIRE sequence in an ILKdependent manner. PARP-1 was a major interactor identified using this binding assay. PARP-1 has recently garnered a great deal of attention for its role in transcriptional regulation [36-43]. We observed that PARP-1 binds the SIRE sequence in the presence, but not the absence of ILK. We were able to show that siRNA-mediated knockdown of PARP-1 expression results in an elevated level of E-cadherin expression, supporting a role for PARP-1 in the regulation of E-cadherin and as a bona fide ILK-regulated SIRE-binding protein. The exposure of the SIRE probe to PC3 cell nuclear extracts resulted in the appearance of shifted bands in the EMSA assay. One of the shifted bands was reduced due to the siRNAmediated knockdown of ILK, suggesting the presence of an ILK-regulated SIRE binding complex. This band corresponded to a band that was reduced due to the siRNA-mediated knockdown of PARP-1. Together, these data support the idea that ILK may regulate the binding of a complex of proteins to the SIRE fragment and that this complex contains PARP-1. The SIRE sequence contains an E-box motif, which is completely conserved in humans, mice and rats. Using a cold mutant SIRE in which the E-box sequence is mutated, we were able to demonstrate that it is not required for the binding of the ILK-regulated complex. However, this 67  does not mean that the E-box motif is not important in modulating binding of the ILK-mediated protein complex or regulating Snail transcription. It is possible that the ILK-regulated complex is displaced from the SIRE by an E-box binding protein complex. Interestingly, Snail has recently been shown to bind its own promoter via the E-box located in the SIRE and inhibit its own transcription [44]. In addition to the E-box motif, the SIRE sequence contains numerous CpG dinucleotides. The Snail promoter contains a 698 bp CpG island that is 25% CpG dinucleotides and spans the SIRE sequence. CpG islands are often associated with ubiquitously expressed housekeeping genes. It is surprising that Snail, a gene normally transcriptionally repressed, contains a CpG island in its promoter, suggesting that the numerous CpG dinucleotides may be important in PARP-1 binding. The role of the E-box sequence and CpG islands in ILK-mediated Snail transcription requires further study. In addition to PARP-1, the SIRE-binding assay identified MBD-5 and the fragment of CHD8 as candidate interactors. Although the tools required for validation of these proteins as specific SIRE-binding partners are not readily available, analysis of their proposed function and the function of known family members suggest that they are relevant interactors. MBD-5 contains a MethylCpG Binding Domain (MBD), which binds methylated CpG dinucleotides or is involved in proteinprotein interactions [45]. The affinity column used a synthetic SIRE sequence that did not contain any methylated CpG dinucleotides, suggesting that MBD-5 interacts with unmethylated CpG dinucleotides or that its interaction with the SIRE sequence is not direct. The CHD-8 fragment constitutes the N-terminal portion of CHD-8, which lacks the Chromo and SNF2-related helicase domains of CHD-8. This fragment still contains the BRK domains and the binding sequence for CTCF [46]. CTCF is a protein involved in imprinting, which has been shown to be regulated by poly-ADP-ribosylation [47, 48]. Lastly, members of both the MBD and CHD families are part of the Mi-2/NuRD protein complex which is a known regulator of Snail transcription [49, 50]. Further 68  studies are required to determine whether MBD-5 and the fragment of CHD-8 are valid SIREbinding partners and how ILK is able to regulate their functions. Finally, the striking upregulation of E-cadherin in PC3 cells depleted of PARP-1, together with data suggesting that PARP-1 is an ILK-dependent SIRE-interacting partner, provides strong evidence for a role of PARP-1 in mediating ILK-dependent regulation of E-cadherin expression. The regulation of E-cadherin expression by PARP-1 is likely dependent on transcriptional repression of the E-cadherin gene as depletion of PARP-1 suppresses mRNA for Snail, as well as another E-cadherin repressor, ZEB1. Importantly, depletion of PARP-1 results in an expression pattern of Snail, ZEB1 and E-cadherin similar to that observed when ILK, an upstream component of this regulatory pathway, is silence. In this study we have identified PARP-1 as a novel SIRE-binding protein downstream of the ILK signaling pathway. Our data demonstrate a role for PARP-1 in the regulation of E-cadherin and implicates transcriptional repressors such as Snail in this process. We propose that ILK regulates PARP-1 to modulate its ability to bind the SIRE sequence of the Snail promoter. The presence of PARP-1 on the Snail promoter mediates Snail transcription and its subsequent repression of E-cadherin transcription. These data, together with the emerging co-factor role of PARP-1 in pathways known to be involved in EMT, suggest that further analysis of PARP-1 in the ILK-mediated regulation of E-cadherin and the process of EMT is needed.  69  2.4 Experimental Procedures  Cell Culture  PC3 and Scp2 cells were obtained from ATCC (Manassas, VA). PC3 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal calf serum (FCS) (Burlington, ON, Canada), penicillin (100 units/ml) and streptomycin (100 mg/ml) (Invitrogen). Scp2 ILK(14) and Scp2 ILK(13) cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml), streptomycin (100 mg/ml) (Invitrogen), and 100 µg/ml G418 (Invitrogen). Parental Scp2 cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml) and streptomycin (100 mg/ml) (Invitrogen). Cells were cultured at 37°C in 5% CO2. All cells were routinely grown on tissue culture plastic. Cells were trypsinized at 90% confluence using trypsin:PBS/EDTA, diluted 1:4 in phosphate buffered saline (PBS), and resuspended in the appropriate media containing serum. Cells were re-plated at a ratio of 1:10.  Coating Plates  Poly-L-lysine-coated plates were prepared as follows: Poly-L-Lysine was diluted to 0.0001% w/v (1:100) in PBS from a stock solution of 0.01% w/v. Tissue culture plates were then coated 1 hour at room temperture. The plates were then washed 3X with PBS.  70  Cell Lysis  Cell monolayers were harvested in cold PBS and lysed in 5x the cell pellet volume of RIPA lysis buffer. Soluble fractions were separated and protein concentrations were determined using the BCA Protein Assay (Pierce, Rockford, IL, USA) according to the manufacturer’s recommendations. Briefly, triplicate 5 µl samples of cleared cell lysate and 95 µl of BCA reagent were added per well and incubated 30 minutes at 37OC. Absorbance was measured using a standard protocol. Bovine Serum Albumin (BSA) was used to establish a protein concentration standard curve. Lysates were used immediately or stored at -80°C.  Nuclear Fractionation  Nuclear extracts were prepared by the mini-extraction method as described previously [51]. Protein concentrations were determined using the Bradford Protein Assay (BioRad, Mississauga, ON, Canada) according to the manufacturer’s instructions. BSA was used to establish a protein concentration standard curve. Lysates were used immediately or stored at 80°C.  Western Blots  Samples to be analyzed were boiled in the appropriate volume of 4x sample buffer for 5 minutes and were resolved by 10% SDS-PAGE at 100 V per gel for approximately 1 hour. Samples were transferred onto PVDF membrane and blocked with 5% nonfat dry milk in TBS. The  71  membrane was incubated overnight at 4°C with the appropriate primary antibody in 5% nonfat dry milk in TBS. The membrane was then incubated with the appropriate secondary HRP-conjugated antibody and visualized using ECL Western blotting detection reagents obtained from Amersham Pharmacia (Buckinghamshire, England, UK), or Supersignal detection reagents (Pierce) according to manufacturer’s instructions. Blots were stripped and re-probed a maximum of 1x using Restore Western blot stripping buffer (Pierce). Images were obtained on a BioRad Versadoc MP 5000 imager (BioRad, Mississauga, ON, Canada) according to the manufacturer’s instructions.  Antibodies  The following antibodies were used: anti-ILK (1:1000 dilution), anti-E-cadherin (1:2500 dilution), anti-Akt (1:1000 dilution), anti-GSK3-! (1:1000 dilution), anti-PARP-1 (1:1000 dilution) (all monoclonal antibodies from BD Biosciences, Mississauga, ON, Canada), monoclonal anti-!-actin (1:10 000 dilution) (Sigma-Aldrich, Oakville, ON, Canada), polyclonal anti-lamin A/C (1:1000 dilution) (Cell Signaling Technologies, Danvers, MA, USA), monoclonal anti-Snail (1:100 dilution) (obtained as a gift from Dr. I. Virtanen) and polyclonal anti-Snail (1:1000) (Abcam Inc., Cambridge, MA).  siRNA Transfection  Transfections were conducted with Silentfect (BioRad) in PC3 cells according to the manufacturer’s directions. Briefly, cells were split into poly-L-lysine coated 6-well cell culture plates and allowed to attach overnight. Poly-L-Lysine (Sigma-Aldrich) was diluted to 0.0001% w/v in PBS  72  from a stock solution of 0.01% w/v, incubated on tissue culture plates for 1 hour at room temperature and washed with PBS. Transfection reagent and siRNA were combined in OptiMEM (Invitrogen), which was subsequently diluted with DMEM containing 10% FCS. Cells were incubated with transfection mixture overnight and refed with DMEM 10% containing FCS. Cells were split (typically into one 100 mm dish per well) 24 hours post-transfection and harvested 96 hours post-transfection.  siRNA Constructs  All siRNA constructs were purchased from Qiagen (Mississauga, ON, Canada) and reconstituted according to the manufacturer’s instructions. Sequences used were as follows: ILK-A (AACCTGACGAAGCTCAACGAG), ILK-FSF [52], ILK-H [52], PARP-1 [53], AKT-1 [54], GSK3! [55] and Snail [56]. Control, non-silencing siRNA (from Qiagen’s data base, 16-base overlap with Thermotoga maritimia).  RNA preparation  mRNA was prepared from cells using the Qiagen RNeasy mini-prep kit (Qiagen) according to the manufacturer’s instructions. A DNase kit was used in conjunction with the mini-prep kit to ensure mRNA purity. cDNA was prepared from purified mRNA using Superscript II (Invitrogen). 2 µg of mRNA was converted to cDNA using random hexamers as primers according to the manufacturer’s instructions. For sequences of siRNA constructs see Appendix B.  73  qRT-PCR  Quantitative Real-Time PCR (qRT-PCR) was conducted using both intercalating dyebased (SYBR Green) as well as probe-based (Roche Universal Probe Library, UPL) (Roche Applied Science, Laval, Quebec, Canada) technologies on an Applied Biosystems (Foster City, CA, USA) qRT-PCR instrument according to the manufactures’ instructions. Briefly, 1 µg of total RNA was used in a 40 µl reaction to make cDNA. Subsequently for the UPL system, 10 µl of qRTPCR mixture containing 100nM UPL probe, 200 nM of each primer and TaqMan PCR master mix (Applied Biosystems) was loaded into a 384-well plate. For the intercalating dye-based methodology, 1 µl cDNA was used per 25 µl reaction, which contained SYBR Green master mix and 0.5 µM of each primer. After a preliminary 95OC incubation the samples were read for 40 cycles (95OC : 30 sec, 60OC : 30 sec, 72OC : 60 sec). Samples were analysed using Applied Biosystems analysis software to determine relative quantity. Control siRNA-treated cells were used as the reference. The values for mRNA expression were normalized using !-actin as the housekeeping gene. All qRT-PCR primers for the UPL system were designed using the Roche Applied Science online assay design centre. The primers used for the SYBR Green system were as follows: E-cadherin [57], Snail sense (5'- CCTCAAGATGCACATCCGAAGCCA-3') and antisense (5'-AGGAGAAGGGCTTCTCGCCAGTGT-3') and !-actin [58]. All primers were purchased from Invitrogen (Burlington, ON, Canada). For sequences of qRT-PCR primers see Appendix C.  74  Resolution of biotinylated oligonucleotides  The single-stranded DNA oligonucleotides were purchased from Invitrogen. DNA oligonucleotides that corresponded to the SIRE sequence were designed with the 5' end of the sense strand conjugated to a biotin molecule, allowing its immobilization on a streptavidin column. Complementary cDNA sequences were incubated together in Annealing Buffer at 90°C for 1 minute and allowed to cool to room temperature. The annealed oligonucleotides were then separated by 10% TBE-PAGE. Bands were visualized with EtBr and UV light. The band corresponding to the dsDNA oligonucleotide was excised and resolubilized in ddH2O. Oligonucleotide concentration was quantified by spectrophotometry. The oligonucleotide probe was stored at -20°C.  Isolation of SIRE-Binding Proteins  Nuclear extracts were concentrated and dialyzed in binding buffer (20 mM HEPES-KOH pH 7.9, 100 mM KCl, 2.5 mM MgCl2, Glycerol 20%, 0.2 mM EDTA, 23 mM NaCl, 1% NP40, 1x Complete™ protease inhibitor cocktail (Santa Cruz Biotechnology, Santa Cruz, CA, USA), 0.2 mM PMSF, 2 mM NaF, 50 mM !-glycerophosphate and 1 mM Na3VO4) using a Millipore (England) 5 Da spin column. Concentrated nuclear extract was precleared with streptavidin-agarose (SigmaAldrich). Protein isolation was conducted with a µMACS streptavidin Kit (Miltenyl, Auburn, CA, USA) in the presence of 50 µg/ml Poly(dI-dC) (Sigma-Aldrich) and sonicated with salmon sperm DNA (10 µl per ml of nuclear extract) (Sigma-Aldrich), according to manufacturer’s instructions. Binding proteins were eluted from the column with an increasing salt concentration (270 mM, 520  75  mM, 770 mM and 1020 mM). Proteins were resolved on 10% SDS-PAGE and visualized on the Typhoon Scanner (Amersham) using Sypro® Ruby stain (Invitrogen) as per the manufacturer’s instructions. Proteins with differential banding between the two experimental conditions were excised and identified by mass spectrometry.  Radioactive labeling of DNA probe  DNA probes were designed with a 5' AAT overhang to allow for radioactive labeling. Single-stranded DNA sequences were purchased from Invitrogen. Complementary cDNA sequences were incubated together in Annealing Buffer at 90°C for 1 minute and allowed to cool to room temperature. The 5' overhang was end-filled by incubation with Klenow enzyme using dTTP and either dATP or 32P-dATP (Amersham, Piscataway, NJ, USA). Specifically, oligonucleotide was incubated with an excess of dTTP and, dATP or 32Pa-dATP at 37°C for 2 hours. Unincorporated nucleic acids were removed using a G50 microspin column (Amersham) according to the manufacturer’s instructions.  EMSA  Electrophoretic mobility shift assays (EMSA) were performed by incubating 10 "g of the nuclear extracts for 20 min at room temperature with a 32P-dATP end-labeled SIRE oligonucleotide. The reaction mixture was incubated in a binding buffer containing 20 mM Hepes–potassium hydroxide, pH 7.9, 2.5 mM MgCl2, 100 mM KCL, 0.2 mM EDTA, 1% NP40, 23 mM NaCl, 5% glycerol and 0.2 mM PMSF. Reaction products were analyzed on a non-denaturing 5%  76  polyacrylamide gel (0.5% Tris-borate-EDTA, 2.5% glycerol). The specificity of the DNA–protein interaction was established by competition experiments using 100x cold competitor.  77  2.5 References  1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.  Savagner, P., Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. Bioessays, 2001. 23(10): p. 912-23. Thiery, J.P., Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer, 2002. 2(6): p. 442-54. Iwano, M., et al., Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest, 2002. 110(3): p. 341-50. Weigelt, B., J.L. Peterse, and L.J. van 't Veer, Breast cancer metastasis: markers and models. Nat Rev Cancer, 2005. 5(8): p. 591-602. Umbas, R., et al., Decreased E-cadherin expression is associated with poor prognosis in patients with prostate cancer. Cancer Res, 1994. 54(14): p. 3929-33. Batlle, E., et al., The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol, 2000. 2(2): p. 84-9. Hennig, G., et al., Mechanisms identified in the transcriptional control of epithelial gene expression. J Biol Chem, 1996. 271(1): p. 595-602. Ji, X., et al., Transcriptional defects underlie loss of E-cadherin expression in breast cancer. Cell Growth Differ, 1997. 8(7): p. 773-8. Giroldi, L.A., et al., Role of E boxes in the repression of E-cadherin expression. Biochem Biophys Res Commun, 1997. 241(2): p. 453-8. Nieto, M.A., The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol, 2002. 3(3): p. 155-66. Cano, A., et al., The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol, 2000. 2(2): p. 7683. Sefton, M., S. Sanchez, and M.A. Nieto, Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development, 1998. 125(16): p. 3111-21. Carver, E.A., et al., The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol, 2001. 21(23): p. 8184-8. Moody, S.E., et al., The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell, 2005. 8(3): p. 197-209. De Craene, B. and G. Berx, Snail in the frame of malignant tumor recurrence. Breast Cancer Res, 2006. 8(4): p. 105. Perez-Mancera, P.A., et al., Cancer development induced by graded expression of Snail in mice. Hum Mol Genet, 2005. 14(22): p. 3449-61. Guaita, S., et al., Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem, 2002. 277(42): p. 39209-16. Rosano, L., et al., Endothelin-1 promotes epithelial-to-mesenchymal transition in human ovarian cancer cells. Cancer Res, 2005. 65(24): p. 11649-57. Li, X., et al., Snail induction is an early response to Gli1 that determines the efficiency of epithelial transformation. Oncogene, 2006. 25(4): p. 609-21.  78  20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37.  Tan, C., et al., Inhibition of integrin linked kinase (ILK) suppresses beta-cateninLef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 2001. 20(1): p. 133-40. Legate, K.R., et al., ILK, PINCH and parvin: the tIPP of integrin signalling. Nat Rev Mol Cell Biol, 2006. 7(1): p. 20-31. Hannigan, G., A.A. Troussard, and S. Dedhar, Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer, 2005. 5(1): p. 51-63. McDonald, P.C., A.B. Fielding, and S. Dedhar, Essential roles of integrin-linked kinase in physiology and cancer biology. J Cell Sci, 2008: p. submitted. Somasiri, A., et al., Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 2001. 114(Pt 6): p. 1125-36. Novak, A., et al., Cell adhesion and the integrin-linked kinase regulate the LEF-1 and beta-catenin signaling pathways. Proc Natl Acad Sci U S A, 1998. 95(8): p. 4374-9. Simpson, L. and R. Parsons, PTEN: life as a tumor suppressor. Exp Cell Res, 2001. 264(1): p. 29-41. Persad, S., et al., Tumor suppressor PTEN inhibits nuclear accumulation of betacatenin and T cell/lymphoid enhancer factor 1-mediated transcriptional activation. J Cell Biol, 2001. 153(6): p. 1161-74. Barbera, M.J., et al., Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene, 2004. 23(44): p. 7345-54. Oloumi, A., S. Syam, and S. Dedhar, Modulation of Wnt3a-mediated nuclear beta-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene, 2006. 25(59): p. 7747-7757. D'Amico, M., et al., The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3beta and cAMP-responsive element-binding protein-dependent pathways. J Biol Chem, 2000. 275(42): p. 32649-57. Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTENmutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12. Tan, C., et al., Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell, 2004. 5(1): p. 79-90. Troussard, A.A., et al., The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene, 2000. 19(48): p. 5444-52. Troussard, A.A., et al., Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3dependent manner. Mol Cell Biol, 1999. 19(11): p. 7420-7. Ewing, C.M., et al., Chromosome 5 suppresses tumorigenicity of PC3 prostate cancer cells: correlation with re-expression of alpha-catenin and restoration of E-cadherin function. Cancer Res, 1995. 55(21): p. 4813-7. Ju, B.G., et al., Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell, 2004. 119(6): p. 815-29. Andreone, T.L., et al., Poly(ADP-ribose) polymerase-1 regulates activation of activator protein-1 in murine fibroblasts. J Immunol, 2003. 170(4): p. 2113-20.  79  38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55.  Idogawa, M., et al., Poly(ADP-ribose) polymerase-1 is a component of the oncogenic T-cell factor-4/beta-catenin complex. Gastroenterology, 2005. 128(7): p. 1919-36. Miyamoto, T., T. Kakizawa, and K. Hashizume, Inhibition of nuclear receptor signalling by poly(ADP-ribose) polymerase. Mol Cell Biol, 1999. 19(4): p. 26449. Pavri, R., et al., PARP-1 determines specificity in a retinoid signaling pathway via direct modulation of mediator. Mol Cell, 2005. 18(1): p. 83-96. Kannan, P., et al., PolyADP-ribose polymerase is a coactivator for AP-2mediated transcriptional activation. Nucleic Acids Res, 1999. 27(3): p. 866-74. Eberhart, C.G., Medulloblastoma in mice lacking p53 and PARP: all roads lead to Gli. Am J Pathol, 2003. 162(1): p. 7-10. Le Page, C., et al., Inhibitors of ADP-ribosylation impair inducible nitric oxide synthase gene transcription through inhibition of NF kappa B activation. Biochem Biophys Res Commun, 1998. 243(2): p. 451-7. Peiro, S., et al., Snail1 transcriptional repressor binds to its own promoter and controls its expression. Nucleic Acids Res, 2006. 34(7): p. 2077-84. Roloff, T.C., H.H. Ropers, and U.A. Nuber, Comparative study of methyl-CpGbinding domain proteins. BMC Genomics, 2003. 4(1): p. 1. Ishihara, K., M. Oshimura, and M. Nakao, CTCF-dependent chromatin insulator is linked to epigenetic remodeling. Mol Cell, 2006. 23(5): p. 733-42. Yu, W., et al., Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat Genet, 2004. 36(10): p. 1105-10. Torrano, V., et al., Targeting of CTCF to the nucleolus inhibits nucleolar transcription through a poly(ADP-ribosyl)ation-dependent mechanism. J Cell Sci, 2006. 119(Pt 9): p. 1746-59. Fujita, N., et al., MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell, 2003. 113(2): p. 207-19. Bowen, N.J., et al., Mi-2/NuRD: multiple complexes for many purposes. Biochim Biophys Acta, 2004. 1677(1-3): p. 52-7. Andrews, N.C. and D.V. Faller, A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res, 1991. 19(9): p. 2499. Troussard, A.A., et al., Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem, 2003. 278(25): p. 22374-8. Kameoka, M., et al., RNA interference directed against Poly(ADP-Ribose) polymerase 1 efficiently suppresses human immunodeficiency virus type 1 replication in human cells. J Virol, 2004. 78(16): p. 8931-4. Katome, T., et al., Use of RNA interference-mediated gene silencing and adenoviral overexpression to elucidate the roles of AKT/protein kinase B isoforms in insulin actions. J Biol Chem, 2003. 278(30): p. 28312-23. Hsieh, A.C., et al., A library of siRNA duplexes targeting the phosphoinositide 3kinase pathway: determinants of gene silencing for use in cell-based screens. Nucleic Acids Res, 2004. 32(3): p. 893-901.  80  56. 57. 58.  Olmeda, D., et al., Snail silencing effectively suppresses tumour growth and invasiveness. Oncogene, 2007. 26(13): p. 1862-74. Tang, A., et al., E-cadherin is the major mediator of human melanocyte adhesion to keratinocytes in vitro. J Cell Sci, 1994. 107 ( Pt 4): p. 983-92. Patel, G.P., S. Ma, and J. Bag, The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res, 2005. 33(22): p. 7074-89.  81  Chapter 3  Conclusions  3.1 Introduction  A great deal of interest has been focused on the process of EMT, in particular its hypothesized role in the invasion and metastasis of cancer and the development of fibrotic disease. The role of EMT in these processes, and the exact characteristics that define the process, are quite controversial. In this study we have worked under the hypothesis that epithelial cells adopt mechanisms of EMT during carcinogenesis and fibrotic disease. Due to the lack of consensus on what characterizes EMT, we have focused our study on the regulation of E-cadherin, a key protein that is downregulated in this process. Transcriptional regulation is key in the modulation of Ecadherin expression and numerous transcriptional repressors have been identified. ILK is known to regulate Snail-1 expression primarily through the SIRE sequence in the 5' promoter, but the transcriptional complex involved in this regulation has not been identified. The goal of this thesis was to identify candidate proteins that are able to bind the SIRE downstream of ILK. We identified PARP-1 as a putative SIRE binding protein and conducted preliminary characterization of the mechanisms of PARP-1 in the regulation of the Snail-1/E-cadherin pathway. PARP-1 originally was thought only to play a role in the detection and repair of DNA damage. Inhibitors designed to target its polymerase activity are being examined for efficacy as a therapy for various carcinomas. Recent work has identified further roles for PARP-1 including a role in ischemia, primarily through NF!B, and as a co-factor in various transcriptional complexes. Its role as a co-factor in of numerous  82  transcriptional complexes has suggests that there may be secondary effects of these inhibitors, which must be considered in development of therapeutic regimes. The data presented here provide further insight into the mechanism by which ILK regulates the process of EMT, via PARP-1 and Snail-1.  3.2 ILK and EMT  The role for ILK in the process of EMT has been demonstrated in numerous studies however the mechanism by which it exerts this control is unknown. The Scp2 mouse mammary epithelial cell line was previously shown to undergo EMT due to the exogenous overexpression of ILK[1]. This EMT is characterized by the acquisition of a mesenchymal morphology, the loss of Ecadherin and a shift from epithelial to mesenchymal tight junction proteins. We are able to expand on these observations by demonstrating that the loss of E-cadherin expression is due to a decrease in mRNA. We hypothesize that the downregulation of E-cadherin transcription is due to Snail-1, which we show is highly expressed at both the mRNA and protein level in Scp2 cells over expressing ILK. Increased mRNA demonstrates that Snail-1 upregulation is due to increased transcription and not just stabilization of protein. However ILKs important role in the regulation of GSK3 also implicates it in the regulation of Snail-1 protein stability. Recent work has shown that the regulation of Snail-1 protein stability by GSK3 is regulated by Wnt signalling[2], a pathway known to be impinged upon by ILK[3-6]. These data demonstrate a direct induction of EMT by ILK and strongly implicate the transcriptional regulation of Snail-1 as a pivotal step downstream of ILK in this process. The Scp2 cell line demonstrates the induction of EMT due to ILK, however we wished to establish a human cell culture model system that would allow us to determine the signalling 83  pathways components in ILK induced EMT. The main model system used in this study is the PC3 cell line. PC3 cells are a human prostate carcinoma cell line that have converted to a mesenchymal phenotype and no longer express E-cadherin. They are PTEN-null, which results in the constitutive activation of the PI3-K/ILK/AKT signalling axis. Data previously published by our laboratory showed that the re-expression of a PTEN construct in PC3 cells resulted in the inhibition of the PI3K/ILK/AKT signalling axis and the re-expression of E-cadherin[3]. PC3 cells are ideal for the study of the initial steps in the reversion to an epithelial phenotype because they are "-catenin-null and therefore are unable to form adherence junctions[7]. The formation of adherence junctions alone can result in the modulation of epithelial and mesenchymal genes and a partial reversion to an epithelial phenotype[1]. Stabilisation of adherence junctions also results in an increase in the halflife of the E-cadherin protein[8, 9], which would not be ideal for assaying regulation of E-cadherin and EMT immediately downstream of ILK. These properties demonstrate that PC3 cells are an appropriate model for the study of EMT downstream of ILK. Using small interfering RNA (siRNA) mediated knockdown of ILK in the PC3 cell line we were able to identify PARP-1, MBD-5 and a fragment of CHD-8 as candidate SIRE binding proteins downstream of ILK. The discovery of these SIRE binding proteins, whose binding activity is regulated by ILK, provides a new target in the study of EMT during development, carcinogenesis and initiation of fibrotic disease. Interestingly PARP-1 has recently emerged as a co-factor in numerous transcription factor complexes, including #-catenin/TCF[10], NF!B[11] and Gli1[12], which are implicated in EMT. Interestingly both #-catenin/TCF [4, 6, 13] and NF!B[14] are regulated by ILK in some cell types and signalling contexts and have also been suggested to regulate Snail-1[15-17]. We were able to characterize the role of PARP-1 downstream of ILK in the regulation of Snail-1.  84  3.3 PARP-1 a SIRE binding protein  Our data demonstrates the ability of PARP-1 to regulate the expression of Snail-1 and Ecadherin. Although PARP-1 was identified due to its ability to bind the SIRE in an in vitro protein chromatography assay we are not able to definitively demonstrate PARP-1 SIRE binding. Using an EMSA we provide data to support the specific binding of PARP-1 to the SIRE fragment downstream of ILK. EMSA data demonstrates that numerous protein complexes are able to bind the SIRE and that one of these complexes was disrupted due to the loss of either ILK or PARP-1. A supershift assay, increasing molecular weight of binding complex due to binding of a specific PARP-1 antibody, would be required to definitively demonstrate that this complex contains PARP1. We were not able to conduct a supershift assay due to the fact that the addition of the reducing agent DTT to the binding buffer in order to obtain focused bands. The addition of DTT results in the dissociation of the heavy and light chains and destruction of the PARP-1 antibody rendering it unable to bind its antigen. Therefore at this time we are unable to conduct a supershift assay. The SIRE sequence in human, mouse and rat is highly homologous (Table 3.1). We predicted that the human SIRE sequence could substitute for the mouse SIRE sequence. EMSA on ILK overexpressing (ILK-13-8), but not parental or anti-sense non-coding ILK overexpressing (ILK-14-1), Scp2 cells produced a SIRE binding complex that corresponded in size the putative PARP-1 containing complex (Figure 3.1). It is likely that the binding proteins important for the transcriptional control of Snail-1 are also highly conserved. This data supports a similar mechanism and protein complex in the context of ILK overexpression in the Scp2 cell line and constitutive ILK activity in the PC3 cell line.  85  Table 3.1 Alignment and homology of the SIRE sequence in human, mouse and rat. Species Human Mouse Rat  SIRE Sequence CGGGCTCTCACCGCCACGCGGCGCGAGCCCGGCCAGCAGCC--GGCGCACCTGCTCGGGGAGTGGCC CGGAATCTCAGCGCCACGCGGCGGGAGCCC---CAGCAGCCCAGGCGCACCTGCTCCGGTCTCAGTC CCCAATCTCAGCGCCACGCGGCGGGAGCCC---CTGCAGCCCAGGCGCACCTGCTCTGATCCCGGTC  Human to Mouse Human to Rat Mouse to Rat  Homology 83.051% 82.353% 91.803%  Overlap 59 bp 51 bp 61 bp  Calculated using EMBL-EBI DNA homology and Similarity Tool  Figure 3.1 Electromobility shift assay (EMSA) using nuclear extracts of PC3 cells and Scp2 stable cell lines and a Klenow 3' 32P-ATP end-labelled SIRE oligonucleotide. Panels (A) and (B) presented in Figure 2.4. The increase in a shifted band (arrows) in the Scp2 ILK-13 sample relative to the parental and ILK-14 samples corresponds to a shifted band due to siRNAmediated depletion of ILK or PARP-1 in PC3 cells. Methods in Appendix D.  86  87  In addition to EMSA we attempted to verify SIRE binding of PARP-1 using Chromatin Immunoprecipatation (ChIP). The ChIP assay allows the verification of protein binding to promoter elements, however the resolution of ChIP is such that it is only possible to demonstrate enriched binding within a region of genomic DNA, due to the 600bp genomic DNA fragment size that equates to approximately 3 nucleosomes. In brief, transcription factor complexes are cross-linked to DNA, DNA is fragmented into approximately 600bp sequences by sonication, protein/DNA complexes are isolated by immunoprecipitation with specific antibodies, crosslinks are reversed and bound DNA is purified for analysis by PCR. We were unable to obtain results in which our experimental samples were significantly different from negative control samples. The lack of significant data may be due to a number of technical issues we were unable to overcome. The fragmentation ofgenomic DNA could result in the binding and activation of PARP-1, via its DNA damage sensor function resulting in increased background. The presence of a CpG island within the Snail-1 promoter resulted in primer sequences and PCR products with high GC content. The over representation of guanidine and cytosine bases results in higher melting temperatures, which greatly reduces the efficiency of PCR. The inclusion of the solvent dimethyl sulfoxide (DMSO) in the reaction buffer reduced melting temperatures, but we were still unable to obtain robust PCR products. As PARP-1 has been shown to bind promoters as part of a transcriptional complex it is possible that the epitope for the PARP-1 antibody was obscured in the SIRE binding complex. The development of new PARP-1 antibodies or the identification of additional complex members may allow the verification of PARP-1 as a component of a transcriptional complex on the Snail-1 promoter. In addition the use of qPCR techniques rather than standard PCR may result in greater signal to noise ratios and obtain significant results. At this time it is not possible to prove that PARP-1 binds the SIRE sequence of the Snail-1 promoter, however its identification with an unbiased assay, the loss of a binding complex in the 88  absence of PARP-1 or ILK, and the downregulation of Snail-1 and concomitant upregulation of Ecadherin with PARP-1 knockdown support our conclusion that PARP-1 is a bona fide SIRE binding protein that is regulated by ILK.  3.4 PARP-1 binding sequence  We are unable to determine the specific PARP-1 binding sequence within the SIRE fragment. Due to its demonstrated role in numerous transcription factor complexes it is most likely that PARP-1 does not bind DNA directly or that the DNA binding is not sequence specific. Other complex members likely mediate binding of the PARP-1 complex to the SIRE sequence. The SIRE contains two features that may be important in PARP-1 complex binding, an E-box motif and multiple CpG dinucleotides. Our data with a SIRE oligonucleotide containing a mutation in the Ebox motif suggests that the E-box domain does not prevent PARP-1 complex binding. However it is possible that the E-box motif may be important for the binding of inhibitory complexes, which could be displaced by the PARP-1 complex. This is supported by the observation that Snail-1 is able to bind its own promoter via the E-box[18]. We attempted Co-Immunoprecipitation analysis to determine if there is an interaction between PARP-1 and Snail-1, no interaction was observed. However this may be due to the lack of a robust Snail-1 antibody. A robust Snail-1 antibody would also allow the immunoprecipitation of Snail-1 to assay its poly-ADP-ribosylation status to determine if it is a target of PARP-1 polymerase activity. Mutations of the SIRE E-box in a Snail-1 promoter luciferase construct could determine if this element is important in the expression of Snail-1. It is interesting that the Snail-1 promoter contains a CpG island as they are normally associated with ubiquitously expressed genes. Future studies are needed to determine if the E-box or CpG dinucleotides, in particular their methylation status, plays a role in Snail-1 regulation. 89  3.5 Signalling downstream of ILK in PARP-1 regulation  Our initial hypothesis was that the kinase activity of ILK was responsible for the downstream events that resulted in PARP-1 binding to the SIRE. This hypothesis was based on the observations that constitutive ILK kinase activity or modulation of its downstream signalling molecules correlated with changes in E-cadherin expression. Somosiri et al. demonstrated that overexpression of wild-type, but not kinase-dead ILK resulted in the loss of E-cadherin expression. AKT is a key target of ILKs kinase activity, which activates its kinase activity. The loss of AKT expression in PC3 cells also leads to a re-expression of E-cadherin and a modulation of Snail-1 protein levels, further supporting a role for ILKs kinase activity. PTEN is an important negative regulator of ILK kinase activity. The loss of PTEN results in the activation of various oncogenic signalling pathways and, importantly in this study, the PI3K-ILKAKT signalling axis. Our lab has previously demonstrated the role for PTEN in the regulation of Ecadherin via regulation of ILK kinase activity [3]. To replicate the loss of E-cadherin in the PTENnull PC3 cell line we downregulated the expression of PTEN using siRNA expression in Human Embryonic Kidney (HEK)-293 cells. Downregulation of PTEN expression in HEK-293 cells results in the down-regulation of E-cadherin protein (Fig 3.2). This downregulation of E-cadherin was partially reversed in a dose-dependent manner by the siRNA mediated downregulation of either ILK or PARP-1. This provides evidence to suggest that PARP-1 plays a role in the dysregulation of E-cadherin in a system in which the PI3K-ILK-AKT signalling axis is constitutively activated. However knockdown of ILK or PARP-1 only partially blocked E-cadherin loss, suggesting that other pathways downstream of PTEN may also contribute to E-cadherin regulation. These data indicate that the kinase activity of ILK is critical in its modulation of EMT. 90  Figure 3.2 The effect of siRNA-mediated depletion of PTEN, ILK and/or PARP-1 on E-cadherin expression in HEK-293 cells. HEK-293 cells were transfected with the indicated µg of specific siRNA. Western blot analysis was conducted to demonstrate the knockdown of protein expression and to assess the effect of PTEN, ILK and PARP-1 knockdown, alone or in combination, on E-cadherin expression. #-actin was used as a loading control. Methods in Appendix D.  However transfection with a dominant-negative ILK construct (ILK-S243D) and treatment with a specific small-molecule ILK inhibitor (QLT-0267) did not result in a re-expression of Ecadherin in the PC3 cell line (data not shown). This suggests that it is not kinase activity alone that regulates PARP-1 binding to the Snail-1 promoter. We hypothesize that the regulation of PARP-1 by ILK in the Snail-1/E-cadherin pathway is indirect and involving both the kinase and adapter functions of ILK. It is possible that ILKs ability to interact and modulate different signalling  91  complexes is effected by its kinase activity or conversely that its interaction with different signalling complexes effects its kinase activity. As previously discussed a number of transcription factor complexes have been shown to be regulated by ILK and have PARP-1 as a co-factor. To elucidate the downstream signalling will require identification of other members of the PARP-1 SIRE binding complex and identification of mechanism that allows PARP-1 to interact with the SIRE, in particular the role of PARP-1s ADP-ribosylase activity.  3.6 Post-translational regulation of Snail-1 by ILK  In the PC3 cell line the knockdown of GSK-3# was not predicted to result in the upregulation of E-cadherin, since its activity is already inhibited by constitutive ILK activity. GSK-3# provides a control demonstrating that the upregulation of E-cadherin due to knockdown of ILK or AKT is not a stress response. Although total Snail-1 protein levels are not greatly affected by loss of ILK or AKT, there is a decrease in nuclear Snail-1. Analysis of Snail-1 protein levels, both the whole cell and nuclear fraction, indicate that localization and levels of Snail-1 protein are regulated by ILK and AKT. The reduction of nuclear Snail-1 may be due to the ability of ILK and AKT to regulate the activity of GSK-3#. GSK-3 is known to phosphorylate Snail-1 resulting in its translocation to the cytoplasm, ubiquitination and subsequent degredation[19, 20]. In the PC3 cell line the downregulation of GSK-3# expression results in an increase of Snail-1 protein levels, both whole cell and nuclear. We conclude that in addition to the transcriptional regulation ILK signalling can regulate Snail-1 post-translationally. We are able to demonstrate that the inhibition of GSK-3 activity partially blocks the upregulation of E-cadherin due to loss of ILK. We characterized the role of GSK-3 kinase activity  92  by inhibition using the GSK-3 inhibitor Lithium Chloride (LiCl). LiCl treatment partially blocked Ecadherin upregulation in ILK siRNA, but not Control siRNA treated PC3 cells (Fig. 3.3). This suggests that upon siRNA-mediated knockdown of ILK, GSK-3 activity is restored, which increases the nuclear export and decreases the stability of Snail-1. This provides evidence that ILK regulates Snail-1 post-translationally, via GSK-3, to regulate E-cadherin expression. LiCl treatment resulted in a further upregulation of E-cadherin expression in PARP-1 siRNA treated PC3 cells, however at this time we are unable to offer a hypothesis for this observation. Our data supports a role for ILKs kinase activity in the regulation of Snail-1 at the post-translational level.  93  Figure 3.3 Effect of the LiCl GSK-3 inhibitor on E-cadherin expression induced by depletion of ILK or PARP-1 in PC3 cells. siRNA-treated cells were incubated in the presence of the 50 mM LiCl or water vehicle. Protein expression was determined by Western blot analysis. #-actin was used as a loading control. Methods in Appendix D.  3.7 Inhibition of PARP-1 enzymatic activity in ILK and PARP-1 siRNA treated cells  In response to DNA damage the enzymatic activity of PARP-1 highly upregulated. This results in the poly- ADP-ribosylation of a number of target proteins, including itself, resulting in the recruitment of DNA repair machinery. In the context of DNA damage the auto-poly-ADPribosylation results in the inhibition of PARP-1 enzymatic activity, acting as a negative-feedback loop, but less extensive auto-poly-ADP-ribosylation may not inhibit its activity[21] and in some  94  contexts may increase its activity[22]. Smaller localized activation of PARP-1 may be critical for its function in transcriptional factor complexes. PARP-1 enzymatic activity is known to be involved in some of its co-factor functions[23]. The addition of the highly negative ADP ribose units by PARP-1 to itself, and other target proteins, can modulate protein-protein and protein-DNA interactions. The role of PARP-1s enzymatic activity in its function as a co-factor is highly context dependent. It can be stimulatory or inhibitory in both transcriptional activation and repression pathways. In the TLE-1/HES1 regulation of the mash1 gene locus, inactive PARP-1 functions as a transcriptional repressor, but switches to a transcriptional activator upon activation of its enzymatic activity[24]. Conversely in #-catenin/TCF4 transcription factor complex, inactive PARP-1 functions as a transcriptional activator and its activation inhibits transcription. Therefore the role of PARP-1s polymerase activity must be characterized to determine the mechanism of its co-factor function in the SIRE complex. We characterize the role of PARP-1 enzymatic activity by inhibiting its activity using 3aminobenzamide (3-AB). The inhibition of PARP-1 activity has no effect on Control or PARP-1 siRNA treated cells, but does inhibit the upregulation of E-cadherin in ILK siRNA treated cells (Fig. 3.4). The inhibition of PARP-1s poly(ADP-ribose) polymerase activity partially reverses the upregulation of E-cadherin due to the loss of ILK. The inability of 3-AB to effect E-cadherin in PARP-1 siRNA treated cells supports the conclusion that 3-AB action on ILK siRNA treaded PC3 cells is through regulation of PARP-1 mediated ADP-ribosylation and not a non-specific effect. These data suggest that the polymerase activity of PARP-1 is involved in its dissociation from the SIRE downstream of ILK.  95  Figure 3.4 Effect of the 3-AB poly(ADP-ribose)polymerase inhibitor on E-cadherin expression induced by depletion of ILK or PARP-1 in PC3 cells. siRNA-treated cells were incubated in the presence of the 100 µM 3-AB inhibitor or DMSO vehicle. Protein expression was determined by Western blot analysis. #-actin was used as a loading control. Methods in Appendix D.  We attempted to quantify the polymerase activity of PARP-1 in ILK siRNA treated cells using a commercially available PARP assay kit. The commercial assay is designed for the quantification of the modulation of PARP activity, such as with chemical inhibitors, in the context of DNA damage. In brief cell extracts are exposed to nicked DNA to stimulated PARP-1 activity and the incorporation of ADP-ribose units is quantified with a colourimetric assay. We modified the assay to omit the nicked DNA to measure endogenous PARP-1 activity, but were unable to detect the low levels of polymerase activity  96  This preliminary data suggests a model in which ILK inhibits PARP-1 polymerase activity, which allows it to form a complex with other proteins on the SIRE. How ILK downstream signaling is able to regulate PARP-1 polymerase activity is unknown.. The phosphorylation of PARP-1 is known to regulate its polymerase activity. As ILK and a number of its downstream effectors are kinases it is possible that in this context PARP-1 is regulated by phosphorylation. PARP-1 is a nuclear protein, whereas ILK is primarily a cytoplasmic protein[25]. ILK does contain a putative nuclear localisation signal and can be nuclear localized[26, 27], but we were not able to demonstrate binding of ILK and PARP-1 by co-immunoprecipitation. This suggests that the regulation of PARP-1 binding to the SIRE downstream of ILK is likely indirect. The polymerase activity of PARP-1 has been shown to activated by kinases such as JNK[28], Txk[29] and CaMKII[24, 30] and more importantly inhibit by kinases such as PKC[31, 32] and signaling downstream of IGF-1[33]. Interestingly phosphorylation of PARP-1 by Txk was require for formation of the transcription factor complex that contained PARP-1 and Txk. This suggests that phosphorylation of PARP-1 may regulate its polymerase activity and protein-protein interactions. Further work is needed to determine if PARP-1 is phosphorylated downstream of ILK signaling and if this phosphorylation regulates its polymerase activity or complex formation.  3.8 Transcriptional repressors of E-cadherin  We propose that re-expression of E-cadherin is due to the inhibition of E-cadherin transcriptional repressors. This hypothesis is supported by a decrease in both Snail-1 and Zeb1 mRNA levels. Knockdown of ILK resulted in the significant downregulation of Snail-1 and Zeb-1 mRNA. Previous studies have shown that the expression of Zeb-1 is regulated by Snail-1[34]. The model proposed based on Snail-1 and Zeb-1 expression patterns during development and in 97  various cell lines suggests that Snail-1 induces an EMT and subsequently upregulates Zeb-1 to maintain the mesenchymal phenotype. This supports our model in which ILK regulated Snail-1 expression and supports a role for Zeb-1 downstream of ILK in the induction of EMT. The knockdown of ILK and AKT did not have a large affect on the total cellular levels of Snail-1 protein; no change in total Snail-1 protein levels was observed due to loss of ILK and only minor change was observed due to loss of AKT. siRNA knockdown of Snail-1 itself results in only a moderate decrease in Snail-1 mRNA levels, but a large increase in E-cadherin protein expression. This suggests that even small changes in Snail-1 protein levels may have profound effects on the cell. The study of Snail protein has been confounded by the lack of robust commercially available antibodies that have high specificity for Snail. Recently, antibodies have been privately developed which has aided in the study of Snail. However endogenous levels of Snail are difficult to detect, due to low expression and high protein turnover. In some cell lines it is necessary to inhibit the Tcrp protease in order to detect Snail protein (Dr. I. Virtanen Personal Communication). The low expression and high protein turnover likely make assaying the proper time point for Snail-1 protein difficult. Assaying the Snail promoter activity using luciferase reporter technology would allow characterization of transcription. We attempted to quantify promoter activity with a Snail-1 luciferase construct, but co-transfection of siRNA and plasmid constructs was not possible in the PC3 cell line as it resulted in a high rate of cell death. New technology may allow this problem to be overcome (see future directions). The data presented in this thesis and in the current literature support a role of the ILK signalling pathway in the regulation of Snail-1 transcription, protein stability and cellular localisation. Further study is required to definitively quantify the downregulation of Snail-1s transcription, protein expression and translocation from the nucleus due to the disruption of ILK signalling and PARP-1 expression. However the data presented here identify PARP-1 as an 98  important co-factor in the regulation of Snail-1 and subsequently E-cadherin downstream of ILK signalling.  3.9 MBD-5 and fragment of CHD-8  In addition to PARP-1 we identified MBD-5 and a fragment of CHD-8 as candidate SIRE binding proteins downstream of ILK signalling using our chromatography approach. Interestingly all three proteins bound the SIRE in the presence, but not absence of ILK, however we are unable to conclude whether their binding directly provides a positive transcriptional signal or displaces an inhibitory complex. Members of both the MBD and CHD families are part of the Mi-2/NuRD protein complex which is a known regulator of Snail transcription [35, 36]. Further studies are required to determine whether MBD-5 and the fragment of CHD-8 are valid SIRE-binding partners and how ILK is able to regulate their functions. The methyl-CpG binding domain (MBD) of MBD-5 is interesting in that the 5' promoter of Snail contains a CpG island, which is unusual for a gene which is normally not expressed. If the MBD is interacting with the unmethylated CpG dinucleotides within the SIRE, the synthetic oligonuclieotide used in its identification was unmethylated, it would be unusual as the prototypic MBD as its name suggests interacts with methylated CpG dinucleotides. Alternatively the MBD may mediate a protein-protein interaction [37] with another SIRE binding protein. The CHD-8 N-terminal fragment has recently been determined to be the rat protein Duplin, identified as a #-catenin binding protein[38-40]. CHD-8 fragment/Duplin was shown interact directly with #-catenin, preventing the its interaction with TCF and inhibiting #-catenin/TCF target gene expression[38, 40]. There is no evidence for a human CHD-8 fragment/Duplin, but full-length CHD-  99  8 has been shown to interact with and inhibit #-catenin [39]. Our possible identification of the Nterminal fragment of CHD-8 by mass spectrometry within the PC3 human cell line may be the first identification of a human homolog and warrants further investigation. CHD-8 also interacts with CTCF [41] a protein involved in imprinting, which has been shown to be regulated by poly-ADPribosylation [42, 43]. This is intriguing in that the binding of CTCF is associated with gene repression and its binding is methylation sensitive[44, 45] as PARP-1 has been shown to bind and inactivate the DNA methylation enzyme Dmnt1[22, 46]. No role for CTCF in #-catenin signalling has been found. The possible role of CHD-8 in the inhibition of #-catenin suggests that this interaction is unlikely in our cellular context, as ILK signalling results in activation of #-catenin/TCF genes. The role of CHD-8 and its N-terminal fragment, CTCF, Dmnt1 and PARP-1 in the regulation of Snail-1 is interesting and requires further study.  3.10 Hypothesized Mechanism  We present a model in which ILK modulates the ability of PARP-1 to bind to the SIRE fragment in the Snail-1 proximal promoter (Fig. 3.5). The binding of PARP-1 to the SIRE regulates Snail-1 expression, which in turn regulates EMT and specifically the expression of E-cadherin. Our data demonstrates that the loss of ILK expression, in a context of constitutive ILK activity, results in the inability of PARP-1 to bind to the SIRE fragment. The loss of ILK, or PARP-1, expression both result in the downregulation of Snail-1 and Zeb1 expression and re-expression of E-cadherin, supporting their role in a common pathway. This model is supported by the observation that loss of E-cadherin due to siRNA knockdown of PTEN is partially blocked by the siRNA knockdown of either ILK or PARP-1. The members of the ILK regulated PARP-1 complex are unknown, but it is  100  interesting to speculate the involvement of pathways such as #-catenin and NF!B due to their known regulation by ILK and the role of PARP-1 as a co-factor in their transcription complexes. The identification of PARP-1 as an ILK regulated SIRE binding protein further elucidates the mechanism of this signalling axis and will aid in the identification of further binding complex proteins. The results presented in this thesis identify PARP-1 as a new protein involved in the regulation of E-cadherin expression. Our data provides support for our working hypothesis and we propose a new signalling model in which ILK regulates the ability of PARP-1 to form a complex on target DNA by modulating PARP-1s polymerase activity (Fig. 3.5). The consequence of this regulation is modulation of Snail-1 expression and subsequent regulation of E-cadherin, EMT and potentially other signalling pathways. Numerous challenges remain in clarifying the mechanisms of this pathway, particularly in the analysis of PARP-1 activity and Snail-1 expression, but the development of new tools and techniques will provide new means of study.  101  Figure 3.5 Schematic of proposed model of ILKs regulation of E-cadherin via PARP-1 and Snail-1. Modulation of PARP-1 polymerase activity by ILK may be through its kinase activity, its adapter function or both. Alternatively the regulation of PARP-1 may be through an intermediate molecule.  102  3.11 Future Directions The work conducted in this thesis provides a number of avenues of research to be pursued. This work involves the development of new tools and identification of additional pathway components.  3.11.1 Development of shRNA Constructs  siRNA knockdown of ILK and AKT, but not GSK-3#, resulted in the re-expression of Ecadherin in the PC3 cell line. The increase in E-cadherin mRNA suggests the re-expression is transcriptional however it was not possible for promoter activity to be assayed by reporter assays due to technical challenges (see future directions). siRNA constructs are a powerful tool that can rapidly and easily repress the expression of target proteins. siRNA technology is limited by its ability to only allow short-term downregulation of target protein expression. shRNA constructs are plasmids that may be transfected into cells and provide access to a wide variety of technologies not available for siRNA. The target sequence is inserted into the plasmid such that when it is transcribed, the mRNA forms small hairpins that are cleaved by endogenous enzymes to produce siRNA fragments. Unlike siRNA, shRNA allows for the long-term inducible downregulation of the target protein. The stable expression of Tetracyclineinducible shRNA constructs will provide a more accurate means of determining the effect of protein loss in various model systems. In addition, siRNA-mediated knockdown of protein expression provides a pool of cells with variable levels of protein expression, due to transfection efficiency, which may decrease the sensitivity of the assay by decreasing the signal to noise ratio. In particular both ILK and AKT are important anti-apoptotic factors, therefore cells in which high  103  siRNA-mediated knockdown occurs may undergo apoptosis, leading to the selection from a remaining pool of cells with a lower rate of transfection. The use of shRNA constructs directed against PARP-1 would allow the exogenous expression of PARP-1 mutants in a wild-type PARP-1 depleted environment. This would allow an examination of specific PARP-1 domains and PARP-1 activity in the regulation of Snail-1 and E-cadherin. The selection of stably transfected population of clones would provide a pool in which all cells contain the shRNA construct and downregulation of the target protein would be consistent in all cells. Using the new shRNA constructs would allow the reproduction of the results presented here and would provide further avenues of research.  3.11.2 Quantification of Promoter Activity of Snail-1 and E-cadherin with Luciferase Reporter Constructs  Although mRNA levels do reflect the levels of transcription, they may be affected by the stability of the mRNA and the rate of translation. Luciferase reporter constructs allow the quantification of promoter activity. Although reporter constructs use only a small portion of the gene promoter, their value as a means of quantifying transcription is well documented. Using siRNA, we were unable to quantify the promoter activity of E-cadherin or Snail-1 using the available luciferase reporter constructs due to technical issues. Transfection of the siRNA and reporter plasmid required different transfection reagents and whether serially transfected or co-transfected, the cells were unable to survive the treatment. This technical issue may be resolved using the Tet-inducible shRNA constructs. A cell line stably expressing a Tet-inducible shRNA construct could be transiently transfected with the luciferase reporter constructs and luciferase activity of induced versus non-induced cells could be compared. This provides a system in which numerous variables can be controlled, providing more accurate and robust results. First, the induced versus non104  induced cells would be identical cells accounting for the unknown factors due to the location in the genome where the construct integrated. Secondly, a single pool of cells transiently transfected with the luciferase reporter construct could be divided into induced and uninduced populations. This would control for any variability in transfection rate. Lastly, use of a tet-induced shRNA system not only allows quantification of promoter activity due to loss of protein expression, but would also allow quantification following protein re-expression after tetracycline stimulation has been removed. This would provide a powerful tool to more accurately measure the effect a protein has on the activity of a gene promoter.  3.11.3 Identification of PARP-1 binding partners  Recent evidence has shown that PARP-1 functions as a co-factor for numerous transcription factors. With the identification of PARP-1 as a downstream factor of ILK in regulation of E-cadherin expression, the next step is to identify binding partners that interact with PARP-1 in an ILK dependent manner. Our lab has recently employed the Stable Isotope Labelling with Amino acids in cell Culture (SILAC) system to identify ILK binding partners. This system could be used in conjunction with the inducible shRNA system to identify PARP-1 binding partners. Briefly, the SILAC system works by comparing two different cell populations that are grown in culture media that contains either a light (containing 12Carbon) or heavy (contains 13Carbon) form of a particular essential amino acid not synthesized by the cell. Culturing cells in this media results in newly synthesized proteins being labelled with the heavy or the light carbon isotope until eventually all proteins become labelled, with no effect on the cells. One population is used as an experimental sample and the other as a control sample. The resultant cells are mixed just prior to lysis and proteins are identified by mass spectrometry, which is able to differentiate between the 105  light and heavy varieties of protein. This provides data on the relative change in protein expression or protein-protein association between control and experimental conditions. This system can be used in conjunction with any purification system such as cell fractionation or immunoprecipitation. Since the cells are mixed prior to purification, no error is introduced due to variability in purification protocol. To identify PARP-1 binding partners that are regulated by ILK, stable lines containing the tet-inducible ILK shRNA construct would be labelled with the two isotopes and then one population would have the shRNA construct induced to downregulate ILK expression. PARP-1 protein complexes would be isolated by immunoprecipitation, with a PARP-1 antibody, and analyzed by mass spectrometry. Alternatively an exogenously expressed Tandem-Affinity Purification (TAP) tagged PARP-1 could be expressed and purified using the TAP technique[47], which allows isolation of highly purified protein complexes. This technique would permit identification of PARP-1 binding proteins that are modulated by ILK signalling, providing insight into the mechanism by which ILK regulates PARP-1.  3.11.4 ILKs Regulation of PARP-1 Polymerase Activity  The quantification of PARP-1 polymerase activity is challenging in that the sensitivity of the assay only allows the quantification of massive PARP-1 polymerase activity that results due to DNA damage, which produces large ADP-ribose polymers, and not the smaller polymers produced due to localized activation that is hypothesized to occur during co-factor reactions. Commercially available poly-ADP ribose (PAR) antibodies recognized only large polymers that are associated with DNA damage, not the shorter polymers hypothesized to be important in transcription. New antibodies have been developed that can detect the shorter polymers. Ju, BG et. al. showed the 106  poly-ADP ribosylation of components of the TLE1/Groucho complex using the 10H antibody for ADP-ribose polymer from RIKEN Cell Bank Japan. This antibody could be used to assay the polyADP ribosylation of PARP-1 binding proteins regulated by ILK and identified by SILAC. In addition it may be possible to compare the general pADP ribosylation status, particularly the nuclear and cytoplasmic fractions, between induced and and uninduced shRNA-transfected cells. New specific and highly efficacious PARP-1 inhibitors have been characterized and are commercially available. These new inhibitors in conjunction with the shRNA constructs could be used to clarify the role of ILK in regulating PARP-1 polymerase activity and its role in E-cadherin regulation. Finally ILKs ability to inhibit PARP-1 polymerase activity may influence the role of PARP-1 in apoptosis. Massive auto-poly-ADP ribosylation due to DNA damage results in cleavage of PARP-1, by caspases, and initiation of apoptosis. Preliminary data, using a PAR antibody in immunocytochemistry, indicates that inhibition of ILK activity, with a specific small molecule inhibitor, potentiates PARP-1 polymerase activity due to H2O2-induced DNA damage (Fig. 3.2). If ILK is able to regulate PARP-1 polymerase activity due to DNA damaging agents, the ILK inhibitor may be a valuable tool in combination with chemotherapy treatments that lead to DNA damage and apoptosis. No firm conclusions can be drawn from this preliminary data, however it does suggests a new avenue of study in the ILK/PARP-1 story that may have important clinical implications.  107  Figure 3.6 Immunofluoresence of poly-ADP-ribose. PC3 cells were grown on poly-L-lysine coated glass coverslips and treated with or without H2O2 and indicated inhibitor. Cells were stained with a poly-ADP-ribose antibody (green), DAPI nuclear stain (blue) or IgG control antibody. Methods in Appendix D. This assay was conducted in collaboration with Dr. Julia Mills.  108  3.12 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.  Somasiri, A., et al., Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 2001. 114(Pt 6): p. 1125-36. Horvay, K., et al., Wnt Signaling Regulates Snai1 Expression and Cellular Localization in the Mouse Intestinal Epithelial Stem Cell Niche. Stem Cells Dev, 2010. Persad, S., et al., Tumor suppressor PTEN inhibits nuclear accumulation of betacatenin and T cell/lymphoid enhancer factor 1-mediated transcriptional activation. J Cell Biol, 2001. 153(6): p. 1161-74. Oloumi, A., et al., Cooperative signaling between Wnt1 and integrin-linked kinase induces accelerated breast tumor development. Breast Cancer Res, 2010. 12(3): p. R38. Oloumi, A., T. McPhee, and S. Dedhar, Regulation of E-cadherin expression and βcatenin/Tcf transcriptional activity by the integrin-linked kinase. biochemica et Biophysica Acta, 2004. 1691(1): p. 1-15. Oloumi, A., S. Syam, and S. Dedhar, Modulation of Wnt3a-mediated nuclear betacatenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene, 2006. 25(59): p. 7747-7757. Ewing, C.M., et al., Chromosome 5 suppresses tumorigenicity of PC3 prostate cancer cells: correlation with re-expression of alpha-catenin and restoration of Ecadherin function. Cancer Res, 1995. 55(21): p. 4813-7. Shore, E.M. and W.J. Nelson, Biosynthesis of the cell adhesion molecule uvomorulin (E-cadherin) in Madin-Darby canine kidney epithelial cells. J Biol Chem, 1991. 266(29): p. 19672-80. Stewart, D.B., A.I. Barth, and W.J. Nelson, Differential regulation of endogenous cadherin expression in Madin-Darby canine kidney cells by cell-cell adhesion and activation of beta -catenin signaling. J Biol Chem, 2000. 275(27): p. 20707-16. Idogawa, M., et al., Poly(ADP-ribose) polymerase-1 is a component of the oncogenic T-cell factor-4/beta-catenin complex. Gastroenterology, 2005. 128(7): p. 1919-36. Hassa, P.O., et al., Acetylation of poly(ADP-ribose) polymerase-1 by p300/CREBbinding protein regulates coactivation of NF-kappaB-dependent transcription. J Biol Chem, 2005. 280(49): p. 40450-64. Tong, W.M., et al., Null mutation of DNA strand break-binding molecule poly(ADPribose) polymerase causes medulloblastomas in p53(-/-) mice. Am J Pathol, 2003. 162(1): p. 343-52. Dwivedi, A., G.B. Sala-Newby, and S.J. George, Regulation of cell-matrix contacts and beta-catenin signaling in VSMC by integrin-linked kinase: implications for intimal thickening. Basic Res Cardiol, 2008. 103(3): p. 244-56. Tan, C., A. Mui, and S. Dedhar, Integrin-linked kinase regulates inducible nitric oxide synthase and cyclooxygenase-2 expression in an NF-kappa B-dependent manner. J Biol Chem, 2002. 277(5): p. 3109-16. Barbera, M.J., et al., Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene, 2004. 23(44): p. 7345-54. Yook, J.I., et al., Wnt-dependent regulation of the E-cadherin repressor snail. J Biol Chem, 2005. 280(12): p. 11740-8.  109  17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.  30. 31. 32. 33. 34.  Julien, S., et al., Activation of NF-kappaB by Akt upregulates Snail expression and induces epithelium mesenchyme transition. Oncogene, 2007. 26(53): p. 7445-56. Peiro, S., et al., Snail1 transcriptional repressor binds to its own promoter and controls its expression. Nucleic Acids Res, 2006. 34(7): p. 2077-84. Zhou, B.P., et al., Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol, 2004. 6(10): p. 931-40. Mishra, P., et al., Glycogen Synthase Kinase-3beta regulates Snail and beta-catenin during gastrin-induced migration of gastric cancer cells. J Mol Signal, 2010. 5: p. 9. Zaalishvili, G., et al., Automodification of PARP-1 mediates its tight binding to the nuclear matrix. Biochem Biophys Res Commun, 2010. 393(1): p. 123-5. Guastafierro, T., et al., CCCTC-binding factor activates PARP-1 affecting DNA methylation machinery. J Biol Chem, 2008. 283(32): p. 21873-80. Kraus, W.L. and J.T. Lis, PARP goes transcription. Cell, 2003. 113(6): p. 677-83. Ju, B.G., et al., Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell, 2004. 119(6): p. 815-29. Driver, G.A. and R.B. Veale, Modulation of integrin-linked kinase (ILK) expression in human oesophageal squamous cell carcinoma cell lines by the EGF and TGFbeta1 growth factors. Cancer Cell Int, 2006. 6: p. 12. Chun, J., et al., The subcellular localization control of integrin linked kinase 1 through its protein-protein interaction with caveolin-1. Cell Signal, 2005. 17(6): p. 751-60. Acconcia, F., et al., Phosphorylation-dependent regulation of nuclear localization and functions of integrin-linked kinase. Proc Natl Acad Sci U S A, 2007. 104(16): p. 6782-7. Zhang, S., et al., c-Jun N-terminal kinase mediates hydrogen peroxide-induced cell death via sustained poly(ADP-ribose) polymerase-1 activation. Cell Death Differ, 2007. 14(5): p. 1001-10. Maruyama, T., et al., Txk, a member of the non-receptor tyrosine kinase of the Tec family, forms a complex with poly(ADP-ribose) polymerase 1 and elongation factor 1alpha and regulates interferon-gamma gene transcription in Th1 cells. Clin Exp Immunol, 2007. 147(1): p. 164-75. Rosenthal, D.S., et al., Calmodulin, poly(ADP-ribose)polymerase and p53 are targets for modulating the effects of sulfur mustard. J Appl Toxicol, 2000. 20 Suppl 1: p. S43-9. Bauer, P.I., et al., Inhibition of DNA binding by the phosphorylation of poly ADPribose polymerase protein catalysed by protein kinase C. Biochem Biophys Res Commun, 1992. 187(2): p. 730-6. Tanaka, Y., et al., Poly (ADP-ribose) synthetase is phosphorylated by protein kinase C in vitro. Biochem Biophys Res Commun, 1987. 148(2): p. 709-17. Beckert, S., et al., IGF-I-induced VEGF expression in HUVEC involves phosphorylation and inhibition of poly(ADP-ribose)polymerase. Biochem Biophys Res Commun, 2006. 341(1): p. 67-72. Guaita, S., et al., Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem, 2002. 277(42): p. 39209-16.  110  35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47.  Fujita, N., et al., MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell, 2003. 113(2): p. 207-19. Bowen, N.J., et al., Mi-2/NuRD: multiple complexes for many purposes. Biochim Biophys Acta, 2004. 1677(1-3): p. 52-7. Roloff, T.C., H.H. Ropers, and U.A. Nuber, Comparative study of methyl-CpG-binding domain proteins. BMC Genomics, 2003. 4(1): p. 1. Sakamoto, I., et al., A novel beta-catenin-binding protein inhibits beta-catenindependent Tcf activation and axis formation. J Biol Chem, 2000. 275(42): p. 32871-8. Thompson, B.A., et al., CHD8 is an ATP-dependent chromatin remodeling factor that regulates beta-catenin target genes. Mol Cell Biol, 2008. 28(12): p. 3894-904. Kobayashi, M., et al., Nuclear localization of Duplin, a beta-catenin-binding protein, is essential for its inhibitory activity on the Wnt signaling pathway. J Biol Chem, 2002. 277(8): p. 5816-22. Ishihara, K., M. Oshimura, and M. Nakao, CTCF-dependent chromatin insulator is linked to epigenetic remodeling. Mol Cell, 2006. 23(5): p. 733-42. Yu, W., et al., Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat Genet, 2004. 36(10): p. 1105-10. Torrano, V., et al., Targeting of CTCF to the nucleolus inhibits nucleolar transcription through a poly(ADP-ribosyl)ation-dependent mechanism. J Cell Sci, 2006. 119(Pt 9): p. 1746-59. Bell, A.C. and G. Felsenfeld, Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature, 2000. 405(6785): p. 482-5. Kurukuti, S., et al., CTCF binding at the H19 imprinting control region mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to Igf2. Proc Natl Acad Sci U S A, 2006. 103(28): p. 10684-9. Reale, A., et al., Modulation of DNMT1 activity by ADP-ribose polymers. Oncogene, 2005. 24(1): p. 13-9. Puig, O., et al., The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods, 2001. 24(3): p. 218-29.  111  Appendix A Protocol for biotin streptavidin chromatography to isolate DNA binding proteins Nuclear Extract preparation Materials • • • • • • • • •  Adherent cells grown in standard 15 cm culture dish PBS pH 8.0 Lysis buffer-1 (10 mM HEPES-KOH pH 7.9, 1.5 mM MgCl2, 10 mM Kcl, 0.5 mM DTT, protease inhibitors, phosphotase inhibitors) Lysis buffer-2 (20 mM HEPES-KOH pH 7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% Glycerol, 0.5 mM DTT, protease inhibitors, phosphotase inhibitors) Binding buffer (20 mM HEPES-KOH pH 7.9, 100 mM KCl, 2.5 mM MgCl2, Glycerol 20%, 0.2 mM EDTA, 23 mM NaCl, 1% Noniodet® P40, protease inhibitors aproptin pmsf etc, phosphotase inhibitors) Concentration column Agarose Streptavidin (Sigma) Poly dI-dC (Sigma) Salmon Sperm DNA  Protocol 1. Place tissue culture dish of adherent cells on ice, aspirate culture media and wash cells 3 times with ice-cold PBS pH 8. 2. Adherent cells are collected in 1 ml ice-cold PBS pH 8.0 using a rubber policeman and transferred to a 1.5 ml microcentrifuge tube. 3. Pellet cells by centrifugation (1000g, 4oC, 5 min) and aspirate PBS. 4. Resuspend pellet in 1500 ml Lysis buffer-1 and incubate on ice for 10 min. 5. Vortex lysate for 10 sec, pellet nuclei by centrifugation (10 sec, 13000g, 4oC) and remove supernatant. 6. Resuspend pellet in 200 ml Lysis buffer-2 and incubate on ice for 20 min. 7. Clear lysate by centrifugation (5 min, 13000g, 4oC) and transfer supernatant to fresh tube. 8. Repeat Steps 1-7 until you have obtained approximately 2 ml of Nuclear Extract. Store lysates at –70 oC. 9. Dilute nuclear extract with 2 ml of Binding Buffer, transfer to 5000 Da concentrating column, and centrifuge in tabletop centrifuge (10,000g, 4oC) until 2 ml remain. 10. Add 2 ml Binding buffer and repeat centrifugation. Once 2 ml remains repeat dilution and centrifugation once more, but centrifuge until only 1 ml remains. 11. Transfer concentrated nuclear extract to fresh 1.5 ml microcentrifuge tube. 12. Add 5 ml strepavidin-agarose and incubating for 30 min at 4oC on a rotator. 13. Collect streptavidin-agarose by centrifugation (30 sec, 10000g, 4oC) and transfer supernatant to fresh tube. 14. Determine protein concentration (BCA) and dilute control and experimental nuclear extracts to same concentration (1.5 mg/ml is optimal) 15. Add 5 mg Poly dI-dC and 10 ml Salmon Sperm DNA per ml of nuclear extract.  112  Binding DNA-Protein Materials • mMACS Streptavidin Kit (Miltenyi Biotec) • streptavidin magnetic beads • magnetic stand (Miltenyi Biotec) • Wash Buffer (20 mM HEPES-KOH pH 7.9, 100 mM Kcl, 2.5 mM MgCl2, 1% Nonidet® P40, protease inhibitors, phosphatase inhibitors) • Elution buffer-1 (20 mM HEPES-KOH pH 7.9, 250 mM NaCl, protease inhibitors, phosphatase inhibitors) • Elution buffer-2 (20 mM HEPES-KOH pH 7.9, 500 mM NaCl, protease inhibitors, phosphatase inhibitors) • Elution buffer-3 (20 mM HEPES-KOH pH 7.9, 750 mM NaCl, protease inhibitors, phosphatase inhibitors) • Elution buffer-4 (20 mM HEPES-KOH pH 7.9, 1 M NaCl, protease inhibitors, phosphatase inhibitors) • Protocol 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.  Add 100 pmoles of biotin-DNA oligonucleotides to 100 ml streptavidin magnetic beads and incubate at 4 oC for 15 min. Add 100 ml of Binding buffer and incubate at 4 oC for 15 min. Add 800 ml of concentrated pre-cleared nuclear extract and incubate on a rotator for at 4 oC for 30 min. Place parpmagnetic binding column on magnetic stand and equilibrate with 100 ml of provided equilibration buffer. Wash equilibrated column 2 times with 100 ml Binding buffer. Apply biotin-DNA/Nuclear extract mix to column. Wash once with 100 ml binding buffer and 3 times with 100 ml Wash buffer. Elute with 100 ml of Elution buffer-1 collecting fraction in fresh tube Elute with 100 ml of Elution buffer-2 collecting fraction in fresh tube Elute with 100 ml of Elution buffer-3 collecting fraction in fresh tube Elute with 100 ml of Elution buffer-4 collecting fraction in fresh tube Remove column from magnetic stand and collect magnetic streptavidin beads in fresh tube. Separate fractions by SDS-PAGE and visualize on the Typhoon Scanner (Amersham) using Sypro® Ruby stain (Invitrogen), per manufacturers instructions. Excise protein bands that show differential banding between the two experimental conditions. Sequence unknown proteins by Mass Spectrometry.  113  Appendix B  siRNA Constructs  Target Gene ILK PTEN AKT1-2 GSK3! Snail PARP-1 Control  siRNA Sequence AACCTGACGAAGCTCAACGAG AAGATCTTGACCAATGGCTAA TGCCCTTCTACAACCAGGA AAGAGCAAATCAGAGAAATGAAC AAGATGCACATCCGAAGCCAC AAGCCTCCGCTCCTGAACAAT AATTCTCCGAACGTGTCACGT  114  Appendix C qRT-PCR Primers Target Gene E-cadherin Snail ILK AKT PARP-1 Zeb-1 !-actin  Forward Primer GAGAAACAGGATGGCTGAAGG CCTCAAGATGCACATCCGAAGCCA GCATGGCTGATGTCAAGTTCTC ATGAGCGACGTGGCTATTGTGAAG GACGTCACTGCCTGGACCAA TTCAGCATCACCAGGCAG CTCTTCCAGCCTTCCTTCCT  Reverse Primer TGAGGATGGTGTAAGCGATGG AGGAGAAGGGCTTCTCGCCAGTGT GCTACCCAGGCAGGTGCAT GAGGCCGTCAGCCACAGTCTG AGGAGCCGAGGCTGTGGAG GAGTGGAGGAGGCTGAGT AGCACTGTGTTGGCGTACAG  115  Appendix D  Cell Culture  PC3, HEK-293 and Scp2 cells were obtained from ATCC (Manassas, VA). PC3 and HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal calf serum (FCS) (Burlington, ON, Canada), penicillin (100 units/ml) and streptomycin (100 mg/ml) (Invitrogen). Scp2 ILK(14) and Scp2 ILK(13) cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml), streptomycin (100 mg/ml) (Invitrogen), and 100 µg/ml G418 (Invitrogen). Parental Scp2 cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml) and streptomycin (100 mg/ml) (Invitrogen). Cells were cultured at 37°C in 5% CO2. All cells were routinely grown on tissue culture plastic. Cells were trypsinized at 90% confluence using trypsin:PBS/EDTA, diluted 1:4 in phosphate buffered saline (PBS), and resuspended in the appropriate media containing serum. Cells were re-plated at a ratio of 1:10.  Coating Plates  Poly-L-lysine-coated plates were prepared as follows: Poly-L-Lysine was diluted to 0.0001% w/v (1:100) in PBS from a stock solution of 0.01% w/v. Tissue culture plates were then coated 1 hour at room temperture. The plates were then washed 3X with PBS.  116  Cell Lysis  Cell monolayers were harvested in cold PBS and lysed in 5x the cell pellet volume of RIPA lysis buffer. Soluble fractions were separated and protein concentrations were determined using the BCA Protein Assay (Pierce, Rockford, IL, USA) according to the manufacturer’s recommendations. Briefly, triplicate 5 µl samples of cleared cell lysate and 95 µl of BCA reagent were added per well and incubated 30 minutes at 37OC. Absorbance was measured using a standard protocol. Bovine Serum Albumin (BSA) was used to establish a protein concentration standard curve. Lysates were used immediately or stored at -80°C.  Western Blots  Samples to be analyzed were boiled in the appropriate volume of 4x sample buffer for 5 minutes and were resolved by 10% SDS-PAGE at 100 V per gel for approximately 1 hour. Samples were transferred onto PVDF membrane and blocked with 5% nonfat dry milk in TBS. The membrane was incubated overnight at 4°C with the appropriate primary antibody in 5% nonfat dry milk in TBS. The membrane was then incubated with the appropriate secondary HRP-conjugated antibody and visualized using ECL Western blotting detection reagents obtained from Amersham Pharmacia (Buckinghamshire, England, UK), or Supersignal detection reagents (Pierce) according to manufacturer’s instructions. Blots were stripped and re-probed a maximum of 1x using Restore Western blot stripping buffer (Pierce). Images were obtained on a BioRad Versadoc MP 5000 imager (BioRad, Mississauga, ON, Canada) according to the manufacturer’s instructions.  117  Antibodies  The following antibodies were used: anti-ILK (1:1000 dilution), anti-E-cadherin (1:2500 dilution), anti-PARP-1 (1:1000 dilution) (all monoclonal antibodies from BD Biosciences, Mississauga, ON, Canada), monoclonal anti-!-actin (1:10 000 dilution) (Sigma-Aldrich, Oakville, ON, Canada),  siRNA Transfection  Transfections were conducted with Silentfect (BioRad) in PC3 cells according to the manufacturer’s directions. Briefly, cells were split into poly-L-lysine coated 6-well cell culture plates and allowed to attach overnight. Poly-L-Lysine (Sigma-Aldrich) was diluted to 0.0001% w/v in PBS from a stock solution of 0.01% w/v, incubated on tissue culture plates for 1 hour at room temperature and washed with PBS. Transfection reagent and siRNA were combined in OptiMEM (Invitrogen), which was subsequently diluted with DMEM containing 10% FCS. Cells were incubated with transfection mixture overnight and refed with DMEM 10% containing FCS. Cells were split (typically into one 100 mm dish per well) 24 hours post-transfection and harvested 96 hours post-transfection.  siRNA Constructs  All siRNA constructs were purchased from Qiagen (Mississauga, ON, Canada) and reconstituted according to the manufacturer’s instructions. Sequences used were as follows: ILK-A  118  (AACCTGACGAAGCTCAACGAG), ILK-H [1], PARP-1 [2]. Control, non-silencing siRNA (from Qiagen’s data base, 16-base overlap with Thermotoga maritimia). For siRNA sequences see Appendix A.  Radioactive labeling of DNA probe  DNA probes were designed with a 5' AAT overhang to allow for radioactive labeling. Single-stranded DNA sequences were purchased from Invitrogen. Complementary cDNA sequences were incubated together in Annealing Buffer at 90°C for 1 minute and allowed to cool to room temperature. The 5' overhang was end-filled by incubation with Klenow enzyme using dTTP and either dATP or 32P-dATP (Amersham, Piscataway, NJ, USA). Specifically, oligonucleotide was incubated with an excess of dTTP and, dATP or 32Pa-dATP at 37°C for 2 hours. Unincorporated nucleic acids were removed using a G50 microspin column (Amersham) according to the manufacturer’s instructions.  EMSA  Electrophoretic mobility shift assays (EMSA) were performed by incubating 10 !g of the nuclear extracts for 20 min at room temperature with a 32P-dATP end-labeled SIRE oligonucleotide. The reaction mixture was incubated in a binding buffer containing 20 mM Hepes–potassium hydroxide, pH 7.9, 2.5 mM MgCl2, 100 mM KCL, 0.2 mM EDTA, 1% NP40, 23 mM NaCl, 5% glycerol and 0.2 mM PMSF. Reaction products were analyzed on a non-denaturing 5% polyacrylamide gel (0.5% Tris-borate-EDTA, 2.5% glycerol). The specificity of the DNA–protein interaction was established by competition experiments using 100x cold competitor. 119  Inhibitor Treatment  PC3 cells were treated with 100 µM of 3-aminobenzamide (3-AB) (Calbiochem, VWR CANLAB Mississaga, ON, Canada) a PARP-1 enzymatic inhibitor, in DMSO, 50 mM of Lithium Chloride (LiCl) (Sigma-Aldrich, Oakville, ON, Canada) a GSK3 inhibitor, in water or indicated concentration of QLT-0267 (Quadralogic Technologies, Inc., Vancouver, BC, Canada), an ILK inhibitor, in DMSO, for 12 hours in DMEM in the presence of 10% FCS. Cells were washed 3 x with PBS and incubated with DMEM containing 10% FCS, Penicillin (100 units/ml) (100 mg/ml) and indicated concentration of inhibitor. Immunofluorescence PC3 cells were grown on Poly-L-lysine coated glass coverslip, treated with 1.0 mM H2O2 at 37˚C for 10 min and/or indicated treatment. Cells were washed in PBS, and fixed with MEOH/acetone (70:30 v/v) for 10 min at -20˚C, air dried and incubated in PBS for 10 min at RT. Cells were permeabilized in blocking buffer (PBS, 5% non-fat dry milk (w/v), 0.05% Tween 20) for 30 min at RT and subsequently stained with 5 !g/ml poly ADP-ribose in blocking buffer for 1 hr at 37˚C. Cells were washed in PBS and incubated with FITC-conjugated goat anti-mouse secondary antibody (5 !g/ml/blocking buffer) for 1 hr at RT. Cells were washed in PBS and visualized by immunoflourescence microscopy. Cells were counterstained with DAPI (Sigma-Aldrich, Oakville, ON, Canada). Cells were incubated, in the dark, in 100 !l of a 2 ng/ml DAPI in PBS solution for 30 minutes.  120  References 1. 2.  Troussard, A.A., et al., Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem, 2003. 278(25): p. 22374-8. Kameoka, M., et al., RNA interference directed against Poly(ADP-Ribose) polymerase 1 efficiently suppresses human immunodeficiency virus type 1 replication in human cells. J Virol, 2004. 78(16): p. 8931-4.  121  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0071449/manifest

Comment

Related Items