UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Human gonadotropin-releasing hormone-II regulation in ovarian cancer : mechanisms and potential functional… Poon, Song Ling 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_spring_poon_songling.pdf [ 3.61MB ]
Metadata
JSON: 24-1.0071442.json
JSON-LD: 24-1.0071442-ld.json
RDF/XML (Pretty): 24-1.0071442-rdf.xml
RDF/JSON: 24-1.0071442-rdf.json
Turtle: 24-1.0071442-turtle.txt
N-Triples: 24-1.0071442-rdf-ntriples.txt
Original Record: 24-1.0071442-source.json
Full Text
24-1.0071442-fulltext.txt
Citation
24-1.0071442.ris

Full Text

HUMAN GONADOTROPIN-RELEASING HORMONE-II REGULATION IN OVARIAN CANCER: MECHANISMS AND POTENTIAL FUNCTIONAL ROLE  by Song Ling Poon B.Sc., National Cheng Kung University, 2003 M.Sc., National Cheng Kung University, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Reproductive and Developmental Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  November 2010 © Song Ling Poon, 2010  Abstract It is increasingly apparent that GnRH-II acts as an autocrine/paracrine regulator in nonpituitary tissues, in addition to its role in the regulation of gonadotropin synthesis, and is an important player in cancer cell biology. High levels of GnRH-II and GnRHR in malignant ovarian tumors as compared with benign ovarian tissues underlies the importance of understanding GnRH-II function in ovarian cancer. In an attempt to define the regulation of GnRH-II in these tissues, we found that a cyclic-AMP responsive element (CRE) is critical for GnRH-II promoter transcription. In this scenario, the transcription factors p-CREB, C/EBP and CBP are recruited to this region in a temporarily-defined manner in response to cAMP/PKA signaling, thereby enhancing GnRH-II transcription and increasing GnRH-II mRNA levels in cancer cells of reproductive tissues. We also verified that EGF/EGFR-activated pCREB/C/EBP interactions target the CRE region within GnRH-II promoter to enhance GnRHII production in ovarian cancer. Importantly, EGF-stimulated GnRH-II expression constitutes a specific autocrine loop that contributes to ovarian cancer motility. In an attempt to define the downstream mechanisms responsible for this autocrine action of GnRH-II, we identified that MMP-2 and MT1-MMP are critical mediators of GnRH-II-enhanced ovarian cancer cell invasion. Specifically, GnRH-II acts via GnRHR to up-regulate 37kDa laminin receptor precusor expression which dimerizes to yield the non-integrin 67kDa laminin receptor (67LR). This leads to an increase interaction between 67LR and laminin in the extracellular matrix, and increases MMP-2 production in ovarian cancer cells. In parellel, GnRH-II/GnRHR-activated PI3K/Akt/-catenin signaling to up-regulate MT1-MMP production which is known to be an activator for MMP-2 zymogen. Lastly, we attempted to define the implication of 67LR in high grade serous ovarian carcinoma due to its critical role in enhancing ovarian cancer progression in our in vitro model. However 67LR did not correlate with the overall survival of stage III & IV high-grade serous ovarian cancer patients. Overall, this study contributes to our understanding of the impact of GnRH-II/GnRHR in ovarian cancer invasive potential and provides insights into the progression of ovarian cancer and the development of new therapeutic strategies.  ii  Preface A version of chapter II has been published. Poon SL, An BS, So WK, Hammond GL, Leung PC. 2008. Temporal recruitment of transcription factors at the 3’5’-cyclic adenosine 5’monophosphate-response element of the human GnRH-II promoter. Endocrinology 149:5162-71. I was responsible for the experimental design and conducted all the experiment in this chapter. I wrote the manuscript which was revised by my supervisors. An BS and So WK have provided techniqcal assistance and advice in the initial experimental design. A version of chapter III has been published. Poon SL, Hammond GT, Leung PC. 2009 Epidermal growth factor induced GnRH-II synthesis contributes to ovarian cancer cell invasion. Mol Endocrinol 10:1646-56. Hammond GT was a summer student in our laboratory. He performed the Western blot for FIG. 3.3. and prepared the summary figure (FIG. 3.7). I performed all the other experiments and I wrote the manuscript which was critically revised by my supervisors. I performed all the experiments in Chapter IV Lau MT is a PhD candidate in our laboratory and performed the luciferase assay for FIG. 5.2. in Chapter V. I performed all the other experiments in this chapter. Chapter VI was performed in collaboration with the scientists at the British Columbia Cancer Agency (BCCA). The immunostaining of tissue microarray was performed by Miss Christine Chow. The scoring of the staining was performed by myself, and with the help of Dr. Mark Carey. The statistical analysis was performed with help from Dr. Steve Kalloger.  iii  Table of Contents Abstract………………………………………………………………………………………….ii Preface………………………………………………………………………………………….iii Table of Contents………………………………………………………………………………...iv List of Tables………………………………….………………………………………………...vii List of Figures………………………………………………………………………………….viii List of Abbreviations…………………...………………………………………………………...x Acknowledgements..……………………………………………………………………………xii CHAPTER 1. Introduction 1.1 Gonadotropin-releasing hormone (GnRH)……………………………..…………………...1 1.1.1 The promoter regulation of GnRH-II.…………………….……………………………...1 1.1.2 Regulation of GnRH-II in human………………………………………………………...3 1.1.3 GnRH-II and GnRH receptor………………….………………………………………….5 1.1.4 GnRH/GnRHR initiated intracellular signal transduction……………………………..8 1.1.4.1 MAPK……………………………………………………………………………..10 1.1.4.2 PI3K……………………………………………………………………………….10 1.1.4.3 Wnt/-catenin……………………………………………………………………..11 1.1.4.4 Other signaling pathways…………………………………………………………12 1.2 Ovarian cancer……………………………………………………………………………...14 1.2.1 Growth factors regulation of ovarian epithelial cancer progression…………………….15 1.2.2 GnRH regulation of ovarian cancer progression……………………………………….17 1.2.3 Matrix metalloproteinases in ovarian cancer progression………………………………18 1.3 67 kDa non-integrin laminin receptor (67LR)……………………………………………21 1.3.1 The functional role of 67LR in normal cells……………………………………………22 1.3.1.1 Interactions with laminin………………………………………………………….22 1.3.1.2 67LR as a co-receptor……………………………………………………………..23 1.3.2 The functional role of 67LR in tumor invasion and aggresiveness……………………..24 1.3.3 GnRH and 67LR……………………………………………………………………….25 1.4 Hypothesis and objectives………………………………………………………………….26  iv  CHAPTER 2. Temporal recruitment of transcription factors at the cAMP-responsive element of the human GnRH-II promoter 2.1 Introduction……………………………………………………………………………….....28 2.2 Materials and methods……………………………………………………………………...29 2.3 Results………………………………………………………………………………..……...33 2.4 Discussion…………………………………………………………………………………...36 CHAPTER 3. Epidermal growth factor induced GnRH-II synthesis contributes to ovarian cancer cell invasion 3.1 Introduction………………………………………………………………………………….49 3.2 Materials and methods……………………………………………………………………...50 3.3 Results……………………………………………………………………………………….55 3.4 Discussion…………………………………………………………………………………...59 CHAPTER 4. 37 kDa Laminin receptor precursor mediates gonadotropin-releasing hormone-IIinduced matrix metalloproteinase-2 expression and invasiveness in ovarian cancer cells 4.1 Introduction………………………………………………………………………………….71 4.2 Materials and methods……………………………………………………………………...72 4.3 Results……………………………………………………………………………………….76 4.4 Discussion…………………………………………………………………………………...81 CHAPTER 5. Gonadotropin-releasing hormone-II increases membrane type I metalloproteinase production via -catenin signaling in ovarian cancer cells 5.1 Introduction………………………………………………………………………………….98 5.2 Materials and methods……………………………………………………………………...99 5.3 Results………………………………………………………………………………..…….102 5.4 Discussion………………………………………………………………………………….106 CHAPTER 6. Expression of the 67 kDa non-integrin laminin receptor in high-grade serous ovarian carcinoma 6.1 Introduction………………………………………………………………………………...117 6.2 Materials and methods…………………………………………………………………….118 6.3 Results……………………………………………………………………………………...120 v  6.4 Discussion………………………………………………………………………………….120 CHAPTER 7. Conclusion and future directions 7.1 Overview…………………………………………………...………………………………128 7.2 The importance of EGF-induced GnRH-II production…………….……………………129 7.3 The role of LRP in ovarian cancer cell invasive potential……………………………130 7.4 The role of GnRH-II/GnRHR-induced MMP-2 and MT1-MMP in ovarian cancer cells.131 7.5 The role of GnRH-II/GnRHR in ovarian cancer progression…………………....……...133 Bibliography…………………………………………………………………………………...136 Appendices…………………………………………………………………………………….158 Appendix I. The effects of growth factors on human GnRH-II promoter activity…………….158 Appendix II. EGF induces GnRH-II promoter activity and GnRH-II mRNA levels in JEG-3 choriocarcinoma cells………………………………………………………………………….159 Appendix III. EGF induces phosphorylation of CREB activates cAMP-responsive element within the human GnRH-promoter…………………………………………………………….160 Appendix IV. EGF and GnRH-II additively enhances JEG-3 cell invasive potential…………161 Appendix V. LRP regulates N-cadherin expression to enhance ovarian cancer cell invasiveness……………………………………………………………………………………162 Appendix VI. GnRH-II-induced MMP-2 and MT1-MMP in two independent signaling pathways……………………………………………………………………………………….163  vi  List of Tables Table 6.1. Percentage of 67LR membrane staining positive cases within the histological subtypes………………………………………………………………………………………..123 Table 6.2. Study population in the present analysis…………………………………………...124  vii  List of Figures FIG. 1.1. Schematic representation of GnRHR signaling in extra-pituitary tissues……………...9 FIG. 1.2. Potential signaling pathways for permitting cross-talk between Wnt and GnRH…….13 FIG. 2.1. 8-bromo cAMP induced GnRH-II transcriptional activity……………………………41 FIG 2.2. 8-bromo cAMP enhanced GnRH-II promoter activity and GnRH-II mRNA levels in a time-dependent manner in JEG-3 and OVCAR-3 cells…………………………………………42 FIG. 2.3. Regulation of CREB phosphorylation at Ser133 by 8-bromo cAMP………………...43 FIG. 2.4. Interaction of CBP and C/EBPwith p-CREB increases after 8-bromo cAMP treatment……………………………………………………………………………………...…44 FIG. 2.5. Requirement of CREB, CBP and C/EBP in 8-bromo cAMP-mediated GnRH-II promoter activation.…………………………………………………….……………………….45 FIG. 2.6. Involvement of CREB, CBP and C/EBP in 8-bromo cAMP-mediated changes in GnRH-II mRNA levels in JEG-3 and OVCAR-3 cells…………………………………………46 FIG. 2.7. Association of p-CREB, C/EBP and CBP with the CRE region of GnRH-II promoter is increased by 8-bromo cAMP treatment………………………………………………………47 FIG 2.8. Proposed model for CRE-mediated GnRH-II gene transcription……………………...48 FIG. 3.1. EGF induces GnRH-II mRNA in ovarian cancer cell lines…………………………..64 FIG. 3.2. EGFR-dependent activation is required for the stimulation of GnRH-II expression in OVCAR-3 cells…………………………………………………………………………………65 FIG. 3.3. EGF-activated ERK1/2 pathway is required for the phosphorylation of CREB and its interaction with C/EBPβ………………………………………………………………………...66 FIG. 3.4. EGF regulates the binding of p-CREB on CRE site in GnRH-II promoter…………..67 FIG. 3.5. GnRH-II acts additively with EGF to promote ovarian cancer cell invasion………...68 FIG. 3.6. GnRH-II signaling is involved in EGF-induced ovarian cancer cell invasion………..69 FIG. 3.7. Proposed model for EGF induced GnRH-II synthesis contributes to ovarian cancer cell invasion………………………………………………………………………………………….70 FIG. 4.1. GnRH-II acts in an autocrine manner to enhance ovarian cancer cell invasion………85 FIG. 4.2. GnRH-II induces the production of LRP in ovarian cancer cells……………………..86 FIG. 4.3. GnRH-II treatment does not affect SKOV-3 cell invasiveness……………………….87 FIG. 4.4. Depletion of GnRHR with GnRHR siRNA does not influence GnRH-II mRNA levels in ovarian cancer cells…………………………………………………………………………..88 FIG. 4.5. LRP mediates the invasive potential of ovarian cancer cells…………………………89 viii  FIG. 4.6. Over-expressing LRP up-regulates ovarian cancer cell invasiveness………………...90 FIG. 4.7. The laminin binding domain of LRP plays an important role in ovarian cancer cell invasion………………………………………………………………………………………….91 FIG. 4.8. LRP regulates MMP-2 production in ovarian cancer cells…………………………...92 FIG. 4.9. LRP mediates the GnRH-II-induced production of MMP-2 by ovarian cancer cells...93 FIG.4.10. GnRH-II treatment does not affect SKOV-3 cell MMP-2 levels…………………….94 FIG. 4.11. LRP and MMP-2 are key mediators of GnRH-II enhanced invasion in ovarian cancer cells……………………………………………………………………………………………...95 FIG. 4.12. Depletion of MMP-2 levels with siRNA does not affect GnRH-II, GnRHR or LRP mRNA levels in SKOV-3 cells…………………………………………………………………96 FIG. 4.13. Proposed model for 67LR as a key mediator in GnRH-II-enhanced ovarian cancer cell invasion…………………………………………………………………………………….97 FIG. 5.1. GnRH-II increases the phosphorylation of Akt and GSK3andinduces -catenin nuclear translocation in ovarian cancer cells…………………………………………………..110 FIG. 5.2. GnRH-II-induced PI3K/Akt signaling increases -catenin-dependent luciferase reporter gene activity and promotes ovarian cancer cell invasion……………………………..111 FIG. 5.3. GnRH-II-induced PI3K/Akt signaling increases the phosphorylation of GSK3…..112 FIG. 5.4. GnRH-II increases MT1-MMP production in ovarian cancer cells…………………113 FIG. 5.5. PI3K/Akt and -catenin signal transduction pathways regulate GnRH-II-induced MT1-MMP production in ovarian cancer cells………………………………………………..114 FIG. 5.6. -Catenin signaling and MT1-MMP contribute to GnRH-II-enhanced ovarian cancer cell invasion……………………………………………………………………………………115 FIG. 5.7. Proposed model illustrating how GnRH-II induced MT1-MMP may contribute to ovarian cancer cell invasion……………………………………………………………………116 FIG. 6.1. Immunoreacitivty pattern of LRP…………………………………………………...125 FIG. 6.2. Kaplan-Meier overall survival curve for 67LR membrane staining in stage III and IV high-grade serous ovarian carcinoma………………………………………………………….126 FIG. 6.3. Kaplan-Meier overall survival curve for 67LR vessel staining in stage III and IV highgrade serous ovarian carcinoma………………………………………………………………..127 FIG. 7.1. Proposed model for GnRH-II autocrine actions in ovarian cancer cell invasion……135  ix  List of Abbreviations AP-1 Akt ANOVA APC BRCA1 BRCA2 cAMP cDNA c-FLIP ChIP CRE CREB CBP C/EBP C/EBP DNA dNTP E2 ECM EGF EGFR EGR-1 ERE ERK1/2 EOC EMSA ER ErbB Ets FAK FBS FGF Fos FSH GAP GnRH-I GnRH-II GnRHR GPCR GSK3 hCG HGF hGLC IGF JNK Jun kDa       Activator protein 1 AKT8 virus oncogen cellular homolog Analysis of variance Adenomatous polyposis coli Breast cancer 1 Breast cancer 2 Cyclic adenosine monophosphate Complementary deoxyribonucleic acid Caspase 8 and FADD-like apoptosis regulator Chromatin immunoprecipitation cAMP response element CRE binding protein CREB binding protein CCAAT enhancer binding protein  CCAAT enhancer binding protein  Deoxyribonucleic acid Deoxynucleoside triphosphate Estradiol Extracellular matrix Epidermal growth factor Epidermal growth factor receptor Early growth response 1 Estrogen response element Extracellular signal-regulated kinase 1/2 Epithelial ovarian cancer Electromobility shift assay Estrogen receptor v-erb-b erythroblastic leukemia viral oncogene E twenty six transcription factor family Focal adhesion kinase Fetal bovine serum Fibroblast growth factor FBJ murine osteosarcoma viral oncogene homolog Follicle stimulating hormone GnRH associated peptide Gonadotropin-releasing hormone I Gonadotropin-releasing hormone II Gonadotropin-releasing hormone receptor G protein couple receptor Glycogen synthase kinase 3 beta Human chronic gonadotropin hormone Hepatocyte growth factor Human granulosa luteinizing cells Insulin-like growth factor c-Jun terminal kinase Jun oncogene Kilodalton x  KGF LH Μ MAPK Ml Min MLK3 MMP mRNA MT1-MMP MW NF-B OSE P4 PBS PCR PED PEA15 PI3K PKA PKC PR RAR RXR RTK RT-PCR SDF-1a SF-1 Shc SOS Taq TGF- P TM VEGF Wnt 37LRP 67LR        Keratinocyte growth factor Luteinizing hormone Micro Mitogen activated protein kinase Mililiter Minute Mixed lineage protein kinase 3 Matrix metalloproteinase Messenger ribonucleic acid Membrane type I matrix metallproteinase Molecular weight Nuclear factor kappa B Ovarian surface epithelium Progesterone Phosphatase buffered saline Polymerase chain reaction Phosphoprotein enriched in diabetes Phosphoprotein enriched in astrocyte 15 Phosphoinositide3-kinase Protein kinase A Protein kinase C Progesterone receptor Retinoic acid receptor alpha Retinoid X receptor alpha Receptor tyrosine kinase Reverse transcription polymerase chain reaction Stromal cell derived-1a Steroidogenic factor 1 Src homology 2 domain containing transforming protein Son of sevenless homolog Thermus acuaticus, source of DNA polymerase Transforming growth factor beta Tissue inhibitor of metalloproteinase Trans-membrane Vascular endothelial growth factor Wingless-type MMTV integration site family 37 kDa laminin receptor precursor 67 kDa non-integrin laminin receptor micro  xi  Acknowledgements First of all, thank you to my supervisors, Dr. Peter CK Leung and Dr. Geoffrey L Hammond. Your confidence and belief in me, your support, and your creation of an environment in which one is free to pursue intellectually compelling and important questions is the greatest gift a supervisor can give to a student. Thank you for your vision, your encouragement, and your friendship. Thank you to my supervisory committees (Dr. Calvin Roskelley, Dr. Wyeth Wasserman, Dr. Anthony Perks, Dr. Basil HoYuen) for your support and guidance over the past 5 years. Thank you to all members of the Leung laboratory. I would especially like to acknowledge Dr. Christian Klausen for your positive attitude and hard work. And of course Mrs. Roshni Nair, our program secretary, her patient and guidance was really important when I arrived in Vancouver and in this department. Finally, this work is dedicated to my parents and family. Without their love and support, none of this would have any significance to me. Thank you for believing in me and let me have the freedom and selfishness to pursue my dreams.  xii  CHAPTER 1. Introduction 1.1 Gonadotropin-releasing hormone (GnRH) The hypothalamic gonadotropin-releasing hormone (GnRH, pGlu-His-Trp-Ser-Tyr-GlyLeu-Arg-Pro-Gly-NH2) is a decapeptide that plays a critical role in regulating mammalian reproductive development and function (1, 2). GnRH-I, the first GnRH isoform discovered in the mammalian brain, plays an important role in the regulation of the hypothalamic-pituitarygonadal axis by stimulating the pituitary secretion of gonadotropins (luteinizing hormone and follicle stimulating hormone), which in turn regulate steroidogenesis and gamatogenesis in both male and female gonads. GnRH-II, the second isoform of GnRH, was first isolated from the chicken brain (3) and is highly conserved among vertebrates (4). Although GnRH-II (pGlu-HisTrp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2) has 70% identity with GnRH-I, it has been suggested that GnRH-II may have physiological functions distinct from those of GnRH-I due to its differential localization in the brain (5) and also its significantly higher levels of expression outside the brain (6). It has been reported that the efficiency of GnRH-II in terms of stimulating gonadotropin secretion is only around 2% that of GnRH-I (7). In the brain, GnRH-II acts as a neuromodulator (8), while the actions of GnRH-II in peripheral tissues are not entirely understood. Thus, the functional roles of GnRH-II in extra-pituitary tissues are potentially very interesting.  1.1.1 The promoter regulation of GnRH-II Human GnRH-II is encoded by chromosome 20p13. The GnRH-II gene is comprised of four exons with three introns, and the prepro-GnRH-II is structurally similar to the GnRH-I precursor (6). The first exon of the GnRH-II gene is untranslated, whereas the second exon encodes the signal sequence, the GnRH decapeptide, the GKR processing signal and part of the  1  GnRH-associated peptide (GAP) residue. The third and fourth exon encode the remaining GAP residues and contain the translation termination codon and the 3' untranslated region. The first report of GnRH-II regulation by Chen et al. demonstrated that treatment with dibutyryl cAMP significantly increases the secretion of GnRH-II and up-regulates GnRH-II gene expression in the TE671 cells (9). In addition, mutagenesis assays indicated that this effect of dibutyryl cAMP acts by regulating an atypical 8 bp palindromic cAMP response binding element (CRE; TGACGTCA) within the human GnRH-II promoter (9). By performing deletion analysis within the human GnRH-II 5' flanking region using the neuroblastoma TE671 cell line, placental choriocarcinoma JEG-3 cells and ovarian carcinoma OVCAR-3 cells as models, Cheng et al. demonstrated that these cell lines posses similar promoter activity profiles and a minimal promoter region (-1124 to -750 bp relative to the translation start codon of the GnRH-II gene) is sufficient to initiate GnRH-II gene transcription in both the neuronal and reproductive cell types (10). Specifically, two E-box binding sites (-790 to 785 bp; -762 to 757 bp) and one Ets-like element (-779 to 776 bp) are found within the untranslated exon 1 of the human GnRH-II gene where they act as enhancer elements for the stimulation of GnRH-II transcription (10). Site-directed mutagenesis showed that these three elements act in a conjunction manner to regulate basal GnRH-II transcription (11). In this context, a basic helix-loop-helix transcription factor AP-4 has been found to bind to the E-box binding site within the human GnRH-II promoter, whereas the transcription factors that bind to the Ets-like element within the GnRH-II promoter remain elusive (10, 11). In addition to enhancer elements, a repressor element has also been identified within the first intron (-641 to -636 bp; relative to the translation start codon) of the human GnRH-II promoter (12). Using electromobility shift assays and chromatin immunoprecipitation assays, Hoo et al. showed that the p65 subunit of nuclear factor kappa B (NF-B) and the retinoic acid  2  receptors (RAR and RXR) bind to this repressor element. Moreover, the over-expression of p65 in both TE671 and JEG-3 cells significantly inhibits human GnRH-II promoter activity and reduces endogenous GnRH-II expression. The over-expression of RAR and RXR demonstrate a tissue-specific regulation of the GnRH-II gene, such that RAR and RXR increase GnRH-II promoter activity in JEG-3 cells but have no effects in TE671 cells (12).  1.1.2 Regulation of GnRH-II in human Human GnRH-I and GnRH-II are encoded by different genes, which are regulated distinctly in different tissues. Studies demonstrate that the GnRH-I and GnRH-II genes are each regulated by their own ligands, gonadotropins and steroid hormones (2). However, most reports only documented how individual factors affect GnRH-II mRNA levels in different tissues or cell lines but failed to examine the molecular mechanisms responsible for this effect. Specifically, in human granulosa luteinizing cells, GnRH-I has been shown to be regulated by its own ligand in a biphasic manner (13), i.e., low concentrations of GnRH-I analog treatment (10 pM and 100 pM), results in an up-regulation of GnRH-I expression, whereas high concentrations of GnRH-I analog treatment (1 M and 10 M) represses GnRH-I expression. This mode of regulation has also been observed in hypothalamic neurons (14) and human ovarian epithelial cells (15). However, GnRH-II analog treatment does not have this biphasic effect. Instead, treatment with different concentrations of GnRH-II analog (10 pM and 10 M) in human granulosa luteinizing cells results in a dramatic decrease in GnRH-II mRNA levels in these cells (13). In Ishikawa human endometrial cancer cells, GnRH-I analog treatment increases its own mRNA expression but has no effect on GnRH-II mRNA levels (16). Gonadotropins, including follicle stimulating hormone (FSH) and luteinizing hormone (LH), differentially regulate the two GnRH genes via the activation of cAMP/PKA signal 3  transduction pathways (2). This regulation results in distinct expression profiles of GnRH-I and GnRH-II in different cell systems (11). For instance, treatment of GT1-7 cells with LH or human chorionic gonadotropin (hCG) down-regulates GnRH-I mRNA levels through the involvement of cellular LH⁄hCG receptors (17). Using pharmacological agents to block PKA or PKC signaling pathways, the latter researchers demonstrated that PKA is the dominant signaling pathway for this repression by LH/hCG (18), thereby suggesting that transcription factors such as Fos, CREB and Jun, which are downstream molecules of activated PKA signaling, may be involved in the transcriptional inhibition of GnRH-I by hCG in GT1-7 cells. This observation was later verified by the same group in their extended studies which identified cis-acting elements and trans-acting transcription factors involved in the inhibition by hCG (19). However, the effect of gonadotropins on GnRH-II expression in GT1-7 cells was not examined. In human granulosa luteinizing cells, treatments with FSH or hCG decrease GnRH-I mRNA levels, but cause a significant concentration-dependent increase in GnRH-II mRNA levels (13). Similarly, the human GnRH-I and GnRH-II genes have been found to be differentially regulated by steroid hormones. In TE-671 neuroblastoma cells, estradiol (E2) decreases human GnRH-I mRNA levels, but increases human GnRH-II mRNA levels (20). For instance, by binding to the estrogen receptor (ER), E2 acts on a putative estrogen response element within the GnRH-II promoter to up-regulate its expression (11). In human granulosa luteinizing cells, E2 suppresses GnRH-I expression, whereas GnRH-II mRNA levels increase in a concentrationand time-dependent manner after E2 treatment (21). Moreover, while progesterone (P4) regulates the expression of GnRH-I mRNA levels in TE671 cells, there is no effect of P4 on GnRH-II mRNA levels in this cell type. However, treatment of human granulosa luteinizing cells with the P4 antagonist, RU486, increases GnHR-II mRNA levels in a concentration- and time-dependent manner, while RU486 has no effect on GnRH-I expression (21), suggesting that endogenous P4 specifically inhibits GnRH-II expression in the ovary. The differential regulation 4  of the GnRH-I and GnRH-II genes by steroid hormones in the ovary suggests that the production of these two peptide hormones may be differentially controlled during the menstrual cycle in a temporally defined manner (11). Other steroids, including androgens, glucocorticoids and dehydroepiandrosterone, or physiological regulators, such as insulin, melatonin, nitric oxide, retinoic acid and insulin-like growth factors, have been extensively investigated as potential regulators of the human and rodent GnRH-I gene. Their effects on human GnRH-II expression have not been studied (2, 11). Thus, it was considered important to further delineate the upstream regulators of human GnRHII expression.  1.1.3 GnRH-II and GnRH receptor The type I GnRH receptor (GnRHR) is a member of the rhodopsin-like G proteincoupled receptor (GPCR) superfamily, and it contains a characteristic seven-transmembrane (TM) domain structure (22-24). However, unlike other members of the GPCR superfamily, the human GnRHR lacks the entire C-terminal tail, which leads to its slow internalization and a lack of the rapid desensitization of the receptor (25, 26). Human GnRHR is encoded by chromosome 4 (27, 28), and the GnRHR gene is comprised of three exons separated by two introns (29, 30). Exon 1 encodes the N-terminal tail, the transmembrane (TM) 1, 2 and 3 domains and part of the TM 4 domain of the GnRHR protein. Exon 2 encodes the remaining portion of TM 4 and the TM 5 domain, whereas exon 3 encodes the TM 6 and 7 domains (29). The distribution of the GnRHR in the pituitary is well documented (30-32). As for extrapituitary sites of expression, the GnRHR has been detected in both normal human reproductive tissues and tumors derived from these tissues (2). For example, the GnRHR has been detected in endometrial cancer cell lines and in both non-malignant endometrial specimens and endometrial carcinomas (33-35), as well as in normal myometrium and uterine leiomyomas (36). In human 5  placental tissues, both GnRH agonist and antagonist bind specifically to the GnRHR (37). Importantly, GnRHR expression in placental cells (i.e., cytotrophoblast and syncytiotrophoblast cells) is altered in concert with the secretion of chorionic gonadotropin throughout pregnancy. (38-40). This variation in GnRHR expression may therefore be functionally important during different stages of pregnancy. As shown by Western blotting analysis, polymerase chain reaction, and radioligand binding assays, GnRHR is detectable in prostate cancer (41, 42). In the latter report, it has been demonstrated that GnRHR is localized in the basal and luminal epithelial cells of both benign and malignant prostate tissues, but their GnRHR mRNA levels do not correlate with different histological grades (42). However, in a larger population analysis, the expression of GnRHR was found to be significantly higher in patients with demonstrated hormone-refractory prostate carcinoma than those that responded to hormonal treatment (43). GnRHR mRNA levels has also been detected in human breast cancer cell lines and in breast tumor biopsy specimens (44-46). Altogether, these studies suggest that GnRH may influence the progression of these cancers. In the ovary, GnRHR mRNA levels show a spatial and temporal change that correlates with folliculogenesis (29). Specifically, GnRHR is not expressed in primordial, early antral or preovulatory follicles, but is detectable in luteinized granulosa cells, late follicles and developing corpora lutea (47, 48), thus suggesting that its stage-specific expression in the ovary may play a role in the regulation of ovulation, follicles atresia and luteolysis. Furthermore, GnRHR protein and mRNA have also been detected in human ovarian cancer cell lines, ovarian tumor specimens, and ovarian surface epithelium, from which ovarian carcinoma may originate (49, 50). Clinically, the level of GnRHR has been reported to be elevated in advanced stage (stages III and IV) ovarian carcinomas, and was suggested to be associated with the grading of this disease (51). In summary, these results suggest a probable correlation and functional role for increasing GnRHR levels in different tissue-derived cancers (52, 53). 6  Since the discovery of GnRH-II, numerous studies have sought to identify a cognate type II GnRHR. In the goldfish and monkey model, type II GnRHR has been cloned and was found to be structurally and functionally different from the type I GnRH receptor (54-56). Screening the human genome databases reveals a putative type II GnRHR gene on chromosome 1q2.2 (56, 57). Although type II GnRHR mRNA can be detected in a variety of reproductive tissues or reproductive tissue-derived cancer cells (56-60), studies have demonstrated that exon 1 contains a frameshift while exon 2 contains a premature stop codon within the open reading frame of type II GnRHR mRNA, suggesting that this gene cannot translate a conventional seven-transmembrane receptor (61). Hence, the functionality of this human type II GnRHR is still in question. The question of whether GnRH-II specifically acts through the type I GnRHR to exert its effects remains debatable. The ability of GnRH-II to stimulate gonadotropin secretion using monkey pituitary cells has demonstrated that the type I GnRHR is responsible for the transmission of GnRH-II signaling despite the existence of a functional type II GnRHR in this species (62). In contrast, researchers found that GnRH-II does not act through the type I GnRHR to exert its neuromodulatory action on musk shrew behavior (63). In tumor systems, Enomoto and Park (59) showed that GnRH-II acts through the type II GnRHR to exert its antiproliferative effects in DU145 prostate cancer cells. However, Limonta et al. reported that GnRH-II exerts its antiproliferative effects through the type I GnRHR in their study using the same DU145 prostate cancer cell line and two additional prostate cancer lines, LNCaP and PC-3 cells (64, 65). Similarly, Grundker et al. (66) showed that siRNA-mediated reduction of the type I GnRHR did not alter the GnRH-II-induced reduction in the proliferation of endometrial and ovarian cancer cell lines. This result suggests the existence of a functional type II GnRHR in these cells lines. In contrast, our group has demonstrated that both in endometrial cancer (67) and ovarian cancer cell lines (68-71), GnRH-II exerts antimitogenic actions through the activation of the type I 7  GnRHR. Furthermore, in other cell types, Hong et al. verified that GnRH-II acts through the type I GnRHR to induce apoptosis in human luteinizing granulosa cells (72). These results add further support for the concept that GnRH-II exerts its effects by activating the type I GnRHR.  1.1.4 GnRH/GnRHR initiated intracellular signal transduction GnRH achieves cell-specific signaling by activating different G proteins upon binding to the GnRHR. In extra-pituitary tissues, GnRH subtypes do not act through the Gq-11phospholipase C signal transduction pathway that functions in the pituitary (73, 74). Instead, Gi signaling is initiated, resulting in the activation of a variety of downstream signaling cascades including mitogen-activated protein kinase (MAPK), phosphoinositide 3-kinase (PI3K), and nuclear factor kappa B (NF-B) signaling (52, 53). Recent studies have also demonstrated that Wnt/-catenin signaling is also involved in GnRH/GnRHR activation (75). These studies imply the initiation of several signaling cascades upon GnRHR activation (Fig. 1.1).  8  FIG. 1.1. Schematic representation of GnRHR signaling in extra-pituitary tissues. GnRH-I and GnRH-II bind with GnRHR and activate a variety of signalings to regulate tumor cell progression.  GnRH,  gonadotropin-releasing  hormone;  GnRHR,  gonadoropitn-releasing  hormone receptor; PI3K, phosphoinositide 3-kinase; NFB, nuclear factor kappa light polypeptide gene enhancer in B cells; PP2A, protein phosphatise 2A; PKC, protein kinase C; MLK3, mixed lineage protein kinase 3; JNK, Jun N-terminal kinase; PTP, protein tyrosine phosphatase; RTK, tyrosine kinase receptor; EGFR, epidermal growth factor receptor; IGFR, insulin-like growth factor receptor; FGFR, fibroblast growth factor receptor; Shc, Src homology 2 domain containing transforming protein; SOS, son of sevenless homolog protein; MEK, mitogen activated protein kinase kinase; ERK1/2, extracellular signal regulated kinase 1/2.  9  1.1.4.1 MAPK Several studies have shown that GnRH subtypes activate the MAPK cascade, including extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK), and p38 MAPK signaling in a tissue-specific and cell-specific manner. For instance, GnRH-I induces DU-145 prostate cancer cell apoptosis by activating the JNK pathway (76). This activation of JNK is achieved through the inhibition of Akt signaling and the activation of Src protein, which promotes the activity of the JNK upstream activator, MLK3 (76). In ovarian cancer cells, GnRH-I mediates cell growth by activating ERK1/2 signaling with the help of Shc and Sos proteins (77). Our laboratory has also demonstrated that GnRH-I and -II-induced MAPK signaling pathways (i.e., ERK1/2 and p38) are required to mediate cell proliferation in a PKCdependent manner (68, 70). Recently, Cheung et al. demonstrated that GnRH-I acts thorough the MAPK/JNK signaling cascade to regulate ovarian cancer cell invasion (78).  1.1.4.2 PI3K The PI3K/Akt signaling pathway has been implicated in mediating cell proliferation, survival, and invasion. Treatment with a GnRH-I agonist induces uterine leiomyoma cell apoptosis by inhibiting PI3K/Akt signaling and repressing anti-apoptotic protein expression (i.e., c-FLIP, PED/PEA15) (79). While in ovarian cancer cell line, GnRH-I and GnRH-II interfere with the activity of the PI3K/Akt signaling to regulate cell invasive properties (71). In many cases, there is a cross-talk between PI3K/Akt signaling and MAPK signaling to mediate GnRH actions. This mode of regulation has been demonstrated in prostate cancer cells in which the activation of PI3K/Akt signaling leads to the stimulation of the JNK pathway and contributes to the pro-apoptotic effect of GnRH-I (76). Similarly, in GT1-7 cells, GnRH-I can activate EGFR and the downstream PI3K/Akt signaling pathway, which can, in turn, induce ERK1/2 phosphorylation (80, 81). 10  1.1.4.3 Wnt/-catenin Recent studies have demonstrated that GPCR signaling may initiate the Wnt/-catenin signaling cascade (Fig. 1.2). This was first reported in studies showing that prostaglandin F2 stimulates -catenin-dependent signaling via the FPB prostanoid GPCR (82-84). -catenin may either act as an adaptor protein, which links the cadherins to the actin cytoskeleton at adherens junctions, or as a signaling molecule in the Wnt/-catenin pathway, whereby it induces transcription of Wnt target genes via the T-cell factor (TCF)/lymphoid enhancer factor (LEF) transcription factor family (85-87). Without Wnt ligand stimulation, -catenin forms a complex with adenomatous polyposis coli (APC), axin, casein kinase I and glycogen synthase kinase-3 (GSK3). The formation of this complex regulates the phosphorylation of -catenin and targets it for degradation in order to maintain low cellular levels of -catenin. Stimulation of the Wnt cascade results in GSK3phosphorylation, which releases the interaction between GSK3 and -catenin, thereby allowing the accumulation of -catenin in the nucleus. Consequently, mutations or alterations of any components within the -catenin complex may lead to the dysregulation of Wnt/-catenin target genes which affect normal physiologic homeostasis, and can promote tumorigenesis (88-91). Recently, it has been shown that -catenin signaling is required for the maximal induction of LH secretion in response to GnRH stimulation (92). This study demonstrated that GnRH induces the co-localization and physical association of -catenin with transcription factors, EGR-1 and SF-1, on the promoter of the LH subunit to enhance gene transcription (92). Furthermore, another report demonstrated that GnRH-I and GnRH-II induce -catenin accumulation in the nucleus, resulting in the activation of -catenin-dependent transcription and up-regulation of Wnt/-catenin target genes in both gonadotrope cells and GnRHR expressing  11  HEK293 cells (93). This study further confirmed the involvement of -catenin signaling upon activation of GnRHR. Importantly, GnRH has been found to stimulate -catenin signaling in a heterologous cell system (93), implying that the Wnt/-catenin signaling cascade may be important to many peripheral tissues and cancers that express GnRHR.  1.1.4.4 Other signaling pathways Other signaling pathways are initiated upon GnRHR activation (52, 94). For instance, a GnRH-I agonist was found to activate the nuclear translocation of NF-B through Gi-coupled GnRHR to regulate ovarian cancer cell growth (95). The activation of this signaling pathway has also been observed in endometrial stromal cells, in which GnRH-I interferes with the tumor necrosis factor alpha-induced NF-B signaling to inhibit the expression of interleukin-8 (96). GnRHR activation may also regulate non-RTK signaling, including proline-rich tyrosine kinase 2 (Pyk2) signaling and focal adhesion kinase (FAK). This effect was evident in human HEC-1A endometrial cancer cells in which GnRH-I and GnRH-II induced 3-integrin-dependent activation of FAK to mediate cell growth (97). In addition, GnRH-I has been shown to induce the regression of uterine leiomyoma through FAK signaling (98), and GnRH attenuates the actions of testosterone and inhibits cell growth in prostate tumors via the involvement of FAK signaling and the FAK cofactor, Hic-5 (99).  12  FIG. 1.2. Potential signaling pathways for permitting cross-talk between Wnt and GnRH. GnRH/GnRHR-activated signal transduction pathway induces the translocation of -catenin into the nucleus, thereby stimulates Wnt/-catenin-dependent target gene transcription. GnRH, gonadotropin-releasing hormone; GnRHR, gonadotropin-releasing hormone receptor; PKC, protein kinase C; JNK, Jun N-terminal kinase; ERK, extracellar signal regulated kinase; TCF/LEF, T cell specific transcription factor/ lymphoid enhancer binding factor; JUN, jun oncogene; PI3K, phosphoinositide 3-kinase; Akt, v-akt murine thymoma viral oncogene homolog; Wnt, wingless-type MMTV integration site family; APC, adenomatous polyposis coli; GSK3, glycogen synthase kinase 3 beta.  13  1.2 Ovarian cancer Ovarian cancer is a major health problem for women and represents one of the the most lethal diseases from malignancies of the female genital tract (100). It accounts for more than 40,000 new cases each year in Europe (101) and 25,000 cases in the United States (102). Approximately 90% of ovarian cancers are epithelial (carcinomas) which can be further classified as serous (50% of ovarian cancers), endometrioid (20%), mucinous (10%), clear cell (5%), transitional, mixed, and undifferentiated, depending on their histological features (103105). Initially, ovarian cancers were thought to arise solely from the ovarian surface epithelium (OSE), which is a single layer of squamous to cuboidal epithelial cells that comprises the ovarian surface (103). This assumption was based on the fact that OSE possesses both epithelial and mesenchymal characteristics, so as to facilitate ovarian rupture and repair through repeated ovulatory cycles. In this context, these functions may therefore increase the susceptibility of OSE to genetic mutation and malignant transformation (106, 107). In particular, putative precursor lesions are hypothesized to originate from OSE-lined clefts and inclusion cysts in the ovarian cortex, and the prevalence of having these lesions increases with age (108-110). On the other hand, it was noted that throughout the progression of ovarian cancer, OSE differentiates and resembles the lining of different Müllerian duct-derived regions of the female reproductive tract (97). For instance, serous, mucinous, and endometrioid ovarian carcinomas are histologically similar to the normal epithelia of the fallopian tube, endocrevix, and endometrium, respectively. This has given rise to the alternative hypothesis that epithelial ovarian cancers do not develop from metaplastic changes in the OSE but arise directly from the fallopian tube and secondary Müllerian system, including endosalpingiosis, endometriosis, and endocervicosis (111, 112). Although these different hypotheses are widely debated, recent studies have demonstrated that some tumors diagnosed as "serous ovarian adenocarcinoma" are 14  more likely derived from the distal fallopian tube and then implant on the ovarian surface, particularly in women with breast cancer 1 (BRCA1) or breast cancer 2 (BRCA2) mutations (113-115). Additionally, the association between endometriosis and ovarian carcinomas of the endometrioid and clear cell subtypes is well documented (116-118). The five-year survival rate for localized ovarian cancer is around 91-95%, compared to only 25-28% of patients that were diagnosed as advanced stage (stage III & IV) ovarian cancer (119). Many of these women with late stage ovarian cancer will exhibit relapse, or even drugresistant disease after initial surgery and chemotherapy. Thus, the development of new treatment strategies is important in ovarian cancer cell biology. Thus far, studies of the molecular mechanisms responsible for the progression of sporadic ovarian cancer have resulted in the identification of potential target genes and their downstream molecules, and these may be targets for pharmacological inhibition or gene silencing. For example, genes that are upregulated in cancer cells or expressed de novo relative to their normal counterparts may be considered as therapeutic targets. In particular, genes that are over-expressed and result in uncontrolled cell proliferation are qualified as therapeutic targets. Ideally, these target genes should not affect normal cell behavior but are required for cancer cell progression (120).  1.2.1 Growth factors regulation of ovarian epithelial cancer progression Compelling evidence suggests that growth factors, hormones, and cytokines are important players in mediating OSE physiology (71, 121). Thus, the dysregulation within the signaling cross-talk in any of these factors, such as increased expression of receptors and their downstream elements, may contribute to the transformation and progression of epithelial ovarian carcinoma (EOC) (122, 123). OSE expresses EGF receptors in vivo and in culture (124). During ovulation, the follicular fluid or blood contains high concentration of EGF which is secreted from the 15  luteinizing granulosa and stromal cells, thus resulting in a microenvironment that exposes the OSE cells to high levels of EGF (125, 126). Studies have suggested that EGF acts as a potent mitogen in human OSE cells and its effects may be enhanced by hydrocortisone (127). Furthermore, EGF affects the differentiation of OSE cells, in which prolonged EGF treatment leads to cell morphology changes from an epithelial to a spindle shape, with the loss of keratin, an epithelial differentiation marker (128). Further investigation demonstrated that EGF enhances cell motility and stimulates the secretion of matrix metalloproteinases, such as MMP-2 and MMP-9 (129). Taken together, EGF may constitute a periodic stimulation in OSE cells so as to induce the post-ovulatory proliferation and the epithelial-mesenchymal transition of OSE cells during follicle rupture. Failure in this mechanism will lead to the formation of epithelial inclusion cysts, which are known to be a preferential sites for malignant transformation (71). The EGF receptor belongs to the ErbB/HER receptor tyrosine kinase family (130). It activates a variety of signaling pathways including the MAPK and PI3K cascades, which play important roles in the regulation of various cellular activities (71, 129, 131). More than 50% of ovarian tumors express the EGF receptor. Moreover, the amplification and/or over-expression of this receptor may be found in ovarian tumors compared to normal OSE. The use of antisense RNA to down-regulate the expression of this receptor results in the inhibition of cellular proliferation and attenuates the progression of tumorigenicity in human ovarian cancer cell lines, thus implicating that altered levels of this receptor play important role in this disease (132-134). Furthermore, EGF has also been shown to modulate EOC cell growth in an indirect manner. While EGF downstream signaling cross-talks to inhibit transforming growth factor-beta signaling to enhance EOC cell proliferation (135), it also interferes with the gonadoropinmediated cell growth in these cells (69).  16  In addition to EGF, transforming growth factor-beta, hepatocyte growth factor, fibroblast growth factor, keratinocyte growth factor, and insulin-like growth factor have also been thoroughly investigated in terms of their physiological impact on normal OSE and EOC (71).  1.2.2 GnRH regulation of ovarian cancer progression The expression of GnRHR has been detected in the primary cultures of ovarian carcinomas (39) and ovarian carcinoma biopsy specimens (38, 45), including both mucinous and serous subtypes (46). High expression (>80%) of GnRHR in biopsy samples (35, 44) compared with OSE supports the hypothesis that the GnRH regulatory system is involved in ovarian cancers. In line with these clinical reports, we and others have also detected the expression of GnRHR in a variety of ovarian cancer cell lines (27, 39, 41-43, 136). The extremely short half-life of hypothalamic GnRH-I and GnRH-II suggests that their action on the ovary does not come from the systemic circulation and that there is a local source of GnRH-I and GnRH-II in ovarian cancers. Indeed, our group and others have detected GnRH-I and GnRH-II mRNA in normal OSE, immortalized OSE cells, as well as in primary cultures of ovarian tumors and ovarian cancer cell lines (43, 137, 138). In addition, the mRNA levels of GnRH-II are increased in human malignant ovarian tissues compared with benign or normal ovarian tissues (139), which points to the possibility of a GnRH-II autocrine regulation of tumor growth or motility in women with ovarian cancer (53). GnRH-like immunoreactivity has been detected in conditioned media (49) and cell lysates (38) from ovarian cancer cell lines. While it has been reported that incubation with a GnRH-I antibody inhibits ES-2 ovarian cancer cell proliferation in a time- and concentrationdependent manner (49), others have reported a significant increase in EFO-21 and EFO-27 ovarian cancer cell proliferation after GnRH-I antiserum treatment (140). Despite this latter discrepancy, there is increasing evidence that endogenously produced bioactive GnRH acts as 17  an autocrine regulator in ovarian cancer cells. For instance, our laboratory has verified the existence of a GnRH-I/GnRHR autocrine loop in primary culture human OSE cells (138). In the latter studies, the GnRH-I agonist, [D-Trp6] GnRH, had a direct inhibitory effect on OSE cell growth in a time- and concentration-dependent manner, and this inhibitory effect was reversed by co-treatment with the GnRHR antagonist, antide (138). Moreover, treatment with the GnRHI agonist stimulated the expression of GnRH-I and the GnRHR in OSE cells, further supporting the existence of a GnRH-I autocrine regulatory system in the ovary (53). In view of the effects of GnRH-I and GnRH-II in mediating tumor cell proliferation, it has been hypothesized that GnRH subtypes may play a role in the metastatic behavior of these cancer cells. Interestingly, our group has demonstrated that GnRH-I and GnRH-II regulate the expression of several extracellular matrix-degrading enzymes in human decidual stromal cells and extravillous cytotrophoblast cells, suggesting that these peptides may be important factors during implantation (40, 68). Importantly, using ovarian cancer cell lines as cell model, others have demonstrated that GnRH-I exerts its pro-invasive effect by mediating the secretion of proMMP2 and pro-MMP-9 (78). Although GnRH-II demonstrates similar effects in promoting ovarian cancer cell invasion (71), the detailed mechanisms for the regulation of GnRH-II or its downstream signaling and its effect on the invasive potential of ovarian cancer cells remain elusive.  1.2.3 Matrix metalloproteinases in ovarian cancer progression Interactions between the extracellular matrix (ECM) and tumor cells or the surrounding stromal cells play an important role in tumor progression (141). In particular, the secretion of matrix metalloproteinases (MMPs) is influenced by these interactions and has been shown to regulate the tumor microenvironment. In this context, increased expression and activation of MMPs has been demonstrated in a variety of cancers (142). 18  MMPs degrade the ECM to regulate cell behaviors relevant to cancer biology, including cancer cell growth, motility, apoptosis, differentiation, tumor angiogenesis, and immune surveillance. MMPs are divided into collagenases, gelatinases, stromelysins and matrilysins according to their specificity (143). The MMPs are also grouped according to their localization: five are secreted and three are membrane type MMPs (MT-MMPs) (144). MMPs are synthesized as inactive zymogens (pro-MMPs), and their activation requires the proteolytic cleavage of the NH2-prodomain (143). MMP-11, MMP-28 and MT-MMPs comprise a furin-like enzyme recognition motif between their pro-peptide and catalytic domain (145). Thus, their activation occurs intracellularly by a serine proteinase before secretion or translocation to the cellular membrane (145). The remaining MMP family members lack the furin-like domain, thereby their activation occurs extracelllary after secretion (146). Inhibitors of MMP activity include α2-macroglobulin, thrombospondin-1 and -2, and the tissue inhibitor of metalloproteinase (TIMP) family. For instance, the plasma protein, α2-macroglobulin, is the main inhibitor of MMPs in tissue fluids (146), and the inhibitory complex that is formed between α2-macroglobulin and MMPs interacts with a scavenger receptor that is responsible for its endocytotic clearance (147). In a similar manner, thrombospondin-2 forms a complex with MMP-2, which also leads to scavenger receptor-mediated endocytosis and clearance (84). On the other hand, thrombospondin-1 binds directly to pro-MMP-2 and -9 to inhibit the activation of these two MMPs (148, 149). The expression of TIMP-1, -2, -3, and -4 and their ability to inhibit MMPs are tissue specific (150). For example, studies with TIMP-2-deficient mice indicate that the proteolytic activity of MMP-2 has a direct correlation with the ratio of TIMP2:MMP-2 in the tissues (151). Inhibitors that structurally resemble the N-terminal domains of TIMPs and either contain a C-terminal proteinase enhancer element (152) or a non-collagenase C-terminal domain (153) have been found to interfere MMPs activity. Lastly, the only known  19  inhibitor for membrane bound MMPs is RECK (reversion-inducing cysteine-rich protein with kazal motifs) (141). MMP-2 and MMP-9 act in degrading the type IV collagen, a major component of the basement membrane and thus have been associated with the malignant phenotype of tumor cells (86). One of the first observations that suggested a role for MMP-9 in tumor invasion relates to the fact that the secretion of MMP-9 is associated with the metastatic phenotype of transformed rat embryo cells (154). Recently, attention has focused on membrane type 1 matrix metalloproteinase (MT1-MMP), which is an integral trans-membrane proteinase that is frequently expressed in malignant cancer cells, and has potent invasion-promoting activity (155). When expressed on the cell surface, MT1-MMP degrades the extracellular matrix (ECM) barrier adjacent to the cells to maintain the migration route (155, 156). However, other than functions as a proteinase that degrades ECM, MT1-MMP binds with cell adhesion molecules (157, 158), or latent forms of MMPs (i.e., MMP-2), and is also involved in the regulation of their respective functions (145, 159). These processing events contribute to MT1-MMP-mediated cell migration and behavior (155). In vitro studies have demonstrated that the expression of MMP-2, -9 and MT1-MMP corresponds with the invasiveness of ovarian cancer cell lines (160-163). In fact, MMP-2, -9, and MT1-MMP are among the most studied MMPs as biomarkers for ovarian cancer. MMP-9 activity in tissue extracts increases significantly in advanced stage ovarian cancers (stage III) compared to benign tumors and has been found to be an independent prognosticator of poor survival (164). In another study of invasive epithelial ovarian cancer, high stromal expression levels of MMP-9 and MT1-MMP correlate significantly with cancer progression and act as independent prognostic markers (165). MMP-2 expression has also been correlated with ovarian cancer progression (165, 166). Elevated levels of MMP-2 in peritoneal implant cancer cells is associated with a significant risk of death in stage III ovarian carcinomas (167). Tissue MMPs 20  have been shown to distinguish different histotypes of ovarian cancer, which is a significant finding given that different histotypes have different prognoses (3). A recent study showed that more than 90% of clear cell carcinomas express moderate to high levels of MMP-2 or MT1MMP, compared with 30% to 55% of the other ovarian cancer histotypes (serous, endometrioid, and mucinous), whereas MMP-9 is expressed more widely in other histotypes (168). Importantly, the cellular source of MMPs must be considered when evaluating MMPs as ovarian cancer biomarkers. For example, high MMP-9 levels in the cancer cells themselves are associated with longer survival, whereas high stromal MMP-9 levels are associated with shorter survival, suggesting a dual role for MMP-9 during ovarian cancer progression (169). The results of these studies lead to interest in the potential use of MMP inhibitors to treat ovarian cancer. An in vivo model in which xenograft mice were administered intraperitoneally with synthetic MMP inhibitors demonstrated that these treatments lead to an increase survival rate in the mice implanted with human ovarian carcinoma (170). Currently, using MMP inhibitors, such as Batimastat and Marimastat, have been shown to be successful in pre-clinical studies. Nevertheless, clinical trials have revealed complications such as local pain and irritation which may result from low drug specificity (171). To address this problem, researchers are also developing therapies that specifically target individual MMP by performing gene knock-down. These in vitro studies have shown a promising reduction in the invasive potential of ovarian cancer cells (172).  1.3 67 kDa non-integrin laminin receptor (67LR) The 67 kDa non-integrin laminin receptor (67LR) was first extracted from the murine melanoma cell membranes and purified by laminin-sepharose affinity chromatography (173). It was later found in human breast carcinoma cells (174) and normal muscle cells (175). The 67LR exhibits a high affinity (dissociation constant (Kd) of 2 nM) and specificity for laminin (173, 21  176). An approximately 1.7 Kb mRNA for 67LR was identified by Northern blot analysis, and the 888 nucleotide coding sequence for 67LR is translated into 295 amino acids resulting in a protein with a molecular mass of approximately 32.8 kDa. Western blotting demonstrated that this precursor protein can be detected in a variety of cell lysates with a molecular mass of 37 kDa. It was eventually named the 37 kDa laminin receptor precursor (37LRP) (177). Although studies have suggested that 37LRP dimerizes to form the mature 67LR (178, 179), the dimerization mechanism remains elusive. The 37LRP is highly conserved through evolution in both vertebrates and invertebrates, suggesting that this protein may possess multiple functions in different tissues (180, 181). For example, the cDNA of 37LRP also encodes the ribosomal protein p40, suggesting a role in translation (181). In addition, studies have demonstrated that 37LRP is involved in the life cycle of prions and acts as a receptor for cellular prions (182, 183). Other studies have reported that 37LRP is identical to the oncofetal antigen protein expressed in tumors (184).  1.3.1 The functional role of 67LR in normal cells 1.3.1.1 Interactions with laminin It is well known that 67LR interacts directly with laminin via two regions within the Cterminal domain: a carboxy-terminal region (205-229) that binds YIGSR on the 1 chain of laminin (185, 186), and a region encompassing amino acids 161-180, known as the peptide G domain (187-189). Using a protease-resistant laminin fragment, a laminin-like EGF domain within the laminin-I β1 short arm (YIGSR) was identified as the minimal sequence required for binding with 67LR (190-192). The corresponding sequence that binds with this YIGSR domain has been mapped to the α-helical peptide residues of human 67LR (205-229) (185, 193). A second laminin interaction site which binds to laminin with a higher affinity (Kd =50 nM) was also 22  discovered (187). This domain spans residues 161-180 of 67LR (187, 194) and is known as the peptide G domain (IPCNNKGAHSVGLMWWMLAR). Studies have shown that both the 205229 and the 161-180 regions of 67LR may bind with the YIGSR region within the laminin-1 β1 chain. (195). In fact, the peptide G domain also interacts with the sulfated polysaccharide heparin. Thus, heparin competes with laminin in binding with peptide G, resulting in the differential regulation of the interaction between 67LR and the basement membrane (196, 197). Deletion of the palindromic sequence LMWWML within the peptide G domain results in the instability of 67LR and a lower affinity of 67LR for laminin, suggesting that this palindromic sequence plays an important role in the interaction of 67LR with laminin. Overall, the interaction sites of 67LR with laminin are different from the sites recognized by integrins (180, 185, 188, 198), thus allowing a higher overall binding affinity and also a broader range of binding and signaling options.  1.3.1.2 67LR as a co-receptor In addition to its direct binding with laminin, 67LR also facilitates the interaction between laminin and integrins. This notion was supported by reports demonstrating that the laminin-induced membrane localization of α6 and β4 integrin subunits is accompanied with increased levels of cell surface 67LR in human carcinoma cells (199, 200). Ultimately, the treatment of cancer cells with cytokines resulting in the reduction of α6 integrin subunit expression also significantly decreases the amount of cell surface 67LR (200). In addition, siRNA-mediated depletion of the α6 integrin subunit results in a proportionate reduction in 67LR cell membrane localization, despite the fact that there is no change in the total amount of mature 67LR or the total level of 37LRP. This result indicates that the siRNA treatment does not affect the overall expression of 37LRP (200). By contrast, the amount of cell surface 67LR increases in response to up-regulated 6 integrin, suggesting that these two molecules interact 23  with each other and may be co-regulated in terms of their localization. Indeed, an α6 monoclonal antibody also pulled down 67LR during co-immunoprecipitation, indicating that the interaction of 67LR and α6 integrin might initially occur in the cytoplasm and then may eventually co-translocate to the cell surface (200). The close association of these two receptors suggests that they may be co-regulated in a variety of processes during interaction with laminin.  1.3.2 The functional role of 67LR in tumor invasion and aggressiveness Laminin is one of the major adhesion substrates for invasive cancer cells. Cells interact with laminin via several cell surface laminin-binding proteins, including integrins α3β1, α6β1, α6β4 and α7β1, dystroglycan, as well as 67LR (201). Studies have demonstrated that tumor cells with higher levels of cell surface laminin receptors not only show increased interaction with laminin but also with the vascular basement membrane (174), thereby enhancing metastatic potential (173). Thus, researchers have been trying to delineate the role of 67LR in cancer progression and metastasis. For instance, increased 67LR expression has been found in a variety of carcinomas and is positively correlated with the aggressiveness or metastatic potential of these cancers (177). In line with these clinical reports, in vitro studies have demonstrated that antiserum against 67LR has an inhibitory effect on cell adhesion (178). In addition, shRNAmediated down-regulation of 67LR reduces the metastatic spread of human melanoma in nude mice (189). Interestingly, it was demonstrated that the laminin-binding peptide G domain within the 67LR plays an important role in increasing the affinity of the cells for laminin and can also increase the number and affinity of 6-containing integrins, thereby contributing to cancer cell progression (188, 202). Treatment of a synthetic peptide G with laminin-1 led to a conformational change in laminin and the subsequent remodeling of the tumor microenvironment and invasiveness in vivo (203, 204). Furthermore, this peptide G remodeling  24  selectively increases the expression of MMP-2, indicating its potential functional role in modulating tumor cell invasive properties (202). Laminin promotes both the proliferation and migration of ovarian cancer cells (96). Clinical studies showed that 67LR levels correlate with the presence of malignancy (205), high histological grade (206), suboptimal debulking (205) and poor outcome (205, 206). Nevertheless, the sample sizes of the above reports were small. In fact, a controversial outcome was reported. In this later study, researchers focused on patients who were diagnosed with serous ovarian carcinoma, and according to their immunohistochemistry results, the levels of 67LR in both effusions and solid tumors were of marginal significance as a diagnostic marker (207). Hence, further study will be required to delineate the role of 67LR in ovarian carcinoma.  1.3.3 GnRH and 67LR GnRH-I and GnRH-II induced the production of 67LR in both normal and leukemic T cells (20). In this study, Chen et al. demonstrated that T cells induce GnRH-I and GnRH-II and treatment of these peptide hormones in normal or cancerous human or mouse T cells increases the cell surface expression of 67LR. In addition, this regulation of 67LR by GnRH-I and GnRHII resulted in increasing cell adhesion to laminin, enhanced cell chemotaxis toward the cytokine SDF-1a, and augmented the metastasis of T lymphoma into the bone marrow and spleen in vivo. Thus, the authors of this study suggested that GnRH-II may play a role in immune system and T cells in particular. Furthermore, they proposed that interactions of GnRH-I or GnRH-II with normal T cells may be beneficial, while the effects of these peptide hormones on malignant T cells may be detrimental. Thus, suggesting that these potential differences in normal and cancerous may have important clinical implications (20).  25  1.4 Hypothesis and objectives: Gonadotropin-releasing hormone (GnRH) is the central neuroendocrine regulator of the hypothalamic-pituitary-gonadal axis. Multiple structural variants of GnRH are present in vertebrates. GnRH-II, the second isoform of GnRH, was first isolated from the chicken brain and is highly conserved among vertebrates. Studies have suggested that it is unlikely to be a primary regulator of gonadotropin release. Instead, it has been suggested that GnRH-II may have physiological functions distinct from those of GnRH-I due to its differential localization in the brain and also its significantly higher levels of expression outside the brain. Our laboratory and others have shown that GnRH-II and its receptor, GnRHR, are expressed in normal ovaries and in ovarian carcinomas. Furthermore, exogenous treatment of GnRH-II enhances the invasiveness of ovarian cancer cells, suggesting that GnRH-II/GnRHR may play an important functional role in the progression of ovarian carcinoma. Thus, my overall hypothesis for this project is that GnRH-II/GnRHR may act as an autocrine/paracrine regulator in the physiological setting of ovarian cancer.  The specific objectives of this work are: Objective 1. To define the transcriptional regulation of human GnRH-II promoter in extra-hypothalamus tissues. (Chapter II) (I) The transcriptional mechanism involving the cyclic AMP responsive element (CRE) within GnRH-II promoter was determined. (II) The effects of individual transcription factors (i.e. p-CREB, C/EBP, CBP) on GnRH-II mRNA levels defined from (I) were determined.  26  Objective 2. To identify the upstream growth factors involved in the regulation of human GnRH-II promoter activity. (Chapter III) (I) The effects of EGF on human GnRH-II promoter activity and GnRH-II mRNA level in ovarian cancer cells were determined. (II) The regulation of EGF on the CRE within GnRH-II promoter was determined. (III) The role of EGF-induced GnRH-II production in ovarian cancer cell invasiveness was determined. Objective 3. To delineate the functional role of GnRH-II/GnRHR system in ovarian cancer (Chapter IV & V) (I) The role of GnRH-II/GnRHR as an autocrine regulator in ovarian cancer cell invasiveness was tested. (Chapter IV) (II) Downstream molecules (i.e. 67LR, MMP-2, MT1-MMP) involved in GnRH-II/GnRHR autocrine regulation were defined. (Chapter IV) (III) The role of 67LR in ovarian cancer cell invasiveness was investigated. (Chapter IV) (IV) The downstream signaling molecules (i.e., PI3K/Akt, -catenin) involved in GnRH-IIenhanced ovarian cancer cell invasiveness were determined. (Chapter V) (V) The downstream molecule (i.e., MT1-MMP) that responds to GnRH-II-activated signal transduction pathways was defined. (Chapter V)  Objective 4. To determine the implication of downstream mechanism activated by GnRHII in ovarian cancer patient specimen. (Chapter VI) (I) I examined the relationship between 67LR and the overall survival or prognosis in highgrade serous ovarian carcinoma (stage III & IV) using tissue microarray output.  27  CHAPTER 2. Temporal recruitment of transcription factors at the cAMPresponsive element of the human GnRH-II promoter1 2.1 Introduction In humans, the two gonadotropin-releasing hormone (GnRH-I and GnRH-II) genes share the same structural organization but are regulated by unique regulatory elements within their promoter sequences (2), as well as in other regions of the human GnRH-II gene (10, 12). We have previously identified a minimal promoter region that includes two enhancer elements (Eboxes)/ and an ETS-like element in the un-translated exon 1 of the human GnRH-II gene (10), and others have found an atypical (agacgtca) cAMP-response element (CRE), positioned at nucleotide sequence -860 to -853 bp relative to the translation initiation codon (10) in the GnRH-II promoter, which responds to dibutryl- cAMP in human TE671 neuroblastoma cells (9). Activation of the cAMP response element binding protein (CREB) via activation of PKA is a prerequisite for CRE-mediated alterations in gene expression (208-210). Through its highly conserved structure (211), unphosphorylated CREB can dimerize and bind DNA, but phosphorylation of CREB at serine 133 appears to increase its affinity for some promoter sequences, and notably those with atypical CREs (212). The major effect of CREB phosphorylation at this site is the recruitment of transcriptional co-activators such as the CREB binding protein (CBP) (213), which augment cAMP-induced transcription (214, 215). Other domains of CREB can also recruit other nuclear proteins to modify its transcriptional activity; for example, CCAAT/enhancer binding protein family members (215, 216) and SF-1 (196, 217) modulate CREB transcriptional activity in different ways (213). The present study set out to define the transcriptional machinery targeting the CRE of the GnRH-II promoter in JEG-3 and OVCAR-3 cells. These cell lines co-express GnRH-I and 1  A version of this chapter has been published. Poon SL, An BS, So WK, Hammond GL, Leung PC 2008 Endocrinology 149(10):5142-71  28  GnRH-II and are valuable models for examining transcriptional regulation of the human GnRHII gene. We demonstrate that stimulation of JEG-3 or OVCAR-3 cells with 8-bromo cAMP increases CREB phosphorylation at serine 133 within 2 h, and induces interactions between phosphorylated CREB (p-CREB), CBP and C/EBP in a temporally-defined manner consistent with the timing of their assembly at the CRE within the human GnRH-II promoter over 1-4 h. These data provide insight into the molecular mechanisms through which the classical cAMPPKA signaling cascade activates human GnRH-II gene transcription in cancer cell lines of reproductive tissue origin.  2.2Materials and methods Cells and cell culture Human  TE671  neuronal  medullablastoma  cells,  human  OVCAR-3  ovarian  adenocarcinoma cells, and human JEG-3 choriocarcinoma cells were obtained from Ameriacan Type Culture Collection (Manassas, VA, USA). The gonadotrope-derived T3 cell line was provided by Dr. P.L. Melon (Department of reproductive medicine, University of California, San Diego, CA, USA). The cells were maintained in DMEM (Invitrogen Inc., Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS; Hyclone Laborataries Inc., Logan, UT, USA). Cultures were maintained at 37 C in a humidified atmosphere of 5% CO2 in air. The cells were sub-cultured when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.5 mM EDTA).  Plasmid construction and reporter gene assays A full-length human GnRH-II promoter construct (pGL2-2103 ⁄ +1-Luc) was generated by PCR amplification from human genomic DNA using sequence-specific primers followed by  29  subsequent cloning into the promoter-less pGL2-Basic vector (Promega, Madison, WI, USA). Transient transfections were carried out using Lipofectamin 2000 Reagent (Invitrogen) following the manufacturer’s suggested procedures. To correct for transfection efficiencies, the Rous sarcoma virus (RSV)-lacZ plasmid was co-transfected into the cells with the GnRH-II promoter-luciferase construct. Briefly, 5 x 105 cells were seeded into six-well tissue culture plates the day before transfection. One microgram GnRH-II promoter-luciferase construct and 0.5 μg RSV-lacZ plasmid were co-transfected into cells grown in standard culture medium containing FBS. In some experiments, 150 nM siCREB, 150 nM siCBP and 150 nM siC/EBPor their control siRNA oligonucleotides (Qiagen Inc., Mississauga, ON, Canada) were co-transfected with the reporter plasmids. After 6 h, 2 ml of serum-free medium was added and the cells were further incubated overnight (18 h). The culture medium was then removed and the cells were treated with 8-bromo cAMP in serum free medium for the times indicated. Cellular lysates were collected with 150 μl reporter lysis buffer (Promega) and assayed for luciferase activity. The -Galactosidase Enzyme Assay System (Promega) was used to measure -galactosidase expression from the (RSV)-lacZ plasmid, and promoter activities were expressed as luciferase activity/-galactosidase activity.  Reverse transcription quantitative real-time PCR (RT-qPCR) After treatment with 8-bromo cAMP, medium was removed from the culture dish and RNA was extracted using Trizol (Invitrogen). The RNA concentration was measured based on the absorbance at 260 nm, and its integrity was confirmed by agarose-formaldehyde gel electrophoresis. Total RNA (2.5 μg) was reverse-transcribed into first-strand cDNA (GE Healthcare Bio-Science, Piscataway NJ, USA) following the manufacturer’s procedure. The primers used for RT-qPCR were designed using the Primer Express Software v2.0 (Applied  30  Biosystems, Foster City, CA, USA). The primers for GnRH-II mRNA are: sense, 5’CTGCTGACTGCCCACCTT; and antisense, 5’-GCTTTCCTCCAGGGTACC AG. The reactions were set up with 16.5 μl SYBR Green PCR Master Mix (Applied Biosystems). All RT-qPCR experiments were run in triplicate and a mean value was used for the determination of mRNA levels. Negative controls containing water instead of sample cDNA were used in each experiment. Relative quantification of the mRNA levels of GnRH-II was performed using the comparative Cq method with GAPDH as the reference gene and with the formula 2-ΔΔCq.  Nuclear protein extraction and immuno-precipitation Briefly, cells were washed with cold PBS and harvested with 1 ml solution A (10 mM Hepes, pH 7.9, 10 mM KCl, 10 mM EDTA, 0.5 mM dithiothreitol, 1 µg/ml aprotinin, and 1 µg/ml protein inhibitor cocktail). Cell lysates were transferred to 1.5 ml centrifuge tubes and placed in an orbital rocker for 10 min at 4 C. Nuclear pellets were obtained by centrifugation at 14,000 g at 4 C for 10 min, and supernatants were collected for cytoplasmic protein. Nuclear pellets were re-suspended in solution B (100 mM HEPES, pH 7.9, 2 M NaCl, 5 mM EDTA, 50% Glycerol) and placed in an orbital rocker for 2 h at 4 C. After centrifugation at 14,000 g at 4 C for 5 min, supernatants containing the nuclear protein extracts were removed and stored at 80 C. Immuno-precipitation was conducted according to the manufacturer’s recommended protocol (Upstate, MA, USA). Briefly, nuclear extracts were incubated with p-CREB antibody (10 ug/ml), CBP antibody (10 ug/ml) and C/EBP antibody (10 ug/ml) individually followed by the antibody capture affinity ligand provided by the immuno-precipitation kit at 4 C overnight. The immuno-precipitated proteins were then subjected to electrophoresis on an 8% SDS-PAGE gel and detected with appropriate antibodies.  31  Chromatin immuno-precipitation (ChIP) All reagents, buffers and supplies were included in a ChIP-ITTM kit (Active Motif, Inc., Carlsbad, CA). Briefly, the cells were cross-linked with 1% formaldehyde for 10 min at room temperature. After washing and treatment with glycine Stop-Fix solution, the cells were resuspended in lysis buffer and incubated for 30 min on ice. The cells were homogenized and nuclei were re-suspended in shearing buffer, and subjected to pre-optimized ultrasonic disruption conditions to yield 100-500 bp DNA fragments. The chromatin was pre-cleared with Protein G beads and incubated (overnight at 4 C) with 1 µg of the following antibodies: negative control mouse IgG (Active Motif), p-CREB antibody (Cell Signaling Technology Inc., Danvers, MA, USA), CBP antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), C/EBPantibody (Santa Cruz). Protein G beads were then added to the antibody/chromatin incubation mixtures and incubate for 1.5 h at 4 C. After extensive washing, immuno-precipitated DNA/protein complex was removed from the beads by elution buffer. To reverse cross-links and remove RNA, 5 M NaCl and RNase were added to the samples and incubated at 65 C for 4 h. The samples were then treated with proteinase K for 2 h at 42 C and the DNA was purified using gel exclusion columns. The purified DNA was subjected to PCR amplification (1 cycle of 94 C for 3 min; 40 cycles of 94 C for 20 sec; 64 C for 30 sec and 72 C for 30 sec) for the CRE site (860/-853  bp)  within  the  GnRH-II  promoter  using  specific  forward  (5’-  CCAGCCTAAAGCAAGAGTCC) and reverse (5’- GTCTATAAATCCTGGGGC CA) primers. As an input control, 10% of each chromatin preparation was used. The PCR products (213 bp) were resolved by electrophoresis in a 2.5% agarose gel and visualized by ethidium bromide staining. The ChIP assay was performed at least three times, and consistent data were obtained between experiments.  32  Data analysis Reporter gene assays and real time PCR data are shown as the mean ± SEM of three independent experiments. Data were analyzed by one-way ANOVA, followed by test using the computer software PRISM (GraphPad Software Inc., San Diego, CA, USA). Data were considered significantly different from each other at p< 0.05.  2.3 Results Human GnRH-II promoter activity is enhanced by 8-bromo cAMP in T-3, TE671, OVCAR-3 and JEG-3 cells When T-3 (Fig. 2.1A), TE671 (Fig. 2.1B), OVCAR-3 (Fig. 2.1C) and JEG-3 (Fig. 2.1D) cells were transfected with a GnRH-II promoter luciferase reporter gene and treated with 1 mM 8-bromo cAMP for 8 h and 24 h, robust luciferase activity was determined in all cell lines. This indicates that cAMP may be a common second messenger involved in the up-regulation of GnRH-II transcription in these different cell types.  Human GnRH-II promoter activity and mRNA levels are enhanced by 8-bromo cAMP in a timedependent manner It is known that GnRH-II has an anti-proliferative effect on human ovarian surface epithelial cancer cells (50, 69, 70), as well as a potential to alter the invasiveness of human placental tissues (68). Thus, we chose human JEG-3 and OVCAR-3 cells as in vitro models to further study the molecular controls of GnRH-II promoter activity in response to cAMP. We first examined the activation of the GnRH-II promoter in JEG-3 and OVCAR-3 cells by transfecting them with a GnRH-II promoter-luciferase reporter gene construct and then stimulating them with 1 mM 8-bromo cAMP for increasing times. Fig 2.2 shows that 8-bromo  33  cAMP activates the GnRH-II promoter in a time-dependent manner, and that this reached a maximum at 24 h in JEG-3 cells (Fig. 2.2A) and at 36 h in OVCAR-3 cells (Fig. 2.2B). A cAMP dose response was performed and 1mM cAMP was found to elicit a maximal response in both JEG-3 (Fig. 2.2C) and OVCAR-3 (Fig.2.2D) cells. In parallel experiments, total RNA preparations of untreated or 8-bromo cAMP-treated JEG-3 and OVCAR-3 cells for different periods of time were subjected to real-time RT-PCR measurements of GnRH-II mRNA levels. The results showed that 1 mM 8-bromo cAMP enhanced GnRH-II mRNA levels in a timedependent manner (Fig. 2.2E and F). In addition, the PKA inhibitor, H89, attenuated the 8bromo cAMP and forskolin-induced GnRH-II promoter activity (Fig. 2.2G and H), suggesting that the GnRH-II promoter activation involves the classical cAMP/PKA signaling pathway.  8-bromo cAMP increases CREB phosphorylation in JEG-3 and OVCAR-3 cells To further verify the involvement of CREB phosphorylation in GnRH-II activation, JEG3 and OVCAR-3 cells were treated with 1 mM 8-bromo cAMP for 2, 4, 8, 16 and 24 h. Western blot analysis showed that 8-bromo cAMP up-regulated the phosphorylation of CREB in a timedependent manner (Fig. 2.3). Analysis of the p-CREB to CREB ratio indicated that treatment of the cells with 8-bromo cAMP significantly increased p-CREB levels by 3 fold within 2 h, and that this was sustained over the 8 - 16 h treatment time in both JEG-3 (Fig. 2.3A) and OVCAR-3 cells (Fig. 2.3B).  CBP and C/EBP interact specifically and in a temporally-defined manner with p-CREB in JEG-3 and OVCAR-3 cells after 8-bromo cAMP stimulation Immuno-precipitation experiments were conducted to determine the interaction of pCREB with its potential co-activators including CBP, C/EBP C/EBP and SF-1.  34  Administration of 1 mM 8-bromo cAMP to both JEG-3 and OVCAR-3 cells enhanced the association of CBP and C/EBP with p-CREB in a time-dependent manner, while there was no effect on C/EBP and SF-1 immuno-precipitations (Fig. 2.4A and B). More importantly, the interaction between p-CREB and CBP increased progressively from 4 - 16 h after cAMP stimulation, while C/EBP associates with p-CREB earlier (i.e., within 2 h) and is sustained to 8 h in JEG-3 cells (Fig. 2.4A) and 16 h in OVCAR-3 cells (Fig. 2.4B). Furthermore, reciprocal immuno-precipitations confirmed the interaction of p-CREB with CBP and C/EBP (Fig. 2.4C and D).  CREB, C/EBP and CBP are all required to mediate changes in GnRH-II expression in response to 8-bromo cAMP stimulation Specific siRNA oligonucleotides were used to knock down endogenous CREB, C/EBP and CBP protein levels to verify their involvement in GnRH-II expression in OVCAR-3 and JEG-3 cells. In these experiments, 8-bromo cAMP significantly induced GnRH-II promoter activity (24 h) and GnRH-II mRNA levels (16 h) in cells co-transfected with control siRNA, while co-transfection with CREB, CBP or C/EBP-specific siRNAs compromised these effects of 8-bromo cAMP (Figs. 2.5A-C, and 2.6A-C).  8-bromo cAMP increases p-CREB, CBP and C/EBP association with the GnRH-II promoter in a temporally-defined manner To determine how 8-bromo cAMP treatment of JEG-3 and OVCAR-3 cells influences pCREB, CBP and C/EBPinteractions with the CRE of the endogenous GnRH-II promoter, chromatin immuno-precipitation assays (ChIPs) were performed. Cross-linked, sheared chromatin from 1, 2 and 4 h 8-bromo cAMP-treated JEG-3 and OVCAR-3 cells were immuno35  precipitated with p-CREB, CBP and C/EBP antibodies respectively, and the recovered DNA was subjected to PCR using primers specific to the CRE region (-860/-853) of the GnRH-II promoter. As shown in figure 7, a 213 bp PCR product was amplified from p-CREB-, CBP- and C/EBP-immuno- precipitated DNA samples in both JEG-3 (Fig. 2.7A) and OVCAR-3 (Fig. 2.7B) cells. In contrast, little or no PCR product was observed with DNA recovered when control IgG was used for the immuno-precipitation. These data reveal the specific associations between p-CREB, CBP and C/EBPat the CRE region of the GnRH-II promoter in these cancer cells after their treatment with 8-bromo cAMP. Furthermore, in the absence of 8-bromo cAMPtreatment, ChIP analysis using p-CREB, CBP or C/EBP antibodies indicated no association of these factors with the GnRH-II CRE region. However, a PCR product was observed after 1 h with the p-CREB ChIP and the apparent abundance of this increased at 2 - 4 h of cAMP stimulation, whereas no C/EBP or CBP or immuno-precipitated products were observed at 1 h in both JEG-3 and OVCAR-3 cells (Fig. 2.7A and B). At 2 h after cAMP stimulation, PCR products were first observed with both the C/EBP and CBP ChIPs. Although the C/EBP ChIP PCR product remained constant between 2 and 4 h, the CBP ChIP PCR product increased further in abundance at 4 h in both cell lines (Fig. 2.7A and B). Overall, these data suggest that 8-bromo cAMP promotes p-CREB, C/EBP and CBP associations with the GnRH-II CRE in a temporally-defined manner.  2.4 Discussion In extra-pituitary tissues, such as the placenta, ovary and endometrium, GnRH-II mimics and exceeds the activities of GnRH-I (2), and this is manifest in different biological responses. For instance, the anti-proliferative effects of GnRH-II in ovarian cancer cells are more potent than those of GnRH-I (58), and GnRH-II is also a more effective regulator of leptin and hCG 36  secretion in human placenta (218, 219). Immunoreactive GnRH-II is abundant in normal ovarian surface epithelial cells, immortalized ovarian surface epithelium cells, primary cultures of ovarian tumors, ovarian cancer cell lines and various human placental cell types (68, 71). However, little is known about what regulates GnRH-II expression in these extra-pituitary cell types. In accordance with the previous finding that (Bu)2cAMP increases GnRH-II but not GnRH-I gene expression in TE671 cells (9), we found that 8-bromo cAMP enhanced human GnRH-II promoter activity in a wide range of cell types, including T-3 cells, TE671 cells, OVCAR-3 cells and JEG-3 cells. Given the potential importance of GnRH-II in altering the behavior of reproductive cancer cell types, such as OVCAR-3 and JEG-3 cells (35, 68-70), we focused our attention on determining the molecular mechanisms that govern the response of the human GnRH-II promoter to cAMP stimulation. We used a cAMP analogue to dissect the transcriptional mechanisms that function via the CRE within the human GnRH-II promoter in JEG-3 and OVCAR-3 cells. It is well known that cAMP regulates a diverse set of genes (220) by phosphorylating a specific sub-set of nuclear factors, such as CREB, ATF-1 and CREM (221, 222), that are all members of the basic region leucine zipper (bZIP) super-family. However, CREB is the only member of the bZIP family that is phosphorylated in response to cAMP stimulation in JEG-3 and OVCAR-3 cells (data not shown). In these cells, we found that CREB phosphorylation at Ser133 not only occurs very rapidly (within 30 min data not shown) after 8-bromo cAMP treatment, but remains elevated for up to 16 h. This appears to be an interesting cell-specific effect because a similarly rapid forskolin-induced CREB (Ser133) phosphorylation in NIH 3T3 mouse fibroblast cells is followed by a subsequent attenuation of p-CREB after 2 h via a protein phosphatase 1dependent mechanism (223, 224). One possibility for this difference may be that the burstattenuation protein phosphatase 1-dependent mechanism observed in NIH 3T3 cells is either delayed or lacking in OVCAR-3 and JEG-3 cells. Alternatively, the cAMP analogue we used 37  may mimic intracellular cAMP levels at higher concentrations and for longer time periods when compared to the forskolin used in the NIH 3T3 studies. The cAMP-mediated increase in Ser133 phosphorylation of CREB is known to enhance its interaction with other nuclear proteins and their target genes via CREs (225). However, genome-wide analysis of CREB occupancy on target promoters by ChIP-on chip experiments suggested that less than 2% of CREB-occupied genes are responsive to a cAMP elevation (226). Interestingly, this small proportion of cAMP-responsive genes are not regulated by Ser133 phophorylated CREB alone but appear to also require the preferential recruitment of regulatory partners that promote productive interactions with co-activators (226). Thus, it is likely that cAMP-induced GnRH-II promoter activation involves the coordination of a multi-component complex including p-CREB and its potential co-activators. In this context, both CBP and C/EBP have been documented to enhance transcription through interactions with p-CREB and to facilitate activation of the basal and induced transcription machinery (24, 215, 227, 228). Phosphorylation of CREB at Ser133 also triggers the KID-mediated recruitment of the transcriptional co-activator CBP or its paralogue p300 via their KIX domain (229-232), which reduce the free energy required for p-CREB to bind other co-regulatory proteins (233). The C/EBP members may form heterodimers with both bZIP and non-bZIP factors (234). For instance, CEBP/ may associate through its C-terminal region with the Q1 domain of CREB (213) or it may bind CBP/p300 (235). In addition, C/EBP may attract CBP to CREB, thereby creating a stronger CREB: C/EBP: CBP transcription complex. The relationship between C/EBP and CREB seems to be synergistic, enhancing the activities of both proteins. The C/EBP gene promoter contains a CRE motif, and its transcription can be mediated by CREB and enforced by C/EBP through its association with CREB (236). Our results suggest that C/EBP is a potential co-regulator of p-CREB that is recruited robustly to the GnRH-II 38  promoter CRE within 2 h of 8-bromo cAMP stimulation in JEG-3 and OVCAR-3 cells. By contrast, p-CREB and CBP interactions occur more progressively over a 2 -16 h time-frame, and this is reflected in a slower recruitment of CBP at the CRE region of the GnRH-II promoter after stimulation of the cells by 8-bromo cAMP. The critical importance of each of these factors in mediating the 8-bromo cAMP induced increases in GnRH-II promoter activity in JEG-3 and OVCAR-3 cells was further demonstrated in specific knock-down experiments, and supports the concept that together they are critical components of a multi-protein complex that is assembled at the GnRH-II promoter CRE to mediate cAMP-signaling in these cancer cells. Both CREB and p-CREB may bind to full-site palindromic (TGACGTCA) or half-site (CGTCA/TGACG) CREs of target genes in a cell-type dependent manner (208, 222, 226). The CRE within the GnRH-II promoter has been shown to modulate its expression (9), and we have demonstrated that p-CREB, CBP and C/EBP are all tethered at the CRE region of the GnRH-II promoter in OVCAR-3 and JEG-3 cells by using ChIP assays. In addition, our ChIP data indicate that loading of p-CREB onto the CRE of the GnRH-II promoter in un-stimulated cells is minimal, and this further supports a dynamic model for p-CREB association with the GnRH-II promoter after cAMP stimulation. Recruitment of essential coactivators (such as CBP or p300) to the CREB-CRE complex is greatly enhanced by the phosphorylation of CREB (221, 237, 238). Although p-CREB and/or C/EBP may bind as homo- or hetero-dimers to the typical palindromic CRE motif (TGACGTCA) (239, 240), the CRE within the GnRH-II promoter is atypical. It is therefore possible that p-CREB and/or C/EBP might occupy different sites within the GnRH-II promoter and then undergo a physical interaction that could lead to further recruitment of other nuclear proteins such as CBP. In support of the latter possibility, p-CREB binds to an atypical CRE  39  within the phosphoenolpyruvate carboxykinase promoter while C/EBP is recruited to a separated site and then interacts with the CRE-bound p-CREB (241). Moreover, there is considerable evidence from genome-wide studies of CREB target genes (226, 242) and expression profiling of C/EBP target genes (243), that both proteins may recruit additional regulatory proteins to enhance transcription. This is consistent with our observation that rapid binding of p-CREB is followed by a robust association of C/EBP at the CRE within the GnRHII promoter in OVCAR-3 and JEG-3 cells, and that this is followed by the progressive recruitment of CBP to the same site over a longer time-frame. Taken together, our data indicate that the classical cAMP/PKA signal transduction pathway enhances the formation of a p-CREB: C/EBPCBP transcription complex. This complex appears to target the CRE in the human GnRH-II proximal promoter and controls its activity in ovarian and placental carcinoma cells. More importantly, our data suggest that pCREB, C/EBP, and CBP are recruited to the CRE of the GnRH-II promoter in a temporarilydefined manner to enhance its transcription in JEG-3 and OVCAR-3 cells in response to cAMP (Fig. 2.8).  40  FIG. 2.1. 8-bromo cAMP induced GnRH-II transcriptional activity. T-3 cells (A), TE671 cells (B), OVCAR-3 cells (C) and JEG-3 cells (D) were treated with 1 mM cAMP for 8 h and 24 h after transient transfection with a GnRH-II promoter luciferase construct together with a (RSV)-lacZ plasmid. Cell lysates were collected for luciferase assay and measurements of -galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/-galactosidase activity (i.e., relative luciferase activity) of three independent experiments. * p<0.05 compared to untreated control (ctrl).  41  FIG 2.2. 8-bromo cAMP enhanced GnRH-II promoter activity and GnRH-II mRNA levels in a time-dependent manner in JEG-3 and OVCAR-3 cells. JEG-3 (A, C) and OVCAR-3 cells (B, D) were treated with 8-bromo cAMP for different times or increasing doses of cAMP (C, D) after transient transfection with a GnRH-II promoter luciferase construct together with a (RSV)-lacZ plasmid. In parallel experiments, total RNA was isolated after the administration of 8-bromo cAMP for 8 h, 16 h, 24 h and subjected for RT-qPCR to evaluate the effect of cAMP on GnRH-II mRNA levels expressed as fold changes over control (ctrl) levels in JEG-3 (E) and OVCAR-3 (F) cells. In addition, a similar experiment was performed in which the PKA inhibitor, H89, was co-treated in the presence or absence of 8-bromo cAMP or forskolin in JEG-3 (G) and OVCAR-3 (H) cells. In A, B, C, D, G and H, cell lysates were collected for luciferase assay and measurements of -galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/-galactosidase activity (i.e., relative luciferase activity) of three independent experiments. * p<0.05 compared to untreated control (ctrl). # p<0.05 compared to cAMP and forskolin treated group.  42  FIG. 2.3. Regulation of CREB phosphorylation at Ser133 by 8-bromo cAMP. Upper panel illustrates the levels of p-CREB, total CREB (CREB) and -actin determined by Western blotting after the administration of 8-bromo cAMP at different time points (2, 4, 8, 16 and 24 h) in JEG-3 (A) and OVCAR-3 cells (B). The lower panel is the integrated optical density (IOD) of p-CREB levels after normalization with total CREB. Results are expressed as mean  SEM of three independent experiments. * p<0.05 compared to untreated control (ctrl).  43  FIG. 2.4. Interaction of CBP and C/EBPwith p-CREB increases after 8-bromo cAMP treatment. JEG-3 (A) and OVCAR-3 cells (B) were treated with 8-bromo cAMP for different times. Cell lysates were immuno-precipitated (IP) with p-CREB antibody. The immuno-precipitates were then probed with CBP, C/EBP, C/EBP and SF-1 antibodies. Reciprocal immuno-precipitation (IP) was conducted upon 8-bromo cAMP treatment of JEG-3 cells (C) and OVCAR-3 cells (D) for 8 or 16 h, cell lysates were immuno-precipitated with CBP or C/EBP antibody, and the IPs were Western blotted probed with pCREB antibody. Western blots are representative data of IP and reciprocal IP from three independent experiments.  44  FIG. 2.5. Requirement of CREB, CBP and C/EBP in 8-bromo cAMP-mediated GnRH-II promoter activation. JEG-3 and OVCAR-3 cells were transfected with GnRH-II-luciferase reporter construct together with 150 nM random siRNA controls (s-ctrl) or siRNAs for CREB (A), CBP (B), C/EBP (C), respectively. The cells were then treated with 8-bromo cAMP for 24 h. The efficiency of the siRNA was tested by immunoblotting for CREB (67.5% knockdown), CBP (88.5% knockdown) or C/EBP(70% knockdown), respectively (upper panel). Cell lysates were also assayed for luciferase activity and measurements of -galactosidase activity as a control for transfection efficiency, the result of which are expressed as mean  SEM luciferase activity/-galactosidase activity (i.e., relative luciferase activity) of three independent experiments. * p<0.05 compared to cells treated with an siRNA control (sictrl). # p<0.05 compared to cells treated with respective siRNAs and followed by 8-bromo cAMP treatment.  45  FIG. 2.6. Involvement of CREB, CBP and C/EBP in 8-bromo cAMP-mediated changes in GnRHII mRNA levels in JEG-3 and OVCAR-3 cells. Cells were transfected with 150 nM random siRNA controls (si-ctrl) or siRNAs for CREB (A), CBP (B), C/EBP (C), respectively, and then treated with 8bromo cAMP for 16 h. The efficiency of the siRNAs was tested by immunoblotting for CREB (67.5% knockdown), CBP (88.5% knockdown) or C/EBP(70% knockdown), respectively (Fig. 5). Total RNA was isolated and cDNA was used in RT-qPCR to evaluate the effect of cAMP on GnRH-II mRNA levels expressed as fold changes over control (ctrl) levels in untreated JEG-3 and OVCAR-3 cells. * p<0.05 compared to cells treated with a siRNA control (si-ctrl). # p<0.05 compared to cells treated with respective siRNAs and followed by 8-bromo cAMP treatment.  46  FIG. 2.7. Association of p-CREB, C/EBP and CBP with the CRE region of GnRH-II promoter is increased by 8-bromo cAMP treatment. Chromatin immuno-precipitation (ChIP) analysis was performed as described in Materials and Methods. JEG-3 (A) and OVCAR-3 cells (B) were treated with 1 mM 8-bromo cAMP for 1 h, 2 h or 4 h, or were untreated (ctrl). Cross-linked, sheared chromatin was immuno-precipitated (IP) with p-CREB, C/EBPor CBPantibodies, and recovered chromatin was subjected to PCR analysis using primers spanning the CRE region of the GnRH-II promoter. The IgG lanes are ChIPs performed using non-specific IgG. An ethidium bromide-stained gel of PCR products shows a representative of ChIP analysis from three independent experiments.  47  FIG 2.8. Proposed model for CRE-mediated GnRH-II gene transcription. The classical cAMP/PKA signal transduction pathway enhances the formation of a p-CREB: C/EBPCBP transcription complex. This complex appears to target the CRE in the human GnRH-II proximal promoter and controls its activity in ovarian and placental carcinoma cells. p-CREB, phosphorylated cAMP responsive binding protein; C/EBPβ, CCAAT/enhancer binding protein beta; CBP, CREB binding protein; CRE, cAMP responsive element.  48  CHAPTER 3.  Epidermal growth factor induced GnRH-II synthesis  contributes to ovarian cancer cell invasion2 3.1 Introduction The two gonadotropin-releasing hormones (GnRH-I and GnRH-II) and the GnRH receptor (GnRHR) have been detected in human ovarian surface epithelial cells and ovarian cancer cell lines (48), and these GnRH subtypes regulate the growth (58, 66, 70) and metastatic activity (71, 78) of ovarian cancer cells. Despite advances in our knowledge of the functional role of GnRH-II in ovarian cancer, the endocrine regulation of GnRH-II expression in ovarian cancer cells is poorly understood. In female reproductive tumor cell lines, studies of cell signaling have focused on the cAMP-mediated activation of protein kinase A (PKA) and the subsequent phosphorylation-dependent activation of CREB (53). Elevated phosphorylated CREB  (p-CREB)  recruits  the  co-regulators,  CREB  binding  protein  (CBP)  and  CCAAT/enhancer binding protein β (C/EBPβ), and increases the cAMP responsive element (CRE)-dependent expression of the GnRH-II gene in a coordinated and temporally-defined manner (53). Additional cis-regulatory regions, including a minimal promoter region that includes two enhancer elements (E-boxes); an ETS-like element in the un-translated exon 1(10), and a NFκB recognition site in the first intron (12) of the human GnRH-II gene, have also been identified. In ovarian carcinoma cells, EGF and EGF-related peptides function as autocrine growth factors (244). The EGF receptor (EGFR) also plays a role in cancer cell biology and is a key therapeutic target in ovarian cancer (122). Classical EGFR signal transduction is initiated by ligand binding to its extracellular domain, which leads to a conformational change in the receptor and induces its homodimerization or heterodimerization with other EGFR family 2  A version of this chapter has been published. Poon SL, Hammond GT, Leung PC 2009 Mol Endocrinol, 23(10):1646-56.  49  members (130, 245). Ligand-induced EGFR dimerization allows trans-phosphorylation of specific tyrosine residues that serve as docking sites for intracellular signaling molecules (122), thereby stimulating the receptor's intrinsic tyrosine kinase activity (246). Each EGF receptor is capable of recruiting a specific subset of adapter proteins and signaling molecules, such as Ras/Raf1/mitogen-activated protein (MAP) kinase and PI3K/Akt, which subsequently activate downstream mediators to stimulate cell proliferation, invasion and angiogenesis (129-131). Gene amplification, genetic mutation, and altered transcription or translation result in aberrant EGFR expression that contributes to malignant transformation (247, 248), poor prognosis and decreased therapeutic responsiveness in ovarian cancer patients (120, 249, 250). Thus, anticancer agents targeting the EGFR or its downstream signaling/target genes hold great promise. In the present study, we sought to determine whether EGF regulates the expression of GnRH-II in ovarian cancer cells. Our results demonstrate that EGF treatment of OVCAR-3 cells increases GnRH-II promoter activity and GnRH-II mRNA levels through the autophosphorylation of EGFR and the activation of ERK1/2/p-CREB/C/EBPβ signaling. The stimulatory effect of EGF was observed in three human ovarian cancer cell lines (OVCAR-3, CaOV-3 and SKOV-3 cells), and this increase in GnRH-II by EGF promotes the EGF-induced invasiveness of ovarian cancer cells, suggesting that GnRH-II is a novel downstream target of EGF in ovarian cancer cell tumorigenicity.  3.2 Materials and methods Cells and cell culture The human ovarian adenocarcinoma cell lines, OVCAR-3, CaOV-3 and SKOV-3 were obtained from Ameriacan Type Culture Collection (Manassas, VA, USA). The cells were maintained in M199/MCDB105 (Invitrogen Inc., Burlington, ON, Canada) supplemented with 50  10% fetal bovine serum (FBS; Hyclone Laborataries Inc., Logan, UT, USA). Cultures were maintained at 37 C in a humidified atmosphere of 5% CO2. The cells were sub-cultured when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.5 mM EDTA).  Antibodies and reagents The polyclonal β-actin antibody and polyclonal C/EBPβ antibody were obtained from Santa  Cruz  Biotechnology  (Santa  Cruz,  CA).  The  monoclonal  phospho-ERK1/2  (Thr202/Tyr204) antibody, polyclonal total ERK1/2 antibody, polyclonal total EGFR and monoclonal phosphor-CREB (Ser133) antibody were obtained from Cell Signaling Technology (Danvers, MA). The monoclonal GnRHR antibody was obtained from Neomarkers (Fremont, CA), horseradish peroxidase-conjugated goat anti-mouse IgG and goat anti-rabbit IgG were obtained from Bio-Rad Laboratories (Hercules, CA). Horseradish peroxidase-conjugated donkey anti-goat IgG was obtained from Santa Cruz. GnRH-II analog (DArg6-Azagly10-GnRH-II) was purchased from Bachem (Belmont, CA). Human epidermal growth factor (EGF) and EGFR inhibitor (AG1478) were obtained from Sigma. MAPK inhibitor (PD98059 and U0126) was obtained from Calbiochem (San Diego, CA).  Plasmid construction and reporter gene assays The GnRH-II promoter-driven luciferase reporter gene construct was generated by PCR amplification of human genomic DNA using sequence-specific primers designed to amplify 2 kb upstream of the 5´ flanking region in GnRH-II promoter and followed by its subsequent cloning into the promoter-less pGL2-Basic vector (Promega, Madison, WI, USA) (10). Mutation of the CRE within the GnRH-II promoter was generated using the GnRH-II promoterdriven luciferase construct as template by the Quickchange II XL site directed mutagenesis kit 51  (Stratagene, La Jolla, CA, USA), and the following oligonucleotide primers: forward, 5´CTCTCTTCCCCTCTGAAGATACCACTGGAGTCTGGGGGTG CACCCCCAGACTCCAGTGGTATCTTCAGAGGGGAAGAGAG.  and The  reverse,  5´-  product  was  sequenced to verify that only the desired mutation had occurred during the mutagenesis reaction. Transient transfections were carried out using Lipofectamin 2000 Reagent (Invitrogen Inc., Burlington, ON, Canada) following the manufacturer’s protocol. To correct for transfection efficiencies, the Rous sarcoma virus (RSV)-lacZ plasmid was co-transfected into the cells with the GnRH-II promoter-driven luciferase reporter gene construct. Briefly, 5 x 105 cells were seeded into six-well tissue culture plates the day before transfection. The GnRH-II promoterdriven luciferase reporter gene construct (1 μg) and 0.5 μg RSV-lacZ plasmid were cotransfected into cells grown in standard culture medium containing FBS. In some experiments, 150 nM siCREB or a control siRNA oligonucleotide (Qiagen Inc., Mississauga, ON, Canada) were co-transfected with the reporter plasmids. After 6 h, 2 ml of serum free medium was added and the cells were further incubated overnight (18 h). The culture medium was then removed and the cells were treated with EGF or 8-bromo cAMP, respectively in serum free medium for the times indicated. Cellular lysates were collected with 150 μl reporter lysis buffer (Promega) and assayed for luciferase activity. The β-Galactosidase Enzyme Assay System (Promega) was used to measure expression from the (RSV)-lacZ plasmid, and promoter activities were expressed as luciferase activity/β-galactosidase activity.  Reverse transcription quantitative real-time PCR (RT-qPCR) After treatment with 8-bromo cAMP, medium was removed from the culture dish and RNA was extracted using Trizol (Invitrogen). The RNA concentration was measured based on the absorbance at 260 nm, and its integrity was confirmed by agarose-formaldehyde gel electrophoresis. Total RNA (2.5 μg) was reverse-transcribed into cDNA using a first-strand 52  cDNA synthesis kit (GE Healthcare Bio-Science, Piscataway NJ, USA) following the manufacturer’s procedure. The primers used for RT-qPCR were designed using Primer Express Software v2.0 (Applied Biosystems, Foster City, CA, USA). The primers for GnRH-II mRNA are: sense, 5´-CTGCTGACTGCCCACCTT; and antisense, 5´-GCTTTCCTCCAGGGTACCAG. The primers for GAPDH are: sense, 5'-GAGTCAACGGATTTGGTCGT; and antisense, 5´GACAAGCTTCCCGTTCTCAG. The reactions were set up with 16.5 μl SYBR Green PCR Master Mix (Applied Biosystems). All RT-qPCR experiments were run in triplicate and a mean value was used for the determination of mRNA levels. Negative controls containing water instead of sample cDNA were used in each experiment. Relative quantification of the mRNA levels of GnRH-II was performed using the comparative Cq method with GAPDH as the reference gene and with the formula 2-ΔΔCq.  Nuclear protein extraction, Western blotting and immunoprecipitation Briefly, cells were washed with ice-cold PBS and harvested with 1 ml solution A (10 mM Hepes, pH 7.9, 10 mM KCl, 10 mM EDTA, 0.5 mM dithiothreitol, 1 µg/ml aprotinin, and 1 µg/ml protein inhibitor cocktail). Cell lysates were transferred to 1.5 ml centrifuge tubes and placed in an orbital rocker for 10 min at 4 C. Nuclear pellets were obtained by centrifugation at 14,000 g at 4 C for 10 min, and supernatants were collected for cytoplasmic protein. Nuclear pellets were re-suspended in solution B (100 mM HEPES, pH 7.9, 2 M NaCl, 5 mM EDTA, 50% Glycerol) and placed in an orbital rocker for 2 h at 4 C. After centrifugation at 14,000 g at 4 C for 5 min, supernatants containing the nuclear protein extracts were removed. The nuclear extracts were then subjected to electrophoresis on an 8% SDS-PAGE gel and Western blotted for detection with appropriate antibodies. Immunoprecipitation was conducted as follows: nuclear extracts were incubated with pCREB antibody (10 ug/ml) followed by the antibody capture affinity ligand provided by the 53  immunoprecipitation kit (Upstate, MA, USA) at 4 C overnight. The immuno-precipitated proteins were then subjected to electrophoresis on an 8% SDS-PAGE gel and detected with appropriate antibodies after Western blotting.  Chromatin immuno-precipitation (ChIP) All reagents, buffers and supplies were included in a ChIP-ITTM kit (Active Motif, Inc., Carlsbad, CA). Briefly, the cells were cross-linked with 1% formaldehyde for 10 min at room temperature. After washing and treatment with glycine Stop-Fix solution, the cells were resuspended in lysis buffer and incubated for 30 min on ice. The cells were homogenized and nuclei were re-suspended in shearing buffer, and subjected to pre-optimized ultrasonic disruption conditions to yield 100-500 bp DNA fragments. The chromatin was pre-cleared with Protein G beads and incubated (overnight at 4 C) with 1 µg of the following antibodies: negative control mouse IgG (Active Motif), p-CREB antibody (Cell Signaling). Protein G beads were then added to the antibody/chromatin incubation mixtures and incubated for 1.5 h at 4 C. After extensive washing, the immuno-precipitated DNA/protein complex was removed from the beads by elution buffer. To reverse cross-links and remove RNA, 5 M NaCl and RNase were added to the samples and incubated at 65 C for 4 h. The samples were then treated with proteinase K for 2 h at 42 C and the DNA was purified using gel exclusion columns. The purified DNA was subjected to PCR amplification (1 cycle of 94 C for 3 min; 40 cycles of 94 C for 20 sec; 64 C for 30 sec and 72 C for 30 sec) for the CRE site (-860/-853 bp) within the GnRH-II promoter using specific  forward,  5´-CCAGCCTAAAGCAAGAGTCC  and  reverse,  5´-  GTCTATAAATCCTGGGGCCA primers. As an input control, 10% of each chromatin preparation was used. The PCR products (213 bp) were resolved by electrophoresis in a 2.5% agarose gel and visualized by ethidium bromide staining (53). The ChIP assay was performed at least three times, and consistent data were obtained between experiments. 54  Invasion assay The invasion assay was performed in Boyden chambers with minor modifications (251). Filters (8 μm pore size, 24 wells, BD Biosciences) were coated with 40μL of 1 mg/ml growthfactor reduced Matrigel (BD Biosciences). Cells in M199/MCDB105 medium supplemented with 0.1% FBS were incubated for 48 h against a gradient of 10% FBS for OVCAR-3 cells and 5% FBS for CaOV-3 and SKOV-3 cells. Cells that penetrated the membrane were fixed with ice-cold methanol, stained with Hoechst 33258 (Sigma), and the number of nuclei was counted using Northern Eclipse 6.0 software from Empix Imaging (Mississauga, ON, Canada). Each treatment was done in duplicate and five microscopic fields were counted per Boyden chamber.  Data analysis Reporter gene assays and real time PCR data are shown as the mean ± SEM of three independent experiments. Data were analyzed by one-way ANOVA, followed by Tukey test using the computer software PRISM (GraphPad Software Inc., San Diego, CA, USA). Values were considered significantly different from each other at p < 0.05.  3.3 Results EGF stimulates GnRH-II expression in OVCAR-3, CaOV-3 and SKOV-3 cells When treated with EGF, 2-3 fold increases in GnRH-II mRNA levels were observed in OVCAR-3 (Fig. 3.1A), CaOV-3 (Fig. 3.1B) and SKOV-3 (Fig. 3.1C) cells. While EGF specifically induced the expression of GnRH-II in these cell lines, it had no effect on GnRH-I or GnRHR mRNA levels after 24 h treatment. However, by treating all three cell lines with EGF for 2, 4, 8, 16, and 24 h, we observed a modest increased in GnRHR protein levels after 8 h treatment in OVCAR-3 and CaOV-3 cells, but not in SKOV-3 cells (Fig. 3.1D). In addition, increased GnRHR levels returned to the pre-treatment levels after 24 h in both OVCAR-3 and 55  CaOV-3 cells (Fig. 3.1D). Using OVCAR-3 cells as our model, EGF treatment increased the activity of a GnRH-II promoter-driven luciferase reporter gene in a concentration-dependent manner (Fig. 3.2A). Blocking downstream signaling by using the EGF receptor inhibitor, AG1478, abolished the EGF-induced GnRH-II promoter-driven luciferase reporter gene activity (Fig. 3.2B), as well as GnRH-II mRNA levels in OVCAR-3 cells (Fig. 3.2C), suggesting that the effect of EGF on GnRH-II regulation is EGF receptor-dependent.  EGF induces the MAPK pathway to enhance phosphorylation of CREB and its interaction with C/EBPβ upon EGFR activation Treatment of OVCAR-3 cells with EGF induced phosphorylation of EGFR at tyrosine 992 and tyrosine 1045 (Fig. 3.3A) but not at tyrosine 1068 (data not shown). In addition, EGF very rapidly induces the phosphorylation of ERK1/2 with a maximum response at 15 min (Fig. 3.3B), suggesting that MAPK signaling may be involved in the regulation of GnRH-II expression in OVCAR-3 cells. The transcription factor CREB is a target of MAPK signaling (252), and is necessary for the regulation of GnRH-II gene expression (53). Western blot results indicate that CREB phosphorylation not only occurs very rapidly (within 10 min) but remains elevated for up to 8 h (Fig 3.3C). Thus, we examined whether EGF-induced MAPK signaling results in the phosphorylation of CREB. We used a pharmacological inhibitor (PD98059) to block EGF-induced ERK1/2 signaling and examined the status of p-CREB (Fig 3.3D). The results of these Western blotting experiments indicate that EGF rapidly induced CREB phosphorylation within 2 h, and that pre-treatment with PD98059 attenuated EGF-induced phosphorylation of CREB in OVCAR-3 cells (Fig. 3.3D). Previously, we demonstrated that an increase of p-CREB recruits C/EBPβ and upregulates GnRH-II transcription (53). Using immunoprecipitation, we have shown that the administration of 100 ng/ml EGF to OVCAR-3 cells enhances the association of p-CREB with 56  C/EBP (Fig. 3.3E). More importantly, the EGF-induced interaction between p-CREB and C/EBP was markedly reduced upon pre-treatment with U0126, a pharmacological agent that specifically inhibits p-ERK1/2 signal transduction pathways (Fig. 3.3E).  EGF induced phosphorylation of CREB activates the cAMP responsive element (CRE) within the GnRH-II promoter To determine whether EGF-induced p-CREB in OVCAR-3 cells targets the CRE region within the GnRH-II promoter, a chromatin immuno-precipitation (ChIP) assay was performed. Cross-linked, sheared chromatin from EGF-treated OVCAR-3 cells was immuno-precipitated with p-CREB antibody, and the recovered DNA was subjected to PCR using primers specific to the CRE region (-860/-853) of the GnRH-II promoter. As shown in figure 4A, a 213 bp PCR product was amplified from p-CREB-immuno-precipitated DNA samples in OVCAR-3 cells treated with EGF, and this was already evident after 1 h, and is increased at 2-4 h of EGF stimulation (Fig. 3.4A). By contrast, little or no PCR product was observed with DNA recovered when control IgG was used for the immuno-precipitation or cells untreated with EGF. These data reveal a specific association between p-CREB at the CRE region of the GnRH-II promoter in OVCAR-3 cells after treatment with EGF and that this occurs in a temporally-defined manner. A specific siRNA oligonucleotide was used to knock down endogenous CREB levels to verify its involvement in GnRH-II expression in OVCAR-3 cells (Fig. 3.4B). In this experiment, EGF induced GnRH-II promoter activity in cells co-transfected with control siRNA, while cotransfection with CREB specific siRNA compromised this effect of EGF (Fig. 3.4C). To further verify that the CRE within the GnRH-II promoter is sufficient for EGF-regulated GnRH-II expression, we mutated 3 bp within the CRE (wild type CRE: agacgtca; mutated CRE: agatacca) of the GnRH-II promoter-driven luciferase reporter gene. Transfection of the mutated reporter  57  gene in OVCAR-3 cells resulted in a 35% decrease in basal GnRH-II promoter activity. Moreover, while treatment with 1mM cAMP led to a significant increase in the wild-type GnRH-II promoter-driven luciferase reporter gene, it had no effect in cells transfected with the CRE-mutated version of the same reporter construct. In a parallel experiment, 100 ng/ml EGF induced the activation of the wild-type GnRH-II promoter, but this stimulation was reduced by 70% when we mutated the CRE within the GnRH-II promoter (Fig. 3.4D). These results indicate that the CRE we have examined is important for basal GnRH-II promoter activity, and that EGF exerts most of its effects through this particular cis-acting element to enhance the transcription of GnRH-II in OVCAR-3 cells.  EGF and GnRH-II act additively to enhance ovarian cancer cell invasion As a strong mitogen, EGF enhances cell motility and induces secretion of proteolytic enzymes to increase the invasiveness in ovarian cancer cells (24, 253). To evaluate the effect of EGF-induced GnRH-II expression in ovarian cancer cells, OVCAR-3 cells, CaOV-3 cells and SKOV-3 cells were treated with 100 ng/ml EGF or 10 nM GnRH-II for 24 h prior to an invasion assay. In these experiments, EGF-treated cells exhibited increased invasiveness as compared with their untreated controls. Interestingly, in the GnRH-II treated group, only OVCAR-3 cells (Fig 3.5A) and CaOV-3 cells (Fig. 3.5B) showed 20 fold and 2 fold increases in their invasiveness, respectively, as compared to the controls, whereas SKOV-3 cells did not respond (Fig. 3.5C). When we used Western blotting to check the expression of the GnRHR in all three cell lines, we found that the expression of GnRHR in SKOV-3 cells is lower than in OVCAR-3 and CaOV-3 cells (Fig. 3.5D), and this suggests that ovarian cancer cells respond to GnRH-II treatment in relation to their GnRHR content. More importantly, to evaluate whether GnRH-II acts in concert with EGF to enhance the invasiveness of ovarian cancer, we co-treated all three cell lines with EGF and GnRH-II, and the results imply that these two agents have an additive 58  effect on the invasiveness of OVCAR-3 (Fig. 3.5A) and CaOV-3 cells (Fig. 3.5B), while GnRHII has no additive effect on the EGF-induced invasiveness in SKOV-3 cells (Fig. 3.5C). In addition, we confirmed that the expression of GnRHR was not regulated by GnRH-II (Fig. 3.5E) treatment but found that a small but consistent transient increase in GnRHR levels after EGF treatment only in OVCAR-3 and CaOV-3 cells (Fig. 3.1D), suggesting that EGF not only upregulates GnRH-II mRNA levels but also transiently increases the GnRHR levels, which would likely further enhance EGF/GnRH-II-induced invasion in ovarian cancer cells.  EGF-induced GnRH-II production enhances the invasiveness of ovarian cancer cells To further explore the possibility that EGF-induced synthesis of GnRH-II acts in an autocrine manner to increase the invasiveness of ovarian cancer cells, a siRNA approach used to knock down the endogenous levels of GnRHR in OVCAR-3 cells and CaOV-3 cells. The transfected cells were then treated with 100 ng/ml EGF or 10 nM GnRH-II for 24 h prior to an invasion assay. This demonstrated that depletion of GnRHR in OVCAR-3 (Fig. 3.6A) and CaOV-3 (Fig. 3.6B) cells inhibited the GnRH-II induced invasion as compared with cells transfected with a scrambled siRNA control. More importantly, the siRNA-mediated knock down of GnRHR levels in these two cell lines also partially abolished EGF-induced invasion, further confirming that GnRH-II/GnRHR signaling is involved in the EGF-induced invasion of OVCAR-3 and CaOV-3 cells.  3.4 Discussion It is becoming increasingly apparent that GnRH-II acts as an autocrine/paracrine regulator in non-pituitary tissues in addition to its role in the regulation of gonadotropin synthesis and steroid hormone production (52, 177), and is an important player in cancer cell biology (71). Ovarian cancer cells also express the EGFR, and EGF is a critical mitogen 59  involved in the differentiation of normal ovarian surface epithelial cells and the motility of ovarian cancer cells (47, 129). In the present studies, we demonstrate for the first time that GnRH-II expression is regulated by EGF activation of its receptor and the ERK1/2/pCREB/C/EBPβ intracellular signaling pathway in an ovarian cancer cell model. More importantly, we have obtained evidence that EGF–stimulated GnRH-II expression constitutes a specific autocrine/paracrine loop that contributes to ovarian cancer motility. As observed by others (168, 254, 255), EGFR activation in OVCAR-3 cells stimulates the classical MAPK/ERK1/2 pathways. Treatment of OVCAR-3 cells with EGF elicits the autophosphorylation of the EGFR at tyrosine 992 and tyrosine 1045, whereas tyrosine 992 is a target of the MAP kinase cascade. It is known that activation of the MAP kinase cascade and the subsequently phosphorylation and translocation of ERK1/2 activates transcription factors, including NFκB, HIF-1α and CREB, resulting in increases in the transcription of pro-invasive genes such as VEGF or COX-2 (3, 256, 257). In our experiments, we have found that pretreatment of OVCAR-3 cells with the EGFR inhibitor, AG1478, abolishes EGF/EGFR downstream signaling, and that this inhibits the EGF-induced activation of a GnRH-II promoter and increases GnRH-II mRNA levels. Interestingly, EGF treatment of OVCAR-3 cells leads to increased ERK1/2 phosphorylation for up to 2 h, and others have noted that such a prolonged phosphorylation of ERK1/2 results in its increased nuclear retention (258-260). Thus, it is plausible that EGF treatment of OVCAR-3 cells prolongs the nuclear retention of activated ERK, and leads to an up-regulation of GnRH-II expression in ovarian cancer cells. It is widely accepted that CREB plays a critical role in GnRH-II expression through the transcriptional activation of the GnRH-II promoter (53). In this study, we present evidence that EGF treatment causes phosphorylation of CREB at serine133 and increases its interaction with C/EBPβ, and that these steps are required for recruitment of the transcriptional co-activator CBP (227, 261), as well as the transcriptional activation of the GnRH-II promoter. In OVCAR-3 cells, 60  treatment with EGF enhanced CREB phosphorylation for up to 8 h, and this is correlated with the loading of p-CREB at the CRE within GnRH-II promoter, and an increase in GnRH-II promoter activity and GnRH-II mRNA levels, which are both maximal at 16 h ~ 24 h. It is also known that the phosphorylation of ERK can lead to the activation of RSK and MSK signaling and thereby stimulate the translocation of phosphorylated CREB (252) or phosphorylated C/EBPβ (262, 263). It was therefore of interest that blockade of EGF-induced ERK1/2 activation with a selective MAPK inhibitor (PD98059) was sufficient to block the phosphorylation of CREB, as demonstrated by Western blotting, as well as the transcriptional activation of a GnRH-II promoter-driven luciferase reporter gene (data not shown) in OVCAR-3 cells. In addition, treatment with another potent ERK1/2 inhibitor (U0126) markedly reduced the EGF-induced interaction of p-CREB with C/EBPβ in OVCAR-3 cells. Thus, it appears that ERK activation is required for the phosphorylation of CREB and its interaction with C/EBPβ, and this will contribute to its subsequent effects on the transcriptional activation of the GnRH-II gene after treatment of ovarian cancer cells with EGF. The GnRH-II gene is regulated by several cis-acting elements within its promoter sequence (2), including an CRE (agacgtca) at nucleotide sequence -860 to -853 bp relative to the translation start site in the GnRH-II promoter, which responds to cAMP analogs in human TE671 neuroblastoma cells (9) and human reproductive cancer cells (53). This CRE from the GnRH-II promoter has been shown to bind p-CREB/CBP/C/EBPβ under 8-bromo cAMP stimulation (53). Currently, our studies suggest that this CRE is one of the key cis-acting elements that respond to EGF stimulation. This was verified when this CRE was mutated within the GnRH-II promoter, and resulted in a blockade of EGF-induced GnRH-II promoter activity. Furthermore, we used a ChIP assay to demonstrate the mechanisms of EGF-regulated CREmediated effects within the GnRH-II promoter. In this context, EGF-induced tethering of pCREB at the CRE region of the GnRH-II promoter in OVCAR-3 cells, while loading of p61  CREB onto the CRE of the GnRH-II promoter in un-stimulated cells was minimal: a finding that supports a dynamic model for p-CREB association with the GnRH-II promoter after EGF stimulation. The critical importance of p-CREB in mediating EGF-induced increases in GnRHII promoter activity in OVCAR-3 cells was further demonstrated in specific knock-down experiments, which further support the concept that p-CREB is a critical component that assembles at the GnRH-II promoter CRE after the EGF treatment of OVCAR-3 cells. It is known that EGF and EGF-like peptides including transforming growth factor-α and amphiregulin are present in the majority of human ovarian carcinoma cells (244, 264-266). The ultimate goal of this study was to determine whether the regulation of GnRH-II by EGF is physiologically relevant to ovarian cancer cell invasiveness. Our initial experiment demonstrated that EGF induced GnRH-II mRNA levels in all three ovarian cancer cell lines (OVCAR-3, CaOV-3 and SKOV-3), and we wanted to know whether this increase of GnRH-II expression enhanced EGF-induced invasiveness in these cell lines. In support of this, we found that treatment with exogenous GnRH-II acts additively with EGF to promote the invasiveness of OVCAR-3 and CaOV-3 cells but not SKOV-3 cells. We also confirmed that neither GnRH-I or GnRH-II have any effect on SKOV-3 cell invasiveness (71), and we attributed this to the low GnRHR levels in SKOV-3 cells as compared with OVCAR-3 and CaOV-3 cells. Moreover, since the levels of GnRHR correlate with cancer grading and are elevated in advanced stage (stages III and IV) as compared to early stage (stages I and II) ovarian carcinomas (51), our findings support the clinical data and that GnRH-II promotes the EGF-induced invasiveness of ovarian cancer cells, and further corroborate the view that GnRH-II/GnRHR plays a crucial role in tumor progression/metastasis (71, 78). The EGF receptor is expressed in 33–75% of ovarian tumors. It is also frequently amplified and/or over-expressed in ovarian cancer cells, when compared to normal ovarian surface epithelial cells, and transfection with an antisense construct of EGF receptor into human 62  ovarian cancer cell lines suppresses their malignant phenotype (132-134). Among the three ovarian cancer cell lines we tested, SKOV-3 cells expressed the most EGFR whereas OVCAR-3 cells expressed the least EGFR; this reflects in line with the fact that SKOV-3 cells have the highest basal invasiveness while OVCAR-3 is the least invasive cell line. In addition, exogenous GnRH-II treatment acts additively with EGF to promote the invasive properties of OVCAR-3 and CaOV-3 cells, and GnRHR appears to be essential for this effect because siRNA-mediated down-regulation of the GnRHR completely blocked it. The down-regulation of the endogenous GnRHR also partially reduced the EGF-induced invasion in OVCAR-3 and CaOV-3 cells and this supports our hypothesis that GnRH-II signaling is involved in the EGF-induced invasiveness of ovarian cancer cells. More importantly, EGF induced a transient increase in GnRHR levels in OVCAR-3 and CaOV-3 cells and this could serve to further enhance EGF/GnRH-II-induced invasion in these two cell lines. By contrast, EGF treatment did not affect the GnRHR levels in SKOV-3 cells; thus confirming our results that there is no additive effect by EGF and GnRH-II on SKOV-3 cells invasion. In summary, our studies provide important insights into the molecular mechanism and physiological relevance of EGF-mediated GnRH-II expression in ovarian cancer. In this scenario (Fig. 3.7), we propose that EGF stimulation of ovarian cancer cells results in the autophosphorylation of the EGFR and induces ERK1/2 signaling, which subsequently enhances the phosphorylation of CREB and its binding with C/EBPβ. The dynamic tethering of p-CREB and C/EBPβ onto a CRE within the GnRH-II promoter then increases its transcriptional activity, and results in increased GnRH-II mRNA levels in ovarian cancer cells. This ultimately enhances their production and secretion of GnRH-II, which then participates in an autocrine/paracrine loop together with EGF to promote the invasiveness of ovarian cancer cells.  63  FIG. 3.1. EGF induces GnRH-II mRNA in ovarian cancer cell lines. (A) OVCAR-3 cells, (B) CaOV3 cells and (C) SKOV-3 cells were treated with 100 ng/ml of EGF for 24 h. Total RNA was isolated and cDNA was used in real-time PCR to evaluate the effect of EGF on GnRH-II, GnRH-I and GnRHR mRNA levels expressed as percentage over control (Ctrl) level. * p<0.05 compared to untreated control (Ctrl). (D) OVCAR-3 cells, CaOV-3 cells and SKOV-3 cells were treated with 100 ng/ml EGF for increasing times (2, 4, 8, 16, 24 h). Cells harvested were then subjected to Western blotting and probed for GnRHR. β-actin was used as a normalization control. Left panels were representative Western blots. Right panels were quantitative results from three independent experiments. * p<0.05 compared to untreated control (Ctrl).  64  FIG. 3.2. EGFR-dependent activation is required for the stimulation of GnRH-II expression in OVCAR-3 cells. (A) OVCAR-3 cells were treated with increasing concentraion of EGF after transient transfection with a GnRH-II promoter-driven luciferase reporter gene construct together with a (RSV)lacZ plasmid. (B) A similar experiment was performed in which 10 μM EGFR inhibitor, AG1478, was pre-treated for 30 min and then co-treated in the presence or absence of 100 ng/ml EGF in OVCAR-3 cells. Cell lysates were collected for luciferase assay and measurements of β-galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/βgalactosidase activity (i.e., GnRH-II promoter luciferase activity) of three independent experiments. (C) In parallel experiments, total RNA was isolated after the administration of AG1478 in the presence or absence of 100 ng/ml EGF for 24 h and subjected for RT-qPCR to evaluate the effect of EGF on GnRHII mRNA levels expressed as fold changes over control (Ctrl) levels in OVCAR-3 cells. * p<0.05 compared to untreated control (Ctrl). # p<0.05 compared to EGF treatment.  65  FIG. 3.3. EGF-activated ERK1/2 pathway is required for the phosphorylation of CREB and its interaction with C/EBPβ. (A) OVCAR-3 cells were treated with 100 ng/ml of EGF for different time slots (5, 15, 30, 60 min) or (2, 4, 8, 16, 24 h). Cells harvested were then subjected to Western blotting and probed for phosphorylated EGFR at different tyrosine (992 and 1045). (B, C) Nuclear lysates harvested from EGF treated cells were subjected to Western blotting and probed for phoshorylated ERK1/2 (p-ERK1/2) and phosphorylated CREB (p-CREB), respectively. (D) OVCAR-3 cells were pretreated with 20 μM PD98059 (selective MAPK inhibitor) for 30 mins and then co-treated in the presence or absence of 100 ng/ml EGF for 2 h or 4 h. Nuclear cell lysates were collected and the level of p-CREB was determined by Western blotting. Total EGFR (EGFR), total CREB (CREB), total ERK1/2 (ERK1/2) and β-actin were used as normalization control. Left panels showed representative Western blots. Right panels were quantitative results from three independent experiments. * p<0.05 compared to untreated control (Ctrl).(E) OVCAR-3 cells were pre-treated with 20 μM U0126 (selective MAPK inhibitor) for 30 min and then treated in the presence or absence of 100 ng/ml EGF for 2, 4 or 8 h. Nuclear cell lysates were collected and subjected to immunoprecipitation (IP) with p-CREB antibody, and the IPs were Western blotted with C/EBPβ antibody. The Western blot is representative of IPs from three independent experiments.  66  FIG. 3.4. EGF regulates the binding of p-CREB on CRE site in GnRH-II promoter. (A) OVCAR-3 cells were treated with 100 ng/ml EGF for 1 h, 2 h or 4 h, or were untreated (Ctrl). Cross-linked, sheared chromatin was immuno-precipitated (IP) with p-CREB and recovered chromatin was subjected to PCR analysis using primers spanning the CRE region of the GnRH-II promoter. The IgG lanes are ChIPs performed using non-specific IgG. An ethidium bromide-stained gel of PCR products shows a representative of ChIP analysis from three independent experiments. (B) The efficiency of the siRNA was tested by Western blotting for CREB (67.5% knockdown) in OVCAR-3 cells. (C) Cells were transfected with GnRH-II promoter-driven luciferase reporter gene construct together with 150 nM random siRNA controls (si-Ctrl) or siRNAs for CREB respectively, and then treated with 100 ng/ml EGF for 24 h. (D) OVCAR-3 cells were transfected with wild type GnRH-II promoter-driven lucifease reporter gene construct or a 3 bp mutated CRE-GnRH-II promoter-driven luciferase reporter construct followed by 100 ng/ml EGF or 1 mM cAMP treatment. Cell lysates were assayed for luciferase activity and measurements of β-galactosidase activity as a control for transfection efficiency, the result of which are expressed as mean  SEM luciferase activity/β-galactosidase activity (i.e., GnRH-II promoter luciferase activity) of three independent experiments.* p<0.05 compared to cells treated with a siRNA control (si-Ctrl). # p<0.05 compared to cells treated with specific CREB siRNA and followed by EGF treatment.  67  FIG. 3.5. GnRH-II acts additively with EGF to promote ovarian cancer cell invasion. (A) OVCAR3 cells (B) CaOV-3 cells and (C) SKOV-3 cells were treated with 100 ng/ml of EGF, 10 nM of GnRH-II or in combination for 24 h and then seeded into Matrigel-coated transwells and cultured for 48 h. Noninvading cells were wiped from the upper side of the filter and nuclei of invading cells were stained with Hoechst 33258. Left panel shows representative photos of invasion assay; right panel shows summarized quantitative results. Results are expressed as mean ± SEM of at least three independent experiments. *p<0.05 compared with untreated control (Ctrl). #p<0.05 compared with EGF or GnRH-II treatment. (D) The endogenous expression of GnRHR and EGFR in OVCAR-3, CaOV-3 and SKOV-3 cells were examined by Western blotting. E, OVCAR-3 cells and CaOV-3 cells were treated with 10 nM of GnRHII for 2, 4, 8, 16 or 24 h. Cells were harvested and protein extracts were subjected to Western blotting and probed for GnRHR or β-actin as a normalization control. Left panels showed representative Western blots. Right panels showed quantitative results from three independent experiments.  68  FIG. 3.6. GnRH-II signaling is involved in EGF-induced ovarian cancer cell invasion. (A) OVCAR3 cells and (B) CaOV-3 cells were transfected with 100 nM type I GnRH receptor siRNA (si-GnRHR) or 100 nM siRNA controls (si-Ctrl) respectively, and followed by 100 ng/ml EGF or 10 nM GnRH-II treatment. Treated cells were then seeded into Matrigel coated transwells and cultured for 48 h. Noninvading cells were wiped from the upper side of the filter and nuclei of invading cells were stained with Hoechst 33258. Left panel shows representative photos of the invasion assay, right panel shows summarized quantitative results. Results are expressed as mean ± SEM of at least three independent experiments. *p<0.05 compared with untreated control (Ctrl). #p<0.05 compared with EGF or GnRH-II treatment. The efficiency for GnRHR siRNA was tested by Western blotting.  69  FIG. 3.7. Proposed model for EGF induced GnRH-II synthesis contributes to ovarian cancer cell invasion. EGF acting on its receptor induces the autophosphorylation of EGFR thereby stimulating the phosphorylation of ERK1/2. Phosphorylated ERK1/2 then translocates into the nucleus and mediates the phosphorylation of CREB, the recruitment of C/EBPβ and the binding of p-CREB onto the CRE site of the GnRH-II promoter. Up-regulated GnRH-II transcription then increases GnRH-II synthesis. Increased production of GnRH-II acts in an autocrine manner through the GnRHR, the levels of which may also be increased by EGF treatment, to stimulate the invasive potential of ovarian cancer cells. EGFR, EGF receptor; GnRHR, GnRH receptor; p-ERK1/2, phosphorylated ERK1/2; p-CREB, phosphorylated CREB; CCAAT/enhancer binding protein beta, C/EBPβ, CRE, cAMP responsive element.  70  CHAPTER 4. 37 kDa Laminin receptor precursor mediates gonadotropinreleasing hormone-II- induced matrix metalloproteinase-2 expression and invasiveness in ovarian cancer cells 4.1 Introduction It is increasingly apparent that gonadotropin-releasing hormone-II (GnRH-II) acts as an autocrine regulator in non-pituitary tissues in addition to its role in promoting gonadotropin synthesis and steroid hormone production (52, 53), and GnRH-II is emerging as an important player in cancer cell biology (71). We have previously reported that epidermal growth factor increases GnRH-II production in ovarian cancer cells, and that this enhances their invasive potential by binding to the GnRH type I receptor (GnRHR) (53), but the downstream mechanisms responsible for this autocrine action of GnRH-II remained to be defined. Matrix metalloproteineases (MMPs) are a family of secreted or membrane-bound enzymes that degrade extracellular matrix (ECM) molecules, thereby facilitating cancer cell migration or invasion (267). The expression of MMP-2 and MMP-9 is significantly higher in ovarian cancer, as compared with normal ovarian tissues (144, 150, 166). Moreover, in vitro studies have demonstrated that MMP-2 (268) and MMP-9 (269, 270) contribute to the invasive and metastatic potential of ovarian carcinoma, and that GnRH-I acts through the GnRHR to increase their proteolytic activities in ovarian cancer cell lines (78). Interestingly, the 37 kDa precursor (LRP) has also been reported to increase the activity of MMP-2, and thereby promote breast cancer cell (202) and melanoma cell (271) invasiveness. The LRP homodimerizes to form the 67 kDa non-integrin laminin receptor (67LR) (178, 272), and an increase in 67LR levels has been found in a variety of common cancers, as compared with their corresponding normal tissues (177, 273). In many cases, a positive correlation between LRP expression and tumor aggressiveness or metastatic potential has also been found (177). At the cell surface, 67LR can interact with laminin and this is thought to 71  influence tumor cell-attachment (198, 274, 275), migration (276), angiogenesis (277), invasion and metastasis (198, 274, 278). A palindromic sequence (LWMMWL) within LRP acts as the major laminin-1 binding site of 67LR (182, 187, 188, 194), and a synthetic polypeptide (peptide G) that includes this sequence binds to laminin-1 with high affinity and can thereby block the interaction between the 67LR and laminin-1 (187). In addition, the amount of 67LR on the cell surface is increased by GnRH-I and GnRH-II in normal and cancerous T cells, and this induces their invasive and metastatic potential (20). We have therefore explored the possibility that LRP influences the way that GnRH-II acts in an autocrine manner to increase ovarian cancer invasion via altered MMP expression.  4.2 Materials and methods Cells and cell culture The human ovarian adenocarcinoma cell lines, OVCAR-3, CaOV-3 and SKOV-3 were obtained from American Type Culture Collection (Manassas, VA, USA). Normal ovarian surface epithelial cells were obtained by scraping the ovarian surface at surgery or laparoscopy for non-malignant disorders, as previously described (279). Cell cultures were maintained in M199/MCDB105 (Invitrogen Inc., Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS; Hyclone Laborataries Inc., Logan, UT, USA) at 37 C in a humidified atmosphere of 5% CO2. The cells were sub-cultured when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.5 mM EDTA).  Antibodies and reagents GnRH-II analog (DArg6-Azagly10-GnRH-II) was purchased from Bachem (Belmont, CA). Peptide G (IPCNNKGAHSVGLMWWMLAR), corresponding to amino acids 161-180 of LRP was synthesized at the University of British Columbia (Vancouver, BC, Canada). The 72  monoclonal LRP antibody (MLuC5) and the polyclonal β-actin antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The monoclonal GnRHR antibody, monocolonal MMP-2 antibody and monoclonal MMP-9 antibody were obtained from Neomarkers (Fremont, CA). Horseradish peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were obtained from Bio-Rad Laboratories (Hercules, CA). Horseradish peroxidase-conjugated donkey anti-goat IgG was obtained from Santa Cruz Biotechnology.  Reverse transcription quantitative real-time PCR (RT-qPCR) After treatment with 10 nM GnRH-II, medium was removed from the culture dish and RNA was extracted using Trizol (Invitrogen). Total RNA (2 g) was reverse transcribed into cDNA using a first-strand cDNA synthesis kit (GE Healthcare Bio-Science, Piscataway NJ, USA) following the manufacturer’s procedure. The primers used for SYBR Green RT-qPCR were designed using Primer Express Software v2.0 (Applied Biosystems, Foster City, CA, USA). The primers for GnRH-II mRNA are: sense, 5´-CTGCTGACTGCCCACCTT; and antisense, 5´-GCTTTCCTCCAGGGTACCAG. The primers for GnRHR are: sense, 5´ACTGTTCCGACTTTGCTGTTGCT; and antisense, 5´-ACCGCTCCCTGGCTATCAC. The primers for LRP are: sense, 5'- ATGTCCTGCAAATGAAGGAGG; and antisense, 5'TGGAAGTCAAGATTGGTGCCA.  The  primers  for  MMP-2  are:  sense,  5'-  TACACCAAGAACTTCCGTCTGT; and antisense, 5'-AATGTCAGGAGAGCTCCCCATA. The primers for MMP-9 are: sense, 5'-GCCACTACTGTGCCTTTGAGTC; and antisense, 5'CCCTCAGAGAATCGCCAGTACT.  The  primers  for  GAPDH  are:  sense,  5'-  GAGTCAACGGATTTGGTCGT; and antisense, 5'-GACAAGCTTCCCGTTCTCAG. The reactions were performed using SYBR Green PCR Master Mix (Applied Biosystems). All RTqPCR experiments were run in triplicate and a mean value was used for the determination of mRNA levels. Negative controls containing water instead of sample cDNA were used in each 73  experiment. Relative quantification of the mRNA levels of GnRH-II, GnRHR, LRP, MMP-2 and MMP-9 was performed using the comparative Cq method with GAPDH as the reference gene and with the formula 2-ΔΔCq.  Plasmid constructs and cell transfections The LRP and eGFP cDNA constructs in the same plasmid expression vector (pRecieverM02) were purchased from GeneCopoeia (Rockville, MD). The LMWWML site within coding sequence of the LRP expression plasmid was mutated to the corresponding sequence of the 37 kDa LRP orthologs found in Arabidopsis (CLFWLL) and Saccharomyces (LIWYLL) because they lack laminin-binding activity but retain other highly-conserved functions of LRP (181). Mutagenesis was performed using the Quickchange II XL site directed mutagenesis kit (Stratagene, La Jolla, CA, USA), with the LRP construct as template and the following oligonucleotide primers: LRP Mut A (mutated sequence underlined encodes CLFWLL): forward, 5'-CTCAGTGGGTTGCTTGTTCTGGTTGCTGGCTCGGGAAGTTCTG and reverse, 5'- CAGAACTTCCCGAGCCAGCAACCAGAACAAGCAACCCACTGAG; LRP Mut B, (mutated  sequence  underlined  encodes  LIWYLL):  CTCAGTGGGTTTGATCTGGTACTTGCTGGCTCGGGAAGTTCTG CAGAACTTCCCGAGCCAGCAAGTACCAGATCAAACCCACTGAG.  forward, and  5'-  reverse, The  5'-  mutated  constructs were sequenced to verify that only the desired mutations had occurred. CaOV-3 cells over-expressing eGFP, wild-type LRP (LRP), or mutated LRP (Mut A and Mut B) were selected with 600 g/ml geneticin (Invitrogen) and cloned by limiting dilution. The eGFP expression vector was used as a transfection control, and clones expressing eGFP were verified by fluorescence microscopy, while LRP mRNA and protein levels in clones expressing wild-type or mutant LRP were measured by RT-qPCR or Western blotting.  74  Transfections of expression plasmids were performed using Lipofectamine LTX and PLUS Reagent (Invitrogen), while siRNA transfections were carried out using Lipofectamine RNAiMAX Reagent (Invitrogen) following the manufacturer’s protocol. Briefly, 5 X 105 cells were seeded into six-well tissue culture plates one day prior to transfection with 100 nM GnRH-II siRNA (si-GnRH-II), 100 nM GnRHR siRNA (si-GnRHR), 75 nM 37kDa LRP siRNA (si-LRP) or a non-targeting control siRNA (si-Ctrl) (Dharmacon, Inc., Lafayette CO). After 6 h, the medium in each well was replaced with 2 ml of 0.5% FBS medium and the cells were further incubated overnight (18 h). The culture medium was then removed and the cells were treated with 10 nM GnRH-II in 0.5% serum medium for the times indicated.  Adhesion assay Equal amounts of laminin (2 g/cm2), fibronectin (5 g/cm2) and growth-factor reduced Matrigel (5 g/cm2) were used to coat 96-well tissue culture plates (Becton Dickinson Labware, Franklin Lakes, NJ) for 2 h at 37 C. Cells were trypsinized and seeded in the coated tissue culture plates in serum free medium and allowed to adhere at 37 C for 8 h. The plates were then washed twice with cold PBS and the adherent cells were fixed with ice-cold methanol, stained with crystal violet and quantified by measuring absorbance at 630 nm.  Invasion assay Transwell cell culture inserts (8 μm pore size, 24-well, BD Biosciences) were coated with 40 μl of 1 mg/ml growth-factor reduced Matrigel (BD Biosciences). Cells in M199/MCDB105 medium supplemented with 0.5% FBS were incubated for 48 h against a gradient of 10% FBS for OVCAR-3 cells (1.5 X 106/insert) and CaOV-3 cells (1.25 X 106/insert) and 24 h of 5% FBS for SKOV-3 cells (1 X 106 /insert). Cells on the lower side of the  75  membrane were fixed with ice-cold methanol, stained with Hoechst 33258 (Sigma), and the number of nuclei were counted using a Zeiss Axiophot epifluorescent microscope equipped with a digital camera and Northern Eclipse 6.0 software (Empix Imaging, Mississauga, ON). Individual experiments had duplicate inserts and five microscopic fields were counted per insert.  Data analysis Results are shown as the mean ± SEM of three independent experiments and were analyzed by one-way ANOVA followed by Tukey test using PRISM software (GraphPad Software Inc., San Diego, CA, USA). Means were considered significantly different from each other at P < 0.05.  4.3 Results GnRH-II modulates ovarian cancer cell invasion in an autocrine manner Treatment of ovarian cancer cells with epidermal growth factor increases their GnRH-II mRNA levels and this contributes to their invasive potential (53). We have now treated two ovarian cancer cell lines with GnRH-II siRNA prior to an invasion assay, and this demonstrated that knockdown of GnRH-II mRNA levels in OVCAR-3 (Fig. 4.1A) and CaOV-3 (Fig. 4.1B) cells significantly reduces their invasive properties (Fig. 4.1C and D). Importantly, this GnRH-II siRNA-mediated reduction in the invasiveness of both cell lines was reversed upon exogenous treatment of GnRH-II (Fig. 4.1C and D). These results confirm and extend our previous finding that GnRH-II functions in an autocrine manner to modulate the invasive potential of ovarian cancer cells.  76  GnRH-II increases LRP production in ovarian cancer cells Over-expression of LRP influences cancer cell metastasis and invasiveness (177), and we therefore compared the LRP mRNA levels in normal ovarian surface epithelial cells and three serous ovarian carcinoma cell lines (i.e. OVCAR-3, CaOV-3 and SKOV-3 cells). The results indicate that LRP mRNA levels are much higher in CaOV-3 and SKOV-3 cells than in OVCAR-3 cells or normal ovarian surface epithelial cells (Fig. 4.2A, upper panel). These three ovarian cancer cell lines exhibit different invasive properties, and this is evident in our invasion assays. For instance, SKOV-3 cells were seeded at the lowest cell density but demonstrate the highest cell invasiveness, while CaOV-3 and OVCAR-3 cells were seeded at a higher cell density and show a lower cell invasive potential (Fig. 4.2A, lower panel). Interestingly, the LRP mRNA levels in these three ovarian cancer cell lines corresponds to their ranking in terms of invasiveness (SKOV-3> CaOV-3> OVCAR-3) (Fig. 4.2A). To examine whether GnRH-II treatment induced LRP production in ovarian cancer cells, OVCAR-3 and CaOV-3 cells were treated with 10 nM GnRH-II for 8 h or 24 h prior to harvesting for measurements of LRP expression. As shown in Figure 4.2B, GnRH-II increased LRP mRNA and LRP levels in both OVCAR-3 and CaOV-3 cells, which express relatively high levels of GnRHR; whereas SKOV-3 cells, a cell line that expresses limited amounts of GnRHR (53), did not respond in this way to GnRH-II treatment (Fig. 4.2B). This is in accordance to our previous finding that GnRH-II treatment does not affect the invasive potential of SKOV-3 cells (53). Furthermore, when SKOV-3 cells were treated with GnRHR siRNA prior to invasion assays, the results show that depletion of GnRHR in this cell line does not have any effects on its basal invasiveness (Fig. 4.3).  77  A GnRH-II/GnRHR autocrine loop regulates LRP levels in ovarian cancer cells When OVCAR-3 (Fig. 4.2C) and CaOV-3 cells (Fig. 4.2D) were treated with GnRH-II siRNA, a reduction in LRP levels was observed that could be reversed by treatment of the cells with exogenous GnRH-II. To verify that GnRH-II acts through the GnRHR to regulate LRP production, the cells were treated with GnRHR siRNA prior to treatment with GnRH-II. The results show that depletion of GnRHR in OVCAR-3 (Fig. 4.2E) and CaOV-3 cells (Fig. 4.2F) inhibits both basal and GnRH-II-induced LRP levels, without altering GnRH-II mRNA levels (Fig. 4.4). These data suggest that GnRH-II acts via the GnRHR in an autocrine manner to regulate LRP production in ovarian cancer cells.  LRP promotes ovarian cancer cell invasion To assess the role of LRP in ovarian cancer cell invasion, siRNA was used to knockdown LRP levels in CaOV-3 (Fig. 4.5A) and SKOV-3 cells (Fig. 4.5B) prior to invasion assays using Matrigel-coated transwells. Cells treated with LRP siRNA exhibited a significant reduction in their invasiveness, as compared with cells treated with control siRNA, suggesting that LRP up-regulates this property of ovarian cancer cells. Peptide G mimics the laminin binding site of LRP, and will competitively block interactions between cell surface 67LR and laminin within an ECM (204). Laminin is a major component of the synthetic ECM, Matrigel, and the basal invasiveness of CaOV-3 (Fig. 4.5C) and SKOV-3 cells (Fig. 4.5D) was reduced by ~50% when peptide G was pre-incubated with Matrigel-coated transwells. We therefore also conducted adhesion assays to determine whether the effects of LRP on ovarian cancer cell invasion are simply caused by a loss of cell adhesion. In laminin-coated tissue culture plates, depletion of LRP with siRNA treatment in CaOV-3 cells resulted in an ~75% inhibition of cell adhesiveness; while only an ~20% inhibition of cell adhesion was observed in Matrigel-coated tissue culture plates (Fig. 4.5E). In addition, pre78  incubation of laminin-coated tissue culture plates with peptide G reduced the adhesion of CaOV-3 cells by ~60%, while peptide G treatment of Matrigel-coated plates reduced the adhesiveness of these cells to the ECM by only ~15% (Fig. 4.5F). Thus, while these results suggest that the interaction between 67LR and laminin facilitates CaOV-3 cell adhesion to the ECM, it does not entirely account for the adhesive properties of ovarian cancer cells or the substantial loss in their invasiveness when LRP levels were depleted. To further verify that LRP promotes ovarian cancer cell invasion, we first stably transfected CaOV-3 cells with a LRP expression vector, and identified two independent CaOV3 cell clones that over-express LRP by Western blotting (Fig. 4.6A). Using transwell invasion assays, we found that the LRP over-expressing CaOV-3 cells were significantly more invasive than CaOV-3 cells stably transfected with a control expression vector (Fig. 4.6B). Furthermore, this increased invasiveness of LRP over-expressing cells was abolished when they were pretreated with LRP siRNA (Fig. 4.6C). Moreover, when CaOV-3 cells were engineered to overexpress a laminin-binding deficient LRP, they showed no change in invasiveness (Fig. 4.7A) or adhesion to Matrigel (Fig. 4.7B). Taken together, these results suggest that increases in LRP production enhance ovarian cancer cell invasiveness in vitro through an increase in the amounts of cell surface 67LR that can interact with laminin within Matrigel.  LRP is an obligate intermediate in GnRH-II-induced MMP-2 production and ovarian cancer cell invasion Since it has been reported that LRP modulates the expression of MMP-2 in breast cancer cells (202), we examined whether altered LRP levels influences MMP-2 or MMP-9 expression in OVCAR-3 and CaOV-3 cells (Fig. 4.8). In these experiments, siRNA-mediated knockdown of LRP levels decreased the basal mRNA levels of MMP-2 but not MMP-9 in both cell lines (Fig. 4.8A, C, D and F). Moreover, transient over-expression of LRP in these cells specifically 79  increased the levels of MMP-2 mRNA, but not MMP-9 mRNA (Fig. 4.8B, C, E and F). In addition, no increases in MMP-2 mRNA (Fig. 4.8G) or MMP-2 (Fig. 4.8H) levels were detected in CaOV-3 cells over-expressing the laminin-binding deficient LRP mutant. These experiments indicate that an interaction between the 67LR and laminin specifically increases MMP-2 production in ovarian cancer cells. In line with a previous report that GnRH-I/GnRHR signaling up-regulates MMP-2 expression in ovarian cancer cells (78), we also found that treatment of OVCAR-3 (Fig. 4.9A) and CaOV-3 cells (Fig. 4.9B) with GnRH-II increased MMP-2 mRNA levels in a timedependent manner. In addition, depletion of GnRHR in OVCAR-3 and CaOV-3 cells abolished the GnRH-II-stimulated increases in MMP-2 levels (Fig. 4.9C and D) in both cell lines, and confirmed that GnRH-II/GnRHR interactions stimulate MMP-2 expression. In addition, we further verified that GnRH-II treatment did not affect MMP-2 mRNA levels in SKOV-3 cells (Fig. 4.10A), which are known to have very low GnRHR levels (53). Moreover, depletion of GnRHR levels in SKOV-3 cells by GnRHR siRNA treatment does not influence MMP-2 levels in these cells (Fig. 4.10B). Importantly, depletion of LRP by LRP siRNA treatment abolished the GnRH-II-induced increase in MMP-2 production in OVCAR-3 (Fig. 4.9E) CaOV-3 cells (Fig. 4.9F). To explore this further, CaOV-3 cells were treated with LRP siRNA or MMP-2 siRNA prior to invasion assays, and the results of these experiments indicate that depletion of either LRP (Fig. 4.11A) or MMP-2 (Fig. 4.11C) abolishes GnRH-II-induced invasion. Furthermore, depletion of MMP-2 levels in CaOV-3 cells did not affect GnRH-II, GnRHR or LRP levels in this cell line (Fig. 4.12). Importantly, pre-incubation of Matrigel-coated transwells with peptide G attenuated the pro-invasive effects of GnRH-II in CaOV-3 cells (Fig. 4.11B). These observations suggest that LRP is a key intermediary in GnRH-II-stimulated MMP-2 production and may thereby play a pivotal role in GnRH-II-induced ovarian cancer cell invasiveness. 80  4.4 Discussion Both GnRH-II (139) and GnRHR (280) are more abundant in malignant ovarian tumors than in benign ovarian tissues, and this underscores the importance of understanding GnRH-II function in the context of ovarian cancer. Building on evidence that GnRH-II acts in an autocrine manner to promote ovarian cancer cell invasion (53), we have now found that this action of GnRH-II involves a GnRHR-dependent up-regulation of LRP production. This was not completely surprising because LRP has been reported to be a downstream target of GnRHII/GnRHR signaling in T cell lymphomas, and to be associated with the metastatic potential of these cancer cells (20). However, our results also show that LRP is a critical intermediary in GnRH-II actions that lead to an increase in the invasive properties of OVCAR-3 and CaOV-3 cells. We believe this is important because LRP can dimerize and form the cell surface 67LR that functions as a binding protein for laminin in the ECM (177). In support of this, we used peptide G to block cell surface 67LR interactions with laminin during our ovarian cancer cell adhesion and invasion assays, and we found that this reduces the GnRH-II enhanced invasive potential of OVCAR-3 and CaOV-3 cells. This is important because increased 67LR levels have been observed in a wide range of malignancies, including ovarian carcinomas (205, 206), and correlate with minimal differentiation, disease progression and poor survival (180, 281). Accordingly, the invasive potential of the ovarian cancer cell lines we have used in our studies is directly related to their LRP levels, and this behavior can be manipulated by changing their LRP levels. Interactions between cancer cells and laminin in the ECM promote tumor dissemination by several mechanisms, including increasing cell proliferation, adhesion, migration or invasion (282-284). In our in vitro studies, altered LRP levels did not influence ovarian cancer cell proliferation (data not shown). However, while the adhesion of these cells to laminin-coated tissue culture plates was largely dependent on the expression of LRP, their adhesion to an 81  artificial ECM (Matrigel) was only modestly affected by altering LRP expression. This suggested to us that the requirement for LRP, in relation to the GnRH-II induced invasive properties of ovarian cancer cells, can not simply be attributed to an alteration in adhesion to the ECM. Although it is known that LRP is a multi-functional protein in eukaryotic cells and that 67LR also acts as an endocytotic receptor (177), our data imply that the laminin-binding domain of LRP plays a key role in the invasion of ovarian cancer cells after treatment of GnRH-II. The importance of interactions between cancer cells and ECM components, like laminin, is well documented in terms of their metastatic potential (285-288). It is also known that cancer cells interact with laminin via several cell-surface laminin-binding proteins, including dystroglycan and the integrins α1β1, α2β1, α3β1, α6β1, α6β4 and α7β1, as well as 67LR (201). Our data indicate that LRP plays a key role in GnRH-II induced increases in the invasive properties of ovarian cancer cells, and that this effect most likely relies on an interaction between the cell surface 67LR and laminin. Although the 67LR is not thought to act independently as a cell surface signaling molecule (177), it may act as an accessory with other cell surface lamininbinding proteins that function as bona fide signaling molecules upon interaction with laminin at sites other than that recognized by 67LR (177). For example, 67LR physically associates with 64 integrin (200) and co-regulation of their membrane localization is important for tumorigenesis (180, 281). In addition, up-regulation of 64 integrin increases its interaction with laminin and activates mitogen-activated protein kinase signaling (3), and also appears to stimulate the production of proteases, including MMP-2, MMP-9 and MT1-MMP, that are important in ECM degradation during cell invasion (289). Laminin induces the production of proteases, like MMPs, as one mode of promoting cancer cell invasion (290). It has previously been reported that GnRH-I treatment of ovarian  82  cancer cells increases MMP-2 and MMP-9 production (78), and we have now shown that the autocrine actions of GnRH-II act through the GnRHR to exert the same effects. Others have shown that siRNA-mediated depletion of 67LR levels significantly reduces tumor aggressiveness with a decrease in the MMP-2 mRNA levels and proteolytic activity of melanoma cells (271). Likewise, we have found that LRP levels influence MMP-2 but not MMP-9 expression in ovarian cancer cells. Importantly, this effect was not seen when a lamininbinding deficient LRP was over-expressed in these cells, suggesting that the specific induction of MMP-2 expression is entirely dependent on the laminin-binding properties of LRP or the 67LR. Thus, our data also imply that the GnRH-mediated induction of MMP-9 expression in ovarian cancer cells must be mediated by some other pathway unrelated to the increased expression of LRP. However, we also conclude that LRP-induced MMP-2 expression must be the predominant mechanism responsible for the autocrine actions of GnRH-II in relation to its effects on the increased invasive potential of some ovarian cancer cells. It should also be noted that MMP-2 is synthesized as a latent zymogen that requires proteolytic cleavage by membrane type I matrix metalloproteinase (MT1-MMP) to achieve its full proteolytic potential (155, 291). This is of interest because we have also recently obtained evidence that MT1-MMP is a downstream target of GnRH-II/GnRHR signaling (Poon SL et al., unpublished), and is independent of the actions of LRP (data not shown). We and others have demonstrated previously that GnRH-I and GnRH-II have no effect on SKOV-3 cell invasiveness, and we attributed this to the low GnRHR levels in SKOV-3 cells as compared with OVCAR-3 and CaOV-3 cells (53). Our results also now indicate that GnRHII treatment does not affect LRP or MMP-2 levels in SKOV-3 cells. In addition, GnRHR siRNA treatment has no effects on SKOV-3 cell invasiveness or LRP and MMP-2 levels. However, siRNA-mediated reductions in LRP levels or peptide G treatment markedly reduce the invasive potential of SKOV-3 cells. Thus, while LRP contributes to the invasive properties of SKOV-3 83  cells, this is not influenced by the GnRH-II/GnRHR autocrine loop as in OVCAR-3 and CaOV3 cells, and other mechanisms may influence LRP expression in SKOV-3 cells. Our present studies provide important insights into a novel aspect of GnRH-II function in ovarian cancer cell biology. In summary, we propose that the epidermal growth factorstimulated increase in GnRH-II production by ovarian cancer cells (53) subsequently acts in an autocrine manner via the GnRHR to stimulate LRP production. Elevated LRP levels increase tumor cell interactions with laminin within the ECM, and this is an obligatory step in GnRH-II stimulation of MMP-2 production which plays a key role in ovarian cancer cell invasion (Fig. 4.13).  84  FIG. 4.1. GnRH-II acts in an autocrine manner to enhance ovarian cancer cell invasion. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 100 nM GnRH-II siRNA (si-GnRH-II) or 100 nM control siRNA (si-Ctrl) for 24 h. In both cases, the mRNA levels of GnRH-II and GnRHR were measured by RT-qPCR and expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl). (C, D) The cells were then seeded into Matrigel-coated transwells and cultured for 48 h in the presence of 10 nM GnRH-II. Non-invading cells were removed from the upper side of the filter and nuclei of invading cells were stained with Hoechst 33258. Upper panels show representative photomicrographs of cells attached to the lower membrane of the transwells in the invasion assays, while lower panels show the quantitative results of these assays, with results expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (siCtrl).  85  FIG. 4.2. GnRH-II induces the production of LRP in ovarian cancer cells. (A) LRP mRNA levels in OVCAR-3, CaOV-3 and SKOV-3 cells were measured by RT-qPCR and expressed relative to the levels in normal ovarian surface epithelial (OSE) cells. *p<0.05 compared with OSE. In parallel experiments, OVCAR-3, CaOV-3 and SKOV-3 cells were subjected to an invasion assay for 24 h. Lower panels show representative photomicrographs of cells attached to the lower membrane of transwells in the invasion assay. Below the photomicrographs, the numbers of invasive cells were quantified in 5 fields and expressed as means ± SEM of three independent experiments. (B) OVCAR-3, CaOV-3 and SKOV-3 cells were treated with 10 nM of GnRH-II and LRP mRNA (left panel) and LRP (right panel) levels were determined after 8h and 24 h, respectively. RT-qPCR results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl). (C, E) OVCAR-3 and (D, F) CaOV-3 cells were treated with 100 nM GnRH-II siRNA (si-GnRH-II), 100 nM GnRHR siRNA (siGnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h and then treated with 10 nM GnRH-II for a further 24 h. Cells were harvested and protein extracts were subjected to Western blotting and probed for LRP, GnRHR or β-actin as a normalization control.  86  FIG. 4.3. GnRH-II treatment does not affect SKOV-3 cell invasiveness. SKOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h. The cells were then seeded into Matrigel-coated transwells and cultured for 24 h in the presence of 10 nM GnRH-II. Non-invading cells were removed from the upper side of the filter and nuclei of invading cells were stained with Hoechst 33258. Results are expressed as mean ± SEM of three independent experiments.  87  FIG. 4.4. Depletion of GnRHR with GnRHR siRNA does not influence GnRH-II mRNA levels in ovarian cancer cells. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h. Total RNA from treated cells was used to prepare cDNA for RT-qPCR analysis to evaluate the efficiency of GnRHR siRNA and the effects of GnRHR on GnRH-II mRNA levels. RT-qPCR results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl).  88  FIG. 4.5. LRP mediates the invasive potential of ovarian cancer cells. (A) CaOV-3 and (B) SKOV-3 cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl) prior to invasion assays for 48 h (CaOV-3 cells) or 24 h (SKOV-3 cells). In both cases, the efficiency of LRP siRNA was verified by Western blotting (upper panels). Synthetic peptide G (1 g) was pre-incubated with the Matrigel-coated transwells for 30 min before (C) CaOV-3 and (D) SKOV-3 cells were subjected to invasion assays. In A,B,C and D, representative photomicrographs of cells attached to the lower membrane of the transwells in the invasion assays are shown, and the lower panels show the quantitative results of these assays, with results expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl) in A and B or untreated control (Ctrl) in C and D. (E) CaOV-3 cells were treated with si-LRP or si-Ctrl prior to adhesion assays for 8 h on uncoated (Ctrl) tissue culture plates, or plates coated with laminin-I, fibronectin or Martigel. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl). (F) Peptide G (1 g) was pre-incubated with the uncoated (Ctrl) or coated tissue culture plates (i.e., with fibronectin, laminin1, or Matrigel) for 30 min before CaOV-3 cells were tested in an adhesion assay for 8 h. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl).  89  FIG. 4.6. Over-expressing LRP up-regulates ovarian cancer cell invasiveness. Over-expressing LRP up-regulates ovarian cancer cell invasiveness. CaOV-3 cells were stably transfected with expression vectors for wild-type LRP or eGFP as a control (Ctrl). (A) Over-expression of LRP in two independent clones (i.e. Clones 1 and 2) was verified by Western blotting. (B) In parallel experiments, these stably transfected CaOV-3 cells were subjected to invasion assays for 48 h. The upper panel shows representative photomicrographs of cells attached to the lower membrane of the transwells in the invasion assays, and the lower panels show the quantitative results of these assays, with results expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control (Ctrl). (C) LRP overexpressing cells (Clones 1 and 2) and control (Ctrl) cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl) prior to invasion assays for 48 h. The efficiency of LRP siRNA in these LRP over-expressing clones were verified by Western blotting of LRP (upper panel). Results of invasion assays are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with the control siRNA (si-Ctrl).  90  FIG. 4.7. The laminin binding domain of LRP plays an important role in ovarian cancer cell invasion. (A) CaOV-3 cells were stably transfected with wild-type LRP (LRP) or two different mutated LRP expression vectors (i.e. Mut A, Mut B). The relative LRP levels in these cells, and cells expressing eGFP as a control, (Ctrl) were compared by Western blotting (upper panel), and invasion assays using these cells were performed for 48 h (lower panel). (B) In parallel experiments, these stably transfected cells were also subjected to adhesion assays for 8 h. In both A and B, results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with the control cells (Ctrl).  91  FIG. 4.8. LRP regulates MMP-2 production in ovarian cancer cells. OVCAR-3 and CaOV-3 cells were treated with (A, D) 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl), or (B, E) transiently transfected with 1 g wild-type LRP expression vector or 1 g eGFP expression vector as a control. (C, F) In both cases, the efficiency of LRP siRNA and over-expression of LRP in these cells were verified by RT-qPCR measurements of LRP mRNA levels. Total RNA from transfected cells was used to prepare cDNA for RT-qPCR analysis to evaluate the effects of LRP on MMP-2 and MMP-9 mRNA levels, which are expressed in A and D as a percentage over control siRNA (si-Ctrl) values, or in B and E as a percentage of corresponding values in the control (Ctrl) cells. (G) Total RNA of CaOV-3 cells stably over-expressing mutated LRP (i.e. Mut A and Mut B), eGFP control vector (Ctrl) and wildtype LRP (LRP) was isolated and subjected to RT-qPCR to measure the MMP-2 and MMP-9 mRNA levels expressed as percentage over cells expressing the control vector (Ctrl). Results are expressed as the mean ± SEM of three independent experiments. *p<0.05 compared with respective controls. (H) In parallel experiments, protein lysates from these stably over-expressing cells were harvested and subjected to Western blotting for their relative MMP-2, MMP-9 and LRP protein levels or β-actin as a normalization control. The Western blotting data are expressed as mean ± SEM of three independent experiments (right panel). *p<0.05 compared with the control cells (Ctrl).  92  FIG. 4.9. LRP mediates the GnRH-II-induced production of MMP-2 by ovarian cancer cells. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 10 nM GnRH-II for up to 72 h. Total RNA from treated cells was used to prepare cDNA for RT-qPCR analysis to evaluate the effect of GnRH-II on MMP-2 mRNA levels. RT-qPCR results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl). (C and D) OVCAR-3 and CaOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h and then treated with 10 nM GnRH-II for 48 h. (E and F) OVCAR-3 and CaOV-3 cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl) for 24 h, and then treated with 10 nM GnRH-II treatment for 48 h. In C-F, cells were harvested and protein extracts were subjected to Western blotting with antibodies against MMP-2, GnRHR, LRP or β-actin as a normalization control. Left panel showed representative Western blots and right panel showed the quantitative results of three independent experiments.  93  FIG.4.10. GnRH-II treatment does not affect SKOV-3 cell MMP-2 levels. (A) SKOV-3 cells were treated with 10 nM GnRH-II for up to 72 h. Total RNA from treated cells was used to prepare cDNA for RT-qPCR analysis to evaluate the effect of GnRH-II on MMP-2 mRNA levels. RT-qPCR results are expressed as mean ± SEM of three independent experiments. (B) SKOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h and then treated with 10 nM GnRH-II for 24 h. Treated cells were harvested and protein extracts were subjected to Western blotting with antibodies against MMP-2, GnRHR or β-actin as a normalization control.  94  FIG. 4.11. LRP and MMP-2 are key mediators of GnRH-II enhanced invasion in ovarian cancer cells. (A) CaOV-3 cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl) for 24 h, and with 10 nM GnRH-II for a further 48 h during an invasion assay. (B) In parallel experiments, 1 g of peptide G was pre-incubated with Matrigel-coated transwells for 30 min prior invasion assay in the presence of 10 nM GnRH-II for 48 h. (C) CaOV-3 cells were treated with 75 nM MMP-2 siRNA (si-MMP-2) or 75 nM control siRNA (si-Ctrl) for 24 h, prior an invasion assay in the presence of 10 nM GnRH-II for 48 h. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl) in A and C or untreated control (Ctrl) in B. The efficiency of LRP siRNA and MMP-2 siRNA were verified by Western blot analysis of LRP (right panels in A and C). In parallel experiments, si-MMP-2 treated cells were harvested and protein extracts were subjected to Western blotting with antibodies against LRP, GnRHR or β-actin as a normalization control.  95  FIG. 4.12. Depletion of MMP-2 levels with siRNA does not affect GnRH-II, GnRHR or LRP mRNA levels in SKOV-3 cells. SKOV-3 cells were treated with 75 nM MMP-2 siRNA (si-MMP-2) or 75 nM control siRNA (si-Ctrl) for 24 h. Total RNA from treated cells was used to prepare cDNA for RTqPCR analysis to evaluate the efficiency of MMP-2 siRNA and the effects of MMP-2 on GnRH-II, GnRHR and LRP mRNA levels. RT-qPCR results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl).  96  FIG. 4.13. Proposed model for 67LR as a key mediator in GnRH-II-enhanced ovarian cancer cell invasion. GnRH-II/GnRHR acts in an autocrine manner to increase the amount of 67LR in ovarian cancer. This leads to an increased between the interaction of laminin with cancer cells, thereby upregulates the production of MMP-2. Increased production of MMP-2 contributes to the GnRH-II-induced ovarian cancer cell invasive potential. 67LR, 67 kDa non-integrin laminin receptor; LRP, 37 kDa nonintegrin laminin receptor precursor; GnRHR, GnRH receptor; MMP-2, matrix metalloproteinase-2.  97  CHAPTER 5. Gonadotropin-releasing hormone-II increases membrane type I metalloproteinase production via -catenin signaling in ovarian cancer cells 5.1 Introduction Gonadotropin-releasing hormone-II (GnRH-II) acts on a variety of extrapituitary tissues and tumor cells (67, 292), including ovarian cancers. The widespread presence (>80%) of the GnRH receptor (GnRHR) in ovarian carcinomas (280) and higher levels of GnRH-II mRNA in malignant ovarian tumors, as compared with benign ovarian tumors (139), underlies the importance of understanding the function of GnRH-II in ovarian cancer. Previously, we have shown that GnRH-II acts in an autocrine manner to enhance ovarian cancer cell invasion (53), but the molecular mechanisms that mediate this action of GnRH-II are poorly understood.   The GnRHR is a G protein coupled receptor that binds GnRH-I and GnRH-II (53).  Binding of these ligands to the GnRHR results in the activation of several downstream signaling molecules, such as mitogen activated protein kinase (MAPK), phosphatidylinositol-3-kinase (PI3K), and nuclear factor kappa B (52, 53). Recently, Wnt/-catenin signaling has been shown to play an essential role in transducing the GnRHR signal in gonadotropes, and that this involves an accumulation of -catenin in the nucleus (92, 93).This is important because -catenin acts as a signaling molecule in the Wnt/-catenin pathway (85-87), and many Wnt/-catenin-target genes contribute to the progression and metastasis of a variety of tumor types (88, 293, 294). In the absence of Wnt ligand, the cellular levels of -catenin are kept low by a destruction complex that includes glycogen synthase kinase 3 (GSK3), which phosphorylates -catenin and targets it for degradation (295). Stimulation of the Wnt pathway leads to the phosphorylation of GSK3 which prevents it from phosphorylating -catenin, and this thereby stabilizes and releases catenin for translocation to the nucleus (296).  98  Metastasis is a complex process that starts with the dissemination of cancer cells from a primary tumor to distant tissues. Along the metastatic cascade, tumor cells interact with and remodel the extracellular matrix (ECM), and a variety of matrix metalloproteinases (MMPs) are key players in the process of tumor cell invasion (143). Membrane type I matrix metalloproteinase (MT1-MMP) has been directly correlated with enhanced cell migration and is generally considered pro-invasive and pro-tumorigenic (297). Ovarian cancer tissue microarray (298) studies have shown that MT1-MMP is expressed in all four subtypes of epithelial ovarian carcinoma (i.e., serous, mucinous, endometroid, clear cell), and high MT1-MMP levels in epithelial ovarian carcinoma have been reported to be indicative of poor prognosis (299, 300). In addition, MT1-MMP synthesis is known to be under the regulation of Wnt/-catenin signaling in mesenchymal stem cells and gastric cancer cells (301, 302), and in vitro studies of a variety of ovarian cancer cell lines, including OVCAR-3 cells, have indicated that MT1-MMP levels play an important role in ovarian cancer cell invasiveness (303, 304). We now demonstrate that GnRH-II induces the nuclear accumulation of -catenin via PI3K/Akt signaling in ovarian cancer cell lines that express the GnRHR, and that -catenin upregulates MT1-MMP production and contributes to GnRH-II-enhanced ovarian cancer cell invasion.  5.2 Materials and methods Cells and cell culture The human ovarian adenocarcinoma cell lines, OVCAR-3 and CaOV-3, were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were maintained in M199/MCDB105 (Invitrogen Inc., Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS; Hyclone Laboratories Inc., Logan, UT, USA). Cultures were maintained at  99  37 C in a humidified atmosphere of 5% CO2. The cells were sub-cultured when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.5 mM EDTA). Both ovarian cancer cell lines express GnRHR (52) and have been shown to response to GnRH-II treatment (53).  Antibodies and reagents GnRH-II analog (DArg6-Azagly10-GnRH-II) was purchased from Bachem (Belmont, CA). The polyclonal MT1-MMP antibody was obtained from Abcam (Cambridge, MA; cat# ab3644). The monoclonal GnRHR antibody was obtained from Neomarkers (Fremont, CA; cat# MS-1139-P). The polyclonal antibodies for phosphorylated Akt (cat# 9271s), total Akt (cat# 9272) and phosphorylated GSK3(cat# 9336s) were obtained from Cell Signaling Technology (Danvers, MA). The monoclonal -catenin antibody was obtained from BD Bioscience (San Jose, CA; cat# 610154). The polyclonal β-actin antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA; cat# C-11), as was the horseradish peroxidase-conjugated donkey anti-goat IgG. Horseradish peroxidase-conjugated goat anti-rabbit IgG and goat antimouse IgG were obtained from Bio-Rad Laboratories (Hercules, CA).  Nuclear extraction and Western blotting Briefly, cells were washed with ice-cold PBS and harvested with 1 ml solution A (10 mM Hepes, pH 7.9, 10 mM KCl, 10 mM EDTA, 0.5 mM dithiothreitol, 1 g/ml aprotinin, and 1 g/ml proteinase inhibitor cocktail). Cell lysates were transferred to 1.5 ml centrifuge tubes and placed in an orbital rocker for 10 min at 4 C. Nuclear pellets were obtained by centrifugation at 14,000 g at 4 C for 10 min, re-suspended in solution B (100 mM HEPES, pH 7.9, 2 M NaCl, 5 mM EDTA, 50% Glycerol) and placed in an orbital rocker for 2 h at 4 C. After centrifugation at  100  14,000 g at 4 C for 5 min, supernatants containing the nuclear protein extracts were removed. The nuclear extracts were then subjected to electrophoresis on an 8% SDS-PAGE gel and Western blotted for detection with appropriate antibodies. Total cell lysates were also prepared using Cell Lysis Buffer (Cell Signaling) and subjected to Western blotting.  Luciferase assay and siRNA transfection To monitor the transcriptional activity of -catenin, cells were grown in standard M199/MCDB105 culture medium containing FBS and co-transfected with 0.5 g of the TOPFLASH luciferase reporter plasmid (Millipore, Temecula, CA) and 0.25 g of a RSV-lacZ plasmid (53). After 6 h, 2 ml culture medium with 0.5% FBS was added and the cells were further incubated overnight (18 h). The culture medium was then removed and the cells were pre-treated with 10 M LY294002 and then with 10 nM GnRH-II treatment in culture medium containing 0.5% FBS for 24 h. Cellular lysates were collected with 150 l reporter lysis buffer (Promega, Madison, WI) and assayed for luciferase activity. The -Galactosidase Enzyme Assay System (Promega) was used to measure -galactosidase expression from the (RSV)-lacZ plasmid, and promoter activities were expressed as luciferase activity/-galactosidase activity. siRNA transfections were carried out using Lipofectamine RNAiMAX Reagent (Invitrogen) following the manufacturer’s protocol. Briefly, 5 x 105 cells were seeded into sixwell tissue culture plates one day prior to transfection with 100 nM GnRHR siRNA (si-GnRHR), 50 nM -catenin siRNA (si--catenin), 50 nM MT1-MMP siRNA (si-MT1-MMP) or a nontargeting control siRNA (si-Ctrl) (Dharmacon, Inc., Lafayette CO). After 6 h, the culture medium in each well was replaced with 2 ml culture medium containing 0.5% FBS, and the cells were further incubated overnight (18 h). The culture medium was then removed and the  101  cells were treated with 10 nM GnRH-II in culture medium containing 0.5% serum for the times indicated.  Invasion assay Transwell cell culture inserts (8 μm pore size, 24-wells, BD Biosciences) were coated with 40 l of 1 mg/ml growth-factor reduced Matrigel (BD Biosciences). Cells in M199/MCDB105 medium supplemented with 0.5% FBS were incubated for 48 h against a gradient of 10% FBS for OVCAR-3 cells and CaOV-3 cells. Cells on the lower side of the membrane were fixed with ice-cold methanol, stained with Hoechst 33258 (Sigma), and the number of nuclei was counted using a Zeiss Axiophot epifluorescent microscope equipped with a digital camera and Northern Eclipse 6.0 software from Empix Imaging (Empix Imaging, Mississauga, ON). Individual experiments were run with duplicate inserts and five microscopic fields were counted per insert.  Data analysis Results are shown as the mean ± SEM of three independent experiments. Data were analyzed by one-way ANOVA followed by Tukey test using PRISM software (GraphPad Software Inc., San Diego, CA, USA). Values were considered significantly different from each other at p < 0.05.  5.3 Results GnRH-II activates PI3K/Akt and -catenin signaling pathways in ovarian cancer cells We first set out to identify downstream signaling events in ovarian cancer cells after treatment with GnRH-II. As shown in Figure 5.1A and B, when OVACAR-3 and CaOV-3  102  ovarian cancer cells were treated with 10 nM GnRH-II for different times (5, 15, 30, 60 min), there was a transient increase in the phosphorylation of both Akt and GSK. Although the phosphorylation of Akt decreases in GnRH-II-treated cells after 30 min, we observed a progressive increase in GSK3 phosphorylation up to 60 min after GnRH-II treatment (Fig. 5.1A and B). This is important because the phosphorylation status of GSK3 mediates the stabilization and accumulation of nuclear -catenin (296). In this regard, when nuclear lysates of the GnRH-II-treated OVCAR-3 and CaOV-3 cells were subjected to Western blotting, it was also apparent that GnRH-II promotes the accumulation of -catenin in the nucleus for at least 60 min (Fig. 5.1C and D). To examine whether the GnRH-II-induced -catenin nuclear translocation is a GnRHRdependent mechanism, OVCAR-3 cells and CaOV-3 cells were treated overnight with GnRHR siRNA prior treatment with GnRH-II for 30 min. Nuclear lysates of these treated cells were then prepared to monitor the accumulation of -catenin in the nucleus by Western blotting. This revealed that depletion of GnRHR in these cell lines attenuated the GnRH-II-induced -catenin accumulation in the nucleus (Fig. 5.1E and F). To determine whether GnRH-II treatment of OVCAR-3 or CaOV-3 cells induced the activity of -catenin as a transcription factor, we transfected these cancer cells with the TOPFLASH luciferase reporter gene and then treated them with GnRH-II for 24 h before measurement of luciferase activity. As shown in Figure 5.2A and B, GnRH-II induces 2 - 3 fold increases in luciferase activity in OVCAR-3 cells and CaOV-3 cells. In addition, this induction was completely inhibited by pre-treatment with a PI3K/Akt signaling inhibitor, LY294002 (Fig. 5.2A and B), suggesting that GnRH-II activates the PI3K/Akt pathway and that this induces catenin signaling in these ovarian cancer cells. Under similar conditions, cells pre-treated with  103  LY294002 attenuated GnRH-II-induced invasion in OVCAR-3 and CaOV-3 cells (Fig. 5.2C and D). To verify whether activation of PI3K/Akt signaling results in the phosphorylation of GSK, and thereby contributes to GnRH-II-induced -catenin nuclear translocation, OVCAR3 (Fig. 5.3A) and CaOV-3 cells (Fig. 5.3B) were pre-treated with LY294200 for 30 min prior 10 nM GnRH-II treatment. Treated cells were harvested and subjected to Western blotting to determine the phosphorylation status of GSK3. The results suggest that GnRH-II-induced PI3K/Akt signaling involves an increase in GnRH-II mediated GSK3 phosphorylation.  GnRH-II up-regulates MT1-MMP production in a GnRHR-dependent manner The MT1-MMP has been shown to play a role in ovarian cancer cells invasion (304). When OVCAR-3 cells and CaOV-3 cells were treated with GnRH-II for 24 h and 48 h, we observed significant increases in their MT1-MMP levels (Fig. 5.4A and B). To examine whether GnRH-II acts through the GnRHR to exert this effect in OVCAR-3 and CaOV-3 cells, the cells were pre-treated with GnRHR siRNA to knock down the endogenous levels of GnRHR. In cells depleted of GnRHR, GnRH-II treatment failed to increase MT1-MMP levels (Fig. 5.4C and D).  The -catenin signaling pathway increases MT1-MMP production in ovarian cancer cells It is known that -catenin signaling directly influences human MT1-MMP gene transcription (305). To examine whether MT1-MMP is a downstream target of -catenin signaling in ovarian cancer cells, OVCAR-3 cells (Fig. 5.5A) and CaOV-3 cells (Fig 5.5B) were treated with lithium chloride (LiCl) for 24 h. We used LiCl for this purpose because it is known to increase the phosphorylation of GSK3 and to thereby facilitate the nuclear translocation of -catenin (306) in numerous cell types (307, 308). When cell lysates of LiCl-treated cells were 104  prepared and subjected to Western blotting, we observed an increase in MT1-MMP levels (Fig. 5.5A and B), which would be consistent with an activation of -catenin To further assess the role of -catenin in terms of GnRH-II-induced MT1-MMP production in ovarian cancer cells, a specific siRNA was used to knock down -catenin levels in OVCAR-3 and CaOV-3 cells (Fig. 5.5C and D). In CaOV-3 cells, we consistently observed an immunoreactive band that migrates with a higher molecular size than -catenin. Since the intensity of this immunoreactive band was not influenced by treatment of the cells with a catenin siRNA (Fig. 5.5D), we conclude that it represents a non-specific interaction between the -catenin antibody and another protein. As shown in Figure 5.5C and D, depletion of -catenin abolished the GnRH-II-induced MT1-MMP levels, which indicates that GnRH-II-activated catenin signaling up-regulates MT1-MMP production in these ovarian cancer cells. In addition, this increase in MT1-MMP synthesis was attenuated when we blocked PI3K/Akt signaling by pre-treatment of OVCAR-3 (Fig. 5.5E) and CaOV-3 cells (Fig. 5.5F) with LY294200 for 30 min prior GnRH-II treatment, suggesting that GnRH-II activates PI3K/Akt signaling and increases -catenin accumulation in the nucleus, and that these events participate in up-regulating MT1MMP production in ovarian cancer cells.  -Catenin enhances MT1-MMP production and contributes to GnRH-II induced ovarian cancer cell invasion Our finding that -catenin signaling stimulates MT1-MMP production after GnRH-II treatment suggests that it plays a role in GnRH-II-induced ovarian cancer cell invasion. Thus, we employed a siRNA strategy to explore the role of -catenin and MT1-MMP in GnRH-II induced invasion in OVCAR-3 cells and CaOV-3 cells. Both cell lines were treated with catenin siRNA (Fig. 5.6A and B) or MT1-MMP siRNA (Fig. 5.6C and D), prior to an invasion 105  assay. As compared with OVCAR-3 cells and CaOV-3 cells treated with control siRNA, the corresponding cells depleted of -catenin or MT1-MMP were resistant to a GnRH-II induced increase in their invasive potential.  5.4 Discussion Recent studies have demonstrated that activation of GnRHR initiates Wnt/-catenin signaling and indirectly promotes GnRH-induced LH-subunit gene expression in gonadotropes (92). Interestingly, the initiation of Wnt signaling by GnRH-I and GnRH-II in the human embryonic kidney 293 cell line can be manipulated by over-expressing GnRHR (93), suggesting that the involvement of GnRH/GnRHR signaling and the-catenin pathway extends to extrapituitary cell types. In this regard, we now provide evidence that GnRH-II activates -catenin signaling and promotes the invasive properties of GnRHR positive ovarian cancer cells. It is well known that GSK3 is a negative regulator of Wnt signaling (94), and that activation of the PI3K/Akt pathway regulates the phosphorylation of GSK3 which acts to enhance -catenin nuclear translocation (309). Likewise, we have found that GnRH-II induced PI3K/Akt signaling stimulates the phosphorylation of GSK3and that GnRH-II treatment fails to enhance the transcriptional activity of -catenin, as measured in a TOPflash luciferase reporter gene assay (293), when GSK3phosphorylation is blocked. These data imply that PI3K/Akt signaling plays a key role in the -catenin mediated effects of GnRH-II in ovarian cancer cells. The Wnt/-catenin signaling pathway has been well defined in terms of the physiologic regulation of many cells (310-312), and the progression of different cancer cell types (313). There are two ways that Wnt/-catenin signalling can contribute to the oncogenic phenotype, both of which enhance -catenin translocation and accumulation in the nucleus, where it 106  associates with T-cell factor/lymphoid enhancer factor (TCF/LEF) and thereby initiates transcription of pro-invasive target genes (88). In the first instance, mutation of a tumor suppressor gene, adenomatous polyposis coli (APC), disrupts the normal formation of the APC/GSK3/-catenin complex in the cytoplasm, and leads to aberrant translocation of catenin to the nucleus (314). In the second scenario, mutations in -catenin gene result in the constitutive accumulation of -catenin in the cell nucleus (315). While there is no evidence for an etiologic role for APC in ovarian cancer (316), there is compelling evidence for altered Wnt signaling and increased nuclear -catenin levels in different ovarian carcinoma subtypes (317, 318), and that this contributes to ovarian cancer progression (96). In particular, a significant correlation has been reported between nuclear -catenin accumulation and the grade of serous carcinomas, which shows a trend toward decreased survival (104). In line with these reports, our findings suggest that -catenin signaling plays an important role in GnRH-II mediated increases in ovarian cancer cell invasion. We therefore considered it important to examine potential targets of -catenin signaling that might contribute to the increased invasive properties of ovarian cancer cells after treatment with GnRH-II, and we focussed our attention on MT1-MMP because it is frequently expressed in a variety of human tumors (297), including ovarian cancer (303), and because there is a well defined TCF/LEF binding site for -catenin in the MT1-MMP promoter (319). Our experiments indicate that GnRH-II stimulates MT1-MMP synthesis in ovarian cancer cells in a GnRHRdependent manner, and that this involves the activation of PI3K/Akt signaling, which leads to an increase in the transcriptional activity of -catenin. In line with observations that altered levels of MT1-MMP are associated with cancer cell invasion (297), our data also show that siRNAmediated depletion of MT1-MMP attenuates GnRH-II enhanced ovarian cancer cell invasion by ~ 50%. Although MT1-MMP can act as a processing enzyme for CD44 and collagen I (156), 107  one of its primary functions is to cleave the proMMP-2 zymogen into its enzymatically active form (158, 320) which functions to promote cancer cell motility (172, 321, 322). We consider this to be particularly important because we have also recently found that GnRH-II indirectly increases MMP-2 expression (Poon et al., unpublished) in ovarian cancer cells. Moreover, since -catenin activation does not play a role in GnRH-II mediated increases in MMP-2 expression (data not shown), we conclude that the autocrine actions GnRH-II/GnRHR activate multiple independent pathways which converge and additively contribute to the over-production of MMP-2. The ECM is generally characterized as either a basement membrane or stromal/interstitial type. Matrigel is a synthetic ECM comprising an Engelbreth-Holm-Swarm mouse sarcoma extract, which includes laminin, collagen IV and entactin, and is thought to resemble the basement membrane (323). By contrast, collagen I is a major component of the stromal/interstitial type of ECM, and collagen I coated transwells have recently been suggested be a more appropriate model for studies of cancer cell invasion (324). While the use of collagen I coated transwells for studies of ovarian cancer cell invasion has so far been limited (303), Matrigel-based invasion assays have been used extensively to monitor the invasive potential of a variety of cancer cell types (325), including the role of MT1-MMP in this process using ovarian cancer cells (326). Building on evidence in the latter report that MT1-MMP is an important player in ovarian cancer cell invasion, our experiments provide multiple lines of evidence that GnRH-II-up-regulated MT1-MMP is required for the GnRH-II-enhanced invasion of two human ovarian cancer cells in Matrigel-based invasion assays. However, it will be of interest to assess the role(s) of GnRH-II and its downstream signaling in ovarian cancer cell using both Matrigel and collagen I coated transwells, in order to determine how the GnRH-II treated cancer cells respond to different types of ECM.  108  In summary, our studies reveal a novel mechanism by which GnRH-II-enhances invasion in ovarian cancer cells. In this scenario (Fig. 5.7), we propose that GnRH-II stimulation of ovarian cancer cell results in the phosphorylation of Akt and induces PI3K/Akt signaling, which subsequently enhances the phosphorylation of GSK3 and activates -catenin signaling. The translocation of -catenin into the nucleus up-regulates the -catenin-target gene, MT1MMP, and thereby contributes to the autocrine actions of GnRH-II in ovarian cancer cell metastasis.  109  FIG. 5.1. GnRH-II increases the phosphorylation of Akt and GSK3andinduces -catenin nuclear translocation in ovarian cancer cells. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 10 nM GnRH-II for different times (5, 15, 30, 60 min). Cells harvested were subjected to Western blotting to detect the phosphorylation of Akt (p-Akt) and the phosphorylation of GSK3(p-GSK3). Total Akt (TAkt) and -actin were used as a normalization control. (C) OVCAR-3 cells and (D) CaOV-3 cells were treated with 10 nM GnRH-II for different times (15, 30, 60, 120 min). Treated cells were then harvested and their nuclear lysates were subjected to Western blotting to measure -catenin levels. (E) OVCAR-3 and (F) CaOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h and then treated with 10 nM GnRH-II for a further 30 min. Treated cells were harvested for the preparation of nuclear cell -catenin levels were determined by Western blotting. Histone was used as a normalization control in (C-F). Western blots are representative of results from three independent experiments.  110  FIG. 5.2. GnRH-II-induced PI3K/Akt signaling increases -catenin-dependent luciferase reporter gene activity and promotes ovarian cancer cell invasion. (A) OVCAR-3 cells and (B) CaOV-3 cells were transfected with a TOPFlash luciferase reporter gene plasmid for 24 h. Transfected cells were then pre-treated with 10 M LY294002 (LY) for 30 min prior treatment with 10 nM GnRH-II for 24 h. Cell lysates were collected for luciferase assays, and measurements of -galactosidase activity as a control for transfection efficiency. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl). (C) OVCAR-3 and (D) CaOV-3 cells were pre-treated with 10 M LY294002 (LY) for 30 min and then seeded into Matrigel-coated transwells and cultured for 48 h in the presence or absence of 10 nM GnRH-II. Non-invading cells were wiped from the upper side of the filter and nuclei of invading cells were stained with Hoechst 33258 and counted. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl).  111  FIG. 5.3. GnRH-II-induced PI3K/Akt signaling increases the phosphorylation of GSK3. (A) OVCAR-3 and (B) CaOV-3 cells were pre-treated with 10 M of the PI3K/Akt signaling inhibitor, LY294002 (LY), for 30 min prior treatment with 10 nM GnRH-II for a further 15 min. Treated cells were harvested for Western blotting to detect the phosphorylation of GSK3(p-GSK3). Phosphorylated Akt (p-Akt) and total Akt (T-Akt) were probed to determine the efficiency of LY treatments, and -actin was used as a normalization control. Western blots are representative of results from three independent experiments.  112  FIG. 5.4. GnRH-II increases MT1-MMP production in ovarian cancer cells. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 10 nM GnRH-II for 24 h or 48 h. Cells harvested were then subjected to Western blotting and probed for MT1-MMP levels. β-actin was used as a normalization control. Upper panel shows a representative Western blot and lower panel shows the quantitative results expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl) of the indicated time point. (C) OVCAR-3 cells and (D) CaOV-3 cells were treated with 100 nM GnRHR siRNA (si-GnRHR) or 100 nM control siRNA (si-Ctrl) for 24 h, and then treated with 10 nM GnRH-II for a further 24 h. Treated cells were harvested and cell lysates were prepared to measure MT1-MMP levels. GnRHR was detected to confirm the efficiency of the GnRHR siRNA treatments, and β-actin was  used as a normalization control.  113  FIG. 5.5. PI3K/Akt and -catenin signal transduction pathways regulate GnRH-II-induced MT1MMP production in ovarian cancer cells. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 20 M LiCl for 24 h. Treated cells were harvested and their cell lysates were subjected to Western blotting to measure MT1-MMP levels. (C) OVCAR-3 cells and (D) CaOV-3 cells were treated with 50 nM catenin siRNA (si--catenin) or 50 nM control siRNA (si-Ctrl) for 24 h prior to treatment with 10 nM GnRH-II for a further 24 h. Cell lysates were then harvested to measure the protein levels of MT1-MMP by Western blotting. The efficiency of the -catenin siRNA was verified by Western blotting and -actin was used as the normalization control. (E) OVCAR-3 and (F) CaOV-3 cells were pre-treated with 10 M LY294002 (LY) for 30 min prior treatment with 10 nM GnRH-II for a further 24 h. Treated cells were harvested and cell lysates were used to measure MT1-MMP levels by Western blotting and β-actin was used as a normalization control.  114  FIG. 5.6. -Catenin signaling and MT1-MMP contribute to GnRH-II-enhanced ovarian cancer cell invasion. (A) OVCAR-3 and (B) CaOV-3 cells were treated with 50 nM -catenin siRNA (si--catenin) or 50 nM control siRNA (si-Ctrl) for 24 h prior to an invasion assay in the presence or absence of 10 nM GnRN-II for a further 48 h. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with control siRNA (si-Ctrl). (C) OVCAR-3 and (D) CaOV-3 cells were treated with 50 nM MT1-MMP siRNA (si-MT1-MMP) or 50 nM control siRNA (si-Ctrl) for 24 h prior to an invasion assay in the presence or absence of 10 nM GnRH-II for a further 48 h. The efficiency for MT1-MMP siRNA was verified by Western blotting. Results are expressed as mean ± SEM of three independent experiments. * p<0.05 compared with control siRNA (si-Ctrl).  115  FIG. 5.7. Proposed model illustrating how GnRH-II induced MT1-MMP may contribute to ovarian cancer cell invasion. GnRH-II acts via the GnRHR to induce the phosphorylation of Akt. Phosphorylated Akt stimulates the phosphorylation of GSK3 and this thereby releases -catenin, which can then and translocate to the nucleus. The accumulation of -catenin in the nucleus acts on the TCF/LEF site within the MT1-MMP promoter which causes an up-regulation of MT1-MMP expression in ovarian cancer cells. Increased production of MT1-MMP contributes to the GnRH-II-enhanced ovarian cancer cell invasion by increasing the cleavage of proMMP-2 zymogen into its active form. GnRHR, GnRH receptor; p-Akt, phosphorylated Akt; p-GSK3, phosphorylated glycogen synthase 3; TCF/LEF, T cell factor/lymphoid enhancer binding factor; MT1-MMP, membrane type I matrix metalloproteinase; MMP-2, matrix metalloproteinase-2.  116  CHATER 6. Expression of the 67 kDa non-integrin laminin receptor in highgrade serous ovarian carcinoma 6.1 Introduction Ovarian cancer is the most lethal gynecological malignancy and the fourth most common cause of female cancer deaths (100) (Canadian Cancer Society Stats). Each year, there are approximately 42,000 new cases in Europe (101) and 22,000 new cases in the USA (102). Approximately 90% of ovarian cancers are epithelial carcinomas (327) and these are classified by their histological features. Most common are serous (50%) tumor followed by endometrioid (20%), mucinous (10%), clear cell (5%), and also some rare cases including transitional, mixed, or undifferentiated (<5%) (328-330). Mortality and morbidity from this cancer arise mainly from intra-abdominal disease spread (205). Thus, it is important to elucidate the biology of how ovarian cancers metastasize. This knowledge could lead to the development of new prognostic tools and, more importantly, to better disease treatment. The degradation and invasion of the basement membrane (BM) by malignant cells is a crucial step in the local invasion and distant metastasis of aggressive epithelial malignancies (331-333). It involves multiple steps, including cell adhesion, extracellular matrix degradation, and subsequent migration of cancer cells (334). Several gene products have been identified as key elements in BM penetration, including various cell surface laminin receptors. Among these, the 67 kDa high-affinity non-integrin laminin receptor (67LR), which was first isolated from cancer cell membranes (173-175), exhibits increased expression in many highly metastatic cancer cells (177). 67LR expression is also associated with poor differentiation, disease progression and poor survival (180, 281). Studies demonstrated that the mature 67LR is formed by the homodimerization of a 37 kDa laminin receptor precursor protein (LRP) (180, 181). Thus, LRP levels can be used as an index to reflect the levels of 67LR on the cell surface. 117  Clinically, LRP levels have been correlated with the presence of malignancy (205), high histological grade (206), suboptimal debulking (205) and poor outcome (205, 206) in ovarian carcinoma (207). In line with these studies, our group demonstrated in an in vitro model that altered LRP levels correlate with the invasiveness of ovarian cancer cell lines and the upregulation of pro-invasive target gene expression (Chapter IV). Although there is some controversy in the literature, we aimed to clarify the role of LRP or 67LR in ovarian carcinoma. We analyzed LRP levels in a well-studied population of ovarian cancer patients using tissue microarray, with the goal of determining whether this protein is correlated with clinical outcomes and survival, particularly in high-grade serous ovarian carcinoma.  6.2 Materials and methods Patient population Approval for the study was obtained from the ethics committee of the University of British Columbia. Most women diagnosed with ovarian cancer in British Columbia are treated at the British Columbia Cancer agency (BCCA) and provincial treatment guidelines were followed. Outcomes are tracked via the Cheryl Brown Ovarian Cancer Outcomes Unit, an ovarian cancer database of the BCCA. 445 cases, dated between the years of 1994 – 2004, were considered for tissue microarray (335). Due to insufficient sample size, we excluded patients diagnosed with mucinous, clear cell, endometroid, and low-grade serous ovarian carcinoma (Table 6.1). In order to avoid potential confounding clinical variables we restricted our analysis to high-grade serous cancers of advanced stage (III and IV) all of whom were treated by initial surgery. We excluded patients treated by neoadjuvant chemotherapy and those that were histologically diagnosed as non-epithelial cell tumors or metastatic tumors (Table 6.2).  118  Tissue microarray (TMA) and immunohistochemistry The ovarian cancer TMA construction was as previously described (335). A gynecological pathologist performed a blinded full-slide review of the 632 cases. Tumor cell type and grade (Silverberg) were assessed. After review, 445 cases of invasive ovarian carcinoma were available in tissue blocks for tissue microarray construction. A representative area of each tumor was selected, and a duplicate core TMA was constructed (Beecher Instruments, Silver Springs, MD, USA). Serial 4 μm sections were cut for immunohistochemical (IHC) analysis and run through an automated protocol, including heat antigen retrieval (Ventana System) (335). LRP monoclonal antibody (MLuC5; Santa Cruz, Cat# SC59732) was optimized prior usage. We scored both membrane and vascular staining, and did not assess cytoplasmic staining. 67LR staining was scored as 0 for negative cases, +1 for mild staining (~1% to 5%), and +2 for intense staining (>50%) (Fig. 6.1A, B, C). Vascular staining of 67LR was graded as present or absent (Fig. 6.1D). If present, there had to be obvious and uniform staining of most of the vessels in the core examined.  Statistical analysis Univariable survival analysis was performed by the generation of Kaplan-Meier curves, and differences between groups were assessed using the logrank statistic (335). Multivariable survival analysis was performed using the Cox Proportional Hazards Model (335). Contingency tables and the Pearson chi-square statistic were used to assess changes in the distribution of LRP expression across different stages of high grade serous ovarian carcinoma (335). All analyses were performed using JMP version 6.0.3 (SAS Institute, Cary NC, USA).  119  6.3 Results Expression of the 67LR in ovarian carcinoma samples Of the 120 cases of high-grade serous carcinoma (stage III & IV), 19 cases (16%) scored +2, 25 cases (21%) scored +1 and 76 cases (63%) were negative for 67LR. Our contingency analysis showed that cancer stage (III & IV) correlates with the membrane staining of 67LR (p=0.0202). The Kaplan-Meier analysis showed that the expression of 67LR does not correlate with the overall survival of these cases (Fig. 6.2). Of the same 120 cases high-grade serous ovarian carcinoma (stage III & IV), 101 cases (84%) were negative for 67LR staining in the vessels while 18 cases (15%) scored positive. Contingency analysis showed that stage (III & IV) does not correlate with 67LR positivity in vessels (p=0.2968) and Kaplan-Meier analysis showed that the expression of 67LR in vessels does not correlate with the overall survival of patients (Fig 6.3). However, when all stages (I, II, III, IV) of high-grade serous ovarian carcinoma were considered, Cox regression analysis showed that vessel staining conferred a better outcome, though this difference was of borderline statistical significance (p=0.0425).  6.4 Discussion The expression of 67LR has been correlated with the prognosis of a variety of carcinomas (281). Therefore, it has been suggested that the detection of 67LR in tumor cells may constitute the basis for new strategies of evaluating prognosis. Presently, our tissue microaaray results show that the membrane staining of 67LR correlates with stages in highgrade serous ovarian carcinoma (stage III & IV). However, the expression of 67LR does not correlate with the overall survival of these patients. Instead, the presence of 67LR within the vessels of tumors may confer a better outcome for these patients.  120  Studies of the prognostic role of 67LR in ovarian carcinomas have been inconclusive. Castronovo et al. reported that ovarian cancer patients who experience subsequent progression of the disease (i.e., alive with recurrence or dead of the disease) and patients with high-grade tumors were characterized by significantly higher levels of 67LR membrane staining in their tumor specimens (205, 206). Reich et al. reported that the high expression of 67LR in tumor cells did not predict disease outcome in either effusions or solid tumors (207). These results may be confounding because the cohort of patients used by Castronovo et al. consisted of different histotypes (i.e., serous, mucinous, endometrioid, clear cell and undifferentiated) and stages (stages I, II, III and IV) of ovarian carcinoma, whereas the patients used in the Reich study included both primary and metastatic lesions of serous ovarian carcinoma. Moreover, the populations in the above studies also included patients who were treated with chemotherapy, which may also contribute to the contradictory results in terms of patient outcomes. Because the etiologies of different ovarian carcinoma histotypes (i.e., low-grade serous, high-grade serous, mucinous, endometrioid, clear cell and undifferentiated) are distinct and the biological aggressiveness and behavior of each subtype is variable (336), our present study only focused on patients with high-grade stage III & IV serous ovarian carcinoma, one of the most common and lethal subtypes of ovarian cancer. We excluded those patients who had received neoadjuvant therapy. In this regard, our results showed that although membrane staining of 67LR is correlated with stage in high-grade serous ovarian carcinoma, it does not have prognostic value in this subtype of ovarian carcinoma. The basement membrane is comprised of different components in a location-specific manner. In this regard, 67LR may associate with different laminin subunits, integrin subtypes or other membrane-bound proteins, leading to distinct effects in a cell type-specific manner. This assumption was evident in in vitro and ex vivo studies, which have demonstrated that 67LR acts as a receptor for the green tea polyphenol epigallocatechin-3-gallate (337-339) and pigment 121  epithelium-derived growth factor to induce apoptosis or inhibit endothelial cell growth (340). These results contradict its role in promoting tumor progression. While the over-expression of 67LR within the vascular endothelium endothelial cells of a variety of tumor types has been well documented (341), both Castronovo and Reiche stated that 67LR staining occurred in the vasculature of their patients. However, they did not clarify whether this staining was histotypespecific nor did they provide statistical data on the significance of 67LR expression in the vessels of ovarian carcinomas. Presently, we have now found that although expression of 67LR within the vessels of stage III & IV high-grade serous ovarian carcinoma did not have any prognostic value, analysis including all stages of high-grade serous patients showed that this 67LR vessel staining confer better outcomes. The interactions between tumor and stromal cells are now considered to play a significant role during tumor development and progression. For example, our present results agree with our in vitro studies in that 67LR is expressed in highly invasive ovarian carcinoma. Intriguingly, 67LR expression within the vasculature may have contradictory effects compared to its role in tumor cells. This apparent contradiction is interesting and leads to a series of questions: what role might 67LR play in endothelial cell functions, and, specifically, how might this receptor affect ovarian cancer metastasis? Larger prospective studies are needed to validate the prognostic role of 67LR vessel staining in ovarian cancer patients, particularly those patients with high-grade serous ovarian carcinoma.  122  Table 6.1. Percentage of 67LR membrane staining positive cases within the histological subtypes.  123  Table 6.2. Study population in the present analysis.  124  FIG. 6.1. Immunoreacitivty pattern of LRP. (A) Representative sample of negative cases show complete lack of staining and are classified as 0. (B) Represntative sample of +2 intense immunoreacitivy exhibits dark brown staining in tumor cell membrane. (C) Representative sample of +1 intense immunoreactivity exhibits moderate brown staining in tumor cell membrane. (D) Representative sample showing LRP staining in vessels.  125  FIG. 6.2. Kaplan-Meier overall survival curve for 67LR membrane staining in stage III and IV high-grade serous ovarian carcinoma.  126  FIG. 6.3. Kaplan-Meier overall survival curve for 67LR vessel staining in stage III and IV highgrade serous ovarian carcinoma.  127  CHAPTER 7. Conclusion and future directions 7.1 Overview GnRH-II has been proposed to act in an autocrine/paracrine manner during cancer progression. However, studies designed to test this hypothesis have been limited to the preliminary characterization of GnRH-II expression, and they have not addressed in detail how GnRH-II functions as an autocrine regulator in cancer cell biology. Thus, the studies described herein were designed to delineate the molecular regulation of GnRH-II in ovarian cancer cell lines and to verify the role of GnRH-II and its downstream effectors in these cells. First, we demonstrated that the cAMP-responsive element is a cis-acting element that is necessary and sufficient for both basal (Chapter II) and EGF-induced (Chapter III) human GnRH-II promoter activity. We then verified that EGF-induced GnRH-II production enhances the invasive potential of ovarian cancer cells (Chapter III). We built upon these results in the subsequent chapters, which describe the downstream mechanisms of GnRH-II/GnRHR autocrine action in ovarian cancer cells (Chapter IV and Chapter V). Ovarian cancer metastasis is a complex process that involves the detachment of tumor cells from the primary lesion and the subsequent attachment of these cells to the peritoneum or omentum (342, 343). In this regard, increased expression of matrix metalloproteinases (MMPs) (143) and/or adhesion molecules (344) may favor the remodeling of the extracellular matrix, thereby resulting in the degradation of the basement membrane, which would allow the tumor cells to invade surrounding tissue. We have found that GnRH-II/GnRHR autocrine actions stimulate the expression of MMP-2 (Chapter IV) and MT1-MMP (Chapter V) in ovarian cancer cells. In this context, the increased production of the 67 kDa non-integrin laminin receptor (67LR) induced by GnRH-II is a critical intermediary step, which leads to an interaction between the 67LR and laminin and the induction of MMP-2 expression in ovarian cancer cells  128  (Chapter IV). The increased expression of MT1-MMP is regulated by -catenin signaling, which is activated by GnRH-II-induced PI3K/Akt signaling (Chapter V). Taken together, the present studies represent a model system that provides insight into the regulation of GnRH-II expression and its potential functional role in ovarian cancer carcinoma (Fig. 7.1).  7.2 The importance of EGF-induced GnRH-II production Compelling evidence suggests that hormones and growth factors influence the occurrence of ovarian carcinoma (71, 345). Among the variety of growth factors and cytokines tested in our cell model (i.e., EGF, HGF, FGF, leptin; Appendix I), only EGF was found to rapidly stimulate GnRH-II transcription. Only GnRH-II, not GnRH-I, is regulated by EGF/EGFR (Chapter III). This result may be explained by the distinct cis-acting elements that are required for the regulation of GnRH-I and GnRH-II transcription. In this regard, the GnRH-I promoter region lacks the cAMP-responsive element (11), which plays a critical role in driving basal GnRH-II transcriptional activity. Interestingly, we found that EGF regulates GnRH-II transcriptional activity in human choriocarcinoma JEG-3 cells (Appendix II) in a manner similar to ovarian cancer cell lines. Moreover, this increase in GnRH-II production contributes to the invasive potential of JEG-3 cells (Appendix II). Elevated levels of GnRH-II and GnRHR have been reported in placental tissues during the first trimester of pregnancy (68, 346). In line with these reports, studies have demonstrated that GnRH-II treatment enhances the expression of matrix metalloproteinases and promotes extravillous trophoblast cell invasiveness (68, 292). Taken together, we propose that cross talk between EGF/EGFR and GnRH-II/GnRHR signaling pathways may constitute an autocrine regulatory system that promotes implantation, and it deserves further investigation.  129  7.3 The role of LRP in ovarian cancer cell invasive potential In chapter V, we observe that the ranking of LRP levels in the three ovarian cancer cell lines (SKOV-3>CaOV-3>OVCAR-3) corresponds to their invasiveness (i.e., from most invasive to least invasive). However, it should be noted that SKOV-3 cells have only limited GnRHR levels, and consequently did not respond to GnRH-II treatment. In other words, the regulation of LRP expression in this highly invasive cell line is independent of the autocrine action of GnRH-II/GnRHR. Thus, further studies are required to fully understand the complex regulation of LRP expression in ovarian cancer cells. Several LRP modulated target genes were identified using our in vitro model. Overexpression of LRP induces N-cadherin expression in ovarian cancer cells (Appendix III). Cadherin switching occurs during epithelial-mesenchymal transition and thereby plays a critical role during tumor progression (347). Although the expression of E-cadherin was not affected in these LRP over-expressing cells, we also know that increased N-cadherin is required for the LRP-mediated increase in ovarian cancer cell invasiveness (Appendix III). These results are consistent with past studies in which both laminin and integrin signaling mediate the expression of N-cadherin during tumor progression (348). They do, however, imply that the interaction between 67LR and laminin regulates the expression of distinct molecules that are important during ovarian tumorigenesis (202, 349, 350). It will therefore be worthwhile to investigate the role of LRP in ovarian cancer cell progression in greater detail. Although our in vitro findings suggest that 67LR plays a key role in determining the invasive potential of ovarian cancer cells, our tissue microarray studies indicate that the expression of 67LR does not correlate with the overall survival of high-grade serous ovarian carcinoma patients (stage III & IV). Nevertheless, we did observe a trend in the expression of 67LR in other ovarian carcinoma subtypes, but a statistical analysis with such a limited sample size of other subtypes would not be conclusive. We are therefore now performing another tissue 130  microarray analysis with a larger number of patient samples to assess the role of 67LR in ovarian carcinoma.  7.4 The role of GnRH-II/GnRHR-induced MMP-2 and MT1-MMP in ovarian cancer cells MMP-2 (268), -9 (166), and MT1-MMP (304, 351) are among the most studied MMPs in ovarian carcinoma. The expression of these three proteases increases in advanced ovarian cancers (International Federation of Gynecology and Obstetrics stage III) more so than in benign tumors. Increased expression of each proteinase was found to be an independent prognosticator of poor survival or cancer progression (164, 352, 353). Not only do the tumor cells secrete these enzymes, but the stromal cells around the tumor may also contribute to the up-regulation of these enzymes during tumor-stromal cell interactions, thus contributing to cancer progression (144). In our cell system, we found that GnRH-II up-regulates the production of both MMP-2 and MT1-MMP in a similar time frame (Chapter IV and V). However, the downstream signaling events involved in the regulation of these two enzymes are distinct and independent of one another (Chapter IV, V and Appendix). Upon comparing the promoter regions of MMP-2 and MT1-MMP, only MT1-MMP possesses an intact -catenin recognition motif (TCF/LEF binding site) and is known to respond to the stimulation of Wnt/-catenin signaling (305, 354, 355). Studies of MMP-2 demonstrated that there are no TCF binding sites within its promoter region. Instead, intact AP-1 (24, 356) and SP-1 (357) recognition motifs were shown to be important for MMP-2 transcriptional activity (358). In fact, both AP-1 and SP-1 transcription factors are known to be regulated by GnRH/GnRHR downstream signaling (2, 53). Thus, it would be worthwhile to study the impact of GnRH-II/GnRHR signaling on MMP-2 and MT1-MMP promoter activity.  131  Studies have shown that MT1-MMP may itself degrade the ECM (359) or may act as a physiological activator of pro-MMP-2 (158, 360). In either case, these effects promote cancer cell invasion (297). Our present studies demonstrated that both proteinases contribute to ovarian cancer cell invasiveness (Chapter IV and V). However, siRNA-mediated depletion of either MT1-MMP or its signaling regulator, -catenin, only resulted in partial inhibition of GnRH-IIinduced ovarian cancer cell invasion (Chapter V) compared with siRNA-mediated MMP-2 depletion, which led to a total inhibition of GnRH-II-enhanced invasiveness in the same cell lines (Chapter IV). These findings imply that the GnRH-II-induced increases in MMP-2 and MT1-MMP expression may act synergistically to enhance ovarian cancer cell invasiveness. Thus, it would be of interest to verify whether increased MT1-MMP enhances MMP-2 proteolytic activity in our model system. These results may further define the role of these two proteinases in GnRH-II-regulated ovarian cancer cell progression. Activation of MMP-2 at the cell surface is a complex and unique multistep pathway that involves not only MT1-MMP but also the tissue inhibitor of MMP-2, TIMP-2 (361). TIMP-2 can directly bind with either pro-MMP-2 or MT1-MMP. In this regards, the activated MT1MMP binds with TIMP-2 and thus allow the cleavage of pro-MMP-2 by MT1-MMP (362). MT1-MMP alone does not fully activate MMP-2; an additional activated MMP-2 is required to remove a residual portion of the MMP-2 propeptide (362) for the full activation of this protease. Thus, the ratio of MMP-2:MT1-MMP:TIMP-2 has been shown to play an important role in the activation of MMP-2 and thereby to enhance cancer cell progression (360). In fact, others have demonstrated a regulatory role of GnRH/GnRHR on TIMP-2 expression (71, 363). Thus, determining the role of TIMP-2 in our model system is worth further investigation.  132  7.5 The role of GnRH-II/GnRHR in ovarian cancer progression The initial rationale for the use of GnRH agonists and antagonists as therapeutic drugs in sex steroid-dependent tumors was based on their down-regulation of pituitary GnRHR and the consequent inhibition of gonadotropin and sex steroid secretion (364). The discovery of GnRH subtypes and GnRHR expression in the localized tumor tissues (53) prompted researchers to define the functional role of GnRH in cancer cell biology. Over the past two decades, in vitro studies have demonstrated that the GnRH/GnRHR system exerts anti-proliferative effects in a variety of tumor cell lines (53). Based on these studies, clinical trials explored the potential of GnRH agonists as an adjuvant therapy in a wide range of malignant tumors, including prostate cancer, breast cancer, endometrial cancer and ovarian cancer (364). Although some of the clinical trials (e.g., prostate cancer and endometrial cancer) have shown potential benefits of GnRH agonists (364), results from the phase II clinical trial for ovarian cancer did not show positive effects (95). Thus, our findings and those of others (71, 78, 365), which have shown the pro-invasive effects of GnRH-I and GnRH-II agonists in ovarian cancer, may be important for future evaluations of GnRH agonist clinical trials. The contradictory finding that GnRH agonists can have both anti-proliferative and proinvasive effects can be explanined. A similar discrepancy has been observed for the PI3K/Akt signaling pathway (366). Akt is well studied for its role as a pro-survival molecule that increases the proliferation of a variety of tumor cells (366). However, compelling evidence indicates that Akt signaling inhibits the invasiveness of tumor cells in a cell-type-specific manner (366). One possible explanation for the contradictions in both the GnRH/GnRHR system and Akt signaling may be attributed to the distinct and complex downstream molecules that are present in differential cell types. In addition, the diversity of downstream signaling pathways, which are initiated upon GnRHR activation, may be attributed to the differential functional roles of GnRH (52, 53). To further define the role of GnRH/GnRHR in ovarian cancer cell tumorigenesis, in 133  vivo studies in a GnRH-I, GnRH-II, or GnRHR knockout xenograft mouse model would be helpful for monitoring the function of GnRH in this disease. Recent morphological and molecular genetic studies have raised the question of whether epithelial ovarian carcinomas are all derived from the same origin (105, 367). This notion challenges previous reports that have identified ovarian cancer-associated genes that were “over-expressed” relative to their “normal” counterpart tissue. For example, high-grade ovarian carcinoma is now hypothesized to develop from fallopian tube epithelial cells and has been shown to possess a distinct molecular genetic signature and distinct behavior when compared with other histotypes of ovarian carcinoma (i.e., mucinous, clear cell, endometrioid) (367, 368). In this regard, studies that showed the “high expression” of GnRH subtypes and GnRHR in ovarian cancer were mostly performed by comparing “malignant” to “benign” and/or “normal” ovary tissues (34, 49, 139). Thus, the significance of these studies may have to be readdressed. Furthermore, differences in the etiologies of these ovarian carcinoma subtypes may also result in differences in the expression of different signaling molecules, receptors and tumor suppressor genes (97, 369). The cell lines we used were established in the 1980s; they were not defined as representative of a particular subtype. Thus, developing and using well-defined ovarian cancer subtype cell lines in the future can improve the interpretation of experimental outcomes. The thesis research contributes to understanding of the impact of GnRH-II/GnRHR on the invasive potential of ovarian cancer, provides insights into the progression of ovarian cancer, and provides new approaches for the evaluation of new therapeutic strategies.  134  FIG. 7.1. Proposed model for GnRH-II autocrine actions in ovarian cancer cell invasion. (1) Binding of EGF with EGFR induces receptor autophosphorylation, thereby stimulating the phosphorylation of ERK1/2. Phosphorylated ERK1/2 translocates into the nucleus and induces the phosphorylation of CREB and the interaction of C/EBPβ with p-CREB. These transcription factors bind onto the CRE site within the GnRH-II promoter and up-regulate its transcription, which increase GnRHII production. (2) Increased production of GnRH-II acts in an autocrine manner through the GnRHR, and initiate two distinct signaling events. (3) It increases 37 kDa LRP expression which results in increasing surface 67LR in ovarian cancer cells (4), thereby increases the interaction of cancer cells with laminin in the extracellular matrix and this leads to the up-regulation of MMP-2 production. (5) In addition, GnRHII/GnRHR interactions induce phosphorylation of Akt, and this activates PI3K/Akt signaling which induces GSK3phosphorylation that promotes (6) the translocation of -catenin into the nucleus where it stimulates the production of MT1-MMP. (7) Together, these events enhance MMP-2 production and activation which promotes ovarian cancer cell invasion. EGFR, EGF receptor; GnRHR, GnRH receptor; p-ERK1/2, phosphorylated ERK1/2; p-CREB, phosphorylated CREB; C/EBPβ, CCAAT/enhancer binding protein; CRE, cAMP responsive element; LRP, 37 kDa laminin receptor precursor; 67LR, 67 kDa non-integrin laminin receptor; MMP-2, matrix metalloproteinase-2; p-Akt, phophorylated Akt; pGSK3, phosphorylated gylcogen synthase 3; Tcf/LEF, T cell factor/lymphoid enhancer binding factor; MT1-MMP, membrane type I metalloproteinase. .  135  BIBLIOGRAPHY 1. 2. 3.  4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.  Conn PM, Hsueh AJ, Crowley WF, Jr. 1984 Gonadotropin-releasing hormone: molecular and cell biology, physiology, and clinical applications. Fed Proc 43:23512361 Cheng CK, Leung PC 2005 Molecular biology of gonadotropin-releasing hormone (GnRH)-I, GnRH-II, and their receptors in humans. Endocr Rev 26:283-306 Miyamoto K, Hasegawa Y, Nomura M, Igarashi M, Kangawa K, Matsuo H 1984 Identification of the second gonadotropin-releasing hormone in chicken hypothalamus: evidence that gonadotropin secretion is probably controlled by two distinct gonadotropin-releasing hormones in avian species. Proc Natl Acad Sci U S A 81:38743878 Chen A, Yahalom D, Ben-Aroya N, Kaganovsky E, Okon E, Koch Y 1998 A second isoform of gonadotropin-releasing hormone is present in the brain of human and rodents. FEBS Lett 435:199-203 Dubois EA, Zandbergen MA, Peute J, Goos HJ 2002 Evolutionary development of three gonadotropin-releasing hormone (GnRH) systems in vertebrates. Brain Res Bull 57:413-418 White RB, Eisen JA, Kasten TL, Fernald RD 1998 Second gene for gonadotropinreleasing hormone in humans. Proc Natl Acad Sci U S A 95:305-309 Densmore VS, Urbanski HF 2003 Relative effect of gonadotropin-releasing hormone (GnRH)-I and GnRH-II on gonadotropin release. J Clin Endocrinol Metab 88:2126-2134 Kauffman AS 2004 Emerging functions of gonadotropin-releasing hormone II in mammalian physiology and behaviour. J Neuroendocrinol 16:794-806 Chen A, Laskar-Levy O, Ben-Aroya N, Koch Y 2001 Transcriptional regulation of the human GnRH II gene is mediated by a putative cAMP response element. Endocrinology 142:3483-3492 Cheng CK, Hoo RL, Chow BK, Leung PC 2003 Functional cooperation between multiple regulatory elements in the untranslated exon 1 stimulates the basal transcription of the human GnRH-II gene. Mol Endocrinol 17:1175-1191 Lee VH, Lee LT, Chow BK 2008 Gonadotropin-releasing hormone: regulation of the GnRH gene. Febs J 275:5458-5478 Hoo RL, Chan KY, Leung FK, Lee LT, Leung PC, Chow BK 2007 Involvement of NF-kappaB subunit p65 and retinoic acid receptors, RARalpha and RXRalpha, in transcriptional regulation of the human GnRH II gene. Febs J 274:2695-2706 Kang SK, Tai CJ, Nathwani PS, Leung PC 2001 Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid in human granulosaluteal cells. Endocrinology 142:182-192 Krsmanovic LZ, Stojilkovic SS, Mertz LM, Tomic M, Catt KJ 1993 Expression of gonadotropin-releasing hormone receptors and autocrine regulation of neuropeptide release in immortalized hypothalamic neurons. Proc Natl Acad Sci U S A 90:3908-3912 Kang SK, Choi KC, Cheng KW, Nathwani PS, Auersperg N, Leung PC 2000 Role of gonadotropin-releasing hormone as an autocrine growth factor in human ovarian surface epithelium. Endocrinology 141:72-80 Baldwin EL, Wegorzewska IN, Flora M, Wu TJ 2007 Regulation of type II luteinizing hormone-releasing hormone (LHRH-II) gene expression by the processed peptide of LHRH-I, LHRH-(1-5) in endometrial cells. Exp Biol Med (Maywood) 232:146-155 136  17.  18. 19. 20. 21. 22. 23. 24.  25.  26. 27.  28. 29. 30. 31. 32.  Lei ZM, Rao CV 1994 Novel presence of luteinizing hormone/human chorionic gonadotropin (hCG) receptors and the down-regulating action of hCG on gonadotropinreleasing hormone gene expression in immortalized hypothalamic GT1-7 neurons. Mol Endocrinol 8:1111-1121 Lei ZM, Rao CV 1995 Signaling and transacting factors in the transcriptional inhibition of gonadotropin releasing hormone gene by human chorionic gonadotropin in immortalized hypothalamic GT1-7 neurons. Mol Cell Endocrinol 109:151-157 Lei Z, Rao CV 1997 cis-Acting elements and trans-acting proteins in the transcriptional inhibition of gonadotropin-releasing hormone gene by human chorionic gonadotropin in immortalized hypothalamic GT1-7 neurons. J Biol Chem 272:14365-14371 Chen A, Zi K, Laskar-Levy O, Koch Y 2002 The transcription of the hGnRH-I and hGnRH-II genes in human neuronal cells is differentially regulated by estrogen. J Mol Neurosci 18:67-76 Khosravi S, Leung PC 2003 Differential regulation of gonadotropin-releasing hormone (GnRH)I and GnRHII messenger ribonucleic acid by gonadal steroids in human granulosa luteal cells. J Clin Endocrinol Metab 88:663-672 Stojilkovic SS, Reinhart J, Catt KJ 1994 Gonadotropin-releasing hormone receptors: structure and signal transduction pathways. Endocr Rev 15:462-499 Sealfon SC, Weinstein H, Millar RP 1997 Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 18:180-205 Cui J, Smith RG, Mount GR, Lo JL, Yu J, Walsh TF, Singh SB, DeVita RJ, Goulet MT, Schaeffer JM, Cheng K 2000 Identification of Phe313 of the gonadotropinreleasing hormone (GnRH) receptor as a site critical for the binding of nonpeptide GnRH antagonists. Mol Endocrinol 14:671-681 Blomenrohr M, Heding A, Sellar R, Leurs R, Bogerd J, Eidne KA, Willars GB 1999 Pivotal role for the cytoplasmic carboxyl-terminal tail of a nonmammalian gonadotropinreleasing hormone receptor in cell surface expression, ligand binding, and receptor phosphorylation and internalization. Mol Pharmacol 56:1229-1237 Vrecl M, Heding A, Hanyaloglu A, Taylor PL, Eidne KA 2000 Internalization kinetics of the gonadotropin-releasing hormone (GnRH) receptor. Pflugers Arch 439:R19-20 Irmer G, Burger C, Muller R, Ortmann O, Peter U, Kakar SS, Neill JD, Schulz KD, Emons G 1995 Expression of the messenger RNAs for luteinizing hormone-releasing hormone (LHRH) and its receptor in human ovarian epithelial carcinoma. Cancer Res 55:817-822 Kaiser UB, Dushkin H, Altherr MR, Beier DR, Chin WW 1994 Chromosomal localization of the gonadotropin-releasing hormone receptor gene to human chromosome 4q13.1-q21.1 and mouse chromosome 5. Genomics 20:506-508 Peng C, Fan NC, Ligier M, Vaananen J, Leung PC 1994 Expression and regulation of gonadotropin-releasing hormone (GnRH) and GnRH receptor messenger ribonucleic acids in human granulosa-luteal cells. Endocrinology 135:1740-1746 Kakar SS 1997 Molecular structure of the human gonadotropin-releasing hormone receptor gene. Eur J Endocrinol 137:183-192 Chi L, Zhou W, Prikhozhan A, Flanagan C, Davidson JS, Golembo M, Illing N, Millar RP, Sealfon SC 1993 Cloning and characterization of the human GnRH receptor. Mol Cell Endocrinol 91:R1-6 La Rosa S, Celato N, Uccella S, Capella C 2000 Detection of gonadotropin-releasing hormone receptor in normal human pituitary cells and pituitary adenomas using immunohistochemistry. Virchows Arch 437:264-269 137  33. 34. 35. 36. 37. 38. 39. 40. 41.  42. 43.  44. 45. 46. 47.  48.  Srkalovic G, Wittliff JL, Schally AV 1990 Detection and partial characterization of receptors for [D-Trp6]-luteinizing hormone-releasing hormone and epidermal growth factor in human endometrial carcinoma. Cancer Res 50:1841-1846 Imai A, Ohno T, Iida K, Fuseya T, Furui T, Tamaya T 1994 Presence of gonadotropin-releasing hormone receptor and its messenger ribonucleic acid in endometrial carcinoma and endometrium. Gynecol Oncol 55:144-148 Chatzaki E, Bax CM, Eidne KA, Anderson L, Grudzinskas JG, Gallagher CJ 1996 The expression of gonadotropin-releasing hormone and its receptor in endometrial cancer, and its relevance as an autocrine growth factor. Cancer Res 56:2059-2065 Marinaccio M, Reshkin S, Pinto V, Paradiso A 1994 [The estimation of LHRH receptors in the tissue of human leiomyoma, myometrium and endometrium]. Minerva Ginecol 46:519-526 Iwashita M, Evans MI, Catt KJ 1986 Characterization of a gonadotropin-releasing hormone receptor site in term placenta and chorionic villi. J Clin Endocrinol Metab 62:127-133 Lin LS, Roberts VJ, Yen SS 1995 Expression of human gonadotropin-releasing hormone receptor gene in the placenta and its functional relationship to human chorionic gonadotropin secretion. J Clin Endocrinol Metab 80:580-585 Boyle TA, Belt-Davis DI, Duello TM 1998 Nucleotide sequence analyses predict that human pituitary and human placental gonadotropin-releasing hormone receptors have identical primary structures. Endocrine 9:281-287 Casan EM, Raga F, Polan ML 1999 GnRH mRNA and protein expression in human preimplantation embryos. Mol Hum Reprod 5:234-239 Limonta P, Moretti RM, Marelli MM, Dondi D, Parenti M, Motta M 1999 The luteinizing hormone-releasing hormone receptor in human prostate cancer cells: messenger ribonucleic acid expression, molecular size, and signal transduction pathway. Endocrinology 140:5250-5256 Tieva A, Stattin P, Wikstrom P, Bergh A, Damber JE 2001 Gonadotropin-releasing hormone receptor expression in the human prostate. Prostate 47:276-284 Straub B, Muller M, Krause H, Schrader M, Goessl C, Heicappell R, Miller K 2001 Increased incidence of luteinizing hormone-releasing hormone receptor gene messenger RNA expression in hormone-refractory human prostate cancers. Clin Cancer Res 7:2340-2343 Eidne KA, Flanagan CA, Harris NS, Millar RP 1987 Gonadotropin-releasing hormone (GnRH)-binding sites in human breast cancer cell lines and inhibitory effects of GnRH antagonists. J Clin Endocrinol Metab 64:425-432 Kottler ML, Starzec A, Carre MC, Lagarde JP, Martin A, Counis R 1997 The genes for gonadotropin-releasing hormone and its receptor are expressed in human breast with fibrocystic disease and cancer. Int J Cancer 71:595-599 Moriya T, Suzuki T, Pilichowska M, Ariga N, Kimura N, Ouchi N, Nagura H, Sasano H 2001 Immunohistochemical expression of gonadotropin releasing hormone receptor in human breast carcinoma. Pathol Int 51:333-337 Brus L, Lambalk CB, de Koning J, Helder MN, Janssens RM, Schoemaker J 1997 Specific gonadotrophin-releasing hormone analogue binding predominantly in human luteinized follicular aspirates and not in human pre-ovulatory follicles. Hum Reprod 12:769-773 Choi JH, Gilks CB, Auersperg N, Leung PC 2006 Immunolocalization of gonadotropin-releasing hormone (GnRH)-I, GnRH-II, and type I GnRH receptor during follicular development in the human ovary. J Clin Endocrinol Metab 91:4562-4570 138  49. 50. 51. 52. 53. 54.  55.  56. 57. 58.  59. 60. 61.  62.  63. 64.  Emons G, Pahwa GS, Brack C, Sturm R, Oberheuser F, Knuppen R 1989 Gonadotropin releasing hormone binding sites in human epithelial ovarian carcinomata. Eur J Cancer Clin Oncol 25:215-221 Choi KC, Auersperg N, Leung PC 2001 Expression and antiproliferative effect of a second form of gonadotropin-releasing hormone in normal and neoplastic ovarian surface epithelial cells. J Clin Endocrinol Metab 86:5075-5078 Chien CH, Chen CH, Lee CY, Chang TC, Chen RJ, Chow SN 2004 Detection of gonadotropin-releasing hormone receptor and its mRNA in primary human epithelial ovarian cancers. Int J Gynecol Cancer 14:451-458 Cheung LW, Wong AS 2008 Gonadotropin-releasing hormone: GnRH receptor signaling in extrapituitary tissues. Febs J 275:5479-5495 So WK, Cheng JC, Poon SL, Leung PC 2008 Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview. Febs J 275:5496-5511 Illing N, Troskie BE, Nahorniak CS, Hapgood JP, Peter RE, Millar RP 1999 Two gonadotropin-releasing hormone receptor subtypes with distinct ligand selectivity and differential distribution in brain and pituitary in the goldfish (Carassius auratus). Proc Natl Acad Sci U S A 96:2526-2531 Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar R, Faurholm B, Scobie G, Kuestner R, Terasawa E, Katz A 2001 A novel mammalian receptor for the evolutionarily conserved type II GnRH. Proc Natl Acad Sci U S A 98:9636-9641 Neill JD, Duck LW, Sellers JC, Musgrove LC 2001 A gonadotropin-releasing hormone (GnRH) receptor specific for GnRH II in primates. Biochem Biophys Res Commun 282:1012-1018 Neill JD 2002 GnRH and GnRH receptor genes in the human genome. Endocrinology 143:737-743 Grundker C, Gunthert AR, Millar RP, Emons G 2002 Expression of gonadotropinreleasing hormone II (GnRH-II) receptor in human endometrial and ovarian cancer cells and effects of GnRH-II on tumor cell proliferation. J Clin Endocrinol Metab 87:14271430 Enomoto M, Endo D, Kawashima S, Park MK 2004 Human type II GnRH receptor mediates effects of GnRH on cell proliferation. Zoolog Sci 21:763-770 Eicke N, Gunthert AR, Viereck V, Siebold D, Behe M, Becker T, Emons G, Grundker C 2005 GnRH-II receptor-like antigenicity in human placenta and in cancers of the human reproductive organs. Eur J Endocrinol 153:605-612 Morgan K, Conklin D, Pawson AJ, Sellar R, Ott TR, Millar RP 2003 A transcriptionally active human type II gonadotropin-releasing hormone receptor gene homolog overlaps two genes in the antisense orientation on chromosome 1q.12. Endocrinology 144:423-436 Okada Y, Murota-Kawano A, Kakar SS, Winters SJ 2003 Evidence that gonadotropin-releasing hormone (GnRH) II stimulates luteinizing hormone and folliclestimulating hormone secretion from monkey pituitary cultures by activating the GnRH I receptor. Biol Reprod 69:1356-1361 Kauffman AS, Wills A, Millar RP, Rissman EF 2005 Evidence that the type-2 gonadotrophin-releasing hormone (GnRH) receptor mediates the behavioural effects of GnRH-II on feeding and reproduction in musk shrews. J Neuroendocrinol 17:489-497 Marelli MM, Moretti RM, Januszkiewicz-Caulier J, Motta M, Limonta P 2006 Gonadotropin-releasing hormone (GnRH) receptors in tumors: a new rationale for the 139  65.  66.  67. 68. 69.  70.  71. 72. 73. 74. 75. 76. 77.  78. 79.  therapeutical application of GnRH analogs in cancer patients? Curr Cancer Drug Targets 6:257-269 Montagnani Marelli M, Moretti RM, Mai S, Januszkiewicz-Caulier J, Motta M, Limonta P 2009 Type I gonadotropin-releasing hormone receptor mediates the antiproliferative effects of GnRH-II on prostate cancer cells. J Clin Endocrinol Metab 94:1761-1767 Grundker C, Schlotawa L, Viereck V, Eicke N, Horst A, Kairies B, Emons G 2004 Antiproliferative effects of the GnRH antagonist cetrorelix and of GnRH-II on human endometrial and ovarian cancer cells are not mediated through the GnRH type I receptor. Eur J Endocrinol 151:141-149 Wu HM, Cheng JC, Wang HS, Huang HY, MacCalman CD, Leung PC 2009 Gonadotropin-releasing hormone type II induces apoptosis of human endometrial cancer cells by activating GADD45alpha. Cancer Res 69:4202-4208 Kim KY, Choi KC, Park SH, Chou CS, Auersperg N, Leung PC 2004 Type II gonadotropin-releasing hormone stimulates p38 mitogen-activated protein kinase and apoptosis in ovarian cancer cells. J Clin Endocrinol Metab 89:3020-3026 Kim KY, Choi KC, Park SH, Auersperg N, Leung PC 2005 Extracellular signalregulated protein kinase, but not c-Jun N-terminal kinase, is activated by type II gonadotropin-releasing hormone involved in the inhibition of ovarian cancer cell proliferation. J Clin Endocrinol Metab 90:1670-1677 Kim KY, Choi KC, Auersperg N, Leung PC 2006 Mechanism of gonadotropinreleasing hormone (GnRH)-I and -II-induced cell growth inhibition in ovarian cancer cells: role of the GnRH-I receptor and protein kinase C pathway. Endocr Relat Cancer 13:211-220 Chen CL, Cheung LW, Lau MT, Choi JH, Auersperg N, Wang HS, Wong AS, Leung PC 2007 Differential role of gonadotropin-releasing hormone on human ovarian epithelial cancer cell invasion. Endocrine 31:311-320 Hong IS, Cheung AP, Leung PC 2008 Gonadotropin-releasing hormones I and II induce apoptosis in human granulosa cells. J Clin Endocrinol Metab 93:3179-3185 Imai A, Horibe S, Takagi A, Tamaya T 1997 Gi protein activation of gonadotropinreleasing hormone-mediated protein dephosphorylation in human endometrial carcinoma. Am J Obstet Gynecol 176:371-376 Kraus S, Naor Z, Seger R 2006 Gonadotropin-releasing hormone in apoptosis of prostate cancer cells. Cancer Lett 234:109-123 Gardner S, Pawson AJ 2009 Emerging targets of the GnRH receptor: novel interactions with Wnt signalling mediators. Neuroendocrinology 89:241-251 Kraus S, Levy G, Hanoch T, Naor Z, Seger R 2004 Gonadotropin-releasing hormone induces apoptosis of prostate cancer cells: role of c-Jun NH2-terminal kinase, protein kinase B, and extracellular signal-regulated kinase pathways. Cancer Res 64:5736-5744 Kimura A, Ohmichi M, Kurachi H, Ikegami H, Hayakawa J, Tasaka K, Kanda Y, Nishio Y, Jikihara H, Matsuura N, Murata Y 1999 Role of mitogen-activated protein kinase/extracellular signal-regulated kinase cascade in gonadotropin-releasing hormoneinduced growth inhibition of a human ovarian cancer cell line. Cancer Res 59:5133-5142 Cheung LW, Leung PC, Wong AS 2006 Gonadotropin-releasing hormone promotes ovarian cancer cell invasiveness through c-Jun NH2-terminal kinase-mediated activation of matrix metalloproteinase (MMP)-2 and MMP-9. Cancer Res 66:10902-10910 Bifulco G, Miele C, Pellicano M, Trencia A, Ferraioli M, Paturzo F, Tommaselli GA, Beguinot F, Nappi C 2004 Molecular mechanisms involved in GnRH analoguerelated apoptosis for uterine leiomyomas. Mol Hum Reprod 10:43-48 140  80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93.  94. 95. 96.  97.  Kraus S, Benard O, Naor Z, Seger R 2003 c-Src is activated by the epidermal growth factor receptor in a pathway that mediates JNK and ERK activation by gonadotropinreleasing hormone in COS7 cells. J Biol Chem 278:32618-32630 Shah BH, Neithardt A, Chu DB, Shah FB, Catt KJ 2006 Role of EGF receptor transactivation in phosphoinositide 3-kinase-dependent activation of MAP kinase by GPCRs. J Cell Physiol 206:47-57 Fujino H, Regan JW 2001 FP prostanoid receptor activation of a T-cell factor/beta catenin signaling pathway. J Biol Chem 276:12489-12492 Farias GG, Godoy JA, Hernandez F, Avila J, Fisher A, Inestrosa NC 2004 M1 muscarinic receptor activation protects neurons from beta-amyloid toxicity. A role for Wnt signaling pathway. Neurobiol Dis 17:337-348 Yang M, Zhong WW, Srivastava N, Slavin A, Yang J, Hoey T, An S 2005 G proteincoupled lysophosphatidic acid receptors stimulate proliferation of colon cancer cells through the {beta}-catenin pathway. Proc Natl Acad Sci U S A 102:6027-6032 Huelsken J, Behrens J 2002 The Wnt signalling pathway. J Cell Sci 115:3977-3978 Nelson WJ, Nusse R 2004 Convergence of Wnt, beta-catenin, and cadherin pathways. Science 303:1483-1487 Moon RT, Kohn AD, De Ferrari GV, Kaykas A 2004 WNT and beta-catenin signalling: diseases and therapies. Nat Rev Genet 5:691-701 Polakis P 2000 Wnt signaling and cancer. Genes Dev 14:1837-1851 Chesire DR, Isaacs WB 2003 Beta-catenin signaling in prostate cancer: an early perspective. Endocr Relat Cancer 10:537-560 Rask K, Nilsson A, Brannstrom M, Carlsson P, Hellberg P, Janson PO, Hedin L, Sundfeldt K 2003 Wnt-signalling pathway in ovarian epithelial tumours: increased expression of beta-catenin and GSK3beta. Br J Cancer 89:1298-1304 Boyer A, Goff AK, Boerboom D WNT signaling in ovarian follicle biology and tumorigenesis. Trends Endocrinol Metab 21:25-32 Salisbury TB, Binder AK, Grammer JC, Nilson JH 2007 Maximal activity of the luteinizing hormone beta-subunit gene requires beta-catenin. Mol Endocrinol 21:963971 Gardner S, Maudsley S, Millar RP, Pawson AJ 2007 Nuclear stabilization of betacatenin and inactivation of glycogen synthase kinase-3beta by gonadotropin-releasing hormone: targeting Wnt signaling in the pituitary gonadotrope. Mol Endocrinol 21:30283038 Caspi M, Zilberberg A, Eldar-Finkelman H, Rosin-Arbesfeld R 2008 Nuclear GSK3beta inhibits the canonical Wnt signalling pathway in a beta-catenin phosphorylationindependent manner. Oncogene 27:3546-3555 Grundker C, Schulz K, Gunthert AR, Emons G 2000 Luteinizing hormone-releasing hormone induces nuclear factor kappaB-activation and inhibits apoptosis in ovarian cancer cells. J Clin Endocrinol Metab 85:3815-3820 Sakamoto Y, Harada T, Horie S, Iba Y, Taniguchi F, Yoshida S, Iwabe T, Terakawa N 2003 Tumor necrosis factor-alpha-induced interleukin-8 (IL-8) expression in endometriotic stromal cells, probably through nuclear factor-kappa B activation: gonadotropin-releasing hormone agonist treatment reduced IL-8 expression. J Clin Endocrinol Metab 88:730-735 Park DW, Choi KC, MacCalman CD, Leung PC 2009 Gonadotropin-releasing hormone (GnRH)-I and GnRH-II induce cell growth inhibition in human endometrial cancer cells: involvement of integrin beta3 and focal adhesion kinase. Reprod Biol Endocrinol 7:81 141  98. 99.  100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115.  116. 117.  Chegini N, Kornberg L 2003 Gonadotropin releasing hormone analogue therapy alters signal transduction pathways involving mitogen-activated protein and focal adhesion kinases in leiomyoma. J Soc Gynecol Investig 10:21-26 Maudsley S, Davidson L, Pawson AJ, Freestone SH, Lopez de Maturana R, Thomson AA, Millar RP 2006 Gonadotropin-releasing hormone functionally antagonizes testosterone activation of the human androgen receptor in prostate cells through focal adhesion complexes involving Hic-5. Neuroendocrinology 84:285-300 Cannistra SA 2004 Cancer of the ovary. N Engl J Med 351:2519-2529 Ferlay J, Autier P, Boniol M, Heanue M, Colombet M, Boyle P 2007 Estimates of the cancer incidence and mortality in Europe in 2006. Ann Oncol 18:581-592 Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, Thun MJ 2008 Cancer statistics, 2008. CA Cancer J Clin 58:71-96 Auersperg N, Wong AS, Choi KC, Kang SK, Leung PC 2001 Ovarian surface epithelium: biology, endocrinology, and pathology. Endocr Rev 22:255-288 Chen VW, Ruiz B, Killeen JL, Cote TR, Wu XC, Correa CN 2003 Pathology and classification of ovarian tumors. Cancer 97:2631-2642 Bell DA 2005 Origins and molecular pathology of ovarian cancer. Mod Pathol 18 Suppl 2:S19-32 Sueblinvong T, Carney ME 2009 Current understanding of risk factors for ovarian cancer. Curr Treat Options Oncol 10:67-81 Thompson MS, Mok SC 2009 Immunopathogenesis of ovarian cancer. Minerva Med 100:357-370 Fleming JS, Beaugie CR, Haviv I, Chenevix-Trench G, Tan OL 2006 Incessant ovulation, inflammation and epithelial ovarian carcinogenesis: revisiting old hypotheses. Mol Cell Endocrinol 247:4-21 Scott M, McCluggage WG 2006 Current concepts in ovarian epithelial tumorigenesis: correlation between morphological and molecular data. Histol Histopathol 21:81-92 Fong MY, Kakar SS The role of cancer stem cells and the side population in epithelial ovarian cancer. Histol Histopathol 25:113-120 Dubeau L 2008 The cell of origin of ovarian epithelial tumours. Lancet Oncol 9:11911197 Salvador LM, Maizels E, Hales DB, Miyamoto E, Yamamoto H, Hunzicker-Dunn M 2002 Acute signaling by the LH receptor is independent of protein kinase C activation. Endocrinology 143:2986-2994 Vicus D, Finch A, Cass I, Rosen B, Murphy J, Fan I, Royer R, McLaughlin J, Karlan B, Narod SA Prevalence of BRCA1 and BRCA2 germ line mutations among women with carcinoma of the fallopian tube. Gynecol Oncol Vicus D, Finch A, Rosen B, Fan I, Bradley L, Cass I, Sun P, Karlan B, McLaughlin J, Narod SA Risk factors for carcinoma of the fallopian tube in women with and without a germline BRCA mutation. Gynecol Oncol 118:155-159 Pichert G, Jacobs C, Jacobs I, Menon U, Manchanda R, Johnson M, Hamed H, Firth C, Evison M, Tutt A, de Silva L, Langman C, Izatt L Novel one-stop multidisciplinary follow-up clinic significantly improves cancer risk management in BRCA1/2 carriers. Fam Cancer Kobayashi H 2009 Ovarian cancer in endometriosis: epidemiology, natural history, and clinical diagnosis. Int J Clin Oncol 14:378-382 Mandai M, Yamaguchi K, Matsumura N, Baba T, Konishi I 2009 Ovarian cancer in endometriosis: molecular biology, pathology, and clinical management. Int J Clin Oncol 14:383-391 142  118. 119. 120.  121. 122. 123.  124.  125. 126. 127. 128. 129. 130. 131. 132. 133.  Kajihara H, Yamada Y, Kanayama S, Furukawa N, Noguchi T, Haruta S, Yoshida S, Sado T, Oi H, Kobayashi H Clear cell carcinoma of the ovary: potential pathogenic mechanisms (Review). Oncol Rep 23:1193-1203 Greenlee RT, Hill-Harmon MB, Murray T, Thun M 2001 Cancer statistics, 2001. CA Cancer J Clin 51:15-36 Schilder RJ, Sill MW, Chen X, Darcy KM, Decesare SL, Lewandowski G, Lee RB, Arciero CA, Wu H, Godwin AK 2005 Phase II study of gefitinib in patients with relapsed or persistent ovarian or primary peritoneal carcinoma and evaluation of epidermal growth factor receptor mutations and immunohistochemical expression: a Gynecologic Oncology Group Study. Clin Cancer Res 11:5539-5548 Wong AS, Leung PC 2007 Role of endocrine and growth factors on the ovarian surface epithelium. J Obstet Gynaecol Res 33:3-16 Lafky JM, Wilken JA, Baron AT, Maihle NJ 2008 Clinical implications of the ErbB/epidermal growth factor (EGF) receptor family and its ligands in ovarian cancer. Biochim Biophys Acta 1785:232-265 Ning Y, Zeineldin R, Liu Y, Rosenberg M, Stack MS, Hudson LG 2005 Downregulation of integrin alpha2 surface expression by mutant epidermal growth factor receptor (EGFRvIII) induces aberrant cell spreading and focal adhesion formation. Cancer Res 65:9280-9286 Rodriguez GC, Berchuck A, Whitaker RS, Schlossman D, Clarke-Pearson DL, Bast RC, Jr. 1991 Epidermal growth factor receptor expression in normal ovarian epithelium and ovarian cancer. II. Relationship between receptor expression and response to epidermal growth factor. Am J Obstet Gynecol 164:745-750 Maruo T, Ladines-Llave CA, Samoto T, Matsuo H, Manalo AS, Ito H, Mochizuki M 1993 Expression of epidermal growth factor and its receptor in the human ovary during follicular growth and regression. Endocrinology 132:924-931 Reeka N, Berg FD, Brucker C 1998 Presence of transforming growth factor alpha and epidermal growth factor in human ovarian tissue and follicular fluid. Hum Reprod 13:2199-2205 Salamanca CM, Maines-Bandiera SL, Leung PC, Hu YL, Auersperg N 2004 Effects of epidermal growth factor/hydrocortisone on the growth and differentiation of human ovarian surface epithelium. J Soc Gynecol Investig 11:241-251 Siemens CH, Auersperg N 1988 Serial propagation of human ovarian surface epithelium in tissue culture. J Cell Physiol 134:347-356 Ahmed N, Maines-Bandiera S, Quinn MA, Unger WG, Dedhar S, Auersperg N 2006 Molecular pathways regulating EGF-induced epithelio-mesenchymal transition in human ovarian surface epithelium. Am J Physiol Cell Physiol 290:C1532-1542 Klapper LN, Kirschbaum MH, Sela M, Yarden Y 2000 Biochemical and clinical implications of the ErbB/HER signaling network of growth factor receptors. Adv Cancer Res 77:25-79 McClellan M, Kievit P, Auersperg N, Rodland K 1999 Regulation of proliferation and apoptosis by epidermal growth factor and protein kinase C in human ovarian surface epithelial cells. Exp Cell Res 246:471-479 Berns EM, Klijn JG, Henzen-Logmans SC, Rodenburg CJ, van der Burg ME, Foekens JA 1992 Receptors for hormones and growth factors and (onco)-gene amplification in human ovarian cancer. Int J Cancer 52:218-224 Brader KR, Wolf JK, Chakrabarty S, Price JE 1998 Epidermal growth factor receptor (EGFR) antisense transfection reduces the expression of EGFR and suppresses the malignant phenotype of a human ovarian cancer cell line. Oncol Rep 5:1269-1274 143  134.  135. 136. 137. 138. 139.  140. 141. 142. 143. 144. 145. 146. 147. 148. 149.  150.  Alper O, De Santis ML, Stromberg K, Hacker NF, Cho-Chung YS, Salomon DS 2000 Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells. Int J Cancer 88:566-574 Dunfield LD, Nachtigal MW 2003 Inhibition of the antiproliferative effect of TGFbeta by EGF in primary human ovarian cancer cells. Oncogene 22:4745-4751 Emons G, Ortmann O, Becker M, Irmer G, Springer B, Laun R, Holzel F, Schulz KD, Schally AV 1993 High affinity binding and direct antiproliferative effects of LHRH analogues in human ovarian cancer cell lines. Cancer Res 53:5439-5446 Qayum A, Gullick W, Clayton RC, Sikora K, Waxman J 1990 The effects of gonadotrophin releasing hormone analogues in prostate cancer are mediated through specific tumour receptors. Br J Cancer 62:96-99 Segal-Abramson T, Kitroser H, Levy J, Schally AV, Sharoni Y 1992 Direct effects of luteinizing hormone-releasing hormone agonists and antagonists on MCF-7 mammary cancer cells. Proc Natl Acad Sci U S A 89:2336-2339 Serin IS, Tanriverdi F, Ata CD, Akalin H, Ozcelik B, Ozkul Y, Kelestimur F GnRH-II mRNA expression in tumor tissue and peripheral blood mononuclear cells (PBMCs) in patients with malignant and benign ovarian tumors. Eur J Obstet Gynecol Reprod Biol 149:92-96 Thompson MA, Adelson MD, Kaufman LM 1991 Lupron retards proliferation of ovarian epithelial tumor cells cultured in serum-free medium. J Clin Endocrinol Metab 72:1036-1041 Liotta LA, Kohn EC 2001 The microenvironment of the tumour-host interface. Nature 411:375-379 Deryugina EI, Quigley JP 2006 Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev 25:9-34 Egeblad M, Werb Z 2002 New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2:161-174 Hijova E 2005 Matrix metalloproteinases: their biological functions and clinical implications. Bratisl Lek Listy 106:127-132 Pei D, Weiss SJ 1995 Furin-dependent intracellular activation of the human stromelysin-3 zymogen. Nature 375:244-247 Sternlicht MD, Werb Z 2001 How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17:463-516 Sottrup-Jensen L, Birkedal-Hansen H 1989 Human fibroblast collagenase-alphamacroglobulin interactions. Localization of cleavage sites in the bait regions of five mammalian alpha-macroglobulins. J Biol Chem 264:393-401 Bein K, Simons M 2000 Thrombospondin type 1 repeats interact with matrix metalloproteinase 2. Regulation of metalloproteinase activity. J Biol Chem 275:3216732173 Rodriguez-Manzaneque JC, Lane TF, Ortega MA, Hynes RO, Lawler J, IruelaArispe ML 2001 Thrombospondin-1 suppresses spontaneous tumor growth and inhibits activation of matrix metalloproteinase-9 and mobilization of vascular endothelial growth factor. Proc Natl Acad Sci U S A 98:12485-12490 Murthi P, Barker G, Nowell CJ, Rice GE, Baker MS, Kalionis B, Quinn MA 2004 Plasminogen fragmentation and increased production of extracellular matrix-degrading proteinases are associated with serous epithelial ovarian cancer progression. Gynecol Oncol 92:80-88 144  151. 152. 153. 154. 155. 156. 157. 158.  159. 160. 161. 162. 163.  164.  165. 166.  Edwards DA, Kim J, Alger BE 2006 Multiple mechanisms of endocannabinoid response initiation in hippocampus. J Neurophysiol 95:67-75 Limonta P, Moretti RM, Marelli MM, Motta M 2003 The biology of gonadotropin hormone-releasing hormone: role in the control of tumor growth and progression in humans. Front Neuroendocrinol 24:279-295 Netzer KO, Suzuki K, Itoh Y, Hudson BG, Khalifah RG 1998 Comparative analysis of the noncollagenous NC1 domain of type IV collagen: identification of structural features important for assembly, function, and pathogenesis. Protein Sci 7:1340-1351 Bernhard EJ, Muschel RJ, Hughes EN 1990 Mr 92,000 gelatinase release correlates with the metastatic phenotype in transformed rat embryo cells. Cancer Res 50:3872-3877 Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M 1994 A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature 370:61-65 Ohuchi E, Imai K, Fujii Y, Sato H, Seiki M, Okada Y 1997 Membrane type 1 matrix metalloproteinase digests interstitial collagens and other extracellular matrix macromolecules. J Biol Chem 272:2446-2451 Kajita M, Itoh Y, Chiba T, Mori H, Okada A, Kinoh H, Seiki M 2001 Membranetype 1 matrix metalloproteinase cleaves CD44 and promotes cell migration. J Cell Biol 153:893-904 Deryugina EI, Ratnikov B, Monosov E, Postnova TI, DiScipio R, Smith JW, Strongin AY 2001 MT1-MMP initiates activation of pro-MMP-2 and integrin alphavbeta3 promotes maturation of MMP-2 in breast carcinoma cells. Exp Cell Res 263:209-223 Sato H, Takino T, Kinoshita T, Imai K, Okada Y, Stetler Stevenson WG, Seiki M 1996 Cell surface binding and activation of gelatinase A induced by expression of membrane-type-1-matrix metalloproteinase (MT1-MMP). FEBS Lett 385:238-240 Moser TL, Young TN, Rodriguez GC, Pizzo SV, Bast RC, Jr., Stack MS 1994 Secretion of extracellular matrix-degrading proteinases is increased in epithelial ovarian carcinoma. Int J Cancer 56:552-559 Young TN, Rodriguez GC, Rinehart AR, Bast RC, Jr., Pizzo SV, Stack MS 1996 Characterization of gelatinases linked to extracellular matrix invasion in ovarian adenocarcinoma: purification of matrix metalloproteinase 2. Gynecol Oncol 62:89-99 Fishman DA, Bafetti LM, Banionis S, Kearns AS, Chilukuri K, Stack MS 1997 Production of extracellular matrix-degrading proteinases by primary cultures of human epithelial ovarian carcinoma cells. Cancer 80:1457-1463 Afzal S, Lalani el N, Foulkes WD, Boyce B, Tickle S, Cardillo MR, Baker T, Pignatelli M, Stamp GW 1996 Matrix metalloproteinase-2 and tissue inhibitor of metalloproteinase-2 expression and synthetic matrix metalloproteinase-2 inhibitor binding in ovarian carcinomas and tumor cell lines. Lab Invest 74:406-421 Lengyel E, Schmalfeldt B, Konik E, Spathe K, Harting K, Fenn A, Berger U, Fridman R, Schmitt M, Prechtel D, Kuhn W 2001 Expression of latent matrix metalloproteinase 9 (MMP-9) predicts survival in advanced ovarian cancer. Gynecol Oncol 82:291-298 Kamat AA, Fletcher M, Gruman LM, Mueller P, Lopez A, Landen CN, Jr., Han L, Gershenson DM, Sood AK 2006 The clinical relevance of stromal matrix metalloproteinase expression in ovarian cancer. Clin Cancer Res 12:1707-1714 Schmalfeldt B, Prechtel D, Harting K, Spathe K, Rutke S, Konik E, Fridman R, Berger U, Schmitt M, Kuhn W, Lengyel E 2001 Increased expression of matrix metalloproteinases (MMP)-2, MMP-9, and the urokinase-type plasminogen activator is 145  167. 168.  169.  170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183.  associated with progression from benign to advanced ovarian cancer. Clin Cancer Res 7:2396-2404 Perigny M, Bairati I, Harvey I, Beauchemin M, Harel F, Plante M, Tetu B 2008 Role of immunohistochemical overexpression of matrix metalloproteinases MMP-2 and MMP-11 in the prognosis of death by ovarian cancer. Am J Clin Pathol 129:226-231 Kalli KR, Bradley SV, Fuchshuber S, Conover CA 2004 Estrogen receptor-positive human epithelial ovarian carcinoma cells respond to the antitumor drug suramin with increased proliferation: possible insight into ER and epidermal growth factor signaling interactions in ovarian cancer. Gynecol Oncol 94:705-712 Sillanpaa S, Anttila M, Voutilainen K, Ropponen K, Turpeenniemi-Hujanen T, Puistola U, Tammi R, Tammi M, Sironen R, Saarikoski S, Kosma VM 2007 Prognostic significance of matrix metalloproteinase-9 (MMP-9) in epithelial ovarian cancer. Gynecol Oncol 104:296-303 Malek A, Schafer R, Tchernitsa O Target genes suitable for silencing approaches and protein product interference in ovarian epithelial cancer. Cancer Treat Rev 36:8-15 Rasmussen HS, McCann PP 1997 Matrix metalloproteinase inhibition as a novel anticancer strategy: a review with special focus on batimastat and marimastat. Pharmacol Ther 75:69-75 Ueda J, Kajita M, Suenaga N, Fujii K, Seiki M 2003 Sequence-specific silencing of MT1-MMP expression suppresses tumor cell migration and invasion: importance of MT1-MMP as a therapeutic target for invasive tumors. Oncogene 22:8716-8722 Rao NC, Barsky SH, Terranova VP, Liotta LA 1983 Isolation of a tumor cell laminin receptor. Biochem Biophys Res Commun 111:804-808 Terranova VP, Rao CN, Kalebic T, Margulies IM, Liotta LA 1983 Laminin receptor on human breast carcinoma cells. Proc Natl Acad Sci U S A 80:444-448 Lesot H, Kuhl U, Mark KV 1983 Isolation of a laminin-binding protein from muscle cell membranes. Embo J 2:861-865 Malinoff HL, Wicha MS 1983 Isolation of a cell surface receptor protein for laminin from murine fibrosarcoma cells. J Cell Biol 96:1475-1479 Nelson J, McFerran NV, Pivato G, Chambers E, Doherty C, Steele D, Timson DJ 2008 The 67 kDa laminin receptor: structure, function and role in disease. Biosci Rep 28:33-48 Rao CN, Castronovo V, Schmitt MC, Wewer UM, Claysmith AP, Liotta LA, Sobel ME 1989 Evidence for a precursor of the high-affinity metastasis-associated murine laminin receptor. Biochemistry 28:7476-7486 Buto S, Tagliabue E, Ardini E, Magnifico A, Ghirelli C, van den Brule F, Castronovo V, Colnaghi MI, Sobel ME, Menard S 1998 Formation of the 67-kDa laminin receptor by acylation of the precursor. J Cell Biochem 69:244-251 Menard S, Castronovo V, Tagliabue E, Sobel ME 1997 New insights into the metastasis-associated 67 kD laminin receptor. J Cell Biochem 67:155-165 Ardini E, Pesole G, Tagliabue E, Magnifico A, Castronovo V, Sobel ME, Colnaghi MI, Menard S 1998 The 67-kDa laminin receptor originated from a ribosomal protein that acquired a dual function during evolution. Mol Biol Evol 15:1017-1025 Hundt C, Peyrin JM, Haik S, Gauczynski S, Leucht C, Rieger R, Riley ML, Deslys JP, Dormont D, Lasmezas CI, Weiss S 2001 Identification of interaction domains of the prion protein with its 37-kDa/67-kDa laminin receptor. Embo J 20:5876-5886 Rieger R, Lasmezas CI, Weiss S 1999 Role of the 37 kDa laminin receptor precursor in the life cycle of prions. Transfus Clin Biol 6:7-16 146  184. 185. 186. 187. 188. 189.  190. 191. 192. 193. 194. 195. 196. 197. 198.  199.  Coggin JH, Jr., Barsoum AL, Rohrer JW 1999 37 kiloDalton oncofetal antigen protein and immature laminin receptor protein are identical, universal T-cell inducing immunogens on primary rodent and human cancers. Anticancer Res 19:5535-5542 Landowski TH, Uthayakumar S, Starkey JR 1995 Control pathways of the 67 kDa laminin binding protein: surface expression and activity of a new ligand binding domain. Clin Exp Metastasis 13:357-372 Gloe T, Riedmayr S, Sohn HY, Pohl U 1999 The 67-kDa laminin-binding protein is involved in shear stress-dependent endothelial nitric-oxide synthase expression. J Biol Chem 274:15996-16002 Castronovo V, Taraboletti G, Sobel ME 1991 Functional domains of the 67-kDa laminin receptor precursor. J Biol Chem 266:20440-20446 Magnifico A, Tagliabue E, Buto S, Ardini E, Castronovo V, Colnaghi MI, Menard S 1996 Peptide G, containing the binding site of the 67-kDa laminin receptor, increases and stabilizes laminin binding to cancer cells. J Biol Chem 271:31179-31184 Taraboletti G, Belotti D, Giavazzi R, Sobel ME, Castronovo V 1993 Enhancement of metastatic potential of murine and human melanoma cells by laminin receptor peptide G: attachment of cancer cells to subendothelial matrix as a pathway for hematogenous metastasis. J Natl Cancer Inst 85:235-240 Graf J, Iwamoto Y, Sasaki M, Martin GR, Kleinman HK, Robey FA, Yamada Y 1987 Identification of an amino acid sequence in laminin mediating cell attachment, chemotaxis, and receptor binding. Cell 48:989-996 Panayotou G, End P, Aumailley M, Timpl R, Engel J 1989 Domains of laminin with growth-factor activity. Cell 56:93-101 Cioce V, Margulies IM, Sobel ME, Castronovo V 1993 Interaction between the 67 kilodalton metastasis-associated laminin receptor and laminin. Kidney Int 43:30-37 Starkey JR, Uthayakumar S, Berglund DL 1999 Cell surface and substrate distribution of the 67-kDa laminin-binding protein determined by using a ligand photoaffinity probe. Cytometry 35:37-47 Castronovo V, Taraboletti G, Sobel ME 1991 Laminin receptor complementary DNAdeduced synthetic peptide inhibits cancer cell attachment to endothelium. Cancer Res 51:5672-5678 Kazmin DA, Hoyt TR, Taubner L, Teintze M, Starkey JR 2000 Phage display mapping for peptide 11 sensitive sequences binding to laminin-1. J Mol Biol 298:431445 Guo NH, Krutzsch HC, Vogel T, Roberts DD 1992 Interactions of a laminin-binding peptide from a 33-kDa protein related to the 67-kDa laminin receptor with laminin and melanoma cells are heparin-dependent. J Biol Chem 267:17743-17747 Jaseja M, Mergen L, Gillette K, Forbes K, Sehgal I, Copie V 2005 Structure-function studies of the functional and binding epitope of the human 37 kDa laminin receptor precursor protein. J Pept Res 66:9-18 Canfield SM, Khakoo AY 1999 The nonintegrin laminin binding protein (p67 LBP) is expressed on a subset of activated human T lymphocytes and, together with the integrin very late activation antigen-6, mediates avid cellular adherence to laminin. J Immunol 163:3430-3440 Salama RH, Muramatsu H, Zou K, Inui T, Kimura T, Muramatsu T 2001 Midkine binds to 37-kDa laminin binding protein precursor, leading to nuclear transport of the complex. Exp Cell Res 270:13-20  147  200. 201. 202. 203. 204.  205. 206. 207. 208. 209.  210. 211. 212. 213. 214. 215. 216.  Ardini E, Tagliabue E, Magnifico A, Buto S, Castronovo V, Colnaghi MI, Menard S 1997 Co-regulation and physical association of the 67-kDa monomeric laminin receptor and the alpha6beta4 integrin. J Biol Chem 272:2342-2345 Sasaki T, Fassler R, Hohenester E 2004 Laminin: the crux of basement membrane assembly. J Cell Biol 164:959-963 Berno V, Porrini D, Castiglioni F, Campiglio M, Casalini P, Pupa SM, Balsari A, Menard S, Tagliabue E 2005 The 67 kDa laminin receptor increases tumor aggressiveness by remodeling laminin-1. Endocr Relat Cancer 12:393-406 Higashiyama M, Doi O, Kodama K, Yokouchi H, Tateishi R 1993 Cathepsin B expression in tumour cells and laminin distribution in pulmonary adenocarcinoma. J Clin Pathol 46:18-22 Ardini E, Sporchia B, Pollegioni L, Modugno M, Ghirelli C, Castiglioni F, Tagliabue E, Menard S 2002 Identification of a novel function for 67-kDa laminin receptor: increase in laminin degradation rate and release of motility fragments. Cancer Res 62:1321-1325 van den Brule FA, Berchuck A, Bast RC, Liu FT, Gillet C, Sobel ME, Castronovo V 1994 Differential expression of the 67-kD laminin receptor and 31-kD human lamininbinding protein in human ovarian carcinomas. Eur J Cancer 30A:1096-1099 van den Brule FA, Castronovo V, Menard S, Giavazzi R, Marzola M, Belotti D, Taraboletti G 1996 Expression of the 67 kD laminin receptor in human ovarian carcinomas as defined by a monoclonal antibody, MLuC5. Eur J Cancer 32A:1598-1602 Givant-Horwitz V, Davidson B, van de Putte G, Dong HP, Goldberg I, Amir S, Kristensen GB, Reich R 2003 Expression of the 67 kDa laminin receptor and the alpha6 integrin subunit in serous ovarian carcinoma. Clin Exp Metastasis 20:599-609 Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH 2004 Cell-typespecific binding of the transcription factor CREB to the cAMP-response element. Proc Natl Acad Sci U S A 101:13572-13577 Moeenrezakhanlou A, Nandan D, Shephard L, Reiner NE 2007 1alpha,25dihydroxycholecalciferol activates binding of CREB to a CRE site in the CD14 promoter and drives promoter activity in a phosphatidylinositol-3 kinase-dependent manner. J Leukoc Biol 81:1311-1321 Jeon SH, Chae BC, Kim HA, Seo GY, Seo DW, Chun GT, Yie SW, Eom SH, Kim PH 2007 The PKA/CREB pathway is closely involved in VEGF expression in mouse macrophages. Mol Cells 23:23-29 Daniel PB, Walker WH, Habener JF 1998 Cyclic AMP signaling and gene regulation. Annu Rev Nutr 18:353-383 Nichols M, Weih F, Schmid W, DeVack C, Kowenz-Leutz E, Luckow B, Boshart M, Schutz G 1992 Phosphorylation of CREB affects its binding to high and low affinity sites: implications for cAMP induced gene transcription. Embo J 11:3337-3346 Johannessen M, Delghandi MP, Moens U 2004 What turns CREB on? Cell Signal 16:1211-1227 Kwok RP, Laurance ME, Lundblad JR, Goldman PS, Shih H, Connor LM, Marriott SJ, Goodman RH 1996 Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature 380:642-646 Flammer JR, Popova KN, Pflum MK 2006 Cyclic AMP response element-binding protein (CREB) and CAAT/enhancer-binding protein beta (C/EBPbeta) bind chimeric DNA sites with high affinity. Biochemistry 45:9615-9623 Thiel G, Al Sarraj J, Vinson C, Stefano L, Bach K 2005 Role of basic region leucine zipper transcription factors cyclic AMP response element binding protein (CREB), 148  CREB2, activating transcription factor 2 and CAAT/enhancer binding protein alpha in cyclic AMP response element-mediated transcription. J Neurochem 92:321-336 217. Zheng W, Jefcoate CR 2005 Steroidogenic factor-1 interacts with cAMP response element-binding protein to mediate cAMP stimulation of CYP1B1 via a far upstream enhancer. Mol Pharmacol 67:499-512 218. Siler-Khodr TM, Grayson M 2001 Action of chicken II GnRH on the human placenta. J Clin Endocrinol Metab 86:804-810 219. Islami D, Bischof P, Chardonnens D 2003 Possible interactions between leptin, gonadotrophin-releasing hormone (GnRH-I and II) and human chorionic gonadotrophin (hCG). Eur J Obstet Gynecol Reprod Biol 110:169-175 220. Montminy M 1997 Transcriptional regulation by cyclic AMP. Annu Rev Biochem 66:807-822 221. Mayr B, Montminy M 2001 Transcriptional regulation by the phosphorylationdependent factor CREB. Nat Rev Mol Cell Biol 2:599-609 222. Meyer TE, Habener JF 1993 Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acidbinding proteins. Endocr Rev 14:269-290 223. Delghandi MP, Johannessen M, Moens U 2005 The cAMP signalling pathway activates CREB through PKA, p38 and MSK1 in NIH 3T3 cells. Cell Signal 17:13431351 224. Canettieri G, Morantte I, Guzman E, Asahara H, Herzig S, Anderson SD, Yates JR, 3rd, Montminy M 2003 Attenuation of a phosphorylation-dependent activator by an HDAC-PP1 complex. Nat Struct Biol 10:175-181 225. Sharma N, Lopez DI, Nyborg JK 2007 DNA binding and phosphorylation induce conformational alterations in the kinase-inducible domain of CREB. Implications for the mechanism of transcription function. J Biol Chem 282:19872-19883 226. Taylor SW, Fahy E, Zhang B, Glenn GM, Warnock DE, Wiley S, Murphy AN, Gaucher SP, Capaldi RA, Gibson BW, Ghosh SS 2003 Characterization of the human heart mitochondrial proteome. Nat Biotechnol 21:281-286 227. Geiger TR, Sharma N, Kim YM, Nyborg JK 2008 The human T-cell leukemia virus type 1 tax protein confers CBP/p300 recruitment and transcriptional activation properties to phosphorylated CREB. Mol Cell Biol 28:1383-1392 228. Manna PR, Stocco DM 2007 Crosstalk of CREB and Fos/Jun on a single cis-element: transcriptional repression of the steroidogenic acute regulatory protein gene. J Mol Endocrinol 39:261-277 229. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855859 230. Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH 1994 Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223-226 231. Lundblad JR, Kwok RP, Laurance ME, Harter ML, Goodman RH 1995 Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional coactivator CBP. Nature 374:85-88 232. Parker D, Ferreri K, Nakajima T, LaMorte VJ, Evans R, Koerber SC, Hoeger C, Montminy MR 1996 Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism. Mol Cell Biol 16:694-703 233. Radhakrishnan I, Perez-Alvarado GC, Parker D, Dyson HJ, Montminy MR, Wright PE 1997 Solution structure of the KIX domain of CBP bound to the 149  234. 235. 236. 237. 238. 239. 240.  241. 242. 243. 244. 245.  246. 247. 248. 249.  transactivation domain of CREB: a model for activator:coactivator interactions. Cell 91:741-752 Ramji DP, Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365:561-575 Pouyssegur J, Volmat V, Lenormand P 2002 Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling. Biochem Pharmacol 64:755-763 Vogel CF, Sciullo E, Park S, Liedtke C, Trautwein C, Matsumura F 2004 Dioxin increases C/EBPbeta transcription by activating cAMP/protein kinase A. J Biol Chem 279:8886-8894 De Cesare D, Sassone-Corsi P 2000 Transcriptional regulation by cyclic AMPresponsive factors. Prog Nucleic Acid Res Mol Biol 64:343-369 Servillo G, Della Fazia MA, Sassone-Corsi P 2002 Coupling cAMP signaling to transcription in the liver: pivotal role of CREB and CREM. Exp Cell Res 275:143-154 Podust LM, Krezel AM, Kim Y 2001 Crystal structure of the CCAAT box/enhancerbinding protein beta activating transcription factor-4 basic leucine zipper heterodimer in the absence of DNA. J Biol Chem 276:505-513 Vallejo M, Ron D, Miller CP, Habener JF 1993 C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CAAT/enhancerbinding proteins and directs their binding to cAMP response elements. Proc Natl Acad Sci U S A 90:4679-4683 Wilson HL, McFie PJ, Roesler WJ 2002 Different transcription factor binding arrays modulate the cAMP responsivity of the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 277:43895-43902 Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH 2004 Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell 119:1041-1054 Friedman JR, Larris B, Le PP, Peiris TH, Arsenlis A, Schug J, Tobias JW, Kaestner KH, Greenbaum LE 2004 Orthogonal analysis of C/EBPbeta targets in vivo during liver proliferation. Proc Natl Acad Sci U S A 101:12986-12991 Casamassimi A, De Luca A, Agrawal S, Stromberg K, Salomon DS, Normanno N 2000 EGF-related antisense oligonucleotides inhibit the proliferation of human ovarian carcinoma cells. Ann Oncol 11:319-325 Tzahar E, Waterman H, Chen X, Levkowitz G, Karunagaran D, Lavi S, Ratzkin BJ, Yarden Y 1996 A hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation factor/neuregulin and epidermal growth factor. Mol Cell Biol 16:5276-5287 Honegger AM, Kris RM, Ullrich A, Schlessinger J 1989 Evidence that autophosphorylation of solubilized receptors for epidermal growth factor is mediated by intermolecular cross-phosphorylation. Proc Natl Acad Sci U S A 86:925-929 Carter TH, Kung HJ 1994 Tissue-specific transformation by oncogenic mutants of epidermal growth factor receptor. Crit Rev Oncog 5:389-428 Salomon DS, Brandt R, Ciardiello F, Normanno N 1995 Epidermal growth factorrelated peptides and their receptors in human malignancies. Crit Rev Oncol Hematol 19:183-232 Psyrri A, Kassar M, Yu Z, Bamias A, Weinberger PM, Markakis S, Kowalski D, Camp RL, Rimm DL, Dimopoulos MA 2005 Effect of epidermal growth factor receptor expression level on survival in patients with epithelial ovarian cancer. Clin Cancer Res 11:8637-8643 150  250. 251. 252. 253.  254. 255. 256. 257. 258. 259.  260. 261. 262. 263. 264. 265.  Lassus H, Sihto H, Leminen A, Joensuu H, Isola J, Nupponen NN, Butzow R 2006 Gene amplification, mutation, and protein expression of EGFR and mutations of ERBB2 in serous ovarian carcinoma. J Mol Med 84:671-681 Woo MM, Salamanca CM, Minor A, Auersperg N 2007 An improved assay to quantitate the invasiveness of cells in modified Boyden chambers. In Vitro Cell Dev Biol Anim 43:7-9 Shaywitz AJ, Greenberg ME 1999 CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68:821-861 Witters L, Scherle P, Friedman S, Fridman J, Caulder E, Newton R, Lipton A 2008 Synergistic inhibition with a dual epidermal growth factor receptor/HER-2/neu tyrosine kinase inhibitor and a disintegrin and metalloprotease inhibitor. Cancer Res 68:70837089 Li AJ, Scoles DR, Armstrong KU, Karlan BY 2008 Androgen receptor cytosineadenine-guanine repeat polymorphisms modulate EGFR signaling in epithelial ovarian carcinomas. Gynecol Oncol 109:220-225 Rosano L, Di Castro V, Spinella F, Tortora G, Nicotra MR, Natali PG, Bagnato A 2007 Combined targeting of endothelin A receptor and epidermal growth factor receptor in ovarian cancer shows enhanced antitumor activity. Cancer Res 67:6351-6359 Chinnappan D, Qu X, Xiao D, Ratnasari A, Weber HC 2008 Human gastrinreleasing peptide receptor gene regulation requires transcription factor binding at two distinct CRE sites. Am J Physiol Gastrointest Liver Physiol 295:G153-G162 Pino MS, Nawrocki ST, Cognetti F, Abruzzese JL, Xiong HQ, McConkey DJ 2005 Prostaglandin E2 drives cyclooxygenase-2 expression via cyclic AMP response element activation in human pancreatic cancer cells. Cancer Biol Ther 4:1263-1269 Khokhlatchev AV, Canagarajah B, Wilsbacher J, Robinson M, Atkinson M, Goldsmith E, Cobb MH 1998 Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation. Cell 93:605-615 Roberson MS, Ban M, Zhang T, Mulvaney JM 2000 Role of the cyclic AMP response element binding complex and activation of mitogen-activated protein kinases in synergistic activation of the glycoprotein hormone alpha subunit gene by epidermal growth factor and forskolin. Mol Cell Biol 20:3331-3344 Robinson MJ, Stippec SA, Goldsmith E, White MA, Cobb MH 1998 A constitutively active and nuclear form of the MAP kinase ERK2 is sufficient for neurite outgrowth and cell transformation. Curr Biol 8:1141-1150 Sharma N, Nyborg JK 2008 The coactivators CBP/p300 and the histone chaperone NAP1 promote transcription-independent nucleosome eviction at the HTLV-1 promoter. Proc Natl Acad Sci U S A 105:7959-7963 Shuman JD, Sebastian T, Kaldis P, Copeland TD, Zhu S, Smart RC, Johnson PF 2004 Cell cycle-dependent phosphorylation of C/EBPbeta mediates oncogenic cooperativity between C/EBPbeta and H-RasV12. Mol Cell Biol 24:7380-7391 Sterneck E, Johnson PF 1998 CCAAT/enhancer binding protein beta is a neuronal transcriptional regulator activated by nerve growth factor receptor signaling. J Neurochem 70:2424-2433 Normanno N, Bianco C, Strizzi L, Mancino M, Maiello MR, De Luca A, Caponigro F, Salomon DS 2005 The ErbB receptors and their ligands in cancer: an overview. Curr Drug Targets 6:243-257 Sewell JM, Macleod KG, Ritchie A, Smyth JF, Langdon SP 2002 Targeting the EGF receptor in ovarian cancer with the tyrosine kinase inhibitor ZD 1839 ("Iressa"). Br J Cancer 86:456-462 151  266. 267. 268. 269. 270.  271. 272. 273. 274.  275. 276. 277. 278. 279. 280.  281. 282.  Stromberg K, Collins TJt, Gordon AW, Jackson CL, Johnson GR 1992 Transforming growth factor-alpha acts as an autocrine growth factor in ovarian carcinoma cell lines. Cancer Res 52:341-347 Roy R, Yang J, Moses MA 2009 Matrix metalloproteinases as novel biomarkers and potential therapeutic targets in human cancer. J Clin Oncol 27:5287-5297 Kenny HA, Kaur S, Coussens LM, Lengyel E 2008 The initial steps of ovarian cancer cell metastasis are mediated by MMP-2 cleavage of vitronectin and fibronectin. J Clin Invest 118:1367-1379 Roomi MW, Monterrey JC, Kalinovsky T, Rath M, Niedzwiecki A In vitro modulation of MMP-2 and MMP-9 in human cervical and ovarian cancer cell lines by cytokines, inducers and inhibitors. Oncol Rep 23:605-614 Agarwal A, Covic L, Sevigny LM, Kaneider NC, Lazarides K, Azabdaftari G, Sharifi S, Kuliopulos A 2008 Targeting a metalloprotease-PAR1 signaling system with cell-penetrating pepducins inhibits angiogenesis, ascites, and progression of ovarian cancer. Mol Cancer Ther 7:2746-2757 Givant-Horwitz V, Davidson B, Reich R 2004 Laminin-induced signaling in tumor cells: the role of the M(r) 67,000 laminin receptor. Cancer Res 64:3572-3579 Romanov VI, Wrathall LS, Simmons TD, Pinto da Silva P, Sobel ME 1995 Protein synthesis is required for laminin-induced expression of the 67-kDa laminin receptor and its 37-kDa precursor. Biochem Biophys Res Commun 208:637-643 Liu L, Sun L, Zhao P, Yao L, Jin H, Liang S, Wang Y, Zhang D, Pang Y, Shi Y, Chai N, Zhang H, Zhang H Hypoxia promotes metastasis in human gastric cancer by up-regulating the 67-kDa laminin receptor. Cancer Sci Satoh K, Narumi K, Abe T, Sakai T, Kikuchi T, Tanaka M, Shimo-Oka T, Uchida M, Tezuka F, Isemura M, Nukiwa T 1999 Diminution of 37-kDa laminin binding protein expression reduces tumour formation of murine lung cancer cells. Br J Cancer 80:1115-1122 Mafune K, Ravikumar TS 1992 Anti-sense RNA of 32-kDa laminin-binding protein inhibits attachment and invasion of a human colon carcinoma cell line. J Surg Res 52:340-346 Vande Broek I, Vanderkerken K, De Greef C, Asosingh K, Straetmans N, Van Camp B, Van Riet I 2001 Laminin-1-induced migration of multiple myeloma cells involves the high-affinity 67 kD laminin receptor. Br J Cancer 85:1387-1395 Tanaka M, Narumi K, Isemura M, Abe M, Sato Y, Abe T, Saijo Y, Nukiwa T, Satoh K 2000 Expression of the 37-kDa laminin binding protein in murine lung tumor cell correlates with tumor angiogenesis. Cancer Lett 153:161-168 Givant-Horwitz V, Davidson B, Reich R 2005 Laminin-induced signaling in tumor cells. Cancer Lett 223:1-10 Leung EH, Leung PC, Auersperg N 2001 Differentiation and growth potential of human ovarian surface epithelial cells expressing temperature-sensitive SV40 T antigen. In Vitro Cell Dev Biol Anim 37:515-521 Wilkinson SJ, Kucukmetin A, Cross P, Darby S, Gnanapragasam VJ, Calvert AH, Robson CN, Edmondson RJ 2008 Expression of gonadotrophin releasing hormone receptor I is a favorable prognostic factor in epithelial ovarian cancer. Hum Pathol 39:1197-1204 Menard S, Tagliabue E, Colnaghi MI 1998 The 67 kDa laminin receptor as a prognostic factor in human cancer. Breast Cancer Res Treat 52:137-145 Engbring JA, Kleinman HK 2003 The basement membrane matrix in malignancy. J Pathol 200:465-470 152  283. 284. 285.  286.  287. 288.  289. 290. 291. 292. 293. 294. 295. 296. 297. 298. 299. 300.  Patarroyo M, Tryggvason K, Virtanen I 2002 Laminin isoforms in tumor invasion, angiogenesis and metastasis. Semin Cancer Biol 12:197-207 Ekblom P, Lonai P, Talts JF 2003 Expression and biological role of laminin-1. Matrix Biol 22:35-47 Maatta M, Butzow R, Luostarinen J, Petajaniemi N, Pihlajaniemi T, Salo S, Miyazaki K, Autio-Harmainen H, Virtanen I 2005 Differential expression of laminin isoforms in ovarian epithelial carcinomas suggesting different origin and providing tools for differential diagnosis. J Histochem Cytochem 53:1293-1300 Kuwashima Y, Uehara T, Kurosumi M, Kishi K, Shiromizu K, Matsuzawa M, Takayama S 1995 Basement membrane status in undifferentiated carcinomas of the ovary. Immunohistochemical distribution of type IV collagen and laminin. Eur J Gynaecol Oncol 16:181-186 Byers LJ, Osborne JL, Carson LF, Carter JR, Haney AF, Weinberg JB, Ramakrishnan S 1995 Increased levels of laminin in ascitic fluid of patients with ovarian cancer. Cancer Lett 88:67-72 Capo-Chichi CD, Smith ER, Yang DH, Roland IH, Vanderveer L, Cohen C, Hamilton TC, Godwin AK, Xu XX 2002 Dynamic alterations of the extracellular environment of ovarian surface epithelial cells in premalignant transformation, tumorigenicity, and metastasis. Cancer 95:1802-1815 Hood JD, Cheresh DA 2002 Role of integrins in cell invasion and migration. Nat Rev Cancer 2:91-100 Kleinman HK, Koblinski J, Lee S, Engbring J 2001 Role of basement membrane in tumor growth and metastasis. Surg Oncol Clin N Am 10:329-338, ix Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA, Goldberg GI 1995 Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270:5331-5338 Liu J, Maccalman CD, Wang YL, Leung PC 2009 Promotion of human trophoblasts invasion by gonadotropin-releasing hormone (GnRH) I and GnRH II via distinct signaling pathways. Mol Endocrinol 23:1014-1021 MacDonald BT, Tamai K, He X 2009 Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17:9-26 Espada J, Calvo MB, Diaz-Prado S, Medina V 2009 Wnt signalling and cancer stem cells. Clin Transl Oncol 11:411-427 Sethi JK, Vidal-Puig A Wnt signalling and the control of cellular metabolism. Biochem J 427:1-17 Rubinfeld B, Albert I, Porfiri E, Fiol C, Munemitsu S, Polakis P 1996 Binding of GSK3beta to the APC-beta-catenin complex and regulation of complex assembly. Science 272:1023-1026 Sato H, Takino T, Miyamori H 2005 Roles of membrane-type matrix metalloproteinase-1 in tumor invasion and metastasis. Cancer Sci 96:212-217 Adley BP, Gleason KJ, Yang XJ, Stack MS 2009 Expression of membrane type 1 matrix metalloproteinase (MMP-14) in epithelial ovarian cancer: high level expression in clear cell carcinoma. Gynecol Oncol 112:319-324 Afzal S, Lalani EN, Poulsom R, Stubbs A, Rowlinson G, Sato H, Seiki M, Stamp GW 1998 MT1-MMP and MMP-2 mRNA expression in human ovarian tumors: possible implications for the role of desmoplastic fibroblasts. Hum Pathol 29:155-165 Davidson B, Goldberg I, Berner A, Nesland JM, Givant-Horwitz V, Bryne M, Risberg B, Kristensen GB, Trope CG, Kopolovic J, Reich R 2001 Expression of 153  301. 302. 303. 304.  305. 306. 307. 308.  309. 310. 311. 312. 313. 314. 315.  membrane-type 1, 2, and 3 matrix metalloproteinases messenger RNA in ovarian carcinoma cells in serous effusions. Am J Clin Pathol 115:517-524 Neth P, Ciccarella M, Egea V, Hoelters J, Jochum M, Ries C 2006 Wnt signaling regulates the invasion capacity of human mesenchymal stem cells. Stem Cells 24:18921903 Du R, Xia L, Sun S, Lian Z, Zou X, Gao J, Xie H, Fan R, Song J, Li X, Liu J, Fan D URG11 promotes gastric cancer growth and invasion by activation of beta-catenin signalling pathway. J Cell Mol Med 14:621-635 Sodek KL, Ringuette MJ, Brown TJ 2007 MT1-MMP is the critical determinant of matrix degradation and invasion by ovarian cancer cells. Br J Cancer 97:358-367 Moss NM, Barbolina MV, Liu Y, Sun L, Munshi HG, Stack MS 2009 Ovarian cancer cell detachment and multicellular aggregate formation are regulated by membrane type 1 matrix metalloproteinase: a potential role in I.p. metastatic dissemination. Cancer Res 69:7121-7129 Takahashi M, Tsunoda T, Seiki M, Nakamura Y, Furukawa Y 2002 Identification of membrane-type matrix metalloproteinase-1 as a target of the beta-catenin/Tcf4 complex in human colorectal cancers. Oncogene 21:5861-5867 Rao AS, Kremenevskaja N, Resch J, Brabant G 2005 Lithium stimulates proliferation in cultured thyrocytes by activating Wnt/beta-catenin signalling. Eur J Endocrinol 153:929-938 Salic A, Lee E, Mayer L, Kirschner MW 2000 Control of beta-catenin stability: reconstitution of the cytoplasmic steps of the wnt pathway in Xenopus egg extracts. Mol Cell 5:523-532 Kioussi C, Briata P, Baek SH, Rose DW, Hamblet NS, Herman T, Ohgi KA, Lin C, Gleiberman A, Wang J, Brault V, Ruiz-Lozano P, Nguyen HD, Kemler R, Glass CK, Wynshaw-Boris A, Rosenfeld MG 2002 Identification of a Wnt/Dvl/beta-Catenin --> Pitx2 pathway mediating cell-type-specific proliferation during development. Cell 111:673-685 Satyamoorthy K, Li G, Vaidya B, Patel D, Herlyn M 2001 Insulin-like growth factor1 induces survival and growth of biologically early melanoma cells through both the mitogen-activated protein kinase and beta-catenin pathways. Cancer Res 61:7318-7324 Jeays-Ward K, Hoyle C, Brennan J, Dandonneau M, Alldus G, Capel B, Swain A 2003 Endothelial and steroidogenic cell migration are regulated by WNT4 in the developing mammalian gonad. Development 130:3663-3670 Yao HH, Matzuk MM, Jorgez CJ, Menke DB, Page DC, Swain A, Capel B 2004 Follistatin operates downstream of Wnt4 in mammalian ovary organogenesis. Dev Dyn 230:210-215 Ricken A, Lochhead P, Kontogiannea M, Farookhi R 2002 Wnt signaling in the ovary: identification and compartmentalized expression of wnt-2, wnt-2b, and frizzled-4 mRNAs. Endocrinology 143:2741-2749 Segditsas S, Tomlinson I 2006 Colorectal cancer and genetic alterations in the Wnt pathway. Oncogene 25:7531-7537 Ebert MP, Fei G, Kahmann S, Muller O, Yu J, Sung JJ, Malfertheiner P 2002 Increased beta-catenin mRNA levels and mutational alterations of the APC and betacatenin gene are present in intestinal-type gastric cancer. Carcinogenesis 23:87-91 Clements WM, Wang J, Sarnaik A, Kim OJ, MacDonald J, Fenoglio-Preiser C, Groden J, Lowy AM 2002 beta-Catenin mutation is a frequent cause of Wnt pathway activation in gastric cancer. Cancer Res 62:3503-3506 154  316. 317.  318. 319. 320.  321. 322. 323. 324. 325. 326. 327. 328. 329. 330. 331. 332. 333. 334. 335.  Gatcliffe TA, Monk BJ, Planutis K, Holcombe RF 2008 Wnt signaling in ovarian tumorigenesis. Int J Gynecol Cancer 18:954-962 Gamallo C, Palacios J, Moreno G, Calvo de Mora J, Suarez A, Armas A 1999 betacatenin expression pattern in stage I and II ovarian carcinomas : relationship with betacatenin gene mutations, clinicopathological features, and clinical outcome. Am J Pathol 155:527-536 Kildal W, Risberg B, Abeler VM, Kristensen GB, Sudbo J, Nesland JM, Danielsen HE 2005 beta-catenin expression, DNA ploidy and clinicopathological features in ovarian cancer: a study in 253 patients. Eur J Cancer 41:1127-1134 Clark IM, Swingler TE, Sampieri CL, Edwards DR 2008 The regulation of matrix metalloproteinases and their inhibitors. Int J Biochem Cell Biol 40:1362-1378 Sounni NE, Devy L, Hajitou A, Frankenne F, Munaut C, Gilles C, Deroanne C, Thompson EW, Foidart JM, Noel A 2002 MT1-MMP expression promotes tumor growth and angiogenesis through an up-regulation of vascular endothelial growth factor expression. Faseb J 16:555-564 Hotary K, Allen E, Punturieri A, Yana I, Weiss SJ 2000 Regulation of cell invasion and morphogenesis in a three-dimensional type I collagen matrix by membrane-type matrix metalloproteinases 1, 2, and 3. J Cell Biol 149:1309-1323 Nonaka T, Nishibashi K, Itoh Y, Yana I, Seiki M 2005 Competitive disruption of the tumor-promoting function of membrane type 1 matrix metalloproteinase/matrix metalloproteinase-14 in vivo. Mol Cancer Ther 4:1157-1166 Kleinman HK, Martin GR 2005 Matrigel: basement membrane matrix with biological activity. Semin Cancer Biol 15:378-386 Rowe RG, Weiss SJ 2009 Navigating ECM barriers at the invasive front: the cancer cell-stroma interface. Annu Rev Cell Dev Biol 25:567-595 Kleinman HK, Jacob K 2001 Invasion assays. Curr Protoc Cell Biol Chapter 12:Unit 12 12 Wu M, Xu G, Xi L, Wei J, Song A, Han Z, Zhou J, Wang S, Zhu T, Zhang A, Lu Y, Ma D 2006 Down-regulation of MT1-MMP expression suppresses tumor cell invasion in metastatic human SW626 ovarian cancer cells. Oncol Rep 15:501-505 Feeley KM, Wells M 2001 Precursor lesions of ovarian epithelial malignancy. Histopathology 38:87-95 Bjorkholm E, Pettersson F, Einhorn N, Krebs I, Nilsson B, Tjernberg B 1982 Longterm follow-up and prognostic factors in ovarian carcinoma. The radiumhemmet series 1958 to 1973. Acta Radiol Oncol 21:413-419 Hogberg T, Carstensen J, Simonsen E 1993 Treatment results and prognostic factors in a population-based study of epithelial ovarian cancer. Gynecol Oncol 48:38-49 Sorbe B, Frankendal B, Veress B 1982 Importance of histologic grading in the prognosis of epithelial ovarian carcinoma. Obstet Gynecol 59:576-582 Liotta LA 1986 Tumor invasion and metastases--role of the extracellular matrix: Rhoads Memorial Award lecture. Cancer Res 46:1-7 Liotta LA, Stetler-Stevenson WG 1991 Tumor invasion and metastasis: an imbalance of positive and negative regulation. Cancer Res 51:5054s-5059s Stenback F, Wasenius VM 1985 Basement membrane structures in tumors of the ovary. Eur J Obstet Gynecol Reprod Biol 20:357-371 Skubitz AP 2002 Adhesion molecules. Cancer Treat Res 107:305-329 Prentice LM, Klausen C, Kalloger S, Kobel M, McKinney S, Santos JL, Kenney C, Mehl E, Gilks CB, Leung P, Swenerton K, Huntsman DG, Aparicio SA 2007 155  336. 337. 338. 339. 340. 341. 342.  343. 344. 345. 346. 347. 348. 349. 350. 351. 352.  Kisspeptin and GPR54 immunoreactivity in a cohort of 518 patients defines favourable prognosis and clear cell subtype in ovarian carcinoma. BMC Med 5:33 Badgwell D, Bast RC, Jr. 2007 Early detection of ovarian cancer. Dis Markers 23:397410 Tachibana H, Koga K, Fujimura Y, Yamada K 2004 A receptor for green tea polyphenol EGCG. Nat Struct Mol Biol 11:380-381 Umeda D, Yano S, Yamada K, Tachibana H 2008 Green tea polyphenol epigallocatechin-3-gallate signaling pathway through 67-kDa laminin receptor. J Biol Chem 283:3050-3058 Hong Byun E, Fujimura Y, Yamada K, Tachibana H TLR4 signaling inhibitory pathway induced by green tea polyphenol epigallocatechin-3-gallate through 67-kDa laminin receptor. J Immunol 185:33-45 Bernard A, Gao-Li J, Franco CA, Bouceba T, Huet A, Li Z 2009 Laminin receptor involvement in the anti-angiogenic activity of pigment epithelium-derived factor. J Biol Chem 284:10480-10490 Stitt AW, McKenna D, Simpson DA, Gardiner TA, Harriott P, Archer DB, Nelson J 1998 The 67-kd laminin receptor is preferentially expressed by proliferating retinal vessels in a murine model of ischemic retinopathy. Am J Pathol 152:1359-1365 Feki A, Berardi P, Bellingan G, Major A, Krause KH, Petignat P, Zehra R, Pervaiz S, Irminger-Finger I 2009 Dissemination of intraperitoneal ovarian cancer: Discussion of mechanisms and demonstration of lymphatic spreading in ovarian cancer model. Crit Rev Oncol Hematol 72:1-9 Shield K, Ackland ML, Ahmed N, Rice GE 2009 Multicellular spheroids in ovarian cancer metastases: Biology and pathology. Gynecol Oncol 113:143-148 Gardner MJ, Jones LM, Catterall JB, Turner GA 1995 Expression of cell adhesion molecules on ovarian tumour cell lines and mesothelial cells, in relation to ovarian cancer metastasis. Cancer Lett 91:229-234 Leung PC, Choi JH 2007 Endocrine signaling in ovarian surface epithelium and cancer. Hum Reprod Update 13:143-162 Kelly AC, Rodgers A, Dong KW, Barrezueta NX, Blum M, Roberts JL 1991 Gonadotropin-releasing hormone and chorionic gonadotropin gene expression in human placental development. DNA Cell Biol 10:411-421 Hazan RB, Qiao R, Keren R, Badano I, Suyama K 2004 Cadherin switch in tumor progression. Ann N Y Acad Sci 1014:155-163 Marthiens V, Kazanis I, Moss L, Long K, Ffrench-Constant C Adhesion molecules in the stem cell niche--more than just staying in shape? J Cell Sci 123:1613-1622 Waltregny D, de Leval L, Coppens L, Youssef E, de Leval J, Castronovo V 2001 Detection of the 67-kD laminin receptor in prostate cancer biopsies as a predictor of recurrence after radical prostatectomy. Eur Urol 40:495-503 Donaldson EA, McKenna DJ, McMullen CB, Scott WN, Stitt AW, Nelson J 2000 The expression of membrane-associated 67-kDa laminin receptor (67LR) is modulated in vitro by cell-contact inhibition. Mol Cell Biol Res Commun 3:53-59 Liao X, Siu MK, Au CW, Wong ES, Chan HY, Ip PP, Ngan HY, Cheung AN 2009 Aberrant activation of hedgehog signaling pathway in ovarian cancers: effect on prognosis, cell invasion and differentiation. Carcinogenesis 30:131-140 Torng PL, Mao TL, Chan WY, Huang SC, Lin CT 2004 Prognostic significance of stromal metalloproteinase-2 in ovarian adenocarcinoma and its relation to carcinoma progression. Gynecol Oncol 92:559-567 156  353. 354. 355. 356. 357. 358. 359. 360. 361. 362. 363.  364. 365. 366. 367. 368. 369.  Davidson B, Goldberg I, Gotlieb WH, Kopolovic J, Ben-Baruch G, Nesland JM, Reich R 2002 The prognostic value of metalloproteinases and angiogenic factors in ovarian carcinoma. Mol Cell Endocrinol 187:39-45 Hlubek F, Spaderna S, Jung A, Kirchner T, Brabletz T 2004 Beta-catenin activates a coordinated expression of the proinvasive factors laminin-5 gamma2 chain and MT1MMP in colorectal carcinomas. Int J Cancer 108:321-326 Liu P, Yang J, Pei J, Pei D, Wilson MJ Regulation of MT1-MMP activity by betacatenin in MDCK non-cancer and HT1080 cancer cells. J Cell Physiol Liu X, Manzano G, Lovett DH, Kim HT Role of AP-1 and RE-1 binding sites in matrix metalloproteinase-2 transcriptional regulation in skeletal muscle atrophy. Biochem Biophys Res Commun 396:219-223 Staun-Ram E, Goldman S, Shalev E 2009 p53 Mediates epidermal growth factor (EGF) induction of MMP-2 transcription and trophoblast invasion. Placenta 30:1029-1036 Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T 2003 Regulation of matrix metalloproteinases: an overview. Mol Cell Biochem 253:269-285 Itoh Y, Seiki M 2006 MT1-MMP: a potent modifier of pericellular microenvironment. J Cell Physiol 206:1-8 Sato H, Takino T Coordinate action of membrane-type matrix metalloproteinase -1 (MT1-MMP) and MMP-2 enhances pericellular proteolysis and invasion. Cancer Sci Yoshizaki T, Sato H, Furukawa M 2002 Recent advances in the regulation of matrix metalloproteinase 2 activation: from basic research to clinical implication (Review). Oncol Rep 9:607-611 Itoh Y, Takamura A, Ito N, Maru Y, Sato H, Suenaga N, Aoki T, Seiki M 2001 Homophilic complex formation of MT1-MMP facilitates proMMP-2 activation on the cell surface and promotes tumor cell invasion. Embo J 20:4782-4793 Lamari FN, Zompra AA, Pateraki E, Kousidou OC, Magafa V, Karamanos NK, Cordopatis P 2006 Gonadotropin-releasing hormone analogues alter gene expression of metalloproteinases and their tissue inhibitors in human breast cancer epithelial cells. Anticancer Res 26:4615-4621 Engel JB, Schally AV 2007 Drug Insight: clinical use of agonists and antagonists of luteinizing-hormone-releasing hormone. Nat Clin Pract Endocrinol Metab 3:157-167 Cheung LW, Leung PC, Wong AS Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene 29:2427-2440 Toker A, Yoeli-Lerner M 2006 Akt signaling and cancer: surviving but not moving on. Cancer Res 66:3963-3966 Kurman RJ, Shih Ie M The origin and pathogenesis of epithelial ovarian cancer: a proposed unifying theory. Am J Surg Pathol 34:433-443 Gross AL, Kurman RJ, Vang R, Shih Ie M, Visvanathan K Precursor lesions of high-grade serous ovarian carcinoma: morphological and molecular characteristics. J Oncol 2010:126295 Vang R, Shih Ie M, Kurman RJ 2009 Ovarian low-grade and high-grade serous carcinoma: pathogenesis, clinicopathologic and molecular biologic features, and diagnostic problems. Adv Anat Pathol 16:267-282  157  Appendices. Appendix I. The effects of growth factors on human GnRH-II promoter activity.  (A) JEG-3 cells and (B) OVCAR-3 cells were treated with 8-bromo cAMP, EGF, leptin, HGF and FGF for 24 h after transient transfection with a GnRH-II promoter luciferase construct together with a (RSV)lacZ plasmid. Cell lysates were collected for luciferase assay and measurements of -galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/-galactosidase activity (i.e. GnRH-II promoter luciferase activity) of three independent experiments. * p<0.05 compared to untreated control (ctrl).  158  Appendix II. EGF induces GnRH-II promoter activity and GnRH-II mRNA levels in JEG3 choriocarcinoma cells.  (A) JEG-3 cells were treated with 50 ng/ml of EGF for 24 h and total RNA was used to prepare cDNA for RTq-PCR to evaluate the effect of EGF on GnRH-II, GnRH-I and GnRHR mRNA levels expressed as percentage over untreated control (Ctrl). Results are expressed as mean SEM of three independent experiments. * p<0.05 compared to untreated control (Ctrl). (B) JEG-3 cells were transiently transfected with a GnRH-II promoter-driven luciferase reporter gene construct together with a (RSV)-lacZ plasmid and then pre-treated with 10 M EGFR inhibitor (AG1478) for 30 min prior treatment with 50 ng/ml EGF for 24 h. Cell lysates were collected for luciferase assay and measurements of β-galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/β-galactosidase activity (i.e. GnRH-II promoter luciferase activity) of three independent experiments.* p<0.05 compared to untreated control (Ctrl). # p<0.05 compared to cells treated with EGF. (C) In parallel experiments, total RNA was used to prepare cDNA after administration of AG1478 in the presence or absence of 50 ng/ml EGF for 24 h and subjected for RTq-PCR to evaluate the effect of EGF on GnRH-II mRNA levels expressed as percentage over untreated control (Ctrl). Results are expressed as mean SEM of three independent experiments. * p<0.05 compared to untreated control (Ctrl). # p<0.05 compared to cells treated with EGF. (D) JEG-3 cells were transfected with wild type GnRH-II promoterdriven lucifease reporter gene construct or a 3 bp mutated CRE-GnRH-II promoter-driven luciferase reporter construct followed by 50 ng/ml EGF or 1 mM cAMP treatment. Cell lysates were collected for luciferase assay and measurements of β-galactosidase activity as a control for transfection efficiency. Results are expressed as mean  SEM luciferase activity/β-galactosidase activity (i.e., GnRH-II promoter luciferase activity) of three independent experiments.* p<0.05 compared to untreated control (Ctrl). # p<0.05 compared to cells transfected with wild type GnRH-II promoter-driven luciferase reporter gene contruct and followed by EGF or cAMP treatment.  159  Appendix III. EGF induced phosphorylation of CREB activates cAMP-responsive element within the human GnRH-II promoter.  (A) Nuclear lysates harvested from EGF treated cells were subjected to Western blotting and probed for phosphorylated CREB (p-CREB). Total CREB (CREB) and β-actin were used as normalization control. (B) JEG-3 cells were pre-treated with 20 M PD98059 (selective MAPK inhibitor) for 30 min and then co-treated in the presence or absence of 50 ng/ml EGF for 2 h or 4 h. Nuclear cell lysates were collected and the level of p-CREB was determined by Western blotting. β-actin was used as normalization control. (C) JEG-3 cells were treated with 50 ng/ml EGF for 1 h, 2 h, 4 h, or were untreated (Ctrl). Cross-linked, sheared chromatin was immuno-precipitated (IP) with p-CREB and recovered chromatin was subjected to PCR analysis using primers spanning the CRE region of the GnRH-II promoter. The IgG lanes are ChIPs performed using non-specific IgG. An ethidium bromide-stained gel of PCR products shows a representative of ChIP analysis from three independent experiments. (D) The efficiency of the siRNA for CREB was tested by Western blotting (Upper panel). Cells were transfected with GnRH-II promoterdriven luciferase reporter gene construct together with 150 nM random control siRNA (si-Ctrl) or CREB siRNA (si-CREB) for 24 h, and then treated with 50 ng/ml EGF for 24 h. Cell lysates were assayed for luciferase activity and measurements of β-galactosidase activity as a control for transfection efficiency, the result of which are expressed as mean  SEM luciferase activity/β-galactosidase activity (i.e. GnRHII promoter luciferase activity) of three independent experiments.* p<0.05 compared to cells treated with a control siRNA (si-Ctrl). # p<0.05 compared to cells treated with CREB siRNA and followed by EGF or cAMP treatment.  160  Appendix IV. EGF and GnRH-II additively enhances JEG-3 cell invasive potential  JEG-3 cells were treated with 25 ng/ml of EGF, 10 nM of GnRH-II or in combination for 24 h and then seeded into Matrigel-coated transwells and cultured for 48 h. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with untreated control (Ctrl). # p<0.05 compared with EGF or GnRH-II treatment.  161  Appendix V. LRP regulates N-cadherin expression to enhance ovarian cancer cell invasiveness.  CaOV-3 cells were stably transfected with expression vectors for wild type LRP, two different LRP mutants, or eGFP as a control (Ctrl). (A) The efficiency of LRP over-expression and the N-cadherin levels (N-cad) in independent clones (i.e. Clones 1 and 2) were tested by Western blotting. β-actin was probed as a normalization control. (B) In parallel experiments, these stably transfected CaOV-3 cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM control siRNA (si-Ctrl). Protein lysates were then harvested and subjected to Western blotting to monitor N-cad protein levels. (C) The efficiency of 50 nM N-cad siRNA (si-N-cad) was tested in Western blotting. (D) LRP over-expressing CaOV-3 cells and control cells (Ctrl) were treated with 50 nM si-N-cad or 50 nM si-Ctrl prior subjected to invasion assay for 48 h. Results are expressed as mean ± SEM of three independent experiments. *p<0.05 compared with siRNA control (si-Ctrl). (E) Protein lysates of CaOV-3 cells stably over-expressing wild type LRP, two different LRP mutants (i.e. Mut A and Mut B) and eGFP control vector (Ctrl) were harvested and subjected to Western blotting for their relative N-cad protein levels or β-actin as a normalization control.  162  Appendix VI. GnRH-II-induced MMP-2 and MT1-MMP in two independent signaling pathways.  (A) OVCAR-3 and (B) CaOV-3 cells were treated with 50 nM -catenin siRNA (si--catenin) or 50 nM control siRNA (si-Ctrl) for 24 h and then treated with 10 nM GnRH-II for 24 h. Cell lysates were harvested and subjected to Western blotting with antibodies against MMP-2, MT1-MMP, -catenin, or -actin as the normalization control. (C) OVCAR-3 and (D) CaOV-3 cells were treated with 75 nM LRP siRNA (si-LRP) or 75 nM siRNA control (si-Ctrl) for 24 h prior treatment with 10 nM GnRH-II for 24 h. Cell lysates were then harvested and subjected to Western blotting with antibodies against MMP-2, MT1-MMP, LRP, or -actin as the normalization control. Western blot results were representative blots of three independent experiments.  163  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071442/manifest

Comment

Related Items