UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Progranulin (PGRN) functions in neuronal cultures Guo, Aobo 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_guo_aobo.pdf [ 1.29MB ]
Metadata
JSON: 24-1.0070855.json
JSON-LD: 24-1.0070855-ld.json
RDF/XML (Pretty): 24-1.0070855-rdf.xml
RDF/JSON: 24-1.0070855-rdf.json
Turtle: 24-1.0070855-turtle.txt
N-Triples: 24-1.0070855-rdf-ntriples.txt
Original Record: 24-1.0070855-source.json
Full Text
24-1.0070855-fulltext.txt
Citation
24-1.0070855.ris

Full Text

PROGRANULIN (PGRN) FUNCTIONS IN NEURONAL CULTURES  by AOBO GUO  B.Sc., Peking University, 2006  A THESIS SUBMITTED IN PARTIAL FULFUILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in The Faculty of Graduate Studies (Surgery)  The University of British Columbia (Vancouver)  September, 2009 © AOBO GUO, 2009  ABSTRACT  Null mutations in the progranulin gene (PGRN) have been identified as a major cause of frontotemporal lobe dementia with ubiquitinated inclusions (FTLD-U). In this disorder, the ubiquitinated aggregated protein inclusions of a normally nuclear-located RNA processing protein called TAR DNA binding protein (TDP-43) accumulate in the cytoplasm of neurons. To determine whether aspects of this clinical pathology can be established in primary cultures of mouse cortical neurons, PGRN levels were knocked down in cultures using lentiviral vectors to introduce siRNA constructs. Similar to observations in the brains of FTLD-U patients, TDP-43 levels were markedly decreased in the nucleus of PGRN knockdown neurons relative to cytoplasmic levels in comparison to control neurons and significantly recovered by over-expressed PGRN, although the TDP-43 cleavage was not obvious in this model. Meanwhile, depletion of PGRN elevated levels of activated caspase-3, and the PGRN-deficient neurons demonstrated enhanced vulnerability to sub-lethal doses of NMDA and H2O2. These results show that it is possible to recapitulate key features of the PGRN null mutation in a culture dish within a short period of time and suggest that the seeds of this form of frontotemporal dementia may be sown early in life.       ii  TABLE OF CONTENTS  ABSTRACT .............................................................................................................................................ii TABLE OF CONTENTS.....................................................................................................................iii LIST OF TABLES .................................................................................................................................iv LIST OF FIGURES ............................................................................................................................... v ACKNOWLEDGEMENTS................................................................................................................. x CHAPTER 1  INTRODUCTION.................................................................................................... 1  1.1 Frontotemporal lobar degeneration (FTLD) ........................................................................ 1 1.2 Progranulin (PGRN) and functions ........................................................................................ 3 1.3 TDP-43 and related neurodegenerative diseases ................................................................. 7 1.4 Aims of the thesis..................................................................................................................... 10 CHAPTER 2 MATERIALS AND METHODS........................................................................ 11 2.1 Mouse primary neuronal culture........................................................................................... 11 2.2 Treatment with amyloid-beta, NMDA and hydrogen peroxide...................................... 12 2.2.1 Amyloid-beta treatment ............................................................................................... 12 2.2.2 NMDA treatment .......................................................................................................... 13 2.2.3 Hydrogen peroxide treatment .................................................................................... 13 2.3 Generation of progranulin siRNA and overexpression vector ....................................... 14 2.3.1 siRNA design and cloning .......................................................................................... 14 2.3.2 PGRN overexpressing vector and cloning .............................................................. 14      iii  2.4 Lentivirus package, titration and infection ......................................................................... 15 2.4.1 Virus packaging and concentration ........................................................................... 15 2.4.2 Virus titration................................................................................................................. 16 2.4.3 Virus titration by one-step real-time PCR ............................................................... 16 2.4.4 Lentivirus infection ...................................................................................................... 17 2.5 MTT assay for cell viability .................................................................................................. 18 2.6 RNA isolation, reverse rranscription and real-time PCR ................................................ 18 2.6.1 RNA isolation ................................................................................................................ 18 2.6.2 RNA concentration measurement ............................................................................. 19 2.6.3 RNA reverse transcription .......................................................................................... 20 2.6.4 Real-time PCR .............................................................................................................. 21 2.7 Protein extraction, Dc protein assay and western blot ..................................................... 22 2.7.1 Protein extraction ......................................................................................................... 22 2.7.2 Dc protein assay............................................................................................................ 22 2.7.3 Western blot ................................................................................................................... 22 2.8 Immunofluorescence ............................................................................................................... 24 2.9 Statistical analysis.................................................................................................................... 25 CHAPTER 3 RESULTS.................................................................................................................. 26 3.1 Levels of endogenous PGRN in sub-lethal neuronal models ......................................... 26 3.1.1 A-Beta treatment on mouse cortical neurons did not regulate endogenous PGRN expression ................................................................................................................... 26      iv  3.1.2 NMDA treatment on mouse cortical neurons did not regulate endogenous PGRN expression ................................................................................................................... 27 3.1.3 H2O2 treatment on mouse cortical neurons did not regulate endogenous PGRN expression ................................................................................................................................. 27 3.2 siRNA knockdown effects on PGRN expression levels .................................................. 28 3.2.1 Effects of siRNA knockdown in PGRN mRNA levels ......................................... 28 3.2.2 Effects of siRNA knockdown in PGRN protein levels ......................................... 29 3.3 Involvements of PGRN in caspase-3 activation and neuronal viability ....................... 29 3.3.1 There is an increase in caspase-3 activation in cells expressing PGRN siRNA .................................................................................................................................................... 29  3.3.2 Caspase-3 activation was unchanged in PGRN siRNA-infected cells expressing human PGRN ...................................................................................................... 30 3.3.3 Neuronal viability ......................................................................................................... 30 3.3.4 Increased vulnerability to NMDA mediated cell death in PGRN-deficient neurons ...................................................................................................................................... 31 3.3.5 Increased vulnerability to H2O2 mediated cell death in PGRN-deficient neurons ...................................................................................................................................... 31 3.4 Changes of TDP-43 in PGRN deficient neurons............................................................... 32 3.4.1 Redistribution of TDP-43 in PGRN knockdown neurons.................................... 32 3.4.2 Immunoreactivity of TDP-43 in NMDA treated neurons .................................... 33 3.4.3 TDP-43 protein is not cleaved in PGRN deficient neurons ................................. 33      v  3.4.4 TDP-43 protein is cleaved to ~35kD bands in NMDA treated neurons............ 34 CHAPTER 4 DISCUSSION AND FUTURE WORK............................................................ 35 4.1 PGRN expression could be regulated by specific dose of H2O2, but not by amyloid-beta or NMDA.. .............................................................................................................. 35 4.2 Effects of PGRN knockdown on activation of caspase-3 and neurons vulnerability 37 4.3 TDP-43 redistributed from nuclei to the cytoplasm in PGRN depleted neurons, but was not cleaved ............................................................................................................................... 39 4.4 Future works ............................................................................................................................. 42 BIBLIOGRAPHY ................................................................................................................................ 64       vi  LIST OF TABLES  Table 1 List of one step real-time PCR primers .............................................................................. 44 Table 2 List of real-time PCR primers............................................................................................... 45 Table 3 List of designed siRNA .......................................................................................................... 46    vii    LIST OF FIGURES  Figure 1 Treatment of cultured cortical mouse neurons with Aβ did not change endogenous PGRN expression ................................................................................................................................... 47 Figure 2 Treatment of cultured cortical mouse neurons with NMDA did not change endogenous PGRN expression............................................................................................................. 48 Figure 3 Treatment of cultured cortical mouse neurons with H2O2 did not change endogenous PGRN expression............................................................................................................. 49 Figure 4 Validation of down-regulation of PGRN mRNA levles in mouse cortical neurons infected with PGRN siRNA-expressing viral vectors..................................................................... 50 Figure 5 PRGN protein levels in mouse cortical cultures infected with the PGRN siRNA-expressing viral vector............................................................................................................. 51 Figure 6 Caspase-3 levels in mouse cortical neuron cultures infected with the PGRN siRNA-expressing viral vector............................................................................................................. 52 Figure 7 Caspase-3 levels in mouse cortical cultures co-infected with the mouse PGRN siRNA-expressing and human PGRN over-expressing viral vectors at 11 DAI ....................... 53 Figure 8 Neuronal death is not significantly increased in PGRN siRNA-expressing cells ... 54 Figure 9 Depletion of PGRN increases vulnerability to NMDA-mediated neuron death ...... 55 Figure 10 Depletion of PGRN increases vulnerability to H2O2-mediated neuron death........ 56 Figure 11 Immunoreactivity of PGRN on neurons treated with the siRNA-expressing vector for 11 days ................................................................................................................................................ 57   viii    Figure 12 Immunoreactivity of TDP-43 on neurons treated with the siRNA-expressing vector for 5 days ..................................................................................................................................... 58 Figure 13A TDP-43 translocates from the nucleus to the cytoplasm in cells expressing PGRN siRNA .......................................................................................................................................... 59 Figure 13B TDP-43 translocates from the nucleus to the cytoplasm in cells expressing PGRN siRNA .......................................................................................................................................... 60 Figure 14 Immunoreactivity of TDP-43 on neurons treated with 50µM NMDA .................... 61 Figure 15 TDP-43 was not cleaved in mouse cortical cultures infected with the PGRN siRNA-expressing viral vector............................................................................................................. 62 Figure 16 TDP-43 was cleaved to ~35kD bands on cortical neurons treated with NMDA ... 63       ix  ACKNOWLEDGEMENTS  I would like to express my deepest gratitude to my supervisor, Dr. William Jia, who inspired, guided, encouraged and supported me, not only on my work but also on my life in these three years. I would like to give my special thanks to Dr. Max Cynader, who offered me lots of valuable ideas and great support for my research. I thank my committee Dr. Shernaz Bamji, who gave me a lot diligent advices and help on image and writing. I also would like to give my thanks to Dr. Weihong Song, who participated in my oral defense and gave me helpful suggestions as the external reviewer. I would like to express my special thanks to Dr. Lucia Tapia. The work on immunocytochemistry was operated under her direction and she worked out some great results for this thesis. I gratefully acknowledge my colleagues, Guoyu Liu, Luke Bu, Wendy Wen, Dong Qiang, Alan Huang, Cleo Lee, Shanshan Zhu, Guang Yang, Ying Jia, Rui Liu, Chengyong Liao, etc. for their great help and support during my three years work and life. Also, I would like to thank Swarni Sunner, Stephanie Thomason, Melanie Bertrand, and Joanne Clifton from department of Surgery, for their grateful help during the process of my Master study. Last but not least, I would like to thank my beloved parents and friends for their loving consideration and great confidence in me all through these three years.       x  CHAPTER 1  INTRODUCTION  1.1 Frontotemporal lobar degeneration (FTLD) Frontotemporal lobar degeneration (FTLD) is the second most common type of early-onset neurodegenerative dementia after Alzheimer’s disease and accounts for 5%~10% of all patients with dementia and 10%~20% of early onset neurodegenerative disease patients (Haugarvoll et al., 2007; Rademakers et al., 2007). With different syndromic variants, FTLD are predominantly characterized by the presence of behaviour and personality changes, language impairment, cognitive decline, and finally resulting in dementia (Bugiani, 2007). With protein inclusions in patients’ brains as the main pathology, this disease could be classified into three categories according to the immunohistochemical properties of the inclusions inside the neuronal cells: tau-positive inclusions, ubiquitin-positive inclusions and inclusions negative for both inclusions as dementia lacking distinctive histopathology (Van Deerlin et al., 2007). Given the high proportion of FTLD patients with family histories of dementia (~25% to 50%), genetic factors are believed to have strong effects on this neurodegenerative disease (Stevens et al., 1998; Chow et al., 1999; Bird et al., 2003; Rosso et al., 2003; Neary et al., 2005). Before 2006, FTD was found to be associated with mutations on the microtubule-associated protein tau (MAPT, tau) encoded by the MAPT gene on chromosome      1  17q21 in several FTD families. The deposition of abnormally hyperphosphorylated tau protein (P-tau) in insoluble filaments in the brain was isolated from neuroectodermic cells of many sporadic and familial cases, therefore this is named as tauopathies (Murrell et al., 1997). Later, FTD was found to be associated with missense mutations in VCP (chromosome 9p13) encoding the valosin-containing protein VCP (Watts et al., 2004) and various mutations in the gene CHMP2B (chromosome 3) encoding the chromatin-modifying 2B proteins (Brown, 1998) involved in formation of multi-vesicular bodies and degradation of receptors (Blair et al., 2008). Meanwhile, some other molecular factors were also reported to be risk factors for FTLD, such as the ubiquitin associated protein 1 (Rollinson et al., 2009). While the linkage to chromosome 17 but no demonstrable tau mutations in several families with FTD had been identified in 2001 (Rosso et al., 2001), it was till 2006, two research groups simultaneously reported the important association of mutations in the gene coding for progranulin (pgrn) in chromosome 17q21.32 with FTD (Baker et al., 2006; Cruts et al., 2006). After that, more kinds of mutations on pgrn were identified to relate to FTLD. Most of the PGRN mutations are non-sense mutations leading to non-sense-mediated mRNA decay and thus result in a loss of function as haploinsufficiency (Baker et al., 2006). Meanwhile, a few missense mutations have also been identified (van der Zee et al., 2007; Mukherjee et al., 2008) and reported to lead either to recued secretion of PGRN (Shankaran et al., 2008) or to a mislocalization of PGRN to the cytosol followed by its degradation.      2  Thus far, neurodegenerative diseases discovered to relate with PGRN mutations were all characterized by a loss of functional PGRN protein, such as in Frontotemporal lobar degeneration (FTLD) (Baker et al., 2006; Mackenzie et al., 2006), Alzheimer’s disease (Brouwers et al., 2007; Cortini et al., 2008) and Parkinson’s disease (PD) (Rovelet-Lecrux et al., 2008).  1.2 Progranulin (PGRN) and functions Progranulin, also named epithelin precursor (Plowman et al., 1992) or acrogranin (Baba et al., 1993), was first isolated from highly tumorigenic mouse teratoma PC cells (Zhou et al., 1993). In human, pgrn is located on chromosome 17q21.32 (Bhandari and Bateman, 1992), while the homologous mouse gene was found on chromosome 11 (Bucan et al., 1996). Progranulin is predicted to be composed of 593 amino acid residues as an 88 kDa glycoprotein and made of 7.5 sequentially arranged granulin/epithelin motifs rich in cysteine (Shoyab et al., 1990; Bateman and Bennett, 1998), which are separated by short intervening spacer sequences (Bhandari and Bateman, 1992; Plowman et al., 1992). Each motif has four-hairpins stacked one above the other in a twisted ladderlike formation (Hrabal et al., 1996). The 6-kD epithelin peptide fragments of PGRN, each containing 12 cysteine residues (Plowman et al., 1992) and corresponding to the individual grn/epi domains, are also functional (Bateman et al., 1990; Shoyab et al., 1990) and released by the proteolytic processing of progranulin.      3  Previously, functions of PGRN in development were well studied (He and Bateman, 2003). As the growth factor for trophoectodermal cells, progranulin was derived from embryonic epithelial lineage and accelerated the onset of cavitation and blastocele expansion (Diaz-Cueto et al., 2000). Cultured blastocyst formation could be significantly delayed by blocking the endogenously secreted PGRN using antibodies. PGRN is expressed during late embryonic development in the brain and spinal cord. It is dramatically upregulated by androgen during development in the ventromedial hypothalamus and arcuate nucleus of the brain in perinatal rats, which are involved in the determination of sexual dimorphism of the brain. Sexual behaviour in adulthood is altered if functions of PGRN are interrupted (Suzuki et al., 1998). The formation tubule and neovascularization are also stimulated by PGRN (Daniel et al., 2003; He et al., 2003). Recently, it is reported that neuronal survival and neurite outgrowth could be enhanced by employment of recombinant progranulin in cultures of rat motor and cortical neurons (Van Damme et al., 2008). Meanwhile, PGRN is also actively involved in the process of wound healing. Injury causes long lasting upregulation of PGRN in dermal wounds, including keratinocytes, inflammatory cells, dermal fibroblasts and endothelial cells, which are quiescent under normal conditions and do not express PGRN in uninjured skin (He et al., 2003). Administering PGRN to cutaneous wounds in rats prolongs inflammatory infiltration, especially of neutrophils, and increases the accumulation of fibroblasts and blood vessels in the wound. Furthermore, there are some cases that upregulation of PGRN mRNA in injured      4  brain tissue appears to occur in microglia, suggesting PGRN may also play a role in inflammation of the nervous system and the regulation of PGRN expression in an ischemic stroke model reflected the function of PGRN in the CNS inflammation (Wang et al., 2003). Furthermore, PGRN can play an important influence on tumor growth. This protein can function as an autocrine regulator of tumorigenesis and is highly expressed in a variety of cancer cell lines, such as adrenal carcinomas and immortalized epithelial cells (He and Bateman, 1999; Lu and Serrero, 2000). And PGRN expression has been reported to enhance many aspects of tumor growth, such as anchorage-independent cell growth of poorly tumorigenic epithelial cells (He and Bateman, 1999, 2003). The biological activities of PGRN are involved in many signalling transduction pathways related to cellular growth and maintenance, such as the mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3'-kinase (PI-3K)/protein kinase B (Akt) pathways (Zanocco-Marani et al., 1999; Lu and Serrero, 2001; He and Bateman, 2003). PGRN activates MAP kinase activity in mouse embryo fibroblasts from IGF-I receptor null mice (Xu et al., 1998). It also stimulates the proliferation of MCF-7 cells through MAP kinase activation, proved by the inhibition of the stimulatory effects of PGRN on DNA synthesis using the MAP kinase inhibitor (Zanocco-Marani et al., 1999; Lu and Serrero, 2001; He and Bateman, 2003). In human breast cancer cells, PGRN was shown to mediate the mitogenic activity of estrogen by inducing cyclin D1 expression and inhibition of PGRN expression resulted in a complete inhibition of tumorigenesis in nude mice, as well as the expression      5  levels of cyclin D1, CDK4 (Cyclin-dependent kinase-4) and MMP-2 (matrix metallo proteinases-2) (Lu and Serrero, 2000, 2001; Liu et al., 2007). Additionally, PGRN may enhance tyrosine-phosphorylation of focal adhesion kinase (FAK) which mediates signalling to and from integrins and the actin cytoskeleton (Cary and Guan, 1999). The biological functions of PGRN may also be mediated by protein-protein interactions between the functional domains of PGRN and its binding partners. Many proteins specifically bind to both progranulin and its proteolytic product, granulin/epithelin were reported. Some studies have suggested the presence of low and high affinity PGRN receptors with a range between 120-179 kDa (Xia and Serrero, 1998). In the membrane, PGRN co-reacts with secretary leukocyte protease inhibitor (SLPI) which protects PGRN from elastase caused proteolysis which digests PGRN to smaller peptides, to regulate inflammation through a tripartite loop (Zanocco-Marani et al., 1999; Lu and Serrero, 2001; He and Bateman, 2003). Additionally, perlecan was reported to interact with PGRN to mediate tumour growth (Gonzalez et al., 2003) and COMP (cartilage oligomeric matrix protein) was identified to regulate chondrocyte proliferation together with PGRN (Xu et al., 2007).       6  1.3 TDP-43 and Related Neurodegenerative Diseases The TAR DNA binding protein 43, also named TARDBP or TDP-43, is a 414-amno acid protein and the primary amino acid structure has strong homology in domain composition to members of the heterogeneous ribonucleoprotein (hnRNP) family (Krecic and Swanson, 1999; Dreyfuss et al., 2002). TDP-43 has two highly conserved RNA recognition motifs (RRM1 and RRM2) flanked by the N-terminal and the C-terminal tail. The N-terminal region contains 2 nuclear localization signals (NLS) and 3 potential caspase-3 cleavage consensus sites (Zhang et al., 2007). The C-terminal tail contains a glycine-rich region often found to mediate protein-protein interaction, which is reported to bind members of the hnRNP protein family (Buratti et al., 2005). TDP-43 was firstly cloned and found to bind to human immunodeficiency virus type 1 TAR DNA sequence motifs (Ou et al., 1995). Then, it was reported to regulate different processes of gene expression, including transcription and splicing, through RNA and DNA binding. Functionally, TDP-43 was shown to play biological activities in promoting the exon 9 splicing of the cystic fibrosis transmembrane conductance regulator gene (Buratti and Baralle, 2001; Buratti et al., 2001; Buratti et al., 2004; Buratti et al., 2005), the exon 3 splicing of the apolipoprotein A-II gene (Mercado et al., 2005) and the exon 7 inclusion during splicing of survival of motor neuron gene (Bose et al., 2008). Additionally, TDP-43 has been implicated in transcriptional regulation and microRNA biogenesis. For instance, loss of TDP-43 in human cells significantly increased cyclin-dependent kinase 6 (Cdk6)      7  protein and transcript levels and resulted in dysmorphic nuclear shape, misregulation of the cell cycle and apoptosis (Ayala et al., 2008). Right after the important discovery of pgrn gene mutation in FTLD-U patients with ubiquitin-positive, tau- and a-synuclein - negative inclusions, TDP-43 was found to be the main protein composing the inclusions in FTLD-U, which was hyperphosphorylated, ubiquitinated, and cleaved to generate C-terminal fragments (Arai et al., 2006; Neumann et al., 2006; Davidson et al., 2007). TDP-43 is normally a nuclear protein and has physiological functions in the nucleus, while pathological TDP-43 inclusions are frequently observed in cytoplasm and inclusion-bearing cells are often devoid of nuclear TDP-43 staining (Neumann et al., 2006). Although a TDP-43-negative subtype of FTLD-U was identified (Roeber et al., 2008) and sporadic FTD was proved to have no association with pathological TDP-43 (Schumacher et al., 2009), the TDP-43 immunoreactivity was found to be very important in diagnosis of different kinds of motor neuron disorders (Dickson et al., 2007) Except for discoveries on FTLD, TDP-43 pathologies were also found in amyotrophic lateral sclerosis (ALS) (Wijesekera and Leigh, 2009), which were used to distinguish sporadic ALS from ALS with SOD1 mutations (Mackenzie et al., 2007; Tan et al., 2007). Then, TDP-43 expression level was proved to correlate with the clinical course of ALS in spinal cord (Sumi et al., 2009) and skeletal muscle (Soraru et al., 2009). It is also increased in cerebrospinal fluid of patients with ALS (Kasai et al., 2009). Recently, the redistribution of TDP-43 was observed in ALS patients (Giordana et al., 2009). Moreover,      8  many other clinical diseases were also reported to be clinicopathological characterized with ubiquitin/TDP-43-positive inclusions, including Alzheimer’s Diseases (Amador-Ortiz et al., 2007; Rohn, 2008), Parkinson diseases (Wider and Wszolek, 2008), Huntington disease (Schwab et al., 2008), myopathies with rimmed vacuoles (Weihl et al., 2008; Olive et al., 2009) or with mitochondrial pathology (Temiz et al., 2009), argyrophilic grain disease (Fujishiro et al., 2009), Perry syndrome (Wider et al., 2008), Pick's disease (Yokota et al., 2009), neuronal injury following axotomy (Moisse et al., 2009), and Wobbler mice modeling motor neuron disease (Dennis and Citron, 2009). After TDP-43 proteinopathy was identified in various neurodegenerative diseases, many groups focused on revealing the molecular mechanisms of TDP-43 and have achieved big progresses on TDP-43 aggregation, translocation and phosphorylation. In 2007, a group from Mayo Clinic found that after transfecting PGRN siRNA into Hela cells, TDP-43 was cleaved by caspase-3 into carboxyl-terminal fragments of 25kD and 35kD (Zhang et al., 2007). More recently, they focused on the downstream effects of that truncated TDP-43 by expressing the same carboxyl-terminal fragments in human embryonic kidney cells and found that full-length TDP-43 localized to the nucleus, but the fragments moved into the cytoplasm and formed aggregates including ubiquitin (Zhang et al., 2009). Similar pathologies of TDP-43 have been shown in yeast before (Johnson et al., 2008). Focusing on the relocalization of TDP-43, a Japanese group applied site specific mutagenesis in combination with proteasome inhibitor in SH-SY5Y cells and recapitulated phosphorylated      9  and ubiquitinated TDP-43 pathological inclusions (Nonaka et al., 2009). They found that the deletion of residues 78-84 resulted in cytoplasmic localization of TDP-43 and the deletion of residues 187-192 localized TDP-43 in nuclei with unique dot-like structures. MG-132, the proteasome inhibitior, caused the mutated TDP-43 to form phosphorylated and ubiquitinated TDP-43 aggregates. Meanwhile, a group from University of Pennsylvania identified that phosphorylation of S409/410 of TDP-43 was a highly consistent feature in pathologic inclusions in the whole spectrum of sporadic and familial forms of TDP-43 proteinopathies. They also developed and characterized novel antibodies raised against phosphorylated S409/410 of TDP-43, by which physiological nuclear TDP-43 was not detectable (Neumann et al., 2009).  1.4 Aims of the thesis Given the important roles of PGRN and TDP-43 in clinical pathologies of various neurodegenerative diseases, I wanted to generate neurodegenerative models in neuronal cultures to examine the two proteins for their molecular mechanisms. Meanwhile, I was also interested in finding a functional relationship between PGRN and TDP-43.    10    CHAPTER 2 MATERIALS AND METHODS  2.1 Mouse primary neuronal culture Pregnant CD1 mice were purchased from Charles River Laboratories (Charles River, Quebec, Canada) and sacrificed according to the guidelines of Institutional Animal Care and Use Committee (IACUC). Primary cerebral cortical cultures were prepared from the embryos of 15 to 16 days fetal mice. After the mother mice were anaesthetized and sacrificed, embryos were transferred to new dishes with cold dissection buffer containing Hanks Balanced solutions (Gibco-BRL, Grand Island, YN), 10mM HEPES (Sigma, Saint Louis, MO) and osmolarity 310-320 mOsm in pH 7.4, and then the whole brains from each embryo were removed and transferred to new dishes with cold dissection buffer again. After the separation of cortices and peeling off meninges with fine forceps, the dissection buffer was removed and 1~2ml 0.25% trypsin (Gibco-BRL, Grand Island, NY) was added to the cortical tissue, followed by 10~20 minutes of incubation at 37 °C. Then the cortical tissue was washed 2~3 times to remove trypsin with DMEM (Gibco-BRL, Grand Island, NY) plus 10% Fetal Bovine Serum (Gibco-BRL, Grand Island, NY) and 1% Penicillin/Streptomycin (Gibco-BRL, Grand Island, NY) and triturated by gently pipetting for 3 times. After spinning the suspension at 1400 rpm for 3 minutes, the supernatant was trashed and the cell pellets were resuspended with 5~10ml plating neurobasal medium containing Neurobasal (Gibco-BRL, Grand Island, NY), 2% B27 plus AO (GIBCO), 2mM L-glutamine (Sigma,   11    Saint Louis, MO), 25uM glutamic acid (Sigma, Saint Louis, MO), 10mM β-mercaptoethanol (Gibco-BRL, Grand Island, NY) and 1% (vol/vol) penicillin/streptomycin (Sigma, Saint Louis, MO). Neurons were counted and plated on poly-D-lysine coated tissue culture dishes at the densities of 1.5x105 cells/well for the 24-well plate and 8.5x105 cells/well for the 6-well plate. 48 hours after plating, the glutamic acid was removed by replacing with fresh maintaining medium containing Neurobasal, B27 plus AO, 2mM L-glutamine, 10mM β-mercaptoethanol and 1% (vol/vol) penicillin/streptomycin. Neurons were cultured at 37 °C in humidified 5% CO2 incubators (NuAir, Plymouth, MN). The medium was changed every 3~4 days by removing half old medium and replacing with the same volume of fresh medium. This culture represents a nearly pure neuronal population since glia cell growth at five days is less than 0.5% (Brewer, 1997) and our own unpublished observations.  2.2 Treatment with Amyloid-Beta, NMDA and Hydrogen Peroxide 2.2.1 Amyloid-Beta Treatment Aβ1-40 (Sigma) was dissolved in appropriate volume of double distilled water and incubated in 37 °C for 1 hour to produce the Aβ fibrils. Then the same volume of sterilized PBS was added into the Aβ solution with the final concentration of 0.5mM in water/PBS to allow the Aβ fibrils growth by incubating the solution at 37 °C for four days. As a negative control, scrambled peptide for Aβ was synthesized and incubated under the exactly same   12    condition as the Aβ. To obtain the Aβ-induced toxicity model, 25uM Aβ or scrambled peptide solution was applied on DIV 10 mouse cortical neurons for 24 hours. Neurons growing in 24-well plates were assessed for cell viability assay and for mRNA and protein expression assays in 6-well plates.  2.2.2 NMDA treatment Glycine and NMDA (both from Sigma) were dissolved in double distilled water to reach stock concentrations of 20mM and 50mM, respectively. The stock solutions were added to the culture medium to achieve final concentrations of 20µM and 50µM, respectively. The neurons were treated on DIV 10 for one hour at 37°C before the medium was changed to control medium for another 24 hours. Neurons without NMDA toxic treatment were cultured under the same condition as the negative control. Neurons growing in 24-well plates were tested for cell viability assay and for mRNA and protein expression assays in 6-well plates.  2.2.3 Hydrogen Peroxide Treatment The H2O2 solution (30% w/w, Sigma) was first diluted to 40mM in double stilled water to make a stock solution. It was then further diluted to 40µM in the culture medium and used to treat neurons on DIV 10 for 12 hours at 37°C. Neurons without H2O2 toxic treatment were cultured under the same condition as the negative control. Neurons growing    13    in 24-well plates were treated for cell viability assay and for mRNA and protein expression assays in 6-well plates.  2.3 Generation of progranulin siRNA and overexpression vector 2.3.1 siRNA design and cloning Three candidates of complementary pair of oligonucleotides coding for siRNA against mouse PGRN and a scrambled sequence control were synthesized (Integrated DNA Technologies) (Table 3). The double-stranded DNA fragments coding for the siRNAs were inserted into the pSUPER vector according to the manufactuer’s instructions (OligoEngine) to generate lentivirus constructs using pLenti3.7 vector.  2.3.2 PGRN overexpressing vector and cloning In order to over-express PGRN in mouse cortical neurons, human progranulin cDNA was subcloned into the viral FUW vector (Reed et al., 2006) at the 3’ end at BamHI and EcoRI sites from pcDNA3.1 plasmid (a generous gift from Dr. Andrew Bateman, McGill University). The progranulin cDNA in FUW vector was named as FUPW and the FUW vector expressing GFP, known as FUGW, was applied as the control vector.    14    2.4 Lentivirus package, titration and infection 2.4.1 Virus packaging and concentration All four vectors mentioned above were packaged to lentivirus vectors respectively as described earlier (Yu et al., 2006), by transfecting HEK 293T cells using a polyethyleneimine procedure (Horbinski et al., 2001; Reed et al., 2006), which yields 90% transfection efficiency. For each 10cm dish, 6μl of 50% (wt/vol) polyethyleneimine and 3μg DNA were separately mixed with 125μl serum free Dulbecco's modified Eagle's medium (DMEM), combined together, and incubated at room temperature for 20 minutes. The mixture was added to each dish followed by adding the same volume of DMEM with 20% FBS 4 hours later. Ten microgram of each plasmid mixed with 5μg of vesicular stomatitis virus glycoprotein (VSVG) and 7.5μg of the packaging plasmid pCMV-Δ8.9 (second generation) were co-transfected into HEK 293T cells at 90% confluency in 10cm dishes. After the transfection, medium was changed 16~20 hours later and the viral supernatants were harvested 48 hours and 72 hours later. Followed by spinning at 3000 rpm for 15 minutes to remove cell debris, supernatants were filtered through 0.45-μm-pore size filters and concentrated by ultracentrifugation (Sorvall® ultracentrifuge, Mandel, Guelph, Ontario, Canada) for 2 hours at 2750 rpm at 4°C. Viral pellets were then resuspended in an appropriate volume of neurobasel and stored at -80°C for use in neuronal cultures.    15    2.4.2 Virus titration There were four lentiviral vectors to be titrated, which were PGRN-siRNA, PGRN-siRNA scramble, FUGW and FUPW. The FUGW vector, expressing the green fluorescent protein (GFP) in all cells, was selected as the standard vector and its titration was assessed on day 3 after infecting HEK 293T cells in 6-well dishes with 1ul virus of ten-fold serial dilutions. Numbers of GFP expressing cells were counted and the virus titer was calculated using the formula P*C0*D, where P is the percentage of GFP positive cells within total cells in one culture well, C0 is the total number of cells at the time of virus infection, and D is the dilution factor.  2.4.3 Virus titration by one-step real-time PCR Titers of other three vectors, FUPW, PGRN-siRNA and PGRN-siRNA scramble, were obtained by quantitative RT-PCR on the viral genome. RNA samples were isolated from concentrated viruses using phenol-choloroform (Invitrogen), followed by adding 1μl RNA with known concentration in each virus RNA sample. After digestion with Dnase I, 2ul of samples for each virus was directly mixed with SYBR® Green PCR master mix, MultiScribe™ reverse transcriptase (Applied Biosystems) and 500 nM primers for the 25μl volume/well one step real-time PCR system. The viral RNA was measured with the lentiviral general antigen gene (GAG) primers and actin from added RNA was employed as the internal standard. The Ct values for each virus were measured by Applied Biosystems 7300 Real-Time PCR System with the thermal cycler profile: 48°C for 30 minutes (which   16    was the only different condition from the two-steps real-time PCR), 95°C for 10 minutes, at 95°C for 40 repetitions with 15 seconds in each cycle, and 60°C for 1 minute. Then, the fold changes of viral RNA in FUPW, PGRN-siRNA or PGRN-siRNA scramble compared with FUGW were calculated using the formula 2-(ΔΔCt), where ΔΔCt was the ΔCt(target vector)-ΔCt(FUGW), and ΔCt was Ct(gag)-Ct(actin). Primers applied for one step real-time PCR were listed in Table 1.  2.4.4 Lentivirus Infection The concentrated viral stocks of PGRN-siRNA or scrambled control were applied to neurons at DIV 5 with 5 MOI (Multiplicity of Infection = ratio of infectious virus particles to cells). For each well, half original neurobasel was removed and virus was added four hours later, the equal amount of neurobasel was added. Almost 100% percent of neurons were GFP positive 5 days after infection (DAI). Effects of PGRN knockdown and consequential changes were examined at DAI 5 or 11 by MTT test for cell viability and mRNA and protein expression assays. For the rescue experiments, neurons were infected with FUPW or FUGW virus at DAI 5 of the siRNA infection at the same MOI and the neurons were examined at DAI 11 by protein expression assay.    17    2.5 MTT assay for cell viability The viability of cultured cells was assessed using MTT assay (Korting et al., 1994). Neurons were plated in 24-well plates with the density of 1.5x105 cells/well. MTT (3-(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide) (Sigma, Saint Louis, MO) was dissolved in PBS to reach stock concentration of 5mg/ml. After treatments, culture medium was removed and 200 µl fresh medium with 0.5mg/ml MTT was added to each well. Following the incubation at 37°C for 4 hours to allow the MTT metabolized, 400µl lysis buffer at pH 4.8 containing 50% (vol/vol) N, N-dimethylformamide (Sigma, Saint Louis, MO), 200mg/ml SDS (BioRad, Hercules, CA) and 0.4% (vol/vol) glacial acetic acid (Fisher Scientific, PA) was applied to neurons followed by incubating overnight in 37°C humidified 5% CO2 incubator. The optical density of each sample was measured at 590 nm absorbance using the “uQuant” microplate spectrophotometer (Bio-Tek Instruments, USA).  2.6 RNA isolation, reverse transcription and real-time PCR 2.6.1 RNA isolation Neurons in 6-well plates were lysed in 1ml Trizol® Reagent (Invtirogen, Carlsbad, CA) per-well by repetitive pipetting and the homogenized samples were incubated for 5 minutes at room temperature to permit the complete dissociation of nucleoprotein complexes after transferred to 1.5ml autoclaved tubes. 0.2ml of chloroform per 1ml of TRIZOL reagent   18    was added to each tube and the capped tubes were hand-shook vigorously for 15 seconds followed by 2~3 minutes of incubation at room temperature. The colorless upper aqueous phase containing RNA was obtained by centrifuging the previously mixed samples at 13krpm for 15 minutes at 4°C and removed to fresh autoclaved tubes. 0.5ml of isopropyl alcohol per 1ml of TRIZOL reagent used for the initial homogenization was mixed with the aqueous phase in each tube to precipitate the RNA. Tubes were then shook gently by hand and incubated at room temperature for 10 minutes. RNA pellets, in gel-like forms on the side and bottom of tubes, were obtained by centrifuging at 13krpm for 10 minutes at 4°C. Supernatants were removed and pellets were washed once with 1ml of 75% ethanol in DEPC-ddwater per 1ml of TRIZOL reagent used initially. Samples were then mixed by vortexing and spun by centrifuging at 7.5krpm for 5 minutes at 4°C. Finally, RNA pellets were air-dried completely for 5~10 minutes and dissolved in RNase free DEPC water by incubating samples at 55~60°C for 10 minutes. RNA solutions were stored at -80°C.  2.6.2 RNA concentration measurement For each sample, 1µl RNA solution was diluted with 49µl DEPC water (dilution factor = 50) in one well of micro UV protective 384-well plate (Corning, USA) and two wells of 50µl DEPC water were added as blanks. Optical densities were measured at 260/280 nm using the microplate spectrophotometer. Since an absorbance of 1 unit at 260 nm corresponds to 0.04µg of RNA per µl, RNA concentration was calculated by the equation: 0.04µg/µl*(absorbance at 260nm corrected by blanks)*(dilution factor) =   19    concentration of RNA (µg/µl). The ratio of absorbance at 260/280nm, both corrected by blanks, indicated the purity of isolated RNA.  2.6.3 RNA reverse transcription Before synthesizing the first-strand cDNA, DNA in the RNA solutions should be removed by DNase I (Amplification Grade, Invitrogen) digestion. One microliter of DNase I (Amp. Grade, 1U/µl) was mixed with 1µg RNA sample, 1µl 10X DNase I reaction buffer and DEPC water to 10ul reaction system in RNase-free 0.5ml microcentrifuge tubes. After incubation at room temperature for 15 minutes, DNase I was inactivated by adding 1µl of 25mM EDTA solution to each reaction mixture followed by incubation at 65°C for 10 minutes. Then 1µl Oligo (dT)12-18 (500µl/ml) and 1µl dNTP Mix (10mM each) were mixed with each 10µl DNA-digested RNA solution. After incubated at 65°C for 5 minutes and quickly chilled on ice for at least 1 minute, each sample was mixed with 4µl 5X First-Strand Buffer, 2µl 0.1M DTT and 1µl RNase Out (40 units/ul, Invitrogen) followed by incubation at 42°C for 2 minutes. Finally, 1µl of SuperScript™ II Reverse Transcriptase (Invitrogen) was mixed with each sample followed by incubation at 42°C for 50 minutes then at 70°C for 15 minutes. The cDNA samples were stored at -80°C and used as the templates for amplification in regular PCR or real-time PCR.    20    2.6.4 Real-time PCR For real-time PCR analysis, each cDNA sample was 4-fold serially diluted to three dilutions. 25ul PCR volume system was applied and 2ul of each diluted cDNA sample was added to 96-well real-time PCR plates along with 23ul of master mixed solution containing 12.5ul SYBR® Green PCR master mix (Applied Biosystems, Foster City, CA), 0.75ul of 10uM mixed primers (forward and reverse) for actin or progranulin and 9.75ul DEPC-treated water. Each dilution was duplicated and duplicated wells of DEPC water was applied as the negative control. After spun for five minutes to avoid bubbles in the system, the 96-well plate was processed by Applied Biosystems 7300 Real-Time PCR System with the thermal cycler profile: 50°C for 2 minutes, 95°C for 10 minutes, 95°C for 40 repetitions with 15 seconds in each cycle, and 60°C for 1 minute. The values of threshold cycle number (Ct) were used to quantify the normalized progranulin mRNA expression using the formula 2-(ΔΔCt), where ΔΔCt was the ΔCtstimulus-ΔCtcontrol and ΔCt was Ctprogranulin-Ctactin. The quality of PCR products was monitored by post-PCR melt curve analysis. Primers applied for real-time PCR were listed in Table 2.    21    2.7 Protein extraction, Dc protein assay and western blot 2.7.1 Protein extraction After 3 times washes with iced-cold PBS, neurons in 6-well plate were collected by scraping with iced-cold 1X sample buffer containing 62.5mM Tris-HCl (pH 6.8 at 25°C), 2% sodium dodecyl sulfate (SDS), 10% glycerol, 50mM dithiothreitol (DTT) and 0.01% (w/v) bromo-phenol blue. Neuron suspensions were gently transferred into pre-cooled microfuge tubes and boiled at 100°C for 5 minutes to denaturize proteins and then stored at -80°C.  2.7.2 Dc protein assay Protein concentrations of cell lysate were measured using a Dc Protein assay protocol (BioRad). A linear standard curve was generated by dissolving bovine serum albumin (BSA) in the 1X sample buffer at concentrations of 5mg/ml, 2.5mg/ml, 1.25mg/ml, 0.625mg/ml and 1.3125mg/ml. After incubation in the 96-well dish according to the manufacturer’s instructions, optical densities of each sample were measured at 570nm using the microplate spectrophotometer and protein concentrations were calculated according to the standard curve.  2.7.3 Western blot Fifty microgram protein from each sample was loaded for each lane of the Sodium Dodecyl Sulfate PolyAcrylamide Gel for electrophoresis (SDS-PAGE). PageRuler™ Plus   22    Prestained Protein Ladders (Fermentas) were applied at 3~5ul/lane for each gel to determine protein molecular weight and monitor the progress of electrophoretic running. Proteins were separated in 6% stacking gels and 10% separating gel with running buffer containing mixed Tris-Base, Glycine and SDS in distilled water, using Bio-Rad Gel electrophoresis system. Proteins were transferred to nitrocellulose membranes (BioRad, Hercules, CA) using the Bio-Rad Wet Transfer system (Bio-Rad, Hercules, CA) under 100 volts at 4°C for 2 hours. After checked with 1:10 diluted Ponceau Red solution (the stock containing 2% Ponceau S in 30% trichloroacetic acid and 30% sulfosalicylic acid) which could be easily washed out by Tris Buffered Saline Tween20 buffer (TBS-T), membranes were blocked with 5% non-fat dry milk in TBS-T at room temperature for 1 hour, then incubated in 3% BSA/TBS-T overnight at 4°C with antibodies for mouse-PGRN (sheep IgG, 1:1000; R&D Systems, Minneapolis, MN), caspase-3(8G10) (rabbit IgG, 1:1000; Cell Signaling, Danvers, MA), TDP-43 (rabbit IgG, 1:1000; ProteinTech, Chicago, IL) or beta-Actin (rabbit IgG, 1:1000; Cell Signaling, Danvers, MA). After washing with TBS-T, membranes were incubated with donkey anti-sheep secondary antibody (1:1000; R&D Systems, Minneapolis, MN) or anti-rabbit secondary (1:2000; Cell Signaling, Danvers, MA), both conjugated with horseradish peroxidase, in 3% BSA/TBST at 37°C for 1 hour. Blots were developed using an enhanced chemiluminescence reaction assay (PerkinElmer, Waltham, MA) with equal volumes of chemiluminescence reagent and oxidizing reagent followed by exposure using Bio-Rad Fluor-S Multi Imager. Optical densities of each protein blot were measured using    23    NIH ImageJ software. Amount of protein was normalized with intensity of actin within the same sample.  2.8 Immunofluorescence Mouse cortical neurons were grown on coverslips treated with 1mg/ml poly-lysine in 24-well dishes and infected with the lentiviral vectors on the 5th day in vitro. On DAI 5 or 11, the cells were washed once with pre-warmed PBS and fixed with pre-warmed 4% paraformaldehyde (Sigma, Saint Louis, MO)/4%sucrose (Sigma, Saint Louis, MO)/PBS (pH 7.4) for 10 minutes at room temperature. After rinsed with PBS for 3 times, neurons were permeabilized with 0.1% Triton X-100 (Sigma, Saint Louis, MO)/PBS for 2~3 minutes at room temperature. Then the neurons were washed for 3 times and blocked with 10% BSA/PBS for 1 hour at room temperature, followed by incubation with the antibody against mouse-PGRN (1:150; R&D Systems, Minneapolis, MN) or TDP-43 (1:150; ProteinTech, Chicago, IL) overnight at 4°C. After washing repeatedly with PBS, the cells were incubated with anti-sheep antibody conjugated with Alexa 546 (Invitrogen) or anti-rabbit antibody conjugated with Texas Red (Molecular Probes, Eugene, OR) at 37°C for 1 hour and counterstained with Hoescht (Sigma, Saint Louis, MO) staining at room temperature for 2~3 minutes to visualize cell nuclei. Finally, colverslips were mounted on glass slides with antifade reagent (Invitrogen). Microphotographs were taken with an Olympus FluoView FV1000 confocal microscope. TDP-43 intensities in immunofluorecent images were   24    analyzed using NIH ImageJ software. For the image analysis, nuclear masks were created using the Hoescht staining of the cells, and used to measure the Mean Intensity values of the TDP-43 in the nuclei. The mean intensity measurements were normalized by the values in the control cells.  2.9 Statistical analysis Data were obtained from at least three independent experiments. Statistical analysis for mRNA amplification, protein intensities and cell viabilities were all conducted using two-tail Students’ T-test. Statistical differences between groups were considered significant when p<0.05. * indicating p<0.05 and ** indicating p<0.01.    25    CHAPTER 3 RESULTS  3.1 Levels of endogenous PGRN in sub-lethal neuronal models 3.1.1 A-Beta treatment on mouse cortical neurons did not regulate endogenous PGRN expression Given the fact that PGRN is up-regulated in various tissues including the brain unpon injury, we speculate that this gene may also be up-regulated in neurons when the cells are challenged with various insults that produce subsequent neurodegeneration. Amyloid-Beta (A-Beta) was applied on cortical neurons to mimic the condition of neurotoxicity resulting in Alzheimer’s disease. To investigate whether the PGRN expression could be regulated by the A-Beta induced toxicity, 25uM aggregated A-Beta 40 fibrils were incubated in neuronal cultures for 24 hours and cell viabilities were assessed using MTT Assays (Figure 1A). Normalized with untreated control group, the viability of neurons treated with 25uM A-Beta was decreased to 70.7±10.6% (P<0.01). However, there were no significant changes of PGRN expression in those cultures at both mRNA level (105.2±5.2%, P>0.05) and protein level (95.4±8.8%, P>0.1) (Figure 1B). Therefore, A-Beta induced toxicity did not alter endogenous PGRN expression.    26    3.1.2 NMDA treatment on mouse cortical neurons did not regulate endogenous PGRN expression Excitotoxicity induced through stimulation of N-methyl-d-aspartate (NMDA) receptors contributes to neuronal death in many brain injuries. To investigate whether PGRN expression could be regulated by the NMDA induced toxicity, 20uM Glycine and NMDA at two different doses of 10uM or 50uM were incubated in neuronal cultures for 1 hour followed by 24 hours recovery in NMDA and glycine free medium and cell viabilities were assessed using MTT Assays (Figure 2A). Normalized with untreated control group, the viability of neurons treated with 20uM Glycine but no NMDA, 10uM NMDA and 50uM NMDA was 95.4±10.0% (P>0.1), 85.9±8.2% (P>0.05) and 58.4±2.2% (P<0.01), respectively. The levels of PGRN in neurons treated with the above three concentrations of NMDA were 106.8±5.1% (P>0.1), 97.7±3.5% (P>0.1) and 108.4±7.4% (P>0.1) for mRNA; 108.9±5.4% (P>0.1), 102.2±8.2% (P>0.1) and 110.5±11.0% (P>0.1) for protein, respectively (Figure 2B). Thus, NMDA induced toxicity did not change endogenous PGRN expression.  3.1.3 H2O2 treatment on mouse cortical neurons did not regulate endogenous PGRN expression Likewise, exposure to hydrogen peroxide (H2O2) has previously been shown to induce cell death via apoptosis in cultured rat cortical neurons (Whittemore et al., 1994). To investigate whether the PGRN expression could be regulated by the hydrogen peroxide induced toxicity, H2O2 at three doses of 20uM, 40uM and 60uM were added to neuronal   27    cultures and cell viability was assessed using MTT Assays (Figure 3A). Normalized with untreated control group, the viability of neurons treated with 20uM, 40uM and 60uM H2O2 was 88.4±5.5% (P>0.05), 68.3±8.1% (P<0.01) and 54.4±7.0% (P<0.01), respectively. The levels of PGRN in neurons treated with the above three concentrations of H2O2 were 88.6±3.6% (P>0.05), 79.9±6.4% (P<0.05) and 72.7±2.7% (P<0.05) for mRNA; 110.0±11.4% (P>0.05), 115.2±8.3% (P<0.05) and 105.5±10.8% (P>0.05) for protein, respectively (Figure 3B). These results showed that H2O2 induced toxicity down regulated endogenous PGRN mRNA level dose-dependently. However, the changes in PGRN mRNA did not seem to be reflected in the protein level on this model.  3.2 siRNA knockdown effects on PGRN expression levels 3.2.1 Effects of siRNA knockdown in PGRN mRNA levels In view of the evidence that neuronal PGRN levels are reduced in FTLD-U patients with PGRN null mutations, we assessed the effects of PGRN depletion in neurons by infecting with scrambled or PGRN-specific siRNA virus. We designed three short oligos and one scrambled control for the target of mouse PGRN (NM_008175.2), named siRNA.1, siRNA.2, siRNA.3 and Scramble (Table 3). All these oligos were sub-cloned to a GFP expressing vectors and packaged to viruses. Five days after infection, almost all neurons were green with GFP and mRNA levels were measured (Figure 4). At the MOI of 5, PGRN   28    mRNA levels were decreased to 4.1±1.1% (P<0.01) and 25.6±3.5% (P<0.01) in neurons expressing siRNA.1 and siRNA.3, respectively, but no change with siRNA.2 (101.1±4.2%, P>0.1). Interestingly, at a MOI of 10, the mRNA level in neurons infected with siRNA.1, was 7.8±2.5% (P<0.01) of the control, while knockdown effects by siRNA.2 (90.1±4.1%, P>0.05) and siRNA.3 (16.9±1.6%, P<0.01) were better than the lower MOI infection. Thus, the virus of siRNA.1 at MOI 5 was chosen for the following PGRN knockdown experiments.  3.2.2 Effects of siRNA knockdown in PGRN protein levels Then we tested the protein levels in neurons infected by the most effective siRNA sequences. Figure 5 show that infection with the PGRN siRNA-expressing construct caused a dramatic reduction in progranulin expression at both 5th and 11th day after infection. PGRN protein levels were reduced by 86.4±7.15% (P<0.01) compared to neurons infected with the scrambled control at 5 DAI and this reduction in PGRN levels was maintained till at least 11 DAI (84.2±5.56%, P<0.01).  3.3 Involvements of PGRN in caspase-3 activation and neuronal viability 3.3.1 There is an increase in caspase-3 activation in cells expressing PGRN siRNA To determine whether depletion of PGRN enhanced vulnerability to cell death, we examined levels of activated caspase-3. Levels of total caspase-3 (Figure 6) were similar at 5   29    DAI in groups with either the scrambled control or PGRN siRNA, and higher as the cultures aged (11 DAI). Note the difference in the levels of activated caspase-3 between the siRNA treated group and the scrambled control at 11 DAI (180±20.5%, P<0.01) in Panel B of Figure 6. This difference was not observed at the 5 DAI time point (110±11.1%, P>0.05). Our data thus show that the reduction in PGRN levels in cortical neurons increased caspase-3 activation.  3.3.2 Caspase-3 activation was unchanged in PGRN siRNA-infected cells expressing human PGRN To ensure not due to off-target effects of PGRN siRNA on neurons, we tried to reverse the increase of caspase-3 activation on the PGRN depleted neurons by expressing human progranulin, which could not be targeted by the siRNA we used. Figure 7 shows that the human progranulin was expressed after infection. The human progranulin is distinguishable from the endogenous mouse progranulin as the molecular weight is slightly bigger than the mouse progranulin. However, the activated caspase-3 was not significantly decreased in the samples co-infected with PGRN siRNA and over-expression vectors, compared with the PGRN siRNA only treatment.  3.3.3 Neuronal viability As caspase-3 is a key regulator of apoptosis, we asked whether the increased levels of caspase-3 resulted in reduced survival in PGRN-deficient cells using the MTT assay   30    (Korting et al., 1994). Figure 8 show that there was no significant change in cell viability between control and siRNA expressing cells at either 5 DAI (94.7±0.931%, P>0.05) or 11 DAI (89.3±4.58%, P>0.05).  3.3.4 Increased vulnerability to NMDA mediated cell death in PGRN-deficient neurons As there was no significant effect of PGRN depletion on neuronal viability, we next examined the effects of PGRN depletion on neuronal vulnerability to external insults. Previous studies have demonstrated that 50µM NMDA for 1 hour causes submaximal cell death in cultured mouse cortical neurons (Wang et al., 2004; Zhu et al., 2009). Cells were treated with NMDA at 4 or 10 DAI and neuronal viability was assessed using the MTT assay 24 hours later (Figure 9). Treatment of cells with NMDA at 4 DAI resulted in a similar reduction in cell viability in both control cells (36.3±3.47%, P<0.01) and siRNA-expressing cells (41.9±5.29%, P<0.01). Interestingly, although treatment of cells with NMDA at 11 DAI resulted in a 31.6±4.01% (P<0.01) reduction in cell viability in control cultures, there was much greater (60.4±9.41%, P<0.01) cell death occurred in neurons expressing PGRN siRNA.  3.3.5 Increased vulnerability to H2O2 mediated cell Death in PGRN-deficient neurons Likewise, cells were treated with 40µM H2O2 for 12 hours at 4 or 10 DAI and neuronal viability was assessed using the MTT assay at 5 or 11 DAI (Figure 10). Treatment of cells with H2O2 at 4 DAI resulted in a similar reduction in cell viability in both scrambled   31    control (36.4±6.97%, P<0.01) and PGRN-knockdown cells (40.0±6.91%, P<0.01). Treatment of cells with H2O2 at 10 DAI resulted in a reduction of 49.1±0.424% (P<0.01) in cell viability in control cultures, but a much greater reduction in cells expressing PGRN siRNA (81.2±1.97%, P<0.01). Again, the difference between the two groups is statistically significant (P<0.01). Our data thus show that PGRN deficient neurons are more vulnerable to the external insults of NMDA and H2O2.  3.4 Changes of TDP-43 in PGRN deficient neurons 3.4.1 Redistribution of TDP-43 in PGRN knockdown neurons Redistribution of nuclear TDP-43 to the cytoplasm is a hallmark of ALS and FTDL-U pathology (Ahmed et al, 2007). To examine whether these events are recapitulated in cultured cortical neurons expressing PGRN siRNA (Figure 11), neurons were fixed and immunostained with TDP-43 antibodies 5 and 11 DAI. At 5 DAI, TDP-43 in cytoplasm did not significantly increase compared with the scramble (Figure 12). At 11 DAI, redistribution of TDP-43 from the nucleus to the cytoplasm was clearly evident in PGRN-deficient neurons (Figure 13A) and the ratio of TPD-43 fluorescence intensities in the nucleus versus its value in the cytoplasm was analysed, which were normalized with the scrambled siRNA group (Figure 13B). In the PGRN-deficient neurons, the ratio reduced to 81.3±1.94% (N=94, P<0.01) of the scrambled control (normalized as 100%). The cytoplasma translocation of   32    TDP-43 could be reversed by over-expressed PGRN. The cytoplasm/nucleus ratio of TDP-43 was 106±6.21% (N=37, P<0.01) of the control in PGRN expression rescued cells. Meanwhile, overexpression of PGRN in the scrambled control neurons did not significantly change the intracellular distribution of TDP-43 (108±5.95%, N=50, P>0.1).  3.4.2 Immunoreactivity of TDP-43 in NMDA treated neurons Then, we checked if the event of TDP-43 translocation is specifically for PGRN deficient neurons or also could occur by other toxic treatments. Neuronal cultures were treated with 50uM NMDA and the neurons were immunostained with TDP-43 antibodies (Figure 14). It is quite interesting to find that, although significant decrease of TDP-43 in the nucleus was not observed, TDP-43 appeared to be more in the cytoplasm with some inclusion-like stains in the NMDA treated neurons.  3.4.3 TDP-43 protein is not cleaved in PGRN deficient neurons Cleavage of TDP-43 to ~35kD and ~25kD bands is another hallmark of ALS and FTDL-U pathology. We measured the TDP-43 protein expression at both 5 DAI and 11 DAI by western blotting to ask whether the protein was cleaved. As shown in Figure 15, there was no significant change of TDP-43 expression nor any cleavage at both time points. This result is not consistent with the report of TDP-43 cleavage by activated caspase-3 (Zhang et al., 2007). It seems that PGRN deficiency only recapitulate the TDP-43 translocation but not the cleavage in our neuronal culture.   33    3.4.4 TDP-43 protein is cleaved to ~35kD bands in NMDA treated neurons To check whether the cleavage could happen on the NMDA model, in which TDP-43 intracellular distribution was also changed, TDP-43 protein expression in NMDA treated neurons was tested. Western blot analysis demonstrated a significant increase in the cleavage of TDP-43 in NMDA treated cells (Figure 16). This cleavage resulted in an additional fragments observed at ~35kD. This 35kD fragment has previously been reported in the brains of patients with FTLD-U (Zhang et al., 2007). However, we did not observe another cleaved band of ~25kD reported by the same previous study.    34    CHAPTER 4 DISCUSSION AND FUTURE WORK  4.1 PGRN expression could be regulated by specific dose of H2O2, but not by Amyloid-Beta or NMDA Our results indicated that PGRN protein levels were not regulated by either NMDA or beta-amyloid. It’s interesting that treatment of H2O2 decreased PGRN mRNA levels in a concentration-dependent manner, while its protein levels were slightly up-regulated or not changed. It might be worthwhile to further investigate on this phenomenon since it may relate to regulation mechanisms on PGRN gene transcription and translation. Some data suggests that PGRN may function as an autocrine neuronal growth factor. For instance, the addition of low concentrations of PGRN can promote mitogenesis in the PC12 phenochromocytoma-derived neuronal cell line (Zhou et al., 1993). However, the protein behaves quite differently from other neurotrophic factors. For instance, BDNF (brain-derived neurotrophin) was reported to be up-regulated under similar neuronal models. Treatment with NMDA on cerebellar granule neurons increased the level of BDNF mRNA (Favaron et al., 1993) and protein in a concentration- and time-dependent, receptor-mediated manner, which could be blocked by the NMDA receptor antagonist dizocilpine (Bhave et al., 1999). BDNF could be fast released after the activation of NMDA receptors (Simon et al., 2007), suggesting the possibility of BDNF involving in a protective effect against NMDA   35    stimulation. Unlike the BDNF, PGRN may have no protective effects against acute NMDA or beta-amyloid induced toxicities. This was also supported by unpublished data from our lab: neither adding recombinant PGRN protein nor over-expressing pgrn can prevent neurons from cell death under the same insults. Additionally, clinical evidence suggested that blunt-force trauma to the cortex could induce a delayed increase PGRN expression in the hippocampus by 24 hours (Matzilevich et al., 2002). This is different from other growth factors such as BDNF and NGF (nerve growth factor), which are up-regulated much more rapidly within 3 hours, suggesting that the role of PGRN may be different from that of other neurotrophic factors in the brain. It is also possible that progranulin could only be up-regulated on specific cell types and development stages. For instance, the spinal cord of some patients with Creutzfeldt-Jakob disease (CJD) (Baker and Manuelidis, 2003) and ALS (Malaspina et al., 2001) showed a 400% increase of PGRN expression, which was considered to be due to the activated microglia, but not neurons. And high PGRN expression was also found during the CNS development, in embryonic neuroepithelial cells (Austin and Cepko, 1990; Daniel et al., 2003).    36    4.2 Effects of PGRN knockdown on activation of caspase-3 and neurons vulnerability In the present study, progranulin was successfully knocked down in cortical neurons by expressing PGRN-specific siRNA vectors. These approaches worked effectively and reliably, which could be applied for further studies on PGRN functions. We found that a persistent deficiency in PGRN level was required to cause elevation of caspase-3 activity in neuronal cells. This was in contrast to some early studies in non-neuronal cells. For instance, application of progranulin can result in rapid activation of the MAP kinase pathway (He et al., 2002). In some cancer cell lines, progranulin reduction using antisense progranulin resulted in reduced proliferation of cancer cells as reflected by DNA synthesis 48 hours after PGRN knockdown (Lu and Serrero, 2000). We do not know whether the delayed appearance of the phenotype that we report here was due to a delayed effect of progranlin knockdown in neuronal cells or other factors. It’s possible that the residual level of progranulin (~15% of normal) remaining after our siRNA treatment allowed for a delay before the pathological consequences were observed. Meanwhile, the progranulin may play its roles outside neurons as the growth factor and the knockdown intracellular levels of PGRN may not affect the secreted protein levels immediately. It is worth noting that degradation of PGRN in the cell culture medium was rather slow measured in conditional medium collected over 24-hour period from HEK 293T cells (He and Bateman,    37    1999). We also estimated that the half-life of PGRN recombinant protein is around 12 hours at 37°C (unpublished data from our lab). Consistent with findings in non-neuronal tissues, PGRN knockdown of itself did not result in enhanced neuronal death, relative to the scrambled controls, even though levels of activated caspase-3 were increased. However, persistently low level of PGRN increased vulnerability of neurons to normally sub-lethal excitotoxic or oxidative insults. This is presumably attributed to the increased caspase-3 activity. Previous studies in non-neuronal cells showed that progranulin is involved in signalling pathways that regulate cell death, including the PI-3K/Akt/p70, and integrin-associated FAK pathways in SW13 carcinoma cells (He et al., 2002), and the MAP kinase pathways in cancer, fibroblast, and epithelial cells (Zanocco-Marani et al., 1999; Lu and Serrero, 2001; He et al., 2002). Although expression levels of progranulin could not be regulated by normally toxic treatments, it may protect against those sub-lethal insults by reducing constitutive levels of activated caspase-3, acting as a growth and/or survival factor in this regard. Consistently, recent studies (Van Damme et al., 2008) show that progranulin supplementation, in normal neurons, can exert a positive influence on neuronal survival, and neurite outgrowth. Furthermore, the sequence of the siRNA used in the present study was blasted with GeneBee BLAST 2.2.8 Service and confirmed on human cell lines for not affecting human PGRN (unpublished data from our lab). However, overexpression of human PGRN in PGRN knockdown mouse neurons on DAI 5 could not prevent elevation of caspase-3 activation.   38    There are two possible explanations. One possibility is that the caspase-3 background in the neuronal cultures was too high due to repeated lentivirus infection; the other possibility is that it was too late to rescue the cells by overexpressing human PGRN after the endogenous PGRN in the cells were knockdown for 5 days.  4.3 TDP-43 redistributed from nuclei to the cytoplasm in PGRN depleted neurons, but was not cleaved Accumulation of hyperphosphorylated, ubiquitinated and N-terminally truncated TAR DNA-binding protein (TDP-43) and translocation of TDP-43 from nucleus to cytoplasm are two pathological hallmarks in most familial and sporadic forms of FTLD-U and ALS. Our primary neuronal model with PGRN deficiency recapitulated TDP-43 translocation but not cleavage, showing both similarities and differences with other studies that have attempted to reduce levels of progranulin expression. One group (Neumann et al., 2009) showed that progranulin knockdown in Hela cells resulted in caspase-dependent cleavage of TDP-43 (Zhang et al., 2007). They did not observe, as we did, the redistribution of TDP-43 from a predominantly nuclear to extranuclear location which could be rescued by over-expressed PGRN. Interestingly, several other groups have also failed to observe redistribution of TDP-43 from nucleus to the cytoplasm following PGRN knockdown in   39    non-neuronal cells. It appears that there is some special property of neurons that promotes the redistribution of TDP-43 after PGRN knockdown. This might be relevant to the observation that although progranulin and TDP-43 are both ubiquitiously expressed, and have been shown to play important roles in non-neuronal tissue, that the major pathologic phenotype observed with progranulin deficiency appears to be a neuronal one. It’s well known that activated caspases are capable of cleaving a vast array of proteins at specific consensus sites and the executive phase of apoptosis is produced by the caspase-dependent cleavage of hundreds of cellular proteins (Nicholson and Thornberry, 1997; Green, 1998; Hengartner, 2000). Furthermore, caspases substrates are generally categorized as proteins involved in the scaffolding of the cytoplasm and nucleus, cell cycle progression and DNA repair-related proteins (Fischer et al., 2003) and some of them are protein kinases or other relative proteins involved in signal transduction. Recently, the activated caspase-3 cleavage sites and properties on TDP-43 were confirmed (Zhang et al., 2007). According to our data, however, the TDP-43 could be cleaved in the NMDA treated neuronal models but not in the PGRN deficient one albeit activity of caspase-3 was elevated in both cases. It is therefore apparent that cleavage of TDP-43 may not solely dependent on activity of caspase-3 and other factors may also play crucial roles for the event. Furthermore, our data showed that translocation from predominant nucleus to cytoplasm is probably an early step of a series of TDP-43 phenotypes, before the cleavage and aggregation, which may require more factors other than PGRN deficiency alone. This   40    hypothesis is supported by other group’s discoveries in SH-SY5Y cells (Nonaka et al., 2009). They proved that TDP-43 translocation to the cytoplasm induced by mutations on nuclear localization signals (NLS) was not sufficient for its aggregation and treatment of proteasomal inhibitor was required for the aggregation formation. Meanwhile, their results suggested the important role of proteasome activity in the TDP-43 degradation, which was also observed in many other neurodegenerative diseases, such as a significant decrease in proteasome activity in AD brains (Keller et al., 2000). In our model, it might be interesting to impair the proteasome function and see whether we could recapitulate the TDP-43 aggregation in PGRN deficient neurons. Generally, we are curious about how the progranulin deficiency leads to TDP-43 proteinopaghies, especially to the protein translocation based on our data. Basically, there are two mechanisms should be concerned. PGRN could be secreted outside neurons and play roles as a growth factor, quite similar as the role of BDNF or NGF, to act on various receptors and trigger signal pathways to lead a series of TDP-43 changes. The other possible role of PGRN is that localization of TDP-43 was determined by intracellular level of PGRN. The latter is supported by mutations of other genes relating to TDP-43 proteinopathy, such as volasin-containing protein (VCP) (Schroder et al., 2005; Forman et al., 2006; Gitcho et al., 2009), which produces non-secreted protein. There is a translocation mediator, nuclear pore complex (NPC), that is crucial in protein translocation between nucleus and cytoplasm (Allen et al., 2000). NPCs are large (125 MDa) macromolecular complexes that comprise   41    50-100 different proteins, facilitating both import and export processes. Multiple pathways for different cargoes, their transport signals, transport receptors and adapters, and the molecules (and their regulators) are involved in the transport mechanisms by NPC. So it’s quite possible that the intracellular PGRN is directly, or indirectly, involved in the nuclear pore complex and mediates TDP-43 translocation from nucleus to cytoplasm. A striking feature of the results reported here is that it appears to be possible to recapitulate some major features of the human disease pathology that normally takes decades to develop within 11 days or so in cultures of primary cortical neurons. The clear phenotypic changes that we observe here may facilitate the search for disease modifying agents. In addition, our findings suggest that progranulin may have a role in neuronal development, which may be related to its role in FTLD, and further suggest that the seeds of this neurodegenerative disorder may be sown early in life. Neuropsychological investigations of individuals who show PGRN haploinsufficiency, but who have not yet demonstrated full blown FTLD would certainly be indicated by these findings.  4.4 Future Works On based of our results, we are still curious about why TDP-43 could be cleaved in NMDA models but not by PGRN deficiency. I also want to know how PGRN affects intracellular location of TDP-43 and which receptors and signalling pathways are involved.   42    Moreover, how PGRN deficiency links with TDP-43 pathologies is the very important question we are trying to investigate.    43    Table 1 List of one step real-time PCR primers  Target Genes  Direction  Sequences  Actin  Forward  5’-ACGAGGCCCAGAGCAAGAG-3’  Reverse  5’-TCTCCAAGTCGTCCCAGTTG-3’  Forward  5’-GGAGCTAGAACGATTCGCAGTTA-3’  Reverse  5’-GGTTGTAGCTGTCCCAGTATTTGTC-3’  gag    44    Table 2 List of real-time PCR primers  Target Genes  Direction  Sequences  Actin  Forward  ACGAGGCCCAGAGCAAGAG  Reverse  TCTCCAAGTCGTCCCAGTTG  Mouse PGRN  Forward  TTCACACACGATGCGTTTCA  (NM_008175.2)  Reverse  GGTCTTTGTGCAGGGAACTTC    45    Table 3 List of designed siRNA  Name  Target Gene  Target Sequence  siRNA.1  Mouse PGRN  5'-GACAGAGTGCATTGCTGTC-3'  siRNA.2  (NM_008175.2)  5'-ATGGGTATCCTCCAAGTAC-3'  siRNA.3  5'-GGTTGGGAATGTGGAGTGT-3'  Scramble  5'-GCCTATGGTCACAGGTAGT-3'  Website for siRNA design: www.ambion.com/techlib/misc/siRNA_finder.html Website for getting Scrambled Sequence: www.sirnawizard.com Website for Gene Blast: www.genebee.msu.su/blast_new (GeneBee BLAST 2.2.8 Services)    46    Figure 1 Treatment of cultured cortical mouse neurons with Aβ did not change endogenous PGRN expression. A) MTT analysis of neuronal viability on Aβ induced excitotoxicity. 10 DIV neurons were treated with 25µM aggregated amyloid beta for 24 hours. Cell viability was evaluated by MTT assays. B) Real-Time PCR analysis of PGRN mRNA levels and Western Blot analysis of PGRN protein levels on Aβ induced toxicity. N=12, **P<0.01.  A **  Viability of Neurons (%)  120 100 80 60 40 20 0 A-Beta 0  A-Beta 25uM  PGRN Expression Level (%)  B 140 120  mRNA Protein  100 80 60 40 20 0 A-Beta 0  A-Beta 25uM    47    Figure 2 Treatment of cultured cortical mouse neurons with NMDA did not change endogenous PGRN expression. A) MTT analysis of neuronal viability on NMDA induced excitotoxicity. 10 DIV neurons were treated with 50µM NMDA for 1 hour and recovered in fresh medium for 24 hours. Cell death was evaluated by MTT assays. B) Real-Time PCR analysis of PGRN mRNA levels and Western Blot analysis of PGRN protein levels on NMDA induced excitotoxicity. N=12, **P<0.01.  A Viability of Neurons (%)  120  **  100 80 60 40 20 0  B  140  PGRN Expression Level (%)  Gly 0, NMDA 0  120  Gly 20uM, NMDA 0  Gly 20uM, NMDA 10uM  Gly 20uM, NMDA 50uM  mRNA Protein  100 80 60 40 20 0 Gly 0,NMDA 0  Gly 20uM, NMDA 0  Gly 20uM, NMDA 10uM  Gly 20uM, NMDA 50uM    48    Figure 3 Treatment of cultured cortical mouse neurons with H2O2 did not change endogenous PGRN expression. A) MTT analysis of neuronal viability on H2O2 induced toxicity. 10 DIV neurons were treated with 40µM H2O2 for 12 hours. Cell death was evaluated by MTT assays. B) Real-Time PCR analysis of PGRN mRNA levels and Western Blot analysis of PGRN protein levels on H2O2 induced toxicity. N=12, *P<0.05, **P<0.01.  A Viability of Neurons (%)  120  **  **  100 80 60 40 20 0 H2O2 0  H2O2 20uM  H2O2 40uM  H2O2 60uM  B  PGRN Expression Level (%)  140  mRNA Protein  120  * *  *  100 80 60 40 20 0 H2O2 0  H2O2 20uM  H2O2 40uM  H2O2 80uM    49    Figure 4 Validation of down-regulation of PGRN mRNA levles in mouse cortical neurons infected with PGRN siRNA-expressing viral vectors. Knockdown of progranulin expression by each of three siRNAs sequences targeting mPGRN were determined by RT-qPCR analysis at the 5th day post-infection. Scrambled control or PGRN-targeted siRNA vectors were infected at MOI 5 or 10. Expressions of PGRN were normalized to β-Actin (the internal control gene) and presented as the fold changes in expression compared with scrambled control infected group. N=3, *P<0.05, ** P< 0.01.  **  PGRN mRNA Expression (%)  120  ** MOI 5 MOI 10  100 80 60 40 20 0 Scramble  siRNA.1  siRNA.2  siRNA.3    50    Figure 5 PRGN protein levels in mouse cortical cultures infected with the PGRN siRNA-expressing viral vector. A) Western Blot analysis of cortical neuron treated with the siRNA-expressing vector or siRNA scrambled control at 5 or 11 DAI. Cell lysates were immunoblotted for antibodies against mouse PGRN and β-Actin. B) Average densities of the Western Blots in panel A (normalized to β-Actin). N=3, *P<0.05, ** P< 0.01.  si R N A  Sc ra m bl e  Sc ra m bl e si R N A  A  PGRN β-Actin  5 DAI  11 DAI  B Normalized Mean Intensity (%)  120  **  **  100 80 60 40 20 0 5DAI Scr.  5DAI siRNA  11DAI Scr.  11DAI siRNA    51    Figure 6 Caspase-3 levels in mouse cortical neuron cultures infected with the PGRN siRNA-expressing viral vector. A) Western Blot analysis of cortical neuron lysates treated with the siRNA scrambled control or siRNA-expressing vector at 5 or 11 DAI. Cell lysates were immunoblotted for antibodies against Caspase-3 (total and cleaved caspase-3) and actin. B) Average densities of the Western Blots in panel A (normalized to actin). N=3, ** P< 0.01.  e si  R N  A  ra m bl Sc  A R N  si  Sc  ra m bl  e  A  Caspase3 Activated Caspase3 β-Actin 5 DAI  11 DAI  B Normalized Mean Intensity (%)  250  Caspase3 Activated Caspase3  **  200  150  100  50  0 5DAI Scr.  5DAI siRNA  11DAI Scr.  11DAI siRNA    52    Figure 7 Caspase-3 levels in mouse cortical cultures co-infected with the mouse PGRN siRNA-expressing and human PGRN over-expressing viral vectors at 11 DAI. Neurons were infected with human PGRN over-expressing or empty viral vectors at 5 days following the infection with the siRNA-expressing vector or siRNA scrambled vector. For Western Blot, cell lysates were collected at 11 days after the knockdown infection. Samples were immunoblotted for antibodies against mouse PGRN, Caspase-3 (total and cleaved caspase-3) and β-Actin. The PGRN antibody recognizes both mouse (lower bands with lighter molecular weight) and human progranulin (upper bands with higher molecular weight).  hPGRN mPGRN siRNA  PGRN  -  +  + -  + + human mouse  Caspase3 Activated Caspase3 β-Actin    53    Figure 8 Neuronal death is not significantly increased in PGRN siRNA-expressing cells. The MTT assays were run at 5 or 11 DAI. Cell viabilities were normalized to cultures infected with siRNA scrambled vector. N=12, ** P<0.01.  120  Viable Cells (%)  100 80 60 40 20 0 5DAI Scr.  5DAI siRNA  11DAI Scr.  11DAI siRNA    54    Figure 9 Depletion of PGRN increases vulnerability to NMDA-mediated neuron death. Cortical neurons were treated with 50µM NMDA for 1 hour at either 4 or 10 day after infection with siRNA-expressing vectors. The MTT assays were run at 5 or 11 day after infection. Cell viabilities were normalized to cultures infected with siRNA scrambled vector. N=12, ** P<0.01.  140  Viable Cells (%)  120  Control NMDA 50µM  **  100 80 60 40 20 0 5DAI Scr.  5DAI siRNA  11DAI Scr.  11DAI siRNA    55    Figure 10 Depletion of PGRN increases vulnerability to H2O2-mediated neuron death. Cortical neurons were treated with 40µM H2O2 for 12 hours at either 4 or 10 day after infection with siRNA-expressing vectors. The MTT assays were run at 5 or 11 day after infection. Cell viabilities were normalized to cultures infected with siRNA scrambled vector. N=12, ** P<0.01.  140  Control H2O2 40µM  Viable Cells (%)  120  **  100 80 60 40 20 0 5DAI Scr.  5DAI siRNA  11DAI Scr.  11DAI siRNA    56    Figure 11 Immunoreactivity of PGRN on neurons treated with the siRNA-expressing vector for 11 days. 11 DAI, cells were fixed and immunostained for mouse progranulin. Infected neurons were labeled with GFP, nuclei were stained blue with Hoescht (blue), and PGRN immunoreactivity is shown in white.  DAPI  PGRN  GFP  DAPI  PGRN  siRNA  Scramble  GFP    57    Figure 12 Immunoreactivity of TDP-43 on neurons treated with the siRNA-expressing vector for 5 days. At 5 DAI, cells were fixed and immunostained for TDP-43. Infected neurons were labeled with GFP, nuclei were stained blue with Hoescht (blue), and TDP-43 immunoreactivity is shown in red.  DAPI  TDP43  GFP  DAPI  TDP43  siRNA  Scramble  GFP    58    Figure 13A TDP-43 translocates from the nucleus to the cytoplasm in cells expressing PGRN siRNA. At 11 DAI, cells were fixed and immunostained for TDP-43. Infected neurons were labeled with GFP, nuclei were stained blue with Hoescht (blue), and TDP-43 immunoreactivity is shown in red.  GFP  DAPI  TDP43  Merge  GFP  DAPI  TDP43  Merge  GFP  DAPI  TDP43  Merge  GFP  DAPI  TDP43  Merge  siRNA+PGRN  siRNA  Scramble+PGRN  Scramble  A    59    Figure 13B TDP-43 translocates from the nucleus to the cytoplasm in cells expressing PGRN siRNA. Normalized to control neurons, ratios of TDP-43 immunoreactivity in the nucleus  compared  to  that  in  the  cytoplasm  were  analysed.  NScramble=105,  NScramble+PGRN=50, NsiRNA=94, NsiRNA+PGRN=37, ** P<0.01.  B  **  **  120  (Normalized to Scramble)  Ratio of TDP-43 Intensity: N/C  140  100 80 60 40 20 0 Scramble  Scramble+PGRN  siRNA  siRNA+PGRN    60    Figure 14 Immunoreactivity of TDP-43 on neurons treated with 50µM NMDA. At 10 DIV, neurons were treated in 50µM NMDA for 1 hour and recovered with fresh medium for another 24 hours, and then were fixed and immunostained for TDP-43 at 11DIV. Nuclei were stained blue with Hoescht (blue), and TDP-43 immunoreactivity is shown in red.  TDP43  Merged  DAPI  TDP43  Merged  NMDA 50uM  NMDA 0  DAPI    61    Figure 15 TDP-43 was not cleaved in mouse cortical cultures infected with the PGRN siRNA-expressing viral vector. For Western Blot analysis, cell lysates were collected at 5 or 11 DAI with the siRNA-expressing vector or siRNA scrambled control and were  si R N A  e am bl Sc r  R N A  si  Sc r  am bl  e  immunoblotted for antibodies against TDP-43 and β-Actin.  43kD TDP43 35kD 25kD β-Actin 5 DAI  11 DAI    62    Figure 16 TDP-43 was cleaved to ~35kD bands on cortical neurons treated with NMDA. At 10 DIV, neurons were treated in 50µM NMDA for 1 hour and recovered with fresh medium for another 24 hours. Cell lysates were immunoblotted for antibodies against activated  M D A N  C on  tro  l  50  uM  caspase-3, TDP-43 and β-Actin.  43kD TDP43 35kD 25kD Activated Caspase3 β-Actin    63    BIBLIOGRAPHY  Allen TD, Cronshaw JM, Bagley S, Kiseleva E, Goldberg MW (2000) The nuclear pore complex: mediator of translocation between nucleus and cytoplasm. J Cell Sci 113 ( Pt 10):1651-1659. Amador-Ortiz C, Lin WL, Ahmed Z, Personett D, Davies P, Duara R, Graff-Radford NR, Hutton ML, Dickson DW (2007) TDP-43 immunoreactivity in hippocampal sclerosis and Alzheimer's disease. Ann Neurol 61:435-445. Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann D, Tsuchiya K, Yoshida M, Hashizume Y, Oda T (2006) TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Commun 351:602-611. Austin CP, Cepko CL (1990) Cellular migration patterns in the developing mouse cerebral cortex. Development 110:713-732. Ayala YM, Misteli T, Baralle FE (2008) TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression. Proc Natl Acad Sci U S A 105:3785-3789. Baba T, Hoff HB, 3rd, Nemoto H, Lee H, Orth J, Arai Y, Gerton GL (1993) Acrogranin, an acrosomal cysteine-rich glycoprotein, is the precursor of the growth-modulating peptides, granulins, and epithelins, and is expressed in somatic as well as male germ cells. Mol Reprod Dev 34:233-243. Baker CA, Manuelidis L (2003) Unique inflammatory RNA profiles of microglia in   64    Creutzfeldt-Jakob disease. Proc Natl Acad Sci U S A 100:675-679. Baker M et al. (2006) Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature 442:916-919. Bateman A, Bennett HP (1998) Granulins: the structure and function of an emerging family of growth factors. J Endocrinol 158:145-151. Bateman A, Belcourt D, Bennett H, Lazure C, Solomon S (1990) Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun 173:1161-1168. Bhandari V, Bateman A (1992) Structure and chromosomal location of the human granulin gene. Biochem Biophys Res Commun 188:57-63. Bird T, Knopman D, VanSwieten J, Rosso S, Feldman H, Tanabe H, Graff-Raford N, Geschwind D, Verpillat P, Hutton M (2003) Epidemiology and genetics of frontotemporal dementia/Pick's disease. Ann Neurol 54 Suppl 5:S29-31. Blair IP, Vance C, Durnall JC, Williams KL, Thoeng A, Shaw CE, Nicholson GA (2008) CHMP2B mutations are not a common cause of familial or sporadic amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 79:849-850. Bose JK, Wang IF, Hung L, Tarn WY, Shen CK (2008) TDP-43 overexpression enhances exon 7 inclusion during the survival of motor neuron pre-mRNA splicing. J Biol Chem 283:28852-28859. Brewer GJ (1997) Isolation and culture of adult rat hippocampal neurons. J Neurosci Methods 71:143-155. Brouwers N et al. (2007) Alzheimer and Parkinson diagnoses in progranulin null mutation carriers in   65    an extended founder family. Arch Neurol 64:1436-1446. Brown J (1998) Chromosome 3-linked frontotemporal dementia. Cell Mol Life Sci 54:925-927. Bucan M, Gatalica B, Baba T, Gerton GL (1996) Mapping of Grn, the gene encoding the granulin/epithelin precursor (acrogranin), to mouse chromosome 11. Mamm Genome 7:704-705. Bugiani O (2007) The many ways to frontotemporal degeneration and beyond. Neurol Sci 28:241-244. Buratti E, Baralle FE (2001) Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. J Biol Chem 276:36337-36343. Buratti E, Brindisi A, Pagani F, Baralle FE (2004) Nuclear factor TDP-43 binds to the polymorphic TG repeats in CFTR intron 8 and causes skipping of exon 9: a functional link with disease penetrance. Am J Hum Genet 74:1322-1325. Buratti E, Dork T, Zuccato E, Pagani F, Romano M, Baralle FE (2001) Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J 20:1774-1784. Buratti E, Brindisi A, Giombi M, Tisminetzky S, Ayala YM, Baralle FE (2005) TDP-43 binds heterogeneous nuclear ribonucleoprotein A/B through its C-terminal tail: an important region for the inhibition of cystic fibrosis transmembrane conductance regulator exon 9 splicing. J Biol Chem 280:37572-37584. Cary LA, Guan JL (1999) Focal adhesion kinase in integrin-mediated signaling. Front Biosci 4:D102-113.   66    Chow TW, Miller BL, Hayashi VN, Geschwind DH (1999) Inheritance of frontotemporal dementia. Arch Neurol 56:817-822. Cortini F, Fenoglio C, Guidi I, Venturelli E, Pomati S, Marcone A, Scalabrini D, Villa C, Clerici F, Dalla Valle E, Mariani C, Cappa S, Bresolin N, Scarpini E, Galimberti D (2008) Novel exon 1 progranulin gene variant in Alzheimer's disease. Eur J Neurol 15:1111-1117. Cruts M et al. (2006) Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature 442:920-924. Daniel R, Daniels E, He Z, Bateman A (2003) Progranulin (acrogranin/PC cell-derived growth factor/granulin-epithelin precursor) is expressed in the placenta, epidermis, microvasculature, and brain during murine development. Dev Dyn 227:593-599. Davidson Y, Kelley T, Mackenzie IR, Pickering-Brown S, Du Plessis D, Neary D, Snowden JS, Mann DM (2007) Ubiquitinated pathological lesions in frontotemporal lobar degeneration contain the TAR DNA-binding protein, TDP-43. Acta Neuropathol 113:521-533. Dennis JS, Citron BA (2009) Wobbler mice modeling motor neuron disease display elevated transactive response DNA binding protein. Neuroscience 158:745-750. Diaz-Cueto L, Stein P, Jacobs A, Schultz RM, Gerton GL (2000) Modulation of mouse preimplantation embryo development by acrogranin (epithelin/granulin precursor). Dev Biol 217:406-418. Dickson DW, Josephs KA, Amador-Ortiz C (2007) TDP-43 in differential diagnosis of motor neuron disorders. Acta Neuropathol 114:71-79. Dreyfuss G, Kim VN, Kataoka N (2002) Messenger-RNA-binding proteins and the messages they   67    carry. Nat Rev Mol Cell Biol 3:195-205. Fischer U, Janicke RU, Schulze-Osthoff K (2003) Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death Differ 10:76-100. Forman MS, Mackenzie IR, Cairns NJ, Swanson E, Boyer PJ, Drachman DA, Jhaveri BS, Karlawish JH, Pestronk A, Smith TW, Tu PH, Watts GD, Markesbery WR, Smith CD, Kimonis VE (2006) Novel ubiquitin neuropathology in frontotemporal dementia with valosin-containing protein gene mutations. J Neuropathol Exp Neurol 65:571-581. Fujishiro H, Uchikado H, Arai T, Hasegawa M, Akiyama H, Yokota O, Tsuchiya K, Togo T, Iseki E, Hirayasu Y (2009) Accumulation of phosphorylated TDP-43 in brains of patients with argyrophilic grain disease. Acta Neuropathol 117:151-158. Giordana MT, Piccinini M, Grifoni S, De Marco G, Vercellino M, Magistrello M, Pellerino A, Buccinna B, Lupino E, Rinaudo MT (2009) TDP-43 Redistribution Is an Early Event in Sporadic Amyotrophic Lateral Sclerosis. Brain Pathol. Gitcho MA, Strider J, Carter D, Taylor-Reinwald L, Forman MS, Goate AM, Cairns NJ (2009) VCP mutations causing frontotemporal lobar degeneration disrupt localization of TDP-43 and induce cell death. J Biol Chem. Gonzalez EM, Mongiat M, Slater SJ, Baffa R, Iozzo RV (2003) A novel interaction between perlecan protein core and progranulin: potential effects on tumor growth. J Biol Chem 278:38113-38116. Green DR (1998) Apoptotic pathways: the roads to ruin. Cell 94:695-698. Haugarvoll K, Wszolek ZK, Hutton M (2007) The genetics of frontotemporal dementia. Neurol Clin   68    25:697-715, vi. He Z, Bateman A (1999) Progranulin gene expression regulates epithelial cell growth and promotes tumor growth in vivo. Cancer Res 59:3222-3229. He Z, Bateman A (2003) Progranulin (granulin-epithelin precursor, PC-cell-derived growth factor, acrogranin) mediates tissue repair and tumorigenesis. J Mol Med 81:600-612. He Z, Ong CH, Halper J, Bateman A (2003) Progranulin is a mediator of the wound response. Nat Med 9:225-229. He Z, Ismail A, Kriazhev L, Sadvakassova G, Bateman A (2002) Progranulin (PC-cell-derived growth factor/acrogranin) regulates invasion and cell survival. Cancer Res 62:5590-5596. Hengartner MO (2000) The biochemistry of apoptosis. Nature 407:770-776. Horbinski C, Stachowiak MK, Higgins D, Finnegan SG (2001) Polyethyleneimine-mediated transfection of cultured postmitotic neurons from rat sympathetic ganglia and adult human retina. BMC Neurosci 2:2. Hrabal R, Chen Z, James S, Bennett HP, Ni F (1996) The hairpin stack fold, a novel protein architecture for a new family of protein growth factors. Nat Struct Biol 3:747-752. Johnson BS, McCaffery JM, Lindquist S, Gitler AD (2008) A yeast TDP-43 proteinopathy model: Exploring the molecular determinants of TDP-43 aggregation and cellular toxicity. Proc Natl Acad Sci U S A 105:6439-6444. Kasai T, Tokuda T, Ishigami N, Sasayama H, Foulds P, Mitchell DJ, Mann DM, Allsop D, Nakagawa M (2009) Increased TDP-43 protein in cerebrospinal fluid of patients with amyotrophic lateral sclerosis. Acta Neuropathol 117:55-62.   69    Keller JN, Hanni KB, Markesbery WR (2000) Impaired proteasome function in Alzheimer's disease. J Neurochem 75:436-439. Korting HC, Schindler S, Hartinger A, Kerscher M, Angerpointner T, Maibach HI (1994) MTT-assay and neutral red release (NRR)-assay: relative role in the prediction of the irritancy potential of surfactants. Life Sci 55:533-540. Krecic AM, Swanson MS (1999) hnRNP complexes: composition, structure, and function. Curr Opin Cell Biol 11:363-371. Liu Y, Xi L, Liao G, Wang W, Tian X, Wang B, Chen G, Han Z, Wu M, Wang S, Zhou J, Xu G, Lu Y, Ma D (2007) Inhibition of PC cell-derived growth factor (PCDGF)/granulin-epithelin precursor (GEP) decreased cell proliferation and invasion through downregulation of cyclin D and CDK4 and inactivation of MMP-2. BMC Cancer 7:22. Lu R, Serrero G (2000) Inhibition of PC cell-derived growth factor (PCDGF, epithelin/granulin precursor) expression by antisense PCDGF cDNA transfection inhibits tumorigenicity of the human breast carcinoma cell line MDA-MB-468. Proc Natl Acad Sci U S A 97:3993-3998. Lu R, Serrero G (2001) Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor). Proc Natl Acad Sci U S A 98:142-147. Mackenzie IR, Baker M, Pickering-Brown S, Hsiung GY, Lindholm C, Dwosh E, Gass J, Cannon A, Rademakers R, Hutton M, Feldman HH (2006) The neuropathology of frontotemporal lobar degeneration caused by mutations in the progranulin gene. Brain 129:3081-3090. Mackenzie IR, Bigio EH, Ince PG, Geser F, Neumann M, Cairns NJ, Kwong LK, Forman MS, Ravits   70    J, Stewart H, Eisen A, McClusky L, Kretzschmar HA, Monoranu CM, Highley JR, Kirby J, Siddique T, Shaw PJ, Lee VM, Trojanowski JQ (2007) Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations. Ann Neurol 61:427-434. Malaspina A, Kaushik N, de Belleroche J (2001) Differential expression of 14 genes in amyotrophic lateral sclerosis spinal cord detected using gridded cDNA arrays. J Neurochem 77:132-145. Matzilevich DA, Rall JM, Moore AN, Grill RJ, Dash PK (2002) High-density microarray analysis of hippocampal gene expression following experimental brain injury. J Neurosci Res 67:646-663. Mercado PA, Ayala YM, Romano M, Buratti E, Baralle FE (2005) Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene. Nucleic Acids Res 33:6000-6010. Moisse K, Volkening K, Leystra-Lantz C, Welch I, Hill T, Strong MJ (2009) Divergent patterns of cytosolic TDP-43 and neuronal progranulin expression following axotomy: implications for TDP-43 in the physiological response to neuronal injury. Brain Res 1249:202-211. Mukherjee O, Wang J, Gitcho M, Chakraverty S, Taylor-Reinwald L, Shears S, Kauwe JS, Norton J, Levitch D, Bigio EH, Hatanpaa KJ, White CL, Morris JC, Cairns NJ, Goate A (2008) Molecular characterization of novel progranulin (GRN) mutations in frontotemporal dementia. Hum Mutat 29:512-521. Murrell JR, Koller D, Foroud T, Goedert M, Spillantini MG, Edenberg HJ, Farlow MR, Ghetti B (1997) Familial multiple-system tauopathy with presenile dementia is localized to   71    chromosome 17. Am J Hum Genet 61:1131-1138. Neary D, Snowden J, Mann D (2005) Frontotemporal dementia. Lancet Neurol 4:771-780. Neumann M, Kwong LK, Lee EB, Kremmer E, Flatley A, Xu Y, Forman MS, Troost D, Kretzschmar HA, Trojanowski JQ, Lee VM (2009) Phosphorylation of S409/410 of TDP-43 is a consistent feature in all sporadic and familial forms of TDP-43 proteinopathies. Acta Neuropathol 117:137-149. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM (2006) Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314:130-133. Nicholson DW, Thornberry NA (1997) Caspases: killer proteases. Trends Biochem Sci 22:299-306. Nonaka T, Arai T, Buratti E, Baralle FE, Akiyama H, Hasegawa M (2009) Phosphorylated and ubiquitinated TDP-43 pathological inclusions in ALS and FTLD-U are recapitulated in SH-SY5Y cells. FEBS Lett 583:394-400. Olive M, Janue A, Moreno D, Gamez J, Torrejon-Escribano B, Ferrer I (2009) TAR DNA-Binding protein 43 accumulation in protein aggregate myopathies. J Neuropathol Exp Neurol 68:262-273. Ou SH, Wu F, Harrich D, Garcia-Martinez LF, Gaynor RB (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J Virol 69:3584-3596. Plowman GD, Green JM, Neubauer MG, Buckley SD, McDonald VL, Todaro GJ, Shoyab M (1992)   72    The epithelin precursor encodes two proteins with opposing activities on epithelial cell growth. J Biol Chem 267:13073-13078. Rademakers R et al. (2007) Phenotypic variability associated with progranulin haploinsufficiency in patients with the common 1477C-->T (Arg493X) mutation: an international initiative. Lancet Neurol 6:857-868. Reed SE, Staley EM, Mayginnes JP, Pintel DJ, Tullis GE (2006) Transfection of mammalian cells using linear polyethylenimine is a simple and effective means of producing recombinant adeno-associated virus vectors. J Virol Methods 138:85-98. Roeber S, Mackenzie IR, Kretzschmar HA, Neumann M (2008) TDP-43-negative FTLD-U is a significant new clinico-pathological subtype of FTLD. Acta Neuropathol 116:147-157. Rohn TT (2008) Caspase-cleaved TAR DNA-binding protein-43 is a major pathological finding in Alzheimer's disease. Brain Res 1228:189-198. Rollinson S et al. (2009) Ubiquitin associated protein 1 is a risk factor for frontotemporal lobar degeneration. Neurobiol Aging 30:656-665. Rosso SM, Kamphorst W, de Graaf B, Willemsen R, Ravid R, Niermeijer MF, Spillantini MG, Heutink P, van Swieten JC (2001) Familial frontotemporal dementia with ubiquitin-positive inclusions is linked to chromosome 17q21-22. Brain 124:1948-1957. Rosso SM, Donker Kaat L, Baks T, Joosse M, de Koning I, Pijnenburg Y, de Jong D, Dooijes D, Kamphorst W, Ravid R, Niermeijer MF, Verheij F, Kremer HP, Scheltens P, van Duijn CM, Heutink P, van Swieten JC (2003) Frontotemporal dementia in The Netherlands: patient characteristics  and  prevalence  estimates  from  a  population-based  study.  Brain   73     126:2016-2022. Rovelet-Lecrux A, Deramecourt V, Legallic S, Maurage CA, Le Ber I, Brice A, Lambert JC, Frebourg T, Hannequin D, Pasquier F, Campion D (2008) Deletion of the progranulin gene in patients with frontotemporal lobar degeneration or Parkinson disease. Neurobiol Dis 31:41-45. Schroder R, Watts GD, Mehta SG, Evert BO, Broich P, Fliessbach K, Pauls K, Hans VH, Kimonis V, Thal DR (2005) Mutant valosin-containing protein causes a novel type of frontotemporal dementia. Ann Neurol 57:457-461. Schumacher A, Friedrich P, Diehl-Schmid J, Ibach B, Perneczky R, Eisele T, Vukovich R, Foerstl H, Riemenschneider M (2009) No association of TDP-43 with sporadic frontotemporal dementia. Neurobiol Aging 30:157-159. Schwab  C,  Arai  T,  Hasegawa  M,  Yu  S,  McGeer  PL  (2008)  Colocalization  of  transactivation-responsive DNA-binding protein 43 and huntingtin in inclusions of Huntington disease. J Neuropathol Exp Neurol 67:1159-1165. Shankaran SS, Capell A, Hruscha AT, Fellerer K, Neumann M, Schmid B, Haass C (2008) Missense mutations in the progranulin gene linked to frontotemporal lobar degeneration with ubiquitin-immunoreactive inclusions reduce progranulin production and secretion. J Biol Chem 283:1744-1753. Shoyab M, McDonald VL, Byles C, Todaro GJ, Plowman GD (1990) Epithelins 1 and 2: isolation and characterization of two cysteine-rich growth-modulating proteins. Proc Natl Acad Sci U S A 87:7912-7916.   74    Soraru G, Orsetti V, Buratti E, Baralle F, Cima V, Volpe M, D'Ascenzo C, Palmieri A, Koutsikos K, Pegoraro E, Angelini C (2009) TDP-43 in skeletal muscle of patients affected with amyotrophic lateral sclerosis. Amyotroph Lateral Scler:1-5. Stevens M, van Duijn CM, Kamphorst W, de Knijff P, Heutink P, van Gool WA, Scheltens P, Ravid R, Oostra BA, Niermeijer MF, van Swieten JC (1998) Familial aggregation in frontotemporal dementia. Neurology 50:1541-1545. Sumi H, Kato S, Mochimaru Y, Fujimura H, Etoh M, Sakoda S (2009) Nuclear TAR DNA binding protein 43 expression in spinal cord neurons correlates with the clinical course in amyotrophic lateral sclerosis. J Neuropathol Exp Neurol 68:37-47. Suzuki M, Yoshida S, Nishihara M, Takahashi M (1998) Identification of a sex steroid-inducible gene in the neonatal rat hypothalamus. Neurosci Lett 242:127-130. Tan CF, Eguchi H, Tagawa A, Onodera O, Iwasaki T, Tsujino A, Nishizawa M, Kakita A, Takahashi H (2007) TDP-43 immunoreactivity in neuronal inclusions in familial amyotrophic lateral sclerosis with or without SOD1 gene mutation. Acta Neuropathol 113:535-542. Temiz P, Weihl CC, Pestronk A (2009) Inflammatory myopathies with mitochondrial pathology and protein aggregates. J Neurol Sci 278:25-29. Van Damme P, Van Hoecke A, Lambrechts D, Vanacker P, Bogaert E, van Swieten J, Carmeliet P, Van Den Bosch L, Robberecht W (2008) Progranulin functions as a neurotrophic factor to regulate neurite outgrowth and enhance neuronal survival. J Cell Biol 181:37-41. Van Deerlin VM, Wood EM, Moore P, Yuan W, Forman MS, Clark CM, Neumann M, Kwong LK, Trojanowski JQ, Lee VM, Grossman M (2007) Clinical, genetic, and pathologic   75    characteristics of patients with frontotemporal dementia and progranulin mutations. Arch Neurol 64:1148-1153. van der Zee J et al. (2007) Mutations other than null mutations producing a pathogenic loss of progranulin in frontotemporal dementia. Hum Mutat 28:416. Wang X, Li X, Xu L, Zhan Y, Yaish-Ohad S, Erhardt JA, Barone FC, Feuerstein GZ (2003) Up-regulation of secretory leukocyte protease inhibitor (SLPI) in the brain after ischemic stroke: adenoviral expression of SLPI protects brain from ischemic injury. Mol Pharmacol 64:833-840. Wang Y, Ju W, Liu L, Fam S, D'Souza S, Taghibiglou C, Salter M, Wang YT (2004) alpha-Amino-3-hydroxy-5-methylisoxazole-4-propionic acid subtype glutamate receptor (AMPAR) endocytosis is essential for N-methyl-D-aspartate-induced neuronal apoptosis. J Biol Chem 279:41267-41270. Watts GD, Wymer J, Kovach MJ, Mehta SG, Mumm S, Darvish D, Pestronk A, Whyte MP, Kimonis VE (2004) Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin-containing protein. Nat Genet 36:377-381. Weihl CC, Temiz P, Miller SE, Watts G, Smith C, Forman M, Hanson PI, Kimonis V, Pestronk A (2008) TDP-43 accumulation in inclusion body myopathy muscle suggests a common pathogenic mechanism with frontotemporal dementia. J Neurol Neurosurg Psychiatry 79:1186-1189. Whittemore ER, Loo DT, Cotman CW (1994) Exposure to hydrogen peroxide induces cell death via   76    apoptosis in cultured rat cortical neurons. Neuroreport 5:1485-1488. Wider C, Wszolek ZK (2008) Etiology and pathophysiology of frontotemporal dementia, Parkinson disease and Alzheimer disease: lessons from genetic studies. Neurodegener Dis 5:122-125. Wider C, Dickson DW, Stoessl AJ, Tsuboi Y, Chapon F, Gutmann L, Lechevalier B, Calne DB, Personett DA, Hulihan M, Kachergus J, Rademakers R, Baker MC, Grantier LL, Sujith OK, Brown L, Calne S, Farrer MJ, Wszolek ZK (2008) Pallidonigral TDP-43 pathology in Perry syndrome. Parkinsonism Relat Disord. Wijesekera LC, Leigh PN (2009) Amyotrophic lateral sclerosis. Orphanet J Rare Dis 4:3. Xia X, Serrero G (1998) Identification of cell surface binding sites for PC-cell-derived growth factor, PCDGF, (epithelin/granulin precursor) on epithelial cells and fibroblasts. Biochem Biophys Res Commun 245:539-543. Xu K, Zhang Y, Ilalov K, Carlson CS, Feng JQ, Di Cesare PE, Liu CJ (2007) Cartilage oligomeric matrix protein associates with granulin-epithelin precursor (GEP) and potentiates GEP-stimulated chondrocyte proliferation. J Biol Chem 282:11347-11355. Yokota O, Tsuchiya K, Arai T, Yagishita S, Matsubara O, Mochizuki A, Tamaoka A, Kawamura M, Yoshida H, Terada S, Ishizu H, Kuroda S, Akiyama H (2009) Clinicopathological characterization of Pick's disease versus frontotemporal lobar degeneration with ubiquitin/TDP-43-positive inclusions. Acta Neuropathol 117:429-444. Yu D, Scott C, Jia WW, De Benedetti A, Williams BJ, Fazli L, Wen Y, Gleave M, Nelson C, Rennie PS (2006) Targeting and killing of prostate cancer cells using lentiviral constructs containing a sequence recognized by translation factor eIF4E and a prostate-specific promoter. Cancer   77    Gene Ther 13:32-43. Zanocco-Marani T, Bateman A, Romano G, Valentinis B, He ZH, Baserga R (1999) Biological activities and signaling pathways of the granulin/epithelin precursor. Cancer Res 59:5331-5340. Zhang YJ, Xu YF, Dickey CA, Buratti E, Baralle F, Bailey R, Pickering-Brown S, Dickson D, Petrucelli L (2007) Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. J Neurosci 27:10530-10534. Zhang YJ, Xu YF, Cook C, Gendron TF, Roettges P, Link CD, Lin WL, Tong J, Castanedes-Casey M, Ash P, Gass J, Rangachari V, Buratti E, Baralle F, Golde TE, Dickson DW, Petrucelli L (2009) Aberrant cleavage of TDP-43 enhances aggregation and cellular toxicity. Proc Natl Acad Sci U S A 106:7607-7612. Zhou J, Gao G, Crabb JW, Serrero G (1993) Purification of an autocrine growth factor homologous with mouse epithelin precursor from a highly tumorigenic cell line. J Biol Chem 268:10863-10869. Zhu S, Tai C, MacVicar BA, Jia W, Cynader MS (2009) Glutamatergic stimulation triggers rapid Krupple-like factor 4 expression in neurons and the overexpression of KLF4 sensitizes neurons to NMDA-induced caspase-3 activity. Brain Res 1250:49-62.    78    

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0070855/manifest

Comment

Related Items