UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Congenital urinary tract obstruction : linking form and function. Trnka, Peter 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_trnka_peter.pdf [ 29.75MB ]
Metadata
JSON: 24-1.0071159.json
JSON-LD: 24-1.0071159-ld.json
RDF/XML (Pretty): 24-1.0071159-rdf.xml
RDF/JSON: 24-1.0071159-rdf.json
Turtle: 24-1.0071159-turtle.txt
N-Triples: 24-1.0071159-rdf-ntriples.txt
Original Record: 24-1.0071159-source.json
Full Text
24-1.0071159-fulltext.txt
Citation
24-1.0071159.ris

Full Text

CONGENITAL URINARY TRACT OBSTRUCTION: LINKING FORM AND FUNCTION by Peter Trnka M.D., Comenius University, Bratislava, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2010  © Peter Trnka, 2010  ABSTRACT Renal dysplasia associated with congenital urinary tract obstruction remains the major cause of end-stage renal disease in young children. The outcomes of the most severely affected boys with posterior urethral valves have not changed since the introduction of fetal intervention over twenty years ago. Poor outcomes likely reflect our limited understanding of the pathophysiology of congenital obstructive nephropathy. The first part of this thesis summarizes the challenges of diagnosis and management of this condition that are based on the assessment of fetal tubular function rather than on tests reflecting the degree of dysplastic changes. The importance of the new biomarker development based on proteomic techniques is also presented. One of the processes leading to renal dysplasia, epithelial-mesenchymal transition (EMT), is presented for the first time in human fetal kidneys in the initial study of this thesis. Characteristic changes of EMT in the collecting duct epithelium consist of the decreased expression of epithelial proteins, increased expression of mesenchymal proteins, disruption of the basement membrane, and deposition of extracellular matrix into the surrounding interstitium. Molecular and cellular signaling events of the phenotypic epithelial transition are presented in the subsequent study in which a modulatory role of Y-box binding protein-1 (YB-1) on EMT is described. Inactivation of YB-1 leads to attenuation of EMT, a fact that might have therapeutic implications and deserves further exploration. Cellular signaling pathways of EMT are also described in this study. The final project of this thesis describes clinical utility of the identified candidate proteins as urinary biomarkers of congenital obstructive nephropathy in patients with posterior urethral valves (PUV). The differential expression of proteins involved in EMT, renal fibrosis, and sensing of urine flow in patients with PUV and controls is presented, as well as their correlation to ii  the degree of renal impairment. The results presented in this thesis contribute to our understanding of the pathophysiology of congenital obstructive nephropathy, and identify key proteins involved in this process that could be measured in urine and used as biomarkers of this devastating disease.  iii  TABLE OF CONTENTS  ABSTRACT...................................................................................................................... ii TABLE OF CONTENTS ............................................................................................... iv LIST OF TABLES ........................................................................................................ vii LIST OF FIGURES ..................................................................................................... viii ACKNOWLEDGEMENTS ............................................................................................ x DEDICATION ............................................................................................................... xii CO-AUTHORSHIP STATEMENT ........................................................................... xiii  CHAPTER 1 INTRODUCTION ................................................................................. 1 Congenital urinary tract obstruction and obstructive nephropathy .................. 1 Identification of potential biomarkers of congenital obstructive nephropathy ............................................................................................................. 3 Molecular mechanisms of epithelial-mesenchymal transition and renal fibrosis in congenital obstructive nephropathy .......................................... 5 Clinical utility of candidate urinary biomarkers of congenital obstructive nephropathy ......................................................................................... 7 References ................................................................................................................ 9  CHAPTER 2 CONGENITAL URINARY TRACT OBSTRUCTION: LINKING FORM AND FUNCTION ............................................................................................. 15 Introduction ........................................................................................................... 15 Diagnosis and current management of congenital urinary tract obstruction ............................................................................................................. 16 Development of glomerular and tubular function in the human fetus ............. 21 iv  Development of glomerular and tubular form in the human fetus .................. 29 The effect of congenital urinary tract obstruction on form and function ........ 30 Developmental kidney injury and lessons learned from acute kidney injury ...................................................................................................................... 34 Conclusions ............................................................................................................ 37 References .............................................................................................................. 38  CHAPTER 3 PHENOTYPIC TRANSITION OF THE COLLECTING DUCT EPITHELIUM IN CONGENITAL URINARY TRACT OBSTRUCTION............. 48 Introduction ........................................................................................................... 48 Materials and methods .......................................................................................... 49 Results ..................................................................................................................... 52 Discussion ............................................................................................................... 65 Conclusions ............................................................................................................ 70 References .............................................................................................................. 71  CHAPTER 4 Y-BOX BINDING PROTEIN-1 MODULATES KIDNEY COLLECTING DUCT EPITHELIAL-MESENCHYMAL TRANSITION ............ 74 Introduction ........................................................................................................... 74 Materials and methods .......................................................................................... 76 Results ..................................................................................................................... 80 Discussion ............................................................................................................... 91 Conclusions ............................................................................................................ 95 References .............................................................................................................. 97  v  CHAPTER 5 URINE PROTEIN EXPRESSION PROFILES IN OBSTRUCTIVE NEPHROPATHY ........................................................................................................ 103 Introduction ......................................................................................................... 103 Materials and methods ........................................................................................ 105 Results ................................................................................................................... 107 Discussion ............................................................................................................. 113 Conclusions .......................................................................................................... 118 References ............................................................................................................ 119  CHAPTER 6 SUMMARY AND CONCLUSIONS ................................................ 123 References ............................................................................................................ 130  APPENDIX ETHICS APPROVALS ....................................................................... 133  vi  LIST OF TABLES  Table 5.1  Clinical characteristics of subjects with posterior urethral valves and age-matched controls ...................................................................... 108  Table 5.2  The levels of potential biomarkers of obstructive nephropathy in whole urine and urine exosomes of subjects with obstructive nephropathy due to posterior urethral valves compared to age-matched controls.............................................................................. 111  vii  LIST OF FIGURES Figure 2.1  Antenatal ultrasound of congenital urinary tract obstruction .................. 17  Figure 2.2  Developmental changes of fetal serum β2-microglobulin ....................... 19  Figure 2.3  Developmental changes of glomerular filtration rate and its relationship to nephrogenesis .................................................................. 23  Figure 2.4  The relationship between fetal GFR, fetal urine production, and the number of glomeruli in the developing kidney ....................................... 24  Figure 2.5  Decrease in fractional excretion of sodium during fetal tubular and collecting duct maturation ....................................................................... 26  Figure 2.6  Decrease in fractional excretion of β2-microglobulin during fetal tubular and collecting duct maturation .................................................... 27  Figure 2.7  Increase in the concentrating ability during fetal tubular and collecting duct maturation ....................................................................... 28  Figure 2.8  Histological characteristics of nonhuman primate fetal obstructive nephropathy ............................................................................................. 31  Figure 2.9  Histological characteristics of human fetal obstructive nephropathy ...... 33  Figure 2.10  Potential biomarkers of fetal obstructive nephropathy ............................ 36  Figure 3.1  Gestational and postnatal ages of obstructed and control kidney tissue samples .............................................................................. 50  Figure 3.2  Histological features of human fetal obstructive nephropathy ................ 54  Figure 3.3  E-cadherin and β-catenin immunoreactivity ........................................... 56  Figure 3.4  E-cadherin and α-smooth muscle actin immunoreactivity ...................... 58  Figure 3.5  Vimentin and collagen IV immunoreactivity .......................................... 60 viii  Figure 3.6  Correlation of the severity of CD dilatation with periductal collar formation and with CD epithelial vimentin expression ........................... 62  Figure 3.7  Gene expression in normal and obstructed fetal kidneys ........................ 64  Figure 3.8  Paradigm of changes associated with human congenital urinary tract obstruction ....................................................................................... 69  Figure 4.1  Dose- and time-dependent changes of epithelial and mesenchymal proteins in IGF-1 stimulated mIMCD3 cells ........................................... 81  Figure 4.2  Phenotypic changes of IGF-1 stimulated mIMCD3 cells ....................... 82  Figure 4.3  YB-1 expression in the human fetal collecting duct epithelium ............. 83  Figure 4.4  Activation of YB-1 in IGF-1-induced EMT of mIMCD3 cells .............. 84  Figure 4.5  Signaling events involved in activation of YB-1 .................................... 85  Figure 4.6  Efficiency of siRNA knockdown of YB-1 .............................................. 86  Figure 4.7  Effect of YB-1 knockdown on EMT of IGF-1-induced mIMCD3 cells .......................................................................................................... 88  Fibure 4.8  Phenotypic differences between IGF-1-stimulated mIMCD3 cells with intact YB-1 and YB-1 knockdown ................................................. 90  Figure 4.9  YB-1 signaling and its effect on EMT .................................................... 96  Figure 5.1  Relationship between the stage of chronic kidney disease, the degree of proteinuria and renal impairment in subjects with obstructive nephropathy due to posterior urethral valves ..................... 109  Figure 5.2  Whole urine and urine exosome levels of biomarkers in subjects with obstructive nephropathy due to posterior urethral valves and controls .................................................................................................. 110  Figure 5.3  Relationship between the excretion of urinary biomarkers, age and kidney function ............................................................................... 112  ix  ACKNOWLEDGEMENTS I would like to thank my mother, father and sister for their love and support throughout many years of my studies and my professional career.  I thank Doug Matsell for being a wonderful mentor. He triggered my interest in science, provided the necessary direction for my research, and inspired me to continue my work in this field. In addition, he was always accessible and willing to help. I enjoyed our discussions as much as I loved playing hockey with him. Thanks Doug.  Thanks to Larissa and Mike, my lab buddies, for their friendship and help in conducting my projects. I have learned a lot through our interactions during the long hours in the lab. Your help is much appreciated.  I thank Kevan Jacobson and Peter von Dadelszen, the members of my supervisory committee, for their constructive criticism and guidance throughout my studies. The input provided by them improved my thesis greatly. Many thanks also to Sandra Dunn for her support and guidance during my directed studies.  I thank all members of the Division of Nephrology at the British Columbia Children’s Hospital, the physicians, nurses, social workers, dieticians, pharmacists and secretaries, for their understanding and help with my clinical duties when I was in the lab.  I would like to thank British Columbia Provincial Renal Agency for providing financial support for my studies. Individual projects presented in this thesis were also funded by the British Columbia Provincial Renal Agency, Kidney Foundation of Canada,  x  Transplant Research Foundation of British Columbia, Canadian Institutes of Health Research, and National Institutes of Health.  Finally, special thanks to my beautiful wife Liz and our wonderful boys Max, Sam and George for their encouragement to pursue my interests, listening to my complaints and frustrations, and for believing in me. I love you.  xi  DEDICATION I dedicate this work to the memory of my grandparents Anna, Emília, Ján and Július.  xii  CO-AUTHORSHIP STATEMENT All the projects included in this thesis were collaborative efforts. Manuscript presented in chapter 2 was co-authored with Michael J Hiatt and Douglas G Matsell at the University of British Columbia. As the first author, I was in charge of the literature review and the manuscript preparation. Manuscript presented in chapter 3 was also co-authored with Michael J Hiatt, Larissa Ivanova, Douglas G Matsell at the University of British Columbia, and Alice F Tarantal at the UC Davis, University of California. I was actively involved in all aspects of this project including formulation of the research hypothesis, performance of immunohistochemical and RT-PCR techniques, data analysis and writing of the manuscript. Manuscript in chapter 4 was co-authored with Larissa Ivanova, Michael J Hiatt, Sandra E Dunn, and Douglas G Matsell at the University of British Columbia. My contribution to this work included proposal of the research hypothesis and specific aims of the study, performance of immunocytochemical and Western blot experiments, data analysis and manuscript preparation. Manuscript in chapter 5 was co-authored with Larissa Ivanova, Michael J Hiatt, Ruth Milner, and Douglas G Matsell at the University of British Columbia. My involvement in this project included formulation of the research proposal, preparation of the samples for the analysis, performance of Western blot technique, data analysis and manuscript preparation.  xiii  All co-authors contributed to the identification and design of the research project and the preparation and revision of these manuscripts.  xiv  CHAPTER 1  INTRODUCTION  Congenital urinary tract obstruction and obstructive nephropathy Congenital abnormalities are detected in 1 – 2% of pregnancies with involvement of the urinary tract in approximately 20% of these cases.1 Most are mild or transient and have good outcome, but severe urinary tract malformations with associated renal dysplasia constitute the main cause of chronic kidney disease in young children. Registries and databases from Europe,2 North and Central America,3 and Australia and New Zealand4 show that hypoplasia/dysplasia, often associated with obstructive nephropathy, is the leading cause of chronic kidney disease and end-stage renal disease in childhood. The latest annual report of the North American Pediatric Renal Trials and Collaborative Studies shows that 20.7% of all registered causes of chronic kidney disease were due to obstructive nephropathy.5 The ItalKid Project, the largest, population-based prospective renal registry in Europe, reported hypodysplasia with identified uropathy as a cause of chronic kidney disease in 43.6% of all registered children.2 In most severely affected patients, usually boys with posterior urethral valves, the urinary tract obstruction is associated with severe hypoplasia/dysplasia of the kidneys. As fetal urine contributes significantly to the production of amniotic fluid in the second half of pregnancy, poor fetal urine output resulting in oligohydramnios leads to the development of pulmonary hypoplasia, the main cause of perinatal mortality.6 To improve the outcomes of these  1  babies, prenatal fetal intervention was introduced with the aim to bypass the obstruction, increase the amniotic fluid flow, and thus allow the fetal lung development.  The outcome of patients with severe obstructive nephropathy has not significantly changed over the last two decades despite advances in antenatal diagnosis and therapeutic intervention.7-9 Even though perinatal survival has increased,10 long-term outcomes of children with obstructive nephropathy who undergo vesico-amniotic shunting remain poor. A substantial number of children surviving the neonatal period develop end-stage renal disease later in life,7 and have a high prevalence of bladder dysfunction associated with recurrent urinary tract infections and pulmonary complications due to pulmonary hypoplasia.8 The reasons for this limited success include poor accuracy of the available diagnostic tests, uncertainty about which fetuses should undergo fetal intervention, timing of this intervention, but mainly the underappreciation of the pathogenesis of renal dysplasia associated with congenital urinary tract obstruction. Current diagnostic tests lack sufficient clinical sensitivity and specificity as they reflect functional changes of an immature kidney (pathophysiology) rather than estimate the degree of structural damage and potential for postnatal deficit (pathogenesis). Multiple small studies on fetal urinary shunting use different criteria for fetal selection and different outcome measures which make the assessment of the efficacy of prenatal intervention and recommendations for the intervention difficult.11 To assess short- and long-term outcomes of prenatal fetal intervention for fetal congenital urinary tract obstruction, and eventually to improve the outcomes of these pregnancies, multicentre randomized control trials are required.12 One such trial is currently recruiting patients across the UK with the plan to extend to international centres.13 The aims of the Percutaneous Shunting in Lower Urinary Tract Obstruction (PLUTO) trial are to 2  determine the efficacy and safety of vesico-amniotic shunting in lower urinary tract obstruction. The first project of this thesis summarizes the current state of knowledge around the diagnosis and management of human congenital obstructive nephropathy based mainly on fetal physiology; it outlines an alternative approach to the diagnosis of this condition based on the proteomic/genomic characterization of obstructive nephropathy.  Identification of potential biomarkers of congenital obstructive nephropathy Appreciation of the knowledge of the pathogenesis and a better understanding of the cellular and molecular events of congenital obstructive nephropathy are required for the development of more reliable tests. The common final pathway of any long-standing kidney injury, including congenital urinary tract obstruction, is the development of tubular atrophy and interstitial fibrosis.14  The developing fetal kidney responds to obstruction by the activation of interstitial fibroblasts and myofibroblasts, and by the stimulation of repair mechanisms. If the process becomes excessive, activated fibroblasts and myofibroblasts upregulate profibrotic pathways with the accumulation of extracellular matrix (ECM) in the kidney interstitium leading to fibrosis and destruction of normal renal parenchyma.15 The origins of interstitial fibroblasts and myofibroblasts have been extensively studied.16-18 Activated resident interstitial fibroblasts seem to be the main source of ECM19 with less contribution by bone marrow-derived myofibroblasts.20 Vascular pericytes and  3  perivasular fibroblasts have been shown to differentiate into myofibroblasts in a model of urinary tract obstruction, likely as a result of vascular injury.21 Endothelial cells can also become activated interstitial fibroblasts and myofibroblasts through the process of endothelial-mesenchymal transition and contribute to ECM deposition.22  Injury to the epithelium in a number of human disease states also causes epithelial cells to acquire mesenchymal characteristics through the process of epithelial-mesenchymal transition (EMT), and in congenital urinary tract obstruction this contributes to the characteristic tubulointerstitial disease.23-28 The injured epithelium plays an important role in this process. Iwano et al. demonstrated in their landmark in vivo study that up to 36% of interstitial fibroblasts derive from EMT of proximal tubular cells during experimental unilateral ureteral obstruction.24 The process of EMT in the kidney is characterized by the loss of epithelial adhesions, de novo expression of mesenchymal markers and actin reorganization by the cells, followed by the disruption of the tubular basement membrane, and finally, by invasion and migration of newly formed myofibroblasts into interstitium.25  Our group has studied the pathogenesis of renal dysplasia in a nonhuman primate model of obstructive nephropathy29,30 and highlighted significant histopathological changes in the renal medullary interstitium, including dilatation of the collecting ducts (CDs), and disruption of the CD epithelium. We have also observed features suggestive of CD EMT in this experimental animal model with loss of the normal epithelial phenotype, gain of a mesenchymal phenotype, disruption of the tubular epithelial basement membrane, and migration of the transformed cells into the interstitium.31 As there were no data on the role of CD EMT in human congenital urinary tract obstruction and obstructive 4  nephropathy, we described the phenotypic transition of the obstructed human CD epithelium and its contribution to the development renal fibrosis. During this process we also identified candidate proteins differentially expressed in obstructed and control kidneys that could potentially be measured in urine and used as non-invasive biomarkers of obstructive nephropathy. The findings of our study on phenotypic transition of the human collecting duct epithelium are described in chapter 3 of this thesis.  Molecular mechanisms of epithelial-mesenchymal transition and renal fibrosis in congenital obstructive nephropathy Normal epithelium is a highly organized structure of individual cells with apical-basal polarity connected to one another by cell-cell junctions that ensure mechanical integrity and that create a permeability barrier between adjacent tissues and the environment. EMT plays an essential role during normal development of this epithelial barrier.32 On the other hand, EMT also contributes to such pathological processes as metastasis in cancer or the development of tissue fibrosis in various organs.26,33,34 The main morphological changes associated with EMT are the loss of epithelial adhesion and anchoring proteins (E-cadherin, ZO-1, catenins), allowing the cells to detach from each other, and the de novo synthesis of flexible and contractile cytoskeletal proteins (vimentin, α-smooth muscle actin), giving the cells motility and flexibility. These phenotypic epithelial changes are followed by the breakdown of the tubular basement membrane thus allowing the newly formed myofibroblasts to migrate into the interstitium of the kidney where they contribute to the development of fibrosis.25  5  Molecular mechanisms of EMT in normal development and disease involving multiple stimulating factors and signaling pathways have been elucidated in recent years.35,36 EMT can be induced in vitro by stimulation of the cells with growth factors, such as transforming growth factor-β, epidermal growth factor, fibroblast growth factor, and others. The role of insulin-like growth factor-1 (IGF-1) in tissue fibrosis is largely unknown and the reports are controversial. Overexpression of IGFs in the expanded interstitium of dysplastic fetal kidneys suggests a profibrotic role of this peptide.37 On the other hand, no effect of inhibition of IGF-1 on the development of renal fibrosis has been reported in the rat model.38 Our group has recently shown that mouse kidney inner medullary collecting duct cells undergo EMT in vitro after IGF-1 stimulation.39 In these cells, IGF-1 stimulation resulted in activation of PI3-kinase pathway, with rapid Akt and GSK-3β phosphorylation, Akt translocation to the nucleus, and early upregulation of Snail1. The late consequences of this stimulation were the phenotyopic transformation of the cells with upregulation of mesenchymal proteins α-smooth muscle actin and vimentin. Other signaling pathways, such as GSK-β/Wnt pathway, TNFα/NF-κB pathway, have been described to contribute to EMT.40 These pathways are interconnected by virtue of multiple transcription factors, including Snail, Twist, Slug, ZEB1/ZEB2.41,42  Transcription factor Y-box binding protein-1 (YB-1) has emerged in recent years as one of the most potent modulators of cancer progression, especially in invasive forms of breast cancer, and has been considered as a attractive target of therapy.43,44 YB-1 has also been recently implicated as key factor in the activation of EMT in cancer.45 Interestingly, YB-1 is expressed in the fetal kidney in mid-gestation and possibly plays a role in normal development of the kidney.46 There are multiple reports investigating the involvement of 6  this protein in kidney disease. YB-1 has been implicated as a major factor in the development of mesangial cell sclerosis in membranoproliferative glomerular disease47,48 as well as a regulator of EMT of TGF-β in proximal epithelial cells.49 The role of YB-1 in EMT of CD cells has not been studied. Based on our in vitro evidence of IGF-1induced EMT of collecting duct cells, and on the evidence of YB-1’s role in the process of EMT, we studied the involvement and functional importance of YB-1 in IGF-1induced EMT of renal collecting duct epithelial cells. This study is summarized in chapter 4 of this thesis.  Clinical utility of candidate urinary biomarkers of congenital obstructive nephropathy While the clinical diagnosis of congenital urinary tract obstruction might be relatively straightforward, the assessment of the severity of the associated obstructive nephropathy is more difficult. The patients are usually followed in nephrology clinics with serial measurements of serum creatinine used as a surrogate marker of glomerular filtration rate (GFR). Some units measure GFR directly, mostly by methods based on plasma disappearance of certain molecules at predefined intervals. However, these diagnostic tests are based on the measurement of kidney function and do not reflect structural changes characteristic of obstructive nephropathy. There are no diagnostic tests available at present that would predict which patients would reach end-stage kidney disease and at what point in time.  The severity of functional renal impairment is directly related to structural damage of the developing kidneys. To assess the degree of these structural changes, one would have to 7  perform a kidney biopsy. In our previous studies with fetal monkey, we have observed the most pronounced damages, characterized by the paucity of collecting ducts, the degree of tubular dilatation and atrophy, and the extent of interstitial fibrosis deep in the kidney medulla,50,51 that is not accessible by renal biopsy without risk. Surrogate markers of structural changes in obstructive nephropathy that can be measured in urine and used in the clinic are therefore needed.  Based on our animal studies on congenital obstructive nephropathy as well as on the findings described in chapter 3 of this thesis, we have identified candidate proteins that are differentially expressed in the tissue of the obstructed kidneys when compared to control kidneys.50 These proteins included scaffolding transmembrane epithelial proteins involved in cell-cell adhesion [E-cadherin, β-catenin, N-cadherin, and L1 cell adhesion molecule (L1CAM)], mesenchymal proteins reflecting the process of epithelialmesenchymal transition [vimentin and α-smooth muscle actin (α-SMA)], specific proteins expressed by principal and intercalated cells of the collecting duct [aquaporin-2 (AQP2) and vacuolar-type H+-ATPase (V-ATPase), respectively], potential flow-sensing protein [transient receptor potential cation channel subfamily V member 4 (TRPV4)], and a profibrotic cytokine involved in progression of fibrosis [transforming growth factor-β1 (TGF-β1)]. The final project of this thesis explores the patterns of excretion of these candidate proteins in urine of patients with the most severe form of lower urinary tract obstruction, posterior urethral valves. We investigated the feasibility of measuring these candidate proteins in urine from patients with kidney injury and correlated their “expression pattern” with the severity of renal impairment. The findings of this study are presented in chapter 5 of this thesis.  8  References 1.  Damen-Elias HA, De Jong TP, Stigter RH, Visser GH, Stoutenbeek PH: Congenital renal tract anomalies: outcome and follow-up of 402 cases detected antenatally between 1986 and 2001. Ultrasound Obstet Gynecol 25: 134-143, 2005.  2.  Ardissino G, Daccò V, Testa S, Bonaudo R, Claris-Appiani A, Taioli E, Marra G, Edefonti A, Sereni F; ItalKid Project: Epidemiology of chronic renal failure in children: Data from the ItalKid project. Pediatrics 111: e382-387, 2003.  3.  Smith JM, Stablein DM, Munoz R, Hebert D, McDonald RA: The 2006 Annual Report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS). Pediatr Transplant 11: 366-373, 2007.  4.  McDonald SP, Craig JC; Australian and New Zealand Paediatric Nephrology Association. Long-term survival of children with end-stage renal disease. N Engl J Med 350: 2654-2662, 2004.  5.  North American Pediatric Renal Trials and Collaborative Studies. NAPRTCS 2008 Annual Report. https://web.emmes.com/study/ped/annlrept/Annual%20Report%202008.pdf.  6.  Freedman AL, Johnson MP, Gonzalez R. Fetal therapy for obstructive uropathy: past, present.future? Pediatr Nephrol 14: 167-176, 2000.  7.  Coplen DE: Prenatal intervention for hydronephrosis. J Urol 157: 2270-2277, 1997.  8.  Biard JM, Johnson MP, Carr MC, Wilson RD, Hedrick HL, Pavlock C, Adzick NS: Long-term outcomes in children treated by prenatal vesicoamniotic shunting for lower urinary tract obstruction. Obstet Gynecol 106: 503-508, 2005.  9.  Holmes N, Harrison MR, Baskin LS: Fetal surgery for posterior urethral valves: long-term postnatal outcomes. Pediatrics 108: E7, 2001. 9  10. Clark TJ, Martin WL, Divakaran TG, Whittle MJ, Kilby MD, Khan KS. Prenatal bladder drainage in the management of fetal urinary tract obstruction: a systematic review and meta-analysis. Obstet Gynecol 102: 367-382, 2003. 11. Morris RK, Khan KS, Kilby MD. Vesicoamniotic shunting for fetal lower urinary tract obstruction: an overview. Arch Dis Child Fetal Neonatal Ed 92: 166-168, 2007. 12. Kilby MD, Somerset DA, Khan KS. Potential for correction of fetal obstructive uropathy: time for a randomized, control trial? Ultrasound Obstet Gynecol 23: 527530, 2004. 13. Morris RK, Kilby MD. An overview of the literature on congenital urinary tract obstruction and introduction to the PLUTO trial: percutaneous shunting in lower urinary tract obstruction. Aust N Z J Obstet Gynaecol 49: 6-10, 2009. 14. Eddy AA: Progression in chronic kidney disease. Adv Chronic Kidney Dis 12: 353365, 2005. 15. Eddy AA: Molecular basis of kidney fibrosis. Pediatr Nephrol 15: 290-301, 2000. 16. Strutz F, Zeisberg M: Renal fibroblasts and myofibroblasts in chronic kidney disease. J Am Soc Nephrol 17: 2992-2998, 2006 17. Qi W, Chen X, Poronnik P, Pollock CA: The renal cortical fibroblasts in renal tubulointerstitial fibrosis. Int J Biochem Cell Biol 38: 1-5, 2006. 18. Grande MT, Lopez-Novoa JM: Fibroblast activation myofibroblast generation in obstructive nephropathy. Nat Rev Nephrol 5: 319-328, 2009. 19. Picard N, Baum O, Vogetseder A, Kaissling B, Le Hir M: Origin of renal myofibroblasts in the model of unilateral ureter obstruction in the rat. Histochem Cell Biol 130: 141-155, 2008.  10  20. Roufosse C, Bou-Gharios G, Prodromidi E, Alexakis C, Jeffery R, Khan S, Otto WR, Alter J, Poulsom R, Cook HT: Bone marrow-derived cells do not contribute significantly to collagen I synthesis in a murine model of renal fibrosis. J Am Soc Nephrol 17: 775-782, 2006. 21. Lin SL, Kisseleva T, Brenner DA, Duffield JS: Pericytes and perivascular fibroblasts are the primary source of collagen-producing cells in obstructive fibrosis of the kidney. Am J Pathol 173: 1617-1627, 2008. 22. Zeisberg EM, Potenta SE, Sugimoto H, Zeisberg M, Kalluri R: Fibroblasts in kidney fibrosis emerge via endothelial-to-mesenchymal transition. J Am Soc Nephrol 19: 2282-2287, 2008. 23. Hay ED, Zuk A: Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced. Am J Kidney Dis 26: 678-690, 1995. 24. Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest 110: 341-350, 2002. 25. Liu Y: Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15: 1-12, 2004. 26. Zeisberg M, Kalluri R: The role of epithelial-to-mesenchymal transition in renal fibrosis. J Mol Med 82: 175-181, 2004. 27. Picard M, Baum O, Vogetseder A, Kaissling B, Le Hir M: Origin of renal myofibroblasts in the model of unilateral ureter obstruction in the rat. Histochem Cell Biol 130: 141-155, 2008. 28. Strutz FM: EMT and proteinuria as progression factors. Kidney Int 75: 475-481, 2009. 11  29. Tarantal AF, Han VK, Cochrum KC, Mok A, daSilva M, Matsell DG: Fetal rhesus monkey model of obstructive renal dysplasia. Kidney Int 59: 446-456, 2001. 30. Matsell DG, Mok A, Tarantal AF: Altered primate glomerular development due to in utero urinary tract obstruction. Kidney Int 61: 1263-1269, 2002. 31. Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007. 32. Shook D, Keller R; Mechanisms, mechanics and function of epithelialmesenchymal transitions in early development. Mech Dev 120: 1351-1383, 2003. 33. Willis BC, duBois RM, Borok Z: Epithelial origin of myofibroblasts during fibrosis in the lung. Proc Am Thorac Soc 3: 377-82, 2006. 34. Gressner OA, Rizk MS, Kovalenko E, Weiskirchen R, Gressner AM: Changing the pathogenetic roadmap of liver fibrosis? Where did it start; where will it go? J Gastroenterol Hepatol 23: 1024-35, 2008. 35. Baum B, Settleman J, Quinlan MP: Transitions between epithelial and mesenchymal states in development and disease. Semin Cell Dev Biol 19: 294-308, 2008. 36. Micalizzi DS, Ford HL: Epithelial-mesenchymal transition in development and cancer. Future Oncol 5: 1129-1143, 2009. 37. Matsell DG, Bennett T, Armstrong RA, Goodyer P, Goodyer C, Han VK: Insulinlike growth factor (IGF) and IGF binding protein gene expression in multicystic renal dysplasia. J Am Soc Nephrol 8: 85-94, 1997. 38. Oldroyd SD, Miyamoto Y, Moir A, Johnson TS, Nahas AM, Haylor JL: An IGF-I antagonist does not inhibit renal fibrosis in the rat following subtotal nephrectomy. Am J Physiol Renal Physiol 290: F695-702, 2006. 12  39. Ivanova L, Butt MJ, Matsell DG: Mesenchymal transition in kidney collecting duct epithelial cells. Am J Physiol Renal Physiol 294: F1238-F1248, 2008. 40. Sabbah M, Emami S, Redeuilh G, Julien S, Prévost G, Zimber A, Ouelaa R, Bracke M, De Wever O, Gespach C: Molecular signature and therapeutic perspective of the epithelial-to-mesenchymal transitions in epithelial cancers. Drug Resist Updat 11: 123-151, 2008. 41. Peinado H, Olmeda D, Cano A: Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer 7: 415428, 2007. 42. Gavert N, Ben-Ze’ev A: Epithelial-mesenchymal transition and the invasive potential of tumors. Trends Mol Med 14: 199-209, 2008. 43. Wu J, Stratford AL, Astanehe A, Dunn SE: YB-1 is a transcription/translation factor that orchestrates the oncogenome by hardwiring signal transduction to gene expression. Translational Oncogenomics 2: 49-65, 2007. 44. Stratford AL, Habibi G, Astanahe A, Jiang H, Hu K, Park E, Shadeo A, Buys TP, Lam W, Pugh T, Marra M, Nielson TO, Klinge U, Mertens PR, Aparicio S, Dunn SE: Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Ybox binding protein-1 (YB-1) and can be inhibited with Iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61, 2007. 45. Evdokimova V, Tognon C, Ng T, Ruzanov P, Melnyk N, Fink D, Sorokin A, Ovchinnikov LP, Davicioni E, Triche TJ, Sorensen PH: Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell 15: 402-415, 2009. 46. Spitkowski DD, Royer-Pokora B, Delius H, Kisseljov F, Jenkins NA, Gilbert DJ, Copeland NG, Royer HD: Tissue restricted expression and chromosomal 13  localization of the YB-1 gene encoding a 42 kD nuclear CCAAT binding protein. Nucleic Acids Res 20: 797-803, 1992. 47. Mertens PR, Harendza S, Pollock AS, Lovett DH: Glomerular mesangial cellspecific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J Biol Chem 272: 22905-22912, 1997. 48. van Royen CR, Eitner F, Martinkus S, Thieltges SR, Ostendorf T, Bokemeyer D, Lüscher B, Lüscher-Firzlaff JM, Floege J, Mertens PR: Y-box protein 1 mediates PDGF-B effects in mesangioproliferative glomerular disease. J Am Soc Nephrol 16: 2985-2996, 2005. 49. Fraser DJ, Phillips AO, Zhang X, van Royen CR, Muehlenberg P, En-Nia A, Mertens PR: Y-box protein-1 controls transforming growth factor-beta1 translation in proximal tubular cells. Kidney Int 73: 724-732, 2008. 50. Matsell DG, Tarantal AF: Experimental models of fetal obstructive nephropathy. Pediatr Nephrol 17: 470-476, 2002. 51. Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007.  14  CHAPTER 2  CONGENITAL URINARY TRACT OBSTRUCTION: LINKING FORM AND FUNCTION1  Introduction Obstructive nephropathy due to congenital urinary tract obstruction is a major cause of chronic kidney disease (CKD) in infants and children.1-3 Severe obstructive nephropathy, most commonly caused by bladder outlet obstruction due to posterior urethral valves, leads to the development of oligo/anhydramnios, pulmonary hypoplasia, and results in fetal loss or early neonatal death. Surviving children experience high rates of CKD with progression to end-stage renal disease, requiring life-long renal replacement therapy by dialysis and kidney transplantation.  Long-term outcomes of children with congenital obstructive nephropathy remain poor.4,5 Current diagnostic tests based on functional changes of the developing kidney have poor predictive values and do not take into consideration the degree of structural damage and potential for postnatal deficit. Despite increased perinatal survival, prenatal intervention has failed to preserve renal function of the obstructed kidneys. There is no consensus with regard to selection of patients for the intervention or timing of the shunting procedure. The improvement of the outcomes of children with congenital obstructive 1  A version of this chapter has been submitted for publication. Trnka P, Hiatt MJ, Matsell DG: Congenital urinary tract obstruction: linking form and function.  15  nephropathy will require the development of reliable diagnostic tests that will select appropriate patients for percutaneous shunting.  In this review, I will provide an overview of current diagnostic and therapeutic approaches to human fetal obstructive nephropathy, discuss the advantages and disadvantages of available tests, and outline the potential for new diagnostic approaches for this condition.  Diagnosis and current management of congenital urinary tract obstruction Estimates of kidney structure Antenatal imaging and biopsy Most cases of congenital urinary tract obstruction are identified by second trimester screening ultrasound. Typically the normal fetal bladder can be visualized from the onset of urine production at approximately 10 weeks gestation and in all pregnancies by 18 – 20 weeks. A distended thick-walled bladder, hydroureters, and bilateral hydronephrosis suggest lower urinary tract obstruction6 (Figure 2.1a). Increased echogenicity of the kidneys, a poorly defined cortico-medullary border, and parenchymal cystic changes are also suggestive of renal dysplasia7 (Figure 2.1b). When associated with severe oligohydramnios in early pregnancy, these changes carry a poor prognosis and are associated with a >90% perinatal mortality.8  16  Figure 2.1 Antenatal ultrasound of congenital urinary tract obstruction. (a) Ultrasound image of a 12 week gestation human fetus with bladder outlet obstruction due to posterior urethral valves; (b) Ultrasound image of an enlarged, echogenic 21 week gestation kidney with multiple parenchymal cysts in a human fetus with posterior urethral valves (courtesy of Dr. Ken Lim, Vancouver, Canada).  Studies analyzing the predictive value of screening antenatal ultrasound are conflicting. Anumba et al. reported the predictive value of echogenic and/or cystic changes of fetal kidneys to detect either dysplasia histologically or chronic kidney disease on postnatal follow-up of 59%. The predictive value of normal parenchyma on prenatal ultrasound to detect no dysplasia or normal renal function was 56%.9 Detailed ultrasound examination of the urinary tract, particularly when performed by an experienced operator, yields a 17  higher accuracy of diagnosis of congenital urinary tract obstruction.10 Fetal magnetic resonance imaging (MRI) can provide more detailed assessment of the fetal urinary tract,11-13 but predictive values of MRI for congenital urinary tract obstruction are difficult to ascertain due to its selective use and small numbers of published cases; the safe use of MRI in pregnancy has not been established.  Limited success in obtaining renal tissue due to the compromised state of the kidney, and the potential for minimal additional information preclude wider diagnostic use of fetal kidney biopsy.14  Estimates of kidney function Fetal glomerular filtration rate (GFR) As noted above, given the inherent drawbacks of antenatal imaging in affected fetuses with kidney disorders, antenatal evaluation strategies have included measures of fetal renal function. Measurement of fetal GFR would be an ideal determinant of renal function and likely a good surrogate for the severity of dysplasia; however, there are no normative data in uncomplicated pregnancies,15 and GFR is somewhat challenging to determine accurately during prenatal life. β2-microglobulin, the light chain of the class I major histocompatibility antigens, has been used as an indirect measure of fetal GFR. It is an attractive candidate for GFR estimation because of a constant production rate by the fetus, inability to cross placenta, and free filtration at the level of the glomerulus. Thus, fetal blood levels reflect fetal GFR in the same manner as blood levels of creatinine reflect kidney function postnatally. Several groups of investigators have measured the levels of β2-microglobulin in fetal blood obtained by cordocentesis at different stages of  18  pregnancy.16-18 Fetuses with obstructive nephropathy had higher serum levels than those without renal damage (Figure 2.2).  Figure 2.2 Developmental changes of fetal serum β2-microglobulin. Fetal serum β2-microglobulin levels in 12 human fetuses with urinary tract obstruction and renal damage (solid circles) and 3 fetuses without renal damage (open circles) plotted against the reference range obtained from fetuses without urinary tract obstruction (mean ± 95% data intervals) (adapted with permission from John Wiley & Sons Ltd., reference 88).  A fetal serum β2-microglobulin cut-off of 5.6 mg/L had a sensitivity of 80%, a specificity of 98.6%, a positive predictive value of 88.9%, and a negative predictive value of 97.1% for postnatal renal failure.16 Filtered β2-microglobulin undergoes 99.9% degradation by proximal tubular cells. Urinary levels < 6 mg/L are considered “normal” in fetuses with congenital urinary tract obstruction,19 while levels > 13 mg/L which reflect tubular damage, were invariably associated with perinatal death.20 The usefulness of β2microglobulin is, however, limited due to the lack of normative data based on the small 19  numbers of patients, measurements at different stages of gestation, and variable measures of outcome. In addition, fetal blood sampling carries the risks of bleeding, amniotic fluid (AF) leak, infection, and fetal death.  Fetal urinary analytes Like GFR, urinary analyte analysis has also been used in the antenatal evaluation of kidney function. Similar to GFR, tubular function undergoes significant changes during fetal maturation. During early development, the urinary ultrafiltrate is minimally modified by passage through the nephron. With maturation, the tubules and collecting ducts become more efficient in water and electrolyte reabsorption. Based on these physiological observations, Glick et al. reported normal fetal urinary thresholds and correlated these values with autopsy and biopsy findings, and clinical outcome in 20 fetuses with bladder outlet obstruction.21 Fetal urine sodium < 100 mEq/L, chloride < 90 mEq/L, and urine osmolality > 210 mEq/L at a mean gestational age of 23.8 weeks predicted “good outcome”, based on the presence of nondysplastic kidneys at autopsy or biopsy, or normal renal and pulmonary function at birth. Values above or below these thresholds reflected poor tubular function of dysplastic kidneys with presumed altered reabsorption of filtered electrolytes and water. Since this publication, multiple studies of the best predictors of poor outcome based on the composition of fetal urine, including sequential fetal urine sampling, have added little information, correlating only modestly with postnatal renal function.22,23 A recent comprehensive systematic literature review on the accuracy of fetal urine analysis to predict postnatal renal function in cases of congenital lower urinary tract obstruction revealed that there is currently no individual analyte or threshold with significant clinical accuracy.24 The thresholds of the most widely investigated analytes (e.g., sodium, chloride, calcium, osmolality and β220  microglobulin) varied widely among the studies and not all studies correlated these thresholds with gestational age. Fetal urine predictors have also been used to select fetuses for prenatal intervention, but unfortunately have not resulted in improved outcomes.  Prenatal surgical intervention  The aim of prenatal intervention in lower urinary tract obstruction is to relieve obstruction in fetuses that would benefit from such shunting.25 The results of the largest published meta-analysis of the outcomes of pregnancies complicated by urinary tract obstruction and oligohydramnios reported 47% perinatal survival after successful vesicoamniotic shunting. Forty percent of survivors developed ESRD on follow-up.4 Long-term outcome studies show a high prevalence of bladder dysfunction requiring regular catheterization or placement of a vesicostomy, urinary tract infections, and the development of asthma and recurrent respiratory infections due to pulmonary hypoplasia.26 Thus, fetal urinary diversion has not resulted in the anticipated improvement, and outcomes of pregnancies complicated by severe congenital urinary tract obstruction remain poor.  Development of glomerular and tubular function in the human fetus Fetal renal function is not sufficient to balance all the metabolic requirements of the growing organism, nor is it necessary, given the interposition of the placenta and maternal-fetal membranes. Nevertheless, the contribution of fetal kidneys to fluid and  21  electrolyte homeostasis gradually increases as gestation progresses, eventually replacing the placenta at the time of birth.  Development of glomerular filtration  In humans, glomerular filtration begins shortly after 9 weeks gestation, when the first primitive glomeruli appear.27 The GFR shows a slow linear increase reflecting new nephron development before 34 weeks gestation and increases rapidly thereafter with completion of nephrogenesis,28 renal blood redistribution, and engagement of younger cortical nephrons (Figure 2.3). Fetal GFR increases proportionally to the body mass of the fetus.29  With the increase in cardiac output and growth of the renal vascular bed during gestation, renal blood flow also increases.30 The kidneys of the 10 – 20 week gestation human fetus receive about 5% of the cardiac output, compared to 9% in 1-week old term infants and 25% in the adult.31 The intrarenal distribution of blood flow also changes during gestation as a result of a centrifugal pattern of new glomerular development. The hemodynamic evolution of the fetal kidney is thus characterized by a shift from a lowflow, high-resistance organ, with most of the blood supply to the inner cortex, to a highflow, low-resistance organ, with most of the blood flow supplying the outer cortex.32  22  Figure 2.3 Developmental changes of glomerular filtration rate and its relationship to nephrogenesis. The pattern of change in GFR, measured by validated creatinine clearance and persistence of the nephrogenic zone in the renal cortex compared with the conceptional age of the human neonate (adapted with permission from reference 89). Abbreviations: GFR, glomerular filtration rate.  As previously noted, the clinical evaluation of fetal kidney function is elusive and challenging. As fetal GFR increases with fetal weight (Figure 2.4a) and urine output increases with advancing gestation (Figure 2.4b), fetal urinary flow rates have been used as a surrogate marker of fetal GFR and can be calculated from changes in fetal bladder volumes on repeat ultrasound examinations over time.33,34 Glomerular numbers are also proportional to fetal weight (Figure 2.4c). The increase in GFR and fetal urine flow correlate closely with the increase in kidney mass, and thus it is reasonable to assume that a main contributing factor is the addition of new nephrons.35,36  23  Figure 2.4 The relationship between fetal GFR, fetal urine production, and the number of glomeruli in the developing kidney. (a) GFR changes in relation to the kidney mass during gestation (GFR ml/min = 0.5295 + 0.1311 (TKW); r = 0.65) (adapted with permission from Elsevier Ltd., reference 35); (b) Hourly fetal urine production rate across gestation (adapted with permission from Elsevier Ltd., reference 33); (c) Relationship between birth weight and the number of glomeruli in the subcapsular cortex of human kidneys ( males;  females) (adapted with permission from Nature Publishing Group, reference 36). Abbreviations: GFR, glomerular filtration rate; TKW, total kidney weight.  24  AF volume can also be used as a surrogate marker of GFR during the second half of pregnancy. In the early fetal period, most of the AF is produced by the amnion, placenta, and umbilical cord. AF volume increases from approximately 25 ml at 10 weeks gestation to approximately 400 ml at 20 weeks gestation when fetal kidneys become the main source, although the total volume of AF can vary substantially. By 28 weeks gestation, AF volume reaches a plateau of approximately 800 ml until term, with a slight decline post-term.37 Any impairment of fetal kidney function, including urinary tract obstruction, will manifest as oligo/anhydramnios from mid-trimester onwards.  Development of tubular function  Glomerular filtrate is further modified by solute reabsorption and excretion via specific transporters and channels in the tubular epithelia. Maturation of these transporters and channels follows the development of glomerular filtration, and is differentially regulated in the specific segments of the fetal nephron. Tubular handling of the various solutes remains immature in the newborn and matures postnatally.38  Sodium is the most studied fetal urinary predictor of postnatal kidney outcome. Reabsorption of filtered sodium in both proximal and distal tubules increases with progressing gestation. This capacity develops even earlier in the collecting duct, where the final regulation of sodium excretion is achieved.39 Consequently, the fractional excretion of sodium decreases during gestation40 (Figure 2.5).  25  Figure 2.5 Decrease in fractional excretion of sodium during fetal tubular and collecting duct maturation. Fractional excretion of sodium changes during gestation in the human infant (r=0.755, p<0.01) (adapted with permission from John Wiley & Sons, Ltd., reference 40).  Somatic growth of the fetus requires a positive potassium balance.41 Urine potassium excretion is almost entirely derived from its secretion in the distal nephron42 under the influence of aldosterone, with an attenuated response of the immature collecting ducts to this hormone.43 Fractional excretion of potassium is lower in newborns compared to children and adults.  A positive phosphate balance is also essential for rapid fetal growth.44 The ability to reabsorb phosphate is greater in immature and neonatal kidneys compared to adult kidneys,45 a result of a physiologic adaptation to the demands of rapid growth, rather than immaturity of transport systems for phosphate.40  With advancing gestational age, calcium, amino acids, and glucose excretion decrease, while magnesium and organic acid excretion increase, reflecting maturation of solute 26  specific transporters.46-50 To our knowledge, no normative human ontogeny data currently exist, limiting the usefulness of the measurement of these solutes in fetal urine or AF for diagnostic or prognostic purposes.  As mentioned above, multiple studies have investigated β -microglobulin monitoring in 2  fetal urine. Gradual maturation of the capacity to reabsorb and degrade β -microglobulin 2  follows histological maturation of the proximal tubular cells.51 As a result, fractional excretion of β -microglobulin decreases until a plateau is reached at approximately 34 2  weeks gestation52 (Figure 2.6).  Figure 2.6 Decrease in fractional excretion of β2-microglobulin during fetal tubular and collecting duct maturation. Fractional excretion of β -microglobulin in 56 healthy preterm and term infants studied 2  on day 1 (open circles) and day 4 (closed circles) (adapted with permission from Nature Publishing Group, reference 52).  Early fetal urine is hypotonic compared to urine produced later in pregnancy. Fetal kidneys are able to respond to physiologic stimuli by concentrating urine as demonstrated in animal studies53 (Figure 2.7). Maturation of this process reflects 27  increased active sodium reabsorption in the loop of Henle and more efficient recycling of urea in the distal nephron.54-55 Collecting duct cell responsiveness to antidiuretic hormone is present from early gestation. The diluting ability of fetal kidneys is also limited as demonstrated by impaired excretion of water load, with significant improvement by term.56  Figure 2.7 Increase in the concentrating ability during fetal tubular and collecting duct maturation. Relationship between fetal gestational age and fetal urine osmolality during arginine vasopressin infusion in ewes 112 to 142 days of gestation (term 145 days) (y = (4.11xX) - 190.1, r=0.70, p<0.001) (adapted with permission from The American Physiological Society, reference 53).  Premature babies have a propensity for metabolic acidosis.57 The reasons are multiple, including impaired secretion of organic acids, impaired proximal tubular reabsorption of bicarbonate and ammonia production, and reduced availability of titratable acids in fetal urine.58 The distal nephron, in particular the cortical collecting duct, contributes by excretion of hydrogen ions or bicarbonate, mediated by α- and β-intercalated cells, respectively. The absolute numbers and relative percentages of these two types of 28  intercalated cells change with advancing gestation59 with a direct effect on the ability of the fetus to excrete acids at defined gestational ages.  In summary, maturation of most transport mechanisms described above follows the same pattern of an immature state in early gestation reaching full function usually after birth. Tubular and collecting duct maturation lags behind the rapidly increasing GFR. Thus, the second trimester of pregnancy is characterized by a relative state of polyuria and electrolyte wasting because of the poor concentrating ability and reabsorptive capacity of the fetal kidney. With maturation of these functions during the last trimester of pregnancy, fetal urine becomes more concentrated with less electrolyte wasting. However, the process of functional maturation of fetal kidneys is complex, with different transport functions developing at different times in gestation, and lagging behind the development of new glomeruli and blood redistribution in the growing kidney.  Development of glomerular and tubular form in the human fetus  Mature human kidney contains approximately one million nephrons. Nephron numbers progressively increase until completion of nephrogenesis by 36 weeks gestation.60 There is a correlation between birth weight and nephron number, with small babies being at risk of hypertension and kidney impairment in adulthood.61 The process of nephrogenesis is characterized by differentiation of undifferentiated cells into various cell phenotypes under the complex guidance of genes and growth factors in a temporal and spatial fashion.62 This process then determines the form of the developing kidney, its physiology, and its final function. The complexity of nephrogenesis is not reflected in the currently used diagnostic tests of congenital urinary tract obstruction. 29  The effect of congenital urinary tract obstruction on form and function The extent of kidney injury in congenital urinary tract obstruction depends on multiple factors, such as the anatomical site, severity, completeness, and duration of the obstruction. A number of animal models have been developed to help define the histopathology and pathogenesis of congenital urinary tract obstruction.63 These models have demonstrated that early obstruction leads to dysplasia with cystic transformation of the developing nephron, abnormal glomerular development, and medullary hypoplasia, while obstruction later in gestation causes hydronephrosis without dysplastic changes.6468  The nonhuman primate model of obstructive nephropathy69 highlights the characteristic dysplastic changes in the obstructed kidneys, with a significant decrease in glomerular number and nephron endowment, glomerular cyst formation, and significant podocyte loss.63 Alterations evident as early as the S-shape stage of nephron development suggest abnormal nephron induction resulting from ureteric duct obstruction and injury. Tubulointerstitial changes include dilatation of the tubules and collecting ducts, marked expansion of the renal interstitium, and striking formation of the pericystic and periductal fibromuscular collars (Figure 2.8).  30  Figure 2.8 Histological characteristics of nonhuman primate fetal obstructive nephropathy. Obstruction was achieved by the injection of alginate beads into the ureter in the early second trimester.70 (a) Cortex of the obstructed kidney shows multiple subcapsular glomerular cysts surrounded by collars expressing α-smooth muscle actin (brown staining). Nuclei stain purple (hematoxylin) (bar = 100 µm); (b) Dilated medullary collecting ducts show decreased expression of the epithelial protein E-cadherin (red staining), de novo expression of the mesenchymal protein α-smooth muscle actin (green staining) by epithelial cells, and formation of immature, α-smooth muscle actin-positive periductal collars (green staining) (bar = 25 µm); (c) In addition to fibromuscular collar formation, increased deposition of vimentin (blue staining) in the interstitium of obstructed kidney is present (bar = 25 µm).  The role of collecting duct epithelial-mesenchymal transition (EMT) and cell remodeling in the development of interstitial fibrosis has been suggested.70 In the obstructed human fetal kidney, the collecting duct epithelium also undergoes a phenotypic transition, evident early in the process of obstruction, with a loss of epithelial proteins, such as Ecadherin, and a gain of mesenchymal proteins, such as vimentin. These cells also display 31  de novo expression of α-smooth muscle actin associated with, and proportional to, the extent of periductal fibromuscular collar formation. Reduced glomerular endowment and cystic changes of all nephron segments are also prominent (Figure 2.9).  The profound and functionally relevant tubulointerstitial changes of the obstructed fetal mammalian kidney, including epithelial phenotypic transition and fibrosis are not accurately reflected in current prenatal testing of the affected human fetus. It is currently not possible to accurately approximate the number of glomeruli in the kidney at any stage of gestation, or the extent of tubulointerstitial damage caused by obstruction. These are both fundamental in determining postnatal and long-term kidney outcome. There is therefore a need to develop new surrogate markers of structural changes. Some of the putative biomarkers of congenital urinary tract obstruction are described in the next section.  32  Figure 2.9 Histological characteristics of human fetal obstructive nephropathy. (a) Decreased number of glomeruli (g) (red staining – vimentin), dilatation of the collecting ducts (cd) (green staining – cytokeratin) and expansion of the interstitium (int) in the cortex of obstructed 36 week gestation kidney (bar = 100 µm); (b) Collecting duct epithelium of the obstructed 36 week gestation kidney shows the dissociation of epithelial proteins E-cadherin (red staining) and β-catenin (green staining) from the cellular membrane, and their translocation to the nucleus (n) and cytoplasm (c), respectively (bar = 25 µm); (c) Formation of fibromuscular collars expressing α-smooth muscle actin (green staining) surrounding the dilated medullary collecting duct (red staining – E-cadherin; blue staining – DAPI) in the 36 week gestation obstructed kidney (bar = 25 µm); (d) Obstructed 36 week gestation kidney shows de novo expression of mesenchymal protein vimentin (blue staining), disruption of the collagen (red staining) in the ductal basement membrane (arrowhead), and deposition of collagen into the expanded interstitium (asterix) (bar = 25 µm). Abbreviations: DAPI, 4',6-diamidino-2-phenylindole.  33  Developmental kidney injury and lessons learned from acute kidney injury Parallels can be drawn between the injury of the kidneys during fetal development, which we refer to here as developmental kidney injury, and those injured postnatally, referred to as acute kidney injury. The morbidity and mortality of both types of injury remain high despite a better understanding of their pathophysiology. One of the main reasons for poor outcomes is the lack of markers of early injury. The ideal biomarker should be minimally invasive, obtained from easily accessible biological samples, be rapidly measurable by a standardized technique in a routine clinical laboratory, be highly sensitive and specific as a predictive marker, allow stratification of risk, and correlate with postnatal clinical outcomes, such as mortality, dialysis requirement, and morbidity.71-73 The focus of new biomarker discovery has shifted to methods such as genomics or proteomics to identify genes and proteins differentially expressed in a disease of interest compared to healthy controls.  The first step in the search for a conventional, animal model-based biomarker is an understanding of the cellular and molecular events leading to obstructive dysplasia. Animal model studies, as described above, are invaluable in defining processes such as tubular EMT or interstitial fibrosis in the obstructed kidneys. The key players in these events, such as transforming growth factor-β (TGF-β), or epithelial and mesenchymal proteins of EMT can be measured in biological fluids. Illustrative examples of potentially useful biomarkers in congenital urinary tract obstruction include components of reninangiotensin system,74 inflammatory markers, including MCP-175,76 or adhesion molecules, such as intercellular adhesion molecule-1 (ICAM-1).77 Several studies have 34  confirmed the utility of the urinary TGF-β1 measurement as a marker of the severity of renal dysplasia in both upper78-80 and lower81,82 urinary tract obstruction in the postnatal period. However, no studies to date have investigated TGF-β as a prenatal biomarker of renal dysplasia.  The next step is the evaluation of human biological specimens. Clearly, fetal kidney tissue would be considered the best source from the diagnostic yield point of view, and AF from the fetal safety point of view. It is also important to realize that each biological specimen can be divided into separate compartments that contain different proteins. A study of normal adult urine composition showed that of total protein content, approximately 48% was contained in sediments, 49% was soluble, and the remaining 3% was in exosomes.83 Prefractionation of fetal urine or AF to separate components might be useful as a means of enrichment for markers of congenital urinary tract obstruction.84 Urinary exosomes, 40 – 80 nm vesicles of endocytic origin, are a particularly interesting source of biomarkers that might provide unique information about the pathophysiological state of the cells releasing them. Exosomes originate as the internal vesicles from multivesicular bodies and are released to urine by fusion of these bodies with an apical plasma membrane.85 The proteome of urinary exosomes has been characterized and includes hundreds of proteins specific to each type of epithelial cell lining the urinary tract.86 Exosomes can also be recovered from AF which has significant implications for prenatal diagnosis of many diseases, including congenital urinary tract obstruction.87 In the developing obstructed kidney, EMT is an important component of the response to injury and likely an early event. It is characterized by decreased kidney tissue expression of epithelial proteins and an increase in expression of mesenchymal proteins,70 which can be measured in fetal urine and AF. Our preliminary results of AF and urinary exosome 35  proteomics suggest that these biomarkers may correlate with the degree of the tubulointerstitial damage (Figure 2.10).  Figure 2.10 Potential biomarkers of fetal obstructive nephropathy. Human amniotic fluid levels of transforming growth factor-β, carbonic anhydrase-II, aquaporin 2, and E-cadherin measured by Western blot analysis in amniotic fluid obtained from a pregnancy with fetal obstructive nephropathy (gestational age 19 weeks) compared to controls (n=10, gestational age 18 to 22 weeks). In addition to decreased levels of TGF-β, there is a reduction in the expression of CA-II (intercalated cell marker), AQ2 (principal cell marker), and E-cad (nonspecific marker of epithelial cells) as a reflection of the collecting duct epithelial cell injury in the obstructed kidneys. Abbreviations: AQ2, aquaporin 2; CA-II, carbonic anhydrase-II; Ecad, E-cadherin; TGF-β, transforming growth factor-β.  Finally, new biomarkers will need to be correlated with meaningful outcomes in longterm clinical studies, with the integration of new biomarker(s) into clinical practice.84 It is unlikely that any single analyte will have sufficient power to become a “gold standard” test for developmental kidney injury. More likely, multiple urine or AF biomarkers in combination will provide the best accuracy and predictive value.  36  Conclusions The outcome of children with congenital urinary tract obstruction and obstructive renal dysplasia remains poor. One of the main reasons is a lack of predictive prenatal tests that can accurately identify the severity of disease. The focus of new biomarker discovery based on genomic and proteomic techniques may allow the identification of key genes and/or proteins that could potentially be measured in biological fluids, and may reflect the extent of developmental kidney injury. Such new biomarkers will need to be evaluated in human clinical studies requiring multicentre collaboration in order to enroll sufficient numbers of patients, allow long-term follow-up for clinically meaningful outcomes, and ultimately provide confidence in the level of accuracy and prediction of severity of disease.  The essential step in identifying new candidate biomarkers of human congenital obstructive nephropathy is characterization of key molecular events and processes that lead to the development of kidney fibrosis. Proteins identified in the kidney tissue during the pathological process could potentially be excreted by the kidney cells and measured in urine. One of such processes, epithelial-mesenchymal transition of the obstructed collecting duct epithelium, is described in the next chapter.  37  References 1.  Ardissino G, Daccò V, Testa S, Bonaudo R, Claris-Appiani A, Taioli E, Marra G, Edefonti A, Sereni F; ItalKid Project: Epidemiology of chronic renal failure in children: Data from the ItalKid project. Pediatrics 111: e382-387, 2003.  2.  Smith JM, Stablein DM, Munoz R, Hebert D, McDonald RA: The 2006 Annual Report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS). Pediatr Transplant 11: 366-373, 2007.  3.  McDonald SP, Craig JC; Australian and New Zealand Paediatric Nephrology Association. Long-term survival of children with end-stage renal disease. N Engl J Med 350: 2654-2662, 2004.  4.  Coplen DE: Prenatal intervention for hydronephrosis. J Urol 157: 2270-2277, 1997.  5.  Holmes N, Harrison MR, Baskin LS: Fetal surgery for posterior urethral valves: long-term postnatal outcomes. Pediatrics 108: E7, 2001.  6.  McHugo J, Whittle M: Enlarged fetal bladders: aetiology, management and outcome. Prenat Diagn 21: 958-963, 2001.  7.  Winyard P, Chitty L: Dysplastic and polycystic kidneys: diagnosis, associations and management. Prenat Diagn 21: 924-935, 2001.  8.  Vanderheyden T, Kumar S, Fisk NM: Fetal renal impairment. Semin Neonatol 8: 279-289, 2003.  9.  Anumba DO, Scott JE, Plant ND, Robson SC: Diagnosis and outcome of fetal lower urinary tract obstruction in the northern region of England. Prenat Diagn 25: 7-13, 2005.  10. Robyr R, Benachi A, Daikha-Dahmane F, Martinovich J, Dumez Y, Ville Y: Correlation between ultrasound and anatomical findings in fetuses with lower 38  urinary tract obstruction in the first half of pregnancy. Ultrasound Obstet Gynecol 25: 478-482, 2005. 11. Martín C, Darnell A, Durán C, Bermúdez P, Mellado F, Rigol S: Magnetic resonance imaging of the intrauterine fetal genitourinary tract: normal anatomy and pathology. Abdom Imaging 29: 286-302, 2004. 12. Hörmann M, Brugger PC, Balassy C, Witzani L, Prayer D: Fetal MRI of the urinary system. Eur J Radiol 57: 303-311, 2006. 13. Witzani L, Brugger PC, Hörmann M, Kasprian G, Csapone Balassy C, Prayer D: Normal renal development investigated with fetal MRI. Eur J Radiol 57: 294-302, 2006. 14. Bunduki V, Saldanha LB, Sadek L, Miguelez J, Miyadahira S, Zugaib M: Fetal renal biopsies in obstructive uropathy: feasibility and clinical correlationspreliminary results. Prenat Diagn 18: 101-109, 1998. 15. Nava S, Bocconi L, Zuliani G, Kustermann A, Nicolini U: Aspects of fetal physiology from 17 to 37 weeks’ gestation as assessed by blood sampling. Obstet Gynecol 87: 975-980, 1996. 16. Berry SM, Lecolier B, Smith RS, Bercau G, Dombrowski MP, Puder KS, Kithier K, Bidat L, Johnson MP, Cotton DB: Predictive value of serum beta 2-microglobulin for neonatal renal function. Lancet 345: 1277-1278, 1995. 17. Cobet G, Gummelt T, Bollmann R, Tennstedt C, Brux B: Assessment of serum levels of alpha-1-microglobulin and beta-2-microglobulin, and retinol binding protein in the fetal blood. A method for prenatal evaluation of renal function. Prenat Diagn 16: 299-305, 1996.  39  18. Tassis BM, Trespidi L, Tirelli AS, Pace E, Boschetto C, Nicolini U: Serum beta 2microglobulin in fetuses with urinary tract anomalies. Am J Obstet Gynecol 176: 5457,1997. 19. Crombleholme TM, Harrison MR, Golbus MS, Longaker MT, Langer JC, Callen PW, Anderson RL, Goldstein RB, Filly RA: Fetal intervention in obstructive uropathy: prognostic indicators and efficacy of intervention. Am J Obstet Gynecol 162: 1239-1244, 1990. 20. Lipitz S, Ryan G, Samuell C, Haeusler MC, Robson SC, Dhillon HK, Nicolini U, Rodeck CH: Fetal urine analysis for the assessment of renal function in obstructive uropathy. Am J Obstet Gynecol 168: 174-179, 1993. 21. Glick PL, Harrison MR, Golbus MS, Adzick NS, Filly RA, Callen PW, Mahony BS, Anderson RL, deLorimierAA: Management of the fetus with congenital hydronephrosis II: Prognostic criteria and selection for treatment. J Pediatr Surg 20: 376-387, 1985. 22. Miguelez J, Bunduki V, Yoshizaki CT, SadekLdos S, Koch V, Peralta CF, Zugaib M: Fetal obstructive uropathy: is urine sampling useful for prenatal counseling? Prenat Diagn 26: 81-84, 2006. 23. Johnson MP, Corsi P, Bradfield W, Hume RF, Smith C, Flake AW, Qureshi F, Evans MI: Sequential urinalysis improves evaluation of fetal renal function in obstructive uropathy. Am J Obstet Gynecol 173: 59-65, 1995. 24. Morris RK, Quinlan-Jones E, Kilby MD, Khan KS: Systematic review of accuracy of fetal urine analysis to predict poor postnatal renal function in cases of congenital urinary tract obstruction. Prenat Diagn 27: 900-911, 2007. 25. Agarwal SK, Fisk NM: In utero therapy for fetal urinary tract obstruction. Prenat Diagn 21: 970-976, 2001. 40  26. Biard JM, Johnson MP, Carr MC, Wilson RD, Hedrick HL, Pavlock C, Adzick NS: Long-term outcomes in children treated by prenatal vesicoamniotic shunting for lower urinary tract obstruction. Obstet Gynecol 106: 503-508, 2005. 27. Gersh I: The correlation of structure and function in the developing mesonephros and metanephros. Contrib Embryol 153: 35-58, 1937. 28. Arant BS Jr: Developmental patterns of renal functional maturation compared in the human neonate. J Pediatr 92: 705-712, 1978. 29. Hill KJ, Lumbers ER: Renal function in adult and fetal sheep. J Dev Physiol 10: 149-159, 1988. 30. Veille JC, Hanson RA, Tatum K, Kelley K: Quantitative assessment of human fetal renal blood flow. Am J Obstet Gynecol 169: 1399-1402, 1993. 31. Rudolph AM, Heymann MA: The fetal circulation. Annu Rev Med 19: 195-206, 1968. 32. Satlin LM, Woda CB, Schwartz GJ: Development of function in the metanephric kidney. In The Kidney: From normal development to congenital disease, edited by Vize PD, Woolf AS, Bard JBL, Academic Press, London, 2003, pp 267-325. 33. Rabinowitz R, Peters MT, Vyas S, Campbell S, Nicolaides KH: Measurement of fetal urine production in normal pregnancy by real-time ultrasonography. Am J Obstet Gynecol 161: 1264-1266, 1989. 34. Hedriana HL: Ultrasound measurement of fetal urine flow. Clin Obstet Gynecol 40: 337-351, 1997. 35. Robillard JE, Kulvinskas C, Sessions C, Burmeister L, Smith FG: Maturational changes in the fetal glomerular filtration rate. Am J Obstet Gynecol 122: 601-606, 1975.  41  36. Mañalich R, Reyes L, Herrera M, Melendi C, Fundora I: Relationship between weight at birth and the number and size of renal glomeruli in humans: a histomorphometric study. Kidney Int 58: 770-773, 2000. 37. Underwood MA, Gilbert WM, Sherman MP: Amniotic fluid: not just fetal urine anymore. J Perinatol 25: 341-348, 2005. 38. Jones DP, Chesney RW: Development of tubular function. Clin Perinatol 19: 33-57, 1992. 39. Aperia A, Elinder G: Distal tubular sodium reabsorption in the developing rat kidney. Am J Physiol 240: F487-491, 1981. 40. Siegel SR, Oh W: Renal function as a marker of human fetal maturation. Acta Paediatr Scand 65: 481-485, 1976. 41. Satlin LM: Maturation of renal potassium transport. Ped Nephrol 5: 260-269, 1991. 42. Giebisch G: Renal potassium channels: function, regulation and structure. Kidney Int 60: 436-445, 2001. 43. Stephenson G, Hammet M, Hadaway G, Funder JW: Ontogeny of renal mineralocorticoid receptors and urinary electrolyte responses in the rat. Am J Physiol 247: F665-671, 1984. 44. Hohenauer L, Rosenberg TF, Oh W: Calcium and phosphorus homeostasis on the first day of life. Biol Neonate 15: 49-56, 1970. 45. Kaskel FJ, Kumar AM, Feld LG, Spitzer A: Renal reabsorption of phosphate during development: tubular events. Ped Nephrol 2: 129-134, 1988. 46. Wittner MC, Desfleurs E, Pajaud S, Moine G, Simeone S, de Rouffignac C, Di Stefano A: Calcium and magnesium transport in the cortical thick ascending limb of Henle’s loop: influence of age and gender. Pflugers Arch 434: 451-456, 1997.  42  47. Brodehl J, Gellissen K: Endogenous renal transport of free amino acids in infancy and childhood. Pediatrics 42: 395-404, 1968. 48. Robillard JE, Sessions C, Kennedy RL, Smith FG: Maturation of the glucose transport process by the fetal kidney. Pediatr Res 12: 680-684, 1978. 49. Horster M, Lewy JE: Filtration fraction and extraction of PAH during neonatal period in the rat. Am J Physiol 219: 1061-1065, 1970. 50. Lelievre-Pegorier M, Merlet-Benichou C, Roinel N, de Rouffignac C: Developmental pattern of water and electrolyte transport in rat superficial nephrons. Am J Physiol 245: F15-21, 1983. 51. Schaeverbeke J, Cheignon M: Differentiation of the glomerular filter and tubular reabsorption apparatus during foetal development of the rat kidney. J Embryol Exp Morphol 58: 157-175, 1980. 52. Assadi FK, John EG, Justice P, Fornell L: Beta-2-microglobulin clearance in neonates: index of tubular maturation. Kidney Int 28: 153-157, 1985. 53. Robillard JE, Weitzman RE: Developmental aspects of the fetal renal response to exogenous arginine vasopressin. Am J Physiol 238: F407-414, 1980. 54. Calcagno PL, Rubin MI, Weintraub DH: Studies on the renal concentrating and diluting mechanisms in the premature infant. J Clin Invest 33: 91-96, 1954. 55. Rane S, Aperia A, Eneroth P, Lundin S: Development of urinary concentrating capacity in weaning rats. Pediatr Res 19: 472-475, 1985. 56. Aperia A, Broberger O, Herin P, Thodenius K, Zetterström R: Postnatal control of water and electrolyte homeostasis in pre-term and full-term infants. Acta Paediatr Scand Suppl 305: 61-65, 1983.  43  57. Edelmann CM, Soriano JR, Boichis H, Gruskin AB, Acosta MI: Renal bicarbonate reabsorption and hydrogen ion excretion in normal infants. J Clin Invest 46: 13091317, 1967. 58. Sulyok E, Varga F: Relationship of fetal renal threshold for bicarbonate reabsorption to urinary sodium excretion in premature infants. Acta Paediatr Acad Sci Hung 19: 281-284, 1978. 59. Hiatt MJ, Ivanova L, Toran N, Tarantal AF, Matsell DG: Remodeling of the fetal collecting duct epithelium. Am J Pathol 176: 630-7, 2010. 60. Saxén L: In Organogenesis of the kidney, edited by Saxén L, Harvard Univ Press, Cambridge, 1987. 61. Hughson M, Farris AB 3rd, Douglas-Denton R, Hoy WE, Bertram JF; Glomerular number and size in autopsy kidneys: the relationship to birth weight. Kidney Int 63: 2113-2122, 2003. 62. Dressler GR: The cellular basis of kidney development. Annu Rev Cell Dev Biol 22: 509-529, 2006. 63. Matsell DG, Tarantal AF: Experimental models of fetal obstructive nephropathy. Pediatr Nephrol 17: 470-476, 2002. 64. Beck AD: The effect of intra-uterine urinary obstruction upon the development of the fetal kidney. J Urol 105: 784-789, 1971. 65. Harrison MR, Nakayama DK, Noall R, de Lorimier AA: Correction of congenital hydronephrosis in utero II. Decompression reverses the effects of obstruction on the fetal lung and urinary tract. J Pediatr Surg 17: 965-974, 1982. 66. Peters CA, Carr MC, Lais A, Retik AB, Mandell B: The response of the fetal kidney to obstruction. J Urol 148: 503-509, 1992.  44  67. Josephson S, Robertson B, Rodensjö M: Effects of experimental obstructive hydronephrosis on the immature nephrons in newborn rats. Urol Int 44: 61-65, 1989. 68. Chevalier RL: Molecular and cellular pathophysiology of obstructive nephropathy. Pediatr Nephrol 13: 612-619, 1999. 69. Tarantal AF, Han VK, Chochrum KC, Mok A, daSilva M, Matsell DG: Fetal rhesus monkey model of obstructive renal dysplasia. Kidney Int 59: 446-456, 2001. 70. Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007. 71. Nguyen MT, Devarajan P: Biomarkers for the early detection of acute kidney injury. Pediatr Nephrol 23: 2151-2157, 2008. 72. Zhou H, Hewitt SM, Yuen PS, Star RA: Acute kidney injury biomarkers – needs, present status, and future promise. Nephrol Self Assess Program 5: 63-71, 2006. 73. Han WK, Bonventre JV: Biologic markers for the early detection of acute kidney injury. Curr Opin Crit Care 10: 476-482, 2004. 74. Fern RJ, Yesko CM, Thornhill BA, Kim, HS, Smithies O, Chevalier RL: Reduced angiotensinogen expression attenuates renal interstitial fibrosis in obstructive nephropathy in mice. J Clin Invest 103: 39-46, 1999. 75. Chevalier RL: Obstructive nephropathy: towards biomarker discovery and gene therapy. Nat. Clin Pract Nephrol 2: 157-168, 2006. 76. Grandaliano G, Gesualdo L, Bartoli F, Ranieri E, Monno R, Leggio A, Paradies G, Caldarulo E, Infante B, Schena EP: MCP-1 and EGF renal expression and urine excretion in human congenital obstructive nephropathy. Kidney Int 58: 182-192, 2000.  45  77. Shappell SB, Mendoza LH, Gurpinar T, Smith CW, Suki WN, Truong LD: Expression of adhesion molecules in kidney with experimental chronic obstructive uropathy: the pathogenic role of ICAM-1 and VCAM-1. Nephron 85: 156-166, 2000. 78. Yang SP, Woolf AS, Yuan HT, Scott RJ, Risdon RA, O’Hare MJ, Winyard PJ: Potential biological role of transforming growth factor-beta1 in human congenital kidney malformations. Am J Pathol 157: 1633-1647, 2000. 79. Furness PD 3rd, Maizels M, Han SW, Cohn RA, Cheng EY: Elevated bladder urine concentration of transforming growth factor-beta1 correlates with upper urinary tract obstruction in children. J Urol 162: 1033-1036, 1999. 80. El-Sherbiny MT, Mousa OM, Shokeir AA, Ghoneim MA: Role of urinary transforming growth factor-beta1 concentration in the diagnosis of upper urinary tract obstruction in children. J Urol 168: 1798-1800, 2002. 81. Palmer LS, Maizels M, Kaplan WE, Firlit CF, Cheng EY: Urine levels of transforming growth factor-beta1 in children with ureteropelvic junction obstruction. Urology 50: 769-773, 1997. 82. MacRae Dell K, Hoffman BB, Leonard MB, Ziyadeh FN, Schulman SL: Increased urinary transforming growth factor-beta (1) excretion in children with posterior urethral valves. Urology 56: 311-314, 2000. 83. Zhou H, Yuen PS, Pisitkun T, Gonzales PA, Yasuda H, Dear JW, Gross P, Knepper MA, Star RA: Collection, storage, preservation, and normalization of human urinary exosomes for biomarker discovery. Kidney Int 69: 1471-1476, 2006. 84. Pisitkun T, Johnstone R, Knepper MA: Discovery of urinary biomarkers. Mol Cell Proteomics 5: 1760-1771, 2006.  46  85. Gonzales P, Pisitkun T, Knepper MA: Urinary exosomes: is there a future? Nephrol Dial Transplant 23: 1799-1801, 2008. 86. Pisitkun T, Shen RF, Knepper MA: Identification and proteomic profiling of exosomes in human urine. Proc Natl Acad Sci USA 101: 13368-13373, 2004. 87. Keller S, Rupp S, Stoeck A, Runz S, Fogel M, Lugert S, Hager HD, Abdel-Bakky MS, Gutwein P, Altevogt P: CD24 is a marker of exosomes secreted into urine and amniotic fluid. Kidney Int 72: 1095-1102, 2007. 88. Nicolini U, Spelzini F: Invasive assessment of fetal renal abnormalities: urinalysis, fetal blood sampling and biopsy. Prenat Diagn 21: 964-969, 2001. 89. Arant BS Jr: Neonatal adjustments to extrauterine life. In Pediatric Kidney Disease (vol 1), edited by Edelmann CM Jr, Little, Brown and Co., Boston, 1992, p 1021.  47  CHAPTER 3  PHENOTYPIC TRANSITION OF THE COLLECTING DUCT EPITHELIUM IN CONGENITAL URINARY TRACT OBSTRUCTION2  Introduction Injury to the epithelium in a number of human disease states causes epithelial cells to acquire mesenchymal characteristics through the process of epithelial-mesenchymal transition (EMT), and in congenital urinary tract obstruction this contributes to the characteristic tubulointerstitial disease.1-6 The hallmark of renal dysplasia is the accumulation of extracellular matrix in the interstitium leading to fibrosis. The injured epithelium plays an important role in this process.  We have previously studied the pathogenesis of renal dysplasia in a nonhuman primate model of obstructive nephropathy7,8 and highlighted significant histopathological changes in the renal medullary interstitium, including dilatation of the collecting ducts (CDs), and disruption of the CD epithelium. We have also defined features suggestive of CD EMT in this experimental animal model with loss of the normal epithelial phenotype, gain of a mesenchymal phenotype, disruption of the tubular epithelial basement 2  A version of this chapter has been published. Trnka P, Hiatt MJ, Ivanova L, Tarantal AF, Matsell DG: Phenotypic transition of the collecting duct epithelium in congenital urinary tract obstruction. J Biomed Biotechnol 2010: 696034, 2010.  48  membrane, and migration of the transformed cells into the interstitium.9 There are no published human studies on the role of CD epithelial cell EMT in congenital obstructive nephropathy.  The aim of this study was to test the hypothesis that congenital urinary tract obstruction in humans results in CD epithelial cell injury and transition to a mesenchymal phenotype, and that these transformed cells contribute to interstitial fibrosis.  Materials and Methods Tissue Samples: Specimens from obstructed and normal human fetal and postnatal kidneys were studied (total n=17). Obstructed kidney samples were obtained from aborted fetuses in the second (18 weeks gestation, n=2) and third trimesters (36 weeks gestation, n=3), and postnatal ages (16 and 24 months, n=2). Controls consisted of kidney samples from fetuses in the late first trimester (10 weeks, n=1), second trimester (15, 18 and 26 weeks, n=6), and third trimester (27 and 36 weeks gestation, n=2), and 12 months postnatal age (n=1) (Figure 3.1). In all cases fetuses had no other noted anomalies. Control kidney samples were obtained from aborted fetuses and children that died from causes unrelated to renal disease. All samples were collected in accordance with the ethical guidelines of the University of British Columbia, and all performed analyses were approved by the Ethics Committee of the University of British Columbia.  49  Figure 3.1 Gestational and postnatal ages of obstructed and control kidney tissue samples.  Tissue Processing: After collection, kidney samples were sectioned transversely and sagitally then immediately fixed in 4% paraformaldehyde overnight, and dehydrated through graded ethanol before transfer to toluene. Sections of paraffin-embedded tissue were cut with a microtome (5 – 10 µm), mounted on Superfrost slides (VWR), and baked overnight at 55ºC. Sections were then cooled to room temperature and stored with desiccant. Samples for quantitative real-time PCR were snap frozen in liquid nitrogen and stored at ≤- 80°C.  Immunofluorescent Histochemistry: Tissue sections were deparaffinized in xylene and rehydrated by passage through graded ethanol. For light microscopy, sections were stained with hematoxylin for 2 minutes and eosin for 40 seconds. For immunohistochemistry, slides were subjected to 40 minutes of heat-induced epitope retrieval in 10 mM citrate buffer (pH 6-6.5). Sections were subsequently cooled to room 50  temperature and blocked for 1 hour with 2% goat or donkey serum. Following blocking, excess buffer was removed from the sections and replaced with diluted primary antibodies in staining buffer for incubation overnight at 4ºC. Sections were then incubated for 1 hour with fluorescently conjugated secondary antibodies at room temperature. Nuclei were also stained for 5 minutes with DAPI dilactate (1:36, Invitrogen) prior to mounting with Prolong Gold mounting media with antifade (Invitrogen). Analysis of tissue staining was performed on a Leica epifluorescence microscope (Wetzlar, Germany) using images captured with a Retiga 1300i camera (QImaging, Canada) and processed with OpenLab imaging software (Improvision, MA, USA). Primary antibodies and their dilutions were as follows: anti-cytokeratin (DakoCytomation, Carpinteria, CA), anti-E-cadherin (BD Transduction Laboratories, San Diego, CA), anti-β-catenin (Cell Signaling Technology Danvers, MA), anti-αsmooth muscle actin, anti-collagen IV (Fitzgerald Industries International Inc., Concord, MA), and anti-vimentin (Sigma-Aldrich, Saint Louis, MO) (all diluted 1:100). Secondary antibodies included goat anti-mouse Alexa488, goat anti-rabbit Alexa568, and donkey anti-goat Alexa568 (Invitrogen Canada Inc., Canada) (all diluted 1:400). For correlation between the degree of obstruction, and periductal α-SMA and CD epithelial vimentin expression, we measured the areas of the CD dilatation, the areas of α-SMA in periductal collars, and the areas of the CD cells expressing vimentin (all expressed in mm2) in obstructed fetal and postnatal kidneys (n=3) using the OpenLab imaging software. The relationship between measured areas was expressed as a scatter plot with trendlines using Microsoft Excel 2008 for Mac.  Real-time PCR: Real-time PCR analysis was performed on total RNA extracted from normal kidneys at 10 weeks gestation (n=1), 15 weeks gestation (n=2), and 18 weeks 51  gestation (n=1), and obstructed kidneys at 18 weeks gestation (n=2) and 36 weeks gestation (n=1). Total RNA was isolated from the whole kidneys using RNeasy Mini Kit protocol (Qiagen Inc., Mississauga, ON, Canada) with RNA-free DNase treatment before treatment with PowerScript reverse transcriptase (BD Biosciences, San Jose, CA). Predesigned TaqMan Gene Expression Assays were used for the following target genes: E-cadherin (Hs01013953_m1), N-cadherin (Hs00983062_m1), α-catenin (Hs00426996_m1), β-catenin (Hs00355045_m1), vimentin (Hs00958116_m1), alpha-3 chain of type IV collagen (Hs01022542_m1), alpha-4 chain of type IV collagen (Hs01011885_m1), α-smooth muscle actin (Hs00559403_m1), and cyclophilin A (Hs99999904_m1) (Applied Biosystems, Foster City, CA). All samples were amplified in triplicate on ABI Prism 7000 Sequence Detection System using TaqMan Universal PCR MasterMix (Applied Biosystems, Foster City, CA). Optimization and relative quantification were done using the prevalidated comparative CT method. Normalization of RNA quantity between samples was accounted for using the expression of the housekeeping gene cyclophilin A. The fold change of each gene between samples was determined relative to control kidney at 18 weeks gestation.  Results Histological features of human congenital obstructive dysplasia  Congenital urinary tract obstruction was associated with abnormal ureteric bud branching and defective metanephric mesenchyme induction with subsequent abnormal collecting duct, tubular, and glomerular development (Figure 3.2). All obstructed developing kidneys showed focal areas of dysplastic and cystic changes. Multiple glomerular cysts 52  were identified in both the cortex and the medulla, whereas cystic dilatation of the renal tubules and CDs were seen predominantly in the medulla (Figure 3.2 B,D). The most pronounced dysplastic changes were seen in the medullary regions of the obstructed kidneys where some areas showed complete loss of normal structure with dilated CDs surrounded by thick mesenchymal collars. Other histopathological features of dysplasia included decreased glomerular endowment, reduced number of CDs, and medullary hypoplasia with interstitial expansion and interstitial fibrosis. The most dilated CDs were lined with a flattened epithelium (Figure 3.2). These changes were present from early gestation and persisted postnatally.  53  Figure 3.2 Histological features of human fetal obstructive nephropathy. Obstructed 18 weeks gestation kidney shows disorganized cortical architecture with multiple glomerular cysts (c), decreased glomerular (g) endowment (B and F) and reduced number and dilation of the collecting ducts (cd) in the hypoplastic medulla (D and H). Cortex (A and E) and medulla (C and G) of a normal 18 week gestation kidney. A-D: hematoxylin and eosin stain; E-H immunofluorescence histochemistry: green = cytokeratin, red = vimentin. Scale bar = 100 µm.  54  Loss of epithelial phenotype in the obstructed collecting duct  The expression of the cytoskeletal proteins E-cadherin and β-catenin were studied in normal and obstructed human fetal kidneys. These proteins are important in normal development of the kidney epithelium10 and are responsible for the maintenance of cell polarity, cell-cell adhesion, and epithelial integrity.11 In the normal human CD epithelium, E-cadherin and β-catenin were expressed early in gestation. Developmentally younger kidneys had more pronounced cytoplasmic expression of both proteins (Figure 3.3 A, inset), whereas kidneys from mid to late gestation and postnatal kidneys showed co-localization of E-cadherin and β-catenin at the intercellular junctions of adjacent CD epithelial cells (Figure 3.3 B,C). In the obstructed kidneys, the disruption of E-cadherinβ-catenin co-localization was noted, as well as a loss of E-cadherin and β-catenin from the cellular membranes, and the translocation of these proteins into the cytoplasm, with E-cadherin identified in the nucleus of the injured CD epithelial cells (Figure 3.3 D,E,F).  55  Figure 3.3 E-cadherin and β-catenin immunoreactivity (IR). Normal kidneys (A-C). (A) In the early gestation kidney (10 weeks), E-cadherin-IR (red) and β-catenin-IR (green) are localized in the cytoplasm (arrows). (B) Co-localization of E-cadherin-IR and β-catenin-IR (yellow) to the intercellular junctions is well established by late gestation (27 weeks) (arrows), and (C) persists in the normal postnatal (12 months) kidney (arrow). Obstructed kidneys (D-F). (D) Disruption of E-cadherin-IR and β-catenin-IR colocalization at the intercellular junctions, with translocation of β-catenin-IR to the cytoplasm (green) and of E-cadherin-IR to the nucleus (red) (arrows in inset) in the mid gestation kidney (18 weeks), (E) late gestation kidney (36 weeks), and (F) postnatally (16 months kidney). Scale bar = 25 µm.  56  Gain of mesenchymal phenotype in the obstructed collecting duct  Injured epithelial cells undergoing EMT express mesenchymal markers, including fibroblast-specific protein-1, α-smooth muscle actin (α-SMA) and vimentin.12 We have previously demonstrated de novo α-SMA expression in CD epithelial cells in the obstructed nonhuman primate.9 These cells contribute to the development of immature mesenchymal collars surrounding the dilated ducts. In the human fetal kidneys examined in this study, the normal CD epithelium did not express α-SMA at any stage of gestation or postnatally (Figure 3.4 A, B, C). However, we observed de novo α-SMA expression in the obstructed epithelium at mid gestation, but not later in gestation or postnatally (Figure 3.4 D). Mid gestation obstructed kidneys developed peritubular circumferential cellular collars expressing α-SMA (Figure 3.4 E), becoming more pronounced as gestation progressed (Figure 3.4 F). The most extensive collars were observed in the inner medulla of postnatal kidneys and also in the most severely obstructed fetal kidneys (Figure 3.4 F). The severity of periductular tubular collar formation correlated with the extent of epithelial injury and the severity of the obstruction.  57  Figure 3.4 E-cadherin and α-smooth muscle actin immunoreactivity. Normal kidneys (A-C). In the normal mid gestation (18 weeks) (A), late gestation (27 weeks) (B), and postnatal (12 months) (C) kidneys, α-smooth muscle actin (α-SMA)-IR (green) was absent in the CD epithelium, however intercellular localization of E-cadherin-IR (red) was well-established from mid gestation onwards (arrows). Obstructed kidneys (D-F). Circumferential collars expressing α-SMA-IR (green) are present in the (D) mid gestation (18 weeks), (E) late gestation (36 weeks), and (F) postnatal (16 months) kidneys (arrows). De novo expression of α-SMA-IR in the obstructed CD epithelium is present at 18 weeks gestation (D inset, arrowhead) but not in the late gestation (E) or postnatal (F) kidneys. As in Figure 3.3, E-cadherin expression (red) is disrupted, with translocation from the cell membrane to cytoplasm (D-F) and to the nucleus (E inset, arrowhead). Scale bar = 25 µm.  58  Vimentin, a member of the intermediate filament family of proteins, offers flexibility to the cell while maintaining cell shape and cytoskeletal integrity.13 Under normal circumstances, differentiated epithelial cells do not express appreciable amounts of vimentin, whereas expression of this protein is a characteristic feature of myofibroblasts. In normal fetal kidneys, interstitial cells expressed vimentin, which was most pronounced in younger gestation kidneys, decreasing in later gestation, and almost absent in postnatal kidneys (Figure 3.5 A,B,C). As expected, normal CD epithelial cells did not express vimentin. However, obstructed CD epithelial cells showed a very pronounced de novo expression of vimentin that correlated with the severity and the duration of the obstruction, increasing from mid to late gestation and postnatally (Figure 3.5 D,E,F). Additionally, obstructed fetal kidneys developed an expanded interstitium, which expressed abundant vimentin, compared to normal kidneys of similar gestation. This was more pronounced in younger kidneys.  59  Figure 3.5 Vimentin and collagen IV immunoreactivity. Normal kidneys (A-C). (A) Interstitial expression of vimentin-IR (blue) (arrow) and diffuse cytoplasmic expression of collagen IV (ColIV)-IR (red) (arrowhead) are present in the mid gestation (18 weeks) kidney. (B) Thin, regular, well-defined expression of ColIV-IR in the CD basement membranes (arrows) is well established by late gestation (27 weeks), and (C) persists postnatally (12 months) (arrows). Obstructed kidneys (D-F). (D) De novo basolateral expression of vimentin-IR (blue) (arrow) in the CD epithelium of the obstructed 18 weeks gestation kidney. (E) More pronounced vimentin-IR expression (arrowheads) and disruption of ColIV-IR expression (red) (arrows) in the CD basement membrane of the late gestation (36 weeks) obstructed CD epithelium, and (F) in the obstructed postnatal (16 months) kidneys. Deposition of ColIV-IR in the expanded interstitium (asterisk), and in the periductal collars (plus) is also present. Scale bar = 25 µm.  60  Disruption of the basement membrane of the obstructed collecting duct  Type IV collagen (ColIV) is a major structural component of all basement membranes, including the CD basement membrane. ColIV molecules are synthesized by the cells attached to the basement membrane and are subsequently incorporated into the membrane itself.14 In EMT, the disruption of basement membranes is necessary to allow the migration of the transformed tubular epithelial cells.3 In this study, the CD epithelium of normal kidneys expressed cytoplasmic ColIV diffusely at mid gestation and apically at late gestation (Figure 3.5 A,B). There was no epithelial expression of ColIV in normal postnatal kidneys (Figure 3.5 C). Notably, and as expected, all normal fetal and postnatal kidneys expressed ColIV in the CD basement membranes in a thin, regular, and welldefined pattern (Figure 3.5 A,B,C). In addition to an increase in apical epithelial cell expression of ColIV, obstructed kidneys demonstrated a marked disruption of the CD basement membrane, characterized by thickening, attenuation, and loss of ColIV expression (Figure 3.5 D,E,F). Interestingly, the expanded interstitium of the obstructed fetal and postnatal kidneys expressed an abundance of ColIV, most pronounced in the immature mesenchymal collars surrounding the most dilated CDs, particularly in the inner medulla of postnatal kidneys, suggesting a correlation with the severity and duration of the obstruction (Figure 3.5 F).  To show the relationship between the severity of obstruction and the extent of phenotypic transition of the CD epithelium, we correlated CD dilatation (as a marker of severity of obstruction) with the expression of α-SMA in periductal collars and of vimentin by the CD cells (as markers of epithelial injury). CD dilatation correlated with periductal αSMA expression and with CD epithelial cell vimentin expression (Figure 3.6). 61  Figure 3.6 Correlation of the severity of CD dilatation with periductal collar formation and with CD epithelial vimentin expression. The relationship between CD dilatation (x-axis), and the areas of periductal collars expressing α-SMA (A) and of CD epithelium expressing vimentin (B) (y-axis) is shown. Measurements were performed in obstructed fetal (36 weeks gestation) and postnatal (16 months) kidneys (n=3). All areas are expressed in mm2.  62  Gene expression in obstructed fetal kidneys  Quantitative real-time PCR analysis was performed for genes encoding epithelial and mesenchymal proteins of interest on total RNA samples obtained from normal (early to mid gestation) and obstructed (mid to late gestation) whole kidneys. First, we studied normal changes in gene expression with advancing gestation. Among genes encoding epithelial proteins, E-cadherin mRNA expression increased in the 18 versus 10 weeks gestation kidneys, with little change in α-catenin, β-catenin, and N-cadherin expression (Figure 3.7A). For genes encoding mesenchymal proteins, vimentin, alpha-3 and alpha-4 chains of ColIV and α-SMA were all increased in the normal 18 weeks compared to 10 weeks gestation kidney (Figure 3.7 A).  We next studied changes in the mRNA expression of genes encoding epithelial and mesenchymal proteins in mid (18 weeks) and late gestation (36 weeks) obstructed kidneys, using the 18-week gestation normal kidney as the reference control value. Of the genes encoding epithelial proteins, N-cad expression decreased in the late gestation obstructed kidney, while α-catenin and β-catenin mRNA increased (Figure 3.7 B). For genes encoding mesenchymal proteins, vimentin mRNA expression increased with severe obstruction at 18 and 36 weeks gestation, while mRNAs for alpha-3, alpha-4 chains of ColIV and for α-SMA were markedly increased in the severely obstructed 36week gestation kidney when compared to the control normal 18 week kidney (Figure 3.7 B).  63  Figure 3.7 Gene expression in normal and obstructed fetal kidneys. (A) Quantitative PCR analysis of total RNA extracted from 10, 15, and 18 weeks gestation normal kidneys, for genes encoding epithelialspecific (E-cad, N-cad, α-cat, and β-cat) and mesenchymal-specific (vimentin, ColIVa3, ColIVa5 and αSMA) proteins. Values are expressed as fold change in mRNA expression compared to the normal 10 weeks gestation kidney as reference. (B) Quantitative PCR analysis of total RNA extracted from obstructed kidneys at 18 weeks gestation (mild and severe) and 36 weeks gestation (severe), and from 18 weeks normal kidney. Values are expressed as fold change in mRNA expression compared to the normal 18 weeks gestation kidney as reference.  64  Discussion Epithelial-mesenchymal transition (EMT) and the reciprocal mesenchymal-epithelial transition (MET) are central mechanisms in the development of specialized cells, tissues and organs from a small variety of pluripotent cells in the embryo.1,15 Experimental evidence that has accumulated over the last decade supports the role of EMT in the pathogenesis of many diseases including cancer progression and metastasis16 and tissue fibrosis associated with interstitial lung,17,18 liver,19 and kidney disease.3,4,6 The role of EMT has been demonstrated in animal and human studies of postnatal kidney disease, including acquired obstructive nephropathy,20 but there are few data regarding congenital urinary tract obstruction.  Many experimental models of obstructive nephropathy have been developed.21 These have provided clues to the pathogenesis and pathology of this disease. However, there are some important differences between the human congenital forms of obstruction and experimental models. In human congenital urinary tract obstruction the timing of obstruction is often early during in utero nephrogenesis as opposed to experimental models, such as the sheep and monkey models, which are mid to late gestation. The bestdescribed models of ureteric obstruction, the mouse and rat, are, in fact, postnatal models. In addition the severity of obstruction differs. Congenital obstruction can be variable, from severe and complete to mild and partial obstruction. Most experimental models are more controlled and therefore reproducible. Consequently, the histopathology of the human forms of congenital obstruction can be variable (partly due to uncontrollable variability of the timing and severity of obstruction and partly to the inherent bias of the availability of tissue) but given the early onset of obstruction, it is 65  often more severe than that of the experimental forms of postnatal obstruction, particularly the postnatal rodent models, as reflected in the severity of architectural disruption and reduction in glomerular number. There are, however, many histological features shared between both types of obstruction, most notably human congenital obstruction and in utero models of obstruction such as the sheep and monkey models. These features include extensive reductions in nephron endowment, alterations of tubular and collecting duct development, collecting duct injury, mesenchymal expansion and interstitial fibrosis.  This report, to our knowledge, is the first description of the phenotypic transition of the obstructed CD epithelium in the human fetus. We have previously described EMT of the obstructed CD epithelium in a nonhuman primate model of obstructive nephropathy.9 Similar to the obstructed fetal monkey kidney, the major histological findings in the obstructed human fetal kidney were cystic and dysplastic changes particularly in the medulla, with marked dilatation of the CDs lined by a flattened epithelium. We also demonstrated many of the prerequisite features of CD EMT, including the loss of the cytoskeletal proteins E-cadherin and β-catenin from cell membranes and intercellular junctions, their translocation into the cytoplasm and nucleus of the obstructed cells, de novo expression of the myoepithelial proteins vimentin and α-SMA, and disruption of the obstructed CD epithelial basement membrane. As documented by immunohistochemistry in this study, from early gestation, CD cells express epithelial markers (E-cadherin, βcatenin) in an intercellular distribution typical of a differentiated epithelium with minimal expression of mesenchymal proteins, such as vimentin and α-smooth muscle actin. These findings confirm that the cells have undergone MET. The loss of normal distribution of epithelial markers and de novo expression of mesenchymal proteins by 66  CD cells in obstructed kidneys imply that obstruction reverses this process. While these findings may not be inclusive of all features of EMT, they do represent a transition to a more mesenchymal phenotype. Our findings would suggest that this transition can occur in cells that have not terminally differentiated. We have also shown that CD dilatation correlated with periductal α-SMA expression and with CD epithelial cell vimentin expression. While we were able to demonstrate a clear correlation in the most severely affected areas, it is important to note that the histopathology and injury in congenital obstructive nephropathy can be variable and focal. We observed areas of severe dysplastic changes alternating with areas of nearly normal histology within the same obstructed kidney. It is therefore very difficult to assign any grading to the whole kidney.  The results of real-time PCR analysis show a marked increase in genes encoding mesenchymal proteins and minimal changes in genes encoding epithelial proteins in obstructed kidneys. It should be noted that we used total RNA extracted from whole kidneys for these experiments. CD epithelial RNA constitutes only a small fraction of the whole kidney RNA. The increase in genes encoding mesenchymal proteins likely reflects mesenchymal expansion and the formation of periductal collars, measures of whole kidney fibrosis, with only a small contribution from the dilated CD epithelial RNA. While the whole kidney fibrosis may be independent of the parallel changes seen in the injured CD epithelium, there is experimental evidence supporting the contribution of the obstructed tubular epithelium to this process.2 The minimal changes in genes encoding epithelial proteins in the obstructed CDs may be explained again by the relatively small contribution of CD RNA relative to total kidney RNA. The other possibility is that there are minimal changes in RNA levels in the obstructed CD epithelium, supported by our  67  immunohistochemistry, demonstrating altered cellular protein localization rather then a decrease in total protein expression.  The sequence of changes seen in EMT is very similar irrespective of the organ involved. The earliest epithelial responses to injury include the loss of intercellular adhesion molecules (E-cadherin) and dissociation of these and other structural anchoring molecules (catenins) from the cytoskeleton of the cell leading to a detachment of the cells from each other, and to their loss of polarity. Reorganization of the actin cytoskeleton, conversion of cytokeratin to vimentin, and de novo expression of α-smooth muscle actin, the main features of transition into a myofibroblastic phenotype, provide the transitioning cells more flexibility and mobility. Vimentin offers the cells more flexibility while maintaining the cell shape and the position of organelles in the cytoplasm.22 α-SMA provides not only structural support but also the element of contractility that can help in the invasiveness of the transformed cells.23 Breakdown of type IV collagen and laminin in the tubular basement membrane opens the path for these invasive cells to enter the interstitium and become interstitial fibroblasts.23,24 The final non-specific pathway of this process is the development of tissue fibrosis and destruction of tissue architecture, leading to organ dysfunction and failure (Figure 3.8). On the other hand, if the disease process is interrupted, phenotypically transformed cells can re-differentiate back into epithelial cells and contribute to the tissue repair, thus undergoing so called epithelialmesenchymal-epithelial cycling.25  68  Figure 3.8 Paradigm of changes associated with human congenital urinary tract obstruction. The obstruction of the developing kidneys causes dissociation of the cytoskeletal proteins (E-cadherin, βcatenin) and their translocation to the cytoplasm and the nucleus. Affected cells become flattened and start expressing mesenchymal markers (vimentin, α-SMA) giving them more flexibility and contractility. Breakdown of the ductal basement membrane allows the cells to migrate into the interstitium and to contribute to the myoepithelial population of periductal cells.  69  Conclusion This study describes the phenotypic changes of the collecting duct epithelium in human congenital obstructive nephropathy. It represents another step in our understanding of the pathogenesis of this disease and brings us closer to the identification of the key genes/proteins that play an important role in this condition. Elucidating the role of the individual proteins in EMT will help guide the development of targeted treatments to reverse tissue fibrosis and eventually prevent the damage of the affected organ.  However, the molecular mechanisms of collecting duct epithelial-mesenchymal transition and cellular signaling guiding this process are largely unknown. To characterize these processes, we identified potential pathways and studied their involvement in vitro. The results of this study are described in the next chapter.  70  References 1.  Hay ED, Zuk A: Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced. Am J Kidney Dis 26: 678-690, 1995.  2.  Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest 110: 341-350, 2002.  3.  Liu Y: Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15: 1-12, 2004.  4.  Zeisberg M, Kalluri R: The role of epithelial-to-mesenchymal transition in renal fibrosis. J Mol Med 82: 175-181, 2004.  5.  Picard M, Baum O, Vogetseder A, Kaissling B, Le Hir M: Origin of renal myofibroblasts in the model of unilateral ureter obstruction in the rat. Histochem Cell Biol 130: 141-155, 2008.  6.  Strutz FM: EMT and proteinuria as progression factors. Kidney Int 75: 475-481, 2009.  7.  Tarantal AF, Han VK, Cochrum KC, Mok A, daSilva M, Matsell DG: Fetal rhesus monkey model of obstructive renal dysplasia. Kidney Int 59: 446-456, 2001.  8.  Matsell DG, Mok A, Tarantal AF: Altered primate glomerular development due to in utero urinary tract obstruction. Kidney Int 61: 1263-1269, 2002.  9.  Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007.  71  10. Hay ED: The mesenchymal cell, its role in the embryo, and the remarkable signaling mechanisms that create it. Dev Dyn 233: 706-720, 2005. 11. Prozialeck WC, Lamar PC, Appelt DM: Differential expression of E-cadherin, Ncadherin and beta-catenin in proximal and distal segments of the rat nephron. BMC Physiol 17: 10, 2004. 12. Kalluri R, Neilson EG: Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest 112: 1776-184, 2003. 13. Goldman RD, Khuon S, Chou YH, Opal P, Steinert PM: The function of intermediate filaments in cell shape and cytoskeletal integrity. J Cell Biol 134: 971983, 1996. 14. Kashtan CE, Michael AF: Alport syndrome. Kidney Int 50: 1445-1463, 1996. 15. Khew-Goodall Y, Wadham C: A perspective on regulation of cell-cell adhesion and epithelial-mesenchymal transition: known and novel. Cells Tissues Organs 179: 8186, 2005. 16. Guarino M, Rubino B, Ballabio G: The role of epithelial-mesenchymal transition in cancer pathology. Pathology 39: 305-318, 2007. 17. Willis BC, duBois RM, Borok Z: Epithelial origin of myofibroblasts during fibrosis in the lung. Proc Am Thorac Soc 3: 377-382, 2006. 18. Corvol H, Flamein F, Epaud R, Clement A, Guillot L: Lung alveolar epithelium and interstitial lung disease. Int J Biochem Cell Biol 41: 1643-1651, 2009. 19. Gressner OA, Rizk MS, Kovalenko E, Weiskirchen R, Gressner AM: Changing the pathogenetic roadmap of liver fibrosis? Where did it start; where will it go? J Gastroenterol Hepatol 23: 1024-1035, 2008.  72  20. Inoue T, Okada H, Takenaka T, Watanabe Y, Suzuki H: A case report suggesting the occurrence of epithelial-mesenchymal transition in obstructive nephropathy. Clin Exp Nephrol 13: 385-388, 2009. 21. Matsell DG, Tarantal AF: Experimental models of obstructive nephropathy. Pediatr Nephrol 17: 470-476, 2002. 22. Toivola DM, Tao GZ, Habtezion A, Liao J, Omary MB: Cellular integrity plus: organelle-related and protein-targeting functions of intermediate filaments. Trends Cell Biol 15: 608-617, 2005. 23. Yang J, Liu Y: Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am J Pathol 159: 14651475, 2001. 24. Acloque H, Thiery JP, Nieto MA: The physiology and pathology of the EMT. Meeting on the epithelial-mesenchymal transition. EMBO Rep 9: 322-326, 2008. 25. Ishibe S, Cantley LG: Epithelial-mesenchymal-epithelial cycling in kidney repair. Curr Opin Nephrol Hypertens 17: 379-385, 2008.  73  CHAPTER 4  Y-BOX BINDING PROTEIN-1 MODULATES KIDNEY COLLECTING DUCT EPITHELIAL-MESENCHYMAL TRANSITION3  Introduction Obstructive nephropathy due to congenital urinary tract obstruction remains a leading cause of chronic kidney disease in children.1 Unfortunately, outcomes of these children have not changed over the last 20 years even with the introduction of fetal diagnosis and therapy for obstructive nephropathy.2,3 This may be due to our limited understanding of the pathophysiology and pathology of this disease.  The main cause of the progressive renal damage in many diseases, including obstructive nephropathy, is the development of tubular atrophy and interstitial fibrosis leading to the decrease of functioning renal mass, and eventually end-stage kidney disease. Multiple studies have investigated the source of fibroblasts and myofibroblasts in the diseased kidney. Resident interstitial fibroblasts, bone marrow-derived fibroblasts, as well as interstitial myofibroblasts derived from endothelial-mesenchymal and epithelialmesenchymal transition (EMT) have all been implicated.4 Iwano et al. showed in their landmark study of unilateral ureteric obstruction in mice that up to 36% of fibroblasts are 3  A version of this chapter has been submitted for publication. Trnka P, Ivanova L, Hiatt MJ, Dunn SE, Matsell DG: Y-box binding protein-1 modulates kidney collecting duct epithelial-mesenchymal transition.  74  derived from EMT of proximal tubular cells.5 We have shown that the collecting duct (CD) epithelial cells also contribute to EMT in a nonhuman primate model of urinary tract obstruction and in the human fetus.6,7  The main morphological changes associated with EMT are the loss of epithelial adhesion and anchoring proteins (E-cadherin, ZO-1, catenins), allowing the cells to detach from each other, and the de novo synthesis of flexible and contractile cytoskeletal proteins (vimentin, α-smooth muscle actin), giving the cells motility and flexibility. These phenotypic epithelial changes are followed by the breakdown of the tubular basement membrane thus allowing the newly formed myofibroblasts to migrate into the interstitium of the kidney where they deposit fibrous tissue.8 Molecular mechanisms of EMT in normal development and disease involving multiple stimulating factors and signaling pathways have been elucidated in recent years.9,10 We have recently shown that mouse inner medullary collecting duct (mIMCD3) cells undergo EMT in vitro via insulin-like growth factor 1 (IGF-1)-induced PI3K/Akt pathway activation.11  Y-box binding protein-1 (YB-1), a transcription/translation factor involved in a variety of cellular functions, including transcriptional and translational regulation, DNA repair, drug resistance, and stress responses to extracellular signals, is associated with aggressive forms of cancer.12,13 YB-1 has recently been implicated as a key factor in the activation of EMT in cancer.14 The role of YB-1 in EMT associated with obstructive nephropathy has not been investigated.  75  Based on in vitro evidence of IGF-1-induced EMT of mIMCD3 cells, and on the evidence of YB-1’s role in the process of EMT, we studied the involvement and functional importance of YB-1 in IGF-1-induced EMT of renal CD epithelial cells.  Materials and Methods Reagents and antibodies: Cell culture reagents, media, and serum were obtained from GIBCO BRL (Burlington, ON, Canada). Electrophoresis reagents were purchased from Bio-Rad (Mississauga, ON, Canada). Monoclonal antibodies (MAbs) against E-cadherin were ordered from BD Transduction Laboratories (San Diego, CA, USA), and MAbs against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), α-SMA and vimentin were purchased from Sigma-Aldrich Canada (Oakville, ON, Canada). Polyclonal antibodies (PAbs) against total and phosphorylated Akt, Erk1/2, RSK, β-catenin, cAMP response element binding protein (CREB; 48H2) and phosphorylated YB-1 were obtained from Cell Signaling Technology (Danvers, MA, USA). PAb against total YB-1 was ordered from Abcam (Cambridge, MA, USA). MAb against vinculin was obtained from Upstate Cell Signaling Solutions (Billerica, MA, USA). Goat anti-rabbit Alexa 488 and Alexa 568, and goat-anti-mouse Alexa 488 and Alexa 568 antibodies were purchased from Invitrogen Molecular Probes (Burlington, ON, Canada) and Sigma-Aldrich Canada (Oakville, ON, Canada). Anti-mouse and anti-rabbit IgG horseradish peroxidase (HRP)linked secondary Abs were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA, USA), and enhanced chemiluminescence (ECL) reagents were obtained from Sigma-Aldrich Canada (Oakville, ON, Canada). IGF-1 was obtained from Upstate Cell Signaling Solutions (Billerica, MA, USA). Prolong® Gold antifade reagent  76  with DAPI was from Invitrogen Molecular Probes (Burlington, ON, Canada). All other reagents were from Sigma-Aldrich Canada (Oakville, ON, Canada).  Cell culture and treatments: The mouse inner medullary collecting duct cell line (mIMCD3) was used in these experiments. This line is derived from an SV40 transgenic mouse as described elsewhere44 and was obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were maintained in Ham’s F-12 mediumDulbecco’s modified Eagle’s medium (1:1) supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 µg/ml) (Life Technologies, Burlington, ON, Canada) at 37°C in a humidified incubator with 5% CO2. The medium was changed every other day. Before stimulation with growth factors, cells were incubated in serum-free medium for 18–24 h.  Western Blot analysis: mIMCD3 cells were harvested in each experiment by scraping into 2 ml of chilled PBS and pelleting in a 15-ml conical tube at 500 rpm for 5 min. Cells were then lysed in RIPA buffer with protease and phosphatase inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, USA). The lysates were clarified by centrifugation at 16,000 g and 4°C for 20 min, and the protein concentration was determined by the Micro-BCA Protein Assay Kit (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer’s instructions. Cellular proteins were separated by SDS-PAGE, transferred onto a nitrocellulose membrane, and probed with the appropriate antibodies, followed by incubation with HRP-conjugated secondary antibodies. Detection was carried out with ECL (ECL kit, Sigma-Aldrich, Oakville, ON, Canada). Cytosolic vinculin and nuclear CREB proteins were used as control for cytosolic and nuclear protein loading, respectively. Densitometry of the blots was performed with ImageJ 77  software (NIH, USA), and the results were normalized to the signal obtained by Western blotting of total proteins, GAPDH, vinculin or CREB in the same cell samples.  Immunocytochemistry: mIMCD3 cells were seeded and grown on glass coverslips. For immunofluorescence assays, cells were fixed with 4% formaldehyde for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, and washed with PBS. Coverslips were blocked with 5% normal serum in PBS-Triton X-100 from the same species as the secondary Ab for 60 min and then incubated overnight at 4°C with various combinations of the primary Abs. Coverslips were then washed with PBS-Tween 20 for 20 min, followed by a 1-h incubation with the appropriate fluorescent dye-conjugated secondary Ab. Coverslips were mounted with Prolong® Gold antifade reagent with DAPI on glass slides and observed with a Leica DM4000B microscope (Leica, Wetzlar, Germany) and appropriate filters.  Subcellular fractionation: Subcellular fractionated protein was extracted from mIMCD3 cells. After washing in ice-cold PBS, cells were resuspended in a 5-ml volume of buffer A [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, and 0.5 mM DTT with the protease inhibitors] and incubated for 10 min on ice. The cells were then passed through a 22-gauge needle 10 times and centrifuged for 2 min at 10,000 rpm and 4°C, and the supernatant was designated the cytoplasmic protein fraction. The nuclear protein fraction was extracted as described by Dignam et al.45 The pellets (crude nuclei) were rinsed in buffer B [10 mM Tris HCl (pH 7.2), 2 mM MgCl2], resuspended in buffer C [20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 0.2 mM EDTA, and 0.5 mM DTT, with 20% (vol/vol) glycerol, 0.42 M NaCl, and protease inhibitors], and incubated for 30 min on ice while vortexing for 30 s at 10-min intervals. Nuclei were ruptured by passing through a 2678  gauge needle 10 times and incubated for another 10 min on ice. Nuclear debris was pelleted by centrifuging for 20 min at 13,000 rpm and 4°C and then frozen on dry ice at 80°C. The resulting supernatant was considered to be the nuclear protein fraction. Protein concentrations were subsequently determined with the Micro-BCA Protein Assay Kit (Pierce Biotechnology, Rockford, IL, USA).  siRNA transfections: The transfection protocol was performed following the manufacturer’s instructions. Briefly, 2 × 105 cells were seeded into each well of a 6-well plate and cultured to 40–50% confluency. Twenty-four hours later, cells were transfected with 10nM siRNA to YB-1 (CCACGCAATTACCAGCAAA (Dharmacon, Lafayette, CO, USA) and control siRNA (AATTCTCCGAACGTGTCACGT) (Qiagen, Mississauga, Ontario, Canada) using Lipofectamine 2000 reagent (Invitrogen Life Technologies, Burlington, ON, Canada). The experiment was performed three times.  Immunohistochemistry of human fetal kidneys: All human kidney samples were collected in accordance with the ethical guidelines of the University of British Columbia. After collection, kidneys were sectioned transversely and sagitally then immediately fixed in 4% paraformaldehyde overnight, and dehydrated through graded ethanol before transfer to toluene. Sections of paraffin-embedded tissue were cut with a microtome (5– 10µm), mounted on Superfrost slides (VWR), and baked overnight at 55°C. Sections were then cooled to room temperature and stored with desiccant. For staining, tissue sections were deparaffinized in xylene and rehydrated by passage through graded ethanol. Slides were then subjected to 40 minutes of heat-induced epitope retrieval in 10mM citrate buffer (pH 6–6.5). Sections were subsequently cooled to room temperature and blocked for 1 hour with 2% goat serum. Following blocking, excess buffer was 79  removed from the sections and replaced with diluted (1:400) primary antibody to total YB-1 (Abcam, Cambridge, MA, USA) in staining buffer for incubation overnight at 4°C. Secondary diluted (1:500) biotinylated goat anti-rabbit antibody (Vector Laboratories, Burlington, ON, Canada) was applied for 2 hours, followed by avidin-biotin peroxidase complex (Vectastatin ABC Kit, Vector Laboratories, Burlington, ON, Canada) for 2 hours and 3,3’-diaminobenzidine (Sigma Fast tablet sets, Sigma-Aldrich, Oakville, ON, Canada) for 10 minutes. Nuclei were stained with hematoxylin (Fisher Scientific, Ottawa, ON, Canada), slides were dehydrated by passage through graded ethanol and xylene, and mounted with Entellan (EMD, Gibbstown, NJ, USA).  Results  Demonstration of IGF-1-induced EMT of mIMCD3 Cells  To confirm our previous results11, we stimulated mIMCD3 cells with increasing concentrations of IGF-1 (1-100 ng/ml) over increasing lengths of time (24-72 hours). We measured total expression of epithelial and mesenchymal proteins by Western blot analysis to establish the optimal dose and duration of IGF-1 stimulation. As expected, there was a progressive decrease in expression of epithelial proteins E-cadherin and βcatenin (Figures 4.1A, 4.1B), and an increase in expression of mesenchymal proteins vimentin and α-smooth muscle actin (Figures 4.1C, 4.1D) in a dose- and time-dependent fashion. The most pronounced changes, achieved after 72-hour incubation of the cells with 100 ng/ml of IGF-1, included a decreased expression of E-cadherin and β-catenin (by 0.52-fold and 0.32-fold, respectively) and an increased expression of vimentin and α-  80  smooth muscle actin (by 2.23-fold and 4.1-fold, respectively) when compared to control, unstimulated cells.  Figure 4.1 Dose- and time-dependent changes of epithelial and mesenchymal proteins in IGF-1 stimulated mIMCD3 cells. IGF-1 stimulation of mIMCD3 cells resulted in a dose- (A) and timedependent (B) decrease in E-cadherin and β-catenin expression, and a similar dose- (C) and timedependent (D) increase in vimentin and α-smooth muscle actin (α-SMA) expression, when compared to unstimulated control cells. Data are presented as means ± SEM (n = 3). *P < 0.05 vs control.  IGF-1 stimulation also induced morphological changes of mIMCD3 cells consistent with EMT. While unstimulated cells displayed a typical epithelial cobblestone morphology (Figure 4.2A), IGF-1-stimulated mIMCD3 cells developed a spindle-shape and fusiform morphology. While unstimulated cells expressed cytoplasmic E-cadherin and β-catenin, perinuclear E-cadherin, and minimal vimentin and α-smooth muscle actin, IGF-1 stimulation resulted in dislocation of both epithelial proteins (E-cadherin, β-catenin) from 81  intercellular junctions to the cytoplasm and the nucleus, most pronounced after 24 hours of stimulation (data not shown), with gradual decrease of total expression of these proteins over 72 hours of stimulation. IGF-1 induced de novo expression of both vimentin and α-smooth muscle actin, most pronounced after 72 hours of stimulation (Figure 4.2B).  Figure 4.2 Phenotypic changes of IGF-1 stimulated mIMCD3 cells. Morphological changes of mIMCD3 cells were studied by phase contrast microscopy, and the expression of epithelial and mesenchymal proteins in mIMCD3 cells was studied by fluorescent microscopy after stimulation of the cells with IGF-1 100ng/ml for 72 hours, compared to control unstimulated cells. (A) IGF-1 stimulation of mIMCD3 cells induced the change from the normal cobblestone cell shape (Control) to spindle-shaped and fusiform morphology of the cells (IGF-1). Bar = 100 µm. (B) Control, unstimulated cells showed cell membrane expression of the epithelial proteins E-cadherin (red) and β-catenin (green) with some perinuclear expression of E-cadherin. Stimulation by IGF-1 for 72 hours disrupted the intercellular localization E-cadherin and β-catenin, and decreased total expression of these proteins. Conversely, IGF-1 simulated cells showed de novo expression of mesenchymal proteins vimentin and α-SMA at 72 hours (IGF-1). Nuclei co-stained with DAPI. Bar = 25 µm.  IGF-1 activation of YB-1  YB-1 is a transcription factor that controls the oncogenome and its role in cancer progression has been well documented.12 Interestingly, in our initial studies of human 82  congenital urinary tract obstruction, YB-1 protein co-localized with mesenchymal proteins in the most damaged areas of obstructed kidneys. The most severely affected kidneys showed the highest expression of YB-1 (Figure 4.3).  Figure 4.3 YB-1 expression in the human fetal collecting duct epithelium. (A) Normal, early gestation (~ 18 weeks) human fetal kidney shows no YB-1 expression in the collecting duct cells. (B) Faint, cytoplasmic expression of YB-1 is present in the collecting duct cells of a late gestation (~ 27 weeks) normal human kidney. (C and D) Collecting duct cells show increased nuclear and cytoplasmic expression of YB-1 in early (~ 18 weeks) and late (~36 weeks) gestation obstructed human fetal kidneys (C and D, respectively). Nuclei co-stained with hematoxylin. Bar = 25 µm.  To implicate YB-1 in collecting duct EMT, we first studied the effects of IGF-1 stimulation on the activation of YB-1. Stimulation of the cells induced an early activation of YB-1, as evidenced by a 2-fold increase in phosphorylated YB-1 (pYB-1) compared to control unstimulated cells at 5-minutes (Figure 4.4A). Western blot analysis of 83  fractionated protein demonstrated predominantly nuclear phosphorylation of YB-1 (Figure 4.4B) with no changes in total YB-1 protein, suggesting phosphorylation of already synthesized YB-1. YB-1 phosphorylation decreased to baseline by 24 hours after IGF-1 stimulation. Nuclear localization of phosphorylated YB-1 was confirmed by immunohistochemistry (Figure 4.4C).  Figure 4.4 Activation of YB-1 in IGF-1-induced EMT of mIMCD3 cells. (A) Western blot analysis of the whole cell lysate demonstrates early phosphorylation of YB-1 (2-fold increase of pYB-1 from baseline expression in control unstimulated cells) with a decline to baseline level of expression by 24 hours. Data are presented as means ± SEM (n = 3). *P < 0.05 vs control. (B) Subcellular fractionation of YB-1 demonstrates predominantly nuclear phosphorylation of YB-1 at 5 minutes of IGF-1 stimulation. Data are presented as means ± SEM (n = 2). (C) Immunocytochemistry of IGF-1-stimulated mIMCD3 cells confirms predominantly nuclear phosphorylation of YB-1 (green) after 5 minutes of stimulation with gradual decrease to baseline over subsequent 24 hours. Nuclei are costained with DAPI (blue). Bar = 10 µm.  84  IGF-1 signaling in mIMCD3 cells  Growth factor stimulation of other cell lines such as the breast cancer cell line MDAMB-231 results in YB-1 phosphorylation leading to nuclear translocation of YB-1 and its DNA binding to target genes.15,16 Similar to our previous study,11 stimulation of mIMCD-3 cells by IGF-1 leads to early phosphorylation of Akt and Erk with a 2 and 2.3fold increase in pAkt and pErk after 5 minutes, respectively, compared to unstimulated cells (Figure 4.5). We also studied the involvement of p90 ribosomal S6 kinase (RSK) in this process. RSK works downstream of Erk and has been shown to activate YB-1 directly and more effectively than Akt.16 Similarly to increases in pAkt and pErk, IGF-1 stimulation induced a 2.3-fold increase in pRSK after 5 minutes of stimulation when compared to control unstimulated cells (Figure 4.5).  Figure 4.5 Signaling events involved in activation of YB-1. mIMCD3 cells were incubated with 100ng/ml of IGF-1 for 24 hours, phosphorylated proteins were normalized to total proteins, and the foldchange in the expression was compared to control, unstimulated cells. Stimulation with IGF-1 induced early increase in the expression of pAkt, pErk, and pRSK with 2-fold increase of pAkt, and 2.3-fold increase in the expression of both pErk and pRSK after 5 minutes of stimulation. The expression of all phosphorylated proteins declined towards baseline over the subsequent 24 hours. Data are expressed as means ± SEM (n = 3). *P < 0.05 vs control.  85  Inactivation of YB-1 attenuates IGF-1-induced EMT of mIMCD3 cells  To confirm the role of YB-1 in IGF-1-induced EMT of mIMCD3 cells, we studied the effect of YB-1 knockdown on EMT using an siRNA strategy. 72-hour transfection of the cells with siRNA decreased YB-1 to 18% of total YB-1 when compared to control untransfected cells (Figure 4.6).  Figure 4.6 Efficiency of siRNA knockdown of YB-1. Cells were transfected with siRNA to YB-1 for 24 to 72 hours. The efficiency of transfection was assessed by measuring tYB-1 protein expression after normalization of total protein to vinculin, and compared to tYB-1 at 0 hours. Transfection of the cells for 72 hours induced knockdown of tYB-1 to 18% of control, untransfected cells. Data are expressed as means ± SEM (n = 3).  After 72 hours of transfection, the cells were stimulated with IGF-1 for a further 72 hours, and the expression of epithelial and mesenchymal proteins was measured by Western blot analysis and visualized by phase contrast and fluorescent microscopy. The level of expression of YB-1 remained below 20% for the duration of the experiments (data not shown). There was no difference in the expression of the proteins of interest between non-transfected and unstimulated cells and cells transfected with scrambled siRNA (data not shown). As expected, IGF-1-stimulated mIMCD3 cells with intact YB-1 86  demonstrated EMT with decreased expression of epithelial proteins (0.36-fold decrease of E-cadherin and 0.29-fold decrease of β-catenin expression) (Figure 4.7A) and de novo expression of mesenchymal proteins (2.09-fold increase of vimentin and 3.39-fold increase of α-smooth muscle actin expression when compared to control cells) (Figure 4.7B).  87  Figure 4.7 Effect of YB-1 knockdown on EMT of IGF-1-induced mIMCD3 cells. Cells were transfected with siRNA to YB-1, grown for 72 hours, and subsequently stimulated by 100ng/ml IGF-1 for a further 72 hours. The extent of EMT was measured by the expression of epithelial and mesenchymal proteins by Western blot analysis and compared to control, non-transfected cells unstimulated by IGF-1. There was no significant difference in the expression of proteins between unstimulated non-transfected cells (Control) and cells transfected with siRNA (siRNA). (A) IGF stimulation of cells with intact YB-1 (labeled IGF-1) decreased the expression of epithelial proteins E-cadherin and β-catenin when compared to control cells (0.36-fold and 0.29-fold, respectively). The knockdown of YB-1 (labeled siRNA+IGF-1) attenuated IGF-1 induced EMT as demonstrated by expression of both E-cadherin and β-catenin similar to control cells (1.29-fold and 1.09-fold increase, respectively). There was a significant difference in the expression of both E-cadherin and β-catenin between IGF-1 and siRNA+IGF-1 cells (P = 0.02 and 0.03, respectively); *P < 0.05. (B) IGF-1 stimulation of cells with intact YB-1 (labeled IGF-1) induced de novo expression of mesenchymal proteins vimentin and α-smooth muscle actin (α-SMA) (2.09-fold and 3.39fold increase, respectively) when compared to control cells. EMT was attenuated in IGF-1-stimulated cells with YB-1 knockdown (labeled siRNA+IGF-1) with decreased expression of vimentin and α-SMA (1.06fold and 1.5-fold increase of the baseline expression of these proteins in control cells). There was a significant difference in the expression of both vimentin and α-SMA between IGF-1 and siRNA+IGF-1 cells (P = 0.04 and 0.03, respectively); *P < 0.05. Results are expressed as means ± SEM (n = 3).  88  There was preserved expression of epithelial proteins E-cadherin and β-catenin (1.29fold and 1.09-fold expression of control cells, respectively) and decreased de novo expression of mesenchymal proteins vimentin and α-smooth muscle actin (1.06-fold and 1.5-fold expression compared to control cells, respectively) in cells with YB-1 knockdown (Figure 4.7). This represents a 3.6-fold higher expression of E-cadherin, 3.8fold higher expression of β-catenin, 2-fold lower expression of vimentin, and 2.3-fold lower expression of α-smooth muscle actin in IGF-1-stimulated cells with YB-1 knockdown compared to IGF-1-stimulated cells with intact YB-1.  The attenuation of EMT was also confirmed by the preservation of cell morphology and expression of epithelial proteins by phase contrast and fluorescent microscopy, respectively. While mIMCD3 cells with intact YB-1 stimulated by IGF-1 for 72 hours demonstrated a spindle-shape and fusiform morphology under phase contrast microscopy, the cells with YB-1 knockdown showed preserved epithelial cobblestone shape (Figure 4.8A). With IGF-1-stimulation mIMCD3 cells with normal expression of YB-1 demonstrated dislocation of both epithelial proteins (E-cadherin and β-catenin) from intercellular junctions and an overall decrease in their expression with de novo expression of mesenchymal proteins (vimentin and α-smooth muscle actin) (Figure 4.8B). YB-1 knockdown prevented EMT in the stimulated cells, as evident in preservation of the normal distribution and total expression of epithelial proteins and attenuated synthesis of mesenchymal proteins after incubation of these cells with IGF-1 for 72 hours (Figure 4.8).  89  Figure 4.8 Phenotypic differences between IGF-1-stimulated mIMCD3 cells with intact YB-1 and YB-1 knockdown. Knockdown of YB-1 was achieved by transfection of the cells with siRNA to YB-1 and growth of transfected cells for 72 hours. Transfected cells were subsequently stimulated with 100ng/ml of IGF-1 for a further 72 hours. Morphological changes of mIMCD3 cells were studied by phase contrast microscopy, and the expression of epithelial and mesenchymal proteins in mIMCD3 cells was studied by fluorescent microscopy. (A) Control unstimulated cells show epithelial, cobblestone morphology (Control). IGF-1 stimulation of the cells with intact YB-1 (IGF-1) induced the change to fusiform and spindle-shape morphology, while the knockdown of YB-1 (IGF-1+siRNA) preserved the morphology of the stimulated cells. Bar = 100 µm. (B) Immunocytochemistry of the control, unstimulated cells (Control) revealed normal intercellular and cytoplasmic expression of epithelial proteins (E-cadherin and β-catenin) and minimal expression of mesenchymal proteins (vimentin and α-SMA). IGF-1-stimulated cells with normal expression of YB-1 (IGF-1) demonstrated the loss of E-cadherin and β-catenin, and de novo expression of vimentin and α-SMA. The stimulated cells with YB-1 knockdown (IGF-1+siRNA) demonstrated preserved expression of E-cadherin and β-catenin and minimal expression of vimentin and α-SMA after 72-hour stimulation with IGF-1. Bar = 25 µm.  90  Discussion In the present study we demonstrated that YB-1 plays an important regulatory role in EMT of kidney collecting duct cells. In mIMCD3 cells IGF-1 activated YB-1 via PI3K/Akt and Mapk/Erk pathways with subsequent morphological changes of the cells, decreased expression of epithelial, and de novo expression of mesenchymal proteins, characteristic of EMT. Knockdown of YB-1 attenuated EMT as evidenced by the preserved epithelial morphology, normal expression of epithelial proteins, and minimal expression of mesenchymal proteins in IGF-1-stimulated cells. The results of this study support the direct involvement of this transcription/translation factor in the EMT process of the collecting duct cells.  Molecular mechanisms guiding EMT are not well understood. Many extracellular stimuli (increased intraluminal pressure, loss of flow) induce EMT but the precise coupling of the sensing stimulus and subsequent stimulation of signaling pathways is unknown. Various factors, such as transforming growth factor-β (TGF-β), epidermal growth factor, and fibroblast growth factor, bind to cell surface receptors and activate pathways that involve Smad proteins, PI3K/Akt, Mapk/Erk pathways among others. This signal is then transduced to transcription factors, such as NFκB, Snai1, Snai2, Zeb1, Zeb2 that translocate to the nucleus and bind to the promoter regions of many genes. The effect of this cascade of activation is a decreased synthesis of epithelial proteins, such as Ecadherin and β-catenin, and an increased production of mesenchymal proteins, such as vimentin and α-smooth muscle actin.4  91  We used IGF-1 as a ligand, triggering the cascade of molecular events in mIMCD3 cells. The choice of this factor was based on the importance of insulin-like growth factors in normal kidney morphogenesis,17,18 as well as their role in the development of multicystic renal dysplasia,19 glomerular disease,20 and recently, in IGF-1-induced EMT of the mouse collecting duct epithelial cells.11 In the present study, IGF-1 was capable of inducing phenotypic changes of mIMCD3 cells, with the morphological changes of the cells, the loss of epithelial proteins and de novo acquisition of mesenchymal proteins characteristic of EMT.  YB-1, a member of the cold-shock domain protein superfamily,	
  was first described in 1988 as a transcription factor binding to the promoter of the MHC class II genes.21 It is a small protein (molecular weight 49kDa) that binds to single-stranded DNA and RNA, and functions as regulator of transcription, RNA metabolism, and protein synthesis.22 YB-1 is usually localized to the cytoplasm of the cell, but stress conditions that activate YB-1 induce translocation of its phosphorylated form (pYB-1) into the nucleus where it binds to the inverted CCAAT element of Y box of many genes involved in cell cycle progression, DNA replication, cell adhesion, motility, replication, and drug resistance.23 In the cytoplasm, YB-1 acts as a translational repressor of protein synthesis through binding to the 5’ terminus of mRNAs with extensive 5’ UTR secondary structures, thus outcompeting the eIF4E initiation complex.24 The role of YB-1 in progression of cancer has been well described, especially aggressive forms of breast cancer25 and non-small cell lung cancer.26  The first kidney expression of the YB-1 gene was described in a 24-week old human fetus in 1992,27 suggesting its role in normal development. Later reports investigated the 92  involvement of YB-1 in kidney disease. Mertens et al. reported that YB-1 is a major activator of MMP-2 transcription in glomerular mesangial cells leading to the development of the end-stage sclerotic lesions characteristic of most forms of chronic glomerular disease.28 In mesangioproliferative glomerular disease, YB-1 was identified as a specific downstream signaling target of PGDF-B via MAPK/ERK pathway.29 TGF-β can also induce the activation of YB-1 via MAPK/ERK pathway, as has been shown in mesangial cells30 or collecting duct cells.11 Fraser et al. reported a direct translational regulation of TGF-β1 by YB-1 in proximal tubular cells. As TGF-β1 is a potent stimulator of EMT, this study shows that YB-1 plays an important role in regulation of proximal tubular cell EMT and its involvement in the development of interstitial fibrosis.31 The role of YB-1 in kidney transplant rejection through the regulation of CCL5 in infiltrating T-cells and monocytes/macrophages has also been reported.32 The most recent reports have indicated that YB-1 can also be secreted by the cells after inflammatory challenge,33 and bind to extracellular Notch-3 receptors on the target cells. Binding of YB-1 to extracellular Notch-3 receptors activates Notch-3 signaling with upregulation of target genes relevant in the development of inflammatory mesagioproliferative disease.34 The role of YB-1 in collecting duct EMT has not been previously studied. In our study, we demonstrated that IGF-1 stimulation of mIMCD3 cells induces rapid phosphorylation of YB-1. The increase in pYB-1 was observed mainly in the nuclei of the stimulated cells, as evidenced by subcellular fractionation and visualized by fluorescent microscopy. These findings suggest the role of pYB-1 in transcriptional modification of proteins involved in EMT.  Multiple molecular mechanisms are involved in the activation of YB-1.12 We studied PI3K/Akt and Mapk/Erk pathways as they have been previously linked to YB-1 93  activation. The importance of IGF-1 and PI3K pathway has been shown in podocyte development,35 but it is likely a universal pathway of IGF-1-induced signal transduction that is not limited to a specific kidney cell line, as demonstrated by the results of our study. The role of PI3K/Akt pathway in YB-1 activation has been well described in cancer.15,36,37 Activated Akt binds to and phosphorylates the YB-1 cold shock domain at Ser102 of YB-1 molecule. The disruption of the Akt phosphorylation correlates with an inhibition of nuclear translocation by the YB-1 and inhibition of tumor cell growth.15 Mapk/Erk, a well-known mitogenic pathway involved in cellular proliferation, is also involved in upregulation of YB-1.30 Recent reports indicate that IGF-1 stimulation of its receptors leads directly to the activation of Mapk/Erk pathway.38,39 The precise mechanisms of YB-1 activation by this pathway are unknown. YB-1 can be phosphorylated directly by Erk2, as shown by Coles et al.,40 or by RSK proteins, direct downstream targets of Erk. RSK family of proteins have recently been shown to activate YB-1 more effectively than Akt and may therefore be the major facilitators of YB-1 function.16 RSKs are not only a substrate of Erk41 but also require phosphorylation by phosphoinositide-dependent protein kinase-142, a kinase crucial for activation of Akt, and thus linking PI3K/Akt and Mapk/Erk pathways in the process of YB-1 activation. In our study, we demonstrated an early 2-fold increase in phosphorylation of Akt, Erk and RSK kinases, followed by phosphorylation of YB-1, suggesting the involvement of these pathways and kinases in the activation of YB-1.  We used an siRNA knockdown strategy to inhibit YB-1. This approach has been successfully used in previous studies.14,37 The most substantial reduction of YB-1 protein expression was achieved after 72 hours of transfection. IGF-1-stimulated mIMCD3 cells with silenced YB-1 demonstrated preserved epithelial cell morphology and the 94  expression of epithelial proteins and decreased expression of mesenchymal proteins, when compared to IGF-1-stimulated cells with intact YB-1. The association of low expression of YB-1 and preservation of epithelial phenotype suggests a direct involvement of YB-1 in collecting duct EMT. Our results are consistent with similar findings in human premalignant mammary epithelial cells.14 YB-1 knockdown has been shown to decrease expression of E-cadherin gene previously, further suggesting that this process takes place at transcriptional level.43 We observed higher expression of epithelial proteins, especially E-cadherin, in YB-1 deficient cells stimulated with IGF-1 compared to control unstimulated cells, possibly suggesting the role of YB-1 in the control of the synthesis of epithelial proteins.  Conclusion  The results of this study suggest that YB-1 plays a crucial role in collecting duct EMT (Figure 4.9). These findings represent a further step in the characterization of the molecular events and regulatory mechanisms of EMT of the collecting duct epithelium, a process that contributes to the development of interstitial fibrosis and progression to endstage kidney disease in obstructive nephropathy.  The work to this point has characterized the differential expression and the potential regulation of genes and proteins in human and experimental models of congenital obstructive nephropathy. In the next project, we investigate the feasibility of measuring these candidate proteins in urine from patients with kidney injury and to correlate their “expression pattern” with the severity of renal impairment.  95  Figure 4.9 YB-1 signaling and its effect on EMT. Binding of IGF-1 to its receptor triggers activation of PI3K/Akt and Mapk in the cytoplasm of the cell. Phosphorylated Akt activates YB-1 directly. Phosphorylated Erk can also activate YB-1 directly or via phosphorylation of RSK. Phosphorylated YB-1 translocates to the nucleus of the cell and binds to Y boxes of the promoters of the genes involved in EMT and modifies their transcription. This leads to decreased synthesis of epithelial proteins (E-cadherin and βcatenin) and de novo synthesis of mesenchymal proteins (vimentin and α-SMA). Knockdown of YB-1 transcription by siRNA leads to decreased synthesis of YB-1 protein. Insufficient amount of this protein is available for phosphorylation in the cytoplasm of the cell with less being translocated to the nucleus and binding to the genes. This results in the attenuation of EMT with preserved expression of epithelial proteins and minimal expression of mesenchymal proteins. Abbreviations: IGF-1, insulin-like growth factor-1; IGF-1R, insulin-like growth factor-1 receptor; PI3K, phosphoinositide 3-kinase; Akt, protein kinase B; Mapk, mitogen-activated protein kinase; RSK, ribosomal protein S6 kinase, 90-KD; YB-1, Ybox binding protein-1; siRNA, small interfering RNA; α-SMA, α-smooth muscle actin.  96  References 1.  Smith JM, Stablein DM, Munoz R, Hebert D, McDonald, RA: The 2006 Annual Report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS). Pediatr Transplant 11: 366-373, 2007.  2.  Holmes N, Harrison MR, Baskin LS: Fetal surgery for posterior urethral valves: long-term postnatal outcomes. Pediatrics 108: E7, 2001.  3.  Coplen DE: Prenatal intervention for hydronephrosis. J Urol 157: 2270-2277, 1997.  4.  Grande MT, López-Novoa JM: Fibroblast activation and myofibroblast generation in obstructive nephropathy. Nat Rev Nephrol 5: 319-328, 2009.  5.  Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest 110: 341-350, 2002.  6.  Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007.  7.  Trnka P, Hiatt MJ, Ivanova L, Tarantal AF, Matsell DG: Phenotypic transition of the collecting duct epithelium in congenital urinary tract obstruction. J Biomed Biotechnol 2010: 696034, 2010.  8.  Liu Y: Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15: 1-12, 2004.  9.  Baum B, Settleman J, Quinlan MP: Transitions between epithelial and mesenchymal states in development and disease. Semin Cell Dev Biol 19: 294-308, 2008.  97  10. Micalizzi DS, Ford HL: Epithelial-mesenchymal transition in development and cancer. Future Oncol 5: 1129-1143, 2009. 11. Ivanova L, Butt MJ, Matsell DG: Mesenchymal transition in kidney collecting duct epithelial cells. Am J Physiol Renal Physiol 294: F1238-F1248, 2008. 12. Wu J, Stratford AL, Astanehe A, Dunn SE: YB-1 is a transcription/translation factor that orchestrates the oncogenome by hardwiring signal transduction to gene expression. Translational Oncogenomics 2: 49-65, 2007. 13. Stratford AL, Habibi G, Astanahe A, Jiang H, Hu K, Park E, Shadeo A, Buys TP, Lam W, Pugh T, Marra M, Nielson TO, Klinge U, Mertens PR, Aparicio S, Dunn SE: Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Ybox binding protein-1 (YB-1) and can be inhibited with Iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61, 2007. 14. Evdokimova V, Tognon C, Ng T, Ruzanov P, Melnyk N, Fink D, Sorokin A, Ovchinnikov LP, Davicioni E, Triche TJ, Sorensen PH: Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell 15: 402-415, 2009. 15. Sutherland BW, Kucab J, Wu J, Lee C, Cheang MC, Yorida E, Turbin D, Dedhar S, Nelson C, Pollak M, Leighton Grimes H, Miller K, Badve S, Huntsman D, BlakeGilks C, Chen M, Pallen CJ, Dunn SE: Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorageindependent growth of breast cancer cells. Oncogene 24: 4281-4292, 2005. 16. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y, Dong Z, Berquin IM, Roux PP, Dunn SE: Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res 10: R99, 2008. 98  17. Matsell DG, Bennett T: Evaluation of metanephric maturation in a human fetal kidney explant model. In Vitro Cell Dev Biol Anim 34: 138-148, 1998. 18. Bridgewater DJ, Matsell DG: Insulin-like growth factor binding protein-2 modulates podocyte mitogenesis. Pediatr Nephrol 18: 1109-1115, 2003. 19. Matsell DG, Bennett T, Armstrong RA, Goodyer P, Goodyer C, Han VK: Insulinlike growth factor (IGF) and IGF binding protein gene expression in multicystic renal dysplasia. J Am Soc Nephrol 8: 85-94, 1997. 20. Mohammed JA, Mok AY, Parbtani A, Matsell DG: Increased expression of insulinlike growth factors in progressive glomerulonephritis of the MRL/lpr mouse. Lupus 12: 584-590, 2003. 21. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, Schwarttz, BD: Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci U S A 85: 7322-7326, 1988. 22. Matsumoto K, Wolffe AP: Gene regulation by Y-box proteins: coupling control of transcription and translation. Trends Cell Biol 8: 318-3232, 1998. 23. Kohno K, Izumi H, Uchiumi T, Ashizuka M, Kuwano M: The pleiotropic functions of the Y-box-binding protein, YB-1. Bioassays 25: 691-698, 2003. 24. Evdokimova V, Ovchinnikov LP, Sorensen PH: Y-box binding protein 1: providing a new angle on translational regulation. Cell Cycle 5: 1143-1147, 2006. 25. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E, Turbin D, Berquin IM, Mertens PR, Iftner T, Gilks CB, Dunn SE: Disruption of the Y-box binding protein1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879, 2006.  99  26. Kashihara M, Azuma K, Kawahara A, Basaki Y, Hattori S, Yanagawa T, Terazaki Y, Takamori S, Shirouzu K, Aizawa H, Nakano K, Kage M, Kuwano M, Ono M: Nuclear Y-box binding protein-1, a predictive marker of prognosis, is correlated with expression of HER2/ErbB2 and HER3/ErbB3 in non-small cell lung cancer. J Thorac Oncol 4: 1066-1074, 2009. 27. Spitkowski DD, Royer-Pokora B, Delius H, Kisseljov F, Jenkins NA, Gilbert DJ, Copeland NG, Royer HD: Tissue restricted expression and chromosomal localization of the YB-1 gene encoding a 42 kD nuclear CCAAT binding protein. Nucleic Acids Res 20: 797-803, 1992. 28. Mertens PR, Harendza S, Pollock AS, Lovett DH: Glomerular mesangial cellspecific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J Biol Chem 272: 22905-22912, 1997. 29. van Royen CR, Eitner F, Martinkus S, Thieltges SR, Ostendorf T, Bokemeyer D, Lüscher B, Lüscher-Firzlaff JM, Floege J, Mertens PR: Y-box protein 1 mediates PDGF-B effects in mesangioproliferative glomerular disease. J Am Soc Nephrol 16: 2985-2996, 2005. 30. Feng Q, Huang S, Zhang A, Chen Q, Guo X, Chen R, Yang T: Y-Box Protein 1 Stimulates Mesangial Cell Proliferation via Activation of ERK1/2. Nephron Exp Nephrol 113: 16-25, 2009. 31. Fraser DJ, Phillips AO, Zhang X, van Royen CR, Muehlenberg P, En-Nia A, Mertens PR: Y-box protein-1 controls transforming growth factor-beta1 translation in proximal tubular cells. Kidney Int 73: 724-732, 2008. 32. Raffetseder U, Rauen T, Djudjaj S, Kretzler M, En-Nia A, Tacke F, Zimmermann HW, Nelson PJ, Frye BC, Floege J, Stefanidis I, Weber C, Mertens PR: Differential  100  regulation of chemokine CCL5 expression in monocytes/macrophages and renal cells by Y-box protein-1. Kidney Int 75: 185-196, 2009. 33. Frye BC, Halfter J, Djudjaj S, Muehlenberg P, Weber S, Raffetseder U, En-Nia A, Knott H, Baron JM, Dooley S, Bernhagen J, Mertens PR: Y-box protein-1 is actively secreted through a non-classical pathway and acts as an extracellular mitogen. EMBO Rep 10: 783-789, 2009. 34. Rauen T, Raffetseder U, Frye BC, Djudjaj S, Mühlenberg PJ, Eitner F, Lendahl U, Bernhagen J, Dooley S, Mertens PR: YB-1 acts as ligand for Notch-3 receptors and modulates receptor activation. J Biol Chem 284: 26928-26940, 2009. 35. Bridgewater DJ, Ho J, Sauro V, Matsell DG: Insulin-like growth factors inhibit podocyte apoptosis through the PI3 kinase pathway. Kidney Int 67: 1308-1314, 2005. 36. Evdokimova V, Ruzanov P, Anglesio MS, Sorokin AV, Ovchinnikov LP, Buckley J, Triche TJ, Sononberg N, Sorensen PH: Akt-mediated YB-1 phosphorylation activates translation of silent mRNA species. Mol Cell Biol 26: 277-292, 2006. 37. Astanehe A, Finkbeiner MR, Hojabrpour P, To K, Fotovati A, Shadeo A, Stratford AL, Lam WL, Berquin AM, Durinio V, Dunn SE: The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28: 2406-2418, 2009. 38. Zoubeidi A, Zardan A, Wiedmann RM, Locke J, Beraldi E, Fazli L, Gleave ME: Hsp27 Promotes Insulin-Like Growth Factor-I Survival Signaling in Prostate Cancer via p90Rsk-Dependent Phosphorylation and Inactivation of BAD. Cancer Res 70: 2307-2317, 2010.  101  39. Ren H, Accili D, Duan C: Hypoxia converts the myogenic action of insulin-like growth factors into mitogenic action by differentially regulating multiple signaling pathways. Proc Natl Acad Sci U S A 107: 5857-5862, 2010. 40. Coles LS, Lambrusco L, Burrows J, Hunter J, Diamond P, Bert AG, Vadas MA, Goodall GJ: Phosphorylation of cold shock domain/Y-box proteins by ERK2 and GSK3beta and repression of the human VEGF promoter. FEBS Lett 579: 53725378, 2005. 41. Dalby KN, Morrice N, Caudwell FB, Avruch J, Cohen P: Identification of regulatory phosphorylation sites in mitogen-activated protein kinase (MAPK)activated protein kinase-1a/p90rsk that are inducible by MAPK. J Biol Chem 273: 1496-1505, 1998. 42. Jensen CJ, Buch MB, Krag TO, Hemmings BA, Gammeltoft S, Frödin M: 90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositidedependent protein kinase-1. J Biol Chem 274: 27168-27176, 1999. 43. Basaki Y, Hosoi F, Oda Y, Fotovati A, Maruyama Y, Oie S, Ono M, Izumi H, Kohno K, Sakai K, Shimoyama T, Nishio K, Kuwano M: Akt-dependent nuclear localization of Y-box-binding protein 1 in acquisition of malignant characteristics by human ovarian cancer cells. Oncogene 26: 2736-2746, 2007. 44. Rauchman MI, Nigam SK, Delpire E, Gullans SR: An osmotically tolerant inner medullary collecting duct cell line from an SV40 transgenic mouse. Am J Physiol 265: F416-424, 1993. 45. Dignam JD, Martin PL, Shastry BS, Roeder RG: Eukaryotic gene transcription with purified components. Methods Enzymol 101: 582-598, 1983.  102  CHAPTER 5  URINE PROTEIN EXPRESSION PROFILES IN OBSTRUCTIVE NEPHROPATHY4  Introduction Posterior urethral valves (PUV) are the most common cause of lower urinary tract obstruction in males. The estimated incidence of PUV is 1:5,000 to 1:8,000 of live male births, but might be higher due to fetal demise.1 The associated obstructive nephropathy and renal dysplasia is the leading cause of end-stage kidney disease in surviving children.2 Normal bladder development is also affected by the obstruction thereby predisposing the affected children to dysfunctional voiding and recurrent urinary tract infections.3 In utero fetal interventions aiming to relieve the bladder obstruction have improved perinatal survival, but have not changed the long-term outcomes of patients with obstructive nephropathy. Approximately 20-30 % of affected children progress to end-stage kidney disease in the first decade of life, with the majority progressing to chronic kidney disease.4-6 These poor outcomes reflect the effects of obstruction on developing kidneys resulting in low nephron numbers, and abnormal tissue architecture with atrophic tubules and interstitial fibrosis.  4  A version of this chapter will be submitted for publication. Trnka P, Ivanova L, Hiatt MJ, Milner R, Matsell DG: Urine protein expression profiles in obstructive nephropathy.  103  Most cases of PUV are diagnosed by the antenatal ultrasound findings of bilateral hydronephrosis, dilated ureters, and distended, thick-walled bladder, and by postnatal confirmation of the presence of the valves either on voiding cystogram or during cystoscopy.7 The assessment of the severity of kidney injury is more difficult. Patients are usually followed in nephrology clinics with serial measurements of serum creatinine used as a surrogate marker of glomerular filtration rate (GFR) and overall kidney function. There are no tests available at present that predict which patients will reach end-stage kidney disease and at what point in time. However, the severity of functional renal impairment is directly related to structural damage of the developing kidneys. In our previous studies of congenital urinary tract obstruction in the human and monkey fetus, we observed pronounced injury, characterized by a paucity of collecting ducts, tubular dilatation and atrophy, and interstitial fibrosis deep into the medulla.8-10 In humans, to assess the extent of these injuries, one would have to perform a kidney biopsy to obtain tissue for analysis. Given the inherent risks of this procedure in the fetus, surrogate markers of structural changes of obstructive nephropathy that can be measured in urine would be useful.  We have previously identified candidate proteins that are differentially expressed in the tissue of obstructed fetal kidneys when compared to control kidneys.9,10 These proteins included scaffolding transmembrane epithelial proteins involved in cell-cell adhesion [Ecadherin, β-catenin, N-cadherin, and L1 cell adhesion molecule (L1CAM)], mesenchymal proteins reflecting the process of epithelial-mesenchymal transition [vimentin and α-smooth muscle actin (α-SMA)], proteins expressed specifically by principal and intercalated cells of the collecting duct [aquaporin-2 (AQP2) and vacuolartype H+-ATPase (V-ATPase), respectively), flow-sensing protein [transient receptor 104  potential cation channel subfamily V member 4 (TRPV4)], and profibrotic cytokines involved in fibrosis [transforming growth factor-β1 (TGF-β1)].  The aim of this study was to investigate the feasibility of measuring these candidate proteins in urine from patients with kidney injury and to correlate their “expression pattern” with the severity of renal impairment.  Materials and Methods Identification of cases: Thirty cases of children with PUV were identified from the BC Children’s Hospital Nephrology clinical database. The diagnosis of PUV was confirmed by chart reviews and review of diagnostic imaging. The study was conducted in accordance with the ethical guidelines of the University of British Columbia with approval by the Ethics Committee of the University of British Columbia.  Collection and processing of urine samples: Urine samples were collected from subjects with PUV and age-matched controls during regular clinic visits. Protease inhibitors (Protease inhibitor cocktail P2714, Sigma-Aldrich, Oakville, ON, Canada) were added immediately to prevent degradation of urinary proteins. All samples were subsequently frozen at –20°C. Prior to analyses, thawed urine samples were centrifuged for 10 min at 300g and for 20 min at 10 000g at 4°C to remove cellular debris. For enrichment of urinary proteins, 4 ml of urine supernatant was spun in an Amicon Ultra-4 concentrator (Millipore, Billerica, MA, USA) at 4000g for 20 min to reduce volumes to ~100 µl. Urine exosomes were collected by centrifugation of the supernatant at 200 000g for 1 h at 4°C using a Beckman SW 40 rotor (Beckman Instruments, Fullerton, 105  CA, USA) and then resuspended in PBS with protease inhibitors. Urinary proteins and exosome-associated protein concentrations were measured by NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Middletown, VA, USA) at 280 nm. Total protein and creatinine were measured in unconcentrated urine using the IDMS reference method by VITROS 5.1 FS analyzer (Ortho Clinical Diagnostics, Rochester, NY, USA).  Immunobloting: Whole urine and urine exosome samples were solubilized in 5×SDSsample buffer and equal amounts of urine and urinary exosome proteins were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). After fractionation by SDSPAGE, proteins were transferred onto nitrocellulose membrane and were probed with the appropriate primary antibodies against: E-cadherin (BD Transduction Laboratories, San Diego, CA, USA), β-catenin (Cell Signaling Technology Inc., Danvers, MA, USA), vimentin, α-SMA, AQP2, L1CAM, (Sigma-Aldrich, Oakville, ON, Canada), N-cadherin, TGF-β1, V-ATPase and TRPV4 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by incubation with the appropriate anti-rabbit and anti-mouse IgG HRPconjugated secondary antibodies (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA). Detection was carried out with ECL (ECL kit, Sigma-Aldrich, Oakville, ON, Canada). Densitometry of the blots was performed with ImageJ software (NIH, USA).  Determination of glomerular filtration rate: Glomerular filtration rate was measured by a two-point single injection of technetium-99m-diethylenetriaminepentaacetic acid (99mTc-DTPA) nuclear GFR method with correction for the early exponential phase using the Bröchner-Mortensen equation.11 In cases where no measured GFR was available (n=5), GFR was estimated from measured height and plasma creatinine using the 106  Schwartz formula.12,13 Where analysis in groups of varying degree of renal impairment was done, NKF KDOQI guidelines classification for chronic kidney disease (CKD) was used.14 CKD stage 1 was defined as normal renal function (GFR>90 ml/min/1.73m2) , CKD stage 2 as mild (GFR=60-89 ml/min/1.73m2) , CKD stage 3 as moderate (GFR=3059 ml/min/1.73m2) , and CKD stage 4 as severe renal impairment (GFR=15-29 ml/min/1.73m2). No patients with end-stage renal disease (GFR<15 ml/min/1.73m2) were included in the study.  Statistical analysis: The differences in protein excretion between subjects and controls were studied using paired t-test. Statistical significance was defined as p<0.05. Linear regression analysis was performed to explore the relationship of the individual proteins and age, and the individual proteins and GFR by univariate analysis. Proteins identified as clinically and/or statistically significant were then studied by multivariate analysis to explore the relationship of these proteins to GFR. Statistical significance was defined as the slope of the curve with R2 >0.2.  Results Proteinuria and renal function  Thirty boys with obstructive nephropathy secondary to PUV were age-matched with twenty-seven children attending the nephrology clinic for other reasons. By the conclusion of the study, we were unable to match three patients with PUV. The most common diagnoses in the control group were hydronephrosis, dysfunctional voiding, controlled hypertension, and solitary kidney. All children in the control group had age107  appropriate growth and were otherwise well. The characteristics of both groups are presented in Table 5.1.  Table 5.1 Clinical characteristics of subjects with posterior urethral valves and age-matched controls.  PUV (n=30)  Control (n=27)  Sex (male)  30  13  Age (years)  7 (0.1 – 18)  7 (0.5 – 16)  Urinary protein (g/L)  0.10 (0.04 – 0.66)  0.04 (0.04 – 0.12)  Urine protein/creatinine ratio (g/mol)  46 (5 – 438)  7 (2 – 136)  Plasma creatinine (µmol/L)  63 (13 – 322)  Not measured  GFR (ml/min/1.73m2)  65 (27 – 138)  Not measured  Values are presented as the median with range in parentheses.  Renal function of subjects with PUV and obstructive nephropathy varied widely from normal (n=8), to mild (n=8), moderate (n=10) or severe (n=4) renal impairment. Median GFR values were 102 ml/min/1.73m2 in CKD stage 1 group, 71 ml/min/min/1.73m2 in CKD stage 2, 47 ml/min/1.73m2 in CKD stage 3, and 29 ml/min/1.73m2 in CKD stage 4. As expected, the subjects with PUV had more proteinuria than controls (median urinary protein/creatinine ratio 46 vs. 7 g/mol, p<0.01). Proteinuria increased proportionately to the decrease in renal function from median protein/creatinine ratio of 10 g/mol (CKD stage 1), 33 g/mol (CKD stage 2), 66 g/mol (CKD stage 3) to 101 g/mol (CKD stage 4) (Figure 5.1).  108  Figure 5.1 Relationship between the stage of chronic kidney disease, the degree of proteinuria and renal impairment in subjects with obstructive nephropathy due to posterior urethral valves. CKD stage based on GFR in ml/min/1.73 m2. Stage 1, >90; stage 2, 60-89; stage 3, 30-59; stage 4, 15-29.  Urinary biomarkers  We first measured the differences in the excretion of individual proteins of interest in urine between subjects with obstructive nephropathy and controls. The analysis of whole urine obtained from subjects showed significantly lower levels of AQP2 (p=0.02) and Ncadherin (p=0.01), significantly higher levels of TGF-β1 (p=0.01), and no significant differences in V-ATPase, TRPV4, and L1CAM excretion compared to controls (Figure 5.2A). There was no detectable expression of E-cadherin and β-catenin in whole urine samples of both subjects and controls.  109  Figure 5.2 Whole urine and urine exosome levels of biomarkers in subjects with obstructive nephropathy due to posterior urethral valves and controls. Median values and range are presented for each protein measured in (A) whole urine and (B) urine exosomes.  Similar to whole urine, the analysis of urine exosome protein revealed significantly higher levels of TGF-β1 (p=0.02), but in contrast to whole urine, TRPV4, L1CAM, and β-catenin were also increased (p<0.01, <0.01, and =0.03, respectively). Like whole urine, 110  exosomes showed significantly lower levels of N-cadherin (p<0.01) in subjects compared to controls. E-cadherin was detected in urine exosome protein of subjects in significantly lower quantity (p<0.01) than in controls. The levels of AQP2 and V-ATPase in urinary exosomes were not significantly different between the two groups (Figure 5.2B). Notably, there was undetectable expression of vimentin and α-SMA in the whole urine samples and urine exosomes in both subjects and controls (data not shown). The summary of the differential excretion of these proteins is presented in Table 5.2.  Table 5.2 The levels of potential biomarkers of obstructive nephropathy in whole urine and urine exosomes of subjects with obstructive nephropathy due to posterior urethral valves compared to age-matched controls.  Excretion in subjects  Increased  Decreased  Unchanged  Whole urine  TGF-β1  AQP2 N-cadherin  V-ATPase TRPV4 L1CAM  Exosomes  TGF-β1 TRPV4 L1CAM β-catenin  N-cadherin E-cadherin  AQP2 V-ATPase  Next, we explored the relationship of individual protein excretion to age. The only statistically significant relationship was between the excretion of TRPV4 in urine exosomes and the age of the subjects (R2=0.23). As the subject’s age increased, so did TRPV4 excretion in exosomes (Figure 5.3A).  111  Figure 5.3 Relationship between the excretion of urinary biomarkers, age and kidney function. (A) TRPV4 excretion in urine exosomes in subjects demonstrated a statistically significant positive correlation with increasing age (R2=0.23), but was not significant in controls. (B) TGF-β1 excretion in whole urine of subjects with obstructive nephropathy correlated with renal impairment (R2=0.23), while (C) a similar trend was present with the excretion of TRPV4 in whole urine of subjects, but this relationship was not statistically significant.  112  We then studied the relationship between individual protein excretion and GFR in subjects with PUV. In the whole urine, worsening of the kidney function was associated with increasing levels of TGF-β1 and TRPV4, and decreasing levels of N-cadherin, but only the relationship between TGF-β1 and GFR was statistically significant (R2=0.23) (Figures 5.3B and 5.3C). There was a wide variation in the levels of AQP2, V-ATPase and L1CAM. No significant relationship could be demonstrated between exosome proteins and GFR.  Finally, using multivariate analysis we analyzed the relationship between individual protein excretion and GFR. The only protein that showed a statistically significant relationship to GFR was TGF-β1 in whole urine (p<0.001). Adding other proteins to the model did not add significance, with the closest being TRPV4 (p=0.18). No relationship between the levels of individual exosome proteins and GFR could be demonstrated in a multivariate model.  Discussion In this study, we have demonstrated that proteins that are differentially expressed in kidneys in human and experimental models of obstructive nephropathy can be easily measured in whole urine and in urine exosomes. The urinary “expression patterns” of these proteins distinguish patients with posterior urethral valves (PUV) and obstructive nephropathy from normal controls. Furthermore, selected proteins, such as TGF-β1, correlate with the degree of renal impairment of the obstructed kidneys.  113  Urinalysis and, in particular, measurement of protein in urine, has always been regarded as a cornerstone of the assessment of patients suspected of having kidney disease. Albumin is the main protein in urine, but with the development of more sophisticated diagnostic techniques, subtle changes in the excretion of specific proteins of smaller molecular weight than albumin can be studied. In recent years, urinary proteomics-based approaches have emerged as tools of earlier detection of kidney disease, improved assessment of the severity of disease, or more precise monitoring of response to therapy.15  Additionally, the analysis of proteins associated with urine exosomes may be of pathophysiologic interest and diagnostic utility. Urine exosomes, the internal vesicles of multivesicular bodies (MVBs), are released to the urine by fusion of the outer membrane of MVBs with the apical plasma membrane of renal tubular epithelial cells.16 They contain membrane and cytosolic proteins, specific for each type of epithelial cells facing the urinary space, that might be altered in quantity as a reflection of the disease affecting these cells. As such, exosomes reflect the physiological or pathophysiological state of their cells of origin.17  We have chosen to study candidate proteins or potential biomarkers with a biological rationale in mind and based on our previous description of tubulo-interstitial disease in fetal animal9 and human10 studies. E-cadherin molecules are part of a cadherin/catenin adhesion complex that connects to the cell’s actin cytoskeleton. Molecules of E-cadherin from adjacent epithelial cells form homophilic adhesions, known as adherens junctions that hold the epithelial cells together and thus contribute to the maintenance of epithelial integrity.18 During obstruction of the urinary tract, epithelial cells lose E-cadherin, a 114  process well described in animal models9,19 and in human congenital obstructive nephropathy.10 Our analysis of urine exosomes demonstrates a significant decrease in the excretion of E-cadherin in subjects with obstructive nephropathy compared to controls, reflecting the in vivo alterations during congenital obstruction.  Interestingly, urine exosome β-catenin excretion was increased in patients with PUV. In vitro and in experimental models, urinary obstruction leads to stabilization of β-catenin in the cytoplasm of the cells which then plays important role in cell signaling.20,21 Tubular and collecting duct epithelial cells show dissociation of β-catenin from intercellular junctions and its translocation into the cytoplasm of the cells with increased gene expression of β-catenin in the obstructed kidneys.10  Notably, N-cadherin excretion was decreased in patients with PUV, both in whole urine and in urine exosomes. N-cadherin is another member of the cadherin gene family that plays important role during fetal kidney development.22 With acute kidney injury (AKI) and with congenital urinary tract obstruction, N-cadherin expression is decreased in the kidney.10,23 Not only was the excretion of N-cadherin decreased in subjects with PUV, but urinary levels were inversely proportional to kidney function. This relationship was not statistically significant, possibly due to a marked variation in the excretion of Ncadherin at lower levels of GFR.  In vivo, one of the most remarkable histopathological changes of congenital obstructive nephropathy is the extensive upregulation of mesenchymal proteins in the tubulointerstitial compartment.9,10 Surprisingly, analysis of whole urine and urine exosomes failed to show any expression of vimentin and α-SMA in most of the samples 115  irrespective of whether they were obtained from the subjects or controls. It is possible that these intermediate microfilaments are not secreted by the cells and are removed with the cellular debris during centrifugation.  Perhaps not surprisingly, one of the most informative proteins excreted in urine and associated with exosomes was TGF-β1. TGF-β1 is a multifunctional protein that controls proliferation, differentiation and many other functions of the cell and plays an important role in the development of tissue fibrosis.24,25 Previous studies have shown that TGF-β1 can be useful as a noninvasive diagnostic biomarker of upper26 and lower27,28 urinary tract obstruction as well as for monitoring the response of obstructed kidneys to surgical treatment. Similarly, we found increased levels of TGF-β1 in whole urine and in urine exosomes of subjects with obstructive nephropathy compared to controls, likely reflecting the extent of fibrosis in the kidneys of patients with PUV. Furthermore, increasing levels of TGF-β1 in whole urine of subjects with obstructive nephropathy were associated with a decrease in GFR, the only protein studied which demonstrated this significant relationship.  Three other proteins that showed altered urinary excretion in patients with PUV included TRPV4, L1CAM and AQP2. TRPV4 is a non-selective cation channel abundantly expressed in epithelial cells of the distal nephron, a region extensively affected by congenital urinary tract obstruction. It has been described as a molecular sensor of both fluid flow and osmolality29,30 and plays a central role in epithelial homeostasis by modulating transcellular ion flux as well as paracellular permeability in response to these stimuli.31 Increased levels of TRPV4 in urine exosomes of subjects with obstructive nephropathy support its contribution to the development of dysplasia in obstructed 116  kidneys. Additionally, increasing levels of TRPV4 in whole urine of subjects were associated with a decrease in kidney function, although the relationship lacked statistical significance.  L1CAM is a membrane glycoprotein normally expressed at the basolateral membrane of the collecting duct epithelial cells.32,33 With acute kidney injury its expression is translocated to the apical membrane, with de novo expression in the thick ascending limb of the loop of Henle and distal tubule.33 Urinary levels of L1CAM are also significantly increased in patients with acute tubular necrosis compared to other causes of acute kidney injury suggesting that this protein might be a marker of distal nephron injury during ATN.33 Our finding of significantly higher levels of L1CAM in urine exosomes from patients with PUV is consistent with the findings in cases of ATN.  Finally, we measured the levels of AQP2 and V-ATPase, proteins specific for principal and intercalated cells of the collecting duct, respectively. AQP2 is a water channel synthesized by principal cells of the collecting duct and stored in intracellular vesicles of these cells. Upon stimulation of principal cells by vasopressin, it is redistributed to the apical membrane, increases their permeability to water and allows water reabsorption from the lumen to the hypertonic medullary interstitium.34 V-ATPase is apically expressed in α-intercalated cells of the distal nephron and is responsible for acid secretion by these cells.35 AQP2 excretion was significantly lower in whole urine obtained from subjects with obstructive nephropathy compared to controls, and may also reflect CD injury and depletion of the principal cell population. The urinary excretion of V-ATPase did not differ between subjects and controls in our study.  117  In summary, we achieved a better diagnostic yield from exosomes compared to whole urine in our study with only three proteins differentially expressed between subjects and controls in whole urine (TGF-β1, AQP2 and N-cadherin), compared to six in urine exosomes (TGF-β1, TRPV4, L1CAM, β-catenin, N-cadherin and E-cadherin). This is likely due to the enrichment of urinary proteins in exosomes enhancing the detectability of rare proteins36 and the fact that the exosome fraction reflects active cellular processes of live cells. 37 Accordingly, we found the exosome fraction of urine a better source of apical membrane proteins (L1CAM, TRPV4), structural scaffolding proteins (E-cadherin and N-cadherin), and flow sensing proteins (TRPV4).  Conclusion  The present study demonstrates the clinical utility of urinary proteins as biomarkers of obstructive nephropathy due to posterior urethral valves. These proteins might be useful not only as noninvasive surrogate biomarkers reflecting the pathophysiological changes in the kidneys of patients with obstructive nephropathy but also to predict the decline in kidney function of affected individuals. This relationship needs to be explored in a prospective manner and will require larger numbers of subjects. Ultimately, the identified proteins might be useful as antenatal diagnostic biomarkers of obstructive nephropathy in amniotic fluid.  118  References 1.  Krishnan A, de Souza A, Konijeti R, Baskin LS: The anatomy and embryology of posterior urethral valves. J Urol 175: 1214-1220, 2006.  2.  Smith JM, Stablein DM, Munoz R, Hebert D, McDonald RA: The 2006 Annual Report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS). Pediatr Transplant 11: 366-373, 2007.  3.  Jaureguizar E, López-Pereira P, Martinez-Urrutia MJ: The valve bladder: etiology and outcome. Curr Urol Rep 3: 115-120, 2002.  4.  Drozdz D, Drozdz M, Gretz N, Möhring K, Mehls O, Schärer K: Progression to endstage renal disease in children with posterior urethral valves. Pediatr Nephrol 12: 630-636, 1998.  5.  Lal R, Bhatnagar V, Mitra DK: Long-term prognosis of renal function in boys treated for posterior urethral valves. Eur J Pediatr Surg 9: 307-311, 1999.  6.  Lopez Pereira P, Espinosa L, Martinez Urrutina MJ, Lobato R, Navarro M, Jaureguizar E: Posterior urethral valves: prognostic factors. BJU Int 91: 687-690, 2003.  7.  De Bruyn R, Marks SD: Postnatal investigation of fetal renal disease. Semin Fetal Neonatal Med 13: 133-141, 2008.  8.  Matsell DG, Tarantal AF: Experimental models of fetal obstructive nephropathy. Pediatr Nephrol 17: 470-476, 2002  9.  Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007.  119  10. Trnka P, Hiatt MJ, Ivanova L, Tarantal AF, Matsell DG: Phenotypic transition of the collecting duct epithelium in congenital urinary tract obstruction. J Biomed Biotechnol 2010: 696034, 2010. 11. Gaspari F, Perico N, Remuzzi G: Measurement of glomerular filtration rate. Kidney Int Suppl 63: S151-154, 1997. 12. Schwartz GJ, Haycock GB, Edelmann CM Jr, Spitzer A: A simple estimate of glomerular filtration rate in children derived from body length and plasma creatinine. Pediatrics 58: 259-263, 1976. 13. Schwartz GJ, Feld LG, Langford DJ: A simple estimate of glomerular filtration rate in full-term infants during the first year of life. J Pediatr 104: 849-854, 1984. 14. Levey AS, Coresh J, Balk E, Kausz AT, Levin A, Steffes MW, Hogg RJ, Perrone RD, Lau J, Eknoyan G: National Kidney Foundation: National Kidney Foundation practice guidelines for chronic kidney disease: evaluation, classification, and stratification. Ann Intern Med 139: 137-147, 2003. 15. Barratt J, Topham P: Urine proteomics: the present and future of measuring urinary components in disease. CMAJ 177: 361-368, 2007. 16. Pisitkun T, Shen RF, Knepper MA: Identification and proteomic profiling of exosomes in human urine. Proc Natl Acad Sci U S A 101: 13368-13373, 2004. 17. Gonzales P, Pisitkum T, Knepper MA: Urinary exosomes: is there a future? Nephrol Dial Transplant 23: 1799-1801, 2008. 18. Van Roy F, Berg X: The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci 65: 3756-3788, 2008. 19. Yang J, Liu Y: Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am J Pathol 159: 14651475, 2001. 120  20. MacDonald, BT, Tamai K, He X: Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17: 9-26, 2009. 21. Surendran K, Schiavi S, Hruska KA: Wnt-dependent beta-catenin signaling is activated after unilateral ureteral obstruction, and recombinant secreted frizzledrelated protein 4 alters the progression of renal fibrosis. J Am Soc Nephrol 16: 23732384, 2005. 22. García-Castro MI, Vielmetter E, Bronner-Fraser M: N-cadherin, a cell adhesion molecule involved in establishment of embryonic left-right asymmetry. Science 288: 1047-1051, 2000. 23. Nürnberger J, Feldkamp T, Kavapurackal R, Saez AO, Becker J, Hörbelt M, Kribben A: N-cadherin is depleted from proximal tubules in experimental and human acute kidney injury. Histochem Cell Biol 133: 641-649, 2010. 24. Wynn TA: Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J Clin Invest 117: 524-529, 2007. 25. Wolf G: Renal injury due to renin-angiotensin-aldosterone system activation of the transforming growth factor-beta pathway. Kidney Int 70: 1914-1919, 2006. 26. El-Sherbiny MT, Mousa OM, Shokeir AA, Ghoneim MA: Role of urinary transforming factor-beta1 in the diagnosis of upper urinary tract obstruction in children. J Urol 168: 1798-1800, 2002. 27. Palmer LS, Maizels M, Kaplan WE, Firlit CF, Cheng EY: Urine levels of transforming growth factor-beta1 in children with ureteropelvic junction obstruction. Urology 50: 769-773, 1997. 28. MacRae Dell K, Hoffman BB, Leonard MB, Ziyadeh FN, Schulman SL: Increased urinary transforming growth factor-beta (1) excretion in children with posterior urethral valves. Urology 56: 311-314, 2000. 121  29. Taniguchi J, Tsuruoka S, Mizuno A, Sato J, Fujimura A, Suzuki M: TRPV4 as a flow sensor in flow-dependent K+secretion from the cortical collecting duct. Am J Physiol Renal Physiol 292: F667-673, 2007. 30. Wu L, Gao X, Brown RC, Heller S, O’Neill RG: Dual role of the TRPV4 channel as a sensor of flow and osmolality in renal epithelial cells. Am J Physiol Renal Physiol 293: F1699-1713, 2007. 31. Harteneck C, Reiter B: TRP channels activated by extracellular hypo-osmolality in epithelia. Biochem Soc Trans 35: 91-95, 2007. 32. Nolte C, Moos M, Schachner M: Immunolocalization of the neural cell adhesion molecule L1 in epithelia of rodents. Cell Tissue Res 298: 261-273, 1999. 33. Allory Y, Audard V, Fontanges P, Ronco P, Debiec H: The L1 cell adhesion molecule is a potential biomarker of human distal nephron injury in acute tubular necrosis. Kidney Int 73: 751-758, 2008. 34. Kwon TH, Nielsen J, Møller HB, Fenton RA, Nielsen S, Frøkiaer J: Aquaporins in the kidney. Handb Exp Pharmacol 190: 95-123, 2009. 35. Hinton A, Bond S, Forgac M: V-ATPase functions in normal and disease processes. Pflugers Arch 457: 589-598, 2009. 36. Pisitkum T, Johnstone R, Knepper MA: Discovery of urinary biomarkers. Mol Cell Proteomics 5: 1760-1771, 2006. 37. Hoorn EJ, Pisitkun T, Zietse R, Gross P, Frokiaer J, Wang NS, Ganzales PA, Star RA, Knepper MA: Prospects for urinary proteomics: exosomes as a source of urinary biomarkers. Nephrology (Carlton) 10: 283-290, 2005.  122  CHAPTER 6  SUMMARY AND CONCLUSIONS  Congenital obstructive nephropathy is a major cause of chronic kidney disease and endstage renal disease in infants and children in all parts of the world.1-3 Although the diagnosis of congenital urinary tract obstruction is relatively straightforward, there are many clinical uncertainties and controversies regarding the diagnosis, optimal management, and prognosis of congenital obstructive nephropathy. Antenatal diagnosis of the severity of obstructive nephropathy is limited and therefore there is no consensus on the indication or the timing of fetal intervention. The outcome studies of fetal interventions are small and they report conflicting, but mainly poor results. The perinatal mortality and long-term morbidity of affected children remain high.  The purpose of this thesis was to summarize the difficulties related to the diagnosis and management of congenital obstructive nephropathy, and to describe potential reasons for limited success; to characterize the alteration of normal molecular events occurring in the obstructed fetal kidney; and using this biological rationale, to identify potential biomarkers of renal dysplasia that might serve as a basis for the development of noninvasive diagnostic tests which better reflect the histopathology of obstructive nephropathy and better correlate with altered kidney function.  123  To achieve these goals, I used different techniques, including literature review, basic laboratory tests, and clinically based methods. In the first project, I used a comprehensive systematic review of the available literature on congenital obstructive nephropathy, by searching PubMed and MEDLINE databases for terms related to different topics of the review without limitations on the year of publication. The identified articles, some of them more than 40 years old, provided an excellent source of information about studies rarely conducted today, especially in the section on fetal renal physiology. In the second project, I used the techniques of immunohistochemistry to study the expression and localization of proteins and quantitative real-time PCR to study the expression of the corresponding genes involved in epithelial-mesenchymal transition (EMT) in human fetal kidney samples of congenital obstructive nephropathy and normal fetal kidneys. The third project was an in vitro study using an immortalized mouse inner medullary collecting duct cell line stimulated by insulin-like growth factor-1 (IGF-1) to induce EMT. I studied the role of Y-box binding protein-1 (YB-1) in this process as well as the involvement of PI3K/Akt, Mapk/Erk and RSK pathways using the techniques of siRNA knockdown, the changes in localization of epithelial and mesenchymal proteins using immunocytochemistry, the quantitative changes of these proteins including their subcellular localization through the process of subcellular fractionation and Western blot analysis. In the last project included in this thesis, I attempted to bring the knowledge of the pathophysiology of congenital urinary obstruction gained from the first three studies from bench to clinic. The technique I used in this last project involved the use of Western blot analysis to study differential expression of potential biomarkers in urine of patients with congenital obstructive nephropathy and healthy controls.  124  What are the main challenges in the management of congenital obstructive nephropathy and reasons for limited success of antenatal intervention? Currently, in clinical practice, the detailed description of the pathology of the fetal renal tract and the determination of the correct diagnosis of the conditions causing obstruction remain difficult.4 Similarly, the correlation between the findings on prenatal ultrasound and histological changes of renal dysplasia in affected kidneys is poor.5 A new diagnostic approach based on the molecular biology of fetal obstructive nephropathy might be more appropriate. In addition to this lack of reliable diagnostic tests of the severity of disease, another important reason for the disappointing outcomes of surgical intervention in fetuses with bladder outlet obstruction is the lack of standardization of patient enrollment and definition of outcome measures. In an attempt to circumvent this issue, the Percutaneous Shunting in Lower Urinary Tract Obstruction (PLUTO) trial from University of Birmingham6 was developed. This is a multicentre, randomized controlled trial aiming to recruit 150 singleton pregnancies with evidence of lower urinary tract obstruction to evaluate the safety and effectiveness of in utero shunting compared to conservative management. Eligibility to participate is based on “uncertainty principle” where the fetal medicine specialist is uncertain as to whether shunting is the most appropriate option of treatment. Although the main outcome measure of this trial is perinatal mortality, longterm follow-up of surviving patients includes assessments of renal function, bladder function and cognitive development. Interestingly, an optional assessment of markers of tubular damage has been proposed. These might include some of the candidate biomarkers of obstructive nephropathy described in this thesis. As such, this important multicentre randomized trial will not only allow enrollment of sufficient numbers of patients to assess the effect of fetal intervention on renal function but also provides the  125  opportunity to investigate non-invasive biomarkers of obstructive nephropathy in urine and amniotic fluid.  Driven by the poor outcomes of babies with congenital urinary tract obstruction, many experimental models of fetal urinary tract obstruction have been developed7 including our fetal monkey model of unilateral ureteral obstruction.8,9 The most pronounced feature of kidney injury in this model is medullary tubulointerstitial disease, with a considerable contribution from mesenchymal-myocyte transformation of the epithelial cells9 and epithelial-mesenchymal transition (EMT), which has been shown to contribute to the population of interstitial fibroblasts/myofibroblasts and to the development of renal fibrosis in numerous studies.10-14 Our human fetal study of obstructive nephropathy is consistent with the hypothesis that the collecting duct epithelium undergoes phenotypic changes suggestive of EMT during congenital urinary tract obstruction and that these transformed cells contribute to renal fibrosis. The main histological changes of cystic dysplasia were the same as in the monkey model, with decreased glomerular endowment, reduced numbers of collecting ducts (CDs), profound medullary tubulointerstitial disease and similar but more severe CD EMT.  The molecular mechanisms and cellular signaling guiding EMT or fibrosis have been elucidated in great detail, particularly in cancer,15,16 and have been studied in kidney as well in recent years.17 Expression of YB-1 in the CD epithelium or its potential role in the disease progression of this part of the nephron has never been studied. Our project, to our knowledge, is the first of such studies. The results are consistent with our hypothesis that YB-1 plays an important regulatory role in EMT of CD epithelium and that the inactivation of YB-1 prevents IGF-1-induced EMT. What are the potential clinical 126  implications of these findings? The targeted inactivation of this protein with subsequent attenuation of EMT might potentially slow down or even stop the process of interstitial fibrosis of the obstructed kidneys, as has been demonstrated in oncology studies.18 Similarly, the involved signaling pathways might serve as a therapeutic target. For example, Akt pathway has been investigated as a potential novel target of disrupting the nuclear translocation of YB-1 in ovarian cancer.19 MAPK pathway and RSK protein also seem to be attractive targets in breast cancer.20 Specific inhibitors of these pathways are available and can be studied in experimental models of congenital obstructive nephropathy. The role of YB-1 in normal development, however, has to be explored before clinical application of this approach as the involved signaling pathways might also play important normal developmental roles.  The final step in bringing the knowledge obtained in our experimental studies back to the clinic was to test the hypothesis that the proteins implicated in pathophysiology of obstructive nephropathy can be measured in urine and used as non-invasive biomarkers of this disease. Proteins studied in the final project of this thesis were chosen based on their altered expression in and contribution to the previously described human and experimental models of obstructive nephropathy, and included cytoskeletal, epithelial, mesenchymal, flow-sensing, and profibrotic proteins.21-24 We demonstrated that proteins that are differentially expressed in kidneys in human and experimental models of obstructive nephropathy can be easily measured in whole urine and in urine exosomes. The urinary “expression patterns” of these proteins, in particular TGF-β1, TRPV4, L1CAM, β-catenin, AQP2, and the cadherins distinguish patients with posterior urethral valves and obstructive nephropathy from normal controls. Furthermore, selected proteins, such as TGF-β1, correlate with the degree of renal impairment of the obstructed kidneys. 127  This study describes the largest number of cases with posterior urethral valves in literature and demonstrates the clinical utility of urinary biomarkers in obstructive nephropathy. These biomarkers might also be useful to predict the decline in kidney function of affected individuals. This relationship needs to be explored in a prospective manner and will require larger numbers of subjects. Ultimately, the identified proteins might be useful as antenatal diagnostic biomarkers of obstructive nephropathy in amniotic fluid.  In 2002 the research priorities for congenital obstructive nephropathy as summarized in the NIH strategic planning workshop included: 1) defining the natural history and pathological description of obstructive nephropathy by developing biomarkers in humans and animal models to generate measures of injury and functional impairment, 2) elucidating the cellular and molecular basis of renal maldevelopment with the focus on the link between functional and developmental pathophysiology, and 3) developing a clinical research infrastructure with the creation of comprehensive registries of patients to include urine, plasma, and tissue samples, as well as standardized imaging leading to clinical trials.25 These recommendations were written almost a decade ago, but the priorities remain the same today. The studies on biomarkers of obstructive nephropathy in humans are scarce, there are no comprehensive registries of affected patients, and multicentre collaborations are practically non-existent.  Many questions in this field remain unanswered and we are a long way from finding a “cure” for these unfortunate babies. But important steps have been made. Our understanding of the underlying pathophysiology of obstructive nephropathy is improving, there is active research in the field of biomarkers of this disease, and possible 128  targets for intervention have been identified. The findings presented in this thesis contribute to this knowledge and will hopefully stimulate and provide the foundation for further research of this important childhood condition.  129  References 1.  Smith JM, Stablein DM, Munoz R, Hebert D, McDonald RA: The 2006 Annual Report of the North American Pediatric Renal Trials and Collaborative Studies (NAPRTCS). Pediatr Transplant 11: 366-373, 2007.  2.  Ardissino G, Daccò V, Testa S, Bonaudo R, Claris-Appiani A, Taioli E, Marra G, Edefonti A, Sereni F; ItalKid Project: Epidemiology of chronic renal failure in children: Data from the ItalKid project. Pediatrics 111: e382-387, 2003.  3.  McDonald SP, Craig JC; Australian and New Zealand Paediatric Nephrology Association. Long-term survival of children with end-stage renal disease. N Engl J Med 350: 2654-2662, 2004.  4.  Abbott JF, Levine D, Wapner R: Posterior urethral valves: inaccuracy of prenatal diagnosis. Fetal Diagn Ther 13: 179-183, 1998.  5.  Robyr R, Benachi A, Daikha-Dahmane F, Martinovich J, Dumez Y, Ville Y: Correlation between ultrasound and anatomical findings in fetuses with lower urinary tract obstruction in the first half of pregnancy. Ultrasound Obstet Gynecol 25: 478-482, 2005.  6.  Pluto Collaborative Study Group, Kilby M, Khan K, Morris K, Daniels J, Gray R, Magill L, Martin B, Thompson P, Alfirevic Z, Kenny S, Bower S, Sturgiss S, Anumba D, Mason G, Tydeman G, Soothill P, Brackley K, Loughna P, Cameron A, Kumar S, Bullen P: PLUTO trial protocol: percutaneous shunting for lower urinary tract obstruction randomised controlled trial. BJOG 114: 904-905, 2007.  7.  Matsell DG, Tarantal AF: Experimental models of fetal obstructive nephropathy. Pediatr Nephrol 17: 470-476, 2002.  8.  Tarantal AF, Han VK, Cochrum KC, Mok A, daSilva M, Matsell DG: Fetal rhesus monkey model of obstructive renal dysplasia. Kidney Int 59: 446-456, 2001. 130  9.  Matsell DG, Mok A, Tarantal AF: Altered primate glomerular development due to in utero urinary tract obstruction. Kidney Int 61: 1263-1269, 2002.  10. Hay ED, Zuk A: Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced. Am J Kidney Dis 26: 678-690, 1995. 11. Picard M, Baum O, Vogetseder A, Kaissling B, Le Hir M: Origin of renal myofibroblasts in the model of unilateral ureter obstruction in the rat. Histochem Cell Biol 130: 141-155, 2008. 12. Zeisberg M, Kalluri R: The role of epithelial-to-mesenchymal transition in renal fibrosis. J Mol Med 82: 175-181, 2004. 13. Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG: Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest 110: 341-350, 2002. 14. Butt MJ, Tarantal AF, Jimenez DF, Matsell DG: Collecting duct epithelialmesenchymal transition in fetal urinary tract obstruction. Kidney Int 72: 936-944, 2007. 15. Radinsky DC, Kenny PA, Bissell MJ: Fibrosis and cancer: do myofibroblasts come also from epithelial cells via EMT? J Cell Biochem 101: 830-839, 2007. 16. López-Novoa JM, Nieto MA: Inflammation and EMT: an alliance towards organ fibrosis and cancer progression. EMBO Mol Med 1: 303-314, 2009. 17. Liu Y: New insights into epithelial-mesenchymal transition in kidney fibrosis. J Am Soc Nephrol 21: 212-222, 2010. 18. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E, Turbin D, Berquin IM, Mertens PR, Iftner T, Gilks CB, Dunn SE: Disruption of the Y-box binding protein1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879, 2006. 131  19. Basaki Y, Hosoi F, Oda Y, Fotovati A, Maruyama Y, Oie S, Ono M, Izumi H, Kohno K, Sakai K, Shimoyama T, Nishio K, Kuwano M: Akt-dependent nuclear localization of Y-box binding protein 1 in acquisition of malignant characteristics by human ovarian cancer cells. Oncogene 26: 2736-2746, 2007. 20. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y, Dong Z, Berquin IM, Roux PP, Dunn SE: Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res 10: R99, 2008. 21. Trnka P, Hiatt MJ, Ivanova L, Tarantal AF, Matsell DG: Phenotypic transition of the collecting duct epithelium in congenital urinary tract obstruction. J Biomed Biotechnol 2010: 696034, 2010. 22. Allory Y, Audard V, Fontanges P, Ronco P, Debiec H: The L1 cell adhesion molecule is a potential biomarker of human distal nephron injury in acute tubular necrosis. Kidney Int 73: 751-758, 2008. 23. Wu L, Gao X, Brown RC, Heller S, O’Neil RG: Dual role of the TRPV4 channel as a sensor of flow and osmolality in renal epithelial cells. Am J Physiol Renal Physiol 293: 1699-1713, 2007. 24. MacRae Dell K, Hoffman BB, Leonard MB, Ziyadeh FN, Schulman SL: Increased urinary transforming growth factor-beta (1) excretion in children with posterior urethral valves. Urology 56: 311-314, 2000. 25. Chevalier RL, Peters CA: Congenital urinary tract obstruction: Proceedings of the State-Of-The-Art Strategic Planning Workshop-National Institutes of Health, Bethesda, Maryland, USA, 11-12 March 2002. Pediatr Nephrol 18: 576-606, 2003.  132  APPENDIX  ETHICS APPROVALS  All research projects and studies presented in this thesis were reviewed and approved by the UBC Research Ethics Board. Copies of the approvals for the individual chapters are as follows:  133  Ethics approvals for Chapter 2:  134  135  Ethics approval for Chapter 3:  136  137  Ethics approval for Chapter 4:  138  Ethics approval for Chapter 5:  139  140  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071159/manifest

Comment

Related Items