UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The role of talin in LFA-1 function in cell-mediated cytotoxicity Mace, Emily Margaret 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_mace_emily.pdf [ 1.88MB ]
Metadata
JSON: 24-1.0070938.json
JSON-LD: 24-1.0070938-ld.json
RDF/XML (Pretty): 24-1.0070938-rdf.xml
RDF/JSON: 24-1.0070938-rdf.json
Turtle: 24-1.0070938-turtle.txt
N-Triples: 24-1.0070938-rdf-ntriples.txt
Original Record: 24-1.0070938-source.json
Full Text
24-1.0070938-fulltext.txt
Citation
24-1.0070938.ris

Full Text

THE ROLE OF TALIN IN LFA-1 FUNCTION IN CELL-MEDIATED CYTOTOXICITY  by  EMILY MARGARET MACE B.Sc., The University of Saskatchewan, 2003  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) March, 2010 © Emily Margaret Mace, 2010  ABSTRACT Natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) are effectors of cell-mediated cytotoxicity towards virally infected and tumourigenic cells. The integrin leukocyte function associated antigen-1 (LFA-1) is required for the adhesion of effector cells to their targets. In addition, LFA-1 transduces signals resulting in actin polymerization. We show that in both CTLs and NK cells, LFA-1 ligand binding results in the recruitment of actin, the cytoskeletal adaptor talin, and the activator of actin nucleation Wiskott-Aldrich Syndrome protein (WASP). We used talin-knockout (KO) NK cells to demonstrate that talin is required for LFA-1 mediated adhesion and polarization towards the target cell. This actin polarization is a prerequisite for subsequent steps leading to cytotoxicity, including the translocation of cytotoxic granules. Further analysis of the LFA-1 mediated signaling that leads to actin polymerization shows that talin recruits proteins that catalyze de novo actin formation. Talin forms a complex with vinculin and the actin-nucleator Arp2/3, and talin is required for the movement of these proteins to LFA-1 following LFA-1 binding to ICAM-1. In addition, talin binds the phosphatidylinositol phosphate kinase PIPKI and talin is required for the localized production of phosphatidylinositol 4,5 bisphosphate (PIP2) following LFA-1 ligation. This production of PIP2 is required for the recruitment of WASP, which in turn activates Arp2/3 to polymerize actin. Thus we have demonstrated a critical role for talin in the actin polarization that is required for cell-mediated cytotoxicity and elucidated the mechanism of LFA-1 mediated actin polymerization.  ii  TABLE OF CONTENTS ABSTRACT .................................................................................................................................... ii  TABLE OF CONTENTS............................................................................................................... iii  LIST OF FIGURES ....................................................................................................................... vi  LIST OF ABBREVIATIONS ...................................................................................................... viii  ACKNOWLEDGEMENTS ........................................................................................................... xi  CO-AUTHORSHIP STATEMENT.............................................................................................. xii  CHAPTER 1 INTRODUCTION .................................................................................................... 1  1.1 Introduction to cell-mediated cytotoxicity ............................................................................ 2  1.1.2 Steps leading to CTL-mediated cytotoxicity ..................................................................... 3  1.1.3 Steps leading to NK cell-mediated cytotoxicity ................................................................ 5  1.2 Integrins and talin ............................................................................................................... 13  1.2.1 Integrins ........................................................................................................................... 13  1.2.2 LFA-1 conformation and activation................................................................................. 14  1.2.3 Talin ................................................................................................................................. 17  1.3 Proteins involved in signals leading to actin polymerization ............................................. 20  1.3.1 Arp2/3 .............................................................................................................................. 20  1.3.2 WASP/WAVE and WIP .................................................................................................. 21  1.3.3 Pyk2/FAK ........................................................................................................................ 24  1.3.4 Vinculin............................................................................................................................ 24  1.3.5 CD44 ................................................................................................................................ 25  1.3.6 Phosphatidylinositol phosphate kinase type I  (PIPKI) ................................................ 26  1.3.7 Phosphatidylinositol 4, 5 bisphosphate (PIP2) ................................................................. 28  1.4 A model for talin’s role in actin polymerization ................................................................. 28  1.5 Thesis hypothesis and objectives ........................................................................................ 30  1.6 Bibliography ....................................................................................................................... 31  CHAPTER 2 LFA-1 BINDING TO LIGAND INDUCES TALIN-MEDIATED ACTIN REORGANIZATION IN T CELLS ............................................................................................. 45  2.1 Introduction ......................................................................................................................... 46  2.2 Materials and methods ........................................................................................................ 49  2.2.1 Mice, antibodies and reagents .......................................................................................... 49  2.2.2 Cells ................................................................................................................................. 49  2.2.3 Binding of cells to beads coated with ICAM-1 or anti-LFA-1 mAb ............................... 50  2.2.4 Confocal microscopy ....................................................................................................... 50  2.2.5 Pyk2 phosphorylation ...................................................................................................... 51  2.2.6 Cell adhesion assay .......................................................................................................... 52  2.3 Results ................................................................................................................................. 53  2.3.1 Actin, talin and WASP accumulates in the immunological synapse of CTLs in an antigen-independent manner ..................................................................................................... 53  2.3.2 LFA-1 capping does not induce co-capping of F-actin ................................................... 55  2.3.4 Binding to ICAM-1-coated plates as well as anti-LFA-1-coated plates induces Pyk2 phosphorylation......................................................................................................................... 60  2.3.5 Disruption of actin cytoskeleton by cytochalasin D treatment inhibits LFA-1 mediated adhesion to ICAM-1 ................................................................................................................. 60  2.4 Discussion ........................................................................................................................... 64  2.5 Bibliography ....................................................................................................................... 69  iii  CHAPTER 3 A DUAL ROLE FOR TALIN IN NK CELL CYTOTOXICITY: ACTIVATION OF LFA-1 MEDIATED ADHESION AND POLARIZATION OF NK CELLS ........................ 73  3.1 Introduction ......................................................................................................................... 74  3.2 Materials and methods ........................................................................................................ 77  3.2.1 Mice, antibodies, reagents and flow cytometry ............................................................... 77  3.2.2 Generation of ES-derived NK cells ................................................................................. 78  3.2.3 NK cell culture ................................................................................................................. 78  3.2.4 RT-PCR............................................................................................................................ 78  3.2.5 H60-Fc and CD160-Fc fusion proteins ............................................................................ 79  3.2.6 Cell adhesion assay .......................................................................................................... 79  3.2.7 Cytotoxicity assays .......................................................................................................... 79  3.2.8 Pyk2 immunoprecipitation and western blotting ............................................................. 80  3.2.9 Confocal microscopy ....................................................................................................... 81  3.2.10 Statistics ......................................................................................................................... 82  3.3 Results ................................................................................................................................. 82  3.3.1 In vitro generation of NK cells from talin1-deficient ES cells ........................................ 82  3.3.2 Talin is required for LFA-1-mediated cell adhesion........................................................ 84  3.3.3 Talin-KO NK cells are unable to mediate cytotoxicity against conventional targets but are able to kill fibroblasts .......................................................................................................... 86  3.3.4 Binding of NK cells to ICAM-1-coated beads results in recruitment of talin and Pyk2 phosphorylation......................................................................................................................... 89  3.3.5 Talin is required for actin accumulation in NK cells binding to ICAM-1-coated beads . 91  3.3.6 NKG2D ligation induces talin-dependent polarization of cytotoxic granules towards targets ........................................................................................................................................ 93  3.4 Discussion ........................................................................................................................... 95  3.5 Bibliography ....................................................................................................................... 99  CHAPTER 4 ELUCIDATION OF THE LFA-1 MEDIATED SIGNALING PATHWAY LEADING TO ACTIN POLARIZATION IN NK CELLS........................................................ 105  4.1 Introduction ....................................................................................................................... 106  4.2 Materials and methods ...................................................................................................... 108  4.2.1 Mice, antibodies, reagents and flow cytometry ............................................................. 108  4.2.2 Cell culture and isolation ............................................................................................... 109  4.2.3 Immunoprecipitation and western blotting .................................................................... 109  4.2.4 Confocal microscopy ..................................................................................................... 110  4.2.5 Statistics ......................................................................................................................... 111  4.3 Results ............................................................................................................................... 111  4.3.1 LFA-1 binding to ICAM-1 results in accumulation of talin, actin, Arp2/3, vinculin and WASP ..................................................................................................................................... 111  4.3.2 Talin is required for recruitment of actin and actin polymerization machinery following binding of LFA-1 to ICAM-1 ................................................................................................. 115  4.3.3 WASP-KO NK cells show normal accumulation of Arp2/3, vinculin and talin, but not actin ......................................................................................................................................... 117  4.3.4 Vinculin, Arp2/3 and talin, but not WASP, constitutively associate in NK cells.......... 119  4.3.5 Talin is required for increased PIP2 level at the site of LFA-1 ligation and is associated with PIPKI ............................................................................................................................. 121  4.3.6 WASP recruitment is dependent on PIP2 ....................................................................... 123  iv  4. 4 Discussion ........................................................................................................................ 125  4.5 Bibliography ..................................................................................................................... 129  CHAPTER 5 DISCUSSION AND SUMMARY ....................................................................... 133  5.1 Talin recruitment and LFA-1 activation ........................................................................... 134  5.2 LFA-1 outside-in signaling ............................................................................................... 135  5.3 A revised model for talin’s role in LFA-1 function .......................................................... 141  5.4 Future directions ............................................................................................................... 141  5.5 Summary ........................................................................................................................... 144  5.6 Bibliography ..................................................................................................................... 145  APPENDIX 1 DETAILED METHODOLOGIES ...................................................................... 148  APPENDIX 2 UBC RESEARCH ETHICS BOARD CERTIFICATE OF APPROVAL .......... 165   v  LIST OF FIGURES Figure 1.1 Signaling leading to CTL-mediated cytotoxicity ........................................................ 4 Figure 1.2 Signaling leading to NK cell-mediated cytotoxicity ................................................... 7 Figure 1.3 Four broad steps leading to granule exocytosis ......................................................... 11 Figure 1.4 Conformational activation of LFA-1 ......................................................................... 15 Figure 1.5 Domain structure of talin ........................................................................................... 17 Figure 1.6 LFA-1 outside-in signaling........................................................................................ 28 Figure 2.1 Antigen-independent accumulation of actin and LFA-1 in CTL .............................. 53 Figure 2.2 Capping of LFA-1 and staining for actin and talin in CTL ....................................... 56 Figure 2.3 Binding of CTL to ICAM-1 and LFA-1-coated beads and staining for actin, talin and WASP ................................................................................................................. 58 Figure 2.4 Tyrosine phosphorylation of Pyk2 after binding to ICAM-1 .................................... 60 Figure 2.5 Adhesion of T cells to ICAM-1 following cytochalasin D treatment ....................... 62 Figure 3.1 Expression of LFA-1, NKG2D, talin1 and talin2 in ES and ES-derived NK cells ... 82 Figure 3.2 Adhesion of WT and talin-KO NK cells to ICAM-1 ................................................ 84 Figure 3.3 Cytotoxicity of WT and talin-KO NK cells .............................................................. 86 Figure 3.4 Accumulation of phospho-Pyk2 following NK cell binding to ICAM-1 coated beads ................................................................................................ 89 Figure 3.5 Accumulation of talin following binding of NK cells to ICAM-1 coated beads ................................................................................................................................ 91 Figure 3.6 Polarization of actin, cytotoxic granules and the MTOC following ligation of LFA-1 and NKG2D .................................................................................. 93 Figure 4.1Accumulation of talin, actin, Arp2/3, vinculin and WASP following NK cell binding to ICAM-1 coated beads ................................................................ 112 Figure 4.2 Expression of receptors on IL-2 activated, IL-15 activated and ex vivo NK cells ................................................................................................................. 113  vi  Figure 4.3 Talin-dependent accumulation of actin, Arp2/3, vinculin and WASP in NK cells bound to ICAM-1 coated beads ................................................................. 115 Figure 4.4 Accumulation of talin, Arp2/3, vinculin and WASP in WT and WASP-KO NK cells ................................................................................................... 117 Figure 4.5 Constitutive association of vinculin with talin and Arp2/3 ..................................... 119 Figure 4.6 Association of talin with PIPKI and production of PIP2 following NK cells binding LFA-1 ............................................................................... 120 Figure 4.7 Disruption of PIP2 prevents WASP recruitment ..................................................... 122  vii  LIST OF ABBREVIATIONS APC ADAP APC Arp BSA CD2AP CFDA-SE CRIB CrkL CTL DAG DAP10 DAP12 DMEM DMSO DNAM-1 EB EBV EDTA EGTA ERK FACS FAK FasL FCS FERM FRET GEF Grb2 GTP HBSS HS1 IBS2 ICAM-1 IL IP3 IS ITAM ITIM  antigen presenting cell adhesion and degranulation promoting adapter protein antigen presenting cell actin related protein bovine serum albumin CD2 associated protein carboxyfluorescein diacetate, succinimidyl ester Cdc42/Rac interactive binding Crk like cytotoxic T lymphocyte diacylglycerol DNAX-activating protein of 10 kDa DNAX-activating protein of 12 kDa Dulbecco's modified eagle's medium dimethyl sulfoxide DNAX accessory molecule-1 embryoid body Epstein Barr virus ethylenediamine tetraacetic acid ethylene glycol tetraacetic acid extracellular signal-related kinase fluorescence activated cell sorting focal adhesion kinase Fas ligand fetal calf serum 4.1 ezrin radixin moesin fluorescence resonance energy transfer guanine nucleotide exchange factor growth factor receptor-bound protein 2 guanosine 5' trisphosphate Hank's balanced salt solution hematopoeitic lineage cell specific protein 1 integrin binding site 2 intercellular adhesion molecule-1 interleukin inositol trisphosphate immunological synapse immunoreceptor tyrosine-based activation motif immunoreceptor tyrosine-based inhibitory motif viii  JNK KD KIR KO LAT LFA-1 mAb MEK MHC MTG MULT-1 Nck N-WASP NK NPF PBS PBS-T PH PI PI3K PIP2 PIP3 PIPK PLCγ PLL PMA poly I:C PSTPIP1 PTEN RAE-1 RPMI RT-PCR SAP SDS-PAGE SH3 SHP shRNA sIC-1 SLAM TCR TIRF  Jun N-terminal kinase knockdown killer immunoglobulin-like receptors knockout linker of activated T cells leukocyte function associated antigen-1 monoclonal antibody MAP kinase kinase major histocompatibility complex monothioglycerol mouse ULBP like transcript-1 non-catalytic region of tyrosine kinase adaptor protein 1 neuronal WASP natural killer nucleation promoting factor phosphate buffered saline phosphate buffered saline-tween 20 pleckstrin homology propidium iodide phosphoinositide 3-kinase phosphatidylinositol (4,5) bisphosphate phosphatidylinositol (3,4,5) trisphosphate phosphatidylinositol phosphate kinase phospholipase C γ poly L lysine phorbol 12-myristate 13-acetate polyinosinic-polycytidylic acid proline-serine-threonine phosphatase-interacting protein 1 phosphatase and tensin homologue retinoic acid early inducible-1 Roswell Park Memorial Institute reverse transcriptase polymerase chain reaction slam-associated protein sodium dodecyl sulfate polyacrylamide gel electrophoresis Src homology 3 Src homology 2-containing phosphatase short hairpin ribonucleic acid soluble ICAM-1 signaling lymphocyte activation molecule T cell receptor total internal reflection flourescence ix  TNF TRAIL ULBP1 VCA WASP WAVE WH1 WT ZAP-70  tumour necrosis factor tumour necrosis factor apoptosis inducing ligand UL-16 binding protein-1 verprolin, cofilin, acidic Wiskott-Aldrich Syndrome protein WASP family verprolin homologous protein WASP homology domain 1 wild-type ζ-associated protein of 70-kDa  x  ACKNOWLEDGEMENTS First and foremost, I would like to thank my supervisor, Fumio Takei. I have learned so much from you, about science and also about patience and perseverance. Thank you for your mentorship and encouragement and your unflagging interest in “how it all works”. I am privileged to have worked in your lab. I would like to thank my committee members, Drs. Dixie Mager, Cal Roskelley, and Michael Gold, who have always been supportive and helpful. I would also like to thank Hugh Brock for encouragement and advice on more than one occasion. I would like to thank all the Takei lab members, past and present. Former lab members include Lisa Dreolini, Matt MacLeod and Nooshin Tabatabaei, who helped me with learning techniques, as well as Linnea Veinotte, Motoi Maeda, Valeria Alcón, Erica Wilson, and Eva Backström. Present lab members who still make the lab a great place to work every day include Valeria Rytova, Claudia Luther, Tim Halim and Laura Guillon. I would like to especially thank Evette Haddad for friendship and support. We have literally laughed and cried together and I appreciate all of it. Your energy and determination has inspired me as we have gone through so much together. I thank John Fee, who helped me with the confocal microscope when I was literally in the dark. I would also like to thank Drs. Susan Monkley and David Critchley, who provided us with the talin-KO ES cells. I must extend a big thank you to Dr. Kathy Siminovitch and her whole lab, especially Pak Kwong, who welcomed me into their lab at Mt. Sinai in Toronto to do experiments with WASP-KO mice. They made a very challenging situation much easier. A big thank you goes to the FACS staff here in the TFL, who cheerfully sorted my cells every week for so long. I would also like to acknowledge Christine Kelly for all the administrative support she provides. I am lucky to have good friends and family and would like to thank them. Thanks to LJ and Natasha for the adventures we have been on and the many happy evenings we have spent together, and to Lorna for being the best friend a sister could ask for. My parents both instilled in me a love of science and nature, and were patient while I was still trying to find my way in the world, which I truly appreciate. I am also thankful that my grandfather saw me complete my degree. He never hesitated to express his pride in all of us grandkids and I strive to honour his memory always. I would like to especially thank my Auntie Maureen, who I am lucky to count as a friend as well as an auntie, who supported me in every possible way. Finally, I must thank Carmella for love, support and patience, particularly during the writing of this thesis.  xi  CO-AUTHORSHIP STATEMENT Chapter 2 is presented as published: Mace EM, Macleod MA, Marwali MR, Dreolini L, Takei F. LFA-1 Binding to Ligand Induces Talin-Mediated Reorganization of the Actin Cytoskeleton in Cytotoxic T Cells. The Open Immunology Journal. Nov 2008; Vol 1. pp.51-61 E.M.M. generated data for figure 3.2, analyzed data for figures 3.1, 3.2, 3.3 and 3.4, did statistical analysis on figure 3.5 and wrote the manuscript. Data for figures 3.1 and 3.5 was generated by M.R.M. Figure 3.5 was from M.R.M. Data for figure 3.3 was generated by L.D. Data for figure 3.4 was generated by M.A.M. F.T. designed experiments and wrote the manuscript. Chapter 3 is presented as published: Mace EM, Monkley SJ, Critchley DR, Takei F. A dual role for talin in NK cell cytotoxicity: activation of LFA-1-mediated cell adhesion and polarization of NK cells. Journal of Immunology 2009 Jan 15; 182(2):948-56. E.M.M performed experiments, analyzed data and wrote the manuscript. S.J.M and D.R.M provided necessary reagents. F.T designed experiments and wrote the manuscript. Chapter 4 is presented as a submitted manuscript: Mace EM, Zhang J, Siminovitch KA and Takei, F. Elucidation of the LFA-1 mediated signaling pathway leading to actin polarization in NK cells. E.M.M designed experiments, performed experiments, analyzed data and wrote the manuscript. J.Z. and K.A.S. provided necessary reagents. F.T. designed experiments and wrote the manuscript.  xii  CHAPTER 1  INTRODUCTION  1  1.1 Introduction to cell-mediated cytotoxicity Activated CD8+ cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells are members of, respectively, the adaptive and innate branches of the immune system, yet both recognize and kill virally infected and tumourigenic cells. CD8+ T cells develop into naïve lymphocytes in the thymus then circulate between the lymph and peripheral blood. Upon recognition of their cognate antigen in the draining lymph nodes, they become activated and proliferate, then exit the lymph node and function as effectors in control of infection. NK cells develop in the bone marrow and then circulate in peripheral blood. Unlike T cells, which express antigen specific receptors, NK cells express germline encoded receptors and can mediate cytotoxicity with no further stimulation1. Apoptosis of the target cell following recognition by a CTL or NK cell can be induced by two pathways, the granule exocytosis pathway and the death receptor pathway, which includes the Fas, tumour necrosis factor (TNF) and TNFR-related apoptosis inducing ligand (TRAIL) pathways2,3.  The most common pathway utilized by both CTLs and NK cells is granule exocytosis3. The apoptosis-inducing granules are specialized secretory lysosomes containing both cellular lysosomal proteins and proteolytic enzymes such as perforin, granzymes and granulysin4,5. The primary difference between the granule exocytosis pathway in NK cells and T cells is thought to be that NK cells contain pre-formed granules, whereas T cell lytic granules are formed following activation6. However, this analysis was performed with human NK cells, which seem to have a certain level of basal activation, whereas naïve murine NK cells may not contain preformed granules until activated or challenged. Upon degranulation, perforin forms cylindrical pores in the target membrane. Presumably these pores allow granzymes and granulysin to diffuse and  2  ionic exchange could occur, resulting in osmotic imbalance and subsequent lysis. However, there is dispute as to whether perforin is required for granzyme entry into cells and by some reports perforin is not required for apoptosis2. A recent paper by Thiery et al. shows that perforin induces clathrin-dependent endocytosis of granzymes by the target cell, resulting in preservation of membrane integrity and apoptosis, rather than necrosis7. The most common granzymes are granzymes A and B. Granzyme A causes slower, caspase-independent apoptosis, whereas Granzyme B causes rapid, caspase-dependent cell death2. Similarly, the Fas pathway induces caspase-mediated cell death. Fas is a member of the TNF family and both NK cells and CTLs express Fas ligand (FasL). Following ligation of the Fas receptor on a target cell by FasL, trimerization of Fas-associated death domain (FADD) molecules occurs and apoptosis follows. TRAIL is also a member of the FasL family and engagement of TRAIL with one of its two receptors, TRAIL-R1 or TRAIL-R2, results in FADD-dependent, caspase-mediated apoptosis2.  CTLs and NK cells utilize both granule exocytosis and receptor-mediated cytotoxicity, however this study is focused on the steps leading to granule exocytosis, a process that is outlined in more detail in section 1.1.4. While this is a common pathway of target cell lysis, CTLs and NK cells use highly specialized and unique mechanisms of initializing the activating signals leading to cytotoxicity (discussed further below).  1.1.2 Steps leading to CTL-mediated cytotoxicity Engagement of an activated CD8+ cytotoxic T cell with a target cell expressing its cognate antigen bound to an MHC class I molecule leads to a well-defined signaling cascade (Figure 1.1). This cascade is initiated by phosphorylation of immunoreceptor tyrosine-based activation  3  motifs (ITAMs) in the cytoplasmic tails of the CD3 accessory molecules associated with the TCR. This is carried out by the Src family kinases Fyn and Lck. Phosphorylated ITAMs allow docking of the SH2 domain containing kinase - associated protein of 70 kDa (ZAP-70), which is phosphorylated and activated by Lck. ZAP-70 activation leads to phosphorylation of the signal  TCR/CD3 ITAM phosphorylation (Lck, Fyn); ZAP-70 binding to ITAMs ZAP-70 activation; LAT & SLP-76 phosphorylation by ZAP-70 PLC and GEF activation by SLP-76 PLCPIP2  IP3 + DAG Ca++ flux  GEFs Ras ERK  Vav RacCdc42actin  CTL-mediated cytotoxicity Figure 1.1 Steps leading to CTL cytotoxicity. The TCR complex and the CD8 co-receptor are brought together by binding of MHC I with peptide. This activates Lck and Fyn which in turn phosphorylate ITAM motifs, allowing ZAP-70 to bind. ZAP-70 activates three important pathways. First, it phosphorylates SLP-76, which activates PLC to produce IP3 and DAG from PIP2, leading to intracellular calcium flux. Second, also via SLP-76, it activates Vav, leading to actin cytoskeletal rearrangement via the Rac pathway. Third, via activation of guanine nucleotide exchange factors (GEFs), it activates the ERK cascade.  4  adaptor proteins linker of activated T cells (LAT) and SLP-76. These adaptors propagate signals that activate multiple signaling pathways. One pathway is activation of phospholipase C (PLC), which cleaves phosphatidylinositol 4,5 bisphosphate (PIP2) into the second messengers inositol trisphosphate (IP3) and diacylglycerol (DAG). IP3 increases intracellular calcium levels, a step that is required for cytotoxic function. DAG activates the Ras/ extracellular related kinase (ERK) pathway. A second pathway is the activation the Rac GTPase by Vav, which is recruited following SLP-76 activation. Vav and activated Rac lead to actin cytoskeletal polarization that is also critical for cytotoxicity. Finally, a third pathway is activation of protein kinase C, also by DAG. Notably, TCR signaling also rapidly activates integrins to increase cellular adhesiveness1.  1.1.3 Steps leading to NK cell-mediated cytotoxicity NK cells require no further stimulation or activation for cytotoxicity upon encountering a susceptible target. Therefore, they are poised for target cell lysis and respond quickly to activating signals. To prevent autoreactivity, inhibitory signaling must also tightly control NK cells. Upon encountering a target, an NK cell will quickly form either an activating or inhibitory immune synapse depending upon the target’s susceptibility to killing. NK cells can simultaneously form both activating and inhibitory synapses with multiple targets, yet kill only sensitive targets8. This underlines the importance of localized, rather than global, signaling for NK cell function. NK cell-mediated killing of target cells is regulated by a balance between signals generated by stimulatory and inhibitory receptors on NK cells. Inhibitory receptors for MHC class I molecules include the killer immunoglobulin-like receptors (KIR) in humans, the lectin-like Ly49 family of receptors in rodents and the CD94/NKG2A heterodimer. While murine Ly49s and human KIRs are dissimilar in structure, they are similar in function9 and share 5  a common mechanism of inhibition. Following ligation of inhibitory receptors, phosphorylation of cytoplasmic immunoreceptor tyrosine-based inhibitory (ITIM) motifs recruits Src homology 2 containing phosphatase-1 (SHP-1). Upon binding ITIMs, SHP-1 is released from autoinhibition, leading to dephosphorylation of tyrosine phosphorylated activation receptors as well as signaling components of the activation pathway. The functional outcome of inhibitory signaling has been well characterized. Ligation of inhibitory receptors on NK cells prevents the release of intracellular Ca++10 and blocks lipid raft polarization11-13. In addition, it results in termination of conjugate formation14and prevents actin cytoskeletal rearrangement15,16. Bryceson et al. showed that approximately 10% of resting human NK cells display the integrin leukocyte function associated antigen 1 (LFA-1) in an activated conformation as detected by conformation-specific monoclonal antibodies17. Engagement of activating receptors results in almost 90% of NK cells expressing active LFA-1. However, co-engagement of the inhibitory receptor CD94/NKG2A prevents this activation even when activating receptors are engaged on the same cell. Thus, control of conjugate formation and NK cell polarization is an important component of NK cell inhibitory receptor signaling.  In contrast to inhibitory receptors, NK cell activating receptors do not signal through a common pathway, and instead are diverse in form and signaling mechanisms. Moreover, pairs of coactivating receptors often mediate NK cytotoxicity such that ligation of a single activation receptor is insufficient for target cell lysis by resting NK cells18. Canonical NK cell activating receptors include the activating Ly49 receptors in mice and the CD94/NKG2C/E heterodimers. These receptors pair with immunoreceptor tyrosine-based activation motif (ITAM)-containing adaptor proteins such as DNAX-activating protein of 12 kDa (DAP12) to transduce strong, T cell  6  Activating receptor: Ly49, CD94/NKG2C/E, NKG2D (DAP12)  NKG2D (DAP10) Grb2-Vav-SLP-76 PLC DAG+IP3 Ca++  Syk, ZAP-70 PI3K PLC DAG+IP3 Ca++  Actin reorganization, degranulation  Akt  Vav-SLP-76-LAT-Grb2-Sos Ras-ERK NK-mediated cytotoxicity  Figure 1.2. Steps leading to NK cell cytotoxicity. Many activating receptors associate with the ITAM-containing DAP12 (right). NKG2D in mice can associate with DAP12 or the non-ITAMbearing DAP10. DAP12 mediated signals are propagated through Syk and ZAP-70, which activates signaling similar to that of TCR induced signals (Figure 1.1). DAP10 signaling activates both PI3K and a Grb2-Vav-SLP-76 signaling complex that leads to actin reorganization and degranulation. receptor (TCR)-like signals through the kinases Syk and ZAP-70 (Figure 1.2). These events lead to activation of a number of signaling proteins including phosphoinositide 3-kinase (PI3K), PLC, Vav1, Rho, Ras, and ERK as well as rises in intracellular free calcium levels. ITAMreceptor signaling also leads to cell polarization, degranulation and transcription of cytokine genes9.  NKG2D is an activating receptor on NK cells, and some CTLs, that pairs with the DNAXactivating protein of 10 kDa (DAP10) adaptor. NKG2D ligands are up-regulated on virally infected or transformed cells and include RAE-1 and H60 in mice19. In mice, NKG2D is found in a ‘long’ (NKG2D-L) isoform that associates exclusively with DAP10, and a ‘short’ (NKG2D-S) 7  isoform that is detected only after NK cell activation and associates with both DAP10 and DAP12. DAP10 contains overlapping binding sites for the p85 subunit of PI3K and the growth factor receptor bound protein 2 (Grb2) signaling adaptor. Intact binding sites for both proteins are required for cytotoxicity and calcium flux, however Grb2 recruitment results in phosphorylation of SLP-76, Vav1 and PLC whereas PI3K recruitment following p85 binding results in localized PIP3 production. While DAP10 signaling, unlike DAP12 signaling, is not dependent on Syk and ZAP-70, the association of NKG2D-S in activated NK cells with both DAP10 and DAP12 results in a potent activation of NK cell cytotoxicity through multiple pathways9.  NK cells from mice deficient in both Syk and ZAP-70 are able to mediate cytotoxicity, illustrating the importance of other receptors in activation signaling20,21. Characterization of receptors such as CD2, the signaling lymphocyte activation molecule (SLAM)/SLAM-associated protein (SAP) family and DNAX accessory molecule 1 (DNAM-1) has illustrated the diversity of NK cell activating molecules. In addition, several adhesion receptors are now known to have co-activating functions in NK cytotoxicity that are independent of their role in adhesion, including the 1 and 2 integrins and CD4418. In resting human NK cells, many pairs of receptors can trigger NK cell cytotoxicity. Using insect cells expressing ligands for human NK cell activating receptors, Long et al. show that while engagement of the Fc receptor CD16 is sufficient to trigger degranulation of resting human NK cells without specific polarization, coengagement of CD16 and either LFA-1 or the activating receptor 2B4 results in target cell lysis via granule polarization and degranulation. Engagement of LFA-1 on resting NK cells is sufficient for granule polarization, although not degranulation, suggesting that LFA-1 plays a  8  role in activating signaling as well as adhesion. The contributions of LFA-1 and CD16 are mutually exclusive, as LFA-1 signaling is not sufficient for degranulation, and CD16 ligation provides no enhancement of polarization. Thus it appears that in NK cells, cytotoxicity is controlled by step-wise activation of polarization and degranulation. LFA-1 and CD16 are not the only receptors that synergize, and with the exception of CD16, which mediates the elimination of antibody-coated cells, all NK cell activating receptors act in concert to induce cytotoxicity or cytokine secretion by resting NK cells. This likely reflects the importance of stepwise regulation as a system of checks and balances to control NK cells’ inherent cytotoxicity18.  1.1.4 Formation of the immunological synapse and granule exocytosis in NK cells and CTLs The steps leading to cytotoxicity are sequential and discrete (Figure 1.3). Firm adhesion required for cytotoxicity is primarily mediated by the 2 integrin, LFA-1 (CD11a/CD18)5,22. NK cells or CTL treated with LFA-1 blocking antibody show impaired cytotoxic function due to defective adhesion, as do NK cells from LFA-1-/- mice23-26. CTLs mediate cytotoxicity following TCR stimulation by non-self peptides27. While NK activating receptors and the TCR both associate with molecules containing ITAM motifs, a single TCR can associate with as many as six CD3 molecules containing ITAMs, whereas NK cell activating receptors couple with fewer ITAMcontaining adaptors. Thus, the activation of a CTL by the ligation of even a small number of TCR molecules likely results in a more rapid, robust activation than that seen in NK cells5. This may account for the observation that NK cells require more “checkpoints” in the cytotoxicity process than CTL, an observation that can also be accounted for by the ability of NK cell  9  inhibitory receptor signaling to terminate the lytic synapse early in its formation5,28. Following the commitment to cytotoxicity, the effector cell polarizes towards its target. This polarization occurs in discrete steps, each of which is required for cytotoxicity, and also involves the formation of the immunological synapse, which is defined as the orderly arrangement of molecules on an immune cell at the interface with another cell5. Polarization includes the accumulation of F-actin at the contact site, the clustering of receptors and lipid rafts, sustained signaling by activating receptors, and movement of the microtubule organizing centre (MTOC) and lytic granules towards the target (discussed further in 1.1.5). This is followed by clearance of actin at the contact site to allow for the passage of lytic granules to the membrane prior to secretion. In the final steps of cytotoxicity, lytic granules fuse with the membrane and then are released into a synaptic cleft formed between the two cells and the target cell undergoes apoptosis. At the termination of cytotoxicity, the effector cell detaches and its ability to mediate killing is rapidly restored. Both NK cells and CTL appear to function as “serial killers”, and can rapidly generate new cytotoxic granules and re-express activating receptors, which allows them to kill multiple targets sequentially29, 30.  1.1.5 Polarization of the cytoskeleton in cytotoxicity Reorganization of the actin cytoskeleton is a critical step in cytotoxicity. In NK cells, WiskottAldrich syndrome protein (WASP) acts as an activator of the actin nucleating actin related protein 2/3 (Arp2/3) complex. NK cells from WAS patients are unable polarize actin towards their targets and show defects in cytotoxicity similar to those seen following treatment of NK cells by actin inhibitors31-33. Treatment of T cells with actin inhibitors prevents conjugate formation, cytotoxicity and T cell activation34. In addition, many proteins associated with actin  10  polymerization are found at the immunological synapse in both T and NK cells, underlying the importance of actin in cytotoxicity. These include Arp2/3, WASP, and the actin cross-linking protein talin. The signaling leading to actin enrichment during cytotoxicity is still unclear. In T cells, engagement of LFA-1 in the absence of TCR signaling leads to the formation of an “actin cloud” that mirrors the ring of LFA-1 found between a T cell and an antigen presenting cell  Target  Target  E  E  E  E  Target  Figure 1.3. Four broad steps leading to granule exocytosis in lymphocyte-mediated cytotoxicity. In the first step (top left), a conjugate is formed between an effector cell (E) and its target. This is mediated primarily by integrins. In the second step (top right), activating signals are propagated across the T cell receptor and co-stimulatory molecules in CTLs, or NK cell activating receptors. In the third step (bottom right), the effector cell polarizes towards its effector with an accumulation of cortical F-actin at the contact site between the two cells. This is followed by movement of the microtubule organizing centre (MTOC) towards the target and translocation of cytotoxic granules to the site of secretion. In the final step (bottom left), actin is cleared from the site of secretion and granules fuse with the plasma membrane then are subsequently exocytosed in to the cleft between the two cells. This is followed by apoptosis of the target cell.  11  (APC), which contains actin and tyrosine phosphorylated proteins35. These results suggest that signaling from integrins is sufficient for at least initial actin accumulation at the point of contact between an immune cell and its target.  Also critical for cytotoxicity is the polarization of the MTOC and cytotoxic granules towards the target cell. This is thought to begin with the movement of granules along microtubules towards the MTOC, where they cluster. This process is dependent on a motor protein, likely dynein, although the exact protein has not been defined5. The MTOC moves towards the immune synapse following granule clustering. This movement is dependent on ERK, Vav1 and Pyk2 activity in NK cells36-38. In T cells, MTOC polarization also requires Cdc42 activity and a complex of ZAP-70, SLP-76 and LAT39,40. This LAT-SLP-76-ZAP-70 complex recruits many enzymes to the immune synapse, including PLC, which produces DAG. DAG is both necessary and sufficient for MTOC polarization41. The source of the force required to translocate the MTOC is unknown. It most likely depends on the insertion of microtubules into the accumulated actin at the synapse, and in T cells this is dependent on the adhesion and degranulation promoting adaptor protein (ADAP)42. An intact and polarized actin cytoskeleton is required for MTOC and granule polarization5, which may reflect a requirement for anchoring of the microtubules to promote MTOC movement. In a more general sense, actin cytoskeletal polarization may be required for the cue as to the direction that the MTOC and granules should be oriented. Following MTOC and granule polarization, cytotoxic granules must somehow be directed to the plasma membrane for subsequent fusion and exocytosis. This is not a passive event, particularly as granules must somehow traverse the actin cytoskeleton, although there is some clearance of F-actin at the point of secretion. It is likely that motor proteins are involved in  12  this granule movement, and NK cells in which myosin II function is impaired show normal granule and MTOC polarization but no degranulation43.  1.2 Integrins and talin 1.2.1 Integrins Integrins are non-covalently linked heterodimeric type I glycoproteins that act as bidirectional signaling molecules across the plasma membrane by binding both extracellular and intracellular ligands. Cytoplasmic signaling controls binding to extracellular ligands (“inside-out signaling”) for integrin-mediated adhesion. The converse is true of “outside-in signaling”, which results in signaling to the cytoplasm and actin cytoskeleton that affects cell migration, morphology, cell cycling and activation44,45. Integrins are structurally diverse, and the pairing of multiple  subunits with a common  subunit enhances this diversity. In vertebrates, 19  subunits pair with 8 different  subunits, resulting in at least 25 heterodimers45,46,123.  Integrins maintain integrity between the cell and its environment (hence their name) and their ligands include components of the extracellular matrix such as collagens, laminins and fibronectin. Every nucleated cell within the body contains a specific integrin signature, reflecting their importance for a number of cell processes. Most cells express the β1 integrin and it can pair with 10  subunits to confer specificity for ligand. The prototypical RGD motif in fibronectin and fibrinogen is recognized by the 3, 5, 6 and 8 subunits. The 2 subunit is unique in that it mediates cell-cell interactions and is expressed exclusively on leukocytes. The 2 subunit can pair with 4 subunits to make 4 unique integrins. These include the L2 integrin (LFA-1), the M2 integrin (Mac-1), and the X2 and D2 integrins. While LFA-1 is expressed on all 13  leukocytes, including T cells, the others are primarily expressed on cells of the myeloid lineage123.  LFA-1 is the major integrin expressed on NK cells and plays a critical role in the migration of T and NK cells as they are recruited to sites of inflammation. In addition, it is required for the interaction of T cells with antigen presenting cells APCs and the interaction between cytotoxic T lymphocytes or NK cells and their targets. The primary ligand of LFA-1 is intracellular adhesion molecule-1 (ICAM-1) but it also binds ICAMs -2 and -3 and junction adhesion molecule-A (JAM-A). T cells from mice in which CD11a has been disrupted undergo normal thymic selection and maturation, but are defective in cytotoxicity and are unable to control metastatic melanoma tumours47. In humans, genetic mutation leading to the loss of 2 integrin expression causes leukocyte adhesion deficiency I (LAD-I) disorder. Patients with LAD-1 in which 2 expression is completely lacking often die in the first year, whereas patients with low integrin expression have a better prognosis. These patients suffer from recurrent bacterial and fungal infections and show poor wound healing48.  1.2.2 LFA-1 conformation and activation Like all integrins, LFA-1 is comprised of a globular extracellular head domain and two stalks (and  subunits) which connect to relatively short cytoplasmic domains. LFA-1’s function is regulated by its conformation. LFA-1 is held in an inactive conformation on resting lymphocytes to avoid inappropriate binding to ligand. Following activation, LFA-1 undergoes rapid conformational change from an inactive state, in which the integrin is bent, with the ligand binding site (I domain) close to the membrane (<5 nm), to an active conformation with the ligand binding site exposed and the integrin extended 20-25 nm away from the membrane to facilitate 14  adhesion49. Signaling that rapidly controls activation via LFA-1’s cytoplasmic domains regulates conformational change. Following signaling through chemokine receptors or the TCR, signals are generated that are thought to result in the separation of the cytoplasmic tails of the  and  subunits of LFA-1. This signaling is transmitted to the ectodomain of the integrin and results in the transition of the integrin from a low affinity to a higher affinity state (Figure 1.4). LFA-1 likely has at least three distinct conformational states with low, intermediate and high affinities. As described above, chemokine receptor or TCR signaling results in LFA-1 activation. However, it has been proposed that inside-out signaling produces intermediate conformation LFA-144 that can then be fully activated by ligand binding. Electron microscopy studies of the v3 integrin show three distinct conformations: low affinity or compact, extended with the cytoplasmic domains together and a closed ligand binding head, and extended with cytoplasmic domains separated and an exposed I domain which allows for highest ligand binding affinity49. This model is supported by recent studies illustrating the importance of mechanotransduction in integrin activation including the role of shear flow of blood in leukocyte arrest50,51. In particular, Shamri et al. showed that endothelium-bound, but not soluble, chemokines are required for full LFA-1 activation, and that binding to ICAM-1 was critical for firm adhesion of lymphocytes under shear flow52. These results suggest that bidirectional ligand occupancy is required for LFA-1 high affinity conformation.  15  Talin Adapted from Kim et al., Science 2003;301:1720-1725 Figure 1.4. LFA-1 conformational activation. LFA-1 is held in an inactive conformation on resting cells, with the ligand binding domain in close proximity to the cell membrane and the cytoplasmic domains associated (left). Following activation signals, the integrin extends away from the cell membrane and the ligand-binding site is exposed. This is accompanied by separation of the cytoplasmic tails that is thought to be caused by binding of proteins such as talin to the cytoplasmic domain (right).  Following binding to ICAM-1 the high affinity conformation of LFA-1 is likely stabilized by binding of proteins to its cytoplasmic domains, and forced separation of integrin subunits results in constitutively active integrins, whereas forced association prevents activation. One protein thought to be involved in LFA-1 activation is the cytoskeletal adaptor talin. Studies done using fluorescence resonance energy transfer (FRET) show that expression of talin head, or ICAM-1 binding the extracellular domain, in K562 cells expressing the L and 2 subunits of LFA-1 disrupts interactions between the integrin cytoplasmic domains, resulting in integrin activation53.  16  1.2.3 Talin Talin belongs to the band 4.1 ezrin radixin moesin (FERM) family of proteins that links the plasma membrane to the actin cytoskeleton. It is comprised of a 50 kDa N terminus head domain and a flexible 220 kDa C terminus rod domain. Talin’s structure illustrates its specialized function as a bridge between the plasma membrane and the actin cytoskeleton (Figure 1.5). Contained within residues 86-400 of the head domain is a region homologous to that found within the FERM superfamily of cytoskeletal adaptors. This FERM domain has been structurally and biochemically characterized and binds multiple ligands including integrin beta tails, actin, phosphatidylinositol phosphate kinase (PIPK), H-Ras, and layilin54. In addition it binds PIP2 and the talin head can insert into lipid bilayers. The talin head can be cleaved from the rod domain by intracellular proteases such as calpain. The talin rod contains a second, lower-affinity binding site for integrin beta tails (IBS2), and two additional actin binding domains, one of which is required for the localization of actin to focal adhesions55. It also contains multiple sites for the binding of vinculin, which itself binds actin and other actin cross-linking proteins such as actinin. In addition, a binding site for -synemin, an intermediate filament protein, has been identified in talin rod, suggesting a link between talin, the actin cytoskeleton, and the intermediate filament network56. Proteomic studies have also identified activated H-Ras as a binding partner of talin57.  17  Vinculin N  FAK  FERM  Actin  *  PIPKI  Actin  IBS2  Actin  C  Integrin  Figure 1.5 Domain structure of talin. Talin head domain contains a FERM domain including binding sites for FAK, actin, PIPKI and integrin  tails. The head can be cleaved from the rod by intracellular proteases (*). Talin rod has multiple binding sites for vinculin, two actin binding sites and a second integrin binding site (IBS2). Interactions between FERM domain and the talin rod promote the adoption of an autoinhibited conformation in which the integrin binding site in the FERM domain is masked and talin has lower binding affinity for integrin beta tails but can still bind PIPKI. This autoinhibition was shown to regulate talin activity, as mutation of the FERM domain to prevent interactions with the talin rod results in significantly increased integrin activation. The physiological mechanism of talin activation is still unclear. The binding of PIP2 results in integrin activation and PIP2 interacts with talin in activated, but not resting, fibroblasts59,60. In addition, talin in its autoinhibited form binds PIPKI and targets it to the membrane where it produces PIP2, which may function to recruit and activate additional talin. Calpain cleavage results in exposure of integrin binding sites and increased binding to integrins. However, Franco et al. showed that calpain was required for focal adhesion disassembly and turnover as opposed to integrin activation61. Talin also contains several protein kinase C (PKC) and Src phosphorylation sites that have been proposed to function in the regulation of its activity62.  18  Disruption of the talin gene in undifferentiated murine embryonic stem (ES) cells abrogates the ability of these cells to spread on extracellular matrix substrates or form focal adhesions on fibronectin, presumably due to defective linkages between integrins and the actin cytoskeleton63. Mice generated from these ES cells are not viable and embryogenesis does not proceed past day 8.5 due to a defect in gastrulation64. Selective disruption of talin in platelets in mice results in an inability of platelets to activate 1 and 3 integrins. These mice have severe hemostatic defects including prolonged bleeding following injury and spontaneous bleeding, as well as reduced thrombus formation65. To date, conditional mutations of talin have not been expressed in any other cell types.  1.2.4 The role of integrins as activating receptors in NK cell cytotoxicity Studies on the role of LFA-1 as a co-activating receptor revealed several roles for LFA-1 in signaling. Riteau et al. show that ligand binding of LFA-1 on resting human NK cells results in rapid phosphorylation of the guanine nucleotide exchange factor Vav1 in an actin-independent, Src family kinase-dependent manner66. A second activating signal through the activating receptor 2B4 results in further Vav1 phosphorylation that is sensitive to inhibition of actin polymerization, and recruitment of Vav1 to the detergent resistant membrane fraction. Thus LFA-1 seems to initiate early signaling that can be further amplified by subsequent activating signals. Similarly, binding of human NK cells to sensitive target cells results in rapid tyrosine phosphorylation of proline rich tyrosine kinase (Pyk2), which can be reproduced by antibody cross-linking of the 1 or  integrin. This phosphorylation of Pyk2 is accompanied by tyrosine kinase activity that contributes to ERK activity and cytotoxicity33.  19  1.3 Proteins involved in signals leading to actin polymerization The link between LFA-1, talin and actin is unclear and has been poorly studied in hematopoietic cells. However, more extensive studies in adherent cells have highlighted some of the players in actin polymerization that likely play a role in integrin signaling. These are outlined below.  1.3.1 Arp2/3 The Arp2/3 complex consists of 7 highly conserved polypeptides: the actin related proteins Arp2 and 3, and ARPC1-5. When activated, Arp2/3 initiates the formation of branched actin filaments, with a daughter filament emerging from a mother filament at a 70 angle67. The Arp2/3 complex has little intrinsic actin nucleation activity, allowing it to be tightly regulated by the cell via nucleation promotion factors such as WASP and WAVE. There are multiple nucleation promotion factors (NPFs). These can be broken down to two classes: class I NPFs, which all possess a common verprolin, cofilin, acidic (VCA) domain and primarily constitute the WASP/WAVE/Scar family of proteins, and class II NPFs, which in mammals is limited to cortactin. The VCA domain, which is sufficient for the polymerization of actin in vitro, delivers a G-actin monomer to the Arp complex, resulting in the formation of an Arp2, -3 –actin trimer67. After the formation of the daughter filament, class I NPFs dissociate from the Arp2/3 complex68. Arp2/3 is a critical part of the T cell actin machinery for both migration and interactions with target cells. It is found at the immune synapse, where it is activated downstream of TCR signaling via Cdc42 and Rac1, which activate WASP and WAVE2 respectively69.  A recent study by Butler et al. has thoroughly examined the role of Arp2/3 in NK cell cytotoxicity70. Using primary human NK cells and the NKL cell line, they showed that Arp2/3 20  localizes to the immune synapse and forms a ring in the periphery that highly colocalizes with actin and LFA-1. Disruption of Arp2/3 by shRNA results in a 40% decrease in cytotoxicity, although the authors posit that the incomplete knockdown of Arp2/3 may result in a less severe phenotype than would be seen in the complete absence of Arp2/3. Examination of the Arp2/3 knockdown cells showed that LFA-1 and NKG2D still localize to the immune synapse, although the surface area of the interface between NK and target cells is significantly decreased. Total internal reflective fluorescence (TIRF) microscopy of cells bound to ICAM-1 and the NKG2D ligand UL16 binding protein 1 (ULBP1) showed that loss of Arp2/3 severely disrupts the organization of LFA-1 and NKG2D, which in control cells form a bullseye pattern with NKG2D staining localized at the center of a ring of LFA-1. While LFA-1 conformational activation is unaffected by a loss of Arp2/3 and LFA-1-talin interactions remain intact, binding of cells to ICAM-1 is decreased by 50%, suggesting that Arp2/3-mediated actin polymerization is required for cell spreading and adhesion. Interestingly, signaling molecules thought to be “upstream” of Arp2/3 in actin signaling pathways, including Vav1, Rac1 and Cdc42 (but not Pyk2), have decreased activity following the loss of Arp2/3. This suggests that these signaling cascades are not a one-way street, but act as dynamic feedback loops.  1.3.2 WASP/WAVE and WIP The central role of WASP family proteins in the control of actin nucleation via Arp2/3 complex has been extensively shown by genetic, biochemical and loss-of-function studies. WASP, which is expressed exclusively in hematopoeitic cells, is the protein product of the gene mutated in Wiskott-Aldrich syndrome, a rare X-chromosome linked disorder. The neuronal (N) WASP isoform was originally isolated from brain but is now known to be expressed in a variety of  21  tissues71. Mammalian cells also express three isoforms of the Scar/WAVE protein, Scar/WAVE1, -2, and -3, which are closely related to WASP proteins and are homologues of the Scar family of proteins in Dictyoselium72,73. WASP activates Arp2/3 via a C terminus VCA region that binds both actin and the Arp2/3 complex74. The N terminus of WASP and N-WASP contain a prolinerich region that binds various SH3 domain-containing proteins. WASP and N-WASP, but not WAVE, also have a WH1 domain that binds WASP interacting protein (WIP), a Cdc42/Rac interacting (CRIB) domain that binds Cdc42, and a basic region that binds PIP274. As a regulator of Arp2/3 mediated actin nucleation, it is not surprising that WASP plays an important role in NK cell cytotoxicity. NK cells from WAS patients show severe deficiencies in cytotoxicity and, in contrast to NK cells from control donors, do not accumulate actin and WASP at the site of contact with sensitive K562 target cells31. In the NK-like YTS cell line WASP and WIP form a complex with actin that is recruited to the plasma membrane following binding of YTS to sensitive targets, but is not present following inhibitory signaling75. WASP and WIP, but not actin, constitutively associate in YTS cells. This suggests that WIP in NK cells acts to stabilize WASP, as it has been shown to do in other cell types. Interestingly, the defects in conjugate formation, actin accumulation and cytotoxicity in NK cells from WAS patients can be overcome by treatment with IL-2 for as little as three hours, suggesting that there are alternative pathways for stimulating actin polymerization in NK cells76,77.  WASP must be activated in order to bind to Arp2/3 and initiate actin polymerization. Inactive WASP is held in an autoinhibited conformation by interactions between the VCA and CRIB domains. The binding of Cdc42-GTP to the CRIB domain, and PIP2 to the adjacent basic region, relieves this autoinhibition78-82. Conformational inactivation of N-WASP can also be released by  22  binding of SH3 domain containing proteins such as CrkL, Nck and Grb283-85. Cross-linking 2 integrins on NK cells results in WASP phosphorylation, suggesting that there is a link between LFA-1 ligation and WASP dynamics76. Phosphorylation of WASP by Abl, Btk and Src family kinases increases its binding affinity for Arp2/3, although the functional significance of this phosphorylation is unclear86-88.  How is WASP activated and recruited in NK cells? T cells from WAS-/- mice show profound defects in actin polymerization, proliferation and IL-2 secretion77,89. Interestingly, in some systems T cells from WAS-/- mice show little defect in actin architecture, which may be due to compensation by the low levels of N-WASP expressed by T cells91. WASP is recruited to the immunological synapse85,90. The recruitment of WASP to the immune synapse in Jurkat T cells is antigen-dependent but does not require interaction with activated Cdc42. Instead, it appears that recruitment of WASP to the T cell immune synapse is dependent on adaptor proteins and has been ascribed to the adaptor CrkL in complex with WIP85, the adaptor LAT in complex with SLP-7692, and the adaptors PSTPIP1 and CD2AP93. In summary, it seems that WASP recruitment in T cells is dependent upon SH3 domain containing proteins although there is some contradiction within the literature about minimal requirements for localization. Another potential mechanism is that WIP is required for localization of WASP to the immune synapse, although WASP and WIP associate constitutively in NK cells75.  Studies in which WASP is disrupted in NK cells are limited to those using NK cells from human patients with WAS. However, WASP knockout (KO) mice have been generated and the effect of  23  WASP deletion on T cells has been studied. WASP deletion severely affects T cell maturation and actin polymerization responses77.  1.3.3 Pyk2/FAK Pyk2 is a member of the focal adhesion kinase (FAK) non-receptor tyrosine kinase family. FAK and Pyk2 are approximately 65% identical. They differ in their N terminus but both contain a common protein tyrosine kinase domain and two proline-rich regions at the C terminus94. Focal adhesion kinase, as the name implies, localizes to focal adhesions in adherent cells where it is tyrosine phosphorylated following integrin ligation and promotes cell migration through disassembly of focal adhesion complexes and regulation of Rho GTPases95. While Pyk2 is considered the hematopoeitic-specific FAK family member, both T and B cells are reported to up-regulate FAK upon stimulation, although expression of FAK in NK cells hasn’t been reported. Pyk2- deficient mice, while exhibiting defects in B cell and macrophage motility, show no defects in T cell development, suggesting that FAK may be compensating for a loss of Pyk296. In T cells, Pyk2 is tyrosine phosphorylated and activated after TCR engagement and translocates to the immune synapse97-100. The binding of LFA-1 on NK cells to ICAM-1 induces rapid Pyk2 phosphorylation and subsequent tyrosine kinase activity leading to ERK activation. Expression of a catalytically inactive Pyk2 mutant in NK cells leads to impaired natural cytotoxicity, suggesting that Pyk2 is required for this process33.  1.3.4 Vinculin Vinculin is found in focal adhesions, where it binds numerous cytoskeletal proteins, including actin, -actinin, talin, Arp2/3, and paxillin101. Like talin, ligand-binding sites in vinculin are 24  masked by an intramolecular interaction between its head and tail domain, and the binding of PIP2 relieves this interaction102-104. In nascent focal adhesions, vinculin directly binds to, and is required for, the recruitment of Arp2/3. This interaction is dependent upon PIP2 and Rac1, likely for activation of vinculin and Arp2/3 respectively105,106. In addition to its role in focal adhesion formation, vinculin likely plays an important role in stabilizing focal adhesions by cross-linking talin and actin, and thus reinforcing the link between integrins and the actin cytoskeleton107. Embryonic stem cells in which the gene encoding vinculin is disrupted have some defects in actin architecture when compared to wild type (WT) cells, but still formed talin-containing focal adhesions63. Vinculin-KO mice are not viable, however, and do not develop past day 10 of embryogenesis due to apparent defects in cell migration and locomotion108. In T cells, vinculin localizes to the immune synapse formed between a CD4+ T cell and an APC in an antigenspecific manner and TCR receptor ligation results in the formation of a WASP-Arp2/3-WAVE2vinculin complex109. Down regulation of vinculin by shRNA in Jurkat T cells results in decreased conjugate formation109. However, localization of talin, but not actin, to the immune synapse accumulation is unaffected by this loss of vinculin. Interestingly, this is the only extensive study of the role of vinculin in immunological synapse formation, and the role of vinculin in lymphocyte function is largely unexplored.  1.3.5 CD44 CD44 is an adhesion molecule that links the plasma membrane to the actin cytoskeleton through cytoplasmic interactions with the ezrin, radixin, moesin (ERM) family of proteins. CD44 binds a number of extracellular matrix ligands including hyaluronic acid, collagen, laminin, fibrinogen, chondroitin sulfate and fibronectin110. Phosphorylation of serine 291 by protein kinase C  25  increases binding of ERM proteins to CD44111. In turn, tyrosine phosphorylation of ERM proteins by receptor tyrosine kinases increases their association with CD44 and promotes their actin cross-linking function110. Unlike integrins, surface expression of CD44 increases upon NK cell activation by cytokines such as IL-2 and IL-15112. Studies done using CD44-/- LFA-1-/- mice show the importance of CD44 in cytotoxicity, as IL-2-activated NK cells from these mice show a near complete deficiency in cytotoxicity, particularly against EL4 and RMA-S targets, due to decreased conjugate formation with target cells23. NK cells from these mutant mice express normal levels of perforin, FasL and TNF-, suggesting they do not have intrinsic defects in their cytotoxic machinery. Expression of either CD44 or LFA-1 singly resulted in an intermediate level of target cell lysis that did not fully compensate for the loss of both proteins, although NK cells from LFA-1+/+CD44-/- mice were consistently more cytotoxic than those from LFA-1-/CD44+/+ mice. Early studies showed that cross linking CD44 on human NK cells results in increased cytotoxicity and accompanying intracellular Ca++ flux against when presented with K562 cells or antibody-coated P815 target cells, suggesting that CD44 plays a role in both natural and antibody-mediated cytotoxicity113. In addition to its role in conjugate formation, ligation of CD44 on the BW5147 T cell line results in downstream signaling including Pyk2 phosphorylation114.  1.3.6 Phosphatidylinositol phosphate kinase type I  (PIPKI) It is becoming increasingly clear that spatially, and temporally, localized pools of PIP2 are critical for the regulation of many cellular processes, including both cytoskeletal dynamics and NK cell cytotoxicity. Localization and production of these pools of PIP2 is under tight control of the enzymes that produce it, specifically the type I and type II phosphatidyinositol kinases 26  (PIPKs). Phosphatidylinositol 5-phosphate 4-kinase, or PIPK type II, phosphorylates the D4 position of PI-5P to produce PIP2. However, the main source of PIP2 production is from PIPK type I, which phosphorylates PI-4P on the D5 position of the inositol ring to produce PIP2115. The PIPK type I subfamily has three isoforms, ,  and , each of which, in turn, has alternate splice variants116. Of these, the PIPKI661 contains a unique 26 amino acid region that gives it specificity for binding to the talin head, and thus targets it to focal adhesions117. Upon growth factor or integrin signaling, talin and PIPKI associate and talin mediates translocation to nascent focal adhesions118. PIP2 produced by PIPKI strengthens the binding of talin to integrin  tails, possibly by enhancing the activation of talin through relief of autoinhibition. Interestingly, the PIPKI and integrin  tail binding sites are overlapping in the talin head, suggesting that PIPKI plays a role in the turnover in focal adhesions by competing for the binding of talin to integrin  tails118,119.  While the role of talin in focal adhesion formation has been well characterized, there are surprisingly few studies on the role of PIPK in lymphocytes in general and NK cells in particular. Micucci et al. investigated the role of the three PIPK isoforms in human NK cells and found that human NK cells express the  isoform (which corresponds to the  isoform in mice) and the  isoform115. Both isoforms produced pools of PIP2 that contributed to the production of IP3 required for Ca++ response during cytotoxicity and subsequent granule exocytosis. This study revealed a critical role for PIPK in NK cell cytotoxicity, but focused on the role of PIP2 as substrate for subsequent IP3 production. The role of PIP2 itself as a messenger was not examined.  27  1.3.7 Phosphatidylinositol 4, 5 bisphosphate (PIP2) PIP2 is important as a substrate for the production of IP3 and DAG by PLC, and PIP3 by PI3K, but it also plays an important role in its own right as a messenger lipid. In particular it is important in cytoskeletal signaling and the regulation of cytoskeletal proteins. Increased PIP2 levels promote actin polymerization through multiple interactions. PIP2 can bind actin-associated proteins through electrostatic interactions120. In addition, many proteins bind PIP2 via pleckstrin homology (PH) domains, including WASP and ERM family members120. In vivo studies illustrate the importance of PIP2 in cytoskeletal signaling and show that sequestering PIP2 alters focal adhesion formation, whereas high concentrations of PIP2 catalyze actin polymerization120. PIP2 also binds to the basic region of WASP and is thought to be required for its activation through concurrent binding of activated Cdc42121. PIP2 also binds the talin head domain and is thought to relieve the autoinhibition of talin and thus strengthen its interaction with integrin  tails.  1.4 A model for talin’s role in actin polymerization Cells adhering to the extracellular matrix via integrins form complex dynamic structures. Much of what we know about integrin signaling to the actin cytoskeleton has been learned from these focal adhesions that are formed in adherent cells. Focal adhesions maintain cell polarity, survival, and directed migration. Talin plays an important role in the formation of focal adhesions. Following integrin signaling, recruitment of PIPKI by talin to focal adhesions results in the localized production of PIP2 and increased activation of both talin and vinculin via relief of autoinhibition117,118,122. Vinculin can induce actin polymerization at focal adhesions through the recruitment of the Arp2/3 complex, a transient interaction which requires binding of PIP2 by 28  vinculin and activation of Arp2/3 by Rac1105. Fibroblasts lacking vinculin, or expressing vinculin mutants unable to recruit Arp2/3, show defects in cell adhesion and spreading. Following integrin engagement, FAK becomes autophosphorylated on tyrosine 397. Phosphorylation of PIPKI by FAK increases PIP2 production and association of PIPKI with talin.  LFA-1 Src kinase?  Talin?  Vav  ?  Pyk2  Rac cdc42  actin Figure 1.6. LFA-1 outside-in signaling. Talin is thought to activate LFA-1, leading to phosphorylation of Vav and Pyk2 by Src family kinases. The relationship between Vav and Pyk2 is unclear. Activation of Rac and Cdc42 follow. LFA-1 signaling has been shown to result in actin remodeling, and this may be mediated by activation of the Rac and Cdc42 mediated pathway of actin polarization. Dashed lines indicate that the relationship between the two proteins is unclear. While this model has been well documented in adherent cells, much less is known about the role that talin plays in lymphocyte signaling. It is thought that talin activates LFA-1 prior to its binding to ICAM-1. Alternatively, talin may be recruited following binding of LFA-1 to ICAM1 to stabilize the high affinity conformation of LFA-1 induced by ICAM-1 binding. LFA-1  29  outside-in signaling leads to actin remodeling and activation of co-stimulatory pathways as shown in Figure 1.6.  1.5 Thesis hypothesis and objectives The overall objective of this thesis was to examine the role that talin plays in LFA-1 outside-in signaling in NK cells and CTLs. I hypothesized that the binding of LFA-1 to ICAM-1 results in the recruitment of talin and the propagation of signals leading to actin polymerization. In Chapter 2 I tested this hypothesis using CTLs. The objective of the subsequent study was to elucidate the role that talin plays in LFA-1-mediated outside-in signaling that leads to actin polymerization. My hypothesis was that talin is required for NK cell cytotoxicity and LFA-1 mediated adhesion. I tested this hypothesis in Chapter 3 by generating talin-KO NK cells and examining the effect of talin disruption on NK cell function. The final objective of this study was to determine the mechanism of LFA-1 mediated actin polymerization. My hypothesis was that talin recruits actin polymerization machinery to LFA-1 following binding of LFA-1 to ICAM-1. In Chapter 4 I tested this using WT, talin- and WASP-KO NK cells to identify a talin-dependent pathway for actin polymerization that functions downstream of LFA-1 ligand binding.  30  1.6 Bibliography 1. Janeway C. Immunobiology : the immune system in health and disease. New York: Garland Science; 2005. 2. Chavez-Galan L, Arenas-Del Angel MC, Zenteno E, Chavez R, Lascurain R. Cell death mechanisms induced by cytotoxic lymphocytes. Cell Mol Immunol. 2009;6:15-25. 3. Russell JH and Ley TJ. Lymphocyte-mediated cytotoxicity. Annu Rev Immunol. 2002;20:323-370. 4. Bossi G and Griffiths GM. CTL secretory lysosomes: biogenesis and secretion of a harmful organelle. Semin Immunol. 2005;17:87-94. 5. Orange JS. Formation and function of the lytic NK-cell immunological synapse. Nat Rev Immunol. 2008;8:713-725. 6. Zarcone D, Prasthofer EF, Malavasi F, Pistoia V, LoBuglio AF, Grossi CE. Ultrastructural analysis of human natural killer cell activation. Blood. 1987;69:1725-1736. 7. Thiery J, Keefe D, Saffarian S, et al. Perforin activates clathrin and dynamin-dependent endocytosis, which is required for plasma membrane repair and delivery of granzyme B for granzyme-mediated apoptosis. Blood First Edition Paper, prepublished online December 28, 2009; DOI 10.1182/blood-2009-10-246116. 8. Eriksson M, Leitz G, Fallman E, et al. Inhibitory receptors alter natural killer cell interactions with target cells yet allow simultaneous killing of susceptible targets. J Exp Med. 1999;190:1005-1012. 9. Lanier LL. Up on the tightrope: natural killer cell activation and inhibition. Nat Immunol. 2008;9:495-502.  31  10. Valiante NM, Phillips JH, Lanier LL, Parham P. Killer cell inhibitory receptor recognition of human leukocyte antigen (HLA) class I blocks formation of a pp36/PLC-gamma signaling complex in human natural killer (NK) cells. J Exp Med. 1996;184:2243-2250. 11. Lou Z, Billadeau DD, Savoy DN, Schoon RA, Leibson PJ. A role for a RhoA/ROCK/LIMkinase pathway in the regulation of cytotoxic lymphocytes. J Immunol. 2001;167:5749-5757. 12. Fassett MS, Davis DM, Valter MM, Cohen GB, Strominger JL. Signaling at the inhibitory natural killer cell immune synapse regulates lipid raft polarization but not class I MHC clustering. Proc Natl Acad Sci U S A. 2001;98:14547-14552. 13. Sanni TB, Masilamani M, Kabat J, Coligan JE, Borrego F. Exclusion of lipid rafts and decreased mobility of CD94/NKG2A receptors at the inhibitory NK cell synapse. Mol Biol Cell. 2004;15:3210-3223. 14. Burshtyn DN, Shin J, Stebbins C, Long EO. Adhesion to target cells is disrupted by the killer cell inhibitory receptor. Curr Biol. 2000;10:777-780. 15. Guerra N, Michel F, Gati A, et al. Engagement of the inhibitory receptor CD158a interrupts TCR signaling, preventing dynamic membrane reorganization in CTL/tumor cell interaction. Blood. 2002;100:2874-2881. 16. Masilamani M, Nguyen C, Kabat J, Borrego F, Coligan JE. CD94/NKG2A inhibits NK cell activation by disrupting the actin network at the immunological synapse. J Immunol. 2006;177:3590-3596. 17. Bryceson YT, Ljunggren HG, Long EO. Minimal requirement for induction of natural cytotoxicity and intersection of activation signals by inhibitory receptors. Blood. 2009;114:26572666.  32  18. Bryceson YT, March ME, Ljunggren HG, Long EO. Activation, coactivation, and costimulation of resting human natural killer cells. Immunol Rev. 2006;214:73-91. 19. Lanier LL. Natural killer cell receptor signaling. Curr Opin Immunol. 2003;15:308-314. 20. Colucci F, Schweighoffer E, Tomasello E, et al. Natural cytotoxicity uncoupled from the Syk and ZAP-70 intracellular kinases. Nat Immunol. 2002;3:288-294. 21. Chiesa S, Mingueneau M, Fuseri N, et al. Multiplicity and plasticity of natural killer cell signaling pathways. Blood. 2006;107:2364-2372. 22. Sims TN and Dustin ML. The immunological synapse: integrins take the stage. Immunol Rev. 2002;186:100-117. 23. Matsumoto G, Nghiem MP, Nozaki N, Schmits R, Penninger JM. Cooperation between CD44 and LFA-1/CD11a adhesion receptors in lymphokine-activated killer cell cytotoxicity. J Immunol. 1998;160:5781-9. 24. Chen BP, Malkovsky M, Hank JA, Sondel PM. Nonrestricted cytotoxicity mediated by interleukin 2-expanded leukocytes is inhibited by anti-LFA-1 monoclonal antibodies (MoAb) but potentiated by anti-CD3 MoAb. Cell Immunol. 1987;110:282-293. 25. Hildreth JE, Gotch FM, Hildreth PD, McMichael AJ. A human lymphocyte-associated antigen involved in cell-mediated lympholysis. Eur J Immunol. 1983;13:202-208. 26. Anikeeva N, Somersalo K, Sims TN, Thomas VK, Dustin ML, Sykulev Y. Distinct role of lymphocyte function-associated antigen-1 in mediating effective cytolytic activity by cytotoxic T lymphocytes. Proc Natl Acad Sci U S A. 2005;102:6437-6442. 27. Germain RN. The art of the probable: system control in the adaptive immune system. Science. 2001;293:240-245.  33  28. Wulfing C, Purtic B, Klem J, Schatzle JD. Stepwise cytoskeletal polarization as a series of checkpoints in innate but not adaptive cytolytic killing. Proc Natl Acad Sci U S A. 2003;100:7767-7772. 29. Bhat R and Watzl C. Serial killing of tumor cells by human natural killer cells - enhancement by therapeutic antibodies. PLoS One. 2007;2:e326. 30. Bossi G, Trambas C, Booth S, Clark R, Stinchcombe J, Griffiths GM. The secretory synapse: the secrets of a serial killer. Immunol Rev. 2002;189:152-160. 31. Orange JS, Ramesh N, Remold-O'Donnell E, et al. Wiskott-Aldrich syndrome protein is required for NK cell cytotoxicity and colocalizes with actin to NK cell-activating immunologic synapses. Proc Natl Acad Sci U S A. 2002;99:11351-11356. 32. Katz P, Zaytoun AM, Lee JH,Jr, Panush RS, Longley S. Abnormal natural killer cell activity in systemic lupus erythematosus: an intrinsic defect in the lytic event. J Immunol. 1982;129:1966-1971. 33. Gismondi A, Jacobelli J, Mainiero F, et al. Cutting edge: functional role for proline-rich tyrosine kinase 2 in NK cell-mediated natural cytotoxicity. J Immunol. 2000;164:2272-6. 34. Fuller CL, Braciale VL, Samelson LE. All roads lead to actin: the intimate relationship between TCR signaling and the cytoskeleton. Immunol Rev. 2003;191:220-236. 35. Suzuki J, Yamasaki S, Wu J, Koretzky GA, Saito T. The actin cloud induced by LFA-1mediated outside-in signals lowers the threshold for T-cell activation. Blood. 2007;109:168-175. 36. Graham DB, Cella M, Giurisato E, et al. Vav1 controls DAP10-mediated natural cytotoxicity by regulating actin and microtubule dynamics. J Immunol. 2006;177:2349-2355.  34  37. Chen X, Allan DS, Krzewski K, Ge B, Kopcow H, Strominger JL. CD28-stimulated ERK2 phosphorylation is required for polarization of the microtubule organizing center and granules in YTS NK cells. Proc Natl Acad Sci U S A. 2006;103:10346-10351. 38. Sancho D, Nieto M, Llano M, et al. The tyrosine kinase PYK-2/RAFTK regulates natural killer (NK) cell cytotoxic response, and is translocated and activated upon specific target cell recognition and killing. J Cell Biol. 2000;149:1249-1262. 39. Stowers L, Yelon D, Berg LJ, Chant J. Regulation of the polarization of T cells toward antigen-presenting cells by Ras-related GTPase CDC42. Proc Natl Acad Sci U S A. 1995;92:5027-5031. 40. Lowin-Kropf B, Shapiro VS, Weiss A. Cytoskeletal polarization of T cells is regulated by an immunoreceptor tyrosine-based activation motif-dependent mechanism. J Cell Biol. 1998;140:861-871. 41. Quann EJ, Merino E, Furuta T, Huse M. Localized diacylglycerol drives the polarization of the microtubule-organizing center in T cells. Nat Immunol. 2009;10:627-635. 42. Combs J, Kim SJ, Tan S, et al. Recruitment of dynein to the Jurkat immunological synapse. Proc Natl Acad Sci U S A. 2006;103:14883-14888. 43. Andzelm MM, Chen X, Krzewski K, Orange JS, Strominger JL. Myosin IIA is required for cytolytic granule exocytosis in human NK cells. J Exp Med. 2007;204:2285-2291. 44. Dustin ML, Bivona TG, Philips MR. Membranes as messengers in T cell adhesion signaling. Nat Immunol. 2004;5:363-372. 45. Humphries MJ. Integrin structure. Biochem Soc Trans. 2000;28:311-339. 46. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69:11-25.  35  47. Shier P, Otulakowski G, Ngo K, et al. Impaired immune responses toward alloantigens and tumor cells but normal thymic selection in mice deficient in the beta2 integrin leukocyte function-associated antigen-1. J Immunol. 1996;157:5375-5386. 48. Hogg N, Henderson R, Leitinger B, McDowall A, Porter J, Stanley P. Mechanisms contributing to the activity of integrins on leukocytes. Immunol Rev. 2002;186:164-171. 49. Takagi J, Petre BM, Walz T, Springer TA. Global conformational rearrangements in integrin extracellular domains in outside-in and inside-out signaling. Cell. 2002;110:599-511. 50. Katsumi A, Orr AW, Tzima E, Schwartz MA. Integrins in mechanotransduction. J Biol Chem. 2004;279:12001-12004. 51. Alon R and Dustin ML. Force as a facilitator of integrin conformational changes during leukocyte arrest on blood vessels and antigen-presenting cells. Immunity. 2007;26:17-27. 52. Shamri R, Grabovsky V, Gauguet JM, et al. Lymphocyte arrest requires instantaneous induction of an extended LFA-1 conformation mediated by endothelium-bound chemokines. Nat Immunol. 2005;6:497-506. 53. Kim M, Carman CV, Springer TA. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science. 2003;301:1720-1725. 54. Critchley DR. Biochemical and structural properties of the integrin-associated cytoskeletal protein talin. Annu Rev Biophys. 2009;38:235-254. 55. Franco SJ, Senetar MA, Simonson WT, Huttenlocher A, McCann RO. The conserved Cterminal I/LWEQ module targets Talin1 to focal adhesions. Cell Motil Cytoskeleton. 2006;63:563-581. 56. Sun N, Critchley DR, Paulin D, Li Z, Robson RM. Identification of a repeated domain within mammalian alpha-synemin that interacts directly with talin. Exp Cell Res. 2008;314:1839-1849.  36  57. Goldfinger LE, Ptak C, Jeffery ED, et al. An experimentally derived database of candidate Ras-interacting proteins. J Proteome Res. 2007;6:1806-1811. 58. Goksoy E, Ma YQ, Wang X, et al. Structural basis for the autoinhibition of talin in regulating integrin activation. Mol Cell. 2008;31:124-133. 59. Martel V, Racaud-Sultan C, Dupe S, et al. Conformation, localization, and integrin binding of talin depend on its interaction with phosphoinositides. J Biol Chem. 2001;276:21217-21227. 60. Heraud JM, Racaud-Sultan C, Gironcel D, et al. Lipid products of phosphoinositide 3-kinase and phosphatidylinositol 4',5'-bisphosphate are both required for ADP-dependent platelet spreading. J Biol Chem. 1998;273:17817-17823. 61. Franco SJ, Rodgers MA, Perrin BJ, et al. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol. 2004;6:977-983. 62. Ratnikov BI, Partridge AW, Ginsberg MH. Integrin activation by talin. J Thromb Haemost. 2005;3:1783-1790. 63. Priddle H, Hemmings L, Monkley S, et al. Disruption of the talin gene compromises focal adhesion assembly in undifferentiated but not differentiated embryonic stem cells. J Cell Biol. 1998;142:1121-1133. 64. Monkley SJ, Zhou XH, Kinston SJ, et al. Disruption of the talin gene arrests mouse development at the gastrulation stage. Dev Dyn. 2000;219:560-574. 65. Nieswandt B, Moser M, Pleines I, et al. Loss of talin1 in platelets abrogates integrin activation, platelet aggregation, and thrombus formation in vitro and in vivo. J Exp Med. 2007;204:3113-3118.  37  66. Riteau B, Barber DF, Long EO. Vav1 phosphorylation is induced by beta2 integrin engagement on natural killer cells upstream of actin cytoskeleton and lipid raft reorganization. J Exp Med. 2003;198:469-74. 67. Goley ED and Welch MD. The ARP2/3 complex: an actin nucleator comes of age. Nat Rev Mol Cell Biol. 2006;7:713-726. 68. Egile C, Rouiller I, Xu XP, Volkmann N, Li R, Hanein D. Mechanism of filament nucleation and branch stability revealed by the structure of the Arp2/3 complex at actin branch junctions. PLoS Biol. 2005;3:e383. 69. Fooksman DR, Vardhana S, Vasiliver-Shamis G, et al. Functional Anatomy of T Cell Activation and Synapse Formation. Annu Rev Immunol. 2009. [Epub ahead of print]. 70. Butler B and Cooper JA. Distinct Roles for the Actin Nucleators Arp2/3 and hDia1 during NK-Mediated Cytotoxicity. Curr Biol. 2009. Dec 1;19(22):1886-96. Epub 2009 Nov 12. 71. Miki H, Miura K, Takenawa T. N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J. 1996;15:5326-5335. 72. Bear JE, Rawls JF, Saxe CL,3rd. SCAR, a WASP-related protein, isolated as a suppressor of receptor defects in late Dictyostelium development. J Cell Biol. 1998;142:1325-1335. 73. Machesky LM and Insall RH. Scar1 and the related Wiskott-Aldrich syndrome protein, WASP, regulate the actin cytoskeleton through the Arp2/3 complex. Curr Biol. 1998;8:13471356. 74. Millard TH, Sharp SJ, Machesky LM. Signalling to actin assembly via the WASP (WiskottAldrich syndrome protein)-family proteins and the Arp2/3 complex. Biochem J. 2004;380:1-17.  38  75. Krzewski K, Chen X, Orange JS, Strominger JL. Formation of a WIP-, WASp-, actin-, and myosin IIA-containing multiprotein complex in activated NK cells and its alteration by KIR inhibitory signaling. J Cell Biol. 2006;173:121-132. 76. Gismondi A, Cifaldi L, Mazza C, et al. Impaired natural and CD16-mediated NK cell cytotoxicity in patients with WAS and XLT: ability of IL-2 to correct NK cell functional defect. Blood. 2004;104:436-443. 77. Zhang J, Shehabeldin A, da Cruz LA, et al. Antigen receptor-induced activation and cytoskeletal rearrangement are impaired in Wiskott-Aldrich syndrome protein-deficient lymphocytes. J Exp Med. 1999;190:1329-1342. 78. Rohatgi R, Ma L, Miki H, et al. The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell. 1999;97:221-231. 79. Aspenstrom P, Lindberg U, Hall A. Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskott-Aldrich syndrome. Curr Biol. 1996;6:7075. 80. Higgs HN and Pollard TD. Activation by Cdc42 and PIP(2) of Wiskott-Aldrich syndrome protein (WASp) stimulates actin nucleation by Arp2/3 complex. J Cell Biol. 2000;150:13111320. 81. Rohatgi R, Ho HY, Kirschner MW. Mechanism of N-WASP activation by CDC42 and phosphatidylinositol 4, 5-bisphosphate. J Cell Biol. 2000;150:1299-1310. 82. Prehoda KE, Scott JA, Mullins RD, Lim WA. Integration of multiple signals through cooperative regulation of the N-WASP-Arp2/3 complex. Science. 2000;290:801-806.  39  83. Rohatgi R, Nollau P, Ho HY, Kirschner MW, Mayer BJ. Nck and phosphatidylinositol 4,5bisphosphate synergistically activate actin polymerization through the N-WASP-Arp2/3 pathway. J Biol Chem. 2001;276:26448-26452. 84. Yamaguchi H, Miki H, Suetsugu S, Ma L, Kirschner MW, Takenawa T. Two tandem verprolin homology domains are necessary for a strong activation of Arp2/3 complex-induced actin polymerization and induction of microspike formation by N-WASP. Proc Natl Acad Sci U S A. 2000;97:12631-12636. 85. Sasahara Y, Rachid R, Byrne MJ, et al. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol Cell. 2002;10:12691281. 86. Baba Y, Nonoyama S, Matsushita M, et al. Involvement of wiskott-aldrich syndrome protein in B-cell cytoplasmic tyrosine kinase pathway. Blood. 1999;93:2003-2012. 87. Cory GO, Garg R, Cramer R, Ridley AJ. Phosphorylation of tyrosine 291 enhances the ability of WASp to stimulate actin polymerization and filopodium formation. Wiskott-Aldrich Syndrome protein. J Biol Chem. 2002;277:45115-45121. 88. Torres E and Rosen MK. Contingent phosphorylation/dephosphorylation provides a mechanism of molecular memory in WASP. Mol Cell. 2003;11:1215-1227. 89. Snapper SB, Rosen FS, Mizoguchi E, et al. Wiskott-Aldrich syndrome protein-deficient mice reveal a role for WASP in T but not B cell activation. Immunity. 1998;9:81-91. 90. Cannon JL, Labno CM, Bosco G, et al. Wasp recruitment to the T cell:APC contact site occurs independently of Cdc42 activation. Immunity. 2001;15:249-259. 91. Billadeau DD and Burkhardt JK. Regulation of cytoskeletal dynamics at the immune synapse: new stars join the actin troupe. Traffic. 2006;7:1451-1460.  40  92. Barda-Saad M, Braiman A, Titerence R, Bunnell SC, Barr VA, Samelson LE. Dynamic molecular interactions linking the T cell antigen receptor to the actin cytoskeleton. Nat Immunol. 2005;6:80-89. 93. Badour K, Zhang J, Shi F, et al. The Wiskott-Aldrich syndrome protein acts downstream of CD2 and the CD2AP and PSTPIP1 adaptors to promote formation of the immunological synapse. Immunity. 2003;18:141-154. 94. Avraham H, Park SY, Schinkmann K, Avraham S. RAFTK/Pyk2-mediated cellular signalling. Cell Signal. 2000;12:123-133. 95. Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6:56-68. 96. Ostergaard HL and Lysechko TL. Focal adhesion kinase-related protein tyrosine kinase Pyk2 in T-cell activation and function. Immunol Res. 2005;31:267-282. 97. Berg NN and Ostergaard HL. T cell receptor engagement induces tyrosine phosphorylation of FAK and Pyk2 and their association with Lck. J Immunol. 1997;159:1753-1757. 98. Qian D, Lev S, van Oers NS, Dikic I, Schlessinger J, Weiss A. Tyrosine phosphorylation of Pyk2 is selectively regulated by Fyn during TCR signaling. J Exp Med. 1997;185:1253-1259. 99. Ganju RK, Hatch WC, Avraham H, et al. RAFTK, a novel member of the focal adhesion kinase family, is phosphorylated and associates with signaling molecules upon activation of mature T lymphocytes. J Exp Med. 1997;185:1055-1063. 100. Sancho D, Montoya MC, Monjas A, et al. TCR engagement induces proline-rich tyrosine kinase-2 (Pyk2) translocation to the T cell-APC interface independently of Pyk2 activity and in an immunoreceptor tyrosine-based activation motif-mediated fashion. J Immunol. 2002;169:292300.  41  101. Ziegler WH, Liddington RC, Critchley DR. The structure and regulation of vinculin. Trends Cell Biol. 2006;16:453-460. 102. Bakolitsa C, Cohen DM, Bankston LA, et al. Structural basis for vinculin activation at sites of cell adhesion. Nature. 2004;430:583-586. 103. Huttelmaier S, Mayboroda O, Harbeck B, Jarchau T, Jockusch BM, Rudiger M. The interaction of the cell-contact proteins VASP and vinculin is regulated by phosphatidylinositol4,5-bisphosphate. Curr Biol. 1998;8:479-488. 104. Weekes J, Barry ST, Critchley DR. Acidic phospholipids inhibit the intramolecular association between the N- and C-terminal regions of vinculin, exposing actin-binding and protein kinase C phosphorylation sites. Biochem J. 1996;314 ( Pt 3):827-832. 105. DeMali KA, Barlow CA, Burridge K. Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J Cell Biol. 2002;159:881-891. 106. Bailly M. Connecting cell adhesion to the actin polymerization machinery: vinculin as the missing link? Trends Cell Biol. 2003;13:163-165. 107. Critchley DR. Cytoskeletal proteins talin and vinculin in integrin-mediated adhesion. Biochem Soc Trans. 2004;32:831-836. 108. Xu W, Baribault H, Adamson ED. Vinculin knockout results in heart and brain defects during embryonic development. Development. 1998;125:327-337. 109. Nolz JC, Medeiros RB, Mitchell JS, et al. WAVE2 regulates high-affinity integrin binding by recruiting vinculin and talin to the immunological synapse. Mol Cell Biol. 2007;27:59866000. 110. Ponta H, Sherman L, Herrlich PA. CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 2003;4:33-45.  42  111. Legg JW, Lewis CA, Parsons M, Ng T, Isacke CM. A novel PKC-regulated mechanism controls CD44 ezrin association and directional cell motility. Nat Cell Biol. 2002;4:399-407. 112. Maenpaa A, Jaaskelainen J, Carpen O, Patarroyo M, Timonen T. Expression of integrins and other adhesion molecules on NK cells; impact of IL-2 on short- and long-term cultures. Int J Cancer. 1993;53:850-855. 113. Galandrini R, De Maria R, Piccoli M, Frati L, Santoni A. CD44 triggering enhances human NK cell cytotoxic functions. J Immunol. 1994;153:4399-4407. 114. Li R, Wong N, Jabali MD, Johnson P. CD44-initiated cell spreading induces Pyk2 phosphorylation, is mediated by Src family kinases, and is negatively regulated by CD45. J Biol Chem. 2001;276:28767-28773. 115. Micucci F, Capuano C, Marchetti E, et al. PI5KI-dependent signals are critical regulators of the cytolytic secretory pathway. Blood. 2008;111:4165-4172. 116. Santarius M, Lee CH, Anderson RA. Supervised membrane swimming: small G-protein lifeguards regulate PIPK signalling and monitor intracellular PtdIns(4,5)P2 pools. Biochem J. 2006;398:1-13. 117. Di Paolo G, Pellegrini L, Letinic K, et al. Recruitment and regulation of phosphatidylinositol phosphate kinase type 1 gamma by the FERM domain of talin. Nature. 2002;420:85-89. 118. Ling K, Doughman RL, Firestone AJ, Bunce MW, Anderson RA. Type I gamma phosphatidylinositol phosphate kinase targets and regulates focal adhesions. Nature. 2002;420:89-93. 119. van den Bout I and Divecha N. PIP5K-driven PtdIns(4,5)P2 synthesis: regulation and cellular functions. J Cell Sci. 2009;122:3837-3850.  43  120. Sechi AS and Wehland J. The actin cytoskeleton and plasma membrane connection: PtdIns(4,5)P(2) influences cytoskeletal protein activity at the plasma membrane. J Cell Sci. 2000;113 Pt 21:3685-3695. 121. Takenawa T and Suetsugu S. The WASP-WAVE protein network: connecting the membrane to the cytoskeleton. Nat Rev Mol Cell Biol. 2007;8:37-48. 122. Brakebusch C and Fassler R. The integrin-actin connection, an eternal love affair. EMBO J. 2003;22:2324-2333. 123. Barczyk M, Carracedo S, Gullberg D. Integrins. Cell Tissue Res. 2010; 339(1):269-80  44  CHAPTER 2  LFA-1 BINDING TO LIGAND INDUCES TALIN-MEDIATED ACTIN REORGANIZATION IN T CELLS  A version of this chapter has been published as: Mace EM, Macleod MA, Marwali MR, Dreolini L, Takei F. LFA-1 Binding to Ligand Induces Talin-Mediated Reorganization of the Actin Cytoskeleton in Cytotoxic T Cells. The Open Immunology Journal. Nov 2008; Vol 1. pp.51-61  45  2.1 Introduction LFA-1 plays a critical role in cell mediated cytotoxicity, by mediating binding of effector cells to target cells1. However, whether LFA-1 plays an additional role in cell-mediated killing of target cells by transducing “outside-in signals” has been unclear. One of the difficulties in studying LFA-1-mediated signaling events is that LFA-1 on resting T cells has very low avidity for ligand and does not effectively mediate binding of resting T cells to APC. When resting T cells interact with APCs, LFA-1 on T cells is thought to be activated by signals generated by the TCR recognizing agonist MHC/peptide complex on APCs2. The activated LFA1 on T cells then binds to ICAM-1 on APC to stabilize T cell-APC interaction. Thus, intracellular events mediated by LFA-1 are difficult to differentially recognize over the strong TCR-mediated signaling events. To circumvent this problem, antibody-mediated cross-linking of LFA-1 is often used to study LFA-1-mediated stimulatory signals. However, our current study shows that ligand binding and antibody-mediated clustering of LFA-1 have different effects, and cross-linking with antibody may not be physiologically relevant. Porter et al. have shown that binding of primary human T cells to immobilized ICAM-1 induced by treatment with EGTA and Mg++ to activate LFA-1 results in reorganization of the actin cytoskeleton3. In our previous studies, we showed that LFA-1 molecules on CTLs generated in vitro from HY-specific TCR-transgenic mouse T cells are in a high-avidity conformation and readily mediate cell adhesion to ICAM-1. Furthermore, binding of CTLs to the murine fibroblast L cell line expressing ICAM-1 but not agonist peptide/MHC complex leads to antigen-independent formation of the immunological synapse, in which LFA-1, CD3 and GM1 show a ring-like distribution at the cell contact site4. The actin cytoskeleton also accumulates at the immunological synapse of CTLs in an antigen-independent manner. Somersalo et al. have  46  shown that binding of CTLs to a planar lipid bilayer containing ICAM-1 leads to formation of an antigen-independent ring junction consisting of LFA-1 and the actin-binding protein talin5. These results suggest that LFA-1-mediated binding of CTLs to ICAM-1 leads to the reorganization of the actin cytoskeleton and formation of antigen-independent immunological synapse. Talin is a major cytoskeletal protein that has recently been proposed to act as the final common step in integrin activation6. It is composed of a ~50 kDa head and a ~200 kDa tail domain. The talin head contains a predicted FERM (band four-point-one, ezrin, radixin and moesin) domain that mediates interactions with the cytoplasmic tails of β1, 2, and 3 integrins69  . Overexpression of recombinant talin fragments containing this FERM domain activates 2 and  3 integrins, possibly by disrupting the interactions between the  and  cytoplasmic tails7-11. RNAi experiments indicate that talin is required for activation of 1 and 3 integrins6. Thus, talin is thought to play a critical role in inside-out activation of LFA-1. Whether talin is involved in LFA-1-mediated outside-in signaling is currently unknown. Wiskott Aldrich Syndrome Protein (WASP) is a leukocyte-specific member of the WASP family of proteins12. Upon T cell activation, WASP interacts with the actin nucleating complex Arp2/3 and promotes actin polymerization13. WASP is recruited to the IS formed in T cells as they interact with APC expressing agonist peptide/MHC complex, and WASP-evoked actin polymerization is thought to promote synapse formation and T cell activation12, although WASPdeficient T cells are able to form the immunological synapse14 . WASP-deficient NK cells have defective cytotoxicity and actin accumulation at the IS on NK cells15. Interaction between LFA-1 and the actin cytoskeleton is complex. LFA-1 in resting cells is thought to be kept inactive through anchoring interactions with the actin cytoskeleton that prevent it from clustering and forming multivalent interactions with ligand2. After TCR 47  engagement, intracellular signals are generated within T cells that are believed to cause the transient solubilization of the cortical cytoskeleton, which liberates LFA-1 and allows its lateral movement in the cell membrane, leading to multivalent interactions with ICAM-1 at the site of conjugate formation. Single molecule tracking experiments with Epstein-Barr Virus (EBV) transformed B cells showed that almost all LFA-1 molecules in resting cells were found to be immobile on the cell surface while treatment of these cells with the phorbol ester phorbol 12myristate 13-acetate (PMA), which experimentally activates LFA-1, increases the mobility of the LFA-1 molecules by a factor of ten16. Additionally, treatment with low concentrations of cytochalasin D, which disrupts actin filaments and inhibits actin polymerization, enhances cell adhesion to ICAM-1 coated surfaces. On the other hand, high concentration of cytochalasin D inhibits cell adhesion to ICAM-1. It is thought that cytochalasin induces the release of LFA-1 from actin constraints, thus allowing it to cluster whereas higher concentration of cytochalasin treatment inhibits re-association of clustered LFA-1 with actin filaments, which is needed for firm cell adhesion. In this study, we investigated the interaction between LFA-1, talin and actin in CTLs. Our results show that ICAM-1 binding to LFA-1, but not LFA-1 clustering, is critical for the reorganization of the actin cytoskeleton. We have shown that some signaling events following LFA-1 ligation, such as those that result in actin, talin and WASP accumulation are dependent upon ICAM-1 ligation. Others, such as Pyk2 phosphorylation, can be induced by clustering of LFA-1. These results, taken together with the accumulation of actin following binding of LFA-1 to ICAM, suggest that outside-in signals are transduced following binding of LFA-1 to ICAM-1. Thus we have shown early events in a previously undefined pathway of outside-in signaling.  48  2.2 Materials and methods A detailed version of all methodologies can be found in the Appendix.  2.2.1 Mice, antibodies and reagents C57BL/6 mice were bred in our animal colony. HY-specific TCR transgenic Rag 2-/- C57BL/10 mice were obtained from Taconic Farms (Tarrytown, NY) and bred in the Joint Animal Facility of the BC Cancer Research Centre. Anti-talin mAb (clone 8d4) was from Sigma (St. Louis, MO). Rat anti-murine CD18 hybridoma (TIB213) was from the American Type Culture Collection (ATCC, Rockville, MD). The YN1/1 mAb specific for murine ICAM-1 has been described17. Mouse anti-WASP mAb were from Santa Cruz Biotechnology (St. Cruz, CA). Murine recombinant soluble ICAM-1 (sICAM-1) was from StemCell Technologies (Vancouver BC, Canada). Cytochalasin D, bovine serum albumin (BSA) fragment V were from Sigma-Aldrich (St. Louis, MO). Calcein-AM, Alexa Fluor 488-conjugated goat anti-rat Ig secondary antibodies, Alexa Fluor 488-conjugated goat anti mouse and rhodamine-conjugated phalloidin, were from Molecular Probes (Eugene, OR).  2.2.2 Cells CTLs were generated from HY-specific TCR transgenic Rag2-deficient female B10 mice by stimulating with B6 dendritic cells as described4. The CTLs thus generated showed strong cytotoxicity against target cells expressing H-2Kb pulsed with the HY peptide. Splenic T cells were isolated by the murine T cell enrichment kit Spin SepTM (StemCell Technologies, Vancouver, BC, Canada). The murine fibroblast L cells and EL4 murine leukemia line were from the ATCC (Rockville, MD). L cells transfected with ICAM-1 have been described4. 49  2.2.3 Binding of cells to beads coated with ICAM-1 or anti-LFA-1 mAb Polystyrene beads (polystyrene 10 micron microspheres, Polysciences Inc., Warrington PA) were mixed at a 1:1 ratio with 40 μg/ml solutions of anti-LFA-1 mAb (TIB213) or recombinant soluble ICAM-1 in Adhesion Buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.2) for 1 h at room temperature with occasional agitation to prevent settling. Coated beads were blocked with Adhesion Buffer containing 10 mg/ml BSA for 1 h at room temperature, followed by three washes with RPMI 1640 10% FCS. CTLs were harvested, centrifuged and resuspended in RPMI 10% FCS, mixed with coated beads at a 1:2 ratio in a microfuge tube and incubated at 37ºC for 5 minutes. The cell-bead mixture was gently resuspended and plated onto a poly-L-lysine coated coverslip, followed by incubation at 37ºC for various time-points.  2.2.4 Confocal microscopy Induction of LFA-1 capping by antibody-mediated cross-linking and the preparation of CTLs interacting with ICAM-1-transfected L cells for confocal microscopy has been described4. For confocal analysis of CTLs binding beads, the samples prepared above were fixed with 4% paraformaldehyde for 15 minutes, blocked with PBS with 1% BSA for 30 minutes and permeabilized with Hank’s Saponin solution (HBSS containing 2% FCS, 5 mM EDTA, 0.5% Saponin) for 5 minutes at room temperature. Actin was detected by incubating cells fixed on coverslips with a 1:40 solution of rhodamine phalloidin in Hank’s Saponin solution for 20 minutes at room temperature. WASP and Pyk-2 were stained by incubating coverslips with a 1:40 solution of the corresponding primary antibody in Hank’s Saponin solution for 1 h at room temperature followed by incubation with 10 μg/ml Alex Fluor 488- or Alexa Fluor 568conjugated goat anti-mouse IgG antibody for WASP, or Alex Fluor 488-conjugated rabbit anti50  goat IgG antibody for Pyk-2. Coverslips were washed 3 times with Hank’s Saponin solution and twice with HBSS and mounted on slides using Vectashield Hard Set Antifade Mounting Medium (Vector Laboratories, Inc., Burlingame, CA). CTL-bead conjugates were analyzed using a BioRad Radiance 2000 Multiphoton microscope (Hercules, CA) with a 60x objective lens. The lasers used were Kr and Mai Tai Ti Sapphire. Alexa Fluor 488 was excited at 488 nm and the emission filter was HQ 515/30. Alexa Fluor 568 and rhodamine were excited at 568 nm and the emission filter was HQ 600/50. Stacks were collected using 0.15 μm Z steps and reconstructed using Volocity software (Improvision, Lexington, MA). The CTL-bead interface was cropped and rotated to obtain a view from the CTL side. The fluorescence intensity and area of actin staining were measured using Volocity software on conjugates collected under identical confocal conditions. The “Integrated Intensity” was determined to be the total fluorescence within an encircled selection divided by the area.  2.2.5 Pyk2 phosphorylation Polystyrene 60 x 15 mm Petri dishes (BD Falcon) were coated with 10 μg/ml ICAM-1 or antiLFA-1 antibody (TIB213) in Adhesion Buffer (20 mM Tris-HCl, 150 mM NaCl pH 8.2) overnight at 4ºC. ICAM-1 and TIB213 coated plates were blocked with Adhesion Buffer containing 1% BSA for 1 hour at room temperature. Coated plates were washed three times with PBS before use. CTLs were harvested, centrifuged and resuspended in 37ºC RPMI 1640 10% FBS at 10 million cells/ml.  One millilitre (10 million cells) of cell suspension was added to  each coated plate. Plates were incubated at 37ºC for various time-points, washed twice with 1 ml of pre-warmed RPMI 1640 10% FCS, then cells were lysed with 1 ml of ice cold lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM KCl, 2 mM EDTA pH 8.0, 1% Triton X-100, 0.5% BSA, 1 mM  51  Na3VO4, 0.2 mM NaMoO4, 1 mM PMSF, 5 μg/ml aprotinin, 10 μg/ml leupeptin and 10 μg/ml pepstatin). For time zero time-points, 10 million CTLs were lysed in a microfuge tube. Cells were sheared with two passages through a # 26 G needle followed by incubation on ice for 10 minutes. After centrifugation at 13,000 rpm with for 20 minutes at 4ºC, supernatants were taken as cell lysates. Immunoprecipitations were performed by incubating lysates with 1 μg anti-Pyk-2 for 1 hour at 4ºC with constant agitation. Protein G beads (Amersham Biosciences, Piscataway NJ) were added and lysates were agitated for an additional hour at 4ºC. Protein G beads were washed three times with Wash Buffer (lysis buffer without BSA) and the immunoprecipitated proteins eluted with SDS-PAGE sample buffer and boiling for 5 minutes. Samples for each time-point (107 cell equivalent) were divided in two equal portions, each separated by SDSPAGE, blotted to polyvinylidene fluoride membranes (Pall, Pensacola, FL) and detected by antiPyk2 or anti-phosphotyrosine (4G10) antibody with horseradish peroxidase-conjugated secondary antibody and an ECL system (Amersham Biosciences, Piscataway, NJ) according to the manufacturer’s protocol.  2.2.6 Cell adhesion assay LFA-1-mediated cell adhesion to immobilized soluble ICAM-1 was assayed as described18. For the actin cytoskeleton disruption, cytochalasin D (at indicated concentration) was added and cells were incubated for 15 minutes at 37ºC. Cells were washed once and incubated with 50 ng/ml PMA for 30 minutes at 37ºC. To determine the morphology of CTLs after washing, images were taken using bright field microscopy (Leica, Richmond Hill, Canada) with 40x objective lens equipped with CCD camera (Qimaging, Burnaby, Canada).  52  2.3 Results 2.3.1 Actin, talin and WASP accumulates in the immunological synapse of CTLs in an antigen-independent manner We have previously reported that LFA-1-mediated binding of CTLs to target cells induces an antigen-independent formation of the immunological synapse consisting of a ring-like codistribution of LFA-1 and CD34. Using this system, we examined the distribution of cytoskeletal proteins in CTL as they interact with ICAM-1-transfected L cells, which do not express agonist peptide/MHC. The conjugates were incubated for 5 and 20 minutes and were fixed, permeabilized and stained with phalloidin for F-actin and anti-LFA-1 or anti-WASP antibody. When CTL bound to L cells expressing ICAM-1, F-actin was enriched in the cell contact area and showed co-distribution with LFA-1 on the merged images (Fig. 2.1A). This finding was consistent after 5 minutes (not shown) and 20 minutes of incubation in 80-90% of conjugates (n=20). The distribution of F-actin (red) and LFA-1 (green) was further analyzed by reconstruction of the confocal images and the analysis of a cross-section of the interface from  53  LFA-1  actin  merge  A  3 1 2  B  LFA-1  actin  merge  C  actin  WASP  1  merge  1 2  2  3  3  D  WASP  actin  merge  E  Fold increase in f luorescence  1  2  3  4  3  2  1  0  actin  LFA-1  WASP  Figure 2.1 Actin and LFA-1 accumulate in antigen-independent immunological synapse on CTL. CTL were incubated with ICAM-1-transfected L cells for 20 minutes, fixed, permeabilized, stained for LFA-1, actin and WASP, and analyzed by confocal microscopy. (A) Cells numbered 1-3 in the merged image (right panel) were selected for 3D reconstruction. (B) The distribution of LFA-1 and actin at the CTL-L cell contact sites of the conjugates numbered in (A) were analyzed. The 3D images were reconstructed using Volocity software from the stacks of confocal images of the cell contact sites and rotated to obtain the images of the CTLtarget interphase from the CTL side. (C) Three representative conjugates stained for WASP and actin from more than 20 images collected are shown. Cells numbered 1-3 in the merge image (right panel) are shown at higher magnification in (D). (E) The increase in fluorescence intensity of actin, LFA-1, and WASP in CTL at the site of contact with L cells was calculated. Shown is a ratio of fluorescent intensity of actin (black bar), LFA-1 (white bar) and WASP (grey bar) at the site of contact site in comparison with fluorescent intensity of a section of membrane of equal area located on the opposite side of the same cell (mean  SEM, n= 10-20). L cells express actin but not LFA-1 or WASP. Therefore, to calculate the increase in F-actin fluorescence in CTLs at the contact site, F-actin fluorescence of L cells measured at a non-contact site of the same size was subtracted. The resulting value was used to calculate the ratio of actin accumulation as described for LFA-1 and WASP. 54  CTL side. Three examples of such analysis are shown in (Fig. 2.1B). In all 15 CTL-L cell contact sites analyzed by 3D reconstruction, F-actin formed in an outer ring. LFA-1 partially codistributed with actin and localized in the ring in 60% of CTL examined, although LFA-1 did not completely overlap with actin and was often enriched in one side of the ring in merged images (Fig 2.1B). We also examined the distribution of WASP in CTL, which accumulated at the cell contact site (Fig 2.1C, D). To quantify the distribution of LFA-1, WASP and actin, we calculated the ratio of fluorescence intensity at the site of contact between CTL and L cells over that of a section of membrane of equal area from the opposite side of the CTL. Since L cells also express F-actin, actin staining of a non-contact site of L cells was subtracted from that at the cell contact site to estimate the actin intensity of CTL at the contact site (Fig 2.1E). These results suggest that binding of LFA-1 on CTL to ICAM-1 on target cells results in the accumulation of actin and WASP in an antigen-independent manner.  2.3.2 LFA-1 capping does not induce co-capping of F-actin The above results showed accumulation of F-actin, talin and WASP in the immunological synapse of CTL. To determine whether this is due to constitutive association of LFA-1 on CTL with the actin cytoskeleton, a co-capping experiment was carried out. Capping of LFA-1 was induced by cross-linking with anti-LFA-1 mAb at 37C to increase membrane fluidity and allow passive diffusion of LFA-1. The cells were fixed, permeabilized and stained for F-actin. Cocapping was assessed by confocal microscopy. We have previously shown that LFA-1 capping induced co-capping of CD3 in CTLs4. In control cells, in which cells were kept on ice to prevent capping, LFA-1 and actin were evenly distributed along the plasma membrane (Fig. 2.2A, first  55  row). Antibody-mediated cross-linking induced striking localization of LFA-1 at one site, forming a “cap” (green), whereas F-actin remained evenly distributed (Fig. 2.2A, second row). This was observed in 94  5 % of capped cells (n=30). We also tested the distribution of talin. In control CTL without LFA-1 capping, talin showed patchy distribution throughout the cytosol and along the plasma membrane (Fig. 2.2A third row), and capping of LFA-1 did not result in cocapping of talin (Fig. 2.2A, bottom row). The accumulation of LFA-1, but not actin or talin, in the cap was further quantified by calculating the ratio of fluorescence intensity of the capped area of the membrane over the intensity of a section of membrane of equal area from the opposite side of the cell. Whereas LFA-1 accumulation in the cap was quite obvious, no such accumulation of actin or talin was detected in the cap as the densities of those proteins in the LFA-1 cap were the same to those in the opposite end of the cell (Fig. 2.2B). Thus, LFA-1 does not seem to be constitutively associated with actin or talin in CTLs.  2.3.3 Binding of ICAM-1-coated beads, but not anti-LFA-1 mAb-coated beads, induces accumulation of talin, actin and WASP at the binding site Since the interaction between CTL and L cells described above may involve multiple proteinprotein interactions, we used cell-size plastic beads coated with recombinant soluble ICAM-1 or anti-LFA-1 mAb in place of ICAM-1-transfected L cells. The densities of these proteins on the beads, as determined by staining with appropriate antibodies and flow cytometric analysis, were comparable to their levels on lymphoid target cells (data not shown). CTL and the beads were incubated for 20 minutes at 37˚C, fixed, permeabilized, stained for talin, F-actin and WASP and  56  LFA-1  A  actin  merged  talin  merged  control  capped LFA-1  control  capped  Fluorescence intensity (cap/opposite)  B 25 20 15 1.5  *  1.0  *  0.5 0  LFA-1  Talin  Actin  Figure 2.2 Actin and talin do not co-cap with LFA-1. CTL were incubated at 37 C with antiLFA-1, fixed, permeabilized and stained for actin or talin. The cells were analyzed by confocal microscopy. Control cells were incubated on ice to prevent capping of LFA-1, then fixed and stained with anti-LFA-1. (A) Images of the mid sections of the cells are shown. Shown are representative cells from more than 30 cells for each condition. (B) Fluorescent intensity of staining shown in (A) was further analyzed to quantify the intensity of the capped area. Shown is a ratio of intensity of the capped area of the membrane over the intensity of a section of membrane of equal area from the opposite side of the same cell (mean  SEM, n= 20) analyzed using Volocity software. * indicates p < 0.05.  57  examined by confocal microscopy. When CTL bound to ICAM-1-coated beads, the shape of CTL significantly changed. They flattened and formed lamellipodia-like membrane extensions that cupped the beads (Fig. 2.3A, top row). Actin, talin and WASP accumulated at the lamellipodia-like structure. In contrast, CTL bound to anti-LFA-1 mAb-coated beads did not change their shapes and did not form lamellipodia-like structure. Furthermore, no significant enrichment of F-actin, talin or WASP at the site of bead-binding was detected (Fig. 2.3A bottom row). The confocal images were further analyzed to quantify the distribution of actin in CTL bound to ICAM-1-coated beads and anti-LFA-1 mAb-coated beads. The intensity of actin staining (Fig. 2.3B), the bead-contact area (Fig. 2.3C), the integrated intensity of actin staining at the contact site (Fig. 2.3D) and the ratio of actin staining intensity between the bead contact site and non-contact sites of the same cells (Fig. 2.3E) were determined by analyzing 18 to 40 cell images by Volocity software (Improvision, Lexington, MA). By all the measurements, CTLs bound to ICAM-1-coated beads, but not anti-LFA-1 mAb-coated beads, showed significant accumulation of F-actin, talin and WASP at the bead-contact sites. Prolonged incubation of CTLs with anti-LFA-1 mAb-coated beads up to 2h did not induce redistribution of actin, talin or WASP (data not shown). These results suggest that binding of ICAM-1 to LFA-1, but not antibody-mediated LFA-1 clustering, induces stimulatory signals in CTL leading to accumulation of F-actin, talin and WASP.  58  actin  A  actin/ bright f ield  talin/ bright field  talin  WASP  bright f ield  ICAM-1  LFA-1  200 100  0  0  ICAM-1 αLFA-1 (n=23) (n=18)  ICAM-1 αLFA-1 (n=23) (n=18)  20  10  0  ICAM-1 LFA-1 (n=23) (n=18)  E 1.5  *  1.0 0.5 0.0  ICAM-1 LFA-1 (n=37) (n=40)  1.5  *  1.0 0.5 0.0  ICAM-1 LFA-1 (n=12) (n=12)  contact-site/non-contact site Intensity ratio  G  F contact-site/non-contact site Intensity ratio  10  *  contact-site/non-contact site Intensity ratio  *  D  *  20  Integrated Intensity (x10-3)  300  C Area (µm2)  Intensity (x10-3)  B  *  1.0  0.5  0.0  ICAM-1 LFA-1 (n=12) (n=12)  Figure 2.3 Binding of ICAM-1-coated beads, but not anti-LFA-1 mAb-coated beads, induces accumulation of actin, talin and WASP at the binding site. (A) CTL were incubated with beads (10 m diameter) pre-coated with recombinant soluble ICAM-1 or anti-LFA-1 mAb for 30 minutes at 37C, fixed, permeabilized and stained for actin, talin and WASP. The stained cells were analyzed by confocal microscopy. At least 50 cell-bead conjugates were analyzed for each condition. Representative images of the mid section of the cell-bead conjugates are shown. Staining analyzed in (A) was further analyzed to quantify the distribution of actin (B through E), WASP (F), and talin (G). The intensity of actin staining in the contact area (B), the size of the contact area (C), the integrated intensity (D) and the ratio of the contact site intensity over noncontact site intensity (E) were determined from 18 to 40 confocal images using Volocity software (Improvision). The ratio of the contact intensity over non-contact site intensity was determined for WASP (F) and talin (G) staining from 12 images per condition using Volocity software (Improvision). Error bars represent S.E.M. * indicate p < 0.05.  59  2.3.4 Binding to ICAM-1-coated plates as well as anti-LFA-1-coated plates induces Pyk2 phosphorylation The above results showed that binding of CTL to anti-LFA-1 mAb-coated beads do not induce accumulation of actin, talin and WASP. To test whether antibody-mediated clustering of LFA-1 resulted in any outside-in signals, we examined Pyk2 phosphorylation. Binding of LFA-1 to sICAM-1 treated plates has been shown to induce Pyk2 phosphorylation19. For this study, CTL were incubated in Petri dishes coated with ICAM-1 or anti-LFA-1 mAb for various time periods, Pyk2 was immunoprecipitated and phosphorylation of tyrosine residues was examined by western blotting. Pyk2 was rapidly phosphorylated within 5 minutes in CTL bound to an antiLFA-1-coated dish as well as those bound to an ICAM-1-coated dish (Fig. 2.4A). Quantification of the ratio between phosphorylated signal and Pyk2 control showed that in both conditions the intensity of signal increased more than 3-fold at the 5 minute time-point relative to the loading control and slowly decreased over 60 minutes (Fig 2.4B). Therefore, binding of CTL to antiLFA-1 coated plastic surface induces stimulatory signals in CTL leading to Pyk2 phosphorylation but not accumulation of actin, talin or WASP.  2.3.5 Disruption of actin cytoskeleton by cytochalasin D treatment inhibits LFA-1 mediated adhesion to ICAM-1 It has been reported that LFA-1 on resting human B lymphoid line is immobile on the plasma membrane due to its association with the actin cytoskeleton and treatment with a low dose cytochalasin D increases the mobility of LFA-1 on the cell surface, which allows clustering of LFA-1 and enhances LFA-1-mediated cell adhesion16. We tested whether similar effects of cytochalasin D treatment are seen with CTL. 60  As LFA-1 on CTL is in a high avidity  conformation, it readily mediated cell adhesion to ICAM-1 without prior stimulation with PMA, and the adhesion was almost completely inhibited by anti-LFA-1 antibody. Surprisingly, cytochalasin D treatment, even at low doses, inhibited cell adhesion (Fig. 2.5A). As a control, we also examined primary splenic T cells. Adhesion of splenic T cells to immobilized ICAM-1 requires activation with PMA. The cell adhesion to ICAM-1 was effectively inhibited by antiLFA-1 antibody. Treatment with cytochalasin D at low concentrations did not enhance LFA-1mediated adhesion of primary splenic T cells treated with  A ICAM-1 Time (min)  0  5  10  α-LFA-1  30  60  5  10  30  60  p-Tyr Pyk-2  p-Tyr / Pyk2  B  8 7 6 5 4 3 2 1 0  5  10  30  60  Time (min)  Figure 2.4. Tyrosine phosphorylation of Pyk-2 is enhanced in CTL after binding to both ICAM-1 and anti-LFA-1 mAb coated surfaces. (A) CTL were allowed to bind to polystyrene Petri dishes coated with recombinant soluble ICAM-1 or anti-LFA-1 mAb for the indicated times (in minutes) at 37ºC. Time zero samples were lysed in a microfuge tube with ice cold lysis buffer. Pyk2 was immunoprecipitated. Immunoprecipitated samples were divided in half and analyzed for Pyk-2 (loading control) and tyrosine phosphorylation with anti-Pyk-2 and antiphosphotyrosine (4G10) primary Abs, respectively. (B) The integrated density for each band on the western blot shown in (A) was calculated using ImageJ software. Shown is the ratio of phospho-tyrosine signal to loading control signal for each time point. Grey bar shows control (0 minute), black bars show ICAM-1 and white bars show LFA-1.  61  PMA, and higher doses inhibited adhesion, although not to the extent seen in CTLs (Fig. 2.5B). Adhesion of primary cells not treated with PMA was minimal, and cytochalasin D treatment produced no significant effect on adhesion of these cells. Finally, we tested the effect of cytochalasin D treatment on the EL4 murine lymphoma cell line. Like primary T cells, PMA stimulation is required for adhesion of EL4 to ICAM-1. Unlike primary cells and CTLs, EL4 cells showed increased adhesion following a low dose of cytochalasin D, although at higher concentrations adhesion was inhibited (Fig 2.5C). Microscopic observation of CTLs bound to immobilized ICAM-1 showed that they flatten and often formed lamellipodia-like extensions whereas cytochalasin treatment inhibited cell flattening and formation of membrane extensions (Fig. 2.5D). The short time incubation with cytochalasin had no effect on the viability of the cells in any of the experiments.  62  % cell binding  A  60  CTLs  50 40  *  *  30  *  20  *  *  *  10  50  10 0 C PMA Ab 0.1 0.3 0.5  1  Cytochalasin D (g/ml)  B 60  Primary T cells  % cell binding  50 40  % cell binding  *  * *  *  1 5 10 20 40 Cytochalasin D (g/ml)  80  20 10 0  C  *  30  0  0.1  60 *  50  EL4  *  40  *  30  *  20  *  10 0  0  0.1  0.3 1 5 10 20 Cytochalasin D (g/ml)  0  0.1 Cytochalasin D (g/ml)  80  D  Figure 2.5. Cytochalasin treatment inhibits adhesion of CTLs and primary T cells, but enhances adhesion of the EL4 cell line. CTL (A), primary splenic T cells (B), or EL4 cells (C) were labeled with Calcein-AM, washed, and treated with 50 ng/ml PMA (indicated by PMA label in (A) and black bars in (B) and (C)) and the indicated amount of cytochalasin D (C label in (A) denotes no treatment with cytochalasin D or PMA). Some cells were treated with antiLFA-1 blocking mAb to confirm specificity of binding to ICAM-1 (indicated by Ab label in (A) and grey bars in (B) and (C)). Cells were allowed to bind to plates that had been coated with soluble recombinant ICAM-1, then fluorescence was read, plates were washed to remove nonadherent cells, and fluorescence as read again. Cell adhesion was calculated as a ratio of pre- to post- wash values. Results shown are representative of at least 3 independent experiments, each done in triplicate. Error bars indicate S.E.M. Asterisks denote p < 0.05 compared to PMAstimulated control (indicated by PMA label in (A) and black bars in (B) and (C)). (D) CTL treated with indicated concentrations of cytochalasin D were subjected to the cell adhesion assay above. After washing away non-adherent cells, cells that remained adhered to the wells were examined with an inverted phase contrast microscope and photographed.  63  2.4 Discussion The reorganization of the actin cytoskeleton in effector cells is the essential first step in cellmediated cytotoxicity. Upon binding to target cells, CTL polarize and F-actin accumulates at the immunological synapse. Cytotoxic granules translocate and are secreted through the synapse20. We have previously shown that binding of CTL to cells expressing ICAM-1 leads to antigenindependent formation of an immunological synapse in which LFA-1 and CD3 are co-distributed in a ring. The actin cytoskeleton also accumulates in the antigen-independent immunological synapse of CTLs4. We now have shown that the reorganization of the actin cytoskeleton in CTLs requires binding of ICAM-1 to LFA-1 on CTLs, independent of TCR signalling. When CTLs bind to cells expressing ICAM-1 or plastic beads coated with recombinant ICAM-1, Factin and WASP accumulate at the binding site. This is not due to simple clustering of LFA-1, or constitutive association of F-actin and WASP with LFA-1, as binding of anti-LFA-1 mAb-coated beads does not induce the same redistribution of these proteins. Antibody-mediated capping of LFA-1 also fails to induce co-capping of F-actin or talin. Without binding of ICAM-1 to LFA-1, cortical actin in CTLs is evenly distributed underneath the plasma membrane whereas talin and WASP are distributed throughout the cytosol. Thus, ligand binding to LFA-1 transduces outsidein signals that lead to the reorganization of the actin cytoskeleton. The precise signaling pathways involved in this are still unclear. Binding of talin to the cytoplasmic tail of integrins, including LFA-1, is thought to be the final step of integrin activation6. Because LFA-1 on CTLs used in this study is pre-activated and readily mediates CTL adhesion to ICAM-1, talin in CTLs may be expected to constitutively associate with LFA-1. However, we see no sign of physical association of talin with LFA-1 in CTLs unless ICAM-1 binds to LFA-1. In addition to the confocal microscopy study presented  64  above, we have attempted to co-immunoprecipitate talin with LFA-1 without success (data not shown). The head domain of talin, which has high affinity for the cytoplasmic tail of LFA-1, can be generated upon cell activation by proteolytic cleavage of talin with the calcium-dependent proteases calpains21. However, western blotting with talin head-specific mAb detects only full length talin, but not free talin head, in CTLs in suspension or bound to immobilized ICAM-1 (data not shown). Therefore, the association between talin and LFA-1 seems to be induced by ligand binding to LFA-1 rather than calpain-mediated cleavage of talin. Kim et al. have shown that ligand binding induces separation of the cytoplasmic domains of the two chains of LFA-19. It is conceivable that this exposes talin-binding site on the cytoplasmic tail of LFA-1 and recruits talin. The mechanisms by which ICAM-1 binding to LFA-1 induces accumulation of F-actin and WASP in the binding site are still unknown. Since talin has multiple actin-binding domains, it is possible that F-actin passively accumulates by its association with talin. On the other hand, accumulation of WASP suggests that ligand binding of LFA-1 may transduce activation signals to recruit and activate WASP, leading to Arp2/3-mediated actin polymerization. WASP is recruited to the immunological synapse formed in T cells as they interact with APC22. However, the activation and recruitment of WASP to the immunological synapse is thought to be mediated by activation signals transduced by the TCR, involving activation of Cdc42, ZAP-70 and Protein Kinase 23. In CTLs in this study, the accumulation of WASP in the immunological synapse is independent of antigen-TCR interaction and is induced by ICAM-1 binding to LFA-1. SanchezMartin et al. reported that LFA-1 ligation induces Vav1-mediated Rac-1 activation23. Since Vav1-mediated Rac activation is thought to be an important step for actin polymerization24, we have examined the effects of ICAM-1 binding to LFA-1 on Vav1, but it seems to be  65  constitutively phosphorylated in CTLs used in this study, and ICAM-1 binding has no significant effect on Vav1 activation (data not shown). Binding of ICAM-2 to the human T cell line Jurkat induces phosphorylation of the -chain and release of Jun-activating binding protein (JAB-1) and phosphorylation of cytohesin-1, which leads to Erk1/2 phosphorylation25. In neutrophils, integrin-mediated signaling requires the Syk tyrosine kinase26, and 2 integrin-mediated activation is defective in double mutant neutrophils and macrophages deficient for both DAP12 and FcR27. Whether the same signaling pathway is involved in LFA-1-mediated activation in CTLs is unknown. An interesting finding in this study is the difference between binding to ICAM-1 and anti-LFA-1 mAb. As discussed above, ICAM-1 binding likely induces conformational changes in LFA-1, which is not achieved by antibody-mediated cross-linking or clustering of LFA-1. Antibody-mediated cross-linking is often used to study LFA-1 signaling. Our current study has shown that antibody-mediated clustering of LFA-1 does induce some signaling such as Pyk2 phosphorylation. It is unclear why antibody-mediated clustering of Pyk2 is sufficient for its phosphorylation. One possibility is that Pyk2 is associated with LFA-1 through some unknown mechanism, and clustering of LFA-1 following antibody cross-linking brings the Pyk2 molecules in proximity with each other leading to autophosphorylation of Pyk2. Suzuki et al. have recently reported that antibody-mediated cross-linking of LFA-1 on T cells results in a ring-shaped organization of actin, termed “actin cloud,” which involves adhesion- and degranulationpromoting adaptor protein (ADAP) phosphorylation and c-Jun N-terminal kinase (JNK) activation28. Our study has clearly shown that binding of immobilized ICAM-1 and immobilized anti-LFA-1 mAb have strikingly different effects on the distribution of actin, talin and WASP  66  and indicated that ligand binding is critical for the reorganization of the actin cytoskeleton in CTLs. Finally, we have examined the effect of actin inhibition by cytochalasin D on CTL. Previous reports have suggested that cytochalasin D treatment at low doses may enhance cell adhesion by releasing LFA-1 from the actin cytoskeleton, thus making it more mobile on the cell surface. We were surprised to find that even low doses of cytochalasin D resulted in inhibition of LFA-1 mediated adhesion to ICAM-1. As a control, we also tested primary T cells. As these splenic T cells were resting, activation by PMA was required for their adhesion to ICAM-1. PMA-induced adhesion of primary T cells was also inhibited by cytochalasin D treatment. In contrast, treatment of the EL4 murine T cell lymphoma cell line with a low dose of cytochalasin D resulted in an increase in adhesion, while a high dose impaired adhesion. This is consistent with previous findings using EBV transformed B cells16. It is unclear why low dose cytochalasin D inhibits adhesion of CTLs and primary T cells while it enhances adhesion of cell lines. It may be due to differences in the interaction between LFA-1 and the actin cytoskeleton. It should also be noted that cytochalasin D treatment, even at high concentrations, had no effect on antibodymediated LFA-1 capping on CTLs or the distribution of LFA-1 on the cell surface (data not shown). This suggests that, in CTLs, cytochalasin does not release LFA-1 from constitutive association with actin, and instead may be impairing actin accumulation required for firm cellular adhesion. Visualization by microscopy of cytochalasin D treated CTLs bound to an ICAM-1 coated surface shows a distinct difference in cellular morphology, with untreated cells appearing flat and spread, and treated cells appearing rounder, with fewer cellular projections. This difference in appearance also suggests that actin may be required for cells to firmly adhere to ICAM-1. These results, combined with the confocal microscopy results, suggest that the actin  67  accumulation that occurs following binding of LFA-1 to ICAM-1, but not anti-LFA-1 crosslinking, is required for adhesion of T cells to ICAM-1 coated surfaces. We are currently investigating whether recruitment of actin following binding to ICAM-1 is talin- and WASPdependent, and are thus working to elucidate an important pathway in immune synapse formation that appears to be dependent upon outside-in integrin signaling.  68  2.5 Bibliography 1. Springer TA, Davignon D, Ho MK, Kurzinger K, Martz E, Sanchez-Madrid F. LFA-1 and Lyt-2,3, molecules associated with T lymphocyte-mediated killing; and Mac-1, an LFA-1 homologue associated with complement receptor function. Immunol Rev. 1982;68:171-195. 2. Dustin ML, Bivona TG, Philips MR. Membranes as messengers in T cell adhesion signaling. Nat Immunol. 2004;5:363-372. 3. Porter JC, Bracke M, Smith A, Davies D, Hogg N. Signaling through integrin LFA-1 leads to filamentous actin polymerization and remodeling, resulting in enhanced T cell adhesion. J Immunol. 2002;168:6330-6335. 4. Marwali MR, MacLeod MA, Muzia DN, Takei F. Lipid rafts mediate association of LFA-1 and CD3 and formation of the immunological synapse of CTL. J Immunol. 2004;173:2960-2967. 5. Somersalo K, Anikeeva N, Sims TN, et al. Cytotoxic T lymphocytes form an antigenindependent ring junction. J Clin Invest. 2004;113:49-57. 6. Tadokoro S, Shattil SJ, Eto K, et al. Talin binding to integrin beta tails: a final common step in integrin activation. Science. 2003;302:103-106. 7. Calderwood DA, Zent R, Grant R, Rees DJ, Hynes RO, Ginsberg MH. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J Biol Chem. 1999;274:28071-28074. 8. Calderwood DA, Yan B, de Pereda JM, et al. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem. 2002;277:21749-21758. 9. Kim M, Carman CV, Springer TA. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science. 2003;301:1720-1725.  69  10. Vinogradova O, Vaynberg J, Kong X, Haas TA, Plow EF, Qin J. Membrane-mediated structural transitions at the cytoplasmic face during integrin activation. Proc Natl Acad Sci U S A. 2004;101:4094-4099. 11. Vinogradova O, Velyvis A, Velyviene A, et al. A structural mechanism of integrin alpha(IIb)beta(3) "inside-out" activation as regulated by its cytoplasmic face. Cell. 2002;110:587-597. 12. Badour K, Zhang J, Shi F, et al. The Wiskott-Aldrich syndrome protein acts downstream of CD2 and the CD2AP and PSTPIP1 adaptors to promote formation of the immunological synapse. Immunity. 2003;18:141-154. 13. Badour K, Zhang J, Siminovitch KA. The Wiskott-Aldrich syndrome protein: forging the link between actin and cell activation. Immunol Rev. 2003;192:98-112. 14. Cannon JL and Burkhardt JK. Differential roles for Wiskott-Aldrich syndrome protein in immune synapse formation and IL-2 production. J Immunol. 2004;173:1658-1662. 15. Orange JS, Ramesh N, Remold-O'Donnell E, et al. Wiskott-Aldrich syndrome protein is required for NK cell cytotoxicity and colocalizes with actin to NK cell-activating immunologic synapses. Proc Natl Acad Sci U S A. 2002;99:11351-11356. 16. Kucik DF, Dustin ML, Miller JM, Brown EJ. Adhesion-activating phorbol ester increases the mobility of leukocyte integrin LFA-1 in cultured lymphocytes. J Clin Invest. 1996;97:21392144. 17. Welder CA, Lee DH, Takei F. Inhibition of cell adhesion by microspheres coated with recombinant soluble intercellular adhesion molecule-1. J Immunol. 1993;150:2203-2210. 18. Marwali MR, Rey-Ladino J, Dreolini L, Shaw D, Takei F. Membrane cholesterol regulates LFA-1 function and lipid raft heterogeneity. Blood. 2003;102:215-222.  70  19. Rodriguez-Fernandez JL, Gomez M, Luque A, Hogg N, Sanchez-Madrid F, Cabanas C. The interaction of activated integrin lymphocyte function-associated antigen 1 with ligand intercellular adhesion molecule 1 induces activation and redistribution of focal adhesion kinase and proline-rich tyrosine kinase 2 in T lymphocytes. Mol Biol Cell. 1999;10:1891-1907. 20. Stinchcombe JC, Bossi G, Booth S, Griffiths GM. The immunological synapse of CTL contains a secretory domain and membrane bridges. Immunity. 2001;15:751-761. 21. Stewart MP, McDowall A, Hogg N. LFA-1-mediated adhesion is regulated by cytoskeletal restraint and by a Ca2+-dependent protease, calpain. J Cell Biol. 1998;140:699-707. 22. Sasahara Y, Rachid R, Byrne MJ, et al. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol Cell. 2002;10:12691281. 23. Sanchez-Martin L, Sanchez-Sanchez N, Gutierrez-Lopez MD, et al. Signaling through the leukocyte integrin LFA-1 in T cells induces a transient activation of Rac-1 that is regulated by Vav and PI3K/Akt-1. J Biol Chem. 2004;279:16194-16205. 24. Miletic AV, Swat M, Fujikawa K, Swat W. Cytoskeletal remodeling in lymphocyte activation. Curr Opin Immunol. 2003;15:261-268. 25. Perez OD, Mitchell D, Jager GC, et al. Leukocyte functional antigen 1 lowers T cell activation thresholds and signaling through cytohesin-1 and Jun-activating binding protein 1. Nat Immunol. 2003;4:1083-1092. 26. Mocsai A, Zhou M, Meng F, Tybulewicz VL, Lowell CA. Syk is required for integrin signaling in neutrophils. Immunity. 2002;16:547-558.  71  27. Mocsai A, Abram CL, Jakus Z, Hu Y, Lanier LL, Lowell CA. Integrin signaling in neutrophils and macrophages uses adaptors containing immunoreceptor tyrosine-based activation motifs. Nat Immunol. 2006;7:1326-1333. 28. Suzuki J, Yamasaki S, Wu J, Koretzky GA, Saito T. The actin cloud induced by LFA-1mediated outside-in signals lowers the threshold for T-cell activation. Blood. 2007;109:168-175.  72  CHAPTER 3  A DUAL ROLE FOR TALIN IN NK CELL CYTOTOXICITY: ACTIVATION OF LFA-1 MEDIATED ADHESION AND POLARIZATION OF NK CELLS  A version of this chapter has been published as: Mace EM, Monkley SJ, Critchley DR, Takei F. A dual role for talin in NK cell cytotoxicity: activation of LFA-1-mediated cell adhesion and polarization of NK cells. Journal of Immunology 2009 Jan 15; 182(2):948-56.  73  3.1 Introduction NK cells kill virus-infected cells and tumor cells without prior immunization. Killing of target cells by NK cells is a multi-step process. The first step is the binding of NK cells to target cells, which is mediated by cell adhesion molecules. This is followed by polarization of NK cells, translocation of cytotoxic granules toward the target cells, and finally the release of perforin and granzymes contained in the cytotoxic granules towards the bound target cells. The leukocyte integrin LFA-1 (L2 integrin, CD11a/CD18) plays an essential role in natural cytotoxicity of NK cells as it mediates binding of NK cells to target cells. NK cells from LFA-1deficient mice are unable to kill target cells due to impaired conjugate formation1. Blocking antibodies to LFA-1 also inhibit NK cell cytotoxicity by inhibiting NK cell binding to target cells2,3. While the importance of LFA-1 in NK cell-target cell adhesion has been well established, recent studies have suggested that LFA-1 may also play a role in signaling events initiated by binding to its primary ligand, ICAM-1. In T cells, LFA-1 acts as a co-stimulatory molecule by lowering the threshold for TCR-mediated signals required for T cell activation. Engagement of LFA-1 in the absence of TCR signals results in the formation of an “actin cloud”, in which actin, LFA-1 and tyrosine phosphorylated proteins are found in a ring at the contact site between a T cell and an antigen presenting cell4. In NK cells, LFA-1 has been implicated in a number of signaling processes associated with cytotoxicity. These include granule polarization5, Vav1 phosphorylation6 and Pyk2 phosphorylation7. However, the mechanism by which LFA-1 transduces signals leading to these events remains unclear. NKG2D is one of the best characterized activating receptors on NK cells and is thought to be responsible for the killing by NK cells of tumor cells and virus-infected cells, which often express NKG2D ligands, including RAE1, MULT and H60 in mice8-11. In mice, NKG2D  74  associates with both DAP10 and the ITAM-bearing DAP12 adaptors. ITAM-coupled receptor signaling in NK cells is similar to that of the B cell or T cell receptor, as Src family kinases, Syk and ZAP-70 mediate signals that converge on downstream targets such as the MEK/ERK pathway, Akt, and NF-κB. While many NKG2D signaling intermediates that lead to NK cell activation have been identified, NKG2D ligation alone seems insufficient for the degranulation of NK cells and efficient cytotoxicity requires co-stimulatory signals12. Thus, the exact mechanisms by which NKG2D promotes NK cell cytotoxicity still remain to be elucidated. Talin is a large (~270 kDa) cytoskeletal adaptor protein that is a ubiquitous component of focal adhesion complexes of adherent cells13. Talin has an N-terminal globular head with a Band 4.1 ezrin radixin moesin (FERM) domain containing a binding site for the cytoplasmic tails of integrin -chains14 and an actin binding site15. It also contains binding sites for focal adhesion kinase (FAK) and the type 1  isoform of the phosphoinositide 4, 5-kinase16-18. The C-terminal talin rod contains a second integrin binding site19, at least two actin binding sites15 and multiple binding sites for vinculin, which itself binds actin20,21. Talin is thought to be critical for the activation of integrins. Binding of the talin FERM domain to the cytoplasmic tail of the  integrin subunit induces separation of the tails of the two integrin chains which results in a rapid transition to a high affinity conformation22,23. Thus, over-expression of talin head activates LFA122. In resting lymphocytes, talin is mostly found in the cytosol and is thought to be in an inactive form due to a head-tail interaction. Upon cell activation, talin is thought to be released from the self-inhibited state, bind to the cytoplasmic tails of integrins and induce their conformational changes by separating the two chains24. Recent studies using selective deletion of talin1 in hematopoeitic cells show that talin1 is required for the activation of β1 and β3 integrins in platelets. In addition, talin1 is required for αIIbβ3 integrin-mediated cell spreading25. Thus, talin  75  appears able to transduce signals resulting in integrin activation as well as those induced by integrin ligand occupancy. In the immune synapse formed between an NK cell and a sensitive target (often termed a “cytolytic immune synapse”), LFA-1, talin and actin form a ring that provides stability to the immune synapse and acts as the scaffold for the assembly of specialized signaling complexes26. In addition, this ring may act as a guide for the delivery of cytotoxic granules to be delivered in a lethal hit to the target26. The signals that cause the accumulation of actin and talin in the immune synapse with LFA-1 are not known. Polarization of the microtubule organization centre (MTOC)2 towards the target is also required for cytotoxicity, and this polarization is followed by the accumulation of cytotoxic granules at the immune synapse26. Both the MTOC and granules are found to accumulate in the centre of the LFA-1-talin-actin ring, and it has been observed in cytotoxic T lymphocytes that microtubules are anchored in the LFA-1 ring27. In order to determine the role that talin plays in LFA-1-mediated NK cell functions, we generated talin1-knockout (KO) NK cells from Tln1 embryonic stem (ES) cells in vitro. Our analyses of talin1-KO NK cells suggest that talin plays a dual role. Initially it is required for LFA-1-mediated cell adhesion presumably by inside-out activation of LFA-1 conformation. Talin1 is then also required for outside-in signaling via ligand-bound LFA-1 resulting in the reorganization of the actin-cytoskeleton and NK cell polarization, both of which are essential for NK cell cytotoxicity. Our results also clarify the role of LFA-1 in NK cell cytotoxicity. Binding of ICAM-1 to LFA-1 mediates initial binding of NK cells to target cells. It also induces reorganization of the actin cytoskeleton, but not polarization of cytotoxic granules. While cytotoxic granule polarization can be induced by co-ligation of the activating receptor NKG2D,  76  reorganization of the actin cytoskeleton mediated by LFA-1 is a talin1-dependent process, and is required for granule polarization.  3.2 Materials and methods A detailed version of all methodologies can be found in the Appendix.  3.2.1 Mice, antibodies, reagents and flow cytometry C57BL/6 mice were bred in the BC Cancer Research Centre Animal Research Centre. All animal use was approved by the animal care committee of the University of British Columbia, and animals were maintained and euthanized under humane conditions in accordance with the guidelines of the Canadian Council on Animal Care. Tln1 ES cells and WT ES cells have been described28. OP9 stromal cells were from RIKEN (Tokyo, Japan). L cells and ICAM-1transfected L cells have been described29. Anti-CD44 mAb was a gift from Dr. Pauline Johnson (Vancouver, Canada). YAC-1 cells, the mouse anti H-2Kk hybridoma (16-3-22S) and rat antimurine LFA-1 hybridoma (TIB213) were from American Type Culture Collection (ATCC, Rockland, MD). 2.4G2 (anti-FcR) has been described30. Biotinylated anti-CD34 (RAM34) mAb was purchased from eBioscience. FITC-conjugated anti-NKG2D and PE-conjugated streptavidin were purchased from BD Biosciences. Anti-talin mAb (8D4) was from Sigma. Anti-ß tubulin mAb (KMX-1) was from Chemicon International. Anti phospho-Pyk2 (Tyr402) mAb (RR102) and anti-phosphotyrosine (4G10) were from Upstate. Anti Pyk2 (N-19) was from Santa Cruz Biotechnology. Polyclonal anti-granzyme B (ab4059) was from Abcam. Rhodamine-conjugated phalloidin, Alexa 647 phalloidin, Alexa 488-conjugated goat anti-mouse IgG, Alexa 568conjugated donkey anti-rabbit IgG and rabbit anti-goat IgG were purchased from Invitrogen 77  Molecular Probes. CFSE was purchased from Invitrogen Molecular Probes. Murine recombinant soluble ICAM-131 was from StemCell Technologies. Manganese chloride solution was from MJS Biolynx. Polystyrene beads were from Polysciences. For flow cytometry, cells were first preincubated with 2.4G2 supernatant followed by primary mAbs. All incubations were performed at 4° for at least 30 min and stained cells were subsequently analyzed on a FACSCaliber (BD Biosciences). Flow cytometry results were analyzed using WinMDI. Cell sorting was carried out on a FacsVantage SE (BD Biosciences).  3.2.2 Generation of ES-derived NK cells Generation of NK cells from ES cells has been described 32,33.  3.2.3 NK cell culture CD49b+ splenocytes were isolated from 6-8 week old C57BL/6 mice using EasySep® panNK positive selection kit (StemCell Technologies). Cells were cultured for 7 days in RPMI 1640 media supplemented with 10% FBS, penicillin, streptomycin, 5 × 10-5 M 2-mercaptoethanol (StemCell Technologies) and 100 g/ml IL-2 (Peprotech). Flow cytometric analysis confirmed that >95% of cells generated this way were NK1.1+CD3-.  3.2.4 RT-PCR RNA from ES cells or ES-derived NK cells was isolated with QIAGEN's RNeasy® Mini Kit and reverse transcribed into cDNA using QIAGEN's Omniscript Reverse Transcription kit. Primer sequences were as follows: talin1 FERM domain (forward) 5’ TTGTGGGCAGATGAGTGAAA  78  3’, (reverse) 5’ TAGGTGTGCGTAGTGTGTG 3’, talin2 FERM domain (forward) 5’ GCCGAGAAGCGAATATTTCA 3’ (reverse) 5’CACTCTCCGGTGAGGACTTC 3’.  3.2.5 H60-Fc and CD160-Fc fusion proteins CD160-Fc fusion protein has been described34. H60 cDNA was generated by RT-PCR using RNA isolated from BALB/c mouse splenocytes, subcloned into pBluescript and sequenced. The cDNA encoding the extracellular domain of H60 was PCR-amplified, sequenced and subcloned into the pIG vector35. H60-Fc fusion protein was produced and purified as described for CD160Fc fusion protein34.  3.2.6 Cell adhesion assay LFA-1–mediated cell adhesion to immobilized soluble ICAM-1 was assayed as described31. For adhesion of NK cells to YAC-1 cells, microwells were coated with 0.005% poly-L-lysine (PLL, Sigma) for 1 h at room temperature, then washed with PBS. YAC-1 cells (105 per well) were dispensed into PLL-coated wells, centrifuged at 1500 rpm for 5 min, and unbound cells were washed away. This generated confluent monolayer of YAC-1 cells. The binding of NK cells to YAC-1 cell monolayer was tested as described for adhesion to ICAM-1-coated plates.  3.2.7 Cytotoxicity assays YAC-1 target cells were labeled with Vybrant CFDA SE Cell Tracer kit (Invitrogen Molecular Probes). CFSE labeled YAC-1 (104) cells were mixed at varying ratios with NK cells in RPMI 1640 10% FBS. When talin-KO NK cells were used as effectors, MnCl2 was added to a final concentration of 1 mM after mixing of effectors and targets. After 4 h, cells were washed and 79  stained with 5 g/ml propidium iodide and analyzed by flow cytometry. The level of cytotoxicity was determined as the number of CFSE+ cells stained with propidium iodide minus the background level (as determined by target cells incubated without effectors). For cytotoxicity of L cells, target cells were trypsinized, harvested, labeled with Calcein-AM (Invitrogen Molecular Probes), resuspended in DMEM + 5% FBS with penicillin and streptomycin, plated in 96 well plates at 104 per well and grown overnight as a monolayer. The following day targets were counted and NK cells were added at various ratios. Where appropriate, target cells were preincubated with anti H2K antibody for 10 minutes prior to the addition of NK cells. Where appropriate, NK cells were pre-incubated with anti-CD44 antibody prior to their addition to target cells. After 4 h, cells were washed and fluorescence was measured by CytoFluor 2300 (Millipore). Specific cell lysis was calculated as a ratio of fluorescence of remaining targets to fluorescence of targets incubated without effectors (minus background).  3.2.8 Pyk2 immunoprecipitation and western blotting Polystyrene 60 mm Petri dishes (BD Falcon) were coated with 10 μg/ml ICAM-1 in Adhesion Buffer (20 mM Tris-HCl, 150 mM NaCl pH 8.2) for 1h at room temperature. Coated plates were washed three times with PBS before use. NK cells were harvested, resuspended in pre-warmed RPMI 1640 10% FCS at 7 × 106 cells/ml, and 0.5 ml of cell suspension was added to each plate. After cells were allowed to settle, 0.5 ml of pre-warmed media with or without 2 mM MnCl2 was added to each plate and plates were incubated at 37ºC for 20 minutes, washed twice with 1 ml of pre-warmed RPMI 1640 10% FCS, then cells were lysed with 1 ml of ice cold lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM KCl, 1 mM EDTA pH 8.0, 1% Triton X-100, 0.5% BSA, 1 mM Na3VO4, 1 mM PMSF, 5 μg/ml aprotinin, 10 μg/ml leupeptin and 10 μg/ml pepstatin). For  80  control samples, 3.5 million NK cells were lysed in a microfuge tube. Control samples corresponding to cells bound to ICAM-1 in the presence of Mn++ were lysed in the presence of 1 mM MnCl2. Immunoprecipitation was carried out as described previously34.  3.2.9 Confocal microscopy Polystyrene beads were coated with 20 ug/ml sICAM-1, 20 ug/ml H60-Fc or 0.005% PLL, spun down and blocked in 200 g/ml BSA, then washed and resuspended in RPMI 10% FBS. NK cells were harvested and resuspended in RPMI1640+ 10% FBS. 105 beads and 2.5 × 105 cells were gently mixed in an Eppendorf tube and, where appropriate, MnCl2 was added to a final concentration of 1 mM. After 5 min, cell-bead conjugates were gently resuspended, dropped onto poly-L-lysine coated coverslips and incubated for varying time-points. Coverslips were fixed with 4% formaldehyde, and samples were permeabilized with Hank’s Saponin solution (HBSS containing 2% FBS, 5 mM EDTA, 0.5% Saponin). Actin was detected by staining samples fixed on coverslips in a 1:40 dilution of rhodamine phalloidin or Alexa 647 phalloidin in Hank’s Saponin solution. Talin, phospho-Pyk2 and granzyme B were stained by incubating samples fixed on coverslips for 1 h in a 1:40 dilution in Hank’s Saponin Solution of the corresponding primary antibody. Coverslips were washed 3 times with Hank’s Saponin Solution and then stained at room temperature for 1 h with 10 g/ml of Alexa 488- conjugated goat anti-mouse IgG antibody for talin and phospho-Pyk2 or Alexa 568- conjugated donkey anti-rabbit IgG antibody for granzyme B. Coverslips were washed 3 times with Hanks Saponin Solution and once with HBSS, then mounted with Vectashield mounting medium (Vector Laboratories). Actin-stained cell-bead conjugates were analyzed using a Leica TCS2 confocal system with a 100× objective lens, zoom 4. All other cell-bead conjugates were analyzed using a Nikon C1-si confocal 81  microscope with a 100× objective lens, zoom 4. Images were collected using sequential scanning to avoid bleed-through. Images were processed and merged using Volocity software (Improvision) and exported as JPG files. For quantification of fluorescent intensity at the site of binding, the sum intensity in the channel of interest was determined using Volocity software for the area of contact between a cell and a bead and compared to the sum fluorescent intensity of the whole same cell using the following equation: [sum intensity (contact site)/sum intensity (whole cell)] ×100. For the comparison of phospho Pyk2 intensity, fluorescent intensity of unbound cells and cells bound to beads was determined using Volocity software. All images used for this analysis were collected from the same experiment using the same instrument settings. The average fluorescent intensity of unbound WT cells was normalized to 1 and all other values are expressed relative to this.  3.2.10 Statistics Student's two-tailed t-test was used for comparison of sets of matched samples. Grouped samples were analyzed using one-way ANOVA analysis.  3.3 Results 3.3.1 In vitro generation of NK cells from talin1-deficient ES cells As homozygous Tln1 KO in mice results in embryonic lethality36, we generated NK cells from Tln1/ ES cells (clone A28) and the corresponding wild type (WT) ES cells (clone HM1) by in vitro differentiation cultures as described32,33. As reported previously28, the two ES cell lines exhibited different morphologies. WT ES cells attached firmly to gelatin-coated plates, flattened and spread, whereas talin-KO ES cells did not spread and appeared rounded (Fig. 3.1 A). Flow 82  cytometric analysis showed that NK cells generated from WT and talin-KO ES cells expressed similar levels of LFA-1 and the NK cell receptor NKG2D (Fig. 3.1 B). The level of LFA-1 on ES-derived NK cells was significantly higher than that of IL-2-stimulated splenic NK cells whereas the level of NKG2D was comparable. A second talin gene, Talin2, has been identified in mice37. While its function is still unknown, the sequence of Talin2 is very similar to that of Talin1, and the talin2 protein is predicted to have a similar function to talin1, with the FERM domain and actin- and integrinbinding sites being conserved between the two37. While talin1 mRNA is widely expressed in various tissues, the expression of talin2 mRNA is more restricted and is undetectable in hematopoietic cells37. RT-PCR analysis of WT and talin1-KO ES cells as well as NK cells  A  B  C WT  WT ES  KO  LAK  WT ES  LFA-1  NK  KO ES  NK  Talin1 (169)  KO ES  Talin2 (239)  NKG2D  GAPDH (192)  Fluorescence intensity  Figure 3.1. Expression of LFA-1, NKG2D, talin1 and talin2 in ES cells and ES-derived NK cells. (A) WT and talin-KO ES cells were grown for two days on gelatinized flasks in the presence of LIF and their morphologies were examined by a phase contrast microscope. (B) NK cells generated from WT and talin-KO ES cells as well as IL-2 activated splenic NK cells were stained with mAbs to LFA-1 and NKG2D and analyzed by FACS. Grey histograms show staining with isotype-matched control antibody and open histograms show staining with antiLFA-1 or anti-NKG2D. Results shown are representative of three independent experiments. (C) RNA was isolated from WT and talin-KO ES cells and NK cells generated from the ES cells, and expression of talin1 and talin2 mRNA was determined by RT-PCR using primers specific for the FERM domain of talin1 or talin2.  83  derived from them using primers specific for the FERM domains of talin1 and talin2 showed that talin-KO ES cells and NK cells generated from them did not express talin1 mRNA. Talin2 mRNA was detectable in both WT and talin-KO ES cells but not in ES-derived NK cells (Fig. 3.1 C). Therefore, it is unlikely that talin2 will be able to compensate functionally for talin1deficiency in NK cells, and hence these cells are referred to subsequently as talin-KO NK cells.  3.3.2 Talin is required for LFA-1-mediated cell adhesion To test the effect of talin-deficiency on LFA-1-mediated cell adhesion, binding of NK cells generated from WT and talin-KO ES cells was tested using microwells coated with increasing concentrations of recombinant soluble ICAM-1. WT NK cells without prior activation adhered to immobilized ICAM-1 in a dose-dependent manner, and anti-LFA-1 antibody abrogated the binding, confirming that cell adhesion to ICAM-1 is mediated by LFA-1. In addition, cells showed little or no (< 1%) non-specific adhesion to BSA (Fig. 3.2, top panel). In contrast, the level of adhesion of talin-KO NK cells to ICAM-1 at any concentration tested was not significantly higher than that of non-specific adhesion to BSA, and anti-LFA-1 had no effect, indicating that LFA-1-mediated adhesion of talin-KO NK cells is severely impaired. Manganese is known to bind to the extracellular domain of LFA-1 and locks it in a conformation with maximal affinity for its ligand independent of inside-out signaling38,39.  84  40 Mn++  30  % cell adhesion  20 10 0 60 50  +Mn++  40 30 20 10 0 40  20  10  5  2.5 BSA Ab  ICAM-1 (g/ml) Figure 3.2. Adhesion to immobilized ICAM-1. WT NK cells (white bars) or talin-KO NK cells (black bars) were incubated without (top panel) or with (bottom panel) 1 mM Mn++. Cells were incubated on varying concentrations of immobilized soluble ICAM-1 as described in Materials in Methods. For control adhesion, BSA was immobilized in place of ICAM-1. For specificity control, cells were incubated with anti-LFA-1 blocking antibody. Results shown are representative of three independent experiments, each done in triplicate. Error bars indicate SEM. Therefore, we tested the adhesion of ES-derived NK cells to ICAM-1 in the presence of 1mM Mn++. Treatment of WT NK cells with 1 mM Mn++ significantly increased their adhesion to ICAM-1 (Fig. 3.2, bottom panel). Talin-KO NK cells also adhered to ICAM-1 in the presence of 1 mM Mn++ although the level of adhesion was significantly lower than that of WT NK cells treated or not with Mn++. Thus, Mn++ seems to activate LFA-1 on talin-KO NK cells, but it does not fully compensate for talin deficiency in LFA-1-mediated cell adhesion to purified and immobilized ICAM-1.  85  3.3.3 Talin-KO NK cells are unable to mediate cytotoxicity against conventional targets but are able to kill fibroblasts To test the effects of talin deficiency on NK cell cytotoxicity, we first tested whether talin-KO NK cells bind to YAC-1 cells in the presence or not of 1 mM Mn++. YAC-1 cells were immobilized in PLL-coated microwells, and NK cells labeled with Calcein-AM were incubated with targets. WT NK cells bound to YAC-1 cells in the absence of Mn++, and 1 mM Mn++ enhanced the binding. Talin-KO NK cells did not efficiently bind to YAC-1 without Mn++, but they bound to YAC-1 cells to the similar level to WT cells in the presence of 1 mM Mn++ (Fig. 3.3A). It should be noted that YAC-1 cells expressed LFA-1 and NK cells expressed ICAM-1, which likely contributed to the formation of cell aggregates. As expected from the results with conjugate formation, WT NK cells killed YAC-1 cells whereas talin-KO NK cells did not kill YAC-1 in the absence of Mn++. Upon addition of Mn++, the killing of YAC-1 by WT NK cells was slightly enhanced whereas talin-KO NK cells did not significantly kill YAC-1 despite efficient binding to YAC-1 cells (Fig. 3.3B). To further test the effects of talin-deficiency on NK cell cytotoxicity, the murine fibroblast line L cells, which do not express ICAM-1, and ICAM-1-transfected L cells (L-IC1)29 were used as target cells. Unexpectedly, talin-KO NK cells efficiently killed L cells in the absence of exogenous Mn++. ICAM-1 expression on L cells enhanced the cytotoxicity (Fig. 3.3C). In addition, WT cells were able to mediate cytotoxicity against untransfected L cells. The cytotoxicity of talin-KO NK cells against both L cells and L-IC1 cells was slightly lower than that of WT NK cells. These results suggest that killing of L cells is mediated by both talindependent and talin-independent mechanisms.  86  % binding  A 80 70 60 50 40 30 20 10 0 KO+ Mn  B % killing  20  10  10 0  10  2.5  0.625  % killing  10  60  40  40  20  20 2.5  0  0.625  60  60  40  40  20  20  0  0 10  2.5  0.625  E 100  10  60  40  40  20  20  0.625  2.5  0.625  L-IC1  80  60  0  2.5  KO  100  L  80  10  80  WT  0.625  L-IC1  80  60  10  2.5  100  L  80  80  % killing  +Mn++  30  0  % killing  WT  40  20  100  D  WT+ Mn  Mn++  30  0  C  KO  0 10  2.5  0.625  10  2.5  0.625  Figure 3.3. Cytotoxicity of WT and talin KO NK cells against YAC-1 and fibroblast targets. (A) WT or talin-KO NK cells were labeled with Calcein-AM and binding to monolayers of YAC-1 cells was tested in the presence (white bars) or absence (black bars) of 1 mM Mn++. The percentages of NK cells bound to YAC-1 monolayers were determined as in Fig. 4.2. Error bars indicate SEM. (B) Cytotoxicity against YAC-1 target cells was analyzed by FACS. YAC-1 targets were labeled with CFDA-SE and incubated for 4 hours with talin-KO (dashed line) or WT (solid line) NK cells. Following incubation, cells were washed and analyzed by flow cytometer 87  as described in Materials and Methods. Error bars indicate SEM. (C) L cell fibroblasts (left panel) or ICAM-1 transfected L cells (right panel) were labeled with Calcein-AM and grown in a monolayer overnight. Talin-KO (dashed line) or WT (solid line) were incubated for 4 h with L or L (ICAM-1) cells. Fluorescence was read and specific cell lysis was determined as described in Materials and Methods. Error bars indicate SEM. (D) L cells were labeled with Calcein-AM and grown in a monolayer overnight. WT (left panel) or talin-KO (right panel) NK cells were treated with (dashed line) or without (solid line) anti-CD44 blocking antibody then incubated for 4 hours with target cells. Fluorescence was read and specific lysis was determined as described. Error bars indicate SEM. (E) L cell fibroblasts (left panel) or ICAM-1 transfected L cells (right panel) were labeled with Calcein-AM and grown in a monolayer overnight. Talin-KO cells were incubated for 4 h with L or L (ICAM-1) cells following incubation of target cells with (dashed line) or without (solid line) anti-H2K antibody to induce antibody-mediated cellular cytotoxicity. Fluorescence was read and specific cell lysis was determined as described. Error bars indicate SEM. Since CD44 has been shown to contribute to NK cell cytotoxicity1, we tested the effects of antiCD44 mAb on the cytotoxocity against L cells. Anti-CD44 mAb significantly reduced the cytotoxicity of both WT and talin-KO NK cells against L cells (Fig. 3.3D). These results indicate that talin-KO NK cells are able to kill L cells by a CD44-dependent mechanism. The incomplete inhibition by anti-CD44 mAb suggests that other receptors may also mediate killing of L cells. We also tested the effect of talin-deficiency on CD16-mediated antibody-dependent cellmediated cytotoxicity. As L cells uniformly express the MHC class I H-2Kk, they were coated with anti-H-2Kk mAb prior to incubation with effector cells. Both WT and talin-KO NK cells killed L cells very efficiently, and the expression of ICAM-1 on L cells did not enhance the cytotoxicity (Fig 3.3E). Thus, talin-KO NK cells are capable of killing target cells by LFA-1independent mechanisms.  88  3.3.4 Binding of NK cells to ICAM-1-coated beads results in recruitment of talin and Pyk2 phosphorylation While the above results showed that talin is required for LFA-1-mediated NK cell adhesion, talin may have an additional role in NK cell cytotoxicity, because talin-KO NK cells are unable to kill YAC-1 even when they efficiently form conjugates in the presence of Mn++. To further study the effects of talin-deficiency in NK cell activation, we used cell-size polystyrene beads coated with ICAM-1 as an artificial target, which allowed us to study LFA-1-mediated outside-in signaling in NK cells independent of other NK cell receptors. Flow cytometric analysis showed that the density of ICAM-1 on the coated beads in this study was comparable to that of mouse lymphoid tumor cell lines (data not shown). As a negative control, we also prepared PLL-coated beads. Both ICAM-1-coated beads and control beads readily bound to WT NK cells. Bead-NK cell conjugates were fixed, permeabilized, stained for talin and analyzed by confocal microscopy. In WT NK cells binding control beads, talin was distributed throughout the cytosol, with 16.8  3% (mean  SEM; n=18) of talin found at the site of contact, whereas 50.4  2.4% (n=18) of talin accumulated at the point of contact with an ICAM-1-coated bead (Fig. 3.4A, B). Talin-KO NK cells were not stained with anti-talin mAb, confirming the specificity of the staining. Thus, binding of ICAM-1 to LFA-1 seems to induce translocation of talin from the cytosol to the site of LFA-1 ligation. LFA-1 ligation has been shown to rapidly induce phosphorylation of the protein tyrosine kinase Pyk2 although the precise role of Pyk2 in NK cell activation is still unclear7,40. When we stained ES-derived NK cells with an anti-phospho-Pyk2 antibody that specifically recognizes activated Pyk2 phosphorylated at Tyr40241,42, the level of phospho-Pyk2 in both WT and talin-KO NK cells was low (Fig. 3.4C, D). Upon binding of ICAM-1-coated beads to WT NK cells, the overall level of phospho-Pyk2 increased two fold  89  WT IC-1  A  WT PLL  KO No bead  B  % f luorescence at contact site  60  Talin  DIC/ talin merge  40  20  0  PLL bead  ICAM-1 bead WT no bead  C  WT PLL bead  WT ICAM-1 bead  KO ICAM-1 bead  PhosphoPyk2  E  4  2 1  20 10  % f luorescence at contact site  3  0  F 30  % f luorescence at contact site  D  Relative f luorescent intensity  DIC/ PhosphoPyk2 merge  0  1  2  3  4  5  p-Tyr  Pyk2  WT KO  WT KO WT WT KO PLL Unbound bead ICAM-1 bead  Figure 3.4. Binding of LFA-1 to ICAM-1 induces accumulation of talin and phosphorylation and localization of Pyk2. (A) WT NK cells (left two panels) were incubated with beads then fixed, permeabilized and stained at 20° with anti-talin mAb and Alexa 488 secondary antibody. Staining of talin-KO cells with anti-talin antibody confirmed a lack of talin expression (right panel); n = 18 per condition. (B) Fluorescent intensity of talin staining at the contact site between a WT cell and an ICAM-1 coated bead (black bar) or a PLL-coated bead (white bar) was expressed as a percentage of total fluorescent intensity of talin staining within the cell. Error bars represent SEM. (C) WT (left three panels) or talin-KO (right panel) NK cells were incubated with beads then fixed, permeabilized and stained with anti-phospho Pyk2 mAb. (D) Fluorescence intensity of phospho-Pyk2 staining was measured for WT (black bars) and talin-KO (white bars) cells unbound to beads and normalized to 1, then compared to fluorescent intensity of cells bound to ICAM-1 coated beads. Error bars indicate SEM. (E) Fluorescent intensity of phospho-Pyk2 staining at the contact site between a WT (black bar) and a talin-KO (white bar) cell and an ICAM-1 coated bead was expressed as a percentage of total fluorescent intensity of phospho-Pyk2 staining within the cell. Error bars represent SEM. (F) WT (lanes 1-3) and talin-KO NK cells (lanes 4- 5) were allowed to bind to polystyrene Petri dishes coated with soluble ICAM-1 in the presence (lanes 3-5) or absence (lanes 1,2) of 1 mM Mn++. Control samples not incubated on plates (lanes 1, 4) were lysed in a microfuge tube with ice cold lysis buffer. Pyk2 was immunoprecipitated. Immunoprecipitated samples were divided in half and analyzed for Pyk-2 (loading control) and phospho-tyrosine by immunoblotting using anti-Pyk-2 and anti-phosphotyrosine (4G10) primary Abs, respectively. 90  (Fig. 3.4D) and over 20% of the staining localized to the site of bead-binding in 72% (n=30) of the conjugates (Fig. 3.4E). Binding of WT cells to a PLL-coated bead did not result in this localization. Talin-KO NK cells, upon treatment with 1 mM Mn++, bound the beads and showed similar increase in the overall level of phospho-Pyk2 as WT NK cells (Fig. 3.4D, E). PhosphoPyk2 also accumulated at the site of contact with the bead in 70% of the conjugates (n=30). To further quantitate Pyk2 phosphorylation following binding to ICAM-1, WT and talin-KO NK cells (in the presence of 1 mM Mn++) were incubated on ICAM-1 coated plates. Pyk2 was immunoprecipitated, and phosphorylation was detected by western blotting (Fig. 3.4F). Pyk2 phosphorylation increased in both WT and talin-KO cells relative to control cells that had not been bound to plates. Mn++ did not affect Pyk2 phosphorylation in WT cells. Thus, LFA-1 ligation generates outside-in signals leading to Pyk2 phosphorylation at the site of LFA-1 ligation, and this process is talin-independent. In addition, the phosphorylation and localization of Pyk2 following binding of talin-KO cells to ICAM-1 coated beads indicates that binding of these cells in the presence of Mn++ is LFA-1 dependent and not due to non-specific interactions.  3.3.5 Talin is required for actin accumulation in NK cells binding to ICAM-1-coated beads We tested the effect of talin disruption on actin accumulation in NK cells binding ICAM-1coated beads. WT NK cells, upon binding ICAM-1-coated beads, flattened and formed a lamellapodia-like structure, which wrapped around the bead, and F-actin accumulated at the lamellapodia-like structure (Fig. 3.5A, bottom panel). The actin accumulation was seen as early as 5 minutes after the initiation of the incubation and persisted for over 30 minutes. Although talin-KO NK cells pre-treated with 1 mM Mn++ readily bound ICAM-1-coated beads, they remained round, with F-actin evenly distributed around the edge of the cell. Longer incubation  91  WT  A  KO  Actin  Merge  % f luorescence at contact site  B  50 40 30 20 10 0 WT  KO  C  F-actin staining WT  D  KO  Granzyme B  Merge  Figure 3.5. Engagement of LFA-1 to ICAM-1 results in talin-dependent actin accumulation, but not accumulation of cytotoxic granules. (A) WT (left panel) or talin-KO (right panel) NK cells were incubated with ICAM-1 coated beads. Cells were fixed with formaldehyde, permeabilized and stained at 20° with rhodamine phalloidin. (B) Fluorescent intensity of actin staining at the contact site between a wild type cell (black bar) or a talin-KO cell (white bar) was expressed as a percentage of total fluorescent intensity of actin staining within the cell. Error bars represent SEM; n = 22 (WT) and 28 (KO); p = <0.0001. (C) WT (solid line) or talin-KO (grey histogram) NK cells were stained with phalloidin Alexa 647 and analysed by FACS to determine total F-actin content. Histograms of unstained control cells are also shown. (D) WT (bottom panel) or talin-KO (top panel) NK cells were incubated with ICAM-1 coated beads (talin-KO cells were incubated in the presence of 1 mM Mn++ to facilitate binding to beads). Cells were fixed with formaldehyde, permeabilized and stained with anti-granzyme B mAb.  92  times did not result in actin accumulation in talin-KO NK cells (results not shown). In WT NK cells, more than 40% of F-actin could be found at the contact site (42.9  3%, n=22). Talin-KO NK cells showed significantly less actin, approximately 15% of total actin (13.9  0.9%, n=28), at the contact site (Fig. 3.5B). This difference in fluorescence intensity likely reflects both a decrease in accumulation, and, to a certain extent, decreased contact area at the contact site due to the rounded phenotype of talin-KO cells. As talin contains multiple binding sites for cortical F-actin, it is conceivable that a talin deficiency may result in lower overall levels of F-actin within talin-KO NK cells. However, comparable levels of F-actin were detected in WT and talinKO by FACS (Fig. 3.5C). While binding of WT cells to an ICAM-1 coated bead caused actin accumulation, staining for granzyme B showed granules dispersed throughout the cell in both WT and KO (with Mn++) NK cells (Fig. 3.5D). Taken together, these results show the importance of LFA-1 signaling in actin accumulation and the critical role that talin plays in this signaling.  3.3.6 NKG2D ligation induces talin-dependent polarization of cytotoxic granules towards targets The stimulatory NK cell receptor NKG2D is known to mediate NK cell cytotoxicity against many tumors. Therefore, we tested the effects of NKG2D ligation on cytotoxic granule translocation in WT and talin-KO NK cells. H60 is a ligand for NKG2D8. We generated H60-Fc fusion protein and immobilized it on cell-size beads to ligate NKG2D. An unrelated Fc fusion protein, CD160-Fc34, was used as a negative control. Beads were coated with ICAM-1 and H60Fc (20 g/ml each). Binding of ICAM-1/H60-Fc beads to WT NK cells resulted in a marked accumulation of granzyme B at the point of contact with the bead. As expected, F-actin 93  A  DIC  Tubulin  Granzyme B  Actin  Merge  WT ICAM-1  KO ICAM-1  WT PLL  WT ICAM-1 + H60  B  % f luorescence intensity at contact site  KO ICAM-1 + H60  40 30 20 10 0  WT ICAM-1 + H60  WT ICAM-1  KO ICAM-1 + H60  KO ICAM-1  Figure 3.6. Co-engagement of LFA-1 and NKG2D results in polarization of actin, cytotoxic granules, and the MTOC. A. WT or talin-KO NK cells were incubated with beads coated with sICAM-1, sICAM-1 and H60-Fc, or PLL. Talin-KO cells were incubated in the presence of 1 mM Mn++ to facilitate binding to beads. Cells were fixed with formaldehyde, permeabilized and stained at 20° with anti-Granzyme B mAb with Alexa 568 secondary antibody, anti-B tubulin mAb with Alexa 488 secondary antibody, and Alexa 647 phalloidin. B. Fluorescent intensity of granzyme B staining at the contact site between a WT cell (black bar) or a talin-KO cell (white bar) was expressed as a percentage of total fluorescent intensity of granzyme B staining within the cell. Error bars represent SEM; n = 8-16 per condition. Images were collected by confocal microscopy and processed as in Fig. 4.  94  accumulated at the site, and the MTOC also polarized towards the beads. Thus, the merged image of NK cells stained for granzymes (red), tubulin (green) and F-actin (blue) showed colocalization of these proteins at the site of bead binding (Fig. 3.6A). In contrast, following binding of ICAM-1/H60-Fc coated beads to talin KO cells in the presence of Mn++, granzyme B was dispersed throughout the cells, MTOC was in a random position, and F-actin remained evenly distributed around the cell periphery. Control beads coated with ICAM-1 and CD160-Fc did not induce granzyme B polarization, indicating that cytotoxic granule polarization induced by H60-Fc is not due to CD16 ligation by the Fc portion of the fusion proteins (data not shown). In order to quantify granule polarization, we measured fluorescence intensity of anti-granzyme B staining at the site of bead binding and compared to overall fluorescence intensity of the cell (Fig. 3.6B). In WT NK cells binding beads coated with ICAM-1 and H60, approximately 30% (27  4.4%, n=7) of the fluorescence intensity of the granzyme B staining was at the point of contact, whereas those cells in contact with ICAM-1 beads had approximately 14% (14.0  1.5%, n=8) of fluorescence intensity at the contact site. With talin-KO NK cells, the fluorescence intensity at the point of contact with bead was low regardless of whether the beads were coated with ICAM-1 alone (13.8  1.1%, n=8) or ICAM-1 and H60 (16.3  2%, n=16). Thus, activating signals from NKG2D causes granzyme polarization in WT cells but this polarization requires talin, presumably because talin-dependent reorganization of the actin cytoskeleton is required for this process.  3.4 Discussion In this study we have generated NK cells from talin1-KO ES cells and studied the role of talin in NK cell cytotoxicity. Our results have shown that the cytotoxicity of talin-KO NK cells is 95  impaired and suggest a dual role for talin. First, talin seems to act as an activator of LFA-1, because talin-KO NK cells are unable to adhere to ICAM-1. Second, talin is also required for LFA-1-induced reorganization of the actin cytoskeleton in NK cells, which is required for polarization of cytotoxic granules towards target cells. Thus, talin is required for not only insideout activation of LFA-1 but also for outside-in signaling through LFA-1 leading to NK cell polarization. Talin has been shown to be required for activation of 1 and 3 integrins22,23. Overexpression of talin head also induces changes in LFA-1 conformation22. Talin knock-down in Jurkat T cells and peripheral blood T cells also showed a requirement for talin in TCR-induced LFA-1 activation43. Thus, activation of LFA-1 by talin is required for effective LFA-1-mediated cell adhesion. However, the addition of exogenous Mn++ to Jurkat cells in which talin is knocked down is unable to rescue the defect in adhesion43. In our study, exogenous Mn++ only partially restores LFA-1-mediated adhesion of talin-KO NK cells. Since the activation of LFA-1 by Mn++ is thought independent of endogenous signaling, it seems likely, although we were unable to confirm this, that effective LFA-1-mediated cell adhesion requires not only high affinity conformation of LFA-1 but also talin-dependent actin accumulation and LFA-1 clustering, as observed for other integrins44,45. While LFA-1-ICAM-1 interaction is sufficient for actin reorganization in NK cells, a second signal is required for granule polarization and reorientation of the MTOC. Co-ligation of LFA-1 and NKG2D induces polarization of cytotoxic granules and MTOC towards the targets. Interestingly, ligation of NKG2D alone has no effect (data not shown). Furthermore talin-KO NK cells do not show polarization of granules and MTOC upon co-ligation of LFA-1 and NKG2D. Therefore, polarization of the actin cytoskeleton is likely required for MTOC and  96  granule polarization. This is consistent with prior studies in which disruption of actin dynamics by inhibitors prevents MTOC reorientation46. Our results also show differential effects of activation signals through LFA-1 and NKG2D in NK cells. LFA-1 signals induce actin reorganization but not granule and MTOC polarization whereas NKG2D signals induce polarization of granules and MTOC, but not actin reorganization. In contrast to our results with ES-derived NK cells and IL-2-activated splenic NK cells (data not shown), Barber et al. showed that LFA-1 ligation on resting human NK cells results in polarization of perforin-containing granules towards a target cell or ICAM-1 coated bead5. The reason for the difference between our results and those of Barber et al. is still unknown. Nevertheless, ligation of LFA-1 leads to reorganization of the actin cytoskeleton in both studies, and our results implicate a critical role for talin in this process. In T cells, LFA-1-ligation has been shown to induce Vav1 phosphorylation, which leads to activation of WASp and Arp2/3 resulting in actin polymerization47. Although LFA-1 ligation also induces phosphorylation and activation of Pyk2, it is unlikely responsible for Vav1 phosphorylation, because our results have shown that Pyk2 phosphorylation is talin-independent whereas reorganization of the actin cytoskeleton requires talin. Talin is known to interact with multiple proteins, including actin and also vinculin, which in turn associates with paxillin48 and -actinin49. Paxillin functions as a scaffold protein and associates with a number of signaling proteins13. Thus, talin likely forms a multi-protein complex as it associates with LFA-1 and recruits signaling proteins yet to be identified that are responsible for reorganization of the actin cytoskeleton. Whereas LFA-1-dependent NK cytotoxicity is impaired by talin-deficiency, NK cells are able to kill fibroblasts L cells in an LFA-1/talin independent manner. CD44 has been reported to  97  compensate for LFA-1-deficiency in NK cytotoxicity, as NK cells from CD44+/+ LFA-1-/- mice retained some cytotoxic function1. As CD44 acts as a link between the plasma membrane and the actin cytoskeleton through members of the ERM family of proteins50, it appears that the compensatory role that CD44 plays is not limited to adhesion but extends to actin reorganization as well. In summary, by utilizing in vitro differentiation to generate talin-KO NK cells and protein-coated beads to investigate these cells, we have shown a dual role for talin. Talin is required both for LFA-1 activation, and LFA-1 mediated actin cytoskeletal rearrangement. This study elucidates talin’s role in LFA-1 function and illustrates the importance of talin for the transduction of LFA-1-mediated early signaling events in NK cell cytotoxicity.  98  3.5 Bibliography 1. Matsumoto G, Nghiem MP, Nozaki N, Schmits R, Penninger JM. Cooperation between CD44 and LFA-1/CD11a adhesion receptors in lymphokine-activated killer cell cytotoxicity. J Immunol. 1998;160:5781-9. 2. Chen BP, Malkovsky M, Hank JA, Sondel PM. Nonrestricted cytotoxicity mediated by interleukin 2-expanded leukocytes is inhibited by anti-LFA-1 monoclonal antibodies (MoAb) but potentiated by anti-CD3 MoAb. Cell Immunol. 1987;110:282-293. 3. Hildreth JE, Gotch FM, Hildreth PD, McMichael AJ. A human lymphocyte-associated antigen involved in cell-mediated lympholysis. Eur J Immunol. 1983;13:202-208. 4. Suzuki J, Yamasaki S, Wu J, Koretzky GA, Saito T. The actin cloud induced by LFA-1mediated outside-in signals lowers the threshold for T-cell activation. Blood. 2007;109:168-175. 5. Barber DF, Faure M, Long EO. LFA-1 contributes an early signal for NK cell cytotoxicity. J Immunol. 2004;173:3653-9. 6. Riteau B, Barber DF, Long EO. Vav1 phosphorylation is induced by beta2 integrin engagement on natural killer cells upstream of actin cytoskeleton and lipid raft reorganization. J Exp Med. 2003;198:469-74. 7. Gismondi A, Jacobelli J, Mainiero F, et al. Cutting edge: functional role for proline-rich tyrosine kinase 2 in NK cell-mediated natural cytotoxicity. J Immunol. 2000;164:2272-6. 8. Malarkannan S, Shih PP, Eden PA, et al. The molecular and functional characterization of a dominant minor H antigen, H60. J Immunol. 1998;161:3501-3509. 9. Carayannopoulos LN, Naidenko OV, Fremont DH, Yokoyama WM. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J Immunol. 2002;169:4079-4083.  99  10. Cerwenka A, Bakker AB, McClanahan T, et al. Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity. 2000;12:721-727. 11. Diefenbach A, Hsia JK, Hsiung MY, Raulet DH. A novel ligand for the NKG2D receptor activates NK cells and macrophages and induces tumor immunity. Eur J Immunol. 2003;33:381391. 12. Bryceson YT, March ME, Ljunggren HG, Long EO. Activation, coactivation, and costimulation of resting human natural killer cells. Immunol Rev. 2006;214:73-91. 13. Critchley DR, Holt MR, Barry ST, Priddle H, Hemmings L, Norman J. Integrin-mediated cell adhesion: the cytoskeletal connection. Biochem Soc Symp. 1999;65:79-99. 14. Garcia-Alvarez B, de Pereda JM, Calderwood DA, et al. Structural determinants of integrin recognition by talin. Mol Cell. 2003;11:49-58. 15. Hemmings L, Rees DJ, Ohanian V, et al. Talin contains three actin-binding sites each of which is adjacent to a vinculin-binding site. J Cell Sci. 1996;109 ( Pt 11):2715-2726. 16. Ling K, Doughman RL, Firestone AJ, Bunce MW, Anderson RA. Type I gamma phosphatidylinositol phosphate kinase targets and regulates focal adhesions. Nature. 2002;420:89-93. 17. Ling K, Doughman RL, Iyer VV, et al. Tyrosine phosphorylation of type Igamma phosphatidylinositol phosphate kinase by Src regulates an integrin-talin switch. J Cell Biol. 2003;163:1339-1349. 18. Di Paolo G, Pellegrini L, Letinic K, et al. Recruitment and regulation of phosphatidylinositol phosphate kinase type 1 gamma by the FERM domain of talin. Nature. 2002;420:85-89.  100  19. Tremuth L, Kreis S, Melchior C, et al. A fluorescence cell biology approach to map the second integrin-binding site of talin to a 130-amino acid sequence within the rod domain. J Biol Chem. 2004;279:22258-22266. 20. Jockusch BM and Rudiger M. Crosstalk between cell adhesion molecules: vinculin as a paradigm for regulation by conformation. Trends Cell Biol. 1996;6:311-315. 21. Bass MD, Smith BJ, Prigent SA, Critchley DR. Talin contains three similar vinculin-binding sites predicted to form an amphipathic helix. Biochem J. 1999;341 ( Pt 2):257-263. 22. Kim M, Carman CV, Springer TA. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science. 2003;301:1720-1725. 23. Tadokoro S, Shattil SJ, Eto K, et al. Talin binding to integrin beta tails: a final common step in integrin activation. Science. 2003;302:103-106. 24. Martel V, Racaud-Sultan C, Dupe S, et al. Conformation, localization, and integrin binding of talin depend on its interaction with phosphoinositides. J Biol Chem. 2001;276:21217-21227. 25. Nieswandt B, Moser M, Pleines I, et al. Loss of talin1 in platelets abrogates integrin activation, platelet aggregation, and thrombus formation in vitro and in vivo. J Exp Med. 2007;204:3113-3118. 26. Vyas YM, Mehta KM, Morgan M, et al. Spatial organization of signal transduction molecules in the NK cell immune synapses during MHC class I-regulated noncytolytic and cytolytic interactions. J Immunol. 2001;167:4358-4367. 27. Kuhn JR and Poenie M. Dynamic polarization of the microtubule cytoskeleton during CTLmediated killing. Immunity. 2002;16:111-121.  101  28. Priddle H, Hemmings L, Monkley S, et al. Disruption of the talin gene compromises focal adhesion assembly in undifferentiated but not differentiated embryonic stem cells. J Cell Biol. 1998;142:1121-1133. 29. Marwali MR, MacLeod MA, Muzia DN, Takei F. Lipid rafts mediate association of LFA-1 and CD3 and formation of the immunological synapse of CTL. J Immunol. 2004;173:2960-2967. 30. Unkeless JC. Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J Exp Med. 1979;150:580-596. 31. Welder CA, Lee DH, Takei F. Inhibition of cell adhesion by microspheres coated with recombinant soluble intercellular adhesion molecule-1. J Immunol. 1993;150:2203-2210. 32. Lian RH, Maeda M, Lohwasser S, et al. Orderly and nonstochastic acquisition of CD94/NKG2 receptors by developing NK cells derived from embryonic stem cells in vitro. J Immunol. 2002;168:4980-4987. 33. Tabatabaei-Zavareh N, Vlasova A, Greenwood CP, Takei F. Characterization of developmental pathway of natural killer cells from embryonic stem cells in vitro. PLoS ONE. 2007;2:e232. 34. Maeda M, Carpenito C, Russell RC, et al. Murine CD160, Ig-like receptor on NK cells and NKT cells, recognizes classical and nonclassical MHC class I and regulates NK cell activation. J Immunol. 2005;175:4426-4432. 35. Ebeling O, Duczmal A, Aigner S, et al. L1 adhesion molecule on human lymphocytes and monocytes: expression and involvement in binding to alpha v beta 3 integrin. Eur J Immunol. 1996;26:2508-2516. 36. Monkley SJ, Zhou XH, Kinston SJ, et al. Disruption of the talin gene arrests mouse development at the gastrulation stage. Dev Dyn. 2000;219:560-574.  102  37. Monkley SJ, Pritchard CA, Critchley DR. Analysis of the mammalian talin2 gene TLN2. Biochem Biophys Res Commun. 2001;286:880-885. 38. Shimizu Y and Mobley JL. Distinct divalent cation requirements for integrin-mediated CD4+ T lymphocyte adhesion to ICAM-1, fibronectin, VCAM-1, and invasin. J Immunol. 1993;151:4106-4115. 39. Gailit J and Ruoslahti E. Regulation of the fibronectin receptor affinity by divalent cations. J Biol Chem. 1988;263:12927-12932. 40. Rodriguez-Fernandez JL, Gomez M, Luque A, Hogg N, Sanchez-Madrid F, Cabanas C. The interaction of activated integrin lymphocyte function-associated antigen 1 with ligand intercellular adhesion molecule 1 induces activation and redistribution of focal adhesion kinase and proline-rich tyrosine kinase 2 in T lymphocytes. Mol Biol Cell. 1999;10:1891-1907. 41. McShan GD, Zagozdzon R, Park SY, et al. Csk homologous kinase associates with RAFTK/Pyk2 in breast cancer cells and negatively regulates its activation and breast cancer cell migration. Int J Oncol. 2002;21:197-205. 42. Koziak K, Kaczmarek E, Park SY, Fu Y, Avraham S, Avraham H. RAFTK/Pyk2 involvement in platelet activation is mediated by phosphoinositide 3-kinase. Br J Haematol. 2001;114:134-140. 43. Simonson WT, Franco SJ, Huttenlocher A. Talin1 regulates TCR-mediated LFA-1 function. J Immunol. 2006;177:7707-7714. 44. Tanentzapf G and Brown NH. An interaction between integrin and the talin FERM domain mediates integrin activation but not linkage to the cytoskeleton. Nat Cell Biol. 2006;8:601-606. 45. Cluzel C, Saltel F, Lussi J, Paulhe F, Imhof BA, Wehrle-Haller B. The mechanisms and dynamics of (alpha)v(beta)3 integrin clustering in living cells. J Cell Biol. 2005;171:383-392.  103  46. Orange JS, Ramesh N, Remold-O'Donnell E, et al. Wiskott-Aldrich syndrome protein is required for NK cell cytotoxicity and colocalizes with actin to NK cell-activating immunologic synapses. Proc Natl Acad Sci U S A. 2002;99:11351-11356. 47. Miletic AV, Swat M, Fujikawa K, Swat W. Cytoskeletal remodeling in lymphocyte activation. Curr Opin Immunol. 2003;15:261-268. 48. Turner CE, Glenney JR,Jr, Burridge K. Paxillin: a new vinculin-binding protein present in focal adhesions. J Cell Biol. 1990;111:1059-1068. 49. McGregor A, Blanchard AD, Rowe AJ, Critchley DR. Identification of the vinculin-binding site in the cytoskeletal protein alpha-actinin. Biochem J. 1994;301 ( Pt 1):225-233. 50. Tsukita S, Oishi K, Sato N, Sagara J, Kawai A, Tsukita S. ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J Cell Biol. 1994;126:391-401.  104  CHAPTER 4  ELUCIDATION OF THE LFA-1 MEDIATED SIGNALING PATHWAY LEADING TO ACTIN POLARIZATION IN NK CELLS  A version of this chapter has been submitted for publication as: Mace, E.M., Zhang, J., Siminovitch, K.A. and Takei, F. Elucidation of the LFA-1 mediated signaling pathway leading to actin polarization in NK cells. 105  4.1 Introduction Natural killer (NK) cells are innate lymphocytes that have the capacity to kill virally infected or transformed cells without prior sensitization. When stimulated to kill by activating receptors, NK cells undergo tightly regulated steps leading to target cell lysis. The first step in NK cell cytotoxicity is adhesion to the target, followed by polarization of the actin cytoskeleton. Subsequently, cytotoxic granules and microtubule organizing center are mobilized toward the bound target cell and granules fuse with the plasma membrane. Perforin and granzymes are exocytosed, resulting in apoptosis of the target cell. The leukocyte integrin LFA-1 is known to be important for NK cell-mediated cytotoxicity as LFA-1-deficient NK cells have defective cytotoxicity1. In addition to mediating the adhesion of NK cells to target cells, LFA-1 is an essential component of the immunological synapse formed on NK cells as they bind to target cells2. Moreover, recent studies have shown that LFA-1 also functions as a co-stimulatory receptor on NK cells. The binding of LFA-1 on NK cells to its ligand intercellular adhesion molecule-1 (ICAM-1) on targets has been shown to be sufficient for granule polarization in human NK cells3. In addition, ligation of LFA-1 on NK cells leads to rapid phosphorylation and activation of the kinases Vav1 and Pyk2, which both play a role in actin polymerization signaling4,5. We have also shown that binding of LFA-1 on NK cells to ICAM-1, in the absence of other activation signals, results in localized actin accumulation and that the cytoskeletal adaptor protein talin is required for this process6. However, the precise mechanism by which LFA-1 ligation results in the reorganization of the actin cytoskeleton and how talin plays a critical role in the process remains unclear. Talin is a large adaptor protein, with a 50 kDa head and a 200 kDa rod domain. The head domain of talin contains a FERM domain, which activates integrins, including LFA-1, through  106  binding to the  subunit of integrin cytoplasmic domains. The FERM domain also contains binding sites for F-actin, phosphatidylinositol 4-phosphate 5-kinase type I  (PIPKI) and the PIPKI product phosphatidylinositol-4,5-bisphosphate (PIP2). The rod domain contains at least two actin binding sites and multiple binding sites for the actin cross-linking protein vinculin7. Talin may be in an autoinhibited conformation in resting cells, mediated by interactions between its head and rod domains. It is unclear what relieves this autoinhibition, although binding of PIP2 is proposed to play a role7. Human NK express PIPKI, and PIP2 is enriched at the interface between an NK cell and a sensitive, but not resistant target. Moreover, disruption of this PIP2 impairs cytotoxicity8. The importance of the actin cytoskeleton in immune cell function has been well documented9. The formation of branched filaments by the actin nucleating Arp2/3 complex is crucial for immune synapse formation10. An important link between integrins and Arp2/3 is vinculin. In adherent cells forming nascent focal adhesions, vinculin interacts with Arp2/3 and localizes it to the leading edge of stimulated cells11. Vinculin also interacts directly with actin and talin through multiple vinculin binding sites in the talin rod. Thus, vinculin appears to play a role in Arp2/3 regulation in addition to its well-studied role as an actin cross-linking protein. Arp2/3 itself possesses little biochemical activity and must be activated by a nucleation promotion factor. The primary nucleation promoting factor at work in hematopoeitic cells is Wiskott-Aldrich Syndrome protein (WASP), the product of the gene mutated in Wiskott Aldrich Syndrome (WAS). A hallmark of WAS is immune dysfunction, and NK cells from WAS patients have decreased cellular cytotoxicity due to impaired conjugate formation22. WASP is found at the immune synapse and, upon activation, promotes Arp2/3-mediated actin polymerization. WASP is held in an autoinhibited conformation, and concurrent binding of PIP2 and active 107  Cdc42 GTPase relieves this autoinhibition12. How WASP is recruited to the immune synapse in NK cells is unclear. In T cells, recruitment of WASP is independent of Cdc42 but antigendependent13. As WASP also binds SH3 domain-containing proteins, it has been proposed that WASP is recruited following T cell receptor (TCR) signaling via adaptors such as CrkL and LAT12. However, in cytotoxic T cells, WASP localizes following LFA-1 ligation to ICAM-114. How WASP is recruited in NK cells is unknown. In this study we investigated the mechanism of LFA-1 mediated outside-in signaling that induces reorganization of the actin cytoskeleton using talin- and WASP-knockout (KO) NK cells. Our results show that talin, through its association with vinculin and PIPKI, mediates two signaling pathways that recruit Arp2/3 and WASP to the site of LFA-1 ligation and induce localized actin polymerization.  4.2 Materials and methods A detailed description of all methodologies can be found in the Appendix.  4.2.1 Mice, antibodies, reagents and flow cytometry C57BL/6 mice were bred in the BC Cancer Research Centre Animal Research Centre. The animal care committee of the University of British Columbia approved all animal use, and animals were maintained and euthanized under humane conditions in accordance with the guidelines of the Canadian Council on Animal Care. Was-/- mice15, Tln1-/- embryonic stem (ES) cells and WT ES cells have been described16. OP9 stromal cells were from RIKEN (Tokyo, Japan). Anti-WASP (B9), -talin (C-20), and -PIPKI (H-300) were from Santa Cruz Biotechnology. Anti-vinculin (V284) was from Millipore. Anti-PIP2 was from Stressgen. Anti108  Arp2 was from Abcam. Rhodamine-conjugated and Alexa 647-conjugated phalloidin, Alexa 488-conjugated donkey anti-mouse IgG and Alexa 568-conjugated donkey anti-rabbit IgG were purchased from Invitrogen Molecular Probes. Murine recombinant soluble ICAM-1 was from StemCell Technologies. Polyinosinic-polycytodylic acid (poly IC), m-3M3FBS and poly-Llysine (PLL) were from Sigma. Fluorescence staining of cells and flow cytometry were done as described6.  4.2.2 Cell culture and isolation NK cells were isolated from 6-8 week old C57Bl/6 mice using EasySep® negative selection kit (StemCell Technologies). Purified NK cells were cultured for 7 days in RPMI 1640 media supplemented with 10% FBS, penicillin, streptomycin, 5 × 10-5 M 2-mercaptoethanol (StemCell Technologies) with 1,000 U/ml IL-2 (Peprotech) or on OP9 stromal cells with 25 ng/ml IL-15 (Stemcell Technologies). Generation of NK cells from ES cells has been described 6. Poly IC (1 mg/ml) was intraperitoneally injected into 6-8 week old C57Bl/6 mice and NK cells were isolated from spleen 18-24 hours after the injection. Where indicated, WASP-KO NK cells were incubated with 4 g/ml of recombinant mouse IL15/IL15Rα complex (eBioscience) for 5 days.  4.2.3 Immunoprecipitation and western blotting Cultured NK cells were harvested and 5 × 106 cells were lysed in 1 ml ice cold lysis buffer (10 mM Tris- (tris(hydroxymethyl)aminomethane) HCl, pH 8.0, 150 mM KCl, 1 mM EDTA (ethylenediaminetetraacetic acid) pH 8.0, 1% Triton X-100, 0.5% bovine serum albumin (BSA)) in the presence of protease inhibitors (Roche). After centrifugation at 13,000 rpm for 20 minutes at 4ºC, supernatants were taken as cell lysates. Immunoprecipitations were performed by 109  incubating lysates with 5 µg of antibody on Protein G Dynabeads (Invitrogen) for 10 minutes at room temperature. The beads were washed 3 times with wash buffer (lysis buffer without BSA) and the immunoprecipitated proteins were eluted using SDS-PAGE reducing buffer. Samples were divided into two equal portions, separated by SDS-PAGE gel electrophoresis, blotted to polyvinylidene fluoride membrane (Pall) and detected by primary antibodies and horseradishperoxidase conjugated secondary antibody with a chemiluminescent system (Amersham) according to manufacturer’s protocol.  4.2.4 Confocal microscopy The preparation of ICAM-1- and PLL-coated beads and confocal microscopy using cells bound to the beads were described6. Where indicated, cells were treated with 20 M m-3M3FBS in dimethyl sulfoxide (DMSO) for 30 minutes at 37° prior to addition of cells to beads. Untreated cells were incubated with DMSO as a control. All primary antibodies and Alexa 647-conjugated phalloidin were used at a 1:50 dilution. All secondary antibodies were used at 10 µg/ml. Rhodamine phalloidin was used at a 1:100 dilution. Cell-bead conjugates were analyzed using a Nikon C1-si confocal microscope with a 100× objective lens, zoom 4. Images were collected using sequential scanning to avoid bleed-through. Images were processed and merged using Volocity software (Improvision) and exported as JPG files. For quantification of fluorescence intensity at the site of binding, the sum intensity in the channel of interest was determined using Volocity software for the area of contact between a cell and a bead and compared to the sum fluorescent intensity of the whole same cell using the following equation: [sum intensity (contact site)/sum intensity (whole cell)] ×100. For quantification of PIP2 accumulation, fluorescence intensity of staining at the point of contact between a cell and a bead was determined using  110  Volocity software and compared to fluorescence intensity of an area of cell membrane of equal size opposite the contact site. Fluorescence staining at the point of contact is expressed as a ratio over the fluorescence staining at the opposite point. For membrane profiles of PIP2 staining, fluorescence intensity along a line drawn from the point of contact between a cell and a bead to the opposite side of the cell was measured using ImageJ softare (NIH). These values were exported to GraphPad software and graphed accordingly.  4.2.5 Statistics Student's two-tailed t-test was used for comparison of sets of matched samples.  4.3 Results 4.3.1 LFA-1 binding to ICAM-1 results in accumulation of talin, actin, Arp2/3, vinculin and WASP NK cells purified from normal B6 mouse spleen did not kill the standard NK target YAC-1 cells, did not have a detectable level of granzyme B or perforin and did not adhere to immobilized ICAM-1 (data not shown). Therefore, we injected poly I:C into B6 mice to prime NK cells. NK cells purified from poly I:C-injected mouse spleen readily bound to cell size beads coated with ICAM-1. Poly-L-lysine (PLL)-coated beads, which efficiently bind to cells but do not ligate specific receptors, were used as control. The cell-bead conjugates were fixed, permeabilized and stained for proteins of interest. As previously reported6, talin and F-actin localized to the site where ICAM-1-coated beads were bound, whereas no such localization of talin or actin was seen with PLL-coated beads (Fig 4.1A, B). To further investigate the signaling pathways generated by LFA-1 ligation that result in the localized actin accumulation, we examined the subcellular 111  localization of proteins involved in actin polymerization. Binding of ICAM-1-coated beads, but not PLL-beads, induced significant accumulation of Arp2/3 (Fig 4.1C), vinculin (Fig. 4.1D) and WASP (Fig. 4.1E) at the binding site. To quantify the level of protein accumulation seen with confocal microscopy, we measured the fluorescence intensity of staining at the point of contact between the cell and the bead and compared to total fluorescent intensity of the entire cell (Fig. 4.1, shown in bar graphs to right of each corresponding panel of microscopy images). The results confirmed that those proteins localized to the site of bead binding in ex vivo NK cells following binding to ICAM-1-coated beads. Many previous studies on LFA-1 signaling in NK cells were done using in vitro cultured cells. Therefore, we tested whether the same protein localization is seen with in vitro cultured NK cells. Purified splenic NK cells, without priming with poly I:C, were cultured with IL-15 in the presence of the stroma cells OP9 or with a high dose (1,000 U/ml) IL-2. In both cultures, NK cells vigorously expanded, enlarged, contained high levels of perforin and granzyme B and were highly cytotoxic against YAC-1 cells (data not shown). The distribution of talin, actin and Arp2/3 in the in vitro cultured NK cells was similar to that seen with the poly I:C-primed ex vivo NK cells. Unexpectedly, the binding of ICAM-1-coated beads did not induce vinculin localization in IL-2-cultured NK cells (Fig 4.1D). Similarly, WASP did not significantly localize to the bead binding site in IL-2-cultured NK cells (Fig. 4.1E), which is consistent with a previously described WASP-independent pathway of actin polymerization15, 17. As IL-2-cultured NK cells appear to be different from ex vivo, IL-15-cultured or ES-derived NK cells, we compared the expression of LFA-1, the NK cell activating receptor NKG2D, and the NK cell inhibitory receptors Ly49C/I and Ly49G in all three types of NK cells. While LFA-1, NKG2D  112  IC-1 PLL  **  **  ***  ]  60 50 40 30 20 10 0  ]  IL-2 Fluor. Merge  ]  IL-15 Fluor. Merge  % fluorescence at contact site  A Ex vivo Talin Fluor. Merge  ex vivo IL-15 IL-2  Arp2/3 50 40 30 20 10 0  % fluorescence at contact site  IC-1 PLL  ]  ]  ]  ***  ex vivo IL-15 IL-2 **  *** ***  ex vivo IL-15 IL-2 % fluorescence at contact site  IC-1 PLL  50 40 30 20 10 0  PLL  ex vivo IL-15 IL-2 ***  **  [  IC-1  50 40 30 20 10 0  **  [  % fluorescence at contact site  E WASP  ***  ]  D Vinculin  ]  C  **  ]  PLL  **  ]  IC-1  60 50 40 30 20 10 0  ]  % fluorescence at contact site  B Actin  ex vivo IL-15 IL-2  Figure 4.1. Binding of LFA-1 to ICAM-1 results in accumulation of talin, actin, Arp2/3, vinculin and WASP. Ex vivo, IL-15 cultured, or IL-2 cultured NK cells were incubated with ICAM-1 (IC-1) or PLL beads, fixed, permeabilized, and stained for talin (A), actin (B), Arp2/3 (C), vinculin (D), or WASP (E). Fluorescent intensity of staining at the contact site between an NK cell bound to an IC-1 (black bars) or PLL (white bars) coated bead was expressed as a percentage of total fluorescent intensity of staining found within the cell and shown to the right of the corresponding panel of fluorescent images. Error bars indicate SEM, n=10 per condition. *** denotes p-value <0.005, ** denotes p-value <0.01, * denotes p-value <0.05 when compared to corresponding PLL condition.  113  and Ly49G expression was similar between the ex vivo and cultured cells, Ly49C/I was significantly down modulated following culture in IL-2, but not IL-15. The mechanism for this down-modulation is unclear but likely reflects changes in the activation of the NK cell following IL-2 culture.  IL-2  IL-15  100  80  80  80  % of Max  100  60  40  40  20  20  0  10  1  10  2  10  3  10  40  20  10  0  10  1  10  2  10  3  10  0  4  10  100  100  100  80  80  80  60  60  40  40  20  20  20  0  0 0  10  1  10  2  10  3  10  4  0  10  1  10  2  10  3  10  10  4  80  % of Max  % of Max  100  80  % of Max  100  80  40  60  20  0  0  10  0  10  1  10  2  10  3  10  4  0  10  1  10  2  10  3  10  4  80  80  % of Max  % of Max  80  60  40  40  20  20  20  0  0 1  10  2  10  3  10  4  3  10  4  0  10  1  10  2  10  3  10  4  10 0  10 1  10 2  10 3  10 4  10 0  10 1  10 2  10 3  10 4  60  40  10  10  0  10  100  0  2  20  100  10  10  60  100  60  1  40  40  20  10  0  10  100  60  0  60  40  10  Ly49G  4  % of Max  % of Max  10  Ly49C/I  60  0  0  NKG2D  % of Max  60  % of Max  % of Max  LFA-1  ex vivo  100  0 100  101  102  103  104  Figure 4.2. Expression of receptors on IL-2 activated, IL-15 activated or ex vivo NK cells. Isotype control is shown as the grey histogram. Cells were analyzed by FACS on a BD FACScalibur.  114  4.3.2 Talin is required for recruitment of actin and actin polymerization machinery following binding of LFA-1 to ICAM-1 We have previously shown that talin is required for the accumulation of F-actin in NK cells bound to ICAM-1-coated beads6. To examine the role of talin in the recruitment of actin polymerization machinery, we generated NK cells in vitro from talin-KO and WT ES cells as in our previous study6. As talin-KO NK cells do not bind ICAM-16, they were incubated in the presence of 1 mM Mn++ to induce high affinity LFA-1 and binding to ICAM-1. In WT cells bound to ICAM-1 beads, actin (Fig 4.3A), Arp 2/3 (Fig 4.3B), vinculin (Fig 4.3C), and WASP (Fig 4.3D) accumulated at the site of contact between cell and bead. Neither WT cells bound to PLL nor talin-KO NK cells bound to either ICAM-1 or PLL showed this accumulation. Quantitative analysis of the confocal images confirmed that binding of LFA-1 to ICAM-1 resulted in significant localization of actin, Arp2/3, vinculin and WASP in WT, but not talin-KO NK cells (Fig 4.3 A-D, bar graphs). These results indicate that talin is required for the recruitment of Arp2/3, vinculin and WASP to the site of LFA-1 ligation.  115  A  WT  Actin  Fluor.  Merge  KO Fluor.  %fluorescence at contact site  IC-1  Merge  PLL  60 50 40 30 20 10 0  B Arp2/3 50 %fluorescence at contact site  IC-1  PLL  10 0  Vinculin  IC-1  PLL  WT  KO  ***  20  % fluorescence at contact site  C  40 30  ***  60 50 40 30 20 10 0  WT  KO  ***  WT  KO  %fluorescence at contact site  D WASP IC-1  PLL  40 30  ***  20 10 0  WT  KO  Figure 4.3. Accumulation of actin, Arp2/3, vinculin and WASP is talin dependent. NK cells generated from WT or talin-KO ES cells were incubated with ICAM-1 (IC-1) or PLL coated beads as indicated. Cells were fixed, permeabilized, and stained for actin (A), Arp2/3 (B), vinculin (C), or WASP (D). Fluorescent intensity of staining at the contact site between an NK cell bound to an IC-1 (black bars) or PLL (white bars) coated bead was expressed as a percentage of total fluorescent intensity of staining found within the cell and shown to the right of the panel of corresponding fluorescent images. Error bars indicate SEM, n=10 per condition. *** denotes p-value <0.005, * denotes p-value <0.05 when compared to corresponding PLL condition.  116  4.3.3 WASP-KO NK cells show normal accumulation of Arp2/3, vinculin and talin, but not actin We isolated NK cells from WASP-KO mice primed with poly I:C as well as those cultured with IL-2 or IL-15. Upon binding of ICAM-1-coated beads, talin (Fig. 4.4A) and Arp2/3 (Fig. 4.4B) accumulated at the contact site in all three types of WASP-KO NK cells. Vinculin (Fig. 4.4C) also accumulated at the contact site in ex vivo and IL-15-cultured WASP-KO NK cells, but no significant accumulation of vinculin was seen in IL-2-cultured WASP-KO NK cells. Actin (Fig. 4.4D) did not accumulate at the contact site in ex vivo and IL-15-cultured WASP-KO NK cells, whereas it accumulated at the contact site in WASP-KO NK cells cultured with IL-2. These results show that WASP is required for actin accumulation at the site of LFA-1 ligation in ex vivo NK cells and IL-15-cultured NK cells whereas IL-2-cultured NK cells have WASPindependent pathway of actin polymerization. The results also show that WASP is not required for the recruitment of talin, vinculin and Arp2/3.  117  A Talin  Ex vivo  Fluor.  Merge  IL-2  IL-15 Fluor.  Merge  Fluor.  Merge  PLL  ***  ex vivo IL-15 IL-2 50 *** * ***  PLL  40 30 20 10 0  PLL  ***  **  30 20 10 0  ***  % fluorescence at contact site  50 40 30 20 10 0  ex vivo IL-15 IL-2  [  D Actin  40  [  IC-1  ex vivo IL-15 IL-2  [  % fluorescence at contact site  C Vinculin  [  IC-1  [  % fluorescence at contact site  [  B Arp2/3  *  [  IC-1  [  % fluorescence at contact site  [  50 *** 40 30 20 10 0  IC-1  PLL  ex vivo IL-15 IL-2  Figure 4.4. WASP-KO NK cells show normal accumulation of talin, Arp2/3, and vinculin, but not actin. Ex vivo, IL-15 activated, or IL-2 activated NK cells from WASP-KO mice were incubated with ICAM-1 (IC-1) or PLL beads, fixed, permeabilized, and stained for talin (A), Arp2/3 (B), vinculin (C), or actin (D). Fluorescent intensity of staining at the contact site between an NK cell bound to an IC-1 (black bars) or PLL (white bars) coated bead was expressed as a percentage of total fluorescent intensity of staining found within the cell and shown to the right of the corresponding panel of fluorescent images. Error bars indicate SEM, n=10 per condition. *** denotes p-value <0.005, ** denotes p-value <0.01, * denotes p-value <0.05 when compared to corresponding PLL condition.  118  4.3.4 Vinculin, Arp2/3 and talin, but not WASP, constitutively associate in NK cells When NK cells cultured with IL-15 bound ICAM-1-coated beads, WASP and Arp2/3 (Fig 4.5A) as well as vinculin and Arp2/3 (Fig 4.5B) co-localized at the site of bead-binding. IL-2 activated cells, consistent with the above results, showed no apparent co-localization of vinculin and Arp2/3 or WASP and Arp2/3, either prior to or following binding to ICAM-1 coated beads (Fig 4.5A, B). To determine if co-localization of these proteins was due to physical association, we carried out co-immunoprecipitation experiments using cultured NK cells. Immunoprecipitation of talin from NK cells cultured with IL-15, but not IL-2, resulted in co-precipitation of vinculin (Fig 4.5C, left panel). Moreover, immunoprecipitation of vinculin from NK cells cultured with IL-15, but not IL-2, resulted in co-precipitation of talin as well as Arp2 (Fig. 4.5C middle two panels). On the other hand, WASP was not co-precipitated with talin or vinculin (data not shown), and WASP immunoprecipitation from both IL-2- and IL-15-cultured NK cells did not co-precipitate Arp2 (Fig. 4.5C right panel), talin or vinculin (data not shown). We also carried out the same co-immunoprecipitation analyses using NK cells bound to immobilized ICAM-1 and obtained the same results (results not shown), indicating that the talin-vinculin-Arp2 association is most probably constitutive in NK cells cultured with IL-15.  119    A  WASP  Arp2/3  Actin  DIC  Merge  IL-15  IL-2 Vinculin Arp2/3  Actin  DIC  Merge  IL-15 IL-2  B  tln vin  vin tln arp2  WASP arp2  IL-15 IL-2 IP: tln  IP: vin  IP: WASP  Figure 4.5. Vinculin constitutively associates with talin and Arp2. (A) IL-15 or IL-2 activated NK cells were incubated with ICAM-1 beads, fixed, permeabilized, and stained for WASP or vinculin (green), Arp2/3 (red) and actin (blue). (B) IL-15 expanded NK cells were lysed and WASP, vinculin or talin were immunoprecipitated. Immunoprecipitates were blotted as indicated.  120  4.3.5 Talin is required for increased PIP2 level at the site of LFA-1 ligation and is associated with PIPKI The above results showed that talin and WASP are required for the accumulation of F-actin at the site of LFA-1 ligation in ex vivo and IL-15-cultured NK cells and the recruitment of WASP is talin-dependent. However, no direct association was detected between WASP and talin, vinculin or Arp2/3. WASP has a PH domain that binds PIP2 and talin binds PIPKIwhich generates PIP218. Therefore, we tested whether binding of ICAM-1-coated beads to NK cells induces elevated levels of PIP2 at the contact site and whether talin is required for the process. As seen in Fig 4.6A (left panel), binding of a WT, but not talin-KO, NK cells to ICAM-1 coated beads resulted in the accumulation of PIP2 at the contact site. We also tested whether WASP is required for the accumulation of PIP2 at the contact site. WASP-KO NK cells, following binding of NK cells to ICAM-1 coated beads, showed the same level of PIP2 accumulation at the contact site as WT NK cells (Fig. 4.6A, right panel). Quantification of the PIP2 accumulation showed that the fluorescence intensity of PIP2 staining at the contact site was approximately two-fold higher than that at the opposite side of the same cell in WT and WASP-KO NK cells, but not talin-KO NK cells (Fig 4.6B). Thus, the localized increase in PIP2 is dependent on talin, but not WASP. Talin-PIPKI association was analyzed by co-immunoprecipitation from IL-15-cultured WT NK cells. Probing PIPKI immunoprecipitate for talin showed co-precipitation of PIPKI and talin (Fig. 4.6C).  121  WT IL-15  WT ES-NK  A  PIP2  Merge  PIP2  Merge  IC-1  PLL Talin-KO ES-NK  WASP-KO IL-15  IC-1 PLL  B  C  [  ***  **  [  *  PIPKI tln  [  5 4 3 2 1 0  IP:PIPKI WT KO WT KO ES-NK IL-15  Figure 4.6. Talin associates with PIPKIand is required for enrichment of PIP2 following binding of LFA-1 to ICAM-1. (A) Wild-type (WT) or talin-KO ES-derived NK cells (ES-NK) and WT or WASP-KO IL-15 activated cells were incubated with ICAM-1 (IC-1) or PLL coated beads, fixed, permeabilized, stained for PIP2 and analyzed by confocal microscopy. (B) Fluorescent intensity of PIP2 staining at the contact site between a WT or talin-KO ES-NK and a WT or WASP-KO IL-15 NK bound to an ICAM-1 (IC-1)or PLL coated bead expressed as a ratio of [fluorescence at the contact site/fluorescence at a random point opposite]. Error bars indicate SEM, n=10 per condition. * denotes p-value <0.05, ** denotes p-value <0.01 when compared to corresponding PLL condition. (C) PIPKI was immunoprecipitated from IL-15 expanded NK cells were lysed and probed as indicated.  122  4.3.6 WASP recruitment is dependent on PIP2 To test whether the elevated level of PIP2 at the site of LFA-1 ligation is responsible for the recruitment of WASP, we tested the effects m-3M3FBS, a compound shown to activate PLC. As PLCconverts PIP2 into diacylglycerol and inositol-1,4,5-trisphosphate m-3M3FBS was expected to lower the level of PIP2. Treatment of NK cells with various concentrations of m3M3FBS showed that 20 mM m-3M3FBS efficiently reduced PIP2 staining whereas higher concentrations affected the cell viability (data not shown). NK cells treated or not with 20 mM m-3M3FBS were incubated with ICAM-1-coated beads and stained for PIP2. The treatment significantly reduced the overall level of PIP2 and accumulation of PIP2 at the site of beadbinding (Fig. 4.7A). The residual staining in the treated cells appeared to be mostly in the cytoplasm of the cell, suggesting that cytoplasmic staining may be non-specific. To quantify the membrane specific reduction of PIP2 following the treatment, we measured the fluorescence intensity of staining along a line from the point of contact between a cell and a bead. With untreated NK cells bound to PLL-coated beads, two equal peaks of PIP2 staining corresponding to the cell membrane at the contact site and the opposite end were detected (Fig. 4.7B, left). In untreated cells bound to ICAM-1 coated beads, a single high peak of staining at the contact site was seen (Fig. 4.7B, center). The treatment with m-3M3FBS almost completely abrogated the staining of antibody, particularly at the membranes (Fig 4.7B, right). We also tested the effects of m-3M3FBS on the localization of talin, WASP, and actinWhile talin accumulation was unaffected by the treatment, actin accumulation and WASP recruitment was almost completely abrogated (Fig. 4.7C). Quantification of these results confirmed that m-3M3FBS treatment significantly decreased the intensity of PIP2, WASP and actin staining at the contact site following binding of a cell to an ICAM-1 coated bead while talin localization was not 123  significantly affected by the treatment (Fig. 4.7D). These results suggest that localized production of PIP2 is required for recruitment of WASP but not talin, and that this PIP2 dependent WASP recruitment is required for actin polymerization following binding of LFA-1 to ICAM-1.  A  Merge  B Fluorescent intensity  PI(4,5)P2   +  IC-1  PLL  m-3M3FBS  Distance from bead  C Talin  Merge  WASP  Merge  Actin  **  ***  [  **  [  +  6 5 4 3 2 1 0  [    Merge  Relative fluorescent intensity  D   +  +  +  + talin actin WASP PIP2  Figure 4.7. Depletion of PIP2 prevents recruitment of WASP, but not talin, and decreases actin polymerization. IL-15 activated NK cells were treated (+) or not (–) with 20 M m3M3FBS and allowed to bind to ICAM-1 coated beads. (A) Cells were fixed, permeabilized and stained for PIP2. (B) Fluorescent intensity of PIP2 staining was measured by drawing a line from the point of contact between an untreated NK cell bound to an poly-L-lysine coated bead (left), an untreated NK cell bound to an ICAM-1 coated bead (centre) or an m-3M3FBS treated cell (right). (C) Cells were fixed, permeabilized, stained for talin, actin or WASP and analyzed by confocal microscopy. (D) Fluorescent intensity of staining at the contact site between an untreated (black bar) or treated (white bar) NK cell bound to an ICAM-1 coated bead expressed as a ratio of fluorescence at the contact site over fluorescence at a random point opposite. Error bars indicate SEM, n=10 per condition. *** denotes p-value <0.005, ** denotes p-value <0.01 when compared to corresponding PLL condition.  124  4. 4 Discussion LFA-1 is considered to be an important stimulatory receptor on NK cells20. It is thought to be required for the formation of the immunological synapse and spatial distribution of multiple receptors in the synapse as NK cells interact with target cells20. We have also shown previously that binding of ICAM-1 to LFA-1 on mouse NK cells induces reorganization of the actin cytoskeleton and polarization of NK cells, which is a pre-requisite for subsequent redistribution of cytotoxic granules toward the bound targets. Moreover, talin is required for this LFA-1induced NK cell polarization6. However, the precise signaling events induced by LFA-1 ligation have been difficult to discern as NK-target interaction involves multiple receptor-ligand combinations that generate complex signaling events. In this study we used ICAM-1-coated cell size beads as artificial targets and talin- and WASP-deficient NK cells to study the effects of LFA-1 ligation independent of other receptors. Our results have revealed the mechanisms by which LFA-1 ligation results in the polarization of the actin cytoskeleton in NK cells. As previously shown6, binding of ICAM-1-coated beads to NK cells induces talin redistribution from the cytosol to the site of the plasma membrane where the beads are bound. ICAM-1 binding presumably separates the two chains of LFA-1 and exposes the cytoplasmic tail of the -chain, where talin binds and stabilizes the high affinity state of LFA-121. Our current results have shown that talin recruited by the ligand-bound LFA-1 brings and activates actin polymerization machinery by two separate pathways. First, talin brings the actin nucleating Arp2/3 to the site of LFA-1 ligation via association of vinculin with both talin and Arp2/3. Second, talin also binds PIPKI and recruits it to the site of LFA-1 ligation, where it synthesizes PIP2. WASP, which has a PH-domain, is recruited by the elevated level of PIP2 at the site. Thus, talin brings together  125  Arp2/3 and WASP to promote the actin nucleation activity of Arp2/3, resulting in the accumulation of F-actin at the site of LFA-1 ligation. While the LFA-1-mediated signaling pathways describe above are in operation in freshly isolated NK cells from poly I:C injected mice and those cultured with IL-15, NK cells cultured with a high dose of IL-2 seem to have distinct LFA-1-mediated signaling pathways. In IL-2 cultured NK cells, vinculin and WASP do not localize to the site of LFA-1 ligation, and no vinculin association with talin or Arp2/3 is detectable. Nevertheless, Arp2/3 and F-actin accumulate at the site of LFA-1 ligation in IL-2-cultured NK cells. Moreover, WASP-KO NK cells cultured with IL-2 accumulate F-actin at the site of LFA-1 ligation, indicating a WASPindependent pathway of actin polymerization. Consistent with our findings, NK cells from WAS patients have been shown to have profound defects in NK cell cytotoxicity due to impaired conjugate formation with targets22.  However, IL-2 stimulation restores target binding and  cytotoxicity15, 17. Currently, what recruits Arp2/3 and activates its actin nucleating function in IL2-activated NK cells is unknown. The effect of IL-2 stimulation on vinculin function was surprising. One possibility is that vinculin is still functioning in the presence of IL-2 but the lack of detection of vinculin represents a lower threshold for vinculin function as opposed to independence from its activity. It would be useful to test whether vinculin is required in both IL2 and IL-15 cultured cells through the use of vinculin deficient NK cells. Although the role of vinculin in the immune system is still unclear, it has been reported to form a complex with Arp2/3, talin and the nucleation promotion factor WAVE2 in T cells23. Vinculin knock-down results in reduced localization of talin to the immunological synpase formed between Jurkat T cells and SEE-pulsed Raji B cells, suggesting that vinculin is required for the recruitment of talin to the synapse in this system23. In our system, talin is required for  126  vinculin recruitment following LFA-1 ligation. While NK cells express WAVE, we saw no WAVE localization following LFA-1 binding in IL-2 or IL-15 activated NK cells (not shown). The hematopoeitic cortactin homologue HS1 has been shown to play a role in NK cell synapse formation24, but it is still unknown whether HS1 mediates actin polymerization following LFA-1 ligation in IL-2-activated NK cells. Our results have shown that PIP2 is important for the recruitment of WASP to the site of LFA-1 ligation in ex vivo NK cells and IL-15-activated NK cells. PIP2 is on the inner leaflet of the plasma membrane and it binds to a number of PH-domain-containing proteins, including WASP. Although it is quite abundant in the plasma membrane, LFA-1 ligation induces a localized elevation of PIP2 level at the site, most likely due to recruitment of PIPKI by talin. Micucci et al. have reported that PIPKI and - are expressed in human NK cells8. Moreover, interaction of a human NK cell with a sensitive, but not resistant target, results in the consumption of cellular PIP2, and quenching of PIP2 in these cells by competitive inhibition results in impaired cytotoxicity8. PIP2 and PIPKI are known to regulate cytoskeletal dynamics in focal adhesions in adherent cells. Talin recruits PIPKI to focal adhesions, where it is phosphorylated and activated by focal adhesion kinase, which both increases local production of PIP2 and strengthens the association of PIPK with talin18. PIP2 also strengthens vinculin-talin and talin-integrin  tail interactions25,26. While our results have shown that PIP2 is required for the recruitment of WASP to the site of LFA-1 ligation, the function of WASP seems to be regulated by multiple mechanisms. In T cells WASP is held in a complex with WIP, which prevents activation of WASP by Cdc42. Following TCR signaling, a ZAP-70-CrkL-WASP-WIP complex is formed and WASP is translocated to the membrane, where phosphorylation of WIP by PKC causes dissociation and 127  subsequent activation of WASP27. SH3 domain containing proteins, including Nck, have been implicated in WASP recruitment and activation in several systems. In NK cells LFA-1 ligation has been reported to activate Vav14, Cdc42  28  and Pyk2 5. Although we have been unable to  detect an enrichment of Cdc42 at the site of LFA-1 ligation (data not shown), it is possible that a small amount of GTP-bound Cdc42 is localized to the site and activates WASP  29  . LFA-1  ligation also induces rapid phosphorylation and localization of Pyk2 at the site6. Pyk2 thus activated may be responsible for the activation of PIPKI that is recruited to the site by talin.  128  4.5 Bibliography 1. Matsumoto G, Nghiem MP, Nozaki N, Schmits R, Penninger JM. Cooperation between CD44 and LFA-1/CD11a adhesion receptors in lymphokine-activated killer cell cytotoxicity. J Immunol. 1998;160:5781-9. 2. Davis DM and Dustin ML. What is the importance of the immunological synapse? Trends Immunol. 2004;25:323-327. 3. Barber DF, Faure M, Long EO. LFA-1 contributes an early signal for NK cell cytotoxicity. J Immunol. 2004;173:3653-9. 4. Riteau B, Barber DF, Long EO. Vav1 phosphorylation is induced by beta2 integrin engagement on natural killer cells upstream of actin cytoskeleton and lipid raft reorganization. J Exp Med. 2003;198:469-74. 5. Gismondi A, Jacobelli J, Mainiero F, et al. Cutting edge: functional role for proline-rich tyrosine kinase 2 in NK cell-mediated natural cytotoxicity. J Immunol. 2000;164:2272-6. 6. Mace EM, Monkley SJ, Critchley DR, Takei F. A dual role for talin in NK cell cytotoxicity: activation of LFA-1-mediated cell adhesion and polarization of NK cells. J Immunol. 2009;182:948-956. 7. Critchley DR and Gingras AR. Talin at a glance. J Cell Sci. 2008;121:1345-1347. 8. Micucci F, Capuano C, Marchetti E, et al. PI5KI-dependent signals are critical regulators of the cytolytic secretory pathway. Blood. 2008;111:4165-4172. 9. Dustin ML. Cell adhesion molecules and actin cytoskeleton at immune synapses and kinapses. Curr Opin Cell Biol. 2007;19:529-533. 10. Wulfing C and Davis MM. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science. 1998;282:2266-2269.  129  11. DeMali KA, Barlow CA, Burridge K. Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J Cell Biol. 2002;159:881-891. 12. Zhang J, Dong B, Siminovitch KA. Contributions of Wiskott-Aldrich syndrome family cytoskeletal regulatory adapters to immune regulation. Immunol Rev. 2009;232:175-194. 13. Cannon JL, Labno CM, Bosco G, et al. Wasp recruitment to the T cell:APC contact site occurs independently of Cdc42 activation. Immunity. 2001;15:249-259. 14. Mace EM, MacLeod MA, Marwali MR, Dreolini L, Takei F. LFA-1 Binding to Ligand Induces Talin-Mediated Reorganization of the Actin Cytoskeleton in Cytotoxic T Cells. The Open Immunology Journal. 2008;1:51. 15. Zhang J, Shehabeldin A, da Cruz LA, et al. Antigen receptor-induced activation and cytoskeletal rearrangement are impaired in Wiskott-Aldrich syndrome protein-deficient lymphocytes. J Exp Med. 1999;190:1329-1342. 16. Priddle H, Hemmings L, Monkley S, et al. Disruption of the talin gene compromises focal adhesion assembly in undifferentiated but not differentiated embryonic stem cells. J Cell Biol. 1998;142:1121-1133. 17. Gismondi A, Cifaldi L, Mazza C, et al. Impaired natural and CD16-mediated NK cell cytotoxicity in patients with WAS and XLT: ability of IL-2 to correct NK cell functional defect. Blood. 2004;104:436-443. 18. Ling K, Doughman RL, Firestone AJ, Bunce MW, Anderson RA. Type I gamma phosphatidylinositol phosphate kinase targets and regulates focal adhesions. Nature. 2002;420:89-93. 19. Bae YS, Lee TG, Park JC, et al. Identification of a compound that directly stimulates phospholipase C activity. Mol Pharmacol. 2003;63:1043-1050.  130  20. Liu D, Bryceson YT, Meckel T, Vasiliver-Shamis G, Dustin ML, Long EO. Integrindependent organization and bidirectional vesicular traffic at cytotoxic immune synapses. Immunity. 2009;31:99-109. 21. Dustin ML, Bivona TG, Philips MR. Membranes as messengers in T cell adhesion signaling. Nat Immunol. 2004;5:363-372. 22. Orange JS, Ramesh N, Remold-O'Donnell E, et al. Wiskott-Aldrich syndrome protein is required for NK cell cytotoxicity and colocalizes with actin to NK cell-activating immunologic synapses. Proc Natl Acad Sci U S A. 2002;99:11351-11356. 23. Nolz JC, Medeiros RB, Mitchell JS, et al. WAVE2 regulates high-affinity integrin binding by recruiting vinculin and talin to the immunological synapse. Mol Cell Biol. 2007;27:5986-6000. 24. Butler B, Kastendieck DH, Cooper JA. Differently phosphorylated forms of the cortactin homolog HS1 mediate distinct functions in natural killer cells. Nat Immunol. 2008;9:887-897. 25. Gilmore AP and Burridge K. Regulation of vinculin binding to talin and actin by phosphatidyl-inositol-4-5-bisphosphate. Nature. 1996;381:531-535. 26. Martel V, Racaud-Sultan C, Dupe S, et al. Conformation, localization, and integrin binding of talin depend on its interaction with phosphoinositides. J Biol Chem. 2001;276:21217-21227. 27. Nurmi SM, Autero M, Raunio AK, Gahmberg CG, Fagerholm SC. Phosphorylation of the LFA-1 integrin beta2-chain on Thr-758 leads to adhesion, Rac-1/Cdc42 activation, and stimulation of CD69 expression in human T cells. J Biol Chem. 2007;282:968-975. 28. Sasahara Y, Rachid R, Byrne MJ, et al. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol Cell. 2002;10:12691281.  131  29. Cannon JL and Burkhardt JK. The regulation of actin remodeling during T-cell-APC conjugate formation. Immunol Rev. 2002;186:90-99.  132  CHAPTER 5  DISCUSSION AND SUMMARY  133  The objective of this thesis was to examine, in detail, the role that talin plays in LFA-1 function during cell-mediated cytotoxicity. While many studies have focused on the activation of LFA-1 by talin, I have examined the signaling mediated by talin following the binding of LFA-1 to ICAM-1. The importance of integrins as co-stimulatory or co-activating receptors in cytotoxicity has only recently come to light. The major contribution of this study is to help define and elucidate the critical role of LFA-1 and talin in the initiation of cytotoxicity in general, and actin polymerization specifically.  5.1 Talin recruitment and LFA-1 activation In Chapter 2 we showed that ligation of LFA-1 to ICAM-1 precedes recruitment of talin in CTLs and that LFA-1 binding to ICAM-1 results in the accumulation of actin, talin and WASP at the contact site with a target cell. The role of LFA-1 as a co-activating or co-stimulatory receptor has been difficult to study in isolation in CTLs due to the presence of powerful TCR signaling, which functions both to activate inside-out LFA-1 signaling and augment actin cytoskeleton rearrangement that is likely initiated by LFA-11,2. However, when we used ICAM-1 coated beads or ICAM-1-expressing non-lymphoid cells, we saw that talin recruitment to LFA-1 occured following binding. While talin does bind integrin  tails and disrupt cytoplasmic subunits of integrins, resulting in their conformational activation3, our studies and others suggest that ligand binding by integrins may precede talin binding. As LFA-1 on in vitro generated CTLs can bind ICAM-1 without further stimulation, it seems to be in a constitutively activate conformation. However, talin in CTLs is mostly distributed in the cytosol. Upon LFA-1 binding to ICAM-1, talin redistributes to the site of LFA-1 ligation. This finding suggests that talin may bind to, and stabilize, a high affinity conformation of ligand-bound integrin. A recent study has also shown  134  that the binding of the talin head domain to LFA-1 results in an intermediate conformation of LFA-1 that has modest affinity to bind ICAM-1, suggesting that talin is not sufficient for LFA1’s transition to a high affinity conformation4. Resting human T cells are unable to bind ICAM-1 without stimulation4. Physiologically, the activation of LFA-1 likely occurs as T cells are arrested and recruited from the vasculature into tissue, and may be initially induced by chemokine signaling2. However, it is unclear what would provide the initial signal that generates intermediate affinity LFA-1 for ICAM-1 binding. In addition to talin, other proteins including RapL, cytohesin, kindlins and filamins bind integrin  tails and may play a role in LFA-1 activation.  5.2 LFA-1 outside-in signaling We observed that while actin, talin and WASP recruitment required the binding of LFA-1 to ICAM-1, clustering of LFA-1 induced by anti-LFA-1 antibody could induce phosphorylation of Pyk2. Clustering of LFA-1 may induce Pyk2 autophosphorylation and subsequent activation of the downstream kinase cascade that has been attributed to LFA-1 outside-in signaling5,6. This signaling pathway includes Vav1, which is an important regulator of actin dynamics in hematopoeitic cells. Unfortunately, the hypothesis that Vav becomes activated following LFA-1 clustering was difficult to test in this study, as Vav appears to be constitutively phosphorylated in CTLs. The recent availability of phospho-specific Vav antibodies may make it possible to reveal subtle differences in the localization of phospho-Vav by confocal microscopy.  While not examined in Chapter 2, the mechanism of actin and WASP recruitment in CTL is most likely talin-dependent, as our results with talin-KO NK cells in Chapter 4 suggest. However,  135  there are likely other pathways being activated by LFA-1 signaling that we did not examine, including some that may be involved in actin polymerization. Formation of the actin cloud induced by LFA-1 ligation in Jurkat T cells in the absence of antigen requires the adaptor ADAP and can be induced by cross linking of a chimeric CD8/ADAP fusion in the absence of LFA-1, suggesting that ADAP is directly involved in LFA-1 outside-in signaling7. Engagement of the 1 integrin on T cells results in ADAP phosphorylation, which increases its association with SLP76. A recent study showed that SLP-76 is recruited to integrins in Jurkat T cells and contributes to subsequent integrin-mediated firm adhesion8,9.This role of adaptor proteins in integrin outsidein signaling in T cells is interesting, particularly as the mechanisms of recruitment of adaptor proteins to integrins is distinct from their recruitment to the TCR9. Whether similar adaptors play a role in NK cells remains to be seen. Both ADAP and SLP-76 are expressed in NK cells, although there is no reported link to integrin activition, and NK cells from ADAP-deficient mice show no defects in cytotoxicity or NK cell development10.  The generation of talin-KO NK cells from embryonic stem cell lines made it possible to examine LFA-1 outside-in signaling and how it leads to actin polymerization in a unique way. What is striking about these results is the pivotal role that talin plays in the recruitment of so many key proteins. Talin appears to act as a central scaffold that, through direct or indirect interactions, is responsible for the localization of multiple components of the actin machinery to integrins. Without talin, no components of actin signaling are recruited. In contrast, loss of WASP does not affect talin or Arp2/3 localization. It is not known what role the individual domains of talin play in the recruitment of these proteins.  136  The loss of talin results in an inability of the cell not only to adhere but also to polarize towards its target. The loss of adhesion was not surprising, as talin was expected to be required for activation of LFA-1. Interestingly, the activation of LFA-1 by Mn++ did not fully restore adhesion to levels of that seen with WT cells, which I attribute to a requirement for actin polymerization in LFA-1 mediated firm adhesion. When similar experiments were performed with WASP-KO NK cells (results not shown), the adhesion of these cells to ICAM-1 was comparable to that of talin-KO NK cells in the presence of Mn++. This confirms the requirement for actin polymerization, particularly as treatment with IL-2 restores WASP-KO NK cell binding to ICAM-1 and it has been shown that IL-2 activates a WASP-independent pathway of actin polymerization. The requirement of talin for polarization of the NK cell towards its target also underlines the requirement for actin polarization as a prerequisite for subsequent steps leading to cytotoxicity. This also supports the model suggested for human NK cells in which a single activating signal is not sufficient for cytotoxicity13.  In the case of NK cells interacting with the fibroblast L cell line, cytotoxicity was functional in the absence of both ICAM-1 on the target cell and talin in the NK cell. We found that CD44 could compensate for a loss of both LFA-1-mediated adhesion and talin-mediated actin polarization, likely because CD44 interacts with ERM proteins that also link to the actin cytoskeleton. The parallels between LFA-1-talin and CD44-ERM signaling to actin seem to reflect a common requirement in cytotoxicity for molecules that function both in adhesion and actin polymerization. However, the role of CD44 in the physiological function of NK cells remains unclear. NK cells from CD44-/- mice activated with poly I:C show only a slight reduction in cytotoxicity when compared to the corresponding wild-type cells (results not  137  shown). In addition, a recent study of T cells from CD44-/- mice revealed that these cells were competent for cytotoxicity and long-term interactions with target cells, yet showed defects in polarity and migration14.  5.3 WASP An interesting finding from the studies done with both CTL (Chapter 2) and NK cells (Chapter 4) is the role that LFA-1 plays in the recruitment of WASP. Our results show that ligand binding of LFA-1 is sufficient for WASP recruitment in CTL and NK cells, and that in NK cells at least, talin is required for this recruitment. It is unclear what the minimum requirements are for WASP recruitment in NK cells. One possibility is that ligation of NK cell activating receptors results in the recruitment of WASP by SH3 domain-containing proteins, as has been shown in T cells. Our results, however, show that LFA-1 ligation can result in recruitment of WASP. Similarly, TCR ligation results in WASP recruitment and activation. It is my opinion that TCR, and likely NK cell activating receptor signaling, also recruits WASP and reinforces the initial actin polymerization that has began with LFA-1signaling. LFA-1 mediated recruitment of WASP and Arp2/3 would put in place a mechanism for firm adhesion that can occur prior to an effector cell to engaging receptors that determine the sensitivity or resistance of a target. Although we do not have the data to show it, it would be interesting to test whether LFA-1 activation and engagement precedes the engagement of the TCR or NK cell activating receptors. An interesting question that arises from this hypothesis is the role of inhibitory signaling in this model. An NK cell that has engaged inhibitory receptors does not sustain an engagement with its potential target, and thus does not maintain actin polarity. In human NK cells, inhibitory receptor signaling recruits SHP-1 phosphatase, which targets Vav1. Dephosphorylation of Vav1 by SHP-  138  1 blocks downstream actin rearrangement and actin dependent recruitment of further activating proteins15. While presumably inhibitory signaling would not prevent LFA-1 mediated actin polarization, it would be interesting to test whether inhibitory signaling simply blocks further actin polymerization or whether it actively promotes a loss of polarity towards a target through targeted actin depolymerization. Actin depolymerization is induced by the ubiquitouslyexpressed protein cofilin16. However, determining whether cofilin is required for actin depolymerization following inhibitory signaling is complicated by the fact that cofilin localizes to the immune synapse and is required for immune synapse formation and T cell activation17.  While we did not explore the mechanism in CTLs, in Chapter 4 we show that in NK cells talin is required for WASP recruitment via the localized production of PIP2 following LFA-1 ligation. This PIP2-dependent mechanism of WASP recruitment has not been previously described. It is possible that the requirement for PIP2 in WASP localization in NK cells is for the maintenance of active WASP through relief of autoinhibition, which would allow for the anchoring of WASP at the membrane through GTP-bound Cdc42, or SH3 domain containing membrane associated adaptors. Our study suggests that localized increase in PIP2 concentration is responsible for the recruitment of WASP to the site of PIP2 production. In migrating cells such as neutrophils, localized PIP3 production, which is regulated dynamically by the activity of PI3K and the phosphatase PTEN, orients the cell, in particular the actin cytoskeleton, towards a source of chemoattractant as detected by G protein coupled receptors18. Similarly, in T cells, localized DAG production is required for reorientation of the MTOC towards a target cell. This has been elegantly shown in a number of ways by Quann et al., who also show that localized DAG accumulation is maintained in part by the activity of the DAG kinase DGK acting at the  139  periphery of the immune synapse to limit diffusion of DAG19. Taken together these results show an interesting role for localized gradients of phospholipids playing a role in lymphocytes. They also paint a picture of a very complex system of reciprocal regulation of phospholipids and actinassociated proteins.  In our system, we report defects in actin accumulation in WASP-KO NK cells, which is consistent with reports of NK cells from WAS patients showing defective actin accumulation and cytotoxicity. However, in some models of WASP-deficient T cells, the accumulation of talin and actin at the immune synapse is normal and defects in cytotoxicity are not observed20,21. In addition, in WASP-KO NK cells treated with IL-2, actin accumulation is restored within several hours22. These results suggest that an alternate pathway of WASP-independent actin polymerization is rapidly inducible in T and NK cells. The identity of the NPF in this system remains a mystery, although it is possible that the compensation seen in the absence of WASP is attributable to more than one factor. In T cells, WAVE is found at the immune synapse and activates Arp2/323. However, we found no sign of WAVE accumulation following LFA-1 engagement in IL-2-activated NK cells, despite WAVE expression in these cells (data not shown). Other NPFs play a role in NK cell actin dynamics, in particular the cortactin homologue HS1. Knockdown of HS1 results in decreased actin accumulation at the immune synapse, lowered cytotoxicity and impaired binding to ICAM-1, suggesting that HS1 regulates both actin and integrin function in NK cells24. It is interesting that, following IL-2 treatment, this as yet undefined pathway of actin polymerization takes precedence over the WASP-dependent pathway, as we see no localization of WASP to LFA-1 following IL-2 treatment in WT cells. The localization of talin and Arp2/3 to LFA-1 is unaffected, while vinculin localization is  140  abrogated. This suggests that this unknown mechanism utilizes a vinculin-independent mechanism of Arp2/3 recruitment.  5.3 A revised model for talin’s role in LFA-1 function Following this study I can propose a model for the role of talin in LFA-1 function in cellmediated cytotoxicity (Figure 5.1). We have shown that following binding of LFA-1 to ICAM1, talin is recruited. Talin associates with, and thereby recruits, vinculin and Arp2/3, although Arp2/3 is likely recruited via vinculin, as no direct interaction between talin and Arp2/3 has been reported. In addition, talin associates with and recruits PIPKI. Upon translocation of this complex to the plasma membrane, PIPKI becomes activated and produces PIP2, which recruits WASP. WASP becomes activated at the membrane, likely by active Cdc42, and in turn activates Arp2/3 to produce F-actin at the plasma membrane. This actin polymerization is the initial step in cytoskeletal polarization, and a second activating signal is then sufficient for polarization of the cytotoxic granules towards the target.  5.4 Future directions A natural continuation of this study would be to introduce truncated or mutated forms of talin into talin-KO NK cells, just as it would be good to re-introduce full-length talin as a control. Expression of the talin head alone in talin-KO NK cells may be sufficient for integrin activation, as over-expression of talin head activates 1 and 3 integrins11. However, it should be noted that talin head was over-expressed in these previous studies. Talin head expressed at a more physiological level may not be translocated to integrins, because the C terminal I/LWEQ actinbinding motif of talin is required for targeting of talin to focal adhesions12. One could predict that 141  expression of talin head alone in NK cells may be sufficient for LFA-1 activation but not the actin polymerization function of talin. This may result in a phenotype similar to that seen when talin-KO NK cells are treated with Mn++, which induces active conformation of LFA-1. Mn++treated talin-KO NK cells show reduced binding to ICAM-1 and are unable to polarize towards their targets. As talin contains actin binding sites in the head, and a second integrin-binding site in the rod, it is difficult to predict to what extent these sites could contribute. It is unlikely that the talin head alone would be sufficient to rescue the phenotype of talin-KO NK cells, simply by the argument that selective evolutionary pressure would eliminate modules of such a large protein were they not required. As all of talin’s vinculin binding sites are in the rod, it is most likely that the rod is required for recruitment of actin polymerization machinery. Truncation mutations would also aid in determining which of the vinculin binding sites, if any, are preferentially required for this function. While this reconstitution of talin would be a logical progression of this project, the technical difficulties associated with the transduction of large cDNAs into in vitro generated ES-derived NK cells has so far prohibited it.  In addition, the WASP-independent pathway of actin polymerization following IL-2 treatment is an intriguing question. As we have now found a way to expand NK cells in vitro with IL-15, it may be easier to compare the two pathways using IL-15 activated and IL-2 activated NK cells. As IL-2 and IL-15 share the common  chain and seem to activate many similar pathways in NK cells, the difference in phenotypes between these cells is perhaps surprising. However, differences in signaling from the IL-15R chain have been reported, suggesting there is some non-redundant function between IL-2 and IL-15 signaling25.  142  LFA-1  CD44 Talin  ?  Src kinase? ? Vav Pyk2#  PIPKI ERM  Rac  Vinculin* PIP2  arp2/3  Cdc42  WASP*  actin Figure 5.1. A revised model for talin’s role in LFA-1 function. LFA-1 activation may be mediated by talin. Following ligand binding by LFA-1, talin binds LFA-1 and recruits Arp2/3 through its association with vinculin, which binds talin directly. Talin also recruits PIPKI, which is activated at the plasma membrane, possibly by Pyk2. PIP2 produced by PIPKI recruits WASP. Talin-independent signaling from LFA-1 includes phosphorylation and recruitment of Pyk2, which can also be induced by antibody cross-linking of LFA-1. Vav is also phosphorylated following LFA-1 engagement, and although it is unclear what the relationship between Src family kinases, Pyk2 and Vav is, one hypothesis is that Vav activation leads to activation and recruitment of Cdc42, which in turn could activate WASP at the plasma membrane to catalyze actin polymerization by Arp2/3. We have also shown that CD44 may function in receptormediated actin polarization. Not shown are other molecules known to play a role in inside-out and outside-in signaling, such as Rap, RIAM and RapL. Legend: * not seen in IL-2 activated NK cells. # reproducible by antibody cross-linking. Dashed lines indicate a relationship not tested in this study.  143  5.5 Summary This thesis has examined the role of talin in LFA-1 function in both cytotoxic T lymphocytes and NK cells. In order to do so, two systems we used were particularly useful in lending insight into talin function. The first was a system in which cell-sized beads were coated with ICAM-1 and cells were analyzed by confocal microscopy. This allowed us to examine LFA-1 signaling in the absence of other receptor signaling. The second was the generation of talin-KO NK cells that allowed us to examine in detail the role of talin in LFA-1 function. With these systems, we have revealed previously unrecognized roles for talin in LFA-1 function, and for LFA-1 in NK cellmediated cytotoxicity. We have shown that talin recruits key actin polymerization machinery to integrins following the binding of LFA-1 to its ligand and elucidated the multiple pathways by which it does so. We have shown that the actin polarization mediated by LFA-1 and talin is a prerequisite for subsequent cytotoxicity. While these studies focused on CTLs and NK cells, integrin signaling to the actin cytoskeleton is an important part of signaling in many hematopoeitic cells, and our findings shed light on an important signaling pathway that, until now, has not been known. In particular, this study highlights the importance of LFA-1 signaling in cell-mediated cytotoxicity. We showed that LFA-1 not only mediates adhesion but also transduces important stimulatory signals leading to reorganization of the actin cytoskeleton. Furthermore, talin’s role in cytotoxicity is not limited to LFA-1 activation, but includes the critical transduction of LFA-1-mediated outside-in signaling.  144  5.6 Bibliography 1. Dustin ML and Springer TA. T-cell receptor cross-linking transiently stimulates adhesiveness through LFA-1. Nature. 1989;341:619-624. 2. Burkhardt JK, Carrizosa E, Shaffer MH. The actin cytoskeleton in T cell activation. Annu Rev Immunol. 2008;26:233-259. 3. Kim M, Carman CV, Springer TA. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science. 2003;301:1720-1725. 4. Li YF, Tang RH, Puan KJ, Law SK, Tan SM. The cytosolic protein talin induces an intermediate affinity integrin alphaLbeta2. J Biol Chem. 2007;282:24310-24319. 5. Perez OD, Mitchell D, Jager GC, et al. Leukocyte functional antigen 1 lowers T cell activation thresholds and signaling through cytohesin-1 and Jun-activating binding protein 1. Nat Immunol. 2003;4:1083-1092. 6. Sanchez-Martin L, Sanchez-Sanchez N, Gutierrez-Lopez MD, et al. Signaling through the leukocyte integrin LFA-1 in T cells induces a transient activation of Rac-1 that is regulated by Vav and PI3K/Akt-1. J Biol Chem. 2004;279:16194-16205. 7. Suzuki J, Yamasaki S, Wu J, Koretzky GA, Saito T. The actin cloud induced by LFA-1mediated outside-in signals lowers the threshold for T-cell activation. Blood. 2007;109:168-175. 8. Hunter AJ, Ottoson N, Boerth N, Koretzky GA, Shimizu Y. Cutting edge: a novel function for the SLAP-130/FYB adapter protein in beta 1 integrin signaling and T lymphocyte migration. J Immunol. 2000;164:1143-1147. 9. Baker RG, Hsu CJ, Lee D, et al. The adapter protein SLP-76 mediates "outside-in" integrin signaling and function in T cells. Mol Cell Biol. 2009;29:5578-5589.  145  10. Fostel LV, Dluzniewska J, Shimizu Y, Burbach BJ, Peterson EJ. ADAP is dispensable for NK cell development and function. Int Immunol. 2006;18:1305-1314. 11. Calderwood DA, Zent R, Grant R, Rees DJ, Hynes RO, Ginsberg MH. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J Biol Chem. 1999;274:28071-28074. 12. Franco SJ, Senetar MA, Simonson WT, Huttenlocher A, McCann RO. The conserved Cterminal I/LWEQ module targets Talin1 to focal adhesions. Cell Motil Cytoskeleton. 2006;63:563-581. 13. Bryceson YT, March ME, Ljunggren HG, Long EO. Activation, coactivation, and costimulation of resting human natural killer cells. Immunol Rev. 2006;214:73-91. 14. Mrass P, Kinjyo I, Ng LG, Reiner SL, Pure E, Weninger W. CD44 mediates successful interstitial navigation by killer T cells and enables efficient antitumor immunity. Immunity. 2008;29:971-985. 15. Stebbins CC, Watzl C, Billadeau DD, Leibson PJ, Burshtyn DN, Long EO. Vav1 dephosphorylation by the tyrosine phosphatase SHP-1 as a mechanism for inhibition of cellular cytotoxicity. Mol Cell Biol. 2003;23:6291-6299. 16. Huang Y and Burkhardt JK. T-cell-receptor-dependent actin regulatory mechanisms. J Cell Sci. 2007;120:723-730. 17. Eibert SM, Lee KH, Pipkorn R, et al. Cofilin peptide homologs interfere with immunological synapse formation and T cell activation. Proc Natl Acad Sci U S A. 2004;101:1957-1962. 18. Devreotes P and Janetopoulos C. Eukaryotic chemotaxis: distinctions between directional sensing and polarization. J Biol Chem. 2003;278:20445-20448.  146  19. Quann EJ, Merino E, Furuta T, Huse M. Localized diacylglycerol drives the polarization of the microtubule-organizing center in T cells. Nat Immunol. 2009;10:627-635. 20. Cannon JL and Burkhardt JK. Differential roles for Wiskott-Aldrich syndrome protein in immune synapse formation and IL-2 production. J Immunol. 2004;173:1658-1662. 21. Krawczyk C, Oliveira-dos-Santos A, Sasaki T, et al. Vav1 controls integrin clustering and MHC/peptide-specific cell adhesion to antigen-presenting cells. Immunity. 2002;16:331-343. 22. Gismondi A, Cifaldi L, Mazza C, et al. Impaired natural and CD16-mediated NK cell cytotoxicity in patients with WAS and XLT: ability of IL-2 to correct NK cell functional defect. Blood. 2004;104:436-443. 23. Nolz JC, Medeiros RB, Mitchell JS, et al. WAVE2 regulates high-affinity integrin binding by recruiting vinculin and talin to the immunological synapse. Mol Cell Biol. 2007;27:5986-6000. 24. Butler B, Kastendieck DH, Cooper JA. Differently phosphorylated forms of the cortactin homolog HS1 mediate distinct functions in natural killer cells. Nat Immunol. 2008;9:887-897. 25. Ma A, Koka R, Burkett P. Diverse functions of IL-2, IL-15, and IL-7 in lymphoid homeostasis. Annu Rev Immunol. 2006;24:657-679.  147  APPENDIX 1  DETAILED METHODOLOGIES  148  A.1.1 Mice C57BL/6 mice were bred in the Joint Animal Facility and Animal Resource Centre of the BC Cancer Research Centre. HY-specific TCR transgenic Rag 2-/- C57BL/10 mice were obtained from Taconic Farms (Tarrytown, NY) and bred in our animal colony. Spleens from WAS-/- mice were a gift from K. Siminovitch (Mount Sinai Hospital, Toronto, Canada). All animal use was approved by the animal care committee of the University of British Columbia, and animals were maintained and euthanized under humane conditions in accordance with the guidelines of the Canadian Council on Animal Care.  A.1.2 Murine splenocyte extraction Splenocytes were isolated from 2-6 month old C57BL/6 mice and single cell suspensions were generated. Spleens were crushed and passed through a 70 m filter, then washed once with RPMI 1640 media with 10% fetal calf serum (FCS). For CTL generation, red blood cells were lysed with 0.8% ammonium chloride (StemCell Technologies) and cells were washed once more and resuspended in media. For NK cell enrichment, red blood cells were not lysed.  A.1.3 Generation of CTLs Spleens were taken from male C57BL/6 mice between 2 and 6 months of age and single cell suspensions were prepared as in A.1.2. Fc receptors were blocked with 2.4G2 hybridoma (ATCC, Rockville MD) supernatant for 10 minutes on ice. Dendritic cells were labeled with 0.65 g/ml of phycoerythrin labeled CD11c antibody and isolated using EasySep® PE selection kit (StemCell Technologies, Vancouver, Canada) as per manufacturer’s instructions. Splenocytes from the spleens of 6-12 week old female HY TCR transgenic Rag2-/- C57BL/10 mice were  149  prepared as in A.1.2 and cultured with dendritic cells at a 20:1 ratio in the presence of 20 U/ml IL-2 in RPMI 1640 media supplemented with 10% FCS, 5 X 10-5 M -mercaptoethanol and penicillin/streptomycin. The cells were co-cultured in 12 well tissue culture plates at a density of 3 x 106 cells/ml in a 2.5 ml volume. CTLs were harvested and used for experiments on day 5-6.  A.1.4 Generation of ES-derived NK cells Talin-KO ES cells (clones A28 and J26) were generated as described by Priddle et al.1 and were a gift , with the corresponding wild-type (WT) HM1 clone, from Drs. David Critchley and Susan Monkley (Univ. of Leicester, UK). These were maintained on gelatin-coated tissue culture flasks in the presence of DMEM containing 10% FCS, 0.1 mM nonessential amino acids, 10 ng/ml of leukemia inhibitory factor and 100 µM monothioglycerol (MTG, Sigma-Aldrich, Oakville, Canada). ES cell differentiation was performed after 2 days of culture. ES cells were harvested following trypsinization with 0.05% trypsin-EDTA (Stemcell Technologies) then resuspended at 1,500–2,000 cells/ml in a differentiation medium consisting of IMDM, 10% FCS, 1% methylcellulose, 150 µM MTG, 50 ng/ml mouse stem cell factor (SCF), 30 ng/ml mouse IL-3, and 30 ng/ml human IL-6. 1 ml of the cell suspension was dispensed into 35 mm petri dishes (StemCell Technologies, Vancouver, BC, Canada). The cells were incubated at 37°C for 7-8 days for embryoid body (EB) formation. EBs were harvested, trypsinized and made into singlecell suspension by passing through a 21-gauge 1½-inch needle three times. Cells were stained with biotinylated anti-CD34 and streptavidin-PE and CD34+ cells were isolated by FACS cell sorting. CD34+ cells were seeded on OP9 stromal cells at a density of 7-8 x 104 per well in a 0.5 ml volume and cultured for 7 days in the presence of 30 ng/ml IL-6, 4 ng/ml IL-7, 40 ng/ml SCF, and 100 ng/ml Flt3-Ligand (Flt3-L) (StemCell Technologies, Vancouver BC Canada). After 7-8  150  days, cells were harvested and re-seeded on fresh OP9 and cultured for 14-28 days in the presence of 5 ng/ml IL-15 (StemCell Technologies, Vancouver, BC Canada) and 100 g/ml IL-2 (Peprotech, Rocky Hill, NJ). Maturation of NK cells was assessed by cell morphology and cytotoxicity towards OP9 stromal cells and cells were harvested accordingly, usually approximately 4 weeks after cell sorting.  A.1.5 Generation of IL-2 and IL-15 activated NK cells Splenocytes were taken from 2-6 month old C57BL/6 mice and single cell suspensions were prepared as in 2.1.2. NK cells were isolated using EasySep® NK cell negative enrichment kit (StemCell Technologies). For generation of IL-2 activated NK cells, cells were cultured for 7 days in RPMI 1640 media supplemented with 10% FCS, penicillin, streptomycin, 5 x 10-5 M mercaptoethanol (StemCell Technologies) and 100 g/ml IL-2 (Peprotech, Rocky Hill, NJ). For generation of IL-15 activated NK cells, cells were cultured for 7 days on OP9 stromal cells in RPMI 1640 media supplemented with 10% FCS, penicillin, streptomycin, 5 x 10-5 M mercaptoethanol (StemCell Technologies) and 25 g/ml IL-15 (StemCell Technologies). Media and cytokines were refreshed after 3 days of culture and cells were harvested on day 7-10 for experiments. Flow cytometric analysis confirmed that >95% of NK cells generated this way were NK1.1+CD3- after 7-10 days in culture.  A.1.6 OP9 cell culture OP9 stroma cells (RIKEN, Japan) were cultured in Minimum essential medium eagle, alpha modification with nucleosides (MEM) with 10% FCS, 5 x 10-5 M -mercaptoethanol, penicillin, and streptomycin. 151  A.1.7 L and L (ICAM-1) cell culture Murine fibroblast L cells and ICAM-1 transfected L cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% FCS, penicillin/streptomycin, and 5×10-5 M -mercaptoethanol. ICAM-1 transfected L cells were maintained in the presence of 400 g/ml G418.  A.1.8 EL4 and YAC-1 culture EL-4 and YAC-1 murine lymphoid cell lines were maintained in DMEM supplemented with 5% FCS and penicillin/streptomycin.  A.2 Antibodies and commercial reagents Murine recombinant sICAM-1 was from StemCell Technologies (Vancouver BC, Canada). Cytochalasin D and bovine serum albumin (BSA) fragment V were from Sigma-Aldrich (St. Louis, MO). Calcein-AM and carboxy-fluorescein diacetate, succinimidyl ester (CF-DA SE) were purchased from Invitrogen Molecular Probes (Eugene, OR). Manganese chloride solution was from MJS Biolynx (Brockville, ONT). Polystyrene beads were from Polysciences (Warrington, PA). Polyinosinic-polycytodylic acid (poly I:C), m-3M3FBS and poly-L-lysine (PLL) were from Sigma. Antibodies used in this thesis are listed in tables 2.1 and 2.2.  152  Table A.1 Primary Antibodies Antibody/ Probe PIP2 WASP  Clone  Species ms ms  Monoclonal Conjugate /Polyclonal monoclonal purified monoclonal purified  Company/ cat # SG 915-052 SC 13139  B-9  gt gt rb  polyclonal polyclonal polyclonal  purified purified purified  SC 11785 SC 7534 AB 47654  polyclonal monoclonal monoclonal  purified purified purified  AB 4059 CH 3408 UP 05-386  Use/Dil’n  Granzyme B β tubulin Vinculin  KMX-1 V284  rb ms ms  Talin  8D4  ms  monoclonal  purified  S 3287  Phosphotyrosine Pyk2 Phospho-Pyk2 CD34 Phalloidin Phalloidin Phosphotyrosine LFA-1 (CD11a) H2K CD44  4G10  ms  monoclonal  purified  ML 05-321  C 1 g/ml C 1:50 W 1:500 W 1:500 W 1:500 C 1:50 W 1g/ml C 1:50 C 1:50 C 1:100 W 1 g/ml C 1:100 W 1:1000 W 1 g/ml  N-19 RR102 RAM34 ----------4G10  gt ms ms -----------ms  polyclonal monoclonal monoclonal ----------monoclonal  purified purified biotin rhodamine Alexa 647 purified  SC 1514 UP 05-679 BD13034185 MP R415 MP A-22287 UP 05-321  W 1:500 C 1:50 F 50 g/ml C 1:100 C,F 1:50 W 1.5g/ml  FD441.8  rat  monoclonal  biotin  16-3-22S  ms ms  monoclonal  purified hyb sup  FcR  2.4G2  rat  monoclonal  hyb sup  NKG2D Ly49C/I NK1.1 CD3  C7 5E6 PK136 145-2C11  ar hm ms ms ar hm  polyclonal monoclonal monoclonal monoclonal  FITC FITC APC PE  ATCC TIB213 ATCC Pauline Johnson ATCC HB 197 BL 115711 BD 553276 BD 550627 BD 553063  F 5 g/ml Ad 2 g/ml Cy 40 g/ml Cy 1 ml per 106 cells F 100 l per 4 x 106 cells F 5 g/ml F 0.1 g/ml F 4 g/ml F 2 g/ml  PIPKIγ Talin Arp2  A-20 C-20  Legend: SG Stressgen; SC Santa Cruz; AB Abcam; CH Chemicon; UP Upstate; S Sigma; ML Millipore; BD BD Bioscience; MP Invitrogen Molecular Probes; ATCC American Tissue Culture Collection; BL BioLegend; ms mouse; gt goat; rb rabbit; ar hm Armenian hamster. C confocal; W western blotting; F FACS; cytotoxicity assay; Ad adhesion assay; FITC fluorescein isothiocyanate; PE phycoerythrin; APC allophycocyanin 153  Table A.2 Secondary Antibodies Antibody mouse IgG mouse IgG goat IgG goat IgG goat IgG rabbit IgG rabbit IgG mouse IgG goat IgG rabbit IgG  Animal donkey goat donkey rabbit donkey goat donkey donkey donkey goat  conjugate Alexa Fluor 488 Alexa Fluor 568 Alexa Fluor 488 Alexa Fluor 488 Alexa Fluor 568 Alexa Flour 488 Alexa Fluor 488 streptavidin-PE streptavidin-PE streptavidin-PE  company/cat# MP A21202 MP A11031 MP A11055 MP A11078 MP A11057 MP A11008 MP A21206 J 715036150 J705036147 J111035003  use/dil’n C 10 g/ml C 10 g/ml C 10 g/ml C 10 g/ml C 10 g/ml C 10 g/ml C 10 g/ml W 1:10000 W 1:10000 W 1:10000  Legend: MP Invitrogen Molecular Probes; J Jackson Laboratories; C confocal; W western blotting; PE phycoerythrin  A.3 H60-Fc and CD160-Fc fusion proteins CD160-Fc fusion protein has been described2. H60 cDNA was generated by RT-PCR using RNA isolated from BALB/c mouse splenocytes, subcloned into pBluescript and sequenced. The cDNA encoding the extracellular domain of H60 was PCR-amplified, sequenced and subcloned into the pIG vector. H60-Fc fusion protein was produced and purified as described for CD160-Fc fusion protein2.  A.4 RT-PCR RNA from embryonic stem cells or ES-derived NK cells was isolated with QIAGEN's RNeasy® Mini Kit and reverse transcribed into cDNA using QIAGEN's Omniscript Reverse Transcription kit.  Primer  sequences  were  as  follows:  talin1  FERM  domain  (forward)  5’  TTGTGGGCAGATGAGTGAAA 3’, (reverse) 5’ TAGGTGTGCGTAGTGTGTG 3’, talin2 FERM  domain  (forward)  5’  GCCGAGAAGCGAATATTTCA 154  3’  (reverse)  5’CACTCTCCGGTGAGGACTTC 3’. The PCR thermocycling reactions for both talin1 and talin2 FERM domain RT-PCR were as follows: 3 min at 95°C followed by 32 cycles of 95°C for 45 s, 57°C for 30 s, 72°C for 1 min, and a final 10 min extension at 72°. 18 µl of PCR products from bulk cultures were mixed with 2 µl of 10× loading buffer and analyzed on a 2% agarose gel.  A.4 Adhesion assays A.4.1 ICAM-1 adhesion assay LFA-1–mediated cell adhesion to immobilized soluble ICAM-1 was assayed as described3. Flatbottomed 96 well immunoassay plates (NUNC Maxisorp) were coated with varying concentrations of soluble ICAM-1 (sICAM-1) diluted in 0.1 M sodium bicarbonate buffer for 60 minutes. The wells were washed 3 times with phosphate buffered saline (PBS) and blocked for 30 minutes with 0.5 mg/ml heat inactivated bovine serum albumin (BSA) in PBS. Cells were harvested, resuspended in Hank’s buffered saline solution (HBSS) at a concentration of 106/ml and labelled with 1 g/ml Calcein-AM for 30 minutes at 37°. Cells were washed twice with HBSS 2% FCS and resuspended at 8 X 105/ml. Following blocking, the plate was washed 3 times in PBS and 105 cells in 100 l were allowed to settle on the sICAM-1 coated surface. HBSS 2% FCS containing MnCl2 was added to appropriate wells to a final concentration of 1 mM Mn++. Fluorescence intensity of the cells was measured by CytoFluor 2300 (Millipore, Bedford, MA). Non-adherent cells were washed away with 5 washes of 100 l of warm HBSS 2% FBS and fluorescent intensity was read again. The percentages of cell adhesion were determined by the ratio of the post-wash over pre-wash fluorescence values after subtracting the  155  background fluorescence values. As a specificity control, cells were pre-incubated with 1.5 g/ml anti-LFA-1 (TIB213) or plated on wells coated with 0.5 mg/ml BSA.  A.4.2 YAC-1 conjugate assay Flat-bottomed 96-well NUNC Maxisorp plates were coated for 1h with 100 l per well of 0.05% poly-L-lysine then wells were washed three times with 100 l of PBS. YAC-1 were harvested and resuspended in HBSS 2% FCS, then 105 cells were seeded in 100 l per well and plates were spun at room temperature for 5 minutes at 1200 rpm. NK cells were harvested and labelled with Calcein-AM as in 2.4. NK cells were added to immobilized targets by adding 106 NK cells in 50 l of HBSS 2% FCS, then adding 50 l of warm HBSS 2% FCS containing, where indicated, 4mM Mn++. The final ratio of NK to target cells was 1:1 and the final concentration of Mn++ when used was 1 mM. NK and targets were incubated for 25 minutes at 37°. Fluorescence was read by CytoFluor 2300. Nonadherent cells were washed away with three washes of 100 l warm HBSS 2% FCS and fluorescent intensity was read again. The percentages of cell adhesion were determined by the ratio of the post-wash over pre-wash fluorescence values after subtracting background fluorescence values obtained from measuring fluorescence of unlabeled YAC-1 targets without NK cells.  A.5 Cytotoxicity assays A.5.1 YAC-1 cytotoxicity assay YAC-1 target cells were labelled with Vybrant CFDA SE Cell Tracer kit (Invitrogen Molecular Probes). YAC-1 were harvested, resuspended at 2 X 106/ml in PBS containing 1 M CFDA-SE and incubated for 35 minutes at 37°. Cells were washed once and resuspended at 105/ml in RPMI 156  1640 media supplemented with 10% FCS, 5 X 10-5 M -mercaptoethanol and penicillin/streptomycin. NK cells were harvested and resuspended in RPMI 1640 media supplemented as for targets. CF-SE labelled YAC-1 (104) cells were mixed at varying ratios with NK cells in a 96 well round-bottomed tissue culture plate. When talin-KO NK cells were used as effectors, MnCl2 was added to a final concentration of 1 mM after mixing of effectors and targets. After 4 hours, cells were washed and stained with 5 g/ml propidium iodide and analyzed by flow cytometry. The level of cytotoxicity was determined as the number of CFSE+ cells stained with propidium iodide minus the background level (as determined by target cells incubated without effectors).  A.5.2 L cell and L (ICAM-1) cytotoxicity assay L and L (ICAM-1) target cells were harvested with 0.25% trypsin and resuspended at 106/ml in HBSS with 1 g/ml Calcein-AM for 30 minutes at 37°. Cells were washed once and resuspended in DMEM 5% FCS with penicillin and streptomycin. L (ICAM-1) cells were resuspended in the same and supplemented with 400 g/ml G418. Both were plated in 96 well flat-bottomed plates at 104 per well and grown overnight as a monolayer. The following day targets were counted and NK cells were added at various ratios. Where appropriate, target cells were pre-incubated with 40 g/ml anti-H2Kk antibody for 10 minutes prior to the addition of NK cells. Where appropriate, NK cells were pre-incubated with anti-CD44 hybridoma supernatant prior to their addition to target cells. After 4 hours at 37°, cells were washed 4 times with 100 l HBSS 2% FCS and fluorescence was measured by CytoFluor 2300 (Millipore, Bedford MA). Specific cell lysis was calculated as a ratio of fluorescence of remaining targets to fluorescence of targets  157  incubated without NK cell effectors. Background fluorescence of wells containing media only was subtracted from all values.  A.6 Flow cytometry and cell sorting Cells were harvested, counted and blocked for 15 minutes on ice with 100 l 2.4G2 hybridoma supernatant per 4 X 106 cells. Cells were washed once and resuspended in 50-100 l of PBS 2% FCS, except cells harvested from embryoid bodies, which were resuspended in 1 ml. Antibody was added at appropriate concentrations and cells were incubated for 30 minutes at 4°. Cells were washed once with PBS 2% FCS and, where required, secondary antibody was added and cells were incubated for another 30 minutes at 4°. Cells were washed once more and resuspended in propidium iodide. CD34+ cells were purified on a FACSVantage cell sorter (BD). Flow cytometry was performed using FACSCalibur (BD) and results were analyzed using FlowJo or CellQuest Pro software. For intracellular staining for PIP2, and blocking of anti- PIP2 staining, 200 ng of anti-PIP2 antibody (Stressgen) was pre-incubated with 60 g of PIP2 di8 (Echelon Biosciences) in phosphate buffered saline (PBS) for 30 minutes at room temperature prior to intracellular staining. Antibody to be used for control staining was also subjected to preincubation at room temperature in PBS for 30 minutes. Cells were harvested and fixed in 4% formaldehyde for 30 minutes, then washed twice in PBS before permeabilization for 5 minutes using Hank’s Saponin solution (HBSS containing 2% FCS, 5 mM EDTA, 0.5% Saponin). AntiPIP2 or blocked antibody were added to cells resuspended in Hank’s Saponin solution and cells were incubated for 30’ at 4°. Cells were washed twice in Hank’s saponin solution and Alexa 488 anti-mouse IgG secondary antibody for detection was added. Cells were incubated for 30 minutes at 4° and then washed twice in Hank’s saponin solution before resuspension in the same.  158  A.7 Confocal microscopy A.7.1 Induction of LFA-1 capping Co-capping experiments were performed as described4. CTL were harvested and resuspended 106/ml in pre-warmed Hank’s balanced salt solution with 2% FCS. Cells were aliquoted in 1 ml volumes to polystyrene tubes, then spun and the supernatant was poured off. Cells were incubated at 4° for 30 minutes with 10 g/ml anti-LFA-1 mAb (TIB 213) in 100 l volume. After washing, cells were incubated with Alexa Fluor 488 conjugated donkey anti mouse IgG for secondary detection. Capping was induced by incubation at 37° for 30 minutes during which control cells were kept at 4°. Following capping cells were passed through a 21g needle 5 times and then fixed with 4% formaldehyde for 15 minutes, washed twice and permeabilized with Hank’s saponin solution. Anti-talin antibody was added at a 1:200 dilution or rhodamine phalloidin was added at a 1:100 dilution and cells were incubated for 30 minutes at 4°. Following washing, Alexa Fluor 568 conjugated donkey anti-goat antibody was added for detection of talin. Cells were washed twice and cytospun onto a coverslip.  A.7.2 Binding of cells to beads Polystyrene 10 micron microspheres (Polysciences Inc., Warrington PA) were mixed at a 1:1 ratio with 20 μg/ml solutions of anti-LFA-1 mAb (TIB213), sICAM-1 in Adhesion Buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.2), or 0.05% poly-L-lysine for 1 h at room temperature with occasional agitation to prevent settling. Coated beads were washed three times with RPMI 1640 10% FCS. CTLs or NK cells were harvested, centrifuged and resuspended 1.25 X 106 /ml in RPMI 10% FCS. For each condition, 2.5 X 105 cells in a 200 l volume were added to 5 X 105 beads in a 25 l volume and incubated at 37ºC for 5 minutes. Where indicated, Mn++ was added  159  to cell-bead mixture at a final concentration of 1 mM. For PLC activator experiments, cells were treated with 20 M m-3M3FBS in dimethylsulfoxide (DMSO) for 30 minutes at 37° prior to addition of cells to beads. Untreated cells were incubated with DMSO as a control. The cellbead mixture was gently resuspended and plated onto a poly-L-lysine coated cover slip in the well of a 12 well plate, followed by incubation at 37ºC for various time-points. For fixation, 1 ml of 4% formaldehyde was added to each well and the plate was incubated on a gently shaking platform for 20 minutes. Coverslips were washed twice with 1 ml of PBS then permeabilized with 1 ml of Hank’s saponin solution.  A.7.3 Staining for confocal microscopy Antibody staining was done in a 300 l volume. Cells were incubated with primary antibody for 30-60 minutes at room temperature. Antibody concentrations are listed in Tables 2.1 and 2.2. Following incubation with primary antibody, coverslips were washed three times with 1 ml per well per wash of Hank’s saponin solution by incubating for 5 minutes on a gently shaking platform. Secondary antibody was diluted to 10 g/ml in 300 l of Hank’s saponin solution and coverslips were incubated for 45-60 minutes. Coverslips were washed twice with 1 ml of Hank’s saponin solution for 5 minutes then once with 1 ml of Hank’s Balanced Salt Solution for 5 minutes. Coverslips were allowed to dry then mounted with VectaShield mounting medium (Vector, Burlingame CA).  A.7.4 Acquisition of confocal images For CTL images, CTL-bead conjugates were analyzed using a BioRad Radiance 2000 Multiphoton microscope (Hercules, CA) with a 60x objective lens. Stacks were collected using 160  0.15 μm Z steps. For NK images of actin staining cell-bead conjugates were analyzed using a Leica TCS2 confocal system with a 100X objective lens. All other cell-bead conjugates were analyzed using a Nikon C1-si confocal microscope with a 100X objective lens. Images were collected using sequential scanning to avoid bleed-through. Alexa Fluor 488 was excited at 488 nm and the emission filter was HQ 515/30. Alexa Fluor 568 and rhodamine were excited at 568 nm and the emission filter was HQ 600/50. Images were processed and merged using Volocity software (Improvision) and exported as JPG files. For quantification of CTL images the cellbead interface was cropped and rotated to obtain a view from the CTL side. The fluorescence intensity and area of actin staining were measured using Volocity software on conjugates collected under identical confocal conditions. The “Integrated Intensity” was determined to be the total fluorescence within an encircled selection divided by the area. For quantification of fluorescent intensity at the site of cell binding, the sum intensity in the channel of interest was determined using Volocity software for the area of contact between a cell and a bead and compared to the sum fluorescent intensity of the whole same cell using the following equation: [sum intensity (contact site)/sum intensity (whole cell)] ×100. For quantification of PIP2 accumulation or protein accumulation following PLC activator treatment, fluorescent intensity of staining at the point of contact between a cell and a bead was determined using Volocity software and compared to fluorescent intensity of an area of cell membrane of equal size opposite the contact site. Fluorescent staining at the point of contact is expressed as a ratio over the fluorescent staining at the opposite point. For membrane profiles of PIP2 staining, fluorescent intensity of staining of a line drawn from the point of contact between a cell and a bead to the opposite side of the cell was measured using ImageJ software (NIH). These values were exported to GraphPad software and graphed accordingly.  161  A.8 Immunoprecipitations and western blotting A.8.1 Pyk2 immunoprecipitation and western blotting Polystyrene 60 x 15 mm Petri dishes (BD Falcon) were coated with 10 μg/ml sICAM-1 in Adhesion Buffer (20 mM Tris-HCl, 150 mM NaCl pH 8.2) for 1h at room temperature. Coated plates were washed three times with PBS before use. NK cells were harvested and resuspended in pre-warmed RPMI 1640 10% FCS at 7 × 106 cells/ml. 0.5 ml of cell suspension was added to each plate. After cells were allowed to settle 0.5 ml of pre-warmed media with or without 2 mM MnCl2 was added to each plate and plates were incubated at 37ºC for 20 minutes, washed twice with 1 ml of pre-warmed RPMI 1640 10% FCS, then cells were lysed with 1 ml of ice cold lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM KCl, 1 mM EDTA pH 8.0, 1% Triton X-100, 0.5% BSA, 1 mM Na3VO4, 1 mM PMSF, 5 μg/ml aprotinin, 10 μg/ml leupeptin and 10 μg/ml pepstatin). For time zero time-points, 3.5 X 106 NK cells were lysed in a microfuge tube. TalinKO NK cells were lysed in the presence of 1 mM MnCl2 to replicate conditions of the cells on the ICAM-1 coated plate. Cells were sheared with two passages through a # 26 G needle followed by incubation on ice for 10 minutes. After centrifugation at 13,000 rpm with for 20 minutes at 4ºC, supernatants were taken as cell lysates. Immunoprecipitations were performed by incubating lysates with 1 μg anti-Pyk-2 for 1 hour at 4ºC with constant agitation. Protein G beads (Amersham Biosciences) were added and lysates were agitated for an additional hour at 4ºC. Protein G beads were washed three times with Wash Buffer (lysis buffer without BSA) and the immunoprecipitated proteins eluted with SDS-PAGE sample buffer and boiling for 5 minutes. Samples for each time-point were divided in two equal portions.  162  A.8.2 Immunoprecipitation of vinculin, talin and WASP NK cells were harvested and 5 X 106 cells were lysed in 1 ml ice cold lysis buffer (10 mM TrisHCl, pH 8.0, 150 mM KCl, 1 mM EDTA pH 8.0, 1% Triton X-100, 0.5% BSA) in the presence of protease inhibitors (Roche). After centrifugation at 13,000 rpm with for 20 minutes at 4ºC, supernatants were taken as cell lysates. Immunoprecipitations were performed by incubating lysates with 5 µg of antibody for 10 minutes at room temperature using 1.5 mg Protein G Dynabeads (Invitrogen). Protein G beads were washed 3 times with 100 l wash buffer (lysis buffer without BSA) and the immunoprecipitated proteins were eluted using 20 l SDS-PAGE reducing buffer.  A.8.3 Western Blotting Samples were separated by 7.5% SDS-PAGE gel and blotted to polyvinylidene fluoride membranes (Pall). Membranes were blocked for 1-12h in 5% skim milk powder in PBS 0.1% Tween 20 (Sigma) (PBS-T) and detected by primary antibody with horseradish peroxidaseconjugated secondary antibody. All antibodies were diluted in 20 ml 2% skim milk powder in PBS-T. Following both primary and secondary antibody incubation membranes were washed once for 15 minutes and 4 times for 5 minutes with PBS-T. Secondary antibody was detected with a chemiluminescent system (Amersham Biosciences) according to the manufacturer’s protocol.  163  A.9 Bibliography  1. Priddle H, Hemmings L, Monkley S, et al. Disruption of the talin gene compromises focal adhesion assembly in undifferentiated but not differentiated embryonic stem cells. J Cell Biol. 1998;142:1121-1133. 2. Maeda M, Carpenito C, Russell RC, et al. Murine CD160, Ig-like receptor on NK cells and NKT cells, recognizes classical and nonclassical MHC class I and regulates NK cell activation. J Immunol. 2005;175:4426-4432. 3. Welder CA, Lee DH, Takei F. Inhibition of cell adhesion by microspheres coated with recombinant soluble intercellular adhesion molecule-1. J Immunol. 1993;150:2203-2210. 4. Marwali MR, MacLeod MA, Muzia DN, Takei F. Lipid rafts mediate association of LFA-1 and CD3 and formation of the immunological synapse of CTL. J Immunol. 2004;173:2960-2967.  164  APPENDIX 2  UBC RESEARCH ETHICS BOARD CERTIFICATE OF APPROVAL  165  166  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0070938/manifest

Comment

Related Items