Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of the interaction between NA⁺/H⁺ exchanger isoform 7 (NHE7) and calmodulin (CaM) Popova, Maria 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_popova_maria.pdf [ 1.33MB ]
Metadata
JSON: 24-1.0069946.json
JSON-LD: 24-1.0069946-ld.json
RDF/XML (Pretty): 24-1.0069946-rdf.xml
RDF/JSON: 24-1.0069946-rdf.json
Turtle: 24-1.0069946-turtle.txt
N-Triples: 24-1.0069946-rdf-ntriples.txt
Original Record: 24-1.0069946-source.json
Full Text
24-1.0069946-fulltext.txt
Citation
24-1.0069946.ris

Full Text

CHARACTERIZATION OF THE INTERACTION BETWEEN NA/H EXCHANGER ISOFORM 7 (NHE7) AND CALMODULIN (CAM)  by Maria Popova B.Sc., The University of Victoria, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August2009  © Maria Popova, 2009  Abstract Na/H exchangers (NHEs) are a family of transmembrane antiporters that catalyze the electroneutral exchange of Na and H. They are primarily involved in regulation of pH and ion homeostasis and are themselves regulated by several signaling pathways, including Ca 2 signaling. NHE isoform 7 (NHE7) is activated by increases in intracellular Ca , mediated by binding of calmodulin (CaM) to the 2 second intracellular loop (1L2) of NHE7. This interaction between NHE7 1L2 and CaM is unconventional, as NHE7 1L2 is an extremely short CaM-binding site (—10 amino acids) unlike previously characterized CaM-binding sites. We showed that the NHE7 1L2-CaM interaction is likely pH-independent by means of pulidown assays with GST fusion peptides of NHE7 1L2 and immobilized CaM beads performed under pH 7.3 and pH 5.8. We also showed that the NHE7 1L2-CaM interaction is mediated by positively charged and hydrophobic amino acids by means of pulidown assays with GST fusion peptides of mutant NHE7 1L2 (NHE7 1L2 KKPL, NHE7 1L2 KKRAAA and NHE7 1L2 FFAA) and immobilized CaM beads. The interaction between NHE7 1L2 and CaM has potential for relevance to the nervous system, which is highlighted by the numerous NHE isoforms that have been implicated in neuronal function: NHE1, NHE6 and NHE9. However, much future research needs to be done to elucidate the exact nature of the contribution to physiology and the nervous system of the NHE7-CaM interaction.  11  Table of Contents Abstract  .  Table of Contents  ii iii  List of Tables  v  List of Figures  vi  List of Abbreviations  vii  Acknowledgements  ix  1. Introduction  1  1.1 pH regulation: physiological relevance and cross-talk with Ca 2 signaling 1.2 Na/H Exchangers (NHEs) 1.3 NHE structure 1.3.1 The N terminal transmembrane segments (TMs) 1.3.2 The C terminal cytosolic tail 1.4 The mammalian NHE gene family 1.4.1 Plasmallemal NHEs 1.4.1.1 NHE1 1.4.1.2 NHE2 1.4.1.3 NHE3 1.4.1.4 NHE4 1.4.1.5 NHE5 1.4.2 Organellar NHEs 1.5 Regulation of NHEs by Ca 2 1.5.1 NHE1 and Ca -CaM 2 1.5.2 NHE7 and Ca -CaM 2  1 2 5 6 7 8 10 10 12 13 14 15 15 17 19 20  2. Materials and Methods 2.1 Materials 2.2 Construct expression and purification 2.2.1 Glutathione-S-transferase (GST) fusion proteins 2.2.2 Maltose Binding Protein (MBP) fusion proteins 2.3 Determination of protein concentration 2.4 Pulldown assay 2.5 Western blot 2.6 Isothermal Titration Calorimetry (ITC) 2.7 Assay for binding of CaM lobes 2.8 NHE7 1L2 versions used  24 24 25 25 28 30 30 31 31 34 34  111  Table of Contents (Continued) 3. Results 3.1 NHE7 1L2, but not NHE1 1L2, binds to CaM 3.2 Identification of critical residues for CaM binding 3.2.1 NHE7 1L2 KKPL 3.2.2 NHE7 1L2 KKRAAA 3.2.3 NHE7 1L2 FFAA 3.3 pH-independence of NHE1 CBDA and NHE7 1L2 binding to CaM 3.4 Isothermal Titration Calorimetry (ITC)  .36 36 38 38 39 41 43 46  4. Discussion 4.1 Characterization of NHE7 1L2 binding to CaM 4.2 CaM lobes responsible for binding to NHE7 1L2 4.3 Functional significance of the CaM-NHE7 interaction 4.4 Possible roles of organellar NHEs and CaM in neuronal function 4.5 Conclusion  50 50 51 53 55 64  References  65  iv  List of Tables Table 1. Oligonucleotides used in this study  26  Table 2. Isothermal Titration Calorimetry (ITC) results of CaM Titration into NHE1 CBDA  48  V  List of Figures Figure 1. General structure of the Na/H Exchangers (NHEs)  4  Figure 2. Na/H exchanger isoform 1(NHE1) mediates recovery of intracellular pH back to baseline following acidification  11  2 signal Figure 3. NHE1 is regulated by a Ca  21  Figure 4. Alignment of C terminal Calmodulin Binding Domain A (CBDA) and second intracellular ioop (1L2) for various NHEisoforms  23  Figure 5. pGEX vector  27  Figure 6. pET vector  29  Figure 7. Isothermal Titration Calorimetry (ITC) setup  33  Figure 8. CaM binds to NHE7 1L2 and NHE1 CBDA but not to NHE1 1L2  37  Figure 9. NHE7 1L2 KKPL binds to CaM in a Ca -independent manner 2  40  Figure 10. NHE7 1L2 KKRAAA and NHE7 1L2 FFAA are incapable of binding to CaM  42  Figure 11. pH-independence of CaM binding to NHE7 1L2 and NHE1 CBDA  45  Figure 12. Isothermal Titration Calorimetry (ITC) results of CaM Titration into NHE1 C terminal CBDA  47  Figure 13. Location of start of deletion that in NHE1 causes slow wave epilepsy, in NHE6 causes Angelman Syndrome, and in NHE9 may cause autism 58  vi  List of Abbreviations AH  Change in Enthalpy  AS  Change in Entropy  AD H D  Attention Deficit Hyperactivity Disorder  ASIC  Acid-Sensing Ion Channel  BSA  Bovine Serum Albumin  CAll  Carbonic Anhydrase II  CaM  Calmodulin  CBDA  Calmodulin Binding Domain A  CBDB  Calmodulin Binding Domain B  C-CaM  C-lobe of Calmodulin  CHP  Calcineurin Homologous Protein  DNA  Deoxyribonucleic Acid  DRA  Downregulated in Adenoma  DTT  Dithiothreitol  EDTA  Ethylene Diamine Tetraacetic Acid  EGTA  Ethylene Glycol Tetraacetic Acid  EIPA  5-(N-ethyl-N-isopropyl) Amiloride  EL  Extracellular Loop  GFP  Green Fluorescent Protein  GST  Glutathione-S-transferase  HRP  Horseradish Peroxidase  IL  Intracellular Loop  IPTG  Isopropyl -D-1 Thiogalactopyranoside  ITC  Isothermal Titration Calorimetry  Kd  Dissociation Constant  kDa  kilo-Dalton vii  KNa  Sodium Affinity  MBP  Maltose Binding Protein  N-CaM  N-lobe of Calmodulin  NCX  2 Exchanger Na/Ca  NHE  Na/W Exchanger  NHERF  Na/H exchanger regulatory factor  NMR  Nuclear Magnetic Resonance  PBS  Phosphate Buffered Saline  PIP2  Phophatidylinositol 4,5-bisphophate  PKA  Protein Kinase A  PKC  Protein Kinase C  PVDF  Polyvinylidene Fluoride  RSK  p90 Ribosomal S6 Kinase  SDS  Sodium Dodecyl Sulfate  SDS-PAGE  Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis  SWE  Slow Wave Epilepsy  TBST  Tris-Buffered Saline with 0.075% Tween 20  TM  Transmembrane Segment  V-ATPase  Vacuolar type H-ATPase  XLM R  X-linked Mental Retardation  viii  Acknowledgements I would like to thank my supervisor, Dr. Masayuki Numata, for giving me the opportunity to work on this project and for all his aid while working on the project. I would also like to thank several past and present members of the Numata lab, namely Sam Chen and Lynn Kimlicka, for work that lead to this project and for aid while working on the project. Finally, I would also like to thank Dr. Filip van Petegem and his lab for collaboration on the Isothermal Titration Calorimetry (ITC) component of this project. For funding, I would like to acknowledge the Natural Sciences and Engineering Research Council of Canada, which partially funded me throughout the duration of this project.  ix  1. Introduction 1.1 pH regulation: physiological relevance and potential cross-talk with Ca 2 signaling Intracellular and extracellular pH serve as important physiological signals. For example, in Caenorhabditis elegans intestine rhythmic, oscillatory changes in the pH of the extracellular space regulate the similarly rhythmic patterns of muscle contraction that carry the food through the intestine (Pfeiffer et a!. 2008). Also, changes in extracellular pH regulate the excitability of neurons (Chesler 2003) due to various pH-sensitive ion channels. For example, there are voltage-gated Ca 2 channels that are sensitive to extracellular pH in neurons (Tombaugh and Somjen 1996, Tombaugh and Somjen 1997). These channels are activated by alkaline pH and inactivated by acidic pH, allowing for regulation of Ca 2 current by extracellular pH. Such Ca 2 current is excitatory, as it depolarizes the cell. Therefore, neuronal activity is stimulate by alkaline pH (when the Ca 2 channels are activated) and inhibited by acidic pH (when the Ca 2 channels are inactivated). Indeed, this is the general pattern for regulation of neuronal excitability by pH: acidic pH depresses and alkaline pH stimulates neurons. As an example that goes against this rule, there are acid-sensing ion channels (ASIC5) that let cations into the cell when the extracellular space is acidified in some neurons, especially nociceptive neurons that encode the sensation of pain (Wu eta!. 2004). Acidification of the extracellular space can occur due to robust synaptic activity, as synaptic vesicles are acidic and fusion of many such vesicles leads to a transient acidification of the synaptic cleft. This in turn opens ASICs, which let in cations (mostly Nat, but also K and Ca j, depolarize the 2  1  cell and lead to action potentials (Wu et aL 2004). Interestingly, different ASIC channels are formed from four genes and six major transcripts by formation of dimers or trimers. These different ASIC channels are gated at different pHs, except for the homodimer of ASIC4, which has been shown to be pH-independent (Chen et al. 2007). Also, some ASIC isoforms can be inhibited by extracellular Ca 2 and hence are regulated by both pH and Ca 2 (Wu et al. 2004). A more recent study has suggested that the vacuolar type W-ATPase (V ATPase) provides a point of intersection between Ca 2 and pH. The V-ATPase has at least two functions: a proton-pumping dependent regulation of organellar pH and a proton-pumping independent regulation of vesicle fusion and/or secretion. In yeast it has been shown that at least the latter function is dependent on the Ca -binding 2 protein calmodulin (CaM), a key component of Ca 2 signaling (see 1.5 for details) (Zhang et aL 2008). Furthermore, in Drosophila it has been shown that the V-ATPase 0 subunit al, which encodes for the biggest subunit of the transmembrane pore of V the V-ATPase and is neuron-enriched if not neuron-specific, directly binds to CaM and recruits CaM to synapses (Zhang eta!. 2008). Whether this binding to CaM is important for just one or both functions of V-ATPase is still unclear (Zhang et aL 2008). But it is clear that pH regulation and Ca 2 signaling can both be mediated by the V-ATPase. 12 Na/H Exchangers (NH Es) The Na/H exchangers (NHEs) are a family of twelve-transmembrane segment antiporters that facilitate the electroneutral transport of Na in one direction and W in the other (Kinsella and Aronson 1980). NHEs are widely  2  accepted as the most prominent pH regulators and they play crucial roles in maintaining pH homeostasis in most organisms. NHEs are highly conserved among different species and in mammals nine different isoforms, termed NHE1 to NHE9, have been identified so far (Orlowski and Grinstein 2004, Brett eta!. 2005a). In mammals, NHEs share the same secondary structure, consisting of the N-terminal twelve transmembrane segments (TM5) followed by a hydrophilic C-terminal tail (see Figure 1). The functional unit of NHEs is a dimer (Hisamitsu eta!. 2006) and indeed they are found as dimers in intact cells (Fliegel et aL 1993, Fafournoux et aL 1994). All NHEs are acutely regulated by intracellular H, which binds and greatly increases transporter activity (Aronson et aL 1982). Indeed, at neutral pH NHEs are almost inactive and only become activated upon acidification. Hence, in terms of pH regulation under physiological conditions, they are acid extruders rather than acid loaders. The regulation of pH mediated by NHEs is physiologically important and abberant activation of NHEs can inititate Ca -mediated signaling under pathological 2 conditions. For example, in the heart the NHEs are a key mechanism mediating damage from ischemia and reperfusion. Ischemia occurs when there is an interruption in blood flow and reperfusion occurs when blood flow is restored but results in inflammation and oxidative damage through the induction of oxidative stress. During ischemia, NHEs remove intracellular H that accumulates due to metabolism in exchange for extracellular Nat The resultant Na overload leads to reverse-mode activity of the Na/Ca 2 exchanger (NCX) and Ca 2 overload (Luo etah 2005, Hwang eta!. 2008). This causes cell toxicity and eventually cell death  3  z  +  +  z  —  1 CD  +  -‘  z  z  -I  C  m  C)  -  x  (Karmazyn 1996). With NHE inhibitors, however, this sequence does not occur and neither does the Ca 2 overload, resulting in improvement in heart function post ischemia. Hence, the NHEs are clearly physiologically important in the heart and mediate the damage from ischemia, as evidenced by the effects of NHE inhibitors. 1.3 NHE structure  Hydrophobicity analysis predicts that NHEs encompass the N-terminal twelve TMs and a hydrophilic C-terminal tail. Wakabayashi eta!. (2000) proposed a membrane topology model of NHE1, the most widely studied NHE isoform, by using cysteine scanning mutagenesis and hydrophobicity analysis. More recently Landau et aL (2007) proposed another model by using a fold-recognition approach based on the crystal structure of NhaA from E. coil and multiple alignment programs. Although both models feature twelve TMs and agree on the location of nine of these TMs, these models assign the extreme N-terminal TMs differently. The differences in the two models reflect a controversy about the extreme N terminus of NHE1. Landau eta!. (2007) suggest that NHE1 contains a signal peptide that is cleaved off during processing of the protein, and TM1 begins at Va1 , which corresponds to TM3 of 125 the Wakabayashi etaL (2000) model. Another major difference between the two models revolves around TM7-TM9 originally assigned by Wakabayashi eta!. (2000). TM9 originally assigned by Wakabayashi et at. (2000) was suggested to contain TM7, TM8 and the extracellular loop in between in the Landau eta!. (2007) model. The intracellular loop following this region has ambiguous patterns of accessibility to extracellular agents and is assumed to be intramembrane spanning in both models. This segment may participate in ion translocation, and therefore may be  5  accessible from both extracellular and cytosolic side. Even though TM9 of the Wakabayashi et al. (2000) model [and TM7 and TM8 in the Landau eta!. (2007) model] has been studied structurally using nuclear magnetic resonance (NMR) (Reddy et aL 2008), it is still unclear which model is correct. This is due to the region having been studied in isolation and the results obtained being compatible with either model (Reddy etaL 2008). Resolution of the controversy awaits the structure of a larger portion of NHE1. L3.1 The N terminal transmembrane segments (TMs) The N-terminal, transmembrane segments of NHEs are responsible for antiporter activity. Based on the available structural information about the N terminus of NHE1, it appears that functionally important amino acid residues are found in unstructured and flexible regions of the molecule (SlepkovetaL 2005, Ding et al. 2006, Ding et al. 2007, Lee et aL 2009). The regions implicated in NHE transporter activity include TM4 (Slepkov eta!. 2004, Slepkov et al. 2005, Slepkov et a!. 2007a), TM11 (Slepkov eta!. 2007b, Lee eta!. 2009) and TM9 (Khadilkar eta!. 2001, Reddy et aL 2008). Also, two membrane associated regions [intracellular loop 2 (1L2) (Khadilkar etah 2001, Mukherjee eta!. 2006) and extracellular loop 5 (EL5) (Slepkov et aL 2007b)J have been implicated in transporter activity. Intriguingly, a cluster of highly conserved titratable residues (ie. acidic or basic residues) is found in the core TMs of NHEs (Landau et aL 2007). These same residues have also been shown to be important for the function of the protein in many cases. In particular, a cluster of four negatively-charged amino acids in the middle of otherwise hydrophobic TMs are seen in all known NHEs (Landau eta!.  6  2007). These residues are expected to be involved in the coordination and transport of Na and/or H by the transporter. There are also other functionally important, conserved residues in the N terminus that appear to be involved in maintaining the structure of NHEs. For example, some hydrophobic amino acids found inside TMs are expected to contribute to the overall structure of NHEs (Slepkov et aL 2007b). 1.3.2 The C terminal cytosolic tail  The C-terminal, cytosolic segment of NHEs is mainly responsible for regulation of the antiporter activity (Bertrand etaL 1994, Gebreselassie etaL 1998). In terms of structure, this region contains many subdomains that bind to specific proteins that regulate transporter activity. These include calmodulin (CaM) (Bertrand et aL 1994, Wakabayashi et a!. 1994), calcineurin homologous proteins 1-3 (CHP1-3) (Lin and Barber 1996, Barroso eta!. 1996, Mailander eta!. 2001, Pang eta!. 2002), carbonic anhydrase II (CA II) (Li eta!. 2002, Li eta!. 2006), ! p 4 2 mitogen-activated protein 4 kinases (Bianchini eta!. 1997), p 90 ribosomal S6 kinase (RSK)(Takahashi eta!. 1997, Cuello eta!. 2007), Nck-interacting kinase (Yan eta!. 2001) and phophatidylinositol 4,5-bisphophate (PIP2)(Aharonoviz eta!. 2000). RSK (Takahashi eta!. 1997, Cuello eta!. 2007) and Nck-interacting kinase (Yan eta!. 2001) both phosphorylate NHE1 once they bind to the C terminus and lead to activation of transporter activity. On the other hand, p42/44 mitogen-activated protein kinases do not themselves phosphorylate NHE1 but their binding to the C terminus does lead to activation of NHE1 transporter activity (Bianchini et a!. 1997). CaM binds to the C terminus in the presence of elevated intracellular Ca 2 and activates transporter activity (Bertrand et aL 1994, Wakabayashi et aL 1994), CHP1-  7  3 are essential cofactors for transporter activity and are always bound to the C terminus of NHE1 under physiological conditions (Lin and Barberl996, Barroso et aL 1996, Mailander eta!. 2001, Pang et al. 2002), CA II binds to the C terminus of NHE1 when it is phosphorylated by RSK and activates transporter activity (Li et al. 2002, Li et aL 2006) and PIP2 is another cofactor that binds to the C terminus of NHE1 under physiological conditions and activates transporter activity (Aharonovitz eta!. 2000). The C terminus of NHEs has a preponderance of 13-structure and random coil (Gebreselassie eta!. 1998, Li et aL 2003), suggesting a compact configuration of antiparallel 13—sheets joined by 13—turns (Li et al. 2003). This structure is suggested to be flexible, altering its conformation due to protein-protein interactions. For example, binding of CHP1-3 to the C terminus favors formation of an ct—helix in the domain mediating that binding (Mishima et at. 2007). Intriguingly, the different isoforms (ie. NHE1 to NHE9) differ most dramatically in the C terminus, suggesting they are differentially regulated. This may help to explain their differential physiological functions (Orlowski and Grinstein 2004). L4 The mammalian NHE gene family Evolutionarily, the NHEs can be grouped into two general classes. The first class is the plasmallemal NHEs, which are functional NHEs across the plasma membrane (Orlowski and Grinstein 2004). Mammalian NHE1-5 are categorized in this class. Generally, this class of NHEs is specific for transport of Na (Orlowski and Grinstein 2007). The different isoforms within this class (ie. NHE1-5) differ in their  8  tissue distribution; NHE1 being ubiquitously expressed (Tse et at. 1991), while NHE2-5 are all expressed in specific tissues. NHE2 is expressed in the stomach and intestines (Tse eta!. 1991, Collins et at. 1993), NHE3 is expressed in the kidney and intestines (Orlowski et aL 1992, Tse eta!. 1992), NHE4 is expressed primarily in the stomach (Orlowski etah 1992), and NHE5 is expressed almost exclusively in the nervous system (I’(lanke eta!. 1995, Baird eta!. 1999). The second class of NHEs is the organellar NHEs. This class includes NHE6-9, is found intracellularly in specific organelles, and functions primarily in organellar pH and ion homeostasis. It has been suggested that organellar NHEs have higher affinity for K than Na, serving as K/H exchangers. This is of potential physiological significance as K is the predominant monovalent cation in the cytosol (Orlowski and Grinstein 2007). The different isoforms within this class (ie. NHE6-9) exhibit differential subcellular localization. Physiological function, pharmacological inhibitor profiles, and regulation of organellar NHEs are significantly different from that of plasmalemmal NHEs. For example, amiloride derivatives that effectively block plasmalemmal NHEs do not inhibit organellar NHEs (Orlowski and Grinstein 2004). Although basic structure with the N terminal TMs and the C terminal cytosolic tail are conserved between the two classes, there are several amino acid residues that are conserved among organellar NHEs but not plasmalemmal NHEs and vice versa. Functions of such class-specific amino acid residues may include docking for distinct binding proteins and locations for distinct post-translational modifications that permit isoform-specific regulation. Furthermore, in yeast it has been shown  9  that these class-specific amino acid residues can be key for function of the proteins. It was found that if conserved, organellar-NHE amino acid residues are mutated to the plasmallemmal-NHE version in the context of the organellar NHE Nhxlp, this leads to a complete loss of function (Mukherjee et aL 2006). It would be intriguing to test whether mutation of plasmallemal-NHE amino acid residues to the organellar NHE version in the context of a plasmallemal NHE would also lead to loss of function. Nine typical NHE isoforms were identified in mammals. In the following, they are summarized. 1.4.1 PIasmaHema NHES 1.4.1.1 NHE1  The first NHE to be cloned (Sardet et aL 1988), NHE1 has also been the most extensively studied isoform. It is ubiquitously expressed and functions as a “housekeeping” protein to help cells recover after acid load. When the cytoplasm is acidified, NHE1 facilitates the transport of I-P out of the cytoplasm, bringing the cytosolic pH back to baseline (see Figure 2 for a typical pH trace). NHE1 exhibits a Na affinity (KNa) of 10.0  ±  1.4 mM and a half-maximal activation value of pH 6.75  0.05 (Orlowski 1993). It is inhibited by amiloride with a k 5 of 1.6 . 0  ±  ±  0.1 tM  (Orlowski 1993). NHE1 can also have structural roles in cytoskeleton and signaling complexes independent of transporter activity (Meima eta!. 2007), a function so far only known for NHE1.  10  8.5  acidification  8.0  175  6  NHE1 activated  Figure 2. Na/H exchanger isoform 1(NHE1) mediates recovery of intracellular pH back to baseline following acidification. Figure modified from Hug and Bridges 2001.  11  Disruption of NHE1 in the mouse is found in the naturally occurring Slow Wave Epilepsy (SWE) mutant mouse (Cox et aL 1997). In accordance, the NHE1 knockout mouse (Bell et aL 1999) exhibited seizures and other neurological symptoms, which were found to be caused by hyperexcitability of neurons (Bell et a!. 1999). This suggests NHE1 is most important in the nervous system despite its ubiquitous expression in most tissues. The neuronal hyperexcitability observed in NHE1 deficient mice is mediated by lack of NHE1 somehow upregulating the Na channel density specifically in hippocampal CAl and cortical neurons (Xia eta!. 2003). Intriguingly, these are the same regions that normally express the highest levels of NHE1 (Ma and Haddad 1997), suggesting NHE1 may normally depress Na channel density. The increase in Na channel density seen with lack of NHE1 leads to an increased Na current and hyperexcitability of neurons, which in turn leads to the seizures and other neurological symptoms of these mice. 1.4.1.2 NHE2 NHE2 is found on the apical membrane of epithelial cells of the digestive tract (ie. stomach and intestines) and is unique among the NHEs to be inhibited by extracellular H (Yu eta!. 1993). It is also inhibited by amiloride with a k 5 of 0.6 tM . 0 (Honda eta!. 1993), has a KNa of 18  ±  1 mM (Levine eta!. 1993) and a half maximal  activation value of pH 6.90 (Yu eta!. 1993). Targeted disruption of NHE2 in the mouse leads to reduced viability of gastric parietal cells and loss of net acid secretion (Schultheis et a!. 1998a), suggesting NHE2 is most important in the stomach. Interestingly, NHE2 is not required for acid  12  secretion by the parietal cell, but is essential for its long-term viability. Perhaps this is mediated by the unique sensitivity of NHE2 to inhibition by extracellular Ht which would allow upregulation of its activity by the increased extracellular alkalinity that accompanies acid secretion and might enable NHE2 to play a specialized role in maintaining the long-term viability of the parietal cell. 1.4.1.3 NHE3 NHE3 is found on the apical membrane of epithelial cells of renal proximal tubules (Ambuhi et a!. 1996) and intestines (Booksten eta!. 1994). NHE3 exhibits a KNa  of 4.7  ±  0.6 mM and a half-maximal activation value of pH 6.45  ±  0.08 (Orlowski  1993). It is inhibited by amiloride with a k 5 of 101 M (Orlowski 1993). . 0 NHE3 possesses some unique regulatory mechanisms. For example, NHE3 is inhibited by Protein Kinase A (PKA) and Protein Kinase C (PKC), whereas NHE1 is activated by PKC and PKA. This negative regulation of NHE3 is mediated through the Na/H exchanger regulatory factor (NHERF) family. NHERFs are multi-PDZ domain containing proteins that anchor transmembrane molecules to the actin cytoskeleton and thereby regulate their localization. In the case of regulation by PICA, upon PICA activation NHERF1 binds to NHE3 (Lamprecht et a!. 1998) and NHE3 is relocated from the plasma membrane to clathrin-coated pits (Kocinsky et aL 2005), where it is expected to be endocytosed. This removal of NHE3 from the plasma membrane then results in inhibition of transporter activity. In the case of regulation by PKC, upon PKC activation NHERF2 binds to NHE3 and, similarly to NHERF1, stimulates the  13  endocytosis of NHE3, thereby inhibiting NHE3 transporter activity (Lee-Kwon et aL 2003). Targeted disruption of NHE3 leads to renal and intestinal absorptive defects (Schuitheis et at. 1998b). Thus, NHE3 is the predominant absorptive NHE in kidney and the intestine. Specifically, homozygous mutant mice show diarrhea, mild acidosis, reduced blood pressure and severe absorptive defects in the intestine. More recently, electroneutral reabsorption of NaC1 from the intestines has been shown to be dependent on NHE3 in addition to the HCO /Cl exchanger 3 Downregulated in Adenoma (DRA), whose activity is coupled to that of NHE3 (Musch et aL 2009). 1.4.1.4 NHE4 NHE4 is found on the basolateral membrane of gastric parietal cells. It is inhibited by amiloride with a k 5 of 813 . 0  ±  20 tM (Chambrey et a!. 1997).  Intriguingly, unlike NHE1-3, NHE4 does not show simple, linear kinetics of interaction with extracellular Na. Instead, sigmoidal kinetics are seen, suggesting there is cooperative binding of extracellular Na to NHE4 (Bookstein et at. 1996). This may be mediated by dimer formation, with one Na-bound monomer increasing the likelihood of the second monomer binding Na via a conformational shift. Targeted disruption of NHE4 leads to impaired gastric acid secretion (Gawenis et at. 2005), suggesting NHE4 is most important in the stomach. Unlike NHE2, which is not required for acid secretion by the parietal cell or proper differentiation of the parietal cell, NHE4 is required for both processes.  14  1.4.1.5 NHE5 NHES mRNA is most abundantly expressed in the brain, especially in neuronrich regions (Kianke eta!. 1995, Baird eta!. 1999). It exhibits a KNa of 18.6 and half-maximal activation value of pH 6.43  ±  ±  1.6 mM  0.08 (Szabo et a!. 2000). It is  inhibited by amiloride with a k 5 of 21 tM (Szabo eta!. 2000). . 0 In terms of regulation of NHE5 activity, NHES is most similar to NHE3. Like NHE3, NHE5 is inhibited by PKA and PKC (Attaphitaya eta!. 2001), although the mechanism of this inhibition has not yet been elucidated. In addition, RACK1 associates with NHE5 in focal adhesions via NHE5’s C terminus and positively regulates the transporter activity (Onishi eta!. 2007). Beyond this, little is known about the physiological function of NHE5, something our lab is trying to rectify. 1.4.2 Organellar NHEs  NHE6-NHE9 are designated organellar NHEs because of their predominant association to organellar membranes. Specifically, NHE6 is found in the early recycling endosome (Numata eta!. 1998, Brett eta!. 2002), NHE7 is found in the trans Golgi network (Numata and Orlowski 2001), NHE8 is found in the endoplasmic reticulum and mid to trans Golgi (Goyal et a!. 2003, Nakamura et aL 2005) and NHE9 is found in the late recycling endosome (Nakamura eta!. 2005). NHE6-9 share a high degree of structural similarity (55-75% amino acid identitiy), whereas they share only limited similarity with plasmalemmal NHEs (approximately 25% amino acid identity) (Orlowski and Grinstein 2007). By both liposome-based in vitro transporter assays (Nakamura et aL 2005) and cell-based organellar trace influx assays (Numata and Orlowski 2001, Kagami etah 2008)  15  organellar NHEs showed higher affinity for K than Nat leading to a hypothesis that the physiological transporter mode is K/H exchange. This leads to an interesting possibility that organellar NHEs may pump W out of acidic organellar lumens by using the K concentration gradient across organellar membranes, which may at least in part contribute to the establishment of pH gradient along secretory and endocytic pathways. This model of NHEs as a proton leak pathway hold up to experimental scrutiny. Activation of NHE6 in mammalian cells by knockdown of RACK1 and redistribution of NHE6 from the plasma membrane to the endosome results in alkalization of the endosome (Ohgaki etal. 2008). Equivalently, overexpression of NHE8 alkalizes the Golgi (Nakamura eta!. 2005) and overexpression of NHE9 alkalizes the recycling end osome (Nakamura et aL 2005). Hence, organellar NHEs can regulate organellar pH. This is known to be important for several cellular processes, including vesicle trafficking and protein sorting (Bowers et aL 2000, Brett eta!. 2005b, Mukherjee eta!. 2006). This is of potential significance in synaptic transmission mediated by secretion and endocytosis of synaptic vesicles. Concomitantly, NHE6, NHE7 and NHE9 are highly enriched in brain tissues and accumulating evidence points to the association of their mutation to neurological disorders (Claes eta!. 1997, Shashi etaL 2000, de Silva eta!. 2003, Gilfillan eta!. 2008, Morrow et aL 2008). See Discussion for more details.  16  L5 Regulation of NHEs by Ca 2+  NHEs are regulated by various signaling cascades. Of these, one of the most important is Ca 2 signaling. Ca 2 signaling is ubiquitous in all forms of life, and is key for many cellular processes. Neurotransmitter release in the brain is triggered by 2 (Morris etaL 1987), as is muscle contraction (Portzehl 1965, Rose etaL 2006). Ca In addition, changes in Ca 2 signaling have been associated with aging in the brain (Foster 2007). Due to its wide-spread physiological effects, it is not surprising to find extensive effects of Ca , even on one molecule: NHE1. 2 As a key secondary messenger, intracellular Ca 2 is tightly regulated, such that resting levels are in the nM range. At the same time, significant stores of Ca 2 are kept in organelles, such as the sarcoplasmic reticulum in muscle cells, ready to be released upon appropriate stimulation of the cell. Intracellular Ca 2 levels can then rise from the nM range into the !M or even mM range, triggering many varied signaling events, leading to the many physiological effects of Ca . 2 Intriguingly, many of these Ca 2 signaling events are mediated by a key molecule: calmodulin (CaM). CaM is a small, 148-amino acid protein that is conserved in most organisms (Zhang and Yuan 1998). CaM is able to bind at least 40 different target proteins and enzymes including various protein kinases (Martin et aL 2004) and phosphatases, receptors, ion-channel proteins (Saimi and Kung 2002), phosphodiesterases, and nitric oxide synthases (Spratt et aL 2007). CaM consists of two similar domains, termed N-lobe (N-CaM) and C-lobe (C-CaM). N-CaM and C-CaM contain two Ca -binding sites, which are made up of so-called EF-hand helix—loop— 2 helix motifs (Zhang and Yuan 1998). Structural analysis revealed that CaM has a  17  dumbbell shape comprising N-CaM and C-CaM, which are connected by a long, solvent-exposed x-helix, the so-called linker helix (Zhang and Yuan 1998). CaM can exist in either the Ca -free state called apoCaM or in various Ca 2 -bound states. 2 Most targets of CaM require three or four Ca 2 ions to be bound to CaM in order to become activated, so one can simplify the discussion by considering Ca -CaM to 2 contain three or four bound Ca 2 ions (Jurado et aL 1999). Both Ca -CaM and 2 apoCaM (Jurado eta!. 1999, Bahler and Roads 2002, Vetter and Leclerc 2003, Fallon  et a!. 2005) are capable of binding target proteins, and both are involved in responding to intracellular Ca 2 levels. ApoCaM generally signals reactions of the cell to low intracellular Ca 2 levels and may act as a store of Ca -unbound CaM, pre 2 bound to the target protein, ready to react with Ca 2 when it becomes available. By contrast, Ca -CaM generally signals reactions of the cell to high intracellular Ca 2 2 levels. The binding of Ca 2 ions causes a conformation change in CaM (Zhang et a!. 1995, Zhang and Yuan 1998). Specifically, hydrophobic residues unexposed to the solvent in apoCaM twist and become exposed to the solvent in Ca -CaM, creating a 2 large, solvent-exposed hydrophobic surface in each EF-hand domain. These hydrophobic surfaces have been shown to be largely responsible for the binding of CaM to its targets (Zhang eta!. 1995, Zhang and Yuan 1998). Some CaM-target proteins have been reported to interact with Ca -CaM at two distinct sites in their 2 amino acid sequence, while others interact at just one site (Zhang and Yuan 1998). It seems that the two represent separate classes of CaM binding peptides and bind to different conformations of Ca -CaM (Zhang and Yuan 1998, Jurado et a!. 1999). At 2  18  the center of the hydrophobic surface, CaM contains a deep hydrophobic cavity that anchors bulky aromatic or long alkyl amino acid side chains of the target proteins (Zhang et aL 1995, Zhang and Yuan 1998). In addition to the change in the EF-hand motifs, the binding of Ca 2 to CaM significantly reduces the backbone flexibility of the protein. The binding of protein targets further reduces the backbone flexibility of CaM throughout its entire sequence. Such protein targets of CaM include NHEs. L51 NHE1 and CaCaM  -CaM binds to the C terminus of NHE1 and activates its transporter activity 2 Ca (Bertrand eta!. 1994, Wakabayashi eta!. 1994, Wakabayashi eta!. 1997). The Ca 2 CaM interaction is mediated by two CaM binding sites in the C terminus of NHE1, termed the C terminal Calmodulin Binding Domain A and C terminal Calmodulin Binding Domain B domains (CBDA and CBDB, respectively) (Bertrand eta!. 1994). CBDA has a dissociation constant (kd) of approximately 20 nM while CBDB has a kd of approximately 350 nM (Bertrand et aL 1994). Like the majority of CaM-binding domains, CBDA and CBDB comprise a stretch of —20 amino acid residues, contain positively charged residues and hydrophobic residues, and have the potential to form an amphiphilic ct-helix (Bertrand et a!. 1994, Zhang and Yuan 1998). The hydrophobic residues of this a-helix will interact with the two hydrophobic surfaces exposed in Ca -CaM and the a-helix’s positively charged residues can make specific 2 salt bridges with acidic residues in CaM (Zhang and Yuan 1998, Martin eta!. 2004). The central linker region in Ca -CaM then unwinds and N-CaM and C-CaM wrap 2 around the a-helix (Zhang and Yuan 1998, Martin et a!. 2004). As a result, the shape of the Ca -CaM-NHE1 complex is globular, as opposed to the dumbbell-shaped 2  19  structure of Ca -CaM alone. The target a-helix, which may be unstructured in 2 solution, forms an cc-helix in the complex and its side chains make intensive interactions with the two hydrophobic patches in Ca -CaM. In addition, residues 2 other than those directly binding to CaM are suggested to be important for target interaction with CaM. The binding of Ca -CaM to NHE1 leads to activation of the 2 transporter activity (Bertrand et a!. 1994, Wakabayashi et aL 1994). Indeed, swapping of CBDA to the equivalent region of the normally Ca 2 unresponsive NHE3 confers Ca 2 responsiveness to NHE3 (Wakabayashi et aL 1995). Since there are no crystal structures of Ca -CaM bound to NHE1 (or indeed any crystal structures of 2 NHE1) available it is unclear how exactly Ca -CaM mediates the change in NHE1 2 transporter activity. One model that has been postulated is that CBDA and CBDB of NHE1 are part of an autoinhibitory domain that normally restricts NHE1’s transporter activity by binding to the N terminus of NHE1. Upon Ca -CaM binding, 2 the autoinhibitory domain can no longer bind to the N terminus, thereby activating NHE1 (see Figure 3)(Bertrand etal. 1994, Wakabayashi etal. 1994). As a final note, there is evidence that regulation can also work the other way. NHE1 activity can lead to oscillations in intracellular Ca 2 levels (Yi et al. 2009). This is in the context of integrin signaling and recruitment of NHE1 to specific lipid raft domains of the plasma membrane. L5.2 NHE7 and Ca ’-CaM 2  In contrast to the plasmallemal NHEs, little is known about the regulation mechanisms of NHE7 and other organellar NHEs. To begin to elucidate how NHE7 is regulated, we generated a human breast cancer MDA-MB-231 cells stably expressing  20  No Signal  With Signal (Ca j 2  1’  -s CaM  NHE1  CBDA  Figure 3. NHE1 is regulated by a Ca 2 signal. In the absence of Ca , the Calmodulin 2 Binding Domain A (CBDA) in the C terminus of NHE1 is part of an autoinhibitory domain that inhibits H binding to NHE1’s ion transporter site, thereby inhibiting transporter activity. Upon signaling that results in elevation of intracellular Ca , 2 CaM binds to Ca 2 and can now bind CBDA, which can no longer bind to the Nterminal part of NHE1 and inhibit transporter activity.  21  C terminally tagged NHE7. We next immunoprecipitated the NHE7 and identified NHE7 binding proteins by mass spectroscopy (Icagami et at. 2008). CaM was one of the NHE7 binding partners identified in this study. Cell-based organellar tracer influx assays further showed that CaM inhibitors as well as Ca 2 deprivation effectively blocked NHE7 transporter activity. An interesting finding was that the C terminal tail of NHE7 has no homologous domain for CBDA and CBDB found in NHE1 (Figure 4). Calmodulin Target Database (http://calcium.uhnres.utoronto.ca) suggested a putative CaM binding site at 195 A 213 of NHE7. Although NHE1 and NHE7 share substantial similarity in this region, a A cluster of positively-charged amino acid residues are observed only in NHE7 (see Table 2). Moreover, based on the alignment of NHE7 and NHE1, and the membrane topology model by Wakabayashi eta!. (2000), this putative CaM binding site falls in the second intracellular ioop (1L2). As 1L2 has been postulated as part of the ion binding site of NHE1 (Wakabayashi eta!. 2000), this finding led us to hypothesize that CaM binding to 1L2 of NHE7 causes conformational change(s) in the ion binding site and hence affects transporter activity and possibly ion selectivity (ie. K over Naj.  22  Figure 4. Alignment of C terminus Calmodulin Binding Domain A (CBDA) and second intracellular loop (1L2) for various NHE isoforms. Identical residues are in red, residues that conserve chemical nature are in blue.  extracellular  N-terminal  1L2  CBDB  CBDA NHE1 NHE5 • NHE7  RNNLQKTRQRLRSYNRHTLVA CGGLY KPRR RYKASCSRHFIS SPQ VYDNQE PLREEDSDFILT  1L2 NHE1 NHES •NHE7  LPL RQFTENL MPSRL FFDNL LKKRHFFRNL  23  2. Materials and Methods 2.1 Materials All chemicals used were purchased from Fischer (Ottawa, Ontario). DNA oligonucleotides were ordered through Invitrogen (Burlington, Ontario). pET vector was a generous gift from the van Petegem lab (University of British Columbia, Biochemistry and Molecular Biology Department) and pGEX vector was purchased from Amersham (Piscataway, NJ). DNA restriction enzymes were obtained from New England Biolabs (Pickering, Ontario) and DNA sequencing was performed by Macrogen (Seoul, Korea). Agarose gel electrophoresis supplies were purchased from Bethesda Research Laboratories (Bethesda, MD) and agarose was obtained from Invitrogen (Burlington, Ontario). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) supplies were purchased from Bio-Rad (Hercules, CA) and SDS was obtained from BioShop (Burlington, Ontario). CaM-agarose beads were purchased from Sigma (Oakville, Ontario) and Glutathione 4B Sepharose Beads from GE Healthcare (Piscataway, NJ). Anti-glutathione-S-transferase (GST) antibody was purchased from StressGen (Victoria, BC) and goat anti-mouse antibody conjugated to horseradish peroxidase (HRP) was obtained from Jackson Laboratories (Bar Harbor, ME). Fully wet transfer supplies were purchased from Bio-Rad (Hercules, CA). Polyvinylidene fluoride (PVDF) membranes were obtained from Pall Corporation (East Hills, NY) and substrate for alkaline phosphatase was purchased from Millipore (Danvers, MA).  24  22 Construct expression and purification 2.21 GIutathioneS-transferase (GST) fusion proteins  Glutathione-S-transferase (GST) fusion proteins of NHE peptides were expressed in DH5ct Escherichia coil using the pGEX 2T plasmid (Figure 5). Synthetic DNA oligonucleotides corresponding to sense and antisense of the peptides (see Table 1) were annealed together in the presence of buffer containing 10 mM Tris pH 8.0, 50 mM NaC1 and 1 mM ethylene diamine tetraacetic acid (EDTA) by boiling for 5 minutes and then letting the solution cool to room temperature. Annealed oligonucleotides were then ligated to the EcoRI and BamHI sites of the pGEX2T vector and sequence was verified by Macrogen (Seoul, Korea). Purified DNA was then transformed into BL21 E. coil, expression was induced by isopropyl 13-D-1 thiogalactopyranoside (IPTG) and the GST fusion peptides were purified from bacteria based on a modified version of the procedure of Smith and Johnson (1988). Briefly, the bacteria were grown to approximate density of 0.6 O.D. 600 in 2 YT media at 37°C and 0.1 mM IPTG was used to induce expression of the peptides at 32°C for another 4 hours. E. coil were then lysed by incubation with 1% Triton-X-100 and protease inhibitor cocktail (Roche, IN, USA) on ice for 20 minutes, followed by sonication for 5 seconds twice, and a further incubation on ice for 20 minutes. GST fusion peptides were affinity purified with Glutathione 4B Sepharose Beads (GE Healthcare, Piscataway, NJ). 5 mL of lysate was incubated with approximately 50 p1 bed volume of Glutathione 4B Sepharose Beads at 4°C for 2 hours with constant rotation. GST fusion peptides were then washed with phosphate buffered saline (PBS) four times and then eluted from the beads using elution buffer (50 mM  25  Table 1. Oligonucleotides used in this study Sequences are listed 5’ to 3’. BamHI and EcoR! sequences at ends are in bold and underlined, and internal restriction enzyme sites are underlined. Name  Sequence  NHE7 IL2sh Sense  GATCCAAAAAACGCCATTTCTTTCGCAACCTGGGGTCCTAAGCTTG  NHE7 IL2sh Antisense  AATTCAAGCTTAGGACCCCAGGTTGCGAAAGAAATGGCGTTTTTTG  NHE7 1L2 KKPL Sense  GATCCGGGTATTCCCTGCCGCTGCGCCATTTCTTTCGCAACCTGGGGTC CATTCTGGCATGATATCG  NHE7 1L2 KKPL  AATTCGATATCATGCCAGAATGGACCCCAGGTTGCGAAAGAAATGGCG  Antisense  CAGCGGCAGGGAATACCC  NHE7 IL2sh KKRAAA  GATCCGCCGCCGCCCATTTCTTTCGCAACCTGGGGTCCTGATATCG  Sense NHE7 IL2sh KKRAAA  AATTCGATATCAGGACCCCAGGTTGCGAAAGAAATGGGCGGCGGCG  Antisense NHE7 IL2sh FFAA  GATCCAAAAAACGCCATGCCGCCCGCAACCTGGGGTCCTGATATCG  Sense NHE7 IL2sh FFAA  AATTCGATATCAGGACCCCAGGTTGCGGGCGGCATGGCGTTTTTTG  Antisense NHE1 IL2sh Sense  GATCCCCGCTGCGCCAGTTTACCGAAAACCTGGGCACCTGATATCG  NHE1 IL2sh Antisense  AATTCGATATCAGGTGCCCAGGTTTTCGGTAAACTGGCGCAGCGGG  NHE7 E2871 Sense  GATCTTTACGCACTTCTTTTTGGAATTAGCGTCCTAAATGATGCTGTT GCC  N HE7 E2 87!  GGCAACAGCATCATTTAGGACGCTAATTCCAAAAAGAAGTGCGTAAA  Antisense  GATC  26  Bsu361 4741 Swal 686 Nan 4288 Hpa4154 EeORV 4098 BssHII409  Apa13859 BstEII 3829  EcoRl 941 Smal 98 Aval 936 XrnaI 936 BarnHl 931 pGEX 2T 4948 base pairs  0 0  Aatll 122  M1u13648  PsU 1902  Figure 5. pGEX vector.  27  glutathione, 50 mM unpHed Tris-HC1, 0.1% Tritox-X-100 and 150 mM NaC1) at room temperature for 10 minutes. Purified GST fusion peptides were kept as small aliquots at -20°C and the protein concentration was determined by means of a bovine serum albumin (BSA) standard (see 2.3 below). 22.2 Maltose Binding Protein (MBP) fusion proteins  Maltose Binding Protein (MBP) fusion proteins of CaM possessing a histidine tag after MBP were expressed in Escherichia coil using the pET 28b TEV plasmid (Figure 6), a kind gift from Dr. van Petegem, and then purified based on a modified version of the procedure of Franke and Hruby (1993). BL21 E. coil were grown to approximate density of 0.6 O.D. 600 in 2YT media at 37°C and 0.1 mM IPTG was used to induce expression of the constructs at 32°C for an additional 4 hours. E. coil were then lysed by incubation with 1% Triton-X-100 and protease inhibitor cocktail (Roche, Mississauga, Ontario) on ice for 20 minutes, followed by sonication for 5 seconds twice, and a further incubation on ice for 20 minutes. Next, 5 mL of precleared lysate was incubated with approximately 50 L bed volume of Invitrogen Pro-Bond Beads (Burlington, Ontario), which are nickel beads, at 4°C for 2 hours with constant rotation. MBP fusion proteins coupled to the beads were then washed with PBS four times and MBP fusion proteins were eluted from the beads using elution buffer (500 mM imidazole pH 7.4, 1 mM CaCl2 and 250 mM KC1) at room temperature for 10 minutes. Purified MBP fusion proteins were kept as small aliquots at -20°C and the protein concentration was determined by means of a BSA standard (see 2.3 below).  28  BipI 5287 XhoI 520 PaeR7l 5209 EagI 5201 Multiple Cknirig NotI 5200 Site (MCS) Hindu 194 Sail 5188 Sad 5181 Ec113611i 5181 EoRi 515 BarnHl 51 69 NheI 513 Ndi 5131 Nool XbaI 5030 BgiIl 464 SgrAl 4922 I 8ph14771  M1ul4242 Bell 4228 BstEll4080 Bsp 1201 4035 Apal 4035  Dralil  A I  —  pET 28b TEY 5176 base pairs  941 Sgf1 942 Pvui 1067 Smal 1067 Xrnal 1249 BspDl 1249 Cial I 84 N rui  1614 Eoo571 1727A1wN1 BssSl  Figure 6. pET vector.  29  2.3 Determination of protein concentration SDS-PAGE was performed using 10% (for MBP fusion proteins) or 12% (for GST fusion peptides) acrylamide gels. Purified samples had SDS sample buffer (see 2.4 below for recipe) added to them and were boiled for 3 minutes and then loaded onto the acrylamide gels. Along with the purified samples, BSA samples of known concentrations were loaded. Purified samples were resolved in 10% (MBP fusion proteins) or 12% (GST fusion peptides) SDS-PAGE gels. Gels were then stained with Coomassie Blue dye for 30 minutes to overnight and destained for at least 2 hours using a destain solution containing 100 ml acetic acid and 900 ml ddH O:Methanol 2 (1:1). Protein concentration was determined by comparing the degree of staining of the purified samples to the staining seen with the BSA samples. 2.4 Puildown assay CaM binding was assayed using approximately 20 tL bed volume CaM-agarose beads. These were incubated with purified GST fusion peptides at 4°C for 2 hours in the presence of Buffer A or Buffer B. Buffer A contained 140 mM KC1, 10 mM HEPES pH 7.3 and 1 mM CaC1 2 while Buffer B contained 140 mM KC1, 10 mM HEPES pH 7.3 and 1 mM ethylene glycol tetraacetic acid (EGTA). Glutathione 4B Sepharose Beads were then washed with appropriate buffer (Buffer A for Ca 2 condition and Buffer B for EGTA condition) four times and then eluted with SDS sample buffer. SDS sample buffer contained 100 mM Tris-HC1 pH 6.8, 20% glycerol, 4% SDS, 0.2% bromothemol blue and 100 mM dithiothreitol (DTT). For some experiments, the flowthrough fraction, consisting of the first wash solution, was kept and Western  30  blot was performed on it (see 2.5 below for details). Eluted samples were resolved in a 12% SDS-PAGE gel and visualized by Coomassie Blue staining (see 2.3). For testing pH-dependence of CaM binding to GST fusion peptides, the standard protocol outlined above was modified. Two additional buffers were used to dilute GST fusion peptides and wash the beads. Buffer C contained 140 mM KC1, 10 mM MES pH 5.8 and 1 mM CaCl2 and Buffer D contained 140 mM KC1, 10 mM MES pH 5.8 and 1 mM EGTA. A total of four conditions were tested, representing Buffers A-D. Otherwise, the pulldowns proceeded as outlined above. 2.5 Western blot Western blot was performed on the flowthrough fractions from the pulidown assay (see 2.4). Five tL of the flowthrough fractions were resolved in a 12% SDS PAGE gel (see 2.3) and transferred onto a PVDF membrane using a fully wet procedure. PVDF membrane was then blocked in 5% skim milk for 1 hour and then incubated with a 1:5000 dilution of mouse anti-GST antibody overnight at 4°C. Following extensive washing with lx Tris-buffered saline with 0.075% Tween 20 (TBST), the blot was incubated with a 1:10000 dilution of goat anti-mouse antibody conjugated to HRP for 1 hour at room temperature. Finally, membrane was washed with lx TBST for 1 hour and signal was detected by enhanced chemiluminescence (Millipore, Danvers, MA). 2.6 Isothermal Titration Calorimetry (ITC) ITC is a biophysical technique used to determine the thermodynamic parameters of biochemical interactions. It is most commonly used to measure  31  binding of two proteins (Protein A and Protein B for example). It requires an isothermal titration calorimeter, which is composed of two identical cells (see Figure 7 for schematic). Sensitive circuits are used to detect temperature differences between the reference cell (filled with buffer or water) and the sample cell containing Protein A. Protein B, the ligand, is then titrated into the sample cell in precisely known aliquots, causing heat to be either consumed or evolved, depending on the nature of the reaction between Protein A and Protein B. The reaction may be either exothermic, in which case heat is evolved, or endothermic, in which case heat is consumed. Measurements consist of the time-dependent input of power required to maintain equal temperatures between the sample and reference cells. Observations are plotted as the power in iical/sec needed to maintain the reference and the sample cell at an identical temperature. This power is given as a function of time in seconds (Ream et aL 1992). Through MicroCal Origin software, this data can then be used to calculate various parameters, including kd, of the interaction. In this project, purified NHE7 1L2, NHE1 CBDA and CaM were dialyzed against 150 mM KCI, 1 mM CaC12, 10 mM HEPES pH 7.4 and 5 mM beta-mercaptoethanol. Protein concentrations were determined by absorbance (Edelhoch 1967). Titrations were then performed on an ITC-200 calorimeter (MicroCal, NJ, USA) at 25°C. CaM at a concentration of 500 iM was titrated, separately, into NHE7 1L2 peptide at a concentration of 50 iM and NHE1 CBDA peptide at a concentration of 50 iM using one 4 p.1 injection followed by 29 injections of 10 p.1 titrant (CaM). No interaction was detected for NHE7 1L2 and CaM. The results for NHE1 CBDA and CaM were processed with MicroCal Origin 7.0 using a single binding site model.  32  ___—  Punger Screw (Dark 8kie  Motor  (LçM BkieJ  Smpe Cen (W1h Syrirge  P1ererce Ci  ‘—Ou1e SNeki  Figure 7. Isothermal Titration Calorimetry (ITC) setup. Retrieved from http://www.microca1.com/techno1ogy/itc.asp.  33  2.7 Assay for binding of CaM lobes Binding of the lobes of CaM to NHE7 1L2 was assayed using three MBP fusion proteins: full-length CaM, N-CaM and C-CaM. 10 ig of each of these were incubated with 5 g of NHE7 1L2 GST fusion peptide at 4°C for 1 hour and then approximately 20 tL bed volume of Glutathione 4B Sepharose Beads were added. The reaction was then incubated at room temperature for 30 minutes with constant rotation. Beads were then washed with Buffer A or Buffer B, depending on the condition (see 2.4 for recipes and details), and eluted with SDS sample buffer (again see 2.4 for recipe). Eluted samples were resolved in 10% SDS-PAGE gels and stained with Coomassie Blue dye (see 2.3) to test for MBP fusion proteins pulled down along with NHE7 1L2. 2.8 NHE7 1L2 versions used Two different versions of NHE7 1L2 were used during the course of this project, differing in their size. Originally, NHE7 1L2 was identified as a putative CaM binding domain using online prediction software (Kagami et aL 2008). The prediction software predicted a very short CaM binding domain, of approximately 10 amino acids. This short version of NHE7 1L2 was termed NHE7 IL2sh. This NHE7 IL2sh was used in the testing of NHE1 1L2 CaM binding in comparison to NHE7 1L2 (where NHE1 1L2 was similarly 10 amino acids long) and as a basis for making the KKRAA and FFAA mutant versions of NHE7 1L2 to test for CaM binding of these mutants. We were concerned, however, with how short NHE7 IL2sh was in comparison to known CaM binding sites, which are approximately 20 amino acids long.  34  Therefore, we also created a longer version of NHE7 1L2, which contained several hydrophobic amino acids putatively in TMs surrounding NHE7 IL2sh in addition to the original NHE7 IL2sh predicted by the online prediction software. This longer version of NHE7 1L2 was termed NHE7 1L2 and was approximately 20 amino acids long. It was used in the experiments looking at pH-dependence of CaM binding to NHE7 1L2 and the experiments verifying the validity of the CaM binding to NHE7 1L2 by comparison with NHE1 CBDA. In addition, the KKPL NHE7 1L2 mutant was based on this longer version of NHE7 IL2 and the ITC experiments were done with this longer version.  35  3. Results 3.1 NHE7 112,  but not NHE1 112, binds to CaM  To test out the Ca -dependent interaction between CaM and NHE1 1L2 or 2 NHE7 1L2, we set out pulldown experiments in the presence of Ca 2 or EGTA (in order to chelate any Ca 2 present and so prevent the binding of Ca 2 to CaM)(see 2.4 for details). As a positive control, the CaM binding of NHE1 CBDA was also tested. Binding was assessed by the amount of GST fusion peptides pulled down in the presence of Ca 2 or EGTA, as assessed by the the approximately 30 kiloDalton (kDa) band corresponding to the GST fusion peptides. Experiments were repeated at least three times and reproducible results were obtained. NHE1 CBDA and NHE7 1L2 GST fusion peptide bands appeared significantly higher in intensity in the presence of Ca 2 than in the presence of EGTA (Figure 8). This suggests that both NHE1 CBDA-CaM binding and NHE7 1L2-CaM binding are -dependet. This is in good agreement with previous observations (Bertrand et 2 Ca a!. 1994, Kagami eta!. 2008). Interestingly, no NHE1 1L2 GST fusion peptide was co-eluted with immobilized CaM, either in the presence of Ca 2 or EGTA (Figure 8). This suggests that NHE1 1L2 is entirely incapable of binding to CaM. Therefore, it appears that NHE7 1L2 but not NHE1 1L2 is capable of binding CaM. This is particularly interesting in view of the fact that the two regions (NHE7 1L2 and NHE1 1L2) are quite similar, with only a few amino acid residues not conserved (see Figure 4). However, there is evidence that even small amino acid changes between NHE isoforms have functional  36  $  Figure 8. CaM binds to NHE7 1L2 and NHE1 CBDA but not to NHE1 1L2. Glutathione-S-transferase (GST) fusion peptides of GST-NHE7 second intracellular loop (1L2), GST-NHE1 1L2, and GST-NHE1 C terminal calmodulin binding domain A (CBDA) were incubated with calmodulin (CaM)-agarose beads in the presence of either 1 mM Ca 2 or 1 mM EGTA for 2 hours and then eluted off with sodium dodecyl sulfate (SDS) sample buffer (see 2.4 for recipe). Eluted samples were resolved in 10% SDS polyacrylamide gel electrophoresis (SDS-PAGE) gels and stained with Coomassie blue dye. A representative set of experiments is shown.  37  consequences (Mukherjee et aL 2006). Our results suggest that the amino acid residues uniquely found in NHE7 are of particular importance in binding to CaM.  3.2 Identification of critical residues for CaM binding To better characterize the interaction between NHE7 1L2 and CaM, and to identifr critical residues in NHE7 1L2 for CaM binding, we next conducted mutagenesis experiments. We paid special attention to basic, positively-charged amino acids (Bagchi eta!. 1992, Afshar eta!. 1994) and hydrophobic amino acids (Bagchi eta!. 1992, Afshar eta!. 1994, van Petegem eta!. 2005, Kim eta!. 2008) that may mediate the binding to CaM. 3.2.1 NHE7 112 KKPL The first mutant we tested was a KKPL mutant where the first two lysines of NHE7 1L2 were mutated to proline and leucine respectively in order to mimic NHE1 1L2, which has those amino acids in the equivalent positions (see Table 2) and was shown to be unable to bind to CaM (Figure 8). We tested out the binding of the KKPL mutant to CaM by a pulldown assay of the GST fusion peptide of the KKPL mutant using CaM-agarose beads (see 2.4). Pulldowns were performed in the presence of Ca 2 or EGTA and wild type NHE7 1L2 (i.e. NHE7 1L2 without any mutations) was used as a positive control. Binding was assessed by the amount of GST fusion peptide pulled down in the presence of Ca 2 or EGTA, as judged by the intensity of the approximately 30 kDa band, corresponding to the GST fusion peptide. Experiments were repeated at least three times and reproducible results were obtained.  38  It was found that the KKPL GST fusion peptide band was of about equivalent intensity in the presence of Ca 2 or EGTA (Figure 8), although it was of lesser intensity than the wild type NHE7 1L2 GST fusion peptide band used as a positive control (Figure 9). This was confirmed by Western blot using an anti-GST antibody on the flowthrough fractions (see 2.5 for details), which represent the unbound fraction and showed a mirror image pattern to the bound fraction (Figure 9). Again, approximately equivalent amounts of KKPL GST fusion peptide were seen in the presence of Ca 2 or EGTA, while less unbound, wild type NHE7 1L2 GST fusion peptide was seen in the presence of Ca 2 than in the presence of EGTA (Figure 9). -independent manner. We 2 This suggests that the KKPL mutant binds to CaM in a Ca postulated that the mutations to hydrophobic proline and leucine in the KKPL mutant caused non-specific hydrophobic interactions. Therefore, in subsequent experiments we converted amino acids to alanines instead and examined their capability to bind to CaM. 322 NHE7 112 KKRAAA The next mutant we tested was the KKRAAA mutant where the first two lysines and the first arginine of NHE7 1L2 were mutated to alanines. This mutant tested the contribution of positively-charged amino acids of NHE7 1L2 to binding of CaM. We examined whether a GST fusion peptide of the KKRAAA mutant binds to CaM by puildown assay using CaM-agarose beads (see 2.4). Pulldowns were performed in the presence of Ca 2 or EGTA and wild type NHE7 1L2 was used as a  39  -3OkDA  Bound  Unbound  Figure 9. NHE7 1L2 KKPL binds to CaM in a Ca ’-independent manner. 2 Glutathione-S-transferase (GST) fusion peptides of GST-NHE7 second intracellular loop (1L2), and GST-NHE7 1L2 KKPL were incubated with calmodulin (CaM) -agarose beads in the presence of either 1 mM Ca 2 or 1 mM EGTA for 2 hours and then eluted off with sodium dodecyl sulfate (SDS) sample buffer (see 2.4 for recipe). Eluted samples were resolved in 12% SDS polyacrylamide gel electrophoresis (SDS-PAGE) gels and stained with Coomassie blue dye to obtain the bound fraction. The unbound fraction was generated by keeping the flowthrough and performing a Western blot on it using an anti-GST antibody (see 2.5 for details). A representative set of experiments is shown.  40  positive control, while NHE1 1L2 was used as a negative control (it was established to be unable to bind to CaM in Figure 8). Binding was measured by the amount of KKRAAA mutant GST fusion peptide pulled down in the presence of Ca 2 or EGTA, as judged by the approximately 30 kDa band corresponding to the GST fusion peptide. Experiments were repeated at least three times and reproducible results were obtained. Either in the presence of Ca 2 or EGTA, GST fusion peptide of the KKRAAA mutant was not co-eluted with immobilized CaM (Figure 10). This suggests that the KKRAAA mutant is entirely incapable of binding to CaM. This furthermore suggests that positively-charged amino acids are important for binding of NHE7 1L2 to CaM, as their mutation led to loss of CaM binding. Finally, this suggests the importance of the KKR motif in the NHE7 1L2-CaM interaction and is consistent with previous reports indicating the importance of basic amino acids in CaM binding sites (Bagchi eta!. 1992,Afshar eta!. 1994). 3.2.3 NHE7 112 FFAA  In addition to the stretch of positively-charged amino acids, NHE7 1L2 uniquely contains two phenylalanines. Since the involvement of bulky hydrophobic amino acids has been implicated in CaM binding (Bagchi eta!. 1992, Afshar et al. 1994, van Petegem et aL 2005, Kim et aL 2008), we next tested the binding of the FFAA mutant where the two phenylalanines of NHE7 1L2 were mutated to alanines. To examine the binding of the FFAA mutant to CaM, we carried out a pulldown assay of GST fusion peptide of the FFAA mutant using CaM-agarose beads (see 2.4).  41  “Ii I ‘‘II rj  L_v  —30 kDa  a Figure 10. NHE7 1L2 KKRAAA and NHE7 1L2 FFAA are incapable of binding to CaM. Glutathione-S-transferase (GST) fusion peptides of GST-NHE7 second intracellular loop (1L2), GST-NHE1 1L2, GST-NHE7 KKRAAA and GST-NHE7 1L2 FFAA were incubated with calmodulin (CaM)-agarose beads in the presence of either 1 mM Ca 2 or 1 mM EGTA for 2 hours and then eluted off with sodium dodecyl sulfate (SDS) sample buffer (see 2.4 for recipe). Eluted samples were resolved in 12% SDS polyacrylamide gel electrophoresis (SDS-PAGE) gels and stained with Coomassie blue dye. A representative result is shown.  42  Pulldowns were performed in the presence of Ca 2 or EGTA and wild type NHE7 1L2 was used as a positive control, while NHE1 1L2 was used as a negative control. Binding was assessed by the amount of FFAA mutant GST fusion peptide pulled down in the presence of Ca 2 or EGTA, as judged by the intensity of the approximately 30 kDa band corresponding to GST fusion peptide. Experiments were repeated at least three times and reproducible results were obtained. No GST fusion peptide was co-eluted with immobilized CaM, either in the presence of Ca 2 or EGTA (Figure 10). This suggests that the FFAA mutant is entirely incapable of binding to CaM. This furthermore suggests the importance of the two phenylalanines for binding of NHE7 1L2 to CaM. Our results reiterate the importance of hydrophobic interactions in the binding of CaM to its target proteins. 33 pH-independence of NHE1 CBDA and NHE7 112 binding to CaM We hypothesized that there could be a pH-dependent interaction between NHE7 1L2 and CaM because NHE7 1L2 contains a histidine residue missing in NHE1 CBDA (see Figure 4), which could become protonated upon change of pH in the physiological range. Such reasoning is based on the expected pKa of the pyrole NH proton of histidine, which is 6.0 and hence close to neutral. Furthermore, it has been shown that in the plant Arabadopsis thaliana NHX1, a homologue of human NHE6-9, can bind to a CaM-like protein in a pH-dependent manner (Yamaguchi et aL 2005). This may be true for NHE7 as well. For all these reasons, we were interested in seeing whether pH can affect NHE7 1L2 binding to CaM.  43  To define pH-dependence of CaM binding to NHE7 IL2 and NHE1 CBDA, a puildown assay was conducted by incubating GST fusion peptides of NHE7 1L2 and NHE1 CBDA with CaM-agarose beads (see 2.4 for details). Pulldowns were performed in the presence of Ca 2 or EGTA and under two different pH conditions: pH 7.3 and pH 5.8. These pHs were chosen because they lie on either side of the pKa of histidine’s pyrole NH, which is expected to be 6.0. Hence, these pHs should represent the unprotonated (pH 7.3) and protonated (pH 5.8) forms of histidine. These pHs are also close to the pH values of the cytosol and acidic organellar lumens. GST alone, coded by pGEX, was used as a negative control. We then compared the amount of GST fusion peptides pulled down in the presence of Ca 2 and EGTA, at pH 7.3 and pH 5.8, as judged by the intensity of the GST fusion peptide band, which ran at approximately 30 kDa. Experiments were repeated at least three times and reproducible results were obtained. NHE7 1L2, and to some extent NHE1 CBDA GST fusion peptide bands were more intense at pH 5.8 than 7.3, although this was much less pronounced than the difference between Ca 2 and EGTA conditions (Figure 11). However, normalization of the obtained data with the amount of background binding in the presence of EGTA at pH 7.2 and pH 5.8 resulted in no significant difference in binding between the two pHs in the presence of Ca 2 for both NHE7 1L2 and NHE1 CBDA GST fusion peptides. This suggests that both NHE7 1L2 and NHE1 CBDA may bind to CaM in a pH-independent manner. The protonation status of the histidine in NHE7 1L2 appears to not be crucial for CaM binding.  44  pH 7.3  pH 5.8  I” C-,  -3OkDa  Figure 11. pH-independence of CaM binding to NHE7 1L2 and NHE1 CBDA. Glutathione-S-transferase (GST) fusion peptides of GST-NHE1 C terminal calmodulin binding domain A (CBDA) and GST-NHE7 second intracellular ioop (1L2), or just GST (pGEX), were incubated with calmodulin (CaM)-agarose beads at pH 7.3 and pH 5.8, in the presence of either 1 mM Ca 2 or 1 mM EGTA, for 2 hours and then eluted off with sodium dodecyl sulfate (SDS) sample buffer (see 2.4 for recipe). Eluted samples were resolved in 12% SDS polyacrylamide gel electrophoresis (SDS-PAGE) gels and stained with Coomassie blue dye. A representative result is shown.  45  3.4 Isothermal Titration Calorimetry (ITC) ITC experiments were performed with affinity-purified CaM and GST fusion peptides of NHE7 1L2 and NHE1 CBDA (see 2.2 for details) and the quality of the purified proteins were evaluated by resolving in SDS-PAGE gels prior to ITC experiments. CaM was titrated, separately, into NHE7 1L2 and NHE1 CBDA GST fusion peptides at 2 5°C. ITC was used to characterize these interactions because this method allows the direct measurement of the thermodynamic parameters of the binding reaction, gives an unmatched level of accuracy and resolution (Velazquez Campoy and Freire 2005), and permits one to obtain an accurate value for kd. No interaction was detected between the NHE7 1L2 GST fusion peptide and CaM. By contrast, an interaction was observed with moderate binding affinity (kd= 5.52 pM) between the NHE1 CBDA GST fusion peptide and CaM (Figure 12 and Table 2). The reaction caused a relatively moderate change in enthalpy (AH) (Table 2), although the change was negative, suggesting enthalpy may drive the reaction. The change in entropy (AS) was also negative (Table 2), suggesting the reaction was not driven by entropy. The interaction between NHE1 CBDA and CaM has been previously published (Bertrand et aL 1994). However, we obtained a kd of 5.52 tM while in the literature the value is 20 nM (Bertrand et aL 1994). Bertrand et aL (1994) used a recombinant protein corresponding to the entire NHE1 C terminus deleted specifically in CBDB (to obtain the value for CBDA) while we used a GST fusion peptide of just CBDA.  46  0  20  Time (mm) 60 100 80  40  120  140  160  ry rr n U)  (‘3  C-) =-  -08. -1.0-  -1.2  —1.6—  •  •  •  O0’’51!01!52!0  2.5  Molar Ratio  Figure 12. Isothermal Titration Calorimetry (ITC) results of CaM Titration into NHE1 CBDA. Purified calmodulin (CaM) at a concentration of 500 tM was titrated into NHE1 C terminal Calmodulin Binding Domain A (CBDA) peptide at a concentration of 50 tM using one 4 p1 injection followed by 29 injections of 10 j.il titrant (CaM) using an ITC 200 calorimeter (MicroCal, NJ, USA) at 25°C.  47  Table 2. Isothermal Titration Calorimetry (ITC) results of CaM Titration into NHE1 CBDA. Purified calmoduljn (CaM) at a concentration of 500 pM was titrated into NHE1 C terminal Calmodulin Binding Domain A (CBDA) peptide at a concentration of 50 iM using one 4 i1 injection followed by 29 injections of 10 pi titrant (CaM) using an ITC 200 calorimeter (MicroCal, NJ, USA) at 25°C. Origin 7.0 software (MicroCal, NJ, USA) was then used to calculate thermodynamic parameters using a single binding site model.  N AH (kcal/mol)  0.934 ± 0.005 03 -1.00 x 10  AS (cal/mol/deg) Kd (tM)  ±  0.07612  -9.61 5.52  ±  0.00572  48  Hence, it is possible that residues surrounding CBDA are important for increasing the affinity for CaM and we were simply missing those in our GST fusion peptide. In addition, Bertrand et aL (1994) used a different method from ours. Instead of ITC, Bertrand etaL (1994) used titration of fluorescence of dansyl-CaM to measure kd. This could account for our different findings, especially if the binding of CaM to NHEs is primarily driven by entropy as opposed to enthalpy. This would make detection of the binding by ITC more difficult, although it should not affect the results obtained using fluorescence of dansyl-CaM. Such an entropy-driven interaction between NHEs and CaM could account not only for the smaller kd value obtained by Bertrand et a!. (1994) for the interaction between NHE1 CBDA and CaM, but could also account for our inability to detect an interaction between NHE7 1L2 and CaM using ITC.  49  4. Discussion 4.1 Characterization of NHE7 112 binding to CaM We tested out the binding of NHE7 1L2 and NHE1 1L2 to CaM. It was found that although NHE7 1L2 bound to CaM, NHE1 1L2 was not able to bind to CaM (Figure 8). This is particularly interesting in view of the fact that the two regions (NHE7 1L2 and NHE1 1L2) are quite similar, with only a few amino acid residues not conserved (see Figure 4). The functional consequences of such a difference in CaM binding between NHE7 1L2 and NHE1 1L2 could be very interesting. As CaM binding to NHE7 1L2 is specific, this interaction could have specific physiological effects. The NHE7 1L2 region contains two lysines and one arginine. Mutation of the two lysines to proline and leucine resulted in residual CaM binding (Figure 9), whereas the mutation of the three basic amino acids to alanines completely abolished Ca -dependent CaM binding (Figure 10). Likewise, mutation of the two 2 phenylalanines in the middle of NHE7 1L2 to alanines completely abolished CaM binding (Figure 10). These data indicate that NHE7 1L2 binds to CaM via basic and hydrophobic amino acids, as previously reported in other CaM-binding proteins. To test whether 1L2 is the sole CaM binding domain in NHE7, it is important to test binding ability of various mutants of full-length NHE7 in the future. This will be readily done by transfecting different mutants into cultured cells and conducting CaM pulldowns. We also tested the pH-dependence of the CaM and NHE7 1L2 interaction, using the CaM and NHE1 CBDA interaction as a negative control. Some pH-dependency of  50  NHE7 1L2 binding to CaM was indeed observed (Figure 11), but normalization with the amount of background binding in the presence of EGTA resulted in no significant difference between the two pHs tested. Hence, our data suggest that NHE7 1L2 binding to CaM is likely pH independent. However, there is a possibility that pHdependent CaM binding is context-dependent and the sensitivity and/or specificity of our pulldown assay was insufficient to detect such a pH-dependency. Indeed, our initial attempt of ITC experiments did not detect any binding between NHE7 1L2 and CaM. Alternative approaches such as band-shift assays under non-denaturing conditions should be considered. For example, non-denaturing PAGE could be used to directly detect the CaM-NHE7 1L2 complex. Since non-denaturing PAGE does not disrupt protein complexes, the CaM-NHE7 1L2 complex could be visualized with Coomassie Blue dye and the kd could be calculated from a series of experiments with known amounts of the CaM and NHE7 1L2, based on the intensity of the band for the CaM-NHE7 1L2 complex. In addition, use of recombinant proteins covering larger segments of NHE7 and/or untagged purified synthetic peptides should be considered in the future for further characterization of the NHE7 1L2-CaM interaction. 42 CaM ‘obes responsible for binding to NHE7 112 A novel finding in this project is the presence of an unconventional CaMbinding site that is significantly shorter than the previously characterized CaM binding sites. A question remains: how the large CaM molecule can bind to such a site. Perhaps with only one lobe? Perhaps only one lobe at a time? Indeed, the ability of one lobe of CaM to bind with higher affinity than another to CaM binding proteins  51  is well documented. Several CaM binding partners, including CaM-dependent kinase II (Forest et a!. 2008) and myosin light chain kinase (Persechini et at. 1994), have a higher affinity for C-CaM than N-CaM. Yet other CaM binding partners, like nitric oxide synthase (Spratt eta!. 2007), have a higher affinity for N-CaM, but this appears to be more rare. In all cases, it is postulated that the lobe with the higher affinity for the target protein will bind first, followed by the binding of the second lobe. The significance of this sequential binding of the lobes of CaM ties in to the different Ca 2 binding properties of C-CaM and N-CaM. C-CaM has the higher affinity for Ca 2 but N-CaM has the faster kinetics of Ca 2 binding (Bayley et at. 1984, Teleman et at. 1986). Therefore, having C-CaM bind to a target protein first will result in CaM binding the target protein when intracellular Ca 2 is only moderately elevated but has been elevated for awhile, as C-CaM becomes activated at lower concentrations of Ca 2 than N-CaM but with slower kinetics than N-CaM. Conversely, having N-CaM bind to a target protein first will result in CaM binding the target protein when intracellular Ca 2 is highly elevated but immediately after such elevation occurs, allowing for more transient and intense intracellular Ca 2 elevation. When CaM binding partners are expected to respond to more transient 2 fluxes, as for example in the synapse during neuronal firing, N-CaM can then be Ca expected to bind with greater affinity to these binding partners. On the other hand, when CaM binding partners are expected to respond to less intense yet stable Ca 2 fluxes, as for example during NaC1 reabsorption in the digestive tract, than C-CaM can be expected to bind with greater affinity to these binding partners.  52  To determine which CaM lobe(s) bind(s) to NHE7 1L2, we began to optimize a pulidown assay of the binding of N-CaM and C-CaM to NHE7 1L2 using Glutathione 4B Sepharose Beads (see 2.7 for details). Our initial attempts at this experiment were unsuccessful because of unexpected rapid degradation of these recombinant proteins. It would be important to re-optimize these experiments in the future. One could also test whether N-CaM and C-CaM together can mimic the binding of fulllength CaM even though the lobes are not connected as in full-length CaM. There is evidence in the literature that this can occur with other CaM binding proteins that contain conventional CaM binding sites (Vetter and Leclerc 2003, Forest et aL 2008). Finally, it is an interesting finding that the unconventional CaM-binding site of NHE7 1L2 still makes use of the same forces for binding to CaM as previously characterized, conventional CaM-binding sites. Namely, it still uses electrostatic and hydrophobic interactions to dock onto the CaM molecule. Further research on the exact details of how NHE7 1L2 binds to CaM, such as from an X-ray crystallographic study of the NHE7 peptide bound to CaM, will help establish how this interaction works and may help identify other proteins that bind to CaM in a similar manner. This is yet another avenue of research that would be interesting to pursue in the future. 4.3 Functional significance of the CaM-NHE7 interaction The results delineated here are an important first step in understanding the interaction between Ca 2 signaling and pH regulation. Two molecules that have been shown to be important for, individually, Ca 2 signaling (CaM) and pH regulation  53  (NHE7) have now also been shown to interact together. To define the functional significance of the CaM-NHE7 interaction would be an important next step. Our previous cell-based organellar tracer influx assays showed that various CaM inhibitor drugs as well as Ca 2 depletion markedly reduced pH-gradient dependent 86 RbCl influx by NHE7 (Kagami et a!. 2008). To further refine the previous findings, it is important to establish liposome-based in vitro assays. Previous studies have successfully used yeast Saccharomyces cerevisiae as an expression system and reconstituted the affinity-purified NHEs in liposomes (Nakamura et aL 2005). By mutagenizing several crucial amino acid residues responsible for CaM binding, direct effects of CaM-dependence on NHE7 transporter activity could be measured. Although such an in vitro system may not adequately represent the complex in vivo reality, it does allow one to study NHE7 and its transporter activity in greater detail and without the problem of interference from other ion transporters or channels. Alternatively, functional implications of CaM binding to NHE7 could be tested in a more in vivo system with a pH-sensitive Green Fluorescent Protein (GFP). This is an established method for measuring the pH within living cells (Robey eta!. 1998) and could be used to measure the pH of intracellular organelles, specifically the Golgi in the context of NHE7. Then the function of CaM binding to NHE7 in maintaining organellar pH could be tested by means of several constructs of NHE7 fused to this pH-sensitive GFP and appropriate targeting of the pH-sensitive GFP to the Golgi lumen (i.e. the luminal side of NHE7). A fusion with wild type NHE7 could  54  be used as a positive control, a fusion with mutant NHE7 unable to bind CaM (for example, the FFAA mutant) could be used as the experimental condition and a fusion with mutant NHE7 that is transport deficient could be used as a negative control. Indeed, some expression constructs as well Chinese hamster ovary cells stably expressing these constructs already made in our laboratory. One could test for differences in Golgi pH between these conditions and hence test for the effect of NHE7 binding to CaM on Golgi pH. This research will help delineate the contribution of NHE7 to cellular functioning, particularly if some defect is seen in cells expressing the CaM-binding deficient NHE7 or the transport deficient NHE7. Little is known about the role of NHE7 and indeed any of the organellar NHEs. Because organellar NHEs are highly conserved from yeast to man, it is conceivable that they perform some essential function for the organism, but as yet the exact nature of that function is still unknown. Reverse genetics approaches using model organisms are required to address these fundamental scientific questions. 4.4 Possib’e roles of organellar NHEs and CaM in neurona function It has long been known that Ca 2 signaling is vital for many physiological effects, especially in the nervous system. Not only is intracellular Ca 2 the trigger for release of neurotransmitters (Morris et al. 1987), but Ca 2 signaling is also vital for overall proper functioning of neurons. For example, Ca 2 signaling has been implicated in schizophrenia. Schizophrenia is a mental disorder characterized by abnormalities in the perception or expression of reality and one of the most serious  55  kinds of mental disorder (Miyakawa et aL 2003). The Ca -CaM dependent 2 phosphatase calcineurin has been shown to be abnormally downregulated in schizophrenic patients (Gerber et aL 2003, Eastwood et al. 2005) and mice lacking calcineurin show symptoms similar to those of szhizophrenic patients (Miyakawa et aL 2003). Furthermore, administration of antipsychotic medication has been shown 2 to upregulate calcineurin (Rushlow et aL 2005), as well as other componets of Ca signaling, including CaM (Rushlow et aL 2009) in the rat. Indeed, it has long been known that some antipsychotic medications directly bind to CaM (Weiss and Greenberg 1980, Weiss eta!. 1980). Therefore, Ca 2 signaling is clearly a key process disrupted in schizophrenia, suggesting normal Ca 2 signaling is vital for proper functioning of the nervous system. More recently, the contribution of pH regulation to the nervous system has been shown to be important as well. It has been shown that pH regulation can be especially vital in neurons, and that NHEs are specifically implicated in various neuropsychiatric disorders. For example, NHE7 is an X-linked gene and its locus of Xpll has been implicated in X-linked Mental Retardation (XLMR) (Claes eta!. 1997). XLMR is a class of disorders characterized by some degree of mental retardation and some degree of mutation on the X chromosome. XLMR includes various specific disorders, including Angelman Syndrome. NHE7 may be directly involved in XLMR, much like NHE6, which has been directly implicated in an Angelman-Syndrome-like phenotype (Gilfillan etah 2008) and whose locus of Xq26 has also been linked to XLMR (Shashi et a!. 2000). Most recently, NHE9 has been implicated in autism  56  (Morrow et aL 2008) and an attention deficit hyperactivity disorder (ADHD)-like phenotype (de Silva eta!. 2003). Autism is a severe neuropsychiatric disorder characterized by impaired social interaction and communication and by repetitive and stereotyped interests and behavior. It has long been known to have a genetic component, as it is highly heritable, but the extreme genetic heterogeneity of autism, and the high de novo mutation rate seen in autism, have both impaired the identification of genes associated with autism. Morrow et aL (2008) overcome this problem by studying related families with the same, heritable, genetic cause of autism. Specifically, they looked at large, heritable deletions in related families. One of the genes found to be partially deleted in a specific family was NHE9. Furthermore, Morrow et a!. (2008) specifically relate this deletion of NHE9, which encompases the C terminus of the protein and starts from the last extracellular loop, to the mutation in NHE6, also a deletion starting with the last extracellular loop, seen to cause an Angelman Syndrome-like phenotype by Gilfillan et al. (2008) and to the mutation in NHE1, yet again a deletion starting with the last extracellular loop, seen in the SWE mutant mouse that is deficient for NHE1 (Cox et a!. 1997) (see Figure 13). Especially in the case of the NHE6 mutation, the phenotype seen is remarkably similar to that of autism. Indeed, Angelman Syndrome is considered an autism-like condition, in addition to being an XLMR. It is often characterized by impairment in social interaction and communication.  57  extracellular  N-terminal  Figure 13. Location of start of deletion that in NHE1 causes slow wave epilepsy, in NHE6 causes Angelman Syndrome, and in NHE9 may cause autism.  58  Such a widespread association between NHEs (NHE1, NHE6, NHE7, NHE9) and neuropsychiatric disorders clearly implies pH regulation to be vital for neuronal function. Indeed, such findings that pH regulation may be important in the nervous system is not surprising. After all, it has long been known that changes in extracellular and intracellular pH have been associated with changes in neuronal excitability (Chesler 2003). Furthermore, normal and abnormal functioning of neurons has been associated with changes in pH. Specifically, depolarization of neurons has been associated with a Ca 2 dependent acidification of intracellular pH (Chesler 2003). In addition, large, stable changes in intracellular and extracellular pH have been associated with neuropsychiatric disorders. For example, a prolonged intracellular and extracellular acidification is seen both during and after seizures (Chesler 2003). Changes in pH are also associated with spreading depression, which is a slowly moving depression of electrical activity in the cerebral cortex that seems to be related to migraine, although it has been observed to accompany ischemia in the brain as well (Ruscak 1962). Ischemia is a loss of blood flow and most often occurs in the brain during stroke. Whether it is associated with migraine or ischemia, spreading depression is associated with a transient intracellular alkalinization followed by a prolonged acidification, both intracellular and extracellular. The acidification is thought to be metabolically mediated, as neurons produce excessive lactic acid during this phenomenon (Mutch and Hansen 1984). By contrast, the preceding alkalinization is thought to be mediated by overcompensation by HC0 3  59  ion of the extracellular space /Cl- exchangers on nearby glial cells for the acidificat en 1984). associated with neuronal activity (Mutch and Hans means of several The brain possesses multiple way of regulating pH by are just one such family, but families of plasmalemmal ion transporters. The NHEs cells) and Na driven Cl electrogenic Na/HCO3 transporters (especially in glial ous system (Chesler 0 antiporters also exist and can regulate pH in the nerv 3 /HC have evolved in the 2003). Clearly, such extensive regulation of pH could not to have multiple levels of nervous system without a reason. Perhaps the reason is The evolution of such a regulation of pH in case one breaks down and fails to act. n is important in the nervous backup mechanism clearly indicates that pH regulatio system. m, pH regulation may In addition to its direct importance to the nervous syste 2 signaling. In this context, the also be indirectly important through its effects on Ca e of the far2 signaling shown in this project may explain som connection to Ca ple, it may be that the reaching effects of pH regulation in the brain. For exam aL 1997, Bell et al. 1999) neurological symptoms in the NHE1 deficient mice (Cox et 2 signaling, lar pH on Ca are at least partially due to indirect effects of intracellu veniste et aL 1988) as well as which has been long known to affect cell survival (Ben process of regulated secretion other important cellular processes. For example, the which proteins 2 signaling. Regulated secretion is the process by is dependent on Ca secreted upon the receipt of to be secreted are packaged ahead of time but are only system. Intriguingly, 2 signal and it is of key important to the nervous a specific Ca  60  g it a good candidate to regulated secretion is also known to be affected by pH, makin be regulated by the CaM-NHE7 interaction. CaM is not the only It should be emphasized that the interaction of NHE7 with 2 signaling. In general, the whole family of NHEs is mechanism that links NHE7 to Ca ion of PKC, 2 in several ways. For example, there is the contribut responsive to Ca porter 2 for activity and, once active, can increase the trans which requires Ca eta!. 2001) while it inhibits activity of NHE1 (Borgese eta!. 1992) and NHE2 (Alrefai (Attaphitaya eta!. the transporter activity of NHE3 (Alrefai et aL 2001) and NHE5 shown to involve NHE 200 1). Furthermore, this PKC-mediated regulation has been in which case the binding proteins, much like CaM-mediated regulation of NHEs, inhibition of NHE3 is NHE binding protein is CaM. For example, the PKC-mediated is a multi-PDZ domain mediated through NHERF2 (Lee-Kwon eta!. 2003), which to the actin containing protein that connects transmembrane molecules ically, NHERF2 cytoskeleton and thereby regulates their localization. Specif thereby inhibiting NHE3 stimulates the endocytosis of NHE3 upon PKC stimulation, transporter activity (Lee-Kwon eta!. 2003). of which NHERF2 is a The Na/H exchanger regulatory factor (NHERF) family has been shown to be member contains four members altogether (NHERF1-4) and et aL 1997), lungs expressed in various tissues, including the digestive tract (Yun 2003). The localization (Raghuram et aL 2001), and the nervous system (Gatto et aL particular interest, as this of NHERF1 in the nervous system (Gatto eta!. 2003) is of enriched in the brain. implies a colocalization with NHE7 and other organellar NHEs  61  Although a direct interaction between NHERF1 and NHE7 has yet to be shown, there is potential for NHE7 to be regulated by NHERF1 in neurons, both due to the implied colocalization and due to the fact that NHERF1 has been shown to bind and regulate other NHE isoforms (ICurashima et aL 1999, Cardone et aL 2007). Such potential regulation of NHE7 by NHERF1 may be dependent on PKC and Ca , similar to the 2 regulation of NHE3 by NHERF 1 (Kurashima eta!. 1999). Indeed, NHE7 is known to respond to PKC activation. Specifically, NHE7 has been shown to colocalize with CD44 in the plasma membrane upon PKC activation (Kagami eta!. 2008). Such a promotion of localization to the plasma membrane has been shown to be mediated by NHERF proteins for the ROMK channel complex (Yoo et a!. 2004). Therefore, it is possible that the localization of NHE7 to the plasma membrane in response to PKC activation may be similarly regulated by NHERF proteins. This would be an interesting hypothesis to test. Changes in Ca 2 levels would clearly be expected to impact NHE7 in more than one way. For example, the localization of NHE7 at the plasma membrane after PKC activation may reflect a unique role of NHE7 in the plasma membrane, perhaps as a scaffold protein. Meanwhile, intracellular Ca 2 would also result in CaM binding to NHE7 and increasing its transporter activity. Such complications at the molecular level may correspond to complications at the physiological level in the phenotype of neuropsychiatric disorders. The same may hold true for other tissues where NHEs have been shown to be important, for example in the heart. There, too, NHEs may be important for their  62  indirect effect on Ca 2 signaling as well as for their transporter function. In either case, this interesting connection between Ca 2 signaling and pH regulation is certainly worth further exploration and this project should be seen as only the beginning of the understanding (and research) still to come. For example, after characterizing the interaction between NHE7 1L2 and CaM it would be worthwhile to expand the research into other NHEs and CaM. For example, it would be interesting to see which lobe(s) of CaM are important for its interaction with NHE1 CBDA and how NHE1 responds to CaM inhibitors on a functional level. The first could be elucidated by pulidown experiments using N-CaM and C-CaM and the second could be elucidated by re-constituting heterologously expressed NHE1 (for example, expressed in yeast) in an in vitro liposome system. This system could then be used to measure transporter activity via a Na uptake assay. This assay relies on radioactive ions being transporterd inside the liposome by NHEs. Radioactive Na is used and the transport of Na into the liposome by NHE1 is used as a proxy for transporter activity. One would make sure the Na influx was due to NHE1 transporter activity by use of an NHE-specific inhibitor such as 5-(N-ethyl-Nisopropyl) amiloride (EIPA) to block this Na influx and by determining that this Na influx is pH dependent, as one would expect for NHE1 transporter activity. Although an in vitro system may not adequately represent the complex in vivo reality, it does allow one to study NHE1 and its transporter activity in greater detail and without the problem of interference from other NHE isoforms.  63  4.5 Conclusion We have shown that NHE7 and CaM interact by means of an unconventional, extremely short CaM-binding site comprising NHE7 1L2. This interaction is likely to be pH-independent and is mediated by positively charged and hydrophobic amino acids of NHE7 1L2. This interaction is expected to affect the functionality of NHE7 and hence to have potential for great relevance to physiology and, specifically, the nervous system. Such potential for relevance to the nervous system is highlighted by the numerous NHE isoforms that have been implicated in neuronal function: NHE1, NHE6 and NHE9. Future research needs to be done to elucidate the exact nature of the contribution to physiology and the nervous system of the NHE7-CaM interaction, however. There is much potential for more research to be done under this theme of intersection between pH and Ca 2 signaling, as this is still a relatively new and unexplored area of research. In particular, the intersection of pH and Ca 2 signaling could be tested in the context of the nervous system, as there is much potential for physiological relevance there.  64  References Afshar, M., Caves, L. S., Guimard, L., Hubbard, R. E., Calas, B., Grassy, G., et al. (1994). Investigating the high affinity and low sequence specificity of calmodulin binding to its targets. Journal of Molecular Biology, 244(5), 554-571. Aharonovitz, 0., Zaun, H. C., Balla, T., York, J. D., Orlowski, J., & Grinstein, S. (2000). Intracellular pH regulation by na(+)/H(+) exchange requires phosphatidylinositol 4,5-bisphosphate. The Journal of Cell Biology, 150(1), 213-224. Alrefai, W. A., Scaglione-Sewell, B., Tyagi, S., Wartman, L., Brasitus, T. A., Ramaswamy, K., etal. (2001). Differential regulation of the expression of na(+)/H(+) exchanger isoform NHE3 by PKC-alpha in caco-2 cells. American Journal of Physiology.Cell Physiology, 281(5), C15 51-8. Ambuhi, P. M., Amemiya, M., Danczkay, M., Lotscher, M., Kaissling, B., Moe, 0. W., et al. (1996). Chronic metabolic acidosis increases NHE3 protein abundance in rat kidney. The American Journal of Physiology, 271(4 Pt 2), F917-25. Aronson, P. S., Nee, J., & Suhm, M. A. (1982). Modifier role of internal H+ in activating the na+-H+ exchanger in renal microvillus membrane vesicles. Nature, 299(5879), 161-163. Attaphitaya, S., Nehrke, K., & Melvin, J. E. (2001). Acute inhibition of brain-specific na(+)/H(+) exchanger isoform 5 by protein kinases A and C and cell shrinkage. American Journal of Physiology.Cell Physiology, 281(4), Cl 146-57. Bagchi, I. C., Huang, Q. H., & Means, A. R. (1992). Identification of amino acids essential for calmodulin binding and activation of smooth muscle myosin light chain kinase. The Journal of Biological Chemistry, 267(5), 3024-3029. Bahler, M., & Rhoads, A. (2002). Calmodulin signaling via the IQ motif. FEBS Letters, 5 13(1), 107-113. Baird, N. R., Orlowski, J., Szabo, E. Z., Zaun, H. C., Schultheis, P. J., Menon, A. G., et al. (1999). Molecular cloning, genomic organization, and functional expression of Na+/H+ exchanger isoform 5 (NHE5) from human brain. The Journal of Biological Chemistry, 274(7), 4377-4382. Barroso, M. R., Bernd, K. K., DeWitt, N. D., Chang, A., Mills, K., & Sztul, E. S. (1996). A novel Ca2+-binding protein, p22, is required for constitutive membrane traffic. The Journal of Biological Chemistry, 271(17), 10183-10187.  65  Bayley, P., Ahistrom, P., Martin, S. R., & Forsen, S. (1984). The kinetics of calcium binding to calmodulin: Quin 2 and ANS stopped-flow fluorescence studies. Biochemical and Biophysical Research Communications, 120(1), 185-191. Bell, S. M., Schreiner, C. M., Schultheis, P. J., Miller, M. L., Evans, R. L., Vorhees, C. V., et al. (1999). Targeted disruption of the murine Nhel locus induces ataxia, growth retardation, and seizures. The American Journal of Physiology, 2 76(4 Ptl),C788-95. Benveniste, H., Jorgensen, M. B., Diemer, N. H., & Hansen, A. J. (1988). Calcium accumulation by glutamate receptor activation is involved in hippocampal cell damage after ischemia. Acta Neurologica Scandinavica, 78(6), 529-536. Bertrand, B., Wakabayashi, S., Ikeda, T., Pouyssegur, J., & Shigekawa, M. (1994). The Na+/H+ exchanger isoform 1 (NHE1) is a novel member of the calmodulin binding proteins, identification and characterization of calmodulin-binding sites. The Journal of Biological Chemistry, 269(18), 13703-13709. Bianchini, L., L’Allemain, G., & Pouyssegur, J. (1997). The p42/p44 mitogen-activated protein kinase cascade is determinant in mediating activation of the Na+/H÷ exchanger (NHE1 isoform) in response to growth factors. The Journal of Biological Chemistry, 272(1), 271-279. Bookstein, C., DePaoli, A. M., Xie, Y., Niu, P., Musch, M. W., Rao, M. C., et al. (1994). Na+/H+ exchangers, NHE-1 and NHE-3, of rat intestine, expression and localization. The Journal of Clinical Investigation, 93(1), 106-113. Bookstein, C., Musch, M. W., DePaoli, A., Xie, Y., Rabenau, K., Villereal, M., et al. (1996). Characterization of the rat Na÷/H÷ exchanger isoform NHE4 and localization in rat hippocampus. The American Journal of Physiology, 271(5 Pt 1), C1629-38. Borgese, F., Sardet, C., Cappadoro, M., Pouyssegur, J., & Motais, R. (1992). Cloning and expression of a cAMP-activated Na+/H+ exchanger: Evidence that the cytoplasmic domain mediates hormonal regulation. Proceedings of the National Academy of Sciences of the United States of America, 89(15), 67656769. Bowers, K., Levi, B. P., Patel, F. 1., & Stevens, T. H. (2000). The sodium/proton exchanger Nhxlp is required for endosomal protein trafficking in the yeast saccharomyces cerevisiae. Molecular Biology of the Cell, 11(12), 4277-4294. Brett, C. L., Donowitz, M., & Rao, R. (2005a). Evolutionary origins of eukaryotic sodium/proton exchangers. American Journal of Physiology.Cell Physiology, 288(2), C223-39.  66  Brett, C. L., Tukaye, D. N., Mukherjee, S., & Rao, R. (2005b). The yeast endosomal Na+K+/H÷ exchanger Nhxl regulates cellular pH to control vesicle trafficking. Molecular Biology of the Cell, 16(3), 1396-1405. Brett, C. L., Wei, Y., Donowitz, M., & Rao, R. (2002). Human na(+)/H(+) exchanger isoform 6 is found in recycling endosomes of cells, not in mitochondria. American Journal of Physiology.Cell Physiology, 282(5), C103 1-41. Cardone, R. A., Bellizzi, A., Busco, G., Weinman, E. J., Dell’Aquila, M. E., Casavola, V., et al. (2007). The NHERF1 PDZ2 domain regulates PKA-RhoA-p38-mediated NHE1 activation and invasion in breast tumor cells. Molecular Biology of the Cell, 18(5), 1768-1780. Chambrey, R., Achard, J. M., & Warnock, D. G. (1997). Heterologous expression of rat NHE4: A highly amiloride-resistant Na+/H+ exchanger isoform. The American Journal of Physiology, 272(1 Pt 1), C90-8. Chen, X., Polleichtner, G., Kadurin, I., & Grunder, 5. (2007). Zebrafish acid-sensing ion channel (ASIC) 4, characterization of homo- and heteromeric channels, and identification of regions important for activation by H+. The Journal of Biological Chemistry, 282(42), 30406-30413. Chesler, M. (2003). Regulation and modulation of pH in the brain. Physiological Reviews, 83(4), 1183-1221. Claes, S., Vogels, A., Holvoet, M., Devriendt, K., Raeymaekers, P., Cassiman, J. J., et al. (1997). Regional localization of two genes for nonspecific X-linked mental retardation to Xp22.3-p22.2 (MRX49) and Xpll.3-pll.21 (MRX5O). American Journal of Medical Genetics, 73(4), 474-479. Collins, J. F., Honda, T., Knobel, S., Bulus, N. M., Conary, J., DuBois, R., et al. (1993). Molecular cloning, sequencing, tissue distribution, and functional expression of a Na+/H+ exchanger (NHE-2). Proceedings of the National Academy of Sciences of the United States of America, 90(9), 3938-3942. Cox, G. A., Lutz, C. M., Yang, C. L., Biemesderfer, D., Bronson, R. T., Fu, A., et a!. (1997). Sodium/hydrogen exchanger gene defect in slow-wave epilepsy mutant mice. Cell, 91(1), 139-148. Cuello, F., Snabaitis, A. K., Cohen, M. S., Taunton, J., & Avkiran, M. (2007). Evidence for direct regulation of myocardial Na+/H+ exchanger isoform 1 phosphorylation and activity by 90-kDa ribosomal S6 kinase (RSK): Effects of the novel and specific RSK inhibitor fmk on responses to aiphal-adrenergic stimulation. Molecular Pharmacology, 71(3), 799-806.  67  de Silva, M. G., Elliott, K., Dahl, H. H., Fitzpatrick, E., Wilcox, S., Delatycki, M., et al. (2003). Disruption of a novel member of a sodium/hydrogen exchanger family and DOCK3 is associated with an attention deficit hyperactivity disorder-like phenotype. Journal of Medical Genetics, 40(10), 733-740. Ding, J., Ng, R. W., & Fliegel, L. (2007). Functional characterization of the transmembrane segment VII of the NHE1 isoform of the Na+/H+ exchanger. Canadian Journal of Physiology and Pharmacology, 85(3-4), 319-325. Ding, J., Rainey, J. K., Xu, C., Sykes, B. D., & Fliegel, L. (2006). Structural and functional characterization of transmembrane segment VII of the Na+/H+ exchanger isoform 1. The Journal of Biological Chemistry, 281(40), 29817-29829. Eastwood, S. L., Burnet, P. W., & Harrison, P. J. (2005). Decreased hippocampal expression of the susceptibility gene PPP3CC and other calcineurin subunits in schizophrenia. Biological Psychiatry, 57(7), 702-710. Edelhoch, H. (1967). Spectroscopic determination of tryptophan and tyrosine in proteins. Biochemistry, 6(7), 1948-1954. Fafournoux, P., Noel, J., & Pouyssegur, J. (1994). Evidence that Na+/H+ exchanger isoforms NHE1 and NHE3 exist as stable dimers in membranes with a high degree of specificity for homodimers. The Journal of Biological Chemistry, 269(4), 2589-2596. Fallon, J. L., Halling, D. B., Hamilton, S. L., & Quiocho, F. A. (2005). Structure of calmodulin bound to the hydrophobic IQ domain of the cardiac ca(v)1.2 calcium channel. Structure (London, England: 1993), 13(12), 1881-1886. Figure_itc_3.gif (n.d.). Retrieved from http://www.microcal.com/technology/itc.asp. Fliegel, L., Haworth, R. S., & Dyck, J. R. (1993). Characterization of the placental brush border membrane Na+/H+ exchanger: Identification of thiol-dependent transitions in apparent molecular size. The Biochemical Journal, 289 (Pt 1)(Pt 1), 10 1-107. Forest, A., Swulius, M. T., Tse, J. K., Bradshaw, J. M., Gaertner, T., & Waxham, M. N. (2008). Role of the N- and C-lobes of calmodulin in the activation of ca(2+)/calmodulin-dependent protein kinase II. Biochemistry, 47(40), 1058710599. Foster, T. C. (2007). Calcium homeostasis and modulation of synaptic plasticity in the aged brain. Aging Cell, 6(3), 3 19-325. Franke, C. A., & Hruby, D. E. (1993). Expression and single-step purification of enzymatically active vaccinia virus thymidine kinase containing an engineered 68  oligohistidine domain by immobilized metal affinity chromatography. Protein Expression and Purification, 4(2), 101-109. Gatto, C. L., Walker, B. J., & Lambert, S. (2003). Local ERM activation and dynamic growth cones at schwann cell tips implicated in efficient formation of nodes of ranvier. The Journal of Cell Biology, 162(3), 489-498. Gawenis, L. R., Greeb, J. M., Prasad, V., Grisham, C., Sanford, L. P., Doetschman, T., et al. (2005). Impaired gastric acid secretion in mice with a targeted disruption of the NHE4 Na+/H+ exchanger. The Journal of Biological Chemistry, 280(13), 12781-12789. Gebreselassie, D., Rajarathnam, K., & Fliegel, L. (1998). Expression, purification, and characterization of the carboxyl-terminal region of the Na+/H+ exchanger. Biochemistry and Cell Biology = Biochimie Et Biologie Cellulaire, 76(5), 837842. Gerber, D. J., Hall, D., Miyakawa, T., Demars, S., Gogos, J. A., Karayiorgou, M., et al. (2003). Evidence for association of schizophrenia with genetic variation in the l. gene, PPP3CC, encoding the calcineurin gamma subunit. Proceedings of 2 p 8 3 the National Academy of Sciences of the United States of America, 100(15), 8993-8998. Gilfillan, G. D., Selmer, K. K., Roxrud, I., Smith, R., Kyllerman, M., Eiklid, K., et al. (2008). SLC9A6 mutations cause X-linked mental retardation, microcephaly, epilepsy, and ataxia, a phenotype mimicking angelman syndrome. American Journal of Human Genetics, 82(4), 1003-1010. Goyal, S., Vanden Heuvel, G., &Aronson, P.S. (2003). Renal expression of novel Na+/H+ exchanger isoform NHE8. American Journal of Physiology.Renal Physiology, 284(3), F467-73. Hisamitsu, T., Ben Ammar, Y., Nakamura, T. Y., & Wakabayashi, S. (2006). Dimerization is crucial for the function of the Na+/H+ exchanger NHE1. Biochemistry, 45(44), 13346-13355. Honda, T., Knobel, S. M., Bulus, N. M., & Ghishan, F. K. (1993). Kinetic characterization of a stably expressed novel Na+/H+ exchanger (NHE-2). Biochimica Et Biophysica Acta, 1150(2), 199-202. Hug, M. J., & Bridges, R. J. (2001). pH regulation and bicarbonate transport of isolated porcine submucosal glands. JOP Journal of the Pancreas, 2(4 Suppl), 274-279. Hwang, I. K., Yoo, K. Y., An, S. J., Li, H., Lee, C. H., Choi, J. H., et al. (2008). Late expression of Na+/H+ exchanger 1 (NHE1) and neuroprotective effects of NHE 69  inhibitor in the gerbil hippocampal CAl region induced by transient ischemia. Experimental Neurology, 212(2), 314-323. Jurado, L. A., Chockalingam, P. S., & Jarrett, H. W. (1999). Apocalmodulin. Physiological Reviews, 79(3), 661-682. Kagami, T., Chen, S., Memar, P., Choi, M., Foster, L. J., & Numata, M. (2008). Identification and biochemical characterization of the SLC9A7 interactome. Molecular Membrane Biology, 2 5(5), 436-447. Karmazyn, M. (1996). The sodium-hydrogen exchange system in the heart: Its role in ischemic and reperfusion injury and therapeutic implications. The Canadian Journal of Cardiology, 12(10), 1074-1082. Khadilkar, A., lannuzzi, P., & Orlowski, J. (2001). Identification of sites in the second exomembrane loop and ninth transmembrane helix of the mammalian Na+/H+ exchanger important for drug recognition and cation translocation. The Journal of Biological Chemistry, 276(47), 43792-43800. Kim, E. Y., Rumpf, C. H., Fujiwara, Y., Cooley, E. S., Van Petegem, F., & Minor, D. L.,Jr. (2008). Structures of CaV2 Ca2+/CaM-IQ domain complexes reveal binding modes that underlie calcium-dependent inactivation and facilitation. Structure (London, England: 1993), 16(10), 1455-1467. Kinsella, J. L., &Aronson, P. S. (1980). Properties of the na+-H+ exchanger in renal microvillus membrane vesicles. The American Journal of Physiology, 23 8(6), F46 1-9. Klanke, C. A., Su, Y. R., Callen, D. F., Wang, Z., Meneton, P., Baird, N., et al. (1995). Molecular cloning and physical and genetic mapping of a novel human Na+/H+ exchanger (NHE5/SLC9A5) to chromosome 16q22.1. Genomics, 25(3), 615622. Kocinsky, H. S., Girardi, A. C., Biemesderfer, D., Nguyen, T., Mentone, S., Orlowski, 1. et al. (2005). Use of phospho-specific antibodies to determine the phosphorylation of endogenous Na+/H+ exchanger NHE3 at PKA consensus sites. American Journal of Physiology.Renal Physiology, 289(2), F249-58. Kurashima, K., D’Souza, S., Szaszi, K., Ramjeesingh, R., Orlowski, J., & Grinstein, S. (1999). The apical na(+)/H(+) exchanger isoform NHE3 is regulated by the actin cytoskeleton. The Journal of Biological Chemistry, 274(42), 2984329849. Lamprecht, G., Weinman, E. J., & Yun, C. H. (1998). The role of NHERF and E3KARP in the cAMP-mediated inhibition of NHE3. The Journal of Biological Chemistry, 273(45), 29972-299 78. 70  Landau, M., Herz, K, Padan, E., & Ben-Tal, N. (2007). Model structure of the Na+/H÷ exchanger 1 (NHE1): Functional and clinical implications. The Journal of Biological Chemistry, 282(5 2), 3 7854-37863. Lee, B. L., Li, X., Liu, Y., Sykes, B. D., & Fliegel, L. (2009). Structural and functional analysis of transmembrane Xl of the NHE1 isoform of the Na+/H+ exchanger. The Journal of Biological Chemistry, 284(17), 11546-11556. Lee-Kwon, W., Kim, J. H., Choi, J. W., Kawano, K., Cha, B., Dartt, D. A., et al. (2003). Ca2+-dependent inhibition of NHE3 requires PKC alpha which binds to E3KARP to decrease surface NHE3 containing plasma membrane complexes. American Journal of Physiology.Cell Physiology, 285(6), Cl 527-36. Levine, S. A., Montrose, M. H., Tse, C. M., & Donowitz, M. (1993). Kinetics and regulation of three cloned mammalian Na+/H+ exchangers stably expressed in a fibroblast cell line. The Journal of Biological Chemistry, 268(34), 2552725535. Li, X., Alvarez, B., Casey, J. R., Reithmeier, R. A., & Fliegel, L. (2002). Carbonic anhydrase II binds to and enhances activity of the Na+/H+ exchanger. The Journal of Biological Chemistry, 277(39), 36085-36091. Li, X., Liu, Y., Alvarez, B. V., Casey, J. R., & Fliegel, L. (2006). A novel carbonic anhydrase II binding site regulates NHE1 activity. Biochemistry, 45(7), 24142424. Li, X., Liu, Y., Kay, C. M., Muller-Esterl, W., & Fliegel, L. (2003). The Na+/H+ exchanger cytoplasmic tail: Structure, function, and interactions with tescalcin. Biochemistry, 42(24), 7448-7456. Lin, X., & Barber, D. L. (1996). A calcineurin homologous protein inhibits GTPase stimulated na-H exchange. Proceedings of the National Academy of Sciences of the United States of America, 93(22), 12631-12636. Luo, J., Chen, H., Kintner, D. B., Shull, G. E., & Sun, D. (2005). Decreased neuronal death in Na+/H+ exchanger isoform 1-null mice after in vitro and in vivo ischemia. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 25(49), 11256-11268. Ma, E., & Haddad, G. G. (1997). Expression and localization of Na+/H+ exchangers in rat central nervous system. Neuroscience, 79(2), 591-603. Mailander, J., Muller-Esterl, W., & Dedio, J. (2001). Human homolog of mouse tescalcin associates with na(+)/H(+) exchanger type-i. FEBS Letters, 507(3), 331-335. 71  Martin, S. R., Biekofsky, R. R., Skinner, M. A., Guerrini, R., Salvadori, S., Feeney, J., et al. (2004). Interaction of calmodulin with the phosphofructokinase target sequence. FEBS Letters, 577(1-2), 284-288. Meima, M. E., Mackley, J. R., & Barber, D. L. (2007). Beyond ion translocation: Structural functions of the sodium-hydrogen exchanger isoform- 1. Current Opinion in Nephrology and Hypertension, 16(4), 365-372. Mishima, M., Wakabayashi, S., & Kojima, C. (2007). Solution structure of the cytoplasmic region of Na+/H+ exchanger 1 complexed with essential cofactor calcineurin B homologous protein 1. The Journal of Biological Chemistry, 282(4), 2741-275 1. Miyakawa, T., Leiter, L. M., Gerber, D. J., Gainetdinov, R. R., Sotnikova, T. D., Zeng, H., et al. (2003). Conditional calcineurin knockout mice exhibit multiple abnormal behaviors related to schizophrenia. Proceedings of the National Academy of Sciences of the United States of America, 100(15), 8987-899 2. Morris, M. E., MacDonald, J. F., Friedlich, J. J., & Szekelyhidi, I. (1987). Intracellular calcium recordings from isolated cells of the mammalian central nervous system. Canadian Journal of Physiology and Pharmacology, 65(5), 926-933. Morrow, E. M., Yoo, S. Y., Flavell, S. W., Kim, T. K., Lin, Y., Hill, R. S., et al. (2008). Identifying autism loci and genes by tracing recent shared ancestry. Science (New York, N.Y.), 321(5886), 218-223. Mukherjee, S., Kallay, L., Brett, C. L., & Rao, R. (2006). Mutational analysis of the intramembranous H10 loop of yeast Nhxl reveals a critical role in ion homoeostasis and vesicle trafficking. The Biochemical Journal, 398(1), 97-105. Musch, M. W., Arvans, D. L., Wu, G. D., & Chang, E. B. (2009). Functional coupling of the downregulated in adenoma cl-/base exchanger DRA and the apical Na÷/H+ exchangers NHE2 and NHE3. American Journal of Physiology.Gastrointestinal and Liver Physiology, 296(2), G202-10. Mutch, W. A., & Hansen, A. J. (1984). Extracellular pH changes during spreading depression and cerebral ischemia: Mechanisms of brain pH regulation. Journal of Cerebral Blood Flow and Metabolism : Official Journal of the International Society of Cerebral Blood Flow and Metabolism, 4(1), 17-2 7. Nakamura, N., Tanaka, S., Teko, Y., Mitsui, K., & Kanazawa, H. (2005). Four Na+/H+ exchanger isoforms are distributed to golgi and post-golgi compartments and are involved in organelle pH regulation. The Journal of Biological Chemistry, 280(2), 1561-1572.  72  Numata, M., & Orlowski, 1. (2001). Molecular cloning and characterization of a novel (na+,K+)/H+ exchanger localized to the trans-golgi network. The Journal of Biological Chemistry, 276(20), 17387-17394. Numata, M., Petrecca, K., Lake, N., & Orlowski, J. (1998). Identification of a mitochondrial Na÷/H÷ exchanger. The Journal of Biological Chemistry, 273(12), 6951-6959. Ohgaki, R., Fukura, N., Matsushita, M., Mitsui, IC., & Kanazawa, H. (2008). Cell surface levels of organellar Na+/H+ exchanger isoform 6 are regulated by interaction with RACK1. The Journal of Biological Chemistry, 283(7), 4417-4429. Onishi, I., Lin, p. j., Diering, G. H., Williams, W. P., & Numata, M. (2007). RACK1 associates with NHE5 in focal adhesions and positively regulates the transporter activity. Cellular Signalling, 19(1), 194-2 03. Orlowski, J. (1993). Heterologous expression and functional properties of amiloride high affinity (NHE-1) and low affinity (NHE-3) isoforms of the rat Na/H exchanger. The Journal of Biological Chemistry, 268(22), 16369-16377. Orlowski, J., & Grinstein, S. (2004). Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pflugers Archiv: European Journal of Physiology, 447(5), 549-565. Orlowski, J., & Grinstein, S. (2007). Emerging roles of alkali cation/proton exchangers in organellar homeostasis. Current Opinion in Cell Biology, 19(4), 483-492. Orlowski, J., Kandasamy, R. A., & Shull, G. E. (1992). Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. The Journal of Biological Chemistry, 267(13), 9331-9339. Pang, T., Wakabayashi, S., & Shigekawa, M. (2002). Expression of calcineurin B homologous protein 2 protects serum deprivation-induced cell death by serum-independent activation of Na+/H+ exchanger. The Journal of Biological Chemistry, 277(46), 43771-43777. Persechini, A., McMillan, K., & Leakey, p. (1994). Activation of myosin light chain kinase and nitric oxide synthase activities by calmodulin fragments. The Journal of Biological Chemistry, 269(23), 16148-16154. Pfeiffer, J., Johnson, D., & Nehrke, K. (2008). Oscillatory transepithelial H(+) flux regulates a rhythmic behavior in C. elegans. Current Biology: CB, 18(4), 297302. 73  Portzehl, H. (1965). Intracellular regulation of the activity of contractile structures of the skeletal muscle. [Die intacellulare Regulation der Aktivitat der contractilen Strukturen des Skeletmuskels] Verhandlungen Der Deutschen Gesellschaft Fur Innere Medizin, 71, 125-138. Raghuram, V., Mak, D. 0., & Foskett, J. K (2001). Regulation of cystic fibrosis transmembrane conductance regulator single-channel gating by bivalent PDZ domain-mediated interaction. Proceedings of the National Academy of Sciences of the United States of America, 98(3), 1300-1305. Ream, J. E., Yuen, H. K., Frazier, R. B., & Sikorski, J. A. (1992). EPSP synthase: Binding studies using isothermal titration microcalorimetry and equilibrium dialysis and their implications for ligand recognition and kinetic mechanism. Biochemistry, 31(24), 5528-5534. Reddy, T., Ding, J., Li, X., Sykes, B. D., Rainey, J. K., & Fliegel, L. (2008). Structural and functional characterization of transmembrane segment IX of the NHE1 isoform of the Na÷/H+ exchanger. The Journal of Biological Chemistry, 283(32), 22018-22030. Robey, R. B., Ruiz, 0., Santos, A. V., Ma, J., Kear, F., Wang, L. J., et a!. (1998). pHdependent fluorescence of a heterologously expressed aequorea green fluorescent protein mutant: In situ spectral characteristics and applicability to intracellular pH estimation. Biochemistry, 37(28), 9894-9901. Rose, A. J., Kiens, B., & Richter, E. A. (2006). Ca2+-calmodulin-dependent protein kinase expression and signalling in skeletal muscle during exercise. The Journal of Physiology, 574(Pt 3), 889-903. Ruscak, M. (1962). Changes in the level of gamma-aminobutyric acid (GABA) in the ischaemic brain of rats following application of some stimuli evoking spreading EEG depression. Physiologia Bohemoslovenica, 11, 192-198. Rushlow, W. J., Seah, C., Sutton, L. P., Bjelica, A., & Rajakumar, N. (2009). Antipsychotics affect multiple calcium calmodulin dependent proteins. Neuroscience, 161(3), 877-886. Rushlow, W. J., Seah, Y. H., Belliveau, D. J., & Rajakumar, N. (2005). Changes in calcineurin expression induced in the rat brain by the administration of antipsychotics. Journal of Neurochemistry, 94(3), 587-596. Saimi, Y., & Kung, C. (2002). Calmodulin as an ion channel subunit. Annual Review of Physiology, 64, 289-3 11.  74  Sardet, C., Franchi, A., & Pouyssegur, J. (1988). Molecular cloning of the growth factor-activatable human Na+/H+ antiporter. Cold Spring Harbor Symposia on Quantitative Biology, 53 Pt 2, 1011-1018. Schultheis, P. J., Clarke, L. L, Meneton, P., Harline, M., Boivin, G. P., Stemmermann, G., et al. (1998a). Targeted disruption of the murine Na+/H+ exchanger isoform 2 gene causes reduced viability of gastric parietal cells and loss of net acid secretion. The Journal of Clinical Investigation, 101(6), 1243-1253. Schuitheis, P. J., Clarke, L. L., Meneton, P., Miller, M. L., Soleimani, M., Gawenis, L. R., et al. (1998b). Renal and intestinal absorptive defects in mice lacking the NHE3 Na+/H+ exchanger. Nature Genetics, 19(3), 282-285. Shashi, V., Berry, M. N., Shoaf, S., Sciote, J. J., Goldstein, D., & Hart, T. C. (2000). A unique form of mental retardation with a distinctive phenotype maps to Xq26q27. American Journal of Human Genetics, 66(2), 469-479. Slepkov, E., Ding, J., Han, J., & Fliegel, L. (2007a). Mutational analysis of potential pore-lining amino acids in TM IV of the na(+)/H(+) exchanger. Biochimica Et Biophysica Acta, 1768(11), 2882-2889. Slepkov, E. R., Chow, S., Lemieux, M. J., & Fliegel, L. (2004). Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1. The Biochemical Journal, 379 (Pt 1), 3 1-38. Slepkov, E. R., Rainey, J. K., Li, X., Liu, Y., Cheng, F. J., Lindhout, D. A., et al. (2005). Structural and functional characterization of transmembrane segment IV of the NHE1 isoform of the Na+/H+ exchanger. The Journal of Biological Chemistry, 280(18), 17863-17872. Slepkov, E. R., Rainey, J. K., Sykes, B. D., & Fliegel, L. (2007b). Structural and functional analysis of the Na÷/H+ exchanger. The Biochemical Journal, 40 1(3), 623-633. Smith, D. B., &Johnson, K. S. (1988). Single-step purification of polypeptides expressed in escherichia coli as fusions with glutathione 5-transferase. Gene, 67(1), 3 1-40. Spratt, D. E., Taiakina, V., & Guillemette, J. G. (2007). Calcium-deficient calmodulin binding and activation of neuronal and inducible nitric oxide synthases. Biochimica Et Biophysica Acta, 1774(10), 1351-1358. Szabo, E. Z., Numata, M., Shull, G. E., & Orlowski, J. (2000). Kinetic and pharmacological properties of human brain na(+)/H(+) exchanger isoform 5 stably expressed in chinese hamster ovary cells. The Journal of Biological Chemistry, 275(9), 6302-6307. 75  Takahashi, E., Abe, J., & Berk, B. C. (1997). Angiotensin II stimulates p9orsk in vascular smooth muscle cells. A potential na(+)-H+ exchanger kinase. Circulation Research, 81(2), 268-273. Teleman, A., Drakenberg, T., & Forsen, S. (1986). Kinetics of Ca2+ binding to calmodulin and its tryptic fragments studied by 43Ca-NMR. Biochimica Et Biophysica Acta, 873(2), 204-2 13. Tombaugh, G. C., & Somjen, G. G. (1996). Effects of extracellular pH on voltage-gated na+, K÷ and Ca2+ currents in isolated rat CAl neurons. The Journal of Physiology, 493 (Pt 3)(Pt 3), 719-73 2. Tombaugh, G. C., & Somjen, G. G. (1997). Differential sensitivity to intracellular pH among high- and low-threshold Ca2+ currents in isolated rat CAl neurons. Journal of Neurophysiology, 77(2), 639-653. Tse, C. M., Brant, S. R., Walker, M. S., Pouyssegur, J., & Donowitz, M. (1992). Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na+/H+ exchanger isoform (NHE-3). The Journal of Biological Chemistry, 267(13), 9340-9346. Tse, C. M., Ma, A. I., Yang, V. W., Watson, A. J., Levine, S., Montrose, M. H., et al. (1991). Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger. The EMBO Journal, 10(8), 19571967. Van Petegem, F., Chatelain, F. C., & Minor, D. L.,Jr. (2005). Insights into voltage-gated calcium channel regulation from the structure of the CaV1.2 IQ domain Ca2+/calmodulin complex. Nature Structural & Molecular Biology, 12(12), 1108-1115. Velazquez Campoy, A., & Freire, E. (2005). ITC in the post-genomic era...? priceless. Biophysical Chemistry, 115(2-3), 115-124. Vetter, S. W., & Leclerc, E. (2003). Novel aspects of calmodulin target recognition and activation. European Journal of Biochemistry! FEBS, 270(3), 404-414. Wakabayashi, S., Bertrand, B., Ikeda, T., Pouyssegur, J., & Shigekawa, M. (1994). Mutation of calmodulin-binding site renders the Na÷/H÷ exchanger (NHE1) highly H(+)-sensitive and Ca2+ regulation-defective. The Journal of Biological Chemistry, 269(18), 13 710-13715. Wakabayashi, S., Ikeda, T., Iwamoto, T., Pouyssegur, J., & Shigekawa, M. (1997). Calmodulin-binding autoinhibitory domain controls “pH-sensing” in the  76  Na+/H+ exchanger NHE1 through sequence-specific interaction. Biochemistry, 36(42), 12854-12861. Wakabayashi, S., Ikeda, T., Noel, J., Schmitt, B., Orlowski, J., Pouyssegur, J., et al. (1995). Cytoplasmic domain of the ubiquitous Na+/H+ exchanger NHE1 can confer Ca2÷ responsiveness to the apical isoform NHE3. The Journal of Biological Chemistry, 270(44), 26460-26465. Wakabayashi, S., Pang, T., Su, X., & Shigekawa, M. (2000). A novel topology model of the human na(+)/H(+) exchanger isoform 1. The Journal of Biological Chemistry, 2 75(11), 7942-7949. Weiss, B., & Greenberg, L. H. (1980). Modulation of beta-adrenergic receptors and calmodulin following acute and chronic treatment with neuroleptics. Advances in Biochemical Psychopharmacology, 24, 139-146. Weiss, B., Prozialeck, W., & Cimino, M. (1980). Acute and chronic effects of psychoactive drugs on adrenergic receptors and calmodulin. Advances in Cyclic Nucleotide Research, 12, 213-225. Wu, L. J., Duan, B., Mei, Y. D., Gao, J., Chen, J. G., Zhuo, M., et al. (2004). Characterization of acid-sensing ion channels in dorsal horn neurons of rat spinal cord. The Journal of Biological Chemistry, 279(42), 43716-43724. Xia, Y., Zhao, P., Xue, J., Gu, X. Q., Sun, X., Yao, H., et al. (2003). Na+ channel expression and neuronal function in the Na+/H+ exchanger 1 null mutant mouse. Journal of Neurophysiology, 89(1), 229-236. Yamaguchi, T., Aharon, G. S., Sottosanto, J. B., & Blumwald, E. (2005). Vacuolar Na+/H+ antiporter cation selectivity is regulated by calmodulin from within the vacuole in a Ca2+- and pH-dependent manner. Proceedings of the National Academy of Sciences of the United States of America, 102(44), 16107-16112. Yan, W., Nehrke, K., Choi, J., & Barber, D. L. (2001). The nck-interacting kinase (NIK) phosphorylates the na+-H+ exchanger NHE1 and regulates NHE1 activation by platelet-derived growth factor. The Journal of Biological Chemistry, 276(3 3), 31349-31356. Yj, Y. H., Ho, P. Y., Chen, T. W., Lin, W. J., Gukassyan, V., Tsai, T. H., et al. (2009). Membrane targeting and coupling of NHE1-integrinalphallbbeta3-NCX1 by lipid rafts following integrin-ligand interactions trigger Ca2+ oscillations. The Journal of Biological Chemistry, 284(6), 3855-3864. Yoo, D., Flagg, T. P., Olsen, 0., Raghuram, V., Foskett, J. K., & Welling, P. A. (2004). Assembly and trafficking of a multiprotein ROMK (kir 1.1) channel complex by PDZ interactions. The Journal of Biological Chemistry, 279(8), 6863-6873. 77  Yu, F. H., Shull, G. E., & Orlowski, J. (1993). Functional properties of the rat Na/H exchanger NHE-2 isoform expressed in Na/H exchanger-deficient chinese hamster ovary cells. The Journal of Biological Chemistry, 268(34), 2553625541. Yun, C. H., Oh, S., Zizak, M., Steplock, D., Tsao, S., Tse, C. M., et al. (1997). cAMPmediated inhibition of the epithelial brush border Na+/H+ exchanger, NHE3, requires an associated regulatory protein. Proceedings of the National Academy of Sciences of the United States of America, 94(7), 3010-3015. Zhang, M., Tanaka, T., & Ikura, M. (1995). Calcium-induced conformational transition revealed by the solution structure of apo calmodulin. Nature Structural Biology, 2(9), 75 8-767. Zhang, M., & Yuan, T. (1998). Molecular mechanisms of calmodulins functional versatility. Biochemistry and Cell Biology = Biochimie Et Biologie Cellulaire, 76(2-3), 313-323. Zhang, W., Wang, D., Volk, E., Bellen, H. J., Hiesinger, P. R., & Quiocho, F. A. (2008). V ATPase VO sector subunit al in neurons is a target of calmodulin. The Journal of Biological Chemistry, 283(1), 294-300.  78  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069946/manifest

Comment

Related Items