UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Myoferlin-dependent regulation of receptor tie-2 : characterization of a novel endothelial-specific anti-angiogenesis… Yu, Carol 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2010_fall_yu_carol.pdf [ 11.07MB ]
Metadata
JSON: 24-1.0071180.json
JSON-LD: 24-1.0071180-ld.json
RDF/XML (Pretty): 24-1.0071180-rdf.xml
RDF/JSON: 24-1.0071180-rdf.json
Turtle: 24-1.0071180-turtle.txt
N-Triples: 24-1.0071180-rdf-ntriples.txt
Original Record: 24-1.0071180-source.json
Full Text
24-1.0071180-fulltext.txt
Citation
24-1.0071180.ris

Full Text

   MYOFERLIN-DEPEDENT REGULATION OF RECEPTOR TIE-2: CHARACTERIZATION OF A NOVEL ENDOTHELIAL-SPECIFIC ANTI- ANGIOGENESIS TARGET    by  Carol Yu  B.Sc., The University of British Columbia, 2008     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE STUDIES  (Pharmacology)         THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)   August 2010  © Carol Yu, 2010 ii  ABSTRACT   Heart disease and cancer are the two leading causes of death worldwide.  In heart disease, reperfusion of an ischemic myocardium through increased angiogenesis, or the growth of new blood vessels, is considered the ‘holy grail’ of future therapies.  In contrast, inhibiting tumour growth by decreasing angiogenesis through anti- angiogenic therapies is increasingly used in cancer patients, although the therapeutic effect is only partial.  Hence, a better comprehension of angiogenesis is clearly warranted.  While a plethora of literature suggests that the vascular endothelial growth factor (VEGF) and angiopoietins systems are the most potent endogenous regulators of angiogenesis, an increasing number of recent studies also show that their net angiogenic effects are mostly dictated by membrane expression of their main receptors, VEGFR-2 and tie-2, respectively.  Recently, endothelial cells (ECs) were unexpectedly found to express myoferlin, a muscle protein [1] known for its ability to regulate plasma membrane integrity [2].  Moreover, myoferlin was found to be involved in the regulation of VEGFR-2 expression in ECs [3].  In this work, we report that disruption of myoferlin by gene-silencing causes decreased tie-2 expression in cultured ECs.  However, myoferlin disruption does not affect the transcriptional levels of tie-2 in cultured ECs.  Separation of caveolae/lipid rafts from cytosol in ECs shows presence of myoferlin and tie-2 in caveolae/lipid rafts, suggesting co-localization of the two proteins to form a large signaling complex at caveoli, which are known platforms for clustering of signaling complexes. Moreover, myoferlin is present in a cancer cell model (Lewis Lung Carcinoma) and myoferlin disruption causes decreased cell proliferation, further exploring the iii  involvement of this membrane protein in a completely different cell system.  The current work identifies potential pharmacological targets for the regulation of the tie- 2 system and since tie-2 expression is almost exclusively found in ECs, this work initiates the characterization of an EC-specific target that could be further exploited to modulate angiogenic responses in an in vivo model. iv  TABLE OF CONTENTS ABSTRACT .................................................................................................................ii TABLE OF CONTENTS ............................................................................................ iv LIST OF FIGURES.....................................................................................................vi LIST OF ILLUSTRATIONS......................................................................................vii LIST OF ABBREVIATIONS ...................................................................................viii	
   ACKNOWLEDGEMENTS ................................................................................. .......ix Chapter 1: Introducion…….……….……………………………………….………...1 1.1. Scope of the thesis ............................................................................................. 2	
   1.2. An introduction to tumour growth, an abnormal growth of cells ...................... 2	
   1.3. Tumour growth – a phenomenon of pathological angiogenesis ........................ 4	
   1.4. The first identification of angiogenesis ............................................................. 5	
   1.5. Angiogenic steps................................................................................................ 6	
   1.6. Identification of Vascular Endothelial Growth Factor (VEGF) and VEGFR-2 6	
   1.6.1. Downstream effects of VEGF/VEGFR-2 signaling ....................................... 7	
   1.7. Identification of angiopoietins and the tie receptors.......................................... 8	
   1.7.1. The tie receptors – their expression and structure .......................................... 8	
   1.7.2. Downstream effects of angiopoietin/tie-2 signaling....................................... 9	
   1.8. VEGF/VEGR-2 and angiopoietin/tie-2 signaling pathways as therapeutic targets...................................................................................................................... 11	
   1.9. Proteasomal, cbl-dependent degradation pathways as means for tyrosine kinase receptor regulation....................................................................................... 12	
   1.10. The endothelium in the process of angiogenesis ........................................... 14	
   1.11. Signaling in ECs: Cholesterol-rich membrane microdomains ...................... 15	
   1.11.1. Lipid rafts.................................................................................................... 16	
   1.11.2. Caveolae...................................................................................................... 16	
   1.12. Ferlins, known regulators of membrane integrity.......................................... 17	
   1.13. Myoferlin, an unexpected regulator of vascular homeostasis........................ 20 Chapter 2: Research Overview..………………………………………………….…22 2.1.	
  	
  Rationale ......................................................................................................... 23	
   2.2.	
  	
  Hypothesis....................................................................................................... 24	
   2.3.	
  	
  Specific aims ................................................................................................... 24 Chapter 3: Methods and Materials……………………………….........……………26 3.1.	
  	
  Cell Culture ..................................................................................................... 27	
   3.2.	
  	
  Gene-silencing by small interfering RNA (siRNA)........................................ 27	
   3.2.1.	
   siRNA treatment........................................................................................... 28	
   3.3.	
  	
  Western blot analysis ...................................................................................... 29	
   3.4.	
  	
  Analysis of transcriptional levels of tie-2 ....................................................... 29	
   3.4.1.	
   RNeasy Mini Kit to isolate RNA from BAEC samples ............................... 31	
   3.4.2.	
   Reverse transcription to obtain cDNA ......................................................... 32	
   3.4.3.	
   Design of tie-2 and GAPDH primers for qPCR........................................... 33	
   3.4.3.1. Designing primers for SYBR Green I assay required stringent criteria .... 33	
   3.4.3.2.	
  Tie-2 and GAPDH primers for qPCR........................................................ 33	
   3.4.4.	
   Standards for qPCR...................................................................................... 34	
   3.4.4.1. .Synthesis and purification of tie-2 and GAPDH DNA samples as standards v  …………………………………………………………………………………….34	
   3.4.5.	
   SYBR Green I Dye....................................................................................... 35	
   3.4.6.	
   Data analysis of qPCR results ...................................................................... 36	
   3.4.6.1.The relative quantification method to analyze qPCR results...................... 37	
   3.4.6.2.The dissociation curve – to confirm detection of a single specific product37	
   3.5.	
  	
  Co-infection of siRNA-transfected cells with Ad70Z/3CBL ......................... 38	
   3.5.1.	
   Amplification of AdCbl(-/-) ......................................................................... 39	
   3.5.2.	
  	
  Cytopathic effect (CPE) assay to determine Adenovirus virulence............. 39	
   3.6.	
  	
  Treating siRNA-transfected cells with Mg-132.............................................. 40	
   3.7.	
  	
  Sucrose gradient fractionation for isolation of caveolae/lipid rafts ................ 40	
   3.8.	
  	
  Proliferation assays ......................................................................................... 41	
   3.8.1.	
  Cell-counting with haemocytometer and data analysis ................................ 42	
   3.8.2.	
  Trypan blue in exclusion assay ..................................................................... 43	
   3.9.	
  	
  Statistical analysis ........................................................................................... 43 Chapter 4: Results..…………………………………………………….........………44 4.1. Disruption of myoferlin caused decreased tie-2 protein expression in BAECs…………………………………………………………………………….45	
   4.2. Myoferlin disruption by gene-silencing in BAECs did not affect transcriptional levels of tie-2 .................................................................................. 48	
   4.3. Decreased tie-2 expression following myoferlin disruption was not cbl- dependent ................................................................................................................ 50	
   4.4. Decreased tie-2 expression following myoferlin disruption was not due to proteasomal degradation ......................................................................................... 52	
   4.5. Myoferlin and tie-2 were localized in caveolae/lipid rafts .............................. 54	
   4.6. Myoferlin is expressed in LLCs and myoferlin disruption in LLCs led to decreased cell proliferation..................................................................................... 56	
   4.7. Summary of results .......................................................................................... 59 Chapter 5: Discussion……………………………………………………………….60 5.1. Myoferlin regulates both VEGFR-2 and tie-2 protein expressions, but not their gene expressions ..................................................................................................... 61	
   5.2. Context-dependent tie-angiopoietin regulators of angiogenesis in the vasculature .............................................................................................................. 63	
   5.3. qPCR for gene expression analysis.................................................................. 65	
   5.3.1. qPCR analysis – comparing different methods of calculations .................... 65	
   5.3.2. Using SYBR Green I vs. TaqMan probe in qPCR detection........................ 66	
   5.4. Other possible mechanisms and ubiquitin ligases involved in tie-2 downregulation following myoferlin disruption..................................................... 68	
   5.5. Lipid rafts as platforms for tie-2 signaling ...................................................... 69	
   5.5.1. Determining co-association of myoferlin and tie-2 as the next step............. 70	
   5.6. Separating caveolae/lipid rafts from bulk cytosolic proteins........................... 70	
   5.7. Myoferlin and cancer: Expansion for ferlin expression in new systems ......... 71	
   5.8. Summary of discussion.................................................................................... 72 Chapter 6: Conclusion and Significance.....................................................................73 REFERENCES........................................................................................................... 76 APPENDICES............................................................................................................ 88  vi  LIST OF FIGURES Figure 1A.  Myoferlin gene-silencing using 15nM myoferlin siRNA causes downregulation of tie-2 receptor...........................................................46 Figure 1B. Myoferlin gene-silencing using 75nM myoferlin siRNA causes downregulation of tie-2 receptor...........................................................47 Figure 2.  Myoferlin knock-down has no effect on tie-2 mRNA levels................49 Figure 3.  Downregulation of tie-2 following myoferlin disruption is not cbl- dependent.............................................................................................. 51 Figure 4.  Downregulation of tie-2 following myoferlin disruption is not due to proteasomal degradation....................................................................... 53 Figure 5.  Myoferlin and tie-2 are co-localized in caveolae/lipid rafts................. 55 Figure 6.  Pictures of LLCs under the light microscope....................................... 57 Figure 7.  Myoferlin is expressed in LLCs and myoferlin disruption causes decreased cell proliferation................................................................... 58 Figure A1.  Representative amplification plot for tie-2 mRNA levels.................... 88 Figure A2.  Representative dissociation curves for tie-2 mRNA levels.................. 89 Figure A3.  Representative amplification plot for tie-2 standards........................... 90 Figure A4.  Representative dissociation curves for tie-2 standards......................... 91 Figure A5.  Standard curve plot for tie-2................................................................. 92 Figure A6.  Representative amplification plot for GAPDH mRNA levels.............. 93 Figure A7.  Representative dissociation curves for GAPDH mRNA levels............ 94 Figure A8.  Representative amplification plot for GAPDH standards.....................95 Figure A9.  Representative dissociation curves for GAPDH standards...................96 Figure A10.  Standard curve plot for GAPDH...........................................................97 Figure A11.  Detection of a single product in qPCR................................................. 98 Figure A12.  LLC viability assay using Trypan blue................................................. 99 Figure A13.  Dynamin-2, myoferlin and tie-2 are co-localized in caveolae/lipid rafts......................................................................................................100 Figure A14. Infection of AdK44ADyn-2 leads to decreased tie-2 expression in ECs.......................................................................................................101 Figure A15. AdK44A dynamin-2 treatment causes decreased EC proliferation.....102 Figure A16. AdK44A dynamin-2 treatment does not affect LLC proliferation......103             vii  LIST OF ILLUSTRATIONS   Illustration 1. VEGF, angiopoietins, and their respective receptors regulate angiogenesis..................................................................................... 11 Illustration 2. Structure of the ferlin family members............................................ 19 Illustration 3. Does myoferlin play a role in regulation of tie-2 expression in ECs and cancer cell growth?....................................................................25    viii  LIST OF ABBREVIATIONS  BAECs Bovine Aortic Endothelial Cells βCOP Coatomer subunit beta cDNA Complemantary deoxyribonucleic acid DMEM Dulbecco’s modified Eagle’s medium EC Endothelial Cell eNOS Endothelial Nitric Oxide Synthase FBS Fetal Bovine Serum GAPDH Glyceraldehude-3-phosphate dehydrogenase GRB2 Growth Factor Receptor-bound protein 2 GST Glutathione S-Transferase HA Hemagglutinin HEK Human Embryonic Kidney HSP 90 Heat Shock Protein 90 HUVEC Human Umbilical Vein Endothelial Cell Ig Immunoglobulin IGF Insulin-like Growth Factor LLCs Lewis Lung Carcinomas MOI  Multiplicity of Infection NO Nitric Oxide PAGE Polyacrylamide electrophoresis PCR Polymerase Chain Reaction PFU Plague Forming Unit PMSF Phenylmethanesulfonyfluoride qPCR Quantitative Polymerase Chain Reaction RISC Ribonucleoprotein RNA-induced Silencing Complex ROX 6-carboxy-X-rhodamine RT-PCR Reverse-Transcriptase Polymerase Chain Reaction siRNA Small Interference Ribonucleic Acid SMC Smooth Muscle Cells S.O.C. Super Optimal broth with Catabolite repression t Time Tie-2 Tyrosine kinase with Ig and EGF homology domains VE Cadherin Vascular Endothelial Cadherin VEGF Vascular Endothelial Growth Factor VEGFR-2 Vascular Endothelial Growth Factor Receptor 2     ix  ACKNOWLEDGEMENTS   I would like to give special thanks to my supervisor, Dr. Pascal Bernatchez, as well as members of my supervisory graduate committee – Dr. Darryl Knight, Dr. Ismail Laher, Dr. Casey van Breeman, Soraya Utokaparch for her assistance in the real-time PCR part of the work, members of the Bernatchez lab – Arpeeta Sharma, Cleo Leung, and Andy Trane, as well as my family and friends, for their continuous support.  In addition, I would like to thank for the support of the Heart and Lung Institute of St. Paul’s Hospital, Vancouver BC, its staff and Faculty members, as well as the Department of Anesthesiology, Pharmacology and Therapeutics, University of British Columbia.  Most importantly, I would like to thank my funding agency, the Canadian Institute of Health Research, for providing me with a salary award.          1                - CHAPTER 1 - Introduction                       2  1.1. Scope of the thesis Angiogenesis, or the growth of new blood vessels, has been implicated in a number of settings including tumour growth.  Therefore, a better understanding of angiogenesis is clearly necessary to further our ability to modulate it in disease settings.  Recently, a protein called myoferlin, which was previously known to be involved in membrane resealing and maintaining membrane integrity [1], was found to play a role in modulating the expression of an important regulator of angiogenesis, vascular endothelial growth factor receptor-2 (VEGFR-2) [3], suggesting a novel role for myoferlin in the endothelium.  In addition to VEGFR-2, another receptor called tie-2 plays hand-in-hand with VEGFR-2 to maintain vascular quiescence and blood vessel growth.  As VEGFR-2 and tie-2 share many similarities, the current work will highlight myoferlin-dependent regulation of receptor tie-2, the mechanisms behind this relationship, as well as involvement of myoferlin in tumour cell growth, and significance of the current results.  1.2. An introduction to tumour growth, an abnormal growth of cells Tumour, which means swelling in the Latin language, is a common medical term for a neoplasm or a solid lesion as a result of abnormal cell growth.  It is different from cancer, which is defined by the presence of a malignant tumour.  A tumour may be benign, pre-malignant, or malignant.  Meanwhile, cancers are usually caused by abnormalities in the genetic material of transformed cells, random errors in the DNA replication cycle, or heredity.  Cancers can be generally classified by the origin of the 3  tumour [4], and the most common category of cancers is carcinoma, which are epithelial cells-derived malignant tumours, and includes lung and breast cancer.  Cancer is a complex disease and represents a wide variety of causes and biology.  In spite of this, the most common cause of cancer are the errors that occur during cell replication, also known as mutations, and are passed to daughter cells.  The balance between the maintenance of genetic stability and exclusion of mutations dictate the fate of genetic transmission in any individual organism.  The normal cell could eliminate mutational changes by a number of mechanisms, such as apoptosis and senescence [5].  However, these methods may not be perfect, and often fail in a number of ways, especially in environments that promote the propagation of these mutations, such as in the presence of carcinogens.  As a result, mutations accumulate and the cell finally acts against its normal functions, thus becoming a cancer cell.  Nonetheless, the biology of cell division, differentiation and apoptosis between normal and cancer cells are comparable [6].  However, dysregulation of these cellular functions may be present in the cancer cell – ineffective constraints on cell proliferation, irregular differentiation program, destabilized chromosomal and genetic organization, which leads to high-frequency replication of variant cells, as well as dysregulated apoptosis.  Within a normal cell cycle, transition between different phases requires activation of intracellular enzymes called cyclin-dependent kinases (CDKs).  In turn, activation of CDKs is regulated by the presence of a number of growth factors, such as platelet-derived growth factor (PDGF), epidermal growth 4  factor (EGF), and insulin-like growth factor (IGF), all of which act upon binding to their respective growth factor receptors.  These receptors are large proteins that span the plasma membrane.  Hence, cell proliferation is largely dependent the regulation of these receptors at the plasma membrane.  Indeed, in many cases of cancer, membrane expression of growth factor receptors such as the EGF receptor are produced in excess and leads to increased signaling for cell proliferation [7].  Therefore, understanding the regulations of growth factor receptors would provide insights on tumour cell proliferation.  1.3. Tumour growth – a phenomenon of pathological angiogenesis Angiogenesis is the formation of new capillary blood vessels from pre-existing ones [8], critical in both physiological settings such as embryogenesis and reproduction, and pathological settings, such as cancer growth. During embryogenesis, cell mass increases by cell proliferation and cells are able to increase blood vessel growth by secreting specific factors.  On the contrary, proliferation is often restricted in a developed organism and angiogenesis remains homeostatic.  However, tumour growth is one of the few exceptions and provides a prime example for pathological angiogenesis.  A hallmark of tumour cells is their ability to proliferate uncontrollably and increase angiogenesis. Currently, angiogenesis is considered a major target in treating cancer [9].  The major difference between physiological and pathological angiogenesis lies in the tightly regulated balance of pro- and anti-angiogenic signals. In this section, the ‘angiogenic switch’ and how angiogenesis and its main regulators are involved in tumour growth will be briefly introduced. 5  It is well-known that tumour growth demands oxygen, nutrients, as well as removal of waste products.  To that end, angiogenesis plays a critical role in the tumour development.  Beyond 1 to 2mm3 in volume, solid tumours are no longer able to spread in size due to limited diffusion of oxygen and nutrients to the centre of the tumour, resulting in cellular hypoxia.  Despite the lack of oxygen and nutrient supply, tumour cells are able to induce angiogenesis by secreting angiogenic factors.  The transition from pre-vascular hyperplasia to vascularized tumours has been coined the term the ‘angiogenic switch’ nearly 30 years ago [10,11], which describes the imbalance between pro- and anti-angiogenic factors, ultimately leading to activities that favor tumour blood vessel growth and therefore, tumour growth.  Among numerous previously identified angiogenic factors are VEGF and angiopoietins [12], although the molecular mechanisms that control the abnormal expressions of pro- angiogenic factors have yet to be fully elucidated.  1.4. The first identification of angiogenesis In 1971, Judah Folkman first hypothesized that angiogenesis was a major determinant of tumour growth [13] and since then, important advances in different experimental approaches have led to subsequent discoveries on the process of angiogenesis and identification of various molecules that may stimulate or inhibit this process. In Folkman’s work, the process of angiogenesis involved vasodilatation of pre-existing, or parent vessels, followed by basement membrane degradation, the formation of lumen, loop, new basement membrane, and finally, pericyte incorporation at newly formed blood vessels [14]. 6  1.5. Angiogenic steps What is known about the vasculogenic process stimulated by VEGF and angiopoietins is that it involves mobilization of endothelial precursor cells from the bone marrow and incorporation into the walls of new growing blood vessels [15], vasodilation and increased vascular permeability of existing vessels to allow formation of a matrix where activated ECs migrate, proliferation of ECs to form new blood vessels [10].  Angiogenesis involves initially the degradation of the basement membrane, followed by invasion of proliferating ECs into the perivascular tissue [16].  Not surprisingly, ECs are involved in many ways.  Stimuli coming from a signal course such as ischemia causes the release of growth factors, which would bind to specific receptors located in the plasma membrane of ECs and activate them, allowing the signal to be sent to the nucleus, ultimately cause migration, adhesion, and proliferation of ECs to form new blood vessels [17].  1.6. Identification of Vascular Endothelial Growth Factor (VEGF) and VEGFR-2 VEGF was isolated as a vascular permeability factor by Senger et al. in 1983 [18] and since then, the research of angiogenesis has attracted much attention in the last two decades after the first identification of the first EC-specific VEGF in 1989 [18,19]. VEGF regulates both physiological and pathological angiogenesis by activating various signaling networks and pathways to promote EC proliferation, migration, differentiation and vascular permeability [20].  Furthermore, VEGF is comprised of 7  five different VEGF glycoproteins (VEGF-A, -B, -C, -D, and –E) and are ligands for tyrosine kinase receptor VEGFR-2, also known as Flk-1, and were found to induce the angiogenic signaling cascade.  VEGFR-2 is composed of seven extracellular immunoglobulin (Ig)-like domains, a single transmembrane region and a consensus tyrosine kinase sequence [21,22].  Moreover, VEGFR-2 was found to localize in endothelial caveolae and co-localized with caveolin-1 [23,24], the main coat protein of caveolae.  1.6.1. Downstream effects of VEGF/VEGFR-2 signaling VEGF is a survival factor both in vitro and in vivo in ECs [25-27].  It also promotes vascular permeability [18,28], cell proliferation, as well as vasodilation [29].  Among the five different VEGF glycoproteins, VEGF-A has been the most extensively studied and characterized.  Predominantly secreted by cancer cells in cancer settings, VEGF is commonly upregulated in a number of human solid tumours [30] and its main target is ECs to mediate tumour angiogenesis [31].  Upon binding by VEGF, VEGFR-2 undergoes dimerization, which results in the induction of mitogenic, chemotactic and pro-survival signal [30].  VEGF induces the phosphorylation of phospholipase C-γ, phosphoinositide 3-kinase (PI3K), Ras GTPase-activating protein [32], and Src kinases [33].  By activating the Raf-Mek-Erk pathway, VEGF binding leads to induction of EC growth [34].  By mediating the PI3K-Akt pathway, VEGF binding has anti-apoptotic and pro-survival effects [26].  8  1.7. Identification of angiopoietins and the tie receptors Shortly after the identification of the VEGF-VEGFR system, another angiogenic regulator, angiopoietin [35], and its respective receptors, tie receptors [36,37], were recognized as the second most important regulators of angiogenesis.  Tie receptors include both tie-1 and tie-2, however, much more is known about tie-2, while tie-1 is still poorly understood and remains an orphan receptor [38].  Loss-of-function studies showed that tie-2-deficient mice die between E10.5 – E12.5 [39,40], which is during the early stages of embryonic cardiovascular and angiogenic development, showing deficiency in ECs, branches, pericytes, as well as smooth muscle cells (SMC).  In addition, angiopoietin-1-deficient mice also displayed similar lethal embryonic phenotype [41].  Gain-of-function studies in mice with overexpressed angiopoietin-1 in the skin caused greater degree of dermal hypervascularization [42].  Indeed, evidence has suggested that the angiopoietin-tie-2 signaling system is involved with the maintenance of the stable and quiescent phenotype of EC [43].  1.7.1. The tie receptors – their expression and structure Tie receptors, which include both tie-1 and tie-2 receptors, are similar to VEGF receptors, and are also tyrosine kinase receptors.  This thesis will mainly focus on tie- 2.  Tie is actually an acronym that stands for tyrosine kinase with Ig and EGF homology domains [36] and tie-2 receptors are constitutively expressed in ECs [43]. As its entire name suggests, the extracellular domains of tie receptors comprise of two amino-terminal Ig-like domains, followed by three epidermal growth factor (EGF) homology domains, which are then followed by another Ig-homology domain and 9  three fibronectin type III domains [43].  The binding of angiopoietin-1 to tie-2 receptors has been most extensively studied.  Angiopoietins bind to the second Ig-like loops and the three EGF-homology domains [44,45] and does not lead to major conformational changes [46].  A more recent study by Katoh et al. in 2009 made observations that lipid rafts in the EC membrane served as signaling platforms for tie-2 receptor signaling [47]. However, the authors found that only when stimulated by angiogpoietin-1, tie-2 would tightly associate with lipid rafts.  As will be discussed later, tyrosine kinase receptors like tie-2 must be tightly regulated to maintain homeostasis, and dysregulation of these receptors has been implicated in development of cancer.  Indeed, a number of clinical studies have made observations of elevated plasma concentrations of tie-2 in cancer patients [48-51], strongly suggesting that uncontrolled activation of the receptor can lead to oncogenesis.  1.7.2. Downstream effects of angiopoietin/tie-2 signaling Tie-2, like any tyrosine kinase receptor, acts through the binding of its specific ligand to its extracellular domain, which promotes dimerization of the receptor to induce conformational changes within its catalytic domain, in turn allowing binding of ATP and enzyme activation.  Tyrosine residues within the activation loop of the catalytic domain of the receptor are then phosphorylated in order to stabilize the activated state of the enzyme [52].  Subsequently, specific tyrosine residues remotely located outside 10  of the catalytic domain are transphosphorylated to provide phosphotyrosine-binding domains, which recognize phosphotyrosine residues depending on presence of surrounding amino acids [53] and promote formation of a signaling complex from the recruitment of different proteins ranging from those with enzymatic activities, such as PI3K, to adaptor and scaffold proteins without enzymatic activities.  Tie-2 activation by angiopoietins leads to phosphorylation of the receptor, which in turn recruits various adaptor proteins.  Two distinct signaling pathways exist – one leads to EC quiescence and maintenance and the other leads to EC activation.  In EC maintenance, the phosphorylation of tie-2 recruits adaptor proteins including growth factor receptor-bound protein 2 (GRB2) and the p85 subunit of PI3K [54-57], which is part of the AKT signaling pathway that ultimately leads to signaling of survival promoting pathways, including endothelial nitric oxide synthase (eNOS) and surviving, and suppressing caspase 9 and BAD, both of which are involved in apoptosis of the cell.  In non-resting ECs, such as in the case of angiogenesis, where ECs are migrating, the AKT pathway is involved in cytokine activation [58,59].  Consequently, proliferation, increased three-dimensional capillary organization and basement-membrane- degrading proteases occur [60-62].   11  Illustration 1.  VEGF, angiopoietins, and their respective receptors regulate angiogenesis.  A signal source, for instance a growing tumour in the hypoxic state, would release growth factors such as angiopoietin and VEGF in order to stimulate angiogenesis towards itself.   1.8. VEGF/VEGR-2 and angiopoietin/tie-2 signaling pathways as therapeutic targets Since the identification of VEGF and angiopoietin as two of the most potent endogenous regulators of angiogenesis, treatment of a number of cancer types has considerably emerged over the past decades.  As such, various monoclonal antibodies against VEGF-A binding to VEGFR-2 such as bevacizumab [63] and others such as tyrosine kinase inhibitor vatalanib [64] have been developed to prevent VEGF 12  signaling, while in vivo tie-2 signaling has been shown to decrease through the expression of a soluble tie-2 receptor (Tie2Ex) [65], and these are only a few examples.  The availability of targeted therapies has definitely provided an opportunity to improve anti-tumour growth in combination with the traditional chemotherapy for cancer patients.  Until now, the importance of the balance between pro- and anti-angiogenic growth factors has been discussed and that the expressions of their respective receptors have also been found to play a role in angiogenesis.  Recent advances in the areas of targeted therapeutics and development of biomarkers have opened the window for therapies against these signaling pathways, such as the development of monoclonal antibodies that target tyrosine kinase receptors involved in pathological blood vessel growth.  Besides clinical interventions against signaling pathways through these receptors in pathological settings, their intracellular signaling events are actually tightly regulated under normal circumstances.  The next section will explore common pathways that tyrosine kinase receptors undergo upon activation and how their signaling are attenuated by the cell.  1.9. Proteasomal, cbl-dependent degradation pathways as means for tyrosine kinase receptor regulation Degradation of proteins is essential for their regulation whereas, protein ubiquitination is an important post-translational modification that controls intracellular signaling events.  Defective degradation of proteins could lead to diseases that range from 13  developmental abnormalities to cancer development.  As such, the family of tyrosine kinase receptors typically undergo ligand binding, dimerization of receptor molecules, and the activated tyrosine kinase receptor would then couple a number of downstream signaling cascades [66].  Consequently, the receptor would undergo desensitization, which generally includes rapid endocytosis, followed by its degradation by lysosomes, proteasomes, or recycling of the receptor back to the cell surface for activation [67]. The receptor internalization pathway involves a plethora of different proteins and molecules, including guanosine triphosphatases (GTPases), ubiquitin ligases and actin cytoskeleton [66].  In spite of this, only ubiquitination will be described further in detail for the scope of this thesis.  The 76-amino-acid globular protein ubiquitin is highly conserved in eukaryotes and its covalent conjugation to other proteins ultimately targets the protein for degradation [68].  In fact, ubiquitin is integral in various cellular processes ranging from cell cycle progression and organelle formation to cell death and DNA repair.  Ubiquitination targets specific protein for degradation by proteasome, a multisubunit and ATP- dependent protease.  Notably, the ubiquitin signal is diverse and a great number of different proteins are involved and slight modifications of the ubiquitin conjugation or bonding, the enzyme that recognizes the substrate, or the number of ubiquitins conjugated on the target protein, could ultimately determine the fate of the ubiquitinated protein [68].  14  To comprehend the complexity of the process of ubiquitination, the basic steps of ubiquitination need to be understood.  First of all, ubiquitination involves multiple steps, each involving at least three types of enzymes – E1, or the ubiquitin-activating enzyme; E2, the ubiquitin-conjugating enzyme; and E3, the ubiquitin ligases [69,70]. The E3 ubiquitin ligases are responsible for catalyzing the transfer of ubiquitin from the E2 enzyme to the ε-amino group of the lysine residue of the target substrate through an isopepetide bond [71].  While the mechanisms of ubiquitination are not fully understood, recent advances have shed light on the mechanism by a family of E3 ligases called cbl.  The cbl ubiquitin ligases are generally composed of an N-terminal tyrosine kinase- binding domain, a Zinc-coordinating RING finger that interacts with E2s; a proline- rich region; and a C-terminal leucine zipper-like region [72].  Importantly, the RING finger was found to be essential for ubiquitination of receptor tyrosine kinases in vitro and in vivo [73].  In this work, the role of cbl will be tested in the settings of tie-2 regulation by myoferlin, a protein that is part of the ferlin protein family, which will be introduced in a later section.  1.10. The endothelium in the process of angiogenesis As the current work centres around the growth of blood vessels, it is important to understand their basic anatomy.  Blood vessels are made up of three distinct layers: the adventitia, media, and intima, and the innermost layer of the blood vessel is the 15  endothelium, which is part of the intima, and provides as the interface between the blood vessel wall and the lumen.  It is not surprising that angiogenesis involves dynamic interactions between the endothelium and its environment.  Signal transduction from hormones and growth factors produce their effects by interacting with specific receptors in the plasma membrane of the EC.  Indeed, a vast literature supports the idea that a number of membrane proteins including some growth factor receptors are found within microdomains in the plasma membrane [74-78], such as the already mentioned VEGFR-2 [79].  Moreover, these microdomains are generally known as lipid rafts, which are further subdivided into caveolae and non-caveolae lipid rafts.  1.11. Signaling in ECs: Cholesterol-rich membrane microdomains Lipid rafts refer to the small domains in the plasma membrane that are rich in cholesterol and sphingolipids, which closely interact with phospholipids that contain saturated fatty acid acyl chains.  Hence, lipid raft domains are tightly packed, giving rise to their far more ordered lipid environment than non-lipid raft regions, or the bulk membrane [80], as well as the key feature that defines lipid rafts.  That is, lipid rafts are resistant to solubilization by nonionic detergents [81] and are subdivided into caveolae and non-caveolae lipid rafts.  16  1.11.1. Lipid rafts Lipid rafts are involved in a number of cellular processes, such as protein and lipid trafficking [82], signal transduction [83], as well as viral entry [84].  Lipid rafts may be generally separated into two main categories: 1) caveolae/lipid rafts and 2) non- caveolae/lipid rafts.  The main differences between the two lie in the critical presence of the protein caveolin-1 and the presence of caveolae, which are “little caves” with a diameter of 50 – 100nm [85], and will be discussed below.  1.11.2. Caveolae Caveolae or caveoli (plural), originally identified by electron microscopy in epithelial [86] and ECs [87] nearly 60 years ago, are the small invaginations of the plasma membrane that are rich in cholesterol, and these small organelles are expressed in most cell types.  A marker for caveolae is caveolin-1, which is a small, 25kD structural protein, and depletion of this coat protein actually inhibits caveolae formation [88]. More recently, much attention has been focused on caveolae due to their heavy involvement in cellular activities including endocytosis, cholesterol homeostasis, signal transduction across the plasma membrane, and Ca+2 signaling [85].  Caveolae serves as compartmentalization clusters for many different signaling proteins, including angiogenic receptor VEGFR-2 [89] and eNOS [90,91].  Caveolae acts as a platform of microdomains to concentrate a number of different receptors and post- receptor components [92].  In fact, the endothelium is heavily enriched with caveolae in the plasma membrane.  Therefore, endothelial caveolae is increasingly accepted as 17  having a dynamic role in signaling transductions, some of which are important pathways in angiogenesis.  Since cellular signaling and trafficking largely take place at the plasma membrane, specifically at these membrane microdomains, the study of membrane proteome has been a popular topic for many.  As a matter of fact, the isolation and identification of proteins that reside in caveolae/lipid rafts has been successful by the use of proteomics analysis, the large-scale study of proteins.  Caveolae/lipid rafts can be isolated from cells and run on a SDS-PAGE gradient gel, following which prominent bands would be excised for mass spectrometry for the identification of proteins.  Using this method, a number of proteins have been identified in endothelial caveolae, such as nogo-B [93], and more recently, myoferlin [3], which is a member of the ferlin protein family, and will be discussed below.  1.12. Ferlins, known regulators of membrane integrity Ferlins are a family of transmembrane proteins that are able to reseal the plasma membrane and are mainly responsible for membrane-trafficking of proteins.  They share homology with synaptotagmins, which are known to have Ca+2-sensing abilities [94].  The name of ferlin comes from FER-1 [95], a protein in Caenorhabditis elegans responsible for the fusion of membranous organelles with the plasma membrane [96]. There are various ferlin members that have recently been found to play the role of plasma membrane resealing, including dysferlin, otoferlin, and myoferlin (Figure 2). Dysferlin is a large 220kD trasnsmembrane protein that is responsible for membrane 18  repair and vesicle trafficking in skeletal muscle cells.  Disruption or mutation of this protein is implicated in three main phenotypes – Myoshi myopathy (MM), Type 2 limb girdle muscular dystrophy, and distal myopathy with anterior tibial onset [97]. Otoferlin, a protein present in the inner ear, is comprised of six C2 domains, which serve as the main Ca+2 sensor for release of neurotransmitter at auditory hair cell ribbon synapses [98,99].  Myoferlin, a 230kD protein and another member of the ferlin family, is widely distributed in mammalian tissues [1] and was identified only a decade ago as highly homologous to dysferlin.  In myoferlin-null mice, the late stage of myogenesis, particularly myoblast fusion, is defective and mice have smaller muscles and their myofibers have reduced cross-sectional area compared to their control counterparts [100].  Myoferlin is required for proper muscle development as it mediates myoblast fusion [101].  In cases where there is ongoing degeneration and regeneration of muscle cells, such as in mouse model of Duchenne muscular dystrophy and in human muscle with the same phenotype, myoferlin mRNA is upregulated [1,100,102], and in dystrophin-deficient mdx mice, myoferlin expression at the plasma membrane is also increased [1], suggesting the importance of myoferlin in both muscle regeneration and repair.  Indeed, myoferlin was found to be highly expressed in elongated myoblasts preparing to fuse to myotubes [103], as well as in injured skeletal muscle cells [104].  In conjunction with this, the most recently published study on myoferlin in a muscular dystrophic mouse model found that the myoferlin gene was focally upregulated in damaged myofibers but not in intact myofibers, which means that the differential gene expressions were not inherent to the primary genetic defect, but rather related to the specific function and repair of the 19  myofiber [101].  Another recent study shows that myoferlin is involved in the regulation of growth factor signaling in myoblast fusion and muscle growth [104].  In this study by Demonbreum et al., striking evidence showed that the insulin-like growth factor (IGF)-1 receptor, a receptor for IGF1, a potent mediator for muscle growth, was co-localized with myoferlin at sites of myoblast fusion and that myoblasts deficient in myoferlin displayed mistrafficking of the IGF1 receptor.  Moreover, IGF1 receptors were accumulated in large vesicles and directed to a degradation pathway via endosomes/lysosomes instead of being recycled to the plasma membrane, leading to decreased IGF1 signaling [104].  Interestingly, myoferlin was also found to be abundant in both cardiac and skeletal muscle cells and it is a candidate gene for muscular dystrophy and cardiomyopathy [1].  Illustration 2.                Structure of the ferlin family members.  Ferlin family members contain multiple cytosolic Ca+2- sensing C2 domains and a C-terminal transmembrane domain.   FER-1 Dysferlin Otoferlin Myoferlin 20  1.13. Myoferlin, an unexpected regulator of vascular homeostasis As mentioned, myoferlin is a member of the ferlin family, which is comprised of a number of proteins that are commonly accepted to possess vital roles in membrane trafficking and patching events at the membrane.  Myoferlin was first identified and characterized in cardiac and skeletal muscle cells and was predicted to be a type II transmembrane protein containing six C2 domains.  In the presence of Ca+2, the first C2 domain of myoferlin binds to phospholipids [100].  Moreover, myoferlin is expressed in both the nuclear membrane, as well as the plasma membrane, which is different from dysferlin, a protein only present in the plasma membrane [1].  In the study by Davis et al., expression of myoferlin was found in animal models of muscular dystrophy, suggesting the primary role of this transmembrane protein in skeletal muscles.  Indeed, myoferlin-deficient mice go through defective myogenesis and muscle regeneration [1,100].  Since ferlin family members share homology with FER- 1, myoferlin was initially suggested to play a role in plasma membrane dynamics.  Recently, myoferlin was first reported in lipid rafts of EC and is highly expressed in blood vessels.  Moreover, myoferlin was identified to be a regulator of VEGFR-2, the main receptor for VEGF [3].  In this work, Bernatchez et al. also found that myoferlin complexed with VEGFR-2 in an SH3-dependent manner to prevent cbl-dependent proteasomal degradation of the receptor.  In addition, in a more recent study, Bernatchez et al. demonstrated that in ECs, myoferlin regulates caveolae/lipid raft and clathrin-dependent endocytosis [2], which 21  are important endocytic processes in membrane trafficking events.  This study explored the new role of myoferlin to regulate plasma membrane turnover events, as well as receptor-dependent endocytosis.                                        22                      - CHAPTER 2 - Research Overview                 23  2.1. Rationale Myoferlin, a member of the ferlin family, has been initially implicated in patients with muscular dystrophy and was initially discovered in skeletal muscle cells and cardiac cells.  Moreover, the identification of myoferlin in the endothelium, specifically in caveolae/lipid rafts, which are heavily involved in plasma membrane signaling, along with its fellow ferlin family members, have opened a wide area of possible research in cell signaling.  As such, blood vessel growth and formation of a functional vasculature, as well as the cell cycle of the proliferating tumour cell, require meticulous regulations of signaling and complex processes.  With the knowledge that myoferlin is involved in the regulation of VEGFR-2 expressions in BAECs [3] and VEGF-dependent downstream activities, such as EC growth and permeability, and that myoferlin is now suggested to play in a role in caveolae/lipid raft-dependent plasma membrane trafficking and the endocytosis process, the role of myoferlin in regulating tie-2 receptor expression, as well as its involvement in tumour cell proliferation, are examined in the current work.  Similar to VEGFR-2, tie-2 is a receptor tyrosine kinase that is mainly expressed in ECs [36,37].  Binding of its ligand to the extracellular domain leads to receptor dimerization, followed by activation of the kinase domain and autophosphorylation of tyrosine residues, ultimately leading to angiogenic signaling pathways.  However, unlike VEGFR-2, tie-2 seems to play a role in vascular quiescence and stability via the Akt pathway [62], as well as vascular migration and proliferation via the Erk pathway [105,106], as in a context-dependent angiogenic receptor.  Thus far, how tie-2 may act 24  as a context-dependent angiogenic receptor to activate either the Akt and Erk pathway remains controversial.  Despite current debate on the signaling pathways of tie-2 and its ligands, or the cellular requirements for tie-2 to play part in the cell survival pathway or proliferation pathway, lipid raft domains acting as a centers for signaling complexes clustering remains commonly accepted and a number of studies support this hypothesis.  Based on the findings that VEGFR-2 is targeted to caveolae/lipid rafts when stimulated [107], and that tie-2 may also be translocated to lipid rafts when stimulated [47], the current work studies the unstimulated, or basal level of expressions of tie-2 regulated by myoferlin membrane protein in ECs.  2.2. Hypothesis We hypothesized that similar to VEGFR-2, myoferlin also plays a role in regulating tie-2 expression in ECs and its downstream activities.  We also hypothesized that myoferlin plays a role in regulating tumour cell proliferation.  2.3. Specific aims In this work, we specifically aimed to: 1. Examine tie-2 expressions in BAECs following myoferlin disruption by gene- silencing 2. Determine tie-2 mRNA levels following myoferlin disruption by gene- silencing 25  3. Investigate the possible mechanisms of tie-2 regulation by myoferlin, namely the proteasomal degradation pathway, and the cbl ubiquitin ligase-dependent degradation pathway 4. Determine the location of myoferlin and tie-2 in BAECs by isolating caveolae/lipid rafts from cytosolic bulk proteins 5. Determine the effects of myoferlin gene-silencing on cell proliferation in LLCs  Illustration 3.         Does myoferlin play a role in regulation of tie-2 expression in ECs and cancer cell growth? Previous studies showed that myoferlin is involved in membrane resealing and trafficking events such as endocytosis.  As such, it may be involved in the regulation of receptor VEGFR-2 by regulating its degradation.  The current work investigates myoferlin’s role in tie-2 expression in ECs, as well as cancer cell growth.      26                 - CHAPTER 3 - Methods and Materials                  27  3.1. Cell Culture BAECs were isolated from bovine aorta and characterized by the expression of eNOS and their phenotypic cobblestone monolayer morphology.  LLCs were purchased from ATCC.  Cell culture plasticware was purchased from Corning.  BAECs and LLCs used were passages between 5 and 15 and cultured in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen), supplemented with 5% fetal bovine serum (FBS, Hyclone) and penicillin streptocycin (Sigma).  Cells were placed in a 37°C humidified incubator supplied with 7% CO2.  3.2. Gene-silencing by small interfering RNA (siRNA) Small interfering RNA (siRNA) was used for gene-silencing in this work.  Since this technique is widely used in the scientific community, this section will only briefly discuss the general mechanisms and history of this scientific approach.  First described in 1998 by Fire and Mello in C. elegans, experimental introduction of RNA into cells may be used to interfere with specific gene functions.  Injected single- stranded RNA (antisense) hybridizes with the endogenous mRNA transcripts [108] and causes gene silencing at the translation stage of protein synthesis [109].  This phenomenon is termed RNA interference of RNAi and after merely a decade, this process has become a common and standard method in scientific research.  RNAi may be further separated mainly into microRNA (miRNA) and siRNA.  28  The mechanism of RNAi has been extensively studied in detail.  The basic process involves a number of steps.  First, after the introduction of dsRNA, a protein called dicer, an endonuclease, would cleave the dsRNA into smaller and shorter siRNA around 21 nucleotides in size.  It then enters the ribonucleoprotein RNA-induced silencing complex (RISC), where the entire complex is guided to the complementary target RNA and the target RNA is cleaved and rapidly degraded by RNases so the coded protein would not be synthesized [110].  3.2.1. siRNA treatment For siRNA-transfection, both 15nM and 75nM concentrations of siRNA (Thermo Scientific Dharmacon) were used.  BAECs or LLCs were seeded in either 6-well plates (for analysis of receptor expressions) or 12-well plates (for proliferation assays) one day prior to cell treatment to allow optimal cell conditions.  At the time of treatment, cells were grown to approximately 70 to 80% confluency.  Oligofectamine (Invitrogen) was used as a transfection reagent that forms stable complexes with oligos to permit for efficient transfection in eukaryotic cells.  Opti-MEM (Gibco) was used as the medium of transfection.  Opti-MEM was mixed with Oligofectamine reagent for 5 minutes while Opti-MEM was also mixed with 15nM or 75nM of siRNA for 5 minutes at room temperature.  After 5 minutes, Opti-MEM with Oligofectamine and Opti-MEM with siRNA were mixed together for another 30 minutes at room temperature prior to treatment of cells.  Cells were then treated with the transfection media and incubated at 37°C and 7% CO2 for 6 hours.  After 6 hours, transfection media was replaced by 5% FBS in DMEM and allowed to grow at 37°C and 7% CO2 29  for 24, 48, and 72hr.  They were then lysed with VJ cell lysis buffer at specific time points.  3.3. Western blot analysis Proteins isolated from cells were subjected to SDS/Polyacrylamide electrophoresis (PAGE) followed by Western blotting.  The antibodies used in Western blot analysis were β-COP (rabbit, ABR), caveolin-1 (rabbit, Santa Cruz Biotechnologies), HSP90 (mouse, BD Transduction), HA (rat, Roche), tie-2 (rabbit, Santa Cruz Biotechnologies), and myoferlin (mouse, Abcam).  Secondary antibodies used were goat anti-mouse 788 (Invitrogen), goat anti-rabbit 698 (Invitrogen) and goat anti-rat 788 (Invitrogen).  Acrylamide gels were made up to 7.5%, where detection of myoferlin (230kD), tie-2 (150kD) and either housekeeping proteins HSP90 (90kD) or βCOP (110kD) were possible.  ODYSSEY Infrared Imaging System (Licor) was used for fluorescent detection of proteins and amount or intensity of proteins present was quantified by densitometry using the ODYSSEY program.  3.4. Analysis of transcriptional levels of tie-2 Transcriptional levels of tie-2 in BAECs treated with 15nM and 75nM of control scrambled and myoferlin siRNA isolated at 24, 48, and 72hr, were determined by Real-time PCR, or quantitative PCR (qPCR).  This method allows the determination for the amount of a target sequence, in this case, tie-2 as it has the ability to monitor the progress of the PCR while it occurs in real time.  This technology combines the traditional and conventional PCR with the detection and quantification of fluorescence 30  from a fluorescent reporter.  Real-time PCR characterizes PCR reactions by the point in time during cycling with first detection of target gene amplification and data is collected throughout the PCR process, as compared to conventional PCR, where the total accumulated amount of target gene is quantified after a fixed number of cycles in an endpoint assay.  In real-time PCR, the greater amount the starting copies of nucleic acid target, the sooner it is to detect the significant increase in fluorescence in real time as the amount of fluorescence is directly proportional to the amount of PCR product. As a result, some advantages of real-time PCR over conventional PCR include the significantly smaller amount of starting template required to begin with, greater accuracy in quantifying the account of PCR products and elimination of the need for post-PCR electrophoretic gel analysis.  In this work, a housekeeping gene was also subjected to qPCR in the same samples as a reference gene for quantification of qPCR products among samples.  BAEC samples were isolated with buffer RLT (supplied in RNeasy Kit, Qiagen), and selected amount was used to produce complementary (cDNA) products using Reverse-transcriptase PCR or RT-PCR, as described in Section 3.4.2.  cDNA samples were then added to 300nM custom-designed tie-2 and GAPDH primers (described in section 3.4.1.) as well as SYBR Green I Mix (ABM) and water.  Using the ABI Prism 7900HT (Applied Biosystems), all qPCR assays were performed in 384-well plates with the following thermal cycler conditions:   31  Stage  Time (minutes) Temperature (ºC) Repeats 1 Step 1 2:00 50.0 --- 2 Step 1 10:00 95.0 --- Step 1 0:15 95.0 3 Step 2 1:00 55.0 35 Step 1 0:15 95.0 --- Step 2 0:15 55.0 --- 4 Step 3 0:15 95.0 ---  Stage 1 was the initial incubation that allowed for AmpErase uracil N-glycosylase (UNG) to activate and decontaminate the reaction by cleavage of uracil bases from the DNA strands that were already synthesized in the presence of dUTP.  Stage 2 was performed to allow activation of the DNA AmpliTaq Gold polymerase.  Stage 3 consisted of 35 cycles of denaturation, annealing of primers, and extension of amplicons at indicated respective temperatures and duration.  Finally, stage 4 is added to run a meltcurve, which will generate a dissociation curve of the amplified product. The need for a dissociation curve will be discussed in section 3.4.6.2.  3.4.1. RNeasy Mini Kit to isolate RNA from BAEC samples For the detection of transcriptional levels of tie-2 and GAPDH, RNA from BAECs in different treatments were analyzed using qPCR.  The RNeasy kit (Qiagen) was used for isolation of RNA.  The RNeasy technology procedure utilizes selective binding properties of a silica-gel-based membrane, with binding capacity of 100ug RNA.  The spinning protocol was used in this experiment.  BAEC samples from 6-well culture 32  dishes were first lysed in 200ul buffer RLT, which contained a highly denaturing guanidine isothiocyanate-containing buffer, which inactivates RNases for isolation of intact RNA.  Addition of ethanol to samples provided appropriate binding conditions of RNA to the silica-gel-based membrane while contaminants were efficiently washed away with provided buffer solutions (RW1 and RPE).  Finally, high-quality RNA was eluted in 70ul water.  3.4.2. Reverse transcription to obtain cDNA Reverse transcription was used to synthesize complementary DNA (cDNA) from BAEC RNA samples.  10µL or RNA for each 20µL reaction was reverse transcribed using random primers and Superscript II Reverse Transcriptase (Invitrogen).  2µg/µL of random primers and 10mL of dNTPs (Invitrogen) were first added to RNA samples and incubated for 65ºC for 5 minutes, followed by immediate placement on ice.  The mixture was then pulse centrifuged to ensure full coverage of any condensation built up within the PCR tube.  Meanwhile, a master mix was made from 4µL of 5X first strand buffer, 2µL of 0.1M dithiothreitol (DTT) and 1µL of RNaseOUT Recombinant Ribonuclease Inhibitor (40U) (Invitrogen).  The master mix was then added to the RNA mixture and incubated at 42ºC for 2 minutes and 1µL of Superscript II Reverse Transcriptase (200U) (Invitrogen) was also added to the reaction mix and the completed reaction mix was then incubated at room temperature for 15 minutes and subsequently placed into the Robocycler (Stratagene).  The Robocycler cycling conditions were 42ºC for 50 minutes and 70ºC for 15 minutes to complete the reverse transcription.  cDNA products were then stored at -20ºC until use. 33  3.4.3. Design of tie-2 and GAPDH primers for qPCR Sequences of primers of both tie-2 and GAPDH were chosen with the use of the Primer ExpressTM software (Applied Biosystems) and the recommended criteria. Selection of amplicons were based on length of amplicons – chosen at about 150 base pairs to allow for rapid amplification and a G-C content between 20 to 80%.  Selected primers were subjected to a BLAST (Basic Local Alignment Search Tool) search through NCBI to ensure specificity to tie-2 and GAPDH.  3.4.3.1. Designing primers for SYBR Green I assay required stringent criteria Since SYBR Green I would bind to non-specific dsDNA, it was vital to design primers that would only bind to the selected target, in this case, tie-2 and GAPDH.  Therefore, amplicons between 100 and 150bp were carefully selected in order to obtain an excellent level of fluorescence without compromising the efficiency of the PCR.  The melting temperature, or the Tm of the primer, is the temperature at which 50% of oligonucleotide is hybridized.  The calculation that was used to determine the Tm is: Tm = 2(number A + T) + 4(number G + C)  3.4.3.2. Tie-2 and GAPDH primers for qPCR The GAPDH forward primer is 5’ACAGTCAAGGCAGAGAACGGG and reverse primer is 5’CACATACTCAGCACCAGCATCAC.  The tie-2 forward primer is 5’ACTCAAGATGYGACCAGAGAA and reverse primer is 34  5’CCTCGAACTCGCCCTTCAC.  The Tm used throughout this work for either of these primers was 55°C.  3.4.4. Standards for qPCR Synthetic standards were produced for both tie-2 and GAPDH to allow generation of a standard curve, from which the efficiencies for each sets of primers could be deduced.  The efficiency of a PCR reaction was calculated by using the following equation: Efficiency = 10(-1/slope) –1  The efficiency of a standard curve should fall between 90 to 110%.  Ideally, a standard curve should consist of at least four concentration points and samples used for the standard curve should also be prepared in at least duplicates to provide an accurate estimate for the copy numbers of the target gene, or its original template concentrations.  In addition, samples should also have concentrations that fall within the range of the standard curve.  3.4.4.1. Synthesis and purification of tie-2 and GAPDH DNA samples as standards Synthetic standards were produced for determination of PCR efficiencies.  A control, untreated, BAEC sample grown to confluency was used to first produce RNA by RNeasy Mini Kit (Qiagen) and converted to cDNA by reverse transcription, following which a conventional PCR using tie-2 and GAPDH primers was run. 35   Resulting PCR product was subjected to TOPO® TA Cloning. The TOPO® cloning reaction was then transformed into competent E. coli supplied by Invitrogen as Transforming One Shot® Mach1™-T1R.  250ul of room temperature S.O.C. (Super Optimal broth with Catabolite repression containing 2% bacto-tryptone, 0.5% bacto- yeast extract, 8.56mM NaCl, 2.5mM KCl, 20mM glucose and water) medium was added and 25ul of mixture from each transformation was spread on a pre-warmed selective plate.  Plates were then incubated overnight and subjected to blue/white screening.  Only white colonies were picked and grown in LB media overnight. Successfully grown culture was spun down into a pellet and subjected to Wizard® Plus SV Minipreps DNA purification system (Promega). DNA plasmids were analyzed by sequencing by the NAPS Sequencing Unit located at the University of British Columbia, Vancouver, BC.  Selected DNA plasmids were then subjected to PCR using either tie-2 or GAPDH primers, followed by gel extractions to obtain purified DNA products and used as standards.  3.4.5. SYBR Green I Dye SYBR Green was used as the fluorescent reporter in the qPCR reactions and these are the small molecules that bind to double-stranded DNA, which increase fluorescence when bound to double-stranded DNA and would not inhibit the PCR reaction.  Some advantages of using SYBR Green I dye is that it can be used to detect amplification of any double-stranded DNA PCR products and that it does not require the use of a probe, which in turn reduces costs and assay setup.  On the other hand, the main 36  disadvantage associated with the use of SYBR Green I Dye is that it may generate false positive signals since it may bind to any non-specific double-stranded DNA.  SYBR Green I Dye (ABM) contained the 2X EvaGreen qPCR Mastermix – ROX. ROX is a passive internal fluorescent reference dye, 6-carboxy-X-rhodamine, which is used to normalize the target signal due to non-PCR related fluorescent fluctuations in reagent concentrations or volume inconsistencies in different samples over time, and is automatically calculated by the qPCR software.  3.4.6. Data analysis of qPCR results The two most common ways to calculate the results from the qPCR assays are the absolute or the relative quantification methods [111].  Absolute quantification is typically used to quantify unknown samples by interpolating their exact copy numbers from the standard curve.  For example, one may desire to quantify the viral copy numbers associated with a disease state in patients.  Relative quantification, on the other hand, is typically used to analyze changes in expressions of a gene of interesting in a given sample compared to a reference sample (ie untreated control samples).  In this work, relative quantification was employed as transcriptional levels of tie-2 in 15nM and 75nM myoferlin siRNA-treated samples were compared to scrambled siRNA-treated control samples.  37  3.4.6.1. The relative quantification method to analyze qPCR results To analyze results from qPCR, there are usually two different methods – the absolute and relative quantification method.  There are three main methods to obtain relative quantification, which will be discussed in the Discussion section.  In the current work, the relative quantification method was used, specifically the Pfaffl method.  The Pfaffl method uses the following equation:  Ratio       =          (Etarget) ΔCT, target (calibrator – test)              (Ereference) ΔCT, reference (calibrator – test) where Etarget and Ereference are the amplification efficiencies of target and reference target genes, respectively, and ΔCT, target (calibrator – test) is the CT of the target gene in the calibrator subtracted by the CT of the target gene in the test sample, and ΔCT, reference (calibrator – test) is the CT of the reference gene in the calibrator subtracted by the CT of the reference gene in the test sample.  3.4.6.2. The dissociation curve – to confirm detection of a single specific product Since one of the disadvantages of the SYBR Green I Dye is its nonspecific binding to any double-stranded product, which may include both the amplified product and primer dimers, it is vital to systematically run a dissociation curve.  This is stage 4 of the qPCR cycling conditions, where temperature is slowly increased from 55°C (annealing temperatures of primers used) to 95°C while fluorescence is continuously 38  being measured.  The principle is that at a certain temperature, the entire amplified product fully dissociates, which leads to a decrease in fluorescence when the SYBR Green I Dye no longer associates with the dsDNA.  This temperature at which the dsDNA dissociates depends on the length and the composition of the amplicon.  The ideal dissociation curve should show a single dissociation peak.  The presence of primer dimers would yield a smaller product with a dissociation peak at around 70°C.  3.5. Co-infection of siRNA-transfected cells with Ad70Z/3CBL BAECs that were transfected with scrambled or myoferlin siRNA were subjected to co-infection of an adenoviral form of the dominant negative form of cbl, or 70Z/3CBL.  For this adenovirus, the cDNA was subcloned in the Ad5 shuttle vector. In addition, this particular adenovirus was hemagglutinin (HA)-tagged.  Two different doses have been used – multiplicity of infection (MOI) of 15 and 30.  MOI is the number of desired viral particles per cell during the infection.  MOI is calculated as follows:  MOI = Plague Forming Units(PFU)/ml x volume of virus used (ml) Number of cells/ml  where PFU/ml is the amount of virus particles per milliliter.  The calculation of PFU will be discussed in the later section.  In the following sections, this adenovirus will be referred to as AdCbl(-/-).  39  3.5.1. Amplification of AdCbl(-/-) The protocol used to amplify AdCbl(-/-) was adapted from the protocol used in the virus amplification facility at the University of Iowa.  293HEK, or Human Embryonic Kidney cells, were used to amplify AdCbl(-/-).  15 150mm2 cell culture plates of infected 293HEK at 50% viability were used as starting material, spun down at 1200rpm for 5 minutes, freeze-thawed three times with 30 seconds of vortexing between each cycle.  Lysates were then spun down again to rid of cell membranes for 10 minutes at 4°C at 4000rpm and supernatant was laid on top of a CsCl gradient in an ultracentrifuge tube as followed: 0.66mL of 1.5g/mL Tris pH 7.9 4mL of 1.35g/mL Tris pH 7.9 4mL of 1.25g/mL Tris pH 7.9 A first spin at 28,000rpm at 12°C was performed for 6 hours, after which a distinct band was removed to put on top of a second gradient for an overnight second spin. Finally, the band was isolated and subjected to dialysis against 10mM Tris HCl at pH 7.9 at room temperature for 45 minutes, 10mM Tris HCl at pH 7.9 pre-cooled at 4°C for 1 hour, and finally against 10mM Tris HCl pH 7.9 and 1mM MgCl2 at 4°C for 45 minutes.  3.5.2. Cytopathic effect (CPE) assay to determine Adenovirus virulence 293HEK cells were plated in 96-well tissue culture plates  (BD Biosciences) at defined density chosen so that by the end of the assay, cells that were not challenged with the virus (negative control) would become confluent.  The adenovirus was titrated by two- 40  fold dilution across the plate with 12 data points in triplicate.  The wells were then added with 5% FBS in DMEM every 72 hours and occasionally monitored microscopically during the incubation time and the assay was completed in 10 days after addition of adenovirus to the cells.  Wells were examined and where cells were 50% alive, the well would then be the endpoint.  Assuming that the well with the highest dilution of virus that still exhibits CPE initially contained one infectious particle, calculation of titer was based on the following formula: Titer = 3n x 40 x 105 PFU/ml Where n is the number of wells showing CPE, and PFU stands for Plaque Forming Unit.  3.6. Treating siRNA-transfected cells with Mg-132 Mg-132 (VWR) was used as an inhibitor of proteasomes.  BAECs that were first treated with scrambled and myoferlin siRNA for 72 hours in 5% FBS in DMEM, and 2 hours prior to cell lysis, 10µM of Mg-132 and equivalent volume of DMSO (Sigma Aldrich), which was the control, was added to the media.  Cells were isolated 2 hours later and Western blot analysis was then performed to detect expressions of myoferlin and tie-2.  3.7. Sucrose gradient fractionation for isolation of caveolae/lipid rafts Localization of proteins in cholesterol-rich membrane microdomains (caveolae/lipid rafts) was assayed by sucrose gradient fractionation. For this purpose, BAEC proteins were isolated with a non-detergent buffer and separated by a 5-35% discontinuous 41  sucrose gradient.  Two 100mm2 culture dishes of confluent BAECs were first washed twice with pre-cooled PBS and cells were then lysed with 2ml of non-detergent lysis buffer that contained 500mM Na2CO3 at pH 11, 3.2mg/ml protease inhibitors (Roche Applied Science) and 2mM phenylmethanesulfonyfluoride (PMSF, Fluka Chemicals), and then subjected to sonication (three 10-second bursts) to dissociate cellular aggregates.  Solubilised cellular material was then adjusted to 45% sucrose by adding 2ml of 90% sucrose in MBS (25mM Mes, pH 6.5, 0.15M NaCl) and mixed well by pipetting up and down.  After incubation on ice for 2 hours, the buffered BAECs was carefully laid at the bottom of the 5-35% discontinuous sucrose gradient (6ml 35% sucrose and 2ml 5% sucrose in MBS containing 500mM Na2CO3), and subjected to 16 hours of ultracentrifugation at 28000rpm at 4°C in an SW28 rotor (Beckman Instruments).  Afterwards, twelve 1ml fractions were carefully taken out from the ultracentrifuge tube and Western blot analysis was carried out.  HSP90 and β-COP were used as markers for bulk cytoplasmic proteins while caveolin-1 was a marker for cholesterol-rich membrane fractions.  3.8. Proliferation assays LLCs were seeded in 12-well plates (as described above) one day before cell treatment.  Treatment of cells was the same as described above.  After treatment, cells were provided with 5% FBS overnight to allow cells to recover from Opti-MEM treatment.  Instead of allowing the cells to grow until isolation, the growth cycles of LLCs were synced at G0 phase by starvation of cells for 8 to 10 hours in serum-free media, and then fed again with 5% FBS and this was noted as t = 0hr.  Control LLCs 42  that were only treated with the vector (Oligofectamine only) were counted (n = 4) to mark the number of cells at t = 0hr.  The schematic experimental procedure is illustrated below: Seed LLCs   Treatment; 5%   Serum-starve            LLCs counted    LLCs counted          FBS overnight    LLCs 8-10hr;      5% FBS          after starvation        Control LLCs count _________|_____________|____________|____________|____________|____________|_________ t =         -48hr                  -24hr            0hr                  24hr                48hr                 72hr   3.8.1. Cell-counting with haemocytometer and data analysis Cell proliferation assay and analysis were performed using the haemocytometer. To use the haemocytometer, cell suspensions were dilute enough that cells did not overlap in the grid and were uniformly distributed.  Preparing the haemocytometer required cleaning of the mirror-like surface and coverslip that would be used.  The coverslip would then be placed over the counting surface and cell suspension (10ul) would be introduced into the V-shaped well using a pipette.  10ul of cell suspension is typically enough to fully cover the mirror surface underneath the coverslip by capillary action.  4X objective under a light microscope would allow viewing of the entire grid of the counter chamber, which is typically separated into 9 individual large squares and each of these squares has a 1mm2 surface area and depth of 0.1mm, bringing the total volume of each square to 0.1 mm3 or 10-4 cm3.  As 1cm3 = 1ml, cell concentration per ml could then be determined. 43  3.8.2. Trypan blue in exclusion assay To ensure that LLCs in cell proliferation assay have not gone through cell death after transfection of siRNA, Trypan blue (Hyclone) was used as an exclusion stain to measure cell viability.  The theory is that live cells would have intact cell membranes and therefore would not take up the Trypan blue dye.  Under the microscope, only dead cells would be shown as a distinctive blue color.  The percentage of viable cells (total cells subtracted by dead cells) from each treatment was determined.  3.9. Statistical analysis Statistical analysis was performed using GraphPad PRISM® Version 4.0 (GraphPad Software).  The resulting tie-2 RNA levels between non-silencing scrambled and myoferlin siRNA-treated BAECs in treatments of different doses and time points were determined using the automatic baseline correction, where results from scrambled siRNA-treated BAECs were chosen as baseline and resulting graphs display the ratio of relative tie-2 RNA in myoferlin siRNA-treated cells to that in scrambled siRNA- treated cells.  The statistical significance of the differences between different treatment groups was determined using the unpaired t-test and a p-value < 0.05 was considered to be statistically significant.  In LLC count in proliferation and viability assays, significance of the differences between scrambled and myoferlin siRNA-treated cells was determined using an analysis of variance (Two-way ANOVA) followed by a Bonferroni test and a p-value < 0.01 was considered to be statistically significant.    44                  - CHAPTER 4 - Results                 45  4.1. Disruption of myoferlin caused decreased tie-2 protein expression in BAECs We investigated the role of myoferlin in expressions of tie-2.  Myoferlin siRNA was used to specifically target myoferlin expression in BAECs.  Western blots in Figure 1 A and B show that 15 and 75nM of myoferlin siRNA successfully knocked down myoferlin expression up to 75 and 80% at 72hr, respectively.  When expression of tie- 2 in BAECs was analyzed by Western blotting, they were also decreased after 24, 48, and 72hr by about 5, 2, 25% and 15, 20, 45% at 15nM myoferlin siRNA and 75nM myoferlin siRNA, respectively, as compared to the scrambled siRNA-treated cells. These data suggest that myoferlin plays a role in regulating tie-2 expression in BAECs.             46  Figure 1. A               Myoferlin gene-silencing using 15nM myoferlin siRNA causes downregulation of tie-2 receptor. BAECs were seeded one day prior to transfection and treated with either 15nM non-silencing (NS) or myoferlin (Myof) siRNA for 24, 48, and 72hr.  Proteins were isolated and blotted against myoferlin, tie- 2, and HSP90 (loading control).  Representative Western blot showm.  Bottom graph shows % myoferlin and tie-2 expressions using densitometry.  Numbers expressed as mean ± SEM (n=3).            Myoferlin Tie-2 HSP90  NS        Myof        NS        Myof       NS        Myof 24hr 48hr 72hr  47  B                               Myoferlin gene-silencing using 75nM myoferlin siRNA causes downregulation of tie-2 receptor. BAECs were seeded one day prior to transfection and treated with either 75nM non-silencing (NS) or myoferlin (Myof) siRNA for 24, 48, and 72hr.  Proteins were isolated and blotted against myoferlin, tie- 2, and HSP90 (loading control).  Representative Western blot shown.  Bottom graph shows % myoferlin and tie-2 expressions using densitometry.  Numbers expressed as mean ± SEM (n=3).       Myoferlin Tie-2 HSP90       NS        Myof        NS        Myof       NS         Myof 24hr 48hr 72hr 48  4.2. Myoferlin disruption by gene-silencing in BAECs did not affect transcriptional levels of tie-2 Transcriptional levels of tie-2 were determined by qPCR, where GAPDH was used as a housekeeping gene.  Standards were also included in the qPCR run to determine efficiencies.  Using the relative quantification method, specifically the Pfaffl method, to determine the amount of tie-2 RNA relative to GAPDH RNA between samples treated by either scrambled or myoferlin siRNA at 15nM or 75nM isolated at three different time points – 24, 48, and 72hr, relative transcriptional levels of tie-2 in scrambled or myoferlin siRNA-treated BAEC samples were not statistically significant.  This result confirms that myoferlin disruption does not alter transcriptional levels of tie-2, and suggests that myoferlin disruption does not affect proteins involved in gene transcription, such as any transcription factors.            49  Figure 2. A        B             C    Myoferlin knock-down has no effect on te-2 mRNA levels.  mRNA from BAEC treated with 15 and 75nM of non-silencing (NS) and myoferlin (Myof) siRNA sequences was isolated at 24hr (A), 48hr (B), and 72hr (C), and qPCR analysis of tie-2 mRNA levels compared to housekeeping gene GAPDH mRNA levels was formed.  Numbers expressed as mean ± SEM (n=3).            50  4.3. Decreased tie-2 expression following myoferlin disruption was not cbl-dependent Because tie-2 expression decreased following myoferlin disruption, the mechanisms were further investigated by first examining the possibility of cbl involvement.  Cbl is an E3 ubiquitin ligase, which is part of the proteasomal degradation pathway.  Using the dominant-negative form of cbl in an adenoviral delivery into siRNA-treated BAECs, myoferlin and tie-2 expressions were again analyzed by Western blotting after 72hr treatment.  Figure 3 demonstrates expressions of myoferlin, tie-2, HA- tagged-AdCbl(-/-), and HSP90 after treatment of 75nM scrambled and myoferlin siRNA, while co-infected with AdCbl(-/-).  The graph quantifies %tie-2 expression in each condition, and shows that in control settings (lanes 1 and 2), tie-2 expression was decreased 47% when comparing myoferlin siRNA-treated cells to scrambled siRNA- treated cells.  However, in cells co-infected with AdCbl(-/-) of MOI = 15 and MOI = 30, %tie-2 expression was also decreased by 40% and 45%, respectively, when comparing the myoferlin siRNA-treated cells to scrambled siRNA-treated cells.  This data suggests that cbl may not be the E3 ubiquitin ligase responsible for the degradation of tie-2 following myoferlin disruption.       51  Figure 3.                     Downregulation of tie-2 following myoferlin disruption is not cbl-dependent.  BAECs were treated with 75nM non-silencing (NS) and myoferlin (Myof) siRNA for 72hr, and co-infected with AdCbl(-/-) at MOI = 15 (lanes 3 and 4) and MOI = 30 (lanes 5 an 6).  Proteins were isolated and blotted against myoferlin, tie-2, hemagglutinin (HA), and HSP90 (loading control).  Graph shows %tie-2 in each condition using densitometry.      1       2      3       4       5        6 NS   Myof   NS   Myof   NS   Myof Myoferlin Tie-2 HA-Cbl(-/-) HSP90 %  T ie -2  E xp re ss io n 0 20 40 60 80 100 AdCbl(-/-) MOI = 15 AdCbl(-/-) MOI = 30 52  4.4. Decreased tie-2 expression following myoferlin disruption was not due to proteasomal degradation With the knowledge that tie-2 expression decreased following myoferlin disruption, and that cbl may not be involved in the degradation pathway of tie2, the mechanisms were further investigated.   Scrambled and myoferlin siRNA-treated BAECs were subjected to Mg-132 treatment 2 hours before cell isolation.  As described earlier, Mg- 132 is a proteasome inhibitor that reduces the amount of degradation of ubiquitin- conjugated proteins.  Figure 4 shows the Western blot of myoferlin, tie-2, and βCOP as a loading control.  In control setting, where DMSO was added 2 hours before cell isolation, tie-2 expression was decreased by 30%, when comparing scrambled siRNA- to myoferlin siRNA-treated cells.  In Mg-132 treated cells, tie-2 expression was also decreased by a similar 35% when comparing scrambled siRNA- to myoferlin siRNA- treated cells.  Furthermore, this data supports the idea that the downregulation of tie-2 was not dependent on the ubiquitination degradation pathway.                   53  Figure 4.                             Downregulation of tie-2 following myoferlin disruption is not due to proteasomal degradation. BAECs were treated with either 75nM non-silencing (NS) and myoferlin (Myof) siRNA for 72hr, and treated with DMSO (control) and 10uM Mg-132.  Proteins were isolated and blotted against myoferlin, tie-2 and βCOP (loading control).  Addition of proteasome inhibitor Mg-132 (2hr pretreatment) did not have an effect on %tie-2 expression, as compared to control (DMSO).       %  T ie -2  E xp re ss io n 0 20 40 60 80 100   NS        Myof        NS        Myof DMSO 10uM Mg-132 75nM Myoferlin Tie-2 βCOP 54  4.5. Myoferlin and tie-2 are localized in caveolae/lipid rafts By using the sucrose gradient fractionation method, proteins in BAEC lysates were separated based on their density, which in turn is dependent on the amount of cholesterol content.  Therefore, proteins that reside in caveolae/lipid rafts, which are in lighter or lower density fractions, were separated from bulk cytosolic proteins, which are in heavier or higher density fractions.  As controls, HSP90 and caveolin-1 were used as HSP90 is a cytosolic protein and caveolin-1 is a protein enriched in caveolae. Presence of myoferlin was detected in both caveolae/lipid raft fractions, as well as cytosolic fractions, but to a lesser extent.  Similarly, tie-2 was also detected in both caveolae/lipid raft fractions, as well as cytosolic fractions.  This data suggests that myoferlin and tie-2 may co-associate to form a large signaling complex in caveolae/lipid rafts, since these organelles are well known to cluster signaling complexes.                     55  Figure 5.                          Myoferlin and tie-2 are co-localized in caveolae/lipid rafts.  Enrichment of myoferlin and tie-2 in caveolae/lipid rafts from native BAEC.  Equal volumes of cell samples were loaded from each fraction, and proteins were blotted for myoferlin, tie-2, caveolin-1 (Cav-1), and HSP90.  Fractions 2 to 4 represent proteins in caveolae/lipid rafts, or light fraction membranes, while fractions 9 to 12 represent bulk cytosolic proteins, or heavy fraction membranes.             HSP90 Cav-1 Myoferlin Tie-2   1       2       3      4      5      6      7     8      9     10   11   12    lysate Caveolae/ Lipid rafts Bulk cytosolic proteins Sucrose Gradient (5-45%) 56  4.6. Myoferlin is expressed in LLCs and myoferlin disruption in LLCs led to decreased cell proliferation By Western blot analysis, as shown in the inset in Figure 7, myoferlin is expressed in LLCs and disruption of the protein by gene-silencing showed decreased expression of myoferlin in a dose-dependent manner.  Proliferation in LLC treated with scrambled or myoferlin siRNA at 15nM or 75nM was examined after 48 and 72hr.  In comparison to their counterparts treated with scrambled siRNA, cells treated with either 15 or 75nM of myoferlin siRNA showed decreased number of cells after both time points, and cell numbers between the 75nM scrambled and myoferlin siRNA treatments were statistically significant at 72hr (p<0.01), also observed in pictures of treated LLCs under the light microscope in Figure 6.  This data not only suggests that myoferlin is present in LLCs, which has never been shown before, disruption of this protein could also lead to decreased cell proliferation, an important feature of any cancer cell type.  Moreover, by using the Trypan blue exclusion assay, shown in Figure A12 in the Appendices, LLCs from each treatment at either time point were at least 95% viable, suggesting that the decrease in cell proliferation was not due to cell death, such as apoptosis.             57  Figure 6.                 48hr          72hr  Pictures of LLCs under the light microscope.  LLCs were treated by non-silencing (NS) or myoferlin (Myof) siRNA at 15 or 75nM for either 48 or 72hr.                           58  Figure 7.    Myoferlin is expressed in LLCs and myoferlin disruption causes decreased cell proliferation. LLCs were transfected with 15nM and 75nM of either non-silencing (NS) or myoferlin (Myof) siRNA and proliferation assay was performed using a haemocytometer.  Inset shows western blot for myoferlin and HSP90 (loading control) for 15 and 75nM siRNA-treated LLCs at 72hr. * Two-way Anova test followed by Bonferroni test, p<0.01, numbers expressed as mean ± SEM, n=4.           15  75  15  75 nM Myoferlin HSP90 NS  Myof  * 59  4.7. Summary of results The major finding of this work is the identification of a novel role of membrane protein myoferlin, which was first identified in ECs in 2007 [3].  Besides serving as a regulator of VEGFR-2 expression [3], myoferlin also regulates levels of tie-2 expression in ECs in vitro.  However, the loss of tie-2 following myoferlin disruption by siRNA gene-silencing was not due to cbl-mediated ubiquitination, nor proteasomal degradation.  In addition, myoferlin disruption only caused decrease in tie-2 levels at the protein level, and not at the transcriptional level, as shown in results from qPCR. Using the sucrose gradient fractionation technique, myoferlin and tie-2 expressions were found in caveolae/lipid rafts, which are known for the clustering of signaling complexes.  This result infers that myoferlin and tie-2 may be co-associated in caveolae/lipid rafts, forming a large signaling complex.  Using an in vitro cancer model, or LLC, myoferlin was identified and disruption of myoferlin by gene- silencing led to decrease in cell proliferation, which suggests a novel role of myoferlin in cancer growth.             60                      - CHAPTER 5 - Discussion                     61  Based on the major finding in this work on myoferlin-dependent regulation of angiogenic receptor tie-2, this chapter of the thesis will discuss a number of topics ranging from theories behind some of the methods and materials used, their advantages and disadvantages, to data analysis of results, recent relevant studies in the literature, and potential future studies.  5.1. Myoferlin regulates both VEGFR-2 and tie-2 protein expressions, but not their gene expressions The major finding in this work was that myoferlin disruption by gene-silencing caused downregulation of tie-2 receptor in ECs in vitro.  In comparison to the work by Bernatchez et al. in 2007, where disruption of myoferlin by siRNA treatment caused a more drastic 76 to 84% reduction [3], there was merely up to about 45% in tie-2 downregulation in this work.  Despite the difference in the reduction of expression following myoferlin disruption between VEGFR-2 and tie-2, the current data is the second piece of evidence that shows a novel role of myoferlin in ECs, which represent a cell type different than cardiac muscle cells and skeletal muscle cells, where myoferlin was originally identified [1].  In line with literature, myoferlin does not play a role in regulating transcriptional levels of proteins.  In comparison to work by Bernatchez et al., in which myoferlin did not affect levels of VEGFR-2 mRNA [3], the current work also shows that myoferlin disruption by gene-silencing does not affect levels of tie-2 mRNA.  Meanwhile, myoferlin disruption causes a decrease in tie-2 protein expression, as analyzed by 62  Western blotting.  As mentioned, myoferlin is a member of the ferlin membrane proteins, and share many similarities with another ferlin member, dysferlin.  Much more is known about dysferlin, owing to its identification in limb girdle muscular dystrophy (LGMD) type 2B and MM phenotypes more than a decade ago [112,113]. Besides being nearly identical in size as dysferlin, myoferlin is also a type II transmembrane protein that anchors itself by its C-terminal and has a large cytoplasmic domain that consists of six C2 domains [1].  These conserved C2 domains are Ca+2-sensing and are typically found in proteins involved in signal transduction or membrane trafficking.  In addition, C2 domains are known to interact with other proteins either dependent or independent of Ca+2 interaction [114-117].  Unlike dysferlin, myoferlin contains an SH3 domain that may allow interactions with other proteins [1].  Consistent with this, myoferlin was found to complex with VEGFR-2 via its SH3 domain [3].  The current work has not yet explored the possibility of binding between myoferlin and tie-2.  The compelling evidence from the work by Bernatchez et al., which focuses on the role of myoferlin in receptor-mediated endocytosis, may hold the key to the underlying mechanism of myoferlin-dependent regulation on tie-2 receptor.  In this study, a molecular complex consisting of myoferlin, caveolin-1, and dynamin was identified as a molecular bandage for membrane repair and cellular membrane integrity maintenance [2].  Caveolin-1, as already mentioned, is a structural component of caveoli and is heavily enriched in these small organelles.  Caveoli, in turn, are involved in coordinating a number of membranous events, such as 63  endocytosis [118].  Endocytosis is the internalization of plasma membrane components, such as associated ligands, and is a basic process in cells as it governs events from the uptake of nutrients to the regulation of internal signaling [119]. Endocytosis may be classified based on involvement of clathrin-coated pits.  Thus, the main endocytotic pathways are either clathrin-dependent or clathrin-independent [120].  Much more has been characterized for the clathrin-dependent endocytotic pathway [121], which heavily involves the 100kD GTPase dynamin, and it is believed that dynamin is directly involved in scission of endocytic vesicles from the membrane [122-124].  The finding that dynamin forms a molecular complex with myoferlin and caveolin-1 [2] suggests that dynamin could potentially play a role in the downregulation of tie-2 following myoferlin disruption.  5.2. Context-dependent tie-angiopoietin regulators of angiogenesis in the vasculature As previously described, the tie-2/angiopoietin system has been described as context- dependent [125].  Under stable conditions, such as vascular quiescence, angiopoietin-1 binds to tie-2 to promote a stabilization effect.  On the contrary, angiopoietin-2 expression is upregulated at sites of vascular remodeling to promote vessel growth.  In fact, formation of blood vessels is a complex process that requires coordination of multiple angiogenic factors and receptors, as well as their signaling pathways. Increasing evidence show that VEGFs and angiopoietins complement each other in settings of angiogenesis to act synergistically [60,126-129], while angiopoetin-1 binding may counteract effects of VEGF [126,130].  Therefore, the net effect through 64  tie-2 signaling is not merely the result of angiopoietin binding, but the coordination of other growth factors and signaling pathways.  A study in 2008 by Saharinen et al. has shed light on the mechanism by which a single tyrosine kinase receptor tie-2 may transduce distinct signals under different circumstances.  It was shown that angiopoietin-1 assembles unique complexes with tie-2 in mobile and confluent ECs [131].  Confluent cultures of ECs that mimic the quiescent endothelium have shown even distribution of tie-2 expression on the cell surface.  However, when stimulated by angiopoietin-1, tie-2 receptors were detected at sites of cell-cell contacts.  On the other hand, sparsely plated ECs that mimic the angiogenic endothelium displayed polarized tie-2 expression at free cell margin in the cell rear when stimulated with angiopoietin-1.  Moreover, different downstream signaling pathways in different subcellular domains were observed, most likely due to the formation of distinct angiopoetin-1-tie-2 signaling complexes in confluent versus subconfluent ECs.  In the current work, BAECs subjected to gene-silencing by siRNA to achieve myoferlin knock-down were grown to about 80% confluency before transfection to mimic the angiogenic endothelium.  Also, basal levels of tie-2 expression were examined following myoferlin disruption.  That is, BAECs were not subjected to any stimulation by any growth factors, such as VEGF or angiopoietins.  The current study specifically aims at investigating myoferlin’s role in regulating unstimulated tie-2 expressions in an angiogenic in vitro model.  Having mentioned that, it would be 65  extremely interesting to look at myoferlin’s regulation on tie-2 expression in stimulated ECs, as compared to unstimulated ECs.  5.3. qPCR for gene expression analysis Although both Northern blot analysis and qPCR are often used for quantitative detection of gene expressions, qPCR remains one of the most sensitive methods to measure gene expressions in multiple samples, and was used in the current work. qPCR requires the standard technique of conventional PCR, which uses a small amount of RNA sample, but also permits the quantitative comparison between a gene of interest relative to a housekeeping gene.  On the other hand, Northern blot is time- consuming and requires a much greater amount of starting RNA material and is not sensitive for detection of low abundance mRNA, and often requires radioactivity. Since the detection of the CT is in the amplification of the PCR, which is an exponential process, even the smallest differences in the starting material will be reflected in the CT values.  The requirements to obtain quantitative results is the co- amplification of a reliable internal control, which should show minimal changes across different treatments, analysis of the reaction within the linear range of amplification, as well as a 90 to 110% efficiency in both the gene of interesting and internal control.  5.3.1. qPCR analysis – comparing different methods of calculations As briefly described in the Methods and Materials section, the analysis methods for real-time qPCR can be typically classified into absolute and relative quantification. Absolute quantification is generally used when the quantity of nucleic acid per a given 66  amount of sample is required.  Usually, the intrinsic property of a sample is derived, which does not depend on properties of other samples.  Otherwise, when the relative amount of a target nucleic acid among samples is required for analysis, the relative quantification method would be used.  For the current thesis, the relative quantification method was used, specifically the Pfaffl method.  There are three calculation methods used in relative quantification – 1) the Livak method, or the 2-ΔΔCT method, 2) the ΔCT method using a reference gene, and 3) the Pfaffl method.  Each method should provide equivalent results in theory, but each has its own advantages and disadvantages.  The Livak method is easy to perform, thus it is widely used.  However, this method assumes that both the target and reference genes are amplified with similar efficiencies that are close to 100%.  The ΔCT method using a reference gene is a variation of the Livak method, and uses the difference between reference and target CT values for each individual sample.  Finally, the Pfaffl method, which was used in this work, is a modified version of the Livak method, but allows for different amplification efficiencies between target and reference genes, which was the case for the qPCR results in this work, and therefore, this method was used.  5.3.2. Using SYBR Green I vs. TaqMan probe in qPCR detection The transcriptional levels of tie-2 and GAPDH in this work were analyzed by qPCR using the SYBR Green I detection method.  As mentioned, there are two most common ways to perform transcriptional analysis and both systems employ 67  fluorescent technologies.  On one hand is the SYBR Green I method, and on the other hand is the TaqMan probe method.  SYBR Green I dye intercalates with any double-stranded DNA and fluoresces upon binding.  This method requires generation of specific forward and reverse primers for genes of interest.  It is also a low-cost assay and requires easy design and set up. However, its main disadvantage is its non-specificity, since the SYBR Green I dye binds to any amplified double-stranded DNA, which also includes primer dimers. Fortunately, a possible way to check for specificity is to run a dissociation curve at the end of the qPCR run.  TaqMan probes are synonymous to Double-Dye probes, and were first developed by Roche and ABI.  Using the TaqMan detection method, specific pairs of primers must also be used in addition to the probes.  These probes consist of a single-stranded probe sequence complementary to one of the strands of the amplicon.  A fluorophore is attached at the 5’ end of the TaqMan probe and a quencher is attached at the 3’ end. The probe first binds to the amplicon during the annealing steps of the qPCR and the 5’ end is displaced when the Taq polymerase extends from the 3’ end of the primer. When the 5’ end of the probe is cleaved, it releases the fluorophore and it passes its energy via Fluorescence Resonance Energy Transfer (FRET) to the quencher.  A main advantage of TaqMan is its specificity to the gene of interest, however, this detection method is usually more expensive than the SYBR Green I method.  68  5.4. Other possible mechanisms and ubiquitin ligases involved in tie-2 downregulation following myoferlin disruption Although only the cbl ubiquitin ligase was studied in this work, there are other possible candidates that could play a role in myoferlin regulation of tie-2 receptor. The cbl E3 ligase is only one of thousands of known players in ubiquitination and protein degradation.  In fact, activated receptor tyrosine kinases may be internalized by clathrin-dependent pathways, as well as clathrin-independent pathways [132]. Meanwhile, there is also caveolae-mediated internalization of activated receptor tyrosine kinases, in which caveolae plays a major role as endocytic carriers [132-134]. In each of these pathways, a number of different interacting proteins or adaptor proteins are involved depending on the ligand that activates the receptor, the localization of the receptor, presence of other interacting proteins, and many more factors, which are beyond the scope of this thesis.  For instance, the well-studied epidermal growth factor receptor (EGFR) recruits the Growth Factor receptor-binding protein 2 (Grb2), which would in turn mediate the binding of c-cbl [135,136], leading to recruitment of cbl-interacting protein of 85k (CIN85), disabled2 protein (DAB2), and endophilin [137,138], which would then initiate the clathrin assembly and budding.  A unique example of a receptor tyrosine kinase that is internalized by the caveolae-dependent pathway is VEGFR-2 [107,132,139,140].  Internalization of VEGFR-2 may involve Arf6, a protein that is known to coordinate actin remodeling and promote plasma membrane recycling [141].  However, different groups have disagreeing observations regarding VEGFR-2 downregulation, with two different groups finding ubiquitination of VEGFR-2 by c-cbl [142,143], and another group 69  finding internalization of VEGFR-2 by protein kinase C (PKC)-regulated pathways, and not by c-cbl [144].  Added to the levels of complexity involving clathrin-dependent and –independent internalization of receptor tyrosine kinases, the ubiquitination pathway itself is a diverse signaling mechanism involving a number of different protein-protein interactions.  As explained in an earlier section, ubiquitination involves sequential interactions among E1, E2, and E3 enzymes.  Moreover, many proteins that are involved in this ubiquitination pathway remain to be discovered, despite the fact that the principles of ubiquitination pathway events have been well studied.  For instance, there are more than 30 different E2s and hundreds of E3s in the human genome [145], all of which could possibly be functional in the downregulation of tie-2 following myoferlin disruption.  5.5. Lipid rafts as platforms for tie-2 signaling In the current study, both myoferlin and tie-2 expressions were detected in caveolae/lipid rafts.  As discussed in the introduction section, a recent study by Katoh et al. has shown that lipid rafts may serve as signaling platforms and that angiopoietin 1-tie-2 could mediate different biological outcomes under influence of lipid rafts [47]. In Katoh’s study, the cell model used was human umbilical vein ECs, or HUVECs, which were different from the cell line used in the current work, BAECs. Nonetheless, this study provides supporting data that is in line with the results in this work, that is, tie-2 may be translocated to caveolae/lipid rafts for proper intracellular 70  signaling.  Moreover, tie-2 may also directly, or indirectly, interact with myoferlin to form a large signaling complex.  5.5.1. Determining co-association of myoferlin and tie-2 as the next step Using sucrose gradient fractionation in this work, expressions of both myoferlin and tie-2 were present in caveolae/lipid rafts.  To further study whether there exists a direct interaction between the two proteins, one of the most straightforward and common methods is to employ Glutathione S-Transferase (GST) beads to create a GST gene fusion system for pull-down assays.  Either the myoferlin or tie-2 gene sequence may be incorporated alongside with GST in an expression vector to produce either GST- myoferlin or GST-tie-2.  This method offers a biological assay to determine direct protein-protein interaction.  If there is indeed a direct protein-protein interaction between myoferlin and tie-2, it could further deepen our understanding on the mechanism by which myoferlin may regulate tie-2 expressions in ECs.  For instance, one could then study the exact domain at which these two proteins interact.  5.6. Separating caveolae/lipid rafts from bulk cytosolic proteins Separation of caveolae/lipid rafts away from bulk cytosolic proteins was possible because of the characteristics of lipid rafts - low density and insolubility in detergent, that are different from bulk cytosolic proteins.  Hence, traditional isolation with detergent uses 1% Triton X-100 to extract cells, followed by centrifugation in a linear 5 – 30% sucrose gradient [81].  In this setting, lipid rafts are distributed in the low- 71  density part of the linear gradient after centrifugation.  However, using a detergent may cause disruption of the proteins that are associated with caveolae/lipid rafts.  One example of such protein is the heterotrimeric Gβ, which is typically associated with caveolae, but after detergent treatment, the association is abolished [146]. Hence, another method using a non-detergent buffer to isolate cells was later developed by Smart et al.  In fact, it was found that caveolae has a unique buoyant density that allows their separation from non-lipid rafts due to their high lipid-to-protein ratio [146].  This detergent-free method allows for purifying caveolae/lipid rafts, yet resident proteins remain intact after the separation, much different from the method that employs detergent.  Another advantage of the detergent-free method over the traditional detergent method is that it may prevent membrane fusion that could generate mixed raft domains, which are not present in intact cells [147].  Therefore, for the purpose of this work, detergent-free buffer was used to separate caveolae/lipid rafts from bulk cytosolic proteins so that resident protein expressions could be detected by Western blot.  5.7. Myoferlin and cancer: Expansion for ferlin expression in new systems Until now, myoferlin has never been explored in cancer cells.  In fact, the current data showing the presence of myoferlin is the first piece of evidence to show that myoferlin, although initially found in cardiac muscle and skeletal cells [1], and only recently found in ECs [3], may also be present in an in vitro tumour model.  The current results suggest that not only is myoferlin involved in regulating events at the 72  vascular level, it may potentially play a role in tumour cell proliferation.  Intuitively and as a matter of fact, signaling is integral in tumour cell growth and at the heart of signaling, endocytosis has been regarded as one of the main pathways for its regulation, recycling and attenuation.  Moreover, many receptors such as epidermal growth factor receptor (EGFR) and transforming growth factor-β receptor are targeted to endocytosis, either for recycling back to the plasma membrane or degradation [148,149].  As reviewed by Lanzetti et al., endocytosis is a potential oncogenic pathway and could play a role in tumour progression and cell cycle control, making it an extremely relevant subject to cancer [150].  The process of endocytosis, as already described, has been found to involve myoferlin [2].  Hence, it is particularly interesting to find that myoferlin disruption using a gene-silencing approach led to a decrease in LLC cell proliferation in vitro, suggesting that the role of myoferlin in endocytosis, as well as plasma membrane resealing and integrity maintenance, may be integral in cancer cell growth.  5.8. Summary of discussion This discussion section touched on the relevance of the current results in terms of what is documented in literature about myoferlin, as well as the possibility of its novel role in cancer cells, the possible mechanisms that could be involved in the downregulation of tie-2 following myoferlin gene-silencing, and possible future studies including binding assays of tie-2 and myoferlin.  In the technical aspects, some advantages and disadvantages of the methods that were used in the study and explanations of why certain methods were used were also discussed. 73             - CHAPTER 6 - Conclusion and Significance                 74  It is widely accepted that heart diseases such as ischemia and cancer are leading causes of death worldwide.  In both cases, the growth of blood vessels, or angiogenesis, is a major determinant or rate-limiting step that regulates the severity of the diseases. Convincing evidence coming from both in vitro and in vivo studies have shown that the endothelium of the blood vessel, which is the inner-most layer of the vessel wall, plays a major role in angiogenesis.  During angiogenesis, angiogenic growth factors such as VEGF and angiopoietins from a signal source, such as a growing tumour in the hypoxic state, stimulate EC proliferation and sprouting.  Expressions of their main respective receptors, VEGFR-2 and tie-2, have also been found in ECs and that their expressions also regulate angiogenesis.  Angiogenic growth factors and their receptors are tightly regulated during homeostasis and are involved in the maintenance of the vasculature.  In the diseased state, however, there is an imbalance between these pro- and anti-angiogenic factors, which ultimately leads to pathological angiogenesis.  Since its original identification in cardiac muscle cells and skeletal muscle cells, the membrane-bound protein myoferlin has been shown in a number of manuscripts to mainly regulate membrane repair and maintenance.  Nonetheless, there is emerging evidence that myoferlin is also present in ECs and may be involved in membrane trafficking of cargo proteins, which is likely to include both VEGFR-2 and tie-2 receptors.  Herein, the current work revealed that myoferlin not only regulates VEGFR-2 levels in ECs, but also tie-2 levels.  Despite decreased tie-2 protein expression following myoferlin disruption, tie-2 mRNA levels remain unchanged, further suggesting that myoferlin regulates post-transcriptional levels of tie-2.  While 75  VEGFR-2 downregulation following myoferlin disruption was due to a cbl-dependent proteasomal degradation pathway, tie-2 downregulation was found to be independent of the proteasomal degradation pathway, and was also independent of cbl ubiquitin ligase.  Thus, further investigations on the mechanisms by which myoferlin regulates tie-2 expression in ECs are required.  Additionally, for the first time, myoferlin was also detected in LLCs, and that its disruption by gene-silencing led to decreased cell proliferation, suggesting a novel role of myoferlin in cancer cells in vitro.  Since VEGFR-2 and tie-2 expressions are almost exclusively found in ECs, the current work initiates the characterization of EC-specific targets that could be exploited to modulate angiogenic responses in vivo.  As the topic of angiogenesis is implicated in many different clinical settings, including peripheral and coronary vascular diseases, tumour growth, hematology, wound healing, ophthalmology, dermatology, among many others, further dissecting its mechanisms will enable us to modulate blood vessel growth as a part of therapies that target these diseases. 76  REFERENCES 1 Davis, D.B., Delmonte, A.J., Ly, C.T., & McNally, E.M., myoferlin, a candidate gene and potential modifier of muscular dystrophy. Hum Mol Genet 9 (2), 217-226 (2000). 2 Bernatchez, P.N., Sharma, A., Kodaman, P., & Sessa, W.C., myoferlin is critical for endocytosis in endothelial cells. Am J Physiol Cell Physiol 297 (3), C484-492 (2009). 3 Bernatchez, P.N. et al., myoferlin regulates vascular endothelial growth factor receptor-2 stability and function. J Biol Chem 282 (42), 30745-30753 (2007). 4 Monzon, F.A. & Dumur, C.I., Diagnosis of uncertain primary tumors with the Pathwork tissue-of-origin test. Expert Rev Mol Diagn 10 (1), 17-25. 5 O'Neil, N. & Rose, A., DNA repair. WormBook, 1-12 (2006). 6 Weber, G., Biochemical strategy of cancer cells and the design of chemotherapy: G. H. A. Clowes Memorial Lecture. Cancer Res 43 (8), 3466- 3492 (1983). 7 Wells, A., Kassis, J., Solava, J., Turner, T., & Lauffenburger, D.A., Growth factor-induced cell motility in tumor invasion. Acta Oncol 41 (2), 124-130 (2002). 8 Carmeliet, P., Mechanisms of angiogenesis and arteriogenesis. Nat Med 6 (4), 389-395 (2000). 9 Carmeliet, P., Angiogenesis in life, disease and medicine. Nature 438 (7070), 932-936 (2005). 10 Bergers, G. & Benjamin, L.E., Tumorigenesis and the angiogenic switch. Nat Rev Cancer 3 (6), 401-410 (2003). 11 Hanahan, D. & Weinberg, R.A., The hallmarks of cancer. Cell 100 (1), 57-70 (2000). 12 Yancopoulos, G.D. et al., Vascular-specific growth factors and blood vessel formation. Nature 407 (6801), 242-248 (2000). 13 Folkman, J., Tumor angiogenesis: therapeutic implications. N Engl J Med 285 (21), 1182-1186 (1971). 14 Moulton, K.S. et al., Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis. Proc Natl Acad Sci U S A 100 (8), 4736-4741 (2003). 77  15 Rafii, S., Heissig, B., & Hattori, K., Efficient mobilization and recruitment of marrow-derived endothelial and hematopoietic stem cells by adenoviral vectors expressing angiogenic factors. Gene Ther 9 (10), 631-641 (2002). 16 Sun, L., Bai, Y., & Du, G., Endothelial dysfunction--an obstacle of therapeutic angiogenesis. Ageing Res Rev 8 (4), 306-313 (2009). 17 Pandya, N.M., Dhalla, N.S., & Santani, D.D., Angiogenesis--a new target for future therapy. Vascul Pharmacol 44 (5), 265-274 (2006). 18 Senger, D.R. et al., Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 219 (4587), 983-985 (1983). 19 Ferrara, N. & Henzel, W.J., Pituitary follicular cells secrete a novel heparin- binding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161 (2), 851-858 (1989). 20 Winder, T. & Lenz, H.J., Vascular endothelial growth factor and epidermal growth factor signaling pathways as therapeutic targets for colorectal cancer. Gastroenterology 138 (6), 2163-2176. 21 Terman, B.I. et al., Identification of a new endothelial cell growth factor receptor tyrosine kinase. Oncogene 6 (9), 1677-1683 (1991). 22 Shibuya, M. et al., Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. Oncogene 5 (4), 519-524 (1990). 23 Feng, Y., Venema, V.J., Venema, R.C., Tsai, N., & Caldwell, R.B., VEGF induces nuclear translocation of Flk-1/KDR, endothelial nitric oxide synthase, and caveolin-1 in vascular endothelial cells. Biochem Biophys Res Commun 256 (1), 192-197 (1999). 24 Feng, Y. et al., VEGF-induced permeability increase is mediated by caveolae. Invest Ophthalmol Vis Sci 40 (1), 157-167 (1999). 25 Gerber, H.P., Dixit, V., & Ferrara, N., Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bcl-2 and A1 in vascular endothelial cells. J Biol Chem 273 (21), 13313-13316 (1998). 26 Gerber, H.P. et al., Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem 273 (46), 30336-30343 (1998). 27 Yuan, F. et al., Time-dependent vascular regression and permeability changes in established human tumor xenografts induced by an anti-vascular endothelial 78  growth factor/vascular permeability factor antibody. Proc Natl Acad Sci U S A 93 (25), 14765-14770 (1996). 28 Dvorak, H.F., Brown, L.F., Detmar, M., & Dvorak, A.M., Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am J Pathol 146 (5), 1029-1039 (1995). 29 Ku, D.D., Zaleski, J.K., Liu, S., & Brock, T.A., Vascular endothelial growth factor induces EDRF-dependent relaxation in coronary arteries. Am J Physiol 265 (2 Pt 2), H586-592 (1993). 30 Ferrara, N., Gerber, H.P., & LeCouter, J., The biology of VEGF and its receptors. Nat Med 9 (6), 669-676 (2003). 31 Grothey, A. & Galanis, E., Targeting angiogenesis: progress with anti-VEGF treatment with large molecules. Nat Rev Clin Oncol 6 (9), 507-518 (2009). 32 Guo, D., Jia, Q., Song, H.Y., Warren, R.S., & Donner, D.B., Vascular endothelial cell growth factor promotes tyrosine phosphorylation of mediators of signal transduction that contain SH2 domains. Association with endothelial cell proliferation. J Biol Chem 270 (12), 6729-6733 (1995). 33 Eliceiri, B.P. et al., Selective requirement for Src kinases during VEGF- induced angiogenesis and vascular permeability. Mol Cell 4 (6), 915-924 (1999). 34 Takahashi, T., Ueno, H., & Shibuya, M., VEGF activates protein kinase C- dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene 18 (13), 2221-2230 (1999). 35 Davis, S. et al., Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 87 (7), 1161-1169 (1996). 36 Partanen, J. et al., A novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains. Mol Cell Biol 12 (4), 1698-1707 (1992). 37 Dumont, D.J., Yamaguchi, T.P., Conlon, R.A., Rossant, J., & Breitman, M.L., tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene 7 (8), 1471- 1480 (1992). 38 Loughna, S. & Sato, T.N., A combinatorial role of angiopoietin-1 and orphan receptor TIE1 pathways in establishing vascular polarity during angiogenesis. Mol Cell 7 (1), 233-239 (2001). 39 Sato, T.N. et al., Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376 (6535), 70-74 (1995). 79  40 Patan, S., TIE1 and TIE2 receptor tyrosine kinases inversely regulate embryonic angiogenesis by the mechanism of intussusceptive microvascular growth. Microvasc Res 56 (1), 1-21 (1998). 41 Suri, C. et al., Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87 (7), 1171-1180 (1996). 42 Suri, C. et al., Increased vascularization in mice overexpressing angiopoietin-1. Science 282 (5388), 468-471 (1998). 43 Augustin, H.G., Koh, G.Y., Thurston, G., & Alitalo, K., Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat Rev Mol Cell Biol 10 (3), 165-177 (2009). 44 Fiedler, U. et al., Angiopoietin-1 and angiopoietin-2 share the same binding domains in the Tie-2 receptor involving the first Ig-like loop and the epidermal growth factor-like repeats. J Biol Chem 278 (3), 1721-1727 (2003). 45 Macdonald, P.R. et al., Structure of the extracellular domain of Tie receptor tyrosine kinases and localization of the angiopoietin-binding epitope. J Biol Chem 281 (38), 28408-28414 (2006). 46 Barton, W.A. et al., Crystal structures of the Tie2 receptor ectodomain and the angiopoietin-2-Tie2 complex. Nat Struct Mol Biol 13 (6), 524-532 (2006). 47 Katoh, S.Y., Kamimoto, T., Yamakawa, D., & Takakura, N., Lipid rafts serve as signaling platforms for Tie2 receptor tyrosine kinase in vascular endothelial cells. Exp Cell Res 315 (16), 2818-2823 (2009). 48 Kopczynska, E. et al., Plasma concentration of angiopoietin-1, angiopoietin-2 and Tie-2 in cervical cancer. Eur J Gynaecol Oncol 30 (6), 646-649 (2009). 49 Caine, G.J. et al., A comparison of plasma versus histologic indices of angiogenic markers in breast cancer. Appl Immunohistochem Mol Morphol 15 (4), 382-388 (2007). 50 Schliemann, C. et al., Circulating angiopoietin-2 is a strong prognostic factor in acute myeloid leukemia. Leukemia 21 (9), 1901-1906 (2007). 51 Caine, G.J., Blann, A.D., Stonelake, P.S., Ryan, P., & Lip, G.Y., Plasma angiopoietin-1, angiopoietin-2 and Tie-2 in breast and prostate cancer: a comparison with VEGF and Flt-1. Eur J Clin Invest 33 (10), 883-890 (2003). 52 Hubbard, S.R., Crystal structure of the activated insulin receptor tyrosine kinase in complex with peptide substrate and ATP analog. EMBO J 16 (18), 5572-5581 (1997). 80  53 Pawson, T., Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 116 (2), 191-203 (2004). 54 Kim, I. et al., Angiopoietin-1 induces endothelial cell sprouting through the activation of focal adhesion kinase and plasmin secretion. Circ Res 86 (9), 952- 959 (2000). 55 Papapetropoulos, A. et al., Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem 275 (13), 9102-9105 (2000). 56 Kontos, C.D., Cha, E.H., York, J.D., & Peters, K.G., The endothelial receptor tyrosine kinase Tie1 activates phosphatidylinositol 3-kinase and Akt to inhibit apoptosis. Mol Cell Biol 22 (6), 1704-1713 (2002). 57 DeBusk, L.M., Hallahan, D.E., & Lin, P.C., Akt is a major angiogenic mediator downstream of the Ang1/Tie2 signaling pathway. Exp Cell Res 298 (1), 167-177 (2004). 58 Graupera, M. et al., Angiogenesis selectively requires the p110alpha isoform of PI3K to control endothelial cell migration. Nature 453 (7195), 662-666 (2008). 59 Kim, I. et al., Hepatic expression, synthesis and secretion of a novel fibrinogen/angiopoietin-related protein that prevents endothelial-cell apoptosis. Biochem J 346 Pt 3, 603-610 (2000). 60 Koblizek, T.I., Weiss, C., Yancopoulos, G.D., Deutsch, U., & Risau, W., Angiopoietin-1 induces sprouting angiogenesis in vitro. Curr Biol 8 (9), 529- 532 (1998). 61 Kanda, S., Miyata, Y., Mochizuki, Y., Matsuyama, T., & Kanetake, H., Angiopoietin 1 is mitogenic for cultured endothelial cells. Cancer Res 65 (15), 6820-6827 (2005). 62 Kim, I. et al., Angiopoietin-1 regulates endothelial cell survival through the phosphatidylinositol 3'-Kinase/Akt signal transduction pathway. Circ Res 86 (1), 24-29 (2000). 63 Kim, K.J. et al., Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362 (6423), 841-844 (1993). 64 Drevs, J. et al., Effects of PTK787/ZK 222584, a specific inhibitor of vascular endothelial growth factor receptor tyrosine kinases, on primary tumor, metastasis, vessel density, and blood flow in a murine renal cell carcinoma model. Cancer Res 60 (17), 4819-4824 (2000). 81  65 Tsai, J.H. & Lee, W.M., Tie2 in tumor endothelial signaling and survival: implications for antiangiogenic therapy. Mol Cancer Res 7 (3), 300-310 (2009). 66 Zwang, Y. & Yarden, Y., Systems biology of growth factor-induced receptor endocytosis. Traffic 10 (4), 349-363 (2009). 67 Sorkin, A. & Goh, L.K., Endocytosis and intracellular trafficking of ErbBs. Exp Cell Res 314 (17), 3093-3106 (2008). 68 Weissman, A.M., Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2 (3), 169-178 (2001). 69 Pickart, C.M., Mechanisms underlying ubiquitination. Annu Rev Biochem 70, 503-533 (2001). 70 Dye, B.T. & Schulman, B.A., Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins. Annu Rev Biophys Biomol Struct 36, 131-150 (2007). 71 Komander, D., The emerging complexity of protein ubiquitination. Biochem Soc Trans 37 (Pt 5), 937-953 (2009). 72 Rao, N., Dodge, I., & Band, H., The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J Leukoc Biol 71 (5), 753-763 (2002). 73 Waterman, H. & Yarden, Y., Molecular mechanisms underlying endocytosis and sorting of ErbB receptor tyrosine kinases. FEBS Lett 490 (3), 142-152 (2001). 74 Allen, J.A., Halverson-Tamboli, R.A., & Rasenick, M.M., Lipid raft microdomains and neurotransmitter signalling. Nat Rev Neurosci 8 (2), 128- 140 (2007). 75 Jacobson, K., Mouritsen, O.G., & Anderson, R.G., Lipid rafts: at a crossroad between cell biology and physics. Nat Cell Biol 9 (1), 7-14 (2007). 76 Parton, R.G. & Simons, K., The multiple faces of caveolae. Nat Rev Mol Cell Biol 8 (3), 185-194 (2007). 77 Patel, H.H., Murray, F., & Insel, P.A., Caveolae as organizers of pharmacologically relevant signal transduction molecules. Annu Rev Pharmacol Toxicol 48, 359-391 (2008). 78 Patel, H.H., Murray, F., & Insel, P.A., G-protein-coupled receptor-signaling components in membrane raft and caveolae microdomains. Handb Exp Pharmacol (186), 167-184 (2008). 82  79 Cho, C.H. et al., Localization of VEGFR-2 and PLD2 in endothelial caveolae is involved in VEGF-induced phosphorylation of MEK and ERK. Am J Physiol Heart Circ Physiol 286 (5), H1881-1888 (2004). 80 Brown, D.A. & London, E., Structure and function of sphingolipid- and cholesterol-rich membrane rafts. J Biol Chem 275 (23), 17221-17224 (2000). 81 Brown, D.A. & Rose, J.K., Sorting of GPI-anchored proteins to glycolipid- enriched membrane subdomains during transport to the apical cell surface. Cell 68 (3), 533-544 (1992). 82 Helms, J.B. & Zurzolo, C., Lipids as targeting signals: lipid rafts and intracellular trafficking. Traffic 5 (4), 247-254 (2004). 83 Simons, K. & Toomre, D., Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 1 (1), 31-39 (2000). 84 Parton, R.G. & Richards, A.A., Lipid rafts and caveolae as portals for endocytosis: new insights and common mechanisms. Traffic 4 (11), 724-738 (2003). 85 Stan, R.V., Structure and function of endothelial caveolae. Microsc Res Tech 57 (5), 350-364 (2002). 86 Yamada, E., The fine structure of the gall bladder epithelium of the mouse. J Biophys Biochem Cytol 1 (5), 445-458 (1955). 87 Palade, G.E., An electron microscope study of the mitochondrial structure. J Histochem Cytochem 1 (4), 188-211 (1953). 88 Drab, M. et al., Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 293 (5539), 2449-2452 (2001). 89 Tahir, S.A., Park, S., & Thompson, T.C., Caveolin-1 regulates VEGF- stimulated angiogenic activities in prostate cancer and endothelial cells. Cancer Biol Ther 8 (23), 2286-2296 (2009). 90 Garcia-Cardena, G., Oh, P., Liu, J., Schnitzer, J.E., & Sessa, W.C., Targeting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications for nitric oxide signaling. Proc Natl Acad Sci U S A 93 (13), 6448-6453 (1996). 91 Shaul, P.W. et al., Acylation targets emdothelial nitric-oxide synthase to plasmalemmal caveolae. J Biol Chem 271 (11), 6518-6522 (1996). 92 Insel, P.A. & Patel, H.H., Membrane rafts and caveolae in cardiovascular signaling. Curr Opin Nephrol Hypertens 18 (1), 50-56 (2009). 83  93 Acevedo, L. et al., A new role for Nogo as a regulator of vascular remodeling. Nat Med 10 (4), 382-388 (2004). 94 McNeil, P.L. & Kirchhausen, T., An emergency response team for membrane repair. Nat Rev Mol Cell Biol 6 (6), 499-505 (2005). 95 Britton, S. et al., The third human FER-1-like protein is highly similar to dysferlin. Genomics 68 (3), 313-321 (2000). 96 Washington, N.L. & Ward, S., FER-1 regulates Ca2+ -mediated membrane fusion during C. elegans spermatogenesis. J Cell Sci 119 (Pt 12), 2552-2562 (2006). 97 Urtizberea, J.A. et al., Dysferlinopathies. Neurol India 56 (3), 289-297 (2008). 98 Yasunaga, S. et al., A mutation in OTOF, encoding otoferlin, a FER-1-like protein, causes DFNB9, a nonsyndromic form of deafness. Nat Genet 21 (4), 363-369 (1999). 99 Roux, I. et al., Otoferlin, defective in a human deafness form, is essential for exocytosis at the auditory ribbon synapse. Cell 127 (2), 277-289 (2006). 100 Doherty, K.R. et al., Normal myoblast fusion requires myoferlin. Development 132 (24), 5565-5575 (2005). 101 Demonbreun, A.R. et al., myoferlin regulation by NFAT in muscle injury, regeneration and repair. J Cell Sci. 102 Haslett, J.N. et al., Gene expression profiling of Duchenne muscular dystrophy skeletal muscle. Neurogenetics 4 (4), 163-171 (2003). 103 Davis, D.B., Doherty, K.R., Delmonte, A.J., & McNally, E.M., Calcium- sensitive phospholipid binding properties of normal and mutant ferlin C2 domains. J Biol Chem 277 (25), 22883-22888 (2002). 104 Demonbreun, A.R. et al., myoferlin is required for insulin-like growth factor response and muscle growth. FASEB J 24 (4), 1284-1295. 105 Eliceiri, B.P., Klemke, R., Stromblad, S., & Cheresh, D.A., Integrin alphavbeta3 requirement for sustained mitogen-activated protein kinase activity during angiogenesis. J Cell Biol 140 (5), 1255-1263 (1998). 106 Meadows, K.N., Bryant, P., & Pumiglia, K., Vascular endothelial growth factor induction of the angiogenic phenotype requires Ras activation. J Biol Chem 276 (52), 49289-49298 (2001). 84  107 Labrecque, L. et al., Regulation of vascular endothelial growth factor receptor- 2 activity by caveolin-1 and plasma membrane cholesterol. Mol Biol Cell 14 (1), 334-347 (2003). 108 Fire, A. et al., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391 (6669), 806-811 (1998). 109 Lopez-Fraga, M., Martinez, T., & Jimenez, A., RNA interference technologies and therapeutics: from basic research to products. BioDrugs 23 (5), 305-332 (2009). 110 Elbashir, S.M., Lendeckel, W., & Tuschl, T., RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15 (2), 188-200 (2001). 111 Livak, K.J. & Schmittgen, T.D., Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 (4), 402-408 (2001). 112 Bashir, R. et al., A gene related to Caenorhabditis elegans spermatogenesis factor fer-1 is mutated in limb-girdle muscular dystrophy type 2B. Nat Genet 20 (1), 37-42 (1998). 113 Liu, J. et al., Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy. Nat Genet 20 (1), 31-36 (1998). 114 Li, C. et al., Ca(2+)-dependent and -independent activities of neural and non- neural synaptotagmins. Nature 375 (6532), 594-599 (1995). 115 Zhang, J.Z., Davletov, B.A., Sudhof, T.C., & Anderson, R.G., Synaptotagmin I is a high affinity receptor for clathrin AP-2: implications for membrane recycling. Cell 78 (5), 751-760 (1994). 116 Schiavo, G., Gmachl, M.J., Stenbeck, G., Sollner, T.H., & Rothman, J.E., A possible docking and fusion particle for synaptic transmission. Nature 378 (6558), 733-736 (1995). 117 Sheng, Z.H., Yokoyama, C.T., & Catterall, W.A., Interaction of the synprint site of N-type Ca2+ channels with the C2B domain of synaptotagmin I. Proc Natl Acad Sci U S A 94 (10), 5405-5410 (1997). 118 Henley, J.R., Krueger, E.W., Oswald, B.J., & McNiven, M.A., Dynamin- mediated internalization of caveolae. J Cell Biol 141 (1), 85-99 (1998). 119 Benmerah, A. & Lamaze, C., Clathrin-coated pits: vive la difference? Traffic 8 (8), 970-982 (2007). 120 Hansen, C.G. & Nichols, B.J., Molecular mechanisms of clathrin-independent endocytosis. J Cell Sci 122 (Pt 11), 1713-1721 (2009). 85  121 Schmid, E.M. & McMahon, H.T., Integrating molecular and network biology to decode endocytosis. Nature 448 (7156), 883-888 (2007). 122 Bashkirov, P.V. et al., GTPase cycle of dynamin is coupled to membrane squeeze and release, leading to spontaneous fission. Cell 135 (7), 1276-1286 (2008). 123 Pucadyil, T.J. & Schmid, S.L., Real-time visualization of dynamin-catalyzed membrane fission and vesicle release. Cell 135 (7), 1263-1275 (2008). 124 Roux, A. & Antonny, B., The long and short of membrane fission. Cell 135 (7), 1163-1165 (2008). 125 Eklund, L. & Olsen, B.R., Tie receptors and their angiopoietin ligands are context-dependent regulators of vascular remodeling. Exp Cell Res 312 (5), 630-641 (2006). 126 Thurston, G. et al., Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1. Science 286 (5449), 2511-2514 (1999). 127 Zhu, W.H., MacIntyre, A., & Nicosia, R.F., Regulation of angiogenesis by vascular endothelial growth factor and angiopoietin-1 in the rat aorta model: distinct temporal patterns of intracellular signaling correlate with induction of angiogenic sprouting. Am J Pathol 161 (3), 823-830 (2002). 128 Saito, M., Hamasaki, M., & Shibuya, M., Induction of tube formation by angiopoietin-1 in endothelial cell/fibroblast co-culture is dependent on endogenous VEGF. Cancer Sci 94 (9), 782-790 (2003). 129 Shyu, K.G., Chang, H., & Isner, J.M., Synergistic effect of angiopoietin-1 and vascular endothelial growth factor on neoangiogenesis in hypercholesterolemic rabbit model with acute hindlimb ischemia. Life Sci 73 (5), 563-579 (2003). 130 Thurston, G. et al., Angiopoietin-1 protects the adult vasculature against plasma leakage. Nat Med 6 (4), 460-463 (2000). 131 Saharinen, P. et al., Angiopoietins assemble distinct Tie2 signalling complexes in endothelial cell-cell and cell-matrix contacts. Nat Cell Biol 10 (5), 527-537 (2008). 132 Le Roy, C. & Wrana, J.L., Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling. Nat Rev Mol Cell Biol 6 (2), 112-126 (2005). 133 Minshall, R.D., Sessa, W.C., Stan, R.V., Anderson, R.G., & Malik, A.B., Caveolin regulation of endothelial function. Am J Physiol Lung Cell Mol Physiol 285 (6), L1179-1183 (2003). 86  134 Pelkmans, L., Burli, T., Zerial, M., & Helenius, A., Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell 118 (6), 767-780 (2004). 135 Haglund, K. et al., Multiple monoubiquitination of RTKs is sufficient for their endocytosis and degradation. Nat Cell Biol 5 (5), 461-466 (2003). 136 Huang, F. & Sorkin, A., Growth factor receptor binding protein 2-mediated recruitment of the RING domain of Cbl to the epidermal growth factor receptor is essential and sufficient to support receptor endocytosis. Mol Biol Cell 16 (3), 1268-1281 (2005). 137 Soubeyran, P., Kowanetz, K., Szymkiewicz, I., Langdon, W.Y., & Dikic, I., Cbl-CIN85-endophilin complex mediates ligand-induced downregulation of EGF receptors. Nature 416 (6877), 183-187 (2002). 138 Kowanetz, K., Terzic, J., & Dikic, I., Dab2 links CIN85 with clathrin-mediated receptor internalization. FEBS Lett 554 (1-2), 81-87 (2003). 139 Kapeller, R., Chakrabarti, R., Cantley, L., Fay, F., & Corvera, S., Internalization of activated platelet-derived growth factor receptor- phosphatidylinositol-3' kinase complexes: potential interactions with the microtubule cytoskeleton. Mol Cell Biol 13 (10), 6052-6063 (1993). 140 Sigismund, S. et al., Clathrin-independent endocytosis of ubiquitinated cargos. Proc Natl Acad Sci U S A 102 (8), 2760-2765 (2005). 141 Donaldson, J.G., Multiple roles for Arf6: sorting, structuring, and signaling at the plasma membrane. J Biol Chem 278 (43), 41573-41576 (2003). 142 Murdaca, J. et al., Grb10 prevents Nedd4-mediated vascular endothelial growth factor receptor-2 degradation. J Biol Chem 279 (25), 26754-26761 (2004). 143 Duval, M., Bedard-Goulet, S., Delisle, C., & Gratton, J.P., Vascular endothelial growth factor-dependent down-regulation of Flk-1/KDR involves Cbl-mediated ubiquitination. Consequences on nitric oxide production from endothelial cells. J Biol Chem 278 (22), 20091-20097 (2003). 144 Singh, A.J., Meyer, R.D., Band, H., & Rahimi, N., The carboxyl terminus of VEGFR-2 is required for PKC-mediated down-regulation. Mol Biol Cell 16 (4), 2106-2118 (2005). 145 Christensen, D.E. & Klevit, R.E., Dynamic interactions of proteins in complex networks: identifying the complete set of interacting E2s for functional investigation of E3-dependent protein ubiquitination. FEBS J 276 (19), 5381- 5389 (2009). 87  146 Smart, E.J., Ying, Y.S., Mineo, C., & Anderson, R.G., A detergent-free method for purifying caveolae membrane from tissue culture cells. Proc Natl Acad Sci U S A 92 (22), 10104-10108 (1995). 147 Pike, L.J., Growth factor receptors, lipid rafts and caveolae: an evolving story. Biochim Biophys Acta 1746 (3), 260-273 (2005). 148 Di Guglielmo, G.M., Le Roy, C., Goodfellow, A.F., & Wrana, J.L., Distinct endocytic pathways regulate TGF-beta receptor signalling and turnover. Nat Cell Biol 5 (5), 410-421 (2003). 149 Sigismund, S. et al., Clathrin-mediated internalization is essential for sustained EGFR signaling but dispensable for degradation. Dev Cell 15 (2), 209-219 (2008). 150 Lanzetti, L. & Di Fiore, P.P., Endocytosis and cancer: an 'insider' network with dangerous liaisons. Traffic 9 (12), 2011-2021 (2008).                           88  APPENDICES  Figure A1.    Representative amplification plot for tie-2 mRNA levels.  Representative amplification plot for tie-2 RNA levels in 15nM or 75nM scrambled siRNA- and myoferlin siRNA-treated BAECs isolated at 24, 48, and 72hr, as well as negative controls.  Samples were run in triplicates.  Green line represents threshold set to determine the Ct where there is significant increase in reporter signal.                  89  Figure A2.    Representative dissociation curves for tie-2 mRNA levels.  Representative dissociation curves for tie- 2 mRNA levels in 15nM or 75nM scrambled siRNA- and myoferlin siRNA-treated BAECs isolated at 24, 48, and 72hr, as well as negative controls.  Samples were run in triplicates.                     90  Figure A3.    Representative amplification plot for tie-2 standards.  Samples were run in triplicates.  Green line represents threshold set to determine the CT where there is significant increase in reporter signal.                      91  Figure A4.   Representative dissociation curves for tie-2 standards.   Standards were cDNA produced from in vitro transcribed transcripts were serially diluted from 107 to 101 copy numbers were run in triplicates.                      92  Figure A5.    Standard curve plot for tie-2.  Standard curve plot was generated by using copy number vs. threshold cycle number.  This representative standard curve shows a slope of -3.498 and R2 value of 0.981.                        93  Figure A6.    Representative amplification plot for GAPDH mRNA levels.  Representative amplification plot for GAPDH mRNA levels in 15nM or 75nM scrambled siRNA- and myoferlin siRNA-treated BAECs isolated at 24, 48, and 72hr, as well as negative controls.  Samples were run in triplicates.  Green line represents threshold set to determine the Ct where there is significant increase in reporter signal.                      94  Figure A7.    Representative dissociation curves for GAPDH mRNA levels.  Representative dissociation curves for GAPDH mRNA levels in 15nM or 75nM scrambled siRNA- and myoferlin siRNA-treated BAECs isolated at 24, 48, and 72hr, as well as negative controls.  Samples were run in triplicates.                     95  Figure A8.    Representative amplification plot for GAPDH standards. Standards were cDNA produced from in vitro transcribed transcripts were serially diluted from 107 to 101 copy numbers were run in triplicates. Green line represents threshold set to determine the Ct where there is significant increase in reporter signal.                      96  Figure A9.    Representative dissociation curves for GAPDH standards.   Standards were cDNA produced from in vitro transcribed transcripts were serially diluted from 107 to 101 copy numbers were run in triplicates.                      97  Figure A10.    Standard curve plot for GAPDH.  Standard curve plot was generated by using copy number vs. threshold cycle number.  This representative standard curve shows a slope of -3.397 and R2 value of 0.984.                       98  Figure A11.    Detection of a single product in qPCR.  Electrophoresis analysis of amplified products from qPCR showed a single band at expected sizes for tie-2 (top panel) and GAPDH (bottom panel).                  500kb 400kb 300kb 200kb 100kb  500kb 400kb 300kb 200kb 100kb 99  Figure A12.    LLC viability assay using Trypan blue.  LLC subjected to gene-silencing treatment by 15 or 75nM non-silencing (NS) or myoferlin (Myof) siRNA for 48 and 72hr.  Numbers shown are mean ± SEM (n=4).                         100  Figure A13.                       Dynamin-2, myoferlin and tie-2 are co-localized in caveolae/lipid rafts.  Enrichment of dynamin-2, myoferlin and tie-2 in caveolae/lipid rafts from native BAEC.  Equal volumes of cell samples were loaded from each fraction, and proteins were blotted for myoferlin, tie-2, caveolin-1 (Cav-1), and HSP90.  Fractions 2 to 4 represent proteins in caveolae/lipid rafts, or light fraction membranes, while fractions 9 to 12 represent bulk cytosolic proteins, or heavy fraction membranes.                    HSP90 Cav-1 Myoferlin Tie-2   1       2       3      4      5      6      7     8      9     10   11   12    lysate Caveolae/ Lipid rafts Bulk cytosolic proteins Sucrose Gradient (5-45%) Dynamin-2 101  Figure A14.                          Infection of AdK44ADyn-2 leads to decreased tie-2 expression in ECs.  BAECs were infected with either Adβgal or AdK44ADyn-2 at MOI = 10 or 20 and expressions of tie-2, dynamin-2 (Dyn-2) and βCOP (loading control) were detected by Western blot.                      %  T ie -2  E xp re ss io n  100 80 60 40 20 0 MOI =      10        20         10         20 Adβgal  AdK44A  Tie-2 Dyn-2 βCOP 102  Figure A15.                      AdK44A dynamin-2 treatment causes decreased EC proliferation.  BAECs were infected with MOI = 2.5 and 25 of either AdGFP (control) or AdK44A Dyn-2 and proliferation assay was performed using a haemocytometer at 0, 48 and 72hr. One-way Anova test followed by Bonferoni test, *p<0.0001, ^p=0.0003, numbers expressed as mean ± SEM, n=4.                      Number of Cells vs. Time (hr) * * ^ * 103  Figure A16.    AdK44A dynamin-2 treatment does not affect LLC proliferation.  LLCs were infected with MOI = 2.5 and 25 of either AdGFP (control) or AdK44A Dyn-2 and proliferation assay was performed using a haemocytometer at 0, 48 and 72hr.  Numbers expressed as mean ± SEM, n=4.                     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0071180/manifest

Comment

Related Items