Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of a KNAT7-BLH-OFP transcription factor complex involved in regulation of secondary cell… Liu, Yuanyuan 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_liu_yuanyuan.pdf [ 1.64MB ]
Metadata
JSON: 24-1.0071348.json
JSON-LD: 24-1.0071348-ld.json
RDF/XML (Pretty): 24-1.0071348-rdf.xml
RDF/JSON: 24-1.0071348-rdf.json
Turtle: 24-1.0071348-turtle.txt
N-Triples: 24-1.0071348-rdf-ntriples.txt
Original Record: 24-1.0071348-source.json
Full Text
24-1.0071348-fulltext.txt
Citation
24-1.0071348.ris

Full Text

Investigation of a KNAT7-BLH-OFP transcription factor complex involved in regulation of secondary cell wall biosynthesis in Arabidopsis thaliana  by  Yuanyuan Liu  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   October 2010 © Yuanyuan Liu, 2010      ii ABSTRACT  The plant secondary cell wall is a composite network of complex polymers (cellulose, lignin, and hemicellulose) that provides protective and structural properties to the cell wall. Based on previous research, the Arabidopsis KNOX gene KNAT7 has been shown to act as a transcription factor that regulates secondary wall formation in Arabidopsis inflorescence stems in coordination with Ovate Family Proteins (OFPs). Co-expression and yeast two-hybrid analyses suggest that BEL1-LIKE HOMEODOMAIN (BLH) transcription factors could be part of a KNOX-BLH-OVATE transcription factor complex regulating aspects of secondary cell wall formation, together with KNAT7 and OFP1/4. I investigated the interactions of BLH partners with KNAT7 and OFP proteins through yeast two-hybrid and in planta bimolecular fluorescence complementation analyses, and have identified a BLH protein BLH6 (At4g34610), from among six candidate BLH proteins as a BLH interacting partner of KNAT7. In addition, I demonstrated that OFP4 interacts with homeodomain of KNAT7 and BLH6 interacts with the KNAT7 MEINOX domain by yeast two-hybrid analyses. Furthermore, I investigated the function of BLH6 and an additional BLH protein, BLH5 (At2g27220), by characterizing the phenotypic effects of blh loss of function and BLH overexpression on stem anatomy. Phenotype analysis showed that blh5 knockout mutant and BLH5 overexpression mutant are indistinguishable from wild type. blh6 knock out mutant displayed slightly thicker cell walls in interfascicular fibers. In addition, I employed protoplast transfection assay to demonstrate that BLH6 is a transcriptional repressor. This study provides new information regarding the existence of a BLH6-KNAT7-OFP complex and insights into the biological function of BLH6.       iii TABLE OF CONTENTS  Abstract………………………………………………………………………………..ii Table of contents………………………………………………………………………….iii List of tables………………………………………………………………………………vi List of figures…………………………………………………………………………….vii Abbreviations……………………………………………………………………………..ix Acknowledgements………………………………………………………………………..x Chapter 1. Introduction and literature review…………………………………………1 1.1 Xylem development and tracheary element differentiation…………………….1 1.2 Secondary cell walls…………………………………………………………….3  1.2.1 Biosynthesis of secondary cell wall components…………………………4 1.3 Transcription factors associated with secondary cell wall formation……….......6 1.4 Homeodomain proteins………………………………………………………....7  1.4.1 KNOX family proteins……………………………………………………7  1.4.2 BELL family of homeodomain proteins…………………………………9  1.4.3 The interaction between KNOX and BLH proteins………………………10  1.4.4 Subcellular localization of KNOX-BLH complex………………………11 1.5 Arabidopsis OVATE family proteins…………………………………………11 1.6 Summary of background data………………………………………………….12 1.7 Research objectives……………………………………………………………13 Chapter 2. Identification of BLH members of a putative KNAT7-BLH-OFP complex regulating secondary wall formation in Arabidopsis…………………………………….14 2.1 Introduction……………………………………………………………………14 2.2 Materials and methods………………………………………………………...15 2.2.1 Phylogenetic analysis……………………………………………………15 2.2.2 Plant material and growth conditions……………………………………16   iv 2.2.3 Generating split YFP and bait and prey of yeast two-hybrid constructs…..16 2.2.4 Bimolecular Fluorescence Complementation (BiFC) assay in Arabidopsis mesophyl protoplasts………………………………………………………………18 2.2.5 Yeast two hybrid assay……………………………………………………..18 2.3 Results……………………………………………………………………………..18 2.3.1 Phylogenetic analysis of BELL family members in different  plant species……………………………………………………………………………18 2 .3 .2  In  s i l i co  ex pres s ion  pa t t e rns  o f  cand ida t e  BLH  genes  in Arabidopsis………………………………………………………………………..22 2.3.3 Bioinformatic and literature-based identification of potential KNAT7 interacting BLH proteins…………………………………………………………..26 2.3.4 BiFC screen for KNAT7 interacting BLH proteins……………………...26 2.3.4.1 Subcellular localization of BLH candidates………………………...26 2.3.4.2 BLH6 interacts with KNAT7 in planta……………………………..27 2.3.4.3 BLH6 interacts with the KNAT7 MEINOX domain……………….29 2.3.5 Yeast two hybrid assay of  BLH- and OFP-KNAT7 interaction candidates…………………………………………………………….....................31 2.3.5.1 BLH6 interacts with the MEINOX domain of KNAT7……….........32 2.3.5.2 OFP4 interacts with the homeodomain of KNAT7…………………34 2.4 Discussion………………………………………………………………………36 Chapter 3. Investigation of Arabidopsis BLH function in secondary wall formation…40 3.1 Introduction………………………………………………………………………40 3.2 Material and methods…………………………………………………………….40 3.2.1 Plant material and growth conditions………………………………….40 3.2.2 T-DNA and reverse transcription PCR…………………………………41 3.2.3 Generation of 4CL1:BLH constructs…………………………………...41 3.2.4 Arabidopsis transformation…………………………………………….41   v 3.2.5 Toluidine blue staining…………………………………………………42 3.2.6 Phloroglucinol-HCL staining…………………………………………..42 3.2.7 Mäule staining………………………………………………………….43 3.2.8 Generation of a GD-BLH6 construct…………………………………..43 3.2.9 Protoplast transfection assays………………………………………….43 3.3 Results………………………………………………………………………..44 3.3.1 Test of BLH5 function……………………………………………………...44 3.3.1.1 Identification of blh5 mutants…………………………………..44 3.3.1.2 Phenotypic characterization of blh5 mutant…………………….45 3.3.1.3 Over-expression of BLH5……………………………………….46 3.3.2 Phenotypic characterization of blh6 mutant………………………………..49 3.3.2.1 Identification of a blh6 mutant………………………………….49 3.3.2.2 Phenotypic characterization of the blh6 mutant………………...49 3.3.2.3 Transcriptional activity of BLH6……………………………….51 3.4 Discussion………………………………………………………………………..53 Chapter 4. Conclusion and future directions………………………………………..56 4.1 BLH expression patterns……………………………………………………..56 4.2 Functional analysis of the KNAT7-BLH6 complex………………………….56 4.3 Analysis of a KNOX-BLH-OVATE complex by protein-protein interaction assays…………………………………………………………………………….58 4.4 KNAT7 target genes………………………………………………………….58 References………………………………………………………………………………60            vi LIST OF TABLES  Table 2.1 Primer sequences to generate truncated KNAT7 clones for yeast two-hybrid assay……………………………………………………………………………………...17 Table 2.2 Species names and NCBI reference sequence numbers of the 39 BLH sequences included in this study…………………………………………………………19 Table 4.1 Double and triple mutants to be generated………………………………........57                                  vii LIST OF FIGURES  Figure 1.1 Primary xylem development in the model system of Zinnia elegans…….........2 Figure 1.2 Secondary xylem development in angiosperms……………………………….3 Figure 1.3 Schematic diagrams of structure of secondary cell wall…………………........4 Figure 1.4 Model of the transcriptional network regulating secondary wall biosynthesis………………………………………………………………………………..7 Figure 1.5 General features of KNOX and BLH homeodomain proteins……………….10 Figure 2.1 Phylogenetic analyses of BEL1-like homeodomain proteins………………21 Figure 2.2 Relative Arabidopsis BLH gene expression levels from anatomy in Genevestigator v3…………………………………………………………………..........24 Figure 2.3 Relative gene expression in different organs from the developmental map in BAR……………………………………………………………………………………...25 Figure 2.4 Subcellular localization of BLH candidates…………………………….........27 Figure 2.5 Schematic diagram representing two sets of BiFC constructs……………….28 Figure 2.6 BLH6 interacts with KNAT7 in planta………………………………….........29 Figure 2.7 BLH6 interacts with MEINOX domain of KNAT7 in planta………………..31 Figure 2.8 Yeast two-hybrid assay of BLH6-, or BLH7- and OFP-KNAT7 interaction candidates………………………………………………………………………………...32 Figure 2.9 BLH6 interacts with the MEINOX domain of KNAT7………………………33 Figure 2.10 KNAT7 interacts with OFP1 and OFP4…………………………………….34 Figure 2.11 OFP4 interacts with the homeodomain of KNAT7…………………….........35 Figure 2.12 Proposed KNAT7-OFP-BLH6 complex model regulating secondary cell wall………………………………………………………………………………….........39 Figure 3.1 Characterization of plants loss of RNA expression of BLH5………………...44 Figure 3.2 Phenotypic characterizations of loss-of-function mutants of BLH5………….46 Figure 3.3 Expression of BLH5 in overexpression lines…………………………………47   viii Figure 3.4 Anatomical characterization of 4CL1:BLH5 mutants………………………..48 Figure 3.5 Charaterization of the blh6-1 allele…………………………………………..49 Figure 3.6 Anatomical characterization of the blh6 loss-of-function mutant……………51 Figure 3.7 Test of the transcriptional activity of BLH6…………………………….........53                      ix ABBREVIATIONS  3AT 35S 4CL1 ABRC BLH BEL1 BAR BiFC BLAST CEYFP/NEYFP CESA cDNA DNA DEX EV FRA8 GD GFP GR GUS hr IFF irx KNOX KNAT LB mRNA MUG OFP ORF PCR RNA RT-PCR TE TALE T-DNA WT X-gal Y2H 3-amino-1, 2, 4-triazole Cauliflower mosaic virus 35S promoter Petroselinum crispum 4-Coumarate:CoA ligase1 Arabidopsis Biological Resource Center BEL1-like homeodomain (protein/gene) BELL1 Bio-Array Resource for Arabidopsis Functional Genomics Bimolecular fluorescence complementation Basic Local Alignment Search Tool C terminus / N terminus of enhanced yellow fluorescent protein Cellulose synthase Complementary DNA reverse transcribed from messenger RNA (mRNA) Deoxyribonucleic acid Dexamethasone Empty vector Arabidopsis thaliana fragile fiber 8 Gal4 DNA binding domain Green fluorescent protein Glucocorticoid receptor β- glucuronidase Hours Interfascicular fiber Irregular xylem Knotted - like homeobox Knotted - like Arabidopsis thaliana (protein/gene) Luria - Bertani bacterial growth medium Messenger RNA 4-methylumbelliferyl-β-D-glucuronide Ovate family protein Open reading frame Polymerase chain reaction Ribonucleic acid Reverse transcription-polymerase chain reaction Tracheary element Three amino acid loop extension Transfer DNA Wild type 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside Yeast two hybrid   x ACKNOWLEDGEMENTS  I sincerely express my tremendous appreciation to those who have encouraged, guided and supported me throughout my life and studies. To my supervisor, Dr. Carl Douglas, thanks for your considerate and continued efforts to establish a social and studying relationship that is energized by curiosity and all things abstract. Thanks to my committee members, Dr. Brian Ellis, Dr. Fred Sack and Dr. George Haughn, your kind care and effort through my research and writing process. Thanks for your will to serve as my advisors for guiding me in different disciplines.  Thank you to Dr. Michael Friedmann for thoughtful guidance and help during the past two and half years. Thank you to all the members from Douglas Lab, Dr. Eryang Li, SungSoo Kim, Dr. Etienne Grienenberger, Apurva Bhargava, Teagen Quilichini and Dr. June Kim, for your encouragements, support, comments and hours of sharing your knowledge and life experience with me. Thank you to Dr. Shucai Wang, Qingning Zeng and Lin Shi, for your kind advisory and encouragement for the explorations in sciences.  I want to thank all my friends and families for their endless support, especially to my dear mother, Jing Chen, for her support and understanding. I would not be where I am today without your great support and encouragement. I would particularly thank my husband, Shijun You, who has always been there for me. Thank you to my parents-in-law, Dr. Minsheng You and Xiaojing Chen, who encouraged me to do my best. Also thank you to Yanlong Guo, Huizi Gao, Ben Lai, Dr. Tao Jia, Xi Chen as well as everyone else that I met in UBC for all of your kind and great support during my daily life.      1  Chapter 1. Introduction and literature review  1.1 Xylem development and tracheary element differentiation Xylem is composed of several cell types, such as tracheary elements (TEs), fibers and parenchyma. TEs in gymnosperms include tracheids, while TEs in angiosperms include both vessels and tracheids. Xylem is produced during primary and secondary growth. Primary xylem is produced via the procambium from the shoot apical meristem, and secondary xylem (wood) is formed from vascular cambium which originates from procambium (Esau, 1965). Xylem cells such as vessels and tracheids that are dead at maturity and have lignified secondary cell walls undergo a common set of developmental steps during xylem development (xylogenesis) (Samuels et al., 2006). Zinnia elegans TEs grown in cell culture have been used as a model system to study xylem differentiation steps such as secondary wall deposition, lignification and programmed cell death (Stacey et al., 1995; Fukuda, 1996). Figure 1.1 summarizes the process of primary xylem development in the model system Zinnia elegans (Samuels et al., 2006). The inflorescence stem of Arabidopsis also serves as a model system to study secondary cell wall development in xylem and interfascicular fiber cells as it displays a gradient of fiber development at increasing distances from shoot apical meristem, and the xylem and interfascicular fiber anatomy and morphology are easily visualized in cross sections (Ehlting et al., 2005). Populus (poplar) has also been used as a model system for wood (secondary xylem) formation in recent years as its genome has been sequenced, genomic and molecular tools have been developed, and it can be transformed (Mellerowicz et al., 2001; Jansson and Douglas, 2007).  Primary and secondary xylem differentiation begins with cell expansion, followed by secondary cell wall synthesis and deposition, lignification, and programmed cell death (PCD) (Turner et al., 2007). During primary xylem development, procambium cells derived from the shoot apical meristem start to expand longitudinally, giving rise to TEs (Figure 1.1). During secondary xylem development, after mitosis of cambial cells, the derivatives that will become xylem first undergo 2  a period of cellular expansion. Angiosperm vessels and gymnosperm tracheids, which are water conducting cells, undergo radial expansion, while angiosperm supportive fibers undergo intrusive elongation (Mellerowicz et al., 2001). At the end of cell expansion phase, TEs and fiber cells begin to produce a three-layered secondary cell wall (S1, S2 and S3 layers), which is made of cellulose and hemicelluloses. At the later stages of cellulose and hemicelluloses biosynthesis, lignification of cell corners and the middle lamella of TE and fibers begins (Donaldson, 2001). The final stage of xylem cell development is PCD, a process that removes the cell contents and leaves empty cells, which are capable of supporting water transport (Figure 1.2) (Fukuda, 1996; Roberts and McCann, 2000).  Figure 1.1 Primary xylem development in the model system of Zinnia elegans. Xylogenesis processes are very similar in primary xylem lignified cells and secondary xylem, although secondary xylem is produced by vascular cambium. Figure from Samuels et al. (2006).        3  Figure 1.2 Secondary xylem development in angiosperms. A schematic diagram of the differentiation of a cambium cell into a vessel element or a fiber cell. The stages of development depicted include cell expansion, deposition of secondary cell wall and lignification, and programmed cell death. Figure from Samuels et al. (2006).   1.2 Secondary cell walls The evolution of lignified secondary cell walls was a crucial adaptive event in land plant evolution, as it provides structural stiffness and strength to plant cells, allowing for their vertical growth, protecting against pathogen attack and facilitating the transport of water and nutrients through lignified tracheids and vessel elements in the xylem (Roberts and McCann, 2000). Secondary walls also have a major impact on human life, as they are major constituents of wood 4  and forage crop biomass. In the future, secondary walls may help to reduce our dependence on petroleum, as they account for the bulk of renewable biomass that can be used for bioenergy (Pauly and Keegstra, 2008).  The plant secondary cell wall is composed of complex polymers that provide protective and structural properties to the cell wall. It includes four major biopolymers: hemicelluloses, cellulose, lignin and also pectin, but the major components are the first three (Balatinecz et al., 2001) (Figure 1.3A). The secondary cell walls are highly organized, with cellulose microfibrils deposited in S1, S2 and S3 layers. The three layers differ in the orientation of cellulose microfibrils (Figure1.3 B) (Barnett and Bonham, 2004; Sticklen, 2008).  Figure 1.3 Schematic diagrams of structure of secondary cell wall (A) Diagram of secondary cell wall relative to the primary wall and plasma membrane, which contains cellulose synthase enzymes as integral membrane proteins. (B) The secondary cell wall S1, S2 and S3 layers. Images were adapted from Sticklen (2008).   1.2.1 Biosynthesis of secondary cell wall components Cellulose is a polymer of β-1, 4-linked glucose residues. Cellulose polymers are organized into cellulose microfibrils that are embedded in a network of hemicellulose and lignin. Cellulose is 5  synthesized by plasma membrane-bound enzyme complexes known as rosettes, which consist of cellulose synthases encoded by CESA (Cellulose Synthase) genes (Doblin et al., 2002). The Arabidopsis genome contains at least 10 CESA genes (Somerville, 2006). Some of them are involved in primary wall biosynthesis, such as CESA1, CESA2, CESA3 and CESA6, while others are secondary wall associated CESA4, CESA7 and CESA8 (Somerville, 2006).  Lignin is an aromatic polymer with three-dimensional linkages, and consists of p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) units, which are derived from p-coumaryl alcohol, coniferyl alcohol and sinapyl alcohol, respectively. These are derived from cinnamic acid, the product of the reaction catalyzed by phenylalanine ammonia-lyase, via phenolic ring modification (hydroxylation and methylation) and a three- step reduction process catalyzed by 4-coumarate:CoA ligase, cinnamoyl-CoA reductase (CCR) and cinnamyl/sinapyl alcohol dehydrogenase (CAD/SAD). After biosynthesis of lignin monomers, they are transported to the cell wall, where they are oxidized by "polyphenol oxidases" such as peroxidase and laccases and then cross-coupled to the growing polymer to extend the complex three-dimensional lignin network (Boerjan et al., 2003). Most of the genes involved in the lignin biosynthetic pathway have been isolated and functionally characterized in Arabidopsis (Boerjan et al., 2003), but the exact roles of the polymerization enzymes have not been well defined in planta.  Hemicelluloses are a class of branched polysaccharides containing a variety of 5-and 6- carbon sugars. For example, xyloglucans are a major constituent of dicot primary walls, while arabinoxylan and glucomannans are the major hemicelluloses in secondary walls (Pauly and Keegstra, 2008). Several genes are known to take part in xylan biosynthesis (Liepman et al., 2005; Zhong et al., 2005), such as FRA8 which encodes glycosyltransferase associated with xylan biosynthesis in Arabidopsis.  Although the biochemistry of secondary wall biosynthetic pathways has been extensively studied, 6  information on transcriptional regulators that control the secondary wall synthetic process is more limited. If the regulatory network controlling secondary cell wall synthesis can be well established, the cell walls of wood and plant fibers may be more easily manipulated.  1.3 Transcription factors associated with secondary cell wall formation Recently, several transcription factors regulating secondary wall biosynthesis have been identified by genetic and reverse genetic analysis in Zinnia and Arabidopsis. These studies indicate that secondary wall –associated NAC domain protein1 (SND1), NAC secondary wall thickening promoting factor (NST1, NST2), vascular-related NAC-domain6 (VND6) and VND7 are key regulators of secondary wall biosynthesis in different cell types (Kubo et al., 2005; Mitsuda et al., 2005; Zhong et al., 2006; Yamaguchi et al., 2008). Besides these master switches, MYB transcription factors (MYB46, MYB83, MYB58 and MYB63) and a KNOX homeodomain protein (KNAT7), have been shown to act downstream of NAC domain transcription factors in regulating secondary wall biosynthesis (Zhong et al., 2008), and some were shown to be direct targets of NACs (Zhong et al., 2007; Zhong et al., 2008; McCarthy et al., 2009) . KNAT7 is also a target of MYB46 (Ko et al., 2009). All these data suggest that a transcriptional network regulates the biosynthesis of three major components of secondary cell wall (lignin, cellulose and hemicellulose). A model for the network regulating secondary wall synthesis based on the above work is presented in Figure 1.4. This model presents a general framework for understanding the secondary cell wall transcriptional network, but it is still far from complete (Zhong et al., 2008).        7  Figure 1.4 Model of the transcriptional network regulating secondary wall biosynthesis. Adapted from Zhong et al. 2008.   1.4 Homeodomain proteins Homeodomain proteins were originally discovered as the protein products encoded by homeotic genes and are characterized by a conserved sequence of 180bp, the homeodomain (Gehring et al., 1994a). The homeodomain was first identified in Drosophila homeotic genes, mutation in which result in homeotic (out of place) developmental phenotypes characterized by loss of segmental identity, for example leading to formation of a leg on the head of a fruit fly instead of the expected antenna (McGinnis et al., 1984). The homeodomain consists of three helices I, II and III, with helices II, III and the small turn connecting them forming a helix-turn-helix motif. The characteristic three-helix structure binds directly with conserved sequences in the target DNA or other proteins to form a complex involved in gene regulation  (Gehring et al., 1994b).  1.4.1 KNOX family proteins Plants contain several families of homeodomain containing transcription factors, such as HD-ZIP and other classes (Mukherjee et al., 2009). Plant Knotted-like homeobox (KNOX) proteins, called KNOTTED-LIKE ARABIDOPSIS THALIANA (KNAT) proteins in Arabidopsis, belong to the plant-specific three amino acid loop extension (TALE) superclass of homeodomain proteins 8  (Hake et al., 2004). Distinguished from the other homeodomain proteins, the TALE superclass of homeodomain proteins has an extra three amino acids between helices 1 and 2 (Bertolino et al., 1995). KNOX proteins also have a KNOX (MEINOX) domain that forms an amphipathic helix having 9-13 turns with most of the conserved residues on one face of the helix and an ELK domain that forms two short helices with 24 amino acids (Figure 1.5).  The eight genes of the KNOX family in Arabidopsis can be grouped into two classes based on their sequence similarities and phylogenetic analysis of aligned sequences (Kerstetter et al., 1994). Class 1 KNOX proteins include SHOOTMERISTEMLESS (STM), BREVIPEDICELLUS (BP) / KNAT1, KNAT2 and KNAT6, while KNAT3, KNAT4, KNAT5 and KNAT7 belong to Class 2. Certain Class 1 KNOX proteins, which are mainly expressed in the shoot apex, are required for proper development of the shoot apical meristem (SAM). For example, the bp mutant shows reduced internode elongation and downward pointing pedicels (Douglas et al., 2002; Venglat et al., 2002). STM is essential for the initiation of the meristem during embryogenesis (Long et al., 1996). However, functions of Class 2 KNOX proteins are not clear. KNAT3, KNAT4 and KNAT5 are thought to participate in Arabidopsis root development based on their expression patterns in the Arabidopsis roots (Truernit et al., 2006). KNAT7 was identified as a transcription factor regulating secondary wall formation based on co-expression and mutant analysis (Brown et al., 2005; Persson et al., 2005), and reverse genetic analysis revealed an irregular xylem (irx) phenotype in the loss of function allele (Brown et al., 2005). Other researchers described a severe reduction in secondary wall thickening in fiber cells caused by an artificial dominant repression version of KNAT7 (Zhong et al., 2008). Our lab has found that KNAT7 is strongly upregulated over the course of inflorescence stem development associated with secondary wall formation (Ehlting et al., 2005) and that knat7 mutants are affected in both vessel and fiber wall formation (Li, 2008). Furthermore, KNAT7 acts as a transcriptional repressor when transiently expressed in Arabidopsis protoplasts (Li et al., submitted).  9  1.4.2 BELL family of homeodomain proteins Arabidopsis BEL1-LIKE homeodomain (BLH) proteins also belong to the TALE class and like KNOX proteins, are unique to plants. In addition to the TALE motif in the homeodomain, BLH proteins have a conserved BELL domain and SKY domain. The BELL and SKY regions compose a conserved bipartite domain in the N terminus of BLH proteins called the MEINOX interacting domain (MID) (Balatinecz et al., 2001; Bellaoui et al., 2001; Müller et al., 2001). Some studies suggest that KNOX-BLH forms heterodimer transcription factor complexes by the interaction of the MEINOX and MID domains (Bellaoui et al., 2001; Müller et al., 2001). There are 13 BLH genes in Arabidopsis (Smith et al., 2004). BELL1 (BEL1) is the founding member of the group and is involved in ovule integument development as revealed by the phenotype of bell1 mutants (Reiser et al., 1995). The misexpression of BEL1-LIKE HOMEODOMAIN1 (BLH1) results in defective Arabidopsis embryo sac development (Pagnussat et al., 2007). The double mutant of the BEL1-like SAWTOOTH1 (SAW1) and SAW2 genes shows a phenotype of increased leaf serration. In addition, SAW1 and SAW2 negatively regulate the KNOX gene BP (Kumar et al., 2007). The Arabidopsis BLH protein BELLRINGER (BLR; it is also named as PENNYWISE, REPLUMLESS, VAAMANA) is required for inflorescence development (Byrne et al., 2003; Bao et al., 2004; Bhatt et al., 2004; Smith et al., 2004). In addition, BLR and its paralogous protein POUNDFOOLISH (PNF) play similar roles in shoot development and flower patterning, and exhibit functional redundancy in these roles (Yu et al., 2009). Moreover, the BLH protein ARABIDOPSIS THALIANA HOMEOBOX1 (ATH1) controls floral competency by activating FLOWERING LOCUS, a flowering repressor gene (Proveniers et al., 2007).       10  Figure 1.5 General features of KNOX and BLH homeodomain proteins. Adapted from Kumar, 2006.   1.4.3 The interaction between KNOX and BLH proteins The protein-protein interactions between KNOX and BLH family members are well characterized in different plant species. It is reported that the interactions between a potato KNOX protein, POTH1 (potato homeobox 1), and StBEL5 (Solanum tuberosom BEL5), which is a BEL1-like protein, directly repress ga20oxidase1 (ga20x1) promoter activity by binding to a specific promoter ga20x1sequence (Chen et al., 2004). Also in maize, the interaction between KNOTTED1 (KN1) and a BLH protein, KIP (Knotted Interacting Protein) results in a heterodimer with increased affinity to the specific KNOX DNA-binding motif (Smith et al., 2002). In Arabidopsis, STM interacts with ATH1, PENNYWISE (PNY/BLH9) and POUNDFOOLISH (PNF/BLH8) to control the initiation and maintenance of floral meristems (Rutjens et al., 2009). PNY is reported to cooperate with KNAT1 to regulate inflorescence development (Smith and Hake, 2003). The BLH proteins SAW1 and SAW2 promote correct leaf shape by repressing BP expression in Arabidopsis leaves (Kumar et al., 2007). A survey of Arabidopsis TALE protein interactions using yeast two-hybrid assays suggests a network of TALE protein-protein interactions with each other and with OVATE FAMILY PROTEINS (OFPs; Hackbusch et al., 2005). It has also been shown that OFPs can regulate the activity of KNAT-BLH heterodimers: OFP5 suppresses the activity of a BLH1 - KNAT3 complex to promote normal development of the Arabidopsis embryo sac (Pagnussat et al., 2007).  11  1.4.4 Subcellular localization of KNOX-BLH complex Interactions between KNOX and BLH proteins can affect cellular trafficking and localization of these transcription factors. The fusion protein STM-GFP and GFP-STM was excluded from the nucleus and remained in the cytoplasm when expressed in transgenic cells (Bhatt et al., 2004). The GFP-BLH3 fusion protein exerted a preference for the nuclear compartment, while it was also detected in cytoplasm (Cole et al., 2006). However, the ATH1/STM, BLH3/STM and PNY/STM heterodimers were all efficiently incorporated into the nuclear compartment (Cole et al., 2006). Similarly, PNY-GFP fluorescence was demonstrated to localize to the cytosol, while co-expressing PNY-GFP with KNAT1 or STM resulted in nuclear localization (Bhatt et al., 2004). Recently, other researchers found that ATH1-GFP and PNY-GFP alone localize to the cytosol and nucleus, while after heterodimeriztion of these BEL1-like proteins with STM they become completely nuclear localized (Rutjens et al., 2009).  1.5 Arabidopsis OVATE family proteins Arabidopsis OVATE FAMILY PROTEINS (OFPs) were reported as novel transcriptional regulators that interact with TALE proteins by protein-protein interactions to form an interaction network (Hackbusch et al., 2005). OFPs contain a conserved C-terminal OVATE domain of approximately 70 amino acids. There are 18 OFP genes in Arabidopsis, and most of them contain a predicted nuclear localization signal but lack DNA binding domains (Hackbusch et al., 2005). Arabidopsis plants overexpressing OVATE FAMILY PROTEIN 1 (OFP1) and OFP4 display reduced aerial organ size and abnormal organ shapes (Wang et al., 2007; Li et al., submitted). OFP1 and OFP4 act as strong transcriptional repressors (Wang et al., 2007) and interact with KNAT7 both in yeast (Hackbusch et al., 2005) and in planta (Li et al., submitted). In addition OFP1 and OFP4 interaction with KNAT7 enhances the transcriptional repression activity of KNAT7 (Li et al., submitted). The ofp4 mutant and ofp1ofp4 double mutant display irregular xylem (irx) phenotypes similar to those found in knat7 (Li et al., submitted), and the OFP4 overexpression phenotypes are suppressed in a knat7 mutant, suggesting that a KNAT7-OFP4 12  complex is required both for aspects of secondary wall formation and other developmental processes. As mentioned above, a BLH-KNOX TALE complex containing OFP5 appears to be essential for normal development and cell specification in the Arabidopsis embryo sac (Pagnussat et al., 2007).  1.6 Summary of background data KNAT 7 was identified by expression profiling as a candidate transcription factor that could regulate secondary wall synthesis in xylem and interfascicular fibers during Arabidopsis inflorescence stem development (Ehlting et al., 2005). A poplar KNAT7 ortholog was identified and shows increased expression during secondary wall deposition during wood formation (Li, 2008). KNAT7 loss-of-function mutants show collapsed vessels in vascular bundles (Brown et al., 2005; Li, 2008), and increased interfascicular fiber cell wall thickness (Li, 2008), while KNAT7 overexpression lines under the control of the parsley 4CL1 promoter show decreased interfascicular fiber cell wall thickness (Li, 2008). Further work has shown that KNAT7 is the direct target of the SND1 master regulator (Zhong et al., 2008) and is positioned downstream of MYB46 (Ko et al., 2009), but KNAT7 targets are not known. As discussed above, selective interactions between KNOX and BLH proteins are required in some cases for site-specific DNA binding and for nuclear localization of the transcription factors. Although heterodimeric complexes between TALE homeodomain proteins regulating developmental processes in plants are well characterized, the majority of them involve Class 1 KNOX proteins, and the partners of Class 2 KNOX proteins are poorly understood. The study of Hackbusch (2005) presents a comprehensive analysis of TALE protein interactions, showing that KNAT7 and BLH5, BLH7, ATH1 interact specifically in vitro, and also interact with a subset of OFP proteins. BHL5 shows a similar expression pattern to KNAT7 in association with secondary cell wall deposition (Ehlting et al., 2005), but BLH6 and BLH10 expression is up-regulated within 6 hours of MYB46 induction, together with KNAT7 (Ko et al., 2009), suggesting that they could function together.  13  1.7 Research objectives Although several BLH proteins have been shown to interact with KNAT7 in vitro, there is no information about the contribution of BLHs to secondary wall biosynthesis. Based on studies from previous papers and the work of our lab, we know that KNAT7 acts as a transcriptional repressor to regulate the secondary wall formation in coordination with OFPs. This study is focused on BLH1, BLH5, BLH6, BLH7, BLH10 and ATH1 as candidate members of a complex containing KNAT7 and OFPs, similar to the KNOX-BLH-OVATE complex recently shown to regulate egg cell development in Arabidopsis (Pagnussat et al., 2007). My research goal was to identify the possible member (s) of a KNAT7-BLH complex and investigate the function (s) of such potential KNAT7 interacting BLH partner (s).                  14  Chapter 2. Identification of BLH members of a putative KNAT7-BLH-OFP complex regulating secondary wall formation in Arabidopsis  2.1 Introduction This chapter presents a study aimed at identification of possible BEL1-LIKE HOMEODOMAIN (BLH) members of a hypothesized KNAT7-BLH-OFP complex involved in secondary cell wall formation. The Arabidopsis KNOX gene KNAT7 has been identified in expression profiling and other experiments as a member of a transcription factor network regulating secondary wall formation during xylem and fiber cell differentiation in Arabidopsis inflorescence stems (Ehlting et al., 2005; Zhong et al., 2008). knat7 mutants display an irregular xylem (irx) phenotype (Brown et al., 2005) as well as increased fiber wall thickness in Arabidopsis inflorescence stems (Li, 2008), suggesting defects in secondary wall composition. Yeast two hybrid assays showed that KNAT7 interacts with members of the Ovate Family Protein (OFP) transcription co-regulators (Hackbusch et al., 2005; Li et al., submitted), and the KNAT7-OFP1 and KNAT7-OFP4 interactions were confirmed by targeted yeast two hybrid assays and bimolecular fluorescence complementation analyses in planta (Li et al., submitted). This work also showed that interaction with OFP1 or OFP4 enhances KNAT7 transcriptional repression activity. Furthermore, an ofp4 mutant exhibits similar cell wall phenotypes as knat7, and the pleiotropic effects of OFP1 and OFP4 overexpression depend upon KNAT7 function (Li et al., submitted).  Co-expression analysis and yeast two hybrid analyses (Hackbusch et al., 2005) suggest that BEL1-LIKE HOMEODOMAIN (BLH) transcription factors could be part of a KNOX-BLH-OVATE transcription factor complex regulating aspects of secondary cell wall formation, together with KNAT7 and OFP1/4. In this chapter I used bioinformatic approaches to identify possible KNAT7 and/or OFP interacting BLH proteins and investigated the functional interactions through yeast two-hybrid and in planta bimolecular fluorescence complementation analyses. This work identified a BLH partner that specifically interacts with KNAT7. 15  2.2 Materials and methods  2.2.1 Phylogenetic analysis Full-length amino acid sequences of 13 members of the Arabidopsis BLH family were downloaded from TAIR (The Arabidopsis Information Resource, http://www.arabidopsis.org/). The homologous sequences in other plants were identified by using BLAST (Basic Local Alignment Search Tool, Altschul et al., 1990) to search genome databases of Populus trichocarpa, Oryza sativa, Ricinus communis, and Physcomitrella patens at the JGI (Joint Genome Institute, http://genome.jgi-psf.org/poplar/poplar.home. html) and NCBI ( National Center for Biotechnology Information, http://blast.ncbi.nlm.nih.gov/Blast.cgi). An alignment of all amino acid sequences was created using MUSCLE v3.6 (Edgar, 2004) with default alignment parameters. The alignment was manually adjusted using Se-Al v2.0 (http://iubio.bio.indiana.edu/soft/iubionew/molbio/dna/analysis/Pist/ main.html ).  Three kinds of phylogenetic analytical methods were applied in this study: distance-based bootstrapping, Maximum Likelihood (ML) and Bayesian Inference (BI). To reconstruct the phylogenetic trees, PHYLIP v3.68 (Retief, 2000) was employed in distance-based analyses, RAxML v7.0.3 (Stamatakis, 2006) was used in ML analyses, while MrBayes v2.1.3 (Huelsenbeck and Ronquist, 2001) was used in the BI method. ProtTest v2.1 (Abascal et al., 2005) was conducted to test evolutionary models for the amino acid alignments.  In distance-based bootstrapping analyses, 500 replicates of bootstrap analysis were completed first, followed by 500 replicates of distance analysis with the JTT+G+I+F model. The consensus tree was generated by consensus calculating. In the ML analyses, the model of JTT+G+I+F selected by ProtTest was applied with 100 heuristic searches followed by 500 replicates of bootstrap analysis. In BI analyses the number of Markov chains was four. The number of generations was 10000, and the sampling frequency was one tree per 100 generations. The 16  substitution rate was set as GTR model invoking a gamma rate distribution and a proportion of invariant sites. The trees that were generated by three different methods were visualized using Tree View (http://taxonomy.zoology.gla.ac. uk/rod/treeview.html), then exported as jpeg format before being imported into Microsoft Word (Microsoft Corporation).  2.2.2 Plant material and growth conditions Arabidopsis thaliana (Arabidopsis) ecotype Columbia-0 was used as wild type throughout, and all mutants and transgenic lines are in this background. For seedlings used for phenotypic and genotypic analysis, seeds were surface-sterilized by 75% ethanol and grown on Murashige and Skoog (MS) Basal Salts with minimal organics (Sigma) and 1% sucrose, solidified with 0.7%(w/v) agar (Sigma). Seeds were cold-treated at 4℃ in dark for 48 hours, then moved to 22℃ under a 16/8 hr (light/dark) photoperiod and constant white light at approximately 120µmol m -2 sec -1  for seed germination and seedling growth for 7-10 days. For some experiments, seedlings were transferred into soil for further research.  For protoplast transfection, approximately 20 Col-0 seeds were germinated and grown in 2×2 inch pots containing a moist of Sunshine Mix #4 (SunGro Horticulture Canada Ltd, http://www.sungro.com) with 16/8 hr (light/dark) at approximately 120µmol m -2 sec -1  at 22℃. Leaves from 3-4 week old plants were used for protoplast isolation.  2.2.3 Generating split YFP and bait and prey of yeast two-hybrid constructs Clones of the complete open reading frames of BLH1, BLH5, BLH6, BLH7, BLH10, ATH1, KNAT7, OFP1 and OFP4 were isolated from cDNA prepared from Arabidopsis inflorescence stem mRNA as previously described (Li, 2008). The clones of BLH candidates were transferred to the Gateway TM  compatible destination vector pSAT4-DEST- n(174)EYFP-C1 (Citovsky et al., 2006) by LR-mediated recombination,to generate fusions to the N-terminal half of the yellow fluorescent protein (YFP). KNAT7, OFP1 and OFP4 were cloned into pSAT5- DEST-c(175-end) 17  EYFP-C1 (Citovsky et al., 2006) to generate fusions to the C-terminal half of YFP. BLH6 and BLH5 inserts were also cloned into pSAT6-EYFP-N1 (Citovsky et al., 2006) to generate C-terminal fusions to full-length YFP.  Truncated KNAT7 clones encoding different domains (KNOX1 domain, KNOX2 domain, MEINOX domain and homeodomian) were generated from a KNAT7 plasmid by PCR amplification. All the primers used in this study are summarized in Table 2.1. These clones were introduced into a Gateway TM  entry vector pCR8 (Invitrogen). Each clone was transferred to Gateway TM  compatible yeast two-hybrid bait and prey destination vectors (Invitrogen) by LR-mediated cloning. Clones of BLH6, BLH7, KNAT7, OFP1 and OFP4 open reading frames were introduced into yeast two-hybrid bait and prey vectors using the same strategy.  Table 2.1 Primer sequences to generate truncated KNAT7 clones for yeast two-hybrid assay. Constructs  Primers ADH1:Gal4 DBD-KNAT7 ATGCAAGAAGCGGCACTAGG TTAGTGTTTGCGCTTGGACTT ADH1:Gal4 AD-KNAT7 ADH1:Gal4 DBD- KNOX1 ATGCAAGAAGCGGCACTAGG CTAAGCGTAAGAACGGAGAAG ADH1:Gal4 AD-KNOX1 ADH1:Gal4 DBD-KNOX2 ATGCGTTCTTACGCTTCCACG TTACCCTTCTCCTAAAGTTGC ADH1:Gal4 AD-KNOX2 ADH1:Gal4 DBD-MEINOX ATGCAAGAAGCGGCACTAGG TTACCCTTCTCCTAAAGTTGC ADH1:Gal4 AD-MEINOX ADH1:Gal4 DBD-ELK-Homeodomain ATGGAAAGAGTCAGACAAGAA TTAGTGTTTGCGCTTGGACTT ADH1:Gal4 AD-ELK-Homeodomain ADH1:Gal4 DBD-BLH6 ATGGAGAATTATCCAGAAACACA TCAAGCTACAAAATCATGTACCAA ADH1:Gal4 AD-BLH6 ADH1:Gal4 DBD-OFP1 ATGGGTAATAACTATCGGTTTAAGC TTATTTGGAATGGGGTGGTGGAAG ADH1:Gal4 AD-OFP1 ADH1:Gal4 DBD-OFP4 ATGAGGAACTATAAGTTAAGA CTACTTCGATGCAAATGTA ADH1:Gal4 AD-OFP4 ADH1:Gal4 DBD-BLH7 ATGGCCACTTATTACAAAACTGG TCAAGCTACAAAATCATGCAACAA ADH1:Gal4 AD-BLH7  18  2.2.4 Bimolecular Fluorescence Complementation (BiFC) assay in Arabidopsis mesophyll protoplasts Arabidopsis leaf mesophyll protoplast cells were isolated and transfected as described previously (Wang et al., 2007). In brief, protoplasts were isolated from rosette leaves of 3-week-old plants. Constructs prepared as described above were transfected into protoplasts and incubated in the dark for 18-20 hr to allow expression of the introduced genes. The YFP fluorescence was examined and photographed using an Olympus AX70 light microscope.  2.2.5 Yeast two hybrid assay The interaction between OFP1/OFP4/KNAT7 and BLH6/BLH7 were tested by using ProQuest Two-Hybrid System (Invitrogen) as described previously (Guo et al., 2009). OFP1, OFP4, KNAT7, KNOX1 domain, KNOX2 domain, MEINOX domain and Homeodomain were cloned into prey vector (pDEST22), and BLH6 (and BLH7 were cloned into bait vector (pDEST32). The known interaction between MYB75 and TT8 (Zimmermann et al., 2004a) was used as a positive control. Coexpression of BLH6 and BLH7 and the empty bait vector was used as a negative control. The ability of yeast transformants to grow on minimal SD (Synthetic Dextrose) medium lacking both leucine and tryptophan is indicative of the presence of both prey and bait constructs. Positive interactions were identified by their ability to activate HIS3, URA3, or LacZ genes, assayed by the appearance of yeast colonies on triple-selection minimal SD medium lacking leucine, tryptophan and uracil or histidine, or a by blue color when assayed with X-gal (5- bromo-4-chloro-3-indolyl-β- D-galactopyranoside).  2.3 Results  2.3.1 Phylogenetic analysis of BELL family members in different plant species Using amino acid sequences of thirteen members of the Arabidopsis thaliana BLH gene family as a query in BLAST searches, a set of 26 homologous proteins from other species was obtained, 19  including five homologous sequences from Oryza sativa, eighteen homologous sequences from Populus trichocarpa, two homologous sequences from Physcomitrella patens and one homologous sequence of Ricinus communis. These sequences, ranging in sizes from about 500 to 800 amino acids, are shown in Table 2.2 and were used as the 39 input sequences to generate phylogenetic trees.  Table 2.2 Species names and NCBI reference sequence numbers of the 39 BLH sequences included in this study.   Figure 2.1A shows the phylogenetic tree constructed using Bayesian Inference (BI) method with posterior probabilities indicated near the branches. The topology of this tree is similar to the tree 20  reconstructed by Maximum Likelihood (JTT+G+I+F model) shown in Figure 2.1B with bootstrap values indicated near the branches. Furthermore, the consensus tree (Figure 2.1 C) reconstructed using distance-based bootstrapping analyses with bootstrap values indicated near the branches is consistent with the BI and ML-JTT trees.  According to the alignments, the homologous sequences obtained from Populus trichocarpa, Oryza sativa, Ricinus communis and Physcomitrella patens contained a conserved SKY domain, BELL domain and Homeodomain (data not shown). This result suggests that they all belong to BLH family. It also points out that BLH genes are ancient, as not only vascular plants but also the moss Physcomitrella contains BLH homologs                  21  Figure 2.1 Phylogenetic analyses of BEL1-like homeodomain proteins. (A) Results of Bayesian analysis of BEL1-like homeodomain proteins. Posterior probabilities are indicated near branches. (B) Phylogenetic tree of BEL1-like homeodomain proteins constructed by ML (JTT model) using RAxML. Bootstrap values are indicated near branches. (C) Distance analysis of BEL1-like homeodomain proteins using PHYLIP.  Bootstrap values are indicated near branches. BLAST searches were used to identify the homologous sequences from Arabidopsis, Populus trichocarpa, Oryza sativa, Ricinus communis and Physcomitrella patens. See Materials and Methods for details.  A  A  A A A 22    2.3.2 In silico expression patterns of candidate BLH genes in Arabidopsis Genes encoding Arabidopsis BLH proteins that are candidates for interaction with KNAT7 would be expected to share a common or overlapping expression pattern with KNAT7. In order to examine where the Arabidopsis BLH genes are expressed, and whether their expressions overlaps with the expression of KNAT7 and OFPs, gene expression data from publicly available   B C 23  microarray experiments was queried using both GENEVESTIGATOR v3 (Tomas et al., 2008); https://www.genevestigator.com/gv/ index.jsp) and BAR (The Bio-Array Resource for plant functional genomics, http://bbc.botany.utoronto.ca/) sites for analysis. The data are summarized in Figure 2.2 and Figure 2.3.                        24  Figure 2.2 Relative Arabidopsis BLH gene expression levels from anatomy in Genevestigator v3. Darker blue indicates higher expression.    25  Figure 2.3 Relative gene expression in different organs from the developmental map in BAR   Figure 2.2 shows a graphical summary of in silico analysis of relative expression levels of 13 members of BLH family genes as well as KNAT7 and OFP1 (there is no data for OFP4) in different organs, cells and developmental stages retrieved from the Anatomy expression set in GENEVESTIGATOR v3 site based on the data from 3110 Affymetrix ATH1 22K arrays. Many BLH genes have high transcript levels in seed coat, stem or the xylem and cork of hypocotyls, which overlap the expression pattern of KNAT7, such as BLH5, BLH6, BLH7, BLH9 and BLH10. However the expression pattern of BLH7 seems to be more general and widely distributed.  Figure 2.3 displays an in silico analysis of the expression levels of the 15 transcription factor genes in different organs from the “Developmental Map” in Arabidopsis eFP Browser at BAR. A comparison of the relative expression levels of 15 genes in Figure 2.3 shows that transcripts of BLH1, BLH6 and KNAT7 are more abundant in the second internode of stem than the first node, which indicates these genes are more highly expressed in stem regions undergoing secondary cell wall synthesis. OFP1 and KNAT7 are expressed at elevated levels in hypocotyls, and BLH1, BLH6, BLH7, BLH9 and ATH1 exhibit relatively high expression in this organ. 0 100 200 300 400 500 600 700 800 1st Node Stem, 2nd Internode Hypocotyl Root Ex pr es si on  l ev el OFP1 BLH1 BLH2 BLH3 BLH4 BLH5 BLH6 BLH7 BLH8 BLH9 BLH10 BLH11 BEL1 ATH1 KNAT7 26  2.3.3 Bioinformatic and literature-based identification of potential KNAT7 interacting BLH proteins According to a large-scale yeast two-hybrid assay (Hackbusch et al., 2005), BLH5, BLH7 and ATH1 interact with KNAT7 in yeast. BLH6 and BLH10 have been shown to be to the direct targets of MYB46 together with KNAT7 (Ko et al., 2009), which suggests that BLH6 and BLH10 are also interesting candidates for KNAT7 interaction. BHL5 shows a similar expression pattern to KNAT7 in association with secondary cell wall deposition (Ehlting et al., 2005). Furthermore, BLH1 is the BLH protein that shows highest similarity to BLH5 (Roeder et al., 2003). In summary, the list of potential BLH components in a putative KNAT7-BLH complex includes BLH1, BLH5, BLH6, BLH7, BLH10 and ATH1.  2.3.4 BiFC screen for KNAT7 interacting BLH proteins  2.3.4.1 Subcellular localization of BLH candidates KNAT7 nuclear localization has been reported by Zhong et al. (2008) and Li et al., (submitted). Recently, it has been shown that an ATH1-GFP fusion is found in both the cytosol and nucleus, while after heterodimeriztion with STM, a KNOX homeodomain protein, it becomes completely nuclear localized (Rutjens et al., 2009). BLH1 was shown to be located only in the nucleus but not in the nucleolus (Hackbusch et al., 2005). To test their subcellular localization, Arabidopsis protoplasts were transfected with C-terminal fusions BLH5 and BLH6 to full-length enhanced yellow fluorescent protein (EYFP). This analysis revealed that BLH5-F-EYFP and BLH6-F-EYFP fluorescence was primarily localized to the nuclei of transformed protoplasts, similarly to KNAT7-F-EYFP (Figure 2.4). However, some BLH6-F-EYFP fluorescence appeared to be present in the cytoplasm.    27  Figure 2.4 Subcellular localization of BLH candidates. Top row, bright field images of representative protoplasts transfected with BLH5F-EYFP, BLH6-F-EYFP, KNAT7-F-EYFP under the control of the 35S promoter, and F-EYFP alone under the control of the 35S promoter. Bottom row, images of the same protoplasts obtained by imaging YFP fluorescence.   2.3.4.2 BLH6 interacts with KNAT7 in planta Bimolecular Fluorescence Complementation (BiFC) (Hu et al., 2002) was used to assay protein-protein interactions between BLH candidates and KNAT7 in planta. The BLH candidates, KNAT7 and OFPs were fused to N or C terminal (N/C-EYFP) fragments of the enhanced yellow fluorescent protein (EYFP). The split EYFPs were fused to both the C- and N- termini of each gene (Figure 2.5). Neither of these fragments is capable of fluorescence alone. As controls, fusions of several proteins to full EYFP were made or were available. Different combinations of fusion constructs were used to transform Arabidopsis mesophyll protoplasts using an Arabidopsis leaf mesophyll protoplast transient expression system in order to test the ability of each BLH candidate to interact with KNAT7.  28  Figure 2.5 Schematic diagram representing two sets of BiFC constructs. All the constructs are driven by cauliflower mosaic virus (CaMV) 35S promoter. Fusions of KNAT7, BLH6 and BLH5 to full EYFP were used as control. The BLH1, BLH5, BLH6, BLH7, BLH10 and ATH1 were fused to N-EYFP, while KNAT7, OFP1 and OFP4 were fused to C-EYFP. The difference between the two sets of constructs is the location of split EYFP. The “+” means the cotransformation of Arabidopsis mesophyll protoplasts with BLH candidates and KNAT7, or BLH6 and OFP1/OFP4.   Representative positive and negative data are shown in Figure 2.6. Among all BLH candidates (BLH1, BLH5, BLH6, BLH7, BLH10 and ATH1) tested for interaction with KNAT7 in different combinations, only the co-expression of KNAT7: C-EYFP with BLH6:N-EYFP or C-EYFP: KNAT7 with N-EYFP:BLH6 generated nuclear localized fluorescence (Figure 2.6). Interestingly, the BLH6 paralog BLH7 (Figures, 2.1 A, B, C) showed no evidence of interaction with KNAT7 (data not shown), suggesting a high level of specificity in BLH-KNAT7 interactions. In addition, the interaction between BLH6 and OFP4/OFP1 was tested, but the interaction was undetected by BiFC (data not shown).    29  Figure 2.6 BLH6 interacts with KNAT7 in planta Left column, bright field images of representative protoplasts co-transfected with KNAT7-C-EYFP and BLH6-N-EYFP, KNAT7-C-EYFP and BLH5-N-EYFP, EMPTY-C-EYFP and BLH6-N-EYFP, MEINOX Domain-C-EYFP and BLH6-C-EYFP. Right column, images of the same protoplasts obtained by imaging YFP fluorescence.   2.3.4.3 BLH6 interacts with the KNAT7 MEINOX domain While BLH and KNOX are both plant specific TALE homeodomain proteins, BLH and KNOX proteins differ greatly in the N terminal regions (Bharathan et al., 1997). There is a MEINOX domain at the N terminus of KNOX proteins characterized by an amphipathic helix containing 9-13 turns, with most of the conserved residues on one face of the helix (Bharathan et al., 1997). An ELK-HD (Homeodomain) domain at the C-terminus of KNOX proteins is highly conserved within the family and folds into three α-helices. The heterodimers formed by BLH and KNOX proteins investigated to date require the interactions between MEINOX domain of KNOX 30  proteins and the SKY and BELL domains upstream of homeodomain of BLH proteins (Mukherjee and Bürglin, 2007; Hay and Tsiantis, 2009; Mukherjee et al., 2009).  BiFC was used to test the interaction between the KNAT7 MEINOX domain with BLH6 in planta. Figure 2.6 reveals that coexpression of BLH6: N-EYFP and KNAT7 MEINOX Domain: C-EYF in protoplasts resulted in fluorescence complementation, indicating interaction of BLH6 with the KNAT7 MEINOX domain. While fluorescence was mainly in the nucleus, it was weak compared to fluorescence generated by BLH6: N-EYFP and KNAT7:C-EYFP interaction, which was strongly localized to the nucleus (Figure 2.6). The difference between the BiFC fluorescence signals was more apparent after increasing the brightness of images, shown in Figure 2.7. While the KNAT7- F-EYFP and KNAT7: C-EYFP with BLH6: N-EYFP was still only observed in nuclei in these images, the weaker fluorescence generated by the interaction of BLH6: N-EYFP and MEINOX Domain: C-EYFP was clearly detected in the cytoplasm as well, and BLH6-F-EYFP generated fluorescence was also observed outside of the nucleus.  These results suggest that BLH6 requires interaction with KNAT7 to direct exclusive nuclear localization. Since two KNOX nuclear localization signal (NLS) sequences are found in the ELK-HD domain of KNOX proteins (Meisel and Lam, 1996), the KNAT7 MEINOX domain itself may be poorly targeted to the nucleus, resulting in poor nuclear localization of the KNAT7 MEINOX-BLH6 complex.        31  Figure 2.7 BLH6 interacts with MEINOX domain of KNAT7 in planta Top row, bright field images of representative protoplasts transfected with BLH6-F-EYFP, KNAT7-F-EYFP under the control of the 35S promoter. Co- transfected with MEINOX Domian-C-EYFP and BLH6-N-EYFP, KNAT7-C-EYFP and BLH6-N-EYFP. Bottom row, images of the same protoplasts obtained by imaging YFP fluorescence with increased brightness.   2.3.5 Yeast two hybrid assay of BLH- and OFP-KNAT7 interaction candidates The interactions between BLH6 and KNAT7/OFP1 were not reported in a large-scale yeast two-hybrid assay (Hackbusch et al., 2005), but BLH6 was reported to interact with OFP4. As BLH6 was the only interacting partner of KNAT7 selected from BiFC screening, these interactions were tested again using our yeast two-hybrid system. As BLH6 is paralogous to BLH7, the interactions between BLH7 with KNAT7, OFP1 and OFP4 were also tested by Y2H even though we did not find any interactions between BLH7 and KNAT7 in the BiFC assay. KNAT7, BLH6, BLH7, OFP1, and OFP4 DNA binding (DB) and activation domain (AD) fusion protein constructs were generated. The ability of co-transformed yeast strains to activate expression of the URA3 nutritional marker gene and the LacZ gene was tested using a growth assay on drop-out media (Ura-) or by the generation of blue color using X-gal (5-bromo-4-chloro-3-indolyl-β-D- galactopyranoside) as the substrate for the LacZ gene, to test for protein-protein interactions. The data presented in Figure 2.8 shows that BLH6 interacts with 32  KNAT7, but not with OFP4 or OFP1, and that there was no detectable interaction of BLH7 with KNAT7, OFP1 or OFP4.  Figure 2.8 Yeast two-hybrid assay of BLH6-, or BLH7- and OFP-KNAT7 interaction candidates. Assay of AD-KNAT7, AD-OFP1, AD-OFP4 interaction with BD-BLH6, or BD-BLH7 using two reporter genes, URA3 (assayed in Ura -  media)and LacZ (assayed using X-gal), with growth controls in Leu -  Trp -  media. MYB75-TT8 interaction was used as a positive control, and BD-BLH –empty prey vector (AD-) interaction was used as a negative control.   2.3.5.1 BLH6 interacts with the MEINOX domain of KNAT7 Yeast two hybrid system was used to test the function of the KNAT7 MEINOX domain in interaction with BLH6, as predicted by work on other KNOX proteins (Burglin, 1997; Mukherjee and Bürglin, 2007) and from BiFC results (Figures 2.6 and 2.7). Four KNAT7 domains, KNOX1, KNOX2, MEINOX (KNOX1 and KNOX2), and the homeodomain were fused to the activation domain (AD) in yeast two-hybrid vectors, and tested for their abilities to interact with a BD (DNA binding domain) -BLH6 fusion (Figure 2.9B). The KNAT7 KNOX2 and MEINOX domains, but no other domains, were able to interact strongly with BLH6, suggesting that the KNOX2 portion of the MEINOX domain is sufficient for KNAT7 interaction with BLH6 33  proteins.  Figure 2.9 BLH6 interacts with the MEINOX domain of KNAT7. (A) Schematic diagram of KNAT7 with four different fragments, KNOX1, KNOX2, MEINOX (KNOX1+KNOX2) domain and Homeodomain. (B) Assay of AD-KNAT7 fragments interaction with BD-BLH6 using two reporter genes, URA3 (assayed in Ura -  media) and LacZ (assayed on X-gal membrane), with growth controls in Leu -  Trp -  media. MYB75-TT8 interaction was used as a positive control, and BD-BLH6 –empty prey vector (AD-) interaction was used as a negative control   B A 34  2.3.5.2 OFP4 interacts with the homeodomain of KNAT7 To gain further insight into the nature of a putative KNAT7-BLH6-OFP complex, the ability of KNAT7 to interact with OFP1 and OFP4, earlier reported by Hackbusch et al. (2005), was re-tested using our yeast two-hybrid system. Figure 2.10 indicates that KNAT7 fused to DNA-binding domain (BD) interacts with OFP4 fused to Activation Domain (AD) in yeast, based on growth on His -  and Ura -  selective media, comparable to that of the MYB75-TT8 interaction (Zimmermann et al., 2004b) used as a positive control. Using similar criteria, detectable but weaker interaction (growth on His -  but not Ura -  selective media) was found between KNAT7 and OFP1. Neither interaction resulted in detectable ß-galactosidase activity, using LacZ gene expression as a read-out, in contrast to the MYB75-TT8 interaction (not shown).  Figure 2.10 KNAT7 interacts with OFP1 and OFP4 Assay of BD-KNAT7 interaction with AD-OFP1 and AD-OFP4 using two reporter genes, URA3 (assayed on Ura -  media) and HIS3 (assayed in His -  media), with growth controls in Leu -  Trp -  media. Growth on His -  media and absence of growth on Ura -  media is indicative of a weak protein-protein interaction. MYB75-TT8 interaction was used as a positive control, and BD-KNAT7 – AD empty vector interaction was used as a negative control.  35  It was demonstrated that the protein-protein interaction between certain KNOX proteins and OFP is mediated by homeodomain and ovate domain, respectively (Hackbusch et al., 2005). To confirm this directly for the KNAT7-OFP1 and –OFP4 interactions, the set of four fusions of KNAT7 truncated domains (KNOX1, KNOX2, MEINOX, and Homeodomain) fused to the GAL4 DB was employed and cotranformed with AD-OFP1 and –OFP4 fusions (Figure 2.11). The KNAT7 homeodomain, but no other domain, was able to interact with OFP4 and showed a weak interaction with OFP1, suggesting that the homeodomain is sufficient for KNAT7 interaction with OFP proteins.  Figure 2.11 OFP4 interacts with the homeodomain of KNAT7 Assay of BD-KNAT7 fragments interaction with AD-OFP1 and AD-OFP4 using two reporter genes, URA3 (assayed on Ura -  media) and HIS3 (assayed in His -  media), with growth controls in Leu -  Trp -  media. Growth on His -  media and absence of growth on Ura -  media is indicative of weak protein-protein interactions. MYB75-TTA8 interaction was used as a positive control. The positive and negative controls are shown in Figure 2.10.    36  2.4 Discussion In this chapter, I tested the hypothesis that KNAT7 interacts with one or more BLH proteins, as part of a putative KNAT7-BLH-OFP complex that could play a role in the regulation of secondary wall biosynthesis. In order to identify potential Arabidopsis BLH proteins as candidates for interaction with KNAT7, I first examined the structure of the BLH gene family in Arabidopsis and other plant species with fully sequenced genomes using phylogenetic methods. Homologs of Arabidopsis BLH genes were found in poplar, rice, and Physcomitrella, and their inferred phylogenetic relationships to Arabidopsis BLH paralogs were consistent among three phylogenetic trees generated using different methods. This result indicates they are related by common ancestry, and homologous genes in other species are likely to share the same function or activity as the Arabidopsis genes. Considering the functions of some Arabidopsis BLH genes such as BEL1, ATH1 and BLH1 have been already fully documented (Reiser et al., 1995; Byrne et al., 2003; Roeder et al., 2003; Bhatt et al., 2004; Kumar et al., 2007; Pagnussat et al., 2007; Proveniers et al., 2007; Yu et al., 2009), the apparent orthologous genes in poplar will probably share these functions. For example, Pop_gwIII246 and Pop_gw8865 appear orthologous to AtBEL1, and may have AtBEL1 function, but have been duplicated in the poplar lineage, consistent with the whole genome duplication event specific to the Salicaceae (Tuskan et al., 2006). At_ATH1 also has two duplicated orthologous genes, Pop_II000155 and Pop_estVI0194. In addition, BLH1 has two apparent poplar orthologs Pop_estVI1097 and Pop_gw1XVI12211, as well as one from Ricinus communis (Rc_223536621).  Based on the phylogenetic trees shown in Figures 2.1 A, B and C, several pairs of Arabidopsis BLH paralogs are evident, including At_BLH8 and At_BLH9, At_BLH4 and At_BLH2, At_BLH7 and At_BLH6, At_BLH10 and At_BLH3. This result is consistent with a previous study (Kumar, 2006), except that in the neighbour joining tree in that study, At_BLH5 was inferred to be paralogous to At_BLH1. With the exception of At_BLH10 and At_BLH3, each of these Arabidopis paralog pairs has pontential poplar orthologs, suggesting the potential for 37  conserved function in these two species. My analysis indicates that At_BLH5 does not have any paralogs or apparent orthologs in poplar, suggesting the possibility of a lineage-specific function for At_BLH5.  Based on the in silico analysis of relative expression levels, some of the 13 members of the Arabidopsis BLH gene family have similar expression patterns as KNAT7, including BLH1, BLH5, BLH6, BLH7, BLH9 and BLH10, especially in the second internode of stem and the xylem and cork of hypocotyls, which contain tissues with the cells undergoing secondary cell wall formation. More research in the future will be needed to understand the expression patterns of candidate BLH genes, for example, using promoter: GUS fusion constructs to track gene expression levels in specific tissues.  Based on these results, I tested a number of potential BLH-KNAT7 interactions by BiFC and yeast two hybrid analyses. BLH6 was the only interacting partner identified from these analyses. Even though the protein sequence of BLH7 shares 68% similarity with BLH6, the BLH7-KNAT7 interaction was undetectable in planta and in yeast. Also, BLH7 did not interact with OFP1 in yeast, which is consistent with results reported by Hackbusch et al. (2005) in planta. However, it is possible that BLH7 could act redundantly with BLH6 because of their overlapping expression patterns and sequence homology. In total, I could not confirm several of the protein-protein interactions predicted by Hackbusch et al. (2005) on the basis of a large screen of KNOX, BLH, and OFP proteins, while I identified new interactions not detected in that study. This points out the need to more thoroughly test individual protein-protein interactions predicted from large-scale screens.  It has been previously described that the MEINOX domain of STM and the BELL domain of BLH3 are sufficient for interaction in vitro and in planta (Cole et al., 2006). Both the BiFC and yeast two-hybrid data revealed that MEINOX domain of KNAT7 is essential and sufficient for 38  interaction with BLH6. If the MEINOX domain provides a central backbone for an assembly of different protein complexes in plants, such functional constraints could easily explain its conservation during evolution. The homeodomain in plant KNOX proteins has been shown to contain two functional NLS sequences (Meisel and Lam, 1996). These NLS seem to be essential for localization of the heterodimer formed between KNAT7 and BLH6, as the interaction between MEINOX domain and BLH6 were not only observed in the nucleus but also cytoplasm (Figures 2.6 and 2.7). While the interaction between KNAT7 and BLH6 was only detected in the nucleus, BLH6 alone showed a less specific pattern of nuclear localization (Figures 2.4 and 2.7). Taken together, these data suggest that efficient targeting of the KNAT7-BLH6 complex to the nucleus requires the KNAT7 interaction partner.  I verified KNAT7-OFP4 and KNAT7-OFP1 interactions previously identified by BiFC (Li et al., submitted) by using yeast two-hybrid assays, but found only weak interaction between KNAT7 and OFP1. In addition, my data show that the KNAT7 homeodomain seems to mediate the interaction of KNAT7 with OFP4. However, in terms of BiFC assay carried out in Arabidopsis leaf mesophyll protoplasts, KNAT7-OFP1 and KNAT7-OFP4 interactions appeared equally strong (Li et al., submitted). In addition, both OFP1 and OFP4 were able to enhance KNAT7 repression activity in the protoplast system (Li et al., submitted), consistent with observation that the phenotypes of OFP4 and OFP1 overexpression mutants are dependent on KNAT7 function. It is possible that there is another member of this complex, such as BLH6, present in protoplasts, stabilizing OFP-KNAT7 interactions in vivo, thus resulting in stronger OFP1-KNAT7 in planta interaction than observed in yeast.  Based on the protein-protein interaction data presented in this chapter, and supporting data from Li et al. (submitted) on OFP1/4-KNAT7 interaction, a model for KNAT7-OFP-BLH6 complex can be proposed as shown in Figure 2.14. As BLH6 interacts with the KNAT7 MEINOX domain and OFPs interact with its homeodomain, KNAT7 may act as a scaffold that allows for 39  interaction with both BLH6 and OFP partners, without direct BLH6-OFP interaction as found in our in planta and in vitro assays. Further research is needed to confirm the existence of the complex, such as yeast three-hybrid assay, immunoprecipitation, and/or pull-down assays.  Figure 2.12 Proposed KNAT7-OFP-BLH6 complex model regulating secondary cell wall. KNAT7 could act as a bridge connecting BLH6 and OFPs. The interaction between KNAT7 and BLH6 is mediated by MEINOX Domain, while OFPs interact with KNAT7 through Homeodomain.              40  Chapter 3. Investigation of Arabidopsis BLH function in secondary wall formation  3.1 Introduction Arabidopsis BEL1-LIKE homeodomain (BLH) proteins belong to the TALE class of homeodomain proteins which are plant specific proteins. There are 13 BLH genes in Arabidopsis (Smith et al., 2004). The functions of some of them, such as BEL1, BLH1, SAW1, SW2, BLR, PNF and ATH1 have been reported by different groups (Reiser et al., 1995; Byrne et al., 2003; Roeder et al., 2003; Bhatt et al., 2004; Kumar et al., 2007; Pagnussat et al., 2007; Proveniers et al., 2007; Yu et al., 2009).  Although the expression of certain BLH genes appears relatively high in the stem, xylem and cork of hypocotyls (Chapter 2), the functions, if any, of BLHs in secondary cell wall formation are poorly understood. In light of expression profiling (Ehlting et al., 2005) and protein-protein interaction data (Chapter 2), BLH5 and BLH6 were selected as our priority interaction partners with KNAT7 that participate in a KNAT7-BLH-OFP complex. In this study, the goal was to test whether BLH5 or BLH6 play roles in secondary cell wall formation by examining the phenotypes of loss-of-function mutants.  3.2 Material and methods  3.2.1 Plant material and growth conditions Growth conditions for Arabidopsis thaliana ecotype Columbia-0 and T-DNA insertion lines in this background were as described in Section 2.2.2. Regions of 5cm from the bottom part of inflorescence stems from plants were approximately 6-8 week old were used for phenotypic characterizations.   41  3.2.2 T-DNA and reverse transcription PCR T-DNA insertion mutant lines for BLH proteins were obtained from the Arabidopsis Biological Resource Center (http:// Arabidopsis.org). The presence of the T-DNA insertion was examined by PCR using gene specific primer (GATCATGCTAGCAAGACAAACG and TGAAGAATTTATCCGGTTCTG for blh5 and TCAATGGTGGCTATAAGCCTG and TTGGGTACGTTTTTGTTTTCAG for blh6) and T-DNA left border LBa1 (TGGTTCACGTAGTGGGCCATCG). Lines were genotyped to select homozygotes at the insertion site by PCR amplification using a combination of gene specific primers and T-DNA primer and transcriptional levels were tested by semi-quantitative RT-PCR using oligos (ATGGCTGCTTTCTTTCTTGGA and CTAATCCATGATTTGATAAGT for blh5 and ATGGAGAATTATCCAGAAACA and TCAAGCTACAAAATCATGTACC for blh6) spanning the insertion sites.  Total RNA was extracted from 3-week-old rosette leaves or 6-week-old stems of Arabidopsis plants using the RNeasy plant mini kit (Qiagen). Single-strand cDNAs were synthesized via reverse transcription using Omniscript RT reverse transcriptase kit (Qiagen).  3.2.3 Generation of 4CL1:BLH constructs Full-length cDNA clones of the complete open reading frames of BLH5 and BLH6 with BglII and PstI sites at 5’ and 3’ ends were isolated from Arabidopsis cDNA. The products were subsequently digested with BglII and PstI and ligated into the binary vector pSM-2 (Canam et al., 2006) containing the vascular specific 4CL1 (Petroselinum crispum 4-Coumarate:CoA ligase1) promoter (Hauffe et al., 1991). The binary vectors containing 4CL1:BLH5 and 4CL1:BLH6 were confirmed by sequence analysis.  3.2.4 Arabidopsis transformation All transgenic lines were generated by transformation of Arabidopsis Columbia wild type using 42  the Agrobacterium tumefaciens-mediated floral dip method (Clough and Bent, 1998). Single colonies of Agrobacterium strain GV301 containing a binary vector with the proper construct were inoculated into 5 ml LB (Luria-Bertani) medium containing proper antibiotics and grown overnight at 28℃, then transferred to 250 ml of LB medium containing the antibiotics and shaken at 28℃ overnight. The culture was spun for 20 minutes at 4℃ in a SORVALL RC-5C centrifuge using a GS-3 rotor at 3000 rpm. The pellet was resuspended with infiltration medium. The plants were dipped into the medium for 5 minutes and covered with a plastic bag and stored horizontally overnight at room temperature in the dark. The plants were transferred to long-day conditions to allow seed maturation. Seeds were harvested and sown onto MS medium containing 50 µg/ml hygromycin. The healthy seedlings (T1) were planted into soil and grown under long-day condition to generate next generation (T2). The expression levels in T1 individuals were determined by semi-quantitative RT-PCR. T2 seeds were selected on MS medium containing 25 µg/ml hygromycin, homozygotes were picked depending on the ratio of resistant to susceptible individuals.  3.2.5 Toluidine blue staining Fresh inflorescence stem tissues were hand sectioned with the use of the razor blades. Sections were stained directly on the slide in a drop of aqueous 0.02% toluidine blue O (Sigma) for 1 minute, rinsed in water and mounted in a drop of 50% glycerol beneath a coverslip and examined immediately with an Olympus AX70 light microscope.  3.2.6 Phloroglucinol-HCL staining Hand sections of fresh 6-week-old Arabidopsis stems were stained with 1% phloroglucinol (w/v) in concentrated HCl for 5 min and mounted in a drop of 50% glycerol beneath a coverslip and observed and photographed immediately under Olympus AX70 light microscope.   43  3.2.7 Mäule staining Hand sections of fresh 6-week-old Arabidopsis stems were treated for 10 min with 0.5% KMnO4 and rinsed in water. Then sections were treated with 30% HCl until the brown colour disappeared, rinsed in water, mounted in concentrated NH4OH, and examined under Olympus AX70 light microscope.  3.2.8 Generation of a GD-BLH6 construct The full-length open-reading frame (ORF) of BLH6 was amplified by PCR using Arabidopsis cDNA with ClaI sites at 5’ and 3’ ends. The PCR fragment was then digested with ClaI and cloned in frame with an N-terminal Gal4 Binding Domain (GD) tag into the pUC19 vector under the control of the double 35S enhancer promoter of CaMV (Wang et al., 2007). The vector containing GD-BLH6 was confirmed by sequence analysis.  3.2.9 Protoplast transfection assays Arabidopsis leaf mesophyll protoplast cells were isolated and transfected as described in section 2.2.4. Transactivators LD-VP16 and GD-VP16, reporters LexA(2x)-Gal4(2x)GUS and Gal4-35S:GUS were obtained from Dr. Shucai Wang, UBC (Wang et al., 2007). All reporter and effector plasmids used in transfection assays were prepared using the EndoFree Plasmid Maxi Kit (Qiagen). Ten µg of effector and reporter plasmid DNA described above were transfected into protoplasts and incubated in the dark for 20-22 hr. After incubation, cells were centrifuged at 180g for 3 min, and the supernatant was removed. The cells were resuspended in 100 µL 1X cell culture lysis reagent (Promega Corp., Madison, WI; Cat #153A) and immediately followed with MUG (4-methylumbelliferyl-β-D-glucuronide) assay as described previously (Wang et al., 2007). All transfection assays were performed as three replicates, and assays were repeated on at least two separate occasions.   44  3.3 Results  3.3.1 Test of BLH5 function  3.3.1.1 Identification of blh5 mutant Based on analysis of expression profiling data (Ehlting et al., 2005) which showed strong co-expression of BLH5 and KNAT7, BLH5 was our top candidate for a BLH component of a KNAT7-BLH heterodimer complex at the outset of my work. In order to test the function of BLH5 in secondary wall biosynthesis, I used a reverse genetics approach. I obtained the BLH5 T-DNA insertion line SALK_122693, from the Salk Institute. The T-DNA insertion site was confirmed by PCR with T-DNA border flanking sequences primers. After generation of homozygous plants for the insertion, the T-DNA insertion site was verified by sequencing. The insertion was located within the second exon of BLH5. According to the results of semi-quantitative RT-PCR, the expression of BLH5 is undetectable in plants homozygous for the SALK_122693 allele (blh5-1) (Figure 3.1). This suggests that plants homozygous for this blh5 allele are loss of function mutant allele of BLH5. The plants homozygous for the blh5-1 allele were the material for all further experiments.  Figure 3.1 Characterization of plant loss of RNA expression of BLH5 Semi-quantitative RT-PCR analysis of BLH5 expression in blh5-1 and in wild type. No transcript was detected in the blh5-1 mutant. ACTIN2 was used as a reference control.  45  3.3.1.2 Phenotypic characterization of blh5 mutant I examined the morphology and inflorescence stem anatomy of the blh5-1 loss-of-function mutant. Anatomy at the base inflorescence stems from 6-8 week old plants were analyzed by staining with toluidine blue and phloroglucinol-HCL (Figure 3.2). The blh5-1 mutant had normal phenotypes indistinguishable from wild type, with no differences in vessel or fiber cell wall thickness, or staining observed. This suggests that BLH5 by itself it does not play a strong role in secondary wall formation, but functional redundancy with other BLH genes is a possibility.                     46  Figure 3.2 Phenotypic characterizations of loss-of-function mutants of BLH5 Cross sections of the bottom of florescence stem of 6-week-old blh5-1 plants (A, C, E), wild type (Col-0) (B, D, F). Phloroglucinol-HCL staining of cross sections (A, B). Toluidine blue staining of cross sections (C-F). The phloroglucinol-HCL reagent detects aldehyde groups contained in lignin and results in red staining that is generally indicative of the presence of lignin. Bars, 5 mm.   3.3.1.3 Over-expression of BLH5 Considering there was no phenotype of blh5-1 loss-of-function mutant, 4CL1:BLH5 overexpression lines were generated. The 4CL1 promoter drives xylem-localized expression 47  (Hauffe et al., 1991), and 4CL1:KNAT7 expressing lines have a distinct phenotype, opposite that of knat7 (Li, 2008). Seeds of T0 4CL1: BLH5 overexpression plants were selected in hygromycin plates, and resistant plants were transferred to soil. T1 plants were checked for expression of BLH5, and a line with the highest expression was selected for analysis (Figure 3.3). Homozygote 4CL1:BLH5 T2 plants were identified for phenotypic analysis.  Figure 3.3 Expression of BLH5 in overexpression lines Semi-quantitative RT-PCR analysis of BLH5 expression in BLH5 overexpression Line 1, Line 2 and in wild type. Highest transcript was detected in Line 1. ACTIN2 was used as a reference control.   I examined the morphology and inflorescence stem anatomy of BLH5 overexpression mutant as described above. Figure 3.4 shows representative results from examination of multiple plants, and indicates that the 4CL1: BLH5 mutant had normal phenotypes and was indistinguishable from wild type.       48  Figure 3.4 Anatomical characterization of 4CL1:BLH5 mutants. Images show sections of bottoms of fresh stems of 4CL1:BLH5 (A, C, E) and wild type Col-0 (B, D, F) for analysis of general anatomy during secondary cell wall formation. Phloroglucinol-HCL staining of cross sections (A-D). Toluidine blue staining of cross sections (E, F). Bars, 5 mm.   49  3.3.2 Phenotypic characterization of blh6 mutant  3.3.2.1 Identification of a blh6 mutant The second BLH candidate analysis was BLH6and T-DNA insertion mutant lines were obtained from the SIGnal database (http://signal.salk.edu). Among the T-DNA insertion lines available, line Salk_011023, was the only one with an exon insertion, and therefore was chosen for further analysis. Lines homozygous for the T-DNA insertion were selected by PCR. The T-DNA insertion site in the last exon was confirmed by sequencing. Semi-quantitative RT-PCR showed that the expression of BLH6 was undetectable in the homozygous plants, and the allele was named blh6-1 (blh6) (Figure 3.5). These results suggest that blh6-1 is a loss of function mutant of BLH6. Plants homozygous for blh6 were used as the material for all subsequent experiments.  Figure 3.5 Charaterization of the blh6-1 allele Semi-quantitative RT-PCR analysis of BLH6 expression in blh6-1 and in wild type. No transcript was detected in the blh6-1 mutant. ACTIN2 was used as a reference control.   3.3.2.2 Phenotypic characterization of the blh6 mutant I examined the morphology and inflorescence stem anatomy of the blh6 loss-of-function mutant. Anatomy at the bases of inflorescence stems from 6-week-old plants from each genotype was analyzed by staining with toluidine blue, phloroglucinol-HCL, and Mäule staining, with representative results shown in Figure 3.6. The phloroglucinol-HCl reagent gives a red reaction 50  when it reacts with aldehyde groups in the lignin polymer, whereas the Mäule reagent gives a qualitative indication of lignin monomer composition by staining G units in yellow and S units in red. Compared with the wild type, the secondary walls of interfascicular fibers in blh6 mutants appeared slightly thicker than those of WT, especially when viewed by Mäule and toluidine blue staining (Figure 3.6 A, E). The blh6 mutant also exhibited stronger red staining with the Mäule reagent in interfascicular fiber cells (Figure 3.6 A), suggesting that S unit deposition may be increased in these cells. Further chemical analysis of total lignin and G and S lignin units in these mutants is needed to confirm this phenotype, as well as more detailed analysis of cell wall thickness by electron microscopy. In contrast to the knat7 and ofp4 mutants, no irx phenotype was observed in the blh6 mutant.                  51  Figure 3.6 Anatomical characterization of the blh6 loss-of-function mutant. Images show cross sections of internodes at the bases of 6-week-old plants. blh6-1 (A,C,E) , wild type Col-0 (B,D,F). Mäule staining of cross sections (A, B). Phloroglucinol-HCL staining of cross sections (C, D). Toluidine blue staining of cross section (E, F). Green arrows indicate the slightly thicker cell wall in blh6-1 mutant. Bars, 5 mm.   3.3.2.3 Transcriptional activity of BLH6 Previous data showed that OFP1, OFP4 and KNAT7 all function as transcriptional repressors in protoplast transfection assays (Wang et al., 2007; Li et al., submitted). Since BLH6 interacts with 52  KNAT7 in vivo (Figure 2.6) and in vitro (Figure 2.8), it is very interesting to figure out the transcriptional function of BLH6. To test this, the protoplast transfection system previously used to demonstrate the transcriptional repression function of OFP1 (Wang et al., 2007) was employed. In this transfection system, illustrated in Figure 3.7 A, there are four different effector plasmids. The first transactivator gene encodes a chimeric protein consisting of the LexA DNA-Binding domain (DBD) fused to the herpes simplex virus VP16 activation domain (LD-VP16), driven by the CaMV35S promoter. The second one, the control effector plasmid, contains a 35S promoter - driving the Saccharomyxces cerevisiae Gal4 DBD alone (GD). The third effector gene encodes a chimeric protein consisting of the Saccharomyces Gal4 DBD fused to the herpes simplex virus VP16 activation domain (GD-VP16), driven by the CaMV35S promoter. The fourth effector is a chimeric protein consisting Gal4 DBD fused to BLH6 (GD-AtBLH6). The GUS reporter gene driven by the 35S promoter with both LexA and Gal4 DNA binding sites [LexA(2x)-Gal4(2x):GUS reporter gene], and Gal4 DNA binding site alone [Gal4-GUS], were used as reporter. Cotransfection of reporter Gal4-GUS with effector GD-VP16 transactivator gene (Figure 3.7A) caused strong activation of the GUS reporter gene. Cotransfection of reporter Gal4-GUS with effector GD induced a very low level of GUS reporter gene expression. These two reactions were used as controls. GUS activity measured after cotransfection of Gal4-GUS with GD-AtBLH6 resulted in no activation of Gal4-GUS, since activity remained very low relative to the GD alone control (Figure 3.7 B). Cotransfection of the LD-VP16 transactivator gene and the effector gene encoding only the Gal4 DBD (GD) resulted in strong activation of GUS reporter gene. However, GUS enzyme activity after cotransfection of LD-VP16 with GD-AtBLH6 was lower relative to protoplasts transfected with the GD alone (Figure 3.7 C). The result indicates that BLH6 negatively regulates VP16 activated gene expression and thus functions as a transcriptional repressor.    53  Figure 3.7 Test of the transcriptional activity of BLH6 (A) Effectors and reporter constructs used in the transfection assays. (B) Transfection assay in which GD-AtBLH6 was co-transfected with the constitutively expressed reporter Gal4-GUS in the absence of transactivator. (C) AtBLH6 represses the expression of the reporter activated by a transactivator LD-VP16. Effector genes, transactivator and reporter genes were contransfected into protoplasts derived from Arabidopsis rosette leaves. GUS activity was assayed after protoplasts had been incubated in darkness for 20-22 hr.     3.4 Discussion In this Chapter, I examined the phenotypes of blh5 and blh6 knock-out mutants, with a focus on inflorescence stem anatomy and secondary wall formation. Based on the expression pattern of the corresponding gene (Ehlting et al., 2005), BLH5 was originally a strong candidate for interaction A B C 54  with KNAT7. However, phenotypic analysis of the blh5 loss of function mutant and overexpression mutant failed to reveal any differences relative to wild-type plants. This is consistent with data obtained later, which showed that interaction between BLH5 and KNAT7 was undetectable in BiFC assays (Figure 2.6) and very weak in our yeast two hybrid assay (data not shown). Taken together these data suggest that BLH5 is not an interacting partner of KNAT7. Thus, while BLH5 is strongly upregulated during inflorescence stem development (Ehlting et al., 2005), its function remains to be determined. It is possible that functional redundancy between BLH5 and other members of BELL family, such as BLH1, exists, given their overlapping expression patterns and sequence similarities. This could be tested by generating a blh5 blh1 double mutant.  In terms of protein-protein interaction assays, data presented in Chapter 2 showed that BLH6 interacts with KNAT in vivo and in vitro. Initial phenotypic analysis of a blh6 loss-of-function mutant indicated that the mutant has somewhat thicker interfascicular fiber secondary cell walls, which if confirmed, would partially phenocopy knat7. However, the blh6 mutant did not display an irx phenotype, which is also a characteristic phenotype of knat7 loss-of-function mutants. This suggests that, as a KNAT7 interacting partner, BLH6 could be required for a subset of KNAT7 functions.  According to the phylogenetic trees described in Chapter 2 (Figures 2.1 A-C), BLH7 is a closely related paralog of BLH6. blh7 blh6 double mutants could be generated to test for functional redundancy between these genes, but the lack of BLH7-KNAT7 interaction suggests that BLH7 has a function at least partially distinct from that of BLH6. While I could not confirm the reported yeast two hybrid interactions of three other BLH proteins with KNAT7 (BLH5, BLH7 and ATH1) reported by Hackbusch et al. (2005) using the BiFC system (Figure 2.6), such potential interactions could be tested using other methods. If such interactions with KNAT7 were to occur, functional redundancy with BHL6 would be possible, perhaps explaining the apparent 55  mild phenotype of blh6 relative to knat7 mutants.  The data from the transcriptional activity assay (Figure 3.8) pointed out that BLH6 functions as a moderate transcriptional repressor in this assay system. The phenotype of the blh6 loss-of-function mutant which shows an apparent increase of the interfascicular cell wall thickness, similar to that seen for loss of KNAT7 function, which is known to be a transcriptional repressor (Li , 2008; Li eta al., submitted). This preliminary evidence indicates that BLH6 may play a role in secondary cell wall formation in concert with KNAT7, consistent with the model we proposed in Figure 2.14. According to this model, BLH6 is a member of a BLH-KNAT7-OFP complex that functions to repress transcription. It will be interesting to use the same system to determine the transcriptional activity of BLH6-KNAT7 and BLH6-KNAT7-OFP complexes predicted to form when the proteins are co-expressed together in protoplasts.  Several aspects of the blh6 phenotype remain to be investigated, and it would be of interest to examine the phenotype of a knat7 blh6 double mutant. However, the results presented in this chapter, together with the protein-protein interaction data in Chapter 2, provide evidence in support of a role of BLH6 in the regulation of secondary cell wall formation through its interaction with KNAT7 as a part of a KNOX-BLH-OFP complex.          56  Chapter 4. Conclusion and future directions  Through use of reverse genetics and protein-protein interaction assays, I identified BLH6 from the six candidate BLH proteins as a BLH interacting partner of KNAT7. Furthermore, I have demonstrated that BLH6 is a transcriptional repressor and it is likely involved in secondary cell wall formation. However, much remains unknown regarding the existence of the BLH6-KNAT7-OFP complex and the biological function of this complex. In this chapter, I propose some research that could be pursued in the future.  4.1 BLH expression patterns If BLH6 functions together with KNAT7 as part of a regulatory complex in vivo, it would be expected to have expression patterns that overlap with KNAT7. KNAT7 had previously been  shown to be expressed in developing fibers and vascular bundles in inflorescence stems (Zhong et al., 2008). Furthermore, promKNAT7:GUS fusion expression is closely associated with the vascular system and interfascicular fibers in Arabidopsis seedlings, roots, and inflorescence stems (Li et al., submitted). In Chapter 2, I conducted an in silico analysis for expression patterns of BLH proteins. In order to provide better information on BLH6 expression patterns and to determine if they overlap with those of KNAT7, we would need to examine the cell-type expression pattern of a promBLH6:GUS fusion transformed into wild type Arabidopsis.  4.2 Functional analysis of the KNAT7-BLH6 complex To study the biological function of KNAT7-BLH6 complex, an interesting experiment would be to generate a blh6 knat7 double mutant, and determine if the mutant has an additive phenotype, or one similar to knat7 or blh6. In terms of the phylogenetic analysis of BELL family, BLH7 is a close paralog of BLH6, suggesting that there might be functional redundancy between two genes. To test this, the blh7 loss-of-function mutants would have to be identified, the blh6 blh7 double mutant generated, and its phenotype compared to that of the single mutants. Considering that 57  4CL1: KNAT7 shows thinner interfascicular fiber cell walls than WT plants (Li, 2008), it would be worthwhile generating 4CL1: BLH6 overexpression lines, and compare the phenotype to that of 4CL1: KNAT7 lines. To further test whether BLH6 is required in the KNOX-BLH-OVATE complex, one could generate blh6 ofp4 double mutants and a blh6 knat7 ofp4 triple mutants by crossing loss-of-function mutants, then identify the homozygotes in the F2 generation by PCR genotyping. If the overexpression phenotype of KNAT7 in the stem requires these BLH proteins to cause decreased interfascicular fiber cell wall thickness, we might expect that loss of function of the corresponding BLH gene would suppress the phenotype. To test this possibility, we could generate the 4CL1:KNAT7 overexpression line in blh6 knockout background. Conversely, we could cross a 4CL1:BLH6 overexpression line to the knat7 knock out background to test whether the potential phenotype of BLH6 overexpression mutant depends on KNAT7 function. We also can cross 4CL1:BLH6 to 4CL1:KNAT7 overexpression lines to determine if the overexpression phenotypes are stronger. Based on the comparison of different mutant phenotypes, it should be possible to gain evidence about whether BLH6 and KNAT7 work in the same or different pathways. All the double and triple mutants planned are listed in Table 4.1 below.  Table 4.1 Double and triple mutants to be generated Double Knock-out Mutant Overexpression Mutant Triple Mutant blh6 blh7 4CL1:BLH6 knat7 KO mutant blh6 knat7 ofp4 triple mutant blh6 knat7 4CL1:KNAT7 blh6 KO mutant blh6 blh7 knat7 triple mutant blh6 ofp4 4CL1:BLH6 4CL1:KNAT7 mutant  As blh6 loss-of-function mutant exhibits possible altered S lignin amount in interfascicular fibers, it will be worth quantifying the total lignin content and amount of G and S subunits of the transgenic plants together with the control plants by chemical analysis. Since BLH6 may control other secondary cell wall properties, it would be worthwhile determining total lignin, cellulose, 58  and hemicellulose levels in the blh6 mutant, relative to wild type, and assay the cell wall phenotype of a second blh6 allele.  4.3 Analysis of a KNOX-BLH-OVATE complex by protein-protein interaction assays  The interaction between KNAT7 and OFP4 and OFP1 has been shown in vivo and in vitro (Li et al., submitted). In Chapter 2, I demonstrated the interaction between BLH6 and KNAT7 in vivo and in vitro, while BLH6 interaction with OFP4 was not detected by BiFC (data not shown) or yeast two-hybrid analysis (Figure 2.8). The question will be how to further test the protein-protein interactions within the KNOX-BLH-OVATE complex. One useful technique would be yeast three hybrid analysis to test whether KNAT7 could act as a scaffold, binding both BLH6 and OFP4 at the same time, if the predicted KNOX-BLH-OVATE complex containing these proteins exists.  Another way to test the interactions would be to use the protoplast transfection system described in Chapter 3 to determine the transcriptional activity of BLH6-KNAT7 and BLH6-KNAT7-OFPs complexes by cotransfecting 35S:HA-KNAT7 and 35S:HA- OFP4 with LexA(2x)-Gal4(2x):GUS reporter gene, the LD-VP16 effecter gene and the second effecter GD-AtBLH6 gene into protoplasts, and then measure GUS reporter expression  levels. These experiments would show whether BLH6 and OFP4 work together to further enhance transcriptional repression by KNAT7 in a protein complex, or whether the proteins have antagonistic effects on transcriptional activity.  4.4 KNAT7 target genes Microarray transcriptome profiling is a useful tool to detect gene expression change in the full-genome level, and I performed preliminary work using a DEX-induction system in which a 35S:KNAT7-GR construct was transformed into the knat7 mutant background. I showed that DEX induction of 35S:KNAT7-GR rescued the knat7 mutant phenotype. These experiments could 59  be continued to identify KNAT7 target genes. Candidate targets could be further investigated by RT-PCR expression profiling, conserved cis-acting regulatory elements identified, binding of recombinant KNAT7 to putative target promoters and cis-elements tested using EMSA, and reverse genetic analyses used to test the biological functions of the target genes. It would also be possible to introduce 35S:KNAT7-GR into ofp4 and blh6 mutant backgrounds, and determine differences in KNAT7-induced gene expression changes relative to WT. This approach could shed light on different functions of KNAT7-containing complexes.                     60  References Abascal, F., Zardoya, R., and Posada, D. (2005). ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic local alignment search tool. Journal of molecular biology 215, 403-410. Balatinecz, J.J., Kretschmann, D.E., and Leclercq, A. (2001). Achievements in the utilization of poplar wood-guideposts for the future. Forestry Chronicle 77, 265-270. Bao, X., Franks, R.G., Levin, J.Z., and Liu, Z. (2004). Repression of AGAMOUS by BELLRINGER in floral and inflorescence meristems. Plant Cell 16, 1478. Barnett, J.R., and Bonham, V.A. (2004). Cellulose microfibril angle in the cell wall of wood fibres. Biological reviews 79, 461-472. Bellaoui, M., Pidkowich, M.S., Samach, A., Kushalappa, K., Kohalmi, S.E., Modrusan, Z., Crosby, W.L., and Haughn, G.W. (2001). The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 13, 2455. Bertolino, E., Reimund, B., Wildt-Perinic, D., and Clerc, R.G. (1995). A novel homeobox protein which recognizes a TGT core and functionally interferes with a retinoid-responsive motif. Journal of biological chemistry 270, 31178. Bharathan, G., Janssen, B.J., Kellogg, E.A., and Sinha, N. (1997). Did homeodomain proteins duplicate before the origin of angiosperms, fungi, and metazoa? Proceedings of the National Academy of Sciences of the United States of America 94, 13749. Bhatt, A.M., Etchells, J.P., Canales, C., Lagodienko, A., and Dickinson, H. (2004). VAAMANA--a BEL1-like homeodomain protein, interacts with KNOX proteins BP and STM and regulates inflorescence stem growth in Arabidopsis. Gene 328, 103-111. Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281. Burglin, T.R. (1997). Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Research 25, 4173. 61  Boerjan, W., Ralph, J., and Baucher, M. (2003). Lignin biosynthesis. Annu Rev Plant Biol 54: 519–546 Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281. Byrne, M.E., Groover, A.T., Fontana, J.R., and Martienssen, R.A. (2003). Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER. Development 130, 3941. Canam, T., Park, J.Y., Yu, K.Y., Campbell, M.M., Ellis, D.D., and Mansfield, S.D. (2006). Varied growth, biomass and cellulose content in tobacco expressing yeast-derived invertases. Planta 224, 1315-1327. Citovsky, V., Lee, L.Y., Vyas, S., Glick, E., Chen, M.H., Vainstein, A., Gafni, Y., Gelvin, S.B., and Tzfira, T. (2006). Subcellular localization of interacting proteins by bimolecular fluorescence complementation in planta. Journal of Molecular Biology 362, 1120-1131. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method forAgrobacterium-mediated transformation ofArabidopsis thaliana. The Plant Journal 16, 735-743. Chen, H., Banerjee, A.K., and Hannapel, D.J. (2004). The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. The Plant Journal 38, 276-284. Cole, M., Nolte, C., and Werr, W. (2006). Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana. Nucleic acids research 34, 1281. Doblin, M.S., Kurek, I., Jacob-Wilk, D., and Delmer, D.P. (2002). Cellulose biosynthesis in plants: from genes to rosettes. Plant and Cell Physiology 43, 1407. Donaldson, L.A. (2001). Lignification and lignin topochemistry--an ultrastructural view. Phytochemistry 57, 859-873. Douglas, S.J., Chuck, G., Dengler, R.E., Pelecanda, L., and Riggs, C.D. (2002). KNAT1 and ERECTA regulate inflorescence architecture in Arabidopsis. Plant Cell 14, 547. Ehlting, J., Mattheus, N., Aeschliman, D.S., Li, E., Hamberger, B., Cullis, I.F., Zhuang, J., Kaneda, M., Mansfield, S.D., and Samuels, L. (2005). Global transcript profiling of 62  primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. The Plant Journal 42, 618-640. Esau, K. (1965). Plant anatomy. New York: Wiley. Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792. Fukuda, H. (1996). Xylogenesis: initiation, progression, and cell death. Annual Review of Plant Biology 47, 299-325. Gehring, W.J., Affolter, M., and Burglin, T. (1994a). Homeodomain proteins. Annual review of biochemistry 63, 487-526. Gehring, W.J., Qian, Y.Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A.F., Resendez-Perez, D., Affolter, M., Otting, G., and Wuthrich, K. (1994b). Homeodomain-DNA recognition. Cell 78, 211-224. Guo, J., Wang, S., Wang, J., Huang, W.D., Liang, J., and Chen, J.G. (2009). Dissection of the Relationship between RACK1 and Heterotrimeric G-proteins in Arabidopsis. Plant and Cell Physiology 50, 1681. Hackbusch, J., Richter, K., Müller, J., Salamini, F., and Uhrig, J.F. (2005). A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins. Proceedings of the National Academy of Sciences of the United States of America 102, 4908. Hake, S., Smith, H.M.S., Holtan, H., Magnani, E., Mele, G., and Ramirez, J. (2004). The role of KNOX genes in plant development. Annu Rev Cell Dev Biol 20, 125–151. Hauffe, K.D., Paszkowski, U., Schulze-Lefert, P., Hahlbrock, K., Dangl, J.L., and Douglas, C.J. (1991). A parsley 4CL-1 promoter fragment specifies complex expression patterns in transgenic tobacco. Plant Cell 3, 435. Hay, A., and Tsiantis, M. (2009). A KNOX family TALE. Current Opinion in Plant Biology 12, 593-598. Hu, C.D., Chinenov, Y., and Kerppola, T.K. (2002). Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Molecular Cell 9, 789-798. 63  Huelsenbeck, J.P., and Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755. Hruz, T., Laule, O., Szabo, G., Wessendorp, F., Bleuler, S., Oertle, L., Widmayer, P., Gruissem, W., and Zimmermann, P. (2008). Genevestigator V3: a reference expression database for the meta-analysis of transcriptomes. Advances in Bioinformatics 2008, 420–747. Jansson, S., and Douglas, C.J. (2007). Populus: a model system for plant biology. Annu Rev Plant Biol 58, 435–458. Kerstetter, R., Vollbrecht, E., Lowe, B., Veit, B., Yamaguchi, J., and Hake, S. (1994). Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6, 1877. Ko, J.H., Kim, W.C., and Han, K.H. (2009). Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis. The Plant Journal 60, 649-665. Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, J., Mimura, T., Fukuda, H., and Demura, T. (2005). Transcription switches for protoxylem and metaxylem vessel formation. Genes & Development 19, 1855. Kumar, R., Kushalappa, K., Godt, D., Pidkowich, M.S., Pastorelli, S., Hepworth, S.R., and Haughn, G.W. (2007). The Arabidopsis BEL1-LIKE HOMEODOMAIN proteins SAW1 and SAW2 act redundantly to regulate KNOX expression spatially in leaf margins. Plant Cell 19, 2719. Kumar, R. (2006) The roles of BEL1-Like proteins in organ morphogenesis in Arabidopsis theliana. PhD thesis, The University of British Columbia Li, E. (2008) Identification and characterization of regulatory genes associated with secondary wall formation in Populus and Arabidopsis thaliana. PhD Thesis, The University of British Columbia Liepman, A.H., Wilkerson, C.G., and Keegstra, K. (2005). Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases. Proceedings of the National Academy of Sciences of of the United States of America 102, 2221. Long, J.A., Moan, E.I., Medford, J.I., and Barton, M.K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 64  66-69. Müller, J., Wang, Y., Franzen, R., Santi, L., Salamini, F., and Rohde, W. (2001). In vitro interactions between barley TALE homeodomain proteins suggest a role for protein–protein associations in the regulation of Knox gene function. The Plant Journal 27, 13-23. McCarthy, R.L., Zhong, R., and Ye, Z.H. (2009). MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant and Cell Physiology 50, 1950. McGinnis, W., Garber, R.L., Wirz, J., Kuroiwa, A., and Gehring, W.J. (1984). A homologous protein-coding sequence in Drosophila homeotic genes and its conservation in other metazoans. Cell 37, 403-408. Mellerowicz, E.J., Baucher, M., Sundberg, B., and Boerjan, W. (2001). Unravelling cell wall formation in the woody dicot stem. Plant Molecular Biology 47, 239-274. Meisel, L., and Lam, E. (1996). The conserved ELK-homeodomain of KNOTTED-1 contains two regions that signal nuclear localization. Plant Molecular Biology 30, 1-14. Mitsuda, N., Seki, M., Shinozaki, K., and Ohme-Takagi, M. (2005). The NAC transcription factors NST1 and NST2 of Arabidopsis regulate secondary wall thickenings and are required for anther dehiscence. Plant Cell 17, 2993. Mukherjee, K., and Bürglin, T.R. (2007). Comprehensive analysis of animal TALE homeobox genes: new conserved motifs and cases of accelerated evolution. Journal of Molecular Evolution 65, 137-153. Mukherjee, K., Brocchieri, L., and Burglin, T.R. (2009). A comprehensive classification and evolutionary analysis of plant homeobox genes. Molecular Biology and Evolution 26, 2775. Pagnussat, G.C., Yu, H.J., and Sundaresan, V. (2007). Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1. Plant Cell 19, 3578. Pauly, M., and Keegstra, K. (2008). Cell-wall carbohydrates and their modification as a resource for biofuels. The Plant Journal 54, 559-568. Persson, S., Wei, H., Milne, J., Page, G.P., and Somerville, C.R. (2005). Identification of genes required for cellulose synthesis by regression analysis of public microarray data sets. 65  Proceedings of the National Academy of Sciences of the United States of America 102, 8633. Proveniers, M., Rutjens, B., Brand, M., and Smeekens, S. (2007). The Arabidopsis TALE homeobox gene ATH1 controls floral competency through positive regulation of FLC. The Plant Journal 52, 899-913. Reiser, L., Modrusan, Z., Margossian, L., Samach, A., Ohad, N., Haughn, G.W., and Fischer, R.L. (1995). The BELL1 gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell 83, 735-742. Retief, J.D. (2000). Phylogenetic analysis using PHYLIP. Methods Mol Biol 132, 243-258. Richmond, T. (2000). Higher plant cellulose synthases. Genome Biology 1, 300.1–300.6. Roeder, A.H.K., Ferrándiz, C., and Yanofsky, M.F. (2003). The role of the REPLUMLESS homeodomain protein in patterning the Arabidopsis fruit. Current Biology 13, 1630-1635. Roberts, K., and McCann, M.C. (2000). Xylogenesis: the birth of a corpse. Current Opinion in Plant Biology 3, 517-522. Rutjens, B., Bao, D., van Eck-Stouten, E., Brand, M., Smeekens, S., and Proveniers, M. (2009). Shoot apical meristem function in Arabidopsis requires the combined activities of three BEL1-like homeodomain proteins. The Plant Journal 58, 641-654. Samuels, A.L., Kaneda, M., and Rensing, K.H. (2006). The cell biology of wood formation: from cambial divisions to mature secondary xylem. Botany 84, 631-639. Smith, H., and Hake, S. (2003). The interaction of two homeobox genes, BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the Arabidopsis inflorescence. Plant Cell 15, 1717. Smith, H., Boschke, I., and Hake, S. (2002). Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proceedings of the National Academy of Sciences of the United States of America 99, 9579. Smith, H., Campbell, B.C., and Hake, S. (2004). Competence to respond to floral inductive signals requires the homeobox genes PENNYWISE and POUND-FOOLISH. Current Biology 14, 812-817. Somerville, C. (2006). Cellulose synthesis in higher plants. Annu Rev Cell Dev Biol 22, 53–78. 66  Stacey, N.J., Roberts, K., Carpita, N.C., Wells, B., and McCann, M.C. (1995). Dynamic changes in cell surface molecules are very early events in the differentiation of mesophyll cells from Zinnia elegans into tracheary elements. The Plant Journal 8, 891-906. Sticklen, M.B. (2008). Plant genetic engineering for biofuel production: towards affordable cellulosic ethanol. Nature Reviews Genetics 9, 433-443. Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688. Truernit, E., Siemering, K.R., Hodge, S., Grbic, V., and Haseloff, J. (2006). A map of KNAT gene expression in the Arabidopsis root. Plant Molecular Biology 60, 1-20. Turner, S., Gallois, P., and Brown, D. (2007). Tracheary element differentiation. Annual Review of Plant Biology 58, 407–433. Tuskan, G.A., Difazio, S., Jansson, S., Bohlmann, J., Grigoriev, I., Hellsten, U., Putnam, N., Ralph, S., Rombauts, S., and Salamov, A. (2006). The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313, 1596. Venglat, S.P., Dumonceaux, T., Rozwadowski, K., Parnell, L., Babic, V., Keller, W., Martienssen, R., Selvaraj, G., and Datla, R. (2002). The homeobox gene BREVIPEDICELLUS is a key regulator of inflorescence architecture in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 99, 4730. Wang, S., Chang, Y., Guo, J., and Chen, J.G. (2007). Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation. The Plant Journal 50, 858-872. Yamaguchi, M., Kubo, M., Fukuda, H., and Demura, T. (2008). Vascular-related NAC-DOMAIN7 is involved in the differentiation of all types of xylem vessels in Arabidopsis roots and shoots. The Plant Journal 55, 652-664. Yu, L., Patibanda, V., and Smith, H.M.S. (2009). A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning. Planta 229, 693-707. Zhong, R., Demura, T., and Ye, Z.H. (2006). SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. Plant Cell 18, 3158. Zhong, R., Richardson, E.A., and Ye, Z.H. (2007). The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. Plant Cell 19, 2776. 67  Zhong, R., Lee, C., Zhou, J., McCarthy, R.L., and Ye, Z.H. (2008). A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell 20, 2763. Zhong, R., Pena, M.J., Zhou, G.K., Nairn, C.J., Wood-Jones, A., Richardson, E.A., Morrison Iii, W.H., Darvill, A.G., York, W.S., and Ye, Z.H. (2005). Arabidopsis fragile fiber8, which encodes a putative glucuronyltransferase, is essential for normal secondary wall synthesis. Plant Cell 17, 3390. Zimmermann, I.M., Heim, M.A., Weisshaar, B., and Uhrig, J.F. (2004a). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. The Plant Journal 40, 22-34. Zimmermann, I.M., Heim, M.A., Weisshaar, B., and Uhrig, J.F. (2004b). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. The Plant Journal 40, 22-34.     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0071348/manifest

Comment

Related Items