UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cadherin-linked molecular mechanisms governing the terminal differentiation of human trophoblastic cells… Ng, York Hunt 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2010_fall_ng_york.pdf [ 3.28MB ]
JSON: 24-1.0071104.json
JSON-LD: 24-1.0071104-ld.json
RDF/XML (Pretty): 24-1.0071104-rdf.xml
RDF/JSON: 24-1.0071104-rdf.json
Turtle: 24-1.0071104-turtle.txt
N-Triples: 24-1.0071104-rdf-ntriples.txt
Original Record: 24-1.0071104-source.json
Full Text

Full Text

CADHERIN-LINKED MOLECULAR MECHANISMS GOVERNING THE TERMINAL DIFFERENTIATION OF HUMAN TROPHOBLASTIC CELLS IN VITRO  by York Hunt Ng B.S., Oklahoma City University, USA, 2001 M.Sc., The University of British Columbia, Canada, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Reproductive and Developmental Sciences)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2010 © York Hunt Ng, 2010  Abstract Background: The formation of the multinucleated syncytial trophoblast of the human placenta is a critical step in pregnancy, which is prone to failure. In these studies, I have examined the role of TWIST, a transcription factor identified as a key repressor of E-cad expression in normal and cancer cells of diverse origins, in the differentiation of human trophoblastic cells in vitro. The invasion of extravillous cytotrophoblasts (EVTs) into the underlying maternal tissues and vasculature is a key step in human placentation. The molecular mechanisms underlying the development of the invasive phenotype of EVTs include many of those first identified as having a role in cancer cell metastasis. In view of these observations, I have examined the expression, regulation, and function of Twist, Runx2 and N-cad in human trophoblastic cells in vitro. Materials and Methods:  Gain or loss-of-function studies were then performed to  determine the role of Twist in terminal differentiation and fusion in these cells. The presence of multinucleated syncytium was confirmed by indirect immunofluorescence. Concentration- and time-dependent studies were performed to determine whether interleukin (IL)-1β and transforming growth factor (TGF)-β1 regulate Twist and Runx2 mRNA and protein levels in EVTs. Next, a siRNA strategy was employed to determine the role of Twist, Runx2 and N-cad in HTR-8/SVneo EVT cells. Results:  Exogenous expression of Twist resulted in a continuous and progressive  decrease in E-cad expression and the subsequent formation of syncytium in BeWo cells maintained under normal culture conditions.  In contrast, siRNA specific for Twist  inhibited the cAMP-mediated differentiation of these cells over time in culture. The cytokines, IL-1β and TGF-β1, respectively induced the differential up- and down-  ii  regulation of Twist and Runx2 expression in primary cultures of EVTs in both a concentration and time-dependent manner. Use of a siRNA strategy demonstrated that a reduction in Twist, Runx2 or N-cad in HTR-8/SVneo cells concomitantly decreased the invasiveness of these cells. Conclusions: Collectively, my findings demonstrate that TWIST is an upstream regulator of the E-CAD-mediated terminal differentiation and fusion of human trophoblastic cells in vitro. TWIST, RUNX2 and N-CAD are key molecules underlying the invasive capacity of EVTs.  iii  TABLE OF CONTENTS ABSTRACT ................................................................................................................................. ii TABLE OF CONTENTS ............................................................................................................ iv LIST OF TABLES ...................................................................................................................... ix LIST OF FIGURES ..................................................................................................................... xi LIST OF ABBREVIATIONS .................................................................................................... xv CHAPTER 1:  OVERVIEW ................................................................................................. 1  1.1  Introduction ................................................................................................. 1  1.2  Human implantation and placentation ......................................................... 3  1.2.1  Terminal differentiation of human cytotrophoblasts ................................... 3  1.2.2  Models used in studying human placentation ........................................... 10  Rodent models ........................................................................................... 10  Non-human primate models ...................................................................... 11  In vitro models of trophoblast differentiation ........................................... 11  EVTs propagated from human first trimester placenta tissues ................. 11  Villous cytotrophoblasts isolated from human term placentae ................. 12  Human trophoblastic cell lines .................................................................. 13  Choriocarcinoma cell lines ........................................................................ 13  HTR-8 cells ............................................................................................... 14  1.3  Cellular and molecular mechanisms involved in terminal differentiation of human trophoblasts ................................................. 15  1.3.1  Extracellular matrix degradation ............................................................... 15  Plasminogen activators and their inhibitors .............................................. 16  iv  Matrix metalloproteinases and their inhibitors .......................................... 17  1.3.2  Extracellular matrix deposition ................................................................. 20  1.3.3  ECM interactions: the integrin gene superfamily of cell adhesion molecules ...................................................................... 21  1.3.4  Cell-cell interactions ................................................................................. 23  1.4  The cadherins superfamily ........................................................................ 24  1.4.1  Classical cadherins .................................................................................... 24  1.4.2  Classical cadherins involvement in developmental processes .................. 28  1.4.3  Classical cadherins and cancers ................................................................ 29  1.4.4  Classical cadherins and placentation ......................................................... 32  1.5  TWIST- A basic helix-loop-helix transcription factor .............................. 33  1.5.1  Twist- A key player in cell differentiation and morphogenesis ................ 35  1.5.2  Twist and cancers ...................................................................................... 36  1.6  Runt-related Gene (Runx) family .............................................................. 38  1.6.1  Runt-related Gene 2 (Runx2) ................................................................... 41  Runx2 and cancers .................................................................................... 42  Regulation and activation of Runx2 .......................................................... 43  Interactions between RUNX2 and TWIST ............................................... 44  1.7  Hypothesis and rationale ........................................................................... 46  CHAPTER 2:  MATERIALS AND METHODS .............................................................. 48  2.1  Tissues ...................................................................................................... 48  2.2  Cells .......................................................................................................... 48  2.3  Experimental culture conditions ............................................................... 50  v  2.4  Generation of first-strand complementary DNA (cDNA) ........................ 51  2.5  Primer design ........................................................................................... 52  2.6  Semi-quantitative RT-PCR ...................................................................... 54  2.7  Real-time-quantitative (q) RT-PCR ......................................................... 55  2.8  Western blot analysis ............................................................................... 56  2.9  siRNA transfection ................................................................................... 57  2.10  Expression vectors .................................................................................... 57  2.11  Generation of stably transfected BeWo cell lines .................................... 58  2.12  Indirect immunofluorescence ................................................................... 58  2.13  Matrigel invasion assay ............................................................................ 59  2.14  Statistical analysis .................................................................................... 60  CHAPTER 3:  TWIST REGULATES CADHERIN-MEDIATED DIFFERENTIATION AND FUSION OF HUMAN TROPHOBLASTIC CELLS IN VITRO .................................. 61  3.1  Introduction and rationale ........................................................................ 61  3.2  Results ...................................................................................................... 64  3.2.1  8-bromo-cAMP promotes the terminal differentiation and fusion of BeWo cells in association with altered Twist and E-cad expression ...................................................................... 64  3.2.2  Twist siRNA inhibits the terminal differentiation and fusion of BeWo choriocarcinoma cells in the presence of 8-bromo-cAMP .................................................................................... 65  3.2.3  pEF1α-Twist promotes the terminal differentiation and  vi  fusion of BeWo cells: correlation with E-cad mRNA and protein levels ................................................................................ 67 3.3  Discussion and summary .......................................................................... 87  CHAPTER 4:  TWIST REGULATES CADHERIN-MEDIATED INVASION OF HUMAN TROPHOBLASTIC CELLS IN VITRO ............................ 93  4.1  Introduction and rationale ........................................................................ 93  4.2  Results ...................................................................................................... 96  4.2.1  Determining the Twist and N-cad mRNA and protein levels in the human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines ............................................... 96  4.2.2  IL-1β and TGF-β1 respectively promote and restrain the invasive ability of EVT primary cultures ...................................... 96  4.2.3  Time-dependent effects of IL-1β and TGF β1 on Twist mRNA and protein levels in EVTs .......................................... 97  4.2.4  Concentration-dependent effects of IL-1β and TGF-β1 on Twist mRNA and protein levels in EVTs ..................................... 98  4.2.5  Decreased Twist down-regulates N-cad expression levels and reduces the invasive capacity of HTR-8/SVneo cells .................. 98  4.2.6  Loss of N-cad reduces the invasive capacity of HTR-8/SVneo cells ......................................................................... 99  4.3  Discussion and summary ........................................................................ 127  vii  CHAPTER 5:  A KEY ROLE FOR RUNX2 IN HUMAN TROPHOBLAST INVASION ............................................... 131  5.1  Introduction and rationale ...................................................................... 131  5.2  Results .................................................................................................... 134  5.2.1  Runx2 is expressed in human placenta, highly invasive EVTs and poorly invasive trophoblastic cell lines ...................................... 134  5.2.2  Time-dependent effects of IL-1β on Runx2 mRNA and protein levels in human EVTs ........................................ 134  5.2.3  Time-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in human EVTs ........................................ 135  5.2.4  Concentration-dependent effects of IL-1β on Runx2 mRNA and protein levels in human EVTs ........................................ 135  5.2.5  Concentration-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in human EVTs ........................................ 136  5.2.6  Attenuation of cytokine-modulated Runx2 mRNA and protein levels in EVTs using neutralizing antibodies directed against IL-1b or TGF-β1 .................................................. 136  5.2.7  Inhibition of Runx2 expression down-regulates N-cad mRNA and protein levels and reduces the invasive capacity of HTR-8/SVneo cells ............................................................................ 137  5.3  Discussion and summary ........................................................................ 159  CHAPTER 6:  GENERAL DISCUSSION ..................................................................... 163  6.1  Discussion .............................................................................................. 163  viii  6.2  Summary and conclusions ....................................................................... 174  6.3  Future directions ...................................................................................... 175  BIBLIOGRAPHY .................................................................................................................... 178 APPENDIX ............................................................................................................................... 215  ix  LIST OF TABLES  Table 2.1. Oligonucleotide primers for Twist, Runx2, N-cad, E-cad and GAPDH mRNA amplification (Semi-quantitative PCR) ...................................................... 53 Table 2.2. Real-time qPCR primers for Runx2, N-cad and GAPDH mRNA ............................. 53  x  LIST OF FIGURES Figure 1.1. A) Schematic diagram representing human trophoblastic cell differentiation. B) Schematic diagram representing chorionic villi .................................................... 5 Figure 1.2. Schematic diagram representing of the basic structure of type 1 classical cadherins in the plasma membrane ................................................. 27 Figure 1.3. Schematic diagram representing of the protein structure of the human Twist ........ 34 Figure 1.4. Schematic diagram representing of the protein structure of the human Runx2....... 38 Figure 3.1. Effects of cAMP on Twist mRNA and protein levels in BeWo cell cultures ......... 69 Figure 3.2. Effects of cAMP on E-cad mRNA and protein levels in BeWo cell cultures ......... 71 Figure 3.3. Immunolocalization of TWIST and E-CAD in BeWo cells cultured in the presence or absence (control) of 1.5 mM 8-bromo-cAMP (cAMP) ........................ 73 Figure 3.4. Effects of Twist siRNA on Twist mRNA and protein levels in BeWo cells cultured in the presence of 1.5 mM 8-bromo-cAMP (cAMP) ................................. 75 Figure 3.5. Effects of Twist siRNA on E-cad mRNA and protein levels in BeWo cells cultured in the presence of 1.5 mM 8-bromo-cAMP (cAMP) ................................. 77 Figure 3.6. Immunolocalization of TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in BeWo cells transfected with siRNA specific for Twist in the presence of 1.5 mM 8-bromo-cAMP (cAMP) ....................................................................... 79 Figure 3.7. Immunolocalization of TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in BeWo cells transfected with a scrambled control siRNA in the presence of 1.5 mM 8-bromo-cAMP (cAMP)............................................................................. 81 Figure 3.8. Twist and E-cad mRNA and protein levels in BeWo choriocarcinoma cells stably transfected with pEF1α-Twist ...................................................................... 83  xi  Figure 3.9. Immunolocalization TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in mock transfected BeWo cells (Reagent) or BeWo cells stably transfected with pEF1α-Twist (pEF1α-Twist) ........................................................................... 85 Figure 3.10. A schematic diagram of a proposed role of Twist in regulating E-cad-mediated terminal differentiation and fusion of human trophoblastic cells ........................................................................................ 92 Figure 4.1. Twist mRNA and protein levels in human placenta, highly invasive EVTs and poorly invasive trophoblastic cell lines ........................................................... 101 Figure 4.2. N-cad mRNA and protein levels in the human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines ................................................. 103 Figure 4.3. Regulatory effects of IL-1β and TGF-β1 on EVT invasion .................................. 105 Figure 4.4. Time-dependent effects of IL-1β on Twist mRNA and protein levels in EVTs .................................................................................................................. 107 Figure 4.5. Time-dependent effects of TGF-β1 on Twist mRNA and protein levels in EVTs .................................................................................................................. 109 Figure 4.6. Concentration-dependent effects of IL-1β on Twist mRNA and protein levels in EVTs .................................................................................................................. 111 Figure 4.7. Concentration-dependent effects of TGF-β1 on Twist mRNA and protein expression levels in EVTs ...................................................................................... 113 Figure 4.8. Effects of Twist siRNA on Twist mRNA and protein levels in HTR-8/SVneo cell cultures .................................................................................... 115 Figure 4.9. Effects of Twist siRNA on N-cad mRNA and protein levels in HTR-8/SVneo cell cultures .................................................................................... 117  xii  Figure 4.10. Reduced Twist expression decrease the invasive capacity of HTR-8/SVneo cells .............................................................................................. 119 Figure 4.11. Effects of N-cad siRNA on N-cad mRNA and protein levels in HTR-8/SVneo cell cultures .................................................................................. 121 Figure 4.12. Reduced N-cad levels decrease the invasive capacity of HTR-8/SVneo cells .............................................................................................. 123 Figure 4.13. Disruption of N-CAD function decreases the invasive ability of HTR-8/SVneo cells .............................................................................................. 125 Figure 4.14. A schematic diagram of a proposed role of Twist in regulating N-cad-mediated differentiation of human trophoblastic cells .............................. 130 Figure 5.1. Runx2 mRNA and protein expression levels in human placenta, highly invasive EVTs and poorly invasive trophoblastic cell lines .................................. 139 Figure 5.2. Time-dependent effects of IL-1β on Runx2 mRNA and protein levels in EVTs .................................................................................................................. 141 Figure 5.3. Time-dependent effects of transforming growth factor-β1 (TGF-β1) on Runx2 mRNA and protein levels in EVTs ............................................................. 143 Figure 5.4. Concentration-dependent effects of IL-1β on Runx2 mRNA and protein levels in EVTs ............................................................................................ 145 Figure. 5.5. Concentration-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in EVTs ............................................................................................ 147 Figure 5.6. Attenuation of IL-1β-mediated increase in Runx2 mRNA and protein levels EVTs ................................................................................................ 149 Figure 5.7. Attenuated of TGF-β1-mediated decrease in Runx2 mRNA and  xiii  protein levels in EVTs ............................................................................................ 151 Figure 5.8. Effects of Runx2 siRNA on Runx2 mRNA and protein levels in HTR-8/SVneo cell cultures ................................................................................. 153 Figure 5.9. Effects of Runx2 siRNA on N-cad mRNA and protein levels in HTR-8/SVneo cell cultures .................................................................................... 155 Figure 5.10. Reduced Runx2 levels decrease the invasive capacity of HTR-8/SVneo cells ............................................................................................... 157 Figure 5.11. A schematic diagram of a proposed role of Runx2 in regulating N-cad-mediated differentiation of human trophoblastic cells ............................... 162 Figure 6.1. A schematic diagram of a proposed role of Twist in regulating terminal differentiation and fusion of human trophoblastic cells .......................... 165 Figure 6.2. A schematic diagram of the proposed roles of Twist, Runx2 and N-cad in regulating the invasive ability of human trophoblastic cells .............................. 166  xiv  LIST OF ABBREVIATIONS  ANOVA  Analysis of variance  bHLH  Basic helix-loop-helix  BSA  Bovine serum albumin  BrdU  5-bromo-2’-deoxy-uridine  C  Carboxy  o  Degrees centigrade  Ca2+  Calcium  CaCl2  Calcium chloride  CAM  Cell adhesion molecule  cAMP  Cyclic adenosine 3’ ,5’-monophosphate  cDNA  Complementary DNA  CP  Cytoplasmic domain  Cx  Connexin  DMEM  Dulbeco’s modified eagle’s medium  DMSO  Dimethyl sulfoxide  DNA  Deoxyribonucleic acid  dNTP  Deoxynucleoside triphosphate  E2  Estradiol  EC  Extracellular subdomain  ECL  Enhanced chemiluminescence  ECM  Extracellular matrix  EDTA  Ethylenediamine tetra-acetate  EMT  Epithelial mesenchymal transition  C  xv  EVT  Extravillous cytotrophoblast  FGF  Fibroblast growth factor  FGFR  FGF receptor  g  Grams  GAPDH  Glyceraldehyde-3-phosphate dehydrogenase  h  Hours  HAV  Histidine-alanine-valine  hCG  Human chorionic gonadotropin  hPL  Human placental lactogen  Ig  Immunoglobin  IGF  Insulin-like growth factor  IGFBP-1  IGF binding protein-1  IL-1β  Interleukin-1β  IUGR  Intrauterine growth restriction  Kb  Kilo bases  kDA  Kilo daltons  LacZ  β-galactosidase  LH  Luteinizing hormone  Min  Minutes  Ml  Milliliter  mM  Millimolar  MF  Microfilaments  MMP  Matrix metalloproteinase  MT-MMP  Membrane-type MMP  xvi  MW  Molecular weight  mRNA  Messenger RNA  µl  Microliter  µM  Micromolar  Nm  Nanomolar  NaCl  Sodium chloride  P  Probability  PA  Plasminogen activator  PAGE  Polyacrylimide gel electrophoresis  PAI  Plasminogen activator inhibitor  PBS  Phosphate buffered saline  PCR  Polymerase chain reaction  PMSF  Phenylmethyl sulfonyl fluoride  RNA  Ribonucleic acid  RER  Rough endoplasmic reticulum  rRNA  Ribosomal RNA  RT  Room temperature  RT-PCR  Reverse transcriptase-polymerase chain reaction  SDS  Sodium dodecyl sulfate  SEM  Standard error of the mean  siRNA  Short interference RNA  SV40  Simian vacuolating virus-40  TGF-β1  Transforming growth factor-β1  TIMP  Tissue inhibitor of MMP  TM  Transmembrane domain  xvii  TBS  Tris buffered baline  tPA  Tissue-type PA  Tris-HCL  Tris (hydroxymethyl)-aminomethane-hydrochloric acid  TSP  Thrombospondin type-1 repeat  uPA  Urokinase-type PA  VCAM  Vascular adhesion molecule  VEGF  Vascular endothelial growth factor  X-gal  5-bromo-4-chloro-3-ondolyl-β-d-galactosidase  xviii  CHAPTER 1: OVERVIEW  1.1: Introduction  The human placenta plays a key role in regulating the growth, development, and survival of the fetus during pregnancy. It is the site of transfer of respiratory gasses, nutrients and waste products between the maternal and fetal systems; it serves as a barrier against blood-borne pathogens and the maternal immune system; and it fulfills an endocrine role by secreting hormones, growth factors and other bioactive substances required for the establishment and maintenance of pregnancy. The establishment and outcome of a pregnancy are highly dependent on the interactions and functional cooperation between the trophoblast and uterus (Pijnenborg et al., 1980; Aplin, 1991). Abnormal placental development is associated with clinical pathological conditions such as miscarriage, intrauterine growth restriction or preeclampsia (King and Loke, 1994; Benirschke and Kaufmannm, 2000).  Moreover, abnormal placental development  associated with fetal aneuploidy contributes to early pregnancy loss (Salafia et al., 1993; van Lijnschoten et al., 1994). In a similar manner, abnormal placental structure has deleterious effects on the growth of the fetus (Krebs et al., 1996; Macara et al., 1996). The trophoblast is an extraembryonic fetal tissue originating from the trophectoderm of the blastocyst. During placental development, three trophoblastic cell populations can be identified: cytotrophoblast stem cells and their derivative cell types:  the  syncytiotrophoblast and the extravillous cytotrophoblast (Hertig et al., 1956; Denker, 1993). The multinucleated syncytial trophoblast is formed from underlying mitotically  1  active, mononucleate cytotrophoblasts, and its formation is a cellular process dependent upon on a precise series of membrane-mediated events (Douglas and King, 1990). The cadherins are cell adhesion molecules capable of mediating the terminal differentiation and fusion of human cytotrophoblast (Getsios et al., 2000). In order for a human placenta to develop and function properly, the embryonic trophoblastic cells must proliferate, differentiate and invade into the maternal endometrium (Aplin, 1991). Studies have shown the important roles played by members of the cadherin subtype in cell differentiation during cancer development and cancer cell invasion (Oka et al., 1993; Hazan et al., 2000). These findings allow us to identify the potential molecular mechanisms involved in trophoblast invasion, as the process of human trophoblast invasion utilizes similar molecular mechanisms as those of tumour cell invasion, albeit trophoblast invasion is a more tightly regulated, developmental process (Lala et al., 2002). The acquisition of the invasive and metastatic phenotype, and the transformation of a cell, result from complex cellular processes that will most likely regulate the levels and actions of transcription factors that control the genetic program. Very often, the regulatory factors associated with tumourigenesis are required for early development of tissues, including epithelial-mesenchymal transition genes (Twist, Snail, Slug, TGF-β) and phenotypic genes (Runx transcription factors) (Morrison and Kimble, 2006). Careful control of gene expression by transcription factors is important in maintaining the physiological levels of proteins needed for normal cell function. However, expression of transcription factors can become aberrant in cancer cells due to epigenetic changes in chromatin, chromosome translocation or mutations (Yang et al., 2004; Blyth et al., 2005).  2  The main objective of my studies was to better understand the role(s) of cadherins in placental development. I have examined transcription factors, known as TWIST and RUNX2 during the terminal differentiation of human trophoblastic cells. In particular, TWIST is known to be a key regulator of cadherin-mediated interactions (Rosivatz et al., 2002; Vesuna et al., 2008).  The ability of the cadherins to regulate the terminal  differentiation of human trophoblastic cells was subsequently examined. In this chapter, the development of the human placenta will be described with emphasis on the terminal differentiation of human cytotrophoblasts, particularly the molecular and cellular mechanisms involving the terminal differentiation of mononucleate  cytotrophoblasts  into  either  syncytiotrophoblasts  or  extravillous  cytotrophoblasts. The cell biology of the cadherin gene superfamily and the transcription factors, TWIST and RUNX2, will also be reviewed.  1.2: Human implantation and placentation  1.2.1: Terminal differentiation of human cytotrophoblasts  The first step in human implantation involves apposition and attachment of trophectodermal cells to the surface epithelium of the endometrium. After this initial contact, the trophectodermal cells penetrate into the basement membrane of the maternal endometrium (Schlafke and Enders, 1975; Bentin-Ley et al., 2000). These stages of development are crucial in the process of establishing a successful pregnancy. Upon implantation, the embryonic trophectoderm consists of two distinct but inter-related  3  ephithelial cell layers: an inner layer of mitotically active cytotrophoblasts, and the outer syncytial trophoblast (Hertig et al., 1956) (Figure 1.1). Even though the trophoblastic cell subpopulation that is involved in the earlier stages of invasion of maternal tissue is still not clearly defined (Pijnenborg, 1990; Aplin, 2000), histological studies have shown that both the cytotrophoblasts and the syncytial trophoblast interact with the epithelial cells in the endometrium (Enders, 1976). During the third week after ovulation, these trophoblastic cells, after infiltration by a vascularized fetal mesenchyme, organize into mature chorionic villous structures. The chorionic villi are made up of a single layer of villous cytotrophoblast cells that rest on a basement membrane, a mesenchymal core containing fetal blood vessels, and an outer layer of syncytial trophoblasts that are in contact with the maternal endometrium and blood. The development and existence of the chorionic villi has been denoted as the hallmark of the human haemochorial placenta, whereby the fetal circulatory system is separated from the maternal blood cells throughout all stages of pregnancy by at least a single layer of trophoblastic cells, the syncytial trophoblast. This epithelial layer is the most important maternal-fetal barrier (Boyd and Hamilton, 1970, McGann et al., 1994). The structural and functional properties of the villous cytotrophoblasts and the multinucleated syncytial trophoblast are different.  For instance, the endoplasmic  reticulum of villous cytotrophoblasts is poorly developed and non-vacuolated though it contains relatively large mitochondria and numerous free ribosomes (Boyd and Hamilton, 1970; Contractor et al., 1977).  4  Mononucleate Cytotrophoblasts  cell fusion  invasion  (The villous pathway)  (The extravillous pathway)  Syncytial trophoblast  Involved in maternalfetal exchanges, and placental endocrine functions  Extravillous trophoblast (EVT)  Binds placenta to uterine wall; increase maternal blood flow to placenta  EVT column  Spiral artery Mononucleated cytotrophoblast  Zone A  Syncytial trophoblast  Zone B  Extravillous cytotrophoblast (EVTs)  Zone C  Figure 1.1. A) Schematic diagram representing human trophoblastic cell differentiation. Mononucleate cytotrophoblasts will undergo differentiation and fusion to form syncytial trophoblast or will proliferate and differentiate to become highly invasive extravillous cytotrophoblasts (EVTs). B) Schematic diagram representing chorionic villi. Zone A represents a floating villous consisting of mononuclear villous cytotrophoblasts entering the non-invasive pathway. Zone B represents an EVT column. Zone C represents the extravillous pathway.  5  Villous cytotrophoblasts seem likely to be the primary site of synthesis of several peptide hormones, such as activin, inhibin and gonadotropin-releasing hormone (Khodr and Siler-Khodr, 1980; Miyake et al., 1982; Petraglia et al., 1991; 1996). In contrast, syncytial trophoblast contains larger nuclei and has more developed organelles such as a vacuolated rough endoplasmic reticulum (RER) associated with protein synthesis, numerous mitochondria for steroid hormone biosysthesis, and Golgi apparatus and secretory vesicles for secretion functions (Boyd and Hamilton, 1970). The syncytial trophoblast is initially formed during implantation and then maintained as a kind of steady-state structure at the maternal-fetal interface throughout pregnancy (Huppertz, 1999). The syncytial trophoblast is a dynamic structure that forms the continuous outer layer of the human placenta. The majority of the biological functions of the human placenta, such as transporting gasses and nutrients from the maternal to the fetal circulation throughout pregnancy, is performed by the multinucleated syncytial trophoblast layer (Richard, 1961; Kliman et al., 1986). Even though the mononucleate trophoblastic cells can produce human chorionic gonadotropin (hCG) at the earliest stages of pregnancy (Ohlsson et al., 1989), the syncytial trophoblast becomes the major source of this and most other peptide and steroid hormones produced by the human placenta throughout pregnancy for placental growth and for maternal adaptation to pregnancy (Hoshina et al 1982; Ringler and Strauss, 1990). Defects in the formation of the syncytial trophoblast are suspected to lead to several complications such as intrauterine growth restriction and pre-eclampsia (Lee et al., 2001, Ishihara et al., 2002). In 1887, Langhans first suggested the cellular basis for the terminal differentiation in his morphological studies of the villous cytotrophoblasts in the human placenta (Boyd  6  and Hamilton, 1970). The human syncytial trophoblast is a terminally differentiated cell formed by post-mitotic fusion of the underlying villous cytotrophoblasts (Richard, 1961; Kliman et al., 1986). Other investigations have proposed that the development of the multinucleated syncytial trophoblast occurs from nuclear duplication in the absence of cytokinesis, a process in which the cytoplasm of a single eukaryotic cell is divided to form two daughter cells (Sarto et al, 1982). Functional studies using 3H-thymidine incorporation in human trophoblastic cells as well as succeeding studies have shown that the villous cytotrophoblasts are mitotically active and that nuclear division is completely absent in the multinucleated syncytial trophoblast in vivo (Richart, 1961; Galton, 1962; Gerbie et al, 1968). Ultrastructural analysis of the human term placenta demonstrated the presence of intercellular junctions within the syncytial trophoblast as well as within the boundary of direct contact between the villous cytotrophoblasts and the syncytial trophoblast. Furthermore, the junctional complexes within the syncytial trophoblast have been conceptualized as remnants of the cytotrophoblastic junctions that merged into the syncytial trophoblast cytoplasm following cellular fusion (Carter, 1964; Metz et al, 1979; Metz and Weihe, 1980). Recent evidence has suggested that envelope-like human endogenous retrovirus (HERV) protein known as syncytin-2 is a crucial mediator of the fusion process involved in the syncytialisation of trophoblasts. For example, real-time reverse transcription PCR and Western blot analyses in differentiating primary trophoblast cells have shown a direct correlation between mRNA and protein levels of Syncytin-2 and cell fusion. Furthermore, experiments with siRNA (small interfering RNA) transfected BeWo and  7  primary human trophoblast cells demonstrated an important diminution in the number of cell fusion processes upon repression of Syncytin-2 expression (Vargas et al., 2009). To date, the molecular and cellular mechanisms that mediate the formation of the syncytial trophoblast from the underlying villous cytotrophoblasts remain poorly characterized. Detailed studies on the molecular and cellular biology in the formation of the syncytial trophoblast are of critical importance for interpretation and treatment of pregnancy complications. A successful human pregnancy depends upon mononucleate cytotrophoblasts entering one of the two distinct and mutually exclusive pathways.  The villous  cytotrophoblastic cells will proliferate and differentiate by fusion to form the outer syncytial trophoblast, as described above, or will enter the extravillous pathway to form highly invasive extravillous cytotrophoblasts (EVTs) (Bischof and Campana, 2000) (Figure 1.1). In the extravillous pathway, cytotrophoblasts located within implanting chorionic villi differentiate into EVTs that invade deeply into the underlying maternal tissues and uterine vasculature, thus allowing an increased and controlled supply of blood flow to the placenta and ensuring an adequate supply of oxygen and nutrients to the developing fetus. This is a critical step in human pregnancy (Pijnenborg et al., 1983 and 1994; Aplin, 1991). Human EVTs can be divided into three populations, depending upon their molecular and morphological phenotypes and location within the extravillous compartment: intermediate cytotrophoblasts that proliferate are located near the villous basement membrane, interstitial cytotrophoblasts that will invade into the decidual stroma and  8  superficial myometrium, and endovascular cytotrophoblasts which will invade into the lumen of the spiral arteries (Pijnenborg et al., 1981, 1983; Roberston et al., 1986; Lala et al., 2002; Bischof and Irminger-Finger, 2005). EVTs will undergo cell proliferation and break through the outer layer of the syncytial trophoblast to develop large cellular columns that stretch out into the maternal decidua (Enders, 1968; Muhlhauser et al., 1993). Subpopulation(s) of EVTs will eventually detach from the tips of these cellular columns and invade into the decidual stroma and superficial myometrium as individual mononucleate cells and invade into the uterine arterial vasculature to replace the endothelial cells (Pijnenborg et al., 1980, 1983). This cellular event is believed to remodel the smooth muscle and elastin layers of the arteries and the underlying endothelial cells in these blood vessels that subsequently allow for increased maternal blood flow to the placenta later in pregnancy, and to thereby ensure an adequate supply of oxygen and nutrients to the developing fetus (Brosens et al, 1967; Pijnenborg et al, 1983). The basic structure of the human placenta has become established at the end of the first trimester of pregnancy and all of the distinct trophoblastic cell subpopulations exist at the maternal-fetal interface (Boyd and Hamilton, 1970). Subsequently, trophoblastic cells continue to proliferate and differentiate, and promote placental growth until the end of pregnancy (Simpson et al, 1992). Therefore, it is important to acquire a detailed understanding of the molecular mechanisms that regulate human trophoblast terminal differentiation, both fusion and invasion, during formation and organization of the human placenta.  9  1.2.2: Models used in studying human placentation Rodent models  Similarities have been noted between mouse and human in terms of placenta cell types (Carter, 2007) and genes controlling placental development (Rossant and Cross, 2001). The benefits of using the mouse as an experimental model include its short generation time. Other major benefits include the availability of embryonic stem cells, which help in gene targeting and the development of transgenic lines (Carter, 2007). However, there are many differences between murine and human placentation; these include fewer placental hormones and a different mode of implantation in the mouse (Carter, 2007). More significantly, the transformation of uterine arteries in mice depends on maternal factors, such as the endothelium, rather than on trophoblasts and there is also limited trophoblast invasion in the mouse (Redline and Lu, 1989; Adamson et al., 2002; Pijnenborg, 2006). It is important to bear in mind that there are still other differences between mouse and human placenta that need to be addressed, such as the labyrinthine rather than villous structure of the exchange area in the mouse and the presence of three layers of trophoblast in the interhaemal membrane (Carter, 2007). Therefore, the mouse is considered to be a less than ideal experimental model for studies of trophoblast invasion and vascular remodelling, in relation to the situation in humans.  10 Non-human primate models  Studies have shown similarities among humans, baboons and macaques in terms of how the spiral arteries are invaded and transformed (Blankenship and Enders, 2003). Importantly, as in humans, the placenta of Old World monkeys (Cercopithecidae), e.g. baboon and macaque, are villous and haemochorial (Hill, 1932). Even though preeclampsia appears to be a uniquely human disease (Martin, 2003), there are findings where Old World monkeys (Palmer et al., 1979) and great apes (Stout and Lemmon, 1969) show symptoms that resemble pre-eclampsia. However, trophoblast invasion in non-human primates is more restricted than in the humans, and the absence of interstitial trophoblast cells in the monkey is a major difference in comparison to human placentation (Carter, 2007). Ethical issues and the high maintenance costs of primate colonies, as well as concerns for vulnerable or endangered species, limits the use of nonhuman primates as animal models (Caldecott and Miles, 2005). In vitro models of trophoblast differentiation EVTs propagated from human first trimester placenta tissues  Irving et al. (1995) reported a pure yield of EVT cultures by isolation (cutting the villi with a surgical scissor and mince finely with a razor blade) from first trimester placenta tissues (6-12 weeks gestation), as confirmed through morphological and phenotypical analysis. Indirect immunofluorescence showed that pure trophoblast outgrowths stain  11  100% positive for the epithelial cell markers cytokeratin 8 and 18, but do not stain for vimentin, a cell marker for mesenchymal cells (Irving et al., 1995). In addition, equal or more than 90% of mechanically isolated EVTs from placenta tissue immunostained positive for cytokeratin and insulin-like growth factor-II (Aplin et al., 1999). Therefore, the expression of these markers in isolated EVTs from placenta tissues allows the confirmation of a valid model for investigating EVT cell biology. Villous cytotrophoblasts isolated from human term placentae  Villous cytotrophoblasts are isolated by a digestive enzyme from human term placental tissues followed by purifying the cells by using either immunoselection or density gradients. These cell isolating methods result in highly purified populations of mononucleate cytotrophoblasts (Kliman et al., 1987; Yui et al., 1994; Morrish et al., 1997).  The cellular biology of mononucleate cytotrophoblasts mimics many of the  cellular events associated with chorionic villous formation in vivo, for example, mononucleate cytotrophoblasts freshly isolated from human term placenta undergo aggregation, differentiation, and fusion to form a multinucleated syncytial trophoblast over time in culture. The level of β human chorionic gonadotropin increases during the formation of multinucleated syncytium in these primary cell cultures (Hoshina et al., 1982).  12 Human trophoblastic cell lines Choriocarcinoma cell lines  Progress in understanding of human trophoblast differentiation has been restricted due to the cellular and morphological differences that exist between human placenta and animal models, as well as the fact that in vivo human experimentation is difficult to justify. Trophoblastic cell lines derived from choriocarcinoma cells have provided a useful alternative for investigating human trophoblast differentiation in vitro (King et al., 2000). Choriocarcinoma is a relatively uncommon malignant tumour of the human placenta that consists of mitotically active cytotrophoblasts (Benirschke and Kaufmann, 2000). The choriocarcinoma cell lines, known as BeWo, JEG-3 and JAR are the most commonly used cell lines. BeWo choriocarcinoma cells undergo cellular differentiation in response to forskolin or cAMP (cyclic adenosine monophosphate) treatment (Seamon et al., 1981; Wice et al., 1990). In response to forskolin or 8-bromo-cAMP, BeWo cells show a marked reduction in DNA synthesis and within 48-96 hours of treatment these cells begin to fuse and form large syncytia (Coutifaris et al., 1991). This constitutes an in vitro model to study the cellular and molecular processes involved in syncytial trophoblast formation. JEG-3 choriocarcinoma cells are mononucleate trophoblastic cells that were established by Kohler et al. (1971). When JEG-3 cells were treated with 8-bromo-cAMP, there was an increase in β human chorionic gonadotropin production; however these cells do not undergo differentiation to form a multinucleated syncytium under these culture  13  conditions (Chou et al., 1978; Burnside et al., 1985; Coutifaris et al., 1991). Instead, JEG-3 cells have been used as an in vitro model to study the cell biology of mononucleate trophoblasts. JAR is a choriocarcinoma cell line originating from a human malignant cytotrophoblastic tumor. JAR cells have been used, for example, to study the molecular mechanisms involved in iodide transport from mother to fetus (Arturi et al., 2002). In preliminary gain-of-function studies using JAR cells transfected with an expression vector containing full-length Twist cDNA, I found significantly increased Twist mRNA expression, however the TWIST protein level remained unchanged (data not shown) and so these choriocarcinoma cells proved to be an unsuitable experimental system in which to study Twist-dependent effects. HTR-8 cells  Studies of the trophoblast biology have been traditionally dependent on the use of primary trophoblast cultures from first trimester tissues (Kliman et al., 1986; Yagel et al., 1989). The drawback of using these primary cell cultures is their short life span, as the cells senesce after 5-6 passages. Furthermore, short-term cultures are not appropriate for certain experiments, such as those involving genetic manipulations, because these studies usually require long-term culture. Experiments using primary trophoblast cultures are also accompanied by high variability between samples due to heterogeneity in the cell population. HTR-8 cells, an EVT cell line, also known as parental HTR-8 cells or sometimes referred to as HTR-8/SVneo, when the parental HTR-8 cells are transfected  14  with Simian Virus 40 (SV 40) large T antigen (Tag). These transfected HTR-8/SVneo cells can normally be maintained in culture for more than 50 passages in comparison to their parental HTR-8 cells which senesced after 12-14 passages. Furthermore, these transfected cells retain most phenotypic features as compared to their non-transfected parental HTR-8 cells (Graham et al., 1993).  HTR-8/SVneo cells also display a  premalignant phenotype as indicated by hyperproliferative and hyperinvasive behaviour, and resistance to the anti-proliferation and anti-invasive effects of transforming growth factor β (TGF β) (Khoo et al., 1998). HTR-8/SVneo cells cultured in hypoxic conditions (2% oxygen concentration) exhibit reduced cell invasive properties. These cells also express cytokeratin and retain several important characteristics typical of primary cultures of first-trimester human cytotrophoblast cells, including altering their behaviour in response to a changing maternal environment (Kilburn et al., 2000).  1.3: Cellular and molecular mechanisms involved in terminal differentiation of human trophoblasts  1.3.1: Extracellular matrix degradation  In general, the extracellular matrix (ECM) that surrounds cells is comprised of proteins such as collagen, fibronectin, laminin and proteoglycans. Degradation of the ECM is required during biological processes such as tumour invasion and early placental development. Several key proteinases, such as those of the plasminogen activator (PA) family and the matrix metalloproteinase (MMP) family are activated to promote ECM degradation during these biological processes (MacDonald et al., 1998; Whiteside et al.,  15  2001, Denys et al., 2004). The roles of PA and MMP family members in human trophoblast differentiation are described in the following sections. Plasminogen activators and their inhibitors  The plasminogen activators (PA) are substrate-specific proteinases that mediate cleavage of plasminogen to plasmin (Alfano et al., 2005). PA exhibits a wide range of serine protease activities that target extracellular matrix components such as laminin and fibrin, as well as assisting in the activation of zymogen forms of MMPs (Vaseelli et al., 1991; Andreasen et al, 2000; Durand et al, 2004). The PA system consists of the urokinase-type PA (uPA), the tissue-type PA (tPA), the PA inhibitors-1 and -2 (PAI-1 and PAI-2), and the uPA receptor (uPAR). uPA is spatiotemporally expressed at the maternal-fetal interface during first trimester pregnancy in humans and higher primates (Hu et al., 1999; Feng et al, 2001). uPA has also been identified in subpopulations of extravillous cytotrophoblasts (EVTs) that invade into decidual tissue and spiral arteries to ensure a continuous supply of blood to the placenta (Fisher and Damsky, 1993). Neutralizing antibodies specific for uPA inhibit the invasive capacity of EVTs (Graham et al., 1994). Furthermore, IL-1β, which promotes trophoblast invasion, up-regulates uPA expression in EVTs (Karmakar and Das, 2002). This suggests that uPA may play a key role in regulating EVT invasion during pregnancy. PAI inhibits the proteolytic activity of uPA by forming a complex with uPAR in a covalent manner that results in a conformational change (Andreasen et al., 1990). TGF-  16  β1, a growth factor that inhibits trophoblast invasion, can up-regulate PAI-1 and PAI-2 in EVTs (Graham, 1997; Karmakar and Das, 2002). In addition, PAI-1 and PAI-2 are differentially expressed during the terminal differentiation and fusion of villous cytotrophoblasts isolated from human term placenta. PAI-1 is highly expressed in freshly isolated mononucleate cytotrophoblasts, while PAI-2 is highly expressed in the terminally differentiated syncytial trophoblast (Feinberg et al., 1989). Matrix metalloproteinases and their inhibitors  Matrix metalloproteinases (MMPs) are a homologous family of proteolytic enzymes. Based on their substrate specificity and structure, over 20 members of the MMP gene family are classified into four subgroups: the collagenases (MMP-1, MMP-8 and MMP13) that digest type I, II, III, VII, and X collagens, which are major constituents of interstitial ECM; the gelatinases (MMP-2 and MMP-9) that digest type IV collagen, a basement membrane protein; membrane-type MMPs (MMP-14, MMP-15 and MMP-16) that are most commonly assigned a role in activating proMMP-2 by cleaving it at the cell surface; and the stromelysins (MMP-3, MMP-7, MMP-10, MMP-11, and MMP-12) that digest type IV, V and VII collagens, proteoglycans, laminin, fibronectin and elastin (Wang et al., 2000, Bischof et al., 2001; Cohen et al., 2006; Fingleton, 2006). These proteinases hold a zinc atom in a highly conserved active site and are responsible for ECM remodelling (Brown and Giavazzi, 1995). MMPs were initially thought to function mainly as enzymes that degrade the structural components of the ECM. However, these  17  proteinases have been found to regulate tissue architecture through their effects on the ECM and intercellular junctions, by producing substrate-cleavage fragments, creating spaces for cells to migrate, thereby activating or deactivating signalling molecules, either directly or indirectly (Sternlicht and Werb, 2001). MMPs are tightly controlled, due to their degradative potential, and are secreted as latent proenzymes. The removal of an amino-terminal domain is required for the enzyme to be activated (Springman et al., 1990; Kleiner and Stetler-Stevenson, 1993). This tight regulation of enzyme activity is necessary in normal physiological situations, such as in wound healing or morphogenesis (Brenner et al., 1989; Bullen et al., 1995). However, there is excessive MMP expression in cancer progression (Brown et al., 1993; Davies et al., 1993).  This enables the tumour cells to grow and then invade into the blood  circulation and lymphatic system, thus leading to tumour spread. Current studies show that the relationship between MMP expression and cancer is complex.  For example, increased MMP activity may promote or inhibit tumour  progression (Coussens et al., 2002) depending on factors such as the tumour site (primary or metastasis), the tumour stage and the MMP substrate profile and enzyme localization (tumor vs. stromal) (Fridman, 2006). MMP-2 and MMP-9 have been linked with the processes of cancer cell invasion and metastasis in humans, as these two proteinases have been associated in the progression of cervical uterine cancer (Libra et al., 2009). Furthermore, as the ECM may be the primary barrier to tumour growth and spread, MMPs may assist malignant tumour cells to overcome this barrier, and thus represent therapeutic targets in the treatment of cancer metastasis (Brown and Giavazzi, 1995).  18  The membrane-type MMPs (MT-MMPs), form a distinct membrane-type subclass in the MMP family since all the others members are secreted in the soluble forms. Instead, MT-MMPs induce the activation of pro-gelatinase A (68-kDa in gelatine zymography) on the cell surface into the activated form of 62-kDA fragments through a 64-kDa intermediate form (Sato et al., 1994; Takino et al., 1995). MT-MMPs have a major impact on cancer development due to their cellular localization at the tumour-matrix interface, for example, MT1-MMP promotes tumour invasion (Fridman, 2006). Furthermore, loss-of-function studies targeting MT1-MMP or MT2-MMP completely abolish the ability of SNAIL to induce carcinoma cell invasion through the underlying basement membrane (Ota et al., 2009). Several studies have shown that MMP-2 and MMP-9 synthesis and activation are also necessary for trophoblast invasion (Librach et al., 1991, Shimonovitz et al., 1994; Bishop and Campana, 2000; Isaka et al., 2003).  These two proteinases are differentially  expressed in the first trimester (6-8 weeks) when trophoblast cells with MMP-2 being a key enzyme (gelatinase) are involved in trophoblast invasion through ECM degradation. In the late first trimester (9-12 weeks) trophoblasts, both of these gelatinases, MMP-2 and MMP-9 are involved in trophoblast invasion through degradation of collagen IV, the main component of the basement membrane (Librach et al., 1991; Xu et al., 2000; StaunRam et al., 2004). Besides regulating extravillous cytotrophoblast invasion, MMP-2 and MMP-9 are produced by the syncytial trophoblast and have a role in degradation and reformation of the placental basal lamina of chorionic villi (Sawicki et al., 2000). The MMPs are inhibited by proteinase inhibitors known as tissue inhibitors of metalloproteinases (TIMPs). The TIMPs (TIMP-1, TIMP-2, TIMP-3 and TIMP-4) share  19  sequence identity with one another, and have similar activities towards the various members of the MMP gene family. However some specificity is evidenced by the finding that TIMP-1 preferentially binds to MMP-9, while TIMP-2 and TIMP-3, but not TIMP-1, are effective inhibitors of Membrane Type-MMPs (Strongin et al., 1995). Several MMPs and TIMPs are co-expressed in trophoblasts, suggesting that the invasive capacity of cytotrophoblastic cells could depend on the relative expression of various MMPs and TIMPs (Freitas et al., 1999; Terrade et al., 2002).  1.3.2: Extracellular matrix deposition  The ECM plays crucial roles in maintaining tissue integrity as well as modulating cellular differentiation during development (Lin and Bissell, 1991; Adams and Watt, 1993).  The ECM also modulates the terminal differentiation and fusion of villous  cytotrophoblasts isolated from term placenta (Kao et al., 1988).  In humans,  mononucleate cytotrophoblasts are separated from villous mesenchymal tissue by a basement membrane. Several ECM components including collagen type IV, laminin, heparan sulphate and proteoglycan are found within the basement membrane (Earl et al, 1990; Damsky et al., 1992; Onodera et al., 1997). The glycoprotein fibronectin is, however, expressed at different gestational periods in the basement membrane (Yamada et al., 1987; Virtanen et al., 1988; Earl et al., 1990), and addition of fibronectin to primary cultures of cytotrophoblasts promotes syncytial trophoblast formation in vitro (Kao et al., 1988). In addition, oncofetal fibronectin, an alternatively spliced variant of fibronectin, is synthesized and secreted by trophoblast cells in culture, and has been  20  identified at the contact sites between cytotrophoblast columns and the maternal decidua (Matsuura and Hakomori, 1985; Matsuura et al., 1989; Feinberg et al., 1991), suggesting that oncofetal fibronectin maintains placental-uterine interactions during pregnancy. Another ECM component known as tenascin has anti-adhesive properties in vitro (Aufderheide and Ekblom, 1988).  This glycoprotein is expressed in areas beneath  degenerating syncytium, at locations where cytotrophoblast cells proliferate (Castelluci et al., 1991; Damsky et al., 1992). This suggests that tenascin may play a direct or indirect role in modulating villous cytotrophoblast differentiation.  1.3.3: ECM interactions: the integrin gene superfamily of cell adhesion molecules  One of the best characterized groups of ECM receptors that mediate cell-ECM interactions are the integrins (Lochter, 1999). Integrins are glycoproteins and members of a protein family that forms heterodimeric subunits that interact with various ECM components (van der Flier and Sonnenberg, 2001). In mammals, 16 different integrin α and 8 different integrin β subunits are currently known (Giancotti, 1997). The α and β subunits interact with each other noncovalently. Each integrin has a specific set of extracellular ligands, and the ligand specificity of the different integrin heterodimers is determined by the specific combination of α and β subunits expressed on the cell surface (Lafrenie and Yamada, 1996). Each subunit has a large extracellular domain, a single transmembrane domain, and a short, noncatalytic cytoplasmic tail, apart from the β4 subunit that has a very large cytoplasmic domain (Colombatti et al., 1993). Integrins are involved not only in adhesive functions between the cell and the ECM that provide  21  traction for movement and cell migration, but they can mediate cell-cell adhesion, and activate signal transduction pathways for anchorage-dependent survival and growth (Rosen et al., 1989). Integrins are expressed in endometrial, decidual, and extravillous cytotrophoblasts (EVTs). During early pregnancy, different members of integrin subtypes (αVβ3, α4β1, α5β1, α6β1 and α7β1) are expressed in trophoblast-endometrium interfaces. During the differentiation of cytotrophoblasts along the extravillous pathway, expression of various integrins differs between proliferative and endovascular EVTs (Merviel et al., 2001). Function-perturbing antibodies to the α5β1 integrin subtype interrupt the organization of extravillous cytotrophoblast columns that form in chorionic villous explant cultures (Aplin et al., 1999). Aberrant expression of αvβ3 is associated with infertility, and women with recurrent miscarriages have a lower expression of α4β1 and α5β1 integrins in the stroma during the implantation window (Skrzypczak et al., 2001). Several other health issues such as preeclampsia and intrauterine growth restriction are believed to be caused by placental vascular problems that may explained by abnormalities in integrin patterns (Damsky et al., 1992; Aplin 1994, Merviel et al., 2001). In female mice, lack of a functional integrin β1 gene results in normal early embryonic development, but there is a failure to implant properly, with subsequent embryonic death (Stephens et al., 1995). Other factors known to be involved in the implantation process may act through integrins. One example includes insulin-like growth factor-1 (IGF-1) mediated migration of EVTs that involves the αVβ3 integrin pathway (Kabir-Salmani et al., 2003 and 2004).  22  1.3.4: Cell-cell interactions  Many studies have focused on the expression of various members of the immunoglobin (Ig) gene superfamily of Ca2+-independent cell adhesion molecules (CAMs) in human trophoblastic cells (Buck, 1992; Burrows et al., 1996). For example, EVTs express vascular (V)-CAM-1, carcinoembryonic antigen (CEA)-CAM, melanoma (Mel)-CAM, platelet-endothelial (PE)-CAM-1, intercellular (I)-CAM, and neural (N)CAM during the first trimester of pregnancy (Damsky et al., 1992; Burrows et al., 1994; Shih and Kurman, 1996; Coukos et al., 1998; Bamberger et al., 2000). A member of the selectin gene family of Ca2+-dependent CAMs called E-selectin, that mediates leukocyteendothelial cell interactions during inflammation, is also found in these EVT cells (Vestweber, 1992; Varki, 1994; Milstone et al., 2000). There is evidence that E-selectin influences how the blastocyst rolls along the inner uterine wall prior to implantation (Hoozemans et al., 2004). However, the biological function(s) of these CAMs at the maternal-fetal interface remains unclear and requires further investigation. The regulated expression of gap junction components known as connexins (Cx), that help to establish cell-cell interactions, has been investigated during human trophoblast differentiation and invasion. A Cx subtype known as Cx43 is expressed in isolated human trophoblastic cells (Cronier et al., 1994). However, the role of gap junctions in the terminal differentiation and fusion of human villous cytotrophoblast remains to be elucidated. Although gap junctions between villous cytotrophoblasts and the syncytial trophoblast in the first trimester placenta were detected in early ultrastructural  23  observations (De Viergilis et al., 1982), these junctions are not present in the trophoblastic cells from human term placenta (Metz et al., 1979 and 1980).  1.4: The cadherin superfamily  In view of the significant role of cell adhesion molecules involvement in regulating human trophoblast differentiation, we have focused our attention on the gene superfamily of cell adhesion molecules known as the cadherins. Cadherins are a gene superfamily of integral membrane glycoproteins that mediate calcium-dependent cell adhesion through homophilic interactions.  The structural components of this gene family include an  extracellular domain responsible for cell-cell interactions, a transmembrane domain, and a cytoplasmic domain that is linked to the cytoskeleton (Yagi and Takeichi, 2000). This gene superfamily of cell adhesion molecules consists of two evolutionarily distinct subfamilies: classical cadherins, which are homophilic Ca2+-dependent cell-cell adhesion molecules; and non-classical cadherins (Yagi and Takeichi, 2000; Angst et al., 2001). Cadherins are widely known to regulate cell-cell adhesions, regulate cell shape, proliferation, migration, differentiation, and segregation, and are involved in intercellular signalling networks (Takeichi, 1991, 1995).  1.4.1: Classical cadherins  Over 15 members of the classical cadherin subfamily have been identified and are sub-classified into type I and type II cadherins. The most commonly known members of  24  the cadherin gene superfamily consist of a carboxy terminal cytoplasmic domain, a transmembrane domain, and an amino terminal extracellular domain, (Grunwald, 1993) (Figure 1.2). Some of the classical type I cadherins include E-cadherin (E-cad), Ncadherin (N-cad) and P-cadherin (P-cad). The names of these cell adhesion molecules originated from their tissue distribution during mouse embryonic development; with Ecad mainly expressed in epithelial cells, N-cad in neuronal cells and P-cad in the placenta (Nose and Takeichi 1986, Nagafuchi et al., 1987; Hatta et al., 1988; Suzuki et al., 1991). Type II classical cadherins include cadherin-6, -7, -8, -9, -10, -11, -12, -14, -19, and -20 (Takeichi, 1995). The classical cadherin subfamily is defined by their highly conserved cytoplasmic domain, which connect with catenins (α-catenin, β-catenin, γ-catenin [also called plakoglobin], and p120ctn) to form the cytoplasmic cell adhesion complex that is necessary for extracellular cell-cell adhesion (Shibamoto et al., 1995; Cavallaro et al., 2002). For example, β-catenin and γ-catenin bind to the same conserved site at the Cterminal region of E-CAD in a mutually exclusive way (Ozawa et al., 1989; Nathke et al., 1994; Witcher et al., 1996), whereas p120ctn interacts with multiple sites in the cytoplasmic tail of E-CAD, including the juxtamembrane region (Ozawa, 1998; Yap et al., 1998). It is also known that α-catenin binds directly to β-catenin and γ-catenin, and thereby connects the cytoplasmic cell adhesion complex to the actin cytoskeleton (Cavallaro et al., 2002). Studies using X-ray diffraction analysis suggest that the N-CAD extracellular domain forms a dimer, in which two monomers are arranged in parallel at the plasma membrane by forming an “adhesion dimer” at their N-terminus. An alternative model is that the two  25  monomers are arranged to form a rod- or cylinder-like oligomer rather than two monomers arranged in parallel (Takeichi, 1995).  In addition, Ca2+ is essential for  cadherin function by linking the five subdomains to form a rod-shape morphology on the cadherin molecules (Tong et al., 1994). Type I and type II cadherins consist five extracellular repeats (EC1-5), and the main difference between them is the presence of a histidine, alanine, valine (HAV) tripeptide within the extracellular repeat (EC1) that is closest to the N-terminus.  Cadherin  molecules with a deletion of EC1 fail to mediate cell-cell interactions, suggesting that the HAV domain interactions between two CAMs may constribute to mediating homophilic protein-protein interaction (Takeichi, 1990; Knudsen et al., 1998). However, the HAV motif is not conserved in Type II cadherins, and the molecular basis of the specificity of cadherin interactions remains unclear. Furthermore, recent X-ray diffraction studies of  26  Extracellular (EC)  HAV  Ca2+  Ca2+  Transmembrane (TM)  Ca2+  Cytoplasmic (CP)  Ca2+ p120  NH2  EC1  EC2  EC3  EC4  EC5  TM  CP1  COOH  CP2 β/γ  α Mf  Figure 1.2. Schematic diagram representing the basic structure of type 1 classical cadherins in the plasma membrane. The cadherins are comprised of five extracellular subdomains (EC1-EC5). The EC1 subdomain contains the HAV, which is believed to play a role in cadherin-mediated adhesion. The cytoplasmic subdomains are highly conserved regions interact with a family of cytoplasmic proteins known as the catenins. CP1 interacts with p120ctn and CP2 forms complexes with either β or γ-catenin and αcatenin. These interactions are believed to link the cadherins to the actin-based microfilaments (MF) of the cytoskeleton.  27  the extracellular domain of the Xenopus Type I cadherins suggest that other extracellular interfaces are involved in cadherin interactions, including the conserved tryptophan side chain at the membrane-distal end of a cadherin that intercalates into a conserved hydrophobic pocket in the corresponding partner (Boggon et al., 2002). Classical cadherins undergo calcium-dependent cell-cell adhesion in a homophilic manner, preferentially binding to like molecules, although in some cases a particular cadherin subtype may interact heterophilically with another cadherin subtype when two cell populations are mixed (Takeishi, 1995). Therefore, the interactions between two given cadherins can be classified into three categories: little or no heterophilic interactions; weak heterophilic interactions; and those in which homophilic and heterophilic interactions are not distinguishable (Nakagawa et al., 1995; Takeichi, 1995). Although the activity of Type I cadherins in tissue formation has been widely studied, with a focus on their cell adhesive properties, this is not the case for many Type II cadherins. However, some of the type II molecules are expressed in loosely associated cells, suggesting a weaker cell-cell interaction compared to type I molecules (Takeichi, 1995; Gumbiner, 1996).  1.4.2: Classical cadherins involvement in developmental processes  In addition to maintaining the structural integrity of cells and tissues, cadherins control a wide range of cellular behaviours (Huber et al., 1996; Larue et al., 1996). They regulate cell polarization (Larue et el., 1994; Riethmacher et al., 1995), and cell  28  movements including cell sorting and cell migration (Nose et al., 1988; Takeichi, 1988; Steinberg and Takeichi, 1994). E-cad-deficient mouse embryos cannot normally develop into blastocysts, thus confirming the importance of E-cad in the organization of pre-implantation embryos (Larue et al., 1994; Riethmacher et al., 1995). N-cad, like E-cad, is critical during embryonic development. Indeed, the loss of either of these cadherin subtypes results in early embryonic death (Larue et al., 1994; Radice et al., 1997a). In addition, in mice without functional N-CAD, the myocardium is malformed, causing arrest of heart development, and the neural tube and somites are also not properly formed (Radice et al., 1997a). However, null mutant mice R-cadherin (R-cad) or P-cadherin (P-cad) are viable and fertile (Radice et al., 1997b; Dahl et al., 2002).  1.4.3: Classical cadherins and cancer  The majority of human cancers originate from epithelial cells. These epithelial cells are organized by a number of specific intercellular junctions, including adherenstype-junctions, tight junctions and desmosomes, which are interconnected with the actin and intermediate filament cytoskeleton (Cavallaro et al., 2002). Among the cell-cell adhesion molecules, cadherins appear to play a crucial role in establishing adherens-typejunctions (Takeichi, 1995; Huber et al., 1996; Yagi and Takeichi, 2000). It is well known that cell-cell adhesion is changed markedly during the development of malignant cancers (Cavallaro et al., 2002). For instance, loss of E-CAD-mediated cell-cell adhesion is a requirement for tumour cell invasion and metastasis formation (Birchmeier and Behrens,  29  1994). Recent evidence demonstrates that N-cad is dominant over E-cad in metastatic progression and is overexpressed in a subset of cancer types in addition to the loss of Ecad (Derycke et al., 2004; Hazan et al., 2004). Nieman et al. (1999) reported that forced expression of N-cad causes E-cad to be down-regulated in breast cancer cells. The increase of N-cad expression increases the resistance to apoptotic stimuli, and a more invasive and motile cell phenotype and metastasis in nude mice (Cavallaro et al., 2002 and 2004; Jiang et al., 2007), thus demonstrating opposite effects to E-cad. It has been suggested in that a switch from epithelial to mesenchymal cadherins supports the transition from benign to an invasive, malignant tumor phenotype. In contrast, Rosivatz et al. (2004) suggest that E-CAD transcriptional repression may not play a major role in colon cancer pathogenesis, and other studies did not always observe a correlation between reduced E-CAD immunohistochemistry and tumor progression.  However, in the latter study, the same tumors had N-CAD  immunoreactivity in 44% of the cases. It seems that N-cad has an invasion promoting effect, as earlier shown for other carcinomas, and that N-cad induced invasion activities can even overcome the E-CAD tumor suppressive function (Hazan et al., 1997; Nieman et al., 1999). This suggests that the “cadherin switch” can vary in a tumor-specific manner. As discussed previously, villous cytotrophoblasts differentiating along the EVT pathway utilize similar molecular mechanisms to those employed in cancer cells (Bischof et al., 2001; Lala et al., 2002). Unlike cancer cell invasion, normal EVT invasion into the maternal endometrium and vasculature is highly regulated (Graham et al., 1993; Irving et  30  al., 1995). We therefore speculate that cadherins play an important role in human trophoblast invasion. Several mechanisms are involved in the loss of E-CAD function during tumourigenesis; these include mutation or deletions of the E-cad gene itself, transcription repression of the E-cad gene, hypermethylation of CpG islands or chromatin rearrangements in the E-cad promoter region, as well as in the β-catenin gene (Hirohashi, 1998). Several studies have highlighted transcription repression as the major mechanism leading to decreased E-cad expression (Schipper et al., 1991; Bussemakers et al., 1992; Brabant et al., 1993). E-cad transcription repressors belong to three families: i) TWIST; ii) SNAIL (SNAIL1, SNAIL2 (SLUG), SNAIL3), and ZEB1 (DeltaEF1)/ ZEB2 (SIP1), and interact with the E-cad gene promoter (Cano et al., 2000; Comjin et al., 2001; Bolos et al., 2003). For example, in many human carcinomas of the ovary, liver, colon, and gastrointestinal tract, Snail expression correlates with inhibition of E-cad expression (Blanco et al., 2002; Jiao et al., 2002).  Furthermore, TWIST has been shown to  transcriptionally repress E-cad in breast cancers (Yang et al., 2004; Vesuna et al., 2008). In human gastric cancer, an increase in Snail mRNA expression is associated with a down-regulation of E-cad. An increase in N-cad mRNA levels was also detected in the same tumours, likely due to the overexpression of Twist (Rosivatz et al., 2002). Twist also induces N-cad expression in prostate carcinoma cells (Alexander et al., 2006). This suggests these EMT regulators could play different roles in gastric carcinogenesis depending on the histological subtype (Rosivatz et al., 2002).  In relation to the  mechanism that regulates E-cad, in vivo footprinting analysis shows that the positive  31  regulatory elements of the E-cad promoter (the CCAAT-box) were bound by transcription factors in cells that expressed E-cad but not in non-expressing cells (Hirohashi, 1998).  1.4.4: Classical cadherins and placentation  It is acknowledged that morphogenesis and cell differentiation depend, in part, on the regulated expression of cell surface glycoproteins and their connections to the cytoskeleton (Edelman, 1988). Some of these adhesion molecules are well-characterized including E-CAD (Damsky et al., 1984; Takeichi, 1991; Kemler et al., 1989). In regard to embryonic development and placental morphogenesis, E-CAD has been gaining much attention (Coutifaris et al., 1991) because antibodies against E-CAD have shown to inhibit the compaction of preimplantation mouse embryos: a developmental process that involves blastomere adhesion and formation of intercellular junctions (Hyafil et al., 1980; Damsky et al., 1983; Vestweber and Kemler, 1984). In addition, E-cad mRNA and protein levels are high in freshly isolated villous cytotrophoblasts and decrease as the cells begin to undergo differentiation and fusion to form multinucleated syncytia (Coutifaris et al., 1991; Rebut-Bonneton et al., 1993). Similarly, E-CAD has been localized on the surface of cytotrophoblasts in situ, but not on the surface of the syncytiotrophoblast (Eidelman et al., 1989).  Furthermore, immunoneutralization  experiments using an antiserum directed against the cell adhesion domain of cadherins found inhibition of the formation of syncytia in comparison to an antiserum against the cytoplasmic tail of E-cad, which had no effect upon aggregation and fusion of these cells  32  (Blaschuk et al., 1990; Pouliot et al., 1990; Coutifaris et al., 1991; Farookhi and Blaschuk, 1991). A type II classical cadherin known as cadherin-11 (Cad-11) plays an important role in mediating trophoblast-endometrium interactions.  Its expression increases during the  formation of multinucleated syncytia in primary cultures of human cytotrophoblasts. When cad-11 was transfected into poorly invasive JEG-3 choriocarcinoma cells, this resulted in the formation of multinucleated syncytia in the transfected JEG-3 cell cultures (MacCalman et al., 1996; Getsios and MacCalman, 2003). This suggests that cad-11 contributes to the morphological and functional differentiation of the multinucleated syncytial trophoblast.  1.5: TWIST- A basic helix-loop-helix transcription factor  The Twist gene encodes a transcription factor that was originally identified in Drosophila. The human Twist gene is located at 7p21 and comprises two exons that are separated by an intron. TWIST contains a conserved basic helix-loop-helix (bHLH) domain (Bourgeois et al., 1996) (Figure 1.3). The function of bHLH transcription factors depends on the DNA-binding region and an HLH motif that mediates homodimerization or heterodimerization with other HLH proteins to form a functional dimer that can recognize and bind to a DNA motif called the E-box (Benezra et al., 1990; Massari and Murre, 2000; Castanon and Baylies, 2002).  33  bHLH Basic domain NH2  b  Loop H  Helix  L  H  COOH  Helix  Figure 1.3. Schematic diagram representing of the protein structure of the human Twist. The TWIST protein has 202 amino acids with a basic helix-loop-helix domain. The basic (b) is the DNA-binding region and the helix-loop-helix mediates homodimerization or heterodimerization with other HLH proteins to form a functional dimer.  34  Post-translational modifications like phosphorylation can alter the dimerization choices of TWIST, either promoting homodimer or heterodimer formation (Firulli et al., 2005), and different TWIST dimerization partners could have specific effects on the transcription regulatory function of TWIST. It has been suggested that TWIST as a heterodimer functions is a transcription repressor, while TWIST homodimers favour the upregulation gene expression by functioning as a transcription activator. For example, in studies of human cranial suture patterning and Drosophila mesoderm development, TWIST homodimers function as transcriptional activators (Castanon et al., 2001; Connerney et al., 2006).  1.5.1: Twist- A key player in cell differentiation and morphogenesis  Twist is expressed in mesodermal and cranial neural crest cells during embryogenesis in vertebrate and invertebrate development (Thisse et al., 1988; Fuchtbauer, 1995). Studies have shown that mutated Twist results in a twisted phenotype in Drosophila embryos, suggesting the expression pattern of Twist is associated with the formation and specification of the mesoderm (Thisse et al., 1988; Leptin, 1991). Heterozygous Twist mutant mice show a number of craniofacial defects, including a narrow palate and craniosynostosis. This is similar to patients with a skeletal dysplasia termed SaethreChotzen’s syndrome, in which reported mutations were found to involve the bHLH domain of the Twist gene (El Ghouzzi et al., 1997; Bourgeois et al., 1998). Furthermore, Bialet et al. (2004) demonstrated that the molecular defect in the Saethre-Chotzen syndrome is caused by haploinsufficiency at the Twist locus. This gene  35  mutation which leaves TWIST’s bHLH domain intact but disrupts its TWIST box results in a serious form of the disease, with limb patterning defects (Gripp et al., 2000; Bialet et al., 2004).  Bialet et al. (2004) has also shown that TWIST inhibits osteoblast  differentiation by interfering with RUNX2, a member of the RUNX family of transcription factors which function through interacting with specific domains in these proteins; i.e., the TWIST box (a domain distinct from their bHLH domains) and a RUNX2 DNA binding domain.  1.5.2: Twist and cancers  Twist is linked to metastases of a wide range tumour types including those of ovary, breast and prostate tissues (Kwok et al., 2005; Puisieux et al., 2006; Hosono et al., 2007). Recently, Twist was shown to play a key role in inducing cell movement and tissue reorganization during invasion and metastasis in breast cancer. Indeed Twist clearly appears to be one of the most strongly up-regulated genes responsible for invasiveness and/or intravasation of mouse mammary tumors (Yang et al., 2004). Twist also has antiapoptotic effects and can play a role in cell survival (Maestro et al., 1999). Yang et al. (2004) reported that suppression of Twist expression in highly metastatic mammary carcinoma cells specifically inhibits their metastasis to the lung. Furthermore, inhibition of Twist expression using small interfering RNA (siRNA) significantly impairs the metastatic ability of the most metastatic tumour cell lines (Yang et al., 2004). EMT is characterized by the gain of mesenchymal cell markers such as N-CAD, vimentin, smooth musle actin, and fibronectin; and the lost of epithelial markers such as  36  E-CAD and catenins (Thiery, 2003; Ridisky, 2005). The loss of E-CAD protein and/or transcriptional repression of E-cad mRNA are hallmarks of EMT, both in cancer progression and embryonic development (Thiery, 2002 and 2003). As mentioned previously, a major mechanism leading to decreased E-CAD levels seems to be a decrease in E-cad transcription (Bussemakers et al., 1993). TWIST is known to play a key role in E-cad repression and EMT induction (Yang et al., 2004). Inactivation of Twist reduces migration and invasion abilities of androgen-independent prostate cancer cells, and is correlated with induction of E-cad expression as well as morphologic and molecular changes linked with EMT (Kwok et al., 2005). In line with its function in EMT, TWIST represses transcription from the E-cad promoter via the E-boxes that are also targeted by SNAIL and SIP1 (Comijn et al., 2001). In addition, high TWIST levels are also linked with deep myometrial invasion of cancer cells and were concurrent with decreased E-CAD levels, a hallmark of EMT (Satoru et al., 2006). The gain of N-cad expression, a mesenchymal marker, may increase motility and invasion of carcinoma cells as well (Cavallaro et al., 2002). The switch from E-CAD to N-CAD is mediated by a number of transcription factors, including TWIST, SIP1 and SNAIL1 (Rosivatz et al., 2004). As mentioned earlier, TWIST has been shown to be essential for the initiation of N-cad expression in Drosophilla (Oda et al., 1998) and in cancer cell invasion (Alexander et al., 2002; Rosivatz et al., 2002). The effect of TWIST on inducing N-cad is exerted by a direct interaction with an E-box cis-element located within the first intron of the N-cad gene (Alexandra et al., 2006).  37  Since Twist has regulatory and functional roles in both cancer differentiation and normal differentiation, we speculate that Twist may play an important role in human trophoblast differentiation.  1.6: Runt-related Gene (Runx) family  The Runx family is composed of three closely related genes; Runt-related gene 1 (Runx1), Runt-related gene 2 (Runx2), and Runt-related gene 3 (Runx3), each with tissue-specific functions and are homologous to the Drosophila gene runt.  RUNX  proteins are scaffolding transcription factors, which contain a runt homology domain that serves as the DNA-binding domain. They localize to subnuclear domains and translate cell signals through the formation of gene promoter regulatory complexes (Zaidi et al., 2001 and 2003). An essential feature of RUNX proteins is their C-terminal nuclear matrix targeting signal (NMTS) domain that mediates the organization of regulatory complexes (Zaidi et al., 2004) (Figure 1.4).  They can form heterodimers with the  transcriptional co-activator core binding factor β (CBF β)/ polyoma enhancer binding protein 2β (PEBP 2β) in vitro (Komori, 2006). RUNX proteins control different aspects of embryonic development, and they are usually anti-proliferative in cellular differentiation in normal tissues. In addition, these transcription factors are known for their pathogenic function in different human diseases (Guo et al., 2002; Pratap et al., 2003; Wotton et al., 2004). RUNX proteins are known to be involved in haematopoiesis (RUNX1), osteogenesis (RUNX2), and neurogenesis (RUNX3), and are also involved in other developmental processes. For example,  38  DNA Binding  NH2  RHD  Subnuclear Targeting  NLS  NMTS  COOH  Nuclear Import  Figure 1.4. Schematic diagram representing of the protein structure of the human Runx2. The RUNX2 protein consists of runt homology domain (RHD) that serves as the DNAbinding domain, the nuclear localization signal (NLS) that directs newly synthesized protein into the nucleus and the nuclear matrix targeting signal (NMTS) domain that mediates the organization of regulatory complexes.  39  conditional expression of Runx1 in an endothelial progenitor cell line from the aortagonad mesonephros region in mice, initiated Vascular Endothelial-cadherin expression and greatly enhanced the vascular network formation activity of the cells, suggesting that Runx1 plays a role in angiogenesis through Vascular Endothelial-cadherin (Iwatsuki et al., 2005). Furthermore, RUNX1 and RUNX3 have both been identified to play a role in the nervous system of mice. RUNX1 plays a role in the nociceptive development of the sensory neurons, however, RUNX3 is responsible for the proprioceptive sensory neurons. Both of these developmental processes are critical in neuronal development (Inoue and Ito, 2008). RUNX proteins can function as cell context-dependent tumour suppressors or oncogenes (Blyth et al., 2005). Aberrant expression of Runx genes is associated with cell transformation and tumour progression (Pratap et al., 2006).  For example, Runx1  mutations and chromosomal translocations have been associated with leukemia subtypes. Amplification of Runx1 is associated with poor prognosis in childhood B-cell leukemia (Osato and Ito, 2005), and loss of Runx3 predisposes mice to gastric hyperplasia (Lau et al., 2006). Recently, the study of RUNX3 in tumour pathogenesis is gaining more attention in the field of cancer research. The RUNX3 transcription factor has been identified to be a downstream effector of the transforming growth factor-β (TGF-β) signalling pathway in controlling cell proliferation, cell invasion, cell adhesion and apoptosis.  This  transcription factor has also been shown to play a role as a tumour suppressor in colorectal and gastric cancers (Subramanian et al., 2009). However, RUNX3 functional  40  inactivation caused by mutation or epigenetic silencing has been seen in a wide range of tumour origins from early progression to malignancy (Chuang and Ito, 2010).  1.6.1: Runt-related Gene 2 (Runx2)  Runx2 expression was initially reported in T cells during thymic development and regulates the osteoblast-specific expression of osteocalcin (Ducy and Karsenty, 1995; Satake et al., 1995; Ducy et al., 1997). Loss of function mutations of Runx2 are linked to Cleidocranial dysplasia syndrome in humans (Otto et al., 2002). Runx2 provides an important mechanistic linkage between cell fate, proliferation, growth control, and lineage commitment. Runx2 has been characterized in bone tissue and is expressed in mesenchymal lineage cells promoting the osteoblast phenotype for bone formation (Otto et al., 1997, Pratap et al., 2006). RUNX2 is the most specific molecular marker of osteoblast lineage; it is needed to induce osteoblast differentiation as well as to regulate most of the genes characteristic of the osteoblast phenotype (Ducy et al., 1997; Komori et al., 1997; Otto et al., 1997). Runx2-/- mice demonstrate a complete lack of both intramembranous and endochondral ossification due to the absence of osteoblast differentiation (Otto et al., 1997). RUNX2 can also act as a suppressor of ribosomal RNA (rRNA) synthesis (Zaidi et al., 2001; Young et al., 2007). It is also highly expressed in several other tissue types, including the testis (Ogawa et al., 2000), mammary epithelium (Inman and Shore, 2003), endothelial cells (Sun et al., 2001), and prostate and breast tumours (Yeung et al., 2002; Barnes et al., 2003).  41  Runx2 also promotes vascular endothelial growth factor (VEGF) expression in hypertrophic chondrocytes to mediate angiogenesis during bone synthesis. Runx2 is highly expressed in human and mouse models of angiogenesis, suggesting a possible function for RUNX2 in neovascularisation of adult tissues. Inactivation of the Runx2 gene in mice leads to an absence of vascularisation, in addition to the abnormal bone formation described above (Ducy et al., 1997; Zelzer et al., 2001). Runx2 and cancers  The proper control of gene expression by transcriptional regulators is crucial in balancing the physiological levels of proteins necessary for normal cell function. However, the expression and activities of master transcription factors such as RUNX, TWIST and HOX can become irregular due to mutation, epigenetic changes in chromatin or chromosomal translocations, and can alter the expression of their downstream targets in cancer cells (Yang et al., 2004; Blyth et al., 2005; Grier et al., 2005). The oncogenic potential of Runx2 is suggested by high levels of endogenous RUNX2 in breast and prostate cancer cells associated with aggressive tumour growth in bone (Barnes et al., 2004; Javed et al., 2005).  However, tumours do not appear in heterozygotes with  haploinsufficiency of Runx2, suggesting Runx2 does not have a role in tumour suppression (Blyth et al., 2005). In cancer cells, Runx2 can activate expression of adhesion proteins, matrix metalloproteinases and angiogenic factors that are related to the invasive properties of metastatic cancer cells (Pratap et al., 2006a), and MMPs have long been implicated in  42  tumour invasion and metastasis (Egeblad and Werb, 2002). RUNX2 transciption factor plays a role in regulating MMP-9 expression and promoting cell invasion in bone metastatic cancer cells (Pratap et al., 2005).  This is important because one of the  processes required for trophoblast invasion is the degradation and remodelling of the MMPs (Cohen et al., 2006). Regulation and activation of Runx2  Increased transcription, epigenetic modifications in chromatin, or silencing of Runx2 repressor proteins have been linked to upregulation of Runx2 expression in breast and prostate cancer cells (Spencer and Davie, 2000; Young et al., 2005). Dysregulation of post-translational modifications (acetylation, ubiquitination, and phosphorylation) can affect the transcriptional activity of Runx2 in cancer cells (Bae and Lee, 2006; Jeon et al., 2006). TGF-β treatment decreases Runx2 expression in osteoblasts, and repeated TGF-β treatment also decreases the amount of functional RUNX2 binding to DNA (Komori, 2006). In addition, Runx2 mediates the responses of cells to signal pathways that are often hyperactive in tumours, including those initiated by TGF-β and other growth factors. The Smads act as effectors of TGF-β to induce changes in gene expression. TGF-β binds to the TβRI/ TβRII receptor complex at the cell surface and activates SMAD 2 and SMAD 3 through phosphorylation, these then form complexes with SMAD 4 and translocate into the nucleus. These complexes link with transcription factors to regulate gene expression through DNA binding (Feng and Derynck, 2005).  43 Interactions between RUNX2 and TWIST  The Saethre-Chotzen (SC) syndrome is characterized by increased osteogenesis and premature fusion of cranial sutures caused by Twist mutations (Yousfi et al., 2002). Decreased Twist production causes a narrow sutural space and fusion of bone domains (Yoshida et al., 2004). Other studies have shown that RUNX2 activity is necessary for the regulation of osteoblast differentiation and in the osteogenic switch (Lian et al., 2004). Bialek et al. (2004) suggested Twist may regulate the developmental action of RUNX2 in bone formation. The TWIST box located within the carboxyterminal 20 residues of TWIST is necessary for anti-osteogenic function in mice (Bialek et al., 2004), and it is known to bind with the runt DNA-binding domain of RUNX2 to inhibit RUNX2 transactivation activity (Lian et al., 2004). A decreased level of TWIST may promote RUNX2 function through the lack of inhibitor protein and by the enhancement of its own promoter activity (Yoshida et al., 2005). A point mutation in the TWIST box leads to an acceleration of bone formation in heterozygous and homozygous mice (Bialek et al., 2004). Furthermore, TWIST box mutations in humans prevent the ability of TWIST to inhibit RUNX2 transactivation (Seto et al., 2007). Cell-free pull-down assays with recombinant RUNX2 and TWIST proteins have suggested a direct physical interaction between RUNX2 and TWIST. In contrast, Komari et al. (2007) show that Runx2 gene expression was unaltered upon transient knock down of Twist in periodontal ligament (PDL) cells using short  44  interference RNA (siRNA), suggesting that regulatory interactions between TWIST and RUNX2 are tissue or cell dependent.  45  1.7: Hypothesis and rationale:  A successful implantation depends upon mononucleate cytotrophoblasts entering one of two distinct and mutually exclusive pathways. The villous cytotrophoblastic cells will proliferate and differentiate by fusion to form the outer syncytial trophoblast, or enter the extravillous pathway to form highly invasive EVTs. Previous studies have shown that the down-regulation of E-cad is associated with the terminal differentiation and fusion of human villous cytotrophoblasts in vitro. There is increasing evidence to suggest that this subpopulation of cytotrophoblasts develop an invasive phenotype via molecular and cellular mechanisms adopted by metastatic tumour cells. N-cad has been assigned an integral role in tumour progression and the onset of metastasis but its role in human trophoblastic cell invasion is not known. In view of these observations, the regulated and inverse expression of E-cad and N-cad is a possible mechanism that mediates terminal differentiation of human trophoblastic cells in vitro. The functions of these classical cadherins are known to be regulated, at least in part, by transciption factors in normal development and in cancer progression. The basic helix-loop-helix transcription factor TWIST, as well as the scaffold transcription factor RUNX2, play integral roles in the onset and progression of cancer in a wide variety of tissues. This has prompted the following hypotheses: 1. That the expression of E-cad and N-cad is tightly regulated by TWIST and/or RUNX2 during the terminal differentiation of human trophoblastic cells in vitro, which was investigated as described in Chapters 3 and 4 using BeWo cells, primary EVTs and HTR8/SVneo cells.  46  2. That N-cad plays a key role in regulated development of an invasive phenotype in EVTs, which was investigated as described in Chapter 4 using primary EVTs and HTR8/SVneo cells. 3. That Runx2 plays a key role in regulated development of an invasive phenotype in EVTs, which was investigated as described in Chapter 5 using primary EVTs and HTR8/SVneo cells.  The specific objectives of my studies were: 1. To identify a role for Twist in regulating the cadherin-mediated terminal differentiation of human trophoblastic cells (in both villous and extravillous pathways). 2. To identify a role for N-cad in regulating human trophoblastic cell invasion in vitro. 3. To identify a role for Runx2 in regulating human trophoblastic cell invasion in vitro.  47  CHAPTER 2: MATERIALS AND METHODS  2.1: Tissues  Samples of first trimester placental tissues were obtained from women undergoing elective termination of pregnancy (gestational ages ranging from 6-12 weeks). The use of these tissues was approved by the committee for Ethical Review of Research on the use of Human Subjects, University of British Columbia, Vancouver, BC, Canada. All women provided informed written consent.  2.2: Cells  Cultures of EVTs were propagated from first trimester placental explants as previously described (Getsios et al, 1998). Briefly, chorionic villi were washed three times in PBS. The villi were finely minced and plated in 25cm2 tissue culture flasks containing Dulbecco’s Modified Eagle’s Medium (DMEM) containing 25 mM glucose, L-glutamine, antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS). The fragments of the chorionic villi were allowed to adhere for 2-3 days, after which any non-adherent tissue was removed. The villous explants were cultured for a further 10-14 days with the culture medium being replaced every 48 h. The EVTs were separated from the villous explants by a brief (2-3 min) trypsin digestion at 37°C and plated in 60 mm2 culture dishes in DMEM supplemented with antibiotics and 10% FBS. The purity of the EVT cultures was determined by  48  immunostaining with a monoclonal antibody directed against human cytokeratin filaments 8 and 18 (data not shown). These cellular markers have been used to determine the purity of human EVT cultures (MacCalman et al, 1996). Only cell cultures that exhibited at least 90% immunostaining for cytokeratin were included in these studies. HTR-8/SVneo, an EVT cell line, was obtained as a gift from Dr Charles H. Graham (Queen’s University, Kingston, ON, Canada).  Culturing of HTR-8/SVneo has been  described previously (Graham et al., 1993). HTR-8/SVneo cells were harvested from ongoing cultures with 0.125% (w/v) trypsin in EDTA buffer. HTR-8/SVneo cells were cultured in 100mm culture dishes (Becton Dickinson and Co, Franklin Lakes, NJ, USA) containing Dulbecco’s Modified Eagle’s Medium (DMEM) containing 25 mM glucose, L-glutamine, antibiotics (100U/ml penicillin, 100 µg/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS). BeWo and JEG-3 choriocarcinoma cell lines (American Type Culture Collection, Rockville, MD, USA) were harvested from ongoing cultures with 0.125% (w/v) trypsin in EDTA buffer. BeWo and JEG-3 cells were cultured in 100mm culture dishes (Becton Dickinson and Co, Franklin Lakes, NJ, USA) containing F12 Kaighn’s medium (F12K) containing L-glutamine, antibiotics (100U/ml penicillin, 100 µg/ml streptomycin) and supplemented with 10% fetal bovine serum (FBS).  49  2.3: Experimental culture conditions  BeWo cells (2.5 x 105 cells) were plated in 35 mm2 tissue culture dishes and grown to 80% confluency. Cells were treated with or without 8-bromo-cAMP (1.5mM; SigmaAldrich, St Louis, MO, USA) for 0, 12, 24, 36 or 48 h. According to the manufacturer, cell-permeable  8-bromo-cAMP  has  greater  resistance  to  hydrolysis  by  phosphodiesterases than cAMP. The dosage (1.5mM) of 8-bromo-cAMP was chosen based on previous studies from my laboratory. EVTs (5 x 106 cells) (passages 4-6) were plated in 60 mm2 tissue culture dishes (Becton Dickinson and Co, Franklin Lakes, NJ, USA) and grown to 80% confluency. The cells were then washed with PBS and cultured in DMEM under serum-free conditions. Twenty four hours after the removal of serum from the culture medium, the cells were again washed with PBS before cultured in the presence of TGF-β1 (0.001, 0.01, 0.1, 1 or 10 ng/ml) or IL-1β (1, 10, 100 or 1000 IU/ml) for 24 h or TGF-β1 (5 ng/ml) for 0, 6, 12, 24, or 48 h or IL-1β (100 IU/ml) for 0, 12, 24, or 48 h. EVTs cultured in the presence of vehicle (0.1% ethanol) served as controls for these studies. The treatment time and dosage for TGF-β1 and IL-1β were chosen based on previous studies from my laboratory. To inhibit the regulatory effects of TGF-β1 and IL-1β on Runx2 mRNA and protein levels in these primary cell cultures, EVTs were cultured in the presence of either TGFβ1 (10 ng/ml) alone or in combination with a function-perturbing monoclonal antibody directed against human TGF-β1 (10 µg/ml; Sigma Aldrich) or IL-1β (100 IU/ml) alone or  50  in combination with a function-perturbing monoclonal antibody directed against human IL-1β (1 or 2 µg/ml; Sigma Aldrich) for 24 h. The time points and the concentrations of cytokines and corresponding functionperturbing antibodies used in these studies were based upon previous reports (Huang et al, 1998; Chung et al, 2001). All of the EVT cell cultures were harvested for either total RNA or protein extraction.  2.4: Generation of first-strand complementary DNA (cDNA)  Total RNA was prepared from placenta tissues, cultures of EVTs and choriocarcinoma cell lines using an RNeasy Mini Kit (Qiagen, Inc, CA, USA) following a protocol recommended by the manufacturer. The total RNA extracts were then treated with deoxyribonuclease-1 to eliminate possible contamination with genomic DNA. To verify the integrity of the RNA, aliquots of the total RNA extracts were electrophoresed in a 1% (w/v) denaturing agarose gel, containing 3.7% (v/v) formaldehyde, and the 28 S and 18 S ribosomal RNA subunits visualized by ethidium bromide staining.  The purity and  concentration of total RNA in each of the extracts were determined by optical densitometry (260/280nm) using a Du-64 UV-spectrophotometer (Beckman Coulter, Mississauga, ON, Canada). Aliquots (~1 µg) of the total RNA extracts prepared from placenta tissues and each of the trophoblastic cell cultures were then reverse-transcribed into cDNA using the First Strand cDNA Synthesis Kit, according to the manufacturer’s protocol (Amersham Pharmacia Biotech, Oakville, ON, Canada).  51  2.5: Primer design  Oligonucleotide primers for human Twist, Runx2, E-cad and N-cad were produced according to sequences deposited in GenBank (Accession No.: NM_000474, NM_004348, NM_004360 and NM_001792 respectively; National Center for Biotechnology Information, Bethesda, MD, USA).  The housekeeping gene,  glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was used as an internal control (Getsios et al, 1998b).  Oligonucleotide primers corresponding to the nucleotide  sequences for Twist, Runx2, E-cad and N-cad were synthesized at the Nucleic Acid and Protein Synthesis Unit, University of British Columbia, Vancouver, Canada.  The  nucleotide sequences of these primers and the expected sizes of the PCR products are listed in Table 2.1. A second set of primers specific for Runx2, N-cad or GAPDH, were also prepared in Table 2.2. These primers were used for the real-time quantitative (q) RT-PCR.  52  Table 2.1. Oligonucleotide primers for Twist, Runx2, E-cad, N-cad and GAPDH mRNA amplification (Semi-quantitative PCR) ________________________________________________________________________ mRNA  Primers (5’-3’)  Size (bp)  Position on cDNA No. of cycles  ________________________________________________________________________ Twist Upstream (5 end) AGTCCGCAGTCTTACGAGGA 576 646-665 30 Downstream (5 end) GCAGAGGTGTGAGGATGGT 1222-1204 E-cad Upstream (5 end) TGGATGTGCTGGATGTGAAT 560 1548 -1567 30 Downstream (5 end) ACCCACCTCTAAGGCCATCT 2107-2088 N-cad Upstream (5 end) ACAGTGGCCACCTACAAAGG 391 654-673 30 Downstream (5 end) TGATCCCTCAGGAACTGTCC 1045-1026 GAPDH Upstream (5 end) ATGTTCGTCATGGGTGTGAACCA 378 449-471 22 Downstream (5 end) TGGCAGGTTTTTCTAGACGGCAG 821-799 ______________________________________________________________________________________  Table 2.2. Real-time qPCR primers for Runx2, N-cad and GAPDH mRNA ________________________________________________________________________ mRNA  Primers (5’-3’)  ________________________________________________________________________ Runx2 Upstream (5 end) AGCCCTCGGAGAGGTACCA Downstream (5 end) TCATCGTTACCCGCCATGA N-cad Upstream (5 end) TGGGAATCCGACGAATGG Downstream (5 end) GCAGATCGGACCGGATACTG GAPDH Upstream (5 end) GAGTCAACGGATTTGGTCGT Downstream (5 end) GACAAGCTTCCCGTTCTCAG ______________________________________________________________________________________  53  2.6: Semi-quantitative RT-PCR  Semi-quantitative RT-PCR was performed using the primer sets specific for Twist, Runx2, E-cad, N-cad or GAPDH, and template cDNA generated from the total RNA extracts prepared from BeWo, JEG-3, EVTs, HTR-8/SVneo cell cultures or placenta tissue (villi).  The PCR cycles were repeated 15-40 times to determine a linear  relationship between the yield of PCR products from representative samples of these cells or tissue and the number of cycles performed.  The optimized numbers of cycles  subsequently used to amplify Twist, Runx2, N-cad, E-cad and GAPDH are listed in Table 2.1. All PCR reactions were performed on three separate occasions.  PCR was also  performed using the primer sets specific for Twist, Runx2, E-cad or N-cad and aliquots of total RNA extracts prepared from BeWo, JEG-3, EVTs, HTR-8/SVneo cell cultures or placenta tissue (villi) (i.e. non-transcribed RNA) or DEPC-treated water (negative control) under the same conditions as described above. An aliquot (10 µl) of the Twist, Runx2, E-cad or N-cad PCR products was subjected to electrophoresis in a 1% agarose gel and visualized by ethidium bromide staining. The intensity of ethidium bromide staining of the PCR products was analysed by UV densitometry (Biometra, Whiteman Co., Frederick, MD, USA). The absorbance values obtained for Twist, Runx2, E-cad or N-cad were then normalized relative to the corresponding GAPDH absorbance value.  54  2.7: Real-time-quantitative (q) RT-PCR  The first-strand cDNA generated from the HTR-8/SVneo cell cultures served as a template for qRT-PCR using the ABI PRISM 7000 sequence detection system (PerkinElmer Applied Biosystems, Foster City, CA) equipped with a 96-well optical reaction plate. Real-time qPCR was performed using 12.5 µl SYBR Green PCR master mix (PerkinElmer Applied Biosystems), 7.5 µl of primer mixture (300nM), and 5 µl of cDNA template [diluted 1:7 (vol/vol)] under the following optimized conditions: 52 C for 2 min followed by 95 C for 10 min and 40 cycles of 95 C for 15 sec and 60 C for 1 min. All PCRs were performed in duplicate, with the mean being used to determine mRNA levels. A control containing DEPC-treated water instead of sample cDNA was included in each plate. Each set of primers generated a single PCR product of the appropriate size when visualized by agarose gel electrophoresis after qRT-PCR. Nucleotide sequences of the resultant PCR products were confirmed by BLAST (http:// www.ncbi.nlm-.nih.gov). The amplification efficiency was determined by plotting log cDNA dilution against CT (  CT = CT.Target - CT.GAPDH), the slope of which was close to zero, indicating maximal and similar efficiency of the target and reference genes (data not shown). CT stands for Cycle threshold and is a measurement for the number of PCR cycles (in Real-time PCR) needed to get a fluorescent signal. Relative Runx2 or N-cad mRNA levels were determined using the formula 2-  T where  CT = (CT.Target - CT.GAPDH) x – (CT.Target - CT.GAPDH) 0. In this  formula, X represents siRNA transfection with control cultures being assigned a value of zero (Kenneth JL and Thomas DS, 2001). Data were analysed using SDS 2.0 software  55  (PerkinElmer Applied Biosystems). This experimental approach was further validated by the observation that differences between the CT for the target gene and GAPDH remained relatively constant for each amount of cDNA examined.  2.8: Western blot analysis  Cultures of EVTs or choriocarcinoma cell lines were washed three times in PBS and incubated in 100 µl of cell extraction buffer (Biosource International, Camarillo, CA, USA) supplemented with 1.0 mM phenylmethylsulphonyl fluoride and protease-inhibitor cocktail for 30 min on a rocking platform. The cell lysates were centrifuged at 10 000 x g for 10 min at 4°C and the supernatants used for Western blot analysis.  The  concentrations of protein in the cell lysates were determined using a BCA kit (Pierce Chemicals, Rockford, IL, USA). Aliquots (approximately 30 µg) of the cell lysates were prepared, and subjected to electrophoresis and immunoblotting, as previously described (MacCalman et al., 1996) using antibodies directed against human TWIST (Santa Cruz Inc, Santa Cruz, CA, USA), RUNX2 (Santa Cruz Inc, Santa Cruz, CA, USA), E-CAD (Transduction Laboratory, Lexington, KY, USA) or N-CAD (Upstate, Lake Placid, NY, USA). To standardize the amounts of protein loaded into each lane, the blots were reprobed with a polyclonal antibody directed against human β-actin (ACTIN) (Sigma Aldrich). The Amersham enhanced chemiluminescence system was used to detect the amount of each antibody bound to antigen with exposure to X-ray film. The absorbance values (density) obtained for TWIST, RUNX2, E-CAD or N-CAD by densitometry were then normalized relative to the corresponding ACTIN absorbance value.  56  2.9: siRNA transfection  siRNA (Qiagen, Valencia, CA, USA; 150 ng/ 35mm2 culture dish) targeting human Twist mRNA (5’-AAGAACACCTTTAGAAATAAA-3’), Runx2 mRNA (5’-CACCT TGACCATAACGTCTT-3’) or N-cad mRNA (5’ AAGGAGTCAG CAGAAGTTGAA3’) was transfected into BeWo or HTR-8/SVneo cells using HiPerFect Transfection Reagent (Qiagen, Valencia, CA) according to a protocol outlined by the manufacturer. BeWo or HTR-8/SVneo cells transfected with a non-silencing or scrambled siRNA (5’AAT TCT CCG AAC GTG TCA CGT-3’), served as negative controls for these studies. Following optimization of the HiPerFect:siRNA concentration ratio, experiments were performed using BeWo or HTR-8/SVneo cells that had been transfected with either siRNA or scrambled siRNA for 0, 12, 24, 36 or 48 h.  2.10: Expression vector  A full length human Twist cDNA (GenBank ID: BC036704) in pOTB7 vector was purchased from ATCC (Manassas, VA, USA). Twist cDNA was ligated into the BamH I/EcoRI site of pEF1α expression vector (Invitrogen, Carlsbad, CA) using standard molecular biology techniques. A clone (pEF1α-Twist) containing the Twist cDNA in the forward orientation was subsequently identified by DNA sequence analysis. Transfection reagent alone served as a control in my studies.  57  2.11: Generation of stably transfected BeWo cell line  Stable transfections were performed to establish BeWo cell line constitutively expressing pEF1α-Twist. pEF1α-Twist expression vectors (2.0 µg/ml) was transfected into BeWo cells using LipofectamineTM 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Cells that were successfully transfected with pEF1α-Twist expression vectors were first selected after 24 h of culture using G418 antibiotic (400 µg/ml F12K; Invitrogen). Positives were then sub-cultured by limiting dilution and expanded into a cell line that was maintained in the selection medium.  2.12: Indirect immunofluorescence  Indirect immunofluorescence was performed using BeWo cells that had been plated on glass coverslips and fixed in methanol at -20°C for 2 min. Coverslips were incubated with primary antibodies for 45 min at 37°C. Primary antibodies were detected by using Alexa Fluor conjugated secondary antibodies (Molecular Probes, Eugene, OR, USA). BeWo cell nuclei were stained with 4’, 6-diamidino-2-phenylindole (DAPI; Sigma, St Louis, MO). The coverslips were examined by using a Leica DMR microscope/ Orca Hamamatsu system and analyzed with OpenLab software (Improvision, Lexington, MA, USA). The antibodies used for indirect immunofluorescence are similar to the antibodies used in western blotting.  58  2.13: Matrigel invasion assay  Cellular invasion assays were performed by using Transwells fitted with Millipore Corp. membranes coated with a thin layer of growth factor-reduced Matrigel (6.5-mm filters, 8-µm pore size; Costar, Toronto, ON, Canada) as previously described (Zhou et al, 1997; Xu et al, 2002). Briefly, 2.5 x 104 cells/250 µl of DMEM supplemented with 10 % FBS were plated in the upper wells of the Transwell invasion chambers.  The  Transwells were then immediately immersed into the lower wells of the invasion chambers which contained 1.2 ml of DMEM. Invasion assays were performed for 24 h in a humidified environment (5% CO2) at 37°C, after which cells attached to the porous membranes were fixed in 4% paraformaldehyde, and cells from the upper surface of the Matrigel layer were completely removed by gentle swabbing. The remaining cells that had invaded into the Matrigel and appeared on the underside of the filters were fixed and stained using a Diff-Quick Stain Kit (Dade AG, Dudingen, Switzerland) according a protocol outlined by the manufacturer. The filters were then rinsed with water, excised from Transwells, and mounted upside-down onto glass slides. Invasion indices were determined by counting the number of stained cells in 10 randomly selected, nonoverlapping fields at 40x magnification using a light microscope. Each cell culture was tested in triplicate wells, on three independent occasions.  59  2.14: Statistical analysis  The absorbance values obtained from the semi-quantitative RT-PCR, real-time RTPCR products and the fluorograms generated by Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, CA, USA). Statistical differences between the absorbance values were assessed by analysis of variance (ANOVA). Differences were considered significant when P < 0.05. Significant differences between the means were determined using Dunnett’s test. The results are presented as the mean relative absorbance (+ SEM) obtained from 4 different experiments.  60  CHAPTER 3: TWIST REGULATES CADHERIN-MEDIATED DIFFERENTIATION AND FUSION OF HUMAN TROPHOBLASTIC CELLS IN VITRO  3.1: Introduction and rationale  The human placenta plays a key role in regulating growth, development, and survival of the fetus during pregnancy (Aplin, 1991). It is the site of transfer of respiratory gasses, nutrients and waste products between the maternal and fetal systems. It serves as a barrier against blood-borne pathogens and the maternal immune system. It also fulfills an endocrine role by secreting hormones, growth factors and other bioactive substances required for the establishment and maintenance of pregnancy.  Upon implantation,  cytotrophoblastic cells proliferate and differentiate to form syncytial trophoblasts, the outer cell layers of chorionic villi (Kaufman, 1985). Less recognized is that the syncytial trophoblast, a large multinucleated cell that forms the continuous outer layer of the human placenta, is responsible for the majority of biological functions assigned to this dynamic tissue (Richart, 1961; Kliman et al., 1986). The multinucleated syncytial trophoblast is formed from the underlying layer of mitotically active, mononucleate cytotrophoblasts, involving a cellular process dependent upon a precise series of membrane-mediated events (Douglas and King, 1990). The cadherins are likely molecular players that mediate terminal differentiation and fusion of the cytotrophoblast.  They belong to a gene superfamily of integral membrane  glycoproteins that mediate calcium-dependent cell adhesion through homophilic  61  interactions. There is a marked reduction in E-cad expression during the aggregation, differentiation and fusion of human trophoblastic cells in vitro (MacCalman et al., 1996; Getsios et al., 2000).  Immunoneutralization studies have shown that an antiserum  directed against the extracellular domain of E-CAD inhibits the formation of syncytial trophoblast (Coutifaris et al., 1991). Taken together, these observations have led to the proposal that down-regulation of E-cad plays discrete roles in differentiation and fusion events of human trophoblastic cells in vitro.  Although the molecular mechanisms  underlying the down-regulation of E-cad during these cellular events remain to be elucidated, transcriptional repression mechanisms have emerged as one of the crucial processes for down-regulating E-cad expression during embryonic development (Carver et al., 2001; Castanon and Baylies, 2002; Thiery, 2003) and tumourigenesis (Bussemakers et al., 1994; Baudry et al., 2003; Yang et al., 2004). In particular, the highly conserved basic helix-loop-helix (bHLH) transcription factor known as TWIST has been shown to inhibit human E-cad gene expression (Yuen et al., 2007; Zhang et al., 2007). Previous studies have demonstrated that down-regulation of E-cad is necessary during the terminal differentiation and fusion of human trophoblasts in vitro (Coutifaris et al., 1991; MacCalman et al., 1996; Getsios et al., 2000), but none of these studies have investigated the transcriptional factors that may down-regulate E-cad during these processes in vitro. Taken together, it is possible that Twist is involved in the mechanisms underlying the formation and organization of the human placenta through downregulation of E-cad. In these studies, I first determined the levels of Twist and E-cad mRNA and protein during the terminal differentiation and fusion of BeWo cells cultured  62  in the presence of 8-bromo-cAMP by using semi-quantitative RT-PCR and Western blotting, respectively. Next, by establishing a stably transfected cell line containing Twist cDNA or utilizing a siRNA targeting Twist, I examined whether Twist is capable of promoting the terminal differentiation in these trophoblastic cells through affecting Ecad expression. Immunofluorescence staining was used in these studies to examine the morphological changes and the localization of TWIST and E-CAD in these cells. Dr. S. Getsios helped perform the immunofluorescence staining in Figure 3.3 and Dr. H.  Zhu  helped  perform  the  semi-quantitative  RT-PCR,  Western  blot  and  immunofluorescence staining in Figures 3.8 and 3.9.  63  3.2: Results  3.2.1: 8-bromo-cAMP promotes the terminal differentiation and fusion of BeWo cells in association with altered Twist and E-cad expression  Twist mRNA was present in cultured BeWo cells, and its levels remained relatively constant over 2 days culture in the absence of 8-bromo-cAMP (Figure 3.1 A). However, a significant increase (P < 0.05) in Twist mRNA levels was detectable when the BeWo cells were cultured in the presence of a fixed concentration of 1.5 mM 8-bromo-cAMP for 24 h (Figure 3.1 A). Levels of Twist mRNA in these cell cultures continued to increase up to 48 h after treatment. The E-cad mRNA levels remained relatively constant in BeWo cells cultured in the absence of 8-bromo-cAMP (Figure 3.2 A). However, Ecad mRNA levels were significantly decreased in BeWo cells cultured in the presence of 1.5 mM 8-bromo-cAMP for 36 h, with levels continuing to decline up to 48 h (Figure 3.2 A). Western blot analysis revealed the presence of a 28 kDa TWIST protein species in all BeWo cell cultures (Figure 3.1B). TWIST protein levels remained relatively constant in BeWo cells cultured in the absence of 8-bromo-cAMP (Figure 3.1 B). In agreement with the RT-PCR analysis, there was a significant increase (P < 0.05) in TWIST levels in BeWo cells cultured in the presence of 8-bromo-cAMP (1.5 mM) for 24 h, and these levels continued to increase up to 48 h after treatment (Figure 3.1B). E-CAD protein levels remained relatively constant in BeWo cells cultured in the absence of 8-bromocAMP (Figure 3.2 B), but there was significant reduction in E-CAD levels in BeWo cells  64  cultured in the presence of 1.5 mM 8-bromo-cAMP for 36 h (Figure 3.2 B). Levels of ECAD protein in these cell cultures continued to decrease up to 48 h after treatment. By using indirect immunofluorescence, a low level of TWIST was found to be localized in the nuclei of mononucleate cytotrophoblasts (Figure 3.3 a) when the cells were cultured in the absence of 8-bromo-cAMP. In contrast, a higher level of TWIST immunoreactivity was found to be primarily localized in the nuclei of the syncytial trophoblast (Figure 3.3 d) 36 h after treatment with 1.5 mM 8-bromo-cAMP. Immunoreactive E-CAD was localized to areas of cell-to-cell contact when the cells were cultured in the absence of 8-bromo-cAMP (Figure 3.3b).  In contrast, E-CAD  immunoreactivity was distributed in a diffuse manner along the surface of the multinucleated syncytium after cells were cultured for 36 h in the presence of 1.5 mM 8bromo-cAMP (Figure 3.3 e).  3.2.2: Twist siRNA inhibits the terminal differentiation and fusion of BeWo choriocarcinoma cells in the presence of 8-bromo-cAMP  In order to repress the increase in Twist expression in BeWo cells after treatment with 1.5 mM 8-bromo-cAMP, I utilized a siRNA complementary to human Twist mRNA. Transfection of BeWo cells with this siRNA inhibited Twist mRNA and protein levels (Figures 3.4 A and B) from being up regulated after co-treatment of these cells with 1.5 mM 8-bromo-cAMP up to 48 h. In contrast, there was a significant increase in Twist mRNA and protein levels in BeWo cells transfected with a non-silencing scrambled siRNA under the same culture conditions and time frame (Figures 3.4 A and B). The  65  levels of E-cad mRNA and protein remained relatively constant at all time points examined in these studies when the cells were transfected with Twist siRNA (Figures 3.5 A and B). There was, however, a significant reduction in E-cad mRNA and protein levels in BeWo cells transfected with non-silencing scrambled siRNA over the same time frame (Figures 3.5 A and B). I also assessed whether inhibiting Twist upregulation resulted in a concomitant decrease in terminal differentiation and fusion of BeWo cells in culture. When these cells were transfected with Twist siRNA in the presence of 1.5 mM 8-bromo-cAMP for 36 h, low levels of TWIST immunoreactivity were localized to the nuclei of the syncytial trophoblast (Figure 3.6 a-c). As well, E-CAD was localized to areas of cell-cell contact under the same conditions (Figure 3.6 d-f).  In contrast, when BeWo cells were  transfected with non-silencing, scrambled siRNA in the presence of 1.5 mM 8-bromocAMP for 36 h, TWIST was clearly localized to the nuclei of the syncytial trophoblast (Figure 3.7 a-c). As well, E-CAD immunostaining was reduced in the multinucleated syncytium that formed in the trophoblastic cell cultures under these conditions (Figure 3.7 d-f). Furthermore, to determine whether BeWo cells transfected with Twist siRNA in the presence of 1.5 mM 8-bromo-cAMP remained mononucleated, I examined the distribution of desmoplakin in these cell cultures.  Desmoplakin is an essential  component of desmosomal junctions and has been used as a marker to determine cell boundaries in a wide variety of normal and malignant epithelial cells in vitro, including human trophoblasts (Douglas and King, 1990; Green and Gaudry, 2000; Getsios and MacCalman, 2003). Desmoplakin immunoreactivity was readily detectable at areas of  66  cell-cell contact (Figure 3.6 g-i) when BeWo cells were transfected with Twist siRNA in the presence of 1.5 mM 8-bromo-cAMP for 36 h.  In contrast, desmoplakin  immunoreactivity was distributed diffusely along the surface of the multinucleated syncytium when BeWo cells were transfected with non-silencing, scrambled siRNA in the presence of 1.5 mM 8-bromo-cAMP for 36 h (Figure 3.7 g-i).  3.2.3: pEF1α-Twist promotes the terminal differentiation and fusion of BeWo cells: correlation with E-cad mRNA and protein levels  In order to manipulate the up-regulation of Twist expression independently of cAMP, BeWo cells were stably transfected with the Twist expression vector pEF1α-Twist. Following selection of transfected cells by G418 treatment (described in Materials and Methods, section 2.11), a pool of stable transfectants was maintained and used for experiments. The increase in Twist in BeWo cells transfected with pEF1α-Twist was concomitant with a reduction of E-cad mRNA and protein levels (Figures 3.8 A and B). In contrast, E-cad mRNA and protein were unchanged or minimally affected in mock transfected BeWo cells as compared to the untransfected parental cell line. TWIST immunostaining was readily detectable in BeWo cells that were transfected with pEF1α-Twist (Figure 3.9 a), and E-CAD immunostaining was diffuse along the cell boundary in the multinucleated syncytium that formed in these cell cultures (Figure 3.9 b).  In contrast, TWIST was barely detectable in the nuclei of the mononucleate  67  cytotrophoblasts of mock transfected cells (Figure 3.9 d), while E-CAD was localized to areas of cell-cell contact in the mock transfected BeWo (Figure 3.9 e). To confirm that the mononucleate BeWo cells transfected with pEF1α-Twist underwent terminal differentiation and fusion to form multinucleated syncytium, I examined the distribution of desmoplakin in these cell cultures.  In BeWo cells  transfected with pEF1α-Twist, desmoplakin immunoreactivity was diffuse along the peripheral membrane of the multinucleated syncytium that formed in these cell cultures (Figure 3.9 c). In contrast, intense desmoplakin staining was readily detectable at areas of cell-cell contact in mononucleate BeWo cells after transfection with the reagent alone (Figure 3.9 f).  68  Figure 3.1. Effects of cAMP on Twist mRNA and protein levels in BeWo cell cultures. A) Semi-quantitative PCR analysis of Twist mRNA levels in BeWo cells cultured in the presence or absence (control) of a fixed concentration of 1.5 mM 8-bromo-cAMP (cAMP) for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively). A 100-bp ladder is shown in lane M (marker) with the size of the cDNA indicated at the right. The Twist mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. B) Representative fluorogram of a Western blot containing total protein (30 µg) extracted from BeWo cells cultured in the presence or absence (control) of 1.5 mM cAMP for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively) and probed with rabbit polyclonal antibodies against TWIST or human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST protein were normalized to the absorbance values obtained for human β-actin (ACTIN). The results from four sets of experiments were standardized to the 0 h control and are represented (mean + S.E.M., n = 4) in the bar graphs (*, P < 0.05 compared to 0 h control).  69  Figure 3.1 A Control M  1  2  3  4  5 576 bp (Twist)  378 bp (GAPDH)  M  cAMP (1.5 mM) 2 3  1  4  5 576 bp (Twist) 378 bp (GAPDH)  Relative Amount of Twist mRNA  ✂  *  ✝✁ ✂ ✝ ✆✁ ✂  Control  *  ✆ ✞✟✠✡ ☛ ✟☞cAMP ✌✍✎✏  ☎✁ ✂ ☎ ✄✁ ✂ ✄  ✁ ✂    0  12  B  24 Time (h)  36  48  Control 1  2  3  4  5 28 kDa (TWIST)  42 kDa (ACTIN)  1  2  cAMP (1.5 mM) 3 4  5 28 kDa (TWIST)  42 kDa (ACTIN) ✗  *  Relative Amount of TWIST Protein  ✖✒ ✓  *  ✖  *  ✕✒ ✓  Control  ✘✙✚✛ ✜ ✙✢ ✣✤✥✦  ✕  cAMP  ✔✒ ✓ ✔ ✑✒ ✓ ✑  0  12  24 Time (h)  36  48  70  Figure 3.2. Effects of cAMP on E-cad mRNA and protein levels in BeWo cell cultures. A) Semi-quantitative PCR analysis of E-cad mRNA levels in BeWo cells cultured in the presence or absence (control) of 1.5 mM 8-bromo-cAMP (cAMP) for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively). A 100-bp ladder is shown in lane M (marker) with the size of the cDNA indicated at the right. Values for E-cad mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from BeWo cells cultured in the presence or absence (control) of 1.5 mM cAMP for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively) and probed with a mouse monoclonal antibody directed against E-CAD. The blots were then re-probed with a polyclonal antibody specific for human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values for E-cad were normalized to the corresponding absorbance values for human β-actin (ACTIN). The results derived from both these analyses and from three other sets of experiments were standardized to the 0 h control and are represented (mean + S.E.M., n = 4) in the bar graphs (*, P < 0.05 compared to 0 h control).  71  Figure 3.2 A M  1  Control 3  2  4  5 560 bp (E-cad)  378 bp (GAPDH)  M  cAMP (1.5 mM) 2 3  1  4  5 560 bp (E-cad) 378 bp (GAPDH)  Relative Amount of E-cad mRNA  ✭★ ✩ ✭ ✧★ ✬ ✮✯✰✱ ✲ ✯✳ Control ✴✵✶✷  *  ✧★ ✫  *  ✧★ ✪  cAMP  ✧★ ✩ ✧  0  12  B 1  2  24 Time (h) Control 3  36  4  48  5 120 kDa (E-CAD)  42 kDa (ACTIN)  1  2  cAMP (1.5 mM) 3 4  5 120 kDa (E-CAD)  42 kDa (ACTIN) 1.4  Relative Amount of E-CAD Protein  1.2 1 0.8  *  Cont rol  *  0.6  cAMP Control  cAMP  0.4 0.2 0  0  12  24 Time (h)  36  48  72  Figure 3.3. Immunolocalization of TWIST and E-CAD in BeWo cells cultured in the presence or absence (control) of 1.5 mM 8-bromo-cAMP (cAMP).  Double-label  immunofluorescence was carried out for BeWo cells cultured in the absence (a, b and c) or presence of 1.5 mM cAMP for 48 h (d, e and f).  The cells were fixed and  immunostained with a rabbit polyclonal antibody directed against TWIST (a and d) and a mouse monoclonal antibody directed against E-CAD (b and e). DAPI was used to detect the nuclei in these BeWo cell cultures (c and f). The experiment was repeated on three independent occasions. Scale bar represents 50 µm.  73  Figure 3.3 DAPI  E-CAD  Control  TWIST  a  b DAPI  E-CAD  1.5 mM cAMP  TWIST  c  d  e  f  74  Figure 3.4. Effects of Twist siRNA on Twist mRNA and protein levels in BeWo cells cultured in the presence of 1.5 mM 8-bromo-cAMP (cAMP). A) Semi-quantitative PCR analysis of Twist mRNA levels in BeWo cells transfected with siRNA specific for Twist or a scrambled control siRNA and cultured in the presence of 1.5 mM cAMP for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively). A 100-bp ladder is shown in lane M (marker) with the size of the cDNA indicated at the right. The Twist mRNA levels in each sample were normalized against the corresponding GAPDH mRNA levels. B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from BeWo cells cultured after transfection with siRNA specific for Twist or a scrambled control siRNA in the presence of a 1.5 mM cAMP for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively), and probed with rabbit polyclonal antibodies directed against TWIST or human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values for TWIST were normalized to the absorbance values for human β-actin (ACTIN) in the corresponding samples. The results from these analyses and from three other sets of experiments were standardized to the 0 h control and are represented (mean + S.E.M., n = 4) in the bar graphs (*, P < 0.05 compared to 0 h control).  75  Figure 3.4 A .  c AM P a nd Co ntro l si RNA  M  1  2  3  4  5  A.  M  cAMP and Control siRNA 2 3 4  1  5 576 bp (Twist)  378 bp (GAPDH)  M  cAMP and Twist siRNA 2 3 4  1  5 576 bp (Twist)  378 bp (GAPDH)  Relative Amount of Twist mRNA  ✾ ✽  * *  ✼  cAMP and Control siRNA  ✻  ✿❀❁❂ ❃❄❅ ❆❇❄❈ ❉ ❇❊ ❋● ❍■❀ ✿❀❁❂ ❃❄❅ ❏❑● ❋❈ ❋● ❍■❀  *  cAMP and Twist siRNA  ✺ ✹ ✸  0  B 1  12  24 Time (h)  36  cAMP and Control siRNA 2 3 4  48  5 28 kDa (TWIST)  42 kDa (ACTIN)  1  cAMP and Twist siRNA 2 3 4  5 28 kDa (TWIST)  42 kDa (ACTIN) ❘▼ ◆ ❘  *  Relative Amount of TWIST Protein  ◗▼ ◆  *  ◗  cAMP and Control siRNA  *  €▼ ◆  ❙❚❯❱ ❲❳❨ ❩❬❳❭ ❪ ❬❫ ❴ ❵ ❛❜❚ ❙❚❯❱ ❲❳❨ ❭ ❝❵ ❴ ❭ ❴ ❵ ❛❜❚  €  cAMP and Twist siRNA  ❖▼ ◆ ❖ ▲▼ ◆ ▲  0  12  24 Time (h)  36  48  76  Figure 3.5. Effects of Twist siRNA on E-cad mRNA and protein levels in BeWo cells cultured in the presence of 1.5 mM 8-bromo-cAMP (cAMP). A) Semi-quantitative PCR analysis of E-cad mRNA levels in BeWo cells transfected with siRNA specific for Twist or a scrambled control siRNA and cultured in the presence of 1.5 mM cAMP for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively). A 100-bp ladder is shown in lane M (marker) with the size of the cDNA indicated to the right. The E-cad mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels.  B) Representative  fluorogram of a Western blot containing 30 µg of total protein extracted from BeWo cells cultured after transfection with siRNA specific for Twist or a scrambled control siRNA in the presence of a fixed concentration of cAMP (1.5 mM) for 0, 12, 24, 36, or 48 h (lanes 1-5, respectively), and probed with mouse monoclonal antibody directed against E-CAD or polyclonal antibody against human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for E-CAD were normalized to the absorbance values obtained for human β-actin (ACTIN) in corresponding samples. The results from these analyses and from three other sets of experiments were standardized to the 0 h control, and are represented (mean + S.E.M., n = 4) in the bar graphs (*, P < 0.05 compared to 0 h control).  77  Figure 3.5 A M  1  cAMP and Control siRNA 2 3 4  5 560 bp (E-cad)  378 bp (GAPDH)  M  cAMP and Twist siRNA 2 3 4  1  5 560 bp (E-cad)  378 bp (GAPDH)  Relative Amount of E-cad mRNA  ❥❡ ❣ ❥❡ ❢ ❥ ❞❡ ✐  * ❞❡ ❤  *  ♠♥ ♦♣q ❦❧ s♣t ✉ s✈ siRNA ✇① ②③❧ cAMP andrControl ❦❧♠♥ ♦♣q ④⑤① ✇t ✇① ②③❧  cAMP and Twist siRNA ❞❡ ❣ ❞❡ ❢ ❞  0  12  B  24 Time (h)  36  48  cAMP and Control siRNA 1  2  3  4  5 120 kDa (E-CAD)  42 kDa (ACTIN)  1  2  cAMP and Twist siRNA 3 4  5 120 kDa (E-CAD)  42 kDa (ACTIN) ❷⑦ ⑧  Relative Amount of E-CAD Protein  ❷  *  ⑥⑦ ❶  *  ⑥⑦ ⑩ ⑥⑦ ⑨  ❸❹❺❻ ❼❽❾ ❿➀❽➁ ➂ ➀➃ ➄➅ ➆➇❹ ❻ ❼❽❾and ➈➉➅Control ➄➁ ➄➅ ➆➇ ❹ ❸❹❺ cAMP siRNA  cAMP and Twist siRNA  ⑥⑦ ⑧ ⑥  0  12  24 Time (h)  36  48  78  Figure 3.6. Immunolocalization of TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in BeWo cells transfected with siRNA specific for Twist in the presence of 1.5 mM 8bromo-cAMP (cAMP). Photomicrographs of immunoreactive TWIST (a), E-CAD (d) and desmoplakin (g) expression in BeWo cells transfected with siRNA specific for Twist and cultured in the presence of 1.5 mM cAMP for 36 h. The cells were fixed and immunostained with either a rabbit polyclonal antibody against TWIST or a monoclonal antibody against E-CAD. A rabbit polyclonal antibody against desmoplakin was used as a marker for cell-cell borders. DAPI was used to detect the nuclei of these BeWo cells (b, e and h). Merged signals are shown on the right (c, f and i). The experiment was repeated on three independent occasions. Scale bar represents 50 µm.  79  cAMP and Twist siRNA (36 h)  cAMP and Twist siRNA (36 h)  cAMP and Twist siRNA (36 h)  Figure 3.6  TWIST DAPI  a  E-CAD  d  DESMOPLAKIN  g  MERGED  b  DAPI  DAPI  c  MERGED  e f  MERGED  h  i  80  Figure 3.7. Immunolocalization of TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in BeWo cells transfected with a scrambled control siRNA in the presence of 1.5 mM 8bromo-cAMP (cAMP). Photomicrographs of immunoreactive TWIST (a), E-CAD (d) and desmoplakin (g) in BeWo cells transfected with a scrambled control siRNA and cultured in the presence of 1.5 mM cAMP for 36 h.  The cells were fixed and  immunostained with either a rabbit polyclonal antibody against TWIST, a monoclonal antibody against E-CAD, or a rabbit polyclonal antibody against desmoplakin. DAPI was used to detect the nuclei of these BeWo cells (b, e and h). Merged signals are shown on the right (c, f and i). The experiment was repeated on three independent occasions. Scale bar represents 50 µm.  81  cAMP and scrambled siRNA (36 h) cAMP and scrambled siRNA (36 h) cAMP and scrambled siRNA (36 h)  Figure 3.7  TWIST DAPI  a  E-CAD  d  DESMOPLAKIN  g  MERGED  b  DAPI  DAPI  c  MERGED  e f  MERGED  h  i  82  Figure 3.8. Twist and E-cad mRNA and protein levels in BeWo choriocarcinoma cells stably transfected with pEF1α-Twist. A) Semi-quantitative PCR analysis of Twist or Ecad mRNA levels in untransfected BeWo cells (Wild), mock transfected BeWo cells (Reagent), or BeWo cells transfected with pEF1α-Twist (pEF1α-Twist).  Values for  Twist or E-cad mRNA levels in each sample were normalized to their corresponding GAPDH mRNA levels. B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from untransfected BeWo cells (Wild), mock transfected BeWo cells (Reagent), or BeWo cells transfected with pEF1α-Twist (pEF1α-Twist) and probed with specific antibodies directed against TWIST or E-CAD. The blots were then re-probed with a polyclonal antibody specific for human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST or E-CAD were normalized to the absorbance values obtained for human β-actin (ACTIN) in corresponding samples. The results from these analyses and from three other sets of experiments were standardized to the values of the transfection reagent control and are represented (mean + S.E.M., n = 4) in the bar graphs (*, P < 0.05 compared to control).  83  Figure 3.8 B  A M  Wild  Reagent  pEF 1αTwist  Wild  Twist  TWIST  E-cad  E-CAD  GAPDH  ACTIN  3  2  R e l a ri v e T w i s t p r o te i n l e v e l s  4  *  1.6  *  5  1.4 1.2 1 0.8 0.6 0.4  1 0.2  0  0  Wild Wild  Reagent Reagent  PEF1α pEF 1α Twist Twist  Wild  Wild  PEF1α  pEF Twist 1αTwist  0.8 0.6 0.4  * 0.2  R e la t iv e E C A D p ro t e in le v e ls  1.2  1  Relative Amount of E-CAD Protein  R e la t iv e E C A D m R N A le v e ls  Reagent  Reagent  1.4  1.2  Relative Amount of E-cad mRNA  pEF 1αTwist  1.8  Relative Amount of TWIST Protein  R e la tiv e T w is t m R N A le v e ls  Relative Amount of Twist mRNA  6  Reagent  1 0.8 0.6 0.4  *  0.2  0  0  Wild Wild  Reagent Reagent  PEF1α pEF *Tw 1α ist Twist  Wild Wild  Reagent Reagent  PEF1α* pEF 1αTw ist Twist  84  Figure 3.9. Immunolocalization of TWIST, E-CAD and desmoplakin (DESMOPLAKIN) in BeWo cells stably transfected with pEF1α-Twist (pEF1α-Twist) or in mock transfected BeWo cells (Reagent). The Twist overexpressing cells (a-c) or the mock transfected cell (d-f) were fixed and immunostained with either a rabbit polyclonal antibody against TWIST (a and d), a mouse monoclonal antibody against E-CAD (b and e), or a rabbit polyclonal antibody against desmoplakin (c and f). DAPI was used to detect the nuclei in these BeWo cell cultures. The experiment was repeated on three independent occasions. Scale bar represents 50 µm.  85  Figure 3.9  TWIST  Reagent  pEF1α-Twist  TWIST  d  a a E-CAD  Reagent  pEF1α-Twist  E-CAD  b  e  DESMOPLAKIN  Reagent  pEF1α-Twist  DESMOPLAKIN  c  f 86  3.3: Discussion and summary  Twist was first identified in Drosophila melanogaster as one of the zygotic genes required for dorsoventral patterning and mesoderm differentiation during embryogenesis (Thisse et al., 1987; Gitelman, 1997). This transcription factor is recognized as an organizer of epithelial-mesenchymal transition (EMT) during gastrulation and regulator of mesoderm differentiation (Thisse et al., 1987; Leptin et al., 1990). Twist has also been found to play an important role in cancer metastasis and was first reported in a breast cancer model, which suggested that Twist induced EMT and resulted in the promotion of tumour invasion (Yang et al., 2004). Similarly, disruption of E-CAD-mediated cell adhesion seems to be crucial in the EMT from non-invasive to invasive tumour cells (Comijn et al., 2001; Yang et al., 2004; Lee et al., 2006). Also, disruption of E-CADmediated cell adhesion has been related to a more infiltrative growth pattern in different types of cancers (Sakuragi et al., 1994; Cheng et al., 1996; Bremnes et al., 2000). In agreement, high Twist expression was seen to be correlated with deep myometrial invasion by endometrial cancer cells and is concurrent with decreased E-cad expression (Kyo et al., 2006). In my own studies, I observed a differential expression of Twist and E-cad during the terminal differentiation and fusion of a human trophoblastic cell line in vitro. These results suggest that TWIST controls the expression of E-cad, and that together they play an important role in human placental development. Importantly, the finding that Twist is up-regulated and E-cad is down-regulated when BeWo cells undergo differentiation and  87  fusion to become syncytia, suggests that TWIST may serve as a transcription repressor of E-cad during this highly regulated series of membrane-mediated processes. My observation of E-cad down-regulation during Twist-regulated differentiation and fusion of human trophoblastic cell line in vitro is consistent with other reports that loss of E-cad expression is a critical process during human trophoblast differentiation (Coutifaris et al., 1991; Getsios et al., 2003). For example, E-CAD has been shown to be present on the surface of cytotrophoblasts in situ, but not on the surface of the encompassing syncytiotrophoblast (Eidelman et al., 1989). Furthermore, the loss of E-CAD function by function-perturbing antibodies against E-CAD disrupted the aggregation of mononucleate cytotrophoblasts isolated from the human term placenta, which in turn inhibited the formation of multinucleated syncytia in cell cultures (Coutifaris et al., 1991). Primary trophoblast cultures were not used in my studies mainly because these samples contain heterogeneous populations of isolated cyto- and syncytial trophoblasts (Nasiry et al., 2006).  To circumvent this problem, I used the fusigenic BeWo  choriocarcinoma cell line, which has long been known to respond to increased intracellular cAMP by differentiating into a multinucleated syncytial trophoblast (Pattillo and Gey, 1968; Wice et al., 1990). Here, I also demonstrate that siRNA directed against Twist disrupts the formation of a multinucleated syncytium in BeWo cells undergoing terminal differentiation and fusion. My gain-of-function studies showed that heterologous Twist overexpression promotes the formation of multinucleated syncytia in these cell cultures. Collectively, and since E-cad expression was inversely altered in response to enhanced or reduced Twist expression, both these studies provide further evidence that E-CAD-mediated differentiation and  88  fusion of human trophoblastic cells are regulated by Twist. My results have also shown that terminal differentiation and fusion of human trophoblastic cells are accurately reproduced in culture at both the morphological and molecular levels. Suppression of Twist expression in highly metastatic mammary carcinomas or prostate cancer cells inhibits their ability to invade or metastasize (Hoek et al., 2004; Yang et al., 2004; Kwok et al., 2005; Hosono et al., 2007). On the other hand, elevated levels of Twist mRNA are associated with malignant transformation of melanoma cells, increase the risk for recurrence and for poor survival in epithelial ovarian carcinoma patients, and induce mesenchymal components and facilitate cell motility of various tumour cells (Kang and Massague, 2004; Yang et al., 2006; Hosono et al., 2007). The major functions of E-CAD are to mediate cell-cell adhesion and to play a pivotal role in the formation and maintenance of many epithelial tissues (Suzuki et al., 1996). Changes in cellular adhesion molecules like E-CAD are important for the invasive and metastatic capacity of human cancers (Takeichi M, 1993; Wijnhoven et al., 2000). For instance, decreased membranous immunoreactivity of E-CAD has also been shown to predict lymph node metastasis in atypical carcinoids (Pelosi et al., 2005). In contrast, increased cytoplasmic immunoreactivity of E-CAD has been suggested to result in loss of cell polarity and differentiation in pancreatic intraepithelial neoplasia (Al-Aynati et al., 2004). Several studies have strongly suggested that transcription repression is a major mechanism leading to decreased E-cad expression (Schipper et al., 1991; Bussemakers et al., 1992; Brabant et al., 1993; Dorudi et al., 1993). This commonly involves silencing of E-cad transcription through E-boxes in its promoter region. In transient reporter assays, over-expression of Twist in human mammary epithelial cells inhibited E-cad  89  promoter activity (Yang et al., 2004). TWIST represses transcription from the E-cad promoter through the E-box sequence, 5’-CANNTG-3’, which is also targeted by SNAIL and SIP1 (Lee et al., 2006). Other ways of silencing E-cad gene expression have been recognized, including gene truncation mutations and loss of heterozygosity (LOH) (Yoshiura et al., 1995, Berx et al., 1996; Huiping et al., 1999; Droufakou et al., 2001). However, these mechanisms appear to be utilized in only a subset of E-cad-negative invasive lobular carcinomas, therefore suggesting that a transcriptional repression mechanism of the E-cad promoter by TWIST plays a major role in the pathogenesis of these tumours (Yang et al., 2004). Although several studies have shown that promoter methylation can influence E-cad expression (Yoshiura et al., 1995; Xue et al., 2003; Lombaerts et al., 2006), this has not always been found (Tamura et al., 2000), and the mechanisms responsible for down-regulation of Ecad may be cell type-specific. The function of bHLH transcription factors like TWIST relies on the basic DNAbinding region and the HLH structure that allows monomers to form functional dimers that can identify and bind to the E-box DNA motif (Massari and Murre, 2000). The basic domain mediates the interaction with DNA (Elleberger et al., 1994; Ma et al., 1994) and bHLH proteins bind as dimers to the consensus hexanucleotide sequence E-box, (Ephrussi et al., 1985). TWIST forms both homodimers (T/T) and heterodimers with E2A E proteins (T/E) (Connerney et al., 2006). It has been suggested that TWIST heterodimers function as a transcription repressor, and that TWIST homodimers upregulate expression of the target gene by functioning as a transcription activator (Castanon et al., 2001; Connerney et al., 2006). However, it remains to be determined if  90  the interaction of TWIST with these E-boxes occurs directly, via interactions with E2A proteins or via indirect mechanisms (Lee et al., 2006). In Drosophila, Twist can increase the expression of Snail, a known repressor of E-cad transcription (Ip et al., 1992). However, Twist expression fails to induce Snail in human mammary epithelial cells that had undergone EMT (Yang et al., 2004). This agrees with the observation that TWIST and SNAIL function independently in mice (Carver et al., 2001; Soo et al., 2002). In summary, I have determined that Twist is capable of regulating E-CAD-mediated differentiation and fusion of human trophoblastic cells in vitro, and these results have contributed to a new understanding of TWIST’s function as a transcriptional repressor during terminal differentiation and fusion of human trophoblasts (Figure 3.10). Furthermore, my studies suggest that TWIST and E-CAD may serve as novel molecular markers for early detection of potential pregnancy disorders such as pre-eclampsia, intrauterine growth restriction (IUGR) and miscarriage.  91  Villous pathway (fusion) (Twist  E-cad) cAMP  Twist  Twist E-cad  E-cad  E-cad  E-cad  Mononucleate cytotrophoblasts  loss of cell-cell contacts  fusion  Multinucleated Syncytial trophoblast  Figure 3.10. A schematic diagram of a proposed role of Twist in regulating E-cadmediated terminal differentiation and fusion of human trophoblastic cells. cAMP upregulates TWIST levels. TWIST down-regulates E-cad expression to mediate the formation of multinucleated syncytial trophoblast from mononucleate cytotrophoblasts.  92  CHAPTER 4: TWIST REGULATES CADHERIN-MEDIATED INVASION OF HUMAN TROPHOBLASTIC CELLS IN VITRO  4.1: Introduction and rationale  Successful  implantation  depends  on  the  differentiation  of  cytotrophoblasts via two distinct and mutually exclusive pathways.  mononucleate The villous  cytotrophoblastic cells will proliferate and differentiate by fusion to form the outer syncytial trophoblast; or enter the extravillous pathway to form highly invasive extravillous cytotrophoblasts (EVTs) (Bischof and Campana, 2000). In the extravillous pathway, these cells invade deeply into the underlying maternal tissues (Pijnenborg et al., 1980).  EVTs invade the uterine stroma and superficial myometrium as individual  mononucleate cells, penetrate the basal lamina, and replace the endothelia of uterine vasculature. This allows an increase in blood supply to the placenta and ensures an adequate supply of oxygen and nutrients to the developing fetus, a critical step in human pregnancy (Aplin., 1991; Pijnenborg et al., 1983 and 1994). Failure of this process is associated with clinical pathological conditions such as miscarriage, intrauterine growth retardation, or preeclampsia (King and Loke, 1994). The process of human trophoblast invasion utilizes similar molecular mechanisms as those of tumour cell invasion, albeit trophoblast invasion is more tightly regulated (Lala et al., 2002). The precise control of trophoblastic cell differentiation along the extravillous pathway has been demonstrated to occur through regulated changes in cell-cell and cell-matrix interactions, and the modification of distinct extracellular matrix (ECM) components  93  through proteolytic degradation and/or activation (Lala and Hamilton, 1996; MacCalman et al., 1998; Chakraborty et al., 2002). To date, the molecular mechanisms that regulate trophoblast differentiation and invasion during formation and organization of the human placenta remain to be elucidated. TWIST, a highly conserved basic helix-loop-helix (bHLH) transcription factor, is known to play a key role in promoting tumour metastasis and is associated with potent invasiveness and poor prognosis of epithelial cancer (Thiery, 2002; Kang and Massague, 2004; Vernon et al., 2004; Yang et al., 2004; Kwok et al., 2005; Lee et al., 2006). In addition, Twist mRNA levels were found to be up-regulated in the highest grade of gliomas (Elias et al., 2005). TWIST has also been shown to be a key regulator of N-cad expression in different types of cancer cell lines (Alexander et al., 2006; Rosivatz et al., 2002). TWIST is essential for the initiation of N-cad expression in Drosophila (Oda et al., 1998). N-CAD is a member of the superfamily of integral membrane glycoproteins that mediate calcium-dependent cell adhesion (Takeichi, 1995; Suzuki, 1996). During cancer progression, there is an increase in expression of N-cad (Tomita et al., 2000; Derycke et al., 2004; Hazan et al., 2004). Other studies have shown a functional role for N-CAD in promoting an invasive phenotype. For example, exogenous expression of N-cad in breast epithelial cells and squamous epithelial cells results in a more invasive phenotype (Islam et al., 1996; Nieman et al., 2000). To date, N-cad has received significant attention in cancer studies (Hazan et al., 2000). Based on these observations, I hypothesize that Twist plays a key role in trophoblastic cell invasion through regulation of N-cad expression during human pregnancy. In my  94  studies, I first determined the expression levels of Twist and N-cad in the villi of first trimester human placentas, in cultures of highly invasive EVTs, and in two choriocarcinoma cell lines (JEG-3 and BeWo) by using semi-quantitative RT-PCR and Western blotting. Next, by using a Matrigel invasion assays, I determined the ability of interleukin (IL)-1β and transforming growth factor (TGF)-β1, two cytokines that are spatiotemporally expressed at the maternal-fetal interface (Graham et al., 1991 and 1993), to regulate trophoblastic cell invasion and Twist expression in these cells. Lossof-function studies using siRNA for Twist were employed to determine the role of Twist or N-cad in trophoblastic cell invasion. Finally, by using a function-perturbing antibody directed against N-CAD, the role of N-cad in regulating the invasive phenotype of these cells was assessed.  95  4.2: Results  4.2.1: Determining the levels of Twist and N-cad mRNA and protein levels in the human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines.  Semi-quantitative RT-PCR and Western blot analysis show that Twist was expressed in the first trimester human placenta and highly expressed in EVTs propagated from first trimester human placenta (refer to Section 2.2 in Materials and Methods for preparation details) and HTR-8/SVneo, a human EVT cell line.  In contrast, Twist mRNA and  proteins levels were significantly lower in poorly invasive JEG-3 and BeWo trophoblastic cell lines (Figure 4.1A and B). I then determined the expression of N-cad in human placental tissue, EVTs, and trophoblastic cell lines.  N-cad expression was absent in the first trimester human  placenta. It was barely detectable at the mRNA level and absent at the protein level in poorly invasive JEG-3 and BeWo trophoblastic cell lines. In contrast, N-cad mRNA and protein levels were higher significantly in EVTs and HTR-8/SVneo cells (Figure 4.2A and B).  4.2.2: IL-1β and TGF-β1 respectively promote and restrain the invasive ability of EVT primary cultures.  Previous studies have shown that IL-1β and TGF-β1 play major regulatory roles in the establishment of pregnancy (Graham and Lala, 1991; Chakraborty et al., 2002). In view  96  of these observations, I examined the ability of these two cytokines to regulate the invasive ability of EVT primary cultures. My results show that the addition of a vehicle (ethanol) to the culture medium of EVTs had no significant effect on the invasiveness of these cells, but a significant increase in EVT invasion was observed when these cells were treated with IL-1β (Figure 4.3A).  In contrast, TGF-β1 significantly reduced the invasive ability of these cells  (Figure 4.3B). I also examined the effect of TGF-β1 on HTR-8/SVneo cell invasion, but found that these cells did not response at all to TGF-β1 treatment (data not shown).  4.2.3: Time-dependent effects of IL-1β and TGF-β1 on Twist mRNA and protein levels in EVTs  Significant increases in Twist mRNA and protein levels (P < 0.05) were detected in primary EVTs cultured in the presence of 100 IU IL-1β for 24 h that were maintained or even slightly elevated after 48 h culture (Figure 4.4A and B). In contrast, the addition of TGF-β1 to the culture medium of these primary cells caused a significant decrease in Twist mRNA and protein levels after 24 h.  Levels of Twist mRNA and protein  expression continued to decrease until 48 h after treatment with this cytokine (Figure 4.5A and B).  97  4.2.4: Concentration-dependent effects of IL-1β and TGF-β1 on Twist mRNA and protein levels in EVTs  A significant increase (P < 0.05) in Twist mRNA and protein levels was detected in primary EVTs cultured for 24 h in the presence of 100 and 1000 IU IL-1β, with 1000 IU of IL-1β having the greatest effect (Figure 4.6A and B). Twist mRNA and protein expression levels were significantly decreased in EVTs cultured in the presence of TGF-β1 (5 and 10 ng/ml) for 24 h, but not at lower concentrations of this cytokine utilized with these primary cell cultures (Figure 4.7A and B).  4.2.5: Decreased Twist down-regulates N-cad expression and reduces the invasive capacity of HTR-8/SVneo cells  I utilized siRNA complementary to human Twist mRNA to decrease Twist expression in cultures of the HTR-8/SVneo EVT cell line. As a control, HTR-8/SVneo cells were transfected with a non-silencing (NS) scrambled siRNA. Transfection of HTR-8/SVneo cells with Twist siRNA significantly decreased Twist (Figure 4.8A and B) and N-cad (Figure 4.9A and B) mRNA and protein levels in these cell cultures after 36 h when compared to the control treatments. I next determined whether a reduction in Twist expression in HTR-8/SVneo resulted in a concomitant decrease in their invasive capacity. I performed invasion assays using Matrigel-coated Transwell chambers. My results show that the numbers of cells that penetrated the Matrigel barrier and appeared on the underside of the Millipore filter were  98  significantly lower in cultures of HTR-8/SVneo transfected with Twist siRNA than in cultures transfected with scrambled control siRNA (Figure 4.10).  4.2.6: Loss of N-cad reduces the invasive capacity of HTR-8/SVneo cells  In order to directly reduce the N-cad mRNA and protein levels in HTR-8/SVneo cells, these cells were transfected with siRNA specific for N-cad. To assess siRNA efficacy, real-time RT-PCR and Western blot analysis were performed. The results demonstrated a significant reduction in N-cad mRNA and protein levels (Figure 4.11A and B) compared to HTR-8/SVneo cells transfected with a non-silencing scrambled siRNA. I examined whether a reduction in N-cad levels in HTR-8/SVneo cells resulted in a concomitant decrease in their invasive capacity. The number of cells that penetrated the Matrigel and reached the underlying side of the filter of the Transwell invasion chambers was significantly lower in cultures of HTR-8/SVneo cells transfected with N-cad siRNA versus cell cultures that were transfected with non-silencing scrambled siRNA (Figure 4.12). To determine whether the reduction in the invasive capacity of HTR-8/SVneo cells transfected with N-cad siRNA was potentially caused by a loss of N-CAD cell-cell adhesion function, HTR-8/SVneo cells were cultured in the presence of a N-CAD function-perturbing antibody that binds to the N-CAD extracellular domain.  The  invasive ability of the antibody-treated cells was then assayed as previously described. A pan-cadherin antibody that binds to the N-CAD intracellular domain was used as the control. My results showed that an N-CAD extracellular domain-specific antibodymediated perturbation of endogenous N-CAD function led to a significantly less invasive  99  phenotype in HTR-8/SVneo cells, when compared to cells cultured with the control pancadherin antibody (Figure 4.13).  100  Figure 4.1. Twist mRNA and protein levels in human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines. A) Semi-quantitative RT-PCR analysis of Twist mRNA levels in first trimester placenta, EVTs, HTR-8/SVneo cells, JEG-3 or BeWo cells (lanes 1-5 respectively). A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. The photomicrographs were scanned using a laser densitometer.  The absorbance values for Twist mRNA were then  standardized to the absorbance value obtained for GAPDH mRNA levels.  The  experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVT control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extract prepared from a first trimester placenta, EVTs, HTR-8/SVneo cells, JEG-3 cells or BeWo cells (lanes 1-5 respectively). Western blot analysis was performed using a polyclonal antibody against TWIST. The resultant fluorograms were scanned and the absorbance values obtained for TWIST protein levels were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVT control).  101  Figure 4.1 A M  1  2  3  4  5 576 bp (Twist)  378 bp (GAPDH)  ➏➋ ➌  Relative Amount of Twist mRNA  ➏ ➎➋ ➌ ➎ ➍➋ ➌ ➍ ➊➋ ➌  *  ➊  Placenta (Villi)  EVTs  HTR-8/ SVneo  JEG3  3  4  * BeWo  B 1  2  5 28 kDa (TWIST)  42 kDa (ACTIN)  ➣ ➑➒  Relative Amount of TWIST Protein  ➣  ➐ ➑→ ➐ ➑➔ ➐ ➑➓ ➐ ➑➒  *  *  JEG3  BeWo  ➐  Placenta (Villi)  EVTs  HTR-8/ SVneo  102  Figure 4.2. N-cad mRNA and protein levels in human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines. A) Semi-quantitative RT-PCR analysis of N-cad mRNA levels in first trimester placenta, EVTs, HTR-8/SVneo cells, JEG-3 or BeWo cells (lanes 1-5 respectively). A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. The photomicrographs were scanned using a laser densitometer.  The absorbance values for N-cad mRNA were then  standardized to the absorbance value obtained for GAPDH mRNA levels.  The  experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVT control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracts prepared from first trimester placenta, EVTs, HTR-8/SVneo cells, JEG-3 cells or BeWo cells (lanes 1-5 respectively). Western blot analysis was performed using a monoclonal antibody against N-CAD. The resultant fluorograms were scanned and the absorbance values for N-CAD were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples.  The experiment was repeated on three  independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVT control).  103  Figure 4.2 A M  1  2  3  4  5 391bp (N-cad)  378 bp (GAPDH)  Relative Amount of N-cad mRNA  2.5  2  1.5  1  0.5  0  B  * Placenta (Villi)  1  EVTs  2  HTR-8/ SVneo  3  *  JEG3  BeWo  4  5 140 kDa (N-CAD)  42 kDa (ACTIN)  0.9  Relative Amount of N-CAD Protein  0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0  Placenta (Villi)  EVTs  HTR-8/ SVneo  *  *  JEG3  BeWo  104  Figure 4.3. Regulatory effects of IL-1β and TGF-β1 on EVT invasion. EVTs were either treated with IL-1β (A) or TGF-β1 (B) for 24 h. The cells were then placed in the upper well of Transwell invasion chambers. After a further 24 h of incubation, the porous membranes from the bottom of the Transwell were removed and fixed, stained, and mounted upside-down on a glass microscope slide. Invasion was determined by counting the number of cells that had invaded through the thin pre-coated layer of Matrigel on the top of the porous (8 µm) membrane and migrated through the pores to the underside of the membrane. Cells were visualized using a light microscope, and counted in three randomly selected fields of each membrane. Each cell line was plated in triplicate wells, and the experiment was repeated on three independent occasions.  The results are  presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to control).  105  Figure 4.3  A .  3  *  Invasion Index  2.5  2  1.5  1  0.5  0  0  100 IL-1β (IU/ml)  B .  1.2 1  Invasion Index  * 0.8 0.6 0.4 0.2 0  0  5 TGF-β1 (ng/ml)  106  Figure 4.4. Time-dependent effects of IL-1β on Twist mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Twist mRNA levels in EVTs cultured in the presence of 100IU/ml IL-1β for 0, 12, 24, or 48 h (lanes 1-4, respectively). A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right.  A representative photomicrograph of the ethidium bromide-stained gels is  presented.  Gels generated from this and three other independent experiments were  analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 h control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with 100IU/ml IL-1β for 0, 12, 24, or 48 h (lanes 1-4, respectively) and probed with a rabbit polyclonal antibody against TWIST or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST were normalized to the absorbance values obtained for human β-actin (ACTIN) in the samples. The results derived from this analysis and from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 h control).  107  Figure 4.4 A M  1  Control 2  3  4 576 bp (Twist)  378 bp (GAPDH) M  1  IL-1β β 2  3  4 576 bp (Twist) 378 bp (GAPDH)  Relative Amount of Twist mRNA  1.8 1.6  *  *  1.4 1.2  Control  1  IL-1β  0.8 0.6 0.4 0.2 0  IL-1β 100 IU/ml  0  12  24  48  Time (h)  B  Control 1  2  3  4 28 kDa (TWIST)  42kDa (ACTIN) IL-1β β 1  2  3  4 28 kDa (TWIST) 42kDa (ACTIN)  2  *  1.8  *  Relative Amount of TWIST Protein  1.6 1.4  Control  1.2 1  IL-1β  0.8 0.6 0.4 0.2 0  IL-1β 100 IU/ml  0  12  24  48  Time (h)  108  Figure 4.5. Time-dependent effects of TGF-β1 on Twist mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Twist mRNA levels in EVTs cultured in the presence of 5 ng/ml TGF-β1 for 0, 6, 12, 24, or 48 h (lanes 1-5, respectively). A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. A representative photomicrograph of the ethidium bromide-stained gels is presented.  Gels generated from this and three other independent experiments were  analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 h control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with 5 ng/ml TGF-β1 for 0, 6, 12, 24, or 48 h (lanes 1-5, respectively) and probed with a rabbit polyclonal antibody against TWIST or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The results derived from this analysis and from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 h control).  109  Figure 4.5 A M  1  2  Control 3  4  5 576 bp (Twist) 378 bp (GAPDH)  M  1  TGF-β β1 3  2  4  5 576 bp (Twist)  Relative Amount of Twist mRNA  378 bp (GAPDH)  1.4 1.2 1  Control  0.8  *  0.6  *  TGF-β1  0.4 0.2 0  TGF-β1 5ng/ml  0  6  B 1  12 Time (h)  Control 3  2  24  48  4  5 28 kDa (TWIST) 42 kDa (ACTIN)  1  2  TGF-β β1 3  4  5 28 kDa (TWIST) 42 kDa (ACTIN)  1.4  Relative Amount of TWIST Protein  1.2 1  Control  0.8  TGF-β1  *  0.6  * 0.4 0.2  TGF-β1 5ng/ml  0  0  6  12 Time (h)  24  48  110  Figure 4.6. Concentration-dependent effects of IL-1β on Twist mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Twist mRNA in EVTs cultured in the presence of IL-1β (0, 1, 10, 100 or 1000 IU/ml; lanes 1-5, respectively) for 24 h. A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. Representative photomicrographs of the resultant ethidium bromide-stained gels are presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 IU/ml control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with IL-1β (0, 1, 10, 100 or 1000 IU/ml; lanes 1-5, respectively) for 24 h and probed with rabbit polyclonal antibodies against TWIST or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The results derived from this analysis and from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 IU/ml control).  111  Figure 4.6  A M  1  2  3  4  5 576 bp (Twist)  Relative Amount of Twist mRNA  378 bp (GAPDH) 2 1.8  *  *  1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0  0  B  1  1  2  10 IL-1β (IU/ml)  3  100  4  1000  5 28 kDa (TWIST)  42 kDa (ACTIN)  Relative Amount of TWIST Protein  2.5 2  *  *  1.5  1 0.5 0  0  1  10 100 IL-1β (IU/ml)  1000  112  Figure 4.7. Concentration-dependent effects of TGF-β1 on Twist mRNA and protein expression levels in EVTs. A) Semi-quantitative RT-PCR analysis of Twist mRNA in EVTs cultured in the presence of TGF-β1 (0, 0.01, 0.1, 1, 5 or 10 ng/ml; lanes 1-6, respectively) for 24 h. A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. Representative photomicrographs of the resultant ethidium bromide-stained gels are presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 ng/ml control) in the graph. B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with TGF-β1 (0, 0.01, 0.1, 1, 5 or 10 ng/ml; lanes 1-6, respectively) for 24 h and probed with rabbit polyclonal antibodies against TWIST or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The results derived from this analysis and from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 ng/ml control).  113  Figure 4.7  A M  1  2  3  4  5  6 576 bp (Twist)  Relative Amount of Twist mRNA  378 bp (GAPDH) 1.2 1 0.8 0.6  *  0.4  *  0.2 0  0  0.01  1  2  0.1 1 TGF-β1 (ng/ml)  5  10  5  6  B 3  4  28 kDa (TWIST) 42 kDa (ACTIN)  Relative Amount of TWIST Protein  1.2 1 0.8 0.6  * *  0.4 0.2 0  0  0.01  0.1 1 TGF-β1 (ng/ml)  5  10  114  Figure 4.8. Effects of Twist siRNA on Twist mRNA and protein levels in HTR-8/SVneo cell cultures. A) Semi-quantitative RT-PCR analysis of Twist mRNA levels in cells transfected with a scrambled control siRNA (lane 1) or siRNA specific for Twist (lane 2) for 36 h. A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. Values for Twist mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from HTR-8/SVneo cells cultured with a scrambled control siRNA (lane 1) or siRNA specific for Twist (lane 2) for 36 h and probed with rabbit polyclonal antibodies against TWIST or human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for TWIST protein levels were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The results derived from this analysis and from three other studies were standardized to the scrambled control siRNA and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA).  115  Figure 4.8 A M  1  2 576 bp (Twist)  378 bp (GAPDH)  Relative Amount of Twist mRNA  1.2  1  0.8  0.6  0.4  * 0.2  0  Control siRNA  Twist siRNA  B 1  2 28 kDa (TWIST)  42 kDa (ACTIN) 1.2  Relative Amount of TWIST Protein  1  0.8  0.6  * 0.4  0.2  0  Control siRNA  Twist siRNA  116  Figure 4.9. Effects of Twist siRNA on N-cad mRNA and protein levels in HTR-8/SVneo cell cultures. A) Semi-quantitative RT-PCR analysis of N-cad mRNA levels in cells transfected with a scrambled control siRNA (lane 1) or siRNA specific for Twist (lane 2) for 36 h. A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. Values for N-cad mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA).  B)  Representative fluorogram of a Western blot containing 30 µg of total protein extracted from HTR-8/SVneo cells transfected with a scrambled control siRNA (lane 1) or siRNA specific for TWIST (lane 2) for 36 h and probed with mouse monoclonal antibody against N-CAD or rabbit polyclonal antibody against human β-actin. system was used to detect antibody bound to antigen.  The Amersham ECL  The resultant fluorograms were  scanned and the absorbance values obtained for N-CAD protein levels were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples.  The results derived from this analysis and from three other studies were  standardized to the scrambled control siRNA and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA).  117  Figure 4.9  A M  1  2 391 bp (N-cad)  378 bp (GAPDH)  Relative Amount of N-cad mRNA  1.2  1  0.8  0.6  * 0.4  0.2  0  B  Control siRNA  Twist siRNA  1  2 140 kDa (N-CAD)  42 kDa (ACTIN) 1.2  Relative Amount of N-CAD Protein  1  0.8  * 0.6  0.4  0.2  0  Control siRNA  Twist siRNA  118  Figure 4.10. Reduced Twist expression decreases the invasive capacity of HTR-8/SVneo cells. HTR-8/SVneo cells were transfected with a scrambled control siRNA (lane 1) or siRNA specific for Twist (lane 2) for 24 h. The cells were then placed in the upper wells of Transwell invasion chambers. After a further 24 h of culture, the porous membranes from the bottom of the Transwells were removed and fixed, stained and mounted upsidedown on a glass microscope slide. Invasion was determined by counting the number of cells that had invaded through the thin pre-coated layer of Matrigel on the top of the porous (8 µm) membrane and migrated through the pores to the underside of the membrane.  Cells were visualized using a light microscope, and counted in three  randomly selected fields of each membrane. Each cell line was plated in triplicate wells, and with the experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to HTR8/SVneo scrambled control siRNA).  119  Figure 4.10  1.4  Invasion Index  1.2 1 0.8 0.6  *  0.4 0.2 0  Control (1)  Twist siRNA (2)  120  Figure 4.11. Effects of N-cad siRNA on N-cad mRNA and protein levels in HTR8/SVneo cell cultures. A) Real-time PCR analysis of N-cad mRNA levels transfected with a scrambled control siRNA (lane 1) or siRNA specific for N-cad (lane 2) for 36 h. Values for the levels of the N-cad mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA). B) Representative fluorogram of a Western blot containing total protein extracted from HTR-8/SVneo cells transfected with a scrambled control siRNA (lane 1) or siRNA specific for N-cad (lane 2) for 36 h and probed with mouse monoclonal antibody directed against N-CAD or rabbit polyclonal antibody against human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for N-CAD protein levels were normalized to the absorbance values obtained for human β-actin (ACTIN) in the corresponding samples. The results derived from both these analyses and from three other sets of experiments were standardized to the scrambled control siRNA and are represented (mean + SEM., n = 4) in the bar graphs (*, P < 0.05 compared to scrambled control siRNA).  121  Figure 4.11  Relative Amount of N-cad mRNA  A. 1.2 1 0.8  *  0.6 0.4 0.2 0  Control siRNA (1)  N-cad siRNA (2)  B  140 kDa (N-CAD)  42kDa (ACTIN)  1.2  Relative Amount of N-CAD Protein  1 0.8  * 0.6 0.4 0.2 0  Control siRNA (1)  N-cad siRNA (2)  122  Figure 4.12. Reduced N-cad levels decrease the invasive capacity of HTR-8/SVneo cells. HTR-8/SVneo cells were transfected with a scrambled control siRNA (lane 1) or siRNA specific for N-cad (lane 2) for 24 h. The cells were then placed in the upper wells of Transwell invasion chambers. After a further 24 h of incubation, the porous membranes from the bottom of the Transwells were removed and fixed, stained and mounted upsidedown on a glass microscope slide. Invasion was determined by counting the number of cells that had invaded through the thin pre-coated layer of Matrigel on the top of the porous (8 µm) membrane and migrated through the pores to the underside of the membrane. Cells were visualized using a light microscope, and were counted in three randomly selected fields of each membrane. Each cell line was plated in triplicate wells, and the experiment was repeated on three independent occasions.  The results are  presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to scrambled control siRNA).  123  Figure 4.12  ➞↕ ➙  Invasion Index  ➞ ↔↕ ➝  *  ↔↕ ➜  ↔↕ ➛ ↔↕ ➙  ↔  Control siRNA (1)  N-cad siRNA (2)  124  Figure 4.13. Disruption of N-CAD function decreases the invasive ability of HTR8/SVneo cells. HTR-8/SVneo cells were treated with a control pan-cadherin antibody (lane 1) or an N-CAD function-perturbing antibody (lane 2) for 24 h. The cells were then placed in the upper wells of Transwell invasion chambers. After a further 24 h of incubation, the porous membranes from the bottom of the Transwells were removed and fixed, stained, and mounted upside-down on a glass microscope slide. Invasion was determined by counting the number of cells that had invaded through the thin pre-coated layer of Matrigel on the top of the porous (8 µm) membrane and migrated through the pores to the underside of the membrane. Cells were visualized using a light microscope, and were counted in three randomly selected fields of each membrane. Each cell line was plated in triplicate wells, and the experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to control pan-cadherin (PAN-CAD) antibody).  125  Figure 4.13  1.2  Invasion Index  1 0.8 0.6  *  0.4 0.2 0  PAN-CAD Ab (1)  N-CAD Ab (2)  126  4.3: Discussion and summary  My studies demonstrate that Twist and N-cad are highly expressed in highly invasive EVTs propagated from first trimester human placenta and the HTR-8 EVT cell line but are not readily detectable in the poorly invasive JEG-3 and BeWo cell lines. In addition, IL-1β and TGF-β1 were found to have differential effects on Twist mRNA and protein levels in primary cultures of EVTs, and this suggests that these molecules play important roles in human trophoblastic cell invasion. Extravillous trophoblasts (EVTs) can be divided into two populations: 1) interstitial cytotrophoblasts that will invade into the decidual stroma and superficial myometrium; and 2) endovascular cytotrophoblasts which will invade into the lumen of the spiral arteries (Pijnenborg et al., 1981; Pijnenborg 1983; Roberston et al., 1986). In order for the human placenta to properly form, the trophoblast must invade into the uterus, which involves attachment of these cells to the extracellular matrix (ECM), degradation of the matrix, and migration. The spiral arteries of the placental bed also have to undergo a certain degree of alteration. The interaction between the invasive cytotrophoblast and the spiral artery vessel wall is the major step in achieving these physiological modifications (Lyall, 2006). Trophoblast invasion is controlled by cell adhesion molecules including cadherins, which are expressed on the surface of cytotrophoblasts that interact with the ECM of the decidua (Kreis et al., 1993; Alberts et al., 1994). The cadherin N-CAD has been shown to have the ability to mediate homotypic cell aggregation as well as the ability to form heterotypic adhesions in various cell types including stromal fibroblasts, vascular endothelial cells, smooth muscle cells, and  127  myofibroblasts (Hazan et al., 1997; Tran et al., 1999; Li et al., 2001; De Wever et al., 2003). For instance, by increasing the interaction with the surrounding stroma, N-CAD is able to promote invasion and metastasis (Hazan et al., 1997).  In addition, the  transcription factor Twist has been reported to increase vascular volume and vascular permeability by increasing vascular endothelial growth factor (VEGF) synthesis, and inducing in vivo angiogenesis (Mironchik et al., 2005). In my studies, when I used a siRNA strategy targeting Twist in human trophoblastic cells, the invasive ability of these cells was significantly reduced. Others have also reported that inactivation of Twist suppressed the migration and invasion abilities of androgen-independent prostate cancer cells (Kwok et al., 2005). In my studies, when the invasive ability of trophoblastic cells was reduced in the presence of Twist siRNA, I also observed decreased N-cad mRNA and protein levels in these cells. This suggests that Twist regulates human trophoblast invasion via N-cad. Furthermore, my results show that by directly limiting N-cad expression in a Twist-independent manner (i.e. with Ncad-directed siRNA) in human trophoblastic cells, the invasive ability of these cells was significantly reduced. My loss-of-function studies in which either Twist or N-cad was targeted have clearly shown a concomitant reduction in the invasive ability of human trophoblastic cells. Furthermore, by blocking the extracellular domain of N-CAD with a function-perturbing antibody, the invasive ability of these trophoblastic cells was reduced. This novel finding further strengthens the growing consensus that trophoblast invasion utilizes similar molecular mechanisms to those of tumour cell invasion.  128  As previously mentioned, decreased Twist expression, which is involved in cancer metastasis, was found to be associated with down-regulation of N-cad in a variety of cancer tumours such as osteosarcomas (Guo et al., 2007). However, in my study, I could not determine whether TWIST interacts with N-cad directly or indirectly. In a prostate cell line, TWIST did not show an increase in promoter-binding activity, but was found to regulate N-cad expression through its direct interaction with an E-box regulatory element located within the first intron of the N-cad gene (Alexander et al., 2006). Rosivatz et al. (2004) suggest that E-cad transcriptional repressors may not play a major role in colon cancer pathogenesis, and other studies have not always found a correlation between reduced E-CAD immunohistochemistry and tumour progression. It seems that N-cad induced invasion activities can even overcome the E-cad tumour suppressive function (Hazan et al., 1997; Nieman et al., 1999). In my preliminary data, I observed that when I silenced Twist expression in human trophoblastic cells, E-cad expression levels remain unchanged (data not shown). This requires further validation, but indicates that the “cadherin switch” varies in a tumour or tissue-specific manner. Collectively, my results have clearly identified TWIST and its associated protein, NCAD, to be key molecules in human EVT invasion (Figure 3.14). To my knowledge, this is the first study to demonstrate the regulation of trophoblast invasion by Twist through its role in the induction of N-cad gene expression. TWIST and N-CAD may serve as useful diagnostic and prognostic tools or novel therapeutic targets for human trophoblastic diseases such as miscarriage, intrauterine growth restriction (IUGR), or preeclampsia.  129  Extravillous pathway (invasion)  (Twist  N-cad  Invasion)  TWIST  N-cad  Invasion  Figure 4.14. A schematic diagram of a proposed role of Twist in regulating N-cadmediated differentiation of human trophoblastic cells. Silencing Twist expressing by siRNA stategy reduces N-cad expression level and reduces the invasion ability of human trophoblastic cells.  130  CHAPTER 5: A KEY ROLE FOR RUNX2 IN HUMAN TROPHOBLAST INVASION.  5.1: Introduction and rationale  The trophoblastic cells form the outer layer of the blastocyst and play an essential role in implantation and placentation during human pregnancy. The cytotrophoblast stem cells are specialized epithelial cells of the placenta which can undergo two differentiation pathways (Zhou et al., 1997). In one pathway, the cytotrophoblast cells fuse to form multinucleated syncytial trophoblast cells, which are involved in maternal-fetal exchanges and placental endocrine functions. In the other pathway, the cytotrophoblasts differentiate into the invasive extravillous cytotrophoblast (EVT) cells. These EVT cells invade the maternal uterine wall and its blood vessels to establish the flow of oxygenated blood to the placenta (Aplin et al., 1991). Proper trophoblast invasion is critical for a healthy pregnancy, and insufficient invasion is associated with preeclampsia, intrauterine growth restriction and recurrent miscarriage (Goldman-Wohl and Yagel, 2002). Cells at the maternal-fetal interface are exposed to numerous cytokines, growth factors and hormones that play critical roles in mediating the processes required for cell invasion (Chakraborty et al., 2002). The processes required for trophoblast invasion include degradation and remodelling of the extracellular matrix (ECM) components, and regulated changes in cell-cell and cell-matrix interactions (MacCalman et al., 1998, Chakraborty et al., 2002; Cohen et al., 2006). The RUNX proteins (runt-related transcription factor) are a family of transcription factors that contain a DNA-binding runt domain (Ito, 1999). The Runx2 gene (also  131  known as PEBP2α/AML3/CBFA1) is essential for osteoblast development and proper bone formation (Otto et al., 1997). In cancer cells, Runx2 is capable of activating the expression of adhesion proteins, matrix metalloproteinases (MMPs) and angiogenic factors known to be associated with invasive properties of metastatic cancer cells (Pratap et al., 2006). Interleukin-1β (IL-1β) is a cytokine that plays a major regulatory role in the establishment of pregnancy (Salamonsen et al., 2000, 2003; Fazleabas et al., 2004). In particular, IL-1β has been shown to increase the invasiveness of primary cultures of trophoblastic cells (Librach et al., 1994; Simon et al., 1994; Karmakar and Das, 2002). Conversely, another cytokine, transforming growth factor-β1 (TGF-β1) is highly expressed in both fetal and maternal cellular compartments of the term human placenta and reduces trophoblastic cell invasion (Lala and Graham, 1990; Graham and Lala, 1991, 1992; Godkin and Dore, 1998), TGF-β1 also plays a key regulatory role in placenta development and function (Graham and Lala, 1991).  Nevertheless, the precise  mechanisms that regulate trophoblast invasion are not fully understood. Cadherins play an important role in embryogenesis.  The neural cell adhesion  molecule, N-cadherin (N-CAD), serves as a key molecule during gastrulation and neural crest development. In previous studies, I have identified that N-cad plays a role in human trophoblastic cell invasion. Furthermore, in cancer, the expression of N-cad in epithelial cells alters cell morphology to a fibroblastic phenotype, enhancing their motility and invasive potential (Derycke and Bracke, 2004). Studies have shown that N-cad plays critical roles in the invasive properties of various cancer cell types, such as those of the  132  colon, breast and pancreas (Nieman et al., 1999; Nakajima et al., 2003; Rieger-Christ et al., 2004). In view of the above observations, I hypothesized that Runx2 expression plays a key role in regulating human trophoblastic cell invasion by modulating N-cad expression. In this study, by using semi-quantitative RT-PCR and Western blotting, I have examined Runx2 mRNA and protein levels in human placental tissues and cells. Furthermore, I have examined the ability of IL-1β and TGF-β1 to regulate Runx2 mRNA and protein expression levels in primary cultures of EVTs. By using the Matrigel invasion assay, I have also identified a role for Runx2 in human trophoblastic cell invasion through silencing Runx2 expression using a siRNA strategy. Finally, I determined whether N-cad can be regulated by Runx-2 in human trophoblastic cell invasion.  133  5.2: Results  5.2.1: Runx2 is expressed in human placenta, highly invasive EVTs, and poorly invasive trophoblastic cell lines.  Prior to these studies, nothing was known about the expression of Runx2 in the human placenta.  Semi-quantitative RT-PCR and Western blot experiments revealed the  presence of Runx2 mRNA and protein in first trimester human placenta. Runx2 mRNA and protein were most abundant in primary EVTs and HTR-8/SVneo EVT cells but were present in very low amounts in JEG-3 and BeWo cells (Figure 5.1A and B).  5.2.2: Time-dependent effects of IL-1β on Runx2 mRNA and protein levels in human EVTs  IL-1β (100 IU/ml) treatment resulted in a significant increase in Runx2 mRNA levels in primary EVTs after 24 h of culture, with maximum levels being detected in cells cultured in the presence of this cytokine for 48 h (Figure 5.2A). Treatment with 100 IU/ml IL-1β for 24 h induced an approximately 1.4-fold increase in Runx2 mRNA, while the same treatment for 48 h induced approximately a 1.5-fold increase.  In  correspondence with the fold-increases in mRNA, RUNX2 protein levels in EVT cultures increased approximately 1.6-fold by treatment with 100 IU/ml IL-1β for 24 h, and increased approximately 1.8-fold upon treatment for 48 h (Figure 5.2B).  134  5.2.3: Time-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in human EVTs  A significant decrease in Runx2 mRNA levels was detected in EVTs cultured in the presence of 5 ng/ml TGF-β1 for 24 h and 48 h (Figure 5.3A). Treatment with 5 ng/ml TGF-β1 for 24 h induced approximately a 30% decrease in Runx2 mRNA, while the same treatment for 48 h induced an approximately 35% decrease in these primary cell cultures.  In agreement with the results obtained using semi-quantitative RT-PCR,  RUNX2 protein levels decreased approximately 30% upon treatment with 5 ng/ml TGFβ1 for 24 h, and approximately 35% after the same treatment for 48 h (Figure 5.3B).  5.2.4: Concentration-dependent effects of IL-1β on Runx2 mRNA and protein levels in human EVTs  Increasing concentrations of IL-1β increased the Runx2 mRNA levels present in primary cultures of human EVTs in a concentration-dependent manner (Figure 5.4A). However, significant increases in Runx2 mRNA levels were only observed in EVTs treated with higher concentrations of IL-1β (10, 100 or 1000 IU/ml) in these studies. IL1β at 10 IU/ml induced approximately a 1.3-fold increase in Runx2 mRNA levels, while 100 and 1000 IU/ml induced approximately 1.5 and 1.7-fold increases, respectively. In agreement with the results obtained using semi-quantitative RT-PCR, IL-1β increased RUNX2 protein levels in EVT cultures in a concentration-dependent manner (Figure 5.4B). In correspondence with the fold-increases in mRNA, RUNX2 protein  135  levels were increased 1.4-fold by 10 IU/ml of IL-1β, 1.6-fold by 100 IU/ml of IL-1β and 1.8-fold by 1000 IU/ml of IL-1β.  5.2.5: Concentration-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in human EVTs  TGF-β1 decreased Runx2 mRNA levels in primary EVTs in a concentrationdependent manner. A significant decrease in Runx2 mRNA was observed only in EVTs treated with the highest concentrations of TGF-β1 (1 or 10 ng/ml) (Figure 5.5A). TGFβ1 at 1 ng/ml induced a 20% decrease in Runx2 mRNA, while treatment with 10 ng/ml TGF-β1 resulted in a 30% decrease in Runx2 mRNA. TGF-β1 treatment also reduced RUNX2 protein levels in primary cultures of EVTs in a concentration-dependent manner (Figure 5.5B). In accordance with the fold-decreases in mRNA, RUNX2 protein levels were decreased 25% by 5 or 10 ng/ml of TGF-β1.  5.2.6: Attenuation of cytokine-modulated Runx2 mRNA and protein levels in EVTs using neutralizing antibodies directed against IL-1β or TGF-β1  Function-perturbing monoclonal antibodies directed against either IL-1β or TGF-β1 had no significant effect on Runx2 mRNA and protein levels in my primary EVTs after 24 h of culture (data not shown). However, IL-1β-mediated increases in the Runx2 mRNA and protein levels in these primary cell cultures were inhibited by the addition of an anti-IL-1β neutralizing antibody to the culture medium for 24 h. IL-1β at 100 IU/ml together with anti-IL-1β antibody at 1 µg/ml induced approximately a 26% decrease in  136  Runx2 mRNA compared to the control treatment (IL-1β at 100IU/ml), while IL-1β at 100 IU/ml together with anti-IL-1β antibody at 2 µg/ml induced approximately a 35% decrease in Runx2 mRNA compared to the control treatment (IL-1β at 100IU/ml) (Figure 5.6A). In accordance with these fold-decreases in mRNA, RUNX2 protein expression was decreased 30% by 100 IU/ml of IL-1β together with anti-IL-1β antibody at 1 µg/ml, and 35% by 100 IU/ml of IL-1β together with anti-IL-1β antibody at 2 µg/ml (Figure 5.6B). Similarly, the monoclonal antibody against TGF-β1 abolished the decrease in Runx2 mRNA and protein levels observed in EVTs cultured in the presence of this cytokine. TGF-β1 at 10 ng/ml together with anti-TGF-β1 antibody at 10 ug/ml induced approximately a 1.3-fold increase in Runx2 mRNA compared to control (TGF-β1 at 10 ng/ml) (Figure 5.7A). A similar fold-increase (1.4-fold) in RUNX2 protein expression was observed under these conditions (Figure 5.7B).  5.2.7: Inhibition of Runx2 expression down-regulates N-cad mRNA and protein levels and reduces the invasive capacity of HTR-8/SVneo cells  In order to repress Runx2 expression in cultures of HTR-8/SVneo cells, I utilized siRNA complementary to human Runx2 mRNA. Transfection of HTR-8/SVneo cells with this siRNA significantly decreased Runx2 mRNA and protein levels in these cell cultures after 36 h compared to cells transfected with a non-silencing, scrambled siRNA (Figure 5.8A and B). The N-cad mRNA and protein levels were significantly decreased after 36 h of siRNA targeting Runx2, compared to HTR-8/SVneo cells transfected with non-silencing, scrambled siRNA in these studies (Figure 5.9A and B).  137  I also examined whether a reduction in Runx2 expression in HTR-8/SVneo cells results in a concomitant decrease in their invasive capacity using Matrigel coated Transwell chambers. The number of cells that penetrated the Matrigel and reached the underside of the membrane in the Transwell invasion chambers was significantly lower in cultures of HTR-8/SVneo cells which had been transfected with Runx2 siRNA compared to cell cultures that had been transfected with non-silencing, scrambled siRNA (Figure 5.10).  138  Figure 5.1. Runx2 mRNA and protein expression levels in human placenta, highly invasive EVTs and poorly invasive trophoblastic cell lines. A) Semi-quantitative PCR analysis of Runx2 mRNA levels in first trimester placenta, primary EVT cell cultures, HTR-8/SVneo cells, JEG-3 or BeWo cells (lanes 1-5, respectively). A 100 bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. The photomicrographs were scanned using a laser densitometer.  The absorbance values  obtained for Runx2 were then standardized to the absorbance value obtained for GAPDH mRNA levels. The experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVTs control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extract prepared from first trimester placenta, primary EVT cell cultures, HTR8/SVneo cells, JEG-3 cells or BeWo cells. Western blot analysis was performed using a polyclonal antibody against RUNX2. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 protein levels were normalized to the absorbance values obtained for β-actin (ACTIN) in the corresponding samples. The experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to EVT control).  139  Figure 5.1 A M  1  2  3  4  5 161 bp (Runx2)  Relative Amount of Runx2 mRNA  378 bp (GAPDH)  1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0  Placenta (Villi)  EVTs  HTR-8 SVneo  *  *  JEG3  BeWo  B 1  2  3  4  5 55 kDa (RUNX2)  42 kDa (ACTIN)  0.8  Relative Amount of RUNX2 Protein  0.7 0.6 0.5 0.4 0.3 0.2 0.1 0  Placenta (Villi)  EVTs  HTR-8 SVneo  *  *  JEG3  BeWo  140  Figure 5.2. Time-dependent effects of IL-1β on Runx2 mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Runx2 mRNA levels in EVTs cultured in the presence of 100 IU/ml IL-1β for 0, 12, 24, or 48h (lanes 1-4, respectively). A 100bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. A representative photomicrograph of the ethidium-stained gels is presented. Gels generated from three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0h control). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with 100 IU/ml IL-1β for 0, 12, 24, or 48h (lanes 1-4, respectively) and probed with a rabbit polyclonal antibody against RUNX2 or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 were normalized to the absorbance values obtained for human βactin (ACTIN) in the samples. The results derived from this analysis and from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0h control).  141  Figure 5.2 A M  Control 2  1  3  4 161 bp (Runx2)  378 bp (GAPDH) IL-1β β M  1  2  3  4 161 bp (Runx2)  378 bp (GAPDH)  Relative Amount of Runx2 mRNA  ➦➠ ➥  *  ➦➠ ➤  *  ➦➠ ➢ ➦➠ ➡  Control  ➦  IL-1β  ➟➠ ➥ ➟➠ ➤ ➟➠ ➢ ➟➠ ➡ ➟  IL-1β 100IU/ml  0  12  24  48  (Time)  B  Control 1  2  3  4 55 kDa (RUNX2) 42 kDa (ACTIN)  1  2  IL-1β β  3  4 55 kDa (RUNX2)  42 kDa (ACTIN) ➩  *  ➲➨ ➯  *  Relative Amount of RUNX2 protein  ➲➨ ➭ ➲➨ ➫  Control  ➲➨ ➩  IL-1β  ➲ ➧➨ ➯ ➧➨ ➭ ➧➨ ➫ ➧➨ ➩ ➧  IL-1β 100IU/ml  0  12  24  48  (Time)  142  Figure 5.3. Time-dependent effects of transforming growth factor-β1 (TGF-β1) on Runx2 mRNA and protein levels in EVTs. A) RT-PCR analysis of Runx2 mRNA levels in EVTs cultured in the presence of 5 ng/ml TGF-β1 for 0, 6, 12, 24 or 48h (lanes 1-5, respectively). A 100-bp ladder is shown in lane M (marker) with the size of the target cDNA indicated at the right. A representative photomicrograph of the resultant ethidium bromide-stained gels is presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are presented as (mean absorbance + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 h control). B) Representative fluorogram of a Western blot containing 30 µl of total protein extracted from corresponding EVT cultures treated with 5 ng/ml TGFβ1 for 0, 6, 12, 24 or 48h (lanes 1-5, respectively) and probed with a rabbit polyclonal antibody  against  RUNX2  or  human  β-actin.  The  Amersham  enhanced  chemiluminescence system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 were normalized to the absorbance values obtained for human β-actin (ACTIN) in the samples. The results derived from this analysis as well as those from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0h control).  143  Figure 5.3 A  Control M  1  2  3  4  5 161 bp (Runx2)  378 bp (GAPDH) TGF-β β1 M  1  2  3  4  5 161 bp (Runx2)  Relative Amount of Runx2 mRNA  378 bp (GAPDH)  ➽ ➵➸ ➽ ➳ ➵➼  Control  *  *  ➳ ➵➻  TGF-β1  ➳ ➵➺ ➳ ➵➸ ➳  TGF-β1 5ng/ml  0  6  12 Time (h)  B 1  2  Control 3  24  48  4  5 55kDa (RUNX2)  42kDa (ACTIN)  1  2  TGF-β β1 3  4  5 55kDa (RUNX2) 42kDa (ACTIN)  ➴➚ ➪  Relative Amount of RUNX2 protein  ➴ ➾➚ ➘  Control  *  * TGF-β1  ➾➚ ➹ ➾➚ ➶ ➾➚ ➪ ➾  TGF-β1 5ng/ml  0  6  12 Time (h)  24  48  144  Figure 5.4. Concentration-dependent effects of IL-1β on Runx2 mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Runx2 mRNA in EVTs cultured in the presence of vehicle alone (lane 1) or increasing concentrations of IL-1β (1, 10, 100 or 1000 IU; lanes 2-5, respectively). A 100-bp ladder is shown in lane M with the size of the target cDNA indicated at the right. Representative photomicrographs of the resultant ethidium bromide-stained gels are presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 IU/ml control).  B) Representative fluorogram of a Western blot  containing 30 µg of total protein extracted from corresponding EVT cultures treated with vehicle alone (lane 1) or increasing concentrations of IL-1β (1, 10, 100 or 1000 IU; lanes 2-5, respectively) and probed with rabbit polyclonal antibodies against RUNX2 or human β-actin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 were normalized to the absorbance values obtained for human β-actin (ACTIN) in the samples. The results derived from this analysis as well as those from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 IU/ml control).  145  Figure 5.4 A M  1  2  3  4  5 161 bp (Runx2)  *  378 bp (GAPDH)  Relative Amount of Runx2 mRNA  Ï  *  Ó❰ Ò  *  Ó❰ Ñ Ó❰ Ð  *  Ó❰ Ï Ó ❮❰ Ò ❮❰ Ñ ❮❰ Ð ❮❰ Ï ❮  0  B.  1  1  2  10 IL-1β (IU/ml)  3  100  4  1000  5 55 kDa (RUNX2)  42 kDa (ACTIN)  ➮  *  ❒ ➬❐  *  Relative Amount of RUNX2 protein  ❒ ➬✃  *  ❒ ➬➱ ❒ ➬➮ ❒ ➷ ➬❐ ➷ ➬✃ ➷ ➬➱ ➷ ➬➮ ➷  0  1  10 IL-1β (IU/ml)  100  1000  146  Figure. 5.5. Concentration-dependent effects of TGF-β1 on Runx2 mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Runx2 mRNA in EVTs cultured in the presence of vehicle alone (lane 1) or increasing concentrations of TGF-β1 (0.001, 0.01, 0.1, 1 or 10 ng/ml; lanes 2-6, respectively). A 100-bp ladder is shown in lane M with the size of the target cDNA indicated at the right.  Representative  photomicrographs of the resultant ethidium bromide-stained gels are presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 ng/ml control) in the graph. B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from corresponding EVTs cultures treated with vehicle alone (lane 1) or increasing concentrations of TGF-β1 (0.001, 0.01, 0.1, 1 or 10 ng/ml; lanes 2-6, respectively) and probed with rabbit polyclonal antibodies against RUNX2 or human βactin. The Amersham enhanced chemiluminescence (ECL) system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 were normalized to the absorbance values obtained for human β-actin (ACTIN) in the samples. The results derived from this analysis as well as those from three other studies were standardized to the untreated control and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to 0 ng/ml control).  147  Figure 5.5  A  M  1  2  3  4  5  6  161 bp (Runx2)  Relative Amount of Runx2 mRNA  378 bp (GAPDH) Ú ÕÖ Ú  *  Ô ÕÙ  *  Ô ÕØ Ô Õ× Ô ÕÖ Ô  0  B  1  0.001  2  0.01 0.1 TGF-β1 (ng/ml)  3  4  1  5  10  6 55kDa (RUNX2)  42kDa (ACTIN) á ÜÝ  Relative Amount of RUNX2 protein  á Û Üà  *  *  1  10  Û Üß Û ÜÞ Û ÜÝ Û  0  0.001  0.01 0.1 TGF-β1 (ng/ml)  148  Figure 5.6. Attenuation of IL-1β-mediated increase in Runx2 mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Runx2 mRNA levels in EVTs cultured with vehicle alone (lane 1), IL-1β alone (100 IU/ml; lane 2), IL-1β (100 IU/ml) plus 1 ug/ml of an anti-IL-1β antibody (lane 3) or IL-1β (100 IU/ml) plus 2 ug/ml of an anti-IL1β antibody (lane 4) for 24 h. A 100 bp ladder is shown in lane M with the size of the target cDNA indicated at the right. A representative photomicrograph of the resultant ethidium bromide-stained gels is presented. Gels generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are presented as (mean + S.E.M., n = 4) in the bar graph (a, P < 0.05 compared to untreated control; b, P < 0.05 compared to cytokine alone).  B)  Representative fluorogram of a Western blot containing 30 ug of total protein extracted from corresponding EVT cultures treated with cultured with vehicle alone (lane 1), IL-1β alone (100 IU/ml; lane 2), IL-1β (100 IU/ml) plus 1 ug/ml of an anti-IL-1β antibody (lane 3) or IL-1β (100 IU/ml) plus 2 ug/ml of an anti-IL-1β antibody (lane 4). The blots were probed for RUNX2 and human β-actin (ACTIN). The data are presented as (mean + S.E.M., n = 4) in the bar graph (a, P < 0.05 compared to untreated control; b, P < 0.05 compared to cytokine alone).  149  Figure 5.6  A M  1  2  3  4 161 bp (Runx2)  Relative Amount of Runx2 mRNA  b èã ç  378 bp (GAPDH)  a  èã æ èã å  b  èã ä  b  è âã ç âã æ âã å âã ä â  IL-1β (IU/ml)  0  100  100  100  Anti IL-1β (ug/ml)  0  0  1  2  2  3  4  B 1  55 kDa (RUNX2)  42 kDa (ACTIN)  ë  a  ïê î  Relative Amount of RUNX2 protein  ïê í ïê ì  b  ïê ë  b  ï éê î éê í éê ì éê ë é  IL-1β (IU/ml)  0  100  100  100  Anti IL-1β (ug/ml)  0  0  1  2  150  Figure 5.7. Attenuation of TGF-β1-mediated decreases in Runx2 mRNA and protein levels in EVTs. A) Semi-quantitative RT-PCR analysis of Runx2 mRNA levels in EVTs cultured with vehicle alone (lane 1), TGF-β1 alone (10 ng/ml; lane 2) or TGF-β1 (10 ng/ml) plus anti-TGF-β1 antibody (10 ug/ml; lane 3). A 100 bp ladder is shown in lane M with the size of the target cDNA indicated at the right.  A representative  photomicrograph of the resultant ethidium bromide-stained gels is presented.  Gels  generated from this and three other independent experiments were analysed by densitometry and subjected to statistical analysis. The data are presented in the bar graph as (mean + S.E.M., n = 4; a, P < 0.05 compared to untreated control; b, P < 0.05 compared to cytokine alone). B) Representative fluorogram of a Western blot containing 30 ug of total protein extracted from corresponding EVT cultures treated vehicle alone (lane 1), TGF-β1 alone (10 ng/ml; lane 2) or TGF-β1 (10 ng/ml) plus anti-TGF-β1 antibody (10 ug/ml; lane 3). The blots were probed for RUNX2 and human β-actin (ACTIN). The data are presented in the bar graph as (mean + S.E.M., n = 4; a, P < 0.05 compared to untreated control; b, P < 0.05 compared to cytokine alone).  151  Figure 5.7  A  M  1  2  3 161 bp (Runx2) b 378 bp (GAPDH)  Relative Amount of Runx2 mRNA  a  1.2  b  1  a 0.8 0.6 0.4 0.2 0  TGF-β1 (ng/ml)  0  5  5  Anti-TGF-β1 antibody (ug/ml)  0  0  10  B 55 kDa (RUNX2)  42 kDa (ACTIN)  1.2  b  Relative Amount of RUNX2 protein  1  a  0.8 0.6 0.4 0.2 0  TGF-β1 (ng/ml) Anti-TGF-β1 antibody (ug/ml)  0 0  5 0  5 10  152  Figure 5.8. Effects of Runx2 siRNA on Runx2 mRNA and protein levels in HTR8/SVneo cell cultures. A) Real-time RT-PCR analysis of Runx2 mRNA levels in cells transfected with a scrambled control siRNA (lane 1) or siRNA specific for Runx2 (lane 2) for 36 h. Values for Runx2 mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA). B) Representative fluorogram of a Western blot containing 30 µg of total protein extracted from HTR8/SVneo cells cultured with a scrambled control siRNA (lane 1) or siRNA specific for Runx2 (lane 2) for 36 h and probed with rabbit polyclonal antibodies against RUNX2 or human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for RUNX2 protein levels were normalized to the absorbance values obtained for β-actin (ACTIN) in the samples. The results derived from this analysis and from three other studies were standardized to the scrambled control siRNA and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA).  153  Figure 5.8  A Relative Amount of Runx2 mRNA  1. 2  1  *  0. 8  0. 6  0. 4  0. 2  0  Control siRNA (1)  Runx2 siRNA (2)  B 55 kDa (RUNX2)  42 kDa (ACTIN)  1.2  Relative Amount of RUNX2 protein  1  0.8  * 0.6  0.4  0.2  0  Control siRNA (1)  Runx2 siRNA (2)  154  Figure 5.9. Effects of Runx2 siRNA on N-cad mRNA and protein levels in HTR8/SVneo cell cultures. A) Real-time RT-PCR analysis of N-cad mRNA levels transfected with a scrambled control siRNA (lane 1) or siRNA specific for Runx2 (lane 2) for 36 h. Values for N-cad mRNA levels in each sample were normalized to the corresponding GAPDH mRNA levels. The data are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA). B) Representative fluorogram of Western blot containing 30 µg of total protein extracted from HTR-8/SVneo cells cultured with a scrambled control siRNA (lane 1) or siRNA specific for Runx2 (lane 2) for 36 h and probed with mouse monoclonal antibody against N-CAD or rabbit polyclonal antibody against human β-actin. The Amersham ECL system was used to detect antibody bound to antigen. The resultant fluorograms were scanned and the absorbance values obtained for N-CAD protein levels were normalized to the absorbance values obtained for human β-actin (ACTIN) in the samples. The results derived from this analysis and from three other studies were standardized to the scrambled control siRNA and are represented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05 compared to scrambled control siRNA).  155  Figure 5.9  Relative Amount of N-cad mRNA  A 1. 2  1  *  0. 8  0. 6  0. 4  0. 2  0  Control siRNA (1)  Runx2 siRNA (2)  B  140 kDa (N-CAD)  42 kDa (ACTIN)  1.2  Relative Amount of N-CAD protein  1 0.8  *  0.6 0.4  0.2 0  Control siRNA (1)  Runx2 siRNA (2)  156  Figure 5.10. Reduced Runx2 levels decrease the invasive capacity of HTR-8/SVneo cells. HTR-8/SVneo cells were transfected with a scrambled control siRNA (lane 1) or siRNA specific for Runx2 (lane 2) for 24 h. The cells were then placed in the upper wells of Transwell invasion chambers. After a further 24 h of incubation, the porous membranes from the bottom of the Transwells were removed and fixed, stained and mounted upsidedown on a glass microscope slide. Invasion was determined by counting the number of cells that invaded through the thin pre-coated layer of Matrigel on the top of the porous (8 µm) membrane. Cells were visualized using a light microscope, and counted in three randomly selected fields of each membrane. Each cell line was plated in triplicate wells, and the experiment was repeated on three independent occasions. The results are presented (mean + S.E.M., n = 4) in the bar graph (*, P < 0.05, compared to HTR8/SVneo scrambled control siRNA).  157  Figure 5.10  1.2  Invasion Index  1 0.8  0.6 0.4  *  0.2 0  Control siRNA (1)  Runx2 siRNA (2)  158  5.3: Discussion and summary  Runx2 expression has been mostly characterized in bone tissue (Otto et al., 1997), but it has also been found to be highly expressed in several other tissue types, including the testes (Ogawa et al., 2000), mammary epithelium (Inman and Shore, 2003), endothelial cells (Sun et al., 2001), and in prostate and breast tumours (Yeung et al., 2002; Barnes et al., 2003). In this study I have examined the expression of Runx2 in first-trimester human placenta tissue and in four human trophoblastic cell types:  highly invasive  primary EVTs, the immortalized EVT cell line HTR-8 cells/SVneo, and the poorly invasive JEG-3 and BeWo choriocarcinoma cell lines. Runx2 was expressed in placental tissue, and the high levels of Runx2 expression in highly invasive EVT cells suggest that Runx2 plays a role in trophoblast invasion. Furthermore, the two choriocarcinoma cell lines, which are considered much less invasive, display significantly lower Runx2 expression. It is known that IL-1β promotes human trophoblast invasion (Karmakar and Das, 2002) and in my studies it increased the expression of Runx2 in EVTs. It has also been shown that IL-1β increases the invasiveness of trophoblast cells, at least in part through the up-regulation of MMP-2 and MMP-9 (Karmakar and Das, 2002), which are key molecules in human trophoblast invasion (Staun-Ram et al., 2004). While my results showed that IL-1β induces the expression of Runx2, I also demonstrated that TGF-β1 suppresses Runx2 expression in EVTs and this is important because TGF-β1 reduces the invasiveness of trophoblasts (Graham and Lala, 1991). TGF-β1 has been previously shown to decrease the functional activity of Runx2 by promoting an interaction between  159  SMAD3 and the Runx2 proteins in osteoblast cells (Alliston et al., 2001). RUNX2 forms co-regulatory complexes with Smads and other co-activator and co-repressor proteins that are organized in subnuclear domains to regulate gene transcription. In addition, Runx2 can also mediate the responses of cells to hyperactive signalling pathways in tumours in response to TGF-β and other growth factor signals. These observations strongly suggest that RUNX2 is a key molecule in regulating human trophoblastic cell invasion (Pratap et al., 2006). A siRNA knockdown of Runx2 in metastatic breast cancer cell lines reduced their invasive properties. In contrast, forced expression of Runx2 in non-metastatic breast cancer lines induced a three-fold increase in cellular invasion (Pratap et al., 2005). In my loss-of-function study, I was able to demonstrate that a decrease in Runx2 expression is concomitant with a reduction in human trophoblast invasion. Studies by Pratap et al. (2005) have provided experimental evidence that Runx2 can regulate the expression of MMP-9 and cellular invasion in breast cancer cell lines. They have demonstrated through chromatin immunoprecipitation that RUNX2 is recruited to the MMP-9 promoter. In other studies, Hazan et al. (2000) demonstrated that increased MMP-9 production in N-cad–expressing breast cancer cells occurred in response to fibroblast growth factor-2 and that this provided the cells with a greater ability to penetrate matrix protein barriers. In my previous studies, I have demonstrated that N-CAD is a significant player in a molecular mechanism underlying the invasive capacity of EVTs in vitro. In addition, it has been previosuly reported that N-cad is a potential target of RUNX2 in embryonic bone tissue (Chua et al., 2009). In this study, I have identified a role for Runx2 in  160  regulating N-cad in human trophoblastic cells. In support of this, when HTR-8/SVneo cells were transfected with siRNA against Runx2, N-cad expression was significantly reduced along with a reduction in the invasive ability of the cells. In summary, my results provide evidence that RUNX2 is a key molecule in mediating human trophoblast invasion through regulating N-cad (Figure 5.11). However, further studies will be necessary to address the molecular interaction between RUNX2 and Ncad.  161  Extravillous pathway (invasion) (Runx2  N-cad  Invasion)  Runx2  N-cad  Invasion  Figure 5.11. A schematic diagram of a proposed role of Runx2 in regulating N-cadmediated differentiation of human trophoblastic cells. Silencing Runx2 expressing by siRNA stategy reduces N-cad expression level and reduces the invasion ability of human trophoblastic cells.  162  CHAPTER 6: GENERAL DISCUSSION  6.1: Discussion  In my studies, I have investigated the roles of the transcription factors TWIST and RUNX2, and the cell adhesion molecules E-CAD and N-CAD, in the villous (noninvasive) and extravillous (invasive) pathways in human trophoblastic cells. When studying the terminal differentiation of human cytotrophoblasts in vitro, I used both primary cultures of human trophoblasts and human trophoblastic cell lines. There are both advantages and disadvantages when using these cell cultures. The advantage of using primary cell cultures is their close biological and morphological proximity to the human placenta. However, there is a number of limitations to these primary cell cultures. Due to limited access to term placental tissues, I switched to using the BeWo trophoblastic cell line in order to study the cellular and molecular mechanisms in the villous pathway. As previously mentioned, BeWo cells have been widely used to study syncytialization in human trophoblasts in the presence of 8-bromo cAMP (Seamon et al., 1981; Wice et al., 1990). Furthermore, the advantages of using a cell line include their immortal and consistent characteristics, cell purity, and commercial availability. To investigate the extravillous pathway, I used primary EVTs for regulatory studies with cytokines such as TGF-β1 and IL-1β, because HTR-8/SVneo cells do not respond to TGF-β1 treatment in my experiments and as reported by another group (Graham et al., 1993). As for the functional studies, I chose to use HTR-8/SVneo cells because these cells are easier to transfect and their characteristics are more uniform, as mentioned earlier.  163  My studies have provided a greater understanding of the cellular and molecular mechanisms that mediate the formation and organization of the human placenta, and demonstrate that Twist can regulate and promote cellular fusion (Figure 6.1). In addition, my studies have suggested a role for Twist, Runx2 and N-cad in regulating EVT invasion (Figure 6.2). In the first part of my studies, I examined the expression of Twist and E-cad during the terminal differentiation and fusion of BeWo cells, a human trophoblastic cell line. I observed Twist was up-regulated and E-cad was down-regulated during the differentiation and fusion processes in human trophoblastic cells. In gain- or loss-offunction studies, I have shown that increasing Twist expression promotes terminal differentiation and fusion of human trophoblastic cells through down-regulation of E-cad expression. In the second part of my studies, I investigated whether Twist and N-cad may play important roles in human trophoblast cell invasion. I first examined the expression of Twist and N-cad in highly invasive EVTs and the poorly invasive JEG-3 and BeWo human trophoblastic cell lines. My results have revealed that Twist and N-cad are highly expressed in highly invasive EVTs but the expression of both is significantly lower in the poorly invasive human trophoblastic cell lines. Next, I determined the regulatory effects of IL-1β and TGF-β1, two cytokines known to control trophoblast invasion (Graham and Lala, 1991; Karmakar and Das, 2002), on primary cultures of EVTs. I found a differential regulation of Twist expression. Twist expression increases after IL-1β treatment in a time- and concentration-dependent manner.  164  Villous pathway (fusion) cAMP  cAMP  TWIST  TWIST  Twist  E-cad  E-cad  fusion  Twist  E-cad  E-cad  fusion  TWIST  Twist  E-cad  E-cad  fusion  Multinucleated Syncytial Multinucleated Syncytial Mononucleate trophoblast trophoblast cytotrophoblasts (cAMP-induced fusion) (Loss-of-function study) (Gain-of-function study) (a) (b) (c)  Figure 6.1. A schematic diagram of a proposed role of Twist in regulating terminal differentiation and fusion of human trophoblastic cells. (a) cAMP up-regulates TWIST levels and down-regulates E-cad expression to promote the formation of syncytial trophoblast. (b) Silencing Twist expression inhibited TWIST levels from up-regulated and E-cad expression from down-regulated in cAMP-induced BeWo cells. These cells remain as mononucleate cytotrophoblasts. (c) Stable transfection with Twist expression vectors in BeWo cells reduces E-cad expression and promotes the formation of syncytial trophoblast.  165  Extravillous pathway (invasion) TGF-β β1  Twist  Runx2  N-cad  Invasion  IL-1β β  Runx2  Twist  N-cad  Invasion  Figure 6.2. A schematic diagram of the proposed roles of Twist, Runx2 and N-cad in regulating the invasive ability of human trophoblastic cells. TGF-β1 down-regulates Twist and Runx2 expression and reduces the invasion ability of EVTs. IL-1β upregulates Twist and Runx2 expression and increases the invasion ability of EVTs. Silencing Twist or Runx2 expression reduces N-cad expression and reduces the invasion ability of HTR-8/SVneo cells. Silencing N-cad expression reduces the invasion ability of HTR-8/SVneo cells.  166  In contrast, Twist expression with TGF-β1 treatment decreases in a time and concentration-dependent manner. However, IL-1β and TGF-β1 have no effects upon Ncad expression, suggesting that other growth factors may be involved in regulating N-cad expression in human EVTs. I continued to determine a role for Twist in human trophoblast invasion by performing a gain-of-function study using JEG-3 cell line. Although Twist mRNA level increased, the protein level remains unchanged. Therefore, I could not determine a role for Twist in trophoblast invasion in these cell models. I then took an opposite approach by using a loss-of-function study to silence Twist expression.  This demonstrated that down-regulation of Twist reduced the invasive  capacity of the EVT cell line and the expression of N-cad, suggesting that Twist promotes trophoblast invasion via N-cad. Next, I performed a loss-of-function study by utilizing a siRNA strategy to silence Ncad expression to investigate a role for this CAM in human trophoblastic cell invasion. My results show that by silencing N-cad expression the trophoblastic cells became significantly less invasive. I continued to determine a functional role for N-CAD in these trophoblastic cells by using a function-perturbing antibody against the extracellular binding domain of N-CAD.  This antibody effected a significant reduction in  trophoblastic cell invasion, thus confirming a functional role of N-CAD in human trophoblastic cells in vitro. I continued to investigate whether Runx2 plays important roles in human trophoblast cell invasion. First, I demonstrated that Runx2 is highly expressed in highly invasive EVTs, but it is present at significantly lower levels in poorly invasive JEG-3 and BeWo  167  trophoblastic cell lines. Next, I investigated whether IL-1β and TGF-β1 were able to respectively promote and repress Runx2 mRNA and protein levels in EVTs. I found that IL-1β significantly increases Runx2 expression, while TGF-β1 significantly reduces Runx2 expression. Taken together, these observations support my hypothesis that Runx2 plays an important role in human trophoblast invasion. In my loss-of-function study, silencing Runx2 expression results in significant reduction on N-cad expression and reduces the invasive ability of HTR-8/SVneo cell. Membrane fusion plays a critical role in development. For example, it mediates the fertilization of the egg and sperm (Wilson and Snell, 1998), and the formation of myotubes from the mononucleate myoblasts in the embryo (Nadal-Ginard, 1987). In addition, during human placentation, it mediates the formation of the syncytial trophoblast from the mononucleate cytotrophoblasts (Kliman et al., 1986). Cell fusion not only brings about morphological changes in these trophoblastic cells, but also influences the physiology of the cells. For instance, the formation of the syncytial trophoblast plays a critical role in the onset of placental hormone production (Hoshina et al., 1982; Cronier et al., 1994). Fox (1964) demonstrated a decrease in the thickness of the syncytial trophoblast layer and an increase in the number of villous cytotrophoblasts in human placental specimens from pregnancies complicated by intrauterine hypoxia. A reduction in the formation of syncytial trophoblast structures in cultures of villous cytotrophoblasts isolated from the term placenta was observed in patients suffering from preeclampsia, a condition in pregnancy characterized by a sharp rise in blood pressure together with large amounts of protein in the urine (Pijnenborg et al., 1996).  168  It has been well documented that cell differentiation and morphogenesis depend partly on the regulated expression of cell adhesion molecules. The commonly known cell adhesion molecules that play a role in terminal differentiation and fusion of human cytotrophoblasts include CAD-11 (MacCalman et al., 1997) and E-CAD (Coutifaris et al., 1991). High levels of E-CAD were immunolocalized to the surface of BeWo cells before they undergo terminal differentiation and fusion, and E-CAD is needed for the cells to undergo cell aggregation prior to cell fusion (Coutifaris et al., 1991). Downregulation of E-cad expression has been shown to be necessary to promote the formation of syncytial trophoblast (Coutifaris et al., 1991; Getsios et al., 2003). In a similar manner, E-cad expression was also down-regulated during the formation of multinucleated osteoclasts from bone marrow mononucleate cells in mice (Suda et al., 1992). Several studies have identified the ability of growth factors to regulate the terminal differentiation and fusion of villous cytotrophoblasts. One example would be epidermal growth factor (EGF) that is produced by both decidual cells and trophoblastic cells at the maternal-fetal interface (Hofmann et al., 1992; Morrish et al., 1998; Leach et al., 1999). Blocking EGF receptor function using an anti-EGF-receptor monoclonal antibody increases E-cad expression in primary cultures of human trophoblastic cells (RebutBonneton et al., 1993; Al Moustafa et al., 1999). This suggests that EGF can downregulate E-cad expression in human trophoblastic cells. EGF treatment of A431 cells, an epidermoid cancer cell line, has been shown to increase cAMP accumulation induced by forskolin (Ball et al., 1990). In addition, cAMP analog has shown to increase MAPK-1/3  169  and cAMP response element-binding protein (CREB) phosphorylation in BeWo cells (Maymo et al., 2010). TWIST, a helix-loop-helix transcription factor that has long been implicated in embryonic morphogenesis, also promotes epithelial-mesenchymal transition (EMT) through the down-regulation of E-cad in a wide range of cancer cells (Yang et al., 2004, Kwok et al., 2005, Yuen et al., 2007). Yang et al. (2004) demonstrated that Twist transcriptionally represses E-cad in human breast cancer cells through direct interaction with an E-Box present in the promoter region of E-cad. As mentioned before, I did not determine the actual mechanism by which up-regulated Twist expression effects downregulated E-cad expression in these trophoblastic cells. However, it is possible that TWIST represses E-cad through direct contact with the E-box present in the promoter region of E-cad during the terminal differentiation and fusion of human villous cytotrophoblasts in vitro. In order to examine whether the repression of E-cad by TWIST in my studies is determined by the E-box located within the promoter region, luciferase reporter gene assays will have to be carried out to assess the transcription efficiency of the E-cad promoter with an E-box mutation. My studies are the first to investigate a role for the Twist gene in terminal differentiation of human cytotrophoblasts in vitro. Collectively, the observations from my studies suggest that Twist and E-cad, which mediate EMT processes in cancer cells, can also influence the terminal differentiation and fusion of human trophoblasts. Additional studies will be needed to identify the underlying mechanisms that increase Twist expression in the human trophoblast differentiation.  170  Increased expression of N-cad promotes the motility and invasion of carcinoma cells (Nienam et al., 1999; Cavallaro et al., 2002; Hazan et al., 2000). Studies have suggested that N-cad-expression in cancer cells may promote homophilic interactions with N-cad expressing tissues such as endothelia and stroma (Hazan et al., 2000). For example, NCAD mediates the transmigration of melanomas through the vascular endothelium (Sandig et al., 1997). Although it is tempting to speculate that N-cad expression in EVTs may facilitate adhesion with the endometrial stroma or the maternal endovascular cells to facilitate the remodelling of the endothelial lining, my single cell model could not confirm this. Besides facilitating homophilic cell adhesion between cancer cells and normal cells, N-cad is also believed to promote cell invasion through cell signalling events (Hazan et al., 2004). It has been reported that in breast cancer cell invasion, there is an interaction between N-CAD and fibroblast growth factor receptor 1 (FGFR1) at the cell surfaces to form an extracellular complex. This complex is formed by the interaction between the extracellular domain of N-CAD and immunoglobulin domains 1 and 2 of FGFR-1, which eventually stabilizes FGFR-1 and leads to prolonged mitogen-activated protein kinase (MAPK) activation (Kim et al., 2000; Suyama et al., 2002). Hazan et al. (2004) proposed that while N-cad promotes homophilic cell-adhesive mechanisms, E-cad controls tumour progression. Previous studies have reported that down-regulation of E-cad is necessary for cancer cells to become invasive (Onder et al., 2008). However, preliminary data from our laboratory (Alex Beristain, unpublished data) show that the exogenous expression of N-cad in JEG-3 cells leads to increased invasion without altering the expression of E-cad. Similarly, Nieman et al. (1999) have reported  171  that N-cad plays a dominant role over the high expression of E-cad in promoting breast cancer cell invasion. In contrast, exogenous expression of E-cad resulted in decreased invasiveness and reduction of N-cad expression in tumour cells expressing endogenous N-cad (Yanagisawa and Anastasiadis, 2006).  Indeed, the molecular mechanisms in  which N-cad and E-cad regulate invasion remain unclear, probably due to the differences in cell types. TWIST is able to increase N-cad expression in a variety of cancer cells (Alexander et al., 2002; Rosivatz et al., 2002). Although the precise mechanism by which Twist regulates N-cad in human trophoblastic cells is unknown, others have found that the effect of TWIST on the induction of N-cad mRNA requires an E-box located within the first intron of the N-cad gene (Alexandra et al., 2006). RUNX2 is a scaffolding transcription factor, which has been well documented to play a role in osteoblast differentiation (Otto et al., 1997). Runx2-null mutations in mice result in severe bone deficiency as well as hypothyroidism, a disease caused by insufficient production of thyroid hormones (Harada and Roden, 2003; Endo and Kobayashi, 2010). Runx2 is phosphorylated and can be activated by the MAPK pathway (Xiao et al., 2000). Runx2 is known to play key roles in angiogenesis (Zelzer et al., 2001), and vascular invasion of bone and is highly expressed in endothelial cells (Mundlos, 1999; Enomoto et al., 2000). Runx2 has been termed an oncogene and it is highly expressed in different types of cancer cells, including breast and prostate cancer cells (Barnes et al., 2004; Javed et al., 2005, Pratap et al., 2006b). These studies have provided additional support that Runx2 play an important role in regulating human trophoblast invasion. My results are also the first to show a regulatory linkage between  172  Runx2 and N-cad. However, further studies will be necessary to identify the molecular mechanisms on how Runx2 regulates N-cad expression. Transforming growth factor-β1 (TGF-β1) is a secreted protein that controls cell growth, cell proliferation, cell differentiation and apoptosis (Ghadami et al., 2000; Vaughn et al., 2000). TGF-β1 has been assigned major regulatory roles in placental development and in decidualization of the endometrial stroma (Godkin and Dore, 1998; Karmakar and Das, 2002). This growth factor binds to a type II receptor dimer, which recruits and phosphorylates a type I receptor dimer to form a hetero-tetrameric complex (Wrana et al., 1992). The type I receptor then phosphorylates receptor-regulated SMADs (R-SMADs) to form R-SMAD/coSMAD (e.g. SMAD4) complexes in the nucleus to regulate targeted gene expression (Souchelnytskyi et al., 2001; Feng and Derynck, 2005). TGF-β is able to differentially regulate Twist expression in a variety of cell types (Leu et al., 2008; Mori et al., 2009; Murakami et al., 2010) and to decrease RUNX2 binding to DNA (Komori, 2006). Interleukin-1β (IL-1β) is a pro-inflammatory cytokine that plays a key regulatory role in the establishment of pregnancy (Salamonsen et al., 2000, 2003; Fazleabas et al., 2004). IL-1β can bind to type 1 IL-1 receptor protein, IL-1 binding activates IL-1 receptor associated kinase-1 and -2 (IRAK-1 and -2),  IRAK-1 then recruits TNF receptor  associated factor 6 (TRAF6) to the IL-1 receptor complex and activates two pathways, one leading to the map-erk kinase (MEK)/ c-Jun N-terminal kinases (JNK) signalling system and the other leading to nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) activation (Muzio et al., 1997; Allan and Rothwell, 2001; Wang et al., 2001). Several NF-kB targets include Twist, snail1, zeb1 (Min et al., 2008).  173  6.2: Summary and Conclusions  My studies are the first to find that Twist is up-regulated and E-cad is down-regulated during the terminal differentiation and fusion of human trophoblastic cells. By using gain- and loss-of-function studies, I was able to demonstrate that Twist is a key regulator of E-cad in these trophoblastic cells. My results also show that Twist regulates cadherinmediated morphological and functional differentiation of human trophoblastic cells. The second part of my thesis describes studies that identify a role for Twist in extravillous cytotrophoblasts.  These demonstrated that Twist promotes human  trophoblastic cell invasion through down-regulating N-cad expression. In a loss-offunction study in which N-cad expression was silenced, there was a significant reduction of trophoblastic cell invasion. Finally, I was able to demonstrate that Runx2, which is known to regulate cancer invasion, also regulates human trophoblastic cell invasion. In addition, silencing Runx2 expression caused a significant down-regulation of N-cad expression. Although the molecular mechanisms involved in the terminal differentiation of human trophoblast are rather complex, my findings help in furthering the understanding of many diseases that are linked to human placentation.  174  6.3: Future directions  A successful human pregnancy depends upon mononucleate cytotrophoblasts entering one of two distinct and mutually exclusive pathways. Villous cytotrophoblastic cells proliferate and differentiate by fusion to form the outer syncytial trophoblast, or enter the extravillous pathway to form highly invasive extravillous cytotrophoblasts. However, the molecular mechanisms involved in determining which pathway the mononucleate cytotrophoblasts will enter remain to be elucidated. Studies have shown that the interaction between TWIST and RUNX2 involves unique domains in these proteins, the twist box and the RUNX2 DNA binding domain (Lian et al., 2004), and it will be necessary to determine if the fate of mononucleate cytotrophoblast is differentially or coordinately regulated by Twist and Runx2 expression.  6.3.1: Investigate the regulation and function of Runx2 in human trophoblast cell fusion  First, it will be necessary to examine Runx2 mRNA and protein expression levels in BeWo choriocarcinoma cells undergoing terminal differentiation and fusion in response to the secondary intracellular signalling molecule 8-bromo-cAMP, by using semi-quantitative RT-PCR and Western blotting, respectively.  Subsequently, gain- or loss-of-function  studies could be carried out using these cells and either a mammalian expression vector containing a cDNA encoding Runx2 or siRNA specific for this transcription factor, respectively. In addition to examining subsequent Runx2 and E-cad mRNA and protein expression levels in these cell cultures, the presence or absence of multinucleated syncytia 175  will be confirmed by indirect immunofluoresence using antibodies directed against RUNX2,  E-CAD  or  DESMOPLAKIN,  a  cellular  marker  of  mononucleate  cytotrophoblasts.  6.3.2: Investigate whether the inter-related expression of Runx2 and Twist determines the differentiation pathway of mononucleate cytotrophoblasts  My preliminary findings demonstrate that Twist expression levels correlate with Runx2 expression levels in human trophoblastic cell invasion. Further investigation is needed into the regulatory effects between Twist and Runx2 in the formation of the multinucleated syncytial trophoblast of the human placenta.  The co-coordinated or  differentially regulated expression of Twist and Runx2 in human trophoblastic cells could be the determining factor for whether the mononucleate cytotrophoblasts enter either the villous or invasive pathway. In future studies, I would investigate the relationship(s) between Runx2 and Twist in terminal differentiation of human trophoblastic cells, either by transfecting a siRNA for Runx2 or Twist into BeWo cells that can undergo terminal differentiation and fusion in response to the secondary intracellular signalling molecule 8-bromo-cAMP.  Semi-  quantitative RT-PCR and Western blotting can be used to examine Runx2 and Twist mRNA and protein levels in these trophoblastic cells.  176  6.3.3: Immunolocalization of TWIST and RUNX2 at the human maternal-fetal interface during pregnancy  If TWIST and RUNX2 in fact play critical role in formation, maintenance, and/or function of the maternal-fetal interfacen then it would be important to be confirm that these proteins are indeed localized here during one or more stages of pregnancy. Tissue sections will be prepared from archived permanent paraffin blocks containing maternalfetal tissues (n=3) obtained during the first trimester of pregnancy. These tissue sections will be immunostained using a commercially available polyclonal antibody directed against human TWIST or RUNX2.  A nonspecific isotype-matched antibody would  served as an appropriate negative control for these experiments.  177  BIBLIOGRAPHY  Adam JC, Watt FM (1993) Regulation of development and differentiation by the extracellular matrix. Development 117:1183-1198. Adamsom SL, Lu Y, Whiteley KJ, Holmyard D, Hemberger M, Pfarrer C, Cross JC (2002) Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev Biol 250:358-373. Al-Aynati M, Radulovich MN, Riddell RH, Tsao MS (2004) Epithelial-cadherin and beta-catenin expression changes in pancreatic intraepithelial neoplasis. Clin Cancer Res 10:1235-1240. Alberts B, Bray D, Lewis J, Raff M, Roberts K, Watson J (1994) Mol Biol of the Cell New York: Garland Publishing Inc. Alexander NR, Tran NL, Rekapally H, Summers CE, Glackin C, Heimark RL (2006) N-cad gene expression in prostate carcinoma is modulated by integrin-dependent nuclear translocation of Twist1. Cancer Res 66:3365-3369. Alfano D, Franco P, Vocca I, Gambi N, Pisa V, Mancini A, Caputi M, Carriero M, Iaccarino I, Stoppelli M (2005) The urokinase plasminogen activator and its receptor: role in cell growth and apoptosis. Thromb Haemost 93:205-211. Allan S, Rothwell N (2001) Cytokines and acute neurodegeneration. Nature Rev Neuroscience 2:734-744 Alliston T, Choy L, Ducy P, Karensty G, Derynck R (2001) TGF-β-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO J 20:2254-2272. Andreasen PA, Egelund R, Magee Petersen HH (2000) The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci 57:25-40. Andreasen PA, Georg B, Lund L, Riccio A, Stacey S (1990) Plasminogen activator inhibitors: hormonally regulated serpins. Mol Cell Endocrinol 68:123-128. Angst BI, Marcozzi C, Magee AI (2001) The cadherin superfamily: diversity in form and function. J Cell Sci 114:629-641. Aplin JD (2000) Maternal influences on placental development. Stem Cell Dev Biol 11:115-125.  178  Aplin JD, Haigh T, Jones CJP, Church HJ, Vicovac L (1999) Development of cytotrophoblast columbs from explanted first trimester human placental villi: role of fibronectin and integrin α5β1. Biol Reprod 60:828-838. Aplin JD (1994) Expression of integrin alpha-6-beta-4 in human trophoblast and its loss from extravillous cells. Placenta 14:203-215. Aplin JD (1991) Implantation, trophoblast differentiation and haemochorial placentation: mechanistic evidence in vivo and in vitro. J Cell Sci 99:681-692. Arturi F, Lacroix L, Presta I, Scarpelli D, Caillou B, Schlumberger M, Russo D, Bidart J-M, Filetti S (2002) Regulation by human chorionic gonadotropin of sodium/iodide symporter gene expression in the Jar human choriocarcinoma cell line. Endocrinol 143:2216-2220. Aufderheide E, Ekblom P (1988) Tenascin during gut development: appearance in the mesenchyme, shift in molecular forms and dependence on the epithelial-mesenchymal interactions. J Cell Biol 107:2341-2349. Bae SC, Lee YH (2006) Phosphorylation, acetylation and ubiquitination: The molecular basis of RUNX regulation. Gene 366:58-66. Ball RL, Tanner KD, Carpenter G (1990) Epidermal growth factor potentiates cyclic AMP accumulation in A-431. J Biol Chem 265:12836-128456. Bamberger A-M, Sudahl S, Loning T, Wagener C, Bamberger CM, Drakakis P, Coutifaris C, Makrigiannakis A (2000) The adhesion molecule CEACAM1 (CD66a, CCAM, BGP) is specifically expressed by the extravillous intermediate trophoblast. Am J Pathol 156:1165-1170. Barnes GL, Hebert KE, Kamal M, Javed A, Einhorn TA, Lian JB, Stein GS, Gerstenfeld LC (2004) Fidelity of Runx2 activity in breast cancer cells is required for the generation of metastases associated osteolytic disease. Cancer Res 64:4506-4513. Barnes GL, Javed A, Waller SM, Kamal MH, Hebert KE, Hassan MQ, Bellahcene A, van Wijnen AJ, Young MF, Lian JB, Stein GS, Gerstenfeld LC (2003) Osteoblastrelated transcription factors Runx2 (Cbfa1/AML3) and MSX2 mediate the expression of bone sialoprotein in human metastatic breast cancer cells. Cancer Res 63:2631-2637. Baudry D, Cabanis MO, Patte C, Zucker JM, Pein F, Fournet JC, Sarnacki S, Junien C, Jeanpierre C (2003) Cadherin in Wilms’ tumor: E-cadherin expression despite absence of WT1. Anticancer Res 23:475-478. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H (1990) The protein Id: A negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49-59.  179  Benirschke K, Kaufmann P (2000) Pathology of the human placenta 4th edition. Springer Verlag, New York. Bentin-Ley U, Horn T, Sjogren A, Sorensen S, Falck Larceny J, Hamberger L (2000) Ultrastructure of human blastocyst-endometrial interactions in vitro. J Reprod Fertil 120:337-350. Berx G, Cleton-Jansen AM, Strumane K, de Leeuw WJ, Nollet F, van Roy F, Cornelisse C (1996) E-cadherin is inactivated in a majority of invasive human lobular breast cancers by truncation mutations throughout its extracellular domain. Oncogene 13:1919-1925. Bhowmick NA, Zent R, Ghiassi M, McDonnell M, Moses HL (2001) Integrin beta 1 signaling is necessary for transforming growth factor-beta activation of p38MAPK and epithelial plasticity. J Biol Chem 276: 46707-46713. Bialek P, Kern B, Yang X, Schrock M, Sosic D, Hong N, Wu Hua, Yu Kai, Ornitz DM, Olson EN, Justice MJ, Karsenty G (2004) A twist code determines the onset of osteoblast differentiation. Dev Cell 6:423-435. Birchmeier W, Behrens J (1994) Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1198:11-26. Bischof P, Irminger-Finger I (2005) The human cytotrophoblast cell, a mononuclear chameleon. Int J Biochem Cell Biol 37:1-16. Bischof P, Meisser A, Campana A (2001) Biochemistry and molecular biology of trophoblast invasion. Ann N Y Acad Sci 943:157-162. Bischof P, Campana A (2000) A putative role for oncogenes in trophoblast invasion? Human Reprod 15:51-58. Bischof P, Campana A (2000) Molecular mediators of implantation. Bailliere’s Clin Obstet and Gynaecol 14:801-814. Bischof P, Maelli M, Campana A (1995) Importance of matrix metaloproteinases (MMP) in human trophoblast invasion. Early Pregnancy 1:263-269. Blanco MJ, Moreno-Bueno G, Sarrio D, Locascio A Cano A, Palacios J, Nieto MA (2002) Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21:3241-3246. Blankenship TN, Enders AC (2003) Modification of uterine vasculature during pregnancy in macaques. Microsc Res Tech 60:390-401.  180  Blaschuk OW, Sullivan R, David S, Pouliot Y (1990) Identification of a cadherin cell adhesion recognition sequence. Dev Biol 139:227-229. Blechschmidt K, Mylonas I, Mayr D, Schiessl B, Schulze S, Becker KF, Jeschke U (2007) Expression of E-cadherin and its repressor snail in placental tissue of normal, preeclamptic and HELLP pregnancies. Virchows Arch 450:195-202. Blyth K, Cameron ER, Neil JC (2005) The runx genes: Gain and loss of function in cancer. Nature Reviews Cancer 5:376-387. Boggon TJ, Murray J, Chappuis-Flament S, Wong E, Gumbiner BM, Shapiro L (2002) C-cadherin ectodomain structure and implications for cell adhesion mechanism. Science 296:1308-1313. Bolos V, Peinado H, Perez-Moreno MA, Fraga MF, Esteller M, Cano A (2003) The transcription factor Slug represses E-cadherin expression and induces ephitelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci 116:499-511. Bourgeois P, Bolcato-Bellemin AL, Danse JM, Bloch-Zupan A, Yoshiba K, Stoetzel C, Perrin-Schmitt F (1998) The variable expressivity and incomplete penetrance of the twist-null heterozygous mouse phenotype resemble those of human saethre-chotzen syndrome. Hum Mol Genet 7:945-957. Bourgeois P, Stoetzel C, Bolcato-Bellemin AL, Mattei MG, Perrin-Schmitt F (1996) The human H-Twist gene is located at 7p21 and encodes a B-HLH protein that is 96% similar to its murine M-twist counterpart. Mamm Genome 7:915-917. Boyd JD, Hamilton WJ (1970) The human placenta. Cambridge: W. Heffer and Sons Ltd. Brabant G, Hoang-Vu C, Cetin Y, Dralle H, Scheumann G, Molne J, Jansson S, Ericson LE, Nilsson M (1993) E-cadherin: a differentiation marker in thyroid malignancies. Cancer Res 53:4987-4993. Bremnes RM, Veve R, Gabrielson E, Hirsch FR, Baron A, Bemis L, Gemmill RM, Drabkin HA, Franklin WA (2000) High throughput tissue microarray analysis used to evaluate biology and prognostic significance of the E-cadherin pathway in non-small-cell lung cancer. J Clin Oncol 20:2417-28. Brenner CA, Adler RR, Rappolee DA (1989) Genes for extracellular matrix-degrading metalloproteinases and their inhibitor, TIMP, are expressed during early mammalian development. Genes Dev 3:848-859. Brosens I, Robertson W, Dixon H (1967) The physiological response to vessels of the placental bed to normal pregnancy. J Pathol Bacteriol 93:569-579.  181  Brown PD, Bloxidge RE, Stuart NSA (1993) Association between expression of activated 72-kilodalton gelatinase and tumour spread in non-small cell lung cancer. J Natl Cancer Inst 85:574-578. Buck CA (1992) Immunoglobulin superfamily: structure, function, and relationship to other receptor molecules. Semin Cell Biol 3:179-188. Bullen EC, Longaker MT, Updike DL (1995) Tissue inhibitor of metalloproteinases-1 is decreased and activated gelatinases are increased in choronic wounds. J Invest Dermatol 104:236-240. Burnside J, Nageeelberg SB, Lippman SS, Weintraub BD (1985) Differential regulation of hCG α and β subunit mRNAs in JEG-3 choriocarcinoma cells by 8-bromocAMP. J Biol Chem 260:12705-12709. Burrows TD, King A, Loke YW (1996) Trophoblast migration during human placental implantation. Hum Reprod Update 2:307-321. Burrows TD, King A, Loke YW (1994) Expression of adhesion molecules by endovascular trophoblast and decidual endothelial cells: implications for vascular invasion during implantation. Placenta 15:21-33. Bussemakers MJG, Giroldi LA, Bokhoven AV, Schalken JA (1994) Transcriptional regulation of the human E-cadherin gene in human prostate cancer cell lines: Characterization of the human E-cadherin gene promoter. Biochem and Biophysic Res Comm 203:1284-1290. Bussemakers MJG, van Moorselaar RJA, Giroldi LA, Ichikawa T, Isaacs JT, Debruyne FMJ, Schalken JA (1992) Decreased expression of E-cadherin in the progression of rat prostatic cancer. Cancer Res 52:2916-2922. Caldecott J, Miles L (2005) World atlas of great apes and their conservation. Berkeley: University of Califonia Press. Cano A, Perez-Moreno MA, Rodrigo I, Locasciop A, Blanco MJ, del Barrio MG, Portillo F, Nieto MA (2002) Regulating adhesion and migration of normal and tumour cells. Nat Cell Biol 2:76-83. Carter AM (2007) Animal models of human placentation- a review. Trophoblast Res 21:S41-S47. Carter AM (1993) Current topic: restriction of placental and fetal growth in guinea-pig. Placenta 14:125-135. Carter JE (1964) Morphological evidence of syncytial formation from cytotrophoblastic cells. Obstet Gynecol 23:647-656.  182  Carver EA, Jiang R, Lan Y, Oram KF, and Gridley T (2001) The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol and Cell Biol 21:8184-8188. Castanon I, Baylies MK (2002) A Twist in fate: evolutionary comparison of Twist structure and function. Gene 287:11-22. Castanon I, Von Stetina S, Kass J, Baylies MK (2001) Dimerization partners determine the activity of the Twist bHLH protein during Drosophila mesoderm development. Development 128:3145-3159. Castellucci M, Classen-Linke I, Muhlhauser J, Kaufmann P, Zardi L, ChiquetEhrismann (1991) The human placenta: a model for tenascin expression. Histochemistry 95:449-458. Cavallaro U (2004) N-cadherin as an invasion promoter: a novel target for antitumor therapy? Curr Opin Investig Drugs 5:1274-1278. Cavallaro U, Schaffhauser B, Christoferi G (2002) Cadherins and the tumour progression: is it all in a switch? Cancer Lett 176:123-128. Chakraborty C, Gleeson L, Mckinnon T, Lala P (2002) Regulation of human trophoblast migration and invasiveness. Can J Physiol Pharmacol 80:116-124. Chang F, Steelman LS, Lee JT, Shelton JG, Navolanic PM, Blalock WL, Franklin RA, McCubrey JA (2003) Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia 17:1263-1293. Cheng L, Nagabhushan M, Pretlow TP, Amini SB, Pretlow TG (1996) Expression of E-cadherin in primary and metastatic prostate cancer. Am J Pathol 148:1375-80. Chou C, Zhu H, Shalev E, MacCalman C, Leung P (2002) The effects of gonadotropin-releasing hormone (GnRH) I and GnRH II on the urokinase-type plasminogen activator/plasminogen activator inhibitor system in human extravillous cytotrophoblasts in vitro. J Clin Endocrinol Metab 87:5594-5603. Chou JY, Wang SS, Robinson JC (1978) Regulation of the synthesis of human chorionic gonadotrophin by 5’-bromo-2’-deoxyuridine and dibutyryl cyclic AMP in trophoblastic and nontrophoblastic tumor cells. J Clin Endocrinol Metab 47:46-51. Chua CW, Chiu YT, Yuen HF, Chan KW, Man K, Wang X, Ling MT, Wong YC (2009) Suppression of androgen-independent prostate cancer cell aggressiveness by FTY720: validating Runx2 as a potential antimetastatic drug screening platform. Clin Cancer Res 15:4322.  183  Chung HW, Wen Y, Ahn JJ, Moon HS and Polan ML (2001) Interleukin-1β regulates urokinase plasminogen activator (uPA), u-PA receptor, soluble u-PA receptor, and plasminogen activator inhibitor-1 messenger ribonucleic acid expression in cultured human endometrial stromal cells. J Clin Endocrinol Metab 86:1332-1340. Cohen M, Meisser A, Bischof P (2006) Metalloproteinases and human placental invasiveness. Placenta 27:783-793. Colombatti A, Bonaldo P, Doliana R (1993) Type A modules: Interacting domains found in several non-fibrillar collagens and in other extracellular matrix proteins. Matrix 13:297-306. Comijn J, Berx G, Vermassen P, Verschueren K, van Grunsven L, Bruyneel E, Mareel M, Huylebroeck D, van Roy F (2001) The two-handed E-box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 7:12671278. Connerney J, Andreeva V, Leshem Y, Muentener C, Mercado MA, Spicer DB (2006) Twist1 dimer selection regulates cranial suture patterning and fusion. Dev Dyn 235:1345-1357. Contractor SF, Banks RW, Jones CJP, Fox H (1977) A possible role for placental lysosomes in the formation of villous syncytiotrophoblast. Cell Tiss Res 178:411-419. Coukos G, Makrigiannakis A, Amin K, Albelda SM, Coutifaris C (1998) Plateletendothelial cell adhesion molecule-1 is expressed by a subpopulation of human trophoblasts: a possible mechanism for trophoblast-endothelial interaction during haemochorial placentation. Mol Hum Reprod 4:357-367. Coussens LM, Fingleton B, Matrisian LM (2002) Matrix metaloproteinase inhibitors and cancer: trials and tribulations. Science 295:2387-2392. Coutifaris C, Kao LC, Sehdev HM, Chin U, Babalola GO, Blaschuk OW, Strauss III JF (1991) E-cadherin expression during the differentiation of human trophoblasts. Development 113:767-777. Cronier L, Bastied B, Herve JC, Deleze J, Malassine A (1994) Gap junctional communication during trophoblast differentiation: influence of human chorionic gonadotropin. Endocrin 135:402-408. Dahl U, Sjodin, Larue L, Radice G, Cajander S, Takeichi M, Kemler R, Semb H (2002) Genetic dissection of cadherin function during nephrogenesis. Mol Cell Biol 22:1474-1487. Damsky CH, Fitzgerald ML, Fischer SJ (1992) Distribution of extracellular matrix components and adhesion receptors are intricately modulated during first trimester  184  cytotrophoblast differentiation along the invasive pathway in vivo. J Clin Invest 89:210222. Damsky CH, Knudsen KA, Buck CA (1984) Integral membrane glycoproteins in cellcell and cell substratum adhesion. The Biology of glycoproteins (RJ Ivatt ed). Damsky CH, Richa J, Solter D, Knudsen KA, Buck CA (1983) Identification and purification of cell surface glycoprotein mediating intracellular adhesion in embryonic and adult tissue. Cell 34:455-466. Davies B, Miles DW, Happerfield LC (1993) Activity of type IV collagenases in benign and malignant breast disease. Br J Cancer 67:1126-1131. De Vergilis G, Sideri M, Fumagalli G, Remotti G (1982) The junctional pattern of human villous trophoblast. A freeze-fracture study. Gynecol Obstet Invest 14:263-272. De Wever O, Mareel M (2003) Role of tissue stroma in cancer cell invasion. J Pathol 200:429-447. Denker HW (1993) Implantation: A cell biological paradox. J Exp Zool 266:541-558. Denys H, De Wever O, Nusgens B, Kong Y, Sciot R, Le AT, van Dam, Jadidizadeh A, Tejpar S, Mereel M, Alman B, Cassiman JJ (2004) Invasion and MMP expression profile in desmoids tumours. Bri J Cancer 90:1443-1449. Derycke LD, Bracke ME (2004) N-cadherin in the spotlight of cell-cell adhesion, differentiation, embryogenesis, invasion and signalling. Int J Dev Biol 48:463-476. Dorudi S, Sheffield JP, Poulsom R, Northover J, Hart IR (1993) E-cadherin expression in colorectal cancer. An immunocytochemical and in situ hybridization study. Am J Pathol 142:981-986. Douglas DA, Shi YE, Sang QA (1997) Computational sequence analysis of the tissue inhibitor of metalloproteinase family. J Protein Chem 16:237-255. Douglas GC, King BF (1990) Differentiation of human trophoblast cells in vitro as revealed by immunocytochemical staining of desmoplakin and nuclei. J Cell Science 96:131-141. Droufakou S, Deshmane V, Roylance R, Handy A, Tomlinson I, Hart IR (2001) Multiple ways of silencing E-cadherin gene expression in lobular carcinoma of the breast. Int J Cancer 92:404-408. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G (1997) Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89:747-754.  185  Ducy P, Karsenty G (1995) Two distinct osteoblast-specific cis-acting elements contro expression of a mouse osteocalcin gene. Mol Cell Biol 15:1858-1869. Dupont J, Fernandez AM, Glackin CA, Helman L, LeRoith D (2001) Insulin-like growth factor 1 (IGF-1)-induced Twist expression is involved in the anti-apoptotic effects of the IGF-1 receptor. J Biol Chem 276:26699-26707. Durand M, Bodker J, Christensen A, Dupont D, Hansen M, Jensen J, Kjelgaard S, Mathiasen L, Pedersen K, Skeldal S, Wind T, Andreasen P (2004) Plaminogen activator inhibitor-I and tumour growth, invasion, and metastasis. Thromb Haemost 91:438-449. Earl U, Estlin C, Bulmer JN (1990) Fibronectin and laminin in the early human placenta. Placenta 11:223-231. Edelman GM (1988) Morphoregulatory molecules. Biochem 27:3533-3543. Egeblad M, Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nature Reviews Cancer 2:161-174. Eidelman S, Damsky CH, Wheelock MJ, Damjanov I (1989) Expression of the cellcell adhesion glycoprotein cell CAM 120/80 in normal human tissues and tumors. Am J Pathol 135:101-110. El Ghouzzi V, Le Merrer M, Perrin-Schmitt F, Lajeunie E, Benit P, Reniter D, Bourgeois P, Bolcato-Bellemin AL, Munnich A, Bonaventure J (1997) Mutations of the Twist gene in the Saethre-Chotzen syndrome. Nat Genet 15:42-46. Elias MC, Tozer KR, Silber JR, Mikheeva S, Deng M, Morrison RS, Manning TC, Silbergeld DL, Glackin CA, Reh TA, Rostomily RC (2005) Twist is expressed in human gliomas and promotes invasion. Neoplasia 7:824-837. Elleberger T, Fass D, Arnaud M, Harrison SC (1994) Crystal structure of transcription factor E47: E-box recognition by a basic region helix-loop-helix dimer. Genes Dev 8:970-980. Enders A (1976) Anatomical aspects of implantation. J Reprod Fertil S25:1-15. Enders A (1968) Fine structure of anchoring villi of the human placenta. Am J Anat 122:419-451. Endo T, Kobayashi T (2010) Runx2 deficiency in mice causes decreased thyroglobulin expression and hypothyroidism. Mol Endocrinol 24:1-7.  186  Enomoto H, Enomoto-Iwamoto M, Nomura S, Himeno M, Kitamura Y, Kishimoto T, Komori T (2000) Cbfa1 is a positive regulatory factor in chondrocyte maturation. J Biol Chem 275:8695-8702. Ephrussi A, Church G, Tonegawa S, Gilber W (1985) B lineage-specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 250:1104-1111. Farookhi R, Blaschuk OW (1991) Cadherins and ovarian follicular development. In ‘Regulatory processes and gene expression in the ovary’. (G Gibori ed). Fazleabas AT, Kim JJ and Strakova Z (2004) Implantation: embryonic signals and the modulation of the uterine environment. Placenta (Suppl. A), S26-S31. Feinberg RF, Kliman HJ, Lockwood (1991) Is oncofetal fibronectin a trophoblast glue for human implantation? Am J Pathol 138:537-543. Feng Q, Liu K, Liu YX, Byrne S, Ockleford CD (2001) Plaminogen activators and inhibitors are transcribed during early maqaque implantation. Placenta 22:186-199. Feng XH, Derynck R (2005) Specificity and versatility in TGF-β signalling through smads. Ann Rev Cell Dev Biol 21:659-693. Fingleton B (2006) Matrix metalloproteinases: roles in cancer and metastasis. Front Biosci 11:479-491. Firulli BA, Krawchuck D, Centonze VE (2005) Altered Twist1 and Hand2 dimerization is associated with Saethre-Chotzen syndrome and limb abnormalities. Nat Genet 37:373-381. Fisher SJ, Damsky CH (1993) Human cytotrophoblast invasion. Semin Cell Biol 4:183188. Fisher SJ, Cui TY, Zhang L, Hartman L, Grahl K, Guo-Yang K, Tarpey J, Damsky CH (1989) Adhesive and degradative properties of human placental cytotrophoblasts in vitro. J Cell Biol 109:891-902. Fox H (1964) The villous cytotrophoblast as an index of placental ischaemia. J Obstet Gynaecol 71:885-893. Freitas S, Meduri G, le Nestour E, Bausero P, Perrot-Applanat M (1999) Expression of metalloproteinases and their inhibitors in blood vessels in human endometrium. Biol Reprod 61:1070-1082. Fridman R (2006) Metalloproteinases and cancer. Cancer Metastasis Rev 25:7-8.  187  Fuchtbauer EM (1995) Expression of M-twist during postimplantation development of the mouse. Dev Dyn 204:316-322. Furlong EE, Andersen EC, Null B, White KP, Scott MP (2001) Patterns of gene expression during Drosophilla mesoderm development. Science 293:1629-1633. Galton M (1962) DNA content of placental nuclei. J Cell Biol 13:183-191. Ge C, Xiao G, Jiang D, Yang Q, Hatch NE, Roca H, Franceschi RT (2009) Identification and functional characterization of ERK/MAPK phosphorylation sites in the Runx2 transcription factor. J Biol Chem 284: 32533-32543. George-Weinstein M, Gerhart J, Blitz J, Simak E, Knudsen K (1997) N-cadherin promotes the commitment and Differentiation of Skeletal Muscle Precursor Cells. Develop Biol 185:14-24. Gerbie AB, Hathaway HH, Brewer JI (1968) Autoradiographic analysis of normal trophoblastic proliferation. Am J Obstet Gynecol 100:640-648. Getsios S, MacCalman CD (2003) Cadherin-11 modulates the terminal differentiation and fusion of human trophoblastic cells in vitro. Dev Biol 257:41-54. Getsios S, Chen GTC, MacCalman CD (2000) Regulation of β-catenin mRNA and protein levels in human villous cytotrophoblasts undergoing aggregation and fusion in vitro: correlation with E-cadherin expression. J Reprod and Fertil 119:59-68. Getsios S, Chen GTC, Huang D, MacCalman CD (1998a) Regulated expression of cadherin-11 in human extravillous cytotrophoblasts undergoing aggregation and fusion in response to transforming growth factor beta 1. J Reprod and Fertil 114:357-363. Getsios S, Chen G, Stephenson MD, Leclerc P, Blaschuk OW, MacCalman CD (1998b) Regulated expression of cadherin-6 and cadherin-11 in the glandular epithelium and stromal cells of the human endometrium. Dev Dyn 211:238-247. Ghadami M, Makita Y, Yoshida K, Nishimura G, Fukushima Y, Wakui K, Ikegawa S, Yamada K, Kondo S, Niikawa N, Tomita H (2000) Genetic mapping of the camurati-engelmann disease locus to chromosome19q13-q13.3. Am J Hum Genet 66: 143-147. Giancotti FG (1997) Integrin signalling: specificity and control of cell survival and cell cycle progression. Curr Opin Cell Biol 9:691-700. Gitelman I (1997) Twist protein in mouse embrogenesis. Dev Biol 189:205-214. Godkin JD and Dore JJE (1998) Transforming growth factor β and the endometrium. Rev Reprod 3:1-6.  188  Goel HL, Moro L, King M, Teider N, Centrella M, McCarthy TL, HolgadoMadruga M, Wong AJ, Marra E, Languino LR (2006) Beta1 integrins modulate cell adhesion by regulating insulin-like growth factor-II levels in the microenvironment. Cancer Research 66:331-342. Golden JG, Hughes HC, Lang CM (1980) Experimental toxaemia in the pregnant guinea pig (cavia porcellus). Lab Anim Sci 30:174-179. Goldman-Wohl D, Yagel S (2002) Regulation of trophoblast invasion: from normal implantation to pre-eclampsia. Mol Cell Endocrinol 22:233-238. Gou Y, Zi X, Koontz Z, Kim A, Xie J, Gorlick R, Holcombe RF, Hoang BH (2007) Blocking Wnt/LRP5 signaling by a soluble receptor modulates the epithelial to mesenchymal transition and osteosarcoma Saos-2 cells. J Ortho Res 25: 964-971. Graham CH (1997) Effect of transforming growth factor-beta on the plasminogen activator system in cultured first trimester human cytotrophoblasts. Placenta 18: 137143. Graham CH, Connely I, MacDougall JR, Kerbel RS, Stetler-Stevenson WG, Lala PK (1994) Resistance of malignant trophoblast cells to both the anti-proliferative and anti-invasive effects of transforming growth factor-β. Exp Cell Res 214:93-99. Graham CH, Hawley T, Hawley R, MacDougall J, Kerbel R, Khoo N, Lala PK (1993) Establisment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 206:204-211. Graham CH, Lala PK (1992) Mechanisms of placental invasion of the uterus and their control. Biochem Cell Biol 70:867-874. Graham CH, Lysiak J, McCrea K, Lala PK (1992) Localization of transforming growth factor-beta at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod 46:561-572. Graham CH and Lala PK (1991) Mechanism of control of trophoblast invasion in situ. J Cell Physiol 148:228-234. Graham JG, Hughes HC, Lang CM (1980) Effects of transforming growth factor-β on the plasminogen activator system in cultured first trimester cytotrophoblasts. Placenta 18:137-143. Green KJ, Gaudry CA (2000) Are desmosomes more than tethers for intermediate filaments? Nat Rev Mol Cell Biol 1:208-216.  189  Grier DG, Thompson A, Kwasniewska A, McGonigle GJ, Halliday HL, Lappin TR (2005) The pathophysiology of HOX genes and their role in cancer. J Pathol 205:154171. Gripp KW, Zackai EH, Stolle CA (2000) Mutations in the human Twist gene. Hum Mutat 15:479. Grunwald GB (1993) The structural and functional analysis of cadherin calciumdependent cell adhesion molecules. Curr Opin Cell Biol 5: 797-805. Gumbiner B (1996) Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84: 345-357. Guo WH, Weng LQ, Ito K, Chen LF, Nakanishi H, Tatematsu M (2002) Inhibition of growth of mouse gastric cancer cells by Runx3, a novel tumor supressor. Oncogene 21: 8351-8355. Harada SI, Rodan GA (2003) Review article control of osteoblast function and regulation of bone mass. Nature 423:349-355. Hatta K, Nose A, Nagafuchi A, Takeichi (1988) Cloning and expression of cDNA encoding a neural calcium-dependent cell adhesion molecules: its identity in the cadherin gene family. J Cell Biol 106:573-581. Hazan RB, Qiao R, Karen R, Badano I, Suyama K (2004) Cadherin switch in tumor progression. Ann NY Acad Sci 1014:155-163. Hazan RB, Phillips GR, Qiao RF, Norton L, Aaronson SA (2000) Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. J Cell Biol 148:779-790. Hazan RB, Kang L, Whooley BP, Borgen PI (1997) N-cadherin promotes adhesion between invasion breast cancer cells and the stroma. Cell Adhes Commun 4:399-411. Hebrok M, Wertz K, Fuchtbauer ER (1994) M-Twist is an inhibitor of muscle differentiation. Dev Biol 165:537-544. Hertig AT, Rock J, Adams J (1956) A description of 34 human ova within the first 17 days of development. Am J Anat 98:325-494. Hill JP (1932) The developmental history of the primates. Phil Trans Roy Soc B 221:45178. Hill PM, Young M (1973) Net placental transfer of free amino acids against varying concentrations. J Physiol 235:409-422.  190  Hirohashi S (1998) Inactivation of the E-cadherin-mediated cell adhesion system in human cancers. Am J Pathol 153:333-339. Hoek K, Rimm DL, Williams KR, Zhao H, Ariyan S, Lin A, Kluger HM, Berger AJ, Cheng E, Trombetta ES, Wu T, Niinobe M, Yoshikawa K, Hannigan GE, Halaban R (2004) Expression profiling reveals novel pathways in the transformation of melanocytes to fs. Cancer Res 64:5270-5282. Hofmann GE, Drews MR, Scott RT Jr, Navot D, Heller D, Deliddisch L (1992) Epidermal growth factor and its receptor in human implantation trophoblast: immunohistochemical evidence for autocrine/paracrine function. J Clin Endocrinol Metab 74:981-988. Hoozemans DA, Schats R, Lambalk CB, Homburg R, Hompes PG (2004) Human embryo implantation: current knowledge and clinical implications in assisted reproductive technology. Reprod Biomed Online 9:692-715. Horshina M, Boothby R, Hussam R, Pattillo, Camel HM, Boime L (1983) Linkage of human chorionic gonadotrophin and placental lactogen biosynthesis to trophoblast differentiation and tumorigenesis. Placenta 6:163-172. Horshina M, Boothby M, Boime I (1982) Cytological localization of chorionic gonadotropin alpha and placental lactogen mRNAs during development of the human placenta. J Cell Biol 93:190-198. Hosono S, Kajiyama H, Terauchi M, Shibata K, Ino K, Nawa A, Kikkawa F (2007) Expression of Twist increases the risk for recurrence and for poor survival in epithelial ovarian carcinoma patients. Br J Cancer 96:314-320. Howard TD, Green ED, Chiang LC, Ma N, Ortiz de Luna RI, Garcia Delgado C, Gonzalez-Ramos M, Kline AD, Jabs EW (1997) Mutations in twist, a basic helix-loophelix transcription factor, in Saethre-Chotzen syndrome. Nat Genet 15: 3-4. Hu ZY, Liu YX, Liu K, Byrne S, Ny T, Feng Q, Ockleford CD (1999) Expression of tissue type and urokinase type plasminogen activators as well as plasminogen activator inhibitor type-1 and type-2 in human and rhesus monkey placenta. J Ant 194:183-195. Huang HY, Wen Y, Irwin JC, Kruessel JS, Soong YK, Polan ML (1998) Cytokinemediated regulation of 92-kildodalton type IV collagenase, tissue inhibitor of metalloproteinase-1 (TIMP-1), and TIMP-3 messenger ribonucleic acid expression in human endometrial stromal cells. J Clin Endocrinol Metab 83:1721-1729. Huber O, Biskamp C, Kemler R (1996) Cadherins and catenins in development. Curr Opin Cell Biol 8:685-691.  191  Huiping C, Sigurgeirsdottir JR, Jonasson JG, Eiriksdottir G, Johannsdottir JT, Egilsson V, Izngvarsson S (1999) Chromosome alterations and E-cadherin gene mutations in human lobular breast cancer. Br J Cancer 81:1103-1110. Huppertz B, Frank HG, Reister F, Kingdom J, Korr H, Kaufmann P (1999) Apoptosis cascade progresses during turnover of human trophoblast: analysis of villous cytotrophoblast and syncytial fragments in vitro. Lab Invest 79:1687-1702. Huber O, Korn R, McLaughlin J, Ohsugi M, Herrmann BG, Kemler R (1996) Nuclear localization of beta-catenin by interaction with transcription factor LEF-1. Mech Dev 59:3-10. Hyafil F, Morello D, Babinet C, Jacob F (1980) Cell surface glycoprotein involved in the compaction of embryonic carcinoma cells and cleavage stage embryos. Cell 21:927934. Isaka K, Usuda S, Ito H, Sagawa Y, Nakamura H, Nishi H, Suzuki Y, Li F, Takayama M (2003) Expression and activation of matrix metalloproteinase 2 and 9 in human trophoblasts. Placenta 24:53-64. Ishihara N, Matsuo H, Murakoshi H, Laoag-Fernandez JB, Samoto T, Maruo T (2002) Increased apoptosis in the syncytiotrophoblast in human term placentas complicated by either preeclampsia or intrauterine growth retardation. Am J Obstet Gynecol 186:158-166. Islam S, Carey T, Wolf G, MJ W, Johnson K (1996) Expression of N-cadherin by human squamous carcinoma cells induces a scattered fibroblastic phenotype with disrupted cell-cell adhesion. J Cell Biol 135:1643-1654. Inman CK, Shore P (2003) The osteoblast transcription factor Runx2 in expressed in mammary epithelial cells and mediates osteopontin expression. J Biol Chem 278:4868448689. Inoue K, Shiga T, Ito Y (2008) RUNX transcription factors in neuronal development. Neural Dev 26:20. Ip YT, Park RE, Kosman D, Yazdanbakhsh K, Levine M (1992) Dorsal-Twist interactions establish snail expression in the presumptive mesoderm of the Drosophila embryo. Genes Dev 6:1518-1530. Irving J, Lysiak J, Graham C, Hearn S, Han V, Lala P (1995) Characteristics of trophoblast cells migrating from first trimester chorionic villus explants and propagated in culture. Placenta 16:413-433. Ito Y, Chuang LS (2010) RUNX3 is multifunctional in carcinogenesis of multiple solid tumors. Oncogene [Epub ahead of print].  192  Ito Y (2004) Oncogenic potential of the RUNX gene family: “Overview”. Oncogene 23:4198-4208. Ito Y (1999) Molecular basis of tissue-specific gene expression mediated by the runt domain transcription factor PEBP2/CBF. Genes Cells 4:685-696. Iwatsuki K, Tanaka K, Kaneko T, Kazama R, Shiki O, Nakayama Y, Ito Y, Satake M, Takahashi SI, Miyajima A, Watanabe T, Hara T (2005) Runx1 promotes angiogenesis by downregulation of insuline-like growth factor-binding protein-3. Oncogene 24:1129-1137. Jansson T, Persson E (1990) Placental transfer of glucose and amino acids in intrauterine growth retardation: studies with substrate analogs in the awake guinea pig. Pediatr Res 28:203-208. Javed A, Barnes GL, Pratap , Antkowiak T, Gerstenfeld LC, van Wijnen AJ (2005) Impaired intranuclear trafficking of Runx2 (AML3/CBFA1) transcription factors in breast cancer cells inhibits osteolysis in vivo. Proc Natl Acad Sci USA 102:1454-1459. Jeon EJ, Lee KY, Choi NS, Lee MH, Kim HN, Jin YH (2006) Bone morphogenetic protein-2 stimulates Runx2 acetylation. J Biol Chem 281:16502-16511. Jiang C, Pecha J, Hoshino I, Ankrapp D, Xiao H (2007) TIP30 mutant derived from hepatocellular carcinoma specimens promotes growth of HepG2 cells through upregulation of N-cadherin. Cancer Res 67:3574-3582. Jiao W, Miyazaki K, Kitajima Y (2002) Inverse correlationship between E-cad and Snail expression in hepatocellular carcinoma cell lines in vitro and in vivo. Br J Cancer 86:98-101. Kabir-Salmani M, Shiokawa S, Akimoto Y, Sakai K, Iwashita M (2004) The role of alpha(5)beta(1)-integrin in the IGF-1 induced migration of extravillous trophoblast cells during the process of implantation. Mol Hum Reprod 10:91-97. Kabir-Salmani M, Shiokawa S, Akimoto Y, Sakai K, Nagamatsu S, Sakai S, Nakamura Y, Lofti A, Kawakami H, Iwashita M (2003) Alphavbeta3 integrin signalling pathway is involved in insulin-like growth factor I-stimulated human extravillous trophoblast cell migration. Endocrinol 144:1620-1630. Kang Y, Massague J (2004) Epithelial-mesenchymal transitions: twist in development and metastasis. Cell 118:277-279. Kao LC, Clatabiano S, Wu S, Strauss JF III, Kliman HJ (1988) The human villous cytotrophoblast; interactions with extracellular matrix proteins, endocrine function, and  193  cytoplasmic differentiation in the absence of syncytium formation. Dev Biol 130:693702. Karmakar S, Das C (2004) Modulation of ezrin and E-cadherin expression by IL-1beta and TGF-beta1 in human trophoblasts. J Reprod Immunol 64: 9-29. Karmakar S, Das C (2002) Regulation of trophoblast invasion by IL-1beta and TGFbeta1. Am J Reprod immunol 48:210-219. Kaufman P (1985) Basic morphology of the fetal and maternal circuits in the human placenta. In vitro profusion of human placental tissue. Contrib Gynecol Obstet 13:77-86. Kemler R, Osawa M, Ringwald M (1989) Calcium dependent cell adhesion molecules. Current Opin Cell Biol 1:892-897. Kenneth JL, Thomas DS (2001) Analysis of relative gene expression data using realðð  time quantitative PCR and the 2- CT method. Methods 25:402-408. Kida Y, Asahina K, Teraoka H, Gitelman I Sato T (2007) Twist relates to tubular epithelial-mesenchymal transition and interstitial fibrogenesis in the obstructed kidney. J Histochem & Cytochem 55:661-673. Kilburn BA, Wang J (2000) Extracellular Matrix composition and hypoxia regulate the expression of HLA-G and integrins in human trophoblast cell line. Biol of Reproduction 62:739-747. Kind KL, Roberts CT, Sohlstrom AI, Katsman A, Clifton PM, Robinson JS, Owens JA (2005) Chronic maternal feed restriction impairs growth but increases adiposity of the fetal guinea-pig? Am J Physiol regul Integr Comp Physiol 288:R119-126. Kim J, Islam S, Kim Y, Prudoff R, Sass K, Wheelock M, Johnson K (2000) Ncadherin extracellular repeat 4 mediates epithelial to mesenchymal transition and increased motility. J Cell Biol 151:1193-1206. King A, Thomas L, Bischof P (2000) Cell culture models of trophoblast II: trophoblast cell lines—a workshop report. Placenta 21. King A, Loke YW (1994) Unexplained fetal growth retardation: what is the cause? Arch Dis Childhood 70:F225-F227. Khodr GS, Siler-Khodr TM (1980) Placental leutinizing hormone-releasing factor and its synthesis. Science 207:315-318. Khoo NKS, Bechberger JF, Sheperd T, Bond SL, McCrae , Hamilton GS, Lala PK (1998) SV-40 Tag transformation of the normal invasion trophoblast results in a  194  premalignant phenotypes I. Mechanisms responsible for hyperinvasiveness and resistance to anti-invasiveness action of TGF-β. Int J Cancer 77:429-439. Kleiner DE, Stetler-Stevenson WG (1993) Structural biochemistry and activation of matrix metalloprteinases. Curr Op Cell Biol 5:891-897. Kliman HJ, Nestler JE, Sermasi E, Sanger J, Strauss III JF (1986) Purification, characterization and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinol 118:1567-1582. Knudsen KA, Frankowski C, Johnson KR, Wheelock MJ (1998) A role for cadherins in cellular signalling aand differentiation. J Cell Biochem Suppl 31:168-176. Komari M, Karakida T, Abe M, Oida S, Mimori K, Iwasaki K, Noguchi K, Oda S, Ishikawa I (2007) Twist negatively regulates osteoblastic differentiation in human periodontal ligament cells. J Cell Biochem 100:303-314. Komori T (2006) Regulation of osteoblast differentiation by transcription factors. J Cell Biochem 99:1233-1239. Komori T Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T (1997) Targeted disruption of Cbfa 1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755-764. Kong KY, Kedes L (2004) Cytoplasmic nuclear transfer of the actin-capping protein tropomodulin. J Biol Chem 279:30856-30864. Krebs C, Macara L, Leiser R, Bowman A, Greer I, Kingdom L (1996) Intrauterine growth restriction with absent end-diastolic flow velocity in the umbilical artery is associated with maldevelopment of the placental terminal villous tree. Am J Obstet Gynecol 175:1534-1542. Kreis T, Vale R (1993) Guidebook to the extracellular matrix and adhesion proteins. Oxford: Oxford Univ. Press. Kronenberg HM (2004) Twist genes regulate Runx2 and bone formation. Dev Cell 6:317-318. Kwok WK, Ling MT, Lee TW, Lau TC, Zhou C, Zhang X, Chua CW, Chan KW, Chan FL, Glackin C, Wong YC, Wang X (2005) Up-regulation of Twist in prostate cancer and its implication as a therapeutic target. Cancer Res 65:5153-5162. Kyo S, Sakaguchi J, Ohno S, Mizumoto Y, Maida Y, Manabu H, Nakamura M, Takakura M, Nakajima M, Masutomi K, Inoue M (2006) High Twist expression is  195  involved in infiltrative endometrial cancer and affects patient survival. Hum Pathol 37:431-438. Lafrenie RM, Yamada KM (1996) Integrin-dependent signal transduction. J Cell Biochem 61:543-553. Lala PK, Lee BP, Xu G, Chakraborty C (2002) Human placental trophoblast as an in vitro model for tumor progression. Can J Physiol Pharmacol 80:142-149. Lala PK, Hamilton GS (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta 17:545-555. Lala PK and Graham CH (1990) Mechanisms of trophoblast invasiveness and their control; the role of proteases and protease inhibitors. Cancer Metastasis Rev 9:369-379. Larue L, Bellacosa A (2005) Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3’ kinase/ AKT pathways. Oncogene 24:7443-7454. Larue L, Antos C, Butz S, Huber O, Delmas V, Dominis M, Kemler R (1996) A role for cadherins in tissue formation. Development 122:3185-3194. Larue L, Ohsugi M, Hirchenhain J, Kemler R (1994) E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci USA 91:8263-8267. Lau QC, Raja E, Salto-Tellez M, Liu Q, Ito K Inoue M (2006) RUNX3 is frequently inactivated by dual mechanisms of protein mislocalization and promoter hypermethylation in breast cancer. Cancer Res 66:6512-6520. Leach RE, Khalifa R, Ramirez ND, Das SK, Wang J, Dey SK, Romero R, Ammant DR (1999) Multiple roles for heparin-binding epidermal growth factor-like growths factors are suggested by its cell-specificexpression during the human endometrial cycle and early placentation. J Clin Endocrinol Metab 84:3355-3363. Lee TK, Poon RTP, Yuen AP, Ling MT, Kwok WK, Wang XH, Wong YC, Guan XY, Man K, Chau KL, Fan ST (2006) Twist overexpression correlates with hepatocellular carcinoma metastasis through induction of epithelial-mesenchymal transition. Hum Cancer Biol 12:5369-5376. Lee X, Keith Jr JC, Stumm N, Moutastsos I, McCoy JM, Crum CP, Genest D, Chin D, Ehrenfeis C, Pinnenborg R, van Assche FA, Mi S (2001) Downregulation of placental syncytin expression and abnormal protein localization in pre-eclampsia. Placenta 22:808-812. Leptin M (1991) Twist and snail as positive and negative regulators during Drosophila mesoderm development. Genes Dev 5:1568-1576.  196  Leptin M, Grunewald B (1990) Cell shape changes during gastrulation in Drosophila. Development 110:73-84. Leu FP, Nandi M, Niu C (2008) The effect of transforming growth factor beta on human neuroendocrine tumor BON cell proliferate and differentiation is mediated through somatostatin signaling. Mol Cancer Res 6:1029-1042. Levanon D, Brenner O, Negreanu V, Bettoun D, Woolf E, Elilam R, Lotem J, Gat U, Otoo F, Speck N, Groner Y (2001) Spatial and temporal expression pattern of Runx3 (Aml12) and Runx1 (Aml1) indicates non-redundant functions during mouse embryogenesis. Mech Dev 109:413-417. Li G, Satyamoorthy K, Herlyn M (2001) N-cadherin-mediated intercellular interactions promote survival and migration of melanoma cells. Cancer Res 61:3819-3825. Li QL, Ito K, Sakakura C, Fukamachi H, Inoue KI, Chi XZ, Lee KY, Nomura S, Lee CW, Han SB, Kim HM, Kim WJ, Yamamoto H, Yamashita N, Yano T, Ikeda T, Itohara S, Inazawa J, Abe T, Hagiwara A, Yamagishi H, Ooe A, Kaneda A, Sugimura T, Ushijima T, Bae SC, Ito Y (2002) Causal relationship between the loss of Runx3 expression and gastric cancer. Cell 109:113-124. Lian JB, Javed A, Zaidi SK, Lengner C, Montecino M, van Wijnen AJ, Stein JL, Stein GS (2004) Regulatory controls for osteoblast growth and differentiation: role of Runx/Cbfa/AML factors. Crit Rev Eukaryot Gene Expr 14:1-41. Libra M, Scalisi A, Vella N, Clementi S, Sorio R, Stivala F, Spandidos DA, Mazzarino C (2009) Uterine cervical carcinoma: Role of matrix mettaloproteinases (Review). Int J Oncology 34:897-903. Librach CL, Feigenbaum SL, Bass KE, Cui T, Verastas N, Sadovsky Y, Quigley JP, French DL, Fisher SJ (1994) Interleukin-1β regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. J Biol Chem 269:17125-17131. Librach CL, Werb Z, Fitzgerald ML, Chiu K, Corwin NM, Esteves RA, Grobelny D, Galardy R, Dmasky CH (1991) 92-kDa type IV collagenase mediates invasion of human cytotrophoblasts. J Cell Biol 113:437-449. Lin CQ, Bissell MJ (1993) Multi-faceted regulation of cellular differentiation by extracellular matrix. FASEB J 7:737-743. Lochter A, Navre M, Werb Z, Bissell M (1999) Multi-faceted regulation of cellular differentiation by extracellular matrix. Mol Biol Cell 10:271-282. Lombaerts M, van Wezel T, Philippo K, Dierssen JWF, Zimmerman RME, Oosting J, van Eijk R, Eilers PH, van de Water B, Cornelisse CJ, Cleton-Jansen AM (2006.) E-cadherin transcriptional downregulational by promotor methylation but not mutation is  197  related to epithelail-to-mesenchymal transition in breast cancer cell lines. British J Cancer 94:661-671. Lipscomb EA, Mercurio AM (2005) Mobilization and activation of a signalling competent alpha6beta4integrin underlies its constribution to carcinoma progression. Cancer Metastasis Reviews 24: 413-423. Lyall, F (2006) Mechanisms regulating cytotrophoblast invasion in normal pregnancy and pre-eclampsia. Aust and NZ J Obstet and Gynecol 46:266-273. Ma PC, Weintraub MA, Weintraub H, Pabo CO (1994) Crystal structure of MyoD bHLH domain-DNA complex: perspectives on DNA recognition and implications for transcriptional activation. Cell 77:451-459. Macara L, Kingdom L Kaufmann P, Kohnen G, Hair J, More I, Lyall F, Greer I (1996) Structural analysis of placental terminal villi from growth-restricted pregnancies with abnormal umbilical artery Doppler waveforms. Placenta 17:37-48. MacCalman CD, Getsios S, Chen G (1998) Type 2 cadherins in the human endometrium and placenta: their putative roles in human implantation and placentation. Am J Reprod Immunol 39:96-107. MacCalman CD, Furth EE, Omigbodun A, Tian XC, Fortune JE, Furth EE, Coutifaris C, Strauss III JF (1996) Regulated expression of cadherin-11 human epithelial cells: a role for cadherin-11 in trophoblast-endometrium interactions. Dev Dyn 206:201-211. MacDonald TJ, Declercky YA, Laug WE (1998) Urokinase induced receptor mediated brain tumor cell migration and invasion. J neuro-oncol 40:215-226. Maestro R, Dei Tos AP, Hamamori Y, Krasnokutsky S, Sartorelli V, Kedes L, Doglioni C, Beach DH, Hannon GJ (1999) Twist is a potential oncogene that inhibits apoptosis. Genes Dev 13:2207-2217. Martin RD (2003) Human reproduction: a comparative background for medical hypothesis. J Reprod Immunol 59:111-135. Masoud F, Mehrotra P, Nowak R (2010) The cytokine interleukin 1beta induces epithelial to mesenchymal transition (EMT) in peritoneal mesothelial cells through direct and indirect effects involving basigin. Biol Reprod 81:606. Massari ME, Murre C (2000) Helix-loop-helix proteins: regulators of transcription in eukaryotic organisms. Mol Cell Biol 20:429-440.  198  Matsuura H, Greene T, Hakomori (1989) An α-N-acetyl galactosaminylation at the threonine residue of a defined peptide sequence creates the oncofetal peptide epitope in human fibronectin. J Biol Chem 264:10472-10476. Matsuura H, Hakomori S (1985) The oncofetal domain of fibronectin defined by monoclonal antibody FDC-6; its presence in fibronectins from fetal and tumor tissues and its absence in those from normal adult tissues and plasma. Proc Natl Acad Sci USA 82: 6517-6521. Maymo JL, Perez Perez A, Duenas JL, Calvo JC, Sanchez-Margalet V, Varone CL (2010) Regulation of placental leptin expression by cyclic adenosine 5’-monophosphate involves cross talk between protein kinase A and mitogen-activated protein kinase signalling pathways. Endocrinol [Epub ahead of print]. McGann KA, Collman R, Kolson DL, Gonzalez-Scarano F, Coukos G, Coutifaris C, Strauss III JF, Nathanson N (1994) Human immunodeficiency virus type I causes productive infection of macrophage in primary placental cell cultures. J Infect Dis 169:746-753. Merviel P, Challier JC, Carbillon L, Foidart JM, Uzan S (2001) The role of integrins in human embryo implantation. Fetal Diagn Ther 16:364-371. Metz J, Weihe E (1980) Intercellular junctions in the full term human placenta. II. Cytotrophoblast cells, intravillous stroma cells and blood vessels. Anat Embryol 158: 167-178. Metz J, Weihe E, Heinrich D (1979) Intercellular junctions in the full term human placental. I. Syncytiotrophoblastic layer Anat Embryol 158:41-50. Milstone DS, Redline RW, O’Donnell PE, Davis VM, Stavrakis G (2000) E-selectin expression and function in a unique placental trophoblast population at the maternal-fetal interface: regulation by a trophoblast-restricted transcriptional mechanism conserved between humans and mice. Dev Dynam 219:63-76. Min C, Eddy SF, Sherr DH, Sonenshein GE (2008) NF-kB and epithelial to mesenchymal transition of cancer. J Cell Biochem 104:733-744. Mironchik Y, Winnard PT, Vesuna F, Kato Y, Wildes F, Pathak AP, Kominsky S, Artemov D, Bhujwalla Z, van Diest P, Burger H, Glackin C, Raman V (2005) Twist overexpression induces in vivo angiogenesis and correlates with chromosomal instability in breast cancer. Cancer Res 65:10801-10809. Miyake A, Sakumoto T, Aono T, Kawamura Y, Maeda T, Kurachi K (1982) Changes in leutinizing hormone-releasing hormone in human placenta throughout pregnancy. Obstet Gynecol 60:444-449.  199  Mori M, Nakagami H, Koibuchi N, Miura K, Takami Y, Koriyama H, Hayashi H, Sabe H, Mochizuki N, Morishita R, Kaneda Y (2009) Zyxin mediates actin fiber reorganization in epithelial-mesenchymal transition and constributes to endocardial morphogenesis. Mol Biol Cell 39:3115-3124. Morrish DW, Dakour J, Hongshi J (1998) Functional regulation of human trophoblast differentiation. J Reprod Immunol 39:179-195. Morrish DW, Dakour J, Li H, Xiao J, Miller R, Sherburne R, Berdan RC, Guilbert LJ (1997) In vitro cultured human term cytotrophoblast: a model for normal primary epithelail cells demonstrating a spontaneous differentiation programme that requires EGF for extensive development of syncytium. Placenta 18:577-585. Morrison SJ, Kimble J (2006) Asymmetric and symmetric stem-cell divisions in development and cancer. Nature 411:1068-1074. Moustafa AE, Yansouni C, Alaoui-Jamali M, O’Connor-McCourt M (1999) Upregulation of E-cadherin by an anti-epithelial growth factor receptor monoclonal antibody in lung cancer cell lines. Clin Cancer Res 5:681-692. Muhlhauser J, Crescimanno C, Kaufmann P, Hofler H, Zacchea D, Castellucci M (1993) Differentiation and proliferation patterns in human trophobalst revealed by cerbB-2oncogene product and EGF-R. J Histochem Cytochem 41:165-173. Mundlos S (1990) Cleidocranial dysplasia: Clinical and molecular genetics. J Med Genet 36:177-182. Murakami M, Suzuki M, Nishino Y, Funaba M (2010) Regulatory expression of gene related to metastasis by TGF-beta and activin A in B16 murine melanoma cells. Mol Biol Rep 37:1279-1286. Muzio M, Ni J, Feng P, Dixit VM (1997) IRAK (pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278:5343-1612. Nakagawa S, Takeichi M (1995) Neural crest cell-cell adhesion controlled by sequential and subpopulation-specific expression of novel cadherins. Development 121:1321-1332. Nakajima S, Doi R, Toyoda E, Tsuji S, Wada M, Koizumi M, Tulachan SS, Ito D, Kami K, Mori T, Kawaguchi Y, Fujimoto K, Hosotani R, Imamura M (2004) Npcadherin expression and epithelial-mesenchymal transition in pancreatic carcinoma. Clin Cancer Res 10:4125-4133. Nadal-Ginard B (1978) Commitment, fusion, and biochemical differentiation of a myogenic line in the absence of DNA synthesis. Cell 15:855-864.  200  Nagafuchi A, Shirayoshi Y, Okazaki K, Yasuda K, Takeichi M (1987) Transformation of cell adhesion properties by exogenously introduced E-cadherin cDNA. Nature 329:341-343. Nasiry SA, Spitz B, Hanssens M, Luyten C, Pijnenborg R (2006) Differential effects of inducers of syncytialization and apoptosis on BeWo and JEG-3 choriocarcinoma cells. Hum Repro 21:193-201. Nathke IS, Hinck L, Swedlow JR, Papkoff J, Nelson WJ (1994) Defining interactions and distributions of cadherin and catenin complexes in polarized epithelial cells. J Cell Biol 125:1341-1352. Nieman MT, Prudoff RS, Johnson KR, Wheelock MJ (1999) N-cadherin promotes motility in human breast cancer cells regardless of their E-cadherin expression. J Cell Biol 147:631-644. Nose A, Nagafuchi A, Takeichi M (1988) Expressed recombinant cadherins mediate cell sorting in model systems. Cell 54:993-1001. Nose A and Takeichi M (1986) A novel cadherin cell adhesion molecules: its expression patterns associated with implantation and organogenesis of mouse embryo. J Cell Biol 103:2649-2658. O’Donnell M, Fleming S (1995) Disruption of cell adhesion in renal epithelium without cadherin loss. J Pathol 175:45-50. O’Rourke MP, Tam PP (2002) Twist functions in mouse development. Int J Dev Biol 46:401-413. Oda H, Tsukita S, Takeichi M (1998) Dynamic behavior of the cadherin-based cell-cell adhesion system during Drosophila gastrulation. Dev Biol 203:435-450. Ogawa S, Harada H, Fujiwara M, Tagashira S, Katsumata T, Takada H. (2000) Cbfa1, an essential transcription factor for bone formation, is expressed in testis from the same promoter used in bone. DNA Res 7:181-185. Ohlsson R, Larsson E, Nilsson O, Wahlstrom T, Sundstrom P (1989) Blastocyst implantation precedes induction of insulin-like growth factor II gene expression in human trophoblasts. Development 105:555-562. Oka H, Shiozaki H, Kobayashi K, Inoue M, Tahara H, Kobayashi T, Takatsuka Y, Matsuyoshi N, Hirano S, Takeichi M, Mori Takesada (1993) Expression of Ecadherin cell adhesion molecules in human breast cancer tissues and its relationship to metastasis. Cancer Res 53:1696-1701.  201  Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA (2008) Loss of Ecadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Res 68:3645-3654. Onodera S, Sasaki T, Tashiro S (1997) Isolation and immunochemical characterization of heparin sulphate rich proteoglycan (HSPG) present in the basement membrane of human placenta. Biol Pharm Bull 20:113-117. Osato M , Ito Y (2005) Increased dosage of the RUNX1/AML1 gene: A third mode of RUNX leukemia? Critical Rev in Eukaryotic Gene Exp 15:217-228. Ota I, Li XY, Hu Y, Weiss SJ (2009) Induction of a MT1-MMP and MT2-MMPdependent basement membrane transmigration program in cancer cells by Snail1. Proc Natl Acad Sci USA 106:20218-20323. Otto F, Kanegane H, Mundlos S (2002) Mutations in the RUNX2 gene in patients with cleidocranial dysplasia. Hum Mutat 19:209-216. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ (1997) Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89:765-771. Ozawa M (1998) Identification of the region of alpha-catenin that plays an essential role in cadherin-mediated cell adhesion. J Biol Chem 273:29524-29529. Ozawa M, Baribault H, Kemler R (1989) The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO 8:1711-1717. Palmar AE, London WT, Sly DL, Rice JM (1979) Spontaneous preeclamptic toxaemia of pregnancy in the patas monkey (Erythrocebus patas). Lab Anim Sci 29:102-106. Pattillo RA, Gey GO (1968) The establishment of a cell line of human hormonesynthesizing trophoblastic cells in vitro. Cancer Res 28:1231-1236. Peinado H, Olmeda D, Cano A (2007) Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelail phenotype? Nat Rev Cancer 7:415-428. Pelosi G, Scarpa A, Puppa G, Veronesi G, Spaggiari L, Pasini F, Maisonneuve P, Iannucci A, Arrigoni G, Viale G (2005) Alteration of the E-cadherin/beta-catenin cell adhesion system is common in palmonary neuroendocrine tumors and is an independent predictor of lymph node metastasis in atypical carcinoids. Cancer 103:1154-1164.  202  Petraglia F, Florio P, Nappi C, Genazzani A (1996) Peptide signalling in human placenta and membranes: autocrine, paracrine, and endocrine mechanisms. Endocr Rev 17:156-186. Petraglia F, Garuti G, Calza L, Roberts V, Giadino L, Genazzani A, Vale W, Meunier H (1991) Inhibin subunits in human placenta: localization and messenger ribonucleic acid levels during pregnancy. Am J Obstet Gynecol 165:750-758 Pijnenborg R, Vercruysse L, Hanssens M (2006) The uterine spiral arteries in human pregnancy: facts and controversies. Placenta 12:939-958. Pijnenborg R, Luyten C, Vercruysse L, van Assche FA (1996) Attcahment and differentiation in vitro of trophoblast from nomal and preeclamptic human placentas. Am J Obstet Gynecol 175:30-36. Pijnenborg R (1994) Trophoblastic invasion. Reprod Med Rev 3:53-73. Pijnenborg R (1990) Trophoblast invasion and placentation in the human: morphological aspects. In: trophoblast invasion and endometrial receptivity. Eds. Denker H-W, and Aplin JD. Trophoblast Research 4:33-47. Plenum, New York. Pijnenborg R, Bland JM, Robertson, WB, Brosens I (1983) Uteroplacental arteriole changes related to interstitial trophoblast migration in early human pregnancy. Placenta 4:387-414. Pijnenborg R, Bland JM, Robertson WB, Dixon G, Brosens I (1981) The pattern of interstitial trophoblast invasion in early human pregnancy. Placenta 2:303-316. Pijnenborg R, Dixon G, Robertson W, Brosens I (1980). Trophoblastic invasion of human deciduas from 8 to 18 weeks of pregnancy. Placenta 1:3-19. Pouliot Y, Holland PC, Blaschuk OW (1990) Developmental regulation of a cadherin during the differentiation of skeletal myoblasts. Dev Biol 141:292-298. Pratap J, Akech J, Bedarb K, Breen M, van Wijnen AJ, Stein JL (2006b) Runx2 in breast and prostate cancer cells: Roles in adhesion, invasion and tumor activity in bone. Proc of the Amer Assoc for Cancer Res 47 article #3971 Pratap J, Lian JB, Javed A, Barnes GL, van Wijnen AJ, Stein JL, Stein GS (2006a) Regulatory roles of Runx2 in metastasic tumor and cancer cell interactions with bone. Cancer Metastasis Rev 25:589-600. Pratap J, Javed A, Languino LR, Wijnen AJ, Stein JL, Stein GS, Lian JB (2005) The runx2 osteogenic transcription factor regulates matrix metalloproteinase 9 in bone metastatic cancer cells and controls cell invasion. Mol Cell Biol 25:8581-8591.  203  Pratab J, Galindo M, Zaidi SK, Vradii D, Bhat BM, Robinson JA (2003) Cell growth regulatory role of Runx2 during proliferative expansion of pre-osteoblasts. Cancer Res 63:5357-5362. Puisieux A, Valsesia-Mittmann S, Ansieau S (2006) A twist for survival and cancer progression. Br J Cancer 94:13-17. Radice G, Ferreira-Cornwell M, Robinson S, Rayburn H Chodosh L, Takeichi M, Hynes R (1997b) Precocious mammary gland development in P-cadherin-deficient mice. J Cell Biol 139:1025-1032. Radice G, Rayburn H, Matsunami H, Knudsen K, Takeichi M, Hynes R (1997a) Developmental defects in mouse embryos lacking N-cadherin. Dev Biol 181:64-78. Radisky DC (2005) Epithelial-mesenchymal transition. J Cell Sci 118:4325-4326. Rebut-Bonneton C, Boutemy-Roulier S, Evain-Brion D (1993) Modulation of pp60csrc activity and the cellular localization during differentiation of human trophoblast cells in culture. J Cell Science 105:629-636. Redline RW, Lu CY (1989) Localization of the fetal major histocompatibility complex antigens and maternal leukocytes in murine placenta. Implications for maternal-fetal immunological relationship. Lab Invest 61:27-36. Richart R (1961) Studies of placental morphogenesis I. Radioautographic studies of human placenta utilizing tritiated thymidine. Proc of the Society for Exp Biol and Med 106:829-831. Rieger-Christ KM, Lee P, Zagha R, Kosakowski M, Moinzadeh A, Stoffel J, BenZe’ev A, Libertino JA, Summerhayes IC (2004) Novel expression of N-cadherin elicits in vitro bladder cell invasion via the AKT signalling pathway. Oncogene 23:4745-4753. Riethmacher D, Brinkmann V, Birchmeier C (1995) A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development. Proc Natl Acad Sci USA 92:855-859. Ringler G, Strauss Jr (1990) In vitro systems for the study of human placental endocrine function. Endocr Rev 11:105-123. Roberston WB, Khong TY, Brosens I, De Wolf F, Sheppard BL, Bonnar J (1986) The placental bed biopsy: review from three European centres. Am J Obstet Gynecol 155: 401-412. Rosen PP, Groshen S, Saigo PE, Kinne DW, Hellman S (1989) Pathological prognostic factors in stage I (T1N0M0) and stage II (T1N1M0) breast carcinoma: a study of 644 patients with medium follow-up of 18 years. J ClinOncol 7:1239-1251.  204  Rosivatz E, Becker I, Bamba M, Schott C, Diebold J, Mayr D, Hofler H, Becker K (2004) Neoexpression of n-cadherin in E-cadherin positive colon cancers. Int J Cancer 111:711-719. Rosivatz E, Becker I, Specht K, Fricke E, Luber B, Busch R, Hofler H, Becker KF (2002) Differential expression of the epithelial-mesencchymal transition regulators snail, SIP1 and twist in gastric cancer. Am J Pathol 161:1881-1891. Rossant J, Cross JC (2001) Placental development: lessons from mouse mutants. Nat Rev Genet 2:538-548. Sakuragi N, Nishiya M, Ikeda K, Ohkouch T, Furth EE, Hareyama H, Satoh C, Fujimoto S (1994) Decreased E-cadherin expression in endometrial carcinoma is associated with tumor dedifferentiation and deep myometrial invasion. Gynecol Oncol 53:183-189. Salafia C, Maier D, Vogel C, Pezzullo J, Burns J, Silberman L (1993) Placental and decidual histology in spontaneous abortion: detailed description and correlations with chromosome number. Am J Obstet Gynecol 82:295-303. Salamonsen LA, Dimitriadis E, Jones TL, Nie G (2003) Complex regulation of decidualization: a role for cytokines and proteases-a review. Placenta (Suppl. A), S76S85. Salamonsen LA, Dimitriadis E and Robb L (2000) Cytokines in implantation. Sem Reprod Med 18:299-310. Sandig M, Voura E, Kalnis V, Siu C (1997) Role of cadherins in the transendothelial migration of melanoma cells in culture. Cell Motil Cytoskeleton 38:351-364. Sarto GE, Stubblefield PA, Therman E (1982) Endomitosis in human trophoblast. Hum Genet 62:228-232. Satake M, Nomura S, Yamaguchi- Iwai Y, Takahama Y, Hashimoto Y, Niki M, Kitamura Y, Ito Y (1995) Expression of the Runt domain-encoding PEBP2 alpha genes in T cells during thymic development. Mol Cell Biol 15:1662-1670. Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M (1994) A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature 370:61-65. Satoru K, Junko S, Satoshi O, Yasunari M, Yoshiko M, Manabu H, Mitsuhiro N, Masahiro T, Miki N, Kenkichi M, Masaki I (2006) High Twist expression is involved infiltrative endometrial cancer and affects patient survival. Hum Path 37:431-438.  205  Sawicki G, Radomski MW, Winten-Lowen B, Krzymien A, Guilbert LJ (2000) Polarized release of matrix metalloproteinase-2 and -9 from cultured human placental syncytiotrophoblast. Biol Reprod 63:1390-1395. Schipper JH, Frixen UH, Behrens J, Unger A, Jahnke K, Birchmeier W (1991) Ecadherin expression in squamous cell carcinomas of head and neck: inverse correlation with tumor dedifferentiation and lymph node metastasis. Cancer Res 51:6328-6337. Schlafke S, Enders A (1975) Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 12:41-65. Seamon K, Padgett W, Daly J (1981) Forskolin: unique diterpene activator of adenylate cyclase in membranes and in intact cells. Proc Natl Acad Sci USA 78:3363-3367. Seidl DC, Hughes HC, Bertolet R, Lang CM (1979) True pregnancy toxaemia (preeclampsia) in the guinea pig (cavia porcellus). Lab Anim Sci 24:686-697. Selvamurugan N, Kwok S, Alliston T, Reiss M, Partridge NC (2004) Transforming growth factor-beta 1 regulation of collagenase-3 expression in osteoblastic cells by crosstalk between the Smad and MAPK signalling pathways and their components, Smad2 and Runx2. J Biol Chem 279:19327-19334. Seto ML, Hing AV, Change J, Hu Ming, Kapp-Simon KA, Patel PK, Burton BK, Kane AA, Smyth MD, Hopper R, Ellenbogen RG, Stevenson K, Speltz ML, Cunningham ML (2007) Isolation sagittal and coronal craniosynostosis associated with Twist Box mutations. Amer J Med Gen 143:678-686. Shibamoto S, Hayakawa M, Takeuchi K, Hori T, Miyazawa K, Kitamura N, Johnson KR, Wheelock MJ, Matsuyoshi N, Takeichi M, Ito F (1995) Association of p120, a tyrosine kinase substrate, with E-cadherin/catenin complexes. J Cell Biol 128:949-957. Shih IM, Hsu MY, Oldt RJ3rd, Herlyn M, Gearhart JD, Kurman RJ (2002) The Role of E-cadherin in the Motility and Invasion of Implantation Site Intermediate Trophoblast. Placenta 23:706-715. Shih IM, Kurman RJ (1996) Expression of melanoma cell adhesion molecule in intermediate trophoblast. Lab Invest 75:377-388. Shimonovitz S, Hurwitz A, Dushnik M, Anteby E, Geva-Eldar T, Yagel S (1994) Developmental regulation of the expression of 72 and 92 kDa type collagenases in human trophoblast invasion. Am J Obstet Gynecol 171:832-838. Simon C, Frances A, Piquette G, Hendrickson M, Milki A, Polan ML (1994) Interleukin-1 system in the materno-trophoblast unit in human implantation:  206  immunohistochemical evidence for autocrine/paracrine function. J Clin Endocrinol Metab 78:847-854. Simpson R, Mayhew T, Barnes P (1992) From 13 weeks to term, the trophoblast of human placenta grows by the continuous recruitment of new proliferative units: a study of nuclear number using the disector. Placenta 13:501-512. Skrzypczak J, Mikolajczyk M, Szmanowski K (2001) Endometrial receptivity: expression of alpha3beta1, alpha4beta1 and alphaVbeta1 endometrial integrins in women with impaired fertility. Reprod Biol 1:85-94. Soo K, O’Rourke MP, Khoo PL, Steiner KA, Wong N, Behringer RR, Tam R (2002) Twist funtion is required for the morphogenesis of the cephalic neural tube and the differentiation of the cranial neural crest cells in the mouse embryo. Dev Biol 247:251-270. Souchelnytskyi S, Rönnstrand L, Heldin CH, ten Dijke P (2001) Phosphorylation of Smad signaling proteins by receptor serine/threonine kinases. Methods Mol Biol 124: 107–20. Spencer VA, Davie JR (2000) Signal transduction pathways and chromatin structure in cancer cells. J Chem Biol Supp 35:27-35. Springman EB, Angleton EL, Birkedal-Hansen H, van Wart HE (1990) Multiple modes of activation of latent human fibroblast collagenase: evidence for the role of a Cys73 active-site zinc complex in latency and a “cysteine switch” mechanism for activation. Proc Natl Acad Sci USA 87:364-368. Staun-Ram E, Goldman S, Gabarin D, Shalev E (2004) Expression and importance of matrix mattaloproteinase 2 and 9 (MMP-2 and -9) in human trophoblast invasion. Repro Biol and Edocrinol 2:59. Steinberg MS and Takeichi M (1994) Experimental specification of cell sorting, tissue spreading, and specific spatial patterning by quantitative difference in cadherin expression. Proc Natl Acad Sci USA 91:206-209. Stephens LE, Sutherland AE, Klimanskaya IV, Andrieux A, Meneses J, Pedersen RA, Damsky CH (1995) Deletion of beta 1 integrin in mice results in inner cell mass failure and preiimplantation lethality. Genes Dev 9:1883-1895. Sternlicht MD, Werb Z (2001) How matrix mettaloproteinases regulate cell behaviour. Annu Rev Cell Dev Biol 17:463-516. Stout C, Lemmon WB (1969) Glomerular capillary endothelial swelling in a pregnant chimpanzee. Am J Obstet Gynecol 105:212-215.  207  Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA, Goldberg GI (1995) Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270:5331-5338. Subramaniam MM, Chan JY, Yeoh KG, Quek T, Ito K, Salto-Tellez M (2009) Molecular pathology of RUNX3 in human carcinogenesis. Biochimica et Biophysica Acta-Revs on Cancer 1796:315-331. Suda T, Takahashi N, Martin TJ (1997) Modulation of osteoclast differentiation. Endocr Rev 13:66-80. Sullivan R, Graham CH (2007) Hypoxia-driven selection of the metastatic phenotype. Cancer Metastasis Rev 26:319-331. Sun L, Vitolo M, Passaniti A (2001) Runt-related gene 2 in endothelial cells: inducible expression and specific regulation of cell migration and invasion. Cancer Res 61:49945001. Suyama K, Shapiro I, Guttman M, Hazan R (2002) A signalling pathway leading to metastasis is controlled by N-cadherin and the FGF receptor. Cancer Cell 2:301-314. Suzuki S, Sano K, Tanihara H (1991) Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Regul 2:261-270. Suzuki ST (1996) Structural and functional diversity of cadherin superfamily: are new members of cadherin superfamily involved in signal transduction pathway? J Cell Biochem 61:531-542. Takeichi M (1995) Morphogenetic roles of the classical cadherins. Curr Opin Cell Biol 7:619-627. Takeichi M (1993) Cadherins in cancer: implications for invasion and metastasis implications for invasion and metastasis. Curr Opin Cell Biol 5:806-811. Takeichi M (1991) Cadherin cell adhesion receptors as a morphogenetic regulator. Science 251:1451-1455. Takeichi M (1990) Cadherins: a molecule family important in selective cell-cell adhesion. Annu Rev Biochem 59:237-252. Takeichi M (1988) The cadherin: cell-cell adhesion molecules controlling animal morphogenesis. Development 102:639-655. Takino T, Sato H, Shinagawa A, Seiki M (1995) Identification of the second membrane-type matrix metalloproteinase (MT-MMP2) gene from a human placenta cDNA library. J Biol Chem 270:23013-23020.  208  Tamura G, Yin J, Wang S, Fleisher AS, Zou T, Abraham JM, Kong D, Smolinski KN, Wilson KT, James SP, Silverberg SG, Nishizuka S, Terashima M, Motoyama T, Meltzer SJ (2000) E-cadherin gene promoter hypermethylation in primary human gastric carcinomas. J Natl Cancer Inst (Bethesda) 92:569-573. Tarrade A, Goffin F, Munaut C, lai-Kuen R, Tricottet V, Foidart JM (2002) Effects of metrigel on human extravillous trophoblasts differentiation: modulation of protease pattern gene expression. Biol Reprod 67:1628-1637. Thiery JP, Morgan M (2004) Breast cancer preogression with a Twist. Nat Med 10:777778. Thiery JP (2003) Epithelail-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol 15:740-746. Thiery JP (2002) Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2:442-454. Thisse B, Stoetzel C, Gorostiza-Thisse C, Perrin-Schmitt F (1988) Sequence of the twist gene and nuclear localization of its protein in endomesodermal cells of early twsit gene and nuclear localization of its protein in endomesodermal cells of early Drosophila embryos. EMBO J 7:2175-2183. Thisse B, el Messal M, Perrin-Schmitt F (1987) The twist gene: isolation of a Drosophila zygotic gene necessary for the establishment of dorsoventral pattern. Nucleic Acids Res 15:3439-3453. Tomita K, van Bokhoven A, van Leenders GJ, Ruijter ET, Jansen CF, Bussemakers MJ, Schalken JA (2000) Cadherin switching in human prostate cancer progression. Cancer Res 60:3650-3654. Tong KI, Yau P, Overduin M, Bagby S, Porumb T, Takechi M, Ikura M (1994) Purification and spectroscopic characterization of a recombinant amino-terminal polypeptide fragment of mouse epithelail cadherin. FEBS Lett 352:318-322. Tran NL, Adams DG, Vaillancourt RR, Heimark RL (2002) Signal transduction from N-cadherin increases Bcl-2. Regulation of the phosphatidylinositol 3-kinase/Akt pathway by homophilic adhesion and actin cytoskeletal organization. J Biol Chem 277:3290532914. Tran NL, Nagle RB, Cress AE, Heimark RL (1999) N-cadherin expression in human prostate carcinoma cell lines: an epithelial-mesenchymal transformation mediating adhesion with stromal cells. Am J pathol 155:787-798. van der Deen M, Akech J, Wang T, Fitzgerald TJ, Altieri DC, Languino LR, Lian JB, van Wijnen AJ, Stein JL, Stein GS (2010) The cancer-related Runx2 protein  209  enhances cell growth and responses to androgen and TGFβ in prostate cancer cells. J Cell Biochem 109:828-837. . van der Flier A, Sonnenberg A (2001) Function and interactions of integrins. Cell and Tissue Res 305:285-298. van Lijnschoten G, Evers J, Menheere P, Geraedts J (1994) Occult abortion: not a major cause of infertility. Fertil Steril 62:1271-1273. Vargas A, Moreau J, Landry S, Lebellego F, Toufaily C, Rassart E, Lafond, Barbeau (2009) Syncytin-2 plays an important role in the fusion of human trophoblast cells. J Mol Biol 392:301-318. Varki A (1994) Selectin ligands. Proc Natl Acad Sci USA 91:7390-7397. Vasselli JD, Sappino AP, Belin D (1991) The plasminogen activator/plasmin system. J Clin Invest 88:1067-1072. Vaughn SP, Broussard S, Hall CR, Scott A, Blanton SH, Milunsky JM, Hecht JT (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics 66:119-121. Vestweber D, Kemler R (1984) Rabbit antiserum against a purified surface glycoprotein decompacts mouse preimplantation embryos and reacts with specific adult tissues. Expl Cell Res 152:169-178. Vestweber D (1992) Selectin: cell surface lectins which mediate the binding of leukocytes to endothelial cells. Semin Cell Biol 3:211-220. Vesuna F, van Diest P, Chen JH, Raman V (2008) Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem and Biophysic Res Comm 367:235-241. Virtanen I, Laitinen L, Vartio T (1988) Differential expression of the extracellular domain-containing form of cellular fibronectin in human placenta at different stages of maturation. Histochemistry 90:25-30. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J-I, Chen ZJ (2003) TAK1 is ubiquitin-dependent kinase of MKK and IKK. Nature 412:346-351. Wang Z, Juttermann R, Soloway PD (2000) TIMP-2 is required for efficient activation of proMMP-2 in vivo. J Biol Chem 275: 26411-26415. Whiteside EJ, Kan M, Jackson MM, Thompson JG, McNaughton C, Herington AC, Harvey MB (1996) Urokinase-type plaminogen activator (uPA) and matrix  210  metalloproteinase-9 (MMP-9) expression and activity during early embryo development in the cow. Anat Embryol 204: 477-483. Wice B, Menton D, Geuze H, Schwartz AL (1990) Modulators of cyclic AMP metabolism induce syncytiotrophoblast formation in vitro. Exp Cell Res 186:306-316. Wijnhoven BP, Dinjens WN, Pignatelli M (2000) E-cadherin-catenin cell-cell adhesion complex and human cancer. Br J Surg 87:992-1005. Wilson NF, Snell WJ (1998) Microvilli and cell-cell fusion during fertilization. Trends Cell Biol 8:93-97. Witcher LL, Collins R, Puttagunta S, Mechanic SE, Munson M, Gumbiner B, Cowin P (1996) Desmosomal cadherin binding domains of plakoglobin. J Biol Chem 271:10904-10909. Wotton SF, Blyth K, Kilbey A, Jenkins A, Terry A Bernardin-Fried F (2004) Runx1 transformation of primary embryonic fibroblasts is revealed I nthe absence of p53. Oncogen 23:5476-5486. Wrana JL, Attisano L, Carcamo J, Zentella A, Doody J, Laiho M, Wang XF, Massaque J (1992) TGF beta signals through a heteromeric protein kinase receptor complex. Cell 71: 1003-1014. Xiao G, Jiang D, Thomas P, Benson MD, Guan K, Karsenty G, Franceschi RT (2000) Fibroblast growth factor 2 induction of the osteocalcin gene requires MAPK activity and phosphorylation of the osteoblast transcription factor, Cbfa1/Runx2 . J Biol Chem 275:4453-4459. Xu G, Guimond M, Chakraborty C, Lala P (2002) Control of proliferation, migration and invasiveness of human extravillous trophoblast by decorin, a decidual product. Biol Reprod 67:681-689. Xu P, Wand Y, Zhu S, Luo S, Piao Y, Zhuang L (2000) Expression of Matrix Metalloproteinase-2, -9, and -14, Tissue Inhibitors of metalloproteinases-1, and matrix proteins in human placenta during the first trimester . Biol of Reprod 62:988-994. Xue WC, Feng HC, Tsao SW, Chan KYK, Ngan HYS, Chiu PM, MacCalman CD, Cheung ANY (2003) Methylation status and expression of E-cadherin and cadherin-11 in gestational trophoblastic diseases. Int J Gynecol Cancer 13:879-888. Yagel S, Casper RF, Powel W, Parhar RS and Lala PK (1989) Characterization of pure human first-trimester cytotrophoblast cells in long-term culture: growth pattern, markers, and hormone production. Am J Obstet Gynecol 160: 938-945.  211  Yagi T, Takeichi M (2000) Cadherin superfamily genes: functions, genomic organization and neurologic diversity. Gene Dev 14:1169-1180. Yamada T, Isemura M, Yamaguchi Y, Munakata H, Hayashi N, Kyogoku M (1987) Immunohistochemical localization of fibronectin in the human placentas at their different stages of maturation. Histochemistry 86:579-584. Yanagimoto K, Sato Y, Shimoyama Y, Tsuchiya B, Kuwao S, Kameya T (2001) Coexpression of N-cadherin and alpha-fetoprotein in stomach cancer. Pathol Int 51:612618. Yanagisawa M, Anastasiadis P (2006) p120 catenin is essential for mesenchymal cadherin-mediated regulation of cell mortility and invasivesness. J Cell Biol 174:10871096. Yang J, Mani SA, Weinberg RA (2006) Exploring a New Twist on Tumor Metastasis. Cancer Res 66:4549-4552. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA (2004) Twist, a master regulator of mophogenesis, plays essential role in tumor metastasis. Cell 117:927-939. Yang Z, Zhang X, Gang H, Li X, Li Z, Wang T, Han J, Luo T, Wen F, Wu X (2007) Up-regulaton of gastric cancer cell invasion by Twist is accompanied by N-cdherin and fibronectin expression. Biochem and Biophy Res Comm 358:925-930. Yap AS, Niessen CM, Gumbiner BM (1998) The juxtamembrane region of the cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and interaction with p120ctn. J Cell Biol 141:779-789. Ye Y, Xiao Y, Wang W, Yearsley K, Gao JX, Shetuni B, Barsky SH (2010) ERalpha signalling through slug regulates E-cad and EMT. Oncogene 29:1451-1462. Yeung F, Law WK, Yeh CH, Westendorf JJ, Zhang Y, Wang R, Kao C, Chung LW (2002) Regulation of human osteocalcin promoter in hormone-independent human prostate cancer cells. J Biol Chem 277:2468-2476. Yoshida T, Phylactou LA, Uney JB, Ishikawa I, Eto K, Iseki S (2005) Twist is required for establishment of the mouse coronal suture. J Anat 206:437-444. Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirihashi S (1995) Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinoma. Proc Natl Acad Sci USA 9:7416-7419. Young DW, Hassan MQ, Pratap J, Galindo M, Zaidi SK, Lee SH, Yang X, Xie R, Javed A, Underwood JM, Furcinitti P, Imbalzano AN, Penman S, Nickerson J, Montecino M, Lian J, Stein JL, van Wijnen AJ, Stein GS (2007) Mitotic occupancy  212  and lineage-specific transcriptional control of rRNA genes by Runx2. J Biol Chem 277:2468-2476. Young DW, Pratap J, Javed A, Weiner B, Ohkawa Y, van Wijnen A (2005) SWI/SNF chromatin remodelling complex is obligatory for BMP2-induced, Runx2dependent sckeletal gene expression that controls obteoblast differentiation. J Cell Biochem 94:720-730. Yousfi M, Lasmoles F, Kern B, Marie PJ (2002) Twist inactivation reduces CBFA1/RUNX2 expression and DNA binding to the osteocalcin promoter in osteoblasts. Biochem and Biophy Res Comm 297:641-644. Yousfi M, Lasmoles F, Lomri A, Delannoy Marie PJ (2001) Increased bone formation and decreased osteocalcin expression induced by reduced Twist dosage in saethrechotzen syndrome. The J Clin Invest 107:1153-1161. Yuen HF, Chua CW, Chan YP, Wong YC, Wang X, Chan KW (2007) Significance of Twist and E-cadherin expression in the metastatic progression of prostatic cancer. Histopathology 50:648-658. Yui J, Garcia-Lloret M, Brown AJ, Berdan RC, Morrish DW, Wegmann TG, Guilbert LJ (1994) Functional, long-term cultures of human trophoblasts purified by column-elimination of CD-9 expressing cells. Placenta 15:231-246. Zaidi SK, Young Dw, Choi JY, Pratap J, Javed A, Montecino M, Stein JL, Lian JB, van Wijnen AJ, Stein GS (2004) Intranuclear trafficking: organization and assembly of regulatory machinery for combinatorial biological control. J Biol Chem 279:4336343366. Zaidi SK, Young Dw, Pockwinse SM, Javed A, Lian JB, Stein JL, van Wijnen AJ, Stein GS (2003) Mitotic partitioning and selective reorganization of tissue-specific transcription factors in progeny cells. Proc Natl Acad Sci USA 100:14852-14857. Zaidi SK, Sullivan AJ, van Wijnen AJ, Stein GS, Lian JB (2002) Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites. Proc Natl Acad Sci USA 99:8048-8053. Zaidi SK, Javed A, Choi JY, van Wijnen A, Stein JL, Lian JB, Stein GS (2001) A specific targeting signal directs Runx2/ Cbfa1 to subnuclear domains and contributes to transactivation of the osteocalcin gene. J Cell Sci 114:3093-3102. Zeitvogel A, Baumann R, Starzinski-Powitz A (2001) Identification of an invasive, Ncadherin expressing epithelial cell type in endometriosis using a new cell culture model. Am J Pathol 159:1839-1852.  213  Zelzer E, Glotzer DJ, Hartmann C, Thomas D, Fukai N, Soker S, Olsen BR (2001) Tissue specific regulation of VEGF expression during bone development requires Cbfa1/Runx2. Mechanisms of Development 106:97-106. Zhang Z, Xie D, Li X, Wong YC, Xin D, Guan XY, Chua CW, Leung SC, NA Y, Wang X (2007) Significance of TWIST expression and its association with E-cadherin in bladder Cancer. Hum Pathol 38:598-606. Zhou Y, Fisher SJ, Janatpour M, Genbacev O, Dejana E, Wheelock M, Damsky CH (1997) Human cytotrophoblast adopt a vascular phenotype as they differentiate: a strategy for successful endvascular invasion? J Clin Invest 99:2139-2151.  214  APPENDIX The University of British Columbia Office of Research Services Clinical Research Ethics Board – Room 210, 828 West 10th Avenue, Vancouver, BC V5Z 1L8  ETHICS CERTIFICATE OF FULL BOARD APPROVAL: RENEWAL PRINCIPAL INVESTIGATOR: DEPARTMENT: UBC CREB NUMBER: UBC/Medicine, Faculty H06-70260 Colin D. MacCalman of/Obstetrics & Gynaecology INSTITUTION(S) WHERE RESEARCH WILL BE CARRIED OUT: Institution  N/A  Site  N/A  Other locations where the research will be conducted:  N/A  CO-INVESTIGATOR(S):  Hua Zhu York HUNT Ng Fatemeh K. Khatibi SPONSORING AGENCIES:  - Canadian Institutes of Health Research (CIHR) - "Structure, Function and Regulation of the Cadherin-11 Complex in the Human Placenta" - Canadian Institutes of Health Research (CIHR) - "Structure, function and regulation of the cadherin-11 complex in the human placenta" PROJECT TITLE: Structure, Function and Regulation of the Cadherin-11 Complex in the Human Placenta THE CURRENT UBC CREB APPROVAL FOR THIS STUDY EXPIRES: January 27, 2010 The UBC Clinical Research Ethics Board Chair or Associate Chair, has reviewed the above described research project, including associated documentation noted below, and finds the research project acceptable on ethical grounds for research involving human subjects and hereby grants approval. DOCUMENTS INCLUDED IN THIS APPROVAL: APPROVAL DATE: N/A February 17, 2009 CERTIFICATION: In respect of clinical trials: 1. The membership of this Research Ethics Board complies with the membership requirements for Research Ethics Boards defined in Division 5 of the Food and Drug Regulations. 2. The Research Ethics Board carries out its functions in a manner consistent with Good Clinical Practices. 3. This Research Ethics Board has reviewed and approved the clinical trial protocol and informed  215  consent form for the trial which is to be conducted by the qualified investigator named above at the specified clinical trial site. This approval and the views of this Research Ethics Board have been documented in writing. The UBC Clinical Research Ethics Board has reviewed the documentation for the above named project. The research study, as presented in the documentation, was found to be acceptable on ethical grounds for research involving human subjects and was approved for renewal by the UBC Clinical Research Ethics Board.  Approval of the Clinical Research Ethics Board by :  Dr. Gail Bellward, Chair  216  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items