Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on the roles of human ferroportin and hephaestin in iron homeostasis Wong, Ann Yuen Kwan 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_wong_annyuenkwan.pdf [ 3.81MB ]
Metadata
JSON: 24-1.0071383.json
JSON-LD: 24-1.0071383-ld.json
RDF/XML (Pretty): 24-1.0071383-rdf.xml
RDF/JSON: 24-1.0071383-rdf.json
Turtle: 24-1.0071383-turtle.txt
N-Triples: 24-1.0071383-rdf-ntriples.txt
Original Record: 24-1.0071383-source.json
Full Text
24-1.0071383-fulltext.txt
Citation
24-1.0071383.ris

Full Text

STUDIES ON THE ROLES OF HUMAN FERROPORTIN AND HEPHAESTIN IN IRON HOMEOSTASIS  by  ANN YUEN KWAN WONG B.Sc., The University of British Columbia, 2005  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  October 2010  © Ann Yuen Kwan Wong, 2010  Abstract Ferroportin-1 (Fpn1) is a highly conserved 571-amino acid protein with the human, mouse, and rat polypeptides having 90–95% sequence identity at the amino acid level. Disruption of Fpn1 expression in zebrafish and mice results in embryonic lethality, while conditional knockout of the gene encoding Fpn1 in the intestine at the postnatal stage leads to severe iron deficiency anemia and iron accumulation in duodenal enterocytes. These studies suggest that Fpn1 is the major, if not the sole, exporter protein for iron. Export of dietary iron is thought to be facilitated by hephaestin (Hpn), a multicopper ferroxidase in the basolateral membrane of duodenal enterocytes. However, the precise mechanism of iron transport by Fpn1 and Hpn remains to be elucidated.  The absence of an iron export mechanism in Saccharomyces cerevisiae was utilized to explore how Fpn1 and Hpn function in iron export. Unlike humans, S. cerevisiae transports excess iron into a storage vacuole through the vacuolar iron transporter, Ccc1p. The Δccc1 mutant fails to store excess iron; as a result, iron accumulates in the cytosol and cells die due to oxidative stress when exposed to high concentrations of extracellular iron. By expressing recombinant human Fpn1 and Hpn in S. cerevisiae, an iron export system was introduced. The functionality of rhHpn in S. cerevisiae was confirmed by both a ferrozine ferroxidase assay and a transferrin iron-loading assay. The effects of the individual or both recombinant proteins on iron sensitivity of the Δccc1 yeast with an additional fet3 (the yeast homolog of Hpn) deletion were evaluated. Recombinant human Fpn1 and Hpn suppressed the lethal phenotype of the Δccc1 mutant while co-expression of rhHpn with rhFpn1 led to a stronger rescue phenotype of the Δccc1 mutant under  ii  concentrations of high extracellular iron. The expression of rhFpn1 and / or rhHpn also relieved the copper sensitive Δfet3 mutant from copper stress. A physical interaction between rhFpn1 and rhHpn was demonstrated by cross-linking with BS3. These studies advance our knowledge of the roles Fpn1 and Hpn play in human enterocytes and suggest that these proteins are intimately involved in iron export from enterocytes into the blood.  iii  Table of Contents Abstract…………………………………………………………………………………. ii Table of Contents ……………………………………………………………………… iv List of Tables………………………………..………………………………………… viii List of Figures ………………………………………………………………................. ix List of Abbreviations……………………………………………................................... xi Acknowledgements.…………...…….………………………………………………... xiii  Chapter 1: Introduction………………………………………………………………... 1 1.1  Introduction…………………………..……...…………………..……………... 1  1.2  Chemistry and Biochemistry of Iron……………………………………............ 1  1.3  Dietary Iron Absorption in Mammals………………...………………………... 3  1.4  1.3.1  Iron as Nutrients……………………………………............................ 3  1.3.2  Iron Absorption Pathways………………………………………......... 4  Proteins of Iron Export…...…………………………………………………….. 7 1.4.1  Ferroportin………………………………………………..................... 7  1.4.2  Hephaestin………………………………………................................. 9  1.4.3  Interaction Between Ferroportin and Multicopper Ferroxidases…..... 10  1.5  Iron Transport and Metabolism………………………………………….......... 12  1.6  Regulation of Iron Homeostasis……………………………………..............… 12  1.7  Diseases and Iron Involvement……………………………………………….. 14  1.8  Diseases of Iron Imbalance…………………………………………………… 15  1.9  1.8.1  Ferroportin and Hemochromatosis…………………………………. 16  1.8.2  Multicopper Ferroxidases and Iron Imbalance……………………... 17  Iron Metabolism in Yeast…………………………………………………….. 17  1.10 Hypotheses……………………………………………………………………. 20 1.11 Objectives……………………………………………………..…………........ 20  iv  Chapter 2: Materials and Methods………………………………………………….. 21 2.1  Materials…………………………………………………………….………… 21  2.2  Generation of Yeast Knock-Out Mutants…………………………………….. 22  2.3  Cloning and Genetic Manipulation of Fpn1 and Hpn cDNA………………… 23  2.4  Transformation and Expression of Recombinant Proteins…………………… 25  2.5  Protein Expression Profiling………………………………………………….. 27  2.6  2.5.1  Western Blot Analysis……………………………………………… 27  2.5.2  In-Gel Fluorescence Analysis………………………………………. 28  Cellular Localization Studies…………………………………………………. 28 2.6.1  Fluorescence Microscopy…………………………………………… 28  2.6.2  Protease-Cleavable Hephaestin Ectodomain……………………….. 29  2.7  Solutions and Glassware Preparation for Metal Assays……………………… 29  2.8  Ferroxidase Activity Assays………………………………………………….. 30  2.9  2.8.1  Ferrozine Assay…………………………………………………….. 30  2.8.2  In-Gel p-Phenylenediamine Assay…………………………………. 30  Transferrin Iron Loading Assay………………………………………………. 31  2.10 Metal Sensitivity Phenotype Assays………………………………………….. 31 2.11 Quantification of Cellular Iron………………………………………………... 32 2.12 Covalent Chemical Cross-Linking……………………………………………. 33  Chapter 3: Expression of Recombinant Human Ferroportin and Hephaestin in Saccharomyces cerevisiae: An Introduced Iron Transport System…... 34 3.1  Rationale and Overview………………………………………………………. 34  3.2  Recombinant Human Ferroportin and Hephaestin Expression in Yeast……… 35  3.3  Cellular Localization of Recombinant Proteins………………………………. 37  3.4  Ferroxidase Activity of Recombinant Hephaestin……………………………. 40  3.5  Recombinant Proteins and Metals Sensitivity of Yeast………………………. 46  3.6  Effects of Recombinant Proteins on Cellular Iron Content…………………... 49  3.7  Discussion…………………………………………………………………….. 52  v  3.7.1  Recombinant Human Ferroportin and Hephaestin Expression in Yeast………………………………………………………………… 52  3.7.2  Cellular Localization of Recombinant Human Proteins……………. 53  3.7.3  Recombinant Human Hephaestin Fulfills Its Proposed Biological Role…………………………………………………………………. 55  3.7.4  Recombinant Human Proteins Rescued Mutant Yeast from Toxic Metals……………………………………………………………….. 57  3.8  Conclusions…………………………………………………………………… 59  Chapter 4: Physical Interaction Between Human Ferroportin and Hephaestin…. 60 4.1  Rationale and Overview…………………………………………………….… 60  4.2  Co-localization of Recombinant Human Ferroportin and Hephaestin in Yeast. 61  4.3  Cross-Linking of Ferroportin and Hephaestin………………………………... 61  4.4  Discussion…………………………………………………………………….. 66 4.4.1  4.5  Human Ferroportin and Hephaestin Physically Interact……………. 66  Conclusions…………………………………………………………………… 67  Chapter 5: Summary and General Discussion……………………………………… 68 5.1  Introduced Iron Export System in Saccharomyces cerevisiae……………….. 68  5.2  Potential Involvement in Transport of Other Metals…………………………. 70  5.3  Interaction Between Ferroportin and Hephaestin…………………………….. 71  5.4  Significance of the Work……………………………………………………... 72  5.5  Future Directions……………………………………………………………... 73 5.5.1  Development of an Expression System That Could Be Optimized for Functional Protein Production…………………………………... 73  5.5.2  Mechanism of Iron Transport by Ferroportin and Hephaestin…….... 73  5.5.3  Isolation of Hephaestin Soluble Ectodomain from Yeast Cell Surface for Structural and Biochemical Analyses………………...... 74  5.5.4  Mapping the Ferroportin-Hephaestin Interaction…………………… 74  vi  References…………………………………………………………………………..….. 75  Appendices.…………………………………………………………………………….. 90 Appendix A: Fluorescence Microscopy of Saccharomyces cerevisiae Empty Vector Controls…...………………………………………………… 90 Appendix B: BPS Assay Metal Specificity………………………………………… 91 Appendix C: Apparent Molecular Weight of Recombinant Human Ferroportin Is Dependent on SDS-Loading……………………………………… 92 Appendix D: Ceruloplasmin Retained Its Oxidase Activity When Treated with SDS and Heat Under Non-Reducing Condition……………………. 93 Appendix E: Rate of Auto-oxidation Is Reduced in the Presence of Yeast……….. 95 Appendix F: Rescue Phenotype Observed Was Not Due to the Loss of Mitochondria in Saccharomyces cerevisiae………………………… 96 Appendix G: Copper Supplementation Improved Recombinant Human Hephaestin Expression……………………………………………… 97  vii  List of Tables Table 2.1 Oligonucleotides used to generate clones for ferroportin and hephaestin expression in S. cerevisiae………………………………………………….. 24  viii  List of Figures Figure 1.1 Classic model of iron metabolism in human enterocytes …………….…….. 5 Figure 1.2 Predicted topology of ferroportin………………………………………….... 8 Figure 1.3 Hypothetical structure of hephaestin……………………………………….. 11 Figure 1.4 Iron metabolism in Baker’s yeast ………………..………………………... 19 Figure 2.1 Recombinant human ferroportin and hephaestin expression constructs….... 26 Figure 3.1 Galactose-inducible expression of rhFpn1 and rhHpn in S. cerevisiae……. 36 Figure 3.2 Cellular localization of rhFpn1 and rhHpn in S. cerevisiae………………... 38 Figure 3.3 Protease released rhHpn soluble ectodomain from S. cerevisiae cell surface………………………………………………………………………. 39 Figure 3.4 Cellular localization of rhFpn1 and rhHpn when expressed alone in S. cerevisiae…………………………………………………………………. 41 Figure 3.5 In-gel oxidase activity of multicopper ferroxidases……………………….. 42 Figure 3.6 Cell surface ferroxidase activity of Δccc1Δfet3 mutants expressing rhFpn1 and / or rhHpn………..……………………………………………. 44 Figure 3.7 Oxidization of iron by recombinant human hephaestin for subsequent binding by apo- transferrin.…………………………………..…………….. 45 Figure 3.8 Expression of recombinant human ferroportin rescues Δccc1Δfet3 yeast from toxic extracellular iron concentrations…..………………..................... 47 Figure 3.9 Expression of recombinant human ferroportin and hephaestin rescues Δccc1Δfet3 yeast from toxic extracellular copper concentrations….…….... 48 Figure 3.10 Expression of recombinant human proteins did not change the iron distribution in yeast…………………………………………………………. 50 Figure 3.11 Viabilities of Δccc1Δfet3 mutants grown under high iron conditions…..... 51  ix  Figure 4.1 Co-localization of recombinant human ferroportin and hephaestin in S. cerevisiae……………………………………...………………………… 62 Figure 4.2 Human ferroportin forms a complex with an unidentified protein on cell surface…...…………………………………………………………. 64 Figure 4.3 Cross-linking recombinant human ferroportin and hephaestin on the yeast cell surface……………………………………………………………. 65 Figure A.1 Fluorescence microscopy of S. cerevisiae containing empty vectors…….. 90 Figure A.2 The BPS assay is specific for determination of iron but not copper concentrations……………………………………………………………… 91 Figure A.3 SDS-loading dependent gel mobility shift of rhFpn1-EGFP……………… 92 Figure A.4 Oxidase activity of ceruloplasmin in plasma……………………………… 94 Figure A.5 Auto-oxidation of iron in the presence and absence of S. cerevisiae……... 95 Figure A.6 Rescue phenotype of iron sensitive mutants was not due to the loss of mitochondria…………………………………………………………….. 96 Figure A.7 Galactose-inducible expression of rhHpn in S. cerevisiae with or without copper supplementation…………………………………………… 97  x  List of Abbreviations aCp  aceruloplasminemia  BMP  bone morphogenetic protein  BPS  bathophenanthroline sulfonate  CAPS  N-cyclohexyl-3-aminopropansulfonic acid  Cp  ceruloplasmin  DCytB  duodenal cytochrome B  DMSO  dimethyl sulfoxide  DMT1  divalent metal transporter 1  ECL  enhanced Chemiluminescence  EGFP  enhanced green fluorescent protein  Fpn1  ferroportin 1  FRET  fluorescence resonance energy transfer  FXa  activated factor X  Fz  ferrozine  GPI  glycosylphosphatidylinositol  HCP1  heme carrier protein 1  HFE  hemochromatosis protein  HJV  hemojuvelin  Hpn  hephaestin  HRG  heme responsive gene  IMP  integrin-mobilferrin pathway  IREG1  iron regulatory transporter 1  xi  Jak2  Janus kinase 2  MCO  multicopper ferroxidase  mHJV  GPI-anchored hemojuvelin  MTP1  metal transporter protein 1  MW  molecular weight  NADP  nicotinamide adenine dinucleotide phosphate  PBS  phosphate buffered saline  PCR  polymerase chain reaction  pPD  para-phenylenediamine  PVDF  polyvinylidene fluoride  rh  recombinant human  RFP  red fluorescent protein  SDS-PAGE  sodium dodecyl sulfate-polyacrylamide gel electrophoresis  sHJV  soluble hemojuvelin  sla  sex-linked anemia  SM  selective media  TER  transepithelial resistance  Tf  transferrin  TfR  transferrin receptor  TM  transmembrane  UPR  unfolded protein response  xii  Acknowledgements  I have been very fortunate to have received help, guidance and support from many people during the course of my Ph.D.  Amongst them, my supervisor Dr. Ross MacGillivray is primary. I would like to express sincere appreciation to Ross for the inspiration and encouragement. Ross always wants the best for his students. Not only has Ross created a rich learning environment, but also provided me with great opportunities to meet and receive advice from some very inspiring individuals. Most importantly, Ross has given me the freedom and support to explore my ideas. I feel very lucky to have worked with you.  I would also like to thank my supervisory committee, Dr. Wilfred Jefferies and Dr. Robert Molday, for all their feedback and encouragement and their help to steer my project to completion.  I want to thank all past and present members of the MacGillivray lab and my side project collaborator – Dr. Louis Wadsworth at the BC Children’s and Women’s Hospital – for all their support and advice.  I would also like to acknowledge all the support I received from my dear friends. Thank you very much for believing in me!!  Heartfelt thanks to my family – my awesome parents, my brother and Jumay.  ... this thesis is for Dannies and Sera.  xiii  Chapter 1: Introduction  1.1  Introduction Since the emergence of an aerobic atmosphere approximately a billion years ago,  iron has become both a friend and a foe to most life forms (reviewed in [1]). Iron serves as an essential element that is involved in many cellular processes involving single electron transfer including oxygen transport and respiration. Additionally, iron plays an important role in cell proliferation and immunity. However, iron can be cytotoxic in its ferrous form as Fe(II) reacts with oxygen in the environment to produce damaging free radicals. Thus, a highly efficient and regulated system for iron acquisition and transport is required to maintain iron homeostasis.  1.2  Chemistry and Biochemistry of Iron Despite iron being the fourth most abundant element in the Earth’s crust [2], iron  deficiency is prevalent in 66–80% of the World’s human population (World Health Organization Statistics, 2003) most of which is due to malnutrition in developing countries. However, even with an iron-rich diet, only 10% of ingested iron is absorbed [3]. This relatively low absorption is due to the complex chemistry of Fe(III) in aqueous solutions that limits its solubility at neutral pH. Aqueous iron mainly exists in two oxidation states – ferrous iron or Fe(II) and ferric iron or Fe(III). At low pH, both Fe(II) and Fe(III) present as soluble hexahydrates – [Fe(H2O)6]2+ and [Fe(H2O)6]3+, respectively. At pH greater than 2, Fe(III) forms an insoluble [Fe(H2O)3(OH-)3] complex. Additionally, the level of insoluble iron at neutral pH increases under physiological oxygen  1  concentration, as Fe(II) auto-oxidizes to Fe(III) [4]. This illustrates the importance of ligands for improving the solubility of iron at physiological oxygen tension and pH; common biological ligands of dietary iron include citrate and amino acids such as histidine [5].  Depending upon surrounding conditions, iron readily undergoes reduction and oxidation. The Fe(II) / Fe(III) redox couple is very reactive and participates in a variety of biological processes involving single electron transfer reactions. The redox potential of the iron pair (0.77 v) [2] can vary up to 1 volt depending on the coordinating ligands [4, 6]. This reactivity allows for reversible redox reactions as the range falls within the potentials of biological oxidants and reductants, and thereby, makes iron an essential element in biological systems in addition to its abundance in the ecosystem. However, the advantage of the Fe(II) / Fe(III) reactivity is counter-balanced by their potential to generate harmful oxygen- and hydroxyl-free radicals via the Haber-Weiss-Fenton series of reactions (reviewed in [4]):  Fe2+ + O2 Æ Fe3+ + O2‫· ־‬ 2O2‫ · ־‬+ 2H+ Æ H2O2 + O2 Fe2+ + H2O2 Æ Fe3+ + OH‫ ־‬+ OH ·  The resulting hydroxyl free radicals promote lipid peroxidation, DNA strand breakage, biomolecule degradation, and eventually cause cell death [7].  2  1.3  Dietary Iron Absorption in Mammals  1.3.1  Iron as Nutrients In an average diet, iron is found mainly as inorganic iron (both Fe(II) and Fe(III))  which accounts for approximately 90% of total dietary iron content. The remaining 10% comes in the form of heme where iron is complexed to protoporphyrin IX [8, 9]. Iron absorption varies significantly with diet composition, iron status of the individual, and most importantly, the bioavailability of the different iron forms. It has been estimated that in the developed world, where meat consumption is relatively high, over half of all absorbed iron comes from the heme in hemoglobin or myoglobin in dietary meats while the rest of the world obtains iron mostly as Fe(III) from plant sources [8-12]. An alternative iron source in some diets comes as Fe(II) from pharmaceutical iron supplements [10, 11]. Among all natural iron sources, heme is the most bioavailable and its level of absorption remains unaffected regardless of diet composition. In contrast, the bioavailability of inorganic iron is dependent on other dietary components. Enhancers, such as ascorbic acid, increase inorganic iron bioavailability by promoting the reduction of Fe(III) to soluble Fe(II). Inhibitors such as phytates in cereal and polyphenols in plants can form insoluble complexes with inorganic iron and thereby reduce its absorption [9, 13]. Additionally, inorganic iron absorption is influenced by the level of gastric acid secretion in the stomach with the resulting acidity increasing the solubility of inorganic iron [14].  3  1.3.2  Iron Absorption Pathways The majority of the body iron store is found in the heme prosthetic groups of  hemoglobin molecules [15]. Because iron is not readily bioavailable, an efficient iron acquisition system must exist to replace the daily iron lost in the feces and in bleeding and accommodate the daily requirement (minimum 20 mg; [16]) for heme synthesis. Dietary iron absorption occurs in the proximal small intestine by specialized epithelial cells called duodenal enterocytes. Mechanisms for inorganic iron uptake allow for both Fe(II) and Fe(III) to be imported into the enterocyte. To date, three pathways for iron uptake in human enterocytes are recognized – two of which are shown in Figure 1.1. The third pathway involves the integrin-mobilferrin pathway (IMP) [17]. Mobilferrin is a homologue of calreticulin, a common chaperone protein within the endoplasmic reticulum, while β3 integrin is a known adhesion protein [11].  Despite having been  studied for over a decade, the IMP pathway remains poorly understood, and thus, has been omitted from Figure 1.1. It is now known that the IMP pathway only transports iron in an inorganic Fe(III) state [5]. It is believed that during iron deficiency, mobilferrin is secreted into the lumen of the small intestine along with the mucosal surface protein mucin and the two proteins chelate Fe(III) [11]. The soluble Fe(III)-mucin-mobilferrin complex is transported to the plasma membrane and Fe(III) is taken up into the enterocyte by β3 integrin [18]. Inside the cytosol, the assembly of a complex of β3 integrin, mobilferrin, flavin mono-oxygenase and DMT1 has been proposed [11]. This complex known as paraferritin was shown to have ferrireductase activity that is capable of reducing the newly transported Fe(III) [19]. Soluble Fe(II) is then free to join the pool of Fe(II) transported across the plasma membrane via the DMT1 pathway.  4  Figure 1.1 Classic model of iron metabolism in human enterocytes. Dietary Fe(III) absorption requires reduction to Fe(II) by DCytB [20], for transport of Fe(II) into cell by DMT1 in the apical membrane [21-23]. DCytB is not required for iron transport by DMT1 [24], therefore, Fe(II) from dietary iron supplements is readily imported into the enterocyte by DMT1. Uptake of iron-porphyrin occurs through HCP1 [25]. Inside the enterocyte, heme is degraded and the iron is released. Depending on the iron load, iron in enterocyte may be exported from the cell or stored in ferritin until needed or until the cell dies at which time the stored iron is eliminated from the body. Absorbed dietary iron required to maintain body iron homeostasis must be transported across the enterocyte, presumably by transcytosis [29] or an iron chaperone [30, 31], and subsequently exported out of the cell into the circulation. The basolateral membrane protein, Fpn1, is implicated as the Fe(II) exporter in the intestine [12, 32]. Hpn is believed to be essential for the transfer of iron from the gut mucosa to blood for binding by transferrin (reviewed in [4]). 5  As shown in Figure 1.1, dietary Fe(III) absorption requires reduction to Fe(II) by an intestinal ferrireductase (DCytB) [20] for transport of Fe(II) into cell by the apical transmembrane protein – divalent metal transporter 1 (DMT1) [21-23]. DCytB is not required for iron transport by DMT1 [24]; therefore, Fe(II) from dietary iron supplements is readily imported into the enterocyte by DMT1. Uptake of iron-porphyrin occurs through heme carrier protein 1 (HCP1) across the apical membrane [25]. HCP1 can also transport folate [26, 27], and it has been hypothesized that a homologue of the C. elegans heme responsive gene (HRG) protein exists in mammalian systems for heme transport [28]. Once inside the enterocyte, heme is degraded and the iron is released. Depending on the iron load, iron in enterocyte maybe exported from the cell or stored in ferritin until needed or until the cell dies at which time the stored iron is eliminated from the body via the feces.  Dietary iron that is absorbed to maintain body iron homeostasis must be transported across the enterocyte, presumably by transcytosis (reviewed in [29]) or iron chaperones [30, 31], and subsequently exported out of the cell and into the circulation. The basolateral enterocyte membrane protein, ferroportin 1 (Fpn1), has been implicated as the Fe(II) exporter protein in the intestine [12, 32]. Once in the blood plasma, the iron is bound by the iron transport protein, apo-transferrin (apo-Tf). Transferrin (Tf) does not bind Fe(II); thus, hephaestin (Hpn), a multicopper ferroxidase on the basolateral membrane of enterocytes, has been suggested to be essential for the transfer of iron from the gut mucosa to blood (reviewed in [4]).  6  1.4  Proteins of Iron Export  1.4.1  Ferroportin Duodenal iron export across the basolateral membrane is mediated by ferroportin  (also known as iron regulatory transporter 1 (IREG1) and metal transporter protein 1 (MTP1)). Discovered independently by three groups [33-35], ferroportin is a highly conserved 571-amino acid protein with the human, mouse, and rat polypeptides sharing 90–95% sequence identity at the amino acid level [36]. The topology of Fpn1 is unresolved but it is predicted to contain twelve transmembrane domains with both the amino- and carboxyl-termini oriented towards the intracellular space according to the latest model (Figure 1.2) [37]. Ferroportin is expressed in cells involved in regulated iron transport including duodenal enterocytes (dietary iron absorption), placental syncytiotrophoblasts (embryonic iron transport) and macrophages (iron recycling from senescent red blood cells) (reviewed in [32]). Disruption of Fpn1 expression in zebrafish [34] and mice [38] resulted in embryonic lethality. Conditional knockout of the gene encoding Fpn1 in the intestine at the postnatal stage leads to severe iron deficiency anemia and iron accumulation in duodenal enterocytes [38]. This suggests that Fpn1 is the major, if not the sole, iron exporter protein (reviewed in [39]).  Little is known about the properties of Fpn1 and the mechanism through which Fpn1 exports iron. Experiments in Xenopus oocytes have demonstrated the ability of Fpn1 to export (presumably) Fe(II) [32]. Sequence analysis of ferroportin reveals a putative NADP / adenine-binding site with the IFVCGP motif in the carboxy terminal  7  Figure 1.2 Predicted topology of ferroportin. [37] Fpn1 was predicted to have twelve membrane-spanning domains with both amino- and carboxyl- termini oriented towards intracellular space. Positions of known disease-related mutations are highlighted in blue for Fpn1 mutants that do not respond to hepcidin down-regulation and in red for Fpn1 mutants that do not localize to the plasma membrane.  8  that is found in yeast ferric reductase suggesting that ferroportin may exhibit reductase activity [40]. Fpn1 functions as a homo-dimer in rat glioma C6 cells, mouse bone marrow macrophages and cultured cells transfected with labeled Fpn1 [41]. A recent study on the cellular localization and movement of Fpn1 and DMT1 with respect to iron status in rat duodenum and Caco-2 cells suggests a novel mechanism for maintaining iron balance [42]. Changes in distribution of DMT1 and Fpn1 between apical and basolateral membrane compartments in response to iron status may be involved in the mucosal block phenomenon – this is a rapid (within 2–4 hours) adaptive response to protect cells against excessive iron absorption. Iron export by Fpn1 is postulated to be mediated by a multicopper ferroxidase; however, the requirement of a ferroxidase for iron export is debatable [32].  1.4.2  Hephaestin The exit of dietary iron from the duodenal epithelial cells is thought to be facilitated  by ferroportin acting in concert with hephaestin, a ferroxidase that resides in the basolateral membrane (reviewed in [12]). Hephaestin was discovered as the mutated gene product in mice with sex-linked anemia (sla) in which a defect in iron transfer from the enterocyte to the blood was found [43, 44]. This suggests that ferroxidase activity is critical for dietary iron release from the duodenal epithelial cells into the bloodstream. The Hpn gene shares 50% sequence identity with the soluble plasma ferroxidase, ceruloplasmin (Cp). A hypothetical model of Hpn structure was generated based on the crystal structure of Cp (Figure 1.3) [45]. Hpn has an additional 86 amino acids at the carboxyl terminus that represent a transmembrane domain and a cytosolic tail. Amino  9  acid residues involved in copper binding and disulfide formation are conserved between Hpn and Cp; therefore, the proteins probably oxidize iron in a similar fashion. Soluble recombinant human Hpn expressed in baby hamster kidney (BHK) cells exhibited ferroxidase activity [46]. Dietary iron absorption remains intact in patients with aceruloplasminemia suggesting that Hpn functions as the ferroxidase in the gut [47]. A third tissue-specific ferroxidase – zyklopen – has recently been identified in the placenta and mammary gland [48].  1.4.3  Interaction Between Ferroportin and Multicopper Ferroxidases An interaction between Fpn1 and multicopper ferroxidases (MCO) has been  observed in various cell types. Not only is Fpn1 found to co-immunoprecipitate with the glycosylphosphatidylinositol (GPI)-anchored form of ceruloplasmin, but Fpn1 also colocalizes with GPI-Cp on astrocytes surface in mammalian central nervous system [49]. The ferroxidase activity of MCO is essential for membrane stability of Fpn1 [50]. In the absence of MCO, iron bound Fpn1 is ubiquitinated, and subsequently internalized and targeted for degradation. In the same study [50], the requirement of MCO for iron transport was demonstrated by silencing GPI-Cp expression in cells expressing a dynamin mutant that traps Fpn1 in the plasma membrane. The loss of iron transport ability was restored by the addition of a multicopper ferroxidase such as Cp and Fet3p (the Hpn homologue in yeast). Because ceruloplasmin is a structural homologue of hephaestin, it has been long proposed that ferroportin and hephaestin interact physically. Recently, co-localization of Fpn1 and Hpn was observed in stably transfected human intestinal absorptive cells [51]. The metal transport specificity of Fpn1 remains unknown  10  Figure 1.3 Hypothetical structure of hephaestin. [45] Ribbon diagram modeled based on known crystal structure of human ceruloplasmin. The putative iron binding site and C-terminal membrane anchor are highlighted.  11  [52] although it has been postulated that its association with Hpn gives specificity (reviewed in [1]); however, studies on plant ferroportin suggests additional roles in nickel [53] and cobalt [54] transport, while studies on mammalian ferroportin revealed its roles in zinc [55] and manganese [56] metabolism.  1.5  Iron Transport and Metabolism Once exported from duodenal enterocytes, two atoms of Fe(III) are delivered by  each molecule of Tf to other parts of the body [57]. Iron-loaded Tf binds to the Tf receptor (TfR) that is ubiquitously present on the plasma membrane of all cells and is internalized through receptor-mediated endocytosis [58]. Inside the cell, endosomes containing the Tf-TfR complex undergo a decrease in pH via proton pumps, resulting in the release of Fe(III) from Tf. An endosomal ferrireductase (Steap3) reduces the free Fe(III) to Fe(II) for export to the cytoplasm by DMT1 [59]. Subsequently, both Tf and TfR are recycled for other rounds of iron binding and delivery (reviewed in [4, 57, 58, 60]). About 85% of Tf-bound iron is delivered to reticulocytes for incorporation into hemoglobin. The remaining iron can be incorporated into other iron-containing proteins such as cytochromes and myoglobin, or stored in hepatocytes.  1.6  Regulation of Iron Homeostasis A system must exist to maintain the balance between iron as an essential element  and iron as a cytotoxic agent. Recently, hepcidin has been identified as the principal regulator of systemic iron homeostasis [61]. This 25 amino acid hormonal peptide produced by the liver is a negative regulator of extracellular iron concentration [62].  12  Hepcidin down-regulates (1) iron absorption by duodenal enterocytes, (2) iron recycling by macrophages from senescent red blood cells, and (3) iron efflux by hepatocytes by binding to Fpn1 in plasma membrane (reviewed in [63]). Upon hepcidin binding, Fpn1 is cooperatively phosphorylated by Janus kinase 2 (Jak2) [64]. The phosphorylated Fpn1 is internalized while simultaneously being dephosphorylated and ubiquitinated as a target for degradation in lysosome [65]. As a secondary effect of Fpn1 down-regulation, increased intracellular iron levels lower the expression of DMT1 resulting in a decrease in iron uptake [66, 67].  Hepcidin expression is modulated at the transcription level by multiple factors including inflammation, transferrin saturation, iron deficiency and hypoxia. In response to inflammation, the cytokine interleukin-6 interacts with its receptor on hepatocyte membranes and activates Stat3 which up-regulates hepcidin expression by binding to a regulatory element on the hepcidin gene [68-70]. A better characterized pathway for regulation of hepcidin expression involves the interaction of hemojuvelin (HJV) with the bone morphogenetic protein (BMP) / Smad signaling pathway [71]. Expressed by liver, heart and skeletal muscles [72], HJV is found in two forms: GPI-anchored HJV (mHJV) and soluble HJV (sHJV) [73]. Hepcidin expression is determined by the relative levels of mHJV and sHJV, determined by the level of Tf-bound iron but not other chelated iron [74]. The two forms reciprocally regulate hepcidin expression in response to the iron requirement of the body. sHJV competes against mHJV for binding to BMP receptors to inhibit BMP / Smad signaling, and thereby blocks hepcidin production [68, 74].  13  The precise role of the hemochromatosis protein (HFE) in the regulation of iron absorption remains to be elucidated. The level of HFE expression inversely correlates to the level of iron uptake [75]. The absence of HFE is associated with iron overloading while overexpression of HFE reduces iron absorption (reviewed in [76]). HFE is believed to act as a sensor of the iron status in the body. Various models regarding HFEmediated regulation of iron homeostasis have been postulated. Studies have indicated that HFE sequesters transferrin receptor 1 (TfR1) when Tf saturation falls within the normal range [77] but competes with holo-Tf for binding to TfR1 with increased Tf saturation [78]. Thus, HFE is proposed to sense the body’s iron requirement based on the level of transferrin saturation with iron. The original model assumed that HFE forms a heterotrimer with β2 microglobulin and TfR1 in the basolateral membrane of enterocytes and signals expression of iron transport proteins through the action of iron response protein [79], or in the plasma membrane of hepatocytes to modulate iron absorption by inducing hepcidin production [80]. A recent study demonstrated the interaction between HFE and transferrin receptor 2 (TfR2) [81]. Because TfR2 is distributed in lipid rafts, it is believed to play a role in signal transduction upon holo-Tf binding. However, the requirement for HFE in TfR2 mediated signal transduction is unknown [81].  1.7  Diseases and Iron Involvement Iron plays contradictory roles in host immunity; iron supports cell proliferation  while killing cells by the generation of reactive oxygen species (ROS). In addition, the billion heme groups found in each red blood cell are sufficient for growth of a thousand bacteria. As part of an inflammatory response, iron is also withheld from microbes to  14  prevent microbial proliferation (reviewed in [82]). Besides activating immune cells and inducing cytokine activities, iron catalyzes the production of highly toxic hydroxyl free radicals by immune cells to kill infectious micro-organisms (reviewed in [83]).  Carcinogenicity of iron has also been suggested. Increased expression of transferrin receptors is found in proliferating tumor cells (reviewed in [84]). Angiogenesis crucial for tumor growth is induced by hypoxic or iron deficient conditions [85]. Additionally, oxidative stress-responsive transcription factors induced by iron can activate transcription of genes like tumor necrosis factor α and interleukin-6 (IL-6). IL-6 is a proinflammatory cytokine that influences cell proliferation and extracellular matrix synthesis. Over expression of IL-6 may lead to chronic inflammation and cancer development (reviewed in [84]).  1.8  Diseases of Iron Imbalance Both iron deficiency and overload have adverse consequences. Iron deficiency  causes anemia or hypoxia [65]. Excess iron or improper processing of iron has been implicated in hemochromatosis [86] and several neurodegenerative disorders, such as Parkinson’s disease, Alzheimer’s disease and Friedrich’s Ataxia [87].  Various defects in genes directly or indirectly involved in maintaining iron homeostasis affect body iron levels. Mutations of transporter proteins involved in iron absorption result in anemia. When defective, the apical ferrous iron transport protein DMT1 causes hypochromic microcytic anemia and hepatic iron accumulation (reviewed  15  in [1]). Increased body iron load observed in patients with hereditary hemochromatosis is caused by one or more mutations in genes encoding proteins involved in maintaining iron homeostasis, including HFE, HJV, hepcidin, TfR2 and Fpn1 [88, 89]. Secondary effects on body iron balance have also been observed in patients with ineffective erythropoiesis. The apical heme transporter protein HCP1 is involved primarily in folate absorption with no mutations to date affecting heme uptake. However, mutation of HCP1 leads to folate deficiency, resulting in megaloblastic anemia due to compromised erythropoiesis (reviewed in [1]). Mutations of the globin beta chain in patients with intermediate to severe beta-thalassemia also cause ineffective erythropoiesis, resulting in secondary iron overload through modulating hepcidin and Fpn1 expression [90].  1.8.1  Ferroportin and Hemochromatosis Mutations in Fpn1 result in hereditary hemochromatosis type IV or ferroportin  disease [36, 52, 91]. These mutations display autosomal dominant inheritance and are heterozygous in clinical presentation [41]. There have been no nonsense mutations identified to date; all Fpn1 mutations are missense mutations that result in either a single amino acid substitution or deletion [41]. Fpn1 mutants are defective either in plasma membrane localization or in response to the binding of hepcidin (Figure 1.2; [41]; reviewed in [92]). Recently, Fpn1 has been characterized as a homodimer which probably explains in part the autosomal dominant nature of ferroportin disease as the mutant subunit may affect the assembly of the dimer and possibly the subsequent membrane localization or response to hepcidin regulation [41]. Ferroportin disease presents as two phenotypes in varying degrees of severity. Patients either show high Tf  16  saturation with prominent hepatocyte iron loading as in the case of classical hemochromatosis, or display increased ferritin levels and a low to normal Tf saturation with iron accumulation predominantly in macrophages.  1.8.2  Multicopper Ferroxidases and Iron Imbalance Aceruloplasminemia (aCp) is an iron metabolic disorder caused by recessive  mutations in the Cp gene that result in a complete absence of Cp ferroxidase activity. Some mutations in Cp cause premature termination of Cp translation. The resulting truncated product lacks copper or is partially loaded with copper [93]. Patients with aCp are anemic due to the low serum iron concentration and high serum ferritin level. Iron accumulation in the brain and visceral organs (such as the liver and pancreas) has also been observed in aCp patients [94]. To date, no disease-associated mutation has been identified in hephaestin or zyklopen, despite their proposed essential role in iron export.  1.9  Iron Metabolism in Yeast Baker’s yeast (Saccharomyces cerevisiae) is an excellent model organism to study  iron homeostasis as many proteins involved in this process appear to be conserved between yeast and humans. Yeast has three classes of iron acquisition pathways (Figure 1.4): a low affinity iron import system (Fet4p and Smf1p) (reviewed in [95]; [96]), a high affinity iron import system (Fet3p and Ftr1p) [97], and siderophore scavenging pathways (Arn1-4p and Sit1p) (reviewed in [98]). Iron trafficking to its major sites of utilization within the cell may involve a putative chaperone, encoded by YIR035C (EntA / BDH2 homologs) [31]. Iron is transported across the mitochondrial membrane by Mrs3/4 and  17  subsequently bound by Yfh1p for transport to sites of heme and iron-sulphur cluster synthesis. Excess iron is transported into a storage vacuole by Ccc1p. Stored iron is released from the vacuole by the Fth1p / Fet5p iron permease-ferroxidase pair, which are homologous to Ftr1p and Fet3p respectively [99]. As discussed earlier, multicellular organisms have added level of complexity for iron acquisition, transport and regulation; nonetheless, the basic concepts of iron uptake and utilization are well conserved between yeast and humans.  Fet3p from the high affinity iron transport system is the yeast homologue of human Hpn in S. cerevisiae. The ferroxidase protein, Fet3p, interacts physically with an iron permease, Ftr1p [100]. It was believed that Fet3p and Ftr1p form a protein complex in the yeast cell membrane as localization of either protein to the plasma membrane requires co-trafficking of the other [97, 101, 102]. A recent study by Bonaccorsi di Patti and colleagues [100] demonstrated a physical interaction between Ftr1p and Fet3p aminoterminal sequencing of the cross-linked protein complex. This high affinity iron uptake process can be summarized in two steps: (1) reduction of complexed Fe(III) to Fe(II) by the ferric reductase Fre1p, and (2) re-oxidization of Fe(II) to Fe(III) by Fet3p, followed by Fe(III) import via Ftr1p (reviewed in [102]). It has been reported that Ftr1p is highly specific in transporting Fe(III) that is oxidized only by Fet3p [97, 103-105]. By comparing the rate of iron import in the presence and absence of a competitive Fe(III) chelators (citrate) of wild-type Fet3p and Ftr1p to that of Fet3p-Ftr1p chimeras, Kwok et al. [106] demonstrated that Fe(III) from Fet3p is channeled directly to Ftr1p for import into the cell.  18  Figure 1.4 Iron metabolism in Baker’s yeast. Absorption of environmental Fe(III) requires reduction to Fe(II) by the ferrireductase, Fre1 / Fre2. Under normal iron conditions, Fe(II) is imported into cell by Smf1p and Fet4p; however, when yeast are exposed to an iron-deficient environment, the reduced iron is first re-oxidized by Fet3p for transported into the cell by Ftr1p. Siderophore-bound iron is imported into the cell by the Arn1-4p / Sit1p transporters. Once inside the cell, iron may be trafficked by a putative chaperone (YIR035C; [31]) to either (1) the mitochondria where it is transported by Mrs3/4 then bound by Yfh1 for incorporation into heme prosthetic groups or ironsulphur clusters, or (2) to its storage vacuole where it is transported across the membrane by Ccc1p. Stored iron is released by the Fth1p / Fet5p permease-ferroxidase pair. Nuclear Aft1 is a transcription factor that modulates expression of iron proteins. Yeast acquire copper from the environment by first reducing Cu(II) to Cu(I), which is transported across the membrane by Ctr1p. Inside the cell, copper is trafficked by the chaperone, Atx1, and imported into the golgi by Ccc2p for loading onto Fet3p. Details of the yeast proteins can be found at www.yeastgenome.org. 19  1.10 Hypotheses The hypotheses in this dissertation were threefold: 1.  An iron export system can be introduced into S. cerevisiae, by expressing functional recombinant human ferroportin and hephaestin.  2.  Ferroportin may be involved in the transport of other metals.  3.  Ferroportin and hephaestin interact physically in human cells.  1.11 Objectives Given that basolateral iron export in duodenal enterocyte is the key regulatory point of human iron homeostasis, knowledge on how the iron exporter proteins – ferroportin and hephaestin – function will contribute significantly to our understanding of the process. Based on mechanisms of analogous systems such as Fpn1 / GPI-Cp in mammalian central nervous system and Ftr1p / Fet3p in S. cerevisiae, it has been postulated that Fpn1 and Hpn physically interact and function in concert to export iron for transport to other sites by transferrin. However, such interactions and the mechanism of iron transport remain poorly defined. As an attempt to resolve some of this mystery, the following questions were addressed in this study: 1.  Can human Fpn1 and Hpn be introduced into S. cerevisiae as an iron export system?  2.  Is Fpn1 involved in the transport of other metals besides iron?  3.  Does Fpn1 interact with Hpn?  20  Chapter 2: Materials and Methods  2.1  Materials Caco-2 cells (HTB-37, ATCC) were kindly provided by Dr. Urs P. Steinbrecher  (Division of Gastroenterology, Department of Medicine, University of British Columbia, Canada). Yeast strain S288C and yeast expression vectors were kindly provided by Dr. LeAnne Howe (Department of Biochemistry and Molecular Biology, University of British Columbia, Canada). Taq polymerase and DNA restriction / modification enzymes were obtained from New England Biolabs (Beverly, MA). Oligonucleotide synthesis was performed by the Integrated DNA Technologies Nucleic Acid Protein Service (IDTNAPS) at the University of British Columbia. Ferrous ammonium sulfate hexahydrate (ReagentPlus grade) was obtained from Sigma-Aldrich (Oakville, ON). Fetal Bovine serum and tissue culture medium – DMEM / High Glucose as both ready-to-use and powder forms – were obtained from Gibco® Invitrogen (Burlington, ON). Tissue culture flasks were supplied by BD Falcon (Oakville, ON), while Corning Polycarbonate Membrane Transwell Permeable Supports were obtained from Fisher Scientific (Ottawa, ON). All sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting, polymerase chain reaction (PCR), and cloning steps were performed using established protocols [107]. Unless otherwise stated, Caco-2 cells were grown at 37 ºC in a 5% CO2 environment and subcultured at 80% confluence as recommended by ATCC. Transepithelial resistance (TER) of Caco-2 cells in Transwells was measured using a TER reader provided by Dr. B. Brett Finlay (Departments of Biochemistry and  21  Molecular Biology and Microbiology and Immunology, University of British Columbia, Canada).  2.2  Generation of Yeast Knock-Out Mutants Yeast knock-out mutants were generated by homologous recombination. Briefly,  genes encoding auxotrophic markers were amplified by PCR using the primers with sequences that are homologous to sequences flanking the targeted genes. Primers were designed using reference sequences available on the Saccharomyces Genome Database (SGD; http://www.yeastgenome.org/) with the Oligo primer analysis software v 4.0. The ccc1 deletion mutant was made by Mark R. Bleackley. To generate a fet3 knock-out mutant, a DNA fragment containing the leu2 gene with flanking sequences homologous to those of fet3 was amplified by PCR using the primers: 5’ CAGTGTAAGGAAGAGTA GCAAAAAATTAGAACTAGATGTCTGCCCCTAAGAAGAT 3’ and 5’ AACAGGTT AACCGCAAAATACATGATCTTCCTTTATTAAGCAAGGATTTTCTTAACTT 3’. The amplicons (5 μg) were purified using the QIAquick PCR Purification Kit (QIAgen, Mississauga, ON) and transformed into wild-type and ccc1 knock-out yeast strains by electroporation as described [108]. Transformants were screened by plating on selective media and incubated at 30ºC for 3 days. Genomic DNA was extracted from selected colonies as described [109] for confirmation of targeted gene deletion by PCR using the primers: 5’ ATGACTAACGCTTTGCTCTCT 3’ and 5’ GAACCGTTTGGCTTTAGTT AA 3’.  22  2.3  Cloning and Genetic Manipulation of Fpn1 and Hpn cDNA Total RNA (5 μg) isolated from human duodenal tissue (obtained after receiving  ethical consent by Dr. Tanya A.M. Griffiths of this lab) was used as template for first strand cDNA synthesis using Superscript II Reverse Transcription kit (Invitrogen) according to manufacturer’s instructions. Genes encoding ferroportin and the hephaestin transmembrane (TM) domain were cloned from human small intestine cDNA using primers listed in Table 2.1. A working construct of soluble rhHpn made by Tanya Griffiths was used as the template construct [46]. The signal peptide in this construct was replaced by the signal peptide of yeast fet3 by Mark R. Bleackley. The DNA sequence encoding the Hpn transmembrane domain and cytosolic tail was inserted in between the carboxyl-terminal of soluble Hpn and the 1D4 epitope tag to generate a full-length human hephaestin construct for expression in yeast.  Both Fpn1 and Hpn genes were inserted into yeast 2-micron vectors (pRS426 or pRS423) for expression under the control of a galactose-inducible promoter – GAL1. To facilitate detection and localization studies, fluorescent protein markers (EGFP and RFP) were added to Fpn1 and Hpn, respectively. The Not I recognition sequence was engineered into the mouse-ferroportin-EGFP pN1 construct (a gift from Dr. Jerry Kaplan, University of Utah; primer sequences in Table 2.1) by using a Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) to allow for excision and subsequent insertion of EGFP into the carboxyl-terminal of the human-Fpn1 pRS426 construct. The original stop codon was removed and the reading frame was corrected by QuikChange® (Stratagene) to generate the Fpn1-EGFP fusion construct.  23  Table 2.1 Oligonucleotides used to generate clones for ferroportin and hephaestin expression in S. cerevisiae. Fpn1 F (for cloning Fpn1 from 5’ ACTGAATTCATGACCAGGGCGGGAGAT 3’ mRNA) Fpn1 R (for cloning Fpn1 from 5’ ACTGCGGCCGCTCAAACAACAGATGTAT mRNA) TTGCTTGA 3’ Hpn C-term F (for cloning Hpn 5’ TTCTCGAACAGAACACTTAA 3’ TM domain from mRNA) Hpn C-term R (for cloning Hpn 5’ ACTGCGGCCGCTCAGGCAGGCGCCACTT TM domain from mRNA) GGCTGGTCTCTGTCCTTCCCTCGATCTGTTT GAAAGACAGAAGCT 3’ EGFP F * (for introducing Not I 5’ GCAGTCGACGGTACCGCGGCCGCCCGGG restriction site into the mouseATCC 3’ ferroportin-EGFP pN1 construct) Fpn1-EGFP stop removal * (for 5’ GGAAAATCAAGCAAATACATCTGTTGTTG removing stop codon and CGGCCGCCCGGGATC 3’ correcting reading frame) Hpn-FXa * (for insertion of FXa 5’ CCCTCTTCACTGTTTTTTCTCGAATCGAGG recognition sequence by GAAGGACAGAACACTTAAGC 3’ QuikChange) Note: Fpn1 reference sequence: NCBI assession number NM_014585 Hpn reference sequence: NCBI assession number AJ296162 fet3 reference sequence can be found on SGD * a complementary oligonucleotide was also used for sequence manipulation by QuikChange® Site-Directed Mutagenesis.  24  The RFP gene was excised from an RFP vector (a gift from Dr. Dennis Thiel, Duke University) and inserted downstream of Hpn following the factor Xa recognition sequence IEGR. To confirm the cell surface localization and the membrane orientation, an additional protease-releasable Hpn construct was made by inserting the factor Xa recognition sequence between Hpn soluble ectodomain and its transmembrane domain at Arg1065 (Hpn amino acid numbering was assigned according to NCBI Accession number NP_620074) by QuikChange® (Stratagene; Table 2.1). All constructs (Figure 2.1) were verified by automated DNA sequence analysis using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The reactions were processed and the resulting DNA sequences were analyzed as described [110] with the ABI 3700 DNA sequencer (Applied Biosystems, Streetsville, ON).  2.4  Transformation and Expression of Recombinant Proteins The Fpn1 and Hpn plasmid DNA propagated in MACH I E. coli were purified using  a QIAprep spin miniprep kit (QIAgen). Pure Fpn1 and / or Hpn yeast expression vectors (5 μg) were transformed into Δfet3 and Δccc1Δfet3 mutants by electroporation according to the procedure supplied by the Fred Hutchinson Cancer Research Center (http://labs.fhcrc.org/gottschling/Yeast%20Protocols/ytrans.html). Yeast transformants containing Fpn1 and / or Hpn constructs or empty plasmids were propagated in selective media (SM) and frozen at -70ºC in SM / 10% DMSO. Δfet3 and Δccc1Δfet3 mutants containing empty pRS426 & pRS423 vectors were used as negative controls. Δfet3 and  Δccc1Δfet3 mutants, expressing (1) rhFpn1 or rhHpn, (2) co-expressing rhFpn1 / rhHpn, or (3) expressing no human proteins, were propagated overnight in 5 mL in SM  25  Figure 2.1 Recombinant human ferroportin and hephaestin expression constructs. Representation of recombinant human Fpn1-EGFP (A), Hpn-RFP (B), and Hpn-FXa (C) expression constructs. All genes were cloned downstream of a galactose-inducible promoter, GAL1, in yeast 2-micron expression vectors.  26  containing 2% dextrose. Cell densities were determined by measuring OD600 and identical numbers of cells from each culture were used in expression studies. Each culture was inoculated initially at an OD600 of ~0.2 in a final volume of 100 mL SM / 2% raffinose at 30ºC and shaking at 250 rpm. When cultures reached an OD600 of ~0.4-0.5, protein expression was induced by adding galactose to a final concentration of 2%. Cells were harvested at 8 hours after induction.  2.5  Protein Expression Profiling  2.5.1  Western Blot Analysis Rapid whole cell extractions of proteins from identical wet cell masses of each  culture were performed as described [111] under non-reducing conditions. Whole cell extracts were analyzed by 7.5% SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membrane in N-cyclohexyl-3-aminopropansulfonic acid (CAPS) buffer for 2.5 hours. The membrane was blocked with StartingBlock Blocking Buffer (PIERCE) and probed with anti-Fpn1 antibody (1:10,000 dilution; a kind gift from Dr. Jerry Kaplan) or anti-GFP antibody (1:5,000 dilution; Cell Signaling Technology) or anti-MTP1 antibody (1:25,000 dilution; Alpha Diagnostic International, San Antonio, TX, USA) or anti-Hpn antibody (1:25,000 dilution; produced by Dr. David M. Hudson with purified soluble recombinant Hpn ectodomain synthesized in BHK cells [112]) or anti-1D4 antibody (1:500; a kind gift from Dr. Robert Molday) in phosphate buffered saline containing 0.05% Tween-20 (PBST) with 0.2% StartingBlock. The membrane was then incubated with goat anti-rabbit IgG-horse radish peroxidase conjugate (1:50,000 dilution; Sigma-  27  Aldrich) in PBST / 0.25% StartingBlock, and developed by Enhanced Chemiluminescence (ECL; Amersham). In the case of the anti-1D4 antibody, a goat antimouse IgG-horse radish peroxidase conjugate (1:15,000 dilution; Sigma-Aldrich) in PBST / 0.25% StartingBlock was used as secondary.  2.5.2  In-Gel Fluorescence Analysis Samples for in-gel fluorescence analysis were prepared as described [113] with  slight modifications. Cells (100 mg) harvested at 8 hours of induction were resuspended in 250 μL Laemmli buffer (62.5 mM Tris-HCl, pH6.8 / 10% glycerol / 20% SDS). Glass beads (Sigma-Aldrich) equivalent to 1/3 volume of the cell suspension were added to each sample. Yeast were homogenized by vortexing and supernatant was collected after brief centrifugation at 1500 rpm. The supernatant was centrifuged at 12500 rpm for 5 minutes before 7.5% SDS-PAGE analysis. GFP signal was visualized on a UV transilluminator and image captured using ChemiGenius (Geneflow Ltd., Staffordshire, UK).  2.6  Cellular Localization Studies  2.6.1  Fluorescence Microscopy Harvested yeast cells (100 mg; fixed with 3.7% formaldehyde then subsequently  with 4% paraformaldehyde or without fixing) were washed with deionized water and resuspended in 1 mL PBS with concanavalin A-Alexa Fluor® 350 conjugate (50 μg / mL; Molecular Probes, Invitrogen) for incubation at 30ºC in the dark for 30 minutes. The  28  cells were washed twice with PBS, resuspended at 1/20th original volume and 3 μL of the cell suspension was mounted on glass slides with ProLong® Gold antifade (Invitrogen). The slides were left to cure at room temperature in the dark for 24 hours before sealing the cover slip with nail polish. The slides were examined by confocal fluorescence imaging or stored at -20ºC until use. Images were captured using the Olympus Fluoview FV1000 laser scanning confocal microscope (Olympus Canada, Markham, ON) using 100X / NA1.40 oil objective with images acquired using FV10-ASW software. The confocal images shown in this thesis are representative images from full 3D confocal stacks scanned at 0.1 μm along the z-axis. Exported images were assembled into figures using Photoshop CS3 (Adobe).  2.6.2  Protease-Cleavable Hephaestin Ectodomain  Δfet3 yeast expressing protease-releasable Hpn with or without Fpn1 were harvested at 8 hours after induction. Cells (350 mg) were washed once with deionized water and resuspended in 200 μL reaction buffer (20 mM Tris-HCl, pH8 / 100 mM NaCl / 2 mM CaCl2). Reactions were initiated with the addition of factor Xa (3 μL, New England Biolabs) and sampled (60 μL) every 2 hours for a total incubation time of 4 hours. Cells were removed by centrifugation and supernatants were prepared for 7.5% SDS-PAGE and Western blot analyses.  2.7  Solutions and Glassware Preparation for Metal Assays For metal quantification or binding studies, deionized water was used for washing  and preparing solutions to minimize metal contaminations. All glassware and plasticware  29  were soaked overnight in 3 M nitric acid and thoroughly rinsed with deionized water to minimize metal contamination.  2.8  Ferroxidase Activity Assays  2.8.1  Ferrozine Assay Discontinuous ferroxidase activity assays were performed at various Fe(II)  concentrations: 0 μM, 5 μM, 10 μM, 20 μM and 40 μM ferrous ammonium sulfate (Sigma-Aldrich) as described [46]. To ensure all cell surface ferroxidase activity was attributable to rhHpn and not to endogenous yeast multicopper ferroxidase, Δccc1Δfet3 yeast expressing either rhFpn1 or rhHpn or co-expressing both rhFpn1 and rhHpn were used. Δccc1Δfet3 yeast transformed with empty plasmids were used as negative controls. The cells were first washed with deionized water to remove any trace metals in the media. Each 1.2 mL final volume reaction was prepared with 150 mg yeast in an acid-washed tube. Individual reactions (200 μL) were quenched by the addition of 50 μL 15 mM ferrozine (Fz). The total incubation time was 30 minutes at room temperature. Cells were removed by centrifugation and substrate depletion was determined by measuring the A562 of the supernatant using the molar absorptivity of the Fe(II)-Fz complex (ε = 27900 M-1 cm-1). The assays were performed in triplicate on three separate cell preparations.  2.8.2  In-Gel p-Phenylenediamine Assay Samples for in-gel p-phenylenediamine (pPD; Sigma-Aldrich) assay were prepared  in the same way as samples for in-gel fluorescence analysis. Cell extracts were incubated  30  at 70ºC for 10 minutes before being analyzed by 5% SDS-PAGE. The resulting gel was incubated in 0.1% pPD in 0.1 M NaOAc (pH5) at 37ºC in the dark for 4 hours for color development [114].  2.9  Transferrin Iron Loading Assay Experiments were set up as described [46] with modifications to test if rhHpn  expressed on the cell surface is capable of fulfilling its assumed physiological role – to load iron onto apo-transferrin. Yeast Δccc1Δfet3 double mutants expressing rhFpn1 or rhHpn or both rhFpn1 and rhHpn or no human proteins (40 mg) were washed with deionized water and used in place of pure Hpn. Apo-transferrin (Sigma-Aldrich) was prepared to remove trace metal contamination as described [115]. Reactions were initiated with the addition of 200 μM ferrous ammonium sulfate (Sigma-Aldrich). Samples taken at various time points were centrifuged to remove cells and supernatants were snap frozen with liquid nitrogen for storage at -70ºC. All samples were prepared as described for analysis by 6% urea-PAGE [116].  2.10  Metal Sensitivity Phenotype Assays The cell density of Δccc1Δfet3 mutants expressing rhFpn1 and / or rhHpn or no  human proteins was adjusted to OD600 ~1.0 at 8 hours after induction with fresh media. Each culture was challenged with 5, 10 or 20 mM ferrous ammonium sulfate or 1, 3, or 5 mM cupric sulfate for 16 hours at 30ºC while shaking at 250 rpm. The viabilities of the cultures were investigated by spotting serial dilutions on SM / 2 % galactose supplemented with 3 mM ferrous ammonium sulfate or 1 mM cupric sulfate. Colony  31  formation was assessed after 3 days of incubation at 30ºC. To ensure yeast cell survival was not attributed to the loss of mitochondria, undiluted cultures were also spotted on yeast extract / peptone / glycerol (YPGly) for survival of the resulting cultures at 30ºC as control.  2.11  Quantification of Cellular Iron In separate experiments, ferrous ammonium sulfate (5 mM final concentration) was  added to cultures of Δccc1Δfet3 mutants expressing rhFpn1 and / or rhHpn or the empty vector control. Cell samples were taken at various time points to assay for cell viability and cellular iron content. Cell viability was assessed by plating 1000-fold dilution of each sample on yeast extract / peptone / dextrose (YPD) and colony forming units after 24 hour incubation at 30ºC were determined by counting the number of colonies formed in a 1 cm by 1 cm region on the plates. The cellular iron content was quantified by bathophenanthroline sulfonate (BPS) colorimetric assay as described [117]. Briefly, at 8 hours of induction, the cell density of cultures was adjusted to OD600 ~1.0 with fresh media and ferrous ammonium sulfate was added to the cultures to a final concentration of 5 mM. Cultures incubated at 250 rpm at 30ºC were sampled (5.5 mL) at various time points. Each sample was washed twice with deionized water and the cell pellets were stored on ice at 4ºC until all samples were ready. The total incubation time for sample collection was 12 hours. Cell samples (3 mg) were digested in 500 μL 3% nitric acid at 98ºC for 16 hours. Acid digested samples were centrifuged at 12500 rpm for 5 minutes to remove cell debris. Supernatants were prepared for iron concentration determination as described [117]. Absorbance at 535 nm for Fe(II)-BPS complex and 680 nm for non-  32  specific signal were recorded using a spectrophotometer. Iron concentration was determined by A535-680 using the molar absorptivity of the Fe(II)-BPS complex (ε = 23141 M-1 cm-1). The assay was performed in triplicate on three separate cell preparations. Additionally, ferrous ammonium sulfate and cupric sulfate at various concentrations were also prepared and measured in the same fashion to verify specificity of this assay.  2.12  Covalent Chemical Cross-linking Human Caco-2 cells were harvested by using a cell scraper and quantified using a  hemocytometer. The cells were centrifuged at 1000 rpm for 5 minutes and resuspended at approximately 2.5 x 106 cells / mL PBS (pH 8.0). Yeast Δccc1Δfet3 mutants expressing rhFpn1 and rhHpn were converted to spheroplasts by incubation with lyticase (0.1 μg / μL Buffer Z pH 7.0 (60 mM NaHPO4·7H2O / 40 mM NaH2PO4·H2O / 10 mM KCl / 1 mM MgSO4·7H2O / 50 mM β-ME)) for 30 minutes at room temperature. Both the Caco-2 cells and spheroplasts were washed 3 times with cold PBS and transferred (250 μL) to Eppendorf tubes. PBS was added to adjust volume of each reaction such that the final volume including BS3 was 300 μL. BS3 – a membrane non-permeable crosslinker (PIERCE) – prepared in PBS was added at 30 seconds intervals to each reaction. The reaction time was 30 minutes at room temperature. Reactions were quenched at 30 seconds intervals by adding Tris-HCl (pH 7.5) to a final concentration of 20 mM and incubated at room temperature for 15 minutes. Caco-2 cells or spheroplasts were lysed and prepared for SDS-PAGE and Western blot analyses.  33  Chapter 3: Expression of Recombinant Human Ferroportin and Hephaestin in Saccharomyces cerevisiae: An Introduced Iron Transport System  3.1  Rationale and Overview Export of dietary iron by Fpn1 is thought to be facilitated by Hpn, a multicopper  ferroxidase in the basolateral membrane of duodenal enterocytes (reviewed in [12]). However, the precise mechanism of iron transport by Fpn1 and Hpn remains to be elucidated. The absence of an iron export mechanism in S. cerevisiae makes it an excellent model for testing how Fpn1 and Hpn function in iron export. Unlike humans, S. cerevisiae transports excess iron into a storage vacuole through a vacuolar iron transporter protein called Ccc1p. The Δccc1 mutant fails to store excess iron; as a result, iron accumulates in the cytosol and cells die due to oxidative stress when exposed to high extracellular iron concentrations [118]. By expressing recombinant human (rh) Fpn1 and / or Hpn in S. cerevisiae, an iron export system that rescues the Δccc1 mutant when grown under high iron conditions was introduced. The expressed rhFpn1 localized to the plasma membrane; however, only a small amount of rhHpn localized to the cell surface with the majority remaining intracellular. To ensure all of the observed cell surface ferroxidase activity was attributed to rhHpn and not its yeast homologue Fet3p, experiments were performed with fet3 knock out yeast. The functionality of cell surface expressed rhHpn in S. cerevisiae was confirmed by both a ferrozine ferroxidase assay and a transferrin iron loading assay. The effects of the individual or both recombinant proteins on iron sensitivity of the Δccc1 yeast with the fet3 deletion were then evaluated. Under conditions of high extracellular iron, recombinant human Fpn1 in the presence and  34  absence of rhHpn suppressed the lethal phenotype of the Δccc1 mutant. In the absence of Fet3p, yeast are known to be sensitive to excess environmental copper [119] and the expression of rhHpn has been reported to complement the loss of Fet3p in yeast, allowing growth under iron deficient conditions [120]. Here, the expression of rhFpn1 and / or rhHpn was shown to relieve the Δfet3 mutant from copper stress.  3.2  Recombinant Human Ferroportin and Hephaestin Expression in Yeast To express recombinant human ferroportin and hephaestin in S. cerevisiae, the  genes encoding the two proteins were cloned by reverse transcription from cDNA prepared from human small intestine RNA and inserted into the 2-micron yeast expression vectors under the control of galactose-inducible promoter. To facilitate detection, fluorescent protein markers – EGFP and RFP – were fused to C-terminal of rhFpn1 and rhHpn, respectively. Yeast mutants expressing rhFpn1 and / or rhHpn were sampled at various time points during galactose induction for protein expression analysis. A representative Western blot of yeast whole cell extract shows the expression profile of rhFpn1 (Figure 3.1A) and rhHpn (Figure 3.1B) in the different transformants. Negative controls were performed on cells transformed with empty vectors. rhFpn1 expression was detected (~120kDa; Figure3.1A, Lanes 1-4, 9-12) under non-reducing conditions in yeast transformed with the rhFpn1 construct with more degradative products being observed in yeast expressing only rhFpn1 (Figure 3.1A, Lanes 1-4). Galactose-inducible expression of rhHpn was observed in yeast transformed with the Hpn construct (Figure 3.1B, Lanes 5-12). The multiple bands suggest that rhHpn might be differentially glycosylated.  35  Figure 3.1 Galactose-inducible expression of rhFpn1 and rhHpn in S. cerevisiae. Western blot analysis of rhFpn1 and rhHpn expression profile at various time points after induction using (A) anti-Fpn1 at 1:10,000 dilution with anti-rabbit IgG at 1:50,000 dilution as secondary antibody, and (B) anti-1D4 at 1:500 dilution with anti-mouse IgG at 1:15,000 dilution as secondary antibody. Representative blots of three independent experiments are shown. Recombinant human Fpn1-EGFP expression was only detected in yeast transformed with Fpn1-EGFP construct (A; Lanes 1-4 and 9-12). Galactose inducible expression of recombinant human Hpn was detected in yeast transformed with the Hpn construct, and the protein were likely differentially glycosylated (B; Lanes 5-12).  36  3.3  Cellular Localization of Recombinant Proteins Fluorescence microscopy was performed to determine the cellular localization of  recombinant human Fpn1-EGFP and Hpn-RFP expressed in yeast. Yeast co-expressing rhFpn1 and rhHpn were either fixed with 3.7% formaldehyde then subsequently with 4% paraformaldehyde or viewed without fixing. Prior to observation by confocal microscopy, the cells were incubated with concanavalin A-Alexa Fluor® 350 conjugate to selectively label α-mannopyranosyl and α-glucopyranosyl on the cell surface. Fixation caused a significant decrease in fluorescence signals of EGFP and RFP, affecting detection by fluorescence microscopy (Figure 3.2A). In comparison, the signals were a lot stronger without fixation (Figure 3.2B). Recombinant human Fpn1 was localized in the plasma membrane, while the majority of rhHpn was intracellular with some signal detected in the plasma membrane (Figure 3.2B). No signal was detected in yeast transformed with empty vectors viewed under the same conditions (Appendix A).  To confirm cell surface expression of at least some of the expressed rhHpn, a FXa cleavable Hpn construct was made (Hpn-FXa) with the FXa recognition sequence inserted after the codon for Arg1065. This site was chosen because this is the last arginine residue present in the ordered region of ceruloplasmin as determined by x-ray crystallography [121]. Yeast expressing rhHpn with and without the FXa cleavage site were treated with FXa for different times. Supernatants were subjected to SDS-PAGE and Western blot analyses. Only cells expressing FXa cleavable rhHpn released the soluble ectodomain into solution (Figure 3.3). The amount of released rhHpn soluble ectodomain did not increase with time, suggesting immediate release from the membrane.  37  Figure 3.2 Cellular localization of rhFpn1 and rhHpn in S. cerevisiae. Fluorescence microscopy images of yeast co-expressing rhFpn1-EGFP and rhHpn-RFP. Fixation with formaldehyde and paraformaldehyde lowered fluorescence signals of EGFP and RFP significantly and affected detection of rhFpn1 and rhHpn (A). Without fixation, rhFpn1 and a small amount of rhHpn localized to the plasma membrane (B).  38  Figure 3.3 Protease released rhHpn soluble ectodomain from S. cerevisiae cell surface. Yeast expressing rhHpn or protease cleavable rhHpn (rhHpn-FXa) with or without rhFpn1 were treated with FXa. At indicated time points, reaction supernatant was sampled for SDS-PAGE analysis. The Western blot was probed with an anti-Hpn antibody at 1:20,000 dilution and an anti-rabbit IgG at 1:50,000 dilution as secondary for detection using ECL. Only yeast expressing Hpn-FXa released the soluble ectodomain of rhHpn (marked by the arrowhead) into solution (Lanes 4-9).  39  In the absence of rhFpn1 (Lanes 7-9), the fragments at approximately 60kDa probably represent hephaestin degradation products.  The cellular localization of recombinant human ferroportin and hephaestin was determined under the same conditions when either protein was expressed alone in S. cerevisiae. In cells only expressing rhFpn1 (Figure 3.4A) or rhHpn (Figure 3.4B), a lack of plasma membrane localization was observed. The EGFP signal from rhFpn1-EGFP was a lot weaker on its own compared to Figure 3.2B, where it was co-expressed with rhHpn-RFP. There was little or no plasma membrane localization of ferroportin or hephaestin when expressed alone. Together with a few tiny concentrated packages of EGFP signal, this result suggests that rhFpn1 or rhHpn, when expressed alone, might not have been trafficked properly to the plasma membrane or one protein may be unstable in the absence of the other protein. The latter is more likely to be the case since some rhHpn soluble ectodomain was released by FXa from the cell surface of yeast expressing only Hpn-FXa (Figure 3.3).  3.4  Ferroxidase Activity of Recombinant Hephaestin The ferroxidase activity of cell surface expressed rhHpn and its ability to load iron  onto apo-Tf was tested by utilizing a ferrozine ferroxidase assay and a transferrin iron loading assay, respectively. Oxidase activity was also demonstrated by electrophoresis on non-reducing SDS-polyacrylamide gels followed by incubation with the chromogenic substrate, pPD (Figure 3.5). The signal from the rhHpn sample (Lane 3) was a lot weaker than the signal from the plasma sample (Lane 1); however, the strong signal at the gel  40  Figure 3.4 Cellular localization of rhFpn1 and rhHpn when expressed alone in S. cerevisiae. Fluorescence microscopy images of yeast expressing rhFpn1-EGFP (A) and rhHpn-RFP (B). Little plasma membrane localization of rhFpn1-EGFP was detected with a much weaker response (A). In the absence of rhFpn1, rhHpn concentrated mostly in intracellular compartments (B).  41  MW (kDa) 170 130 100 70 Figure 3.5 In-gel oxidase activity of multicopper ferroxidases. Proteins in plasma (5 μL; approximately 1.5 μg Cp) and whole cell extracts from yeast expressing either rhFpn1 or rhHpn were resolved on 5% non-reducing SDS polyacrylamide gels. Oxidase activity was tested by incubation in chromogenic substrate, pPD. Both plasma (Cp; Lane 1) and Hpn-expressing yeast whole cell extract (Lane 3) samples gave oxidized pPD.  42  interface suggested that some rhHpn did not enter the gel. No signal was detected in cells expressing rhFpn1 (Lane 2).  Representative curves of ferrozine ferroxidase assay results are shown in Figure 3.6. Yeast expressing rhHpn exhibit ferroxidase activity, while cells expressing rhFpn1 display a background activity level equivalent to auto-oxidation of the substrate by empty plasmid control. In the presence of rhFpn1, rhHpn showed higher ferroxidase activity. Besides the insignificant level of auto-oxidation, the activity curves had an inflection point at 5 μM ferrous ammonium sulfate suggesting that there was a phase with reduced rhHpn-substrate interaction and / or substrate oxidation.  When Δfet3 mutants expressing either rhFpn or rhHpn or an empty vector control were incubated with ferrous ammonium sulfate in the presence of apo-Tf, the iron oxidized by rhHpn was bound by transferrin (Figure 3.7). The detection of all apo-, mono- and di-ferric species of Tf at 15 hours of incubation with yeast expressing only rhFpn1 (Lane 4) and the empty plasmid control (Lane 14) suggests that iron underwent minor auto-oxidation over the course of the experiment. Monoferric transferrin species were detected at 4 and 10 hours of incubation with cells expressing rhHpn (Lanes 6, 7), while the conversion to holo-Tf was evident at 15 hours of incubation (Lane 8). Again, increased activity was observed in yeast co-expressing both rhFpn1 and rhHpn. Monoferric Tf was detected shortly after the addition of ferrous ammonium sulfate to the reaction (Lane 9) and the conversion to holo-Tf was complete at 10 hours of incubation (Lane 11).  43  Figure 3.6 Cell surface ferroxidase activity of Δccc1Δfet3 mutants expressing rhFpn1 and / or rhHpn. Discontinuous ferroxidase activity assays were performed at various Fe(II) concentrations with 150 mg of yeast expressing rhFpn1 and / or rhHpn or empty vector control. Reactions were quenched at 5 or 10 minute intervals by the addition of ferrozine (Fz). Substrate depletion was determined by A562 using the molar absorptivity of the Fe(II)-Fz complex (ε = 27900 M-1 cm-1). Rate of Fe(II) oxidation by yeast expressing rhFpn1 was negligible (blue) and comparable to the rate of autooxidation by empty plasmid control (red). Yeast expressing rhHpn demonstrated ferroxidase activity (yellow), and the level of activity was higher in the presence of rhFpn1 (green). Additionally, a change in reaction rate was observed at 5 μM ferrous ammonium sulfate. All data were collected in triplicate.  44  Figure 3.7 Oxidation of iron by recombinant human hephaestin for subsequent binding by apo-transferrin. 6% urea-PAGE analysis was performed to resolve the different transferrin species: apo (no iron), C-lobe / N-lobe (Tf with one molecule of iron binding to one of the two lobes) and diferric (Tf with a molecule of iron binding to each lobe). Δccc1Δfet3 yeast expressing rhFpn1 alone (Lanes 1-4) and empty vector control (Lanes 13, 14) showed that iron underwent minor auto-oxidation over the course of the experiment. Yeast expressing rhHpn (Lanes 5-8) oxidized and loaded iron onto apo-Tf, resulting in monoferric (Lanes 6, 7) and diferric Tf species (Lane 8). Iron oxidation and loading onto apo-Tf appeared faster in yeast co-expressing rhFpn1 and rhHpn (Lanes 912). The last lane showed purified holo-Tf from Sigma as positive control.  45  3.5  Recombinant Proteins and Metals Sensitivity of Yeast Recombinant human Fpn1 or Hpn, expressed alone or together, were tested for their  ability to rescue iron or copper sensitive yeast mutants from toxic metal concentrations. Cells expressing rhFpn1 and / or rhHpn or empty vectors were challenged with toxic extracellular iron or copper and the viability of the resulting cultures were assessed. It has been reported previously that yeast lacking Ccc1p display an iron sensitive phenotype [118], while yeast lacking Fet3p have reduced tolerance to copper stress [119].  Yeast expressing rhFpn1 and / or rhHpn or containing empty vectors were challenged at various iron concentrations, and the viabilities of the resulting cultures were tested by plating on selective media. Δfet3 mutant was used as positive control to ensure the observed phenotype was attributed to the expression of rhHpn. Representative results are shown in Figure 3.8 and indicate that the expression of rhFpn1 but not rhHpn rescued the iron sensitive Δccc1Δfet3 mutants from high concentrations of extracellular iron. A stronger rescue phenotype was observed with Δccc1Δfet3 yeast co-expressing both rhFpn1 and rhHpn.  Similarly, the mutants were tested against excess extracellular copper for potential effects on copper metabolism. Representative results of yeast exposed to 1 mM cupric sulfate are shown in Figure 3.9. Yeast lacking Fet3p are known to be copper sensitive [122] and the expression of rhHpn had been shown to complement the loss of Fet3p [120]. In this study, rhHpn rescued Δccc1Δfet3 mutants from copper toxicity. The results also suggested a role of rhFpn1 in copper transport, as the expression of rhFpn1 rescued the  46  Figure 3.8 Expression of recombinant human ferroportin rescued Δccc1Δfet3 yeast from toxic extracellular iron concentrations. The viabilities of iron tolerant Δfet3 and iron sensitive Δccc1Δfet3 yeast grown under different extracellular iron concentrations (5, 10 or 20 mM ferrous ammonium sulfate) were tested by spotting 100-fold serial dilutions on selective media containing 3 mM ferrous ammonium sulfate. rhFpn1 expression rescued iron storage defective Δccc1Δfet3 yeast mutants from toxic iron.  47  Figure 3.9 Expression of recombinant human ferroportin and hephaestin rescues Δccc1Δfet3 yeast from toxic extracellular copper concentrations. The viabilities of copper tolerant Δccc1 and copper sensitive Δccc1Δfet3 yeast grown under excess extracellular copper (1 mM) was tested by spotting 100-fold serial dilutions on selective media containing 1mM cupric sulfate. Expression of rhFpn1 and / or rhHpn1 rescued Δfet3 yeast mutants from toxic copper.  48  mutant from excess copper. Higher concentrations of copper were tested but were highly toxic and killed most cells.  3.6  Effects of Recombinant Proteins on Cellular Iron Content The effects of recombinant human protein(s) on yeast cellular iron content were  evaluated by the BPS colorimetric assay. This assay is highly specific for quantifying iron [117] (Appendix B). Based on results from the iron sensitivity phenotype assay, yeast expressing rhFpn1 and / or rhHpn or containing empty vectors were incubated in 5 mM ferrous ammonium sulfate. The cellular iron contents at various time points were measured and the iron concentrations were determined (Figure 3.10). As controls, the iron contents of Δfet3 mutants and Δccc1Δfet3 double mutants with empty plasmids were measured.  Without the vacuolar iron transporter protein Ccc1p, concentrations of iron  in the Δccc1Δfet3 mutants was significantly lower (average of ~9 μM / mg cells) than that in the Δfet3 mutant (approximately ~26.5 μM / mg cells). Δccc1Δfet3 yeast expressing rhFpn1 and / or rhHpn and no human proteins showed similar cellular iron contents (around 9 μM / mg cells), indicating that the expression of rhFpn1 and / or rhHpn did not restore iron storage and iron was not sequestered inside yeast.  After completion of this experiment, the cell viabilities of the different yeast were measured by determining the colony forming units after overnight incubation on YPD. Results (Figure 3.11) were in agreement with trends observed in phenotype assay, where cells were spotted at 16 hours after culturing in high extracellular iron, followed by incubation for 3 days (Figure 3.8). Again, yeast expressing both rhFpn1 and rhHpn  49  Figure 3.10 Expression of recombinant human proteins did not change the iron distribution in yeast. Cellular iron content determined using BPS colorimetric assay after nitric acid digestion of yeast expressing rhFpn1 and / or rhHpn or empty plasmid control. Average iron content in Δfet3 yeast is shown by the purple bar, while that of the Δccc1Δfet3 mutant expressing recombinant human proteins are shown by the colored bars: rhFpn1 (A, blue), rhHpn (B, yellow), both rhFpn1 and rhHpn (C, green) and empty plasmids control (D, red). All Δccc1Δfet3 transformants were found to have similar cellular iron level. All data were collected in triplicates and error bars represent ± 1 S.D.  50  Figure 3.11 Viabilities of Δccc1Δfet3 mutants grown under high iron conditions. Δccc1Δfet3 yeast expressing rhFpn1 and / or rhHpn or no human proteins were grown in media supplemented with 5 mM ferrous ammonium sulfate. (A) Viabilities of the resulting cultures at various time points during the incubation was tested by plating on YPD. Expression of both rhFpn1 and rhHpn1 rescued Δccc1Δfet3 yeast mutants from toxic iron initially; strongest rescue phenotype was observed with cells co-expressing rhFpn1 and rhHpn1. (B) Colony forming units of Δccc1Δfet3 yeast expressing rhFpn1 and / or rhHpn or no human proteins cultured in 5 mM ferrous ammonium sulfate over time. Representative data from three independent experiments is shown.  51  exhibited the strongest rescue phenotype amongst all transformants. rhFpn1 and rhHpn alone might have rescued the cells initially; however, after 2 hours of incubation, the number of colonies did not differ significantly from that of the empty vector control.  3.7  Discussion  3.7.1  Recombinant Human Ferroportin and Hephaestin Expression in Yeast As shown in Figure 3.1, recombinant human ferroportin and hephaestin were  successfully expressed in S. cerevisiae under the control of a galactose-inducible promoter. A previous biophysical study analyzed recombinant human ferroportin with a 20 amino acid bovine rhodopsin tag and C-terminal FLAG tag produced in insect cells by size exclusion chromatography and showed that rhFpn1 has a molecular weight (MW) of 69.1 ± 6.2 kDa [37]. In the current study, rhFpn1-EGFP migrated on the 7.5% nonreducing SDS gel as presumably a dimer with an apparent molecular weight of ~120 kDa. The protein mass was lower than the predicted mass of ~90 – 96 kDa for Fpn1-EGFP monomer. This is possibly due to the formation of polypeptide hairpins during gel loading that cause gel shift; this may explains why the apparent MW of membrane proteins often deviate significantly (-46% – +48%) from predicted MW [123]. To confirm if SDS-loading did alter the migration of rhFpn-EGFP on SDS-PAGE, a GFP ingel fluorescence study was performed. In this analysis, the apparent MW of rhFpn1EGFP decreased with increased SDS concentration (Appendix C) confirming the presence of an SDS-dependent loading phenomenon.  52  For Western blot analyses, whole cell extracts from the same mass of yeast were loaded per lane. Results for rhFpn1-EGFP expression (Figure 3.1A) showed relatively similar intensities at different time points after induction. This suggested that rhFpn1 synthesis was maximal shortly after galactose induction. Unlike rhFpn1, galactoseinducible expression of rhHpn was evident as the band intensity increased over time (Figure 3.1B). rhHpn may be differentially glycosylated as glycosylation was observed previously with recombinant Hpn expressed in BHK cells [46]. Hyperglycosylation of heterologous proteins is known to be common in yeast [124, 125].  Degraded products were observed for rhFpn1-EGFP (Figure 3.1A), especially when expressed alone in yeast. The seemingly non-inducible expression of rhFpn1 may be explained by the saturation of the system. Overexpression of rhFpn1 might have activated the unfolded protein response (UPR) pathway, which targets any unfolded or improperly folded proteins in the endoplasmic reticulum for degradation [126, 127]. The higher amount of degraded rhFpn1 in yeast expressing ferroportin alone suggested that rhHpn might play a role in stabilizing rhFpn1 in the membrane, and thereby, might prevent its internalization and degradation. This interpretation is in agreement with the reported observation where ferroxidase activity of MCO is required to stabilize ferroportin in the plasma membrane [50].  3.7.2  Cellular Localization of Recombinant Human Proteins The cellular localizations of rhFpn1-EGFP and rhHpn-RFP were determined by  53  fluorescence microscopy. As reviewed by Kohlwein [128], GFP is usually unaffected by fixation with formaldehyde, paraformaldehyde, glutaraldehyde and / or methanol; however, fixation may be detrimental to GFP fluorescence signal depending on the fusion protein. The latter was the case as observed with rhFpn1-EGFP (Figure 3.2A). As observed previously [129], formaldehyde fixation led to diminished fluorescence signals of the recombinant proteins. Cells from the same yeast culture were split in half with one batch subjected to fixation prior to plasma membrane probing (Figure 3.2A) while the other was directly treated with concanavalin A-Alexa Fluor® 350 conjugate (Figure 3.2B). Both rhFpn1-EGFP and rhHpn-RFP signals in the plasma membrane were lowered significantly by fixation.  When expressed alone, both rhFpn1 and rhHpn showed minimal plasma membrane localization (Figure 3.4). A weak signal was detected in yeast expressing only rhFpn1EGFP (Figure 3.4A). Similarly, in the absence of rhFpn1, rhHpn localized to intracellular compartments (Figure 3.4B); as reported by Li et al. [120], these are likely late endosomes. Contrarily, yeast co-expressing rhFpn1 and rhHpn demonstrated plasma membrane localization for ferroportin but limited cell surface localization of rhHpn – the majority of rhHpn remained intracellular. This led me to wonder if the cells were copper deficient or if the copper transport system was working at its rate limit. Thus, the majority of rhHpn may not have been fully copper loaded and thus failed to be trafficked to the plasma membrane. However, Hpn has also been found to concentrate in the intracellular compartments of rat enterocytes by immunohistochemistry [130], as well as the apical supranuclear position and recycling endosome compartment of mice  54  enterocytes [114, 131].  Despite minimal plasma membrane localization observed by fluorescence microscopy in cells expressing only rhHpn (Figure 3.4), treatment with FXa released Hpn soluble ectodomain from cell surface in yeast expressing rhHpn-FXa with and without rhFpn1 (Figure 3.3). This suggested that the proteins might have localized to the plasma membrane transiently. A recent study demonstrated that Hpn migrates to the basolateral membrane in response to iron feeding in rats [132]. Together with the protease releasable Hpn and fluorescence microscopy results, it is likely that Hpn only localizes to the cell surface when its oxidase function is required. Additionally, fragments of rhHpn were released by FXa in the absence of rhFpn1 (Figure 3.3; Lanes 7-9). Besides the introduced FXa cleavage site, the hephaestin amino acid sequence does not contain any other FXa recognition sequence. It has been reported that FXa cleaves at sequences other than the known recognition sequence IEGR [133]. It is possible that the lower molecular weight fragments may have resulted from FXa proteolytic cleavage at non-IEGR sites. The absence of this ~60 kDa fragment in the reaction with yeast expressing both rhFpn1 and rhHpn-FXa (Lanes 4-6) implies that rhFpn1 and rhHpn interact and that rhFpn1 may limit the accessibility of rhHpn to FXa, thereby protecting rhHpn from the protease.  3.7.3  Recombinant Human Hephaestin Fulfills Its Proposed Biological Role The ferroxidase activity of rhHpn was assessed qualitatively by using an in-gel  oxidase assay on non-reducing SDS-PAGE gels. The presence of SDS and heating at 70ºC for 10 minutes only partially denature the proteins. When plasma samples were  55  treated with or without SDS / heating, Cp in plasma retained its oxidase activity (for example Figure 3.5, Lane 1); however, the addition of β-mercaptoethanol caused a reduction of disulfide bonds and denatured the proteins, resulting in a significant decrease in activity (Appendix D). When samples subjected to non-reducing SDS-PAGE were incubated with the chromogenic substrate – pPD, a purple band was detected at the stacking and resolving gel interface (Figure 3.5; Lane 3), indicating that some proteins might have aggregated and did not enter the gel. Both Cp from plasma (Lane 1) and rhHpn (Lane 3) oxidized pPD in gel. The concentration of Cp loaded on the gel was estimated to be 1.5 μg based on physiological concentration of 300 μg / mL [134].  Further testing of cell surface-expressed rhHpn by ferrozine ferroxidase activity assays on intact cells confirmed that rhHpn expressed by S. cerevisiae was functional and that its soluble ectodomain was oriented towards the extracellular space (Figure 3.6). The higher ferroxidase activity observed in cells co-expressing rhFpn1 supported the idea that rhFpn1 and rhHpn stabilize each other in the plasma membrane. Results also showed that auto-oxidation was negligible at 5 μM or lower concentrations of ferrous ammonium sulfate. When expressing rhFpn1 alone, yeast gave a rate of Fe(II) oxidation that was comparable to that of auto-oxidation. The inflection points at 5 μM ferrous ammonium sulfate might indicate the background auto-oxidation rate at higher iron concentrations and possibly a change in reaction rate due to increased enzyme-substrate interaction.  rhHpn expressed on the yeast cell surface was also capable of loading iron onto  56  Tf (Figure 3.7). The process was a lot slower compare to that observed with 0.4 μM purified soluble rhHpn [46]. With purified soluble rhHpn, transferrin iron loading achieved completion at ~6 hours of incubation [46], whereas rhHpn on the yeast surface took 15 hours to convert apo-Tf to diferric Tf. These results are consistent with a Fpn1 and Hpn interaction leading to improved membrane stability and iron oxidase activity as oxidation and transferrin iron loading appear to be faster in yeast co-expressing both rhFpn1 and rhHpn.  In a separate study, urea gel results showed that the rate of auto-oxidation was much slower in the presence of yeast cells (data not shown). Reaction with yeast expressing only rhFpn1 presented a small amount of iron-bound Tf at 12 hours of incubation; monoferric Tf was detected a lot earlier in reactions without yeast. Perhaps, the yeast ferrireductase – Fre1 / Fre2 – were reducing iron, resulting in an apparently slower rate of auto-oxidation (Appendix E).  3.7.4  Recombinant Human Proteins Rescued Mutant Yeast from Toxic Metals As expected, my results showed that iron storage efficient yeast (Δfet3) survived  under conditions of high extracellular iron, while iron storage defective mutants (Δccc1Δfet3) died of oxidative stress when exposed to excess iron (Figure 3.8). Expression of rhHpn alone did not rescue the Δccc1Δfet3 mutants from concentrations of high extracellular iron, while the expression of both rhFpn1 and rhHpn rescued the cells even at a final concentration of 20 mM ferrous ammonium sulfate. Quantification of the cellular iron content showed highly similar results for cells expressing rhFpn1 and / or  57  rhHpn and empty vector controls (Figure 3.10). The rescue was not the result of complementation of the loss of the vacuolar iron transporter Ccc1p as the iron content of cells was not elevated; these results are also consistent with Fpn1 and Hpn functioning as a complex to export excess iron out of the cell.  When investigating cell viability over time under conditions of high extracellular iron (Figure 3.11), expression of rhFpn1 or rhHpn (to a lesser extent) alone appeared to rescue yeast from toxic iron initially. rhHpn probably rescued the cells by oxidizing the reduced iron, and thereby, prevented absorption. A much stronger rescue phenotype was observed with yeast co-expressing rhFpn1 and rhHpn, suggesting that rhHpn might have facilitated iron export through stabilizing cell surface localization and possibly modulating iron transport kinetics. As a result, yeast with the introduced iron export system managed to survive toxic iron conditions over longer period of time.  Δfet3 mutants expressing either or both recombinant human protein(s) appeared to grow better than empty vector controls under conditions of high extracellular copper (Figure 3.9). As expected, the expression of rhHpn complemented for the loss of Fet3p by rescuing Δfet3 mutants from levels of high extracellular copper. This might have been accomplished by oxidation of Cu1+ as proposed by Shi et al. [119] for mechanism through which Fet3p coped with copper stress. Surprisingly, the expression of rhFpn1 also rescued the mutants from toxic copper concentrations, suggesting a role of ferroportin in copper metabolism. Based on the available data, it is uncertain whether rhFpn1 may also be involved in copper transport. The involvement of ferroportin in  58  other metal transport had been implicated in the current study as well as recent reports in which Fpn1 was found to play an important role in nickel [53], cobalt [54], zinc [55] and manganese [56] metabolism. Although a recent study demonstrated that copper import by Ctr1p was significantly down-regulated by excess environmental copper [135], death of the Δccc1Δfet3 double knock out mutant indicated that the system was overwhelmed at the copper concentrations tested. This suggests that Ctr1p down-regulation did not contribute to the rescue phenotype observed with the expression of rhFpn1 and / or rhHpn.  Survival of cells in response to metal stress was dependent on recombinant human protein(s) expression. The possibility of survival due to the loss of mitochondria in yeast was proven to be negative since cells cultured in and survived the toxic metal environment also grew on YPGly plates (Appendix F).  3.8  Conclusions In this study, an iron export system was successfully introduced into S. cerevisiae  by expressing recombinant human ferroportin and hephaestin. The proteins localized to the plasma membrane when expressed together and likely localized transiently to cell surface when expressed individually. Recombinant human ferroportin and hephaestin rescued yeast mutants from toxic levels of environmental iron or copper. This validates the hypothesis that ferroportin may be involved in the transport of other metals. Because ferroportin and hephaestin stabilize each other in the plasma membrane and the expression of rhFpn1 protected rhHpn from FXa cleavage, results from this study support the hypothesis that ferroportin and hephaestin physically interact.  59  Chapter 4: Physical Interaction Between Human Ferroportin and Hephaestin  4.1  Rationale and Overview An interaction between ferroportin and hephaestin has long been proposed based on  the observed interactions between ferroportin or other iron permeases and multicopper ferroxidases. Fpn1 was found to co-immunoprecipitate and co-localize with GPI-Cp on astrocytes surface in mammalian central nervous system [49]. The hephaestin homologue in yeast – Fet3p – was also found to complex with an iron permease, Ftr1p and co-traffick to the plasma membrane in S. cerevisiae [97, 101, 102]. This ferroxidaseiron permease pair had also been shown to interact physically by cross-linking [100]. The iron transport kinetics of the Ftr1p-Fet3p high affinity iron transport system in the presence and absence of a competitive Fe(III) chelator – citrate – suggested that iron oxidized by Fet3p was channeled directly to Ftr1p for import into cells [106]. Similarly, the vacuolar iron transporter and ferroxidase – Fth1p and Fet5p – were found to associate in yeast [136]. Moreover, the ferroxidase activity of MCO was shown to stabilize Fpn1 in membrane [50]. Recently, the co-localization of Fpn1 and Hpn was observed in stably transfected human intestinal absorptive cells [51].  As discussed in Chapter 3, ferroportin and hephaestin likely physically associate as they appear to stabilize each other in the plasma membrane. Additional degradation products of rhHpn were released by FXa from the cell surface in the absence of rhFpn1, suggesting that rhFpn1 protected or shielded the rhHpn from proteolytic cleavage by FXa. Here, a study conducted to confirm the proposed Fpn1-Hpn interaction using the  60  established heterologous protein expression system introduced in Chapter 3 is described. Preliminary studies using the human colorectal adenocarcinoma cell line – Caco-2 – showed a ferroportin-protein complex when cross-linked with BS3. Subsequent studies in S. cerevisiae showed co-localization of rhFpn1 and rhHpn in the plasma membrane. The physical interaction between recombinant human ferroportin and hephaestin was demonstrated by Western blot analysis where the cross-linked protein complex was recognized by both the anti-GFP and the anti-1D4 antibodies.  4.2  Co-localization of Recombinant Human Ferroportin and Hephaestin in Yeast To allow proteins to interact, it is important that they be localized to the same  cellular compartment. The cellular localization of rhFpn1-EGFP and rhHpn-RFP in S. cerevisiae was determined by fluorescence microscopy. As previously shown in Chapter 3, when expressed together, rhFpn1-EGFP and rhHpn-RFP co-localized in the plasma membrane in yeast (Figure 4.1; Figure 3.2B). Again, the majority of the expressed recombinant human hephaestin remained intracellular with a weak signal detected at the plasma membrane.  4.3  Cross-linking of Ferroportin and Hephaestin Prior to the development of the yeast model for this study, investigation of the  Fpn1-Hpn interaction was performed in Caco-2 cells. Caco-2 is a well characterized human colon cancer cell line that differentiates to give cells with physical and biochemical properties similar to those of enterocytes [137]. Because the Caco-2 cell line endogenously expresses both Fpn1 and Hpn [138], it makes an ideal mammalian cell  61  Figure 4.1 Co-localization of recombinant human ferroportin and hephaestin in S. cerevisiae. Fluorescence microscopy images of yeast co-expressing rhFpn1-EGFP and rhHpn-RFP. rhFpn1-EGFP co-localized to the plasma membrane with a small portion of the expressed rhHpn-RFP. The majority of rhHpn-RFP remained intracellular. (A) filter for EGFP, (B) filter for RFP, (C) overlay of (A) and (B), and (D) interference contrast.  62  model for studying how Fpn1 and Hpn function in iron transport.  Expression of Fpn1 and Hpn relies on Caco-2 cells becoming polarized to display the morphology and other properties that resemble duodenal enterocytes [138].  For  direct proof of an Fpn1–Hpn interaction, intact Caco-2 cells and Δccc1Δfet3 S. cerevisiae mutants expressing both rhFpn1 and rhHpn were subjected to cross-linking by a chemical cross-linker, BS3. BS3 is a membrane non-permeable cross-linker with a spacer arm of 11.4 Å in length; thus, BS3 will only cross-link associated proteins that are exposed on cell surface.  When polarized Caco-2 cells were treated with BS3, a high molecular weight (>175 kDa) protein-complex was detected with an anti-MTP1 antibody at cross-linker concentrations of 3 mM or higher (Figure 4.2, Lanes 3-5). Both the protein complex and Fpn1 monomer reacted with the anti-MTP1 antibody on the Western blot. Besides Fpn1, the identity of any other protein involved in the molecular weight shift was unknown due to the unavailability of the anti-Hpn antibody at the time.  The same experiment was performed on yeast expressing both rhFpn1 and rhHpn. Similarly, a >268 kDa protein complex was detected when cells were treated with BS3 at all concentrations tested (Figure 4.3). When cell extracts were resolved by 7.5% SDSPAGE and Western blot analysis, the high MW protein complex reacted with both the anti-GFP antibody (Figure 4.3A, Lanes 2-4) and the anti-1D4 antibody (Figure 4.3B, Lanes 2-4), indicating that rhFpn1 and rhHpn interact in yeast plasma membrane.  63  Figure 4.2 Human ferroportin forms a complex with an unidentified protein on cell surface. Protein extracts from Caco-2 cells treated with and without BS3 were resolved by 7.5% reducing SDS-PAGE. Western blot analysis performed using an anti-MTP1 antibody at 1:25,000 dilution and anti-rabbit IgG as secondary at 1:50,000 dilution detected the Fpn1 monomer of ~62 kDa and an Fpn1-protein complex of >175 kDa (marked by arrowhead) when cells were treated with cross-linker at concentrations of 3 mM or higher. The origin of the gels is noted by the dotted line.  64  Figure 4.3 Cross-linking recombinant human ferroportin and hephaestin on the yeast cell surface. Whole cell extracts of yeast treated with and without BS3 were resolved by 3-8% SDS-PAGE for Western blot analysis. Western blot analysis with (A) an anti-GFP antibody at 1:5,000 dilution and (B) an anti-1D4 antibody at 1:500 revealed a protein complex of >268 kDa when cells were treated with the cross-linker. Putative Fpn1-Hpn complexes were marked by the arrows. The origin of the gels is noted by the dotted line.  65  4.4  Discussion  4.4.1  Human Ferroportin and Hephaestin Physically Interact Because of the biophysical and biochemical properties of Caco-2 cells, this  mammalian cell line makes a good model for studying iron metabolism in enterocytes [138]. Preliminary studies conducted on Caco-2 cells revealed a protein that was complexed to Fpn1; the complex migrated with a MW of >175 kDa when the cells were treated with the BS3 cross-linker (Figure 4.2). Because an anti-Hpn antibody was not available at the time, the blot was not probed with an anti-Hpn antibody for confirmation. A published study has demonstrated that the ferroportin dimer can be cross-linked with EGS but not DSP [41]. EGS has a spacer arm of 16.1 Å while DSP has a spacer arm of 12.0 Å. Thus, it is unlikely that BS3 cross-linked Fpn1 to itself with a spacer arm of 11.4 Å. A recent study showed an interaction between the Fpn1 dimer and Hpn by blue native PAGE [132].  Several studies on ferroportin and hephaestin using the mammalian Caco-2 cell line have demonstrated that Hpn was only expressed in fully differentiated cells [51] and that the mRNA expression level of ferroportin was dependent on the stage of confluency and polarization [138]. As a result, additional experiments were conducted using the S. cerevisiae expression system described in Chapter 3. Yeast expressing both rhFpn1EGFP and rhHpn-RFP were shown to co-localize in the plasma membrane (Figure 4.1, Figure 3.2B). In addition to the results in the previous chapter that suggested an interaction between rhFpn1 and rhHpn, a physical interaction between rhFpn1 and rhHpn  66  was demonstrated in this chapter by cross-linking with BS3 (Figure 4.3). Western blot analysis revealed that the protein complex (>268 kDa) was recognized by both the antiGFP and the anti-1D4 antibodies. This result is in agreement with a recent published study, where Fpn1 and Hpn were shown to migrate and interact in rat duodenal enterocytes in response to iron feeding [132]. Yeh et al. [132] found that Fpn1 and Hpn form two different complexes: one involving an Fpn1 dimer and intact Hpn and another one consisting of an Fpn1 monomer and a fragment of Hpn.  4.5  Conclusions In this study, physically interaction between human ferroportin and hephaestin was  demonstrated. The Fpn1-protein interaction was suggested by cross-linking experiments in Caco-2 cells. The interaction was confirmed with the cross-linked protein complex in S. cerevisiae protein extracts reacting with both the anti-GFP and anti-1D4 antibodies against the carboxyl-termini tags of rhFpn1 and rhHpn, respectively. Details of the interaction remain undefined and are currently under further investigation.  67  Chapter 5: Summary and General Discussion  5.1  Introduced Iron Export System in Saccharomyces cerevisiae A decade after the proteins were first identified, the roles ferroportin and hephaestin  in iron transport remain poorly understood. Studies of the metal transport mechanism were attempted using Caco-2 cells, which express both proteins endogenously. However, several studies using Caco-2 cells showed differential expression of Fpn1 at various stages of confluency and polarization [138] while expression of Hpn was evident only in differentiated cells [51]. Recently, the cellular localization and movement of both Fpn1 and DMT1 were shown to change according to the iron status in rat duodenum and Caco2 cells [42]. These added levels of complexity make it difficult to design experiments to test specifically for the basolateral iron export abilities of Fpn1 and Hpn.  Studies on recombinant Fpn1 or Hpn in various cell models have provided valuable insights in how the proteins function in iron metabolism. Ferroportin was found to function in its dimeric form [41] while its membrane stability and iron efflux ability rely on the ferroxidase activity of MCO [50]. Much of the published studies dealt with Fpn1 or Hpn individually. An attempt to study both human Fpn1 and Hpn together is described in this thesis. The lack of an iron export mechanism in addition to the high conservation of iron and copper transport proteins make yeast a great candidate for establishing a cell model for this study.  A cell based model system for studying Fpn1 and Hpn was developed by  68  introducing an iron export system into S. cerevisiae. Recombinant human ferroportin and hephaestin were expressed either individually or in combination in yeast deletion mutants lacking Fet3p or both Fet3p and Ccc1p. When expressed together, the recombinant proteins localized correctly to the plasma membrane although most rhHpn remained intracellular. Overexpression of rhHpn might have exhausted the endogenous yeast copper transport system. The majority of rhHpn might have remained incompletely or partially copper loaded, and thus, may not localize to the plasma membrane. A concern with overexpression of rhHpn is the lack of copper required for functional rhHpn production in yeast. Although preliminary study showed that copper supplementation improved rhHpn expression (Appendix G), copper importer protein Ctr1p is reported to be down-regulated by excess copper [135]. Copper loading may be improved by the coexpression of Ctr1p; however, a balance between copper as a supplement to complement rhHpn overexpression and copper as a cellular toxin must be tightly controlled.  rhHpn might have localized transiently to cell surface, particularly when expressed on its own. Intracellular localization of both recombinantly and endogenously expressed Hpn has been reported: rhHpn was shown to concentrate in late endosomes in yeast [120], while Hpn was found at apical supranuclear position and in recycling endosomes in mice enterocytes [114, 131]. Recently, Hpn was found to migrate to basolateral membrane in response to iron feeding [132]. These suggest that Hpn may only be expressed at cell surface when its ferroxidase activity is required and the migration of Hpn may serve as an extra point of regulation for controlling iron efflux. Similarly, rhFpn1 might also be localized in the plasma membrane transiently or its membrane stability might be unstable  69  as evident by the weaker fluorescence signal of rhFpn1-EGFP in the absence of rhHpn. This further supports the observation that functional MCO is required for Fpn1 membrane stability [50].  Both rhFpn1 and rhHpn rescued iron sensitive Δccc1Δfet3 yeast from toxic extracellular iron concentrations presumably by exporting iron out of the cells. Not only was the cellular iron content of iron storage defective Δccc1Δfet3 yeast expressing rhFpn1 and / or rhHpn comparable to that of the empty vector control (Figure 3.10), but was also significantly lower than that of the Δfet3 iron storage intact yeast. This suggests that the expression of neither recombinant human protein complemented the loss of Ccc1p as no sign of iron sequestration or storage in intracellular compartment was detected. Studies conducted with mutants with defective clatharin coat formation to trap Fpn1 in the plasma membrane demonstrated the requirement of functional MCO for Fpn1 iron export [50]. However, this may not be the case as a small level of rescue was observed in cells expressing rhFpn1 alone. In the absence of functional MCO, Fpn1 may transport iron at a much slower rate.  5.2  Potential Involvement in Transport of Other Metals It was unclear whether ferroportin transports iron specifically or its association with  hephaestin determines its metal specificity (reviewed in [1]). Besides its iron transport ability, results from this study suggest that recombinant human ferroportin and hephaestin may also be involved in copper metabolism in yeast. The expression of rhFpn1 both with and without rhHpn rescued yeast Δfet3 copper sensitive mutants from toxic levels of  70  environmental copper. The rescue phenotype against excess extracellular copper even in the presence of rhHpn showed that interaction with Hpn did not provide Fpn1 with iron transport specificity. Together with some recent studies demonstrating nickel [53] and cobalt [54] transport by plant Fpn1 or zinc [55] and manganese [56] transport by mammalian Fpn1, the cumulative data suggests that ferroportin may not be an ironspecific transporter; ferroportin may also be involved in the transport of other metals.  5.3  Interaction Between Ferroportin and Hephaestin Fet3p, the homologue of hephaestin in yeast, interacts physically with an iron  permease, Ftr1p [100]. It was believed that Fet3p and Ftr1p form a protein complex in the yeast cell membrane as localization of either protein to the plasma membrane requires co-trafficking of the other [97, 101, 102]. Similarly, the structural homologue of hephaestin, GPI-Cp was shown not only to have co-localized with Fpn1 on astrocyte surface but also co-immunoprecipitated with Fpn1 in mammalian central nervous system [49]. These led to the investigation of a potential interaction between Fpn and Hpn.  Because ferroportin and hephaestin stabilize each other in the plasma membrane and the expression of rhFpn1 protects rhHpn-FXa from FXa cleavage, results from the current study support the hypothesis that ferroportin and hephaestin interact physically. The weaker fluorescence signals of rhFpn1-EGFP and rhHpn-RFP in yeast plasma membrane when expressed individually are consistent with the published observation that ferroxidase activity of MCO stabilizes Fpn1 in plasma membrane [50]. The interaction between rhFpn1 and rhHpn was demonstrated by the BS3 cross-linked protein complex  71  being recognized by both the anti-GFP and the anti-1D4 antibodies against the carboxylterminal tags of rhFpn1 and rhHpn, respectively. Recently, it has also been reported that Fpn1 and Hpn migrate to and interact in the basolateral membrane of rat duodenal enterocytes in response to iron feeding [132]. Further details of the interaction and mechanism of action still remain to be elucidated.  5.4  Significance of the Work The importance of iron homeostasis for the well-being of humans is demonstrated  by various disorders that result from iron deficiency or iron overloading, including anemia, hemochromatosis, and some neurodegenerative disorders (such as Alzheimer’s and Parkinson’s diseases). A recent study suggests the involvement of hepcidin and ferroportin in secondary iron overload associated with beta-thalassemia [90]. Being the key regulatory point, defining how the ferroportin-hephaestin iron export pair functions in iron metabolism has the potential to contribute significantly to our understanding of iron transport and regulatory systems in humans.  Since they were first identified, both ferroportin and hephaestin have been expressed and studied individually using various model cell systems. Prior to the present work, the combinatorial effects of recombinant human ferroportin and hephaestin on the metabolism of iron or other metals had not been studied. By expressing rhFpn1 and rhHpn in Saccharomyces cerevisiae, a model system for further characterization of their mechanism of action has been established. The interaction between human Fpn1 and Hpn has also been confirmed. This study should open the way for further  72  characterization that can define the mechanism of interaction and metal transport by rhFpn1 and rhHpn.  5.5  Future Directions  5.5.1  Development of an Expression System That Could Be Optimized for Functional Protein Production Δccc1 and Δfet3 mutants exhibit iron and copper sensitivity phenotypes,  respectively. This study has shown that the expression of rhFpn1 and rhHpn can rescue these mutants from toxic concentrations of iron or copper. This leads to the question that whether the expression of functional complementary proteins can be optimized when the Δccc1Δfet3 double deletion mutants are cultured under subtoxic levels of metals. With these highly sensitive mutants, it may be possible to identify a subtoxic growth / induction condition that would allow for the screening of functional proteins as they are being synthesized. Preliminary studies suggest that copper supplementation to a final concentration of 1 mM during batch-fed induction using a fermentation unit improved rhHpn expression (Appendix G). Iron is highly toxic and the optimal subtoxic concentration is still under investigation.  5.5.2  Mechanism of Iron Transport by Ferroportin and Hephaestin In the presence of rhHpn, rhFpn1 exhibited better membrane stability and a stronger  rescue phenotype when exposed to high extracellular iron. This suggests that hephaestin might be modulating the iron transport kinetics of ferroportin as well as enhancing its  73  membrane stability. It is possible that this kinetic change is accomplished by iron channeling directly from Fpn1 to Hpn. With the established yeast expression system, one could investigate iron channeling mechanism between human Fpn1 and Hpn, based on Kwok et al. [106] who showed that iron channeling occurs between Ftr1p and Fet3p.  5.5.3  Isolation of Hephaestin Soluble Ectodomain from Yeast Cell Surface for Structural and Biochemical Analyses Incomplete copper loading has been an issue with recombinant hephaestin  production for downstream analyses [46]. It is possible that copper loading affected the membrane localization of rhHpn expressed in S. cerevisiae. Thus, with the FXa cleavable hephaestin construct, fully copper loaded proteins may be isolated from the incompletely copper loaded protein for further structural and biochemical analyses.  5.5.4  Mapping the Ferroportin-Hephaestin Interaction To further define the interaction between rhFpn1 and rhHpn, the cross-linked  protein complex is currently subjected to mass spectroscopy analysis. This will confirm the identities of the complexed proteins, and perhaps identify the interacting peptides. With the EGFP and RFP fusion proteins, fluorescence resonance energy transfer experiments can be conducted to map the distance between the interacting proteins. Microarrays with peptides from the intra- and extra-cellular loops of Fpn1 may also be used to determine the potential interacting site(s) with Hpn.  74  References 1.  M.R. Bleackley, A.Y.K. Wong, D.M. Hudson, C.H.Y. Wu, and R.T.A. MacGillivray. (2009) Blood Iron Homeostasis: Newly-Discovered Proteins and Iron Imbalance. Transfus Med Rev 23:103–123.  2.  W.R. Harris. (2002) Iron chemistry, in Molecular and cellular iron transport. D.M. Templeton, Editor. Marcel Dekker Inc.: New York, 1–40.  3.  M.C. Linder, N.R. Zerounian, M. Moriya, and R. Malpe. (2003) Iron and copper homeostasis and intestinal absorption using the Caco2 cell model. Biometals 16:145–160.  4.  P. Aisen, C. Enns, and M. Wessling-Resnick. (2001) Chemistry and biology of eukaryotic iron metabolism. Int J Biochem Cell Biol 33:940–959.  5.  M.E. Conrad and J.N. Umbreit. (2000) Iron absorption and transport-an update. Am J Hematol 64:287–298.  6.  D. Radisky and J. Kaplan. (1999) Regulation of transition metal transport across the yeast plasma membrane. J Biol Chem 274:4481–4484.  7.  C.H. Park, B.R. Bacon, G.M. Brittenham, and A.S. Tavill. (1987) Pathology of dietary carbonyl iron overload in rats. Lab. Invest 57:555–563.  8.  G.J. Anderson, D.M. Frazer, A.T. McKie, C.D. Vulpe, and A. Smith. (2005) Mechanisms of haem and non-haem iron absorption: Lessons from inherited disorders of iron metabolism. Biometals 18:339–348.  9.  P. Sharp and S.K. Srai. (2007) Molecular mechanisms involved in intestinal iron absorption. World J Gastroenterol 13:4716–4724.  10.  J. Umbreit. (2005) Iron deficiency: A concise review. Am J Hematol 78:225–231.  75  11.  M.E. Conrad and J.N. Umbreit. (2002) Pathways of iron absorption. Blood Cells Mol Dis 29:336–355.  12.  R.E. Fleming. (2005) Advances in understanding the molecular basis for the regulation of dietary iron absorption. Curr Opin Gastroenterol 21:201-206.  13.  T.H. Bothwell, R.D. Baynes, B.J. MacFarlane, and A.P. MacPhail. (1989) Nutritional iron requirements and food iron absorption. J Intern Med 226:357–365.  14.  B.S. Skikne, S.R. Lynch, and J.D. Cook. (1981) Role of gastric acid in food iron absorption. Gastroenterology 81:1068–1071.  15.  G.O. Latunde-Dada, A.T. McKie, and R.J. Simpson. (2006) Animal models with enhanced erythropoiesis and iron absorption. Biochim Biophys Acta 1762:414–423.  16.  M.J. Koury, and P. Ponka. (2004) New insights into erythropoiesis: the roles of folate, vitamin B12, and iron. Annu Rev Nutr 24:105–131.  17.  M.E. Conrad, J.N. Umbreit, E.G. Moore, C. Uzel, and M.R. Berry. (1994) Alternate iron transport pathway. Mobilferrin and integrin in K562 cells. J Biol Chem 269:7169–7173.  18.  M. Simovich, L.N. Hainsworth, P.A. Fields, J.N. Umbreit, and M.E. Marcel. (2003) Localization of the iron transport proteins Mobilferrin and DMT-1 in the duodenum: the surprising role of mucin. Am J Hematol 74:32–45.  19.  J.N. Umbreit, M.E. Conrad, E.G. Moore, M.P. Desai, and J. Turrens. (1996) Paraferritin: a protein complex with ferrireductase activity is associated with iron absorption in rats. Biochemistry 35:6460–6469.  20.  A.T. McKie, D. Barrow, G.O. Latunde-Dada, A. Rolfs, G. Sager, E. Mudaly, M. Mudaly, C. Richardson, D. Barlow, A. Bomford, T.J. Peters, K.B. Raja, S. Shirali, M.A. Hediger, F. Farzaneh, R.J. Simpson. (2001) An iron-regulated ferric reductase associated with the absorption of dietary iron. Science 291:1755–1759.  76  21.  S. Gruenheid, M. Cellier, S. Vidal, and P. Gros. (1995) Identification and characterization of a second mouse Nramp gene. Genomics 25:514-525.  22.  M.D. Fleming, C.C. Trenor III, M.A. Su, D. Foernzler, D.R. Beier, W.F. Dietrich, and N.C. Andrews. (1997) Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16:383–386.  23.  H. Gunshin, B. Mackenzie, U.V. Berger, Y. Gunshin, M.F. Romero, W.F. Boron, S. Nussberger, J.L. Gollan, and M.A. Hediger. (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388:482–488.  24.  H. Gunshin, C.N. Starr, C. DiRenzo, M.D. Fleming, J. Jin, E.L. Greer, V.M. Sellers, S.M. Galica, and N.C. Andrews. (2005) Cybrd1 (duodenal cytochrome b) is not necessary for dietary iron absorption in mice. Blood 106:2879–2883.  25.  M. Shayeghi, G.O. Latunde-Dada, J.S. Oakhill, A.H. Laftah, K. Takeuchi, N. Halliday, Y. Khan, A. Warley, F.E. McCann, R.C. Hider, D.M. Frazer, G.J. Anderson, C.D. Vulpe, R.J. Simpson, and A.T. McKie. (2005) Identification of an intestinal heme transporter. Cell 122:789–801.  26.  A.D. Qiu, M. Jansen, A. Sakaris, S.H. Min, S. Chattopadhyay, E. Tsai, C. Sandoval, R.B. Zhao, M.H. Akabas, and I.D. Goldman. (2006) Identification of an intestinal folate transporter and the molecular basis for hereditary folate malabsorption. Cell 127:917–928.  27.  R. Zhao, S.H. Min, A. Qiu, A. Sakaris, G.I. Goldberg, C. Sandoval, J.J. Malatack, D.S. Rosenblatt, and I.D. Goldman. (2007) The Spectrum of mutations in the PCFT gene, coding for an intestinal folate transporter, that are the basis for hereditary folate malabsorption. Blood 110:1147–1152.  28.  A. Rajagopal, A.U. Rao, J. Amigo, M. Tian, S.K. Upadhyay, C. Hall, S. Uhm, M.K. Mathew, M.D. Fleming, B.H. Paw, M. Krause, I. Hamza. (2008) Haem homeostasis is regulated by the conserved and concerted functions of HRG-1 proteins. Nature 453:1127–1131.  29.  Y. Ma, M. Yeh, K. Yeh, and J. Glass. (2006) Iron Imports. V. Transport of iron through the intestinal epithelium. Am J Physiol Gastrointest Liver Physiol 290:G417–G422.  77  30.  H. Shi, K.Z. Bencze, T.L. Stemmler, and C.C. Philpott. (2008) A cytosolic iron chaperone that delivers iron to ferritin. Science 320:1207–1210.  31.  L.R. Devireddy, D.O. Hart, D.H. Goetz, and M.R. Green. (2010) A Mammalian Siderophore Synthesized by an Enzyme with a Bacterial Homolog Involved in Enterobactin Production. Cell 141:1006–1017.  32.  A.T. McKie and D.J. Barlow. (2004) The SLC40 basolateral iron transporter family (IREG1/ferroportin/MTP1). Pflugers Arch 447:801–806.  33.  S. Abbound and D.J. Haile. (2000) A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 275:19906–19912.  34.  A. Donovan, A. Brownlie, Y. Zhou, J. Shepard, S.J. Pratt, J. Moynihan, B.H. Paw, A. Drejer, B. Barut, A. Zapata, T.C. Law, C. Brugnara, S.E. Lux, G.S. Pinkus, J.L. Pinkus, P.D. Kingsley, J. Palis, M.D. Fleming, N.C. Andrews, and L.I. Zon. (2000) Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403:776–781.  35.  A.T. McKie, P. Marciani, A. Rolfs, K. Brennan, K. Wehr, D. Barrow, S. Miret, A. Bomford, T.J. Peters, F. Farzaneh, M.A. Hediger, M.W. Hentze, and R.J. Simpson. (2000) A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 5:299–309.  36.  M. Wessling-Resnick. (2006) Iron Imports. III. Transfer of iron from mucosa into circulation. Am J Physiol Gastrointest Liver Physiol 290:1–6.  37.  A.E. Rice, M.J. Mendez, C.A. Hokanson, D.C. Rees, and P.J. Björkman. (2009) Investigation of the Biophysical and Cell Biological properties of Ferroportin, a Multipass Integral Membrane Protein Iron Exporter. J Mol Biol 386:717–732.  38.  A. Donovan, C.A. lima, J.L. Pinkus, G.S. Pinkus, L.I. Zon, S. Robine, and N.C. Andrews. (2005) The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab 1:191–200.  39.  T. Ganz. (2005) Cellular iron: Ferroportin is the only way out. Cell Metab 1:155– 157.  78  40.  T.V. Le Nghia and Des R. Richardson. (2002) Ferroportin1: a new iron export molecule? Int J Biochem Cell Biol 34:103–108.  41.  I. De Domenico, D.M. Ward, G. Musci, and J. Kaplan. (2007) Evidence for the multimeric structure of ferroportin. Blood 109:2205–2209.  42.  M.T. Núñez, V. Tapia, A. Rojas, P. Aguirre, F. Gómez, and F. Nualart. (2009) Iron supply determines apical/basolateral membrane distribution of intestinal iron transporters DMT1 and ferroportin 1. Am J Physiol Cell Physiol 298:C477–C485.  43.  C.D. Vulpe, Y.M. Kuo, T.L. Murphy, L. Cowley, C. Askwith, N. Libina, J. Gitschier, and G.J. Anderson. (1999) Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 21:195–199.  44.  H. Chen, T. Su., Z.K. Attieh, T.C. Fox, A.T. McKie, G.J. Anderson, and C.D. Vulpe. (2003) Systemic regulation of Hephaestin and Ireg1 revealed in studies of genetic and nutritional iron deficiency. Blood 102:1893–1899.  45.  B.A. Syed, N.J. Beaumont, A. Patel, C.E. Naylor, H.J. Bayele, C.L. Joannou, P.S. Rowe, R.W. Evans, and S.K. Srai. (2002) Analysis of the human hephaestin gene and protein: comparative modeling of the N-terminus ecto-domain based upon ceruloplasmin. Protein Eng 15:205–214.  46.  T.A.M. Griffiths, A.G. Mauk, and R.T.A. MacGillivray. (2005) Recombinant Expression and Functional Characterization of Human Hephaestin: A Multicopper Oxidase with Ferroxidase Activity. Biochemistry 44:14725–14731.  47.  N.E. Hellman and J.D. Gitlin. (2002) Ceruloplasmin metabolism and function. Annu Rev Nutr 22:439–548.  48.  H. Chen, A.K. Attieh, B.A. Syed, Y-M. Kuo, V. Stevens, B.K. Fuqua, H.S. Andersen, C.E. Naylor, R.W. Evans, L. Gambling, R. Danzeisen, M.B-H.J. Usta, C.D. Vulpe, and H.J. McArdle. (2010) Identification of Zyklopen, a New Member of the Vertebrate Multicopper Ferroxidase Family, and Characterization in Rodents and Human Cells. J Nutr 140:1728–1735.  79  49.  S.Y. Jeong and S. David. (2003) Glycosylphosphatidylinositol-anchored Ceruloplasmin is Required for Iron Efflux from Cells in the Central Nervous System. J Biol Chem 278:27144–27148.  50.  I. De Domenico, D.M. Ward, M.C. Bonaccorsi di Patti, S.Y. Jeong, S. David, G. Musci, and J. Kaplan. (2007) Ferroxidase activity is required for the stability of cell surface ferroportin in cells expressing GPI-ceruloplasmin. The EMBO Journal 26:2823–2831.  51.  O. Han and E.-Y. Kim. (2007) Colocalization of Ferroportin-1 With Hephaestin on the Basolateral Membrane of Human Intestinal Absorptive Cells. J Cell Biochem 101:1000–1010.  52.  L.J.-C. Wu, A.G. Miriam Leenders, S. Cooperman, E. Meyron-Holtz, S. Smith, W. Land, R.Y.L. Tsai, U.V. Berger, Z.-H. Sheng, and T.A. Rouault. (2004) Expression of the iron transporter ferroportin in synaptic vesicles and the blood-brain barrier. Brain Res 1001:108–117.  53.  G. Schaaf, A. Honsbein, A.R. Meda, S. Kirchner, D. Wipf, and N. von Wirén. (2006) AtIREG2 Encodes a Tonoplast Transport Protein Involved in Irondependent Nickel Detoxification in Arabidopsis thaliana Roots. J Biol Chem 281:25532–25540.  54.  J. Morrissey, I.R. Baxter, J. Lee, L. Li, B. Lahner, N. Grotz, J. Kaplan, D.E. Salt, and M.L. Guerinot. (2009) The Ferroportin Metal Efflux Proteins Function in Iron and Cobalt Homeostasis in Arabidopsis[W],[OA]. The Plant Cell 21:3326–3338.  55.  M-B. Troadee, D.M. Ward, E. Lo, J. Kaplan, and I. De Domenico. (2010) Induction of FPN1 transcription by MTF-1 reveals a role for ferroportin in transition metal efflux. Blood: [in press].  56.  Z. Yin, H. Jiang, E-S.Y. Lee, M. Ni, K.M. Erikson, D. Milatovic, A.B. Bowman, and M. Aschner. (2010) Ferroportin is a manganese-responsive protein that decreases manganese cytotoxicity and accumulation. J Neurochem 112:1190–1198.  57.  R.T.A. MacGillivray and A.B. Mason. (2002) Transferrins, in Molecular and cellular iron transport. D.M. Templeton, Editor. Marcel Dekker Inc.: New York, 41–69.  80  58.  C.A. Enns. (2002) The transferrin receptor, in Molecular and cellular iron transport. D.M. Templeton, Editor. Marcel Dekker, Inc: New York, 71–94.  59.  R.S. Ohgami, D.R. Campagna, E.L. Greer, B. Antiochos, A. McDonald, J. Chen, J.J. Sharp, Y. Fujiwara, J.E. Barker, and M.D. Fleming. (2005) Identification of a ferrireductase required for efficient transferrin-dependent iron uptake in erythroid cells. Nat Genet 37:1264–1269.  60.  P. Aisen. (1998) Transferrin, the transferrin receptor, and the uptake of iron by cells. Met Ions Biol Syst 35:585-631.  61.  T. Ganz. (2003) Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation. Blood 102:783–788.  62.  C. Pigeon, G. Ilyin, B. Courselaud, P. Leroyer, B. Turlin, P. Brissot, and O. Loréal. (2001) A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem 276:7811–7819.  63.  E. Nemeth and T. Ganz. (2006) Regulation of iron acquisition and iron distribution in mammals. Biochim Biophys Acta 1763:690–699.  64.  I. De Domenico, E. Lo, D.M. Ward, and J. Kaplan. (2009) Hepcidin-induced internalization of ferroportin requires binding and cooperative interactive with Jak2. Proc Natl Acad Sci USA 106:3800–3805.  65.  E. Nemeth, M.S. Tuttle, J. Powelson, M.B. Vaughn, A. Donovan, D.M. Ward, T. Ganz, and J. Kaplan. (2004) Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 306:2090–2093.  66.  D.M. Frazer, S.J. Wilkins, E.M. Becker, T.L. Murphy, C.D. Vulpe, A.T. McKie, and G.J. Anderson. (2003) A rapid decrease in the expression of DMT1 and Dcytb but not Ireg1 or hephaestin explains the mucosal block phenomenon of iron absorption. Gut 52:340–346.  81  67.  D.M. Frazer, S.J. Wilkins, E.M. Becker, C.D. Vulpe, A.T. McKie, D. Trinder, and G.J. Anderson. (2002) Hepcidin expression inversely correlates with the expression of duodenal iron transporters and iron absorption in rats. Gastroenterology 123:835–844.  68.  J.L. Babitt, F.W. Huang, Y. Xia, Y. Sidis, N.C. Andrews, and H.Y. Lin. (2007) Modulation of bone morphogenetic protein signaling in vivo regulates systemic iron balance. J Clin Invest 117:1933–1939.  69.  D.M. Wrighting, and N.C. Andrews. (2006) Interleukin-6 induces hepcidin expression through STAT3. Blood 108:3204–3209.  70.  M.V. Verga Falzacappa, M. Vujic Spasic, R. Kessler, J. Stolte, M.W. Hentze, and M.U. Muckenthaler. (2007) STAT3 mediates hepatic hepcidin expression and its inflammatory stimulation. Blood 109:353–358.  71.  J.L. Babitt, F.W. Huang, D.M. Wrighting, Y. Xia, Y. Sidis, T.A. Samad, J.A. Campagna, R.T. Chung, A.L. Schneyer, C.J. Woolf, N.C. Andrews, and H.Y. Lin. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet 38:531–539.  72.  G. Papanikolaou, M.E. Samuels, E.H. Ludwig, M.L. MacDonald, P.L. Franchini, M.P. Dubé, L. Andres, J. MacFarlane, N. Sakellaropoulos, M. Politou, E. Nemeth, J. Thompson, J.K Risler, C. Zaborowska, R. Bavakaiff, C.C. Radomski, T.D. Pape, O. Davidas, J. Christakis, P. Brissot, G. Lockitch, T. Ganz, M.R. Hayden, and Y.P. Goldberg. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet 36:77–82.  73.  L. Lin, Y.P. Goldberg, and T. Ganz. (2005) Competitive regulation of hepcidin mRNA by soluble and cell-associated hemojuvelin. Blood 106:2884–2889.  74.  L. Lin, E.V. Valore, E. Nemeth, J.B. Goodnough, V. Gabayan, and T. Ganz. (2007) Iron transferrin regulates hepcidin synthesis in primary hepatocyte culture through hemojuvelin and BMP2/4. Blood 110:2182–2189.  75.  A.R. West, C. Thomas, J. Sadlier, and P.S. Oates. (2006) Haemochromatosis protein is expressed on the terminal web of enterocytes in proximal small intestine of the rat. Histochem Cell Biol 125:283–292.  82  76.  G. Sebastiani and A.P. Walker. (2007) HFE gene in primary and secondary hepatic iron overload. World J Gastroenterol 13:4673–4689.  77.  N.C. Andrews and P.J. Schmidt. (2007) Iron homeostasis. Annu Rev Physiol 69:69–85.  78.  A.P. Jr. West, A.M. Giannetti, A.B. Herr, M.J. Bennett, J.S. Nangiana, J.R. Pierce, L.P. Weiner, P.M. Snow, and P.J. Bjorkman. (2001) Mutational analysis of the transferrin receptor reveals overlapping HFE and transferrin binding sites. J Mol Biol 313:385–397.  79.  A. Waheed, J.H. Grubb, X.Y. Zhou, S. Tomatsu, R.E. Fleming, M.E. Costaldi, R.S. Britton, B.R. Bacon, and W.S. Sly. (2002) Regulation of transferrin-mediated iron uptake by HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci USA 99:3117–3122.  80.  R.E. Fleming and W.S. Sly. (2002) Mechanisms of iron accumulation in hereditary hemochromatosis. Annu Rev Physiol 64:663–680.  81.  T. Goswami and N.C. Andrews. (2006) Hereditary hemochromatosis protein, HFE, interaction with transferrin receptor 2 suggests a molecular mechanism for mammalian iron sensing. J Biol Chem 281:28494–28498.  82.  G. Weiss. (2002) Iron and immunity: a double-edged sword. Eur J Clin Invest 32 (Suppl.I):70–78.  83.  X. Huang. (2003) Iron overload and its association with cancer risk in humans: evidence for iron as a carcinogenic metal. Mut Res 533:153–171.  84.  K.S. Choi, M.K. Bae, J.W. Jeong, H.E. Moon, and K.W. Kim. (2003) Hypoxiainduced angiogenesis during carcinogenesis. J. Biochem Mol Biol 36:120–127.  85.  S. Tokyokuni. (2002) Iron and carcinogenesis: from Fenton reaction to target genes. Redox Rep 7:189–197.  83  86.  T. Ganz and E. Nemeth. (2006) Iron imports. IV. Hepcidin and regulation of body iron metabolism. Am J Physiol Gastrointest Liver Physiol 290:G199–203.  87.  L. Zecca, M.B.H. Youdim, P. Riederer, J.R. Connor, and R.R. Crichton. (2004) Iron, brain ageing and neurodegenerative disorders. Nat Rev Neurosci 5:863–873.  88.  K.J.H. Robson, A.T. Merryweather-Clarke, E. Cadet, V. Viprakasit, M.G. Zaahl, J.J. Pointon, D.J. Weatherall, and J. Rochette. (2004) Recent advances in understanding haemochromatosis: a transition state. J Med Genet 41:721–730.  89.  D.W. Swinkels, M.C.H. Janssen, J. Bergmans, and J.J.M. Marx. (2006) Hereditary Hemochromatosis: Genetic Complexity and New Diagnostic Approaches. Clin Chem 52:950–968.  90.  S. Gardenghi, M.F. Marongiu, P. Ramos, E. Guy, L. Breda, A. Chadburn, Y.F. Liu, N. Amariglio, G. Rechavi, E.A. Rachmilewitz, W. Breuer, Z. loav Cabantchik, D.M. Wrighting, N.C. Andrews, M. de Sousa, P.J. Giardina, R.W. Grady, and S. Rivella. (2007) Ineffective erythropoiesis in β-thalassemia is characterized by increased iron absorption mediated by down-regulation of hepcidin and up-regulation of ferroportin. Blood 109:5027–5035.  91.  I. De Domenico, D.M. Ward, E. Nemeth, T. Ganz, E. Corradini, F. Ferrara, G. Musci, A. Pietrangelo, and J. Kaplan. (2006) Molecular and clinical correlates in iron overload associated with mutations in ferroportin. Haematologica 91:1092– 1095.  92.  I. De Domenico, D.M. Ward, G. Musci, and J. Kaplan. (2006) Iron overload due to mutations in ferroportin. Haematologica 91:92–95.  93.  V. Vassiliev, Z.L. Harris and P. Zatta. (2005) Ceruloplasmin in neurodegenerative diseases. Brain Res Brain Res Rev 49:633–640.  94.  H. Miyajima. (2003) Aceruloplasminemia, an iron metabolic disorder. Neuropathology 23:345–350.  95.  A.V. Ho, D.M. Ward, and J. Kaplan. (2002) Transition Metal Transport in Yeast. Annu Rev Microbiol 56:237–261.  84  96.  D. Dix, J. Bridgham, M. Broderius, and D. Eide. (1997) Characterization of the FET4 protein of yeast. Evidence for a direct role in the transport of iron. J Biol Chem 272:11770–11777.  97.  R. Stearman, D.S. Yuan, Y. Yamaguchi-Iwai, R.D. Klausner and A. Dancis. (1996) A permease-oxidase complex involved in high-affinity iron uptake in yeast. Science 271:1552–1557.  98.  C.C. Philpott. (2006) Iron uptake in fungi: A system for every source. Biochimica et Biophysica Acta 1763:636–645.  99.  C. Askwith and J. Kaplan. (1998) Iron and copper transport in yeast and its relevance to human disease. Trends Biochem Sci 23:135–138.  100. M.C. Bonaccorsi di Patti, R. Miele, M.E. Schininà and D. Barra. (2005) The yeast multicopper oxidase Fet3p and the iron permease Ftr1p physically interact. Biochem Biophys Res Commun 333:432–437. 101. T.–P. Wang, L. Quintanar, S. Severance, E.I. Solomon and D.J. Kosman. (2003) Targeted suppression of the ferroxidase and iron trafficking activities of the multicopper oxidase, Fet3p, from Saccharomyces cerevisiae. J Biol Inorg Chem 8:611–620. 102. D.S. Yuan, A. Dancis and R.D. Klausner. (1997) Restriction of copper export in Saccharomyces cerevisiae to a late Golgi or post-Golgi compartment in the secretory pathway. J Biol Chem 272:25787–25793. 103. D.M. de Silva, C.C. Askwith, D. Eide, and J. Kaplan. (1995) The FET3 gene product required for high affinity iron transport in yeast is a cell surface ferroxidase. J Biol Chem 270:1098–1101. 104. D.M. de Silva, S. Davis-Kaplan, J. Fergestad, and J. Kaplan. (1997) Purification and characterization of Fet3 protein, a yeast homologue of ceruloplasmin. J Biol Chem 272:14208–14213.  85  105. S. Severance, S. Chakraborty, and D.J. Kosman. (2004) The Ftr1p iron permease in the yeast plasma membrane: orientation, topology and structure-function relationships. Biochem J 380:487–496. 106. E.Y. Kwok, C.S. Stoj, S. Severance, and D.J. Kosman. (2006) An engineered bifunctional high affinity iron uptake protein in the yeast plasma membrane. J Inorg Bio 100:1053–1060. 107. J. Sambrook and D.W. Russell. (2001) Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 108. R.D. Gietz and R.A. Woods. (2002) Yeast Transformation by the Liac/SS Carrier DNA/PEG Method. Meth Enzymol 350:87–96. 109. C.S. Hoffman and F. Winston. (1987) A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267–272. 110. J. Hewitt, J.N.M. Ballard, T.N. Nelson, V.C. Smith, T.A.M. Griffiths, S. Pritchard, J.K. Wu, L.D. Wadsworth, B. Casey, and R.T.A. MacGillivray. (2005) Severe FVII deficiency caused by a new point mutation combined with a previously undetected gene deletion. Br J Haematol 128:380–385. 111. V.V. Kushinirov. (2000) Rapid and reliable protein extraction from yeast. Yeast 16:857–860. 112. D.M. Hudson, S.B. Curtis, V.C. Smith, T.A. Griffiths, A.Y.K. Wong, C.H. Scudamore, A.M. Buchan, and R.T.A. MacGillivray. (2010) Human hephaestin expression is not limited to enterocytes of the gastrointestinal tract but is also found in the antrum, the enteric nervous system, and pancreatic β-cells. Am J Physiol Gastrointest Liver Physiol 298:G425–G432. 113. Application note: Biotechnology Explorer Protein Electrophoresis of GFP: A pGLO™ Bacterial Transformation Kit Extension. BioRad.  86  114. H. Chen, A.K. Attieh, T. Su, B.A. Syed, H. Gao, R.M. Alaeddine, T.C. Fox, J. Usta, C.E. Naylor, R.W. Evans, A.T. McKie, G.J. Anderson, and C.D. Vulpe. (2004) Hephaestin is a ferroxidase that maintains partial activity in sex-linked anemia mice. Blood 103:3933–3939. 115. A.A. Moshtaghie, A. Badii, and T. Mohammadian. (2004) The Comparative Study of Binding Characteristics of Cobalt and Iron to Human Serum Transferrin. J Res Med Sci 6:250–254. 116. A.B. Mason, P.J. Halbrooks, J.R. Larouche, S.K. Briggs, M.L. Moffett, J.E. Ramsey, S.A. Connolly, V.C. Smith, and R.T.A. MacGillivray. (2004) Expression, purification, and characterization of authentic monoferric and apo-human serum transferrins. Prot Expr Purif 36:318–326. 117. J. Tamarit, V. Irazusta, A. Moreno-Cermeño, and J. Ros. (2006) Colorimetric assay for the quantitation of iron in yeast. Anal Biochem 351:149–151. 118. L. Li, O.S. Chen, D.M. Ward, and J. Kaplan. (2001) CCC1 is a Transporter that Mediates Vacuolar Iron Storage in Yeast. J Biol Chem 276:29515–29519. 119. X. Shi, C. Stoj, A. Romeo, D.J. Kosman, and Z. Zhu. (2003) Fre1p Cu2+ Reduction and Fet3p Cu1+ Oxidation Modulate Copper Toxicity in Saccharomyces cerevisiae. J Biol Chem 278:50309–50315. 120. L. Li, C.D. Vulpe, and J. Kaplan. (2003) Functional studies of hephaestin in yeast: evidence for multicopper oxidase activity in the endocytic pathway. Biochem J 375:793–798. 121. I. Bento, C. Peixoto, V.N. Zaitsev, and P.F. Lindley. (2007) Ceruloplasmin revisited: structural and functional roles of various metal cation-binding sites. Acta Cryst D63:240–248. 122. L. Li and J. Kaplan. (1998) Defects in the Yeast High Affinity Iron Transport System Result in Increased Metal Sensitivity because of the Increased Expression of Transporters with a Broad Transition Metal Specificity. J Biol Chem 273:22181– 22187.  87  123. A. Rath, M. Glibowicka, V.G. Nadeau, G. Chen, and C.M. Deber. (2009) Detergent binding explains anomalous SDS-PAGE migration of membrane proteins. Proc Natl Acad Sci USA 106:1760–1765. 124. R. Conde, R. Cueva, G. Pablo, J. Polaina, and G. Larriba. (2004) A Search for Hyperglycosylation Signals in Yeast Glycoproteins. J Biol Chem 279:43789–43798. 125. S. Nakamura, H. Takasaki, K. Kobayashi, and A. Kato. (1993) Hyperglycosylation of Hen Egg White Lysozyme in Yeast. J Biol Chem 268:12706–12712. 126. D.A. Griffith, C. Delipala, J. Leadsham, S.M. Jarvis, and D. Oesterhelt. (2003) A novel yeast expression system for the overproduction of quality-controlled membrane proteins. FEBS Letters 553:45–50. 127. S. Wagner, M.L. Bader, D. Drew, and J.-W. de Gier. (2006) Rationalizing membrane protein overexpression. Trends Biotechnol 24:364–371. 128. S.D. Kohlwein. (2000) The Beauty of the Yeast: Live Cell Microscopy at the Limits of Optical Resolution. Microsc Res Tech 51:511–529. 129. H. Chen, H.L. Puhl 3rd, S.V. Koushik, S.S. Vogel, and S.R. Ikeda. (2006) Measurement of FRET Efficiency and Ratio of Donor to Acceptor Concentration in Living Cells. Biophys J 91:L39–L41. 130. D.M. Frazer, C.D. Vulpe, A.T. McKie, S.J. Wilkins, D. Trinder, G.J. Cleghorn, and G.J. Anderson. (2001) Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins. Am J Physiol Gastrointest Liver Physiol 281:G931–G939. 131. Y.M. Kuo, T. Su, H. Chen, Z. Attieh, B.A. Syed, A.T. McKie, G.J. Anderson, J. Gitschier, and C.D. Vulpe. (2004) Mislocalisation of hephaestin, a multicopper ferroxidase involved in basolateral intestinal iron transport, in the sex linked anaemia mouse. Gut 53:201–206. 132. K.-Y. Yeh, M. Yeh, L. Mims, and J. Glass. (2009) Iron feeding induces ferroportin 1 and hephaestin migration and interaction in rat duodenal epithelium. Am J Physiol Gastrointest Liver Physiol 296:G55–G65.  88  133. M. He, L. Jin, and B. Austen. (1993) Specificity of Factor Xa in the Cleavage of Fusion Proteins. J Prot Chem 12:1–5. 134. S. Sengupta, C. Wehbe, A.K. Majors, M.E. Ketterer, P.M. DiBello, and D.W. Jacobsen. (2001) Relative Roles of Albumin and Ceruloplasmin in the Formation of Homocystine, Homocysteine-Cysteine-mixed Disulfide, and Cystine in Circulation. J Biol Chem 276:46896–46904. 135. X. Wu, D. Sinani, H. Kim, and J. Lee. (2009) Copper Transport Activity of Yeast Ctr1 Is Down-regulated via Its C Terminus in Response to Excess Copper. J Biol Chem 284:4112–4122. 136. J.L. Urbanowski and R.C. Piper. (1999) The Iron Transporter Fth1p Forms a Complex with the Fet5 Iron Oxidase and Resides on the Vacuolar Membrane. J Biol Chem 274:38061–38070. 137. B.M. Evers. (1999) Intestinal Cell Differentiation: Cellular Mechanisms and the Search for the Perfect Model Focus on “Involvement of p21(WAF1/Cip1) and p27(Kip1) in intestinal epithelial cell differentiation”. Am J Physiol Cell Physiol 276:1243–1244. 138. O. Han and M. Wessling-Resnick. (2002) Copper repletion enhances apical iron uptake and transepithelial iron transport by Caco-2 cells. Am J Physiol Gastrointest Liver Physiol 282:G527–G533.  89  Appendix A: Fluorescence Microscopy of Saccharomyces cerevisiae Empty Vector Controls  Under the same preparation and observation conditions for detecting rhFpn1-EGFP and rhHpn-RFP signals, no fluorescent signal was detected in yeast transformed with empty expression vectors. Representative image is shown below:  Figure A.1 Fluorescence microscopy of S. cerevisiae containing empty vectors. No fluorescence signal was detected with EGFP or RFP filter under the same conditions used for Figures 3.2, 3.4 and 4.1. (A) filter for EGFP, (B) filter for RFP, (C) Interference contrast, and (D) overlay of (A) and (B).  90  Appendix B: BPS Assay Metal Specificity  The BPS assay was conducted with iron and copper solutions at various concentrations to confirm the specificity of the assay for iron. Standard solutions of ferrous ammonium sulfate (orange) and cupric sulfate (blue) at various concentrations in deionized water were subjected to nitric acid digestion and prepared for spectroscopic determination under the same conditions as yeast samples. The corrected absorbance readings that fall within the range of Δccc1Δfet3 cellular iron content are shown below. Insignificant absorbance levels were detected in cupric sulfate samples, indicating that the BPS assay was highly specific for quantification of cellular iron content.  Figure A.2 The BPS assay is specific for determination of iron but not copper concentrations. Standard solutions of ferrous ammonium sulfate (orange) and cupric sulfate (blue) were prepared for colorimetric quantification using BPS. The assay shows much higher sensitivity to iron than copper. All data were collected in triplicates and error bars represent ± 1 S.D.  91  Appendix C: Apparent Molecular Weight of Recombinant Human Ferroportin Is Dependent on SDS-Loading  Whole cell extracts from equal masses of yeast expressing rhFpn1-EGFP were prepared for in-gel GFP fluorescence analysis as described in Chapter 2 using sample loading buffers with varying amount of SDS (3 – 15 %). Proteins were resolved by 7.5% SDS-PAGE analysis for in-gel GFP fluorescence detection. The gel (shown below) was viewed on an UV transilluminator and captured using the ChemiGenius system. The apparent MW of rhFpn1-EGFP decreased as the concentration of SDS in the sample loading buffer increased.  Figure A.3 SDS-loading dependent gel mobility shift of rhFpn1-EGFP. In-gel GFP fluorescence analysis of rhFpn1-EGFP shows a decrease in apparent molecular weight with increased SDS concentration in sample loading buffer.  92  Appendix D: Ceruloplasmin Retained Its Oxidase Activity When Treated with SDS and Heat Under Non-Reducing Condition  Yeast samples for in-gel oxidase activity assay were subjected to SDS and heat treatments to help solubilize proteins from the plasma membrane. To confirm that SDS and heat treatment under non-reducing condition did not abolish MCO oxidase activity, ferrozine ferroxidase activity assay on plasma samples treated under various conditions was conducted. Ferrozine forms a purple complex when it chelates Fe(II). If Fe(II) is oxidized by MCO, less Fe(II) is available for binding by ferrozine, resulting in a decrease in the purple signal. To test for the effects of SDS and heat treatments, plasma samples were subjected to: (1) no pre-treatments (Figure A.4A), (2) heating at 70ºC for 10 minutes (Figure A.4B), (3) heating at 70ºC for 10 minutes in the presence of 5% SDS (Figure A.4C), and (4) heating at 70ºC for 10 minutes in the presence of 5% SDS and βmercaptoethanol (Figure A.4D). In the absence of reducing agent (Figure A.4A-C), ceruloplasmin in plasma retained its ferroxidase activity. The Fe(II) content in the corresponding buffers (yellow curves) was much higher than the parallel reactions with the plasma sample (blue curves), except for the reaction with plasma heated at 70ºC without SDS (Figure A.4B). The much higher apparent absorbance may have resulted from protein aggregation. When β-mercaptoethanol was added to the reaction, oxidase activity of Cp was reduced significantly (Figure A.4D), suggesting that disulfide bonds may have held the protein together. Under these testing conditions (Figure 3.5, Figure A.4C), the proteins are likely partially denatured and retain some, if not all, of their enzymatic activities.  93  Figure A.4 Oxidase activity of ceruloplasmin in plasma. Oxidation of Fe(II) by Cp (blue) and the extent of auto-oxidation in corresponding buffer (yellow) are shown. Plasma samples were subjected to: (A) no pre-treatment, (B) heating at 70ºC for 10 minutes, (C) heating at 70ºC for 10 minutes in the presence of 5% SDS, and (D) heating at 70ºC for 10 minutes in the presence of 5% SDS and β-mercaptoethanol. All data were collected in triplicates and error bars represent ± 1 S.D.  94  Appendix E: Rate of Auto-oxidation Is Reduced in the Presence of Yeast  The rate of background auto-oxidation of ferrous ammonium sulfate was assessed in the presence and absence of Δccc1Δfet3 yeast mutant (16mg cells / reaction; empty plasmid control) by ferrozine ferroxidase activity assays. Representative curves of rate of auto-oxidation in the presence and absence of yeast is shown below. The rate of autooxidation was reduced in the presence of yeast.  Figure A.5 Auto-oxidation of iron in the presence and absence of S. cerevisiae. Rate of Fe(II) auto-oxidation in the presence of yeast (pink) is lower than that in the absence of yeast (grey). All data were collected in triplicates and error bars represent ± 1 S.D.  95  Appendix F: Rescue Phenotype Observed Was Not Due to the Loss of Mitochondria in Saccharomyces cerevisiae  Yeast expressing rhFpn1 and / or rhHpn or empty vectors control were challenged at high extracellular concentrations of iron or copper. Resulting cultures were spotted on YPGly plates to test if the rescue phenotype was attributed to the expression of the recombinant proteins or due to the loss of mitochondria. Survivors also grew on YPGly plates, indicating that the rescue phenotype was not due to the loss of mitochondria in yeast. A representative plate is shown below:  Figure A.6 Rescue phenotype of iron sensitive mutants was not due to the loss of mitochondria. Survivors from toxic metal assays grew on YPGly plate, indicating that the cells retained their mitochondria.  96  Appendix G: Copper Supplementation Improved Recombinant Human Hephaestin Expression  Δccc1Δfet3 yeast co-expressing rhFpn1 and rhHpn were cultured using a computercontrolled fermenter. At OD600 ~0.4, the culture was induced under subtoxic metal concentrations with galactose (2% final concentration) and metal solutions pumping into the fermenter at a rate of 5 mL per 22 minutes. As control, equal volume of diluted galactose solution (2% final concentration) was introduced into a parallel fermenter culture. Samples were taken at various time points for Western blot analysis. As shown below, improved rhHpn expression was observed when the culture was supplemented with excess extracellular copper (Lanes 1-5). This suggests that cultures grown under slightly toxic conditions may help to optimize for the production of functional rhHpn.  Figure A.7 Galactose-inducible expression of rhHpn in S. cerevisiae with or without copper supplementation. Induction for rhHpn expression under subtoxic copper concentration improved yield of rhHpn (Lanes 1-5). 97  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071383/manifest

Comment

Related Items