Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studying the effect of OGX-225, a novel antisense therapy, on prostate cancer cells Alwaal, Amjad Hassan 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_alwaal_amjad.pdf [ 678.82kB ]
Metadata
JSON: 24-1.0071307.json
JSON-LD: 24-1.0071307-ld.json
RDF/XML (Pretty): 24-1.0071307-rdf.xml
RDF/JSON: 24-1.0071307-rdf.json
Turtle: 24-1.0071307-turtle.txt
N-Triples: 24-1.0071307-rdf-ntriples.txt
Original Record: 24-1.0071307-source.json
Full Text
24-1.0071307-fulltext.txt
Citation
24-1.0071307.ris

Full Text

       STUDYING THE EFFECT OF OGX-225, A NOVEL ANTISENSE THERAPY, ON PROSTATE CANCER CELLS    by Amjad Hassan Alwaal     M.B.B.S., King Abdul Aziz University, 2003   A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF   Master of Science in   The Faculty of Graduate Studies (Surgery)   The University Of British Columbia (Vancouver) September, 2010 © Amjad Hassan Alwaal, 2010      ABSTRACT Prostate cancer (PCa) is the most common malignancy diagnosed in Canadian men. If the disease is not detected early the patients would present with metastatic disease. Metastatic PCa represents a challenge for treatment. The primary treatment at this stage is androgen ablation (castration). However, metastatic PCa invariably progress to a castration-resistant form, which does not respond to androgen ablation. This form is a lethal form of the disease, and there are several strategies that have been described to treat this form of cancer. The Insulin-like Growth Factor (IGF) system plays a pivotal role in prostate development and castration-resistant progression. It is tightly regulated by seven high affinity Insulin-like Growth Factor Binding Proteins (IGFBP 1-7). IGFBP-2 and IGFBP-5 are over-expressed in PCa and play a role in castration-resistant progression, while IGFBP-3 is downregulated and inhibits growth of PCa cells. OGX-225 is a novel second- generation antisense drug (ASO) that targets both IGFBP-2 and IGFBP-5. M. Muramaki et al, at the prostate center in Vancouver, showed in their unpublished data that it inhibits the growth PCa cells both in vitro and in vivo, and that it downregulates IGFBP-2 and IGFBP-5. In my thesis, I showed the inability to rescue PCa cells exposed to OGX-225 by adding back IGFBP-5, indicating that the action of OGX-225 is irreversible and targets several targets in addition to IGFBP-2 and IGFBP-5. I also showed the growth inhibitory effect of IGFBP-3 through a mechanism other than apoptosis, while not having an additive effect on PCa cells when combined with OGX-225. This thesis reports the multi-targeting ability of OGX-225 resulting in the inability to rescue PCa   ii     cells exposed to it, and gives some insight into the mechanism of action of IGFBP-3 and its effect when combined with OGX-225.    iii     TABLE OF CONTENTS  ABSTRACT .......................................................................................................................ii TABLE OF CONTENTS....................................................................................................iv LIST OF TABLES............................................................................................................. vi LIST OF FIGURES............................................................................................................ v ACKNOWLEDGEMENTS ............................................................................................. viii DEDICATIONS ................................................................................................................ ix 1 INTRODUCTION............................................................................................................ 1 1.1 Introduction ………………………........................................................................... 1 1.2 The Prostate ......................................................................................................... 1 1.3 Prostate Cancer (PCa).…………........................................................................... 3 1.4 IGF Axis ……………………………........................................................................ 5 1.4.1 IGFs and IGF Receptors ………................................................................ 9 1.4.2 IGFBPs …………………………............................................................... 11 1.4.2.1 IGFBP-1 ………………………........................................................ 12 1.4.2.2 IGFBP-2 ………………………….................................................... 13 1.4.2.3 IGFBP-3 ……………...………........................................................ 14 1.4.2.4 IGFBP-4 ........................................................................................ 15 1.4.2.5 IGFBP-5 ........................................................................................ 16 1.4.2.6 IGFBP-6 ………………………........................................................ 17 1.4.2.7 IGFBP-7 ........................................................................................ 18 1.4.3 IGFBP Proteases ………………............................................................. 18 1.4.4 IGFBP-rPs ………………………............................................................. 19 1.4.5 IGF Axis and Androgen Receptor in Prostate Cancer…...…...…..…...…20 1.5  Antitumor Activity of OGX-225, A Novel ASO Inhibitor of IGFBP-2 and IGFBP-5 in Prostate Cancer Models …………….......................................... 21  1.6 Specific experimental objectives ................................................................... 23 2 MATERIALS AND METHODS..................................................................................... 25 2.1 Prostate Cancer Cell Lines and Reagents ...................................................... 25 2.2 MTS Assay ...................................................................................................... 26   iv     2.3 Technique for Testing the Ability to Rescue PC3 Cells Exposed to OGX-225.27 2.4 Technique for Testing the Combined Effect of OGX-225 and Recombinant IGFBP-3 on PC3 Cells.................................................................................... 28 2.5 Technique for Testing the Combined Effect of OGX-225 and Recombinant IGFBP-3 on PC3 Cells, Using Flowcytometry……........................................ 28 3 RESULTS ………………………................................................................................... 30 3.1 Inability to Rescue PC3 Cells Exposed to OGX-225 .................................... 30 3.2 IGFBP-3 Does Not Have An Additive Effect on PC3 Cells When Combined with OGX-225 ............................................................................................... 34 3.3 IGFBP3 Growth Inhibitory Effect on PC3 Cells is Not Apoptotic ……..……. 36 4 DISCUSSION AND CONCLUSIONS........................................................................... 38 4.1 Discussion .................................................................................................... 38 4.2 Conclusions .................................................................................................. 46 BIBLIOGRAPHY ............................................................................................................ 47    v     LIST OF TABLES  Table 1: Homologous targets to OGX-225…………………………….……..……….42    vi     LIST OF FIGURES  Figure 1:  The Insulin-like Growth Factor (IGF) receptor activation and downstream signalling……………...…….………….…………………..………….7  Figure 2:  Rescuing PC3 cells after being exposed to OGX-225 using 350ng/ml recombinant IGFBP-5. ……………..……………………………32  Figure 3: Comparing The cytotoxic Effect of OGX-225 and Recombinant IGFBP-3 on PC3 cells………………………….…………………………… 35 Figure 4: Comparing The Apoptotic Effect of OGX-225 and Recombinant IGFBP-3 on PC3 cells………………………….…………………….………37    vii     ACKNOWLEDGEMENTS  I offer my enduring gratitude to the faculty, staff and my fellow students at the prostate centre at UBC, who have inspired me to continue my work in this field. I owe particular thanks to Dr. Michael E. Cox, whose brilliance, incredible vision, and endless support has enabled me to finish this thesis. I also thank Dr. Christopher Nguan for enlarging my vision of science and providing me with the advice and support to advance in this field and in my career.    viii     DEDICATIONS  To my mother Saadiyah, and to my wife Atlal.    ix     1 INTRODUCTION 1.1 Introduction Prostate cancer (PCa) is the third leading cause of death in Canadian men(1). When it presents late it represents a great challenge for doctors to treat. Castration-resistant prostate cancer (CRPC) is a terminal and lethal form of the disease, and different therapeutic strategies have been proposed to treat this form of cancer. OGX-225 is a novel antisense oligodeoxynucleotide (ASO) that is designed to target IGFBP-2 and IGFBP-5, and delays the progression of CRPC.  1.2 The Prostate The prostate is an exocrine gland of the male reproductive system. It is situated at the base of the bladder and is part of the male sex accessory tissues along with the seminal vesicles, ampullae, and bulbourethral glands(2, 3). It weighs normally between 20-30 grams. The prostate functions to secrete parts of the seminal fluid. It secretes many biologic substances in the ejaculate such as fructose, citric acid, spermine, prostaglandins, zinc, proteins, and specific enzymes such as immunoglobulins, proteases, esterases, and phosphatases. The prostate also contains smooth muscles that help expel the semen during ejaculation. Embryologically, five epithelial buds form in a paired manner on the posterior side of the urogenital sinus on both sides of the verumontanum, and they then invade the mesenchyme to form the prostate(4). The prostate is composed of epithelial and stromal components. The stroma of the prostate contains smooth muscle cells, fibroblasts, and endothelial cells 1     embedded in an extracellular matrix. It supports the epithelial cells and regulates their growth and differentiation(5). Andromedins, such as Insulin-like Growth Factor (IGF) and Fibroblast Growth Factors (FGFs), play a major role in normal prostatic growth and differentiation(6, 7). They are secreted by the stromal cells and mediate the androgen action on epithelial cells. Transforming Growth Factorbeta 1 (TGF-beta 1) inhibition of epithelial cells is opposed by the stimulatory action of IGF and FGFs to maintain the equilibrium of epithelial cell numbers(8). The epithelium forms the glandular acini, which is separated from the stroma by a basement membrane. The epithelium is composed of three major cell types: secretory epithelial, basal, and neuroendocrine cells. The most common type is the secretory epithelial cell, which is terminally differentiated and is easily distinguished by their morphology and abundant secretory granules and enzymes that stain abundantly with the Prostate Specific Antigen (PSA) and acid phosphatase. They are also rich in keratins(2). The basal cells are smaller and less abundant, being less than 10% of the number of epithelial cells. They are less differentiated and are almost devoid of secretory granules(9). The neuroendocrine cells of the prostate regulate the secretory epithelial cells and are composed of three types, with the major type containing both serotonin and thyroid stimulating hormone. The two minor cell types contain calcitonin and somatostatin(10).  2     1.3 Prostate Cancer (PCa) PCa is the most frequently diagnosed cancer in Canadian men (except for nonmelanotic skin cancer, which is rarely fatal)(1). Adenocarcinoma is the most common form of PCa representing > 95% of this cancer. Other rare types of PCa includes (Rhabdomyosarcoma, leiomyosarcoma, lymphoma, and transitional cell carcinoma)(11). It arises from the glandular epithelial cells, usually from the peripheral zone of the prostate(12, 13). Most of the patients with PCa are asymptomatic until the disease is advanced. Therefore, screening for PCa becomes a necessity to detect the disease at an early stage. Screening is done through Digital Rectal Examination (DRE) to detect masses or nodules, and through measuring the serum level of the PSA, which is usually elevated in PCa. The disease is confirmed and graded by histologic analysis of prostate biopsies, using Gleason score, which predicts the prognosis, based on the histologic features of the PCa. The higher the Gleason score, the more aggressive the tumor(11). In localized PCa, a big challenge for the clinician is determining which patients should be offered conservative treatment and which patients should be offered the definitive management. This is especially true for the older population, as the definitive treatment options can carry morbidity to the patient. Generally, the conservative treatment should be offered to patients with life expectancy of less than 10 years, while definitive management is recommended if Gleason score of 4 or 5 is present, more than two biopsy cores are involved, or more than 50% of a biopsy core is involved(11). The definitive treatment options for localized PCa include surgical (radical prostatectomy), radiotherapy, or other 3     forms of minimally invasive therapies such as brachytherapy. It has not been determined yet if one of these options is superior to the others. However, when PCa cells metastasize to lymph nodes, bone, or other organs, the treatment plan also changes as a more systemic approach is needed(11). The first line of treatment for these patients would typically be androgen withdrawal as PCa is a hormonally sensitive tumor. This was demonstrated through the pioneering work of Huggins and Hodges in the early 1940s(14). Charles Huggins was awarded the noble prize for Medicine for his pioneering work in 1966. Androgens enable growth in PCa through stimulation of cellular proliferation and inhibition of apoptosis(15). Androgen withdrawal can be achieved through surgical castration (bilateral orchiectomy), or medical castration (Gonadotropin-releasing hormone GnRH agonists). Patients usually respond to the hormonal treatment, and will be in remission for an average of 24 months(16). PCa will then exhibit a transformation from Androgen Dependent (AD) to castration-resistant phenotype, which will worsen the prognosis, as the median survival then is 8 to 12 months(15). This phenotype represents a clinical dilemma. Several agents were previously used to treat CRPC, including mitoxantrone, which has shown modest subjective benefits with otherwise minimal evidence of objective antitumor activity. It was mostly beneficial for palliative purposes(17). Docetaxel is a newer cytotoxic agent that induces apoptosis through p53 independent mechanisms, possibly by inhibiting microtubule depolymerization(18). It has become the agent of choice as of 2004 on the basis of a large phase III randomized trial, TAX 327, which demonstrated its superiority to the past standard, mitoxantrone and 4     prednisone, in terms of survival prolongation(19). These benefits, while clinically significant, remains modest, and there is an increased need for newer therapeutic modalities or second-line agents for patients progressing after docetaxel therapy. For this reason, several new agents have been developed to combat CRPC. OGX-011, an antisense oligonucleotide targeting clusterin, was found to enhance the effects of the cytotoxic chemotherapy in docetaxelrefractory cells(20). On the other hand in clinical trials, Erlotinib, a new smallmolecule Tyrosine Kinase Inhibitor (TKI) targeting Epidermal Growth Factor (EGF) receptor, known to be overexpressed in PCa, was found to have insignificant clinical benefits in patients with CRPC(21). Abiraterone is even a newer drug that inhibits CYP17, which is a key in androgen and estrogen synthesis, and has clinically significant benefits in CRPC in terms of PSA level and Circulating Tumor Cells (CTC) counts, further confirming the fact that CRPC remains hormone driven(22). Etoposide inhibits androgen/AR-mediated cell growth in PCa cells(23). All these and other new therapeutic modalities are promising new frontiers in managing CRPC.  1.4 IGF Axis Androgens are the primary growth factors for PCa. They act indirectly through AR-positive stromal cells resulting in their release of paracrine growth factors, stimulating epithelial proliferation and survival(24, 25). Other non-androgenic growth factors were also found to play a role in PCa growth regulation through different mechanisms, such as activation of AR in CRPC, or activation of different 5     signal transduction pathways as in the andromedins (FGF, EGF, and IGF) signalling pathways(26). Since the late 1990s, the IGF family was found to play a major role in different malignancies including PCa(27, 28). It was also found that it has a major mitogenic and anti-apoptotic effect on PCa cell lines(29). The IGF family consists of two ligands (IGF-I and IGF-II), two receptors (IGF-IR and IGFIIR), seven high affinity IGF binding proteins (IGFBPs 1-7), a large group of IGFBP proteases, and low affinity IGFBP-related peptides (IGFBP-rPs)(29) (Fig.1). IGF-I is a mitogen for a variety of cells through stimulation of DNA synthesis and by increasing the level of Cyclin D1, which accelerates the progression of cells from G1 to S phase(7). It also stimulates the expression of Bcl and suppresses Bax, which results in increasing the Bcl/Bax ratio resulting in the blocking of apoptosis(30). By binding to a Tyrosine Kinase (TK) receptor, IGF activates the TK receptor at the cell surface and activate downstream signal cascades (PI3K/AKT cascade) to increase PCa cell growth and proliferation(31). It is also implicated in tumor angiogenesis by increasing vascular endothelial growth factor (VEGF)(32) and in cell migration(33). IGF can mediate growth in CRPC through signalling pathways independent of androgens, and therefore new strategies are being pursued through the development of small molecule and humanized antibody inhibitors of the IGF-1R and antisense inhibition of IGFBP expression for treatment of CRPC.  6     Fig. 1: The Insulin-like Growth Factor (IGF) receptor activation and downstream signalling.  7     Legend to Fig. 1: The Insulin-like Growth Factor (IGF) receptor activation and downstream signalling. IGF-IR binds preferentially to, and activates the IGF-IR, which is a tyrosine kinase (TK) receptor. This triggers down-stream signalling pathways, including Ras/Raf/mitogen-activated protein kinase (MAPK) through adaptor proteins, which through ERK1 and 2 mediates cellular proliferation by downregulating Bim and BAD and upregulating Mcl-1. TK also activates PI3K (a process amplified in PTEN depleted cells) resulting in activation of PDK1 and Akt, which inhibits Bim and BAD directly or indirectly (via inhibiting FOXO). Akt also activates mTORC1/RAPTOR indirectly through inhibiting the inhibitor proteins TSC1 and 2, thus promoting cell survival. mTORC2/RICTOR also promotes survival by activating Akt and SGK1 (an inhibitor of FOXO). The availability of IGF-I to its receptor is influenced by IGF-binding proteins (IGFBPs) and IGFBP proteases. IGF-IIR has no TK activity, and it reduces IGF-I availability to IGF-IR. (Modified from Gennigens 2005(29), Grant 2008(34), and Laplante 2009(35)).  8     1.4.1  IGFs and IGF Receptors  IGF-I and IGF-II are single chain polypeptides(36). They share 62% homology between them. Their A and B regions also share a homology to proinsulin. IGF-I gene is located on the long arm of chromosome 12 (12q23.2), while IGF-II is located on the short arm of chromosome 11 (11p15.5), at 1.4 kilobases (kb) downstream from the insulin gene(37). IGF-I and II act as both endocrine hormones and as tissue growth factors. IGF-I is a 70 amino acid molecule that is synthesized primarily in the liver and bone marrow(38), and is regulated primarily by the Growth Hormone (GH)(39). Its liver production is increased by physical exercise and smoking(40), while decreased by low calorie intake(41). IGF-I is increased gradually after birth, peaks at puberty, and decline afterwards(42). It plays an important role in organogenesis and promotes cellular differentiation of several mesothelial cells, such as myocytes, osteoblasts, and chondrocytes(36). It also promotes antiapoptotic and mitogenic functions on tumor cells that secrete IGF-I(43). IGF-II is a 67 amino acid molecule, which is synthesized primarily in the liver, and is present in much higher plasma levels than IGF-I(44). It is instrumental in embryonic and fetal growth and development(45), and is believed to have an antiapoptotic effect(46). Its expression is suppressed by maternal imprinting and regulated by 3 IGF-II mRNA Binding Proteins (IMPs 1-3)(47). Both IGF-IR and IGF-IIR are glycoproteins that are located on the cell membrane(48-50). They differ completely in their structure and function. IGF-IR 9     is a tetramer composed of two identical α subunits (each subunit weighs 130 kDA) and two identical β subunits (each subunit weighs 90 kDa), which are encoded by a single allele and are generated by proteolytic processing(48-51). The holomeric IGF-IR weighs 320 kDa(52). It has a 60% homology with insulin receptor (IR). IGFs and insulin cross-binds with each other’s receptors, but with a weaker affinity than with each one’s own receptor(53, 54). The IGF-IR and IR can hybridize to form a heterodimer composed of one α and one β subunits of IGF-IR and one α and one β subunits of IR. This hybrid receptor can bind to IGF-I and II and Insulin. However, it binds IGF-I with higher affinity than insulin. It also activates MAPK/PI3K signalling pathway(55, 56). IGF-IIR is a monomer that weighs 250 kDa(50, 57-59). It has three binding sites, one for IGF-II, and two for proteins that contains mannose-6-phosphate (M6P) including renin, proliferin, thyroglobulin, and TGF-β(60). The expression of IGF-IR is regulated by steroid hormones and different growth factors(50, 51). Since high levels of IGF-I suppress IGF-IR, then IGF-I has a negative feedback effect on the receptor. Expression of IGF-IR is stimulated by other growth factors such as basic FGF, PDGF, and EGF. It is also stimulated by estrogens, glucocorticoids, growth hormone, FSH, luteinizing hormone, and TSH. It was reported that increased IGF-IR expression is associated with castration-resistant antiapoptotic and promitotic IGF signaling in PCa disease progression(61). IGFIR is inhibited by tumor suppressor gene products such as the wild type of p53 protein and Wilm’s Tumor-1 (WT-1) protein(62-65). Nutrition also affects IGF-IR levels(41, 66, 67). 10     Binding of IGFs to IGF-IR activates its intrinsic TK activity, which triggers a cascade of reactions involved in signal transduction pathways. Two major signal transduction pathways have been identified for IGF-IR: the Ras, Raf, mitogenactivated protein kinase (MAPK) pathway, and the other pathway involves phosphoinositol-3-kinase pathway(48, 60). Activation of IGF-IR is necessary to mediate the actions of IGF, and IGF-IR is involved in cell transformation. In vitro studies have shown that by eliminating IGF-IR gene, by suppressing its expression, or by inhibiting its function, cell transformation can be abolished(68). IGF-IIR has no known intracellular catalytic or adaptor signalling capacity, and selectively binds to IGF-II(57). Since binding of IGF-II to IGF-IIR results in the degradation of IGF-II, IGF-IIR can work as an antagonist to IGF-II, decreasing its biological activity(57). Therefore, IGF-IIR has been considered a tumor suppressor molecule. Another feature that makes IGF-IIR efficient as an antagonist to IGF-II is its unusually enhanced biological ability to antagonize IGFII. The extracellular domain of IGF-IIR dissociates after proteolytic degradation of the receptor upon binding IGF-II, and this extracellular part binds IGF-II in the blood resulting in its further degradation(69-74).  1.4.2  IGFBPs  Approximately, 99% of IGF-I is circulating in the bound form with the IGFBPs. There are seven IGF binding proteins known so far (IGFBP 1-7). All IGFBPs bind preferentially to IGF-I(75, 76), except IGFBP-6, which binds preferentially to IGFII(77). IGFBPs consist of three domains of approximately equal length(78-80). 11     The N-terminal and C-terminal domains are highly conserved and cysteine-rich, and are joined by a variable linker domain. There are intra-domain disulfide bonds within the N or C domains but there is no inter-domain disulfide bond(79). The N and C domains are both required for high-affinity IGF binding, because N and C domain fragments bind IGFs with lower affinities than full-length IGFBPs(78, 79, 81-85). IGFBPs bind IGFs and modulate IGF effects by regulating ligand availability to the IGF-IR. By binding 99% of IGF-I, the IGFBPs create a slow release circulating pool, which control the free IGF level available for ligand interaction. This tight control of the free IGF is instrumental for enhancing the function of IGF by preventing the downregulation of its receptor from ligand overexposure(86).  1.4.2.1 IGFBP-1 IGFBP-1 is a 30kDa protein produced in the liver and kidney. Its gene is located on the short arm of chromosome 7 (7p12.3). It binds to IGF-I and IGF-II with equal affinity (KD 0.1 nM)(87-90). It inhibits metabolic as well as the growthpromoting function of IGF-I(91). The N- and C-terminal portions are highly conserved across the IGFBP family and are responsible for IGF binding(92). Phosphorylation of IGFBP-1 enhances its binding affinity to IGF-I by six- to eightfolds, thus enhancing also its ability to inhibit it(93). IGFBP-1 is associated with increased extracellular matrix production and kidney hypertrophy. It is upregulated by insulin deficiency and downregulated by insulin and steroids(76, 94). 12     1.4.2.2  IGFBP-2  The gene for IGFBP-2 is located on the long arm of chromosome 2 (2q35)(95), encoding for a 31kDa protein(96). The concentrations of IGFBP-2 are age-dependent, with high level in infancy and older age adults, but lower levels in young adults(97). The concentration of IGFBP-2 in the seminal fluid (10,000ng/ml) is higher than any other IGFBP in any biological fluid(98). IGFBP-2 is produced by the prostate and the central nervous system (CNS), where it is the major IGFBP in the cerebrospinal fluid (CSF), and was found to be elevated in certain CNS tumors. It was also found to be markedly over-expressed in a number of other malignancies, such as colon, breast, and prostate cancers(99, 100). IGFBP-2 immunohistochemical staining levels are higher in high Gleason grade cancers compared with low-grade cancers or benign epithelial cells(101), and with recurrent castration-resistant tumors than with untreated hormone naïve cells(102). IGFBP-2 has been shown to function as an enhancer of IGF-I function in several cell lines(103, 104), and it participates in CNS development(76). The Cdomain of IGFBP-2 has an RGD motif that binds integrins, leading to altered cell migration(105). IGFBP-2 may associate with the cell surface via glycosaminoglycans, and presumably proteoglycans if high concentrations of IGF-I or -II are present(106, 107). The transfection of IGFBP-2 in human epidermoid carcinoma was found to increase tumorigenisis(108). All these findings suggest that changes in IGF/IGBP-2 signaling may activate alternate 13     growth factor pathway involved in castration-resistant progression. Although the exact mechanism by which IGFBP-2 works is not clearly defined, it has been suggested that it works via phosphatidylinositol 3-kinase (PI3K)/Akt/mammalian target of rapamycin pathway(109, 110). IGFBP-2 is upregulated by reduced insulin levels and reduced protein diet, and is downregulated by rapid proliferation, growth factors, and TGF-β(76).  1.4.2.3  IGFBP-3  The IGFBP-3 gene is located on the short arm of chromosome 7 (7p12.3)(95, 111). It is produced primarily in the liver, while also produced by prostate epithelial cells, osteoblasts, Kupffer cells, and bone tissue. It has three glycosylation sites, and resides in the circulation in different glycosylated forms ranging from (40-44kDa)(97). The non-glycosylated form of IGFBP-3 weighs 29kDa(112). Serum levels of IGFBP-3 and IGF-I vary with age. They start low at birth, then increase over childhood, peaks at puberty, and then start to decline afterwards(112, 113). 75 to 90% of IGF-I in the serum is complexed with IGFBP3 in a ternary complex composed of IGFBP-3, Acid-Labile Subunit (ALS), and IGF. ALS is produced in the liver as a direct effect of GH. It stabilizes the IGFIGFBP-3 complex, prevents IGF-I extravasation to the extravascular compartment, and prolongs its half-life(114). IGFBP-3 is a potent anti-proliferative protein, which induces apoptosis and inhibits proliferation in breast and prostate cancer cells(115-117). Blocking IGFBP-3 synthesis or action inhibits the anti-proliferative activity of transforming 14     growth factor (TGF)-β, retinoic acid, tumor necrosis factor-α and p53(115, 118123), while IGFBP-3 inhibitory signals require an intact (TGF)-β signaling pathway(124). Decreased expression and plasma levels of IGFBP-3 are associated with a number of malignancies, including hepatocellular carcinoma(125), non-small cell lung carcinomas(126), PCa(127-129), and Ewing tumors(130, 131). It was initially thought that IGFBP-3 works by binding IGF-I and IGF-II and prevent their attachment to their receptors, thus inhibiting their action. However, it is believed now that IGFBP-3 also acts via IGF-independent mechanism(117, 132, 133). The exact mechanism of action is not well understood, but it is proposed that it attach to an unidentified cell surface receptor(134, 135) and activate signal transduction pathways(75) or internalization(136). IGFBP-3 is upregulated by IGF-I, IGF-II, TGF-β, 1α,25-dihydroxy Vitamin D, and retinoic acid, and is downregulated by glucocorticoids (e.g. Prostate Specific Antigen PSA, Cathepsin D, and dexamethasone)(76).  1.4.2.4  IGFBP-4  The gene for IGFBP-4 is located on the long arm of chromosome 17 (17q21.2)(95), and it is produced in the liver, bone, central nervous system, and prostate. Its translated protein has a molecular weight of 24 kDa. It is upregulated by parathyroid hormone, GH, and 1α,25-dihydroxy vitamin D, while it is downregulated by IGF-II, and glucocorticoids(76). Several cancer cell-lines express IGFBP-4, including PCa(137). IGFBP-4 binds to IGF-I and acts as an 15     antagonist both in vitro and in vivo, by sequestering it and making it unavailable to its receptor(112, 138). It also delays the onset of tumor formation and enhances apoptosis in a malignant prostate tumor cell lines(139). Antisense inhibition of IGFBP-4 provides a growth advantage of cells in response to IGFI(140). Colony formation of PCa is strongly inhibited in animals with IGFBP-4 transfected cells(139). IGFBP-4 also acts in an IGF-I independent fashion. It inhibits human ovarian steroidogenesis(141), and blocks the differentiation in skeletal myoblasts(142, 143). IGFBP-4 mRNA expression is not necessarily correlated with the protein level, which carries the functional aspects of IGFBP4(137).  1.4.2.5  IGFBP-5  The gene for IGFBP-5 is located on the long arm of chromosome 2 (2q35), next to IGFBP-2(95). It weighs 29kDa(97), and can be found in several glycosylated forms ranging from 29 to 32kDa. Like IGFBP-3, IGFBP-5 levels decline with age, starting after puberty(144). It forms also a trimeric complex with IGFs and ALS. IGFBP-5 is the most abundant IGFBP in the bone. It binds strongly to bone cells due to high affinity for hydroxyapatite(112), thus it sequesters IGF-I in bone matrix. It also binds to endothelial cell monolayers, and is found in high concentrations in the Extracellular Medium (ECM). The affinity of IGFBP-5 to IGF-I when bound to ECM is decreased by 7 to 12 folds when compared with intact IGFBP-5 in solution(145), but this form of IGFBP-5 has a prolonged half16     life(146). IGFBP-5 enhances IGF-I action especially in osteoblasts(146). It is upregulated by diabetic conditions, and downregulated by Follicle stimulating hormone(76). IGFBP-5 is expressed in the PCa cell-line PC3(147). In situ hybridization and immunohistochemical studies have shown the overexpression of IGFBP-5 in malignant prostatic epithelial cells. However, in situ hybridization showed that IGFBP-5 mRNA is restricted to stromal cells, suggesting that IGFBP-5 is released by stromal cells to associate with epithelial cells through internalization to serve as a route for intercellular communication(148). Several studies have shown the growth enhancing effect of IGFBP-5 on PCa cells(149). For example, when the PCa cell line LNCaP was transfected with IGFBP-5, a faster growth was observed when compared to vector-transfected cells. Apoptosis was induced by androgen withdrawal in both transfected and untransfected cells, but only transfected cells were rescued when IGF-I was introduced(149). This suggests that IGFBP-5 enhance the anti-apoptotic effect of IGF-I.  1.4.2.6  IGFBP-6  The gene for IGFBP-6 is located on the long arm of chromosome 12 (12q13.13)(95). It has a molecular weight of 34 kDa, and is produced in the ovary and prostate(76). It is the only IGFBP that binds to IGF-II with higher affinity than IGF-I(150-152). The major function of IGFBP-6 appears to be regulation of IGF-II function by inhibiting its action while having minimal effect on IGF-I function(153). It is 17     upregulated by IGF-II, growth factors, bone morphogenetic proteins, and downregulated by differentiation inducing drugs, and dexamethasone(76).  1.4.2.7  IGFBP-7  The IGFBP-7 gene is located on the long arm of chromosome 4 (4q12). It encodes a 277 amino acid protein, which binds IGF-I. It is found in normal leptomeningeal and senescent mammary epithelial cells(154). It has been suggested to play a role in the growth-regulatory pathways of meningiomas and breast cancer(155).  1.4.3  IGFBP Proteases  IGFBP proteases act to hydrolyze IGFBPs. Their categories include kallikreins(156), cathepsins(157), and matrix metalloproteinases proteases (MMPs)(158). Kallikrein-like serine proteases that cleave IGFBP-3 include PSA, gamma-nerve growth factor, and plasmin(159). In fact, plasmin degrades multiple IGFBPs(159). Thrombin, another serine protease, cleaves IGFBP-5 at physiological doses(160). Transmembrane protease, serine 2 (TMPRSS2), is a putative serine protease to IGFBP-3, and is overexpressed in normal and malignant prostatic epithelial cells(161). TMPRSS2-ERG fusion gene was also found to be overexpressed in PCa(162). Cathepsins are intracellular proteases that are activated under acidic conditions, which might be relevant to certain physiologic and pathologic processes, like tumor infiltration. Under these conditions, hydrogen ions are 18     released creating acidic environment for extracellular cathepsins to work, and through interaction with the IGF system might affect cellular growth rate(163). MMPs are a group of peptide hydrolases that degrade collagen and proteoglycans during tissue remodeling. They need metal cations for their action, and their function is impaired by metal chelators and direct inhibitors(164). IGFBP proteases cleave IGFBPs into fragments that have lower affinity for IGF, increasing the bioavailability of free IGF to the cell receptors(165). IGFBP proteases also have an important autocrine/paracrine growth regulatory rate and they are important for several physiological processes, such as ovarian follicular growth and atresia(166). They also play an important role in certain malignant processes, such as the autocrine IGF axis in PCa(167).  1.4.4 IGFBP-rPs IGFBP-rPs (IGFBP-related peptides) is a recently recognized group of proteins that bind to IGFs with low affinity(168). They exhibit significant structural homology to IGFBPs(169). IGFBP-rP1 mRNA is downregulated in several tumor cell lines, and are highly expressed in senescent mammary epithelial cells, suggesting that IGFBP-rP1 has a role in growth suppression(78). Introduction of IGFBP-rP1 retrovirally into prostate cell lines has resulted in growth suppression. IGFBP-rP2 is involved in atherosclerosis, fibrotic disorders (e.g. scleroderma)(78), and childhood acute lymphoblastic leukemia (ALL)(170). IGFBP-rP3 is a target for Wilm’s Tumor (WT-1) regulation, indicating it is involved in kidney morphogenesis and Wilm’s Tumor(171). IGFBP-rP4 has been shown to 19     promote adhesions of fibroblasts and epithelial cells, and to induce chemotaxis of fibroblasts(172). IGFBP-rP5 mRNA and protein expression is found to be elevated in osteoarthritis. Other IGFBP-rPs have low affinity for IGFs, and their biological functions are not clear(173).  1.4.5  IGF Axis and Androgen Receptor in Prostate Cancer  Most PCa patients progress to CRPC after androgen ablation. Several mechanisms have been described or hypothesized to be responsible for castration-resistant transformation(174, 175). They include mutation or amplification of the androgen receptor (AR) to increase sensitivity to androgens, mutations of AR to allow AR activation by other steroids and anti-androgens, coactivators to increase the sensitivity of the AR, enhanced AR signaling through activation of AR by peptide growth factors and cytokines, and bypass of AR signaling(15, 176). Several interactions have been reported between IGF-I and AR. Androgens increase IGF-IR levels in prostate epithelial cells, IGF-IR signaling alters AR phosphorylation, IGF-IR signaling effects translocation of AR to the nucleus, and inhibition of IGF-IR in conjunction with castration(177).  20     1.5  Antitumor Activity of OGX-225, A Novel ASO Inhibitor of IGFBP-2 and IGFBP-5 in Prostate Cancer Models  If PCa is not detected early, it will metastasize to lymph nodes and bone. The treatment will need to be androgen ablation through medical or surgical castration, and usually PCa will respond initially to the hormonal treatment. But eventually PCa will become castration-resistant. There are different mechanisms proposed for the castration-resistant disease that were mentioned earlier. Many genes are found to be upregulated in PCa, including Bcl-2, Bcl-X, clusterin, Hsp27, IGFBP-2, and IGFBP-5, and they were reported to confer resistance to proapoptotic stimuli(178-180). Experimental evidence strongly suggests the involvement of the IGF system and subsequent activation of downstream kinase signaling in the castration-resistant progression(181, 182). IGFBP-2 and IGFBP-5 levels are correlated while IGFBP-3 is inversely associated with poor prognosis(101). It is clear that IGFBP-3 and IGFBP-4 antagonize the IGF system and enhance the sensitivity to apoptosis(183). However, IGFBP-2 and IGFBP-5 are increased after androgen ablation in CRPC. This suggests that IGFBP-2 and IGFBP-5 play a role in CRPC progression(184, 185). This has made IGFBP-2 and IGFBP-5 a potential target for therapeutics aiming to potentiate the effect of hormonal therapy and prevent the progression to CRPC. OGX-225 is a novel antisense drug (AS) that targets IGFBP-2 and IGFBP5(186). It was found to downregulate IGFBP-2 and IGFBP-5 and induce 21     apoptosis in high-grade human glioma cells(187). It also inhibited the in vitro and in vivo growth of breast cancer cells, which are overexpressing IGFBP-2(188). Antisense olidodeoxynucleotides (ASOs) are chemically modified stretches of single-strand DNA complementary to mRNA regions of a target gene, which inhibit translation by forming DNA/RNA duplexes, thus reducing mRNA and protein levels of the target gene. Initially, ASO was rapidly degraded by cellular nucleases due to its phosphodiester backbone. However, second generation phosphothioate ASO modified at 5’ and 3’ ends modified by methoxy-ethoxy (MOE) residues at the 2’-α-position of the deoxyribose have enhanced RNAbinding affinity and prolonged the half-life of the second generation in comparison to the first(189, 190). It was recently reported in a phase I trial that OGX-011, a second-generation ASO targeting clusterin gene, was well tolerated and potently inhibited clusterin expression in PCa(191). M. Muramaki, et al., from the prostate canter in Vancouver BC, have studied the therapeutic effects of OGX-225, on human PCa cells both in vivo and in vitro (unpublished data). In vitro, the results showed that the growth of both PC3 and LNCaP cells was inhibited by treatment with OGX-225 in a dose-dependent manner, compared to treatment with control oligodeoxynucleotide (ODN). Flowcytometric analysis indicated that OGX-225 resulted in a corresponding relative dose-dependent increase in fraction of cells in sub-G0/G1 phase of LNCaP and PC3 cells. In vivo, compared with control ODN, OGX-225 treatment resulted in the significant reduction of LNCaP and PC3 tumor volume and delayed tumor re-growth. In summary, M Muramaki experiments suggest that 22     OGX-225 inhibits PC3 and LNCaP cell growth (cytotoxic), and downregulates IGFBP-2 and IGFBP-5 (specific), both in vitro and in vivo. The central hypothesis of my thesis is that since OGX-225 downregulates IGFBP-2 and IGFBP-5 in PCa leading to apoptosis, then adding back IGFBP-5 to OGX-225 treated PCa cells will rescue them. Also, that IGFBP-3 inhibits PCa cells growth through an apoptotic mechanism, and that combining IGFBP-3 with OGX-225 will have an additive effect.  1.6  Specific Experimental Objectives  CRPC represents a terminal stage in PCa development in which hormonal therapy no longer is effective, and different chemotherapeutic agents do not show a curative effect. Research is moving quickly to identify different cellular targets for therapies, to cure or prolong survival of patients with this disease. Different proteins were found to be upregulated in CRPC, including IGFBP-2 and IGFBP-5. This has made IGFBP-2 and IGFBP-5 interesting targets for therapeutics, as it is been suggested they may play a role in the castrationresistant progression. M. Muramaki et al experiments have demonstrated unequivocally that OGX-225 (a novel ASO targeting IGFBP-2 and -5) has a cytotoxic effect on PCa cells (PC3 and LNCaP) in a dose-dependent manner. In addition, it was shown that it does specifically downregulates IGFBP-2 and IGFBP-5, and that it inhibits PCa cell growth through induction of apoptosis. My objectives during my one year of work at the prostate center at UBC Vancouver, was to determine the ability to rescue PC3 cells when exposed to 23     OGX-225, using recombinant IGFBP-5. Also, I was studying the effect of adding recombinant IGFBP-3 (a pro-apoptotic protein) to PC3 cells when used alone, and when added to OGX-225 treated cells, using MTS assay and flowcytometry.  24     2  MATERIALS AND METHODS  2.1  Prostate Cancer Cell Lines and Reagents  PC3 human PCa cells were obtained from American Type Culture Collection   (ATCC---www.atcc.org) and maintained in DMEM supplemented with 10% FBS  (Invitrogen Canada Inc. Burlington, Ontario). Frozen cells stored at liquid nitrogen (-196°C) were thawed rapidly in a 37°C water bath and immediately added to 9 ml of media with 5% FBS in a 10 cm plate. General reagents were from (SigmaAldrich, St. Louis, MO) or (Fisher Scientific, Ottawa, ON) unless otherwise indicated. Cells were passaged at 70% confluency, and cultured in 10 cm2 tissue culture plates (Nalge Nunc International, Rochester, NY) at 37°C and 5% CO2. To passage cells, the media was aspirated and cells were washed once in 2 ml of phosphate buffered saline (PBS) and 1 ml of 1x Trypsin-EDTA [10% 10x Trypsin-EDTA (Invitrogen, Burlington, ON) and 90% Fetal Bovine Serum (FBS, Invitrogen, Burlington, ON)] was added to the plates and incubated for one to three minutes to loosen adherent cells. Cells were triturated from the plates with 5 ml of media and added to a larger volume of media for replating. OGX-225 (Antisense Oligodeoxynucleotide ASO, OncoGenex Pharmaceuticals. Vancouver, BC. Canada). The sequence for OGX-225 is 5’CAGCAGCCGCAGCCCGGCTC-3’. Recombinant IGFBP-5 (R&D Systems. Minneapolis, MN). Oligofectamine (Invitrogen, Burlington, ON) was used to 25     increase ASO uptake into cells in vitro. For transfection, the low-serum medium OPTI-MEM (Invitrogen, Burlington, ON) was used. Scramble B (ScrB) (control oligodeoxynucleotide) (Integrated DNA Technologies, Inc., Coralville, IA). The sequence for ScrB is 5’-CAGCAGCAGAGTATTTATCAT-3’.  2.2  MTS Assay  It is a calorimetric method used to detect viable cells in proliferation, cytotoxicity, or chemosensitivity assays. The reagent was a tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium. The electron coupling reagent PMS was maintained separately from the MTS and was added at the time of the MTS use to form a stable complex in the solution. The solution was added then to the medium. The MTS, an aqueous soluble formazan, was then metabolized by dehydrogenase enzymes found in metabolically active cells. In 1-4 hours, the absorbance of formazan crystals was read using 96-well plate at 490 nm. Absorbance was directly proportional to number of living cells in culture. This method differs from MTT assay. Formazan crystals of MTS do not need solubilization in culture medium, whereas formazan crystals of MTT are insoluble in culture medium and they require SDS or DMSO for solubilization. This can be time efficient and cost effective. All MTS reagents were from (Promega, Madison, WI).  26     2.3  Technique for Testing the Ability to Rescue PC3 Cells Exposed to OGX-225  PC3 cells were plated at 40% confluence in 24-well plates. They were allowed to grow in DMEM + 10% FBS without antibiotics for 24 hours at 37°C in humidified 5% CO2. ASOs [OGX-225 (Oncogenex) and ScrB (Integrated DNA Technologies, Inc)] dilutions were prepared at 50, 100, 250, and 500 nM concentrations. The Oligofectamine Reagent (Invitrogen) was combined with OPTI-MEM. Incubation was allowed at room temperature for 10 minutes. The mixture of ASO dilution was combined with Oligofectamine reagent mixture and allowed for incubation for 20 minutes. Media were removed from the plates and replaced with 500 µL of OPTI-MEM in each well. The above-mentioned final mixture was overlaid in each well. The test was done in duplicates. Then, the plates were incubated for 4 hours at 37°C in humidified 5% CO2. 250 µL of DMEM + 15% FBS (Invitrogen) was then added to each well. The same procedure was then repeated on day two. When DMEM + 15% FBS (Invitrogen) was added however on day 2, half of the wells that were exposed to OGX-225 of all concentrations received 350 ng/mL of recombinant IGFBP-5 as well to test for rescue. 48 hours later, MTS assay was done to measure viable cells and thus level of cytotoxicity and rescue.  27     2.4  Technique for Testing the Combined Effect of OGX- 225 and Recombinant IGFBP-3 on PC3 Cells  The same reagents and transfection technique from the previous experiment was repeated here, however the test was done in quadriplicates and when DMEM + 15% FBS (Invitrogen) was added on day 2, half of the wells that were exposed to OGX-225 (OncoGenex) received 2000 ng/mL of recombinant IGFBP3 (R&D Systems. Minneapolis, MN). Some wells that were not exposed to OGX225 also received 2000 ng/mL of IGFBP-3 (R&D Systems) alone. This is to test for the sole effect of IGFBP-3 (R&D Systems) and the combined effect of OGX225 (OncoGenex) and IGFBP-3 (R&D Systems), while other wells did not receive any reagent and were used as control. 48 hours later, MTS assay was done to measure viable cells and thus level of cytotoxicity.  2.5 Technique for Testing the Combined Effect of OGX225 and Recombinant IGFBP-3 on PC3 Cells, Using Flowcytometry In this experiment, using Flowcytometric Analysis (FACS) we analyzed the effect of OGX-225 (OncoGenex) on PC3 cell lines. We compared the effect of OGX-225 (OncoGenex) at a dose of 50 ng/ml to the effect of IGFBP-3 (R&D Systems) and assessed their combined effect. The effect was measured using apoptotic index and DNA content.  28     Four 10 cm2 dishes were prepared. PC3 cells were plated in each dish and were allowed to grow for 2 days to 60% confluence. Then, transfection with OGX-225 (OncoGenex) at a dose of 50 ng/ml was done in 2 of the dishes according to its protocol, which is a two-day transfection using oligofectamine (Invitrogen) in a reduced serum medium (OPTIMEM) with DMEM+10% FBS (Invitrogen) added after 4 hours of each transfection. One of the 2 dishes that received OGX-225 (OncoGenex) received 2000 ng/ml single dose of IGFBP-3 (R&D Systems). One of the 4 dishes received only the same dose of IGFBP-3 (R&D Systems), while another dish was used as a control. After 48 hours, cells floating in the medium were collected and the cells in the dishes were trypsinized and washed with PBS. Then they were fixed with 80% iced ethanol and kept on ice for 2 hours. The iced ethanol was washed with staining buffer. Then cells were stained with propidium iodide (PI) solution for 30 minutes at room temperature. Stained cells were analyzed for PI incorporation and relative DNA content with a BD FACSCanto™ II flow cytometer (BD Biosciences).  29     3  RESULTS  3.1  Inability to Rescue PC3 Cells Exposed to OGX-225  In order to test for the effect of OGX-225 on PC3 cells, a dose-response was measured at doses of 50, 100, 250, and 500 nM. The PC3 cells were treated daily with indicated concentrations of OGX-225 and control ODN daily for 2 days. After 72 hours incubation, the growth of PC3 cells was found to be inhibited by the treatment with OGX-225 in a dose-dependent manner compared to treatment with control ODN. The maximal toxicity was seen at 250 nM, and higher concentrations of OGX-225 did not increase toxicity. This might be explained by the fact that at 250 nM almost all the PC3 cells died and so further increases in the dose will not have a significant effect. Therefore, 250 nM might be the best maximum dose of OGX-225. ScrB had no obvious toxic effects at up to 500 nM. This experiment was modeled and designed on those previously designed and performed by Muramaki et al., but are yet unpublished. In his data he already showed dose and sequence-specific knockdown of IGFBP-2 and IGFBP-5. This experiment was expanded to include testing whether PC3 cells exposed to OGX-225 can be rescued by adding back recombinant IGFBP-5. 350 ng/ml of recombinant IGFBP-5 was added to half the wells exposed to OGX-225 in each dose cohort. Using the MTS assay to test for cell viability there was no observed difference between cells that received recombinant IGFBP-5 and those that did not (Fig. 2), this indicates that the cellular events initiated by exposure to OGX225 cannot be reversed by simply adding recombinant IGFBP-5. 30     The experiment was repeated (data not shown) to test for rescue of PC3 using higher concentration of IGFBP-5 (R&D Systems) (700 ng/mL), and recombinant IGFBP-2 (R&D Systems. Minneapolis, MN) (150, 360, and 700 ng/mL). All of these reagents did not show any rescue to PC3 cells when exposed to OGX-225. This probably indicates that OGX-225 action as a polyspecific agent is an irreversible one. These results were not shown because while I could see that adding those reagents clearly did not have an effect on the PC3 cells, the OGX-225 did not have a dose dependent effect either on PC3 cells Therefore, it was hard to conclude failure of rescue from this experiment.  31        32   Figure 2:  Legend to Fig. 2: Rescuing PC3 cells after being exposed to OGX-225 using 350 ng/ml recombinant IGFBP-5. PC3 cells were exposed to different concentrations of OGX-225 and ScrB. MTS assay was done to detect viable PC3 cells after each treatment. 350 nM of recombinant IGFBP-5 was added to half the wells treated with OGX-225 on the second day of transfection to look for rescue. ScrB had no cytotoxic effects on PC3 cells. OGX-225 had a significant dose-dependent cytotoxic effect. Maximal effect was seen at 250 nM and further concentrations of OGX-225 above 250 nM did not increase toxicity. Recombinant IGFBP-5 did not rescue PC3 cells exposed to OGX-225. Columns, Percentage of living cells in duplicate analysis (n = 3), bars, SD. *, differ from control (p < 0.0001), **, differ from OGX-225 50nM (p < 0.0001), ***, differ from OGX-225 100 nM (p < 0.0001) by Student’s t test.  33     3.2  IGFBP-3 Does Not Have An Additive Effect on PC3 Cells When Combined with OGX-225  IGFBP-3 has been shown to have a growth inhibitory effect in PCa cells(165) (Fig. 3). Rajah et al have shown that IGFBP-3 inhibits PC3 growth by inducing apoptosis(115). After demonstrating the growth inhibitory effect of OGX-225, we wanted to study the effect of combining OGX-225 with IGFBP-3 on the growth of PC3 cells, and whether they would have any additive effect. Using the above mentioned transfection technique; we divided the wells into four cohorts. One cohort received OGX-225, one received IGFBP-3, and one received a combined dose of IGFBP-3 and OGX-225, while one did not receive any agent. Recombinant IGFBP-3 was given at a dose of 2000 ng/ml because Rajah et al did their experiment using 500 ng/ml over 72hrs (Total of 1500 ng/ml). The MTS assay showed the expected growth inhibitory effect of OGX-225 and IGFBP-3. When they were combined however, there was no additive effect observed and it was similar to adding either one alone.  34     Fig. 3: Comparing The Cytotoxic Effect of OGX-225 and Recombinant IGFBP-3 on PC3 cells. PC3 cells were exposed to OGX-225 and recombinant IGFBP-3. MTS assay was done to detect viable PC3 cells after each treatment. Recombinant IGFBP-3 (at 2000 ng/ml) had a similar cytotoxicity profile to 50 nM OGX-225 when compared to control. However, it does not have an additive cytotoxic effect when added with OGX-225. Columns, Percentage of living cells in quadruplicate analysis (n = 4), bars, SD. *, differs from No Treatment (p < 0.05) by Student’s t test.  35     3.3  IGFBP3 Growth Inhibitory Effect on PC3 Cells is Not Apoptotic  After demonstrating the cytotoxic effect of adding IGFBP-3 to PC3 cells, we wanted to examine the cell cycle status of OGX-225 and IGFBP-3 treated PC3 cells for mitotic activity and relative DNA content. We had four cohorts in this experiment, similar to the previous experiment (IGFBP-3, OGX-225, combined OGX-225 and IGFBP-3, and untreated cells). The fraction of cells undergoing apoptosis (sub G0/G1 fraction) was significantly elevated for OGX-225 than for untreated cells. The apoptotic fraction (percentage of sub G0/G1 fraction) of IGFBP-3 was not different from the untreated cells. The apoptotic fraction of the cells exposed to the combined dose of OGX-225 and IGFBP-3 was not different from adding OGX-225 alone (Fig. 4). The possibilities are, IGFBP-3 did not work technically in this experiment or it might be reducing the PC3 count through a different mechanism by arresting the cell cycle, which is not in line with Rajah et al results.  36     Fig. 4: Comparing The Apoptotic Effect of OGX-225 and Recombinant IGFBP-3 on PC3 cells. PC3 cells were treated with OGX-225 and recombinant IGFBP-3. After 48 hours incubation, percentage of sub G0/G1 population was determined by flowcytometry. IGFBP-3 had similar apoptotic effect as control, while OGX-225 at 50 nM concentration had the expected apoptotic effect. The addition of IGFBP-3 to the PC3 cells exposed to OGX-225 did not have any increase in the apoptotic effect of OGX-225. Columns, percentage of sub G0/G1, bars, 95% confidence interval. The 95% confidence interval was calculated based on the relative number of events, as the test was done only once (n = 1). 37     4  DISCUSSION AND CONCLUSIONS  4.1 Discussion PCa is the most commonly diagnosed malignancy in men. Initially, PCa is a hormonally sensitive malignancy, but eventually it progress to a castrationresistant form, which no longer responds to hormonal therapy, and chemotherapeutics do not cure the disease. The IGF family plays a pivotal role in prostate development and castration-resistant progression(181, 182). It is composed of two ligands, IGF-I and IGF-II, which regulate the mitotic and antiapoptotic effects on PCa cell lines. Their action is mediated through two cell surface receptors. The IGF ligands are tightly regulated through 7 high-affinity binding proteins (IGFBP 1-7), a large group of proteases, and low affinity IGFBPrelated peptides. Several strategies have been used to disrupt IGF signaling(175). Growth hormone-releasing hormone (GHRH) antagonists inhibit the release of GH, and function to block IGF-I signaling(192). Neutralization of IGF ligands can inhibit the activation of their receptors. IGFBP-1 has been reported to inhibit IGF-I effects in an IGF-I-dependent manner to induce apoptosis in LNCaP cells(193). Another way to neutralize the ligands is to use antibodies against IGF-I and IGF-II(194). IGF-IR represents an attractive target for anticancer therapeutics(195). Several  38     approaches have been used to inhibit IGF-IR, including ASO(196), siRNA(197), and anti-IGF-IR-monoclonal antibodies(198). Some IGFBPs enhance IGF function, while some IGFBPs act to antagonize IGF. Expression of IGFBPs differs in PCa, where IGFBP-2 and IGFBP-5 are found to be elevated while IGFBP-3 is below normal levels(101). The overexpression of IGFBP-2 and IGFBP-5 after castration represents an adaptive response to increased IGF-I activity and castration-resistant progression(104, 184). Forced over-expression of IGFBP-5 induces LNCaP proliferation, and a corresponding PI3K activation. PI3K inhibitor-induced apoptosis is inhibited by adding IGF-I, suggesting that high-levels of IGFBP-5 enhance the IGF-I antiapoptotic effects. IGFBP-2 is also involved in the progression of PCa, and is found to be elevated more in malignant prostatic disease than hyperplastic(199) and in higher Gleason grade tumor(101). It is also associated with higher risk of PSA recurrence after radical prostatectomy(200), and with castration-resistant progression(104). IGFBP-2 is found to be also elevated in LNCaP cells after androgen withdrawal in vitro, in LNCaP xenografts in vivo, and in the human disease using tissue microarray in untreated and hormonally-treated prostatectomy specimens(104). These data suggest that overexpression of IGFBP-2 and IGFBP-5 post-castration function to enhance IGF-I-mediated proliferation and cell survival.  39     Since both IGFBP-2 and IGFBP-5 are often co-expressed together in PCa progression, and IGFBP-5 is also expressed in the bone and play a role in bone metastases(201), they prove to be attractive targets to slow castration-resistant progression. Monospecific ASO against either IGFBP-2(104) or IGFBP-5(202) was found to delay the castration-resistant progression and attenuates IGF-I responsiveness. The homology between the genes encoding IGFBP-2 and IGFBP-5 allowed the design of bispecific ASO targeting both proteins. It is termed OGX-225 (OncoGenex, Vancouver, Canada). M. Muramaki et al, have provided in their unpublished data the first preclinical proof-of-concept to support clinical trials with OGX-225. OGX-225 has potently suppressed both IGFBP-2 and IGFBP-5 in a dose- and sequence-specific fashion in LNCaP and PC3 cells, respectively. OGX-225 also inhibited the growth of LNCaP and PC3 cells both in vitro and in vivo, by increasing the apoptotic rates in a dose-dependent and sequence-specific manner. These findings provide the evidence that knocking down these targets with this drug can delay the castration-resistant progression. In my thesis, I have shown a replication of the dose-dependent cytotoxic effects of OGX-225 on PC3 cells in comparison to control ODN, which was observed in M. Muramaki et al experiments. In order to demonstrate that the cytotoxic effects of 225 are due to targeting the IGFBPs, I attempted a rescue experiment designed to replace the putative OGX-225 target IGFBP-5 with recombinant IGFBP-5. However, the PC3 cells exposed to OGX-225 could not be rescued by adding recombinant IGFBP-5 at 350 ng/ml concentration to them. 40     This might suggest that the initial apoptotic pathway triggered by OGX-225 is an irreversible one, and simply adding back growth factors might be too late to result in the survival of the exposed PCa cells. It also might suggest that OGX-225 has other sites of action, other than IGFBP-2 and IGFBP-5, due to possible sequence homology with other proteins or growth factors. A Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI) database revealed a homology of OGX-225 to several targets of different (sometimes opposing), or unknown functions (Table 1). As shown in table 1, while OGX-225 share a sequence homology with its intended targets IGFBP-2 and IGFBP-5 (enhancers of IGF-I function), it also share a sequence homology with TGF-β, IGFBP-3, and IGFBP-4 which are pro-apoptotic molecules. It also shows a sequence homology with TBX-2, which is implicated in the development of several tissues and has a possible role in several types of cancer including breast cancer and melanoma. However, its role in normal or malignant prostate has not been studied. Other homologous targets have either unknown function or their role in prostate has not been studied. These targets include PDE6D, SPEG, PRRT2, PIB5PA, GPR180, ARID1B, and ALX4. It is difficult, given the amount of the available information and the several sequence homologies with diverse targets, to determine the exact reason for the failure to rescue PCa cells exposed to OGX-225, and this remains an area that requires further research to be done. IGFBP-3 plays a role as a growth inhibitory protein in PCa cells(165). Initially, it was thought that it functions only by sequestering IGF and preventing it from binding to its receptor. However, further data have suggested that it inhibits 41     growth through IGF-independent mechanism. R. Rajah et al, have shown that IGFBP-3 inhibits growth in PC3 cells by inducing apoptosis(115). Using MTS assay, I have demonstrated the growth inhibitory effect of IGFBP-3 on PC3 cells, it was comparable to adding OGX-225. However, adding IGFBP-3 in addition to OGX-225 did not have any additive effect. The fact that the growth inhibitory function of IGFBP-3 requires an intact TGF-β pathway(124), and OGX-225 downregulates TGF-β pathway, might explain the non-additive effect of IGFBP-3 on PC3 cells when combined with OGX-225. Using flowcytometry, the apoptosis-inducing effect of OGX-225 on PC3 cells was again observed here. IGFBP-3 did not demonstrate any apoptotic effect in this experiment. The apoptotic effect -assessed by measuring the cells in subG0/G1 phase- of IGFBP-3 was similar to control, and when given in addition to OGX-225 to PC3 cells there was no increase in the apoptotic effect of OGX-225. This might suggest that recombinant IGFBP-3 did not work technically in this experiment, or that IGFBP-3 act through a different mechanism than apoptosis, possibly by arresting the cell cycle, which is not in line with R. Rajah et al results.    42     Table 1: Homologous targets to OGX-225  Name of Protein  Insulin-like growth factor binding protein 5 (IGFBP5) Insulin-like growth factor binding protein 3 (IGFBP3), transcript variant 1  Sequence Alignment  Query 1 Sbjct 940  CAGCAGCCGCAGCCCGGCTC 20 |||||||||||||||||||| CAGCAGCCGCAGCCCGGCTC 921  Query 1  CAGCAGCCGCAGCCCGGCTC  Sbjct 341  |||||||||||||||||||| CAGCAGCCGCAGCCCGGCTC 322  Insulin-like growth factor binding protein 3 (IGFBP3), transcript variant 2  Query 1  Insulin-like growth factor binding protein 2, 36kDa (IGFBP2)  Query 1  Query T-box 2 (TBX2) Sbjct     6  CAGCAGCCGCAGCCCGGCTC 20 |||||||||||||||||||| CAGCAGCCGCAGCCCGGCTC 370  GCCGCAGCCCGGCTC ||||||||||||||| 1411 GCCGCAGCCCGGCTC  Query coverage  Maximum Identity  NM_000599.2  100%  100%  Enhance function(146)  NM_001013398.1  100%  100%  Anti-proliferative protein(115)  NM_000598.4  100%  100%  Anti-proliferative protein  NM_000597.2  100%  100%  Enhance IGF-I function(103), enhance CNS development(76)  100%  Transcription factor in the development of several tissues, including kidney and mammary glands(203)  20 NM_005994.3 1425  Protein Function  IGF-I  20  CAGCAGCCGCAGCCCGGCTC 20 |||||||||||||||||||| Sbjct 341 CAGCAGCCGCAGCCCGGCTC 322  Sbjct 389  Accesion Number  100%  41   Name of Protein  Phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D)  SPEG complex locus (SPEG)  Insulin-like growth factor binding protein 4 (IGFBP4)  Transforming growth factor, beta 1 (TGFB1)  Sequence Alignment  Query 5 Sbjct 72  Query 5 Sbjct 705  Query 4 Sbjct 476 Query 1 Sbjct 894  AGCCGCAGCCCGGCT ||||||||||||||| AGCCGCAGCCCGGCT  CAGCAGCCGCAGCCC ||||||||||||||| CAGCAGCCGCAGCCC  CAGCCGCAGCCCGGCTC ||||||||||||||||| CAGCCGCAGCCCGGCTC CAGCAGCCGCAGCCCGG ||||||||||||||||| CAGCAGCCGCAGCCCGG  Accesion Number  Query coverage  Maximum Identity  Protein Function  NM_002601.2  90%  100%  Regulates the level of cGMP in vertebrate photoreceptor cells(204)  19 58  NM_005876.4  90%  100%  Regulates the growth and differentiation of vascular smooth muscle cells(203)  NM_001552.2   85%  100%  Anti-proliferative protein(114)  NM_000660.3   85%  100%  Anti-proliferative protein(205)  15 7042  20 460 17 878                42      Sequence Alignment  Accesion Number   Query coverage  Maximum Identity  CAGCAGCCGCAGCCCGG 17 ||||||||||||||||| Sbjct 189 CAGCAGCCGCAGCCCGG 173  NM_145239.2  0.85  100%  Unknown  Name of Protein  Proline-rich transmembrane protein 2 (PRRT2)  Phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A (PIB5PA), transcript variant 1  G protein-coupled (GPR180)  receptor  180  Query 1  GCAGCCGCAGCCCGG 17 ||||||||||||||| Sbjct 1768 GCAGCCGCAGCCCGG 1782  NM_014422.2  75%  100%  Negative regulator of PI3-kinase signalling events that promote neurite elongation and survival(206)  NM_180989.4  75%  100%  May play a role remodelling(206)  NM_003898.2  75%  100%  May be involved in different protein-protein interactions(207)  100%  Associated with protein binding and transcription co-activator activity by chromatin-regulated transcription(208) and maintenance(208)  Query 3  Query 1 Sbjct 99 Query 1  Synaptojanin 2 (SYNJ2) Sbjct 105  AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 3  Protein Function  Query 1 Sbjct 178  CAGCAGCCGCAGCCC ||||||||||||||| CAGCAGCCGCAGCCC CAGCAGCCGCAGCCC ||||||||||||||| CAGCAGCCGCAGCCC  15 85 15 91  CAGCAGCCGCAGCCC 15 ||||||||||||||| CAGCAGCCGCAGCCC 1799  NM_175863.2  75%  in  vascular        43   Name of Protein  AT rich interactive domain 1B (SWI1like) (ARID1B), transcript variant 1  AT rich interactive domain 1B (SWI1like) (ARID1B), transcript variant 2  CAGCAGCCGCAGCCC 15 ||||||||||||||| Sbjct 1785 CAGCAGCCGCAGCCC 1799  Query coverage  Maximum Identity  Protein Function  100%  Associated with protein binding and transcription co-activator activity by chromatin-regulated transcription and maintenance  Query 1  CAGCAGCCGCAGCCC 15 ||||||||||||||| Sbjct 1824 CAGCAGCCGCAGCCC 1838  NM_017519.1  75%  NM_020732.2  75%  100%  Associated with protein binding and transcription co-activator activity by chromatin-regulated transcription and maintenance.  NM_021926.2  75%  100%  Homeodomain protein expressed in the mesenchymal compartment of a number of developing tissues (209)  Query 1  Query 1 Aristaless-like homeobox 4 (ALX4) Sbjct 432     Accesion Number   Sequence Alignment  CAGCAGCCGCAGCCC ||||||||||||||| CAGCAGCCGCAGCCC  15 446  44   4.2  Conclusions  CRPC represents a lethal form of the disease. IGFBP-2 and IGFBP-5 are overexpressed in this form of cancer and are antiapoptotic, while IGFBP-3 is downregulated and has a growth inhibitory effect in PCa. OGX-225 is a secondgeneration ASO that targets both IGFBP-2 and IGFBP-5, and inhibits growth of PCa cells both in vitro and in vivo through apoptosis. Our data show inability to rescue PC3 cells exposed to IGFBP-5. Since OGX-225 affects different targets in PCa cells, affecting these targets in combination might be responsible for the cytotoxic effect of OX-225, and simply adding back IGFBP-5 would not rescue PCa cells from such a multi-targeting drug. Also, they demonstrate the growth inhibitory effect of IGFBP-3 on PC3 cells, however we showed that IGFBP-3 might not work through an apoptotic pathway, and it does not have an additive effect on PC3 cells when combined with OGX-225.     46   BIBLIOGRAPHY  1.  Canadian Cancer Society 2009.  2.  De Klerk DP HW, Coffey DS. Studies on the role of macromolecular Synthesis in the growth of the prostate. In: Grayhack JT WJ, Sherbenske MJ editor. In Benign Prostatic Hyperplasia. Washington, DC1976. p. 43-51.  3.  D C. The Biology, endocrinology, and physiology of the prostate and seminal vesicles. In: Walsy PC RA, Stamey TA, editor. Campbell's Urology1992.  4.  Aumüller G. Morphologic and endocrine aspects of prostatic function. The Prostate. 1983;4(2):195-214.  5.  Cunha GR, Alarid ET, Turner T, Donjacour AA, Boutin EL, Foster BA. Normal and abnormal development of the male urogenital tract. Role of androgens, mesenchymal-epithelial interactions, and growth factors. J Androl. 1992 November 1, 1992;13(6):465-75.  6.  Ezzat S, Asa SL. FGF Receptor Signaling at the Crossroads of Endocrine Homeostasis and Tumorigenesis. Horm Metab Res. 2005;37(06):355-60.  7.  Furlanetto R, Harwell S, Frick K. Insulin-like growth factor-I induces cyclin-D1 expression in MG63 human osteosarcoma cells in vitro. Mol Endocrinol. 1994 April 1, 1994;8(4):510-7.     47   8.  Byrne RL, Leung H, Neal DE. Peptide growth factors in the prostate as mediators of stromal epithelial interaction. Br J Urol. 1996 May;77(5):627-33.  9.  Bonkhoff H, Remberger K. Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: A stem cell model. The Prostate. 1996;28(2):98-106.  10.  Abrahamsson P-A, Lilja H. Partial characterization of a thyroid-stimulating hormone-like peptide in neuroendocrine cells of the human prostate gland. The Prostate. 1989;14(1):71-81.  11.  Catalona WJ HM. Definitive therapy for localized prostate cancer- an overview. In: Wein AJ KL, Novick AC, Partin AW, Peters CA, editor. Campbell-Walsh Urology 9th edition2006. p. 2932-46.  12.  Cunha GR, Ricke W, Thomson A, Marker PC, Risbridger G, Hayward SW, et al. Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol. 2004 Nov;92(4):221-36.  13.  LaczkÛ In, Hudson DL, Freeman A, Feneley MR, Masters JR. Comparison of the zones of the human prostate with the seminal vesicle: Morphology, immunohistochemistry, and cell kinetics. The Prostate. 2005;62(3):260-6.  14.  Huggins C, Hodges CV. Studies on Prostatic Cancer: I. The Effect of Castration, Of Estrogen and of Androgen Injection on Serum Phosphatases in Metastatic Carcinoma of the Prostate. CA Cancer J Clin. 1972 July 1, 1972;22(4):232-40.     48   15.  Feldman BJ FD. The development of androgen-independent prostate cancer. Nat Rev Cancer. 2001;1:34-45.  16.  McNeal J, Kindrachuk R, Freiha F, Bostwick D, Redwine E, Stamey T. PATTERNS OF PROGRESSION IN PROSTATE CANCER. The Lancet. [doi: DOI: 10.1016/S0140-6736(86)90715-4]. 1986;327(8472):60-3.  17.  Osborne CK DA, Von Hoff DD, Crawford ED. Mitoxantrone: modest activity in a phase II trial in advanced prostate cancer. Cancer Treat Rep. 1983;67(12):1133-5.  18.  Friedland D, Cohen J, Miller R, Jr., Voloshin M, Gluckman R, Lembersky B, et al. A phase II trial of docetaxel (Taxotere) in hormone-refractory prostate cancer: correlation of antitumor effect to phosphorylation of Bcl-2. Semin Oncol. 1999 Oct;26(5 Suppl 17):19-23.  19.  Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med. 2004 Oct 7;351(15):1502-12.  20.  Sowery RD, Hadaschik BA, So AI, Zoubeidi A, Fazli L, Hurtado-Coll A, et al. Clusterin knockdown using the antisense oligonucleotide OGX-011 resensitizes docetaxel-refractory prostate cancer PC-3 cells to chemotherapy. BJU Int. 2008 Aug;102(3):389-97.     49   21.  Festuccia C, Gravina GL, Biordi L, D'Ascenzo S, Dolo V, Ficorella C, et al. Effects of EGFR tyrosine kinase inhibitor erlotinib in prostate cancer cells in vitro. Prostate. 2009 Oct 1;69(14):1529-37.  22.  Attard G, Reid AH, A'Hern R, Parker C, Oommen NB, Folkerd E, et al. Selective inhibition of CYP17 with abiraterone acetate is highly active in the treatment of castration-resistant prostate cancer. J Clin Oncol. 2009 Aug 10;27(23):3742-8.  23.  Liu S, Yamauchi H. Etoposide induces growth arrest and disrupts androgen receptor signaling in prostate cancer cells. Oncol Rep. 2010 Jan;23(1):16570.  24.  Cunha GR. Androgenic effects upon prostatic epithelium are mediated via trophic influences from stroma. Prog Clin Biol Res. 1984;145:81-102.  25.  Cunha GR, Cooke PS, Kurita T. Role of stromal-epithelial interactions in hormonal responses. Archives of Histology and Cytology. 2004;67(5):417-34.  26.  Attar RM, Takimoto CH, Gottardis MM. Castration-resistant prostate cancer: locking up the molecular escape routes. Clin Cancer Res. 2009 May 15;15(10):3251-5.  27.  Pollak M. Insulin-like growth factor physiology and cancer risk. European Journal of Cancer. [doi: DOI: 10.1016/S0959-8049(00)00102-7]. 2000;36(10):1224-8.     50   28.  Pollak M. Insulin-like Growth Factors and Prostate Cancer. Epidemiol Rev. 2001 January 1, 2001;23(1):59-66.  29.  Gennigens C, Menetrier-Caux C, Droz JP. Insulin-Like Growth Factor (IGF) family and prostate cancer. Critical Reviews in Oncology/Hematology. [doi: DOI: 10.1016/j.critrevonc.2005.10.003]. 2006;58(2):124-45.  30.  Parrizas M, LeRoith D. Insulin-Like Growth Factor-1 Inhibition of Apoptosis Is Associated with Increased Expression of the bcl-xL Gene Product. Endocrinology. 1997 March 1, 1997;138(3):1355-8.  31.  Murillo H, Huang H, Schmidt LJ, Smith DI, Tindall DJ. Role of PI3K signaling in survival and progression of LNCaP prostate cancer cells to the androgen refractory state. Endocrinology. 2001 Nov;142(11):4795-805.  32.  Akagi Y, Liu W, Zebrowski B, Xie K, Ellis LM. Regulation of Vascular Endothelial Growth Factor Expression in Human Colon Cancer by Insulin-like Growth Factor-I. Cancer Res. 1998 September 1, 1998;58(17):4008-14.  33.  Playford MP, Bicknell D, Bodmer WF, Macaulay VM. Insulin-like growth factor 1 regulates the location, stability, and transcriptional activity of Œ≤-catenin. Proceedings of the National Academy of Sciences of the United States of America. 2000 October 24, 2000;97(22):12103-8.  34.  Grant S. Cotargeting survival signaling pathways in cancer. J Clin Invest. 2008 Sep;118(9):3003-6.     51   35.  Laplante M, Sabatini DM. mTOR signaling at a glance. J Cell Sci. 2009 Oct 15;122(Pt 20):3589-94.  36.  Sara VR, Hall K. Insulin-like growth factors and their binding proteins. Physiol Rev. 1990 July 1, 1990;70(3):591-614.  37.  JE Brissenden UA, Francke U. Human chromosomal mapping of genes for insulin-like growth factors I and II and epidermal growth factor. Nature. 1984.  38.  Rinderknecht E, Humbel RE. Primary structure of human insulin-like growth factor II. FEBS Lett. 1978 May 15;89(2):283-6.  39.  Herington AC, Cornell HJ, Kuffer AD. Recent advances in the biochemistry and physiology of the insulin-like growth factor/somatomedin family. Int J Biochem. 1983;15(10):1201-10.  40.  Kaklamani VG, Linos A, Kaklamani E, Markaki I, Mantzoros C. Age, sex, and smoking are predictors of circulating insulin-like growth factor 1 and insulinlike growth factor-binding protein 3. J Clin Oncol. 1999 Mar;17(3):813-7.  41.  THISSEN J-P, KETELSLEGERS J-M, UNDERWOOD LE. Nutritional Regulation of the Insulin-Like Growth Factors. Endocr Rev. 1994 February 1, 1994;15(1):80-101.  42.  Tannenbaum G, Guyda H, Posner B. Insulin-like growth factors: a role in growth hormone negative feedback and body weight regulation via brain. Science. 1983 April 1, 1983;220(4592):77-9.     52   43.  Kulik G, Weber MJ. Akt-dependent and -independent survival signaling pathways utilized by insulin-like growth factor I. Mol Cell Biol. 1998 Nov;18(11):6711-8.  44.  O'Dell SD, Day IN. Insulin-like growth factor II (IGF-II). Int J Biochem Cell Biol. 1998 Jul;30(7):767-71.  45.  Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulin-like growth factors in embryonic and postnatal growth. Cell. 1993 Oct 8;75(1):73-82.  46.  Pavelic K, Bukovic D, Pavelic J. The role of insulin-like growth factor 2 and its receptors in human tumors. Mol Med. 2002 Dec;8(12):771-80.  47.  Nielsen FC, Nielsen J, Christiansen J. A family of IGF-II mRNA binding proteins (IMP) involved in RNA trafficking. Scand J Clin Lab Invest Suppl. 2001;234:93-9.  48.  LEROITH D, WERNER H, BEITNER-JOHNSON D, ROBERTS AT, JR. Molecular and Cellular Aspects of the Insulin-Like Growth Factor I Receptor. Endocr Rev. 1995 April 1, 1995;16(2):143-63.  49.  Yu H, Rohan T. Role of the Insulin-Like Growth Factor Family in Cancer Development and Progression. J Natl Cancer Inst. 2000 September 20, 2000;92(18):1472-89.     53   50.  Stewart CE, Rotwein P. Growth, differentiation, and survival: multiple physiological functions for insulin-like growth factors. Physiol Rev. 1996 October 1, 1996;76(4):1005-26.  51.  Sepp-Lorenzino L. Structure and function of the insulin-like growth factor I receptor. Breast Cancer Research and Treatment. [10.1023/A:1005955017615]. 1998;47(3):235-53.  52.  Dricu A, Kanter L, Wang M, Nilsson G, Hjertman M, Wejde J, et al. Expression of the insulin-like growth factor 1 receptor (IGF-1R) in breast cancer cells: evidence for a regulatory role of dolichyl phosphate in the transition from an intracellular to an extracellular IGF-1 pathway. Glycobiology. 1999 Jun;9(6):571-9.  53.  Steele-Perkins G, Turner J, Edman JC, Hari J, Pierce SB, Stover C, et al. Expression and characterization of a functional human insulin-like growth factor I receptor. Journal of Biological Chemistry. 1988 August 15, 1988;263(23):11486-92.  54.  Frattali AL, Pessin JE. Relationship between alpha subunit ligand occupancy and beta subunit autophosphorylation in insulin/insulin-like growth factor-1 hybrid receptors. Journal of Biological Chemistry. 1993 April 5, 1993;268(10):7393-400.  55.  Benyoucef S, Surinya KH, Hadaschik D, Siddle K. Characterization of insulin/IGF hybrid receptors: contributions of the insulin receptor L2 and Fn1     54   domains and the alternatively spliced exon 11 sequence to ligand binding and receptor activation. Biochem J. 2007 May 1;403(3):603-13. 56.  Cox ME, Gleave ME, Zakikhani M, Bell RH, Piura E, Vickers E, et al. Insulin receptor expression by human prostate cancers. Prostate. 2009 Jan 1;69(1):33-40.  57.  Oates AJ, Schumaker LM, Jenkins SB, Pearce AA, DaCosta SA, Arun B, et al. The mannose 6-phosphate/insulin-like growth factor 2 receptor (M6P/IGF2R), a putative breast tumor suppressor gene. Breast Cancer Res Treat. 1998 Feb;47(3):269-81.  58.  Morgan DO, Edman JC, Standring DN, Fried VA, Smith MC, Roth RA, et al. Insulin-like growth factor II receptor as a multifunctional binding protein. Nature. 1987 Sep 24-30;329(6137):301-7.  59.  Oshima A, Nolan CM, Kyle JW, Grubb JH, Sly WS. The human cationindependent mannose 6-phosphate receptor. Cloning and sequence of the full-length cDNA and expression of functional receptor in COS cells. Journal of Biological Chemistry. 1988 February 15, 1988;263(5):2553-62.  60.  JONES JI, CLEMMONS DR. Insulin-Like Growth Factors and Their Binding Proteins: Biological Actions. Endocr Rev. 1995 February 1, 1995;16(1):3-34.  61.  Krueckl SL, Sikes RA, Edlund NM, Bell RH, Hurtado-Coll A, Fazli L, et al. Increased insulin-like growth factor I receptor expression and signaling are     55   components of androgen-independent progression in a lineage-derived prostate cancer progression model. Cancer Res. 2004 Dec 1;64(23):8620-9. 62.  Werner H, Re GG, Drummond IA, Sukhatme VP, Rauscher FJ, Sens DA, et al. Increased expression of the insulin-like growth factor I receptor gene, IGF1R, in Wilms tumor is correlated with modulation of IGF1R promoter activity by the WT1 Wilms tumor gene product. Proceedings of the National Academy of Sciences of the United States of America. 1993 June 15, 1993;90(12):5828-32.  63.  Werner H. Dysregulation of the Type 1 IGF receptor as a paradigm in tumor progression. Molecular and Cellular Endocrinology. [doi: DOI: 10.1016/S03037207(98)00099-9]. 1998;141(1-2):1-5.  64.  Werner H, Karnieli E, Rauscher FJ, LeRoith D. Wild-type and mutant p53 differentially regulate transcription of the insulin-like growth factor I receptor gene. Proceedings of the National Academy of Sciences of the United States of America. 1996 August 6, 1996;93(16):8318-23.  65.  Prisco M, Hongo A, Rizzo M, Sacchi A, Baserga R. The insulin-like growth factor I receptor as a physiologically relevant target of p53 in apoptosis caused by interleukin-3 withdrawal. Mol Cell Biol. 1997 March 1, 1997;17(3):1084-92.  66.  Qu Z, Chow JC, Ling P-R, Ziegler TR, Bistrian BR, Smith RJ. Tissue-specific effects of chronic dietary protein restriction and gastrostomy on the insulin-like     56   growth factor-I pathway in the liver and colon of adult rats. Metabolism. [doi: DOI: 10.1016/S0026-0495(97)90015-9]. 1997;46(6):691-7. 67.  Zhang W, Thornton Jr. WH, MacDonald RS. Insulin-Like Growth Factor-I and II Receptor Expression in Rat Colon Mucosa Are Affected by Dietary Lipid Intake. J Nutr. 1998 February 1, 1998;128(2):158-65.  68.  Baserga R. The Insulin-like Growth Factor I Receptor: A Key to Tumor Growth? Cancer Res. 1995 January 15, 1995;55(2):249-52.  69.  Kiess W, Greenstein LA, White RM, Lee L, Rechler MM, Nissley SP. Type II insulin-like growth factor receptor is present in rat serum. Proceedings of the National Academy of Sciences of the United States of America. 1987 November 1987;84(21):7720-4.  70.  MacDonald RG, Tepper MA, Clairmont KB, Perregaux SB, Czech MP. Serum form of the rat insulin-like growth factor II/mannose 6-phosphate receptor is truncated in the carboxyl-terminal domain. Journal of Biological Chemistry. 1989 February 25, 1989;264(6):3256-61.  71.  Valenzano KJ, Remmler J, Lobel P. Soluble Insulin-like Growth Factor II/Mannose 6-Phosphate Receptor Carries Multiple High Molecular Weight Forms of Insulin-like Growth Factor II in Fetal Bovine Serum. Journal of Biological Chemistry. 1995 July 7, 1995;270(27):16441-8.  72.  Zaina S, Squire S. The Soluble Type 2 Insulin-like Growth Factor (IGF-II) Receptor Reduces Organ Size by IGF-II-mediated and IGF-II-independent     57   Mechanisms. Journal of Biological Chemistry. 1998 October 30, 1998;273(44):28610-6. 73.  Xu Y, Papageorgiou A, Polychronakos C. Developmental Regulation of the Soluble Form of Insulin-Like Growth Factor-II/Mannose 6-Phosphate Receptor in Human Serum and Amniotic Fluid. J Clin Endocrinol Metab. 1998 February 1, 1998;83(2):437-42.  74.  Costello M, Baxter RC, Scott CD. Regulation of Soluble Insulin-Like Growth Factor II/Mannose 6-Phosphate Receptor in Human Serum: Measurement by Enzyme-Linked Immunosorbent Assay. J Clin Endocrinol Metab. 1999 February 1, 1999;84(2):611-7.  75.  Ricort J-M. Insulin-like growth factor binding protein (IGFBP) signalling. Growth Hormone & IGF Research. [doi: DOI: 10.1016/j.ghir.2004.02.002]. 2004;14(4):277-86.  76.  Meinbach DS, Lokeshwar BL. Insulin-like growth factors and their binding proteins in prostate cancer: cause or consequence? Urol Oncol. 2006 JulAug;24(4):294-306.  77.  Baxter RC, Saunders H. Radioimmunoassay of insulin-like growth factorbinding protein-6 in human serum and other body fluids. J Endocrinol. 1992 July 1, 1992;134(1):133-9.  78.  Hwa V, Oh Y, Rosenfeld RG. The Insulin-Like Growth Factor-Binding Protein (IGFBP) Superfamily. Endocr Rev. 1999 December 1, 1999;20(6):761-87.     58   79.  Bach LA, Headey SJ, Norton RS. IGF-binding proteins - the pieces are falling into place. Trends in Endocrinology and Metabolism. [doi: DOI: 10.1016/j.tem.2005.05.005]. 2005;16(5):228-34.  80.  Kuang Z, Yao S, Keizer DW, Wang CC, Bach LA, Forbes BE, et al. Structure, Dynamics and Heparin Binding of the C-terminal Domain of Insulin-like Growth Factor-binding Protein-2 (IGFBP-2). Journal of Molecular Biology. [doi: DOI: 10.1016/j.jmb.2006.09.006]. 2006;364(4):690-704.  81.  Firth SM, Baxter RC. Cellular Actions of the Insulin-Like Growth Factor Binding Proteins. Endocr Rev. 2002 December 1, 2002;23(6):824-54.  82.  Carrick F, Wallace J, Forbes B. The interaction of Insulin-like Growth Factors (IGFs) with Insulin-like Growth Factor Binding Proteins (IGFBPs): a review. Letters in Peptide Science. [10.1007/BF02446511]. 2001;8(3):147-53.  83.  Denley A, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE. Molecular interactions of the IGF system. Cytokine & Growth Factor Reviews. [doi: DOI: 10.1016/j.cytogfr.2005.04.004].16(4-5):421-39.  84.  Carrick FE, Forbes BE, Wallace JC. BIAcore Analysis of Bovine Insulin-like Growth Factor (IGF)-binding Protein-2 Identifies Major IGF Binding Site Determinants in Both the Amino- and Carboxyl-terminal Domains. Journal of Biological Chemistry. 2001 July 20, 2001;276(29):27120-8.     59   85.  Headey SJ, Leeding KS, Norton RS, Bach LA. Contributions of the N- and Cterminal domains of IGF binding protein-6 to IGF binding. J Mol Endocrinol. 2004 October 1, 2004;33(2):377-86.  86.  Boisclair YR, Rhoads RP, Ueki I, Wang J, Ooi GT. The acid-labile subunit (ALS) of the 150 kDa IGF-binding protein complex: an important but forgotten component of the circulating IGF system. J Endocrinol. 2001 Jul;170(1):63-70.  87.  Lee PD CC, Powell DR. Regulation and function of insulin-like growth factorbinding protein-1. Proc Soc Exp Biol Med. 1993(1):2-29.  88.  Lee PD GL, Conover CA, Powell DR. Insulin-like growth factor binding protein-1: recent findings and new directions. Proc Soc Exp Biol Med. 1997;216(3):319-57.  89.  Wheatcroft SB, Kearney MT. IGF-dependent and IGF-independent actions of IGF-binding protein-1 and -2: implications for metabolic homeostasis. Trends in Endocrinology & Metabolism. [doi: DOI: 10.1016/j.tem.2009.01.002]. 2009;20(4):153-62.  90.  Beattie J, Allan GJ, Lochrie JD, Flint DJ. Insulin-like growth factor-binding protein-5 (IGFBP-5): a critical member of the IGF axis. Biochem J. 2006 Apr 1;395(1):1-19.  91.  Murphy LJ, Rajkumar K, Molnar P. Phenotypic manifestations of insulin-like growth factor binding protein-1 (IGFBP-1) and IGFBP-3 overexpression in     60   transgenic mice. Progress in Growth Factor Research. [doi: DOI: 10.1016/0955-2235(95)00026-7]. 1995;6(2-4):425-32. 92.  Sitar T, Popowicz GM, Siwanowicz I, Huber R, Holak TA. Structural basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding proteins. Proceedings of the National Academy of Sciences. 2006 August 29, 2006;103(35):13028-33.  93.  Sakai K, D'Ercole AJ, Murphy LJ, Clemmons DR. Physiological differences in insulin-like growth factor binding protein-1 (IGFBP-1) phosphorylation in IGFBP-1 transgenic mice. Diabetes. 2001 Jan;50(1):32-8.  94.  UNTERMAN TG, OEHLER DT, MURPHY LJ, LACSON RG. Multihormonal Regulation of Insulin-Like Growth Factor-Binding Protein-1 in Rat H4IIE Hepatoma Cells: The Dominant Role of Insulin. Endocrinology. 1991 June 1, 1991;128(6):2693-701.  95.  Allander SV BS, Larsson C, et al. Structure and chromosomal localization of human insulin-like growth factor binding-protein genes. Growth Regul. 1993;3(1):3-5.  96.  Shimasaki S, Ling N. Identification and molecular characterization of insulinlike growth factor binding proteins (IGFBP-1, -2, -3, -4, -5 and -6). Progress in Growth Factor Research. [doi: DOI: 10.1016/0955-2235(91)90003-M]. 1991;3(4):243-66.     61   97.  Levitt Katz LE, Rosenfeld RG, Cohen SP. Clinical Significance of Insulin-Like Growth Factor Binding Proteins (IGFBPs). The Endocrinologist. 1995;5(1):3643.  98.  Schwander J MJ. The RIA for IGFBP-2 in man: A meagre catch? . Growth Regul. 1993;3(1):104-8.  99.  Hoeflich A, Reisinger R, Lahm H, Kiess W, Blum WF, Kolb HJ, et al. Insulinlike Growth Factor-binding Protein 2 in Tumorigenesis: Protector or Promoter? Cancer Res. 2001 December 1, 2001;61(24):8601-10.  100.  Zhang W, Wang H, Song SW, Fuller GN. Insulin-like Growth Factor Binding Protein 2: Gene Expression Microarrays and the Hypothesis-generation Paradigm. Brain Pathology. 2002;12(1):87-94.  101.  Figueroa JA, De Raad S, Tadlock L, Speights VO, Rinehart JJ. DIFFERENTIAL EXPRESSION OF INSULIN-LIKE GROWTH FACTOR BINDING PROTEINS IN HIGH VERSUS LOW GLEASON SCORE PROSTATE CANCER. The Journal of Urology. [doi: DOI: 10.1016/S00225347(01)63620-6]. 1998;159(4):1379-83.  102.  Bubendorf L, Kolmer M, Kononen J, Koivisto P, Mousses S, Chen Y, et al. Hormone Therapy Failure in Human Prostate Cancer: Analysis by Complementary DNA and Tissue Microarrays. J Natl Cancer Inst. 1999 October 20, 1999;91(20):1758-64.     62   103.  COHEN P, PEEHL DM, LAMSON G, ROSENFELD RG. Insulin-Like Growth Factors (IGFs), IGF Receptors, and IGF-Binding Proteins in Primary Cultures of Prostate Epithelial Cells. J Clin Endocrinol Metab. 1991 August 1, 1991;73(2):401-7.  104.  Kiyama S, Morrison K, Zellweger T, Akbari M, Cox M, Yu D, et al. CastrationInduced Increases in Insulin-Like Growth Factor-Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors. Cancer Res. 2003 July 1, 2003;63(13):3575-84.  105.  Jones JI GA, Busby WH Jr, Wright G, Clemmons DR. Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the a5b1 integrin by means of its Arg-Gly-Asp sequence Proc Natl Acad Sci U S A. 1993;90(22):10553-7.  106.  Russo VC, Bach LA, Fosang AJ, Baker NL, Werther GA. Insulin-Like Growth Factor Binding Protein-2 Binds to Cell Surface Proteoglycans in the Rat Brain Olfactory Bulb. Endocrinology. 1997 November 1, 1997;138(11):4858-67.  107.  Arai T, Busby W, Jr, Clemmons D. Binding of insulin-like growth factor (IGF) I or II to IGF-binding protein-2 enables it to bind to heparin and extracellular matrix. Endocrinology. 1996 November 1, 1996;137(11):4571-5.  108.  Menouny M, Binoux M, Babajko S. IGFBP-2 expression in a human cell line is associated with increased IGFBP-3 proteolysis, decreased IGFBP-1     63   expression and increased tumorigenicity. International Journal of Cancer. 1998;77(6):874-9. 109.  Levitt RJ, Georgescu M-M, Pollak M. PTEN-induction in U251 glioma cells decreases the expression of insulin-like growth factor binding protein-2. Biochemical and Biophysical Research Communications. [doi: DOI: 10.1016/j.bbrc.2005.08.229]. 2005;336(4):1056-61.  110.  Perks CM VE, Rosendahl AH, Tonge D, Holly JM. IGF-II and IGFBP-2 differentially regulate PTEN in human breast cancer cells. Oncogene. 2007;26(40):5966-72.  111.  Wetterau LA, Moore MG, Lee K-W, Shim ML, Cohen P. Novel Aspects of the Insulin-like Growth Factor Binding Proteins. Molecular Genetics and Metabolism. [doi: DOI: 10.1006/mgme.1999.2920]. 1999;68(2):161-81.  112.  Kelley KM, Oh Y, Gargosky SE, Gucev Z, Matsumoto T, Hwa V, et al. Insulinlike growth factor-binding proteins (IGFBPs) and their regulatory dynamics. The International Journal of Biochemistry & Cell Biology. [doi: DOI: 10.1016/1357-2725(96)00005-2]. 1996;28(6):619-37.  113.  Paolisso G, Ammendola S, Del Buono A, Gambardella A, Riondino M, Tagliamonte MR, et al. Serum Levels of Insulin-Like Growth Factor-I (IGF-I) and IGF-Binding Protein-3 in Healthy Centenarians: Relationship with Plasma Leptin and Lipid Concentrations, Insulin Action, and Cognitive Function. J Clin Endocrinol Metab. 1997 July 1, 1997;82(7):2204-9.     64   114.  Jogie-Brahim S, Feldman D, Oh Y. Unraveling insulin-like growth factor binding protein-3 actions in human disease. Endocr Rev. 2009 Aug;30(5):41737.  115.  Rajah R, Valentinis B, Cohen P. Insulin-like Growth Factor (IGF)-binding Protein-3 Induces Apoptosis and Mediates the Effects of Transforming Growth Factor-Œ≤1 on Programmed Cell Death through a p53- and IGF-independent Mechanism. Journal of Biological Chemistry. 1997 May 2, 1997;272(18):12181-8.  116.  Butt AJ, Firth SM, King MA, Baxter RC. Insulin-like Growth Factor-binding Protein-3 Modulates Expression of Bax and Bcl-2 and Potentiates p53independent Radiation-induced Apoptosis in Human Breast Cancer Cells. Journal of Biological Chemistry. 2000 December 15, 2000;275(50):39174-81.  117.  Hong J, Zhang G, Dong F, Rechler MM. Insulin-like Growth Factor (IGF)binding Protein-3 Mutants That Do Not Bind IGF-I or IGF-II Stimulate Apoptosis in Human Prostate Cancer Cells. Journal of Biological Chemistry. 2002 March 22, 2002;277(12):10489-97.  118.  Gucev ZS, Oh Y, Kelley KM, Rosenfeld RG. Insulin-like Growth Factor Binding Protein 3 Mediates Retinoic Acid- and Transforming Growth Factor {beta}2-induced Growth Inhibition in Human Breast Cancer Cells. Cancer Res. 1996 April 1, 1996;56(7):1545-50.     65   119.  Rajah R, Lee K-W, Cohen P. Insulin-like Growth Factor Binding Protein-3 Mediates Tumor Necrosis Factor-{alpha}-induced Apoptosis: Role of Bcl-2 Phosphorylation. Cell Growth Differ. 2002 April 1, 2002;13(4):163-71.  120.  Vasylyeva TL, Chen X, Ferry JRJ. Insulin-like growth factor binding protein-3 mediates cytokine-induced mesangial cell apoptosis. Growth Hormone & IGF Research. [doi: DOI: 10.1016/j.ghir.2005.02.008]. 2005;15(3):207-14.  121.  Ryan KM, Vousden KH. Characterization of Structural p53 Mutants Which Show Selective Defects in Apoptosis but Not Cell Cycle Arrest. Mol Cell Biol. 1998 July 1, 1998;18(7):3692-8.  122.  Grimberg A, Liu B, Bannerman P, El-Deiry WS, Cohen P. IGFBP-3 mediates p53-induced apoptosis during serum starvation2002.  123.  Harms KL, Chen X. The C Terminus of p53 Family Proteins Is a Cell Fate Determinant. Mol Cell Biol. 2005 March 1, 2005;25(5):2014-30.  124.  Fanayan S, Firth SM, Butt AJ, Baxter RC. Growth inhibition by insulin-like growth factor-binding protein-3 in T47D breast cancer cells requires transforming growth factor-beta (TGF-beta ) and the type II TGF-beta receptor. J Biol Chem. 2000 Dec 15;275(50):39146-51.  125.  Hanafusa T, Yumoto Y, Nouso K, Nakatsukasa H, Onishi T, Fujikawa T, et al. Reduced expression of insulin-like growth factor binding protein-3 and its promoter hypermethylation in human hepatocellular carcinoma. Cancer Letters. [doi: DOI: 10.1016/S0304-3835(01)00736-4]. 2002;176(2):149-58.     66   126.  Chang YS, Gong K, Sun S, Liu D, El-Naggar AK, Khuri FR, et al. Clinical Significance of Insulin-like Growth Factor-binding Protein-3 Expression in Stage I Non-Small Cell Lung Cancer. Clinical Cancer Research. 2002 December 2002;8(12):3796-802.  127.  Wang L, Habuchi T, Tsuchiya N, Mitsumori K, Ohyama C, Sato K, et al. Insulin-like Growth Factor-binding Protein-3 Gene -202 A/C Polymorphism Is Correlated with Advanced Disease Status in Prostate Cancer. Cancer Res. 2003 August 1, 2003;63(15):4407-11.  128.  Deal C, Ma J, Wilkin F, Paquette J, Rozen F, Ge B, et al. Novel Promoter Polymorphism in Insulin-Like Growth Factor-Binding Protein-3: Correlation with Serum Levels and Interaction with Known Regulators. J Clin Endocrinol Metab. 2001 March 1, 2001;86(3):1274-80.  129.  Ramachandran S LP, Young AN, Yin-Goen Q, Lim SD, Laycock N, Amin MB, Carney JK, Marshall FF, Petros JA, Moreno CS. Loss of HOXC6 expression induces apoptosis in prostate cancer cells. Oncogene. 2005;24(1):188-98.  130.  Prieur A, Tirode F, Cohen P, Delattre O. EWS/FLI-1 Silencing and Gene Profiling of Ewing Cells Reveal Downstream Oncogenic Pathways and a Crucial Role for Repression of Insulin-Like Growth Factor Binding Protein 3. Mol Cell Biol. 2004 August 15, 2004;24(16):7275-83.     67   131.  Benini S, Zuntini M, Manara MC, Cohen P, Nicoletti G, Nanni P, et al. Insulinlike growth factor binding protein 3 as an anticancer molecule in Ewing's sarcoma. International Journal of Cancer. 2006;119(5):1039-46.  132.  Spagnoli A, Torello M, Nagalla SR, Horton WA, Pattee P, Hwa V, et al. Identification of STAT-1 as a Molecular Target of IGFBP-3 in the Process of Chondrogenesis. Journal of Biological Chemistry. 2002 May 24, 2002;277(21):18860-7.  133.  Silha JV, Sheppard PC, Mishra S, Gui Y, Schwartz J, Dodd JG, et al. InsulinLike Growth Factor (IGF) Binding Protein-3 Attenuates Prostate Tumor Growth by IGF-Dependent and IGF-Independent Mechanisms. Endocrinology. 2006 May 1, 2006;147(5):2112-21.  134.  Oh Y, M√ºller HL, Pham H, Rosenfeld RG. Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578T human breast cancer cells. Journal of Biological Chemistry. 1993 December 15, 1993;268(35):26045-8.  135.  HUANG SS, LING T-Y, TSENG W-F, HUANG Y-H, TANG F-M, LEAL SM, et al. Cellular growth inhibition by IGFBP-3 and TGF-{beta}1 requires LRP-1. FASEB J. 2003 November 1, 2003;17(14):2068-81.  136.  Lee K-W, Liu B, Ma L, Li H, Bang P, Koeffler HP, et al. Cellular Internalization of Insulin-like Growth Factor Binding Protein-3. Journal of Biological Chemistry. 2004 January 2, 2004;279(1):469-76.     68   137.  Durai R, Davies M, Yang W, Yang SY, Seifalian A, Goldspink G, et al. Biology of insulin-like growth factor binding protein-4 and its role in cancer (review). Int J Oncol. 2006 Jun;28(6):1317-25.  138.  Wang J, Niu W, Witte DP, Chernausek SD, Nikiforov YE, Clemens TL, et al. Overexpression of Insulin-Like Growth Factor-Binding Protein-4 (IGFBP-4) in Smooth Muscle Cells of Transgenic Mice through a Smooth Muscle {alpha}Actin-IGFBP-4 Fusion Gene Induces Smooth Muscle Hypoplasia. Endocrinology. 1998 May 1, 1998;139(5):2605-14.  139.  Damon SE, Maddison L, Ware JL, Plymate SR. Overexpression of an Inhibitory Insulin-Like Growth Factor Binding Protein (IGFBP), IGFBP-4, Delays Onset of Prostate Tumor Formation. Endocrinology. 1998 August 1, 1998;139(8):3456-64.  140.  Dai B, Widen SG, Mifflin R, Singh P. Cloning of the functional promoter for human insulin-like growth factor binding protein-4 gene: endogenous regulation. Endocrinology. 1997 Jan;138(1):332-43.  141.  Mason HD, Cwyfan-Hughes S, Holly JMP, Franks S. Potent Inhibition of Human Ovarian Steroidogenesis by Insulin-Like Growth Factor Binding Protein-4 (IGFBP-4). J Clin Endocrinol Metab. 1998 January 1, 1998;83(1):284-7.  142.  Damon SE, Haugk KL, Birnbaum RS, Quinn LS. Retrovirally mediated overexpression of insulin-like growth factor binding protein 4: Evidence that     69   insulin-like growth factor is required for skeletal muscle differentiation. Journal of Cellular Physiology. 1998;175(1):109-20. 143.  Ewton DZ, Coolican SA, Mohan S, Chernausek SD, Florini JR. Modulation of insulin-like growth factor actions in L6A1 myoblasts by insulin-like growth factor binding protein (IGFBP)-4 and IGFBP-5: A dual role for IGFBP-5. Journal of Cellular Physiology. 1998;177(1):47-57.  144.  Mohan S, Farley JR, Baylink DJ. Age-related changes in IGFBP-4 and IGFBP-5 levels in human serum and bone: Implications for bone loss with aging. Progress in Growth Factor Research. [doi: DOI: 10.1016/09552235(95)00027-5]. 1995;6(2-4):465-73.  145.  Jones JI, Gockerman A, Busby WH, Camacho-Hubner C, Clemmons DR. Extracellular matrix contains insulin-like growth factor binding protein-5: potentiation of the effects of IGF-I. The Journal of Cell Biology. 1993 May 1993;121(3):679-87.  146.  Andress DL, Birnbaum RS. Human osteoblast-derived insulin-like growth factor (IGF) binding protein-5 stimulates osteoblast mitogenesis and potentiates IGF action. Journal of Biological Chemistry. 1992 November 5, 1992;267(31):22467-72.  147.  Conover CA, Perry JE, Tindall DJ. Endogenous cathepsin D-mediated hydrolysis of insulin-like growth factor-binding proteins in cultured human prostatic carcinoma cells. J Clin Endocrinol Metab. 1995 Mar;80(3):987-93.     70   148.  Tennant MK, Thrasher JB, Twomey PA, Birnbaum RS, Plymate SR. Insulinlike growth factor-binding proteins (IGFBP)-4, -5, and -6 in the benign and malignant human prostate: IGFBP-5 messenger ribonucleic acid localization differs from IGFBP-5 protein localization. J Clin Endocrinol Metab. 1996 Oct;81(10):3783-92.  149.  Gleave ME, Miyake H. Castration-induced upregulation of insulin-like growth factor binding protein-5 potentiates IGF-1 and accelerates androgenindependent progression in prostate cancer. Prostate Cancer Prostatic Dis. 2000 Dec;3(S1):S16.  150.  Duan C, Hawes SB, Prevette T, Clemmons DR. Insulin-like Growth Factor-I (IGF-I) Regulates IGF-binding Protein-5 Synthesis through Transcriptional Activation of the Gene in Aortic Smooth Muscle Cells. Journal of Biological Chemistry. 1996 February 23, 1996;271(8):4280-8.  151.  Bach LA TN, Rechler MM. Human insulin-like growth factor-binding protein-6 is O-glycosylated. Biochem Biophys Res Commun. 1992 186(1):301-7.  152.  Claussen M, Buergisser D, Schuller A, Matzner U, Braulke T. Regulation of insulin-like growth factor (IGF)-binding protein-6 and mannose 6phosphate/IGF-II receptor expression in IGF-IL-overexpressing NIH 3T3 cells. Mol Endocrinol. 1995 July 1, 1995;9(7):902-12.  153.  Bach LA. Insulin-Like Growth Factor Binding Protein-6: The ‚ÄúForgotten‚Äù Binding Protein? Horm Metab Res. 1999;31(02/03):226-34.     71   154.  Oh Y, Nagalla SR, Yamanaka Y, Kim HS, Wilson E, Rosenfeld RG. Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J Biol Chem. 1996 Nov 29;271(48):30322-5.  155.  Murphy M, Pykett MJ, Harnish P, Zang KD, George DL. Identification and characterization of genes differentially expressed in meningiomas. Cell Growth Differ. 1993 Sep;4(9):715-22.  156.  Cohen P, Graves H, Peehl D, Kamarei M, Giudice L, Rosenfeld R. Prostatespecific antigen (PSA) is an insulin-like growth factor binding protein-3 protease found in seminal plasma. J Clin Endocrinol Metab. 1992 October 1, 1992;75(4):1046-53.  157.  Conover CA, De Leon DD. Acid-activated insulin-like growth factor-binding protein-3 proteolysis in normal and transformed cells. Role of cathepsin D. Journal of Biological Chemistry. 1994 March 11, 1994;269(10):7076-80.  158.  Fowlkes J, Suzuki K, Nagase H, Thrailkill K. Proteolysis of insulin-like growth factor binding protein-3 during rat pregnancy: a role for matrix metalloproteinases. Endocrinology. 1994 December 1, 1994;135(6):2810-3.  159.  Angelloz-Nicoud P, Harel L, Binoux M. Recombinant human insulin-like growth factor (IGF) binding protein-3 stimulates prostate carcinoma cell proliferation via an IGF-dependent mechanism. Role of serine proteases. Growth Regul. 1996 Sep;6(3):130-6.     72   160.  Zheng B, Clarke JB, Busby WH, Duan C, Clemmons DR. Insulin-Like Growth Factor-Binding Protein-5 Is Cleaved by Physiological Concentrations of Thrombin. Endocrinology. 1998 April 1, 1998;139(4):1708-14.  161.  Afar DE, Vivanco I, Hubert RS, Kuo J, Chen E, Saffran DC, et al. Catalytic cleavage of the androgen-regulated TMPRSS2 protease results in its secretion by prostate and prostate cancer epithelia. Cancer Res. 2001 Feb 15;61(4):1686-92.  162.  FitzGerald L, Agalliu I, Johnson K, Miller M, Kwon E, Hurtado-Coll A, et al. Association of TMPRSS2-ERG gene fusion with clinical characteristics and outcomes: results from a population-based study of prostate cancer. BMC Cancer. 2008;8(1):230.  163.  Bereket A, Wilson T, Kolasa A, Fan J, Lang C. Regulation of the insulin-like growth factor system by acute acidosis. Endocrinology. 1996 June 1, 1996;137(6):2238-45.  164.  Nunn S, Gibson T, Rajah R, Cohen P. Regulation of prostate cell growth by the insulin-like growth factor binding proteins and their proteases. Endocrine. [10.1007/BF02778077]. 1997;7(1):115-8.  165.  Cohen P, Peehl DM, Graves HC, Rosenfeld RG. Biological effects of prostate specific antigen as an insulin-like growth factor binding protein-3 protease. J Endocrinol. 1994 Sep;142(3):407-15.     73   166.  Besnard N, Pisselet C, Zapf J, Hornebeck W, Monniaux D, Monget P. Proteolytic activity is involved in changes in intrafollicular insulin- like growth factor-binding protein levels during growth and atresia of ovine ovarian follicles. Endocrinology. 1996 May 1, 1996;137(5):1599-607.  167.  Rajah R, Katz L, Nunn S, Solberg P, Beers T, Cohen P. Insulin-like growth factor binding protein (IGFBP) proteases: Functional regulators of cell growth. Progress in Growth Factor Research. [doi: DOI: 10.1016/09552235(95)00012-7]. 1995;6(2-4):273-84.  168.  Baxter RC, Binoux MA, Clemmons DR, Conover CA, Drop SLS, Holly JMP, et al. Recommendations for Nomenclature of the Insulin-Like Growth Factor Binding Protein Superfamily. Endocrinology. 1998 October 1, 1998;139(10):4036-.  169.  Yamanaka Y, Wilson EM, Rosenfeld RG, Oh Y. Inhibition of Insulin Receptor Activation by Insulin-like Growth Factor Binding Proteins. Journal of Biological Chemistry. 1997 December 5, 1997;272(49):30729-34.  170.  Vorwerk P WH, Hohmann B, Oh Y, Rosenfeld RG, Mittler U. CTGF (IGFBPrP2) is specifically expressed in malignant lymphoblasts of patients with acute lymphoblastic leukaemia (ALL). Br J Cancer. 2000;83(6):756-60.  171.  Chevalier G, Yeger H, Martinerie C, Laurent M, Alami J, Schofield P, et al. novH: differential expression in developing kidney and Wilm's tumors. Am J Pathol. 1998 June 1, 1998;152(6):1563-75.     74   172.  Kireeva M, MO F, Yang G, Lau L. Cyr61, a product of a growth factorinducible immediate-early gene, promotes cell proliferation, migration, and adhesion. Mol Cell Biol. 1996 April 1, 1996;16(4):1326-34.  173.  Rajaram S, Baylink DJ, Mohan S. Insulin-Like Growth Factor-Binding Proteins in Serum and Other Biological Fluids: Regulation and Functions. Endocr Rev. 1997 December 1, 1997;18(6):801-31.  174.  PETRYLAK D. Therapeutic options in androgen-independent prostate cancer: building on docetaxel. BJU International. 2005;96(s2):41-6.  175.  Kojima S, Inahara M, Suzuki H, Ichikawa T, Furuya Y. Implications of insulinlike growth factor-I for prostate cancer therapies. International Journal of Urology. 2009;16(2):161-7.  176.  Grossmann ME, Huang H, Tindall DJ. Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer. J Natl Cancer Inst. 2001 November 21, 2001;93(22):1687-97.  177.  Lin H-K, Yeh S, Kang H-Y, Chang C. Akt suppresses androgen-induced apoptosis by phosphorylating and inhibiting androgen receptor. Proceedings of the National Academy of Sciences of the United States of America. 2001 June 19, 2001;98(13):7200-5.  178.  McDonnel TJ, Navone NM, Troncoso P, Pisters LL, Conti C, von Eschenbach AC, et al. Expression of BCL-2 Oncoprotein and P53 Protein Accumulation in Bone Marrow Metastases of Androgen Independent Prostate Cancer. The     75   Journal of Urology. [doi: DOI: 10.1016/S0022-5347(01)65204-2]. 1997;157(2):569-74. 179.  Raffo AJ, Perlman H, Chen M-W, Day ML, Streitman JS, Buttyan R. Overexpression of bcl-2 Protects Prostate Cancer Cells from Apoptosis in Vitro and Confers Resistance to Androgen Depletion in Vivo. Cancer Res. 1995 October 1, 1995;55(19):4438-45.  180.  Leung S, Miyake H, Zellweger T, Tolcher A, Gleave ME. Synergistic chemosensitization and inhibition of progression to androgen independence by antisense Bcl-2 oligodeoxynucleotide and paclitaxel in the LNCaP prostate tumor model. International Journal of Cancer. 2001;91(6):846-50.  181.  Pollak MN SE, Hankinson SE. Insulin-like growth factors and neoplasia. Nat Rev Cancer. 2004;4(7):505-18.  182.  Baserga R. The IGF-I Receptor in Cancer Research. Experimental Cell Research. [doi: DOI: 10.1006/excr.1999.4667]. 1999;253(1):1-6.  183.  Angelloz-Nicoud P, Binoux M. Autocrine regulation of cell proliferation by the insulin-like growth factor (IGF) and IGF binding protein-3 protease system in a human prostate carcinoma cell line (PC-3). Endocrinology. 1995 December 1, 1995;136(12):5485-92.  184.  Miyake H, Nelson C, Rennie PS, Gleave ME. Overexpression of Insulin-Like Growth Factor Binding Protein-5 Helps Accelerate Progression to AndrogenIndependence in the Human Prostate LNCaP Tumor Model through Activation     76   of Phosphatidylinositol 3'-Kinase Pathway. Endocrinology. 2000 June 1, 2000;141(6):2257-65. 185.  Nickerson T, Miyake H, Gleave ME, Pollak M. Castration-induced Apoptosis of Androgen-dependent Shionogi Carcinoma Is Associated with Increased Expression of Genes Encoding Insulin-like Growth Factor-binding Proteins. Cancer Res. 1999 July 1, 1999;59(14):3392-5.  186.  Sowery RD, So AI, Gleave ME. Therapeutic options in advanced prostate cancer: present and future. Curr Urol Rep. 2007 Jan;8(1):53-9.  187.  Levitt R GM, Pollack M, editor. Bispecific antisense oligonucleotide targeting both IGFBP-2 and IGFBP-5 inhibits growth of U87 glioma cells. Proc Amer Assoc Cancer Res; 2004.  188.  So AI, Levitt RJ, Eigl B, Fazli L, Muramaki M, Leung S, et al. Insulin-Like Growth Factor Binding Protein-2 Is a Novel Therapeutic Target Associated with Breast Cancer. Clinical Cancer Research. 2008 November 1, 2008;14(21):6944-54.  189.  Gleave ME MB. Antisense therapy for cancer. Nat Rev Cancer. 2005;5(6):468-79.  190.  Monia BP, Lesnik EA, Gonzalez C, Lima WF, McGee D, Guinosso CJ, et al. Evaluation of 2'-modified oligonucleotides containing 2'-deoxy gaps as antisense inhibitors of gene expression. Journal of Biological Chemistry. 1993 July 5, 1993;268(19):14514-22.     77   191.  Chi KN, Eisenhauer E, Fazli L, Jones EC, Goldenberg SL, Powers J, et al. A Phase I Pharmacokinetic and Pharmacodynamic Study of OGX-011, a 2'Methoxyethyl Antisense Oligonucleotide to Clusterin, in Patients With Localized Prostate Cancer. J Natl Cancer Inst. 2005 September 7, 2005;97(17):1287-96.  192.  Stangelberger A, Schally AV, Varga JL, Hammann BD, Groot K, Halmos G, et al. Antagonists of growth hormone releasing hormone (GHRH) and of bombesin/gastrin releasing peptide (BN/GRP) suppress the expression of VEGF, bFGF, and receptors of the EGF/HER family in PC-3 and DU-145 human androgen-independent prostate cancers. The Prostate. 2005;64(3):303-15.  193.  Ngo TH, Barnard RJ, Leung P-S, Cohen P, Aronson WJ. Insulin-Like Growth Factor I (IGF-I) and IGF Binding Protein-1 Modulate Prostate Cancer Cell Growth and Apoptosis: Possible Mediators for the Effects of Diet and Exercise on Cancer Cell Survival. Endocrinology. 2003 June 1, 2003;144(6):2319-24.  194.  Goya M, Miyamoto Si, Nagai K, Ohki Y, Nakamura K, Shitara K, et al. Growth Inhibition of Human Prostate Cancer Cells in Human Adult Bone Implanted into Nonobese Diabetic/Severe Combined Immunodeficient Mice by a LigandSpecific Antibody to Human Insulin-Like Growth Factors. Cancer Res. 2004 September 1, 2004;64(17):6252-8.  195.  Mutaguchi K, Yasumoto H, Mita K, Matsubara A, Shiina H, Igawa M, et al. Restoration of Insulin-Like Growth Factor Binding Protein-Related Protein 1     78   Has a Tumor-Suppressive Activity through Induction of Apoptosis in Human Prostate Cancer. Cancer Res. 2003 November 15, 2003;63(22):7717-23. 196.  Jansen B, Zangemeister-Wittke U. Antisense therapy for cancer--the time of truth. The Lancet Oncology. [doi: DOI: 10.1016/S1470-2045(02)00903-8]. 2002;3(11):672-83.  197.  Burfeind P, Chernicky CL, Rininsland F, Ilan J. Antisense RNA to the type I insulin-like growth factor receptor suppresses tumor growth and prevents invasion by rat prostate cancer cells in vivo. Proceedings of the National Academy of Sciences of the United States of America. 1996 July 9, 1996;93(14):7263-8.  198.  Arteaga CL, Kitten LJ, Coronado EB, Jacobs S, Kull FC, Allred DC, et al. Blockade of the type I somatomedin receptor inhibits growth of human breast cancer cells in athymic mice. The Journal of Clinical Investigation. 1989;84(5):1418-23.  199.  Ho PJ, Baxter RC. Insulin-like growth factor-binding protein-2 in patients with prostate carcinoma and benign prostatic hyperplasia. Clinical Endocrinology. 1997;46(3):333-42.  200.  Brant AI, Fran√ßois H, Jean-Fran√ßois A, Fran√ßois M, Pierre D, Yves F, et al. Insulin-Like Growth Factor Binding Protein 2: An Androgen-Dependent Predictor of Prostate Cancer Survival. European urology. 2005;47(5):695-702.     79   201.  Andress DL. IGF-binding protein-5 stimulates osteoblast activity and bone accretion in ovariectomized mice. Am J Physiol Endocrinol Metab. 2001 August 1, 2001;281(2):E283-8.  202.  Miyakoshi N, Richman C, Kasukawa Y, Linkhart TA, Baylink DJ, Mohan S. Evidence that IGF-binding protein-5 functions as a growth factor. The Journal of Clinical Investigation. 2001;107(1):73-81.  203.  Hsieh CM, Yoshizumi M, Endege WO, Kho CJ, Jain MK, Kashiki S, et al. APEG-1, a novel gene preferentially expressed in aortic smooth muscle cells, is down-regulated by vascular injury. J Biol Chem. 1996 Jul 19;271(29):17354-9.  204.  Hill JJ, Tremblay TL, Cantin C, O'Connor-McCourt M, Kelly JF, Lenferink AE. Glycoproteomic analysis of two mouse mammary cell lines during transforming growth factor (TGF)-beta induced epithelial to mesenchymal transition. Proteome Sci. 2009;7:2.  205.  Ma K, Cheung SM, Marshall AJ, Duronio V. PI(3,4,5)P3 and PI(3,4)P2 levels correlate with PKB/akt phosphorylation at Thr308 and Ser473, respectively; PI(3,4)P2 levels determine PKB activity. Cell Signal. 2008 Apr;20(4):684-94.  206.  Tsukada S, Iwai M, Nishiu J, Itoh M, Tomoike H, Horiuchi M, et al. Inhibition of experimental intimal thickening in mice lacking a novel G-protein-coupled receptor. Circulation. 2003 Jan 21;107(2):313-9.  207.  Nemoto Y, Arribas M, Haffner C, DeCamilli P. Synaptojanin 2, a novel synaptojanin isoform with a distinct targeting domain and expression pattern. J Biol Chem. 1997 Dec 5;272(49):30817-21.     80   208.  Kim S, Zhang Z, Upchurch S, Isern N, Chen Y. Structure and DNA-binding sites of the SWI1 AT-rich interaction domain (ARID) suggest determinants for sequence-specific DNA recognition. J Biol Chem. 2004 Apr 16;279(16):16670-6.  209.  Meijlink F, Beverdam A, Brouwer A, Oosterveen TC, Berge DT. Vertebrate aristaless-related genes. Int J Dev Biol. 1999;43(7):651-63.        81   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071307/manifest

Comment

Related Items