UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Interleukin-10 inhibition of tumor necrosis factor alpha production in activated macrophages requires… Golds, Gary Brandhorst 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_fall_golds_gary.pdf [ 936.91kB ]
Metadata
JSON: 24-1.0071024.json
JSON-LD: 24-1.0071024-ld.json
RDF/XML (Pretty): 24-1.0071024-rdf.xml
RDF/JSON: 24-1.0071024-rdf.json
Turtle: 24-1.0071024-turtle.txt
N-Triples: 24-1.0071024-rdf-ntriples.txt
Original Record: 24-1.0071024-source.json
Full Text
24-1.0071024-fulltext.txt
Citation
24-1.0071024.ris

Full Text

INTERLEUKIN-10 INHIBITION OF TUMOR NECROSIS FACTOR ALPHA PRODUCTION IN ACTIVATED MACROPHAGES REQUIRES SHIP1 AND BTK by Gary Brandhorst Golds B.Sc., Simon Fraser University, 2008  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) June 2010  © Gary Brandhorst Golds, 2010  Abstract Inflammation is a physiological process required for defense against pathogens and the repair of damaged tissues. However, excessive or improper inflammation can be detrimental and results in a number of diseases such as rheumatoid arthritis and inflammatory bowel disease. To prevent the negative effects of inflammation, the inflammatory response is tightly regulated by the anti-inflammatory cytokine interleukin-10 (IL-10). The main target of IL-10 are activated macrophages whose exposure to IL-10 results in the anti-inflammatory response (AIR) characterized by depressed antigen presentation and the inhibited secretion of pro-inflammatory cytokines such as tumor necrosis factor alpha (TNFα). To induce the AIR in macrophages, IL10 binds to cell surface receptors which activate the transcription factor STAT3 leading to the transcription of gene products responsible for carrying out the AIR. However, we hypothesized that IL-10 also uses a STAT3-independent mechanism to induce the AIR. Here we demonstrate that IL-10 utilizes the lipid phosphatase SHIP1 to inhibit TNFα production in activated macrophages. SHIP1 is responsible for dissociating TNFα mRNA from polysomes leading to inhibited translation of TNFα mRNA during the AIR. This effect of SHIP1 occurs early in the AIR and helps to immediately halt TNFα production. We also demonstrate that the tyrosine kinase Btk, a reported positive regulator of TNFα production in macrophages, is also utilized by IL-10 in the early AIR to inhibit TNFα production. However, Btk is not required for IL-10 to dissociate TNFα mRNA from polysomes suggesting that Btk and SHIP1 are involved in distinct IL-10 signalling pathways. Finally we show that TIA-1, a RNA binding protein that silences TNFα mRNA translation is not involved in the IL-10 AIR. These results clearly demonstrate the existence of non-STAT3 signalling pathways in the IL-10 AIR and suggest that SHIP1 and Btk activators could be used as potential therapeutics in the treatment of inflammatory disorders. ii  Table of contents  Abstract ......................................................................................................................................................... ii Table of contents .......................................................................................................................................... iii List of tables ................................................................................................................................................. vi List of figures .............................................................................................................................................. vii List of abbreviations ................................................................................................................................... viii 1 Introduction ................................................................................................................................................1 1.1 Inflammation .......................................................................................................................................1 1.1.2 Regulating inflammation ..............................................................................................................2 1.2 Interleukin-10 ......................................................................................................................................3 1.2.2 Interleukin-10 signalling ..............................................................................................................3 1.2.3 IL-10 function in macrophages.....................................................................................................4 1.2.4 IL-10 in disease ............................................................................................................................5 1.2.5 IL-10 independent STAT3 signalling ...........................................................................................6 1.3 Macrophages .......................................................................................................................................6 1.3.2 Macrophage activation .................................................................................................................7 1.4 TLR4 signalling ...................................................................................................................................8 1.5 SH2-containing inositol-5ʹ-phosphatase 1 (SHIP1) ............................................................................9 1.5.2 SHIP1 function in macrophages ...................................................................................................9 1.6 Bruton’s tyrosine kinase and Tec kinase .......................................................................................... 11 1.6.2 Role of Btk and Tec in B-cell and T-cell signalling .................................................................. 11 1.6.3 Role of Btk and Tec in macrophage function ............................................................................ 12 1.6.4 Activation of Btk and Tec ......................................................................................................... 13 1.6.5 Negative regulation of Btk and Tec ........................................................................................... 14 iii  1.7 T-cell intracellular antigen ............................................................................................................... 14 1.7.2 TIA-1 related protein ................................................................................................................. 15 1.7.3 TIA-1 and TIAR activation ....................................................................................................... 15 1.8 Translation ........................................................................................................................................ 16 1.8.2 Initiation .................................................................................................................................... 16 1.8.3 Elongation and termination ....................................................................................................... 17 1.8.4 Regulation of translation ........................................................................................................... 18 1.9 Hypothesis ........................................................................................................................................ 19 2 Materials and methods............................................................................................................................. 20 2.1 Reagents and cell lines ..................................................................................................................... 20 2.2 Cell culture ....................................................................................................................................... 20 2.3 Bacterial transformation and vector purification .............................................................................. 20 2.4 Generation of pTRIPZ-siRNA vectors ............................................................................................. 21 2.5 Lentiviral transduction...................................................................................................................... 22 2.6 Immunoblotting and analysis ........................................................................................................... 23 2.7 Sucrose gradient fractionation and RNA purification ...................................................................... 24 2.8 DNase treatment and cDNA synthesis ............................................................................................. 25 2.9 Quantitative-PCR and analysis ......................................................................................................... 25 2.10 Quantification of TNFα production in LPS and IL-10 stimulated macrophages ........................... 27 2.11 Statistical analysis .......................................................................................................................... 27 3 Results ..................................................................................................................................................... 28 3.1 Inducible knockdown of SHIP1 and STAT3.................................................................................... 28 3.2 SHIP1 is required for IL-10 to dissociate TNFα mRNA from polysomes. ...................................... 32 3.3 SHIP1 is required for early IL-10 inhibition of TNFα production in LPS activated macrophages .. 36 3.4 Inducible knockdown of Btk and TIA-1........................................................................................... 38  iv  3.5 Btk but not TIA-1 is required for IL-10 to inhibit TNFα production in LPS activated macrophages ................................................................................................................................................................ 40 3.6 Btk is not required for IL-10 to dissociate TNFα mRNA from polysomes ...................................... 44 3.7 Btk knockdown does not alter early LPS induced TNFα production in macrophages ..................... 47 4 Discussion ............................................................................................................................................... 49 4.1 The role of SHIP1 in the IL-10 AIR ................................................................................................. 49 4.2 Btk as a negative regulator of TNFα production .............................................................................. 51 4.3 Requirement of Btk in TNFα production ......................................................................................... 53 4.4 Overall IL-10 response ..................................................................................................................... 54 4.5 Future directions ............................................................................................................................... 55 4.6 Conclusion ........................................................................................................................................ 57 References .................................................................................................................................................. 58  v  List of tables Table 1 siRNA Oligonucleotides targeting SHIP1, STAT3 or Scrambled Control.................................. 29 Table 2 siRNA Oligonucleotides targeting TIA-1, TIAR, Btk or Tec. .................................................... 39  vi  List of figures Figure 1 Domain structure of Btk and SHIP1 proteins.............................................................................. 10 Figure 2 Cloning strategy for generation of drug inducible siRNA lentiviral vectors .............................. 30 Figure 3 Drug inducible knockdown of SHIP1 and STAT3 protein ......................................................... 33 Figure 4 Polysome fractionation of RNA from RAW264.7, SHIP1 siRNA and Scrambled siRNA transduced cells .......................................................................................................................................... 34 Figure 5 IL-10 responsiveness in Parental RAW264.7, SHIP1 siRNA and Scrambled siRNA transduced cells............................................................................................................................................................. 37 Figure 6 Drug inducible knockdown of Btk and TIA-1 protein. ............................................................... 42 Figure 7 Sequence alignment between TIAR siRNA and TIA-1 and TIAR mRNA................................. 43 Figure 8 IL-10 responsiveness in Btk and TIAR siRNA transduced cells. ............................................... 45 Figure 9 Polysome fractionation of RNA from Btk siRNA transduced cells. ........................................... 46 Figure 10 LPS induced TNFα production in Btk siRNA transduced cells. ............................................... 48 Figure 11 Proposed model of IL-10 signalling in macrophages................................................................ 56  vii  List of abbreviations AIR  anti-inflammatory response  ARE  AU-rich elements  BCR  B-cell receptor  BLNK  B-cell linker protein  BMDM  bone-marrow derived macrophage  Bmx  bone marrow kinase on chromosome X  BSA  bovine serum albumin  Btk  Bruton's tyrosine kinase  DEPC  diethyl pyrocarbonate  DMEM  Dulbecco's modified eagle medium  FCS  fetal calf serum  GAPDH  glyceraldehyde 3-phosphate dehydrogenase  GFP  green flourescent protein  IBD  inflammatory bowel disease  IBtk  Inhibitor of Btk  IFN  interferon  IB  inhibitor of nuclear factor-kappa B  Ik  inhibitor of nuclear factor-κB kinase  IkB  inhibitor of nuclear factor kappa B kinase  IL-10  interleukin-10  IL-10R1  interleukin-10 receptor subunit 1  IL-10R2  interleukin-10 receptor subunit 2  viii  IL-1RA  interleukin-1 receptor agonist  iNOS  inducible nitric oxide synthase  IRAK  interleukin-1 receptor-associated kinase  Itk  interleukin-2 inducible T-cell kinase  Jak  janus associated kinase  LAT  linker for activation of T cells  LBP  lipopolysaccharide binding protein  LPS  lipopolysaccharide  Mal  myeloid differentiation primary-response protein 88 adaptor like protein  MAPK  mitogen-activated protein kinase  M-CSF  macrophage colony stimulating factor  MHC II  major histocompatability complex II  miR  microRNA-like  miR-155  microRNA-155  miRNA  microRNA  Myd88  myeloid differentiation primary-response protein 88  NF-B  nuclear-factor kappa B  NO  nitric oxide  PAMP  pathogen-associated molecular pattern  PBS  phosphate buffered saline  PH  Pleckstrin homology  PI3K  phosphoinositide-3-kinase  Pin1  protein interacting with NIMA1  ix  PIP3  phosphatidylinositol-(3,4,5)-triphosphate  PKC  Protein kinase C  PLC  phospholipase C gamma  PTEN  phosphatase and tensin homologue deleted on chromosome 10  qPCR  quantitative PCR  RANKL  receptor activator for nuclear factor κ B ligand  RRM  RNA recognition motif  Sab  SH3-domain binding protein that preferentially associates with Bruton's tyrosine kinase  SDS  sodium dodecyl sulfate  SDSPAGE  sodium dodecyl sulfate polyacrylamide gel electrophoresis  SH1  Src homology 1  SH2  Src-homology 2  SH3  Src homology 3  SHIP1  Src homology 2-containing inositol-5ʹ-phosphatase 1  siRNA  small inhibitory RNA  SLP  signal linker protein  SLPI  secretory leukocyte protease inhibitor  STAT3  signal transducer and activator of transcription 3  TAB  transforming-growth factor-β-activated kinase 1 binding protein  TAK1  transforming-growth factor-β-activated kinase 1  TBS-T  tris-buffered saline with tween  TCR  T-cell receptor  x  TFK  Tec family kinase  TGF  transforming growth factor beta  TIA-1  T-cell intracellular antigen 1  TIAR  T-cell intracellular antigen 1 related protein  TIR  toll/IL-1R  TLR  toll-like receptor  TLR4  toll-like receptor 4  TNF  tumor necrosis factor alpha  TRAF6  tumor-necrosis-factor receptor-associated factor 6  TRE  tetracycline response element  TTP  Tristetraprolin  UTR  untranslated region  Xid  x-linked immunodeficiency  XLA  x-linked agammaglobulinemia  xi  1 Introduction 1.1 Inflammation Inflammation was originally described in the first century as the combined symptoms of heat, pain, redness and swelling1. Today, it is known that inflammation is a complex physiological process which combines the responses of the immune system as well as the circulatory system. The inflammatory response is believed to have evolved as a way for the body to fight infection and repair tissue damage and therefore it is generally considered to be a beneficial response 2. However, chronic or excessive inflammation can be detrimental as seen in the case of a number of pathologies such as inflammatory bowel disease, rheumatoid arthritis, anaphylaxis and atherosclerosis 2. Inflammation can be initiated by mast cells and macrophages residing in the tissues of the body 3. These cells respond to a variety of stimuli including pathogen associated molecular patterns (PAMPS), virulence factors, allergens and intracellular contents from damaged cells. Once stimulated, these resident macrophages and mast cells produce a plethora of inflammatory mediators including cytokines like tumor necrosis factor alpha (TNFα), chemokines, histamine and eicosanoides1. The release of these mediators causes localized inflammation characterized by vasodilation of the circulatory system and extravasation of leukocytes from the blood into the tissue. Among the first leukocytes to migrate into the inflamed tissue are neutrophils which become activated by the secretions of the resident mast cells and macrophages such as TNF and CXCL8 with TNFα being the major activator 1. The activated neutrophils then release their own inflammatory mediators as well as the cytotoxic contents of their granules, such as hydrogen peroxide, in an attempt to kill any surrounding pathogens. If this is successful, the inflammatory 1  stimulus will be removed and the inflammatory response switches into a repair response 2. In this way, inflammation is an important first step in the repair of damaged tissues. If the initial action of the recruited neutrophils does not successfully clear the pathogen, then the inflammatory stimulus persists and the response heightens with the recruitment of additional leukocytes such as macrophages and T-cells. The recruitment of T-cells to the site of inflammation is an important first step in the activation of the adaptive immune response and consequently the inflammatory process is also important for the initializing of the adaptive immune system. 1.1.2 Regulating inflammation Despite the overall beneficial effect of the inflammatory response, many of the products released by activated leukocytes during inflammation are damaging not only to pathogens but also to host cells. These include reactive oxygen and nitrogen species, proteinases and hydrogen peroxide1. Therefore, the inflammatory response also damages the tissues of the host. To minimize this damage, inflammation is tightly regulated through the secretion of antiinflammatory molecules such as secretory leukocyte protease inhibitor (SLPI) 4. In the early stages of inflammation, lipoxins, derived from the arachadonic acid released by activated neutrophils1, are particularly important for controlling the inflammatory response. In the later stages of inflammation, the main regulators are the anti-inflammatory cytokines transforming growth factor  (TGF) and interleukin-10 (IL-10), with IL-10 being the best characterized. Finally, the overall immune response in the body is also regulated by the actions of immunosuppressive regulatory T-cells and B-cells5, 6, which often produce their immunosuppressive effects through the release of IL-10 and TGFWithout the proper regulation of inflammation by these factors the body is prone to developing a number of diseases 2  associated with a hyperactive inflammatory response such as Alzheimer’s disease, asthma, chronic obstructive pulmonary disease, type I diabetes and atherosclerosis 1. Inflammation is important in atherosclerosis pathogenesis as inflammatory macrophages accumulate at atherosclerotic plaques and help to drive the progression of these plaques and the formation of additional plaques 7. 1.2 Interleukin-10 Interleukin-10 (IL-10) was first discovered as a cytokine synthesis inhibitory factor secreted from stimulated TH2 cells that could inhibit the production of cytokines from TH1 cells8. After its initial discovery, it was quickly realized that IL-10 also affects the activity of many other immune cells making it a broad range modulator of immune function. The IL-10 gene is found on chromosome 1 in both humans and mice and shares a similar structure between the species with both mouse and human genes being composed of 5 exons separated by 4 introns9. The IL-10 gene encodes for a 17 kDa protein that forms a non-covalent homodimer in its active secreted form. Based on its structure IL-10 protein is a member of the class 2 -helical cytokine family which also includes IL-19, IL-20, IL-22, IL-24, IL-26, interferon (IFN) alpha (IFN) and IFN 10. While many immune cells can respond to IL-10, activated macrophages and dendritic cells are believed to be the major target of IL-10 as these cell types express the highest levels of the IL-10 receptor complex and undergo profound changes upon IL-10 stimulation. 1.2.2 Interleukin-10 signalling IL-10 binds to a receptor complex composed of two subunits: IL-10 receptor 1 (IL-10R1) and IL-10 receptor 2 (IL-10R2) 11. IL-10R1 is expressed constitutively at low levels on most cells and IL-10R2 also has a broad range of expression suggesting that many cells are capable of responding to IL-10 12. The binding of IL-10 to its receptor complex is mediated primarily 3  through IL-10R1 as it has a much higher affinity for the IL-10 protein than does the IL-10R2 subunit11 but IL-10R2 is required for signal transduction. The binding of the IL-10 homodimer to the receptor complex leads to the transphosphorylation and activation of the Janus associated kinases (Jak) Jak1 and Tyk2 that are associated with the IL-10R1 and IL-10R2 subunits, respectively 13. The activation of these kinases allows them to phosphorylate residues Y446 and Y496 on the IL-10R1 subunit and once phosphorylated, these residues can then be bound by Src homology 2 (SH2) domains found on signal transducer and activator of transcription 3 (STAT3) and STAT1. Once bound, STAT3 and STAT1 become phosphorylated by the receptor associated kinases14 causing homodimerization and/or heterodimerization and subsequent dissociation of STAT3 and STAT1 from the IL-10 receptor complex. This allows for the translocation of the STAT homodimers from the cytosol of the cell into the nucleus where they then regulate the transcription of gene targets. The gene targets, once transcribed and translated, then mediate the effects of IL-10 within the cell. Through analyses of STAT1 deficient cells, it has been shown that STAT1 is dispensable for the anti-inflammatory effects of IL-10 15 but is still important in proliferative effects of IL-10. 1.2.3 IL-10 function in macrophages Activated macrophages are one of the main targets of IL-10 as they express high levels of the IL-10 receptor complex. In activated macrophages, IL-10 induces what is termed the antiinflammatory response (AIR) which is characterized primarily by depressed antigen presentation and the inhibited secretion of inflammatory mediators. IL-10 stimulation of macrophages leads to downregulation of the major histocompatability complex II (MHC II) as well as the CD80 and CD86 costimulatory molecules 16, 17. The downregulation of ICAM-1 on macrophages by IL-10 is also reported suggesting that IL-10 can affect macrophage adhesion properties 18. The other 4  major effect of IL-10 is to inhibit the secretion of a number of inflammatory cytokines by activated macrophages including TNF, IL-1, IL-1, IL-6, IL-12 and IL-18 12. Chemokine secretion is also inhibited with IL-10 decreasing the secretion of MCP1, MCP5 and CXCL8 12. IL-10 also downregulates cyclooxygenase expression 19 and decreases the secretion of nitric oxide (NO) by activated macrophages 20. Finally IL-10 stimulation leads to the production of anti-inflammatory molecules such as IL-1 receptor agonist (IL-1RA) 21 and soluble TNF receptor 22  . Overall the effects of IL-10 on activated macrophages are quite profound and serve to inhibit  macrophage effector function. 1.2.4 IL-10 in disease As IL-10 is a potent anti-inflammatory cytokine, it is not surprising that IL-10 plays a key role in a number of diseases, particularly in inflammatory and autoimmune disease. IL-10 knockout mice spontaneously develop inflammatory bowel disease (IBD) and arthritis highlighting the importance of IL-10 in the normal prevention of these diseases23. Interluekin10 is also protective in models of endotoxic shock 24 and helps to prevent systemic lupus erythematosis, rheumatoid arthritis and allergic inflammation 12, demonstrating the importance of IL-10 in the regulation of autoimmune disease. IL-10 has also been found to inhibit allograft rejection in organ transplantation 25. The importance of IL-10 in the prevention of these diseases demonstrates that IL-10 function is usually beneficial in the body. However, increased IL-10 levels have also been associated with chronic infections and some types of cancer 10, 12 due to the inhibition of the immune response by IL-10. Therefore, IL-10 function is important in both the prevention and the progression of a number of diseases.  5  1.2.5 IL-10 independent STAT3 signalling While STAT3 is required for the anti-inflammatory effects attributed to IL-10, there is evidence for STAT3 independent IL-10 signalling. IL-10 has been reported to modulate both the phosphoinosotide-3-kinase (PI3K) pathway and the p38 mitogen activated protein kinase (MAPK) pathway 24, 26. In fact, it is known that IL-10 is able to dissociate TNFα mRNA from polysomes in a p38 dependent fashion suggesting that this function of IL-10 may be STAT3 independent 26. Studies using a STAT3 dominant negative isoform expressed in monocytes have also shown that IL-10 can still inhibit TNF production in LPS activated macrophages in the first hour of IL-10 stimulation. This suggests that in the early phase of the IL-10 response in macrophages, STAT3 is dispensable and further suggests that other pathways must be mediating the inhibitory effects of IL-10 on TNFα production. Finally, IL-10 has also been shown to inhibit nuclear factor kappa B (NF-B) activity through two mechanisms: STAT3 dependent expression of inhibitor of nuclear factor kappa B kinase (IK), and the rapid and apparently STAT3 independent decrease in NF-B DNA binding 27, 28. 1.3 Macrophages Macrophages were originally identified as a subset of cells in the blood which had the capability to engulf large particles. While macrophages are now recognized as being an integral part of the innate immune system, their primary role is to engulf apoptotic cells in the blood such as red blood cells29 and therefore one of the most important roles of macrophages is to maintain cell homeostasis in the body. Macrophages are derived from circulating blood monocytes and reside in every tissue in the body which helps them to serve as sentinels for the detection of pathogens and injury in the body. Macrophages serve an important role in immune responses as  6  they secrete a wide range of autocrine and paracrine factors and are also critical for antigen presentation and activation of the adaptive immune system 29. 1.3.2 Macrophage activation Normally macrophages are found in a resting inactive state in which they can phagocytose apoptotic cells but do not produce inflammatory mediators. However, upon proper stimulation macrophages can become “activated” leading to profound changes in their behaviour. The activation of macrophages was originally described as a response to interferon gamma (IFN) exposure 30, but it is now known that macrophages can become activated through a number of other stimuli. One common stimulus is PAMPs which can be recognized by the tolllike receptors (TLRs) present on the outer cell membrane of macrophages. PAMPs can also be recognized by NOD-like receptors expressed inside cells. Macrophages activated through TLR signalling produce high levels of pro-inflammatory mediators such as TNFα, IL-1, IL-6 and IL23, secrete high levels of NO and also express high levels of MHC II and co-stimulatory molecules CD80 and CD86 29. While activated macrophages generally secrete these proinflammatory cytokines, certain stimuli such as IL-4 can lead to the “alternative” activation of macrophages which results in macrophages that do not produce large levels of inflammatory mediators, do not have increased levels of antigen presentation and do not produce NO31. These alternatively activated M2 macrophages are generally thought to be involved in wound repair processes and the promotion of healing31. As TNFα is one of the most important mediators of inflammation and activated macrophages are one of the largest producers of TNFα, macrophages are key players in the inflammatory response and therefore regulating macrophage response is important in controlling inflammation.  7  1.4 TLR4 signalling Macrophages recognize PAMPS primarily through TLRs expressed on their outer cell membrane. TLRs were originally identified in Drosophila melongaster as a receptor important in embyrogenesis, but they were soon found to play a critical role in the innate immune system. TLRs all share a conserved toll/IL-1R (TIR) domain located on the cytoplasmic portion of the protein 32. This TIR domain is approximately 200 amino acids and is critical for TLR signal transduction 33. To date there have been 11 different TLRs identified in mammals which possess differential ligand specificity, cell localization and signalling pathways 32. One TLR agonist is lipopolysaccharide (LPS), a component of the cell wall of Gram-negative bacteria, that binds and signals in cells through TLR4. LPS is first bound outside the cell by LPS binding protein (LBP) creating a LPS-LPB complex that is then bound by CD14 on the surface of macrophages. CD14 then presents the LPS-LPB complex to the TLR4-MD2 receptor complex causing the dimerization of the TLR4 receptor 34. The dimerized receptor will then recruit myeloid differentiation primary-response protein 88 (Myd88) that in turn recruits IL-1R-associated kinase 4 (IRAK-4) to the receptor. IRAK-4 then phosphorylates IRAK-1 causing the recruitment of tumor-necrosis-factor receptor-associated factor 6 (TRAF6). TRAF6 and IRAK-1 then dissociate from the receptor and form a complex with transforming-growth factor-β-activated kinase (TAK1) and TAK1-binding proteins 1 and 2 (TAB1 and TAB2). This leads to the degradation of IRAK-1 and the remaining proteins migrate into the cytosol where TRAF6 becomes ubiquitinated activating TAK1. Activated TAK1 then phosphorylates MAPKs as well as the inhibitor of nuclear factor-κB (IB)-kinase (IK) complex. This complex phosphorylates IB causing it to release NF-B which can then translocate to the nucleus and induce the transcription of pro-inflammatory genes 33. In addition to the activation of NF-kB and MAPKs,  8  TLR4 signalling also leads to the activation of the PI3K pathway and Src kinases and Tec kinases 33. 1.5 SH2-containing inositol-5ʹ-phosphatase 1 (SHIP1) SHIP1 is a 145 kDa lipid phosphatase expressed exclusively in hematopoietic cells whereas the closely related SHIP2 protein is expressed ubiquitously in the body. SHIP1 contains an N-terminal SH2 domain, a C2 domian, a phosphatase domain, as well as a putative pleckstrin homology (PH) domain (data unpublished) (Figure 1). The primary function of SHIP1 is to antagonize PI3K signalling by converting the PI3K product, phosphatidylinositol-(3,4,5)triphosphate (PIP3) into phosphatidylinositol-(4,5)-biphosphate by dephosphorylating the 3ʹ position of the lipid inositol ring35. The ability to antagnoize PI3K signalling is also shared by phosphatase and tensin homologue deleted on chromosome ten (PTEN), but SHIP1 and PTEN often have functions distinct from one another 36. As SHIP1 is only expressed in hematopoietic cells, it is not surprising that SHIP1 has an important role in immune cell function. SHIP1-/mice have increased numbers of macrophages and granulocytes and exhibit depressed Natural killer cell development 34, 37, highlighting the importance of SHIP1 in immune cell development. As SHIP1 antagonizes the PI3K pathway which can function as a survival and proliferation pathway, SHIP1 is also an important tumor suppressor 34. 1.5.2 SHIP1 function in macrophages SHIP1 appears to play a very important role in the biology of macrophages. SHIP1 has been found to be a negative regulator of macrophage colony stimulating factor (M-CSF) signalling by preventing M-CSF induced Akt phosphorylation 38, suggesting that SHIP1 is important in regulating macrophage proliferation as Akt activity promotes cell survival and proliferation 39. In SHIP-/- mice there is a dramatic increase in the levels of alternatively 9  Figure 1 Domain structure of Btk and SHIP1 proteins. (A) Schematic diagram of the domain structure of SHIP1. (B) Schematic diagram of the domain structure of Btk. Y223 and Y551 represent tyrosine residues and phosphorylation sites 223 and 551 of human Btk. SH3 = Src homology 3 domain. SH2 = Src homology 2 domain. TH = Tec homology domain. PH = Pleckstrin homology domain. C2 = C2 domain. PR = Proline-rich region. Kinase = SH1 domain.  10  activated M2 macrophages. These M2 macrophages are considered to be healer macrophages as they produce considerably less NO than classical M1 macrophages, and they also express high levels of L-arginase, an enzyme which depletes arginine reserves required for the production of NO 34. Also it has been found that SHIP-/- mice are much more susceptible to endotoxic shock, and SHIP1 activation during LPS induced endotoxic shock in mice leads to much higher survival rates and decreased TNFα serum levels 40. These findings suggest that SHIP1 is an important negative regulator of the inflammatory pathway and TNFα production in macrophages. This notion is further supported by the finding that one of the anti-inflammatory effects of IL-10 on macrophages is to suppress microRNA(miRNA)-155 (miR-155) which is a suppressor of SHIP1 protein expression41. 1.6 Bruton’s tyrosine kinase and Tec kinase Bruton’s tyrosine kinase (Btk) and Tec kinase are non-receptor tyrosine kinases which are members of the Tec family kinases (TFKs) which also include interleukin-2 inducible T-cell kinase (Itk), Rlk/Txk and bone marrow kinase on chromosome X (Bmx) 42. The TFKs are expressed almost exclusively in hematopoietic cells suggesting that they are important in immune cell function 43. They share a structure similar to the related Src tyrosine kinases containing SH1, SH2 and SH3 domains, but they also possess an N-terminal PH domain (Figure 1). The SH3 and PH domain of Tec kinases are also separated by a Tec homology domain which contains proline-rich sequences likely involved in mediating protein interactions 44. 1.6.2 Role of Btk and Tec in B-cell and T-cell signalling Of the Tec kinases, Btk was the first to be discovered as it was found that mutation of Btk causes X-linked agammaglobulinemia (XLA) in humans45. XLA is characterized by a severe deficiency in circulating B-cells which leads to frequent bacterial infections45. Mutations of Btk 11  in mice lead to a similar, although less severe condition in mice known as X-linked immunodeficiency (xid). Mutations in Btk result in XLA and xid due to the fact that Btk is required for B-cell maturation through B cell receptor (BCR) signalling 46. Similarly, Tec is involved in T-cell receptor (TCR) signalling 47 and both Tec and Btk play an important role in phospholipase C gamma (PLC) activation and subsequent Ca2+ flux downstream of the TCR or BCR47. 1.6.3 Role of Btk and Tec in macrophage function The role of the TFKs in myeloid cells has been less studied but recent research has indicated an important role for the TFKs in various myeloid cell functions 48. Macrophages express both Btk and Tec, and LPS stimulation of macrophages has been shown to lead to rapid phosphorylation of Btk and Tec 49. Macrophages derived from XLA patients or xid mice produce less TNFα and IL-1 in response to LPS stimulation 49, 50 and have decreased expression of inducible nitric oxide synthase (iNOS) and produce less NO51. These results indicate that Btk function is important in LPS-TLR4 signalling in macrophages. Btk is also known to interact with a number of proteins in the TLR4 signalling pathway such as Myd88 adaptor like protein (Mal), IRAK-1, Myd88 and TLR4 itself 52 further suggesting that Btk can participate in TLR4 signalling. Btk appears to enhance LPS induced macrophage responses through two main mechanisms: p38 mediated mRNA stability and NF-B activity. Btk overexpression in monocytes has been shown to increase the stability of TNFα mRNA and therefore lead to increased TNFα production in a p38 dependent manner 49. Inhibition of Btk activity has also been found to result in decreased NF-B activity following LPS stimulation in a number of studies 52-55. Btk appears to modulate NF-B activity through the phosphorylation of Mal 53. The activation of NF-B in B cells through BCR signalling is also dependent on Btk 46. While 12  Tec is also activated by LPS in macrophages, there is little known about specific roles for Tec in LPS signalling in macrophages. Btk and Tec also appear to play a role in the development and survival of macrophages as Tec is required for proper macrophage signalling through the M-CSF receptor 56 and xid mice show reduced numbers of myeloid progenitors and monocytes 48. Finally, Btk and Tec are also required for phagocytosis in macrophages as inhibiting Tec and Btk activity with the drug LFM-A13 leads to impaired phagocytosis of IgG opsonized beads in a mouse macrophage cell line, RAW264.7 57. 1.6.4 Activation of Btk and Tec The activation of Btk and Tec is generally considered to be a two step process. First, Btk or Tec must be localized to the membrane by the binding of their PH domain to PIP3 58. This requirement of membrane localization indicates that Btk and Tec require PI3K activity for their own function however, it has been found that Btk can still be activated and function in PI3K p85(-/-) B-cells suggesting that PIP3 binding may not be a complete requirement for Btk activity 59  . The next step in Btk and Tec activation is their phosphorylation by an upstream kinase 58.  This is generally accomplished by the Src kinases Lyn or Syk 60, 61 and takes place on Tyrosine 551 (Y551) residue of human Btk located in the SH1 domain (Figure 1). Phosphorylation of this tyrosine residue is critical for kinase activation of Btk since phenylalanine substitution of Y551 (Y551F) showed substantially reduced enzymatic activity compared to wild-type Btk 62. Once this tyrosine residue is phosphorylated, an -helix that normally occludes the active site of Btk undergoes a conformational change exposing the active site and allowing kinase acitivity63. The activity of Btk can be further modulated by phosphorylation of Y223 of the SH3 domain, but this phosphorylation does not directly affect the active site of Btk but rather affects the association of Btk with other proteins 64. 13  1.6.5 Negative regulation of Btk and Tec Btk is known to interact with a number of different proteins 44 and some of these proteins have been found to negatively regulate the activity of Btk. Inhibitor of Btk (IBtk) is a small protein that binds between the PH and TH domain of Btk resulting in inhibited Btk function44. Another negative regulator of Btk is SH3-domain binding protein that preferentially associates with Btk (Sab), a protein which binds to the SH3 domain of Btk resulting in the inhibited kinase activity of Btk 64. Protein interacting with NIMA1 (Pin1) a peptidyl-prolyl cis-trans isomerase is another Btk inhibitor which can bind to Btk and promote the dephosphorylation of Btk 60. The identification of these and other Btk interacting proteins suggest that protein-protein interaction is very important in modulating and regulating Btk activity. As Btk and Tec traditionally require PIP3 for their activity, negative regulators of the PI3K pathway might also inhibit Btk and Tec function. Indeed, SHIP1 has been found to negatively regulate the function of both Btk and Tec by inhibiting their membrane localization 65, 66  . Overexpression of SHIP1 in B-cells led to decreased Btk membrane association and  attenuated BCR signalling 65. The overexpression of SHIP1 in the Jurkat T-cell line also diminished function and membrane localization of Tec 66. Interestingly, it was also found that the SH3 domain of Tec but not Btk could associate with SHIP1 66, suggesting that SHIP1 may regulate Tec and Btk differently. 1.7 T-cell intracellular antigen T-cell intracellular antigen 1 (TIA-1) is a small RNA-binding protein which is a member of the RNA-recognition motif (RRM) family of RNA binding proteins 67. TIA-1 contains three RRMs which bind uridine rich sequences with high affinity 68, as well as a glutamine rich region at the carboxy-terminus which is important in mediating protein interactions68. Studies have 14  demonstrated a role for TIA-1 in a variety of processes. TIA-1 knockout mice have a high rate of embryonic lethality indicating a requirement of TIA-1 during development 69. The splicing of various pre-mRNA molecules is also regulated by TIA-1 through its interaction with U1 small nuclear ribonucleoprotein 70. TIA-1 function has been shown to be important in apoptosis 71, viral replication 72 and stress response in cells 73. TIA-1 is also a well characterized translational regulator and can control the translation of target mRNA molecules which include 2 adrenergic receptor 74, -F1 ATPase 70, mitochondrial cytochrome c 75, cyclooxygenase-2 76 and TNF 69. TIA-1 specifically binds to the AU-rich element (ARE) in the 3ʹ untranslated region (UTR) of TNFα mRNA 69 and controls TNFα mRNA translation. Macrophages from TIA-1-/- mice overproduce TNFα in response to LPS and have increased levels of TNFα mRNA association with polysomes. 1.7.2 TIA-1 related protein T-cell intracellular antigen related protein (TIAR) is also a member of the RRM family of RNA binding proteins and is highly similar to TIA-1, with 85% overall sequence similarity but much lower similarity in the C-terminal region of the protein 77. Similar to TIA-1, TIAR binds to AREs in the 3ʹUTR of TNFα mRNA 78 and regulates TNFα translation. TIAR knockout mice also have a high rate of embryonic lethality and macrophages from TIAR-/- mice produce excess amounts of TNFα in response to LPS. One important function of TIAR is its ability to regulate the alternate splicing of TIA-1 pre-mRNAs which causes preferential levels of one TIA-1 isoform over the other 79. 1.7.3 TIA-1 and TIAR activation The mechanism of activation of TIA-1 and TIAR is still largely unknown. During times of cell stress, phosphorylation of the translation initiation factor eIF-2a causes TIA-1 and TIAR 15  to shuttle target mRNAs to stress granules resulting in translational silencing 80. However, TIA and TIA-R function in non-stressed cells as well but how their activity is regulated under these conditions is not yet known. 1.8 Translation The translation of messenger RNA is a critical step in the regulation of protein production. While the initiation of transcription is the key first step in protein production, transcriptional regulation is complex and not rapidly modulated meaning that transcription is not a means whereby rapid changes in a cell can be achieved81. Translation on the other hand allows for quick regulation and therefore translational control is a mechanism allowing for rapid changes within a cell81. This rapid response has been taken advantage of by a number of processes in the immune system82. Translation can be controlled on a global scale in a cell by the regulation of translation initiation factors, or can be specific to a subset of mRNAs through the presence of regulatory elements within the mRNA molecule83. All mRNAs contain the same basic structure comprising a 5' 7-methylguanylate cap and a 3' poly(A) tail, both of which are important in overall mRNA stability 83. In between these two structures exist a cap structure near the 5' end important in translation initiation, internal ribosome entry sites, and one or more open reading frames which code for the protein 83. These basic elements of an mRNA molecule are important in controlling the three basic steps of translation: initiation, elongation and termination. 1.8.2 Initiation Translation initiation is the most complex process of translation and therefore is the main mechanism of translational regulation. Translation itself is carried out by ribosomes which are composed of 40S and 60S subunits. Initially, the 40S subunit forms a 43S pre-initiation complex 16  by binding to global translation initiation factors 83. These initiation factors interact with the 5' 7-methylguanylate cap and facilitate the loading of the 43S pre-initiation complex onto the mRNA molecule84. Once loaded, the 43S complex will scan along the mRNA molecule in a 5' to 3' direction until it encounters an initiation codon which is usually the first AUG found on the mRNA85. However, sometimes the 43S complex will bypass the first initiation codon and instead continue to scan the mRNA until it encounters an internal ribosome entry site86. Once at the initiation site, an initiator tRNA will bind to the AUG sequence which then allows for the binding of the 60S ribosomal subunit to form the 80S ribosome complex 83. During this process of tRNA binding and 60S binding, many of the initiation factors associated with the 43S preinitiation complex dissociate. At this stage translation elongation will begin and the protein will start to be produced. 1.8.3 Elongation and termination Once the 80S ribosome complex is associated with an mRNA, an amino-acyl tRNA will bind in the A-site of the ribosome based upon the sequence of the next codon of the mRNA molecule. A peptide bond is then formed between the preceding amino acid located in the P-site of the ribosome complex and the amino acid in the A-site 83. After this, the tRNA in the P-site, which is no longer linked to its amino acid, will then migrate to the E-site of the ribosome allowing it to dissociate from the 80S ribosome complex, while the tRNA in the A-site moves to the P site. This opens up the A-site for a new tRNA to bind based upon the sequence of the next codon of the mRNA. This process of elongation continues until a stop codon is reached which causes release factors to bind to the A-site of the 80S ribosome complex leading to the dissociation of the ribosome subunits from the mRNA molecule. In addition to these stop codons, other proteins have been found to be able to cause the release of the 60S ribosome 17  subunit halting translation 83. However, in this case of termination the 40S subunit continues to scan along the mRNA 83. 1.8.4 Regulation of translation As initiation is the key step in translation, the majority of translational regulation occurs at this initiation step. Because of this, the number of ribosomes associated with a particular mRNA molecule is generally a good indicator of the level of translation of that mRNA. Following from this, mRNA molecules associated with only one ribosome (monosomes) are thought to be less translationally active than mRNA molecules associated with multiple ribosomes (polysomes). The main mechanism of translation initiation regulation is through the control of the initiation factors. This is achieved by modulating their phosphorylation state 83. However, the degradation of initiation factors has also been found to be important in regulating translational activity87. As the same set of initiation factors are involved in the initiation of translation for all mRNA molecules, changes in the activity of these factors lead to the global translational regulation of all mRNA molecules83. Specific regulation of mRNA molecules often involves the sequences found in the 3' UTR of a mRNA molecule. Sequences in this region are bound by regulatory proteins which interfere with the loading of the 43S pre-initiation complex, often through steric hinderence of the initiation factors88. Aside from their role in inhibiting initiation, these sequences can also be bound by proteins which regulate the stability of a particular mRNA, and this has direct consequences on the amount of protein produced by that mRNA. These 3'UTRs are particularly important in inflammation as a large number of pro-inflammatory mediators contain 3'UTRs in their mRNA 89. Finally, there can be spatial regulation of mRNA translation whereby specific  18  mRNA molecules are transported to a particular location of a cell before translation occurs. This can help lead to cell polarization and facilitate asymmetric cell division90. 1.9 Hypothesis IL-10 function is pivotal in the body for the regulation of the inflammatory process as well as the control and suppression of multiple diseases. Activated macrophages are one of the main targets of IL-10 and the inhibited production of TNFα in activated macrophages by IL-10 contributes largely to its ability to regulate inflammation. While the STAT3 pathway is important in IL-10 induced suppression of TNFα production, there is reason to believe that IL-10 also signals through additional STAT3-independent pathways. We believe that one of these STAT3 independent pathways utilized by IL-10 involves the protein SHIP1 as SHIP1 activity can suppress TNFα production in LPS stimulated macrophages. Specifically, we hypothesize that IL-10 utilizes SHIP1 to induce the dissociation of TNFα mRNA away from polysomes in LPS activated macrophages, thereby leading to decreased TNFα production. This IL-10-SHIP1 pathway should function independent of STAT3. Herein we demonstrate that IL-10 requires SHIP1 protein to dissociate TNFα mRNA from polysomes in activated macrophages and that this occurs early in the IL-10 AIR. We also identify Btk as another protein utilized by IL-10 to suppress TNFα production in activated macrophages.  19  2 Materials and methods 2.1 Reagents and cell lines All reagents used in the described experiments were obtained from Sigma-Aldrich (Oakville ON, Canada) unless otherwise stated. The RAW264.7 mouse macrophage cell line was obtained from Dr. Neil Reiner (University of British Columbia). The following primary antibodies were used: SHIP1 p150 (BD Biosciences, Mississauga ON, Canada) Catalogue # 611334, STAT3 (BD Biosciences, Mississauga ON, Canada) Catalogue #S21320, p38 MAPK (Santa Cruz Biotechnology, Santa Cruz CA) Catalogue # sc-535, Btk (Santa Cruz Biotechnology, Santa Cruz CA) Catalogue # sc-1696, TIA-1/TIAR (Santa Cruz Biotechnology, Santa Cruz CA) Catalogue # sc-48371, Tec (Millipore, Etobicoke ON, Canada) Catalogue # 06561. 2.2 Cell culture All cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Fisher Scientific, Toronto ON, Canada) supplemented with 9% (v/v) fetal calf serum (FCS) (Fisher Scientific, Toronto ON, Canada) which had been heat inactivated by incubation at 56oC for 90 minutes to inactive complement proteins contained in the serum. Cells were passaged every 48 hours and plated at 2.5x106 cells in 10 mL of medium on a 10 cm tissue culture dish (Fisher Scientific, Toronto ON, Canada). All cells were maintained at 37oC and 5% CO2. 2.3 Bacterial transformation and vector purification For all transformations 2 L of plasmid was added to one vial of DH5chemically competent Escherichia coli (Invitrogen, Burlington, ON, Canada) and incubated for 5 minutes on ice. The mixture was then heat shocked for 30 seconds at 42oC and placed on ice. 250 L of 20  room temperature Luria-Bertani medium was then added and the mixture was incubated for 60 minutes at 37oC on a shaker at 200 revolutions per minute (rpm). The mixture was then plated onto LB-Agar plates and grown overnight at 37oC to produce colonies. For plasmid purification QIAprep Spin Miniprep Kit (QIAGEN, Mississauga ON, Canada) was used according to the manufacturers’ protocol. 2.4 Generation of pTRIPZ-siRNA vectors siRNA oligonucleotides targeting mRNA of interest were designed using BLOCK-iT™ siRNA online design software (Invitrogen, Burlington, ON, Canada) and obtained as single stranded oligonucleotides (Invitrogen, Burlington, ON, Canada). An annealing reaction was performed between single stranded oligonucleotides by incubating 10 M of each oligonucleotide for 4 minutes at 95oC in annealing buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 100 mM NaCl) and then letting the resulting double stranded oligonucleotide cool to room temperature. The double stranded oligonucleotide was then used in a ligation reaction with a modified pcDNA6.2-EmGFP (Dr. Deider Fink, University of British Columbia) that had been linearized by a restriction enzyme digestion with Bsa I (New England Biolabs, Pickering ON, Canada). 10 ng of linearized pcDNA6.2-EmGFP vector was incubated with 1 ng of double stranded oligonucleotide and 1 unit of T4 DNA Ligase (Invitrogen, Burlington, ON, Canada) in T4 Ligation Buffer (Invitrogen, Burlington, ON, Canada) for 2 hours at 24oC. Ligated plasmids were then transformed into DH5component E. coli and purified to obtain pcDNA6.2-EmGFPsiRNA vectors. 300 ng of pcDNA6.2-EmGFP-siRNA vector and 300 ng of pDONR-221 vector (Invitrogen, Burlington, ON, Canada) were used in a BP recombination reaction by adding BPClonase™ mix (Invitrogen, Burlington, ON, Canada), incubating at 24oC for 1 hour and then adding 1 unit of Proteinase K (Invitrogen, Burlington, ON, Canada) and incubating for 10 21  minutes at 37oC. Recombined plasmids were then transformed into DH5 component E. coli and purified to obtain pENTR-221-siRNA vectors. 150 ng of pENTR-221-siRNA vector was combined with 150 ng of pTRIPZ-Dest vector (Fisher Scientific, Toronto ON, Canada) and LR Clonase™ mix (Invitrogen, Burlington, ON, Canada) and incubated for 60 minutes at 24oC in a LR recombination reaction. 1 unit of Proteinase K was then added and the mixture was incubated at 37oC for 10 minutes. Recombined plasmids were transformed into DH5 competent E. coli and purified to obtain pTRIPZ-siRNA vectors. BP and LR Clonase™ technology is based upon E. Coli bacteriophage lambda recombination which uses integrase enzyme to excise and integrate the bacteriophage genome into host bacterial genomes. 2.5 Lentiviral transduction Lentivirus was produced from generated pTRIPZ-siRNA vectors by Mr. Rupinder Dhesi (Vancouver Costal Health Research Center, Vancouver Canada). RAW264.7 cells were seeded at 7.5x104 cells per well onto 96 well plates in 200 L of medium and grown overnight. The next day, lentivirus was diluted 1:20, 1:40 or 1:80 in DMEM supplemented with 9% (v/v) FCS and 8 g/mL protamine sulphate. Media was removed from each well containing RAW264.7 cells and 50 L of diluted lentivirus was added and cells incubated for 6 hours. Medium was then removed and 200 L DMEM medium supplemented with 9% (v/v) FCS was added and cells were grown overnight. The next day cells in each well were transferred into 24 well plates containing 1 mL of DMEM medium supplemented with 9% (v/v) FCS and 3 g/mL puromycin. Cells were maintained in puromycin-containing medium for 5 days to allow for drug selection. Cells were then incubated for 24 hours with 9% (v/v) FCS DMEM supplemented with 2 g/mL doxocycline to induce expression of GFP-siRNA constructs. These cells were then sorted for  22  GFP fluorescence with the top 10% GFP fluorescent cells being kept. These cells became the siRNA transduced cell lines used in experiments. 2.6 Immunoblotting and analysis Cells were seeded at 6.25x105 cells per well on 6-well plates and grown for 48 hours in either the presence or absence of 2 g/mL doxocycline. Media was removed and cells were lifted in 1 mL of cold Dulbecco's Phosphate Buffered Saline (PBS) (Fisher Scientific, Toronto ON, Canada). Cells were pelleted by centrifugation at 1,500 rpm for 5 minutes at 4oC. The PBS supernatant was removed and cells were resuspended in 150 L of PSB (50 mM HEPES, 100 mM NaF, 10 mM NaPPi, 2 mM Na3VO4 , 2 mM MoO4 and 5 mM EDTA, pH 7.5) supplemented with 1% Nonidet P-40 (Roche Diagnostics, Mississauga ON, Canada) and Protease Inhibitor Cocktail (Roche Diagnostics, Mississauga ON, Canada) and incubated for 30 minutes on a rocker at 4oC. Samples were then centrifuged at 14,000 rpm for 10 minutes at 4oC to pellet cell debris and nucleii. 125 L of supernatant was added to 125 L of sodium dodecyl sulfate (SDS) sample buffer (35% glycerol, 20% 2-Mercaptoethanol (BIO-RAD, Mississauga ON, Canada) and 45% SDS). Equal volumes of samples were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred onto Immobilon polyvinylidene difluoride membrane (Millipore, Etobicoke ON, Canada) at 3 mAmp/cm2 of membrane for 35 minutes. Membranes were blocked with 3% bovine serum albumin (BSA) in Tris-buffered Saline supplemented with 0.1% Tween (TBS-T) for 60 minutes at 24oC. Membranes were then rinsed in TBS-T and incubated with primary antibody overnight at 24oC. Membranes were washed 3 times in TBS-T for 5 minutes and incubated with Alexa-Fluor 680® secondary antibodies (Invitrogen, Burlington, ON, Canada) diluted 1:10,000 in TBS-T for 45 minutes. Membranes were then washed 3 times in TBS-T for 5 minutes and imaged on a LI-COR 23  Odyssey system (LI-COR, Lincoln NB, USA). Densitometrical analysis was performed using Odyssey 2.1 software by taking the integrated intensity of each protein band, normalizing to the integrated intensity of an appropriate endogenous control (p38 or STAT3) and calculating the normalized value relative to samples from non doxocycline treated cells. 2.7 Sucrose gradient fractionation and RNA purification Two days prior to stimulation, cells were seeded at 8x106 cells onto a 10 cm plate in 10 mL of media supplemented with 2 g/mL doxocycline and grown overnight. Cells were then lifted and seeded at 8x106 cells onto a 10 cm plate in 10 mL of media supplemented with 2 g/mL doxocycline and grown overnight for stimulation the next day. For stimulations, media was removed and 5 mL of fresh 9% (v/v) FCS DMEM was added and cells were incubated for 60 minutes. LPS was then added to a final concentration of 1 ng/mL and cells were incubated for 45 minutes. For IL-10 stimulated cells, IL-10 was then added to a final concentration of 100 ng/mL and cells were incubated for an additional 15 minutes. For cells stimulated with LPS alone, IL-10 was not added and cells were incubated for 15 minutes. After stimulation, media was removed and cells were washed in 5 mL cold PBS. Lysates were prepared by adding 500 uL of Lysis Buffer (10 mM KCl, 10 mM Tris-Cl, 10 mM MgCl2, 20 mM Dithiothreitol, 150 ug/mL cycloheximide, 0.5% NP-40, and 500 Units of RNase Protector (Roche Diagnostics, Mississauga ON, Canada)) to each plate and lifting cells using a cell scraper. Lysates were then incubated for 30 minutes at 4oC on a rocker and then centrifuged at 14,000 rpm for 10 minutes at 4oC. 70%, 50% or 30% sucrose solutions (10 mM KCl, 10 mM Tris-Cl, 10 mM MgCl2, 20 mM DTT, 150 g/mL cycloheximide, 100 U/mL RNase Protector and sucrose) were prepared. 500 L of lysate supernatants were added to 125 L of 50% sucrose solution to make 10% sucrose lysates. 450 L of this solution was then layered onto the top of a sucrose step gradient (450 L 24  of 30% sucrose solution on top of 250 L of 50% sucrose solution on top of 200 L of 70% sucrose solution in a 1.5mL ultracentrifuge tube (Beckman, Mississauga ON, Canada)). Gradients were centrifuged at 60,000 rpm for 35 minutes in a TL-100.4 rotor using a TL-100 Tabletop Ultracentrifuge (Beckman, Mississauga ON, Canada). Starting from the top, 10 125 L fractions were collected from the sucrose gradients. For each fraction, 150 ng of human RNA was then added as well as 950 L of TRIZOL® Reagent (Invitrogen, Burlington, ON, Canada). RNA was then purified from TRIZOL® solution according to manufacturer’s protocol and resuspended in 15 L of diethyl pyrocarbonate (DEPC) treated water. 2.8 DNase treatment and cDNA synthesis For each sample, 7 L of purified RNA was combined with 2.5 L of 5X DNase I Incubation Buffer (Roche Diagnostics, Mississauga ON, Canada), 10 units of DNase I Enzyme (Roche Diagnostics, Mississauga ON, Canada) and 14.5 L of DEPC water and this mixture was incubated for 30 minutes at 30oC. 2 L of 0.1 M EDTA was added and the mixture was then incubated at 75oC for 10 minutes to terminate the reaction. For cDNA synthesis reactions, Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics, Mississauga ON, Canada) was used according to manufacturer’s protocol. 5 L of DNAse treated samples was used as a template for all cDNA synthesis reactions. The resulting cDNA was diluted 1:4 in DEPC water prior to use in quantitative PCR. 2.9 Quantitative-PCR and analysis Quantitative PCR (qPCR) analysis of cDNA samples was done to determine levels of mouse TNFα mRNA and human Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. For detection of TNFα mRNA levels, Taqman® probe-based detection was used. For each  25  reaction, 5 L of template was added to 250 nM Universal ProbeLibrary Probe #49 (Roche Diagnostics, Mississauga ON, Canada), 900 nM of TNFα forward primer (5`TCTTCTCATTCCTGCTTGTGG3ʹ), 900nM of TNFα reverse primer (5`GGTCTGGGCCATAGAACTGA3ʹ), 1X Faststart Universal Probe Master (Rox) mix (Roche Diagnostics, Mississauga ON, Canada) and DEPC water in 15 L total volume. For detection of GAPDH, SYBR green based detection was used. 5 L of template was added to 300 nM of GAPDH-forward primer (5ʹAGCCACATCGCTCAGACAC3ʹ), 300 nM of GAPDH-reverse primer (5ʹGCCCAATACGACCAAATCC3ʹ), 1X Faststart SYBR Green (Rox) (Roche Diagnostics, Mississauga ON, Canada) and DEPC water in 15 L total volume. For both TNFα mRNA and GAPDH mRNA detection, each sample was run in triplicate on a 96-well optical plate (Applied Biosystems, Foster City CA) using an ABI 7300 Real Time PCR System (Applied Biosystems, Foster City CA). Ct values for all samples were determined using ABI 7300 Real Time PCR Software (Applied Biosystems, Foster City CA). To quantify levels of TNFα mRNA the Comparative Ct method of quantification was used 91. Briefly, for each sample the Ct value for GAPDH was subtracted from the Ct value for TNFα of the same sample to give ΔCt. This normalized value was then compared to the normalized value of an external standard (cDNA from RNA purified from RAW264.7 cells stimulated for 2 hours with 1 ng/mL LPS) by subtracting the normalized value of the standard from the normalized value for all other samples to give ΔΔCt. The level of TNFα mRNA in each sample relative to the external standard was then determined by taking 2- ΔΔCt. To calculate percent TNFα mRNA in each fraction, the sum of the relative values of TNFα mRNA in all 10 fractions were added to give the total level of TNFα mRNA recovered. The level of TNFα mRNA in each fraction was then divided by this value to give percent TNFα mRNA as previously described92. A validation experiment between mouse  26  TNFα primers and human GAPDH primers was also performed to ensure that PCR efficiencies were within 5% of each other 91. All qPCR reations were performed with both a no template control (DEPC Water Only) and a No Reverse-transcriptase control (DNase treated RNA incubated without reverse transcriptase in cDNA synthesis reaction) to control for the presence of genomic DNA. 2.10 Quantification of TNFα production in LPS and IL-10 stimulated macrophages Cells were seeded at 5x106 cells onto a 10 cm plate in 10 mL of 9% (v/v) FCS DMEM and grown overnight either in the presence or absence of 2 g/mL doxocycline. Cells were then lifted and seeded at 5x104 cells/well in a 96-well plate in 200 L of 9% (v/v) FCS DMEM supplemented with or without 2 g/mL doxocycline and grown overnight. For stimulations, medium was removed and 250 L of 9% (v/v) FCS DMEM was added to each well and cells were incubated for 45 minutes. 50 L of medium containing LPS or LPS and IL-10 was then added to each well to give the desired final concentration of LPS and IL-10. Cells were then incubated for 60 minutes and 100 L of cell supernatants were collected. These supernatants were diluted 1:1 in blocking buffer (10% FCS in PBS) and assayed for TNFα concentration by enzyme-linked immunosorbant assay (ELISA) using BD OptEIA™ Mouse TNF ELISA Set II kit (BD Biosciences Mississauga ON, Canada) according to manufacturer’s protocol. For IL-10 stimulations, percent maximum TNFα was calculated by taking the concentration of TNFα produced in the presence of LPS and IL-10 and dividing by the concentration of TNFα produced in the presence of LPS alone. 2.11 Statistical analysis ANOVA analyses and students t-tests were performed using GraphPad Prism4 software.  27  3 Results 3.1 Inducible knockdown of SHIP1 and STAT3 To investigate the role of SHIP1 and STAT3 in the IL-10 AIR, RAW264.7 mouse macrophages with small interfering RNA (siRNA) mediated knockdown of SHIP1 or STAT3 were generated. As STAT3 is required for cell growth and survival 93, and over time, cells can compensate for the loss of a particular protein, the knockdown of SHIP1 and STAT3 was required to be inducible. To accomplish this, siRNA targeting SHIP1 or STAT3 was designed and cloned into a miRNA expression vector (pTRIPZ) under the control of a doxocycline/tetracycline inducible promoter. BLOCK-iT™ siRNA design software from Invitrogen was used to create siRNA against target protein SHIP1 or STAT3 mRNA. The siRNA designed by this program mimics the structure and the function of miRNA, a type of of siRNA found in cells. miRNAs bind to target mRNA through sequence complementarity and either repress the translation of the mRNA or target the mRNA for degradation leading to a decrease in the levels of target protein over time. A non-specific siRNA (Scrambled siRNA) which does not target any mRNA was also designed to serve as a control for siRNA expression. The single stranded oligonucleotides designed by the BLOCK-iT™ software (Table 1) were annealed together to create double stranded siRNA with single stranded RNA overhangs on both the 5ʹ and 3ʹ end of the siRNA. These double stranded siRNAs were ultimately inserted into the pTRIPZ lentiviral vector using the cloning scheme outlined in Figure 2. Briefly, a ligation reaction between the double stranded siRNAs and linearized pcDNA 6.2-GW/EmGFP-miR vector was performed to create pcDNA 6.2-GW/EmGFP-miR-siRNA vectors. The pcDNA 6.2GW/EmGFP-miR was used because the insertion site for the siRNA is flanked by 5ʹ and 3ʹ microRNA-like (miR) sites which facilitate the expression and processing of the inserted siRNAs 28  Target SHIP1  STAT3  Scrambled  Top Oligonucleotide 5’TGCTGATTCTCTCCTTCCTGACTCTTGTTTT GGCCACTGACTGACAAGAGTCAAAGGAG AGAAT-3’ 5’TGCTGGTTGTTAGACTCCTCCATGTTGTTTT GGCCACTGACTGACAACATGGAGTCTAAC AACC-3’ 5’TGCTGAAATGTACTGCGCGTGGAGACGTT TTGGCCACTGACTGACGTCTCCACGCAGT ACATTT-3’  Bottom Oligonucleotide 5’CCTGATTCTCTCCTTTGACTCTTGTCAGTCA GTGGCCAAAACAAGAGTCAGGAAGGAGA GAATC-3’ 5’CCTGGTTGTTAGACTTCCATGTTGTCAGTC AGTGGCCAAAACAACATGGAGGAGTCTA ACAACC-3’ 5’CCTGAAATGTACTGCGTGGAGACGTCAGT CAGTGGCCAAAACGTCTCCACGCGCAGT ACATTTC-3’  Table 1 siRNA Oligonucleotides targeting SHIP1, STAT3 or Scrambled Control. The sequences of oligonucleotides used to generate SHIP1, STAT3 or Scrambled siRNAs.  29  Figure 2 Cloning strategy for generation of drug inducible siRNA lentiviral vectors. Double stranded siRNA designed using BLOCK-iT design software was annealed into linearized pcDNA 6.2GW/EmGFP-miR vector via complementary overhanging nucleotides to create pcDNA 6.2-GW/EmGFPmiR-siRNA. A BP recombination reaction was then performed between pcDNA 6.2-GW/EmGFP-miRsiRNA and pDONR-221 to generate the pENTR-221-siRNA vector. A LR recombination reaction between the generated pENTR-221-siRNA vector and pTRIPZ-Dest vector was then performed to create the pTRIPZ-siRNA vector used for lentiviral production. attB = attB recombination site. EmGFP = GFP gene. miR = microRNA-like sequence. attP = attP recombination site. attL = attL recombination site. attR = attR recombination site. TRE = tetracycline response element.  30  as miRNA. The insertion site also contains an upstream gene encoding for green fluorescent protein (GFP) which allows co-expression of both GFP and the siRNA resulting in the ability to track siRNA expression through GFP fluorescence. Once the pcDNA 6.2-GW/EmGFP-miRsiRNA vectors were generated they were used in a BP recombination reaction with pDONR-221 vector to create pENTR-221-siRNA vectors which contained attL recombination sites flanking the siRNA insert. These sites allowed for a LR recombination reaction to be performed with a pTRIPZ vector modified to contain attR recombination sites (pTRIPZ-Dest) to create pTRIPZsiRNA vectors. The pTRIPZ vector is a lentiviral vector and contains a tetracycline response element (TRE) which in the presence of tetracycline or doxocycline allows for the induced expression of the GFP-siRNA insert. Lentivirus was produced from the pTRIPZ-siRNA vectors and this was used to transduce the immortalized mouse macrophage cell line RAW264.7. After transduction, cells were drug selected in 3 g/mL puromycin for five days to allow for the death of any non-transduced cells. Drug selected cells were treated for 24 hours with 2 g/mL of doxocycline to induce GFP and siRNA expression and cells were then sorted for the highest GFP expressing cells (top 10%) as it was found that cells with high levels of GFP expression resulted in greater protein knockdown. This may be due to multiple insertions of the GFP-siRNA constructs into the host genome resulting in greater siRNA and GFP expression. The resulting cells became the SHIP1 siRNA, STAT3 siRNA and Scrambled siRNA transduced cell lines used in subsequent experiments. To determine the amount of protein knockdown by expression of the siRNA constructs, SHIP1 siRNA, STAT3 siRNA and Scrambled siRNA transduced cells were treated with 2 g/mL doxocycline for 0, 24 or 48 hours. Treatment of the STAT3 siRNA cells with doxocycline for longer periods of time (72 hours or more) resulted in decreased cell viability 31  based upon trypan blue exclusion staining. This suggests that cells cannot survive with prolonged knockdown of STAT3. Lysates from the siRNA transduced cells were analyzed by immunoblotting for SHIP1 and STAT3 protein as well as p38 MAPK as an endogenous control (Figure 3). It was found that induction of the SHIP1 siRNA resulted in approximately 70% reduction in SHIP1 protein levels compared to untreated cells after 48 hours of doxocycline treatment. However, expression of the STAT3 siRNA only resulted in a 50% reduction in STAT3 protein levels as compared to untreated cells. This modest degree of STAT3 knockdown makes it hard to rule out the ability for STAT3 to still function in STAT3 siRNA transduced cells and therefore any attempts to identify the individual role of STAT3 in the IL-10 AIR using this cell line would be subject to the criticism that STAT3 may still function in the cells. This is especially important as STAT3 is widely regarded as being necessary and sufficient for all of the effects of the IL-10 AIR. Therefore, without complete knockdown of STAT3 protein, the individual role of STAT3 in the IL-10 AIR could not be adequately probed using the STAT3 siRNA transduced cell line. 3.2 SHIP1 is required for IL-10 to dissociate TNFα mRNA from polysomes. IL-10 has previously been reported to dissociate TNFα mRNA from polysomes in activated mouse bone marrow derived macrophages (BMDMs) 26. To see if IL-10 has the same effect in RAW264.7 cells, small scale sucrose gradient fractionation of total cell lysates was used to fractionate RNA associated with monosomes and polysomes. To look specifically at TNFα mRNA in these fractions, RT-qPCR was used to measure the amount of TNFα mRNA in each fraction as described in Materials and Methods. In RAW264.7 cells stimulated with 1 ng/mL LPS for 60 minutes, the majority of TNFα mRNA was detected in the polysome associated fractions 8 and 9 as well as the monosome associated fraction 4 (Figure 4). However, in 32  Figure 3 Drug inducible knockdown of SHIP1 and STAT3 protein. (A) Immunoblot analysis of SHIP1 and STAT3 protein knockdown. SHIP1 siRNA, STAT3 siRNA or Scrambled siRNA transduced macrophages were treated with 2 g/mL doxocycline for 0, 24 or 48 hours. Cell lysates were prepared as described in Materials and Methods and analyzed by immunoblot for SHIP1, STAT3 and p38 protein levels. (B) Quantification of SHIP1 and STAT3 knockdown. Densitometry was performed using Odyssey 2.1 software on immunoblots to quantify the levels of SHIP1, STAT3 and p38 protein. Levels of SHIP1 or STAT3 protein were normalized to levels of p38 protein. Normalized values were then determined relative to siRNA transduced cells treated with 2 g/mL doxocycline for 0 hours. Results represent 3 independent experiments. P-values are based on a two tailed unpaired Students t-test with a confidence interval of 95%. 33  Figure 4 Polysome fractionation of RNA from RAW264.7, SHIP1 siRNA and Scrambled siRNA transduced cells. Cells treated for 48 hours with 2 g/mL doxocycline were stimulated with 1 ng/mL LPS for 45  minutes. IL-10 was then added to a final concentration of 100 ng/mL or not added and cells were stimulated for an additional 15 minutes. Cell lysates were then prepared and subjected to sucrose gradient fractionation and RT-qPCR analysis as described in Materials and Methods. Percent TNFα mRNA in each fraction was determined by taking the relative TNFα signal from each fraction as a percent of the sum of the TNFα mRNA signal from all 10 fractions. Fraction 1 indicates the top of the sucrose gradient. Results are representative of at least 2 independent experiments.  34  macrophages stimulated with 1 ng/mL LPS for 45 minutes and then treated with 100 ng/mL IL10 for 15 minutes, no TNFα mRNA was found associated with the polysomal fractions and there was a corresponding increase in the TNFα mRNA associated with monosomal fractions. This confirmed that IL-10 had the ability to dissociate TNFα mRNA away from polysomes in RAW264.7 macrophages. Importantly, this effect of IL-10 was rapid, occurring within 15 minutes of IL-10 stimulation. This shows that this is an early effect of IL-10 on macrophages which suggests STAT3 independence. Longer periods of IL-10 stimulation were not tested. To determine the potential contribution of SHIP1 to the IL-10 induced dissociation of TNFα mRNA from polysomes in activated macrophages, lysates from SHIP1 siRNA transduced cells treated for 48 hours with doxocycline to induce SHIP1 knockdown were analyzed by sucrose gradient fractionation as described for parental RAW264.7 cells. LPS stimulation of these knockdown cells once again led to association of TNFα mRNA with both polysomes and monosomes. However, when these cells were then stimulated with IL-10 it was found that IL-10 was no longer able to dissociate TNFα mRNA away from polysomes as indicated by the high level of TNFα mRNA associated with the polysome fraction (Figure 4). To ensure that the expression of the siRNA-GFP constructs within the macrophages was not the reason for IL-10’s inability to dissociate TNFα mRNA from polysomes, the same experiment was performed with lysates from Scrambled siRNA transduced cells treated with doxocycline for 48 hours. The ability for IL-10 to dissociate TNFα mRNA from polysomes was found to be fully functional in these Scrambled siRNA transduced cells as compared to Parental RAW 264.7cells (Figure 4). Taken together, these results demonstrate that IL-10 requires SHIP1 to induce the dissociation of TNFα mRNA from polysomes in LPS activated macrophages.  35  3.3 SHIP1 is required for early IL-10 inhibition of TNFα production in LPS activated macrophages A decrease in the association of a particular mRNA with polysomes diminishes the translational efficiency of that mRNA molecule. Therefore, a decrease in the amount of TNFα mRNA associated with polysomes in RAW264.7 macrophages should be reflected in decreased TNFα protein being produced and secreted by these cells. Since SHIP1 is required for the dissociation of TNFα mRNA from polysomes by IL-10, we expect that SHIP1 will also be required for the decrease in TNFα secretion in response to IL-10 treatment. To investigate this, RAW264.7, SHIP1 siRNA transduced cells and Scrambled siRNA transduced cells were treated with doxocycline for 48 hours to induce protein knockdown or were incubated without doxoxcycline treatment. Equal numbers of these cells were then stimulated with LPS ± IL-10 for one hour and cell supernatants were collected and analyzed for TNFα concentration by ELISA. This one hour time point was chosen as LPS induced TNFα production is only detectable by ELISA at time points of 30 minutes or later. In parental RAW264.7 cells and Scrambled siRNA transduced cells it was found that IL-10 inhibited TNFα production by approximately 15% and 30% respectively, and that treatment with doxocycline did not affect this inhibition by IL-10 (Figure 5). However, in SHIP1 siRNA transduced cells treated with doxocycline for 48 hours, IL-10 was only able to inhibit TNFα production by approximately 5%. This is in contrast to SHIP1 siRNA-transduced cells not treated with doxocycline where IL-10 was still capable of inhibiting TNFα production by about 25%. This finding indicates that IL-10 requires SHIP1 to inhibit TNFα production in activated macrophages early on in IL-10 stimulation and is also in agreement with experiments using SHIP-/- peritoneal macrophages (data unpublished). It also  36  Figure 5 IL-10 responsiveness in Parental RAW264.7, SHIP1 siRNA and Scrambled siRNA transduced cells. Cells treated with or without 2 g/mL doxocycline for 48 hours were stimulated with 1 ng/mL LPS or 1 ng/mL LPS and 15 ng/mL IL-10 for 1 hour. Cell supernatants were then collected and the concentration of TNFα in the supernantants was determined by ELISA. Percent inhibition TNFα was calculated by dividing the amount of TNFα produced in the presence of LPS + IL-10 by that produced in the presence of LPS alone. Each experiment was carried out in biological quadruplicates and results are based upon the average ± SEM of 6 independent experiments. Total average TNFα production ± SEM in response to LPS stimulation for Parental RAW264.7, Scrambled siRNA and SHIP1 siRNA transduced cells not treated with doxoxycline is 725 ± 197 pg/mL, 1074 ± 269 pg/mL and 734 ± 137 pg/mL respectively. Total average TNFα production ± SEM in response to LPS stimulation for Parental RAW264.7, Scrambled siRNA and SHIP1 siRNA transduced cells treated doxoxycline is 569 ± 154 pg/mL, 946 ± 251 pg/mL and 514 ± 80 pg/mL respectively. P-values are based upon two-way ANOVA analysis.  37  correlates with the requirement of SHIP1 by IL-10 to dissociate TNFα mRNA from polysomes suggesting that the decrease in early TNFα production by IL-10 is at least in part through a translational mechanism. The ability for IL-10 to inhibit TNF production in STAT3 siRNA transduced cell lines was not tested due to the modest level of STAT3 protein knockdown. 3.4 Inducible knockdown of Btk and TIA-1 Having determined that SHIP1 is required for IL-10 to induce the dissociation of TNFα mRNA from polysomes in LPS activated macrophages, the potential downstream target of SHIP1 in this response was next investigated. Four proteins were evaluated as potential SHIP1 downstream mediators: Btk, Tec, TIA-1 and TIAR. Btk and Tec are both known to be activated by LPS and Btk activity can enhance TNFα production in LPS stimulated macrophages through the p38 MAPK signalling pathway 49, the same pathway utilized by IL-10 to regulate TNFα mRNA association with polysomes 26. Additionally, SHIP1 is known to negatively regulate both Btk and Tec function 66. TIA-1 and the highly related TIAR silence the translation of TNFα mRNA, while TIA-1-/- macrophages display greatly enhanced TNFα mRNA association with polysomes 69. Therefore, SHIP1 may inhibit TNF production by inhibiting Btk/Tec activity. Alternatively, SHIP1 may affect association of TNF mRNA with polysomes through the activation of TIA-1/TIAR. To assess the specific function of these four proteins in the IL-10 response in macrophages, the same technique used to knockdown SHIP1 and STAT3 protein through drug inducible expression of siRNA was employed. For each target protein two siRNAs were generated to increase the chances of successful knockdown (Table 2). These siRNAs were used to generate siRNA transduced cell lines using the same technique as described with SHIP1, STAT3 and Scrambled siRNAs. The resulting cells lines were then analyzed by immunoblot for 38  Target TIA-1 Construct 3  TIA-1 Construct 4  TIAR Construct 1  TIAR Construct 5  Btk Construct 6  Btk Construct 8  Tec Construct 7  Tec Construct 9  Top Oligonucleotide  Bottom Oligonucleotide  5'TGCTGACAAGGTCCAATCTGGCTAAAGTTT TGGCCACTGACTGACTTTAGCCATTGGAC CTTGT-3' 5'TGCTGTTGAGGTGGTGGCACACTGTAGTTT TGGCCACTGACTGACTACAGTGTCACCAC CTCAA-3' 5'TGCTGAGAATAAGGACTTCTGTCACAGTTT TGGCCACTGACTGACTGTGACAGGTCCTT ATTCT-3' 5'TGCTGAATCCTTGTTGGTTCCACGGCGTTT TGGCCACTGACTGACGCCGTGGACAACA AGGATT-3' 5'TGCTGTTCACTAGACTCCTCACCTCTGTTTT GGCCACTGACTGACAGAGGTGAAGTCTA GTGAA-3' 5'TGCTGTGACAATGAAACCTCCTTCTTGTTTT GGCCACTGACTGACAAGAAGGATTTCATT GTCA-3' 5'TGCTGTAAAGGGAGACAGTGTACAAGGTT TTGGCCACTGACTGACCTTGTACAGTCTCC CTTTA-3' 5'TGCTGTTAGCTTCCTCTATGAAATCCGTTTT GGCCACTGACTGACGGATTTCAGAGGAA GCTAA-3'  5'CCTGACAAGGTCCAATGGCTAAAGTCAGT CAGTGGCCAAAACTTTAGCCAGATTGGAC CTTGTC-3' 5'CCTGTTGAGGTGGTGACACTGTAGTCAGT CAGTGGCCAAAACTACAGTGTGCCACCAC CTCAAC-3' 5'CCTGAGAATAAGGACCTGTCACAGTCAGT CAGTGGCCAAAACTGTGACAGAAGTCCTT ATTCTC-3' 5'CCTGAATCCTTGTTGTCCACGGCGTCAGTC AGTGGCCAAAACGCCGTGGAACCAACAA GGATTC-3' 5'CCTGTTCACTAGACTTCACCTCTGTCAGTC AGTGGCCAAAACAGAGGTGAGGAGTCTA GTGAAC-3' 5'CCTGTGACAATGAAATCCTTCTTGTCAGTC AGTGGCCAAAACAAGAAGGAGGTTTCATT GTCAC-3' 5'CCTGTAAAGGGAGACTGTACAAGGTCAGT CAGTGGCCAAAACCTTGTACACTGTCTCC CTTTAC-3' 5'CCTGTTAGCTTCCTCTGAAATCCGTCAGTC AGTGGCCAAAACGGATTTCATAGAGGAA GCTAAC-3'  Table 2 siRNA Oligonucleotides targeting TIA-1, TIAR, Btk or Tec. The sequences of oligonucleotides used to generate TIA-1, TIAR, Btk or Tec targeting siRNAs.  39  their ability to knockdown target protein after 24 and 48 hours of doxocycline induction of the siRNAs. For Btk, both siRNAs targeting Btk (Construct 6 and Construct 8) produced substantial decreases in Btk protein levels after 48 hours of doxocycline treatment (22% and 27% of normal levels respectively) (Figure 6). However, neither of the two siRNAs targeting Tec (Construct 7 and Construct 9) were capable of decreasing Tec protein levels. This lack of knockdown was also found with the siRNA constructs targeting TIA-1 (Construct 3 and Construct 4). For TIAR it was found that expression of either construct (Construct 1 and Construct 5) did not reduce the levels of TIAR protein. Surprisingly though, expression of the TIAR siRNAs did result in a substantial decrease in TIA-1 protein levels after 48 hours of doxocycline treatment (15% and 20% of normal levels for Construct 1 and Construct 5 respectively) (Figure 6). The ability for the siRNA targeting TIAR to knockdown TIA-1 can be rationalized in two ways. First, TIAR and TIA-1 mRNA are highly similar in sequence, and in the specific regions where the two siRNAs targeting TIAR target TIAR, the similarity between TIAR and TIA-1 is nearly 100% (Figure 7). Additionally, miRNAs are often bind without 100% sequence complementarity between the miRNA and the target mRNA molecule. This mismatch would allow siRNAs targeting one mRNA to also target mRNA molecules that are highly homologous, such as in the case of TIAR and TIA-1. 3.5 Btk but not TIA-1 is required for IL-10 to inhibit TNFα production in LPS activated macrophages To investigate the potential contribution of Btk and TIA-1 to the IL-10 AIR response in macrophages, the ability for IL-10 to inhibit TNFα production in LPS-stimulated cells lacking Btk or TIA-1 protein was determined. Cells transduced with Btk siRNA or TIAR siRNA were treated with doxocycline for 48 hours to induce knockdown and then equal numbers of cells 40  41  Figure 6 Drug inducible knockdown of Btk and TIA-1 protein. Immunoblot analysis and corresponding denistometrical analysis of Btk (A), Tec(B), TIA-1 (C) TIAR (D), or Scrambled siRNA transduced macrophages were treated with 2 g/mL doxocycline for 0 24 or 48 hours. Cell lysates were prepared as described in Materials and Methods and analyzed by immunoblot for Btk, Tec, TIA-1, TIA-R, p38 or STAT3 protein levels. Densitometry was performed using Odyssey 2.1 software on immunoblots to quantify the levels of Btk, Tec, TIA-1, TIAR, p38 or STAT3 protein. Levels of Btk and Tec protein were normalized to levels of p38 protein while levels of TIA-1 and TIA-R were normalized to levels of STAT3 protein. Normalized values were then determined relative to siRNA transduced cells treated with 2 g/mL doxocycline for 0 hours. Results represent 3 independent experiments. P-values are based on a two tailed unpaired students t-test with a confidence interval of 95%.  42  Figure 7 Sequence alignment between TIAR siRNA and TIA-1 and TIAR mRNA. Multiple sequence alignments were performed between TIA-1 and TIAR mRNA sequences as well as the mRNA targeting region of the TIAR siRNA Construct 1 or Construct 5. An * indicates 100% match between siRNA sequence, TIA-1 mRNA and TIAR mRNA. Sequence alignment was performed using ClustalW2 software.  43  were stimulated with LPS or co-stimulated with LPS and IL-10 for one hour, and the amount of TNFα produced in the cell supernatants was measured by ELISA. It was found that in cells lacking TIA-1, IL-10 was still able to inhibit TNFα production as effectively as in TIAR siRNA transduced cells not treated with doxocycline (Figure 8). This indicates that IL-10 does not use TIA-1 to inhibit TNFα production in the early phase of the IL-10 AIR in activated macrophages. Surprisingly, in Btk siRNA transduced cells treated with doxocycline for 48 hours, IL-10 was not able to inhibit TNFα production as compared to cells not treated with doxoxycline (Figure 8). This indicates that IL-10 requires Btk to inhibit TNFα production during the early (1 hour) response to IL-10 treatment of activated macrophages. Importantly, this effect was observed for both Btk-targeting siRNAs reducing the possibility that this effect was due to reducing the level of an off-target protein involved in the IL-10 AIR by the siRNAs targeting Btk. Taken altogether, this data demonstrates that Btk but not TIA-1 is required for IL-10 to inhibit TNFα production in LPS activated macrophages. 3.6 Btk is not required for IL-10 to dissociate TNFα mRNA from polysomes The impaired ability of IL-10 to inhibit TNFα production in doxocycline treated Btk siRNA transduced cells was very similar to what was found with doxocycline treated SHIP1 siRNA transduced cells (Figure 9). As IL-10 utilizes SHIP1 to dissociate TNFα mRNA from polysomes in activated macrophages, we asked whether IL-10 might also require Btk for this process. To investigate this, small scale sucrose gradient fractionation was performed on Btk siRNA transduced cells as previously described for SHIP1 siRNA transduced cells. It was found that in Btk siRNA transduced cells treated for 48 hours with doxocycline to induce Btk knockdown, IL-10 was still able to dissociate TNFα mRNA from polysomes (Figure 9). This demonstrates that IL-10 does not require Btk to dissociate TNFα mRNA from polysomes and 44  Figure 8 IL-10 responsiveness in Btk and TIAR siRNA transduced cell. Cells treated with or without 2 g/mL doxocycline for 48 hours were stimulated with 1 ng/mL LPS or 1 ng/mL LPS and 10 ng/mL IL-10 for 1 hour. Cell supernatants were then collected and the concentration of TNFα in the supernantants was determined by ELISA. Percent inhibition TNFα was calculated by dividing the amount of TNFα produced in the presence of LPS + IL-10 by that produced in the presence of LPS alone. Each experiment was carried out in biological quadruplicates and results are based upon the average ± SEM of 6 independent experiments. Total average TNFα production ± SEM in response to LPS stimulation for Parental RAW264.7, Scrambled, Construct 6, Construct 8, Construct 1, Construct 5 and SHIP1 siRNA transduced cells not treated with doxocycline is 725 ± 197 pg/mL, 1074 ± 269 pg/mL, 834 ± 156 pg/mL, 724 ± 201 pg/mL, 780 ± 127 pg/mL, 826 ± 59 pg/mL and 734 ± 137 pg/mL respectively. Total average TNFα production ± SEM in response to LPS stimulation for Parental RAW264.7, Scrambled, Construct 6, Construct 8, Construct 1, Construct 5 and SHIP1 siRNA transduced cells treated with doxocycline is 569 ± 154 pg/mL, 946 ± 251 pg/mL, 579 ± 58 pg/mL, 523 ± 80 pg/mL, 691 ± 267 pg/mL, 741 ± 100 pg/mL and 514 ± 80 pg/mL respectively. P-values are based upon two-way ANOVA analysis.  45  Figure 9 Polysome fractionation of RNA from Btk siRNA transduced cells. Cells transduced with Btk siRNA Construct 8 were treated for 48 hours with 2 g/mL doxocycline and then stimulated with 1 ng/mL LPS for 45 minutes. IL-10 was then added to a final concentration of 100 ng/mL or not added and cells were stimulated for an additional 15 minutes. Cell lysates were then prepared and subjected to sucrose gradient fractionation and RT-qPCR analysis as described in Materials and Methods. Percent TNFα mRNA in each fraction was determined by taking the relative TNFα signal from each fraction as a percent of the sum of the TNFα mRNA signal from all 10 fractions. Fraction 1 indicates the top of the sucrose gradient. Results are representative of 2 independent experiments.  46  that the function of Btk in the IL-10-induced inhibition of TNFα production likely does not involve the translational regulation of TNFα mRNA. Instead Btk may regulate transcription of TNF mRNA, TNF mRNA stability or TNF protein secretion in order to inhibit TNF production. 3.7 Btk knockdown does not alter early LPS induced TNFα production in macrophages IL-10’s requirement of Btk for the inhibited production of TNFα in LPS-stimulated macrophages was surprising as this indicated that Btk is a negative regulator of TNFα production even though most research has found that Btk is a positive regulator of TNFα production 49-52. This made us curious as to whether or not Btk is required for the production of TNFα in LPS stimulated macrophages. To determine this, Btk siRNA transduced cells were treated with doxocycline for 48 hours to induce knockdown of Btk. Cells were then stimulated with 1 ng/mL of LPS alone for one hour and the amount of TNFα produced by the cells was measured by ELISA. We found that cells lacking Btk produced the same amount of TNFα in response to LPS as compared to Btk siRNA transduced cells not treated with doxocycline (Figure 10). This indicates that Btk is not required for TNFα production during the first hour of LPS stimulation in RAW264.7 macrophages.  47  Figure 10 LPS induced TNFα production in Btk siRNA transduced cells. Parental RAW264.7, Scrambled siRNA or Btk siRNA transduced cells were treated with or without 2 g/mL doxocycline for 48 hours. Cells were then stimulated with 1 ng/mL LPS for 60 minutes and cell supernatants were analyzed for TNFα concentration by ELISA. Each experiment was carried out in biological quadruplicates and error bars represent the deviation between these quadruplicates. Two-way ANOVA analysis was performed between cells treated with doxocycline and those not treated for each cell type. Results are representative of 5 independent experiments.  48  4 Discussion 4.1 The role of SHIP1 in the IL-10 AIR The discovery that SHIP1 is required for IL-10 to promote the dissociation of TNFα mRNA from polysomes in activated macrophages is important for a number of reasons. First, the role of SHIP1 in the inhibition of TNFα production further supports the notion that SHIP1 is a negative regulator of TNFα production. Second, as SHIP1 is a negative regulator of PI3K signalling, the inhibition of TNFα production by SHIP1 suggests that PI3K is a positive regulator of TNFα production. This is important as there is still much debate as to whether or not PI3K is a positive or negative regulator of LPS-induced TNFα production in macrophages 94. Likewise, this also helps to clarify the effect of IL-10 stimulation of macrophages on the PI3K pathway, suggesting that IL-10 inhibits PI3K signalling in activated macrophages. This could be confirmed by looking at downstream targets of PI3K such as Akt phosphorylation in response to IL-10 stimulation. Third, the finding that IL-10 uses SHIP1 to inhibit TNFα production in the early AIR strongly suggests the use of a STAT3-independent pathway by IL-10 in the AIR. The use of SHIP1 by IL-10, taken together with previous findings indicating STAT3-independent IL10 signalling pathways 26, 95 provides strong evidence that the dogma that IL-10 signalling acts only through STAT3 is incorrect. This is not necessarily surprising as it is known that both IL10 and the pro-inflammatory cytokine IL-6 signal in macrophages by activating STAT3 96. Therefore, the outcome of STAT3 activity in response to these two cytokines could be based at least in part upon non-STAT3 alternate pathways activated by IL-6 and IL-10. Alternatively, the timing or strength of STAT3 activity could account for the differences in IL-6 and IL-10 signalling. Finally, involvement of SHIP1 in the IL-10 AIR also supports the recent finding that  49  IL-10 stimulation of macrophages reduces miR-155 levels leading to increased SHIP1 levels41 as signalling molecules often upregulate the expression of their downstream effectors 97. Although SHIP1 is required to dissociate TNFα mRNA from polysomes in activated macrophages, it is still not clear how SHIP1 accomplishes this. TIA-1, one potential downstream target of SHIP1 in this response, was found not to be required for IL-10 to inhibit TNFα production in LPS activated macrophages indicating that TIA-1 is not the target of SHIP1. Interestingly Btk, another potential downstream target of SHIP1, was found to be required for IL-10 to inhibit TNFα production in LPS activated macrophages. However, it was found that Btk had no effect on TNFα mRNA association with polysomes in response to IL-10, demonstrating that Btk is not the target of SHIP1 in the IL-10 induced dissociation of TNFα mRNA from polysomes. As the knockdown of Tec and TIAR was not successful, these two proteins remain potential downstream targets of SHIP1 in the IL-10 AIR. The use of Tec-/- and TIAR-/- mice may allow an alternative means of investigating these proteins as a downstream target of SHIP1 in the IL-10 AIR. Also, since it is known that the IL-10-induced dissociation of TNFα mRNA from polysomes is dependent upon the p38 MAPK pathway 26, it is likely that the protein that SHIP1 modulates will be involved in p38 signalling. This notion is further supported by unpublished data from our lab indicating that IL-10 inhibits p38 MAPK in a SHIP1 dependent manner. One interesting question raised by the involvement of SHIP1 in the IL-10 AIR is how IL10 activates SHIP1. Like STAT3, SHIP1 contains an SH2 domain, so it is possible that SHIP1 could be recruited to the active IL-10 receptor complex through the binding of its SH2 domain to the phosphorylated tyrosine residues on IL-10R1. This question could be addressed through IL10 receptor immunoprecipitation experiments or through the use of in silico protein interaction 50  prediction 98. Alternatively, SHIP1 may be recruited to the IL-10 receptor through adaptor proteins that are known to interact with SHIP1 such as Shc 34. If this is the case, then the knockdown of the adaptor protein involved in SHIP1 recruitment should yield a similar phenotype to SHIP1 knockdown in the IL-10 response. 4.2 Btk as a negative regulator of TNFα production The finding that IL-10 requires Btk to inhibit TNFα production in LPS activated macrophages is surprising as it suggests that Btk is a negative regulator of TNFα production. This is contrary to many published papers which suggest that Btk is required for optimal TNFα production in macrophages in response to LPS 48-52, 55. However, there is evidence to support a role for Btk in IL-10 signalling as it was found that B-cells from xid mice, a strain of mice with a naturally occurring mutation in Btk, were unresponsive to IL-10 stimulation and failed to upregulate MHC class II expression99. Some phenotypes associated with xid and XLA, a human disease based on mutations in Btk, also might suggest an involvement of Btk in IL-10 signalling. XLA patients frequently develop rheumatoid arthritis and type I diabetes mellitus100, 101. While this has been interpreted as a consequence of hyperactive TH1 responses in XLA patients, this could also be interpreted as a deficiency in IL-10 response as IL-10-/- mice also have increased incidence of rheumatoid arthritis and diabetes mellitus 102, 103. Studies using T-cell depletion in xid mice might reveal whether the increased rates of autoimmune disease in these mice are in fact caused by a TH1 response. While the data presented here clearly demonstrate a role for Btk in IL-10 signalling, how Btk helps to inhibit TNFα production remains unknown. Since the loss of Btk had no effect on the ability of IL-10 to dissociate TNFα mRNA from polysomes it seems likely that Btk does not affect TNFα production by regulating TNFα mRNA translation. Instead, Btk may affect the 51  transcription of TNFα mRNA or possibly the stability of TNFα mRNA. Both of these possibilities will need to be investigated. The possible effect of Btk on TNF mRNA stability could be determined through actinomycin D mRNA stability experiments. The downstream target of Btk activity in the IL-10 inhibition of TNFα production in activated macrophages also remains elusive. In the context of BCR signalling, Btk is responsible for the activation of PLC and Protein Kinase C (PKC). While PLC is known to be a positive regulator of TNFα production in macrophages 104, activation of both PKC and PKC have been shown to lead to decreased TNFα mRNA levels by increasing the levels of tristetraprolin (TTP), a protein which binds to and destabilizes TNFα mRNA 105, 106. This raises the possibility that activation of PKCmight be how Btk can suppress TNFα production in response to IL-10. Interestingly, PKC-/- mice have a very similar phenotype to xid mice with a severe reduction of circulating Bcells 107, highlighting the close connection between Btk activity and PKC activity. Another puzzling question raised by the requirement of Btk in the IL-10 AIR is how IL10 receptor engagement can lead to the activation of Btk. Since PI3K signalling is generally required for Btk activation 43, 44, 60, the finding that IL-10 utilizes the PI3K antagonist SHIP1 and previous research which has shown that IL-10 inhibits PI3K signalling 108, suggest that Btk must be recruited to the membrane and activated in a PI3K independent manner. In BCR and TCR signalling Btk is recruited to the receptor complex through protein interactions with BLNK/SLP65 in B-cells and LAT and SLP-76 in T-cells 109, 110. Interestingly mouse macrophages express both BLNK/SLP-65 and SLP-76 57, raising the possibility that these proteins are responsible for recruiting Btk to the activated IL-10 receptor. Recently it has been found that in osteoclasts Btk does form a complex with BLNK and SLP-76 111 during Receptor Activator for Nuclear Factor κB Ligand (RANKL) signalling. 52  4.3 Requirement of Btk in TNFα production Another interesting finding was that the loss of Btk did not affect TNFα production in LPS stimulated RAW264.7 macrophages. This goes against previous research which indicates that Btk is a positive regulator of TNFα production and is required for the LPS induced production of TNFα 48-51. However, all of the studies reporting Btk to be required for LPS induced TNFα production have only examined TNFα production in the late stages of LPS stimulation (18 hours or later). The research presented here examined TNFα production in the early stages of LPS production (1 hour) and found no requirement for Btk in LPS induced TNFα production in macrophages. This might suggest that Btk is only required for LPS induced TNFα production at late timepoints, and that early on in the LPS stimulation of macrophages Btk is dispensible. This may not be surprising as one of the key molecules that is known to be regulated by Btk in LPS-TLR4 signalling is Mal, a protein which likely acts in the late stages of LPS signalling 112. The notion that Btk is not involved in early LPS-induced TNFα production is further supported by the finding that early LPS induced activation of MAPKs was the same in wildtype human monocytes and XLA monocytes 113. Similar results were found in bone marrow derived mast cells from xid mice 114. Another factor to consider when looking at the role of Btk in LPS induced TNFα production in macrophages is that Btk is required for the induction by TLR4 of IL-10 production in macrophages 115. This makes it hard to rule out the contribution of autocrine IL-10 effects in the phenotype of Btk deficient macrophages. Overall it seems that Btk may only be required for TNFα production in the late stages of LPS signalling, however further research will need to be done to confirm this.  53  4.4 Overall IL-10 response The research presented here has further clarified how IL-10 signals and mediates the AIR in activated macrophages. The identification of SHIP1 and Btk as being required for IL-10 to inhibit TNFα production in macrophages clearly demonstrates that IL-10 uses signalling pathways in addition to STAT3 in the AIR. Interestingly, the loss of both SHIP1 and Btk affected the ability for IL-10 to inhibit TNFα production in the early phase of IL-10 stimulation suggesting that these two proteins are important in early IL-10 induced TNFα inhibition. As STAT3 function in the IL-10 AIR requires the transcription and translation of target genes, a process which takes time to occur, it may be that SHIP1 and Btk function to repress TNFα production when STAT3-dependent transcription and translation is occurring. In this way, IL-10 can rapidly inhibit TNFα production through SHIP1 and Btk before STAT3 function kicks in and the AIR is fully implemented. The idea that STAT3 independent pathways function in the early IL-10 response is supported by the finding that expression of a STAT3 dominant negative isoform in LPS-stimulated monocytes impaired the IL-10 inhibition of TNFα production only after two hours of IL-10 treatment while the effects of IL-10 in the first hour of stimulation were not impaired 95. As inflammation can accelerate rapidly 1, this rapid SHIP1 and Btk-dependent decrease in TNFα production may be physiologically important for slowing down the initial inflammatory response before it becomes overwhelming. The overall results of this research allow us to better understand how IL-10 signalling occurs in activated macrophages. Upon IL-10 receptor dimerization, SHIP1 is quickly recruited to the receptor complex, possibly through binding of its SH2 domain to the phosphorylated tyrosine resides on the IL-10R1 subunit. SHIP1 function at the membrane then leads to the dissociation of TNFα mRNA from polysomes possibly by inhibiting p38 MAPK, and this leads 54  to decreased TNFα translation and production (Figure 11). At the same time, IL-10 also activates Btk, perhaps through recruitment of the adaptor proteins BLNK/SLP-65 or SLP-76. Activated Btk then attenuates TNFα production, possibly through PKC induced TNFα mRNA destabalization by TTP. This combination of SHIP1 and Btk function leads to a rapid decrease in TNFα production. Meanwhile, STAT3 is activated by the IL-10 receptor complex and its Janus associated kinases and translocates to the nucleus where it regulates the transcription of gene targets such as SOCS3, which once translated, completely inhibit TNFα production and deactivate the macrophage. 4.5 Future directions The research here has identified novel roles for both SHIP1 and Btk in the IL-10 AIR. While both of these proteins are required for IL-10 to inhibit early TNFα production, the downstream protein targets of SHIP1 and Btk in this response still need to be elucidated. As SHIP1 is required for IL-10 to dissociate TNFα mRNA from polysomes, a function regulated by the p38 MAPK pathway, it is likely that the downstream target of SHIP1 is involved in p38 MAPK signalling. Btk on the other hand is not involved in TNFα mRNA dissociation from polysomes suggesting that Btk inhibits TNFα production through non-translational mechanisms such as TNFα transcription, mRNA stability or secretion. Further studies will need to be done to determine at what level Btk inhibits the production of TNFα in macrophages. Although the research here demonstrates a clear requirement for SHIP1 and Btk in the IL-10 AIR, the independence of STAT3 in the AIR remains unclear. Both Btk and SHIP1 are required for IL-10 to inhibit TNFα production in LPS-activated macrophages as early as one  55  Figure 11 Proposed model of IL-10 signalling in macrophages. IL-10 receptor engagement and activation leads to three separate signalling pathways which help to inhibit TNFα production. (1) SHIP1 is recruited from the cytosol to the activated IL-10 receptor complex through its SH2 domain where it becomes phosphorylated and activated. Activated SHIP1 then inhibits the p38 MAPK pathway leading to the dissociation of TNFα mRNA from polysomes resulting in decreased translation of TNFα. (2) Btk is recruited to the IL-10 receptor complex by binding to the adaptor protein SLP-76 or BLNK. Once at the receptor Btk is phosphorylated on its active site leading to Btk kinase activation. Activated Btk then inhibits TNFα production by promoting the degradation of TNFα mRNA. (3) STAT3 is recruited to the activated IL-10 receptor by its SH2 domain binding to phosphorylated residues on the IL-10R1 subunit. STAT3 is then phosphorylated by the receptor associated Janus kinases Jak1 and Tyk2 leading to disengagement of STAT3 from the receptor. Phosphorylated STAT3 then homodimerizes and translocates to the nucleus where it controls the transcription of various gene targets which mediate the late stages of the AIR.  56  hour after IL-10 stimulation and SHIP1 is required for IL-10 to dissociate TNFα mRNA from polysomes, a function that occurs within 15 minutes after IL-10 stimulation. These early responses involving SHIP1 and Btk suggest STAT3 independence but cannot formally rule out a non-transcriptional role for STAT3 in the early IL-10 AIR. This will only be achieved after examining cells in which STAT3 is inducibly knocked down. Finally, the exact role of Btk in the LPS induced production of TNFα must be further examined in order to determine definitely if Btk is required for TNFα production and at what stage, if any, in the LPS response is Btk required. 4.6 Conclusion The results of the research presented here further our understanding of IL-10 signalling in cells and of the IL-10 AIR. A novel role for both SHIP1 and Btk in the IL-10 AIR has been found with both proteins being required for IL-10 to inhibit TNFα production in the early AIR. SHIP1 has been found to be required for IL-10 to induce the dissociation of TNFα mRNA from polysomes and to decrease TNFα production by activated macrophages. Btk, on the other hand, does not regulate TNFα mRNA association with polysomes, suggesting that Btk regulates TNFα production through a non-translational mechanism. The role of Btk in LPS-induced TNFα production in macrophages has also been further clarified with the finding that Btk is dispensable for TNFα production in early LPS-TLR4 signalling. Finally, it has also been found that the small RNA binding protein TIA-1 is not involved in the IL-10 AIR. Taken together these results help to clarify how IL-10 functions in activated macrophages and identifies SHIP1 and Btk as protein targets for inhibiting TNFα production in the body. Btk and SHIP1 activators might also be used to mimic the anti-inflammatory effects of IL-10, an application that would aide in the treatment of many inflammatory diseases and disorders. 57  References 1.  Nathan, C. Points of control in inflammation. Nature 420, 846-52 (2002).  2.  Medzhitov, R. Origin and physiological roles of inflammation. Nature 454, 428-35 (2008).  3.  Bunting, M., Harris, E.S., McIntyre, T.M., Prescott, S.M. & Zimmerman, G.A. Leukocyte adhesion deficiency syndromes: adhesion and tethering defects involving beta 2 integrins and selectin ligands. Curr Opin Hematol 9, 30-5 (2002).  4.  Ashcroft, G.S., Lei, K., Jin, W., Longenecker, G., Kulkarni, A.B., Greenwell-Wild, T., HaleDonze, H., McGrady, G., Song, X.Y. & Wahl, S.M. Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound healing. Nat Med 6, 1147-53 (2000).  5.  Vignali, D.A., Collison, L.W. & Workman, C.J. How regulatory T cells work. Nat Rev Immunol 8, 523-32 (2008).  6.  DiLillo, D.J., Matsushita, T. & Tedder, T.F. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Ann N Y Acad Sci 1183, 38-57.  7.  Libby, P., Okamoto, Y., Rocha, V.Z. & Folco, E. Inflammation in atherosclerosis: transition from theory to practice. Circ J 74, 213-20.  8.  Fiorentino, D.F., Bond, M.W. & Mosmann, T.R. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med 170, 2081-95 (1989).  9.  Kim, J.M., Brannan, C.I., Copeland, N.G., Jenkins, N.A., Khan, T.A. & Moore, K.W. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J Immunol 148, 3618-23 (1992).  10.  Pestka, S., Krause, C.D., Sarkar, D., Walter, M.R., Shi, Y. & Fisher, P.B. Interleukin-10 and related cytokines and receptors. Annu Rev Immunol 22, 929-79 (2004).  11.  Donnelly, R.P., Dickensheets, H. & Finbloom, D.S. The interleukin-10 signal transduction pathway and regulation of gene expression in mononuclear phagocytes. J Interferon Cytokine Res 19, 563-73 (1999).  12.  Mosser, D.M. & Zhang, X. Interleukin-10: new perspectives on an old cytokine. Immunol Rev 226, 205-18 (2008).  13.  Kotenko, S.V., Krause, C.D., Izotova, L.S., Pollack, B.P., Wu, W. & Pestka, S. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. Embo J 16, 5894-903 (1997).  14.  Lai, C.F., Ripperger, J., Morella, K.K., Jurlander, J., Hawley, T.S., Carson, W.E., Kordula, T., Caligiuri, M.A., Hawley, R.G., Fey, G.H. & Baumann, H. Receptors for interleukin (IL)-10 and 58  IL-6-type cytokines use similar signaling mechanisms for inducing transcription through IL-6 response elements. J Biol Chem 271, 13968-75 (1996). 15.  Weber-Nordt, R.M., Riley, J.K., Greenlund, A.C., Moore, K.W., Darnell, J.E. & Schreiber, R.D. Stat3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J Biol Chem 271, 27954-61 (1996).  16.  de Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C.G. & de Vries, J.E. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174, 1209-20 (1991).  17.  Ding, L., Linsley, P.S., Huang, L.Y., Germain, R.N. & Shevach, E.M. IL-10 inhibits macrophage costimulatory activity by selectively inhibiting the up-regulation of B7 expression. J Immunol 151, 1224-34 (1993).  18.  Willems, F., Marchant, A., Delville, J.P., Gerard, C., Delvaux, A., Velu, T., de Boer, M. & Goldman, M. Interleukin-10 inhibits B7 and intercellular adhesion molecule-1 expression on human monocytes. Eur J Immunol 24, 1007-9 (1994).  19.  Niiro, H., Otsuka, T., Kuga, S., Nemoto, Y., Abe, M., Hara, N., Nakano, T., Ogo, T. & Niho, Y. IL-10 inhibits prostaglandin E2 production by lipopolysaccharide-stimulated monocytes. Int Immunol 6, 661-4 (1994).  20.  Bogdan, C., Vodovotz, Y. & Nathan, C. Macrophage deactivation by interleukin 10. J Exp Med 174, 1549-55 (1991).  21.  Jenkins, J.K., Malyak, M. & Arend, W.P. The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 beta production in human monocytes and neutrophils. Lymphokine Cytokine Res 13, 47-54 (1994).  22.  Dickensheets, H.L., Freeman, S.L., Smith, M.F. & Donnelly, R.P. Interleukin-10 upregulates tumor necrosis factor receptor type-II (p75) gene expression in endotoxin-stimulated human monocytes. Blood 90, 4162-71 (1997).  23.  Howard, M., Muchamuel, T., Andrade, S. & Menon, S. Interleukin 10 protects mice from lethal endotoxemia. J Exp Med 177, 1205-8 (1993).  24.  Williams, L.M., Ricchetti, G., Sarma, U., Smallie, T. & Foxwell, B.M. Interleukin-10 suppression of myeloid cell activation--a continuing puzzle. Immunology 113, 281-92 (2004).  25.  Kim, Y.H., Lim, D.G., Wee, Y.M., Kim, J.H., Yun, C.O., Choi, M.Y., Park, Y.H., Kim, S.C. & Han, D.J. Viral IL-10 gene transfer prolongs rat islet allograft survival. Cell Transplant 17, 60918 (2008).  59  26.  Kontoyiannis, D., Kotlyarov, A., Carballo, E., Alexopoulou, L., Blackshear, P.J., Gaestel, M., Davis, R., Flavell, R. & Kollias, G. Interleukin-10 targets p38 MAPK to modulate AREdependent TNF mRNA translation and limit intestinal pathology. Embo J 20, 3760-70 (2001).  27.  Yin, M.J., Yamamoto, Y. & Gaynor, R.B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature 396, 77-80 (1998).  28.  Schottelius, A.J., Mayo, M.W., Sartor, R.B. & Baldwin, A.S., Jr. Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB DNA binding. J Biol Chem 274, 31868-74 (1999).  29.  Mosser, D.M. & Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8, 958-69 (2008).  30.  Gordon, S. Alternative activation of macrophages. Nat Rev Immunol 3, 23-35 (2003).  31.  Pollard, J.W. Trophic macrophages in development and disease. Nat Rev Immunol 9, 259-70 (2009).  32.  Akira, S. & Takeda, K. Toll-like receptor signalling. Nat Rev Immunol 4, 499-511 (2004).  33.  Slack, J.L., Schooley, K., Bonnert, T.P., Mitcham, J.L., Qwarnstrom, E.E., Sims, J.E. & Dower, S.K. Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways. J Biol Chem 275, 4670-8 (2000).  34.  Rauh, M.J., Sly, L.M., Kalesnikoff, J., Hughes, M.R., Cao, L.P., Lam, V. & Krystal, G. The role of SHIP1 in macrophage programming and activation. Biochem Soc Trans 32, 785-8 (2004).  35.  Gratacap, M.P., Severin, S., Chicanne, G., Plantavid, M. & Payrastre, B. Different roles of SHIP1 according to the cell context: the example of blood platelets. Adv Enzyme Regul 48, 240-52 (2008).  36.  Nishio, M., Watanabe, K., Sasaki, J., Taya, C., Takasuga, S., Iizuka, R., Balla, T., Yamazaki, M., Watanabe, H., Itoh, R., Kuroda, S., Horie, Y., Forster, I., Mak, T.W., Yonekawa, H., Penninger, J.M., Kanaho, Y., Suzuki, A. & Sasaki, T. Control of cell polarity and motility by the PtdIns(3,4,5)P3 phosphatase SHIP1. Nat Cell Biol 9, 36-44 (2007).  37.  Wang, J.W., Howson, J.M., Ghansah, T., Desponts, C., Ninos, J.M., May, S.L., Nguyen, K.H., Toyama-Sorimachi, N. & Kerr, W.G. Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation. Science 295, 2094-7 (2002).  38.  Baran, C.P., Tridandapani, S., Helgason, C.D., Humphries, R.K., Krystal, G. & Marsh, C.B. The inositol 5'-phosphatase SHIP-1 and the Src kinase Lyn negatively regulate macrophage colonystimulating factor-induced Akt activity. J Biol Chem 278, 38628-36 (2003).  60  39.  Martelli, A.M., Chiarini, F., Evangelisti, C., Grimaldi, C., Ognibene, A., Manzoli, L., Billi, A.M. & McCubrey, J.A. The phosphatidylinositol 3-kinase/AKT/mammalian target of rapamycin signaling network and the control of normal myelopoiesis. Histol Histopathol 25, 669-80.  40.  Ong, C.J., Ming-Lum, A., Nodwell, M., Ghanipour, A., Yang, L., Williams, D.E., Kim, J., Demirjian, L., Qasimi, P., Ruschmann, J., Cao, L.P., Ma, K., Chung, S.W., Duronio, V., Andersen, R.J., Krystal, G. & Mui, A.L. Small-molecule agonists of SHIP1 inhibit the phosphoinositide 3-kinase pathway in hematopoietic cells. Blood 110, 1942-9 (2007).  41.  McCoy, C.E., Sheedy, F.J., Qualls, J.E., Doyle, S.L., Quinn, S.R., Murray, P.J. & O'Neill, L.A. IL-10 inhibits miR-155 induction by Toll-like receptors. J Biol Chem.  42.  Schwartzberg, P.L., Finkelstein, L.D. & Readinger, J.A. TEC-family kinases: regulators of Thelper-cell differentiation. Nat Rev Immunol 5, 284-95 (2005).  43.  Smith, C.I., Islam, T.C., Mattsson, P.T., Mohamed, A.J., Nore, B.F. & Vihinen, M. The Tec family of cytoplasmic tyrosine kinases: mammalian Btk, Bmx, Itk, Tec, Txk and homologs in other species. Bioessays 23, 436-46 (2001).  44.  Jefferies, C.A. & O'Neill, L.A. Bruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? Immunol Lett 92, 15-22 (2004).  45.  Tsukada, S. & Witte, O.N. X-linked agammaglobulinemia and Bruton's tyrosine kinase. Adv Exp Med Biol 365, 233-8 (1994).  46.  Bradley, L.A., Sweatman, A.K., Lovering, R.C., Jones, A.M., Morgan, G., Levinsky, R.J. & Kinnon, C. Mutation detection in the X-linked agammaglobulinemia gene, BTK, using single strand conformation polymorphism analysis. Hum Mol Genet 3, 79-83 (1994).  47.  Finkelstein, L.D. & Schwartzberg, P.L. Tec kinases: shaping T-cell activation through actin. Trends Cell Biol 14, 443-51 (2004).  48.  Mangla, A., Khare, A., Vineeth, V., Panday, N.N., Mukhopadhyay, A., Ravindran, B., Bal, V., George, A. & Rath, S. Pleiotropic consequences of Bruton tyrosine kinase deficiency in myeloid lineages lead to poor inflammatory responses. Blood 104, 1191-7 (2004).  49.  Horwood, N.J., Mahon, T., McDaid, J.P., Campbell, J., Mano, H., Brennan, F.M., Webster, D. & Foxwell, B.M. Bruton's tyrosine kinase is required for lipopolysaccharide-induced tumor necrosis factor alpha production. J Exp Med 197, 1603-11 (2003).  50.  Horwood, N.J., Page, T.H., McDaid, J.P., Palmer, C.D., Campbell, J., Mahon, T., Brennan, F.M., Webster, D. & Foxwell, B.M. Bruton's tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6, production. J Immunol 176, 3635-41 (2006).  61  51.  Mukhopadhyay, S., Mohanty, M., Mangla, A., George, A., Bal, V., Rath, S. & Ravindran, B. Macrophage effector functions controlled by Bruton's tyrosine kinase are more crucial than the cytokine balance of T cell responses for microfilarial clearance. J Immunol 168, 2914-21 (2002).  52.  Jefferies, C.A., Doyle, S., Brunner, C., Dunne, A., Brint, E., Wietek, C., Walch, E., Wirth, T. & O'Neill, L.A. Bruton's tyrosine kinase is a Toll/interleukin-1 receptor domain-binding protein that participates in nuclear factor kappaB activation by Toll-like receptor 4. J Biol Chem 278, 2625864 (2003).  53.  Gray, P., Dunne, A., Brikos, C., Jefferies, C.A., Doyle, S.L. & O'Neill, L.A. MyD88 adapter-like (Mal) is phosphorylated by Bruton's tyrosine kinase during TLR2 and TLR4 signal transduction. J Biol Chem 281, 10489-95 (2006).  54.  Liljeroos, M., Vuolteenaho, R., Morath, S., Hartung, T., Hallman, M. & Ojaniemi, M. Bruton's tyrosine kinase together with PI 3-kinase are part of Toll-like receptor 2 multiprotein complex and mediate LTA induced Toll-like receptor 2 responses in macrophages. Cell Signal 19, 625-33 (2007).  55.  Doyle, S.L., Jefferies, C.A. & O'Neill, L.A. Bruton's tyrosine kinase is involved in p65-mediated transactivation and phosphorylation of p65 on serine 536 during NFkappaB activation by lipopolysaccharide. J Biol Chem 280, 23496-501 (2005).  56.  Melcher, M., Unger, B., Schmidt, U., Rajantie, I.A., Alitalo, K. & Ellmeier, W. Essential roles for the Tec family kinases Tec and Btk in M-CSF receptor signaling pathways that regulate macrophage survival. J Immunol 180, 8048-56 (2008).  57.  Jongstra-Bilen, J., Puig Cano, A., Hasija, M., Xiao, H., Smith, C.I. & Cybulsky, M.I. Dual functions of Bruton's tyrosine kinase and Tec kinase during Fcgamma receptor-induced signaling and phagocytosis. J Immunol 181, 288-98 (2008).  58.  Joseph, R.E. & Andreotti, A.H. Conformational snapshots of Tec kinases during signaling. Immunol Rev 228, 74-92 (2009).  59.  Suzuki, H., Matsuda, S., Terauchi, Y., Fujiwara, M., Ohteki, T., Asano, T., Behrens, T.W., Kouro, T., Takatsu, K., Kadowaki, T. & Koyasu, S. PI3K and Btk differentially regulate B cell antigen receptor-mediated signal transduction. Nat Immunol 4, 280-6 (2003).  60.  Mohamed, A.J., Yu, L., Backesjo, C.M., Vargas, L., Faryal, R., Aints, A., Christensson, B., Berglof, A., Vihinen, M., Nore, B.F. & Smith, C.I. Bruton's tyrosine kinase (Btk): function, regulation, and transformation with special emphasis on the PH domain. Immunol Rev 228, 58-73 (2009).  62  61.  Mueller, H., Stadtmann, A., Van Aken, H., Hirsch, E., Wang, D., Ley, K. & Zarbock, A. Tyrosine kinase Btk regulates E-selectin-mediated integrin activation and neutrophil recruitment by controlling phospholipase C (PLC) gamma2 and PI3Kgamma pathways. Blood 115, 3118-27.  62.  Rawlings, D.J., Scharenberg, A.M., Park, H., Wahl, M.I., Lin, S., Kato, R.M., Fluckiger, A.C., Witte, O.N. & Kinet, J.P. Activation of BTK by a phosphorylation mechanism initiated by SRC family kinases. Science 271, 822-5 (1996).  63.  Marcotte, D.J., Liu, Y.T., Arduini, R.M., Hession, C.A., Miatkowski, K., Wildes, C.P., Cullen, P.F., Hong, V., Hopkins, B.T., Mertsching, E., Jenkins, T.J., Romanowski, M.J., Baker, D.P. & Silvian, L.F. Structures of human Bruton's tyrosine kinase in active and inactive conformations suggest a mechanism of activation for TEC family kinases. Protein Sci 19, 429-39.  64.  Yamadori, T., Baba, Y., Matsushita, M., Hashimoto, S., Kurosaki, M., Kurosaki, T., Kishimoto, T. & Tsukada, S. Bruton's tyrosine kinase activity is negatively regulated by Sab, the Btk-SH3 domain-binding protein. Proc Natl Acad Sci U S A 96, 6341-6 (1999).  65.  Bolland, S., Pearse, R.N., Kurosaki, T. & Ravetch, J.V. SHIP modulates immune receptor responses by regulating membrane association of Btk. Immunity 8, 509-16 (1998).  66.  Tomlinson, M.G., Heath, V.L., Turck, C.W., Watson, S.P. & Weiss, A. SHIP family inositol phosphatases interact with and negatively regulate the Tec tyrosine kinase. J Biol Chem 279, 55089-96 (2004).  67.  Tian, Q., Streuli, M., Saito, H., Schlossman, S.F. & Anderson, P. A polyadenylate binding protein localized to the granules of cytolytic lymphocytes induces DNA fragmentation in target cells. Cell 67, 629-39 (1991).  68.  Dember, L.M., Kim, N.D., Liu, K.Q. & Anderson, P. Individual RNA recognition motifs of TIA1 and TIAR have different RNA binding specificities. J Biol Chem 271, 2783-8 (1996).  69.  Piecyk, M., Wax, S., Beck, A.R., Kedersha, N., Gupta, M., Maritim, B., Chen, S., Gueydan, C., Kruys, V., Streuli, M. & Anderson, P. TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha. Embo J 19, 4154-63 (2000).  70.  Izquierdo, J.M. Control of the ATP synthase beta subunit expression by RNA-binding proteins TIA-1, TIAR, and HuR. Biochem Biophys Res Commun 348, 703-11 (2006).  71.  Izquierdo, J.M., Majos, N., Bonnal, S., Martinez, C., Castelo, R., Guigo, R., Bilbao, D. & Valcarcel, J. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol Cell 19, 475-84 (2005).  72.  Li, W., Li, Y., Kedersha, N., Anderson, P., Emara, M., Swiderek, K.M., Moreno, G.T. & Brinton, M.A. Cell proteins TIA-1 and TIAR interact with the 3' stem-loop of the West Nile virus complementary minus-strand RNA and facilitate virus replication. J Virol 76, 11989-2000 (2002). 63  73.  Yamasaki, S., Stoecklin, G., Kedersha, N., Simarro, M. & Anderson, P. T-cell intracellular antigen-1 (TIA-1)-induced translational silencing promotes the decay of selected mRNAs. J Biol Chem 282, 30070-7 (2007).  74.  Kandasamy, K., Joseph, K., Subramaniam, K., Raymond, J.R. & Tholanikunnel, B.G. Translational control of beta2-adrenergic receptor mRNA by T-cell-restricted intracellular antigen-related protein. J Biol Chem 280, 1931-43 (2005).  75.  Kawai, T., Lal, A., Yang, X., Galban, S., Mazan-Mamczarz, K. & Gorospe, M. Translational control of cytochrome c by RNA-binding proteins TIA-1 and HuR. Mol Cell Biol 26, 3295-307 (2006).  76.  Dixon, D.A., Balch, G.C., Kedersha, N., Anderson, P., Zimmerman, G.A., Beauchamp, R.D. & Prescott, S.M. Regulation of cyclooxygenase-2 expression by the translational silencer TIA-1. J Exp Med 198, 475-81 (2003).  77.  Kawakami, A., Tian, Q., Duan, X., Streuli, M., Schlossman, S.F. & Anderson, P. Identification and functional characterization of a TIA-1-related nucleolysin. Proc Natl Acad Sci U S A 89, 8681-5 (1992).  78.  Gueydan, C., Droogmans, L., Chalon, P., Huez, G., Caput, D. & Kruys, V. Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA. J Biol Chem 274, 2322-6 (1999).  79.  Izquierdo, J.M. & Valcarcel, J. Two isoforms of the T-cell intracellular antigen 1 (TIA-1) splicing factor display distinct splicing regulation activities. Control of TIA-1 isoform ratio by TIA-1related protein. J Biol Chem 282, 19410-7 (2007).  80.  Kedersha, N.L., Gupta, M., Li, W., Miller, I. & Anderson, P. RNA-binding proteins TIA-1 and TIAR link the phosphorylation of eIF-2 alpha to the assembly of mammalian stress granules. J Cell Biol 147, 1431-42 (1999).  81.  Anderson, P. Post-transcriptional regulons coordinate the initiation and resolution of inflammation. Nat Rev Immunol 10, 24-35.  82.  Hao, S. & Baltimore, D. The stability of mRNA influences the temporal order of the induction of genes encoding inflammatory molecules. Nat Immunol 10, 281-8 (2009).  83.  Gebauer, F. & Hentze, M.W. Molecular mechanisms of translational control. Nat Rev Mol Cell Biol 5, 827-35 (2004).  84.  Lamphear, B.J., Kirchweger, R., Skern, T. & Rhoads, R.E. Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap-dependent and cap-independent translational initiation. J Biol Chem 270, 21975-83 (1995). 64  85.  Kozak, M. Pushing the limits of the scanning mechanism for initiation of translation. Gene 299, 1-34 (2002).  86.  Pestova, T.V., Kolupaeva, V.G., Lomakin, I.B., Pilipenko, E.V., Shatsky, I.N., Agol, V.I. & Hellen, C.U. Molecular mechanisms of translation initiation in eukaryotes. Proc Natl Acad Sci U S A 98, 7029-36 (2001).  87.  Pause, A., Belsham, G.J., Gingras, A.C., Donze, O., Lin, T.A., Lawrence, J.C., Jr. & Sonenberg, N. Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature 371, 762-7 (1994).  88.  Wells, S.E., Hillner, P.E., Vale, R.D. & Sachs, A.B. Circularization of mRNA by eukaryotic translation initiation factors. Mol Cell 2, 135-40 (1998).  89.  Stoecklin, G., Stoeckle, P., Lu, M., Muehlemann, O. & Moroni, C. Cellular mutants define a common mRNA degradation pathway targeting cytokine AU-rich elements. Rna 7, 1578-88 (2001).  90.  Johnstone, O. & Lasko, P. Translational regulation and RNA localization in Drosophila oocytes and embryos. Annu Rev Genet 35, 365-406 (2001).  91.  Freeman, W.M., Walker, S.J. & Vrana, K.E. Quantitative RT-PCR: pitfalls and potential. Biotechniques 26, 112-22, 124-5 (1999).  92.  Ding, X.C. & Grosshans, H. Repression of C. elegans microRNA targets at the initiation level of translation requires GW182 proteins. Embo J 28, 213-22 (2009).  93.  Inghirami, G., Chiarle, R., Simmons, W.J., Piva, R., Schlessinger, K. & Levy, D.E. New and old functions of STAT3: a pivotal target for individualized treatment of cancer. Cell Cycle 4, 1131-3 (2005).  94.  Luyendyk, J.P., Schabbauer, G.A., Tencati, M., Holscher, T., Pawlinski, R. & Mackman, N. Genetic analysis of the role of the PI3K-Akt pathway in lipopolysaccharide-induced cytokine and tissue factor gene expression in monocytes/macrophages. J Immunol 180, 4218-26 (2008).  95.  Denys, A., Udalova, I.A., Smith, C., Williams, L.M., Ciesielski, C.J., Campbell, J., Andrews, C., Kwaitkowski, D. & Foxwell, B.M. Evidence for a dual mechanism for IL-10 suppression of TNFalpha production that does not involve inhibition of p38 mitogen-activated protein kinase or NFkappa B in primary human macrophages. J Immunol 168, 4837-45 (2002).  96.  Murray, P.J. The JAK-STAT signaling pathway: input and output integration. J Immunol 178, 2623-9 (2007).  97.  Mitrophanov, A.Y. & Groisman, E.A. Positive feedback in cellular control systems. Bioessays 30, 542-55 (2008).  65  98.  Fernandez-Ballester, G. & Serrano, L. Prediction of protein-protein interaction based on structure. Methods Mol Biol 340, 207-34 (2006).  99.  Go, N.F., Castle, B.E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T.R., Moore, K.W. & Howard, M. Interleukin 10, a novel B cell stimulatory factor: unresponsiveness of X chromosome-linked immunodeficiency B cells. J Exp Med 172, 1625-31 (1990).  100.  Hernandez-Molina, G., Svyryd, Y., Sanchez-Guerrero, J. & Mutchinick, O.M. The role of the X chromosome in immunity and autoimmunity. Autoimmun Rev 6, 218-22 (2007).  101.  Timmers, E., de Weers, M., Alt, F.W., Hendriks, R.W. & Schuurman, R.K. X-linked agammaglobulinemia. Clin Immunol Immunopathol 61, S83-93 (1991).  102.  de Kleer, I.M., Kamphuis, S.M., Rijkers, G.T., Scholtens, L., Gordon, G., De Jager, W., Hafner, R., van de Zee, R., van Eden, W., Kuis, W. & Prakken, B.J. The spontaneous remission of juvenile idiopathic arthritis is characterized by CD30+ T cells directed to human heat-shock protein 60 capable of producing the regulatory cytokine interleukin-10. Arthritis Rheum 48, 200110 (2003).  103.  Tisch, R. & McDevitt, H. Insulin-dependent diabetes mellitus. Cell 85, 291-7 (1996).  104.  Aki, D., Minoda, Y., Yoshida, H., Watanabe, S., Yoshida, R., Takaesu, G., Chinen, T., Inaba, T., Hikida, M., Kurosaki, T., Saeki, K. & Yoshimura, A. Peptidoglycan and lipopolysaccharide activate PLCgamma2, leading to enhanced cytokine production in macrophages and dendritic cells. Genes Cells 13, 199-208 (2008).  105.  Leppanen, T., Jalonen, U., Kankaanranta, H., Tuominen, R. & Moilanen, E. Inhibition of protein kinase C beta II downregulates tristetraprolin expression in activated macrophages. Inflamm Res 57, 230-40 (2008).  106.  Leppanen, T., Jalonen, U., Korhonen, R., Tuominen, R.K. & Moilanen, E. Inhibition of protein kinase Cdelta reduces tristetraprolin expression by destabilizing its mRNA in activated macrophages. Eur J Pharmacol 628, 220-5.  107.  Leitges, M., Schmedt, C., Guinamard, R., Davoust, J., Schaal, S., Stabel, S. & Tarakhovsky, A. Immunodeficiency in protein kinase cbeta-deficient mice. Science 273, 788-91 (1996).  108.  Bhattacharyya, S., Sen, P., Wallet, M., Long, B., Baldwin, A.S., Jr. & Tisch, R. Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3K/Akt pathway and of IkappaB kinase activity. Blood 104, 1100-9 (2004).  109.  Jumaa, H., Mitterer, M., Reth, M. & Nielsen, P.J. The absence of SLP65 and Btk blocks B cell development at the preB cell receptor-positive stage. Eur J Immunol 31, 2164-9 (2001).  110.  Kurosaki, T. & Tsukada, S. BLNK: connecting Syk and Btk to calcium signals. Immunity 12, 1-5 (2000). 66  111.  Shinohara, M., Koga, T., Okamoto, K., Sakaguchi, S., Arai, K., Yasuda, H., Takai, T., Kodama, T., Morio, T., Geha, R.S., Kitamura, D., Kurosaki, T., Ellmeier, W. & Takayanagi, H. Tyrosine kinases Btk and Tec regulate osteoclast differentiation by linking RANK and ITAM signals. Cell 132, 794-806 (2008).  112.  Verstak, B., Nagpal, K., Bottomley, S.P., Golenbock, D.T., Hertzog, P.J. & Mansell, A. MyD88 adapter-like (Mal)/TIRAP interaction with TRAF6 is critical for TLR2- and TLR4-mediated NFkappaB proinflammatory responses. J Biol Chem 284, 24192-203 (2009).  113.  Perez de Diego, R., Lopez-Granados, E., Pozo, M., Rodriguez, C., Sabina, P., Ferreira, A., Fontan, G., Garcia-Rodriguez, M.C. & Alemany, S. Bruton's tyrosine kinase is not essential for LPS-induced activation of human monocytes. J Allergy Clin Immunol 117, 1462-9 (2006).  114.  Zorn, C.N., Keck, S., Hendriks, R.W., Leitges, M., Freudenberg, M.A. & Huber, M. Bruton's tyrosine kinase is dispensable for the Toll-like receptor-mediated activation of mast cells. Cell Signal 21, 79-86 (2009).  115.  Schmidt, N.W., Thieu, V.T., Mann, B.A., Ahyi, A.N. & Kaplan, M.H. Bruton's tyrosine kinase is required for TLR-induced IL-10 production. J Immunol 177, 7203-10 (2006).  67  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0071024/manifest

Comment

Related Items