UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The biological role of IL-7Ralpha Y449 signaling in lymphocyte development, function and transformation Osborne, Lisa Colleen 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_osborne_lisa.pdf [ 8.18MB ]
Metadata
JSON: 24-1.0071126.json
JSON-LD: 24-1.0071126-ld.json
RDF/XML (Pretty): 24-1.0071126-rdf.xml
RDF/JSON: 24-1.0071126-rdf.json
Turtle: 24-1.0071126-turtle.txt
N-Triples: 24-1.0071126-rdf-ntriples.txt
Original Record: 24-1.0071126-source.json
Full Text
24-1.0071126-fulltext.txt
Citation
24-1.0071126.ris

Full Text

THE BIOLOGICAL ROLE OF IL-7Ralpha Y449 SIGNALING IN LYMPHOCYTE DEVELOPMENT, FUNCTION AND TRANSFORMATION by LISA COLLEEN OSBORNE B.Sc., University of Victoria, 2004 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) AUGUST 2010  © Lisa Colleen Osborne, 2010  Abstract The cytokine interleukin (IL)-7 is necessary for human T cell development and murine B and T lymphopoiesis. Mice lacking IL-7, either of its receptor components, the common γ chain (γc) or IL-7 receptor α (IL-7Rα), or essential intracellular signaling molecules are severely lymphopenic. Due to the developmental block in early T and B progenitors, the requirement for IL-7Rα signaling in later T and B cell stages has been difficult to evaluate. To address this question, we characterized lymphopoiesis in IL-7Rα449F mice harboring a single point mutation in IL-7Rα, where a key signaling residue (tyrosine 449) is mutated to phenylalanine (F). Biochemical analysis revealed that IL-7Rα Y449 is essential for activation of STAT5 and that there are both Y449-dependent and independent contributions to cell survival through regulation of Bcl-2 family members. IL-7Rα449F T and B cells are able to overcome the characteristic developmental block of IL-7Rα-/- mice and develop appreciable numbers of peripheral T and B cells. This finding permitted evaluation of peripheral T cell function. These experiments demonstrated that IL-7Rα Y449 signals are required for naïve T cell homeostasis, generation of a primary CD4 T cell response and for maintenance of memory CD8 T cells following Listeria monocytogenes infection. In contrast to expectations, the CD8 memory T cell maintenance defect does not appear to be a direct result of decreased Bcl-2 expression. Dysregulated cytokine signaling can also contribute to development and/or maintenance of leukemia and lymphoma. Through genetic analysis of two distinct oncogenes, we were able to show that the IL-7Rα449F mutation was sufficient to protect mice from IL-7 mediated T and B cell transformation and significantly delay the emergence of B cell lymphomas in the Eµ-myc mouse model of Burkitt’s lymphoma. Disruption of STAT5 activation appears to play a significant role in both models of tumor protection. Collectively, the data demonstrate that IL-7Rα signaling has both Y449-dependent and independent modalities that cooperate to ensure optimal B and T cell development and response to infection. Further, the data show that these signaling pathways can contribute to lymphomagenesis, and may be attractive targets for immunotherapeutics of IL-7 responsive tumors.  ii  Table of Contents Abstract .......................................................................................................................................... ii
 Table of Contents........................................................................................................................... iii
 List of Tables ................................................................................................................................ vii
 List of Figures .............................................................................................................................viiii
 List of Abbreviations ..................................................................................................................... ix
 Acknowledgements........................................................................................................................ xi
 Dedication ..................................................................................................................................... xii Co-authorship Statement.............................................................................................................. xiii 1
 Introduction............................................................................................................................... 1
 1.1
 The adaptive immune system: A double edged sword ...................................................... 2
 1.2
 The γc cytokine family in lymphocyte development and function.................................... 3
 1.3
 IL-7Rα signaling and effects on cellular function............................................................. 4
 1.4
 Specific functions of IL-7 during lymphocyte development ............................................. 7
 1.4.1
 IL-7 provides essential survival signals to developing thymocytes............................ 7
 1.4.2
 IL-7 signaling has multiple roles in B lymphopoiesis ................................................ 9
 1.5
 Interleukin-7 and peripheral T cell homeostasis.............................................................. 12
 1.5.1
 IL-7 provides survival and proliferation signals to naïve T cells ............................. 12
 1.5.2
 Memory T cell quality and quantity are positively influenced by IL-7.................... 12
 1.6
 Lymphoid transformation as a result of de-regulated developmental signals ................. 15
 1.7
 Summary .......................................................................................................................... 17
 1.8
 References........................................................................................................................ 26
 2
 Impaired CD8 T cell memory and CD4 T cell primary responses in IL-7Rα mutant mice... 35
 2.1
 Introduction...................................................................................................................... 36
 2.2
 Results.............................................................................................................................. 39
 2.2.1
 Generation of IL-7Rα449F mice................................................................................. 39
 2.2.2
 Development of early hematopoietic lineages in IL-7Rα449F mice .......................... 39
 2.2.3
 IL-7Rα449F thymocytes bypass a developmental block ............................................ 40
 2.2.4
 IL-7Rα Y449 independent signals are involved in peripheral T cell development.. 41
 2.2.5
 Homeostatic proliferation is IL-7Rα Y449-dependent............................................. 42
 2.2.6
 IL-7Rα Y449 is essential for CD4 primary immune responses ............................... 42
 iii  2.2.7
 IL-7Rα Y449 is essential for maintenance of CD8 T cell memory.......................... 43
 2.2.8
 STAT5, but not Bcl-2, is IL-7Rα Y449-dependent.................................................. 45
 2.3
 Discussion ........................................................................................................................ 46
 2.4
 Materials and methods ..................................................................................................... 50 2.5
 References........................................................................................................................ 68
 3
 Selective ablation of the YxxM motif of IL-7Rα suppresses lymphomagenesis but maintains lymphocyte development .............................................................................................................. 72
 3.1
 Introduction...................................................................................................................... 73
 3.2
 Results.............................................................................................................................. 75
 3.2.1
 Abrogation of IL-7Rα Y449 signals protects from IL-7-mediated lymphomagenesis ................................................................................................................................... 75
 3.2.2
 IL-7Rα Y449 signaling is essential for IL-7-induced splenomegaly and CD8 T cell expansion but does not alter lymphoma precursor populations................................ 75
 3.2.3
 IL-7Rα Y449 is required for IL-7-mediated increases in cell survival .................... 76
 3.2.4
 c-Myc lymphomagenesis is reduced by the IL-7Rα449F mutation ............................ 77
 3.2.5
 IL-7Rα449F mutation inhibits essential progenitor B cell survival and proliferation signals ....................................................................................................................... 78
 3.2.6
 c-Myc tumors retain IL-7 responsiveness but become IL-7-independent ................ 79
 3.2.7
 IL-7Rα449F mice retain cell extrinsic susceptibility to tumors.................................. 80
 3.3
 Discussion ........................................................................................................................ 81
 3.4
 Materials and methods ..................................................................................................... 84
 3.5
 References...................................................................................................................... 104
 4
 Partial lymphopenia supports slow lymphopenia induced proliferation that is independent of increased IL-7 availability .......................................................................................................... 108
 4.1
 Introduction.................................................................................................................... 109
 4.2
 Results............................................................................................................................ 111
 4.2.1
 Partial lymphopenia in IL-7Rα449F mice supports LIP ........................................... 111
 4.2.2
 LIP in IL-7Rα449F mice is not due to increased self-peptide/MHC availability ..... 111
 4.2.3
 IL-7 availability is sufficient for LIP induction, but does not account for LIP in IL7Rα449F hosts........................................................................................................... 113
 4.2.4
 Transferred polyclonal T cells retain TCR Vβ diversity ........................................ 113
 4.3
 Discussion ...................................................................................................................... 115
 iv  4.4
 Materials and methods ................................................................................................... 118
 4.5
 References...................................................................................................................... 126
 5
 General discussion and future perspectives .......................................................................... 129
 5.1
 IL-7Rα Y449 signals regulate lymphocyte development, homeostasis and function ... 130
 5.1.1
 IL-7Rα signaling pathways and survival in B and T cell development ................. 131
 5.1.2
 An undefined requirement for IL-7Rα in T cell progenitors.................................. 132
 5.1.3
 Homeostasis and function of peripheral T cells...................................................... 133
 5.1.4
 B cell development in the absence of IL-7Rα Y449 .............................................. 135
 5.1.5
 Potential role of glucose metabolism in protection from Eµ-myc transformation.. 136
 5.1.6
 Clinical uses of IL-7 and implications .................................................................... 137
 5.2
 Future directions ............................................................................................................ 139
 5.2.1
 Analysis of IL-7Rα Y449-independent signaling in thymopoiesis ........................ 139
 5.2.2
 Characterization of the CD4 primary response defect in IL-7Rα449F mice ............ 141
 5.2.3
 Determination of survival deficiency mechanism in IL-7Rα449F CD8 memory T cells ................................................................................................................................. 142
 5.2.4
 B cell development in the absence of IL-7Rα Y449 signaling............................... 144
 5.2.5
 Contribution of IL-7Rα Y449 signaling to autoimmune pathology....................... 145
 5.3
 Concluding remarks ....................................................................................................... 148
 5.4
 References...................................................................................................................... 149
 Appendix A................................................................................................................................. 154
 A.1
 Objective ........................................................................................................................ 155 A.2
 Preliminary results ......................................................................................................... 156
 A.3
 Summary
and
future directions..................................................................................... 158 Appendix B ................................................................................................................................. 161
 B.1
 Objective ........................................................................................................................ 162 B.2
 Preliminary results ......................................................................................................... 163
 B.3
 Summary
and
future directions..................................................................................... 166 Appendix C ................................................................................................................................. 173
 C.1
 Objective ........................................................................................................................ 174 C.2
 Preliminary results ......................................................................................................... 175
 C.3
 Summary
and
future directions..................................................................................... 177 Appendix D................................................................................................................................. 181
 v  List of Tables Table 3.1 Phenotypes of Tg IL-7; IL-7Rα+/+ tumors.................................................................. 102
 Table 3.2 Phenotypes of Eµ myc; IL-7Rα+/+ and Eµ myc; IL-7Rα449F tumors .......................... 103
  vi  List of Figures Figure 1.1 Schematic representation of γc cytokine family receptors .......................................... 18
 Figure 1.2 Schematic view of T lymphopoiesis within the thymus.............................................. 19
 Figure 1.3 Summary of progenitor B cell development ............................................................... 20
 Figure 1.4 Flt3/Ras signaling maintains progenitor B cells in a state of IL-7 responsiveness ..... 21
 Figure 1.5 Signals from the pre-BCR and IL-7 co-operate to maintain pre-B cells..................... 22
 Figure 1.6 BCR signaling pathways ............................................................................................. 23
 Figure 1.7 Homeostatic proliferation of T cells is regulated by IL-7 and interaction with APCs 24
 Figure 1.8 T cell responses to acute and chronic infections in mice and the requirement for IL-7 ....................................................................................................................................................... 25
 Figure 2.1 Generation of IL-7Rα449F knock-in mouse.................................................................. 56
 Figure 2.2 Southern blot analysis of knock-in mutation of the IL-7Rα locus.............................. 57
 Figure 2.3 Bone marrow progenitor populations and IL-7Rα expression are normal in IL-7Rα449F mice............................................................................................................................................... 58
 Figure 2.4 An early thymocyte defect is bypassed in IL-7Rα449F mice........................................ 60
 Figure 2.5 Disruption of IL-7Rα Y449 signaling only partially perturbs peripheral lymphocyte development.................................................................................................................................. 61
 Figure 2.6 IL-7Rα Y449F site-specific mutation does not affect expression of receptor subunits of the γc-sharing cytokines (γc chain or IL-2/15Rβ) in peripheral T cells ................................... 62
 Figure 2.7 Signals from IL-7Rα Y449 are essential for IL-7 driven homeostatic proliferation .. 63
 Figure 2.8 IL-7Rα Y449 is essential for the CD4 primary response to Listeria monocytogenes 65
 Figure 2.9 CD8 memory T cells require signals from IL-7Rα Y449 for long-term maintenance 66
 Figure 2.10 IL-7Rα449F mutation abrogates activation of STAT5 but Bcl-2 up-regulation is Y449-independent......................................................................................................................... 67
 Figure 3.1 IL-7Rα Y449 signaling is essential for Tg IL-7 mediated lymphomagenesis, splenomegaly and CD8 T cell expansion...................................................................................... 88
 Figure 3.2 IL-7Rα Y449 is required for Tg IL-7 mediated lymphomagenesis ............................ 89
 Figure 3.3 Increased Bcl-2 and Bcl-xL expression in T lymphocytes as a result of chronic IL-7 exposure is IL-7Rα Y449-dependent ........................................................................................... 91
 Figure 3.4 Lymphoma protected IL-7Rα449F mice show abrogated cell survival signals ............ 93
 Figure 3.5 Mutation of IL-7Rα Y449 significantly delays Eµ-myc mediated oncogenesis ......... 94
 vii  Figure 3.6 Quantification of total protein in Myc-induced tumor lysates .................................... 95
 Figure 3.7 IL-7Rα Y449 is required for viability and proliferation of B cell subsets.................. 96
 Figure 3.8 Mature B cells from WT and IL-7Rα449F mice lack surface expression of IL-7Rα ... 97
 Figure 3.9 IL-7Rα Y449 is essential for IL-7 mediated activation of STAT5 in bone marrow progenitor B cells.......................................................................................................................... 98
 Figure 3.10 PI3 kinase p110δ activity is non-essential for Tg IL-7 mediated lymphomagenesis 99
 Figure 3.11 c-Myc tumors retain IL-7 responsiveness but become IL-7-independent............... 100
 Figure 3.12 IL-7Rα449F mice retain cell extrinsic susceptibility to tumors ................................ 101
 Figure 4.1 Chronic partial lymphopenia supports slow T cell proliferation............................... 120
 Figure 4.2 Proliferating polyclonal T cells take on a memory phenotype in response to partial lymphopenia................................................................................................................................ 121
 Figure 4.3 IL-7Rα449F mutation does not dramatically alter TCR Vβ repertoire ....................... 122
 Figure 4.4 IL-7 overexpression is sufficient to drive T cell proliferation .................................. 123
 Figure 4.5 Partial lymphopenia cannot be accounted for by increased IL-7 availability, but may provide greater access to antigen presenting cells ...................................................................... 124
 Figure 4.6 Lymphopenia induced proliferation does not cause clonal expansion of transferred T cells ............................................................................................................................................. 125
 Figure A.1 IL-7Rα Y449 signaling promotes optimal CD8 memory T cell generation and differentiation.............................................................................................................................. 159
 Figure A.2 In vitro activation of OT-I cells requires IL-7Rα Y449 signaling for survival, but not proliferation................................................................................................................................. 160
 Figure B.1 IL-7Rα449F mutation does not cause gross differentiation defects in OT-II TCR transgenic T cells ........................................................................................................................ 168
 Figure B.2 Bone Marrow derived Dendritic Cells (BMDCs) provide better stimulation of OT-II T cells than Listeria-OVA infectio ............................................................................................. 169
 Figure B.3 IL-7Rα449F mutation hinders OT-II T cell responses to OVA323-339-loaded BMDC challenge ..................................................................................................................................... 170
 Figure B.4 IL-7Rα449F mutation does not affect antigen presentation or activation capacity of BMDCs ....................................................................................................................................... 171
 Figure B.5 In vitro activation of OT-II cells is independent of IL-7 or IL-7Rα Y449............... 172
 Figure C.1 Innate-like B cells have distinct requirements for IL-7Rα signal ............................ 179
 Figure C.2 B1 and B2 cells are uniquely sensitive to IL-7 overexpression................................ 180
 viii  List of Abbreviations 
 APC  antigen presenting cell  Bax  Bcl-2 associated X protein  Bcl  B cell lymphoma  BCR B cell receptor BM  bone marrow  BMDC bone marrow derived dendritic cell BrdU 5-bromo-2-deoxyuridine CCL  C-C chemokine ligand  CCR C-C motif receptor CFA  complete Freund’s adjuvant  CFSE 5(6)-carboxyfluorescein diacetate N-succinimidyl ester CTP  circulating T cell progenitor  DC  dendritic cell  DN  double negative  DP  double positive  EAE  experimental autoimmune encephalopathy  EBF  Early B cell factor  ETP  early thymic progenitor  F  phenylalanine  Flt-3  Fms-like tyrosine kinase-3  FO  follicular  γc  gamma common chain  Glut1 glucose transporter 1 GSK-3 glycogen synthase kinase-3 HKX hexokinase HP  homeostatic proliferation  HSC  hematopoietic stem cell  IFN-γ interferon-γ IL  interleukin  Lin  lineage  LIP  lymphopenia induced proliferation ix  LLO  listeriolysin O  LM  Listeria monocytogenes  LMPP lineage committed multipotent precursor Mdm2 murine double minute-2 MHC major histocompatibility complex Mcl  myeloid cell leukemia  MOG myelin oligodendrocyte glycoprotein MS  multiple sclerosis  MZ  marginal zone  NK  natural killer  OVA ovalbumin Pax5  Paired box protein 5  PI3  phosphatidylinositol-3  PSGL1 P-selectin glycoprotein ligand 1 SP  single positive  STAT signal transducer and activator of transcription T1D  type 1 diabetes  TCR  T cell receptor  TSLP thymic stromal lymphopoietin WT  wild type  Y  tyrosine  x  Acknowledgements Many thanks to my supervisor, Ninan Abraham, for providing all the things that a good supervisor should: know-how, support, training and a good work environment but especially for infectious enthusiasm and for believing in me when I needed it. Overall, it’s been a pleasure. And to Jill and Kia – the original A-team members. My committee – Mike Gold, Marc Horwitz and Robert Kay, for insight, bringing your attention to meetings, and asking questions that forced me to think on my feet, process information and to respond in a (hopefully) intelligent manner. Thanks are extended to researchers who provided mouse lines and other reagents that were necessary for the research: Dr. Christine Eischen provided Eµ-myc mice; Dr. Bart Vanhaesebroeck provided p110δD910A mice; Dr. Philippa Marrack provided anti-Bim producing Ham151 cells. Dr. Sarah Gaffen provided technical support, Robert Farese and Stephen Young assisted with ES cell manipulation and microinjection, and Drs. Ken Harder, Pauline Johnson and Robert Kay provided helpful feedback of prepared manuscripts. Jacob Hodgson - for inspiration that a life of research can be fulfilling and rewarding and a reminder that the questions are always there, it’s just a matter of finding a way to address them, for long conversations that always made me think and for all kinds of advice that I should have written down. Maya Poffenberger for sanity, tea and a unique perspective on all subjects, Costanza Casiraghi for laughter, surprises and a courageous example, Martin Richer for pushing me to try and be that much better and Caylib Durand for reminding that in the end, it’s all fun and games. And very special thanks to my family: Momma, Nat & Keith and the kids, Dean, my Uncle Charlie and the rest of the Osborne clan. I love every single one of you. And to my friends, you’re unbelievably rad.  xi  Dedication To Gord - for your love, support, constant faith and laughter. You’re amazing. Thank you so much for being with me through it all.  xii  Co-authorship Statement Osborne LC, Dhanji S, Snow JW, Priatel JJ, Ma MC, Miners MJ, Teh HS, Goldsmith MA, Abraham N. 2007. Impaired CD8 T cell memory and CD4 T cell primary responses in IL7Rα mutant mice. The Journal of Experimental Medicine 204: 619-31.
 N Abraham generated the IL-7Rα449F mouse during his post-doctoral fellowship in the laboratory of MA Goldsmith. JW Snow and MC Ma helped with initial characterization of lymphocyte development in this mouse model (10% of published data). LC Osborne wrote the manuscript and designed, performed and analyzed experiments that make up 70% of published data. S Dhanji and JJ Priatel were extremely helpful in experimental design and analysis of data regarding L. monocytogenes infection of IL-7Rα449F mice. Osborne LC, Duthie KA, Seo J, Gascoyne RD, Abraham N. 2010. Selective ablation of the YxxM motif of IL-7Rα suppresses lymphomagenesis but maintains lymphocyte development. Oncogene. LC Osborne and N Abraham designed the study. LC Osborne performed experiments, analyzed data and wrote the manuscript. KA Duthie and JH Seo contributed to experimental setup. RD Gascoyne provided invaluable help with analysis and interpretation of lymphoid pathology samples.  xiii  1  Introduction1  1  A version of this chapter has been published. Osborne, LC Abraham, N. 2010 Regulation of memory T cells by γc cytokines. 2010. Cytokine 50: 105–113. 1  1.1  The adaptive immune system: A double edged sword Key characteristics of the adaptive immune system are specificity and memory. It is  estimated that circulating T cells can recognize up to 106 different epitopes at any given time, and upon recognition of a given epitope, memory lymphocytes are generated that provide qualitatively and quantitatively better protection upon re-encounter. Given these two characteristics, the adaptive immune system can provide more tailored/appropriate responses to infectious microorganisms than the generalized responses of the innate immune system. Vaccines are based on this principle and since their inception have prevented innumerable deaths from communicable diseases. Unfortunately, the immune system that developed as a means of protection can actually become a source of significant health issues in patients where regulatory imbalances occur. Genetic abnormalities can result in T and B cell immunodeficiencies, leaving patients susceptible to infection by opportunistic pathogens, often with fatal consequences (1). Conversely, lymphocytes are also common targets of transformation, and leukemias and lymphomas (cancers of the immune system) are estimated to have accounted for almost 10% of new cancer cases in Canada in 2008 (2). In genetically susceptible patients, autoimmune pathology can result in destruction of tissue or organs mediated by self-reactive immune mediators. The careful regulation of lymphocyte development and maintenance is a dynamic process involving numerous cytokines, chemokines and growth factors. Understanding the signals involved in lymphopoiesis and transformation will aid in developing treatments for immunodeficiency disorders as well as lymphomas.  2  1.2  The γc cytokine family in lymphocyte development and function Cytokines play an important role in lymphocyte development and homeostasis. The γ  common (γc) chain-dependent cytokine family includes interleukins (IL)-2, -4, -7, -9, -15 and 21, all of which use the γc chain as a receptor subunit. Loss of γc signaling in humans results in X-linked severe combined immunodeficiency (X-SCID) characterized by functionally deficient B cells and absent T and natural killer (NK) cells (T-B+NK-) (3). In contrast, γc-/- mice lack B cells in addition to T and NK cells (4). Despite the shared usage of the γc chain, individual γc cytokine family members have diverse roles in lymphocyte development and homeostasis. IL-2 and IL-15 are important in maintenance and development of regulatory T cells (5) and memory CD8 T cells (6-8), and IL-7 is essential for development of conventional αβ T cells, γδ T cells, survival and function of naïve and memory cells as well as murine B lymphopoiesis (9-13). In contrast, IL-4, IL-9 and IL-21 are dispensable for T and B cell development (14-17). IL-4 is essential for induction of a Th2 profile in CD4 helper T (Th) cells (18, 19) and IL-4 deficient mice have a B-cell intrinsic defect in class-switching to immunoglobulin (Ig) IgG1 and IgE (1). IL-21 has roles in NK cell and CD8 cytotoxic T lymphocyte (CTL) activity (20, 21) and is also important for Ig class-switching. Loss of signals mediated by IL-4 and IL-21 likely explain the observed B cell dysfunction in X-SCID patients (16). To provide signaling specificity to cytokines that have such diverse effects on a wide range of cell types, the γc typically pairs with α receptor subunits to form heterodimers that recognize unique cytokine ligands (Figure 1.1). The IL-2 and IL-15 receptors are heterotrimers composed of γc, their specific α receptor subunits and IL-2/15Rβ (CD122). The IL-7Rα chain transmits IL-7 mediated signals when partnered with the γc, but can also transmit thymic stromal lymphopoietin (TSLP) signals by partnering with the TSLP receptor, a γc-like molecule (22). TSLP has minimal effects on developing T or B cells, but its role in peripheral T cell homeostasis and effects on dendritic cell activation are becoming more appreciated (22). The complexity of the in vivo roles of these cytokines and the signaling pathways they elicit has been studied extensively and has provided numerous insights into immune regulation.  3  1.3  IL-7Rα signaling and effects on cellular function IL-7Rα signaling is of particular interest due to its importance in B and T lymphopoiesis  and roles in peripheral and memory T cells (9-11, 13, 23, 24). In addition, IL-7 has been implicated in a number of human lymphomas (25-33). Stromal cells of lymphoid organs produce IL-7 that acts on target cells by binding to its cognate receptor on the surface of lymphocytes. This induces activation of a number of downstream signaling pathways that can affect survival, proliferation, differentiation and cellular metabolism. Signaling analysis of IL-7 stimulation has identified two main pathways downstream of IL-7Rα, the Jak (Janus kinase)/STAT (signal transducer and activator of transcription) and PI3 (phosphatidylinositol-3) kinase/Akt pathways. The Jak kinases Jak 1 and Jak3 are necessary components, and there is some evidence that related non-receptor tyrosine kinases, such as Pyk2 (34), may contribute. Recruitment of STAT5 and the p85 subunit of PI3 kinase to the IL-7Rα is dependent upon phosphorylation of a tyrosine residue, Y449, that is part of a YxxM SH2 binding motif. The IL-7Rα Y449 requirement was originally demonstrated in human progenitor B cell lines (35, 36), human thymocytes (37, 38) and a murine T cell line (38). Through these pathways, IL-7Rα signaling contributes to survival and proliferation of developing B and T cells, as well as peripheral T cell homeostasis and function. In various cell types and in response to different stimuli, STAT5 can mediate transcription of anti-apoptotic Bcl-2 family members Bcl-2, Bcl-xL and Mcl-1 and of proliferation factors cyclinD2, pim1 and c-Myc (39). In response to IL-7, STAT5 has been demonstrated to be necessary for transcription of B lineage factors EBF (early B cell growth factor), Pax5 and for access to the Igµ heavy chain locus (40-43). Similarly, STAT5 mediates access to the T cell receptor (TCR) γ locus in response to IL-7 stimulation in developing thymocytes (44). Thus, STAT5 plays important roles downstream of IL-7 in development and survival of both B and T cells. Interestingly, STAT5-/- mice phenocopy IL-7Rα-/- mice, demonstrating that the absence of STAT5 precludes the ability of IL-7 to mediate lymphopoiesis (45). However, STAT5 is downstream of numerous other factors. Therefore, complete lack of STAT5 also disrupts signaling from these activators and interrupting these signaling pathways contributes to the severe phenotype, which includes stunted growth and neonatal lethality in addition to lymphopenia (45). Activation of PI3 kinase occurs in multiple cell types and is downstream of numerous signals, including integrin activation, G-protein coupled receptors, antigen receptors and 4  cytokines. Depending on the cell type and the integration of other cues, this can lead to cell survival, proliferation, migration and/or glucose metabolism. Akt phosphorylation is a common readout for activation of PI3 kinase. Downstream of IL-2, IL-4 and TCR signaling, robust Akt phosphorylation can be detected within 15 minutes. Initial reports of IL-7 mediated PI3 kinase signaling suggested that activation (assayed by either direct PI kinase activity or Akt phosphorylation) occurred with similar kinetics in human pre-B- and T-cell lines and human thymocytes (36-38). However, in primary murine T cells, IL-7 stimulation requires 6-18 hours to induce detectable Akt phosphorylation and at no time does it reach the signal strength induced by IL-2 or TCR cross-linking, but the signal is sustained much longer than in response to immediate activators (46, 47). Thus, PI3 kinase activation is not an immediate early event following IL-7 ligation in murine T cells, but through sustained signaling may significantly contribute to cell homeostasis. Interestingly, in response to certain cytokines Akt phosphorylation appears to require STAT5 as an intermediary (46). Cells expressing constitutively active forms of STAT5 due to oncogenic translocations or genetic manipulation also show constitutive Akt phosphorylation (48). This is PI3 kinase-dependent since treatment with the PI3 kinase inhibitor LY294002 disrupts Akt phosphorylation and diminishes cell survival and proliferation (46). The mechanistic details of this pathway have not been fully elucidated and may involve STAT5mediated transcription and/or protein-protein interactions. In an early hematopoietic cell line, expression of a mutant STAT5 that prevents DNA binding and transcription was sufficient to abrogate Akt phosphorylation although the transcriptional targets necessary for Akt phosphorylation were not defined (46). In contrast, previous reports have demonstrated that STAT5 can interact with PI3 kinase p85 through the scaffolding protein Gab2 in response to IL2 or IL-3 (48). Although not well understood, these results pinpoint STAT5 activity as a central requirement for mediating a number of IL-7 effects. Together, STAT5 and PI3 kinase signaling can be linked to the various effects IL-7 exerts on cells. Transcriptional up-regulation of anti-apoptotic Bcl-2 family members and inhibition of pro-apoptotic members through activation of these signaling pathways affects cell survival. Degradation of the cyclin dependent kinase inhibitor p27Kip1 downstream of PI3 kinase may be important for IL-7’s proliferative effect (49). In addition, IL-7 has been identified as an important regulator of glucose metabolism in lymphocytes (50). In order for IL-7 stimulation to maintain surface expression of the glucose transporter Glut1 and increase glucose uptake, the activation of IL-7Rα Y449, STAT5 and Akt are all required (46). Utilizing these signaling 5  pathways, IL-7 provides important homeostatic, proliferative and survival signals to developing B cells and thymocytes and peripheral T cells.  6  1.4  Specific functions of IL-7 during lymphocyte development  1.4.1  IL-7 provides essential survival signals to developing thymocytes Although the differentiation steps between hematopoietic stem cells (HSC) in the bone  marrow (BM) and thymic resident early thymic progenitor (ETP) are still being elucidated (51, 52), it is understood that a BM derived progenitor must exit into the circulation and from there home to and gain entry into the thymus. Contrary to the long-held assumption that these cells would derive from a lymphoid-restricted common lymphoid progenitor (CLP), these cells retain both myeloid and lymphoid potential and can give rise to B, NK and dendritic cells (DCs) as well as macrophages and granulocytes both in vitro and in vivo (53). However, the thymus as a primary lymphoid organ is a dedicated site for generation of T cells. A key factor for T cell lineage commitment is Notch signaling (54). Thymic stromal cells express Notch ligands Deltalike1 and Delta-like4, which interact with thymocyte expressed Notch1. This interaction allows for ligand-induced proteolysis and release of intracellular Notch that translocates to the nucleus and initiates a transcriptional program to cement T lineage commitment and inhibit differentiation of other lineages. The importance of this interaction is clearly demonstrated by genetic manipulation in mice – Notch1 deletion in hematopoietic progenitors or expression of dominant negative Deltex1 or MAML (Mastermind-like) (transcriptional target and regulator, respectively) abrogates T cell development but allows aberrant thymic B cell development (55, 56). Conversely, overexpression of intracellular Notch1 results in inhibited B lymphopoiesis and extrathymic immature T cell development (57). Collectively, these data demonstrate that Notch1 signals are both necessary and sufficient for T cell commitment and inhibition of B lineage potential. Thymocyte development can be monitored by surface expression of the CD4 and CD8 T cell co-receptors (Figure 1.2). The earliest developmental stages (double negative, DN) can be further separated into at least 4 subsets (DN1 to DN4) based on expression of CD44, CD25 and c-kit. The ETP has been characterized as a rare subset within the DN1 gate (LineageCD44hiCD25-c-kit+IL-7Rαlo) (58). Thymic progenitors enter the thymus from the blood at the cortical-medullary junction and traverse through the cortex as they undergo differentiation towards the CD4+CD8+ double positive (DP) stage (Figure 1.2) (54). During these stages, thymocytes undergo TCR rearrangement to generate either αβ or γδ TCRs. Cells that generate αβ TCRs must meet the stringent requirements of positive and negative selection. DP cells are tested for their ability to recognize self-peptide presented by major histocompatibility complex 7  (MHC) I or II and if they pass this positive selection test become either CD4+CD8- or CD4-CD8+ single positive (SP) cells that move into the medulla and undergo negative selection. The few cells that meet these requirements become either CD4+ single positive (SP) MHCII-restricted helper or regulatory T cells or CD8+ SP MHCI-restricted cytotoxic T cells. IL-7Rα is dynamically expressed during thymopoiesis. ETPs are characterized by low surface expression of IL-7Rα, but it is highly expressed by DN2 and DN3 cells, and is downregulated throughout the DP stage until the completion of positive selection. IL-7Rα-/- mice develop very few T cells, with thymic cellularity varying from 0.1-10% of wild type (WT) littermates and a developmental block at the DN1 to DN2 stage (10). IL-7-/- mice demonstrate a similar developmental block, but thymic cellularity is not as severely affected (11), suggesting that TSLP signaling through IL-7Rα contributes to the more severe defect. Although abrogation of TSLP signaling in TSLPR-/- mice only minimally affects T cell development, providing TSLP to IL-7-/- mice was sufficient to partially restore thymocyte cellularity (59). These data demonstrate that IL-7, not TSLP, is the primary activator of IL-7Rα signaling in the thymus, but that in its absence TSLP can play a supportive role. The primary role of IL-7Rα signaling in DN thymocytes appears to be the provision of survival signals through regulation of Bcl-2 family members. Indeed, ectopic expression of Bcl-2 allows for partial T cell reconstitution in IL-7Rα-/- mice (60, 61). Similarly, deletion of proapoptotic factors Bim or Bax in IL-7Rα-/- mice prevents apoptosis of early DN thymocytes and permits significantly higher recovery of mature thymocytes and peripheral T cells (62, 63). These data suggest that IL-7Rα is necessary for thymocyte survival since differentiation can proceed in the absence of IL-7Rα as long as apoptosis is prevented. Interestingly, despite the central role of IL-7Rα stimulated STAT5 signaling detailed in the previous section, αβ thymocyte development cannot be rescued in IL-7Rα-/- mice by expressing a constitutively active (CA) STAT5 protein (44). This suggests that STAT5 activation does not account for the entirety of the IL-7 signal and that STAT5-independent pathways can contribute to regulation of Bcl-2 family members downstream of IL-7. In contrast, retroviral expression of CA-STAT5 in hematopoietic progenitors of IL-7Rα-/- mice significantly increased γδ T cell production in fetal thymic organ culture (44). In conjunction with reports that STAT5 is necessary for chromatin modification and access to the TCR γ locus (64), these data suggest that STAT5 activity underlies the necessity of IL-7Rα in γδ T cell development. Activation of the PI3 kinase pathway is likely another important effect of IL-7 in thymocyte progenitors since deletion of the PI3 8  kinase negative regulator PTEN (phosphatase and tensin homolog deleted on chromosome 10) can also allow for IL-7 independent T cell differentiation (65). In agreement with the hypothesis that IL-7 is of primary importance in DN thymocytes, it is most highly expressed in the cortical region where DN cells reside (54). Altogether, these data show that IL-7 mediated signaling through the IL-7Rα provides supportive survival signals for generation of conventional αβ T cells, and that STAT5 signals are critical mediators of γδ T cell differentiation. 1.4.2  IL-7 signaling has multiple roles in B lymphopoiesis IL-7/IL-7Rα interactions are essential for murine B cell generation. Without these signals  B cell development is hindered at the earliest stage and progenitors are unable to maneuver the B220+CD19- (fraction A) to B220+CD19+ (fraction B) differentiation step (10, 11). However, there are detectable mature B cell pools in IL-7-/- and IL-7Rα-/- mice. These have been identified as progeny of fetal B lymphopoiesis, which is IL-7-independent (66). For unknown reasons, although this cytokine plays such an important role in murine B cell development, it appears dispensable for generation of human B cells (3). B cell maturation from hematopoietic stem cells requires generation of an intact, non-autoreactive B cell receptor. This is achieved by step-wise rearrangement of germline DNA at the Ig heavy chain (HC) and light chain (LC) loci and development can be monitored by expression of a number of surface markers (Figure 1.3). During B cell development, from the earliest stages until the pre-B to immature B transition, IL7 is thought to provide cues mediating proliferation, survival and differentiation signals. At the earliest stage, the differentiation of CD19- fraction A to CD19+ fraction B cells, IL-7Rα signaling is necessary for expression of B lineage specification genes EBF and Pax5 (40). STAT5 activity underlies the requirement for IL-7Rα signaling at this point, as expression of CA-STAT5b in IL-7Rα-/- cells restores EBF and Pax5 expression and allows generation of CD19+ progenitors (41). Interestingly, another important mediator of early B lymphopoiesis, FMS-like tyrosine kinase-3 (Flt3), has recently been shown to impact IL-7Rα/STAT5 signaling. In the absence of Ras activation downstream of Flt3 ligation, IL-7Rα surface expression, IL-7 responsiveness (as measured by STAT5 phosphorylation) and Ebf expression are decreased and pro-B cell development is inhibited (67). As with IL-7Rα-/- mice, CA-STAT5b was sufficient to restore pro-B cell development in mice lacking Ras signaling (67). Other Ras effects that contribute to pre-pro-B cell differentiation include mediating proliferation through Erk activation and inhibiting transcription of socs2 and socs3, negative regulators of cytokine-induced STAT signaling (see Figure 1.4) (67). These data support previous findings that Flt3/IL-7Rα double 9  knock out mice show complete B cell abrogation by demonstrating that Flt3 activation of Ras primes B cell progenitors and maintains them in an IL-7 responsive state in order for efficient transduction of IL-7 mediated survival and differentiation cues. At the pro-B cell stage (fractions B and C), IL-7Rα signaling through STAT5 provides survival signals through Mcl-1 expression (68). At these stages, heavy chain rearrangements are taking place and a number of groups have shown that IL-7Rα/STAT5 signaling contributes to B cell differentiation by regulating histone acetylation and chromatin accessibility of the distal variable regions of the IgH locus (41-43). Rearrangement of an Igµ HC capable of pairing with the surrogate light chain (SLC, composed of two proteins VpreB and λ5) allows surface expression of the HC/SLC heterodimeric pre-B cell receptor (BCR). Pre-BCR expression increases cellular sensitivity to IL-7, allowing them to proliferate in response to lower cytokine concentrations (69). This phenomenon has been proposed to act as a physical checkpoint (69, 70). Similar to the migration through the thymic cortex that developing thymocytes have to navigate, B cell progenitors in the BM have a spatial interaction with their environment. A hypothetical model in which developing B cells migrate through a gradient of IL-7 availability has been proposed (Figure 1.5) (70). In this model, pre-BCR- early pro-B cells (fraction B) expressing the IL-7R are bathed in a relatively high concentration of IL-7 that provides survival signals while the Igµ heavy chain (HC) is undergoing VHDJH recombination (in fraction C). As cells migrate, surface pre-BCR expression favors survival in an environment where IL-7 availability decreases. Although the mechanisms regulating IL-7 availability are unclear, various stromal cell types may have different IL-7 production capacity, may secrete IL-7 into different environments with different extracellular matrix, or may express other cytokines that affect IL-7 (70). These pre-BCR+ cells are still reliant on IL-7 signaling, so those that do not rearrange a useful heavy chain would still require high concentrations of IL-7 for survival and become susceptible to apoptosis in physical environments with limited IL-7 availability. Thus, IL-7 signals are critical for expansion of the population of progenitor B cells that have successfully rearranged their heavy chain. Cells with a functional pre-BCR displayed bypass the checkpoint and are driven into the large pre-BII (fraction C’) developmental stage. Here, pre-BCR/IL-7Rα signal convergence is necessary for optimal activation of the Ras/Erk pathway that generates the proliferative burst characteristic of this stage. The initial report that IL-7 and pre-BCR signaling converged to sustain ERK signaling clearly demonstrated that pre-BCR signaling was immediate and transient and that IL-7 induced delayed yet sustained activation, suggesting that different upstream 10  pathways lead to ERK activation (71). Pre-BCR activation is mediated by classical Ras-RafMek-ERK signaling initiated by protein tyrosine kinases Lyn and Syk (Figure 1.6) (72), and leads to regulation of c-myc, ilf2, mef2c and mef2d (73). It remains unclear how IL-7Rα signaling achieves Erk activation in developing B cells. Expansion of the pre-B cell pool in response to pre-BCR and IL-7 contributes to the diversity of the eventual mature B cell pool, since each daughter cell will rearrange a unique light chain. During pre-B cell expansion, both IL-7Rα and pre-BCR are down regulated from the surface. It is in the resulting small pre-B cell population (fraction D) that the light chain locus becomes accessible and rearrangement occurs. Recent evidence demonstrated that initiation of light chain rearrangement was only permitted in the absence of IL-7Rα and STAT5 signaling (68). Thus, it appears that another function of IL-7 signaling is to actively restrict light chain rearrangement. Unlike the continued importance of IL-7Rα in mature T cells, there is no apparent role for IL-7Rα signaling in mature murine B cell homeostasis or function.  11  1.5  Interleukin-7 and peripheral T cell homeostasis  1.5.1  IL-7 provides survival and proliferation signals to naïve T cells When T cells have emigrated to the periphery, homeostasis of naïve T cells is  accomplished through a combination of cytokine and TCR signaling. Interaction with MHC molecules in the periphery is crucial to T cell survival (74, 75). Under normal, non-inflammatory conditions, survival signals can be provided by MHC mediated presentation of cognate antigen (76). Absence of MHC derived survival signals during in vitro culture results in T cell apoptosis, but the addition of IL-4 or IL-7 can provide protection and maintain T cell survival (77). T cell survival is also dependent on maintenance of cellular metabolism and glucose uptake. IL-7 prevents T cell atrophy in a PI3 kinase dependent manner (78). The evidence that both cytokine and TCR signaling are required in vivo is highlighted by the fact that in the absence of IL-4 and IL-7 signaling, MHC II mediated survival effects significantly decrease (77). IL-7 has been specifically identified as necessary for survival of both CD4 and CD8 naïve T cells. Since naïve T cells are metabolically inert, a common tool for studying the requirements for their proliferation and survival relies on adoptive transfer techniques. Transfer of purified, naïve T cells from WT hosts into lymphopenic hosts results in a proliferative burst as the cells “sense” the empty niche they have been placed in. The primary signal these transplanted cells are responding to is the unusually high concentration of bioavailable IL-7 (Figure 1.7). Both IL-7 and interactions with self-peptide/MHC are essential for induction of this lymphopenia-induced proliferation (LIP) in naïve CD4 and CD8 T cells (24, 79-83). The requirement for IL-7 for mediating proliferation and survival of naïve CD8 T cells was demonstrated by abrogation of IL-7 signaling. IL-7 deficient hosts do not support induction of LIP and naïve IL-7Rα-/- CD8 T cells are lost at a rapid rate upon transfer (13). In contrast, neither IL-4 nor IL-15 is required for LIP of naïve CD8 T cells (24, 84). IL-7 signaling is also essential for survival of naïve CD4 T cells (85). STAT5 activation is an important component of IL-7 driven LIP in both CD4 and CD8 naïve T cells (86, 87). Thus, the requirements for naïve T cell LIP are similar between CD4 and CD8 T cells and are primarily driven by the TCR and IL7. 1.5.2  Memory T cell quality and quantity are positively influenced by IL-7 Following clonal expansion of antigen specific T cells, a contraction phase occurs that  restores the pool of T cells to normal numbers with 5-10% of CD8 T cells retained as long-lived memory cells. Both intrinsic and extrinsic death pathways mediate the contraction phase (88). 12  The observation that IL-7Rα was down-regulated on the surface of the majority of antigen (Ag)specific CD8 effectors, and those that maintained/re-expressed IL-7Rα at high levels following LCMV infection were more likely to form the memory pool led to the hypothesis that receptor expression conferred a unique survival advantage by rendering cells responsive to limiting amounts of bioavailable cytokine (89, 90). Further studies supported this model by demonstrating that IL-7Rα regulation was similar in a number of different infection settings for both CD4 and CD8 T cells (91, 92). A memory precursor effector cell (MPEC) population has been defined as Ag-specific CD8 T cells that are IL-7Rαhi KLRG1lo while short-lived effector cells (SLECs) are IL-7Rαlo KLRG1hi at the peak of the primary T cell response (89). These MPECs have been seen to arise as a result of asymmetric division after an Ag-specific CD8 T cell comes in contact with an Ag-bearing, activated DC. After T cell activation, the first cell division results in production of a daughter cell proximal to the immunological synapse with phenotypic characteristics of effector T cells and a smaller daughter cell at the distal pole that includes the cellular stores of IL-7Rα mRNA and has greater memory potential (93). It is clear that IL-7Rα signaling is essential for CD8 memory T cell survival, since abrogation of IL-7Rα expression results in failure of memory T cell persistence (Figure 1.8) (13, 94). Several experimental systems have been designed to test the hypothesis that IL-7Rα signaling could provide a selection signal to recruit effectors into the memory pool. Two independent groups generated Tg IL-7Rα mice in which IL-7Rα expression was maintained on T cell surfaces throughout an immune response. The fate of Tg IL-7Rα CD8 T cells was followed during either LCMV or Listeria monocytogenes infection. Interestingly, forced receptor expression had no effect on either the primary, memory or recall responses in either study (95, 96). A potential caveat of these studies pertains to IL-7 availability. It has been postulated that down-regulation of the receptor is an altruistic mechanism that allows limiting amounts of cytokine to provide survival signals to a greater proportion of cells (97). In these models, failure to down-regulate the receptor could engender an environment in which the cytokine remains the limiting factor. In another approach to test the idea that augmented IL-7Rα signals could enhance vaccination protocols by increasing the size of the memory T cell pool, Sun et al. generated T cells expressing a chimeric GM-CSF/IL-7 receptor, which results in GM-CSF triggered IL-7R signaling (98). LCMV infection results in a burst of GM-CSF expression, potentially overcoming the limitation of bioavailable IL-7 and allowing this system to determine whether increased IL-7Rα signaling during T cell priming affects the generation of memory T 13  cells. This system did result in increased effector numbers, but surprisingly, had no effect on memory T cell recovery (98). Taken together, the data shows that IL-7 signaling is necessary for formation of a stable pool of both CD4 and CD8 T cells, but that it acts in a permissive rather than selective manner, and that other factors are required for control of the contraction phase and selection of memory T cells (99, 100). An alternative method to test the hypothesis that IL-7 signaling can impact memory T cell differentiation is to increase the cytokine concentration at the time of infection or during the subsequent immune response. The inclusion of IL-7 as a vaccine adjuvant with the aim of increasing the number of effectors recruited to the memory T cell pool has given differing results using varying IL-7 administration protocols. Administration of IL-7 during the T cell expansion phase (days 1-7 post-infection) has no effect on the accumulation of Ag-specific CD8 effector or memory T cells (101). However, a number of studies have conclusively shown that in vivo IL-7 administration during the contraction phase (day 8 post-infection and onward) augments effector-to-memory transition and increases the size and functionality of the memory T cell response (Figure 1.9). Similar results have been reported for polyclonal and TCR Tg CD4 and CD8 T cells using a variety of vaccination protocols, including viral infection (LCMV, vaccinia), Ag-loaded DCs, and DNA vaccines (101-103). Furthermore, a recent report has demonstrated that in vivo IL-7 administration during the contraction phase of an immune response affects the quality of the effector T cells as well as boosting the size of the resultant memory T cell pool (103). Surprisingly, this study showed that IL-7 treatment increases CD8 T cell cytotoxic activity, antagonizes T cell inhibitory TGF-β signaling and increases production of IL-2 and inflammatory IL-17. Importantly, these effects were only elicited when IL-7 treatment was given post-infection and did not occur under normal physiologic conditions. Thus, these findings show that IL-7 has significant potential to increase both the quality and quantity of vaccine-induced memory T cells if given at the appropriate time and provides ample evidence to investigate the use of IL-7 in humans as a vaccine adjuvant as well as for increasing the effectiveness of immune responses to chronic viral infections and tumor antigens.  14  1.6  Lymphoid transformation as a result of de-regulated developmental signals Lymphocytes are common targets for transformation, as evidenced by the frequent  occurrence of leukemia and lymphoma (2). Part of their intrinsic susceptibility stems from genetic instability due to activity of Recombination Activation Gene (RAG) proteins in precursor stages and the action of Activation-Induced Deaminase (AID) in somatic hypermutation in the germinal centre reaction in mature B cells. Besides these mutagenic activities, hyperactivation of signaling effectors normally regulated by growth factors and differentiation cues are common in lymphoid tumors. In order to study the role of dysregulated signaling on lymphoid homeostasis and transformation, numerous mouse models have been developed and analyzed. Notch is a key factor for commitment to the T lineage, and constitutively active Notch mutations are common in human T-acute lymphocytic leukemia (ALL) patients (104). Similarly, expressing Notch proteins with targeted mutations (based on the mutations found in patient samples) causes murine T-ALL. Interestingly, latency periods of tumor development in mice mimic the severity of human disease with different mutations (104). Overexpression of c-Myc, a B cell proliferation factor, is frequently found in Burkitt’s lymphoma patients. The Eµ-myc mouse model presents with B cell transformation through hyperproliferation and is a wellaccepted model for studying Burkitt’s lymphoma transformation (105). Phosphorylated STAT5 can be found in various T cell lymphomas (106) and is a marker of poor prognosis in human prostate cancer (107). In mice, expression of constitutively active STAT5 is sufficient to cause CD8 T cell lymphoblastic lymphoma (108). PI3 kinase activation of Akt contributes to lymphocyte survival, proliferation and metabolism. The lipid phosphatase PTEN is a negative regulator of Akt activity and PTEN inhibition leads to hyperactivation of Akt. Mutations that decrease PTEN expression are commonly found in human T-ALL and a variety of nonHodgkin’s lymphoma (106). The oncogenic potential of hyperactivated PI3 kinase signaling is demonstrated by the rapid onset of thymomas in mice where PTEN is specifically deleted in T cells. In this model, PTEN deficiency causes clonal expansion of thymic progenitors and can result in tumor induced mortality as early as 5 weeks of age (109). Collectively, these studies show that dysregulation of lymphocyte growth factors and differentiation cues have the potential to directly cause or provide support for lymphoid transformation. Both PI3 kinase and STAT5 are downstream of IL-7, and IL-7 can co-operate with both Notch and c-Myc in T and B cell development. A variety of human malignancies, including 15  Hodgkin’s lymphoma, Burkitt’s lymphoma, B- and T-ALL and Sezary syndrome have reported either elevated IL-7 detection, or that IL-7 can act as an important support factor for tumor cell growth. A mouse model where B and T cells constitutively produce IL-7 results in transformation of both cell types and tumor-induced mortality (110). Interestingly, modulation of STAT5 expression significantly delays lymphomagenesis in these mice (111). Determination of how these signals become dysregulated and the effects they have in tumor development and maintenance can provide opportunities for targeted immunotherapeutics. mTOR is an important target of Akt activation and is central to regulating translation of proteins involved in survival and proliferation. Inhibiting mTOR with rapamycin or rapamycin analogues is being tested for use in clinical trials and has been approved for treatment of mantle cell lymphoma (112, 113). STAT5 and PI3 kinase signals can mediate cell survival through upregulation of Bcl-2 and related family members and high expression can lend survival fitness to tumor cells. Two Bcl-2 inhibitors, ABT-263 and ABT-737, have been developed and are being tested for use against numerous cancer cell types, including leukemias and lymphomas. Clearly, the regulatory checkpoints in place during lymphocyte development and function are not fool proof and can contribute to tumor formation or maintenance. Understanding these pathways and how they intersect is key for drug development and for determining the mechanism of empirically derived drugs.  16  1.7  Summary Since IL-7 is essential to T cell development, and current knowledge of IL-7 signaling  pathways pointed to phosphorylation of a specific tyrosine, Y449, as being important for activating known signaling pathways, I aimed to determine how lymphopoiesis and T cell function would be affected by specific mutation of this residue. To address the hypothesis that altering IL-7Rα Y449 signaling would have demonstrable effects on IL-7 mediated events, a novel “knock-in” mouse model, IL-7Rα449F, expressing a full length receptor with a point mutation at Y449 was generated. The data presented in this thesis deal with the impact of the IL7Rα449F mutation on lymphocyte development, T cell responses to pathogen infection, susceptibility of B and T cells to oncogene mediated transformation and the effect of partial lymphopenia on homeostasis of healthy T cells. The data show that there are Y449-independent events that allow partial lymphopoiesis in both B and T lineages, but that Y449 signals are essential for maintenance of memory CD8 T cells and rapid lymphocyte transformation.  17  Figure 1.1  Figure 1.1 Schematic representation of γc cytokine family receptors The γc chain is a shared component of receptors for IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21. Note the inclusion of IL-2Rβ in the heterotrimeric IL-2 and IL-15 receptors. IL-7Rα is a shared component of receptors for IL-7 and TSLP. Noted below the receptors are the intracellular Janus (Jak) kinases activated by receptor ligation, the associated STATs and affected cell types. With permission: Rochman Y, Spolski R and Leonard WJ. (2009) New insights into the regulation of T cells by γc family cytokines. Nature Reviews Immunology 9: 480.  18  Figure 1.2  Figure 1.2 Schematic view of T lymphopoiesis within the thymus The thymus has two distinct regions, the cortex and the medulla. These regions are characterized by the presence of particular stromal cell types that contribute to differentiation of thymocyte precursors at defined maturations stages. Thymocyte differentiation is characterized by the expression of well-defined cell-surface markers, including CD4, CD8, CD44 (or CD117) and CD25, as well as the status of the T-cell receptor (TCR). Progenitors enter the thymus at the cortico-medullary junction (CMJ) and move out toward the cortex as immature CD4-CD8double negative (DN) thymocytes where they undergo TCR rearrangement and positive selection mediated by interactions with cortical epithelial cells. The resulting CD4+CD8+ double positive (DP) cells migrate back through the cortex toward the CMJ. CD4+CD8- or CD4-CD8+ single positive (SP) thymocytes undergo negative selection in the medulla prior to export into the periphery. With permission: Zúñiga-Pflücker JC. (2004) T-cell development made simple. Nature Reviews Immunology 4: 67-72. 19  Figure 1.3  Figure 1.3 Summary of progenitor B cell development Listed are designations of differentiation stages as noted by Hardy fractions and Basel nomenclature and associated surface markers that can be used for characterization. The state of immunoglobulin heavy chain (HC) and light chain (LC) DNA rearrangements are listed below. The primary function of IL-7 signaling at each discrete stage is also listed.  20  Figure 1.4  Figure 1.4 Flt3/Ras signaling maintains progenitor B cells in a state of IL-7 responsiveness A non-transcriptional mechanism of Ras activation ensures surface expression of IL-7Rα and inhibits transcription of STAT-inhibitory socs genes. High surface expression of IL-7Rα and inhibited Socs activity allows robust IL-7 mediated STAT5 signaling that is necessary for progenitor B cell development. CXCR4 activity is a mediator of bone marrow retention. Socs mediated inhibition may contribute to maintaining progenitors within the bone marrow to permit access to maturation cues. With permission: Li LX, Goetz CA, Katerndahl CD, Sakaguchi N, Farrar MA. A Flt3- and Rasdependent pathway primes B cell development by inducing a state of IL-7 responsiveness. 2010. The Journal of Immunology 184:1728-36  21  Figure 1.5  Figure 1.5 Signals from the pre-BCR and IL-7 co-operate to maintain pre-B cells A hypothetical model of IL-7 concentration gradients acting as a physical checkpoint for preBCR signaling. Prior to pre-BCR expression, cells are located in an environment with a high concentration of bioavailable IL-7 that on its own is sufficient to mediate survival and proliferation. As cells move down the IL-7 gradient, expression of a productively rearranged preBCR is necessary for ERK activation to compensate for the diminished IL-7 signal strength as a result of low cytokine availability. With permission: Fleming HE, Paige CJ. Cooperation between IL-7 and the pre-B cell receptor: a key to B cell selection. 2002. Seminars in Immunology 14: 423-30.  22  Figure 1.6  Figure 1.6 BCR signaling pathways Binding of antigen to the B cell receptor (BCR) leads to activation of the tyrosine kinase LYN, phosphorylation of the immunoreceptor tyrosine-based activation motifs (ITAMs) in the cytoplasmic domains of Igα and Igβ, recruitment and activation of the tyrosine kinase SYK (spleen tyrosine kinase), phosphorylation of the adaptor protein BLNK (B cell linker) and assembly of a complex including BTK (Bruton's tyrosine kinase), VAV1 and PLCγ2 (phospholipase Cγ2). Through downstream signaling effectors, including PI3 kinase, the RAS, RAF, MEK (MAPK/ERK kinase) and ERK (extracellular signal-regulated kinase) signaling cascade is activated. With permission: Tybulewicz VL and Henderson RB. Rho family GTPases and their regulators in lymphocytes. 2009. Nature Reviews Immunology. 9:630-44.
  23  Figure 1.7  Figure 1.7 Homeostatic proliferation of T cells is regulated by IL-7 and interaction with APCs In a lymphoreplete environment, IL-7 concentration and access to APCs is limiting. Without contact with either cytokine or APC, naïve T cells undergo apoptosis. In contrast, in T lymphopenic environments, there is minimal competition for either cytokine or selfpeptide/MHC interaction. These signals co-operate to drive T cell proliferation until T cells number recover. This is a self-limiting pathway since restoration of T cell numbers also restores competition for cytokine and APC. With permission: Takada K and Jameson SC. Naive T cell homeostasis: from awareness of space to a sense of place. 2009. Nature Reviews Immunology 9: 823-832  24  Figure 1.8  Figure 1.8 T cell responses to acute and chronic infections in mice and the requirement for IL-7 Model of acute infection in mice. WT mice (red line) will clear virus (black line) and establish T cell memory that enables more rapid viral clearance upon re-exposure. Role of IL-7 in memory T cell homeostasis. Lack of IL-7 signaling (IL-7-/- or IL-7Rα-/-) allows generation of a primary response but memory T cell populations wane due to lack of survival signals (green line). Exogenous administration of IL-7 (blue box) during the contraction phase of the anti-viral response augments the T cell effector-to-memory transition and results in more memory T cells with increased function (dashed blue line). With permission: Osborne, LC, Abraham N. (2010) Regulation of memory T cells by γc cytokines. 2010. Cytokine 50: 105–113.  25  1.8  References  1.  Kovanen, P.E. and W.J. Leonard. 2004. Cytokines and immunodeficiency diseases: critical roles of the gamma(c)-dependent cytokines interleukins 2, 4, 7, 9, 15, and 21, and their signaling pathways. Immunol.Rev. 202:67-83.  2.  Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics. 2008.  3.  Buckley, R.H. 2004. Molecular defects in human severe combined immunodeficiency and approaches to immune reconstitution. Annu Rev Immunol. 22:625-655.  4.  DiSanto, J.P., W. Müller, D. Guy-Grand, A. Fischer and K. Rajewsky. 1995. Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain. Proc.Natl.Acad.Sci.U.S.A. 92:377-381.  5.  Malek, T.R. and A.L. Bayer. 2004. Tolerance, not immunity, crucially depends on IL-2. Nat.Rev.Immunol. 4:665-674.  6.  Becker, T.C., E.J. Wherry, D. Boone, K. Murali-Krishna, R. Antia, A. Ma and R. Ahmed. 2002. Interleukin 15 is required for proliferative renewal of virus-specific memory CD8 T cells. J.Exp.Med. 195:1541-1548.  7.  Kennedy, M.K., M. Glaccum, S.N. Brown, E.A. Butz, J.L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C.R. Willis, K. Brasel, P.J. Morrissey, K. Stocking, J.C. Schuh, S. Joyce and J.J. Peschon. 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J.Exp.Med. 191:771-780.  8.  Lodolce, J.P., D.L. Boone, S. Chai, R.E. Swain, T. Dassopoulos, S. Trettin and A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity. 9:669-676.  9.  Maraskovsky, E., M. Teepe, P.J. Morrissey, S. Braddy, R.E. Miller, D.H. Lynch and J.J. Peschon. 1996. Impaired survival and proliferation in IL-7 receptor-deficient peripheral T cells. J.Immunol. 157:5315-1523.  10. Peschon, J.J., P.J. Morrissey, K.H. Grabstein, F.J. Ramsdell, E. Maraskovsky, B.C. Gliniak, L.S. Park, S.F. Ziegler, D.E. Williams, C.B. Ware, J.D. Meyer and B.L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J.Exp.Med. 180:1955-1960. 11. von Freeden-Jeffry, U., P. Vieira, L.A. Lucian, T. McNeil, S.E. Burdach and R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J.Exp.Med. 181:1519-1526. 12. He, Y.W. and T.R. Malek. 1996. Interleukin-7 receptor alpha is essential for the development of gamma delta + T cells, but not natural killer cells. J.Exp.Med. 184:289-293. 13. Schluns, K.S., W.C. Kieper, S.C. Jameson and L. Lefrancois. 2000. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat.Immunol. 1:426-432. 14. Kuhn, R., K. Rajewsky and W. Müller. 1991. Generation and analysis of interleukin-4 deficient mice. Science. 254:707-710. 26  15. Townsend, M.J., P.G. Fallon, D.J. Matthews, P. Smith, H.E. Jolin and A.N.J. McKenzie. 2000. IL-9-deficient mice establish fundamental roles for IL-9 in pulmonary mastocytosis and goblet cell hyperplasia but not T cell development. Immunity. 13:573-583. 16. Ozaki, K., R. Spolski, C.G. Feng, C.F. Qi, J. Cheng, A. Sher, H.C. Morse 3rd, C. Liu, P.L. Schwartzberg and W.J. Leonard. 2002. A critical role for IL-21 in regulating immunoglobulin production. Science. 298:1630-1634. 17. Kasaian, M.T., M.J. Whitters, L.L. Carter, L.D. Lowe, J.M. Jussif, B. Deng, K.A. Johnson, J.A.S. Witek, M. Senices, R.F. Konz, A.L. Wurster, D.D. Donaldson, M. Collins, D.A. Young and M.J. Grusby. 2002. IL-21 Limits NK Cell Responses and Promotes AntigenSpecific T Cell Activation A Mediator of the Transition from Innate to Adaptive Immunity. Immunity. 16:559-569. 18. Cherwinski, H.M., J.H. Schumacher, K.D. Brown and T.R. Mosmann. 1987. Two types of mouse helper T cell clone. III. Further differences in lymphokine synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. J.Exp.Med. 166:1229-1244. 19. Stevens, T.L., A. Bossie, V.M. Sanders, R. Fernandez-Botran, R.L. Coffman, T.R. Mosmann and E.S. Vitetta. 1988. Regulation of antibody isotype secretion by subsets of antigen-specific helper T cells. Nature. 334:255-258. 20. Parrish-Novak, J., S.R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J.A. Gross, J. Johnston, K. Madden, W. Xu, J. West, S. Schrader, S. Burkhead, M. Heipel, C. Brandt, J.L. Kuijper, J. Kramer, D. Conklin, S.R. Presnell, J. Berry, F. Shiota, S. Bort, K. Hambly, S. Mudri, C. Clegg, M. Moore, F.J. Grant, C. Lofton-Day, T. Gilbert, F. Rayond, A. Ching, L. Yao, D. Smith, P. Webster, T. Whitmore, M. Maurer, K. Kaushansky, R.D. Holly and D. Foster. 2000. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature. 408:57-63. 21. Parrish-Novak, J., D.C. Foster, R.D. Holly and C.H. Clegg. 2002. Interleukin-21 and the IL21 receptor: novel effectors of NK and T cell responses. J. Leukoc. Biol. 72:856-863. 22. Rochman, Y., R. Spolski and W.J. Leonard. 2009. New insights into the regulation of T cells by gamma(c) family cytokines. Nat.Rev.Immunol. 9:480-490. 23. Seddon, B., P. Tomlinson and R. Zamoyska. 2003. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat.Immunol. 4:680-686. 24. Goldrath, A.W., P.V. Sivakumar, M. Glaccum, M.K. Kennedy, M.J. Bevan, C. Benoist, D. Mathis and E.A. Butz. 2002. Cytokine requirements for acute and basal homeostatic proliferation of naive and memory CD8+ T cells. J.Exp.Med. 195:1515-1522. 25. Foss, H.D., M. Hummel, S. Gottstein, K. Ziemann, B. Falini, H. Herbst and H. Stein. 1995. Frequent expression of IL-7 gene transcripts in tumor cells of classical Hodgkin's disease. Am.J.Pathol. 146:33-39. 26. Cattaruzza, L., A. Gloghini, K. Olivo, R. Di Francia, D. Lorenzon, R. De Filippi, A. Carbone, A. Colombatti, A. Pinto and D. Aldinucci. 2009. Functional coexpression of Interleukin (IL)-7 and its receptor (IL-7R) on Hodgkin and Reed-Sternberg cells: 27  Involvement of IL-7 in tumor cell growth and microenvironmental interactions of Hodgkin's lymphoma. Int.J.Cancer. 125:1092-1101. 27. Touw, I., K. Pouwels, T. van Agthoven, R. van Gurp, L. Budel, H. Hoogerbrugge, R. Delwel, R. Goodwin, A. Namen and B. Lowenberg. 1990. Interleukin-7 is a growth factor of precursor B and T acute lymphoblastic leukemia. Blood. 75:2097-2101. 28. Barata, J.T., A. Silva, J.G. Brandao, L.M. Nadler, A.A. Cardoso and V.A. Boussiotis. 2004. Activation of PI3K is indispensable for interleukin 7-mediated viability, proliferation, glucose use, and growth of T cell acute lymphoblastic leukemia cells. J.Exp.Med. 200:659669. 29. Barata, J.T., A.A. Cardoso, L.M. Nadler and V.A. Boussiotis. 2001. Interleukin-7 promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia cells by downregulating the cyclin-dependent kinase inhibitor p27(kip1). Blood. 98:1524-1531. 30. Long, B.W., P.L. Witte, G.N. Abraham, S.A. Gregory and J.M. Plate. 1995. Apoptosis and interleukin 7 gene expression in chronic B-lymphocytic leukemia cells. Proc.Natl.Acad.Sci.U.S.A. 92:1416-1420. 31. Juarez, J., R. Baraz, S. Gaundar, K. Bradstock and L. Bendall. 2007. Interaction of interleukin-7 and interleukin-3 with the CXCL12-induced proliferation of B-cell progenitor acute lymphoblastic leukemia. Haematologica. 92:450-459. 32. Scupoli, M.T., O. Perbellini, M. Krampera, F. Vinante, F. Cioffi and G. Pizzolo. 2007. Interleukin 7 requirement for survival of T-cell acute lymphoblastic leukemia and human thymocytes on bone marrow stroma. Haematologica. 92:264-266. 33. Sasson, S.C., S. Smith, N. Seddiki, J.J. Zaunders, A. Bryant, K.K. Koelsch, C. Weatherall, M.L. Munier, C. McGinley, J. Yeung, S.P. Mulligan, J. Moore, D.A. Cooper, S. Milliken and A.D. Kelleher. 2010. IL-7 receptor is expressed on adult pre-B-cell acute lymphoblastic leukemia and other B-cell derived neoplasms and correlates with expression of proliferation and survival markers. Cytokine. 50:58-68. 34. Benbernou, N., K. Muegge and S.K. Durum. 2000. Interleukin (IL)-7 induces rapid activation of Pyk2, which is bound to Janus kinase 1 and IL-7Ralpha. J.Biol.Chem. 275:7060-7065. 35. Venkitaraman, A.R. and R.J. Cowling. 1994. Interleukin-7 induces the association of phosphatidylinositol 3-kinase with the alpha chain of the interleukin-7 receptor. Eur.J.Immunol. 24:2168-2174. 36. Dadi, H.K., S. Ke and C.M. Roifman. 1993. Interleukin 7 receptor mediates the activation of phosphatidylinositol-3 kinase in human B-cell precursors. Biochem.Biophys.Res.Commun. 192:459-464. 37. Dadi, H.K. and C.M. Roifman. 1993. Activation of phosphatidylinositol-3 kinase by ligation of the interleukin-7 receptor on human thymocytes. J.Clin.Invest. 92:1559-1563. 38. Pallard, C., A.P. Stegmann, T. van Kleffens, F. Smart, A. Venkitaraman and H. Spits. 1999. Distinct roles of the phosphatidylinositol 3-kinase and STAT5 pathways in IL-7-mediated development of human thymocyte precursors. Immunity. 10:525-535. 28  39. Jiang, Q., W.Q. Li, F.B. Aiello, R. Mazzucchelli, B. Asefa, A.R. Khaled and S.K. Durum. 2005. Cell biology of IL-7, a key lymphotrophin. Cytokine Growth Factor Rev. 16:513-533. 40. Kikuchi, K., H. Kasai, A. Watanabe, A.Y. Lai and M. Kondo. 2008. IL-7 specifies B cell fate at the common lymphoid progenitor to pre-proB transition stage by maintaining early B cell factor expression. J.Immunol. 181:383-392. 41. Goetz, C.A., I.R. Harmon, J.J. O'Neil, M.A. Burchill and M.A. Farrar. 2004. STAT5 activation underlies IL7 receptor-dependent B cell development. J.Immunol. 172:4770-4778. 42. Corcoran, A.E., A. Riddell, D. Krooshoop and A.R. Venkitaraman. 1998. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature. 391:904907. 43. Chowdhury, D. and R. Sen. 2003. Transient IL-7/IL-7R signaling provides a mechanism for feedback inhibition of immunoglobulin heavy chain gene rearrangements. Immunity. 18:229-241. 44. Ye, S.K., Y. Agata, H.C. Lee, H. Kurooka, T. Kitamura, A. Shimizu, T. Honjo and K. Ikuta. 2001. The IL-7 receptor controls the accessibility of the TCRgamma locus by Stat5 and histone acetylation. Immunity. 15:813-823. 45. Yao, Z., Y. Cui, W.T. Watford, J.H. Bream, K. Yamaoka, B.D. Hissong, D. Li, S.K. Durum, Q. Jiang, A. Bhandoola, L. Hennighausen and J.J. O'Shea. 2006. Stat5a/b are essential for normal lymphoid development and differentiation. Proc.Natl.Acad.Sci.U.S.A. 103:10001005. 46. Wofford, J.A., H.L. Wieman, S.R. Jacobs, Y. Zhao and J.C. Rathmell. 2008. IL-7 promotes Glut1 trafficking and glucose uptake via STAT5-mediated activation of Akt to support Tcell survival. Blood. 111:2101-2111. 47. Lali, F.V., J. Crawley, D.A. McCulloch and B.M. Foxwell. 2004. A late, prolonged activation of the phosphatidylinositol 3-kinase pathway is required for T cell proliferation. J.Immunol. 172:3527-3534. 48. Santos, S.C., V. Lacronique, I. Bouchaert, R. Monni, O. Bernard, S. Gisselbrecht and F. Gouilleux. 2001. Constitutively active STAT5 variants induce growth and survival of hematopoietic cells through a PI 3-kinase/Akt dependent pathway. Oncogene. 20:20802090. 49. Li, W.Q., Q. Jiang, E. Aleem, P. Kaldis, A.R. Khaled and S.K. Durum. 2006. IL-7 promotes T cell proliferation through destabilization of p27Kip1. J.Exp.Med. 203:573-582. 50. Jacobs, S.R., R.D. Michalek and J.C. Rathmell. 2010. IL-7 Is Essential for Homeostatic Control of T Cell Metabolism In Vivo. J.Immunol. 184:3461-3469. 51. Sambandam, A., J.J. Bell, B.A. Schwarz, V.P. Zediak, A.W. Chi, D.A. Zlotoff, S.L. Krishnamoorthy, J.M. Burg and A. Bhandoola. 2008. Progenitor migration to the thymus and T cell lineage commitment. Immunol.Res. 42:65-74. 52. Chi, A.W., J.J. Bell, D.A. Zlotoff and A. Bhandoola. 2009. Untangling the T branch of the hematopoiesis tree. Curr.Opin.Immunol. 21:121-126. 29  53. Bell, J.J. and A. Bhandoola. 2008. The earliest thymic progenitors for T cells possess myeloid lineage potential. Nature. 452:764-767. 54. Ciofani, M. and J.C. Zuniga-Pflucker. 2007. The thymus as an inductive site for T lymphopoiesis. Annu.Rev.Cell Dev.Biol. 23:463-493. 55. Izon, D.J., J.C. Aster, Y. He, A. Weng, F.G. Karnell, V. Patriub, L. Xu, S. Bakkour, C. Rodriguez, D. Allman and W.S. Pear. 2002. Deltex1 redirects lymphoid progenitors to the B cell lineage by antagonizing Notch1. Immunity. 16:231-243. 56. Maillard, I., A.P. Weng, A.C. Carpenter, C.G. Rodriguez, H. Sai, L. Xu, D. Allman, J.C. Aster and W.S. Pear. 2004. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood. 104:1696-1702. 57. Pui, J.C., D. Allman, L. Xu, S. DeRocco, F.G. Karnell, S. Bakkour, J.Y. Lee, T. Kadesch, R.R. Hardy, J.C. Aster and W.S. Pear. 1999. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity. 11:299-308. 58. Allman, D., A. Sambandam, S. Kim, J.P. Miller, A. Pagan, D. Well, A. Meraz and A. Bhandoola. 2003. Thymopoiesis independent of common lymphoid progenitors. Nat.Immunol. 4:168-174. 59. Al-Shami, A., R. Spolski, J. Kelly, T. Fry, P.L. Schwartzberg, A. Pandey, C.L. Mackall and W.J. Leonard. 2004. A role for thymic stromal lymphopoietin in CD4(+) T cell development. J.Exp.Med. 200:159-168. 60. Maraskovsky, E., L.A. O'Reilly, M. Teepe, L.M. Corcoran, J.J. Peschon and A. Strasser. 1997. Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/- mice. Cell. 89:1011-1019. 61. Akashi, K., M. Kondo, U. von Freeden-Jeffry, R. Murray and I.L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell. 89:1033-1041. 62. Khaled, A.R., W.Q. Li, J. Huang, T.J. Fry, A.S. Khaled, C.L. Mackall, K. Muegge, H.A. Young and S.K. Durum. 2002. Bax deficiency partially corrects interleukin-7 receptor alpha deficiency. Immunity. 17:561-573. 63. Oliver, P.M., M. Wang, Y. Zhu, J. White, J. Kappler and P. Marrack. 2004. Loss of Bim allows precursor B cell survival but not precursor B cell differentiation in the absence of interleukin 7. J.Exp.Med. 200:1179-1187. 64. Maki, K. and K. Ikuta. 2008. MEK1/2 induces STAT5-mediated germline transcription of the TCRgamma locus in response to IL-7R signaling. J.Immunol. 181:494-502. 65. Hagenbeek, T.J., M. Naspetti, F. Malergue, F. Garcon, J.A. Nunes, K.B. Cleutjens, J. Trapman, P. Krimpenfort and H. Spits. 2004. The loss of PTEN allows TCR alphabeta lineage thymocytes to bypass IL-7 and Pre-TCR-mediated signaling. J.Exp.Med. 200:883894. 66. Erlandsson, L., S. Licence, F. Gaspal, S. Bell, P. Lane, A.E. Corcoran and I.L. Mårtensson. 2004. Impaired B-1 and B-2 B cell development and atypical splenic B cell structures in IL7 receptor-deficient mice. Eur.J.Immunol. 34:3595-3603. 30  67. Li, L.X., C.A. Goetz, C.D.S. Katerndahl, N. Sakaguchi and M.A. Farrar. 2010. A Flt3-and Ras-Dependent Pathway Primes B Cell Development by Inducing a State of IL-7 Responsiveness. J.Immunol. 184:1728-1736. 68. Malin, S., S. McManus, C. Cobaleda, M. Novatchkova, A. Delogu, P. Bouillet, A. Strasser and M. Busslinger. 2009. Role of STAT5 in controlling cell survival and immunoglobulin gene recombination during pro-B cell development. Nat.Immunol. 11:171-179. 69. Marshall, A.J., H.E. Fleming, G.E. Wu and C.J. Paige. 1998. Modulation of the IL-7 doseresponse threshold during pro-B cell differentiation is dependent on pre-B cell receptor expression. J.Immunol. 161:6038-6045. 70. Fleming, H.E. and C.J. Paige. 2002. Cooperation between IL-7 and the pre-B cell receptor: a key to B cell selection. Semin.Immunol. 14:423-430. 71. Fleming, H.E. and C.J. Paige. 2001. Pre-B cell receptor signaling mediates selective response to IL-7 at the pro-B to pre-B cell transition via an ERK/MAP kinase-dependent pathway. Immunity. 15:521-531. 72. Tybulewicz, V.L.J. and R.B. Henderson. 2009. Rho family GTPases and their regulators in lymphocytes. Nat.Rev.Immunol. 9:630-644. 73. Yasuda, T., H. Sanjo, G. Pages, Y. Kawano, H. Karasuyama, J. Pouyssegur, M. Ogata and T. Kurosaki. 2008. Erk kinases link pre-B cell receptor signaling to transcriptional events required for early B cell expansion. Immunity. 28:499-508. 74. Kirberg, J., A. Berns and H. von Boehmer. 1997. Peripheral T cell survival requires continual ligation of the T cell receptor to major histocompatibility complex-encoded molecules. J.Exp.Med. 186:1269-1275. 75. Tanchot, C., F.A. Lemonnier, B. Perarnau, A.A. Freitas and B. Rocha. 1997. Differential requirements for survival and proliferation of CD8 naive or memory T cells. Science. 276:2057-2062. 76. Boursalian, T.E. and K. Bottomly. 1999. Survival of naive CD4 T cells: roles of restricting versus selecting MHC class II and cytokine milieu. J.Immunol. 162:3795-3801. 77. Vella, A., T.K. Teague, J. Ihle, J. Kappler and P. Marrack. 1997. Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat6 is probably not required for the effect of IL-4. J.Exp.Med. 186:325-330. 78. Rathmell, J.C., E.A. Farkash, W. Gao and C.B. Thompson. 2001. IL-7 enhances the survival and maintains the size of naive T cells. J.Immunol. 167:6869-6876. 79. Ernst, B., D.S. Lee, J.M. Chang, J. Sprent and C.D. Surh. 1999. The peptide ligands mediating positive selection in the thymus control T cell survival and homeostatic proliferation in the periphery. Immunity. 11:173-181. 80. Kieper, W.C. and S.C. Jameson. 1999. Homeostatic expansion and phenotypic conversion of naive T cells in response to self peptide/MHC ligands. Proc.Natl.Acad.Sci.U.S.A. 96:1330613311.  31  81. Tan, J.T., B. Ernst, W.C. Kieper, E. LeRoy, J. Sprent and C.D. Surh. 2002. Interleukin (IL)15 and IL-7 jointly regulate homeostatic proliferation of memory phenotype CD8+ cells but are not required for memory phenotype CD4+ cells. J.Exp.Med. 195:1523-1532. 82. Murali-Krishna, K., L.L. Lau, S. Sambhara, F. Lemonnier, J. Altman and R. Ahmed. 1999. Persistence of memory CD8 T cells in MHC class I-deficient mice. Science. 286:1377-1381. 83. Seddon, B. and R. Zamoyska. 2002. TCR and IL-7 receptor signals can operate independently or synergize to promote lymphopenia-induced expansion of naive T cells. J.Immunol. 169:3752-3759. 84. Tan, J.T., E. Dudl, E. LeRoy, R. Murray, J. Sprent, K.I. Weinberg and C.D. Surh. 2001. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc.Natl.Acad.Sci.U.S.A. 98:8732-8737. 85. Seki, Y., J. Yang, M. Okamoto, S. Tanaka, R. Goitsuka, M.A. Farrar and M. Kubo. 2007. IL-7/STAT5 cytokine signaling pathway is essential but insufficient for maintenance of naive CD4 T cell survival in peripheral lymphoid organs. J.Immunol. 178:262-270. 86. Burchill, M.A., C.A. Goetz, M. Prlic, J.J. O'Neil, I.R. Harmon, S.J. Bensinger, L.A. Turka, P. Brennan, S.C. Jameson and M.A. Farrar. 2003. Distinct effects of STAT5 activation on CD4+ and CD8+ T cell homeostasis: development of CD4+CD25+ regulatory T cells versus CD8+ memory T cells. J.Immunol. 171:5853-5864. 87. Taylor, D.K., P.T. Walsh, D.F. LaRosa, J. Zhang, M.A. Burchill, M.A. Farrar and L.A. Turka. 2006. Constitutive activation of STAT5 supersedes the requirement for cytokine and TCR engagement of CD4+ T cells in steady-state homeostasis. J.Immunol. 177:2216-2223. 88. Bouillet, P. and L.A. O'Reilly. 2009. CD95, BIM and T cell homeostasis. Nat.Rev.Immunol. 9:514-519. 89. Kaech, S.M., J.T. Tan, E.J. Wherry, B.T. Konieczny, C.D. Surh and R. Ahmed. 2003. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat.Immunol. 4:1191-1198. 90. Huster, K.M., V. Busch, M. Schiemann, K. Linkemann, K.M. Kerksiek, H. Wagner and D.H. Busch. 2004. Selective expression of IL-7 receptor on memory T cells identifies early CD40L-dependent generation of distinct CD8+ memory T cell subsets. Proc.Natl.Acad.Sci.U.S.A. 101:5610-5615. 91. Klonowski, K.D., K.J. Williams, A.L. Marzo and L. Lefrancois. 2006. Cutting edge: IL-7independent regulation of IL-7 receptor alpha expression and memory CD8 T cell development. J.Immunol. 177:4247-4251. 92. Dooms, H., K. Wolslegel, P. Lin and A.K. Abbas. 2007. Interleukin-2 enhances CD4+ T cell memory by promoting the generation of IL-7R alpha-expressing cells. J.Exp.Med. 204:547557. 93. Chang, J.T., V.R. Palanivel, I. Kinjyo, F. Schambach, A.M. Intlekofer, A. Banerjee, S.A. Longworth, K.E. Vinup, P. Mrass, J. Oliaro, N. Killeen, J.S. Orange, S.M. Russell, W. Weninger and S.L. Reiner. 2007. Asymmetric T lymphocyte division in the initiation of adaptive immune responses. Science. 315:1687-1691. 32  94. Carrio, R., C.E. Rolle and T.R. Malek. 2007. Non-redundant role for IL-7R signaling for the survival of CD8 memory T cells. Eur.J.Immunol. 37:3078-3088. 95. Hand, T.W., M. Morre and S.M. Kaech. 2007. Expression of IL-7 receptor {alpha} is necessary but not sufficient for the formation of memory CD8 T cells during viral infection. Proc.Natl.Acad.Sci.U.S.A. 104:11730-11735. 96. Haring, J.S., X. Jing, J. Bollenbacher-Reilley, H.H. Xue, W.J. Leonard and J.T. Harty. 2008. Constitutive expression of IL-7 receptor {alpha} does not support increased expansion or prevent contraction of antigen-specific CD4 or CD8 T cells following Listeria monocytogenes infection. J.Immunol. 180:2855-2862. 97. Mazzucchelli, R. and S.K. Durum. 2007. Interleukin-7 receptor expression: intelligent design. Nat.Rev.Immunol. 7:144-154. 98. Sun, J.C., S.M. Lehar and M.J. Bevan. 2006. Augmented IL-7 signaling during viral infection drives greater expansion of effector T cells but does not enhance memory. J.Immunol. 177:4458-4463. 99. Joshi, N.S. and S.M. Kaech. 2008. Effector CD8 T cell development: a balancing act between memory cell potential and terminal differentiation. J.Immunol. 180:1309-1315. 100. D'Cruz, L.M., M.P. Rubinstein and A.W. Goldrath. 2009. Surviving the crash: Transitioning from effector to memory CD8 T cell. Semin.Immunol. 21:92-98. 101. Nanjappa, S.G., J.H. Walent, M. Morre and M. Suresh. 2008. Effects of IL-7 on memory CD8 T cell homeostasis are influenced by the timing of therapy in mice. J.Clin.Invest. 118:1027-1039. 102. Melchionda, F., T.J. Fry, M.J. Milliron, M.A. McKirdy, Y. Tagaya and C.L. Mackall. 2005. Adjuvant IL-7 or IL-15 overcomes immunodominance and improves survival of the CD8+ memory cell pool. J.Clin.Invest. 115:1177-1187. 103. Pellegrini, M., T. Calzascia, A.R. Elford, A. Shahinian, A.E. Lin, D. Dissanayake, S. Dhanji, L.T. Nguyen, M.A. Gronski, M. Morre, B. Assouline, K. Lahl, T. Sparwasser, P.S. Ohashi and T. Mak. 2009. Adjuvant IL-7 antagonizes multiple cellular and molecular inhibitory networks to enhance immunotherapies. Nat.Med. 15:528-536. 104. Medyouf, H., X. Gao, F. Armstrong, S. Gusscott, Q. Liu, A.L. Gedman, L.H. Matherly, K.R. Schultz, F. Pflumio, M.J. You and A.P. Weng. 2010. Acute T-cell leukemias remain dependent on Notch signaling despite PTEN and INK4A/ARF loss. Blood. 115:1175-1184. 105. Adams, J.M., A.W. Harris, C.A. Pinkert, L.M. Corcoran, W.S. Alexander, S. Cory, R.D. Palmiter and R.L. Brinster. 1985. The c-myc oncogene driven by immunoglobulin enhancers induces lymphoid malignancy in transgenic mice. Nature. 318:533-538. 106. Zhao, W. 2010. Targeted therapy in T-cell malignancies: dysregulation of the cellular signaling pathways. Leukemia. 24:13-21. 107. Liao, Z., J. Lutz and M.T. Nevalainen. 2009. Transcription factor Stat5a/b as a therapeutic target protein for prostate cancer. Int.J.Biochem.Cell Biol. 42:186-192.  33  108. Kelly, J.A., R. Spolski, P.E. Kovanen, T. Suzuki, J. Bollenbacher, C.A. Pise-Masison, M.F. Radonovich, S. Lee, N.A. Jenkins, N.G. Copeland, H.C.3. Morse and W.J. Leonard. 2003. Stat5 synergizes with T cell receptor/antigen stimulation in the development of lymphoblastic lymphoma. J.Exp.Med. 198:79-89. 109. Hagenbeek, T.J. and H. Spits. 2008. T-cell lymphomas in T-cell-specific Pten-deficient mice originate in the thymus. Leukemia. 22:608-619. 110. Rich, B.E., T.J. Campos, R.I. Tepper, R.W. Moreadith and P. Leder. 1993. Cutaneous lymphoproliferation and lymphomas in interleukin 7 transgenic mice. J.Exp.Med. 177:305316. 111. Abraham, N., M.C. Ma, J.W. Snow, M.J. Miners, B.G. Herndier and M.A. Goldsmith. 2005. Haploinsufficiency identifies STAT5 as a modifier of IL-7-induced lymphomas. Oncogene. 24:5252-5257. 112. Drakos, E., G.Z. Rassidakis and L.J. Medeiros. 2008. Mammalian target of rapamycin (mTOR) pathway signalling in lymphomas. Expert Rev Mol Med. 10:e4. 113. Dancey, J. 2010. mTOR signaling and drug development in cancer. Nat Rev Clin Oncol. 7:209-219.  34  2 Impaired CD8 T cell memory and CD4 T cell primary responses in IL7Rα mutant mice2  2  A version of this chapter has been published. Osborne LC, Dhanji S, Snow JW, Priatel JJ, Ma MC, Miners MH, Teh HS, Goldmsith MA, Abraham N. 2007. Impaired CD8 T cell memory and CD4 T cell primary responses in IL-7Rα mutant mice. The Journal of Experimental Medicine 204: 619-31. 35  2.1  Introduction The cytokine IL-7 is essential for development of murine pro-B and pro-T cells (1, 2)  and normal function and survival of peripheral T cells (3). Loss of IL-7 or either component of its heterodimeric receptor, the IL-7Rα (CD127) or common γ chain (γc, CD132) results in severe combined immunodeficiency (SCID) in mice (1, 2) and T cell immunodeficiency in humans (4). Furthermore, IL-7 and its signaling have been shown to be essential in homeostasis and function of peripheral T cells (3). Upon pathogen exposure, antigen specific T cells undergo clonal expansion and differentiate into effector cells to clear the infection. In order to maintain homeostasis within the peripheral T cell niche, the majority of these effector cells die by apoptosis. However, 510% of pathogen-specific clones are retained long term as memory T cells to mount a more efficient response upon subsequent exposure. Memory T cells are believed to last up to 15 years in humans as seen in smallpox immunization (5), but the mechanism by which this occurs is an open question. Evidence suggests that signals from the γc cytokines IL-7 and IL15 are critical in the maintenance of memory CD8 T cells: IL-15 providing signals to drive basal levels of proliferation (6-8) and IL-7 providing survival signals by maintaining expression of Bcl-2 (9). In situations of lymphopenia, such as following chemotherapy and in cases of viral infection, T cells respond by initiating a proliferative program to replenish host lymphoid cellularity (10-12). IL-7 is up-regulated in this situation, suggesting that increased availability of IL-7 plays a major role in altered homeostatic conditions (13). IL-7 signaling has been shown to have a role in homeostatic proliferation (HP) of both naïve and memory T cells (9, 12, 14-16). Naïve CD4 and CD8 T cells rely on both IL-7 and TCR signaling for HP (9, 17, 18). In contrast, HP of memory phenotype CD8+CD44hi T cells is primarily cytokine driven, utilizing IL-15 to drive HP, although supraphysiological doses of IL-7 have been shown to be sufficient in the absence of IL-15 (15, 19, 20). The requirements for memory CD4 T cell HP are less clear, and may require a synergy of both IL-7 and TCR signaling for efficient responses (14). Studies have shown that naïve T cells develop a memory-like phenotype during HP and have features of functional memory T cells (21), raising the question of whether molecular pathways involved in HP are similar to those that generate classical memory T cells following infection.  36  The γc is constitutively expressed at low levels on lymphocytes, but IL-7Rα expression is restricted to specific stages of differentiation to mediate cellular responses (2224). Within the T cell lineage, IL-7Rα is expressed in the early stages of development on CD4-CD8- double negative (DN) cells, consistent with IL-7 cytokine or receptor deficiencies resulting in a thymic developmental block at these early stages and a paucity of thymocytes differentiating into CD4+CD8+ double positive (DP), CD4 or CD8 single positive (SP) or peripheral T cells (1, 2). IL-7Rα expression is down regulated on CD4+CD8+ DP thymocytes, likely to prevent transduction of survival signals to clones that do not meet the requirements of positive selection (25). IL-7Rα expression is then resumed and maintained on surviving CD4+ and CD8+ SP thymocytes (24) and is involved in survival and functional responses of mature T cells (3, 9). It is thought that the primary function of IL-7 signaling in the DN stages is to provide survival signals since ectopic expression of the anti-apoptotic Bcl-2 protein in IL-7Rα-/- mice has been shown to rescue T cell development (26, 27). Indeed, Bcl-2 expression closely correlates with IL-7Rα expression during thymic maturation. IL-7Rα activation reportedly initiates at least two separate signaling cascades, the Jak/STAT pathway and the PI3 kinase/Akt pathway. Phosphorylation of tyrosine residues of the IL-7Rα and γc by their constitutively associated Jak kinases leads to recruitment of Src Homology 2 (SH2)-domain effectors such as STAT5 and phospatidylinositol-3 (PI3) kinase (24). Each of these cascades are thought to separately regulate Bcl-2 family members to promote survival of activated cells and increase resistance to apoptosis (28, 29). The distal three of four IL-7Rα cytoplasmic tyrosines (Y390, 401, 449, and 456), are conserved between mice and humans. Of these, Y449, nested in a YxxM motif, is necessary for STAT5 activation and regulation of PI3 kinase in B cells and human thymocytes and T cells (30-32). Thus, Y449 is a critical residue in initiation of signaling cascades leading to cell differentiation, proliferation and survival (24, 29, 31). Y401 is nested in a conserved YxxL motif that is less widely distributed and is non-essential for thymocyte development and STAT5 activation (29). Y456 is in the least optimal setting since it is not in an acidic context and is less than four amino acids from the carboxyl terminus of the receptor. The severe developmental defect in IL-7-/- and IL-7Rα-/- mice hampers further analysis of the role of this essential cytokine in T cell function. To this end, we have generated an IL-7Rα “knock in” mouse in which the gene has a site-specific mutation of 37  Y449 to phenylalanine (F) (IL-7Rα449F) to specifically abrogate Y449xxM derived signals. Like IL-7Rα-/- mice, lymphocyte development is disrupted at early stages but is substantially restored in IL-7Rα449F mice revealing a significant role for IL-7Rα Y449-independent events. This IL-7Rα Y449-independent increase in lymphocyte cellularity is recapitulated in the periphery, and IL-7Rα449F mice develop significantly larger pools of peripheral T cells than IL-7Rα-/- mice. Thus, this model enables investigation of the role of IL-7Rα signaling in an in vivo context. In addition, known signaling pathways can be separated into Y449dependence and independence and functional outcomes described in these terms. Analysis of IL-7Rα449F T cells revealed a critical role for Y449-mediated signaling in physiologically relevant processes such as HP, generation of a primary CD4 T cell immune response and maintenance of antigen specific CD8 memory T cells. Remarkably, Bcl-2 regulation is near normal in IL-7Rα449F mice and we conclude that maintenance of Bcl-2 expression is not sufficient for survival of CD8 memory T cells as has been previously suggested (9). Our analysis provides genetic separation of IL-7 mediated CD8 memory cell maintenance from survival provided by Bcl-2.  38  2.2  Results  2.2.1  Generation of IL-7Rα 449F mice To analyze the role of signaling effectors downstream of IL-7Rα on in vivo T-  lymphocyte function, we used homologous recombination with a replacement vector to generate the IL-7Rα449F knock-in mice (see Fig. 2.1.a, Fig. 2.2. and Materials and Methods). The targeted IL-7Rα locus retained the endogenous promoter and upstream exons, however Exons 6-8 were replaced with cDNA encoding the transmembrane and cytoplasmic domains, with disruption of the YxxM motif by the Y449F substitution (Fig. 2.1.a). The phosphorylated IL-7Rα YxxM motif has been shown to be the binding site for the SH2domain of PI3 kinase and activation of downstream pathways (30-32). The NeoR selection marker was deleted by Cre-mediated recombination to eliminate potential promoter effects. Initial analysis of mutant IL-7Rα protein expression from thymocyte lysates indicated patterns comparable to wild-type (WT) thymocytes with mature polypeptides (90 kDa) (Fig. 2.1.b). Most importantly, we determined that the Y449F knock-in mutation did not affect surface expression of IL-7Rα on peripheral CD4 and CD8 T cells (Fig. 2.1.c). Furthermore, signaling analysis of WT and IL-7Rα449F cultured T cell blasts showed that TCR activation of the Erk and p38 MAPK pathways was unaffected, but that IL-7 activation of STAT5 requires IL-7Rα Y449 (Fig. 2.1.d). Interestingly, IL-7 by itself does not induce phosphorylation of Akt (Fig. 2.1.d) or S6 kinase (data not shown) in primary murine T cells at the time points tested. 2.2.2  Development of early hematopoietic lineages in IL-7Rα 449F mice To perform a comprehensive analysis of hematopoietic development in IL-7Rα449F  mice, we investigated the effect of loss of IL-7Rα Y449 signaling during development of early hematopoietic lineages using flow cytometry. We found the total number of bone marrow hematopoietic stem cells (HSCs) and derivatives were unaffected by the mutation (Fig. 2.3.a). Once again, we determined that the Y449F knock-in mutation does not affect surface expression of IL-7Rα on HSCs (Fig. 2.3.b). However, the earliest thymic T cell progenitors were severely impaired in both IL-7Rα mutants as evidenced by a 20-fold decrease in the total number of ETPs (characterized as Lin-CD3-CD4-CD8-CD25-CD117+, (33)) in IL-7Rα449F and IL-7Rα-/- mice in comparison to WT (Fig. 2.3.c).  39  2.2.3  IL-7Rα 449F thymocytes bypass a developmental block Complete disruption of IL-7Rα results in decreased survival of early T lymphocyte  progenitors causing a severe cytopenia that precludes detailed analysis of its role in peripheral T cells (1, 2, 26). In contrast, IL-7Rα449F mice showed only a 4-fold decrease in thymic cellularity compared to WT despite the severe ETP defect (Fig. 2.4.a, right panels) suggesting a role for IL-7Rα Y449-independent signaling in thymocyte development. In agreement with this hypothesis, the distribution of thymocyte subsets in IL-7Rα449F mice was indistinguishable from WT (Fig. 2.4.a, left panels). To further examine thymocyte development, WT, IL-7Rα449F and IL-7Rα-/- thymocytes were analyzed by expression of CD44 and CD25 in the CD4-CD8- DN compartment using flow cytometry. At all DN stages (DN I, CD4-CD8-CD44+CD25-; DN II, CD4-CD8-CD44+CD25+; DN III, CD4-CD8-CD44CD25+; DN IV, CD4-CD8-CD44-CD25-), the defects in IL-7Rα449F were less severe than in IL-7Rα-/- mice (Fig. 2.4.b, left panels). In addition, IL-7Rα449F mice had significantly higher numbers of DP thymocytes than IL-7Rα-/- mice (Fig. 2.4.a). This could be explained by the observation that IL-7Rα449F and WT mice showed similar production of DP thymocytes from DN IV precursors while IL-7Rα-/- DNIV cells encountered a severe developmental block at this stage (Fig. 2.4.b, right hand panel). This indicates an IL-7Rα Y449-independent compensatory mechanism that contributes to restoration of normal thymocyte development and partial rescue of total T cell numbers. The role of IL-7Rα signaling in positive selection was examined by determining the frequency of TCRβ+ DP thymocytes that had downregulated HSA (Fig. 2.4.c) or up-regulated the maturation marker CD69 (data not shown). These analyses showed that neither complete deletion nor mutation of IL-7Rα resulted in impaired positive selection and we conclude that IL-7Rα is non-essential in this process. Commitment to the γδ T cell lineage is IL-7Rα-dependent (34) and occurs late in the DNII to DNIII stage (35). We assessed γδ development by flow cytometry by staining total thymocytes with anti-γδ antibody and a lineage cocktail. Our data showed that γδ development is Y449 dependent since their numbers were markedly diminished (Fig. 2.4.d). Taken together, our data shows that IL-7Rα Y449-signals play critical roles in both αβ and γδ T cell development. To examine the basis of restored cellularity in IL-7Rα449F mice, cell turnover was determined by BrdU incorporation to monitor uptake by rapidly cycling DN thymocytes. We 40  found IL-7Rα449F DN IV cells that lack surface expression of the mutated IL-7Rα (data not shown) have markedly decreased BrdU uptake while the DN III and DP stages undergo more rapid cycling compared to WT (Fig. 2.4.e). Taken together, the data suggest that IL-7Rα driven cell division in DN and DP thymocytes is Y449-independent. To examine the severity of the IL-7Rα449F mutation on developmental potential, competitive re-population experiments were performed. This analysis revealed that IL7Rα449F thymocytes were less robust than their WT counterparts. Similar to what was seen in whole mice, when either WT or IL-7Rα449F whole bone marrow were delivered separately, IL-7Rα449F recipient thymic development resulted in 4-fold lower cellularity than WT recipients (data not shown). However, when WT (CD90.1+) and IL-7Rα449F (CD90.2+) whole bone marrow were delivered at a 1:1 ratio, the thymic output was comprised of less than 5% IL-7Rα449F derived cells although subset distribution was still normal (Fig. 2.4.f). Taken together, our data shows that knock-in disruption of IL-7Rα Y449 signals causes stagespecific defects, particularly dramatic at the ETP stage, but that these are bypassed to generate normal thymocyte subsets. 2.2.4  IL-7Rα Y449 independent signals are involved in peripheral T cell development The severe developmental defect in IL-7Rα-/- thymocytes (1) causes a paucity of T  cells in the periphery that confounds further analysis of the role of IL-7 in T cell function (3). When peripheral T cells were examined in IL-7Rα449F mice, we found that the relative subset distribution is similar between IL-7Rα449F and WT mice, while IL-7Rα-/- mice had significant disruption of CD4 and CD8 T cell development (Fig. 2.5.a). Quantification of peripheral lymphocytes revealed that IL-7Rα449F mice had significantly lower total cell numbers than WT mice (CD4 T cells: 2.5±0.3, CD8 T cells: 3.8±0.6, B cells: 3.7± 1.0 fold decrease, n=3) but that these subsets were higher than in IL-7Rα-/- mice, thus indicating that lymphocyte development is partially IL-7Rα Y449-independent (Fig. 2.5.b). Consistent with the expectation that this targeted mutation only affects IL-7Rα-mediated events, development of natural killer (NK) cells (NK1.1+CD3-) was unaffected in the spleens of both IL-7Rα449F and IL-7Rα-/- mice (Fig. 2.5.b). TCRβ and CD3ε expression levels on WT, IL7Rα449F and IL-7Rα-/- splenic T cells were analyzed by flow cytometry and found to be comparable between WT and IL-7Rα449F mice while those from IL-7Rα-/- mice were  41  severely deficient (Fig. 2.5.c). This shows that IL-7Rα Y449 signaling is dispensable for peripheral T cell maturation as assessed by antigen receptor expression. To eliminate the possibility of altered expression of other γc receptor family members in IL-7Rα449F mice accounting for differences in peripheral T cell function, surface expression levels of cytokine receptor chains γc and IL-2/15Rβ were examined. Our data showed only marginal differences in IL-7Rα and γc expression between WT and IL-7Rα449F CD4 and CD8 T cells although the frequency of IL-2/15Rβ expressing cells was increased in both IL-7Rα449F and IL-7Rα-/- T cells (Fig. 2.6.). 2.2.5  Homeostatic proliferation is IL-7Rα Y449-dependent Since IL-7Rα449F mice are able to support T cell development, we sought to address  what aspects of T cell function were impaired or retained. IL-7 has been shown to be involved in homeostatic proliferation of naïve CD4 and CD8 T cells (9, 13, 14). To address the role of IL-7Rα Y449 in homeostatic proliferation, IL-7Rα449F and WT (CD45.2+) T cells were labeled with the mitotic tracker CFSE and transferred into either normal or irradiated recipient host mice (CD45.1+). In stark contrast to WT T cells, IL-7Rα449F T cells were unable to proliferate when transferred into acutely lymphopenic hosts as measured by CFSE dilution (Fig. 2.7.). Indeed the deficiency was as severe as that in IL-7Rα-/- cells. A small pool of CD8 T cells underwent limited rounds of division, but this appeared IL-7Rαindependent since similar division was observed with IL-7Rα-/- cells (Fig. 2.7.). Our data strongly argues that homeostatic proliferation of both CD4 and CD8 T cells is dependent on signals initiated by IL-7Rα Y449. 2.2.6  IL-7Rα Y449 is essential for CD4 primary immune responses To determine the role of IL-7Rα Y449 in generating a functional polyclonal T cell  immune response in vivo, WT and IL-7Rα449F mice were infected with a recombinant Listeria monocytogenes strain expressing an immunodominant foreign, MHC class I (Kb) restricted peptide, SIYRYYGL (rLM-SIY) (Priatel, J., Zenewicz, L., Shen, H. and Teh, H., manuscript in preparation). Primary responses to rLM-SIY were monitored at day 7 and antigen-specific T-cells were enumerated by IFN-γ production in CD4 or CD8 T cells following in vitro stimulation with immunodominant MHC class II (LLO190-201)- and MHC class I (SIY)-restricted peptides, respectively. Surprisingly, IL-7Rα449F CD4 T cells failed to generate a detectable primary immune response following infection (Fig. 2.8.a). In contrast, 42  IL-7Rα449F CD8 T cells mounted a robust response that was equivalent to WT controls in total cell numbers (Fig. 2.8.a), independent of lower initial T cell numbers in IL-7Rα449F mice. In vitro anti-CD3/anti-CD28 TCR stimulation assays showed that IL-7Rα449F CD4 and CD8 T cells had impaired proliferation response to low, but not high, levels of TCR stimulation (Fig. 2.8.b) and this may account for the defective CD4 primary response. To determine whether or not the decrease in B cells or an altered splenic compartment could account for the lack of CD4 T cell primary response in IL-7Rα449F mice, equal numbers of WT Thy1.1 (CD90.1+) T cells were adoptively transferred into WT and IL7Rα449F CD90.2+ hosts. The mice were infected with rLM-SIY and responses measured at day 7 post-infection by determining IFN-γ expression upon in vitro stimulation with the indicated peptides. The fact that WT CD90.1+ CD4 T cells responded strongly in IL-7Rα449F hosts (Fig. 2.8.c) confirmed that the IL-7Rα449F CD4 defect was T cell intrinsic and not a result of inefficient antigen presentation. These data show that CD4, but not CD8 T cells require IL-7Rα Y449-mediated signals to generate primary responses to rLM-SIY. 2.2.7  IL-7Rα Y449 is essential for maintenance of CD8 T cell memory Previous reports have suggested that IL-7Rα is critical for the generation and/or  maintenance of T cell memory. The fact that IL-7Rα449F mice mount a strong primary CD8 T cell response to the MHC class I-restricted SIY peptide enabled us to investigate whether the formation of CD8 T cell memory is dependent on IL-7Rα Y449. WT and IL-7Rα449F mice were infected with rLM-SIY and analyzed 45 days later for antigen specific memory CD8 T cells by expression of IFN-γ in response to peptide. Despite generating equivalent numbers of CD8 T cell effectors as WT at day 7, IL-7Rα449F mice showed an 8-fold reduction in memory CD8 T cell numbers compared to WT mice (Fig. 2.9.a). Not surprisingly, the severely impaired primary CD4 T cell response in IL-7Rα449F mice resulted in very few LLO-reactive memory CD4 T cells. This experiment indicates an essential role for IL-7Rα Y449 signaling in regulation of CD8 memory T cells. To test the fitness of IL-7Rα449F memory T cells, WT and IL-7Rα449F mice previously immunized with rLM-SIY were homologously re-challenged at 100 days post-infection. Three days following re-infection, the IL-7Rα449F mice showed an increase in the number of SIY-specific CD8 T cells but failed to reach the same level as achieved by WT controls (Fig. 2.9.b). 43  Since IL-7Rα449F T cells have impaired proliferation at low dose stimulus of the TCR, the possibility existed that the number of IL-7Rα449F memory CD8 T cells was underestimated by assessing their ability to produce IFN-γ upon peptide challenge. In order to confirm our findings of decreased CD8 memory T cells, an H2-Kb MHC I:Ig fusion protein conjugated to PE (MHC:Ig dimer) was loaded with SIY peptide and used for detection of antigen specific cells. As shown in Fig. 2.9.c, the number of IL-7Rα449F memory CD8 T cells remained significantly lower (2.5 fold) than WT at day 60, although the decrease was not quite as dramatic as that shown by IFN-γ induction. This suggests that antigenspecific IL-7Rα449F memory CD8 T cells have compromised TCR-mediated cytokine induction. Strikingly, when memory T cells were assayed at day 100 in a parallel experiment, the WT CD8 memory T cell numbers remained constant while IL-7Rα449F CD8 memory T cell numbers continued to decrease (Fig. 2.9.c). These data demonstrate a requirement for IL-7Rα Y449 signals in maintenance and long-term survival of memory CD8 T cells. To address whether or not the lack of primary CD4 T helper cell expansion in the IL7Rα449F mice was affecting the generation of an efficient memory CD8 T cell compartment, we performed adoptive transfer experiments wherein WT CD90.1+ T cells were transferred into IL-7Rα449F (CD90.2+) hosts. This allows WT and IL-7Rα449F CD8 T cells to encounter antigen in the same environment and receive the same signals from activated WT CD4 T helper cells. WT and IL-7Rα449F antigen specific CD8 T cells were enumerated using MHC:Ig dimer staining at d7 and d45 post-rLM-SIY infection. To account for differences in transplant versus host cell numbers within spleens, we normalized the number of antigen specific CD8 memory T cells against the number of antigen specific primary CD8 T cells, and represented this as a percentage. The normal range of effector T cells that survive the contraction period to become memory cells is between 5 and 10%. We saw that greater than 15% of WT but less than 5% of IL-7Rα449F effector CD8 T cells were maintained at memory stage at Day 45 post-infection (Fig. 2.9.d), refuting the hypothesis that lack of CD4 T cell help accounts for the defect in IL-7Rα449F CD8 T cell memory. We therefore looked at possible cell intrinsic disruptions in IL-7Rα449F CD8 memory T cells. Memory T cells require a balance of cell survival and low-level proliferation for long-term maintenance. Previous studies have demonstrated a role for IL-7 in survival of memory CD8 T cells by regulating levels of the survival factor Bcl-2 (9, 36). Using 44  intracellular staining and flow cytometry, we found that the levels of Bcl-2 in WT and IL7Rα449F CD8+ IFN-γ+ memory T cells were equivalent following re-challenge (Fig. 2.9.e) and at day 45 post-infection (data not shown) and therefore cannot account for the maintenance defect. IL-15 has been demonstrated to regulate proliferation of memory CD8 T cells (6-8), but it remained possible that the IL-7Rα449F memory CD8 T cell pool was decreasing over time due to decreased proliferation. In agreement with previous studies that cycling of memory cells is regulated by IL-15 (37), we found that the cycling of IL-7Rα449F memory CD8 T cells was not disrupted as shown by BrdU incorporation (Fig. 2.9.f). Thus, the defect in IL-7Rα449F memory CD8 T cells does not result from impaired cycling, or from a lack of Bcl-2 survival signals. 2.2.8  STAT5, but not Bcl-2, is IL-7Rα Y449-dependent To more fully address the requirement of IL-7Rα Y449 in activation of known IL-7  signaling pathways, WT and IL-7Rα449F thymocytes and splenocytes were stimulated ex vivo with purified, recombinant IL-7 and analyzed by flow cytometry for phosphorylation of STAT5 and up-regulation of Bcl-2. This analysis showed that STAT5 activation was entirely IL-7Rα Y449 dependent in all IL-7 responsive subsets (thymic DN, CD4 and CD8, splenic CD4 and CD8 T cells) (Fig. 2.10.a). Surprisingly, two pro-survival members of the Bcl-2 family, Bcl-2 and Bcl-xL, were IL-7Rα Y449 independent (Fig. 2.10.b and data not shown). Analysis of Bcl-2 regulation showed that IL-7Rα449F DN thymocytes had decreased levels of Bcl-2 following 24 hour ex vivo culture compared to WT and that they were severely impaired in their ability to up-regulate Bcl-2 in response to IL-7 (Fig. 2.10.b). However, the remaining thymocyte subsets and peripheral T cells showed significant induction of Bcl-2 expression at the same time points (Fig. 2.10.b) leading to the conclusion that IL-7 mediated Bcl-2 regulation is mostly Y449-independent. Our findings support the hypothesis that IL-7induced Bcl-2 is important during the DN stages of development to impart survival signals that allow differentiation events to occur (26, 27) but importantly, refutes the notion that Bcl2 is sufficient in IL-7Rα-mediated events in peripheral T cells, particularly maintenance of CD8 memory T cells.  45  2.3  Discussion Existing knockout models have severe limitations for discerning the requirement of  IL-7Rα-induced signaling pathways downstream of T cell function in the periphery due to secondary effects (1, 3, 38, 39). We have established a novel model, the IL-7Rα449F knock-in mouse that allows analysis of development and function in T and B cells in the absence of IL-7Rα signaling from the Y449 residue. IL-7Rα Y449 was chosen for site-directed mutagenesis because previous work had linked activation of the PI3 kinase in B cells (30), human thymocytes (31) and a human T lymphoblastoid cell line (32) and, more recently, the STAT5 pathway to this residue (29). Similar to what is seen in IL-7Rα-/- mice, our analysis reveals that Y449 signaling is important in the early stages of T cell development. However, unlike IL-7Rα-/- mice, there is partial rescue of T cell numbers at later stages of thymic development. This novel aspect of the IL-7Rα449F mouse model means that in contrast with IL-7Rα-/- mice, IL-7Rα449F peripheral T cells are present at numbers amenable to further analysis. The defect seen in the number of ETPs detected in IL-7Rα449F relative to that of WT suggests a role for IL-7Rα signaling at the earliest stages of T cell development. This is seen despite the lack of IL-7Rα on the surface of ETPs (40) and is thus suggestive of either defective trafficking of progenitors into the thymus or a survival defect in the circulating Linsca1+c-kit+ progenitor. While a small population of circulating Lin-c-kit-B220+CD19-CD44hi cells has been reported to have T cell precursor potential (41), this elusive population (42) has not been quantified in the IL-7Rα449F mouse. Since the BM HSC and post-HSC compartments are normal in both IL-7Rα449F and IL-7Rα-/- animals, it is likely that the IL7Rα449F mutation affects early differentiation or survival events that account for the decrease in resident thymic progenitors. The difference in ETP development between IL-7Rα449F and IL-7Rα-/- also indicates that signaling events that occur independently of the Y449 residue are sufficient to support some ETP development. Moreover, Y449-independent signals are sufficient to enable further T cell development since the 20-fold decrease in ETPs is overcome and thymocyte and peripheral T cell numbers are decreased by only 4-fold. Our data also suggests that positive selection occurs in the absence of IL-7Rα-dependent signals since cells that successfully transition from DNIV to DP have normal frequencies of cells down-regulating HSA and up-regulating CD69. Together with our data showing IL-7Rα 46  Y449 dependent Bcl-2 up-regulation in the DN compartment, these findings strongly support the hypothesis that the primary role of IL-7Rα in early thymocyte development is to provide Bcl-2 mediated protection from apoptosis. Although the IL-7Rα subunit is also shared with the TSLP receptor to mediate TSLP signaling (43), it does not appear that the effects of IL7Rα449F disruption are TSLP-mediated since TSLP and TSLP receptor knockouts show no major B or T cell development defects (44, 45). The limited defects we found in the IL-7Rα449F mice enabled us to expand on the role of IL-7Rα in the development and function of peripheral T cells as established by the IL-7-/and IL-7Rα-/- mouse models and other indirect methods of blocking IL-7Rα function. For example, studies using adoptive transfer systems and/or neutralizing antibodies to IL-7Rα have shown that IL-7 plays a role in HP of naïve T cells (9, 17), and is essential for survival of memory CD4 (14) and CD8 (9) T cells. Previous studies have indicated that the transcription factor STAT5 is involved in HP (46, 47). Our study supports these findings and provides a direct link between IL-7Rα Y449-mediated STAT5 activation and efficient homeostatic proliferation. The pool of proliferating IL-7Rα449F CD8 T cells are IL-7Rα independent and are likely memory phenotype cells responding to IL-15 signaling. Interestingly, IL-7Rα449F T cells have attenuated responses to low dose α-CD3 and antiCD28 stimulation suggesting possible integration of TCR and IL-7Rα downstream signaling. The decreased proliferation elicited by low levels of TCR signaling may contribute to impaired HP since previous work has suggested that IL-7 and TCR signaling synergize to promote optimal HP (17). Most importantly, our data is at odds with the hypothesis that regulation of Bcl-2 is sufficient for maintenance of memory CD8 T cells. Previously, an adoptive transfer experiment of IL-7Rα-/- OT-I transgenic TCR CD8 T cells concluded that the defect in maintenance of memory CD8 T cells in this system was the decreased level of pro-survival Bcl-2 in these cells (9). However, IL-7Rα449F CD8 memory T cells express normal levels of Bcl-2 yet do not demonstrate long-term maintenance. Expression of Bcl-2 is not due to antigen stimulus since the same frequency of unstimulated controls express similar levels of Bcl-2. These data indicate two possible mechanisms to explain the defect of IL-7Rα449F CD8 memory T cells: fewer T cells from the primary response could be recruited to memory during the immune contraction phase or, if contraction is normal, the memory cells could be lacking a survival signal other than Bcl-2, such as Bcl-xL or Mcl-1. 47  Although the original pool of effector CD8 T cells is the same size as WT controls, by day 45 the IL-7Rα449F pool of CD8 memory T cells is significantly smaller, and continues to decrease over time. These cells retain the ability to expand upon secondary challenge in vivo indicating that although CD4 T cells do not generate a primary response their presence is sufficient to provide the ‘help’ signals necessary for re-expansion. This is further supported by our data showing that even in the presence of WT CD4 T cells, a smaller proportion of IL7Rα449F effector CD8 T cells are maintained to memory stage than WT cells generated in the same host. Finally, this is in agreement with the finding that CD4 help following acute infection is antigen-independent (48). Nonetheless, the decrease in cell numbers or the absence of IL-7Rα Y449-dependent signals compromises functional efficacy of CD8 memory T cells. When IL-7Rα449F mice were challenged with a homologous prime/boost regimen with a more virulent LM expressing gp33 of lymphocytic choriomeningitis virus (LCMV), IL-7Rα449F CD8 memory T cells were unable to provide protective immunity (data not shown). Our in vivo analyses extend upon a report describing the effect of IL-7Rα Y449F mutation (29). In agreement with our findings in primary cells, that study showed that activation of STAT5 is Y449-dependent. However, in contrast to the suggestion that IL-7mediated Bcl-2 regulation is also Y449-dependent, our in vivo model shows that loss of Bcl2 up-regulation is dramatic in DN thymocytes but is mostly restored at later stages of development in the IL-7Rα449F mouse. Moreover, we have found that IL-7 does not induce PI3 kinase activation in murine primary T cells as measured by Akt phosphorylation. This is in contrast to B cells and human T cells (reviewed in (49)) but is in keeping with findings in the CT6 murine T cell line (50). Our data suggests that IL-7 induction of Bcl-2 is STAT5and Akt-independent. In conclusion, we have characterized a novel IL-7Rα mutant mouse that has provided insight into the role of IL-7 signaling during early stages of T cell development and function of peripheral T cells. We show that IL-7Rα Y449-dependent signals such as STAT5 are required for accumulation of ETPs in the thymus. Interestingly, we also demonstrate a functional defect in the ability of IL-7Rα449F CD4 T cells to generate a primary response to infection with rLM-SIY. This suggests a previously underappreciated role for IL-7 signaling in either TCR repertoire selection or for acquiring effector function. In contrast, IL-7Rα449F CD8 T cells undergo vigorous expansion at acute stages of infection but a defect becomes 48  apparent in the maintenance of these cells to memory stage. The loss of antigen-specific CD8 memory T cells despite continued Bcl-2 expression disputes a sufficient role for Bcl-2 in IL7-mediated events in peripheral T cells (9). This suggests that IL-7 induced survival of CD8 memory T cells requires more than Bcl-2 expression and is being investigated further.  49  2.4  Materials and methods  Mice Animals were housed at the University of British Columbia, Microbiology and Immunology department animal facility in accordance with University of British Columbia Animal Care and Biosafety Committee certificates. C57BL/6, B6.SJL-Ptprca Pepcb (BoyJ), B6.PLThy1a/CyJ (Thy1.1+) and IL-7Rα-/- mice were obtained from Jackson Laboratories (Bar Harbor, ME). IL-7Rα 449F mice generation IL-7Rα449F mice were generated by homologous recombination. A replacement vector was generated in pKSloxPNT (51) (provided by Robert Farese) that substituted Exons 6-8 encoding the transmembrane and cytoplasmic domains of IL-7Rα with a partial cDNA (nucleotides 707- 1398) encoding a Y-to-F mutation at residue 449 and an SV40 polyadenylation signal (see below for details). The targeted locus would retain regulation by the endogenous promoter. RF8 ES cells (129/SvJae origin) (52) were electroporated with linearized vector, selected and targeted ES clones were identified by genomic Southern analysis. Two out of three targeted clones were transiently transfected with MC-Cre (provided by Shinya Yamanaka) to delete the loxP flanked NeoR cassette and subclones verified as above. IL-7Rα+/449F founders were generated by standard procedures and backcrossed at least 6 generations with C57BL/6 mice. PCR genotyping was performed with primers A (5’ TCTTCCTGAACAGCCAG), B (5’ TCTCTTCTGTGAGCTACGG) and C (5’ CCCTGAACCTGAAACATAAA), for 30 cycles each of 30 sec at 94°C, 30 sec at 60°C, 1 min at 72°C. Primers A and B amplify a 489 bp fragment from the wild-type allele, while Primers A and C amplify a 595 bp fragment from the knock-in allele. Knock-in targeting of the IL-7Rα locus We obtained BAC clones bearing IL-7Rα genomic DNA from an ES cell BAC library of 129 origin (Research Genetics, Hunstville, AL) and mapped them by genomic Southern analysis. The upstream short arm flanking genomic fragment was obtained by PCR amplification of Exon 4 to 6 sequence from the BAC clones, subcloning a 2.1kb BglII to BamH1 and verifying Exon 5 and 6 boundaries by sequencing. cDNA corresponding to the entire cytoplasmic domain of IL-7Rα was reverse transcribed from RNA from 7OZ/3 cells then amplified and cloned into pCR2.1. Residue Y449 was mutated to F using PCR 50  mutagenesis with the primer 5’ G AAT CAA GAA Gaa gct tTC GTC ACC ATG TCT AG 3’, where lower case indicates a silent HindIII restriction site introduced. This mutated IL7Rα cytoplasmic cDNA was verified by sequencing and fused to SV40 polyadenylation signal in pREP7 (Invitrogen, Burlington, ON). A BamHI to SalI fragment bearing cytoplasmic cDNA (nucleotides 707 to 1398) fused to SV40 polyadenylation signal was cloned distal to the 5’ BglII to BamH1 genomic fragment maintaining Exon 6 reading frame, in the BamHI- SalI sites of pKSloxPNT targeting vector. A 3’ EcoRI genomic fragment spanning the last exon of IL-7Rα, Exon 8, was isolated from BAC clones, subcloned and mapped. From this, the downstream long arm of the vector consisting of the 4.88kb BamHI fragment immediately 3’ to Exon 8 was cloned into the SfiI-NotI sites of pKSloxPNT to generate the final targeting vector, pKSloxPNT IL7Rα449F. The targeting vector was fully sequenced to confirm intact coding sequences, intron-exon boundaries and fragment orientation and linearized with NotI. Antibodies FITC-, PE-, CyC-, APC-, Alexa647-, APC Cy7-, PE Cy7-, and biotinylated antibodies were obtained from BD Pharmingen (Mississauga, ON) (anti- γδ TCR, NK1.1, B220, Gr-1, Mac-1, CD3ε, CD4, CD8α, CD25, CD44, CD69, CD90.1, CD90.2, c-kit, IL-2/15Rβ, γc, HSA, Sca1, TCRβ, Bcl-2, phosphoSTAT5, BrdU, H-2Kb:Ig Recombinant Fusion Protein, Mouse DimerX I) or eBioscience (San Diego, CA) (anti-CD4, CD8α, CD45.2, IL-7Rα). Unlabeled antibodies were obtained from Cell Signaling Technology (Danvers, MA) (anti-Akt, phosphoAkt Ser473, phosphoSTAT5, phosphoErk, Erk, p38 MAPK), BD Pharmingen (antiphospho p38 MAPK), Santa Cruz Biotechnology (Santa Cruz, CA) (anti-IL-7Rα, sc-662) and Sigma (Oakville, ON) (anti-α-tubulin). Rabbit polyclonal anti-STAT5A and STAT5B were a kind gift from Dr. Lothar Henninghausen. Fluorescent secondary antibodies used in the Odyssey Infrared Imaging System (LiCOR, Lincoln, NB), were obtained from Rockland Immunochemicals (goat anti-rabbit IgG IRDye800) and Invitrogen/Molecular Probes (goat anti-mouse IgG Alexa680). Horseradish peroxidase-conjugated secondary antibodies used in chemiluminescent immunoblotting were from Amersham Biosciences (Piscataway, NJ). Flow Cytometry Surface staining for stem cell and lymphocyte characterization was carried out according to standard procedures. For analysis of phosphoSTAT5 activation, cells were acid stripped (10 mM NaCitrate, pH4, 140 mM NaCl) and starved for 4 hours in serum free RPMI + 1% BSA. 51  Cells were stimulated by addition of 25 ng/ml recombinant murine IL-7 (Chemicon, Temecula, CA) for 10 minutes at 37oC in serum free media. Cells were fixed for 10 minutes in 1% PFA at room temperature (RT) and permeabilized in 100% ice-cold methanol. Staining for phosphoSTAT5, CD4 and CD8 was carried out using standard procedures. For detection of Bcl-2 up-regulation, cells were cytokine stripped and serum starved as above, and stimulated with IL-7 for 20 hours at 37oC. Cells were fixed and permeablized for 1 hour at RT in 1% PFA, 0.1% Tween-20 and stained for surface markers and intracellular Bcl-2. Samples were collected on either a FACSCalibur or LSRII (BD Biosciences, Mississauga, ON) and data analyzed with FlowJo software (Tree Star). Cell Cycle Analysis Two doses of 1 mg BrdU were delivered i.p. to WT and IL-7Rα449F mice at 4-hour intervals. Twenty hours following the second BrdU dose, thymi were harvested and stained for surface markers (for DN, α-CD25, CD44 and Lineage cocktail α-CD3, CD4, CD8, γδ TCR, Gr-1, Mac1; for DP, α-CD4, CD8). Cells were then treated according to manufacturer’s instructions for detection of BrdU. Western blotting Samples were lysed in Lysis buffer (10 mM Tris-HCl, pH7.5, 5 mM EDTA, 1% Triton X100), and cleared lysates quantified and normalized for total protein level. For immunoblot analysis of IL-7Rα expression, total thymocyte lysates were resolved by SDS-PAGE and proteins electrophoretically transferred to nitrocellulose. A polyclonal anti-IL-7Rα from Santa Cruz (sc-662) was used for detection, and visualized with donkey anti-rabbit HRP and SuperSignal West Pico ECL reagents (Pierce). For analysis of signaling pathways, WT and IL-7Rα449F CD8 T cells were cultured for 48 hrs at 106 cells/ml in the presence of 2µg/ml ConA in complete media, then maintained in 20U/ml IL-2 for 3 days and finally, cytokine stripped and serum starved for 4 hours. Cells were stimulated with 25 ng/ml IL-7, 1 µg soluble α-CD3 or 10 nM IL-2. Western blots were probed for detection of phosphorylated and total levels of Akt, p38 MAPK, Erk and STAT5 using the LiCor Odyssey imaging system. Homeostatic proliferation Spleens were collected from CD45.2+ WT, IL-7Rα449F and IL-7Rα-/- mice and prepared as single cell suspensions. Red blood cells were lysed using ACK lysis buffer (155 mM NH4Cl, 52  10 mM KHCO3, 100 µM EDTA). Lymphocytes were B cell depleted using sheep anti-mouse IgG DynaBeads (Invitrogen, Burlington, ON). Purified cells were CFSE labeled as previously described (53). T cell subsets were quantified by flow cytometry and 5x106 T cells were transferred i.v. to CD45.1+ congenic mice that either had or had not received a sub-lethal dose of irradiation the previous day (600 rads). After 7 days, spleens of recipient mice were harvested and stained for CD45.2, CD4 and CD8α. Competitive re-population Bone marrow cells were isolated from the femurs of Thy1.1 and IL-7Rα449F mice. After red blood cell lysis, 2x106 whole bone marrow cells from Thy1.1 (CD45.2+, CD90.1+) and IL7Rα449F (CD45.2+, CD90.2+) donors were adoptively transferred into lethally irradiated (1200 rads) BoyJ (CD45.1+) congenic recipients. Recipient mice received Biosol (neomycin sulfate) at 2 mg/ml in their water the night before irradiation and for the following two weeks. At 4 weeks post-injection, recipient thymuses were harvested and stained for CD45.2, CD90.1, CD90.2, CD4 and CD8α. In vitro TCR stimulation assay Peripheral T cells were purified from the spleens of WT and IL-7Rα449F mice using α-CD4 and α-CD8 MACS beads (Miltenyi Biotec, Auburn, CA) according to manufacturers instructions. Purified, CFSE labeled CD4 and CD8 WT and IL-7Rα449F T cells were cultured in vitro for 3 days in RPMI + 10% FBS in the presence of 1 µg α-CD28 and the indicated doses of plate-bound α-CD3. Cells were harvested, stained for CD4 and CD8 and dilution of CFSE was monitored by flow cytometry. Listeria monocytogenes infection and response assays Naïve C57BL/6 and IL-7Rα449F mice were injected intravenously with 105 cfu or previously immunized mice infected with 106 cfu of rLM-SIY in PBS. At appropriate time points postinfection, spleens were collected, homogenized to single cell suspension, red blood cells lysed and the cells re-stimulated in vitro with epitope-specific peptides for 5 hours at 37oC in the presence of 1 µl/106 cells Golgi plug (BD Pharmingen). The CD4 specific LLO peptide was added at 5 µM and the CD8 specific SIY peptide at 1 µM in Iscove’s media + 10% FCS. Following stimulation, cells were fixed and permeabilized in 2% PFA, 0.2% Tween-20 for 20 minutes at RT. Cells were then stained for CD4, CD8α and IFN-γ. Antigen specific cells were designated as CD4+ or CD8+cells that expressed IFN-γ following in vitro challenge with 53  antigenic peptides. SIY peptide loading of the BD Bioscience MHC I:Ig dimer fusion protein was carried out according to manufacturer’s instructions with a 40 M excess of peptide. For flow cytometric analysis of SIY-specific CD8 T cells using peptide loaded dimer, 0.5 µg dimer/2x106 cells was used. For adoptive transfer experiments, WT T cells were purified from Thy1.1 mice by B cell depletion and 107 T cells injected intravenously to C57BL/6 or IL-7Rα449F recipients. The following day, recipient mice were infected with 105 cfu of rLM-SIY and the analysis carried out as above (with addition of anti-CD90.1) at 7 days post-infection. Analysis of Bcl2 levels and BrdU incorporation was carried out with or without peptide stimulation and without IL-7 stimulation. Bcl-2 intracellular staining was carried out as above. For cell cycle analysis, mice were given a single 2 mg dose of BrdU i.p. and then fed BrdU in their water for 8 days (0.8 mg/ml). Staining was performed according to manufacturers instructions. Statistical Analysis All data are presented as mean ± standard error of the mean (s.e.m.) and analyzed by student’s T test. Significance was set at P value of less than 0.05.  54  Figure 2.1 Generation of IL-7Rα 449F knock-in mouse (a) A targeting vector carrying a partial cDNA of the IL-7Rα transmembrane and cytoplasmic domains with Y449F site-specific mutation (*) was used for homologous recombination in ES cells. WT, targeted, floxed and targeted (IL-7Rα449F) loci are shown (not to scale). Light gray boxes, exons; numerals below thick, black lines, exon numbers; dark gray box, IL-7Rα cDNA; sequences for neomycin (NEO) and thymidine kinase (TK) are shown; H, HindIII; B, BamHI; St, StuI; Bg, BglII; N, NotI, H*, HindIII site introduced. Probe 1 is a 0.65 kb EcoRI-BamHI fragment upstream of the short arm (see Online Supplemental Material), Probe 2 is a 202 bp fragment amplified from Exon 8 and the Neo probe is a 1.6 kb HindIII-SpeI fragment from the targeting vector. (b) Expression of IL-7Rα is maintained in IL-7Rα449F thymocytes. Thymocyte lysates were prepared from WT, IL7Rα449F and IL-7Rα-/- mice, and analyzed by immunoblot. Protein loading is indicated by the anti-Tubulin immunoblot (bottom panel). (c) Site-specific mutation of IL-7Rα Y449 does not affect expression of IL-7Rα on peripheral CD4 and CD8 T cells as assessed by flow cytometry. Experiment is representative of 3 mice for WT, IL-7Rα-/- and IL-7Rα449F in two independent experiments. Isotype antibody, dashed trace; anti-IL-7Rα, solid trace. (d) IL7Rα Y449F mutation abrogates activation of STAT5, but identifies activation of the p38 MAPK pathway as Y449-independent. Neither Akt or Erk are activated by IL-7 in T cells, but are efficiently activated by α-CD3 and IL-2 stimulation.  55  Figure 2.1  56  Figure 2.2  Figure 2.2 Southern blot analysis of knock-in mutation of the IL-7Rα locus Genomic DNA was from targeted ES clones (left hand panel) and targeted, Cre mediated Neo-deleted ES subclones used for injections (Subclones 2-4, right hand panel). The targeted locus was verified by the digests and probes indicated in Figure 2.1.a.  57  Figure 2.3  Figure 2.3 Bone marrow progenitor populations and IL-7Rα expression are normal in IL-7Rα 449F mice (a) Bone marrow progenitors develop at similar frequencies (left panels) and total cell numbers (right panel) in mice with targeted IL-7Rα449F mutation. Bar graphs are gated on Lin-Sca1+c-kit+ hematopoietic stem cells (HSCs) and their Lin-Sca1loc-kit+ derivatives (postHSCs). (b) IL-7Rα is expressed normally on IL-7Rα449F bone marrow populations as determined by FACS analysis. Isotype antibody, dashed trace; anti- IL-7Rα, solid trace. (c) The frequency of early thymic progenitors (ETPs) is decreased in both IL-7Rα-/- and IL7Rα449F thymi as compared to WT. FACS plots shown are gated on Lin-CD44+CD25- DNI populations. WT, black bars; IL-7Rα-/-, unfilled bars; IL-7Rα449F, hatched bars. All experiments are representative of at least 3 mice for WT, IL-7Rα-/- and IL-7Rα449F in two independent experiments.  58  Figure 2.4 An early thymocyte defect is bypassed in IL-7Rα 449F mice (a) FACS analysis shows that IL-7Rα449F thymocytes develop DN, DP, CD4 SP and CD8 SP populations in frequencies similar to WT mice (left hand panels). Total cellularity in IL7Rα449F mice is reduced in comparison to WT but significantly higher than in IL-7Rα-/littermates (right hand panel). (b) DN thymocyte development is affected by IL-7Rα449F mutation (left hand panels). Average cell numbers are shown in quadrants. The transition to DP thymocytes is unaffected in IL-7Rα449F mice (right hand panel). (c) Positive selection is IL-7Rα independent as shown by frequency of HSAlo cells in WT, IL-7Rα-/- and IL-7Rα449F DP thymocytes. (d) γδ T cell development is impaired in the absence of IL-7Rα Y449 signaling. Bar charts show the number of anti-γδ TCR+ lymphocytes in the thymus. (a, b, d) WT, black bars; IL-7Rα-/-, unfilled bars; IL-7Rα449F, hatched bars. (e) BrdU uptake revealed cell cycling is increased in DNIII and DP stages but decreased in DNIV IL-7Rα449F thymocytes. Isotype antibody, dashed trace; anti-BrdU, solid trace. (f) Competitive repopulation shows IL-7Rα449F derived cells were able to differentiate normally but are poorly competetive. Bar chart (left panel) and contour plots (right hand panels) are gated on CD90.1+ CD45.2+ (black bar) and CD90.1- CD45.2+ (hatched bar) thymocytes. Numbers in bar charts represent the average thymocyte recovery from each genotype. All experiments are representative of at least 3 mice for WT and IL-7Rα449F. IL-7Rα-/- samples were pooled from 3-6 mice.  59  Figure 2.4  60  Figure 2.5  Figure 2.5 Disruption of IL-7Rα Y449 signaling only partially perturbs peripheral lymphocyte development (a) Peripheral CD4 and CD8 T cells develop in IL-7Rα449F mice and confirm involvement of IL-7Rα Y449-independent pathways. (b) Quantification of FACS data shows that peripheral T and B cell development is reduced in IL-7Rα449F compared to WT but significantly higher than in IL-7Rα-/- littermates and supports a role for IL-7Rα Y449-independent signaling requirements. Natural killer cells (CD3-NK1.1+) are unaffected by abrogation of IL-7Rα Y449 signals. Data is expressed as percentage of WT cellularity, IL-7Rα-/-, unfilled bars; IL7Rα449F, hatched bars. (c) IL-7Rα Y449-independent signaling allows for accumulation of mature CD3+TCRβ+ T cells in the periphery. (See Figure 2.6.)  61  Figure 2.6  Figure 2.6 IL-7Rα Y449F site-specific mutation does not affect expression of receptor subunits of the γc-sharing cytokines (γc chain or IL-2/15Rβ) in peripheral T cells Experiments are representative of at least 3 mice for WT and IL-7Rα449F. IL-7Rα-/- samples consisted of 2-3 pooled spleens. Isotype antibody, dashed trace; anti-cytokine receptor, solid trace.  62  Figure 2.7  Figure 2.7 Signals from IL-7Rα Y449 are essential for IL-7 driven homeostatic proliferation Experiments are representative of 2-4 recipient mice from WT, IL-7Rα449F and IL-7Rα-/- T cells in two independent experiments. Irradiated hosts, black, filled trace; non-irradiated hosts, white trace.  63  Figure 2.8 IL-7Rα Y449 is essential for the CD4 primary response to Listeria monocytogenes (a) CD4 but not CD8 T cells require IL-7Rα Y449 for differentiation into effector cells. Bar charts represent total cell numbers of CD4+ IFN-γ+ or CD8+ IFN-γ+ T cells from WT (black bars) or IL-7Rα449F (hatched bars) spleens at day 7 post-infection. (b) Decreased TCR proliferation in IL-7Rα449F CD4 and CD8 T cells at low concentrations of agonist stimulation. The doses of plate-bound α-CD3 are indicated. Histograms show representative results of 1 to 3 replicates. WT, solid trace; IL-7Rα449F, dashed trace. (c) Adoptively transferred WT Thy1.1 (CD90.1+) CD4 and CD8 T cells respond to rLM-SIY infection equally well in WT (CD90.1-) and IL-7Rα449F (CD90.1-) hosts. Bar charts represent the number of Thy1.1 antigen specific T cells recovered from WT hosts (black bars) and IL7Rα449F hosts (hatched bars). Data are representative of at least 3 infected mice of each genotype for each experiment.  64  Figure 2.8  65  Figure 2.9  Figure 2.9 CD8 memory T cells require signals from IL-7Rα Y449 for long-term maintenance (a) IL-7Rα449F CD8 T cells are defective in their ability to survive and generate a stable pool of antigen specific memory cells. (b) Re-challenge with rLM-SIY at day 100 showed that recovery of antigen specific CD8 memory T cells was significantly impaired in IL-7Rα449F mice. (c) Analysis of SIY specific T cells at days 60 and 100 post-rLM-SIY infection using SIY loaded MHC:Ig dimer showed that IL-7Rα449F memory CD8 T cells numbers are impaired and decrease over time. Data shown is representative of 4 mice of each genotype. (d) Adoptive transfer of WT CD90.1+ CD4 and CD8 T cells allows generation of WT CD8 memory, but provision of WT CD4 T cell help is insufficient for IL-7Rα449F CD8 T cell memory. % primary effectors persisting as memory = no. of d45 CD8+ Dimer+ / no. of d7 CD8+Dimer+ x 100. Data shown is based on 4 transplanted mice at each time point. (e) Intracellular Bcl-2 was measured in peptide stimulated CD8+IFN-γ+ T cells of WT and IL7Rα449F mice at memory stages. No significant difference was detected in frequency of Bcl2+ cells. Isotype antibody, gray filled trace; unstimulated, dashed line; SIY stimulated, solid line. Data shown is representative of 3 mice of each genotype and 2 independent experiments. (f) BrdU incorporation is similar in WT and IL-7Rα449F memory CD8 T cells at day 45 post-rLM-SIY infection. Histograms are gated on CD8+IFN-γ+ cells. Solid line, WT; dashed line, IL-7Rα449F. Data is representative of 3 WT and IL-7Rα449F mice. 66  Figure 2.10  Figure 2.10 IL-7Rα 449F mutation abrogates activation of STAT5 but Bcl-2 upregulation is Y449-independent (a) Intracellular flow cytometry of WT and IL-7Rα449F lymphocytes stimulated ex vivo showed that activation of the STAT5 pathway is dependent on IL-7Rα Y449 in both the thymus and periphery. Isotype antibody, gray filled trace; untreated, dashed line; +IL-7, solid line. (b) Bcl-2 up-regulation is IL-7Rα Y449 independent in all thymic subsets and peripheral T cells except DN. Bar charts shown represent WT –IL-7, unfilled bars; WT +IL7, black bars; IL-7Rα449F –IL-7, gray bars; IL-7Rα449F +IL-7, hatched bars. All experiments are representative of at least 3 mice for each genotype and two independent experiments.  67  2.5  References  1.  Peschon, J.J., P.J. Morrissey, K.H. Grabstein, F.J. Ramsdell, E. Maraskovsky, B.C. Gliniak, L.S. Park, S.F. Ziegler, D.E. Williams, C.B. Ware, J.D. Meyer, and B.L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J.Exp.Med. 180:1955-1960.  2.  von Freeden-Jeffry, U., P. Vierira, L.A. Lucian, T. McNeil, S.E.G. Burdach, and R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J.Exp.Med. 181:1519-1526.  3.  Maraskovsky, E., M. Teepe, P.J. Morrissey, S. Braddy, R.E. Miller, D.H. Lynch, and J.J. Peschon. 1996. Impaired survival and proliferation in IL-7 receptor-deficient peripheral T cells. J.Immunol. 157:5315-5323.  4.  Puel, A., S.F. Ziegler, R.H. Buckley, and W.J. Leonard. 1998. Defective IL7R expression in T(-)B(+)NK(+) severe combined imunodeficiency. Nat.Genet. 20:394397.  5.  Hammarlund, E., M.W. Lewis, S.G. Hansen, L.I. Strelow, J.A. Nelson, G.J. Sexton, J.M. Hanifin, and M.K. Slifka. 2003. Duration of antiviral immunity after smallpox vaccination. Nat.Med. 9:1131-1137.  6.  Becker, T.C., E.J. Wherry, D. Boone, K. Murali-Krishna, R. Antia, A. Ma, and R. Ahmed. 2002. Interleukin 15 is required for proliferative renewal of virus-specific memory CD8 T cells. J.Exp.Med. 195:1541-1548.  7.  Goldrath, A.W., P.V. Sivakumar, M. Glaccum, M.K. Kennedy, M.J. Bevan, C. Benoist, D. Mathis, and E.A. Butz. 2002. Cytokine requirements for acute and Basal homeostatic proliferation of naive and memory CD8+ T cells. J.Exp.Med. 195:15151522.  8.  Schluns, K.S., K. Williams, A. Ma, X.X. Zheng, and L. Lefrancois. 2002. Cutting edge: requirement for IL-15 in the generation of primary and memory antigenspecific CD8 T cells. J.Immuno.l 168:4827-4831.  9.  Schluns, K.S., W.C. Kieper, S.C. Jameson, and L. Lefrancois. 2000. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat.Immunol. 1:426-432.  10.  Goldrath, A.W., and M.J. Bevan. 1999. Low-affinity ligands for the TCR drive proliferation of mature CD8+ T cells in lymphopenic hosts. Immunity. 11:183-190.  11.  Kieper, W.C., and S.C. Jameson. 1999. Homeostatic expansion and phenotypic conversion of naive T cells in response to self peptide/MHC ligands. Proc.Natl.Acad.Sci.U.S.A. 96:13306-13311.  12.  Marrack, P., J. Bender, D. Hildeman, M. Jordan, T. Mitchell, M. Murakami, A. Sakamoto, B.C. Schaefer, B. Swanson, and J. Kappler. 2000. Homeostasis of alpha beta TCR+ T cells. Nat.Immunol. 1:107-111.  13.  Surh, C.D., and J. Sprent. 2005. Regulation of mature T cell homeostasis. Semin.Immunol. 17:183-191.  14.  Seddon, B., P. Tomlinson, and R. Zamoyska. 2003. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat.Immunol. 4:680-686. 68  15.  Tan, J.T., B. Ernst, W.C. Kieper, E. LeRogy, J. Sprent, and C.D. Surh. 2002. Interleukin (IL)-15 and IL-7 jointly regulate homeostatic proliferation of memory phenotype CD8+ cells but are not required for memory phenotype CD4+ cells. J.Exp.Med. 195:1523-1532.  16.  Vivien, L., C. Benoist, and D. Mathis. 2001. T lymphocytes need IL-7 but not IL-4 or IL-6 to survive in vivo. Int.Immunol. 13:763-768.  17.  Seddon, B., and R. Zamoyska. 2002. TCR and IL-7 receptor signals can operate independently or synergize to promote lymphopenia-induced expansion of naive T cells. J.Immunol. 169:3752-3759.  18.  Surh, C.D., and J. Sprent. 2002. Regulation of naive and memory T-cell homeostasis Microbes Infect. 4:51-56.  19.  Judge, A.D., X. Zhang, H. Fujii, C.D. Surh, and J. Sprent. 2002. Interleukin 15 controls both proliferation and survival of a subset of memory-phenotype CD8+ T cells. J.Exp.Med. 196:935-946.  20.  Kieper, W.C., J.T. Tan, B. Bondi-Boyd, L. Gapin, J. Sprent, R. Ceredig, and C.D. Surh. 2002. Overexpression of interleukin (IL)-7 leads to IL-15 independent generation of memory phenotype CD8+ T cells. J.Exp.Med. 195:1533-1539.  21.  Hamilton, S.E., M.C. Wolkers, S.P. Schoenberger, and S.C. Jameson 2006. The generation of protective memory-like CD8+ T cells during homeostatic proliferation requires CD4+ T cells. Nat.Immunol. 7:475-481.  22.  Fry, T.J., and C.L. Mackall. 2002. Interleukin-7: from bench to clinic. Blood. 99:3892-3904.  23.  Sudo, T., S. Nishikawa, N. Ohno, N. Akiyama, M. Tamakoshi, H. Yoshida, and S. Nishikawa. 1993. Expression and function of the interleukin 7 receptor in murine lymphocytes. Proc.Natl.Acad.Sci.U.S.A. 90:9125-9129.  24.  Hofmeister, R., A.R. Khaled, N. Benbernou, E. Rajnavolgyi, K. Muegge, and S.K. Durum. 1999. Interleukin-7: physiological roles and mechanisms of action. Cytokine Growth Factor Rev. 10:41-60.  25.  Van De Wiele, C.J., J.H. Marino, B.W. Murray, S.S. Vo, M.E. Whetsell, and T.K. Teague. 2004. Thymocytes between the β-selection and positive selection checkpoints are nonresponsive to IL-7 as assessed by STAT-5 phosphorylation. J.Immunol. 172:4235-4244.  26.  Akashi, K., M. Kondo, U. von Freeden-Jeffry, R. Murray, and I.L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell. 89:1033-1041.  27.  Maraskovsky, E., L.A. O'Reilly, M. Teepe, L.M. Corcoran, J.J. Peschon, and A. Strasser. 1997. Bcl-2 can rescue T lymphocyte development in interleukin-7 receptordeficient mice but not in mutant rag-1-/- mice. Cell. 89:1011-1019.  28.  Amos, C.L., A. Woetmann, M. Nielsen, C. Geisler, N. Odum, B.L. Brown, and P.R. Dobson. 1998. The role of caspase 3 and BclxL in the action of interleukin 7 (IL-7): a survival factor in activated human T cells. Cytokine. 10:662-668.  69  29.  Jiang, Q., W.Q. Li, R.R. Hofmeister, H.A. Young, D.R. Hodge, J.R. Keller, A.R. Khaled, and S.K. Durum. 2004. Distinct regions of the interleukin-7 receptor regulate different Bcl2 family members. Mol.Cell.Biol. 24:6501-6513.  30.  Dadi, H.K., S. Ke, and C.M. Roifman. 1993. Interleukin 7 receptor mediates the activation of phosphatidylinositol-3 kinase in human B-cell precursors. Biochem. Biophys Res.Commun. 192:459-464.  31.  Pallard, C., A.P. Stegmann, T. van Kleffens, F. Smart, A. Venkitaraman, and H. Spits. 1999. Distinct roles of the phosphatidylinositol 3-kinase and STAT5 pathways in IL-7-mediated development of human thymocyte precursors. Immunity. 10:525535.  32.  Venkitaraman, A.R., and R.J. Cowling. 1994. Interleukin-7 induces the association of phosphatidylinositol 3-kinase with the alpha chain of the interleukin-7 receptor. Eur.J.Immunol. 24:2168-2174.  33.  Bhandoola, A., A. Sambandam, D. Allman, A. Meraz, and B. Schwarz. 2003. Early T lineage progenitors: new insights, but old questions remain. J.Immunol. 171:56535658.  34.  Ye, S.K., Y. Agata, H.C. Lee, H. Kurooka, T. Kitamura, A. Shimizu, T. Honjo, and K. Ikuta. 2001. The IL-7 receptor controls the accessibility of the TCRgamma locus by Stat5 and histone acetylation. Immunity. 15:813-823.  35.  Ciofani, M., G.C. Knowles, D.L. Wiest, H. von Boehmer, and J.C. Zuniga-Pflucker. 2006. Stage-Specific and Differential Notch Dependency at the alphabeta and gammadelta T Lineage Bifurcation. Immunity. 25:105-116.  36.  Kaech, S.M., J.T. Tan, E.J. Wherry, B.T. Konieczny, C.D. Surh, and R. Ahmed. 2003. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat.Immunol. 4:1191-1198.  37.  Ku, C.C., M. Murakami, A. Sakamoto, J. Kappler, and P. Marrack. 2000. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science. 288:675-678.  38.  Yao, Z., Y. Cui, W.T. Watford, J.H. Bream, K. Yamaoka, B.D. Hissong, C. Li, S.K. Durum, Q. Jiang, A. Bhandoola, L. Hennighausen, and J.J. O'Shea. 2006. Stat5a/b are essential for normal lymphoid development and differentiation. Proc.Natl.Acad.Sci.U.S.A. 103:1000-1005.  39.  Nakayama, K., K. Nakayama, I. Negishi, K. Kuidi, Y. Shinkai, M.C. Louie, L.E. Fields, P.J. Lucas, V. Stewart, F.W. Alt, and D.Y. Loh. 1993. Disappearance of the lymphoid system in Bcl-2 homozygous mutant chimeric mice. Science. 261:15841588.  40.  Allman, D., A. Sambandam, S. Kim, J.P. Miller, A. Pagan, D. Well, A. Meraz, and A. Bhandoola. 2003. Thymopoiesis independent of common lymphoid progenitors. Nat.Immunol. 4:168-174.  41.  Martin, C.H., I. Aifantis, M.L. Scimone, U.H. von Andrian, B. Reizis, H. von Boehmer, and F. Gounari. 2003. Efficient thymic immigration of B220+ lymphoidrestricted bone marrow cells with T precursor potential. Nat.Immunol. 4:866-873.  42.  Schwarz, B.A., and A. Bhandoola. 2004. Circulating hematopoietic progenitors with T lineage potential. Nat.Immunol. 5:953-960. 70  43.  Levin, S.D., R.M. Koelling, S.L. Friend, D.E. Isaksen, S.F. Ziegler, R.M. Perlmutter, and A.G. Farr. 1999. Thymic stromal lymphopoietin: a cytokine that promotes the development of IgM+ B cells in vitro and signals via a novel mechanism. J.Immunol. 162:677-683.  44.  Carpino, N., W.E. Thierfelder, M.S. Chang, C. Saris, S.J. Turner, S.F. Ziegler, and J.N. Ihle. 2004. Absence of an essential role for thymic stromal lymphopoietin receptor in murine B-cell development. Mol.Cell.Biol. 24:2584-2592.  45.  Al-Shami, A., R. Spolski, J. Kelly, T.J. Fry, P.L. Schwartzberg, A. Pandey, C.L. Mackall, and W.J. Leonard. 2004. A role for thymic stromal lymphopoietin in CD4+ T cell development. J.Exp.Med.200:159-168.  46.  Burchill, M.A., C.A. Goetz, M. Prlic, J.J. O'Neill, I.R. Harmon, S.J. Bensinger, L.A. Turka, P. Brennan, S.C. Jameson, and M.A. Farrar. 2003. Distinct effects of STAT5 activation on CD4+ and CD8+ T cell homeostasis: development of CD4+CD25+ regulatory T cells versus CD8+ memory T cells. J.Immunol. 171:  47.  Kelly, J., R. Spolski, K. Imada, J. Bollenbacher, S. Lee, and W.J. Leonard. 2003. A role for Stat5 in CD8+ T cell homeostasis. J.Immunol. 170:210-217.  48.  Sun, J.C., M.A. Williams, and M.J. Bevan. 2004. CD4 T cells are required for the maintenance, not programming, of memory CD8 T cells after acute infection. Nat.Immunol. 5:927-933.  49.  Jiang, Q., W.Q. Li, F.B. Aiello, R. Mazzucchelli, B. Asefa, A.R. Khaled, and S.K. Durum. 2005. Cell biology of IL-7, a key lymphotrophin. Cytokine Growth Factor Rev. 16:513-533.  50.  Lali, F.V., J. Crawley, D.A. McCulloch, and B.M. Foxwell. 2004. A late, prolonged activation of the phosphatidylinositol 3-kinase pathway is required for T cell proliferation. J.Immunol. 172:3527-3534.  51.  Hanks, M., W. Wurst, L. Anson-Cartwright, A.B. Auerbach, and A.L. Joyner. 1995. Rescue of the En-1 mutant phenotype by replacement of En-1 with En-2. Science. 269:679-682.  52.  Meiner, V.L., S. Cases, H.M. Myers, E.R. Sande, S. Bellosta, M. Schambelan, R.E. Pitas, J. McGuire, J. Herz, and R.V. Farese, Jr. 1996. Disruption of the acylCoA:cholesterol acyltransferase gene in mice: evidence suggesting multiple cholesterol esterification enzymes in mammals. Proc.Natl.Acad.Sci.U.S.A. 93:1404114046.  53.  Priatel, J.J., O. Utting, and H.S. Teh. 2001. TCR/self-antigen interactions drive double-negative T cell peripheral expansion and differentiation into suppressor cells. J.Immunol. 167:6188-6194.  71  3 Selective ablation of the YxxM motif of IL-7Rα suppresses lymphomagenesis but maintains lymphocyte development3  3  A version of this chapter has been published. Osborne LC, Duthie KA, Seo JH, Gascoyne RD, Abraham N. 2010. Selective ablation of the YxxM motif of IL-7Rα suppresses lymphomagenesis but maintains lymphocyte development. Oncogene 29:3854-64. 72  3.1  Introduction Leukemia and lymphoma account for 700,000 cancer cases annually. These remain the  leading cause of disease related deaths in children with secondary health drawbacks for survivors (1). Development of immunotherapies specifically targeting cancer while minimizing damage to surrounding lymphocytes and tissues could improve patient outcome. The cytokine interleukin-7 (IL-7) has been identified as a supportive factor for several human lymphocyte malignancies, including Hodgkin’s and both B and T cell acute and chronic lymphocytic leukemias (2-10). Along with Notch ligands and c-kit, IL-7 has a prominent, essential role in early T and B- cell fate determination. The role of survival and other signals induced by deregulation of this primary lymphoid cytokine in determining tumorigenesis is unknown. In murine B cell development, co-operative signals initiated from the pre-BCR and IL-7R govern pre-B cell proliferation during heavy chain rearrangement to allow differentiation and maturation. c-Myc is a transcription factor that plays a key role in regulating B lymphocyte differentiation and expansion (11). Overexpression of c-Myc in the Eµ-myc mouse causes transformation of pre-B cells to lymphoma (12) and is a well-defined model for human B lymphomagenesis. Similarly, transgenic overexpression of IL-7 (Tg IL-7) causes mixed T and B cell lymphoma (13) which permits analysis of signals required in this model. Since IL-7 is essential for both T and B cell development in mice and T cells in humans (14-16), we aimed to determine if signals necessary for lymphocyte homeostasis and development could be separated from those required for transformation. IL-7 signaling is transduced by the IL-7 receptor, a heterodimer composed of the γ common chain (γc, CD132, shared receptor component for cytokines IL-2, -4, -7, -9, -15 and 21) and the IL-7 receptor α (IL-7Rα, CD127, also shared with TSLP receptor). The IL-7Rα has a conserved tyrosine residue, Y449, located in an SH2 domain binding motif (YxxM), required for activation of STAT5 and the PI3 kinase/Akt pathway (17, 18). In contrast to IL-7Rα knockout mice that are severely lymphopenic due to developmental blocks in both B and T cell lineages (16), mice with a targeted Y449 to phenylalanine (F) knock-in mutation at the IL-7Rα locus (IL-7Rα449F) show relatively normal T cell differentiation (19). Since the IL-7Rα449F mutation allows T cell differentiation but alters the signaling capacity of the receptor (19) we tested the hypothesis that IL-7Rα Y449 mediated pathways were essential for lymphoid transformation.  73  We crossed IL-7Rα449F mice with the Tg IL-7 model and the Eµ-myc model to evaluate the role of IL-7Rα signaling in T and B cell development and transformation. We determined that specific elimination of IL-7Rα Y449-mediated signaling was sufficient to prevent lymphomagenesis in the Tg IL-7 model and surprisingly, caused significantly lower c-Myc driven mortality. In the Tg IL-7 model, T cell transformation is associated with altered regulation of Bcl-2 family members and increased CD8 T cell survival. We determined that IL-7Rα449F mutation prevented lymphomagenesis and normalized expression of Bcl-2 family members without severe detriment to lymphocyte development. B cell hyperproliferation is characteristic of Eµ-myc induced transformation. Analysis of Eµ-myc; IL-7Rα449F B cell progenitors revealed that the IL-7Rα449F mutation rendered them less viable, unable to activate STAT5 in response to IL-7 and resistant to Eµ-myc induced proliferation. Thus, we show that interference with IL-7Rα Y449 signaling impairs lymphomagenesis in both B and T cells using two distinct genetic models.  74  3.2  Results  3.2.1  Abrogation of IL-7Rα Y449 signals protects from IL-7-mediated lymphomagenesis Tg IL-7 mice have been previously used to study IL-7 responsive tumor types and IL-7-  mediated transformation (13, 20). To investigate the requirement of IL-7Rα Y449 signaling in IL-7 mediated lymphomagenesis, we generated Tg IL-7 IL-7Rα+/+, IL-7Rα+/449F and IL-7Rα449F animals. Tg IL-7; IL-7Rα+/+ mice developed lymphoid tumors and had a median mortality of 24 weeks (Fig. 3.1.a, (13)). Strikingly, replacement of wild type (WT) IL-7Rα with one mutated allele (Tg IL-7; IL-7Rα+/449F) doubled the median survival age (47 weeks). Mice expressing both copies of the mutated IL-7Rα449F allele were completely protected (>65 weeks) (Fig. 3.1.a). Spleens from end stage Tg IL-7; IL-7Rα+/+ were hypertrophic with expanded white pulp areas while age-matched Tg IL-7; IL-7Rα449F spleens had normal white and red pulp separation (Fig. 3.2.a). These differences occurred despite comparable levels of thymic IL-7 mRNA expression in Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα+/+ littermates (Fig. 3.2.b). Together, these observations suggested that IL-7Rα Y449 signaling was essential for IL-7 mediated lymphocyte transformation. 3.2.2  IL-7Rα Y449 signaling is essential for IL-7-induced splenomegaly and CD8 T cell expansion but does not alter lymphoma precursor populations To determine the effects of the Tg IL-7 and IL-7Rα449F mutations, we assessed  lymphocyte differentiation in thymi and spleens of 8 week old WT, IL-7Rα449F, Tg IL-7; IL7Rα+/+ and Tg IL-7; IL-7Rα449F mice. As previously shown (19), the IL-7Rα449F mutation allowed T cell differentiation and CD4/CD8 profiles similar to WT in both thymus and spleen, although cellularity was decreased (Fig. 3.1.b, c). In contrast, at 8 weeks and with no detectable lymphocyte transformation, Tg IL-7; IL-7Rα+/+ mice had significant abnormalities in subset composition. IL-7 overexpression resulted in increased frequency and number of CD8 single positive (SP) thymocytes, development of an abnormal thymic B cell population, and decreased frequency and number of CD4+CD8+ double positive (DP) cells (Fig. 3.1.b, c and (13, 21). At the same time, an abnormal population of DP cells was present in the spleens of Tg IL-7; IL-7Rα+/+ mice (Fig. 3.1.b, bottom panel) and splenomegaly had developed due to increased peripheral CD4 and CD8 T cells and B cells (Fig. 3.1.c, bottom panel). Chronic IL-7 overexposure resulted in development of fatal thymomas or peripheral lymphoid tumors that were primarily composed of DP and CD8 SP T cells (Table 3.1). 75  Despite the fact that IL-7 overexpression allowed for significant IL-7Rα Y449independent increases in lymphocyte cellularity, the IL-7Rα449F mutation prevented Tg IL-7induced developmental defects noted above and resulted in thymic and peripheral lymphocyte differentiation similar to WT. Remarkably, CD8 T cell expansion was prevented, the frequency of thymic B cells was decreased, and splenic DP cells were absent in Tg IL-7; IL-7Rα449F mice (Fig. 3.1.b, c). Most importantly, these mice did not develop splenomegaly (Fig. 3.1.b, c, bottom panel) or succumb to tumor-induced mortality (Fig. 3.1.a). While the transformation target population is not clearly defined in the Tg IL-7 model, the DN, CD4 and CD8 T cell pools were nonetheless equivalent between Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F mice making target size of these cell types an unlikely factor (Fig. 3.1.c). 3.2.3  IL-7Rα Y449 is required for IL-7-mediated increases in cell survival To determine how IL-7 affects lymphomagenesis, we analyzed lymphoid organs of early  stage Tg IL-7; IL-7Rα+/+ mice for evidence of increased cell survival and/or cell proliferation. Expression of the IL-7-regulated anti-apoptotic protein Bcl-2 was consistently increased in predisease samples of Tg IL-7; IL-7Rα+/+ DP and CD8 SP thymocytes (Fig. 3.3.a). In peripheral CD4 and CD8 T cells, transgenic IL-7 increased expression of Bcl-2 and Bcl-xL through IL-7Rα Y449, but did not affect expression of Mcl-1 or the pro-apoptotic Bcl-2 inhibitor, Bim (Fig. 3.4.a, Fig. 3.3.b). We then compared expression of Bcl-2 in Tg IL-7; IL-7Rα+/+ thymomas and agematched, healthy Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F thymocytes and found that the increase noted in healthy samples was significantly increased in frank lymphomas, particularly in the DP and CD8 SP thymocyte populations and that this increase was IL-7Rα Y449-dependent (Fig. 3.4.b). Bcl-xL expression was also increased in Tg IL-7; IL-7Rα+/+ thymomas, although expression of Mcl-1 was unaffected (Fig. 3.3.c). Interestingly, Bim down-regulation was noted in one Tg IL-7; IL-7Rα+/+ thymoma analyzed (data not shown), suggesting that IL-7 may affect lymphoid transformation through Bcl-2/Bim imbalance. Thus, deregulation of Bcl-2 family members is characteristic of IL-7-mediated transformation and is dependent on the IL-7Rα Y449xxM motif. To determine the functional consequence of differential anti-apoptosis effector expression, we exposed splenic lymphocytes from WT, IL-7Rα449F, Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F mice to a variety of apoptotic stimuli and measured the percentage of viable 76  cells after treatment. IL-7 overexpression provided a survival advantage to dexamethasone (Dex) treated or cytokine starved CD8 T cells and this protection was IL-7Rα Y449-dependent (Fig. 3.4.c, Fig. 3.3.d). Interestingly, CD4 SP T cells and B cells were not protected from Dex-induced apoptosis (data not shown). However, Tg IL-7 CD8 T cells were still susceptible to free radical induced apoptosis despite the finding that ectopic Bcl-2 expression can be protective in this setting (Fig. 3.3.d, (22)). Analysis of proliferation using Ki67 expression in pre-disease samples from Tg IL-7; IL7Rα+/+ and age-matched WT controls suggested that the IL-7 transgene had a less profound effect on proliferation than cell survival. In agreement with previous data (21), Tg IL-7; IL7Rα+/+ DN (CD4-CD8-B220-) thymocytes had fewer Ki67+ cells than WT counterparts (Fig. 3.4.d). In contrast, there was a paradoxical increase in Ki67+ DN thymocytes in Tg IL-7; IL7Rα449F mice over WT controls (Fig. 3.4.d), consistent with our previous findings (23). Increased DN proliferation could contribute to the increased number of DP thymocytes in these mice (Fig. 3.1.c). However, at later stages of thymocyte development, IL-7 overexpression has minimal effects on Ki67 expression. Notably, neither Tg IL-7; IL-7Rα+/+ nor Tg IL-7; IL7Rα449F CD8 SP thymocytes (Fig. 3.4.d) or peripheral T or B cells (data not shown) show significant changes in Ki67 expression compared to WT counterparts (data not shown). These data suggest that the anti-apoptosis signals relayed through the IL-7Rα Y449 residue may allow the accumulation of secondary genetic lesions required for lymphocyte transformation. 3.2.4  c-Myc lymphomagenesis is reduced by the IL-7Rα 449F mutation We next evaluated whether disrupted IL-7Rα Y449 signaling could confer protection in  Eµ-myc mice, a murine B cell lymphoma model of human Burkitt lymphoma (12). Eµ-myc; IL7Rα+/+, Eµ-myc; IL-7Rα+/449F and Eµ-myc; IL-7Rα449F mice were generated. Strikingly, a single mutated IL-7Rα allele provided significant protection, and expressing two mutated copies increased the median survival time from 15.5 to 66.5 weeks (Fig. 3.5.a). To ensure differences in transgene expression were not the cause of the delayed tumor onset in Eµ-myc; IL-7Rα449F mice, we quantified c-Myc in tumors isolated from Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F mice and found that expression was similar (Fig. 3.5.b). This genetic analysis indicated that IL-7Rα signals involved in B lymphopoiesis were critical for emergence of Eµ-myc-induced tumors. Overexpression of the c-Myc oncoprotein results in developmental arrest and pre-B or B cell lymphomas (12, 24). Since IL-7Rα449F mice have decreased numbers of peripheral B cells 77  (19) , it was possible the Eµ-myc; IL-7Rα449F mice were protected from c-Myc induced lymphomagenesis due to a decreased population of lymphoma precursors. We quantified B cell progenitor populations in the bone marrow (BM) of pre-disease Eµ-myc and non-transgenic IL7Rα+/+ and IL-7Rα449F mice at 6 weeks of age (Fig. 3.5.c). In agreement with previous findings (24), the pre-B subset was greatly expanded in Eµ-myc; IL-7Rα+/+ mice compared to non-Tg controls. In contrast, the IL-7Rα449F mutation resulted in decreased numbers of pre-B and mature B cells compared to WT. The combination of these two alterations in Eµ-myc; IL-7Rα449F mice resulted in pre-B cell numbers similar to WT. Thus, the IL-7Rα449F mutation does decrease the target population and could contribute to delayed lymphomagenesis. 3.2.5  IL-7Rα 449F mutation inhibits essential progenitor B cell survival and proliferation signals To determine if factors other than decreased B cell cellularity contributed to the  protection in Eµ-myc; IL-7Rα449F mice, we analyzed B cell subsets for survival and proliferation defects. Since hyperproliferation is a hallmark of Eµ-myc induced tumors (25) we evaluated proliferation of BM and splenic B cell subsets using expression of Ki67 as a marker. As expected, Eµ-myc; IL-7Rα+/+ B cells expressed high levels of Ki67 more frequently than WT counterparts (Fig. 3.7.a). Interestingly, fewer Eµ-myc; IL-7Rα449F B cells were Ki67+ (Fig. 3.7.a), indicating that the IL-7Rα449F mutation interfered with c-Myc induced proliferation and likely contributes to the protection noted in these mice. A paradoxical finding, however, was that the IL-7Rα449F mutation actually increased the frequency of Ki67+ cells compared to WT in BM B progenitors (Fig. 3.7.a). Since cellularity of this compartment was decreased, we aimed to determine if cell viability was compromised. Bcl-2 expression was used as a measure of anti-apoptosis capacity. At the earliest stages of B cell development, no significant differences in Bcl-2 expression were detected between mice of all genotypes (Fig. 3.7.b). However, as B cells matured, mice bearing the IL-7Rα449F mutation had higher Bcl-2 expression (Mature BM cells shown in Fig. 3.7.b, data not shown for splenic B cells) despite the absence of expression of IL-7Rα in mature B cells (26, 27) and Fig. 3.8). In agreement with previous findings (28, 29), mature splenic B cells of pre-disease Eµ-myc; IL7Rα+/+ mice down-regulated the anti-apoptotic Bcl-2 protein compared to WT (data not shown). To determine if changes in Bcl-2 expression had a functional consequence, viability of progenitor and splenic B cells from WT, IL-7Rα449F, Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL78  7Rα449F mice was determined directly ex vivo. IL-7Rα449F and Eµ-myc; IL-7Rα449F mice had significantly fewer viable cells in the pre-B and mature B cell compartments indicating a clear survival defect due to loss of IL-7Rα Y449-signaling (Fig. 3.7.c) independent of Bcl-2 levels. Thus, IL-7Rα449F B cells are not protected from apoptosis indicating that increased Bcl-2 expression may not correlate with increased susceptibility to transformation in B cells. To determine if IL-7 signaling pathways known to be important for B cell development were affected in IL-7Rα449F mice, we monitored STAT5 activation in BM B cell progenitors. As with our previously reported analysis of T cells, STAT5 activity in B cells required phosphorylation of IL-7Rα Y449 (Fig. 3.7.d). We failed to detect IL-7-induced immediate, early activation of PI3 kinase by Akt phosphorylation in primary B cell progenitors (data not shown). This is consistent with data showing that PI3 kinase p110δ activity is not required for IL-7 induced lymphomagenesis in Tg IL-7; p110δD910A mice (Fig. 3.10). Together, these data show that the IL-7Rα449F mutation delays c-Myc induced tumor onset by interfering with pre-B cell viability and proliferation induced by c-Myc overexpression. 3.2.6  c-Myc tumors retain IL-7 responsiveness but become IL-7-independent To determine if the IL-7Rα449F mutation affected the course of lymphomagenesis, we  performed histopathological and flow cytometric analyses of B cell stages on tumors taken from end stage mice. Eµ-myc; IL-7Rα+/+ tumors had a Burkitt-like lymphoma with morphology similar to that seen in human disease with prominent apoptotic cell death and a high frequency of mitotic cells (Fig. 3.11.a). This typical “starry-sky” pattern was also seen in affected lymphoid organs of Eµ-myc; IL-7Rα+/449F and Eµ-myc; IL-7Rα449F animals in the majority of cases (data not shown and Figure 3.11.a). In agreement with previous findings (12), Eµ-myc; IL-7Rα+/+ tumors were composed of either pre-B or mature B cells, and this was also the case for the majority of the Eµ-myc; IL-7Rα449F tumors (Table 3.2). In addition, IL-7Rα449F mutation did not affect the characteristic hyperproliferation induced by c-Myc in these end stage tumors (data not shown). To determine whether Eµ-myc tumors retain IL-7Rα Y449-dependency posttransformation, cells harvested from Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F tumors were transplanted to WT mice and hosts monitored for survival. In this analysis, comparing growth rates of two Eµ-myc; IL-7Rα+/+ and one Eµ-myc; IL-7Rα449F tumors, the Eµ-myc; IL-7Rα449F tumor had no impairment of tumor growth and was in fact more aggressive and caused rapid 79  morbidity (Fig. 3.11.b). This suggested that frank lymphomas can bypass the requirement for IL7Rα Y449 signals. To more generally determine whether IL-7 signaling plays a role in Eµ-myc tumor progression, Eµ-myc; IL-7Rα+/+ tumor cells were transplanted to congenic hosts and the mice were treated with either neutralizing anti-IL-7 antibody or an isotype control. The tumor chosen for analysis (Eµ-myc 1409), was IL-7Rα+ and demonstrated IL-7 responsiveness in vitro (Fig. 3.11.c). Despite effective IL-7- neutralization shown by host-derived BM progenitor B cell lymphopenia in anti-IL-7 treated mice (Fig. 3.11.d), tumors grew to similar size over the treatment period supporting an IL-7 independent growth phase at this stage. Together, these data suggest that although the IL-7Rα449F mutation inhibits IL-7 mediated B cell progenitor survival and Eµ-myc induced proliferation to delay transformation, it does not affect late-stage disease. 3.2.7  IL-7Rα 449F mice retain cell extrinsic susceptibility to tumors To determine whether IL-7Rα449F mice are protected from IL-7 and c-Myc mediated  lymphomagenesis as a result of cell extrinsic effects such as greater tumor surveillance and clearance of developing tumors, we transplanted established tumorigenic cell lines into WT and IL-7Rα449F mice and monitored survival of the host mice. Two aggressive syngeneic murine T cell lymphoma cell lines were tested (RMA and EL4), and in both cases WT and IL-7Rα449F mice were equally susceptible to transplanted tumor cells (Fig. 3.12.a and data not shown). To directly test whether Myc-induced lymphoma were differentially cleared, this experiment was performed with spontaneously arising Eµ-myc; IL-7Rα+/+ tumor cells transplanted intravenously (i.v.) into WT and IL-7Rα449F mice. As with the RMA cells, WT and IL-7Rα449F mice were equally susceptible to transplanted tumor cells (Fig. 3.12.b). This experiment was repeated with 3 different Eµ-myc-derived tumors and the results were comparable for each experiment. PCR analysis of recovered tumor cells confirmed that they were carrying the Eµ-myc transgene and thus derived from the transplanted cells, while analysis of tail biopsies confirmed that host mice were non-transgenic (Fig. 3.12.c). These data show the host milieu was not responsible for the protection in these mice and suggests that cell intrinsic IL-7Rα-dependent signals are essential for early lymphomagenesis.  80  3.3  Discussion IL-7 and its downstream signaling effectors PI3 kinase, STAT5, Bcl-2 and Mcl-1 have  been implicated in human leukemia and lymphoma. We undertook this study to determine how lymphomagenesis was affected when IL-7-mediated activation of such pathways was compromised. Perhaps unsurprisingly, IL-7Rα449F mutation completely abrogated tumor development in Tg IL-7 mice. More significantly, it also delayed tumor onset in Eµ-myc mice. In both lymphoma models, we saw dose-dependent protection mediated by IL-7Rα449F disruption, where substitution of one allele was sufficient to significantly delay disease progression. Although it is possible that IL-7Rα449F mice bear a differentiation impairment that contributes to tumor latency, acute ablation of this motif or signaling effectors recruited to it would be required to determine this. The protection conferred in two distinct lymphoma models and the fact that one mutated allele of this motif significantly affects tumor latency in the absence of developmental or cellularity deficiencies in both models (data not shown) make it more likely to be due to signaling changes. The Eµ-myc transgenic mouse model results in lymphoid transformation via hyperproliferation and secondary genetic lesions sustained during successive cell cycles (12, 25). Pro- and pre-B cells respond to co-operative pre-BCR and IL-7Rα signaling for optimal proliferation during heavy chain rearrangement (27, 30) and manipulation of these pathways can affect c-Myc induced tumor development. For example, RAG is required for pre-BCR surface expression that induces maturation of pro- to pre-B cells and c-Myc mediated cellular proliferation (31). However, transgenic expression of c-Myc in rag2-/- mice bypasses the requirement for pre-BCR signaling and gives rise to cells with a pre-B cell phenotype (32). These data explain the fact that rag1-/- mice, which normally have a developmental block at the pro-B cell stage and therefore have dramatically decreased numbers of Eµ-myc lymphoma precursors, not only developed Eµ-myc induced pre-B cell lymphomas but showed earlier tumor onset (33). Similarly, loss of the BCR signaling effector phospholipaseCγ2 shortens the lifespan of Eµ-myc mice due to an increase of BM pre-B cells that are hypersensitive to IL-7-induced proliferation (34). These studies show that c-Myc overexpression is sufficient to overcome a preBCR mediated developmental abnormality and that c-Myc and IL-7 co-operation can enhance oncogenic potential. Here, we have shown that IL-7Rα Y449 is essential for synergistic IL7Rα/pre-BCR signaling since the IL-7Rα449F mutation reduces pre-B cell viability and inhibits cMyc induced proliferation, which together significantly delays tumorigenesis in a lymphocyte 81  intrinsic manner. A large body of work has addressed the molecular requirements of c-Myc induced lymphomas and other than the p19ARF/Mdm2/p53 axis, few molecules have been shown to be essential to this process (35). For example, NF-κB, the tumor suppressor Ink4c, the death protein Apaf1/caspase9, as well as the DNA modifying enzymes AID and Rag have all been shown to be dispensable for c-Myc driven tumorigenesis (33, 36-39). However, our data shows that signals through IL-7Rα Y449, such as STAT5, can regulate transformation in this lymphoma model. The IL-7 transgene has profound effects on lymphocyte development causing CD8 T cell expansion and abnormal appearance of peripheral DP T cells and thymic B cells (13, 21). While the IL-7Rα449F mutation prevented these developmental abnormalities, Tg IL-7; IL-7Rα449F mice had significantly elevated thymic cellularity. Other cytoplasmic tyrosine residues of IL-7Rα or the JAK kinases may be involved in restoring survival and proliferation signals to T cell progenitors. Molecular changes in response to chronic IL-7 exposure in Tg IL-7 mice leads to tumor development, most commonly T lineage cells with a CD8+ or CD4+CD8+ phenotype. Tg IL-7 mediated lymphomas appear to arise from long-lived cells that up-regulate anti-apoptotic Bcl-2 family members and become resistant to apoptosis. In contrast, elevated Bcl-2 in IL-7Rα449F B cells failed to confer increased cellular viability in IL-7Rα449F BM progenitors. This is reminiscent of IL-7Rα449F memory T cells that are not maintained despite similar levels of Bcl-2 expression (19) and suggests that Bcl-2 is not sufficient to ensure survival in all cell types. Although Bcl-2 up-regulation is seen in over half of c-Myc-induced tumors (29), loss of Bcl-2 does not significantly impact the lifespan of Eµ-myc mice (40). Whether specific disruption of Bcl-2 (or Bcl-xL) in Tg IL-7 mice would similarly result in tumors that acquire anti-apoptotic capability via other molecular means remains to be addressed. We have previously demonstrated in thymocytes and T cells that IL-7Rα Y449 is dispensable for up-regulation of Bcl-2 following acute IL-7 stimulation although baseline Bcl-2 expression is lower in IL-7Rα449F cells (19). Our current findings support a model where IL-7Rα Y449 signaling plays an important role in regulation of anti-apoptotic effectors in vivo under conditions of chronic IL-7 exposure since substitution of IL-7Rα Y449 prevents the gross overexpression of Bcl-2 and Bcl-xL seen in Tg IL-7; IL-7Rα+/+ thymocytes, T cells and tumors. Thus, chronic, but not acute, IL-7 exposure in primary T cells may require long-term stimulation of IL-7Rα Y449-dependent signals. This may involve PI3 kinase activation (18, 41) through 82  subunits other than p110δ or other effectors to achieve Bcl-2 up-regulation. STAT5 activation plays a pivotal role in IL-7 mediated B cell development (42). We have previously shown that STAT5 haploinsufficiency protects from Tg IL-7 tumors (20), and show here that activation of this important factor is abrogated by the IL-7Rα449F mutation in progenitor B cells. Together, these findings indicate that STAT5, an essential mediator of lymphoid development, plays an essential role in lymphoid transformation. It remains to be addressed whether Eµ-myc tumorigenesis requires STAT5 activation directly or if IL-7Rαmediated signals other than STAT5, such as sustained stimulation of the PI3 kinase/Akt pathway through p27kip1 or other metabolic effectors regulating glucose metabolism contribute to tumor formation. Overall, our genetic analyses show that interference with IL-7Rα Y449 signaling has profound effects on transformation of T and B lymphocyte lineages. Through analysis of IL7Rα449F mice in the context of oncogene overexpression, we have shown that IL-7Rα Y449 mutation negates IL-7’s ability to transform CD8 T cells by preventing the skewed expression of Bcl-2 family members. Surprisingly, this mutation has a significant effect on the emergence of cMyc induced tumors by decreasing B cell viability independent of Bcl-2 and interfering with Myc-induced proliferation. Thus, disruption of IL-7Rα signaling has dramatic effects on disease outcome.  83  3.4  Materials and methods  Mice IL-7Rα449F mice were generated by homologous recombination (19). Briefly, wild type exons were replaced with the Y449F mutated version, resulting in mutant receptor expression under endogenous promoter control. Tg IL-7 mice (IL-7 overexpressed in B and T cells by a modified IgH chain enhancer and promoter) (13, 20) were backcrossed over 20 generations with C57BL/6 mice (The Jackson Laboratory). Eµ-myc mice (c-Myc oncoprotein overexpressed specifically in B cells under control of the c-Myc promoter paired with the Eµ IgH chain enhancer) (12) were on the C57BL/6 background. Each transgenic line was bred with IL-7Rα449F mice (backcrossed to C57BL/6 over 10 generations) to generate Tg IL-7; IL-7Rα+/449F, Tg IL-7; IL-7Rα449F, Eµmyc; IL-7Rα+/449F and Eµ-myc; IL-7Rα449F animals. Mice were monitored daily and sacrificed at the earliest signs of morbidity. All animals were housed at the University of British Columbia (UBC) and experiments performed in compliance with UBC Animal Care Committee certificates. Antibodies Purified, biotinylated and directly conjugated antibodies were obtained from BD Biosciences (anti-B220, CD3, CD4, CD8, CD19, CD24, CD43, IgM, Bcl-2, Ki67), eBioscience (anti-IL7Rα) or Southern Biotech (anti-Bcl-xL). Anti-Bim was purified from supernatants of Ham151 cells (Oliver et al., 2004) and conjugated to Alexa647 (Invitrogen). Unlabeled antibodies were obtained from Southern Biotech (anti-Bcl-xL), Cell Signaling Technology (anti-c-myc) or Abcam (anti-Mcl-1). Fluorescent secondary antibodies used in the Odyssey Infrared Imaging System (LiCOR) were obtained from Rockland Immunochemicals or Invitrogen. Flow cytometry Bone marrow progenitor B cells were characterized based on expression of surface markers B220, CD43, CD24 and IgM (43): B220+CD43+IgM-CD24– (pre-pro-B), B220+CD43+IgMCD24+ (pro-B), B220midCD43-IgM- (pre-B), and B220hiCD43-IgM+ (mature B). For analysis of Ki67, cells were stained for IgM and B220, fixed for 10 min in 1% paraformaldehyde at room temperature, permeabilized in 100% ice-cold methanol and stained for intracellular Ki67. Bcl-2 and Bim expression was measured as previously described (19). For Bcl-xL and Mcl-1 detection, cells were stained with antibodies to surface markers, treated with eBioscience Fixation & Permeabilization buffers and antibodies against Bcl-xL or Mcl-1. Mcl-1 was visualized with 84  donkey anti-rabbit IgG (H+L) PE from Jackson ImmunoResearch. MFI (mean fluorescence intensity) was calculated by subtracting the MFI value of the relevant isotype control from the raw MFI value for each sample. For STAT5 analysis, BM was isolated, depleted of Lineage positive cells using biotinylated antibodies against Gr-1, NK1.1, CD3, CD8, Ter119 and IgM and immunomagnetic negative selection (StemCell Technologies) (similar to protocol published by (44). The recovered cells were labeled with streptavidin-FITC, rested for 30 minutes at 37oC, then stimulated with 25 ng/ml IL-7 and processed as previously described (19) with concomitant anti-pSTAT5 and anti-B220 labeling. Samples were collected on an LSRII (BD Biosciences), and data analyzed with FlowJo software (Tree Star). Apoptosis induction Splenic lymphocytes were plated in IMDM supplemented with 10% FBS at a density of 105 cells/ml and treated with 10-7 M dexamethasone (Sigma-Aldrich). Alternatively, splenocytes were cytokine stripped (19) and plated in IMDM + 0.5% BSA with or without hydrogen peroxide for the indicated amounts of time. Cells were labeled with antibodies to CD3, CD4, CD8 and B220 and stained for AnnexinV (eBioscience) and propidium idodide (PI) or 7AAD according to manufacturer’s instructions and analyzed by flow cytometry. Western blotting Samples were lysed in modified RIPA lysis buffer (30 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% Igepal, 0.5% sodium deoxycholate, 0.1% SDS) and processed as previously described (19). Quantification is based on integrated pixel intensity from the LiCor Odyssey imager where loading was normalized to total Coomassie stain of the SDS-PAGE gel (23, 45). Quantitative RT-PCR Quantitative PCR of IL-7 transcript levels was performed as previously described (20) using a BioRad CFX96 Real-Time PCR system. Histopathology Samples were formalin fixed (HistoPrep, Fisher Scientific) for at least 24 hours then processed, sectioned (3 µm) and Hematoxylin & Eosin (H & E) stained. Slides were photographed using a Moticam 2000 digital camera mounted on a Motic AE31 microscope and processed using Motic 2.0 software. Tumor cell in vivo transfer Murine RMA (a Rauscher virus induced T-cell lymphoma line from C57BL/6 (46), kindly 85  provided by Dr. Hung-Sia Teh, UBC) and EL4 (C57BL/6 chemically induced lymphoma, ATCC) cells were grown in RPMI supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate and 50 µM β-mercaptoethanol. Cells were washed in PBS and 105 RMA cells or PBS were injected sub-cutaneously into the right flank of mice. Alternatively, single cell preparations harvested from lymphoid tumors from Eµ-myc; IL-7Rα+/+, Eµ-myc; IL-7Rα449F or WT spleens were washed twice in PBS, and indicated numbers of cells transferred intravenously to WT or IL-7Rα449F mice. For IL-7 blocking studies, 0.5 mg anti-IL7 or isotype control antibody (BioXCell) was delivered intraperitoneally to mice every 2 days, starting the day after tumor transfer for a total of 10 days. Recipient mice were monitored for tumor development and sacrificed when tumor burden exceeded 2 cm in diameter. Statistical analysis All data except survival curves are presented as mean + SD and analyzed by Student’s t test, oneway, repeated measures ANOVA followed by Tukey’s post test or two-way ANOVA and Bonferroni’s post-test, as appropriate. Survival data was analyzed using the logrank test. Significance was set at P≤0.05.  86  Figure 3.1 IL-7Rα Y449 signaling is essential for Tg IL-7 mediated lymphomagenesis, splenomegaly and CD8 T cell expansion (a) Expression of one mutant copy of IL-7Rα significantly delays IL-7 mediated tumor induced mortality and targeted mutation of both copies prevents tumor induced mortality. *, P<0.05 (b) Thymus and spleen T cell differentiation profiles of an 8-week old pre-disease cohort of WT, IL7Rα449F, Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F animals. Average cellularity of lymphoid organs is shown in brackets above thymus and spleen CD4/CD8 plots. Average frequencies of gated populations are shown. Top panel: thymus CD4/CD8 flow cytometry plots gated on CD19cells. Middle panel: Thymic frequencies of CD19+ cells, gated on total live lymphocyte population. Bottom panel: Spleen CD4/ CD8 flow cytometry plots are gated on CD19lymphocytes. (c) Quantification of total thymocyte (top panel) and splenocyte (bottom panel) subsets. All data are representative of 2 independent experiments, n=3 of each genotype per experiment. *, P<0.05.  87  Figure 3.1  88  Figure 3.2  Figure 3.2 IL-7Rα Y449 is required for Tg IL-7 mediated lymphomagenesis (a) H & E staining of spleens from age-matched WT (i), Tg IL-7; IL-7Rα+/+ (ii), IL-7Rα449F (iii), and Tg IL-7; IL-7Rα449F (iv) mice. Representative samples are shown: WT (n=4), Tg IL-7; IL7Rα+/+ (n=6), IL-7Rα449F (n=4), Tg IL-7; IL-7Rα449F (n=6). Original magnification x10. WP (white pulp), RP (red pulp). (b) Quantitative RT-PCR of absolute levels of cDNA generated from Tg IL-7; IL-7Rα+/+ (n = 3) and Tg IL-7; IL-7Rα449F (n = 5) thymi shows that there is no significant difference in the expression of the IL-7 transgene between the two strains (P=0.66).  89  Figure 3.3 Increased Bcl-2 and Bcl-xL expression in T lymphocytes as a result of chronic IL-7 exposure is IL-7Rα Y449-dependent (a) Intracellular flow cytometry histograms showing expression of anti-apoptotic proteins Bcl-2 in DP (top panels) and CD8 SP (bottom panels) thymocytes of age-matched WT, IL-7Rα449F, Tg IL-7; IL-7Rα+/+ (pre-disease) and Tg IL-7; IL-7Rα449F splenic CD8 SP T cells. Data is representative of 4 independent experiments, n=3 for each genotype per experiment. Grey histogram, isotype control; blue histogram, anti-Bcl-2 fluorescence. Average MFI values are indicated in the top corners, dashed vertical line represents the MFI for WT samples as a reference point. (b) Quantification of intracellular levels of Bcl-2, Bcl-xL, Mcl-1 and Bim in splenic CD8 SP T cells of WT, IL-7Rα449F, pre-disease Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL7Rα449F counterparts, n=3 or 4 for each genotype. MFI of the isotype control was subtracted from the MFI of each sample to correct for non-specific antibody binding. *, P<0.05, represents that Tg IL-7; IL-7Rα+/+ samples are statistically different from all other genotypes. NS represents that Tg IL-7; IL-7Rα+/+ samples are not statistically different from other genotypes. (c) Expression of Bcl-xL and Mcl-1 in Tg IL-7; IL-7Rα+/+ thymomas and control thymi. Equal amounts of whole thymus lysate from healthy controls and Tg IL-7; IL-7Rα+/+ thymomas were subjected to SDS-PAGE and immunoblots probed for expression of Bcl-xL and Mcl-1 using the Odyssey infra red imager (LiCor). Representative results are shown; numbers below the blots indicate quantification of Bcl-xL and Mcl-1 band intensity (in pixels/mm2, normalized to total protein loaded) from 3 mice of each genotype. The protein gel was Coomassie stained and intensity (in pixels/mm2) of total protein in each lane was quantified as loading control. (d) Splenic lymphocytes of age-matched, pre-disease WT, IL-7Rα449F, Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F mice were cytokine stripped and plated in IMDM + 0.5% BSA for 24 hours with the indicated concentrations of hydrogen peroxide or vehicle control (IMDM). Viable (AnnexinV-7AAD-) CD8 SP T cells were quantified after treatment. Comparison of untreated samples (black bars) allows comparison of cell viability after cytokine withdrawal, *, P<0.05. Data is representative of 2 independent experiments with 2-3 mice of each genotype.  90  Figure 3.3  91  Figure 3.4 Lymphoma protected IL-7Rα 449F mice show abrogated cell survival signals (a) Intracellular flow cytometry histograms showing expression of anti-apoptotic proteins Bcl-2 (top panels) and Bcl-xL (bottom panels) of age-matched WT, IL-7Rα449F, Tg IL-7; IL-7Rα+/+ (pre-disease) and Tg IL-7; IL-7Rα449F splenic CD8 SP T cells. Data is representative of 4 independent experiments (Bcl-2) or 1 experiment (Bcl-xL), n=3 for each genotype per experiment. Filled grey histogram, isotype control; open histogram, anti-Bcl-2 or anti-Bcl-xL fluorescence. Average mean fluorescence intensity (MFI) values are indicated in the top corners, dashed vertical line represents the MFI for WT samples as a reference point. (b) Bcl-2 expression in subsets of Tg IL-7; IL-7Rα+/+ thymomas. Intracellular flow cytometry plots of Bcl-2 expression in age-matched Tg IL-7; IL-7Rα+/+ (healthy versus DP/CD8+ mixed phenotype thymoma) and healthy Tg IL-7; IL-7Rα449F thymus samples. Data shown is representative of 6 Tg IL-7; IL-7Rα+/+ thymoma and age-matched controls. (c) Splenic lymphocytes of agematched, pre-disease WT, IL-7Rα449F, Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F mice were treated for the indicated time points with dexamethasone or vehicle control. Viable (AnnexinVPI-) CD8 SP T cells were quantified after treatment. Data is representative of 3 independent experiments measuring triplicate samples of each genotype. (d) Cellular proliferation of thymocytes as measured by intracellular detection of the nuclear antigen Ki67. Data is representative of 2 independent experiments, n=3 for each genotype per experiment. (b, d) DN, DP, CD4 SP and CD8 SP subsets are gated on B220- cells. *, P<0.05  92  Figure 3.4  93  Figure 3.5  Figure 3.5 Mutation of IL-7Rα Y449 significantly delays Eµ-myc mediated oncogenesis (a) The IL-7Rα449F mutation significantly delays the onset of Eµ-myc induced tumors in mice bearing one or two copies of the mutated receptor. *, P<0.05 (b) c-Myc expression in tumor samples of Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F mice and non-Tg littermates. Numbers above immunoblot denote individual samples of each genotype. Numbers below the blot indicate quantification of c-Myc band intensity (in pixels/mm2, normalized to total protein loaded (P=0.07), see Fig. 3.6 for protein loading). (c) Quantification of B cell progenitor subsets in BM of 6 week old WT, IL-7Rα449F, Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F mice (Total cell numbers in 2 femurs/mouse).  94  Figure 3.6  Figure 3.6 Quantification of total protein in Myc-induced tumor lysates Coomassie stained protein gel was used to normalize for protein loading of samples in Fig. 3.5.b. Intensity (in pixels/mm2) of total protein in each lane was quantified as loading control.  95  Figure 3.7  Figure 3.7 IL-7Rα Y449 is required for viability and proliferation of B cell subsets (a) Intracellular Ki67 staining of BM and splenic Immature (B220+IgM-) and Mature (B220+ IgM+) B cells. (b) Intracellular Bcl-2 staining of BM Immature (B220+CD43+) and Mature (B220+CD43-) B cells. (c) Quantification of viable (AnnexinV- 7AAD-) BM progenitor B cells of 6 week old WT, IL-7Rα449F, Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F mice. (a-c) Data are representative of at least 2 separate experiments, n=3 for each genotype per experiment. *, P<0.05 (d) Lineage- progenitor B cells were isolated from bone marrow of 6 week old WT, IL7Rα449F, Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F mice. Following IL-7 stimulation (25 ng/ml) for the indicated times, phosphorylation of STAT5 was assayed by intracellular flow cytometry. For cytometry plots, see Fig. 3.9. Data is representative of 2-3 mice in 2 independent experiments.  96  Figure 3.8  Figure 3.8 Mature B cells from WT and IL-7Rα 449F mice lack surface expression of IL-7Rα Splenic B220+ CD43- B cells of age-matched WT and IL-7Rα449F mice were analyzed for expression of IL-7Rα. Filled histogram, isotype control. Black trace, anti-IL-7Rα fluorescence.  97  Figure 3.9  Figure 3.9 IL-7Rα Y449 is essential for IL-7 mediated activation of STAT5 in bone marrow progenitor B cells Cytometry plots of representative data showing phosphorylation of STAT5 in Lineage- B220+ BM B cells in response to IL-7 in mice bearing a WT copy of the IL-7Rα, but not in IL-7Rα449F or Eµ-myc; IL-7Rα449F mice.  98  Figure 3.10  Figure 3.10 PI3 kinase p110δ activity is non-essential for Tg IL-7 mediated lymphomagenesis PI3 kinase p110δD910A mice, which express a catalytically inactive version of the p110δ subunit, were crossed to Tg IL-7 mice to generate Tg IL-7; p110δ+/+, Tg IL-7; p110δ+/D910A, Tg IL-7; p110δD910A animals. Survival analysis of these mice showed that tumor progression and morbidity were unaffected by loss of signals initiated by PI3 kinase p110δ.  99  Figure 3.11  Figure 3.11 c-Myc tumors retain IL-7 responsiveness but become IL-7-independent (a) H & E stained lymphoid tissue from Eµ-myc; IL-7Rα+/+ and Eµ-myc; IL-7Rα449F tumors. Representative samples are shown: Eµ-myc; IL-7Rα+/+, n=10, Eµ-myc; IL-7Rα449F, n=4. Original magnification x10 (i, ii) and x40 (iii, iv). (b) 106 live cells from established primary tumors harvested from Eµ-myc; IL-7Rα+/+ (mouse ID’s Eµ-myc 1408 and Eµ-myc 1409) and Eµmyc; IL-7Rα449F (ID Eµ-myc; IL-7Rα449F 1201) were transplanted i.v. into WT hosts and tumor development monitored over time. (c) Cells from established Eµ-myc; IL-7Rα+/+ tumors were tested for IL-7 responsiveness in vitro. Cells were treated with or without 10 ng/ml IL-7 for 24 hours, with 10 µM BrdU added for the last hour of incubation and then analyzed for BrdU incorporation by flow cytometry. (d) 5x106 live cells from the IL-7 responsive Eµ-myc; IL7Rα+/+ tumor (Eµ-myc 1409) were transplanted i.v. into congenic CD45.1+ hosts. The next day, and every 2nd day thereafter for a total of 5 treatments, mice received 500 µg of either neutralizing anti-IL-7 or an isotype matched control antibody. At the end of 10 days, BM and spleens were harvested. CD45.1+ host BM progenitor B cells were quantified (left panel) to show blockade of IL-7 function. CD45.2+ donor tumor cells were quantified in the spleens of recipient mice (right panel). 100  Figure 3.12  Figure 3.12 IL-7Rα 449F mice retain cell extrinsic susceptibility to tumors (a) RMA tumor cells or PBS were transplanted sub-cutaneously into IL-7Rα+/+ and IL-7Rα449F animals and tumor development monitored over time. Results of two experiments are pooled, P=0.24. (b) Cells were harvested from lymphoid tissue tumors of Eµ-myc; IL-7Rα+/+ mice and 107 live cells transplanted i.v. into IL-7Rα+/+ and IL-7Rα449F animals and tumor development monitored over time. Representative data from one of three tumor transplant experiments are shown, P=0.66. (c) PCR analysis on tumors and tail biopsies from Eµ-myc transplanted mice for detection of transgenic c-Myc. c-Myc transgene, 500 bp; GAPDH, 300 bp.  101  Table 3.1 Phenotypes of Tg IL-7; IL-7Rα +/+ tumors. Thymomas and peripheral lymphoid tumors were phenotyped by flow cytometry using antibodies against CD3, CD4, CD8 and B220 or CD19. Tumors were designated to be of a certain phenotype when the population was greater than 60% of the total lymphocyte population. Genotype  Mouse  Tumor phenotype  Cell type  ID Tg IL-7; +/+  IL-7Rα  3141  CD4+ CD8+  DP  Affected  Rate of  Organ  occurrence  pLNs  3/7 (43%)  3168  Thymus  3170  pLNs  2796  CD8+  CD8 SP  3138 2828  Thymus  2/7 (29%)  Spleen CD8+ and B220+  Mixed CD8 Thymus  1/7 (14%)  SP and B 2797  B220+  B cell  Axial LN  1/7 (14%)  102  Table 3.2 Phenotypes of Eµ-myc; IL-7Rα +/+ and Eµ-myc; IL-7Rα 449F tumors. Lymphoma samples from Eµ-myc; IL-7Rα+/+ and Eµ- myc; IL-7Rα449F animals were phenotyped by flow cytometry using a combination of B220 or CD19, CD43, IgM and CD24. Tumors were designated to be of a certain phenotype when the population was greater than 60% of the total lymphocyte population. Genotype  Mouse Tumor phenotype  Cell type  ID Eµ-myc;  521  IL-7Rα+/+  Rate of occurrence  B220+CD43+CD24+  Mixed  and  Pro/Pre  1/8 (12%)  B220+CD43-CD24+ B220+CD43-CD24+  Pre  2/8 (25%)  B220+CD43-IgM+  Mature  5/8 (63%)  634  B220+CD43+CD24+  Pro  1/6 (17%)  633  B220+CD43-CD24+  Pre  2/6 (33%)  B220+CD43-IgM+  Mature  2/6 (33%)  CD4+CD19mid  Aberrant  1/6 (17%)  620 930 506 507 829 968 972 Eµ-myc; IL-7Rα449F 1201 620 1202 678  103  3.5  References  1.  Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics. 2008.  2.  Barata, J.T., A.A. Cardoso, L.M. Nadler and V.A. Boussiotis. 2001. Interleukin-7 promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia cells by downregulating the cyclin-dependent kinase inhibitor p27(kip1). Blood. 98:1524-1531.  3.  Barata, J.T., A. Silva, J.G. Brandao, L.M. Nadler, A.A. Cardoso and V.A. Boussiotis. 2004. Activation of PI3K is indispensable for interleukin 7-mediated viability, proliferation, glucose use, and growth of T cell acute lymphoblastic leukemia cells. J.Exp.Med. 200:659669.  4.  Cattaruzza, L., A. Gloghini, K. Olivo, R. Di Francia, D. Lorenzon, R. De Filippi, A. Carbone, A. Colombatti, A. Pinto and D. Aldinucci. 2009. Functional coexpression of Interleukin (IL)-7 and its receptor (IL-7R) on Hodgkin and Reed-Sternberg cells: Involvement of IL-7 in tumor cell growth and microenvironmental interactions of Hodgkin's lymphoma. Int.J.Cancer. 125:1092-1101.  5.  Foss, H.D., M. Hummel, S. Gottstein, K. Ziemann, B. Falini, H. Herbst and H. Stein. 1995. Frequent expression of IL-7 gene transcripts in tumor cells of classical Hodgkin's disease. Am.J.Pathol. 146:33-39.  6.  Juarez, J., R. Baraz, S. Gaundar, K. Bradstock and L. Bendall. 2007. Interaction of interleukin-7 and interleukin-3 with the CXCL12-induced proliferation of B-cell progenitor acute lymphoblastic leukemia. Haematologica. 92:450-459.  7.  Long, B.W., P.L. Witte, G.N. Abraham, S.A. Gregory and J.M. Plate. 1995. Apoptosis and interleukin 7 gene expression in chronic B-lymphocytic leukemia cells. Proc.Natl.Acad.Sci.U.S.A. 92:1416-1420.  8.  Scupoli, M.T., O. Perbellini, M. Krampera, F. Vinante, F. Cioffi and G. Pizzolo. 2007. Interleukin 7 requirement for survival of T-cell acute lymphoblastic leukemia and human thymocytes on bone marrow stroma. Haematologica. 92:264-266.  9.  Sasson, S.C., S. Smith, N. Seddiki, J.J. Zaunders, A. Bryant, K.K. Koelsch, C. Weatherall, M.L. Munier, C. McGinley, J. Yeung, S.P. Mulligan, J. Moore, D.A. Cooper, S. Milliken and A.D. Kelleher. 2010. IL-7 receptor is expressed on adult pre-B-cell acute lymphoblastic leukemia and other B-cell derived neoplasms and correlates with expression of proliferation and survival markers. Cytokine. 50:58-68.  10. Touw, I., K. Pouwels, T. van Agthoven, R. van Gurp, L. Budel, H. Hoogerbrugge, R. Delwel, R. Goodwin, A. Namen and B. Lowenberg. 1990. Interleukin-7 is a growth factor of precursor B and T acute lymphoblastic leukemia. Blood. 75:2097-2101. 11. Habib, T., H. Park, M. Tsang, I.M. de Alboran, A. Nicks, L. Wilson, P.S. Knoepfler, S. Andrews, D.J. Rawlings, R.N. Eisenman and B.M. Iritani. 2007. Myc stimulates B lymphocyte differentiation and amplifies calcium signaling. J.Cell Biol. 179:717-731. 12. Adams, J.M., A.W. Harris, C.A. Pinkert, L.M. Corcoran, W.S. Alexander, S. Cory, R.D. Palmiter and R.L. Brinster. 1985. The c-myc oncogene driven by immunoglobulin enhancers induces lymphoid malignancy in transgenic mice. Nature. 318:533-538. 13. Rich, B.E., T.J. Campos, R.I. Tepper, R.W. Moreadith and P. Leder. 1993. Cutaneous 104  lymphoproliferation and lymphomas in interleukin 7 transgenic mice. J.Exp.Med. 177:305316. 14. Kovanen, P.E. and W.J. Leonard. 2004. Cytokines and immunodeficiency diseases: critical roles of the gamma(c)-dependent cytokines interleukins 2, 4, 7, 9, 15, and 21, and their signaling pathways. Immunol.Rev. 202:67-83. 15. von Freeden-Jeffry, U., P. Vieira, L.A. Lucian, T. McNeil, S.E. Burdach and R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J.Exp.Med. 181:1519-1526. 16. Peschon, J.J., P.J. Morrissey, K.H. Grabstein, F.J. Ramsdell, E. Maraskovsky, B.C. Gliniak, L.S. Park, S.F. Ziegler, D.E. Williams, C.B. Ware, J.D. Meyer and B.L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J.Exp.Med. 180:1955-1960. 17. Pallard, C., A.P. Stegmann, T. van Kleffens, F. Smart, A. Venkitaraman and H. Spits. 1999. Distinct roles of the phosphatidylinositol 3-kinase and STAT5 pathways in IL-7-mediated development of human thymocyte precursors. Immunity. 10:525-535. 18. Wofford, J.A., H.L. Wieman, S.R. Jacobs, Y. Zhao and J.C. Rathmell. 2008. IL-7 promotes Glut1 trafficking and glucose uptake via STAT5-mediated activation of Akt to support Tcell survival. Blood. 111:2101-2111. 19. Osborne, L.C., S. Dhanji, J.W. Snow, J.J. Priatel, M.C. Ma, M.J. Miners, H.S. Teh, M.A. Goldsmith and N. Abraham. 2007. Impaired CD8 T cell memory and CD4 T cell primary responses in IL-7R alpha mutant mice. J.Exp.Med. 204:619-631. 20. Abraham, N., M.C. Ma, J.W. Snow, M.J. Miners, B.G. Herndier and M.A. Goldsmith. 2005. Haploinsufficiency identifies STAT5 as a modifier of IL-7-induced lymphomas. Oncogene. 24:5252-5257. 21. El Kassar, N., P.J. Lucas, D.B. Klug, M. Zamisch, M. Merchant, C.V. Bare, B. Choudhury, S.O. Sharrow, E. Richie, C.L. Mackall and R.E. Gress. 2004. A dose effect of IL-7 on thymocyte development. Blood. 104:1419-1427. 22. Hockenbery, D.M., Z.N. Oltvai, X.M. Yin, C.L. Milliman and S.J. Korsmeyer. 1993. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell. 75:241-251. 23. Duthie, K.A., L.C. Osborne, L.J. Foster and N. Abraham. 2007. Proteomic analysis of IL-7 induced signaling effectors show selective changes in IL-7Ralpha 449F knock-in T cell progenitors. Mol Cell Proteomics. 6:1700-1710. 24. Langdon, W.Y., A.W. Harris, S. Cory and J.M. Adams. 1986. The c-myc oncogene perturbs B lymphocyte development in E-mu-myc transgenic mice. Cell. 47:11-18. 25. Adams, J.M., A.W. Harris, A. Strasser, S. Ogilvy and S. Cory. 1999. Transgenic models of lymphoid neoplasia and development of a pan-hematopoietic vector. Oncogene. 18:52685277. 26. Wei, C., R. Zeff and I. Goldschneider. 2000. Murine pro-B cells require IL-7 and its receptor complex to up-regulate IL-7R alpha, terminal deoxynucleotidyltransferase, and c mu expression. J.Immunol. 164:1961-1970. 27. Marshall, A.J., H.E. Fleming, G.E. Wu and C.J. Paige. 1998. Modulation of the IL-7 doseresponse threshold during pro-B cell differentiation is dependent on pre-B cell receptor expression. J.Immunol. 161:6038-6045. 105  28. Eischen, C.M., G. Packham, J. Nip, B.E. Fee, S.W. Hiebert, G.P. Zambetti and J.L. Cleveland. 2001. Bcl-2 is an apoptotic target suppressed by both c-Myc and E2F-1. Oncogene. 20:6983-6993. 29. Eischen, C.M., D. Woo, M.F. Roussel and J.L. Cleveland. 2001. Apoptosis Triggered by Myc-Induced Suppression of Bcl-XL or Bcl-2 Is Bypassed during Lymphomagenesis. Mol.Cell.Biol. 21:5063-5070. 30. Fleming, H.E. and C.J. Paige. 2002. Cooperation between IL-7 and the pre-B cell receptor: a key to B cell selection. Semin.Immunol. 14:423-430. 31. Yasuda, T., H. Sanjo, G. Pages, Y. Kawano, H. Karasuyama, J. Pouyssegur, M. Ogata and T. Kurosaki. 2008. Erk kinases link pre-B cell receptor signaling to transcriptional events required for early B cell expansion. Immunity. 28:499-508. 32. Bachmann, M.F., P. Wolint, S. Walton, K. Schwarz and A. Oxenius. 2007. Differential role of IL-2R signaling for CD8+ T cell responses in acute and chronic viral infections. Eur.J.Immunol. 37:1502-1512. 33. Nepal, R.M., A. Zaheen, W. Basit, L. Li, S.A. Berger and A. Martin. 2008. AID and RAG1 do not contribute to lymphomagenesis in E mu c-myc transgenic mice. Oncogene. 27:47524756. 34. Wen, R., Y. Chen, L. Bai, G. Fu, J. Schuman, X. Dai, H. Zeng, C. Yang, R.P. Stephan, J.L. Cleveland and D. Wang. 2006. Essential role of phospholipase C gamma 2 in early B-cell development and Myc-mediated lymphomagenesis. Mol.Cell.Biol. 26:9364-9376. 35. Eischen, C.M., J.D. Weber, M.F. Roussel, C.J. Sherr and J.L. Cleveland. 1999. Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev. 13:2658-2669. 36. Scott, C.L., M. Schuler, V.S. Marsden, A. Egle, M. Pellegrini, D. Nesic, S. Gerondakis, S.L. Nutt, D.R. Green and A. Strasser. 2004. Apaf-1 and caspase-9 do not act as tumor suppressors in myc-induced lymphomagenesis or mouse embryo fibroblast transformation. J.Cell Biol. 164:89-96. 37. Nilsson, L.M., U.B. Keller, C. Yang, J.A. Nilsson, J.L. Cleveland and M.F. Roussel. 2007. Ink4c is dispensable for tumor suppression in Myc-induced B-cell lymphomagenesis. Oncogene. 26:2833-2839. 38. Kotani, A., N. Kakazu, T. Tsuruyama, I.M. Okazaki, M. Muramatsu, K. Kinoshita, H. Nagaoka, D. Yabe and T. Honjo. 2007. Activation-induced cytidine deaminase (AID) promotes B cell lymphomagenesis in Emu-cmyc transgenic mice. Proc.Natl.Acad.Sci.U.S.A. 104:1616-1620. 39. Keller, U., J.A. Nilsson, K.H. Maclean, J.B. Old and J.L. Cleveland. 2005. Nfkb 1 is dispensable for Myc-induced lymphomagenesis. Oncogene. 24:6231-6240. 40. Kelly, P.N., H. Puthalakath, J.M. Adams and A. Strasser. 2007. Endogenous bcl-2 is not required for the development of Emu-myc-induced B-cell lymphoma. Blood. 109:49074913. 41. Lali, F.V., J. Crawley, D.A. McCulloch and B.M. Foxwell. 2004. A late, prolonged activation of the phosphatidylinositol 3-kinase pathway is required for T cell proliferation. J.Immunol. 172:3527-3534. 42. Yao, Z., Y. Cui, W.T. Watford, J.H. Bream, K. Yamaoka, B.D. Hissong, D. Li, S.K. Durum, 106  Q. Jiang, A. Bhandoola, L. Hennighausen and J.J. O'Shea. 2006. Stat5a/b are essential for normal lymphoid development and differentiation. Proc.Natl.Acad.Sci.U.S.A. 103:10001005. 43. Hardy, R.R., C.E. Carmack, S.A. Shinton, J.D. Kemp and K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J.Exp.Med. 173:1213-1225. 44. Li, L.X., C.A. Goetz, C.D.S. Katerndahl, N. Sakaguchi and M.A. Farrar. 2010. A Flt3-and Ras-Dependent Pathway Primes B Cell Development by Inducing a State of IL-7 Responsiveness. J.Immunol. 184:1728-1736. 45. Aldridge, G.M., D.M. Podrebarac, W.T. Greenough and I.J. Weiler. 2008. The use of total protein stains as loading controls: an alternative to high-abundance single protein controls in semi-quantitative immunoblotting. J. Neurosci. Methods. 172:250-254. 46. Karre, K., H.G. Ljunggren, G. Piontek and R. Kiessling. 1986. Selective rejection of H-2deficient lymphoma variants suggests alternative immune defence strategy. Nature. 319:675-678.  107  4 Elevated IL-7 availability does not account for T cell proliferation in mild lymphopenia4  4  A version of this chapter has been submitted for publication. Osborne, LC and Abraham, N. 2010. Elevated IL-7 availability does not account for T cell proliferation in mild lymphopenia. 108  4.1  Introduction Numerous situations may induce lymphopenia in the course of a lifetime. Primary  immunodeficiencies, viral infection (such as in the case of HIV), radiation, chemotherapy, aging and thymectomy can all result in profound lymphopenia and leave patients susceptible to infection. In these situations, efficient T cell reconstitution is imperative to restore cell-mediated immunity. In adult patients, T cell reconstitution is especially difficult owing to age-related thymic involution and decreased thymic output (1). In these cases, treatment with cytokines such as interleukin (IL)-7 is being examined for its clinical application to enhance T cell reconstitution (2-4). There are a number of factors that must be considered prior to clinical application of in vivo T cell restoration protocols. Potential drawbacks include spurring unregulated cell growth leading to tumor development and triggering clonal expansion and activation of self-reactive T cells. Thus, information regarding safe, rapid T cell expansion that limits tumor and autoimmune potential while maintaining T cell function is necessary. In lymphoreplete conditions, the naïve T cell pool and TCR repertoire diversity are maintained by a combination of thymic output and low level peripheral T cell division, ensuring fitness for recognition of diverse antigenic stimuli (5, 6). Naïve T cell survival requires signaling from IL-7 and the TCR. Due to competition for limiting amounts of IL-7 and interaction with MHC presenting self-peptides, T cells receive low intensity signals and do not become overtly activated. In severely lymphopenic states, however, T cell competition for these factors is reduced and a program of T cell proliferation termed lymphopenia-induced proliferation (LIP) can be initiated to restore T cell numbers. The presence of IL-7 and the ability of T cells to interact with self-peptide presented on MHC by APCs are required for LIP (7-14). However, LIP results in conversion of naïve T cells (CD44lo) into memory phenotype (CD44hi) T cells (15, 16). Memory phenotype (MP) T cells are more easily activated than naïve T cells and no longer require co-stimulation for acquisition of effector function (8). Since LIP is mediated by interaction with self-peptides and results in accumulation of MP T cells with decreased activation requirements, it has been proposed that this could increase the risk of autoimmune disease development or narrowing of the TCR repertoire and decreased cell-mediated immunity (17, 18). It is essential to determine how to harness LIP for rapid T cell reconstitution while maintaining immune potential following lymphopenic episodes in patients (2). While the effects of severe lymphopenia are well studied, there are few reports analyzing the effect of mild lymphopenia on peripheral T cell expansion. This is of interest in situations 109  following long term therapeutic toxicity or HIV infection, where immunodeficiency is long lasting but incomplete. In order to examine the effect of chronic mild lymphopenia on T cell proliferation, we analyzed the proliferative capacity and characteristics of naïve polyclonal wild type (WT) T cells after transfer into IL-7Rα449F (mild, T cell counts ~25% of WT) and IL-7Rα-/(severe, T cell counts <5% of WT) lymphopenic hosts (19, 20). Our data demonstrated that mild lymphopenia supports proliferation of naïve T cells, but at a much slower rate than is observed in IL-7Rα-/- hosts. Importantly, this was not dependent on elevated levels of available IL-7, but instead correlated with increased access to APCs. Further, our data suggests that T cell repertoire diversity is maintained following proliferation. These data provide evidence that T cell reconstitution can occur in conditions of chronic mild lymphopenia without limiting TCR diversity.  110  4.2  Results  4.2.1  Chronic mild lymphopenia in IL-7Rα 449F mice supports LIP To determine whether the mild lymphopenia observed in IL-7Rα449F mice affected LIP of  transferred cells, we purified T cells from naïve CD45.1+ mice and transferred them i.v. to WT, IL-7Rα449F or IL-7Rα-/- CD45.2+ hosts. Following 1 week in vivo incubation, the total cell numbers and CFSE dilution profile of recovered CD45.1+ cells was determined. As expected, the severe lymphopenia of IL-7Rα-/- host mice supported extensive cell division and accumulated significantly more transferred cells than lymphoreplete WT hosts (Fig. 4.1.a, b). At this time point, the mild lymphopenia in IL-7Rα449F hosts appeared insufficient to provide enough of the required factors, either IL-7 availability or self-peptide/MHC interactions, to support LIP since CFSE was not diluted and transferred CD45.1+ cells did not accumulate (Fig. 4.1.a, b). However, when in vivo incubation was increased to 4 weeks, 38% of CD4 and 61% of CD8 T cells had undergone at least one division in IL-7Rα449F hosts while <10% of T cells from WT hosts had diluted CFSE (Fig. 4.1.c and Fig. 4.2). This level of proliferation was not as extensive as the division that occurred in IL-7Rα-/- hosts (all cells had undergone at least one division and >90% had completely diluted CFSE), but the mild lymphopenia supported T cell proliferation and CD8 accumulation in a way that WT hosts did not. These results were confirmed by quantification of the recovered CD45.1+ T cells (Fig. 4.1.d). A previous report analyzing transient T lymphopenia demonstrated that in order for transferred T cells to proliferate, at least 90% of host T cells had to be depleted and the slowly proliferating T cells maintained a CD44lo naïve phenotype (21). In contrast, in our model of chronic mild lymphopenia, proliferating CD45.1+ T cells readily acquired a CD44hi memory-like phenotype, similar to what was observed on cells recovered from IL-7Rα-/- hosts (Fig. 4.2). Thus, these data show that chronic mild lymphopenia can support LIP with a similar phenotypic outcome to IL-7Rα-/- hosts, but with constrained kinetics. 4.2.2  IL-7 availability is sufficient to induce T cell proliferation, but does not account for proliferation in IL-7Rα 449F hosts To address the hypothesis that increased IL-7 concentration is sufficient to drive T cell  proliferation, we tested the ability of IL-7 overexpressing T cells from CD45.2+ transgenic (Tg) IL-7 mice (22) to proliferate in a lymphoreplete (WT CD45.1+) host. Due to the competitive environment, T cell proliferation was slow, but after 2 weeks in vivo, Tg IL-7 T cells bearing the WT IL-7 receptor (Tg IL-7; IL-7Rα+/+) had significantly diluted CFSE (Fig. 4.3.a). These findings are consistent with previous data demonstrating that elevated IL-7 or treatment with 111  agonistic IL-7/α-IL-7 complexes are sufficient to drive T cell proliferation in the absence of lymphopenia (9, 23). In agreement with our previous report (19), T cell proliferation required IL7Rα Y449 mediated signals, as evidenced by failure of Tg IL-7; IL-7Rα449F T cells to dilute CFSE (Fig. 4.3.a). In addition, when Tg IL-7; IL-7Rα+/+ and Tg IL-7; IL-7Rα449F T cells were incubated in CD45.1+ WT hosts for 12 weeks, Tg IL-7; IL-7Rα449F T cells could not be detected while Tg IL-7; IL-7Rα+/+ T cells had diluted CFSE to near extinction (Fig. 4.3.b and data not shown), indicating that IL-7Rα Y449 is necessary not only for proliferation but also for T cell maintenance. Together, these data suggest that even in a lymphoreplete host where competition for APC interaction is strong, IL-7 signaling is sufficient to drive T cell proliferation. We then examined whether there was a measurable difference in the amount of bioavailable IL-7 in WT, IL-7Rα449F and IL-7Rα-/- mice. When naïve T cells are exposed to IL7, IL-7Rα is down-regulated (24). As a non-quantitative measure of IL-7 availability, we transferred naïve (CD44lo) CD45.1+ T cells into WT, IL-7Rα449F and IL-7Rα-/- mice i.v. and monitored surface CD127 expression 20 hours later. In agreement with previous findings (25), CD127 was significantly decreased on CD45.1+ T cells recovered from IL-7Rα-/- hosts, but maintained on those recovered from WT hosts. CD45.1+ T cells recovered from IL-7Rα449F hosts showed minimal decreases in CD127 expression, and it was retained at significantly higher levels than on T cells recovered from IL-7Rα-/- hosts (Fig. 4.4.a). This result was confirmed by quantitative analysis of splenic IL-7 concentration. Stromal support cells in secondary lymphoid organs constitutively express IL-7 at very low levels, making protein detection difficult. To measure splenic IL-7, we dispersed entire spleens in Collagenase IV to liberate IL-7 from cell surfaces or the extracellular matrix. To normalize for different spleen sizes caused by lymphopenia in IL-7Rα449F and IL-7Rα-/- mice, IL-7 concentration was expressed per mg wet spleen weight. This analysis showed that IL-7 availability was elevated in IL-7Rα-/- spleen tissue, but the amount of IL-7 detected was not statistically different between WT and IL-7Rα449F spleens (Fig. 4.4.b). Thus, in 2 separate assays, increased IL-7 availability could not be detected in IL-7Rα449F mice. Therefore, we conclude that, IL-7 availability does not appear to be a primary cause of the differences in CD45.1+ T cell proliferation between WT and IL-7Rα449F hosts. A potential caveat of our approach is that the IL-7Rα449F receptor may not undergo IL-7 induced down-regulation. Overnight in vitro stimulation of WT and IL-7Rα449F T cells demonstrated that the IL-7Rα449F T cells do not down-regulate the receptor as readily as WT 112  controls (Fig. 4.4.c). Thus, it is possible that increased amounts of bioavailable IL-7 were not detected in the spleens of IL-7Rα449F mice because IL-7Rα-expressing cells that bind IL-7 are acting as a cytokine sink. Failure to down-regulate the receptor may lead to disrupted cytokine regulation. A previous report has demonstrated that IL-7Rα expression on memory phenotype and regulatory T cells can limit peripheral T cell expansion (21). Both these cell types are present in IL-7Rα449F mice, and failure to down-regulate IL-7Rα surface expression could contribute to further IL-7 sequestration and inhibit proliferation of transferred T cells. 4.2.3  T cell proliferation in IL-7Rα 449F mice correlates with increased access to APCs and self-peptide/MHC interactions Since self-peptide/MHC interactions are a key requirement for LIP (12, 15), the TCR  repertoire of peripheral T cell pools of WT and IL-7Rα449F mice is an important factor. If IL7Rα449F hosts have a significant alteration in their TCR repertoire, this could lead to decreased competition for self-peptide recognition and an advantage for transferred WT CD45.1+ T cells in IL-7Rα449F hosts. Analysis of TCR repertoire by surface staining of TCR Vβ chains showed that there was minimal difference in TCR Vβ representation between WT and IL-7Rα449F T cells (Fig. 4.5.a). Thus, the IL-7Rα449F mutation does not significantly affect TCR selection. In the absence of TCR repertoire deficiencies, it is unlikely that transferred CD45.1+ T cells are proliferating in response to self-peptides that IL-7Rα449F T cells are incapable of recognizing. Since neither IL-7 availability nor TCR Vβ usage appeared altered in IL-7Rα449F mice, we evaluated whether APCs could be more accessible to transferred T cells. To address this question, we characterized and quantified splenic APCs based on surface expression of CD11b and CD11c in WT and IL-7Rα449F mice. These analyses showed no difference in the absolute number of APCs between WT and IL-7Rα449F mice (Fig. 4.5.b). However, there are far fewer host T cells in IL-7Rα449F mice and this decreased competition for APC interaction may influence CD45.1+ T cell proliferation. Comparing the ratio of the absolute numbers of T cells:APCs in WT and IL-7Rα449F hosts showed that there are significantly fewer T cells per APC in IL-7Rα449F hosts (Fig. 4.5.c). This increased availability of self-peptide/MHC interactions may be sufficient to drive the CD45.1+ T cell proliferation seen in IL-7Rα449F hosts. 4.2.4  Transferred polyclonal T cells retain TCR Vβ diversity Limiting dilution analysis of transferred T cells has demonstrated that LIP can result in  clonal expansion of transferred T cells that receive both self-peptide/MHC and IL-7 signaling, 113  and that this self-peptide mediated clonal expansion conferred susceptibility to autoimmune pathology in the host mice (26). However, detection of oligoclonal expansion required transfer of very low T cell numbers (<1000), much less than what is routinely transferred in these types of analyses. To test whether transfer of non-limiting T cell numbers are subject to the same TCR repertoire limitation, we transferred 1-2x106 purified T cells from naïve CD45.1+ mice and assayed proliferation and TCR Vβ usage of transferred T cells after 4 weeks in vivo incubation in WT, IL-7Rα449F and IL-7Rα-/- hosts. TCR Vβ usage of recovered cells was compared to the Vβ profile of cells prior to transfer and to T cells from CD45.1+ littermates that had not been transferred to control for differences in TCR repertoire mediated by aging. These comparisons demonstrated that the TCR repertoire diversity was maintained in transferred CD45.1+ T cells following LIP in both IL-7Rα449F and IL-7Rα-/- hosts (Fig. 4.6). Overall, this showed that TCR repertoire diversity is maintained following T cell transfer and proliferation induced by both mild and severe lymphopenia, suggesting that it does not pose a significant risk for autoimmune development.  114  4.3  Discussion We undertook this study to address the question of how T cells respond when they  encounter a mildly lymphopenic environment and found that mild lymphopenia limits the proliferative capacity of transferred polyclonal T cells compared to severe lymphopenia. Since LIP is regulated by IL-7 availability and TCR signaling mediated by interaction with APCs presenting self-peptide, we analyzed their ability to support T cell proliferation in IL-7Rα449F hosts. Interestingly, IL-7 availability was not elevated in IL-7Rα449F mice, but the reduced T cell numbers decreased competition with the transferred T cells for access to APCs and selfpeptide/MHC mediated TCR signals. This shows that the level of IL-7 available in WT mice is sufficient to support T cell proliferation, consistent with its role as an essential mediator of naïve T cell homeostasis. However, the significant increase in both the frequency and kinetics of T cell proliferation in IL-7Rα-/- hosts suggests that IL-7 availability must be increased above this threshold for efficient T reconstitution. Retention of TCR diversity is a desirable characteristic in T cell reconstitution following lymphopenia, as oligoclonal or monoclonal expansion is more likely to lead to autoimmune pathology mediated by self-peptide selected T cells. The data presented here suggests that the proliferation evoked by either mild or severe lymphopenia is unlikely to favor excessive selfreactivity. This is consistent with clinical studies showing that IL-7 treatment actually increased naïve T cell numbers with a diverse TCR repertoire (27, 28). Further, these results agree with conclusions from a previous study of partial lymphopenia (21). To model situations of transient partial lymphopenia, WT mice were rendered partially lymphopenic (~10% of host T cells remaining) via Ab-mediated T cell depletion (21). In this model, very little proliferation of transferred cells was detected and the cells retained a naïve phenotype, leading to the conclusion that transient partial lymphopenia did not predispose to autoimmune pathology. In our system of chronic mild lymphopenia (~25% of host T cells remaining), which may be more similar to aging populations or HIV-infected patients where thymic export or peripheral T cell health is compromised, T cells underwent significantly more proliferation and took on a CD44hi memory phenotype. This may be explained in part by the longer time frame of our assay (4 weeks compared to 12 days) that permitted more cell divisions and associated phenotypic changes. In contrast, the inherent limitations of Ab-induced lymphopenia and the contribution of thymic export to peripheral T cell replenishment prevented longer-term analysis in the transient T cell depletion model. Regardless, overtly auto-reactive T cells were not detected in either assay and T 115  cell proliferation was restrained by competition for IL-7 with resident IL-7Rα-expressing T cells in both models. Thus, in situations of mild lymphopenia, a program of IL-7 treatment may be required for more rapid T cell reconstitution, and this can likely be achieved without the drawback of auto-reactive T cell expansion. However, these results do not rule out that IL-7 or lymphopenia can contribute to proliferation or accumulation of auto-reactive T cells. Numerous studies have shown that lymphopenia is associated with autoimmune pathology or increased cytotoxicity of tumor reactive clones (18, 29-32). Thus, the lymphopenic environment does have the potential to support expansion and activation of auto-reactive T cells and these studies have clearly demonstrated that acquisition of effector function can significantly affect disease outcome. However, the majority of these studies analyzed Ag-specific monoclonal T cell populations and their responses to cognate Ag (26, 32, 33) or mouse models with compromised regulatory T cell function (18). In order to more closely mimic human T cell transplantation, we chose to analyze the behavior of polyclonal T cells. Interestingly, despite previous reports suggesting that LIP can act as a cofactor for autoimmune diseases due to acquisition of an effector memory phenotype and interaction with self-peptides, our work suggests that polyclonal T cells, although they do take on a CD44hi phenotype, do not undergo clonal expansion that could result in autoimmune pathology mediated by self-peptide reactivity. Further studies of TCR transgenic T cells in the presence or absence of the cognate antigen could permit further insight into the role of increased self-peptide/MHC interactions on T cell proliferation in the absence of elevated IL-7 levels. Together these data show that the amount of bioavailable IL-7 has a significant impact on T cell proliferation. In agreement with the hypothesis that IL-7 provides proliferative signals, we detected significant expansion of Tg IL-7 T cells in lymphoreplete congenic WT hosts where T cell competition for self-peptide/MHC interactions is high but IL-7 is not limiting. Further, in the presence of high IL-7 levels in IL-7Rα-/- hosts, WT CD45.1+ T cells underwent rapid expansion, but this was limited in mildly lymphopenic IL-7Rα449F hosts where IL-7 availability is not elevated. However, IL-7Rα449F hosts do support significantly more proliferation of transferred T cells than WT hosts. This may be more accurately referred to as “enhanced homeostatic proliferation” since it may result from less competition for T cells to interact with self-peptide presenting APCs. In agreement with this idea, increasing the number of APCs, either by adoptive transfer or cytokine treatment, has previously been shown to increase T cell proliferation in the absence of IL-7 changes (25, 34). 116  Due to its roles in thymocyte development and peripheral T cell homeostasis, IL-7 has emerged as a candidate immunotherapeutic for increasing T cell number and function in lymphopenic patients. Two independent clinical trials have been conducted and both report increased naïve CD4 and CD8 T cells numbers in IL-7 treated patients (27, 28). Interestingly, analysis of naïve T cell TCR repertoire following IL-7 mediated expansion showed that repertoire contraction did not occur, and in fact, repertoire diversity was increased (27, 28). Our results lend further support to the idea that IL-7 may be a useful immunotherapeutic for T cell reconstitution following clinical T cell depletion in autoimmune patients, HIV patients or in aging populations. In the clinical trials, human naïve T cells were preferentially expanded and retained their naïve phenotype upon IL-7 treatment. In contrast, in LIP experiments, purified murine naïve T cells take on a CD44hi memory-like phenotype. This is an interesting discrepancy that warrants further examination. In lymphopenic environments, competition for cytokine and selfpeptide/MHC interactions are decreased and together these are responsible for the conversion of naïve to memory-like phenotype. However, in non-lymphopenic patients, competition for MHC interaction would still be intact while IL-7 treatment would increase cytokine availability. In vitro, high IL-7 concentrations are sufficient to drive T cell proliferation in the absence of TCR stimulation (35) – this type of cytokine driven proliferation paired with increased cell survival may explain the accumulation of naïve T cells without memory T cell conversion seen in clinical trials. It will be interesting to determine whether IL-7 treatment of severely lymphopenic patients will result in naïve or memory-like T cell accumulation. Promisingly, our analysis suggests that TCR repertoire diversity will still be maintained, but care must be taken to monitor patients for signs of autoimmune pathology due to the association of IL-7Rα deregulation in such diseases.  117  4.4  Materials and methods  Mice C57BL/6, B6.SJL-Ptprca Pepcb (CD45.1+) and IL-7Rα-/- mice were originally purchased from The Jackson Laboratory (Bar Harbor, ME). IL-7Rα449F mice were generated by homologous recombination to express the mutant receptor under control of the endogenous promoter and backcrossed to C57BL/6 at least 12 generations in our facility (19). Tg IL-7 mice (IL-7 overexpressed in B and T cells by a modified IgH chain enhancer and promoter) (22) were backcrossed over 20 generations with C57BL/6 mice. Tg IL-7 and IL-7Rα449F mice were crossbred to generate Tg IL-7; IL-7Rα449F mice that express the IL-7 transgene and the mutant IL7Rα. All mice were bred and maintained at the University of British Columbia (UBC) and experiments performed in compliance with University Animal Care Committee and Canadian Council of Animal Care guidelines and approval. Antibodies Directly conjugated and biotinylated antibodies were obtained from BD Pharmingen (Mississauga, ON) (anti-CD3ε, CD4, CD8α, CD11b, CD11c, CD44, CD45.1, TCR Vβ panel, BrdU) or eBioscience (San Diego, CA) (anti-CD45.2, IL-7Rα). Flow Cytometry Surface staining for lymphocyte characterization was carried out according to standard procedures. Samples were collected on an LSRII cytometer (BD Biosciences, Mississauga, ON) and data analyzed with FlowJo software (Tree Star, Ashland, OR). IL-7 Quantification Analysis of in vivo CD127 regulation was performed as previously described (25). Briefly, 5x106 CD45.1+ T cells were transferred i.v. into WT, IL-7Rα449F or IL-7Rα-/- hosts. 20 hours later, spleens were isolated and CD127 surface expression on CD45.1+ T cells analyzed by flow cytometry. For splenic IL-7, spleens were harvested into cold PBS + 4% FBS + 2mM EDTA. Organ weight was recorded then spleen placed into 125 µl cold Collagenase IV (1000 U/ml in PBS) in a 1.5 ml centrifuge tube. Spleens were minced using fine dissection scissors and placed in a 55oC heat block for 1-2 hours. Samples were centrifuged at 16,000 x g at 4oC for 10 minutes. The resulting supernatants were transferred to ice and sampled in duplicate using Mouse IL-7 Quantikine kit (R & D Systems, Burlington, ON). After overnight incubation on the ELISA plate, the rest of the assay was carried out according to manufacturer’s instructions. 118  Analysis of Lymphopenia Induced Proliferation Naïve T cells were isolated from the spleens and lymph nodes of 6-10 week old CD45.1+ mice using the EasySep® Mouse T Cell Enrichment Kit (Stem Cell Technologies, Vancouver, BC) according to manufacturer’s instructions. Anti-CD44 biotin was added to the depletion cocktail when enriching for CD44lo T cells. Cells were labeled with CFSE as previously described, (19). Purified, labeled cells were transferred into age- and sex-matched unirradiated host mice (see Figure Legends for cell numbers transferred). After the indicated time points, total cell numbers and CFSE dilution was determined by flow cytometry. TCR Vβ analysis following LIP After 4-5 weeks of in vivo incubation, total splenic T cells were purified using the EasySep® Mouse T Cell Enrichment Kit (Stem Cell Technologies, Vancouver, BC). Isolated cells were quantified and labeled with antibodies to CD45.1, CD45.2, CD3, CD4, CD8 and a panel of TCR Vβ chains. Statistical analysis All data except survival curves are presented as mean + SD and analyzed by Student’s t test or one-way, repeated measures ANOVA followed by Tukey’s post test, as appropriate. Significance was set at P≤0.05.  119  Figure 4.1  Figure 4.1 Chronic mild lymphopenia supports slow T cell proliferation 5x106 purified CFSE labeled T cells from naïve CD45.1+ mice were transferred i.v. into age- and sex-matched CD45.2+ WT, IL-7Rα449F or IL-7Rα-/- hosts. After 1 week (a, b) or 1 month (c, d) in vivo incubation, CD45.1+ T cells were quantified and analyzed for CFSE dilution by flow cytometry. (a, c) Flow cytometry plots are gated on live CD45.1+/CD45.2- CD4 or CD8 T cells. Data is representative of at least 5 mice for each genotype in two independent experiments.  120  Figure 4.2  Figure 4.2 Proliferating polyclonal T cells take on a memory phenotype in response to mild lymphopenia 5x106 CD44lo T cells were purified from 6 week old CD45.1+ mice, CFSE labeled and transferred i.v. into age- and sex-matched WT, IL-7Rα449F or IL-7Rα-/- hosts. After 4 weeks, cells were analyzed for CFSE dilution and CD44 surface expression. Data is representative of at least 3 separate trials with 3-4 mice per genotype. Flow cytometry plots are gated on live CD45.1+/CD45.2- CD4 or CD8 T cells. Gated boxes show the percentage of cells that have undergone at least one division.  121  Figure 4.3  Figure 4.3 IL-7 overexpression is sufficient to drive T cell proliferation Peripheral T cells (CD45.2+) from 6-7 week old Tg IL-7 or Tg IL-7; IL-7Rα449F mice were purified, CFSE labeled and transferred i.v. into age- and sex-matched WT CD45.1+ mice. After 2 weeks (a) or 12 weeks (b), spleens were harvested and the presence and CFSE dilution profiles of CD45.2+ cells analyzed by flow cytometry. Flow cytometry plots are gated on live CD45.2+ T cells (a) or total lymphocyte gate (b).  122  Figure 4.4  Figure 4.4 Mild lymphopenia is not associated with increased IL-7 availability (a) Surface expression of CD127 on CD45.1+ T cells after 20 hours in vivo incubation in WT, IL7Rα449F and IL-7Rα-/- hosts. Left panel, histogram representation; right panel, quantification of CD127 mean fluorescence intensity (MFI). (b) Comparison of IL-7 level in WT, IL-7Rα449F and IL-7Rα-/- spleens, normalized for different spleen sizes caused by IL-7Rα mutations. (c) Surface expression on WT and IL-7Rα449F CD4 T cells after overnight in vitro culture in the presence or absence of 10 ng/ml IL-7. Data is representative of two independent analyses with 3-5 mice of each genotype.  123  Figure 4.5  Figure 4.5 IL-7Rα 449F mutation does not significantly alter TCR Vβ repertoire, but may provide greater access to antigen presenting cells Peripheral T cells from WT and IL-7Rα449F mice were analyzed for TCR Vβ usage by flow cytometry using antibodies against the indicated TCR Vβ chains. Data is representative of 3 different trials with 3-4 mice per genotype. (b) Splenic APCs were quantified from WT and IL7Rα449F mice. Splenocytes were dispersed and stained for APC markers CD11b and CD11c. (c) T cell:APC ratio of WT and IL-7Rα449F mice. T cells were gated as CD3+B220-. Data is representative of three independent analyses with 3-5 mice of each genotype.  124  Figure 4.6  Figure 4.6 Lymphopenia induced proliferation does not cause preferential monoclonal expansion of transferred T cells Purified T cells from young CD45.1+ mice were transferred to CD45.2+ WT, IL-7Rα449F and IL7Rα-/- hosts. Following 1 month in vivo incubation, flow cytometric TCR Vβ analysis was performed on CD45.1+ T cells. Each dot represents an individual WT, IL-7Rα449F or IL-7Rα-/host or CD45.1+ mouse.  125  4.5  References  1.  Mackall, C.L. and R.E. Gress. 1997. Thymic aging and T-cell regeneration. Immunol.Rev. 160:91-102.  2.  Cui, Y., H. Zhang, J. Meadors, R. Poon, M. Guimond and C.L. Mackall. 2009. Harnessing the physiology of lymphopenia to support adoptive immunotherapy in lymphoreplete hosts. Blood. 114:3831-3840.  3.  Fry, T.J., B.L. Christensen, K.L. Komschlies, R.E. Gress and C.L. Mackall. 2001. Interleukin-7 restores immunity in athymic T-cell-depleted hosts. Blood. 97:1525-1533.  4.  Mackall, C.L., T.J. Fry, C. Bare, P. Morgan, A. Galbraith and R.E. Gress. 2001. IL-7 increases both thymic-dependent and thymic-independent T-cell regeneration after bone marrow transplantation. Blood. 97:1491-1497.  5.  Takada, K. and S.C. Jameson. 2009. Naive T cell homeostasis: from awareness of space to a sense of place. Nat.Rev.Immunol. 9:823-832.  6.  Surh, C.D. and J. Sprent. 2008. Homeostasis of naive and memory T cells. Immunity. 29:848-862.  7.  Tan, J.T., E. Dudl, E. LeRoy, R. Murray, J. Sprent, K.I. Weinberg and C.D. Surh. 2001. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc.Natl.Acad.Sci.U.S.A. 98:8732-8737.  8.  Tan, J.T., B. Ernst, W.C. Kieper, E. LeRoy, J. Sprent and C.D. Surh. 2002. Interleukin (IL)15 and IL-7 jointly regulate homeostatic proliferation of memory phenotype CD8+ cells but are not required for memory phenotype CD4+ cells. J.Exp.Med. 195:1523-1532.  9.  Kieper, W.C., J.T. Tan, B. Bondi-Boyd, L. Gapin, J. Sprent, R. Ceredig and C.D. Surh. 2002. Overexpression of interleukin (IL)-7 leads to IL-15-independent generation of memory phenotype CD8+ T cells. J.Exp.Med. 195:1533-1539.  10. Seddon, B., P. Tomlinson and R. Zamoyska. 2003. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat.Immunol. 4:680-686. 11. Seddon, B. and R. Zamoyska. 2002. TCR and IL-7 receptor signals can operate independently or synergize to promote lymphopenia-induced expansion of naive T cells. J.Immunol. 169:3752-3759. 12. Ernst, B., D.S. Lee, J.M. Chang, J. Sprent and C.D. Surh. 1999. The peptide ligands mediating positive selection in the thymus control T cell survival and homeostatic proliferation in the periphery. Immunity. 11:173-181. 13. Goldrath, A.W. and M.J. Bevan. 1999. Low-affinity ligands for the TCR drive proliferation of mature CD8+ T cells in lymphopenic hosts. Immunity. 11:183-190. 14. Moses, C.T., K.M. Thorstenson, S.C. Jameson and A. Khoruts. 2003. Competition for self ligands restrains homeostatic proliferation of naive CD4 T cells. Proc.Natl.Acad.Sci.U.S.A. 100:1185-1190. 15. Kieper, W.C. and S.C. Jameson. 1999. Homeostatic expansion and phenotypic conversion of naive T cells in response to self peptide/MHC ligands. Proc.Natl.Acad.Sci.U.S.A. 96:1330613311.  126  16. Goldrath, A.W., L.Y. Bogatzki and M.J. Bevan. 2000. Naive T cells transiently acquire a memory-like phenotype during homeostasis-driven proliferation. J.Exp.Med. 192:557-564. 17. Khoruts, A. and J.M. Fraser. 2005. A causal link between lymphopenia and autoimmunity. Immunol.Lett. 98:23-31. 18. King, C., A. Ilic, K. Koelsch and N. Sarvetnick. 2004. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell. 117:265-277. 19. Osborne, L.C., S. Dhanji, J.W. Snow, J.J. Priatel, M.C. Ma, M.J. Miners, H.S. Teh, M.A. Goldsmith and N. Abraham. 2007. Impaired CD8 T cell memory and CD4 T cell primary responses in IL-7R alpha mutant mice. J.Exp.Med. 204:619-631. 20. Peschon, J.J., P.J. Morrissey, K.H. Grabstein, F.J. Ramsdell, E. Maraskovsky, B.C. Gliniak, L.S. Park, S.F. Ziegler, D.E. Williams, C.B. Ware, J.D. Meyer and B.L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J.Exp.Med. 180:1955-1960. 21. Bourgeois, C. and B. Stockinger. 2006. CD25+CD4+ regulatory T cells and memory T cells prevent lymphopenia-induced proliferation of naive T cells in transient states of lymphopenia. J.Immunol. 177:4558-4566. 22. Rich, B.E., T.J. Campos, R.I. Tepper, R.W. Moreadith and P. Leder. 1993. Cutaneous lymphoproliferation and lymphomas in interleukin 7 transgenic mice. J.Exp.Med. 177:305316. 23. Boyman, O., C. Ramsey, D.M. Kim, J. Sprent and C.D. Surh. 2008. IL-7/anti-IL-7 mAb complexes restore T cell development and induce homeostatic T Cell expansion without lymphopenia. J.Immunol. 180:7265-7275. 24. Mazzucchelli, R. and S.K. Durum. 2007. Interleukin-7 receptor expression: intelligent design. Nat.Rev.Immunol. 7:144-154. 25. Guimond, M., R.G. Veenstra, D.J. Grindler, H. Zhang, Y. Cui, R.D. Murphy, S.Y. Kim, R. Na, L. Hennighausen, S. Kurtulus, B. Erman, P. Matzinger, M.S. Merchant and C.L. Mackall. 2009. Interleukin 7 signaling in dendritic cells regulates the homeostatic proliferation and niche size of CD4+ T cells. Nat.Immunol. 10:149-157. 26. Le Campion, A., M.C. Gagnerault, C. Auffray, C. Becourt, M. Poitrasson-Riviere, E. Lallemand, B. Bienvenu, B. Martin, F. Lepault and B. Lucas. 2009. Lymphopenia-induced spontaneous T-cell proliferation as a cofactor for autoimmune disease development. Blood. 114:1784-1793. 27. Rosenberg, S.A., C. Sportes, M. Ahmadzadeh, T.J. Fry, L.T. Ngo, S.L. Schwarz, M. StetlerStevenson, K.E. Morton, S.A. Mavroukakis, M. Morre, R. Buffet, C.L. Mackall and R.E. Gress. 2006. IL-7 administration to humans leads to expansion of CD8+ and CD4+ cells but a relative decrease of CD4+ T-regulatory cells. J.Immunother. 29:313-319. 28. Sportes, C., R.R. Babb, M.C. Krumlauf, F.T. Hakim, S.M. Steinberg, C.K. Chow, M.R. Brown, T.A. Fleisher, P. Noel, I. Maric, M. Stetler-Stevenson, J. Engel, R. Buffet, M. Morre, R.J. Amato, A. Pecora, C.L. Mackall and R.E. Gress. 2010. Phase I study of recombinant human interleukin-7 administration in subjects with refractory malignancy. Clin.Cancer Res. 16:727-735. 29. Gattinoni, L., S.E. Finkelstein, C.A. Klebanoff, P.A. Antony, D.C. Palmer, P.J. Spiess, L.N. Hwang, Z. Yu, C. Wrzesinski, D.M. Heimann, C.D. Surh, S.A. Rosenberg and N.P. Restifo. 127  2005. Removal of homeostatic cytokine sinks by lymphodepletion enhances the efficacy of adoptively transferred tumor-specific CD8+ T cells. J.Exp.Med. 202:907-912. 30. Wrzesinski, C., C.M. Paulos, A. Kaiser, P. Muranski, D.C. Palmer, L. Gattinoni, Z. Yu, S.A. Rosenberg and N.P. Restifo. 2010. Increased intensity lymphodepletion enhances tumor treatment efficacy of adoptively transferred tumor-specific T cells. J.Immunother. 33:1-7. 31. Dummer, W., A.G. Niethammer, R. Baccala, B.R. Lawson, N. Wagner, R.A. Reisfeld and A.N. Theofilopoulos. 2002. T cell homeostatic proliferation elicits effective antitumor autoimmunity. J.Clin.Invest. 110:185-192. 32. Calzascia, T., M. Pellegrini, A. Lin, K.M. Garza, A.R. Elford, A. Shahinian, P.S. Ohashi and T.W. Mak. 2008. CD4 T cells, lymphopenia, and IL-7 in a multistep pathway to autoimmunity. Proc.Natl.Acad.Sci.U.S.A. 105:2999-3004. 33. Le Saout, C., S. Mennechet, N. Taylor and J. Hernandez. 2008. Memory-like CD8+ and CD4+ T cells cooperate to break peripheral tolerance under lymphopenic conditions. Proc.Natl.Acad.Sci.U.S.A. 105:19414-19419. 34. Ge, Q., V.P. Rao, B.K. Cho, H.N. Eisen and J. Chen. 2001. Dependence of lymphopeniainduced T cell proliferation on the abundance of peptide/ MHC epitopes and strength of their interaction with T cell receptors. Proc.Natl.Acad.Sci.U.S.A. 98:1728-1733. 35. Swainson, L., S. Kinet, C. Mongellaz, M. Sourisseau, T. Henriques and N. Taylor. 2007. IL7-induced proliferation of recent thymic emigrants requires activation of the PI3K pathway. Blood. 109:1034-1042.  128  5 General discussion and future perspectives  129  5.1  IL-7Rα Y449 signals regulate lymphocyte development, homeostasis and function The identity, lifespan, activation and migration of lymphocytes is controlled by responses  to a wide variety of extracellular signals, with the ultimate goal of maintaining the health of the organism by warding off infection while simultaneously preventing tumor formation and autoimmune pathology. The research findings presented in this thesis dealt with the contributions of a cytokine, IL-7, to the development, function and homeostasis of B and T cells. Prior to this work, it had been clearly documented that IL-7 and IL-7Rα signaling were required for development of these cell types, therefore preventing meaningful analysis of how and when these signals were required in mature cells. Chapter 2 describes the characterization of a novel mouse model (the IL-7Rα449F mouse) that harbors a knock-in mutation at a key signaling residue, Y449, of IL-7Rα. The results presented in this chapter revealed a number of unexpected findings in terms of T cell biology. This is the first demonstration that domains other than the Y449xxM motif contribute to thymopoiesis since IL-7Rα449F mice develop significantly more T cells than either IL-7-/-, γc-/-, IL-7Rα-/- or Jak3-/- mice. Analysis of T cells that developed in IL-7Rα449F mice revealed the completely unexpected finding that IL-7Rα Y449 is an essential component of CD4, but not CD8, T cell activation in response to Listeria monocytogenes infection and that the requirement for IL-7Rα signaling in memory CD8 T cells is separable from Bcl-2 expression. The experiments in Chapter 3 show that signaling changes mediated by the IL-7Rα449F mutation render developing B and T cells resistant to two different oncogenes, overexpression of c-Myc and IL-7, respectively. In both systems, failure to activate STAT5 appears to be a key event in preventing lymphocyte transformation. The fourth chapter examines the partial lymphopenia of IL-7Rα449F mice and demonstrates that the decreased number of T cells is sufficient to allow increased proliferation of transferred T cells in the absence of detectable increases in IL-7 availability. The finding that targeted ablation of a single signaling motif of IL-7Rα allowed partial T and B cell development was somewhat surprising. The prototypical γc cytokine receptor, IL-2R, has numerous tyrosines and other motifs that are documented sites of effector recruitment (1). In contrast, previous biochemical data from human B and T cells suggested that Y449 of IL-7Rα was required for activation of both known signaling pathways, Jak/STAT and PI3 kinase (2-4). However, B and T cell development in IL-7Rα449F mice clearly demonstrates that not all signals 130  initiated by the IL-7R rely solely on Y449 phosphorylation. This result provided the opportunity to address IL-7Rα signaling in mature T cell homeostasis and function as well as lymphocyte susceptibility to transformation in a way that had not been previously possible. These analyses demonstrated that IL-7Rα Y449 signals maintain peripheral T cell homeostasis, contribute to cellular immunity and that signals initiated by phosphorylation of this residue co-operate with oncogenes to drive lymphoid transformation. 5.1.1  IL-7Rα signaling pathways and survival in B and T cell development A guiding principle of this work was to determine which known signaling pathways were  maintained or disrupted in the IL-7Rα449F mouse and the biological implications of these signaling changes. In vitro stimulation of bone marrow B cell progenitors, thymocytes and splenocytes clearly showed that IL-7Rα Y449 is essential for IL-7 mediated STAT5 activation. Conversely, regulation of Bcl-2 and related family members was not directly Y449-dependent and expression analysis of these proteins has revealed a previously unappreciated level of complexity. STAT5 signaling is necessary for both B and T cell development, but is sufficient to overcome IL-7Rα deficiency only in the B cell lineage (5, 6). STAT5 can directly regulate expression of Bcl-2 family members including Bcl-2, Bcl-xL and Mcl-1. In pro-B cells, STAT5 is necessary to ensure Mcl-1 expression and progenitor viability (7). From analysis of gene knock out mice, we know that Bcl-xL is not essential at this stage of B lymphopoiesis, but it is necessary for survival of pre-B cells. (7) Since IL-7Rα-/- mice fail to develop pre-B cells, it is unknown if IL-7 signaling maintains Bcl-xL expression. However, it is likely that IL-7 provides more than mere survival signals throughout B cell development since neither ectopic Bcl-2 expression nor Bim deficiency can fully rescue B lymphopoiesis in IL-7Rα-/- mice (8, 9). In IL7Rα449F mice, survival and B cell numbers at the pro-B cell stage are minimally affected, suggesting that survival can be mediated by Y449-independent events. Although Mcl-1 status has not been measured in these cells, Bcl-2 expression is increased compared to WT, perhaps being up-regulated by Y449-independent signals to compensate for lack of STAT5/Mcl-1 expression. Despite Bcl-2 expression, viability of IL-7Rα449F pre-B cells is compromised, suggesting that signals initiated by IL-7Rα Y449, perhaps controlling Bcl-xL expression, are critical. Clearly, there are complex networks regulating progenitor cell survival. 131  From our data in the IL-7Rα449F model and previous data showing that T cell development can be partially restored in IL-7Rα-/- mice by transgenic Bcl-2 expression or deletion of Bim or Bax, it appears that IL-7Rα transmits critical survival signals in thymocyte progenitors since DN thymocyte cellularity is low in both IL-7Rα449F and IL-7Rα-/- mice and IL7Rα449F DN thymocytes have very low Bcl-2 expression. However, the question of how IL-7Rα initiates regulation of these survival signals is unclear. IL-7Rα449F mutation abrogates STAT5 activation, and literature suggests that PI3 kinase activation requires Y449 and may even depend on STAT5 activity (2-4). We haven’t successfully shown IL-7 mediated PI3 kinase activation (as detected by phosphoAkt or phosphoS6) in WT lymphocytes, and therefore are unable to show loss of activity by the IL-7Rα449F mutation, but despite interruption of STAT5 and (possibly) PI3 kinase activation in IL-7Rα449F mice, thymocytes are able to bypass the DN4 developmental block characteristic of IL-7Rα-/- hosts and generate a pool of peripheral T cells. These data are consistent with reports that STAT5 signaling is insufficient to re-constitute αβ T cell development in IL-7Rα-/- cells (10) and that deletion of PI3 kinase p85 regulatory or p110 catalytic subunits has only minor affects on T cell development (11, 12) (and loss of p110δ signaling has no effect on IL-7 mediated tumorigenesis). What remains unresolved is how the IL-7Rα Y449-independent regulation of survival effectors is controlled: what molecules are being recruited to IL-7Rα and where are they binding? Current work in the laboratory analyzing a panel of targeted IL-7Rα mutants is ongoing to address this question. 5.1.2  An undefined requirement for IL-7Rα in T cell progenitors The field of thymic progenitor development has made important progress in the last  number of years, helped considerably by characterization of ETPs (Lin-c-kit+IL-7Rαlo) as a subpopulation of DN1 cells (13). The identity of the thymic settling progenitor population has been hotly contested, although the current literature shows that a population of Lin-Sca+c-Kit+Flt3hi lymphoid primed multipotent progenitors (LMPPs) found in blood has the potential to enter the thymus, receive Notch signals and generate T cells in vivo (14). As these cells mature and receive Notch signals, Flt3 expression decreases, IL-7Rα increases, and T cell commitment is solidified at the expense of B, NK, DC and myeloid potential (15). What remains unknown is how these signals relate to each other mechanistically. The timing and mechanism of IL-7 signaling in this process also remains unclear. Although IL-7Rα expression on the LMPP was 132  not reported, a circulating T cell progenitor (CTP) characterized as Lin-Thy1+CD25-IL-7Rα+ has been described (16), and based on low expression of c-kit appears to be a different cell type than the LMPP. The physiological relevance of these two cell types has not been directly compared. An unexpected finding from this work that warrants further investigation is the striking defect in the number of early thymic progenitors in IL-7Rα449F mice (20-fold decrease compared to WT). This defect is particularly interesting since the number of cells in the preceding developmental stage monitored (BM hematopoietic progenitor cell) is normal in IL-7Rα449F mice and the following stages (DN through CD4 and CD8 SP T cells) are decreased by only 4-fold. Since low IL-7Rα expression is a characteristic of the ETP, it is unlikely that this cell type relies on IL-7 for survival, differentiation or commitment. There are a number of earlier stages that could potentially be affected, perhaps the BM MPP or the blood-borne progenitor is defective in some way, either due to survival or proliferation defects or inefficient thymic settling. There is also evidence that IL-7 and Notch signaling are co-operative in nature in early thymopoiesis; failure to properly integrate these signals could inhibit ETP generation even if thymic settling is not compromised. Following this step, it is of further interest to determine how the DN stages compensate for this early deficiency to generate a pool of T cells decreased by only 25% compared to WT. The compensation has occurred by the DP stage, indicating that the DN developmental stages are undergoing IL-7Rα Y449-independent events. In agreement with this hypothesis, IL-7Rα449F DN thymocytes incorporate more BrdU than WT counterparts, although the nature of the proliferative signal at this stage is unknown. 5.1.3  Homeostasis and function of peripheral T cells Peripheral T cells are responsive to signals mediated by both IL-7 and TSLP. Thus, to  interpret IL-7Rα449F peripheral T cell defects, the effect of the Y449 mutation on signaling events mediated by both TSLP and IL-7 stimulation will be necessary. Since IL-7Rα449F T cells are unable to proliferate in response to lymphopenia and naïve IL-7Rα449F T cells have demonstrated survival defects in intact hosts it was concluded that IL-7Rα Y449 signals are essential for peripheral T cell homeostasis. This finding was consistent with other studies showing that IL-7 and STAT5 signaling are both necessary for LIP (17-20) since IL-7Rα449F cells cannot activate STAT5 in response to IL-7. The survival defect is not as easily explained as there are only minimal differences in expression of Bcl-2 family members Bcl-2, Bcl-xL, Mcl-1 133  and Bim between WT and IL-7Rα449F T cells as measured by flow cytometry. However, the cellular localization and phosphorylation status of these effectors or the mitochondrial potential in these cells have not yet been investigated. IL-7 has recently been described as one of the first extracellular molecules that directly impacts internal cellular metabolism in vivo (21). The importance of IL-7 mediated metabolic regulation was first demonstrated by showing that T cells cultured in the absence of IL-7 atrophied and became anergic to mitogenic stimuli (22). When T cells are activated, IL-7Rα is down regulated and cells become reliant on signals mediated by the TCR complex for proliferation. Clonal expansion is energetically expensive. Thus, a potential homeostatic role for IL-7Rα signaling may be to provide a steady level of glucose that can be used to fuel proliferation. This requirement for IL-7Rα signaling in T cell maintenance may play a role in the otherwise unexpected IL-7Rα449F CD4 T cell primary response defect following L. monocytogenes infection. A pervasive metabolic defect may play a role in the inability of IL7Rα449F CD4 T cells to clonally expand in response to L. monocytogenes or OVA loaded dendritic cells. Glucose metabolism in lymphocytes relies on surface expression of the glucose transporter (Glut1) and intracellular enzymatic activity. There is evidence that IL-7Rα regulates surface expression of Glut1 in a Y449 and STAT5-dependent manner, but Glut1-independent changes in glucose uptake have also been described (4, 23). IL-7Rα signaling maintains glucose metabolism through transcriptional regulation of a key glycolytic enzyme, hexokinase II (HKXII) (23). The upstream regulators of HKXII have not been reported, but IL-7-dependent changes can be detected within 2-4 hours of IL-7 treatment, long before detectable changes in Akt phosphorylation can be measured (23). Thus, it is possible that this is another STAT5 mediated event, if it is initiated by Y449 phosphorylation. Why this would selectively affect CD4 T cells in L. monocytogenes infection is unclear, but may be due to the fact that CD8 T cells are more sensitive to TCR stimulation than CD4 T cells potentially allowing them to become IL-7 independent sooner. A caveat of the approach we have described here – analyzing the capacity of IL-7Rα449F T and B cells to maintain themselves in homeostatic conditions, following infection or their sensitivity to transformation – is that signals required for development are not necessarily separated from those required in these processes. It is possible that IL-7Rα Y449-independent compensatory mechanisms allow survival and differentiation of cells that develop in the absence 134  of IL-7Rα Y449 signaling. As such, these cells may not provide a completely accurate reflection of the role of IL-7Rα Y449 signaling in otherwise healthy cells. To clearly address this issue, a conditional knock-in mouse would need to be generated, where the mutant receptor would only be expressed in stages beyond the differentiation blockage, or could be switched from WT to IL7Rα449F under the researcher’s control. This type of approach would more clearly be able to address the issue of how IL-7Rα Y449 signaling is necessary for naïve T cell homeostasis and for the requirement of IL-7Rα Y449 to maintain memory T cells over the long-term. 5.1.4  B cell development in the absence of IL-7Rα Y449 In the absence of IL-7Rα signaling, mice develop very few B cells due to a  developmental block that prevents conversion of CD19- (fraction A) to CD19+ (fraction B) cells (24, 25). Based on findings that IL-7Rα mediated STAT5 activation is necessary for regulation of Ebf1 (24), an essential B cell transcription factor, and that enforced survival through either transgenic Bcl-2 expression or Bim deficiency was insufficient to rescue B cell development in IL-7Rα-/- mice (8, 9), it was thought that IL-7 provided essential differentiation signals to early B lymphocyte progenitors. However, a recent report challenging this notion demonstrated that B cell progenitors lacking STAT5 can be ‘rescued’ by expression of Bcl-2 and that ectopic Bcl-2 expression provides partial B cell rescue in IL-7Rα-/- mice (7). Furthermore, levels of the genes encoding B lymphopoiesis transcription factors Ebf1, Pax5 and E2A and VH-DJH recombination of the IgH locus is normal at both proximal and distal sites in the Bcl-2 rescued cells (7). Based on this data, the authors concluded that IL-7Rα and STAT5 relay permissive, rather than differentiation signals and that the paucity of splenic B cells in IL-7Rα and STAT5 deficient mice is due to loss of the progenitor pool. The discrepancies in the findings from this paper and previous literature (8, 9, 24)could have to do with either age of the mice or the cell types analyzed. In this report, mice were analyzed at or before 6 weeks of age, yet fetal B cell development is IL-7-independent (26), therefore the analyzed cells could have contained fetalderived subsets. Alternatively, because enforced survival through transgenic Bcl-2 expression allowed collection of bona fide pro-B cells (CD19+c-kit+IgM-), analysis of genomic DNA on these sorted populations may be a more accurate reflection of VHDJH recombination than in previous analyses of non-transgenic IL-7Rα-/- or STAT5-/- B220+IgM- pools that contained a large proportion of uncommitted, unrearranged CD19- pre-pro-B cells. 135  These results are interesting in the context of B cell development in IL-7Rα449F mice. Loss of IL-7Rα Y449 disrupts IL-7 mediated STAT5 activation, but does not result in the same developmental blockage at the fraction A stage seen in IL-7Rα-/- and STAT5-/- mice, suggesting that IL-7Rα Y449-, STAT5-independent events have a role in early B lymphopoiesis. Thus, it appears that STAT5 is important, but is not the sole mediator of IL-7Rα signaling in early B cell progenitors. However, STAT5-/- pro-B cells rescued by Bcl-2 expression were not fit for the proliferative burst mediated by co-operative pre-BCR and IL-7Rα signaling (7), indicating that STAT5 is an essential component of the signaling cross-talk in pre-B cell expansion. This is again consistent with what was seen in IL-7Rα449F mice where pre-B cells were formed, but did not undergo population expansion. Further experiments are needed in order to identify how the remainder of the IL-7Rα chain generates signal and contributes to B and T lymphopoiesis. IL-7Rα signaling leads to myc transcription in pre-B cells and interruption of Myc expression can dampen proliferation of large pre-B cells (27). Thus, it is attractive to hypothesize that this is a signal that has been lost in IL-7Rα449F cells and contributes to their failure to thrive at the large pre-B cell stage. However, survival rather than proliferation defects seem to contribute more to the loss of the pre-B cell pool in IL-7Rα449F mice and genetic evidence suggests that regulation of myc transcripts may be initiated by a Y449-independent signaling event since neither STAT5 or PI3 kinase activity were able to restore IL-7 responsiveness when Myc was limiting (28). This leads to the hypothesis that IL-7Rα Y449 signaling regulates pre-B cell survival, perhaps through STAT5 mediated Bcl-xL expression, and that STAT5 makes an additional contribution to these cells, such as regulation of proliferation or maintenance of cellular metabolism that cannot be overcome simply by Bcl-2 expression. 5.1.5  Potential role of glucose metabolism in protection from Eµ-myc transformation Cancer cells, like activated T cells, utilize glycolysis for energy (29). Potential defects in  cellular metabolism mediated by the IL-7Rα449F mutation may play a central role in the protection from IL-7 or c-Myc induced lymphomagenesis. Interestingly, glucose metabolism has been linked to cell survival through expression of Bcl-2 family members Mcl-1, Bax and Puma (30). Glucose metabolism increases cell survival through a p53 dependent inhibition of Bax activity and Puma induction and stabilizes Mcl-1 through inhibition of glycogen synthase kinase3 (GSK-3) (31). IL-7 also regulates cell survival and can affect expression and activity of these effectors. Although untested so far, it is possible that IL-7 signaling can affect p53 stabilization 136  through activation of Akt and Mdm2. This puts p53 activity at a central crossroad of IL-7 and glucose metabolism. Expression of Eµ-myc can lead to transformation through inactivation of p53. In healthy cells, growth factor withdrawal leads to decreased glucose metabolism and apoptosis through p53-mediated Puma induction and Bax activation (30). Therefore, Eµ-myc induced p53 inactivation provides a growth advantage to cells in stressful situations (e.g. limiting amounts of growth factor) by inhibiting Puma induction and Bax activity. Interestingly, Puma is frequently deleted in Eµ-myc B cell tumors (32). In the absence of IL-7Rα Y449, the pre-B cell apoptotic phenotype may be partially due to heightened p53 expression or activity leading to increased Puma expression or Bax activity. These changes may contribute to the delayed onset of Eµ-myc lymphomagenesis in IL-7Rα449F mice by increasing the threshold of p53 activity and even following p53 inactivation, these cells may be less prone to transformation due to lower Mcl-1 expression and/or alterations in glucose metabolic pathways. 5.1.6  Clinical uses of IL-7 and implications Due to its roles in thymocyte development and peripheral T cell homeostasis, IL-7 has  emerged as a candidate immunotherapeutic for increasing T cell number and function in lymphopenic patients. Two independent clinical trials have been conducted and both report increased naïve CD4 and CD8 T cells numbers in IL-7 treated patients (33, 34). In both studies, T cell numbers remained elevated for several weeks after cessation of treatment, likely due to increased cell survival mediated by increased Bcl-2 expression (34). Interestingly, analysis of naïve T cell TCR repertoire following IL-7 mediated expansion showed that repertoire contraction did not occur, and in fact, repertoire diversity was increased (33, 34). These are promising results that lend further support to the idea that IL-7 may prove to be a useful immunotherapeutic for T cell reconstitution following antibody-mediated T cell depletion in autoimmune patients, HIV patients or in aging populations. In clinical trials where lymphoreplete hosts were treated with recombinant IL-7, naïve T cells were preferentially expanded and retained their naïve phenotype. In contrast, in LIP experiments, purified naïve T cells take on a CD44hi memory-like phenotype. This is an interesting discrepancy that warrants further examination. In lymphopenic environments, competition for cytokine and self-peptide/MHC interactions are decreased and together these are responsible for the conversion of naïve to memory-like phenotype. However, in non137  lymphopenic patients, competition for MHC interaction would still be intact while IL-7 would be more readily available following cytokine treatment. In vitro, high IL-7 concentrations are sufficient to drive T cell proliferation in the absence of TCR stimulation (35) – this type of cytokine driven proliferation paired with increased cell survival may explain the accumulation of naïve T cells without memory T cell conversion seen in clinical trials. It will be interesting to determine whether IL-7 treatment of lymphopenic patients will result in naïve or memory T cell accumulation. Promisingly, our analysis suggests that TCR repertoire diversity will still be maintained, but care must still be taken to monitor patients for signs of autoimmune pathology due to the association of IL-7Rα deregulation in such diseases (36, 37).  138  5.2  Future directions  5.2.1  Analysis of IL-7Rα Y449-independent signaling in thymopoiesis Analysis of IL-7Rα449F and IL-7Rα-/- lymphocyte development demonstrates that IL-7Rα  Y449-independent events can participate since IL-7Rα449F mice are not severely lymphopenic. Despite normal numbers of hematopoietic stem cells in IL-7Rα449F mice, there is a 20-fold decrease in the number of ETPs, indicating that IL-7Rα Y449 signaling contributes to an early step in thymopoiesis. However, between the ETP and DP stage, at least one developmental stage must respond to IL-7Rα Y449-independent events because DP and SP T cell numbers are only 4-fold lower than WT. The developmental stage and the nature of the IL-7Rα Y449-independent signal remain unknown. An approach being pursued in the lab presently is to analyze a panel of IL-7Rα mutant chains for their ability to re-constitute T cell development after retroviral infection of IL-7Rα-/stem cells and transfer to lymphopenic hosts. This approach was designed in order to isolate the functionally important domains of the receptor. Alternatively, the IL-7Rα449F chain alone can be used to provide a more detailed understanding of T cell development and IL-7Rα Y449dependent signaling. It is unclear how early T linage commitment and development are affected by loss of IL-7Rα Y449 signaling. Currently, the data shows that the number of ETP’s is decreased in IL-7Rα449F mice, but whether these progenitors have an intrinsic defect or if the defect comes at an earlier stage, such as the developmental potential or numbers of circulating Tprogenitors (either LMPPs [Lin-Sca+c-kithi Flt3+] (38) or common T progenitors [CTPs] [LinSca+c-kitloFlt3-IL-7Rα+Thy1+]) (16) has yet to be determined. Initial quantification of circulating progenitors in WT, IL-7Rα449F and IL-7Rα-/- mice will be informative. If there are equal numbers between WT, IL-7Rα449F and IL-7Rα-/- mice, the question then becomes whether these cells have an intrinsic survival defect or if the defect lies in thymic entry. Blood-borne thymic progenitors expressing CCR7 and CCR9 respond to a CCL19, CCL21, CCL25 gradient and thymic entrance requires interactions between PSGL-1 and Pselectin (14, 39-41). Surface expression of these receptors on circulating progenitors and expression of thymic chemokines and glycoprotein should be compared to WT. The ability of IL-7Rα mutant cells to migrate in response to CCL19, CCL21 and CCL25 can be tested in vitro in transwell assays. If significant defects are not identified, the ETP’s themselves should be  139  analyzed. However, since a defining characteristic of these cells is low surface expression of IL7Rα (Lin-CD44hiCD25loc-kit+IL-7Rαlo), it is not expected that this will be the limiting cell type. Low numbers of thymic resident ETPs confounds analysis of thymocyte intrinsic defects in IL-7Rα449F and IL-7Rα-/- mice. To address the stage specific requirement for IL-7Rα Y449 signaling, DN1, DN2, DN3 or DN4 cells could be sorted by flow cytometry and equal numbers of live cells transferred intravenously to lethally irradiated congenic hosts (in the presence of congenically marked Rag1-/- bulk bone marrow). Thymocytes can then be harvested at various time points, quantified and analyzed for the ability to navigate the subsequent differentiation stages. This approach is unique in that it normalizes the number of defined progenitors to simply address the question of whether IL-7Rα449F cells have a better ability than IL-7Rα-/- to bypass the developmental block. In addition, by performing this experiment at each separable developmental stage, the requirement for IL-7Rα signals can be isolated accordingly. A caveat of this approach is that IL-7Rα mutants may have survival or migration defects that alter the ability of cells to seed the thymus. To address this issue, intrathymic transfers could be performed. Alternatively, OP9-DL1 or OP9-DL4 stromal cells, which provide necessary Notch signaling, can be used as an in vitro system to model thymocyte development and could be adopted to analyze the developmental potential of IL-7Rα449F progenitors. These series of experiments will neatly address the functional role of IL-7Rα Y449 signaling at discrete stages of thymopoiesis. These studies may identify a stage where IL-7Rα Y449-independence plays an important role, or may show that IL-7Rα Y449-independent events occur at multiple stages. If the latter scenario is true, this could suggest that the discrepancy between the 20-fold ETP decrease versus only 4-fold decrease in IL-7Rα449F DP cells is a cumulative result of each successive stage utilizing compensatory mechanisms as a result of occupying a less full space. If, however, a stage specific effect is found, this would potentially reveal a useful target stage for analysis of the signaling pathways involved. Using the OP9-DL1 or OP9-DL4 cells, large numbers of cells from the identified stage could be isolated. α-IL-7Rα immunoprecipitation studies followed by mass spectrometry could be designed to determine the identity of the interacting proteins. Understanding how these cells behave will shed light on the role of IL-7Rα signaling in early thymopoiesis.  140  5.2.2  Characterization of the CD4 primary response defect in IL-7Rα 449F mice The lack of a normal primary response to rLM-SIY infection in polyclonal IL-7Rα449F  CD4 T cells requires further investigation. There are a number of possibilities that could explain the noted defect, including the possibility that the IL-7Rα plays a role in TCR receptor selection and/or that IL-7 signaling is involved in activation of CD4 T cells in response to infection. To test the hypothesis that specific deficiencies in IL-7Rα Y449 mediated signaling are involved in TCR signaling and affect the transition from naïve to effector CD4 T cells, IL-7Rα449F mice were crossed with OT-II TCR transgenic mice (42). The OT-II TCR is specific for an ovalbumin (OVA) derived peptide (OVA323-339) in the context of MHC II H-2b (43). If IL-7Rα Y449 has a role in TCR repertoire selection, providing the transgenic TCR removes this variable. Preliminary experiments where purified naïve WT or IL-7Rα449F OT-II CD4 T cells were adoptively transferred into congenic hosts followed by challenge with OVA-peptide loaded bone marrow derived dendritic cells (BMDCs) have demonstrated that the OT-II; IL-7Rα449F CD4 T cells are unable to mount a response, similar to what we observed following L. monocytogenes challenge. These results suggest that OT-II; IL-7Rα449F CD4 T cells are defective in their ability to mount a primary response and that Y449-dependent signals are necessary in the maturation/differentiation of naïve CD4 to effector cells. Analysis of surface expression of CD25 and CD69 at early time points will allow determination of whether or not activation involves signals mediated by IL-7Rα Y449. To determine the role of IL-7Rα Y449 signaling in proliferation and survival of OT-II CD4 T cells, IL-7Rα+/+ and IL-7Rα449F OT-II CD4 T cells could be CFSE labeled prior to transfer and their CFSE dilution profiles and viability (via 7AAD/AnnexinV staining) compared following OVA-BMDC stimulation. To determine if the IL-7Rα449F mutation affects TCR and co-stimulation mediated activation, IL-7Rα+/+ and IL7Rα449F OT-II CD4 T cells can be stimulated with α-CD3 alone or in combination with α-CD28. The biochemical response (activation of Lck, Slp76, Zap70) can be monitored by western blot and/or flow cytometry. The functional response to the same stimulation can be monitored by the ability of these cells to flux calcium. Interestingly, the severe defect noted in vivo is not mimicked in vitro. Purified WT or IL7Rα449F OT-II CD4 T cells cultured in the presence of OVA-peptide loaded BMDCs proliferate to a similar extent and viability differences are not obvious. Contrary to in vivo situations, cultured CD4 T cells are under no competition stress for either access to APCs or nutrients. This could suggest that OT-II; IL-7Rα449F CD4 T cells are unable to mount a primary response in vivo 141  not because of an intrinsic defect in TCR signaling and T cell activation, but due to a competitive disadvantage of transferred IL-7Rα449F naïve T cells imparted by their reliance on IL-7 prior to activating APC interactions. Consistent with this hypothesis, treating host mice with neutralizing α-IL-7Rα antibodies had minimal effects on OT-II CD4 T cells in terms of CFSE dilution and cell recovery when compared to cells recovered from PBS treated host mice. Another approach to test the hypothesis that IL-7Rα Y449 signaling is more relevant in naïve CD4 T cell homeostasis than TCR mediated activation is to prime WT and IL-7Rα449F OT-II CD4 T cells in vitro by OVA-BMDCs and after 2-3 days, transfer the cells into congenic hosts. The kinetics of cell expansion and contraction can be monitored over 4-5 days in vivo by quantifying recovered cells. Effector capacity of these cells can be measured directly ex vivo (by injecting host mice with BrefeldinA) or by in vitro peptide re-stimulation and quantification of IFN-γ and/or IL-2 production in addition to tetramer/peptide detection. Further, if this in vitro primed monoclonal population is sufficient to generate a primary response to OVA, OT-II; IL-7Rα+/+ and OT-II; IL-7Rα449F mice can be used to test the hypothesis that IL-7Rα Y449 dependent signals are required for memory CD4 T cell homeostasis. This will be a useful system since accumulating evidence suggests a key role for IL-7 signaling as a survival factor in these cells (44-48) and the lack of a primary response in polyclonal mice precluded its analysis. 5.2.3  Determination of survival deficiency mechanism in IL-7Rα 449F CD8 memory T cells Homeostasis of memory CD8 T cells requires IL-7Rα Y449 signaling since IL-7Rα449F  memory CD8 T cells are not maintained over the long term. This failure of maintenance contributes to an overall decrease in the number of antigen specific memory T cells and compromised protective immunity. In contrast to expectations, the level of pro-survival Bcl-2 was similar between WT and IL-7Rα449F L. monocytogenes specific memory CD8 T cells. This raises the question of which survival effectors necessary for long-term memory T cell maintenance are disrupted by the IL-7Rα449F mutation. To address this question, OT-I TCR Tg mice that generate T cells that recognize the SIINFEKL peptide (OVA257-264) of OVA can be used. OT-I; IL-7Rα+/+ and OT-I; IL-7Rα449F naïve T cells adoptively transferred into congenic hosts and challenged with rLM-OVA generate a population of memory cells that are easily purified based on surface expression and are amenable to further biochemical testing. Similar to 142  what was seen in polyclonal mice infected with rLM-SIY, OT-I; IL-7Rα449F CD8 T cells mount a robust primary response but have significantly fewer memory cells. To test the hypothesis that the IL-7Rα449F mutation results in differential expression of survival effectors, proteomic comparison between IL-7Rα+/+ and IL-7Rα449F OT-I memory CD8 T cells can be performed. This approach will provide an unbiased comparison of the two samples. Based on the role of IL-7 signaling in regulating expression of pro-survival Bcl-2 family members and their central role in cell survival, the mass spectrometer may be tuned to search for members of this protein family. Alternatively, a conserved transcriptional signature of memory lymphocytes has been described (49) and a proteomic screen may highlight hits that correlate with altered expression of ‘memory-specific’ genes in the OT-I; IL-7Rα449F cells as compared to OT-I; IL-7Rα+/+. Quantification of mass spectrometry results should yield identification of proteins that are either unique to a sample set or differentially expressed between the two. Verification of expression patterns should be performed by western blot or flow cytometry in WT and IL7Rα449F OT-I memory CD8 T cells. To verify that these proteins have a physiological role, candidate genes can be overexpressed or knocked-down using retroviral gene delivery. This will allow determination of whether manipulating expression levels of the identified proteins can correct the IL-7Rα449F maintenance deficiency or conversely, cause WT OT-I CD8 memory T cells to become less stable over time. IL-7Rα signaling may also be implicated in memory CD8 T cell generation. At the height of the primary immune response in L. monocytogenes and LCMV infection, the majority of CD8 T cells have down-regulated IL-7Rα, but IL-7Rα expression marks a small population of CD8 T cells that have memory precursor potential. Further work has demonstrated that although IL-7Rα expression is essential, enforced IL-7Rα expression does not increase the number of memory CD8 T cells. These data suggest that IL-7Rα signals act in a permissive, rather than deterministic, manner for memory T cell recruitment. Our previous analysis of polyclonal IL7Rα449F mice did not examine whether rLM-SIY specific memory CD8 T cell recruitment was compromised. Comparison of WT and IL-7Rα449F OT-1 CD8 T cell contraction following rLMOVA infection will allow analysis of IL-7Rα signaling requirements in memory CD8 T cell generation. If contraction is normal between WT and IL-7Rα449F OT-1 T cells, this will suggest that IL-7Rα Y449 signaling is dispensable at this stage. However, if contraction is exacerbated 143  in IL-7Rα449F OT-1 T cells compared to WT OT-1, further analysis of IL-7Rα mediated survival signals, including both pro- and anti-apoptotic Bcl-2 family members, will be warranted. 5.2.4  B cell development in the absence of IL-7Rα Y449 signaling  The work describing the effect of the Y449 mutation on Eµ-myc induced transformation hinted at a role of IL-7Rα Y449 in the essential cross-talk between IL-7Rα and pre-BCR mediated signals for optimal B cell development. However, a number of questions have not yet been addressed. In order to fully characterize the extent of IL-7Rα Y449-independent B cell generation, WT, IL-7Rα449F and IL-7Rα-/- BM progenitor B cells should be directly compared. Since fetal B cell development has a clearly documented IL-7Rα-independent pathway that has carryover effects in young mice (up to 6 weeks of age) (26), 8-10 week old mice should be analyzed. To determine the ability of IL-7Rα449F cells to bypass the requirement for IL-7Rα signaling from B220+CD19- pro-B cells to B220+CD19+ pre-B cells, isolated BM cells should be stained for expression of B220, CD19, c-kit and CD25. Using combinations of antibodies listed in Figure 1.4 and measurements of cell size (using forward scatter quantification), each discrete step of B cell differentiation can be quantified and compared between IL-7Rα449F and IL-7Rα-/mice. Prior to pre-BCR expression, IL-7Rα is expressed and regulates survival of pro-B cells through STAT5 mediated transcription of Mcl-1 (7). In pre-B cells, Bcl-xL expression becomes primarily important for maintaining cell survival (7). We have previously documented increased expression of Bcl-2 in IL-7Rα449F progenitor B cells, but have not measured Mcl-1 and Bcl-xL expression. Interestingly, despite elevated Bcl-2 expression, IL-7Rα449F cells are more apoptotic than WT counterparts, perhaps suggesting that these proteins are not functionally redundant. Because the IL-7Rα449F mutation bypasses the pro-B cell developmental block, these mice may provide a means of determining whether IL-7Rα mediated STAT5 signaling is essential for IgH distal V region rearrangement. Sufficient numbers of CD19+c-kit+IgM- pro-B cells can be sorted from BM of 8-10 week old mice and genomic DNA analyzed for VH rearrangements. If the STAT5 signal is necessary for distal gene accessibility, it is expected that these cells will only show rearrangements at the proximal VH7183 rather than distal VHJ558 regions. In addition to follicular (FO) B cells, there are classes of B cells that have innate-like qualities, termed B1a, B1b and marginal zone (MZ) B cells. Like FO B cells, B1 cell lineages are dependent on IL-7Rα signaling and few cells are detected in the spleen and peritoneum of IL144  7Rα-/- mice (26). However, marginal zone B cell numbers are reduced only 10-fold in IL-7Rα-/mice and they constitute roughly 50% of splenic CD19+ cells. Interestingly, MZ B cell numbers are similar to WT in IL-7Rα449F mice. Maturation into B1, MZ or follicular B cells is thought to occur in the periphery following IgM expression (50). Since IL-7Rα is no longer expressed on IgM+ cells, it is unclear why IL-7Rα signaling should impact maturation into FO, MZ or B1 cells. Further, it is puzzling where these mature B cells come from in IL-7Rα-/- mice since adult BM progenitors do not differentiate past the earliest stages. It has been proposed that IL-7independent generation of MZ B cells in neonatal mice paired with their long lifespan may explain the presence of MZ cells in adult IL-7Rα-/- mice, but that FO B cell pools in adult mice require consistent replenishment that cannot occur in the absence of IL-7Rα signaling (26). To directly address the question of adult B cell progenitor capacity, BM from WT, IL7Rα449F and IL-7Rα-/- mice (>8 weeks of age) could be used in re-population assays and development of FO, MZ and B1 B cells analyzed. It is possible that IL-7Rα-/- progenitors will completely fail to generate mature B cells of any type due to the IL-7 requirement of pre-pro-B cells, but IL-7Rα449F mice can support some B cell maturation. This will provide useful insights into the potential role of IL-7 in cell fate decisions. For example, BCR signal strength is a determinant of immature B cell fate decisions resulting in maturation into FO or B1 cells due to strong signal and weaker signaling resulting in MZ B cells (51). If VHDJH recombination is affected and pre-B cell proliferation is inhibited by lack of IL-7Rα Y449, these effects may significantly alter the BCR repertoire in IL-7Rα449F mice. Together, this leads to the hypothesis that low-affinity BCRs are over-represented in IL-7Rα449F mice and that MZ B cell differentiation is favored due to weaker BCR signal transduction. This phenotypic characterization of adult B lymphopoiesis will provide information on the role of IL-7Rα signaling requirements in B cell development and function. 5.2.5  Contribution of IL-7Rα Y449 signaling to autoimmune pathology Recently, mutations in IL-7Rα and IL-2Rα have been described as highly associated  with multiple sclerosis (MS), and in IL-7Rα with anti-neutrophil cytoplasmic antibody (ANCA)associated vasculitis (AAV) and systemic lupus erythematosus (SLE), suggesting that these signaling pathways may be involved in either development or maintenance of autoimmune pathologies (36, 37, 52-54). While it is still unclear what role IL-7Rα signaling is playing, we have undertaken analysis of IL-7Rα449F mice in two models of autoimmunity; experimental 145  autoimmune encephalopathy (EAE) as a model of MS, and non-obese diabetic (NOD) mice as a model of Type I diabetes (T1D). Since IL-7Rα-/- mice lack B and T cells, these mice are protected from autoimmunity. However, there are significantly more lymphocytes in IL-7Rα449F mice, thus allowing analysis of whether these cells have autoimmune potential or if Y449dependent signals are necessary for either initial activation or maintenance of auto-reactive memory T cells. We have initiated backcrossing to generate NOD IL-7Rα449F mice to test the hypothesis that IL-7Rα Y449 signaling is important for T1D. Pancreatic destruction in NOD mice involves numerous cell types and activities, including activation and maintenance of pathological selfreactive CD4 and CD8 T cells, B cell mediated antigen presentation and progressively impaired function of regulatory CD4 T (Treg) cells. In NOD mice, the IL-7Rα449F mutation may delay onset of spontaneous diabetes development. NOD mice are lymphopenic compared to nonautoimmune reference strains and have a high frequency of proliferating T cells and an activated/memory phenotype. This led to the hypothesis that lymphopenia-induced proliferation acts as a driver for autoimmune pathology in NOD mice (55). We have shown that IL-7Rα Y449 signaling is essential for LIP. As such, disease onset may be delayed in NOD IL-7Rα449F mice due to inhibited activation of self-reactive T cells. Alternatively, fewer T cells in NOD IL7Rα449F mice may be sufficient to delay disease onset since partial lymphopenia could decrease the pool of potentially auto-reactive clones. If spontaneous disease onset is delayed in NOD IL7Rα449F mice, protective mechanisms will have to be explored. To determine whether impaired LIP impacts diabetes onset, equal numbers of NOD or NOD IL-7Rα449F T cells could be transferred into NOD SCID mice followed by monitoring CFSE dilution of the transferred cells, time to disease onset and pancreatic cell infiltrate characterization. To control for differences in generation of auto-reactive T cells in NOD and NOD IL-7Rα449F mice, cells from TCR transgenic mice with demonstrated diabetogenic potential can also be used in similar adoptive transfer models. CD4 T cells from BDC2.5 transgenic mice express an MHCII-restricted TCR specific for a pancreatic antigen and NOD 8.3 mice generate pathogenic CD8 T cells. Comparison of IL-7Rα+/+ and IL-7Rα449F NOD TCR transgenic T cells will allow more stringent analysis of potential activation deficiencies in the absence of IL-7Rα Y449. B cell deficient NOD µMT mice are protected from spontaneous diabetes development due to the requirement for B cell mediated Ag presentation. However, B cell transplant from NOD mice is sufficient to restore disease susceptibility. To address whether altered development caused by lack of IL-7Rα 146  Y449 impacts mature B cell Ag presentation, peripheral B cells from IL-7Rα+/+ and IL-7Rα449F NOD mice can be transferred into NOD µMT hosts and disease susceptibility monitored. Another important facet of diabetes in the NOD mouse is an impaired ability of Treg cells to suppress destructive T cells. Treg function has not been characterized in the IL-7Rα449F mouse. However, IL-7Rα signaling has a role in thymic development and peripheral homeostasis of these cells (56) and the absence of IL-7Rα Y449 may impair these functions. Potential functional deficiencies in Treg suppression may lower the threshold required for T cell mediated destruction. Thus, if IL-7Rα449F T cells are able to activate, even at lower frequency, this may be sufficient to cause disease. Quantification of FoxP3+ CD4 Treg cells in NOD IL-7Rα+/+ and IL7Rα449F mice can be performed by flow cytometric analysis and function addressed by in vitro suppression assays. In EAE, myelin oligodendrocyte glycoprotein (MOG) peptide is given to mice in an emulsion of complete Freund’s adjuvant (CFA) and this treatment regime reproducibly triggers an immune reaction against MOG expressing neuronal cells in C57BL/6 mice within 8-10 days. Interestingly, preliminary experiments suggest that IL-7Rα449F mice are protected from EAE development. To support this finding, EAE-induced lesions in spinal cords of WT, IL-7Rα449F and IL-7Rα-/- mice can be quantified by histological examination at defined time points. During EAE, auto-reactive T helper type 1 (TH1) and TH17 cells gain access to the spinal sheath and contribute to myelin destruction. Recently, it has been reported that IL-7 mediated STAT5 activation is essential for maintenance of pathogenic TH17 cells in human MS patients and murine EAE (57). To determine whether MOG-specific CD4 T cells are being activated and differentiating into pathogenic effectors following EAE induction in IL-7Rα449F mice, lymphocytes from spleens, draining LNs and brain and spinal cord can be stimulated in vitro with the peptide and intracellular cytokine production (IFN-γ and IL-17) assayed by flow cytometry. It will be interesting to determine if TH17 cells are generated in IL-7Rα449F mice following EAE induction and if they are capable of mediating myelin destruction. In both the NOD diabetes model and EAE induction, analyzing IL-7Rα+/- mice would provide invaluable information to determine whether partial IL-7Rα Y449 insufficiency can provide protection from autoimmune pathology. If so, this may provide relevance for targeting IL-7Rα Y449-mediated pathways as immunotherapeutics with less severe immunosuppressive side effects than current treatments afford. 147  5.3  Concluding remarks Overall, the research presented in this thesis has shown that IL-7Rα has at least two  signaling modules, one through Y449 that mediates STAT5 activation (and potentially PI3 kinase) and another that is mediated by unknown effectors. The effects of Y449-independent signaling allow for significantly more B and T cell development than can occur in the complete absence of IL-7Rα. In terms of cellular function, this mutation has deleterious effects on bone marrow progenitor B cell and peripheral memory CD8 T cell survival. It also drastically reduces the transformation susceptibility of both B and T cells. Collectively, the data presented herein demonstrate that IL-7Rα Y449 signals are integral to generation and function of the adaptive immune system, and that targeted signal ablation may prove beneficial in certain clinical settings, such as treatment of IL-7 responsive tumors, T cell mediated autoimmunity or prevention of memory T cell mediated allograft rejection.  148  5.4  References  1.  Gaffen, S.L. 2001. Signaling domains of the interleukin 2 receptor. Cytokine. 14:63-77.  2.  Pallard, C., A.P. Stegmann, T. van Kleffens, F. Smart, A. Venkitaraman and H. Spits. 1999. Distinct roles of the phosphatidylinositol 3-kinase and STAT5 pathways in IL-7-mediated development of human thymocyte precursors. Immunity. 10:525-535.  3.  Jiang, Q., W.Q. Li, R.R. Hofmeister, H.A. Young, D.R. Hodge, J.R. Keller, A.R. Khaled and S.K. Durum. 2004. Distinct regions of the interleukin-7 receptor regulate different Bcl2 family members. Mol.Cell.Biol. 24:6501-6513.  4.  Wofford, J.A., H.L. Wieman, S.R. Jacobs, Y. Zhao and J.C. Rathmell. 2008. IL-7 promotes Glut1 trafficking and glucose uptake via STAT5-mediated activation of Akt to support Tcell survival. Blood. 111:2101-2111.  5.  Yao, Z., Y. Cui, W.T. Watford, J.H. Bream, K. Yamaoka, B.D. Hissong, D. Li, S.K. Durum, Q. Jiang, A. Bhandoola, L. Hennighausen and J.J. O'Shea. 2006. Stat5a/b are essential for normal lymphoid development and differentiation. Proc.Natl.Acad.Sci.U.S.A. 103:10001005.  6.  Goetz, C.A., I.R. Harmon, J.J. O'Neil, M.A. Burchill and M.A. Farrar. 2004. STAT5 activation underlies IL7 receptor-dependent B cell development. J.Immunol. 172:4770-4778.  7.  Malin, S., S. McManus, C. Cobaleda, M. Novatchkova, A. Delogu, P. Bouillet, A. Strasser and M. Busslinger. 2009. Role of STAT5 in controlling cell survival and immunoglobulin gene recombination during pro-B cell development. Nat.Immunol. 11:171-179.  8.  Maraskovsky, E., J.J. Peschon, H. McKenna, M. Teepe and A. Strasser. 1998. Overexpression of Bcl-2 does not rescue impaired B lymphopoiesis in IL-7 receptordeficient mice but can enhance survival of mature B cells. Int.Immunol. 10:1367-1375.  9.  Oliver, P.M., M. Wang, Y. Zhu, J. White, J. Kappler and P. Marrack. 2004. Loss of Bim allows precursor B cell survival but not precursor B cell differentiation in the absence of interleukin 7. J.Exp.Med. 200:1179-1187.  10. Ye, S.K., Y. Agata, H.C. Lee, H. Kurooka, T. Kitamura, A. Shimizu, T. Honjo and K. Ikuta. 2001. The IL-7 receptor controls the accessibility of the TCRgamma locus by Stat5 and histone acetylation. Immunity. 15:813-823. 11. Reif, K., K. Okkenhaug, T. Sasaki, J.M. Penninger, B. Vanhaesebroeck and J.G. Cyster. 2004. Cutting edge: differential roles for phosphoinositide 3-kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J.Immunol. 173:2236-2240. 12. Okkenhaug, K. and B. Vanhaesebroeck. 2003. PI3K in lymphocyte development, differentiation and activation. Nat.Rev.Immunol. 3:317-330. 13. Allman, D., A. Sambandam, S. Kim, J.P. Miller, A. Pagan, D. Well, A. Meraz and A. Bhandoola. 2003. Thymopoiesis independent of common lymphoid progenitors. Nat.Immunol. 4:168-174. 14. Zlotoff, D.A., A. Sambandam, T.D. Logan, J.J. Bell, B.A. Schwarz and A. Bhandoola. 2010. CCR7 and CCR9 together recruit hematopoietic progenitors to the adult thymus. Blood. 115:1897-1905. 15. Bell, J.J. and A. Bhandoola. 2008. The earliest thymic progenitors for T cells possess myeloid lineage potential. Nature. 452:764-767. 149  16. Krueger, A. and H. von Boehmer. 2007. Identification of a T lineage-committed progenitor in adult blood. Immunity. 26:105-116. 17. Burchill, M.A., C.A. Goetz, M. Prlic, J.J. O'Neil, I.R. Harmon, S.J. Bensinger, L.A. Turka, P. Brennan, S.C. Jameson and M.A. Farrar. 2003. Distinct effects of STAT5 activation on CD4+ and CD8+ T cell homeostasis: development of CD4+CD25+ regulatory T cells versus CD8+ memory T cells. J.Immunol. 171:5853-5864. 18. Seddon, B. and R. Zamoyska. 2002. TCR and IL-7 receptor signals can operate independently or synergize to promote lymphopenia-induced expansion of naive T cells. J.Immunol. 169:3752-3759. 19. Schluns, K.S., W.C. Kieper, S.C. Jameson and L. Lefrancois. 2000. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat.Immunol. 1:426-432. 20. Tan, J.T., B. Ernst, W.C. Kieper, E. LeRoy, J. Sprent and C.D. Surh. 2002. Interleukin (IL)15 and IL-7 jointly regulate homeostatic proliferation of memory phenotype CD8+ cells but are not required for memory phenotype CD4+ cells. J.Exp.Med. 195:1523-1532. 21. Jacobs, S.R., R.D. Michalek and J.C. Rathmell. 2010. IL-7 Is Essential for Homeostatic Control of T Cell Metabolism In Vivo. J.Immunol. 184:3461-3469. 22. Rathmell, J.C., E.A. Farkash, W. Gao and C.B. Thompson. 2001. IL-7 enhances the survival and maintains the size of naive T cells. J.Immunol. 167:6869-6876. 23. Chehtane, M. and A.R. Khaled. 2010. Interleukin-7 Mediates Glucose Utilization in Lymphocytes through Transcriptional Regulation of the Hexokinase II Gene. Am. J. Physiol., Cell Physiol. 298:C1560-C1571. 24. Kikuchi, K., H. Kasai, A. Watanabe, A.Y. Lai and M. Kondo. 2008. IL-7 specifies B cell fate at the common lymphoid progenitor to pre-proB transition stage by maintaining early B cell factor expression. J.Immunol. 181:383-392. 25. Miller, J.P., D. Izon, W. DeMuth, R. Gerstein, A. Bhandoola and D. Allman. 2002. The earliest step in B lineage differentiation from common lymphoid progenitors is critically dependent upon interleukin 7. J.Exp.Med. 196:705-711. 26. Erlandsson, L., S. Licence, F. Gaspal, S. Bell, P. Lane, A.E. Corcoran and I.L. Mårtensson. 2004. Impaired B-1 and B-2 B cell development and atypical splenic B cell structures in IL7 receptor-deficient mice. Eur.J.Immunol. 34:3595-3603. 27. Morrow, M.A., G. Lee, S. Gillis, G.D. Yancopoulos and F.W. Alt. 1992. Interleukin-7 induces N-myc and c-myc expression in normal precursor B lymphocytes. Genes Dev. 6:6170. 28. Katayama, Y., M. Sekai, M. Hattori, I. Miyoshi, Y. Hamazaki and N. Minato. 2009. Rap signaling is crucial for the competence of IL-7 response and the development of B-lineage cells. Blood. 114:1768-1775. 29. MacIver, N.J., S.R. Jacobs, H.L. Wieman, J.A. Wofford, J.L. Coloff and J.C. Rathmell. 2008. Glucose metabolism in lymphocytes is a regulated process with significant effects on immune cell function and survival. J.Leukoc.Biol. 84:949-957. 30. Zhao, Y., J.L. Coloff, E.C. Ferguson, S.R. Jacobs, K. Cui and J.C. Rathmell. 2008. Glucose metabolism attenuates p53 and Puma-dependent cell death upon growth factor deprivation. J.Biol.Chem. 283:36344-36353. 150  31. Zhao, Y., B.J. Altman, J.L. Coloff, C.E. Herman, S.R. Jacobs, H.L. Wieman, J.A. Wofford, L.N. Dimascio, O. Ilkayeva, A. Kelekar, T. Reya and J.C. Rathmell. 2007. Glycogen Synthase Kinase 3 {alpha} and 3 {beta} Mediate a Glucose-Sensitive Antiapoptotic Signaling Pathway To Stabilize Mcl-1. Mol.Cell.Biol. 27:4328-4339. 32. Garrison, S.P., J.R. Jeffers, C. Yang, J.A. Nilsson, M.A. Hall, J.E. Rehg, W. Yue, J. Yu, L. Zhang, M. Onciu, J.T. Sample, J.L. Cleveland and G.P. Zambetti. 2008. Selection Against PUMA Gene Expression in Myc-Driven B Cell Lymphomagenesis. Mol.Cell.Biol. 28:53915402. 33. Rosenberg, S.A., C. Sportes, M. Ahmadzadeh, T.J. Fry, L.T. Ngo, S.L. Schwarz, M. StetlerStevenson, K.E. Morton, S.A. Mavroukakis, M. Morre, R. Buffet, C.L. Mackall and R.E. Gress. 2006. IL-7 administration to humans leads to expansion of CD8+ and CD4+ cells but a relative decrease of CD4+ T-regulatory cells. J.Immunother. 29:313-319. 34. Sportes, C., R.R. Babb, M.C. Krumlauf, F.T. Hakim, S.M. Steinberg, C.K. Chow, M.R. Brown, T.A. Fleisher, P. Noel, I. Maric, M. Stetler-Stevenson, J. Engel, R. Buffet, M. Morre, R.J. Amato, A. Pecora, C.L. Mackall and R.E. Gress. 2010. Phase I study of recombinant human interleukin-7 administration in subjects with refractory malignancy. Clin.Cancer Res. 16:727-735. 35. Swainson, L., S. Kinet, C. Mongellaz, M. Sourisseau, T. Henriques and N. Taylor. 2007. IL7-induced proliferation of recent thymic emigrants requires activation of the PI3K pathway. Blood. 109:1034-1042. 36. Lundmark, F., K. Duvefelt, E. Iacobaeus, I. Kockum, E. Wallström, M. Khademi, A. Oturai, L.P. Ryder, J. Saarela, H.F. Harbo, E.G. Celius, H. Salter, T. Olsson and J. Hillert. 2007. Variation in interleukin 7 receptor α chain (IL7R) influences risk of multiple sclerosis. Nat.Genet. 39:1108-1113. 37. Gregory, S.G., S. Schmidt, P. Seth, J.R. Oksenberg, J. Hart, A. Prokop, S.J. Caillier, M. Ban, A. Goris, L.F. Barcellos, R. Lincoln, J.L. McCauley, S.J. Sawcer, D.A.S. Compston, B. Dubois, S.L. Hauser, M.A. Garcia-Blanco, M.A. Pericak-Vance and Haines, J.L. for for the Multiple Sclerosis Genetics Group. 2007. Interleukin 7 receptor α chain (IL7R) shows allelic and functional association with multiple sclerosis. Nat.Genet. 39:1083-1091. 38. Adolfsson, J., R. Mansson, N. Buza-Vidas, A. Hultquist, K. Liuba, C.T. Jensen, D. Bryder, L. Yang, O.J. Borge, L.A. Thoren, K. Anderson, E. Sitnicka, Y. Sasaki, M. Sigvardsson and S.E. Jacobsen. 2005. Identification of Flt3+ lympho-myeloid stem cells lacking erythromegakaryocytic potential a revised road map for adult blood lineage commitment. Cell. 121:295-306. 39. Gossens, K., S. Naus, S.Y. Corbel, S. Lin, F. Rossi, J. Kast and H.J. Ziltener. 2009. Thymic progenitor homing and lymphocyte homeostasis are linked via S1P-controlled expression of thymic P-selectin/CCL25. J.Exp.Med. 206:761-768. 40. Rossi, F.M.V., S.Y. Corbel, J.S. Merzaban, D.A. Carlow, K. Gossens, J. Duenas, L. So, L. Yi and H.J. Ziltener. 2005. Recruitment of adult thymic progenitors is regulated by Pselectin and its ligand PSGL-1. Nat.Immunol. 6:626-634. 41. Krueger, A., S. Willenzon, M. Lyszkiewicz, E. Kremmer and R. Förster. 2010. CC chemokine receptor 7 and 9 double-deficient hematopoietic progenitors are severely impaired in seeding the adult thymus. Blood. 115:1906-1912. 151  42. Barnden, M.J., J. Allison, W.R. Heath and F.R. Carbone. 1998. Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol.Cell Biol. 76:34-40. 43. Robertson, J.M., P.E. Jensen and B.D. Evavold. 2000. DO11.10 and OT-II T cells recognize a C-terminal ovalbumin 323-339 epitope. J.Immunol. 164:4706-4712. 44. Seddon, B., P. Tomlinson and R. Zamoyska. 2003. Interleukin 7 and T cell receptor signals regulate homeostasis of CD4 memory cells. Nat.Immunol. 4:680-686. 45. Kondrack, R.M., J. Harbertson, J.T. Tan, M.E. McBreen, C.D. Surh and L.M. Bradley. 2003. Interleukin 7 regulates the survival and generation of memory CD4 cells. J.Exp.Med. 198:1797-1806. 46. Lenz, D.C., S.K. Kurz, E. Lemmens, S.P. Schoenberger, J. Sprent, M.B. Oldstone and D. Homann. 2004. IL-7 regulates basal homeostatic proliferation of antiviral CD4+T cell memory. Proc.Natl.Acad.Sci.U.S.A. 101:9357-9362. 47. Li, J., G. Huston and S.L. Swain. 2003. IL-7 promotes the transition of CD4 effectors to persistent memory cells. J.Exp.Med. 198:1807-1815. 48. Purton, J.F., J.T. Tan, M.P. Rubinstein, D.M. Kim, J. Sprent and C.D. Surh. 2007. Antiviral CD4+ memory T cells are IL-15 dependent. J.Exp.Med. 204:951-961. 49. Haining, W.N., B.L. Ebert, A. Subrmanian, E.J. Wherry, Q. Eichbaum, J.W. Evans, R. Mak, S. Rivoli, J. Pretz, J. Angelosanto, J.S. Smutko, B.D. Walker, S.M. Kaech, R. Ahmed, L.M. Nadler and T.R. Golub. 2008. Identification of an evolutionarily conserved transcriptional signature of CD8 memory differentiation that is shared by T and B cells. J.Immunol. 181:1859-1868. 50. LeBien, T.W. and T.F. Tedder. 2008. B lymphocytes: how they develop and function. Blood. 112:1570-1580. 51. Pillai, S. and A. Cariappa. 2009. The follicular versus marginal zone B lymphocyte cell fate decision. Nat Rev Immunol. 9:767-777. 52. Rane, L., N. Vudattu, K. Bourcier, E. Graniar, J. Hillert, V. Seyfert and M.J. Maeurer. 2010. Alternative splicing of interleukin-7 (IL-7) and interleukin-7 receptor alpha (IL-7Rα) in peripheral blood from patients with multiple sclerosis (MS). J.Neuroimmunol. 222:82-86. 53. Svejgaard, A. 2008. The immunogenetics of multiple sclerosis. Immunogenetics. 60:275286. 54. McKinney, E.F., P.A. Lyons, E.J. Carr, J.L. Hollis, D.R.W. Jayne, L.C. Willcocks, M. Koukoulaki, A. Brazma, V. Jovanovic, D.M. Kemeny, A.J. Pollard, P.A. Macary, A.N. Chaudhry and K.G. Smith. 2010. A CD8 T cell transcription signature predicts prognosis in autoimmune disease. Nat.Med. 16:586-591. 55. King, C., A. Ilic, K. Koelsch and N. Sarvetnick. 2004. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell. 117:265-277. 56. Bayer, A.L., J.Y. Lee, A. de la Barrera, C.D. Surh and T.R. Malek. 2008. A function for IL7R for CD4+CD25+Foxp3+ T regulatory cells. J.Immunol. 181:225-234. 57. Liu, X., S. Leung, C. Wang, Z. Tan, J. Wang, T.B. Guo, L. Fang, Y. Zhao, B. Wan, X. Qin, L. Lu, R. Li, H. Pan, M. Song, A. Liu, J. Hong, H. Lu and J.Z. Zhang. 2010. Crucial role of 152  interleukin-7 in T helper type 17 survival and expansion in autoimmune disease. Nat.Med. 16:191-197.  153  Appendix A  
  154
  A.1  Objective The results obtained from infecting WT and IL-7Rα449F mice with recombinant Listeria  monocytogenes expressing the SIYYRGL (rLM-SIY) demonstrated an intact CD8 primary T cell response but impaired maintenance of memory CD8 T cells in the absence of IL-7Rα Y449 signaling. To further elaborate on these findings, we generated OT-I; IL-7Rα449F mice that develop CD8 T cells of monospecificity to an ovalbumin peptide (OVA257-264) presented by MHCI (H2 Kb). Analysis of WT and IL-7Rα449F OT-I CD8 T cells in response to Listeria monocytogenes expressing ovalbumin (rLM-OVA) infection allows for more simplified comparisons of easily retrievable cell types.  
  155
  A.2  Preliminary results To determine the role of IL-7Rα Y449 signaling in CD8 memory T cell generation and  maintenance, CD8 T cells were purified from WT and IL-7Rα449F OT-1 mice (CD45.2+) and 104 live cells transferred i.v. into WT congenic (CD45.1+) host mice. The following day, OTI/CD45.1+ chimeric mice were infected i.v. with 103 cfu rLM-OVA (see Figure A.1.a). At designated time points following infection (5 – 45 days), Ag-specific WT or IL-7Rα449F OT-I CD8 T cells were quantified from host spleens. Similar to our previous analysis, IL-7Rα449F OTI CD8 T cells expanded in response to LM-OVA infection, although in this analysis there were fewer recovered cells than WT OT-I CD8 T cells (Figure A.1.b, c). The kinetics of the CD8 T cell response were followed throughout the infection and revealed that although IL-7Rα449F CD8 T cells expanded in response to rLM-OVA, clonal expansion was impaired compared to WT from days 5 -11 post-infection and this resulted in a severe memory defect (Figure A.1.b). Phenotypic characteristics of recovered OT-I CD8 T cells were analyzed during the immune response. At early time points (days 5, 8 and 11), there were minimal differences in expression of activation markers CD25 and CD69, differentiation markers CD44, CD62L, KLRG1 and CD127 or survival protein Bcl-2 (Figure A.1.c, d). However, at memory stage (day 45 postinfection), the phenotypic characteristics of IL-7Rα449F OT-I cells were quite different than those of WT OT-I cells. IL-7Rα449F OT-I cells expressed had higher KLRG1 surface expression (Figure A.1.d) and the ratio of effector memory (CD44hi CD62Llo) to central memory (CD44hi CD62Lhi) populations was reversed compared to WT OT-I cells (Figure A.1.c). Furthermore, the level of Bcl-2 was lower in the recovered OT-I IL-7Rα449F T cells. Together, this data suggests that IL-7Rα Y449 is essential for long-term survival and maintenance of protective central memory CD8 T cells. However, this data must be interpreted with caution. Not all CD45.1/OT-I chimeric mice showed optimal OT-I T cell responses, perhaps due to sub-optimal transfer of either OT-I T cells or rLM-OVA infection. Evidence of mouse-to-mouse variation was especially evident at memory stages since the recovery of WT OT-I T cells varied from <0.1% to 1% of total lymphocytes (data not shown). Furthermore, the low frequency of OT-I cells recovered from CD45.1/IL-7Rα449F OT-I chimeric mice decreased the number of cells available for analysis at this time point. Thus, future experiments of this kind would benefit from analyzing more mice at this time point and collecting a greater number of events during flow cytometric analysis to ensure a reliable data set. However, it is not recommended to increase the number of OT-I T 
  156
  cells originally transferred as it has previously been shown that increasing the number of antigen specific T cell clones during the initial response negatively affects memory T cell generation. In vitro analysis of T cell responses can provide information regarding ability to respond to TCR signals. Purified CD8 T cells from WT and IL-7Rα449F OT-I mice were CFSE labeled and plated in vitro with serially diluted concentrations of OVA257-264. After 3 days, TCR-driven proliferation was determined by CFSE dilution. When a similar experiment was performed on polyclonal T cells from WT and IL-7Rα449F mice, it revealed that IL-7Rα449F T cells were unable to respond as well as WT cells at lower concentrations of α-CD3 stimulation (see Figure 2.8). Interestingly, at all stimulation concentrations, both WT and IL-7Rα449F T cells diluted CFSE to similar extent (Figure A.2.a), but far fewer IL-7Rα449F cells were recovered than WT cells (Figure A.2.b). This indicates that IL-7Rα Y449 signaling is necessary for in vitro CD8 T cell survival, but not TCR-driven proliferation. Impaired survival could contribute to the in vivo defect since cellular activation and differentiation markers appear similar between WT and IL7Rα449F but fewer IL-7Rα449F cells were recovered at each time-point following infection. Importantly, the cell intrinsic defects have a significant impact on long-term survival of memory T cells. Consistent with our previous analysis of polyclonal WT and IL-7Rα449F T cells, Bcl-2 expression levels are not significantly decreased in IL-7Rα449F OT-I T cells throughout the infection. Together, this data suggests that IL-7Rα provides critical survival signals to T cells and that the absence of those survival signals in naïve T cells affects their ability to mount an optimal response even upon initiation of TCR signaling.  
  157
  A.3  Summary and future directions These results extend the finding that IL-7Rα449F CD8 T cells can undergo clonal  expansion in response to cognate antigen but have a cell intrinsic survival defect that impairs memory T cell maintenance. Further work in this area could include analysis of primary CD8 T cell function and the molecular requirements for long-term survival. In vitro cytotoxic T lymphocyte (CTL) assays and determination of granzyme B and IL-2 production of WT and IL7Rα449F OT-I CD8 T cells will provide information regarding whether or not IL-7Rα signaling affects differentiation and function of CD8 effector T cells. To determine the IL-7Rα Y449initiated signals necessary for long-term CD8 T cell survival, proteomic analysis of effectors at the peak of response and/or at memory stages could be performed as outlined in Section 5.2.3. In addition, the effect of abrogated IL-7Rα Y449 signaling on recall responses remains an open question. In early experiments, IL-7Rα449F mice failed to provide protective immunity upon rechallenge with a virulent LM strain expressing LCMV gp61 peptide (data not shown). Using the OT-I/CD45.1 chimeric mouse system, equal numbers of WT and IL-7Rα449F OT-I T cells could be recovered from CD45.1+ host mice at memory stages and transplanted to naïve CD45.1+ hosts. Challenging these mice with rLM-OVA would then allow determination of whether reactivation and function of IL-7Rα449F memory T cells is compromised or if the defect is limited to cell survival.  
  158
  Figure A.1  Figure A.1  IL-7Rα Y449 signaling promotes optimal CD8 memory T cell generation and  differentiation (a) 104 WT and IL-7Rα449F OT-I CD8 T cells were purified and transferred i.v. to CD45.1+ host mice. The following day 103 cfu of rLM-OVA were transferred i.v. to the OT-I/CD45.1+ chimeric mice. (b) Quantification of recovered OT-I and IL-7Rα449F OT-I CD8 T cells (CD45.1CD45.2+ CD8+ TCR Vα2+) at various time points post-infection. (c, d) Phenotypic comparison of WT and IL-7Rα449F OT-I T cells throughout infection. Experiment has been performed once with 3-4 mice per group at each time point.  
  159
  Figure A.2  Figure A.2  In vitro activation of OT-I cells requires IL-7Rα Y449 signaling for survival,  but not proliferation CD8 T cells from WT or IL-7Rα449F OT-I mice were purified, CFSE labeled and plated in triplicate in a 96-well flat-bottom plate (2x105 cells/well). CD45.1+ splenocytes were treated with serially diluted concentrations of OVA257-264 peptide and added to each well to act as a population of antigen presenting cells (2x105 cells/well). After 3 days of culture, cells were analyzed by flow cytometry for CFSE dilution. Flow cytometry plots shown in (a) demonstrate that IL-7Rα449F OT-I T cells dilute CFSE similar to WT OT-I CD8 T cells. However, plots shown in (b) demonstrate that fewer IL-7Rα449F OT-I T cells were recovered per well. Flow cytometry plots shown are gated on CD45.2+ CD8+ T cells. Experiment was performed twice.  
  160
  Appendix B  
  161
  B.1  Objective Infection of IL-7Rα449F mice with rLM-SIY resulted in a reproducible defect in the  primary CD4 T cell response to the MHCII-restricted native listeriolysin O (LLO) peptide. To determine the molecular basis of this defect, IL-7Rα449F mice were crossed with OT-II TCR transgenic mice that generate CD4 T cells specific for an ovalbumin peptide (OVA323-339) presented by MHCII I-Ab. Analysis of this defined population removes variables such as potential differences in TCR repertoire between WT and IL-7Rα449F polyclonal mice. In addition, this model provides a simple system for detection of Ag-specific T cells based on expression of the transgenic TCR (detected by surface expression of the congenic marker CD45.2 and TCR Vα2).  
  162
  B.2  Preliminary results To determine the effect of the IL-7Rα449F mutation on T cell development in the presence  of the OT-II TCR transgene, thymus and spleen from WT and IL-7Rα449F transgenic and nontransgenic mice were analyzed. In keeping with a critical role for IL-7Rα Y449 signaling in early T cell development, thymocyte and peripheral T cell counts were reduced in IL-7Rα449F and OT-II IL-7Rα449F mice (Figure B.1.a). However, thymocyte and T cell differentiation was similar between WT and IL-7Rα449F mice with an accumulation of CD4 T cells (data not shown and Figure B.1.b). Phenotypic analysis of splenic CD4 T cells from IL-7Rα WT and mutant OTII TCR transgenic mice revealed that the IL-7Rα449F mutation did not significantly affect T cell differentiation, maturation or activation. The subsets of naïve, central and effector memory phenotype cells were slightly altered between WT and IL-7Rα449F mice, with less naïve (CD44lo) and an accumulation of effector memory phenotype (CD44hiCD62Llo) T cells in IL-7Rα449F mice (Figure B.1.c) but no significant difference in expression of the TCR Vα2 chain that is utilized by the OT-II transgene (Figure B.1.d). Further analysis of CD5, CD25 and CD69 suggested that the IL-7Rα449F mutation did not severely impact CD4 T cell differentiation (Figure B.1.d). These results confirmed that these cell types could be used to determine the requirement for IL-7Rα Y449 signaling in CD4 T cell responses, but suggest that it may be prudent to isolate CD44lo T cells for comparison. In order to determine whether OT-II T cells require IL-7Rα Y449 for clonal expansion, CD4 T cells were isolated from spleens and lymph nodes (LNs) of WT and IL-7Rα449F OT-II mice (CD45.2+) and transferred i.v. into WT congenic (CD45.1+) hosts. Infection of OTII/CD45.1 chimeric mice with a recombinant Listeria monocytogenes strain expressing ovalbumin (rLM-OVA) did not elicit a significant OT-II T cell response as measured by detection of CD45.2+ TCR Vα2+ T cells (Figure B.2). Thus, we utilized a previously published system where peptide-loaded bone marrow (BM) derived dendritic cells (DCs) were used as antigen presenting cells (APCs). BMDCs were generated by culturing BM cells (without red blood cell depletion) in the presence of 20 ng/ml GM-CSF for 8 days, then activated and loaded by addition of 1 µg/ml LPS and 1 µg/ml OVA323-339 for an additional 24 hour culture period. To test the response of OT-II T cells to OVA-loaded BMDCs in vivo, WT OT-II CD4 T cells were transferred i.v. to CD45.1+ congenic hosts and OVA-BMDCs transferred i.v. 24 hours later. The primary CD4 T cell response was much more robust than that achieved by parallel rLM-OVA infection (Figure B.2) and was used as the infection system for further experiments. 
  163
  To determine whether the IL-7Rα449F mutation had a significant impact on OT-II CD4 T cell responses, WT and IL-7Rα449F OT-II cells were transferred to CD45.1+ hosts and the chimeric mice were challenged with OVA-BMDCs the following day. Seven days post-infection, the number of splenic OT-II CD4 T cells was quantified by flow cytometry. This revealed that, similar to rLM-SIY infection of polyclonal mice, the IL-7Rα449F mutation abrogated a primary CD4 T cell response (Figure B.3.a). This suggested that the LLO-specific defect we previously noted was not due to a repertoire deficiency but instead that CD4 T cells require IL-7Rα Y449mediated signals in the acute response stage. Recovered cells were analyzed for a number of phenotypic markers. At this stage, both WT and IL-7Rα449F OT-II cells had down-regulated the early activation markers CD25 and CD69 and expressed similarly low amounts of PD-1, a marker of ‘exhaustion’ in CD8 T cells that may indicate poorly fit effector T cells (Figure B.3.b). KLRG1 surface expression negatively correlates with memory precursor potential in CD8 T cell responses, but is less well characterized in CD4 T cells. Expression on WT and IL-7Rα449F OT-II T cells at day 7 post-BMDC challenge was inconclusive (data not shown). Thus, this system recapitulates the in vivo requirement for IL-7Rα Y449 signaling that we reported in polyclonal IL-7Rα449F mice responding to rLM-SIY. An additional benefit that arose from use of the BMDC-OVA challenge model was the possibility of formally testing the activating and presenting capacity of WT and IL-7Rα449F APCs. In our original report, the possibility of host differences in terms of antigen presentation and cytokine production may have contributed to the difference in T cell responses. To test this hypothesis, we generated WT and IL-7Rα449F BMDCs and loaded them with OVA323-339. Prior to in vivo comparison of how these cells function, the phenotype of BMDCs generated from WT and IL-7Rα449F bone marrow was compared and found to be similar (data not shown). For in vivo analysis of WT and IL-7Rα449F BMDC function, the expansion and differentiation of WT OT-II T cells in CD45.1/OT-II chimeric mice was quantified. Similar numbers of OT-II T cells were recovered from the spleens and lymph nodes of mice challenged with either WT or IL7Rα449F OVA-loaded BMDCs (Figure B.4.a, data not shown). Expression of CD44, CD25, CD69, KLRG1 and CD127 was similar on recovered OT-II cells challenged with either WT or IL-7Rα449F OVA-loaded BMDCs. Thus, antigen presentation is not altered by the IL-7Rα449F mutation, further suggesting that the differences in T cell responses are caused by cell intrinsic defects.  
  164
  Having determined that antigen presentation was not the source of defective CD4 T cell responses in IL-7Rα449F mice and acknowledging the possibility that IL-7Rα449F CD4 T cells are at a competitive disadvantage in vivo, we tested the cell intrinsic capacity of WT and IL-7Rα449F OT-II CD4 T cells to generate antigenic responses in vitro. This removes the requirement for cytokine-mediated homeostasis of the T cells prior to activation, and ensures sufficient access for T cell activation. WT and IL-7Rα449F OT-II CD4 T cells were purified, CFSE labeled and plated with equal amounts of OVA loaded BMDCs and cultured for 4 days. T cell proliferation and activation were analyzed by CFSE dilution and expression of differentiation markers, respectively. In two individual trials, IL-7Rα449F OT-II CD4 T cells displayed no defect in antigen driven proliferation or differentiation, as marked by expression of CD44 on proliferating (CFSE diluting) cells (Figure B.5.a, c). This is in contrast to what we previously saw in T cells purified from polyclonal IL-7Rα449F mice where TCR signaling was triggered by treatment with agonistic CD3/CD28 antibodies. The reason for this difference is currently unknown, but may be a result of TCR normalization. Further tests to confirm that the IL-7Rα449F defect is restored by transgenic TCR expression could include titrating down the number of antigen presenting cells, as the set-up tested may not have reached the minimal signaling threshold that was required to see the difference in polyclonal T cells. This could also be addressed by repeating the α-CD3/αCD28 experimental set-up. Interestingly, analysis of IL-7 overexpressing OT-II (transgenic [Tg] IL-7 OT-II) T cells show minimal differences in proliferation or differentiation compared to WT (Figure B.5.b, c), further confirming that, at the doses tested, IL-7 does not play a key role in CD4 T cell activation in vitro. The ability to generate effector T cells with similar activation histories may allow analysis of the role of IL-7 and IL-7Rα Y449 signaling in generating and/or maintaining memory CD4 T cells. In vitro activated WT, IL-7Rα449F and Tg IL-7 OT-II T cells could be transplanted to CD45.1+ congenic hosts and cell recovery monitored over time. If IL-7Rα Y449 signals are necessary for long-term maintenance, the numbers of IL-7Rα449F OT-II T cells will decrease relative to WT OT-II cells. In contrast, if IL-7 plays a supportive role for CD4 memory maintenance, the numbers would be elevated compared to WT. The requirement for survival and/or homeostatic proliferation could then be queried. Thus, although the system would be manipulated, it could provide insight into the role of this cytokine and its essential signaling pathways in maintenance of this important cell type.  
  165
  B.3  Summary and future directions This set of preliminary data clearly demonstrates that CD4 T cells require intact IL-7Rα  signaling in order to generate a primary immune response. The mechanisms for this are unclear, but may be linked to a requirement for IL-7Rα signaling to maintain a baseline of glucose metabolism to allow the necessary burst of glycolysis for clonal expansion. The signaling pathways downstream of TCR and IL-7Rα converge at activation of the PI3 kinase pathway and the IL-7Rα449F mutation may interrupt a required synergy from this convergent point to support T cell expansion. To determine whether CD4 T cell responses have an acute requirement for IL7Rα signaling, as opposed to the defect in IL-7Rα449F CD4 T cells arising from altered development, mice or OT-II cells could be treated with function blocking IL-7Rα antibody. A preliminary experiment where CD45.1+/OT-II chimeric mice were treated with α-IL-7Rα provided inconclusive results and should be repeated. Further, the cytokine production profile of recovered WT and IL-7Rα449F OT-II T cells has not been determined. It should be verified that the LPS activated BMDCs are initiating a similar Th1 profile in both WT and IL-7Rα449F OT-II responding cells. This data provides evidence that CD4 T cells rely on IL-7Rα signaling for some important element of activation in vivo, and that the defect in CD4 T cell primary responses we noted following rLM-SIY infection was not simply due to a defect in the IL7Rα449F TCR repertoire. Interestingly, the IL-7Rα necessity can be overcome in vitro, possibly by providing supraphysiological TCR signals that can bypass the need for synergistic cytokine signals in vivo. The molecular basis for this remains unknown, and determination of this mechanism should be a focus of future study.  
  166
  Figure B.1  IL-7Rα 449F mutation does not cause gross differentiation defects of OT-II  TCR transgenic T cells (a) Quantification of thymocytes and splenic T cells from WT and IL-7Rα449F OT-II mice. Data is representative of three experiments, n=3-4 each. (b-d) Phenotypic analysis of WT and IL7Rα449F OT-II peripheral T cells. (b) Expression of the OT-II TCR transgene causes overrepresentation of CD4 T cells in the periphery. Flow cytometry plots are gated on live CD3+ cells. (c) Representation of differentiation states (naïve, CD44lo; central memory phenotype, CD44hiCD62Lhi; effector memory phenotype, CD44hiCD62Llo) of splenic CD4+ T cells taken from uninfected WT and IL-7Rα449F OT-II mice. Significant differences in the percentage of naïve and effector memory phenotype populations were noted in 2 of 3 analyses. (d) Comparison of TCR associated molecules (TCR Vα2 and CD5) and activation markers (CD25, CD69) on CD4+ T cells from naïve WT and IL-7Rα449F OT-II mice.  
  167
  Figure B.1  
  168
  Figure B.2  Figure B.2  Bone Marrow Derived Dendritic Cells (BMDCs) provide better stimulation  of OT-II T cells than Listeria-OVA infection OT-II T cell activation was tested in response to either rLM-OVA infection or challenge with OVA323-339-loaded BMDCs. 3x106 purified OT-II CD4 T cells (CD45.2+) were transferred i.v. into CD45.1+ mice. 24 hours later OT-II/CD45.1+ chimeric mice were either infected with 103 cfu rLM-OVA or challenged with 2x106 OVA323-339-loaded BMDCs (both administered i.v.). One week later, spleens of OT-II/CD45.1+ chimeric mice were analyzed for the presence of OTII cells (CD45.2+ CD45.1-) (left and middle panels). Quantification of the recovered OT-II cells on the right. Experiment was performed once with 2 mice per group.  
  169
  Figure B.3  Figure B.3  IL-7Rα 449F mutation hinders OT-II T cell responses to OVA323-339-loaded  BMDC challenge WT and IL-7Rα449F OT-II CD4 T cells were purified and transferred i.v. to CD45.1+ host mice. The following day OVA323-339-loaded BMDCs were transferred i.v. to the OT-II/CD45.1+ chimeric mice. (a) One week post-challenge, spleens were harvested and the recovery of CD45.2+ CD4+ (or CD45.2+ TCR Vα2+) was quantified. As a control, a group of WT OT-II/ CD45.1+ chimeric mice was left unchallenged (OT-II –BMDCs). (b) WT and IL-7Rα449F OT-II T cells were analyzed for expression of CD25, CD69 and PD-1. Experiment has been performed once with 3 mice per group.  
  170
  Figure B.4  Figure B.4  IL-7Rα 449F mutation does not affect antigen presentation or activation  capacity of BMDCs WT and IL-7Rα449F bone marrow was plated in the presence of 20 ng/ml GM-CSF for 8 days to generate CD11b+CD11c+ BMDCs (WT and IL-7Rα449F BMDCs have similar maturation profiles and result in similar cell recovery after culture, data not shown. Experiment was performed twice with a single donor per experiment). After the 8 days, BMDCs were activated with LPS, IL-4 and loaded with OVA323-339 peptide for an additional 24 hours. To test the in vivo ability of these cells to activate OT-II T cells, 3x106 WT and IL-7Rα449F BMDCs were transferred i.v. into OTII/CD45.1+ chimeric mice. One week post-challenge, spleens were harvested and the number (a) and phenotype (b) of the recovered OT-II T cells determined. Experiment was performed twice with similar results, 3 mice per group.  
  171
  Figure B.5  Figure B.5 In vitro activation of OT-II cells is independent of IL-7 or IL-7Rα Y449 CD4 T cells from WT, IL-7Rα449F (a) or Tg IL-7 (b) OT-II mice were purified, CFSE labeled and plated in triplicate in a 96-well flat-bottom plate (2x105 cells/well). CD45.1+ splenocytes were treated with serially diluted concentrations of OVA323-339 peptide and added to each well to act as a population of antigen presenting cells (2x105 cells/well). After 4 days of culture, cells were analyzed by flow cytometry for CFSE dilution (a,b) and CD44 expression (c) . Flow cytometry plots shown are gated on CD45.1- CD45.2+ CD4+ T cells. Experiment was performed three times for WT and IL-7Rα449F OT-II cells, and once for Tg IL-7 OT-II cells.  
  172
  Appendix C  
  173
  C.1  Objective Mature B cells can be separated into a number of different subsets based on cell surface  phenotype and function. Classical adaptive B cells (B2) can respond to a vast array of antigenic insults due to their diverse array of B cell receptors (BCRs). These cells circulate throughout the body, participate in T-dependent humoral responses and can be recruited to tissue-specific sites of infection in response to chemokine gradients. In contrast, innate-like B cells have more limited BCR diversity, are tissue-restricted and can be activated independent of T cell help. Marginal zone B cells are non-circulating cells located within the splenic marginal zone where they act as sentinels for rapid detection of a number of systemic infections. B1 cells are primarily located in the peritoneal cavity, with small numbers found in the spleen and they demonstrate preferential recognition of bacterial polysaccharides and self-antigens. Since B cell development in adult bone marrow requires IL-7Rα signaling and IL-7Rα449F mice have a partial block at the pre-B cell differentiation stage, we aimed to determine what impact the IL-7Rα449F mutation would have on differentiation of mature B cell subsets.  
  174
  C.2  Preliminary results We used flow cytometry to characterize mature B cells in spleens and the peritoneal  cavity of mice. To determine the role of IL-7Rα signaling, we analyzed differentiation of IL7Rα449F and IL-7Rα-/- mice. To determine the impact of IL-7 on B cell differentiation, Tg IL-7 mice were also analyzed. As we previously reported, B cell numbers (total CD19+ splenocytes) were decreased in IL-7Rα449F and IL-7Rα-/- mice (data not shown). Further subsetting revealed that the B2 subset (adaptive B cells, CD19+CD5-CD21+CD23+) were under-represented in both IL-7Rα mutant mice in a manner similar to what we had previously seen, namely that there was an approximately 4-fold reduction in IL-7Rα449F B2 cell numbers and more severe B2 lymphopenia in IL-7Rα-/- mice (Figure C.1.a, b). Strikingly, there was a clear IL-7Rα-dependent, Y449-independent requirement for marginal zone (MZ) B cell development (CD19+CD5CD21+CD23-). In both mutant mice, there are increased frequencies of the MZ B cell compartment (Figure C.1.b, top panel), but the severe lymphopenia of IL-7Rα-/- mice did not compensate for this increased representation and resulted in significantly fewer MZ B cells in these mice. However, IL-7Rα449F mice had similar numbers of MZ B cells as WT controls. This is the first evidence we have to date of a clear IL-7Rα Y449-dependent developmental program in T or B cell lineages. In contrast, the number of splenic B1 cells (CD19+CD5+) was decreased in both IL-7Rα mutant mice and there was no significant difference in the number of B1 cells between IL-7Rα449F and IL-7Rα-/- mice (Figure C.1), suggesting that IL-7Rα Y449 is an essential component of the IL-7Rα signal for B1 differentiation. Thus, this analysis has identified IL-7Rα-dependent developmental lineages that can be separated by IL-7Rα Y449independence (MZ) and Y449-dependence (B1). Analysis of these cell types should still be interpreted with caution. Comparing cellularity of peritoneal cavity washes is more difficult at this stage due to experimental variation and cell recovery, but flow cytometric analysis suggests that differentiation of peritoneal B1a and B1b cells is not dramatically different between WT, IL-7Rα449F and IL-7Rα-/- mice (Figure C.1.c). Further work will need to be done to determine whether there are tissue specific differences in terms of IL-7Rα requirement for B1 cell differentiation. To determine the impact of constitutive IL-7 expression, we analyzed B cell subsets in Tg IL-7 mice. This analysis showed that only splenic B2 and B1 cells were sensitive to increased IL-7 expression, and there were significantly more of these cells in Tg IL-7 spleens than WT (Figure C.2). In agreement with the previous analysis, MZ B cell development was unimpaired 
  175
  and B1 development was defective in IL-7Rα449F mice (Figure C.2). Interestingly, IL-7 overexpression in combination with the IL-7Rα449F mutation (Tg IL-7; IL-7Rα449F) resulted in B cell numbers and differentiation profiles similar to WT. This may suggest that IL-7Rα Y449independent signaling events can be activated and feed into similar signaling pathways when chronically stimulated.  
  176
  C.3  Summary This set of preliminary data provides evidence of an IL-7Rα Y449-independent  developmental pathway for generation of MZ B cells. Interestingly, it is also suggestive of a completely Y449-dependent pathway for B1 cell development. Determination of the signaling events that shape differentiation of these subsets may provide insight into IL-7Rα signaling. Furthermore, the developmental pathways for these subsets are still unclear, thus analysis of IL7Rα and cytokine mutants may help shape our understanding in this field. These two innate-like B cell subsets play important roles in protection from some bacterial pathogens, and may also play a role in some autoimmune pathologies due to production of self-antigen specific antibodies. Although IL-7Rα is down-regulated on mature B cells (and on these cell types, data not shown), it will be imperative to determine how they function following development in the absence of these signals.  
  177
  Figure C.1  Innate-like B cells have distinct requirements for IL-7Rα signals  Spleens and the peritoneal cavity lavage were harvested from age-matched (12 week old) WT, IL-7Rα449F and IL-7Rα-/- mice. B2, MZ and B1 splenic subsets were quantified (a) based on surface expression of CD19, CD5, CD21, and CD23. (b) Top panel: Frequencies of B2 and MZ B cells were determined by expression of CD21 and CD23, and are shown next to the indicated gates. Plots were previously gated on live CD19+CD5- lymphocytes (shown in bottom panel). Bottom panel: B1 cells are identified as CD19+CD5+ cells, frequencies of B1 cells as a portion of the total lymphocyte gate are indicated. (c) B2, B1a and B1b cells in the peritoneal lavage. Plots show cells that have previously been gated as CD19+F4/80-. Frequencies are shown in the box associated with each indicated population. Experiment was performed once with n=3 for each genotype.  
  178
  Figure C.1  
  179
  Figure C.2  Figure C.2  B1 and B2 cells are uniquely sensitive to IL-7 overexpression  Spleens and the peritoneal cavity lavage were harvested from age-matched (12 week old) WT, IL-7Rα449F, Tg IL-7 and Tg IL-7; IL-7Rα449F mice. B2, MZ and B1 splenic subsets were quantified (a) based on surface expression of CD19, CD5, CD21, and CD23. (b) Top panel: Frequencies of B2 and MZ B cells were determined by expression of CD21 and CD23, and are shown next to the indicated gates. Plots were previously gated on live CD19+CD5- lymphocytes (shown in bottom panel). Bottom panel: B1 cells are identified as CD19+CD5+ cells, frequencies of B1 cells as a portion of the total lymphocyte gate are indicated. Experiment was performed once with n=3 for each genotype.  
  180
  Appendix D  
  181  https://rise.ubc.ca/rise/Doc/0/F6O0R6MTC5MKV3HOT0NI...  THE UNIVERSITY OF BRITISH COLUMBIA  ANIMAL CARE CERTIFICATE BREEDING PROGRAMS  Application Number: A07-0415 Investigator or Course Director: Ninan Abraham Department: Microbiology & Immunology  1 of 3  18/05/10 2:45 PM  https://rise.ubc.ca/rise/Doc/0/F6O0R6MTC5MKV3HOT0NI...  Animals:  Mice TSLPR knockout 200 Mice Thy1.1 48 Mice OT-II 170 Mice OT-I 160 Mice OT-I 220 Mice Tg Myc 116 Mice Tg Myc 200 Mice C57BL/6 270 Mice p110 delta knock-in 116 Mice Tg IL-7 200 Mice C57BL/6 270 Mice OT-II 220 Mice BoyJ 130 Mice BoyJ 130 Mice IL-7R449F knock-in 530 Mice Thy1.1 48 Mice IL-7R449F knock-in 170 Mice IL-7R knockout 100 Mice Tg IL-7 175 Mice IL-7R knockout 66  Approval Date: April 19, 2010 Funding Sources: Funding Agency: Funding Title: Funding Agency: Funding Title: Funding Agency:  2 of 3  Canada Foundation for Innovation CFI Infrastructure Operating Funds Canadian Institutes of Health Research (CIHR) IL-7 Signaling in Normal and Aberrant T cell Development and Function Canada Foundation for Innovation  18/05/10 2:45 PM  https://rise.ubc.ca/rise/Doc/0/F6O0R6MTC5MKV3HOT0NI...  Funding Title:  Laboratory of Immune System Functional Genomics  Unfunded title:  n/a  The Animal Care Committee has examined and approved the use of animals for the above breeding program. This certificate is valid for one year from the above approval date provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies.  A copy of this certificate must be displayed in your animal facility.  Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, BC V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093  3 of 3  18/05/10 2:45 PM  https://rise.ubc.ca/rise/Doc/0/2T3RB7P662IKD1NJLR54M3GR...  The University of British Columbia  Biohazard Approval Certificate PROTOCOL NUMBER: B06-0113 INVESTIGATOR OR COURSE DIRECTOR: Ninan Abraham DEPARTMENT: Microbiology & Immunology PROJECT OR COURSE TITLE: Cytokine Signalling in Normal and aberrant T cell Development and Function APPROVAL DATE: October 15, 2009  START DATE: August 15, 2006  APPROVED CONTAINMENT LEVEL: 2  FUNDING TITLE: IL-7 Signaling in normal and aberrant T cell development and function FUNDING AGENCY: Michael Smith Foundation for Health Research FUNDING TITLE: IL-7 Signalling in Normal and aberrant T cell Development and Function FUNDING AGENCY: Canadian Institutes of Health Research (CIHR) FUNDING TITLE: The Role of IL-7-medicated signals in Maintenance of T-Cell Memory FUNDING AGENCY: Canadian Institutes of Health Research (CIHR)  UNFUNDED TITLE: Cytokine Signalling in Normal and aberrant T cell Development and Function The Principal Investigator/Course Director is responsible for ensuring that all research or course work involving biological hazards is conducted in accordance with the University of British Columbia Policies and Procedures, Biosafety Practices and Public Health Agency of Canada guidelines. This certificate is valid for one year from the above start or approval date (whichever is later) provided there are no changes. Annual review is required. A copy of this certificate must be displayed in your facility. Office of Research Services  1 of 2  18/05/10 2:43 PM  https://rise.ubc.ca/rise/Doc/0/2T3RB7P662IKD1NJLR54M3GR...  102, 6190 Agronomy Road, Vancouver, V6T 1Z3 Phone: 604-827-5111 FAX: 604-822-5093  2 of 2  18/05/10 2:43 PM  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071126/manifest

Comment

Related Items