UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Integrin Linked Kinase as a therapeutic target for treating breast cancer : the value of using multiple… Kalra, Jessica 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_kalra_jessica.pdf [ 4.26MB ]
Metadata
JSON: 24-1.0071056.json
JSON-LD: 24-1.0071056-ld.json
RDF/XML (Pretty): 24-1.0071056-rdf.xml
RDF/JSON: 24-1.0071056-rdf.json
Turtle: 24-1.0071056-turtle.txt
N-Triples: 24-1.0071056-rdf-ntriples.txt
Original Record: 24-1.0071056-source.json
Full Text
24-1.0071056-fulltext.txt
Citation
24-1.0071056.ris

Full Text

INTEGRIN LINKED KINASE AS A THERAPEUTIC TARGET FOR TREATING BREAST CANCER: THE VALUE OF USING MULTIPLE ENDPOINTS TO ASSESS THERAPEUTIC EFFECTS OF TARGETED DRUGS AND DRUG COMBINATIONS  by  Jessica Kalra MSc. Science, University of Western Ontario, 2004 BSc. (Hons.), University of Waterloo, 1998  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES  (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (VANCOUVER) July 2010 ©Jessica Kalra 2010  i  ABSTRACT Substantial preclinical evidence indicates that inhibition of Integrin Linked-Kinase (ILK) correlates with cytotoxic/cytostatic cellular effects, delayed tumour growth in animal models of cancer and inhibition of angiogenesis. It is increasingly evident that optimal therapeutic benefits obtained using ILK targeting strategies will only be achieved in combination settings. For this reason the therapeutic potential of the ILK small molecule inhibitor, QLT0267, alone or in combination with chemotherapies commonly used to treat breast cancer patients was investigated. The results suggested that the combination of QLT0267 and docetaxel (Dt) interacted synergistically when assessing metabolic activity as a therapeutic endpoint. Further endpoint analysis in cell lines with low Her2/neu levels revealed that the QLT0267/Dt combinations resulted in a 3- fold decrease in concentration of QLT0267 required to achieve 50% inhibition of P-AKT. For Her2/neu positive cell lines the QLT0267/Dt combination was antagonistic. In vivo studies using breast cancer cells (LCC6) implanted orthotopically demonstrated that treatment with QLT0267/Dt engendered improved therapeutic effects. Using luciferase positive LCC6 cells metastatic, orthotopic and ascites tumour models were characterized. The results suggested that the orthotopic LCC6 tumour model was most sensitive to docetaxel. Using the more docetaxel treatment refractory LCC6 model (disseminated disease) it was shown that QLT0267 could not sensitize the tumours to Dt treatment. These data suggest that clinical benefits of QLT0267/Dt in patients with breast cancer would most likely be observed used in the adjuvant or neoadjuvant setting. Finally, preliminary studies indicate that the effects of QLT0267 were influenced by Her2/neu expression. To understand how, six Her2/neu positive breast cancer cell  ii  lines were evaluated following treatment with QLT0267. These cell lines demonstrated suppression (32 to 87%) of total Her2/neu protein.  Attenuation of ILK activity or  expression was associated with decreases in YB-1 protein and transcript levels and decreased YB-1 promoter activity. YB-1 is a known transcriptional regulator of Her2/neu expression. ILK inhibition also engendered suppression in TWIST (a regulator of YB-1 expression) protein expression. Taken together, these data indicate that ILK regulates the expression of Her2/neu through TWIST and YB-1, lending support to the use of ILK inhibitors in the treatment of aggressive Her2/neu positive tumours.  iii  TABLE OF CONTENTS ABSTRACT..................................................................................................................... ii TABLE OF CONTENTS ................................................................................................. iv LIST OF TABLES........................................................................................................... vi LIST OF FIGURES ....................................................................................................... vii ABBREVIATIONS .......................................................................................................... x ACKNOWLEDGEMENTS ............................................................................................ xiii CO-AUTHORSHIP STATEMENT ................................................................................ xiv CHAPTER 1................................................................................................................... 1 1.1 Overview .............................................................................................................. 1 1.2 Hypothesis ........................................................................................................... 4 1.3 Specific Research Aims ........................................................................................ 4 1.4 Breast Cancer ...................................................................................................... 5 1.4.1 The Human Breast ......................................................................................... 7 1.4.2 Etiology and Pathogenesis of Breast Cancer ............................................... 11 1.4.3 Histological Types of Breast Cancer ............................................................ 17 1.4.4 Prognostic and Predictive Factors: Identification of Molecular Targets ......... 18 1.4.5 Current Treatment Options for Patients with Breast Cancer ......................... 23 1.5 Next Generation Therapeutics ............................................................................ 28 1.5.1 Combination Chemotherapy and Analysis of Drug-Drug Interactions ........... 29 1.5.2 Targeting Integrin Linked Kinase as a Means to Treat Breast Cancer .......... 33 1.5.3 ILK Structure and Function .......................................................................... 33 1.5.4 The role of ILK in Normal Tissues ................................................................ 36 1.5.5 ILK in Carcinogenesis and Role in Human Cancers ..................................... 38 1.5.6 Targeting ILK for Treatment of Cancer ......................................................... 40 1.6 Summary ............................................................................................................ 44 1.7 Significant Outcomes .......................................................................................... 46 1.8 References ......................................................................................................... 48 CHAPTER 2 QLT0267, a small molecule inhibitor targeting Integrin-Linked Kinase (ILK), and Docetaxel can combine to produce synergistic interactions linked to enhanced cytotoxicity, reductions in P-AKT levels, altered F-actin architecture and improved treatment outcomes in an orthotopic breast cancer model.* ......................................... 64 2.1 Introduction ........................................................................................................ 64 2.2 Materials and Methods ....................................................................................... 66 2.3 Results ............................................................................................................... 74 2.4 Discussion ........................................................................................................ 101 2.5 References ....................................................................................................... 106 CHAPTER 3 Validating the use of a luciferase labeled breast cancer cell line, MDA435LCC6, as a means to monitor tumour progression and to assess the therapeutic activity of an established anticancer drug, docetaxel (Dt) alone or in combination with the ILK inhibitor, QLT0267.*............................................................ 110 3.1 Introduction ...................................................................................................... 110 3.2 Materials and Methods ..................................................................................... 112 3.3 Results ............................................................................................................. 121 3.4 Discussion ........................................................................................................ 135  iv  3.5 References ....................................................................................................... 143 CHAPTER 4 Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1*....................................................................... 145 4.1 Introduction ...................................................................................................... 145 4.2 Materials and Methods ..................................................................................... 146 4.3 Results ............................................................................................................. 152 4.4 Discussion ........................................................................................................ 169 4.5 References ....................................................................................................... 176 CHAPTER 5............................................................................................................... 183 5.1 Summarizing Discussion .................................................................................. 183 5.2 Overall Significance .......................................................................................... 198 5.3 References ....................................................................................................... 200 APPENDICES ............................................................................................................ 204 Appendix A List of Publications .............................................................................. 204 Appendix B Certificate of Ethics Approval .............................................................. 206  v  LIST OF TABLES Table 1.1 Risk Factors for Breast Cancer 1 ................................................................. 14 Table 1.2 a Prognostic Factors of Breast Cancer 1 ...................................................... 19 Table 1.2b Staging of Breast Cancer 1 ........................................................................ 20 Table 1.3 Features of the Major Intrinsic Biological Subtypes of Breast Cancer .......... 22 Table 2.1 Effective Doses (ED)1 at 10, 50 and 90% Effect Levels of QLT0267 in Human Breast Tumour Cell Lines 1................................................................................... 76 Table 2.2 Synergy, Antagonism, and Additivity in LCC6 and LCC6Her2 Cells Treated With QLT0267 in Combination with Several Clinically Relevant Agents 1 ............. 79  vi  LIST OF FIGURES Figure 1.1 Breast cancer in Canada. 1. .......................................................................... 6 Figure 1.2 Anatomy of the human breast. 1 .................................................................. 8 Figure 1.3 Target molecules and the hallmarks of cancer 1 ......................................... 16 Figure 1.4 Treatment standards for early, locally advanced and advanced breast cancer. 1 ............................................................................................................... 26 Figure 1.5 Demonstration of the median effect principle and combination index values.1 ............................................................................................................................. 31 Figure 1.6 The structure ILK and its interacting partners. 1 .......................................... 34 Figure 1.7 ILK mediated signalling pathways 1 ............................................................ 37 Figure 1.8 Structure of QLT0267. 1.............................................................................. 41 Figure 2.1 Breast Cancer cells exhibit dose dependent decrease in cell viability (A) and P-AKT (B) in response to increasing concentrations of the ILK small molecule inhibitor, QLT0267 (267).1 .................................................................................... 78 Figure 2.2 Breast cancer cells treated with 267 and Docetaxel (Dt) combined at a fixed ratio and added at various concentrations exhibit synergistic effects based on a measured cell viability endpoint. 1 ........................................................................ 82 Figure 2.3 The dose reduction index (DRI) calculated using the Calcusyn program (see Methods) was used to estimate the ED50 of drugs (267 and/or Dt) against the indicated cell lines. 1 ............................................................................................ 85 Figure 2.4 LCC6 and LCC6Her2 cells were treated for 8 hours with increasing concentrations of 267 (A), Dt (B) or a fixed ratio combination of 267 and Dt (50 µmoles:1 nmoles) (C) to establish dose response curves based on and endpoint measuring suppression of P-AKT levels as determined by western blot analysis. 1 ............................................................................................................................. 87 Figure 2.5 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 cells express baseline levels of ILK, AKT, and P-AKT (A). LCC6 (B), LCC6Her2 (C), MCF-7 (D) and MCF-7Her2 (E) cells were treated for 8 hours 267 (42 µM), Dt (1 nM) or the combination of 267 and Dt. 1 ........................................................................................................................... 90 Figure 2.6 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated with 267(10µM), Dt (0.25nM) or a combination of both for 72 hours. 1................................................ 92  vii  Figure 2.7 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated for 8 hours with 267 (42 µM), Dt (1 nM) or the combination of 267 and Dt. 1 ............................................. 95 Figure 2.8 Bioluminescent imaging of orthotopic LCC6 tumours (see Methods) are shown 1 day after treatment initiation and on day 22 after treatment initiation. ..... 99 Figure 3.1 Cell growth and sensitivity to Dt in vitro. 1 ................................................ 123 Figure 3.2 Growth of LCC6WT-Luc cells in female NCr nude mice following inoculation orthotopically (o.t.) (mammary fat pad), intracardiacally (i.c.) (left ventricle), or intraperitoneally (i.p.). 1 ..................................................................................... 126  Figure 3.3 Docetaxel pharmacokinetics and distribution to sites of disease development following inoculation of LCC6WT-Luc cells via the o.t., i.c. and i.p. injection. 1 ..... 129  Figure 3.4 Dt treatment of mice (i.v. Q7D x 4 with 5 mg/kg) with established tumours developed following orthotopic (Panel A), intracardiac (Panel B) or intraperitoneal (Panel C) injection of LCC6WT-luc breast cancer cells. 1 ...................................... 132  Figure 3.5 Treatment of mice with Dt at the MTD (i.v. Q7D x 4 with 15 mg/kg). 1 ...... 134 Figure 3.6 Treatment of mice inoculated i.c. with LCC6WT-luc cells with single agent or a combination of Dt (10 mg/kg Q7D x 4) and the ILK inhibitor QLT0267 (QD x 28). 1 ........................................................................................................................... 137  Figure 4.1 1 Her2/neu expression following treatment of various breast cancer cell lines with QLT0267. .................................................................................................... 154  Figure 4.2 Pathway analysis of SKBR3 cells transiently nucleofected with 2 µg of ILK siRNA using the Amaxa Nucleofector 1 .............................................................. 157  Figure 4.3 Inhibition of ILK activity or expression influences YB-1 transcription and subcellular localization. 1 ......................................................................................... 160  Figure 4.4 Over-expression of ILK in SKBR3 cells increases YB-1 expression and nuclear localization. 1 ........................................................................................ 163  viii  Figure 4.5 Inhibition of ILK activity or expression regulates TWIST expression. 1 ...... 165  Figure 4.6 Over-expression of ILK increases TWIST expression through activation of STAT-3. 1 .......................................................................................................... 168  Figure 4.7 Proposed working model of the ILK centered regulation of Her2/neu through multiple mechanisms involving YB-1. 1 ............................................................... 175 Figure 5.1 Inhibition of ILK in combination with treatment of breast cancer cell lines with Docetaxel exhibit potentiation in inducing a cell cycle block and apoptosis. 1 ..... 187  Figure 5.2 ILK inhibition suppresses the expression of EGFR, and behaves synergistically with the EGFR inhibitor Lapatinib at low FA. 1 ............................ 196  Figure 5.3 Bioluminescent imaging shows that over short time-points QLT0267 is associated with decreases in tumour growth. 1 ................................................... 196  ix  ABBREVIATIONS 267 [3H]Dt AI AP-2 ATP AUC BAC bFGF BLI BRCA C CEF CHEK2 CI CH-ILKBP CMF CMV CREB D DCIS DMEM DMSO DPM DRI Dt ECM ED EDTA EGFR EMT ER fa FA F-actin FBS fu GAPDH GFP GSK-3 Her2/neu, c-erb-B2 Hif1α i.c. IF IHC  QLT0267 Tritium Labled Docetaxel Aromatase Inhibitor Activating Protein 2 Adenosine Triphosphate Area Under the Curve Biconic Acid Basic Fibroblast Growth Factor Bioluminescent Imaging Breast Cancer Early Onset Control Cyclophosphamide, Epirubicin, Fluorouracil Cell-cycle checkpoint kinase gene Combination Index Calponin Homology-Containing ILK-Binding Protein Cyclophosphamide, Methotrexate, Fluorouracil Cytomegalovirus cAMP Response Element Binding Dose Ductal Carcinoma In situ Dulbecco’s Modified Eagle Medium Dimethyl Sulfoxide Disintegrations Per Minute Dose Reduction Index Docetaxel Extracellular Matrix Effective Dose Ethylenediaminetetraacetic Acid Epidermal Growth Factor Receptor Epithelial to Mesenchymal Transition Estrogen Receptor Fraction Affected Focal Adhesion Filamentous Actin Fetal Bovine Serum Fraction Unaffected Glyceraldehyde 3-phosphate Dehydrogenase Green Fluorescent Protein Glycogen Synthase Kinase 3 Human Epidermal Grown Factor Hypoxia Inducible Factor 1 alpha Intracardiac Immunofluorescence Immunohistochemistry  x  ILK ILKAP i.p. i.v. IVIS LCC6 LCC6Her2 LCIS Luc LV MAPK MEP MLCK MMP mRNP s MST MTD Neg NFκB NP-40 NSCLC QD o.t. P-AKT PBS pd PDK1 PEA PFA PGs PH PI3K pk PKB PKC p.o. PTEN PR p/s/cm2/s PtdIns(3,4,5)P3 RNAi ROI RSV RT-PCR s.c.  Integrin-Linked Kinase ILK Associated Protein Intraperitoneal Intravenous In vivo Imaging System MDA MB435/LCC6 MDA MB435/LCC6 Her2/neu Lobular Carcinoma In situ Luciferin Lentivirus Mitogen-Activated Protein Kinase Median effect method Myosin Light Chain Kinase Matrix Mettaloproteinases Messenger Ribonucleic Protein Median Survival Time Maximum Tolerated Dose Negative control siRNA Nuclear Factor Kappa-Light-Chain-Enhancer Activated B Cells Nonyl Phenoxylpolyethoxylethanol Non-Small Cell Lung Carcinoma Quaque in Die Orthotopic Phosphorylated AKT (serine 473) Phosphate Buffered Saline Pharmacodynamics Phosphoinositide-Dependent Kinase 1 Pseudomonas Exotoxin A Paraformaldehyde Processing Bodies Plekstrin Homology Phosphoinositide 3 Kinase Pharmacokinetics Protein Kinase B Protein Kinase C Per Oral Phosphatase and tensin homolog Progesterone Receptor Photons/s/cm2/steradian Phosphatidylinositol-3,4,5-Trisphosphate Ribonucleic Acid Interference Region of Interest Rous Sarcoma Virus Real time Polymerase Chain Reaction Subcutaneous  of  xi  SDS SDS-PAGE SGs ShRNA Sirna STAT-3 sVEGF T TUNEL Tz v/v VEGF w/v YB-1  Sodium Dodecyl Sulfate Sodium Dodecyl Sulfate Polyacrylamide Gel Stress Granules Small Hairpin RNA Small Interfering RNA Signal Transducer and Activator of Transcription 3 Secreted VEGF Treated Terminal Deoxynucleotidyl Transferase dUTP Nick End Labelling Trastuzumab Volume to Volume Vascular Endothelial Growth Factor Weight to Volume Y-Box Binding Protein 1  xii  ACKNOWLEDGEMENTS I would like to acknowledge my advisory committee; Hayden Pritchard, Shoukat Dedhar, Karen Gelmon, Sandra Dunn, David Walker and Marcel Bally. I would like to thank Sandra Dunn for the endless encouragement and for looking after me during this process. I owe particular thanks to Dr. Marcel Bally for taking me on as a student and providing a rich environment, mentorship, guidance and a great sense of humor along the way. The past and present members of Experimental Therapeutics and Integrative Oncology at the BC Cancer Research Center as well as Anna Stratford at Child and Family Research Institute have provided tremendous support for the work presented here. I am grateful to Wieslawa Dragowska, Brent Sutherland, Maite Verrault and Catherine Tucker who have not only contributed to this thesis academically but whose moral support paved a road to the end. To David Walker – I really could not (and would not) have done this without you. Special thanks are owed to my parents, who have supported me throughout my years (and years) of education and encouraged me to always reach higher. Finally, thank you to Jason Valerio for keeping me grounded and reminding me to live and love outside of the lab.  xiii  CO-AUTHORSHIP STATEMENT I designed and executed all experiments and data analysis and wrote the text provided in this thesis and the associated manuscript. Corinna Warburton contributed the LCC6Her2 cell line, executed confirmatory studies and helped revise manuscripts which appear as the second and third chapter. Karen Fang conducted initial exploratory studies to screen drug combinations which were later repeated and further expanded by myself, in cases of overlap the results from both studies were averaged. Anna Stratford and Lincoln Edwards contributed to study design. Mykola Maydan, Paul MacDonald and Iveta Dobreva contributed advice. Malathi Anantha contributed expertise on PK and PD studies. Hong Yan provided cell culture support. Dita Strut, Young-Joo Yang, Maryam Osooly, and Dana Masin provided animal study support. Tim Daynard contributed QLT0267. Dawn Waterhouse, Wieslawa Dragowska and Brent Sutherland helped edit the manuscripts. Karen Gelmon provided clinical expertise and perspective. Sandra Dunn provided mentorship and helped revise the manuscripts. Marcel Bally is the thesis supervisor and provided guidance, advice and editorial assistance.  xiv  CHAPTER 1 1.1 Overview This doctoral research focuses on assessing the effectiveness of Integrin Linked Kinase (ILK) inhibition or silencing as part of effective combination therapies for women with breast cancer. Although this research is assessing treatment strategies in the context of cell-based and animal based models of breast cancer. The goal is to obtain data that would better predict whether treatments will achieve improvements in longterm survival for women with breast cancer, while assuring that the patient’s quality of life is maintained or improved. A guiding principle for this thesis research is that existing chemotherapeutic agents already shown to be effective in prolonging the life expectancy of women with breast cancer will not be easily replaced. Instead, improvements in treatment outcomes will come from the addition of carefully selected therapeutics targeting specific signals which are uniquely expressed in an individual’s breast cancer cells. As highlighted in section 1.4.3 and 1.4.4, breast cancers can be grouped into a number of distinct disease subtypes based on histological attributes and expression of certain molecular attributes (e.g. expression of estrogen receptor, over expression human epidermal growth factor receptor 2 (Her2/neu), etc.) [1-5]. As clinicians gain a better understanding of the molecular differences between breast cancers, it is anticipated that treatments will become more individualized. However, as more personalized treatment options emerge they are not replacing existing standards of care that have proven effective in broad population settings. Rather, the treatment strategies used today, which involve the use of drugs in combination, will be modified to include novel therapeutic agents to create new combinations that are better designed to  1  treat the patient’s unique type of breast cancer. Selection of therapeutic targets, the subsequent development of agents against these targets and, finally, the assessment of how these agents can be used in the context of existing standards of care is a drug development challenge. There are many variables to consider in the selection and optimization of drug combinations where one of the agents used is designed to target aberrant signalling pathways in cancer cells, while also insuring that the activity of currently used chemotherapy is maintained or enhanced. These variables must consider the specific molecular target and its role in signalling pathways that influence development, progression and metastasis of cancer (for examples see Chapter 4). In addition the use of agents which target a specific signalling pathway must be determined in the context of existing chemotherapeutic agents and this is a daunting task since therapeutic results can depend on drug concentrations, drug/drug ratios, as well as dosing schedules and the sequence in which the drugs are given. A mechanism-based understanding of drug interactions is thus needed to rationalize the design and use of selected combinations. Further, there is a clear lack of preclinical (cell- and animal-based) models that can accurately predict treatment outcomes for agents used in patients. Currently, the identification of drug combinations that provide meaningful therapeutic benefits in a clinical setting is achieved empirically in patients. This is an arduously slow process that often leads to results suggesting little or no therapeutic benefit [6]. For this reason a methodology developed in this doctoral research was based on assessments of multiple therapeutic endpoints in hope that these data could more accurately predict drug combinations effects in animal models and in patients (see Chapter 2). The use of  2  multiple preclinical models, both in vitro and in vivo, can also enhance the likelihood that one has selected an effective drug combination and under which circumstance that combination is most likely going to exhibit therapeutic activity in the clinical setting (see Chapter 3). The approach described in this thesis has evaluated Integrin Linked Kinase (ILK) as a therapeutic target in treatment of women with breast cancer. ILK is an established and validated molecular target that plays a role in cancer development and progression [7-11]. Work led by Dr. S. Dedhar and expanded upon by many others, clearly demonstrates that enhanced ILK signalling is linked to increased tumour cell proliferation [12-23], survival [14, 24-35], differentiation [36-38], migration [15, 17, 23, 39-42], invasion [23, 43-46] and angiogenesis [27, 47-49], all hallmark features of cancer development and progression [50-52]. Although this research focuses on ILK as a therapeutic target for use in breast cancer, the principles outlined here can be generally applied to the development of other molecularly targeted drugs in combination with standard of care therapeutic agents. The results described predict that combinations involving use of agents that interfere with ILK signalling and docetaxel, a drug commonly used in the treatment of breast cancer [53-55], will be beneficial if used in an adjuvant (early) treatment setting. Based on our data, the effect is likely to be observed in patients that express human epidermal growth factor receptor 2 (Her2/neu), a receptor tyrosine kinase that is a predictor of more aggressive forms of breast cancer.  3  1.2 Hypothesis Signal transduction inhibition via ablation of PI3/AKT using the ILK inhibitor QLT0267, will enhance the efficacy of selected agents used as part of the standard of care for women with breast cancer and enhanced efficacy will be expressed in a combination setting across multiple clinically relevant endpoints.  1.3 Specific Research Aims i) To establish that QLT0267, a small molecule inhibitor targeting integrin-linked kinase (ILK), can combine with drugs commonly used to treat women with breast cancer to produce synergistic interactions linked to enhanced cytotoxicity, reductions in PAKT levels and improved treatment outcomes in an orthotopic breast cancer model.  ii) To validate the use of a bioluminescent breast cancer cell line, MDA435/LCC6, as a means to monitor tumour progression and to define and select an aggressive model of breast cancer that is least sensitive to Docetaxel (Dt), an established anticancer drug used to treat breast cancer. Subsequently to establish whether docetaxel (Dt) in combination with the ILK inhibitor, QLT0267, results in improved treatment outcomes.  iii) To better understand how ILK inhibition influences breast cancer cells that over-express Her2/neu.  4  1.4 Breast Cancer Breast cancer is the most common malignancy in women. In Canada, this year (2010) approximately 22,700 women will be diagnosed and 5400 will succumb to the disease (i.e. 1 in 9 women will be diagnosed and 1 in 28 will die) [56]. As the demographics shift towards an increasingly aged population, the incidence of breast cancer is expected to increase by a third over the next 20 years. The clinical picture of incidence and deaths relating to breast cancer is encouraging in that both have been steadily declining since 1969 (Figure 1.1) in part due to better diagnostic techniques, early detection using regular mammographic screening and improved treatment strategies [56]. Ironically, when screening techniques were first introduced in the early 1980’s, the incidence of mammary tumours actually increased from 60% to 80%. It quickly became apparent that small invasive carcinomas and in situ carcinomas were much more readily detected using these tools [56-59]. Currently, various groups are debating the utility of early screening, in light of studies such as the one done by Zahl et al in 2008. This study showed that women aged 50-64 receiving a single screening had a tumour rate that was 22% lower as compared to women receiving at least 3 consecutive screenings before this age range. This research team postulates that some of the cancers detected during early screens are able to undergo spontaneous regression by later screening times [60]. Despite this, it is important to keep in mind that the introduction of screening vastly reduced the number of women with large or locally advanced carcinoma. Following that, in 1994, after a lag time of about 10 years, the mortality rates associated with breast cancer started to decline. If screening is detecting clinically significant cancers at a curable stage, this downward trend will surely continue,  5  Figure 1.1 Breast cancer in Canada. Canadian statistics illustrating incidence (A) and mortality (B) rates for women with breast cancer from 1980 -2009.  From Canadian Cancer Society Statistics 2010  6  however a pertinent question is how to identify patients with tumours that will benefit from rigorous treatments versus those women presenting with tumours that are potentially capable of undergoing remission without the use of toxic treatments [56]. For these women, better treatment modalities that target relevant tumour markers would contribute to reducing the risk of mortality in recurrent and invasive breast carcinoma. 1.4.1 The Human Breast The breast is a histologically dynamic organ undergoing cyclical changes during the reproductive life of the female. The human mammary glands rest on the pectoralis muscle on the upper chest wall. Histologically the breast is composed of specialized epithelium and stroma that form highly modified apocrine sweat glands. Each breast is made of 15-25 glandular units called breast lobes, embedded in adipose tissue and separated by a collagenous stroma. These lobes drain into a large duct called the lactiferous duct. Successive branching of the large ducts leads to the terminal duct lobular unit which branches into a grapelike cluster of small acini to form a lobule. The lobules are separated by dense collagenous connective tissue and adipose tissue known as interlobular stroma, while the ducts are enclosed by a hormonally responsive, highly vascular, less collagenous, intralobular stroma that contains lymphocytes. For a detailed illustration of human breast anatomy see Figure 1.2 [59, 61-64]. During the sixth week of embryogenesis, mesenchyme condenses around the epithelium of a breast bud that had previously developed from a ridge of thickened ectoderm extending from the limb buds to the groin on the anterior surface of the fetus. These are known as milk lines. In humans, only one gland develops on each side of the thorax as epithelium forms solid cords that invade from the epidermis to the deeper  7  Figure 1.2 Anatomy of the human breast. The human mammary glands rest on the pectoralis muscle on the upper chest wall. Histologically the breast is composed of specialized epithelium and stroma that form highly modified apocrine sweat glands. Each breast is made of 15-25 glandular units called breast lobes, embedded in adipose tissue and separated by a collegenous stroma. These lobes drain into a large duct called the lactiferous duct. Successive branching of the large ducts leads to the terminal duct lobular unit which branches into a grapelike cluster of small acini to form a lobule. The lobules are separated by dense collegenous connective tissue and adipose tissue (interlobular stroma), while the ducts are enclosed by a hormonally responsive, highly vascular, less collegenous, stroma that contains lymphocytes (intralobular stroma). Figure 1.2 Anatomy of the Human Breast. 1  Adapted from Elsevier Pathological Basis for Disease, Robbins and Cotran, 8th edition, 2008  8  mesenchyme. Gradually the cords undergo a process of branching and canalize to form the foundation for the ductal system. During development but before puberty the tissue organizes into a larger ductal system. At the onset of puberty, high levels of estrogens stimulate the resumption of proliferation of cells within ducts, lobules and stroma. Prior to menarche the breast is made of a branched system of approximately 20 lobes terminating as the lactiferous ducts distributed around the nipple. The architecture of the breast is now established and the glandular portion consists of terminal ductules, interlobular collecting ducts with an interlobular stroma [61, 62, 65, 66].  Menarche initiates the further development of lobules at the distal ends of the terminal ducts forming acini, which experience cyclical changes as the reproductive cycle continues. Additional interlobular stroma and adipose tissue begins to accumulate increasing the overall volume of the breast. Throughout the reproductive years of the human female, breast tissue responds to cyclical hormonal changes involved in the reproductive cycle. Increasing levels of progesterone and estrogen at the onset of ovulation stimulate epithelial cell proliferation within the terminal ducts triggering the development of more acini within the lobules. In the basal layer of the epithelium, vacuoles appear, and edema of the intralobular stroma is apparent. As hormone levels fall at the end of menstruation, epithelial cells undergo apoptosis and lymphocytes are seen to infiltrate the interlobular stroma [59, 61, 67-71].  Further changes in breast histology occur during pregnancy. When hormone levels fail to return to baseline levels as a result of fertilization of an ovum, breast lobules continue to increase in size and number. During the second trimester of  9  pregnancy, colostrum rich in lactoferrin, immunoglobulins and lysozyme, is produced at a rate of 30 ml per day in response to increasing levels of prolactin. Within epithelial cells, secretory vacuoles are readily apparent in the third trimester and after parturition. Decreasing progesterone levels and increasing prolactin trigger further secretions from glandular epithelium causing the lumina of these vacuoles to distend with proper breast milk rich in lipids, lactose, potassium, calcium and casein. When lactation is complete, lobules regress and atrophy; causing the total breast size to decrease [61, 63, 64, 7074]. By age 30, glandular epithelium and connective tissues of the lobules begin to regress in a process known as involution, and the fibrous stroma is slowly replaced by adipose tissue [75]. After menopause, the intralobular stroma becomes collagenous and the acini are reduced in size [75].  Considering the dynamic nature of the breast epithelium, it is not surprising that the organ is subject to a high risk of carcinogenesis. Repeating patterns of mitosis followed by apoptosis readily introduce the possibility for spontaneous mutations in cell regulatory machinery. Furthermore, as the breast is hormonally responsive, changes in endocrine patterns or introduction of exogenous hormones adds another level of risk for dysregulation of the cell cycle and/or apoptosis. A variety of reviews discuss the relationship of breast tissue dynamics and risk for breast cancer [69, 70, 75-77], these and other putative risk factors are also discussed in more detail in section 1.4.2.  The lymphatic structure of normal breast tissue contributes to the metastatic behaviour of breast cancers [78-80]. The lymphatic draining of normal breast tissue is derived from a plexus originating in the intralobular stroma and area around the large  10  ducts. This system of lymphatic vessels ultimately empty into the subareolar plexus joining with efferent lymphatics extending around the axilla and into the lower pectoralis axilliary nodes. A second drainage system leads to the internal mammary nodes receiving 25% of the total flow from the breasts [59, 61]. As outlined below, when staging breast cancer, the presence of cancer cells in draining lymph nodes is a critical factor influencing prognosis and treatment course.  1.4.2 Etiology and Pathogenesis of Breast Cancer The intrinsic dynamic nature of breast tissue (i.e. the cyclical periods of mitosis and apoptosis as summarized in the previous section), in combination with multiple risk factors associated with the development of breast cancer, make this a relatively common malignancy. Two major etiological factors linked to development of breast cancer are a positive family history and aberrant hormonal signalling. For this reason breast cancer can be categorized as 1) hereditary or 2) sporadic due to hormonal influences. The major risk factors in the development of sporadic breast cancer include age, age at menarche, first live birth, first-degree relatives with breast cancer, breast biopsies and race. Additional risk factors include; estrogen exposure, radiation exposure, carcinoma of the contralateral breast or endometrium, geographic influence, diet, obesity, exercise, breast-feeding, and exposure to environmental toxins [59, 7880]. Having stated this, the majority of these cancers occur in postmenopausal women and involve over-expression of the estrogen receptor (ER). The pathophysiology of estrogen related cancers has two main mechanisms: 1) metabolites of estrogen can cause mutations or generate DNA-damaging free radicals [81-84]; and 2) the hormonal  11  action of estrogens drive cellular proliferation [59, 85, 86]. However, a number of sporadic lesions are ER negative thus other mechanisms must also play a role.  Approximately 15% of women with breast cancer have a first degree relative with the disease, and 1% with multiple family members [59, 79, 87, 88]. Five to 10 % of breast cancers are attributed to hundreds of mutations in two autosomal-dominant genes, Breast Cancer Early Onset (BRCA) 1 and BRCA2 [59, 87-90]. The general lifetime breast cancer risk for female carriers of mutations in these genes is 60% to 85% [87, 89, 91], and the median age at diagnosis is 20 years earlier than women without these mutations [59, 87-89]. The protein products of these genes act as tumour suppressors, with functions that include transcriptional regulation, cell-cycle control, ubiquitin-mediated protein degradation, and chromatin remodelling. A key function for both genes appears to be their role in protecting the genome from damage by stopping the progress of the cell cycle and influencing DNA damage repair [92-98]. Genetic susceptibility due to other known genes accounts for fewer than 10% of hereditary breast carcinomas [99]. Examples of these include mutations in the cell-cycle checkpoint kinase gene (CHEK2), or the tumour suppressors p53, LKB1 and phosphatase and tensin homolog (PTEN) [87, 88, 99, 100]. Whether sporadic or hereditary, the development of breast carcinomas is the result of a variable series of genetic or functional changes taking place in cells within the breast. This suggests that the development of breast cancer is a complex and multifaceted process of carcinogenesis that is uniquely dependent on the various cell types and functions with normal breast as described in Section 1.2.1. A polygenic model where genes act in combination to create a spectrum of risk could explain the remaining incidence of  12  familial breast cancers, as well as risk in the general population [101-104]. These risk factors have been summarized in Table 1.1. A general model for carcinogenesis postulates that a normal cell must achieve seven new capabilities in order for cancer to develop: self-sufficiency in growth signals, insensitivity to inhibitory signals, evasion of apoptosis, defects in DNA repair and genetic instability, limitless replicative potential, sustained angiogenesis, and the ability to invade and metastasize [50-52]. These hallmarks of cancer are summarized in Figure 1.3, Sledge et al., Laubenbacher et al. and Russo et al. review how these phenotypes relate to the development of breast cancer specifically [51, 105]. It seems that hereditary forms of breast carcinoma facilitate the process of carcinogenesis by providing at least one characteristic that enables cells to undergo dysregulated cellular proliferation, resulting in increased numbers of epithelial cells.  As proliferation  continues, cells acquire genetic instability reflected in hetrozygosity and aneuploidy as is the case with high-grade ductal carcinoma in situ (DCIS) and some invasive carcinomas. As explained in the following section (1.4.3), breast cancers such as DCIS have a propensity towards growth. A limitless replicative potential and rapid proliferation is a sign of tumour progression. Numerous studies show that AKT signalling is at the heart of many phenotypic changes in breast cancer as well as other cancers [4, 70]. High levels of proangiogenic factors are commonly seen in breast tumours, in fact, high levels of Vascular Endothelial Growth Factor (VEGF) are associated with poor prognosis [106-108]. Factors like VEGF, Basic Fibroblast Growth Factor (bFGF) [109], and leptin [110] secreted from tumours or surrounding cells lead to increased angiogenesis.  13  Table 1.1 Risk Factors for Breast Cancer 1 Environmental Factors: High risk Increasing age Breast cancer in a first-degree relative Atypical ductal or lobular hyperplasia Lobular carcinoma in-situ Prior history of breast cancer Increasing mammographic breast density Low risk Early menarche/late menopause Elevated levels of estrogens and androgens Age at first live birth Diet and alcohol consumption Obesity Exercise Race and Geographic Location  Incidence rise with increasing age, Average age = 64, 77% of cases occur after 50 13 % have one affected relative 1 % have 2 or more History of breast abnormalities noted on previous breast biopsy  Menarche Before 11 is related to a 20% increase in risk, risk for late menopause is undefined Postmenopausal hormone replacement therapy, oophorectomy reduces risk of BC by 75% Women having a first child > 30 or null-parity is associated with higher risk, breast feeding is protective Alcohol and fat intake is associates with increased risk, Beta Carotene reduces risk Increased risk attributed to increases estrogen production and or anovulation Decreased risk in premenopausal women who exercise Risk of developing invasive carcinmoma at age 50: African American 1/20, Cacuasion 1/15, Asian/Pacific Islanders 1/26, Hispanic 1/27, 4-7 times higher incidence in Europe and US  14  Genetic Factors BRCA1 and BRCA2 mutations  PTEN  P53  CHEK2 LKB1 ATM  Tumour suppressor genes, involved in DNA repair and regulation of transcription, 35% of breast cancers exhibit mutations in BRCA 1 (> than 500 mutations), BRCA 2 (> 300 mutations), Increased risk by 60-80% with younger age of onset. Tumour suppressor genes, involved in PI3 Kinase pathway, Cowden syndrome the result of mutations in PTEN, increased risk by 25-50%, LOH is seen in up to 41% of patients with breast cancer Tumour suppressor genes, involved in cell cycle regulation, Germline mutation in LiFraumeni syndrome, associated with an 18 fold higher risk before age 45, Spontaneous mutations are seen in upto 57% of breast cancers Cell cycle checkpoint kinase, recognition and repair of DNA damage, Increased risk by 20% Peutz-Jeghers Syndrome truncating mutations in LKB1, risk undefined Ataxia telangiectasia carriers, Increased sensitivity to radiation exposure, risk undefined  Adapted from references 59, 79-80, 87 - 104 and 147.  15  15  Figure 1.3 Target molecules and the hallmarks of cancer. This Figure organizes molecular markers that are often disrupted in cancers into categories according to the phenotypic changes associated with the 6 hallmarks of cancer; 1) Self-sufficiency in growth signals; 2) Evasion of apoptosis; 3) Sustained angiogenesis; 4) Limitless replication; 5) Insensitivity to anti-growth signals; 6) Invasion and metastasis. It is interesting to note that some markers such as ILK are found in more than one category. Figure 1.3 Target Molecules and the Hallmarks of Cancer 1  From Verrault et al, Curr Gene Ther. 2006 Aug;6(4):505-33.  16  The process by which breast carcinoma in situ progresses to invasive carcinoma is not fully understood. Two hypotheses include: 1) loss of the basement membrane and tissue integrity caused by the abnormal function of myoepithelial and stromal cells, or 2) gain of the invasive abilities on the part of tumour cells [59, 111-115]. Perhaps because of the different initiating factor and various types of cells involved in the development of cancer it is not surprising that breast cancers can be sub-classified according to both histological factors and genetic factors as summarized in the following sections. 1.4.3 Histological Types of Breast Cancer Cancers of the breast most often arise from the glandular epithelium of the terminal ducts forming adenocarcinomas. The two broad categories of breast cancer are carcinoma in situ and invasive carcinoma. Carcinoma in situ is limited to ducts and lobules by the basement membrane, and thus do not invade into lymphatics and blood vessels and do not metastasize. Carcinoma in situ is classified as ductal or lobular. Ductal carcinoma in situ (DCIS) are clonal expansions of cells originating within ducts or lobules. These colonies remain within the basement membrane and are sometimes associated with calcification or fibrosis. There are three subcategories of DCIS; 1) comedoadenocarcinomas which are associated with necrosis, calcification and fibrosis 2) Non-comedo DCIS that form from monomorphic cells in a solid, cribriform, papillary or micropappillary pattern, and 3) Paget’s disease of the nipple, where malignant cells, referred to as Paget cells, extend from DCIS within the ductal system into nipple skin without crossing the basement membrane. Lobular Carcinoma In situ (LCIS) are often incidental findings on biopsies done for other reasons. The cells are detached from neighbours due to a loss of E-Cadherin. Often there is an over-expression of Estrogen  17  (ER) and Progesterone receptors (PR). It is thought that LCIS is not a true neoplasm but rather suggestive of an increased risk for Invasive Carcinoma. Invasive carcinoma or infiltrating carcinoma differs from Carcinoma In Situ in that it has invaded beyond the basement membrane into stroma. Cells might also invade into the vasculature and reach lymph nodes thus increasing the potential for developing metastatic disease at distant sites. Metastases of breast cancer are typically seen in bone, kidney, liver and brain. The term inflammatory carcinoma refers to the clinical presentation of a carcinoma extensively involving dermal lymphatics [59]. The two types of stroma in the breast, intralobular and interlobular, can give rise to neoplastic tissue as well. Interlobular stroma is the source of the same types of tumours found in connective tissue in other sites of the body such as lipomas and angiosarcomas and fibrous tumours while fibroadenomas and phyllodes tumour may develop within intralobular stroma [59, 61]. 1.4.4 Prognostic and Predictive Factors: Identification of Molecular Targets Prognosis is determined by the examination of the primary carcinoma and the axillary lymph nodes and assessing for major prognostic factors: invasive carcinoma versus in situ disease, distant metastases, lymph node metastases, macrometastases (> 0.2 cm), tumour size, locally advanced disease and inflammatory carcinoma [59]. Women presenting with breast swelling and skin thickening suggestive of inflammatory breast disease, have a particularly poor prognosis with a 3-year survival rate of only 3% to 10% [116]. The major prognostic factors are used to divide breast carcinomas into clinical stages as described in Table 1.2. Minor prognostic factors such as histological  18  Table 1.2 a Prognostic Factors of Breast Cancer 1 Major prognostic Factors Invasive carcinoma or in situ Higher risk of mortality with invasive carcinoma disease Distant metastases Favoured sites of metastatic spread are lungs, bones, liver, adrenals, brain and menengies Lymph node involvement With no lymph node involvement the 10 year survival rate is 70-80%; with 1-3 positive nodes this falls to 35-40%; 10+ positive nodes 10-15% Tumour size The larger size is correlated to lymph node involvement, see table 1.2b Locally advanced disease Invasion into skin and/or muscle Inflammatory carcinoma Breast swelling or thickening of the skin, 3 year survival of 3-10% Minor Prognostic Factors Histological subtypes Tubular, mucinous, medullary, lobular, and papillary invasive carcinoma has a better prognosis than cancers of no special type Tumour grade Grading is based on nuclear morphometry, tunbule formation, and mitotic rate, 10 year survival for Grade I –85%, Grade II – 60%, Grade III – 15% Hormone receptor status 50-85% of breast cancers are ER+, better prognosis, and predictive of response to therapy Her2/neu status 20-30% of breast cancers exhibit over-expression of this glycoprotein, these tumours carry a poor prognosis, Her2/neu is predictive of response to therapy Lymphovascular invasion Presence of tumour cells in the vascular space is associated with lymph node metastases and carries a poor prognosis for women without lymph node involvement Proliferative rate Analysis of S phase fraction, Ki67 and Cyclin are markers which asses the rate of proliferation, highly proliferative tumours carry a poor prognosis DNA content Aneuploidy carries a poor prognosis  19  Table 1.2b Staging of Breast Cancer 1 Stage 0  DCIS/LCIS  Size  node  5 yr survival rate (%) 92  I  Invasive Carcinoma  <2cm*  Negative  87  II  Invasive Carcinoma  <5cm**  Up to 3 involved axilliary nodes  62  III  Invasive Carcinoma  <5cm***  4+ involved axilliary nodes  46  IV  Breast Cancer with distant metastasis  13  *including carcinoma in situ with micro-invasion without nodal involvement (or only metastases < 0.02 cm in diameter) **invasive carcinoma greater than 5 cm without nodal involvement ***invasive carcinoma greater than 5 cm in diameter with nodal involvement; invasive carcinoma with 10 or more involved axillary nodes; invasive carcinoma with involvement of the ipsilateral internal mammary lymph nodes; or invasive carcinoma with skin involvement (edema, ulceration, or satellite skin nodules), chest wall fixation, or clinical inflammatory carcinoma Adapted from references 59, 117 - 120  20  20  type, tumour grade, hormone receptor (ER, PR) expression, Her2/neu over-expression, lymphovascular invasion, proliferative rate, and DNA content, are used to determine whether; 1) women with nodal involvement and/or carcinomas over 1 cm in diameter will benefit from some form of systemic therapy, chemotherapy regimens, and/or hormonal therapies; or 2) women with small node-negative carcinomas need any additional treatment. ER and PR, and Her2/neu are most useful as predictive factors for response to specific therapeutic agents such as tamoxifen, aromatase inhibitors (such as anastrozole or letrozole) and/or trastuzumab, a humanized monoclonal antibody targeting the receptor tyrosine kinase Her2/neu [117-120]. As gene expression profiling becomes widely available, newer predictive markers as well as potential molecular targets for use in the treatment of breast cancer are being discovered and validated. Evidence from micro-array, immunohistochemistry (IHC) and real time polymerase chain reaction (RT-PCR) studies confirm that breast cancer is a heterogeneous disease with multiple molecular subtypes that vary in their clinical outcome. Five molecular subtypes are currently widely accepted. These are: ER positive Luminal A, ER positive Luminal B, basal like (i.e. triple negative), c-erb-B2 positive and normal breast, where basal like and c-erbB2 positive have the shortest survival times. Table 1.3 summarizes the major breast cancer subtypes with respect to marker expression, frequency in the population and response to various treatment strategies [1-5, 121-124]. The molecules mentioned above represent those which have been thoroughly validated, however it should be noted that as molecular technologies advance, the molecular signatures of specific tumours are increasing the number of  21  Table 1.3 Features of the Major Intrinsic Biological Subtypes of Breast Cancer 1 Subtype Luminal A Luminal B HER2+ Frequency 50% 15% 25% Estrogen Receptor Status + + Proliferation Status (Ki67) + + Keratin 8/18 8/18 Her2/neu genes (c-ErbB2) +/+ Prognosis good poor poor Response to anti-estrogens + + Response to CMF chemotherapy + + Response to anthracycline + + Response to taxanes + + Adapted from references 117-130  Basal-like 10% + 5/15 poor -  22  valuable prognostic molecular markers available, such as PTEN, AKT and ILK described in section 1.5.2. At the present time prognostic profiling is aiding doctors and their patients in making treatment decisions. Cianfrocca and Gradishar [1] recently reviewed the use of gene array profiling in prognostic profiling for breast cancer using the 70 gene assay (MammaPrint), the 76 gene assay, the 21 gene RT-PCR assay (Oncotype DX) and the hoxb13:IL17BR assay and concluded that regardless of which assay was used these techniques were prognostic and predictive of outcome more so than the use of traditional indicators listed above. According to Cianfracco the MammaPrint and Oncotype Dx are the most commonly used assay in Europe and the United States. Further identification of specific molecular markers is influencing the drug choices being offered to patients. As our understanding of how molecular events influence breast cancer development and progression increases there will be even greater opportunities in the future to customize treatments for patients based on prognostic profiling information. This is the dream for development of personalized care and development of potentially curative treatment regimes for patients. However, as discussed in the following sections, future treatments will be influenced remarkably by current treatment standards. Therefore, as it is argued in this thesis, it is critical that novel therapeutic agents are developed in consideration of existing treatment practices. 1.4.5 Current Treatment Options for Patients with Breast Cancer Therapeutic approaches in the treatment of breast cancer include combinations of surgery, adjuvant radiation, and systemic control, using hormonal treatment or chemotherapy or both [125, 126]. Additionally the efficacy of treatment is in part based  23  on the stage of disease. In this regard patients are first categorized into broad groups based on stage and grade of disease. These groups are; 1) Early Breast Cancer; 2) Locally Advanced Breast Cancers; or 3) Advanced Breast Cancer. Surgical mastectomy was the standard of care for breast cancer patients; a treatment approach that appeared in the late 1800’s. Today, treatment of early breast cancer involves breast conserving surgery (i.e. lumpectomy and sentinel node biopsy or axillary dissection), followed by whole breast irradiation. Studies have demonstrated that recurrence rates can be reduced from 30% to 10% with localized radiation therapy [127]. Radiation can also be used in a neo-adjuvant setting to reduce the tumour volume prior to surgery [127]. The use of systemic therapies is determined by the assessment of information gathered during diagnosis biopsy or surgery; information which includes tumour size, nodal involvement, positive or negative for hormonal receptors, and Her2/neu overexpression. If chemotherapy is used then treatments of early disease are based on a multiple modality approach. Neoadjuvant chemotherapy will include anthracyclines (doxorubicin or epirubicin) followed by surgery and radiation. Adjuvant chemotherapy can be added to this treatment regimen and this invariably involves the use of multiple drugs. Examples include cyclophosphamide in combination with methotrexate and fluorouracil (CMF) or cyclophosphamide in combination with epirubicin and fluorouracil (CEF). The goal of adjuvant chemotherapy is to reduce the chance of recurrence following surgery and/or radiation [128-130]. Tamoxifen is used in pre-menopausal patients with tumours that express the estrogen receptor (ER+). Post-menopausal women with ER+ and Ki67+ breast tumours are treated with Aromatase Inhibitors (AI)  24  such as Letrozole or Testolactone. Newer therapeutic strategies involve pharmacologic agents or therapeutic antibodies targeting membrane-bound growth factor receptors and include examples like Gefitinib or Erlotinib (targeting Epidermal Growth Factor Receptor (EGFR) expression) [131-133], Trastuzumab (targeting Her2/neu positive tumours) [134-136], and Lapatinib (targeting both EGFR and Her2/neu signalling) [135, 137-139]. Agents designed to effect angiogenesis (e.g. Bevacizumab which targets vascular endothelial cell growth factor (VEGF) [135, 140-142] or Sunitinib, which is a small molecule tyrosine kinase inhibitor that targets the VEGF receptors (1, 2 and 3) [140, 141, 143-145]) have also been considered as part of a adjuvant treatment regimen [146-150]. As indicated above, the choice of treatment depends in part on tumour stage, grade and the presence of biomarkers (see Tables 1.2 and 1.3). With respect to biomarkers, studies have mainly focused on estrogen and progesterone receptors as well as Her2/neu over-expression or amplification not only as markers to help select therapies that target these molecular changes but also to make decisions on the use of more traditional chemotherapies. For example, Parker et al. reported in a retrospective study that tumour markers such as ER and Her2/neu can be used to predict response to chemotherapy  regimens  containing  paclitaxel,  fluorouracil,  doxorubicin  and  cyclophosphamide (T/FAC). This group reported that ER positive tumours exhibit poorer responses to T/FAC while Her2/neu positive tumours are highly responsive to T/FAC [151]. Moreover the use of taxanes, and in particular pacilitaxel, can be beneficial depending on grade, stage, hormone receptor and nodal status [55, 152, 153].  25  Figure 1.4 Treatment standards for early, locally advanced, and advanced breast cancer. Adjuvant therapy algorithm based on genomic analyses (A). Metastatic breast cancer algorithm (B). Figure 1.4 Treatment Standards for Early, Locally Advanced and Advanced Breast Cancer. 1  Adapted from Higa et al, Expert Opinion: Pharmacotherapy 2009 10(15)  26  Currently, treatment of women with localized disease is very successful. Even some subtypes of metastatic disease are managed well. Moreover, studies have shown that locally advanced disease is responsive to neo-adjuvant chemotherapy with Doxorubicin, Traztuzumab, or Tamoxifen or AI’s (for ER+ disease). Figure 1.4 summarizes the current standards in the treatment of early, locally advanced and advanced breast cancers. In spite of advances in early diagnosis, treatment methods and reduced mortality rates of breast cancer, 30-40% of women in North America relapse and succumb to the disease exemplifying the need for novel therapeutic approaches. It is relapsed disease and aggressive disease phenotypes that are not well managed using currently available treatment standards. As one example, triple negative or basal subtypes (ER-, PR-, Her2/neu-) are the most aggressive forms of breast cancer with the poorest outcome regardless of the therapeutic strategy used, and additional research into potential biological markers that could serve as therapeutic targets is required [154-156]. As mentioned in section 1.2, detection and classification of patients who do not respond well to current treatment standards serves a couple of purposes: 1) the patients could be spared the deleterious side effects of cytotoxic treatments that provide limited or no benefits and 2) the patients that could most benefit from treatments developed around specific molecular markers that are unique to the patients disease could be identified for participation in clinical trials with experimental molecular targeting agents. This is an important line of ongoing research where a key message is that new approaches for prognosis and treatment of breast cancer are still urgently required.  27  1.5 Next Generation Therapeutics In light of this need for better treatment options and with the exponential increase in information on potential molecular pathways that drive development and progression of breast cancers, there is a plethora of molecular targets that have been identified that may have potential therapeutic value in the context of carefully selected patient populations. There is not sufficient space in this thesis introduction to review all the therapeutic targets that have been identified as important to breast cancer progression, survival and metastasis. Many of these targets have been reviewed elsewhere [157]. For brevity, Figure 1.3 provides an overview of potential targets that have been identified and organizes these targets according to the hallmarks of cancer. This figure has been limited to targets that have been reasonably well validated through extensive in vitro and in vivo studies as well as by therapeutic strategies identified to mitigate the effects of the target. Regarding the latter, however, it can now be argued that any target that influences cancer progression and development as a result of over expression can be silenced through use of therapeutic small interfering Ribonucleic Acid (siRNA) sequences. As outlined in Figure 1.3, the therapeutic targets have been categorized under the six essential alterations in cell physiology that dictate malignant growth as described elsewhere [50-52, 59]. These include (I) self-sufficiency in growth signals; (II) insensitivity to growth inhibitory signals; (III) evasion of programmed cell death; (IV) limitless replicative potential; (V) sustained angiogenesis, and (VI) tissue invasion and metastasis [52]. The assignment of these targets to one or more of the six categories does help identify targets that may be of greatest therapeutic interest. A number of targets appear in more than one of the six essential groups described above (e.g.  28  VEGF, Ras, Raf, Protein Kinase C-α (PKC-α), Her2/neu, ILK). Some of these targets have already been proven to be of important therapeutic value (e.g. VEGF, Her2/neu) while others show significant promise based on preclinical evidence. These represent particularly promising targets for therapeutic intervention because of their potential to induce pleotropic effects (affecting multiple key features dictating tumour growth). As described in section 1.5.5-1.5.6, research evaluating the effects of targeting ILK expression exemplify such pleotropic effects, and this is one of the reason that this thesis research has focused primarily on ILK as a therapeutic target to be developed in the context of existing drugs used for treating breast cancer. With this as a stated goal, it is important to gain a perspective of how combination effects can be measured and how results from such studies can be interpreted. 1.5.1 Combination Chemotherapy and Analysis of Drug-Drug Interactions The reason why cancer is treated using combination chemotherapy is rather simple: cancer is a heterogeneous disease and cell populations survive treatments with selected drugs and repopulate tumours with cells that have become resistant to these selected drugs. Use of multiple drugs, in theory, helps to avoid the development of resistant subpopulations and makes the eradication of a range of different malignant cell populations feasible. Clinicians and scientists have understood these benefits based on empirical data demonstrating improved treatment outcomes when using multiple drugs. This principle is now being applied to targeted agents and only now are patients beginning to realize the benefits of combining classical chemotherapeutic agents with novel drugs targeting specific molecular pathways. As indicated in the previous section there are many drugs that are being used to treat breast cancer and there are  29  numerous new drugs that have been identified to target molecular features expressed in breast cancer cells. The recognition that there are multiple drugs available and that these drugs must be used in combination creates a drug combination development problem. How does one select drug combinations that have the greatest likelihood of providing benefits to patients? Analysis of drug interactions is a complicated procedure with multiple assessment strategies available [158]. Widely used strategies to determine whether various drug combinations result in synergistic, antagonist or additive effects include the statistical method, the arithmetic sum, the fractional product concept, the isobologram method, the median effect principle, and response surface modeling, [157]. For the studies described in this thesis the Median Effect Principle (MEP) method of Chou and Talalay was used. The MEP method describes the relationship between a measured response within a population of cells (fraction affected (f a) versus the fraction unaffected (f u)) and the fraction of the dose (D) required to achieve a specified effect level and is represented by the formula: fa/fu = (D/Dm)m Where Dm is the dose required to achieve a 50% effect level and m is a coefficient indicating the sigmoidicity of the dose–effect curve. The right side of the equation [(D/Dm)m] represents the dose, and the left side of the equation [fa/fu] represents the effect of the interaction. This analysis can be used to determine the combination index (CI) which provides a measure of whether the drug-drug interactions are additive (CI=1), antagonistic (CI>1) or synergistic (CI<1). The CI can be calculated at any effect level  30  Figure 1.5 Demonstration of the median effect principle and combination index Values. The MEP analysis can be used to determine the combination index (CI) which provides a measure of whether the drug-drug interactions are additive (CI=1), antagonistic (CI>1) or synergistic (CI<1). The CI can be calculated at any effect level and the effect used can be derived on the basis of any measured endpoint .  Figure 1.5 Demonstration of the Median Effect Principle and Combination Index Values.1  Adapted from Waterhouse et al, Handbook of Particulate Drug Delivery 2006  31  and the effect used can be derived on the basis of any measured endpoint (e.g. cell viability, cell number, apoptosis induction, intracellular enzyme inhibition, inhibition of VEGF secretion, etc.). Figure 1.5 illustrates a generic fa/CI plot. A commercially available program, CalcuSyn, can be used to calculate CI values for a broad range of effect levels and, on the basis of this analysis, F a verses CI plots can be generated. The latter plots are important to consider and recognize that drugdrug interactions are dependent on the effect level. Some drug-drug interactions are highly synergistic but synergy is only observed at low effect levels, while at high effect levels the interaction proves to be antagonistic. It is also now well established that drugdrug interactions are also influenced by drug-drug ratio, drug sequencing, experimental endpoint assessed and experimental condition (well fed vs. starved). These variables make it very challenging to determine whether a specific drug combination is providing therapeutic effects which are better than would be expected based on the action of the individual drugs (i.e. synergistic). The use of CI values also highlights an important practical aspect of selecting drug combinations that combine to provide synergistic effects: synergistic drug combinations can produce effects comparable to those achieved with the single agents, but at substantially lower doses. This interpretation suggests that one value of selecting a synergistic drug combination arises as a result of potential reductions in toxicity. Measured CI values can be used to estimate the dose reduction index (DRI) for combination of drugs. DRI estimates the extent to which the dose of one or more agents in the combination can be reduced to achieve effect levels that are comparable to those achieved with single agents.  32  1.5.2 Targeting Integrin Linked Kinase as a Means to Treat Breast Cancer As suggest in the preface to section 1.5, many molecular targets have potential value in the context of treating breast cancer and it is argued here that the true value of agents that act against these targets will only be observed in a combination setting. One way to narrow down the selection of a potential targets is to consider only those that, when inhibited, could produce pleotropic effects. ILK is such a target; where inhibition of one key kinase should produce a combination of therapeutic effects altering the tumours ability to progress. Integrin-linked kinase (ILK) was first discovered using the cytoplasmic tail of β1 integrin as bait in a yeast-two hybrid system [19]. Since its discovery, it has been shown that ILK is widely expressed in tissues, with especially high levels in pancreatic, cardiac and skeletal muscle tissues [9]. ILK functions as a scaffold protein associated with integrins [9, 10, 159-161], as well as a serine/threonine protein kinase localized to focal adhesions (FAs) [162-165]. In both cases the endogenous role of ILK is in signalling pathways involved in cell-matrix interactions. In a normal cell, ILK is important to development and baseline levels of ILK are required to maintain tissue homeostasis. Over-expression of ILK has been associated with dysregulation of growth characteristic of carcinogenesis [7-11, 166-168].  ILK is an  attractive therapeutic target and methods to silence ILK expression (e.g. use of siRNA targeting ILK mRNA) or to inhibit it’s kinase activity should prove valuable as a tool in the treatment of a variety of human cancers, including breast cancer [7-11, 166-168]. 1.5.3 ILK Structure and Function The ILK gene is encoded on chromosome 11p15.5 – 11p15.4 [19, 169]. The ILK protein has an N-terminal domain that contains four ankyrin repeats, a central pleckstrin  33  Figure 1.6 The structure of ILK and its interacting partners. The N-terminal ankyrin repeats of ILK interact directly with PINCH, ILKAP, SPARC and T-cadherin. The central PH-like domain of ILK binds to PtdIns(3,4,5)P3. The C-terminal kinase domain of ILK interacts with Beta 1 and 3 integrin, and actin-binding adaptor proteins such as parvins, paxillin, Mig-2 and Wech. The C-terminal kinase domain also interacts with PDK1, Akt, Rictor and Src.  Figure 1.6 The Structure ILK and its Interacting Partners. 1  Adapted from McDonald, P. C. et al. J Cell Sci 2008;121:3121-3132  34  homology (PH)-like domain and a C-terminal kinase domain (See Figure 1.6) [9]. ILK interacts with many proteins [170-172], such as the adapter proteins: PINCH [165, 172181], Calponin homology-containing ILK-binding protein (CH-ILKBP) (i.e. α-parvin or actopaxin) [40, 179, 181, 182], Affixin [176, 183-186], Paxillin [34, 163, 187], the catalytic proteins: integrin-linked kinase-associated serine/threonine phosphatase 2C (ILKAP) [20, 188], Protein Kinase B (AKT) [189, 190], phosphoinositide lipids [189, 191, 192] and more notably the transmembrane receptors β1 and β3 integrins [19] [160, 193]. These interactions are illustrated in Figure 1.6. The interactions of ILK with the cytoplasmic domain of β1 integrin have been well documented and appear to function as a scaffold protein forming complexes connecting integrins to the actin cytoskeleton [19, 40, 165, 166, 172, 184, 185, 194, 195]. ILK cell–extracellular matrix (ECM) adhesion is important for control of cell shape change, migration, proliferation, survival, and differentiation [9, 196]. Moreover, ILK mediated adhesion to ECM controls a variety of signal transduction pathways within the cell. The kinase activity of ILK is stimulated by integrins, growth factors and chemokines [37, 45, 189, 197, 198] and expression of ILK increases under hypoxic conditions [24, 199]. ILK has also been shown to directly phosphorylate proteins such as AKT [30, 31, 34, 189, 190, 200-202], Glycogen Synthase Kinase 3 (GSK-3) [13, 189, 203-206], Myosin Light Chain Kinase (MLCK) [207], affixin, [19, 184, 186, 208, 209] the cytoplasmic domain of β1 integrin [19, 208, 209], and phosphoinositide lipids [189, 209]. These proteins in turn, play roles in the activation or repression of genes involved in the regulation of cell survival, cell cycle, cell adhesion and spreading, the formation of focal adhesion plaques, ECM modification, cell motility, and contractility. The most notable  35  downstream target of the kinase activity of ILK is serine 473 on AKT [189]. To become fully active AKT is phosphorylated at two sites; threonine 308 and serine 473. The activation of the serine/threonine protein kinase, AKT, is known to regulate phenotypes including cell proliferation, survival, protein synthesis and metabolism [210]. Amplification and activation of AKT have been reported in various tumours including breast cancer [70, 211]. The activity of ILK is negatively regulated by ILKAP [20] and phosphatase and tensin homolog deleted on chromosome 10 (PTEN) [31]. PTEN is a phosphatase involved in the regulation of the cell cycle, preventing cells from growing and dividing too rapidly [212, dephosphorylating  213].  PTEN antagonizes PI3K signaling by  phosphatidylinositol-3,4,5-trisphosphate  (PtdIns(3,4,5)P3)  and  negatively regulating the PI3K/AKT pathway [212, 213]. PTEN mutations and deletions are common in cancers such as glioblastoma, endometrial cancer, prostate cancer, and reduced expression is found in many other tumour types such as lung and breast cancer [212, 213]. PTEN disruption leads to dysregulation of the PI3K/AKT pathway and increased cell proliferation and reduced cell death [212, 213]. The activity of ILK is increased with activity of PtdIns(3,4,5)P3 [189], therefore, mutations in PTEN have been shown to activate ILK [31]. Figure 1.7 illustrates some of the ILK mediated signalling pathways. 1.5.4 The role of ILK in Normal Tissues ILK knock-out studies have indicated the importance of ILK in normal eukaryotic development and physiological function. For example ILK ablation is embryonic lethal in Xenopus laevis [214], mice [215, 216] and zebrafish [183]. These studies show that ILK is critical in the mediation of protein-protein interactions that are related to cytoskeletal  36  Figure 1.7 ILK mediated signalling pathways. Activation of ILK by integrins and growth factors results in the modulation of downstream effectors such as AKT and GSK3 that play a role in motility and contractility, survival, EMT, invasion, proliferation, and angiogenesis. ILK activity is inhibited by ILKAP and PTEN.  Adapted from McDonald, P. C. et al, J Cell Sci 2008;121:3121-3132 37 Figure 1.7 ILK Mediated Signalling Pathways 1  dynamics and activation of signalling pathways involved with development and differentiation [183, 214, 216, 217]. More recently, Fielding et al. showed that ILK plays an important role in the development of mitotic spindle [166, 194, 195], which has implications in terms of ILK’s role in the development of both normal and neoplastic tissue. Tissue specific knock down of ILK, using Cre-lox-driven recombination and RNA interference methods, illustrate that ILK has physiological importance in several major tissue and/or organ systems, including the musculoskeletal system [218-222], smooth muscle [207, 223-227], the kidney [228-231], and liver [232-235], with some of the most profound effects of tissue specific deletions seen in the central nervous system [236240], the immune system [241-243], and the cardiovascular system [183, 207, 244, 245]. ILK’s wide-ranging roles in normal tissue explain its ubiquitous expression in a variety of tissues. Under normal circumstances the expression of ILK is regulated and maintained at baseline levels through the lifespan of cells. Dysregulation of ILK activity or expression is associated with oncogenic effects. 1.5.5 ILK in Carcinogenesis and Role in Human Cancers The presence of ILK in tissues seems to be tightly regulated as over-expression of ILK in model systems leads to the acquisition of oncogenic phenotypes such as increased migration and invasion, proliferation, survival, angiogenesis [48] and epithelial–mesenchymal transition (EMT)  [246]. ILK is over-expressed or has an  increased level of activity in a wide variety of human malignancies including lung [247, 248], brain [249], prostate [250], pancreatic [251], Ewing’s Sarcoma [252], colon [200, 253], gastric [254], ovarian cancers [255], malignant melanomas [256] and thyroid [257] cancers. It has been shown that ILK expression levels correlate with tumour grade,  38  stage and can be prognostic of patient survival in prostate [250], ovarian [255], pancreatic [251], Non-small cell lung carcinoma (NSCLC) [247, 248], colon [253] and melanoma [256].  How tumour cells acquire increased expression of ILK is not well understood. One mechanism was discussed earlier in the context of PTEN expression, however, PTEN mutations are not always present in ILK over-expressing cancers. Despite the vague etiology, the downstream consequences of ILK over-expression are becoming increasingly clear. Informative findings come from studies done with normal cells transfected with a constitutively active ILK gene. Over-expression of wild-type ILK in mammary epithelial cells induced mesenchymal transition where cells exhibited decreased expression of cytokeratin and E-cadherin, while there was an increase in vimentin expression. Furthermore, cells were able to reorganize cytoskeletal actin into stress fibers and these cells exhibited an invasive phenotype [246]. White et al. showed that transgenic mice expressing ILK in the mammary epithelium develop mammary epithelial hyperplasia and focal mammary tumours [22]. It has also been established that cells with high levels of ILK promote cell proliferation, survival and migration [14, 15, 17, 24-35, 39-42]. The over-expression of ILK in epithelial cells has been shown to induce EMT by inhibiting E-cadherin expression and triggering the nuclear translocation of β catenin resulting in a transformed, tumourigenic phenotype [258-260]. Overexpression and constitutive activation of ILK lead to dysregulated growth, suppression of apoptosis and anoikis [26], phenotypes often associated with carcinogenesis. This dysregulation seems to be the direct consequence of the over-activation of the AKT signalling cascade. In mammary cells, the over-expression of ILK has been shown to  39  stimulate anchorage-independent cell growth, cell cycle progression, and constitutive up-regulation of cyclins D and A expression in vivo [20, 21, 204]. Additionally, ILK activity plays an important part in VEGF-mediated endothelial activation and angiogenesis [8, 47, 48]. ILK mediated dysregulation of cytoskeletal components such as actin microfilaments can increase the potential for migration and invasion [40, 41, 261]. The role of ILK in regulation of the microtubule cytoskeleton and mitotic spindle organization may also explain how tumour cells with ILK over-expression develop genomic instability [166, 194, 195]. As cancer cells become dependent on ILK signaling compensatory mechanisms for the activation of the AKT pathway seem to fall apart [202]. Furthermore, tissue specific knock-down of ILK demonstrate its importance in oncogenic progression as carcinogen induced intestinal tumour formation is markedly diminished in the absence of ILK [12].  1.5.6 Targeting ILK for Treatment of Cancer Strategies used to silence ILK expression in tumour cells have been shown to inhibit AKT signalling, oncogenic transformation, cell cycle progression, VEGF secretion and tumour cell growth in vitro and in vivo [7-11, 167, 168, 262]. When this is considered together with the information illustrating the effects of ILK expression on development and progression of cancer (Section 1.5.5) one can confidently state that ILK is a validated therapeutic target with applications in treating cancer. Tools currently used to inhibit ILK expression and activity include pharmaceutically viable smallmolecule inhibitors of ILK that have been synthesized from the K15792 class of the pharmacophore family (see Figure 1.8). The ILK inhibitor, QLT0267 (267) used in this thesis arose from this therapeutic candidate. In addition, gene silencing methods  40  Figure 1.8 Structure of QLT0267. Pharmaceutically viable small-molecule inhibitors of ILK that have been synthesized from the K15792 class of the pharmacophore family. These inhibitors of ILK compete with ATP for the active site of the ILK kinase domain.  Figure 1.8 Structure of QLT0267. 1  41  including ILK targeted antisense sequences and therapeutic siRNA sequences have considerable therapeutic potential. Finally, gene therapy approaches involving creation of dominant negative ILK or expression of small hairpin ribonucleic acids (shRNA) targeting ILK can be considered if appropriate vectors for delivery of these sequences can be defined. Studies using antisense oligonucleotides have shown that reduced ILK expression is correlated with decreases in phosphorylation of AKT at Ser473. The antisense specific decreases in ILK and the associated reductions in P-AKT (Ser473) result in the induction of apoptosis in vitro [14]. In vivo studies using glioblastoma xenografts established that treatment with ILK antisense could arrest tumour growth [14]. This result is important to consider in terms of the work presented in this thesis. It would appear that effective targeting of ILK will be associated with stable disease or slower progress rather than tumour regression. Thus it is argued that ILK inhibition will have to be done in combination with other drugs if responses are going to be seen inpatients [7]. Although there is preclinical evidence to support the development of antisense therapeutics [263-267],  this therapeutic approach has encountered  challenges in that some of the therapeutic effects can be attributed to off-target effects, in particular immune stimulation [266]. Further, antisense oligonucleotides are not very potent, so high doses are required to achieve therapeutic effects [267]. More recently, RNA interference (RNAi) has proven to be a more important tool to study the effects of ILK silencing in cancer development and progression. Studies have shown that ILK silencing impairs phosphorylation of AKT at Ser473 in several cancer models including pancreatic cancer [268] and glioma [269]. Liu et al. showed  42  that the use of ILK siRNA in human tubular epithelial cells inhibited EMT induction after cells were exposed to connective tissue growth factor [270]. Duxbury et al. reported that through the attenuation of P-AKT, ILK knock-down was capable of inducing apoptosis and increased the sensitivity of pancreatic adenocarcinoma cells to gemcitabine [268]. Other studies showed that ILK knock-down using siRNA was able to alter cytoskeletal elements, reducing stress fiber formation, preventing adhesion, cellular spreading and inevitable migration and invasion [23, 30, 48, 269-271]. Although the development of siRNA therapeutics and use of gene therapy strategies to achieve stable expression of shRNA is advancing towards clinical trials [272], this technology remains clinically unproven. Hence a focus on medicinal chemistry and development of small molecule inhibitors of ILK remains the most likely to have clinical applications within the next 10 years. The development of small-molecule inhibitors against ILK activity has provided a robust method of assessing the functions of ILK and the consequences of inhibiting ILK kinase activity in both normal and cancerous tissues. The inhibitors of ILK are adenosine triphosphate (ATP) analogs that compete with ATP for the active site of the ILK kinase domain [9]. The generic structure for the KP15792 class of inhibitors is provided in Figure 1.8. Using small molecule ILK kinase inhibitors derived from this pharmacophore, it has been shown that AKT phosphorylation at Serine 473 can be attenuated in a number of human cancer models with a concomitant induction of apoptosis, decreased EMT, proliferation, angiogenesis, migration and invasion [31, 4548, 201, 259, 260, 269, 273-277]. Of particular importance was a study done by Troussard et al in 2006. This paper suggests that inhibition of ILK activity in cancer cells  43  was indeed able to successfully decrease AKT phosphoryaltion at serine 473 (P-AKT) leading to an induction of apoptosis, but interestingly normal cells were able to activate redundant pathways to re-establish baseline P-AKT [202].  As illustrated in this thesis and elsewhere, QLT0267 has been a very important tool for the study of the effects of ILK inhibition both in vitro and in vivo. Studies have shown that the drug is well tolerated in preclinical animal models and there are no measurable toxicity related side effects at doses of 200 mg/kg given QD (once daily by oral gavauge) for up to 28 days. In vivo, ILK inhibition using QLT0267 has been shown to suppress tumour growth and angiogenesis [7, 34, 47, 257]. Interestingly, some groups have shown this ILK inhibitor to act synergistically with gemcitabine in an orthotopic pancreatic model [34] and cisplatin in a thyroid xenograft model [257].  1.6 Summary This doctoral project focuses on the utility of signal transduction inhibitors targeting ILK in the context of combination therapies to enhance the efficacy of chemotherapies currently used for breast cancer. Enhanced therapy is judged by assays that measure drug-drug interactions that define, using multiple therapeutically relevant endpoints, whether the drug combinations result in synergy or potentiation [157, 158, 278-280]. When considering either of these effects it is important to note that they are associated with immediate therapeutic benefits which result from reductions in drug toxicity [157, 281]. This argument is based on the fact that therapeutic effects comparable to those obtained with the single agent should be achieved when the synergistic combination is used at significantly lower drug doses. Using medium  44  through-put cell based screening assays, one goal of this research was to develop a mechanism-based understanding of drug interactions across multiple therapeutic and/or toxicological endpoints in order to select drug combinations that improve therapeutic outcomes. An outcome from this research is a defined strategy to better understand the utility of molecular targeting strategies, drug combination effects and, hopefully, development of a strategy to better predict the potential of selected drug combinations when used to treat breast cancer patients. As a platform to establish proof-of-concept, the therapeutic effects of QLT0267 were evaluated against highly aggressive breast tumour cell lines. As discussed above, ILK has received a great deal of attention as a therapeutic target in recent years. ILK regulates cell survival and proliferative pathways activated by integrin receptors and receptor tyrosine kinases. ILK activity and/or expression are up-regulated in several types of cancers, especially those with inactivating mutations in the tumour suppressor PTEN. In addition, over-expression of ILK in the mammary gland of transgenic mice induces hyperplasia and tumour formation.  ILK is also activated by EGFR and  Her2/neu, and may play an important role in herceptin resistance. Recently published data also suggests a role for ILK in mitosis. Effective targeting of ILK interferes with the PI3K/AKT survival pathway. Additionally, because ILK plays an adaptor function linking the ECM to the actin cytoarchitecture which in turn mediates cell adhesion, spreading, motility and invasion, ILK targeting strategies may also abrogate these phenotypes. Thus, ILK is an attractive target for therapy due to its relevance in multiple signalling pathways that control key hallmarks of cancer development and progression.  45  However, the rationale for pursuing the further development of ILK inhibitors has been questioned on the basis of poor single agent activity as measured by changes in tumour growth in in vivo models. As already summarized above, ILK inhibitors (such as QLT0267) are mainly cytostatic, therefore, it is argued here that ILK inhibitors will exhibit optimal therapeutic effects only when used in a combination setting. Previous studies have shown that the administration of QLT0267 in combination with gemcitabine resulted in a significant increase in apoptosis [257], and more recently, transfection of hepatoma cell lines with kinase dead ILK mutants increased their sensitivity to the EGFR inhibitors erlotinib, gefitinib and cetuximab in vitro and in vivo [36, 275]. One broad objective of this thesis was to identify agents that could be combined with QLT0267 in breast cancer to produce interactions that are additive or, better yet, synergistic with respect to multiple endpoints in vitro and in vivo. A second objective was to better delineate the mechanisms that contribute to synergy between QLT0267 and the selected therapeutic agent, taxotere. The successful drug combination would ideally limit tumour growth, angiogenesis, and metastasis through effects on key intracellular pathways influenced by ILK.  1.7 Significant Outcomes Results obtained from this research provide a framework for studies that may help to develop a molecular targeted drug in a combination setting with a focus on the identifying synergistic combinations of drugs and determination of mechanism(s) for synergistic interactions. The importance of properly designed animal studies in the assessment of combinations has been exemplified and some of the in vitro work has been successfully translated to preclinical studies which would further promote the use  46  of ILK targeting strategies in combination with docetaxel in clinical studies focused on women with early stage breast cancers. Furthermore, in exploring mechanisms of ILK inhibition, the project outlined has added to the knowledge of ILK signaling pathways. I also provide evidence that ILK ablating strategies could be beneficial in the treatment of Her2neu positive breast cancers.  47  1.8 References 1. 2.  3.  4. 5.  6.  7. 8. 9. 10. 11.  12. 13.  14.  15.  16. 17.  Cianfrocca, M. and W. Gradishar, New molecular classifications of breast cancer. CA Cancer J Clin, 2009. 59(5): p. 303-13. Mullan, P.B. and R.C. Millikan, Molecular subtyping of breast cancer: opportunities for new therapeutic approaches. Cell Mol Life Sci, 2007. 64(24): p. 3219-32. Peppercorn, J., C.M. Perou, and L.A. Carey, Molecular subtypes in breast cancer evaluation and management: divide and conquer. Cancer Invest, 2008. 26(1): p. 1-10. Polyak, K., Breast cancer: origins and evolution. J Clin Invest, 2007. 117(11): p. 3155-63. Tang, P., K.A. Skinner, and D.G. Hicks, Molecular classification of breast carcinomas by immunohistochemical analysis: are we ready? Diagn Mol Pathol, 2009. 18(3): p. 125-32. Voskoglou-Nomikos, T., J.L. Pater, and L. Seymour, Clinical predictive value of the in vitro cell line, human xenograft, and mouse allograft preclinical cancer models. Clin Cancer Res, 2003. 9(11): p. 4227-39. Edwards, L.A., et al., Integrin-linked kinase (ILK) in combination molecular targeting. Cancer Treat Res, 2004. 119: p. 59-75. Hannigan, G., A.A. Troussard, and S. Dedhar, Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer, 2005. 5(1): p. 51-63. McDonald, P.C., A.B. Fielding, and S. Dedhar, Integrin-linked kinase--essential roles in physiology and cancer biology. J Cell Sci, 2008. 121(Pt 19): p. 3121-32. Persad, S. and S. Dedhar, The role of integrin-linked kinase (ILK) in cancer progression. Cancer Metastasis Rev, 2003. 22(4): p. 375-84. Yoganathan, N., et al., Integrin-linked kinase, a promising cancer therapeutic target: biochemical and biological properties. Pharmacol Ther, 2002. 93(2-3): p. 233-42. Assi, K., et al., Integrin-linked kinase regulates cell proliferation and tumour growth in murine colitis-associated carcinogenesis. Gut, 2008. 57(7): p. 931-40. Cordes, N. and D. van Beuningen, Arrest of human lung fibroblasts in G2 phase after irradiation is regulated by converging phosphatidylinositol-3 kinase and beta1-integrin signaling in vitro. Int J Radiat Oncol Biol Phys, 2004. 58(2): p. 45362. Edwards, L.A., et al., Inhibition of ILK in PTEN-mutant human glioblastomas inhibits PKB/Akt activation, induces apoptosis, and delays tumor growth. Oncogene, 2005. 24(22): p. 3596-605. Gagne, D., et al., Integrin-linked kinase regulates migration and proliferation of human intestinal cells under a fibronectin-dependent mechanism. J Cell Physiol. 222(2): p. 387-400. Grashoff, C., et al., Integrin-linked kinase regulates chondrocyte shape and proliferation. EMBO Rep, 2003. 4(4): p. 432-8. Guo, L., et al., Targeting of integrin-linked kinase with a small interfering RNA inhibits endothelial cell migration, proliferation and tube formation in vitro. Ophthalmic Res, 2009. 42(4): p. 213-20.  48  18. 19.  20. 21.  22.  23. 24. 25.  26. 27. 28. 29. 30. 31.  32. 33.  34.  Han, S., et al., Fish oil inhibits human lung carcinoma cell growth by suppressing integrin-linked kinase. Mol Cancer Res, 2009. 7(1): p. 108-17. Hannigan, G.E., et al., Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 1996. 379(6560): p. 91-6. Kumar, A.S., et al., ILKAP regulates ILK signaling and inhibits anchorageindependent growth. Oncogene, 2004. 23(19): p. 3454-61. Radeva, G., et al., Overexpression of the integrin-linked kinase promotes anchorage-independent cell cycle progression. J Biol Chem, 1997. 272(21): p. 13937-44. White, D.E., et al., Mammary epithelial-specific expression of the integrin-linked kinase (ILK) results in the induction of mammary gland hyperplasias and tumors in transgenic mice. Oncogene, 2001. 20(48): p. 7064-72. Wong, R.P., et al., The role of integrin-linked kinase in melanoma cell migration, invasion, and tumor growth. Mol Cancer Ther, 2007. 6(6): p. 1692-700. Abboud, E.R., et al., Integrin-linked kinase: a hypoxia-induced anti-apoptotic factor exploited by cancer cells. Int J Oncol, 2007. 30(1): p. 113-22. Agouni, A., et al., Parathyroid hormone-related protein induces cell survival in human renal cell carcinoma through the PI3K Akt pathway: evidence for a critical role for integrin-linked kinase and nuclear factor kappa B. Carcinogenesis, 2007. 28(9): p. 1893-901. Attwell, S., C. Roskelley, and S. Dedhar, The integrin-linked kinase (ILK) suppresses anoikis. Oncogene, 2000. 19(33): p. 3811-5. Friedrich, E.B., et al., Integrin-linked kinase regulates endothelial cell survival and vascular development. Mol Cell Biol, 2004. 24(18): p. 8134-44. Fukuda, T., et al., CH-ILKBP regulates cell survival by facilitating the membrane translocation of protein kinase B/Akt. J Cell Biol, 2003. 160(7): p. 1001-8. Gary, D.S., et al., Essential role for integrin linked kinase in Akt-mediated integrin survival signaling in hippocampal neurons. J Neurochem, 2003. 84(4): p. 878-90. McDonald, P.C., et al., Rictor and integrin-linked kinase interact and regulate Akt phosphorylation and cancer cell survival. Cancer Res, 2008. 68(6): p. 1618-24. Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTENmutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12. Pinkse, G.G., et al., RGD peptides confer survival to hepatocytes via the beta1integrin-ILK-pAkt pathway. J Hepatol, 2005. 42(1): p. 87-93. Wang, S.C., et al., DOC-2/hDab-2 inhibits ILK activity and induces anoikis in breast cancer cells through an Akt-independent pathway. Oncogene, 2001. 20(47): p. 6960-4. Yau, C.Y., et al., Inhibition of integrin-linked kinase by a selective small molecule inhibitor, QLT0254, inhibits the PI3K/PKB/mTOR, Stat3, and FKHR pathways and tumor growth, and enhances gemcitabine-induced apoptosis in human orthotopic primary pancreatic cancer xenografts. Cancer Res, 2005. 65(4): p. 1497-504.  49  35.  36.  37.  38.  39. 40.  41.  42.  43.  44.  45.  46.  47.  48. 49.  50.  Tabe, Y., et al., Activation of integrin-linked kinase is a critical prosurvival pathway induced in leukemic cells by bone marrow-derived stromal cells. Cancer Res, 2007. 67(2): p. 684-94. Fuchs, B.C., et al., Epithelial-to-mesenchymal transition and integrin-linked kinase mediate sensitivity to epidermal growth factor receptor inhibition in human hepatoma cells. Cancer Res, 2008. 68(7): p. 2391-9. Li, Y., et al., Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest, 2003. 112(4): p. 503-16. Medici, D. and A. Nawshad, Type I collagen promotes epithelial-mesenchymal transition through ILK-dependent activation of NF-kappaB and LEF-1. Matrix Biol, 2009. Acconcia, F., et al., An inherent role of integrin-linked kinase-estrogen receptor alpha interaction in cell migration. Cancer Res, 2006. 66(22): p. 11030-8. Attwell, S., et al., Integration of cell attachment, cytoskeletal localization, and signaling by integrin-linked kinase (ILK), CH-ILKBP, and the tumor suppressor PTEN. Mol Biol Cell, 2003. 14(12): p. 4813-25. Filipenko, N.R., et al., Integrin-linked kinase activity regulates Rac- and Cdc42mediated actin cytoskeleton reorganization via alpha-PIX. Oncogene, 2005. 24(38): p. 5837-49. Qian, Y., et al., ILK mediates actin filament rearrangements and cell migration and invasion through PI3K/Akt/Rac1 signaling. Oncogene, 2005. 24(19): p. 315465. Lin, S.W., et al., Critical involvement of ILK in TGFbeta1-stimulated invasion/migration of human ovarian cancer cells is associated with urokinase plasminogen activator system. Exp Cell Res, 2007. 313(3): p. 602-13. Mi, Z., et al., Integrin-linked kinase regulates osteopontin-dependent MMP-2 and uPA expression to convey metastatic function in murine mammary epithelial cancer cells. Carcinogenesis, 2006. 27(6): p. 1134-45. Rosano, L., et al., Integrin-linked kinase functions as a downstream mediator of endothelin-1 to promote invasive behavior in ovarian carcinoma. Mol Cancer Ther, 2006. 5(4): p. 833-42. Troussard, A.A., et al., The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene, 2000. 19(48): p. 5444-52. Edwards, L.A., et al., Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment by inhibition of integrin-linked kinase (ILK). Mol Cancer Ther, 2008. 7(1): p. 59-70. Tan, C., et al., Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell, 2004. 5(1): p. 79-90. Watanabe, M., et al., Involvement of integrin-linked kinase in capillary/tube-like network formation of human vascular endothelial cells. Biol Proced Online, 2005. 7: p. 41-7. Hanahan, D. and R.A. Weinberg, The hallmarks of cancer. Cell, 2000. 100(1): p. 57-70.  50  51. 52.  53. 54.  55. 56.  57.  58. 59.  60.  61. 62. 63. 64. 65. 66. 67.  68.  Laubenbacher, R., et al., A systems biology view of cancer. Biochim Biophys Acta, 2009. 1796(2): p. 129-39. Verreault, M., et al., Gene silencing in the development of personalized cancer treatment: the targets, the agents and the delivery systems. Curr Gene Ther, 2006. 6(4): p. 505-33. Crown, J., Docetaxel: overview of an active drug for breast cancer. Oncologist, 2001. 6 Suppl 3: p. 1-4. Crown, J., M. O'Leary, and W.S. Ooi, Docetaxel and paclitaxel in the treatment of breast cancer: a review of clinical experience. Oncologist, 2004. 9 Suppl 2: p. 24-32. Saloustros, E., D. Mavroudis, and V. Georgoulias, Paclitaxel and docetaxel in the treatment of breast cancer. Expert Opin Pharmacother, 2008. 9(15): p. 2603-16. Society, C.C. Canadian Cancer Stastics 2009. 2009; Available from: http://www.cancer.ca/Canadawide/About%20cancer/Cancer%20statistics/~/media/CCS/Canada%20wide/Files %20List/English%20files%20heading/pdf%20not%20in%20publications%20secti on/Stats%202009E%20Cdn%20Cancer.ashx. Autier, P., et al., Advanced breast cancer and breast cancer mortality in randomized controlled trials on mammography screening. J Clin Oncol, 2009. 27(35): p. 5919-23. Gotzsche, P.C. and M. Nielsen, Screening for breast cancer with mammography. Cochrane Database Syst Rev, 2009(4): p. CD001877. Vinay Kumar, M., MD, FRCPath, Abul K. Abbas, MBBS, Nelson Fausto, MD and Jon Aster, MD Robbins and Cotran Pathologic Basis of Disease, Professional Edition, 8th Edition. 2008. Zahl, P.H., J. Maehlen, and H.G. Welch, The natural history of invasive breast cancers detected by screening mammography. Arch Intern Med, 2008. 168(21): p. 2311-6. Barbara Young, J.L., Alan Stevens, John Heath, Philip Deakin, Wheater's Functional Histology. 2010. Howard, B.A. and B.A. Gusterson, Human breast development. J Mammary Gland Biol Neoplasia, 2000. 5(2): p. 119-37. Neville, M.C., Physiology of lactation. Clin Perinatol, 1999. 26(2): p. 251-79, v. Neville, M.C., Anatomy and physiology of lactation. Pediatr Clin North Am, 2001. 48(1): p. 13-34. Knight, C.H. and M. Peaker, Development of the mammary gland. J Reprod Fertil, 1982. 65(2): p. 521-36. Seltzer, V., The breast: embryology, development, and anatomy. Clin Obstet Gynecol, 1994. 37(4): p. 879-80. Longacre, T.A. and S.A. Bartow, A correlative morphologic study of human breast and endometrium in the menstrual cycle. Am J Surg Pathol, 1986. 10(6): p. 382-93. Ramakrishnan, R., S.A. Khan, and S. Badve, Morphological changes in breast tissue with menstrual cycle. Mod Pathol, 2002. 15(12): p. 1348-56.  51  69.  70. 71.  72. 73. 74. 75. 76. 77.  78. 79. 80. 81. 82. 83. 84. 85. 86.  87. 88. 89.  Sternlicht, M.D., Key stages in mammary gland development: the cues that regulate ductal branching morphogenesis. Breast Cancer Res, 2006. 8(1): p. 201. Watson, C.J., Post-lactational mammary gland regression: molecular basis and implications for breast cancer. Expert Rev Mol Med, 2006. 8(32): p. 1-15. Watson, C.J., Involution: apoptosis and tissue remodelling that convert the mammary gland from milk factory to a quiescent organ. Breast Cancer Res, 2006. 8(2): p. 203. Kent, J.C., How breastfeeding works. J Midwifery Womens Health, 2007. 52(6): p. 564-70. Master, S.R. and L.A. Chodosh, Evolving views of involution. Breast Cancer Res, 2004. 6(2): p. 89-92. McManaman, J.L. and M.C. Neville, Mammary physiology and milk secretion. Adv Drug Deliv Rev, 2003. 55(5): p. 629-41. Walker, R.A. and C.V. Martin, The aged breast. J Pathol, 2007. 211(2): p. 23240. Lanigan, F., et al., Molecular links between mammary gland development and breast cancer. Cell Mol Life Sci, 2007. 64(24): p. 3159-84. Monks, J. and P.M. Henson, Differentiation of the mammary epithelial cell during involution: implications for breast cancer. J Mammary Gland Biol Neoplasia, 2009. 14(2): p. 159-70. Vetto, J.T., S.W. Luoh, and A. Naik, Breast cancer in premenopausal women. Curr Probl Surg, 2009. 46(12): p. 944-1004. Visvader, J.E., Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis. Genes Dev, 2009. 23(22): p. 2563-77. Institute, N.C. The Breast Cancer Risk Assessment Tool 2010; Available from: http://www.cancer.gov/bcrisktool/. Miller, K., Estrogen and DNA damage: the silent source of breast cancer? J Natl Cancer Inst, 2003. 95(2): p. 100-2. Yager, J.D. and N.E. Davidson, Estrogen carcinogenesis in breast cancer. N Engl J Med, 2006. 354(3): p. 270-82. Yager, J.D. and J.G. Liehr, Molecular mechanisms of estrogen carcinogenesis. Annu Rev Pharmacol Toxicol, 1996. 36: p. 203-32. Russo, J., et al., Estrogen and its metabolites are carcinogenic agents in human breast epithelial cells. J Steroid Biochem Mol Biol, 2003. 87(1): p. 1-25. Katzenellenbogen, B.S., Estrogen receptors: bioactivities and interactions with cell signaling pathways. Biol Reprod, 1996. 54(2): p. 287-93. Fox, E.M., J. Andrade, and M.A. Shupnik, Novel actions of estrogen to promote proliferation: integration of cytoplasmic and nuclear pathways. Steroids, 2009. 74(7): p. 622-7. Bradbury, A.R. and O.I. Olopade, Genetic susceptibility to breast cancer. Rev Endocr Metab Disord, 2007. 8(3): p. 255-67. Ripperger, T., et al., Breast cancer susceptibility: current knowledge and implications for genetic counselling. Eur J Hum Genet, 2009. 17(6): p. 722-31. Marshall, M. and S. Solomon, Hereditary breast-ovarian cancer: clinical findings and medical management. Plast Surg Nurs, 2007. 27(3): p. 124-7.  52  90. 91.  92. 93.  94. 95. 96.  97. 98.  99. 100. 101. 102. 103. 104. 105. 106. 107.  108. 109.  Scully, R. and N. Puget, BRCA1 and BRCA2 in hereditary breast cancer. Biochimie, 2002. 84(1): p. 95-102. Evans, D.G., et al., Penetrance estimates for BRCA1 and BRCA2 based on genetic testing in a Clinical Cancer Genetics service setting: risks of breast/ovarian cancer quoted should reflect the cancer burden in the family. BMC Cancer, 2008. 8: p. 155. Bertwistle, D. and A. Ashworth, Functions of the BRCA1 and BRCA2 genes. Curr Opin Genet Dev, 1998. 8(1): p. 14-20. Bertwistle, D. and A. Ashworth, The pathology of familial breast cancer: How do the functions of BRCA1 and BRCA2 relate to breast tumour pathology? Breast Cancer Res, 1999. 1(1): p. 41-7. Boulton, S.J., Cellular functions of the BRCA tumour-suppressor proteins. Biochem Soc Trans, 2006. 34(Pt 5): p. 633-45. Deng, C.X. and S.G. Brodie, Roles of BRCA1 and its interacting proteins. Bioessays, 2000. 22(8): p. 728-37. Starita, L.M. and J.D. Parvin, The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair. Curr Opin Cell Biol, 2003. 15(3): p. 345-50. Venkitaraman, A.R., Functions of BRCA1 and BRCA2 in the biological response to DNA damage. J Cell Sci, 2001. 114(Pt 20): p. 3591-8. Yoshida, K. and Y. Miki, Role of BRCA1 and BRCA2 as regulators of DNA repair, transcription, and cell cycle in response to DNA damage. Cancer Sci, 2004. 95(11): p. 866-71. de Jong, M.M., et al., Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility. J Med Genet, 2002. 39(4): p. 225-42. Walsh, T., et al., Spectrum of mutations in BRCA1, BRCA2, CHEK2, and TP53 in families at high risk of breast cancer. JAMA, 2006. 295(12): p. 1379-88. Ghoussaini, M. and P.D. Pharoah, Polygenic susceptibility to breast cancer: current state-of-the-art. Future Oncol, 2009. 5(5): p. 689-701. Peto, J., Breast cancer susceptibility-A new look at an old model. Cancer Cell, 2002. 1(5): p. 411-2. Pharoah, P.D., Genetic susceptibility, predicting risk and preventing cancer. Recent Results Cancer Res, 2003. 163: p. 7-18; discussion 264-6. Pharoah, P.D., et al., Polygenic susceptibility to breast cancer and implications for prevention. Nat Genet, 2002. 31(1): p. 33-6. Russo, J. and I.H. Russo, The pathway of neoplastic transformation of human breast epithelial cells. Radiat Res, 2001. 155(1 Pt 2): p. 151-154. Locopo, N., M. Fanelli, and G. Gasparini, Clinical significance of angiogenic factors in breast cancer. Breast Cancer Res Treat, 1998. 52(1-3): p. 159-73. Manders, P., et al., The prognostic value of vascular endothelial growth factor in 574 node-negative breast cancer patients who did not receive adjuvant systemic therapy. Br J Cancer, 2002. 87(7): p. 772-8. Sledge, G.W., Jr., Vascular endothelial growth factor in breast cancer: biologic and therapeutic aspects. Semin Oncol, 2002. 29(3 Suppl 11): p. 104-10. Atiqur Rahman, M. and M. Toi, Anti-angiogenic therapy in breast cancer. Biomed Pharmacother, 2003. 57(10): p. 463-70.  53  110. 111. 112.  113. 114. 115. 116. 117. 118.  119. 120. 121. 122.  123.  124.  125.  126. 127. 128.  Cirillo, D., et al., Leptin signaling in breast cancer: an overview. J Cell Biochem, 2008. 105(4): p. 956-64. Alix-Panabieres, C., V. Muller, and K. Pantel, Current status in human breast cancer micrometastasis. Curr Opin Oncol, 2007. 19(6): p. 558-63. Chambers, A.F., et al., Molecular biology of breast cancer metastasis. Clinical implications of experimental studies on metastatic inefficiency. Breast Cancer Res, 2000. 2(6): p. 400-7. Cunnick, G.H., et al., Lymphangiogenesis and breast cancer metastasis. Histol Histopathol, 2002. 17(3): p. 863-70. Parker, B. and S. Sukumar, Distant metastasis in breast cancer: molecular mechanisms and therapeutic targets. Cancer Biol Ther, 2003. 2(1): p. 14-21. Rabbani, S.A. and A.P. Mazar, Evaluating distant metastases in breast cancer: from biology to outcomes. Cancer Metastasis Rev, 2007. 26(3-4): p. 663-74. Woodward, W.A. and M. Cristofanilli, Inflammatory breast cancer. Semin Radiat Oncol, 2009. 19(4): p. 256-65. Fukutomi, T. and S. Akashi-Tanaka, Prognostic and predictive factors in the adjuvant treatment of breast cancer. Breast Cancer, 2002. 9(2): p. 95-9. Hayes, D.F., C. Isaacs, and V. Stearns, Prognostic factors in breast cancer: current and new predictors of metastasis. J Mammary Gland Biol Neoplasia, 2001. 6(4): p. 375-92. Isaacs, C., V. Stearns, and D.F. Hayes, New prognostic factors for breast cancer recurrence. Semin Oncol, 2001. 28(1): p. 53-67. Soerjomataram, I., et al., An overview of prognostic factors for long-term survivors of breast cancer. Breast Cancer Res Treat, 2008. 107(3): p. 309-30. Cheang, M.C., M. van de Rijn, and T.O. Nielsen, Gene expression profiling of breast cancer. Annu Rev Pathol, 2008. 3: p. 67-97. Nielsen, T.O., et al., Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res, 2004. 10(16): p. 5367-74. Raica, M., et al., From conventional pathologic diagnosis to the molecular classification of breast carcinoma: are we ready for the change? Rom J Morphol Embryol, 2009. 50(1): p. 5-13. Sorlie, T., et al., Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A, 2001. 98(19): p. 10869-74. Guarneri, V. and P. Conte, Metastatic breast cancer: therapeutic options according to molecular subtypes and prior adjuvant therapy. Oncologist, 2009. 14(7): p. 645-56. Guarneri, V., et al., Primary systemic therapy for operable breast cancer: a review of clinical trials and perspectives. Cancer Lett, 2007. 248(2): p. 175-85. Bourgier, C., M. Ozsahin, and D. Azria, Multidisciplinary approach of early breast cancer: The biology applied to radiation oncology. Radiat Oncol. 5(1): p. 2. Adjuvant systemic therapy for women with node-positive breast cancer. The Steering Committee on Clinical Practice Guidelines for the Care and Treatment of Breast Cancer. CMAJ, 1998. 158 Suppl 3: p. S52-64.  54  129.  130. 131. 132. 133.  134. 135. 136.  137.  138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. 149.  Jonat, W., et al., Trends in endocrine therapy and chemotherapy for early breast cancer: a focus on the premenopausal patient. J Cancer Res Clin Oncol, 2006. 132(5): p. 275-86. Trudeau, M.E., Optimizing adjuvant breast cancer chemotherapy: rationale for the MA.21 study. Oncology (Williston Park), 2001. 15(5 Suppl 7): p. 7-13. Gutteridge, E., et al., The effects of gefitinib in tamoxifen-resistant and hormoneinsensitive breast cancer: A phase II study. Int J Cancer, 2009. Lurje, G. and H.J. Lenz, EGFR Signaling and Drug Discovery. Oncology. 77(6): p. 400-410. Modjtahedi, H. and S. Essapen, Epidermal growth factor receptor inhibitors in cancer treatment: advances, challenges and opportunities. Anticancer Drugs, 2009. 20(10): p. 851-5. Kurosumi, M., Recent trends of HER-2 testing and trastuzumab therapy for breast cancer. Breast Cancer, 2009. 16(4): p. 284-7. Normanno, N., et al., Target-based therapies in breast cancer: current status and future perspectives. Endocr Relat Cancer, 2009. 16(3): p. 675-702. Spector, N.L. and K.L. Blackwell, Understanding the mechanisms behind trastuzumab therapy for human epidermal growth factor receptor 2-positive breast cancer. J Clin Oncol, 2009. 27(34): p. 5838-47. Frampton, J.E., Lapatinib: a review of its use in the treatment of HER2overexpressing, trastuzumab-refractory, advanced or metastatic breast cancer. Drugs, 2009. 69(15): p. 2125-48. Frenel, J.S., et al., Lapatinib in metastatic breast cancer. Womens Health (Lond Engl), 2009. 5(6): p. 603-12. Roy, V. and E.A. Perez, Beyond trastuzumab: small molecule tyrosine kinase inhibitors in HER-2-positive breast cancer. Oncologist, 2009. 14(11): p. 1061-9. Hayes, D.F., K. Miller, and G. Sledge, Angiogenesis as targeted breast cancer therapy. Breast, 2007. 16 Suppl 2: p. S17-9. Khosravi Shahi, P., A. Soria Lovelle, and G. Perez Manga, Tumoral angiogenesis and breast cancer. Clin Transl Oncol, 2009. 11(3): p. 138-42. Traina, T.A., Bevacizumab in the treatment of metastatic breast cancer. Oncology (Williston Park), 2009. 23(4): p. 327-32. Chow, L.Q. and S.G. Eckhardt, Sunitinib: from rational design to clinical efficacy. J Clin Oncol, 2007. 25(7): p. 884-96. Ivy, S.P., J.Y. Wick, and B.M. Kaufman, An overview of small-molecule inhibitors of VEGFR signaling. Nat Rev Clin Oncol, 2009. 6(10): p. 569-79. Pytel, D., et al., Tyrosine kinase blockers: new hope for successful cancer therapy. Anticancer Agents Med Chem, 2009. 9(1): p. 66-76. Dizdar, O. and K. Altundag, Emerging drugs in metastatic breast cancer. Expert Opin Emerg Drugs, 2009. 14(1): p. 85-98. Higa, G.M., Breast cancer: beyond the cutting edge. Expert Opin Pharmacother, 2009. 10(15): p. 2479-98. Higa, G.M. and J. Abraham, Biological mechanisms of bevacizumab-associated adverse events. Expert Rev Anticancer Ther, 2009. 9(7): p. 999-1007. Morris, P.G. and C.A. Hudis, Personalizing therapy for metastatic breast cancer. Expert Rev Anticancer Ther, 2009. 9(9): p. 1223-6.  55  150. 151. 152.  153.  154. 155. 156. 157.  158. 159.  160. 161. 162.  163.  164.  165. 166. 167.  Morris, P.G., H.L. McArthur, and C.A. Hudis, Therapeutic options for metastatic breast cancer. Expert Opin Pharmacother, 2009. 10(6): p. 967-81. Parker, J.S., et al., Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin Oncol, 2009. 27(8): p. 1160-7. Sparano, J.A., Taxanes for breast cancer: an evidence-based review of randomized phase II and phase III trials. Clin Breast Cancer, 2000. 1(1): p. 3240; discussion 41-2. Hugh, J., et al., Breast cancer subtypes and response to docetaxel in nodepositive breast cancer: use of an immunohistochemical definition in the BCIRG 001 trial. J Clin Oncol, 2009. 27(8): p. 1168-76. Dawson, S.J., E. Provenzano, and C. Caldas, Triple negative breast cancers: clinical and prognostic implications. Eur J Cancer, 2009. 45 Suppl 1: p. 27-40. Rakha, E.A. and I.O. Ellis, Triple-negative/basal-like breast cancer: review. Pathology, 2009. 41(1): p. 40-7. Rakha, E.A., et al., Triple-negative breast cancer: distinguishing between basal and nonbasal subtypes. Clin Cancer Res, 2009. 15(7): p. 2302-10. Dawn N. Waterhouse, J.K., Maite Verreault, Euan Ramsay, Wieslawa Dragowska, Donald Yapp, Murray Webb, Gigi Chiu, Marcel B. Bally, ed. M.N.V.R. Kumar. 2008. Zoli, W., et al., In vitro preclinical models for a rational design of chemotherapy combinations in human tumors. Crit Rev Oncol Hematol, 2001. 37(1): p. 69-82. Dedhar, S., B. Williams, and G. Hannigan, Integrin-linked kinase (ILK): a regulator of integrin and growth-factor signalling. Trends Cell Biol, 1999. 9(8): p. 319-23. Legate, K.R. and R. Fassler, Mechanisms that regulate adaptor binding to betaintegrin cytoplasmic tails. J Cell Sci, 2009. 122(Pt 2): p. 187-98. Legate, K.R., et al., ILK, PINCH and parvin: the tIPP of integrin signalling. Nat Rev Mol Cell Biol, 2006. 7(1): p. 20-31. Li, F., Y. Zhang, and C. Wu, Integrin-linked kinase is localized to cell-matrix focal adhesions but not cell-cell adhesion sites and the focal adhesion localization of integrin-linked kinase is regulated by the PINCH-binding ANK repeats. J Cell Sci, 1999. 112 ( Pt 24): p. 4589-99. Nikolopoulos, S.N. and C.E. Turner, Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J Biol Chem, 2001. 276(26): p. 23499-505. Tu, Y., et al., A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol, 2001. 153(3): p. 585-98. Yang, Y., et al., Structural basis of focal adhesion localization of LIM-only adaptor PINCH by integrin-linked kinase. J Biol Chem, 2009. 284(9): p. 5836-44. Fielding, A.B. and S. Dedhar, The mitotic functions of integrin-linked kinase. Cancer Metastasis Rev, 2009. 28(1-2): p. 99-111. Hehlgans, S., M. Haase, and N. Cordes, Signalling via integrins: implications for cell survival and anticancer strategies. Biochim Biophys Acta, 2007. 1775(1): p. 163-80.  56  168. 169. 170. 171. 172. 173.  174. 175.  176. 177. 178.  179.  180.  181.  182.  183.  184.  185.  Yoganathan, T.N., et al., Integrin-linked kinase (ILK): a "hot" therapeutic target. Biochem Pharmacol, 2000. 60(8): p. 1115-9. Hannigan, G.E., et al., Mapping of the gene encoding the integrin-linked kinase, ILK, to human chromosome 11p15.5-p15.4. Genomics, 1997. 42(1): p. 177-9. Dobreva, I., et al., Mapping the integrin-linked kinase interactome using SILAC. J Proteome Res, 2008. 7(4): p. 1740-9. Huang, Y. and C. Wu, Integrin-linked kinase and associated proteins (review). Int J Mol Med, 1999. 3(6): p. 563-72. Wu, C., ILK interactions. J Cell Sci, 2001. 114(Pt 14): p. 2549-50. Chiswell, B.P., et al., Structural basis of competition between PINCH1 and PINCH2 for binding to the ankyrin repeat domain of integrin-linked kinase. J Struct Biol, 2009. Chiswell, B.P., et al., The structural basis of integrin-linked kinase-PINCH interactions. Proc Natl Acad Sci U S A, 2008. 105(52): p. 20677-82. Fukuda, T., et al., PINCH-1 is an obligate partner of integrin-linked kinase (ILK) functioning in cell shape modulation, motility, and survival. J Biol Chem, 2003. 278(51): p. 51324-33. Wu, C., The PINCH-ILK-parvin complexes: assembly, functions and regulation. Biochim Biophys Acta, 2004. 1692(2-3): p. 55-62. Wu, C., PINCH, N(i)ck and the ILK: network wiring at cell-matrix adhesions. Trends Cell Biol, 2005. 15(9): p. 460-6. Zhang, Y., et al., Characterization of PINCH-2, a new focal adhesion protein that regulates the PINCH-1-ILK interaction, cell spreading, and migration. J Biol Chem, 2002. 277(41): p. 38328-38. Zhang, Y., et al., Assembly of the PINCH-ILK-CH-ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci, 2002. 115(Pt 24): p. 4777-86. Zhang, Y., et al., A critical role of the PINCH-integrin-linked kinase interaction in the regulation of cell shape change and migration. J Biol Chem, 2002. 277(1): p. 318-26. Tu, Y., et al., The LIM-only protein PINCH directly interacts with integrin-linked kinase and is recruited to integrin-rich sites in spreading cells. Mol Cell Biol, 1999. 19(3): p. 2425-34. Guo, L. and C. Wu, Regulation of fibronectin matrix deposition and cell proliferation by the PINCH-ILK-CH-ILKBP complex. FASEB J, 2002. 16(10): p. 1298-300. Bendig, G., et al., Integrin-linked kinase, a novel component of the cardiac mechanical stretch sensor, controls contractility in the zebrafish heart. Genes Dev, 2006. 20(17): p. 2361-72. Yamaji, S., et al., Possible role of ILK-affixin complex in integrin-cytoskeleton linkage during platelet aggregation. Biochem Biophys Res Commun, 2002. 297(5): p. 1324-31. Yamaji, S., et al., Affixin interacts with alpha-actinin and mediates integrin signaling for reorganization of F-actin induced by initial cell-substrate interaction. J Cell Biol, 2004. 165(4): p. 539-51.  57  186.  187.  188.  189.  190.  191. 192.  193. 194.  195. 196. 197.  198.  199.  200.  201.  Yamaji, S., et al., A novel integrin-linked kinase-binding protein, affixin, is involved in the early stage of cell-substrate interaction. J Cell Biol, 2001. 153(6): p. 1251-64. Nikolopoulos, S.N. and C.E. Turner, Molecular dissection of actopaxin-integrinlinked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem, 2002. 277(2): p. 1568-75. Leung-Hagesteijn, C., et al., Modulation of integrin signal transduction by ILKAP, a protein phosphatase 2C associating with the integrin-linked kinase, ILK1. EMBO J, 2001. 20(9): p. 2160-70. Delcommenne, M., et al., Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A, 1998. 95(19): p. 11211-6. Persad, S., et al., Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem, 2001. 276(29): p. 27462-9. Wymann, M.P. and L. Pirola, Structure and function of phosphoinositide 3kinases. Biochim Biophys Acta, 1998. 1436(1-2): p. 127-50. Wu, C., Integrin-linked kinase and PINCH: partners in regulation of cellextracellular matrix interaction and signal transduction. J Cell Sci, 1999. 112 ( Pt 24): p. 4485-9. Liu, S., D.A. Calderwood, and M.H. Ginsberg, Integrin cytoplasmic domainbinding proteins. J Cell Sci, 2000. 113 ( Pt 20): p. 3563-71. Fielding, A.B., I. Dobreva, and S. Dedhar, Beyond focal adhesions: integrinlinked kinase associates with tubulin and regulates mitotic spindle organization. Cell Cycle, 2008. 7(13): p. 1899-906. Fielding, A.B., et al., Integrin-linked kinase localizes to the centrosome and regulates mitotic spindle organization. J Cell Biol, 2008. 180(4): p. 681-9. Dedhar, S., Cell-substrate interactions and signaling through ILK. Curr Opin Cell Biol, 2000. 12(2): p. 250-6. Imanishi, Y., et al., Angiopoietin-2 stimulates breast cancer metastasis through the alpha(5)beta(1) integrin-mediated pathway. Cancer Res, 2007. 67(9): p. 4254-63. Xie, D., et al., Cyr61 is overexpressed in gliomas and involved in integrin-linked kinase-mediated Akt and beta-catenin-TCF/Lef signaling pathways. Cancer Res, 2004. 64(6): p. 1987-96. Lee, S.P., et al., Integrin-linked kinase, a hypoxia-responsive molecule, controls postnatal vasculogenesis by recruitment of endothelial progenitor cells to ischemic tissue. Circulation, 2006. 114(2): p. 150-9. Bravou, V., et al., ILK over-expression in human colon cancer progression correlates with activation of beta-catenin, down-regulation of E-cadherin and activation of the Akt-FKHR pathway. J Pathol, 2006. 208(1): p. 91-9. Koul, D., et al., Targeting integrin-linked kinase inhibits Akt signaling pathways and decreases tumor progression of human glioblastoma. Mol Cancer Ther, 2005. 4(11): p. 1681-8.  58  202.  203.  204.  205.  206.  207.  208.  209.  210. 211. 212.  213. 214.  215. 216.  217.  Troussard, A.A., et al., Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res, 2006. 66(1): p. 393-403. Cordes, N. and D. van Beuningen, Cell adhesion to the extracellular matrix protein fibronectin modulates radiation-dependent G2 phase arrest involving integrin-linked kinase (ILK) and glycogen synthase kinase-3beta (GSK-3beta) in vitro. Br J Cancer, 2003. 88(9): p. 1470-9. D'Amico, M., et al., The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3beta and cAMP-responsive element-binding protein-dependent pathways. J Biol Chem, 2000. 275(42): p. 32649-57. Joshi, M.B., et al., Integrin-linked kinase is an essential mediator for T-cadherindependent signaling via Akt and GSK3beta in endothelial cells. FASEB J, 2007. 21(12): p. 3083-95. Troussard, A.A., et al., Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3dependent manner. Mol Cell Biol, 1999. 19(11): p. 7420-7. Wilson, D.P., et al., Integrin-linked kinase is responsible for Ca2+-independent myosin diphosphorylation and contraction of vascular smooth muscle. Biochem J, 2005. 392(Pt 3): p. 641-8. Mulrooney, J., et al., Phosphorylation of the beta1 integrin cytoplasmic domain: toward an understanding of function and mechanism. Exp Cell Res, 2000. 258(2): p. 332-41. Pasquet, J.M., M. Noury, and A.T. Nurden, Evidence that the platelet integrin alphaIIb beta3 is regulated by the integrin-linked kinase, ILK, in a PI3-kinase dependent pathway. Thromb Haemost, 2002. 88(1): p. 115-22. Liu, P., et al., Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov, 2009. 8(8): p. 627-44. Cicenas, J., The potential role of Akt phosphorylation in human cancers. Int J Biol Markers, 2008. 23(1): p. 1-9. Knobbe, C.B., et al., The roles of PTEN in development, physiology and tumorigenesis in mouse models: a tissue-by-tissue survey. Oncogene, 2008. 27(41): p. 5398-415. Leslie, N.R. and C.P. Downes, PTEN function: how normal cells control it and tumour cells lose it. Biochem J, 2004. 382(Pt 1): p. 1-11. Yasunaga, T., et al., Xenopus ILK (integrin-linked kinase) is required for morphogenetic movements during gastrulation. Genes Cells, 2005. 10(4): p. 36979. Lange, A., et al., Integrin-linked kinase is an adaptor with essential functions during mouse development. Nature, 2009. 461(7266): p. 1002-6. Sakai, T., et al., Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev, 2003. 17(7): p. 926-40. Knoll, R., et al., Laminin-alpha4 and integrin-linked kinase mutations cause human cardiomyopathy via simultaneous defects in cardiomyocytes and endothelial cells. Circulation, 2007. 116(5): p. 515-25.  59  218.  219. 220.  221.  222.  223.  224. 225.  226.  227.  228.  229.  230. 231.  232.  233.  Gheyara, A.L., et al., Deletion of integrin-linked kinase from skeletal muscles of mice resembles muscular dystrophy due to alpha 7 beta 1-integrin deficiency. Am J Pathol, 2007. 171(6): p. 1966-77. Huang, Y., et al., The roles of integrin-linked kinase in the regulation of myogenic differentiation. J Cell Biol, 2000. 150(4): p. 861-72. Terpstra, L., et al., Reduced chondrocyte proliferation and chondrodysplasia in mice lacking the integrin-linked kinase in chondrocytes. J Cell Biol, 2003. 162(1): p. 139-48. Wang, H.V., et al., Integrin-linked kinase stabilizes myotendinous junctions and protects muscle from stress-induced damage. J Cell Biol, 2008. 180(5): p. 103749. Zaucke, F. and S. Grassel, Genetic mouse models for the functional analysis of the perifibrillar components collagen IX, COMP and matrilin-3: Implications for growth cartilage differentiation and endochondral ossification. Histol Histopathol, 2009. 24(8): p. 1067-79. Friedrich, E.B., et al., Role of integrin-linked kinase in vascular smooth muscle cells: regulation by statins and angiotensin II. Biochem Biophys Res Commun, 2006. 349(3): p. 883-9. Ho, B. and M.P. Bendeck, Integrin linked kinase (ILK) expression and function in vascular smooth muscle cells. Cell Adh Migr, 2009. 3(2): p. 174-6. Kogata, N., et al., Integrin-linked kinase controls vascular wall formation by negatively regulating Rho/ROCK-mediated vascular smooth muscle cell contraction. Genes Dev, 2009. 23(19): p. 2278-83. Wu, Y., et al., Integrin-linked kinase regulates smooth muscle differentiation marker gene expression in airway tissue. Am J Physiol Lung Cell Mol Physiol, 2008. 295(6): p. L988-97. Zhang, W., et al., Integrin-linked kinase regulates N-WASp-mediated actin polymerization and tension development in tracheal smooth muscle. J Biol Chem, 2007. 282(47): p. 34568-80. Dai, C., et al., Essential role of integrin-linked kinase in podocyte biology: Bridging the integrin and slit diaphragm signaling. J Am Soc Nephrol, 2006. 17(8): p. 2164-75. Kanasaki, K., et al., Integrin beta1-mediated matrix assembly and signaling are critical for the normal development and function of the kidney glomerulus. Dev Biol, 2008. 313(2): p. 584-93. Keskanokwong, T., et al., Interaction of integrin-linked kinase with the kidney chloride/bicarbonate exchanger, kAE1. J Biol Chem, 2007. 282(32): p. 23205-18. El-Aouni, C., et al., Podocyte-specific deletion of integrin-linked kinase results in severe glomerular basement membrane alterations and progressive glomerulosclerosis. J Am Soc Nephrol, 2006. 17(5): p. 1334-44. Donthamsetty, S., et al., Liver-specific ablation of integrin-linked kinase in mice results in enhanced and prolonged cell proliferation and hepatomegaly after phenobarbital administration. Toxicol Sci. 113(2): p. 358-66. Gkretsi, V., et al., Liver-specific ablation of integrin-linked kinase in mice results in abnormal histology, enhanced cell proliferation, and hepatomegaly. Hepatology, 2008. 48(6): p. 1932-41.  60  234. 235.  236.  237.  238. 239. 240.  241. 242. 243. 244. 245.  246. 247. 248. 249.  250. 251.  252.  Gkretsi, V., et al., Integrin-linked kinase is involved in matrix-induced hepatocyte differentiation. Biochem Biophys Res Commun, 2007. 353(3): p. 638-43. Gkretsi, V., et al., Loss of integrin linked kinase from mouse hepatocytes in vitro and in vivo results in apoptosis and hepatitis. Hepatology, 2007. 45(4): p. 102534. Belvindrah, R., et al., Integrin-linked kinase regulates Bergmann glial differentiation during cerebellar development. Mol Cell Neurosci, 2006. 33(2): p. 109-25. Chun, S.J., et al., Integrin-linked kinase is required for laminin-2-induced oligodendrocyte cell spreading and CNS myelination. J Cell Biol, 2003. 163(2): p. 397-408. Mills, J., et al., Role of integrin-linked kinase in nerve growth factor-stimulated neurite outgrowth. J Neurosci, 2003. 23(5): p. 1638-48. Mills, J., et al., Critical role of integrin-linked kinase in granule cell precursor proliferation and cerebellar development. J Neurosci, 2006. 26(3): p. 830-40. Pereira, J.A., et al., Integrin-linked kinase is required for radial sorting of axons and Schwann cell remyelination in the peripheral nervous system. J Cell Biol, 2009. 185(1): p. 147-61. Friedrich, E.B., et al., Role of integrin-linked kinase in leukocyte recruitment. J Biol Chem, 2002. 277(19): p. 16371-5. Liu, E., et al., Targeted deletion of integrin-linked kinase reveals a role in T-cell chemotaxis and survival. Mol Cell Biol, 2005. 25(24): p. 11145-55. Yoshimi, R., et al., The gamma-parvin-integrin-linked kinase complex is critically involved in leukocyte-substrate interaction. J Immunol, 2006. 176(6): p. 3611-24. Hannigan, G.E., J.G. Coles, and S. Dedhar, Integrin-linked kinase at the heart of cardiac contractility, repair, and disease. Circ Res, 2007. 100(10): p. 1408-14. White, D.E., et al., Targeted ablation of ILK from the murine heart results in dilated cardiomyopathy and spontaneous heart failure. Genes Dev, 2006. 20(17): p. 2355-60. Somasiri, A., et al., Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 2001. 114(Pt 6): p. 1125-36. Takanami, I., Increased expression of integrin-linked kinase is associated with shorter survival in non-small cell lung cancer. BMC Cancer, 2005. 5: p. 1. Okamura, M., et al., Prognostic value of integrin beta1-ILK-pAkt signaling pathway in non-small cell lung cancer. Hum Pathol, 2007. 38(7): p. 1081-91. Obara, S., et al., Integrin-linked kinase (ILK) regulation of the cell viability in PTEN mutant glioblastoma and in vitro inhibition by the specific COX-2 inhibitor NS-398. Cancer Lett, 2004. 208(1): p. 115-22. Graff, J.R., et al., Integrin-linked kinase expression increases with prostate tumor grade. Clin Cancer Res, 2001. 7(7): p. 1987-91. Sawai, H., et al., Integrin-linked kinase activity is associated with interleukin-1 alpha-induced progressive behavior of pancreatic cancer and poor patient survival. Oncogene, 2006. 25(23): p. 3237-46. Chung, D.H., et al., ILK (beta1-integrin-linked protein kinase): a novel immunohistochemical marker for Ewing's sarcoma and primitive neuroectodermal tumour. Virchows Arch, 1998. 433(2): p. 113-7.  61  253. 254.  255.  256.  257. 258.  259.  260.  261.  262. 263. 264. 265.  266. 267. 268.  269.  270.  Bravou, V., et al., Integrin-linked kinase (ILK) expression in human colon cancer. Br J Cancer, 2003. 89(12): p. 2340-1. Ito, R., et al., Expression of integrin-linked kinase is closely correlated with invasion and metastasis of gastric carcinoma. Virchows Arch, 2003. 442(2): p. 118-23. Ahmed, N., et al., Integrin-linked kinase expression increases with ovarian tumour grade and is sustained by peritoneal tumour fluid. J Pathol, 2003. 201(2): p. 229-37. Dai, D.L., et al., Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 2003. 9(12): p. 4409-14. Younes, M.N., et al., Integrin-linked kinase is a potential therapeutic target for anaplastic thyroid cancer. Mol Cancer Ther, 2005. 4(8): p. 1146-56. Novak, A., et al., Cell adhesion and the integrin-linked kinase regulate the LEF-1 and beta-catenin signaling pathways. Proc Natl Acad Sci U S A, 1998. 95(8): p. 4374-9. Oloumi, A., T. McPhee, and S. Dedhar, Regulation of E-cadherin expression and beta-catenin/Tcf transcriptional activity by the integrin-linked kinase. Biochim Biophys Acta, 2004. 1691(1): p. 1-15. Tan, C., et al., Inhibition of integrin linked kinase (ILK) suppresses beta-cateninLef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 2001. 20(1): p. 133-40. Boulter, E. and E. Van Obberghen-Schilling, Integrin-linked kinase and its partners: a modular platform regulating cell-matrix adhesion dynamics and cytoskeletal organization. Eur J Cell Biol, 2006. 85(3-4): p. 255-63. Eke, I., S. Hehlgans, and N. Cordes, There's something about ILK. Int J Radiat Biol, 2009. 85(11): p. 929-36. Bumcrot, D., et al., RNAi therapeutics: a potential new class of pharmaceutical drugs. Nat Chem Biol, 2006. 2(12): p. 711-9. de Fougerolles, A.R., Delivery vehicles for small interfering RNA in vivo. Hum Gene Ther, 2008. 19(2): p. 125-32. Mao, C.P., C.F. Hung, and T.C. Wu, Immunotherapeutic strategies employing RNA interference technology for the control of cancers. J Biomed Sci, 2007. 14(1): p. 15-29. Marques, J.T. and B.R. Williams, Activation of the mammalian immune system by siRNAs. Nat Biotechnol, 2005. 23(11): p. 1399-405. Sledz, C.A. and B.R. Williams, RNA interference in biology and disease. Blood, 2005. 106(3): p. 787-94. Duxbury, M.S., et al., RNA interference demonstrates a novel role for integrinlinked kinase as a determinant of pancreatic adenocarcinoma cell gemcitabine chemoresistance. Clin Cancer Res, 2005. 11(9): p. 3433-8. Edwards, L.A., et al., Combined inhibition of the phosphatidylinositol 3-kinase/Akt and Ras/mitogen-activated protein kinase pathways results in synergistic effects in glioblastoma cells. Mol Cancer Ther, 2006. 5(3): p. 645-54. Liu, B.C., et al., Inhibition of integrin-linked kinase via a siRNA expression plasmid attenuates connective tissue growth factor-induced human proximal  62  271.  272. 273.  274. 275.  276.  277.  278. 279.  280.  281.  tubular epithelial cells to mesenchymal transition. Am J Nephrol, 2008. 28(1): p. 143-51. Durbin, A.D., et al., JNK1 determines the oncogenic or tumor-suppressive activity of the integrin-linked kinase in human rhabdomyosarcoma. J Clin Invest, 2009. 119(6): p. 1558-70. Wang, S.L., H.H. Yao, and Z.H. Qin, Strategies for short hairpin RNA delivery in cancer gene therapy. Expert Opin Biol Ther, 2009. 9(11): p. 1357-68. Cruet-Hennequart, S., et al., alpha(v) integrins regulate cell proliferation through integrin-linked kinase (ILK) in ovarian cancer cells. Oncogene, 2003. 22(11): p. 1688-702. Eke, I., et al., The small molecule inhibitor QLT0267 Radiosensitizes squamous cell carcinoma cells of the head and neck. PLoS One, 2009. 4(7): p. e6434. Eke, I., et al., Pharmacological inhibition of EGFR tyrosine kinase affects ILKmediated cellular radiosensitization in vitro. Int J Radiat Biol, 2007. 83(11-12): p. 793-802. Liu, J., et al., Integrin-linked kinase inhibitor KP-392 demonstrates clinical benefits in an orthotopic human non-small cell lung cancer model. J Thorac Oncol, 2006. 1(8): p. 771-9. Muranyi, A.L., S. Dedhar, and D.E. Hogge, Combined inhibition of integrin linked kinase and FMS-like tyrosine kinase 3 is cytotoxic to acute myeloid leukemia progenitor cells. Exp Hematol, 2009. 37(4): p. 450-60. Chou, T.C., Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 70(2): p. 440-6. Chou, T.C., Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev, 2006. 58(3): p. 621-81. Chou, T.C. and P. Talalay, Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul, 1984. 22: p. 27-55. Waterhouse, D.N., et al., Development and assessment of conventional and targeted drug combinations for use in the treatment of aggressive breast cancers. Curr Cancer Drug Targets, 2006. 6(6): p. 455-89.  63  CHAPTER 2 QLT0267, a small molecule inhibitor targeting Integrin-Linked Kinase (ILK), and Docetaxel can combine to produce synergistic interactions linked to enhanced cytotoxicity, reductions in P-AKT levels, altered F-actin architecture and improved treatment outcomes in an orthotopic breast cancer model.* 2.1 Introduction Integrin-Linked Kinase (ILK), an intracellular serine/threonine kinase, is a key signalling molecule expressed in most, if not all, tissues, with high levels of expression in normal pancreatic, cardiac and skeletal muscle tissues. Through interactions with a diverse range of proteins including: adapters such as PINCH, CH-ILKBP, Affixin and Paxillin; kinases such as ILKKAP, AKT and PDK-1; and transmembrane receptors such as β1 and β3 integrins [1], ILK is thought to play a key role in integrin and growth factor receptor related signalling cascades [2, 3]. For instance, ILK acts as a scaffold protein to allow for protein-complex formations connecting extracellular integrin signals to intracellular actin cytoskeleton rearrangements through direct interaction with the cytoplasmic domain of β1-integrin [4]. Cell–extracellular matrix (ECM) adhesion complexes influence a vast number of cellular processes including cellular morphology, migration, proliferation, survival, and differentiation. Activation of downstream targets of ILK such as AKT [5], GSK-3 [6], MLC [7], affixin [8] and the cytoplasmic domain of β1 integrin [9], is associated with signalling cascades known to regulate transcription of genes involved in a diverse range of functions including: cell survival, cell cycle progression, cell adhesion and spreading, focal adhesion plaque formation, ECM modification, cell motility, and contractility [1, 10]. *A version of this chapter has published. Jessica Kalra, Corinna Warburton, Karen Fang, Lincoln Edwards, Tim Daynard, Dawn Waterhouse, Wieslawa Dragowska, Brent Sutherland, Shoukat Dedhar, Karen Gelmon and Marcel Bally, (2009) “Inhibition of the phosphatidylinositol 3-kinase/AKT pathway using small molecule inhibitors against ILK sensitizes breast cancer cells to treatment with docetaxel” Breast Cancer Research;11, 3, R25  64  Increased ILK expression and activity is found in association with many cancer types including: breast, brain, prostate, pancreatic, colon, gastric, ovarian cancers, and malignant melanomas [4, 11-16]. Further, there is mounting experimental evidence indicating that ILK plays a pivotal role in many processes associated with tumorigenesis. Enforced over-expression of ILK in immortalized rat intestinal epithelial cells induces epithelial to mesenchymal transition (EMT) and a transformed tumorigenic phenotype that is, in part, linked to ILK-dependent inhibition of E-cadherin expression and increased nuclear translocation of β catenin. Over-expression and constitutive activation of ILK leads to dysregulated growth and suppression of apoptosis and anoikis [17, 18]. With specific respect to breast cancer, over-expression of ILK in mammary cells stimulates anchorage-independent cell growth, cell cycle progression, and increased cyclin D and A expression in vitro [2, 19]. Furthermore, mammary epithelial cells over-expressing ILK exhibit hyperplasia and tumour formation, in vivo. [4]. Further evidence has indicated ILK might play a key role in VEGF-mediated endothelial activation and angiogenesis [4, 20]. Targeted inhibition of ILK in cancer cells by various strategies can also lead to suppression of the AKT signalling pathway, inhibition of cell cycle progression, reduced VEGF secretion in vitro, and reduced tumour growth in vivo [21]. A number of pharmaceutically viable small-molecule inhibitors of ILK have been developed and partially characterized. From the K15792 class of the pharmacophor family [22], some of these inhibitors were shown to effectively inhibit cancer cell survival, growth [23] and invasion [24], and induce apoptosis and cell-cycle arrest, in vitro [25], as well as inhibit tumour growth and angiogenesis in vivo [20]. Interestingly, the most promising ILK  65  inhibitor, QLT0267, while capable of eliciting pleiotropic effects in xenograft models of glioma, unfortunately, was shown to only delay, but not prevent tumour growth in vivo, even at doses as high as 200 mg/kg [2, 23]. Based on these findings, I speculate that optimal therapeutic effects of QLT0267 will only be realized using a combination therapeutic strategy. Here I demonstrate on the basis of a cell viability assessment determined using multiple breast cancer cell lines that QLT0267 in combination docetaxel (Dt) interacted in a synergistic manner (increased therapeutic benefit over single agents as assessed by the median effect methodology developed by Chou and Talalay). Experimentations aimed to identify underlying molecular mechanisms and additional drug-drug interactions using multiple endpoint analyses, revealed in breast cancer cells expressing low levels of Her2/neu, beneficial drug-drug interactions on the basis of endpoints measuring AKT phosphorylation and F-actin cytoarchitecture. Using an orthotopic model of breast cancer (low Her2/neu), QLT0267/Dt combinations were found to exert enhanced therapeutic activity, as demonstrated by significantly reduced tumour growth and extended survival in mice treated with the combination compared to the single agents.  2.2 Materials and Methods Chemicals Cisplatin, Doxorubicin, Paclitaxil, Docetaxel, Vinorelbine and Trastuzumab were obtained from the British Columbia Cancer Agency Pharmacy (Vancouver, BC, Canada) and QLT0267 was a generous gift from QLT Inc, (Vancouver BC, Canada). All other chemicals, unless specified, were purchased from Sigma Chemical Company (Oakville,  66  Ontario). Docetaxel (Dt) was reconstituted in 13% ethanol for a final concentration of 10 mg/ml and Trastuzumab (Hoffman-La Roche, Mississauga, Ontario, Canada) was reconstituted in PBS at a stock concentration of 21 mg/ml. Cell-lines and Culture MCF-7, KPL-4, BT-474, MDA MB/468 and SKBR3 cells were purchased from American Type Culture Collection (Manassas, VA). MDA-MB-435 (LCC6) estrogen receptor negative breast cancer cells [26] were a generous gift from Dr. Robert Clarke (Georgetown University, Washington, DC). MCF-7Her2 cells were a kind gift from Dr. Moulay Alaoui-Jamali (McGill University, Montreal, Quebec, Canada). LCC6Her2 cells, previously described by our group [27], were generated by the stable transfection (neomycin selection using G418) of plasmid DNA containing the Her2/neu gene driven by the RSV-LTR promoter.  LCC6 cells were stably transfected using a Lenti-virus  system with the luciferase gene and green fluorescent protein (GFP). Cells were sorted by FLOW cytometry for GFP expression and selected cells were used in the following experiments. Sorted cells exhibited similar in vitro and in vivo growth rates as the parental LCC6 cell line. Additionally LCC6 luc and parental LCC6 were equally sensitive to docetaxel. The breast cancer origin of the LCC6 parental cell line, MDA-MB-435, is controversial. Based on studies of Ross et al [28] and Rae et al [29] it has been suggested that the MDA-MB-435 cell line is of a melanoma origin. However, Sellappan et al [30], have been able to demonstrate that MDA-MB-435 cells can be induced to express breast differentiation-specific proteins and secrete milk lipids. Further, more recent studies of Neve et al [31] have demonstrated that the MDA-MB-435 cell line  67  shares many molecular features with breast cancer cell lines of breast epithelium origin. In studies from our laboratory [27] using a LCC6 cell line permanently transfected with the Her2/neu gene (LCC6Her2 cell line), we have been able to demonstrate that the Her2/neu positive variant exhibit enhanced survival under stress, overproduction of VEGF, activation of NF-κB and in vivo sensitivity to trastuzumab (aka Herceptin); results that are consistent with what is known about Her2/neu positive breast cancer models. Thus, I believe it is justifiable to use these cells as a model breast cancer cell line; particularly when the results obtained using this cell line are confirmed with other breast cancer cell lines. LCC6, LCC6Her2, LCC6luc, KPL-4, BT-474, MDA MB/468, MCF-7 and MCF-7Her2 cells were maintained in DMEM/high glucose supplemented with L-glutamine (2 mmol/L; DMEM and L-glutamine from Stem Cell Technologies, Vancouver, British Columbia, Canada) 5 mM penicillin/streptomycin, and 10% fetal bovine serum (FBS) (Hyclone, Logan, UT). SKBR3 cells were maintained in McCoy′s 5a medium (from Stem Cell Technologies, Vancouver, British Columbia, Canada) supplemented with L-glutamine, 5 mM penicillin/streptomycin and 10% FBS. All cells were maintained at 37°C and 5% CO2 in a humidified atmosphere. Cell Viability Assays Metabolic activity (measure of cell viability) of breast cancer cell lines incubated in the presence of various therapeutic agents was determined using Alamar Blue® assays (Medicorp Inc. Montreal, QU) according to the manufacture’s suggestions. Briefly, 6000 cells / well seeded in triplicate onto 96-well flat bottom tissue culture plates (Techno Plastic Products AG, Switzerland) were allowed to adhere to the substratum for  68  24 hours under normal growth conditions (37°C and 5% CO2 in a humidified atmosphere). Serial dilutions of individual drugs, QLT0267/drug combinations and vehicle controls diluted in appropriate cell culture medium were then added to wells and cells were grown for an additional 72 hours. To assess cell viability, cells were then incubated with 10% resazurin solution for four hours at 37°C and fluorescence was measured at 560/590 nm using an Optima fluorescence plate reader (BMG Labtech, Durham NC). Relative fluorescence determined from drug treated cells was normalized to fluorescence determined from control cells (cells grown in presence of appropriate vehicle control alone) and data is shown as percentage (%) relative cell viability compared to vehicle control treated cells (100% viability, highest fluorescence). Background fluorescence was subtracted from all samples and results of experiments conducted in triplicate are indicated (Average, +/- SD). Drug Combination Effects - Median Effect Principle To determine whether various QLT0267/drug combinations had resulted in synergistic, antagonist or additive effects, the Median Effect Principle (MEP) Method of Chou and Talalay was used to determine Combination Index (CI) values  [32-34].  Briefly, the MEP method is used to describe and understand the relationship between a measured response within a population of cells (fraction affected (f a) versus the fraction unaffected (fu)) and the fraction of the dose (D) required to achieve an effect level of 50% and is represented by the formula: fa/fu = (D/Dm)m  69  Where Dm is the dose required to achieve a 50% effect level and m is a coefficient indicating the sigmoidicity of the dose–effect curve. The right side of the equation [(D/Dm)m] represents the dose, and the left side of the equation [fa/fu] represents the effect of the interaction. The combination index (CI) can be calculated at any effect level and the effect used can be derived on the basis of different endpoints (e.g. cell viability, inhibition of VEGF secretion, etc.). If CI is equal to one then the combination interactions result in additive effects, if the CI is less than 1 the combination interactions are considered synergistic, and if the CI is greater than 1 the combination interactions are considered antagonistic. To determine CI values, the commercially available program CalcuSyn was used to calculate CI values for a broad range of effect levels and, on the basis of this analysis, Fa verses CI plots were generated. CI values were then used to estimate the dose reduction index (DRI) for combination of drugs. Please note the DRI estimates the extent to which the dose of one or more agents in the combination can be reduced to achieve effect levels that are comparable to those achieved with single agents. Drug combinations that acted synergistically can be identified as those that exhibited significant dose reduction values (i.e. a given measured effect will be observed at dose(s) significantly lower than expected based on single agent activities). VEGF Expression To determine whether a specified treatment influenced VEGF expression, ELISA assays using Quantikine Human VEGF Immunoassay kits (R&D Systems, Minneapolis, MN) were conducted according to manufacturer’s suggestions. Briefly, 6000 cells were seeded onto 96 well tissue culture plates and allowed to adhere for 24 hours. Cells were  70  then grown in the presence of single agents or combinations of drugs for 72 hours (as described above). The experiments were completed in triplicate and repeated at least two times. Supernatants were collected, combined and then assayed for the presence of secreted VEGF (specific for recombinant human VEGF 165 and recombinant human VEGF121) using the Optima fluorescence plate reader (BMG Labtech, Durham NC). Results were normalized to total protein found in supernatant and compared to standard curves determined using VEGF standards provided in the kit. This assay accurately measures VEGF levels between 9 pg/ml and 2000 pg/ml. Western Blot Analysis Total protein lysates were prepared from cells incubated in the presence of single drug, the drug combinations or vehicle controls. Briefly, cells were rinsed with PBS, harvested from plates with trypsin, centrifuged at 1500 x g for five minutes. Cell pellets were then re-suspended in lysis buffer (150 mmol/L NaCl, 1% NP40, 0.5% sodium deoxycholate, 2.5 mmol/L EDTA, 0.1% SDS, Mini protease inhibitor cocktail tablets (Roche Diagnostics, Mannheim, Germany), sheared using 25 gauge needles, incubated on ice for 30 minutes and finally centrifuged at 10,000 x g for ten minutes to remove insoluble material. Protein concentrations were determined from supernatant using the Bradford Method and approximately 75 µg of total protein from each sample were denatured in loading buffer (Invitrogen) by boiling for 10 minutes and loaded onto 10% SDS-polyacrylamide gels. Proteins separated by electrophoresis were transferred to Nitrocellulose membrane (Millipore, Bedford, MA) and blocked for 1 hour at room temperature in Odyssey blocking buffer (Licor Biosciences, Lincoln, NBR). Membranes were incubated at 4oC overnight in Odyssey blocking buffer containing polyclonal anti-  71  ILK, anti-AKT, anti-P-AKT or anti-Her2/neu antibodies (1:1000 dilution; Cell Signalling Technology, Beverly, MA). Membranes were then washed three times for five minutes with PBS-Tween (1% v/v) and incubated with either anti-rabbit or mouse IRDYE (green) (Rockland, Gilbertsville, PA) or anti-rabbit Alexa 680 (red) (Invitrogen, Molecular probes, Burlington, ON) (1:10,000) for one hour at room temperature and signals were detected and quantified using the Odyssey Infrared Detection System and associated software (Odyssey v1.2) (Licor). Background and input variation between samples were corrected using signal intensities for negative control pixel noise and actin band intensities, respectively. Data were expressed as mean values +/- standard deviation and parametric analysis was done using an unpaired Student t-test. Immunofluorescence Analysis Cells grown on coverslips were rinsed with PBS (pH 7.4), fixed using 2.5% paraformaldehyde (w/v) in PBS for twenty minutes at room temperature and permeabilized using 0.5% Triton X-100 (v/v) in PBS for five minutes at room temperature. Coverslips were then washed three times with PBS and incubated for one hour in 2% bovine serum albumin (BSA) (w/v) in PBS to block non-specific binding, washed three times in PBS and then incubated with phalloidin conjugated to Texas red, (1:500) (Molecular Probes, Eugene, OR) for twenty minutes at room temperature. Nuclei were stained using Hoechst nuclear stain (10 mg/ml) (Molecular Probes) (1:1000) for 15 minutes at room temperature. Coverslips were rinsed once with double distilled water and mounted to microscope slides using a 9:1 solution of glycerol and PBS (Air Products & Chemicals, Inc., Allentown, PA). Images were viewed and  72  captured using a Leica CTR-mic UV fluorescent microscope (Wetzlar, Germany) and a DC100 digital camera with Open Lab software (Improvision, Lexington, MA). Tumour Xenografts All animal studies were conducted in accordance with institutional (University of British Columbia) guidelines for humane animal treatment and according to the current guidelines of the Canadian Council of Animal Care. Mice were maintained at 22°C in a 12 hour light and dark cycle with ad libitum access to water and food. Two million LCC6luc cells were injected into the mammary fat pad of female NCr nude mice (Taconic Oxnard, CA, USA) in a volume of 50 L using a 28-gauge needle. Tumour growth was monitored using an IVIS 200 non-invasive imaging system (Xenogen, Caliper Life Sciences, MA, USA), and manually using callipers when tumour dimensions exceeded 3 mm in length and width. Tumour volume (mm3) estimated from length and width measurements were calculated according to the equation L X W  2  /2 with the length  (mm) being the longer axis of the tumour. Animal body weights were recorded every Monday and Friday. In vivo Imaging System: (IVIS) Imaging was performed once every seven days to monitor tumour progression. LCC6luc tumour bearing mice were injected i.p. with 500 μl D-luciferin (15 mg/ml) (Xenogen Corp., Alameda, CA, USA). Mice were anaesthetized using isoflurane and twenty minutes post i.p. injection mice were imaged. Photographic and luminescence images were taken at exposure times of 1, 2 and 5 second(s) and Xenogen IVIS® software was used to quantify non-saturated bioluminescence in regions of interest (ROI). Light emission between 5.3067 x 106 – 2.2179 x 109 was determined to contain  73  tumour tissue while emissions below this range were considered as background. Bioluminescence was quantified as photons/s/cm2/steradian for each ROI. Statistical Analysis All statistical data was collected using GraphPad InStat (San Diego, CA). Oneway analysis of variance was done using standard error of the mean, mean and n and a Tukey-Kramer Multiple Comparisons Test was used as the post hoc test.  2.3 Results Breast cancer cells treated with QLT0267 exhibit dose-dependent decreases in cell viability. To study whether inhibition of ILK causes reduced breast cancer cell viability, seven human breast cancer cell lines (BT474, SKBR-3, KPL-4, MDA-MB/468, MCF-7, LCC6 and LCC6Her2) were exposed to serial dilutions (ranging from 1 - 256 μM) of the small molecule inhibitor of ILK, QLT0267. As shown in Figure 2.1A, all cell lines examined exhibited QLT0267 dose-dependent decreases in cell viability. Using the CalcuSyn™ program, Effective Doses (ED) capable of eliciting a 10, 50 or 90 percent (%) decrease in cell viability were extrapolated from each dose response curve and these data have been summarized in Table 2.1. ED values showed some variation (ED50s ranging from 10 to 71 µM) depending on the specific breast cancer line examined. In general, slower growing breast cancer cells (SKBR-3 and BT-474) appear less sensitive to QLT0267 than faster growing breast cancer cells (MCF-7 and LCC6). While one cannot completely rule out the possibility that off-target ILKindependent, QLT0267-mediated cellular effects might influence cell viability, treatment with QLT0267 did cause dose dependent decreases in P-AKT levels, a key downstream target of ILK. This data has been summarized in Figure 2.1B which provides the dose of  74  QLT0267 required to achieve 50% reduction of P-AKT in each of the 7 cell lines evaluated. Cells were treated with 8 different concentrations of QLT0267 for 8 hours and P-AKT levels in cell lysates were determined by western blot analysis as described in the Methods. Dose response curves were generated and the Effective Doses (ED) capable of eliciting a 50% decrease PAKT was extrapolated from individual curves. KPL4 cells did not exhibit any reductions in P-AKT even at the highest dose tested (50 µM). It is notable that suppression of P-AKT did not necessarily correlate with the cell viability data. For example, SKBR3 cells were quite sensitive to QLT0267 mediated inhibition of P-AKT levels, but were the least sensitive in terms of the cell viability assessments as determined by Alamar Blue. Combination of QLT0267 with chemotherapeutic agents commonly used for treating breast cancer identifies synergistic interactions with Dt. For an initial screen of drug combination effects 2 of the 7 breast cancer cells (LCC6 and LCC6Her2) were treated with QLT0267 in combination with cisplatin, doxorubicin, paclitaxel, vinorelbine, docetaxel (Dt), and trastuzumab and cell viability was determined using the Alamar Blue metabolic assay. The combination effects were measured over a broad range of effective doses and the results have been summarized in Table 2.2. Importantly, combinations of QLT0267 with Dt exhibited synergistic interactions at all drug ratios examined. In contrast, combinations of QLT0267 with cisplatin, doxorubicin, paclitaxel and vinorelbine exhibited antagonistic interactions. Trastuzumab (Tz) exhibited variable interactions with QLT0267 which appeared to be highly ratio dependent, a common feature associated with other drug combinations [35]. It should  75  Table 2.1 Effective Doses (ED)1 at 10, 50 and 90% Effect Levels of QLT0267 in Human Breast Tumour Cell Lines 1 Cell Line Drug concentration range (µM) ED10 (µM) ED50 (µM) ED90 (µM) MDA MB 435/LCC6 2.0 – 256.0 2.05 17.2 143.6 MDA MB 435/LCC6Her2 2.0 – 256.0 1.66 12.2 90.4 MDA MB 468 1.0 – 133.3 0.91 25.6 718.7 MCF-7 1.0 – 133.3 1.15 9.8 83.3 KPL-4 2.0 – 256.0 0.31 12.1 473.0 BT-474 2.0 – 256.0 29.8 70.9 168.2 SKBR-3 2.0 – 256.0 28.8 55.8 108.2 1 1  ED values were calculated with Calcusyn software using the median effect principle defined by Chou and Talaly  75 76  be noted, since Tz exhibited little measurable activity under the in vitro assay conditions used, fixed drug ratios of QLT0267 with Tz were defined using the ED 50 value of QLT0267 and the maximum concentration of Tz that had been used in the single agent assay (1 mg/ml). As shown in Figure 2.2, comparisons of dose response curves (cell viability) of LCC6 (Figure 2.2A) and LCC6Her2 (Figure 2.2B) cells treated with QLT0267 and Dt alone and in combination showed that when used in combination there was a shift in the dose response curves to the left when the doses plotted for the combination are defined by the most active agent in the combination (Dt).  While statistically  significant shifts in dose response curves can be indicative of synergistic interactions, it is difficult to draw this conclusion on the basis of the sigmoidal dose response curves alone. Thus the dose response data were analyzed using the Median Effect Principle (MEP) developed by Chou and Talay [33] (see Methods). Using the CalcuSyn® program, Combination Index (CI) values were estimated and these results have been summarized in Figure 2.2C and D. The CI values for QLT0267/Dt combinations were, in general, below 0.9 for both LCC6 (Figure 2.2C) and LCC6Her2 (Figure 2.2D) treated cells, indicating weak to strong synergistic interactions. Importantly, the CI values were consistently below 1 over a broad range of effective doses as define by the Fraction Affected (FA) value. The combination of QLT0267 and DT was also evaluated in several other breast cancer cell lines. CI values were calculated from cell viability dose response curves. These data are summarized in Figure 2.2E, which shows the CI values determined at the ED50 (dose exhibiting 50% loss in cell viability relative to untreated cells). The results indicate that the observed synergistic interactions (defined by mean CI values <0.9) are achieved in at least five of the six cell lines tested (LCC6, LCC6 Her2, MCF-7,  77  Figure 2.1 Breast cancer cells exhibit dose dependent decrease in cell viability (A) and P-AKT (B) in response to increasing concentrations of the ILK small molecule inhibitor, QLT0267. Seven breast cancer cell lines (LCC6, LCC6Her2, SKBR-3, KPL-4, BT-474, MBA-MB-468 and MCF-7) were treated with increasing doses (1 μM to 256 μM) of QLT0267 for 72 hours and cell viability was evaluated using the AlamarBlue® assay as described in the Methods (A). Percentage cell viability relative to control (untreated) cells are shown. Each data point represents the mean (+/- Standard deviation) determined from three experiments done in triplicate. Treated cells were assessed for P-AKT using western blot analysis of protein lysates collected 8 hours after treatment. WB were analyzed using densitometry, dose response curves were generated and anlyzed using Calcusyn to determine the ED50 of QLT0267 for P-AKT suppression for each cell line (B).  dose dependent decrease in cell viability (A) and P-AKT (B) in response to increasing concentrations of the ILK small molecule inhibitor, QLT0267 (267). 1 Figure 2.1 Breast Cancer cells exhibit  78  Table 2.2 Synergy, Antagonism, and Additivity in LCC6 Cells Treated With QLT0267 in Combination with Several Clinically Relevant Agents 1 Chemotherapeutic agent Drug concentration range QLT0267: Drug ratio (nM)1 Result2 Cisplatin 0.15 – 20.0 µM 1, 2 & 4 : 1 Doxorubicin 0.0625 – 2.0 µM 10, 20, & 40 : 1 Paclitaxel 0.313 – 15.0 nM 1000 & 4000 :1 Vinorelbine 0.0625 – 4.0 nM 10,000, 20,000 & 40,000 : 1 Docetaxel 0.125 – 1.0 nM 50,000, 95,000 : 1 -7 Trastuzumab 3.1 x 10 - 1 mg/ml 50,000 : 1mg/ml 2 1 Ratios were chosen based on ED values of single agent treatment 2 Synergy is defined as a combination that exhibits combination index values of less than 1 minimum of four drug concentrations  Antagonistic at all ratios Antagonistic at all ratios Antagonistic at all ratios Antagonistic at all ratios Synergistic at all ratios Variable  at high affect levels over a  78 79  MDA MB468 and SKBR-3). For KPL-4 cells the calculated CI values were indicative of slightly antagonistic (mean CI of 1.4) interactions. If drug combinations interact in a manner that result in synergy, then the dose of each drug used in the combination to achieve a specific measurable effect level will be substantially reduced when compared to the dose needed to achieve the same effect level when the drugs are given alone. This parameter can be calculated and is defined by the Dose Reduction Index or DRI (refer to Materials and Methods). The DRI can be used to estimate the doses of QLT0267 and Dt needed when used in combination to achieve a defined effect level which can then be compared to the single agent dose required to achieve this effect. Based on these analyses, it was estimated that the concentration (dose) of QLT0267 in the QLT0267/Dt combination required to achieve an ED50 could be reduced by up to 3.6 fold in the LCC6 cell line (Figure 2.3A). QLT0267 dose reductions were less remarkable in the other cell lines evaluated; ranging from no change to a 30% reduction. A similar analysis was completed for Dt (Figure 2.3B) and it was estimated that the concentration (dose) of Dt in the QLT0267/Dt combination required to achieve an ED50 could be reduced in all cell lines by 2 to 25 fold when compared to Dt alone. For example in SKBR3 cells the ED50 of Dt given alone is 5 nM while in combination with QLT0267 the ED50 of Dt decreases to less than 1 nM. (Figure 2.3) QLT0267 and QLT0267/Dt combination treatments cause dose dependent reduction in P-AKT levels estimated by western blot analysis. Western blot analysis was used to assess P-AKT (specifically at serine 473) levels in LCC6 and LCC6Her2 cells treated with increasing concentrations of QLT0267 alone (Figure 2.4A), Dt alone (Figure 2.4B) or QLT0267 in combination with Dt (Figure 2.4C). In these studies P-AKT  Figure 2.2 Breast cancer cells treated with QLT0267 and Docetaxel (Dt) combined at a fixed ratio and added at various concentrations exhibit synergistic effects based on a measured cell viability endpoint. (A, B): LCC6 (A) and LCC6Her2 (B) cells were treated with increasing concentrations of QLT0267, Dt or QLT0267 and Dt combined at a fixed ratio (50 µmoles : 1 nmole). Percentage cell viability relative to control cells not treated with drugs (100% viable) are shown and each data point is the average (+/- standard deviation) of triplicate samples. (C,D): CI (combination index) values determined by Calcusyn (see Methods) from dose response curves of LCC6 (C) and LCC6Her2 (D) cells treated with QLT0267/Dt combinations. Data points represent the average (+/- standard deviation) from triplicate experiments. CI values less than 1 are indicative of synergistic effects; CI values greater than 1 are indicative of antagonistic effects; and CI values equal to 1 are indicative of additive effects. FA (fraction affected) is a measure of the determined effect (cytotoxicity as measured by an Alamar blue assay) and amount of drug to achieve a FA of 0.5 is referred as the ED50. (E) Mean CI values at ED50 for LCC6, LCC6Her2, MCF-7, MDA MB468, KPL-4, and SKBR-3 cells treated with QLT0267 and Dt combined are shown and each data point represents the average (+/- standard deviation) from triplicate experiments.  81  Figure 2.2 Breast cancer cells treated with 267 and Docetaxel (Dt) combined at a fixed ratio and added at various concentrations exhibit synergistic effects based on a measured cell viability endpoint. 1  82  (Ser473) was measured 8 hours after addition of QLT0267, a time point selected because no significant changes in cell viability (as measured by dye exclusion) were noted (even at the highest QLT0267 dose used) yet significant reductions in P-AKT (Ser473) were detectable as noted in the representative western blots shown in Figure 4. P-AKT (Ser473) levels were reduced in a dose dependent manner over the range of QLT0267 concentrations evaluated in both LCC6 and LCC6Her2 cells (Figure 2.4A). Dt treatment alone was shown to have little or no measurable effect on P-AKT (Ser473) levels (Figure 2.4B). In cells treated with the QLT0267/Dt there were significant reductions in P-AKT (Ser473) levels which were also dose dependent (Figure 2.4C). None of the treatment strategies were shown to influence expression of total ILK or total AKT where protein loading was verified using β-actin. P-AKT levels from three independent experiments (as illustrated in Figures 2.4A-C) were qualitatively assessed by densitometry to estimate the effective doses needed to achieve a defined effect level represented by a FA value. As described above, these data in turn, could be used to estimate the dose of QLT0267 required to achieve a defined level of P-AKT (Ser473) suppression when the drug was used alone or in combination with Dt. These calculated values have been summarized in Figure 2.4D (LCC6) and 4E (LCC6Her2). The results clearly demonstrate that the combination acts differently in the Her2/neupositive cell line when compared to the parental LCC6 cell line. More specifically for LCC6 cells the dose of QLT0267 required to achieve a defined level of P-AKT (Ser473) suppression was substantially reduced when Dt was present indicating that Dt potentiates QLT0267 mediated suppression of P-AKT (Ser473). For example, the dose of QLT0267 required to achieve 50% suppression of P-AKT (Ser473) (FA = 0.5) when used alone was  83  Figure 2.3 The dose reduction index (DRI) calculated using the Calcusyn program (see Methods) was used to estimate the ED50 of drugs (QLT0267 and/or Dt) against the indicated cell lines. The DRI estimates the extent to which the dose of one or more agents in the combination can be reduced to achieve effect levels that are comparable to those achieved with single agents. Black bars indicate the mean ED50 calculated for the drugs when added alone and the grey bars indicate the mean ED50 calculated for the drugs when used in combination. A: ED50s for QLT0267; when used in combination to treat LCC6 cells the ED50 of QLT0267 can be reduced by 3.6 fold. B: ED50s for Dt; the dose reduction index assessment for Dt indicated that dose reductions of up to 27.5 fold (LCC6 cells) can be obtained.  84  Figure 2.3 The dose reduction index (DRI) calculated using the Calcusyn program (see Methods) was used to estimate the ED50 of drugs (267 and/or Dt) against the indicated cell lines. 1  85  Figure 2.4 LCC6 and LCC6Her2 cells were treated for 8 hours with increasing concentrations of QLT0267 (A), Dt (B) or a fixed ratio combination of QLT0267 and Dt (50 µmoles:1 nmoles) (C) to establish dose response curves based on and endpoint measuring suppression of P-AKT levels as determined by western blot analysis. Representative western blot images were collected using a fluorescence based imaging system (odyssey, Licor) where the colours (red or green) represent the secondary antibody used, show that increasing concentrations of Docetaxel (B) exerted no significant effect on the expression of ILK, AKT and P-AKT in either cell line. Treatment with increasing doses of QLT0267 alone (A) or in combination with Dt (C) showed dose dependent decreases in P-AKT. Densitometry assessment of western blots (n=3) were used to estimate treatment response relative to controls (taken to be 100% P-AKT levels) and the resulting data was then analyzed by Calcusyn to determine estimated DRI. The DRI was then used to estimate the dose of QLT0267 when used alone (black bars) or in combination with Dt (grey bars) needed to achieve a defined FA (fraction affected). The dose of drug required to achieve an FA of 0.5 is defined as the ED50 for the measured P-AKT suppression endpoint. The ED50 of QLT0267 was ~30 µM in the LCC6 cell line (D), while in the presence of Dt the QLT0267 ED50 was ~11 µM. In LCC6Her2 cells (E), more QLT0267 was required when used in combination to achieve FA similar to that of single agents. For example in the LCC6 Her2 cells, the QLT0267 ED50 when used alone was ~30µM, and this increased to 130 µM when QLT0267 was used in combination with Dt.  86  Figure 2.4 LCC6 and LCC6Her2 cells were treated for 8 hours with increasing concentrations of 267 (A), Dt (B) or a fixed ratio combination of 267 and Dt (50 µmoles:1 nmoles) (C) to establish dose response curves based on and endpoint measuring suppression of P-AKT levels as determined by western blot analysis. 1  87  calculated to be 30 µM, while in combination with Dt the dose required to achieve the same FA was reduced 3-fold. In contrast, the densitometry data indicated that for LCC6Her2 cells, the concentration of QLT0267 required in combination with Dt to achieve a defined effect (FA) on P-AKT (Ser473) inhibition was significantly higher than that required when QLT0267 was used as a single agent. For example, 30 µM QLT0267 was required to achieve an FA of 0.5 (ED50) when QLT0267 was used alone, however, in the presence of Dt the concentration of QLT0267 required to achieve an FA of 0.5 was estimated to be 130 µM (Figure 2.4). Differences in the combination effects due to Her2/neu over-expression were confirmed using the MCF-7 and MCF-7Her2 cell lines, as summarized in the representative western blots shown in Figure 2.5. Qualitative (densitometry) assessments of the P-AKT (Ser473) western blot data (average of triplicate experiments) have been presented as a value that is relative to control (untreated) PAKT levels (Ser473) and these are provided in brackets. The QLT0267/Dt combination resulted in enhanced P-AKT (Ser473) suppression compared to QLT0267 alone when used to treat the parental cell lines (Figure 2.5B and D). However this combination effect was lost when tested in the Her2/neu over-expressing cell lines, where the level of P-AKT (Ser473) suppression was no better or even worse than when QLT0267 was used alone (compare Figure 2.5C and 2.5E). This effect is most notable in the LCC6Her2 cells where QLT0267 caused a 92% reduction in P-AKT (relative to control) when used alone, but only a 24% reduction when used in combination with Dt. It should be noted that all four cell lines studies expressed similar levels of ILK and AKT (Figure 2.5A) and treatment with QLT0267 and Dt alone or in combination did not effect total ILK or AKT  88  Figure 2.5 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 cells express baseline levels of ILK, AKT, and P-AKT (A). LCC6 (B), LCC6Her2 (C), MCF-7 (D) and MCF-7Her2 (E) cells were treated for 8 hours QLT0267 (42 µM), Dt (1 nM) or the combination of QLT0267 and Dt. WB analysis using a fluorescence based imaging system (Odyssey, Licor) shows that treatment with QLT0267 and QLT0267/Dt elicit considerable reductions in the level of P-AKT relative to controls (untreated cells). Treatment with Dt had no effect on P-AKT levels. Reductions in P-AKT were not attributable to changes in the level of ILK or AKT. Band intensities for P-AKT were normalized to actin then to untreated controls and changes in levels are indicated in the values provided just below the P-AKT band. (n=3)  89  90 Figure 2.5 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 cells express baseline levels of ILK, AKT, and P-AKT (A). LCC6 (B), LCC6Her2 (C), MCF-7 (D) and MCF-7Her2 (E) cells were treated for 8 hours 267 (42 µM), Dt (1 nM) or the combination of 267 and Dt. 1  levels as detected by western blot analysis. QLT0267 and QLT0267/Dt combinations inhibit VEGF secretion. I investigated whether QLT0267 alone or in combination with Dt could influence VEGF secretion in LCC6, LCC6Her2, MCF-7 and MCF-7Her2 cells, an endpoint measured 72 hours after drug addition. The 72 hour time point was selected because VEGF levels in the media were highest at this time, however it can be suggested at this time point VEGF levels would be a reflection of both direct effects of QLT0267 on VEGF expression and indirect effects due to QLT0267 and/or Dt cytotoxicity as fewer viable cells capable of producing VEGF would be present. For this reason I focused on doses of QLT0267 and Dt below that which caused 50% toxicity over the 72 hour incubation time. The results, summarized in Figure 2.6, are consistent with previous publications and indicate that when LCC6, LCC6Her2, and MCF-7 cells are treated with QLT0267 there is a significant decrease in VEGF secretion. This decrease was not observed in the MCF-7Her2 cell line. Treatment of LCC6 and LCC6Her2 cells with 10 µM QLT0267 resulted in an approximately 79% and 83% decrease in VEGF secretion, respectively. When Dt was combined with QLT0267, the decrease in VEGF secretion was larger (92%) when the drugs were added in combination to the LCC6 Her2 cells. Conversely, when the drugs were used in combination to treat the LCC6 cells the decrease in VEGF levels in the media was 72%, an effect that was actually less then what was observed when using QLT0267 alone. It should be noted that treatment with Dt (0.25 nM) was associated with a 56% and a 40% decrease in VEGF levels relative to controls for the LCC6 and LCC6Her2 cells, respectively. Thus the enhanced effect observed when using  91  Figure 2.6 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated with QLT0267(10 µM), Dt (0.25 nM) or a combination of both for 72 hours. Conditioned media was collected subsequently assessed for VEGF secretions using ELISA as described in the Methods. All four cell lines assessed showed a decrease in VEGF secretion when treated with low doses of QLT0267 alone or with the combination QLT0267/Dt. Dt also moderately attenuated VEGF secretion in each cell line. (n=3)  Figure 2.6 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated with 267(10µM), Dt (0.25nM) or a combination of both for 72 hours. 1  92  QLT0267/Dt combination against the LCC6Her2 cells could be explained by the effects of the individual agents. This, however, is not the case for the LCC6 cells.  The effect of  QLT0267 on VEGF secreted by MCF-7 cells was similar to that observed with the LCC6 cell line; QLT0267 produced a 90% reduction in VEGF secretion when used alone and only 53% reduction when used in combination with Dt. Results obtained with the MCF7Her2 cell line suggest that significantly higher doses of QLT0267 (more than 21 µM) was required to see changes in VEGF levels found in the media. However, when MCF-7Her2 cells are treated with a combination of QLT0267 (10 µM) and Dt (0.25 nM) significant reductions in VEGF secretion were seen. QLT0267/Dt treatment causes disruption of normal F-actin cytoarchitecture and abnormal nuclear morphology. In addition to assessing how Dt influenced known or suspected down-stream effects of QLT0267’s action on ILK (P-AKT levels, VEGF secretion), the influence of QLT0267 on Dt induced changes in cytoarchitecture and nuclear morphology were investigated 8 hours after drug addition to the cells. The drug doses used were 42 µM for QLT0267 and 1 µM for Dt; dose that are cytotoxic (Alamar Blue metabolic assay) after 72 hrs but exhibit no significant cytotoxicity at 8 hours after drug addition. As illustrated by the representative photomicrographs in Figure 2.7, immunofluorescence based experimentation showed that untreated LCC6 (Figure 2.7A) and LCC6Her2 (Figure 2.7B) cells contained normal intact nuclei (blue color) and typical filamentous actin cytoskeleton (Red color) with distinct intracellular organization and prominent stress fibers. LCC6 cells treated with QLT0267 alone (Figure 2.7E) showed an accumulation of F-actin at the cell periphery, while LCC6Her2 cells treated with QLT0267 alone (Figure 2.7F) exhibited cytoplasmic actin distribution and increased  93  Figure 2.7 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated for 8 hours with QLT0267 (42 µM), Dt (1 nM) or the combination of QLT0267 and Dt. Subsequently, cells were fixed using paraformaldehyde, permeabilized, and stained for nuclear material using Hoechst and F-actin using Texas red conjugated phalloidin. Representative photomicrographs of untreated cells (A – D) or cells treated with QLT0267 (E – H), Dt (I – L) and the combination of QLT0267/Dt (M – P) are shown, where blue represents the nucleus and red the F-actin microfilaments. Combination treatment resulted in a distinct decrease in total F-actin staining, a change in actin organization, the appearance of apoptotic nuclear bodies (see white arrows), as well as metaphase chromosomes suggestive of a cell cycle block in these cells. (Magnification 100X)  94  Figure 2.7 LCC6, LCC6Her2, MCF-7 and MCF-7Her2 were treated for 8 hours with 267 (42 µM), Dt (1 nM) or the combination of 267 and Dt. 1  95  formation of focal adhesions at cell periphery. As expected, Dt treatment alone of LCC6 and LCC6Her2 cells caused significant loss of staining of both F-actin microfilaments (Figure 2.7I and 2.J). Importantly, QLT0267/Dt treated LCC6 and LCC6Her2 cells (Figure 2.7M and 2.N, respectively) showed more pronounced reduction of F-actin, appearance of apoptotic nuclear bodies (arrows), and metaphase chromosomes, suggesting that QLT0267/Dt combination in these cell types specifically inhibited cell cycle progression. Untreated MCF-7 cells showed the typical cytoplasmic distribution of F-actin slightly enriched at the cellular membrane and lack stress fibers (Figure 2.7C). MCF-7 cells treated with QLT0267 (Figure 2.7G) showed accumulation of F-actin at the cell periphery and punctate cytoplasmic staining, while cells treated with Dt alone (Figure 2.7K) showed decreased F-actin expression, loss of uniform expression and increased punctate areas. Images of MCF-7 cells treated with QLT0267/Dt (Figure 2.7O) were strikingly similar to those shown for LCC6 cells treated with this combination; reflected by reduced F-actin distribution, appearance of apoptotic nuclear bodies (arrows), and presence of metaphase chromosomes. Untreated MCF-7Her2 cells showed typical punctate and peripheral staining of F-actin as well as large nuclei enriched localization of F-actin at the cell membrane (Figure 2.7D). MCF-7Her2 cells treated with QLT0267 alone showed cell rounding and enriched F-Actin at the cell membrane (Figure 2.7H), while cells treated with Dt alone showed trademark [36] F-actin rings, peripheral stress fibers, and punctate cytoplasmic staining (Figure 2.7L). Finally MCF-7Her2 cells treated with QLT0267/Dt (Figure 2.7P) showed disorganized F-actin, with peripheral staining; however, in contrast to all the other cell lines examined, only minor changes in nuclear morphology were evident.  96  QLT0267/Dt combination therapy in vivo correlates with reduced tumour burden and extended survival in orthotopic LCC6 breast cancer tumour model. The results presented thus far indicate that combinations of QLT0267 and Dt should provide improved therapeutic effects based on several different therapeutically relevant endpoints when used to treat breast cancers with low Her2/neu expression. The results demonstrated that the combination effects are more complicated in cell lines that overexpress Her2/neu and that for some endpoints measured (P-AKT) the data do not necessarily support further development of the QLT0267/Dt combination for tumours that over-express Her2. Studies to be reported elsewhere have been completed to better characterize the effects of QLT0267 and ILK inhibition in Her2/neu overexpressing cell lines. Here, however, I determined whether the favourable drug-drug interactions observed in vitro for the low Her2/neu expressing cells line could be recapitulated in vivo. QLT0267 and Dt alone and in combination were used to treat mice with established LCC6luc tumours (LCC6 transfected with luciferase as described in the Methods). These tumours were readily detectable in all mice 24 hrs and 7 days post-implantation of 2x106 cells. Mice (n = 5, per treatment strategy) were treated with: i) the vehicle controls used for both QLT0267 (p.o.) and Dt (i.v.); ii) 200 mg/kg QLT0267 (QD x 28) (p.o.); iii) 10 mg/kg Dt (Q7D x 4) (i.v.); or iv) QLT0267 (200 mg/kg) (p.o.) / Dt (5 mg/kg) (i.v.). The QLT0267 dose and schedule was selected based on previous studies that showed effective therapy in different human xenograft models [21, 37]. The aim of this study was to determine whether use of QLT0267 (200 mg/kg QD x14) in combination with Dt might improve treatment outcomes. A suboptimal dose of Dt (5mg/kg) was administered using a Q7D X 4 dose schedule in order for us to assess  97  Figure 2.8 Bioluminescent imaging of orthotopic LCC6 tumours (see Methods) are shown 1 day after treatment initiation and on day 22 after treatment initiation. The treatment groups included vehicle controls (A & E), QLT0267 (B & F), Dt (C & G), and the combination of QLT0267/Dt (D & H) treated animals (doses indicated on graph). Total light emission from tumours in animals was visualized and quantified. Animals treated with the combination showed lower total light flux than all other treatment groups (I). Animals treated with QLT0267 exhibited tumours with darkened areas in the core (see inset in 8F as an example). Tumour size in treated animals was measured by callipers and these data were used to estimate the tumour volumes (see Methods) shown in J. The combination of QLT0267/Dt was significantly lower (p < 0.005) then all other treatment groups analyzed (***). Kaplan-Meir survival analysis of data defining survival endpoints based on tumour ulceration and/or tumours >0.5 g were used to determine median survival times (K). For animals treated with QLT0267 (200 mg/kg) the median survival time was 33 days (26 days post treatment initiation), animals treated with Dt (5 mg/kg) exhibited a median survival time of 31 days (24 days post treatment initiation); and animals treated with the QLT0267/Dt combination exhibited a median survival time of > 90 days (83 days post treatment initiation). In this group 3/5 animals were alive at day 90, while no animals were alive for any other treatment group.  98  Figure 2.8 Bioluminescent imaging of orthotopic LCC6 tumours (see Methods) are shown 1 day after treatment initiation and on day 22 after treatment initiation. 1  99  whether QLT0267 contributed to improved outcomes in a combination setting. The results of this in vivo efficacy study have been summarized in Figure 2.8. Tumour growth was monitored using non-invasive imaging (Figure 2.8A-I) using the IVIS 200 to image luciferase expressing LCC6 cells and by external calliper measurements (Figure 2.8J). Survival (Figure 2.8K) was determined based on the time in days required for the mice to be terminated due to tumour ulceration and/or the presence of tumours exhibiting volumes in excess of 500 mg. Tumours in animals treated with QLT0267 (Figure 2.8F), Dt (Figure 2.8G) and QLT0267/Dt (Figure 8H) all showed reduced total light emission (luciferase expression ) 22 days post cell injection when compared to vehicle control treated mice (Figure 2.8E). Quantification of total light flux (n = 5 mice per treatment, Ave +/- SE, background subtracted) (Figure 2.8I) demonstrated tumour burden was significantly less in mice that had received the combination treatment as compared to mice treated with the vehicle control or QLT0267 alone (p < 0.05). There was a modest difference in tumour burden between Dt and QLT0267/Dt treated mice, but this difference was not statistically significant. When tumour burden was measured using callipers, the tumours from QLT0267/Dt treated mice were significantly smaller compared to all other treatment groups, including mice treated with Dt alone, (p < 0.05) (Figure 2.8J). It is interesting to note that close examination of the pattern of luciferase expression showed that tumours from QLT0267 treated animals (alone or in combination) exhibited dark regions in the center of the tumour (for example refer to Figure 2.8F, inset). These dark regions may reflect regions of necrosis or alternatively could be a result of treatment induced changes in tumour perfusion that may alter luciferin delivery to the tumours.  100  Kaplan-Meir survival analysis (Figure 2.8K) based on survival endpoints defined by tumour ulceration and/or tumour size (500 mg or larger) showed that the median survival time was 28 days (or 21 day post treatment initiation) for untreated mice, 33 days (or 26 days post treatment initiation) for mice treated with QLT0267, 31 days (or 24 days post treatment initiation) for mice treated with Dt and > 90 days (or > 83 days post treatment initiation) for mice treated with the QLT0267/Dt combination. In reference to the latter group, it should be noted that 3 out of 5 mice treated with QLT0267/Dt combinations were still alive at day 91, while mice from all other treatment groups had been terminated due to tumour ulceration and/or a tumour size >500 mg.  2.4 Discussion Although it is understood that ILK is an important therapeutic target in cancer, the data summarized here (see Figure 2.8) and elsewhere suggest that an ILK inhibitor such as QLT0267 given alone will not achieve much more than a delay in tumour progression. Lack of potent single agent activity, when using in vivo tumour growth as an efficacy measure, lends support to the belief that ILK inhibitors must be developed in the context of other therapeutics. A similar trend was exemplified by treatment regiments incorporating trastuzumab (Herceptin™), a therapy that targets Her2/neu expressing tumours. Trastuzumab as a single agent exhibits little significant activity, but when used in a combination setting it has proved to be of significant therapeutic value [38]. The studies described here, focused on identifying agents that would work synergistically with QLT0267. I used cell based screening assays in order to assess whether drugs commonly used for breast cancer could be combined with QLT0267 to achieve better than expected therapeutic results. For these studies a fixed drug ratio  101  experimental design was used where drug-drug interactions were determined using at least 3 different drug-drug ratios applied over a broad range of effective doses (see Table 2.2). I show for the first time that combination of QLT0267/Dt appeared to interact in a manner that results in synergy. Drug-drug interactions were measured by use of the median effect method of Chou and Talalay and were initially determined on the basis of a therapeutic endpoint measuring metabolic activity (Alamar Blue assay). Synergy was observed over a broad range of effective dose and was measured in five out of six breast cancer cell lines tested (see Figure 2.2), regardless of Her2/neu status. Although limited to results obtained with the 2 cell lines used for the broad combination screen (LCC6 and LCC6Her2) it is interesting to note that the QLT0267/Dt combination was synergistic while combinations of QLT0267 with paclitaxel and vinorelbine appeared antagonistic. This would suggest that the mechanism(s) promoting synergy may not involve microtubules in general. It has been suggested that Dt is more effective in treatment of breast cancer than paclitaxel [39] and in addition to its influence on microtubule assembly that culminates in a general cytotoxic response, Dt activity has been linked to increased activation of the apoptotic program and to changes of apoptotic marker expression [40-43]. It may be these additional activities of Dt that combine with QLT0267 to produce enhanced therapeutic effects. It was important to demonstrate that the individual drugs within the QLT0267/Dt combination exert benefits consistent with their individual mechanisms of action. For example QLT0267 activity can be linked to measured changes in P-AKT (ser473) levels and VEGF while docetaxel activity can be assessed by drug mediated changes in cell  102  architecture. ILK inhibition by QLT0267 engenders dose dependent decreases in levels of P-AKT (see Figure 2.1B, 2.4 & 2.5) and when QLT0267 is added as a single agent it can inhibit VEGF secretion (see Figure 2.6). Perhaps unexpectedly, single agent QLT0267 treatment also caused changes in cytoarchitecture and nuclear morphometry (see Figure 2.7). This effect of QLT0267 has not be reported previously, however, studies have provided evidence that ILK plays a role in cytoskeletal arrangement of actin through the regulation of proteins such as Rac and Cdc42 [9, 44, 45]. Furthermore, siRNA mediated ILK silencing resulted in diminished cell spreading and actin cytoskeleton reorganization; results that help to explain ILK’s role in the regulation of cancer cell motility and invasiveness [46]. Recent evidence indicates a role for ILK in regulation of mitotic spindle organization [47]. When this information is considered in light of the activity of Dt, one can speculate about the mechanism that may be promoting synergy when Dt is used in combination with QLT0267. Studies have shown that cells treated with Dt exhibit a reorganization of the microfilament network [36], disturbed microtubule structures, less F-actin stress fiber formation, decreased activation of Rac1/Cdc42, reduced cell motility and an inhibition of angiogenesis [48]. When considering the primary effect of Dt on the microtubule cytoskeleton of cancer cells, and based on the results summarized here it can be suggested that the combination of Dt and QLT0267 may result in synergistic changes in tubulin, F-actin organization and apoptosis leading to nuclear degeneration. As indicated above, inhibition of ILK by QLT0267 was expected to cause a decrease in phosphorylated AKT at serine 473. However the effect of Dt on AKT has not been well studied. Studies have suggested that Dt can suppress the phosphorylation of AKT  103  in lymphoma cell lines [49] and lung carcinoma [50]. Others have suggested that the AKT pathway can be activated by Dt [51]. As shown in Figure 2.4, results obtained in several breast cancer cell lines indicate that Dt added at doses of up to 1 nM exerted no significant effect on P-AKT levels after an 8 hr exposure. Importantly, Dt potentiates the effect of QLT0267 on P-AKT levels, at least in LCC6 and MCF-7 cell lines (Figures 2.4 and 2.5). Interestingly, this beneficial combination effect was not observed in the Her2/neu transfected variants of these cell lines, suggesting that phosphorylation of AKT does not play a role in the enhanced cytototoxicity seen when QLT0267 is combined with Dt to treat the Her2/neu over-expressing cells. It has also been established that one of the beneficial therapeutic effects of QLT0267 is associated with its ability to inhibit VEGF secretion. More specifically, it has been reported that integrins cooperate with the VEGF receptors to promote angiogenesis in vascular endothelial cells [52] and other studies indicate that ILK and PI3-kinase are involved in VEGF signaling pathways [53]. Although not well studied, it has been suggested that Dt can influence vascularization in vivo in a fashion that is related to VEGF signaling. More specifically, Murtagh et al. [54] have recently demonstrated that Dt can prevent VEGF-induced phosphorylation of focal adhesion kinase, Akt and endothelial nitric oxide synthase, effects that may be mediated by Dt mediated dissociation of Hsp90 from tubulin and subsequent Hsp90 degradation by ubiquination. Thus, it could be speculated that combinations of QLT0267 and Dt would be of particular interest in the context of VEGF induced tumour vascularization; where QLT0267 would suppress VEGF production and Dt would mitigate signaling through any remaining VEGF. However, preliminary in vitro studies summarized in Figure 2.6  104  suggest in the cell lines that express low levels of Her2/neu that the QLT0267/ Dt combination was less effective at inhibiting VEGF secretion than when QLT0267 was used alone. Similar to the P-AKT (Ser473) results, when using VEGF secretion as an endpoint, the results obtained in the Her2/neu over-expressing cell lines differed from those obtained with cells that express low Her2/neu levels. On the basis of VEGF secretion and P-AKT (Ser473) data I can conclude that the QLT0267/Dt drug combination effects were dependent on Her2/neu expression. These differences encouraged us to assess the effect of QLT0267 on Her2/neu signalling in the Her2/neu positive cell lines. Although not reported here, these studies demonstrated that QLT0267 treatment induced a dose dependent decrease in Her2/neu levels; an effect that could also be obtained when using siRNA to silence ILK. This unexpected effect of QLT0267 on Her2/neu positive cell lines complicated the interpretation of results in these Her2/neu positive cells and for this reason the in vivo studies reported here focused on mice bearing orthotopically transplanted LCC6 cells which do not express detectable levels of Her2. CONCLUSION: This in vivo study provided evidence supportive of the beneficial therapeutic effects of the QLT0267/Dt combination on LCC6 tumours (see Figure 2.8) and suggested that further studies are warranted to address development of this combinations and the factors that may influence treatment outcomes; factors that include drug dose, schedule and sequencing as well as an assessment of therapeutic response in vivo that also includes multiple endpoints (e.g. tumour cell proliferation and death as well as tumour vascularization).  105  2.5 References 1.  2.  3. 4. 5.  6.  7. 8.  9.  10.  11. 12.  13.  14. 15. 16.  Wu, C. and S. Dedhar, Integrin-linked kinase (ILK) and its interactors: a new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J Cell Biol, 2001. 155(4): p. 505-10. Yau, C.Y., et al., Inhibition of integrin-linked kinase by a selective small molecule inhibitor, QLT0254, inhibits the PI3K/PKB/mTOR, Stat3, and FKHR pathways and tumor growth, and enhances gemcitabine-induced apoptosis in human orthotopic primary pancreatic cancer xenografts. Cancer Res, 2005. 65(4): p. 1497-504. Yoganathan, T.N., et al., Integrin-linked kinase (ILK): a "hot" therapeutic target. Biochem Pharmacol, 2000. 60(8): p. 1115-9. Hannigan, G., A.A. Troussard, and S. Dedhar, Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer, 2005. 5(1): p. 51-63. Wu, C., Integrin-linked kinase and PINCH: partners in regulation of cellextracellular matrix interaction and signal transduction. J Cell Sci, 1999. 112 ( Pt 24): p. 4485-9. Persad, S., et al., Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem, 2001. 276(29): p. 27462-9. Deng, J.T., et al., Phosphorylation of the myosin phosphatase inhibitors, CPI-17 and PHI-1, by integrin-linked kinase. Biochem J, 2002. 367(Pt 2): p. 517-24. Yamaji, S., et al., A novel integrin-linked kinase-binding protein, affixin, is involved in the early stage of cell-substrate interaction. J Cell Biol, 2001. 153(6): p. 1251-64. Hannigan, G.E., et al., Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 1996. 379(6560): p. 91-6. Mulrooney, J., et al., Phosphorylation of the beta1 integrin cytoplasmic domain: toward an understanding of function and mechanism. Exp Cell Res, 2000. 258(2): p. 332-41. Ahmed, N., et al., Cell-free 59 kDa immunoreactive integrin-linked kinase: a novel marker for ovarian carcinoma. Clin Cancer Res, 2004. 10(7): p. 2415-20. Intaraprasong, P., et al., Expression of integrin-linked kinase is not a useful prognostic marker in resected hepatocellular cancer. Anticancer Res, 2007. 27(6C): p. 4371-6. Lu, H., et al., Integrin-linked kinase expression is elevated in human cardiac hypertrophy and induces hypertrophy in transgenic mice. Circulation, 2006. 114(21): p. 2271-9. Okamura, M., et al., Prognostic value of integrin beta1-ILK-pAkt signaling pathway in non-small cell lung cancer. Hum Pathol, 2007. 38(7): p. 1081-91. Qi, X.P., et al., [Expression of integrin-linked kinase in prostate cancer and its significance]. Zhonghua Nan Ke Xue, 2005. 11(1): p. 34-7. Dai, D.L., et al., Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 2003. 9(12): p. 4409-14.  106  17.  18. 19.  20. 21.  22. 23.  24.  25.  26. 27.  28. 29.  30.  31. 32.  33.  34.  Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTENmutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12. Attwell, S., C. Roskelley, and S. Dedhar, The integrin-linked kinase (ILK) suppresses anoikis. Oncogene, 2000. 19(33): p. 3811-5. Radeva, G., et al., Overexpression of the integrin-linked kinase promotes anchorage-independent cell cycle progression. J Biol Chem, 1997. 272(21): p. 13937-44. Tan, C., et al., Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell, 2004. 5(1): p. 79-90. Edwards, L.A., et al., Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment by inhibition of Integrin-linked kinase (ILK). Mol Cancer Ther, 2008. 7(1): p. 59-70. Kretzler, P.L.M., K.P. INC., Editor. 2002: Canada. Edwards, L.A., et al., Inhibition of ILK in PTEN-mutant human glioblastomas inhibits PKB/Akt activation, induces apoptosis, and delays tumor growth. Oncogene, 2005. 24(22): p. 3596-605. Troussard, A.A., et al., Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res, 2006. 66(1): p. 393-403. Edwards, L.A., et al., Combined inhibition of the phosphatidylinositol 3-kinase/Akt and Ras/mitogen-activated protein kinase pathways results in synergistic effects in glioblastoma cells. Mol Cancer Ther, 2006. 5(3): p. 645-54. Leonessa, F., et al., MDA435/LCC6 and MDA435/LCC6MDR1: ascites models of human breast cancer. Br J Cancer, 1996. 73(2): p. 154-61. Dragowska, W.H., et al., HER-2/neu overexpression increases the viable hypoxic cell population within solid tumors without causing changes in tumor vascularization. Mol Cancer Res, 2004. 2(11): p. 606-19. Ross, D.T., et al., Systematic variation in gene expression patterns in human cancer cell lines. Nat Genet, 2000. 24(3): p. 227-35. Rae, J.M., et al., MDA-MB-435 cells are derived from M14 melanoma cells--a loss for breast cancer, but a boon for melanoma research. Breast Cancer Res Treat, 2007. 104(1): p. 13-9. Sellappan, S., et al., Lineage infidelity of MDA-MB-435 cells: expression of melanocyte proteins in a breast cancer cell line. Cancer Res, 2004. 64(10): p. 3479-85. Neve, R.M., et al., A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell, 2006. 10(6): p. 515-27. Chou, T.C. and P. Talalay, Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul, 1984. 22: p. 27-55. Chou, T.C., Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev, 2006. 58(3): p. 621-81. Zoli, W., et al., In vitro preclinical models for a rational design of chemotherapy combinations in human tumors. Crit Rev Oncol Hematol, 2001. 37(1): p. 69-82.  107  35.  36.  37. 38. 39. 40.  41.  42.  43.  44. 45.  46.  47.  48.  49.  Mayer, L.D., et al., Ratiometric dosing of anticancer drug combinations: controlling drug ratios after systemic administration regulates therapeutic activity in tumor-bearing mice. Mol Cancer Ther, 2006. 5(7): p. 1854-63. Rosenblum, M.D. and R.R. Shivers, 'Rings' of F-actin form around the nucleus in cultured human MCF7 adenocarcinoma cells upon exposure to both taxol and taxotere. Comp Biochem Physiol C Toxicol Pharmacol, 2000. 125(1): p. 121-31. Younes, M.N., et al., Integrin-linked kinase is a potential therapeutic target for anaplastic thyroid cancer. Mol Cancer Ther, 2005. 4(8): p. 1146-56. Pegram, M.D., Docetaxel and herceptin: foundation for future strategies. Oncologist, 2001. 6 Suppl 3: p. 22-5. Montero, A., et al., Docetaxel for treatment of solid tumours: a systematic review of clinical data. Lancet Oncol, 2005. 6(4): p. 229-39. Yoo, G.H., et al., Docetaxel associated pathways in cisplatin resistant head and neck squamous cell carcinoma: a pilot study. Laryngoscope, 2005. 115(11): p. 1938-46. Fabbri, F., et al., Mitotic catastrophe and apoptosis induced by docetaxel in hormone-refractory prostate cancer cells. J Cell Physiol, 2008. 217(2): p. 494501. Mhaidat, N.M., et al., Docetaxel-induced apoptosis of human melanoma is mediated by activation of c-Jun NH2-terminal kinase and inhibited by the mitogen-activated protein kinase extracellular signal-regulated kinase 1/2 pathway. Clin Cancer Res, 2007. 13(4): p. 1308-14. Wang, L.G., et al., The effect of antimicrotubule agents on signal transduction pathways of apoptosis: a review. Cancer Chemother Pharmacol, 1999. 44(5): p. 355-61. Somasiri, A., et al., Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 2001. 114(Pt 6): p. 1125-36. Filipenko, N.R., et al., Integrin-linked kinase activity regulates Rac- and Cdc42mediated actin cytoskeleton reorganization via alpha-PIX. Oncogene, 2005. 24(38): p. 5837-49. Graness, A., K. Giehl, and M. Goppelt-Struebe, Differential involvement of the integrin-linked kinase (ILK) in RhoA-dependent rearrangement of F-actin fibers and induction of connective tissue growth factor (CTGF). Cell Signal, 2006. 18(4): p. 433-40. Fielding, A.B., I. Dobreva, and S. Dedhar, Beyond focal adhesions: integrinlinked kinase associates with tubulin and regulates mitotic spindle organization. Cell Cycle, 2008. 7(13): p. 1899-906. Bijman, M.N., et al., Microtubule-targeting agents inhibit angiogenesis at subtoxic concentrations, a process associated with inhibition of Rac1 and Cdc42 activity and changes in the endothelial cytoskeleton. Mol Cancer Ther, 2006. 5(9): p. 2348-57. Ramos, J., et al., Motexafin gadolinium modulates levels of phosphorylated Akt and synergizes with inhibitors of Akt phosphorylation. Mol Cancer Ther, 2006. 5(5): p. 1176-82.  108  50.  51. 52. 53.  54.  Hohla, F., et al., Synergistic inhibition of growth of lung carcinomas by antagonists of growth hormone-releasing hormone in combination with docetaxel. Proc Natl Acad Sci U S A, 2006. 103(39): p. 14513-8. Maddika, S., et al., Akt-mediated phosphorylation of CDK2 regulates its dual role in cell cycle progression and apoptosis. J Cell Sci, 2008. 121(Pt 7): p. 979-88. Byzova, T.V., et al., Role of integrin alpha(v)beta3 in vascular biology. Thromb Haemost, 1998. 80(5): p. 726-34. Watanabe, M., et al., Involvement of integrin-linked kinase in capillary/tube-like network formation of human vascular endothelial cells. Biol Proced Online, 2005. 7: p. 41-7. Murtagh, J., H. Lu, and E.L. Schwartz, Taxotere-induced inhibition of human endothelial cell migration is a result of heat shock protein 90 degradation. Cancer Res, 2006. 66(16): p. 8192-9.  109  CHAPTER 3 Validating the use of a luciferase labeled breast cancer cell line, MDA435LCC6, as a means to monitor tumour progression and to assess the therapeutic activity of an established anticancer drug, docetaxel (Dt) alone or in combination with the ILK inhibitor, QLT0267.*  3.1 Introduction Animal models are a vital tool in the study of cancer and are used to gain a better understanding of cancer biology and to assess the pharmacological behaviour of experimental drugs. Since the late 1950’s, xenografts of human tumour cell lines injected subcutaneously into mice have been used to study cancer treatments. These models have been useful in the identification of many of the anticancer drugs that are used today; however they are, in general, considered to be poor predictors of therapeutic activity in patients [1]. Even with the advent of transgenic models [1, 2] or the use of tumour models arising following orthotopic transplantation of human tumours [3-5], there is little evidence indicating what models are the most predictive for use in the development of drug candidates for cancer indications. This is a serious problem for those investigators wishing to define better treatments for patients with cancers that do not respond well to existing standard of care chemotherapy protocols. Regardless, studies in animal models of cancer must be used to identify drug candidates with therapeutic potential and these models can help to define activity relative to drugs that are already approved for use while also providing insight into mechanism of action, drug distribution, drug metabolism, and toxicity. *A version of this chapter has been submitted, Jessica Kalra, Malathi Anantha, Corinna Warburton, Dawn Waterhouse, Hong Yan, Young-Joo Yang, Dita Strut, Maryam. Osooly, Dana Masin, and Marcel Bally, “Validating the use of a luciferase labeled breast cancer cell line, MDA435LCC6, as a means to monitor tumour progression and to assess the therapeutic activity of an established anticancer drug, docetaxel (Dt) alone or in combination with the ILK inhibitor, QLT0267” (April 2010).  110  Retrospective studies have suggested that the best preclinical indicator of partial and complete responses for a drug candidate tested in phase II human clinical trials is demonstrable activity in multiple animal models of cancer [6]. As an example, Sathornsumetee et al. completed an elegant retrospective review of the preclinical and clinical trials for vandetanib. In their assessment vandetanib proved efficacious in the treatment of multiple human cancer xenograft models established as subcutaneous, orthotopic or metastatic disease. Subsequent analysis of Phase I and II clinical trials demonstrated in patients that vandetanib was a promising new agent [7]. Perhaps then, it can be suggested that multiple preclinical models designed to emulate human cancers should be tested in parallel to give the best indication of how an agent will perform in the clinic. It is well recognized that the effectiveness of anticancer drugs will be influenced by the growth behavior and genetics of the cancer cells used as well as the microenvironment where the tumours form. The latter will affect tumour cell behavior as well as accessibility of drugs to regions where the tumour cells localize. For breast cancer treatments this is recognized clinically, where chemotherapy regimens utilize different drugs when treating local or metastatic disease [8]. These observations again highlight the need for testing experimental drugs in multiple models grown in various sites before considering their use in the clinic. When considering such an approach, investigators have often relied on use of different tumour cell lines, injected by various routes to establish tumours prior to initiating treatment. However, comparison of results obtained in tumour models developed with different cell lines is challenging because treatment outcomes will be dependent on the cell lines used as well as the site of tumour progression. To address this issue, a strategy relying on use of an isogenic  111  human breast cancer cell line capable of establishing tumours in different sites in vivo depending on the route of cell inoculation as been outlined here. Furthermore, it is argued that, once identified, the most treatment refractory models should then be used to assess methods for enhancing treatment outcomes involving broader dose escalations, use of combinations and assessment of dose scheduling parameters. This approach, where a single cell line is used to establish disease in multiple locations, may better predict how the site of tumour growth influences treatment outcomes. The specific aims of this study were: 1) to develop and characterize in vitro LCC6 breast cancer cells transfected with a luciferase gene; 2) to explore the use of in vivo bioluminescence imaging (BLI) to visualize and monitor tumour progression following injection of the cells into the mammary fat pad, the peritoneal cavity or intracardiacally; 3) to determine whether the site of tumour cell inoculation and the associated site(s) of disease progression influence docetaxel (Dt) efficacy; and 4) to determine if the more treatment refractory model could be sensitized to docetaxel by combining its use with the ILK inhibitor, QLT0267, a targeted agent that has previously been shown to sensitize orthotopic LCC6WT=uc breast tumours to docetaxel [9]. The results suggest that the metastatic model is most treatment refractory while tumours established following injection into the mammary fat pad appeared most sensitive to treatment with Dt.  3.2 Materials and Methods  Chemicals Docetaxel (Dt) was obtained from the British Columbia Cancer Agency Pharmacy (Vancouver, BC, Canada). Dt was reconstituted in 13% ethanol for a final concentration  112  of 10 mg/ml. Luciferin was obtained from Caliper Life Sciences (Almeda, CA, USA), and reconstituted in sterile PBS for a final concentration of 15 mg/ml. QLT0267 was a generous gift from QLT Inc, (Vancouver, BC, Canada). Tritium labeled docetaxel was obtained from American Radiolabeled Chemicals (St. Louis, MO, USA). Cell-lines and Culture MDA-MB-435/LCC6 (LCC6) estrogen receptor negative breast cancer cells [10] were a generous gift from Dr. Robert Clarke (Georgetown University, Washington, DC, USA). The breast cancer origin of the LCC6 parental cell line, MDA-MB-435, is controversial. Based on studies of Ross et al [11] and Rae et al [12] it has been suggested that the MDA-MB-435 cell line is of a melanoma origin sharing features of the M14 melanoma cell line. However, Sellappan et al [13], have been able to demonstrate that MDA-MB-435 cells can be induced to express breast differentiationspecific proteins and secrete milk lipids. Furthermore Neve et al [14] have demonstrated that the MDA-MB-435 cell line shares many molecular features with breast cancer cell lines of breast epithelium origin. In studies from our laboratory [15] using a LCC6 cell line permanently transfected with the Her2/neu gene (LCC6Her2 cell line), we have been able to demonstrate that the Her2/neu positive variant exhibits enhanced survival under stress, overproduction of VEGF, activation of NF-κB and in vivo sensitivity to trastuzumab (aka Herceptin); results that are consistent with what is known about Her2/neu positive breast cancer models. Although the M14 melanoma cell line and the MDA-MB-435 cell line show striking similarities with respect to genetic profile leading to the belief that both are in fact the M14 cell line, most recent karyotype evidence has shown that both cell lines were derived from a female patient consistent with the origin  113  of MDA-MB-435 and not M14 cells [16]. Thus, I believe it is justifiable to use these cells as a model breast cancer cell line. Stock cells lines were maintained in the absence of penicillin and streptomycin and screened for mycoplasma prior to preparing a stock of cells that were frozen for use in experiments. Cells were re-suspended in freezing media (10 % DMS0 in FBS) and slowly frozen in Nalgene® 1 ºC freezing containers (Rochester NY, USA) containing 100% isopropanol at -80 ºC for 24 hours before storage in liquid nitrogen. Frozen cells were quickly thawed at 37 ºC, centrifuged to remove freezing media, plated and passaged twice before use in experiments.  LCC6 and LCC6WT-luc cells used for  experiments were maintained in DMEM/high glucose supplemented with L-glutamine (2 mmol/L; DMEM and L-glutamine from Stem Cell Technologies, Vancouver, British Columbia, Canada), 5 mM penicillin/streptomycin (Stem Cell), and 10% fetal bovine serum (FBS) (Hyclone, Logan, UT, USA). All cells were maintained at 37°C and 5% CO 2 in a humidified atmosphere and allowed to undergo no more than 20 passages. Lentivirus Transfections Constructs for the lentivirus (LV) vector containing the luciferase (luc) and Green Fluorescent Protein (GFP) genes were obtained from Dr. Alice Mui (Jack Bell Research Center, Vancouver General Hospital) who also assisted in the transfection of the LCC6vector and LCC6WT cells lines. Briefly, the luciferase coding sequence was isolated from the pGL-3 vector (Promega, Madison, WI, USA) and cloned into the lentiviral vector FG9 downstream of the CMV – LTR and UBiC promoter. To generate luciferaseexpressing lentivirus (Lenti-luc), this vector was cotransfected using calcium phosphate with packaging constructs pRSVREV, pMDLg/pRRE, and the VSV-G expression  114  plasmid pHCMVG into HEK-293T cells. Five million 293T HEK cells were plated on poly-L-lysine-coated tissue culture plates allowed to adhere for 24 hours. The following day, 10 µg of the transducing vector, 7.5 µg of the packaging vector, and 2.5 µg of the VSV envelope pMD.G were co-transfected by LipofectAMINE 2000 (Invitrogen, Burlington ON, Canada), according to the manufacturer's instructions. After 24 hours, fresh media was applied to cells, and cells were cultured for another 24 hours. Conditioned medium was then collected and cleared of debris by low speed centrifugation, filtered, and stored at -70 °C. Collection of supernatant was done daily for 4 days, pooled and ultracentrifuged. The pellet was re-suspended in 500 µl of media, and aliquots were stored at -70 °C. A similar method was used to generate GFPexpressing lentivirus. The LCC6 cells were then infected with Lenti-luc virus (25 µL concentrated viral supernatant/mL medium). Briefly, one million cells were seeded in each well of a 12 well plate in 500 µl of complete media and allowed to adhere for 24 hours. Subsequently, Lenti-vector or Lenti-Luc and the Lenti-GFP constructs were added to the media at a ratio of 10:1 in the presence of Polybrene (8 µg/mL medium). After approximately 5 hours of incubation, the cells were washed with PBS, fresh culture medium was added and cells were incubated for up to 6 days. To enrich for luciferase positive cells, cells were first sorted by FACS for GFP expression. Subsequently GFP-positive cells were re-plated in low concentrations into soft agar in the wells of a 96 well plate. Luciferin was added to each well and plates were imaged using IVIS (see below) to identify luciferase positive colonies. Positive colonies were selected expanded and used for the in vitro and in vivo studies described below.  115  Growth Curves and Cell Viability Assay Metabolic activity (used as a measure of cell viability) was determined using the Alamar Blue® assay (Medicorp Inc. Montreal, QC,Canada) run according to instructions provided by the manufacturer. For growth curves, 1000 cells were seeded in triplicate onto 96-well flat bottom tissue culture plates (Techno Plastic Products AG, Switzerland) and allowed to adhere to the substratum for 24 hours under normal growth conditions (37°C and 5% CO2 in a humidified atmosphere). Thereafter, for 7 days the number of viable cells was estimated by Alamar blue. For cytotoxicity assays, 6000 cells / well (seeded in triplicate onto 96-well flat bottom tissue culture plates) were allowed to adhere for 24 hours under normal growth conditions (37°C and 5% CO2 in a humidified atmosphere). Serial dilutions of Dt or vehicle controls diluted in DMEM cell culture medium were added to wells and cells were grown for an additional 72 hours before measuring cell viability. To assess cell viability, cells were incubated with 10% resazurin solution for four hours at 37°C and fluorescence was measured at 560/590 nm using an Optima fluorescence plate reader (BMG Labtech, Durham, NC, USA). Relative fluorescence determined from drug treated cells was normalized to fluorescence determined from control cells (cells grown in the absence of added drug) and the percent (%) cell viability relative to vehicle control treated cells (100% viability) was determined. Background fluorescence was subtracted from all samples and results of experiments conducted in triplicate at least three times were averaged. Animal Studies All animal studies were conducted in accordance with institutional (University of British Columbia) guidelines for humane animal treatment and according to the current  116  guidelines of the Canadian Council of Animal Care. Mice were maintained at 22°C in a 12 hour light and dark cycle with ad libitum access to water and food. The studies used female NCr nude mice weighing between 18 and 25 g which were obtained from Taconic (Oxnard, CA, USA) and maintained in an SPF-facility. Animals were housed in groups of 4 or 5. Long-term survival was determined based on the time in days when mice were terminated due to tumour ulceration, the presence of tumours exhibiting volumes in excess of 500 mg, and/or signs of deteriorating animal health requiring euthanasia as defined by a health monitoring standard operating procedure. Animals that did not develop tumours as assessed by BLI prior to initiation of treatments were excluded from the study. Experimental Design, Tumour Xenografts and Treatments For the first study (Figure 3.2), mice were randomized into 3 groups of 6 according to the site of tumour inoculation (i.p., o.t. or i.c.). To initiate the i.p. model, the abdomen of each animal was disinfected using 70% isopropanyl alcohol to clean the injection site and 5x106 LCC6WT-luc cells in 500 µl HBSS were injected i.p. using a 25gauge needle. The o.t. model was initiated via injection of 2x106 LCC6luc cells into the mammary fat pad in a volume of 50 L media using a 28-gauge needle [17]. For the i.c. tumour model, disease was initiated by anesthetizing animals using isoflurane and positioning animals so that a 26-gauge needle attached to a 1 mL tuberculin syringe could be inserted at a 30 degree angle immediately caudal to the xyphiod process. The needle was aimed towards the left shoulder. Slight negative pressure was placed on the syringe upon entry and the needle was slowly moved forward until blood appeared in the hub of the needle. Once the needle was in the correct position, 2x106 LCC6WT-luc  117  cells in a volume of 100 µl media were slowly (over 30 to 60 seconds) injected. Animals were monitored for tumour growth, body weight and health status. Tumour growth for all three models, was monitored using an IVIS 200 imaging system (Xenogen, Caliper Life Sciences, MA, USA) as described below. Animal body weights were measured every Monday, Wednesday and Friday. For the second study (Figure 3.3), mice were randomized into 3 groups (20 mice per group) according to the site of tumour inoculation (i.p., o.t. or i.c.). Tumours were established as described above and on day 7, animals were treated with 1 dose of 10 mg/kg Dt spiked with tritium labeled Dt. Four animals were removed per group at 0.5, 1, 2, 4, and 24 hours post treatment, at which time blood was collected via cardiac puncture and organs were harvested as outlined in the methods below. For the third study (Figure 3.4), mice were randomized into 3 groups according to the site of tumour inoculation (i.p., o.t. or i.c.) and further randomized into 2 sub-groups (6 mice per group) (vehicle and 5 mg/kg). Tumours were established as described above and readily detectable by luminescence in all animals 24 hrs and 7 days post-inoculation. On day 7, animals were treated with the vehicle or Dt (5 mg/kg) (i.v. Q7D x 4). Animals were monitored for growth, body weight and survival. Tumour growth was monitored using the IVIS 200. For the fourth study (Figure 3.5), mice were randomized into 2 groups according to the site of tumour inoculation (i.p. or i.c.) and further randomized into 4 sub-groups (6 mice per group) according to the dose of docetaxel (5, 10, 15 mg/kg) used. Tumours were established as described above and on day 7, animals were treated with Dt or the vehicle control (i.v. Q7D x 4). Animals were monitored for growth, body weight and survival. Tumour growth was monitored using the IVIS 200. For the  118  fifth study (Figure 3.6) mice were randomized into 2 groups to be inoculated with LCC6WT-luc cells and further randomized into 4 sub-groups according to treatment (vehicle, 10mg/kg Dt, 200mg/kg QLT0267 or a combination of 10 mg/kg Dt and 200mg/kg QLT0267) (5 mice per group). The QLT0267 dose (200 mg/kg) and schedule (QD x 28) was selected based on previous studies that showed effective therapy in different human xenograft models [9, 18, 19]. i.c. tumours were established as described above and on day 7, animals were treated with (vehicle; Dt - 10 mg/kg (i.v.) (Q7D x 4); QLT0267 - 200 mg/kg (p.o.) (QD x 28); or a combination of Dt - 10 mg/kg (i.v.) (Q7D x 4) and QLT0267 - 200 mg/kg (p.o.) (QD x 28). Animals were monitored for tumour growth (IVIS 200), body weight and overall health status. In vivo Imaging System (IVIS) Imaging was performed once per week to monitor tumour progression. LCC6WTluc  tumour bearing mice were injected i.p. with 500 μl D-luciferin (15 mg/ml) (Xenogen  Corp., Alameda, CA, USA). Mice were anaesthetized using isoflurane and at precisely twenty minutes (±2 min.) post luciferin injection mice were imaged. Photographic and luminescence images were taken at exposure times of 1, 2 and 5 second(s) and Xenogen IVIS® software was used to quantify non-saturated bioluminescence in regions of interest (ROI). Light emission between 5.5 x 10 6 – 7.0 x 1010 was assumed to be indicative of viable luciferase-labeled tumour cells while emissions below this range were considered as background. Bioluminescence was quantified as photons/second for each ROI.  119  Dt Pharmacokinetics and Tumour Tissue Drug Uptake Tumour bearing animals were given an i.v. dose of 10 mg/kg Dt, labeled with 3 µCi of [3H]-Dt. Four animals were sacrificed by CO2 asphyxiation at 0.5, 1, 2, 4, and 24 hrs and blood was collected immediately via a cardiac puncture. Blood was rapidly transferred to EDTA containing Microtainers TM and placed on ice. Plasma was separated by centrifugation (15 min at 1500 x g at 4 °C) and stored at -80 °C. Onehundred µL of plasma was added to 5 ml scintillation fluid and the amount of [3H]-Dt present was measured by liquid scintillation counting (Packard 1900TR Liquid Scintillation Analyzer). DPMs were assumed to be due to intact Dt and the results were converted to concentration of Dt ([Dt]) per 1 mL of plasma using the specific activity of the injected Dt solution prior to injection of animals. To determine the amount of drug in the peritoneal cavity, the cavity was lavaged with 5 mL of ice cold saline. 100 µL of collected fluid was assessed for radioactive Dt. The resulting DPMs were used to estimate the amount of drug in the peritoneal cavity, which included cell and non-cell associated [3H]-Dt. Tumours or tissues containing tumours were harvested and the presence of luciferase positive cells was confirmed by BLI. Tumours or tissues with confirmed evidence of tumour growth (e.g. mammary fat pad for mice given o.t. cell inoculations, pancreas for mice given i.p. cell inoculations and adrenal glands and ovaries for mice given i.c. cell inoculations) were harvested. Harvested tissue was weighed and then solubilized using 500 µL of Solvable (Perkin Elmer, Boston, MA USA) and incubated overnight at 50 °C. Organ homogenates were decolorized using 200 µL H2O2 and 50 µL EDTA and subsequently incubated overnight at room temperature. The samples were  120  assessed for [3H]-Dt using scintillation counting and these data were then used to estimate the amount of Dt per mg of tissue. Statistical Analysis All statistical data was collected using GraphPad Prism (San Diego, CA, USA). Parametric analysis was done using standard deviation or standard error of the mean and n, in an unpaired Student t test. DT area under the curve analysis was done using Phoenix™ WinNonlin® software (Pharsight, St. Louis, MO, USA). Kaplan-Meier survival curves were generated using SigmaPlot 10.0 (Dundas Software, Germany).  3.3 Results Development and characterization of LCC6 breast cancer cells transfected with a luciferase gene. As described in the Methods, luciferase positive LCC6WT cells were clonally selected, tested for mycoplasma using a standard PCR method, expanded and frozen for subsequent use. LCC6WT, LCC6WT-luc and LCC6vector cells were studied in vitro to determine if the transfected cell lines exhibited cell growth attributes and drug sensitivity comparable to the parental cell lines. These data have been summarized in Figure 3.1. Tumour cell growth rates, summarized in Figure 3.1A, indicate that the luciferase transfected cells grow comparably to the parental or vector transfected cell lines, exhibiting doubling times of approximately 24 hrs when the cells are growing exponentially (after day 6). Sensitivity of the luciferase transfected cells to Dt (72 hour exposure time) was determined using the Alamar blue assay and the results (Figure 3.1B) indicated that the IC50 for Dt when used against the parental cell line LCC6WT or LCC6WT-luc was approximately 0.7 nM. The LCC6 vector cell line exhibited a Dt IC50 of 1.0 nM).  121  Monitoring tumour progression with bioluminescence imaging. In order to correlate FLUX values determined in vivo to the estimated number of viable cells, dilutions of cells derived from culture were prepared (0 to 5.0 x 106 cells) and placed in wells of a 48-well plate. The plate was then imaged using IVIS (Figure 3.2A). FLUX measurements (p/s) were determined and then plotted against the number of cells plated per well (Figure 3.2A) to generate a curve relating FLUX to cell number. The results summarized in Figure 3.2B - G are for animals that have been inoculated with LCC6 WT-luc cells orthotopically (3.2B and 3.2C), in the left ventricle (3.2D and 3.2E); and the peritoneal cavity (3.2F and 3.2G). Animals were imaged by whole body scans using BLI once a week for 6 weeks. Figures 3.2C, 3.2E, and 3.2G show the quantity of light FLUX on the indicated days. In order to generate tumour growth curves (insets to Figure. 3.2C, 3.2E, and 3.2G), FLUX data were related to cell number using the data provided in Figure 3.2A. The results summarized in Figure 3.2 lead to several conclusions. First, LCC6WT-luc cell proliferation is faster when the cells are inoculated i.p. For example, if the conversion of flux data to viable cell number is accurate, then 28 days after i.p. tumour cell inoculation the whole body scan would suggest that approximately 150 million luciferase positive cells are present. If the cells are given by i.c. injection, then the tumour cell burden is almost 20-fold lower. It needs to be recognized, however, that these differences may be due in part to the fact that luciferin was administered i.p. and the luciferase-labeled cells in the peritoneal cavity may have far greater access to the substrate when compared to tumour cells within other tissues or organs. Second, orthotopic injection of LCC6WT-luc cells results in well defined  122  Figure 3.1 Cell growth and sensitivity to Dt in vitro. LCC6WT cells were stably cotransfected using a Lenti-virus vector containing the luciferase gene or green fluorescent protein (GFP) (see Methods).  After transfection and selection, selected  cells were collected, determined to be mycoplasma free and subsequently grown in vitro. Tumour cell growth rates were determined following plating of 1000 cells and as described in the methods, the number of viable cells was determined for 7 days using the Alamar blue assay (Panel A). Sensitivity of the transfected cells to increasing concentrations of Dt was determined using the Alamar blue assay on cells that had been exposed to Dt for 72 hrs. The results presented were determined three times in triplicate and the data points represent the mean (± SEM) of the three independent studies.  Figure 3.1 Cell growth and sensitivity to Dt in vitro. 1  123  localized disease that does not appear to disseminate from the site of injection (Figure 3.2B). Third, i.c. injection of LCC6WT-luc cells does produce a disseminated disease with growth in many discrete regions. Isolation of various organs and an assessment of bioluminescence indicated established tumours in the brain, lungs, ovary, lymph nodes, bones (femur and rib cage) and occasionally heart. The latter is likely a reflection of the inoculation site and localization of cells in that tissue. Finally, i.p. injection of LCC6WT-luc cells resulted in ascites formation, which is evident by broad and diffuse bioluminescence within the peritoneal cavity. It is notable that on day 28, when animals were terminated, tumour cells were present within the ascites fluid, within tumour nodules that could be found within the peritoneal cavity and within the pancreas. Docetaxel pharmacokinetics and tumour drug levels. Orthotopic, metastatic and ascites tumours were established as described in the Methods and seven days after cell inoculation, animals were given an i.v. injection of [3H]-labeled Dt (see methods). At various time points (0.5, 1, 2, 4 and 24 hours) blood was collected by cardiac puncture and tumour tissue and/or ascites fluid was harvested. Dt elimination following i.v. injection was comparable in all three tumour bearing models (Figure 3.3A). The average Dt AUC0-24h was 482.6 ng/ml*hr and there were no significant differences in drug levels at the specified time points between the different tumour models (p > 0.05). Peritoneal fluid from mice inoculated i.p. with LCC6WT-luc cells was collected and analyzed for Dt. These data have been summarized in Figure 3.3B. Following i.v. injection, Dt accumulates in the peritoneum over the first 2 hours and the concentration in ascites fluid is maintained in the peritoneal fluid collected from the peritoneal cavity  124  Figure 3.2 Growth of LCC6WT-Luc cells in female NCr nude mice following inoculation orthotopically (o.t.) (mammary fat pad), intracardiacally (i.c.) (left ventricle), or intraperitoneally (i.p.). LCC6WT-luc cells were serially diluted and placed into wells of a 24 well plate and immediately imaged using the IVIS 200 system to obtain FLUX measurements (Panel A-representative images).  These data were  averaged (n = 4) and used to generate a plot of comparing total flux to cell number (Panel A - graph). LCC6WT-Luc cells were inoculated orthotopically (Panels B & C), via intracardiac injection (Panels D & E), or intraperitoneally (Panels F & G) (see methods). Bioluminescence imaging was used to monitor tumour growth. Images shown were acquired on days 0, 1, 7, 14, 21, and 28. FLUX values were measured using whole body scans for each animal (representative images shown in B, D and F). FLUX data (shown in panels C, E and G) was then related to cell number (insets to panels C, E and G) using the calibration curve (panel A).  125  126  Figure 3.2 Growth of LCC6WT-Luc cells in female NCr nude mice following inoculation orthotopically (o.t.) (mammary fat pad), intracardiacally (i.c.) (left ventricle), or intraperitoneally (i.p.). 1  over the 24 hour time course. The AUC0-24hrs for Dt in the peritoneal cavity was 432.6 ng/ml*hr. Since bioluminesence data suggested that following i.p. inoculation the LCC6WT-luc cells tumours appeared within the pancreas and for this reason the pancreas was assessed for Dt levels (Figure 3.3C). The pancreatic tissue levels ranged from 0.4 ng/mg tissue to 0.1 ng/mg tissue with an AUC0-24h of 3.74 ng/mg*hr. An AUC0-24h of 287.9 ng/mg*hr was calculated for the mammary fat pad of mice inoculated with LCC6WT-luc cells orthotopically (Figure 3.3D). As already indicated, when the tumour cells were given by an intracardiac injection the cells established tumours in various tissues in the mouse. This is illustrated by the representative BLI data provided in Figure 3.3F. Disease development, however, was most consistent within the adrenal glands and ovaries and for this reason Dt levels were determined in these tissues following i.v. administration of Dt to animals with established systemic disease. The results summarized in Figure 3.3E, indicate that Dt accumulation in the adrenal glands was low, ranging from 0.1 ng/mg to 0.007 ng/mg with an AUC0-24h of 0.842 ng/mg*hr while the ovaries exhibit the lowest levels of Dt from 0.08 – 0.008 ng/mg with an AUC0-24h of 0.476 ng/mg*hr (Figure 3.3E). Dt treatment of mice bearing LCC6WT-luc tumours established after orthotopic, intracardiac and intraperitoneal injections of LCC6WT-luc cells. Orthotopic, metastatic and ascites tumours were established in NCr nude mice as described above. Seven days after cell inoculation the mice were treated with vehicle or 5 mg/kg Dt; a well tolerated Dt dose selected to better differentiate between the activity of the drug in the models. In Figure 3.4, results obtained when mice with established orthotopic (Figure  127  Figure 3.3 Docetaxel pharmacokinetics and distribution to sites of disease development following inoculation of LCC6WT-Luc cells via the o.t., i.c. and i.p. injection. 0.5, 1, 2, 4 and 24 hours after i.v. injection of Dt (10 mg/kg) labeled with [3H]-Dt, animals (n = 4 per time point) were terminated by CO 2 asphyxiation and blood was collected by cardiac puncture and placed into an EDTA-containing micro-container placed on ice (see Methods). Subsequently plasma was separated from blood cells and the amount of [3H]-Dt in 50 µL of plasma was determined by liquid scintillation counting. These data were then used to calculate the plasma concentration of Dt (ng/mL) (Panel A). Dt levels in ascites fluid (cell-associated and non-cell associated) were determined following a 5 mL lavage with serum media (see methods). The total amount of fluid recovered from the peritoneal cavity was measured and an aliquot of the ascites was taken for scintillation counting. The amount of Dt per mL of ascites fluid was then determined (Panel B). In animals inoculated with LCC6WT-luc cells, tumours consistently developed in the pancreas. Therefore the pancreas from each mouse was harvested and processed (see Methods) for assessment of [3H]-Dt. These data were then used to estimate the amount of Dt in pancreatic tissue (ng/mg tissue). For mice bearing metastatic disease, BLI data suggested that organs/tissues such as the brain, lung, rib cage, and heart (Panel F) exhibited tumour growth, however growth was most consistently observed in the adrenal glands and ovaries thus these organs were chosen as representative organs for metastatic disease. These tissues were collected and analyzed as described above (Panel E). Similarly, tumours harvested from the animals bearing orthotopic tumours were collected and processed (Panel D). All tissue levels  128  129  were reported as ng Dt per mg wet tissue and the results presented represent the mean (n = 4) ± SD.  Figure 3.3 Docetaxel pharmacokinetics and distribution to sites of disease development following inoculation of LCC6WT-Luc cells via the o.t., i.c. and i.p. injection. 1  3.4A), metastatic (Figure 3.4B) and ascites (Figure 3.4C) tumours were treated with Dt are compared. BLI analysis indicated that Dt treatment caused a significant reduction in tumour growth as measured on day 21 in all three models when compared to control mice (p < 0.05). Treatment effects were also reflected in the Kaplan Meier Survival Curves which highlight two important points. First, when evaluating the controls it is clear that the most aggressive disease develops following i.c. injection of the LCC6WT-luc cells, where the median survival time (MST) is 23 days. This is in contrast to the data provided in Figure 3.2 which would suggest that the mice given the i.c. injection of cells has the lowest tumour burden. Control animals inoculated with LCC6WT-luc cells via the o.t. or i.p. routes exhibited MSTs of 28 and 32 days, respectively. Second, when treated with 5 mg/kg Dt the increase in MST was greatest (13 days) when Dt was used to treat disease established after o.t. inoculation of the LCC6WT-luc cells. There was a 1.42, 1.26, and 1.25 fold increase in the MST in the o.t., i.c. and i.p. models, respectively when compared to vehicle treated animals. Since animals with established orthotopic tumours were most sensitive to treatment with Dt, the remaining studies focused on the more treatment refractory models. Dt, when administered at higher doses (Figure 3.5), was more effective in prolonging the survival time of animals bearing i.p. tumours (Figure 3.5A), where > 80% of the animals survived when treated with Dt at a dose of 15 mg/kg (Q7D x 4). In contrast, by day 76, 100% of the i.c. inoculated animals had to be sacrificed due to tumour progression, even when treated with 15 mg/kg Dt (Figure 3.5B). Assessing whether the metastatic model could be sensitized to docetaxel by combining its use with the ILK inhibitor QLT0267. The results presented thus far  130  Figure 3.4 Dt treatment of mice (i.v. Q7D x 4 with 5 mg/kg) with established tumours developed following orthotopic (Panel A), intracardiac (Panel B) or intraperitoneal (Panel C) injection of LCC6WT-luc breast cancer cells. The IVIS200 system was used to obtain BLI (representative images provided on top row) and subsequent FLUX analysis was used to assess tumour progression for each model (middle row). Image analysis for total FLUX quantification was determined on 21 days after tumour cell inoculation (following the 3 rd treatment with Dt). Kaplan-Meier survival curves were generated based on the time when animals needed to be terminated due to overall health status or tumour ulceration and tumour size (for the orthotopic tumours only). If animals were terminated due to health status the following day was recorded as the time of death. Median survival time (MST) for each group was estimated and the T C value was determined by subtracting the MST of control animals (C) from the Dt treated (T) animals. Results were obtained using at least 5 mice per treatment group and error bars (on Total Flux data) represent the SEM. An ANOVA analysis of data indicated that the treatment groups were statistically different from controls (* p > 0.05; ** p > 0.01; and *** p > 0.005).  131  Figure 3.4 Dt treatment of mice (i.v. Q7D x 4 with 5 mg/kg) with established tumours developed following orthotopic (Panel A), intracardiac (Panel B) or intraperitoneal (Panel C) injection of LCC6WT-luc breast cancer cells. 1  132  indicate that the metastatic disease is least sensitive to Dt when used at a dose close to the maximum tolerated dose. This may be explained in part by limited drug delivery to tissues with established disease as described in Figure 3.3. To determine whether treatment outcomes can be improved when using the metastatic model, Dt was used in combination QLT0267, an agent that targets ILK and can sensitize cells to cytotoxic agents by inhibiting the AKT pathway [9, 18, 20].  Previously it was shown that  QLT0267 improved the efficacy of Dt when used to treat the orthotopic LCC6 model [9]. In the present study, QLT0267 and Dt were used alone and in combination to treat animals with established LCC6WT-luc metastatic tumours. Metastatic disease (i.c.) was established and treated as described in the Methods. The results of this in vivo efficacy study have been summarized in Figure 3.6. Tumour growth was monitored using BLI (Figure 3.6 A & 3.6B). Survival (Figure 3.6 C) was determined based on the time in days before animals were terminated due to poor health status. Tumours in animals treated with Dt, QLT0267 and Dt/ QLT0267 showed reduced bioluminescence on day 21 post cell injection when compared to vehicle control treated mice. Quantification of total light flux demonstrated that the tumour burden on day 21 was significantly less in mice that had received treatment as compared to mice treated with the vehicle control (p < 0.05), however animals treated with the combination of Dt/ QLT0267 did not exhibit benefits that were significantly better then that achieved with Dt alone. This is likely because Dt treatment was so effective when assessing therapy at this time point. Kaplan-Meier survival analysis (Figure 3.6C) of survival data (as defined by animal health) suggested that for animals treated with QLT0267 (200 mg/kg) the median survival time was 31 days for LCC6WT-luc (n = 5) as compared to 23 days for  133  Figure 3.5 Treatment of mice with Dt at the MTD (i.v. Q7D x 4 with 15 mg/kg). Mice inoculated with LCC6WT-Luc cells i.p. (A) or i.c. (B) (see Methods) were treated i.v. with 5, 10, or 15 mg/kg of Dt once a week for four weeks. Kaplan-Meier survival curves were generated based on the time when animals needed to be terminated due to overall health status. If animals were terminated due to health status the following day was recorded as the time of death.  Results were obtained using at least 5 mice per  treatment group.  Figure 3.5 Treatment of mice with Dt at the MTD (i.v. Q7D x 4 with 15 mg/kg). 1  134  control animals (n = 13). Animals treated with Dt exhibited a median survival time of 45 days for LCC6WT-luc. Animals treated with the QLT0267/Dt combination exhibited a median survival time that was not significantly better than that achieved with QLT0267 alone and, surprisingly, suggested that the treatment outcomes when using the drug combination was slightly worse than that achieved with Dt alone.  3.4 Discussion Although efficacy data obtained in animal based tumour models are required for the development of new anticancer drugs and to assess drug combination effects, these models are widely criticized because the data obtained are not highly predictive of activity in humans. There are many examples that could be highlighted [16-22], but in general strong evidence of activity in well characterized preclinical models is rarely recapitulated in clinical trials. The poor correlation between preclinical studies and clinical results has been attributed to various limitations in the animal models used, models which do not adequately represent the human disease and/or the stage of disease progression. The latter refers to the fact that many new drug candidates are assessed in patients who exhibit late stage disease; disease that has progressed following extensive standard of care treatment regimens. It also refers to the fact that late stage disease is often systemic (metastatic) and there are very few metastic models of human cancer routinely used. Investigators have suggested approaches to address these limitations, however, the solutions to these problems are not simple and to date no one approach has been developed which can accurately predict therapeutic effects in humans. Retrospective  135  Figure 3.6 Treatment of mice inoculated i.c. with LCC6 WT-luc cells with single agent or a combination of Dt (10 mg/kg Q7D x 4) and the ILK inhibitor QLT0267 (QD x 28). LCC6WT-luc cells were inoculated i.c. (see Methods) and then treated with vehicle control, Dt (10 mg/kg), QLT0267 (200mg/kg), or the combination of QLT0267/Dt. BLI was obtained as described in the Methods 21 days after tumour cell inoculation (representative images have been provided in Panel A). Total light emission from tumours in animals was quantified at that time (Panel B). Kaplan-Meier survival curves (Panel C) were generated based on the time when animals needed to be terminated due to overall health status. If animals were terminated due to health status the following day was recorded as the time of death. Results were obtained using at least 5 mice per treatment group.  136  Figure 3.6 Treatment of mice inoculated i.c. with LCC6WT-luc cells with single agent or a combination of Dt (10 mg/kg Q7D x 4) and the ILK inhibitor QLT0267 (QD x 28). 1  137  studies have clearly shown that under situations where significant therapeutic benefits have been observed in early clinical studies the preclinical data to support development of the drug consisted of strong evidence of therapeutic effects in multiple (5 or more) tumour models. The studies described here were designed to validate the use of multiple models of breast cancer where the site of disease development varied, but the human breast cancer cell line used to generate the different models was the same. Validation was based on use of Dt, an agent that is well-recognized as an effective drug in the treatment of breast cancer [21, 22]. This approach allowed us to compare how a single cell line grown in different microenvironments would influence Dt efficacy. As expected the site of disease development does affect treatment outcomes and these results can be partially attributed to Dt delivery to the regions where the tumours progress. A luciferase positive breast cancer cell line (LCC6) was created to allow for assessment of tumour growth in a variety of regions using non-invasive imaging methods (BLI). In vitro results suggested that the introduction of the luciferase gene into the LCC6 cell line did not influence the cells growth rate or sensitivity to Dt (see Figure 3.1). Importantly BLI was exquisitely sensitive and could accurately detect as few as 10,000 viable cells. There has been some suggestion that the distribution of and availability of substrate post injection and the uptake of substrate into tumour cells  in  vivo limits the utility of this method of measuring tumour volume. Our studies show that relative tumour size can be readily measured when imaging protocols have been appropriately optimized as described in the methods. Furthermore, follow-up studies  138  using histological approches should be undertaken to evaluate and confirm result obtained using BLI. In this study I show that inoculated cells established tumours in immune compromised mice and the site(s) of disease development were dependent on the cell inoculation site (see Figure 3.2). Inoculation of these cells into the mammary fat pad led to localized growth, with no evidence of metastatic disease development prior to the time when animals had to be terminated due to tumour ulceration or size. When the cells were inoculated i.p., disease development was restricted to the peritoneal cavity, where tumour growth resulted in ascites. There was no evidence of metastic disease when the cells were inoculated i.p., however there was consistent development of tumours within the pancreas of inoculated animals. It is not clear why there was an affinity for the pancreas when using this route of cell inoculation. It should be noted that the LCC6 cell line does not express E-cadherin and loss of E-cadherin in other breast cancer cell lines has been associated with increased invasiveness and growth in the pancreas [23]. Intracardiac injection of the LCC6 cells resulted in metastatic disease. Although BLI data suggested that animals inoculated i.c. exhibited the lowest tumour cell burden (at least 10-fold lower than observed when using the other routes of inoculation (see Figure 3.2), tumour related morbidity was most rapid in this model. Control animals needed to be terminated due to disease progression around 20-22 days after i.c. cell inoculation, while animals inoculated with the cells i.p. or orthotopically survived to day 28-32 after cell inoculation. Importantly, Dt was therapeutically active in all three models used; consistent with the fact that Dt has demonstrated positive activity in early (adjuvant) treatment of  139  breast cancer and late stage metastatic disease [21, 22]. When using a well-tolerated low dose of Dt, treatment effects were greatest in animals bearing orthotopic tumours and least effective in animals with metastatic disease. Although the site of disease development did not affect Dt elimination from the plasma (see Figure 3.3), Dt delivery to sites of disease development following i.c. inoculation of cells was remarkably lower than that observed to sites involved when the cells were inoculated i.p. and orthotopically. Thus reduced Dt activity in models with metastatic disease could be explained by a more aggressive disease phenotype as well as reduced drug delivery to tissues/organs with progressing tumours. Even when treated with Dt at the maximum tolerated dose in the NCr nude mice (15 mg/kg Q7D), 100% of the mice with metastatic disease needed to be terminated due to disease progression. In contrast, 80% of the mice inoculated with cells i.p. and treated with Dt at the MTD survived beyond 80 days. It can be argued that the results summarized here are consistent with results expected for Dt in treatment of women with breast cancer. Dt exhibits its greatest therapeutic potential when used in the adjuvant setting, although it is not clear whether Dt provides significant benefit in patients when compared to combinations of an anthracycline and cyclophosphamide [21, 22]. Dt is used frequently in patients with relapse (treatment refractory/resistant and metastatic) disease, but in this setting it offers improvements in median survival time, not survival [21]. Regardless of setting it is clear that the therapeutic benefits of Dt will be greatest when used in a combination regimen. Previous studies from our laboratory have demonstrated that the therapeutic effects of Dt can be enhanced when it is used in combination with QLT0267, an investigative drug candidate that targets ILK and, as a result, inhibits the AKT survival  140  pathway [5]. The previous study suggested that synergistic interactions between QLT0267 and Dt were due in part to enhanced effects of Dt on tubulin and F-actin organization which could potentially have a dramatic effect on cell motility, invasion and metastasis. These results were obtained using the orthotopic LCC6 breast cancer model, which exhibits no evidence of metastatic disease development. In this study, additional treatment with QLT0267 did not improve therapeutic outcomes for animals with metastatic disease. However, it should be noted that the dose of Dt used (10 mg/kg) was very effective at controlling disease progression. Thus future studies should be done to evaluate the combination of QLT0267 and Dt with lower doses of Dt (i.e. 2.5 and 5 mg/kg). In light of the results presented here and in the previous chapter, I predict that benefits of using QLT0267 in combination with Dt would most likely be observed in the adjuvant setting [5]. Unfortunately, if QLT0267 was developed to the point where human clinical studies were initiated, its use would likely be first assessed in patients with advanced, metastatic disease. As shown here a model that is representative of this type of disease (the i.c. LCC6 model) appears to be least responsive to Dt. Further, the activity of Dt in combination with QLT0267 did not prove to be beneficial over Dt alone. As such, these results would predict that combinations of QLT0267 with Dt would not be better than single agent Dt in a relapsed disease setting. This is perhaps also consistent with previous results indicating that QLT0267 interacts with Dt in a manner that prevents invasion and metastasis and thus it would have less impact on treatment outcomes following metastasis. CONCLUSION: LCC6WT-luc breast cancer cells can be used to create metastatic, orthotopic and ascites models in vivo. Disease development is easily monitored using  141  bioluminescence imaging methods. This study demonstrates that the metastatic model, established after intracardiac injection of tumour cells, is the most aggressive in terms of disease related morbidity and least sensitive to Dt, an established agent used in the treatment of early and late stage breast cancer. A drug candidate that inhibits the AKT survival pathway (QLT0267), when used in combination with Dt provided no added therapeutic benefits when used to treat the metastatic LCC6 model, which contrasts with previous results demonstrating Dt/QLT0267 interacted synergistically and improved treatment outcomes in the orthotopic LCC6 model. In light of these data, the three different preclinical breast cancer models derived from a single cell line would predict that clinical benefits in patients with breast cancer would most likely be observed if QLT0267 was combined with Dt to treat patients in the adjuvant or neoadjuvant setting. The approach described here, where a single breast cancer cell line was used to establish three distinct tumour models, can be used widely to assess how tumour microenvironment and drug distribution influence treatment response.  142  3.5 References 1. 2. 3. 4. 5.  6.  7. 8. 9.  10. 11. 12.  13.  14. 15.  16. 17.  Talmadge, J.E., et al., Murine models to evaluate novel and conventional therapeutic strategies for cancer. Am J Pathol, 2007. 170(3): p. 793-804. Cespedes, M.V., et al., Mouse models in oncogenesis and cancer therapy. Clin Transl Oncol, 2006. 8(5): p. 318-29. Bibby, M.C., Orthotopic models of cancer for preclinical drug evaluation: advantages and disadvantages. Eur J Cancer, 2004. 40(6): p. 852-7. Tseng, W., X. Leong, and E. Engleman, Orthotopic mouse model of colorectal cancer. J Vis Exp, 2007(10): p. 484. Hoffman, R.M., Orthotopic metastatic mouse models for anticancer drug discovery and evaluation: a bridge to the clinic. Invest New Drugs, 1999. 17(4): p. 343-59. Voskoglou-Nomikos, T., J.L. Pater, and L. Seymour, Clinical predictive value of the in vitro cell line, human xenograft, and mouse allograft preclinical cancer models. Clin Cancer Res, 2003. 9(11): p. 4227-39. Sathornsumetee, S. and J.N. Rich, Vandetanib, a novel multitargeted kinase inhibitor, in cancer therapy. Drugs Today (Barc), 2006. 42(10): p. 657-70. Bergh, J., et al., A systematic overview of chemotherapy effects in breast cancer. Acta Oncol, 2001. 40(2-3): p. 253-81. Kalra, J., et al., QLT0267, a small molecule inhibitor targeting integrin-linked kinase (ILK), and docetaxel can combine to produce synergistic interactions linked to enhanced cytotoxicity, reductions in P-AKT levels, altered F-actin architecture and improved treatment outcomes in an orthotopic breast cancer model. Breast Cancer Res, 2009. 11(3): p. R25. Leonessa, F., et al., MDA435/LCC6 and MDA435/LCC6MDR1: ascites models of human breast cancer. Br J Cancer, 1996. 73(2): p. 154-61. Ross, D.T., et al., Systematic variation in gene expression patterns in human cancer cell lines. Nat Genet, 2000. 24(3): p. 227-35. Rae, J.M., et al., MDA-MB-435 cells are derived from M14 melanoma cells--a loss for breast cancer, but a boon for melanoma research. Breast Cancer Res Treat, 2007. 104(1): p. 13-9. Sellappan, S., et al., Lineage infidelity of MDA-MB-435 cells: expression of melanocyte proteins in a breast cancer cell line. Cancer Res, 2004. 64(10): p. 3479-85. Neve, R.M., et al., A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell, 2006. 10(6): p. 515-27. Dragowska, W.H., et al., HER-2/neu overexpression increases the viable hypoxic cell population within solid tumors without causing changes in tumor vascularization. Mol Cancer Res, 2004. 2(11): p. 606-19. Chambers, A.F., MDA-MB-435 and M14 cell lines: identical but not M14 melanoma? Cancer Res, 2009. 69(13): p. 5292-3. Conley, F.K., Development of a metastatic brain tumor model in mice. Cancer Res, 1979. 39(3): p. 1001-7.  143  18.  19. 20. 21. 22. 23. 24.  26.  Edwards, L.A., et al., Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment by inhibition of integrin-linked kinase (ILK). Mol Cancer Ther, 2008. 7(1): p. 59-70. Younes, M.N., et al., Integrin-linked kinase is a potential therapeutic target for anaplastic thyroid cancer. Mol Cancer Ther, 2005. 4(8): p. 1146-56. McDonald, P.C., A.B. Fielding, and S. Dedhar, Integrin-linked kinase--essential roles in physiology and cancer biology. J Cell Sci, 2008. 121(Pt 19): p. 3121-32. Saloustros, E., D. Mavroudis, and V. Georgoulias, Paclitaxel and docetaxel in the treatment of breast cancer. Expert Opin Pharmacother, 2008. 9(15): p. 2603-16. Crown, J., et al., Docetaxel and paclitaxel in the treatment of breast cancer: a review of clinical experience Paclitaxel and docetaxel in the treatment of breast cancer The role of taxanes in the treatment of breast cancer 25. Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. Oncologist, 2004. 9 Suppl 2(15): p. 24-32. Hazan, R.B., et al., Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. J Cell Biol, 2000. 148(4): p. 779-90.  144  CHAPTER 4 Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1* 4.1 Introduction Increased ILK expression and/or activity [1-5] has been documented in many cancers types, including lung [1], brain [2], prostate [3], pancreatic [4], colon [5, 6], gastric [7], ovarian [8] cancers, and malignant melanomas [9]. Over-expression of ILK in epithelial cells has been shown to induce epithelial–mesenchymal transition (EMT) [1013] and deregulated growth, while targeted inhibition of ILK induces apoptosis and cell cycle arrest [14-17]. In normal mammary cells, over-expression of ILK stimulates anchorage-independent cell growth [18-20], and causes constitutive up-regulation of cyclin D and A expression while promoting cell cycle progression [20] and promotes hyperplasia and tumour formation in vivo [21]. Given the importance of ILK in cancer development and progression, it is anticipated that ILK inhibition and/or silencing may be an effective way of treating cancer. Preclinical studies completed to date support this idea [22, 23]. A recent study from our lab using preclinical breast cancer models highlighted the therapeutic benefits associated with targeting ILK [23]. However, the results clearly indicated that Her2/neu positive breast cancer cell lines responded uniquely when compared to cell lines that expressed low levels of Her2/neu. For example Her2/neu positive tumours were more sensitive to treatment with QLT0267. The studies summarized here investigated Her2/neu expression in six cell lines where Her2/neu over-expression was a result of gene amplification (SKBR3, BT474, JIMT-1, and *A version of this manuscript has been submitted Jessica Kalra, Brent W. Sutherland, Anna L. Stratford, Karen A. Gelmon, Shoukat Dedhar, Sandra E. Dunn, and Marcel B. Bally “Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1 “(April 2010)  145  KPL-4), or gene transfection (LCC6Her2, MCF-7Her2). The results presented demonstrate that ILK inhibition (with a small molecule ILK inhibitor, QLT0267) or silencing (using siRNA) suppressed Her2/neu protein expression. Evidence is provided to suggest that ILK-mediated regulation of Her2/neu appears to act through signaling pathways involving the transcription factors YB-1 and TWIST.  4.2 Materials and Methods Chemicals and Reagents Negative control siRNA (low GC content) (Neg). siRNA sequences against human TWIST1 mRNA (Genbank accession no. NC:000007) and ILK mRNA (Genbank accession no. GI:3150001) were generated by Invitrogen (Burlington, Ontario, Canada). QLT0267 (267) was a generous gift from QLT Inc, (Vancouver BC). The pIRES-hrGFP (Stratagene La Jolla CA, USA) vectors containing a FLAG tagged full length human normal ILK (ILKWT) gene were a generous gift from Dr. Shoukat Dedhar. All other chemicals, unless specified, were purchased from Sigma Chemical Company (Oakville, Ontario). Cells & Cell Culture All cell lines were tested to ensure that they were mycoplasma free. Cells used for studies were derived from original stocks that had been expanded and frozen. They were maintained in culture for no more than 20 passages and at that time were replaced with frozen stock. MDA-MB-435/LCC6 [24] breast cancer cells were a gift from Dr. Robert Clarke (Georgetown University, Washington, DC) and were derived from the parental cell line MDA-MB-435. The origin of this cell line is controversial [25] but I believe it is justifiable to use these cells as a model breast cancer cell line [28]. LCC6  146  cells were transfected via electroporation with the mammalian expression vector pREP9 (Invitrogen, Grand Island, NY) containing the 4.3 kb full-length human normal c-erbB2 cDNA to yield LCC6Her2 as previously described [26, 27]. JIMT-1 cells were a gift from Dr. Jorma Isola (Tampere University and Tampere University Hospital. Tampere, Finland). MCF7, KPL-4 and SKBR3 cells were purchased from American Type Culture Collection (Manassas, VA). MCF7Her2 cells were a kind gift from Dr. Moulay AlaouiJamali (McGill University, Montreal, Quebec, Canada). LCC6, JIMT-1, BT474, KPL-4, MCF7Her2, and MCF7 cells were maintained in DMEM/high glucose supplemented with L-glutamine (Stem Cell Technologies, Vancouver, British Columbia, Canada) and 10 % FBS (Hyclone, Logan, UT). SKBR3 cells were maintained in McCoy′s 5a medium (Stem Cell Technologies, Vancouver, British Columbia, Canada) supplemented with Lglutamine and 10% fetal bovine serum. MCF7 cells were nucleofected (Amaxa Biosystems, Lonza Cologne, Basel, Switzerland) with the pIRES-hrGFP empty vector or the vector containing ILKWT gene and selected with G418 and sorted for GFP using FACS. All cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere. Nucleofection of siRNA or plasmid DNA: SKBR3, LCC6Her2 and JIMT-1 cells were transiently nucleofected with ILK siRNA as previously described [28]. MCF7 and SKBR3 cells were stably nucleofected with a plasmid encoding ILKWT. The nucleofection protocol for siRNA and plasmid DNA were similar. Briefly, the Nucleofector Technology (Amaxa Biosystems, Lonza Cologne, Basel, Switzerland) was used according to the manufacturer’s protocol. Optimal conditions were first determined using a GFP plasmid or Cy5 siRNA and analysis of cell labeling by FLOW cytometry. Once protocols were defined, 1x106 cells were suspended  147  in nucleofection buffer containing 1-4 µg of either siRNA or plasmid DNA and placed in the nucleofector for electroporation. Programs E09 (buffer C), D010 (buffer R), T020 (buffer R), P020 (buffer R) were used in SKBR3, LCC6Her2, JIMT-1 and MCF7 cells, respectively. Cells were re-suspended in DMEM and allowed to recover at 37°C and 5 % CO2 in a humidified atmosphere. For plasmid nucleofection, cells were selected for using G418 (Invitrogen, Burlington, Ontario, Canada) and sorted based on expression of GFP. Cells were analyzed for GFP expression using FLOW cytometry before each use. Cells that were greater than 90% positive for GFP, were processed for subsequent analyses. SDS-PAGE and Western Blot SDS-PAGE followed by Western blotting analysis was used to semiquantitatively determine ILK, AKT, pAKT TWIST, YB-1 and Her2/neu protein levels. Briefly, whole cell lysates were harvested by incubation in lysis buffer (50mM Tris/HCl pH 8.5, 150mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate) and pelleted by centrifugation at 14000 RPM for 10 minutes at 4°C. For sub-cellular localization studies, cells were incubated in lysis buffer (10mM Hepes, 1.5mM MgCl2, 10mM KCL, 1mM EDTA, 0.1% NP40) and then pelleted. The supernatant was collected as the cytoplasmic fraction, and the pellet was re-suspended in extraction buffer (0.42mM NaCl, 20mM HEPES, 1.5mM MgCl2, 20% glycerol). Cells were pelleted and the supernatant was collected as the nuclear fraction. Samples were separated on 10 % SDS-PAGE gels. Protein was transferred to Nitrocellulose membrane (Millipore, Bedford, MA) and blocked in Odyssey blocking buffer (Licor Biosciences, Lincoln, NBR). The blots were labeled with mouse polyclonal anti-ILK  148  (Transduction laboratories, BD Biosciences, Franklin Lakes, NJ, USA), rabbit polyclonal anti-TWIST,  anti-AKT,  anti-pAKTser473,  anti-pSTATser705,  anti-Her2/neu,  mouse  monoclonal anti-HSP-90 (Cell Signaling Technology, Beverly, MA, USA), rabbit polyclonal anti-YB-1 (Abcam, Cambridge MA, USA) or rabbit polyclonal anti-CREB (Millipore (Upstate), Etobicoke, ON, USA) antibodies. Primary antibody binding was detected by further incubations with anti-rabbit IRDYE (green) (Rockland, Gilbertsville, PA) or anti-mouse Alexa 680 (red) (Invitrogen, Molecular probes, Burlington, ON) and signal was detected and quantified using the Odyssey Infrared Detection System and associated software (Odyssey v1.2) (Licor, Lincoln NE, USA). Protein loading was determined by re-probing membranes for β-actin (Sigma-Aldrich, Oakville, ON). The absorbance of specific protein bands in a square region of interest surrounding each band, after background subtraction, was normalized to actin bands measured in the same way. Studies were conducted at least 3 times. Where indicated, absorbance data were expressed as mean absorbance values +/- standard deviation and parametric analysis was done using an unpaired Student t-test. Immunofluorescent Imaging Cells grown on coverslips were fixed using a 2.5 % paraformaldehyde solution in PBS, permeabilized with Triton X-100 and blocked in a 2.5 % BSA solution in PBS for 1 hour at room temperature before staining for YB-1 using a polyclonal rabbit primary antibody (1:25) or TWIST a polyclonal rabbit primary antibody (1:50). All antibodies were diluted in BSA/PBS. Coverslips were washed three times for five minutes using PBS. Primary antibody binding was detected by further incubations with anti-rabbit Alexa546 or Alexa488. To ensure that there was no non-specific antibody binding, a  149  secondary antibody control coverslip was used for each experiment where coverslips were stained with either Alexa546 or Alexa488 alone (data not shown). Hoechst (Molecular Probes, Eugene, OR, USA) (1:1000) was used to identify nuclei. The coverslips were then mounted to a microscope slide using a 9:1 solution of glycerol and 1x PBS. Cells were viewed using a Leica fourescent microscope (Wetzlar, Germany) with a 100 x oil immersion lens under the Z568RDCf filter set (Chroma, Rockingham, VT, USA) to visualize Alexa 546 and UV lamp to visualize Hoechst. Images were captured using DC100 digital camera and Open Lab software (Improvision, Lexington, MA, USA). Luciferase Assay SKBR3 cells were plated in six-well plates (4×105 cells/well) and transfected with a luciferase construct (pGL3 basic vector, Promega, Madison, WI, USA) containing the core promoter and the partial first exon of the YB-1 gene (courtesy of Dr. Kimitoshi Kohno, Department of Molecular Biology, University of Occupational and Environmental Health, Kitakyushi, Japan). Cells were transfected with a total of 1.0 μg DNA using FuGene (Roche, Toronto, ON, Canada). To assess transfection efficiency, cells were co-transfected with a renilla-expressing plasmid (pRL-TK, 10:1 luciferase:renilla) (Promega, Madison, WI, USA). After 24 hours, cells were treated with vehicle (PTE) or QLT0267 (42 μM) for 24 hours prior to harvesting in 1 × passive lysis buffer (Promega, Madison, WI, USA). Luciferase activity was measured using the Lumat LB 9507 Luminometer (Berthold Technologies, Oak Ridge TN, USA), according to the manufacturers' instructions, and results were normalized to the corresponding renilla readings from the same sample. The studies were done at least 3 times and  150  luminescence data were expressed as mean values +/- standard deviation and parametric analysis was done using an unpaired Student t-test. RNA Extraction and PCR The extraction of total RNA from a minimum of 1x106 cells was completed using the RNeasy mini kit (Qiagen, Hilden, Germany). RNAs were reverse transcribed using the Invitrogen Superscript III kit (Invitrogen, Burlington, ON) according to the manufacturer’s instructions. The RNA concentration of each sample was measured using the Nanodrop ND1000 spectrophotometer (Thermoscientific, Wilmington, DE, USA) and sample purity was determined by assessing the A260/A280 ratio, which always measured between 2.0 and 2.1. For PCR 1 - 3 µg of cDNA was added to PCR master mix containing 10 X PCR buffer, 3mM MgCl 2, 1mM dNTP, Taq polymerase, and 0.5 µM each of the appropriate forward and reverse primers (Invitrogen, Burlington ON, Canada) where GAPDH mRNA was used as an internal standard. Primer sequences used are as follows: Her2/neu forward primer 5’TCCTGTGTGGACCTGGATGAC3’ Her2/neu reverse primer 5’CCAAAGACCACCCCCAAGA3’ YB-1 forward primer 5’AAGTGATGGAGGGTGCTGAC3’ YB-1 reverse primer 5’TTCTTCATTGCCGTCCTCTC3’ GAPDH forward primer 5’GAAGGTGAAGGTCGGAGT3’ GAPDH reverse primer 5’GAAGATGGTGATGGGATTTC3’ cDNA was amplified using the DNA engine Peltier thermal cycler (Biorad, Mississauga ON, Canada).  PCR products were run out on a 1.5 % agarose gel  151  containing 0.004% ethidium bromide, and detected using the Eagle Eye II Cabinet detection system (Stratagene, La Jolla, CA, USA). Quantitative Real-Time PCR Quantitative SYBR green PCR assays for YB-1 and Her2/neu was performed in a ABI Prism 7700 Sequence detection system (Applied Biosystems, Streetsville ON, Canada) using the SYBR Green Kit supplied by Applied Biosystems. PCR amplification were carried out in a 20 μl volume under the following conditions: an enzyme activation step at 95°C for 2 minutes, followed by 45 cycles consisting of 30 seconds of denaturation at 95°C, 20 seconds of annealing at 60°C, and 20 seconds of elongation at 72°C. The specificity of the amplified products was verified by melting curve analysis and agarose gel electrophoresis. Ct values were converted to fold change.  4.3 Results QLT0267 or ILK targeted siRNA suppress total Her2/neu expression in multiple breast cancer cell lines. In an effort to better understand the effects of QLT0267 on Her2/neu positive breast cancer cells, the expression of total Her2/neu was examined in cell lines that were treated with QLT0267 at various doses for 24 hours, a time-point selected based on alamar blue assays that demonstrate no decreases in cell viability at this time (Figure 4.1). All six breast cancer cell lines examined, including LCC6 Her2 (Figure 4.1A), MCF7Her2 (Figure 4.1B), BT474 (Figure 4.1C), KPL4 (Figure 4.1D), SKBR3 (Figure 4.1E) and JIMT-1 (Figure 4.1F) showed a reduction in total Her2/neu protein levels in response to exposure to QLT0267. Her2/neu levels in cells treated with QLT0267 were qualitatively assessed by densitometry (average of three independent experiments) and the results indicated that in all cell lines 42µM QLT0267 resulted in  152  Figure 4.1 Her2/neu expression following treatment of various breast cancer cell lines with QLT0267. Expression of total Her2/neu in A - LCC6Her2, B - MCF7Her2, C – BT474, D – KPL4, E – SKBR3 and F – JIMT-1 cells treated with QLT0267 was determined using western blot analysis. Cells were treated for 24 hours with 10, 21 or 42 µM QLT0267. Subsequently, cells were lysed, protein were isolated and 50 µg whole cell lysates were separated on a 10% SDS-PAGE gels as described in the Methods. Membranes were probed for Her2/neu and β-actin. In all six cell lines, increasing concentrations of QLT0267 inhibited the expression of total Her2/neu. At 42 µM total Her2/neu is decreased by 69, 86.5, 49, 47, 63, and 32% (n=3) in LCC6Her2, MCF7Her2, BT474, KPL4, SKBR3 and JIMT-1 cells, respectively.  153  Figure 4.1 1 Her2/neu expression following treatment of various breast cancer cell lines with QLT0267.  154  suppression of total Her2/neu. Levels were decreased by 69, 86.5, 49, 47, 63, and 32% in LCC6Her2, MCF7Her2, BT474, KPL4, SKBR3 and JIMT-1 cells, respectively. To determine if the suppression of Her2/neu was a direct or indirect effect of QLT0267, SKBR3 were transiently nucleofected with 2 µg siRNA or a universal siRNA control (Neg) and ILK, AKT P-AKTser473, and Her-2/neu levels were determined at 24, 48, 72, and 96 hours (see representative blots in Figure 4.2). ILK expression was decreased by an average of 49%, 66%, 66% and 79% at 24, 48, 72 and 96 hours, respectively. Total Her2/neu expression was decreased by 71% at 96 hours (Figure 4.2A). Analysis of phosphorylation of AKT at serine 473 was done to elucidate whether the mechanism through which ILK modulates the expression of Her2/neu involves its downstream target, AKT. The results demonstrate that ILK silencing is associated with significant decreases in P-AKTser473 levels, but the effect is transient. Within 24 hours of treatment using ILK targeted siRNA, there was 79% suppression of P-AKTser473. These values returned to control levels by 72 hours (4. 2A). P-AKTser473 levels in SKBR3 cells were also determined following treatment with QLT0267 (Figure 4.2B). Significant decreases in P-AKTser473 were observed at 6 and 18 hours; however, P-AKTser473 levels begin to increase by 24 hours (Figure 4.2B). Transient decreases in P-AKTser473 levels following inhibition or silencing of ILK is consistent with the initiation of compensation mechanisms as reported by others [15, 29]. In order to determine whether ILK silencing by siRNA or inhibition by QLT0267 effected Her2/neu transcription, RNA was isolated from SKBR3 cells treated with QLT0267 or transfected with ILK siRNA. Her2/neu mRNA was measured using PCR and based on three independent experiments results indicated that inhibition (QLT0267)  155  Figure 4.2 Pathway analysis of SKBR3 cells transiently nucleofected with 2 µg of ILK siRNA using the Amaxa Nucleofector. 50 µg whole cells lysates harvested from cells at 24, 48, 72, and 96 hours post transfection, were separated on 10% SDS-PAGE gels. Resulting western blots were probed for ILK, Her2/neu, AKT, PAKTser473, and βactin was used to verify loading. ILK expression was decreased by 49, 66, 66 and 79% at 24, 48, 72 and 96 hours respectively. PAKT ser473 was suppressed by 79% at 24 hours where ILK silencing was at 49%. At 48 hours of treatment with ILK siRNA, SKBR3 cells exhibit a 66% suppression of ILK. At this and later time-points PAKTser473 expression is similar to control cells. Total Her2/neu expression was reduced by 71% at 96 hours of treatment with ILK siRNA as compared to the Neg siRNA (n=3). B - SKBR3 cells were treated with 42 µM QLT0267 for 6, 18 or 24 hours. Subsequently, cells were lysed, 50 µg of protein was isolated and then separated on 10% SDS-PAGE gels. Resulting western blots were probed for Her2/neu, PAKTser473 and β-actin to verify loading. Treatment with QLT0267 suppressed PAKT ser473 in all cell lines at a time-point earlier than that observed to suppress Her2/neu. PAKTser473 was decreased at 6 hours for while Her2/neu levels decreased substantially at 24 hours, where PAKTser473 begins to increase. C - SKBR3 cells were treated with 42 µM QLT0267 for 24 hours or transfected with ILK siRNA. Subsequently RNA was isolated from cells and reverse transcribed. Her2/neu was amplified from cDNA using RT-qPCR and PCR. A 9.8 and 2.5 fold decrease of Her2/neu transcript was observed when cells were treated using QLT0267 or ILK siRNA. (n=3)  156  Figure 4.2 Pathway analysis of SKBR3 cells transiently nucleofected with 2 µg of ILK siRNA using the Amaxa Nucleofector 1  157  or silencing (siRNA) of ILK was associated with 9.8 and 2.5 fold decreases in Her2/neu transcript levels, respectively (Figure 4.2C). Influence of ILK inhibition or silencing on YB-1 expression and intracellular localization. ILK silencing/suppression decreased Her2/neu expression in both SKBR3 cells, where over-expression is due to c-erbB2 gene amplification as well as and in LCC6Her2 cells, where Her2/neu expression is the result of c-erbB2 gene transfection driven by the RSV-LTR promoter. Mechanisms which could influence Her2/neu expression in these different cell types might therefore involve transcriptional and translational regulation. There was a strong rationale for examining whether ILK regulates YB-1 expression and / or cellular localization, as both could trigger changes in Her2/neu expression [38-49]. SKBR3 cells were transiently nucleofected with ILK siRNA. Subsequently ILK, Her2/neu, total YB-1 and β-actin levels were determined by western blot analysis. The results, summarized in Figure 4.3A, indicate that ILK levels were 64% and 84% suppressed at the 24 and 48 hour time points, respectively. Consistent with the results summarized in Figure 4.2A, ILK silencing was associated with significant decreases in total Her2/neu levels. These studies also demonstrated that ILK silencing was associated with decreases in YB-1 expression where 48 hours after ILK siRNA addition, YB-1 protein levels were reduced by 74%. Furthermore, ILK silencing (siRNA) and inhibition (QLT0267) engendered a 9.9- and 6.8-fold decrease in YB-1 transcript levels, respectively (Figure 4.3B). To determine whether ILK inhibition can influence transcription of YB-1, the activity of the YB-1 promoter region was evaluated using luciferase reporter assay [30, 31]. SKBR3 cells transfected with a YB-1 promoter construct linking YB-1 expression to luciferase were treated with  158  Figure 4.3 Inhibition of ILK activity or expression influences YB-1 transcription and sub-cellular localization. A - SKBR3 cells were transiently nucleofected with 4 µg ILK siRNA. Subsequently, cells were lysed and 50 µg of protein was isolated from samples at 24, 48 hours, separated on a 10% SDS-PAGE gel and probed for ILK, Her2/neu, YB-1 and β-actin to verify loading. ILK expression was substantially silenced when SKBR3 cells were treated with 4 µg of ILK siRNA for both 24 and 48 hours. Cells exhibit a 96% decrease in total Her2/neu expression after 48 hours at which time YB-1 expression is reduced by 74%. B - YB-1 transcript levels were analyzed in SKBR3 cells treated with QLT0267 or nucleofected with 4 µg ILK siRNA for 48 hours using PCR. A 9.9 fold and 6.5 fold decrease in YB-1 transcript was observed in QLT0267 treated and ILK silenced cells respectively as compared to control. C – SKBR3 cells were transfected with a YB-1 promoter/luciferase construct and treated with QLT0267 or vehicle control (PTE) for 24 hours. A significant reduction in YB-1 promoter activity of 50% is achieved when cells are treated with QLT0267 as compared to untreated controls (p < 0.05) D - SKBR3 cells grown on coverslips were treated with 42 µM QLT0267 for 24 hours,  fixed with 4% PFA and then stained  for YB-1.  Immunofluorescent images show that treatment of SKBR3 cells trigger a decrease in YB-1 protein (red) as well as a change in localization to granular structures in the cytoplasm (white arrows). Hoechst staining was used to counter stain nuclei (blue). (Bar = 5 µm) (n=3)  159  Figure 4.3 Inhibition of ILK activity or expression influences YB-1 transcription and sub-cellular localization. 1  160  QLT0267 or vehicle control and changes in luciferase activity were determined (Figure 4.3C). The results demonstrate that QLT0267 treated cells exhibited a 50% decrease (p < 0.05) in YB-1 promoter activity when compared to untreated controls. It is not clear why, but the vehicle treated cells exhibited an increase in promoter activity (Figure 4.3C). To  confirm  the  western  blot  data  summarized  in  Figure  4.3A,  immunofluorescence imaging of YB-1 was examined in SKBR3 cells treated with QLT0267. Representative images of untreated SKBR3 cells compared to cells treated with QLT0267 are shown in Figure 4.3D. QLT0267 treated cells exhibited lower levels of immunofluoresence, consistent with the western blot data. In addition, the fluorescence imaging clearly demonstrated localization of YB-1 into well defined puncta (Figure 4.3D, white arrows). Similar results were seen in other cell lines including LCC6Her2 cells (data not shown). Influence of ILK over-expression on YB-1 and Her2/neu levels. To assess how ILK influences the expression of YB-1 and Her2/neu SKBR3 cells were stably transfected with the ILKWT gene as described in the Methods. Exogenous expression of ILK in SKBR3ILKWT cells (Figure 4.4A) caused a small, but reproducible, decrease in native ILK expression.  In order to assess whether there were changes in YB-1 levels or  distribution, the ILKWT transfected cells were plated on coverslips fixed and stained for YB-1 (red) and nuclei (blue) (Figure 4.4B). When comparing SKBR3 ILK cells to SKBR3vector cells, YB-1 localization changed dramatically. SKBR3vector cells exhibited diffuse YB-1 staining, while SKBR3ILK cells exhibited increased levels of YB-1 and the YB-1 was mainly localized in the nucleus and perinuclear area (Figure 4.4B). To  161  Figure 4.4 Over-expression of ILK in SKBR3 cells increases YB-1 expression and nuclear localization. A – SKBR3 cells were stably nucleofected with an empty pIREShrGFP II vector or one containing a FLAG tagged ILK gene. Cells over-expressing ILKWT or the empty vector were analyzed for ILK, FLAG and β-actin protein expression in whole cell lysates using western blot analysis. Cells transfected with ILK exhibited double bands when blots were probed for ILK indicating the endogenous protein (lower band) and the FLAG-tagged exogenous protein (upper band). FLAG protein was readily detected in ILK transfected cells. B – SKBR3vector and SKBR3ILKWT cells were grown on coverslips, fixed then stained for YB-1 (red) and the nucleus (blue). SKBR3vector cells exhibit a diffuse and mainly punctuate cytoplasmic pattern of YB-1 staining while SKBR3ILKWT cells exhibit a mainly nuclear or peri-nuclear localization of YB-1. C – 50 µg of Cytoplasmic and nuclear protein lysate fractions harvested from SKBR3 vector and SKBR3ILKWT cells were separated  on SDS-PAGE gels, transferred to nitrocellulose  membranes and probed with anti-YB-1, and anti-vinculin and CREB to verify purity of cytoplasmic and nuclear fractions respectively. The resulting western analysis showed that YB-1 increased by 4 fold in the nuclear fraction and by 254% when considering cytoplasmic and nuclear fractions together in cells transfected with ILK as compared to vector transfected cells. (n=3)  162  Figure 4.4 Over-expression of ILK in SKBR3 cells increases YB-1 expression and nuclear localization. 1  163  confirm immunoflourescence results, cytoplasmic and nuclear protein fractions (see Materials and Methods) were prepared from the SKBR3vector and SKBR3ILK cells were used in Western Blot analysis. As shown in Figure 4.4C, representative western blot analysis of YB-1 in SKBR3 cells transfected with ILK showed a 254% increase (compared to vector transfected cells) in YB-1 when considering protein levels in the nucleus and cytoplasmic fractions. CREB (marker for the nuclear fraction) and Vinculin (marker for the cytoplasmic fraction) was used to verify the purity of the fractions (Figure 4.4C). The amount of YB-1 in the nucleus increased 4-fold when comparing cells transfected with ILK to cells transfected with the vector. It should be noted that similar studies were completed in MCF-7 cells. Forced over-expression of ILK in these cells, which express basal levels of Her2/neu, did not influence total YB-1 or Her2/neu protein levels. However increases in YB-1 and Her2/neu transcript were observed (data not shown). The role of TWIST and STAT-3 in regulating YB-1 and Her2/neu expression. Changes in YB-1 levels and localization following ILK inhibition/silencing or forced over expression provide an explanation for how ILK expression may influence Her2/neu expression in cell lines that over-express Her2/neu due to gene amplification or transfection. The results suggest that if ILK is inhibited or suppressed there will be a decrease in YB-1 mRNA and protein levels. It is not clear, however, how ILK would regulate the expression of YB-1 and for this reason studies were initiated to assess how ILK expression/inhibition influenced expression of the transcription factor TWIST. This protein is known to bind to the E-box regions within the YB-1 promoter and thus regulate YB-1 expression [32-34]. SKBR3 cells were treated with QLT0267 or  164  Figure 4.5 Inhibition of ILK activity or expression regulates TWIST expression. A – SKBR3 cells were treated with 42 µM QLT0267, Neg siRNA, or ILK siRNA. Subsequently, cells were lysed, protein was isolated and then separated on a 10% SDS-PAGE gel. Resulting western blots were probed for ILK, TWIST and β-actin. TWIST protein is reduced to 2% in SKBR3 cell treated with QLT0267 or nucleofected with ILK siRNA when compared to controls (untreated or Neg siRNA respectively). B SKBR3 were transiently nucleofected with Control or 4 µg TWIST siRNA for 96 hours. Subsequently, cells were lysed protein was isolated from samples, separated on a 10% SDS-PAGE gel and probed for Her2/neu, YB-1, TWIST and β-actin. Silencing of TWIST is seen at 96 hours. With a 40% silencing of twist YB-1 is decreased by 47% and Her2/neu total protein is reduced by 70%. (n=3)  Figure 4.5 Inhibition of ILK activity or expression regulates TWIST expression. 1  165  transfected with ILK siRNA and the resulting cell lysates were blotted and probed for ILK, TWIST and β-actin. The results have been summarized in Figure 4.5. Treatment with QLT0267 or transfection with ILK targeted siRNA both abrogated the expression of TWIST by 98% (Figure 4.5A). To elucidate whether a direct relationship exists between TWIST, YB-1 and Her2/neu expression in SKBR3 cells, the cells were nucleofected with siRNA targeting TWIST. Subsequently, the levels of TWIST, Her2/neu, YB-1, and βactin, were determined. Silencing TWIST proved to be quite troublesome in that several siRNA species both custom and commercial exhibited only minimal silencing effects. However , the results, represented by the western blot provided in Figure 4.5B, indicated that a 40% silencing of TWIST still was able to decrease YB-1 expression by 47% and Her2/neu expression by 70%. Under conditions where the SKBR3 cells were forced  to  over-express  ILK,  TWIST  increased  by  1.9  fold  (Figure  4.6A).  Immunofluorescence analysis of TWIST in SKBR3 and SKBR3ILKWT was completed (Figure 4.6B) and in both cell lines TWIST protein is found throughout the cytoplasm as well as the nucleus. Furthermore, these immunofluorescence studies indicated that ILK over expression was associated with an increase in TWIST expression in the SKBR3 cells. A key regulator of TWIST transcription is STAT-3 [35-37]. STAT-3 is activated by phosphorylation and translocated to the nucleus [38]. To determine if increases in TWIST expression were the result of increased phosphorylation of STAT-3 in the ILK over-expressing SKBR3 cells, the expression of P-STAT3ser705 in the nuclear fraction of these cells was examined and the results have been summarized in Figure 4.6C. Western blots probed for P-STAT3ser705, STAT-3, CREB (nuclear marker) and vinculin  166  Figure 4.6 Over-expression of ILK increases TWIST expression through activation of STAT-3. A - SKBR3 cells were stably nucleofected with an empty pIRES-hrGFP II vector or one containing a FLAG tagged ILK gene. Cells over-expressing ILKWT or the empty vector were analyzed for ILK, TWIST and β-actin protein expression in whole cell lysates using western blot analysis. Cells transfected with ILK exhibited double bands when blots were probed for ILK indicating the endogenous protein (lower band) and the FLAG-tagged exogenous protein (upper band). Over-expression of ILK was shown to increase TWIST by 1.9 fold at the protein level. B – SKBR3vector and SKBR3ILKWT cells were grown on coverslips, fixed with 4% PFA SKBR3 ILKWT and then stained for TWIST (red). Nuclei were counterstained with Hoechst (blue). Immunofluorescent analysis showed that SKBR3ILKWT cells have a substantial increase in TWIST staining. C – Protein lysates were collected from SKBR3 vector and SKBR3ILKWT cells, cytoplasmic fractions were separated from nuclear fractions, and run out on SDS-PAGE gels. The resulting western analysis showed that P-STAT-3ser705 increased by 2.0 fold in the nuclear fraction of cells transfected with ILK. Interestingly ILK over-expressing cells exhibit a 225% increase in total STAT when considering cytoplasmic and nuclear fractions together in cells transfected with ILK as compared to vector transfected cells. (n=3)  167  Figure 4.6 Over-expression of ILK increases TWIST expression through activation of STAT-3. 1  168  (cytoplasmic marker) indicated that SKBR3 cells transfected with ILK exhibited a 225% increase (relative to the vector transfected cells) in STAT-3 levels when considering the nuclear and cytoplasmic fractions together. Furthermore, a 2.0 fold increase in PSTATser705 is observed in the nuclear fraction of SKBR3 ILKWT cells (Figure 4.6C).  4.4 Discussion It has recently been shown that the activity of QLT0267, whether used alone or in combination, was dependent on whether the breast cancer cell lines used expressed Her2/neu [23]. It was therefore, important to gain a better understanding of how ILK inhibition influenced Her2/neu signaling and the studies described here were undertaken to address this issue. Our results demonstrate for the first time that ILK inhibition causes significant decreases in Her2/neu expression and that this is regulated through a previously unrecognized mechanism involving the transcription factors YB-1 and TWIST-1. To date no direct relationship between ILK expression and Her2/neu signaling has been documented yet it is clear from the results in this report that ILK targeted siRNA or inhibition with QLT0267, engenders significant decreases in total Her2/neu protein levels (Figure 4.1 and 4.2). Initially, a clue to the mechanism governing this effect was identified because suppression of Her2/neu (due to ILK silencing/inhibition) was observed in cell lines transfected with the c-erbB2 gene as well as in cells that over express Her2/neu due to c-erbB2 gene amplification. Thus, it was first thought that the regulation of Her2/neu via ILK would involve a factor that would act at a translational level as the transfected cells were made to express Her2/neu driven off an exogenous promoter. YB-1 was previously identified as an important transcription/translation factor  169  that participates in the formation of mRNPs [39-42] and in the regulation of mRNA translation and degradation [43-45]. YB-1 is an oncogene that is over-expressed in a variety of cancers and its forced expression induces the development of breast cancers [46, 47]. Previous studies indicate that normally about 90% of YB-1 protein is localized in the cytoplasm and when YB-1 is phosphorylated on serine 102, by AKT or RSK, the protein translocates to the nucleus [30, 48, 49]. Nuclear localization of YB-1 is associated with increased expression of Her2/neu and EGFR [50-52]. Furthermore, it has been shown that knockdown of YB-1 with siRNA reduces Her2/neu expression [38]. RNA interference strategies targeting ILK have been shown to interfere with nuclear translocation of YB-1 in human ovarian cancer cells [48], and it was postulated that this effect occurred through decreased phosphorylation of AKT. Thus Inhibition of ILK, may suppress phosphorylation of AKT, maintaining levels of YB-1 in the cytoplasm. In the cytoplasm, YB-1 can act as a translation factor binding to mRNA [39-41, 53]. Messenger RNA is normally bound to proteins, forming polysomes and messenger ribonucleoprotein complex (mRNPs). Messenger RNA released from disassembled polysomes and mRNPs are sorted and remodeled in stress granules (SGs), from which selected transcripts are delivered to processing bodies (PB) for degradation. SGs are cytoplasmic aggregates of protein and RNA approximately 100-200 nm in diameter and they are thought to be sites of stalled translation (e.g. pre-initiation complexes) [54-57]. Kedersha et al. established that YB-1 is a useful marker of SGs and PBs. These processes may be related given that YB-1 modulates the formation of SGs and translation of mRNA [42].  170  In this study, using immunofluorescent localization of YB-1 in SKBR3 cells, I demonstrated decreases in YB-1 nuclear staining and cytosolic sequestration of YB-1 into intracellular puncta that could be SGs following treatment with QLT0267 (see Figure 4.4B). This effect was also observed in the other breast cancer cell lines that were studied here. The formation of SGs may play a role in the translational regulation of both Her2/neu and YB-1. It is possible that when ILK is inhibited, a subsequent decrease in phosphorylation of AKT (Serine 473) could lead to accumulation of YB-1 in the cytoplasm where it may form SGs and PBs leading to the degradation of Her2/neu and YB-1 transcript. The results presented in Figure 4.2 demonstrated decreases in PAKTser473 following treatment with QLT0267 or ILK silencing by siRNA. Although this effect was transient, it remains a possible mechanism through which ILK may regulate the localization of YB-1 and thus impact Her2/neu expression. Nonetheless additional mechanisms linking ILK silencing/inhibition to decreases in Her2/neu levels needed to be considered. Another important point to note is that previous reports suggest that the LTR-RSV promoter used to drive c-erbB2 gene expression in the MCF7 and LCC6 cells has a binding site for YB-1 [53] which would also support a transcriptional regulatory mechanism of Her2/neu via ILK and YB-1 . ILK targeted siRNA or QLT0267 exhibited reduced YB-1 transcript levels (Figure 4.3B) and cells treated with QLT0267 displayed decreased YB-1 promoter activity. To elucidate a mechanism of transcriptional regulation of YB-1 via ILK, studies described here also evaluated the transcription factor TWIST. TWIST is known to bind to E-box regions within the YB-1 promoter and thus regulate its expression [32-34]. TWIST is considered oncogenic and is over-expressed in breast cancer [58, 59].  Entirely  171  consistent with a role for TWIST in ILK–mediated regulation of Her2/neu expression, decreased ILK expression or activity led to a near complete inhibition of TWIST expression (Figure 4.5A) suggesting that ILK may be able to regulate TWIST expression. Moreover, silencing of TWIST was associated with decreased expression of both YB-1 and Her2/neu (see Figure 4.5B). Finally, over-expression of ILK in SKBR3 cells resulted in increased TWIST expression (see Figure 4.6 A&B), suggesting for the first time that TWIST is a downstream target of ILK. TWIST expression is known to be regulated by two transcription factors that can be directly linked to pathways influenced, in part, by ILK. These include STAT-3 [35-37] and Hif1α [60-63]. The possible pathways through which ILK may modulate the expression and activity of TWIST and therefore YB-1 and Her2/neu are detailed in Figure 4.7. In this chapter I examined the role ILK in the activation of STAT-3. I showed that ILK over expression is associated with increased levels of phosphorylated, thus activated STAT-3 (Figure 4.6C). Activation of STAT-3 allows for its nuclear translocation and thus induction of gene transcription namely of TWIST. Where ILK activity or expression is attenuated, this pathway is shut down. Inactive STAT-3 is no longer able to promote transcription of TWIST which thereafter is unable to initiate transcription of YB-1. The effect of YB-1 on Her-2/neu expression is two-fold, 1) decreased YB-1 protein levels results in decreased Her-2/neu transcription and 2) cytoplasmic YB-1 forms SGs that act to stall translation of Her-2/neu mRNA. It is interesting to note that phenotypic changes seen with TWIST overexpression, mimic those seen with ILK over-expression and include increased EMT [64-  172  66], increased VEGF secretion [67, 68], increased propensity for invasion and migration [66, 69-73], evasion of apoptosis [74-76], drug resistance [77-79] and deregulated growth [33, 75, 80-83]. TWIST has been labeled as the master regulator of EMT, thus the previously unrecognized role of ILK in regulating TWIST expression is very relevant in the context of managing cancer development and progression. Conclusion: This study shows for the first time that ILK is involved in the expression of Her2/neu through a pathway that involves TWIST and YB-1. The broader implication of this study is support for the use of ILK inhibitors in the treatment of aggressive Her2/neu positive tumors.  173  Figure 4.7 Proposed working model of the ILK centered regulation of Her2/neu through multiple mechanisms involving YB-1. ILK is able to phosphorylate many downstream effectors that have the potential to regulate YB-1 transcription, translation and sub-cellular localization. Known kinases that phosphorylate YB-1 inducing its nuclear translocation include GSK-3 [84], ERK [84], RSK [30], and AKT [49, 85-87]. ILK activates AKT through phosphorylation of serine 473 [15, 16, 88, 89]. ILK inhibits GSK3β through phosphorylation on Serine 9 [88, 90]. When active, GSK-3 ubiquinates Hif1α leading to its degradation [91, 92]. However, when Hif1α is activated, which can occur through AKT/mTOR [93], it translocates to the nucleus and can bind to the HRE segment on the TWIST promoter leading to an increase in TWIST protein [60-63]. Thus ILK can regulate the expression of TWIST by phosphorylating AKT leading to activation of Hif1α. Alternatively, ILK can also phosphorylate STAT-3 on serine 705 [94, 95]. Activated STAT-3 translocates to the nucleus and induces the expression of TWIST [3537]. TWIST binds to E-box regions in the promoter sequence of YB-1 initiating its transcription [32-34]. YB-1 nuclear localization is associated with increased expression of Her2/neu [50-52]. When ILK is inhibited several of these pathways could potentially lead to decreased transcription of YB-1 and cytosolic sequestration in stress granules. When YB-1 is depleted in the nucleus, transcription of Her2/neu is decreased [50-52]. In the cytoplasm, YB-1 may bind to YB-1 and Her2/neu /neu mRNA inhibiting their translation [96-98].  174  Figure 4.7 Proposed working model of the ILK centered regulation of Her2/neu through multiple mechanisms involving YB-1. 1  175  4.5 References 1. 2.  3. 4.  5. 6.  7.  8.  9.  10.  11.  12.  13.  14.  15. 16.  Takanami, I., Increased expression of integrin-linked kinase is associated with shorter survival in non-small cell lung cancer. BMC Cancer, 2005. 5: p. 1. Obara, S., et al., Integrin-linked kinase (ILK) regulation of the cell viability in PTEN mutant glioblastoma and in vitro inhibition by the specific COX-2 inhibitor NS-398. Cancer Lett, 2004. 208(1): p. 115-22. Graff, J.R., et al., Integrin-linked kinase expression increases with prostate tumor grade. Clin Cancer Res, 2001. 7(7): p. 1987-91. Sawai, H., et al., Integrin-linked kinase activity is associated with interleukin-1 alpha-induced progressive behavior of pancreatic cancer and poor patient survival. Oncogene, 2006. 25(23): p. 3237-46. Bravou, V., et al., Integrin-linked kinase (ILK) expression in human colon cancer. Br J Cancer, 2003. 89(12): p. 2340-1. Bravou, V., et al., ILK over-expression in human colon cancer progression correlates with activation of beta-catenin, down-regulation of E-cadherin and activation of the Akt-FKHR pathway. J Pathol, 2006. 208(1): p. 91-9. Ito, R., et al., Expression of integrin-linked kinase is closely correlated with invasion and metastasis of gastric carcinoma. Virchows Arch, 2003. 442(2): p. 118-23. Ahmed, N., et al., Integrin-linked kinase expression increases with ovarian tumour grade and is sustained by peritoneal tumour fluid. J Pathol, 2003. 201(2): p. 229-37. Dai, D.L., et al., Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 2003. 9(12): p. 4409-14. Li, Y., et al., PINCH-1 promotes tubular epithelial-to-mesenchymal transition by interacting with integrin-linked kinase. J Am Soc Nephrol, 2007. 18(9): p. 253443. Li, Y., et al., Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest, 2003. 112(4): p. 503-16. Oloumi, A., T. McPhee, and S. Dedhar, Regulation of E-cadherin expression and beta-catenin/Tcf transcriptional activity by the integrin-linked kinase. Biochim Biophys Acta, 2004. 1691(1): p. 1-15. Oloumi, A., S. Syam, and S. Dedhar, Modulation of Wnt3a-mediated nuclear beta-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene, 2006. 25(59): p. 7747-57. Duxbury, M.S., et al., RNA interference demonstrates a novel role for integrinlinked kinase as a determinant of pancreatic adenocarcinoma cell gemcitabine chemoresistance. Clin Cancer Res, 2005. 11(9): p. 3433-8. McDonald, P.C., A.B. Fielding, and S. Dedhar, Integrin-linked kinase--essential roles in physiology and cancer biology. J Cell Sci, 2008. 121(Pt 19): p. 3121-32. Persad, S., et al., Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTENmutant prostate cancer cells. Proc Natl Acad Sci U S A, 2000. 97(7): p. 3207-12.  176  17. 18. 19. 20.  21.  22.  23.  24. 25. 26.  27.  28.  29.  30.  31.  Persad, S. and S. Dedhar, The role of integrin-linked kinase (ILK) in cancer progression. Cancer Metastasis Rev, 2003. 22(4): p. 375-84. Hannigan, G.E., et al., Mapping of the gene encoding the integrin-linked kinase, ILK, to human chromosome 11p15.5-p15.4. Genomics, 1997. 42(1): p. 177-9. Kumar, A.S., et al., ILKAP regulates ILK signaling and inhibits anchorageindependent growth. Oncogene, 2004. 23(19): p. 3454-61. Radeva, G., et al., Overexpression of the integrin-linked kinase promotes anchorage-independent cell cycle progression. J Biol Chem, 1997. 272(21): p. 13937-44. White, D.E., et al., Mammary epithelial-specific expression of the integrin-linked kinase (ILK) results in the induction of mammary gland hyperplasias and tumors in transgenic mice. Oncogene, 2001. 20(48): p. 7064-72. Edwards, L.A., et al., Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment by inhibition of integrin-linked kinase (ILK). Mol Cancer Ther, 2008. 7(1): p. 59-70. Kalra, J., et al., QLT0267, a small molecule inhibitor targeting integrin-linked kinase (ILK), and docetaxel can combine to produce synergistic interactions linked to enhanced cytotoxicity, reductions in P-AKT levels, altered F-actin architecture and improved treatment outcomes in an orthotopic breast cancer model. Breast Cancer Res, 2009. 11(3): p. R25. Leonessa, F., et al., MDA435/LCC6 and MDA435/LCC6MDR1: ascites models of human breast cancer. Br J Cancer, 1996. 73(2): p. 154-61. Chambers, A.F., MDA-MB-435 and M14 cell lines: identical but not M14 melanoma? Cancer Res, 2009. 69(13): p. 5292-3. Dragowska, W.H., et al., HER-2/neu overexpression increases the viable hypoxic cell population within solid tumors without causing changes in tumor vascularization. Mol Cancer Res, 2004. 2(11): p. 606-19. Warburton, C., et al., Treatment of HER-2/neu overexpressing breast cancer xenograft models with trastuzumab (Herceptin) and gefitinib (ZD1839): drug combination effects on tumor growth, HER-2/neu and epidermal growth factor receptor expression, and viable hypoxic cell fraction. Clin Cancer Res, 2004. 10(7): p. 2512-24. Verreault, M. and M.B. Bally, siRNA-mediated integrin-linked kinase suppression: nonspecific effects of siRNA/cationic liposome complexes trigger changes in the expression of phosphorylated-AKT and mTOR independently of ILK silencing. Oligonucleotides, 2009. 19(2): p. 129-40. Troussard, A.A., et al., Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res, 2006. 66(1): p. 393-403. Stratford, A.L., et al., Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res, 2008. 10(6): p. R99. Stratford, A.L., et al., Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with Iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res, 2007. 9(5): p. R61.  177  32. 33. 34.  35. 36.  37.  38.  39.  40.  41. 42. 43.  44. 45. 46.  47. 48.  Shiota, M., et al., Twist and p53 reciprocally regulate target genes via direct interaction. Oncogene, 2008. Shiota, M., et al., Twist promotes tumor cell growth through YB-1 expression. Cancer Res, 2008. 68(1): p. 98-105. Shiota, M., et al., Programmed cell death protein 4 down-regulates Y-box binding protein-1 expression via a direct interaction with Twist1 to suppress cancer cell growth. Cancer Res, 2009. 69(7): p. 3148-56. Cheng, G.Z., et al., Twist is transcriptionally induced by activation of STAT3 and mediates STAT3 oncogenic function. J Biol Chem, 2008. 283(21): p. 14665-73. Ling, X. and R.B. Arlinghaus, Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice. Cancer Res, 2005. 65(7): p. 2532-6. Lo, H.W., et al., Epidermal growth factor receptor cooperates with signal transducer and activator of transcription 3 to induce epithelial-mesenchymal transition in cancer cells via up-regulation of TWIST gene expression. Cancer Res, 2007. 67(19): p. 9066-76. Takemoto, S., et al., Expression of activated signal transducer and activator of transcription-3 predicts poor prognosis in cervical squamous-cell carcinoma. Br J Cancer, 2009. 101(6): p. 967-72. Chernov, K.G., et al., Role of microtubules in stress granule assembly: microtubule dynamical instability favors the formation of micrometric stress granules in cells. J Biol Chem, 2009. 284(52): p. 36569-80. Chernov, K.G., et al., Atomic force microscopy reveals binding of mRNA to microtubules mediated by two major mRNP proteins YB-1 and PABP. FEBS Lett, 2008. 582(19): p. 2875-81. Chernov, K.G., et al., YB-1 promotes microtubule assembly in vitro through interaction with tubulin and microtubules. BMC Biochem, 2008. 9: p. 23. Kedersha, N. and P. Anderson, Mammalian stress granules and processing bodies. Methods Enzymol, 2007. 431: p. 61-81. Evdokimova, V., L.P. Ovchinnikov, and P.H. Sorensen, Y-box binding protein 1: providing a new angle on translational regulation. Cell Cycle, 2006. 5(11): p. 1143-7. Evdokimova, V., et al., Akt-mediated YB-1 phosphorylation activates translation of silent mRNA species. Mol Cell Biol, 2006. 26(1): p. 277-92. Kohno, K., et al., The pleiotropic functions of the Y-box-binding protein, YB-1. Bioessays, 2003. 25(7): p. 691-8. Bergmann, S., et al., YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res, 2005. 65(10): p. 4078-87. Berquin, I.M., et al., Y-box-binding protein 1 confers EGF independence to human mammary epithelial cells. Oncogene, 2005. 24(19): p. 3177-86. Basaki, Y., et al., Akt-dependent nuclear localization of Y-box-binding protein 1 in acquisition of malignant characteristics by human ovarian cancer cells. Oncogene, 2007. 26(19): p. 2736-46.  178  49.  50.  51.  52.  53.  54.  55. 56. 57. 58.  59. 60. 61. 62. 63. 64.  65. 66.  Sutherland, B.W., et al., Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene, 2005. 24(26): p. 4281-92. Fujii, T., et al., Expression of HER2 and estrogen receptor alpha depends upon nuclear localization of Y-box binding protein-1 in human breast cancers. Cancer Res, 2008. 68(5): p. 1504-12. Kashihara, M., et al., Nuclear Y-box binding protein-1, a predictive marker of prognosis, is correlated with expression of HER2/ErbB2 and HER3/ErbB3 in nonsmall cell lung cancer. J Thorac Oncol, 2009. 4(9): p. 1066-74. Wu, J., et al., Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res, 2006. 66(9): p. 4872-9. Ozer, J., et al., Isolation and characterization of a cDNA clone for the CCAAT transcription factor EFIA reveals a novel structural motif. J Biol Chem, 1990. 265(36): p. 22143-52. Anderson, P. and N. Kedersha, RNA granules: post-transcriptional and epigenetic modulators of gene expression. Nat Rev Mol Cell Biol, 2009. 10(6): p. 430-6. Anderson, P. and N. Kedersha, Stress granules. Curr Biol, 2009. 19(10): p. R397-8. Balagopal, V. and R. Parker, Polysomes, P bodies and stress granules: states and fates of eukaryotic mRNAs. Curr Opin Cell Biol, 2009. 21(3): p. 403-8. Yamasaki, S. and P. Anderson, Reprogramming mRNA translation during stress. Curr Opin Cell Biol, 2008. 20(2): p. 222-6. Martin, T.A., et al., Expression of the transcription factors snail, slug, and twist and their clinical significance in human breast cancer. Ann Surg Oncol, 2005. 12(6): p. 488-96. Watanabe, O., et al., Expression of twist and wnt in human breast cancer. Anticancer Res, 2004. 24(6): p. 3851-6. Gort, E.H., et al., The TWIST1 oncogene is a direct target of hypoxia-inducible factor-2alpha. Oncogene, 2008. 27(11): p. 1501-10. Peinado, H. and A. Cano, A hypoxic twist in metastasis. Nat Cell Biol, 2008. 10(3): p. 253-4. Yang, M.H. and K.J. Wu, TWIST activation by hypoxia inducible factor-1 (HIF-1): implications in metastasis and development. Cell Cycle, 2008. 7(14): p. 2090-6. Yang, M.H., et al., Direct regulation of TWIST by HIF-1alpha promotes metastasis. Nat Cell Biol, 2008. 10(3): p. 295-305. Ansieau, S., et al., Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell, 2008. 14(1): p. 79-89. Cates, J.M., et al., Epithelial-mesenchymal transition markers in pancreatic ductal adenocarcinoma. Pancreas, 2009. 38(1): p. e1-6. Karreth, F. and D.A. Tuveson, Twist induces an epithelial-mesenchymal transition to facilitate tumor metastasis. Cancer Biol Ther, 2004. 3(11): p. 1058-9.  179  67.  68.  69.  70. 71.  72. 73.  74.  75. 76.  77.  78. 79.  80.  81. 82. 83.  Mironchik, Y., et al., Twist overexpression induces in vivo angiogenesis and correlates with chromosomal instability in breast cancer. Cancer Res, 2005. 65(23): p. 10801-9. Niu, R.F., et al., Up-regulation of Twist induces angiogenesis and correlates with metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res, 2007. 26(3): p. 385-94. Cheng, G.Z., W. Zhang, and L.H. Wang, Regulation of cancer cell survival, migration, and invasion by Twist: AKT2 comes to interplay. Cancer Res, 2008. 68(4): p. 957-60. Elias, M.C., et al., TWIST is expressed in human gliomas and promotes invasion. Neoplasia, 2005. 7(9): p. 824-37. Luo, G.Q., et al., Effect and mechanism of the Twist gene on invasion and metastasis of gastric carcinoma cells. World J Gastroenterol, 2008. 14(16): p. 2487-93. Matsuo, N., et al., Twist expression promotes migration and invasion in hepatocellular carcinoma. BMC Cancer, 2009. 9: p. 240. Valdes-Mora, F., et al., TWIST1 overexpression is associated with nodal invasion and male sex in primary colorectal cancer. Ann Surg Oncol, 2009. 16(1): p. 7887. Dupont, J., et al., Insulin-like growth factor 1 (IGF-1)-induced twist expression is involved in the anti-apoptotic effects of the IGF-1 receptor. J Biol Chem, 2001. 276(28): p. 26699-707. Maestro, R., et al., Twist is a potential oncogene that inhibits apoptosis. Genes Dev, 1999. 13(17): p. 2207-17. Zhang, X., et al., Anti-apoptotic role of TWIST and its association with Akt pathway in mediating taxol resistance in nasopharyngeal carcinoma cells. Int J Cancer, 2007. 120(9): p. 1891-8. Kajiyama, H., et al., Chemoresistance to paclitaxel induces epithelialmesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int J Oncol, 2007. 31(2): p. 277-83. Pham, C.G., et al., Upregulation of Twist-1 by NF-kappaB blocks cytotoxicity induced by chemotherapeutic drugs. Mol Cell Biol, 2007. 27(11): p. 3920-35. Zhuo, W.L., et al., Short interfering RNA directed against TWIST, a novel zinc finger transcription factor, increases A549 cell sensitivity to cisplatin via MAPK/mitochondrial pathway. Biochem Biophys Res Commun, 2008. 369(4): p. 1098-102. Hasselblatt, M., et al., TWIST-1 is overexpressed in neoplastic choroid plexus epithelial cells and promotes proliferation and invasion. Cancer Res, 2009. 69(6): p. 2219-23. Hu, L., et al., Twist is required for thrombin-induced tumor angiogenesis and growth. Cancer Res, 2008. 68(11): p. 4296-302. Kwok, W.K., et al., Up-regulation of TWIST in prostate cancer and its implication as a therapeutic target. Cancer Res, 2005. 65(12): p. 5153-62. Puisieux, A., S. Valsesia-Wittmann, and S. Ansieau, A twist for survival and cancer progression. Br J Cancer, 2006. 94(1): p. 13-7.  180  84.  85. 86.  87.  88.  89. 90.  91.  92.  93.  94.  95.  96.  97.  Coles, L.S., et al., Phosphorylation of cold shock domain/Y-box proteins by ERK2 and GSK3beta and repression of the human VEGF promoter. FEBS Lett, 2005. 579(24): p. 5372-8. Bader, A.G. and P.K. Vogt, Phosphorylation by Akt disables the anti-oncogenic activity of YB-1. Oncogene, 2008. 27(8): p. 1179-82. Oda, Y., et al., Prognostic implications of the nuclear localization of Y-boxbinding protein-1 and CXCR4 expression in ovarian cancer: their correlation with activated Akt, LRP/MVP and P-glycoprotein expression. Cancer Sci, 2007. 98(7): p. 1020-6. To, K., et al., The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-ace tamide (OSU03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol, 2007. 72(3): p. 641-52. Delcommenne, M., et al., Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A, 1998. 95(19): p. 11211-6. McDonald, P.C., et al., Rictor and integrin-linked kinase interact and regulate Akt phosphorylation and cancer cell survival. Cancer Res, 2008. 68(6): p. 1618-24. Troussard, A.A., et al., Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3dependent manner. Mol Cell Biol, 1999. 19(11): p. 7420-7. Flugel, D., et al., Glycogen synthase kinase 3 phosphorylates hypoxia-inducible factor 1alpha and mediates its destabilization in a VHL-independent manner. Mol Cell Biol, 2007. 27(9): p. 3253-65. Mottet, D., et al., Regulation of hypoxia-inducible factor-1alpha protein level during hypoxic conditions by the phosphatidylinositol 3-kinase/Akt/glycogen synthase kinase 3beta pathway in HepG2 cells. J Biol Chem, 2003. 278(33): p. 31277-85. Pore, N., et al., Akt1 activation can augment hypoxia-inducible factor-1alpha expression by increasing protein translation through a mammalian target of rapamycin-independent pathway. Mol Cancer Res, 2006. 4(7): p. 471-9. Fuchs, B.C., et al., Epithelial-to-mesenchymal transition and integrin-linked kinase mediate sensitivity to epidermal growth factor receptor inhibition in human hepatoma cells. Cancer Res, 2008. 68(7): p. 2391-9. Yau, C.Y., et al., Inhibition of integrin-linked kinase by a selective small molecule inhibitor, QLT0254, inhibits the PI3K/PKB/mTOR, Stat3, and FKHR pathways and tumor growth, and enhances gemcitabine-induced apoptosis in human orthotopic primary pancreatic cancer xenografts. Cancer Res, 2005. 65(4): p. 1497-504. Skabkina, O.V., et al., YB-1 autoregulates translation of its own mRNA at or prior to the step of 40S ribosomal subunit joining. Mol Cell Biol, 2005. 25(8): p. 331723. Skabkina, O.V., et al., P50/YB-1, a major protein of cytoplasmic mRNPs, regulates its own synthesis. Dokl Biochem Biophys, 2004. 395: p. 93-5.  181  98.  Skabkina, O.V., et al., Poly(A)-binding protein positively affects YB-1 mRNA translation through specific interaction with YB-1 mRNA. J Biol Chem, 2003. 278(20): p. 18191-8.  182  CHAPTER 5 5.1 Summarizing Discussion The treatment of particularly aggressive forms of breast cancer remains elusive as 23.6% of Canadian women with breast cancer still succumb to this disease [1]. This doctoral thesis explored the function of Integrin Linked Kinase (ILK) in breast cancer and examined the use of a small molecule ILK inhibitor, QLT0267, in attenuating some of the more aggressive phenotypes of breast cancer such as those which are Her2/neu positive. This effort addressed the possibility of using QLT0267 to sensitize tumours to chemotherapies, in particular Dt, that are currently being used in the clinic to treat women with breast cancer. The first aim was to assess the effects of ILK inhibition using the highly selective, small molecule ILK inhibitor QLT0267, on the growth and survival of seven breast cancer cell models in vitro. A preliminary study was undertaken to identify a model cell line that would be the optimal platform in which to study the effects of QLT0267 in combination. After assessing the response of four Her2/neu positive and three Her2/neu negative human breast tumour cell lines to QLT0267, the MDA MB 435/LCC6 (LCC6) cell line, a more aggressive variant of MDA MB 435 cells was chosen for two reasons: 1) the cells grow well in vivo as solid subcutaneous tumours, as orthotopic tumours and as systemic tumours and 2) a stably transfected Her2/neu cell line (LCC6Her2) has been developed and characterized. The latter is important because, in breast carcinoma, over-expression of the receptor tyrosine kinase Her2/neu is associated with younger patient age, earlier disease recurrence, lymph node involvement, increased level of metastases, resistance to endocrine therapy and poor survival [2, 3]. Thus, it was  important to use a single cell model that could compare therapeutic effects of the ILK inhibitor on both Her2/neu positive and negative tumours. The second part of this aim was to determine using cell-based screening assays, the nature of drug interactions that arise when combining QLT0267 with selected anticancer drugs with proven or potential therapeutic activity in the treatment of breast cancer. Drug interactions were categorized mathematically as synergistic, additive or antagonistic, using Calcusyn Software that relies on the Median Effect Principles developed by Chou and Talalay [4-6]. Using LCC6 and LCC6Her2, a number of existing therapeutics were screened for their potential use with QLT0267. These drugs included cisplatin, doxorubicin paclitaxel, vinorelbine, a small molecule inhibitor for the EGF receptor tyrosine kinase - PD 153035, imatinib mesylate, docetaxel and trastuzumab. Three combinations were shown to exhibit synergistic interactions as judged by a single assay endpoint measuring metabolic activity: QLT0267/Docetaxel (Dt), QLT0267/PD 153035 and QLT0267/Imatinib Mesylate. The remaining studies focus on QLT0267 and Dt; a decision made in part because of the clinical potential of developing this combination and the established utility of Dt in the treatment of breast cancer patients even when used as a single agent [7-10]. Traditionally, Dt is considered to be a microtubule stabilizer, however, it has been demonstrated that Dt may exert effects beyond targeting tubulin [11, 12]. In some reports treatment with Dt has been associated with dramatic disruption of F-actin cytoarchitecture [13], increased apoptosis and changes in apoptotic marker expression [14]. The survival promoting activities of ILK have already been discussed (see section 1.5.2-1.5.6, and ILK inhibition is known to induce apoptosis. I showed that the effects of  184  ILK on actin polymerization are dramatic. Furthermore, Fielding et al has shown in a recent publication that ILK interacts with the centrosome and regulates mitotic spindle organization [15-18]. Taken together these data with Dt and ILK supports complimentary mechanisms of action for QLT0267 and Dt. The series of studies described in Chapter two compare the effects of single agent therapy to combination therapy using QLT0267/Dt across multiple endpoints. In this study there were three goals: i) to illustrate that the agents do not interfere with the known effects of the other agent; ii) to analyze synergy across endpoints other then cytotoxicity; and iii) to uncover clues for mechanisms that may explain why QLT0267/Dt combinations are synergistic. The evaluation of P-AKT (serine 473) and VEGF was done to determine whether Dt would interfere with ILK inhibition via QLT0267, and the evaluation of F-actin was done to determine whether ILK inhibition would interfere with the effects of Dt on cytoarchitecture. Finally, the combination QLT0267/Dt was also examined in vivo. Single agent and combination QLT0267/Dt was used to treat an orthotopic model of LCC6WT in NCr nude mice. Survival and tumour growth data indicate that the combination of QLT0267 and Dt is significantly more effective than either single agent [19]. Potentially QLT0267 and Dt act on several overlapping intracellular signalling pathways, such as the PI3/AKT pathway, that can provide a basis for understanding why these two agents work well together in vitro. Some preliminary studies were undertaken to delineate the mechanism(s) leading to synergistic interactions between QLT0267 and Dt. Immunofluorescent imaging of cytoarchitecture, cell cycle analysis and apoptosis assays were performed to determine whether the combination of  185  QLT0267/Dt was synergistic in eliciting cytoskeletal alterations, cell cycle blockade or inducing apoptosis. Preliminary studies showed that significant disruption of F-Actin cytoarchitecture and nuclear morphology is seen in cells treated with QLT0267/Dt as compared to cells treated with single agents (see Figure 2.7). Furthermore, Dt was able to enhance the G2M cell cycle block exhibited in cells treated with QLT0267 (Figure 5.1A). Finally cells treated with the combination of QLT0267/Dt show enhanced annexin V staining (Figure 5.1B) and caspase 3 activation (Figure 5.1C), indicating that addition of Dt has potentiating effects on the induction of apoptosis by QLT0267. Future studies will attempt to elucidate the mechanisms that contribute to: i) cytoarchitecture and nuclear disruption with a major focus on tubulin and actin dynamics and molecules such as Rho, Rac and Cdc42, and ii) expression and activity of proapoptotic and antiapoptotic markers such as BAD, BCL-2 and BCL-xl. Gene silencing using siRNA against anti-apoptotic proteins in combination with QLT0267 or Dt may help to define mechanisms leading to synergy.  When using preclinical models to assess the therapeutic effects of drugs developed for breast cancer, it is important to identify models that may better predict for outcomes in breast cancer patients. This thesis research includes studies assessing drug efficacy in models that represent different levels of sensitivity to Dt, a standard agent used to treat patients. The goal was to address this idea in the context of the QLT0267/Dt combination and to this end a cell line that could be used to establish localized disease (orthotopic (o.t.) or intraperitonel (i.p.) injection) or disseminated disease (intracardiac (i.c.) injection) was characterized. The goal of these studies were:  186  Figure 5.1 Inhibition of ILK in combination with treatment of breast cancer cell lines with Docetaxel exhibit potentiation in inducing a cell cycle block and apoptosis. LCC6 cells were treated with Docetaxel and QLT0267 alone or in combination and subjected to cell cycle analysis using flow cytometry and propidium iodide staining at a 12 hour time point (A), Annexin V binding at a 12 hour time point (B) and ELISA to assess Caspase-3 activation at time points listed (C). Dt was able to enhance the G2M cell cycle block exhibited in cells treated with QLT0267. Cells treated with the combination of QLT0267/Dt show enhanced Annexin V staining and caspase-3 activation.  Figure 5.1 Inhibition of ILK in combination with treatment of breast cancer cell lines with Docetaxel exhibit potentiation in inducing a cell cycle block and apoptosis. 1  187  i) To develop and characterize LCC6 and LCC6Her2 breast cancer cells that were transfected with the luciferase gene; ii) To explore the use of in vivo bioluminescent imaging (BLI) to visualize and monitor tumour progression; iii) To determine whether the site of tumour cell inoculation and the associated site(s) of disease progression influence Dt efficacy; and iv) To determine if the most Dt treatment refractory models could be sensitized to Dt by combining its use with the ILK inhibitor QLT0267.  One of the most important features of this study was the comparison of how a single cell line grown in different microenvironment would influence tumour growth and drug accumulation. It is becoming increasingly clear that the microenvironment plays a profound role in tumour growth and metastasis. The in vivo microenvironment influences nutrient and drug delivery, immune response, wound healing, cell migration and invasion [20]. Each microenvironment is biochemically unique in part due to the diversity in cell populations found within tissues. In some tumour environments, cancer associated fibroblasts found in the stroma play a role in the development and progression of disease [21-23]. Additionally, proteins found in the ECM can direct signalling pathways and contribute to the tumour cells propensity towards migration and invasion [24-27]. Weaver et. al. showed that when physical interactions between mammary epithelial cells and ECM are inhibited their growth and differentiation can be attenuated while using the same inhibition in non-malignant cells could lead to transformation [28]. Ingber et al suggest that changes in ECM and tissue structure appear to have the potential to be as carcinogenic as oncogenic chemicals, viruses, radiation and gene mutations [29, 30]. Furthermore, it is becoming apparent that cancer microenvironments influence neovascularization and metastasis [31].  188  In the studies described in Chapter 3, luciferase positive human breast cancer cell lines (LCC6, LCC6Her2) were generated and characterized. Female NCr nude mice were inoculated with cells using different injection routes and tumour development was monitored using BLI. These in vivo studies indicated that tumour progression was most rapid when cells were inoculated i.c., which resulted in metastatic disease development involving organs such as the brain, ovaries, adrenal glands and lungs. Distribution of Dt to sites of tumour growth and Dt pharmacokinetics were determined in tumour bearing animals (Figure 3.3). Dt pharmacokinetics were comparable regardless of the model used, however when considering sites of tumour growth Dt levels were much lower in sites of disease development commonly occurring when the cells were injected i.c.. Interestingly, and in concordance with previous studies done in patients with ascites using doxorubicin [32], and adriamycin [33], high concentrations of Dt begin to accumulate in the peritoneum of ascites mice early and this concentration is maintained in the peritoneal cavity over a period of 24 hours. The fact that mice bearing ascites tumours seem to be least responsive to 5 mg/kg Dt, but have access to high concentrations of drug was surprising. However as noted by Gotleib, Warburg et. Al (1953), established ascites tumour cells grow under highly crowded, virtually anoxic conditions [32]. Furthermore, hypoxic cells undergo phenotypic changes that enable metastasis and drug resistance [34]. Many papers support the hypothesis that hypoxia is related to drug sensitivity claiming some drugs are more sensitive, others less so [35]. It is not clear what the effects of drug accumulation in the peritoneum are. That is, the peritoneum may act as a short term reservoir that may have a positive effect by slowly allowing for resorption of agent into the bloodstream, on the other hand, accumulation of  189  large concentrations of drug in the peritoneal cavity may also trigger toxicity. Regardless,  studies  of  intraperitoneal  chemotherapy  suggested  that  the  macromolecular agents are cleared more slowly from the peritoneal compartment and remain there at high concentration while the blood concentration remains low [32, 36]. Similar to our findings with docetaxel, doxorubicin [32] is not cleared from the peritoneal fluid after 24 hours. This study suggests that efficacy of chemotherapeutic agents in the peritoneal compartment has as much to do with ratio of drug to tumour burden. Using this line of thinking I show increasing the concentration of Dt delivered to mice with ascites vastly improves survival and development of disease (Figure 3.5).  Consistent with the Dt delivery data, metastatic disease proved to be most resistant to treatment using Dt. A key objective of this research was to determine whether QLT0267 could be used in combination with Dt to achieve improved treatment outcomes in the most aggressive model. Results summarized in Chapter 2 already established that QLT0267/Dt combinations were more effective than single agents when used in the orthotopic model, but according to the data summarized in Chapter 3 the most Dt sensitive model was the orthotopic model. Using the disseminated model, disease progression was followed using BLI in animals treated with Dt alone or in combination with the small molecule ILK inhibitor QLT0267. Disappointingly, treatment of mice inoculated i.c. with LCC6 cells with a combination of Dt and the ILK inhibitor QLT0267 resulted in no added benefit above treatment with Dt alone. However, these data exemplify the importance of using multiple preclinical models to assess the efficacy of drugs and drug combinations. This study has two important implications: i) it is likely that an ILK inhibitor will be most effective in a disease setting where the breast cancer  190  has not already metastized; and if the later is correct then ii) ILK inhibitors would have the greatest impact if used to treat regionally localized disease. This observation should help guide the clinical development of ILK inhibitors and suggests that after safety studies are complete (Phase I clinical trial) that efficacy studies should be completed in the context of an adjuvant setting. The results in Chapter 4 would suggest that this may be particularly important for treatment of Her2/neu positive patients that are at higher risk for metastasis and aggressive disease development. A novel finding in this research concerned the significant differences between cells that express Her2/neu and those which are Her2/neu negative when treated with QLT0267. QLT0267 was more effective at decreasing metabolic activity and VEGF secretion in LCC6Her2 cells. Dt potentiated the inhibition of P-AKT (serine 473) by QLT0267 in LCC6 cells but antagonizes it in LCC6Her2 cells. These data made it reasonable to ask whether QLT0267 or Dt influenced Her2/neu expression. The studies demonstrated for the first time that Her2/neu positive cells treated with QLT0267 exhibited a dose-dependent decrease in Her2/neu protein expression. At first it was not clear whether this is a direct result of ILK mediated signalling or an indirect result associated with off-target effects of the QLT0267 kinase inhibitor. ILK silencing studies using ILK-targeted siRNA showed that ablation of ILK expression in Her2/neu positive cells also triggered a down-regulation of Her2/neu protein. The results summarized in Chapter 4 now suggest that ILK, through phosphorylation of STAT-3, up-regulates TWIST. TWIST promotes the transcription of YB-1, and YB-1 promotes the transcription and translation of Her2/neu. This proposed pathway explains how inhibition of ILK engenders decreases in Her2/neu expression. There is very little published on the  191  relationship between ILK and TWIST; one paper published in 2009 showed that in human gastric cancer cell lines, silencing of TWIST using siRNA resulted in an increase in ILK transcript [37]. Interestingly, over-expression of TWIST has many overlapping phenotypes with the over-expression of ILK, such as, increased EMT, invasion and survival [38-45].  One particular signalling pathway that stands out is the Snail/E-  cadherin axis leading to EMT. Repression of E-cadherin expression by the transcription factor, Snail, is implicated in EMT and cancer progression. ILK regulates Snail, perhaps through Poly(ADP-ribose) polymerase-1, (PARP-1), which in turn can repress Ecadherin expression [46-48]. Furthermore ILK has been shown to correlate with expression of Snail in ductal pancreatic adenocarcinoma [49]. A parallel relationship between TWIST and EMT seems to exist. In esophageal carcinoma [50] ovarian carcinoma, parathyroid carcinomas [38], bladder cancer [51] and lung fibrosis [45] high TWIST expression was correlated with reduced E-cadherin expression. More importantly, Kwok et al showed that silencing of TWIST can not only suppress migration and invasion of prostate cancer cell lines, but was also correlated with an induction of Ecadherin expression and morphologic and molecular changes associated with mesenchymal to epithelial transition [52]. Future studies should further explore the relationship between ILK and TWIST in this context. As a follow-up to the studies evaluating Her2/neu signalling, EGFR expression was analyzed after treatment with QLT0267. EGFR is also regulated by YB-1 [53-55] so it was anticipated that ILK inhibition would also reduce EGFR expression. ILK inhibition was able to reduce EGFR expression by 87% (Figure 5.2A). These studies have interesting implications, particularly with the use of ILK inhibition or silencing in  192  Figure 5.2 ILK inhibition suppresses the expression of EGFR, and behaves synergistically with the EGFR inhibitor Lapatinib at low FA. Total EGFR expression in SKBR3 cells treated with QLT0267 was determined using western blot analysis. (A) Cells were treated for 24 hours with 42 µM QLT0267. Subsequently, cells were lysed, protein were isolated and 50 µg whole cell lysates were separated on a 10% SDSPAGE gels as described in the Methods on page 71. Membranes were probed for EGFR and β-actin. Total EGFR is decreased by 82%. Furthermore, SKBR3 cells treated with QLT0267 and Lapatinib combined at a fixed ratio and added at various concentrations exhibit a shift to the left in dose response curves indicating synergistic effects based on a measured cell viability endpoint (see page 70 for methods) (B). CI values determined by Calcusyn from dose response curves indicate that at low effect levels QLT0267 and Lapatinib behave synergistically (CI < 1), but at high effect levels the interaction in antagonistic (CI > 1) (C) (See page 69 for methods). (n=3)  193  combination with EGFR and Her2/neu inhibitors. It could be predicted that ILK inhibition would engender decreases in EGFR and Her2/neu expression and reduction in these target proteins would, in turn, be reflected by reduced effects of EGFR or Her2/neu inhibitors. To test this idea, preliminary studies were initiated to study combinations of QLT0267 with Lapatinib, a dual kinase small molecule inhibitor targeting Her2/neu and EGFR. These results have been summarized in Figure 5.2B, and suggest that at low effect levels (low Fraction Affected (FA)) the interactions between QLT0267 and Lapatinib are synergistic, but at the desirable high effect levels (Fa > 0.75) the QLT0267/lapatinib interactions are strongly antagonistic. One of the most intriguing observations from Chapter 2 and Chapter 4 was that the relationship between ILK and the phosphorylation of AKT was complex. In vitro studies using the ILK inhibitor and ILK siRNA suggest that downstream effects on PAKT (ser473) are both dose and time dependent in vitro. It was important to also demonstrated this effect of ILK inhibition on P-AKT in vivo. However problems in assessing P-AKT (ser473) in vivo and the transient nature of P-AKT suppression created challenges. These studies were not included in the thesis, however, they are useful to consider in the context of this discussion. In order to understand how ILK works in vivo, the molecular effects of treating LCC6 orthotopic breast tumours with QLT0267 were analyzed at early time-points. Animals were inoculated in the mammary fat pads with tumour cells which were allowed to develop into tumours over a period of seven days, treatment began on day eight and continued everyday for 7 days. When following tumour progression alone (i.e. measurements of tumour size using BLI and caliper measurements), ILK inhibition slowed cancer growth  194  Figure 5.3 Bioluminescent imaging shows that over short time-points QLT0267 is associated with decreases in tumour growth. Bioluminescent imaging of orthotopic LCC6 tumours (see Methods on page 73) are shown 4, 24, 78, 126 and 168 hours treatment initiation which occurred on day 7 post inoculation of tumour cells. The treatment groups included vehicle controls and QLT0267 Total light emission from tumours in animals was visualized and quantified. Over 168 hours animals treated with QLT0267 showed lower total light flux than vehicle control (A). In this study animals (n=4 per time point) were terminated by CO2 asphyxiation at 2, 4, 6 and 24 hours after the first treatment, at 6 hours after subsequent treatments on days 1, 3, and 7 and finally 24 hours after the last treatment on day 8 and blood was collected by cardiac puncture and placed into an EDTA-containing micro-container placed on ice (see Methods). Subsequently plasma was separated from blood cells and the amount of QLT0267 in plasma was determined by an undisclosed LC-MS methodology by QLT Inc. The majority of QLT0267 was eliminated from the blood compartment within 6 hours (B). Interestingly, QLT0267 pharmacokinetics changed in animals previously treated with QLT0267, where subsequent treatments were eliminated at a significantly faster rate (C).  195  Figure 5.2 ILK inhibition suppresses the expression of EGFR, and behaves synergistically with the EGFR inhibitor Lapatinib at low FA. 1  Figure 5.3 Bioluminescent imaging shows that over short time-points QLT0267 is associated with decreases in tumour growth. 1  196  as early as 8 days after treatment was initiated (Figure 5.3). In this study mice were terminated at 2, 4, 6 and 24 hours after the first treatment as well as at 6 hours after subsequent treatments on days 1, 3, and 7 and finally 24 hours after the last treatment on day 8. Blood was collect into EDTA containing tubes for isolation of plasma and tumours were harvested, embedded in paraffin, sectioned and cored to make a large 116 sample tissue microarray (TMA) which included, control, vehicle and treated samples from each time-point. Pharmacokinetic analysis of serum levels of QLT0267 over 7 days showed that the majority of QLT0267 was eliminated from the blood compartment within 6 hours (Figure 5.3). Interestingly, QLT0267 blood levels at 6 hours were significantly lower in animals previously treated with QLT0267. This suggests that there is a time-dependent increase in the elimination rate of QLT0267 and that there is likely a rapidly upregulated metabolism of QLT0267. This will need to be characterized further if this drug is to be developed for use in humans and the changes in blood levels observed following repeat administration almost certainly impact the therapeutic potential of this drug. TMA’s were assessed for molecular changes in tumour tissues at each time-point using IHC. More specifically, analyses included staining for: i) P-AKT; ii) Ki67 (a marker for cell proliferation); as well as iii) Caspase-3 and Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) (as markers for cell death). Although tumours were clearly smaller in treated animals versus untreated animals, no significant changes  in  any of  these  markers  were  observed.  In  preliminary  studies,  immunofluorescence and western blots of tumour cell lysates from QLT0267 treated  197  animals bearing LCC6 and LCC6Her2 tumours suggested that QLT0267 may be influencing the activity and localization of BCl-xl and BAD. For this reason IHC analyses of BCL-xl and BAD were also done on the TMA. Staining for BAD indicated a slight decrease in expression and localization within treated cells at later time-points, while pBAD and Bcl-xl TMAs remain to be analyzed. Given the results summarized in Chapter 4, the TMA will also be stained for YB-1 and TWIST. It is critically important to gain a better understanding of how QLT0267 is suppressing growth rates in tumours when it is used in vivo. This is important for the clinical development of drugs targeting ILK and will inform clinicians about critical factors that should be measured in patients treated with these agents to determine whether they are active.  5.2 Overall Significance Observations made in this thesis provide a framework for future studies addressing the use of molecular targeting drugs in combination therapies using standard of care chemotherapeutic agents. In the second chapter, I demonstrated that the goal in developing targeted drugs such as QLT0267 needs to be the identification of synergistic drug combinations and the determination of the mechanism(s) of the synergistic interactions. In the third chapter I showed the importance of using properly designed animal studies in the assessment of possible drug combinations. In this chapter I have also shown clearly that drug comnbinations may have significantly varied efficacy depending on the site of the disease burden. As for the combination of QLT0267 and Dt, Chapters 2 and 3 revealed that the best use of ILK targeting strategies in combination with docetaxel would be in an adjuvant setting early in the treatment  course of breast cancer patients.  Finally, in chapter four, through the  198  exploration of signalling consequences of ILK inhibition, I have shown for the first time that ILK can modulate the expression of Her2/neu through a pathway involving YB-1 and TWIST, adding to our knowledge of the breadth of ILK signaling, and also providing a further rationale for the inhibition ILK in the treatment of breast cancer.  199  5.3 References  1.  2.  3. 4. 5.  6.  7. 8.  9. 10.  11. 12. 13.  14.  15. 16.  Society, C.C. Canadian Cancer Stastics 2009. 2009; Available from: http://www.cancer.ca/Canadawide/About%20cancer/Cancer%20statistics/~/media/CCS/Canada%20wide/Files %20List/English%20files%20heading/pdf%20not%20in%20publications%20secti on/Stats%202009E%20Cdn%20Cancer.ashx. Slamon, D.J., et al., Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science, 1987. 235(4785): p. 17782. Yarden, Y., Biology of HER2 and its importance in breast cancer. Oncology, 2001. 61 Suppl 2: p. 1-13. Chou, T.C., Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 70(2): p. 440-6. Chou, T.C., Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev, 2006. 58(3): p. 621-81. Chou, T.C. and P. Talalay, Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul, 1984. 22: p. 27-55. Crown, J., Docetaxel: overview of an active drug for breast cancer. Oncologist, 2001. 6 Suppl 3: p. 1-4. Crown, J., M. O'Leary, and W.S. Ooi, Docetaxel and paclitaxel in the treatment of breast cancer: a review of clinical experience. Oncologist, 2004. 9 Suppl 2: p. 2432. Saloustros, E., D. Mavroudis, and V. Georgoulias, Paclitaxel and docetaxel in the treatment of breast cancer. Expert Opin Pharmacother, 2008. 9(15): p. 2603-16. Sparano, J.A., Taxanes for breast cancer: an evidence-based review of randomized phase II and phase III trials. Clin Breast Cancer, 2000. 1(1): p. 3240; discussion 41-2. Riou, J.F., A. Naudin, and F. Lavelle, Effects of Taxotere on murine and human tumor cell lines. Biochem Biophys Res Commun, 1992. 187(1): p. 164-70. Huizing, M.T., et al., Taxanes: a new class of antitumor agents. Cancer Invest, 1995. 13(4): p. 381-404. Rosenblum, M.D. and R.R. Shivers, 'Rings' of F-actin form around the nucleus in cultured human MCF7 adenocarcinoma cells upon exposure to both taxol and taxotere. Comp Biochem Physiol C Toxicol Pharmacol, 2000. 125(1): p. 121-31. Karabulut, B., et al., Docetaxel/zoledronic acid combination triggers apoptosis synergistically through downregulating antiapoptotic Bcl-2 protein level in hormone-refractory prostate cancer cells. Cell Biol Int, 2009. 33(2): p. 239-46. Fielding, A.B. and S. Dedhar, The mitotic functions of integrin-linked kinase. Cancer Metastasis Rev, 2009. 28(1-2): p. 99-111. Fielding, A.B., I. Dobreva, and S. Dedhar, Beyond focal adhesions: integrinlinked kinase associates with tubulin and regulates mitotic spindle organization. Cell Cycle, 2008. 7(13): p. 1899-906.  200  17. 18.  19.  20. 21. 22.  23. 24. 25.  26. 27. 28.  29.  30. 31. 32. 33.  34.  Fielding, A.B., et al., Integrin-linked kinase localizes to the centrosome and regulates mitotic spindle organization. J Cell Biol, 2008. 180(4): p. 681-9. Shiota, M., et al., Programmed cell death protein 4 down-regulates Y-box binding protein-1 expression via a direct interaction with Twist1 to suppress cancer cell growth. Cancer Res, 2009. 69(7): p. 3148-56. Kalra, J., et al., QLT0267, a small molecule inhibitor targeting integrin-linked kinase (ILK), and docetaxel can combine to produce synergistic interactions linked to enhanced cytotoxicity, reductions in P-AKT levels, altered F-actin architecture and improved treatment outcomes in an orthotopic breast cancer model. Breast Cancer Res, 2009. 11(3): p. R25. Laconi, E., The evolving concept of tumor microenvironments. Bioessays, 2007. 29(8): p. 738-44. Hanna, E., J. Quick, and S.K. Libutti, The tumour microenvironment: a novel target for cancer therapy. Oral Dis, 2009. 15(1): p. 8-17. Micke, P. and A. Ostman, Tumour-stroma interaction: cancer-associated fibroblasts as novel targets in anti-cancer therapy? Lung Cancer, 2004. 45 Suppl 2: p. S163-75. Sund, M. and R. Kalluri, Tumor stroma derived biomarkers in cancer. Cancer Metastasis Rev, 2009. 28(1-2): p. 177-83. Kedrin, D., et al., Cell motility and cytoskeletal regulation in invasion and metastasis. J Mammary Gland Biol Neoplasia, 2007. 12(2-3): p. 143-52. Kopfstein, L. and G. Christofori, Metastasis: cell-autonomous mechanisms versus contributions by the tumor microenvironment. Cell Mol Life Sci, 2006. 63(4): p. 449-68. Quaranta, V., Motility cues in the tumor microenvironment. Differentiation, 2002. 70(9-10): p. 590-8. Yamaguchi, H., J. Wyckoff, and J. Condeelis, Cell migration in tumors. Curr Opin Cell Biol, 2005. 17(5): p. 559-64. Weaver, V.M., et al., Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol, 1997. 137(1): p. 231-45. Ingber, D.E., Mechanical signaling and the cellular response to extracellular matrix in angiogenesis and cardiovascular physiology. Circ Res, 2002. 91(10): p. 877-87. Ingber, D.E., Can cancer be reversed by engineering the tumor microenvironment? Semin Cancer Biol, 2008. 18(5): p. 356-64. Furuya, M., Y. Yonemitsu, and I. Aoki, III. Angiogenesis: complexity of tumor vasculature and microenvironment. Curr Pharm Des, 2009. 15(16): p. 1854-67. Gotlieb, W.H., et al., Doxorubicin levels in the serum and ascites of patients with ovarian cancer. Eur J Surg Oncol, 2007. 33(2): p. 213-5. Lazo, J.S. and P.E. Schwartz, Rapid distribution of adriamycin in the ascitic and pleural fluid of women with ovarian carcinomas. Gynecol Oncol, 1985. 21(1): p. 65-72. Kobryn, C.E. and G. Fiskum, Differential sensitivity of AS-30D rat hepatoma cells and normal hepatocytes to anoxic cell damage. Am J Physiol, 1992. 262(6 Pt 1): p. C1384-7.  201  35. 36.  37. 38.  39.  40. 41. 42.  43. 44.  45. 46.  47. 48. 49.  50.  51.  52.  Gupta, V. and J.J. Costanzi, Role of hypoxia in anticancer drug-induced cytotoxicity for Ehrlich ascites cells. Cancer Res, 1987. 47(9): p. 2407-12. Kimura, M., et al., Intracavitary administration: pharmacokinetic advantages of macromolecular anticancer agents against peritoneal and pleural carcinomatoses. Anticancer Res, 1998. 18(4A): p. 2547-50. Feng, M.Y., et al., Gene expression profiling in TWIST-depleted gastric cancer cells. Anat Rec (Hoboken), 2009. 292(2): p. 262-70. Fendrich, V., et al., Unique expression pattern of the EMT markers Snail, Twist and E-cadherin in benign and malignant parathyroid neoplasia. Eur J Endocrinol, 2009. 160(4): p. 695-703. Fondrevelle, M.E., et al., The expression of Twist has an impact on survival in human bladder cancer and is influenced by the smoking status. Urol Oncol, 2009. 27(3): p. 268-76. Kang, Y. and J. Massague, Epithelial-mesenchymal transitions: twist in development and metastasis. Cell, 2004. 118(3): p. 277-9. Karreth, F. and D.A. Tuveson, Twist induces an epithelial-mesenchymal transition to facilitate tumor metastasis. Cancer Biol Ther, 2004. 3(11): p. 1058-9. Lee, T.K., et al., Twist overexpression correlates with hepatocellular carcinoma metastasis through induction of epithelial-mesenchymal transition. Clin Cancer Res, 2006. 12(18): p. 5369-76. Matsuo, N., et al., Twist expression promotes migration and invasion in hepatocellular carcinoma. BMC Cancer, 2009. 9: p. 240. Niu, R.F., et al., Up-regulation of Twist induces angiogenesis and correlates with metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res, 2007. 26(3): p. 385-94. Pozharskaya, V., et al., Twist: a regulator of epithelial-mesenchymal transition in lung fibrosis. PLoS One, 2009. 4(10): p. e7559. Tan, C., et al., Inhibition of integrin linked kinase (ILK) suppresses beta-cateninLef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 2001. 20(1): p. 133-40. Barbera, M.J., et al., Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene, 2004. 23(44): p. 7345-54. McPhee, T.R., et al., Integrin-linked kinase regulates E-cadherin expression through PARP-1. Dev Dyn, 2008. 237(10): p. 2737-47. Schaeffer, D.F., et al., Tumor expression of Integrin-linked kinase (ILK) correlates with the expression of the E-cadherin repressor Snail: an immunohistochemical study in ductal pancreatic adenocarcinoma. Virchows Arch. Sasaki, K., et al., Significance of Twist expression and its association with Ecadherin in esophageal squamous cell carcinoma. J Exp Clin Cancer Res, 2009. 28: p. 158. Zhang, W., et al., Integrin-linked kinase regulates N-WASp-mediated actin polymerization and tension development in tracheal smooth muscle. J Biol Chem, 2007. 282(47): p. 34568-80. Kwok, W.K., et al., Up-regulation of TWIST in prostate cancer and its implication as a therapeutic target. Cancer Res, 2005. 65(12): p. 5153-62.  202  53.  54.  55.  Lee, C., et al., Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res, 2008. 68(21): p. 8661-6. To, K., et al., The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-ace tamide (OSU03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol, 2007. 72(3): p. 641-52. Wu, J., et al., Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res, 2006. 66(9): p. 4872-9.  203  APPENDICES Appendix A List of Publications Articles submitted to refereed journals: J. Kalra, M. Anantha, C. Warburton, D. Waterhouse, H. Yan, Y. Yang, D. Strut, M. Osooly, D. Masin, and M.B. Bally “Validating the use of a bioluminescent breast cancer cell line, MDA435LCC6, as a means to monitor tumor progression and to assess the therapeutic activity of an established anticancer drug, docetaxel (Dt) alone or in combination with the ILK inhibitor, QLT0267”. April 2010, Breast Cancer Research. Articles published in refereed journals: J. Kalra, B. Sutherland, A. Stratford, S. Dunn, M. B. Bally “ILK inhibition engenders suppression of Her2/neu expression through a pathway involving TWIST and YB-1” April 2010, Oncogene. J. Kalra; C. Warburton; K. Fang; L.Edwards; T. Daynard; D. Waterhouse; W.H. Dragowska; K.Gelmon; S. Dedhar, and M.B. Bally “Inhibition of the phosphatidylinositol 3-kinase/AKT pathway using small molecule inhibitors against ILK sensitizes breast cancer cells to treatment with docetaxel” Breast Cancer Research. 2009 May; (11, 3, R25) Edwards LA, Woo J, Huxham LA, Verreault M, Dragowska WH, Chiu G, Rajput A, Kyle AH, Kalra J, Yapp D, Yan H, Minchinton AI, Huntsman D, Daynard T, Waterhouse DN, Thiessen B, Dedhar S, Bally MB. “Suppression of VEGF secretion and changes in glioblastoma multiforme microenvironment.” Molecular Cancer Therapeutics. 2008 Jan;7(1):59-70. Dawn N. Waterhouse, Jessica Kalra, Maite Verrault, Euan Ramsay, Wieslawa Dragowska, Donald Yapp, Murray Webb, Gigi Chiu, Marcel B. Bally “Nanotechnology as an enabling approach to the development of fixed dose combination products for treating cancer.” Handbook of Particulate Drug, American Scientific Publihers, USA (2006) Jessica Kalra, Qing Shao, Hong Qin+, Tamsin Thomas, Moulay A. Alaoui-Jamali and Dale W. Laird “Cx26 suppresses breast tumour cell growth, migration and invasion by a gap junctional intercellular communication-independent mechanism.” Carcinogenesis 2006 Dec;27(12):2528-37. Hong Qin, Qing Shao, Tamsin Thomas, Jessica Kalra, Moulay A. Alaoui-Jamali, and Dale W. Laird “Connexin26 regulates the expression of angiogenesis-related genes in human breast tumour cells by both GJIC-dependent and -independent mechanisms.” Cell Communication and Adhesion 2003 10: 387-393  204  Other refereed contributions: J. Kalra, M. Anantha, H. Yan, Y. Yang, D. Strut, M. Oosely, D. Masin, M.B. Bally, (2009). “Non-Invasive, whole-body bioluminescent imaging as a means to assess tumor growth: Comparing the efficacy and pharmacokinetics of taxotere when used to treat mice bearing LCC6 breast cancer tumours grown as ascites, orthotopic and metastatic disease”. Beatson International Cancer Conference – Glasgow, Scotland, UK. (abstract) Jessica Kalra, Corinna Warburton, Karen Fang, Dawn Waterhouse, Wieslawa Dragowska, Shoukat Dedhar, Marcel Bally (2007). “Inhibition of the phosphatidylinositol 3-kinase/AKT pathway using small molecule inhibitors against ILK can be used to sensitize breast tumour cells to treatment with Docetaxel AACR – Los Angeles, California, USA (abstract). J. Kalra, C. Warburton, L.Edwards, T. Daynard, D. Waterhouse, W.H. Dragowska, K.Gelmon, S. Dedhar, and M.B. Bally (2006). “Use of cell-based screening assays as a tool to identify drugs to be used in combination with a novel Integrin Linked Kinase (ILK) inhibitor being developed for treatment of breast cancer” Reasons for Hope: CBCRA conference – Montreal, Qubec, Canada, (oral presentation). Jessica Kalra, Qing Shao, Hong Qin+, Tamsin Thomas, Moulay A. Alaoui-Jamali* and Dale W. Laird (2005). “Functional, non-functional and mutant Cx26 inhibits breast tumour cell migration and invasion by a gap junctional intercellular communicationindependent mechanism.” International Gap Junction Conference – Whistler, British Columbia, Canada, (abstract). Cindy Shao, Hong Qin, Jessica Kalra, Tamsin Thomas, Moulay Alaoui-Jamali and Dale W. Laird (2003). “Potential GJIC-dependent and -independent breast tumour cell growth suppression.” Beaston International Cancer Conference - Glasgow, Scotland & International Gap Junction Conference - Cambridge, U.K. (abstract) Cindy Shao, Hong Qin, Jessica Kalra, Moulay Alaoui-Jamali & Dale W. Laird (2003). “Cx26 functions as a tumour suppressor and regulates multiple genes by mechanisms that are both gap junctional intercellular communication -dependent and -independent.” American Association for Cancer Research - Washington D.C, USA, (abstract)  205  Appendix B Certificate of Ethics Approval  206  Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, BC V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093  207  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071056/manifest

Comment

Related Items