UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

CtrA and GtaR : two systems that regulate the Gene Transfer Agent in Rhodobacter capsulatus Leung, Molly Mo-Yin 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_leung_molly.pdf [ 2.7MB ]
Metadata
JSON: 24-1.0069928.json
JSON-LD: 24-1.0069928-ld.json
RDF/XML (Pretty): 24-1.0069928-rdf.xml
RDF/JSON: 24-1.0069928-rdf.json
Turtle: 24-1.0069928-turtle.txt
N-Triples: 24-1.0069928-rdf-ntriples.txt
Original Record: 24-1.0069928-source.json
Full Text
24-1.0069928-fulltext.txt
Citation
24-1.0069928.ris

Full Text

CtrA and GtaR: Two systems that regulate the Gene Transfer Agent in Rhodobacter capsulatus   by  Molly Mo-Yin Leung  B.Sc., Simon Fraser University, 2002    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies  (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2010  © Molly Mo-Yin Leung, 2010 ii  ABSTRACT  Bacteria are found in almost all conceivable environments, and some species can survive many different conditions.  The ability to detect environmental conditions and respond with appropriate changes to gene expression is essential to survival. Bacteria sometimes express genes involved in horizontal gene transfer when encountering a stressful environment.  Horizontal gene transfer has an important role in the evolution of prokaryotic genomes.  Rhodobacter capsulatus produces a mediator of horizontal gene transfer called the gene transfer agent (GTA).  The R. capsulatus GTA is a bacteriophage-like particle that transfers ~4 kb of double stranded genomic DNA using a transduction-like mechanism.  Previously, two proteins encoded outside the GTA gene cluster, GtaI and CtrA, were found to regulate GTA expression.  GtaI and GtaR are LuxI-type and LuxR-type quorum sensing proteins, respectively.  CtrA and CckA are homologues of the response regulator and sensor kinase, respectively, of the Caulobacter crescentus CtrA/CckA signal transduction system.  In this thesis, I studied the interactions between these regulatory proteins, environmental conditions and GTA in R. capsulatus.  I found that growth conditions had opposite effects on GTA and ctrA expression, but no effect on gtaR expression, and phosphate limitation decreased expression of ctrA. Knockout experiments revealed that GtaI and GtaR affect ctrA, gtaR and GTA expression.  Results from GtaR-DNA binding experiments were consistent with a model in which GtaR directly regulates its own expression but indirectly regulates ctrA and GTA expression. These studies also identified GtaR binding sequences. I found that in R. capsulatus CtrA did not regulate its own transcription, contrary to what occurs in C. crescentus.  My research also showed that GTA expression was affected by at least one other unidentified system.  Promoter deletion studies of ctrA, gtaR and GTA genes identified sequences that may be involved in GtaI-, GtaR-, CtrA-, and/or growth condition-based regulation.  Overall, these studies contribute to the understanding of how bacteria detect multiple environmental signals and respond with changes to gene expression.   iii  TABLE OF CONTENTS Abstract ........................................................................................................................ii Table of Contents ........................................................................................................ iii List of Tables .............................................................................................................. vii List of Figures ............................................................................................................ viii Abbreviations ............................................................................................................... x Acknowledgements......................................................................................................xi 1 Introduction .............................................................................................................. 1 1.1 The position of Rhodobacter capsulatus in the microbial world ........................ 1 1.2 Horizontal gene transfer and gene transfer agents ........................................... 2 1.3 Properties of RcGTA ......................................................................................... 3 1.4 RcGTA gene clusters ........................................................................................ 4 1.5 RcGTA expression ............................................................................................ 8 1.6 Regulation of the RcGTA gene cluster transcription ......................................... 8 1.6.1 CtrA ............................................................................................................. 8 1.6.1.1 Two-component signal transduction systems ....................................... 8 1.6.1.2 CtrA in C. crescentus .......................................................................... 10 1.6.1.3 CtrA in R. capsulatus .......................................................................... 12 1.6.1.4 The RcGTA structural gene operon and regulation by CtrA ................ 14 1.6.2 CckA in R. capsulatus................................................................................ 15 1.6.3 Quorum sensing and regulation of RcGTA ................................................ 15 1.6.3.1 Introduction to quorum sensing systems ............................................. 15 1.6.3.2 The GtaI and GtaR in R. capsulatus ................................................... 18 1.6.3.3 Regulation of RcGTA by GtaI and GtaR in R. capsulatus ................... 19 1.6.4 Effects of growth phase and nutrient limitation on GTA expression ........... 19 1.7 Goals of my research ...................................................................................... 22 2 Materials and Methods ........................................................................................... 24 2.1 Bacterial strains, growth conditions and plasmids ........................................... 24 iv  2.2 Recombinant DNA techniques ........................................................................ 26 2.3 DNA Sequencing ............................................................................................ 26 2.4 Construction of promoter::lacZ fusions ........................................................... 26 2.5 Site directed mutagenesis ............................................................................... 34 2.6 Construction of chromosomal gene mutants ................................................... 35 2.7 mRNA 5‟ end mapping .................................................................................... 36 2.8 Cell lysis for GTA bioassay ............................................................................. 37 2.9 RcGTA bioassay ............................................................................................. 38 2.10 β-galactosidase assays ................................................................................... 39 2.11 Protein concentration ...................................................................................... 40 2.12 SDS polyacrylamide gel electrophoresis (SDS PAGE) ................................... 40 2.13 Construction of plasmids to express 6 x His-tagged GtaR in E. coli ............... 40 2.14 Protein purification .......................................................................................... 41 2.15 Western blots .................................................................................................. 42 2.16 Electrophoretic mobility shift assay ................................................................. 42 2.17 DNase I footprinting assay .............................................................................. 44 3 Results ................................................................................................................... 45 3.1 RcGTA expression and release or RcGTA particles from cells ....................... 45 3.1.1 RcGTA gene cluster promoter region ........................................................ 45 3.1.1.1 RcGTA orfg1 promoter region deletions .............................................. 48 3.1.1.2 The orfg1 effect ................................................................................... 53 3.1.2 Expression of RcGTA orfg1 under four different growth conditions ........... 57 3.1.3 Expression of RcGTA orfg1 in ctrA- and cckA- strains ............................... 59 3.1.4 Accumulation of RcGTA capsid protein in cckA- cells ................................ 60 3.2 Regulation of ctrA expression ......................................................................... 62 3.2.1 Expression of ctrA in regulatory mutant strains ......................................... 62 3.2.2 Growth phase and ctrA expression ............................................................ 64 3.2.3 Analysis of the ctrA promoter region .......................................................... 67 3.2.4 Environmental factors and ctrA expression ............................................... 74 3.2.4.1 Culture growth conditions .................................................................... 74 v  3.2.4.2 The ctrA promoter and culture growth conditions ................................ 78 3.2.4.3 Effects of nutrient limitation on ctrA expression .................................. 81 3.3 GtaI-based and GtaR-based regulation .......................................................... 84 3.3.1 Regulation of ctrA ...................................................................................... 84 3.3.1.1 Expression of ctrA in GtaI and GtaR mutant strains ............................ 84 3.3.1.2 GtaI-based and GtaR-based regulation of the ctrA promoter .............. 88 3.3.1.3 Expression of ctrA in GtaI and GtaR mutants grown under four different growth conditions ................................................................................................ 93 3.3.2 Autoregulation of gtaR ............................................................................... 95 3.3.3 Location of the gtaR promoter ................................................................... 97 3.3.3.1 The effect of growth conditions on gtaR expression ......................... 102 3.3.4 Purification of the 6 x His-tagged GtaR protein ........................................ 104 3.3.5 GtaR-DNA binding ................................................................................... 105 3.3.5.1 GtaR binds the gtaR promoter .......................................................... 106 3.3.5.2 GtaR does not bind the ctrA or the RcGTA gene cluster promoter ... 110 3.3.5.3 GtaR binding sequence..................................................................... 113 4 Discussion ............................................................................................................ 118 4.1 Environmental factors affecting expression of the RcGTA, ctrA, and gtaR genes 118 4.1.1 Growth phase .......................................................................................... 118 4.1.2 Growth condition ...................................................................................... 120 4.1.3 Nutrient limitation ..................................................................................... 123 4.2 Cellular systems regulating the expression of RcGTA, ctrA, and gtaR ......... 125 4.2.1 Regulation of RcGTA by CtrA and CckA ................................................. 125 4.2.2 Regulation of RcGTA, gtaR, and ctrA by the GtaI and GtaR proteins ..... 129 4.3 R. capsulatus promoters ............................................................................... 132 4.3.1 The ctrA promoter region ......................................................................... 134 4.3.2 The gtaR promoter region ........................................................................ 136 vi  4.3.3 The RcGTA promoter region and the RcGTA mRNA .............................. 138 4.4 Concluding remarks ...................................................................................... 140 5 References ........................................................................................................... 143 Appendix A – ANOVA FOR lacZ assays ..................................................................... 150 Appendix B – Means for groups in homogeneous subsets ......................................... 157   vii  LIST OF TABLES Table 1.1  Summary of GTA properties. .......................................................................... 3 Table 1.2  RcGTA capsid in the cellular and supernatant fractions. .............................. 21 Table 2.1  Strains used in this study.............................................................................. 25 Table 2.2  Primers used in this thesis............................................................................ 28 Table 2.3  Plasmids and subclones used in this thesis. ................................................ 31 Table 2.4  DNA fragments used for EMSA. ................................................................... 43 Table 3.1  Nucleotide positions of elements and proposed regulatory sequences in Figure 3.1. .................................................................................................... 48 Table 3.2  RcGTA bioassay on extracellular medium and intracellular lysate of Y262 and cckA- cell cultures. ................................................................................. 62 Table 3.3  Nucleotide positions of proposed elements and regulatory sequences in Figure 3.9. .................................................................................................... 70 Table 3.4  Nucleotide positions of elements and proposed regulatory sequences in Figure 3.20. ................................................................................................ 101   viii  LIST OF FIGURES Figure 1.1  Electron micrograph of RcGTA particles ...................................................... 4 Figure 1.2 Representation of the RcGTA gene cluster .................................................. 6 Figure 1.3  A 16S rDNA phylogenetic tree of selected genome-sequenced ................... 7 Figure 1.4  A phosphorelay system regulates CtrA phosphorylation state and proteolysis that results in asymmetric cell division in C. crescentus ........... 12 Figure 1.5  The LuxI/LuxR quorum sensing system in V. fischeri. ................................ 18 Figure 3.1   Sequence 5‟ of orfg2 of the RcGTA gene cluster. ...................................... 47 Figure 3.2  Expression of RcGTA gene cluster promoter deletions .............................. 52 Figure 3.3  Effect of orfg1::lacZ and orfg2::lacZ fusion plasmids on RcGTA capsid production. ................................................................................................. 56 Figure 3.4  Effects of growth condition on RcGTA expression. .................................... 58 Figure 3.5  Expression of the RcGTA gene cluster in R. capsulatus regulatory mutants  ................................................................................................................... 60 Figure 3.6  Expression of ctrA in R. capsulatus regulatory mutants ............................. 64 Figure 3.7  Expression of ctrA in WT, ctrA-, and gtaI- strains over culture growth phases  ................................................................................................................... 67 Figure 3.8  Representation of ctrA and surrounding genes. ......................................... 68 Figure 3.9  Sequence 5‟ of the ctrA start codon. .......................................................... 69 Figure 3.10 Expression of ctrA promoter deletions ....................................................... 73 Figure 3.11 Effect of growth condition on ctrA expression in WT, ctrA-, and cckA- strains  ................................................................................................................... 76 Figure 3.12 Effect of growth conditions on culture growth rates and final yields of WT, ctrA-, and cckA- strains ............................................................................... 77 Figure 3.13 Expression of ctrA promoter deletions in WT cells grown under different culture conditions ....................................................................................... 80 Figure 3.14 Effect of nutrient limitation on ctrA expression and growth in WT cultures . 83 Figure 3.15 Expression of ctrA in R. capsulatus GtaI and GtaR mutants ...................... 87 Figure 3.16 Expression of ctrA in WT and gtaR- strains over culture growth phases .... 88 ix  Figure 3.17  Expression of ctrA promoter deletions in R. capsulatus quorum sensing mutants ...................................................................................................... 92 Figure 3.18 Effect of culture growth conditions on ctrA expression in GtaI and GtaR mutants ...................................................................................................... 95 Figure 3.19 Expression of gtaR in R. capsulatus GtaI and GtaR mutants ..................... 97 Figure 3.20 Sequence 5‟ of the gtaR start codon. ....................................................... 100 Figure 3.21 Expression of gtaR promoter deletions .................................................... 102 Figure 3.22 Effect of growth condition on gtaR expression ......................................... 103 Figure 3.23 SDS PAGE of 6 x His-tagged GtaR protein purification (Ni-NTA column) 105 Figure 3.24 Binding of the GtaR protein to the gtaR promoter region ......................... 109 Figure 3.25 Binding of GtaR to gtaR promoter region in the presence of non-specific competitor DNA ........................................................................................ 110 Figure 3.26 EMSA using the GTA gene cluster promoter region and the GtaR protein  ................................................................................................................. 112 Figure 3.27 EMSA using the ctrA and the GtaR protein .............................................. 113 Figure 3.28  DNase I footprint analysis of the interaction between GtaR and the gtaR promoter region, examined on the coding and the noncoding strands ..... 116 Figure 3.29 EMSA to confirm the GtaR binding sequence in the gtaR promoter region  ................................................................................................................. 117 Figure 4.1  Comparison of RcGTA capsid expression and ctrA expression. .............. 123 Figure 4.2  A quorum sensing based model of GtaR regulation in R. capsulatus....... 130 Figure 4.3  Alignment of putative -10 and -35 promoter sequences of R. capsulatus genes ....................................................................................................... 134 Figure 4.4  GtaR binding sequence in the gtaR promoter region ............................... 137 Figure 4.5  Expression of RcGTA genes in of WT vs. ctrA- cells, and exponential vs. stationary phase cells ............................................................................... 140    x  ABBREVIATIONS AI-2   autoinducer-2 Amp (AmpR)  ampicillin (ampicillin resistance) ATP   adenine triphosphate bp   base pair(s) cfu   colony forming unit(s) CPM   counts per minute DNA   deoxyribonucleic acid EMSA   electrophoretic mobility shift assay Gent (GentR)  gentamicin (gentamicin resistance) GTA   gene transfer agent HSL(s)  homoserine lactone(s) IPTG   isopropylthio-β-galactoside Kan (Kan R)  kanamycin (kanamycin resistance) kb   kilobase pair(s) nt   nucleotide(s) ONPG  ortho-nitrophenyl-β-galactoside ORF   open reading frame PAGE   polyacrylamide gel electrophoresis PCR   polymerase chain reaction RcGTA  Rhodobacter capsulatus gene transfer agent Rif (RifR)  rifampicin (rifampicin resistance) RNA   ribonucleic acid RPM   rotations per minute SDS   sodium dodecyl sulphate Sp (SpR)   spectinomycin (spectinomycin resistance) Tc (TcR)  tetracycline (tetracycline resistance) WT    wild type  xi  ACKNOWLEDGEMENTS  I am indebted to many people who have helped me in my journey as a graduate student:  I thank Tom Beatty for his enthusiasm, encouragement, and efforts in making me a better scientist.  I am grateful to my advisory committee, Lindsay Eltis, Erin Gaynor, and George Spiegelman for their support, suggestions and supervision.  A special thanks to George Spiegelman for allowing me to perform radioactive experiments in his laboratory and helping me overcome my irrational fears of 32P.  I also thank Ryan Mercer and Andrew Lang for openly sharing unpublished results with me.  I thank past and present members of the Beatty Lab especially Arthur Fang for reminding me that microbiology is “cool”, Jeanette Beatty for having discussions with me on science and non-science related topics, Ali Tehrani for showing me that there is always a joke to be found amongst bad data, and Kristopher Shelswell for being the friendly competition I needed to finish my degree.  I am grateful for my friends who have endured my many disappearing acts during the last several years, and still accept me back with open arms.  Most importantly, I thank my family for loving me and keeping me balanced over the years:  my father for showing me that there is always more to dream about and accomplish in life and science; my mother for keeping me grounded in reality and teaching me to see the many sides of every situation; and my sister for reminding me to live and laugh today because you never know when someone will steal your boots   1  1 INTRODUCTION 1.1 The position of Rhodobacter capsulatus in the microbial world  Rhodobacter capsulatus is an α-proteobacterium, with the closest neighbours based on 16S rDNA homology being Rhodobacter sphaeroides and Paracoccus denitrificans (Lang and Beatty, 2007).  The metabolic properties of R. capsulatus are typical of purple non-sulphur photosynthetic bacteria, including growth by photosynthesis, lithotrophy, and aerobic and anaerobic respiration (Imhoff, 1995).  This metabolic diversity allows R. capsulatus to survive in many freshwater environments both in the light and dark.  Its photosynthetic capability is the topic of much interest and study, especially in light of the need for an alternative to fossil fuels.  In the laboratory, R. capsulatus can be cultured under aerobic and anaerobic conditions, in the light and dark, with a variety of electron donors and acceptors.  Although the genome sequence of R. capsulatus was completed only recently (Mercer et al., 2010, In press), a substantial amount of genome data have been available as contigs since 2001 (http://www.integratedgenomics.com).  One aspect of this genome is the presence of 41 phage-related genes in 6-7 locations (Haselkorn et al., 2001), including the gene transfer agent (GTA) (Lang and Beatty, 2001).  The R. capsulatus gene transfer agent (RcGTA) is a phage-like particle that packages linear double stranded DNA and is a useful tool for generating chromosomal gene knockouts.  2  1.2 Horizontal gene transfer and gene transfer agents  Horizontal gene transfer is one mechanism that allows bacteria to adapt to a changing environment, and plays an important role in the evolution of prokaryotic genomes.  In a recent study of 116 prokaryotic genomes, it was estimated that approximately 14% of the total DNA was a result of horizontal gene transfer, where the proportion of horizontally transferred genes per genome ranged from 0.05% to 25.2% (van Passel et al., 2005).  Currently known mechanisms of horizontal gene transfer in bacteria include conjugation, transformation and transduction.  Transduction has been found to be important in the spread of virulence (Cheetham and Katz, 1995) and antibiotic resistance (Davies, 1994).  One variation on transduction is found in the gene transfer agent (GTA), which has been defined as “a virus-like particle that only carries random pieces of the genome of the producing cell in a process similar to generalized transduction” (Lang and Beatty, 2007).  It is estimated that there are up to one billion viral particles per ml of marine water (Suttle, 2005), and it is possible that a significant portion of these viral particles are GTAs.  The first GTA was found in R. capsulatus (Marrs, 1974), and to avoid confusion, hereafter gene transfer agents in general will be called „GTAs‟, and the R. capsulatus gene transfer agent will be called „RcGTA‟.  Other GTAs have been identified, including Dd1 in Desulfovibrio desulfuricans (Rapp and Wall, 1987), VSH-1 in Brachyspira hyodysenteriae (Humphrey et al., 1997), VTA in Methanococcus voltae (Eiserling et al., 1999), and an RcGTA-like GTA in Ruegeria (formerly Silicibacter) pomeroyi (Biers et al., 2008). A summary of the properties of these GTAs is found in Table 1.1.   3  Table 1.1  Summary of GTA properties. Species  Gene transfer agent Head diameter, tail length (nm) DNA packaged (kb) Size of coding region (kb) References Rhodobacter capsulatus RcGTA 30, 50 4.5 14.1  (Yen et al., 1979) Brachyspira hyodysenteriae VSH-1 45, 64 7.5 16.3  (Humphrey et al., 1997) Desulfovibrio desulfuricans Dd1  43, 7 13.6 n/a  (Rapp and Wall, 1987) Methanococcus voltae VTA  40, 61 4.4 n/a  (Eiserling et al., 1999) Ruegeria pomeroyi GTA ~50-70, 0 n/a 14.7 (Biers et al., 2008) n/a = not known 1.3 Properties of RcGTA  Electron microscopy of the RcGTA particle reveals that it looks very similar to a tailed phage (Figure 1.1) (Yen et al., 1979). RcGTA transfers DNA in a mechanism similar to transduction, since unlike conjugation RcGTA-mediated genetic exchange does not require direct contact between the donor cell and the recipient cell, and unlike transformation the extracellular DNA that is transferred is protected from DNase degradation (Marrs, 1974).  However, RcGTA differs from typically lytic tailed bacteriophages because it causes no observable lysis in R. capsulatus.  Also, RcGTA particles contain ~4 kb of double stranded DNA (Yen et al., 1979), which is insufficient to transfer the ~14 kb RcGTA gene cluster (Lang and Beatty, 2000).  Rather than specifically transferring its own genes, RcGTA randomly packages genomic DNA (Yen et al., 1979).  4  Figure 1.1 Electron micrograph of RcGTA particles.  Electron microscopy reveals that the RcGTA particle resembles a phage particle with a head of ~ 30 nm diameter and a tail of ~ 50 nm length.  Reprinted from the Journal of Molecular Biology, Vol 131, Yen, Hu and Marrs, Characterization of the gene transfer agent made by an overproducer mutant of Rhodopseudomonas capsulata, Pages 157-168, Copyright 1979, with permission from Elsevier (Yen et al., 1979). 1.4 RcGTA gene clusters  Figure 1.2 gives a representation of the RcGTA gene cluster and surrounding genes.  The RcGTA gene cluster consists of 17 open reading frames (ORFs) (named orfg1 to orfg15) and about half of these ORFs have sequence similarity to phage genes such as a terminase, a prohead protease, a capsid protein and a major tail protein (Lang and Beatty, 2007).   Recently, many of the proteins predicted to be present in RcGTA particles were identified in R. capsulatus using a proteomics approach (Chen et al., 2009).  Although only R. capsulatus (Solioz et al., 1975), B. hyodysenteriae (Humphrey et al., 1997), D. desulfuricans (Rapp and Wall, 1987), M. voltae (Eiserling et al., 1999)  5  and R. pomeroyi (Biers et al., 2008) have been found to produce functional GTA-like particles, RcGTA-like gene homologues are widespread in α-proteobacteria (Biers et al., 2008; Lang and Beatty, 2002; Lang and Beatty, 2007; Paul, 2008).  The occurrence of RcGTA gene homologues and their organization relative to the RcGTA gene cluster can be separated into four major categories: 1) a complete RcGTA-like gene cluster containing genes 1-15 is present in a single location; 2) a partial and/or rearranged RcGTA-like gene cluster is present in a single location; 3) several RcGTA gene homologues are scattered in various locations in the genome; and 4) no detectable RcGTA gene homologues (Biers et al., 2008; Lang and Beatty, 2002; Lang and Beatty, 2007).  When these categories are superimposed upon a 16S rDNA phylogenetic tree of selected representatives from the major orders of α-proteobacteria for which complete genome sequences have been determined, a correlation between the pattern of RcGTA-like gene distribution and the phylogenetic tree can be seen (Figure 1.3). This suggests that RcGTA-like gene clusters descended along with the 16S rRNA genes from a common ancestor, with a high degree of conservation in the Rhodobacterales order and partial or complete loss in most other groups (Lang and Beatty, 2007).   6    Figure 1.2 Representation of the RcGTA gene cluster. Each ORF in the RcGTA gene cluster has been numbered and shaded in gray.  Genes surrounding the RcGTA gene cluster are in black.  In light gray are ORFs encoding gene products that have been identified by mass spectrometry of purified RcGTA particles (Chen et al., 2009).  The following ORFs code for protein products that have sequence similarity to phage components: 2, terminase; 3, portal protein; 4, prohead protease; 5, capsid protein; 7, head-tail adaptor; 9, major tail protein; 11, tail tape measure; and 15, host specificity protein.   7   Figure 1.3 A 16S rDNA phylogenetic tree of selected genome-sequenced α-proteobacteria, with categories of RcGTA-like gene cluster indicated by the numbers on the right: 1) a complete RcGTA-like gene cluster containing genes 1-15 is present in a single location; 2) a partial and/or rearranged RcGTA-like gene cluster is present in a single location; 3) several RcGTA gene homologues are scattered in various locations in the genome; and 4) no detectable RcGTA gene homologues.  Bootstrap values for the neighbour-joining tree are shown for the major lineages next to branches (percentages based on 10000 replicates).  The scale bar indicates the number of base substitutions per site.  8  1.5 RcGTA expression  Studies of RcGTA have revealed that RcGTA expression is affected by nutrient availability (Taylor, 2004) and growth phase (Florizone, 2006; Lang and Beatty, 2000). Northern blot experiments have shown that RcGTA gene cluster transcription is low in exponential phase and increases in the early stationary phase (Lang and Beatty, 2000), and western blot experiments have shown that RcGTA capsid protein is made in the cell at early stationary phase and is found in the cell culture medium shortly thereafter (Florizone, 2006).   Nutrient limitation experiments using western blot analysis of capsid protein expression revealed that RcGTA expression was inhibited by limiting nitrogen and induced by limiting phosphate or carbon source.  RcGTA release was also shown to be induced by limiting phosphate (Taylor, 2004).  These experiments have shown that RcGTA expression is affected by growth phase and nutrient availability, but the regulatory proteins involved have not been identified yet. 1.6 Regulation of the RcGTA gene cluster transcription 1.6.1 CtrA 1.6.1.1 Two-component signal transduction systems  Bacteria use two-component signal transduction systems to detect environmental conditions and respond with appropriate changes to gene expression.  Typically, two- component systems consist of a sensor kinase, which detects specific signals, and a cognate response regulator, which binds to DNA to modify gene transcription (Laub and Goulian, 2007; Parkinson, 1995).  Sensor kinases are usually integral membrane  9  proteins that, upon binding or detecting a specific signal, autophosphorylate at a conserved histidine residue (Laub and Goulian, 2007; Stock et al., 1995).  This activates the sensor kinase to phosphorylate its cognate response regulator, typically on a conserved aspartic acid residue.  Upon phosphorylation, the response regulator‟s affinity for DNA binding is changed resulting in altered expression of its target genes (Laub and Goulian, 2007; Stock et al., 1995).  One variation of the two-component system is the phosphorelay system, which includes intermediary proteins in addition to the sensor kinase and response regulator.  In phosphorelay systems, the sensor kinase transfers the phosphoryl group to the aspartic acid residue of a response regulator that lacks an output domain.  The phosphoryl group is then transferred to the histidine residue of a phosphotransfer protein, which phosphorylates the response regulator (Laub and Goulian, 2007; Mitrophanov and Groisman, 2008).  Several examples of signal transduction systems are OmpR-EnvZ (Forst and Roberts, 1994; Pratt and Silhavy, 1995), NtrBC (Magasanik, 1996), PhoBR (Wanner, 1995) and UhpABC (Kadner, 1995) in E. coli, and ComAP in Bacillus subtilis (Grossman, 1995), which detect osmolarity, ammonia, phosphate, phosphorylated sugars and cell population density, respectively.  Another example is the CtrA/CckA signal transduction system in C. crescentus that regulates the cell cycle (Laub et al., 2000).  CtrA is the response regulator of this system and its activity is tightly regulated by a complicated system that includes the sensor kinase CckA (this is discussed in further detail below).  10  1.6.1.2 CtrA in C. crescentus  CtrA is a response regulator first discovered in C. crescentus, with homologues found in many bacteria including Sinorhizobium meliloti (Barnett et al., 2001), Rhodopseudomonas palustris, Brucella abortus (Bellefontaine et al., 2002) and R. capsulatus (Lang and Beatty, 2000).  In C. crescentus, CtrA acts as a master regulator of the cell cycle, and the levels of this protein changes as a cell progresses through the cell cycle (Laub et al., 2002; Laub et al., 2000).  CtrA is involved in regulating processes such as polar morphogenesis, DNA replication initiation, DNA methylation, and cell division.  Microarray analysis of C. crescentus has shown that CtrA regulates the expression of 144 genes, of which at least 95 are regulated directly (Laub et al., 2002; Laub et al., 2000).  Fourteen of these genes are regulatory genes (including CtrA itself), 10 of which encode two-component system proteins.  Analysis of the regulatory region of these 144 genes has revealed two alternative consensus sequences for CtrA binding: one gapped (TTAA-N7-TTAAC) and one ungapped (TTAACCAT) (Laub et al., 2002; Laub et al., 2000).  Footprinting experiments on several of these upstream sequences have shown that CtrA does in fact bind both these sequences (Reisenauer et al., 1999). However, the regulation by CtrA is not completely understood, because CtrA can directly regulate genes that do not have the consensus sequences, and in other cases CtrA does not regulate genes that have the consensus sequences (Laub et al., 2002).  It is known that the phosphorylated form of CtrA (CtrA~P) binds DNA, and this phosphorylation is tightly regulated by a phosphorelay system involving ChpT, CckA and DivK. CtrA~P activity is controlled by proteolysis, which is thought to be triggered by dephosphorylation of CpdR; unphosphorylated CpdR stimulates CtrA proteolysis  11  (Bowers et al., 2008; Iniesta et al., 2006; Iniesta and Shapiro, 2008).  The phosphorylation state of DivK is regulated by DivJ (located at the stalk pole) and PleC (located at the swarmer pole) (Jacobs et al., 2001).  DivK is phosphorylated by DivJ and dephosphorylated by PleC, resulting in the accumulation of CtrA in the swarmer cell and the lack of CtrA in the stalk cells (Figure 1.4).  CtrA in C. crescentus regulates its own transcription, and the ctrA gene has two promoters (P1 and P2), each containing one CtrA binding site.  A footprinting experiment showed that CtrA binding sites are located in the -10 region of P1 (which contains an ungapped consensus sequence) and the -35 region of P2 (which contains a gapped consensus sequence) (Domian et al., 1999).  The positioning of these binding sites in conjunction with mutational studies indicates that CtrA acts as a negative regulator of P1 and positive regulator of P2.  P1 is active earlier than P2 in the cell cycle.  When CtrA~P is at a low concentration in the cell, it will not bind P1, leaving it active, nor will it bind P2, leaving it inactive.  But as CtrA~P accumulates in the cell with transcription driven by P1 (the weaker promoter), CtrA~P binds to and inactivates P1, and activates P2 (the stronger promoter), thus causing an increase in CtrA production (Domian et al., 1999).  S. meliloti and B. abortus CtrAs are 82% and 81% identical to C. crescentus CtrA, respectively.  Primer extension assays of the S. meliloti and B. abortus ctrA transcripts have identified two and three transcriptional start sites, respectively (Barnett et al., 2001; Bellefontaine et al., 2002).  DNase I footprinting analysis using CtrA~P identified five and two CtrA binding sites the S. meliloti and B. abortus ctrA promoter regions, respectively (Barnett et al., 2001; Bellefontaine et al., 2002).  Although  12  expression and mutational experiments have not been done in S. meliloti and B. abortus, the above data are consistent with a model of ctrA autoregulation similar to that found in C. crescentus.   Figure 1.4 A phosphorelay system regulates CtrA phosphorylation state and proteolysis that results in asymmetric cell division in C. crescentus. (a) Curved arrows represent phosphorylation and dephosphorylation events.  Straight arrows represent the regulation of phosphoryl transfer events.  Dotted bars represent inhibition.  DivK~P inhibits phosphorylation of CckA by an unknown mechanism and unphosphorylated CpdR inhibits CtrA~P activity by stimulating CtrA proteolysis. (b) Prior to cell division (left) PleC is located at the swarmer pole and DivJ is located at the stalk pole but DivK, DivK~P and CtrA are freely diffusible.  After cytoplasmic compartmentalization (right), DivK~P accumulates in the stalk cell resulting in the proteolysis of CtrA, and DivK accumulates in the swarmer cell resulting in the accumulation of CtrA.  Figure modified from Bower et al. (Bowers et al., 2008). 1.6.1.3  CtrA in R. capsulatus  CtrA is essential for the viability of C. crescentus (Quon et al., 1996) and S. meliloti (Barnett et al., 2001) but non-essential for R. capsulatus (Lang and Beatty,  13  2000).  This indicates a difference in the regulatory role of R. capsulatus CtrA and allows for much more freedom (e.g., disruption of the ctrA gene) in studying CtrA in R. capsulatus.  Like the C. crescentus CtrA, the R. capsulatus CtrA regulates flagellar genes (Lang and Beatty, 2000; Lang and Beatty, 2002).  A recent study used microarray data to identify 227 genes as a part of the R. capsulatus CtrA regulon by comparing gene expression of ctrA- to WT cells at exponential and stationary phase (Mercer et al., 2010, In press).  The majority of these genes (216) were up-regulated by CtrA (i.e. decreased expression in the ctrA- strain compared to WT) with increases of transcription ranging from 2-fold to more than 20-fold.  Amongst these genes are the RcGTA genes and flagellar genes.  In addition, a suite of potential signal transduction genes was identified as part of the CtrA regulon.  Alignment of the C. crescentus and R. capsulatus CtrA protein sequence shows that C. crescentus and R. capsulatus CtrA are 71% identical in amino acid sequence, with the helix-turn-helix motif being 100% identical (Lang and Beatty, 2000).  C. crescentus and R. capsulatus ctrA are also reciprocal best hits (using BLAST), indicating that they are orthologues (Moreno-Hagelsieb and Latimer, 2008).  The R. capsulatus CtrA contains a conserved Asp51, which is likely to be phosphorylated. Despite the similarity in CtrA sequence in C. crescentus and R. capsulatus it has been found that R. capsulatus CtrA regulates RcGTA expression (Lang and Beatty, 2000), but the C. crescentus CtrA did not replace the function of R. capsulatus CtrA in regulating RcGTA production (Lang and Beatty, 2001).  It is possible that there are two different types of CtrA systems: 1) in bacteria such as C. crescentus with asymmetrical  14  cell division CtrA is essential; and 2) in bacteria such as R. capsulatus with symmetrical cell division CtrA is non-essential. 1.6.1.4  The RcGTA structural gene operon and regulation by CtrA  It is thought that the RcGTA gene cluster is transcribed as an operon and it has been suggested that the primary transcript is processed into RNA of various sizes (Lang and Beatty, 2000), analogous to that seen in the Streptomyces temperate phage ϕC31 (Howe and Smith, 1996; Suarez et al., 1992).  The orfg2 knockout (see Figure 1.2 for a representation of the RcGTA gene cluster), made by omega cartridge insertion, has no detectable RcGTA capsid protein and is unable to produce RcGTA particle capable of transduction (A.S. Lang, personal communication).  This mutant can be complemented by a cosmid containing orfg1 to orfg15 (of the RcGTA gene cluster), but not by one containing orfg1 to orfg12, indicating that the RcGTA gene cluster is transcribed as a single operon from at least orfg2 to orfg13 (A.S. Lang, personal communication). Experiments are currently being done to determine if orfg1 is also part of this operon (A.S. Lang).   Northern blots using orfg2 and orfg4 probes showed heterogeneity in the size of complementary RNA molecules.  RcGTA transduction efficiencies decrease to less than 0.1% when an R. capsulatus ctrA mutant is used as the RcGTA donor compared to WT (A.S. Lang, personal communication).  Also, both northern blots and expression from an orfg2::lacZ plasmid-borne gene fusion indicated that transcription of the RcGTA gene cluster is ctrA-dependent (Lang and Beatty, 2000).  15  1.6.2 CckA in R. capsulatus  The histidine kinase CckA has a major role in regulating phosphorylation and proteolysis of CtrA in C. crescentus (Figure 1.4).  Alignment of the C. crescentus and R. capsulatus CckA protein sequences showed that they are 44% identical in amino acid sequence (Lang and Beatty, 2000).  C. crescentus and R. capsulatus cckA are also reciprocal best hits (using BLAST), indicating that they are orthologues (Moreno- Hagelsieb and Latimer, 2008). RcGTA transduction efficiencies decrease to about 1% when an R. capsulatus cckA mutant is used as the RcGTA donor compared to WT (A.S. Lang, personal communication).  It is possible that the R. capsulatus CckA has a role in regulating CtrA phosphorylation similar to that found in C. crescentus. 1.6.3 Quorum sensing and regulation of RcGTA 1.6.3.1 Introduction to quorum sensing systems  Quorum sensing is a mechanism used by bacterial cells to detect surrounding population densities (Miller and Bassler, 2001).  A basic quorum sensing system consists of a signal and a signal receptor.  Low population densities of bacterial cells result in low amounts of quorum sensing signal, but as cell population density increases the concentration of the signaling molecule also increases.  When the signal accumulates to a threshold concentration, a critical fraction the quorum sensing receptors becomes bound to the signal, resulting in a change in transcription of a variety of genes, depending on the species (Miller and Bassler, 2001).  For example, quorum sensing regulates bioluminescence in Vibrio fischeri (Engebrecht et al., 1983), antibiotic biosynthesis in Streptomyces spp. (Waters and Bassler, 2005), conjugation in  16  Agrobacterium tumefaciens (Piper et al., 1993), competence and sporulation in B. subtilis (Grossman, 1995), the production of virulence factors in Staphylococcus aureus (Waters and Bassler, 2005), and biofilm formation in Pseudomonas aeruginosa (Davies et al., 1998).  There are a variety of quorum sensing systems and many different types of quorum signaling molecules, including oligopeptides, Pseudomonas quinolone signals (PQS), autoinducer-2 (AI-2), and acyl-homoserine lactones (acyl-HSL) (Camilli and Bassler, 2006).  In Gram-positive bacteria, the oligopeptide signal is detected by a membrane-bound receptor of a two component system (Waters and Bassler, 2005). Binding of the signal activates a phosphorylation cascade which leads to a change in transcription of target genes.  The highly hydrophobic quinolone signals were recently discovered in P. aeruginosa and found to be transported between cells in endogenously produced membrane vesicles.  AI-2 is made by LuxS (the AI-2 synthase) in a wide variety of bacteria and has been suggested to be a means of interspecies communication (Camilli and Bassler, 2006; Waters and Bassler, 2005).  The focus of this section will be on the Gram-negative type of quorum sensing system involving an acyl-HSL signal (Waters and Bassler, 2005).  In this system LuxI (or a homologue), the homoserine lactone synthase, produces an acyl-HSL, and LuxR (or a homologue) is the cognate response regulator that detects this signal (Figure 1.5). As in the well-studied V. fischeri system, upon binding acyl-HSL the LuxR protein binds DNA to modify transcription of target genes.  The LuxI/LuxR quorum sensing system is auto-regulatory because production of acyl-HSL results in the inhibition of luxR transcription and activation of luxI transcription.  The major function of the LuxI/LuxR  17  quorum sensing system appears to be activation of transcription of the genes involved in bioluminescence (luxCDABE), which are in the same operon as luxI (Figure 1.5).  It is not unusual to find more than one LuxI/LuxR-type of quorum sensing system in a single species.  For example, P. aeruginosa has both the LasI/LasR and RhlI/RhlR quorum sensing systems (Waters and Bassler, 2005), and Erwinia carotovora has the CarI/CarR and ExpI/ExpR quorum sensing systems, all of which are homologous to the LuxI/LuxR system (von Bodman et al., 2003; Welch et al., 2000).  Interestingly, the CarI and ExpI proteins produce the same HSL autoinducer (N-(3-oxohexanoyl)-HSL), which may provide a mechanism for coordinating the two systems.  One variation on the LuxI/LuxR-type of quorum sensing system is found in the Erwinia chrysanthemi CarI/CarR system.  Gel mobility shift experiments showed that in vitro, CarR bound target DNA in the absence of N-(3-oxohexanoyl)-HSL, and released DNA in the presence of the HSL signal (Welch et al., 2000).   18   Figure 1.5 The LuxI/LuxR quorum sensing system in V. fischeri.  In V. fischeri, the quorum sensing system consists of LuxI (square), which is responsible for synthesizing the HSL autoinducer (pentagon), and LuxR (circle), which is responsible for regulating target genes upon binding the HSL autoinducer.  As the cell population density increases, the HSL autoinducer accumulates and when a threshold concentration of HSL autoinducer is reached, the equilibrium shifts from LuxR protein to HSL-LuxR.  The HSL-LuxR complex then binds the luxICDABE promoter to activate transcription, and binds the luxR promoter to inhibit transcription. This results in an exponential increase in both autoinducer synthesis and light production.  Figure modified from Miller and Bassler (Miller and Bassler, 2001; Waters and Bassler, 2005). 1.6.3.2 The GtaI and GtaR in R. capsulatus  Although a preliminary genome sequence of R. capsulatus appeared to contain a luxI homologue (now called gtaI), acyl-HSL in R. capsulatus could not be detected by bioassay (Schaefer et al., 2002).  However, Schaefer et al. (2002) developed an assay that identified two long-chain acyl-HSLs (C16-HSL and C14-HSL) involved in quorum sensing in R. capsulatus.  Further study of the R. capsulatus genome revealed three ORFs encoding signal receptors with significant sequence similarity to known LuxR homologues (Schaefer et al., 2002).  These three ORFs, rcc00328, rcc01088 and rcc01823 (previously called RCC03806, RCC04617 and RCC02401) are predicted to encode proteins with 37%, 31% and 36% similarity (respectively) to CerR, the R. sphaeroides LuxR-type protein (Schaefer et al., 2002).  The predicted protein product of  19  rcc00328, which has the highest percentage similarity to CerR, is encoded by the ORF immediately upstream of the gtaI gene (the gtaI start codon and the rcc00328 stop codon are separated by 49 bp).  With such close proximity, it was possible that the protein encoded by rcc00328 was the cognate signal receptor (which was named GtaR) of the HSL produced by GtaI, and that gtaR and gtaI are co-transcribed as an operon. 1.6.3.3 Regulation of RcGTA by GtaI and GtaR in R. capsulatus  The finding that GtaI/GtaR in R. capsulatus are homologues of LuxI/LuxR, in combination with the knowledge that RcGTA expression is maximal in the stationary phase (Solioz et al., 1975), led to the discovery of GtaI-based regulation of RcGTA production in R. capsulatus.  Using a plasmid carrying the RcGTA orfg2 promoter fused to lacZ, Schaefer et al. (2002) found a seven-fold reduction in β-galactosidase specific activity in a gtaI mutant compared to a WT strain.  Furthermore, the addition of C16- HSL to cultures of this gtaI mutant strain restored expression of the fusion gene to WT levels, and similar results were obtained using RcGTA transduction assays (Schaefer et al., 2002).  These results were consistent with the idea that GtaI and GtaR function in a quorum sensing system in R. capsulatus that is needed to induce transcription of the RcGTA gene cluster.  Further study is required to determine the mechanism of this regulation. 1.6.4 Effects of growth phase and nutrient limitation on GTA expression  It was discovered in the 1970s that the frequency of RcGTA-mediated gene transduction is maximal in the stationary phase of R. capsulatus cultures (Solioz et al., 1975).  Northern blot and RcGTA promoter::lacZ gene fusion experiments showed that  20  this stationary phase regulation is associated with maximal levels of RcGTA structural gene transcripts so that the regulation appeared to be at the level of transcription (Lang and Beatty, 2000).  Also, western blots revealed that RcGTA capsid protein appeared to accumulate abruptly in WT cells in the early stationary phase, whereas extracellular RcGTA accumulated at later time points (Florizone, 2006).  It is not known what aspect of stationary phase leads to induction of RcGTA gene transcription.  However, stationary phase induction of phage lytic cycles is common, as seen in the bacteriophages P22 in Salmonella typhimurium (Ramirez et al., 1999; Ramirez and Villaverde, 1997) and mu in E. coli (Ranquet et al., 2005).  Variants of the RCV minimal medium, a defined medium containing phosphate as the P source, malic acid as the C source, and ammonium as the N source (Beatty and Gest, 1981), have been used to titrate growth-limiting amounts of nutrients.  In this approach, reducing the concentration of one nutrient such that cultures enter the stationary phase at a lower culture density compared to RCV medium, cell concentration effects (as in quorum-sensing) can be separated from nutrient-depletion effects.  R. capsulatus cultures were grown in P-, C- and N-deficient variants of the RCV medium, and western blots using an RcGTA capsid protein antibody were used to measure levels of RcGTA capsid.  Preliminary results showed that an N-deficient culture lacked detectable RcGTA capsid protein compared to the replete RCV culture; in a P-limited culture, intracellular amounts of the capsid protein were elevated, and RcGTA was released in high quantity from cells; in a C-limited culture, elevated levels of the capsid were present in cells, but there was no increase in RcGTA released (Table 1.2) (also see Figure 4.1 for western blots) (Taylor, 2004).  21  Table 1.2  RcGTA capsid in the cellular and supernatant fractions.   RCV-derived media  Low N Low P Low C RCV medium YPS medium Cell - ++ +++ + ++ Supt. - ++ - - ++ Note:  The symbols used are as follows:  no detectable capsid, -; low amounts of capsid, +; high amounts of capsid, ++; and very high amounts of capsid, +++.   The results of these preliminary nutrient limitation experiments resemble results from experiments done with ctrA and cckA mutants: N limitation, like ctrA mutant, results in greatly reduced RcGTA capsid expression whereas P limitation results in increased expression; although C limitation resulted in accumulation of the capsid protein in cells, there was little or no extracellular RcGTA, similar to the cckA mutant (see Figure 4.1).  It is possible that in R. capsulatus N or P limitation differentially affects the phosphorylation of CtrA, and that C limitation affects CckA activity.  In E. coli there is cross-talk between the NtrBC (nitrogen availability) two-component system and the UhpABC (phosphorylated sugars), PhoBR (phosphate availability), and ArcAB (oxygen availability) two-component systems (Stock et al., 1989; Verhamme et al., 2002). Perhaps there is similar cross-talk between the CtrA and other signal transduction systems (involving phosphate, nitrogen and carbon detection) resulting in an integrated regulation of RcGTA expression.  Alternatively, there might be cross regulation between CtrA and these nutrient-limitation signal transduction systems.  There is some evidence supporting the idea that, in B. subtilis, the ResDE two-component system (involved in regulation during respiratory growth) decreases adenylase phosphatase levels by inhibiting phoPR expression under phosphate starvation induction (PSI) conditions (Sun et al., 1996a; Sun et al., 1996b).  It is also possible that CtrA and nutrient limitation  22  operate independently to regulate RcGTA.  In Streptomyces, AfsR (regulates antibiotic synthesis) and PhoP (a PhoB homologue) both bind to the afsS promoter region and regulate afsS expression (Santos-Beneit et al., 2009). 1.7 Goals of my research It is known that RcGTA expression is dependent on the CtrA, CckA and GtaI regulatory proteins.  However, the nature of interaction between these systems and the mechanisms regulating RcGTA gene expression are unknown.  Also unknown are the regulatory systems that result in a change in RcGTA expression in response to growth conditions.  The focus of my thesis was to investigate the integration of signals associated with growth conditions and the cellular proteins CtrA, GtaI and GtaR resulting in the coordinated regulation and appropriate expression of the RcGTA, ctrA and gtaR genes.  I approached the investigation by determining and comparing the expression of the RcGTA gene cluster, ctrA, and gtaR in a variety of regulatory mutants, as well as different growth conditions, nutrient limitations, and growth phases.  Furthermore, the RcGTA orfg1, ctrA, and gtaR promoter regions were studied to locate the promoter and important regulatory sequences involved in regulation by the aforementioned conditions and regulatory systems.  It was found that the GtaI protein regulates not only the expression of the RcGTA gene cluster, but also ctrA and gtaR.  Subsequent experiments were done to determine the interaction between GtaR and each of these genes.  The work in thesis has revealed a complex network of interaction between environmental signals, regulatory  23  systems and the expression of RcGTA.  Further experiments need to be done to elucidate the exact details of this network‟s interactions and will provide an interesting perspective on the coordinated integration of control over bacterial gene expression in response to multiple environmental and cellular conditions.   24  2 MATERIALS AND METHODS 2.1 Bacterial strains, growth conditions and plasmids  Table 2.1 lists and describes the strains of Escherichia coli and R. capsulatus used.  The E. coli strain used for cloning and subcloning was DH10B (Invitrogen), whereas the strains S17-1 (Simon et al., 1983) and HB101(pRK2013) (Ditta et al., 1985) were used to conjugate plasmids into R. capsulatus.  E. coli strains were grown at 37C in Luria-Bertani medium (Sambrook et al., 1989) supplemented with the appropriate antibiotics at the following concentrations (µg/ml): ampicillin, 150; tetracycline-HCl, 10; kanamycin sulphate 50; and gentamicin sulphate, 10  The R. capsulatus B10 strain (Marrs, 1974) was used as the starting strain for subsequent strain constructions (see Section 2.6).  R. capsulatus strains were grown under either aerobic or photosynthetic anaerobic conditions in either YPS medium (Wall et al., 1975), RCV medium (Beatty and Gest, 1981), or a RCV-derived medium supplemented with the appropriate antibiotics at the following concentrations (g/ml): tetracycline-HCl, 1.0; kanamycin sulphate, 10; and gentamicin sulphate, 3.  The RCV-derived media used in this study were 1/5 P (1.92 mM PO4 Buffer), 1/640 P (15 µM PO4 Buffer), trace P (no added PO4 Buffer), 1/3 C (0.13% D, L-malic acid), 2 x C (0.8% D, L-malic acid, 19.2 mM PO4 Buffer), and 1/2 N (0.05% (NH4)2SO4). PO4 buffer was made at pH 6.8 using KH2PO4 and K2HPO4.  25   The turbidity of cultures was used as a measure of cell culture density and monitored by measuring light scattering with a Klett-Summerson photometer (filter #66; red); 100 Klett units represents approximately 4 x 10 8  colony forming units per ml. Table 2.1  Strains used in this study. Strain Description Reference E. coli DH10B Used for cloning Invitrogen HB101 (pRK2013) Used as a helper strain for conjugation of plasmids into R. capsulatus; KanR (Ditta et al., 1985) S17-1pir Used for conjugation of plasmids into R. capsulatus (Simon et al., 1983) BL21(DE3) Used for T7 promoter-based expression systems (carries lambda DE3 lysogen) Invitrogen R. capsulatus B10 WT R. capsulatus strain (Marrs, 1974) SB1003 WT R. capsulatus strain; Rif R (Yen and Marrs, 1976) Y262 RcGTA overproducer made in the SB1003 background (unknown mutations) (Yen and Marrs, 1976) BCKF ctrA knockout mutant (by KIXX disruption) made in the B10 background; KanR (Lang and Beatty, 2000) BKKR cckA knockout mutant (by KIXX disruption) made in the B10 background; KanR (Lang and Beatty, 2000) YCKF ctrA knockout mutant (by KIXX disruption) made in the Y262 background; KanR (Lang and Beatty, 2000) YKKR cckA knockout mutant (by KIXX disruption) made in the Y262 background; KanR (Lang and Beatty, 2000) ALS-1 gtaI knockout mutant (by Sp disruption) made in the SB1003 background; RifR SpR (Schaefer et al., 2002) BLKI markerless gtaI knockout mutant made in the B10 background this thesis BLKR markerless gtaR knockout mutant made in the B10 background this thesis BLKO markerless gtaI/gtaR double knockout mutant made in the B10 background this thesis DW5 PuhA -, no photosynthesis (Wong et al., 1996) * Resistance markers: KmR, kanamycin; RifR, rifampicin; SpR, spectinomycin.  26  2.2 Recombinant DNA techniques  Standard methods of DNA purification, restriction enzyme digestion, and other modification techniques were used (Sambrook et al., 1989). 2.3 DNA Sequencing  Sequencing for cloning confirmation and 5‟ RACE was done by the Nucleic Acid Protein Service Unit (NAPS Unit, UBC).  Sequencing for the footprinting experiments was done using the SequiTherm EXCELTM II DNA Sequencing Kit (Epicenter biotechnologies) according to the manufacturer‟s protocol.  The template used was the DNA fragment P2C, which was generated by PCR, and the primers used were LHR2.2 and PRcheck primers, which were 5‟ end labeled using 32P ATP (Perkin Elmer) and T4 Polynucleotide Kinase (Invitrogen). 2.4 Construction of promoter::lacZ fusions  Descriptions of all primers used in the construction of ctrA::lacZ, orfg1::lacZ and gtaR::lacZ fusion plasmids are found in Table 2.2.  The subclones and resultant clones are found in Table 2.3.  The ctrA::lacZ fusion plasmid p601-17 was constructed by performing PCR using B10 chromosomal DNA as the template, and the primers CEPS17 and CEPS2 to introduce an upstream PstI and downstream BamHI site to the amplicon, respectively. This amplicon was ligated into the plasmid pXCA601 as a PstI to BamHI fragment to create the ctrA::lacZ fusion plasmid p601-17.  Other ctrA::lacZ fusion plasmids were  27  constructed in a similar manner as p601-17, except that p601-15, p601-13, p601-11, p601-11.7, p601-9, p601-7, and p601-5 used the upstream primer CEPS15, CEPS13, CEPS11, CEPS11.7, CEPS9, CEPS7, and CEPS5, respectively, instead of CEPS17.  The plasmid p601-17x was created using B10 chromosomal DNA as the template for PCR.  The downstream amplicon was made by PCR using the primers CEPS5x and CEPS2, which introduced an XbaI and BamHI site, respectively.  This was ligated into pUC19 as an XbaI to BamHI fragment, resulting in the plasmid pUC5x-17. The upstream amplicon was made by PCR using the primers CEPS17 and CEPS11.7x, which introduced a PstI and an XbaI site, respectively.  This was ligated into pUC5x-17 as a PstI to XbaI fragment, resulting in the plasmid pUC17x.  The PstI to BamHI fragment was excised from pUC17x and ligated into pXCA601 resulting in the plasmid p601-17x.  The plasmid p601-11x was constructed in a similar manner as plasmid p601-17x except the primer CEPS11 was used instead of the primer CEPS17.  The construction of plasmids p601-SIR and p601-IRD is discussed in the following section (Section 2.5).  The gtaR::lacZ fusion plasmid p601-P2R was constructed by performing PCR using B10 chromosomal DNA as the template, and using the upstream primer KOR1Fc and the downstream primer LHR2.2, which introduced a PstI and BamHI site, respectively.  This amplicon was ligated into pXCA601 as a PstI to BamHI fragment to create the gtaR::lacZ fusion plasmid p601-P2R.  The gtaR::lacZ fusion plasmids p601- P25 and p601-P23 were constructed in a similar manner as p601-P2R except the primers LHR5 and LHR3 were used instead of KOR1F, respectively.  The plasmid  28  p601-P1R was constructed in a similar manner as the plasmid p601-P2R except the primer LHR2.1 was used instead of LHR2.2.  The orfg1::lacZ fusion plasmids were constructed in a similar manner as the ctrA::lacZ fusion plasmids, however the primers used for PCR were different.  For the construction of plasmids pG65, pG64 and pG61, the downstream primer used was pGTA2.6, and upstream primers used were pGTA5, pGTA4 and pGTA1, respectively. The upstream primer pGTA5 and the downstream primer pGTA2.1 were used in the construction of pG15.  All lacZ fusion plasmids were sequenced to confirm that each clone had the correct sequence.  Sequencing was performed by NAPS using plasmid templates that had been purified using the QIAprep Miniprep Kit (Qiagen). Table 2.2  Primers used in this thesis. Primers Sequence (5‟ to 3‟) Used for / in the construction of Construction of orfg1::lacZ fusions GTA1 ACGCTTCAAGCTGCAGATAAGGCATG the plasmids p601-G61 and p601-G65 GTA4 CGCCTGCAGCAACCCTGAATATAGC the plasmid p601-G64 GTA5 GATGCGGCTGCAGACCGATCC the plasmids p601-G15 and p601-G65, and the DNA fragment G65 (for ESMAs) GTA2.6 GAACCGGATCCATCGCCAGGG the plasmids p601-G65, p601-G64 and p601-G61, and the DNA fragment G65 (for ESMAs) GTA2.1 CTCCAGCGGATCCACCGGAGG  the plasmid p601-G15  29  Table 2.2 con‟t Primers Sequence (5‟ to 3‟) Used for / in the construction of gtaR::lacZ fusions LHR2  ACACTTGTTGGGATCCGTGTGTATG the plasmid p601-P1R LHR2.2 GTGATCTGTCGGATCCTCGGGATAGG the plasmids p601-P2R, p601-P25, and p601-P23, and the DNA fragments P25, P23, P2C, DR9, DR7, DR5, DR3 and DR1 for EMSAs LHR3  TTTCGAAGCTGCAGACGAATAAGC the plasmid p601-P23, and the DNA fragment P23 for EMSAs LHR5  AGACCACCCTGCAGAAAGCCA the plasmid p601-P25, and the DNA fragment P25 for EMSAs KOR1F  CGATGAAGGTCGACACTGACGGTT the plasmids p601-P2R  and p601-P1R ctrA::lacZ fusions CEPS2 GAGAGGTCGTCGGATCCTCCTCCAC the ctrA::lacZ fusion plasmids, and the DNA fragment C11.7 for EMSAs CEPS 17 GATCTGCAGCGAGACCTCCCGTTC the plasmids p601-17, p601- 17x, and pUC19-17 CEPS 15 CCTTTTTCTGCAGGGCCGCGC   the plasmid p601-15 CEPS 13 GCCCGACCTGCAGACGACCAC  the plasmid p601-13 CEPS 11 GGTGAGCCCCTGCAGCTGAAAAAAG the plasmids p601-11 and p601-11x CEPS11.7 GCGTCGTTGGCTGCAGTCGCGCAAGG for the construction of p601-11.7 and the DNA fragment C11.7 for EMSAs CEPS 9   CGCATGGTCTGCAGGGACGCTC   the plasmid p601-9 CEPS 7   GATCGAGGGCTGCAGGCGGAGAAC   the plasmid p601-7 CEPS 5 CGTGTTAACCATCTGCAGACAAGGTC G the plasmid p601-5 CEPS5x CGTGTTAACCATCTAGAGACAAGGTC GAACG the plasmids p601-11x and p601-17x CEPS11.7x CCTTGCGCGACTCTAGACAACGACG the plasmids p601-11x and p601-17x IRDR CGATGATCGCCTTGCGCGACTCTAGA TCGGCCCGGGTCAGAAT the plasmid p601-IRD IRDF ATTCTGACCCGGGCCGATCTAGAGTC GCGCAAGGCGATCATCG the plasmid p601-IRD SIRF ATCTGAAAAAAGTGGATGGTCTAGAC GATTCTGACCCGGGCCG the plasmid p601-SIR SIRR CGGCCCGGGTCAGAATCGTCTAGACC ATCCACTTTTTTCAGAT the plasmid p601-SIR  30  Table 2.2 con‟t Primers Sequence (5‟ to 3‟) Used for / in the construction of Construction of chromosomal gene knockout mutants KOR1Fc GAGTTCAACCTGCAGTCGACGAAGAA AGTG the gtaR, gtaI, and gtaR/gtaI gene knockout mutants KOR1Rb GCAGACACTTGTTATCTAGATGTGTA TGGAC the gtaR and gtaR/gtaI gene knockout mutants KOR2Fb GCGAAGGAGTTCTAGATGCTGTAGGT CC the gtaR and gtaR/gtaI gene knockout mutants KOR2R  GATCATCCGAGCTCCTTTGCCCC the gtaR, gtaI, and gtaR/gtaI gene knockout mutants KOI1Rb CAAAGGAAAGTCTAGAGGTCTGCATC G the gtaI and gtaR/gtaI gene knockout mutants KOI2Fb CCAATGCGTTTCTAGAGACCTGATGG C the gtaI and gtaR/gtaI gene knockout mutants 5‟ RACE Abridged anchor primer GGCCACGCGTCGACTAGTACGGGIIG GGIIGGGIIG 5‟ RACE Abridged universal amplification primer GGCCACGCGTCGACTAGTAC 5‟ RACE Fustin GTCCTCCACCAACAAAATCCGCATCC 5‟ RACE Fustout GATGCTGCGAGAGGTCGTCGGGTC 5‟ RACE Fustnest CGCATCCTGGGTTCTCCGCATTA 5‟ RACE -21M13F GTTTTCCCAGTCACGACGTTGTA sequencing from TOPO clones in 5‟ RACE, and construction of the M13 DNA fragment for EMSAs -21M13R CAGGAAACAGCTATGACC sequencing from TOPO clones in 5‟ RACE Construction of 6 x His-tagged GtaR plasmid PR28n CTGTCTAAAAACATATGTCCATACAC AC For the amplification of gtaR in the construction of pET28R PR28c  CGCTGCGGGATCCTACAG For the amplification of gtaR in the construction of pET28R  31  Table 2.2 con‟t Primers Sequence (5‟ to 3‟) Used for / in the construction of Construction of DNA fragments used in EMSAs LHRrf GAAAAGATCAACCGGGAATTG   DNA fragments DRR and R2R LF1 CCGAAATCAACAAGTGTCTGCG   DNA fragment DR1 LF3 ACATGTCCATACACACCGAAATCAA  DNA fragment DR3 LF5 GTCTAAAAAGACATGTCCATACACAC CG DNA fragment DR5 LF7 TGGCACCTGTCTAAAAAGACATGTCC A DNA fragment DR7 LF9 AGGCAATTCCCGGTTGATCTT   DNA fragment DR9 PRcheck  GAGACTTGGCGGCAATCTG DNA fragments DR1, DR3, DR5, DR7, and DR9 3RPL GCTTATTCGTCTGCAGCTTCGAAA DNA fragment R23 5RPL   TGGCTTTCTGCAGGGTGGTCT DNA fragment R25 M200R GCGCAACGCATTTAATG DNA fragment M1  Table 2.3  Plasmids and subclones used in this thesis. Plasmids Description Marker Reference orfg1::lacZ and orfg2::lacZ fusions pXCA601 promoter probe vector, for construction of promoter::lacZ fusions TcR (Adams et al., 1989) pYP 901 bp 5‟ of orfg2 start codon and the first several orfg2 codons cloned into pXCA601 as a PstI to BamHI fragment TcR (Lang and Beatty, 2000) pYnP same as pYP except the orfg2 start codon and all sequence 5‟ of it is deleted TcR (Lang and Beatty, 2000) p601-g61 202 bp 5‟ of orfg1 start codon and orfg1 start codon cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-g64  248 bp 5‟ of orfg1 start codon and orfg1 start codon cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-g65 611 bp 5‟ of orfg1 start codon and orfg1 start codon cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-g15 same as p601-g65 except the orfg1 start codon and the 56 bp immediately upstream of it is deleted (a 558 bp PstI to BamHI fragment cloned into pXCA601) TcR this thesis  32  Table 2.3 con‟t Plasmids Description Marker Reference ctrA::lacZ fusions p601-5 47 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-7 116 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-9 227 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-11 379 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-13 571 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-15 677 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-17 1463 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-SIR same as p601-17 except the SIR inverted repeat is deleted TcR this thesis p601-IRD same as p601-17 except the IRD inverted repeat is deleted TcR this thesis p601-11.7 270 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-11x same as p601-11 except the predicted -10 and -35 sites, and surrounding sequences are deleted TcR this thesis p601-17x same as p601-17 except the predicted -10 and -35 sites, and surrounding sequences are deleted TcR this thesis pUC19 Cloning Vector, lacZα (Invitrogen) ApR  (Norrander et al., 1983) pUC19-17 1463 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pUC19 as a PstI to BamHI fragment ApR  this thesis  33  Table 2.3 con‟t Plasmids Description Marker Reference pUC5x-17 47 bp 5‟ of ctrA start codon and the first 9 ctrA codons cloned into pUC19 as a XbaI to BamHI fragment ApR  this thesis pUC17x subclone for the PstI to BamHI fragment cloned into p601-17x ApR  this thesis pUC11x subclone for the PstI to BamHI fragment cloned into p601-17x ApR  this thesis gtaR::lacZ fusions p601-P1R 1096 bp 5‟ of gtaR start codon cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-P21 587 bp 5‟ of gtaR start codon and the first 9 gtaR codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-P23 290 bp 5‟ of gtaR start codon and the first 9 gtaR codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis p601-P2R 1183 bp 5‟ of gtaR start codon and the first 9 gtaR codons cloned into pXCA601 as a PstI to BamHI fragment TcR this thesis chromosomal gene knockout mutants pZJD29A Suicide vector used to make markerless knockout mutants in R. capsulatus. Contains the sacB gene. GmR J. Jiang and C. E. Bauer, unpublished plasmid construction pUCR1 the sequences upstream of the gtaR gene cloned into pUC19 as a SalI to XbaI fragment ApR this thesis pUCR12 the sequence downstream of gtaR gene cloned into pUCR1 as a XbaI to SacI fragment ApR this thesis pUCI1 the sequences upstream of the gtaI gene cloned into pUC19 as a SalI to XbaI fragment ApR this thesis pUCI12 the sequence downstream of gtaI gene cloned into pUCI1 as a XbaI to SacI fragment ApR this thesis pUCR12 sequences upstream of the gtaR gene, the sequence between the gtaR and gtaI gene, and the sequence downstream of the gtaI gene cloned into pUC19 as a SalI to SacI fragment ApR this thesis  34  Table 2.3 con‟t Plasmids Description Marker Reference pJDR12 the SalI to SacI fragment from pUCR12 cloned into pJD29A GmR this thesis pJDI12 the SalI to SacI fragment from pUCI12 cloned into pJD29A GmR this thesis pJDR12 the SalI to SacI fragment from pUCR12 cloned into pJD29A GmR this thesis 6 x His-tagged GtaR plasmid pET28a(+) Expression vector for His-tagged proteins KanR Novagen pET28R gtaR ligated into pET28a(+) as a NdeI to BamHI fragment to obtain a N-terminal 6 x His-tagged GtaR protein KanR this thesis * Resistance markers: ApR, ampicillin; GmR, gentamicin; KanR, kanamycin; TcR, tetracycline. 2.5 Site directed mutagenesis  The construction of p601-SIR and p601-IRD used site directed mutagenesis to make deletions of two inverted repeats found in the ctrA promoter region.   The ctrA promoter region was amplified by PCR using B10 chromosomal DNA as the template, and using the primers CEPS17 and CEPS2.  The resultant amplicon was ligated into pUC19 as a PstI to BamHI fragment to create the plasmid pUC19-17 (Table 2.3).  Site directed mutagenesis was done using pUC19-17 as template DNA, and the primer sets IRDF and IRDR, and SIRF and SIRR (Table 2.2), resulting in the plasmids pUC-IRD and pUC-SIR (Table 2.3), respectively.  The ctrA promoter region with either the IRD or SIR inverted repeat deleted was excised from the pUC-IRD and pUC-SIR plasmids, respectively, as a PstI to BamHI fragment and ligated into pXCA601, resulting in the plasmids p601-IRD and p601-SIR (Table 2.3), respectively.  35  2.6 Construction of chromosomal gene mutants  All gene disruptions made in this study were markerless in-frame deletions of the majority of the gene.  All mutant strains were constructed from the R. capsulatus B10 strain.  All primers and plasmid used in the construction of chromosomal gene mutants are described in Table 2.2 and 2.3, respectively.  The gtaR mutant BLKR was constructed using B10 chromosomal DNA as the template for all PCR.  The region 5‟ of the gtaR start codon and the first five codons of the gtaR gene were amplified using the primers KOR1Fc and KOR1Rb, which introduced an upstream SalI and downstream XbaI restriction enzyme cut site to the amplicon, respectively.  The resultant ~1.0 kb amplicon was ligated into pUC19 as a SalI to XbaI fragment and this plasmid was called pUCR1.  The regions 3‟ of the gtaR stop codon and the last two codons of the gtaR gene were amplified using the primers KOR2Fb and KOR2R, which introduced an upstream XbaI and downstream SacI restriction enzyme cut site to the amplicon, respectively.  The resultant ~2.1 kb amplicon was ligated into pUCR1 as an XbaI to SacI, fragment and this plasmid was called pUCR12.  The plasmid pUCR12 was digested with SalI (there is a SalI cut site ~60 bp upstream of the SacI site) and the resultant SalI to SalI fragment was ligated into the suicide vector pZJD29A (Table 2.3).  The resultant plasmid was named pJDR12, and was conjugated from the E. coli S17-1 strain to the R. capsulatus B10 strain.  The resultant transconjugants were screened for single crossover events (GentR and SucroseS).  These colonies were the grown in the absence of antibiotics for four days, and screened for a double crossover event (GentS and SucroseR).  The resultant  36  candidates were confirmed by PCR of the gtaR gene using chromosomal DNA as a template.  The gtaI mutant BLKI was made in a manner similar to the gtaR mutant BLKR, except the primers KOR1Fc and KOR1Rb were used to make the ~1.7 kb upstream amplicon (which was ligated into pUC19 resulting in the plasmid pUCI1), and the primers KOI2Fb and KOR2R were used to make the ~1.9 kb downstream amplicon, which was ligated into pUCI1 resulting in the plasmid pUCI12.  The gtaI/gtaR double mutant BLKO was made in a manner similar to BLKR, using pUCI12 as the template DNA, and KOR2Fb and KOR2R as primers for PCR.  The resultant ~1.5 kb amplicon was ligated into pUCR1 as an XbaI to SacI fragment and this plasmid was called pUCR12.  The plasmid pUCR12 was digested with SalI, and the resultant SalI to SalI fragment was ligated into the suicide vector pJZD29A.  The resultant plasmid was named pJDR12 and was conjugated from the E. coli S17-1 strain to the R. capsulatus B10 strain.  The resultant transconjugants were screened for single crossover events (GentR and SucroseS).  These colonies were the grown in the absence of antibiotics for four days then screened for a double crossover event (GentS and SucroseR).  The resultant candidates were confirmed by PCR of the gtaR and gtaI genes using chromosomal DNA as a template. 2.7 mRNA 5’ end mapping  The 5‟ end of the ctrA transcript was mapped using the 5‟ rapid amplification of cDNA ends (RACE) kit (Invitrogen).  The primers used for transcript 5‟ end mapping were the Abridged Anchor Primer (AAP) and Abridged Universal Amplification Primer  37  (AUAP), which were provided with the 5‟ RACE kit, and the primers Fustin, Fustout and Fustnest (Table 2.2), which were designed according to the 5‟ RACE kit manufacturer‟s specifications.  The RNA used for 5‟ end mapping of the ctrA transcript was isolated from R. capsulatus B10 cell cultures (30 ml) that were grown under photosynthetic anaerobic conditions in RCV medium and harvested at early stationary phase.  RNA isolation was done using the RNeasy mini prep kit (Qiagen), which yielded ~125 µg of RNA, at a concentration of ~0.84 mg/ml.  25 µg of this RNA was used for the 5‟ RACE. The resultant amplicons were cloned into the pCR® 4 TOPO® Vector following the TOPO® TA Cloning® Kit for Sequencing (Invitrogen) suggested protocol, and sequenced by the NAPS Unit (UBC) using the primers -21M13F and -21M13R (Table 2.2). 2.8 Cell lysis for GTA bioassay  R. capsulatus cultures were grown in YPS medium under photosynthetic anaerobic conditions and harvested at mid-stationary phase (40 hours of growth, ~450 Klett Units). The cultures were normalized to 450 Klett Units by addition of YPS media and 10 ml of the culture was centrifuged at 3000 x g for 5 min in a Beckman JA-20 rotor, and the supernatant fluid removed and reserved for GTA bioassay.  The cell pellet was resuspended in 300 µl of Buffer 1 [20 mM Tris-HCl (pH 7.8), 5 mM EDTA, 250 mM sucrose, 0.5 mg/ml lysozyme] and subjected to three freeze-thaw cycles by transfer between dry ice and a ~30 ºC water bath.  10 mL of Buffer 2 [20 mM Tris-HCl (pH 7.8), 0.5 mM MgCl2, 0.1 mg/ml DNAase I (Sigma)] were added and the resultant mixture was  38  vortexed.  The cellular debris was removed by centrifugation at 5000 x g for 10 min in a Beckman JA-20 and the resultant supernatant fluid was used for RcGTA bioassays. 2.9 RcGTA bioassay  Bioassays for RcGTA activity were performed as described (Solioz et al., 1975), with minor modifications as described by Taylor (2004).  Donor strains were grown in YPS medium under photosynthetic anaerobic conditions and collected at mid-stationary phase.  The donor strain was normalized to 450 Klett Units by addition of YPS medium and 100 μl of 0.2 µm filtered culture liquid to be assayed was mixed with 100 μl of the indicator strain cells and 400 μl of G-buffer [10 mM Tris-Cl (pH 7.8), 1 mM MgCl2, 1 mM CaCl2, 1 mM NaCl, 500 μg/ml BSA] (Solioz et al., 1975).  The indicator strain was a puhA deletion mutant strain DW5, that is incapable of photosynthetic growth (Wong et al., 1996).  DW5 cells were grown in RCV under aerobic conditions overnight, collected by centrifuging and resuspending cells in an equal volume of G-buffer. The entire mixture was incubated for 1 hour at 30-35ºC with gentle agitation and then 900 μl of RCV medium was added and incubation under the same conditions was continued for 3-4 hours. The cells were spread on RCV plates and incubated under photosynthetic conditions in anaerobic Gas-Pak jars for 2-3 days. Plates were removed and the numbers of puhA+ colonies counted; because DW5 is incapable of photosynthetic growth, all colonies were transductants.  39  2.10 β-galactosidase assays  R. capsulatus cultures were grown under desired conditions, harvested at the desired point in the growth phase (as determined by culture turbidity), and assayed for β-galactosidase activities using a colourimetric assay with o-nitrophenol-β-D- galactoside, on at least triplicate culture samples as described (Miller, 1992) with some modifications.  The cells were resuspended in Z-buffer [60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1mM MgSO4, 50 mM β-mercaptoethanol], lysed by sonication, and cellular debris removed by centrifugation.  The supernatant fluid was then used for Lowry assay to determine protein concentration, and for colourimetric assays to determine β-galactosidase activities.  The development of colour was monitored by absorbance at 420 nm at five second intervals over three to five minute time spans. The rate of colour evolution and protein concentration was then used to obtain β- galactosidase specific activities in units of nmol of o-nitrophenol-β-D-galactoside per minute per mg protein, which is equivalent to Miller units per mg, by using Equation 2.1: β − galactosidase specific activities =  𝐴420 𝑚𝑖𝑛  ×  𝑡𝑜𝑡𝑎𝑙 𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑟𝑒𝑎𝑐𝑡𝑖𝑜𝑛  𝑚𝑙 4.5 ×  𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑙𝑦𝑠𝑎𝑡𝑒 𝑖𝑛 𝑟𝑒𝑎𝑐𝑡𝑖𝑜𝑛  𝑚𝑙  ×  𝑐𝑜𝑛𝑐𝑒𝑛𝑡𝑟𝑎𝑡𝑖𝑜𝑛 𝑜𝑓 𝑝𝑟𝑜𝑡𝑒𝑖𝑛 𝑚𝑔 𝑚𝑙   Equation 2.1  β-galactosidase specific activities. The PASW program (IBM) was used to perform statistical analyses of the data from the lacZ assays.  A summary of ANOVA and post hoc analysis is shown in Appendix A and Appendix B, respectively.  40  2.11 Protein concentration  Protein concentration was determined using a modified Lowry assay (Peterson, 1983).  BSA was used for the standard curve. 2.12  SDS polyacrylamide gel electrophoresis (SDS PAGE)  The Laemmli buffer system (Laemmli, 1970) was used to separate proteins on 12% acrylamide gels with 4% stacking gels (acrylamide/bis 37.5:1). Protein samples were boiled for 10 minutes in Sample Loading Buffer [50 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 0.1% bromophenol blue, 1% β-mercaptoethanol] prior to loading the gel.  Gels were run with the Mini-PROTEAN II system (Bio-Rad) according to manufacturer‟s protocols.  SDS PAGE gels were stained using Coomassie Blue (40% methanol, 10% acetic acid, 0.025% Coomassie dye) and destained using a Destaining Solution (40% methanol, 10% acetic acid). 2.13  Construction of plasmids to express 6 x His-tagged GtaR in E. coli  An N-terminal 6 x His-tag was added to the GtaR protein for purification using a chelated nickel resin in column chromatography.  This was done by cloning the gtaR gene into the expression vector pET-28a(+) (Table 2.3).  The gtaR gene was amplified by PCR using R. capsulatus B10 chromosomal DNA as template, with the upstream primer PR28n and the downstream primer PR28c (Table 2.2), which introduced an NdeI and BamHI site, respectively.  This amplicon was ligated into pET-28a(+) as an NdeI to  41  BamHI fragment, resulting in the plasmid pET28R (Table 2.3).  The plasmid pET28R was then transformed into the E. coli BL21(DE3) strain (Table 2.1). 2.14  Protein purification  Protein was purified following the QIAexpressionist kit (Qiagen) suggested protocol to yield native protein with some modifications.  500 ml cultures of BL21(DE3)(pET28R) were grown in LB medium supplemented with 50 µg/ml kanamycin sulphate at 37ºC with shaking at 250 RPM to an OD660 = 0.55, induced with 1 mM IPTG, transferred to 30ºC with shaking at 250 RPM until the OD660 = 1.00, and harvested by centrifugation.  Cell pellets were resuspended in 4 ml of Lysis Buffer [20 mM HEPES (pH 8.0), 150 mM NaCl, 5 mM imidazole, 10% glycerol, 1 x Roche Complete Mini Protease Inhibitor (according to manufacturer‟s protocol)], and treated with 5 mg of lysozyme and 1 mg DNAase I for one hour, on ice.  The cells were then lysed by French press and cellular debris separated by centrifugation at 12,100 x g for 25 min in a Beckman JA-20 rotor, followed by centrifugation of the resultant supernatant fluid at 541,000 x g for 15 min in a Beckman TLA100.3 rotor at 4ºC.  The protein in the supernatant fluid was bound to 500 μl of Ni-nitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen) in a mini-column made by packing glass wool into a 5 ml syringe. The column had been equilibrated with Lysis Buffer.  Three washes of 3 ml each were performed using Wash Buffer [20 mM HEPES (pH 8.0), 75 mM NaCl, 75 mM imidazole, 10% glycerol, 1 x Roche Complete Mini Protease Inhibitor (according to manufacturer‟s protocol)].  The protein was then eluted with five consecutive elutions of 0.5 ml of Elution Buffer 1 [20 mM HEPES (pH 8.0), 50 mM NaCl, 200 mM imidazole, 10%  42  glycerol, 1 x Roche Complete Mini Protease Inhibitor (according to manufacturer‟s protocol)], followed by one elution with 0.5 ml of Elution Buffer 2 [20 mM HEPES (pH 8.0), 50 mM NaCl, 300 mM imidazole, 10% glycerol, 1 x Roche Complete Mini Protease Inhibitor (according to manufacturer‟s protocol)].  Each step of the 6 x His-tagged GtaR purification process was assessed using SDS PAGE. 2.15  Western blots  R. capsulatus cell cultures were grown under photosynthetic anaerobic conditions in various media and were harvested at the desired growth phase, as determined by culture turbidity.  The cells and cell culture medium were separated by centrifugation at 13,000 RPM in a bench-top microcentrifuge for 5 min.  Equivalent number of cells (or culture medium), according to OD660, were run on 12% SDS-PAGE gels and blotted onto a nitrocellulose membrane (Perkin Elmer).  The blotting was done using a Mini Trans-Blot apparatus (Bio-Rad) according to manufacturer's specifications in Electroblot Buffer [27.5 mM Tris-Base, 192 mM glycine, 20% methanol] at 100 V (constant voltage) for ~1.5 hours.  The primary antibody was a mouse anti-capsid antibody raised against the R. capsulatus RcGTA capsid protein (Taylor, 2004).  Primary antibody binding was detected using a peroxidase-linked anti-rabbit Ig secondary antibody (from donkey; Amersham) as part of the enhanced chemiluminescence (ECL) kit according to the manufacturer's instructions (Amersham). 2.16  Electrophoretic mobility shift assay  The DNA fragments used for electrophoretic mobility shift assay (EMSA) experiments are listed in Table 2.9.  These DNA fragments were generated by PCR  43  using R. capsulatus B10 chromosomal DNA as the template, and the primers listed in Table 2.9, and described in Table 2.2.  The GtaR protein was diluted in Dilution Buffer [20 mM HEPES (pH 8.0), 50 mM NaCl, 10% glycerol] prior to the binding reaction to allow for equal volumes of protein to used in each reaction.  Binding of 0 to 1.44 µM GtaR protein to 100 nM DNA fragments was done in 5 µl reaction volumes containing 10 mM HEPES (pH 8.0) at 37ºC for 30 min.  Glycerol was added to each reaction to yield a final concentration of 10%.  The reactions were separated on 4-5% native polyacrylamide gels with the Mini-PROTEAN II systems (Bio-Rad) according to the manufacturer‟s recommendation in 1 x TBE [446 mM Tris-Base, 445 mM boric acid, 10 mM EDTA (pH 8.0)] for 2-4 hours at 60 V (constant voltage) at room temperature.  The native polyacrylamide gels were then stained with ethidium bromide and the DNA photographed under UV light using geldoc AlphaImager 2200. Table 2.4  DNA fragments used for EMSA. Promoter region Fragment name Primers used ctrA promoter region 11.7 CEPS11.7 and CEPS2 RcGTA gene cluster promoter region G65 GTA5 and GTA2.6 gtaR promoter region P25 LHR5 and LHR2.2 P23 LHR3 and LHR2.2 P2C PRcheck and LHR2.2 R25 KOR1Fc and 5RPL R23 KOR1Fc and 3RPL R2R KOR1Fc and LHRrf DR9 LF9 and LHR2.2 DR7 LF7 and LHR2.2 DR5 LF5 and LHR2.2 DR3 LF3 and LHR2.2 DR1 LF1 and LHR2.2 DRR LHR3 and LHRrf pUC19 MCS M13 -21M13F and M200R  44  2.17  DNase I footprinting assay  The primers LHR2.2 and PRcheck were 5‟ end labeled using 32P ATP (7000 Ci/mmol; Perkin Elmer) and T4 polynucleotide kinase (Invitrogen).  The excess 32P ATP was removed using the Nucleotide Removal Kit (Qiagen), and the primers concentrated by ethanol precipitation.  These primers were used to generate the labeled P2C DNA fragments (labeled on the coding or noncoding strand) that were used for the footprinting assay.  These DNA fragments were generated by performing PCR, using previously generated P2C amplicon as template with either labeled LHR2.2 or PRcheck, and unlabeled PRcheck or LHR2.2 (respectively) as primers.  These 245 bp amplicons were isolated on a 5% polyacrylamide gel, extracted by electroelution, and concentrated by ethanol precipitation.  Binding of 0 to 1.44 µM GtaR protein to 200,000 CPM of the DNA fragments was done in a 25 µl reaction volume containing 10 mM HEPES (pH 8.0) at 37ºC for 30 min.  DNase I (Invitrogen) was added to each reaction and incubated at 37ºC for 15 sec.  The DNase I reaction was stopped by adding 75 µl of Stop Buffer [27 mM EDTA], protein was removed from the DNA by phenol extraction, and the DNA concentrated by ethanol precipitation.  The DNA was resuspended in Formaldehyde Buffer [90% formaldehyde, 0.5 x TBE, 0.05 % (w/v) bromophenol blue, 0.05 % (w/v) xylene cyanol], and separated on a 6% polyacrylamide sequencing gel containing 7 M urea (Sambrook et al., 1989) at 25 W (constant power) for 2.5 hours.  The gels were dried and exposed to film (Kodak Biomax MR film).  45  3 RESULTS 3.1 RcGTA expression and release or RcGTA particles from cells 3.1.1 RcGTA gene cluster promoter region  The RcGTA gene cluster consists of 17 ORFs (Figure 1.2), and is thought to be expressed as a single operon from a promoter upstream of orfg1.  Previous mRNA 5‟ end mapping identified two transcript start sites 5‟ of orfg1 (Florizone, 2006).  A proximal 5‟ end was mapped immediately upstream of a -35 site predicted by the Softberry bacterial promoter prediction program BPROM (http://linux1.softberry.com/berry.phtml). A distal 5‟ end was mapped within rcc01681 and was used to propose -10 and -35 sites (Figure 3.1) (Florizone, 2006).  Four in-frame possible start codons for orfg1 were identified.  These were found using the ERGO light bioinformatics suite (http://www.ergo-light.com/ERGO/), by Lang (Lang, 2000), Mercer et al. (2010, In press), and me (Leung), at nt 494-496, 551-553, 587-589 and 650-652 (labeled #1-4 in Figure 3.1).  The potential start codons #1 and #3 were identified using automated ORF identifying programs (set at default parameters), and #2 and #4 were identified by visual scanning of the sequence for an “ATG” that was in-frame with and within 100 bp of potential start codons #1 and #3.  Multiple potential start codons for orfg1 were investigated because in-frame orfg1::lacZ fusion experiments using start codon #2 and #3 resulted in low expression (see section 3.1.1.1 for results and more discussion on this).  46   Previous studies showed that C16-HSL serves as a signal that activates RcGTA gene cluster expression and that the production of C-HSL is directed by GtaI, a homologue of the LuxI quorum sensing protein (Schaefer et al., 2002).  Three homologues of the quorum sensing response regulator LuxR were identified in R. capsulatus, and it is possible that one is the cognate response regulator to the signal produced by GtaI.  To evaluate potential response regulator binding sites, the orfg1 promoter region was scanned for a lux box using the alignment software Multalin version 5.4.1 (Corpet, 1988) and the lux box sequence (ACCTGTAGGA TCGTACAGGT) (Fuqua et al., 1994; Horng et al., 2002).  A putative lux box was located 3 bp 5‟ of the rcc01681 stop codon (Figure 3.1).  The conservation between this sequence and the lux box sequence identified by Fuqua et al. (1994) is low (only 10 of 20 nt), indicating that it is not likely a LuxR-type protein binding site.  However, the lux box consensus sequence (NRCTGSRXYASRNYNCAGYN, where N = A, T, G, or C; X = N or gap; R = A or G; Y = T or C; and S = C or G) identified by Horng et al. (2009) indicates that that lux box sequences are not generally well conserved. The conservation between the putative LuxR-type protein binding site sequences and the non-degenerate sequences in the lux box consensus sequence is 8 of 8 nt.  This indicates that the putative lux box upstream of orfg1 cannot be eliminated as a potential for a LuxR-type protein.   47           PstI AGCGTCTTTG TCAACCGGCT GCGCAGGGGA TGCGGCTGCA GACCGATCCG GCGGTGATTT 59  ACGGCGTGAC CAAGGGGCAG GGCGTGCTGG GGCGCGGTTT GCGGCAATCG GAGCTGCGGC 119  GCGAGACGCC CTATAACACC TATGTCATCG ACGGGCTGCC GCCGGGGCCG ATCTGCAACC 179  CCGGGACGCA GGCGATCCGC GCGGCGCTGA ACCCTGATTC GACGAAGTTC CTGTATTTCG 239  TGGCGGACGG CACCGGCGGG CATGCTTTTG CCGAGACGAT CACCGAGCAT AACCGGAACG 299              rcc01681 TCGCGCGCTG GCGGGAGATC GAGAAGACCC AAAAGCAGGG CGCAAGCGAC GGAAACTGAA 359  GGAAAACCCC GGCTTCGTCC GGGGTTTTTT CTTTTCAGCG GGTGCAACCC TGAATATAGC 419  ACTTGACTTT GCGAACGCTT CAAGGTAGAG ATAAGGCATG CTAGGAGAGG TGGGCAAGCG 479    g1#1 (ERGO) CCGCGGGTGA CCGTGTGCGC TTTTTTCATT TCGCTCGTGC GGACAGGCAT GAGAGGCGGG 539   g1#2 (Lang)           g1#3 (Mercer) TCACGCAAGA CATGGACATG GGGTTCAAGG GTGGGGACGC TCCTCCGGTG GATTTGCTGG 599              g1#4 (Leung) AGGAGACGGA GGAGCTTTAT CGGGAAATTG CCGGGGAACT GGCCCTGGCG ATGAAAGGGG 659  TTCGCCAGGG CGAGGCGAAG GAGGCCAAGG CCGCCGCGCA GGCGGTCAAG GACCTTCGCG 719  CGGCGTTCCA GATGGTGATG GAAGAAAGGG TGCGTGTTGA AAAACTTCGC AGACAAGTTG 779  CCGGTGTCGG AGCCGGAAGC GAGCTTGACC TGGACGCCGC CCGGGCTGAG ATCGGGCGCC 839           g1 GCCTGGCTTG CCTGCGCGAC GCCGCAGGAG GTTGACGCCT TTCTGGGGGG GCTTGGGAAC 899     g2       EcoRI AATGCGCTTT TGGCGCTGCC CTGGATTTTC GAATTCTGGG CGCTGCCGCA TCAGCTGCCC 959  Figure 3.1  Sequence 5‟ of orfg2 of the RcGTA gene cluster. In green are start codons labeled with the green bent arrow ( ) and the name of the gene name or ORF assignment. Highlighted in yellow are predicted starts codon for orfg1 (in brackets are the identifying person or program). Highlighted in bright green are the putative -10 and -35 sites predicted by the Softberry program BPROM. Highlighted in dark green are the proposed -10 and -35 sites according to the 5‟-most mRNA 5‟ end. Highlighted in turquoise are mRNA 5‟ ends as mapped by Florizone (2006) using 5‟ RACE. Highlighted in red are stop codons of genes as labeled. In fuchsia and underlined is a putative lux box predicted by Multalin (Corpet, 1988). In Bold are EcoRI and PstI sites. Orange arrow indicates the 3‟ end of the orfg1::lacZ fusions. Blue arrows indicate the 5‟ end of the orfg1 promoter deletion fusions to lacZ. Note: each arrow is identified with a number that corresponds to the plasmid name (e.g. the clone containing the sequence between the orange arrow labeled “1” and the blue arrow labeled “5” is called p601-G15). Table 3.1 identifies the nt of each element in this figure. 5 6 1 1 4  48  Table 3.1  Nucleotide positions of elements and proposed regulatory sequences in Figure 3.1.   Element   nt position   notes orfg1 putative start codon #1    494-496 orfg1 putative start codon #2    551-553 orfg1 putative start codon #3    587-589 orfg1 start codon #4     650-652 orfg2 start codon      901-903 predicted -10 site (BPROM)   441-450 predicted -35 site (BPROM)    422-427 predicted -10 site (5‟ RACE)    322-327 predicted -35 site (5‟ RACE)   299-304 mRNA 5‟ ends     336 and 440 rcc01681 stop codon    356-358 g1 stop codon     872-874 putative lux box      362-383 Orange Arrow #1         589   3‟ end for pG15 Orange Arrow #6         653   3‟ end for pG65, pG64 and pG61 Blue Arrow #1          448   5‟ end for pG61 Blue Arrow #4      403   5‟ end for pG64 Blue Arrow #5          39   5‟ end for pG15 and pG65 3.1.1.1 RcGTA orfg1 promoter region deletions  Previously, it was unknown if orfg1 was part of the RcGTA operon and whether the RcGTA promoter was upstream of orfg1 or orfg2.  The plasmid pYP (see Figure 3.2), which contains a fusion between orfg2 (terminase gene) of the RcGTA gene cluster and the E. coli lacZ coding sequence, was used to monitor expression of the RcGTA gene cluster (Lang and Beatty, 2000).  A negative control plasmid pYnP (see Figure 3.2), which contains an orfg2::lacZ fusion and is similar to pYP but is truncated in the orfg1-orfg2 intergenic region (Lang and Beatty, 2000), was used.  Preliminary work indicated that disruptions of orfg1 and orfg2 result in decreased RcGTA transduction, which can be restored with complementation of orfg1 to orfg15, but not orfg1 to orfg12 (A.S. Lang, personal communication).  On the basis of this work done by others, it was thought that the RcGTA promoter is located 5‟ of the orfg1 gene and 3‟ of the PstI site at  49  position 39 in Figure 3.1 (blue arrow labeled “5”).  However, there were four potential start codons for orfg1 (Figure 3.1), and it was not clear which one was correct.  Locating the orfg1 start codon was important because orfg1::lacZ translational fusions (see below) require a start codon.  To further locate the RcGTA gene cluster promoter and to identify the orfg1 true start codon, a series of translationally in-frame fusions between orfg1 and the E. coli lacZ coding sequence were made and tested for expression in the RcGTA overproducer strain, Y262 (Figure 3.2).  For the purpose of all lacZ fusion experiments in this thesis, the term “expression” will be defined as the net value of protein product resulting from the combined processes of transcription, translation, and mRNA and protein degradation, unless otherwise indicated.  R. capsulatus cultures were grown in the rich medium YPS under photosynthetic anaerobic conditions, collected after 36 hours (early stationary phase) and assayed for β-galactosidase specific activity as a measure of orfg2::lacZ or orfg1::lacZ expression.  To identify which of the four predicted orfg1 start codons is the true start codon, the plasmids pG65 and pG15 were made.  The plasmid pG65 contains a translationally in-frame fusion between orfg1 potential start codon #4 (position 650-652) and the lacZ coding sequence, with 610 bp of sequence 5‟ of this potential start codon present.  Expression from pG65 was ~3 times higher than that from the pYP plasmid, which contains orfg1 and a portion of orfg2 (Figure 3.2).  If orfg1 is part of the RcGTA operon, this may indicate that the level of translation of orfg2 is lower than orfg1.  If orfg1 is not part of the RcGTA operon, this may indicate that transcription of orfg2 is lower than orfg1.  Alternatively, these results may indicate a difference between the orfg1::lacZ and orfg2::lacZ mRNA and protein stabilities.  50  Plasmid pG15 is a translationally in-frame fusion between the orfg1 potential start codon #3 (position 587-589; identified by Mercer et al., In press, 2010) and the lacZ coding sequence, with 550 bp 5‟ of this potential start codon present (i.e. the same 5‟ end as in the plasmid pG65).  Y262 cells containing pG15 had β-galactosidase specific activities 11% of Y262 cells containing pG65 but expression from pG15 is similar to that of the negative control plasmid pYP (Figure 3.2).  Since all four orfg1 potential start codons identified are in-frame with each other, the simplest interpretation of these data is that orfg1 translation initiates at the 3‟-most predicted start codon.  I suggest that the ATG labeled as “g1#4 (Leung)” in Figure 3.1 is the genuine start codon for the orfg1 gene.  In attempts to locate the RcGTA promoter, the orfg1::lacZ deletion fusions pG64 and pG61 were made (Figure 3.1 and Figure 3.2).  The β-galactosidase specific activities from pG64 and pG61 were 12% and 9% of pG65, and 31% and 21% of pYP, respectively (Figure 3.2).  Plasmid pG64 contains only 247 bp of sequence upstream of the orfg1 start codon and lacks the predicted lux box (position 362-383 in Figure 3.1) as well as the 5‟-most predicted -10 and -35 sites (position 322-327 and 299-304, respectively, in Figure 3.1), which were proposed by Florizone (2006) according to the 5‟-most RcGTA orfg1 transcript 5‟ end (position 336 in Figure 3.1).  Plasmid pG61 lacks most of the -10 site predicted by the BPROM software (position 441-450 in Figure 3.1) and all sequences 5‟ of it (Figure 3.1).  These results indicate that either an activator binding site or the RcGTA gene cluster promoter is missing from the pG61 and pG64 fusion plasmids, but present in the pG65 fusion plasmid.  This supports the location of the RcGTA gene cluster promoter proposed by Florizone (2006), according to the 5‟- most RcGTA transcript end identified by 5‟ RACE.  51   As a brief summary of this section, I suggest that: 1) the RcGTA promoter is located 5‟ of orfg1; 2) the -10 and -35 sites identified by 5‟ RACE (position 322-327 and 299-304, respectively, in Figure 3.1) (Florizone, 2006) are required for orfg1 transcription; and 3) the ATG labeled “g1#4” in Figure 3.1 (nt 650-652) is the start codon for orfg1.   5 2   Figure 3.2 Expression of RcGTA gene cluster promoter deletions.  On the left are representations of the orfg1::lacZ and orfg2::lacZ fusions used to investigate sequences for RcGTA expression.  On the right are the β-galactosidase specific activities of Y262 cells containing each orfg1::lacZ (or orfg2::lacZ) gene fusion plasmid. The end points for the DNA fragments in the different plasmids are listed in Table 3.1.   53  3.1.1.2 The orfg1 effect  Previously, an interesting regulatory effect involving the plasmid pYP (the orfg2::lacZ fusion containing orfg1 and sequences upstream of it, and the expression of the RcGTA capsid protein was found (Florizone, 2006).  Western blots of the pellet (representing the intracellular fraction) and supernatant (representing the extracellular fraction) of cell cultures were probed using an antibody against the RcGTA capsid protein.  Capsid protein was detected in both the pellet and supernatant of Y262 cultures, but in the Y262 strain containing pYP, a lower amount of capsid protein was detected in the pellet and none was detected in the supernatant (Figure 3.3).  This effect was not due to the vector, because western blots of Y262 cells containing the pYnP plasmid showed that RcGTA capsid expression was similar to that of Y262 cell cultures (Figure 3.3).  This effect was named the “orfg1 effect” because it was suspected that the extra copies of orfg1 were causing this effect.  To further investigate the “orfg1 effect”, RcGTA capsid production in Y262 strains that contained the pG65, pG64, pG61, and pG15 plasmids were determined using western blots.  Cell cultures were grown under photosynthetic anaerobic conditions in YPS medium and collected after 36 hours of growth (Florizone, 2006).  Growth under photosynthetic anaerobic conditions in YPS medium was used because RcGTA transduction efficiencies were high when donor cultures were grown under these conditions.  Cells were collected by centrifugation, and both the resultant pellet and supernatant fluid tested for RcGTA capsid protein by western blot analysis (see Materials and Methods).  Western blots of the Y262 strain containing pG65 or pYP showed decreased capsid in the pellet compared to Y262 alone, and no capsid in the  54  supernatant.  This indicated that the sequence responsible for the “orfg1 effect” is common to pG65 and pYP, and so it appeared that the “orfg1 effect” was not caused by orfg1 because pG65 contained only the first codon of orfg1.  Western blots of the Y262 strain containing pG64, pG61, and pG15 showed capsid present in the pellet and the supernatant, as was found for the host strain alone.  Therefore, it is unlikely that multiple copies of the -10 and -35 sites proposed by Florizone (2006) (position 322-327 and 299- 304 in Figure 3.1) and surrounding sequences were the cause of the “orfg1 effect”, because pG15 contains these sequences.  It is also unlikely that multiple copies of the DNA sequences found in pG65 were responsible for this effect because pG64, pG61 and pG15, in combination, contain all those sequences.  The plasmids that did not cause the “orfg1 effect” also had low expression of β-galactosidase.  This was due to the absence of a promoter in pYnP, pG64 and pG61, and the lack of a start codon in pG15.  This is consistent with the possibility that the orfg1 effect is due to regulation by non-coding RNA.  More specifically the sequences found in the pG65 but not the pG61 transcript (i.e., the 63 bp sequence found between the orfg1 putative start codons # 3 and  #4, nt 590-652 in Figure 3.1), because the orfg1 effect was not seen in cells containing pG61. The lack of transcript from pG64 and pG61 compared to pG65 is consistent with this model but more investigation is required to identify the cause of the “orfg1 effect”.  The assumption that pG65 and pG61, but not pG64 and pG61, produce transcripts could be tested by northern blots.  It is unlikely that β-galactosidase protein would inhibit RcGTA capsid protein expression.  However, this could be tested by performing western blots on cells containing the lacZ gene under the control of a  55  promoter other than the RcGTA promoter.  I have eliminated several possible causes of the “orfg1 effect” here and suggested two other possibilities to be tested.   56   Figure 3.3 Effect of orfg1::lacZ and orfg2::lacZ fusion plasmids on RcGTA capsid production.  A. Representations of the orfg1::lacZ and orfg2::lacZ fusions, and corresponding β-galactosidase relative activities (see Section 3.1.1.1 and Figure 3.2). The β-galactosidase relative activities were obtained by normalizing β-galactosidase specific activities to that of Y262 cells containing pG65.  B.  Western blots of Y262 strains containing the orfg1::lacZ and orfg2::lacZ fusion plasmids.  Data from Jeanette Beatty.  57  3.1.2 Expression of RcGTA orfg1 under four different growth conditions  In the laboratory, R. capsulatus is typically grown under either aerobic or anaerobic photosynthetic conditions in YPS or RCV media.  Higher frequencies of RcGTA transduction are obtained when RcGTA donor strains are grown under photosynthetic anaerobic conditions in YPS medium compared to RCV medium. Western blot assays using antibodies against the RcGTA capsid protein showed that under photosynthetic anaerobic conditions, cells grown in RCV medium had less capsid protein in the cell and no capsid released into the surrounding media compared to cells grown in YPS, which had capsid protein present both in the cell and surrounding media (Figure 4.1) (Taylor, 2004).  Under the assumption that the RcGTA gene cluster is ex pressed from a single promoter found upstre am of orfg1, I used the orfg1::lacZ translational fusion to investigate the effects of culture growth conditions on RcGTA gene cluster expression. I used the Y262 strain containing pG65 (orfg1::lacZ in Figure 3.2) grown under four different conditions:  1) in the minimal medium RCV under anaerobic photosynthetic conditions; 2) in the rich medium YPS under anaerobic photosynthetic conditions; 3) in RCV medium under aerobic respiratory conditions; and 4) in YPS medium under aerobic respiratory conditions. These cultures were collected at early stationary phase and assayed for β-galactosidase specific activity.  The results revealed that β- galactosidase specific activity was highest when cell cultures were grown in YPS medium under photosynthetic anaerobic conditions (Figure 3.4), which corresponded with RcGTA bioassay findings (personal communication, A.S. Lang).  Cell cultures grown under aerobic conditions (in YPS and RCV media) had similar activity compared  58  to cultures grown in YPS medium under photosynthetic conditions.  Cell cultures grown in RCV medium under photosynthetic anaerobic conditions had the lowest β- galactosidase specific activity, which was 41% of cultures grown in YPS medium under photosynthetic anaerobic conditions.  The results showing decreased orfg1::lacZ expression of cells grown under photosynthetic anaerobic conditions in RCV compared to YPS medium in Figure 3.4 are consistent with the transduction and western blot assay results.  Figure 3.4 Effects of growth condition on RcGTA expression.  The β-galactosidase specific activities of Y262(pG65) cultures grown under four different growth conditions: photosynthetic anaerobic conditions in RCV medium (PS RCV), photosynthetic anaerobic conditions in YPS medium (PS YPS), aerobic conditions in RCV medium (AE RCV) and aerobic conditions in YPS medium (AE YPS). 0 50 100 150 200 250 PS RCV PS YPS AE RCV AE YPS β -g a la c to s id a s e  S p e c if ic  A c ti v it y (M il le r u n it s /m g )  59  3.1.3 Expression of RcGTA orfg1 in ctrA- and cckA- strains  Earlier experiments using the orfg2::lacZ fusion plasmid (pYP) revealed that orfg2 expression was decreased in the ctrA- strain compared to Y262 (Lang and Beatty, 2000).  I wanted to determine whether orfg1 expression is also regulated by CtrA and CckA, by using the orfg1::lacZ fusion plasmid (pG65).  The ctrA- and cckA- strains used in these experiments were made in the Y262 background.  The Y262, ctrA- and cckA- strains containing the pG65 plasmid were grown in YPS medium under anaerobic photosynthetic conditions, collected after 36 hours (early stationary phase), and assayed for β-galactosidase specific activity as a measure of orfg1::lacZ expression. The growth conditions were chosen because they resulted in the highest expression of orfg1::lacZ in Section 3.1.2 (Figure 3.4) and were the conditions used for northern blot analysis of the orfg2 and orfg4 transcripts in Y262 and ctrA- cells (Lang and Beatty, 2002).  Expression of orfg1::lacZ in the ctrA- and cckA- strains were 1.6% and 13%, respectively, compared to Y262.  These results indicate that CtrA is required for orfg1 expression.  The level of activity in the cckA mutant was higher than in the ctrA mutant but still low compared to that of Y262.  This indicates that CckA plays a role in activating orfg1 expression.  These results correspond to previous northern blot results that show no detectable transcripts corresponding to orfg2 and orfg4 in the ctrA- strain (Lang, 2000; Lang and Beatty, 2002).  It is unknown whether R. capsulatus CtrA is a cognate response regulator to CckA and whether CckA phosphorylates CtrA directly.  Perhaps CtrA and CckA are part of a phosphorelay system and/or CtrA phosphorylation is modulated by other signal transduction systems.  If so, this would explain why the cckA- mutation has less of an effect than the ctrA- mutation on orfg1 expression.  60   Figure 3.5 Expression of the RcGTA gene cluster in R. capsulatus regulatory mutants. Cells were grown in YPS medium under anaerobic photosynthetic conditions.  The β- galactosidase specific activities from the ctrA- and cckA- regulatory mutant strains containing the orfg1::lacZ gene fusion plasmid pG65 are shown. 3.1.4 Accumulation of RcGTA capsid protein in cckA- cells  Previously, western blots of the cckA- strain cultures using an antibody against the RcGTA capsid protein showed an accumulation of capsid in the pellet and no capsid in the supernatant (Florizone, 2006).  I wanted to determine if this intracellular accumulation of capsid represented a population of fully assembled and functional RcGTA particles.  To address this question, Y262 and cckA- cultures were grown in YPS medium under photosynthetic anaerobic conditions and collected after 36 hours (early stationary phase).  The amount of RcGTA was measured in transduction bioassays of both the culture supernatant and the pellet lysate (Materials and Methods), which represent the intracellular and extracellular RcGTA, respectively.  The results are shown in Table 3.2.  Western blot results from a previous, parallel experiment can be 0 50 100 150 200 250 Parental ctrA- cckA- β -g a la c to s id a s e  S p e c if ic  A c ti v it y  (M il le r u n it s /m g )   Y262      tr -      -   61  seen in Figure 4.1.  The RcGTA bioassays using the supernatant from the Y262 and cckA- cell cultures resulted in 1447 and 7 cfu, respectively.  The RcGTA bioassays using the Y262 pellet lysate resulted in 1157 cfu, which indicated an intracellular assembly of fully functional RcGTA particles that were not released.  The RcGTA bioassays using the cckA- pellet lysate resulted in 183 cfu, 10-fold lower than the assays using the Y262 pellet lysate, even though western blots showed more capsid protein in the cckA- cellular portion compared to the Y262 cellular portion.  Although there were functional RcGTA particles present in cckA- cells, it appears that the majority of the intracellular accumulation of capsid protein shown by the western blot was free RcGTA capsid protein, partially formed RcGTA, and/or non-functional RcGTA. This indicates that CckA plays a role in RcGTA assembly and possibly release.   62  Table 3.2  RcGTA bioassay on extracellular medium and intracellular lysate of Y262 and cckA- cell cultures.   Recipient   DW5 None D o n o r Y262 Culture Supernatant 1447 ± 200 0 ± 0 Lysed cells 1157 ± 425 n/a cckA- Culture Supernatant 7 ± 4 0 ± 0 Lysed cells 183 ± 88 n/a None 1 ± 1 n/a Notes: - n/a indicates not done.   - values in this table are shown as averages of sample triplicates in cfu per  RcGTA transduction. 3.2 Regulation of ctrA expression 3.2.1 Expression of ctrA in regulatory mutant strains  Previously it was observed that expression from the RcGTA orfg2::lacZ fusion plasmid was reduced in ctrA- (Lang and Beatty, 2002) and gtaI- (quorum sensing) strains (Schaefer et al., 2002), as were RcGTA transduction efficiencies.  In C. crescentus, ctrA transcription is autoregulated by CtrA and its cognate sensor kinase CckA.  I therefore investigated whether R. capsulatus ctrA expression is regulated by the GtaI protein, and whether ctrA expression is autoregulatory (involving CtrA and/or CckA).  The plasmid p601-17 contains an in-frame translational fusion between the 8th codon of R. capsulatus ctrA and the E. coli lacZ coding sequence, with ~1.5 kb of sequence 5‟ of the ctrA gene present.  WT, ctrA-, cckA-, and gtaI- strains containing the p601-17 plasmid were grown in RCV medium under anaerobic photosynthetic  63  conditions, collected at early stationary phase, and assayed for β-galactosidase specific activity as a measure of ctrA::lacZ expression.  Figure 3.6 shows that activities in the ctrA- and cckA- strains were similar to WT, indicating that ctrA expression is not regulated by CtrA or CckA under this growth condition.  However, expression of ctrA::lacZ in the gtaI- strain was decreased by ~50% compared to WT (Figure 3.6).  This indicates that there is GtaI-based regulation of ctrA expression at early stationary phase (high cell culture density).  If GtaI is part of a quorum sensing system that regulates ctrA in a manner analogous to the Lux system (Miller and Bassler, 2001), this result indicates that GtaI regulates ctrA expression by either repressing ctrA expression at low cell culture densities, or inducing ctrA expression at high cell culture densities (see Sections 3.3.1.1 and 3.3.5 for more details on the role of GtaI and GtaR in ctrA expression).  Under this model, it is possible that this repression or induction is relieved or activated, respectively, by C16-HSL (the signal produced by GtaI) at high cell culture density resulting in increased ctrA transcription.  Therefore, it is also possible that the reduced RcGTA expression in gtaI mutants is due, at least in part, to a decrease in ctrA expression, because CtrA is required for RcGTA expression (Figure 3.5) (Lang and Beatty, 2002).  64   Figure 3.6 Expression of ctrA in R. capsulatus regulatory mutants. All strains contained the p601-17 plasmid (ctrA::lacZ fusion) except for WT(pXCA601) which contained the empty plasmid (pXCA601).  The β-galactosidase specific activities from the ctrA-, cckA-, and gtaI- regulatory mutant strains containing the ctrA::lacZ gene fusion plasmid p601- 17 are shown. 3.2.2 Growth phase and ctrA expression  Previous RNA (northern) blot experiments on the ctrA transcript of cell cultures grown in different culture growth phases showed a rough outline of very low ctrA expression in the mid-log phase, higher in the late-log, and highest in the early stationary phase of growth (Lang, 2000; Lang and Beatty, 2002).  To improve the understanding of ctrA expression during cell culture growth and to validate the ctrA::lacZ approach, I measured β-galactosidase activity in WT, ctrA-, and gtaI- strains containing p601-17 (the ctrA::lacZ fusion, see section 3.2.1, Figure 3.9, and Table 3.3 for more details) over 168 hours (7 days) of cell culture growth in RCV medium under anaerobic photosynthetic conditions.  Samples of these cultures were collected at various time 0 200 400 600 800 1000 1200 1400 1600 WT (p601) WT ctrA- cckA- gtaI- β -g a la c to s id a s e  S p e c if ic  A c ti v it y  ( M il le r u n it s /m g )      WT WT       ctrA-         cckA-         gtaI- (pXCA601)  65  points and assayed for β-galactosidase specific activity as an indication of ctrA::lacZ expression.  In the WT strain, the amount of activity increased from early- to late-log phases of growth, and continued to increase for at least another 30 hours in stationary phase (Figure 3.7).  These results obtained with the plasmid-borne ctrA::lacZ fusion mirrored the results obtained using the northern blot technique (Lang and Beatty, 2000), and therefore supports the idea that the ctrA::lacZ β-galactosidase specific activities parallel the amount of ctrA mRNA in WT cells.  Furthermore, the results showed that ctrA::lacZ expression in WT R. capsulatus cultures increased in stationary phase (the 30 hour time point), plateaus after mid stationary phase (the 48 hour time point), and drops at late stationary phase (after the 144 hour time point) (Figure 3.7).  At the 48 hour time point, there is an increase in activity but no increase in cell culture density relative to the 36 hour time point (Figure 3.7), indicating that at early to mid stationary phase there continued to be an increase in ctrA::lacZ expression or an accumulation of the β- galactosidase fusion protein relative to total protein (see Section 4.1.1 for more discussion on this).  The β-galactosidase specific activities in the ctrA- strain was similar to that of WT over the time course (Figure 3.7), indicating that growth phase-dependent regulation of ctrA expression was not dependent on CtrA under this growth condition.  Activity in the gtaI- strain was ~50% lower than in the WT at all time points except for the first and last time points (Figure 3.7), showing that a functional GtaI system is required for WT level expression of ctrA at all times under these growth conditions.  However, ctrA expression increased as the gtaI- culture progressed from log to stationary phases, analogous to  66  the WT strain.  This indicates that the increase in ctrA expression over the culture growth phases is independent of the GtaI protein, although GtaI is required for full expression of ctrA.  67   Figure 3.7 Expression of ctrA in WT, ctrA-, and gtaI- strains over culture growth phases. Cell culture densities were measured with a Klett-Summerson photometer, and are given on the left Y-axis.  The β-galactosidase specific activities of WT, ctrA-, and gtaI- regulatory mutant strains containing the ctrA::lacZ gene fusion plasmid p601-17 were assessed over culture growth phases, and are given on the right Y-axis.  See Materials and Methods for unit definitions. 3.2.3 Analysis of the ctrA promoter region  Figure 3.8 shows ctrA and its surrounding genes, and Figure 3.9 shows the sequence immediately 5‟ of the ctrA start codon.  The region 5‟ (upstream) of the ctrA start codon was investigated to identify the ctrA promoter and regulatory sequences (Figure 3.9).  The Softberry promoter prediction software BPROM (http://linux1.softberry.com/berry.phtml) was used to find putative -10 and -35 sites  68  (position 1280-1290 and 1261-1265, respectively) in the sequence upstream of the ctrA gene (Figure 3.9).  The 5‟ end of the ctrA transcript (position 1296) was determined by 5‟ RACE (see Materials and Methods) and was found to be consistent with one set of predicted -10 and -35 sites (position 1280-1290 and 1261-1265).  Two inverted repeats named SIR and IRD (short for sinistro inverted repeat and inverted repeat dextro, respectively; nt 1114-1150 and 1169-1198, respectively) were found upstream of the predicted -10 and -35 sites (position 1280-1290 and 1261-1265) and two sequences with similarity to the gapped consensus sequence for C. crescentus CtrA binding (position 1401-1416 and 1439-1454) were found downstream of the predicted -10 and -35 sites (Figure 3.9).   Figure 3.8 Representation of ctrA and surrounding genes.  Arrows represent the direction of transcription.  trmU is predicted to be a tRNA (5-methylaminomethyl-2- thiouridylate)-methyltransferase, rcc01662 is a predicted protein of unknown function and ligA is predicted to be a NAD-dependent DNA ligase.   69  GATCCGCACC GAGACCTCCC GTTCCGGGTG ...(N730).. CGCAGCAGGC GCCCTTTTTC 789  GCCAGGGCCG CGCCATGGTC ATAAAGCTGC AAGGTCACGC CGATGACATC GTAACCTTCC 849  TCCTTCAGCA TGGCGGCCAC CACCGAGCTG TCGACGCCGC CCGACATGGC GACGACCACG 909  CGGGTGTCGG CGGGCGCTTT CGGCAGGCCC CAGCGAATTC AGGGGGAGAT CTTTCGGCAT 969  CGCAACAGTC CTTTAACCAG ACCCGCAGGA ATATAGGAAA ATGCGAACTA CTCTCAACCC 1029  TTGGCTAAAC CCAGCGTTAA GGCCCTCGGC GCATTCTGCC CCCATGAAGA CGAGGGGGTG 1089   AGCCCATGTA TCTGAAAAAA GTGGATGGTC CGCGCGCAGT TACGCTGCCC GACGGGACGA 1149   TTCTGACCCG GGCCGATCTG CCGCCGAAAG AAACGCGTCG TTGGGTGGCG TCGCGCAAGG 1209   CGATCATCGT GCATGCGGTG ACGCATGGTC TGATCGGACG CTCGGAAGTA CTTGAACGTT 1269   ACGGCTTATC GGAGGAAGAA TTCGATATCT GGGCGGAAGC GGTCAAGAAA CACGGCATCG 1329          rcc01662 CAGGGCTGAA AGTGACGGCG ATCCAGAAAT ATCGACAACT TTAAGTTGCA AATGAACGGA 1389   ATCCTGCGAC AGTAACTACG TGTTAACCAT TTGGTGACAA GGTCGAACGT GATCGAGGGA 1449   TTAATGCGGA GAACCCAGGA TGCGGATTTT GTTGGTGGAG GACGACCCGA CGACCTCTCG 1509  Figure 3.9 Sequence 5‟ of the ctrA start codon. In green are start codons, also labeled with the green bent arrow ( ) and the name of the gene name or ORF assignment. Highlighted in bright green are the putative -10 and -35 sites predicted by the Softberry program BPROM (http://linux1.softberry.com/berry.phtml). Highlighted in turquoise are the mRNA 5‟ end mapped by 5‟ RACE. Highlighted in red is the stop codon for rcc01662. The sequences overlined with dashes ( ) are 2 inverted repeats identified eye. Highlighted in yellow are the complementary bp in the inverted repeats. Italicized and underlined are sequences with similarity to the C. crescentus CtrA binding site gapped consensus sequence. Orange arrow indicates the 3‟ end of all ctrA::lacZ fusions. Blue arrows indicate the 5‟ end of the ctrA promoter deletion fusions to lacZ. Note: each arrow is identified with a number that corresponds to the plasmid name (e.g. the arrow number 5 corresponds with plasmid p601-5). Table 3.3 identifies the nt of each element in this figure.  17 15 trmU 13 Rcc01662 SIR inverted repeat 11 11.7 7 IRD inverted repeat 9 5 ctrA 2  70  Table 3.3  Nucleotide positions of proposed elements and regulatory sequences in Figure 3.9.   Element    nt position   notes trmU start codon 906-908 rcc01662 start codon  1073-1075 ctrA start codon 1469-1471 predicted -10 site (BPROM) 1280-1290 and 838-846 predicted -35 site (BPROM)  1261-1265 and 816-821 mRNA 5‟ ends 1296 and 1411 rcc01662 stop codon 1371-1373 SIR 1114-1150 IRD 1169-1198 CtrA gapped binding    1401-1416 and 1439-1454    site-like sequences Orange Arrow #2 1493 3‟ end for all ctrA::lacZ fusions Blue Arrow #17 8 5‟ end for p601-17, p601-SIR,      p601-IRD, and p601-17x Blue Arrow #15 93 5‟ end for p601-15 Blue Arrow #13  900 5‟ end for p601-13 Blue Arrow #11 1100 5‟ end for p601-11 p601-11x Blue Arrow #11.7 1201 5‟ end for p601-11.7 Blue Arrow #9  1243 5‟ end for p601-9 Blue Arrow #7     1354 5‟ end for p601-7 Blue Arrow #5  1428 5‟ end for p601-5   To identify and confirm important sequences in the ctrA promoter region, a series of progressively shorter segments of the sequence 5‟ of ctrA was used to create in- frame translational fusions of ctrA to lacZ, similar to p601-17 (Figure 3.10).  WT cells containing ctrA::lacZ fusion plasmids were grown in RCV medium under photosynthetic anaerobic conditions, collected at early stationary phase, and evaluated for β- galactosidase specific activity as a measure of ctrA::lacZ expression.  WT cells containing p601-17, the longest 5‟ fusion, yielded β-galactosidase specific activities of ~1400 Units (defined in Materials and Methods).  Cells containing p601-15, p601-13, or p601-11 had activities similar to cells containing p601-17 (Figure 3.10).  This indicates that all elements necessary for full ctrA  71  expression in cells grown under these conditions are found in the p601-11 plasmid, which is missing sequences 5‟ of the two inverted repeats SIR and IRD.  Deletion of either the SIR (p601-SIR) or the IRD (p601-IRD) inverted repeats resulted in no significant drop in ctrA expression (Figure 3.10).  This is in contrast to the 65% decrease when both the SIR and IRD inverted repeats were deleted (p601-11.7) (Figure 3.10).  Similarly, cells containing p601-9, the fusion plasmid with sequences 5‟ of the predicted -10 and -35 sites omitted, yielded β-galactosidase specific activities 35% of WT cells containing p601-17 (Figure 3.10).  These results indicate that the SIR and IRD inverted repeats have a modulatory role in ctrA expression. Although the loss of one inverted repeat did not greatly affect expression, the loss of both inverted repeats resulted in a significant reduction of ctrA expression in WT cells.  The similarity in expression from the p601-11.7 and p601-9 plasmids seemingly indicates that the 44 bp sequence difference between these two plasmids (Figure 3.9) has no role in regulating ctrA expression.  However, experiments described in Section 3.3.1.3 indicate otherwise.  Plasmid p601-7 lacks the predicted -10 and -35 sites, and all further 5‟ sequences. The presence of the plasmid p601-7 in WT cells resulted in β-galactosidase specific activities 10% of cells containing p601-17 (Figure 3.10).  Cells containing p601- 5, the fusion plasmid that has only 45 bp 5‟ of the ctrA start codon, have almost no activity (Figure 3.10).  The plasmids p601-17x and p601-11x are identical to the plasmid p601-17 and p601-11, respectively, except for the absence of 226 bp including the predicted -10 and -35 sites (Figure 3.9).  Cells containing p601-17x or p601-11x yielded almost no expression (Figure 3.10).  These results support position 1261 to 1265 as the  72  -10 and 1280 to 1290 as the -35 sites in the ctrA promoter region as shown in Figure 3.9, and indicate that there are no other promoters 5‟ of this promoter.   7 3    Figure 3.10 Expression of ctrA promoter deletions.  On the left are representations of the ctrA::lacZ fusions used to investigate sequences for ctrA expression.  On the right are the β-galactosidase specific activities of WT cells containing each ctrA::lacZ gene fusion plasmid.   74  3.2.4 Environmental factors and ctrA expression 3.2.4.1 Culture growth conditions   Previously it was found that growth conditions affected the intracellular accumulation and release of RcGTA capsid protein (Figure 4.1) (Taylor, 2004), and because CtrA is required for RcGTA expression I wanted to determine whether ctrA expression is affected by culture growth conditions.  The WT strain containing p601-17 (~1.5 kb of sequences 5‟ of ctrA::lacZ) was grown under four different culture growth conditions:  1) in the minimal medium RCV under anaerobic photosynthetic conditions (PS RCV); 2) in the rich medium YPS under anaerobic photosynthetic conditions (PS YPS); 3) in RCV medium under aerobic respiratory conditions (AE RCV); and 4) in YPS medium under aerobic respiratory conditions (AE YPS) (Figure 3.11).  The cells in these cultures were collected at early stationary phase and assayed for β-galactosidase specific activity as a measure of ctrA::lacZ expression.  The results revealed that WT cells grown in RCV medium under anaerobic photosynthetic conditions had ~2.5 times more ctrA::lacZ expression than either cells grown in YPS medium under anaerobic photosynthetic conditions or cells grown in RCV medium under aerobic respiratory conditions.  There was almost 5 times more ctrA::lacZ expression in WT cells grown in RCV medium under anaerobic photosynthetic conditions than in YPS under aerobic respiratory conditions.  These data are consistent with idea that growth conditions modulate ctrA expression.  The growth kinetics of WT strains containing p601-17 grown in the four conditions are shown in Figure 3.12A.  The maximal cell numbers and growth rates of  75  these cultures were roughly, PS YPS > PS RCV > AE YPS > AE RCV.  Under anaerobic photosynthetic conditions, cultures grown in YPS medium had A higher early stationary phase density (Figure 3.12A) but lower ctrA::lacZ expression (Figure 3.11) compared to cells grown in RCV medium.  Cells grown under aerobic respiratory conditions had ctrA::lacZ expression similar to that of cells grown under photosynthetic conditions in YPS medium (Figure 3.11), in spite of differences in early stationary phase cell culture density (Figure 3.12A).  Collectively, these data show that the difference in ctrA::lacZ expression in response to growth condition does not correlate with a difference in cell culture density, or growth rate.  This indicates that the growth condition-associated modulation of ctrA expression is independent of cell culture density and growth rate differences.  Although I previously determined that ctrA is not regulated by CtrA or CckA when cultures are grown in RCV medium under anaerobic photosynthetic conditions (see Section 3.2.1, Figure 3.6), I measured the expression of ctrA::lacZ in ctrA- and cckA- strains grown under the other three conditions used above to determine whether CtrA or CckA has a role in regulating ctrA expression under these different growth conditions. The results show that β-galactosidase specific activities in the ctrA- and cckA- strains grown under all four conditions tested were similar to that of the WT (Figure 3.11), with the exception of the cckA- strain grown under photosynthetic anaerobic conditions in YPS medium when activities were similar to that in RCV medium.  Growth curves of ctrA- and cckA- strains grown under the four conditions were similar to those of the WT strain (Figure 3.12B and Figure 3.12C).  Therefore, it seems that neither CtrA nor CckA  76  were responsible for the changes in ctrA expression found using four standard laboratory growth conditions.  Figure 3.11 Effect of growth condition on ctrA expression in WT, ctrA-, and cckA- strains. The β-galactosidase specific activities of WT, ctrA- and cckA- cells containing p601-17, grown under four different growth conditions: photosynthetic anaerobic conditions in RCV medium (PS RCV), photosynthetic anaerobic conditions in YPS medium (PS YPS), aerobic conditions in RCV medium (AE RCV), and aerobic conditions in YPS medium (AE YPS).   0 200 400 600 800 1,000 1,200 1,400 1,600 WT(p601-17) ctrA-(p601-17) cckA-(p601-17) β -g a la c to s id a s e  S p e c if ic  A c ti v it y  (M il le r u n it s /m g ) PS RCV PS YPS AE RCV AE YPS  WT        ctrA-           cckA-   Figure 3.12 Effect of growth conditions on culture growth rates and final yields of WT, ctrA-, and cckA- strains.  A. WT cell cultures.  B. ctrA- cell cultures.  C. cckA- cell cultures.  In all three strains, the stationary phase culture density is highest when cultures are grown under photosynthetic anaerobic conditions in YPS medium (PS YPS), followed by (in decreasing order) photosynthetic anaerobic conditions in RCV medium (PS RCV), aerobic conditions in YPS medium (AE YPS), and aerobic conditions in RCV medium (AE RCV). 460 513 130 214 1 10 100 1000 0 20 40 C e ll  C u lt u re  D e n s it y  ( K le tt s ) Time (hours) A. WT PS RCV PS YPS AE RCV AE YPS 453 504 114 193 1 10 100 1000 0 20 40 C e ll  C u lt u re  D e n s it y  ( K le tt s ) Time (hours) B. ctrA- PS RCV PS YPS AE RCV AE YPS 438 473 114 175 1 10 100 1000 0 20 40 C e ll  C u lt u re  D e n s it y  ( K le tt s ) Time (hours) C. cckA- PS RCV PS YPS AE RCV AE YPS 7 7   78  3.2.4.2 The ctrA promoter and culture growth conditions  To identify the sequence in the ctrA promoter region important for expression under different growth conditions, WT cells containing the ctrA::lacZ deletion fusions were grown in the four conditions tested in the previous section (Section 3.2.4.1). Cells were collected at early stationary phase and assayed for β-galactosidase specific activity.  Figure 3.13 is a summary of the results, and shows that some error bars are quite large making interpretation difficult.  In general, a similar trend of expression was seen from plasmids p601-17, p601-11, p601-SIR and p601-IRD.  β-galactosidase specific activities were higher when cells were grown under photosynthetic anaerobic conditions in RCV medium than the other three conditions (Figure 3.13), although to a lesser degree with p601-11, p601-SIR and p601-IRD than with p601-17.  Cells containing deletion plasmids shorter than p601-11 (i.e., p601-11.7, p601-9, p601-7, and p601-5) had indistinguishably low β-galactosidase specific activity when grown under all four growth conditions (Figure 3.13).  The deletion plasmids p601-17x, and p601-11x had almost no β-galactosidase specific activity when cells are grown under all four grown conditions because those plasmids lack a promoter.  Comparing the patterns of expression seen with p601-17 and p601-11 with those of p601-11.7 and p601-9 indicates that the 44 bp sequence present in p601-11 and absent in p601-11.7 is responsible for the regulation of ctrA in response to different in growth conditions.  In summary, two general growth condition-mediated regulatory patterns disappear as the sequence 5‟ of the ctrA start codon is truncated: 1) growth under photosynthetic anaerobic conditions results in higher ctrA::lacZ expression than growth  79  under aerobic conditions; and 2) growth in RCV medium results in higher ctrA::lacZ expression than growth in YPS medium.  These patterns are seen when comparing plasmids containing segments larger than in p601-11.7 (p601-17, p601-11, p601-SIR and p601-IRD) to p601-11.7 and plasmids containing segments shorter than in p601- 11.7 (p601-9, p601-7, and p601-5).        8 0    Figure 3.13  Expression of ctrA promoter deletions in WT cells grown under different culture conditions.  On the left are representations of the ctrA::lacZ fusions, and on the right are the β-galactosidase specific activities of the WT strain containing each ctrA::lacZ gene fusion plasmid grown under different conditions.  The four growth conditions tested were: photosynthetic anaerobic in RCV medium (PS RCV), photosynthetic anaerobic in YPS medium (PS YPS), aerobic in RCV medium (AE RCV) and aerobic in YPS medium (AE YPS).   81  3.2.4.3 Effects of nutrient limitation on ctrA expression  To further investigate the effects of growth conditions on the expression of ctrA, WT cells containing the plasmid p60 1-17 (~1.5 kb of sequence 5‟ of ctrA::lacZ) were grown under anaerobic photosynthetic conditions in minimal, defined, RCV-derived media that contained reduced amounts of phosphate, nitrogen, or carbon source (malic acid).  These cultures were collected at early stationary phase and assayed for β- galactosidase specific activity.  Cells grown in N-limited or C-limited RCV media had β-galactosidase specific activities similar to cells grown in RCV medium, whereas cells grown in 1/5 P-limited RCV medium had ~50% decreased activities (Figure 3.14).  The culture density at early stationary phase of cultures grown in N-limited, C-limited, 1/5 P-limited and RCV media was 387, 245, 337 and 470 Klett units, respectively (Figure 3.14).  Cells grown in N- limited, C-limited and P-limited RCV media had lower early stationary phase culture densities but, of these three, only cells grown in the 1/5 P-limited RCV had decreased ctrA::lacZ expression.  This indicates that the decrease in ctrA::lacZ expression was not culture density-dependent, but instead may be due specifically to phosphate limitation.  I also measured the expression of ctrA::lacZ in an RCV-derived medium with double the concentration of malic acid, which also contained double the concentration of phosphate.  The culture density at early stationary phase of cultures grown in this medium was higher than that of cultures grown in RCV medium (Figure 3.14) and β- galactosidase specific activity was decreased to ~60% of cultures grown in RCV medium (Figure 3.14).  This result additionally supports the idea that the nutrient limitation effects on ctrA expression are independent of cell culture density effects.  82   I further tested the phosphate limitation effect by growing cell cultures in RCV- derived media with phosphate concentrations lower than 1/5 (1.92 mM) of that in RCV medium.  Media containing 15 µM and trace phosphate (labeled 1/640 P and trace P, respectively, in Figure 3.14) were buffered with MOPS to ensure that an effect was not a pH effect.  Cultures grown in 1/640 P- and trace P-RCV media had early stationary cell culture densities of 272 and 243 Klett units, respectively.  Cell cultures grown in RCV+MOPS medium had increased β-galactosidase specific activities compared to cultures grown in RCV medium (Figure 3.14), indicating that the decrease in ctrA::lacZ expression seen in cultures grown in the P-limited RCV-derived media (containing MOPS) was not due to the addition of MOPS, but rather a phosphate-specific effect.  The increase in ctrA::lacZ expression in cultures grown in the RCV+MOPS medium indicates a possible pH effect in cultures grown in RCV medium.  As R. capsulatus cultures grow in RCV medium, the pH increases due to the consumption of malic acid.  The addition of MOPS to RCV medium increases the buffering capacity of the medium and the final pH of the culture medium was lower in cultures grown in RCV+MOPS (final pH 7.73 ± 0.02) than RCV medium (final pH 8.70 ± 0.01).  Although no difference is seen in the final stationary phase cell density as measured by light scattering, ctrA::lacZ expression increased by ~50%.  Therefore, it appears that there is a pH effect, such that high pH values in cultures reduce the expression of ctrA::lacZ. Further experiments need to be done to verify this pH effect.  I suggest that phosphate limitation decreases ctrA expression in a pH-independent and culture density- independent manner, and high pH decreases ctrA expression in a culture density- independent manner.               Figure 3.14 Effect of nutrient limitation on ctrA expression and growth in WT cultures.  A. The β-galactosidase specific activities of the WT strain containing p601-17 grown in different RCV-derived media under anaerobic photosynthetic conditions.  B. Growth curve of WT cell cultures grown in nutrient-limited RCV-derived media. The RCV-derived media used were RCV supplemented with MOPS, RCV with 1/5 phosphate (1/5 P), RCV with 1/640 phosphate (1/640 P), RCV with no phosphate (trace P), RCV with 1/3 malic acid (1/3 C), RCV with double the malic acid (2 C), and RCV with 1/2 ammonium (1/2 N).  All P-limited RCV-derived media are supplemented with MOPS (see Materials and Methods for more details). 470 495 337 272 243 245 518 387 1 10 100 1000 0 15 30 45 C u lt u re  D e n s it y  ( K le tt  U n it s ) Time (hours) RCV RCV + MOPS 1/5 P 1/640 P trace P 1/3 C 2 C 1/2 N 0 200 400 600 800 1,000 1,200 1,400 1,600 1,800 RCV RCV + MOPS 1/5 1/640 trace 1/3 2 1/2 β -g a la c to s id a s e  S p e c if ic  A c ti v it y  (M il le r u n it s /m g ) Media A.               B. P           C      N 8 3   84  3.3 GtaI-based and GtaR-based regulation 3.3.1 Regulation of ctrA 3.3.1.1 Expression of ctrA in GtaI and GtaR mutant strains  Schaefer et al. (2002) identified three LuxR-type proteins rcc0028, rcc01088, and rcc01823 (previously called RCC03806, RCC04617, and RCC02401) in R. capsulatus, having 26%, 21% and 23% identity (37%, 31%, and 36% similarity), respectively  to CerR, the R. sphaeroides LuxR-type protein.  R. sphaeroides cerR and R. capsulatus rcc00328 are reciprocal best hits (BLAST), indicating that they are orthologues. rcc00328 was named GtaR because of its high similarity to CerR and its location immediately upstream of the gtaI gene (the gtaI start codon is 49 bp downstream of the rcc00328 stop codon).  In R. sphaeroides, cerR is in located upstream of cerI (separated by 179 bp) and is in the same orientation (Puskas et al., 1997).  Previously, I found that ctrA expression was decreased approximately 50% in the R. capsulatus gtaI- strain compared to the WT strain (see Section 3.2.1), indicating that the C16-HSL made by GtaI is needed for full activation of ctrA transcription.  This gtaI- mutant was made in the SB1003 background by Schaefer et al. (2002).  I made a markerless gtaI- mutant in the B10 background (see Materials and Methods), and found that expression from the plasmid-borne ctrA::lacZ promoter fusion (p601-17) was the same in both the SB1003 and B10 gtaI- mutants.  All experiments hereafter used the gtaI- mutant made in the B10 background.  85   A markerless gtaR- mutant was made in the B10 background (see Materials and Methods) to determine the effect on ctrA expression.  The WT and gtaR- strains containing p601-17 were grown in RCV medium under anaerobic photosynthetic conditions, harvested at early stationary phase, and assayed for β-galactosidase specific activity.  The WT and gtaR- strains had similar β-galactosidase specific activity (Figure 3.15).  Time course experiments using the gtaR- strain revealed that the growth curve and ctrA::lacZ expression in the gtaR- and WT strains were similar (Figure 3.16).  These results were initially surprising.  I expected that the phenotype of the gtaI- and gtaR- strains to be the same, because I expected that the GtaR protein would bind the C16-HSL made by the GtaI protein and function in a similar manner to LuxR in V. fischeri; i.e., I expected that C16-HSL-GtaR would bind DNA to activate expression of the ctrA gene.  There are several possible explanations for the difference between the gtaI- and gtaR- phenotypes: 1) GtaR is not the cognate response regulator to GtaI; 2) the LuxR-type proteins GtaR, rcc01088 and rcc01823 are redundant, and therefore a triple knockout would be required to produce a mutant phenotype; 3) GtaR binds DNA in the absence of signal and directly represses ctrA expression; or 4) GtaR indirectly regulates the ctrA gene.  To determine whether GtaR regulates ctrA expression, I measured β- galactosidase specific activity from p601-17 in a gtaI-/gtaR- double mutant as an indication of ctrA expression.  The gtaI-/gtaR- double mutant strain containing p601-17 was grown in RCV medium under anaerobic photosynthetic conditions, harvested at early stationary phase, and assayed for β-galactosidase specific activity.  The expression of ctrA::lacZ in the gtaI-/gtaR- strain was similar to that of gtaR- and WT  86  strains (Figure 3.15), indicating that GtaR regulates ctrA expression because the gtaR- mutation offsets the effects of the gtaI- mutation.  These results eliminate the possibility that GtaR is redundant, and are compatible with the model that GtaR regulates ctrA transcription, either directly or indirectly, in the same pathway as GtaI (see Figure 4.2 in Section 4.2.2 for a model).  However, it is still possible that GtaR is not the cognate response regulatory to GtaI, but instead GtaR and GtaI function in two separate and opposing systems to modulate ctrA expression.  The simplest models for how the GtaR protein regulates ctrA expression are that, in the absence of C16-HSL, GtaR: 1) binds the ctrA promoter directly to repress ctrA transcription; or 2) activates a repressor or inhibits an activator of ctrA transcription to indirectly inhibit ctrA transcription.  I address these two possibilities using electrophoretic gel mobility shift assay (EMSA) experiments (see Section 3.3.5).   87   Figure 3.15 Expression of ctrA in R. capsulatus GtaI and GtaR mutants.  The β- galactosidase specific activities in gtaI-, gtaR-, and gtaI-/gtaR- regulatory mutant strains containing the ctrA::lacZ gene fusion plasmid p601-17 are shown.  0 200 400 600 800 1,000 1,200 1,400 WT gtaI- gtaR- gtaI-/gtaR- β -g a la c to s id a s e  S p e c if ic  A c ti v it y (M il le r u n it s /m g )             t I-         t -    gtaI-/gtaR-  88   Figure 3.16 Expression of ctrA in WT and gtaR- strains over culture growth phases.  WT and gtaR- cell culture densities were measured with a Klett-Summerson photometer and are given on the left Y-axis. The β-galactosidase specific activities of WT and gtaR- strains containing the ctrA::lacZ gene fusion plasmid p601-17 are given on the right Y- axis.  See Materials and Methods for unit definitions and other details. 3.3.1.2 GtaI-based and GtaR-based regulation of the ctrA promoter  In Section 3.2.3, a series of ctrA promoter deletions was made to evaluate the possible regulatory sequences.  The two inverted repeats (SIR and IRD) and surrounding sequences were found to be important for maximal ctrA expression.  To determine whether these inverted repeats or other sequences in the ctrA promoter region were important for GtaI-based and/or GtaR based regulation, the mutant strains gtaI-, gtaR-, and gtaI-/gtaR- containing the ctrA::lacZ promoter deletion plasmids were grown in RCV medium under anaerobic photosynthetic conditions, collected at early stationary phase, and evaluated for β-galactosidase specific activity (note that the  89  gtaI-/gtaR- mutant was not tested for β-galactosidase specific activity from the ctrA promoter deletion plasmids p601- 5, p601-7, p601-9, p601-11, p601-11x, and p601- 17x).  As expected, the ctrA promoter deletions that lack the putative -10 and -35 sites (p601- 5, p601-7, p601-11x, and p601-17x) had essentially no expression in the WT, gtaI-, and gtaR- strains (Figure 3.17).  Expression from the plasmids p601-11 and p601- SIR were similar to p601-17, with activity in gtaI- less than 30% that of WT, gtaR- and gtaI-/gtaR- (expression from p601-11 was not tested in the gtaI-/gtaR- strain) (Figure 3.17).  This indicates that p601-11 and p601-SIR contain all the regulatory sequences required for regulation of ctrA expression by the GtaI and GtaR in addition to those required for regulation by growth conditions (see Section 3.2.4.1).  In general, a common trend was seen in all the ctrA promoter deletion plasmids containing the putative -10 and -35 sites, where β-galactosidase specific activities were similar in WT, gtaR- and gtaI-/gtaR- strains, and decreased in the gtaI- strain (Figure 3.17).  The plasmids p601-IRD and p601-11.17 were the exceptions to this pattern, with increased expression in the gtaR- and gtaI-/gtaR- strains compared to expression in the WT strain.  Expression from p601-IRD, which contains the predicted -10 and -35 sites but lacks the IRD inverted repeat, was decreased by ~50% in the gtaI- strain and increased by ~50% in the gtaR- and gtaI-/gtaR- strains, compared to the WT strain (Figure 3.17).  Expression from p601-11.7, which lacks the IRD inverted repeat and all sequences upstream of it, was decreased by ~50% in the gtaI- strain and increased by ~100% in the gtaR- and gtaI-/gtaR- strains, compared to the WT strain (Figure 3.17). These results indicate that the IRD inverted repeat is involved in repression of ctrA expression, because its absence resulted in an increase in expression from the p601-  90  IRD and p601-11.7 plasmids in strains lacking GtaR.  This increase in expression was seen only in the gtaR- and gtaI-/gtaR- strains, indicating that repression of ctrA expression involving the IRD inverted repeat is minor compared to the effects of GtaR. It is possible that the repression involving the IRD inverted repeat is one of several overlapping types of modulation of ctrA expression.  All deletion plasmids containing the predicted -10 and -35 sites had lower expression in the gtaI- strain than the WT strain, with decreases ranging from 52% to 84%.  Therefore, the sequences involved in GtaI-based regulation of ctrA expression is found within p601-9, the shortest deletion plasmid to contain the predicted -10 and -35 sites.  The ctrA promoter deletion fusion p601-9 is similar to p601-11.7 because it contains the predicted -10 and -35 sequences, but lacks the inverted repeat IRD and all sequences upstream of it.  However, p601-9 lacks an additional 44 bp sequence that is present in the p601-11.7 plasmid (Figure 3.9).  The expression from p601-9 was decreased in all strains tested, compared to the longer deletion plasmids (p601-17, p601-11, p601-SIR, and p601-IRD), although it still contained the predicted promoter. It was also still affected by loss of GtaI since expression was ~4 fold lower in the gtaI- strain compared to the WT strain (Figure 3.17).  The IRD and SIR inverted repeats are likely not involved in the GtaI-based regulation of ctrA expression because there was still a decrease in expression from the plasmids p601-11.7 and p601-9 (both lack the IRD and SIR inverted repeats) in the gtaI- strain compared to the WT strain.  Instead, the sequences involved in the decrease of ctrA expression in the gtaI- strain appear to be located between the 5‟ endpoint of p601-9 and the transcriptional start site.  91   The increase in expression from the p601-IRD and p601-11.7 plasmids in the gtaR- and gtaI-/gtaR- strains compared to the WT strain was not seen with the p601-9 plasmid (Figure 3.17), indicating that the 44 bp sequence 3‟ of the IRD inverted repeat may be involved in the loss of repression of ctrA expression.  This up-regulation was not seen unless the IRD inverted repeat in the ctrA::lacZ fusion and the chromosomal gtaR gene were deleted, indicating that the regulatory effects of GtaR and the IRD inverted repeat masked the up-regulation of ctrA expression involving the 44 bp sequence 3‟ of the IRD inverted repeat.  This masking effect was seen in the WT strain and any strains containing p601-17, p601-11 or p601-SIR.  The decrease in expression in the gtaR strain containing p601-9, compared to p601-11.7 (Figure 3.17), was not due to the inability of RNA polymerase to bind the -35 site because there was no difference in expression between p601-9 and p601-11.7 in WT the strain.  The expression of ctrA is likely determined by the cumulative regulatory affects of several regulatory systems, including those involving the IRD inverted repeat, the 44 bp sequence 3‟ of the IRD inverted repeat, and the GtaI and GtaR proteins.  9 2   Figure 3.17  Expression of ctrA promoter deletions in R. capsulatus quorum sensing mutants. On the left are representations of the ctrA::lacZ fusions, and on the right are the β-galactosidase  specific activities of WT, gtaI-, gtaR-, and gtaI-/gtaR- strains containing each ctrA::lacZ gene fusion plasmid grown under photosynthetic anaerobic conditions in RCV medium.   93  3.3.1.3 Expression of ctrA in GtaI and GtaR mutants grown under four different growth conditions  GtaI and GtaR have not been shown to function in the same quorum sensing system, but they are hom ologous to CerI and CerR (the LuxI-type and LuxR-type proteins in R. sphaeroides), respectively.  Quorum sensing systems are often part of regulatory hierarchies (Fuqua et al., 1996).  For example, in V. fisheri the activation of luxR requires both the LuxR protein and cyclic-AMP receptor protein with cAMP (CRP- cAMP) (Dunlap and Greenberg, 1988).  To determine if the GtaI-based and GtaR-based regulation of ctrA expression is affected by different growth conditions, the WT, gtaI-, gtaR-, and gtaI-/gtaR- strains containing p601-17 (the full length ctrA::lacZ promoter fusion) were grown under the four growth conditions tested in Section 3.2.4.1.  These conditions were: 1) in RCV medium under anaerobic photosynthetic conditions; 2) in YPS medium under anaerobic photosynthetic conditions; 3) in RCV medium under aerobic respiratory conditions; and 4) in YPS medium under aerobic respiratory conditions.  Samples were collected at early stationary phase and evaluated for β- galactosidase specific activity as a measure of ctrA expression.  As shown in Figure 3.18 the WT, gtaR-, and gtaI-/gtaR- strains had similar ctrA::lacZ expression when grown under each condition.  The highest β-galactosidase specific activity was observed in cultures grown in RCV medium under photosynthetic anaerobic conditions.  The expression of ctrA::lacZ in the gtaI- strain was similar to that of the WT, gtaR-, and gtaI-/gtaR- strains in all growth conditions, except for in RCV medium under photosynthetic conditions, which resulted in decreased ctrA::lacZ expression in the gtaI- strain compared to the other strains.  This indicates that GtaI-  94  based regulation of ctrA is affected by growth under photosynthetic conditions.  Two possible interpretations of these results are that: 1) GtaI-based up-regulation of ctrA expression only functions when cells are grown in RCV medium under photosynthetic anaerobic conditions (out of the conditions tested), or 2) GtaI-based up-regulation of ctrA expression is minor compared to the down-regulation of ctrA expression caused by growth of cells in conditions other than RCV medium under photosynthetic anaerobic conditions (out of the conditions tested).  It is likely that integration of the multiple regulatory systems involved in modifying ctrA expression in response to multiple conditions and signals is complex.  Of the four growth conditions tested, GtaI-based regulation of ctrA expression is present only in cells grown in RCV medium under photosynthetic conditions, and GtaR-based regulation ctrA expression is not affected by growth conditions.   95   Figure 3.18 Effect of culture growth conditions on ctrA expression in GtaI and GtaR mutants.  The β-galactosidase specific activities of WT, gtaI-, gtaR-, and gtaI-/gtaR- strains containing p601-17 grown under four different growth conditions: photosynthetic anaerobic conditions in RCV medium (PS RCV), photosynthetic anaerobic conditions in YPS medium (PS YPS), aerobic conditions in RCV medium (AE RCV), and aerobic conditions in YPS medium (AE YPS). 3.3.2 Autoregulation of gtaR  Many quorum sensing proteins are autoregulatory at the transcriptional level.  I wanted to determine whether the expression of gtaR was regulated by GtaI and/or GtaR.  The plasmid p601-2R contains an in-frame translational fusion between the 9th codon of the gtaR gene and the 8th codon of the E. coli lacZ gene, with ~1.1 kb of sequences 5‟ of the gtaR gene present.  The WT, gtaI-, gtaR-, and gtaI-/gtaR- R. capsulatus strains containing p601-P2R were grown in RCV medium under anaerobic photosynthetic conditions, harvested at early stationary phase, and evaluated for β- galactosidase specific activity.  As shown in Figure 3.19, gtaR expression was modestly 0 200 400 600 800 1,000 1,200 1,400 WT gtaI- gtaR- gtaI-/gtaR- β -g a la c to s id a s e S p e c if ic   A c ti v it y (M il le r u n it s /m g ) PS RCV PS YPS AE RCV AE YPS           -    gtaR-      gtaI-/gtaR-  96  lower in the gtaI- strain and unchanged in the gtaR- and gtaI-/gtaR- strains compared to the WT strain.  This is similar to the expression profile of ctrA in the GtaI and GtaR mutant strains (Figure 3.15), and is consistent with the possibility that gtaR is regulated by a GtaI/GtaR quorum sensing system, where GtaR is a response regulator cognate to the signal produced by GtaI (see Figure 4.2 in Discussion Section 4.2.2).  Alternatively, GtaI and GtaR may function in two separate and opposing systems to modulate gtaR expression. It is possible that gtaR and gtaI are expressed as a single operon because the gtaI start codon is 49 bp downstream of the gtaR stop codon.  Typical intergenic regions in operons are less than 20 bp in length (Moreno-Hagelsieb and Collado-Vides, 2002; Price et al., 2006), but some are larger than 20 bp (Salgado et al., 2000) and the RcGTA gene cluster has “inter-ORF” regions ranging from 1-246 bp in length (Lang, 2000).   97  0 20 40 60 80 100 120 140 WT gtaI- gtaR- gtaI-/gtaR- β -g a la c to s id a s e  S p e c if ic  A c ti v it y  ( M il le r u n it s /m g )  Figure 3.19 Expression of gtaR in R. capsulatus GtaI and GtaR mutants.  All strains contained the gtaR::lacZ gene fusion plasmid, p601-P2R.  The β-galactosidase specific activities of WT, gtaI-, gtaR- and gtaI-/gtaR- strains are shown. 3.3.3 Location of the gtaR promoter  Two ATGs (position 1055-1058 and 1157-1159 in Figure 3.20) were identified as possible start codons for the gtaR gene.  One ATG is 102 bp upstream of the other ATG and they are in are in the same reading frame (Figure 3.20).  There were no obvious Shine Dalgarno sequences upstream of either ATG. To determine if either of the two putative start codons could function as a start codon, two in-frame gtaR::lacZ fusions were created.  The plasmid p601-P1R contains the fusion to the upstream putative start codon and plasmid p601-P2R contains the fusion to the downstream putative start codon, with ~1 kb of sequence 5‟ of each putative start codons.  The WT strain containing each of these plasmids was grown in RCV medium under anaerobic photosynthetic conditions, harvested at early stationary phase, and evaluated for β-                gtaI-            gtaR-         gtaI-/gtaR-  98  galactosidase specific activity.  The β-galactosidase specific activity from p601-P1R was low compared to expression from p601-P2R (Figure 3.21), which is consistent with the assignment of downstream putative start codon (position 1157-1159 in Figure 3.20) as the actual start codon for gtaR.  Analysis of the gtaR upstream region using the BPROM program from Softberry (http://linux1.softberry.com/berry.phtml) identified three predicted -10 and -35 sites upstream of the gtaR gene. The 3‟-most predicted -10 and -35 sites (position 681-689 and 661-666, respectively in Figure 3.20) are within 134 bp of the gtaR start codon, the middle sites are within 230 bp of the start codon (position 946-955 and 925-930 respectively in Figure 3.20), and the 5‟-most sites are located 494 bp from the gtaR start codon (position 1043-1051 and 1021-1026, respectively in Figure 3.20).  The 5‟-most predicted -10 and -35 sites (position 1043-1051 and 1021-1026 in Figure 3.20) were found within the rplQ homologue (the ribosomal L17 protein, rcc00327), which is upstream of and in the same transcriptional orientation as gtaR.  To identify potential GtaR binding sites, the gtaR promoter region was scanned for a lux box using the sequence alignment software Multalin version 5.4.1 (Corpet, 1988) and the lux box sequence (ACCTGTAGGA TCGTACAGGT) (Fuqua et al., 1994; Horng et al., 2002). Two potential GtaR binding sites were found: one overlapping the 3‟-most predicted -10 site (position 628-648), and one upstream of the 5‟-most predicted -35 site (position 1037-1058) (Figure 3.20). The conservation between the lux box sequence identified by Fuqua et al. (1994) and these sequences was low: 10 of 20 nt conserved in the upstream (position 628-648 in Figure 3.20) and 13 of 20 nt in the downstream (position 1037-1058 in Figure 3.20) potential GtaR binding sites.  However, the lux box  99  consensus sequence (NRCTGSRXYASRNYNCAGYN, where N = A, T, G, or C; X = N or gap; R = A or G; Y = T or C; and S = C or G) identified by Horng et al. (2009) indicates that that lux box sequences are not generally well conserved. The conservation between the non-degenerate sequences in the lux box consensus sequence and the upstream (position 628-648) and downstream (position 1037-1058) potential GtaR binding site sequences were 4 of 8 nt and 7 of 8 nt, respectively.  This indicates that if GtaR binds the gtaR promoter, it is more likely to bind the downstream than the upstream potential GtaR binding site.  A series of gtaR::lacZ promoter deletion fusions was made, similar to p601-P2R but with decreasing amounts of 5‟ sequence, to identify regulatory sequences in the gtaR promoter.  The plasmid p601-P2R contains 1093 bp 5‟ of the gtaR start codon, p601-25 contains 595 bp, and p601-23 contains 290 bp of sequence 5‟ of the gtaR start codon.  The strain containing p601-P2R, p601-P25, or p601-P23 were grown in RCV medium under anaerobic photosynthetic conditions, harvested at early stationary phase, and assayed for β-galactosidase specific activity.  I found that activity from p601-P25 was the same as that from p601-P2R (Figure 3.21) indicating that under these growth conditions p601-P25 contains all sequences required for gtaR expression.  The activity from p601-P23 was ~40% of p601-P2R and p601-P25 (Figure 3.21), indicating that p601-P25 contains sequences important for gtaR expression that are missing from p601-P23.  These sequences include the 5‟-most predicted -10 and -35 sites, as well as the 5‟-most predicted lux box (Figure 3.20).   100  CGGAATCGGC CTCGAAGACC GATGCCGACG ACGGGCTCGA GTTCAACCCG CTGCTGCTGA 69  AGAAAGTGGA CGAGCTGGAA CTGTCGGTCC ...(N190).. TCTGGCCAAG CGCTTCGAAG 309  rpoA ACCAGTTCTG AAAACGTCCG GGGGGTGGGT GACCGCCCCC CGAAAATGCC CGGACTTCCG 369  GGGAACCCTG GGCATGATGC CCCAACGAAG CCCCCCGCAC GCACGGGGCG CAACACAAAG 429  CAAAACGACC TTAGGAGAGA CCCATGCGTC ACGCCCGCGG CTACCGCCGT CTGAACCGTA 489  CCCACGAACA CCGCAAGGCG CTGTTCGCCA ACATGTGCGG CTCGCTCATC GAACACGAAC 549  AGATCAAGAC CACCCTGCCG AAAGCCAAGG AACTGCGTCC GATCATCGAA AAGCTGATCA 609  CGCTGGCCAA GCGCGGCGAC CTGCATGCCC GTTGTCAGGC GGCGGCGATG CTTGAAGCAG 669  GACAAGGACG TGGCCAAGCT TTTCGACGTG CTCGGGCCCC GCTACAAGGA CCGTCAGGGC 729  GGCTACACCC GCGTCCTGAA AGCCGGTTTC CGCTATGGCG ACATGGCGCC GATGGCCTTC 789  ATCGAATTCG TCGAGCGCGA CGTTTCGGCG AAGGGCGCGG CTGACAAGGC CCGTGAAGCG 849       rplQ GCTTTCGAAG CGGCCGACGA ATAAGCTTTC CGCAAGGGAA GCCGGAAGCC CGCCCCTCGG 909  GGCGGGTTTT CGTTTTTGCG GGCGGCGCAA CCGCAGGGCG AGACTTGGCG GCAATCTGCC 969  CGTAATGGCG CCGATTTCAG CAAAAACCAC CCCGCCGGAG GCAATTCCCG GTTGATCTTT 1029  TCCGGTGGCA CCTGTCTAAA AAGACATGTC CATACACACC GAAATCAACA AGTGTCTGCG 1089   GGAAATCGGT CGCGTCGCGA CGGATGGCTA TTTCATCGGC CTGCATATCC GTTTCGCCGC 1149   CCCGATCATG CAATTCCAGA CCTATCCCGA GGCGTGGACA GATCACTACA CCCGGCAGGC 1209   Figure 3.20 Sequence 5‟ of the gtaR start codon. In green are start codons, also labeled with the green bent arrow ( ) and the name of the gene or ORF assignment. Highlighted in yellow is a putative upstream start codon for gtaR. Highlighted in green are the putative -10 and -35 sites predicted by the Softberry program BPROM. Highlighted in red are the rpoA and rplQ stop codons as labeled. In fuchsia and underlined are putative lux boxes predicted by Multalin (Corpet, 1988). Orange arrows indicate the 3‟ end of gtaR::lacZ fusions. Blue arrows indicate the 5‟ end of the gtaR promoter deletion fusions to lacZ. Note: each arrow is identified with a number that corresponds to the plasmid name (e.g., the clone containing the sequence between the blue arrow labeled “R” and the orange arrow labeled 2.1 is called p601-P1R). Table 3.4 identifies the nt of each element in this figure. rplQ 3 5 R 2.1 2.2 gtaR  101   Table 3.4  Nucleotide positions of elements and proposed regulatory sequences in Figure 3.20.   Element   nt position    notes rplQ start codon    453-455 gtaR start codon        1157-1159 putative gtaR start codon   1055-1058 predicted -10 site (BPROM)  681-689, 946-955, 1043-1051 predicted -35 site (BPROM)   661-666, 925-930, 1021-1026 rpoA stop codon    318-320 rplQ stop codon    868-870 putative lux boxes    628-648 and 1037-1058 Orange Arrow #2.1        1069    3‟ end of p601-P1R Orange Arrow #2.2        1183    3‟ end of p601-P2R,            p601-P25, and p601-P23 Blue Arrow #R        61    5‟ end of p601- P1R and            p601-P2R Blue Arrow #5        569    5‟ end of p601- P25 Blue Arrow #3         865    5‟ end of p601- P23   102   Figure 3.21 Expression of gtaR promoter deletions.  On the left are representations of the gtaR::lacZ fusions used to investigate sequences for gtaR expression.  The green boxes represent the -10 and -35 sites predicted by the Softberry software BPROM (http://linux1.softberry.com/berry.phtml), whereas the purple boxes represent putative lux boxes predicted by the Multilan software (Corpet, 1988).  On the right are the β- galactosidase specific activities of WT cells containing each gtaR::lacZ gene fusion plasmid. 3.3.3.1 The effect of growth conditions on gtaR expression  Previously it was found that culture conditions had opposite effects on ctrA and orfg1 expression.  Growth in RCV medium under photosynthetic anaerobic conditions resulted in the lowest orfg1 expression and highest ctrA expression compared to the other growth conditions tested (Figure 3.4 and Figure 3.11).  Since GtaR regulates both ctrA and orfg1 expression, it was possible that the growth condition effects were due to growth condition effects on gtaR expression.  To determine whether gtaR gene expression was affected by culture conditions, the WT strain containing the plasmid-  103  borne gtaR::lacZ promoter fusion (p601-P2R) was grown under four different growth conditions (the same four conditions tested in Section 3.2.4.1), harvested at early stationary phase, and evaluated for β-galactosidase specific activity.  These growth conditions were: 1) in the minimal medium RCV under anaerobic photosynthetic conditions; 2) in the rich medium YPS under anaerobic photosynthetic conditions; 3) in RCV medium under aerobic respiratory conditions; and 4) in YPS medium under aerobic respiratory conditions.  As shown in Figure 3.22, the β-galactosidase specific activities of WT cells containing p601-P2R were similar in all four growth conditions.  Cells grown in YPS medium under aerobic conditions had slightly lower activities.  This indicates that gtaR expression was not greatly affected by the growth conditions tested.  Figure 3.22 Effect of growth condition on gtaR expression.  The β-galactosidase specific activities of the WT strain containing p601-P2R grown under four different growth conditions: photosynthetic anaerobic conditions in RCV medium (PS RCV); photosynthetic anaerobic conditions in YPS medium (PS YPS); aerobic conditions in RCV medium (AE RCV); and aerobic conditions in YPS medium (AE YPS). 0 20 40 60 80 100 120 140 PS RCV PS YPS AE RCV AE YPS β -g a la c to s id a s e  S p e c if ic  A c ti v it y  ( M il le r u n it s /m g )  104  3.3.4 Purification of the 6 x His-tagged GtaR protein  For the EMSA and footprinting experiments, the gene encoding the 6 x His- tagged GtaR protein was cloned into an E. coli overexpression plasmid and the protein purified using a Ni-NTA column (see Materials and Methods).  Figure 3.23 is a picture of the SDS PAGE used to assess each step of the purification.  The molecular mass of GtaR was predicted to be 23 kDa using the gtaR start and stop codons predicted by Mercer et al. (2010, In press) and the software ProteinCalculator v3.3 (http://www.scripps.edu/~cdputnam/protcalc.html).  The SDS PAGE reveals a prominent band of ~23 kDa in size at all steps of purification.  The band seen below the 23 kDa band (in elution 2-4) may represent a degradation product of the 6 x His-tagged GtaR protein.  This smaller band was more prominent in previous purifications, which did not include protease inhibitors in the buffers used for protein purification.  However, I estimate this presumed degradation product to be less than 5%, and suggest that this method yields a protein sample consisting of more than 95% of the 6 x His-tagged GtaR.  The 6 x His-tagged GtaR protein in lane 12 in Figure 3.23 appeared to be the most pure and was used for all ESMA and footprinting experiments.  The protein concentration of elution 5 was measured by Lowry assay to be 3.0 mg/ml (127 µM).   105    Figure 3.23 SDS PAGE of 6 x His-tagged GtaR protein purification (Ni-NTA column). Equal volumes of sample from each purification step were loaded onto the gel.  The pellets (lane 1 and 3) were resuspended in lysis buffer prior to SDS PAGE.  Each lane represent the following steps: the pellet and supernatant fluid after the first centrifugation of lysed cells, lane 1 and 2, respectively; the pellet and supernatant fluid after the second centrifugation of lysed cells, lane 3 and 4, respectively; flow through from binding of 6 x His-tagged GtaR to Ni-NTA column, lane 5; Novex® Sharp Prestained Protein ladder  (Invitrogen), lane 6; wash 1, lane 7; wash 2, lane 8; wash 3, lane 9; elution 1, lane 10; elution 2, lane 11; elution 3, lane 12; elution 4, lane 13; elution 5, lane 14; and the final elution, lane 15.  The numbers in lane 6 identify the mass of standard protein in the ladder in kDa.  See Materials and Methods for more details. 3.3.5 GtaR-DNA binding  The expression of the RcGTA gene cluster, the ctrA gene and the gtaR gene were found to be modulated by GtaI and GtaR.  To gain additional data on whether this was direct or indirect regulation by GtaR, electrophoretic mobility shift assays (EMSAs) were used to test GtaR-DNA binding.  These EMSAs were done using a 6 x His-tagged GtaR as the binding protein, and PCR amplicons of the gtaR, ctrA or the RcGTA orfg1 promoter regions as DNA targets.  All in vitro protein work used a 6 x His-tagged GtaR protein, which for simplicity will hereafter be referred to as the GtaR protein. 100 nM of washes 30 20 15 1    2    3     4    5    6    7    8    9   10   11 12  13  14  15 elutions  106  DNA was used in each EMSA with GtaR protein concentrations ranging from 0 to 1.44 µM unless otherwise stated. 3.3.5.1 GtaR binds the gtaR promoter  Previously, I showed that GtaR regulates gtaR expression (see Section 3.3.2). To assess if this regulation is direct or indirect, EMSAs were performed using the GtaR protein and the gtaR promoter region as target DNA.  In total, 1145 bp of sequence, including 1106 bp of sequence 5‟ of the gtaR start codon and 39 bp of the gtaR gene, were used to test binding of GtaR to the gtaR promoter region.  The approach was to divide this 1145 bp region into shorter fragments to locate the GtaR binding sequences, as shown in Figure 3.24.  EMSAs of the 638 bp fragment of the gtaR promoter (position 558 to 1196 in Figure 3.20), which had a 3‟ end 15 bp into the gtaR coding region showed a band with altered mobility, when GtaR protein concentrations were 90 nM or higher (with 100 nM of DNA target) (Figure 3.24).  The proportion of shifted to non-shifted DNA increased with increased GtaR protein concentration, and 100% of the DNA is shifted at 1.44 µM of GtaR.  When the 507 bp fragment (position 51 to 558 in Figure 3.20) was tested for GtaR binding, none was found (Figure 3.24).  The GtaR binding site in the gtaR promoter region was further delineated using EMSAs of the 345 bp, 245 bp, 800 bp, and 986 bp fragments (corresponding to position 851 to 1196, 751 to 1196, 51 to 851, and 51 to 1037 in Figure 3.20, respectively).  At 90 nM or higher of GtaR, EMSAs of the 345 bp and 245 bp fragments each showed one retarded band (Figure 3.24), which could represent the GtaR-DNA complexes.  Similar  107  to the EMSAs of the 638 bp fragment, the proportion of shifted to non-shifted DNA increased with GtaR protein concentrations and 100% of the DNA was shifted at 1.44 µM of GtaR (Figure 3.24).  No shifts were seen in the EMSAs of the 800 bp and 986 bp fragments (Figure 3.24).  To determine the specificity of GtaR binding to the gtaR promoter region, EMSAs of the 345 bp fragment of the gtaR promoter region were done with the addition 100 nM of a ~210 bp nonspecific competitor DNA, resulting in a 1:1 ratio of specific to non- specific DNA.  This competitor DNA fragment was constructed by PCR using the oligonucleotides -21M13F and M200R as the primers, and the pUC19 plasmid as template DNA.  Figure 3.24 shows that the non-specific DNA was not bound at any tested concentration of GtaR.  The EMSAs of the 345 bp fragment with and without competitor DNA showed similar results, with proportions of bound to unbound DNA increasing with increased GtaR protein concentrations (Figure 3.24 and Figure 3.25). These results show that the binding of GtaR to the gtaR promoter region is specific.  In LuxR-type proteins, the binding of the signal changes the protein‟s affinity for DNA.  CarR, the LuxR-type protein in Erwinia carotovora, binds to its target DNA in the absence of the signal molecule, N-(3-oxohexanoyl)-L-HSL (Welch et al., 2000).  In the presence of sufficient N-(3-oxohexanoyl)-L-HSL concentrations, the affinity of CarR decreases and CarR does not bind DNA (Welch et al., 2000).  I thought that GtaI and GtaR might function in the same pathway to form a quorum sensing system because of their similarity to CerI and CerR (LuxI-type and LuxR-type protein in R. sphaeroides), respectively, and the close proximity of the gtaI and gtaR genes (Schaefer et al., 2002). GtaI is involved in the production of C16-HSL in R. capsulatus, and it is possible that  108  GtaR is the cognate response regulator to this signal.  I showed that GtaR can bind the gtaR promoter in the absence of C16-HSL in vitro and I wanted to determine if the presence of C16-HSL would result in GtaR releasing DNA.  EMSAs using 100 nM of the 638 bp and 345 bp fragments were done using 360 nM and 720 nM of GtaR in the presence of 0 to 960 nM C16-HSL (data not shown).  The C16-HSL (supplied by A. Schaefer) was either added directly to the GtaR-DNA binding reaction or pre-incubated with the GtaR protein prior to the DNA binding reaction.  No differences were found in the EMSAs performed in the presence or absence of C16-HSL (data not shown).  There are several possible explanations for this, which will be discussed in the Discussion Section (Section 4.2.2).   1 0 9    Figure 3.24 Binding of the GtaR protein to the gtaR promoter region.  On the left and right are EMSAs and in the middle are representations of the DNA fragments used for the assays, adjacent to the corresponding EMSAs.  The green boxes are -10 and -35 sites predicted by Softberry and the purple boxes are lux boxes predicted by Multalin. The size of DNA fragments used is shown.   110   Figure 3.25 Binding of GtaR to gtaR promoter region in the presence of non-specific competitor DNA. The 345 bp fragment of the gtaR promoter was used as the target DNA and the 210 bp M1 DNA fragment was used as non-specific competitor DNA in these EMSAs.  A partial shift in the target DNA band is seen at 180 nM of GtaR protein and a complete band shift is seen at 720 nM of GtaR protein.  There is no shift seen in the competitor band at any concentration of GtaR protein tested.  3.3.5.2 GtaR does not bind the ctrA or the RcGTA gene cluster promoter  EMSAs were performed using the ctrA or orfg1 regulatory regions as DNA targets, to determine if GtaR can bind these sequences.  There is one predicted lux box in the orfg1 promoter region (Figure 3.1) but none in the ctrA promoter region (Figure 3.9).  The ctrA and orfg1 promoter regions were amplified by PCR resulting in the 350 bp and 650 bp DNA fragments, respectively.  The EMSAs of the ctrA and orfg1 promoter regions with the GtaR protein are shown in Figure 3.27 and Figure 3.26, respectively. The 350 bp and 650 bp bands represent the unbound form of the ctrA and orfg1 promoter region amplicons, respectively (Figure 3.26 and Figure 3.27).  There was no retardation of either the ctrA or orfg1 promoter DNA bands even in the presence  111  of the highest GtaR protein concentrations tested (1.44 µM).  However, at concentrations of 1.44 µM GtaR protein, EMSAs of the ctrA and orfg1 promoter region showed some smearing (Figure 3.26 and Figure 3.27), which could be due to nonspecific binding of the GtaR protein to DNA.  The lack of a retarded band, which would represents a GtaR-DNA complex, in the ctrA and orfg1 promoter region EMSAs raises the possibilities that GtaR either: 1) does not bind the ctrA and orfg1 promoter regions, and instead indirectly regulates these two genes, or 2) that binding to these two promoters requires C16-HSL or some other signal.  To determine if GtaR requires C16-HSL to bind the ctrA and orfg1 promoter region DNA, EMSAs using the ctrA and orfg1 promoters in the presence of C16-HSL were done using two methods (data not shown): 1) pre-incubating the GtaR protein with C16-HSL prior to the GtaR-DNA binding reaction; or 2) adding C16-HSL directly to the GtaR-DNA binding reaction.  Neither method resulted in retardation of the ctrA and orfg1 DNA fragments (data not shown). These results indicate either that: 1) GtaR does not bind the ctrA and orfg1 regulatory region, 2) GtaR does bind the ctrA and orfg1 regulatory region but requires a signal other than C16-HSL, or 3) that C16-HSL was not successful in binding the GtaR protein to cause the GtaR protein to bind DNA in vitro.   112    Figure 3.26 EMSA using the GTA gene cluster promoter region and the GtaR protein. A. Representation of orfg2, orfg1 and sequences 5‟ of it.  The green boxes are -10 and -35 sites predicted by BPROM (http://linux1.softberry.com/berry.phtml) and the blue dot is the transcript 5‟ end identified by 5‟ RACE.  Contained in the red box is the DNA fragment used for EMSA.  B.  The EMSAs were performed as described in Materials and Methods using the GtaR protein and the region upstream of orfg1 as the DNA target.                  A. B.  113    Figure 3.27 EMSA using the ctrA and the GtaR protein. A. Representation of the ctrA gene and sequences 5‟ of it.  The double ended red arrows are inverted repeats, the green boxes are -10 and -35 sites predicted by BPROM (http://linux1.softberry.com/berry.phtml) and the blue dot is the ctrA transcript 5‟ end identified by 5‟ RACE.  Contained in the red box is the DNA fragment used for EMSA. B.  The EMSA was performed as described in Materials and Methods using the GtaR protein and the ctrA promoter region as the DNA target. 3.3.5.3 GtaR binding sequence  To identify the GtaR binding sequence, a footprinting assay of GtaR was done using the 245 bp fragment of the gtaR promoter region (shown in Figure 3.24).  32P-5‟- end-labeled primers were used to amplify the 245 bp fragment in two different PCRs. This resulted in two types of 245 bp fragments, one that was labeled on one strand at the upstream end, and one that was labeled on the other strand at the downstream end. In separate experiments, GtaR was bound to each of these labeled fragments and the mixture exposed to DNase I. A. B.  114   The results showed three adjacent protected regions separated by three hypersensitive sites (Figure 3.28).  Such hypersensitive sites are indicative of bending of the DNA by GtaR binding.  The protected regions overlap the 5‟-most predicted lux box and the 5‟-most predicted -35 site in the gtaR promoter region (Figure 3.28 and see Figure 4.4 for position of protected regions and hypersensitive sites in the gtaR promoter region).  These protected regions and hypersensitive sites are shifted by ~3 bp on each strand, indicating that GtaR binds DNA in the minor groove (Suck et al., 1988; Travers, 1989).  The three GtaR protected sites were confirmed by EMSAs using a series of DNA fragments that were constructed by PCR using 5‟ primers that made successively larger deletions of 5‟ sequences from the 245 bp fragment of the gtaR promoter (Figure 3.29). The 186 bp amplicon, named DR9, contains the 3‟-most predicted lux box and the 3‟- most predicted -10 and -35 sites.  ESMAs of DR9 showed a retarded band when 90 nM or more GtaR protein were used (Figure 3.29).  The proportion of bound to unbound DNA increased with GtaR protein concentration.  This is similar to the EMSAs of the 245 bp fragment (Figure 3.24), indicating that the GtaR binding sequences are found within the 186 bp fragment.  The 160 bp amplicon, named DR7, is missing all sequences 5‟ of the GtaR binding sites that were identified in the footprinting assays. EMSAs of DR7 showed a shifted band (Figure 3.29), indicating that GtaR is still capable of binding this DNA fragment.  However, a higher concentration of GtaR was required for binding because the shifted band was only present with GtaR concentrations of 360 nM or higher.  EMSAs of the 152 bp, 142 bp and 137 bp amplicons (named DR5, DR3 and DR1, respectively) contained deletions of one, two or all three of the GtaR binding  115  sites, respectively, and showed no retarded band even at the highest concentration of GtaR protein (1.44 µM) (Figure 3.29).  This lack of band shift in the EMSAs of DR5 and DR3 indicates that GtaR requires all three sites for strong binding.  The EMSAs of DRR, which is the sequence 5‟ of DR7, showed no GtaR binding.  This confirms that there are no GtaR binding sites 5‟ of the three GtaR protected sites identified in the footprinting assays.    1 1 6    Figure 3.28  DNase I footprint analysis of the interaction between GtaR and the gtaR promoter region, examined on the coding and the noncoding strands.  The DNA fragment was incubated with different concentrations of GtaR as indicated.  The protected sequences are bracketed and hypersensitive sites are in bold.  The putative lux box is highlighted in fuchsia and the predicted -35 site is boxed in green (         ).  The position of these protected and hypersensitive sites relative to other elements in the gtaR promoter region are shown in Figure 4.4.  1 1 7     Figure 3.29 EMSA to confirm the GtaR binding sequence in the gtaR promoter region.  On the left are representations of the DNA fragments used in the EMSA.  The green boxes are -10 and -35 sites predicted by BPROM  (http://linux1.softberry.com/berry.phtml), the purple box is the lux box predicted by Multalin (Corpet, 1988), and the turquoise diamonds are the three protected regions identified by DNase I footprinting analysis done with the GtaR protein.  The size and name of each DNA fragment is identified and the corresponding EMSAs are to the right. The EMSAs were performed as described in Materials and Methods.   118  4 DISCUSSION 4.1 Environmental factors affecting expression of the RcGTA, ctrA, and gtaR genes 4.1.1 Growth phase  It was previously reported that RcGTA capsid production is initiated at approximately early stationary phase and RcGTA is released into the environment shortly thereafter (Florizone, 2006).  The R. capsulatus CtrA protein, which is homologous to a protein that regulates cell cycle in C. crescentus, is required for RcGTA expression and release.  Using a translationally in-frame ctrA::lacZ fusion, I found that ctrA expression was growth phase-dependent.  This growth phase- dependent expression of ctrA was independent of the GtaI-based regulation because it was seen in the gtaI- strain.  The growth phase-dependent expression of ctrA may be partially responsible for the growth phase-dependent expression of RcGTA, because CtrA regulates RcGTA expression.  Expression from the ctrA::lacZ fusion represents both transcription and translation because it is a translational fusion.  However, the use of this reporter fusion does not take mRNA and protein degradation into account.  It is possible that the fusion mRNA and/or the fusion protein are degraded faster or slower than the native ctrA mRNA and CtrA protein.  The increase of ctrA::lacZ expression seen in the time course experiments (Figure 3.7), as indicated by increased β-galactosidase activity over time, may be different from the levels of ctrA expression from the chromosomal copy.  119  However, these results correspond with those found in northern blot  experiments, which showed that the level of native ctrA transcript increases as cultures progress from the exponential to stationary phase of growth (Lang and Beatty, 2000).  Although RT- qPCR can be performed to validate a reporter construct, I used the northern blot to support the validity of the ctrA::lacZ fusion as a method of indicating ctrA expression for my studies.  The time course ctrA::lacZ fusion experiments with the gtaI- strain showed that although GtaI was required for the full expression of ctrA, the growth phase- dependence was still present (Figure 3.7).  This indicates that some signal relating to cell culture density but independent of GtaI regulates the growth phase-dependent expression of ctrA over time.  This regulation does not involve CtrA itself, because CtrA does not regulate its own transcription in R. capsulatus (Figure 3.7). No experiments have been done to further identify the signal responsible for the growth phase- dependence of ctrA expression.  However, environmental signals are major candidates because over time concentrations of nutrients decrease and wastes increase in cell cultures.  Although ctrA expression increased over a time course in a similar pattern as RcGTA expression and release, the level of CtrA alone could not be solely responsible for the growth phase-dependent expression of RcGTA, because previous northern blot experiments showed that RcGTA expression is growth phase-dependent even in the presence of constitutively high levels of CtrA (Lang and Beatty, 2000).  Instead it is possible that ctrA and the RcGTA gene cluster are both under the regulation of a system that detects some signal associated with the growth phase of cell cultures.  120  These signals could include the diminution in nutrients, such as nitrogen, phosphate and carbon sources.  In E. coli the NtrBC (Magasanik, 1996), PhoBR (Wanner, 1995) and UhpABC (Kadner, 1995) signal transduction systems detect decreased availability of ammonia, phosphate and phosphorylated sugars, respectively.   Many questions still remain regarding the growth phase-dependent expression of ctrA and the RcGTA gene cluster, which require further experiments to answer.  What is the full number and identity of signals and regulatory systems responsible for the growth phase-dependent expression of ctrA and the RcGTA gene cluster?  What are the interactions between a yet to be elucidated growth phase related system, CtrA and RcGTA?  Is the phosphorylation state of CtrA dependent on growth phase and, if so, which protein(s) are responsible for the phosphorylation and dephosphorylation of CtrA? Which promoter region sequences of the ctrA and RcGTA genes are involved in regulation by growth phase? 4.1.2 Growth condition  The frequency of RcGTA-dependent gene transduction is high when the RcGTA donor cells are grown in YPS medium compared to the frequency in cultures grown in RCV medium, under anaerobic photosynthetic conditions (unpublished).  Using the orfg1::lacZ fusion, I have shown that growth in RCV medium under anaerobic photosynthetic conditions results in low orfg1 expression compared to growth either in YPS medium or under aerobic conditions, both of which results in similar high levels of orfg1 expression.  These results agree with previous western blot experiments which showed that in cultures grown under photosynthetic anaerobic conditions, the RcGTA  121  capsid was detected in the cellular and the supernatant fractions of cultures grown in YPS medium, whereas a smaller amount of RcGTA capsid was detected in the cellular fraction and none in the supernatant fraction of cultures grown in RCV medium (Figure 4.1) (Taylor, 2004).  It would be interested to perform transduction and western blot assays on cell cultures grown under aerobic conditions to determine if the results parallel these orfg1::lacZ findings.  It is possible that the effect of growth condition on RcGTA expression stem from effects on ctrA and gtaR expression, because CtrA and the GtaR regulate RcGTA expression.  Using the ctrA::lacZ and gtaR::lacZ fusions, I found that growth conditions also affected ctrA but not gtaR expression (Figure 3.11 and Figure 3.22).  Thus, differential expression of gtaR was not the cause of the effects of growth condition on RcGTA expression.  Growth condition had opposite effects on ctrA and orfg1 expression.  Growth in RCV medium under photosynthetic anaerobic conditions resulted in increased ctrA expression and decreased orfg1 expression, compared to the other growth conditions tested (Figure 3.4 and Figure 3.11).  It is possible that RcGTA requires a certain concentration of CtrA for expression, whereas high concentrations of CtrA inhibit RcGTA expression.  However, CtrA most likely requires phosphorylation to become active and, as noted previously, the lacZ fusion method does not take posttranslational modifications into account.  It may be that the CtrA~P concentration is more important than CtrA concentration in respect to the regulation of RcGTA expression, although a minimal population of the CtrA protein is necessary for phosphorylation to CtrA~P.  Alternatively, it is also possible that CtrA is not responsible for the growth condition effects on RcGTA orfg1 expression, and ctrA and orfg1 are  122  under the regulation of a protein that responds to an as yet unidentified growth condition.  In the future, RT-qPCR could be use to further validate the use of the ctrA::lacZ, orfg1::lacZ, and gtaR::lacZ constructs.  However, based on these promoter fusion results, I propose that regulation of the RcGTA orfg1 promoter involves CtrA, GtaI and GtaR, but also depends on factors that differ during culture growth in YPS compared to other media under photosynthetic anaerobic conditions.  Further experiments need to be done to answer outstanding questions. Questions such as: What signal(s) are detected under different growth conditions?  Do these signals result from metabolic processes?  What protein(s) are involved in detecting these signal(s)?  Which signaling system(s) are involved in regulating ctrA, gtaR, and the RcGTA gene cluster expression in response to these growth condition signal(s)?  Which other genes are part of this “growth condition” regulon?  Some preliminary experiments were done to begin to address some of these questions, as described in the following section.   123   Figure 4.1 Comparison of RcGTA capsid expression and ctrA expression.  Western blots of the Y262 cells grown in different media, and of ctrA- and cckA- strains grown in YPS medium under anaerobic photosynthetic conditions (Florizone, 2006; Taylor, 2004).  The ctrA expression of WT, ctrA- and cckA- strains containing the ctrA::lacZ plasmid grown in different media under photosynthetic conditions, and the orfg1 expression of Y262 cells grown in different media under photosynthetic conditions are shown as β-galactosidase relative activities. 4.1.3 Nutrient limitation  Previously, western blots were done using the RcGTA capsid antibody and Y262 cells grown in nutrient-limited RCV-derived media, to find clues about possible signals that activate RcGTA production.  The results of this work revealed that compared to cells grown in RCV medium: cultures grown under nitrogen limitation had no detectable RcGTA capsid in either the cellular or supernatant fractions; cultures grown under phosphate limitation had higher RcGTA capsid expression in both the cellular and supernatant fraction; and cultures grown under carbon limitation had an accumulation of capsid in the cellular fraction but no detectable capsid in the supernatant fraction (Figure 4.1) (Taylor, 2004).  124   At the time that the western bots shown in Figure 4.1 were done, I had already found that (similar to RcGTA orfg1 expression) ctrA expression is affected by growth conditions, and I wanted to determine whether ctrA expression is also regulated by nutrient limitation.  Experiments using the ctrA::lacZ fusion revealed that ctrA expression was low in cultures grown in YPS medium and the P-limited RCV-derived medium, whereas ctrA expression was high in cultures grown in RCV medium and RCV-derived media limited in either nitrogen or carbon (Figure 3.14 and Figure 4.1).  Low expression of ctrA coincided with the presence of capsid in the culture medium, whereas high expression of ctrA coincided with the absence of capsid in the supernatant (Figure 4.1). One possible explanation for this pattern is that low levels of CtrA are necessary for RcGTA release.  However, expression of ctrA and RcGTA capsid protein was high in cultures grown under carbon limitation.  Therefore, high expression of ctrA does not necessarily correspond to low expression of RcGTA.  It seems that CtrA is not involved in the nutrient limitation effects on RcGTA capsid production.  An alternative explanation is that the nutrient limitation effects seen in ctrA expression and RcGTA release are due to regulation by a system in common that detects nutrient availability.  Further experiments should be done to elucidate the signal(s) and regulatory system(s) involved in the nutrient-dependent regulation of ctrA and RcGTA expression.  Microarray experiments comparing cultures grown under different nutrient-limited media could identify different regulons.  Experiments using knockouts of PhoB (the response regulator of the PhoR/PhoB two component system that detects environmental phosphate) and NtrC (the response regulator of the NtrBC signal two component system that detects environmental ammonia) homologues in R.  125  capsulatus could be useful in determining the role of phosphate and ammonia in the regulation of RcGTA and CtrA.  These homologues are rcc03498 (phoB) and rcc01798 (ntrC). 4.2 Cellular systems regulating the expression of RcGTA, ctrA, and gtaR 4.2.1 Regulation of RcGTA by CtrA and CckA  Experiments using the orfg1::lacZ fusion plasmid pG65 have shown that CtrA and CckA are required for RcGTA orfg1 expression.  In ctrA- and cckA- strains, expression from pG65 is decreased to 3% and 28%, respectively, relative to the expression in the parental strain Y262.  The decreased expression from pG65 in the ctrA- strain corresponds to western blot data that show a decreased amount of the RcGTA capsid in the cellular fraction and no detectable RcGTA capsid in the supernatant fraction of ctrA- cultures, compared to the Y262 strain (Figure 3.14) (Florizone, 2006).  The decrease in RcGTA expression from pG65 in the cckA- strain seems contrary to the findings in western blot experiments, which showed an increased accumulation of intracellular capsid and a lack of extracellular capsid in the cckA- strain compared to Y262 (Figure 3.14) (Florizone, 2006).  It was previously suggested that the primary RcGTA transcript is processed into smaller mRNA segments, based on the appearance of northern blots probed with an orfg2 and orfg4 DNA fragments (Lang and Beatty, 2000).  The orfg1::lacZ fusion reports expression of orfg1 specifically, and it is possible that the mRNA containing the capsid gene is more stable than the mRNA  126  containing orfg1, resulting in an accumulation of capsid protein in the cckA- mutant regardless of the decreased expression from the orfg1::lacZ fusion.  A lack of RcGTA release may also contribute to this accumulation.  RcGTA bioassays using Y262 cell lysate resulted in ~6 times more tranductants than when using cckA- cell lysates (Table 3.2), even though western blots showed an increase in intracellular RcGTA capsid protein in cckA- cells compared to Y262 cells.  This shows that Y262 cells contained a greater number of assembled and functional RcGTA particles than cckA- cells, and indicates that there is likely a component other than the RcGTA capsid protein that is a limiting factor in RcGTA assembly in the cckA- strain.  I propose that the function of CckA in RcGTA transduction is at least two-fold.  Firstly, CckA has a role in regulating orfg1 (and perhaps the entire RcGTA gene cluster) transcription, and secondly, CckA has a role in regulating RcGTA release.  Recently, microarray experiments were done to compare the gene expression of WT vs. ctrA- cells, and exponential vs. stationary phase WT cells.  The results showed that the expression of RcGTA genes was higher in WT cells by 2.3-17.7 fold, compared to ctrA- cells, and higher in stationary phase cells by 2.4-5.8 fold, compared to exponential phase cells.  For example, some RcGTA gene-to-gene differences from each other, in term of the degree of down regulation in the ctrA mutant relative to the WT strain, were: the expression of orfg1 was less than 2-fold higher in the WT than ctrA- strain; orfg5 was 12.4-fold higher in the WT strain; the expression of orfg1 was 3.9-fold higher in stationary phase than exponential phase; and orfg5 was 5.2-fold higher in stationary phase (Mercer et al., 2010, In press).  These results further support the idea  127  that the RcGTA primary transcript is processed into smaller mRNAs that differ in stability, resulting in differential accumulation of the encoded protein products.  Although I have found that ctrA expression is regulated by GtaI, GtaR and environmental signals, it is still unknown what signals activate the phosphorylation of the R. capsulatus CtrA protein, assuming that phosphorylation of the R. capsulatus CtrA protein affects its activity.  Also unknown are the proteins responsible for regulating the phosphorylation state of the CtrA protein.  Unlike C. crescentus, there are no obvious DivJ or DivL homologues in R. capsulatus (Mercer et al., 2010, In press).  Perhaps CtrA phosphorylation state is regulated by nutrient limitation.  WT cells grown in P-limited RCV-derived medium and in YPS medium had high amounts of RcGTA capsid expression and release, compared to cells grown in RCV medium, which had low RcGTA expression and no release.  These data indicate that low phosphate concentrations signal RcGTA expression and release.  It is possible that CtrA is phosphorylated in response to low phosphate concentrations to activate RcGTA expression and release.  Future experiments could include making a constitutively active CtrA mutant and testing if low phosphate still affects RcGTA expression and release, to determine whether phosphate limitation effects and CtrA regulation of RcGTA are independent or linked.  Also, experiments using CtrA isolated (by immunoprecipitation) from cells grown in the presences of H2 32PO4 could be performed to determine whether CtrA is phosphorylated in response to P-limitation.  Similar experiment were used to determine whether CckA was required for CtrA phosphorylation in C. crescentus (Jacobs et al., 1999).  128   In cckA- cells, expression from the orfg1::lacZ fusion indicated low expression (13%) of the RcGTA gene cluster, although western blots showed an accumulation of capsid protein in cckA- cells (Figure 4.1).  Western blots of WT cells grown in the C- limited RCV-derived medium are similar to those of cckA- cells grown in YPS medium (Figure 4.1).  It would be interesting to see if expression from the orfg1::lacZ fusion of cells grown in C-limited RCV-derived medium is similar to that of cckA- cells.  Perhaps CckA responds to carbon limitation by dephosphorylating CtrA, resulting in decreased transcription of the RcGTA gene cluster.  Further experiments need to be done to determine whether R. capsulatus CckA and CtrA function in the same pathway to regulate RcGTA expression, and whether nutrient limitation is detected through this pathway.  The regulation of RcGTA expression by CtrA is complex in R. capsulatus, and likely involves transcriptional regulation of ctrA and phosphorylation of CtrA, in response to cell population density, growth phase, and environmental conditions.  CtrA-DNA binding experiments will need to be done to determine whether CtrA or CtrA~P binds to the RcGTA promoter, and to determine whether CtrA regulates RcGTA transcription directly or indirectly.  I speculate that CtrA~P does not bind the RcGTA promoter at low concentrations, resulting in low RcGTA transcription, but at mid-level concentrations CtrA~P binds to the RcGTA promoter to activate transcription.  When high concentrations of CtrA~P are reached, CtrA~P binds a second site in the RcGTA promoter to inhibit expression of RcGTA.  A similar model is seen in the regulation of ctrA transcription by CtrA in C. crescentus (Domian et al., 1999).  129   Further studies to determine the mechanism of regulation by R. capsulatus CtrA would be valuable.  A ChIP-on-chip experiment could be done (Laub et al., 2002) to identify which of the 255 genes shown to be regulated by CtrA by microarray experiments (Mercer et al., 2010, In press) are regulated by CtrA directly or indirectly. Also, analysis of the promoters bound by CtrA could identify CtrA-binding sequences in R. capsulatus. 4.2.2 Regulation of RcGTA, gtaR, and ctrA by the GtaI and GtaR proteins  Experiments using ctrA::lacZ, gtaR::lacZ, and orfg1::lacZ fusions have shown GtaI-based and GtaR-based modulation of ctrA, gtaR, and RcGTA orfg1 expression. The results from these experiments are also consistent with a model in which GtaI and GtaR function together as a quorum sensing system, and GtaR binds DNA in the absence of C16-HSL to repress these genes (Figure 4.2A).  EMSA experiments supported this model of GtaI/GtaR regulation for gtaR but not ctrA and orfg1 expression, because in the absence of C16-HSL the GtaR protein bound the gtaR but not the ctrA and orfg1 promoter regions.  This indicates that GtaR directly affects its own expression (Figure 4.2B), but indirectly affects the expression of ctrA and the RcGTA gene cluster (Figure 4.2C and Figure 4.2B).  130  Figure 4.2 A quorum sensing based model of GtaR regulation in R. capsulatus. The grey circle represents the GtaR protein, the black pentagon represents the C16-HSL, which is produced by GtaI, and the oval represents an unknown regulating protein (either a repressor or and activator).  A. A general model for GtaR function.  At low cell population density, C16-HSL concentration is low and GtaR binds DNA.  As the cell population density increases, the C16-HSL signal accumulates and binds to GtaR, which releases DNA.  B. A model for direct regulation of gtaR expression by GtaR.  In the absence of C16-HSL GtaR binds to the gtaR regulatory region to repress gene expression, but in the presence of C16-HSL GtaR releases DNA resulting in gtaR expression. C. A model for indirect regulation of ctrA and orfg1 expression by GtaR involving an unidentified repressor protein.  D. A model for indirect regulation of ctrA and orfg1 expression by GtaR involving an unidentified activator protein.  131    EMSAs were performed to determine if the presence of C16-HSL signal affected GtaR‟s in vitro affinity for DNA.  Binding of GtaR to the gtaR promoter region was unaffected by the presence of C16-HSL, which can be explained in several ways.  First, it is possible that the N-terminal 6 x His-tag interfered with the C16-HSL binding site. The N-terminal two thirds of the LuxR protein in V. fischeri has been implicated in HSL signal binding (Hanzelka and Greenberg, 1995), and the LuxR homologue TraR has been crystallized with DNA bound to the C-terminal domain and the HSL bound to the N-terminal domain (Vannini et al., 2002).  Further experiments on GtaR using a C- terminal 6 x His-tag, or a GtaR protein without a His-tag, could be done to resolve this issue.  Secondly, it is possible that GtaR binds the gtaR promoter both in the presence and absence of C16-HSL.  In P. aeruginosa, RhlR binds to the rhlAB las box both in the absence and presence of acyl-HSL, as a repressor and an activator, respectively (Medina et al., 2003).  Thirdly, it is possible that GtaR has a poorly accessible autoinducer binding site and that it either required more binding time with C16-HSL than was used, or that GtaR needed to be expressed in the presence of C16-HSL during the GtaR protein purification process.  Various LuxR homologues have been found to have a difference in autoinducer accessibility in the N-terminal domain, and therefore different autoinducer binding strengths (Koch et al., 2005; Vannini et al., 2002; Zhang et al., 2002; Zhu and Winans, 1999).   I also did EMSA experiments to determine if the GtaR protein would bind the ctrA and RcGTA gene cluster promoter regions in the presence of C16-HSL, because there  132  was no binding in the absence of C16-HSL.  I found that GtaR did not bind either promoter region in the presence of C16-HSL.  As discussed above, it is possible that C16-HSL did not actually bind to GtaR, or that GtaR binds neither the ctrA nor RcGTA gene cluster promoter regions in the presence or absence of C16-HSL.  The ESMA experiments done in this thesis support a model in which GtaR indirectly regulates RcGTA transcription, possibly through the regulation of ctrA expression.  Alternatively, it is possible that GtaR regulates both ctrA and RcGTA expression indirectly, through another regulator.  Future experiments should be aimed at differentiating between these possibilities and, if appropriate identifying a regulator and studying its role in regulating ctrA and RcGTA expression. 4.3 R. capsulatus promoters  Unfortunately, little is known about R. capsulatus promoters, and there is no published consensus sequence.  Swem et al. (2001) compared the -10 and -35 regions (some known and some putative) of RegA-controlled promoters in R. capsulatus and R. sphaeroides (Figure 4.3).  They found quite a bit of variability in sequence, with the predominant aspect being an increase in A/T residues relative to the average of 33.4% for the entire genome (Haselkorn et al., 2001).  The -10 and -35 regions of the RcGTA, ctrA, and gtaR promoters have increased A/T residues compared to the genome average, but relatively undefined sequences (Figure 4.3).  When the frequency of residues in these -10 and -35 sites were analyzed using Weblogo 3.0 (Crooks et al., 2004; Schneider and Stephens, 1990), no definitive consensus sequence was found.  133  However, there is a tendency for the first three residues of the -35 sites to be TTG, and the second and last residue of the -10 sites to be A and T, respectively (Figure 4.3).  134       -35      -10 R. cap petABC TGGACT ...N16... CTAAAC R. cap cycA  TTGCCC ...N16... GAAACA R. cap cycY  TTGAAA ...N17... GTAGAT R. cap cydAB TGGTCC ...N15... ATAGCT R. cap ccoNOQP1 TTGATC ...N17... CATACC R. cap ccoNOQP2 AAGCGG ...N17... CACAAA R. cap cbbI  TTGTAA ...N15... CATAGT R. cap cbbII  TTGCAT ...N16... CAACGT R. cap puc  TTGATC ...N17... CATAGT R. sph cbbI  TTATTA ...N15... GATCCG R. cap nifA2 TTGCGC ...N15... AAGCTT R. sph cycA  TAATTT ...N17... CATAGT R. cap puf  GCGACG ...N17... TTACAT R. cap ctrA  TTGAAC ...N15... AGGAAG R. cap GTA  GTCGCG ...N17... GAAGAC R. cap gtaR  TTGAAG ...N17... CAAGCT            ...N15-17...    Figure 4.3 Alignment of putative -10 and -35 promoter sequences of R. capsulatus genes.  These were identified by primer extension in previous studies (Du et al., 1998; Dubbs et al., 2000; Elsen et al., 2000; Florizone, 2006; Karls et al., 1999; Swem et al., 2001; Vichivanives et al., 2000), and by primer extension and/or BPROM promoter prediction software in this study.  Two R. sphaeroides -10 and -35 promoter sequences (R. sph) are included.  The frequency of bases found at each position is indicated by the coloured chart created by the Weblogo 3.0 software (Crooks et al., 2004; Schneider and Stephens, 1990). 4.3.1 The ctrA promoter region  The promoter deletion experiments done in this thesis have revealed much about the regulation of ctrA expression.  I propose that ctrA expression is under the control of at least two regulatory systems.  The first involves the GtaI/GtaR proteins which indirectly control ctrA expression, possibly through the regulation of another regulator. The GtaI/GtaR proteins may induce the expression of a repressor or repress the 1    2    3    4    5    6 -35 1    2    3    4    5    6 -10  135  expression of an inducer, either of which would result in expression of ctrA at high culture population densities.  The second is an unidentified regulatory system that interacts with the IRD inverted repeat to repress ctrA expression.  An increase in expression was seen only if both the IRD inverted repeat and the GtaR protein were absent (Figure 3.17).  This indicates an overlap in repression of ctrA expression by this system and the GtaI/GtaR proteins.  A third possible regulatory system activates ctrA expression and involves the 44 bp sequence in between the IRD inverted repeat and the putative -35 site.  When this region was deleted (p601-9), a decrease in expression was seen in the gtaR- strain, but not the WT strain (Figure 3.17).  Perhaps this sequence or the IRD inverted repeat is involved in regulating ctrA expression in response to growth conditions, nutrient limitation or growth phase, which would explain why growth phase-dependent expression of ctrA is seen even in the gtaI- strain (Section 3.2.2 and Figure 3.7).  The expression of ctrA appears to be regulated by many systems, including the GtaI-based and GtaR-based regulatory system(s).  I have shown that ctrA expression is affected by growth condition, nutrient limitation and growth phase, but the regulatory systems involved in responding to these conditions are unclear.  Additional work needs to be done to identify these systems and their mechanism of regulation of ctrA expression.  136  4.3.2 The gtaR promoter region  EMSA and footprinting experiments have identified sequences protected by the GtaR protein in the gtaR promoter region (Figure 4.4).  Comparisons of the three GtaR protected sequences on the coding strand revealed that GtaR protected region 1 and 3 are inverted repeats, but GtaR protected region 2 has no similarity to either 1 or 3 (Figure 4.4B).  Deletion studies of the gtaR promoter region revealed that sequences present in p601-P25 but absent from p601-P23 are important to gtaR expression.  It is possible that these sequences contain either a promoter or regulatory sequences important for the induction of gtaR transcription, because a predicted lux box and predicted -10 and -35 sites are found in these sequences.  The expression from p601- P23 was 43% that of p601-P2R, indicating that there is likely a gtaR promoter present in the p601-P23 plasmid.  The p601-P23 plasmid contains two predicted -10 and -35 sites and one predicted lux box.  The sequences protected by the GtaR protein found in DNase I footprinting experiments coincide with the predicted lux box and the 3‟-most predicted -35 site (Figure 4.4). A 5‟ RNA end-mapping experiment could be done to identify the number and location of the gtaR promoter(s).  Although the GtaR binding sequence has been identified, further deletion studies will have to be done on the gtaR promoter to identify other important regulatory sequences involved in the growth condition-effect on gtaR expression (Figure 3.22).  137  A.  AGATCAAGAC CACCCTGCCG AAAGCCAAGG AACTGCGTCC GATCATCGAA AAGCTGATCA 609  CGCTGGCCAA GCGCGGCGAC CTGCATGCCC GTTGTCAGGC GGCGGCGATG CTTGAAGCAG 669  GACAAGGACG TGGCCAAGCT TTTCGACGTG CTCGGGCCCC GCTACAAGGA CCGTCAGGGC 729  GGCTACACCC GCGTCCTGAA AGCCGGTTTC CGCTATGGCG ACATGGCGCC GATGGCCTTC 789  ATCGAATTCG TCGAGCGCGA CGTTTCGGCG AAGGGCGCGG CTGACAAGGC CCGTGAAGCG 849       rplQ GCTTTCGAAG CGGCCGACGA ATAAGCTTTC CGCAAGGGAA GCCGGAAGCC CGCCCCTCGG 909  GGCGGGTTTT CGTTTTTGCG GGCGGCGCAA CCGCAGGGCG AGACTTGGCG GCAATCTGCC 969  CGTAATGGCG CCGATTTCAG CAAAAACCAC CCCGCCGGAG GCAATTCCCG GTTGATCTTT 1029   TCCGGTGGCA CCTGTCTAAA AAGACATGTC CATACACACC GAAATCAACA AGTGTCTGCG 1089 AGGCCACCGT GGACAGATTT TTCTGTACAG GTATGTGTGG CTTTAGTTGT TCACAGACGC   GGAAATCGGT CGCGTCGCGA CGGATGGCTA TTTCATCGGC CTGCATATCC GTTTCGCCGC 1149 CCTTTAGCCA GCGCAGCGCT GCCTACCGAT AAAGTAGCCG GACGTATAGG CAAAGCGGCG   CCCGATCATG CAATTCCAGA CCTATCCCGA GGCGTGGACA GATCACTACA CCCGGCAGGC 1209 GGGCTAGTAC GTTAAGGTCT GGATAGGGCT CCGCACCTGT CTAGTGATGT GGGCCGTCCG  B.  GGCACCTGTCTAAAAAGACATGTCCAT CCGTGGACAGATTTTTCTGTACAGGTA   Figure 4.4 GtaR binding sequence in the gtaR promoter region.  A. Position of GtaR binding sequences in the gtaR promoter region.  B. Analysis of the three GtaR protected sequences. In green and labeled with the green bent arrow ( ) is the gtaR start codon. Highlighted in green or boxed in green are the putative -10 and -35 sites predicted by the Softberry program BPROM. Highlighted in red is the stop codon of rplQ as labeled. Highlighted in yellow are the bases protected by GtaR in DNase I footprinting assay. Also marked by numbered double ended arrows (        ). Single ended arrow indicates inverted repeat sequences on opposite strands. Highlighted in blue are the hypersensitive sites found by DNase I footprinting assays. In fuchsia and underlined are putative lux boxes predicted by Multalin (Corpet, 1988). Blue arrows indicate the 5‟ end of the gtaR promoter deletion fusions to lacZ. gtaR 3 5 1       2     3 1       2     3  138  4.3.3 The RcGTA promoter region and the RcGTA mRNA  The RcGTA promoter deletion studies done in this thesis were designed with the assumption that the RcGTA gene cluster is transcribed as an operon from a single promoter upstream of orfg1.  The function of orfg1 is unknown, but complementation experiments have shown that it is essential for RcGTA transduction (A.S. Lang, personal communication).  Results from the RcGTA promoter deletion studies done in this thesis concur with the -10 and -35 sites proposed by Florizone (2006), and have identified the orfg1 start codon.  Additional studies of the sequences upstream of orfg1 are required to identify important regulatory sequences.  The construction of the orfg1::lacZ promoter deletion fusions allowed me to study the “orfg1 effect”, which is the lack of RcGTA release in cells containing certain orfg1::lacZ or orfg2::lacZ fusions.  It appears that the “orfg1 effect” is not caused by extra copies of orfg1, but rather by the 63 bp sequence upstream of the orfg1 start codon (i.e., the sequences present in pG65 but absent from pG15; see Figure 3.3).  It is possible that the RNA of the 63 bp sequence regulates RcGTA expression.  This could be tested by performing western blots on the Y262 strain containing a plasmid with this sequence under the control of a constitutive promoter, to determine whether the “orfg1 effect” is seen.  Alternatively, the “orfg1 effect” may be an artifact of the β-galactosidase protein because it is only seen when the protein is expressed.  This could be tested by performing western blots on the Y262 strain containing lacZ under the control of a promoter (other than the RcGTA promoter) to determine whether the “orfg1 effect” is seen.  139   There is some evidence that indicates that the RcGTA primary transcript is cleaved into smaller mRNA segments (Lang, 2000; Lang and Beatty, 2000).  A mutant in orfg2, made by Tn5 insertion, cannot be complemented by a cosmid containing orfg1 to orfg11 and half of orfg12, but can be complemented by a cosmid containing orfg1 to orfg15 (Lang, 2000).  These data are consistent with the model that the RcGTA gene cluster is an operon and is transcribed as a single transcript.  Northern blots using probes for orfg2 and orfg4 result in smears from 0.2 to 4.4 kb and 0.2 to 7.5 kb in size, respectively (Lang, 2000; Lang and Beatty, 2000).  These data indicate that the RcGTA primary transcript is processed into smaller mRNAs, analogous to that seen in the Streptomyces temperate phage ϕC31 (Howe and Smith, 1996; Suarez et al., 1992). The orfg1::lacZ fusions used in this thesis report the expression of orfg1 specifically, and do not take into account the potentially different stabilities of the other mRNA segments.  Recent microarray experiments comparing gene expression of WT vs. ctrA- cells, and exponential vs. stationary phase cells have shown that the genes in the RcGTA gene cluster have varying fold changes of expression (Figure 4.5).  Notably, orfg5 had higher fold changes of expression than orfg1 in the comparison of WT to ctrA- cells, and exponential to stationary phase cells (Figure 4.5).  It appears that RcGTA expression is regulated by differential degradation rates of segments of a multi-gene primary transcript.  I speculate that the stoichiometry of the RcGTA proteins is controlled, at least in part, by segmental differences in degradation rates of the orfg1 to orfg15 transcript.  140   Figure 4.5 Expression of RcGTA genes in of WT vs. ctrA- cells, and exponential vs. stationary phase cells.  The graph represents my interpretation of data from microarray experiments performed with R. capsulatus cells grown in YPS medium under photosynthetic anaerobic conditions (Mercer et al., 2010, In press).  In blue is the fold increase in expression of stationary compared to exponential phase cells.  In red is the fold increase in expression of WT compared to ctrA- cells. 4.4 Concluding remarks  If GtaI and GtaR function as a quorum sensing system, then my studies of these proteins in R. capsulatus have yielded information about a poorly understood class of quorum sensing response regulators, which bind DNA in the absence of the cognate HSL signal.  The R. capsulatus 6 x His-tagged GtaR protein purified in my work has the advantage of being stable and soluble in the absence of HSL, in contrast to LuxR 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 o rf g 1 o rf g 2 o rf g 3 o rf g 3 .5 o rf g 4 o rf g 5 o rf g 6 o rf g 7 o rf g 8 o rf g 9 o rf g 1 0 o rf g 1 0 .5 o rf g 1 1 o rf g 1 2 o rf g 1 3 o rf g 1 4 o rf g 1 5 F o ld  i n c re a s e  i n  e x p re s s io n stationary vs. exponential phase WT vs. ctrA-- exponential vs. stationary phase  141  (Urbanowski et al., 2004), CepR (Weingart et al., 2005), and TraR (Chai and Winans, 2005; Zhu and Winans, 1999; Zhu and Winans, 2001).  This gives us the opportunity to perform crystallization experiments on the unbound form of a LuxR-type protein in the absence of DNA and signal-binding.  Currently the best crystal structure of a LuxR-type protein is of the A. tumefaciens TraR protein bound to DNA and N-(3-oxo-oxtanoyl)-L- HSL (Vannini et al., 2002).  Microarray experiments are currently being done with the gtaI- and gtaR- strains to determine which genes are regulated by GtaI and GtaR.  A CHiP-on-chip experiment using the GtaR protein could be done to determine whether GtaR regulates these genes directly or indirectly.  This experiment in combination with the microarray results would also tell us whether GtaR acts solely as a negative regulator, or if it also activates transcription.  There remain many unanswered questions about GtaI and GtaR.  What proteins, if any, other than GtaR regulate the expression of gtaR?  Do the other two CerR homologues (rcc01088 and rcc01823) have any function in R. capsulatus?  Can R. capsulatus detect HSL signals produced by other bacteria, perhaps using the rcc01088 and/or rcc01823 gene products?  My studies of ctrA have revealed that ctrA expression changes in response to nutrient limitation, growth phase, and cell culture density.  Expression of ctrA is regulated by GtaI, GtaR and regulatory systems that have yet to be identified.  Unlike C. crescentus, R. capsulatus CtrA does not regulate its own transcription.  Perhaps this is one characteristic that distinguishes CtrA of bacteria that undergo symmetric cell division from that of bacteria that undergo asymmetric cell division.  Little is known  142  about the R. capsulatus CtrA protein.  Does CtrA act as a positive and/or negative regulator?  Does phosphorylation increase or decrease the affinity of CtrA for DNA? What proteins regulate the phosphorylation state of CtrA?  What signals do these proteins respond to?  Which genes are directly regulated by CtrA?  It has become clear that a complicated network of systems regulates the production of extracellular RcGTA.  The pathways involving CtrA, CckA, GtaI and GtaR are intricate, involving factors such as growth phase, cell culture density, and nutrient availability.  This complexity compounds the difficulty in elucidating the mechanisms of RcGTA regulation.  Many questions remain unanswered and will require further study. These questions include: How is the RcGTA particle released from the cell?  Is there a non-lytic mechanism or does a sub-population lyse to release RcGTA?  If the mechanism is lytic, how are the donor cells determined?  What signals and systems are involved in regulating the release of RcGTA?  What is the method of coordination between the CtrA, CckA and the GtaI/GtaR system in regulating RcGTA expression? What other systems are involved in regulating RcGTA expression?  What percentage of virus-like particles in the environment are RcGTA-like particles, and can they mediate interspecies horizontal gene transfer?  The R. capsulatus RcGTA provides a model for the study of GTAs in general and the role of RcGTA-like particles involved in genetic exchange.  It is unknown how many bacterial species are capable of genetic exchange mediated by RcGTA particles, but with an estimation of up to 1030 viral particles in aquatic environments, the possibility that a portion of these are GTAs appears likely.   143  5 REFERENCES Adams, C. W., Forrest, M. E., Cohen, S. N., and Beatty, J. T. (1989). Structural and functional analysis of transcriptional control of the Rhodobacter capsulatus puf operon. J Bacteriol 171, 473-482. Barnett, M. J., Hung, D. Y., Reisenauer, A., Shapiro, L., and Long, S. R. (2001). A homolog of the CtrA cell cycle regulator is present and essential in Sinorhizobium meliloti. J Bacteriol 183, 3204-3210. Beatty, J. T., and Gest, H. (1981). Biosynthetic and bioenergetic functions of citric acid cycle reactions in Rhodopseudomonas capsulata. J Bacteriol 148, 584-593. Bellefontaine, A. F., Pierreux, C. E., Mertens, P., Vandenhaute, J., Letesson, J. J., and De Bolle, X. (2002). Plasticity of a transcriptional regulation network among alpha- proteobacteria is supported by the identification of CtrA targets in Brucella abortus. Mol Microbiol 43, 945-960. Biers, E. J., Wang, K., Pennington, C., Belas, R., Chen, F., and Moran, M. A. (2008). Occurrence and expression of gene transfer agent genes in marine bacterioplankton. Appl Environ Microbiol 74, 2933-2939. Bowers, L. M., Shapland, E. B., and Ryan, K. R. (2008). Who's in charge here? Regulating cell cycle regulators. Curr Opin Microbiol 11, 547-552. Camilli, A., and Bassler, B. L. (2006). Bacterial small-molecule signaling pathways. Science 311, 1113-1116. Chai, Y., and Winans, S. C. (2005). Amino-terminal protein fusions to the TraR quorum- sensing transcription factor enhance protein stability and autoinducer-independent activity. J Bacteriol 187, 1219-1226. Cheetham, B. F., and Katz, M. E. (1995). A role for bacteriophages in the evolution and transfer of bacterial virulence determinants. Mol Microbiol 18, 201–208. Chen, F., Spano, A., Goodman, B. E., Blasier, K. R., Sabat, A., Jeffery, E., Norris, A., Shabanowitz, J., Hunt, D. F., and Lebedev, N. (2009). Proteomic analysis and identification of the structural and regulatory proteins of the Rhodobacter capsulatus gene transfer agent. J Proteome Res 8, 967-973. Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16, 10881-10890. Crooks, G. E., Hon, G., Chandonia, J. M., and Brenner, S. E. (2004). WebLogo: a sequence logo generator. Genome Res 14, 1188-1190. Davies, D. G., Parsek, M. R., Pearson, J. P., Iglewski, B. H., Costerton, J. W., and Greenberg, E. P. (1998). The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280, 295-298. Davies, J. (1994). Inactivation of antibiotics and the dissemination of resistance genes. Science 264, 375–382. Ditta, G., Schmidhauser, T., Yakobson, E., Lu, P., Liang, X. W., Finlay, D. R., Guiney, D., and Helinski, D. R. (1985). Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13, 149-153.  144  Domian, I. J., Reisenauer, A., and Shapiro, L. (1999). Feedback control of a master bacterial cell-cycle regulator. Proc Natl Acad Sci U S A 96, 6648-6653. Du, S., Bird, T. H., and Bauer, C. E. (1998). DNA binding characteristics of RegA. A constitutively active anaerobic activator of photosynthesis gene expression in Rhodobacter capsulatus. J Biol Chem 273, 18509-18513. Dubbs, J. M., Bird, T. H., Bauer, C. E., and Tabita, F. R. (2000). Interaction of CbbR and RegA transcription regulators with the Rhodobacter sphaeroides cbbI Promoter- operator region. J Biol Chem 275, 19224-19230. Dunlap, P. V., and Greenberg, E. P. (1988). Control of Vibrio fischeri lux gene transcription by a cyclic AMP receptor protein-LuxR protein regulatory circuit. J Bacteriol 170, 4040-4046. Eiserling, F., Pushkin, A., Gingery, M., and Bertani, G. (1999). Bacteriophage-like particles associated with the gene transfer agent of Methanococcus voltae PS. J Gen Virol 80, 3305–3308. Elsen, S., Dischert, W., Colbeau, A., and Bauer, C. E. (2000). Expression of uptake hydrogenase and molybdenum nitrogenase in Rhodobacter capsulatus is coregulated by the RegB-RegA two-component regulatory system. J Bacteriol 182, 2831-2837. Engebrecht, J., Nealson, K., and Silverman, M. (1983). Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32, 773-781. Florizone, S. M. (2006) Studies on the Regulation of the Gene Transfer Agent (GTA) of Rhodobacter capsulatus, University of British Columbia, Vancouver. Forst, S. A., and Roberts, D. L. (1994). Signal transduction by the EnvZ-OmpR phosphotransfer system in bacteria. Res Microbiol 145, 363-373. Fuqua, C., Winans, S. C., and Greenberg, E. P. (1996). Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu Rev Microbiol 50, 727-751. Fuqua, W. C., Winans, S. C., and Greenberg, E. P. (1994). Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J Bacteriol 176, 269-275. Grossman, A. D. (1995). Genetic networks controlling the initiation of sporulation and the development of genetic competence in Bacillus subtilis. Annu Rev Genet 29, 477-508. Hanzelka, B. L., and Greenberg, E. P. (1995). Evidence that the N-terminal region of the Vibrio fischeri LuxR protein constitutes an autoinducer-binding domain. J Bacteriol 177, 815-817. Haselkorn, R., Lapidus, A., Kogan, Y., Vlcek, C., Paces, J., Paces, V., Ulbrich, P., Pecenkova, T., Rebrekov, D., Milgram, A., et al. (2001). The Rhodobacter capsulatus genome. Photosynth Res 70, 43-52. Horng, Y. T., Deng, S. C., Daykin, M., Soo, P. C., Wei, J. R., Luh, K. T., Ho, S. W., Swift, S., Lai, H. C., and Williams, P. (2002). The LuxR family protein SpnR functions as a negative regulator of N-acylhomoserine lactone-dependent quorum sensing in Serratia marcescens. Mol Microbiol 45, 1655-1671. Howe, C. W., and Smith, M. C. (1996). Characterization of a late promoter from the Streptomyces temperate phage phi C31. J Bacteriol 178, 2127-2130.  145  Humphrey, S. B., Stanton, T. B., Jensen, N. S., and Zuerner, R. L. (1997). Purification and characterization of VSH-1, a generalized transducing bacteriophage of Serpulina hyodysenteriae. J Bacteriol 179, 323–329. Imhoff, J. F. (1995). Taxonomy and Physiology of Phototrophic Purple Bacteria and Green Sulfur Bacteria. In Anoxygenic photosynthetic bacteria, R.E. Blankenship, M.T. Madigan, and C.E. Bauer, eds. (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 1-15. Iniesta, A. A., McGrath, P. T., Reisenauer, A., McAdams, H. H., and Shapiro, L. (2006). A phospho-signaling pathway controls the localization and activity of a protease complex critical for bacterial cell cycle progression. Proc Natl Acad Sci U S A 103, 10935-10940. Iniesta, A. A., and Shapiro, L. (2008). A bacterial control circuit integrates polar localization and proteolysis of key regulatory proteins with a phospho-signaling cascade. Proc Natl Acad Sci U S A 105, 16602-16607. Jacobs, C., Domian, I. J., Maddock, J. R., and Shapiro, L. (1999). Cell cycle-dependent polar localization of an essential bacterial histidine kinase that controls DNA replication and cell division. Cell 97, 111-120. Jacobs, C., Hung, D., and Shapiro, L. (2001). Dynamic localization of a cytoplasmic signal transduction response regulator controls morphogenesis during the Caulobacter cell cycle. Proc Natl Acad Sci U S A 98, 4095-4100. Kadner, R. J. (1995). Expression of the Uhp sugar-phosphate transport system of Escherichia coli. In Two-Component Signal Transduction, J.A. Hoch, and T.J. Silhavy, eds. (Washington, DC: American Society for Microbiology), pp. 263-274. Karls, R. K., Wolf, J. R., and Donohue, T. J. (1999). Activation of the cycA P2 promoter for the Rhodobacter sphaeroides cytochrome c2 gene by the photosynthesis response regulator. Mol Microbiol 34, 822-835. Koch, B., Liljefors, T., Persson, T., Nielsen, J., Kjelleberg, S., and Givskov, M. (2005). The LuxR receptor: the sites of interaction with quorum-sensing signals and inhibitors. Microbiology 151, 3589-3602. Laemmli, D. M. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227, 680-685. Lang, A. S. (2000) The Gene Transfer Agent (GTA) of Rhodobacter capsulatus, University of British Columbia, Vancouver. Lang, A. S., and Beatty, J. T. (2000). Genetic analysis of a bacterial genetic exchange element: the gene transfer agent of Rhodobacter capsulatus. Proc Natl Acad Sci U S A 97, 859-864. Lang, A. S., and Beatty, J. T. (2001). The gene transfer agent of Rhodobacter capsulatus and "constitutive transduction" in prokaryotes. Arch Microbiol 175, 241- 249. Lang, A. S., and Beatty, J. T. (2002). A bacterial signal transduction system controls genetic exchange and motility. J Bacteriol 184, 913-918. Lang, A. S., and Beatty, J. T. (2007). Importance of widespread gene transfer agent genes in alpha-proteobacteria. Trends Microbiol 15, 54-62.  146  Laub, M. T., Chen, S. L., Shapiro, L., and McAdams, H. H. (2002). Genes directly controlled by CtrA, a master regulator of the Caulobacter cell cycle. Proc Natl Acad Sci U S A 99, 4632-4637. Laub, M. T., and Goulian, M. (2007). Specificity in two-component signal transduction pathways. Annu Rev Genet 41, 121-145. Laub, M. T., McAdams, H. H., Feldblyum, T., Fraser, C. M., and Shapiro, L. (2000). Global analysis of the genetic network controlling a bacterial cell cycle. Science 290, 2144-2148. Magasanik, B. (1996). Regulation of nitrogen utilization. In Escherichia coli and Salmonella: Cellular and Molecular Biology, F.C. Neidhardt, ed. (Washington, DC: American Society for Microbiology), pp. 1344-1356. Marrs, B. (1974). Genetic recombination in Rhodopseudomonas capsulata. Proc Natl Acad Sci U S A 71, 971-973. Medina, G., Juarez, K., Valderrama, B., and Soberon-Chavez, G. (2003). Mechanism of Pseudomonas aeruginosa RhlR transcriptional regulation of the rhlAB promoter. J Bacteriol 185, 5976-5983. Mercer, R. G., Callister, S. J., Lipton, M. S., Pasa-Tolic, L., Strnad, H., Paces, V., Beatty, J. T., and Lang, A. S. (2010). Loss of the Response Regulator CtrA Causes Pleiotropic Effects on Gene Expression in Rhodobacter capsulatus but Does Not Affect Growth Phase Regulation. Journal of Bacteriology 192 (In press). Miller, J. H. (1992). A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria,  (Plainview, N.Y.: Cold Spring Harbor Laboratory Press). Miller, M. B., and Bassler, B. L. (2001). Quorum sensing in bacteria. Annu Rev Microbiol 55, 165-199. Mitrophanov, A. Y., and Groisman, E. A. (2008). Signal integration in bacterial two- component regulatory systems. Genes Dev 22, 2601-2611. Moreno-Hagelsieb, G., and Collado-Vides, J. (2002). A powerful non-homology method for the prediction of operons in prokaryotes. Bioinformatics 18 Suppl 1, S329-336. Moreno-Hagelsieb, G., and Latimer, K. (2008). Choosing BLAST options for better detection of orthologs as reciprocal best hits. Bioinformatics 24, 319-324. Norrander, J., Kempe, T., and Messing, J. (1983). Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26, 101-106. Parkinson, J. S. (1995). Genetic Approaches for Signaling Pathways and Protiens. In Two-component Signal Transduction, J.A. Hoch, and T.J. Silhavy, eds. (Washington, DC: American Society for Microbiology), pp. 9-24. Paul, J. H. (2008). Prophages in marine bacteria: dangerous molecular time bombs or the key to survival in the seas? ISME J 2, 579-589. Peterson, G. (1983). Determination of total protein. Meth Enzymol 91, 95-119. Piper, K. R., Beck von Bodman, S., and Farrand, S. K. (1993). Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362, 448-450. Pratt, L. A., and Silhavy, T. J. (1995). Porin Reguon of Escherichia coli. In Two- component Signal Transduction, J.A. Hoch, and T.J. Silhavy, eds. (Washington, DC: American Society for Microbiology), pp. 105-128.  147  Price, M. N., Arkin, A. P., and Alm, E. J. (2006). The life-cycle of operons. PLoS Genet 2, e96. Puskas, A., Greenberg, E. P., Kaplan, S., and Schaefer, A. L. (1997). A quorum-sensing system in the free-living photosynthetic bacterium Rhodobacter sphaeroides. J Bacteriol 179, 7530-7537. Quon, K. C., Marczynski, G. T., and Shapiro, L. (1996). Cell cycle control by an essential bacterial two-component signal transduction protein. Cell 84, 83-93. Ramirez, E., Schmidt, M., Rinas, U., and Villaverde, A. (1999). RecA-dependent viral burst in bacterial colonies during the entry into stationary phase. FEMS Microbiol Lett 170, 313-317. Ramirez, E., and Villaverde, A. (1997). Viral spread within ageing bacterial populations. Gene 202, 147-149. Ranquet, C., Toussaint, A., de Jong, H., Maenhaut-Michel, G., and Geiselmann, J. (2005). Control of bacteriophage mu lysogenic repression. J Mol Biol 353, 186-195. Rapp, B. J., and Wall, J. D. (1987). Genetic transfer in Desulfovibrio desulfuricans. Proc Natl Acad Sci USA 84, 9128–9130. Reisenauer, A., Quon, K., and Shapiro, L. (1999). The CtrA response regulator mediates temporal control of gene expression during the Caulobacter cell cycle. J Bacteriol 181, 2430-2439. Salgado, H., Moreno-Hagelsieb, G., Smith, T. F., and Collado-Vides, J. (2000). Operons in Escherichia coli: genomic analyses and predictions. Proc Natl Acad Sci U S A 97, 6652-6657. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning : a laboratory manual 2nd edn (Plainview: New York : Cold Spring Harbor Laboratory Press). Santos-Beneit, F., Rodriguez-Garcia, A., Sola-Landa, A., and Martin, J. F. (2009). Cross-talk between two global regulators in Streptomyces: PhoP and AfsR interact in the control of afsS, pstS and phoRP transcription. Mol Microbiol 72, 53-68. Schaefer, A. L., Taylor, T. A., Beatty, J. T., and Greenberg, E. P. (2002). Long-chain acyl-homoserine lactone quorum-sensing regulation of Rhodobacter capsulatus gene transfer agent production. J Bacteriol 184, 6515-6521. Schneider, T. D., and Stephens, R. M. (1990). Sequence logos: a new way to display consensus sequences. Nucleic Acids Res 18, 6097-6100. Simon, R., Priefer, U., and Puhler, A. (1983). A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotech 1, 784-791. Solioz, M., Yen, H. C., and Marris, B. (1975). Release and uptake of gene transfer agent by Rhodopseudomonas capsulata. J Bacteriol 123, 651-657. Stock, J. B., Ninfa, A. J., and Stock, A. M. (1989). Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol Rev 53, 450-490. Stock, J. B., Surette, M. G., Levit, M., and Park, P. (1995). Two-Component Signal Transduction Systems: Structure-Function relationships and Mechanisms of Catalysis. In Two-component Signal Transduction, J.A. Hoch, and T.J. Silhavy, eds. (Washington, DC: American Society for Microbiology), pp. 25-52.  148  Suarez, J. E., Clayton, T. M., Rodriguez, A., Bibb, M. J., and Chater, K. F. (1992). Global transcription pattern of phi C31 after induction of a Streptomyces coelicolor lysogen at different growth stages. J Gen Microbiol 138, 2145-2157. Suck, D., Lahm, A., and Oefner, C. (1988). Structure refined to 2A of a nicked DNA octanucleotide complex with DNase I. Nature 332, 464-468. Sun, G., Birkey, S. M., and Hulett, F. M. (1996a). Three two-component signal- transduction systems interact for Pho regulation in Bacillus subtilis. Mol Microbiol 19, 941-948. Sun, G., Sharkova, E., Chesnut, R., Birkey, S., Duggan, M. F., Sorokin, A., Pujic, P., Ehrlich, S. D., and Hulett, F. M. (1996b). Regulators of aerobic and anaerobic respiration in Bacillus subtilis. J Bacteriol 178, 1374-1385. Suttle, C. (2005). Viruses in the sea. Nature 437, 356-361. Swem, L. R., Elsen, S., Bird, T. H., Swem, D. L., Koch, H. G., Myllykallio, H., Daldal, F., and Bauer, C. E. (2001). The RegB/RegA two-component regulatory system controls synthesis of photosynthesis and respiratory electron transfer components in Rhodobacter capsulatus. J Mol Biol 309, 121-138. Taylor, T. A. (2004) Evolution and Regulation of the Gene Transfer Agent (GTA) of Rhodobacter capsulatus, University of British Columbia, Vancouver. Travers, A. A. (1989). DNA conformation and protein binding. Annu Rev Biochem 58, 427-452. Urbanowski, M. L., Lostroh, C. P., and Greenberg, E. P. (2004). Reversible acyl- homoserine lactone binding to purified Vibrio fischeri LuxR protein. J Bacteriol 186, 631-637. van Passel, M., Thygesen, H., Luyf, A., van Kampen, A., and van der Ende, A. (2005). An acquisition account of genomic islands based on genome signature comparisons. BMC Genomics 6, 163-173. Vannini, A., Volpari, C., Gargioli, C., Muraglia, E., Cortese, R., De Francesco, R., Neddermann, P., and Marco, S. D. (2002). The crystal structure of the quorum sensing protein TraR bound to its autoinducer and target DNA. EMBO J 21, 4393- 4401. Verhamme, D. T., Arents, J. C., Postma, P. W., Crielaard, W., and Hellingwerf, K. J. (2002). Investigation of in vivo cross-talk between key two-component systems of Escherichia coli. Microbiology 148, 69-78. Vichivanives, P., Bird, T. H., Bauer, C. E., and Robert Tabita, F. (2000). Multiple regulators and their interactions in vivo and in vitro with the cbb regulons of Rhodobacter capsulatus. J Mol Biol 300, 1079-1099. von Bodman, S. B., Ball, J. K., Faini, M. A., Herrera, C. M., Minogue, T. D., Urbanowski, M. L., and Stevens, A. M. (2003). The quorum sensing negative regulators EsaR and ExpR(Ecc), homologues within the LuxR family, retain the ability to function as activators of transcription. J Bacteriol 185, 7001-7007. Wall, J. D., Weaver, P. F., and Gest, H. (1975). Gene transfer agents, bacteriophages, and bacteriocins of Rhodopseudomonas capsulata. Arch Microbiol 105, 217-224. Wanner, B. L. (1995). Signal transduction and cross regulation in the Escherichia coli phosphate regulon by PhoR, CreC and acetyl  149  phosphate. In Two-component Signal Transduction, J.A. Hoch, and T.J. Silhavy, eds. (Washington, DC: American Society for Microbiology), pp. 203-221. Waters, C. M., and Bassler, B. L. (2005). Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21, 319-346. Weingart, C. L., White, C. E., Liu, S., Chai, Y., Cho, H., Tsai, C. S., Wei, Y., Delay, N. R., Gronquist, M. R., Eberhard, A., and Winans, S. C. (2005). Direct binding of the quorum sensing regulator CepR of Burkholderia cenocepacia to two target promoters in vitro. Mol Microbiol 57, 452-467. Welch, M., Todd, D. E., Whitehead, N. A., McGowan, S. J., Bycroft, B. W., and Salmond, G. P. (2000). N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia. EMBO J 19, 631-641. Wong, D. K., Collins, W. J., Harmer, A., Lilburn, T. G., and Beatty, J. T. (1996). Directed mutagenesis of the Rhodobacter capsulatus puhA gene and orf 214: pleiotropic effects on photosynthetic reaction center and light-harvesting 1 complexes. J Bacteriol 178, 2334-2342. Yen, H. C., Hu, N. T., and Marrs, B. L. (1979). Characterization of the gene transfer agent made by an overproducer mutant of Rhodopseudomonas capsulata. J Mol Biol 131, 157-168. Yen, H. C., and Marrs, B. L. (1976). Maps of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata. J Bacteriol 126, 619-629. Zhang, R. G., Pappas, T., Brace, J. L., Miller, P. C., Oulmassov, T., Molyneaux, J. M., Anderson, J. C., Bashkin, J. K., Winans, S. C., and Joachimiak, A. (2002). Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 417, 971-974. Zhu, J., and Winans, S. C. (1999). Autoinducer binding by the quorum-sensing regulator TraR increases affinity for target promoters in vitro and decreases TraR turnover rates in whole cells. Proc Natl Acad Sci U S A 96, 4832-4837. Zhu, J., and Winans, S. C. (2001). The quorum-sensing transcriptional regulator TraR requires its cognate signaling ligand for protein folding, protease resistance, and dimerization. Proc Natl Acad Sci U S A 98, 1507-1512.     150  APPENDIX A – ANOVA FOR LACZ ASSAYS   Sum of Squares df Mean Square F Sig. Figure 3.2   Between Groups 70787 5 14157 42.952 0.000   Within Groups 3955 12 330   Total 74742 17 Figure 3.4   Between Groups 228 3 76 0.946 0.463   Within Groups 644 8 80   Total 872 11 Figure 3.5   Between Groups 60456 2 30228 94.928 0.000   Within Groups 1911 6 318   Total 62366 8 Figure 3.6   Between Groups 3744474 4 936119 20.179 0.000   Within Groups 463905 10 46391   Total 4208380 14 Figure 3.7 (compare WT, ctrA- and gtaI- within a given time point) 8 hr Between Groups 38872 2 19436 3.416 0.102   Within Groups 34135 6 5689   Total 73007 8 16 hr Between Groups 281821 2 140910 18.393 0.003   Within Groups 45966 6 7661   Total 327787 8 28 hr Between Groups 654330 2 327165 12.385 0.007   Within Groups 158494 6 26416   Total 812824 8 36 hr Between Groups 1135283 2 567642 15.601 0.004   Within Groups 218308 6 36385   Total 1353591 8 48 hr Between Groups 2060515 2 1030257 35.435 0.000   Within Groups 174448 6 29075   Total 2234963 8   151    Sum of Squares df Mean Square F Sig. 72 hr Between Groups 2909957 2 1454979 25.840 0.001   Within Groups 337838 6 56306   Total 3247795 8 96 hr Between Groups 3179749 2 1589875 11.598 0.009   Within Groups 822469 6 137078   Total 4002218 8 120 hr Between Groups 2314696 2 1157348 19.139 0.002   Within Groups 362828 6 60471   Total 2677524 8 144 hr Between Groups 2703137 2 1351569 11.673 0.009   Within Groups 694722 6 115787   Total 3397859 8 168 hr Between Groups 16304 2 8152 0.136 0.875   Within Groups 358541 6 59757   Total 374846 8 Figure 3.7 (compare time points within WT, ctrA- and gtaI- growth curves) WT Between Groups 12510000 9 1389461 22.100 0.000   Within Groups 1257427 20 62871   Total 13760000 29 ctrA- Between Groups 14300000 9 1589442 18.470 0.000   Within Groups 1721152 20 86058   Total 16030000 29 gtaI- Between Groups 2016716 9 224080 19.556 0.000   Within Groups 229168 20 11458   Total 2245884 29 Figure 3.10   Between Groups 13340000 11 1212475 70.123 0.000   Within Groups 397688 23 17291   Total 13730000 34 Figure 3.11   Between Groups 9248363 11 840760 16.005 0.000   Within Groups 2836738 54 52532   Total 12090000 65   152    Sum of Squares df Mean Square F Sig. Figure 3.13 (compare ctrA promoter deletions within different growth conditions) PS RCV Between Groups 9624690 9 1069410 85.329 0.000   Within Groups 250654 20 12533   Total 9875344 29 PS YPS Between Groups 1827980 9 203109 4.983 0.001   Within Groups 815224 20 40761   Total 2643204 29 AE RCV Between Groups 2191367 9 243485 4.667 0.002   Within Groups 1043515 20 52176   Total 3234883 29 AE YPS Between Groups 651280 9 72364 1.247 0.323   Within Groups 1160726 20 58036   Total 1812006 29 Figure 3.13 (compare different growth conditions within ctrA promoter deletions) p601-17 Between Groups 2442555 3 814185 14.687 0.001   Within Groups 443492 8 55437   Total 2886047 11 p601-11 Between Groups 1840481 3 613494 4.906 0.032   Within Groups 1000356 8 125044   Total 2840837 11 p601-SIR Between Groups 1336880 3 445627 4.670 0.036   Within Groups 763403 8 95425   Total 2100283 11 p601-IRD Between Groups 1405440 3 468480 14.121 0.001   Within Groups 265411 8 33176   Total 1670851 11 p601-11.7 Between Groups 157242 3 52414 0.619 0.622   Within Groups 676993 8 84624   Total 834235 11 p601-9 Between Groups 225335 3 75112 6.982 0.013   Within Groups 86069 8 10759   Total 311403 11 p601-7 Between Groups 31612 3 10537 3.302 0.078   Within Groups 25530 8 3191   Total 57142 11   153    Sum of Squares df Mean Square F Sig. p601-5 Between Groups 702 3 234 2.219 0.163   Within Groups 844 8 105   Total 1545 11 p601-17x Between Groups 8791 3 2930 5.594 0.023   Within Groups 4191 8 524   Total 12981 11 p601-11x Between Groups 1472 3 491 1.024 0.432   Within Groups 3831 8 479   Total 5303 11 Figure 3.14   Between Groups 3965631 7 566519 22.579 0.000   Within Groups 401450 16 25091   Total 4367081 23 Figure 3.15   Between Groups 1343104 3 447701 15.465 0.001   Within Groups 231593 8 28949   Total 1574697 11 Figure 3.16 WT Between Groups 702817 3 234272 30.992 0.000   Within Groups 60473 8 7559   Total 763290 11 gtaR- Between Groups 522502 3 174167 30.711 0.000   Within Groups 45369 8 5671   Total 567871 11   154    Sum of Squares df Mean Square F Sig. Figure 3.16             Between Groups 23014 1 23014 1.584 0.277 Within Groups 58123 4 14531 Total 81137 5 Between Groups 6554 1 6554 0.738 0.439 Within Groups 35507 4 8877 Total 42061 5 Between Groups 189 1 189 0.184 0.690 Within Groups 4111 4 1028 Total 4300 5 Between Groups 1051 1 1051 0.519 0.511 Within Groups 8102 4 2026 Total 9153 5 Figure 3.17 WT Between Groups 9624690 9 1069410 85.329 0.000   Within Groups 250654 20 12533   Total 9875344 29 gtaI- Between Groups 982894 9 109210 13.942 0.000   Within Groups 156667 20 7833   Total 1139561 29 gtaR- Between Groups 14560000 9 1617466 50.283 0.000   Within Groups 643345 20 32167   Total 15200000 29 gtaI-/gtaR- Between Groups 881231 3 293744 5.610 0.023   Within Groups 418882 8 52360   Total 1300113 11 Figure 3.17 p601-17 Between Groups 2488588 3 829529 17.771 0.001   Within Groups 373429 8 46679   Total 2862017 11 p601-11 Between Groups 2268324 2 1134162 73.173 0.000   Within Groups 92998 6 15500   Total 2361322 8 p601-SIR Between Groups 2187842 3 729281 12.526 0.002   Within Groups 465771 8 58221   Total 2653614 11  155    Sum of Squares df Mean Square F Sig. p601-IRD Between Groups 3688220 3 1229407 25.013 0.000   Within Groups 393198 8 49150   Total 4081418 11 p601-11.7 Between Groups 1206367 3 402122 25.575 0.000   Within Groups 125785 8 15723   Total 1332152 11 p601-9 Between Groups 274467 2 137233 149.150 0.000   Within Groups 5521 6 920   Total 279987 8 p601-7 Between Groups 5624 2 2812 1.753 0.251   Within Groups 9626 6 1604   Total 15250 8 p601-5 Between Groups 901 2 450 14.272 0.005   Within Groups 189 6 32   Total 1090 8 p601-17x Between Groups 3202 2 1601 6.359 0.033   Within Groups 1511 6 252   Total 4713 8 p601-11x Between Groups 1036 2 518 2.044 0.210   Within Groups 1520 6 253   Total 2556 8 Figure 3.18 PS RCV Between Groups 1343104 3 447701 15.465 0.001   Within Groups 231593 8 28949   Total 1574697 11 PS YPS Between Groups 97060 3 32353 0.819 0.519   Within Groups 315860 8 39482   Total 412919 11 AE RCV Between Groups 30635 3 10212 0.176 0.910   Within Groups 464396 8 58049   Total 495031 11 AE YPS Between Groups 32211 3 10737 0.311 0.817   Within Groups 276425 8 34553   Total 308636 11   156    Sum of Squares df Mean Square F Sig. Figure 3.18 WT Between Groups 1029238 3 343079 6.207 0.017   Within Groups 442206 8 55276   Total 1471443 11 gtaI- Between Groups 1233275 3 411092 27.824 0.000   Within Groups 118198 8 14775   Total 1351473 11 gtaR- Between Groups 1297583 3 432528 10.249 0.004   Within Groups 337626 8 42203   Total 1635209 11 gtaI-/ gtaR- Between Groups 232672 3 77557 1.590 0.266   Within Groups 390243 8 48780   Total 622915 11 Figure 3.19   Between Groups 4567 3 1522 4.446 0.041   Within Groups 2739 8 342   Total 7307 11 Figure 3.21   Between Groups 24772 3 8257 26.744 0.000   Within Groups 2470 8 309   Total 27242 11 Figure 3.22   Between Groups 3063 3 1021 2.489 0.135   Within Groups 3282 8 410   Total 6345 11    157  APPENDIX B – MEANS FOR GROUPS IN HOMOGENEOUS SUBSETS Tukey‟s test was used to analyze data sets that had equal sample size (N) and Gabriel‟s test was used to analyze data sets that had unequal sample size. Conditions N Subset for alpha = 0.05 1 2 3 4 5 Figure 3.2   pYnP 3 9 pG61 3 16 pG15 3 21 pG64 3 23 pYP 3   74 pG65 3     187 Sig.   0.921 1.000 1.000 Figure 3.4   PS RCV 3 5 AE RCV 3 11 PS YPS 3 12 AE YPS 3 17 Sig.   0.392 Figure 3.5   ctrA - 3 3 cckA- 3 25 Y262 3   187 Sig.   0.371 1.000 Figure 3.6   WT (pXCA601) 3 5 gtaI- 3   669 WT 3   1214 1214 ctrA- 3     1257 cckA- 3     1309 Sig.   1.000 0.067 0.981   158  Conditions N Subset for alpha = 0.05 1 2 3 4 5 Figure 3.7 (compare timepoints within WT, ctrA- and gtaI- growth curves) 8 hr cckA - 3 217 WT 3 296 ctrA- 3 378 Sig.   0.088 16 hr cckA - 3 300 WT 3   617 ctrA- 3   714 Sig.   1.000 0.419 28 hr cckA - 3 594 WT 3   1044 ctrA- 3   1238 Sig.   1.000 0.374 36 hr cckA - 3 719 WT 3   1455 ctrA- 3   1488 Sig.   1.000 0.975 48 hr cckA - 3 894 WT 3   1766 ctrA- 3   2008 Sig.   1.000 0.266 72 hr cckA - 3 876 WT 3   1936 ctrA- 3   2188 Sig.   1.000 0.443 96 hr cckA - 3 1009 WT 3   2210 ctrA- 3   2322 Sig.   1.000 0.928 120 hr cckA - 3 986 WT 3   1806 ctrA- 3   2204 Sig.   1.000 0.198  159  Conditions N Subset for alpha = 0.05 1 2 3 4 5 144 hr cckA - 3 854 ctrA- 3   1888 WT 3   2112 Sig.   1.000 0.711 168 hr ctrA - 3 622 cckA- 3 694 WT 3 724 Sig.   0.870 Figure 3.7 (compare WT, ctrA- and gtaI- within a given time point) WT 8 hr 3 296 16 hr 3 617 617 168 hr 3 724 724 28 hr 3   1044 1044 36 hr 3     1455 1455 48 hr 3     1766 1766 1766 120 hr 3       1806 1806 72 hr 3       1936 1936 144 hr 3       2112 2112 96 hr 3         2210 Sig.   0.552 0.556 0.052 0.096 0.504 ctrA- 8 hr 3 378 168 hr 3 622 622 16 hr 3 714 714 714 28 hr 3   1238 1238 1238 36 hr 3     1488 1488 1488 144 hr 3       1888 1888 48 hr 3       2008 2008 72 hr 3         2188 120 hr 3         2204 96 hr 3         2322 Sig.   0.912 0.293 0.092 0.095 0.056   160  Conditions N Subset for alpha = 0.05 1 2 3 4 5 cckA- 8 hr 3 217 16 hr 3 300 300 28 hr 3   594 594 168 hr 3     694 694 36 hr 3     719 719 719 144 hr 3     854 854 854 72 hr 3     876 876 876 48 hr 3     894 894 894 120 hr 3       986 986 96 hr 3         1009 Sig.   0.992 0.071 0.062 0.075 0.077 Figure 3.10   p601-17x 3 11 p601-5 3 23 p601-11x 2 38 p601-7 3 140 140 p601-9 3   491 p601-11.7 3   501 p601-SIR 3     1195 p601-IRD 3     1220 p601-13 3     1273 p601-11 3     1373 p601-17 3     1418 1418 p601-15 3       1773 Sig.   0.986 0.099 0.667 0.109    161  Conditions N Subset for alpha = 0.05 1 2 3 4 5 Figure 3.11 (Gabriel‟s test used for this set)   AE YPS ctrA - 6 274 AE YPS WT 9 284 AE RCV cckA- 3 375 AE YPS cckA- 7 380 PS YPS WT 6 510 510 AE RCV ctrA- 3 525 525 AE RCV WT 6 531 531 PS YPS ctrA- 3 726 726 726 PS YPS cckA- 2 788 788 788 788 PS RCV cckA- 6   1050 1050 1050 PS RCV ctrA- 6     1147 1147 PS RCV WT 9       1295 Sig.   0.087 0.055 0.377 0.101 Figure 3.13 PS RCV p601-17x 3 11   p601-5 3 23   p601-11x 3 45   p601-7 3 140   p601-9 3   491   p601-11.7 3   501   p601-SIR 3     1195   p601-IRD 3     1220   p601-11 3     1373   p601-17 3     1418   Sig.   0.910 1.000 0.354 PS YPS p601-5 3 13   p601-11x 3 54   p601-17x 3 75 75   p601-7 3 206 206 206   p601-9 3 304 304 304   p601-17 3 355 355 355   p601-11.7 3 477 477 477   p601-IRD 3 575 575 575   p601-SIR 3   656 656   p601-11 3     737   Sig.   0.065 0.052 0.094  162  Conditions N Subset for alpha = 0.05 1 2 3 4 5 AE RCV p601-17x 3 16   p601-5 3 22   p601-11x 3 36 36   p601-7 3 62 62 62   p601-9 3 114 114 114   p601-SIR 3 306 306 306   p601-IRD 3 477 477 477   p601-17 3 541 541 541   p601-11.7 3   689 689   p601-11 3     713   Sig.   0.195 0.054 0.056 AE YPS p601-11x 3 24   p601-5 3 35   p601-17x 3 56   p601-7 3 119   p601-9 3 230   p601-11 3 274   p601-17 3 296   p601-IRD 3 322   p601-11.7 3 372   p601-SIR 3 475   Sig.   0.433 Figure 3.13 p601-17 AE YPS 3 296   PS YPS 3 355   AE RCV 3 541   PS RCV 3   1418   Sig.   0.599 1.000 p601-11 AE YPS 3 274   AE RCV 3 713 713   PS YPS 3 737 737   PS RCV 3   1373   Sig.   0.428 0.180    163  Conditions N Subset for alpha = 0.05 1 2 3 4 5 p601-SIR AE RCV 3 306   AE YPS 3 475 475   PS YPS 3 656 656   PS RCV 3   1195   Sig.   0.539 0.082 p601-IRD AE YPS 3 322   AE RCV 3 477   PS YPS 3 575   PS RCV 3   1220   Sig.   0.383 1.000 p601-11.7 AE YPS 3 372   PS YPS 3 477   PS RCV 3 501   AE RCV 3 689   Sig.   0.567 p601-9 AE RCV 3 114   AE YPS 3 230 230   PS YPS 3 304 304   PS RCV 3   491   Sig.   0.190 0.060 p601-7 AE RCV 3 62   AE YPS 3 119   PS RCV 3 140   PS YPS 3 206   Sig.   0.057 p601-5 PS7 YPS 3 13   AE RCV 3 22   PS RCV 3 23   AE YPS 3 35   Sig.   0.122 p601-17x PS RCV 3 11   AE RCV 3 16 16   AE YPS 3 56 56   PS YPS 3   75   Sig.   0.153 0.051  164  Conditions N Subset for alpha = 0.05 1 2 3 4 5 p601-11x AE YPS 3 24   AE RCV 3 36   PS RCV 3 45   PS YPS 3 54   Sig.   0.400 Figure 3.14   trace P 3 217   1/640 P 3 297   1/5 P 3 490 490   2 C 3 584 584 584   1/2 N 3   870 870   RCV 3     994   1/5 C 3     1021   RCV + MOPS 3       1518   Sig.   0.153 0.128 0.059 1.000 Figure 3.15   gtaI - 3 294   gtaI -/gtaR- 3   995   WT 3   1040   gtaR - 3   1136   Sig.   1.000 0.745 Figure 3.16   12  hr 3 377   16  hr 3 517 517   24  hr 3   715   36 hr 3     1022   Sig.   0.271 0.091 1.000   165  Conditions N Subset for alpha = 0.05 1 2 3 4 5 Figure 3.17 WT p601-17x 3 11   p601-5 3 23   p601-11x 3 45   p601-7 3 140   p601-9 3   491   p601-11.7 3   501   p601-SIR 3     1195   p601-IRD 3     1220   p601-11 3     1373   p601-17 3     1418   Sig.   0.910 1.000 0.354 gtaI- p601-17x 3 15   p601-11x 3 24   p601-5 3 44   p601-7 3 81   p601-9 3 85   p601-11 3 220 220   p601-11.7 3 241 241   p601-17 3   399 399   p601-SIR 3   423 423   p601-IRD 3     546   Sig.   0.112 0.199 0.588 gtaR- p601-5 3 23   p601-11x 3 48   p601-17x 3 53   p601-7 3 124   p601-9 3 404   p601-11.7 3   946   p601-11 3   1168 1168   p601-SIR 3   1436 1436   p601-17 3     1545 1545   p601-IRD 3       1985   Sig.   0.279 0.074 0.289 0.142   166  Conditions N Subset for alpha = 0.05 1 2 3 4 5 p601-17 gtaI - 3 399   gtaI -/gtaR- 3   1353   WT 3   1418   gtaR - 3   1545   Sig.   1.000 0.705 p601-SIR gtaI - 3 423   WT 3   1195   gtaR - 3   1436   gtaI -/gtaR- 3   1494   Sig.   1.000 0.472 p601-IRD gtaI - 3 546   WT 3   1220   gtaI -/gtaR- 3   1758 1758   gtaR - 3     1985   Sig.   1.000 0.069 0.616 p601-11.7 gtaI - 3 241   WT 3 501   gtaR - 3   946   gtaI -/gtaR- 3   1007   Sig.   0.128 0.929 Figure 3.18 WT AE YPS 3 294   PS YPS 3   995   PS RCV 3   1040   AE RCV 3   1136   Sig.   1.000 0.745 gtaI- PS YPS 3 283   PS RCV 3 355   AE YPS 3 374   AE RCV 3 530   Sig.   0.470   167  Conditions N Subset for alpha = 0.05 1 2 3 4 5 gtaR- AE RCV 3 455   PS YPS 3 510   PS RCV 3 541   AE YPS 3 595   Sig.   0.891 gtaI-/gtaR- PS YPS 3 154   AE YPS 3 224   AE RCV 3 255   PS RCV 3 296   Sig.   0.788 Figure 3.18 PS RCV gtaI -/gtaR- 3 296   gtaI - 3 355   gtaR - 3 541 541   WT 3   1040   Sig.   0.598 0.117 PS YPS gtaI -/gtaR- 3 154   gtaI - 3 283 283   gtaR - 3   510   WT 3     995   Sig.   0.585 0.181 1.000 AE RCV gtaI -/gtaR- 3 255   gtaR - 3 455   gtaI - 3 530   WT 3   1136   Sig.   0.411 1.000 AE YPS gtaI -/gtaR- 3 224   WT 3 294   gtaI - 3 374   gtaR - 3 595   Sig.   0.246   168  Conditions N Subset for alpha = 0.05 1 2 3 4 5 Figure 3.19  gtaI - 3 64   gtaR - 3 103 103   WT 3 109 109   gtaI -/gtaR- 3   114   Sig.   0.070 0.877 Figure 3.21   p601-P1R 3 3   p601-P23 3 47   p601-P2R 3   109   p601-P25 3   111   Sig.   0.059 0.999 Figure 3.22   AE YPS 3 69   PS YPS 3 81   AE RCV 3 85   PS RCV 3 113   Sig.   0.111 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0069928/manifest

Comment

Related Items