Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Imprinted genes in the placenta and obstetrical complications Bourque, Danielle Kathleen 2010

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2010_fall_bourque_danielle.pdf [ 1.76MB ]
Metadata
JSON: 24-1.0070983.json
JSON-LD: 24-1.0070983-ld.json
RDF/XML (Pretty): 24-1.0070983-rdf.xml
RDF/JSON: 24-1.0070983-rdf.json
Turtle: 24-1.0070983-turtle.txt
N-Triples: 24-1.0070983-rdf-ntriples.txt
Original Record: 24-1.0070983-source.json
Full Text
24-1.0070983-fulltext.txt
Citation
24-1.0070983.ris

Full Text

IMPRINTED GENES IN THE PLACENTA AND OBSTETRICAL COMPLICATIONS by Danielle Kathleen Bourque B.Sc., Dalhousie University, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) June 2010  © Danielle Kathleen Bourque, 2010  !  ABSTRACT  "#$%!&'#()!*#+&!,('-+#+$.'/!#('!#//0$.#1'2!3.1%!04/1'1(.$#5!$0*,5.$#1.0+/!/6$%! #/!*#1'(+#5!,('7'$5#*,/.#!89":;!#+2!<'1#5!.+1(#61'(.+'!-(031%!('/1(.$1.0+!8=>?@;A!900(! ,5#$'+1#1.0+!./!1%06-%1!10!$0+1(.461'!10!1%'/'!$0*,5.$#1.0+/)!461!/,'$.<.$!$#6/'/!#('! 5#(-'5&!6+B+03+A!C06/'!*02'5/!/6--'/1!1%#1!',.-'+'1.$!*'$%#+./*/)!.+!,#(1.$65#(! -'+0*.$!.*,(.+1.+-)!1%#1!#51'(!-'+'!('-65#1.0+!*#&!%'5,!('-65#1'!,5#$'+1#5! 2'D'50,*'+1!#+2!'*4(&0+.$!-(031%A!:%'!<.(/1!-0#5!0<!1%./!1%'/./!./!10!'E#*.+'!.<! ',.-'+'1.$!*02.<.$#1.0+/!8.A'A!FGH!*'1%&5#1.0+;!#+2!#51'('2!'E,('//.0+!0<!.*,(.+1'2! -'+'/!.+!1%'!%6*#+!,5#$'+1#!#('!$0+1(.461.+-!<#$10(/!10!9":!#+2!=>?@A!:%'!/'$0+2!-0#5! 0<!1%./!1%'/./!./!10!.2'+1.<&!.*,(.+1'2!50$.!1%#1!#('!6/'<65!.+!1%'!2.#-+0/./!0<!,5#$'+1#5! ,#1%050-.'/!1%#1!#//0$.#1'2!3.1%!#4+0(*#5!.*,(.+1.+-)!.+$562.+-!1(.,50.2&)! %&2#1.2.<0(*!*05'/)!#+2!,5#$'+1#5!*'/'+$%&*#5!2&/,5#/.#A! =!<06+2!1%#1!FGH!*'1%&5#1.0+!#1!1%'!.*,(.+1.+-!$0+1(05!('-.0+!I!8=J@I;!0+! $%(0*0/0*'!II,IKAK!3#/!/.-+.<.$#+15&!2'$('#/'2!.+!=>?@!,5#$'+1#/!8,!L!MAMMI;)!461! +01!.+!1%0/'!#//0$.#1'2!3.1%!,('7'$5#*,/.#A!C'1%&5#1.0+!#1!=J@N!8ODFC@I;!3#/!+01! /.-+.<.$#+15&!#51'('2!.+!9":!0(!=>?@A!G0!/.-+.<.$#+1!$%#+-'/!.+!'E,('//.0+!5'D'5/!3'('! 04/'(D'2!.+!1%'!-'+'/!$0+1(055'2!4&!1%'/'!=J@/A!:%'('!3'('!+0!/.-+.<.$#+1!*'1%&5#1.0+! $%#+-'/!04/'(D'2!.+!#+&!$#+2.2#1'!.*,(.+1'2!-'+'!'D#56#1'2!4&!1%'!=556*.+#!#((#&A! P=G"7I!*'1%&5#1.0+)!#!*#(B'(!0<!3%05'!-'+0*'!*'1%&5#1.0+)!3#/!#5/0!/.*.5#(!.+!#55! -(06,/A!:%'!'/1#45./%*'+1!0<!4.0*#(B'(/!1%#1!$0652!4'!6/'2!10!#$$6(#1'5&!.2'+1.<&! 1%0/'!30*'+!#1!#+!.+$('#/'2!(./B!<0(!,('7'$5#*,/.#!0(!=>?@!30652!4'!#!*#Q0(!/1',! <0(3#(2!.+!#+1'+#1#5!$#('A!!  !  ii  H55!,5#$'+1#5!,#1%050-.'/!81(.,50.2&)!%&2#1.2.<0(*!*05'/!0(!,5#$'+1#5! *'/'+$%&*#5!2&/,5#/.#;!3'('!#//0$.#1'2!3.1%!#51'('2!=J@N!8ODFC@I;!*'1%&5#1.0+A! 9&(0/'R6'+$.+-!#//#&/!<0(!!"#$)!!%&'%)!#+2!($!)*3'('!#5/0!$0*,#('2!<0(!1%'.(!61.5.1&! .+!2.#-+0/.+-!,#('+1#5!-'+0*.$!.*4#5#+$'!.+!,5#$'+1#5!/#*,5'/A!!"#$*/%03'2!1%'! $5'#('/1!/',#(#1.0+!4'13''+!-(06,/A!:%'!$0*4.+'2!6/'!0<!ODFC@I!#+2!!"#$!#//#&/! $0652!,(0D.2'!#!,01'+1.#55&!D#56#45'!2.#-+0/1.$!1005!.+!1%'!(#,.2!/$(''+.+-!0<! *'1%&5#1.0+!'((0(/!.+!,5#$'+1#5!2./0(2'(/A!:%'/'!('/651/!#5/0!2'*0+/1(#1'!1%'! *#.+1'+#+$'!0<!.*,(.+1.+-!/1#16/!#1!1%'/'!50$.!.+!1%'!%6*#+!,5#$'+1#)!'D'+!.+!1%'! ,('/'+$'!0<!#4+0(*#5!,#1%050-&A  !  iii  TABLE OF CONTENTS Abstract ...................................................................................................................... ii Table of Contents...................................................................................................... iv List of Tables ............................................................................................................vii List of Figures ........................................................................................................ viii List of Abbreviations ................................................................................................ix Acknowledgements ....................................................................................................x Co-authorship Statement ........................................................................................xii Chapter 1: Introduction .............................................................................................1 1.1. Overview................................................................................................................1 1.2. The placenta...........................................................................................................4 1.2.1. Placental structure and function ................................................................4 1.2.2. Gene expression in placental development ..............................................8 1.3. Pre-eclampsia ........................................................................................................9 1.4. Intrauterine growth restriction ............................................................................10 1.5. The placenta in pre-eclampsia and intrauterine growth restriction .....................11 1.6. Imprinting ...........................................................................................................13 1.6.1. Early evidence parental genomes are not equivalent .............................13 1.6.2. The role of DNA methylation in imprinting ...........................................15 1.6.3. Methods to assess DNA methylation ......................................................17 1.6.4. The placenta and genomic imprinting ....................................................20 1.6.5. Selected imprinted genes and associated disorders ................................22 1.7. The goals of this thesis .......................................................................................28 1.7.1. Research questions .................................................................................28 1.7.2. Hypothesis ..............................................................................................29 1.7.3. Objective 1 – Characterization of imprinting in normal placentas .........29 1.7.4. Objective 2 – Identification of abnormal patterns of imprinting in placentas associated with PET and/or IUGR ....................................................30 1.7.5. Objective 3 – Design of imprinted gene methylation assays for the !  iv  diagnosis of placental conditions .....................................................................30 1.7.6. Introduction to Manuscript 1...................................................................31 1.7.7. Introduction to Manuscript 2 ..................................................................31 1.8. References ...........................................................................................................32 Chapter 2: Manuscript 1. Decreased placental methylation at the H19/IGF2 imprinting control region is associated with normotensive intrauterine growth restriction but not preeclampsia .............................................................................39 2.1. Introduction..........................................................................................................39 2.2. Methods ...............................................................................................................41 2.2.1. Sample ascertainment .............................................................................41 2.2.2.Whole genome methylation arrays ..........................................................43 2.2.3. Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) for ICR1.......................................................................................44 2.2.4. Pyrosequencing for ICR2, candidate gene and LINE-1 methylation......45 2.2.5. Whole genome expression arrays ...........................................................46 2.3. Results..................................................................................................................47 2.3.1. Illumina methylation results ...................................................................47 2.3.2. ICR1 methylation by Ms-SNuPE............................................................47 2.3.3. ICR2, candidate gene, and LINE-1 methylation by pyrosequencing......52 2.3.4. Illumina expression results .....................................................................53 2.4. Discussion............................................................................................................54 2.5. Supplementary table information .......................................................................57 2.6. References............................................................................................................58 CHAPTER 3: Manuscript 2. The utility of quantitative methylation assays at imprinted genes for the diagnosis of fetal and placental disorders......................62 3.1. Introduction..........................................................................................................62 3.2. Methods ...............................................................................................................64 3.2.1. Study samples .........................................................................................64 3.2.2. Pyrosequencing assays ...........................................................................65  !  v  3.3. Results .................................................................................................................67 3.3.1. Chromosome 11p15.5 assays (KvDMR1 and H19-ICR)........................67 3.3.2. Non-chromosome 11 pyrosequencing assays ........................................70 3.3.3. Utility of assays for estimation of paternal:maternal genomic ratios......71 3.4. Discussion............................................................................................................73 3.5. References............................................................................................................75 CHAPTER 4. Discussion and conclusion ...............................................................78 4.1. DNA methylation as a biomarker ........................................................................78 4.2. Imprinting in the placenta....................................................................................81 4.3. Methods to assess DNA methylation...................................................................82 4.4. Further directions.................................................................................................83 4.4.1. Assisted reproductive technologies.........................................................83 4.4.2. Diet and environmental influences..........................................................85 4.4.3. Utility of this work ..................................................................................85 4.5. Significance .........................................................................................................86 4.6. References............................................................................................................88 APPENDIX A............................................................................................................91 APPENDIX B ............................................................................................................95  !  vi  LIST OF TABLES Table 2.1. Summary of mean DNA methylation values obtained using MS-SNuPE (ICR1) and pyrosequencing (ICR2, H19, CDKN1C, PEG10, PLAGL1, SNRPN, MEST, LINE-1)...........................................................................................................51 Table 3.1. Comparison of DNA methylation assays at imprinted genes for the ability to distinguish digynic triploidy (N=13) from diandric triploidy (N=8)..........................70  !  vii  LIST OF FIGURES Figure 1.1. Structure of the human placenta...............................................................6 Figure 1.2. The structure of the ICR that controls H19 and IGF2 on chromosome 11p15.5 .......................................................................................................................17 Figure 1.3. Map of chromosome 11p15.5 showing selected imprinted genes...........23 Figure 2.1. Intra-placental correlation for percent methylation at the H19/IGF2 ICR ............................................................................................................48 Figure 2.2. Inter-group comparisons for percent DNA methylation at the H19/IGF2 ICR ............................................................................................................50 Figure 3.1. Pyrosequencing results for KvDMR1 and SGCE DNA methylation assays ..........................................................................................................................68 Figure 3.2. DNA methylation at the H19-ICR and SGCE promoter versus paternal genomic contribution ..................................................................................................72  !  viii  LIST OF ABBREVIATIONS AFP ART ATP !-hCG BP BW BWS CHM CpG DMR DNA EVT GA HELLP ICR ICSI IUGR Ms-SNuPE PCR PET PHM PMD PPi RNA SAM SGA STBM TCDD TNDM uE3 UPD  !  alpha fetoprotein assisted reproductive technologies adenosine triphosphate beta human chorionic gonadotropin blood pressure birth weight Beckwith-Wiedemann syndrome complete hydatidiform mole cytosine-phosphate-guanine dinucleotide differentially methylated region deoxyribonucleic acid extravillous trophoblast gestational age hemolytic anemia, elevated liver enzymes, low platelet count imprinting control region intracytoplasmic sperm injection intrauterine growth restriction Methylation-sensitive Single Nucleotide Primer Extension polymerase chain reaction pre-eclampsia/pre-eclamptic toxaemia partial hydatidiform mole placental mesenchymal dysplasia pyrophosphate ribonucleic acid Significance Analysis of Microarray small for gestational age syncytial trophoblast microvillous membranes 2,3,7,8-Tetrachlorodibenzodioxin Transient Neonatal Diabetes Mellitus unconjugated estriol uniparental disomy  ix  ACKNOWLEDGEMENTS I would first like to thank my supervisor, Dr. Wendy Robinson, for giving me the opportunity to come to Vancouver and undertake a research project in a field I am passionate about. Thank you for your guidance and support over the past four years. I would also like to thank all the members of the Robinson Lab, both past and present, for guidance, motivation and for understanding the importance of free chocolate. To my fellow students, Karla Bretherick, Sara Harbord, Luana Avila, Courtney Hanna, Ryan Yuen and Dan DiegoAlvarez, you have helped make the past four years one of the best times of my life. And to Maria Penaherrera and Ruby Jiang, thanks for your invaluable input and technical help.  I would also like to thank the members of my thesis committee: Drs. Sylvie Langlois and Louis Lefebvre. I appreciate your guidance and encouragement throughout this project. To Dr. Langlois, thank you for allowing me to get a glimpse of the world of clinical genetics. And to Dr. Lefebvre, I know I am leaving research to go to medical school, but I will always remember how important and interesting the placenta really is!  I would also like to acknowledge my funding agencies: the Canadian Institutes for Health Research; the Michael Smith Foundation for Health Research; and the Interdisciplinary Women’s Reproductive Health Training Program. Their generous financial support allowed me to successfully carry out this project, to present my work at so many wonderful conferences and to learn from experts all over the world.  !  x  And to my friends, you know who you are. I wish I had space to name you all, but I’m sure I would forget someone! Thank you to all of you who saw me through the bad times and the good. Finally, to my parents, thanks for letting me move all the way across the country without asking too many questions.  !  xi  CO-AUTHORSHIP STATEMENT  I conducted the literature review and wrote Chapter 1 in its entirety. Dr. Wendy Robinson provided input and edited the chapter. Manuscript 1. Placentas were recruited by the Robinson lab clinical research coordinator from either the EMMA Clinic (run by Dr. Peter von Dadelszen) or from hospital postings. Luana Avila and Ruby Jiang sampled the placentas and extracted DNA and RNA. I ran all the methylation and expression experiments and analyzed the data. Luana also assisted with the analysis of the microarray data. Dr. Maria Penaherrera prepared the DNA for microarray analysis in collaboration with the lab of Dr. Michael Kobor. She also provided technical assistance and assisted with data analysis. I wrote this manuscript. Dr. Wendy Robinson provided guidance, aided with experimental design and manuscript editing. Manuscript 2. Beckwith-Wiedemann syndrome samples were obtained from Dr. Rosanna Weksberg in Toronto or were referred by Dr. Margot van Allen and other clinicians at the BCCW Medical Genetics Clinic. Dr. Deborah McFadden provided placental samples from triploids, CHMs and some PMDs. DNA was extracted by Ruby Jiang and other lab personnel. I designed all the assays outlined in Manuscript 2 and I tested the controls with the various assays and the BWS cases and abnormal placentas with the KvDMR1 assay. Ryan Yuen helped with pyrosequencing assay design. Dr. Maria Penaherrera and Ruby Jiang also ran some pyrosequencing assays on the abnormal placentas. I wrote the original draft of the manuscript. Dr. Wendy Robinson aided with experimental design and manuscript revisions. I wrote Chapter 4 in its entirety.  !  xii  CHAPTER 1. INTRODUCTION  1.1. Overview  Each year in British Columbia, many pregnancies are associated with obstetrical complications and poor outcomes. Two of these complications are pre-eclampsia (PET), which affects approximately 5% of pregnancies, and low birth weight or intrauterine growth restriction (IUGR), which also affects approximately 5% of pregnancies [1]. Pre-eclampsia is a form of pregnancy-induced hypertension. While there is no universally accepted definition of IUGR, it can be described as a failure of a fetus to reach its growth potential [2]. Pre-eclampsia is the number one cause of maternal death and it can be detrimental, and even fatal, for the baby. For example, babies born to mothers with pre-eclampsia are more likely to be premature and have low birth weight compared to babies from uncomplicated pregnancies. These babies are also more likely to have high blood pressure and body mass [3] and be at an increased risk for atherosclerosis and insulin-resistance syndrome in later life compared to adults from unaffected pregnancies [4]. In the mother, complications from pre-eclampsia include pulmonary edema and renal failure [5]. Preeclampsia has also been identified as a predictor of future cardiovascular disease in affected women [6]. The presence of IUGR often correlates with increased perinatal morbidity and mortality, as well with long-term consequences in post-natal health [7]. Multiple complications are known to be associated with IUGR, including oxygen deprivation, ischemic encephalopathy, polycythemia, hypoglycemia, and other metabolic abnormalities !  1  [8]. Adults affected by IUGR as a baby may continue to show long-term sequelae such as development of coronary heart disease, insulin resistance, and hypertension [7]. Other longterm problems include decreased IQ and learning difficulties [9], seizures, and attention problems [10]. Both PET and IUGR may result in serious long-term health problems and are a significant burden on the health care system [11]. Poor placentation, a deficiency in migration and differentiation of cells at the maternal-fetal interface, is thought to contribute to obstetrical complications [12], but specific causes are largely unknown. The placenta is a complex organ that is composed of many cell types that have distinct functions [13]. The variety of cell types that compose the placenta, each with different gene expression patterns and changing distribution throughout pregnancy, makes it difficult to diagnose specific causes of placental failure. Although the underlying causes of placental insufficiency are still unknown, mouse models have suggested that epigenetic changes, both globally and at the level of specific genes, that alter gene regulation may be involved. In particular, genomic imprinting in the placenta may have a key function in the regulation of placental development and embryonic growth [14,15]. Imprinted genes show parent-of-origin dependent expression and are disproportionately expressed in the placenta. Methylation of the DNA is a main mechanism of establishing and maintaining genomic imprinting during development. Disruption of imprinted genes in the mouse often results in abnormal placental development and fetal growth [16]. Imprinted gene expression, as well as DNA methylation, appears to be variable in the early mouse embryo and in the placenta and may help the placenta respond to environmental stimuli; however, it is also possible that epigenetic errors can arise spontaneously in early development and contribute to placental insufficiency and abnormal fetal development. Preimplantation culture of mouse embryos can lead to loss of !  2  placental imprinting at multiple genes and is affected by the culture media used [17,18]. If epigenetic errors confined to the placenta may result in placental insufficiency, they may also lead to an increased risk of pre-eclampsia and IUGR [19,20]. There is remarkable variability in placental structure among different mammals [21,22] and thus animal models are limited in their direct application to the human situation. So, despite the information obtained from mouse models, very little is currently known about the role of imprinting in the regulation of normal and pathological human placental development. The goal of this thesis was to investigate if the disruption of normal patterns of DNA methylation associated with imprinted gene expression in early development is a significant cause of human placental insufficiency leading to maternal pre-eclampsia and fetal IUGR. The first objective of this project was to characterize methylation and imprinted gene expression in term placental whole villous cells. The second part of the project was to identify abnormal patterns of methylation and imprinting errors in chorionic villi from placentas that are from pregnancies associated with PET and/or IUGR and to identify if these changes are restricted to the chorionic villi. The final objective of this project was to design new methylation assays that may aid in the diagnosis of various placental pathologies.  !  3  1.2. The placenta  1.2.1. Placental structure and function  The placenta is a multifunctional organ that serves as a lifeline for the developing fetus. Although the placenta is situated outside of the fetal body and has a limited lifespan, it is of critical importance to the fetus in marsupials and placental mammals. It provides contact to the mother and can act as: lungs, kidneys, gut, endocrine system, liver, bone marrow, and immune system [23]. In humans, implantation of the embryo occurs approximately six days after conception [24]. During this time, there is a decidualization of the uterine endothelium. The decidua is involved in establishment and maintenance of pregnancy and will also have paracrine, nutritional, and immunoregulatory roles during pregnancy. Ultimately, normal implantation and placentation is a balance between regulatory gradients created by both the trophoblasts and endometrium. Shallow implantation has been reported in pre-eclampsia and IUGR [25] while excessive invasion is associated with trophoblast disease and placenta acreta. The early blastocyst must develop a mechanism to invade the uterine endothelium to anchor the embryo and to establish a connection for nutrient exchange with the mother. Early placentation is a highly regulated process as foreign placental cells must be allowed to invade the uterus deeply enough for secure implantation but not so deeply as to cause harm to the mother’s body [24]. A subpopulation of cells, trophoblasts, is involved in implantation into the endothelium. These cells are extremely invasive and must be tightly controlled. The  !  4  endometrium must control the trophoblast invasion by secreting locally acting factors (cytokines and protease inhibitors). Trophoblast cells are found in the outer layer of the chorionic villi (the inner layer is a mesenchymal core composed of villous stroma and fetal blood vessels) [26]. Cytotrophoblasts are the undifferentiated, mitotically active, mononucleate type of trophoblasts. They are progenitor cells that give rise to three differentiated forms of trophoblasts in response to various hormonal stimuli. The first of these are the villous syncytiotrophoblasts – a layer of differentiated, multinucleate cells that arise from the post-mitotic fusion of cytotrophoblasts [27]. (Figure 1.1) These cells comprise the outer layer of the chorionic villi. The syncytiotrophoblasts are involved in the initial stages of blastocyst invasion and placentation, maternal-fetal exchange of nutrients and wastes, and secretion of placental hormones (e.g. human chorionic gonadotropin). During trophoblast development, cavities (lacunar spaces) begin to appear in between the syncytiotrophoblasts and will eventually form the spaces into which maternal blood flows [24]. The second type of trophoblasts includes the column or anchoring trophoblasts [24]. They are found in columns at the junction between the chorionic villi and the maternal endothelium. These cells produce a compound (trophouteronectin) that helps the placenta attach to the uterus.  !  5  a)  b)  Figure 1.1. Structure of the human placenta. a) Relative locations of the various forms of trophoblasts during placental development (not to scale; EVTs are extra-villous trophoblasts); b) A cross-section through a chorionic villus.  !  6  The third and final type of trophoblasts is the intermediate invasive trophoblasts. These cells will invade deeply into the maternal decidua, forming columns and differentiate into extra-villous trophoblasts (EVTs). The EVTs are important in remodeling the maternal spiral arteries to help the placenta acquire a blood supply sufficient to sustain a developing fetus [28]. In areas of low oxygen (e.g. near the uterine surface) cytotrophoblasts continue to proliferate, but in areas of high oxygen (e.g. near the uterine spiral arteries) cytotrophoblasts differentiate. These low oxygen conditions stimulate the placenta to grow more quickly than the embryo it is supporting. Once the placenta has obtained an adequate blood supply, the growth of the placenta slows; as the cytotrophoblasts begin to differentiate, embryonic growth accelerates [29]. Proliferation in response to hypoxic conditions is somewhat unique to the trophoblasts as the majority of cell types found in the body tend to decrease cellular activity in response to hypoxia [30]. While the cause of the trophoblast response to hypoxia is still unknown, it has been suggested that the response may be mediated by epigenetic factors as DNA methylation and histone modifications in the mouse placenta appear to be different from that in the embryo [19]. By four weeks post-conception, the basic structure of the mature placenta has been achieved. The placenta now includes a fetal circulation that terminates in the capillary loops of the villi. By this point, the fetal circulation interacts with the lacunar spaces, which in turn are supplied by the maternal arteries and veins. The villi closest to the maternal blood supply will become the placenta proper, while the villi farthest from the maternal blood supply will develop into the chorion [24,31]. During this time, the amnion develops to surround and protect the developing embryo within the fluid-filled amniotic sac.  !  7  Between the fetus and the placenta, there are two fetal membranes – the amnion and the chorion [32]. The closest membrane to the fetus is the amnion, which encloses the amniotic sac and amniotic cavity. Just outside the amnion is the chorion, which developed from the chorionic villi farthest from the maternal blood supply. Moving closer to the maternal side, the next layer is the chorionic villi that developed close to the maternal blood supply [26]. These villi are composed of mesenchymal cells and trophoblast cells. Within the villi there are lacunar spaces to allow maternal blood to enter the placenta and to allow nutrient transfer through the placenta to the fetus. The nutrients are absorbed into the fetal blood in the placental vessels and eventually the nutrients make it to the fetus via the umbilical cord. The final layer of the placenta is the maternal contribution, also known as the decidua. Fetal invasive trophoblast cells (EVTs) penetrate into the decidua and help the placenta attach to the uterus.  1.2.2. Gene expression in placental development  Placental development is a series of highly regulated, coordinated processes that are under the control of multiple placentally expressed genes. Individual genes and genome wide transcriptional programs of the placenta have been studied in both mice [33] and humans [34]. While mice are an informative model system, the murine placenta is structurally different from the human placenta and as such, gene expression patterns may not be identical to those in the human placenta. Despite this, mice have helped us understand the processes involved in placental development and have allowed identification of genes that merit further studies in humans [35].  !  8  From the limited number of studies that have been performed to date, it appears that all mouse placental cell types and genes have human counterparts. The knowledge of which genes are expressed in different placental cell types and the expression patterns of these genes in the mouse has allowed the identification of orthologous cells in humans [36]. If the human orthologues to all mouse placental genes can be identified, the mouse will serve as an even more informative model organism for human placental dysfunctions. Understanding the genetic contribution to mouse placental failure will help direct future studies in human placental dysfunction and its outcomes – particularly pre-eclampsia and intrauterine growth restriction [36].  1.3. Pre-eclampsia (PET)  Pre-eclampsia is a form of pregnancy-induced hypertension; it is the number one cause of maternal death and it can be detrimental, and even fatal, for the baby. Preeclampsia is defined as hypertension above 140/90 mm Hg and proteinuria above 0.3g/24 hours [37]. Symptoms appear after 20 weeks gestation and subside after delivery of the baby. It has been suggested that there are two forms of pre-eclampsia: early onset (<34 weeks) and late onset (>34 weeks). Early onset pre-eclampsia is thought to be a more severe form of the disease and is associated with abnormal uterine artery Doppler (increased resistance), HELLP syndrome, intrauterine growth restriction and prematurity [38]. Late onset pre-eclampsia is associated with better neonatal outcomes, in part due to onset being nearer to term. As pre-eclampsia is a heterogeneous disorder, it is thought that the two forms of pre-eclampsia may have different etiologies [37]. However, in both forms the underlying cause of pre-eclampsia appears to be reduced placental perfusion caused by abnormal !  9  placentation and trophoblast invasion [39]. The reduced perfusion can cause the fetus to outstrip the placental and maternal supplies [40]. Delivery of the fetus, and consequently the placenta, is sufficient to resolve the disease. It has been suggested that maternal (e.g. an inflammatory response to the poorly functioning placenta [41]) and genetic factors (e.g. confined placental trisomy 16 [42]) may also play a role in the development of preeclampsia. There are two syndromes involved in pre-eclampsia: maternal and fetal. The hallmark feature of the maternal syndrome is hypertension; however, many organ systems may be affected (e.g. respiratory, hepatic) [41]. The fetal syndrome of pre-eclampsia may manifest as IUGR. Even though normotensive IUGR may appear on its own in the absence of pre-eclampsia, the two complications are often considered to be variations in the manifestation of the same underlying placental pathophysiology [43].  1.4. Intrauterine growth restriction (IUGR)  Intrauterine growth restriction is the failure of a fetus to reach its growth potential [2]. The presence of IUGR often correlates with increased perinatal morbidity and mortality, as well with long-term consequences in post-natal health [7]. There is no universally accepted definition of intrauterine growth restriction (IUGR). Some groups [44] use the term small for gestational age (SGA) which is based on a strict cut off for weight or length, such as less than the 5th or 10th percentile. Using a criterion like this may exclude babies who were destined to be large, but failed to meet their growth potential and may include babies that are constitutionally small, but otherwise healthy. Other groups have also used additional measures when defining IUGR, for example a longitudinal !  10  decrease in abdominal circumference [45] or alterations in fetal and placental metabolism and transport [46] in addition to birth weight. In this work, IUGR was defined using a definition which required the presence of either of two pediatric criteria: 1) less than the 3rd percentile for gestational age corrected length and weight; 2) less than the 10th percentile for gestational age corrected length and weight and the presence of at least one obstetrical factor (measured by ultrasound): (a) persistent uterine artery notching at 22+0-24+6 weeks gestation, (b) absent or reversed end diastolic velocity on umbilical artery Doppler, and/or (c) oligohydramnios (amniotic fluid index <50mm). Multiple non-placental causes (e.g. fetal infection [2], maternal smoking [47]) for IUGR have been suggested, but abnormal trophoblast invasion, decreased maternal spiral artery remodeling, and consequent reduction in blood flow between the mother and placenta appear to be involved in many cases [39]. Trisomy mosaicism, the presence of cells with one extra chromosome in the placenta, has been reported at an increased frequency in placentas associated with IUGR compared with placentas from babies with normal birth weight, further supporting the hypothesis that problems with the placenta may lead to IUGR, at least in some cases [48].  1.5. The placenta in pre-eclampsia and intrauterine growth restriction  Abnormal placental pathology is common in PET and IUGR and the placenta itself may be in part responsible for the development of pre-eclampsia and IUGR [49]. Shallow implantation and poor remodeling of the maternal spiral arteries can lead to a reduction in blood flow from the maternal circulation to the lacunar spaces of the placenta and  !  11  consequently a reduction in nutrient transfer to the fetus, possibly leading to pre-eclampsia in the mother and poor growth of the fetus [50]. There are two main theories for the development of pre-eclampsia. The first theory proposes that poor trophoblast invasion and inadequate remodeling of the maternal spiral arteries during the first trimester of pregnancy can lead to pre-eclampsia. Poor invasion can lead to a hypoxic placenta that suffers oxidative stress and eventually to the endothelial vascular (maternal) syndrome of pre-eclampsia [5]. With poor invasion it is also possible that the fetus may not receive adequate nutrition and oxygen from the mother and will suffer from growth restriction. Secondly, the development of pre-eclampsia in the mother may result from an inflammatory reaction to the fetus and placenta. Shedding of trophoblast debris into the maternal circulation is increased in pre-eclampsia and may cause an inflammatory reaction [4]. A third model combines the above theories and proposes that a hypoxic and dysfunctional placenta may release factors to which the mother has an immune response (e.g. vascular endothelial growth factor-1, VEGF-1) [12]. It has also been suggested that the inflammatory response differentiates pre-eclampsia from isolated fetal growth restriction [41]. Often the cause of IUGR is not known, but in some cases of isolated IUGR where decreased maternal blood flow to the fetus has been suggested to be the underlying cause, vascular changes including impediment of normal blood flow between villi (e.g. maternal floor infarction) and chronic inflammation of the villi (e.g. villitis) may be involved [49]. Defects in placental transport due to underlying vascular problems can lead to nutritional deficiencies in the fetus which may in turn lead to IUGR [51].  !  12  1.6. Imprinting  The study of epigenetics in the placenta is a rapidly advancing field. Epigenetics is the study of heritable, but reversible, changes to DNA that do not affect the sequence of the DNA directly but may alter gene expression. These changes include DNA methylation and histone methylation or acetylation. One particularly interesting type of epigenetic process is genomic imprinting that marks the parental genomes as non-equivalent and allows genes to be expressed in a parent-of-origin specific manner.  1.6.1. Early evidence that parental genomes are not equivalent  In the 1980s, scientists noticed that uniparental mouse embryos failed to develop to term [52,53]. Gynogenetic embryos were created from two maternal contributions by removing the paternal pronucleus from a fertilized egg and transferring a female pronucleus from a second egg in to the manipulated egg. The embryos were then implanted in to a pseudopregnant mouse [53]. The gynogenetic embryos suffered from severe growth restriction and failed to develop extra-embryonic tissues. In contrast, androgenetic embryos are created from two paternal contributions by extracting the female pronucleus from a fertilized egg and replacing it with a second male pronucleus, and implanting the resultant embryo in a pseudopregnant mouse [52]. The androgenetic embryos arrested at an extremely early phase in development but had overgrown extra-embryonic tissues (the murine equivalent of a hydatidiform mole in humans). From these early studies, it is clear that both male and female contributions are required for normal development.  !  13  Early studies using mice presenting with uniparental disomy of individual chromosomes confirmed that maternally and paternally derived chromosomes can produce different phenotypes in the resultant offspring [54]. The two most common outcomes of these uniparental disomies were alterations in growth (both enhanced and repressed) and abnormal behaviour. However, not all chromosomes produce an abnormal phenotype when present as a uniparental disomy, which indicates that specific regions or genes are involved in this phenomenon. These findings are consistent with the idea that DNA is modified differentially during male and female gametogenesis. If the male and female gametes were functionally non-equivalent, there would be a need for both parental genomes in normal development. Additionally, abnormal placental pathology can result from genomic imbalances, highlighting the importance of having both parental genomes in normal development. Of particular interest are placental mesenchymal dysplasia (PMD), complete hydatidiform moles (CHM), and partial hydatidiform moles (PHM). Placental mesenchymal dysplasia manifests as enlarged, cystic villi and is caused by the presence of androgenetic cells in the placenta in addition to biparental cells [55]. The androgenetic cells arise after a failure of the maternal genome to undergo DNA replication during the first post-fertilization cell division, forming 2 daughter cells – one diploid biparental cell and one haploid androgenetic cell [56]. The androgenetic daughter cell then undergoes endoreduplication to become diploid. The severity of the PMD is dependent on the degree of androgenetic cells. A wide degree of variation in the percentage of androgenetic cells can be seen between different cases of PMD. Complete hydatidiform moles usually arise by the fertilization of an empty ovum with one or more sperm [57]. When one sperm fertilizes an empty ovum, it must undergo endoreduplication to have the required 46 chromosomes. PHMs are caused by androgenetic !  14  triploidy (two paternal contributions but only one maternal contribution). This can occur following fertilization of one haploid egg with one (and endoreduplication) or two sperm [58]. Digynic triploids do not manifest as PHMs, but as a growth-restricted fetus with a very small placenta.  1.6.2. The role of DNA methylation in genomic imprinting  DNA methylation has been suggested to be one of the mechanisms that mark the maternal and paternal genomes as functionally different [59]. Methylation occurs primarily on the cytosine residue of CpG dinucleotides. When present at the promoter of certain genes, methylation can be associated with transcriptional silencing of that gene; however, many other factors (e.g. histones, transcription factors) may also play a role. Methylation is heritable and reversible, which means that it can be stably passed on from cell to cell, but can be erased when needed (i.e. before establishing the correct pattern of imprints during gametogenesis). In the case of imprinted genes, only the maternal or paternal copy of the gene is expressed and the other copy is silenced by DNA methylation (often in the promoter region). Shortly after fertilization, there is a global demethylation of the genome and methylation must be reestablished very early in embryonic development [60]. DNA methylation marks, including those of imprinted genes, are established during gametogenesis by enzymes known as de novo DNA methyltransferases – particularly DNMT3a. Deletion of these enzymes in mice results in an embryonic lethal phenotype. In the germ cells, all imprints are erased and replaced with the correct marks (i.e. female germ cells acquire a female pattern of imprints, and vice versa for male germ cells). In contrast, in !  15  somatic cells DNA methylation imprints are maintained to reflect the imprinting status acquired from the parents. Once, the initial methylation marks are set down, maintenance of methylation ensures methylation and imprints are not lost during cell division. This function is performed by another DNA methyltransferase – DNMT1 [60]. Imprinted genes are often found clustered together on chromosomes, which can result in coordinated expression of the genes under the control of an imprinting control region (ICR) [61]. An ICR is often a differentially methylated region (DMR) that has a parent-specific pattern of DNA methylation inherited directly from the gametes. One example is ICR1 on chromosome 11p15.5 (Figure 1.2) that controls the expression of H19 (coding for a non-translated RNA) and IGF2 (coding for a growth factor) [62]. H19 is only expressed from the maternal chromosome and IGF2 is only expressed from the paternal chromosome (Figure 1.2). When the ICR is unmethylated, as on the maternal chromosome, a protein called CTCF binds to the ICR. The bound CTCF protein inhibits IGF2 from interacting with the enhancer and thus IGF2 is not expressed. On the paternal chromosome, the ICR is methylated. This blocks CTCF from binding to the ICR. Without CTCF bound, IGF2 can interact with its downstream enhancer and is gets expression (H19 is methylated and repressed at this time).  !  16  Figure 1.2. The structure of the ICR that controls H19 and IGF2 on chromosome 11p15.5. The “lollipops” on the paternal chromosome represent DNA methylation marks. When the ICR is methylated, CTCF is unable to bind to it, and the downstream enhancer can interact with IGF2, resulting in the expression of IGF2. When the ICR is unmethylated, CTCF binds, blocking the interaction between the enhancer and IGF2, resulting in the expression of H19.  1.6.3. Methods to assess DNA methylation  a) Traditional bisulfite sequencing  In bisulfite sequencing, genomic DNA is treated with a compound known as sodium bisulfite, which converts all unmethylated cytosine nucleotides to uracil, while preserving the methylated cytosine residues. The locus of interest is subject to amplification by polymerase chain reaction (PCR). The PCR step pairs the uracil residues with adenine, which then pair with thymine residues (thereby replacing the uracils with thymines) [63]. The resulting product may be sequenced directly, but often it is cloned in to a plasmid vector  !  17  and transformed in to bacteria which gets plated on selective agar. Traditional dideoxy, gelbased Sanger sequencing is used to quantify the level of methylation by comparing the ratio of cytosine/thymine. Multiple CpG sites can be assayed at one time with this method. The gold standard for methylation analysis has traditionally been bisulfite sequencing; however newer technologies may offer advantages over this technique. In particular, the cloning step is labour intensive and is not suitable for high throughput analysis.  b) Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE)  Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) also uses sodium bisulfite to convert unmethylated cytosine residues to uracil, PCR to amplify the DNA, and primer extension with dideoxynucleotides; however, it differs from traditional bisulfite sequencing in two ways [63]. The first difference is that a cloning step is not required, but in some cases an additional nested PCR step may be required to achieve ample product for analysis. The second way in which it differs is that it only measures one CpG site at a time – it is the equivalent of genotyping. A primer is laid down next to the site of interest and that primer is extended by one nucleotide only. The ratio of C genotype to T genotype reflects the degree of methylation at that site. At the beginning of this project, MsSNuPE was used to assay methylation; however, due to decreased time and cost associated with pyrosequencing, the lab has moved away from Ms-SNuPE.  !  18  c) Pyrosequencing  Pyrosequencing also makes use of bisulfite conversion, PCR amplification and primer extension; however, it does not use traditional dideoxy Sanger sequencing [64]. Instead, an enzyme cascade is used to produce light when nucleotides are incorporated into the sequence. Each time a nucleotide is added to the growing sequence, pyrophosphate (PPi) is released. An enzyme called ATP-sulfurylase converts the PPi to ATP; ATP then powers a luciferase-catalyzed reaction that produces light. The amount of light produced is directly related to the number of nucleotides incorporated; therefore, the degree of methylation (i.e. the ratio of the light produced by a C nucleotide to a T nucleotide) is proportional to the light emitted. As with traditional bisulfite sequencing, multiple sites can be assayed at one time; however, the sequence of interest must be known ahead of time. Pyrosequencing is quite high throughput and cost effective.  d) Illumina GoldenGate Methylation Array  The techniques described above all have one thing in common – they can only assay one area at a time. The Illumina GoldenGate Methylation array (Cancer Panel 1) measures methylation at 1,505 CpG sites in 807 genes (70 of which are found in imprinted regions) [65]. Genomic DNA is treated with sodium bisulfite and amplified. CpGs are assayed as single nucleotide polymorphisms using allele specific extension followed by ligation to locus specific DNA sequences. The ligation adds universal priming sites and a bead “address” to the target DNA. The target regions are then amplified with fluorescently labelled universal primers and hybridized to the array beads. The degree of fluorescence (red !  19  is methylated, green is unmethylated) is the measure of methylation. There are two major drawbacks to this method: 1. the cost is substantial; 2. it may overestimate methylation differences. This, and other methylation arrays, function well as a tool to help identify candidate genes that merit further study. The next generation of Illumina is the Infinium Array that measures methylation at over 27,000 sites in over 14,000 genes.  1.6.4. The Placenta and Genomic Imprinting  The emergence of the placenta in mammals has been suggested to be a driving force for the evolution of genomic imprinting. With the development of placentation, new challenges were imposed on the mother. The placental mammals had to ensure a delicate balance was maintained during reproduction - the female had to allow for the growth and development of a new organism within her (half of which was foreign) while restraining the growth of this new organism so her own wellbeing was not sacrificed [66]. When the zygote implants itself in the uterus, there must be some limitation on the ability of the placenta to invade the maternal tissues or the mother might not survive her pregnancy. In this instance, it is likely that paternally expressed genes would promote growth of the fetus and increase the maternal invasion by the placenta, whereas maternally expressed genes would restrict these functions [67]. In keeping with this hypothesis, the majority of imprinted genes are found in eutherian mammals and these genes tend to influence growth. Knockouts of some genes in mouse models have been shown to affect the structure and function of the placenta; paternally expressed genes decrease placental function when knocked out [68] and vice-versa for maternally expressed genes [69]. One such imprinted gene that is critically important in normal embryonic and placental development is Igf2. For !  20  example, complete loss of Igf2 expression in mice (fetus and placenta) resulted in 40% growth retardation at birth [70]; in contrast, biallelic expression can result in overgrowth of up to 160% [71] and cancer development [72]. High levels of Igf2 have also been associated with various malformations and intrauterine death [73]. Complete loss of Igf2 expression in the placenta alone results in decreased placental nutrient transfer [74], severe placental growth retardation, loss of glycogen cells, and ultimately in fetal growth restriction [14]. Although the placenta plays an important role in coordinating fetal growth and development, there is some evidence to suggest that epigenetic regulation of gene expression appears to be less stable and more environmentally responsive in the placenta than in the fetus itself. Doherty and Mann [17,18] have both demonstrated that preimplantation culture of mouse placental cells can result in the loss of imprinting at a variety of genes (including H19, Snrpn, Ascl2, Xist). In addition to culture effects, methylation at imprinted regions, including ICR1, has been shown to be responsive to outside influences such as, environmental toxins (e.g. TCDD [75]), tamoxifen treatment [76], and prenatal ethanol exposure [77]. One recent study identified periconceptional maternal folic acid as being a factor in decreased birth weight and increased methylation at IGF2 in young children [78]; however, despite progress in understanding the role of epigenetics in mouse development, current knowledge of imprinting in human development is still limited [79]. In the past few years, interest in the role of imprinting in placentation and obstetrical disorders has grown substantially. Several groups have used whole genome arrays to try to better understand the role of imprinted genes. McMinn et al. [80] have shown that eight imprinted genes (PHLDA2, MEST, MEG3, GATM, GNAS, PLAGL1, IGF2 and CDKN1C) are differentially expressed in normal human and IUGR placentas. More recently, Diplas et al. [81] found that nine imprinted genes were differentially expressed in IUGR placentas – !  21  five were up-regulated (PHLDA2, ILK2, NNAT, CCDC86, PEG10) and four were downregulated (PLAGL1, DHCR24, ZNF331, CDKAL1). At the single gene level, Guo et al. [44] reported a reduction in IGF2 expression in small for gestational age human placentas; however, they did not find a concomitant alteration in methylation at the differentially methylated region that controls IGF2 expression. IGF2 has also been shown to play a role in placental transport [68]. Loss of imprinting of PHLDA2 has also been shown to be associated with IUGR [82]. Loss of placental Cdkn1c expression has been shown to produce pre-eclampsia-like symptoms in mice [83], while STOX1 has been suggested to be involved in the pathogenesis of preeclampsia in humans [84]. Biallelic expression of H19 in the human placenta has recently been associated with severe forms of pre-eclampsia [85]. These findings suggest abnormal expression of imprinted genes may be involved in the development of IUGR and preeclampsia, but to date, it has not been well studied in humans.  1.6.5. Selected imprinted genes and associated disorders  a) H19/IGF2 (and ICR1)  The genes for H19 and insulin-like growth factor 2 (IGF2) are found on chromosome 11p15.5 (Figure 1.3). The maternally expressed H19 gene codes for a non-translated RNA of currently unknown function and the paternally expressed IGF2 has been implicated in several growth disorders, primarily Beckwith-Wiedemann (BWS) [86] and Silver-Russell (SRS) [87] syndromes. The two genes are coordinately regulated by a differentially methylated CTCF binding region known as imprinting control region 1 (ICR1), located !  22  between the genes [88]. When ICR1 is unmethylated (as on the maternal allele), CTCF (an insulator protein) binds and blocks the enhancer (downstream of H19) from interacting with IGF2 and H19 gets expressed. When the DMR is methylated (as on the paternal allele), the enhancer can interact with IGF2 resulting in its expression (and the repression of H19) (Figure 1.2). IGF2 plays a role in multiple aspects of embryonic, fetal growth and postnatal growth. Loss of Igf2 expression in the mouse placenta results in severe placental and fetal growth restriction [70]. In humans, a decrease in IGF2 expression was recently reported in small for gestational age placentas as compared to control placentas [44]. Additionally, biallelic expression of H19 (which occurs when the enhancer can’t interact with IGF2) in early gestation human placentas has been correlated with severe forms of pre-eclampsia [85].  Centromeric  Telomeric  Figure 1.3. Map of chromosome 11p15.5 showing selected imprinted genes. Pink boxes represent maternally expressed genes; blue boxes represent paternally expressed genes; yellow boxes represent imprinting control regions (ICR) whose methylation status controls the expression of nearby genes.  !  23  Changes to the methylation status of ICR1 are associated with two clinical syndromes: Beckwith-Wiedemann (BWS) and Silver-Russell (SRS). ICR1 hypermethylation can lead to an increase in expression of IGF2 and the resulting pre- and post-natal overgrowth in BWS [89,90]. Children with BWS also have large tongues, omphalocoeles, and severe hypoglycemia. Biallelic expression of IGF2 is also involved in the development of Wilms’ tumour that is seen at increased frequency in children affected by BWS. Approximately 10% of BWS cases are caused by hypermethylation of ICR1 [90,91]. ICR1 hypomethylation and consequent repression of IGF2 expression occurs in approximately one-third of patients with Silver Russell syndrome (SRS) [87]. SRS is characterized by pre- and postnatal growth deficiency, feeding difficulties, body asymmetry, failure to thrive and developmental delay.  b) CDKN1C (and ICR2)  Imprinting control region 2 (ICR2, KvDMR1), located centromeric to ICR1 on 11p15.5, is normally methylated on the maternal allele and controls the expression levels of several nearby genes, including CDKN1C (Figure 1.3). Loss of methylation at ICR2 accounts for approximately 50% of all BWS cases [90,92] and a maternally inherited duplication with gain of methylation of this region has been reported in a patient with SRS [93]. Loss of methylation at ICR2 results in decreased cyclin-dependent kinase inhibitor 1C (CDKN1C) expression (maternally expressed). CDKN1C encodes for a negative regulator of the cell cycle and overexpression of CDKN1C can cause cells to arrest in G1. In contrast, loss of Cdkn1c expression in fetal mice correlates with some phenotypes of BWS !  24  and pre-eclampsia in humans (e.g. placentomegaly and trophoblastic hyperplasia) [83] and approximately 40% of BWS familial cases involve loss of function mutations in CDKN1C [61].  c) PHLDA2/IPL/TSSC3  PHLDA2 (found on chromosome 11p15.5) codes for a cytoplasmic protein with a pleckstrin-homology (PH) domain; the protein may play a role in apoptosis and growth inhibition [94]. It is expressed from the maternal allele in both the placenta and the liver. In mice, knockouts of the maternal allele result in placental overgrowth without obvious effects on the fetus [95]. In contrast, over-expression of Phlda2 from a transgene causes a reduction in placental development indicating that Phlda2 may be a negative regulator of placental growth [96]. In humans, elevated expression of PHLDA2 has been reported in the placentas of babies born with low birth weight [82].  d) PEG1/MEST  Paternally expressed gene 1 (PEG1) is also known as mesoderm-specific transcript (MEST). It is located at 7q32 – a region that may be associated with SRS. Uniparental disomy (UPD, a situation in which both copies of a gene, region, or chromosome come from one parent) of this region has been reported in SRS [97,98] and hypermethylation of this gene has been reported in SRS following assisted reproduction [99], although MEST’s involvement in SRS is hotly contested [100,101]. The gene codes for an !-hydrolase enzyme and is known to be imprinted in a variety of fetal tissues [102]. In mice, paternal !  25  transmission of a knockout results in placental and embryonic growth retardation. Postnatally, these mutants continue to suffer from reduced growth and survival. Additionally, parthenogenetic embryos do not develop past day 10, coinciding with the highest expression of murine Mest [103]. Female mice that are deficient for Mest show a reduction in normal maternal behaviours (e.g. impaired placentophagia, deficient nest building and young gathering) [104]. MEST has also been shown to be imprinted in human placentas [103] and may play a role in placental development and angiogenesis [105].  e) PEG3  Paternally expressed gene 3 (PEG3) is found at 19q13.4 and codes for a zinc finger protein that may a play a role in the tumour necrosis factor pathway (mediates cell proliferation, differentiation and apoptosis). In mice, a Peg3 knockout has been created through insertion of a !geo cassette into the fifth exon of the gene [106]. The Peg3 deficient mice are viable, but the placentas of mutant embryos are smaller than normal and infants may suffer from growth restriction. In addition, mutant females are deficient in maternal behaviours (e.g. nest building, keeping pups warm) and because of this lack of maternal care there is decreased infant feeding and growth and consequently an increase in infant mortality. Expression of human PEG3 is considerably higher in the villous cytotrophoblast than in the corresponding decidua (expression has not been reported in other placental cells). As PEG3 is expressed in proliferating cells, it may play a role in placental growth. This hypothesis is corroborated with the finding that Peg3 deficient mice have small placentas [107].  !  26  f) PLAGL1/ZAC/LOT1  PLAGL1 is a paternally expressed gene located on chromosome 6q24 originally identified as an imprinted gene in 2000 [108]. Uniparental disomy for 6q24 has been reported in patients with transient neonatal diabetes (TNDM), which is associated with IUGR, dehydration, hyperglycemia and failure to thrive; it usually resolves by six months of age [109]. In patients with no chromosomal changes, loss of methylation at an imprinting control region near the gene has also been implicated in TNDM [110,111]. Additionally, Plagl1 has also been reported to be a member of an imprinted gene network (along with Igf2, H19, Cdkn1c, Kcnq1ot1 and Dlk1) that is involved in the regulation of mouse embryonic growth [112]. Decreased expression of murine Plagl1 can result in IUGR, bone anomalies, and neonatal mortality. In humans, this imprinted gene network may also be involved in BWS as PLAGL1 interacts with LIT1 (KCNQ1OT1) on 11p15.5 to influence the expression of CDKN1C, a gene known to be involved in the pathogenesis of some cases of BWS [113].  g) STOX1  STOX1 is maternally expressed from chromosome 10q22 in early placental development, particularly in extravillous trophoblast cells (EVTs). It was first thought to play a role in pre-eclampsia when it was discovered that, in Dutch families, pre-eclampsia segregated with a susceptibility locus on chromosome 10q22 [114]. Development of preeclampsia has been linked to various missense mutations within the gene, but pre-eclampsia only develops when the mutation is passed through the maternal allele. This loss of function !  27  can result in the failure of extravillous trophoblast cells to take on an invasive phenotype that leads to placental insufficiency and then to pre-eclampsia. There is ongoing conflict however as to whether the gene is indeed imprinted [115] and/or involved in pre-eclampsia [116].  h) CTNNA3  CTNNA3 is found on chromosome 10q21.3 and codes for alpha T-catenin, which is necessary for cell-cell adhesion complexes. Transcription of the gene in the placenta is high in normal first trimester development. The maternal allele is preferentially expressed in the placenta, but imprinting is actually limited to the villous cytotrophoblasts and biallelic expression is seen in extravillous cytotrophoblasts [117]. The transition from proliferating, anchoring villi to motile, invasive extravillous cytotrophoblasts correlates with a decrease in alpha T-catenin levels [84]. Abnormal transcription of cellular adhesion molecules in invasive cytotrophoblasts is thought to be an early sign of pre-eclampsia and increased expression of CTNNA3 in invasive trophoblasts could result in their decreased ability to invade the uterine wall and could potentially lead to pre-eclampsia [118].  1.7. The goals of this thesis  1.7.1. Research questions  Are epigenetic modifications (i.e. DNA methylation) and altered expression of imprinted genes in the human placenta a contributing factor to maternal pre-eclampsia !  28  (PET) and fetal IUGR? Also, what methylation-based assays for imprinted regions could be used to facilitate the diagnosis of placental pathologies that are associated with abnormal imprinting (i.e. triploidy, hydatidiform moles, and placental mesenchymal dysplasia)?  1.7.2. Hypothesis  Given that DNA methylation and imprinted gene expression appear to be important in the regulation of embryonic growth and placental development in the mouse, I hypothesize the disruption of normal patterns of DNA methylation associated with imprinted gene expression in early development is a significant cause of human placental insufficiency leading to maternal pre-eclampsia and fetal IUGR.  1.7.3. Objective 1 – Characterization of imprinting in normal placentas  The first objective of this project was to characterize methylation and imprinted gene expression in term placental whole villi. Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) and pyrosequencing were used to assess methylation of functionally important CpG sites within or near the H19, CDKN1C, PLAGL1, MEST, PEG10, and SNRPN imprinted genes. These genes were chosen for their important role in placental development in murine studies. Illumina GoldenGate Methylation arrays were used to assay methylation at the whole genome level. Illumina HumanRef-8 v2 Bead Chip arrays were used to measure imprinted gene expression levels.  !  29  1.7.4. Objective 2 – Identification of abnormal patterns of imprinting in placentas associated with PET and/or IUGR  The second part of the project was to identify abnormal patterns of methylation and imprinting errors in chorionic villi from placentas that are from pregnancies associated with PET and/or IUGR and to identify if these changes are restricted to the chorionic villi. As with the controls, MS-SNuPE and pyrosequencing were used to assess CpG sites within or near individual genes and Illumina GoldenGate Methylation arrays were used to assay methylation at the whole genome level and to identify candidate genes that merit further study by identifying major epigenetic changes between normal and affected placentas. Samples were also assessed with the Illumina HumanRef-8 v2 Bead Chip expression array to measure imprinted gene expression levels.  1.7.5. Objective 3 – Design of imprinted gene methylation assays for the diagnosis of placental conditions  The final part of this project was to design new methylation assays that may aid in the diagnosis of various conditions. To help diagnose conditions such as IUGR and PET, loci that have variable methylation may be most useful as they allow the placenta to adapt to changing environmental conditions. In contrast, the diagnosis of hydatidiform moles or identification of parent of origin in triploidy, would be best served by studying loci that are less variable and maintain their imprinting status in a variety of situations.  !  30  1.7.6. Introduction to Manuscript 1  Manuscript 1 addresses the main objectives of the thesis (Objectives 1 and 2): whether abnormal regulation (both methylation and expression) of imprinted genes is associated with PET and/or IUGR. This manuscript has been published in Placenta [119].  1.7.7. Introduction to Manuscript 2  Manuscript 2 originally outlined a new pyrosequencing assay designed to measure methylation at KvDMR1 (found on chromosome 11p15.5) and its application to the study of fetal and placental disorders. It has since evolved to address Objective 3 by presenting a comparison of methylation assays for imprinted loci to determine which may be the most useful in the diagnosis of hydatidiform moles (complete and partial) and parent of origin in triploidy. This manuscript has been accepted for publication in Clinical Genetics.  !  31  1.8  References  [1] BC Vital Statistics Agency. Selected Vital Statistics and Health Status Indicators, 133rd Annual Report. 2004. [2] Brodsky D, Christou H. Current concepts in intrauterine growth restriction. J Intensive Care Med 2004; 19:307-319. [3] Seidman DS, Laor A, Gale R, Stevenson DK, Mashiach S, Danon YL. Pre-eclampsia and offspring’s blood pressure, cognitive ability and physical development at 17-years-ofage. BJOG 1991; 98:1009-1014. [4] Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet 2005; 365:785-799. [5] Walker JJ. Pre-eclampsia. Lancet 2000; 356:1260-1265. [6] Irgens HU, Reisaeter L, Irgens LM, Lie RT. Long term mortality of mothers and fathers after pre-eclampsia: population based cohort study. BMJ 2001; 323:1213-1217. [7] Barker DJ. The long-term outcome of fetal retarded growth. Clin Obstet Gynecol 1997; 40:853-863. [8] Resnik R. Intrauterine growth restriction. Obstet Gynecol 2002; 99:490-496. [9] Strauss RS. Adult Functional Outcome of Those Born Small for Gestational Age: Twenty-six-Year Follow-up of the 1970 British Birth Cohort. JAMA 2000; 283:625-632. [10] Hack M. Effects of intrauterine growth retardation on mental performance and behavior, outcomes during adolescence and adulthood. Eur J Clin Nut. 1998; 52 Suppl 1:S65-70. [11] Liu A, Wen SW, Bottomley J, Walker MC, Smith G. Utilization of health care services of pregnant women complicated by preeclampsia in Ontario. Hypertens Pregnancy 2009; 28:76-84. [12] Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science 2005; 308:1592-1594. [13] Rossant J, Cross JC. Placental development: lessons from mouse mutants. Nat Rev Genet 2001; 2:538-548. [14] Fowden AL, Sibley C, Reik W, Constancia M. Imprinted genes, placental development and fetal growth. Horm Res 2006; 65:50-58. [15] Angiolini E, Fowden A, Coan P, Sandovici I, Smith P, Dean W, Burton G, Tycko B, Reik W, Sibley C, Constancia M. Regulation of placental efficiency for nutrient transport by imprinted genes. Placenta 2006; 27:S98-S102. [16] Morgan HD,Santos F,Green K,Dean W,Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet 2005; 14:R47-R58. [17] Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000; 62:1526-1535. [18] Mann MRW,Lee SS,Doherty AS,Verona RI,Nolen LD,Schultz RM,Bartolomei MS. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004; 131:3727-3735. [19] Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet 2005; 14 Spec No 1:R47-58. [20] Reik W, Davies K, Dean W, Kelsey G, Constancia M. Imprinted genes and the coordination of fetal and postnatal growth in mammals. Novartis Found Symp 2001; 237:1931-discussion 31-42. !  32  [21] Carter AM, Enders AC, Jones CJ, Mess A, Pfarrer C, Pijnenborg R, Soma H. Comparative placentation and animal models: patterns of trophoblast invasion -- a workshop report. Placenta 2006; 27 Suppl A:S30-3. [22] Zechner U, Shi W, Hemberger M, Himmelbauer H, Otto S, Orth A, Kalscheuer V, Fischer U, Elango R, Reis A, Vogel W, Ropers H, Ruschendorf F, Fundele R. Divergent genetic and epigenetic post-zygotic isolation mechanisms in Mus and Peromyscus. J Evol Biol 2004; 17:453-460. [23] Benirschke K, Kaufmann P. Pathology of the Human Placenta. 1995; Springer-Verlag New York Inc.: New York, NY. [24] Kliman HJ. Encyclopedia of Reproduction - From Trophoblast to Human Placenta. 1998; 2009. [25] Brosens JJ, Pijnenborg R, Brosens IA. The myometrial junctional zone spiral arteries in normal and abnormal pregnancies. Am J Obstet Gynecol 2002; 187:1416-1423. [26] Benirschke K, Kaufmann P, Baergen R. Early Development of the Human Placenta. In Pathology of the Human Placenta. 2006 pp 42-29. Springer: New York, NY. [27] Handwerger S, Aronow B. Dynamic changes in gene expression during human trophoblast differentiation. Recent Prog Horm Res 2003; 58:263-281. [28] Kaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod 2003; 69:1-7. [29] Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human placental development by oxygen tension. Science 1997; 277:1669-1672. [30] Guillemin K, Krasnow MA. The hypoxic response: Huffing and HIFing. Cell 1997; 89:9-12. [31] Georgiades P, Ferguson-Smith AC, Burton GJ. Comparative developmental anatomy of the murine and human definitive placentae. Placenta 2002; 23:3-19. [32] Popek EJ. Normal Anatomy and Histology of the Placenta. In Pathology of the Placenta. 1999(Eds.) Lewis S.H., Perrin E. pp 49-88. Churchill Livingstone: Philadelphia. [33] Tanaka TS, Jaradat SA, Lim MK, Kargul GJ, Wang X, Grahovac MJ, Pantano S, Sano Y, Piao Y, Nagaraja R, Doi H, Wood WH, 3rd, Becker KG, Ko MS. Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray. PNAS 2000; 97:9127-9132. [34] Sood R, Zehnder JL, Druzin ML, Brown PO. Gene expression patterns in human placenta. PNAS 2006; 103:5478-5483. [35] Cross JC, Baczyk D, Dobric N, Hemberger M, Hughes M, Simmons DG, Yamamoto H, Kingdom JCP. Genes, development and evolution of the placenta. Placenta 2003; 24:123130. [36] Hemberger M, Cross JC. Genes governing placental development. Trends Endocrinol Metab 2001; 12:162-168. [37] von Dadelszen P, Magee L, Roberts JM. Subclassification of pre-eclampsia. Hypertens Pregnancy 2001; 38:718-721. [38] Murphy DJ, Stirrat GM. Mortality and morbidity associated with early-onset preeclampsia. Hypertens Pregnancy 2000; 19:221-231. [39] Kaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod 2003; 69:1-7.  !  33  [40] Roberts JM, Redman CW. Pre-eclampsia: more than pregnancy-induced hypertension. The Lancet 1993; 341:1447-1451. [41] von Dadelszen P,Magee LA,Marshall JC,Rotstein OD. The maternal syndrome of preeclampsia: a forme fruste of the systemic inflammatory response syndrome. Sepsis 2000; 4:43-47. [42] Yong PJ, Langlois S, von Dadelszen P, Robinson WP. The association between preeclampsia and placental trisomy 16 mosaicism. Prenatal Diagnosis 2006; 26:956-961. [43] Khong TY, De Wolf F, Robertson WB, Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-forgestational age infants. BJOG 1986; 93:1049-1059. [44] Guo L, Choufani S, Ferreira J, Smith A, Chitayat D, Shuman C, Uxa R, Keating S, Kingdom J, Weksberg R. Altered gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA) placentae. Dev Biol 2008; 320:79-91. [45] Pardi G, Cetin I, Marconi AM, Lanfranchi A, Bozzetti P, Ferrazzi E, Buscaglia M, Battaglia FC. Diagnostic value of blood sampling in fetuses with growth retardation. NEJM 1993; 328:692-696. [46] Cetin I, Ronzoni S, Marconi AM, Perugino G, Corbetta C, Battaglia FC, Pardi G. Maternal concentrations and fetal-maternal concentration differences of plasma amino acids in normal and intrauterine growth-restricted pregnancies. AJOG 1996; 174:1575-1583. [47] Triche EW, Hossain N. Environmental factors implicated in the causation of adverse pregnancy outcome. Semin Perinatol 2007; 31:240-242. [48] Amiel A,Bouaron N,Kidron D,Sharony R,Gaber E,Fejgin MD. CGH in the detection of confined placental mosaicism (CPM) in placentas of abnormal pregnancies. Prenat Diagnon 2002; 22:752-758. [49] Roberts DJ, Post MD. The placenta in pre-eclampsia and intrauterine growth restriction. J Clin Pathol 2008; 61:1254-1260. [50] Moffett-King A. Natural killer cells and pregnancy. Nat Rev Immunol 2002; 2:656-663. [51] Cetin I, Alvino G. Intrauterine growth restriction: implications for placental metabolism and transport. A review. Placenta 2009; 30 Suppl A:S77-82. [52] McGrath J, Solter D. Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 1984; 37:179-183. [53] Surani MA, Barton SC, Norris ML. Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 1984; 308:548-550. [54] Cattanach BM, Kirk M. Differential activity of maternally and paternally derived chromosome regions in mice. Nature 1985; 315:496-498. [55] Robinson WP, Lauzon JL, Innes AM, Lim K, Arsovska S, McFadden DE. Origin and outcome of pregnancies affected by androgenetic/biparental chimerism. Hum Reprod 2007; 22:1114-1122. [56] Kaiser-Rogers KA, McFadden DE, Livasy CA, Dansereau J, Jiang R, Knops JF, Lefebvre L, Rao KW, Robinson WP. Androgenetic/biparental mosaicism causes placental mesenchymal dysplasia. J.Med.Genet. 2006; 43:187-192. [57] Kajii T, Ohama K. Androgenetic origin of hydatidiform mole. Nature 1977; 268:633634. [58] McFadden DE, Kalousek DK. Two different phenotypes of fetuses with chromosomal triploidy: correlation with parental origin of the extra haploid set. Am J Med Genet 1991; 38:535-538. !  34  [59] Tycko B, Morison IM. Physiological functions of imprinted genes. J Cell Physiol 2002; 192:245-258. [60] Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001; 293:1089-1093. [61] Maher ER, Reik W. Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J Clin Invest 2000; 105:247-252. [62] Reik W, Murrell A. Genomic imprinting. Silence across the border. Nature 2000; 405:408-409. [63] Laird PW. Principles and challenges of genome-wide DNA methylation analysis. Nat Rev Genet 2010; 11:191-203. [64] Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001; 11:311. [65] Illumina. Assay Technology 2010; 2010. [66] Hall JG. Genomic imprinting: review and relevance to human diseases. Am J Hum Genet 1990; 46:857-873. [67] Sleutels F, Barlow DP. The origins of genomic imprinting in mammals. Adv Genet 2002; 46:119-163. [68] Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W. Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 2002; 417:945-948. [69] Takahashi K, Kobayashi T, Kanayama N. p57Kip2 regulates the proper development of labyrinthine and spongiotrophoblasts. Mol Hum Reprod 2000; 6:1019-1025. [70] DeChiara TM, Efstratiadis A, Robertson EJ. A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 1990; 345:78-80. [71] Sun FL, Dean WL, Kelsey G, Allen ND, Reik W. Transactivation of Igf2 in a mouse model of Beckwith-Wiedemann syndrome. Nature 1997; 389:809-815. [72] Sakatani T, Kaneda A, Iacobuzio-Donahue CA, Carter MG, de Boom Witzel S, Okano H, Ko MSH, Ohlsson R, Longo DL, Feinberg AP. Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice. Science 2005; 307:1976-1978. [73] Reik W, Constancia M, Dean W, Davies K, Bowden L, Murrell A, Feil R, Walter J, Kelsey G. Igf2 imprinting in development and disease. Int J Dev Biol 2000; 44:145-150. [74] Sibley CP, Coan PM, Ferguson-Smith AC, Dean W, Hughes J, Smith P, Reik W, Burton GJ, Fowden AL, Constância M. Placental-specific insulin-like growth factor 2 (Igf2) regulates the diffusional exchange characteristics of the mouse placenta. PNAS USA 2004; 101:8204-8208. [75] Wu Q, Ohsako S, Ishimura R, Suzuki JS, Tohyama C. Exposure of mouse preimplantation embryos to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the methylation status of imprinted genes H19 and Igf2. Biol Reprod 2004; 70:1790-1797. [76] Pathak S, Kedia-Mokashi N, Saxena M, D'Souza R, Maitra A, Parte P, Gill-Sharma M, Balasinor N. Effect of tamoxifen treatment on global and insulin-like growth factor 2-H19 locus-specific DNA methylation in rat spermatozoa and its association with embryo loss. Fertil Steril 2009; 91:2253-2263. [77] Haycock PC, Ramsay M. Exposure of mouse embryos to ethanol during preimplantation development: effect on DNA methylation in the h19 imprinting control region. Biol Reprod 2009; 81:618-627.  !  35  [78] Steegers-Theunissen RP, Obermann-Borst SA, Kremer D, Lindemans J, Siebel C, Steegers EA, Slagboom PE, Heijmans BT. Periconceptional maternal folic acid use of 400 microg per day is related to increased methylation of the IGF2 gene in the very young child. PLoS One 2009; 4:e7845. [79] Wagschal A, Feil R. Genomic imprinting in the placenta. Cytogenet Genome Res 2006; 113:90-98. [80] McMinn J, Wei M, Schupf N, Cusmai J, Johnson EB, Smith AC, Weksberg R, Thaker HM, Tycko B. Unbalanced placental expression of imprinted genes in human intrauterine growth restriction. Placenta 2006; 27:540-549. [81] Diplas AI, Lambertini L, Lee MJ, Sperling R, Lee YL, Wetmur J, Chen J. Differential expression of imprinted genes in normal and IUGR human placentas. Epigenetics 2009; 4:235-40. [82] Apostolidou S, Abu-Amero S, O'Donoghue K, Frost J, Olafsdottir O, Chavele KM, Whittaker JC, Loughna P, Stanier P, Moore GE. Elevated placental expression of the imprinted PHLDA2 gene is associated with low birth weight. J Mol Med 2007; 85:379-387. [83] Kanayama N, Takahashi K, Matsuura T, Sugimura M, Kobayashi T, Moniwa N, Tomita M, Nakayama K. Deficiency in p57Kip2 expression induces preeclampsia-like symptoms in mice. Mol Hum Reprod 2002; 8:1129-1135. [84] van Dijk M, Mulders J, Könst A, Janssens B, van Roy F, Blankenstein M, Oudejans C. Differential downregulation of alphaT-catenin expression in placenta: trophoblast cell typedependent imprinting of the CTNNA3 gene. Gene Expression Patterns 2004; 5:61-65. [85] Yu L, Chen M, Zhao D, Yi P, Lu L, Han J, Zheng X, Zhou Y, Li L. The H19 gene imprinting in normal pregnancy and pre-eclampsia. Placenta 2009; 30:443-447. [86] Weksberg R, Shen DR, Fei YL, Song QL, Squire J. Disruption of insulin"like growth factor 2 imprinting in Beckwith"Wiedemann syndrome. Nat Genet 1993; 5:143-150. [87] Gicquel C, Rossignol S, Cabrol S, Houang M, Steunou V, Barbu V, Danton F, Thibaud N, Le Merrer M, Burglen L, Bertrand A, Netchine I, Le Bouc Y. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver-Russell syndrome. Nat Genet 2005; 37:1003-1007. [88] Engel N, West AG, Felsenfeld G, Bartolomei MS. Antagonism between DNA hypermethylation and enhancer-blocking activity at the H19 DMD is uncovered by CpG mutations. Nat Genet 2004; 36:883-888. [89] Weksberg R, Smith AC, Squire J, Sadowski PD. Beckwith-Wiedemann syndrome demonstrates a role for epigenetic control of normal development. Hum Mol Genet 2003; 12:R61-R68. [90] Weksberg R, Shuman C, Smith AC. Beckwith-Wiedemann syndrome. Am J Med Genet C Semin Med Genet 2005; 137:12-23. [91] Weksberg R, Nishikawa J, Caluseriu O, Fei Y-, Shuman C, Wei C, Steele L, Cameron J, Smith A, Ambus I, Li M, Ray PN, Sadowski P, Squire J. Tumor development in the Beckwith-Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 2001; 10:2989-3000. [92] Smilinich NJ, Day CD, Fitzpatrick GV, Caldwell GM, Lossie AC, Cooper PR, Smallwood AC, Joyce JA, Schofield PN, Reik W, Nicholls RD, Weksberg R, Driscoll DJ, Maher ER, Shows TB, Higgins MJ. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith– Wiedemann syndrome. PNAS 1999; 96:8064-8069. !  36  [93] Schonherr N, Meyer E, Roos A, Schmidt A, Wollmann HA, Eggermann T. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 2007; 44:59-63. [94] Muller S, van den Boom D, Zirkel D, Koster H, Berthold F, Schwab M, Westphal M, Zumkeller W. Retention of imprinting of the human apoptosis-related gene TSSC3 in human brain tumors. Hum Mol Genet 2000; 9:757-763. [95] Frank D, Fortino W, Clark L, Musalo R, Wang W, Saxena A, Li C-, Reik W, Ludwig T, Tycko B. Placental overgrowth in mice lacking the imprinted gene Ipl. PNAS 2002; 99:7490-7495. [96] Salas M, John R, Saxena A, Barton S, Frank D, Fitzpatrick G, Higgins MJ, Tycko B. Placental growth retardation due to loss of imprinting of Phlda2. Mech Dev 2004; 121:11991210. [97] Kotzot D, Schmitt S, Bernasconi F, Robinson WP, Lurie IW, Ilyina H, Mehes K, Hamel BC, Otten BJ, Hergersberg M. Uniparental disomy 7 in Silver-Russell syndrome and primordial growth retardation. Hum Mol Genet 1995; 4:583-587. [98] Russo S, Bedeschi MF, Cogliati F, Natacci F, Gianotti A, Parini R, Selicorni A, Larizza L. Maternal chromosome 7 hetero/isodisomy in Silver-Russell syndrome and PEG1 biallelic expression. Clin Dysmorphol 2000; 9:157-162. [99] Kagami M, Nagai T, Fukami M, Yamazawa K, Ogata T. Silver-Russell syndrome in a girl born after in vitro fertilization: partial hypermethylation at the differentially methylated region of PEG1/MEST. J Assist Reprod Genet 2007; 24:131-136. [100] Riesewijk AM, Blagitko N, Schinzel AA, Hu L, Schulz U, Hamel BC, Ropers HH, Kalscheuer VM. Evidence against a major role of PEG1/MEST in Silver-Russell syndrome. Eur J Hum Genet 1998; 6:114-120. [101] Kobayashi S, Uemura H, Kohda T, Nagai T, Chinen Y, Naritomi K, Kinoshita EI, Ohashi H, Imaizumi K, Tsukahara M, Sugio Y, Tonoki H, Kishino T, Tanaka T, Yamada M, Tsutsumi O, Niikawa N, Kaneko-Ishino T, Ishino F. No evidence of PEG1/MEST gene mutations in Silver-Russell syndrome patients. Am J Med Genet 2001; 104:225-231. [102] Kaneko-Ishino T, Kuroiwa Y, Miyoshi N, Kohda T, Suzuki R, Yokoyama M, Viville S, Barton SC, Ishino F, Surani MA. Peg1/Mest imprinted gene on chromosome 6 identified by cDNA subtraction hybridization. Nat Genet 1995; 11:52-59. [103] Kobayashi S, Kohda T, Miyoshi N, Kuroiwa Y, Aisaka K, Tsutsumi O, KanekoIshino T, Ishino F. Human PEG1/MEST, an imprinted gene on chromosome 7. Hum Mol Genet 1997; 6:781-786. [104] Lefebvre L, Viville L, Barton SC, Ishino F, Keverne EB, Surani MA. Abnormal maternal behaviour and growth retardation associated with loss of the imprinted gene Mest. Nat Genet 1998; 20:163-169. [105] Mayer W,Hemberger M,Frank HG,Grümmer R,Winterhager E,Kaufmann P,Fundele R. Expression of the imprinted genes MEST/Mest in human and murine placenta suggests a role in angiogenesis. Dev Dyn 2000; 217:1-10. [106] Li L-,Keverne EB,Aparicio SA,Ishino F,Barton SC,Surani MA. Regulation of maternal behavior and offspring growth by paternally expressed Peg3. Science 1999; 284:330-333. [107] Hiby SE,Lough M,Keverne EB,Surani MA,Loke YW,King A. Paternal monoallelic expression of PEG3 in the human placenta. Hum Mol Genet 2001; 10:1093-1100. [108] Kamiya M, Judson H, Okazaki Y, Kusakabe M, Muramatsu M, Takada S, Takagi N, Arima T, Wake N, Kamimura K, Satomura K, Hermann R, Bonthron DT, Hayashizaki Y. !  37  The cell cycle control gene ZAC/PLAGL1 is imprinted--a strong candidate gene for transient neonatal diabetes. Hum Mol Genet 2000; 9:453-460. [109] Gardner RJ, Robinson DO, Lamont L, Shield JP, Temple IK. Paternal uniparental disomy of chromosome 6 and transient neonatal diabetes mellitus. Clin Genet 1998; 54:522525. [110] Gardner RJ,Mackay DJ,Mungall AJ,Polychronakos C,Siebert R,Shield JP,Temple IK,Robinson DO. An imprinted locus associated with transient neonatal diabetes mellitus. Hum Mol Genet 2000; 9:589-596. [111] Arima T, Drewell RA, Arney KL, Inoue J, Makita Y, Hata A, Oshimura M, Wake N, Surani MA. A conserved imprinting control region at the HYMAI/ZAC domain is implicated in transient neonatal diabetes mellitus. Hum Mol Genet 2001; 10:1475-1483. [112] Varrault A, Gueydan C, Delalbre A, Bellmann A, Houssami S, Aknin C, Severac D, Chotard L, Kahli M, Le Digarcher A, Pavlidis P, Journot L. Zac1 regulates an imprinted gene network critically involved in the control of embryonic growth. Dev Cell 2006; 11:711-722. [113] Arima T,Kamikihara T,Hayashida T,Kato K,Inoue T,Shirayoshi Y,Oshimura M,Soejima H,Mukai T,Wake N. ZAC, LIT1 (KCNQ1OT1) and p57KIP2 (CDKN1C) are in an imprinted gene network that may play a role in Beckwith–Wiedemann syndrome. Nucleic Acids Research 2005; 33:2650-2660. [114] van Dijk M, Mulders J, Poutsma A, Konst AA, Lachmeijer AM, Dekker GA, Blankenstein MA, Oudejans CB. Maternal segregation of the Dutch preeclampsia locus at 10q22 with a new member of the winged helix gene family. Nat Genet 2005; 37:514-519. [115] Iglesias-Platas I, Monk D, Jebbink J, Buimer M, Boer K, van der Post J, Hills F, Apostolidou S, Ris-Stalpers C, Stanier P, Moore GE. STOX1 is not imprinted and is not likely to be involved in preeclampsia. Nat Genet 2007; 39:279-80. [116] Kivinen K, Peterson H, Hiltunen L, Laivuori H, Heino S, Tiala I, Knuutila S, Rasi V, Kere J. Evaluation of STOX1 as a preeclampsia candidate gene in a population-wide sample. Eur J Hum Genet 2007; 15:494-497. [117] Oudejans CBM, Mulders J, Lachmeijer AMA, van Dijk M, Könst AAM, Westerman BA, van Wijk IJ, Leegwater PAJ, Kato HD, Matsuda T, Wake N, Dekker GA, Pals G, ten Kate LP, Blankenstein MA. The parent-of-origin effect of 10q22 in pre-eclamptic females coincides with two regions clustered for genes with down-regulated expression in androgenetic placentas. Mol Hum Reprod 2004; 10:589-598. [118] Zhou Y, Damsky CH, Chiu K, Roberts JM, Fisher SJ. Preeclampsia is associated with abnormal expression of adhesion molecules by invasive cytotrophoblasts. J Clin Invest 1993; 91:950-960. [119] Bourque DK, Avila L, Peñaherrera MS, von Dadelszen P, Robinson WP. Methylation at the H19 and IGF2 imprinting control region is decreased in placentas associated with normotensive intrauterine growth restriction but not preeclampsia. Placenta 2010; 31:197202.  !  38  ! CHAPTER 2. MANUSCRIPT 1: Decreased placental methylation at the H19/IGF2 imprinting control region is associated with normotensive intrauterine growth restriction but not preeclampsia.  2.1. Introduction Abnormal placental development is responsible for a wide-range of pregnancy complications including infertility, miscarriage, maternal pre-eclampsia (PET) and intrauterine growth restriction (IUGR). Pre-eclampsia affects approximately 5% of pregnancies and can be fatal for both the mother and fetus. The fetal syndrome of preeclampsia may manifest as IUGR [1] and both normotensive IUGR and pre-eclampsia are associated with a deficiency of extravillous trophoblast (EVT) invasion leading to incomplete remodeling of the maternal spiral arteries [2,3]. This in turn limits the transfer of nutrients and wastes between the fetus and mother. Placentas from pregnancies associated with maternal pre-eclampsia also have areas of syncytial knots (clusters of preapoptotic/apoptotic nuclei) and areas of necrosis associated with loss of the syncytial trophoblast microvillous membranes (STBM). Excess STBM are observed in early-onset pre-eclampsia but not in normotensive IUGR [4]. Although confined placental trisomy can contribute to placental insufficiency in some cases [5,6] the initiating cause for abnormal trophoblast development in most cases is largely unknown and likely heterogeneous in etiology. Many imprinted genes, those exhibiting parent-of origin differences in gene expression, are intimately involved with the regulation of embryonic growth and placental A version of this chapter has been published. DK Bourque, L Avila, M Peñaherrera, P von Dadelszen, WP Robinson. Decreased placental methylation at the H19/IGF2 imprinting control region is associated with normotensive intrauterine growth restriction but not preeclampsia. Placenta 2010; 31:197-202.  !  39!  development [7,8] and disruption of imprinting in mouse models can result in abnormal placental development and fetal growth [9]. Although the placenta plays a critical role in coordinating fetal growth and development, regulation of imprinted gene expression appears to be less stable in the placenta than in the fetus itself. Preimplantation culture of mouse embryos can lead to loss of placental imprinting at multiple genes and is affected by the culture media used [10,11]. This instability and relaxation of methylation may aid the placenta in adapting to changing physiological conditions. It has thus been hypothesized that sporadic loss-of-imprinting errors could also occur in human placentas and contribute to abnormal fetal growth. However, it has also been suggested that imprinting may be less maintained in human, as compared to mouse placentas [12]. Over 50 imprinted genes that are distributed in distinct clusters that are regulated by a common imprinting control region (ICR) have been identified in humans [13]. Two clusters of imprinted genes within chromosome 11p15.5, each regulated by a separate imprinting control region (ICR1 and ICR2), have been implicated in fetal and placental growth. The paternally expressed insulin-like growth factor 2 (IGF2) and maternally expressed H19 genes are coordinately regulated by a differentially methylated CTCF binding region known as imprinting control region 1 (ICR1) [14]. The H19 gene codes for a non-translated RNA of currently unknown function, while IGF2 has been implicated in several growth disorders. ICR1 is hypomethylated, leading to repression of IGF2 expression in approximately one-third of patients with Silver Russell syndrome (SRS), a syndrome associated with pre- and postnatal growth deficiency [15], whereas it is hypermethylated leading to an increase in expression of IGF2 in some cases of pre- and post-natal overgrowth diagnosed as Beckwith-Wiedemann syndrome (BWS) [16,17]. Complete loss of Igf2 expression in the mouse placenta results in severe placental and fetal !  40  growth restriction. Recently, a decrease in IGF2 expression was reported in small for gestational age placentas as compared to control placentas [18]. Imprinting control region 2 (KvDMR1), located centromeric to ICR1, is normally methylated on the maternal allele. Loss of methylation at this region has been reported in BWS patients with normal ICR1 methylation [19], and a maternally inherited duplication with gain of methylation of this region has been reported in a patient with SRS [20]. Loss of methylation at ICR2 can result in decreased cyclin-dependent kinase inhibitor 1C (CDKN1C) expression. Loss of Cdkn1c expression in fetal mice correlates with some phenotypes of BWS and pre-eclampsia in humans [21], and approximately 40% of BWS familial cases involve loss of function mutations in CDKN1C [22]. Despite improved understanding of the fundamental role that is played by genomic imprinting in the regulation of placental function in the mouse, current knowledge of imprinting in human placental development is poor [23]. The goal of the present study is to assess the role of aberrant DNA methylation associated with imprinted genes, particularly involving ICR1 and ICR2 within 11p15.5, in human placentas from pregnancies associated with pre-eclampsia and/or IUGR.  2.2. Methods  2.2.1 Sample Ascertainment  Pregnancies were prospectively ascertained through poster recruitment (hospital, midwives and doctors’ offices) or through referral to the EMMA (Evaluating Maternal Markers of Acquired Risk of Pre-eclampsia) Clinic, BC Women’s Hospital. Women are !  41  seen in this clinic if they have at least one of: past history of pre-eclampsia (severe, early onset and/or associated with perinatal loss), pre-existing hypertension, unexplained low first trimester PAPP-A (<0.60 multiples of the median [MoM]), unexplained elevated second trimester alpha-fetoprotein (AFP; >2.5 MoM) or human chorionic gonadotrophin (HCG; >3.0 MoM). Ethics approval for this study was obtained through the University of British Columbia and the BC Children’s & Women’s Hospital ethics boards. Consent was obtained during pregnancy. Placentas were obtained at birth and assigned to control (N=22, mean gestational age, GA=39.0 weeks), intrauterine growth restricted only (IUGR, N=13, mean GA=35.4 weeks), pre-eclampsia (PET, N=17, mean GA=35.9 weeks), and PET with IUGR (P+I, N=21, mean GA=32.5 weeks) outcomes. Intrauterine growth restriction was defined as either (1) birth weight <3rd percentile for gender and gestational age using Canadian charts [24], or (2) birth weight <10th percentile with either of the following ultrasound findings: (a) persistent uterine artery notching at 22+0-24+6 weeks gestation, (b) absent or reversed end diastolic velocity on umbilical artery Doppler, and/or (c) oligohydramnios (amniotic fluid index <50mm). Pre-eclampsia was defined as: (1) at least two of the following: hypertension (sBP #140mmHg and/or dBP #90mmHg, twice, >4h apart) after 20 weeks, and proteinuria defined as #0.3g/d or #2+ dipstick proteinuria after 20 weeks [25], (2) non-hypertensive and non-proteinuric HELLP syndrome, using Sibai's criteria [26], or (3) an isolated eclamptic seizure without preceding hypertension or proteinuria, using the British Eclampsia Survey Team (BEST) criteria to define eclampsia [27] (see Supplementary Table 1 for additional clinical information). Two distinct placental samples of ~1cm3 were biopsied (one near the cord insertion and one near the placental periphery) from the fetal side of each placenta for DNA !  42  extraction. From each site, the surface layers of amnion and chorion were removed before DNA and RNA extraction. Extraction of DNA and RNA was performed using standard techniques. For methylation studies, approximately 300ng of DNA was treated with sodium bisulfite (EZ DNA Methylation-Gold™, Zymo Research, Orange, CA, USA). All placentas were evaluated for the presence of placental trisomy using comparative genomic hybridization [28] and any identified trisomy was confirmed using microsatellite markers. Trisomy was observed in four placentas (Control PM65: 47,XXX; IUGR PM41: 47,XX,+7 and PM72: 46,XX/47,XX,+13; and PET + IUGR PM60: 47,XX,+2) [29]. Trisomy was also present in the amnion for case PM65 but not for cases PM41, PM72 or PM60, indicating that in the latter three cases the trisomy was likely confined to the placenta.  2.2.2. Whole Genome Methylation Arrays  GoldenGate Methylation Cancer Panel 1 arrays (Illumina Inc., San Diego, CA) were used to identify candidate imprinted genes that merit further study. Two independent villous samples were analyzed from each placenta (control, N=5 placentas; IUGR, N=5; and PET, N=4) for a total of 28 analyzed samples. The BeadChip array was processed in the Centre for Molecular Medicine and Therapeutics (CMMT) BioAnalyzer Core Facility (Vancouver, BC, Canada). Output was analyzed using Illumina’s BeadStudio software (v3.2.7, 2007). Parameters for differential methylation analysis were as follows: normalization=average; reference group=control placentas; error model=t-test. The BeadStudio software uses diffscores to represent methylation differences between groups. Samples with a diffscore of greater than ±13 correspond to a nominal (uncorrected) significance p<0.05 (diffscore = |10 !  43  log pval|). Negative diffscores reflect hypomethylation compared to the control group and positive diffscores reflect hypermethylation compared to the control group. The BenjaminiHochberg correction was used to correct for multiple comparisons and results were then further analyzed using the Significance Analysis of Microarrays (SAM) software [30].  2.2.3. Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) for ICR1  Bisulfite converted DNA was PCR amplified using primers F6005 and R6326 and PCR as previously reported [31]. Each 10$L PCR contained: 1X Rose Taq buffer (including 2mM MgCl2), 0.125mM dNTP, 3pmol of each primer, 0.1U Rose Taq (Rose Scientific, Edmonton, AB, Canada), and 2$L bisulfite converted DNA, with an initial denaturation at 94°C, 10 min; 30 cycles of 94°C for 45s, 61°C for 45s, 72°C for 1 min; a final extension at 72°C for 10 min. The first PCR was followed by a 20$L semi-nested PCR of 35 cycles using primers F6115 and R6326 using 1 $L of PCR product from the first reaction. PCR products were cleaned using DNA Clean & Concentrator™-5 (Zymo Research, Orange, CA, USA). Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) was used to assess methylation at two CpGs (C10 and C12) within the 6th CTCF binding site of ICR1 that were previously identified as being differentially methylated by parental origin and representative of the region [32,33]. SNaPshot Multiplex Kit (Applied Biosystems, Foster City, CA, USA) was used to according to manufacturer’s directions. The reaction was terminated by dephosphorylation using 1U of calf intestinal phosphatase (Invitrogen, Carlsbad, CA, USA) and incubation at 37°C for 1 hour followed by deactivation of the enzyme at 72°C for 15min. Products were sized and quantified on an ABI Prism 310 !  44  Genetic Analyzer. Using this method, we previously observed a strong correlation between estimated methylation values for the independent PCR assays of C10 and C12 in blood samples (r=0.95, p<0.0001, N=87) and for repeat estimates from distinct bisulfite conversions (r=0.8, p<0.0001, N=93) [34] and have applied this assay to diagnosis of hypomethylation in Silver-Russell Syndrome patients. Assessment of methylation at ICR1 by pyrosequencing was not performed as a published assay for this region [35] was found to span the rs2107425 polymorphism, and further assays we attempted showed an amplification bias in some individuals based on a SNP within the amplified region (rs10732516). No amplification bias or association of methylation with local sequence variation was detected with the Ms-SNuPE assay (data not shown).  2.2.4. Pyrosequencing for ICR2, candidate gene and LINE-1 methylation  Pyrosequencing was used to assess methylation at seven CpGs within ICR2 including the differentially methylated NotI site that is often altered in BWS[19,36] and is used in diagnostic testing for BWS.[17] Bisulfite converted DNA was amplified by PCR (see Supplementary Table 2 for primer sequences). Each 25 $L PCR contained: 1X HotStarTaq buffer (including 1.5mM MgCl2), 0.2mM dNTP, 5pmol of each primer, 1.0U HotStarTaq DNA Polymerase (QIAGEN Inc., Mississauga, ON, Canada), and 2$L bisulfite converted DNA. Thermocycling conditions included: an initial denaturation at 95 °C for 10 min; 40 cycles of 95 °C for 40 s, 55 °C for 40 s, 72 °C for 40 s; a final extension at 72 °C for 7 min. Sequencing of PCR products (10$L) using a PyroMark™ MD (Biotage AB, Uppsala, Sweden), available in the lab of Dr. Angela Devlin, was performed according to  !  45  manufacturer’s directions. Pyro Q-CpG software (v1.0.9, 2006, Biotage AB) was used to analyze results. Methylation at 13 CpG sites within the CDKN1C promoter was assessed using a pyrosequencing assay available from the Biotage PyroMark™ Assay Database. Pyrosequencing assays for the following candidate genes were also developed: H19 promoter, PEG10 promoter, PLAGL1 promoter, SNRPN promoter, MEST exon 1 (see Supplementary Table 2 for primer sequences). The PCR and thermocycling conditions were identical to those described above. Methylation at 7 CpG sites from a consensus sequence found within LINE-1 elements was also preformed according to manufacturer’s directions (PyroMark™ LINE-1 Kit, Biotage AB).  2.2.5. Whole genome expression arrays  HumanRef-8 v2 BeadChip gene expression arrays (Illumina Inc., San Diego, CA) were used to correlate methylation patterns with gene expression. Total mRNA was extracted from a subset of the placentas using an RNeasy® kit (QIAGEN). Two independent villous samples were analyzed from each placenta (control, N=5 placentas; IUGR, N=5; and PET, N=4) for a total of 28 analyzed samples. The samples were chosen because RNA was available and the placentas were processed soon after delivery. The BeadChip array was processed in the Centre for Molecular Medicine and Therapeutics (CMMT) BioAnalyzer Core Facility (Vancouver, BC, Canada). Output was analyzed using Illumina’s BeadStudio software (v3.2.7, 2007). Parameters for differential expression analysis were as follows: normalization=average; reference group=control placentas; error model=t-test. Samples with a diffscore of greater than ±13 correspond to a nominal !  46  (uncorrected) significance p<0.05 (diffscore = |10 log pval|). Negative diffscores reflect underexpression compared to the control group and positive diffscores reflect overexpression compared to the control group. The Benjamini-Hochberg correction was used to correct for multiple comparisions and results were then further analyzed using the SAM software [30].  2.3. Results  2.3.1. Illumina methylation results  Although 1,505 CpG sites are assayed on the GoldenGate Methylation Cancer Panel, only 70 are located within the promoter region of imprinted genes. None of the differentially methylated ICRs are included on this array. After analysis with SAM and correction for multiple comparisons, no CpGs in either the IUGR or PET groups were found to be significantly altered.  2.3.2. ICR1 Methylation by MS-SNuPE  Methylation at ICR1 (associated with H19 and IGF2 expression) was quantified at two CpG sites (C10 and C12) from each of two sampling sites within each placenta. There was a strong correlation between C10 and C12 methylation levels from a single placental sample (r=0.82, p<0.0001, Figure 2.1). However, this correlation was weaker than the C10C12 correlation observed in blood samples analyzed in the same laboratory by this method (r=0.95, p<0.0001 N=87) [34] which suggests that methylation of these sites is more !  47  variable in the placenta than in peripheral blood. The within-placenta between-site correlation was r=0.47 for C10, r=0.48 for C12 and was r=0.56 when comparing the average C10 and C12 methylation for each site (p<0.0001 for each correlation). To obtain a methylation value representative of the whole placenta, it is thus important to average data from multiple sites. For subsequent comparisons, methylation values were averaged across the two CpGs and two sampling sites to obtain a single methylation value for each placenta.  Figure 2.1. Intra-placental correlation for percent methylation at the H19/IGF2 ICR. The methylation values as measured by SNuPE from two separate sampling sites from one placenta were correlated (r=0.56, p<0.0001). Percent methylation at C10 and C12 were averaged to obtain a single methylation value for each sample.  !  48  The mean ICR1 methylation values for each clinical group were: controls (N=22), 36.7%; IUGR (N=13), 30.8%; PET (N=17), 38.3%; PET+IUGR (N= 21), 37.6% (Figure 2.2, Table 2.1). Methylation at ICR1 showed significant between group differences (p<0.001, one-way ANOVA). This effect was due to a reduction of methylation in the IUGR group compared to all other groups (p<0.0001, compared to controls) and 7 of the 13 placentas in the IUGR group had methylation values at least 2 SD below the mean of the control group. These seven placentas were: PM30, PM35, PM41, PM47, PM123, PM128, PM120. There was no difference between mean methylation in PET, with or without IUGR, and the control group. There were also no significant differences in ICR1 methylation when considering early onset (N=6) or late onset (N=11) pre-eclampsia separately (not shown). There was no correlation between methylation and sex, gestational age, time to placental sampling after birth, mode of delivery, oligohydramnios, symmetrical vs. asymmetrical IUGR, maternal gestational diabetes mellitus or the presence of placental trisomy. There was a significant correlation between methylation and gestational age corrected birth weight (measured in SD relative to the mean) (r=0.29, p=0.015), which was more pronounced when the cases with pre-eclampsia were excluded from the analysis (r=0.62, p<0.0001). Nonetheless, a similar correlation between methylation and GA-corrected birth weight was present within the pre-eclampsia (with or without IUGR) group analyzed separately (r=0.29, p=0.038). It appears that a greater average methylation in the pre-eclampsia group overall is confounding the association with IUGR in comparisons with control placentas.  !  49  Figure 2.2. Inter-group comparisons for percent methylation at the H19/IGF2 ICR. There is a significant reduction in mean methylation (average of two sites measured by SNuPE) in placental villi associated with normotensive IUGR compared to controls (p<0.01), PET (p<0.01), and PET+IUGR (p<0.01) pregnancies.  !  50  Table 2.1. Summary of mean methylation values obtained using MS-SNuPE (ICR1) and pyrosequencing (ICR2, H19, CDKN1C, PEG10, PLAGL1, SNRPN, MEST, LINE-1). ICR1 methylation was significantly different between groups (P<0.0001) due to reduced methylation in villi from IUGR placentas compared to each of the other groups. No other groups were significantly altered.  Control VILLI  IUGR  PET  PET+IUGR  N=22  N=13  N=17  N=21  36.7 ± 3.0%  30.8 ± 3.2%  38.3 ± 4.0%  37.6 ± 3.8%  (S.E. 0.6%)  (S.E. 1.0%)*  (S.E. 1.0%)  (S.E. 0.8%)  65.4 ± 3.4%  64.8 ± 3.2%  65.2 ± 3.0%  64.7 ± 3.3%  (S.E. 0.7%)  (S.E. 0.9%)  (S.E. 0.7%)  (S.E. 0.7%)  49.5 ± 4.4%  48.9 ± 3.3%  49.3 ± 4.2%  48.5 ± 6.8%  (S.E. 0.9%)  (S.E. 0.9%)  (S.E. 1.0%)  (S.E. 1.5%)  CDKN1C  5.2 ± 2.8%  4.5 ± 0.6%  7.0 ± 5.5%  6.9 ± 3.3%  promoter  (S.E. 0.7%)  (S.E. 0.6%)  (S.E. 1.7%)  (S.E. 0.9%)  57.1 ± 5.8%  56.6 ± 11.9%  57.9 ± 8.0%  57.9 ± 6.4%  (S.E. 1.2%)  (S.E. 3.3%)  (S.E. 1.9%)  (S.E. 1.5%)  PLAGL1  52.6 ± 2.6%  53.0 ± 2.1%  54.2 ± 6.6%  53.7 ± 3.9%  promoter  (S.E. 0.5%)  (S.E. 0.9%)  (S.E. 1.8%)  (S.E. 0.8%)  46.3 ± 3.0%  50.7 ± 4.8%  47.8 ± 4.1%  51.4 ± 5.8%  (S.E. 0.6%)  (S.E. 1.3%)  (S.E. 1.0%)  (S.E. 1.3%)  58.9 ± 9.5%  60.1 ± 8.4%  59.3 ± 11.0%  59.7 ± 8.8%  (S.E. 2.0%)  (S.E. 2.3%)  (S.E. 2.7%)  (S.E. 2.0%)  49.6 ± 2.0%  50.0 ± 2.0%,  48.5 ± 2.4%  51.0 ± 4.6%  (S.E. 0.6%)  (S.E. 0.7%)  (S.E. 0.7%)  (S.E. 1.3%)  N=5  N=5  N=5  N=4  35.8 ± 2.9%  36.4 ± 3.4%  34.5 ± 3.3%  37.2 ± 1.4%  (S.E. 1.3%)  (S.E. 1.7%)  (S.E. 1.5%)  (S.E. 0.7%)  ICR1 ICR2 H19 promoter  PEG10 promoter  SNRPN promoter  MEST exon 1 LINE-1  AMNION ICR1  *p<0.001 compared to control (t-test)  !  51  To determine if reduced methylation was restricted to chorionic villi, ICR1 methylation was assessed in a subset of amnion samples. There was no significant difference between methylation at ICR1 within the amnion in any of the clinical groups and specifically no reduction in methylation in the IUGR group as compared to the control group (Table 2.1). In addition, chorionic villi from five control and five IUGR group placentas were separated into trophoblast and mesenchyme by enzymatic digestion. Mean ICR1 methylation was similar between cell-types in both groups and there was not a significant correlation between methylation level of trophoblast and mesenchyme from a single site (r=0.14), though sample size was likely too small to evaluate such an effect.  2.3.3. ICR2, candidate gene, and LINE-1 methylation by pyrosequencing  Methylation at ICR2 was quantified at seven adjacent CpG sites, including those in the BWS diagnostic NotI site. There was a correlation in methylation levels between different CpGs from the same sample and for average methylation between placental sites (r=0.38, p=0.001). As for ICR1, methylation across the CpGs and the two placental sampling sites was averaged to give one measurement per placenta. No significant differences in ICR2 methylation were detected between any of the clinical groups or between early and late onset preeclampsia (Table 2.1). Methylation level at 13 CpG sites within the CDKN1C promoter was very low and no significant differences were detected between any of the groups. Whole blood and saliva were also tested with this method and also showed very little methylation; however, promoter regions associated with CpG islands are frequently unmethylated [37]. None of the other candidate genes were significantly altered between the groups (Table 2.1). As an !  52  indirect marker of genome-wide methylation, methylation status was also evaluated at a consensus sequence within LINE-1 elements, which make up about 15% of the genome. The mean methylation values for each clinical group were all approximately 50% (Table 2.1). It thus appears that the altered methylation at ICR1 does not stem from a general hypomethylation of the genome.  2.3.4. Illumina expression results  Although over 22,000 transcripts are assayed on the Illumina HumanRef-8 v2 BeadChip, for the present study we only considered the expression level of 44 reported imprinted genes (59 transcripts). Among these, only IGF2 (transcripts NR_003512.1, NM_001007139.4, NM_00612.4) was significantly underexpressed in placental villi associated with IUGR compared to controls (average expression level of 16700 vs 35000, p<0.0001). Other imprinted genes had decreased expression (e.g. CDKN1C in PET) or increased expression (MEST in IUGR and PET, SNRPN in IUGR); however, these were not significant when analyzed by SAM. In addition, only IGF2 was significantly altered after using the Benjamini-Hochberg correction. This result was not supported by quantitative real time PCR using either !-actin or !-2-microglobulin as an endogenous control; however, other groups have reported both increases [38] and decreases [18] in IGF2 expression in IUGR placentas. Unlike DNA methylation, which is relatively stable, placental RNA degrades quite rapidly after birth. Most of our placentas were >6 hours post-birth at the time of sampling, and thus the mRNA data must be interpreted cautiously.  !  53  2.4. Discussion  The placenta is a remarkably adaptive organ that mediates the exchange of nutrients between two genetically distinct individuals, the mother and the fetus, which may have conflicting needs [39]. Many imprinted genes studied in the mouse appear to regulate fetal growth in a manner that maintains a balance between maternal nutrient supply and fetal growth [8,39,40]. Altered expression of both IGF2 and PHLDA2 have been reported in pathological human placentas [18,41,42]; however, methylation provides an independent, potentially more stable, assessment of the placental genome. Although both IUGR and PET associated placentas show similar deficiencies in trophoblast invasion, only normotensive IUGR associated placentas showed reduced methylation at ICR1 in this study as compared to controls. This reduced methylation may reflect an adaptive process serving to adjust placental and fetal growth in response to poor placental perfusion and prevent maternal pre-eclampsia. Consistent with this possibility, average methylation in pre-eclampsia tended to be higher than controls, particularly in the absence of IUGR. This supports failure to limit fetal growth in the presence of poor placental perfusion could in turn contribute to the development of maternal pre-eclampsia. The presence of high levels of trisomy in two of the IUGR associated placentas, which is likely the initial cause of placental dysfunction, is consistent with the hypothesis that reduced methylation at ICR1 may be a consequence of other placental abnormalities rather than a spontaneous defect. Methylation at ICR1 has been shown in a number of studies to be particularly responsive to environmental influences such as culture media [10,11], environmental toxins (e.g. TCDD) [43], and prenatal ethanol exposure [44].  !  54  Previous studies have reported a reduction in IGF2 expression in placentas from pregnancies associated with IUGR or SGA [18,41] and complete loss of placental Igf2 expression is associated with fetal growth restriction in mice [7]. Furthermore, selective deletion of the placental specific form of Igf2 from murine placentas also leads to a significant decrease in fetal weight, with pups being 69% of normal weight at birth [45]. Reduced placental Igf2 expression leads to a reduction in size of all placental layers and alters the diffusional exchange characteristics of the placenta [46]. In human pregnancies, reduced exchange surface area, and likely reduced transfer capacity of the placenta, has been noted in IUGR [47]. Altered placental transfer to the fetus may also be a mechanism involved in the pathogenesis of IUGR, as the developing fetus will not be able to receive adequate nutrition to allow for normal growth. Although a reduction in IGF2 expression was observed in SGA placentas in a recent report, loss of methylation at ICR1 was not observed in the same placentas [18]. The differences in methylation values between the two studies may reflect differences in patient ascertainment or sampling procedures. An increase in average methylation of ICR1 in preeclamptic placentas may confound the relationship of decreased methylation with IUGR, if these placentas are not analyzed separately. While there is much overlap between cases diagnosed as SGA or IUGR, these are different diagnostic criteria, and in our study cases with low birth weight were required to show other prenatal indicators of poor placental function to be classified as IUGR. Furthermore, we removed the amnion and chorion from the villous sample prior to DNA extraction. Including amnion could dilute the methylation effect, as we observed normal methylation in amnion even when reduced in the placental villi. Another study found biallelic expression and loss of imprinting at H19 in placentas from pre-eclamptic women [48]; however, our results do not support these findings. !  55  In the present study we did not find evidence for altered methylation at ICR2 (KvDMR1), nor specifically at CDKN1C, a gene associated with altered growth in BWS. Very little methylation (~5%) was detected at CDKN1C despite being reported to be differentially methylated in murine placenta [49], and some imprinted genes, including those within the ICR2 cluster, may not be imprinted in the human placenta [12]. The mouse knockout of Cdkn1c displays some phenotypes of preeclampsia and BWS [21], and a modest reduction in CDKN1C expression was observed in both the IUGR and PET group. Measurement of DNA methylation may provide a useful diagnostic tool for indirectly detecting altered gene expression, due to its increased stability over RNA. Placental RNA in particular degrades extremely rapidly and may be affected by labour duration and delivery method. Further studies will be necessary to determine if altered methylation at ICR1 is an early or late event in IUGR and thus could provide any prognostic value. If reduction of IGF2 expression is a compensatory response to other factors such as poor placental perfusion, it may be a beneficial response for the mother. A full understanding of the genetic and or environmental conditions leading to reduced IGF2 in some pregnancies with abnormal trophoblast invasion and not in others (i.e. those with preeclampsia) will be important before any therapies attempting to improve fetal growth are initiated.  !  56  2.5. Supplementary Tables  Please see Appendix A for the following Supplementary Tables.  2.5.1 Supplementary Table 1. Additional clinical information for the placentas used in this study.  2.5.2 Supplementary Table 2. Primers and sequences to analyze for pyrosequencing assays.  !  57  2.6. References  [1] Sibai B,Dekker G,Kupferminc M. Pre-eclampsia. Lancet 2005; 365:785-799. [2] Kaufmann P,Black S,Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod 2003; 69:1-7. [3] Granger JP, Alexander BT, Llinas MT, Bennett WA, Khalil RA. Pathophysiology of hypertension during preeclampsia linking placental ischemia with endothelial dysfunction. Hypertension 2001; 38:718-722. [4] Goswami D, Tannetta DS, Magee LA, Fuchisawa A, Redman CW, Sargent IL, von Dadelszen P. Excess syncytiotrophoblast microparticle shedding is a feature of early-onset pre-eclampsia, but not normotensive intrauterine growth restriction. Placenta 2006; 27:5661. [5] Kalousek DK, Vekemans M. Confined placental mosaicism. J Med Genet 1996; 33:529533. [6] Yong PJ, Langlois S, von Dadelszen P, Robinson WP. The association between preeclampsia and placental trisomy 16 mosaicism. Prenat Diag 2006; 26:956-961. [7] Fowden AL, Sibley C, Reik W, Constancia M. Imprinted genes, placental development and fetal growth. Horm Res 2006; 65:50-58. [8] Angiolini E, Fowden A, Coan P, Sandovici I, Smith P, Dean W, Burton G, Tycko B, Reik W, Sibley C, Constancia M. Regulation of placental efficiency for nutrient transport by imprinted genes. Placenta 2006; 27:S98-S102. [9] Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet 2005; 14:R47-R58. [10] Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000; 62:1526-1535. [11] Mann MRW, Lee SS, Doherty AS, Verona RI, Nolen LD, Schultz RM, Bartolomei MS. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004; 131:3727-3735. [12] Monk D,Arnaud P,Apostolidou S,Hills FA,Kelsey G,Stanier P,Feil R,Moore GE. Limited evolutionary conservation of imprinting in the human placenta. PNAS 2006; 103:6623-6628. [13] Reik W, Walter J. Genomic imprinting: parental influence on the genome, Nat Rev Genet 2001; 2:21-32. [14] Engel N, West AG, Felsenfeld G, Bartolomei MS. Antagonism between DNA hypermethylation and enhancer-blocking activity at the H19 DMD is uncovered by CpG mutations. Nat Genet 2004; 36:883-888. [15] Gicquel C, Rossignol S, Cabrol S, Houang M, Steunou V, Barbu V, Danton F, Thibaud N, Le Merrer M, Burglen L, Bertrand A, Netchine I, Le Bouc Y. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver-Russell syndrome. Nat Genet 2005; 37:1003-1007. [16] Weksberg R, Smith AC, Squire J, Sadowski PD. Beckwith-Wiedemann syndrome demonstrates a role for epigenetic control of normal development. Hum Mol Genet 2003; 12:R61-R68. !  58  [17] Weksberg R, Shuman C, Smith AC. Beckwith-Wiedemann syndrome. Am J Med Genet C Semin Med Genet 2005; 137:12-23. [18] Guo L, Choufani S, Ferreira J, Smith A, Chitayat D, Shuman C, Uxa R, Keating S, Kingdom J, Weksberg R. Altered gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA) placentae. Dev Biol 2008; 320:79-91. [19] Smilinich NJ, Day CD, Fitzpatrick GV, Caldwell GM, Lossie AC, Cooper PR, Smallwood AC, Joyce JA, Schofield PN, Reik W, Nicholls RD, Weksberg R, Driscoll DJ, Maher ER, Shows TB, Higgins MJ. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith– Wiedemann syndrome. PNAS 1999; 96:8064-8069. [20] Schonherr N, Meyer E, Roos A, Schmidt A, Wollmann HA, Eggermann T. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 2007; 44:59-63. [21] Kanayama N, Takahashi K, Matsuura T, Sugimura M, Kobayashi T, Moniwa N, Tomita M, Nakayama K. Deficiency in p57Kip2 expression induces preeclampsia-like symptoms in mice. Mol Hum Reprod 2002; 8:1129-1135. [22] Maher ER, Reik W. Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J Clin Invest 2000; 105:247-252. [23] Wagschal A, Feil R. Genomic imprinting in the placenta. Cytogenet Genome Res 2006; 113:90-98. [24] Kramer MS, Platt RW, Wen SW, Joseph KS, Allen A, Abrahamowicz M, Blondel B, Breart G, for the Fetal/Infant Health Study Group of the Canadian Perinatal Surveillance System. A New and Improved Population-Based Canadian Reference for Birth Weight for Gestational Age. Pediatrics 2001; 108:e35. [25] Magee LA, Helewa M, Moutquin JM, von Dadelszen P. Diagnosis, evaluation, and management of the hypertensive disorders of pregnancy. J Obstet Gynaecol Can 2008; 30:S1-S48. [26] Audibert F, Friedman SA, Frangieh AY, Sibai BM. Clinical utility of strict diagnostic criteria for the HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Am J Obstet Gynecol 1996; 175:460-464. [27] Douglas KA, Redman CWG. Eclampsia in the United Kingdom. BMJ 1994; 309:13951400. [28] Lestou VS, Lomax BL, Barrett IJ, Kalousek DK. Screening of human placentas for chromosomal mosaicism using comparative genomic hybridization. Teratology 1999; 59:325-330. [29] Robinson WP, Penaherrera MS, Jiang R, Avila L, Sloan J, McFadden DE, Langlois S, von Dadelszen P. Assessing the role of placental trisomy in preeclampsia and intrauterine growth restriction. Prenat Diag 2010; 30:1-8. [30] Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. PNAS 2001; 98:5116-5121. [31] Kerjean A, Dupont J-, Vasseur C, Le Tessier D, Cuisset L, Paldi A, Jouannet P, Jeanpierre M. Establishment of the paternal methylation imprint of the human H19 and MEST/PEG1 genes during spermatogenesis. Hum Mol Genet 2000; 9:2183-2187. [32] Sievers S, Alemazkour K, Zahn S, Perlman EJ, Gillis AJ, Looijenga LH, G, U., Schneider DT. IGF2/H19 imprinting analysis of human germ cell tumors (GCTs) using the methylation-sensitive single-nucleotide primer extension method reflects the origin of GCTs !  59  in different stages of primordial germ cell development. Genes Chromosomes Cancer 2005; 44:256-264. [33] Takai D, Gonzales FA, Tsai YC, Thayer MJ, Jones PA. Large scale mapping of methylcytosines in CTCF-binding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet 2001; 10:2619-2626. [34] Penaherrera MS, Weindler S, Van Allen MI, Yong S-, Metzger D, McGillivray B, Boerkoel C, Langlois S, Robinson WP. Methylation profiling in individuals with SilverRussell Syndrome. Am J Med Genet Part A 2010; 152A:347-355. [35] Byun HM, Wong HL, Birnstein EA, Wolff EM, Liang G, Yang AS. Examination of IGF2 and H19 loss of imprinting in bladder cancer. Cancer Res. 2007; 67:10753-10758. [36] Weksberg R, Nishikawa J, Caluseriu O, Fei Y-, Shuman C, Wei C, Steele L, Cameron J, Smith A, Ambus I, Li M, Ray PN, Sadowski P, Squire J. Tumor development in the Beckwith-Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 2001;10:2989-3000. [37] Jones PA, Takai D. The Role of DNA Methylation in Mammalian Epigenetics. Science 2001; 293:1068-1070. [38] Abu-Amero SN, Ali Z, Bennett P, Vaughan JI, Moore GE. Expression of the insulinlike growth factors and their receptors in term placentas: a comparison between normal and IUGR births. Mol Reprod Dev 1998; 49:229-235. [39] Reik W, Constancia M, Fowden A, Anderson N, Dean W, Ferguson-Smith A, Tycko B, Sibley C. Regulation of supply and demand for maternal nutrients in mammals by imprinted genes. J Physiol 2003; 547:35-44. [40] Constancia M, Kelsey G, Reik W. Resourceful imprinting. Nature 2004; 432:53-57. [41] McMinn J, Wei M, Schupf N, Cusmai J, Johnson EB, Smith AC, Weksberg R, Thaker HM, Tycko B. Unbalanced placental expression of imprinted genes in human intrauterine growth restriction. Placenta 2006; 27:540-549. [42] Apostolidou S, Abu-Amero S, O'Donoghue K, Frost J, Olafsdottir O, Chavele KM, Whittaker JC, Loughna P, Stanier P, Moore GE. Elevated placental expression of the imprinted PHLDA2 gene is associated with low birth weight. J Mol Med 2007; 85:379-387. [43] Wu Q, Ohsako S, Ishimura R, Suzuki JS, Tohyama C. Exposure of mouse preimplantation embryos to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the methylation status of imprinted genes H19 and Igf2. Biol Reprod 2004; 70:1790-1797. [44] Haycock PC, Ramsay M. Exposure of mouse embryos to ethanol during preimplantation development: effect on DNA methylation in the h19 imprinting control region. Biol Reprod 2009; 81:618-627. [45] Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W. Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 2002; 417:945-948. [46] Sibley CP, Coan PM, Ferguson-Smith AC, Dean W, Hughes J, Smith P, Reik W, Burton GJ, Fowden AL, Constância M. Placental-specific insulin-like growth factor 2 (Igf2) regulates the diffusional exchange characteristics of the mouse placenta. PNAS 2004; 101:8204-8208. [47] Mayhew TM, Ohadike C, Baker PN, Crocker IP, Mitchell C, Ong SS. Stereological investigation of placental morphology in pregnancies complicated by pre-eclampsia with and without intrauterine growth restriction. Placenta 2003; 24:219-226.  !  60  [48] Yu L, Chen M, Zhao D, Yi P, Lu L, Han J, Zheng X, Zhou Y, Li L. The H19 gene imprinting in normal pregnancy and pre-eclampsia. Placenta 2009; 30:443-447. [49] Lewis A, Mitsuya K, Umlauf D, Smith P, Dean W, Walter J, Higgins M, Feil R, Reik W. Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of DNA methylation. Nat Genet 2004; 36:1291-1295.  !  61  ! CHAPTER 3. MANUSCRIPT 2: The utility of quantitative methylation assays at imprinted genes for the diagnosis of fetal and placental disorders  3.1  Introduction Abnormal expression of imprinted genes has been implicated in many growth  disorders of the placenta and/or fetus [1,2]. These genes tend to be distributed in distinct clusters that are epigenetically regulated by one or more imprinting control regions (ICRs) [3]. Quantification of DNA methylation at differentially methylated regions (DMRs) located at either ICRs or promoters associated with specific genes is commonly used for the diagnosis of imprinting disorders including Beckwith-Wiedemann syndrome (BWS) [4], Russell-Silver syndrome [5,6], and Prader-Willi and Angelman syndromes [7,8]. While imprinting is recognized as important in the genesis of a variety of disorders affecting the placenta including complete hydatidiform mole (CHM), partial hydatidiform mole (PHM), and placental mesenchymal dysplasia (PMD), DNA methylation has not traditionally been applied to their diagnosis. Distinguishing between CHM, PHM, and hydropic abortuses (HA) continues to pose problems in diagnosis [9-11]. It is imperative that accurate diagnosis be made as CHM is associated with an increased risk of gestational trophoblastic neoplasia and patient management differs from that in the other placental conditions. Recurrence risks can also differ depending on the underlying etiology. Triploidy rarely is recurrent, however familial recurrent biparental CHMs can occur in female carriers of mutations in NALP7 [12,13]. We hypothesize that methylation-based assays at imprinted regions would be useful to help distinguish these phenotypically overlapping entities. A version of this chapter has been accepted for publication. DK Bourque, MS SN! Peñaherrera, RKC Yuen, MA van Allen, DE McFadden, WP Robinson. The utility of quantitative methylation assays at imprinted genes for the diagnosis of fetal and placental disorders. Clinical Genetics 2010. ePub ahead of print April 8, 2010. !  Chromosome 11p15.5 contains two clusters of imprinted genes each regulated by a different ICR. The centromeric ICR, known as KvDMR1, is located within an intron of the KCNQ1 gene, and contains the promoter for the KCNQ1OT1 non-coding RNA [14]. It is normally methylated on the maternal allele and unmethylated on the paternal allele and this methylation is associated with the regulation of several imprinted genes, including CDKN1C, KCNQ1, KCNQ1OT1, and PHLDA2. Roughly half of BWS patients show loss of methylation at KvDMR1 [4,14] and diagnosis typically utilizes a differentially methylated Not1 restriction enzyme cutting site at this locus and Southern blotting. Loss of KvDMR1 methylation is associated with decreased expression of the maternally expressed CDKN1C, mutations in which can also cause BWS [15,16]. CHMs are typically of androgenetic origin [2] (i.e. there is no maternal contribution to the genome) and show decreased CDKN1C expression [17]. Thus immunostaining of CDKN1C (also known as p57KIP2) has been used in the diagnosis of CHMs and gestational trophoblastic disease [1,11]. However, some CHMs have stained positively for CDKN1C as a result of retention of a maternal chromosome 11 [11,18], confounding the interpretation of some cases. Methylation changes at KvDMR1 or other DMRs associated with imprinted genes may provide an alternative method of diagnosis. Furthermore, placentas affected with placental mesenchymal dysplasia (PMD) may also exhibit a paternally biased methylation pattern, despite positive CDKN1C staining, as PMD is usually caused by the presence of chimeric androgenetic cells in the placenta [19]. PMD has also been reported with mosaic deletion of the maternal copy of 11p15.5 [20] and there appears to be an increased incidence of prenatally diagnosed BWS in association with PMD [21], though the etiology in those cases is unclear [20]. PHMs are due to diandric triploidy [22,23] and will also stain positively for CDKN1C, but have a 2:1 ratio of paternal to maternal haploid genomes. !  !  63  Methylation assays of imprinted sites have not been used in clinical placental pathology possibly because it has been suggested that regulation of imprinted gene expression may not be well-maintained in the human placenta [24-26]. Furthermore, differentially methylated sites that may be used in clinical diagnosis of imprinting disorders in blood samples, such as assays for the CDKN1C and IGF2 promoters, are not useful in placental samples as they are not methylated in this tissue. It is thus important that a potential methylation-based assay for detecting genomic imbalance in placental tissue is evaluated for stability across a variety of normal and abnormal placental samples. In this study we evaluate the utility of a pyrosequencing assay for KvDMR1 to assess 11p15.5 abnormalities in blood and placenta to identify imprinting errors and distinguish between those placental abnormalities characterized by parental genome imbalances, such as in triploidy and PMD. We then compare this assay to similar assays involving other imprinted DMRs of clinical relevance to determine which ones can be reliably applied to assist in the diagnosis of a variety of placental disorders.  3.2  Methods  3.2.1 Study samples  Ethics approval for this study was obtained through the University of British Columbia and the BC Children’s & Women’s Hospital ethics boards. Genomic DNA was extracted using standard protocols. Blood (N=11) and saliva (N=8) samples were collected from healthy adults, thirteen cases of BWS (six with known abnormal KvDMR1 methylation status), and epidermal cells (from both sides of the body) from one case of left !  !  64  side hemihypertrophy. In addition, DNA was extracted from chorionic villi of placentas from healthy pregnancies (N=22), placentas with triploidy of known parental origin (N=8 diandric triploidy, N=13 digynic triploidy) based on previous microsatellite testing [27,28], placentas affected with PMD (N=11 samples taken from 6 placentas) confirmed previously to be due to androgenetic chimerism [19] and trophoblast cells from one CHM. The CHM was confirmed by microsatellite testing to be homozygous at all tested polymorphic markers from multiple chromosomes, consistent with an origin from endoreduplication of the haploid genome present in a single sperm.  3.2.2 Pyrosequencing assays  Pyrosequencing was used to assess methylation at seven CpGs within KvDMR1 including the differentially methylated NotI site that is often altered in BWS [14,29] and is used in diagnostic testing for BWS [4]. PCR conditions were as outlined previously [30]. The two CpGs in the Not1 site were compared to the other five CpGs in the region and were highly correlated (r=0.94, p<0.0001, N=142). Thus, methylation values at the seven CpG sites were averaged to get a single methylation value per sample. Hypomethylation was defined as more than 2SD below the mean of controls while hypermethylation was defined as more than 2SD above the mean of controls. Because methylated and unmethylated strands show different sequences after bisulfite conversion, there may be differences in the efficiency of each strand to be amplified by PCR [31]. To test for linearity of amplification of the methylated allele, a standard curve comparing serial dilutions of methylated : unmethylated DNA with relative proportions of 0:100, 25:75, 33:66, 50:50, 66:33, 75:25, 100:0 was prepared using DNA from two cell !  !  65  lines obtained from the NIGMS Human Genetic Cell Repository (Coriell Institute for Medical Research, Camden NJ, USA). Somatic cell hybrid (SCH) cell line NA10482 (GM10482A) contains a single derivative chromosome 11 with a paternal methylation imprint, and SCH NA07300 (GM07300) contains a single chromosome 11 with a maternal methylation imprint [32]. While the results fit well with a linear model (y= -0.92*x+101.86, R2=0.977), a closer fit was obtained with a slight curvilinear model (y=-0.0043*x20.49x+95.3 R2=0.998). Other DMRs were selected based on being 1) associated with clinically relevant genes; 2) approximately 50% methylated in control placental samples; and 3) highly reproducible. These included the telomeric chromosome 11p15.5 ICR, located proximal to the H19 promoter and shown previously to be useful in the diagnosis of 11p15.5-associated imprinting abnormalities in Russell-Silver syndrome [33]. Methylation at the promoter regions for the H19 and CDKN1C genes was also tested by pyrosequencing but these sites were excluded because the average level of methylation was <10% in control placental samples. Non-chromosome 11 assays included those for the promoter of i) SNRPN [30], a maternally methylated region used in diagnosis of abnormalities of 15q11.2 in Prader-Willi and Angelman syndromes; ii) SGCE, a maternally methylated locus on chromosome 7q21 which we previously showed displayed increased methylation in cases of maternal uniparental disomy 7 in Silver–Russell syndrome patients [5]; and iii) MEST [34], another similarly methylated chromosome 7 imprinted gene.  !  !  66  3.3. Results  3.3.1. Chromosome 11p15.5 assays (KvDMR1 and H19-ICR)  Repeat measurements of 13 samples (including blood, saliva and placental samples) assayed in two independent reactions were highly correlated (r=0.98, p<0.0001), thus demonstrating high reproducibility of the KvDMR1 assay. Values for blood and saliva from controls were similar (70%±1.2% and 72%±4.3%, respectively). Six cases of BWS, known to have reduced KvDMR1 methylation status based on clinical testing using a Southern blot assay, also showed extremely reduced methylation (2-12%) by the pyrosequencing assay (Figure 3.1.a), and the two results were highly correlated (r=0.99, p<0.0001). Of the seven cases of BWS not previously tested at this site by Southern, two had a reduction in methylation of 20% or more below the control blood mean (27% and 50%), while the others had methylation levels within the normal range (68-75%). Epidermal cells from a case of asymmetric hemihypertrophy had reduced methylation on the left side compared to the right (55% and 66%, respectively), which was consistent with the restriction of hypertrophy to the left side of the body (Figure 3.1.a).  !  !  67  a)  b)  Figure 3.1. Pyrosequencing results for KvDMR1 and SGCE methylation assays. a) KvDMR1 methylation values for control blood, control saliva, BWS samples, and left and right epidermal samples from a case of hemihypertrophy (HH). b) SGCE methylation values for control placental villi, diandric triploidy, digynic triploidy, trophoblast of one CHM (CHM), and six PMD samples with more than 60% androgenetic cells. Black bold lines indicate ±2 S.D. of control placental villi.  !  !  68  Control placental villi were slightly less methylated (65%±3.4%) than control blood and saliva (p<0.01, ANOVA). Twelve of thirteen placentas with triploidy of maternal origin were hypermethylated compared to control placentas (mean=77%, p<0.0001, t-test) with the remaining case being at the high end of normal. All eight placentas with triploidy of paternal origin were hypomethylated compared to controls (mean=45%, p<0.0001, t-test). The difference in KvDMR1 methylation between the two types of triploids was also highly significant (p<0.0001, t-test), and the distinct non-overlapping range of values observed within each group suggests this test can be used to determine the parental origin of triploidy. An assay for the H19-ICR useful in the diagnosis of hypomethylation in RussellSilver syndrome [33] was also tested. In this case the paternal allele is methylated and thus the digynic triploids exhibit lower levels of methylation for this site than the diandric triploids (Table 3.1).  !  !  69  Table 3.1. Comparison of methylation assays at imprinted genes for the ability to distinguish digynic triploidy (N=13) from diandric triploidy (N=8).  Methylation  Control  Assay  Locus  KvDMR1  Digynic triploid  Diandric triploid  Mean (Range)  s.d.  Mean (Range)  s.d.  Mean (Range)  s.d.  11p15.5  65.4 (57.7-70.8)  3.4  77.1 (69.6-81.3)  2.8  47.4 (40.9-53.1)  3.0  H19 ICR  11p15.5  49.6 (46.5-53.3)  2.0  37.4 (33.8-40.8)  2.1  60.3 (51.0-64.0)  4.0  SGCE  7q21  49.1 (46.3-52.3)  1.7  62.4 (59.5-66.0)  1.8  34.2 (31.7-36.5)  1.5  MEST  7q32  65.3 (61.3-68.0)  2.3  74.4 (68.8-81.2)  4.4  47.7 (38.7-52.3)  3.9  SNRPN  15q11.2  46.1 (38.8-63.9)  5.4  67.6 (63.0-73.4)  3.0  38.5 (36.0-44.2)  3.2  3.3.2. Non-chromosome 11 pyrosequencing assays  While an assay for KvDMR1 is of value to the diagnosis of BWS, any imprinted DMR may be used to evaluate parental origin of triploidy. Table 3.1 shows the results for additional assays tested in the triploid samples. All showed highly significant (p<0.0001) differences between the diandric and digynic triploids with non-overlapping ranges. The SGCE assay showed the smallest standard deviation of values within each group and the largest between group difference, with 36.5% methylation being the highest observed level of methylation in a digynic triploid and 59.5% methylation being the lowest observed methylation value for a diandric triploid (Figure 3.1.b). Furthermore, neither triploid group overlapped with the range of values observed in control placentas.  !  !  70  3.3.3. Utility of assays for estimation of paternal:maternal genomic ratios  Placental mesenchymal dysplasia is characterized genetically by a mix of androgenetic and biparental cells that varies from sample to sample within a single placenta. Using the assay for KvDMR1, there was a significant inverse correlation (r=0.93, p<0.0001) between the estimated percent paternal contribution (based on microsatellite data) and methylation level of the same DNA sample (data not shown). However, the best linear correlation was achieved with the assays for the H19-ICR and SGCE (r2=0.98, P<0.0001 for both) (Figure 3.2). As the site assayed within the H19-ICR is methylated on the paternal allele, while the assayed SGCE site is methylated on the maternal allele, a reciprocal relationship between methylation at these sites and relative genomic imbalance (excess paternal contribution) is observed.  !  !  71  Figure 3.2. Among 11 samples of placental mesenchymal dysplasia (PMD) and one complete hydatiform mole (CHM), estimated percent methylation shows a significant linear relationship with the relative paternal genomic contribution (as estimated by allelic dosage at microsattelite loci) for both the H19-ICR (%) and SGCE promoter(&) (R2=0.98, p<0.0001 for each).  !  !  72  3.4. Discussion  Rapid and reliable diagnosis of methylation abnormalities at the KvDMR1 is useful for many clinical conditions. While methylation at this site has been extensively studied in the past in cases of BWS, pyrosequencing offers an inexpensive, rapid and high-throughput alternative approach. The level of KvDMR1 methylation measured in control blood is somewhat higher than expected (70% methylation instead of 50% methylation) which is in part due to a slight amplification bias in the PCR. The CHM showed 8% methylation, despite no evidence for any maternal contribution, which suggests either that some methylation can occur on the paternal allele or that some CHMs have biparental cell populations in low numbers. Further studies of a large number of CHMs are needed to fully establish the range of methylation values expected in complete androgenetic moles, as well as in biparental moles. Methylation at this and other imprinted DMRs can be used to distinguish between diandric triploid PHM, CHM, and hydropic normal placentas based on methylation profile. Furthermore, the presence of triploidy and its parental origin can be suspected based on the methylation value, which cannot be determined from immunostaining alone. The methylation assays used here are relatively inexpensive and rapid, but would require access to molecular diagnostic testing facilities. SGCE provided the clearest separation of diandric and digynic triploids and demonstrated an inverse linear relationship with level of methylation and relative paternal contribution. However, the combination of a chromosome 11 DMR assay (e.g. KvDMR1 or H19-ICR) and non-chromosome 11 assay (e.g. SGCE) would be indicated in some cases. CHMs of androgenetic origin that retain a maternal chromosome 11 show positive !  !  73  immunostaining of CDKN1C [11,17]. Such cases would be expected to display an abnormal methylation profile consistent with diandric triploidy at chromosome 11 markers but absent methylation for maternally methylated sites from other chromosomes. Such a result could help distinguish such cases from a PHM (diandric triploidy). PMD is characterized by siteto-site variability in the levels of androgenetic cells, tending to be absent in trophoblast samples and highest in the characteristic enlarged vessels [19]. Thus a corresponding site-tosite variability in methylation is expected in such cases. The presence of methylation levels between that expected for CHMs and diandric triploidy combined with such within placenta variability would this suggest the diagnosis of androgenetic chimerism. Regulation of imprinted gene expression has been hypothesized to be less stable in the placenta than in the fetus itself [24]. Furthermore, it has been suggested that methylation may be less important for the maintenance of imprinted gene expression in the placenta [25], and imprinting in general may be less maintained in human, as compared to mouse, placentas [26]. While there are indeed promoters of some imprinted genes for which methylation is not maintained in the placenta (such as the promoters for 11p15.5 genes H19 and CDKN1C) [30], the parent-of-origin specific methylation at the sites utilized here all appear to be stably maintained in the placenta even in the presence of abnormal pathology. Thus, parent-of-origin specific methylation appears to be important for the regulation of many imprinted genes in the placenta.  !  !  74  3.5. References [1] Allias F, Lebreton F, Collardeau-Frachon S, Vasiljevic A, Devouassoux-Shisheboran M, Aziza J, Jeanne-Pasquier C, Arcin-Thoury F, Patrier S. Immunohistochemical expression of p57 in placental vascular proliferative disorders of preterm and term placentas. Fetal Pediatr Pathol 2009; 28:9-23. [2] Kajii T, Ohama K. Androgenetic origin of hydatidiform mole. Nature 1977; 268:633634. [3] Reik W, Davies K, Dean W, Kelsey G, Constancia M. Imprinted genes and the coordination of fetal and postnatal growth in mammals. Novartis Found Symp 2001; 237:1931-discussion 31-42. [4] Weksberg R, Shuman C, Smith AC. Beckwith-Wiedemann syndrome. Am J Med Genet C 2005; 137:12-23. [5] Penaherrera MS, Weindler S, Van Allen MI, Yong S-, Metzger D, McGillivray B, Boerkoel C, Langlois S, Robinson WP. Methylation profiling in individuals with SilverRussell Syndrome. Am J Med Genet Part A 2010; 152A:347-355. [6] Schonherr N, Meyer E, Roos A, Schmidt A, Wollmann HA, Eggermann T. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 2007; 44:59-63. [7] Nicholls RD, Saitoh S, Horsthemke B. Imprinting in Prader-Willi and Angelman syndromes. Trends Genet 1998; 14:194-200. [8] Dittrich B, Robinson WP, Knoblauch H, Buiting K, Schmidt K, Gillessen-Kaesbach G, Horsthemke B. Molecular diagnosis of the Prader-Willi and Angelman syndromes by detection of parent-of-origin specific DNA methylation in 15q11-13. Hum Genet 1992; 90:313-315. [9] Sebire NJ, Fisher RA. Partly molar pregnancies that are not partial moles: additional possibilities and implications. Pediatr Dev Pathol 2005; 8:732-733. [10] van der Smagt JJ, Scheenjes E, Kremer JA, Hennekam FA, Fisher RA. Heterogeneity in the origin of recurrent complete hydatidiform moles: not all women with multiple molar pregnancies have biparental moles. BJOG 2006; 113:725-728. [11] McConnell TG, Murphy KM, Hafez M, Vang R, Ronnett BM. Diagnosis and subclassification of hydatidiform moles using p57 immunohistochemistry and molecular genotyping: validation and prospective analysis in routine and consultation practice settings with development of an algorithmic approach. Am J Surg Pathol 2009; 33:805-817. [12] Murdoch S, Djuric U, Mazhar B, Seoud M, Khan R, Kuick R, Bagga R, Kircheisen R, Ao A, Ratti B, Hanash S, Rouleau GA, Slim R. Mutations in NALP7 cause recurrent hydatidiform moles and reproductive wastage in humans. Nat Genet 2006; 38:300-302. [13] Wang CM, Dixon PH, Decordova S, Hodges MD, Sebire NJ, Ozalp S, Fallahian M, Sensi A, Ashrafi F, Repiska V, Zhao J, Xiang Y, Savage PM, Seckl MJ, Fisher RA. Identification of 13 novel NLRP7 mutations in 20 families with recurrent hydatidiform mole; missense mutations cluster in the leucine-rich region. J Med Genet 2009; 46:569-575. [14] Smilinich NJ, Day CD, Fitzpatrick GV, Caldwell GM, Lossie AC, Cooper PR, Smallwood AC, Joyce JA, Schofield PN, Reik W, Nicholls RD, Weksberg R, Driscoll DJ, Maher ER, Shows TB, Higgins MJ. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith– Wiedemann syndrome. PNAS 1999; 96:8064-8069. !  !  75  [15] Du M, Zhou W, Beatty LG, Weksberg R, Sadowski PD. The KCNQ1OT1 promoter, a key regulator of genomic imprinting in human chromosome 11p15.5. Genomics 2004; 84:288-300. [16] Diaz-Meyer N, Day CD, Khatod K, Maher ER, Cooper W, Reik W, Junien C, Graham G, Algar E, Der Kaloustian VM, Higgins MJ. Silencing of CDKN1C (p57KIP2) is associated with hypomethylation at KvDMR1 in Beckwith-Wiedemann syndrome. J Med Genet 2003; 40:797-801. [17] Fisher RA, Hodges MD, Rees HC, Sebire NJ, Seckl MJ, Newlands ES, Genest DR, Castrillon DH. The maternally transcribed gene p57(KIP2) (CDNK1C) is abnormally expressed in both androgenetic and biparental complete hydatidiform moles. Hum Mol Genet 2002; 11:3267-3272. [18] Fisher RA, Nucci MR, Thaker HM, Weremowicz S, Genest DR, Castrillon DH. Complete hydatidiform mole retaining a chromosome 11 of maternal origin: molecular genetic analysis of a case. Mod Pathol 2004; 17:1155-1160. [19] Robinson WP, Lauzon JL, Innes AM, Lim K, Arsovska S, McFadden DE. Origin and outcome of pregnancies affected by androgenetic/biparental chimerism. Hum Reprod 2007; 22:1114-1122. [20] Robinson WP, Slee J, Smith N, Murch A, Watson SK, Lam WL, McFadden DE. Placental mesenchymal dysplasia associated with fetal overgrowth and mosaic deletion of the maternal copy of 11p15.5. Am J Med Genet Part A 2007; 143A:1752-1759. [21] Paradinas FJ, Sebire NJ, Fisher RA, Rees HC, Foskett M, Seckl MJ, Newlands ES. Pseudo-partial moles: placental stem vessel hydrops and the association with BeckwithWiedemann syndrome and complete moles. Histopathology 2001; 39:447-454. [22] McFadden DE, Kalousek DK. Two different phenotypes of fetuses with chromosomal triploidy: correlation with parental origin of the extra haploid set. Am J Med Genet 1991; 38:535-538. [23] McFadden DE, Langlois S. Parental and meiotic origin of triploidy in the embryonic and fetal periods. Clin Genet 2000; 58:192-200. [24] Mann MRW, Lee SS, Doherty AS, Verona RI, Nolen LD, Schultz RM, Bartolomei MS. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004; 131:3727-3735. [25] Lewis A, Mitsuya K, Umlauf D, Smith P, Dean W, Walter J, Higgins M, Feil R, Reik W. Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of DNA methylation. Nat Genet 2004; 36:1291-1295. [26] Monk D,Arnaud P,Apostolidou S,Hills FA,Kelsey G,Stanier P,Feil R,Moore GE. Limited evolutionary conservation of imprinting in the human placenta. PNAS 2006; 103:6623-6628. [27] McFadden DE, Jiang R, Langlois S, Robinson WP. Dispermy--origin of diandric triploidy: brief communication. Hum Reprod 2002; 17:3037-3038. [28] McFadden DE, Robinson WP. Phenotype of triploid embryos. J Med Genet 2006; 43:609-612. [29] Weksberg R, Nishikawa J, Caluseriu O, Fei Y-, Shuman C, Wei C, Steele L, Cameron J, Smith A, Ambus I, Li M, Ray PN, Sadowski P, Squire J. Tumor development in the Beckwith-Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 2001; 10:2989-3000.  !  !  76  [30] Bourque DK, Avila L, Peñaherrera MS, von Dadelszen P, Robinson WP. Methylation at the H19 and IGF2 imprinting control region is decreased in placentas associated with normotensive intrauterine growth restriction but not preeclampsia. Placenta 2010; 31:197202. [31] Shen L, Guo Y, Chen X, Ahmed S, Issa JP. Optimizing annealing temperature overcomes bias in bisulfite PCR methylation analysis. Biotechniques 2007; 42:48, 50, 52. [32] Gabriel JM, Higgins MJ, Gebuhr TC, Shows TB, Saitoh S, Nicholls RD. A model system to study genomic imprinting of human genes. PNAS 1998; 95:14857-14862. [33] Horike S, Ferreira JC, Meguro-Horike M, Choufani S, Smith AC, Shuman C, Meschino W, Chitayat D, Zackai E, Scherer SW, Weksberg R. Screening of DNA methylation at the H19 promoter or the distal region of its ICR1 ensures efficient detection of chromosome 11p15 epimutations in Russell-Silver syndrome. Am J Med Genet Part A 2009; 149A:24152423. [34] Shen L, Kondo Y, Guo Y, Zhang J, Zhang L, Ahmed S, Shu J, Chen X, Waterland RA, Issa JP. Genome-wide profiling of DNA methylation reveals a class of normally methylated CpG island promoters. PLoS Genet 2007; 3:2023-2036.  !  !  77  ! CHAPTER 4. DISCUSSION AND CONCLUSION  4.1. DNA methylation as a biomarker  DNA methylation may fulfill the requirements for a useful biomarker of the development of pre-eclampsia (PET) and intrauterine growth restriction (IUGR) for several reasons. First, DNA methylation is implicated in the control of gene expression [1]. This can be achieved either directly (e.g. promoter methylation) or indirectly (e.g. recruited factors to change histone modifications). Gene expression itself can be difficult to measure due the need to measure expression at a physiological relevant time, whereas DNA methylation may be more stable and could be measured at a later time point. Second, DNA methylation is stable and heritable in the sense that it is stably passed from mother to daughter cells during cell division [1]. This means that DNA methylation can be measured from the placenta after birth and possibly still reflect the epigenetic landscape during the pregnancy. Finally, from a technical perspective, the stability of DNA methylation makes it easier to work with than mRNA in the laboratory setting. As is true for mRNA from other sources [2], placental mRNA degrades quickly and may be affected by mode of delivery, duration of labour, and processing time [3] and obtaining samples expeditiously can prove challenging. Additionally, quantitative real-time PCR analysis of gene expression requires comparison of the expression levels of the gene of interest to a reference gene that is ideally expressed at a similar level as the target and degrades at a similar rate as the target gene. In the case of the placenta, normalization to several reference genes may be recommended due to mRNA degradation [4]. Measurement of DNA methylation does not require comparison to a reference gene and provides an absolute measure of the percent methylation. !  TU!  Measurement of DNA methylation has disadvantages and challenges associated with it as well. DNA methylation status may not directly reflect expression levels due to the presence of other factors, such as histone modifications. Methylation may be influenced by a variety of factors including cell type and gestational age. Finally, you must know which CpG sites are relevant to assay when assessing DNA methylation; this is in contrast to assessing gene expression where any part of the transcript may be used as a target. Manuscript 1 describes DNA methylation changes that are found at ICR1 on chromosome 11p15.5 from placentas associated with normotensive IUGR. Several sites (ICR2 and other 11p15.5 genes) were also assayed; however, ICR1 was the only site to exhibit altered methylation. Other groups have failed to show a similar methylation decrease in ICR1 methylation in small for gestational age (SGA) placentas [5]. This discrepancy may be due to the different criteria used to define SGA and IUGR. While SGA may be defined as simply <10th percentile for weight (gestational age corrected), our definition of IUGR requires the presence of other prenatal indicators of poor placental function. Specifically, IUGR was defined as either (1) birth weight <3rd percentile for gender and gestational age using Canadian charts [6], or (2) birth weight <10th percentile with one ultrasound finding: (a) persistent uterine artery notching at 22+0-24+6 weeks gestation, (b) absent or reversed end diastolic velocity on umbilical artery Doppler, and/or (c) oligohydramnios (amniotic fluid index <50mm). While there is much overlap between cases diagnosed as SGA or IUGR, these are different diagnostic criteria. Comments received during the submission and revision process of Manuscript 1 at Placenta indicate that some researchers are hesitant to accept methylation data without concomitant gene expression and protein data. However, I feel that I must address these objections. Messenger RNA is unstable [2] and may degrade quickly after birth. As DNA !  !  79  methylation tends to be more stable than expression, it is easier to assess it accurately post delivery. It is quite possible that gene expression levels at term do not reflect expression earlier in gestation; to understand the gene expression and protein levels at the relevant time of gestation (i.e. at the onset of IUGR or pre-eclampsia) placental samples must be taken at that time. Needless to say, this is practically impractical and unethical to do from a human pregnancy. Also, gene expression may vary between placental sampling sites, possibly reflecting local environmental influences (such as hypoxia) [7]. As such, methylation data may be more reliable and easy to assess than gene expression for certain areas (e.g. ICR1 and ICR2 on 11p15.5); however, I found no methylation at the promoter of CDKN1C which highlights that not all genes are controlled directly by DNA methylation. In these cases, assessment of histone modifications may also prove helpful. Several groups have previously reported a decrease in IGF2 expression placentas from pregnancies associated with IUGR or SGA [5,8]. Although I reported a decrease in IGF2 expression with the Illumina gene expression array, I was unable to detect the same decrease with qRT-PCR despite using two endogenous controls. This is likely caused by one of two factors. The first is the length of time between delivery and sampling. This could result in a general degradation of mRNA. Secondly, work in the Robinson laboratory has shown that mRNA from some genes may degrade at a faster rate than others (unpublished). In light of this, the Illumina expression data may actually be more accurate than the qRTPCR data. Unlike in qRT-PCR, where expression is measured relative to a single endogenous control, the Illumina gene expression array normalizes gene expression relative to all the other probes on the plate (in this case over 22,000 other probes). Unfortunately, without good quality RNA taken from placentas quickly after delivery, it will be difficult to  !  !  80  truly establish whether the change in methylation we have observed at ICR1 is associated with a decrease in IGF2 expression in placentas from pregnancies affected by IUGR.  4.2. Imprinting in the placenta  Additional points brought up by a reviewer of Manuscript 1 highlight the possibility that imprinting may not be as well maintained in the human placenta as in the mouse placenta and as such, our data may not be relevant. This claim is based on a paper published in 2006 [9] that reported some genes, while known to have imprinted expression in murine placentas, are actually biallelically expressed in human placentas. While some of my data do support this claim (for example, we show a lack of methylation present at the promoter of CDKN1C which is controlled by ICR2 on 11p15.5), I show here that many genes and ICRs do retain their imprinted status in human placentas. Work presented in Manuscript 2 uses cases of hydatidiform moles, placental mesenchymal dysplasia and triploidy to further reinforce that some genes maintain their imprinted status in the placenta and that methylation may actually be useful in differentiating various placental pathologies at the molecular level. Macroscopic and histological analysis may not be able to differentiate the various types of abnormal placental pathologies and diagnosis is subject to inter-observer variability [10]. Molecular analysis currently involves immunostaining for CDKN1C; however, this method may be influenced by retained maternal chromosomes in some cases of complete hydatidiform moles [11,12]. Multiple studies performed by other groups also support that (at least some) imprinted genes are imprinted in the human placenta [5,13-15]. Additionally, McMinn et al. [8] have used expression arrays to show that eight imprinted genes (PHLDA2, MEST, !  !  81  MEG3, GATM, GNAS, PLAGL1, IGF2 and CDKN1C) are differentially expressed in normal human and IUGR placentas. These studies, as well as the ones ongoing in the Robinson laboratory, highlight the importance of continuing to undertake studies of imprinting in the human placenta.  4.3.  Methods to assess DNA methylation  A variety of methylation methods were used during the course of this thesis. The original studies performed in our lab used Methylation-sensitive Single Nucleotide Primer Extension (Ms-SNuPE) to assess methylation at ICR1 of 11p15.5; however, a pyrosequencing assay for this region has recently been developed by the Weksberg lab [16]. Due to the availability of this new assay, the Robinson lab has made the switch from SNuPE to pyrosequencing for this region. Pyrosequencing offers several advantages over SNuPE: 1. It is less expensive, less labour intensive, and more high-throughput than SNuPE; 2. It is not dependent on gel analysis; and, 3. It allows analysis of multiple CpG sites in a single assay. As outlined in Manuscripts 1 and 2, I have developed a variety of pyrosequencing assays that will continue to be used in future projects. The gold standard in methylation analysis has traditionally been the clone and sequence technique in which bisulfite treated DNA is cloned in to a vector, transformed in to bacteria, and plated on selective agar. Pyrosequencing may be a more quantitative method than bisulfite sequencing as it does not require cloning and selection steps, which may reduce the accuracy of standard bisulfite sequencing. One group has reported that while the methods were relatively equal in their sensitivity, they observed greater variability in methylation measured by bisulfite sequencing, which they attribute to the cloning and !  !  82  selection step [17]. Additionally, the cloning step is both time and labour intensive and is not well suited for high throughput analysis. There are some drawbacks to using pyrosequencing. To design assays for pyrosequencing, the sequence target of interest must already be known. In areas with multiple CpG sites, it can be difficult to find appropriate areas to place primers, which may lead to some amplification biases. Additionally, work in the Robinson laboratory has shown there to be approximately five percent variation within a given assay. I also made use of Illumina GoldenGate methylation array. It covers 1505 CpG sites across the human genome, with 70 probes located in imprinted genes. I found that the GoldenGate methylation array had a tendency to overestimate methylation differences between genes. Additionally, as the Illumina array measures many sites at one, there is a high likelihood of false positive findings (which must be controlled for by correcting for multiple comparisons). In spite of this, I feel that it is still an important tool to identify genes that merit further investigation with pyrosequencing.  4.4. Future directions  4.4.1. Assisted reproductive technologies (ART)  In recent years, the use of assisted reproductive technologies (ART) has increased dramatically. The umbrella of ART encompasses procedures such as hormonal stimulation to induce superovulation, in vitro fertilization (IVF), and intracytosplasmic sperm injection (ICSI), culture and preimplantation genetic diagnosis. This increase in prevalence is in part due to women postponing child bearing until later in life. ART pregnancies are more often !  !  83  associated with congenital anomalies (although this is a small increase above those conceived naturally) and obstetrical complications, primarily low birth weight, than are pregnancies conceived naturally. Given that many genes are expressed very early in development, and imprinted genes, may be sensitive to environmental influences and culture [18], it stands to reason that ART may have an effect on the resulting pregnancy. There is a growing body of evidence pointing to possible epigenetic changes in pregnancies that have been conceived with the help of ART. Animal studies have suggested that both genome-wide [19] and locus specific [20] changes can occur following embryo manipulation. There is also some evidence to suggest that underlying infertility may affect DNA methylation [21,22] or that abnormal DNA methylation could lead to reduced fertility. Methylation changes in human pregnancies have also been reported. Katari et al. used the same methylation array used in our study (GoldenGate Methylation Array from Illumina) to investigate genome wide differences between pregnancies conceived in vivo or in vitro [23]. They found some modest methylation differences between the groups and found alterations in the imprinted genes on the array. They also found some concomitant gene expression changes. At the single-locus level, Gomes et al. found the same KvDMR1 methylation changes seen in Beckwith-Wiedemann syndrome in 3 out of 18 clinically normal children conceived through ART (2 IVF and 1 ICS1) [24]. There is a clear need for additional studies of methylation and expression of imprinted regions in ART pregnancies. A better understanding of the underlying reasons why these pregnancies are at a higher risk for complications and the ability to tease apart the effects of infertility and ART may aid in the prevention of such complications. As the use of  !  !  84  ART continues to increase, so will the importance of better understanding the effects, both short and long term, of these technologies on the resulting pregnancies.  4.4.2. Diet and environmental influences  As diet, specifically folate and vitamin B12, plays a role in imprinted gene methylation in mice [25-28], it may also be involved in imprinted gene methylation in humans. While it was not possible within the confines of this project, an analysis of diet prior to and during pregnancy and the subsequent effects on imprinted gene methylation and obstetrical outcome could provide insight in to the role of diet on pregnancy outcomes. Also, as a variety of environmental factors are known to influence methylation (ethanol [29], tamoxifen [30], TCDD [31], bisphenol A [32-34]), measuring exposure levels prior to and during pregnancy may shed some light on the role of environmental influences on pregnancy outcome. These studies might better help us understand if imprinting is maintained in the placenta to ensure that it can react accordingly to changing conditions and to allow the pregnancy to continue.  4.4.3. Utility of this work  The new methylation assays presented in this thesis will hopefully lead to better, and more reliable, diagnoses of hydatidiform moles, placental mesenchymal dysplasia, and parent of origin in triploidy. Although some groups feel that there is no or limited retention of imprinting status in the human placenta [9], my work with these pathologies in Manuscript 2 shows that they reliably maintain their imprinting status. The triploids for !  !  85  which parent of origin has been identified could then help confirm or find additional imprinted genes as these regions would have significantly different patterns of methylation from normal placentas. Additional pyrosequencing assays and the Illumina GoldenGate methylation array would prove to be very useful in this respect. The techniques presented in this thesis will hopefully be able to be applied to the study of whether altered methylation in intrauterine growth restriction is a cause of abnormal placental pathology or a consequence of an underlying placental pathology. I attempted to use Ms-SNuPE to look at placentas with confined placental trisomy with the idea that the placental trisomy, not the methylation, should be the cause of growth restriction. Unfortunately, the poor quality DNA from these trisomic placentas was unable to be amplified with the Ms-SNuPE assay and did not produce any useable data. With the development of an H19 ICR pyrosequencing assay [16], future studies might be able to better understand if the change in methylation at ICR in IUGR is a cause or a consequence of an underlying placental problem.  4.5.  Significance  This project is part of a larger initiative to develop a strategy for improved diagnosis and management of pregnancies associated with pre-eclampsia and/or IUGR. Pre-eclampsia accounts for up to 20% of maternal mortality in developed countries [35] and is associated with a significant number of perinatal deaths and IUGR [36]. Both pre-eclampsia and IUGR are associated with many long term health risks and even a small reduction in their incidence can result in a significant reduction in health care costs [37]. Medical intervention for preeclampsia is most useful early in pregnancy, thus early diagnosis is important. !  !  86  One of the major goals of this initiative is to correlate molecular data with clinical course and severity to identify clinical subsets of pre-eclampsia/IUGR of distinct etiology. The epigenetic changes that correlate with clinical sub-populations can be then used to identify patients that differ in terms of recurrence risk and long-term outcomes of their babies. The establishment of biomarkers that could be used to accurately identify those women at an increased risk for pre-eclampsia or IUGR would be a major step forward in antenatal care. The work presented in this thesis is a preliminary step towards achieving these goals.  !  !  87  4.6. References [1] Jones PA, Takai D. The Role of DNA Methylation in Mammalian Epigenetics. Science 2001; 293:1068-1070. [2] Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time RT-PCR - A perspective. J Mol Endocrinol 2005; 34:597-601. [3] Fajardy I, Moitrot E, Vambergue A, Vandersippe-Millot M, Deruelle P, Rousseaux J. Time course analysis of RNA stability in human placenta. BM Mol Biol 2009; 10:21. [4] Meller M, Vadachkoria S, Luthy DA, Williams MA. Evaluation of housekeeping genes in placental comparative expression studies. Placenta 2005; 26:601-607. [5] Guo L, Choufani S, Ferreira J, Smith A, Chitayat D, Shuman C, Uxa R, Keating S, Kingdom J, Weksberg R. Altered gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA) placentae. Dev Biol 2008; 320:79-91. [6] Kramer MS, Platt RW, Wen SW, Joseph KS, Allen A, Abrahamowicz M, Blondel B, Breart G, for the Fetal/Infant Health Study Group of the Canadian Perinatal Surveillance System. A New and Improved Population-Based Canadian Reference for Birth Weight for Gestational Age. Pediatrics 2001; 108:e35. [7] Wyatt SM, Kraus FT, Roh C-, Elchalal U, Nelson DM, Sadovsky Y. The correlation between sampling site and gene expression in the term human placenta. Placenta 2005; 26:372-379. [8] McMinn J, Wei M, Schupf N, Cusmai J, Johnson EB, Smith AC, Weksberg R, Thaker HM, Tycko B. Unbalanced placental expression of imprinted genes in human intrauterine growth restriction. Placenta 2006; 27:540-549. [9] Monk D,Arnaud P,Apostolidou S,Hills FA,Kelsey G,Stanier P,Feil R,Moore GE. Limited evolutionary conservation of imprinting in the human placenta. PNAS 2006; 103:6623-6628. [10] Fukunaga M, Katabuchi H, Nagasaka T, Mikami Y, Minamiguchi S, Lage JM. Interobserver and Intraobserver Variability in the Diagnosis of Hydatidiform Mole. Am J Surg Pathol 2005; 29:942-947. [11] Fisher RA, Nucci MR, Thaker HM, Weremowicz S, Genest DR, Castrillon DH. Complete hydatidiform mole retaining a chromosome 11 of maternal origin: molecular genetic analysis of a case. Mod Pathol 2004; 17:1155-1160. [12] McConnell TG, Murphy KM, Hafez M, Vang R, Ronnett BM. Diagnosis and subclassification of hydatidiform moles using p57 immunohistochemistry and molecular genotyping: validation and prospective analysis in routine and consultation practice settings with development of an algorithmic approach. Am J Surg Pathol 2009; 33:805-817. [13] Hiby SE,Lough M,Keverne EB,Surani MA,Loke YW,King A. Paternal monoallelic expression of PEG3 in the human placenta. Hum Mol Genet 2001; 10:1093-1100. [14] Saxena A, Frank D, Panichkul P, Van den Veyver IB, Tycko B, Thaker H. The Product of the Imprinted Gene IPL Marks Human Villous Cytotrophoblast and is Lost in Complete Hydatidiform Mole. Placenta 2003; 24:835-842. [15] McMinn J, Wei M, Sadovsky Y, Thaker HM, Tycko B. Imprinting of PEG1/MEST Isoform 2 in Human Placenta. Placenta 2006; 27:119-126. [16] Horike S, Ferreira JC, Meguro-Horike M, Choufani S, Smith AC, Shuman C, Meschino W, Chitayat D, Zackai E, Scherer SW, Weksberg R. Screening of DNA methylation at the !  !  88  H19 promoter or the distal region of its ICR1 ensures efficient detection of chromosome 11p15 epimutations in Russell-Silver syndrome. Am J Med Genet Part A 2009; 149A:24152423. [17] Reed K, Poulin ML, Yan L, Parissenti AM. Comparison of bisulfite sequencing PCR with pyrosequencing for measuring differences in DNA methylation. Anal Biochem 2010; 397:96-106. [18] Mann MRW,Lee SS,Doherty AS,Verona RI,Nolen LD,Schultz RM,Bartolomei MS. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004; 131:3727-3735. [19] Zaitseva I, Zaitsev S, Alenina N, Bader M, Krivokharchenko A. Dynamics of DNAdemethylation in early mouse and rat embryos developed in vivo and in vitro. Mol Reprod Dev 2007; 74:1255-1261. [20] Suzuki J, Jr., Therrien J, Filion F, Lefebvre R, Goff AK, Smith LC. In vitro culture and somatic cell nuclear transfer affect imprinting of SNRPN gene in pre- and post-implantation stages of development in cattle. BMC Dev Biol 2009; 9:9. [21] Houshdaran S, Cortessis VK, Siegmund K, Yang A, Laird PW, Sokol RZ. Widespread epigenetic abnormalities suggest a broad DNA methylation erasure defect in abnormal human sperm. PLoS One 2007; 2:e1289. [22] Marques CJ, Costa P, Vaz B, Carvalho F, Fernandes S, Barros A, Sousa M. Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia. Mol Hum Reprod 2008; 14:67-74. [23] Katari S, Turan N, Bibikova M, Erinle O, Chalian R, Foster M, Gaughan JP, Coutifaris C, Sapienza C. DNA methylation and gene expression differences in children conceived in vitro or in vivo. Hum Mol Genet 2009; 18:3769-3778. [24] Gomes MV, Huber J, Ferriani RA, Amaral Neto AM, Ramos ES. Abnormal methylation at the KvDMR1 imprinting control region in clinically normal children conceived by assisted reproductive technologies. Mol Hum Reprod 2009; 15:471-477. [25] Waterland RA, Lin J-, Smith CA, Jirtle RL. Post-weaning diet affects genomic imprinting at the insulin-like growth factor 2 (Igf2) locus. Hum Mol Genet 2006; 15:705716. [26] Kovacheva VP, Mellott TJ, Davison JM, Wagner N, Lopez-Coviella I, Schnitzler AC, Blusztajn JK. Gestational Choline Deficiency Causes Global and Igf2 Gene DNA Hypermethylation by Up-regulation of Dnmt1 Expression. J Biol Chem 2007; 282:3177731788. [27] Strakovsky R, Pan Y-. Maternal Protein and Folate Intake Affects Gene Expression and DNA Methylation in Rat Placenta. FASEB J. 2008; 22:727. [28] Wade RE, Boersma H, Devlin AM. Prenatal Exposure to Disrupted Methyl Metabolism Affects Expression & Allele-Specific Methylation of H19/Igf2 in Brain. FASEB J. 2009; 23:219.4. [29] Haycock PC, Ramsay M. Exposure of mouse embryos to ethanol during preimplantation development: effect on DNA methylation in the h19 imprinting control region. Biol Reprod 2009; 81:618-627. [30] Pathak S, Kedia-Mokashi N, Saxena M, D'Souza R, Maitra A, Parte P, Gill-Sharma M, Balasinor N. Effect of tamoxifen treatment on global and insulin-like growth factor 2-H19 locus-specific DNA methylation in rat spermatozoa and its association with embryo loss. Fertil Steril 2009; 91:2253-2263.  !  !  89  [31] Wu Q, Ohsako S, Ishimura R, Suzuki JS, Tohyama C. Exposure of mouse preimplantation embryos to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) alters the methylation status of imprinted genes H19 and Igf2. Biol Reprod 2004; 70:1790-1797. [32] Dolinoy DC, Huang D, Jirtle RL. Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. PNAS 2007; 104:1305613061. [33] Bromer JG, Zhou Y, Taylor MB, Doherty L, Taylor HS. Bisphenol-A exposure in utero leads to epigenetic alterations in the developmental programming of uterine estrogen response. FASEB J. 2010. [34] Ho SM, Tang WY, Belmonte de Frausto J, Prins GS. Developmental exposure to estradiol and bisphenol A increases susceptibility to prostate carcinogenesis and epigenetically regulates phosphodiesterase type 4 variant 4. Cancer Res 2006; 66:56245632. [35] MacKay AP, Berg CJ, Atrash HK. Pregnancy-related mortality from preeclampsia and eclampsia. Obstet Gynecol 2001; 97:533-538. [36] Seidman DS, Laor A, Gale R, Stevenson DK, Mashiach S, Danon YL. Pre-eclampsia and offspring’s blood pressure, cognitive ability and physical development at 17-years-ofage. BJOG 1991; 98:1009-1014. [37] Liu A, Wen SW, Bottomley J, Walker MC, Smith G. Utilization of health care services of pregnant women complicated by preeclampsia in Ontario. Hypertens Pregnancy 2009; 28:76-84.  !  !  90  APPENDIX A. Supplementary Table 1. Additional clinical details from the placentas in Manuscript 1. GA=gestational age; BW=birth weight; AFP=alpha-fetoprotein; uE3=unconjugated estriol; B-hCG=human chorionic gonadotropin; Bal=Balanced; GD= gestational diabetes; IUFD= intrauterine fetal demise; EoPET= early onset preeclampsia; LoPET= late onset preeclampsia; HELLP= hemolytic anemia, elevated liver enzymes, low platelet count; REDF= reversed end diastolic flow. GA (weeks)  BW (g)  SD from mean  Mat. Age (years)  AFP (MoM)  uE3 (MoM)  B-hCG (MoM)  46, XY 46, XY 46, XY 46, XX 46, XY  37 +5 40 +2 38 +5 36 + 36 +5  3270 3570 2950 2305 3335  0 SD (-0.2) SD (-1.2) SD (-1.3) SD (+0.8) SD  37 32 33 35 32  N/A 1.63 0.64 1.15 0.72  N/A 1.49 1.25 1.13 1.22  N/A 1.22 0.40 1.12 0.90  PM57 PM59  46, XX 46, XY  41 +4 40  2925 3635  (-1.5) SD 0 SD  36 26  N/A N/A  N/A N/A  N/A N/A  PM65 PM68 PM70 PM73 PM74 PM77 PM78 PM82 PM84 PM87 PM89 PM94 PM96 PM101 PM104  47, XXX 46, XY 46, XX 46, XY 46, XY 46, XY 46, XY 46, XX 46, XX 46, XX 46, XX 46, XX 46, XY 46, XY 46, XY  41 +3 39 39 38 +1 37 +6 36 +3 38 41 +3 39 +6 37 +2 41 +5 40 +2 40 38 40 +5  3250 4615 3915 3510 3460 2975 3610 3890 3635 3470 4140 3580 3900 2885 3360  (-0.8) SD (+3.0) SD (+1.8) SD (+0.5) SD (+0.5) SD (+1.6) SD (+0.7) SD (+0.6) SD (+0.4) SD (+1.1) SD (+1.7) SD (+0.2) SD (+0.8) SD (-0.88) SD (-0.37) SD  30 36 34 30 36 33 34 35 33 34 25 36 33 34 30  N/A 0.77 N/A N/A 1.20 0.84 0.79 N/A 1.31 1.04 0.88 N/A 0.85 1.75 0.84  N/A 1.02 N/A N/A 0.98 0.68 1.05 N/A 1.14 1.16 0.50 N/A 0.74 0.93 0.74  N/A 0.71 N/A N/A 0.55 1.09 0.48 N/A 1.31 0.90 1.78 N/A 0.94 1.20 0.46  Placenta CONTROLS PM5 PM8 PM10 PM17 PM20  Karyotype  Other  Severe oligohydramnios Severe oligohydramnios  IUGR PM4  46, XX  37  2340  (-1.2) SD  37  N/A  N/A  N/A  PM29  46, XX  36  2600  (-0.4) SD  29  2.53  0.74  3.03  PM30  46, XX  36 +2  2240  (-0.8) SD  32  0.92  0.50  3.10  PM35  46, XX  PM41  47, XX,+7  PM42 PM47  37  2345  (-1.2) SD  28  2.33  0.36  0.58  37 +1  1725  (-2.4) SD  43  0.62  0.73  0.50  46, XX  26  450  (-2.1) SD  33  N/A  N/A  N/A  38  2645  (-1.5) SD  35  N/A  N/A  1.75  PM72  46, XX 46, XX/47, XX,+13  34  1445  (-2.2) SD  38  0.91  0.24  1.11  PM121  46, XY  40  2930  (-1.2) SD  35  1.01  0.09  3.42  !  !  GD, oligohydramnios  Oligohydramnios IUFD, severe oligohydramnios, retrognathiat Oligohydramnios Severe oligohydramnios  91  PM123  46, XX  35 +3  1565  (-1.9) SD  26  N/A  N/A  N/A  PM128  46, XX  31  1390  (-1.11) SD  33  1.70  1.57  1.02  PM130  46, XY  36 +6  2090  (-1.7) SD  37  N/A  N/A  N/A  PM139  46, XY  36  1740  (-2.5) SD  30  2.16  0.49  2.38  Severe oligohydramnios Asymmetric IUGR, oligohydramnios Asymmetric IUGR, severe oligohydramnios  PM36  46, XX  37 +2  3170  (+0.4) SD  31  N/A  N/A  N/A  EoPET  PM44  46, XY  39 +2  2730  (-1.34) SD  27  1.32  0.67  1.34  LoPET  PM46  46, XX  40  3385  (-0.1) SD  40  N/A  N/A  N/A  LoPET  PM50  46, XX  38 +2  2935  (-0.8) SD  30  N/A  N/A  N/A  LoPET, HELLP  PM53  46, XX  38 +4  4400  (+2.5) SD  35  0.70  0.55  1.38  LoPET, GD  PM54  46, XX  34 +4  2270  0 SD  41  N/A  N/A  N/A  LoPET  PM55  46, XX  40  4095  (+1.3) SD  26  1.11  1.06  1.37  LoPET  PM56  46, XX  34  2615  (+2.2) SD  27  0.92  1.52  1.00  LoPET  PM58  46, XX  37  3010  (+0.2 SD)  37  1.00  1.17  0.73  PM64  46, XX  33 +2  1728  (-1 SD)  27  N/A  N/A  N/A  LoPET, GD EoPET, HELLP, oligohydramnios  PM71  46, XX  38 +6  2675  (-1.5) SD  39  N/A  N/A  N/A  LoPET  PM80  46, XY  28 +4  1095  (-1) SD  35  2.10  0.88  2.31  EoPET  PM98  46, XY  37 +3  3310  (+0.6 SD)  34  1.39  1.66  1.51  LoPET  PM99  46, XY  26 +6  N/A  N/A  37  N/A  N/A  N/A  EoPET  PM100  46, XY  36  3385  (+3.0) SD  34  N/A  N/A  N/A  EoPET  PM119  46, XY  37  2530  (-1.2 SD)  33  N/A  N/A  N/A  LoPET  PM138  46, XY  34  3685  (+6.7) SD  38  0.88  0.91  0.89  EoPET, GD  PM6  46, XY  32 +5  1160  (-3.4) SD  42  N/A  N/A  N/A  EoPET, asymmetric IUGR  PM15  46, XX  32 +6  1480  (-2.0) SD  36  1.65  1.19  2.00  PM21  46, XY  33  1650  (-1.4 SD)  34  N/A  N/A  N/A  PM26B  46, XX  31 +5  940  (-3.2) SD  36  2.14  1.94  2.52  PM31  46, XX  36  1480  (-3.3) SD  31  N/A  N/A  N/A  PM32  46, XX  35  1630  (-1.8) SD  36  N/A  N/A  N/A  PM37  46, XY  24 +4  360  (-2.6) SD  35  1.49  0.74  5.57  PM38  46, XY  36  2225  (-0.8) SD  31  N/A  N/A  N/A  PM39  46, XY  32  1700  (+0.3) SD  19  N/A  N/A  N/A  LoPET EoPET, mild asymmetric IUGR  PM40  46, XX  38 +2  2565  (-1.7) SD  33  0.81  0.90  1.36  LoPET  PM43  46, XX  31 +5  1440  (-0.9) SD  32  0.86  1.26  0.81  PM51  46, XX  34  1400  (-2.9) SD  42  N/A  N/A  N/A  PM52  46, XY  35 +3  1840  (-1.3) SD  23  1.41  0.76  3.95  EoPET EoPET, asymmetric IUGR, oligohydramnios LoPET, GD, oligohydramnios  PET  PIH + IUGR  !  !  EoPET, HELLP EoPET, heart defects, omphalocoele EoPET LoPET, asymmetric IUGR LoPET, oligohydramnios EoPET, IUFD, severe oligohydramnios, REDF  92  PM60  47, XX,+2  33 +2  PM62  46, XY  PM66  46, XY  PM67 PM86 PM97  46, XY  PM116  46, XY  PM129  46, XY  37 +2  !  EoPET, severe asymmetric IUGR, severe oligohydramnios, REDF  1465  (-2.6) SD  39  N/A  N/A  N/A  27 +1  480  (-2.5 SD)  40  N/A  N/A  N/A  EoPET  35  1790  (-1.4) SD  38  N/A  N/A  N/A  LoPET, mild IUGR  46, XY  33 +6  1560  (-2.2) SD  40  N/A  N/A  N/A  EoPET, GD  46, XY  25  545  (-1.6) SD  35  2.02  1.17  3.24  26  440  (-2.2) SD  23  1.77  0.39  1.09  EoPET EoPET,chr.3 variant, IUFD  32 +3  1480  (-0.7) SD  26  0.64  0.79  0.78  1840  (-2.2) SD  37  9.55  0.68  3.11  !  EoPET EoPET, asymmetric IUGR  93  Supplementary Table 2. Primers and sequences to analyze for pyrosequencing assays.  Location KvDMR1  Seq. to Analyze H19 Promoter  Seq. to Analyze PEG10 Promoter  Seq. to Analyze PLAGL1 Promoter  Seq. to Analyze SNRPN Promoter  Seq. to Analyze MEST Exon 1  Seq to. Analyze  !  Primers KvDMR1-F2 (5’-TTAGTTTTTTGYGTGATGTGTTTATTA-3’) KvDMR1-R (5’-Biotin/CCCACAAACCTCCACACC-3’). KvDMR1-S (5’-TTGYGTGATGTGTTTATTA-3’). TTTYGGGGTGATYGYGTGAGGATAGYGGTYGTATTTYGATATTGTTGTGGGTTTTTYG H19-F (5'-Biotin/ATTGTGGGAGGGGTTAGTATAGGA) H19-R (5'-CTCCACRCTCAAAAATCATCAC-3') H19-S (5'-ATTTACCCACAAATATTCC-3') CCRTACCTACRCATTACTAACAACACRACCRAATCCT PEG10-F (5'-TTGGTTTTGGTTTTTGGAAATAG-3') PEG10-R (5'-Biotin/TTTCCCCCTCTTACTAAATACATTTCT-3') PEG10-S (5'-TTGTTTAGTTTTTAGTATTTTATGA-3') TTTYGTTTTTTTGTTTYGTAAAATYGAAGAAAATYGAGATTTTYGTTATYG PLAGL1-F (5'-Biotin/GAYGGGTTGAATGATAAATGGTAGATG-3') PLAGL1-R (5'-TCRACRCAACCATCCTCTTAACTAC-3') PLAGL1-S (5'-ACRCAACCATCCTCTTA-3') TTTYGTTTTTTTGTTTYGTAAAATYGAAGAAAATYGAGATTTTYGTTATYG SNRPN-F (5'-Biotin/TATGTTTAGGYGGGGATGTGTG-3') SNRPN-R (5'-AAAAACCACCRACACAACTAACCTTAC-3') SNRPN-S (5'-CAAACAAATACRTCAAACATCT-3') CCRACRACCRCTCCACTCTACRCCAAACTCRCTACAACAAC MEST-F (5-Biotin/GGGTTTTTTTTGGGAATAGGGTGAA-3') MEST-R (5'-CRCCTCTTACCTAATTCAAATAAAACCTT-3') MEST-S (5'-CCTTACCTACAAAACTCCAT) ATTTCRAAAAACCRATTACRCATACRCTTCCT  !  94  APPENDIX B. UBC C&W CREB Approval  !  !  95  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0070983/manifest

Comment

Related Items