Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

CIS-regulatory integration of intrinsic transcription factors with target-derived signals in neuronal.. Tang, Chung Yiu Jonathan 2009-12-31

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2009_fall_tang_chungyiu.pdf [ 6.59MB ]
Metadata
JSON: 24-1.0069953.json
JSON-LD: 24-1.0069953-ld.json
RDF/XML (Pretty): 24-1.0069953-rdf.xml
RDF/JSON: 24-1.0069953-rdf.json
Turtle: 24-1.0069953-turtle.txt
N-Triples: 24-1.0069953-rdf-ntriples.txt
Original Record: 24-1.0069953-source.json
Full Text
24-1.0069953-fulltext.txt
Citation
24-1.0069953.ris

Full Text

C/S-REGULATORY INTEGRATION OF INTRINSIC TRANSCRIPTION FACTORS WITH TARGET-DERIVED SIGNALS IN NEURONAL DIFFERENTIATION by Chung Yiu Jonathan Tang B.Sc, The University of British Columbia, 2007 A THESIS SUMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Cell and Developmental Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August 2009 © Chung Yiu Jonathan Tang, 2009  ABSTRACT We now know that expression of the appropriate terminal differentiation gènes (TDG), such as neuropeptides, neurotransmitters, ion channels, et cetera, in maturing neurons is controUed by cell-specific combinations of transcription factors and by signais secreted from the neurons' target cells. However, it is unclear how thèse two regulatory inputs are integrated inside neurons. In Drosophila, target-derived Bone Morphogenetic Protein (BMP) signais and a wellcharacterized combinatorial code of transcription factors activate expression of the FMRFa gène in the Tv neurons. Hère, I performed a cz's-regulatory analysis of FMRFa in order to understand how the two factors functionally intersect. Mutant analysis reveals that 4 of the 7 known FMRFa regulators, Apterous, BMP signalling, Dachshund and Zfhl, ail regulate the expression of the Tv enhancer, a 446 bp cw-regulatory élément that faithfully reproduces FMRFa expression in the Tv neurons. Within the Tv enhancer, I identified a functional module, termed HD/BRE-A, that is predicted to respond to both BMP signalling and the homeodomain transcription factor Apterous. I also verified that Apterous and the BMP factors, Mad and Medea, can directly bind to HD/BRE-A in vitro. Furthermore, transgenic analyse indicate that the positioning between the Apterous and Medea binding site is critical for Tv enhancer activation, suggesting a strict physical requirement for simultaneous association of thèse factors. Taken together, my results supports a model of czs-regulatory intégration of BMP signaling and homeodomain transcription factors in the régulation of TDGs.  ii  TABLE OF CONTENTS Abstract Table of contents List of figures Acknowledgements Dedication  ii iii v vi vii  1. Introduction 1 1.1. Neuronal spécification of BMP-dependent gènes in the Drosophila nervous System 1 1.1.1. Gaps exist in our knowledge of neuronal terminal differentiation 1 1.1.2. Significance 1 1.2. Background/Literature review 2 1.2.1. Neuronal terminal differentiation 2 1.2.2. Drosophila as a model to study neuronal terminal differentiation 3 1.2.3. Neuronal diversity mediated by single target-derived signais 4 1.2.4. The BMP pathway 4 1.2.5. Functional intersection between HD TFs and the BMP/TGF-p pathway 6 1.2.6. FMRFa, a well-characterized BMP-dependent neuropeptide 7 1.2.7. Tvenhancer 8 1.3. Rationale/Hypothesis/Objectives 9 2. Materials and methods 10 2.1. Fly genetics 10 2.2. Molecular biology/Transgene construction 10 2.2.1. pHS mCherry-nls attB 10 2.2.2. Tvwt-nEYFP and TvmutX-nEYFP attB 11 2.2.3. Insulated Tv-nEYFP.nls attB 12 2.2.4. Tv-mCherry in pGL3 for S2 cell transfection 12 2.2.5. HA-Ap in pAct5.1 13 2.2.6. GST-LIMless Ap in bacterial vector 13 2.3. EMSA/protein synthesis 13 2.4. Irnmunohistochemistry/Confocalimaging 13 2.4.1. Immunohistochemistry protocol 13 2.4.2. Confocal imaging and analysis procédure 14 2.5. Co-immunoprecipitation 14 2.6. Bioinformatics 14 3. Results: Basic Characterization of the Tv enhancer 17 3.1. An integrase-based Tvwt-nEYFP reporter to study the c/s-regulation of FMRFa... 17 3.1.1. Expression oîTvwt-nEYFP 17 3.2. The Tv enhancer is BMP-dependent and responsive to combinatorial transcriptional régulation 20 3.2.1. BMP pathway 20 3.2.2. Apterous 20 3.2.3. Dachshund 21 iii  3.2.4. Zfhl 21 3.2.5. Eyes absent 21 wt 3.2.6. Apterous and Dachshund can induced ectopic expression oîTv -nEYFP 21 3.3. Summary 22 4. Results: Identification of a putative BMP-responsive élément 25 4.1. Conservation of séquences that are putative homeodomain-Smad intégration sites 25 4.2. Functional analysis of predicted HD/BRE modules 30 4.3. Functional analysis of predicted Mad binding sites 30 4.4. Summary of bioinformatics and HD/BRE analysis 31 5. Results: Transgenic analysis of HD/BRE-A 33 5.1. Detailed analysis of HD/BRE-A 33 5.1.1. Mad-A and HD-A 33 5.1.2. Med-A is a functional motif 34 5.1.3. Relative spacing between HD/BRE-A binding motifs is critical for wildtype Tvactivation 37 5.2. Summary 38 6. Results: Biochemical characterization of HD/BRE modules 40 6.1. Apterous, Mad and Medea bind appropriate HD/BRE séquences in vitro 40 6.1.1. Overview 40 6.1.2. Apterous 40 6.1.3. Mad 40 6.1.4. Med 41 6.1.5. Summary 42 6.2. Apterous fail to co-immunoprecipitate with Mad or Medea in vitro 45 6.3. Summary 45 7. Discussion 47 7.1. Cw-regulatory intégration of BMP signalling and Apterous at the Tv enhancer ....47 7.2. Mechanism of czs-regulatory intégration at the Tv enhancer 48 7.2.1. Apterous and BMP signalling 48 7.2.2. Dachshund and Zfhl 50 7.3. A collaborative mechanism of cz's-regulatory intégration between BMP signalling and Apterous? 51 7.4. Future questions 52 7.5. Conclusion 53 Bibliography 54 Appendices 62 Appendix A - FMRFa/Tv enhancer related images 62 Appendix B - Tv-nEYFP data analysis tables 68 Appendix C - Tv mutant constructs and primers 75 Appendix D - EMSA oligonucleotides 81 Appendix E - EMSA- related figures 87 Appendix F - Proctolin 89 Appendix G - Dilp 7 97 Appendix H - Bioinformatics 99 iv  LIST OF FIGURES  Figure 1.1. The BMP signalling pathway 6 Figure 1.2. Neuronal identity is determined by intrinsic and extrinsic factors 8 Figure 3.1. Schematic représentation of pHS Tv-nEYFP attB and the integrase system 18 Figure 3.2. Tv-nEYFP is a faithful reporter oîFMRFa expression 19 Figure 3.3. The Tv enhancer is regulated by BMP signalling and the FMRFa transcription factor code 23 Figure 3.4. Misexpression of Apterous and Dachshund induces ectopic Tv-nEYFP expression 24 Figure 4.1. Phylogenetic conservation of the Tv enhancer 27 Figure 4.2. Séquence comparison of the Tv enhancer between 12 Drosophila species 28 Figure 4.3. Detailed alignment of HD/BRE-A/B/C of the Tv enhancer 29 Figure 4.4. Expression analysis of hétérozygote Tv-nEYFP reporters 32 Figure 5.1. Every élément in the identified HD/BRE-A module is important for Tv-nEYFP expression 36 Figure 5.2. Spacing between predicted Mad, Apterous and Medea binding sites is critical for normal Tv expression 39 43 Figure 6.1. Apterous, Mad and Medea can ail associate specifically with HD/BRE-A Figure 6.2. Compétition assay showing séquence specificity in Apterous and Mad binding ....44 Figure 6.3. Apterous failed to co-immunoprecipitate Mad or Medea in BMP-active, S2 cells .46 Figure 7.1. Model: Intersection of BMP signalling with Apterous at the Tv enhancer 53  v  ACKNOWLEDGEMENTS Spécial thanks to Dr. Douglas Allan for re-igniting my passion for science. I thank my lab members, particularly Marc Ridyard, for co-operating with me on the FMRFa/proctolin/dilp7 projects. I thank Hugh Brock and Michael Underhill for critically reading the manuscript. I thank Allan Laughon, Stefan Thor for plasmids. I thank Eric Jan for providing space and radioactive materials for EMSA. I thank Jacob Hodgson for assistance with the ChIP experiments. I thank Kailun Jiang for assistance with protein purification and molecular cloning. I thank the Bamji and Loewen labs for sharing of reagents and work space. This work was supported by a graduate research award from the Canadian Institutes of Health Research.  VI  DEDICATION  Dedicated to my parents, Joe and Mary.  vii  1. Introduction 1.1. Neuronal spécification of BMP-dependent gènes in the Drosovhila nervous svstem 1.1.1. Gaps exist in our knowledge of neuronal terminal differentiation Neuronal identity is marked by the gène expression profiles of neurons. When a neuron exits the cell cycle, it has been fated to become a spécifie neuronal subtype, but it has not completely achieved terminal differentiation, as defîned by the expression of gènes important for mature neuronal function. Thèse gènes, hereafter referred to as terminal differentiation gènes (TDGs), include neuropeptides, neurotransmitters, neurotransmitter biosynthetic enzymes, ion channels, et cetera. In gênerai, TDGs médiate neuronal communication through their influence on synaptic transmission, neuropeptide/neurotransmitter processing and sécrétion, etc. The activation of thèse gènes occurs throughout the life of a neuron and dépends on the neuron's intrinsic complément of transcription factors (TFs), as well as extrinsic signais derived from target cells. The intégration of thèse two inputs results in the cell-specific expression of TDGs in the nervous system. Despite this knowledge, we know very little about how thèse two inputs integrate to specify TDG expression. Since extrinsic target-derived signalling and intrinsic transcription factors primarily regulate gène activity at the transcriptional level, a c/s-regulatory analysis of target gènes may reveal gênerai mechanisms of TDG spécification in post-mitotic neurons. 1.1.2. Significance To date, almost nothing is known about how post-mitotic neurons convert target-derived signais into spécifie profiles of TDG expression. It is crucial to gain a better understanding of this process because many brain diseases arise from defects in synaptic connections. Thèse defects can in turn resuit in the dysregulation of TDGs. For example, the expression of neuropeptides and neuropeptide-processing enzymes are disrupted in the brains of Alzheimer's disease patients (Saito et al., 2005; Saito et al., 2003). Likewise, the onset of Schizophrenia has been linked to abnormal changes in the expression of neuropeptides and neurotransmitters (Boules et al., 2007; Lewis and Levitt, 2002; Stephan et al., 2006). Thus, by studying the interaction between TFs and target-derived signais in their régulation of TDGs, we can gain 1  insights into the mechanism behind dysregulation of TDG expression. This new knowledge can be applied to the design of préventive and therapeutic treatments of many brain diseases. 1.2. Background/Literature Review 1.2.1. Neuronal terminal differentiation The acquisition of entire sets of TDGs is a prolonged process that occurs over the lifetime of a neuron and dépends on intrinsic and extrinsic factors (Edlund and Jessell, 1999; Hippenmeyer et al, 2004; Koo and Pfaff, 2002). Intrinsicallv, TFs, inherited from neuronal precursors or activated at the time of a neuron's birth, can dictate a neuron's differentiation program. TFs are DNA binding proteins involved in gène régulation. They act by binding to spécifie séquences, or motifs, in the c/s-regulatory régions of gènes. This in turns lead to the activation, de-repression or silencing of gènes, depending on the molecular context. Thus, the cell-specific expression of many neuronal gènes can be attributed to the sélective activation of TFs in subset of neurons (Hobert and Westphal, 2000; Hunter and Rhodes, 2005; Jessell, 2000; Shirasaki and Pfaff, 2002). Homeodomain-type TFs play a particularly critical rôle in this process (Briscoe and Novitch, 2008; Dasen et al., 2005; Landgraf and Thor, 2006; Shirasaki and Pfaff, 2002; Skeath and Thor, 2003; Thaler et al., 2004). A simplistic view of TDG régulation in post-mitotic neuron cornes from studies in C.elegans. In this organism, which has only 302 neurons, only one or two TFs are required for a neuron's entire répertoire of TDGs (Etchberger et al., 2007; Wenick and Hobert, 2004). However, in higher organisms such as Drosophila (-300,000 neurons) and mammals (billions of neurons), combinations of 5-10 TFs may be required to activate a TDG in spécifie cells (Allan et al., 2005; Allan et al., 2003; Jorgensen et al, 2004). Some of thèse TFs may cluster into modules at the cw-regulatory régions of TDGs, thereby increasing the specificity of gène expression in the nervous system (Jorgensen et al., 2004). Others TFs may control TDG expression through indirect ways, such as through the control of axon pathfinding, and the ability to sensé target-derived signais (Allan et al., 2003). Besides TFs, TDG activation can also require extrinsic signais derived from target cells. Thèse rétrograde signais help to shape a neuron's properties to ensure functional compatibility between pre- and post-synaptic cells. Signalling molécules such as TGF-p/Bone Morphogenetic Proteins (BMP), neurotrophins, and cytokines are ail target-derived signais important for the  proper differentiation of maturing neurons (Allan et al., 2003; Ernsberger and Rohrer, 1999; Hippenmeyer et al., 2004; Nishi, 2003; Xu and Hall, 2006). They act via the activation of signalling pathways which affect many gène regulatory mechanisms in a cell. Notably, the same signalling pathway may control the transcriptional activation of différent TDGs in différent neuronal contexts, suggesting interplay between target-derived signalling and cell-specifïc transcription factor codes (Coulombe and Kos, 1997; Coulombe and Nishi, 1991; Pavelock et al., 2007). Thus, a key to understanding the diversification of TDG expressions in the nervous System is the mechanistic knowledge of the interplay between intrinsic and extrinsic factors. 1.2.2. Drosophila as a model to study neuronal terminal differentiation Attempts to address thèse problems require manipulation of signalling pathways and TF expression. This has been met with many technical problems in vertebrates, as mutations of TFs and signalling components (pertinent to this study) often resuit in embryonic lethality or aberrant spécification of neuronal populations (Harrison et al., 1999; Lechleider et al., 2001; Monuki et al., 2001; Oppenheim, 1989; Pfaff et al., 1996; Sheng et al., 1996; Sirard et al, 1998; Sofroniew et al., 2001; Thaler et al., 1999; Tremblay et al., 2001; Yang et al, 1998). Drosophila melanogaster is an idéal model organism for this objective because disruption of signalling pathways and TFs pertinent to this study do not always lead to embryonic lethality or neuronal lineage re-specification (Allan et al., 2005; Allan et al., 2003; Benveniste et al., 1998; MiguelAliaga et al., 2004). In cases where embryonic lethality does occur, measures can be taken to allow for embryo survival up to the developmental stage of interest. Drosophila possesses a much simpler nervous system than mammals, making it easier to study individual neurons. To illustrate, the late embryonic/larval Drosophila ventral nerve cord (VNC) consists of-10,000 neurons, whereas mammalian nervous Systems are estimated to hâve between millions to billions of neurons. Moreover, the gènes and mechanisms of neuronal terminal differentiation are well-conserved between invertebrates and vertebrates (Arendt, 2005; Arendt and Nubler-Jung, 1996, 1999; Thor and Thomas, 2002), including the rôle of targetderived signais Bone Morphogenetic Protein (BMP) signalling (Allan et al., 2003; Hodge et al., 2007; Nishi, 2003) (Figure 1.1). Furthermore, the availability of a wide variety of genetic tools and databases make it very convenient to study individual neurons in Drosophila. To illustrate, a large collection of GAL4 drivers is available in the fly community. Thèse drivers allow for the  cell-specific expression of UAS-transgene or RNAi in overexpression or knockdown experiments (Brand and Perrimon, 1993; Dietzl et al., 2007; Duffy, 2002). Lastly, the récent advent of an optimized transgenesis System utilizing the phiC31 integrase has reduced the time and workload needed to generate numerous transgenic flies (Bischof et al., 2007). This System allows for site-specific intégration of transgenes into genomic DNA, making it idéal for direct comparison of enhancer-reporter variants. 1.2.3. Neuronal diversity mediated by single target-derived signais One of the key questions surrounding neuronal differentiation has to do with how a common target-derived signal induces différent responses in différent neurons. A survey across vertebrate species showed that signais conducted through the same pathway can be interpreted in différent ways by différent neurons (Coulombe and Kos, 1997; Coulombe and Nishi, 1991; Pavelock et al., 2007). This apparent dilemma may be explained by différences in the complément of TFs that are expressed in différent neurons. However, it remains a mystery as to how neuron-specific TFs integrate with the same target-derived signais to turn on différent TDGs. To address this issue, our laboratory has recently identified numerous BMP-dependent TDGs that are expressed in différent subsets of neurons, and regulated by différent combinations of cell-specifically-expressed TFs. 1.2.4. The BMP pathway BMP ligands are well-conserved members of the TGF-P family of signalling molécules (Schmierer and Hill, 2007J. In neurons, BMPs are important for intercellular communication, synaptic growth, and neurotransmitter release in vertebrates (Ai et al., 1999; Guha et al., 2004; Hall et al., 2002; Hodge et al., 2007; Lee-Hoeflich et al., 2004; Pavelock et al., 2007; Shen et al, 2004; Sun et al., 2007; Withers et al., 2000; Xu and Hall, 2006) and in Drosophila (Aberle et al., 2002; Allan et al., 2003; Eaton and Davis, 2005; Marques et al., 2002; McCabe et al., 2003; Rawson et al., 2003). Canonical transduction through the BMP signalling pathway is well characterized and well conserved (Fig. 1.1) (Affolter et al., 2001; Massague and Gomis, 2006; Massague et al., 2005; Massague and Wotton, 2000; Schmierer and Hill, 2007; Shi and Massague, 2003). In Drosophila neurons, BMP signalling is initiated when the target-derived BMP ligand Glass bottom boat (Gbb) binds to the type-II BMP receptor Wishful Thinking (Wit) 4  (Allan et al., 2003). This ligand-receptor interaction results in the recruitment and phosphorylation of the type-I BMP receptor Saxophone (Sax) or Thickveins (Tkv). The type-I receptor then proceeds to phosphorylate the cytoplasmic Smads, Mothers against decapentalplegic (Mad), to generate phosphoMad (pMad) (Fig. 1.1). Phosphorylation of Mad is believed to expose its nuclear localization signal and allow for nuclear localization through interactions with Importin-B (Xiao et al., 2000). pMad can interact with the common-nonphosphorylated Smad, Medea, to form the pMad/Medea complex. The pMad/Medea complex then translocates into the nucleus, where it elicits transcriptional response. pMad/Medea acts as a TF, which binds Mad (GRCGNC) and Medea (GTCT) binding motifs (together called BMP response élément, or BRE) (Gao and Laughon, 2007; von Bubnoff et al., 2005). pMad and Medea are well described to bind DNA somewhat weakly and often require interactions with additional TFs (Affolter et al., 2001; Attisano and Wrana, 2000; Gao and Laughon, 2007; Massague and Wotton, 2000; Shi and Massague, 2003; Wotton and Massague, 2001). Such interactions not only increase DNA binding affinity but also increase target gène specificity. Therefore, it is conceivable that the BMP signal may be diversified by the interaction of pMad/Medea with différent TFs in différent neurons.  5  Extracellular  Figure 1.1. The BMP signalling pathway. A BMP ligand is bound to the tetrameric receptor complex comprised of Type II and Type I BMP receptors. Upon binding to the ligand, the type II receptor phosphorylates the Type I receptor, which then goes on to phosphorylate Mad, generating pMad. Phosphorylation exposes the NLS of Mad and allows for its nuclear localization through interactions with Importin-B. pMad then binds to Medea to become pMad/Medea, which is translocated into the nucleus and induces transcriptional response.  1.2.5. Functional intersection between HD TFs and the BMP/TGF-p pathway Homeodomain-containing (HD) TFs make up a family of DNA-binding proteins that is involved in ail stages of developmental hierarchy in a wide range of species, and notably play a critical rôle in nervous System development (Briscoe and Novitch, 2008; Dasen et al., 2005; Landgraf and Thor, 2006; Shirasaki and Pfaff, 2002; Skeath and Thor, 2003; Thaler et al., 2004). Common to this family of proteins is an evolutionarily conserved DNA-binding domain that generally binds to the TAATNN consensus séquence (Berger et al., 2008; Noyés et al., 2008). Amongst HD TFs, additional specificity is conferred by their differential préférences for variants of this basic HD-binding séquence (Berger et al., 2008; Noyés et al., 2008; Svingen and Tonissen, 2006). 6  Récent studies hâve pointed to a rôle for HD TFs as co-factors for the BMP pathway (Brugger et al., 2004; Faresse et al., 2008; Grocott et al., 2007; Lamba et al., 2008; Li et al., 2006; Suszko et al., 2008; Walsh and CarroU, 2007; Zhou et al., 2008). Enhancer analysis on the BMP-dependent msx2 gène in mouse showed that a phylogenetically conserved séquence containing closely associated BRE and HD séquences was able to induce BMP-dependent gène expression not only in its host species, but also in Drosophila (Brugger et al., 2004). Similarly, a tight coupling of BRE and HD was also found in the BMP-dependent sal gène in Drosophila (Walsh and CarroU, 2007). The spacing between BRE and HD is crucial for fonction, as demonstrated by the loss of reporter activity when thèse two motifs are physically separated (Walsh and CarroU, 2007). Using a séries of bandshift assays and loss-of-function experiments, Walsh and CarroU (2007) former showed that the sal regulator Ubx, a HD TF, can indeed bind to the sal enhancer through the aforementioned HD motif. Taken together, thèse fmdings suggest an evolutionarily conserved partnership between homeodomain and BMP (via pMad and Medea) signalling in gène régulation. However, it is still unclear what the relationship is between thèse two TFs in BMP-dependent neuronal differentiation, and which HD factors may interact with BMP signais in the terminal steps of neuron-specific differentiation.  1.2.6. FMRFa, a well-characterized BMP-dependent neuropeptide FMRFa was the fîrst BMP-dependent neuropeptide found in the Drosophila ventral nerve cord (VNC) (Allan et al., 2003). FMRFa is notably expressed in a group of 6 neurons termed the Thoracic ventral (Tv) neurons (Fig.3.2) (Schneider et al., 1993). At embryonic stage 17, the Tv neurons establishes axonal connection with the neurohemal organ, which in turns secrètes the retrogradely-transported BMP-ligand Gbb to activate the expression of FMRFa in the Tv neurons. FMRFa is regulated by a unique Tv neuron-specific TF code that includes the LIM-HD TF apterous (ap), the basic Helix-loop-Helix TF dimmed (dimm), dachshund (dac), eyes absent (eyà) the Zinc finger TF squeeze (sqz) and the zinc-fïnger homeodomain TF zinc flnger homeodomain 1 (zjhl) (Allan et al., 2005; Allan et al., 2003; Miguel-Aliaga et al., 2004; Vogler and Urban, 2008) (Fig. 1.2). Amongst thèse TFs, apterous is of particular interest because it is the only TF in the 'FMRFa combinatorial code' that is required in ail TF combinations known to induce ectopic FMRFa expression. In addition, thèse TF combinations fail to trigger ectopic FMRFa expression in a wit mutant background, suggesting a requirement 7  for BMP signalling in Apterous activation of FMRFa (Allan et al., 2005; Allan et al., 2003; Miguel-Aliaga et al., 2004). Whether there is a connection between BMP-signalling and any of the intrinsic FMRFa regulators remain unknown.  1.2.7. Tv enhancer Previously, a 446 bp FMRFa enhancer was identified to be sufficient for Tv-neuron expression of FMRFa (Benveniste et al., 1998), hereafter referred to as the Tv enhancer. Lossof-function genetic experiments indicate that apterous and zfhl can regulate expression of the Tv enhancer (Benveniste et al., 1998; Vogler and Urban, 2008). In the Tv enhancer, three predicted HD binding sites are bound by Apterous in vitro and at least two of them are essential for reporter activity in vivo. In this work, thèse sites will be denoted as HD-A, HD-B and HD-C, in accordance with previous work (Benveniste et al., 1998). Despite this understanding, it is unknown whether the Tv enhancer is also regulated by target-derived BMP signalling, or by other TFs of the FMRFa combinatorial code.  Figure 1.2. Neuronal identity is determined by intrinsic and extrinsic factors. Hère, the target-derived signal (BMP ligand, light blue circle) is converted into a signal transducer (pMad) in the Thoracic ventral (Tv) neuron. This signal transducer translocates into the nucleus, where it intégrâtes with a combinatorial TF code (Dimmed (Dim), Ap (Ap), Squeeze (Sqz), Zfhl and Dachshund (Dac) to turn on the neuropeptide FMRFa. Détails of pMad formation and translocation in described in Figure 1.1. 8  1.3. Rationale/Hypothesis/Obiectives FMRFa is the best characterized target-dependent TDG in any model System. Thus, it is most ready for an in-depth czs-regulatory analysis to understand how TDGs are controlled by target-derived signalling and intrinsic transcription factors. Since BMP signalling and FMRFa intrinsic transcription factor codes primarily regulate gène expression at the transcriptional level, I propose that they integrate at the cz's-regulatory régions of FMRFa. Notably, I propose that the homeodomain transcription factor Apterous is a key integrator with BMP signalling due to its central rôle in FMRFa activation and its ability to directly bind the Tv enhancer. The Tv enhancer provides a convenient tool to test our ideas because it narrows down FMRFa régulation in the Tv neurons to a 446 bp DNA fragment. In this thesis, I hypothesize that BMP signalling acts directly with Apterous at the Tv enhancer to cell-specifically regulate the expression of FMRFa. My project aimed to: 1.) Détermine whether BMP signalling régulâtes the Tv enhancer. 2.) If so, identify the BMP-responsive éléments in the Tv enhancer and their relationship to Apterous-responsive éléments. 3.) Examine the ability of the BMP-activated molécules to associate with the Tv enhancer, and with Apterous.  9  2. Materials and methods 2.1. Flv Genetics The following fly stocks were used: w1118; apterous: ap  44  (a, P élément P{GawB}  insertion 5bp upstream of the apterous promoter, a strong hypomorphic allele referred to hère as a / ^ ( 0 ' K e e f e et al., 1998)), a/44 (amorphic apterous allele (Bourgouin et al, 1992)), UASapterous (Allan et al., 2003); wishful thinking: wif412 (null allele, nonsense point mutation before transmembrane domain (Marques et al., 2002)); wi^11 (point mutant that acts as a genetic null (Marques et al., 2002)); dachshund: dac (amorphic allele due to 25kb insertion (Tavsanli et al., 2004)), Df(2L) Exel7086 (a dac deficiency, hère referred to as dacDf), UAS dac (MiguelAliaga et al., 2004); eyes absent: eycF1 (nonsense mutation that acts as strong hypomorphic allele (Bui et al., 2000), eyacll'IID (nonsense mutation that acts as a genetic null (Bui et al., 2000); zflil: zfh00865 (a P élément P{PZ) insertion 52bp upstream of the promoter of the longest transcript that is known to be a protein null in Tv neurons (Justice et al., 1995; Vogler and Urban, 2008)); Enhancer trap Une OK6GAU that expresses GAL4 in most if not ail motorneurons (Aberle et al., 2002); Tv-enhancer FMRFa-lacZ transgenic insert pWF-E17 (Benveniste et al., 1998); Tv-nEYFP wildtype and mutant reporter flies were injected into flies bearing an attP acceptor site at P2 (Chr 3) by Genetics Services Inc, Cambridge, MA; (www.geneticservices.com). attP2 was found to provide optimal reporter activity over two other sites, attPlô and attP40 (see Appendix A). The integrase Unes were maintained as homozygous stocks. Mutants were kept over CyO, Actin-GFP or TM3, Ser, Actin-GFP balancer chromosomes. w i;iS was typically used as a control. Ail crosses were maintained at 25 C on standard cornmeal food. 2.2. Molecular Biology/Transgene Construction 2.2.1. pHS mCherry-nls attB was constructed in the following way: The loxP-UAS-MCSSV40polyA cassette was excised from the pUAST attB vector (Bischof et al., 2007) by Nhel and Spel sites, and the backbone overhangs were filled-in using Klenow fragment. The blunt-ended vector was then ligated with an EcoRV-loxP-MCS-hsp70TATA-nuclear mCherry-early SV40 10  polyA-attB-Swal cassette, made as described below. The MCS-hsp70TATA-nuclear mCherryearly SV40 polyA portion of the pH mCherry vector (C.Y.J.T, Allan lab; generated from pHStinger (Barolo et al., 2004)) was fused to the attB portion of pUAST attB using splicing by overlap extension (Horton et al., 1990) Amplification of the fused product was done using a 5' primer carrying an EcoRV-loxP-MluI overhang, and a 3' primer containing a Swal-Zral overhang. Several improvements were made to the loxP/attB backbone to facilitate a more diverse range of cloning tasks. First, three unique restriction sites were introduced: 1.) a MluI site was placed between the loxP and MCS région. 2.) an Avril site was engineered between the SV40 early polyadenylation signal and attB séquence. 3.) a Zral site was placed immediately 3' of the attB séquence. Second, three commonly used restriction sites, BamHI, Nhel and Spel were turned into unique sites in this new vector. Notably, Spel is now positioned immediately 5' of the SV40 early polyadenylation signal, allowing for convenient exchange of reporters when used in concert with the unique Agel site, located immediately 5' of the mCherry gène.  Primers for generating EcoRV-loxP-MCS-hsp70TATA-nuclear mCherry-early SV40 polyAattB-Swal cassette are as follows: l st segment: 2 nd  5'-GTGTGTGTGCTAGCATAACTTCGTATAATGTATGCTATACGAAGT TATACGCGTGCATGCTGCAGCAGATCTGGTCT - 3' 5' - ATACATTGATGAGTTTGGACAAACC -3' segment: 5 ' - GTCCAAACTCATCAATGTATCCTAGGGTCGACGATGTAGGTCAC GG-3'  5' - CCCCATTTAAATGACGTCGTCGACATGCCCGCCGTGAC - 3' Fused product: 5' - CGCCGGGGATATCATAACTTCGTATAATGTATG - 3' 5' - CCCCATTTAAATGACGTCGTCGACATGCCCGCCGTGAC 2.2.2. Tvwt-nEYFP and Tvmutx-nEYFP attB. The 446 bp Tv ds-regulatory fragment was amplified from genomic DNA (Oregon R) and engineered to hâve Xbal and EcoRI restriction sites on the 5' and 3' ends, respectively. This fragment was cloned into Xbal and EcoRI digested pHS mCherry-nls attB, generating pHS Tv-mCherry.nls attB. However, this reporter was found to be weakly expressed in transgenic flies. Thus, mCherry.nls was excised from the pHS-Tv-mCherry-nls-attB vector through Agel and Spel restriction sites, and the remaining backbone was ligated to an nEYFP.nls fragment carrying 5'-AgeI and 3'-SpeI overhangs, generating pHS-Tv-nEYFP-nls-attB, hère referred to as Tvwt-nEYFP. Subséquent mutant il  constructs, Tvm-nEYFP,  were ail cloned into this construct via replacement of the wildtype Tv  séquence through Xbal and EcoRI restriction sites. AU Tv mutant fragments were generated by PCR-basedmutagenesis. TvmMadA/B/c was the first mutant generated and conveniently served as the template for many single- and double- mutant combinations. Primers used to generate ail mutants are listed in Appendix C, Table C.2.  2.2.3. Insulated Tv-nEYFP.nls attB. Using pStinger (Barolo et al., 2004) as a PCR template, the 5' insulator élément was amplified and engineered to carry 5'-MluI and 3'BglII restriction sites while the 3' insulator élément was amplified and engineered to carry 5'-Avril and 3'-SpeI restriction sites. The MluI/BglII digested 5' insulator PCR product was cloned into the MluI/BglII restriction sites in pHS-Tv-nEYFP-nls-attB. The résultant vector was then digested with Avril and ligated with the AvrII/Spel digested 3' insulator PCR product. Both insulator éléments were inserted in the same orientation relative to the MCS-reporter cassette as that in pStinger.  Primers for insulator éléments 5' insulator: 3 ' insulator:  5' - TTTTACGCGTATGCATCACGTAATAAGTGTGCG- 3' 5' _ TTTTCCAGATCTGCTGCAGCATGC - 3' 5 ' - TTTTCCTAGGCACGTAATAAGTGTGCGT - 3 ' 5' - GGGGACTAGTAATTGATCGGCTAAATGG - 3'  2.2.4. Tv-mCherry in pGL3 for S2 cell transfection - To construct the Tv-mCherry.nls reporter, the -1.1 kb Tv-hsp70TATA-mCherry.nls fragment was amplified from pHS-TvmCherry (unpublished CYJT, Allan Lab) and engineered to be flanked by HindIII/Xbal restriction sites. This fragment was used to replace the HindlII-Zwc-Xbal fragment in pGL3, generating pGTv-nmC. To generate the Tv mutant mCherry constructs, mutant fragments were excised from the pHS Tv mutant nEYFP-attB vector via Xbal/Xho I restriction digest while the wildtype Tv fragment was excised from the pGTv-mC via Nhel/Xhol restriction digest. The Xbal-Tv mutant-XhoI fragment is then ligated to the Nhel-pHS-NEYFP-attB-XhoI backbone, producing the corresponding Tv mutant mCherry vectors. Wildtype and mutant Tv cisregulatory fragments were excised from their respective nEYFP-attB vectors by digestion with Xbal/Xhol, and cloned into the pG-mCherry.nls. 12  2.2.5. HA-Ap in pAct5.1 - The HA-tagged Apterous cDNA construct for expression in S2 cells was made from cloning a Kpnl/Xbal fragment excised from pCDNA3M-HA-Ap (Linda Jurata) into the Kpnl/Xbal restriction sites in the pAct vector (a gift from Eric Jan, UBC). 2.2.6. GST LIMless Ap in bacterial vector - In order to minimize interférence from the LIM domain on Ap DNA binding in vitro, a truncated, LIM-less Ap coding séquence (Benveniste et al., 1998) flanked by EcoRI/BamHI sites was amplified by PCR from pCDNA3M-HA-Ap (Linda Jurata) and cloned into pGEX-2TK via the EcoRI/BamHI restriction sites. 2.3. EMSA/Protein Svnthesis GST-MadN, GST-LIMless Ap and MBP-MedN were expressed in Rossetta bacteria cells, purified under non-denaturing conditions and dialyzed into storage buffer of 20mM HEPES pH 7.8 (25.6 degrees), 50mM KCl, ImM DTT, and 10% glycerol. Aliquots were stored in -80 degrees until use. EMSA probes were made from annealing of complementary single stranded oligonucleotides, followed by end-labelling with gamma P32 ATP (Amersham Biosciences) using T4 Kinase. Probes were purified using Centrispin-20 séparation columns (Princeton Séparations) and counted for radioactivity. Rabiolabelled probes (50,000 cpm) were incubated with purified proteins in a solution containing 20mM HEPES pH 7.8, 50mM KCl, ImM DTT, lmg/ml BSA, 0.25mM EDTA. As an exception, 50ng poly dldC-dldC was included in EMSA reactions involving HA-LIMLess Ap to reduce non-specific binding. After 30 minute incubation at room température, samples were loaded onto a pre-run 5% polyacrylamide gel at 100V, and then electrophoresed at 200V at room température for approximately 25 minutes in 0.5X TBE buffer. Gels were exposed to phosphor screens (Molecular Dynamics) and imaged on phosphoimager (Typhoon). Ail probe séquences used are listed in the appendix. 2.4. Immunohistochemistry/Confocal Imagine 2.4.1. Immunohistochemistry protocol The following antibodies were used: anti-FMRFa (1:500) (Peninsula Laboratories Inc.), anti-p-Galactosidase clone 40-la (1:100), anti-Eyes absent (1:100) (both from the 13  Developmental Studies Hybridoma Bank). Immunolabeling was carried out using standard protocols as previously described (Allan et al., 2003). 2.4.2. Confocal imaging and analysis procédure Ail images were acquired on an Olympus FV1000 confocal microscope as multiple TIFF files representing individual Z-stacks. Ail images for comparison were taken from tissues that were processed simultaneously, mounted on the same slide, and imaged with identical confocal settings, using Nyquist optics and setting the high/low so as not to saturate the most intense fluorescent pixels. To count numbers of Tv neurons expressing Tv-nEYFP, we only included VNC's in which ail six Tv neurons were identified (using anti-FMRFa immunoreactivity). Of thèse, we analyzed Z-stacked images and counted the number of nEYFP-expressing Tv neurons by eye. For measurement of fluorescence intensity, we imaged every identified Tv neuron (using anti-FMRFa immunoreactivity) in each CNS collected. Raw files were imported into Image J (US National Institutes of Health) for analysis. For each Tv neuron, we compressed ail Z-slices spanning whole Tv neurons using the Z-projector function, set to sum the pixel intensities from each Z-slice. Each Tv neuron was outlined and the mean of the summed pixel intensity for each neuron was measured. Background fluorescence intensity was corrected for by subtracting a directly adjacent région of background (of equal size to the Tv neuron) from the same summed Z-stack for each Tv neuron. The resulting value for each Tv neuron was then incorporated as a single datum point towards the mean fluorescence intensity for each experiment. To normalize data across multiple time points and génotypes, we further expressed each datum point as a percentage of the mean of the Tvwt-nEYFP control for that experiment. 2.5. Co-imnmnoprecipitation One and a half million S2 cells were transiently transfected with 0.3ug per plasmid type of pAct5.1-HA-Ap, pAct5.1-FLAG-Mad, pAct5.1-myc-Medea and pAc5.1-TkvQD (generous gifts from Konrad Basler) in a 6 well plate using Effectene (Invitrogen). Forty-eight hours after transfection, cells were lysed on ice for 30 minutes in 50mM Tris-HCl pH 8.0,150mM NaCl, 1% NP40, 2mM EDTA plus protease inhibitors and Phosstop phosphatase inhibitors (Roche). After pelleting of cell débris, the supernatants were isolated and pre-cleared with protein A/G sepharose beads for 1 hour at 4 degrees Celsius, lOOOug of cell lysate was then used for 14  immunoprecipitation of HA-Apterous with Oug or 2ug of rabbit anti-HA (ab9110, AbCam) overnight at 4 degrees Celsius. On the second day, protein A/G sepharose beads were added to immunoprecipitated antibody-antigen complexes for 2 hours at 4°C. This was followed by washes in cell lysis buffer and then boiling of beads to elute immunoprecipitated products in 2x SDS loading buffer. Samples were then loaded for western blot analysis, using 1:500 rat antiHA (3F10, Roche), 1:1000 mouse anti-FLAG (M2, Sigma), 1:500 mouse anti-myc (9E10, Sigma).  2.6. Bioinformatics The Tv-enhancer séquence was derived from Release r5.18 (May 29, 2009) of the D.melanogaster génome (downloaded from FlyBase) and is situated at Chromosome 2R: 5792874..5793318. Evoprinter was utilized to rapidly identify the top three non-overlapping BLAT alignments of the D.melanogaster Tv-enhancer séquence in the génomes of ail 12 sequenced Drosophilid species (Odenwald et al., 2005; Yavatkar et al., 2008). For each eBLAT that aligned to the D.melanogaster Tv enhancer pièce, we performed both a BLAST search (in Flybase) and a BLAT search (in UCSC Browser) of that séquence on the pertinent species' génome. We then examined whether that séquence was near the FMRFa gène for that species. For every species, only the l st BLAT was in the vicinity of the FMRFa for each génome, and in ail cases was found 5' of the FMRFa gène. Thèse are ail shown in Appendix G. To account for potential annotation failures of additional FMRFa gènes, that may lie within the région of eBLAT2 or 3 séquences, we performed TBLASTN 2.2.21 (NCBI), using the D.melanogaster FMRFa full length amino acid séquence as a query, to uncover additional FMRFa gènes. The répétitive nature of this polypeptide (with multiple FMRFGR/K motifs) makes it simple to verify true versus false low identity "hits". In every case, only one FMRFa gène was found in each génome and BLAT2/3 séquences were not found to be in the proximity of that FMRFa gène. Thèse data, utilizing the sequenced génomes currently available for each Drosophila species, suggest that the Tv enhancer has not been subjected to rearrangement or duplication throughout the évolution of Drosophila, spanning D.melanogaster to D.grimshawi. Thèse data further establish that the Tv enhancer is upstream of the FMRFa gène in ail species. UCSC Browser (http://genome.ucsc.edu/cgi-bin/hgGatewav'), Galaxy (http://main.g2.bx.psu.edu/), and a stand-alone downloaded version of the ClustalX graphical 15  interface (Chenna et al., 2003; Larkin et al., 2007) were utilized for séquence alignments of the Tv-enhancer from the twelve Drosophila species. The D.melanogaster Tv-enhancer coordinates (Chr 2R: 5792874..5793318) was input into the UCSC Browser génome browser search. From the génome browser, we extracted séquences via the Table Browser using the following criteria: Région: Position Chr2R: 5792874-5793318 Group: Comparative Genomics; Track: Conservation; Table: Multizl5way, with the output set to MAF and sent directly to Galaxy. In Galaxy, the MAF format was converted into FASTA. The Tv-enhancer comprises two distinct MAF blocks. Thèse were concatenated using the "FASTA manipulation>Concatenate FASTA alignment by species" command. The output generated was saved as a .txt file and uploaded into ClustalX to view aligned séquences. Alignments shown in Fig.4.3.were 50bp fragments of the Tv enhancer downloaded from the Génome Browser using the PDF/PS Tab and downloaded as a .pdf file. Thèse were then coloured in Preview to highlight spécifie séquence features and selected for upload into this document using Grab.  16  3. Results: Basic Characterization of the Tv enhancer 3.1. An integrase-based Tvwt-nEYFP reporter to studv the cis-regulation of FMRFa In order to dissect the cz's-regulation of FMRFa in the Tv neurons, I turned to a detailed analysis of the 446 bp Tv-enhancer (Benveniste et al., 1998). I utilized the <J)C31 integrase-based transgenesis System for my transgenic analysis (Bischof et al., 2007). This methodology targets injected transgenes (carrying the attB séquence) to a spécifie genomic location (containing the attP séquence), for stable germline transmission. Since ail wildtype and mutant reporters are integrated into the same genomic locus, position effects are controlled for, and allow for reliable comparison between wildtype and mutant reporter activities. To utilize this system, I generated a transformation plasmid containing an attB séquence for site-specific intégration into genomic attP sites, and a nuclear-localized EYFP (nEYFP) reporter placed downstream of the hsp70 minimal promoter (Fig. 3.1 A). Ail wildtype and mutant Tv-enhancer séquences (See Appendix C for séquences) were sub-cloned into this plasmid as EcoPJ/Xbal fragments and placed upstream of the minimal promoter. The wildtype Tv reporter will be referred to as TV*-nEYFP, while mutant Tv reporters will be referred to as TvmutX-nEYFP, with mutrdenoting the nature of the mutation. I screened numerous well-characterized attP intégration sites (see Methods and Materials) and found that attP2 (Groth et al., 2004) provided optimal reporter expression with minimal background, as previously reported (Markstein et al., 2008) (see Appendix A, Figure A.l). Accordingly, ail subséquent experiments were conducted with nEYFP reporters inserted into the attP2 locus (Fig. 3.1 B). Contrary to reports that gypsy insulator éléments hâve a positively acting effect on reporter expression levels (Markstein et al., 2008), an insulated TvwtnEYFP construct (see Materials and Methods) did not show significant différence in activity from the non-insulated version, suggesting that the effects reported may be cell-specific or transgene-specific (data not shown). This issue was not pursued any further. 3.1.1. Expression of Tvwt-nEYFP The expression of Tvwt-nEYFP in early larval stage 1 (Ll) larvae was highly restricted to Tv neurons, as defined by co-labelling for anti-FMRFa, and was observed in 5.8±0.1 Tv neurons per VNC (n= 72 VNC's) (Fig. 3.2). Like the endogenous peptide, Tv^-nEYFP expression persists throughout the larval stages and is also détectable in adults (Eade and Allan, 2009) (see 17  Appendix A, Figure A.2). Taken together, thèse results indicate that Tv-nEYFP is a faithful reporter oîFMRFa  expression in the Tv neurons.  A. white  loxP  Tv enhanoer  SV40 early polyA  hsp70 nuclear TATA eYFP  attB  \  B.  '•! J 1  Avr II  3™ chromosome  ^•^^W^TH^™^  î<* chromo SOIDB  F i g u r e 3.1 Schematic représentation of pHS Tv-nEYFP attB and the integrase System.  A. Map of pHS Tv-nEYFP attB showing the main features in the following order, starting from 5' to 3'. Unique restriction sites introduced to this vector are underlined. B. Site-specifïc intégration of pHS Tv-nEYFP attB into genomic attP site (attP2). Slanted lines represent points where flanking séquences are omitted from the Figure.  18  Tv nEYFP  TO LL  cr  2  Bi  LL __>_ —-i  ç  <  Figure 3.2. Tv-nEYFP is a faithful reporter oîFMRFa expression. Projected confocal stack through the Drosophila Ll ventral nerve cord (VNC) expressing nEYFP driven from the Tv-enhancer {Tv-nEYFP; green) and immunostained with anti-FMRFa (blue). (Top panel) Overlaid image of Tv-nEYFP and anti-FMRFa shows perfect overlap of both signais in the Tv neurons, indicating that the Tv-nEYFP reporter is a faithful reporter oîFMRFa expression. (Bottom panels) Split fluorophore images, showing individual fluorescent image for Tv-nEYFP (left panel) and FMRFa peptide (right panel). Note that anti-FMRFa also detects a set of medial neurons termed the SE neurons. SE neurons are not BMP-dependent nor are they regulated by the Tv-specific combinatorial code.  19  3.2. The Tv enhancer is BMP-dependent and responsive to combinatorial transcriptional régulation. In order to détermine whether the Tv enhancer is a suitable tool for studying the cisregulatory interplay between target-derived BMP signalling and Tv neuron-specific transcription factor codes, we tested the responsiveness of Tvwt-nEYFP to regulators previously found to regulate endogenous FMRFa expression. In ail cases, I utilized anti-Eyes absent or anti-FMRFa immunoreactivity to visualize the Tv-cluster in each thoracic hemisegment (Miguel-Aliaga et al., 2004). Data summary and statistical analysis of ail experiments in this section can be found in Appendix B, Figure B.l.  3.2.1. BMP pathway Wishful thinking is a BMP type II receptor shown to be essential for FMRFa expression (see Introduction). In wishful thinking null mutants (wi^^/wit811), Tvwt-nEYFP expression was eliminated, being observed in 0.0±0.0 Tv neurons per VNC (n= 10 VNC's, P=4.9 x 10"23 compared to +/+ control) (Figure 3.3 B and C). I obtained similar results with a Tv-lacZreporter (Benveniste et al., 1998) (see Appendix A, Figure A.3). This indicates that, similar to the endogenous peptide, Tv-nEYFP expression is dépendent on target-derived BMP signalling.  3.2.2. Apterous In a strong apterous mutant background (apGAL4/apP44), Tvwt-nEYFP was severely affected (Fig. 3.3 E), being observed in 0.7±0.3 Tv neurons per VNC (n= 10 VNC's, P=5.2 x 10" 15  compared to +/+ controls). Interestingly, Tvwt-nEYFP was expressed in 3.0±0.4 Tv neurons  per VNC (n= 10 VNC's, P=1.9 x 10"7 compared to +/+ control) in a heterozygous apterous mutant background (apGAL4/+), indicating that apterous is haploinsufficient for Tv-nEYFP expression (Fig. 3.3 D). Haploinsufficiency for apterous was not observed with endogenous FMRFa expression and a previously-studied Tv-lacZ reporter (Allan et al., 2003; Benveniste et al., 1998), suggesting that the heterozygous Tv**-nEYFP reporter provides a sensitive readout for screening regulators of FMRFa in the Tv neurons.  20  3.2.3. Dachshund Dachshund (Dac) is a FMRFa regulator that can trigger ectopic expression of the peptide when mis-expressed with opterous in post-mitotic neurons of the Drosophila nervous System (Miguel-Aliaga et al., 2004). In null dac mutants (Df(2L)Exel7086/dac3), Tvwt-nEYFP expression was slightly reduced, being observed in 4.8±0.2 Tv neurons per VNC (n= 14 VNC's, P=0.0012 compared to controls) (Fig. 3.3 G). This is reminiscent of the slight down-regulation of FMRFa peptide in dac mutants (Miguel-Aliaga et al., 2004). However, as was the case for apterous mutants, Tvwt-nEYFP was more sensitive than the endogenous peptide was to dac mutation (Miguel-Aliaga et al., 2004). Furthermore, 7Vw'-72.£YFP-expressing neurons displayed visibly weaker reporter activity in dac mutant background than in wildtype background (+/+ or Df(2L)Exel7086/+) (Fig. 3.3 F, G). Taken together, thèse results suggest that Dac is a moderate regulator of the Tv enhancer.  3.2.4. Zfh 1 Zfhl was previously shown to regulate the expression of FMRFa and the Tv-lacZ reporter (Vogler and Urban, 2008). I verified that Tv enhancer expression is dépendent on Zfhl, as Tvwt-nEYFP is expressed in 0.7±0.6 Tv neurons per VNC (n=9 VNC's, P=5xl0" n compared to controls) m a zfhl hypomorphic mutant background (zfhom5/zjh00865) (Fig. 3.3 I).  3.2.5. Eyes absent Next, I examined whether Eyes absent régulâtes the Tv enhancer. Hère, I tested the eya mutant combination (eyaE1/eyaCh'IID) and found that embryos failed to reach late 17/larval stages, the critical time window for analyzing FMRFa activation. Given the hypersensitivity of TvwtnEYFP, I analyzed Tvwt-nEYFP expression in a hétérozygote eya mutant background (eyaEl/+) and found no significant différence compared to wildtype (data not shown). Further expérimentation will be needed to détermine the effect of this TF on Tv expression. 3.2.6. Apterous and Dachshund can induce ectopic expression of Tvwt-nEYFP Next, I tested whether apterous and/or dachshund is sufficient for Tv enhancer activation by mis-expressing combinations of apterous and/or dachshund in post-mitotic motor neurons (Miguel-Aliaga et al., 2004) using the OK6-GAL4 driver (Aberle et al., 2002). I found that 21  whereas mis-expression ofopterons alone failed to trigger any ectopic neurons (0.0±0.0 neurons per VNC (n= 2 VNC's), mis-expression oîapterous and dachshund, or dachshund alone in motorneurons triggered significant ectopic expression oîTv-nEYFP, being observed in 74.3±3.8 neurons per VNC (n= 3 VNC's, P=0006 compared to controls) and 51.0±6.2 Tv neurons per VNC (n= 3 VNC's, P=0.008 compared to controls), respectively (Fig. 3.4 A-D). Mis-expression oîapterous and dachshund is more potent than mis-expression of dachshund alone, as the combination triggered higher number of ectopic cells (P=0.03 between OK6 GAL4 x UAS dac and OK^14 x UAS ap, UAS dac) and visibly stronger ectopic nEYFP signais (Fig. 3.4 C, D). We also detected similar ectopic Tv-lacZ expression from mis-expression of Apterous and Dachshund in ail post-mitotic neurons, using the pan-neuronal GAL4 driver, elavGAL4~°155 (see Appendix A, Figure A.3.). Since mis-expression of dachshund alone could not ectopically activate an 8.0 kb FMRFa enhancer that includes the Tv enhancer (Miguel-Aliaga et al., 2004), my resuit could indicate that the Tv enhancer is hypersensitive to the positive regulatory effects of dachshund. Lastly, I also tested the ability of another FMRFa regulator, sqz, to activate ectopic Tv-nEYFP expression when misexpressed in combination with apterous, but failed to detect any ectopic effect (data not shown). 33. Summarv In summary, thèse results indicate that the Tv enhancer behaves in a similar manner to the endogenous FMRFa peptide in numerous key regards, and contains séquences required for both the gain-of-function and loss-of-function phenotypes conferred by manipulation of the BMP pathway and the FMRFa combinatorial code (Allan et al., 2005; Allan et al., 2003; Miguel-Aliaga et al., 2004). It should be noted that in ail mutants for ail gènes tested above, except eya, Tv neurons survive to the point of analysis and they properly innervate the neurohemal organ (Allan et al, 2003; Benveniste et al., 1998; Miguel-Aliaga et al., 2004; Vogler and Urban, 2008), suggesting that the decrease in reporter activity is caused by a gène regulatory defect rather than a cell-wide problem.  22  +/+  witA12/+  witA12/witB11  apGAL4/+  apGAL4/apP44  a. IL > ç >  h-  Figure 3.3. The Tv enhancer is regulated by BMP signalling and the FMRFa transcription factor code. Stacked projection of Ll larval VNC expressing one copy of Tvwt-nEYFP (green) in wildtype (A) and various mutant backgrounds (B-F). Tv-nEYFP expression is dépendent on BMP signalling, as shown in wit mutants (compare B with C). Tv-nEYFP is also dépendent upon apterous (compare A with D and E), dachshund (compare F with G), and zfhl (compare H with I). White font letters at bottom right corner of images represents number of nEYFP-positive neurons/Tv cluster ± S.E.M, as identified using either anti-Eya or anti-FMRFa. 23  W1118  UASAp  UAS Dac  UAS Ap, UAS Dac  a. LL.  >LU C  £ <  2 o Figure 3.4. Misexpression of Apterous and Dachshund induces ectopic Tv-nEYFP expression. Stacked projection of Ll larval CNS displaying Tv-nEYFP (green) expression pattern after misexpression of no transgene (A), UAS-ap (B), UAS-dac (C), or UAS-ap, UAS-dac (D), driven by OKÔ0^4. Whitefont numbers at bottom right corner of images indicate mean number of ectopic nEYFP-positive neurons counted in the VNC. S.E.M is also indicated.  24  4. Results: Identification of a putative BMP-responsive élément. 4.1. Conservation of séquences that are putative homeodomain-Smad intégration sites Since the Tv enhancer is BMP-dependent, it is possible that BMP signalling directly controls FMRFa transcription in the Tv neurons through Mad and/or Medea binding to this fragment (see Introduction). If this is true, then one would expect to find séquences corresponding to consensus Mad and/or Medea binding sites within the Tv enhancer. We further expected functional Mad/Medea binding sites to be evolutionarily conserved. Thus, we attempted to identify potential BMP-responsive éléments through conservation analysis of the Tv enhancer séquence (Fig. 4.1). C/s-regulatory éléments important for FMRFa expression in the Tv neurons are expected to be conserved throughout the ~50 million years of Drosophilid évolution; I confirmed FMRFa expression (using immunostaining for FMRFa) in the stereotypical Tv neurons (identifïed using anti-Eya immunostaining) in the CNS of the Drosophilid species D. ananassae, D. wiîlistoni and D. virilis (see Appendix A, Figure A.4) (Fig. 4.2 A) (Clark et al., 2007; Stark et al., 2007). We utilized many séquence alignment tools to analyze the Tv enhancer, but found two to be most useful for our analysis. Thèse are the UCSC génome browser (http://genome.ucsc.edu/cgi-bin/hgGateway) (Kuhn et al., 2007) and Evoprinter (http://evoprinter.ninds.nm.gov/evoprintprograrnHD/evphd.html) (Odenwald et al., 2005; Yavatkar et al., 2008). The UCSC génome browser provides a rapid display of best-match, pairwise alignments of the query séquence (eg. D.melanogaster Tv enhancer) to ail other Drosophila génomes, using blastz (Chiaromonte et al., 2002)). Thèse are displayed as multiple séquence alignments of ail twelve Drosophila species using multiz (Blanchette et al., 2004), and assessed for conservation (imaged as "mountains" that delineate degree of conservation) using phastCons (Siepel et al., 2005). Evoprinter performs three non-overlapping BLAT alignments (Kent, 2002) with a séries of modifications termed enhanced BLAT (eBLAT) (Yavatkar et al., 2008), with the output being the query séquence (eg. D.melanogaster Tv enhancer) colour-coded to highlight which bases are conserved across ail species selected in a search (Odenwald et al., 2005). One advantage of Evoprinter is the ability to 'test' the conservation of any combination of Drosophilid species, which assists in filtering out atypical non-alignment of séquences of 25  individual species, and to identify highly conserved, duplicated or rearranged séquences between species. Hère, I show the results of our analysis utilizing UCSC génome browser (Figs. 4.1, 4.3) and Evoprinter (Fig. 4.2) alignments, with the 446 bp Tv-enhancer as the input query for both. Notably, the three Apterous-binding HD motifs were found to be absolutely conserved throughout évolution, except for one base pair mismatch between Drosophila melanogaster and Drosophila willistoni at position 6 of the third HD motif. Importantly, we found that each of the three HD motifs is juxtaposed to a conserved séquence that matches the approximate consensus GSCGNC of a Mad-binding motif. Only one of those sites, HD-A, also has an adjacent Medea-binding site of the consensus GTCT (Gao and Laughon, 2007; von Bubnoff et al., 2005). This Medea-binding site is also conserved throughout Drosophila évolution, except for a single base-pair mismatch in D. ananassae. Together with the HD séquence, we dénote thèse three sites as HD/BRE-A, B and C. Importantly, HD/BRE-A was the most conserved module, in ail its constituent HD, Mad and Medea-binding séquences, as well as in their relative spacing. HD/BRE-B and HD/BRE-C were less well conserved in their putative Mad-binding séquences (Fig. 4.3).  26  A >D.melanogasterTv enhancerfull séquence CCATCTGCAGACGTGGTTTTCGAACGTATTTATATTGATTATGGGTGATCGTCA ACAAGAGCAGTGGACACCCAATAAACCTGTCCAAAAACCCGACACATTTCTGC CCAGTCATGCGTGGTGGACAATAGCCAAATGCCATTGATGAGACTCGTCTCCA AAACTTTGGCCTTTTGCCGGGCCGTAATTACAGACTTCCGTCTTTTGAACAGTT TTTTCAGCCCCACCCAAGAGTCGAGTCTTGAAAAGCTGGCTGGGATGGGGTGG TTTCGGGTGCTGGACGAGATGCCAGAGGCGCCACAATGTATCCTGTTACAGGT TACAGGGCCATAAAGCGCCATAAACGCCGCGACGGCAATGGCAATTAATAACG CATACGGACACGTAGTCGATCCACTGGCTAGAAGGCTAATTGGACGTGCCCGG CCAGGATGTCCCTGCTCAT  Overvieu of 2R  B  i i i 1m i i | i n n i i i i | i i i i i i n i | i i i n i i i i | i i i i i i i i i | i i n i n u | n i i i n i i | i i i i i i i i i | i i i n i i i i | i m u m | i i n i n i i > 1 n m ii >ii 11 m 11 I>I 11 m n 1 il 11im feh 7h 8h 9h ion u n 1211 i3M M M î a i 191 1711 îan 1911 2011 2m  t i m H i| m M iin| m i m i i] m m i n i m u m i| m n n  on  ih  ai  3h  4h  5h  111111 1  5794k Gène S p a n CG1441  1111  5795k  11111  1 1 ' ' ' 1 1 ' ' ' i>  5796k  5797k  57S  Fmrf  îlRNfl CG1441-RA O - O - a — CG1441-RB <-0—O— CDS CG1441-PB  Flïirf-RA n>  -a -a  1  1 *•  CG1441-PA BLHST  chraR::  5793000 I  5792950 I  100 bases ) — 5703QS0 I  579S100 I Gap- Locations  i  H  5703150 l  5793250 I  5703300 I  Gap Vour Saouencfl hom Blat Sfiflrcfi YourSeq I 12 Fiios. MosqutoJHon^vtee, Beette Muttiz Alignments & phastOanj  1 Al  d_slmutarH I d„sschefia I d_yakuba I dL«feeia I d ananassaeI d psôudoobscura I d_p«simi6s I d_willistoni I d_virils I d_mojnvBnsis I d_fprlmshawf I: a_gamblas a_melllfera  • Il I I  A^flLl •  Figure 4.1: Phylogenetic conservation of the Tv enhancer: (A) Full séquence of Tv enhancer from D.melanogaster in FASTA format (B) Screenshot from Flybase Génome Browser (2R:5788096..5798095) showing BLAST hit for the Tv-enhancer (2R: 5792874..5793318; grey bar) of D.melanogaster Tv enhancer séquence, 5' of the FMRFa gène. (C) PDF output from UCSC Browser showing multiple species séquence conservation through the Tv enhancer (using phastCons).  27  A  nuljrmn;iMi.T Mibjjruup mrUnoga«lt>r group  D, mclanogaster D. simulant D. S f t l l t l l i . i  D. yakuba D, crccta I). anatumai1). pseudctnbscura D», pi-rsiniilis D, « ilistoni D. itiojavensis D. virilis  Soplmphoru Drosophllidai-  Dipltrru  Hansûian l)rc«nphita  D. grimshawi  B Tv enhancer séquence, showing EvoDiff profile. ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggacacccaataaaccTgtccaaaaaccc gacacatttctgcccagtcatgcgi.ggtggacaatagccaaatgccattgatgagactcgtctccaAAACTTTGGCCTTTtgcc gGGCCGTAATTACAGACTTCCGtCtTttgaacagttttttcagccccacccaagagtcgagtcttgaaaagctggctg ggatggggtggtttcgggtgctgGAcGagaTGCCAgAGGCGCCACAAtGTATCCtgttacagGTTACAG GGCCATAAAgCgCCATAAAcgccGCGACGgCAAtGgCAATTAATAaCGCATACGgACA CGTAGtcgatccactggctagaaGGCTAATTGGACGTGCccGgCcAGGatgtccctgctcat  Figure 4.2: Séquence comparison of the Tv enhancer between 12 Drosophila species. (A) Phylogenetic tree showing evolutionary relationships of the sequenced Drosophilids. Screenshot from Flybase BLAST homepage (http://flybase.org/blast/) (B) Evoprint (in EvoDiff format) of the full length séquence of the D.melanogaster Tv-enhancer; Black capital letters are bases in the D.melanogaster référence séquence that are absolutely conserved in the D.simulans, hellia, D.erecta, D.yakuba, D.pseudoobscura, D,virilis or D.grimshawi orthologous DNAs. Coloured bases are bases in the D.melanogaster séquence that are conserved in ail species except the species coloured. The underlined séquences include HD/BRE A, B, and C in the order highlighted, and are shown in Fig 4.3.  28  A Tv enhancer séquence, showing EvoDiff profile. ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggacacccaataaacctgtccaaaaaccc gacacatttctgcccagtcatgcgtggtggacaatagccaaatgccattgatgagactcgtctccaAAACTTTGGCCTTTtMçç aGGCCGTAATTACAGACTTCCG;CtTttgaacagttttttcagccccacccaagagtcgagtcttgaaaagctggci.g icgggtgctgGAcGagaTGCCAgAGGCGCCACAAlGTATCCtgttacagGTTACAG GGCCATAAAgCgCCATAAActiccGCGACGaCAAtGgCAATTAATAaCGCATACGgACA CGTAGtcgatccactggctagaaGGCTAATTGGACGTGCccGgCcAGGatgtccctgct B . double underline séquence (HD/BRE-A)  d.jïi©ïanogastor C  d.simuians C d.scchellia C d.yakuba C  d erocta ç d^ananassae I d psoudoobseura C  d^pcrsimilis C d.willistoni d virilis d mojavensis d grimshawi  C A A G  G C G C  A A A A A A A A A A A 1A A S  T T T T T A A A A A A  G C C G G G C C G G C C G G G C C G G C C G G G C C G G C C G G G C C G G C C G G G C C G G T T G G C C C C G T G T G G C C i G ;T G T G G C C G T G A G G G C '-G T G T G G C C G G: T G T G G C C G T G A G G C C G  T T T T T T T T T T T T  A A A A A A A A A A A A  A A A A A A A A A A A A  T T T T T T  T T T T T T T T T T  T T A C T T A C T T A C T T A C T T A C T T A C T T A T T T A T T T A C T T A C T T A C T T A C  A C T C A C T G  C . single underline séquence (HD/BRE-B)  d.mclanogaster A  d;.,simulans A d..soctiejlia: A  d_yafcuba A d. erecta dananassao d pscuticobscui-a dporsimilis d..willisîoni d__virëis  A C A A A A  d mojavensis G d. grimshawi A  A C A C A C A C A C A C A G A C A T C. C G C 3 C  G C C G C G A C G G C G C C G C G A C G G C G C C G C G A C G A C G C C G C G A C G G C G C C G C G A C G G C G G C . A A G G C G •••. i G C G A C C G ••. T G C G A C C G C C T T G A G là A A G A C T G G C G A C T G G C G A C A A C G A C • T G G C G A C  C C C C C C C C C C C C  A A A A A A A A A A A A  A A A A A A A A A A A A  A A A A A A A A A A A A  T T T T T T T T T T T T  T T T T T T T T T T T T  A A A A A A A A A A A A  T T T T T T T T T T T T  D . dotted underline séquence (HD/BRE-C) « c , Beotic Muttz Alignmonts & ptostCoris Scores  Conservation  d.molanogastof G  a simulans G d secheHia d..yakuba d eracsa d.jananassao  G G G î  d.pseudoobacura D djœfsimilis c d„wiîIistoni G d. virilis G  d mojavensis A d . grimshawi c  T  o  ;A  T A C >A  G G G G G G G G G G A G  G G G G G G G G G G G G  C C C C C C C C C C C C  T T T T T T T T T T T T  A A A A A A A A A A A A  A A A A A A A A A A A A  T T T T T T T T T T T T  T T T T T T T T T T T T  G G G G G G G G IA G G G  G A G A G A G A G A  G T G T G T S C G T  G  G. G-: T G G G  c  C C C T T T  T G C G G  Figure 4.3. Detailed alignaient of HD/BRE-A/B/C modules of the Tv enhancer. (A) Evoprint of the Tv-enhancer from Fig 4.2. (B-D) 12 species séquence alignaient through underlined région from (A). Colour shading represents a consensus h (HD^ a consensus Mad-binding site (Mad), and a consensus H | . Note the Caps, denoted t (with the number of bases added for each species shown above {eg 10 or 14}). See Appendix H for full multiple alignaient format file (MAF) of Tv enhancer to see thèse additional bases. 29  4.2. Functional analysis of predicted HD/BRE modules The close association of predicted Mad/Medea-binding sites with HD-binding sites suggests a functional relationship between Apterous and BMP signalling. Although HD-C was previously shown to be important for Tv-enhancer expression (Benveniste et al., 1998), nothing is known regarding the functional rôle for each of the other HD sites, or the candidate Mad and Medea sites. To test the functional rôle of each candidate HD/BRE module, I compared reporter expression of wildtype versus mutant Tv enhancer séquences, using site-specifically integrated Tv-nEYFP reporters (as genetic hétérozygotes). I examined Tv-nEYFP reporters carrying double mutations of adjacent Mad and HD binding sites from each HD/BRE module, and detected a decrease in reporter expression in ail cases (Fig 4.4). Whereas Tvwt-nEYFP was expressed in 5.8±0.1 Tv neurons per VNC (n=72 VNCs), TvmMad-A/HD-A was expressed in 0.1±0.1 Tv neurons per VNC (n=8 VNCs; P=4xl0"8 compared to wildtype), indicating a near abolishment of reporter expression. TvmMad-B/HD-B and TvmMad-c/HD-c did not differ significantly from wildtype reporter in terms of cell count, expressing in 5.7±0.2 Tv neurons per VNC (n=6; P=0.6 compared to wildtype) and 5.5±0.2 Tv neurons per VNC (n=6; P=0.2 compared to wildtype), respectively. However, mutation of HD/BRE B or C did down-regulate reporter expression levels, with the respective reporters expressing at 26.8±2.7 and 49.8±7.6 % of wildtype fluorescent intensity (Fig. 4.4; Appendix B, Table B.3,4). Thèse results indicate that ail three HD/BRE régions contain séquences important for Tv expression, but that only HD/BRE-A is critical for Tvenhancer activity. 4.3. Functional analysis of putative Mad binding sites In order to test the contribution of individual Mad-binding sites to the expression of the Tv enhancer, I examined the effect of mutating individual candidate Mad-binding sites on TvnEYFP activity. Notably, only mutation of Mad-binding site A led to a réduction in reporter expression. Whereas Tvwt-nEYFP was expressed in 5.8±0.1 Tv neurons per VNC (n=72 VNCs), TvmMad-A-nEYFP was expressed in 3.7±0.5 Tv neurons per VNC (n=7 VNCs; P=2xl()-13, compared to wildtype) (Fig. 4.4 C; Appendix B, Table 3,4). TvmMad'A-nEYFP also displayed a strong decrease in fluorescent intensity compared to wildtype (Fig. 4.4 B). In contrast, TvmMad-B„ nEYFP and TvmMad~c-nEYFP displayed wildtype expression levels, being observed in 5.9±0.1 Tv 30  neurons per VNC (n=9 VNCs; No significant différence compared to wildtype) and 6.0±0.0 Tv neurons per VNC (n=12 VNCs; No significant différence compared to wildtype), respectively (Fig.4.4; Appendix B, Table 3). Furthermore, nEYFP intensity in thèse two mutants did not differ significantly from wildtype (Fig. 4.4 B and Appendix B, Table 4). Next, I tested Tv-nEYFP reporters containing ail possible combinations of mutant Madbinding sites to détermine whether Mad-B and C contnbute combinatorially to the expression of the Tv-enhancer. Notably, combination of mutated Mad-A with mutated Mad-B and/or C did not resuit in any further réduction in reporter activity from that of mutant Mad-A alone, as TvmMad-A/B-nEYFP,  TvmMad-A/c:-nEYFP and TvmMad'A/B/c -nEYFP were expressed in 4.0±0.3 Tv  neurons per VNC (n=7 VNCs; P=0.3 compared to TvmMad-A-nEYFP), 4.5±0.5 Tv neurons per VNC (n=4 VNCs; P=0.6 compared to TvmMad-A-nEYFP), and 4.0±0.0 Tv neurons per VNC (n=3 VNCs; P=0.7 compared to TvmMad-A-nEYFP), respectively (Fig. 4.4; Appendix B, Table 3). Moreover, double mutation of Mad-B and C failed to reduce Tv-nEYFP reporter expression relative to wildtype; TvmMad'B/c-nEYFP was expressed in 5.7±0.2 Tv neurons per VNC (n=6 VNCs; P=0.6 compared to wildtype). I also measured fluorescent intensity of Tv-nEYFP reporters for ail mutant combinations above, and confirmed that Mad-B and C séquences play no significant rôle in Tv-enhancer activity (Fig. 4.4 B; Appendix B, Table 4).  4.4. Summary of bioinformatics and HD/BRE analvsis Taken together, thèse results indicate that only HD/BRE-A contains functional motifs predicted to bind the BMP second messenger/transcription factor Mad. Importantly, double mutation of Mad-A and HD-A caused a more severe down-regulation of reporter activity than that of Mad-A alone, suggesting that HD-A is also functional. Furthermore, since neither mutation of Mad-B nor C affected Tv expression, it is likely that mutation of HD-B and C contributed solely to the decrease in reporter activities of T^Mad-B/HD-B_nEYFp md  TymMad-c/HD-  SI  -nEYFP, respectively. Thus, HD/BRE-A is the most likely candidate région for direct régulation by the BMP pathway. Given the juxtaposition of Mad, Med and HD binding motifs at HD/BRE-A, this module may also serve as the intégration point between BMP signalling and a homeodomain transcription factor, which we postulate to be Apterous.  31  -922  -476 Mean#YFP positive neurons/Tv neuron  1 M  1 H  •!—1  rsn—i  i—M  ™ n  mMad-C  i—••  i—H  BBrsn  1 - v mMad-A/B  i ii" ™  rxiH i !••  tm\ i ™r*i  i M rsn™  rxn«i ranra  Hrxi ™rsn  T v wt  jv  mMad-A  j j j  v  BH  *  mMad-B v  mMad-A/C  j  mMad-B/C  T v  mMad-A/B/C  Tv mMad-A/mHD-A Tv mMad-B/mHD-B Tv mMad-C/mHD-C j  j  delcons50  | |  •  I  •  7i  rsnnsti  i  i 11 i  •  mai  i  H* * -1 H * H -4 *  11 i  H*  • Dtl M  1  H  N/A  *  5.8+0.1 3.7+0.5* 5.9+0.1 6.0+0.0 4.0+0.3* 4.5+0.5* 5.7+0.2 4.0+0.0* 0.1+0,1* 5.7±0.2 5.540.2 0.0+0.0*  Relative Fluorescence intensity of YFP reporter vs. wt (%}  Figure 4.4. Expression analysis of hétérozygote Tv-nEYFP reporters. (A). Schematic représentation of Tv-nEYFP and numerous mutant versions of the reporter. Predicted Mad-binding sites (yellow) and known homeodomain-binding sites (red) are highlighted. Mutated sites are represented by X. Expression states of wildtype and variant reporter are measured as relative fluorescence intensity (B) and mean number of nEYFP-positive neurons/Tv neuron (C). (B). Relative fluorescence intensity is plotted directly next to the corresponding reporter shown in (A). Asterisks indicate a P value < 0.0001 when compared to Tv-nEYFP. TvmMad-A/mHD-A and Tvdelcom50 are not shown for intensity, due to the low to zéro number of nEYFP-positive Tv neurons, respectively. Error bars represent S.E.M. N/A indicates not available, as the specifïed samples hâve little to no YFP neurons available for quantification. (C). Mean number of nEYFP-positive neurons/Tv neuron is tabulated in the same order as the reporters shown in (A). AntiFMRFa was used to visualize the Tv neurons in ail cases. Asterisks represent P value <0.0001 when compared to Tv-nEYFP.  32  5. Results: Transgenic analysis of HD/BRE-A  5.1. Detailed analysis of HD/BRE-A. Although both HD and candidate Mad-binding motifs of HD/BRE-A were shown to be essential for Tv-enhancer activity (Chapter 4), it was unclear whether the consensus Medea binding séquence, hereafter referred to as Med-A, is also functional. Furthermore, it was unclear whether each predicted motif in the module acts independently or acts synergistically with one another. In order to address thèse issues, I performed a more detailed analysis of HD/BRE-A. I used homozygous Tv-nEYFP reporters in ail subséquent experiments because they display stronger fluorescent signais and improves one's ability to distinguish the intensity profile of weak-expressing Tv-enhancer mutants. 5.1.1. Mad-A and HD-A To begin my analysis, I re-examined the effects of mutations of Mad-A and HD-A on homozygous reporter activities. First, I verified that Mad-A is required for Tv expression. Although homozygous TvmMad'A-nEYFP was expressed in the normal number of Tv neurons, at 5.8±0.3 Tv neurons per VNC (n=4 VNCs, P=0.10 compared to wildtype), its expression levels was strongly reduced, at 30.7±3.8 % of wildtype nEYFP intensity (n=23 neurons, P=2.7 x 10"9 compared to wildtype) (Fig. 5.1; Appendix B, Table 5, 6). I also tested whether a more subtle mutation of Mad-A would disrupt reporter expression. In fvmMad'A'4bp, I mutated 4 bases out of the 9 bp séquence, as opposed to mutation of 6 bases in TvmMad'A (Fig. 5.1; Appendix C, Table Cl). I found that TvmMad-A'4bp-nEYFP did not significantly differ from TvmMad'A in either cell count or expression level; TvmMa*A'4bp'-nEYFP was observed in 5.7±0.3 Tv neurons per VNC (n=3, P=0.046 compared to wildtype, P=0.84 compared to T^Mad'A-nEYFP) and expressed at 20.5±3.5 % of wildtype nEYFP intensity (n=47 neurons, P=1.2xl0"21 compared to wildtype, P=0.09 compared to TvmMad-A) (Appendix B, Table 5, 6). Second, I found that HD-A alone is critical for Tv activation. TvmHD'A-nEYFP was expressed in 0.4±0.2 Tv neurons per VNC (n=7 VNCs, P=1.4 xlO"14 compared to wildtype) and at 9.7±7.0 % of wildtype nEYFP intensity (n=5 neurons, P=0.00027) (Fig 5.1). To détermine 33  whether Mad-A and HD-A are independently-acting motifs, I examined reporters bearing a double mutation of Mad-A and HD-A site. Interestingly, I found that TVnMad-A/HD-A-nEYFP did not differ significantly from reporters bearing mutation of HD-A alone; T^nMiuM/HD'A-nEYFP was observed in 1.0±0.0 Tv neurons per VNC (n=2, P=2.5 x 10" compared to wildtype, P=0.19 compared to TvmliD'A-nEYFP) and expressed at 5.3±1.7 % of wildtype nEYFP intensity (n=3 neurons, P=0.0023 compared to wildtype, P=0.65 compared to TV"™'*-nEYFP). While the sample size is small, thèse results suggest that HD-A is epistatic to Mad-A, and is contrary to the model that the two motifs act independently of each other. However, one issue with this interprétation is that the expression levels are so low in the TvmHD-A-nEYFP that it may be difficult to precisely ascertain any différences between the single HD-A mutant and double HDA/Mad-A mutant. This may be resolved by adding increasing numbers of Tv-nEYFP reporters, and/or using anti-EYFP immunoreactivity (anti-GFP) to enhance the reporter signal. Regardless, co-mutation of Mad-A did not enhance the loss of expression of an HD-A mutation. 5.1.2. Med-A is a functional motif An important feature that distinguishes HD/BRE-A from HD/BRE-B and C is the présence of an evolutionarily conserved, putative Medea binding site, or Med-A, which lies directly adjacent to HD-A (Figs. 4.2,4.3). To test the functionality of this motif, I swapped two base pairs within the motif (5'-AGAC-3' to 5'-GAAC-3') that is predicted to make direct contact with the MH1 domain of Smad4/Medea (Gao and Laughon, 2007). TvmMed-A-nEYFP displayed a slight réduction in cell count, at 5.3±0.3 Tv neurons per VNC (n=4, P=2.8 x 10"6) but was expressed at strongly reduced levels compared to wildtype, at 12.5±1.4 % of wildtype NEYFP intensity (n=60 neurons, P= 1.5xl0"12 compared to wildtype) (Fig. 5.1). This indicates that MedA is required for wildtype Tv expression. Note that this is a similar effect as mutation of Mad-A (TvmMad-A-4bp-nEYFP was observed in 5.7±0.3 Tv neurons per VNC and expressed at 20.5±3.5 % of wildtype nEYFP intensity). Overall, the above results showed that each predicted binding motif in HD/BRE-A is essential for Tv activation. Besides Med-A, three other Medea consensus séquences were positioned within 50 bp of HD/BRE-A; two are located upstream of HD/BRE-A, while the other is located 4 bp downstream from Med-A. 34  tgagactcgtctccaAAACTTTGGCCTTTtgccgGGCCGTAATTACAGACTTCCGtCtTttga None of thèse additional motifs were found to be conserved throughout Drosophila évolution (Fig 4.2). To détermine whether thèse séquences contribute to the residual activity left in a Med-A mutant reporter, I generated multiple combinations of mutations in thèse predicted Medea binding site. One of thèse Tv mutants contains a mutation in Med-A along with mutations in the two closest predicted Medea sites (Tvm3Med-nEYFP). Interestingly, while I found no significant différence in cell count, I found that reporter activity was significantly higher in Tvm3Med-nEYFP than in TvmMed-A-nEYFP; Tvm3Med-nEYFP was observed in 5.3±0.3 Tv neurons per VNC (n=6, P=0.86 compared to TvmMed'A-nEYFP) and expressed at 25.6±3.2 % of wildtype nEYFP intensity (n=35, P=5.2xl0"9 compared to wildtype, P=9.0xl0"5compared to TvmMed'A-nEYFP) (Fig. 5.1). While this might indicate that one of the surrounding Medea binding sites is a répressive élément, additional Tvm3Med-nEYFP lines will hâve to be tested to rule out any variation in transgenic attP2 lines expression. Nevertheless, this preliminary resuit suggest that the surrounding Medea sites do not compensate for mutation in Med-A, and are not likely to be positively-acting éléments in the Tv-enhancer.  35  -922  Tvwt  TyitiMad-A  jymHD-A TymMed-A |  -476  TTGGCCTTTTGCCGGGCCGTAATTACAGACTTCCGTCTTTTGA : TTGGCCTTTTAGTAGTACGTAATTACAG TTTGA TTGGCCTTTTGCCGGGCCGGAGCTCCAGACTTCCGTCTTTTGA | : TTGGCCTTTTGCCGGGCCGTAATTACGAACTTCCGTCTTTTGA I  KM  IXI  I  B 150  *  -100  -50  II •n <  o c » 3 < o W (0  *i  a _ •s (D  5 3  M ^ p •>»  Figure 5.1. Every élément in the identified HD/BRE-A is important for Tv-nEYFP expression. A. Schematic représentation of Tv-nEYFP and HD/BRE-A région. Homozygous reporters were used for this experiment. HD/BRE-A is comprised of a predicted Mad (yellow), Apterous (red) and Medea (green) binding sites, and is represented by a simplified, color-coded rectangle box. In order to study the importance of thèse sites, mutagenesis was carried out and séquences in red font represent the mutant base pairs. X on one of the rectangle boxes indicates that the particular binding site has been mutated according to the displayed mutant séquences shown. Stacked projections of Ll larval CNS expressing Tv-nEYFP reporters with mutations in ail three predicted binding sites are shown. B. Expression states of wildtype and mutant Tv-nEYFP reporters is represented as mean number of nEYFP-positive Tv neurons/VNC (red bars) as well as relative fluorescence intensity vs. wt (blue bars). Asterisks represent P value < 0.005 compared to wildtype. Error bars represent S.E.M. 36  5.1.3. Relative spacing between HD/BRE-A binding motifs is critical for wildtype Tv activation Next, we tested for functional spatial requirements for the HD, Mad and Medea motifs in HD/BRE-A, commonly used to indicate molecular interactions between trans-acting factors (Fig. 10). Previous studies showed that there is a requirement for proper spacing between Mad and Medea motifs (Gao and Laughon, 2007) in BMP-responsiveness. In the présence of an additional transcription factor binding site, such as a homeodomain factor, certain studies hâve shown a requirement for native spacing between HD and BMP-binding séquences (Walsh and Carroll, 2007). In contrast, other studies hâve shown that a juxtaposed Medea site is not critical for BMP-responsiveness in the présence of a second juxtaposed motif for an additional transcription factor, including homeodomain transcription factors (Brugger et al., 2004). In order to discriminate a spatial requirement for the HD motif in relation to the Mad and Medea motifs in HD/BRE-A, we created two mutant Tv-nEYFP constructs in which a five basepair spacer was inserted between the Mad and HD motifs {TVns5Mad'A/HD'A-nEYFP) and between the HD and Medea motifs (T)/m5HD-À/MuU-nEYFJF) (Fig. 5.2 A). A 5 bp spacer will presumably place maximal steric strain on molecular interactions by imposing a half-helical turn between DNA-binding motifs. In thèse two constructs, the spacing between Mad-A and Med-A sites is équivalent, but the relationship of the HD-A site to either the Mad-A or Med-A motifs was altered. Intriguingly, I observed a dramatic down-regulation of reporter expression when a spacer was inserted between HD-A and Med-A. Tvins5HD'A/Med'A-nEYFP was observed in fewer cells than wildtype, at 4.7±0.3 Tv neurons per VNC (n=3 VNCs; P=6.8 xlO"12 compared to wildtype), and was expressed at a dramaticaliy lower level, at 5.6±0.8 % of wildtype nEYFP intensity (n=24, P=l.lxl0-13) (Fig. 5.2 B). In contrast, fvinsSMad-A/HD-A-nEYFP showed no significant réduction in cell count, at 5.7±0.3 Tv neurons per VNC (n=3 VNCs; P=0.046 compared to wildtype) but was expressed at a significantly lower level than wildtype, at 77.6±4.9 % of wildtype nEYFP intensity (n=53 neurons; P=0.0028 compared to wildtype) (Fig. 5.2 B). Thèse data indicate that no critical spatial requirements exist between the Mad and Medea, or Mad and HD motifs - in the context of a 5bp spacer within the HD/BRE-A, but that there is a critical spacing requirement between the HD and Medea motifs. I am in the process of generating Tv enhancer mutants bearing différent 5bp spacer insertions to rule out any sequencespecific effects in TJm5H*A/Mèd-A-nEYFP and  j^a5MaU/HD-A-nEYFP. 37  5.2. Summary Overall, the above results indicate that each predicted DNA-binding élément in the HD/BRE-A module is essential for activation of the Tv enhancer. Furthermore, the relative orientation of the predicted binding séquences is critical for proper Tv activation, suggesting a strict spatial requirement for proper binding between Apterous, Mad and Medea.  38  -922  -476  HWHH Tvwt  -pvins5Mad-A/HD-A jyinsSHD-A/Med-A  nEYFP  •*-  TTGGCCTTTTGCCGGGCCGTAATTACAGACTTCCGTCTTTTGA TTGGCCTTTTGCCGGGCCGTTGTGTAATTACAGACTTCCGTCTTTTGA TTGGCCTTTTGCCGGGCCGTAATTACTCAACAGACTTCCGTCTTTTGA  B  Figure 5.2. Spacing between predicted Mad, Apterous, and Medea binding sites is critical for normal Tv expression. A. Schematic représentation of Tv-nEYFP and HD/BRE-A région, including séquence of spacer mutants. Homozygous reporters were used for this experiment. HD/BRE-A is comprised of a predicted Mad (yellow), Apterous (red) and Medea (green) binding sites, and is represented by a simplified, color-coded rectangle box. In order to study the spatial relationship between thèse sites, a 5 bp spacer (horizontal, double arrowhead) was inserted on either site of the Apterous binding site. Stacked projections of Ll larval CNS expressing Tv-nEYFP reporters bearing the insertion mutations are shown. B. Expression states of wildtype and mutant Tv-nEYFP reporters is represented as mean number of nEYFP-positive Tv neurons/VNC (red bars) as well as relative fluorescence intensity vs. wt (blue bars). Asterisks represent P value < 0.005 compared to wildtype. Error bars represent S.E.M.  39  6. Results: Biochemical characterization of HD/BRE modules  6.1. Apterous., Mad and Medea bind appropriate HD/BRE séquences in vitro. 6.1.1. Overview Thus far, transgenic analysis suggest that HD/BRE-A is the most likely site of intégration between BMP signalling and Apterous in the régulation of the Tv enhancer. This model would be strengthened if the proposed transcription factors can physically associate with HD/BRE-A at the appropriate motifs. To test whether Apterous, Mad and Medea can bind HD/BRE-A at putative HD, Mad and Medea motifs, respectively, I performed DNA-protein interaction studies using electrophoretic mobility shift assays (EMSA).  6.1.2. Apterous First, I examined Apterous binding to the Tv enhancer, using a N-terminal, GST fusion to the homeodomain of Apterous (GST-LIMless Ap) (for SDS-PAGE analysis of purified proteins see Appendix E, Figure E.I.). In agreement with a previous report (Benveniste et al., 1998), I found that Apterous can bind specifically to ail three HD motifs in the Tv enhancer (HD-A/B/C; Fig. 6.1; see Appendix E, Figure E.2). Strikingly, whereas HD/BRE-A oligonucleotides carrying wildtype HD-A motif or mutated Mad-A motif were able to compete for Apterous binding to radiolabelled, wildtype HD/BRE-A, oligonucleotides bearing mutation in HD-A motif failed to show any compétition even at 1000 fold excess level (Fig. 6.2 A). This resuit shows that Apterous binding is highly spécifie to HD-A.  6.1.3. Mad Next, I tested whether Mad can bind to the Tv enhancer, using a previously characterized N-terminal fusion of GST to the MH1 domain of Mad (GST-MadN) (Kim et al, 1998; Walsh and Carroll, 2007). I found that GST-MadN can associate specifically with ail three wildtype HD/BRE séquences (Mad-A/B/C) in vitro (Fig. 6.1; see Appendix E, Figure E.2.). Since only Mad-A is essential for Tv expression in vivo, I will focus my analysis hère on this motif. Mad and Medea both possess evolutionarily divergent MH1 DNA binding domains, which hâve 40  evolved to bind différent consensus séquences (Walsh and Carroll, 2007). However, truncated Mad MH1 domain was previously found to display residual binding activity for consensus Medea séquences (Walsh and Carroll, 2007). Since HD/BRE-A also contains a Medea consensus séquence, I examined the ability of GST-MadN to bind to oligonucleotides carrying only Mad-A and HD-A motifs (HD/BRE-A-Madonly). I found that GST-MadN caused a single band shift when incubated with HD/BRE-A-Madonly oligonucleotides, suggesting that MadN binds to mis séquence as a single species (Fig. 6.1 B). GST-MadN binding affinity for HD/BRE-A-Madonly was reduced by mutating the Mad-A motif (Fig. 6.1 B). Furthermore, wildtype HD/BRE-A-Madonly séquence competed more efficiently for MadN binding than mutant HD/BRE-A-Madonly séquences where Mad-A is mutated (Fig. 6.2 B). Together, thèse results indicates that MadN can associate specifically with Mad-A.  6.1.4. Medea Finally, I tested whether Med can bind to HD/BRE-A, using an N-terminal fusion of MBP to the MH1 domain of Med (MBP-MedN). Besides Med-A, an additional consensus Medea binding site is présent on HD/BRE-A oligonucleotides. Thus, both sites were always mutated together in the following EMSA experiments. Upon incubation with oligonucleotides bearing the HD/BRE-A séquence, MBP-MedN caused two very weak band shifts (Fig. 6.1 B). The top band shift can be eliminated by mutating both consensus Medea binding sites in the HD/BRE-A oligonucleotide (Fig. 6.2 B) suggesting spécifie binding by MedN. The bottom band shift may represent non-specific binding by incompletely translated, or degraded MBP-MedN. In accordance with this idea, non-specific binding was also observed when MBP-tag alone was incubated with the HD/BRE-A oligonucleotide (Fig. 6.2 B). As noted above, binding by MBPMedN to HD/BRE-A is weak and may indicate that majority of the purified proteins are inactive. In support of this, significant aggregation of radiolabelled HD/BRE-A oligonucleotides was observed in the wells, suggesting formation of insoluble protein-DNA complexes. To obtain better results, purification of MBP-MedN may hâve to be optimized to enhance solubility. Alternatively, GST-MedN has been shown to provide robust binding to consensus Medea séquences (Walsh and Carroll, 2007), and may be the more suitable construct to use for future experiments.  41  6.1.5. Summary To summarize, I found that the DNA-binding domains of Apterous, Mad and Medea can specifically associate with the HD/BRE-A séquence in vitro. Coincidentally, the same mutations that reduced reporter activity in vivo also disrupted DNA binding of each of the factors. Taken together, thèse results indicate that Apterous, Mad and Medea can ail associate specifically with each of their cognate séquence motifs in the HD/BRE module and strongly support the idea that thèse three proteins also bind to HD/BRE-A in vivo to regulate the expression oîFMRFa.  42  -922  -476  |—0—0-D|  r—+  1 nEYFP  A BC  : TTGGCCTTTTGCCGGGCCGTAATTACAGACTTCCGTCTTTTGA 1X1 ' I : "TGGCCTTTTAGTAGTACGTA STTCCGTCTTTTGA : TTGGCCT TGCCGGGCCGGAGCTCCAGACTTCCGTCTTTTGA rTTGGCCTTTTGCCGGGCCGTAATTACGAACTTCCGTTCT B I  I I  • — .„,.,.. . .  ulfc^li.I|  il * MI  Figure 6.1. Apterous, Mad and Medea can ail associate specifîcally with HD/BRE-A. A. Schematic représentation of Tv-nEFYP and a zoomed-in séquence showing the HD/BRE-A région. Predicted Mad, Apterous and Medea binding sites are highlighted in yellow, red and green, respectively. Simplified représentation of HD/BRE-A is displayed as colour-coded boxes indicating the corresponding binding sites. X in box indicates that the corresponding binding site has been mutated. B. GST-MadN (MadN), HA-LIMless Ap (Ap), and GST-MedN (MedN) can ail bind to radiolabelled oligonucleotides bearing the wildtype HD/BRE-A séquence shown in (A). Binding activity is either lost or reduced to oligonucleotides bearing mutation of predicted Mad, Apterous or Medea bindings sites as indicated in (A). Tag control for MadN and Ap binding experiments are purifïed GST. Tag control for MedN binding experiment is purifïed MBP. Arrow indicates band shift which is eliminated upon mutation of consensus Medea sites.  43  Tv1w2Med: TTGGCCTTTTGCCGGGCCGTAATTACAGACTTCCGTCTTTTGA A  mutHD : TTGGCCTTTTGCCGGGCCGGAGCTCCAGACTTCCG mutMad: TTGGCCTTTTAGTAGTACGTAATTACAGACTTCCG Tv1w2Med GSIUMIcMAp-  +-  GST  -  _  Cdd ntutMsd  -  —  + _  + _  -(-+ _  -  — —  —  MÉI  B  + -  +  -  _  +  — — I*K «Oit tMfoc — —  —  Cold Tv1w2M«| — — *0« 106» IMOK CûldmtnHD  + -  — —  ——'  _ _  _ — -  _  _  _  iM4*  -  **^ ***  Madonly: TTOGCCTTTTGCCGGGCCOTAATTACAG mutMad: TTGGCCTTTTAGTAGTACGTAATTACAG Madonly GSTMadN  -  +  OST  +• -  Cow mutMad! — — W  ^ Madonly  -  -  +  +  +  - - — — — -  +• + -  -  + -  lano&iJM»  1(Ut1M*3M« -  -  -  Figure 6.2. Compétition assay showing séquence specifîcity in Apterous and Mad binding. Oligonucleotide séquences representing predicted Mad, Apterous and Medea binding sites are highlighted in yellow, red and green colours, respectively. Red font letters indicate mutated séquences. A. EMSA experiment showing band shifts caused by binding of GST-LIMless Ap to radiolabelled Tvlw2Med oligonucleotides. Band shift signais are sharply reduced from compétition with cold, Tvlw2Med or mutMad oligonucleotides at 1000 fold excess of radiolabelled probes. However, cold oligonucleotides bearing mutation in the predicted homeodomain binding site (mutHD) fail to compete away the signal even at 1000 fold excess of radiolabelled probes. B. EMSA experiment showing band shifts caused by binding of GST-MadN to radiolabelled Madonly oligonucleotides. Band shift signais are more effîciently competed away by addition of cold mutMad oligonucleotides over addition of cold, wildtype Madonly oligonucleotides. 44  6.2. Apterous fails to co-immunoprecipitate with Mad or Medea in vitro The ability of Ap/Mad/Medea to associate specifically with their corresponding binding sites in vitro, combined with transgenic data indicating a requirement for proper spacing between their corresponding sites in vivo, raises the possibility that Ap/Mad/Med activate FMRFa expression through the formation of a physical complex. To test this idea, I examined whether an N-terminally tagged HA-Apterous can co-immunoprecipitate FLAG-Mad or myc-Medea from S2 cell lysate in a constitutively active BMP signalling background, induced by constitutively-activated BMP-type I receptor, Thickveins (TkvQD-FLAG). Using anti-HA for immunoprecipitation of HA-Ap, I detected expression of ail transfected products in the input and flow-through fractions (Fig. 6.3). However, while I detected HA-Ap in the IP fraction, I could not detect FLAG-Mad or myc-Medea in the same fractions (Fig. 6.3). The same resuit was obtained following co-immunoprecipitation experiments carried out in low (75 mM NaCl) and high (300 mM NaCl) sait conditions (data not shown). Together, thèse results fail to provide support for the idea that Apterous can associate with Mad and/or Medea. However, proving a négative resuit can be difficult, and further tests must be performed to optimise thèse tests. A positive control to perforai would be to show that tagged Mad can co-immunoprecipitate tagged Medea, and vice versa. Moreover, tagged Mad or Medea will hâve to be tested for pull-down of tagged Apterous. 6.3. Summary In summary, I found that Apterous, Mad and Medea can ail interact specifically with their predicted binding motifs in HD/BRE-A in vitro. However, it is still unclear whether thèse factors can associate with HD/BRE-A in vivo. Furthermore, no évidence has been found to date for physical association between Apterous and Mad or Medea.  45  Anti-HA  75kDa HAAp IP  50kDa AntïFLAG  Antï-myc  75kDa 50kDa  < FLAG tkvQD « — - FLAG Mad  lOOkDà  Myc-Medea  %%}W Figure 6.3. Apterous failed to co-immunoprecipitate Mad or Medea in BMP-active, S2 cells. Images showing western blot results from immunoprecipitation of HA-Apterous using anti-HA. S2 cells transfected with FLAG-TkvQD, HA-Apterous, FLAG-Mad, and myc-Medea and co-immunoprecipitation was carried out. While ail transfected products were found in input and flow-through, only FÏA-Apterous was detected in the IP fraction. Migration of HA-Apterous was distorted on the gel, and the 2ug anti-HA IP sample was found near the 75kDa ladder band.  46  7. Discussion 7.1. C/y-regulatory intégration of BMP signalling and Apterous at the Tv enhancer. The above results support the model that target-derived BMP signalling and the homeodomain transcription factor Apterous directly activâtes FMRFa expression in the Tv neurons. The two factors integrate at the Tv enhancer through direct binding of both Mad/Medea and Apterous to the HD/BRE-A module. Several Unes of évidence support this idea. First, expression of the Tv enhancer is dépendent on Apterous and BMP signalling. Second, the Tv-enhancer includes a module that consists of highly conserved transcription factor binding sites for Mad, Medea and Apterous, collectively called HD/BRE-A. Third, ail three binding sites are necessary for normal Tv expression. Fourth, Mad, Apterous and Medea can ail specifically associate with their predicted binding sites in the HD/BRE-A module in vitro. Fifth, proper topology between Mad, Apterous and Medea binding sites is required for wildtype Tv expression, suggesting a spatial requirement for binding between thèse transcription factors. Altogether, this study demonstrates the first mechanistic link between target-derived signalling and homeodomain transcription factors in the activation of TDGs in post-mitotic neurons. Is the c/s-regulatory intégration of BMP signalling and homeodomain transcription factors a common mechanism for specifying neuronal identity? There are reasons to believe this is the case. First, BMP/homeodomain-coupled cw-regulation of gènes hâve been demonstrated outside the nervous System, in vertebrates and invertebrates (Brugger et al., 2004; Walsh and Carroll, 2007). This suggests that homeodomain transcription factors can act with Mad/Medea in différent contexts. Second, récent findings in our laboratory suggest that HD/BRE modules are prévalent in the cw-regulatory régions of BMP-responsive TDGs. For instance, we hâve found that proctolin is a BMP-dependent neuropeptide expressed in a small subset of Drosophila neurons termed the posterior cluster neurons (Cattaneo et al.). Its expression pattern is faithfully reproduced by a BMP-dependent enhancer that is ~500bp in length. Similar to FMRFa, both proctoring and its ~500bp enhancer are also regulated by a homeodomain transcription factor, HB9 (see Appendix F). This suggests that BMP signalling and HB9 may integrate at HD/BRE modules to activate proctoring expression Several predicted HD/BREs exist in the proctoring enhancer, containing HD-, Mad- and Medea-binding motifs (see Appendix F). Thèse predicted 47  modules differ from HD/BRE-A in the Tv enhancer in ternis of positioning and exact séquences. However, it remains unclear whether thèse modules are functional, and whether they can be recognized by HB9, Mad and Medea. Cw-regulatory analysis of another BMP-dependent neuropeptide, dilp7, offers a contrasting view on the action of BMP signalling and homeodomain transcription factors in regulating TDGs. Dilp7's expression pattern can be recapitulated by a ~1.5 kb enhancer (see Appendix G). However, individual deletion of two highly conserved, predicted HD/BRE modules failed to disrupt expression of the l.Okb enhancer (data not shown). Furthermore, while both the dilp7 transcript and the 1.0 kb enhancer are regulated by HB9, only the transcript responds to BMP régulation (Miguel-Aliaga et al., 2008). Thèse studies suggest that the action of homeodomain transcription factors and BMP signalling may be separable in some cases. Thus, further studies are needed to détermine whether the Tv enhancer can serve as a paradigm for understanding how target-derived signalling integrate with intrinsic transcription factor codes in the nervous system. 7.2. Mechanism of cis-regulatory intégration at the Tv enhancer The FMRFa neuropeptide is expressed in 17 diverse neuronal types and its expression can be recapitulated by an 8.0 kb enhancer, which includes the 446 bp Tv enhancer (Benveniste et al., 1998). In this study I verified that Apterous and Zfhl regulate the Tv enhancer, and discovered two additional regulators of this séquence: BMP signalling and Dachshund. It is striking that at least 4 of the 7 known FMRFa regulators in the Tv neurons act through a 446 base pair DNA séquence. The intégration of multiple regulatory inputs into such a tight genomic région further illustrâtes the modular nature of transcriptional régulation. 7.2.1. Apterous and BMP signalling Hère, I provide évidence that Apterous and the BMP transcriptional regulators, Mad and Medea, can directly regulate Tv expression through association with the HD/BRE-A module. Interestingly, I observed that the HD-A is epistatic to Mad-A, supporting the notion that Apterous and Mad act synergistically through HD/BRE-A to regulate Tv expression. It is unlikely that the two predicted motifs are actually bound by one factor. Whereas mutation of each motif caused drastic down-regulation of the reporter, insertion of a 5-bp spacer between 48  Mad-A and HD-A only slightly reduced reporter activity. This resuit would not be expected if an unknown regulator binds onto an overlapping séquence between both predicted motifs. Further experiments would be needed to détermine whether HD-A is also epistatic to Med-A. Intégration of BMP signalling and Apterous at HD/BRE-A alone probably does not sufficiently specify gène expression in the Tv neurons; a 3x tandem repeat of HD/BRE-A minimal séquence failed to direct reporter activity in the Tv neurons (data not shown). This is in spite of the fact that pMad and Apterous expression patterns overlap uniquely in the Tv neurons. It is possible that the 3xHD/BRE-A séquence does induce reporter expression in Tv neurons, but at levels below détection. It is also possible that BMP signalling and Apterous require additional factors for proper intégration at HD/BRE-A. This is supported by the fact that directly upstream of HD/BRE-A lies a highly conserved stretch of séquence that our bioinformatics analysis predicts may bind nuclear hormone factors (Fig. 6). To rule out both possibilities, I constructed synthetic séquences carrying 6 and 12 tandem repeats of HD/BRE-A plus the predicted nuclear hormone factor binding site, and examined whether they can drive reporter expression in Tv neurons. Shortly after the completion of this thesis, I found that such a séquence indeed drove YFP expression in the Tv neurons (Appendix A, Fig. A.5.). Ectopic expression of this reporter was also detected in the brain lobes and in other neurons of the VNC, suggesting that additional flanking éléments may be required to refine the spatial expression oîFMRFa (Appendix A, Fig. A.5.). Furthermore, I found that the predicted nuclear hormone factor binding site is necessary for Tv enhancer expression (Appendix A, Fig. A.6.). Thèse preliminary results now point to a model where Apterous, BMP signalling and an unknown factor act directly at the HD/BRE-A région to specify gène expression in the Tv neurons (Fig. 7.1). Apterous likely contributes to FMRFa régulation through additional binding to the HD-B and C motifs. Although it is unclear whether Apterous acts alone at those motifs, the identification of a functional 50 bp région, directly adjacent to HD-B, plus the conservation of séquences surrounding the HD-B and C motifs, suggest that additional factors might be involved. BMP signalling is unlikely to be one of thèse factors. Although Mad-binding séquences surround HD -B and C, and can be bound by recombinant Mad in vitro, the same séquences were not necessary for Tv enhancer activation in vivo. This might explain the weak conservation of Mad-B and C relative to Mad-A. Several reasons could account for the observation that Mad-B and C are not functional in vivo. First, the spacing between 49  homeodomain-binding motifs and Mad-binding motifs in HD/BRE-B and C are différent from that in HD/BRE-A. This could alter the topology of Mad binding relative to Apterous binding, and prevent the proper activator complexes from forming. Second, neither HD/BRE-B nor C has a nearby consensus Medea séquence, which is critical for formation of a pMad/Med complex. It would be interesting to test whether Mad-B and C can be manipulated into functional, BMPresponsive éléments, by adding juxtaposed Medea motifs, when HD/BRE-A is mutated. However, as noted above, blocks of highly conserved séquences surround HD-B and C, and are likely to be functionally important. Altérations in spacing or insertion of a Medea binding motif in this région might disrupt the ability of unknown factors to interact with Apterous, and further confound expérimental results. Instead, one might test the hypothesis that Mad-B and C are true Mad-binding motifs by determining whether either of them can functionally replace Mad-A at the HD/BRE-A module. Since TVns5Mad'Â/HD-A-nEYFP expresses at near-wildtype activity, changes in spacing from insertion of Mad-B and C might be tolerated by the Tv enhancer. 7.2.2. Dachshund and Zfhl Currently, we do not know how Dachshund and Zfhl regulate FMRFa.. However, there are reasons to believe that the two also directly act with BMP-signalling and Apterous at the Tv enhancer. Dachshund is a transcriptional co-activator whose homologs are known to bind Smad complexes to regulate gène expression in Drosophila and in vertebrates (Kida et al., 2004; Takaesu et al., 2006; Wu et al., 2003). Although Dachshund only moderately régulâtes TvnEYFP expression, it can synergistically act with Apterous to trigger ectopic Tv-nEYFP expression in the nervous system. Furthermore, Dachshund and Apterous dépends on BMP signalling for their ectopic activation of the 8.0 kb FMRFa enhancer (Miguel-Aliaga et al., 2004). Taken together, thèse observations suggest that Dachshund may be a modulator of the BMP pathway, and may directly interacts with Mad/Medea and Apterous at the HD/BRE-A to regulate FMRFa levels. Genetic interaction studies could help reveal functional relationships between Dachshund, Apterous and BMP-signalling. Preliminarily, I tested whether transheterozygous ap and dac mutants would show genetic interactions by affecting expression of the sensitized Tv-nEYFP reporter, but did not find any effect (data not shown).  50  It is curious to note that, using similar GAL4 drivers, misexpression of Dachshund alone induced ectopic expression of the Tv enhancer in many neurons, but only weakly activated the 8.0 kb FMRFa enhancer in several neurons (see Fig. 3.4.) (Miguel-Aliaga et al., 2004). On the other hand, Apterous cannot induce any ectopic Tv-nEYFP by itself. Thus, it is possible that within the FMRFa 8.0 kb enhancer, répressive éléments suppress indiscriminate, BMPdependent activation of the reporter in non-appropriate neurons. While over-expression of Dachshund may prime the pMad/Medea complex for indiscriminate activation of the 8.0 kb enhancer, further over-expression of Apterous is needed to overcome the répressive éléments. When the répressive éléments are absent, as is the case for Tv-nEYFP, over-expression of Dachshund can sufficiently induce BMP-dependent activation of the reporter, and Apterous further strengthens the response. It is unclear how Zfhl régulâtes FMRFa expression. Since the epistatic relationship between Zfhl and other FMRFa regulators has not been determined, it is hard to evaluate whether Zfhl directly régulâtes FMRFa through the Tv enhancer, or through régulation of another transcription factor. However, there are reasons to believe that Zfhl can act directly with BMP signalling. SIP-1, the mammalian homolog of Zfhl, has been shown to bind to the MH2 domain of Smads (Verschueren et al, 1999). Although not yet tested, Zfhl 's presumed ability to bind both Smads and homeodomain motifs suggests that it may also act with BMP signalling at HD/BRE-A. DNA binding experiments will be needed to test whether Zfhl can associate with HD-A. A récent report suggests that Zfhl can directly regulate Tv expression through binding to the HD-C motif (Vogler and Urban, 2008). However, it is unlikely that Zfhl acts solely through HD-C binding, because Tv-nEYFP showed weaker expression in a zfhl mutant background than TvmMad'c/HD'c-nEYFP in a wildtype background (Mad-C is not a functional élément) 7.3 A collaborative mechanism of ds-regulatory intégration between BMP signalling and Apterous? Although mutant analysis and enhancer mutagenesis experiments show a synergistic relationship between BMP signalling and Apterous in the activation of the Tv enhancer, it is unclear how the two factors might act together at the molecular level. A model of co-operative régulation through direct binding between transcriptional partners is attractive, given the strict, 51  evolutionarily conserved topology between Mad-A, HD-A and Med-A. However, coimmunoprecipitation experiments failed to lend support for the model that Apterous can interact with either Mad or Medea. On the other hand, my results are more in agreement with a collaborative regulatory mechanism where two transcription factors are required to bind in close proximity to each other, but do not directly interact. Binding of Apterous and the pMad/Medea complex may occur simultaneously on the HD/BRE-A module, with the two factors binding on opposite sides of the double hélix. Insertion of a half-helical turn between Mad-A and Med-A binding sites may be tolerated, given the reported flexibility between Mad/Medea interactions (Gao and Laughon, 2007). However, such flexibility probably dépends on the absence of additional interfering factors. By moving the HD-A motif onto the same helical side as that of Med-A, Apterous would be binding directly next to Medea, and this may hâve disrupted physical interactions between Medea and Mad and/or other factors, or vice versa, resulting in the dramatic down-regulation of Tv expression seen in  Tv-hu5mMAdA-hEYFP.  1A. Future questions Despite the progress that my work has made, several issues hâve to be addressed. First, while mutations of Mad-A or Med-A led to réduction in reporter activities, the results failed to phenocopy the abolishment of reporter signal seen in a wit mutant background. This may be because the mutations used only partially disrupted Mad and Medea binding to HD/BRE-A. In support of this, the same Mad-A mutation used to disrupt reporter activity reduced, but not completely abolish MadN binding affinity for HD/BRE-A in vitro. If the Mad-A and Med-A mutations are indeed DNA-binding hypomorphs, a double-mutation of Mad-A and Med-A should further decrease reporter activity. Alternatively, wildtype BMP signalling may prevent the expression of the repressor molécule Brinker, which is known to repress BMP-dependent target gènes in the absence of BMP signalling. The repression of Brinker in the wildtype backgrounds of TvmMad-A-nEYFP and TvmMed-A-nEYFP reporters might allow for leakiness of the Tv enhancer. Second, it is unclear whether HD/BRE-A really responds to BMP signalling. I recently discovered that a 47 bp séquence including HD/BRE-A is sufficient for reporter expression in the Tv neurons (Appendix A, Fig. A.5.). Our model would be strengthened if it was shown that this séquence fails to drive reporter expression in a BMP mutant background. Another approach  would be to show Mad and Med binding to HDBRE-A in BMP-active conditions, but not when BMP signalling is suppressed. This would be best tested by EMSA in S2 cells. Third, it is unknown whether Apterous, Mad and Medea can associate with the Tv enhancer in vivo. In a preliminary ChIP experiment, I found that a HA-tagged Apterous specifîcally associated with the Tv enhancer. However, mutation of ail three HD-motifs failed to abolish the signal, suggesting saturation of DNA binding by Apterous. Thus, a more robust ChIP assay needs to be developed before this issue can be examined.  7.5 Conclusion Taken together, my results provide the first mechanistic link between target-derived BMP signalling and homeodomain transcription factors in the régulation of TDGs. It remains to be seen whether this mechanism applies to other target-dependent TDGs, but important tools hâve now been generated to undergo further cw-regulatory studies (see Appendix F, G).  r  Zftil  L /  Dac  Ap  -922  BMPpathway  Eya  -476  +-Q—h  FMRFa  Tv expression  ^)Mad|^fr Tv nucleus Figure 7.1. Model: Intersection of BMP signalling with Apterous at the Tv enhancer. Within the Tv nucleus, Apterous (Ap), Zfhl, Dachshund (Dac), and the BMP pathway is now know to regulate the expression of the Tv enhancer. It is still unclear whether Eyes absent (Eya), Dimmed (Dimm), or Squeeze (Sqz) also control Tv enhancer expression. Within the Tv enhancer, Apterous, Mad (pMad) and Medea is thought to bind directly to HD/BRE-A (yellow/red/green) and along with an unknown factor (X?) binding directly upstream of HD/BRE-A (purple), they form an activating complex that can specify gène expression in the Tv neurons. 53  Bibliography Aberle, H., Haghighi, A.P., Fetter, R.D., McCabe, B.D., Magalhaes, T.R., and Goodman, C.S. (2002). wishfol thinking encodes a BMP type II receptor that régulâtes synaptic growth in Drosophila. Neuron 33, 545-558. Affolter, M., Marty, T., Vigano, M.A., and Jazwinska, A. (2001). Nuclear interprétation of Dpp signaling in Drosophila. EMBO J 20, 3298-3305. Ai, X., Cappuzzello, J., and Hall, A.K. (1999). Activin and bone morphogenetic proteins induce calcitonin gene-related peptide in embryonic sensory neurons in vitro. Mol Cell Neurosci 14, 506-518. Allan, D.W., Park, D., St Pierre, S.E., Taghert, P.H., and Thor, S. (2005). Regulators acting in combinatorial codes also act independently in single differentiating neurons. Neuron 45, 689-700. Allan, D.W., St Pierre, S.E., Miguel-Aliaga, L, and Thor, S. (2003). Spécification of neuropeptide cell identity by the intégration of rétrograde BMP signaling and a combinatorial transcription factor code. Cell 113, 73-86. Arendt, D. (2005). Gènes and homology in nervous system évolution: comparing gène fonctions, expression patterns, and cell type molecular fïngerprints. Theory Biosci 124, 185-197. Arendt, D., and Nubler-Jung, K. (1996). Common ground plans in early brain development in mice and Aies. Bioessays 18, 255-259. Arendt, D., and Nubler-Jung, K. (1999). Comparison of early nerve cord development in insects and vertebrates. Development 126, 2309-2325. Attisano, L., and Wrana, J.L. (2000). Smads as transcriptional co-modulators. Curr Opin Cell Biol 12, 235-243. Barolo, S., Castro, B., and Posakony, J.W. (2004). New Drosophila transgenic reporters: insulated Pelement vectors expressing fast-maturing RFP. Biotechniques 36, 436-440, 442. Benveniste, R.J., Thor, S., Thomas, J.B., and Taghert, P.H. (1998). Cell type-specifïc régulation of the Drosophila FMRF-NH2 neuropeptide gène by Apterous, a LIM homeodomain transcription factor. Development 125, Al 51-Al65. Berger, M.F., Badis, G., Gehrke, A.R., Talukder, S., Philippakis, A.A., Pena-Castillo, L., Alleyne, T.M., Mnaimneh, S., Botvinnik, O.B., Chan, ET., et al. (2008). Variation in homeodomain DNA binding revealed by high-resolution analysis of séquence préférences. Cell 133, 1266-1276. Bischof, J., Maeda, R.K., Hediger, M., Karch, F., and Basler, K. (2007). An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104, 33123317. Blanchette, M., Kent, W.J., Riemer, C , Elnitski, L., Smit, A.F., Roskin, K.M., Baertsch, R., Rosenbloom, K., Clawson, H., Green, E.D., et al. (2004). Aligning multiple genomic séquences with the threaded blockset aligner. Génome Res 14, 708-715. 54  Boules, M., Shaw, A., Fredrickson, P., and Richelson, E. (2007). Neurotensin agonists: potential in the treatment of schizophrenia. CNS Drugs 21,13-23. Bourgouin, C, Lundgren, S.E., and Thomas, J.B. (1992). Apterous is a Drosophila LIM domain gène required for the development of a subset of embryonic muscles. Neuron 9, 549-561. Brand, A.H., and Perrîmon, N. (1993). Targeted gène expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401-415. Briscoe, J., and Novitch, B.G. (2008). Regulatory pathways linking progenitor patterning, cell fates and neurogenesis in the ventral neural tube. Philos Trans R Soc Lond B Biol Sci 363, 57-70. Brugger, S.M., Merrill, A.E., Torres-Vazquez, J., Wu, N., Ting, M.C., Cho, J.Y., Dobias, S.L., Yi, S.E., Lyons, K., Bell, J.R., et al. (2004). A phylogenetically conserved cis-regulatory module in the Msx2 promoter is suffïcient for BMP-dependent transcription in murine and Drosophila embryos. Development 737,5153-5165. Bui, Q.T., Zimmerman, J.E., Liu, H., and Bonini, N.M. (2000). Molecular analysis of Drosophila eyes absent mutants reveals features of the conserved Eya domain. Genetics 755, 709-720. Cattaneo, A., Capsoni, S., Margotti, E., Righi, M., Kontsekova, E., Pavlik, P., Filipcik, P., and Novak, M. (1999). Functional blockade of tyrosine kinase A in the rat basai forebrain by a novel antagonistic antireceptor monoclonal antibody. J Neurosci 19, 9687-9697. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., and Thompson, J.D. (2003). Multiple séquence alignment with the Clustal séries of programs. Nucleic Acids Res 31, 3497-3500. Chiaromonte, F., Yap, V.B., and Miller, W. (2002). Scoring pairwise genomic séquence alignments. Pac Symp Biocomput, 115-126. Clark, A.G., Eisen, M.B., Smith, D.R., Bergman, CM., Oliver, B., Markow, T.A., Kaufman, T.C, Kellis, M., Gelbart, W., Iyer, V.N., et al. (2007). Evolution of gènes and génomes on the Drosophila phylogeny. Nature 450, 203-218. Coulombe, J.N., and Kos, K. (1997). Target tissue influence on somatostatin expression in the avian ciliary ganglion. Ann N Y Acad Sci 814, 209-225. Coulombe, J.N., and Nishi, R. (1991). Stimulation of somatostatin expression in developing ciliary ganglion neurons by cells of the choroid layer. J Neurosci 77, 553-562. Dasen, J.S., Tice, B.C., Brenner-Morton, S., and Jessell, T.M. (2005). A Hox regulatory network establishes motor neuron pool identity and target-muscle connectivity. Cell 123,477-491. Dietzl, G., Chen, D., Schnorrer, F., Su, K.C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S., et al. (2007). A genome-wide transgenic RNAi library for conditional gène inactivation in Drosophila. Nature 448,151-156. Duffy, J.B. (2002). GAL4 system in Drosophila: a fly geneticist's Swiss army knife. Genesis 34,1-15. Eade, K.T., and Allan, D.W. (2009). Neuronal phenotype in the mature nervous System is maintained by persistent rétrograde bone morphogenetic protein signaling. J Neurosci 29, 3852-3864. 55  Eaton, B.A., and Davis, G.W. (2005). LIM Kinasel Controls Synaptic Stability Downstream of the Type H BMP Receptor. Neuron 47, 695-708. Edlund, T., and Jessell, T.M. (1999). Progression from extrinsic to intrinsic signaling in cell fate spécification: a view from the nervous System. Cell 96, 211-224. Ernsberger, U., and Rohrer, H. (1999). Development of the cholinergic neurotransmitter phenotype in postganglionic sympathetic neurons. Cell Tissue Res 297, 339-361. Etchberger, J.F., Lorch, A., Sleumer, M.C., Zapf, R., Jones, S.J., Marra, M.A., Holt, R.A., Moerman, D.G., and Hobert, O. (2007). The molecular signature and cis-regulatory architecture of a C. elegans gustatory neuron. Gènes Dev 21, 1653-1674. Faresse, N., Colland, F., Ferrand, N., Prunier, C, Bourgeade, M.F., and Atfi, A. (2008). Identification of PCTA, a TGIF antagonist that promûtes PMLfonctionin TGF-beta signalling. EMBO J 27,1804-1815. Gao, S., and Laughon, A. (2007). Flexible interaction of Drosophila Smad complexes with bipartite binding sites. Biochim Biophys Acta 1769, 484-496. Grocott, T., Frost, V., Maillard, M., Johansen, T., Wheeler, G.N., Dawes, L.J., Wormstone, I.M., and Chantry, A. (2007). The MH1 domain of Smad3 interacts with Pax6 and represses autoregulation of the Pax6 PI promoter. Nucleic Acids Res 35, 890-901. Groth, A.C., Fish, M., Nusse, R., and Calos, M.P. (2004). Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 166, 1775-1782. Guha, U., Gomes, W.A., Samanta, J., Gupta, M., Rice, F.L., and Kessler, J.A. (2004). Target-derived BMP signaling limits sensory neuron number and the extent of peripheral innervation in vivo. Development 131, 1175-1186. Hall, A.K., Burke, R.M., Anand, M., and Dinsio, K.J. (2002). Activin and bone morphogenetic proteins are présent in périnatal sensory neuron target tissues that induce neuropeptides. J Neurobiol 52, 52-60. Harrison, K.A., Thaler, J., Pfaff, SX., Gu, H., and Kehrl, J.H. (1999). Pancréas dorsal lobe agenesis and abnormal islets of Langerhans in Hlxb9-deficient mice. Nat Genêt 23, 71-75. Hippenmeyer, S., Kramer, L, and Arber, S. (2004). Control of neuronal phenotype: what targets tell the cell bodies. Trends Neurosci 27, 482-488. Hobert, O., and Westphal, H. (2000). Functions of LJJVI-homeobox gènes. Trends Genêt 16, 75-83. Hodge, L.K., Klassen, M.P., Han, B.X., Yiu, G., Hurrell, J., Howell, A., Rousseau, G., Lemaigre, F., Tessier-Lavigne, M., and Wang, F. (2007). Rétrograde BMP signaling régulâtes trigeminal sensory neuron identities and the formation of précise face maps. Neuron 55, 572-586. Horton, R.M., Cai, Z.L., Ho, S.N., and Pease, L.R. (1990). Gène splicing by overlap extension: tailormade gènes using the polymerase chain reaction. Biotechniques 8, 528-535.  56  Hunter, C.S., and Rhodes, S.J. (2005). LIM-homeodomain gènes in mammalian development and human disease. Mol Biol Rep 32, 67-77. Jessell, T.M. (2000). Neuronal spécification in the spinal cord: inductive signais and transcriptional codes. Nat Rev Genêt 1, 20-29. Jorgensen, J.S., Quirk, C.C., and Nilson, J.H. (2004). Multiple and overlapping combinatorial codes orchestrate hormonal responsiveness and dictate cell-specific expression of the gènes encoding luteinizing hormone. Endocr Rev 25, 521-542. Justice, R.W., Zilian, O., Woods, D.F., Noll, M., and Bryant, P.J. (1995). The Drosophila tumor suppressor gène warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and prolifération. Gènes Dev 9, 534-546. Kent, W.J. (2002). BLAT~the BLAST-like alignment tool. Génome Res 12, 656-664. Kida, Y., Maeda, Y., Shiraishi, T., Suzuki, T., and Ogura, T. (2004). Chick Dachl interacts with the Smad complex and Sin3a to control AER formation and limb development along the proximodistal axis. Development 131, 4179-4187. Kim, J., Johnson, K., Chen, H.J., Carroll, S., and Laughon, A. (1998). Drosophila Mad binds to DNA and directly médiates activation ofvestigial by Decapentaplegic. Nature 388, 304-308. Koo, S.J., and Pfaff, S.L. (2002). Fine-tuning motor neuron properties: signaling from the periphery. Neuron 35, 823-826. Kuhn, R.M., Karolchik, D., Zweig, A.S., Trumbower, H., Thomas, D.J., Thakkapallayil, A., Sugnet, C.W., Stanke, M., Smith, K.E., Siepel, A., et al. (2007). The UCSC génome browser database: update 2007. Nucleic Acids Res 35, D668-673. Lamba, P., Khivansara, V., D'Alessio, A.C., Santos, M.M., and Bernard, D.J. (2008). Paired-like homeodomain transcription factors 1 and 2 regulate follicle-stimulating hormone beta-subunit transcription through a conserved cis-element. Endocrinology 149, 3095-3108. Landgraf, M., and Thor, S. (2006). Development of Drosophila motoneurons: spécification and morphology. Semin Cell Dev Biol 17, 3-11. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., MeWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., et al. (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-2948. Lechleider, R.J., Ryan, J.L., Garrett, L., Eng, C, Deng, C, Wynshaw-Boris, A., and Roberts, A.B. (2001). Targeted mutagenesis of Smadl reveals an essential rôle in chorioallantoic fusion. Dev Biol 240, 157-167. Lee-Hoeflich, S.T., Causing, C.G., Podkowa, M., Zhao, X., Wrana, J.L., and Attisano, L. (2004). Activation of LIMK1 by binding to the BMP receptor, BMPRII, régulâtes BMP-dependent dendritogenesis. Embo J 23, 4792-4801. Lewis, D.A., and Levitt, P. (2002). Schizophrenia as a disorder of neurodevelopment. Annu Rev Neurosci 25, 409-432. 57  Li, X., Nie, S., Chang, C , Qiu, T., and Cao, X. (2006). Smads oppose Hox transcriptional activities. Exp Cell Res 312, 854-864. Lovoulos, C , Tittle, S., Goldstein, L., Austin, D.J., Singh, S., Rocco, E., Keane, J., Tang, P., Kopf, G.S., and Elefteriades, J.A. (2004). Right ventricle-sparing heart transplantation effective against iatrogenic pulmonary hypertension. J Heart Lung Transplant 23,236-241. Markstein, M., Pitsouli, C , Villalta, C , Celniker, S.E., and Perrimon, N. (2008). Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat Genêt 40,476483. Marques, G., Bao, H., Haerry, T.E., Shimell, M.J., Duchek, P., Zhang, B., and O'Connor, M.B. (2002). The Drosophila BMP type II receptor Wishful Thinking régulâtes neuromuscular synapse morphology and function. Neuron 33, 529-543. Massague, J., and Gomis, R.R. (2006). The logic of TGFbeta signaling. FEBS Lett 580, 2811-2820. Massague, J., Seoane, J., and Wotton, D. (2005). Smad transcription factors. Gènes Dev 19, 2783-2810. Massague, J., and Wotton, D. (2000). Transcriptional control by the TGF-beta/Smad signaling System. EMBO J 19, 1745-1754. McCabe, B.D., Marques, G., Haghighi, A.P., Fetter, R.D., Crotty, M.L., Haerry, T.E., Goodman, C.S., and O'Connor, M.B. (2003). The BMP homolog Gbb provides a rétrograde signal that régulâtes synaptic growth at the Drosophila neuromuscular junction. Neuron 39, 241-254. Miguel-Aliaga, L, Allan, D.W., and Thor, S. (2004). Independent rôles of the dachshund and eyes absent gènes in BMP signaling, axon pathfmding and neuronal spécification. Development 131, 5837-5848. Miguel-Aliaga, L, Thor, S., and Gould, A.P. (2008). Postmitotic spécification of Drosophila insulinergic neurons from pioneer neurons. PLoS Biol 6, e58. Monuki, E.S., Porter, F.D., and Walsh, C.A. (2001). Patterning of the dorsal telencephalon and cérébral cortex by a roof plate-Lhx2 pathway. Neuron 32, 591-604. Nishi, R. (2003). Target-mediated control of neural differentiation. Prog Neurobiol 69, 213-227. Noyés, M.B., Christensen, R.G., Wakabayashi, A., Stormo, G.D., Brodsky, M.H., and Wolfe, S.A. (2008). Analysis of homeodomain specifîcities allows the family-wide prédiction of preferred récognition sites. Cell 133, 1277-1289. O'Keefe, D.D., Thor, S., and Thomas, J.B. (1998). Function and specificity of LEM domains in Drosophila nervous System and wing development. Development 125, 3915-3923. Odenwald, W.F., Rasband, W., Kuzin, A., and Brody, T. (2005). EVOPRINTER a multigenomic comparative tool for rapid identification of functionally important DNA. Proc Natl Acad Sci U S A 102, 14700-14705. Oppenheim, R.W. (1989). The neurotrophic theory and naturally occurring motoneuron death. Trends Neurosci 12, 252-255. 58  Pavelock, K.A., Girard, B.M., Schutz, K.C., Braas, K.M., and May, V. (2007). Bone morphogenetic protein down-regulation of neuronal pituitary adenylate cyclase-activating polypeptide and reciprocal effects on vasoactive intestinal peptide expression. J Neurochem 100, 603-616. Pfaff, S.L., Mendelsohn, M., Stewart, CL., Edlund, T., and Jessell, T.M. (1996). Requirement for L M homeobox gène Isll in motor neuron génération reveals a motor neuron-dependent step in interneuron differentiation. Cell 84, 309-320. Rawson, J.M., Lee, M., Kennedy, EL., and Selleck, S.B. (2003). Drosophila neuromuscular synapse assembly and function require the TGF-beta type I receptor saxophone and the transcription factor Mad. J Neurobiol 55, 134-150. Saito, T., Iwata, N., Tsubuki, S., Takaki, Y., Takano, J., Huang, S.M., Suemoto, T., Higuchi, M., and Saido, T.C. (2005). Somatostatin régulâtes brain amyloid beta peptide Abeta42 through modulation of proteolytic dégradation. Nat Med 11, 434-439. Saito, T., Takaki, Y., Iwata, N., Trojanowski, J., and Saido, T.C. (2003). Alzheimer's disease, neuropeptides, neuropeptidase, and amyloid-beta peptide metabolism. Sci Aging Knowledge Environ 2003, PE1. Schmierer, B., and Hill, C.S. (2007). TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nat Rev Mol Cell Biol 8, 970-982. Schneider, L.E., Roberts, M.S., and Taghert, P.H. (1993). Cell type-specific transcriptional régulation of the Drosophila FMRFamide neuropeptide gène. Neuron 10, 279-291. Shen, W., Finnegan, S., Lein, P., Sullivan, S., Slaughter, M., and Higgins, D. (2004). Bone morphogenetic proteins regulate ionotropic glutamate receptors in human retina. Eur J Neurosci 20, 20312037. Sheng, H.Z., Zhadanov, A.B., Mosinger, B., Jr., Fujii, T., Bertuzzi, S., Grinberg, A., Lee, E.J., Huang, S.P., Mahon, K.A., and Westphal, H. (1996). Spécification of pituitary cell lineages by the LEVÎ homeobox gène Lhx3. Science 272,1004-1007. Shi, Y., and Massague, J. (2003). Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685-700. Shirasaki, R , and Pfaff, S.L. (2002). Transcriptional codes and the control of neuronal identity. Annu Rev Neurosci 25,251-281. Siepel, A., Bejerano, G., Pedersen, J.S., Hinrichs, A.S., Hou, M., Rosenbloom, K., Clawson, H., Spieth, J., Hillier, L.W., Richards, S., et al. (2005). Evolutionarily conserved éléments in vertebrate, insect, worm, andyeast génomes. Génome Res 15,1034-1050. Sirard, C , de la Pompa, J.L., Elia, A., Itie, A., Mirtsos, C , Cheung, A., Hahn, S., Wakeham, A., Schwartz, L., Kern, S.E., et al. (1998). The tumor suppressor gène Smad4/Dpc4 is required for gastrulation and later for anterior development of the mouse embryo. Gènes Dev 12, 107-119. Skeath, J.B., and Thor, S. (2003). Genetic control of Drosophila nerve cord development. Curr Opin Neurobiol/3, 8-15. 59  Sofironiew, M.V., Howe, CL., and Mobley, W.C. (2001). Nerve growth factor signaling, neuroprotection, and neural repair. Annu Rev Neurosci 24, 1217-1281. Stark, A., Lin, M.F., Kheradpour, P., Pedersen, J.S., Parts, L., Carlson, J.W., Crosby, M.A., Rasmussen, M.D., Roy, S., Deoras, A.N., étal (2007). Discovery of functional éléments in 12 Drosophila génomes using evolutionary signatures. Nature 450, 219-232. Stephan, K.E., Baldeweg, T., and Friston, K.J. (2006). Synaptic plasticity and dysconnection in schizophrenia. Biol Psychiatry 59, 929-939. Sun, M., Thomas, M.J., Herder, R., Bofenkamp, M.L., Selleck, S.B., and O'Connor, M.B. (2007). Presynaptic contributions of chordin to hippocampal plasticity and spatial learning. J Neurosci 27, 77407750. Suszko, M.I., Antenos, M., Balkin, D.M., and Woodruff, T.K. (2008). Smad3 and Pitx2 cooperate in stimulation of FSHbeta gène transcription. Mol Cell Endocrinol 281,27-36. Svingen, T., and Tonissen, K.F. (2006). Hox transcription factors and their elusive mammalian gène targets. Heredity 97, 88-96. Takaesu, N.T., Hyman-Walsh, C, Ye, Y., Wisotzkey, R.G., Stinchfield, M.J., O'Connor, M.B., Wotton, D., and Newfeld, SJ. (2006). dSno Facilitâtes Baboon Signaling in the Drosophila Brain by Switching the Affînity of Medea Away From Mad and Toward dSmad2. Genetics 174,1299-1313. Tavsanli, B.C., Ostrin, E.J., Burgess, H.K., Middlebrooks, B.W., Pham, TA., and Mardon, G. (2004). Structure-function analysis of the Drosophila retinal détermination protein Dachshund. Dev Biol 272, 231-247. Thaler, J., Harrison, K., Sharma, K., Lettieri, K., Kehrl, J., and Pfaff, S.L. (1999). Active suppression of interneuron programs within developing motor neurons revealed by analysis of homeodomain factor HB9. Neuron 23, 675-687. Thaler, J.P., Koo, S.J., Kania, A., Lettieri, K., Andrews, S., Cox, C, Jessell, T.M., and Pfaff, S.L. (2004). A postmitotic rôle for Isl-class LIM homeodomain proteins in the assignaient of viscéral spinal motor neuron identity. Neuron 41, 337-350. Thor, S., and Thomas, J. (2002). Motor neuron spécification in worms, Aies and mice: conserved and 'lost' mechanisms. Curr Opin Genêt Dev 12, 558-564. Tremblay, K.D., Dunn, N.R., and Robertson, EJ. (2001). Mouse embryos lacking Smadl signais display defects in extra-embryonic tissues and germ cell formation. Development 128, 3609-3621. Verschueren, K., Remacle, J.E., CoUart, C, Kraft, H., Baker, B.S., Tylzanowski, P., Nelles, L., Wuytens, G., Su, M.-T., Bodmer, R., et al. (1999). SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5'-CACCT Séquences in Candidate Target Gènes. J. Biol. Chem. 274, 20489-20498. Vogler, G., and Urban, J. (2008). The transcription factor Zfhl is involved in the régulation of neuropeptide expression and growth of larval neuromuscular junctions in Drosophila melanogaster. Dev Biol 319, 78-85. 60  von Bubnoff, A., Peiffer, D.A., Blitz, IL., Hayata, T., Ogata, S., Zeng, Q., Trunnell, M., and Cho, K.W. (2005). Phylogenetic footprinting and génome scanning identify vertebrate BMP response éléments and new target gènes. Dev Biol 281, 210-226. Walsh, CM., and Carroll, S.B. (2007). Collaboration between Smads and a Hox protein in target gène repression. Development 134, 3585-3592. Wenick, A.S., and Hobert, O. (2004). Genomic cis-regulatory architecture and trans-acting regulators of a single interneuron-specific gène battery in C. elegans. Dev Cell 6,151-110. Withers, G.S., Higgins, D., Charette, M., and Banker, G. (2000). Bone morphogenetic protein-7 enhances dendritic growth and receptivity to innervation in cultured hippocampal neurons. Eur J Neurosci 12, 106116. Wotton, D., and Massague, J. (2001). Smad transcriptional corepressors in TGF beta family signaling. Curr Top Microbiol Immunol 254,145-164. Wu, K., Yang, Y., Wang, C , Davoli, M.A., D'Amico, M., Li, A., Cveklova, K., Kozmik, Z., Lisanti, M.P., and Russell, R.G.e.a. (2003). DACH1 inhibits transforming growth factor-beta signaling through binding Smad4. J. Biol. Chem. 278, 51673-51684. Xiao, Z., Liu, X., and Lodish, H.F. (2000). Importin beta médiates nuclear translocation of Smad 3. J Biol Chem 275, 23425-23428. Xu, P., and Hall, A.K. (2006). The rôle of activin in neuropeptide induction and pain sensation. Dev Biol 299, 303-309. Yang, X., Li, C , Xu, X., and Deng, C. (1998). The tumor suppressor SMAD4/DPC4 is essential for epiblast prolifération and mesoderm induction in mice. Proc Natl Acad Sci U S A 95, 3667-3672. Yavatkar, A.S., Lin, Y., Ross, J., Fann, Y., Brody, T., and Odenwald, W.F. (2008). Rapid détection and curation of conserved DNA via enhanced-BLAT and EvoPrinterHD analysis. BMC Genomics 9,106. Zhou, B., Chen, L., Wu, X., Wang, J , Yin, Y., and Zhu, G. (2008). MH1 domain of SMAD4 binds Nterminal residues of the homeodomain of Hoxc9. Biochim Biophys Acta 1784, 747-752.  61  Appendices  Appendix A - FMRFa/Ty enhancer-related images -922  "476  |—H—1|  |  •  *•  Bv  attP2  attP40  L3  L3  Tv nmCherry  L2  Figure A.l. Screen for optimal attP loci for Tv-nmCherry expression. Schematic représentation of TvnmCherry, Stacked projection of larval CNS showing anti-FMRFa (green) and Tv-nmCherry (red) expression in the Tv neurons. Tv-nmCherry was integrated into similar vector backbone as Tv-nEYFP. Similar results were obtained for Tv-nEYFP integrated into attP2 and attP40. attP2 was found to be optimal attP site out of the three candidates, as judged by eye.  62  adult  c CL IL  >>  Figure A.2. Tv-nEYFP is expressed in adult Tv neurons. Stacked projection of adult CNS showing anti-FMRFa staining (red) and Tv-nEYFP expression (green).  63  < (5 I  to 4-J  <U  C  <  Figure A.3. Tv-lacZ is regulated by BMP signalling and can respond to Ap and Dac. Stacked projection of larval (A,B) and embryonic (C) CNS showing anti-beta-galactosidase staining for Tv-lacZ expression. A, B. TvlacZ expression is eliminated in witA12/Bll mutant background (compare A (witA12/+) with B (witA12/witBl 1)). C. Tv-lacZ can also be induced by misexpression of Apterous and Dachshund in post-mitotic neurons by the panneuronal GAL4 driver, elavGAL4.  64  1 Anti-Eya, Anti-FMRFa  D. ananassae L3  D. vîrilîs L3  D. wiliïstoni L3  Figure A.4. Immunostaining of three divergent Drosophila species reveal the conserved expression of FMRFa in the stereotypical Tv neurons. Stacked projection of L3 larval CNS from D. ananassae, D. virilise andD. willistoni. FMRFa peptide was detected by anti-FMRFa (green) in ail three species. Overlaid and individual channel images are shown, except in D.wUlistoni. Expression of the peptide is highly restricted to the stereotypical Tv cluster, as marked by anti-Eya (red).  65  6xHD/BRE-A-ext-nEYFP  AACTTTGGCCTTTtacoaGGCCci  CAGACTTCC(  6xHD/BRE-A-ext-nEYFP  y_  2 IL i  C <  Figure A.5. A 47 bp séquence including HD/BRE-A can drive reporter expression in the Tv neurons. Schematic représentation of 6xHD/BRE-A-ext-nEYFP. The exact séquence used for the repeats is shown. Capitalized letters are highiy conserved throughout Drosophila évolution. Underlined letters indicate additional séquences added to a minimal HD/BRE-A séquence that failed to drive reporter expression in the Tv neurons (data not shown). Stacked projection of L2 larval CNS expressing nEYFP (green in box A, B, D) driven by 6xHD/BREA-ext séquence. FMRFa peptide was detected by anti-FMRFa (magenta in box A, C). Box D shows the extent of ectopic YFP expression along the VNC.  66  Tvwt: AAÇTTTGGCCTTTtgccgGGCCgTAAI ACAGAfïTCÇj gTTtg Tv27 : AACAGAGGCCTAGagccgGGCCgJ^ACAGACTTCœ ctTTts  Figure A.6. An additional séquence upstream of HD/BRE-A is required for reporter expression in the Tv neurons. Exact séquences showing région surrounding HD/BRE-A (yellow/red/green). Tv wt séquence was mutated at a conserved stretch of séquence just 5' of HD/BRE-A (Tv27). Capitalized letters are highly conserved throughout Drosophila évolution. Underlined letters indicate additional séquences added to a minimal HD/BRE-A séquence that failed to drive reporter expression in the Tv neurons (data not shown). Stacked projection of L3 larval CNS expressing nEYFP (green) driven by Tv wt or Tv27.  67  Appendix B - Tv-nEYFP data analysis tables  68  Table B.l. Single-eopy Tv-nEYFP expression in transcription factor mutant background  Gène  Génotype  mean # YFP neurons/ CNS  standard errer  Number ofCNS  ttest vs, Tv-nEYFP  Tv-nEYFP/+  5.7  0.1  18  wit  Tv-nEYFP, witA12/+  5,5  0.2  11  4.3E-Q1  wit  Tv-nEYFP, witA12fwitBU  0.0  0.0  12  6.6E-24  dac  Df(2L)Exel7086/+ ; Tv-nEYFP/+  5.5  0.2  11  4.3E-01  dac  Df(2L)Exel7086/dac3 ; Tv-nEYFP/+  4.8  0.2  14  1.2E-03  ap  apGAL4/+ ; Tv-nEYFP/+  3.0  0.4  10  8.3E-08  ap  apGAL4/apP44 ; Tv-nEYFP/^  0.7  0.3  10  1.2E-15  zflil  Tv-nEYFP, zfhlQ0865/+  5.4  0,2  11  2.2E-01  zfli!  Tv-nEYFP, zfhl'00865à/h 100865  0.7  0.6  9  1.6E-11  ttest vs. Tv-nEYFP, mutant/+  2.1E-16  5.2E-02  3.1E-04  1.5E-06  Table B.2. Single-copy Tv-nEYFP expression after misexpression of transgenes by OK6-GAL4  OK6 GAL4 x wlUS UASAp UASDac UASAp, UAS Dac  Average # of ectopic YFP Nimiber ttest vs. ttest vs. Standard nenrons CNS Error UASDac ofCNS UASAp 0.0 1 0.0 i 0.0 0.0 A* 51.0 3 S.0E-03 6.2 74.3  3.8  3  3.3E-02  Table BJ. Cell count analysis of heteroiygous  Reporter Tvwt-nEYFP Tx^,adA-nEYFP WSiai'-B-nEYFP WlKiadC-nEYFP Tf"***-nEYFP WSiad-AC~nEYFP W^^-nEïFP TvmMadA8C-nEYFP WnMad-iHD-A-nEYFP TV"SfadBHDB-nEYFP Yfibj.cHo.c_ jyjelcom.  •vl  50h  nEYFp  Pmn_7YFP  TV~HEYFP  reporters  Mean #YFPTv Standard Number Error ofCNS neurons 0.1 5.8 72 0.5 7 3.7 0.1 9 5,9 6.0 0.0 12 4.0 0.3 7 4 0.5 45 5.7 0.2 6 0.0 3 4.0 8 0.1 0.1 0.2 6 5.7 6 0.2 5.5 8 0.0 0.0  ttest relative to TvvvtnEYFP 2.5E-13 43E-01 8.0E-02 1.4E-Î3 3.9E-06 6.2E-01 5.5E-09 4.1E-48 6.2E-01 1.9E-01 4.3E-51  ttest relative to  ttest relative to  ttest relative to  j  -n mMad-lî  y mMad-C_  nEYFP  nEYFP  mMad-A  nEYFP  3.5E-01 6.5E-01 7.4E-01 7.7E-06  1.8E-05 3.3E-01 2.5E-06  6.4E-05 3.5E-02 N/A  3.3E-01 4.9E-03  Table B.4. Intensif} measiirement of heterozygous Tv-nEYFP reporters Relative fluorescence intensity of YFPpositive neuron relative to wildtvpe Reporter Tvu'-nEYFP 7V"**'-nEYFP T\/"s'"dS-n£YFP WUad-('-nEYFP nMladiU-nEYFP 7Vu"rf",c-nEYFP T\r"*wc-nEYFP W""ati-i8(-nEYFP T\f"ad-Am-A-nEYFP T/M*MiD4'-nEYFP Wiad-cm-c-nEYFP  N)  (%)  100.0 44.8 111.9 101.5 26.3 39.9 97.5 42.0 7.3 26.8 49.8  Standard Error 3,0 5.1 10.4 7.8 2.4 5.6 10,7 6.5 N/A 2.7 7.6  ttest vs, Tv""nEYFP  # neurons quantified 524 35 48 61 36 27 41 33 1 46 41  3.0E-06 2.5E-01 8.7E-01 2.8E-10 7.4E-06 8.2E-01 9.9E-07 N/A 1.8E-12 5.4E-06  ttest vs,  ttestvs.  ttest vs.  i-mMad-A  np mMad-D  -p mMad-C  nEYFP  nEYFP  nEYFP  1.4E-03 5.2E-01 7.3E-01 N/A  1.1E-09 3.4E-01 1.2E-06  3.1E-06 7.6E-01 1.1E-06  9.1E-12 1.6E-05  Table B.5. Cell count analysis of homozygous Tv-nEYFP reporters ttest vs. Reporter TvMi-nEYFP TV"SiadA.tiEYFP "P^n,,,a<i~A",hi'„ri£yFp HIX4  TV"  -nEYFP  Tvm.UaJ.AHI>-A-nEYFp  WMed-A-nEYFP T\r3U<J-nEYFP YytmSHatl-AHD-A Tvtmsm>-A  _ngypp  iM-KnEYFP  T^'^'-nEYFP  Standard Error  Mean # YFP neurons/cord 6.0 5.8 5.7 0.4 1.0 5.3 5.3 5.7 4.7 0,0  0.0 0.3 0,3 0.2 0.0 0.3 0.3 0,3 0.3 0,0  Number ttest vs. ofCNS Tv-nEYFP 45 4 1.0E-01 3 4.6E-02 7 1.4E-44 2 2.5E-33 *T 2.8E-06 6 1.5E-04 4.6E-02 3 6.8 E-12 3 5 6.5E-48  y  ttest vs.  ttest vs.  -p mMed-A_  •y mMad-A_  mMad-A.UD-A-  nEYFP  OJc> i Jr Jr  8.5E-01 1.9E-Q1  8.6E-01  Table B.6. Intensity measurements of homozygous Tv-nEYFPreporters  Reporter Tvw,-nEYFP Ws,adA-nEYFP TVnf,1adA"(bp-nEYFP T\r'm-A-nEYFP Tv-"'Mad-im'A-nEYFP T\^kdA-nEYFP TV"med-n£YFP TvlnS5Mad.,lHÙ.Amr}EYFp  Tv'm5mASkdA-nEYFP  •fi  Relative fluorescence intensity of ttest vs. YFP-positive ttest vs. ttest vs ttest vs, rp.MHD-A y mt>fad-A jiJHiéfd-A neuron vs. Standard #ncurons 7V*"'Error wildtype (%) nEYFP quantified nEYFP nEYFP nEYFP 5.7 277 100.0 3,8 30.7 2.7E-09 23 1.2E-21 3.7 47 20.5 9.2E-02 2.7E-04 5 7.0 9.7 3 1.7 6.5E-01 5.3 2.3E-03 60 1.4 12.5 1.5B-12 5.2E-09 9.0E-05 35 25,6 3,2 77.6 53 2-8E-03 4.9 24 5.6 0.8 1.1E-13  Appendix C - Tv mutant constructs primers  75  Table C I . Tv^nEYFP reporters iised in this study Reporter  Région of mutation 5*~3*  Tv*'-nEYFP  none  TvMiad-4-nEYFP  TY\ TAG T AGTACG T AATTA  Tf***B*EYFP  AAAGCGCCATAAAGTAGTAGTAGTAAATGOCAAATTAFA  W^-nEYFP  GGCTAATTGGAAGTAGTAGTAGTAGATGTCCCTGCT  Kk,d A!B  combine mutations in m.MadA and B  Miad ir  combine mutations in mMadA and C  M BIC  combine mutations in mMadB and C  T^ T\  '  -nEYFP  - -nEYFP  T/ *  -nEYFP  Miad mc  combine mutations in mMadA, B and C  Mlad im> A  TTTTAGTAGTACGGAGCTCCAGAC  Tv  - -nEYFP  n  -  - -nEYFP  W^WH-nErFP  AAAGCGCCATAAAGTAGTAGTAGTAAATGGCAAGAGCTC  W***omM:-tiEYFP T^i<onsmp-nEYFP  GGCGAGCTCGAAGTAGTAGTAGTAGATGTCCCTGCT deleted this région: TGCCAGAGGCGCCACAATGTATCCTGTTACAGGTTACAGGGrCATAAAGC  T^IH>A-nEYFP  TTTTGCCGGGCCGGAGCTCCAGAC  T^HM.,iEYFP  AGACTCGTTCCCAAAACTTT......CGTAATTACGAACTTCCGTTC  ,M A  W '- -nEYFP >  i A 4k  T\J* '** - - r.nEYFP •pJnxJMad-AlilïA cypn YytmmLt-AMitd-A^fc Yfp  teHD/BRE'A-nEYFP  CGTAATTACGAACTTCCGTCT CKîCCTTTTCÎC ! AGTACGTAATTA GCCGGGCCa FIG ! GTAATTACAdAC GCCGGGCCGTAATTAC '1C AACAGAC 3x tandem repeat of : l'TTGCCGGGCCG'I AAT1ACAGACT1C  Note: Red font îndicate mutated or inserted séquences en  Table C.2. Primer séquences for generating Tv mutants  Tv mutant TvB1 -r inMad-A  *T* mMad-B  -r niMad-C  'T>vmMad-AB  rv.n*1ad-AC  Metbod/ Amplifini Segment PCR segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment PCR segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment  ^1 -^1  Tem plate genomîc DNA T^mMadA/B/t'  TV" <T> mMad-A  TV* Tv*1  **« iriMad-lï  T- mMadA/aC  .-p mMadA/BC  Tv"1  Forward 5*-3' CGGTCTAGAGCCATCTGCAGACGTG GT CGGTC TAGAGCCATCTGCAGACGTG OT CGTAA'ITACAGAC T T C C G T C r r ITGA ACA CGGTCTAGAGCCATCTGCAGACGTG GT CGGTCTAG AGCC ATC TCîCAG ACGTG GT GTAGTAGTAGTAAATGGC AA ATTAT AACGCATACG CGGTCTAGAGCCATCTGCAGACGTG GT CGGTC IAGAGCCATCTGCAG ACGTG GT CGGTCTAGAGCCATCTGCAGACGTG GT GTAGTAGTAGTAAATGGCAAATrAT AACGCATACG  tV  CGGTCTAGAGCCATCTGCAGACGTG GT CGGTCTAGAGCCATCTGCAGACGTG GT  Tv" 1  C G T A A I T A C A G A C T T C C G T C n ITGA ACA  ~r irôrfad-A'B  TViridadA/BiC  -r  inMadA'C  CGGTCTAGAGCCATCTGCAGACGTG GT  Reverse 5"-3'  Restriction site for eoining  CCCGAATTCAATGAGCAGGGACATC  Xbal/EcoRI  GACGGAAGTCTGTAATTACG CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCAATGAGCAGGGACATC TrGCCATTTACTACTACTACTTTATGGC GCTTTATGGC  Xbaï/EcoRI  CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCAATGAGCAGGGACATC TAAGAATTCAATGAGCAGGGACATCTA CT ACTACT ACTTCCAATTAGCCTTCTAG C r r G C C A l T T A C T ACTACT ACTTIATGGC GCTTTATGGC  Xbaï/EcoRI  Xbaï/EcoRI  CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCAATGAGCAGGGACATC  Xbaï/EcoRI  GACGG A AGTCTGTAAITACG TAAGAATTCAATGAGCAGGGACATCTA CT AC.1ACIACTTCC AATT AOCCTTCTAG C TAAGAATTCAATGAGCAGGGACATCTA CTACTACTACTTCCAATTAGCCTTCTAG C  Xbaï/EcoRI  Table C.2. (continuée!) Tv mutant 'f nsMad-B-C  IV  <y irMad-AntflD-A  i _ iM«4 HIIITI n IV  iV -vl  Methoil/ ÂniplHml Segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR segment 3 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment PCR segment  Templatc  Tv w1 1" iriMadA/fr'C  Forwartl 5'-3*  Reverse S'-3'  CGGTCTAGAGCCATCTGCAGACGTG GT GTAGTAGTAGTAAATÛGC A A A H A T AACGCATACG  TTGCCATHACTACTACTACTITATGGC GCTTTATGGC  TvB1  CGGTCTAGAGCCATCTGCAGACGTG GT CGGTCTAGAGCCATCTGCAGACCiTG GT AGTAGTACGTAATTACAGACTTCCG TCTTTTGAACAGTTT TTTCAGC  Tv*1  GTAGTAG TAGTAAATGGC AAATTAT AACGCATACG  "tyWMtOC  Tv* 1  •i- mMadA/rVC  Tv" Tv*"1 •ryriMt*MHM  CGGTCTAGAGCCATCTGCAGACGTG GT CGGTCTAGAGCCATCTGCAGACGTG GT AGTAGTACGGAGCTCCAGACTTCCG TCTTTTGAACA CGGTCTAGAGCCATCTGCAGACGTG GT CGGTCTAGAGCCATCTGCAGACGTG  Tv" 1  or AATGGCAAATTATAACGCATACGGA  Tv"  CACG  -¥• mMad-RmHD-  CGGTCTAGAGCCATCTGCAGACGTG GT  B  IV*1  CGGTCTAGAGCCATCTGCAGACGTG GT  Restriction site for coining  CCCGAATTCAATGAGCAGGGACATC  CCCG AA'JTCA ATGAGCAGGGAC ATC GTC TGTA ATTACGT ACTACT A A A AGGC CAAAGT r r f GGAG ACGAGTCT TrGCCATTTACT ACTACT ACTTTATGCrC GCTTTATGGC TAAGAATrCAATGAGCAGCjGACATCTA CTACTACTACTrCCAATTAGCCTTCTAG C TAAGAATTCAATGAGCAGGGACATCTA CT ACTACT ACTTCCAATTAGCCTTCTAG C GTCTGGAGCTCCGTACTACTAAAAGGC CAAAGTTTTGG  Xbal/EeoRI  Xbal/EcoRl  CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCA ATGAGCAGGGAC ATC TTGCCATTTACTACTACTACTTTATGGC GCTTTATGGCCCTGTAACCÎG  Xbal/EcoRl  CCCG AATTC A ATGAGCAGGGAC ATC  CCCGAATTCAATGAGCAGGGACATC CCCGAATTCAATGAGCAGGGACATCTA CT ACTACT ACTTCGAGCTCGCCTTCTAG CCAGTOÛAT  Xbal/EcoRl  Table C.2. (continuel! ) Tv mutant 1<dcl cciti 50bp  Tv'"" M -nEYFP  "jv.ntlMed  T* mMcd-A  Methotl/ Amplifiinl Segment SOE PCR segment 1 SOE l'CR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment ! SOE PCR segment 2 SOE PCR final segment  Tem plate  Forward S'-3'  Reverse 5'-3'  Tvw1  CGGTCTAGAGCCATCTGCAGACGTG GT  ATrGCCGTCGCGGCGTTT ATGGCTCTC GTCCAGCACCCGAA  3V*  GCCATAAACGCCGCG  CCCGAATTCAATGAGCAGGGACATC  q>vdd<eo<fw Sftbp  CGGTCTAGAGCCATCTGCAGACGTG GT  Tv w1  Tv* '| v mMt>-A  Tvw,  Tv"1  "i> ni3Mcd  Tv*1  Tv* q\jnMc*t-A  CGGTCTAGAGCCATCIGCAGACGTG GT I rrGAACAGTrrTTTCAGCCCCACCC A CGGTCTAGAGCCATCTGCAGACGTG GT  CCCGAATTCAATGAGCAGGGACATC GGCTGAAAAAACTGTTCAAAAGACGG AAGTCTGGAGCTCCGGCCCGGCAAAAG G  Restriction site for eoining  Xbal/EcoRl  CCCG AATTCA ATG AGCAGGG AC ATC CCCGA ATTC A ATGAGCAGGGAC ATC GGCTGAAAAAACTGTTCAAAGAACGG AAGT1CGTAATTACGGCCCGGCAA AAG GCCAAAGTTTTGGGAACGAGTTC  Xbal/EcoRl  CGGTCTAGAGCCATCTGCAGACGTG GT TTTGA AC AGTTTTTTC AGCCCCACCC CCCGAATTCAATGAGCAGGGACATC A  CGGTCTAGAGCCATCTGCAGACGTG CCCGAATTCAATGAGCAGGGACATC GT CGGTCTAGAGCCATCTGCAGACGTG GCTGAAAAAACTGTTCAAAAGACGGA AGTTCGTAATTACGGCCCGGC GT T1TG A ACAGTnTlTC AGCCCC ACCC CCCGAATTCAATGAGCAGGGACATC A CGGTCTAGAGCCATCTGCAGACGTG GT  CCCGAATTCAATGAGCAGGGACATC  Xbal/EcoRl  Xbal/EcoRl  Table C.2. (continuée!)  Tv mutant  *-r v mMad-A-4bp  rr  j  itWad-A-41jp  tns5HLî-A,Mid-A  3xl1D/BRE-A  oo  O  Methotl/ Amplifml Segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment SOE PCR segment ! SOE PCR segment 2 SOE PCR final segment SOE PCR segment 1 SOE PCR segment 2 SOE PCR final segment Anneul/Prîm cr extension segment  Tem plate  Tvw1  Tv" i nftlitf A fly  Tv" Tv"  Forwarcl 5"-3" CGGTCTAGAGCCATCTGCAGACGTG GT TTTGAACAGTTT TTTCAGCCCC ACCC A CGGTCTAG AOCCATC TGC AG ACGTG GT CGGTCTAGAGCCATCTGCAGACGTG GT TTTGAAC AOTTITITC AGCCCC ACCC A  Reverse 5'-3' CTGAAAAAACTGTTCAAAAGACGGAA GTCTGTAAT TACGT AC TAQCAAA AGGC CAAAGT  Restriction site for coining  CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCAATGAGCAGGGACATC CTGAAAAAACTGTTCAAAAGACGGAA GTCTGTAAITACACAACGGCCCGGCAA AAGGCC  Xbal/EcoRl  COCO AATTC AATO AGC AGGGAC ATC  CGGTCTAGAGCCATCTGCAGACGTG •[• mMad-A-tbp  Tvw1 Tvw1  ATHsd-A  None  CGGTCTAGAGCCATCTGCAGACGTG GT TTTGAACAGTTTTTTCAGCCCCACCC A CGGTCTAGAGCCATCTCiCAGACGTG GT CGOTCTAGATIT GCCGGGCCGTAAT TACAGACTTCTTTGCCGGGCCGTAA  TTAC  CCCGAATTCA ATGAGCAGGGAC ATC CTGAAAAAACTGTTCAAAAGACGGAA GTCTGTTGAGTAATTACGGCCCGGCAA AAGGCC  Xbal/EcoRI  CCCGAATTCAATGAGCAGGGACATC  CCCGAATTCAATGAGCAGGGACATC  Xbal/EcoRl  CCCGAATTCG AAGTCTGTAATT ACGGC CCGGC A A AG AAGTCTGTA ATT ACGGC  Xbal/EcoRl  Appendix D - EMSA oligonucleotides  81  Table D.l. List of oligonucleotides used for EMSA experiments Oligo set Tv HDBREA with 2 Medea sites wt Tv HDBREA with 2 Medea sites wt  Ordcrcd oligo name  Oligonucleotidc séquence 5'-3'  TvBRElwZMed sensé TvBRElw2Med antisense  TTG GCC TTT TGC CGG GCC GTA ATT ACA GAC TTC CGT CTT TTG A TCA AAA GAC GGA AGT CTG TAA TTA CGG CCC GGC AAA AGG CCA A  Tv HDBREA mut2Med TvBRElw2Med mut2Med sensé TvBRElw2Med mut2Med antisense Tvlw2Me m2MeB sen Tvl w2Me m2MeB antisen  TTG GCC TTT TGC CGG GCC GTA ATT ACC AAC TTC CGT TCT TTG A TCA AAG AAC GGA AGT TGG TAA TTA CGG CCC GGC AAA AGG CCA A TTG GCC TTT TGC CGG GCC GTA ATT ACA GTA TTC CAG TAT TTG A TCA AAT ACT GGA ATA CTG TAA TTA CGC CCC GGC AAA AGG CCA A  Tv HDBREA mutlVtad+2iVled TvBRE!w2Med mutMad2Med sensé TvBRElw2Med mutMad2Med antisen TvBR£lw2Me mutMa2Me B sensé TvBREl w2Me mutMa2Me B antisen  TTG GCC TTT TAG TAG TAC GTA ATT ACC AAC TTC CGT TCT TTG A TCA AAG AAC GGA AGT TGG TAA TTA CGT ACT ACT AAA AGG CCA A  TTG GCC TTT TAG TAG TAC GTA ATT ACA GTA TTC CAG TAT TTG A TCA AAT ACT GGA ATA CTG TAA TTA CGT ACT ACT AAA AGG CCA A  Tv HDBREA mutate adjacent GGCC + Mad+2Med Tvlw2Me mutGCMe A sensé Tvlw2MemutGCMe A antisense  TTA GTA TTT TAG TAG TAC GTA ATT ACC AAC TTC CGT TCT TTG A  Tvlw2Me mutGCMe B sensé Tvlw2Me mutGCMe B antisense  TTG AAG TTT TAG TAG TAC GTA ATT ACA GTA TTC CAG TAT TTG A  TCA AAG AAC GGA AGT TGG TAA TTA CGT ACT ACT AAA ATA CTA A  TCA AAT ACT GGA ATA CTG TAA TTA CGT ACT ACT AAA ACT TCA A  Note: Yellow highlighted oligonucleotides indicate those that were described in the thesis. Underlined text dénotes start of a new set of EMSA oligonucleotides.  Table D.l. (continuée!) Olijjo set  Ordered oligo name  Qligonucleotide séquence 5'-3'  Tvl w2Me mMad sensé Tvlw2MeraMad antisen  TTG GCC TTT TAG TAG TAC GTA ATT ACA GAC TTC CGT CTT TTG A TCA AAA GAC GGA AGT CTG TAA TTA CGT ACT ACT AAA AGG CCA A  Tv 1 w2Me mMaMel B sen Tvlw2MemMaMelB antisen  TTG GCC TTT TAG TAG TAC GTA ATT ACA GTA TTC CGT CTT TTG A TCA AAA GAC GGA ATA CTG TAA TTA CGT ACT ACT AAA AGG CCA A  Tvlw2MemMaMe2B sen Tvlw2MemMaMe2B antisen  TTG GCC TTT TAG TAG TAC GTA ATT ACA GAC TTC CAO TAT TTG A TCA AAT ACT GGA AGT CTG TAA TTA CGT ACT ACT AAA AGG CCA A  TvBREInoMed sensé TvBREInoMed antisensé  TTGGCCTTTTGCCGGGCCGTAATTACAG CTGTAATTACGGCCCGGCAAAAGGCCAA  TvHDBREA mutMad  TvHDBREA mutMad+Medl  Tv HDBREA mutMad+Med2  Tv HDBREA noMed wt Tv HDBREA noMed wt  Tv HDBREA noMed mutMad TvBREInoMed mutMad sensé TvBREInoMed mutMad antisen  CTGTAATTACGTACTACTAAAAGGCCAA  Tvl noMe mutGC A sen Tvl noMe mutGC A antisen  TTAGTATTTTAGTAGTACGTAATTACAG CTGTAATTACGTACTACTAAAATACTAA  Tvl noMe mutGC B sen Tvl noMe mutGC B antisen  TTGAAGTTTTAGTAGTACGTAATTACAG CTGTAATTACGTACTACTAAAATACTAA  TTGGCCTTTTAGTAGTACGTAATTACAG  Tv HDBREA noMed mutate adjacent GGCC séquence  Note: Yellow highlighted oligonucleotides indicate those that were described in the thesis, Underlined text dénotes start of a new set of EMSA oligonucleotides. oo  Table D.l. (continuel!) Oligo set  Ordered oligo name  Oligonucleotide séquence 5'-3'  TvBRElwlMed sensé TvBREl wl Med antisense  TTG GCC TTT TGC CGG GCC GTA ATT ACA GAC TTC CG CGG AAG TCT GTA ATT ACG GCC CGG CAA AAG GCC AA  Tv HDBREA witfal Medea  site Tv HDBREA withl Medea site wt  Tv HDBREA mutMedea site TvBRElwlMed mutMad sensé TvBRElwlMed mutMad antisense  TTG GCC TTT TAG TAG TAC GTA ATT ACA GAC TTC CG CGG AAG TCT GTA ATT ACG TAC TAC TAA AAG GCC AA  Tv HDBREA mutHD site TvBREl wl Med mutHD sensé TvBRElwlMed mutHD antisense  TTG GCC TTT TGC CGG GCC GGA GCT CCA GAC TTC CG CGG AAG TCT GGA GCT CCG GCC CGG CAA AAG GCC AA  TvBREl 2Medonly sensé Tvl 2Medonly antisense  CGT AAT TAC AGA CTT CCG TCT TTT GA TCA AAA GAC GGA AGT CTG TAA TTA CG  Tvl 2Medonly mut2Me sensé Tvl 2Medonly mut2Me antisen  CGT AAT TAC GAA CTT CCG TTC TTT GA TCA AAG AAC GGA AGT TCG TAA TTA CG  TvBRE2 sensé  GCC ATA AAC GCC GCG ACG GCA ATG GCA AAT TAT AAC GCA TAC  Tv HDBREA+ 2Medea sites without M ad A Tv HDBREA + 2Medea sites without MadA wt  Tv HDBREA mutated both Medeasites  Tv HDBREB Tv HDBREB wt  00  GTA TGC GTT ATA ATT TGC CAT TGC CGT CGC GGC GTT TAT GGC TvBRE2 antisense Note: Yellow highlighted oligonucleotides indieate those that were described in the thesis, Underlined text dénotes start of a new set of EMSA oligonucleotides.  Table D.l. (continued) Oligo set Tv HDBREB mutate Mad site  Ordered oligo name  Gligonucleotide séquence 5'-3'  Tv2 mutMa sensé Tv2 mutMa anti  GCC ATA AAG TAG TAG TAG TAA ATG GCA AAT TAT AAC GCA TAC GTA TGC GTT ATA ATT TGC CAT TTA CTA CTA CTA CET TAT GGC  Tv2 mutHD sensé Tv2 mutHD antisen  GCC ATA AAC GCC GCG ACG GCA ATG GCA AGA GCT CAC GCA TAC GTA TGC GTG AGC TCT TGC CAT TGC CGT CGC GGC GTT TAT GGC  TvBRE3 sensé TvBRE3 antisense  GCT AGA AGG CTA ATT GGA CGT GCC CGG CCA GGA TGT CCC TGC GCA GGG ACA TCC TGG CCG GGC ACG TCC AAT TAG CCT TCT AGC  Tv3 mutMa sensé Tv3 mutMa antisense  GCT AGA AGG CTA ATT GGA AGT AGT AGT AGT AGA TGT CCC TGC GCA GGG ACA TCT ACT ACT ACT ACT TCC AAT TAG CCT TCT AGC  Tv3 mutHD sensé Tv3 mutHD anti  GCT AGA AGG CGA GCT CGA CGT GCC CGG CCA GGA TGT CCC TGC GCA GGG ACA TCC TGG CCG GGC ACG TCG AGC TCG CCT TCT AGC  BrkS EMSA sensé BrkS EMSA antisen  AAT TCG ACT GGC G AC ATT CTG TCT GTG GCG ATC GCG GCC GGC CGC GAT CGC CAC AGA CAG AAT GTC GCC AGT CGA ATT  0/+ vg comp EMSA sensé Q+ vg comp EMSA antisense  TTT GTG CTT GGC TGC CGT CGC GAT TCG ACA ACT TTG G CCA AAG TTG TCG AAT CGC GAC GGC AGC CAA GCA CAA A  Qm vg comp EMSA sensé Qm vg comp EMSA antisense  ITT GTG CTT GAG ATC TAG ATC TAT TCG ACA ACT TTG G CCA AAG TTG TCG AAT AGA TCT AGA TCT CAA GCA CAA A  sal Ml EMSA sensé sal Ml EMSA antisense  AAT CAT AIT AAG ACG GGC ACA TTA TAA A TTT ATA ATG TGC CCG TCT TAA TAT GAT T  Tv HDBREB mutate III) site  Tv HDBREC Tv HDBREC wt  Tv HDBREC mutate Mad site  Tv HDBREC mutate HD site  Mjsc. niions  AAT CAT ATT AAA ACG GGC ACA TTA TAA A sal pm808 EMSA sensé Note: Yellow highlighted oligonucleotides indicate those that were described in the thesis. Underlined text dénotes start of a new set of EMSA oligonucleotides.  Table D.l. (contiriued) Oligo set  Ordered oligo name sal pm808 EMSA antisense  Oligonucleotide séquence 5'-3' TTT ATA ATG TGC CCG TTT TAA TAT GAT T  Vg EMSA sensé Vg EMSA antisense  CTTGGCTGCCGTCGCGATTC GAATCGCGACGGCAGCCAAG  Tv con50 région  Tv mutcon50 A antisense  TGG ACG AGA TGC CAG AGG CGC CAC AAT GTA TCC TGC CGC AGG TTA CAG G CCT GTA ACC TGC GGC AGG ATA CAT TGT GGC GCC TCT GGC ATC TCG TCC A  Tv mutcon50B sensé Tv mutconSOB antisense  CAG GCC GCA GGG CCA TAA AGC GCC ATA AAC GTT TAT GGC GCT TTA TGG CCC TGC GGC CTG  Tv mutconSO A sensé  TTC AAA AGC TGG CTG GGA TGG GGT GGC CCC GGG TGC TGG ACG AGAT ATC TCG TCC AGC ACC CGG GGC CAC CCC ATC CCA GCC AGC TTT TCA Tv mutbef50 anti A Note: Yellow highlighted oligonucleotides indicate those that were described in the thesis, Underiined text dénotes start of a new set of EMSA oligonucleotides. Tv mutbef50 sensé  oo en  Appendix E - EMSA-related figures  ..  •  **»**  %.  -^  'Û  ^  4L  s^  &  ^  4L  'iA  4L  *£  ^  tf  S  o-  ift  *  <>  ^  <S.  -*  €•  Figure E.l.SDS-PAGE analysis of bacterially purifîed proteins used for EMSA. Bacterially expressed GST, GST-LIMless Ap, GST-LIMless Islet, GST-LIMless Lim3, GST-MadN, MBP and MBP-MedN were quantifiedby UV Spectroscopy at 280nm. 3ug of products were loaded onto a 10% gel, ran and stained with coomassie blue. Ladder is BioRad Précision Plus.  87  -476  -922  1—0-D-flJ  HVÏRF;  V  A BC wtA: TTGGCCTTTTGCC GG G CC STAATTACAGACTTCCG mutBREA: ÂGTAGTA mutHDA: GAGCTC ^ ^ ^ wtB : QCCATAAftC GCC GC GAC GGCAATGGCAAATTATAACGC ATAC  B  mutBREE: mutHDB: GTAGTAGTAGTA T; wtC : GCTAGAAGGCTAATTGGAC GT GCCC GGC CAGGATGTCCCTGC mutBREC: 3A3CTC mutHDC: AGTAGT AGTAGTA wtA  mutHDA  wtA  mutBREA  wtB  wtB  mutHDB  wtC  mutHDC  mutBREB  wtC  mutBREC  ^JAadU  ,m * • • • - • • »  - -  j —y  mmmm  * i  . * *  Figure E.2. Apterous and Mad can bind specifîcally with ail three predicted HD/BRE séquences. A. Schematic représentation of FMRFa locus, with Tv enhancer marked by its position relative to the FMRFa transcriptional start site. HDBRE-A ,B and C are marked in red/yellow box in the enhancer. Wildtype and mutant séquences of oligonucleotides containing homeodomain-binding sites (red) and predicted Mad-binding sites (yellow) are shown. Red font indicates mutant bases. Exact séquences of oligonucleotides used for EMSA in (B) are shown, except for wtA, which is missing the séquence 5'ACTTCCG-3' in the 3' end in this particular EMSA experiment. B. Bacterially-purified GST-LIMless Ap (top panel) and GST-MadN (bottom panel) can ail interact specifîcally with each HDBRE in vitro. Binding activity is lost when each protein is tested for binding to oligonucleotides bearing mutations in their corresponding binding sites.  88  Appendix F - Proctolin -1077  -24  f  -577  |  -1077 -977 -877  Ë  j — •  1  V  Proctl_GAL4  +1012  1  ~^/ Procttran GAL4  GGTAXGSATG ASCAIAITGC XACTACTAIT CCXC&XCCCA XCGGCSXCSI aaaa&cccrr GCCCXGCCCG AAACTGGCCC Acrxcce&XG CCCGXC&CGX CCAXACTX-AC xcgxATA&CG SXSATCAXAA GGAGT&GGGX AGCCsgagçA_xsxiTGGGAA CGGGACGGGC XTXGACCGSS XS&AGGGTAC GGGCAGTGeA ATTCA&TCAC ASC&AXGGeX ACAgAAAAei SCGCXAXAXC A&AAAXXXCG BM^TCGST gSTSCSXSST AXXÇaAAXSG ICC&TTTCAC CGACACCACA XAASXXASXG XCGXTACCGA r e r e i r ^ a CSCSAXAXAS XXXXTAAAGC HPTAGCCA GCACSCACCA XA&SXXTACC aecmasTC gcrerssrcr .G CCAXAGCCAG CCGC&CAIAX CCCASCAGCG C G G A G G A B | M C A X A A C A A X XGiSXGCXGG GCTCCAGITA ACSXTAACCA AAGICGXAGC  -777  ; GSXAXXGSXC GSCGXGXAXA GGGXCSXCSI: s c x i : c x g | BsxaiTGTia. AcrcACSAgi: XSASSXCAAX ISCAAXXSSX XXXASCAXXS ACCAAGGACX GGGGCAXXXA TTSACGCCCG CAAXGXgAAg AAXrGC&SCC AXGACGACGG CAGXCCCAAC I S O U t U I AACAGCAACA GXGCGGXAAC XGSXTCCXGA ceecGTAAàx AACXGCGGSC: SXXAXAGXXS XXA&CSXCGG XACTGCTGCC GisaGSGXXs XCSXTGAXSA XXGTCGXTGX CACSCCAÏTG  -677  J i l S t t m « AACXAAGASA XACCCISDUkÏXAAAXAACA AAAXACXGCX AIAISAAAAX WTÏGA&AXC XTAAACISXT XAXSXTXAGA XTTCAAAAAC TTSATTCTCX AXGSGAXàTT iGXXTAITGX XXTAXSACGA IAXACIXTIA nU«XXXXAG AAXXTGACAA AXACAAArCT AA(  _577  XSAITAXASC AAGGGACAGG ACACAIXTCI XSXSAAXAAA AAACCGAXGJHMfccAAXEA AAAAXTGXXS TGCACTCATG CS.CTCASXAG XTAXTECGAA A C ^ H A T C G XTCCCXGXCC XGXGXAAAGA ACAXXTAXXT rXXGSCXACT AAIASIXACX XXTTAAC&AC ACSXSASTAC: S X S A S m X C UX3UU6CIT  -477  XXTAAAialT AXXSXGGAXA XXITA1XXTA ITACXAXSCG AACI'AIXIAI XTCAGXTCei CCXaXATACC C A : m M H = C U I K C & = AAAXXXAXAA TASCACCXSX AAAATTAAAX QXGGXACGC XXSAXAAAIA AASXCAASSA SGAIAIAISG SX G A A X j ji.. SSTTITITSSXS  -377  ACAACCCACX AAAACCCGCA GXAACÎTAAC CAXSAAAGXX SSCCAAGCGA AACCAIXTCG CC2.GATSAAS CtXTCXGXTC GGGATSCTSS XAXSGCSSSG XGSTGGGrsa XTXTGBGgsx CAXXSAAXTg GXAaxTCAA ccGsrxcscx XTssxAAAgc ssxcxacn-c saaAGAX&AG CCCIACSACC aiaccgcccc  -277  XXXTXXXTGG GCGXGETGGG CGTAIACGI» ÏHkXGAIGAX SACGCCCSAS A&C&GGACAS XAGAAAXSCG AGSCCACACA AACACGGrCG CGCACASCCA » » » » » w CGCACGACCC SCAXAXSCAt JklïACTACrA CIGCSGGCIC ÏTSTCCTEXT AXCXXTACGC XCCSGXGTSX TXGXSCC&GC SCSXGTCSGX  -177  CAGGCACAXG XAAACGAGXG XSXGGXGACA ATGATAtGGA XAssAxsrxs XTGXTXGGXA. CSTXCGCI'GG CXXTXCCCGA GXCCGX ïI>.C ATi-recicic ACACCACXSX XAŒAXACCX ATCCTACSAC SAC&AACCAX GAAiGCBlCe BAAAAGGGCT •iSS&CAAAC CAAASScM • t C S A A I X C C • > ^ H H n r j % n T T TGAAATCGGG AAAGAGCrCG ACTSTACCCC XXTCXCSASC CGAASXcfl JrCCXGXXX'S £"T.C:£:3-ÂX2^BASCXXAASS • I r i ' H ^ ^ H f c T P S c i s r M  -77 +23  ASIXCACAIC AXCSCXCSGG XAAAKX'AIA jxscrtseex ' I S I X S EA0CGA6CCC AXIiaAAXÔX AACAAXASSA  +223  ÏTASCSaCCC ACICGCSCCa GSACAACTCC GT&ACÏTGA& ACXCCAXCSA AAAACACAAA CCSXSASrCA CAXTSAACXT ESASSEASCr xxrx. sr iz~.~ SSÇAStCASX AAXCSSXGSG XSASCGCSSX'  Hjssisxx  afigSggg SXgBAAgeSA  rtïcœccsAA  +123  +323  CSXXGCSCGC t o m u M GCGAOeCGCG CSXSAIXXXX f£ZT%lHI^MH .--r.7 .^.rXCGS s sr-vrB hrxxxAHHHc  ;css;îiesA ^î?ca^;;£c S5c?7c:r CGXCAXCX!:: AAàXKCGSg ZASXSgcsca. Arm'SGCX'A IAAAXAS.AA xsxcssgAgs -GflCACgAÎ^: XCCSeXG^CG CCG;A?5---CC BCASXAiSASS -XXASASC:C:S SrgASSSCS; XAAAAre5Â,X j^XXAXSXXX AZASgCBXSg •CCX'CAA  SAXSACXASA CTACXSAXCÏ  CAAAACACAX rCGCTACSXS ACGÎTGÎTAG SACSSAATAC CXSCCXTAXS SAASCSGCIT fîXXXX'SXSXAAscsaxecac  casesssers  CiSSX'SXASA XSXSCCASXT ACACSBXCAA  «rccAcewa  secxTcscrx  CTSSXXXCStS XSXCASXSCC Axuscssxa& ATIT-CGASXA TTSfrS!i||jjjf.~ CX'gXXX C:Ei.X XSSSXAAACA AACCAASX'SS CS'eCSCTSCA CSSAASCE&A SACCAAASTC ACASIC-ACSS XMRBSXAXX XAAASCÎCSX u o a m s ^A£5AAASXXi iCCffiAXTXSI5 iiitwm WWII i  neeraracc  XXTAMTX-SA AXXXXXCSSA SSCSCCACXT SAAAASAAAX ACACSCSAM: ASAASXTA&A AAilTXXACS T M M W T f coocesnoA C H T Î C M T A XSXSCSCÎTS TCÎTCAAIXÏ  +423  ICAASAAAAC SXXTXATTAX CAAAAZï&ZA AISACSCSIC ASXTiSÎTXS  +523  SXTGXAGAAC S^^Hx:CX*AA AAAXTCCA^X CAAAXAXtTA XAAGXXTCAX CAACaXCIXS CTCTS.-.SB.ÏX XXTASLSSXTA BTÎîaEAAAS ATXCASASEI'A  +623  CCCAACXAAC AXTSAXCTSA A^^BAAX'AA E3SXX3AXXG X CASAS SX IX XAACXASACT  +723  AXSCXXSCAA GAXTXAXSAS XAAAXTUZA SBAATCCCAS XSSAXSACXC XSCXTCASXC a W B i M T » Aixr»xci.sx' caesceatnc ccrscAixcr TACSAACSXT CXAAAIACXC X&SCCTXTST XXAAIAEX"A STSASKAAS SSACSXTASA çgmxwitc MXXtOMB  +823  SXSA^^BSX GCSAXGCATX XXXSSXX7 SX XXXXAXTCCC ACXSCSSCCC CACSTtAAAA CaSCXACGXAA ASACCÏAACA xsAcsrxsss SXSSAAÎXTX  +923  ter—srcr-  es  iMir  -  csxxTcarxx  ïssm  •iSAKXAA HxXX'^AAXX  asmoe  TCarSCAAXE CTGCA&GSSS XACAC31XACEASTACSIXAC sAcsxrcccc AîeiGEAÏSA  ICCXXSCASC ^.SSA^^SX "s  SAXXSXSAAA XAXAAAAAAS XX&C3.SAAXT STAiCASAXC CEAACACXXX AIAIXXXXXC AAI'SÎŒTAA AAXTSXXX'AS AXASAITCCC SASASAXAAS CXZC&BSBOBC XAXCXAASSS cxcxcx.vr.x L: SAASI«EACG  sccM'caaia XI'SCCAISCC cssx^sxxsx AAC&SXiCSS ccssxsccAr scccccaAcc  i A X X A a m x wCXSÏAAXXB XTAATSXSXA BSAceaxaaJ ASSACAACAl  ^eoeaMseae C S S S S S i I S S ~ ™2T SÏZXSZM 1 im Figure F.l. Detailed analysis of proctolin cis-regulatory région included in the proctolin reporters. Evolutionally conserved cluster of séquences across Drosophila species ((D.melanogaster, D. erecta, D. persimilis, D. pseudoobscura, D.virilis, and D.grimshawî) are underlined. The putative proctolin core promoter (red font) is found to be surrounded by a cluster of homeodomain consensus (highlight in red), Mad consensus or near consensus (highlight in yellow or purple)/Medea consensus (highlight in green) séquences. Start methionine of GAL4(and also proctolin) is highlighted in blue.  BS  89  n  /-  -577  -24  h -24  -1077  -f -577  h  /*-  n r  procîolm  i l_  -1012  {"  | ^ proctô G4L4 &4L4  [y  proctLGAL4 procttranGAL4  § • procttmn5LGAL<  Figure F.2. Proctolin enhancer-GAL4 constructs. Schematic représentation of proctolin enhancers linked to GAL4 drivers.  90  proctL  0AL4  S: CD UJ  proctS GAL4  1  -£2 C 00  3 ventral  dorsal procttran GAL4  S: CD UJ  g C co  3 ventral  dorsal  Figure F.3. Expression pattern oîproctolin reporters in the VNC of the 3rd instar larvae of Drosophila. Confocoal z-series of the ventral and dorsal sides of the proctLGAL4 (A and B), proctS GAL4 (C) and procttran (D and E) reporter expression in the dorsal and ventral régions of the larval CNS. UAS-nls-mycEGFP is driven by the above reporters for détection of expression. No dorsal image was included for proctS QAL4 because no ÙAS-nls-myc-EGFP expression was detected. UAS-nls-myc-EGFP expression was detected in the Pc neurons (white box) when driven by procttranGAL4 (D) but not byproctLGAL4 (A).  91  procttranGAL4  ô -1—'  O O Q_  c CD  CL CD LU o  5  1*9  ç:  .G4I4  Figure F.4. The procttran™"1 reporter produced similar expression pattern as Proctolin at fîrst instar larval stage Ll. (A) Merged confocal z-series ofproctLGAL4,UAS-nls -myc-EGFP expression pattern (B) and immunostaining of Proctolin (C) shows overlap along the midline clusters of neurons and the Pc neurons (A, white box).  92  PrtranGAL4/UAS nmEGFP; witB11/+  PrtranGAL4/UAS nmEGFP; witB11/witA12  Figure F.5. Prtran GAL4 is regulated by BMP signalling. Stacked projection of larval LICNS showing UAS nmEGFP driven by Prtran GAL4 in wildtype (witBl 1/+) and wit (witBl l/witA12) background. Prtran is a ~1 kb translational fusion with GAL4 takenfromjust infrontof the proctolin ATG codon.  93  Figure F.6. HB9 and Um3 are two homeodomain transcription factors expressed in the proctolinexpressing Pc neurons. AU VNC were dissected from l st instar larvae (A) Merged z-stack image of antiProctolin immunostaining (B) and HB9GAL4 UAS nls myc EGFP expression (C). (D). Merged z-stack image of anti-Proctolin immunostaining (E) and Hm3GAL4 UAS nls myc EGFP expression (F). Anti-Proctolin immunostaining for HB9/+ (G) and HB9/HB9 (H) showing that HB9 régulâtes proctolin.  94  Figure F.7. The 553 bp proctolin and 445 bp FMRFa enhancer are both BMP-responsive. Left panel depicts a diagram of Tv (red) and Pc (neurons) in the Drosophila central nervous system. Visualization of enhancer GAL4 > reporter nerve cords from first instar larvae (A-D). Compare A and B for 553 bp proctolin reporter expression in wildtype versus BMP mutant. Mutation of Mad binding séquences in the 445bp FMRAa reporter resuit in loss of reporter activity (compare C and D. BRE stands for BMP response éléments and are Mad binding sites).  FMRFa  1 : GTCT-Nis-GCCGGGCCGTAATTACAGAC 2: ^ B - N I O Î - C G C C G C G A C G G C A A T G G C A A H B T A A  3: • | N , e 7 - G G C i H r G G A C G T G C C C G G C C A G C - N m - | | Proctolin: 1. CGGCTTCGG—AGGACAAACCAAAGGC^BTTCG 2.H^i2»-GGGCGTGCTGGGCGTATACGTJ^TGATGATGACGCCCGA  Figure F.8. Ciuster of homeodomain (purple) and Mad (yellow) and Medea (green) séquences in the 553 bp proctolin and 445 bp FMRFa enhancers. Note that shown séquences are not necessarily identical to the consensus ones.  95  VNC T1 T2 T3 AI  • T v neurons: FMRFa TFs: apterous* squeeze dachsund eyes absent * dimmed phosphoMad • Pc neurons: Proctolin  TFs:lim3* H89* A8  blistered ftZ*  squeeze eut * odd-skîpped* h b * dachsund achaete" dimmed phosphoMad  Figure F.9. Expression pattern of FMRFa and Proctolin in BMP-responsive cells in the ventral nerve cord (VNC) of the Drosophila melanogaster. Tv (red), and Pc (blue) neurons. TFs (TFs) in each cell type is listed. Asterisks dénote TFs that are uniquely expressed in the Thoracic (Tv) or Posterior cluster (Pc) neurons.  96  Appendix G- dilp7 -1040  +660  Dilp7 GAL4  , „ . . ASCAACSIAA ATSCSTATAX Mauaaanar TCXAcrscMTCCTASCACAGrrErssaàr i s u o r n i rrsAArrxis l u o u i a ACCGCSAACA -1U4U TCSTXSI&IT ricscftTAT* XATTTAC&XA ASSISACSIÊ ACSATCGIGE ouuaccira ACHSITATA jutcrnuxc rrrcnroeT xsscscirsr  -940  A*X5GC*»£& rrGAACAAAA GAAAASÏTTA AAXAXXCXAG IATASSCSEA Aca.rAAAAî.1 ASXTTITITS XSTACCCXSX ASSSTAITCS CXASCCGCCX  TTACOSXXXI AJLCnSSTTT CXTTTCAAAF TTAEUkSATC AÏATTCGCAT TGTUTXtTA SBttMaa»C ACAT-SGSSOi TCCCATAASC SAICSSCSSA  _g^Q ATÏCBCSSSA uutGAue Httscr&ere TIXAUUU uaeecsra a a s i r s n e TC&TÎSXTTT AKATÎTCAS m m s e u AisesiiiE XAAGASCSCI i t t i s c m e XXTTSAFCAC AXAXXXXXXX XXTSCSTAAX acrmase  -740  *Bnant.*% TSSTAAASXC ASXAAÏACTT rrcacrm»  ÏATTGTATTT GTlïATSAiT SEATirSTkC JUrakUOTT IGTTCATTSI GITAiiriAA AATTSAIGAC TCTGTGTAeA C U t U ATAACAXAAA CArATACEXA CMArACATG T i a X Î X G I A i ACAASSAACA CA&TTTAITr TXiACIACTS AGAtACAIGX GTTAE  „,. TTATTSSC&T GCCSCTGGÏT TTC&CFFCFA TTTS -O40 AATÀACCGÎA CGCTCACCAA AASTSAiGAT  GTTMAATOG MTGaiTTii iiCTEGIliG CirtSA CAAATTTAGC riAOTASAÎT ETGÀACAÏTC GTAACT  ximt  'AAAATA CÊAIASÂMA iSASiCiiCI  -540 smacuii» CTGïTiAsrs ecsssrim JUUUTQSÛI irasmcaT cracxaiTrs Tnacroot SKECCCAIAI ssracssm amTTsrcE CAMIGTTAI CÎ.CAKTCAC SGTCCGÏTT TTT11GTCGA AATCA&AGTA GGTGailAAC iiilSIGTIS CÎMGGTÏTA CTSTGCCA&S niMttOCr ::TMi-.r.-. XÏTSÈ a a x r c u s ax -440 AAssauxa m e e c n r e àjaccsarsA. iiccrecsoB s azz: srsriiSTTC TTsœnTàT aaiccssiic nTssiriiT TASSACSCSC  -340 AAerxcasrr CGAA&GCACÏ XACAAAAAAA iaiAiaaxrc SSSAAAAXAA sscrrccaaA ASSCSACCSA ACACCSSC*G tercaxocsa eaacnusAcx  rr:a&sicfc& m o e w i a r g m m r Txrrma&s a c c n x m i ccsa&ssiTi xeesiissiT TBISSCCSTC anujr&ssn ensarriai.  _240 ïSAAXiSCiô SCCAA5SASS AASSACCrCC ACTÏSSASCÏ STTSSA6CAT rSFGTSGAG» AAASSTSCAT carUXTÏOt CâCSSAACSX STSaiCASCG scrraxcsxx. CSSOTCCTCC xxccrss&ss xasaccxcsa CAACÎSCGES SÎÏCACSTCE xxzecacsxa SEAUTAASI srscnx.sxÊ axxTçrcss: ItïTATSCAT acrEGC&C&S Tgj3a-Tt-J.a» SAAAAXCAiC ITC :XA sctsiecESE TT rACA CCCGCCSAiA ASAAXACSIA rSASCSTSTC AOCCSASTIT CrUTASETS CGAXXCGATA  -140*  _4Q K R U U E B +  i  S  ISUTTEETT ITiîxTTHS:  s ssn'&cxAAr SSXSXiJI j/gZ SIA^^|«X  gQ GCmTlSCC C1CEGTTTCG OH3U3USHX TSi£àTTCSÏ SCAAAEATÏS i3UyUIÎTir SCSaSCTTCG AAAtAAiiiC àÂGKCMOG San'CCSSCI CS&AUXC36 STiSACAAASC SSSTSTCarA ACXTïaiSCA CerrTATAAC 5 m T H m C^XCSAASC XXXATTTTXS ITC2.CSSSCC SEAASSCS3SA  1gQ gsrriTAcsA saaAMJggr 0 f i f t oiCAisiAis + ^oU SXGXiCÊTiC +  ssnmacc ggssTTSTgG msasAAsis UCKTKK mena Aœrii  ACXBEmSC E +  S-ST TSSTTÂSÂST AÂÎÂXKÎÎTA TT ACMAICICA. TX3X4X3SAX  GXMCITGCÛ csan-TAis gzgT'SAA.gss « u » w a ccrsaârn' scxsassii SSàGGITlAi CGiO Gira xsxuxseaT ISSEAUSSU iciTiiccrà i c c a i c c »  gespcn aauuuiM SSMCCSMS ccusscstg NSCOBBIK A^CSSCCAAC:  isccîisciA rgaaargsrt iim.ny.55 .riiTi'Gri'cy f^&£&^u»£, icnro-cci  BBOOKXaCE CASSî'i icc:-::c : • :S5C35C*5C SSSCISECAà "CSSCSStSS iàTCCAi  casscrsas sresacsFg ajaiKss g^giçgçe ccxs&ccsss ssicissscc:  STGGIMIIC SGCacsseiA i c o i n s A ; a m a t a » g m m -sssxssr-s ASACSSSC: s s i i c s ^ a n s c r s a s i "sxtsssgs sgcissscgi ASSAKESSA  ess nATATTT-ca AAiccrsAcs itacaccsa.!; CCCAiSCC JUŒSX2UST tTTISaCTSÎ' TSTSTSiSCTS  cgQ CAEASCSCXC AsrosecACB csxecsceES sxsaocoBca i-casearcas csrrcEtTcs axasccsscs ABC&CULTXC ssssacsiasi s x : i ; s c s à 3 r œ c c s i s c SÎ.^EÎ-ÎSSS. CACICSSCSX &srzc£&sx:: K à i s s a ^ s c x^xcesuec: xcsrsxu&s zzzszszzzz  îesutou zaïszsiii::  +660  Figure G . I . Detailed analysis of t h e dilp7 cis-regulatory région included in t h e dilp7°AL4 reporter. Evolutionally conserved cluster of séquences across Drosophila species {{D.melanogaster, D. erecta, D. persimilis, D. pseudoobscura, D.virilis, and D.grimshawi) are underlined. The putative dilp7 core promoter is in red font. Clusters of homeodomain consensus (highlight in red), Mad consensus or near consensus (highlight in yellow or purple)/Medea consensus or near consensus (highlight in green or light green) séquences was found. Start methionine of GAL4(and also dilpl) is highlighted in blue.  97  dilpTGAL4  Figure G.2. Expression oîdilp7-GAL4 in lst Instar larvae oî Drosophila. Projected whole VNC confocal zseries of the lst Instar larval VNC .myc. EGFP. Both are expressed exactly in a pattern consistent with previous reports.  98  Appendix H - Bioinformatics Black capital letters represent bases in the D.melanogaster référence séquence that are conserved in the D.simulans, D.sechellia, D.erecta, D.yakuba, D.virilis andD.grimshawi orthologous DNAs  ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggaca cccaataaacctgtccaaaaacccgacacatttctgcccagtcatgcgtggtggacaatagccaaatgcc attgatgagactcgtctccaaaactTTgGCCtTTtgccgGGCCGTAATTACAGACTTccgtcttttgaac agttttttcagccccacccaagagccgagtcttgaaaagctggctgggatggggtggtttcgggtgctgG AcGagaTGCcagAGGCGCCACAALGTATCCtgctacagGTTACAGGgCCATAAAgcgcCATAAacgccGC GACGgCAAuGgCAAATTATAaCGCATACgyACAcGTAGtcgatccactggctagaaGGCTAATTGGACGf gcccggccaggatgtccctgctcat Black capital letters represent bases conserved in ail species and colored bases represent séquences présent in ail species except D.simulans, D.sechellia, D.erecta, D.yakuba, D.virilis or D.grimshawi  ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggaca cccaataaacctgtccaaaaacccGACaCATTTCTGCccAGTCATGcgtggtggacaatagccaaatgcc attgatgagactcgtctccaAAACTTTGGCCTTTTGccgGGCCGTAATTACAGACTTCCGLCTTtLgaac agttttttcagccccacccaagagtcgagtcttgaaaagctggctggGATGGgGTGGtttcGGgtgctgG AcGAGATGCCAgAGGCGCCACAAtGTATCCtgttacagGTTACAGGGCCATAAAgCgCCATAAAcgccGC GACGGCAAf GgCAAATTATAaCGCATACGgACACGTAGt c gatccact ggc tagaAGGCTAATTGGACGT GCcCGgCCAGGATGtccctgctcat Black capital letters represent bases in the D.melanogaster référence séquence that are conserved in the D.simulans, D.sechellia, D.erecta, D.yakuba, D.pseudoobscur a, D.virilis and D.grimshawi orthologous DNAs  ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggaca cccaataaacctgtccaaaaacccgacacatttctgcccagtcatgcgtggtggacaatagccaaatgcc attgatgagactcgtctccaaaact:TTc"rGCCf'TTtgcc gGGCCgTAATTAcAGACTTccgtctt ttgaac agttttttcagccccacccaagagtcgagtcttgaaaagctggctgggatggggtggtttcgggtgctgg acgagaTGCcagAGGCGCCACAAtGTATCCtgttacagGTTACAgGgCCATAAAgcgccATAAacgccGC GACggcaatGgCAAATTATAaCGCATACggACAcGTAGtcgatccactggctagaaGGCTAATTGGACGr gcccggccaggatgtccctgctca Black capital letters represent bases conserved in ail species and colored bases represent séquences présent in ail species except D.simulans, hellia, D.erecta, D.yakuba, D.pseudoobscur a, D.virilis or D.grimshawi  ccatctgcagacgtggttttcgaacgtatttatattgattatgggtgatcgtcaacaagagcagtggaca cccaataaacctgtccaaaaacccgacacatttctgcccagtcatgcgtggtggacaatagccaaatgcc attgatgagactcgtctccaAAACTTTGGCCTTTtgccgGGCCGTAATTACAGACTTCCGtCtTttgaac agttttttcagccccacccaagagtcgagtcttgaaaagctggctgggatggggtggtttcgggtgctgG AcGagaTGCCAgAGGCGCCACAAtGTATCCtgttacagGTTACAGGGCCATAAAgCgCCATAAAcg cGC GACGgCAAtGgCAAATTATAaCGCATACGgACACGTAGtcgatccactggctagaaGGCTAATTGGACGT GCccGgCcAGGatgtccctgcccat Figure H.l. Evoprint of Tv enhancer showing results after fîltering various Drosophila species.  99  Explanation of genomic BLAT of Tv séquence to Drosophila species Comparative Genomics: For each eBLAT (1-3) that aligned to the D.melanogaster TV enhancer pièce, we performed both a BLAST search (in Flybase) and a BLAT search (in UCSC Browser) of that séquence on the pertinent species' génome. We then examined whether that séquence was near the FMRFa gène for that species. For every species, onlt the lst BLAT was in the vicinity of the FMRFa for each génome, and in ail cases was found 5' of the FMRFa gène. To account for the potential failure of annotation of additional FMRFa gènes within the région of BLAT2 or 3 séquences, we performed TBLASTN 2.2.21 (NCBI: Search translated nucleotide databases using D.melanogaster FMRFa Ml length amino acid séquence). In every case, only one FMRFa gène was found in each génome and BLAT2/3 séquences were not found to be in the proximity of that FMRFa gène. Thèse data, utilizing the sequenced génomes currently available for each Drosophila species, suggest that the Tv enhancer has not been subjected to rearrangement or duplication throughout the évolution of Drosophila, spanning D.melanogaster to D.grimshawi. Thèse data further establish that the Tv enhancer is upstream of the FMRFa gène in ail species. [Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schâffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new génération of protein database search programs", Nucleic Acids Res. 25:3389-3402]. In the following pages, we show the genomic location of the séquence that best matches the Tv enhancer.  Explanation of genomic BLAT of Tv séquence to Drosophila species (continuée!) Location of Tv pièce relative to D.melanogaster FMRFa gène (showing 2R:5788096..5798095) Overview o f 2R ^iiiii^iiuiii^iiiuii^iuiiii^riiuiM|iiiiiiih|iiNiii!i|jimiiH|iiii  3789k '  9PI  ,l  ion  Tâî" ,, T3tî ,,,, Ï4H  5793k '  5790k' ' " " 3791k  5794k  ïaî" " ïâî'* " Ï 7 H " " îsn"" i9n " " 'iîôfi ' ' " zâîi  5795k  5796k  '5797k  5798k  nRNA CG1441-RR  <h-0-0  CG1441-RB  «a-a-o— CDS  Tv pièce on UCSC Browser, showing Comparative Genomics, 2R: 5792874-5793318 pOSition/SeatCh chr2R:5,792.S74-5,793,318  ( jump ) fciëâT) SJZC 4 4 5 b p . ( configure )  IchraR <46oi i • •4aiiiiiiiMinfr • • • i i i i n S cale chr2R!  579308fl|  H iiiiinin-w^n  les bases]—5793Ô50I  579316 Gap Locations  57932861  Vour Séquence from Blat Searcn FlyBase Protein-Cociing Gènes FlyBase Noncoa;ing Gehes RefSeq Gènes RefSeq Gènes D. melanogaster mRNfls from GenBank j l a n o g a s t e r mRNfls melanogaster ESTs That Hâve Been spliced S p l i c e d ESTS 12 F1ies, Mosquito, Honeybee, Beetle Muitiz Al ignments & phasteons scores Conservât ion d_sirriulansl CL.se Chel liai d_yakuba ! • cLerecta ! • q_ananassae 1 d_pseudoobscura • d_»ersimi l i s ! d_wi11istoni t d_viri lis II d_mojavensis|' d_sr imshawi I a_gamb iae = a_me11 ifera t_castaneum  •fBff  11 IHWHJHI WŒÉîà _ - I I I I B I i ill I. . •iiiimni nii!ii m  Repeatins Eléments ey RepeatMasker RepeatMasker:  Location of Tv pièce relative to FMRFa gène (showing 2R:5788096..5798095) pOSition/SCarCh  chr2R:5,788,096-5,798,09S  chrSR ( 46c>rn-M^iiiii il scale chr2R:  CG1441 CG1441  57896881  57968881  Oump''!^cteaf ) SÎZC lOjOOObp. f configure'  É)W m  S Wo|57918881  milim •iiiiiim • BII  57928881  •SU  wm-i  D. m e l a n o g a s t e r mRHRs f r o m GenBank  H H  m e l a n o g a s t e r ESTs T h a t Hâve Been s p l i c e d 12 F i i e s ,  d_simulans d_sechel1ia d_yakuba d_erecta a_ananassae d_pseudooes c u r a d_persimilis d_w i 1 1 i s t o n i d_v î r i l i s d_mojavensis d_grimshawi a_gambiae a_me11ifera t_castaneum  -\  57968881  F l y B a s e Noncooling Gènes RefSeq Gènes  s p 1 i cea ESTS  Conservation  57958881  v o u r Séquence f r o m B i a t s e a r c h YourSeq H M F l y B a s e F r o t e i n - C o d i n g Gènes Fmrf fcijjDf >fa  RefSeq Gènes j l a n o g a s t e r mRNfls  57938881 S794888I Gap Locations  ••m  M o s q u i t o , Honeybee, B e e t i e M u i t i z  iiJi,iiijiiiiii]i,iii  filignments  & phasteons  scores  57978881  57988881  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.simulans - GENE ID: 6733792 Dsim\GD10699 NCBI locus:XM 002080800.1 Blat 1 only one that maps to FMRFa Release=rl.3 4423713.. 4424156 Showing 2R:4418935..4428934 Ouervieu o f 2R < nimi|iniinii|iiiiiinijiiiiniii|iii lllll|lllllllll|lllllllll|lllllllll|lllllHll|llll|tlll|lllllllll|lllllllll|lllHllll|Htllllll|lllllllll|lllHII)l|lHllllll|HIHini|lHHIIIl|HI ) 0« 1M 21 311 4M 5M 6M 7M 8M 9M 10M 1111 12M 13M 14M 15M 16M 17M 18M 1911  i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i t i i | i i i i i \ i i i | t i i i i i i i i | i i i i i i i i i | i ii i i i | i i i i i i i i )  <  4421k  4419k 44 Gène Spart Dsim\GD10039 <  i  nRNR Dsil»\GD10039-RA <Kh-<a niRNH  4423k  4425k  4427k  4426k Dsiw\BD10699 C Dsim\GD10699-RA  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.sechelia GENEID: 6608431 Dsec\GM21167: NCBI accession XM 002033129.1| - Blat 1 only one that maps to FMRFa release=rl.3 Scaffold 1: 3403612.. 3404057 Showing scaffold_l :3398835..3408834 Overvieu of  scaffold_l  ( i n i i i II | n i il n i i |i i II M 111| n i111 11| i u n il n l n l m u i | n i n i l I I l u l i n i l i | n i M i n l i n i i n 111| H n i i i i i l i i n i i n i 11 M i i n i i l i i u n n i | )  411  6M  511  711  811  9(1  1011  11M  1211  1411  13M  C | I I I I I I I I I | I I I I I I 1 I I | I I I I I I I I I 1 I I I I I I I M | I I I I I I I I I | I I I I I I I 1 I | I I I I I I I I I | I I I I I I I I 1 | I I I I I I I I I | 1 I I I I  3399k  3400k  3401k  3402k  3403k  3404k  3405k  3406k  3407k  Gène Span 0sec\GM20568 D rtRNR Dsec\GI120568-RA  «->  3408k Dsec\GM21167 0sec\GM21167-RA I  •>  niRNfl  5796k  5797k  5798k ^ O f 9 9 k CG12140 C  nRNH CG1441-RA CG1441-RB  -Kl  Fmrf-Rfi D  5800k  5801k  5802k  Mef2  Mef2-RC  -HS (1ef2-RF  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.erecta GENEID: 6541511 Dere\GG24119: NCBI accession XM 001969091.1| - Blat 1 only one that maps to FMRFa release=rl.3; scaffold_4929: 8575920.. 8575478 showingscaffold_4929:8570699..8580698 Overvieu of scaffold_4929 (llHlll|llllHtlljllHHIIl|lllllllll|lllHMH|lHllllll|lllllHU|lltllllll|mH lllllllllllll|llllllltl|lllllllll|ltlllllll|lllllltlljlllllltll|lllllllll|lllllllll|lllllHll|lllllHll|llllllttl|lllllllll|lllllllll|llimill|lllllHlt|llltllllt]lllilllll|lll )  011 1M  2M  3M  411  311  611  7M  811  9M 10M 1111 1211 13M 14M 15M 16M 1711 1811 19P1 20M 21M 22fl 23(1 2411 2511 2611  O i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i [ i i i i i i i i i | i i i i i i i i i | i i i i i i i i i [ i i i i i O  8571k  8572k  8573k  8574k  8575k  8576k  8577k  8578k  8579k  8580k  Gène Span Pere\GG24119  Dere\GG25250  Dere\GG25250  Dere\GG24119-RA < w ' niRNR  CG1441  UL.1441  < nRNfl CG1441-RA CG1441-RB  Fmrf-Rfl D  CG12140-RA (1ef2-RC  Explanation of genomic BLAT of Tv séquence to Drosophila species (continuée!) D.yakuba GENE ID: 6528833 Dvak\GE19316. NCBI accession XM 002089829.il - Blat 1 only one that maps to FMRFa release=rl.3: 2L:18418229.. 18418669 and release=rl.3: 2L:1841870L. 18418870 showing 2L:18413449..18423448 Blast for 2L: 18418229.. 18418669 Overvieu o f 2L (  lllllll|lllllllll|lllllllll|llllllNl|lllllllll|lllllllll|lllllllll|lllllllll|llllHlll|llHlllll|'""""l'""""l'""""l'""""l"'"""l'""» I|IIIIIIIII|III 211 3ti 4M 5n ai 7n 8n 9n ion IIM 1211 1311 MM ISM î .611 a i 17M  on ih  « l uW i 18M  |llHlllll|lMllllll|ll .911 20M 21M  2211  • I I M I I  W  Gène Span 0yak\GE21940  0i)ak\GE19316  nRNR Dyak\GE21940-RA  0yak\GE19316-Rfl  Blast for 2L:18418701.. 18418870 Overvieu o f 2L <  lllini|lMIIHlMlllllMM|lhllllll|llMlllll|lllllllll|lllllllll|lllllllll|linMlll|lllllllll|lllNlltl|llllllltl|lllllMll|lllllllll|lllllllll|)IIMIIIl|lllllllll|lllllllll|lHÉllllll|lllllllll|lllllllll|lllllllll 9 91 41 91 6M 7M 8M 9M 10M 11M 12M 13M 14M 15M 16M 17H 18M 19M 20M 21M 22  011 111  ft-H  M  I | I I I  18415k  ' i i I i ii  18418k  i I i i i i  18419k  ^  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.persimilis GENE ID: 6592788 Dper\GL16762: NCBI accession XM 002018403.1| - only Blat 1 hits FMRFa release=rl.3; scaffold_4: 6304994..6304577 showingscaffold_4:6299786..6309785 Overvieu o f s c a f f o l d _ 4 < i i i i i i i t i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i I i i i i i i I—>  211  O l,i i ' 6300k  i,l,i ' 6301k  Gène Span 0per\GL16762  <  '  nRNR Dpei-\GL16762-RA niRNfl  6M  : 1 I | I I I I I I I I I | I I l I I I I I i | I I I I l I l I t | I I I 1 I I 1 I I j I I I I I M i I [ 1 l ] M l l I l \ I I I I I 1 I I I | I I I 1 I I—>  6302k  6303k  6304k  6305k  6306k  6307k  6308k 0per\GLL7707  0per\GL17707-RA  Explanation of genomic BLAT of Tv séquence to Drosophila species (continuée!) D.ananassae. GENE ID: 6496402 Dana\GF13563 NCBI Accession XM 001960803.il Only Blatl hits FMRFa Releaserl.3;scaffold_13266: 15300329.. 15300672 Showingscaffold_13266:15298329..15302672 Overvieu of scaffold_13266 <  IN  0M  <I  it I I |  I I I MI H i|  lfl  II|IIIIIIIII|IIIIIIIII|HIIIIIII|IIIIII ni I N ni |i ni il I I I | il il I I I il | il m in i| m ti m i] m m ni |i in il m | il il in il | il ni iin| in il m i| ni m m h m H m | H it m IilI I|I n  ai  3»  «I  91  91  ai  MI  ion  IIM  îai  îai  lin  ISM  îsi  i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i  15296k  15297k  15298k  Gène Span Dana\GF11303  15299k  15300k  15301k  15302k  15303k  i8M  ITM  )  19M  i i i | i i i i i i i i i | i i i  15304k  O  15305k  Dana\GF13563  Dan  I  [>  *  Dana\GF11301 <  nRHH Dana\GF11303-RA DanaSGF11301-Rft niRNR Orthologs Art? CG1441  i  Dana\GF13563-RA  Dan  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.pseudoobscura, GENE ID: 4804717 Dpse\GA15356 NCBI accession: XM 001361198.2 Blatl only one to hit FMRFa release=r2.4: 3: 10983437.. 10983147 showing 3:10978292..10988291 Overvieu of 3  iiiniiii|ninim|ninim|miiHM|MnnH^tiiiniitl"iiiini|ii)iiini|iitn > 11M 12M fc 14M 1!s T ' i a i ITM'""^ IBM 19M  C i m i n l11ii 11111* j111 >i ii 1111t H H I H | m i l H H i M H ) l t H | H H t l l H | m i l H H l n m i H t { l M U H I l | H H H I H  011  4M  il  5M  6M  711  8M  9M  10M  < I I I I I I | I I I I I I I I I | 1 I I I I I I I I | I I I I I I I I I | I I I I I I I I I | I I I I I M  10979k Gène Span Dpse\GftL5356  10980k  10981k  10982k  10983k  1 I | I 1 I I 1 I [ 1 I | I [ I I I I 1 I I | I I I I I I I I I | I M  10984k  10985k  10986k  10987k  I ) I I I I | I  )  10988k  DpseSGftL2961  nRHR  Dpse\Gfll5356-Rfi CDS Dpse\GA15356-PA niRNR  Dpse\GA12961-RA r~v-r>-<~>-r : Dpse\GA12961-Pf>  Explanation of genomic BLAT of Tv séquence to Drosophila species (continuée!) D.virilis (Dmel FMRFa TBLASTN hits two records in D.virilis - but both are the same gène) GENE ID: 6625712 DvuAFmrf: NCBI accession XM 002051008.il chroml2875 + 20483908 20485734 1827 chroml2875 + 20484455 20485495 1041 Release=rl.2; scaffold_12875 : 20459755.. 20459825 Release=rl.2; scaffold_12875 : 20459859..20460123 Showing scaffold_12875:20455751..20465750. NCBI accession Overvieu o f < llllllll  OH  scaffold.12675  Il II |l II I I » Il |l II II II II | I H II l l l l |  1H  2N  311  4PI  5M  Ill|  611  |  |  7H  811  ltl[lllllllll|lHllllllllMIIIHl|l  911  1011  1111  1211  |  |  |  13M  14M  15M  ||IIIIIHI||IIIIHII|IHIIIIII|HHIHII[IH  16M  1711  1811  19M  2011  Détails 20456k  I | I I > I I i i -i-i-l 20457k  I I I M M I I I I |  H  hi i i i i i i i i | i  H-w-i 20465k  Gène Span Dvir\Fmrf  niRHR Orthologs  Drthoiogous région in D. melanogaster 2R  <  1  Hef2-RC I1ef2-RF <  l  Showing scaffold_12875:20455751..20465750 Overvieu of scaffold_12875 < iniiii|MHiim|iinniii|imiiMi|nnHttt)ntiinii| OH i n 211 3M 4M 511 611  | 7M  mt|mnimhiinim|miiiiii|utHHnt+HiH tnhiintiit|iinMtn|ni»Hii|nitniii|iiii 8M 9tt lOfl lltl 12M 13M 14N 15M 16M 17M  |HMMnHmiiiin|in IBM 19TI 20t1 !  ttaits < I I I t H-H-M I | I 1 I I 20456k 20457k  M I I I \ I I I I I 1 I I i | I  I I t hM-HH  I I I i I 1 "(•••[•"! • I I t I I >  Gène Span  109  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.grimshawi GENE ID: 6560226 Dgri\GH20248 NCBI accession XM 001986904.il Release=rl.3; scaffoId_15245: 11087651.. 11087366 Showingscaffold_15245:11081000..11091000 Overvieu of scaffold_15245 <Mtiiin|iiiiiiiii|iiiiinii|iitiiiiii|iiniiiii|iiiiiiiii|iiiiMinhiiiiiiii[iiiiiiiii[iitiiiiii|iiMiiiM||iiitiiti|iiiiiiiM|iniiiiii|iiiiiiiiiliiiiiiiii|iiiiiiiii|iiiiiiiiiji ) OU 1M 2M 3M 4M 511 6M 811 9M 1 0 M lifl 1211 1 3 M 1 4 M 15(1 1 6 M 17fl 16M  1  <i i i i i i i i i [ i i i i i i i i i I i i i i i i i i i I i i i i i i i i i | i i i i i i i i i 1 i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i t | i i i i i i i i O 11081k 11082k 11083k 11084k 11085k 11086k 11087k 11088k 11089k 11090k 11091 Gène Span Egri\GH20248  Fmrf  > nRNR CG1441-RA  Fmrf-RA  CG1441-RB  CG12140 1  >Mef2  CG12140-RA def2-RC  -H]  <•  i  def2-RF <•  i  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.willistoni ENE ID: 6640994 Dwil\GK15742. NCBI Accession XM 002063706.11 Release=rl.3; scf2_l 100000004514: 923454.. 923290 Showing scf2_l 100000004514:914000.-924000 Owerwieu of scf2_lieeB8BfeB4514 <  1  1  1  1  1  1  1  h-  H—i—i—i—i—i—i—i—i—i—|—\—i—t-  1 | I I I I l I I I I | I I I I I I I I I | I 1 t I I I 1 1 1 | I 1 I 1 I I M I | I  44-H-i  -i—i—i—»  ~i—i—i—i—i—|—i—i—i—i-  211  011  916k  917k  ;  l  i  t  i  |  l  l  i  i  i  i  i  i  t  |  i  i  i  i  i  918k  i  i  i  i  |  i  i  i  i  i  i  [  922k  i  i  [  i  i  i  i  i  i  i  i  l )  923k  Gène S p a n Duil\GK15742 nRNfl Dwil\GK15742-RA <  — I  niRHH  HSP(l)  ={ j | 111 11111111111 1111 11111 11111 111 n u i u i  5789k  5790k  5791k  5792k  5793k^  5794k  5795k  5796k ^ 5 7 9 7 k  5798k  Gène Span CG1441  5799k  5800k  58Ôlk  58Ô2k  CG1Z140 Nef2  <  BRNfi CG1441-RA -+-Q  Fmrf-Rfl D  '  CG12140-RA ID-  M  l>-* Mef2-RC <  I  Mef2-RF <  •  Explanation of genomic BLAT of Tv séquence to Drosophila species (continued) D.mojavensis GENE ID: 6578865 Dmoi\GI19418 NCBI accession XM 002004728.il BLAT 1 is the only one to hit FMRFa. Seq of BLATl BLASTs to two close seqs. Release=rl.3: scaffold_6496: 5676089.. 5676021 Release 1.3: scaffold 6496: 5675955.. 5675789 Overvieu of scaffold. <IHIIIl|llimill[lllll>m|lHIIIIH|imillll|lHIII ll|»lllllll|llllUMl|llllllllljlHlltlll|lllHIIM^UMI»l]HIIMIN|lllllllll|lMII4lll|llllMlll|lllllllll|MIIIHIl|h»Mlll|lllllllll|lllMIHl|llHllll|llH)llll|l)lllllll|llllllllt|MIHIIIl|*llll )  on in  O  2n  3n  <m  sn  6H  7n  en  9M ion u n i2n i3n i4n îsn i6n I?M îsn i9n 2on 2in 22n 23n 24n 2sn 26n  i i i i i i i i I i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i t i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i*>  5668k  5669k  5670k  5671k  5672k  5673k  5674k  5675k  5676k  5677k  567E  Gène Span Dmoj\GI19418 Dmoj\GI19418-Rft <  — i  nlRNfl  HSPC2)  Showing scaffold_6496:5668000. .5678000 Overvieu of scaffoltLe 496 OlllHl|llHIH*l|llHlllllllllllUll|UIIWIlillim ll|lllllllll|lllll|lll|llllllllt|tllllllll|Hlllllll|)lltllHl|ll«lltlljlllllllll|lBllllll|llllll»l|llilllll|lllUllt^lMlltlB|lllllllll[BIIIIHl|ltlllllll|lllllWll|lllllll)l|NIIMIIlllHllllll|lllll )  on m  <i  ai  3n  i i i i i i i i i i i i i  5668k  4n  sn  6n  7n  sn  9n  ion lin i2n i3n i4n îsn i6n I T H im  , i i | i i i i i i i t i | i i i i i i i i i 1 i i i i i i i i i | i i  5671k  5669k  5673k  isn  2on 2in 22n 23n 24H 25n 26n  i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i i | i i i i i i i i  5674k  5675k  5676k  5677k  i)  567E  Gène Span DinojSGI19418 nRNR Dmoj\GI19418-Rfl I  niRNfl  us région in D. melanoï 2R i 111 i l 1111 n 111 n i il 1111 M i i i 111 i l 1111111 n 1111111111] 11111111 >  5790k Gène Span CG1441  5791k  5794k  Fw-f  5795k  5796k ^*--BîgTk  5798k  5799k  5800k  5801k  5802k  CG12140  i  Hef2 < nRNfl CG1441-RA  Finrf-Rfl  l  CG12140-RA Hef2-RC <  i  Hef2-RF <  i  112  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069953/manifest

Comment

Related Items