UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Y-box binding protein-1 is essential for the growth and survival of HER2 over-expressing breast cancers.. Dhillon, Jaspreet 2010

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2010_fall_dhillon_jaspreet.pdf [ 2.51MB ]
Metadata
JSON: 1.0069973.json
JSON-LD: 1.0069973+ld.json
RDF/XML (Pretty): 1.0069973.xml
RDF/JSON: 1.0069973+rdf.json
Turtle: 1.0069973+rdf-turtle.txt
N-Triples: 1.0069973+rdf-ntriples.txt
Original Record: 1.0069973 +original-record.json
Full Text
1.0069973.txt
Citation
1.0069973.ris

Full Text

 Y-BOX BINDING PROTEIN-1 IS ESSENTIAL FOR THE GROWTH AND SURVIVAL OF HER2 OVER-EXPRESSING BREAST CANCERS AND MEDIATES TRASTUZUMAB RESISTANCE BY INDUCING CD44    by    Jaspreet Dhillon    B.Sc., The University of British Columbia, 2007      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF    MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE STUDIES  (Experimental Medicine)      THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)   APRIL 2010      © Jaspreet Dhillon, 2010 ii  ABSTRACT  Y-box binding protein-1 (YB-1) is an oncogenic transcription/translation factor expressed in 40% of all subtypes of invasive breast carcinomas, where its expression is correlated with relapse and poor survival.  HER2 amplifications are a frequent genetic abnormality observed in approximately 25% of breast cancers where its over-expression is associated with poor clinical outcome and decreased disease free survival.  We recently reported that HER2 over-expressing breast cancers are dependent on YB-1 for growth and survival.  In HER2 positive tumours we implicated YB-1 in sustaining cancer cells by its involvement in the STAT3 signalling pathway.    The development of trastuzumab, a targeted therapy against HER2, has provided substantial advances in the care and treatment of patients whose tumours over-express HER2. Unfortunately, the development of acquired resistance to trastuzumab remains a prevalent challenge in the treatment of patients whose tumours express HER2.  Since YB-1 is also linked to drug resistance in other types of cancer, we addressed its possible role in trastuzumab insensitivity.  Employing an in vivo model of acquired resistance, we demonstrated that resistant cell lines have elevated levels of P-YB-1S102 and its activating kinase P-RSK and that these levels are sustained following trastuzumab treatment.  Further, to demonstrate the importance of YB-1 in mediating drug resistance, the expression of the active mutant YB-1S102D rendered the BT474 cell line insensitive to trastuzumab.  Questioning the role of tumour initiating cells (TICs) and their ability to escape cancer therapies, we investigated YB-1’s involvement in inducing the cancer stem cell marker CD44.  Notably, the resistant cells expressed more CD44 mRNA and protein compared to BT474 cells, which correlated with increased mammosphere formation.  Expression of YB-1S102D in the BT474 cells increased CD44 protein levels, resulting in enhanced mammosphere formation.  Further, exposing BT474 cells to trastuzumab selected for a resistant subpopulation enriched for CD44.  Conversely, siRNA inhibition of CD44 restored trastuzumab sensitivity in the resistant cell lines.  Our findings provide insight on a novel mechanism employed by tumour cells to acquire the ability to escape the effects of trastuzumab and suggest that targeting YB-1 may overcome resistance by eliminating the unresponsive TIC population, rendering the cancer sensitive to therapy.                    iii  TABLE OF CONTENTS ABSTRACT.......................................................................................................................................................... ii TABLE OF CONTENTS .................................................................................................................................... iii LIST OF FIGURES............................................................................................................................................. iv LIST OF ABBREVIATIONS ............................................................................................................................... v ACKNOWLEDGEMENTS................................................................................................................................ vii  CO-AUTHORSHIP STATEMENT  ................................................................................................................... ix  CHAPTER ONE: INTRODUCTION  ......................................................................................................... 1  1.1 BREAST CANCER  ................................................................................................................................ 1   1.2 CURRENT THERAPEUTIC STRATEGIES  ............................................................................................ 3   1.3 TRANSCRIPTION FACTORS IN CANCER  ............................................................................................ 8   1.4 Y-BOX BINDING PROTEIN-1 (YB-1)  ................................................................................................... 9   1.5 SIGNAL TRANSDUCERS AND ACTIVATORS OF TRANSCRIPTION (STATs)  .................................... 16   1.6 MEMBRANCE RECEPTORS  .............................................................................................................. 18   1.7 HUMAN EPIDERMAL GROWTH FACTOR RECEPTOR-2 (HER2)  .................................................... 19   1.8 TRASTUZUMAB (HERCEPTIN™)  ..................................................................................................... 21   1.9 CD44  .................................................................................................................................................. 23   1.10 CANCER STEM CELLS  ...................................................................................................................... 25   1.11 THESIS HYPOTHESIS AND OBJECTIVES  ......................................................................................... 29  REFERENCES  ............................................................................................................................................... 30 CHAPTER TWO: TARGETING YB-1 IN HER2 OVER-EXPRESSING BREAST CANCER CELLS INDUCES APOPTOSIS VIA THE mTOR/STAT3 PATHWAY AND SUPPRESSES TUMOUR GROWTH IN MICE  ............................................................................................................................................................ 45  2.1 INTRODUCTION ................................................................................................................................ 46   2.2 MATERIALS AND METHODS  ............................................................................................................ 47   2.3 RESULTS AND DISCUSSION  ............................................................................................................. 50   REFERENCES  ............................................................................................................................................... 61 CHAPTER THREE:  THE EXPRESSION OF ACTIVATED Y-BOX BINDING PROTEIN-1 SERINE 102 MEDIATES TRASTUZUMAB RESISTANCE IN BREAST CANCER CELLS BY INCREASING CD44 EXPRESSION  ................................................................................................................................................... 63  3.1 INTRODUCTION ................................................................................................................................ 64   3.2 MATERIALS AND METHODS  ............................................................................................................ 66   3.3 RESULTS AND DISCUSSION  ............................................................................................................. 73   REFERENCES  ............................................................................................................................................... 87 CHAPTER FOUR: DISCUSSION ............................................................................................................... 89  4.1 SIGNIFICANCE OF YB-1 IN HER2 OVER-EXPRESSING BREAST CANCER  ..................................... 89   4.2 IMPLICATIONS AND FUTURE DIRECTIONS  ................................................................................... 90   4.3 CONCLUSION... ................................................................................................................................ 106   REFERENCES  ............................................................................................................................................. 107  APPENDICES .................................................................................................................................................. 114  APPENDIX I................................................................................................................................................. 114   APPENDIX II  .............................................................................................................................................. 115   APPENDIX III .............................................................................................................................................. 116   APPENDIX IV .............................................................................................................................................. 117   APPENDIX V ............................................................................................................................................... 117         iv  LIST OF FIGURES Figure 1.1.  The structure and functions of YB-1  ..................................................................... 10  Figure 1.2.  Schematic model of YB-1 signalling ........................................................ ……….1 1  Figure 2.1.  Inhibition of YB-1 generally suppresses the growth of breast cancer cell lines and leads to the induction of apoptosis  ............................................................................................ 55  Figure 2.2.  Loss of YB-1 decreased signalling through the STAT3 pathway  ........................... 56  Figure 2.3.  Inhibition of YB-1 suppresses tumour growth in soft agar ..................................... 57  Figure 2.4.  Inhibition of YB-1 suppressed the development of tumours in mice  ...................... 58  Supplemental Figure 2.1.  Inhibition of YB-1 induces apoptosis and enhances growth suppression in combination with Taxol  .................................................................................... 59  Supplemental Figure 2.2.  YB-1 inhibition decreases mTOR protein levels but not transcript levels ........................................................................................................................................ 60  Figure 3.1.  Trastuzumab resistant cell lines have increased levels of P-YB-1S102 and depend on YB-1 for growth and survival  ................................................................................................... 78  Figure 3.2.  Phosphorylation of YB-1 is essential for cell viability and also promotes resistance to trastuzumab therapy  ............................................................................................................. 80  Figure 3.3.  Trastuzumab resistant cell lines have increased levels of CD44 ............................. 81  Figure 3.4.  YB-1 binds to and regulates the CD44 promoter thereby maintaining trastuzumab resistant cells ............................................................................................................................. 83  Supplemental Figure 3.1.  Inhibition of YB-1 enhances the suppression of colony formation in soft agar in combination with trastuzumab ................................................................................ 85  Supplemental Figure 3.2.  Trastuzumab is ineffective at preventing mammosphere  formation  ................................................................................................................................. 86            v  LIST OF ABBREVIATIONS  4-OHT 4-hydroxy tamoxifen ABC ATP-binding cassette ADCC Antibody dependent cellular cytotoxicity ALDH Aldehyde dehydrogenase AML Acute myeloid leukemia ATP Adenosine triphosphate CDK2 Cyclin dependent kinase-2 CGH Comparative genomic hybridization ChIP Chromatin immunoprecipitation CML Chronic myelogenous leukemia COC ChIP-on-chip CRS Cytoplasmic retention site CSC Cancer stem cell CSD Cold shock domain ECD Ectodomain ECM Extracellular matrix EGF Epidermal growth factor EGFR Epidermal growth factor receptor ELB Egg lysis buffer ER Estrogen receptor ERE Estrogen response element ESA Epithelial surface antigen FACS Fluorescent Activated Cell Sort FBXW7 F-box and WD repeat domain-containing 7 GIST Gastrointestinal stromal tumour HA Hyaluronan HCS High content screening HER2 Human epidermal growth factor receptor-2 HR Trastuzumab resistant IGF-IR Insulin like growth factor-I receptor IR Insulin receptor JAK Janus kinase JNK C-jun kinase MAPK Mitogen-activated protein kinase MDR1 Multi-drug resistance-1 MET Mesenchymal epithelial transition MHC II Major Histocompatibility Class II MMTV Mouse mammary tumour virus MRP1 Multi-drug resistance protein-1 mTOR Mammalian target of rapamycin MUC4 Mucin-4 MVP Major vault protein Myr Myristolated NK Natural killer NLS Nuclear localization signal NOD/SCID Non-obese diabetic mice with severe combined immunodeficiency vi  disease NSCLC Non-small cell lung cancer PBS Phosphate buffered saline PCNA Proliferative cell nuclear antigen PI3K Phosphatidylinositol -3-kinase   Pin1 Peptidyl-prolyl cis/trans isomerise PLK1 Polo-like kinase-1 RSK p90 ribosomal S6 kinase RTK Receptor tyrosine kinase SERM Selective estrogen receptor modulator SH2 SRC homology-2 STAT Signal transducer and activator of transcription TBP TATA-box binding protein TIC Tumour-initiating cell TKI Tyrosine kinase inhibitor TMA Tumour microarray TSP1 Thrombospondin-1 VEGF Vascular endothelial growth factor YB-1 Y-box binding protein-1                                vii  ACKNOWLEDGEMENTS  I am most grateful and appreciative of my supervisor, Dr. Sandra Dunn.  Thank you for giving me the opportunity to join your lab, at first as a volunteer and continuing on with graduate studies.  Your passion for science has truly been inspiring and your continuous motivation and support through this journey has been invaluable.  You have been the utmost mentor.    My special thanks go to Anna, Cathy, and Arezoo, your expert knowledge, intellectual input, and most importantly, friendship has directly influenced the completion of my Master’s thesis.  To my ‘cove’ buddies – Alastair, Kristen, and Mary, thank you for keeping it real and of course, as always, professional.  You three never fail to put a smile on my face, thank you for all your support.  To Jennifer, Kaiji, and Abbas – thank you for all your help.  To prior Dunn lab members, Karen, Mel, Michelle, Goli and Yuanyuan, your influence on my lab experience will always be remembered.  I am so thankful that I had the opportunity to belong to a lab full of such awesome individuals and great friends.  I will miss each and every one of you – thank you for all of the memories.  To Dr. Cox and Dr. Pallen.  It has been a privilege to have you two on my graduate supervisory committee.  I thank you for your input, support, guidance, and advice during the completion of my research project.  Last but not least, I would like to thank my family for their constant and continuous support.                           viii             To my parents.                                      ix  CO-AUTHORSHIP STATEMENT  Chapter 2: The work described in Chapter 2 was published in Cancer Research as a Priority Report in November 2008.  The manuscript presented within the Chapter was designed by Sandra Dunn, Cathy Lee and me.  I designed, optimized, completed, and analyzed all work associated with querying the mechanism of YB-1 mediated apoptosis.  I assessed signalling changes following YB-1 knockdown in BT474-m1 and Au565 cells by western blot, confirmed apoptosis following STAT3 inhibition, characterized in vitro STAT3 binding to an MCL promoter by electrophoretic mobility shift assays, completed the STAT3C rescue experiment and also determined mTOR transcript levels with YB-1 inhibition by q-RT-PCR in the BT474-m1 and Au565 cell lines.  The majority of the data presented in Chapter 2 was completed by Cathy Lee.  She completed YB-1 knockdown western blots showing changes in EGFR and HER2 levels, YB-1 timecourse knockdown experiment demonstrating the induction of apoptosis, FACS analysis of Annexin V with YB-1 inhibition, soft agar assays, and in vivo experiments.  Kaiji Hu completed the highcontent screening to assess growth with YB-1 knockdown in a panel of breast cancer cells and also completed the three channel apoptosis screen.  Michelle Wang completed the animal experiments.  Eugene Park performed the combined Taxol and YB-1 inhibition experiments.  Arezoo Astanehe assessed mTOR transcript levels following YB-1 knockdown in the SUM149 cell line.  The manuscript was written and prepared by Sandra Dunn, Cathy Lee, Connie Eaves, and me.  Chapter 3: The manuscript described in Chapter 3 was recently submitted to a peer-reviewed journal.  The focus of the experimental work was designed by me and Sandra Dunn.  I designed, optimized, performed, and analyzed all cell line/YB-1 knockdown/drug treatment western blots, soft agar assays, growth assays, establishment of the BT474 stable clones, quantitative real-time PCRs, mammosphere assays, immunofluorescence analysis, and luciferase assays.  Arezoo Astanehe completed the ChIP experiment, established the BT474LT cultures and also assisted in various aspects of the research plan.  Cathy Lee completed the soft agar assay with YB-1 knockdown and trastuzumab treatment in the BT474-m1 cells.  Abbas Fotovati performed the immunofluorescence staining of CD44 in the BT474, HR5, and HR6 cells, helped to optimize the staining protocol for mammospheres and also assisted with imaging and general staining techniques.  Kaiji Hu analyzed growth experiments employing the Cellomics ArrayScan VTI.  The manuscript was written and prepared in collaboration with Sandra Dunn and me.         1  CHAPTER ONE: INTRODUCTION  1.1 BREAST CANCER Cancer arises from the ability of a single cell to bypass the normal homeostatic mechanisms regulating proliferation, differentiation, and death resulting in abnormal and uncontrolled cell growth.  A myriad of processes which insult the genome of a single cell, whether genetic or epigenetic, are sufficient to expand and select for these deviant cells, initiating tumour formation (Hahn and Weinberg, 2002).  The acquisition of genomic instability arises through a number of mechanisms including inherited mutations and exposure to harmful chemical and/or physical mutagens.  Although complex, cancers conform to six classical hallmarks: the ability to evade apoptosis, self-sufficiency in growth signals, insensitivity to anti-growth signals, sustained angiogenesis, limitless replicative potential, and the ability to invade tissue and metastasize (Hanahan and Weinberg, 2000).    Breast cancers are diverse; no one tumour being the same.  The cellular origin of breast malignancies remains controversial as the mammary cellular hierarchy is only partially understood.  It has been speculated that the various tumour types arise from distinct breast epithelial cells which have different susceptibilities for oncogenic hits (Visvader and Lindeman, 2008).  Nevertheless, breast tumours are composed of an assortment of cell types, they vary in anatomic extent, and give rise to malignancies that have various clinical outcomes (Vargo-Gogola and Rosen, 2007).   Loss of tumour suppressor genes including germline mutations in the high-penetrance cancer susceptibility genes BRCA1 and BRCA2 (Nathanson et al., 2001) or the activation of oncogenes such as c-Myc (MYC) (Nass and Dickson, 1997), and cyclin D1 2  (CCND1) (Steeg and Zhou, 1998) have all been implicated in breast malignancies as their deregulation can lead to cellular chaos.  Although these common genetic aberrations have been recognized for their contribution to the initiation and progression of breast cancer, an exclusive genetic malfunction has not been identified.  More recently, comprehensive cDNA microarray experiments employing a large cohort of primary tumour samples categorized invasive ductal carcinomas into five distinct molecular classes based on differences in gene expression patterns (Perou et al., 2000; Sorlie et al., 2003).  Breast cancers are first classified for their expression of the estrogen receptor (ER).  Tumours lacking ER are classified as basal-like which accounts for approximately 11% of breast cancers (Kwan et al., 2009), the HER2+ subgroup which is discussed later, in addition to the normal breast-like.  ER positive tumours are associated with a favourable prognosis and are categorized into the prevalent Luminal A and also the Luminal B subtype (Kwan et al., 2009).  These studies made evident that breast tumours are molecularly heterogeneous, directly impacting the clinical course of the disease. The HER2+ and basal-like subgroups have the least favourable prognosis and clinical outcome compared with ER positive subclasses which have a relatively good clinical outcome (Sorlie et al., 2001).  The revelation of the molecular complexity in breast cancer and its influence on tumourigenic potential and disease outcome emphasizes how important individualized therapies will be in the future.  Given that breast cancer is not a single disease, therapeutic strategies can be altered to best combat the tumour at hand and hence improve patient care and clinical outcomes.   3  1.2  CURRENT THERAPEUTIC STRATEGIES Breast cancer is the most frequently diagnosed malignancy in Canadian women (Canadian Cancer Society).  In 2010, over 20 000 women will be diagnosed with the disease in Canada alone (Canadian Cancer Society) and according to the World Health Organization, over one million new cases will be diagnosed globally.  Metastasis of breast tumours, commonly to the bone, lungs, and liver, is the primary cause of disease related mortalities (Chambers et al., 2002).  Advancements in early screening technologies and innovative therapeutic options have provided an 87% five year survival rate (Canadian Cancer Society).  Although the death rates from breast cancer have declined, it remains the second leading cause of cancer related deaths (Kamangar et al., 2006).  Disease recurrence is a common clinical burden women encounter following an initial remission.  Often, cancer relapse is associated with a more aggressive and therapeutically unresponsive tumour where patients are left with unfavourable survival rates.  Hence, enhanced therapeutic options are essential to treat and prevent disease recurrence and relapse.  There are an abundance of options to treat breast malignancies dependent on tumour biology variables, such as its size and grade.  Regardless, a combinatory therapeutic approach is often taken to control and treat the disease.  Surgery, including lumpectomies, mastectomies, and axillary dissections are the primary treatment options to remove cancerous masses (Baselga and Norton, 2002).  To most effectively treat the disease, chemotherapy, radiotherapy, hormonal therapy, and biological therapy are utilized in conjunction with surgery to remove residual malignant cells and prevent recurrence (Baselga and Norton, 2002). Given the diverse array of characteristics amongst tumours, treatment regimes have become personalized to target the unique biology of the tumour. 4  Traditional breast cancer therapy includes the use of a variety of chemotherapeutic agents which function to kill cancer cells while ideally leaving normal cells unharmed.  However, as these therapies target rapidly dividing cells, normal cells are also affected leading to the many adverse side effects associated with chemotherapy.  These cytotoxic chemicals act as cellular poisons by interfering with cell cycle progression (Wright, 1984).  Cancer cells are highly proliferative making them particularly vulnerable to chemotherapeutic agents that cause DNA damage such as doxorubicin.  This further relies on the cells retention of normal check point controls which in many instances is not the case (Gralow, 2005; Hortobagyi, 2000).  For early stage breast carcinoma, adjuvant treatment options include the combinatory use of alkylating agents (cyclophosphamide), anthracyclines (doxorubicin), antimetabolites (5-fluorouracil), and antimicrotubule agents (paclitaxel and docetaxel) (Gralow, 2005; Hortobagyi, 2000).  New and improved therapies with more potent activity are employed to treat advanced malignancy in the adjuvant setting including vinca alkaloids (vinorelbine), pyrimidine analogs (gemcitabine), and new antimetabolies (capecitabine) (Gralow, 2005).  Although normal cells have regulatory mechanisms capable of recognizing the insults of chemotherapy, they do not always escape the effects of these chemicals, hence toxicity is a common symptom.   Estrogen, a steroidal sex hormone, mediates a variety of processes in normal female physiology.  However, prolonged cycling of the hormone has been implicated in the development of breast pathogenesis given its ability to induce cellular proliferation (Clarke et al., 1997).  The function of estrogen is mediated by its receptor ER, a nuclear receptor which acts as a transcription factor upon ligand binding (MacGregor and Jordan, 1998).  Activated ER is capable of inducing a variety of genes whose promoters contain estrogen response elements (EREs) (MacGregor and Jordan, 1998).  Approximately 60% of breast tumours express ER (Ali and Coombes, 2000), 5  hence endorcrine therapies are a critical entity in the treatment of hormonally responsive tumours and contribute to the positive clinical outcomes for patients with these tumour types.  Tamoxifen, a selective estrogen receptor modulator (SERM) was the first anti-ER agent used in the clinical setting (MacGregor and Jordan, 1998; Martino et al., 2004).  Administered as a prodrug, the active form of the antiestrogen, 4-hydroxytamoxifen (4-OHT) is generated following first pass metabolism in the liver and competes with endogenous estrogen for ER ligation.  In the breast, 4-OHT acts as an ER antagonist and inhibits ER from regulating the transcription from EREs.  Unfortunately, tamoxifen has both antagonist and agonist properties, depending on the target cell, therefore increasing the risks of adverse effects including endometrial cancer (Jordan, 2004).  More recently, raloxifene, a new SERM with antiestrogenic activity in both the breast and uterus, has been approved for the treatment of ER+ breast cancers (Jordan, 2004).  A second approach to fighting ER positive breast cancer is by inhibition of the enzyme aromatase, which functions to convert androgens to estrogen.  The aromatase inhibitors, anastrozole and letrozole function by preventing estrogen synthesis and have been approved for the treatment of postmenopausal patients with ER positive tumours (Din et al., 2010).  An additional strategy utilized to treat ER positive tumours is administration of fulvestrant, a selective estrogen receptor downregulator, which functions by downregulating and degrading the ER (Dowsett et al., 2005).  Not all tumours respond to cytotoxic and hormonal therapies as cancer cells are able to acquire mechanisms of resistance.  A contributing factor to the failure of achieving a therapeutic 6  response to tamoxifen has been linked to the loss of ER expression (Johnston et al., 1995). Further to this, growth factor receptor signalling crosstalk with ER has also been implicated in resistance.  Signalling via the mitogen-activated protein kinase (MAPK), phosphatidylinositol -3-kinase (PI3K)-AKT, and p38 MAPK pathways by activation of the epidermal growth factor receptor (EGFR), the human epidermal growth factor-2 receptor (HER2), or the insulin-like growth factor-I receptor (IGF-IR) and/or insulin receptor (IR) are capable of activating ER by a number of phosphorylation events which allows for continued ER mediated transcription in the presence of tamoxifen (Johnston and Dowsett, 2003).  We have previously demonstrated that inhibiting activation of IGF-IR/IR with BMS-536924 impeded the growth of tamoxifen resistant MCF-7 Tam-R cells (Law et al., 2008).  Identifying specific molecules which have become deregulated in cancer is important in the design and development of innovative treatments specifically targeting dysfunctional molecular entities (Gibbs, 2000; Strebhardt and Ullrich, 2008).  Tyrosine kinases play a fundamental role in normal cellular processes by their involvement in cellular signal transduction.  This occurs through the activation of proteins via transfer of a phosphate moiety from adenosine triphosphate (ATP) to the hydroxyl group of a tyrosine residue (Gschwind et al., 2004).  Aberrant tyrosine kinase activity aids in cellular transformation and carcinogenesis.  Therefore, blocking their activity serves as an attractive target in hindering the progression of their message to the nucleus (Gschwind et al., 2004).  The development of tyrosine kinase inhibitors (TKIs) has provided success in the treatment of patients with a wide variety of malignancies.  Imatinib (Gleevec), a small molecule inhibitor against the BCR-ABL oncoprotein, was the first TKI therapy approved for clinical use (Druker et al., 1996).  The majority of chronic myelogenous leukemia (CML) patients harbour the classic Philadelphia chromosome and express the resulting BCR-ABL 7  protein, a kinase with constitutive activity (Goldman and Melo, 2008).  Imatinib functions as a competitive inhibitor for the kinase active site of ABL and therefore prevents its natural substrates access to the site (Druker et al., 1996).  Clinical applications of imatinib were later expanded to the treatment of gastrointestinal stromal tumours (GISTs) (Joensuu et al., 2001) after discovering its ability to also inhibit c-Kit, a tyrosine kinase receptor crucial in the pathogenesis of GISTs (Buchdunger et al., 2000).  The expression of c-Kit and its ligand, stem cell factor, has been reported in breast cancer (Hines et al., 1995).  However, a study employing imatinib to treat patients whose tumours expressed c-Kit demonstrated no response to therapy as all experienced disease progression (Cristofanilli et al., 2008).  Lapatinib (Tykerb), a TKI, with dual specificity for EGFR and HER2 has demonstrated clinical success and has been approved by Health Canada for the treatment of breast cancer in combination with capecitabine (Gomez et al., 2008).  Furthermore, erlotinib (Tarceva) and gefitinib (Iressa), TKIs targeting the kinase activity of EGFR, which is over-expressed in large cohorts of breast cancer patients (Fox et al., 1994; Klijn et al., 1992; Sainsbury et al., 1987), have demonstrated success in preclinical studies (Campiglio et al., 2004; Takabatake et al., 2007; Yamasaki et al., 2007).  However, independent phase II clinical trials with erlotinib and gefitinib demonstrated little success as single agents since only a partial response was observed in a minority of patients (Lin and Winer, 2004).  However, these agents have been successfully implemented in the treatment protocols for non- small cell lung cancers (NSCLCs) (Comis, 2005), as well as for the treatment of pancreatic cancer (erlotinib) (Starling et al., 2009).  Targeting biological molecules which have been recognized for their importance in the signalling circuitry programs of cancer cells have also been identified as promising druggable targets (Gibbs, 2000).  As these proteins are necessary for the maintenance of the hallmarks of a 8  cancer cell, inhibiting their actions appear to be a rational idea for drug development.  The mammalian target of rapamycin (mTOR) is involved in cell growth, proliferation, survival, transcription, and translation (Hay and Sonenberg, 2004), hence, agents including rapamycin (sirolimus), and its derivatives RAD001 (everolimus) (Miller et al., 2009) and CCI-779 (temsirolimus) (Yu et al., 2001), have been developed to inhibit mTOR activity and have demonstrated success in preclinical studies for use in breast cancer.  1.3 TRANSCRIPTION FACTORS IN CANCER Transcription factors function to modulate gene expression by accepting signalling cues in the cytoplasm and transmitting them to the DNA.  Interestingly, the human genome project identified transcription factors as one of the largest classes of molecules; represented by approximately 2000 genes (Venter et al., 2001).  Furthermore, transcription factors have been implicated for their role in cancer, in fact a significant proportion of oncogenes and tumour suppressors are transcription factors (Darnell, 2002).  Commonly mutated or over-expressed transcription factors include members of the following families: STAT, Ets, CREB, API, FoxO, Myc, NF-κB, and E2F (Brennan et al., 2008).   Strategies to interfere with the function of transcription factors are in development and include dimerisation blockage via peptides, decoy oligonucleotides, and displacing transcription factors from DNA by blocking their binding site (Brennan et al., 2008; Darnell, 2002).  For example, a peptide targeting STAT3 has demonstrated success in preventing STAT3 dimer formation, and therefore inhibition of STAT3 mediated gene induction (Turkson et al., 2001).  More recently, peptide stapling has become an area of interest to convert peptides into bioactive ligands.  The technique employs a number of modifications to the typical features of a peptide while maintaining its functionality, with the 9  ultimate goal of making a more potent moiety than the native peptide.  Moellering et al have demonstrated successful targeting of the NOTCH transcription factor complex with these synthetic peptides (Moellering et al., 2009).  Transcription factors serve as powerful players in oncogenesis in that a single factor is capable of regulating a number of different genes.  Therefore, targeting this group of molecules may provide an additional approach for targeted therapies.  1.4 Y-BOX BINDING PROTEIN-1 (YB-1) The Y-box binding protein-1 (YB-1) is a cellular entity with a constellation of functions including transcriptional regulation, translation, DNA repair, drug resistance and stress responses.  Y-box proteins are members of the highly conserved cold-shock domain (CSD) family of proteins and are composed of three unique structural features, a CSD sandwiched between N-terminal and C-terminal domains, each with distinct functions, as illustrated in Figure 1.1.  The variable N-terminal domain, composed of proline and alanine residues, functions in transactivation (Kohno et al., 2003).  The C-terminal domain of YB-1 mediates protein-protein interactions via the alternating basic and acidic residues within the domain (Kohno et al., 2003).  Further, the C-terminal domain also harbours a nuclear localization signal (NLS) in addition to a cytoplasmic retention site (CRS), dictating the cellular localization of the protein (Kohno et al., 2003).      10   Figure 1.1.  The Structure and Functions of YB-1.  YB-1 is composed of three unique domains.  The N-termainl domain is essential for transactivation, while the C-terminal functions in protein-protein interactions.  The cold shock domain (CSD) interacts with nucleic acids and also binds to DNA regions containing the inverted CAAT box.  YB-1 is also phosphorylated at serine 102 which resides within the CSD by either AKT or RSK.  This activation is crucial for nuclear import and DNA binding.   The evolutionary conserved CSD functions to interact with both DNA (Hasegawa et al., 1991) and RNA (Bouvet et al., 1995) and was later identified as an essential requirement in YB-1’s affinity for nucleic acids (Kloks et al., 2002).  The CSD of YB-1 has a unique DNA recognition motif that recognizes and binds to DNA regions containing an inverted CAAT box (Didier et al., 1988; Sakura et al., 1988).  Furthermore, the CSD also functions in the nuclear trafficking of YB-1 in co-operation with the C-terminal domain (Jurchott et al., 2003).  YB-1 was first identified as a transcription factor regulating the promoter of the Major Histocompatibility Class II (MHCII) gene (Didier et al., 1988) and in the same year it was also shown to interact with the EGFR enhancer and HER2 promoter (Sakura et al., 1988).  Since then it has been extensively characterized in its role in gene regulation.  However, YB-1 also functions in DNA repair via its interaction with proliferating cell nuclear antigen (PCNA) (Ise et al., 1999) in addition to its involvement in mRNA transport and translation (Evdokimova et al., 2006).  Provided that the focus of our research looks at YB-1’s function in transcription, this aspect will be the focus of discussion.    11  YB-1 is an important factor in cancer initiation and progression by having the ability to alter the gene expression pattern of cells, which may ultimately induce an oncogenic switch in signal transduction.  Both the AKT and MAPK signalling cascades are well established pathways studied in cancer biology.  In fact, our laboratory identified YB-1 as a novel target of AKT for phosphorylation at its serine 102 residue which resides in the CSD (Sutherland et al., 2005).  More recently, we have also described p90 ribosomal S6 kinase (RSK) as being capable of phosphorylating the same serine 102 residue of YB-1 (Stratford et al., 2008).  A schematic representation of YB-1 signalling is presented in Figure 1.2.     Figure 1.2.  Schematic model of YB-1 signalling.  YB-1 is activated by phosphorylation of its serine 102 residue by either AKT or RSK via output signals from growth factor receptors.  Nuclear P-YB-1S102 functions as a transcription factor by binding to CAAT elements within promoters and regulates a number of genes including EGFR, HER2, MET, PIK3CA, CD44, and CD49f.  12  In fact, it has been demonstrated that YB-1 is preferentially activated by RSK using in vitro kinase assays as YB-1 has a higher affinity for interaction with RSK over AKT (Stratford et al., 2008).  Activation of YB-1 by phosphorylation at its serine 102 residue is critical to its function within the nucleus.  Exogenous expression of YB-1S102A, which eliminates the capacity to be phosphorylated at that site in the CSD, attenuates the nuclear translocation of YB-1 and also affects its role as a transcription factor since only 50% of the mutant protein is found within the nuclear compartment (Sutherland et al., 2005).  More importantly, the phosphorylation of the serine residue is crucial in YB-1’s ability to interact with DNA and induce gene expression (Wu et al., 2006).  Expression of Flag-YB-1S102A completely abolished binding to the -1kb of the EGFR promoter where as binding was evident in cells with wild type YB-1 (Wu et al., 2006).    Taken together, AKT and RSK function to phosphorylate serine 102 and enhance YB-1’s ability to enter the nucleus and its affinity for DNA.  There, YB-1 has been shown to be involved in regulating cyclin A (CCNA) (Jurchott et al., 2003), cyclin B (CCNB) (Jurchott et al., 2003), topoisomerase II alpha (TOP2A) (Shibao et al., 1999), and DNA polymerase alpha (DPA) (En-Nia et al., 2005).  Further to its induction of the mentioned growth promoting genes, YB-1 also transcriptionally controls matrix metalloproteinase-2 (MMP-2) (Mertens et al., 1997), matrix metalloproteinase-12 (MMP-12) (Samuel et al., 2005), collagen type I alpha 1 (COL1A1) (Norman et al., 2001), and collagen type I alpha 2 (COL1A2) (Higashi et al., 2003).  Hence, YB-1 also indirectly controls metastatic potential by its regulation of genes whose products are involved in cell adhesion, motility, and invasion.  This collectively indicates that YB-1’s function as a transcription factor is capable of inducing cancer with an aggressive phenotype.  YB-1 also has the ability to indirectly modify gene expression via protein-protein interaction.  It is able to bind to the tumour suppressor p53, preventing its regulation of p21 and therefore 13  stimulate aberrant cell cycle progression (Okamoto et al., 2000).  It is clear that YB-1 functions to switch a cell’s normal regulatory machinery into overdrive and therefore provoke changes to acquire a malignant phenotype.   YB-1 expression is limited to rapidly growing cells including those found in various embryonal and fetal tissues (Uchiumi et al., 2006).  However, its expression is silenced in most adult tissues except for those which are highly proliferative such as the glandular epithelial cell zone of normal colorectal mucosa (Shibao et al., 1999).  In fact, the generation of YB-1 knockout mice results in impaired cell proliferation resulting in embryonic lethality (Uchiumi et al., 2006).  Moreover, YB-1 has been associated with highly proliferative cells in a range of cancer types.  It correlates with increased Ki67 staining in primary tissue samples of osteosarcoma (Oda et al., 1998) and breast cancer (Wu et al., 2006).  In addition, YB-1 positively correlates with PCNA expression, a marker for highly proliferative cells in colorectal cancer (Shibao et al., 1999).  Direct evidence for a role of YB-1 in proliferation came from a gene knock down study where the loss of one allele in the chicken lymphocytic cell line DT40 impeded growth by greater that 70% (Swamynathan et al., 2002).   Interestingly, elevated levels of YB-1 have been recognized in a wide variety of malignancies including cancers of the breast (Bargou et al., 1997), prostate (Gimenez-Bonafe et al., 2004), lung (Shibahara et al., 2001), ovary (Yahata et al., 2002), bone (Oda et al., 1998), myelomas (Chatterjee et al., 2008), rhabdomyosarcoma (Oda et al., 2008) and glioblastoma (Faury et al., 2007) while the normal matched tissues had little or no YB-1 expression.  Further, RNA antisense against YB-1 in melanoma, adenocarcinoma, hepatoma, fibrosarcoma, and colon cancer cells induced cell death (Lasham et al., 2003).  Since then, we have also confirmed the role of YB-1 in the growth and survival of breast cancers (Lee et al., 14  2008).  Taken together, a wide range of malignant tissues not only highly express YB-1 but also depend on it.  In the breast, YB-1 has been established as an oncogene.  YB-1 expression is confined to malignant breast tissue as it is not detected in normal breast (Bargou et al., 1997; Rubinstein et al., 2002).  Furthermore, targeted expression of YB-1 in the mammary gland employing a transgenic mouse model induced invasive tumour formation with 100% penetrance (Bergmann et al., 2005).  We have demonstrated the requirement of wild type YB-1 for growth in monolayer and in 3-dimensional anchorage independent assays where as expression of YB-1S102A or YB-1 inhibition with siRNA impeded cell growth (Finkbeiner et al., 2009; Lee et al., 2008; Sutherland et al., 2005; Wu et al., 2006).  We have also identified YB-1 in transcriptionally regulating the expression of EGFR (Stratford et al., 2007; Wu et al., 2006), HER2 (Wu et al., 2006), MET (Finkbeiner et al., 2009), and PIK3CA (Astanehe et al., 2009), all of which are commonly over-expressed or mutated in cancer.  Furthermore, Chapter Two provides evidence for the requirement of YB-1 for in vivo tumourigenesis (Lee et al., 2008).  Although the levels of P-YB-1S102 vary in the various types of breast cancer cell models studied, the levels of total protein remain constant amongst breast cancer subtypes (Finkbeiner et al., 2009).  Of note, the over-expression of YB-1 in breast cancers is not due to chromosomal amplifications on account that a comparative genomic hybridization (CGH) array analysis on primary basal-like breast cancer specimens did not identify any changes in the YB1 locus (1p34.2) (Stratford et al., 2007).  Since there are no known mutations and YB-1 is not amplified, its expression likely results from transcriptional activation.  C-Myc for example is aberrantly expressed in breast cancers (Liao and Dickson, 2000).  Interestingly, the YB-1 promoter contains sequences specifically recognized by c-Myc which directly regulates the YB-1 promoter in collaboration with p73 15  (Uramoto et al., 2002).  More recently, TWIST has been shown to induce YB-1 (Shiota et al., 2008).  Undoubtedly, YB-1’s direct regulation of a wide range of oncogenes implicates it as a critical mediator in many established cancer pathways.   In addition to the above mentioned myriad of functions, YB-1 also plays a significant role in drug resistance.  It facilitates the expression of the multi-drug resistance-1 gene (MDR1) (Goldsmith et al., 1993; Stein et al., 2001), multi-drug resistance related protein-1 (MRP1) (Stein et al., 2001), and the major vault protein (MVP) (Stein et al., 2005), all which function in drug resistance.  MDR1, a P-glycoprotein, is a member of the ATP-binding cassette (ABC) transporters which functions to efflux compounds out of the cell.  Unfortunately, this includes ridding toxic agents from cancer cells and their expression is often elevated following chemotherapy (Choudhuri and Klaassen, 2006).  Cisplatin (Ise et al., 1999) and paclitaxel (Fujita et al., 2005) have been implicated in inducing YB-1 mediated expression of MDR-1 resulting in a multi-drug resistant phenotype.  Furthermore, antisense against YB-1 in human epidermoid cancer cell lines increased their sensitivity to cisplatin, mitomycin C, and UV radiation (Ohga et al., 1998).  Besides, through induction of MDR1, YB-1 may also mediate drug resistance by its involvement in DNA repair as it has been identified to preferentially bind cisplatin damaged DNA in association with PCNA (Shibahara et al., 2004).  Clinical evidence further supports the in vitro chemoresistant phenotype maintained by YB-1.  In an analysis of breast cancer specimens from patients receiving post-operative chemotherapy, those with high YB-1 expression had a 66% relapse rate compared to 0% relapse in those with low YB-1 expression (Janz et al., 2002).  In addition, work in our lab implicated YB-1 as a predictive biomarker of relapse and poor survival across all breast cancer subtypes in a cohort of 4049 samples (Habibi et al., 2008).  Moreover, YB-1 was also predictive of decreased breast cancer specific survival in a 16  subset of patients treated with tamoxifen (Habibi et al., 2008).  Collectively, this suggests that YB-1’s ability to induce chemoresistance may contribute to its correlations with poor clinical outcome.   1.5 SIGNAL TRANDUCERS AND ACTIVATORS OF TRANSCRIPTION (STATs)  Signal transducers and activators of transcription (STATs) are a family of latent cytoplasmic transcription factors essential for cell growth, survival, differentiation, and motility (Bromberg and Darnell, 2000).  Since their initial identification (Schindler et al., 1992), a total of seven family members have been described: STAT1 to STAT4, STAT5a, STAT5b, and STAT6 (Darnell et al., 1994).  The activation of STAT3 is achieved by cytokine and growth factors that have receptors with intrinsic or associated tyrosine-kinase activity.  Activated Janus kinase (JAK) family members, SRC kinases, EGFR, and HER2 interact with STAT3 through their SRC homology 2 (SH2) domain resulting in phosphorylation of tyrosine 705 which allows for STAT3 dimer formation via reciprocal phosphotyrosine-SH2 interactions between monomers (Levy and Darnell, 2002).  Furthermore, the active dimers undergo an additional phosphorylation event within their transactivation domain at serine 727 mediated by ERK (Chung et al., 1997), p38 (Goh et al., 1999), c-jun kinase (JNK) (Haq et al., 2002), PKCδ (Jain et al., 1999), mTOR (Yokogami et al., 2000), and Pin1 (Lufei et al., 2007).  It has been suggested that this serine phosphorylation functions to enhance STAT3 mediated transcription (Wen et al., 1995).  However, at present the functions of both phosphorylation at tyrosine 705 and serine 727 remain controversial.  It has been reported that phosphorylation at tyrosine 705 is essential for dimer formation, nuclear transport, and DNA binding while activation at serine 727 enhances STAT3’s potency as a transcription factor by increasing its affinity for DNA in addition to recruiting co-17  activators (Bowman et al., 2000).  Conversely, evidence suggests that STAT3 is able to function in the absence of the above mentioned phosphorylation events.  STAT3 has been reported to achieve nuclear transport independent of tyrosine phosphorylation (Liu et al., 2005).  Furthermore, acetylation events at particular lysine residues have been reported to induce STAT3 dimer formation where transcription activity remains persistent in the absence of phosphorylation thereby contradicting the requirement for tyrosine 705 phosphorylation for dimerisation (Lee et al., 2009; O'Shea et al., 2005).  Regardless, STAT3 serine phosphorylation is necessary for oncogenesis since expression of a dominant negative mutant where the serine 727 residue is substituted for an alanine prevents transformation of v-src NIH-3T3 cells (Bromberg et al., 1998).   Persistent activation of STATs, STAT3 and STAT5 in particular, has been found in a significant proportion of solid tumours, as well as, haematological malignancies where their role in oncogenesis is substantial (Yu and Jove, 2004).  STAT3 is commonly found to be constitutively activated in breast cancer as a result of deregulated and overactive upstream kinase activity.  At this time no known STAT3 gene mutations have been identified (Yu and Jove, 2004).  Further, STAT3 has been demonstrated to function as an oncogene since it is capable of transforming fibroblasts measured by in vitro anchorage independence and in vivo tumour growth assays (Bromberg et al., 1999).  The ability of STAT3 to induce oncogenic transformation is a direct result of it’s role in regulating genes involved in survival, cell cycle progression and motility including cyclin D1 (CCND1) (Bromberg et al., 1999), p21WAF1 (Sinibaldi et al., 2000), Bcl-xL (Bromberg et al., 1999), MCL1 (Liu et al., 2003), survivin (Gritsko et al., 2006),  MYC (Bromberg et al., 1999), and TWIST (Lo et al., 2007).  Moreover, in vivo RNA interference against STAT3 suppressed tumour growth in both breast (Ling and Arlinghaus, 2005) and 18  prostate (Gao et al., 2005) tumours.  Beyond its role in carcinogenesis, STAT3 has also been reported to be involved in drug resistance in breast and ovarian cancers (Bourguignon et al., 2008; Real et al., 2002).  Interestingly, STAT3 activity has been demonstrated to be essential for the maintenance of breast cancer stem-like cells (Zhou et al., 2007), suggesting that it plays a more global role in malignant transformation by its involvement in tumour progression and perhaps recurrence.  1.6 MEMBRANE RECEPTORS Membrane receptors are essential in normal cell growth and development as they are responsible for governing proliferation, migration, metabolism, differentiation, and survival by relaying extracellular mitogenic growth signals at the cell surface to the cytoplasm (Gschwind et al., 2004).  Numerous growth factor receptors have intrinsic kinase activity within their cytoplasmic tails where as integrins impart signals via indirect association with intracellular kinases.  Regardless, these receptors orchestrate the many cellular regulatory pathways governing cell fate through their interaction with growth factors, extracellular matrix (ECM) components, and cell-cell adhesion/interaction molecules (Hanahan and Weinberg, 2000).  In cancer, deregulation of membrane receptors by over-expression or mutations renders them constitutively active and allows for abnormal intracellular signalling capable of potent oncogenic transformation (Weinberg, 2007).  Consequently, cell-surface receptors serve as attractive targets for cancer therapy (Gschwind et al., 2004).  Presently, therapeutic agents targeting membrane receptors are used in the clinic to treat breast cancer, GISTs, and NSCLCs (Gschwind et al., 2004).   19  1.7 HUMAN EPIDERMAL GROWTH FACTOR RECEPTOR-2 (HER2) HER1/EGFR/ErbB1, HER2/ErbB2, HER3/ErbB3, and HER4/ErbB4 constitute a superfamily of receptor tyrosine kinases (RTKs) with potent roles in tumourigenesis.  These four distinct receptors function in collaboration with one another to dictate a network of signalling pathways involved in cell division, apoptosis, invasion, and adhesion (Yarden and Sliwkowski, 2001).  A variety of ligands specifically bind to the epidermal growth factor (EGF) receptors leading to either homo- or heterodimerisation.  This results in the activation of intrinsic kinase activity ensuing in the phosphorylation of tyrosine residues which are present within the cytoplasmic tails of these receptors (Yarden and Sliwkowski, 2001).  However, HER2 has little to no affinity for any particular ligand and achieves activation through heterodimerisation.  Despite its inability to bind ligands, HER2 is the preferential heterodimerisation partner of the remaining activated ligand bound family members resulting in powerful signalling outputs (Graus-Porta et al., 1997).  The importance of the human epidermal growth factor receptor-2 (HER2) was realized in the 1980s by a number of hallmark studies.  In 1981, Weinberg’s laboratory identified unique DNA sequences isolated from rat carcinomas and neuroblastomas with the ability to transform the mouse fibroblast cell line NIH-3T3, which they referred to as neu (Shih et al., 1981).  Subsequently, they demonstrated neu had substantial homology to the established ERBB gene and also, its protein product (p185) shared similarities to EGFR (Schechter et al., 1984).  Next, the functional importance of neu was demonstrated when monoclonal antibodies (mAb) against p185 reverted transformation in neu transfected NIH-3T3 cell lines (Drebin et al., 1984).  Later, HER2, the human counterpart of neu was identified by two independent research studies using 20  DNA hybridization studies employing v-ERBB probes (Coussens et al., 1985; King et al., 1985).  In fact King et al identified HER2 as being amplified five to ten fold in the mammary cancer cell line MAC117 (King et al., 1985), providing the impetus to further explore HER2 in breast cancers.  Landmark studies conducted by Dennis Slamon in collaboration with Genentech later identified HER2 as an extremely important factor in breast cancer (Slamon et al., 1987; Slamon et al., 1989).  HER2 was found to be amplified two to twenty fold in approximately 25% to 30% of primary human breast cancer samples (Slamon et al., 1987).  The genetic lesion had a direct clinical correlation with outcome as amplification was associated with decreased overall survival and time to relapse (Slamon et al., 1987).  It was later noted that the incidence of HER2 amplification was directly linked to the over-expression of HER2 in both breast and ovarian cancer (Slamon et al., 1989).  The aggressive phenotype associated with HER2 can be explained by its involvement in cell proliferation and survival mechanisms as its activity regulates PI3K-AKT, MAPK, SRC, and STAT signalling events (Hynes and Lane, 2005).  The potency of HER2 cannot be attributed to activating mutations since they are absent in primary human breast cancer samples (Lemoine et al., 1990).  Further, transgenic mice models with targeted expression of unactivated HER2 under the mouse mammary tumour virus (MMTV) promoter had the capacity to induce latent focal mammary tumours.  Many mice also harboured metastases to the lungs (Guy et al., 1992).  Evidently, HER2 functions in orchestrating cellular events which promote the initiation and progression of aggressive metastatic breast cancers with poor clinical outcome.  The identification of one novel factor frequently over-expressed in a proportion of breast cancer patients was groundbreaking and provided the rationale for the development of targeted therapies to treat breast cancers. 21  1.8 TRASTUZUMAB (HERCEPTIN™)  The vast evidence supporting the role of HER2 in breast cancer development and progression prompted the development of novel therapeutic agents against the oncogenic membrane receptor.  Trastuzumab (Herceptin™), a humanized monoclonal antibody that binds to the extracellular domain of HER2 was created by Genentech in 1992 (Carter et al., 1992).  Initial proof of concept studies demonstrated efficacy of the antibody as trastuzumab was able to bind HER2 with high affinity.  This resulted in decreased cell growth in vitro (Carter et al., 1992) as well as suppression of in vivo tumour growth in xenograft models (Baselga et al., 1998).  Initial clinical trials employing trastuzumab as a single agent for the treatment of HER2 positive metastatic breast cancers demonstrated clinical benefit with 12 to 34% of tumours responding to treatment (Baselga et al., 1996; Cobleigh et al., 1999; Vogel et al., 2002).  Later trials employed a strategy of combining trastuzumab with either paclitaxel (Slamon et al., 2001) or docetaxel (Esteva et al., 2002).  The combinatory therapeutic regime achieved increased response rates, time to disease progression, and overall survival. The results were far superior compared to trastuzumab monotherapy.  Trastuzumab was approved by the Food and Drug Agency (FDA) in 1998 for women with metastatic breast cancer whose tumours over-express HER2.  The direct mechanism by which trastuzumab achieves tumour regression remains elusive, however several mechanisms have been proposed.  HER2 receptor blockage results in a dampening of downstream HER2 mediated AKT and MAPK signalling cascades (Dubska et al., 2005; Nagata et al., 2004).  This results in the accumulation of p27kip1 and hence sequestration of cyclin dependent kinase 2 (CDK2), promoting cell cycle arrest and apoptosis (Lane et al., 2001).  Furthermore, trastuzumab has also been linked to HER2 receptor degradation and internalization 22  (Cuello et al., 2001), yet contrary studies have suggested trastuzumab has no effect on HER2 surface expression (Arnould et al., 2006).  Also, proteolytic cleavage of HER2 yields an intact membrane receptor with enhanced kinase activity in addition to an ectodomain (ECD) fragment (Christianson et al., 1998).  In vitro studies have demonstrated trastuzumab mediated inhibition of HER2 cleavage, preventing the creation of a more potent RTK (Molina et al., 2001).  Another mechanism which has been implicated is the reduction of tumour angiogenesis by decreasing vascular endothelial growth factor (VEGF) levels while increasing thrombospondin-1 (TSP1) (Izumi et al., 2002).  Further, in vivo studies of HER2 over-expressing breast cancers with trastuzumab demonstrated a significant reduction in tumour volume as well as decreased microvessel density (Izumi et al., 2002; Petit et al., 1997).  Lastly, mechanisms regulated by the immune system have also been linked to cytotoxic events induced by trastuzumab.  Natural killer (NK) cells express the Fc gamma receptor which binds to the Fc domain of trastuzumab.  Hence, trastuzumab recruits NK cells to tumours which then initiate cancer cell lysis in an antibody dependent cellular cytotoxic (ADCC) manner.  This has been demonstrated in several breast cancer cell lines (Cooley et al., 1999; Lewis et al., 1993).  Trastuzumab has provided clinical benefit when administered in combination with conventional chemotherapies.  Unfortunately, in some instances the therapeutic efficacy of trastuzumab is futile, a subset of patients do not respond to initial therapy while others develop resistance within one year (Esteva et al., 2002; Slamon et al., 2001).  A variety of hypotheses regarding resistance have been proposed, however they have not provided definitive answers to overcoming trastuzumab insensitivity. One theory proposed in mediating resistance is alterations in HER2 receptor-trastuzumab interactions.  The membrane associated glycoprotein mucin-4 (MUC4) has been shown to interact with HER2 and in doing so preventing interaction between HER2 and 23  trastuzumab (Nagy et al., 2005; Price-Schiavi et al., 2002).  Another idea suggests increased cell signalling from compensatory pathways during trastuzumab treatment may aid in escaping its effect.  EGFR, HER3, HER4 and IGFR-1R signalling have been suggested as alternative pathways activated during therapy thereby aiding tumour cells in overriding the effects of trastuzumab (Lu et al., 2001; Sergina et al., 2007).  For example, the expression of constitutively active AKT in HER2 over-expressing breast cancer cell lines BT474 and SKBR3 rendered them insensitive to trastuzumab mediated apoptosis (Yakes et al., 2002).  Furthermore, Nagata et al demonstrated that PTEN inhibition reversed the antitumour activity of trastuzumab which was further validated when it was shown that patients with HER2 over-expressing tumours which are PTEN deficient have a poor response to therapy (Nagata et al., 2004).  More recently, a large scale RNA interference screen also implicated PTEN as well as mutant PIK3CA in the development of trastuzumab resistance (Berns et al., 2007).  Clearly, a more thorough understanding of the molecular mechanisms that limit the efficacy of trastuzumab would help to identify patients at risk of being nonresponsive and also aid in the development of better therapeutic options.  1.9 CD44 CD44 is a class I transmembrane glycoprotein expressed across a range of cell types where it primarily functions as an adhesion molecule.  CD44 binds hyaluronan (HA) in addition to serving as a docking site for collagen, laminin, and fibronectin thereby mediating cellular migration through the extracellular matrix (Ponta et al., 2003).  Various CD44 isoforms exist as a result of alternative splicing of pre-mRNA species and extensive post-translational modifications including glycosylation (Screaton et al., 1992).  Thus the functions of CD44 are 24  intimately related to the structural modifications encountered by the molecule as they dictate the receptor’s interactions with various extracellular components.  Initial interest in understanding the receptor’s role in cancer was sparked by the identification of CD44 having a role in the metastasis of rat pancreatic cancer cell models (Gunthert et al., 1991).  Although CD44 lacks intrinsic signalling activity, its role in tumourigenesis can be contributed to its extracellular interactions with the mesenchymal epithelial transition (MET) receptor (Nestl et al., 2001) and all four ErbB receptors (Bourguignon et al., 1997; Sherman et al., 2000; Yu et al., 2002).  Thus CD44’s ability to serve as a co-receptor mediates downstream survival and growth pathways through MAPK and PI3K-AKT signalling.  Interestingly, in the trastuzumab resistant JIMT-1 breast cancer cell line, the CD44-HER2 interaction circumvents trastuzumab access to its receptor.  This is a result of HER2 being masked by HA binding to CD44 (Palyi-Krekk et al., 2007).  Beyond its indirect role in influencing cell signalling by serving as a co-receptor, CD44 also mediates other signalling events by interacting with SRC (Lee et al., 2008), Rho GTPase (Bourguignon, 2008), Rho kinase (Bourguignon et al., 2006), LCK (Ilangumaran et al., 1998), FYN (Ilangumaran et al., 1998), and PKC (Legg et al., 2002).  Despite lacking kinase activity in its cytoplasmic tale, the intracellular segment of the protein has two serine residues whose phosphorylation is regulated by PKC (Legg et al., 2002).  The phosphorylation status of CD44 has been associated with its ability to interact with ankryn, ezrin, radixin, and moesin (Legg et al., 2002) and thus impact actin cytoskeletal dynamics which in pathogenesis are dysfunctional.  More recently, a novel role of CD44 in DNA transcription has been described (Lee et al., 2009).  Lee et al report that following receptor activation, CD44 is internalized and associates with STAT3 and p300, allowing for STAT3 dimerisation by acetylation of its lysine 685 residue (Lee et al., 2009).  This complex then localizes to the nucleus where it binds and 25  regulates the cyclin D1 promoter, resulting in cell cycle progression (Lee et al., 2009).  Thus, CD44 has been implicated in a wide range of cancers where it appears to afford cells with a growth advantage.    CD44 has most recently been identified as a marker which defines a subset of breast cancer cells with the ability to drive tumourigenesis and generate a tumour with a heterogeneous cell population, referred to as tumour-initiating cells (TICs) (Al-Hajj et al., 2003).  Subsequent studies in cancers of the prostate (Collins et al., 2005), ovary (Zhang et al., 2008), colon (Dalerba et al., 2007), stomach (Takaishi et al., 2009), and blood (Jin et al., 2006) validated CD44+ cells as being highly associated with tumour initiation.  In fact, cells positive for CD44 expression have also been implicated in conferring resistance to radiotherapy (Phillips et al., 2006) and chemotherapy (Bourguignon et al., 2008; Li et al., 2008; Marangoni et al., 2009).   Complementary to this, gene expression studies comparing CD44+ tissues to normal mammary epithelium identified genes associated with invasion, metastasis, angiogenesis and known stem cells markers to be upregulated in CD44+ samples (Liu et al., 2007; Shipitsin et al., 2007).  Moreover, the gene profiles of these tumourigenic cells strongly associated with poor clinical outcome, providing evidence for CD44 serving as a direct prognostic marker (Liu et al., 2007; Shipitsin et al., 2007).  Therefore, targeting the TIC population which is defined by its expression of CD44 would perhaps help to improve the success of cancer therapies.  1.10 CANCER STEM CELLS Solid tumours are composed of a variety of cell types which differ in morphology, cell surface antigens, genetic aberrations, proliferation rates, response to drugs, and in their ability to initiate 26  tumour formation in in vivo transplant assays (Dick, 2008).  There exist two hypotheses which attempt to explain the observed heterogeneity in tumours.  The traditional paradigm known as the clonal model suggests that genetic lesions within a single cell confers superior growth and survival advantages which allows for the divergent expansion of these mutated cells thus initiating tumour formation (Reya et al., 2001).  In this model, cells composing the tumour are considered functionally equivalent and the acquisition of behavioural heterogeneity is achieved by intrinsic and extrinsic influences.  Alternatively, a second theory implicates cancer stem cells as the culprits of carcinogenesis.  Normal stem cells are a rare population that are multipotent, that is they have the ability to differentiate to give rise to a progeny of various cell types.  In addition, these cells have the ability to self-renew and generate new stem cells, thereby maintaining the stem cell pool.  The cancer stem cell theory argues that a unique and rare subset of cells, referred to as cancer stem cells (CSCs) and/or TICs, drives tumour initiation, progression, and recurrence.  CSCs are thought to be the progeny of transformed normal stem cells and hence share similar characteristics to normal stem cells.  On the other hand, it has also been argued that cancer cells mutate to adopt stem cell characteristics.  The exact mechanisms by which CSCs arise thus remains to be further explored.    Therefore, a cell within a tumour, capable of tumour initiation through its indefinite self-renewal and differentiation properties, and able to generate a heterogeneous tumour is termed a CSC (Clarke et al., 2006).  Thus, experimentally, in vivo transplant assays are utilized to identify this class of cells.  Cells are selected for specific surface antigens capable of generating a tumour composed of various cell types and that recapitulates the parent tumour.  This suggests that they possess differentiation properties while the cell’s capacity for self-renewal is demonstrated by its ability to form additional tumours when serially passaged into a second host (Clarke et al., 2006).  In summary, the capacity for self-renewal and the ability to differentiate and produce a heterogeneous progeny of cells are the hallmarks of CSCs and/or TICs. 27  Evidence supporting the cancer stem cell model was first identified in acute myeloid leukemia (AML).  A pioneering study by Dick et al demonstrated that CD34+/CD38- cells isolated from AML patient samples were extremely rare, however they were the only cells capable of inducing AML in mice when transplanted into non-obese diabetic mice with severe combined immunodeficiency disease (NOD/SCID) (Bonnet and Dick, 1997).  Interestingly, the CD34+/CD38- phenotype had been previously established to identify normal stem cells in the hematopoietic system (Larochelle et al., 1996).  Therefore, for the first time, a subset of cancer cells related to normal stem cells, were identified to be present in cancer and also initiate disease.  More recently, tumourigenic breast cancer cells have been identified by a CD44+/CD24-/low/ESA+ (Al-Hajj et al., 2003) and/or ALDH+ (Ginestier et al., 2007) phenotype.  Cells possessing this phenotype were present albeit rare in human tumour samples.  Strikingly, as few as one hundred CD44+/CD24-/low cells were able to induce tumour formation in mice whereas thousands of cells with varying phenotypes were necessary for cancer initiation (Al-Hajj et al., 2003).  The prospective identification of these highly tumourigenic cells thus provides a new avenue of exploration to elucidate the pathways involved in disease initiation, progression, and recurrence.  Following the initial identification of TICs in the breast, progress has been made in understanding their role beyond disease initiation.  Gene profiling studies of CD44+/CD24low/- breast cancer samples implicated them with an invasive gene signature, thus associating TIC-like cells with cancer progression (Liu et al., 2007; Shipitsin et al., 2007).  Furthermore, it has been demonstrated that TICs are resistant to radiotherapy (Phillips et al., 2006) and a variety of chemotherapies (Li et al., 2008).  For example, enrichment in the proportion of CD44+/CD24low/- cells was observed in primary tumour samples following neoadjuvant chemotherapy suggesting 28  that TIC-like cells are unresponsive to therapy (Li et al., 2008).  In addition, CD44+CD24low/- breast tumours also correlate with poor clinical outcome (Liu et al., 2007).  Taken together, an emerging concept is that cancer recurrence is a consequence of ineffective targeting of TICs.                                       29  1.11 THESIS HYPOTHESIS AND OBJECTIVES   Hypothesis:  YB-1 provides an enhanced growth and survival phenotype in HER2 over-expressing breast cancer cells where its aberrant expression confers acquired resistance to trastuzumab therapy by inducing a tumour initiating phenotype through its regulation of CD44.   Objectives:  I. To characterize the molecular mechanism regulated by YB-1 which protects HER2 over-expressing breast cancer cells against apoptosis. II. To determine YB-1’s role in the growth and survival of HER2 over-expressing cells resistant to trastuzumab. III. To validate the role of activated P-YB-1S102 in mediating a trastuzumab resistant phenotype. IV. To query the relationship between YB-1 and the tumour-initiating associated receptor CD44 in acquired trastuzumab resistance.                30  REFERENCES  Canadian Cancer Society. Canadian Cancer Statistics 2009 .  Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. (2003). Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100: 3983-3988. Ali S, Coombes RC. (2000). Estrogen receptor alpha in human breast cancer: Occurrence and significance. J Mammary Gland Biol Neoplasia 5: 271-281. Arnould L, Gelly M, Penault-Llorca F, Benoit L, Bonnetain F, Migeon C et al. (2006). Trastuzumab-based treatment of HER2-positive breast cancer: An antibody-dependent cellular cytotoxicity mechanism? Br J Cancer 94: 259-267. Astanehe A, Finkbeiner MR, Hojabrpour P, To K, Fotovati A, Shadeo A et al. (2009). The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28: 2406-2418. Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K et al. (1997). Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3: 447-450. Baselga J, Norton L. (2002). Focus on breast cancer. Cancer Cell 1: 319-322. Baselga J, Norton L, Albanell J, Kim YM, Mendelsohn J. (1998). Recombinant humanized anti-HER2 antibody (herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58: 2825-2831. Baselga J, Tripathy D, Mendelsohn J, Baughman S, Benz CC, Dantis L et al. (1996). Phase II study of weekly intravenous recombinant humanized anti-p185HER2 monoclonal antibody in patients with HER2/neu-overexpressing metastatic breast cancer. J Clin Oncol 14: 737-744. Bergmann S, Royer-Pokora B, Fietze E, Jurchott K, Hildebrandt B, Trost D et al. (2005). YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res 65: 4078-4087. Berns K, Horlings HM, Hennessy BT, Madiredjo M, Hijmans EM, Beelen K et al. (2007). A functional genetic approach identifies the PI3K pathway as a major determinant of trastuzumab resistance in breast cancer. Cancer Cell 12: 395-402. Bonnet D, Dick JE. (1997). Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 3: 730-737. Bourguignon LY. (2008). Hyaluronan-mediated CD44 activation of RhoGTPase signaling and cytoskeleton function promotes tumor progression. Semin Cancer Biol 18: 251-259. Bourguignon LY, Gilad E, Brightman A, Diedrich F, Singleton P. (2006). Hyaluronan-CD44 interaction with leukemia-associated RhoGEF and epidermal growth factor receptor promotes 31  Rho/Ras co-activation, phospholipase C epsilon-Ca2+ signaling, and cytoskeleton modification in head and neck squamous cell carcinoma cells. J Biol Chem 281: 14026-14040. Bourguignon LY, Peyrollier K, Xia W, Gilad E. (2008). Hyaluronan-CD44 interaction activates stem cell marker nanog, stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem 283: 17635-17651. Bourguignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. (1997). Interaction between the adhesion receptor, CD44, and the oncogene product, p185HER2, promotes human ovarian tumor cell activation. J Biol Chem 272: 27913-27918. Bouvet P, Matsumoto K, Wolffe AP. (1995). Sequence-specific RNA recognition by the xenopus Y-box proteins. an essential role for the cold shock domain. J Biol Chem 270: 28297-28303. Bowman T, Garcia R, Turkson J, Jove R. (2000). STATs in oncogenesis. Oncogene 19: 2474-2488. Brennan P, Donev R, Hewamana S. (2008). Targeting transcription factors for therapeutic benefit. Mol Biosyst 4: 909-919. Bromberg J, Darnell JE,Jr. (2000). The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19: 2468-2473. Bromberg JF, Horvath CM, Besser D, Lathem WW, Darnell JE,Jr. (1998). Stat3 activation is required for cellular transformation by v-src. Mol Cell Biol 18: 2553-2558. Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C et al. (1999). Stat3 as an oncogene. Cell 98: 295-303. Buchdunger E, Cioffi CL, Law N, Stover D, Ohno-Jones S, Druker BJ et al. (2000). Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J Pharmacol Exp Ther 295: 139-145. Campiglio M, Locatelli A, Olgiati C, Normanno N, Somenzi G, Vigano L et al. (2004). Inhibition of proliferation and induction of apoptosis in breast cancer cells by the epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor ZD1839 ('iressa') is independent of EGFR expression level. J Cell Physiol 198: 259-268. Carter P, Presta L, Gorman CM, Ridgway JB, Henner D, Wong WL et al. (1992). Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci U S A 89: 4285-4289. Chambers AF, Groom AC, MacDonald IC. (2002). Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer 2: 563-572. 32  Chatterjee M, Rancso C, Stuhmer T, Eckstein N, Andrulis M, Gerecke C et al. (2008). The Y-box binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood 111: 3714-3722. Choudhuri S, Klaassen CD. (2006). Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters. Int J Toxicol 25: 231-259. Christianson TA, Doherty JK, Lin YJ, Ramsey EE, Holmes R, Keenan EJ et al. (1998). NH2-terminally truncated HER-2/neu protein: Relationship with shedding of the extracellular domain and with prognostic factors in breast cancer. Cancer Res 58: 5123-5129. Chung J, Uchida E, Grammer TC, Blenis J. (1997). STAT3 serine phosphorylation by ERK-dependent and -independent pathways negatively modulates its tyrosine phosphorylation. Mol Cell Biol 17: 6508-6516. Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL et al. (2006). Cancer stem cells--perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer Res 66: 9339-9344. Clarke RB, Howell A, Potten CS, Anderson E. (1997). Dissociation between steroid receptor expression and cell proliferation in the human breast. Cancer Res 57: 4987-4991. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L et al. (1999). Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17: 2639-2648. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. (2005). Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 65: 10946-10951. Comis RL. (2005). The current situation: Erlotinib (tarceva) and gefitinib (iressa) in non-small cell lung cancer. Oncologist 10: 467-470. Cooley S, Burns LJ, Repka T, Miller JS. (1999). Natural killer cell cytotoxicity of breast cancer targets is enhanced by two distinct mechanisms of antibody-dependent cellular cytotoxicity against LFA-3 and HER2/neu. Exp Hematol 27: 1533-1541. Coussens L, Yang-Feng TL, Liao YC, Chen E, Gray A, McGrath J et al. (1985). Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science 230: 1132-1139. Cristofanilli M, Morandi P, Krishnamurthy S, Reuben JM, Lee BN, Francis D et al. (2008). Imatinib mesylate (gleevec) in advanced breast cancer-expressing C-kit or PDGFR-beta: Clinical activity and biological correlations. Ann Oncol 19: 1713-1719. Cuello M, Ettenberg SA, Clark AS, Keane MM, Posner RH, Nau MM et al. (2001). Down-regulation of the erbB-2 receptor by trastuzumab (herceptin) enhances tumor necrosis factor-33  related apoptosis-inducing ligand-mediated apoptosis in breast and ovarian cancer cell lines that overexpress erbB-2. Cancer Res 61: 4892-4900. Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW et al. (2007). Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A 104: 10158-10163. Darnell JE,Jr. (2002). Transcription factors as targets for cancer therapy. Nat Rev Cancer 2: 740-749. Darnell JE,Jr, Kerr IM, Stark GR. (1994). Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264: 1415-1421. Dick JE. (2008). Stem cell concepts renew cancer research. Blood 112: 4793-4807. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, Schwartz BD. (1988). Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci U S A 85: 7322-7326. Din OS, Dodwell D, Wakefield RJ, Coleman RE. (2010). Aromatase inhibitor-induced arthralgia in early breast cancer: What do we know and how can we find out more? Breast Cancer Res Treat .  Dowsett M, Nicholson RI, Pietras RJ. (2005). Biological characteristics of the pure antiestrogen fulvestrant: Overcoming endocrine resistance. Breast Cancer Res Treat 93 Suppl 1: S11-8. Drebin JA, Stern DF, Link VC, Weinberg RA, Greene MI. (1984). Monoclonal antibodies identify a cell-surface antigen associated with an activated cellular oncogene. Nature 312: 545-548. Druker BJ, Tamura S, Buchdunger E, Ohno S, Segal GM, Fanning S et al. (1996). Effects of a selective inhibitor of the abl tyrosine kinase on the growth of bcr-abl positive cells. Nat Med 2: 561-566. Dubska L, Andera L, Sheard MA. (2005). HER2 signaling downregulation by trastuzumab and suppression of the PI3K/Akt pathway: An unexpected effect on TRAIL-induced apoptosis. FEBS Lett 579: 4149-4158. En-Nia A, Yilmaz E, Klinge U, Lovett DH, Stefanidis I, Mertens PR. (2005). Transcription factor YB-1 mediates DNA polymerase alpha gene expression. J Biol Chem 280: 7702-7711. Esteva FJ, Valero V, Booser D, Guerra LT, Murray JL, Pusztai L et al. (2002). Phase II study of weekly docetaxel and trastuzumab for patients with HER-2-overexpressing metastatic breast cancer. J Clin Oncol 20: 1800-1808. Evdokimova V, Ovchinnikov LP, Sorensen PH. (2006). Y-box binding protein 1: Providing a new angle on translational regulation. Cell Cycle 5: 1143-1147. 34  Faury D, Nantel A, Dunn SE, Guiot MC, Haque T, Hauser P et al. (2007). Molecular profiling identifies prognostic subgroups of pediatric glioblastoma and shows increased YB-1 expression in tumors. J Clin Oncol 25: 1196-1208. Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y et al. (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28: 1421-1431. Fox SB, Smith K, Hollyer J, Greenall M, Hastrich D, Harris AL. (1994). The epidermal growth factor receptor as a prognostic marker: Results of 370 patients and review of 3009 patients. Breast Cancer Res Treat 29: 41-49. Fujita T, Ito K, Izumi H, Kimura M, Sano M, Nakagomi H et al. (2005). Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res 11: 8837-8844. Gao L, Zhang L, Hu J, Li F, Shao Y, Zhao D et al. (2005). Down-regulation of signal transducer and activator of transcription 3 expression using vector-based small interfering RNAs suppresses growth of human prostate tumor in vivo. Clin Cancer Res 11: 6333-6341. Gibbs JB. (2000). Mechanism-based target identification and drug discovery in cancer research. Science 287: 1969-1973. Gimenez-Bonafe P, Fedoruk MN, Whitmore TG, Akbari M, Ralph JL, Ettinger S et al. (2004). YB-1 is upregulated during prostate cancer tumor progression and increases P-glycoprotein activity. Prostate 59: 337-349. Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown M et al. (2007). ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1: 555-567. Goh KC, Haque SJ, Williams BR. (1999). p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18: 5601-5608. Goldman JM, Melo JV. (2008). BCR-ABL in chronic myelogenous leukemia--how does it work? Acta Haematol 119: 212-217. Goldsmith ME, Madden MJ, Morrow CS, Cowan KH. (1993). A Y-box consensus sequence is required for basal expression of the human multidrug resistance (mdr1) gene. J Biol Chem 268: 5856-5860. Gomez HL, Doval DC, Chavez MA, Ang PC, Aziz Z, Nag S et al. (2008). Efficacy and safety of lapatinib as first-line therapy for ErbB2-amplified locally advanced or metastatic breast cancer. J Clin Oncol 26: 2999-3005. Gralow JR. (2005). Optimizing the treatment of metastatic breast cancer. Breast Cancer Res Treat 89 Suppl 1: S9-S15. 35  Graus-Porta D, Beerli RR, Daly JM, Hynes NE. (1997). ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. EMBO J 16: 1647-1655. Gritsko T, Williams A, Turkson J, Kaneko S, Bowman T, Huang M et al. (2006). Persistent activation of stat3 signaling induces survivin gene expression and confers resistance to apoptosis in human breast cancer cells. Clin Cancer Res 12: 11-19. Gschwind A, Fischer OM, Ullrich A. (2004). The discovery of receptor tyrosine kinases: Targets for cancer therapy. Nat Rev Cancer 4: 361-370. Gunthert U, Hofmann M, Rudy W, Reber S, Zoller M, Haussmann I et al. (1991). A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65: 13-24. Guy CT, Webster MA, Schaller M, Parsons TJ, Cardiff RD, Muller WJ. (1992). Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc Natl Acad Sci U S A 89: 10578-10582. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res 10: R86. Hahn WC, Weinberg RA. (2002). Modelling the molecular circuitry of cancer. Nat Rev Cancer 2: 331-341. Hanahan D, Weinberg RA. (2000). The hallmarks of cancer. Cell 100: 57-70. Haq R, Halupa A, Beattie BK, Mason JM, Zanke BW, Barber DL. (2002). Regulation of erythropoietin-induced STAT serine phosphorylation by distinct mitogen-activated protein kinases. J Biol Chem 277: 17359-17366. Hasegawa SL, Doetsch PW, Hamilton KK, Martin AM, Okenquist SA, Lenz J et al. (1991). DNA binding properties of YB-1 and dbpA: Binding to double-stranded, single-stranded, and abasic site containing DNAs. Nucleic Acids Res 19: 4915-4920. Hay N, Sonenberg N. (2004). Upstream and downstream of mTOR. Genes Dev 18: 1926-1945. Higashi K, Inagaki Y, Suzuki N, Mitsui S, Mauviel A, Kaneko H et al. (2003). Y-box-binding protein YB-1 mediates transcriptional repression of human alpha 2(I) collagen gene expression by interferon-gamma. J Biol Chem 278: 5156-5162. Hines SJ, Organ C, Kornstein MJ, Krystal GW. (1995). Coexpression of the c-kit and stem cell factor genes in breast carcinomas. Cell Growth Differ 6: 769-779. Hortobagyi GN. (2000). Developments in chemotherapy of breast cancer. Cancer 88: 3073-3079. 36  Hynes NE, Lane HA. (2005). ERBB receptors and cancer: The complexity of targeted inhibitors. Nat Rev Cancer 5: 341-354. Ilangumaran S, Briol A, Hoessli DC. (1998). CD44 selectively associates with active src family protein tyrosine kinases lck and fyn in glycosphingolipid-rich plasma membrane domains of human peripheral blood lymphocytes. Blood 91: 3901-3908. Ise T, Nagatani G, Imamura T, Kato K, Takano H, Nomoto M et al. (1999). Transcription factor Y-box binding protein 1 binds preferentially to cisplatin-modified DNA and interacts with proliferating cell nuclear antigen. Cancer Res 59: 342-346. Izumi Y, Xu L, di Tomaso E, Fukumura D, Jain RK. (2002). Tumour biology: Herceptin acts as an anti-angiogenic cocktail. Nature 416: 279-280. Jain N, Zhang T, Kee WH, Li W, Cao X. (1999). Protein kinase C delta associates with and phosphorylates Stat3 in an interleukin-6-dependent manner. J Biol Chem 274: 24392-24400. Janz M, Harbeck N, Dettmar P, Berger U, Schmidt A, Jurchott K et al. (2002). Y-box factor YB-1 predicts drug resistance and patient outcome in breast cancer independent of clinically relevant tumor biologic factors HER2, uPA and PAI-1. Int J Cancer 97: 278-282. Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. (2006). Targeting of CD44 eradicates human acute myeloid leukemic stem cells. Nat Med 12: 1167-1174. Joensuu H, Roberts PJ, Sarlomo-Rikala M, Andersson LC, Tervahartiala P, Tuveson D et al. (2001). Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 344: 1052-1056. Johnston SR, Dowsett M. (2003). Aromatase inhibitors for breast cancer: Lessons from the laboratory. Nat Rev Cancer 3: 821-831. Johnston SR, Saccani-Jotti G, Smith IE, Salter J, Newby J, Coppen M et al. (1995). Changes in estrogen receptor, progesterone receptor, and pS2 expression in tamoxifen-resistant human breast cancer. Cancer Res 55: 3331-3338. Jordan VC. (2004). Selective estrogen receptor modulation: Concept and consequences in cancer. Cancer Cell 5: 207-213. Jurchott K, Bergmann S, Stein U, Walther W, Janz M, Manni I et al. (2003). YB-1 as a cell cycle-regulated transcription factor facilitating cyclin A and cyclin B1 gene expression. J Biol Chem 278: 27988-27996. Kamangar F, Dores GM, Anderson WF. (2006). Patterns of cancer incidence, mortality, and prevalence across five continents: Defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 24: 2137-2150. King CR, Kraus MH, Aaronson SA. (1985). Amplification of a novel v-erbB-related gene in a human mammary carcinoma. Science 229: 974-976. 37  Klijn JG, Berns PM, Schmitz PI, Foekens JA. (1992). The clinical significance of epidermal growth factor receptor (EGF-R) in human breast cancer: A review on 5232 patients. Endocr Rev 13: 3-17. Kloks CP, Spronk CA, Lasonder E, Hoffmann A, Vuister GW, Grzesiek S et al. (2002). The solution structure and DNA-binding properties of the cold-shock domain of the human Y-box protein YB-1. J Mol Biol 316: 317-326. Kohno K, Izumi H, Uchiumi T, Ashizuka M, Kuwano M. (2003). The pleiotropic functions of the Y-box-binding protein, YB-1. Bioessays 25: 691-698. Kwan ML, Kushi LH, Weltzien E, Maring B, Kutner SE, Fulton RS et al. (2009). Epidemiology of breast cancer subtypes in two prospective cohort studies of breast cancer survivors. Breast Cancer Res 11: R31. Lane HA, Motoyama AB, Beuvink I, Hynes NE. (2001). Modulation of p27/Cdk2 complex formation through 4D5-mediated inhibition of HER2 receptor signaling. Ann Oncol 12 Suppl 1: S21-2. Larochelle A, Vormoor J, Hanenberg H, Wang JC, Bhatia M, Lapidot T et al. (1996). Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: Implications for gene therapy. Nat Med 2: 1329-1337. Lasham A, Moloney S, Hale T, Homer C, Zhang YF, Murison JG et al. (2003). The Y-box-binding protein, YB1, is a potential negative regulator of the p53 tumor suppressor. J Biol Chem 278: 35516-35523. Law JH, Habibi G, Hu K, Masoudi H, Wang MY, Stratford AL et al. (2008). Phosphorylated insulin-like growth factor-i/insulin receptor is present in all breast cancer subtypes and is related to poor survival. Cancer Res 68: 10238-10246. Lee C, Dhillon J, Wang MY, Gao Y, Hu K, Park E et al. (2008). Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res 68: 8661-8666. Lee JL, Wang MJ, Chen JY. (2009). Acetylation and activation of STAT3 mediated by nuclear translocation of CD44. J Cell Biol 185: 949-957. Lee JL, Wang MJ, Sudhir PR, Chen JY. (2008). CD44 engagement promotes matrix-derived survival through the CD44-SRC-integrin axis in lipid rafts. Mol Cell Biol 28: 5710-5723. Legg JW, Lewis CA, Parsons M, Ng T, Isacke CM. (2002). A novel PKC-regulated mechanism controls CD44 ezrin association and directional cell motility. Nat Cell Biol 4: 399-407. Lemoine NR, Staddon S, Dickson C, Barnes DM, Gullick WJ. (1990). Absence of activating transmembrane mutations in the c-erbB-2 proto-oncogene in human breast cancer. Oncogene 5: 237-239. 38  Levy DE, Darnell JE,Jr. (2002). Stats: Transcriptional control and biological impact. Nat Rev Mol Cell Biol 3: 651-662. Lewis GD, Figari I, Fendly B, Wong WL, Carter P, Gorman C et al. (1993). Differential responses of human tumor cell lines to anti-p185HER2 monoclonal antibodies. Cancer Immunol Immunother 37: 255-263. Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF et al. (2008). Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst 100: 672-679. Liao DJ, Dickson RB. (2000). c-myc in breast cancer. Endocr Relat Cancer 7: 143-164. Lin NU, Winer EP. (2004). New targets for therapy in breast cancer: Small molecule tyrosine kinase inhibitors. Breast Cancer Res 6: 204-210. Ling X, Arlinghaus RB. (2005). Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice. Cancer Res 65: 2532-2536. Liu H, Ma Y, Cole SM, Zander C, Chen KH, Karras J et al. (2003). Serine phosphorylation of STAT3 is essential for mcl-1 expression and macrophage survival. Blood 102: 344-352. Liu L, McBride KM, Reich NC. (2005). STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-alpha3. Proc Natl Acad Sci U S A 102: 8150-8155. Liu R, Wang X, Chen GY, Dalerba P, Gurney A, Hoey T et al. (2007). The prognostic role of a gene signature from tumorigenic breast-cancer cells. N Engl J Med 356: 217-226. Lo HW, Hsu SC, Xia W, Cao X, Shih JY, Wei Y et al. (2007). Epidermal growth factor receptor cooperates with signal transducer and activator of transcription 3 to induce epithelial-mesenchymal transition in cancer cells via up-regulation of TWIST gene expression. Cancer Res 67: 9066-9076. Lu Y, Zi X, Zhao Y, Mascarenhas D, Pollak M. (2001). Insulin-like growth factor-I receptor signaling and resistance to trastuzumab (herceptin). J Natl Cancer Inst 93: 1852-1857. Lufei C, Koh TH, Uchida T, Cao X. (2007). Pin1 is required for the Ser727 phosphorylation-dependent Stat3 activity. Oncogene 26: 7656-7664. MacGregor JI, Jordan VC. (1998). Basic guide to the mechanisms of antiestrogen action. Pharmacol Rev 50: 151-196. Marangoni E, Lecomte N, Durand L, de Pinieux G, Decaudin D, Chomienne C et al. (2009). CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer 100: 918-922. Martino S, Costantino J, McNabb M, Mershon J, Bryant K, Powles T et al. (2004). The role of selective estrogen receptor modulators in the prevention of breast cancer: Comparison of the clinical trials. Oncologist 9: 116-125. 39  Mertens PR, Harendza S, Pollock AS, Lovett DH. (1997). Glomerular mesangial cell-specific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J Biol Chem 272: 22905-22912. Miller TW, Forbes JT, Shah C, Wyatt SK, Manning HC, Olivares MG et al. (2009). Inhibition of mammalian target of rapamycin is required for optimal antitumor effect of HER2 inhibitors against HER2-overexpressing cancer cells. Clin Cancer Res 15: 7266-7276. Moellering RE, Cornejo M, Davis TN, Del Bianco C, Aster JC, Blacklow SC et al. (2009). Direct inhibition of the NOTCH transcription factor complex. Nature 462: 182-188. Molina MA, Codony-Servat J, Albanell J, Rojo F, Arribas J, Baselga J. (2001). Trastuzumab (herceptin), a humanized anti-Her2 receptor monoclonal antibody, inhibits basal and activated Her2 ectodomain cleavage in breast cancer cells. Cancer Res 61: 4744-4749. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA et al. (2004). PTEN activation contributes to tumor inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in patients. Cancer Cell 6: 117-127. Nagy P, Friedlander E, Tanner M, Kapanen AI, Carraway KL, Isola J et al. (2005). Decreased accessibility and lack of activation of ErbB2 in JIMT-1, a herceptin-resistant, MUC4-expressing breast cancer cell line. Cancer Res 65: 473-482. Nass SJ, Dickson RB. (1997). Defining a role for c-myc in breast tumorigenesis. Breast Cancer Res Treat 44: 1-22. Nathanson KL, Wooster R, Weber BL. (2001). Breast cancer genetics: What we know and what we need. Nat Med 7: 552-556. Nestl A, Von Stein OD, Zatloukal K, Thies WG, Herrlich P, Hofmann M et al. (2001). Gene expression patterns associated with the metastatic phenotype in rodent and human tumors. Cancer Res 61: 1569-1577. Norman JT, Lindahl GE, Shakib K, En-Nia A, Yilmaz E, Mertens PR. (2001). The Y-box binding protein YB-1 suppresses collagen alpha 1(I) gene transcription via an evolutionarily conserved regulatory element in the proximal promoter. J Biol Chem 276: 29880-29890. Oda Y, Kohashi K, Yamamoto H, Tamiya S, Kohno K, Kuwano M et al. (2008). Different expression profiles of Y-box-binding protein-1 and multidrug resistance-associated proteins between alveolar and embryonal rhabdomyosarcoma. Cancer Sci 99: 726-732. Oda Y, Sakamoto A, Shinohara N, Ohga T, Uchiumi T, Kohno K et al. (1998). Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human osteosarcoma. Clin Cancer Res 4: 2273-2277. Ohga T, Uchiumi T, Makino Y, Koike K, Wada M, Kuwano M et al. (1998). Direct involvement of the Y-box binding protein YB-1 in genotoxic stress-induced activation of the human multidrug resistance 1 gene. J Biol Chem 273: 5997-6000. 40  Okamoto T, Izumi H, Imamura T, Takano H, Ise T, Uchiumi T et al. (2000). Direct interaction of p53 with the Y-box binding protein, YB-1: A mechanism for regulation of human gene expression. Oncogene 19: 6194-6202. O'Shea JJ, Kanno Y, Chen X, Levy DE. (2005). Cell signaling. stat acetylation--a key facet of cytokine signaling? Science 307: 217-218. Palyi-Krekk Z, Barok M, Isola J, Tammi M, Szollosi J, Nagy P. (2007). Hyaluronan-induced masking of ErbB2 and CD44-enhanced trastuzumab internalisation in trastuzumab resistant breast cancer. Eur J Cancer 43: 2423-2433. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA et al. (2000). Molecular portraits of human breast tumours. Nature 406: 747-752. Petit AM, Rak J, Hung MC, Rockwell P, Goldstein N, Fendly B et al. (1997). Neutralizing antibodies against epidermal growth factor and ErbB-2/neu receptor tyrosine kinases down-regulate vascular endothelial growth factor production by tumor cells in vitro and in vivo: Angiogenic implications for signal transduction therapy of solid tumors. Am J Pathol 151: 1523-1530. Phillips TM, McBride WH, Pajonk F. (2006). The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. J Natl Cancer Inst 98: 1777-1785. Ponta H, Sherman L, Herrlich PA. (2003). CD44: From adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol 4: 33-45. Price-Schiavi SA, Jepson S, Li P, Arango M, Rudland PS, Yee L et al. (2002). Rat Muc4 (sialomucin complex) reduces binding of anti-ErbB2 antibodies to tumor cell surfaces, a potential mechanism for herceptin resistance. Int J Cancer 99: 783-791. Real PJ, Sierra A, De Juan A, Segovia JC, Lopez-Vega JM, Fernandez-Luna JL. (2002). Resistance to chemotherapy via Stat3-dependent overexpression of bcl-2 in metastatic breast cancer cells. Oncogene 21: 7611-7618. Reya T, Morrison SJ, Clarke MF, Weissman IL. (2001). Stem cells, cancer, and cancer stem cells. Nature 414: 105-111. Rubinstein DB, Stortchevoi A, Boosalis M, Ashfaq R, Guillaume T. (2002). Overexpression of DNA-binding protein B gene product in breast cancer as detected by in vitro-generated combinatorial human immunoglobulin libraries. Cancer Res 62: 4985-4991. Sainsbury JR, Farndon JR, Needham GK, Malcolm AJ, Harris AL. (1987). Epidermal-growth-factor receptor status as predictor of early recurrence of and death from breast cancer. Lancet 1: 1398-1402. Sakura H, Maekawa T, Imamoto F, Yasuda K, Ishii S. (1988). Two human genes isolated by a novel method encode DNA-binding proteins containing a common region of homology. Gene 73: 499-507. 41  Samuel S, Twizere JC, Bernstein LR. (2005). YB-1 represses AP1-dependent gene transactivation and interacts with an AP-1 DNA sequence. Biochem J 388: 921-928. Schechter AL, Stern DF, Vaidyanathan L, Decker SJ, Drebin JA, Greene MI et al. (1984). The neu oncogene: An erb-B-related gene encoding a 185,000-mr tumour antigen. Nature 312: 513-516. Schindler C, Shuai K, Prezioso VR, Darnell JE,Jr. (1992). Interferon-dependent tyrosine phosphorylation of a latent cytoplasmic transcription factor. Science 257: 809-813. Screaton GR, Bell MV, Jackson DG, Cornelis FB, Gerth U, Bell JI. (1992). Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci U S A 89: 12160-12164. Sergina NV, Rausch M, Wang D, Blair J, Hann B, Shokat KM et al. (2007). Escape from HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature 445: 437-441. Sherman LS, Rizvi TA, Karyala S, Ratner N. (2000). CD44 enhances neuregulin signaling by schwann cells. J Cell Biol 150: 1071-1084. Shibahara K, Sugio K, Osaki T, Uchiumi T, Maehara Y, Kohno K et al. (2001). Nuclear expression of the Y-box binding protein, YB-1, as a novel marker of disease progression in non-small cell lung cancer. Clin Cancer Res 7: 3151-3155. Shibahara K, Uchiumi T, Fukuda T, Kura S, Tominaga Y, Maehara Y et al. (2004). Targeted disruption of one allele of the Y-box binding protein-1 (YB-1) gene in mouse embryonic stem cells and increased sensitivity to cisplatin and mitomycin C. Cancer Sci 95: 348-353. Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H et al. (1999). Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer 83: 732-737. Shih C, Padhy LC, Murray M, Weinberg RA. (1981). Transforming genes of carcinomas and neuroblastomas introduced into mouse fibroblasts. Nature 290: 261-264. Shiota M, Izumi H, Onitsuka T, Miyamoto N, Kashiwagi E, Kidani A et al. (2008). Twist promotes tumor cell growth through YB-1 expression. Cancer Res 68: 98-105. Shipitsin M, Campbell LL, Argani P, Weremowicz S, Bloushtain-Qimron N, Yao J et al. (2007). Molecular definition of breast tumor heterogeneity. Cancer Cell 11: 259-273. Sinibaldi D, Wharton W, Turkson J, Bowman T, Pledger WJ, Jove R. (2000). Induction of p21WAF1/CIP1 and cyclin D1 expression by the src oncoprotein in mouse fibroblasts: Role of activated STAT3 signaling. Oncogene 19: 5419-5427. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. (1987). Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235: 177-182. 42  Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE et al. (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244: 707-712. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A et al. (2001). Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344: 783-792. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al. (2001). Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 98: 10869-10874. Sorlie T, Tibshirani R, Parker J, Hastie T, Marron JS, Nobel A et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 100: 8418-8423. Starling N, Watkins D, Cunningham D, Thomas J, Webb J, Brown G et al. (2009). Dose finding and early efficacy study of gemcitabine plus capecitabine in combination with bevacizumab plus erlotinib in advanced pancreatic cancer. J Clin Oncol 27: 5499-5505. Steeg PS, Zhou Q. (1998). Cyclins and breast cancer. Breast Cancer Res Treat 52: 17-28. Stein U, Bergmann S, Scheffer GL, Scheper RJ, Royer HD, Schlag PM et al. (2005). YB-1 facilitates basal and 5-fluorouracil-inducible expression of the human major vault protein (MVP) gene. Oncogene 24: 3606-3618. Stein U, Jurchott K, Walther W, Bergmann S, Schlag PM, Royer HD. (2001). Hyperthermia-induced nuclear translocation of transcription factor YB-1 leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 276: 28562-28569. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y et al. (2008). Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res 10: R99. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. Strebhardt K, Ullrich A. (2008). Paul ehrlich's magic bullet concept: 100 years of progress. Nat Rev Cancer 8: 473-480. Sutherland BW, Kucab J, Wu J, Lee C, Cheang MC, Yorida E et al. (2005). Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24: 4281-4292. Swamynathan SK, Varma BR, Weber KT, Guntaka RV. (2002). Targeted disruption of one allele of the Y-box protein gene, chk-YB-1b, in DT40 cells results in major defects in cell cycle. Biochem Biophys Res Commun 296: 451-457. 43  Takabatake D, Fujita T, Shien T, Kawasaki K, Taira N, Yoshitomi S et al. (2007). Tumor inhibitory effect of gefitinib (ZD1839, iressa) and taxane combination therapy in EGFR-overexpressing breast cancer cell lines (MCF7/ADR, MDA-MB-231). Int J Cancer 120: 181-188. Takaishi S, Okumura T, Tu S, Wang SS, Shibata W, Vigneshwaran R et al. (2009). Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells 27: 1006-1020. Turkson J, Ryan D, Kim JS, Zhang Y, Chen Z, Haura E et al. (2001). Phosphotyrosyl peptides block Stat3-mediated DNA binding activity, gene regulation, and cell transformation. J Biol Chem 276: 45443-45455. Uchiumi T, Fotovati A, Sasaguri T, Shibahara K, Shimada T, Fukuda T et al. (2006). YB-1 is important for an early stage embryonic development: Neural tube formation and cell proliferation. J Biol Chem 281: 40440-40449. Uramoto H, Izumi H, Ise T, Tada M, Uchiumi T, Kuwano M et al. (2002). p73 interacts with c-myc to regulate Y-box-binding protein-1 expression. J Biol Chem 277: 31694-31702. Vargo-Gogola T, Rosen JM. (2007). Modelling breast cancer: One size does not fit all. Nat Rev Cancer 7: 659-672. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG et al. (2001). The sequence of the human genome. Science 291: 1304-1351. Visvader JE, Lindeman GJ. (2008). Cancer stem cells in solid tumours: Accumulating evidence and unresolved questions. Nat Rev Cancer 8: 755-768. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L et al. (2002). Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20: 719-726. Weinberg RA. (2007). The Biology of Cancer. Garland Science, Taylor & Francis Group, LLC: United States of America.  Wen Z, Zhong Z, Darnell JE,Jr. (1995). Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82: 241-250. Wright JC. (1984). Cancer chemotherapy: Past, present, and future--part I. J Natl Med Assoc 76: 773-784. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879. 44  Yahata H, Kobayashi H, Kamura T, Amada S, Hirakawa T, Kohno K et al. (2002). Increased nuclear localization of transcription factor YB-1 in acquired cisplatin-resistant ovarian cancer. J Cancer Res Clin Oncol 128: 621-626. Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL. (2002). Herceptin-induced inhibition of phosphatidylinositol-3 kinase and akt is required for antibody-mediated effects on p27, cyclin D1, and antitumor action. Cancer Res 62: 4132-4141. Yamasaki F, Zhang D, Bartholomeusz C, Sudo T, Hortobagyi GN, Kurisu K et al. (2007). Sensitivity of breast cancer cells to erlotinib depends on cyclin-dependent kinase 2 activity. Mol Cancer Ther 6: 2168-2177. Yarden Y, Sliwkowski MX. (2001). Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2: 127-137. Yokogami K, Wakisaka S, Avruch J, Reeves SA. (2000). Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol 10: 47-50. Yu H, Jove R. (2004). The STATs of cancer--new molecular targets come of age. Nat Rev Cancer 4: 97-105. Yu K, Toral-Barza L, Discafani C, Zhang WG, Skotnicki J, Frost P et al. (2001). mTOR, a novel target in breast cancer: The effect of CCI-779, an mTOR inhibitor, in preclinical models of breast cancer. Endocr Relat Cancer 8: 249-258. Yu WH, Woessner JF,Jr, McNeish JD, Stamenkovic I. (2002). CD44 anchors the assembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes Dev 16: 307-323. Zhang S, Balch C, Chan MW, Lai HC, Matei D, Schilder JM et al. (2008). Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res 68: 4311-4320. Zhou J, Wulfkuhle J, Zhang H, Gu P, Yang Y, Deng J et al. (2007). Activation of the PTEN/mTOR/STAT3 pathway in breast cancer stem-like cells is required for viability and maintenance. Proc Natl Acad Sci U S A 104: 16158-16163.       45  CHAPTER TWO: TARGETING YB-1 IN HER2 OVER-EXPRESSING BREAST CANCER CELLS INDUCES APOPTOSIS VIA THE mTOR/STAT3 PATHWAY AND SUPPRESSES TUMOUR GROWTH IN MICE*  This chapter introduces the necessity of YB-1 for the growth and survival of breast cancer cells.  We demonstrate that siRNA targeting YB-1 significantly suppressed growth in a panel of breast cancer cells representative of the aggressive triple negative and HER2 positive subtypes.  Importantly, in the HER2 subtype, it was demonstrated that inhibition of YB-1induced apoptosis evidenced by the phosphorylation of H2AX, Annexin V staining, and a triple immunofluorescence apoptosis assay.  Further, we were able to implicate STAT3 as a facilitator in the YB-1 mediated survival advantage in HER2 over-expressing breast cancer cells.  In addition, we show that inhibiting YB-1 prevents colony formation in anchorage independent growth assays as well as suppressing tumour formation in vivo.  Taken together, this study implicates YB-1 as a critical factor involved in the tumourigenic capacity of HER2 positive breast cancer cells.  *A version of this chapter has been published.  Lee C, Dhillon J, Wang MY, et al. Targeting YB-1 in HER2 over-expressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumour growth in mice. Cancer Res. 2008;68:8661-8666.       46  2.1 INTRODUCTION The over-expression of the human epidermal growth factor receptor-2 (HER2) is clearly associated with one of the most aggressive types of breast cancer (Sorlie et al., 2001).  Equally challenging are those in the triple negative or basal-like subtype (Sorlie et al., 2001).  HER2 has become a desirable molecular target for breast cancer that has led to the development of therapies designed to inhibit it such as Herceptin, pertuzumab and more recently lapatinib.  Thus far, the success of these agents is initially very good despite that ~30% of patients do not respond and those that do are often faced with the development of resistance.  We have identified a second factor expressed in aggressive types of breast cancer, the Y-box binding protein-1 (YB-1) that induces growth promoting genes such as HER2, EGFR, proliferating nuclear antigen (PCNA), cyclin A (CCNA) and cyclin B (CCNB); review (Wu et al., 2007).  Further to this, the presence of YB-1 specifically in the nuclear compartment of breast cancer cells is associated with HER2 based on the examination of primary tumours by immunohistochemistry (Fujii et al., 2008). YB-1 is activated by kinases such as AKT (Sutherland et al., 2005) also known to be linked to breast cancer (Wu et al., 2007).  When YB-1 is highly expressed in the mammary gland, transgenic mice develop tumours with 100% penetrance indicating that it is a bona fide oncogene (Bergmann et al., 2005).  Because YB-1 is commonly expressed in breast cancers (Wu et al., 2006), we questioned whether they were indeed dependent upon it for growth and survival.  We therefore inhibited YB-1 using small interfering RNAs as a novel way of potentially blocking the growth of breast cancers.  Inhibiting YB-1 suppressed the growth of 6 out of 7 breast cancer cell lines that were either triple negative or had HER2 amplifications.  Following this, we focused on those that had HER2 amplifications given the many clinical challenges that currently prevent the successful treatment of this aggressive type of breast cancer. 47  2.2 MATERIALS AND METHODS Inhibition of YB-1 with small interfering RNAs BT474-m1 cells were obtained from MC Hung, MD Anderson Cancer Center.  SUM149 cells were obtained from Astrand (Ann Arbor, Michigan).  184htrt cells were a gift from Dr. J. Carl Barett (National Insitute of Health, USA).  All other cell lines were purchased from the American Type Culture Collection (Rockwood, MD).  The sequence for siYB-1#1 was as previously reported (Wu et al., 2006), siYB-1#2 was designed using the following sequence (CCACGCAAUUACCAGCAAAdTdT) and the control siRNA oligonucleotide was (UUCUCCGAACGUGUCACGUdTdT).  Each of the cell lines were plated at a density of 1000 cells per 96 well, transfected with siYB-1#2 (5nM), we confirmed that knock-down was >75% by detecting YB-1 protein levels by immunofluorescence after 48 hours.  Following this tumour cell growth was assessed after 72 hours by Hoechst staining as previously described using the ArrayScan VTI (Cellomics, Pittsburg PA) (To et al., 2007).  For the siRNA transfections, where changes in signal transduction were monitored, the cells (3x105 per 6-well dish to 3.5x105 per 6- well dish) were transfected with 5nM of control or siRNA oligonucleotides (Dharmacon, IL) according to the manufacturer’s protocol.   Apoptosis assays BT474-m1 cells were treated with control siRNA, siYB-1#1 or siYB-1#2 oligonucleotides for 1-4 days and analyzed for P-H2AXS139 (1:500 dilution; AbCam) by immunoblotting.  For Annexin V staining, the manufacturer’s protocol was followed (Promega) and the cells were analyzed on a FACSCalibur (BD).  Analysis of chromatin condensation, propidium iodide uptake and P-H2AXS139 was performed as previously described (To et al., 2007).  For propidium iodide 48  staining, the cells were collected after being treated for 4 days with siRNA to YB-1, washed, stained with 30µg/mL of PI (Sigma, St. Louis, MO), and suspended in 500µL of 1% FBS containing PBS before being analyzed on a FACSCalibur (BD).    Pathway evaluation of apoptosis induction BT474-m1 or Au565 cells were treated with siYB-1 for up to 96 hours and then they were lysed in ELB buffer (To et al., 2007)  and the proteins were evaluated by immunoblotting using antibodies to the following diluted to 1:1000 unless otherwise indicated: YB-1 (1:10,000; gift from Dr. Colleen Nelson, University of British Columbia), P-ERK1/2T202/Y204 (Cell Signalling Technology (CST), Danvers, MA), P-STAT3S727 (CST), P-STAT3Y705 (CST), STAT3 (CST), MCL-1 ( Santa Cruz Biotechnology, Santa Cruz, CA), survivin (CST), P-H2AXS139 (1:500; AbCam), EGFR ( StressGen, San Diego, CA), HER2 (AbCam), P-AKTS473 (CST), and P- GSKβS9 (CST).  Vinculin (1:2000; clone Vin 11-5, V4505 antibody, Sigma) and pan-actin (CST) antibodies were used as loading controls.    The activity of STAT3 was evaluated via gel shift by isolating nuclear proteins from BT474-m1 cells and a MCL-1 probe (Liu et al., 2003), was used to detect activity according to our previously reported methods (Stratford et al., 2007).  We used 1µg of STAT3 antibody (Santa Cruz, Cat# SC-482x) in the competition experiment.  STAT3 was silenced using QIAGEN HP validated siRNA in addition to a second siRNA oligonucleotide (Konnikova et al., 2003).  BT474-m1 and Au565 cells (3x105 per 6-well dish or 3.5x105 per 6-well dish) were treated with transfection reagent alone, control siRNA (50nM) or siSTAT3#1 oligonucleotide (50nM, Dharmacon Research Inc) or siSTAT3#2 (50nM, QIAGEN) for 96 hours.  For the rescue 49  experiments, 2g of Flag:STAT3C (Bromberg et al., 1999)  was co-transfected into BT474-m1 cells (5.5x105 per 6- well dish) with 5nM of siYB-1#2 or control siRNA using Lipofectamine 2000 with a DNA:lipofectamine ratio of 1:3, harvested 72 hours later and immunoblotted for P-H2AXS139, Flag (1:2000 M2 antibody, Sigma) and YB-1 (as described above).  mTOR mRNA was evaluated using Assay on Demand (Applied Biosystems).  Soft agar assays YB-1 was silenced as described above in the BT474-m1 and MDA-MB-453 cells and 24 hours later the cells were plated into the soft agar.  Colony formation was performed as previously described (Sutherland et al., 2005).  Briefly, BT474-m1 (1x104 per 6-well dish) or MDA-MB-453 (1.5x105 per 6-well dish) cells were added to a 1:1 mixture of 2x DMEM and a solution of 0.6% agarose (Invitrogen) was prepared and the colonies were counted 28 days later.   Inhibition of YB-1 in vivo BT474-m1 cells were transfected with 5nM of control siRNA or  YB-1 siRNA oligonucleotides for 24 hours, harvested, and washed twice with Hanks Balanced Salt Solution (Invitrogen).  They were then mixed (1x106 cells) with Matrigel (BD) at a 1:1 ratio yielding a total volume of 200µL which was injected subcutaneously into the right lower hind flank of six female nu/nu mice per treatment group.  Tumour growth was measured using calipers and body weight was measured twice a week.  Differences in tumour incidence were evaluated using the student’s t test.  Tumours from the termination of the study (week 3) were evaluated for YB-1 protein levels.  50  2.3 RESULTS AND DISCUSSION Initially we silenced YB-1 with siRNA in a panel of breast cancer cell lines and cell growth was evaluated 96 hours later using a high content screening (HCS) platform (Figure 2.1 A, representative images of YB-1 knockdown).  Seven breast cancer cell lines were screened which had HER2 amplifications or were triple negative.  Silencing YB-1 with siYB-1#2 inhibited the growth of the HER2 over-expressing BT474-m1 and Au565 cells by ~50% (Figure 2.1 B), yet the 184htrt immortalized breast epithelial cells and MDA-MB-453 cells were insensitive to the effect of YB-1.  Beyond this, YB-1 knockdown also suppressed the growth of triple negative breast cancer cell lines by 40-80% (Figure 2.1 B).  To understand the underlying reason for growth suppression in the HER2 over-expressing models of breast cancer, we show that inhibiting YB-1 in the BT474-m1 (Figure 2.1 B, right panel) and Au565 cells (data not shown) decreased HER2, EGFR, and ERK1/2 signalling while there was no effect on the P-AKTS473 or P-GSKβS9 pathway.  For unknown reasons siYB-1 failed to inhibit the ERK pathway in MDA-MB-453 cells which may explain why their growth was not suppressed (data not shown).  Over a 1-4 day time course with siYB-1 the BT474-m1 cells underwent apoptosis that was detectable after 2 days based on the induction of P-H2AXS139 and increased annexin V staining (Figure 2.1 C-D).  In support of this, cells treated for 3 days with siYB-1#2 had enhanced chromatin condensation, propidium iodide uptake and P-H2AXS139 at the cellular level as detected in HCS in both BT474-m1 and Au565 cells compared to the scrambled control (Supplemental Figure 2.1 A-B).  Treating BT474-m1 cells for 4 days with siYB-1#1 or siYB-1#2 increased propidium iodide uptake as much as 30-fold based on flow cytometry (Supplemental Figure 2.1 C).  Because YB-1 inhibition altered the apoptotic threshold of the BT474-m1 cells as indicated above, we examined the possibility that this would enhance their sensitivity to taxol.  To this effect, we showed that silencing YB-1 improved the growth inhibitory effect of taxol (0.1-10 51  nM) on the BT474-m1 cells compared to cells treated with the control oligonucleotide (Supplemental Figure 2.1 D).  Our studies therefore indicate that breast cancers that express high levels of HER2 as well as those that are triple negative are dependent upon YB-1 for growth and survival.  Furthermore, combining YB-1 inhibition with taxol improves cell killing.  To investigate the underlying mechanism of siYB-1 induced apoptosis, we queried the STAT3 pro-survival pathway (Gritsko et al., 2006).  This was a candidate pathway because it was previously reported that STAT3 is phosphorylated at serine 727 in breast cancer cells (Yeh et al., 2006) as an event downstream of HER2 (Fernandes et al., 1999) and its dimerisation partner EGFR (Garcia et al., 1997) which are both transcriptionally regulated by YB-1 (Wu et al., 2006).  As yet, a link between YB-1 and STAT3 has not been previously documented.  Inhibiting YB-1 in BT474-m1 or Au565 cells for 3 days decreased P-STAT3S727 and its downstream gene MCL-1, however P-STAT3Y705 was undetectable and total STAT3 levels were unaffected (Figure 2.2 A).  The STAT3 downstream gene survivin did not change.  This correlated with decreased signalling through P-ERK1/2T202/Y204 and P-mTORS2448.  Surprisingly, total mTOR was also decreased (Figure 2.2 A).  In addition, following YB-1 knock-down the decrease in mTOR protein levels as noted in other cell lines, namely SUM149 (triple negative breast cancer) and SF188 (pediatric glioblastoma) cells (Supplemental Figure 2.2 A-B).  However, mTOR transcript level did not decrease following YB-1 inhibition (Supplemental Figure 2.2 C-D) ruling it out as a direct transcriptional target.  Additional studies are underway to investigate whether YB-1 regulates the rate of mTOR translation or sustains its protein stability.  Independent of how mTOR is altered by YB-1, it could have an important impact on the STAT3 pathway because it is known to phosphorylate STAT3 S727 (Yokogami et al., 2000).   52  Following cytokine stimulation, STAT3 is phosphorylated at tyrosine 705 leading to co-operation with serine 727 for maximal transcriptional activation (Wen et al., 1995).  However, NOTCH signalling leads to P-STAT3S727 in the absence of P-STAT3Y705 (Androutsellis-Theotokis et al., 2006).  Similarly, P-STAT3S727 is essential for the survival of macrophages in the absence of P-STAT3Y705 (Liu et al., 2003).  Given our data, we suspected that STAT3 was able to protect the BT474-m1 and Au565 cells from apoptosis upon phosphorylation at serine 727 while it appears that phosphorylation of tyrosine 705 was not required.  In support of this, we confirmed the absence of tyrosine 705 phosphorylation by comparing the BT474-m1 cells to the MDA-MB-231 cells which are known to express high levels of STAT3Y705 (Berishaj et al., 2007) (data not shown).  We determined STAT3 was indeed active by isolating nuclear proteins from BT474-m1 cells and then probing an MCL-1 promoter sequence using gel shift assays.  Nuclear isolates bound to the MCL-1 promoter, which was inhibited with unlabelled oligonucleotide or by pre-incubating the nuclear extracts with an antibody to STAT3 (Figure 2.2 B, lanes 1-4).  Similar to the effect of siYB-1, inhibition of STAT3 expression using siRNA decreased expression of MCL-1 protein and thereby increased P-H2AXS139 (Figure 2.2 C, left and right columns, respectively).  Finally, transfection of a constitutively activated form of STAT3 (STAT3C) (Bromberg et al., 1999) partially rescued the cells from siYB-1#2 induced apoptosis based on reduced P-H2AXS139 (Figure 2.2 D).  Taken together we concluded that YB-1 engages the STAT3 pro-survival pathway to protect breast cancer cells from apoptosis.    Given this, we addressed whether inhibiting YB-1 could suppress the tumourigenic potential of HER2 over-expressing breast cancer cells by examining growth in soft agar and then in mice.  To do so, we demonstrated that inhibition of YB-1 with siYB-1#1 and siYB-1#2 silenced the expression of the target protein for up to 14 days (Figure 2.3 A).  In soft agar, YB-1 inhibition 53  prevented colony growth by 85-92% compared to the control (Figure 2.3 B-C, left column).  Au565 cells responded similarly (data not shown).  Colony formation was inhibited in the MDA-MB-453 cells but to a lesser degree (~50%) (Figure 2.3 C, right column).  Finally, we characterized the tumour growth of BT474-m1 cells in mice, and determined that >80% of the mice develop tumours within one week making this a convenient model for studying the effect of relatively short-lived siRNAs in vivo.  We therefore transfected the cells with siYB-1#1 or siYB-1#2 for 24 hours and then injected 1 million cells into the hind flank of nude mice.  Inhibition of YB-1 suppressed tumour formation throughout the first 2 weeks (n=6, Figure 2.4 A).  By the third week, smaller but detectable tumours were apparent in 4 of 6 and 5 of 6 mice injected with siYB-1#1 and in siYB-1#2-treated cells, respectively (Figure 2.4 A-B, inset, representative images of tumours).  As we suspected, the small tumours that developed by the third week from the cells pre-treated with siYB-1, re-expressed YB-1, indicating that the siRNA was no longer active (Figure 2.4 C).  Taken together, our data demonstrates that inhibiting YB-1 disrupts the tumour initiating potential of HER2 over-expressing breast cancer cells likely via sensitizing the cells to apoptosis by interfering with the STAT3 pathway.  It is noteworthy that in a recent study the PTEN/mTOR /STAT3 pathway reportedly promotes the growth of tumour initiating cells in breast cancer cells (Zhou et al., 2007).  In that study, STAT3 was specifically phosphorylated at serine 727 based on reverse phase array profiling.  Importantly, inhibition of STAT3 with siRNA or a small molecule referred to as IS3 295 selectively blocked the growth of these cells and perturbed the establishment of tumours in mice (Zhou et al., 2007).  Because we find that inhibiting YB-1 interferes with this pathway it seems reasonable that it could also suppress the growth of tumour initiating cells by altering this network.   54  To conclude, these studies provide pre-clinical rationale for targeting YB-1 in HER2 over-expressing or triple negative breast cancers setting forward the idea that it may be a good molecular target across different tumour subtypes.                     55  2.4 FIGURES  Figure 2.1.  Inhibition of YB-1 generally suppresses the growth of breast cancer cell lines and leads to the induction of apoptosis.  In a high content screen, YB-1 was silenced for three days with siYB-1#2.  A. The loss of YB-1 expression following treatment with siYB-1#2 was monitored by immunofluorescence.  Representative images for SUM149 and MDA-MB-231 cell are shown (Magnification 10x, ArrayScan VTI).  B. Inhibiting YB-1 suppressed the growth of 6 out of 7 breast cancer cell lines representing cancers that had HER2 amplifications or were triple negative.  The loss of YB-1 had no effect on the immortalized breast epithelial cell line 184htrt or MDA-MB-453 cells.  Silencing YB-1 in the BT474-m1 cells for 72 hours also resulted in decreased signalling through the HER2/EGFR/ERK pathway based on immunoblotting.  C. BT474-m1 cells were transfected with control siRNA or siRNA oligos targeting YB-1 and harvested 1, 2, 3 and 4 day after transfection. Proteins were isolated from the cells and the lysates were subjected to Western blotting to examine the level of P-H2AXS139.  Pan-actin was used as loading control.  D. Small interfering RNAs against YB-1 induced annexin V staining after treatment for 4 days.  Changes in annexin V were monitored by flow cytometry.  AB- 20020406080100% growth  InhibitionYB - 1E G F RH E R - 2P - E R K 1 / 2T 2 0 2 / Y 2 0 4      A c t i nH i p e r f e c t                +                                                                                      C o n t r o l  o l i g o                      +                                                                          s i Y B - 1 # 1                                         +                                                                              s i Y B - 1 # 2                                                    +P - AKTS 4 7 3P - G S K bS9N T                   H E R 2                                    T r i p l e  n e g a t i v ea m p l i f i e d  S U M  1 4 9C o n t r o l  s i Y B - 1#2M D A - MB - 231D A P I                       Y B - 1                      M e r g e D A P I                       Y B - 1                        M e r g eDCD a y  1 D a y  4P - H 2 A XS 1 3 9YB - 1D a y  3A c t i nD a y  2****01234567D a y 1 D a y 2 D a y 3 D a y 4D a y s a f te r  tr a n s f e c ti o nFold Annexin V stainingH iP e r f e c tC o n t r o l o li g os iY B - 1 # 1  o lig os iY B - 1 # 2  o lig o***56   Figure 2.2.  Loss of YB-1 decreased signalling through the STAT3 pathway.  A. Loss of YB-1 expression with siYB-1#2 (72 hours) was associated with a decrease in P-STAT3S727 and MCL-1 relative to the transfection reagent control (lane 1) or control siRNA (lane 2) in the BT474-m1 cells (left panel).  There was no change in total levels of STAT3 or survivin.  STAT3Y705 was undetectable.  Actin or vinculin was used as a control for equal sample loading.  The extracts were also evaluated for P-mTORS2448, mTOR, and ERK1/2.  This was also consistently observed in the Au565 cells (right panel).  B. Nuclear extracts were isolated from BT474-m1 cells to confirm that STAT3 was active in these cells lacking tyrosine 705 phosphorylation.  In the absence of nuclear protein, no binding was observed (lane 1).  The addition of nuclear proteins resulted in binding to a MCL-1 promoter sequence containing the STAT3 binding site (lane 2), which could be inhibited with cold competitive oligonucleotide (lane 3) or an antibody specific to STAT3 (1µg) (lane 4).  C. BT474-m1 and Au565 cells were treated with tranfection reagent, control siRNA (50 nM) or STAT3 siRNA (50 nM) for 96 hours.  As a consequence, STAT3 was silenced, MCL-1 decreased and P-H2AXS139 was induced in BT474-m1 (left panel) and Au565 cells (right panel).  D. To examine the possibility that STAT3 could rescue the induction of apoptosis by YB-1 we introduced Flag:STAT3C and siYB-1#2 by co-transfection.  The cells were then examined 3 days later for changes in P-H2AXS139.  The ectopic expression of STAT3C rescued YB-1 induced apoptosis given that P-H2AXS139 was reduced. +       +      +      + + +      +      ++Bi o t i n - ST AT 3  p ro b eU n l a b e l l e d  ST AT 3  p ro b eAn t i - ST AT 3  a n t i b o d yN u cl e a r Pro t e i n1       2 3   4F re e  p ro b eSh i f tABCDST AT 3MC L - 1P - H 2 AXS 1 3 9HiperfectsiSTAT3 #1Act i nB T 4 7 4 m 1ST AT 3MC L - 1P - H 2 AXS 1 3 9Vi n cu l i nRNA iMAXsiSTAT3 #2A u5 6 5Ctrl siRNACtrl siRNAF l a g : ST AT 3 CYB - 1P - H 2 AXVi n cu l i n+              +              + Em p t y Ve ct o rST AT 3 C  ve ct o rL i p o f e ct a m in eC o n t ro l  oligosi Y B - 1  # 2+            +             ++                                           ++                                         ++       +           P - S T A T 3Y 7 0 5HiPerfectCtrl siRNAsiYB-1#2                  B T 4 7 4 m 1YB - 1P - m T O RS 2 4 4 8m T O RP - S T A T 3S 7 2 7S T A T 3P - E R K 1 / 2T 2 0 2 / Y 2 0 4M C L - 1V i n c u l i nS u r v i v i nE R K 1 / 2iMAXCtrl siRNAsiYB-1#2                  A u 5 6 5P - S T A T 3Y 7 0 5YB - 1P - m T O RS 2 4 4 8m T O RP - S T A T 3S 7 2 7S T A T 3P - E R K 1 / 2T 2 0 2 / Y 2 0 4M C L - 1V i n c u l i nS u r v i v i nE R K 1 / 257   Figure 2.3.  Inhibition of YB-1 suppresses tumour growth in soft agar.  A. Time-course study (1-14 days) was conducted to examine the long-term stability of the YB-1 siRNA oligonucleotides.  Vinculin antibody was used as loading control.  YB-1 inhibition was sustained out to 10 days with some detectable inhibition still at 14 days.  B. The impact of knocking down YB-1 was evaluated in soft agar.  BT474-m1 cells were treated with siYB-1 for 24 hours and colony growth was assessed after 28 days. Photomicrographs of representative colonies were taken.  YB-1 inhibition decreased the size of colonies compared to the control siRNA.  C. BT474-m1 and MDA-MB-453 cells were treated with YB-1 siRNA for 48 hours and anchorage-independent growth of the cells was assessed by soft agar assays. Quantification of the number of colonies is shown in the bar charts. On average the BT474-m1 cells produced larger colonies ie greater than 300-800 microns and 10-12 could be counted per field.  The MDA-MB-453 cells developed smaller colonies of approximately 50 microns in size but were more numerous.  On average there were 40-50 colonies per field.  * treatment was significantly different from the controls based on student’s t tests.  58   Figure 2.4.  Inhibition of YB-1 suppressed the development of tumours in mice. A. BT474-m1 cells were transfected with control siRNA, siYB-1#1 or siYB-1#2 for 24 hours and then the cells were injected subcutaneously into nu/nu mice.  The incidence of tumour formation was on average 83% in the mice treated with either the wild-type cells or the control siRNA oligonucleotide in the first week.  Conversely, tumour incidence was only 33% or 17% when mice were injected with cells transfected with siYB-1#1 or siYB-1#2, respectively (P<0.01).  Similarly, the loss of YB-1 expression suppressed tumour formation in the second week as well (P<0.01).  B. By the third week, tumours developed in the mice however they were remarkably smaller in size compared to the control siRNA treated mice, the tumours that arose in siYB-1#1 or siYB-1#2 were ~50-67% smaller (P<0.01) respectively. Significance was determined using a student’s t test. *<0.01.  C. The re-expression of YB-1 was confirmed in the small tumours that eventually arose in the cells transfected with siYB-1#2. ** indicates P<0.01 compared to the control siRNA oligonucleotide control.      59  2.5 SUPPLEMENTAL FIGURES  Supplemental Figure 2.1.  Inhibition of YB-1 induces apoptosis and enhances growth suppression in combination with Taxol.  A.  BT474-m1 and Au565 cells were transfected with 5nM of Ctrl siRNA or siYB-1 oligonucleotides in a 96 well plate and incubated for 3 days.  Following cells were permeabilized and stained with Hoechst dye, propidium iodide, or P-H2AXS139.  The plates were then analyzed and images were acquired on the ArrayScanVTI Reader.  Representative images demonstrate apoptosis in cells treated with siYB-1.  B.  Relative staining intensities of Hoechst, propidium iodide, and P-H2AXS139 were compared between the control and treatment groups in the BT474-m1 cells.  C.  PI staining was quantified in the Au565 cells comparing the control and treatment groups.  D.  BT474-m1 cells were treated with siYB-1#2 in combination with taxol for 72 hours.  Cell growth was analyzed on the ArrayCan VTI.  The combined treatment had an enhanced effect on growth inhibition.      60    Supplemental Figure 2.2.  YB-1 inhibition decreases mTOR protein levels but not transcript levels.  A.  SUM149 (triple negative breast cancer cells) and SF188 (pediatric glioblastoma cells) were treated with 20nM of either Ctrl siRNA, siYB-1#1, or siYB-1#2 for 96 hours.  Following, YB-1, mTOR, and Vinculin levels were assessed by immunoblotting.  B.  Quantitative real-time PCR of BT474-m1 and Au565 cells harvested following 36 or 48 hours of 5nM of Ctrl siRNA, siYB-1#1, or siYB-1#2 transfection.  Data demonstrates mTOR transcript levels do no correlate with decrease in YB-1 mRNA levels.  D.  SUM149 cells were transfected with 20nM of Ctrl siRNA, siYB-1#1, or siYB-1#2 for 48 or 72 hours and analyzed by quantitative real-time PCR.  mTOR transcript levels did not decrease with inhibition of YB-1.           61  REFERENCES Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW et al. (2006). Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 442: 823-826. Bergmann S, Royer-Pokora B, Fietze E, Jurchott K, Hildebrandt B, Trost D et al. (2005). YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res 65: 4078-4087. Berishaj M, Gao SP, Ahmed S, Leslie K, Al-Ahmadie H, Gerald WL et al. (2007). Stat3 is tyrosine-phosphorylated through the interleukin-6/glycoprotein 130/Janus kinase pathway in breast cancer. Breast Cancer Res 9: R32. Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C et al. (1999). Stat3 as an oncogene. Cell 98: 295-303. Fernandes A, Hamburger AW, Gerwin BI. (1999). ErbB-2 kinase is required for constitutive stat 3 activation in malignant human lung epithelial cells. Int J Cancer 83: 564-570. Fujii T, Kawahara A, Basaki Y, Hattori S, Nakashima K, Nakano K et al. (2008). Expression of HER2 and estrogen receptor alpha depends upon nuclear localization of Y-box binding protein-1 in human breast cancers. Cancer Res 68: 1504-1512. Garcia R, Yu CL, Hudnall A, Catlett R, Nelson KL, Smithgall T et al. (1997). Constitutive activation of Stat3 in fibroblasts transformed by diverse oncoproteins and in breast carcinoma cells. Cell Growth Differ 8: 1267-1276. Gritsko T, Williams A, Turkson J, Kaneko S, Bowman T, Huang M et al. (2006). Persistent activation of stat3 signalling induces survivin gene expression and confers resistance to apoptosis in human breast cancer cells. Clin Cancer Res 12: 11-19. Wu J, Stratford AL, Astanehe A, Dunn SE. (2007). YB-1 is a transcription/translation factor that orchestrates the oncogenome by hardwiring signal tranduction to gene experssion.  Translat Oncoge 2: 1-17. Konnikova L, Kotecki M, Kruger MM, Cochran BH. (2003). Knockdown of STAT3 expression by RNAi induces apoptosis in astrocytoma cells. BMC Cancer 3: 23. Liu H, Ma Y, Cole SM, Zander C, Chen KH, Karras J et al. (2003). Serine phosphorylation of STAT3 is essential for mcl-1 expression and macrophage survival. Blood 102: 344-352. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al. (2001). Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 98: 10869-10874. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and 62  can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. Sutherland BW, Kucab J, Wu J, Lee C, Cheang MC, Yorida E et al. (2005). Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24: 4281-4292. To K, Zhao Y, Jiang H, Hu K, Wang M, Wu J et al. (2007). The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phen yl]-acetamide (OSU-03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol 72: 641-652. Wen Z, Zhong Z, Darnell JE,Jr. (1995). Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82: 241-250. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879. Yeh YT, Ou-Yang F, Chen IF, Yang SF, Wang YY, Chuang HY et al. (2006). STAT3 ser727 phosphorylation and its association with negative estrogen receptor status in breast infiltrating ductal carcinoma. Int J Cancer 118: 2943-2947. Yokogami K, Wakisaka S, Avruch J, Reeves SA. (2000). Serine phosphorylation and maximal activation of STAT3 during CNTF signalling is mediated by the rapamycin target mTOR. Curr Biol 10: 47-50. Zhou J, Wulfkuhle J, Zhang H, Gu P, Yang Y, Deng J et al. (2007). Activation of the PTEN/mTOR/STAT3 pathway in breast cancer stem-like cells is required for viability and maintenance. Proc Natl Acad Sci U S A 104: 16158-16163.           63  CHAPTER THREE:  THE EXPRESSION OF ACTIVATED Y-BOX BINDING PROTEIN-1 SERINE 102 MEDIATES TRASTUZUMAB RESISTANCE IN BREAST CANCER CELLS BY INCREASING CD44 EXPRESSION**  This chapter describes the importance of P-YB-1S102 in a model of acquired trastuzumab resistance.  We demonstrate that the trastuzumab resistant cell lines, HR5 and HR6, have increased levels of P-YB-1S102 and its activating kinase P-RSK in comparison to the sensitive BT474 cells.  The importance of activated YB-1 in mediating trastuzumab resistance is demonstrated by the expression of a constitutively active mutant of YB-1, Flag-YB-1S102D in the trastuzumab sensitive BT474 cell line which rendered them insensitive to treatment.  In addition, we provide evidence that trastuzumab resistance is brought about by P-YB-1S102 mediated induction of CD44 expression, given the HR5 and HR6 cells have increased levels of CD44 in comparison to the BT474 cells which correlates with the levels of P-YB-1S102.  Overall, this study reveals a novel role of YB-1 in mediating trastuzumab resistance by inducing a tumour initiating phenotype which is unresponsive to therapy.  **A version of this chapter has been submitted for publication.  Dhillon J, Astanehe A, Lee C, Fotovati A, Hu K, Dunn SE.  The expression of activated Y-box binding protein-1 serine 102 mediates trastuzumab resistance in breast cancer cells by increasing CD44+ cells.         64  3.1 INTRODUCTION Molecular targeted therapies have revolutionized the field of cancer therapeutics (Sawyers, 2004).  Although they have proved to be successful in the treatment of cancer patients, there remain many pitfalls associated with their use.  The human epidermal growth factor receptor-2 (HER2), an established proto-oncogene over-expressed in 20 to 30% of breast cancer patients, defines aggressive disease and is associated with poor prognosis, a shorter disease free period and poor survival (Slamon et al., 1987).  The development of trastuzumab (Herceptin), a humanized monoclonal antibody targeting HER2, has provided clinical benefit when administered in combination with conventional chemotherapies (Cobleigh et al., 1999; Slamon et al., 2001).  Unfortunately, the therapeutic efficacy of trastuzumab has been low in many instances, as many patients do not respond to initial treatment or develop resistance to therapy within one year (Slamon et al., 2001; Vogel et al., 2002).  A number of mechanisms have been implicated in the acquisition of resistance; however they have not provided definitive answers to overcoming the problem.   In this study, we queried the role of YB-1, a transcription/translation factor that is over-expressed in 40% of human breast cancers, in trastuzumab resistance because of its established association with poor survival, disease recurrence, and relapse, specifically in the HER2 subtype (Habibi et al., 2008).  Its function in breast cancer growth and survival is eminent by its regulation of EGFR, HER2, MET, PIK3CA expression in addition to its mediation of drug resistance by induction of MDR1 (Astanehe et al., 2009; Bargou et al., 1997; Finkbeiner et al., 2009; Stratford et al., 2007; Wu et al., 2006).  We have previously identified  a role for YB-1 in the growth and survival of HER2 positive breast cancers and demonstrated that it was necessary 65  for in vivo tumourigenesis (Lee et al., 2008).  More recently, our laboratory has confirmed a novel role for YB-1 in the maintenance of a TIC phenotype (To et al., 2010).    Given the recent evidence implicating HER2 as a regulator of TICs and that these cell types are resistant to common chemotherapies (Korkaya et al., 2008; Li et al., 2008), we questioned whether YB-1 plays a role in the development of acquired trastuzumab resistance by inducing a TIC phenotype.  Since the mode of resistance remains poorly understood, this study provides a novel mechanism by which cancer cells acquire the ability to escape the effects of trastuzumab and thus a rationale to target YB-1 in the treatment of trastuzumab resistance.            66  3.2 MATERIALS AND METHODS Cell Culture and Reagents Human breast cancer cells, trastuzumab sensitive BT474, and the resistant counterparts HR5 and HR6 were a generous gift from Dr. Carlos L. Arteaga (Vanderbilt-Ingram Comprehensive Cancer Center, Vanderbilt University School of Medicine, Nashville, Tennessee).  Cell line models mimicking acquired trastuzumab resistance (HR) were created from BT474 xenografts established in athymic nude mice which were given a course of trastuzumab therapy.  HR5 and HR6 cell lines were established from tumours which recurred during treatment (Ritter et al., 2007).  BT474-m1 cells were obtained from MC Hung, M.D. Anderson Cancer Center and AU565 cells were purchased from the American Type Culture Collection.  BT474, BT474-m1, HR5 and HR6 cells were maintained in F12/DMEM supplemented with 10% fetal bovine serum (Invitrogen, Burlington, ON, Canada) and AU565 cells were maintained in 10% RPMI at 37ºC, 5% CO2.  Trastuzumab was purchased from the BC Cancer Agency Pharmacy (Vancouver, BC, Canada).  Protein extraction and Immunoblot analysis Protein was isolated from log-growing cells which were lysed in Egg Lysis Buffer (ELB) as previously described (Wu et al., 2006), supplemented with protease and phosphatase inhibitors, and quantified using the Bradford assay (Biorad, Hercules, CA, USA).  Immunoblotting techniques were completed as described previously (Wu et al., 2006).  The primary antibodies used for protein detection were as follows: YB-1, 1:2000 (Abcam, Cambridge, MA, USA), P-YB-1S102, 1:1000 (Cell Signalling Technology, Danvers, MA, USA), EGFR, 1:1000 (Stressgen, San Diego, CA, USA), HER2, 1:200 (Abcam), ERK, 1:1000 (Cell Signalling Technology, 67  Danvers, MA, USA), P-ERKThr202/Tyr204, 1:1000 (Cell Signalling Technology), AKT, 1:1000 (Cell Signalling Technology), P-AKTS473, 1:1000 (Cell Signalling Technology), pan-RSK, 1:1000 (Cell Signalling Technology), P-RSKS380, 1:500 (Cell Signalling Technology), P-RSKS221/S227, 1:1000 (Invitrogen), P-γH2AXS139, 1:1000 (Abcam), Pan-actin, 1:1000 (Cell Signalling Technology), Vinculin, 1:1000 (Upstate, Temecula, CA, USA), PARP, 1:1000 (Cell Signalling Technology).  Trastuzumab treatment BT474, HR5, and HR6 cells were seeded at a density of 3 x 105 cells in a six-well plate.  Cells were treated with 20μg/mL of trastuzumab 24 hours after seeding; cells were harvested for immunoblotting 72 hours post treatment.  BT474 Flag-EV, Flag-YB-1WT, Flag-YB-1S102D, and Flag-YB-1S102A were plated at a density of 3.5 x 104 cells/well into a 12-well plate and treated with 20μg/mL of trastuzumab for seven days.  Cells were then stained with Hoechst33342 (Sigma Aldrich, Oakville, ON,Canada) and cell numbers were analyzed with the Cellomics ArrayScan VTI instrument (Cellomics, Pittsburgh, PA, USA) to assess growth.    siRNA transfection BT474, HR5, and HR6 were seeded into a 6-well plate at 3 x 105 cells/well 24 hours prior to transfection.  Five nM of either control siRNA (AllStars Negative Control siRNA, #1207820, Qiagen, Hilden, Germany) or YB-1 oligonucleotide #1 or oligonucleotide #2 (Astanehe et al., 2009) was transfected using Lipofectamine RNAiMAX (Invitrogen) for 96 hours.  68  Growth Inhibition Analysis BT474, HR5, and HR6 cells were seeded at a density of 5.5 x 104 cells/well in a 24-well plate and allowed to adhere for 24 hours.  Cells were then treated with 5nM of either control siRNA or YB-1 siRNA or 20nM of CD44 siRNA (CD44 siRNA (Hs_CD44_5_HP Validated siRNA, #SI00299705, Qiagen).  After 24 hours, cells were either grown in regular growth media or media supplemented with 20μg/mL of trastuzumab for 72 hours.  Following treatment, cell proliferation was evaluated using the CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI, USA).  YB-1 knockdown was concurrently confirmed by immunoblot analysis of whole cell extracts and q-RT-PCR was employed to verify CD44 inhibition.  Soft agar anchorage independent growth assay To evaluate anchorage independent growth with YB-1 inhibition, BT474, HR5 and HR6 cells were transfected with either control siRNA or YB-1 siRNA as described above.  Forty eight hours post transfection, cells were trypsinized and suspended into 0.3% agar and plated at a density of 5 x 103 cells/well in a 24-well plate on top of a layer of 0.6% agar.  For the combined YB-1 inhibition and trastuzumab soft agar studies, trastuzumab was added to the top layer of agar at final concentrations of 0µg/mL, 0.2µg/mL, 2.0µg/mL, and 20µg/mL.  Soft agar solutions were prepared with DMEM supplemented with 10% FBS, except for the studies employing AU565 cell where RPMI supplemented with 10% FBS was used instead.  Colonies were counted after 21 – 28 days.  69  Stable transfectant cell lines BT474 cells were plated at a density of 5.5 x 105 cells/well into a 6-well plate.  After 24 hours, cells were transfected with 2μg of Flag-EV, Flag-YB-1WT, or Flag-YB-1S102D plasmid constructs as described previously (Finkbeiner et al., 2009) with 6μL of Lipofectamine 2000 Reagent (Invitrogen), employing the manufacturer suggested DNA:transfection reagent ratio of 1:3.  Transfection reagent and DNA complexes were replaced with fresh growth media 5 hours post transfection.  The transfected cells were then expanded into 10cm dishes, at approximately 80% confluency, 400µg/mL of G418 (Calbiochem, EMD Chemicals, San Diego, CA, USA) was added to the growth media and replaced every 4 days to select for cells expressing the transgene.  Cells were continuously maintained in G418 and split at low density.  For each construct, four clones were picked and further expanded.  Clonal cells were then evaluated for transgene expression by immunoblot analysis and quantitative real-time PCR.  Clones expressing the highest levels of the transgene were then selected to carry out further experiments.   Quantitative real-time PCR RNA isolation, cDNA synthesis, and real-time PCR experiments were performed as described previously (Astanehe et al., 2009).  TaqMan Universal Master Mix was used with TaqMan Gene Expression Assays designed against CD44 (Hs00153304_m1, Applied Biosystems, Foster City, CA, USA) and TATA-box binding protein (TBP) endogenous control (Part No. 4326322E, Applied Biosystems, Foster City, CA, USA) were used to detect transcript levels on an ABI Prism 7000 Sequence Detector.  70  Immunofluorescence analysis Cells were seeded onto glass coverslips at a density of 5 x 105 cells/well and allowed to adhere.  Next, cells were washed with phosphate buffered saline (PBS) and then fixed with 2% formalin for 20 minutes and rinsed three times with PBS.  Following, the coverslips were incubated with CD44 conjugated to phycoerythrin, 1:100 (Clone G44-26, Becton Dickinson (BD) Pharmingen, Franklin Lakes, NJ, USA) diluted in immunofluorescence buffer (PBS with 2% goat serum, 1% BSA, and 1% saponin) for 1 hour at room temperature.  Following, coverslips were washed three times with PBS and then incubated in secondary Alexa Fluor 546 goat anti mouse IgG (Invitrogen) diluted 1:1000 in immunofluorescence buffer for 1 hour at room temperature.  Lastly, coverslips were washed with PBS three times and then mounted onto glass slides using Prolong Gold antifade reagent with DAPI (Invitrogen).  Cells were imaged on an Olympus Fluorescence BX61 Microscope.  Mammosphere non-adherent growth assay Single cells at a density of 5 x 103 were plated into Ultra-Low Attachment coated 6-well culture plates (Corning, Lowell, MA, USA) in a 1:1 DMEM/F12 basal media freshly supplemented with human basic fibroblast growth factor (Invitrogen), epidermal growth factor (Invitrogen), heparin (Sigma Aldrich), and B27 supplement without Vitamin A (Sigma Aldrich).  Mammospheres greater than 15 cells in size were counted at seven days.    71  Immunofluorescence analysis of mammospheres Mammospheres were grown and cultured as described above.  After seven days of growth, spheres were transferred into a 15mL conical tube and centrifuged at 1000 rpm for 2 minutes.  Spheres were then washed once with PBS and resuspended into a 1:1 solution of methanol:acetone and spotted onto glass slides, slides were placed at -20ºC for 10 minutes and then air dried.  Spheres were stained with CD44 conjugated to phycoerythrin, 1:25 (Clone G44-26, Becton Dickinson (BD) Pharmingen, Franklin Lakes, NJ, USA) diluted in immunofluorescence buffer (PBS with 2% goat serum, 1% BSA, and 1% saponin) overnight at 4ºC.  Slides were then washed 3 times with PBS and then incubated with secondary antibodies as described above for 1 hour at room temperature.  Next, slides were washed twice with PBS and then nuclei were stained with Hoechst33342 (Sigma Aldrich, Oakville, ON, Canada).  Slides were then washed once with PBS and mounted using Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA).  Spheres were visualized by confocal micrsocopy using the Fluoview FV1000 laser scanning microscope (LSI3-FV1000-inverted).  Chromatin immunoprecipitation (ChIP) BT474, HR5, and HR6 cell lines were plated at a density of 1 x 107 in a 15cm dish for each of control chicken IgY and YB-1 immunoprecipitation antibody pull-down. YB-1 promoter complexes were isolated by chromatin immunoprecipitation using a polyclonal chicken antibody as previously described (Wu et al., 2006).  DNA was purified using the QIAquick PCR purification kit (Qiagen).  A primer set designed to flank a YB-1 binding site (ATTG) in the first two kilobases of the CD44 promoter was designed with the following sequence, annealing 72  position, and optimized annealing temperature (Ta):  -1657 to -1900, F – TCAAACACAATTTTGCTTTTAGTAATG, R – TGGCTGCTTCTTAGTTGTGTG, Ta = 59ºC.    CD44 luciferase assay To compare the direct effect of YB-1 levels on CD44 promoter activity, cell lines were transfected with a 2kB promoter construct (Addgene) and a renilla expression vector, pRL-TK (Promega).  Cells were plated in 6-well plates (5.5 x 105 cell/well) and transfected with a total of 1.5µg of DNA using FuGene HD Transfection Reagent (Roche, Indianapolis, IN, USA).  Cells were harvested 48 hours post transfection in 1 x PLB buffer (Promega) and luciferase activity was measured.  All luciferase measurements were normalized to the renilla readings for the matching sample.  Statistical Analysis The results are reported as the mean ± standard deviation.  Significance was determined using paired Student’s t-test and p-values < 0.05 were considered significant and represented by a *.        73  3.3 RESULTS AND DISCUSSION P-YB-1S102 is highly expressed in trastuzumab resistant cell lines.   A recent study by Ritter et al demonstrated the in vivo generation of cell lines with acquired trastuzumab resistance that serve as an attractive model to study as they emulate a typical course of  clinical therapeutic resistance (Ritter et al., 2007).  Moreover, these resistant cell lines, HR5 and HR6, were shown to express increased levels of the YB-1 target gene EGFR (Ritter et al., 2007), which we have extensively characterized (Stratford et al., 2007; Wu et al., 2006).  Interestingly, we observed that protein levels of P-YB-1S102 and its activating kinase P-RSK (Stratford et al., 2008) were significantly higher in the HR5 and HR6 cell lines in comparison to their parental BT474 counterpart (Figure 3.1 A).  Importantly, P-RSK and P-YB-1S102 levels were persistent in the HR5 and HR6 cell lines following 72 hours of trastuzumab treatment, but dropped considerably in the trastuzumab sensitive cell line BT474 (Figure 3.1 B).  Surprisingly, P-AKTS473 levels also diminished with trastuzumab exposure in all three cell lines suggesting that is not the kinase responsible for maintaining YB-1 phosphorylation.     Trastuzumab resistant cell lines depend on YB-1 for growth and survival.   We have previously reported on the dependence of HER2 positive breast cancer models on YB-1 for cell survival, growth in vitro and in vivo tumourigenesis (Lee et al., 2008).  Consequently, we inhibited YB-1 with targeting siRNA and found that the loss of YB-1 initiated apoptosis as indicated by increased levels of P-H2AXS139 and PARP cleavage in all three cell lines (Figure 3.1 C).  Furthermore, we evaluated anchorage independent growth in the BT474, HR5, and HR6 cell lines with YB-1 depletion and found that colony formation was considerably hindered by 60% - 74  90%, suggesting that it is also essential for the growth and survival of both trastuzumab sensitive and resistant cell lines (Figure 3.1 C).  YB-1 inhibition further sensitizes cells to trastuzumab and can be used to overcome resistance.   To determine whether the expression of YB-1 contributes to a cells response to trastuzumab, we inhibited YB-1 with siRNA with simultaneous drug treatment and measured cell viability in the BT474, HR5, and HR6 cell lines.  Interestingly, depletion of YB-1 alone resulted in a 40% reduction in viable cells (Figure 3.1 D).  Further, as displayed in Figure 3.1 D, an approximate 60% reduction in proliferation was observed when cells were treated with trastuzumab with YB-1 inhibition.  In fact, with the loss of YB-1, both sensitive BT474 and resistant HR5 and HR6 cell lines had similar responses to trastuzumab treatment.  Additionally, inhibiting YB-1 expression with siRNA suppressed the growth of the BT474-m1 and AU565 cells in soft agar, which are HER2 positive and trastuzumab sensitive, by ~60%, moreover siYB-1 enhanced the sensitivity of these cells to trastuzumab (Supplemental Figure 3.1).  To elaborate on this, in the BT474-m1 cells, it took 20µg/mL of trastuzumab to suppress colony formation by 95%.  In contrast, only 0.2µg/mL of trastuzumab was required to have the same effect with simultaneous YB-1 inhibition.   Also, pharmacological inhibition of YB-1 phosphorylation with BI-D1870, a RSK inhibitor, had a striking effect on growth and resulted in cell death in both sensitive and resistant cell lines (Figure 3.2 A-B).  These findings suggest that a RSK dependent mechanism preserves YB-1 activation to promote resistance to trastuzumab therapy.   75  BT474 Flag-YB-1S102Dstable clones are trastuzumab resistant.   BT474 cells expressing Flag-YB-1S102D, a phospho-mimic mutant of YB-1 was employed with the intention of generating a cell line capable of phenocopying acquired resistance.  We therefore compared the response of all stable cell lines to trastuzumab in a monolayer growth assay.  The BT474 YB-1S102D mutant was capable of rendering the cell line insensitive to trastuzumab in contrast to the BT474 EV cell line (Figures 3.2 C-D).  However, the inactive mutant, YB-1S102A did not, providing further evidence that signal transduction pathways regulated by phosphorylated YB-1 are critical to the ability of the cells to escape the effects of trastuzumab.   Trastuzumab resistant cell lines have increased expression of CD44 which is regulated by YB-1.  In breast cancers, cells with a CD44+/CD24-/low/ESA+ phenotype have been defined as TICs (Al-Hajj et al., 2003).  These cells are more tumourigenic as demonstrated by in vivo serial dilution tumour formation assays in addition to their enhanced mammosphere forming abilities when compared to their non-TIC counterparts.  More recently, TICs have been implicated in drug resistance and disease recurrence (Li et al., 2008; Marangoni et al., 2009).  A study comparing paired tumour biopsies of patients before and after conventional chemotherapy demonstrated that breast cancer cells resistant to treatment were enriched in CD44+/CD44-/low cells and in fact these resistant cells had higher mammosphere formation capability compared to the pre-treatment samples (Li et al., 2008).  We have previously implicated YB-1 as a regulator of a set of common genes associated with a stem cell signature (Finkbeiner et al., 2009), including CD44.  More recently, we demonstrated that YB-1 promotes tumour initiation by inducing CD44, an established TIC marker (To et al., 2010).  Here we find the HR5 and HR6 cell lines express 76  more CD44 transcripts as well as protein as compared to the BT474 cells (Figure 3.3 A) which correlates with increased mammosphere formation (Figure 3.3 B).  There was also more P-YB-1S102 found in HR5 and HR6 cells grown as mammospheres (Figure 3.3 B).  Further, when grown as mammospheres, the HR5 and HR6 cells expressed more CD44 as demonstrated by immunofluorescence analysis of whole mount mammospheres (Figure 3.3 C) whereas inhibition of YB-1 impaired mammosphere formation (Figure 3.3 D).    We next employed ChIP assays to demonstrate that YB-1 in fact was responsible for the regulation of CD44 by showing promoter binding in our model of resistance, in fact the resistant cell lines displayed increased binding which also correlated to increased CD44 promoter activity (Figure 3.4 A).  The stable expression of YB-1S102D in BT474 cells had similar effects by increasing CD44 protein levels (Figure 3.4 B).  Similarly to the HR5 and HR6 models, the BT474 YB-1S102D mutant cell line was more efficient in its ability to form mammospheres and also demonstrated a significant increase in CD44 promoter activity (Figure 3.4 B).  We assessed CD44 levels in the BT474 cell line following trastuzumab treatment for seven days to ask whether the remaining cells were CD44 positive. Interestingly, the remaining cells that survived treatment had a two fold increase in CD44 transcript levels (Figure 3.4 C).  Further, when trastuzumab sensitive BT474 cells were grown as mammospheres in the presence of trastuzumab, they were unresponsive to therapy, again suggesting that TIC like cells are resistant to trastuzumab (Supplemental Figure 3.2).  This suggests that a subset of cells exists within the bulk population which is intrinsically resistant to trastuzumab.  Hence, we inhibited CD44 with siRNA with coinciding trastuzumab treatment and demonstrated that the combinatory treatment was capable of significantly reducing the number of viable cells (Figure 3.4 D).   77  Taken together, we have implicated YB-1 as a mediator of acquired trastuzumab resistance.  The ability of YB-1 to induce a TIC phenotype in HER2 positive breast cancer cells desensitizes them to the effects of trastuzumab.  Given YB-1’s established association with cancer relapse, the ability of this transcription factor to regulate such a tumourigenic subpopulation sheds light on its ability to confer drug resistance.  In a recent prospective study, high YB-1 expression signified a subset of HER2 positive patients that benefited from more aggressive chemotherapy (Gluz et al., 2009).   Our findings complement current literature correlating cancer recurrence to the inability of therapies to effectively terminate the TIC population within the bulk tumour.     To conclude, this study provides insight into a novel mechanism by which cancer cells acquire the ability of resistance to trastuzumab therapy.  We nominate YB-1 as a candidate for molecularly targeted therapy with the hopes of treating acquired trastuzumab resistance by eliminating the TICs responsible for cancer recurrence and hence relapse.            78  3.4 FIGURES     Figure 3.1.  Trastuzumab resistant cell lines have increased levels of P-YB-1S102 and depend on YB-1 for growth and survival.  A.  BT474, HR5, and HR6 cells were lysed and protein levels were evaluated by immunoblotting.  The trastuzumab resistant cells, HR5 and HR6, express increased levels of P-YB-1S102 protein and its activating kinase P-RSK compared to the sensitive BT474 cell line.  B.  BT474, HR5, and HR6 cells were treated with trastuzumab (20µg/mL) for 72 hours.  Following, cells were harvested and protein expression was analyzed by immunoblotting.       A B 79    C.  Cells were transfected with 5nM of either control siRNA or siYB-1#2 for 72 hours.  Following, cells were harvested and protein levels were determined by immunoblotting.  Silencing YB-1 with siRNA induced apoptosis in all three cell lines as suggested by phosphorylation of H2AX and PARP cleavage.  Also, following 24 hours of transfection, cells were seeded into soft agar.  Inhibition of YB-1 markedly attenuated colony formation.  YB-1 inhibition was confirmed by immunoblotting 72 hours post transfection.  D.  BT474, HR5, and HR6 cells were transfected with 5nM of either control siRNA or siYB-1#2 for 24 hours, after which trastuzumab (20µg/mL) was added to the growth media.  Cell proliferation was analyzed 96 hours post transfection via MTS assay.         C D 80    Figure 3.2.  Phosphorylation of YB-1 is essential for cell viability and also promotes resistance to trastuzumab therapy.  A. 72 hours of BI-D1870 treatment (10µM) decreased P-YB-1S102 protein levels and induced apoptosis as demonstrated by immunoblotting. Successful targeting of RSK was demonstrated by decreased levels of P-S6RPS240/244, an established RSK substrate.  B.  Cells were treated with 1µM, 5µM, and 10µM of BI-D1870 for 72 hours after which cell growth was evaluated by the Cellomics ArrayScanner.  BI-D1870 affected cell growth across all cell lines at 5µM and 10µM.   C.  BT474 stable cells were treated with trastuzumab (20µg/mL) for seven days.  Representative photomicrographs of cells following treatment demonstrate cells expressing YB-1S102D were less sensitive to trastuzumab.  D.  Following trastuzumab treatment, cell growth was quantified by nuclei staining and analysis by the Cellomics Arrayscanner.  Immunoblot illustrates transgene expression in the BT474 stable cell lines.       A B D C 81    Figure 3.3. Trastuzumab resistant cell lines have increased levels of CD44. A. BT474, HR5 and HR6 cells were grown on glass coverslips.  Following, cells were fixed and stained for CD44.  Cells were imaged on the Olympus Fluorescence BX61.  CD44 transcript levels were also characterized from RNA isolated from log growing cells.  Trastuzumab resistant cell lines, HR5 and HR6, have increased CD44 protein as demonstrated by immunofluorescence and increased CD44 transcript levels as quantified by q-RT-PCR.  B.  Single BT474, HR5, and HR6 cells were seeded into the mammosphere assay at a density of 5 x 103 cells per 6-well dish.  Mammospheres greater than 15 cells in size were counted at seven days.  Mammospheres were subsequently isolated and lysed.  Protein analysis of mammospheres shows increased levels of P-YB-1S102 in the resistant cell lines.   A B 82    C.  Cells grown as mammospheres were isolated and stained for CD44.  Spheres were resuspended into a 1:1 solution of methanol:acetone and spotted onto glass slides and placed at -20ºC for 10 minutes and then air dried.  Following, cells were stained at 4ºC with anti-CD44 overnight.  Spheres were next washed, incubated in secondary antibody and mounted.  Confocal microscopy illustrates increased expression of CD44 in spheres formed by the resistant cell lines. D.  Cells were transfected with 5nM of control siRNA, siYB-1#1, or siYB-1#2 for 24 hours and then seeded into the mammosphere assay.  Spheres were quantified 7 days later.  Inhibiting YB-1 with siRNA decreased sphere formation efficiency. C D 83    Figure 3.4.  YB-1 binds to and regulates the CD44 promoter thereby maintaining trastuzumab resistant cells.  A. DNA complexes pulled down with either a YB-1 or non-immune IgY were amplified by PCR reactions using a primer set flanking the human CD44 promoter.  Representative ethidiom bromide stained agarose gel results demonstrate enhanced binding in the resistant cell lines.  The images were quantified by taking into account nonspecific binding to the IgY.  The BT474 and HR5 cells were transfected with a CD44 promoter construct and a Renilla expression vector.  Luciferase activity was measured 48 hours after transfection and all luciferase measurements were normalized to the renilla readings for the matching sample.  The HR5 cells exhibited a 1.6 fold increase in CD44 promoter activity compared to the BT474 cell line.  B.  The BT474 YB-1S102D cell lines express higher levels of CD44 protein as demonstrated by immunofluorescence and also exhibit an enhanced potential to form mammospheres in addition to a significant increase in CD44 promoter activity.     A B 84    C.  BT474 cells were treated with trastuzumab (20µg/mL) for seven days after which CD44 mRNA levels were assessed by q-RT-PCR.  Viable cells following trastuzumab treatment were enriched two-fold in CD44 levels compared to the untreated control.  D.  BT474, HR5, and HR6 cells were transfected with 20nM of either control siRNA or siCD44 for 24 hours.  Following, trastuzumab (20µg/mL) was added to the growth media for 72 hours.  Cell viability was assessed following 96 hours by MTS assay.   C D 85  3.5 SUPPLEMENTARY FIGURES   Supplemental Figure 3.1.  Inhibition of YB-1 enhances the suppression of colony formation in soft agar in combination with trastuzumab.  HER2 positive, trastuzumab sensitive cells BT474 (A) and AU565 (B) cells were transfected with control siRNA or siRNA against YB-1 for 48 hours and then seeded into soft agar with trastuzumab at concentrations of 0, 0.2, 2, and 20 µg/mL.  Colonies were quantified 30 days later.  Representative photomicrographs demonstrate the additive effects of YB-1 depletion with trastuzumab treatment on colony inhibition and are quantified in the bar graphs.       A B 86   Supplemental Figure 3.2.  Trastuzumab is ineffective at preventing mammosphere formation.  BT474, HR5, and HR6 cells were seeded into the mammosphere assay at 5000 cells/well and treated with 20µg/mL of trastuzumab.  Mammospheres were counted 7 days later.  Trastuzumab was ineffective at hindering sphere formation.           87  REFERENCES  Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. (2003). Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100: 3983-3988. Astanehe A, Finkbeiner MR, Hojabrpour P, To K, Fotovati A, Shadeo A et al. (2009). The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28: 2406-2418. Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K et al. (1997). Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3: 447-450. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L et al. (1999). Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17: 2639-2648. Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y et al. (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28: 1421-1431. Gluz O, Mengele K, Schmitt M, Kates R, Diallo-Danebrock R, Neff F et al. (2009). Y-box-binding protein YB-1 identifies high-risk patients with primary breast cancer benefiting from rapidly cycled tandem high-dose adjuvant chemotherapy. J Clin Oncol 27: 6144-6151. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res 10: R86. Korkaya H, Paulson A, Iovino F, Wicha MS. (2008). HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion. Oncogene 27: 6120-6130. Lee C, Dhillon J, Wang MY, Gao Y, Hu K, Park E et al. (2008). Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res 68: 8661-8666. Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF et al. (2008). Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst 100: 672-679. Marangoni E, Lecomte N, Durand L, de Pinieux G, Decaudin D, Chomienne C et al. (2009). CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer 100: 918-922. Ritter CA, Perez-Torres M, Rinehart C, Guix M, Dugger T, Engelman JA et al. (2007). Human breast cancer cells selected for resistance to trastuzumab in vivo overexpress epidermal growth 88  factor receptor and ErbB ligands and remain dependent on the ErbB receptor network. Clin Cancer Res 13: 4909-4919. Sawyers C. (2004). Targeted cancer therapy. Nature 432: 294-297. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. (1987). Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235: 177-182. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A et al. (2001). Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344: 783-792. Stratford AL, Fry CJ, Desilets C, Davies AH, Cho YY, Li Y et al. (2008). Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res 10: R99. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. To K, Fotovati A, Reipas K, Law JH, Hu K, Wang J et al. (2010). Y-Box Binding Protein-1 induces expression of CD44 and CD49f leading to enhanced self-renewal, mammosphere growth, and drug resistance. Cancer Res 70: 2840-2851.  Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L et al. (2002). Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20: 719-726. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879.         89  CHAPTER FOUR: DISCUSSION AND FUTURE DIRECTIONS  4.1 SIGNIFICANCE OF YB-1 IN HER2 OVER-EXPRESSING BREAST CANCER  Breast cancer is a disease characterized as being molecularly heterogeneous.  While the gain and loss of chromosomes may seem random, amplifications in HER2 are recurrent with a frequency of 25-30% of reported cases (Slamon et al., 1987).  The resultant receptor over-expression typifies cancer cells with an aggressive and metastatic phenotype associated with unfavourable clinical outcomes (Slamon et al., 1987; Slamon et al., 1989).  The ability of HER2 to transform cells rests on its influence on a multitude of cellular processes.  At the cell surface, HER2 interacts with a range of membrane receptors including EGFR (Yarden and Sliwkowski, 2001), MET receptor (Khoury et al., 2005), CD44 (Bourguignon et al., 1997b), IGF-IR (Balana et al., 2001) and integrins (Falcioni et al., 1997), allowing for the activation of divergent signal transduction cascades that elicit aberrant cellular growth and survival, thereby mediating pathogenesis.    Studies presented herein characterize the function of YB-1 in the HER2 subtype of breast malignancy.  The data in Chapter Two introduces the necessity of YB-1 for the growth and survival of both HER2 positive and the triple negative subtypes of breast cancer cells.  Moreover, in HER2 over-expressing breast cancer cells, YB-1 inhibition induced apoptosis.  A molecular mechanism involving the STAT3 pro-survival pathway was identified to be dampened with YB-1 silencing which altered the apoptotic threshold of the cells.  Furthermore, we reveal that silencing YB-1 suppressed in vitro anchorage independent growth and also inhibits tumourigenesis in vivo.  Related to these findings, we next explored the role of YB-1 in a model 90  of acquired trastuzumab resistance.  Given YB-1’s association with the HER2 subtype and the common clinical hurdle of resistance to trastuzumab, a specific HER2 targeting therapy, we questioned whether this transcription factor also contributes to the acquisition of a resistant phenotype.  Within Chapter Three, we demonstrate that protein levels of P-YB-1S102 are elevated in two trastuzumab resistant cell lines, in addition to its activating kinase, P-RSK.  Further, the RSK/YB-1 signalling pathway remains engaged following trastuzumab treatment while it is hindered in the sensitive counterpart.  The significance of P-YB-1S102 in contributing to resistance was made evident by successfully establishing a cell line mimicking the resistant phenotype by expressing a constitutively active mutant of YB-1.  Furthermore, we provide evidence that P-YB-1S102 regulates CD44, an established stem cell associated factor which is found to be elevated in the resistant models.  The increased CD44 levels in the trastuzumab resistant cells contribute to their enhanced propensity for mammosphere formation.  This work implicates cells with tumour-initiating properties as the culprit population responsible for escaping trastuzumab therapy.  We have demonstrated that P-YB-1S102 sustains tumour-initiating cells as defined by their CD44 expression and hence promotes a resistant phenotype.  Overall, the data presented in this thesis provide evidence for the requirement of YB-1 in HER2 positive breast cancer and suggests that it may be a contributing factor to the poor prognosis and tumour recurrence associated with this subtype.  4.2 IMPLICATIONS AND FUTURE DIRECTIONS YB-1 regulates STAT3 mediated pro-survival signalling Having observed that the loss of YB-1 led to the induction of apoptosis, we sought to understand why this occurred at the molecular level.  We queried the function of STAT3 in altering the 91  apoptotic threshold of BT474-m1 cells following the loss of YB-1 function via siRNA treatment.  The activation of STAT3 has been demonstrated to be an event downstream of HER2 (Fernandes et al., 1999) and EGFR (Garcia et al., 1997), both of which are YB-1 target genes (Stratford et al., 2007; Wu et al., 2006).  Furthermore, Tan et al demonstrated inhibition of in vivo tumourigenesis in xenograft models of HER2 over-expressing breast cancer cells employing a cell permeable peptide blocking STAT3 activity (Tan et al., 2006).  In fact, STAT3 suppression has been shown to evoke apoptosis in cancers of the breast (Gritsko et al., 2006), and prostate (Lee et al., 2004), and in gliomas (Iwamaru et al., 2007) and astrocytomas (Konnikova et al., 2003).  This ability stems from STAT3’s regulation of survivin (Gritsko et al., 2006), BCL2 (Real et al., 2002), Bcl-xL (Bromberg et al., 1999), and MCL1 (Liu et al., 2003), proteins that have anti-apoptotic functions.  Traditionally, the function of STAT3 has been attributed to its phosphorylation at tyrosine 705 which leads to protein dimerisation (Levy and Darnell, 2002), while subsequent phosphorylation at serine 727 has been suggested to enhance nuclear transport and DNA binding (Wen et al., 1995).  Interestingly, we show decreases in P-STAT3S727 with YB-1 inhibition whereas P-STAT3Y705 was not detectable in any of the HER2 over-expressing breast cancer cell lines under investigation (Appendix I), which is further supported by Berishaj et al (Berishaj et al., 2007).  YB-1 itself does not have kinase activity, therefore decreases in P-STAT3S727 must be the result of changes in the activity of kinases which are associated with YB-1 signalling pathways or are directly regulated by the transcription factor.  ERK (Chung et al., 1997) and mTOR (Yokogami et al., 2000) are two potential kinases that have previously been reported to phosphorylate STAT3 at serine 727.  We show that inhibiting YB-1 with siRNA in HER2 over-expressing breast cancer cell lines resulted in decreased levels of both P-ERKT202/Y204 and P-mTORS2448.  To identify the kinase responsible for the phosphorylation of STAT3 at serine 727, we inhibited mTOR with rapamyacin, as well as ERK with PD98058 in the BT474-m1 cell line.  A reduction in P-STAT3S727 was observed with pharmacological 92  inhibition of either ERK or mTOR, suggesting that both kinases are involved in the activation of STAT3 (Appendix II).  To further characterize STAT3 phosphorylation and validate the drug inhibition studies, a rescue experiment should be performed.  This would entail inhibiting YB-1 with siRNA and attempting to rescue phosphorylation of STAT3 at serine 727 with ectopic expression of either mTOR or ERK.   Interestingly, total levels of mTOR decreased with the loss of YB-1.  Transcriptional regulation of MTOR was ruled out since mTOR transcript levels did not decrease with siRNA inhibition of YB-1.  The mechanism by which total mTOR protein levels decrease is an avenue open for exploration as the regulation of mTOR expression has not been characterized.  Yet the importance of mTOR in cancer is evident (Guertin and Sabatini, 2007).  Protein levels of mTOR have been shown to be directly regulated by the tumour suppressor F-box and WD repeat domain-containing 7 (FBXW7) (Mao et al., 2008).  FBXW7 binds to and marks mTOR for ubiquitination and subsequent degradation (Mao et al., 2008).  Therefore, YB-1 may directly or indirectly be involved in hindering the expression of FBXW7; hence with YB-1 depletion, FBXW7 has the opportunity to control total mTOR levels.  It would be of interest to assess FBXW7 levels in the HER2 over-expressing cells BT474-m1 and Au565 following YB-1 inhibition to query whether the observed decrease in total mTOR is potentially the result of protein ubiquitination mediated by FBXW7.  Given YB-1’s role in translation, it would be interesting to explore its involvement in the translational control of mTOR.  Of note, cytoplasmic YB-1 has been demonstrated to interact with a number of mRNA species, where it functions to suppress translation (Evdokimova et al., 2006a).  Upon activation by phosphorylation at serine 102, YB-1 is shuttled to the nucleus, thereby allowing for the translation of a number of oncogenic transcripts including VEGF and FOS (Evdokimova et al., 2006b).  Therefore, it is 93  unlikely that decreased mTOR protein is a direct result of YB-1 functioning in translation.   In fact if this was the case, mTOR protein levels would be expected to rise with the loss of YB-1.  We observed that silencing of YB-1 leads to a downregulation of mTOR and phosphorylation of STAT3, however, we cannot determine whether they are related events at this time.  STAT3 has been shown to promote tumour cell survival and the development of malignancies.  How this occurs is of great debate.  Classically, it was thought that STAT3 required phosphorylation at serine 727 and tyrosine 705 in order to optimally function.  However, STAT3 is reportedly capable of functioning as a transcription factor in the absence of phosphorylation at tyrosine 705 in macrophage survival (Liu et al., 2003) and also in NOTCH signalling in stem cells (Androutsellis-Theotokis et al., 2006).  Moreover, the human prostate cancer cell line LNCaP expressing mutated STAT3, where the tyrosine 705 residue was changed to an phenylalanine and the serine 727 mutated to glutamic acid, was capable of in vivo tumourigenesis, suggesting that it retains its oncogenic abilities, independent of tyrosine phosphorylation (Qin et al., 2008).  Furthermore, Pin1 mediated activation of STAT3 at its serine 727 residue has also been demonstrated to recruit p300 (acetyltransferase), a STAT3 co-factor, which allows for P-STAT3S727 dependent gene transcription (Lufei et al., 2007).  Interestingly, intrinsic transferase activity of p300 regulates STAT3 dimer formation via acetylation of lysine at residue 685 within the SH2 domain (Yuan et al., 2005).  Given this, it is plausible that YB-1 may also physically interact with STAT3 in a complex with p300 given that a YB-1/p300 interaction has been described (Higashi et al., 2003).  If so, YB-1 inhibition may allow p300 to interact with its preferential binding partners and in doing so, decrease STAT3 transcriptional activity.  It would be worthwhile to assess YB-1/STAT3/p300 interactions by co-immunoprecipitation studies.  Also, we show that MCL-1 protein levels are decreased with the 94  loss of YB-1 and STAT3.  Furthermore, we used electrophoretic mobility shift assays to demonstrate nuclear STAT3 binding to a representative binding site within the MCL1 promoter.  MCL-1 regulation can also occur in a transcriptionally independent mechanism mediated by glycogen synthase kinase-3β (GSK3β) (Ding et al., 2007).  GSK3β directly phosphorylates MCL-1, marking it for proteosome mediated turnover (Ding et al., 2007).  However, with YB-1 inhibition, we did not observe changes in P-GSK3βS9 or its activating kinase P-AKTS473.  Beyond MCL1, additional STAT3 downstream targets such as BCL2 (Real et al., 2002), BCL-xL (Bromberg et al., 1999), and survivin (Gritsko et al., 2006) function as regulators of apoptosis.  We did not observe changes in survivin levels with decreased P-STAT3S727 and preliminary evaluation of BCL-xL provided inconclusive results.  Therefore, it would be worth analyzing additional STAT3 targets which function as mediators of apoptosis following YB-1 knockdown.  With the current set of data, we implicate STAT3 in promoting a survival advantage in HER2 positive breast cancer cells by its transcriptional regulation of MCL1.    YB-1 and acquired trastuzumab resistance The benefits of directly targeting HER2 with trastuzumab have been demonstrated (Cobleigh et al., 1999; Slamon et al., 2001; Vogel et al., 2002); however the molecular mechanism by which the antibody exerts its anti-tumour effect remains to be fully understood.  Further to this, many patients with HER2 amplifications fail to respond to initial trastuzumab treatment or escape the effects of the antibody within one year, suggesting both intrinsic and acquired mechanisms of therapeutic resistance.  Various molecular theories have been proposed to describe how tumour cells gain the ability to escape the effects of trastuzumab, however they have failed to identify a reliable biomarker which would aid in predicting one’s response to therapy. 95  We investigated the role of P-YB-1S102 in an in vivo model of acquired trastuzumab resistance generated by Ritter et al which emulates a typical course of antibody therapy (Ritter et al., 2007).  Initial studies ruled out changes in HER2 receptor levels as a possible explanation (Ritter et al., 2007).  They also explored antibody insensitivity to antibody-dependent cellular cytotoxicity as a potential mechanism of resistance but this did not turn out to be the cause.  A defect in molecular signalling was next considered.  As such, they report that the resistant cells express higher levels of EGFR (Ritter et al., 2007).  Since EGFR is a YB-1 target gene (Stratford et al., 2007; Wu et al., 2006), we queried the function of P-YB-1S102 in trastuzumab resistance.  In our work, we provide evidence for the requirement of YB-1 in both resistant and sensitive breast cancer cell lines as demonstrated in monolayer and soft agar assays.  Moreover, we suspect P-YB-1S102 as a causative agent in generating a resistant phenotype as activated protein levels withstand trastuzumab treatment in the HR5 and HR6 cell lines.  Supportive of this, over-expression of a constitutively active mutant of YB-1 rendered the trastuzumab sensitive BT474 cell line resistant to therapy whereas the inactive mutant YB-1S102A failed to convey drug resistance.    Considering YB-1’s function as a transcription factor that regulates a number of cancer related genes, a rational idea for its contribution to trastuzumab resistance would be its modulation of gene expression and the resultant changes in protein levels.  We have evidence that following trastuzumab treatment, P-YB-1S102 nuclear levels are sustained in the resistant cell lines whereas levels decrease in the sensitive BT474 cells (submitted).   A related research project in the lab investigated this further by performing a ChIP-sequencing study in the BT474, HR5, and HR6 cells following trastuzumab treatment to identify changes in gene expression in the resistant models by sequencing YB-1 bound DNA complexes.  ChIP-sequencing is more advantageous 96  than a ChIP-on-chip study as the former technique is capable of an in depth genome wide analysis whereas microarray platforms are limited to specific genomic regions.  To further support the current set of gene expression changes, it would be important to also complete the ChIP-sequencing study with the BT474 YB-1S102D cells.  The binding profiles could then be compared to those identified in the resistant cell lines. We have previously confirmed the ability of YB-1S102D to induce MET (Finkbeiner et al., 2009) and PIK3CA (Astanehe et al., 2009), hence changes similar to those observed in the HR5 and HR6 cells should be expected in the BT474 YB-1S102D cells.  The MET receptor was in fact identified in the ChIP-Sequencing study of YB-1 target genes in the HR5 and HR6 cells.  Furthermore, the resistant cells were confirmed to have greater amounts of MET receptor as compared to the BT474 cells (submitted).  Interestingly, the MET receptor has been previously implicated in trastuzumab resistance (Shattuck et al., 2008).  Therefore, YB-1 mediated trastuzumab resistance may also be a result of its induction of MET.  Taken together, these findings suggest that YB-1’s regulation of the transcriptional circuitry of a cell is capable of rendering it insensitive to trastuzumab by bringing about changes to a vast array of signalling pathways.  A recent study utilizing the HR5 and HR6 cells to study acquired trastuzumab resistance implicated mTOR as a mediator of drug insensitivity.  Miller et al demonstrated that mTOR inhibition with RAD001 significantly impeded the growth of both sensitive BT474 and resistant HR5 and HR6 cells (Miller et al., 2009).  During the preliminary characterization phase of the BT474, HR5, and HR6 cells, we did not observe increased levels of activated mTOR in the resistant models compared to their sensitive counterpart, however we did not look at mTOR’s downstream target p70 S6 kinase, which was shown to be elevated by Miller et al.  Interestingly, in Chapter Two, we provide evidence for the downregulation of mTOR with YB-1 inhibition.  97  Perhaps the sensitization of the HR5 and HR6 cells to trastuzumab amidst YB-1 exhaustion (Chapter Three) was an effect mediated by decreased signalling via the mTOR pathway.  It would be of interest to further examine mTOR in the HR5 and HR6 cells.  Initially, mTOR protein levels should be assessed following YB-1 inhibition.  If levels do decrease, the functional value of mTOR could be further investigated in trastuzumab resistance.  Altered signalling seems to be a causative explanation for trastuzumab resistance based on EGFR over-expression.  This was reported by Ritter et al and confirmed independently by us.  The events following EGFR receptor activation in these models is where our results differ from Ritter et al.  They show increased levels of P-AKTS473 in the resistant HR5 and HR6 cell lines, but we do not, rather we find higher activation of the related serine/threonine kinase RSK.  This can be attributed to the elevated EGFR levels in the HR5 and HR6 cells, as activation of EGFR by EGF has been shown to lead to RSK phosphorylation (Nam et al., 2008).  Further, we suggest that the MAPK pathway promotes a resistant phenotype by RSK’s phosphorylation of YB-1 at serine 102.  AKT mediated YB-1 activation was ruled out since phosphorylated levels of YB-1 were sustained while P-AKTS473 decreased.  These studies prompted the question as to whether trastuzumab resistant cells rely on RSK signalling.  To address whether RSK was important to the growth of the trastuzumab resistant cells, it was inhibited with either a small molecule inhibitor or siRNA.  Direct inhibition of RSK with BI-D1870, an ATP competitive inhibitor, suppressed phosphorylation of YB-1 and also induced apoptosis.  However, BI-D1870 is not completely specific to RSK alone as it also targets Aurora B and polo-like kinase-1 (PLK1) (Sapkota et al., 2007).  To complement the BI-D1870 studies 98  and confirm apoptosis was induced by RSK inhibition, we targeted both RSK1 and RSK2 with siRNA and demonstrated an induction of cell death, thereby eliminating the potential involvement of additional kinases (Appendix III).  In our RSK knockdown experiment, we were unable to achieve a substantial RSK1 knockdown.  However, decreases in RSK2 alone were enough to induce apoptosis.  It would be necessary to optimize the siRNA transfection conditions for RSK1 and evaluate its role in apoptosis.   Also, since RSK2 knockdown alone was sufficient to induce cell death, it would be necessary to evaluate RSK1 and RSK2 inhibition separately to figure out their individual contributions.  Interestingly, we have demonstrated that with an effective inhibition of RSK1 and RSK2, the trastuzumab resistant cells have an increased response to trastuzumab (submitted).  To further substantiate our proposal of the RSK/YB-1 signalling pathway in trastuzumab resistance, it would be important to transform the sensitive BT474 cell line with myristolated (myr) RSK, a constitutively active mutant of the kinase, and assess cell growth in the presence of trastuzumab.  In addition to this, cell growth and apoptosis should be evaluated in the stable cell lines following BI-D1870 to determine whether YB-1S102D expression is capable of rescuing the downstream effects of RSK inhibition thereby confirming RSKs involvement in trastuzumab resistance.  Finally, to supplement our in vitro evidence implicating P-YB-1S102 in trastuzumab resistance, an in vivo study would be necessary to absolutely confirm YB-1 as a biomarker for drug resistance.  This could be completed by establishing xenografts employing the BT474 YB-1S102D stable cell lines in mice, followed by trastuzumab treatment.  Tumour regression would then be monitored and the response of the BT474 YB-1S102D cells would be evaluated after observation of complete tumour regression in the BT474 EV xenografts.   We expect that BT474 YB-1S102D tumours would be unresponsive to trastuzumab treatment. 99  Resistance to therapy by YB-1’s induction of tumour-initiating cells YB-1’s contribution to drug resistance is evident by its regulation of MDR1 (Goldsmith et al., 1993; Stein et al., 2001), MVP (Stein et al., 2005), and MRP1 (Stein et al., 2001).  Further, upon treatment with paclitaxel, there appears to be an increase in nuclear localization of YB-1, with a concordant increase in P-glycoprotein levels in primary breast cancer patient samples (Fujita et al., 2005).   Supportive of this, upon trastuzumab treatment, HR5 and HR6 resistant cell lines maintain nuclear P-YB-1S102 levels.  These findings suggest YB-1 is able to retain its function as a transcription factor in the presence of therapy targeting tumour cells and thereby perhaps implement their escape from treatment.  In fact gene expression analysis of residual tumour cells following docetaxel treatment identified the expression of genes associated with cell survival and the cell cycle to be increased in comparison to the tumour prior to drug therapy (Chang et al., 2005), findings which corroborate genes regulated by YB-1.  More recently, drug resistance has been associated with tumour-initiating cells (TICs).  These cells represent a minor fraction of a tumour and have unique stem-cell like qualities which allow them to regenerate disease via their capacity for self-renewal and differentiation (Reya et al., 2001).  Breast TICs are identified by their unique cell surface marker profile CD44+/CD24-/low (Al-Hajj et al., 2003) and also increased aldehyde dehydrogenase-1 (ALDH1) activity (Ginestier et al., 2007).  ALDH1 is an intracellular detoxifying enzyme that functions to oxidize aldehydes (Sophos and Vasiliou, 2003).  In stem cells, ALDH1 has been associated with differentiation by its function in the oxidation of retinol to retinoic acid (Chute et al., 2006).  A current model to explain drug resistance in cancer is the ability of TICs to survive therapy as they are inherently resistant, thus allowing them to regenerate disease, hence providing a rationale for cancer 100  recurrence and relapse (Dean et al., 2005).  The theory has been validated in the clinical setting by the demonstration of an elevation in the TIC population, defined by CD44+/CD24low/- following neoadjuvant chemotherapy in patients with advanced breast cancer (Li et al., 2008).  Subsequent studies have further characterized this subpopulation of cells as being resistant to therapy (Creighton et al., 2009; Fillmore and Kuperwasser, 2008; Marangoni et al., 2009).  TICs therefore represent a logical target for improving the treatment of cancer.  Several lines of evidence point toward YB-1 in the regulation of TICs.  We investigated YB-1 in a cohort of  >4000 breast cancer cases representative of all tumour subtypes and correlated its expression with relapse and poor survival (Habibi et al., 2008).  Moreover, in a subset of the cohort under investigation, YB-1 was also predictive of decreased survival in patients treated with tamoxifen (Habibi et al., 2008).  In addition, we also determined YB1 expression in bipotent progenitor cells from reduction mammoplasty samples, suggesting YB-1 plays a function in the normal primitive stem cell (Finkbeiner et al., 2009).  Further to this, a ChIP-on-chip analysis using promoter arrays in a basal like breast cancer model identified a number of YB-1 target genes, including CD44, CD49f, NOTCH, and WNT, which are associated with stem cells (Finkbeiner et al., 2009).    In addition, HER2 has been demonstrated to regulate breast stem cells (Korkaya et al., 2008) and TICs have also been isolated from tumours generated in Neu-MMVT transgenic mice models (Liu et al., 2007a).  Besides, activation of YB-1 by RSK lies downstream of HER2 signalling.  Hence, YB-1’s relationship to TICs was explored as a potential mechanism of acquired trastuzumab resistance.  101  To corroborate the hypothesis that TICs are drug resistant, we observed increased levels of CD44 protein and mRNA in the trastuzumab resistant cells which paralleled their enhanced efficiency for mammosphere formation.   Correspondingly, expression of the YB-1S102D mutant in BT474 cells caused the cells to acquire insensitivity to trastuzumab which correlated to their increase in CD44 protein, CD44 promoter activity, as well as an elevation in mammosphere formation efficiency.  Coupled to the in vitro evidence of a TIC phenotype in the trastuzumab resistant cell lines, we found that trastuzumab was ineffective in eliminating TICs.  In mammosphere assays, trastuzumab had no effect on sphere formation in all three cell lines suggesting that it lacks the ability to function on this subset of cells.  Furthermore, after challenging the sensitive BT474 cells with the antibody, the residual cells were enriched for CD44.  Additionally, we established an in vitro model of a trastuzumab resistant cell line from the BT474 cells by long-term treatment with trastuzumab (described as BT474LT).  The resultant population expressed increased levels of CD44 protein and mRNA (Appendix IV) which correlated with increased levels of P-YB-1S102, P-RSKS380, and P-RSKS221/S227 (data not shown).  We therefore propose that trastuzumab is incapable of exerting its anti-tumourigenic effects against TICs.  Contrary to our hypothesis, Magnifico et al report that trastuzumab is successful in eradicating TICs (Magnifico et al., 2009).  However, they fail to employ established markers such as CD44 to identify potential TICs and rely on the mammosphere assay as their method of TIC identification.  Further, the trastuzumab concentrations used in their studies are extremely high and do not represent drug levels achievable in patients.  Nevertheless, our data and recent literature supports the idea that TICs are unresponsive to therapies.  Hence targeting this population of cells may aid in improving the therapeutic response of patients to trastuzumab.  102  Collectively, the data presented herein demonstrate that YB-1 mediated signalling sustains a TIC population.  Given that our in vitro model of trastuzumab resistance, BT474LT, has increased levels of activated RSK and YB-1 and that the BT474 YB-1S102D recapitulates a phenotype similar to the HR5 and HR6 cells, the RSK/YB-1 pathway should be further investigated for its role in the maintenance of TICs.  To assess RSKs activation of YB-1 and the resulting impact on the TIC population, it would be of interest to characterize mammosphere formation efficiency and CD44 levels in BT474 cells expressing myr-RSK (described above).  In addition, CD44 levels and the propensity for mammosphere formation should be evaluated following RSK inhibition with either siRNA and/or BI-D1870 in both the in vivo models of acquired resistance as well as those established in vitro to ascertain RSKs involvement in TICs.  Korkaya et al have demonstrated that expression of HER2 in normal mammary epithelial cells increases the expression of ALDH and also increases mammosphere formation efficiency.  Further to this, they also showed that a number of stem cell regulatory genes are upregulated with HER2 over-expression (Korkaya et al., 2008).  Lastly, they demonstrate that in trastuzumab resistant cell lines, drug treatment has no effect on altering the percentage of ALDH cells, suggesting that trastuzumab has no influence on these stem like cells.  Contrary to our results regarding CD44 in trastuzumab sensitive cells, they show that trastuzumab is capable of decreasing ALDH positive cells in sensitive models (Korkaya et al., 2008).  Therefore, to further supplement our current set of data, it would also be interesting to evaluate ALDH1 levels in the sensitive BT474 and resistant HR5 and HR6 cell lines and query whether enzyme levels correlate to the CD44 status.    In addition, to further assess our current hypothesis, it would be valuable to perform a Fluorescent Activated Cell Sort (FACS) analysis for CD44 in the BT474 cells and assess cell growth of the sorted populations after exposure to trastuzumab.  Also, the P-YB-1S102 levels 103  should be compared in the CD44-/low and CD44+ populations of BT474 cells and these populations should then be assessed for mammosphere formation and the sphere formation efficiency of the CD44+ population should be compared to that of the HR5 and HR6 resistant models.  Further to this, it would be expected that mammosphere formation would be inhibited in the CD44-/low population as the tumour initiating capacity of the cell fraction is eliminated.   Beyond being a positive marker for tumour-initiating cells, functional roles for CD44 have also been described in ovarian cancer (Bourguignon et al., 1997a), acute myeloid leukemia (Jin et al., 2006), and breast cancer (Marangoni et al., 2009).  We also demonstrate that trastuzumab treatment amidst CD44 inhibition decreases cell viability in the BT474, HR5, and HR6 cells.  This in part may be due to a loss in HER2-CD44 receptor interaction.  Previous studies have indicated that HER2 and CD44 physically interact with one another and in fact in the JIMT-1, trastuzumab resistant cell line, high CD44 levels correlate with a decreased rate of HER2 downregulation with trastuzumab (Nagy et al., 2005; Palyi-Krekk et al., 2007; Robinson et al., 2006).  They also demonstrate that inhibiting CD44 with siRNA enhances the effects of trastuzumab.  Thus, it would be of interest to investigate receptor interactions in the HR5 and HR6 cells, first via a preliminary immunofluorescence screen followed by co-immunoprecipitation studies.  To further evaluate CD44 and HER2 interactions, live cell imaging technology could be utilized to investigate the receptor interactions in real time with and without trastuzumab treatment.  In addition, flow cytometric fluorescence resonance energy transfer (FRET) analysis can also be used to evaluate associations between the two receptors.  104  Lastly, to substantiate our proposed model of acquired trastuzumab resistance, a correlation to clinical outcome would be essential.  At present, there exists a tumour microarray (TMA) prepared by Dr. Karen Gelmon, composed of 153 cases of HER2 positive breast cancers treated with trastuzumab (Robinson et al., 2006).  Staining consecutive slices of the TMA block for P-YB-1S102 and CD44 and correlating protein expression to various clinical outcomes such as survival and relapse would validate our novel mechanism.  CD44 expression has been previously associated with poor prognosis in breast cancer (Liu et al., 2007b; Shipitsin et al., 2007), lung cancer (Liu et al., 2007b), and prostate cancer (Liu et al., 2007b; Noordzij et al., 1997).  Contradictory to this, CD44 expression has also been linked to a favourable clinical outcome in patients with ovarian cancer (Sillanpaa et al., 2003), while a study suggests that CD44 expression is implicated in metastasis with no influence on clinical outcome in breast cancer (Abraham et al., 2005).  At present, no study has evaluated CD44 expression in prospective breast tumour samples; hence the importance of evaluating P-YB-1S102 and CD44 expression in these samples and correlating it to clinical behaviour.  This would provide further impetus to target these factors in the clinical setting.  Albeit, CD44 is an essential factor in normal cells where it is involved in haematopoiesis, the immune system, and organogenesis; its over-expression is associated with pathology (Ponta et al., 2003).  Further to this, transgenic CD44 null mice are fully viable with a slightly perturbed phenotype (Schmits et al., 1997).  Therefore, interfering with its expression would not be expected to have robust effects in normal cells.  More importantly, given that YB-1 expression is limited to disease and its regulation of a number of established oncogenes, it serves as an ideal target for cancer therapy.   105  STAT3 and acquired trastuzumab resistance Another point of discussion is the function of STAT3 in trastuzumab resistance.  STAT3 has previously been associated with resistance to chemotherapy by its induction of BCL2 (Real et al., 2002) and MDR1 (Bourguignon et al., 2008a).  Interestingly, a study describing trastuzumab induced apoptosis mediated by a reduction in MCL-1 expression gained our attention as MCL1 is a STAT3 target gene (Henson et al., 2006).  Since we have linked STAT3 signalling to YB-1 (Chapter Two), it was worth investigating the transcription factor in acquired resistance.  We show that the HR5 and HR6 cells have increased levels of P-STAT3S727 in comparison to the sensitive BT474 cells, however mTOR levels do not correlate with the levels of activated STAT3, suggesting it is not associated with the elevated P-STAT3S727 levels in the resistant cell lines.  Furthermore, following trastuzumab treatment activated STAT3 levels are sustained in the resistant cell lines whereas they decrease in the sensitive cell line (Appendix V).  We therefore attempted to induce resistance in the BT474 cell by transfection of a constitutively active mutant of STAT3, referred to as STAT3C.  To our surprise, STAT3C was incapable of rescuing the BT474 cells from trastuzumab induced growth inhibition (Appendix V).  However, we explored this with transient transfections and the generation of a cell line that stably expresses STAT3C may provide better insight into STAT3’s ability to confer resistance.  Given that STAT3C functions as an active P-STAT3Y705 mutant, it may be necessary to use a P-STAT3S727 mutant where the serine residue is mutated to a glutamic acid to assess the significance of the serine 727 site of STAT3 in trastuzumab resistance.  On another note, breast cancer stem like cells require P-STAT3S727 for viability (Zhou et al., 2007).  In addition, neural stem cells also rely on P-STAT3S727 in a NOTCH dependent manner (Androutsellis-Theotokis et al., 2006).  The association of STAT3 with stem like cells suggests that it may also be involved in promoting drug resistance by its involvement in regulating crucial genes in these cell types.  Furthermore, 106  STAT3 has been shown to function in collaboration with CD44 to induce cyclin D (Lee et al., 2009) as well as MDR1 (Bourguignon et al., 2008b).  Although STAT3 may not be directly associated with mediating trastuzumab resistance, it may play a role in sustaining the TICs responsible for drug insensitivity.  Therefore, it would be interesting to compare gene expression signatures in the BT474, HR5, and HR6 cell lines following trastuzumab treatment by a ChIP-on-chip analysis to understand genes which remain activated or are induced by STAT3.  In addition, it would be interesting to FACS sort BT474 cells for CD44 and assess P-STAT3S727 in the high and low populations to determine if it correlated to TICs in the model under study.  4.3 CONCLUSION We have demonstrated the requirement of YB-1 in HER2 over-expressing breast cancers.  This collection of work describes a novel mechanism where YB-1 mediates resistance to trastuzumab by inducing a tumour-initiating phenotype through its regulation of CD44.  Taken together, our data suggest that YB-1 would be good candidate for therapeutic targeting to improve the clinical efficacy of trastuzumab.          107  REFERENCES Abraham BK, Fritz P, McClellan M, Hauptvogel P, Athelogou M, Brauch H. (2005). Prevalence of CD44+/CD24-/low cells in breast cancer may not be associated with clinical outcome but may favor distant metastasis. Clin Cancer Res 11: 1154-1159. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. (2003). Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100: 3983-3988. Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW et al. (2006). Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 442: 823-826. Astanehe A, Finkbeiner MR, Hojabrpour P, To K, Fotovati A, Shadeo A et al. (2009). The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene 28: 2406-2418. Balana ME, Labriola L, Salatino M, Movsichoff F, Peters G, Charreau EH et al. (2001). Activation of ErbB-2 via a hierarchical interaction between ErbB-2 and type I insulin-like growth factor receptor in mammary tumor cells. Oncogene 20: 34-47. Berishaj M, Gao SP, Ahmed S, Leslie K, Al-Ahmadie H, Gerald WL et al. (2007). Stat3 is tyrosine-phosphorylated through the interleukin-6/glycoprotein 130/Janus kinase pathway in breast cancer. Breast Cancer Res 9: R32. Bourguignon LY, Peyrollier K, Xia W, Gilad E. (2008a). Hyaluronan-CD44 interaction activates stem cell marker nanog, stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem 283: 17635-17651. Bourguignon LY, Peyrollier K, Xia W, Gilad E. (2008b). Hyaluronan-CD44 interaction activates stem cell marker nanog, stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem 283: 17635-17651. Bourguignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. (1997a). Interaction between the adhesion receptor, CD44, and the oncogene product, p185HER2, promotes human ovarian tumor cell activation. J Biol Chem 272: 27913-27918. Bourguignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. (1997b). Interaction between the adhesion receptor, CD44, and the oncogene product, p185HER2, promotes human ovarian tumor cell activation. J Biol Chem 272: 27913-27918. Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C et al. (1999). Stat3 as an oncogene. Cell 98: 295-303. Chang JC, Wooten EC, Tsimelzon A, Hilsenbeck SG, Gutierrez MC, Tham YL et al. (2005). Patterns of resistance and incomplete response to docetaxel by gene expression profiling in breast cancer patients. J Clin Oncol 23: 1169-1177. 108  Chung J, Uchida E, Grammer TC, Blenis J. (1997). STAT3 serine phosphorylation by ERK-dependent and -independent pathways negatively modulates its tyrosine phosphorylation. Mol Cell Biol 17: 6508-6516. Chute JP, Muramoto GG, Whitesides J, Colvin M, Safi R, Chao NJ et al. (2006). Inhibition of aldehyde dehydrogenase and retinoid signaling induces the expansion of human hematopoietic stem cells. Proc Natl Acad Sci U S A 103: 11707-11712. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L et al. (1999). Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17: 2639-2648. Creighton CJ, Li X, Landis M, Dixon JM, Neumeister VM, Sjolund A et al. (2009). Residual breast cancers after conventional therapy display mesenchymal as well as tumor-initiating features. Proc Natl Acad Sci U S A 106: 13820-13825. Dean M, Fojo T, Bates S. (2005). Tumour stem cells and drug resistance. Nat Rev Cancer 5: 275-284. Ding Q, He X, Hsu JM, Xia W, Chen CT, Li LY et al. (2007). Degradation of mcl-1 by beta-TrCP mediates glycogen synthase kinase 3-induced tumor suppression and chemosensitization. Mol Cell Biol 27: 4006-4017. Evdokimova V, Ovchinnikov LP, Sorensen PH. (2006a). Y-box binding protein 1: Providing a new angle on translational regulation. Cell Cycle 5: 1143-1147. Evdokimova V, Ruzanov P, Anglesio MS, Sorokin AV, Ovchinnikov LP, Buckley J et al. (2006b). Akt-mediated YB-1 phosphorylation activates translation of silent mRNA species. Mol Cell Biol 26: 277-292. Falcioni R, Antonini A, Nistico P, Di Stefano S, Crescenzi M, Natali PG et al. (1997). Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp Cell Res 236: 76-85. Fernandes A, Hamburger AW, Gerwin BI. (1999). ErbB-2 kinase is required for constitutive stat 3 activation in malignant human lung epithelial cells. Int J Cancer 83: 564-570. Fillmore CM, Kuperwasser C. (2008). Human breast cancer cell lines contain stem-like cells that self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res 10: R25. Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y et al. (2009). Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene 28: 1421-1431. 109  Fujita T, Ito K, Izumi H, Kimura M, Sano M, Nakagomi H et al. (2005). Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res 11: 8837-8844. Garcia R, Yu CL, Hudnall A, Catlett R, Nelson KL, Smithgall T et al. (1997). Constitutive activation of Stat3 in fibroblasts transformed by diverse oncoproteins and in breast carcinoma cells. Cell Growth Differ 8: 1267-1276. Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown M et al. (2007). ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1: 555-567. Goldsmith ME, Madden MJ, Morrow CS, Cowan KH. (1993). A Y-box consensus sequence is required for basal expression of the human multidrug resistance (mdr1) gene. J Biol Chem 268: 5856-5860. Gritsko T, Williams A, Turkson J, Kaneko S, Bowman T, Huang M et al. (2006). Persistent activation of stat3 signaling induces survivin gene expression and confers resistance to apoptosis in human breast cancer cells. Clin Cancer Res 12: 11-19. Guertin DA, Sabatini DM. (2007). Defining the role of mTOR in cancer. Cancer Cell 12: 9-22. Habibi G, Leung S, Law JH, Gelmon K, Masoudi H, Turbin D et al. (2008). Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res 10: R86. Henson ES, Hu X, Gibson SB. (2006). Herceptin sensitizes ErbB2-overexpressing cells to apoptosis by reducing antiapoptotic mcl-1 expression. Clin Cancer Res 12: 845-853. Higashi K, Inagaki Y, Fujimori K, Nakao A, Kaneko H, Nakatsuka I. (2003). Interferon-gamma interferes with transforming growth factor-beta signaling through direct interaction of YB-1 with Smad3. J Biol Chem 278: 43470-43479. Iwamaru A, Szymanski S, Iwado E, Aoki H, Yokoyama T, Fokt I et al. (2007). A novel inhibitor of the STAT3 pathway induces apoptosis in malignant glioma cells both in vitro and in vivo. Oncogene 26: 2435-2444. Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. (2006). Targeting of CD44 eradicates human acute myeloid leukemic stem cells. Nat Med 12: 1167-1174. Khoury H, Naujokas MA, Zuo D, Sangwan V, Frigault MM, Petkiewicz S et al. (2005). HGF converts ErbB2/Neu epithelial morphogenesis to cell invasion. Mol Biol Cell 16: 550-561. Konnikova L, Kotecki M, Kruger MM, Cochran BH. (2003). Knockdown of STAT3 expression by RNAi induces apoptosis in astrocytoma cells. BMC Cancer 3: 23. Korkaya H, Paulson A, Iovino F, Wicha MS. (2008). HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion. Oncogene 27: 6120-6130. 110  Lee JL, Wang MJ, Chen JY. (2009). Acetylation and activation of STAT3 mediated by nuclear translocation of CD44. J Cell Biol 185: 949-957. Lee SO, Lou W, Qureshi KM, Mehraein-Ghomi F, Trump DL, Gao AC. (2004). RNA interference targeting Stat3 inhibits growth and induces apoptosis of human prostate cancer cells. Prostate 60: 303-309. Levy DE, Darnell JE,Jr. (2002). Stats: Transcriptional control and biological impact. Nat Rev Mol Cell Biol 3: 651-662. Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF et al. (2008). Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst 100: 672-679. Liu H, Ma Y, Cole SM, Zander C, Chen KH, Karras J et al. (2003). Serine phosphorylation of STAT3 is essential for mcl-1 expression and macrophage survival. Blood 102: 344-352. Liu JC, Deng T, Lehal RS, Kim J, Zacksenhaus E. (2007a). Identification of tumorsphere- and tumor-initiating cells in HER2/Neu-induced mammary tumors. Cancer Res 67: 8671-8681. Liu R, Wang X, Chen GY, Dalerba P, Gurney A, Hoey T et al. (2007b). The prognostic role of a gene signature from tumorigenic breast-cancer cells. N Engl J Med 356: 217-226. Lufei C, Koh TH, Uchida T, Cao X. (2007). Pin1 is required for the Ser727 phosphorylation-dependent Stat3 activity. Oncogene 26: 7656-7664. Magnifico A, Albano L, Campaner S, Delia D, Castiglioni F, Gasparini P et al. (2009). Tumor-initiating cells of HER2-positive carcinoma cell lines express the highest oncoprotein levels and are sensitive to trastuzumab. Clin Cancer Res 15: 2010-2021. Mao JH, Kim IJ, Wu D, Climent J, Kang HC, DelRosario R et al. (2008). FBXW7 targets mTOR for degradation and cooperates with PTEN in tumor suppression. Science 321: 1499-1502. Marangoni E, Lecomte N, Durand L, de Pinieux G, Decaudin D, Chomienne C et al. (2009). CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer 100: 918-922. Miller TW, Forbes JT, Shah C, Wyatt SK, Manning HC, Olivares MG et al. (2009). Inhibition of mammalian target of rapamycin is required for optimal antitumor effect of HER2 inhibitors against HER2-overexpressing cancer cells. Clin Cancer Res 15: 7266-7276. Nagy P, Friedlander E, Tanner M, Kapanen AI, Carraway KL, Isola J et al. (2005). Decreased accessibility and lack of activation of ErbB2 in JIMT-1, a herceptin-resistant, MUC4-expressing breast cancer cell line. Cancer Res 65: 473-482. Nam HJ, Kim S, Lee MW, Lee BS, Hara T, Saya H et al. (2008). The ERK-RSK1 activation by growth factors at G2 phase delays cell cycle progression and reduces mitotic aberrations. Cell Signal 20: 1349-1358. 111  Noordzij MA, van Steenbrugge GJ, Verkaik NS, Schroder FH, van der Kwast TH. (1997). The prognostic value of CD44 isoforms in prostate cancer patients treated by radical prostatectomy. Clin Cancer Res 3: 805-815. Palyi-Krekk Z, Barok M, Isola J, Tammi M, Szollosi J, Nagy P. (2007). Hyaluronan-induced masking of ErbB2 and CD44-enhanced trastuzumab internalisation in trastuzumab resistant breast cancer. Eur J Cancer 43: 2423-2433. Ponta H, Sherman L, Herrlich PA. (2003). CD44: From adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol 4: 33-45. Qin HR, Kim HJ, Kim JY, Hurt EM, Klarmann GJ, Kawasaki BT et al. (2008). Activation of signal transducer and activator of transcription 3 through a phosphomimetic serine 727 promotes prostate tumorigenesis independent of tyrosine 705 phosphorylation. Cancer Res 68: 7736-7741. Real PJ, Sierra A, De Juan A, Segovia JC, Lopez-Vega JM, Fernandez-Luna JL. (2002). Resistance to chemotherapy via Stat3-dependent overexpression of bcl-2 in metastatic breast cancer cells. Oncogene 21: 7611-7618. Reya T, Morrison SJ, Clarke MF, Weissman IL. (2001). Stem cells, cancer, and cancer stem cells. Nature 414: 105-111. Ritter CA, Perez-Torres M, Rinehart C, Guix M, Dugger T, Engelman JA et al. (2007). Human breast cancer cells selected for resistance to trastuzumab in vivo overexpress epidermal growth factor receptor and ErbB ligands and remain dependent on the ErbB receptor network. Clin Cancer Res 13: 4909-4919. Robinson AG, Turbin D, Thomson T, Yorida E, Ellard S, Bajdik C et al. (2006). Molecular predictive factors in patients receiving trastuzumab-based chemotherapy for metastatic disease. Clin Breast Cancer 7: 254-261. Sapkota GP, Cummings L, Newell FS, Armstrong C, Bain J, Frodin M et al. (2007). BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo. Biochem J 401: 29-38. Schmits R, Filmus J, Gerwin N, Senaldi G, Kiefer F, Kundig T et al. (1997). CD44 regulates hematopoietic progenitor distribution, granuloma formation, and tumorigenicity. Blood 90: 2217-2233. Shattuck DL, Miller JK, Carraway KL,3rd, Sweeney C. (2008). Met receptor contributes to trastuzumab resistance of Her2-overexpressing breast cancer cells. Cancer Res 68: 1471-1477. Shipitsin M, Campbell LL, Argani P, Weremowicz S, Bloushtain-Qimron N, Yao J et al. (2007). Molecular definition of breast tumor heterogeneity. Cancer Cell 11: 259-273. Sillanpaa S, Anttila MA, Voutilainen K, Tammi RH, Tammi MI, Saarikoski SV et al. (2003). CD44 expression indicates favorable prognosis in epithelial ovarian cancer. Clin Cancer Res 9: 5318-5324. 112  Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. (1987). Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235: 177-182. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE et al. (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244: 707-712. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A et al. (2001). Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344: 783-792. Sophos NA, Vasiliou V. (2003). Aldehyde dehydrogenase gene superfamily: The 2002 update. Chem Biol Interact 143-144: 5-22. Stein U, Bergmann S, Scheffer GL, Scheper RJ, Royer HD, Schlag PM et al. (2005). YB-1 facilitates basal and 5-fluorouracil-inducible expression of the human major vault protein (MVP) gene. Oncogene 24: 3606-3618. Stein U, Jurchott K, Walther W, Bergmann S, Schlag PM, Royer HD. (2001). Hyperthermia-induced nuclear translocation of transcription factor YB-1 leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 276: 28562-28569. Stratford AL, Habibi G, Astanehe A, Jiang H, Hu K, Park E et al. (2007). Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res 9: R61. Tan M, Lan KH, Yao J, Lu CH, Sun M, Neal CL et al. (2006). Selective inhibition of ErbB2-overexpressing breast cancer in vivo by a novel TAT-based ErbB2-targeting signal transducers and activators of transcription 3-blocking peptide. Cancer Res 66: 3764-3772. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L et al. (2002). Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20: 719-726. Wen Z, Zhong Z, Darnell JE,Jr. (1995). Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82: 241-250. Wu J, Lee C, Yokom D, Jiang H, Cheang MC, Yorida E et al. (2006). Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 66: 4872-4879. Yarden Y, Sliwkowski MX. (2001). Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2: 127-137. Yokogami K, Wakisaka S, Avruch J, Reeves SA. (2000). Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol 10: 47-50. 113  Yuan ZL, Guan YJ, Chatterjee D, Chin YE. (2005). Stat3 dimerization regulated by reversible acetylation of a single lysine residue. Science 307: 269-273. Zhou J, Wulfkuhle J, Zhang H, Gu P, Yang Y, Deng J et al. (2007). Activation of the PTEN/mTOR/STAT3 pathway in breast cancer stem-like cells is required for viability and maintenance. Proc Natl Acad Sci U S A 104: 16158-16163.                 114  APPENDICES  Appendix I   Figure I.  Investigation of activated STAT3 in a panel of breast cancer cell lines.  Immunoblot analysis of whole cell lysates of six HER2 positive breast cancer cell lines (BT474, HR5, HR6, BT474-m1, AU565, and MDAMB 453) demonstrates expression of P-STAT3S727, while P-STAT3Y705 is absent.  P-STAT3Y705 expression is limited to the MDAMB 231 cell line, which is a model of basal like breast cancer.          115  Appendix II  FIGURE II.  mTOR and ERK phosphorylate STAT3 at Serine 727.  BT474-m1 cells were treated with 40nM of Rapamycin for 24 hours or PD98059µM for 6 hours.  Protein levels were then assessed by immunoblotting.  P-STAT3S727 levels decreased with the inhibition of both mTOR and ERK.  Furthermore, MCL-1 protein levels also decreased with a reduction in P-STAT3S727.             116  Appendix III   Figure III.  RSK inhibition induces apoptosis.  BT474, HR5, and HR6 cells were transfected with 20nM of control siRNA or RSK1 and RSK2 siRNA for 96 hours.  Immunoblot demonstrates an induction of apoptosis with loss of RSK.             117  Appendix IV    Figure IV.  BT474 LT cultures resistant to trastuzumab have elevated levels of CD44.  BT474 were continuously treated with trastuzumab (20µg/mL) for over thirty days, cells escaping treatment were labelled BT474 LT.  A.  q-RT-PCR of BT474 and BT474 LT show increased CD44 transcript levels in the resistant variants.  B.  Cells grown on glass coverslips were fixed and stained for CD44.  BT474 LT, trastuzumab resistant cell lines demonstrate increased CD44 protein levels.     A B 118  Appendix V   Figure V.  Investigation of STAT3 in trastuzumab resistance.  A.  BT474, HR5, and HR6 cells were evaluated for P-STAT3S727 and P-mTORS2448 levels by immunoblotting.  B.  The trastuzumab resistant HR5 and HR6 cell lines were transfected with control siRNA or siSTAT3 and protein levels were assessed 72 hours post transfection.  Inhibition of STAT3 induced apoptosis in both resistant cell lines.   C.  BT474, HR5, and HR6 cells were treated with trastuzumab (20µg/mL) for 72 hours.  Following, P-STAT3S727 levels were investigated by immunoblotting.  The drug resistant, HR5 and HR6 cells express higher levels of P-STAT3S727 in comparison to the BT474 cell line.  Furthermore, activated STAT3 levels are sustained following trastuzumab treatment in the trastuzumab resistant cell lines while levels decrease in the sensitive BT474 cells.  D.  Trastuzumab sensitive BT474 cells were transiently transfected with 2µg of EV or Flag-STAT3C.  24 hours following DNA transfection, growth media was supplemented with 20µg/mL of trastuzumab, and cells were cultured for an additional 72 hours.  Next, cells were fixed and stained with Hoechst and analyzed by the Cellomics ArrayScan VTI.  Expression of STAT3C was not able to rescue the sensitive BT474 cells from trastuzumab.   A B C D 

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 45 0
Germany 1 7
Singapore 1 0
City Views Downloads
Washington 36 0
Ashburn 5 0
Unknown 5 7
Wilmington 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069973/manifest

Comment

Related Items

Admin Tools

To re-ingest this item use button below, on average re-ingesting will take 5 minutes per item.

Reingest

To clear this item from the cache, please use the button below;

Clear Item cache