Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of a novel secretion system in Leishmania : composition, mechanisms, and immune modulating… Silverman, Judith Maxwell 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_silverman_judith.pdf [ 8.13MB ]
Metadata
JSON: 24-1.0069776.json
JSON-LD: 24-1.0069776-ld.json
RDF/XML (Pretty): 24-1.0069776-rdf.xml
RDF/JSON: 24-1.0069776-rdf.json
Turtle: 24-1.0069776-turtle.txt
N-Triples: 24-1.0069776-rdf-ntriples.txt
Original Record: 24-1.0069776-source.json
Full Text
24-1.0069776-fulltext.txt
Citation
24-1.0069776.ris

Full Text

Identification of a Novel Secretion System in Leishmania: Composition, Mechanisms and Immune Modulating Properties by  Judith Maxwell Silverman  Artium Baccalaureus, Columbia University, Barnard College, Summa Cum Laude  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in  The Faculty of Graduate Studies (Microbiology and Immunology)  The University of British Columbia (Vancouver)  April 2010  ©Judith Maxwell Silverman, 2010  Abstract Human infection with protozoa of the genus Leishmania results in a spectrum of disease manifestations collectively termed the leishmaniases. These diseases involve a chronic infection of macrophages which display a deactivated phenotype. Various proteins secreted by leishmania are known to interact with host signaling molecules, bringing about activation of negative feedback loops. Some of these have been shown to block interferon-γ signaling and to inhibit macrophage microbicidal functions. Unlike the well characterized secretion mechanisms used by bacterial pathogens, the mechanism(s) by which leishmania and other eukaryotic pathogens secrete proteins into host cells has remained elusive. The overall aim of this project was to gain a more thorough understanding of host immune-modulation by leishmania, based on the hypothesis that much of these effects are mediated by secreted proteins. The project goals were to: 1) comprehensively identify the proteins secreted by leishmania, 2) determine the mechanism by which proteins are secreted from leishmania into host cells, and 3) determine the functional properties of leishmania secreted compounds. To achieve these goals, a global proteomic analysis of leishmania secreted proteins was carried out using quantitative mass spectrometry. This identified 358 bona fide leishmania secreted proteins many of which were orthologs of proteins considered to be markers of mammalian exosomes. Subsequent experiments confirmed that leishmania secrete exosomes into conditioned media. Comparative proteomics showed that exosomes account for at least 50% of protein secretion by leishmania. Furthermore, the results showed that the cargo profile of leishmania exosomes is influenced by changes in temperature and pH, similar to those experienced by promastigotes after host invasion. Microscopy of leishmania infected cells confirmed the novel finding that leishmania use exosomes to deliver proteins into host cells. Additional studies demonstrated that leishmania exosomes have immunosuppressive properties which, in a cargo dependent manner, modulate the responses of monocytes, dendritic cells, and T lymphocytes. These findings suggest that leishmania utilize exosomes in long-range cellular communication and immune-modulation. In conclusion, this research has significantly advanced the current knowledge of leishmania biology, through the identification of novel secreted molecules, discovery of a secretion system, and description of the immune-modulating effects of leishmania exosomes.  ii  Table of Contents Abstract ................................................................................................................................................. ii Table of Contents ................................................................................................................................. iii List of Tables ......................................................................................................................................... ix List of Figures ......................................................................................................................................... x List of Abbreviations ............................................................................................................................ xii Acknowledgements ............................................................................................................................ xiv Dedication............................................................................................................................................ xv Co-Authorship Statement ................................................................................................................... xvi 1.  Introduction .................................................................................................................................1 1.1  Epidemiology, transmission and disease manifestations of the leishmaniases ......................1  1.2  Immunopathogenesis of leishmania infection .........................................................................4  1.3  Leishmania target host cell signaling pathways and inhibit phagocyte activation ..................8  1.4  Exosomes............................................................................................................................... 10  1.5  Bibliography .......................................................................................................................... 15  2.  Proteomic Analysis of the Secretome of Leishmania donovani ................................................ 24 2.1  Summary ............................................................................................................................... 24  2.2  Background ........................................................................................................................... 25  2.3  Results ................................................................................................................................... 27  2.3.1  Leishmania conditioned medium contains a multiplicity of enriched proteins. ........... 27  iii  2.3.2  Quantitative mass spectrometry identifies a wide array of leishmania secreted  proteins………….. ................................................................................................................................ 29 2.3.3  Gene ontology analysis of the leishmania secretome. ................................................. 32  2.3.4  Bioinformatics analysis of secreted proteins in the leishmania genome. .................... 36  2.3.5  Evidence that proteins released by leishmania may originate in exosome-like vesicles,  apoptotic vesicles, and glycosomes. ................................................................................................. 38 2.4  Discussion .............................................................................................................................. 40  2.5  Conclusions ........................................................................................................................... 52  2.6  Materials and methods ......................................................................................................... 52  2.6.1  Cell culture .................................................................................................................... 52  2.6.2  Isolation of promastigote conditioned medium ........................................................... 53  2.6.3  Protein precipitation ..................................................................................................... 54  2.6.4  Glucose-6-phosphate dehydrogenase assay................................................................. 55  2.6.5  LC-MS/MS of promastigote conditioned medium and data analysis ........................... 55  2.6.6  Western blotting ........................................................................................................... 57  2.6.7  Scanning electron microscopy ...................................................................................... 57  2.6.8  Bioinformatics screen of the genome of L. major to identify candidate secreted  proteins…………. ................................................................................................................................. 58 2.6.9  Gene ontology ............................................................................................................... 58  2.6.10 Statistical analysis ......................................................................................................... 58 2.7  Additional data files .............................................................................................................. 59 iv  2.8 3.  Bibliography .......................................................................................................................... 60 An Exosome-based Secretion Pathway is Responsible for Protein Export from Leishmania and  for Communication with Macrophages .................................................................................................... 68 3.1  Summary ............................................................................................................................... 68  3.2  Background ........................................................................................................................... 69  3.3  Results ................................................................................................................................... 70  3.3.1  Protein secretion by leishmania involves the release of exosome-like vesicles ........... 70  3.3.2  Leishmania exosome release at elevated temperature and low pH ............................ 72  3.3.3  Proteomic analysis of L. donovani exosomes................................................................ 75  3.3.4  Functional annotation of exosomes released at elevated temperature and low pH ... 78  3.3.5  Leishmania exosomes are released into infected macrophages and are taken up by  naïve cells from the extracellular environment ................................................................................ 79 3.3.6 3.4  Leishmania exosomes selectively induce macrophage secretion of IL-8 ...................... 83  Discussion .............................................................................................................................. 84  3.4.1  Exosome phenotype is modulated in response to infection-like conditions ................ 84  3.4.2  Leishmania exosomes are delivered to host cells and facilitate pathogen-host  communication ................................................................................................................................. 85 3.5  Conclusion ............................................................................................................................. 88  3.6  Materials and methods ......................................................................................................... 89  3.6.1  Reagents, materials, and antibodies ............................................................................. 89  3.6.2  Cell culture .................................................................................................................... 89 v  3.6.3  Isolation of exosomes ................................................................................................... 89  3.6.4  Purification of exosomes ............................................................................................... 90  3.6.5  Exosome isolation for proteomic analysis .................................................................... 90  3.6.6  Peptide labeling and mass spectrometry ...................................................................... 91  3.6.7  LC-MS/MS data analysis ................................................................................................ 91  3.6.8  Gene ontology annotation enrichment analysis ........................................................... 92  3.6.9  Exosome isolation for macrophage treatments............................................................ 92  3.6.10 Leishmania viability after exosome collection .............................................................. 92 3.6.11 Macrophage infection and exosome treatment ........................................................... 93 3.6.12 Electron microscopy ...................................................................................................... 94 3.6.13 Graphics and statistical analysis .................................................................................... 94 3.7  Additional data files .............................................................................................................. 94  3.8  Bibliography .......................................................................................................................... 98  4.  Leishmania Exosomes Modulate Innate and Adaptive Immune Responses through Effects on  Monocytes and Dendritic Cells ............................................................................................................... 102 4.1  Summary ............................................................................................................................. 102  4.2  Background ......................................................................................................................... 103  4.3  Results ................................................................................................................................. 104  4.3.1  Leishmania exosomes modulate cytokine production by human monocytes. ........... 104  4.3.2  Leishmania exosomes attenuate a fully polarized Th1 response. .............................. 106  vi  4.3.1  Exosomes exacerbate leishmania disease progression in vivo. .................................. 108  4.3.2  Immunemodulation by leishmania exosomes is influenced by vesicle composition. 110  4.4  Discussion ............................................................................................................................ 116  4.4.1  Leishmania produce exosomes with immunomodulatory properties. ....................... 116  4.4.2  Multiple signals, including exosomes combine to regulate cytokine production during  leishmania infection. ....................................................................................................................... 117 4.4.3  WT vs HSP100-/- exosomes: modulation of signaling pathways. ................................. 121  4.4.4  Potential for vaccine development ............................................................................. 122  4.5  Conclusion ........................................................................................................................... 123  4.6  Methods .............................................................................................................................. 124  4.6.1  Reagents ...................................................................................................................... 124  4.6.2  Cell culture .................................................................................................................. 124  4.6.3  Cell purification and differentiation ............................................................................ 124  4.6.4  Isolation of leishmania exosomes ............................................................................... 125  4.6.5  Exosome treatments and DC maturation ................................................................... 125  4.6.6  Animals and exosome vaccination .............................................................................. 126  4.6.7  Flow cytometric analysis ............................................................................................. 126  4.6.8  Determination of cytokine concentration................................................................... 127  4.6.9  2-D gel electrophoresis and MALDI-TOF mass spectrometry ..................................... 127  4.6.10 Quantitative mass spectrometry................................................................................. 128  vii  4.6.11 LC-MS/MS data analysis .............................................................................................. 129 4.6.12 mRNA detection by RT-PCR......................................................................................... 129 4.6.13 Statistical analysis ....................................................................................................... 130 4.7  Additional data files ............................................................................................................ 131  4.8  Bibliography ........................................................................................................................ 132  5.  Discussion ................................................................................................................................ 137 5.1  Significance for the field...................................................................................................... 137  5.2  Limitations ........................................................................................................................... 140  5.3  Future directions ................................................................................................................. 141  5.4  In closing.............................................................................................................................. 143  5.5  Bibliography ........................................................................................................................ 145  Appendix ........................................................................................................................................... 148 A.1  Presentations and awards ................................................................................................... 148  Poster presentations ................................................................................................................ 148 Invited oral presentations ........................................................................................................ 148 Awards and honors ................................................................................................................... 148 A.2  List of publications .............................................................................................................. 148  A.3  Ethics approval .................................................................................................................... 149  A.4  Biohazard approval ............................................................................................................. 150  A.5  Animal care approval .......................................................................................................... 151  viii  List of Tables  Table 1.1  Exosomes are released by a wide variety of cell types…………………………………………………13  Table 2.1  Leishmania secreted proteins associated with exosome-like and glycosomal vesicles..38  Table 2.2  Highly enriched leishmania secreted proteins…………………………………………………………….41  Table 2.3  Leishmania candidate virulence factors enriched in conditioned medium………………….42  Table 3.1  Leishmania exosomes carry candidate virulence factors……………………………………………..86  Table 3.2  Transmembrane transport related proteins in leishmania exosomes………………………….87  Table 4.1  HSP100-/- exosomes have irregular cargo profiles.………..………………….……………………..113  ix  List of Figures Figure 1.1  Global geographical distribution of leishmania infections……………………………..………………1  Figure 1.2  The leishmania life cycle………………………………………………………………..……………………………..3  Figure 1.3  Immunopathogenesis and induction of active visceral leishmaniasis…………………………….7  Figure 1.4  Leishmania interfere with host cell signaling…………………………………………………………………8  Figure 1.5  Biogenesis and secretion of exosomes………………………………………………………………………..11  Figure 2.1  Leishmania conditioned medium contains enriched proteins and is minimally contaminated by incidental cell lysis……………………………………………………………………………28  Figure 2.2  Quantitation of leishmania secreted proteins in conditioned media……………………………30  Figure 2.3  Leishmania HSP‘s are enriched in conditioned medium………………………………………………32  Figure 2.4  High prevalence gene ontology assignments in the leishmania secretome………………….33  Figure 2.5  Gene ontology assignments concentrated in the leishmania secretome……………………..35  Figure 2.6  Microvesicles budding from the flagellar pocket and plasma membrane of leishmania…………………………………………………………………………………………………………………..39  Figure 3.1  Leishmania conditioned medium contains bona fide exosomes………………………………….72  Figure 3.2  Heat shock increases exosome release from L. donovani…………………………………………….74  Figure 3.3  Changes in pH affect the cargo of L. donovani exosomes…………………………………………….75  Figure 3.4  Quantitative proteomics identifies the cargo and relative abundance of exosomal proteins under infection-like conditions, showing that exosomes account for 52% of the secretome and have high protein overlap with mammalian exosomes………………………77  Figure 3.5  Leishmania exosomes are released into infected macrophages………………………………….81  Figure 3.6  Leishmania exosomal markers are delivered to the cytoplasm of infected macrophages………………………………………………………………………………………………………………82  Figure 3.7  Leishmania exosomes induce IL-8 secretion………………………………………………………………..84  Figure 3.8  Three potential mechanisms by which Leishmania exosomes may deliver cargo to the host cell cytoplasm……………………………………………………………………………………………………..88  Figure S3.1  L. mexicana have exosome-like vesicles and MVBs budding from the plasma membrane………………………………………………………………………………………………………………….97  x  Figure S3.2  Conditions mimicking the environment encountered during mammalian infection influence the specific enrichment of proteins with diverse functions in L. donovani exosomes……………………………………………………………………………………………………………………98  Figure 4.1  Exosomes from L. donovani modulate cytokine secretion by human monocytes………106  Figure 4.2  Leishmania exosomes modulate the phenotype of immature and mature monocytederived DCs……………………………………………………………………………………………………………….108  Figure 4.3  Differentiation of naïve CD4 T cells into IFN-γ-producing Th1 cells by either L. donovani infected MoDCs or MoDCs loaded with L. donovani exosomes…………………………………109  Figure 4.4  Leishmania exosomes promote Th2 polarization and disease exacerbation in vivo…..110  Figure 4.5  Exosomes from HSP100 null mutants are lacking important HSPs…………………………….112  Figure 4.6  Exosomes from HSP100-/- L. donovani induce cytokine secretion from human monocytes………………………………………………………………………………………………………………..114  Figure 4.7  Exosomes from HSP100-/- leishmania, but not WT exosomes induce naïve CD4 lymphocytes to differentiate into IFN-γ producing T cells…………………………………………115  Figure 4.8  HSP100-/- exosomes do not affect costimulatory molecule expression on MoDCs…….116  xi  List of Abbreviations 2-D:  two dimensional  BB:  bromophenol blue  BFA:  brefeldin A  CA:  cell associated proteins  Cm:  conditioned media  cpm:  counts per minute  DC:  dendritic cell  DNM:  dominant negative mutant  ECM:  exosome collection media  EF-1α:  elongation factor 1 alpha  EM:  electron microscopy  ESCRT:  endosomal sorting complex required for transport  FACS:  fluorescence activated cell sorter  FBS:  fetal bovine serum  FITC:  fluorescein  Foxp3:  forkhead box P3  G6PD:  glucose-6-phosphate dehydrogenase  GeLC-MS/MS: gel-enhanced liquid chromatography/tandem mass spectrometry GFP:  green fluorescent protein  GO:  gene ontology  GPI:  glycophosphotidylinositol  HIV:  human immunodeficiency virus  HMW:  high molecular weight marker  HSP:  heat shock protein  IEF:  isoelectric focusing  IFN-γ:  interferon-gamma  IL:  interleukin  ILV:  intraluminal vesicle  IP-10:  IFN-γ-inducible protein-10  JAK-Stat1:  janus tyrosine kinase- signal transducer and activator of transcription -1  LC-MS/MS:  liquid chromatography-tandem mass spectrometry  LPG:  lipophosphoglycan  MALDI-TOF:  matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry xii  MAP kinase:  mitogen-activated protein kinase  ME:  mercaptoethanol (β)  MHC:  major histocompatibility complex  MIG:  monokine induced by IFN-γ  MoDC:  monocyte-derived DC  MS/MS:  tandem mass spectrometry  MS:  mass spectrometry  MVB:  multivesicular body  MWCO:  molecular weight cut-off  NADP:  nicotinamide adenine dinucleotide phosphate  PBMCs:  peripheral blood mononuclear cells  PBS:  phosphate buffered saline  PFA:  paraformaldehyde  PLM:  phagolysosomal membrane  PM:  plasma membrane  PMA:  phorbol 12-myristate 13 acetate  PMSF:  phenyl-methane-sulphonyl fluoride  PMSF:  phenylmethylsulphonyl fluoride  PTS1 and 2:  peroxisomal targeting signals 1 and 2  SAcP:  secreted acid phosphates  SBTI:  soya bean trypsin inhibitor  SD:  standard deviation  SEM:  scanning electron microscopy  SHP-1:  Src homology domain containing protein tyropsine phosphatase-1;  SILAC:  Stable isotopic labeling of amino acids in culture  SIR2:  silent information regulator 2-like protein  TEM:  transmission electron microscopy  TGF-β:  transforming growth factor-betta  TM:  transmembrane  TNF-α:  tumor necrosis factor alpha  UA:  uranyl acetate  VL:  visceral leishmaniasis  Vps4:  vacuolar protein sorting  WCL:  whole cell lysate xiii  Acknowledgements  Thank you to my mentor Dr. Neil Reiner, for taking a chance on an American, fresh from the beaches of Hawaii, with an A.B. Also to Dr. Leonard Foster, an inspiring scientist, compassionate mentor, and fabulous collaborator; I am so very grateful to have had the chance to work with you. Thank you. Many thanks to the past and present members of the Reiner lab: Dr. Devki Nandan, Dr. Alireeza Moenrezakhanlou, Dr. Martin Lopez, Emily Thi, Dr. Carolina Camargo de’Olivera, and Ulrike Lambertz. I have learned so much from you. Additional thanks to my colleagues in the Division of Infectious Diseases and the Infection and Immunity Research Center. I thank the Canadian Institute of Health Research, the Michael Smith Foundation for Heath Research, and the BC Proteomics Network for funding my work. A special thanks to the Medical Services Plan of BC, without which this work would have been left unfinished. For expert technical assistance and advice I thank Dr. Wandy Beatty, Dr. Laura Sly, Dr. Rob McMaster, and Dr. Stephen Beverley. To my many students, thank you dearly for your all hard work; we learned together. Dr. Jeanne Poindexter is principally responsible for my fascination with microorganisms; I am indebted to her severe intellect, even style, and nose for passion. Every sip of wine and bite of brie bring fond thoughts of her infamous fermentation lecture and the myriad of livings made by microorganisms. To my incredibly patient parents, Deborah and Matthew Silverman, I am so grateful and lucky to have been blessed with such fun, intelligent, adventurous, caring, and generous parental units. You are inspiring. Dr. Lawrence Silverman was and continues to be a loving reminder that we are limited only by how we limit ourselves. I am indebted to him, and his son, my father, for their insistence on how successes are infinitely possible. Finally, my deepest gratitude to Jeffrey Justin Apple Giffin, for keeping it real - every step of the way.  xiv  Dedication  for my sister Anna and my grandparents Judy and Bob Bubby and Poppa  xv  Co-Authorship Statement  The work presented in this thesis is the result of multiple collaborations. In all instances I principally designed the studies, conducted the data generation and analysis, and prepared the manuscripts. Dr. Neil E. Reiner was involved in study design and manuscript preparation of all chapters. Dr. Leonard J. Foster contributed to design and data generation of the quantitative mass spectrometry experiments in all chapters. The contributions of the other authors are listed below according to the work contributed to: Chapter 2: Simon K. Chan designed the bioinformatics screen for secreted proteins under my supervision. Chapter 3: Joachim Clos conducted L. mexicana TEM. Chapter 4: Joachim Clos generated HSP100 null mutant L. donovani and conducted 2D gel electrophoresis and MALDI-TOF-MS.  xvi  1. Introduction 1.1 Epidemiology, transmission and disease manifestations of the leishmaniases Members of the genus Leishmania are a diverse group of protozoan pathogens belonging to the order Kinetoplastida and the family Trypanosomatidae. Leishmania spp. are the causative agents of a group of predominantly tropical and sub-tropical infectious diseases collectively termed the leishmaniases. As of 2001, an estimated twelve million people worldwide were infected with leishmania and the World Health Organization estimated that an additional two million new cases occur each year (1). It is believed that 350 million people are at risk of contracting leishmaniasis in 88 countries (Fig 1.1). The clinical outcome of infection ranges from self-healing localized cutaneous lesions to ultimately fatal disseminated disease and this is largely determined by the infecting species.  1  Localized cutaneous lesions, most often caused by L. major and L. mexicana infection, are mainly found on the arms, legs and face and often heal without treatment anywhere from three months to two years (2). Species within the L. braziliensis complex are the main causative agents of mucocutaneous leishmaniasis (MCL). In this second major disease classification, following the appearance of an initial cutaneous lesion, secondary metastatic lesions develop months to years later, and these primarily involve mucous membranes of the nose, mouth and upper airways. Chemotherapy is essential for MCL which unlike CL, does not resolve spontaneously. Moreover, demonstrating variable levels of resistance to standard therapies, MCL typically causes extensive disfiguration and can be fatal (3). Infection with L. donovani and L. infantum/chagasi usually results in the most severe and third major form of leishmaniasis, visceral leishmaniasis (VL). In VL, the organisms migrate to and infect cells of the spleen, liver and bone marrow. The disease is characterized by hepatosplenomegaly, fever, mucosal ulcers and weight loss and is predominantly fatal in the absence of medical intervention (1). Nevertheless, in highly endemic areas, greater than 60% of the local population will have circulating anti-leishmania reactive antibodies, or a positive (Montenegro) skin test. This is despite the fact that only as many as 15% report ever having had active disease (4), and has led to the conclusion that infection with visceralizing leishmania are frequently subclinical. The data point to age, malnutrition, genetic background, co-infection with HIV and other immuno-compromising conditions as primary risk factors for developing active disease. Other species contribute to global leishmania morbidity and mortality, but the four species reviewed above, account for the majority of cases. Leishmania infections disproportionately affect poor, rural populations in developing areas of the world (Fig. 1.1) and due to the debilitating and disfiguring manifestations of disease, they are a great barrier to socioeconomic progress in endemic areas. Leishmania are digenetic organisms that are transmitted to a mammalian host by the bite of an infected sandfly (Fig. 1.2). Current dogma with respect to the pathogenesis of leishmania infection states that upon inoculation into the dermis of a human host, leishmania promastigotes, motile, 2  flagellated cells which develop in the sandfly midgut, invade macrophages wherein they differentiate into non-flagellated amastigotes. The latter replicate in macrophage phagolysosomes (Fig. 1.2) until the plasma membrane of the host cell is ruptured, releasing the highly infective amastigotes which go on to infect neighboring cells and sandflies feeding on an infected host.  In the New World* the sandfly vector is Lutzomyia longipalpis, but in the Old World several species are involved, mainly belonging to the subgenus Phlebotomus (Larroussious), e.g. Phlebotomus perniciosus, Phlebotomus ariasi, Phlebotomus neglectus (5). Thirteen of the 15 leishmania species known to cause diseases in humans are zoonotic in nature; domestic dogs and wild canids are thought to be the main reservoir, but interesting data points to domestic cats, horses, and rodent reservoirs (5). Recent environmental changes such as urbanization, deforestation, newly implemented irrigation schemes, and changing human behavior have expanded leishmania endemic regions and have led to sharp increases in the number of reported cases (5-8). In addition, VL has established itself in previously unaffected areas by piggy-backing on the spread of the HIV epidemic (9). Leishmania-HIV co-  *  The New World is comprised of North America, whereas the rest of the world is the Old World.  3  infection results in a deadly synergy as leishmania infection enhances the immuno-compromised state of infected individuals, thereby promoting HIV replication, resulting in earlier onset of AIDS (10). Likewise, CD4 T depletion due to HIV enhances susceptibility to leishmania infection and disease. Consistent with this, as highly active retroviral therapy has become widely available, HIV-leishmania coinfection in southern Europe has experienced a significant decline (5). Despite this, the number of leishmania infections in these areas is still on the rise, a fact attributed to changing environments (5). Pentavalent antimonials have been a mainstay of treatment for the leishmaniases for many years. These agents have substantial toxicities and are more and more frequently ineffective against the emerging resistant strains (11-14). Other agents, including miltefosine, conventional and liposomal amphotercin, and pentamidine are also used with success to treat leishmaniasis. However, these drugs are often expensive, effective doses may be accompanied by severe side effects and they are not widely available to persons in endemic areas (1). A vaccine for human use has yet to be developed (12;15;16). The combination of expansion of endemic regions, HIV co-infection, and evolving drug resistance, has created an immense need for 1) more effective anti-leishmanial drugs, 2) an effective vaccine, either prophylactic, therapeutic or both, and 3) other control measures such as sandfly population control. Furthermore, progress in controlling the leishmaniases requires an improved appreciation of the biology of the infection to design novel prevention and treatment strategies.  1.2 Immunopathogenesis of leishmania infection Control and clearance of leishmania infection in both humans and mice requires an active Th1 type immune response typified by the production of interleukin (IL) -12 by antigen presenting cells and interferon (IFN) -γ by T cells. Together with tumor necrosis factor (TNF) -α, these cytokines activate infected macrophages to kill internalized leishmania. Both human and murine models of infection show there to be distinct differences in T cell responses to visceralizing leishmania as opposed to species causing localized cutaneous disease. Murine cutaneous leishmaniasis is dominated by a clear 4  Th1/Th2 polarization which correlates with disease outcome. Susceptible Balb/c mice inoculated with L. major cutaneously display a predominant Th2 immune response (IL-4, IL-13 and IL-5) which inhibits the production of type 1 cytokines (IFN-γ and IL-2) resulting in disease progression (17). In contrast, resistant C57BL/6 mice with cutaneous L. major infection mount a strong Th1 response and the lesions heal readily (2). Remarkably, despite elimination of more than 99% of the parasites from these animals, viable organisms have been shown to persist both at the site of infection and in draining lymph nodes. Sub-clinical parasite persistence, a de facto form of chronic infection, was initially thought to be linked to the suppressive effects of leishmania-specific CD4(+)CD25(+)Foxp3(+) T regulatory cells (18). These cells differentiate in the thymus and expand during the development of adaptive immunity to leishmania. IL-10 is known to be critical for the parasite to prevent a protective acquired immune response to leishmania (18) and indeed, these anti-leishmania T regs were found to produce IL-10 ex vivo (18). However, the suppressive effect of these T regs on CD4(+) T effector cells was found to not be IL-10 dependent. It was subsequently discovered that dual IL-10- and IFN-γproducing Th1 cells, CD4(+)CD25(-)Foxp3(-), were required to inhibit the acquired immune responses against L. major in Rag-/- (T cell deficient) reconstituted mice, while CD4(+)CD25(+)Foxp3(+) T regs, were not (19). Moreover, IL-10 producing, CD4(+)CD25(+)Foxp3(+) T regs were not able to maintain chronic infection in Rag-/- mice , while introduction of CD4(+)CD25(-)Foxp3(-), dual IL-10- and IFN-γ-producing Th1 cells resulted in persistent infection (19). These quasi-suppressive Th1 cells were also found to be the primary source of IL-10 in patients with human visceral leishmaniasis (20), where notably, Foxp3(+) T regs cells were not found in infected tissues (20). When considering the essential role of IL-10 (18-22) in leishmania pathogenesis, these findings have cast doubt on the importance of antigen-specific, natural T regs in mediating suppression of host responses in the leishmaniases. Visceral leishmaniasis, in contrast to cutaneous leishmaniasis, does not clearly follow a Th1/Th2 dichotomy and the causative mechanisms of immunosuppression are less clear. For example, the  5  evidence suggests that in mouse models of acute visceral leishmaniasis (L. donovani infections in C57BL/6 mice) IL-10 and TGF-β, not Th2 cytokines IL-4 or IL-13 as is observed in acute CL, are responsible for inhibition of a curative Th1 response (23). This cytokine profile is similar to what was observed in the mice with chronic L. major infections. However, even in susceptible BalB/c mice, infections with visceralizing leishmania normally self cure and this suggests that for VL, the mouse is perhaps a better model for subclinical infection. Unlike mice, Syrian hamsters are unable to clear visceral leishmania infections, and develop severe disseminated disease. These animals succumb if not treated and perhaps represent a better model for active human visceral disease. Despite the differences in disease phenotype, the cytokine profiles in L. donovani infected hamsters are similar to those in mice. They both have high levels of Th1 cytokines IFN-γ, IL-12 and TNF-α along with high levels of IL-10 and TGF-β, while type 2 cytokines are notably absent (23). Human immune responses to infection with L. donovani are greatly dependent on the form of the disease (Fig. 1.3). Peripheral blood mononuclear cells (PBMCs) from individuals with subclincal infections, as well as cured patients, proliferate robustly and produce large amounts of IL-2, IFN-γ and IL-12 in response to leishmania antigens (23). In contrast, PBMCs from acute VL patients are characteristically non responsive to leishmania antigens, neither proliferating nor producing IFN-γ, and this lack of responsiveness has been shown predict poor disease outcome (24). Moreover, the antigenspecific responses of PBMCs from cured individuals were seen to be inhibited when co-cultured with PBMCs from the same patient prior to healing, indicating that these cells are capable of mediating immunosupression, perhaps through the release of immunosuppressive factors (25). Despite the well documented presence of Th2-type cytokines IL-4 and IL-13 in patients with active VL (26) (in contrast to murine models of VL), the cytokine response seems to be dominated by pro-inflammatory cytokines, and high plasma levels of IL-1, IL-6, IL-8, IL-12, TNF-α, IFN-γ, and IFN-γ-inducible protein-10 (IP-10) have  6  all been observed (20;27;28). Interleukin-10 has drawn significant attention for contributing to immunosuppression, and likely accounting for the lack of antigen-specific responsiveness in VL patients. IL-10 has been found in to be elevated in plasma of active VL patients (20), and infected tissues, including bone marrow and spleen, have been found to contain elevated IL-10 transcripts (29). Interestingly these tissues also express IFN-γ transcripts and it was found that the primary source of IL10 in Indian VL patients was CD4 (+)CD25(-) Foxp3(-) activated T cells also producing IFN-γ (20). Figure 1.3 illustrates the current paradigm of human VL disease development and immunopathogenesis.  Notably, both IL-10 transcripts and IL-10 protein were found to be reduced after resolution of disease (29). It has been hypothesized that the production of IL-10 by these cells counteracts the protective actions of IFN-γ and IL-12, thereby conditioning host macrophages to support enhanced growth and survival of leishmania. Nevertheless, the literature is inconsistent with respect to the ability of IL-10 neutralizing antibody to restore proliferation and production of IFN-γ by PBMCs from 7  patients (20;30), indicating the likelihood that other factors may be at work. In addition to IL-10, high circulating levels of TGF-β, soluble IL-4 receptor, IL-6 and soluble IL-2 receptor are thought to potentially play immunosuppressive roles in human visceral leishmaniasis (23;31) though the mechanisms have not been clearly elucidated.  1.3 Leishmania target host cell signaling pathways and inhibit phagocyte activation Recent evidence suggests that diverse intracellular microbes including Leishmania (32-35), Yersinia (36), Mycobacteria (37-39), HIV-1 (40) and others disrupt signaling pathways required to bring about macrophage activation. Macrophage deactivation by leishmania has been studied extensively and a variety of mechanisms potentially contributing to this phenotype have been identified (32;33;41-45). As illustrated in Figure 1.4, impaired cell signaling leading to inhibition of macrophage activation, results in a defective innate immune response (13;32;46).  8  Notably, leishmania infected macrophages have an attenuated oxidative burst and protein phosphorylation in response to the activating compound phorbol 12-myristate 13 acetate (PMA) (47). Furthermore, IFN- signaling through the Jak-Stat1 pathway was shown to be attenuated in L. donovani infected macrophages (44) and MAP kinase signaling was similarly impaired (43). Despite these findings, relatively few bona fide leishmania virulence factors, compounds involved in mediating these effects, have been described. The best characterized candidate virulence factor is arguably the cell surface metalloprotease leishmanolysin GP63. GP63 has been shown to cleave host compliment (48), and was recently implicated in disrupting p38-MAP kinase signal transduction in infected macrophages (49). Importantly, this phenotype of signal attenuation appeared to be related at least in part to activation in infected cells of the negative regulatory host enzyme SHP-1, Src homology 2 domain containing tyrosine phosphatase-1 (SHP-1) (17;41;50). Leishmania elongation factor-1α (EF-1) has been identified as a selective activator of host SHP-1 both in vitro and in vivo (42). EF-1 has also been shown to traffic across the phagolysosomal membrane and into the cytosol of infected cells via a recently identified secretion system, described in Chapter 3, where it interacts with SHP-1 (42). Similarly, secreted cysteine proteases such as cathepsin B, deletion of which leads to impaired virulence in mice (51), may be involved in immunosuppression as recombinant protein has been shown to induce the release of activated TGF-β from its latent precursor (52). Parallel studies found that live promastigotes and promastigote culture supernatants were able to activate latent TGF-β leading to enhanced parasite persistence in infected macrophages (53). It has also been shown that the leishmania lipophosphoglycan, a major promastigote surface molecule, attenuates multiple macrophage functions (54-59) including phagosome maturation delay, inhibition of oxygen radical formation, and cell signaling through effects on protein kinase C (60). Together, these studies suggested a model in which secretion of effector proteins by leishmania contributes to pathogenesis. Additional support for such a model came from two studies in which  9  leishmania were shown to have reduced survival in macrophages when secretion was disrupted. Expression of either 1) a mutated leishmania calreticulin, a chaperone of the endoplasmic reticulum (ER) which is essential for a functional N-terminal secretion system (61), or 2) a dominant negative mutant of the AAA ATPase Vps4 (62), which has been shown to disrupt protein secretion from various eukaryotic cells (63), greatly reduced leishmania virulence both in vitro and in vivo (61;62). Surprisingly, despite the plethora of work describing modulation of host cell signaling by leishmania, knowledge about the leishmania secretome has been limited and no secretion mechanism for the delivery of effector proteins into host cells had been described. To generate a more comprehensive understanding of leishmania secreted proteins specifically and leishmania biology in general, I carried out a global proteomic analysis of the leishmania secretome (64), which is reported in detail in Chapter 2. Furthermore, in Chapter 3 of this thesis I present evidence that protein secretion by leishmania and delivery of candidate effectors into host cells is mediated –at least in part- by exosomes (In press, J. Cell Sci.).  1.4 Exosomes The discovery of exosomes dates back to the mid 1980’s, when an observation was made that during maturation, reticulocytes released or shed excess transferrin receptors in microvesicles (65). This observation sparked two decades of research into released vesicles and led to the characterization of a new organelle, the exosome. As shown in Figure 1.5, exosomes are formed within endosomes or secretory lysosomes, by invagination of the limiting membrane, resulting in the formation of a multivesicular body (MVB) (66;67). The “endosomal sorting complexes required for transport” ESCRTs I, II, and III have been shown to function sequentially in the generation of MVBs in many eukaryotic cells (68), and orthologs were predicted in the leishmania genome (69). The multimeric AAA ATPase Vps4 is thought to bind the ESCRT III complex and catalyze its disassembly in an ATP dependent manner, thus completing the final stages in intraluminal vesicle (ILV) fission and MVB formation (Fig. 1.5). 10  Examination of Vps4 mutants has shown that functional Vps4 is required for MVB formation, and for normal trafficking of MVBs to lysosomes in mammalian cells (70;71). These studies show that exosome biogenesis and secretion is an intricate process, involving multiple protein complexes. ESRCTdependent exosome formation is controversial, however, as ceramide has been shown to regulate exosome formation in Oli-neu cells independent of ESCRT machinery (72). Nonetheless, it is universally accepted that exosomes are released into the extracellular milieu by fusion of MVBs with the plasma membrane (73).  Intracellular vesicle trafficking is complex involving a myriad of regulatory proteins. Of these, the Rab family of small GTPases have stood out as “hubs” around which vesicle transport is regulated (74). A striking feature of the Rab GTPases is their specificity. Individual members of the Rab family associate with distinct membrane-bound compartments and are thought to control targeting to and fusion of transport vesicles with the appropriate destination membrane (75). Thus far, two Rab GTPase family members, Rab11 (76) and Rab27 (77-79), have been established as having direct roles in exosome 11  secretion (Fig. 1.5). Expression of Rab11 mutants that are GTPase deficient or defective in GTP-binding was found to attenuate exosome release in the K562 reticulocyte model (76). This same group later found that Rab11 controlled MVB targeting to the plasma membrane and this was calcium dependent (80). In contrast to mutant Rab11’s, which were shown to disrupt MVB trafficking and thereby attenuate exosome release, Rab27a was shown to directly control the fusion of secretory lysosomes [known to contain ILVs (67)] with the PM (79). In addition, Rab27b was shown to regulate exocytosis of mast cell granules. Although the exact stage at which Rab27b acted was not thoroughly investigated (78), it was proposed to act similarly to Rab27a at the final step in exocytosis. It is noteworthy that the leishmania genome has been found to contain orthologs of both of these Rab proteins specifically as well as numerous proteins known to involved in multivesicular body formation and vesicle trafficking. As shown in Table 1.1, exosomes are known to be released by numerous mammalian cell types, including cells of both the adaptive and innate immune systems, non-immune cells, and various tumors. Exosomes have been found in diverse human body fluids including urine and blood plasma and it has been suggested that they may be useful as disease biomarkers (81-84). Moreover, bioactive, proinflammatory exosomes have been shown to be released by cells infected with both bacteria and viruses (85;86). Only three non-mammalian cell types have been shown to release bona fide exosomes (Table 1.1): C. elegans (105), the pathogenic fungus Cryptococcus neoformans (107), and Leishmania spp. (In press, J. Cell Sci.). Other opportunistic fungal pathogens in the phyla Ascomycota, including Histoplasma capsulatum, have been shown to release membrane vesicles, though these have not been formally characterized as exosomes (108). The research reported in this thesis, demonstrating exosome release by Leishmania spp. while novel in its own right, also has identified for the first time, a secretion system used by these organisms to deliver candidate effector proteins into host cells. These new findings are reviewed in detail in Chapter 3 of this thesis. Table 1.1 Exosomes are released by a wide variety of cell types.  12  Mammalian Exosome Releasing cells  References  Immune cells  (87) (88) (85;89) (90) (91) (92) (93) (65) (76) (94) (95) (96)  B lymphocytes Mast cells Macrophages Dendritic cells Thymocytes Non-immune cells Stem cells Adipocytes Reticulocytes Keratinocytes Platelets Endothelial cells syncytiotrophoblast (STB) of human placenta Intestinal epithelial cells Tumor cells Brain Breast Ovarian Nasopharyngeal carcinoma Body Fluids Blood serum/plasma Urine Breast Milk Amniotic fluids Non-Mammalian Exosome Releasing cells Eukaryotic C. elegans Cryptococcus neoformans Leishmania spp.  (97;98) (99) (100) (101) (102) (103) (84) (82) (81) Reference (104;105) (106) (In press, J. Cell Sci.)  Though much is yet to be learned, we are beginning to appreciate that mammalian exosomes function as organelles involved in intercellular communication and signaling, and to unravel their complex roles in immune-modulation and immune surveillance. Exosomes have been shown to have both pro- and anti-inflammatory properties, largely depending on the cell type of orgin (66). Proinflammatory exosomes released by DCs are potent antigen presentation organelles, capable of activating T cells both directly, and indirectly (109-112). Indirect activation is the result of the capacity of exosomes to load DCs with antigen, a property that is actively being explored for potential use in the generation of cancer vaccines and treatments (110;113;114). This strategy may not be not limited to cancer, however, as exosomes from Toxoplasma gondii antigen-pulsed DCs were found to be protective against challenge with T. gondii infection (115;116). These findings have fueled interest in DC exosomes as potential cell free vaccines (117). 13  In contrast, exosomes secreted by tumors have widespread anti-inflammatory effects including inhibition of the cytotoxic activity of CD8(+) T cells, promotion of T cell killing, induction of regulatory T cells and myeloid-derived suppressor cell activity, and inhibition of monocyte differentiation into DCs (66;99-102;118). Furthermore, even in healthy people exosomes apparently function in an antiinflammatory manner, as both cells of the placenta and primed CD4(+) T cells release exosomes that function in reducing T cell mediated killing of various cellular targets. These properties have been hypothesized to contribute to tolerance of the fetus, and limitation of auto-immune reactivity respectively (66;96). My studies of leishmania exosomes have shown these vesicles to possess generally immunosuppressive and pro-parasitic properties both in vitro and in vivo. This work, discussed in Chapter 4, is the first description of immune-modulation by a non-mammalian exosome, as well as the first to describe a leishmania-derived extracellular mechanism of immune-suppression.  14  1.5 Bibliography (1) Chappuis F, Sundar S, Hailu A, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol 2007 Nov;5(11):873-82. (2) Mahon-Pratt D, Alexander J. Does the Leishmania major paradigm of pathogenesis and protection hold for New World cutaneous leishmaniases or the visceral disease? Immunol Rev 2004 Oct;201:206-24. (3) Awasthi A, Mathur RK, Saha B. Immune response to Leishmania infection. Indian J Med Res 2004 Jun;119(6):238-58. (4) Bern C, Haque R, Chowdhury R, et al. The epidemiology of visceral leishmaniasis and asymptomatic leishmanial infection in a highly endemic Bangladeshi village. Am J Trop Med Hyg 2007 May;76(5):909-14. (5) Gramiccia M, Gradoni L. The current status of zoonotic leishmaniases and approaches to disease control. International Journal for Parasitology 2005 Oct;35(11-12):1169-80. (6) Anis E, Leventhal A, Elkana Y, Wilamowski A, Pener H. Cutaneous leishmaniasis in Israel in the era of changing environment. Public Health Rev 2001;29(1):37-47. (7) Costa CH, Werneck GL, Rodrigues L, Jr., et al. Household structure and urban services: neglected targets in the control of visceral leishmaniasis. Ann Trop Med Parasitol 2005 Apr;99(3):229-36. (8) Croft SL, Vivas L, Brooker S. Recent advances in research and control of malaria, leishmaniasis, trypanosomiasis and schistosomiasis. East Mediterr Health J 2003 Jul;9(4):518-33. (9) Sinha PK, Pandey K, Bhattacharya SK. Diagnosis & management of leishmania/HIV co-infection. Indian J Med Res 2005 Apr;121(4):407-14. (10) Wolday D, Berhe N, Akuffo H, Desjeux P, Britton S. Emerging Leishmania/HIV co-infection in Africa. Med Microbiol Immunol (Berl) 2001 Nov;190(1-2):65-7. (11) Gupta S, Ramesh SC, Srivastava VM. Efficacy of picroliv in combination with miltefosine, an orally effective antileishmanial drug against experimental visceral leishmaniasis. Acta Trop 2005 Apr;94(1):41-7. (12) Requena JM, Iborra S, Carrion J, Alonso C, Soto M. Recent advances in vaccines for leishmaniasis. Expert Opin Biol Ther 2004 Sep;4(9):1505-17. (13) Vannier-Santos MA, Martiny A, de SW. Cell biology of Leishmania spp.: invading and evading. Curr Pharm Des 2002;8(4):297-318. (14) Beatty WL, Russell DG. Identification of mycobacterial surface proteins released into subcellular compartments of infected macrophages. Infect Immun 2000 Dec;68(12):6997-7002. (15) Sukumaran B, Madhubala R. Leishmaniasis: current status of vaccine development. Curr Mol Med 2004 Sep;4(6):667-79. 15  (16) Aguilar-Be I, da Silva ZR, Paraguai de SE, et al. Cross-protective efficacy of a prophylactic Leishmania donovani DNA vaccine against visceral and cutaneous murine leishmaniasis. Infect Immun 2005 Feb;73(2):812-9. (17) Forget G, Siminovitch KA, Brochu S, Rivest S, Radzioch D, Olivier M. Role of host phosphotyrosine phosphatase SHP-1 in the development of murine leishmaniasis. Eur J Immunol 2001 Nov;31(11):3185-96. (18) Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL. CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 2002 Dec 5;420(6915):502-7. (19) Anderson CF, Oukka M, Kuchroo VJ, Sacks D. CD4(+)CD25(-)Foxp3(-) Th1 cells are the source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis. J Exp Med 2007 Feb 19;204(2):285-97. (20) Nylen S, Maurya R, Eidsmo L, Manandhar KD, Sundar S, Sacks D. Splenic accumulation of IL-10 mRNA in T cells distinct from CD4+CD25+ (Foxp3) regulatory T cells in human visceral leishmaniasis. The Journal of Experimental Medicine 2007 Apr 16;204(4):805-17. (21) Anderson CF, Stumhofer JS, Hunter CA, Sacks D. IL-27 regulates IL-10 and IL-17 from CD4+ cells in nonhealing Leishmania major infection. J Immunol 2009 Oct 1;183(7):4619-27. (22) Murray HW, Lu CM, Mauze S, et al. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infect Immun 2002 Nov;70(11):6284-93. (23) Wilson ME, Jeronimo SM, Pearson RD. Immunopathogenesis of infection with the visceralizing Leishmania species. Microb Pathog 2005 Apr;38(4):147-60. (24) Carvalho EM, Barral A, Pedral-Sampaio D, et al. Immunologic markers of clinical evolution in children recently infected with Leishmania donovani chagasi. J Infect Dis 1992 Mar;165(3):53540. (25) Carvalho EM, Bacellar O, Barral A, Badaro R, Johnson WD, Jr. Antigen-specific immunosuppression in visceral leishmaniasis is cell mediated. J Clin Invest 1989 Mar;83(3):8604. (26) Sundar S, Reed SG, Sharma S, Mehrotra A, Murray HW. Circulating T helper 1 (Th1) cell- and Th2 cell-associated cytokines in Indian patients with visceral leishmaniasis. Am J Trop Med Hyg 1997 May;56(5):522-5. (27) Kurkjian KM, Mahmutovic AJ, Kellar KL, Haque R, Bern C, Secor WE. Multiplex analysis of circulating cytokines in the sera of patients with different clinical forms of visceral leishmaniasis. Cytometry A 2006 May;69(5):353-8. (28) Ansari NA, Saluja S, Salotra P. Elevated levels of interferon-gamma, interleukin-10, and interleukin-6 during active disease in Indian kala azar. Clin Immunol 2006 Jun;119(3):339-45. (29) Ghalib HW, Piuvezam MR, Skeiky YA, et al. Interleukin 10 production correlates with pathology in human Leishmania donovani infections. J Clin Invest 1993 Jul;92(1):324-9.  16  (30) Carvalho EM, Bacellar O, Brownell C, Regis T, Coffman RL, Reed SG. Restoration of IFN-gamma production and lymphocyte proliferation in visceral leishmaniasis. J Immunol 1994 Jun 15;152(12):5949-56. (31) van der PT, Zijlstra EE, Mevissen M. Interleukin 6 during active visceral leishmaniasis and after treatment. Clin Immunol Immunopathol 1995 Oct;77(1):111-4. (32) Nandan D, Knutson KL, Lo R, Reiner NE. Exploitation of host cell signaling machinery: activation of macrophage phosphotyrosine phosphatases as a novel mechanism of molecular microbial pathogenesis. J Leukoc Biol 2000 Apr;67(4):464-70. (33) Reiner NE, Ng W, Wilson CB, McMaster WR, Burchett SK. Modulation of in vitro monocyte cytokine responses to Leishmania donovani. Interferon-gamma prevents parasite-induced inhibition of interleukin 1 production and primes monocytes to respond to Leishmania by producing both tumor necrosis factor-alpha and interleukin 1. J Clin Invest 1990 Jun;85(6):1914-24. (34) Reiner NE, Ng W, Ma T, McMaster WR. Kinetics of gamma interferon binding and induction of major histocompatibility complex class II mRNA in Leishmania-infected macrophages. Proc Natl Acad Sci U S A 1988 Jun;85(12):4330-4. (35) Descoteaux A, Matlashewski G. c-fos and tumor necrosis factor gene expression in Leishmania donovani-infected macrophages. Mol Cell Biol 1989 Nov;9(11):5223-7. (36) Bliska JB, Galan JE, Falkow S. Signal transduction in the mammalian cell during bacterial attachment and entry. Cell 1993 Jun 4;73(5):903-20. (37) Sibley LD, Hunter SW, Brennan PJ, Krahenbuhl JL. Mycobacterial lipoarabinomannan inhibits gamma interferon-mediated activation of macrophages. Infect Immun 1988 May;56(5):1232-6. (38) Sibley LD, Adams LB, Krahenbuhl JL. Inhibition of interferon-gamma-mediated activation in mouse macrophages treated with lipoarabinomannan. Clin Exp Immunol 1990 Apr;80(1):141-8. (39) Sibley LD, Krahenbuhl JL. Mycobacterium leprae-burdened macrophages are refractory to activation by gamma interferon. Infect Immun 1987 Feb;55(2):446-50. (40) Baldwin GC, Fleischmann J, Chung Y, Koyanagi Y, Chen IS, Golde DW. Human immunodeficiency virus causes mononuclear phagocyte dysfunction. Proc Natl Acad Sci U S A 1990 May;87(10):3933-7. (41) Nandan D, Reiner NE. Leishmania donovani engages in regulatory interference by targeting macrophage protein tyrosine phosphatase SHP-1. Clin Immunol 2005 Mar;114(3):266-77. (42) Nandan D, Yi T, Lopez M, Lai C, Reiner NE. Leishmania EF-1alpha activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem 2002 Dec 20;277(51):50190-7. (43) Nandan D, Lo R, Reiner NE. Activation of phosphotyrosine phosphatase activity attenuates mitogen-activated protein kinase signaling and inhibits c-FOS and nitric oxide synthase  17  expression in macrophages infected with Leishmania donovani. Infect Immun 1999 Aug;67(8):4055-63. (44) Nandan D, Reiner NE. Attenuation of gamma interferon-induced tyrosine phosphorylation in mononuclear phagocytes infected with Leishmania donovani: selective inhibition of signaling through Janus kinases and Stat1. Infect Immun 1995 Nov;63(11):4495-500. (45) Reiner NE. Targeting cell regulation promotes pathogen survival in macrophages. Clin Immunol 2005 Mar;114(3):213-5. (46) Martiny A, Vannier-Santos MA, Borges VM, et al. Leishmania-induced tyrosine phosphorylation in the host macrophage and its implication to infection. Eur J Cell Biol 1996 Oct;71(2):206-15. (47) Olivier M, Brownsey RW, Reiner NE. Defective stimulus-response coupling in human monocytes infected with Leishmania donovani is associated with altered activation and translocation of protein kinase C. Proc Natl Acad Sci U S A 1992 Aug 15;89(16):7481-5. (48) Brittingham A, Morrison CJ, McMaster WR, McGwire BS, Chang KP, Mosser DM. Role of the Leishmania surface protease gp63 in complement fixation, cell adhesion, and resistance to complement-mediated lysis. J Immunol 1995 Sep 15;155(6):3102-11. (49) Halle M, Gomez MA, Stuible M, et al. The Leishmania surface protease GP63 cleaves multiple intracellular proteins and actively participates in p38 mitogen-activated protein kinase inactivation. J Biol Chem 2009 Mar 13;284(11):6893-908. (50) Blanchette J, Racette N, Faure R, Siminovitch KA, Olivier M. Leishmania-induced increases in activation of macrophage SHP-1 tyrosine phosphatase are associated with impaired IFNgamma-triggered JAK2 activation. Eur J Immunol 1999 Nov;29(11):3737-44. (51) Bart G, Frame MJ, Carter R, Coombs GH, Mottram JC. Cathepsin B-like cysteine proteinasedeficient mutants of Leishmania mexicana. Mol Biochem Parasitol 1997 Sep;88(1-2):53-61. (52) Somanna A, Mundodi V, Gedamu L. Functional analysis of cathepsin B-like cysteine proteases from Leishmania donovani complex. Evidence for the activation of latent transforming growth factor beta. J Biol Chem 2002 Jul 12;277(28):25305-12. (53) Gantt KR, Schultz-Cherry S, Rodriguez N, et al. Activation of TGF-beta by Leishmania chagasi: importance for parasite survival in macrophages. J Immunol 2003 Mar 1;170(5):2613-20. (54) Desjardins M, Descoteaux A. Inhibition of Phagolysosomal Biogenesis by the Leishmania Lipophosphoglycan. The Journal of Experimental Medicine 1997 Jun 16;185(12):2061-8. (55) Lodge R, Descoteaux A. Modulation of phagolysosome biogenesis by the lipophosphoglycan of Leishmania. Clin Immunol 2005 Mar;114(3):256-65. (56) Dermine JF, Goyette G, Houde M, Turco SJ, Desjardins M. Leishmania donovani lipophosphoglycan disrupts phagosome microdomains in J774 macrophages. Cell Microbiol 2005 Sep;7(9):1263-70.  18  (57) de Veer MJ, Curtis JM, Baldwin TM, et al. MyD88 is essential for clearance of Leishmania major: possible role for lipophosphoglycan and Toll-like receptor 2 signaling. Eur J Immunol 2003 Oct;33(10):2822-31. (58) Descoteaux A, Avila HA, Zhang K, Turco SJ, Beverley SM. Leishmania LPG3 encodes a GRP94 homolog required for phosphoglycan synthesis implicated in parasite virulence but not viability. EMBO J 2002 Sep 2;21(17):4458-69. (59) Holm A, Tejle K, Magnusson KE, Descoteaux A, Rasmusson B. Leishmania donovani lipophosphoglycan causes periphagosomal actin accumulation: correlation with impaired translocation of PKCalpha and defective phagosome maturation. Cell Microbiol 2001 Jul;3(7):439-47. (60) Descoteaux A, Matlashewski G, Turco SJ. Inhibition of macrophage protein kinase C-mediated protein phosphorylation by Leishmania donovani lipophosphoglycan. J Immunol 1992 Nov 1;149(9):3008-15. (61) Debrabant A, Lee N, Pogue GP, Dwyer DM, Nakhasi HL. Expression of calreticulin P-domain results in impairment of secretory pathway in Leishmania donovani and reduced parasite survival in macrophages. Int J Parasitol 2002 Oct;32(11):1423-34. (62) Besteiro S, Williams RA, Morrison LS, Coombs GH, Mottram JC. Endosome sorting and autophagy are essential for differentiation and virulence of Leishmania major. !Lost Data 2006 Apr 21;281(16):11384-96. (63) Yang M, Coppens I, Wormsley S, Baevova P, Hoppe HC, Joiner KA. The Plasmodium falciparum Vps4 homolog mediates multivesicular body formation. J Cell Sci 2004 Aug 1;117(17):3831-8. (64) Silverman JM, Chan SK, Robinson DP, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol 2008;9(2):R35. (65) Pan BT, Teng K, Wu C, Adam M, Johnstone RM. Electron microscopic evidence for externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J Cell Biol 1985;101:942-8. (66) Thery C, Ostrowski M, Segura E. Membrane vesicles as conveyors of immune responses. Nat Rev Immunol 2009 Aug;9(8):581-93. (67) Blott EJ, Griffiths GM. Secretory lysosomes. Nat Rev Mol Cell Biol 2002 Feb;3(2):122-31. (68) Babst M. A Protein's Final ESCRT. Traffic 2005 Jan 1;6(1):2-9. (69) Ivens AC, Peacock CS, Worthey EA, et al. The genome of the kinetoplastid parasite, Leishmania major. Science 2005 Jul 15;309(5733):436-42. (70) Fujita H, Yamanaka M, Imamura K, et al. A dominant negative form of the AAA ATPase SKD1/VPS4 impairs membrane trafficking out of endosomal/lysosomal compartments: class E vps phenotype in mammalian cells. J Cell Sci 2003 Jan 15;116(2):401-14.  19  (71) Yoshimori T, Yamagata F, Yamamoto A, et al. The Mouse SKD1, a Homologue of Yeast Vps4p, Is Required for Normal Endosomal Trafficking and Morphology in Mammalian Cells. Mol Biol Cell 2000 Feb 1;11(2):747-63. (72) Trajkovic K, Hsu C, Chiantia S, et al. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008 Feb 29;319(5867):1244-7. (73) Keller S, Sanderson MP, Stoeck A, Altevogt P. Exosomes: From biogenesis and secretion to biological function. Immunology Letters 2006 Nov 15;107(2):102-8. (74) Brumell JH, Scidmore MA. Manipulation of Rab GTPase Function by Intracellular Bacterial Pathogens. Microbiol Mol Biol Rev 2007 Dec;71(4):636-52. (75) Brennwald P. Reversal of Fortune: Do Rab GTPases Act on the Target Membrane? J Cell Biol 2000 Apr 3;149(1):1-4. (76) Savina A, Vidal M, Colombo MI. The exosome pathway in K562 cells is regulated by Rab11. J Cell Sci 2002 Jun 15;115(12):2505-15. (77) Haddad EK, Wu X, Hammer JA, Henkart PA. Defective granule exocytosis in Rab27a-deficient lymphocytes from Ashen mice. J Cell Biol 2001;152:835-42. (78) Mizuno K, Tolmachova T, Ushakov DS, et al. Rab27b regulates mast cell granule dynamics and secretion. Traffic 2007 Jul;8(7):883-92. (79) Stinchcombe JC. Rab27a is required for regulated secretion in cytotoxic T lymphocytes. J Cell Biol 2001;152:825-34. (80) Savina A, Fader CM, Damiani MT, Colombo MI. Rab11 Promotes Docking and Fusion of Multivesicular Bodies in a Calcium-Dependent Manner. Traffic 2005;6(2):131-43. (81) Asea A, Jean-Pierre C, Kaur P, et al. Heat shock protein-containing exosomes in mid-trimester amniotic fluids. J Reprod Immunol 2008 Oct;79(1):12-7. (82) Admyre C, Johansson SM, Qazi KR, et al. Exosomes with immune modulatory features are present in human breast milk. J Immunol 2007 Aug 1;179(3):1969-78. (83) Pan S, Zhang H, Rush J, et al. High throughput proteome screening for biomarker detection. Mol Cell Proteomics 2005 Feb;4(2):182-90. (84) Gonzales PA, Pisitkun T, Hoffert JD, et al. Large-Scale Proteomics and Phosphoproteomics of Urinary Exosomes. J Am Soc Nephrol 2008 Dec 3. (85) Bhatnagar S, Shinagawa K, Castellino FJ, Schorey JS. Exosomes released from macrophages infected with intracellular pathogens stimulate a proinflammatory response in vitro and in vivo. Blood 2007 Nov 1;110(9):3234-44. (86) Nguyen DG, Booth A, Gould SJ, Hildreth JEK. Evidence That HIV Budding in Primary Macrophages Occurs through the Exosome Release Pathway. Journal of Biological Chemistry 2003 Dec 26;278(52):52347-54. 20  (87) Raposo G, Nijman HW, Stoorvogel W, et al. B lymphocytes secrete antigen-presenting vesicles. J Exp Med 1996 Mar 1;183(3):1161-72. (88) Laulagnier K, Motta C, Hamdi S, et al. Mast cell- and dendritic cell-derived exosomes display a specific lipid composition and an unusual membrane organization. Biochemical Journal 2004 May 15;380(1):161-71. (89) Cantin R, Diou J, Belanger D, Tremblay AM, Gilbert C. Discrimination between exosomes and HIV-1: purification of both vesicles from cell-free supernatants. J Immunol Methods 2008 Sep 30;338(1-2):21-30. (90) Thery C, Boussac M, Veron P, et al. Proteomic analysis of dendritic cell-derived exosomes: a secreted subcellular compartment distinct from apoptotic vesicles. J Immunol 2001 Jun 15;166(12):7309-18. (91) Wang GJ, Liu Y, Qin A, et al. Thymus Exosomes-Like Particles Induce Regulatory T Cells. J Immunol 2008 Oct 15;181(8):5242-8. (92) Kang D, Oh S, Ahn SM, Lee BH, Moon MH. Proteomic Analysis of Exosomes from Human Neural Stem Cells by Flow Field-Flow Fractionation and Nanoflow Liquid Chromatography&#x2212;Tandem Mass Spectrometry. J Proteome Res 2008 Aug 1;7(8):347580. (93) Aoki N, Jin-no S, Nakagawa Y, et al. Identification and characterization of microvesicles secreted by 3T3-L1 adipocytes: redox- and hormone-dependent induction of milk fat globule-epidermal growth factor 8-associated microvesicles. Endocrinology 2007 Aug;148(8):3850-62. (94) Looze C, Yui D, Leung L, et al. Proteomic profiling of human plasma exosomes identifies PPARgamma as an exosome-associated protein. Biochem Biophys Res Commun 2009 Jan 16;378(3):433-8. (95) Zhan R, Leng X, Liu X, et al. Heat shock protein 70 is secreted from endothelial cells by a nonclassical pathway involving exosomes. Biochem Biophys Res Commun 2009 Sep 18;387(2):22933. (96) Hedlund M, Stenqvist AC, Nagaeva O, et al. Human Placenta Expresses and Secretes NKG2D Ligands via Exosomes that Down-Modulate the Cognate Receptor Expression: Evidence for Immunosuppressive Function. J Immunol 2009 Jul 1;183(1):340-51. (97) Mallegol J, Van NG, Lebreton C, et al. T84-intestinal epithelial exosomes bear MHC class II/peptide complexes potentiating antigen presentation by dendritic cells. Gastroenterology 2007 May;132(5):1866-76. (98) Buning J, von SD, Tafazzoli K, et al. Multivesicular bodies in intestinal epithelial cells: responsible for MHC class II-restricted antigen processing and origin of exosomes. Immunology 2008 Dec;125(4):510-21. (99) Graner MW, Alzate O, Dechkovskaia AM, et al. Proteomic and immunologic analyses of brain tumor exosomes. FASEB J 2008 Dec 24.  21  (100) Liu C, Yu S, Zinn K, et al. Murine Mammary Carcinoma Exosomes Promote Tumor Growth by Suppression of NK Cell Function. J Immunol 2006 Feb 1;176(3):1375-85. (101) Gutwein P, Stoeck A, Riedle S, et al. Cleavage of L1 in exosomes and apoptotic membrane vesicles released from ovarian carcinoma cells. Clin Cancer Res 2005 Apr 1;11(7):2492-501. (102) Keryer-Bibens C, Pioche-Durieu C, Villemant C, et al. Exosomes released by EBV-infected nasopharyngeal carcinoma cells convey the viral latent membrane protein 1 and the immunomodulatory protein galectin 9. BMC Cancer 2006;6:283. (103) Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C. Exosomal-like vesicles are present in human blood plasma. Int Immunol 2005 Jul;17(7):879-87. (104) Kolotuev I, Apaydin A, Labouesse M. Secretion of Hedgehog-related peptides and WNT during Caenorhabditis elegans development. Traffic 2009 Jul;10(7):803-10. (105) Liegeois S, Benedetto A, Garnier JM, Schwab Y, Labouesse M. The V0-ATPase mediates apical secretion of exosomes containing Hedgehog-related proteins in Caenorhabditis elegans. J Cell Biol 2006 Jun 19;173(6):949-61. (106) Panepinto J, Komperda K, Frases S, et al. Sec6-dependent sorting of fungal extracellular exosomes and laccase of Cryptococcus neoformans. Mol Microbiol 2009 Mar;71(5):1165-76. (107) Rodrigues ML, Nakayasu ES, Oliveira DL, et al. Extracellular Vesicles Produced by Cryptococcus neoformans Contain Protein Components Associated with Virulence. Eukaryotic Cell 2008 Jan 1;7(1):58-67. (108) Nosanchuk JD, Nimrichter L, Casadevall A, Rodrigues ML. A role for vesicular transport of macromolecules across cell walls in fungal pathogenesis. Commun Integr Biol 2008;1(1):37-9. (109) Segura E, Nicco C, Lombard B, et al. ICAM-1 on exosomes from mature dendritic cells is critical for efficient naïve T-cell priming. Blood 2005 Jul 1;106(1):216-23. (110) Andre F, Chaput N, Schartz NE, et al. Exosomes as potent cell-free peptide-based vaccine. I. Dendritic cell-derived exosomes transfer functional MHC class I/peptide complexes to dendritic cells. J Immunol 2004 Feb 15;172(4):2126-36. (111) Nolte-'t Hoen EN, Buschow SI, Anderton SM, Stoorvogel W, Wauben MH. Activated T-cells recruit exosomes secreted by dendritic cells via LFA-1. Blood 2008 Dec 8. (112) Zitvogel L. Eradication of established murine tumors using a novel cell-free vaccine: dendritic cell-derived exosomes. Nature Med 1998;4:594-600. (113) Chen W, Wang J, Shao C, et al. Efficient induction of antitumor T cell immunity by exosomes derived from heat-shocked lymphoma cells. Eur J Immunol 2006 Jun;36(6):1598-607. (114) Andre F, Andersen M, Wolfers J, et al. Exosomes in cancer immunotherapy: preclinical data. Adv Exp Med Biol 2001;495:349-54.  22  (115) Aline F, Bout D, Amigorena S, Roingeard P, mier-Poisson I. Toxoplasma gondii antigen-pulseddendritic cell-derived exosomes induce a protective immune response against T. gondii infection. Infect Immun 2004 Jul;72(7):4127-37. (116) Beauvillain C, Juste MO, Dion S, Pierre J, mier-Poisson I. Exosomes are an effective vaccine against congenital toxoplasmosis in mice. Vaccine 2009 Mar 10;27(11):1750-7. (117) Lamparski HG, Metha-Damani A, Yao JY, et al. Production and characterization of clinical grade exosomes derived from dendritic cells. Journal of Immunological Methods 2002 Dec 15;270(2):211-26. (118) Fevrier B, Vilette D, Archer F, et al. Cells release prions in association with exosomes. Proc Natl Acad Sci U S A 2004 Jun 29;101(26):9683-8.  23  2. Proteomic Analysis of the Secretome of Leishmania donovani† 2.1 Summary Leishmania and other intracellular pathogens have evolved strategies that support invasion and persistence within host target cells. In some cases, the underlying mechanisms involve the export of virulence factors into the host cell cytosol. Previous work from this laboratory identified one such candidate leishmania effector, elongation factor-1 (EF-1) to be present in conditioned medium of infectious leishmania as well as within macrophage cytosol following infection. To investigate secretion of potential effectors more broadly, we used quantitative mass spectrometry to analyze the protein content of conditioned medium collected from cultures of stationary-phase promastigotes of Leishmania donovani, an agent of visceral leishmaniasis. Analysis of leishmania conditioned medium resulted in the identification of 151 proteins apparently secreted by L. donovani. Ratios reflecting the relative amounts of each leishmania protein secreted as compared to that remaining cell associated revealed a hierarchy of protein secretion, with some proteins secreted to a greater extent than others. Comparison to an in silico approach defining proteins potentially exported along the classic eukaryotic secretion pathway suggested that few leishmania proteins are targeted for export using a classic eukaryotic N-terminal secretion signal peptide. Unexpectedly, a large majority of known eukaryotic exosomal proteins were detected in leishmania conditioned medium suggesting a vesicle-based secretion system. This analysis shows that protein secretion by L. donovani is a heterogeneous process, unlikely to be determined by a classical N-terminal secretion signal. As an alternative, L. donovani appears to use multiple non-classical secretion pathways, including the release of exosome-like microvesicles.  †  A version of this chapter has been published. Silverman, J. M., S. K. Chan, D. P. Robinson, D. M. Dwyer, D. Nandan, L. J. Foster, and N. E. Reiner. 2008. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol. 9:R35.  24  2.2 Background Leishmania spp. are the causative agents of a group of tropical and sub-tropical infectious diseases termed the leishmaniases. These infections disproportionately affect poorer peoples in developing areas of the world. Due to the debilitating and disfiguring results of infection, these diseases are a great barrier to socioeconomic progress in endemic areas. As of 2001, twelve million people worldwide were estimated to be infected with leishmania and two million new cases are believed to occur each year (1). Recent environmental changes such as urbanization, deforestation, and new irrigation schemes have expanded endemic regions and have led to sharp increases in the number of reported cases (2-4). In addition, visceral leishmaniasis is establishing itself in previously unaffected areas by piggy-backing on the spread of the HIV epidemic (5). Leishmania co-infection with HIV has become a serious global health threat. The two infections are involved in a deadly synergy as leishmania infection enhances the immunocompromised state of infected individuals, thereby promoting HIV replication, resulting in earlier onset of AIDS (6). The combination of HIV co-infection, expansion of endemic regions, and evolving drug resistance (7), has created an immense need for more effective antileishmanial drugs and other control measures. Progress in controlling the leishmaniases requires an improved appreciation of the biology of the parasite to design novel treatment strategies. Members of the genus Leishmania are digenetic protozoans. The organisms exist either as flagellated, motile promastigotes within the alimentary canal of their phlebotomine sandfly vector or as non-motile amastigotes that reside within phagolysosomes of mammalian mononuclear phagocytes. Promastigote surface coat constituents have been the focus of considerable interest (8-10), and many of these including glycoproteins, proteoglycans, and glycolipids, have been shown to play protective roles (8;11;12). Surface-associated molecules are considered to make up the vast majority of leishmania secreted material (9). Through these studies, it has become evident that there are a number of unusual features that typify exocytosis by this group of trypanosomatids. For example, in  25  these highly polarized cells, regulated secretion is thought to occur solely at the flagellar pocket, a deep invagination of the plasma membrane from which the single flagellum of leishmania emerges (9;13). Leishmania are known to synthesize and traffic most surface molecules, such as lipophosphoglycan (LPG) and leishmanolysin GP63, along the classical endoplasmic reticulum - Golgi apparatus - plasma membrane pathway (9). As mentioned, these surface molecules are ultimately delivered to the flagellar pocket and it is thought that the pocket retains its role as the primary if not sole site of secretion in non-flagellated amastigotes (9). Thus far, no leishmania candidate virulence factors have been shown to traffic through the flagellar pocket. This is not surprising, however, given that no ultrastructural work has accompanied descriptions of leishmania candidate virulence factors, and little attention has been paid to their intra- or extra-cellular trafficking pathways. Whether leishmania use a classical N-terminal signal sequence peptide to direct the export of most secreted proteins through the flagellar pocket or a different mechanism is unclear. Two leishmania surface glycoproteins, a proteophosphoglycan and GP63, are initially synthesized with a cleavable Nterminal signal sequence (9). However, the vast majority of characterized leishmania secreted proteins have no identifiable secretion signal sequence, with the exception of those that are initially membrane bound (9;14;15). The lack of a clear N-terminal secretion signal sequence amongst the majority of characterized leishmania secreted proteins suggests the existence of important non-classical pathways of secretion. Despite the potential importance of protein secretion by leishmania, only a small number of leishmania proteins have been examined in detail from this perspective (14;16-18). Ideally, one would like to know the identities of all the components of any complex system in order to fully comprehend functionality. Consequently, we set out to identify all - or as many as possible - of the proteins secreted by leishmania. To this end, we designed a quantitative proteomic approach based on SILAC (stable isotopic labeling of amino acids in culture (19-21)). SILAC involves culturing cells with either normal  26  isotopic abundance amino acids or with stable isotope-enriched amino acids (e.g. L-arginine vs. 13C6-Larginine) until essentially all proteins of the cell are labeled. The two populations or samples to be compared are then mixed and analyzed by nanoflow liquid chromatography-tandem mass spectrometry (LC-MS/MS). We used this approach to analyze the extent to which any given leishmania protein was secreted into promastigote conditioned medium (Cm) by relating it to the level of the same protein that remained cell associated (CA). In this report, we identified 358 proteins in combined Cm/CA mixtures from L. donovani and based on a quantitative analysis, we conclude that 151 were actively secreted. The general properties of the identified secreted proteins allowed us to postulate potential mechanisms of secretion as well as functional roles in the context of infection.  2.3 Results 2.3.1 Leishmania conditioned medium contains a multiplicity of enriched proteins. The main objective of this study was to characterize as comprehensively as possible the proteins actively secreted by promastigotes of L. donovani into culture medium. Prior to proceeding with the SILAC and LC-MS/MS analysis, we sought to develop a system where we were confident that the proteins we were detecting in Cm were not artifacts and were in fact present due to bona fide secretion. Previous investigations of protein secretion by leishmania were hampered by the presence of degradation products and by the requirement of the cells for serum (14;22). In light of these complexities, we included a non-toxic protease inhibitor, soy bean trypsin inhibitor, in the promastigote culture medium during collection and isolation of Cm to minimize degradation of secreted proteins by proteases. Secondly, we reduced Cm collection time to < 6 h in order to allow culture of promastigotes under serum-free conditions. Pulse-chase labeling of leishmania with 35S-methionine followed by isolation of serum-free Cm showed clearly that leishmania secreted numerous proteins (Fig. 2.1A). Here, an equal number of TCA precipitated counts per minute (cpm) of Cm and WCL were analyzed, allowing us to compare directly the intensities of protein bands from Cm and WCL. The results show that some of the leishmania secreted proteins, (arrows, Fig. 2.1A), were clearly enriched in the Cm. It is 27  also important to note that the clearly distinct protein separation patterns of leishmania Cm and WCL indicate that the proteins detected in Cm were unlikely to be artifacts present due to lysis of cells during culture or processing (Fig. 2.1A).  To control further for the possibility of false positive protein detection in Cm due to inadvertent lysis of promastigotes either spontaneously (due to programmed cell death) or during isolation of Cm, using an enzymatic assay we measured the amount of cytosolic marker glucose 6-phosphate dehydrogenase (G6PD) (23) present in Cm. The total amount of G6PD activity detected in Cm was compared to activities found to be associated with serial dilutions of the total mass of promastigotes that was used to generate the Cm. As shown in Figure 2.1B, the amount of G6PD detected in Cm never exceeded the total enzyme activity that was associated with 5% of the promastigotes used to generate  28  the Cm. Notably, there was also no difference in the amount of G6PD detected in Cm collected from promastigotes that had been grown in either stable isotope or normal isotopic abundance culture medium during the SILAC analysis described below. 2.3.2 Quantitative mass spectrometry identifies a wide array of leishmania secreted proteins. Serum-free leishmania conditioned medium collected from stationary phase promastigotes was fractionated either by one dimension SDS-PAGE or by in solution isoelectric focusing and analyzed by LC-MS/MS using a linear trapping quadrupole-Fourier transform (LTQ-FT) hybrid mass spectrometer (see Methods). We set three criteria that had to be met for any protein detected by MS to be included in the leishmania “secretome”. First, we only considered proteins to be identified if at least two unique tryptic peptide sequences from that protein were detected (see Methods for peptide criteria limits). Second, we required that a particular protein be observed in at least three of four independent experiments. This resulted in the identification of 358 proteins, listed in Additional Data File 1, in the pooled Cm and CA samples with an estimated false discovery rate of less than one protein in 200. Interestingly, by these criteria we did not detect G6PD in any of the LC-MS/MS analyses, likely because the amount of G6PD was below the detection limit of the MS. The method of preparation of Cm for LC-MS/MS analysis did not provide sufficient amounts of protein to reliably use standard methods for measuring total protein concentration (see Methods) so we estimated the protein content of Cm samples from an initial LC-MS/MS analysis and mixed these with an equal amount of oppositely-labeled CA protein. As this method of equalization is imprecise, we normalized all Cm/CA ratios within an experiment to histone H2B [GeneDB:LmjF19.0050]. H2B was consistently detected in Cm, most likely as a result of both general cell lysis and apoptosis (24;25). After normalization, the values were loge transformed (Additional Data File 2) and Cm/CA ratios for all identified proteins were calculated as the mean Cm/CA ratio for all peptides from that protein across all experiments (Additional Data File 2) (26;27). These SILAC ratios reflected the degree of enrichment of 29  individual protein species in leishmania Cm and a frequency distribution is shown in Figure 2.2. Across all experiments the overall mean ± standard deviation Cm/CA value for the 358 proteins was 1.35 ± 0.85 (Fig. 2.2).  We used the Cm/CA ratio of histone H2B to define the third criterion for inclusion in the secretome. We considered leishmania proteins with a mean Cm/CA peptide ratio at least two SDs (1.7) above the ratio for histone H2B (after transformation = zero) to be actively secreted by leishmania (Fig. 2.2, solid line). In choosing this very conservative yet arbitrary cutoff we reasoned that if H2B was representative of proteins externalized by apoptosis then by allowing a significant margin of error around it, the proteins (numbering 151 in total) with Cm/CA ratios > 1.7 were likely to be bona fide secreted proteins.  30  This conservative approach provided a high level of specificity for “secretion” at the expense of sensitivity. We used Western blotting to examine a select group of proteins in paired Cm and CA samples to determine to what extent this orthogonal method of detection would correlate with the SILAC/MS analysis. Here we examined four proteins: HSP70 with a Cm/CA value of 1.86, above the cutoff of Histone H2B +2 SD (or + 1.70), HSP83/HSP90, with a Cm/CA ratio of 1.50 falling just below the cutoff, EF1α with a ratio of 0.69, and SAcP, which was not detected by LC-MS/MS. As shown in Figure 2.3, SAcP was detected as a dispersed band in Cm, but was completely absent from the aliquots of WCL analyzed (lanes 1 and 2). Both HSP70 and HSP90 were also clearly enriched in Cm, with HSP70 to a greater extent than HSP90 (compare Cm to WCL lane 2). On the other hand, the bulk of EF-1α was retained intracellularly (Fig. 2.3). This qualitative analysis indicated that the SILAC/LC-MS/MS results correlated closely with conventional protein detection by Western blotting in respect to providing a semi-quantitative estimate of protein secretion by leishmania. Additionally, these findings indicated that the arbitrary third criterion for inclusion in the secretome was both valid and in fact highly rigorous since HSP90, a protein falling just below the secretome cutoff (Cm/CA of 1.7, Fig. 2.2), was clearly found to be enriched in Cm by Western blotting (again compare Cm to WCL lane 2, Fig. 2.3). The results for SAcP both by MS and Western were of particular interest and appeared to be a special case. Whereas this ecto-enzyme, which has previously reported to have an N-terminal secretion signal (28), was highly enriched in Cm (Fig. 2.3), its absence from the LC-MS/MS analysis suggested that its absolute abundance must be quite low. This is addressed further in the discussion section. The results of the Western blotting also indicated that there was minimal contamination of Cm by incidental lysis. Figure 2.3 shows the protein profile of 5% of the cells (selected based upon the maximum amount of lysis that may have occurred according to the results of the G6PD analysis, Figure 2.1B) to be markedly distinct from that of the leishmania Cm (compare Cm to WCL lane 1). The distinct 31  profiles of Cm and WCL observed in the metabolic labeling experiment (Fig. 2.1A) also indicated that contamination of Cm through lysis was negligible.  2.3.3 Gene ontology analysis of the leishmania secretome. To develop an understanding of how protein secretion by leishmania might be related to specialized functions or processes, we used the Leishmania Genome (29) and the Gene Ontology (GO) (30) databases in conjunction with the Blast2GO analysis tool (31) to ask whether any classes of proteins were more likely to be found in among the leishmania secreted proteins. This analysis resulted in 85% of the proteins detected in leishmania Cm having one or more GO term assignments (Additional Data File 3). After tallying the number of leishmania secreted proteins assigned to each GO term, it was clear that many of the secreted proteins (Fig. 2.4A) were involved in turnover and synthesis of protein and non-protein macromolecules. In fact, 27 of the 151 secreted proteins (18%) were predicted to be involved in protein translation [GO: 0006412], which was more than in any other discrete biological  32  process (Fig. 2.4A). Beyond this, as shown in Figure 2.4A, the leishmania secreted proteins identified by LC-MS/MS were found to be involved in a wide array of processes including proteolysis [GO:0006508], protein folding [GO:0006457], and biological regulation [GO:0065007].  33  Consistent with the biological process GO analysis, a full 50% of leishmania secreted proteins were involved in protein binding interactions, for example binding to ATP [GO:0005524], ions [GO:0043167], or other proteins [GO:0005515] (Fig. 2.4B). Other highly represented functions included pyrophosphatase activity, hydrolase activity and oxidoreductase activity [GO:0016462, GO:0016787, and GO:0016491]. It is noteworthy that nearly 20 proteins which fell below the secretion cutoff were annotated as having transporter activity [GO:0005215], while no such activity was found for the secreted proteins (Additional Data File 3). Of interest, there appeared to be a trend towards concentration of a distinct set of processes and functions in the group of 151 leishmania proteins making up the leishmania secretome. As shown Figure 2.5A, when compared to the total group of 358 proteins consistently identified in Cm, there appeared to be enrichment of proteins involved in processes related to growth [GO:0040007], RNA metabolism [GO:0016070], and biopolymer modification [GO:0043412], including protein amino acid phosphorylation [GO:0006468]. Consistent with these biological process assignments, molecular functions such as kinase activity, peptidase activity and translation factor activity [GO:0016301, GO:0008233, GO:0003746 respectively] appeared to be more prevalent amongst the group of 151 leishmania secreted proteins than amongst the total group of 358 proteins consistently identified in Cm (Fig. 2.5B). We used the GOSSIP (32) statistical framework to determine if any GO terms were significantly enriched in the secreted proteins when compared to other Cm proteins. Many of the processes and functions discussed and depicted in Figure 2.5 had significant (p<0.05) single test pvalues. However, after correcting for multiple testing using both a False Discovery Rate, the most common correction method (32), and a Family Wise Error Rate, which is more correct in this context since there was no a priori basis for an association between the secreted proteins and any GO term (32), no terms were found to be significantly enriched in the group of 151 secreted proteins. This may be due to our small sample size of individual GO terms associated with at most 358 proteins. In  34  contrast, these statistical tests are regularly carried out on sample sizes in the tens of thousands (32) of  genes or proteins. In addition, statistical significance may not have been achieved because we were comparing two data sets with a high probability of overlap, as we looked for enrichment of GO terms associated with the group of 151 proteins in leishmania secretome compared to GO terms associated with the total group of 358 Cm proteins. 35  In fact, some of the below the cut off Cm proteins may be actively secreted and certainly were found to be exported by some mechanism, including cell death. For these reasons, we consider that the apparent concentration of GO associations shown in Figure 2.5 may in fact be meaningful. In addition to members of the secretome having pleiotropic functions, they were also predicted to have a variety of subcellular localizations. Nearly one third of leishmania secreted proteins were predicted to be cytoplasmic [GO:0005737] by GO, and these had associations to both membrane bound [GO:0043227] and non-bound intracellular organelles [GO:0043228] including: ribosomal proteins, nuclear proteins, mitochondrial proteins, and glycosomal proteins (Additional Data File 3). Only five secreted proteins were predicted to be integral membrane proteins and none of the secretome proteins were predicted to be associated with the endoplasmic reticulum. 2.3.4 Bioinformatics analysis of secreted proteins in the leishmania genome. We screened the leishmania genome database for proteins containing a classical N-terminal secretion signal peptide, in order to generate a putative list of classically secreted proteins for comparison to the proteins identified by LC-MS/MS. We modified a bioinformatics approach previously used to identify proteins secreted by Mycobacterium tuberculosis (33) and applied it to the genome of Leishmania major (34). Proteins were considered highly likely to be secreted if the sequence included a classical N-terminal secretion signal peptide and lacked additional transmembrane (TM) domains. Additional TM domains would have suggested that the protein was membrane bound and therefore unlikely to be released from the cell. The majority of leishmania surface expressed proteins are associated with the plasma membrane via a GPI lipid attachment (9), and some of these GPI-attached surface proteins, such as GP63, are known to disassociate from the membrane and can be detected in Cm (35). In light of this, as a final step we screened the proteins positive for a signal sequence and negative for multiple TM domains for GPI-linkage attachment sites and considered positive proteins to be secreted (Additional Data File 4). Using these parameters, we found that the leishmania genome  36  encodes 217 proteins containing a classical secretion signal peptide, of which 141 are annotated as hypothetical proteins (Additional Data File 4). Of the remaining 76 proteins, approximately one third appear to be gene duplications leaving 50 unique leishmania proteins with a known or putative classical eukaryotic secretion signal peptide. It is of interest that only one of the proteins we predicted to be secreted via an N-terminal secretion signal, LmjF16.0790, a chitinase, has been previously demonstrated to be secreted by leishmania promastigotes (16;36), although we did not detect this protein in our LC-MS/MS analysis. Our analysis also suggests that SAcP does not contain a classical secretion signal, contrary to a previous report (37). Based upon the Von Heijne algorithm [34], the latter study predicted the presence of a 23 amino acid N-terminal “signal peptide”. Subsequently, this leader peptide was shown to be sufficient for secretion of a GFP fusion construct expressed in L. donovani [27]. The SignalP algorithm we used is the updated version of the 1985 Von Heijne algorithm. The lack of concordance in these predictions highlights the limitations of bioinformatics, while reinforcing the well known fact that signal sequences are highly variable. Our bioinformatics analysis also confirmed the annotation in the Leishmania Genome database (29) that none of the histidine secretory acid phosphatases found in the genomes of Leishmania major or Leishmania donovani infantum have classical N-terminal secretion signals. Interestingly, only the membrane bound acid phosphatases of L. major are annotated as containing classical secretion signal peptides, whereas the same is not true of the orthologs in L. donovani infantum, and these membrane bound proteins would have been excluded by our TM domain screen. Only fourteen of the proteins predicted to be secreted through a classical signal sequence-dependent mechanism were detected in leishmania Cm by MS and only two of these, GeneDB:LmjF04.0310 and LmjF36.3880, had sufficiently high SILAC ratios to be included in the secretome (Additional Data File 4). While there are several possible explanations for failing to detect a protein by LC-MS/MS, the lack of correlation between the measured and the in silico predicted secretomes suggests that leishmania utilize non-classical secretion signals and pathways to regulate the export of the majority of secreted proteins. 37  2.3.5 Evidence that proteins released by leishmania may originate in exosome-like vesicles, apoptotic vesicles, and glycosomes. Somewhat unexpected was the finding that, leishmania Cm contained all of the proteins identified previously associated with exosomes isolated from both B-lymphocytes and dendritic cells, with the exception of those for which the leishmania genome does not contain an ortholog (Additional Data File 5). In fact, over 10% of the proteins found in the leishmania secretome have been detected previously in exosome-like microvesicles released from other eukaryotic cells (Table 2.1) including B-lymphocytes (38), dendritic cells (24), and adipocytes (39). Table 2.1: Leishmania secreted proteins associated with exosome-like and glycosomal vesicles GeneDB Accession No. LmjF35.3340 LmjF29.0510 LmjF36.6910 LmjF01.0770 LmjF28.2860 LmjF24.2060 LmjF33.2550 LmjF28.2770 LmjF35.3860 LmjF12.0250 LmjF14.1160 LmjF36.2030 LmjF23.1220 LmjF05.0350 LmjF36.2020 LmjF36.1630 LmjF16.0540 LmjF27.2000 LmjF31.1070 LmjF26.1240 LmjF04.0960 LmjF27.1260 LmjF30.3240 LmjF21.0810 LmjF36.3210 LmjF33.2540 a b  Protein Identification  a  6-phosphogluconate dehydrogenase, decarboxylating, putative cofilin-like protein chaperonin, putative,T-complex protein 1 (theta subunit), putative eukaryotic initiation factor 4a, putative cytosolic malate dehydrogenase, putative transketolase, putative isocitrate dehydrogenase, putative heat-shock protein hsp70, putative t-complex protein 1, eta subunit, putative cysteinyl-tRNA synthetase, putative Enolase chaperonin Hsp60, mitochondrial precursor t-complex protein 1, gamma subunit, putative trypanothione reductase Chaperonin Hsp60, mitochondrial precursor Clathrin heavy chain, putative aspartate carbamoyltransferase, putative hypothetical protein, conserved biotin/lipoate protein ligase-like protein heat shock protein 70-related protein adenylate kinase, putative T-complex protein 1, beta subunit, putative glutamyl-tRNA synthetase, putative methionyl-tRNA synthetase, putative 14-3-3 protein-like protein carboxypeptidase, putative,metallo-peptidase  Mean Cm/Ca ratio 3.01  Microvesicle b Association GLY  2.80 2.61  DC AP  2.60 2.20 2.19 2.16 2.14 2.14 2.07 2.05 2.03 2.00 1.99 1.98 1.98 1.95 1.90 1.89 1.86 1.77 1.76 1.74 1.74 1.74 1.73  DC AP GLY AP BC, DC, AP AP GLY BC, DC, AP AP AP GLY AP BC, AP GLY GLY AP BC, DC, AP GLY AP GLY GLY DC, AP GLY  The Mascot algorithm was used to identify the protein names and the GeneDB Accession Nos. (29). Mean of normalized, Ln transformed Cm/CA peptide ratios for at least three of four experiments.  38  Recently, mammalian adipocytes were shown to secrete microvesicles, which were referred to as adiposomes (39). These adiposomes contained 98 proteins, 13 of which we concluded to be actively secreted (Table 2.1). At least 25 additional adiposome proteins were detected in leishmania Cm with relative abundances lower than the secretome cutoff (Additional Data File 5). The concordance of the proteomic data between these higher eukaryotic secreted microvesicles and the leishmania secretome is remarkable. These findings suggested that leishmania secrete exosome/adiposome-like microvesicles carrying proteomic cargo that is similar in composition to host microvesicles. In support of this, using scanning electron microscopy, we observed 50 nm microvesicles specifically located at the mouth of the leishmania promastigote flagellar pocket (Fig. 2.6A and B), as well as evenly distributed across the cell surface of cells with the apparent morphology of amastigotes undergoing differentiation axenically (Fig. 2.6C).  Surprisingly, DNA binding histone proteins were reliably detected by LC-MS/MS in Cm of stationary phase promastigotes (Additional Data File 1 and 5). Histone proteins have been detected in dendritic cell exosomal preparations and were shown to enrich in these preparations after the cells were treated with an apoptosis inducing agent (24). The dendritic cell vesicles containing histone proteins were more electron dense and migrated to a slightly higher sucrose density than the exosomes (24). This led the authors to conclude that the histone containing vesicles were indeed a distinct population of vesicles, termed apoptotic vesicles or blebs (24). The detection of histones in Cm of stationary phase leishmania (Additional Data File 1 and 5), along with the significant number of apoptotic leishmania 39  known to be present in a stationary phase population, approximately 43% + 5 (25), suggests that promastigotes may have been releasing apoptotic vesicles as well as exosomes. In addition to exosomal and apoptotic vesicle-associated proteins, we also found that the leishmania secretome included many of the major glycolytic enzymes that normally reside in glycosomes of kinetoplastid organisms (40) (Table 2.1, Additional Data File 5). Relevant to these findings, leishmania have been shown to utilize peroxisomal targeting signals (PTS1 and PTS2) to direct proteins to the glycosome (41) and a screen of the leishmania genome identified approximately 100 proteins with either a PTS1 or a PTS2 targeting signal (42). Remarkably, our MS analysis of leishmania Cm detected nearly half of these predicted glycosomal proteins, with 10 being detected at high enough relative abundance to be considered bona fide secreted proteins (Table 2.1). These findings suggest that leishmania release either whole glycosomes or glycososomal cargo into the extracellular environment.  2.4 Discussion To our knowledge, this report is the first proteomic analysis of protein secretion by Leishmania, or, for that matter, any other kinetoplast. This quantitative proteomic analysis showed that L. donovani released a wide array of proteins when in the stationary phase of growth (Additional Data File 1). Based on previous studies concerned with the pathogenesis of leishmania as well as other intracellular pathogens (17;43), we anticipated that leishmania may secrete virulence effectors into their extracellular environment, including the cytosolic compartment of infected host cells. By examining the composition of the leishmania secretome and generating quantitative information concerning the relative enrichment of secreted proteins, we expected to identify candidate leishmania effector proteins that may be involved in virulence. As expected, protein export was found to be heterogeneous, with some proteins exported to a higher degree than they were retained by the cell, while for others the opposite was true (Fig. 2.2 and Table 2.2). It was our assumption that proteins 40  with higher Cm/CA ratios were more likely to be actively secreted than they were to be externalized as a result of either incidental lysis or apoptosis. In light of this, we used the relative abundance data and a rigorous statistical cutoff (Cm/CA values > the ratio for H2B by at least two standard deviations), to define proteins actively secreted by leishmania. Based upon this analysis, we consider 151 proteins in this dataset to be bona fide members of leishmania secretome. On the other hand, we recognize that in implementing this rigorous cutoff, we likely sacrificed some sensitivity. Thus it is probable that at least some proteins with ratios falling below the cutoff are actively secreted as well. Table 2.2: Highly enriched leishmania secreted proteins GeneDB Accession No. LmjF14.1360 LmjF23.0200 LmjF15.1203 LmjF35.2420  LmjF16.0140 LmjF32.2180 LmjF11.0630  LmjF35.3340  LmjF04.0310 LmjF36.3840  Protein Identification  a  myo-inositol-1-phosphate synthase endoribonuclease L-PSP (pb5), putative 60S acidic ribosomal protein P2 Phosphoinositide-binding protein, putative eukaryotic translation initiation factor 1A, putative hypothetical protein, conserved aminopeptidase, putative, metallo-peptidase, Clan MF, Family M17 6-phosphogluconate dehydrogenase, decarboxylating, putative beta-fructofuranosidase, putative glycyl tRNA synthetase, putative  Mean Cm/CA b ratio 3.93  Function  c  Predicted Location  Inositol biosynthesis (44) Nuclease, mRNA cleavage Translation (45)  Cytosol  Cytosol*  3.26  Phosphoinositol binding, signal transduction Translation  3.08  Translation initiation  Cytosol, exosomes (24;38;39) Nucleus  3.05  Proteolysis  Cytosol  3.01  Glucose cataboloism  Cytosol  2.93  Carbohydrate metabolism Translation  Cytosol*  3.91 3.73 3.51  2.87  c  Cytosol Ribosome*  Cytosol  a  The Mascot algorithm was used to identify the protein names and the GeneDB Accession Nos. (29). Mean of normalized, Ln transformed Cm/CA peptide ratios for at least three of four experiments. c Putative functions and locations are derived from the GeneDB database unless otherwise noted. *Protein sequence contains an N-terminal secretion signal peptide according to SignalP. b  Next, we inspected the leishmania secretome for potential virulence factors. Candidate virulence factors were divided into four categories; proteins putatively involved in intracellular survival, proteins with known immunosuppressive functions, proteins involved in signal transduction, and proteins 41  involved with transport processes (Table 2.3). By far the largest class of candidate virulence factors was comprised of proteins that may be required for intracellular survival. Table 2.3: Leishmania candidate virulence factors enriched in conditioned medium. GeneDB Accession No. LmjF35.2420 LmjF33.1380 LmjF09.0770 LmjF34.2820 LmjF28.2740 LmjF25.0750 LmjF35.1010 LmjF10.0490 LmjF31.2790  LmjF35.2210 LmjF33.1750  Protein Identification  a  Signal Transduction Proteins phosphoinositide-binding protein, putative mitogen activated protein kinase 11, putative,map kinase, putative Oligopeptidase b,serine peptidase, clan SC, family S9A-like protein regulatory subunit of protein kinase a-like protein activated protein kinase c receptor (LACK) protein phosphatase, putative casein kinase, putative mitogen-activated protein kinase 3, putative,map kinase 3, putative adp-ribosylation factor, putative Immunosupressive Proteins kinetoplastid membrane protein-11 macrophage migration inhibitory factor-like protein cyclophilin a Proteins Involved in Intracellular survival myo-inositol-1-phosphate synthase endoribonuclease L-PSP (pb5), putative  Mean Cm/CA ratio  Putative Function  c  3.51 2.42  Kinase* Kinase  2.31  Cell-cell signaling  2.30 2.28 2.27 2.08 1.73  Kinase Kinase receptor Phosphatase Kinase Kinase, signal transduction Small GTPase mediated signal transduction  1.67  2.33 2.21  Immunosuppressive (46) Immunosuppressive (47)  1.73  Immunosuppressive (48)  3.93 3.91  Inositol biosynthesis (44) mRNA salvage, inhibition protein synthesis  aminopeptidase, putative,metallo-peptidase, Clan MF, Family M17 proteasome regulatory non-ATP-ase subunit 2, putative uracil phosphoribosyltransferase, putative Oligopeptidase b,serine peptidase, clan SC, family S9A-like protein iron superoxide dismutase, putative  3.05  Proteolysis  2.40  Proteolysis  2.34 2.31  Pyrimidine salvage Invasion, Proteolysis  2.29  Anti-oxidant  carboxypeptidase, putative,metallo-peptidase, Clan MA(E), family 32 heat-shock protein hsp70, putative  2.14  Proteolysis  2.14  Protein stability  2.10  Proteolysis  2.08  Proteolysis  LmjF14.1160  thimet oligopeptidase, putative,metallopeptidase, Clan MA(E), Family M3 dipeptidyl-peptidase III, putative,metallopeptidase, Clan M-, Family M49 Enolase  2.05  LmjF19.0160  aminopeptidase, putative,metallo-peptidase, Clan  2.04  Plasminogen binding (49), Invasion Proteolysis  LmjF25.0910 LmjF14.1360 LmjF23.0200  LmjF11.0630 LmjF28.1730 LmjF34.1040 LmjF09.0770 LmjF32.1820 LmjF13.0090 LmjF28.2770 LmjF26.1570 LmjF05.0960  42  GeneDB Accession No. LmjF21.1830  Protein Identification  a  MG, Family M24 proteasome alpha 5 subunit, putative  Mean Cm/CA ratio  Putative Function  c  2.03  Proteolysis  1.99 1.97  Anti-oxidant Proteolysis  LmjF23.0270  trypanothione reductase proteasome regulatory non-ATP-ase subunit 5, putative,19S proteasome regulatory subunit pteridine reductase 1  1.92  Anti-oxidant  LmjF26.0810 LmjF27.0190 LmjF26.2280  glutathione peroxidase-like protein, putative proteasome alpha 7 subunit, putative Nitrilase, putative  1.89 1.89 1.86  LmjF26.1240 LmjF31.1890 LmjF06.0140  1.86 1.85 1.85 1.81  Proteolysis  1.79  Proteolysis  1.78 1.77  Proteolysis Proteolysis  1.77  Proteolysis  1.74 1.66 1.64 1.60  Anti-apoptotic Proteolysis Proteolysis Proteolysis  3.51  LmjF27.0760  heat shock protein 70-related protein peptidase m20/m25/m40 family-like protein proteasome beta 6 subunit, putative,20S proteasome beta 6 subunit, putative proteasome regulatory non-ATPase subunit, putative proteasome regulatory non-ATP-ase subunit 11, putative,19S proteasome regulatory subunit, Metallo-peptidase, Clan MP, Family M67 proteasome activator protein pa26, putative aminopeptidase P, putative,metallo-peptidase, Clan MG, Family M24 proteasome regulatory non-ATPase subunit 6, putative 14-3-3 protein-like protein proteasome alpha 2 subunit, putative proteasome alpha 1 subunit, putative proteasome alpha 1 subunit, putative Proteins Involved in Vesicular Transport Processes phosphoinositide-binding protein, putative (sorting nexin 4) small GTP-binding protein Rab1, putative  Anti-oxidant Proteolysis Carbon-nitrogen hydrolase Protein stability Proteolysis Proteolysis  LmjF32.1730  coatomer epsilon subunit, putative  2.09  LmjF36.1630  Clathrin heavy chain, putative  1.98  LmjF18.0700  hypothetical protein, conserved  1.85  LmjF31.2790  adp-ribosylation factor, putative  1.67  Transport of proteins and other substances Endosomes/Golgi trafficking Intracellular protein transport Endocytosis, Trans-Golgi to lysosome trafficking HEAT repeat, Intracellular protein transport Intracellular protein transport  LmjF05.0350 LmjF21.0760  LmjF29.0120 LmjF34.0650  LmjF35.0750 LmjF35.2350 LmjF02.0370 LmjF36.3210 LmjF21.1700 LmjF36.1600 LmjF35.4850  LmjF35.2420  2.27  a  The Mascot algorithm was used to identify the protein names and the GeneDB Accession Nos. (29). Mean of normalized, Ln transformed Cm/CA peptide ratios for at least three of four experiments. c Putative functions and locations are derived from the GeneDB database unless otherwise noted. *Protein sequence contains an N-terminal secretion signal peptide according to SignalP. b  43  The leishmania secretome showed a remarkable abundance of proteasome subunits such as [GeneDB:LmjF35.4850, LmjF36.1600, LmjF21.1700, LmjF21.1830, LmjF27.0190, LmjF36.1650, and LmjF34.0650] and proteases like the oligopeptidases [GeneDB:LmjF09.0770] (Tables 2.2 and 2.3, Additional Data File 1) of which many had high Cm/CA values. In addition, proteolysis was one of the most common GO terms assigned to the leishmania secreted proteins. Although the frequency of this term did not reach statistical significance (see Gene ontology analysis of the leishmania secretome in Results section), this term appeared to be somewhat overrepresented amongst the proteins in the upper half of the ratio distribution (Figs. 2.4A and 2.5A). It seems likely that the secretion of at least some of these proteins may be part of a stress response. On the other hand, some of these proteins may be involved in pathogenesis. One potential mechanism is the direction of their proteolytic activities towards degradative enzymes resident in phagolysosomes to promote intracellular survival. A second possibility might involve direction of their proteolytic activities to degrade MHC class I and II molecules thereby preventing antigen loading and reduced efficiency of antigen presentation as has been described for leishmania infected cells (50). These findings suggest that secreted leishmania proteins with proteolytic activities may contribute to pathogenesis and further investigation of this is warranted. Also likely to be involved in intracellular survival are secreted antioxidants, and more generally proteins with oxidoreductase activity, like iron superoxide dismutase [GeneDB:LmjF32.1820]. Other examples of these were found in the leishmania secretome (Fig. 2.5B and Additional Data File 1) and these may provide protection from intracellular free radical attack. In addition, some members of the secretome, such as the putative 14-3-3 protein, are known to have powerful anti-apoptotic properties in other systems (51). That leishmania infection inhibits host cell apoptosis is well known (52;53), and these anti-apoptotic secreted proteins may be active in prolonging the lifespan of infected host cells.  44  An important inclusion to the category of proteins with functional roles in intracellular survival were nucleases such as [GeneDB:LmjF23.0200], an endoribonuclease, which was found to be the second most highly secreted protein (Table 2.2). This endoribonuclease belongs to a class of proteins that act on single stranded mRNA and are thought to be inhibitors of protein synthesis (54). These nucleases may aid in purine salvage which is obligatory for leishmania, as they are incapable of de novo purine synthesis (55). Myo-inositol-1-phosphate synthase [GeneDB:LmjF14.1360], the protein with the highest relative abundance ratio (Table 2.2) and therefore the most enriched in the Cm, may also play a role in intracellular survival (Table 2.3). Leishmania myo-inositol-1-phosphate synthase has been shown to be essential for growth and survival in myo-inositol limited environments (44). Leishmania myo-inositol-1phosphate synthase knockouts were found to be completely avirulent (44) in mice, suggesting that the phagolysosomal lumen may be a myo-inositol limited environment. Myo-inositol-1-phosphate synthase is required for de novo biosynthesis of myo-inositol, a precursor of vital inositol phospholipids such as those found in the GPI membrane anchors of nearly all leishmania surface proteins and other glycoconjugates such as GP63 and LPG. The massive export of this essential enzyme into Cm is intriguing and warrants further study. The leishmania secreted protein kinetoplastid membrane protein-11 [GeneDB:LmjF35.2210], identified in the SILAC/MS analysis, has been characterized previously as having immunomodulatory effects on host cells during leishmania infection (46). Furthermore, we found that the leishmania secretome contains an ortholog of the mammalian macrophage migration inhibitory factor [GeneDB:LmjF33.1750], a protein with known immunosuppressive and immunomodulatory properties (47) in humans. It is possible that this leishmania ortholog could share these functions and affect host immune responses during leishmania infection.  45  Manipulation of host cell function via interference with signaling pathways is a well known virulence tactic of intracellular pathogens (56-60). After internalization, leishmania infected macrophages exhibit defective signaling in response to various stimuli (57;58;60). Based upon our analysis, we estimate that at least 10 secreted leishmania proteins are predicted to be involved in some manner in signal transduction (Table 2.3 and Additional Data File 3). In this regard, we found that kinase activity was concentrated in the upper half of the secretome ratio distribution (Fig. 2.5B). Secreted leishmania signaling intermediates like the MAP kinases 3 and 11 [GeneDB:LmjF33.1380 and LmjF10.0490] and the protein tyrosine phosphatase-like protein [GeneDB:LmjF16.0230] have the potential to affect macrophage cell signaling after internalization (59). Another interesting signaling related protein, the putative phosphoinositide-binding protein [GeneDB:LmjF35.2420], was one of most highly secreted proteins (Table 2.2). This protein might influence macrophage cell signaling through its potential binding of inositol containing signaling intermediates that are products of phosphatidyloinositol 3 kinase (PI3K). Notably, gene ontology analysis identified this putative phosphoinositide-binding protein [GeneDB:LmjF35.2420] as a sorting nexin 4-like protein (Additional Data File 3). Sorting nexins are known to be involved in coordinating intracellular vesicle trafficking processes including both endocytosis and exocytosis (61). As such, this putative sorting nexin may be considered to be a leishmania candidate virulence factor for its potential to modulate vesicle trafficking in infected cells (Table 2.3). Somewhat unexpected was the finding of proteins in leishmania Cm known to be involved in vesicular transport (Tables 2.3 and 2.1, respectively) such as the phosphoinositide binding protein discussed above, the small GTP-binding protein Rab1 [GeneDB:LmjF27.0760] and a putative ADPribosylation factor [GeneDB:LmjF31.2790]. We have classified these proteins as candidate virulence factors because, while these transport vesicle regulatory proteins may normally regulate vesicle trafficking in leishmania, ectopically following secretion, they may have the potential to affect vesicle  46  trafficking in infected cells. For example, it is tempting to speculate that these leishmania secreted proteins could directly affect phagosome maturation through modulating transport to and fusion with host multivesicular bodies, endosomes, and lysosomes. Another interesting and unexpected aspect of the leishmania secretome was the presence of numerous proteins related to translational machinery (Fig. 2.4A and Additional Data File 3). The functional basis for this is unclear at this time. Perhaps the turnover of these proteins is extremely high and excess machinery is disposed of via secretion in addition to the reported processes of ubiquitination and proteasome mediated degradation. Interestingly, clathrin-coated vesicles isolated from rat liver (62) were found to contain over 30 of the same translation related proteins we found in leishmania Cm, including a putative leishmania eukaryotic translation initiation factor 1A (EIF-1A) [GeneDB:LmjF16.0140], the protein with the fifth highest enrichment ratio (Table 2.2). Appreciation of the multifunctional nature of proteins is increasing, and the possibility exists that these proteins, perhaps purposely packaged in leishmania secretory vesicles, may play ancillary roles in pathogenesis or pathogen survival, similar to what appears to be the case for EF-1α (17). The protein secretion pathways utilized by leishmania are not well understood. According to our analysis, only 2 of the 151 proteins in the leishmania secretome contain a classical N-terminal secretion signal (Additional Data File 2 and 4). The fact that > 98% of the secretome lack a targeting signal indicates that non-classical secretion pathways are likely the dominant means by which leishmania proteins are secreted. In support of this argument, the leishmania secretome included a large number of proteins previously identified as components of exosomes secreted from various higher eukaryotic cell types (Table 2.1). Leishmania Cm also contained many proteins shown to be cargo of clathrincoated vesicles. Rat liver clathrin-coated vesicles were found to contain a total of 346 proteins, and in addition to the 30 translation related proteins mentioned above, an additional 30 of these proteins were detected in leishmania Cm, including clathrin [GeneDB: LmjF36.1630] and HSP70. Significantly,  47  both clathrin and HSP70 have been found in exosomes released from various human cells (24;38;39). In fact, the proteomes of these clathrin-coated vesicles and that of mammalian exosomes were strikingly similar (24;62-65). Furthermore, leishmania have been shown to form clathrin-coated vesicles (66) and clathrin-directed trafficking in leishmania was shown to be essential for survival in macrophages (67). Taken together, these findings suggest that leishmania may use clathrin-coated vesicles as a transport mechanism to direct, at least vesicle trafficking, if not exocytosis of proteins from endosomal compartments to the extracellular milieu. Based on these findings, we propose leishmania protein secretion likely involves the release of exosome-like vesicles, which may or may not be clathrincoated. Moreover, we suggest that at least three distinct vesicular secretion processes contribute to the secretome including: exosomes, apoptotic vesicles, and glycosomes (Table 2.1). Exosomes are small vesicles, 50-100 nm in diameter, released by fusion of either multivesicular endosomes or secretory lysosomes with the plasma membrane of eukaryotic cells (68-70). Exosomes were initially described in reticulocytes as a mechanism for shedding organellar proteins and excess transferrin receptor during differentiation into mature nuclei free red blood cells (71). Somewhat later, the proteomes of B-lymphocyte and dendritic cell exosomes were described (24;38). Dendritic cell exosomes have gathered a significant amount of attention for their immunostimulatory properties as cell-free, peptide-based vaccines (72-75). The striking correspondence between the leishmania secretome and these exosomes strongly suggests that protein secretion by leishmania involves the release of intraluminal vesicles originating from either the tubular lysosome (76), multivesicular endosomes or both. It is tempting to speculate that leishmania exosomes, like dendritic cell exosomes (72;73), may be capable of modulating the host immune response, although it likely that their properties may be quite distinct. The formation of membrane blebs at the plasma membrane of apoptotic mammalian cells and their subsequent release are phenomena that have been attracting significant attention (24;77;78). As  48  mentioned above, these apoptotic vesicles have been found to contain histone proteins and cytochrome c oxidase subunits. That leishmania undergo apoptosis is well established (25), and our finding that they release cytochrome c oxidase subunits and histones into Cm (Additional Data Files 1 and 5) suggests that they release apoptotic vesicles. Moreover, it has been shown that cultures of stationary phase leishmania promastigotes contain up to 43% apoptotic cells and when the latter are removed by sorting, the remaining non-apoptotic population is incapable of establishing and maintaining an infection (25). These findings, taken together with our detection of apoptotic vesicle marker proteins, histones 1 through 4, in leishmania Cm (Additional Data Files 1 and 5), strongly suggest the possibility that leishmania apoptotic vesicles may be involved in pathogenesis. This could take the form of immune evasion, wherein, similar to activation of the ‘silent phagocytosis’ pathway used to internalize and clear very early apoptotic cells by mammalian macrophages (79), these apoptotic vesicles would promote inhibition of macrophage activation prior to subsequent invasion by viable leishmania promastigotes. Somewhat more difficult to explain from our findings is the suggestion for whole glycosome release, based upon both the characterized and the putative glycosomal proteins we detected in leishmania Cm (Table 2.1). Notably, many of the leishmania Cm proteins that were bioinformatically predicted to be glycosomal by the presence of PTS1 or PTS2 have been identified in purified glycosomes of the closely related kinetoplast Trypanosoma brucei brucei (80). Our identification of the two most prevalent leishmania glycosomal membrane proteins in promastigote Cm (Additional Data File 5) suggests that intact glycosomes were being exported from the cell. This is as opposed to a model in which these organelles were fusing with the flagellar pocket to release their cargo, in which case we would not have expected to have detected glycosomal membrane proteins per se. As we suggested above to potentially explain the secretion of translation machinery proteins, release of  49  glycosomal proteins may be related to a stress response, but the targeted release of glycosomes with a more specialized function remains a possibility. As previously stated, it is our hypothesis that the proteins with higher relative abundance in leishmania Cm are more likely to play an active role in pathogenesis than those proteins secreted to a lesser extent. Following this logic, export of proteins with lower Cm abundance may be related to either routine waste disposal or apoptotic blebbing and these may be less likely to contribute to pathogenesis. Although this is a reasonable working model, it is not absolute and does not mean that proteins secreted in lesser abundance may not be of interest. In fact, EF1α, a candidate virulence factor that has been shown to inhibit macrophage activation (17), had a Cm/CA peptide ratio in the lowest 20% of the ratio distribution (Fig. 2.2, Additional Data Files 2 and 5), and well below the cutoff for active secretion used to define the secretome. These data, especially when combined with the findings that apoptotic leishmania are required for leishmania disease development (25), support the interpretation that many of the proteins found in leishmania Cm are potential candidates for unique and essential roles in leishmania virulence and further analysis will be required to prioritize which should receive additional attention. It should be mentioned that three leishmania proteins previously described to be secreted, SAcP (14), chitinase (36), and silent information regulator 2 (SIR2) (18) were not identified in this LC-MS/MS analysis of leishmania Cm. One possible explanation for why these identifications were not made is that they have extremely low intracellular concentrations with nearly all of the synthesized protein being secreted. Under these conditions other proteins present in the cell at a higher concentration could mask the CA peptide signals in the MS. Importantly, the SILAC/MS analysis was designed to compute ratios of simultaneously detected spectra from mixed Cm and CA samples. The absence of a CA signal in the MS would have provided a denominator of zero thereby not allowing for the computation of a meaningful Cm/CA ratio and exclusion from the analysis. Thus no matter how  50  abundant these peptides might be in Cm, without a comparable CA signal these proteins would not be included in the leishmania secretome as defined by this study. It is possible that this explanation may also account for why chitinase and SIR2 were not identified in the secretome, especially considering that neither have characterized intracellular functions. Finally, we conducted these experiments using Leishmania donovani donovani. Sequencing of the L. donovani genome is currently underway. As such we used the completed L. major genome to assign protein identities to the mass spectra gathered from leishmania Cm. Though the genomes for these two species are thought to be very similar, as their similar life cycles, biology and expression profiles would indicate (81), it is possible that genomic difference between species prevented identification of some Cm proteins. Examination of the secretome led to several additional findings worth noting. First, the number of proteins known to be associated with small vesicles outstripped by far the number of proteins identified that had classical secretion signals. This finding suggests that the main secretory route for leishmania involves the release of small vesicles. Second, for the majority of candidate virulence factors that were identified, it seems most likely that they may function to influence the survival of leishmania within the phagolysosome, though this remains to be formally tested. As the collection time for Cm was limited due to the need to culture organisms in the absence of serum, the proteins in the secretome that may be involved in pathogenesis are likely to act during early stages of infection. During this early stage, they may contribute to the observed delay of phagosome maturation (82). It has been proposed that delayed phagosome maturation represents a window of opportunity during which internalized promastigotes can differentiate into the more acid-tolerant amastigotes (83;84). Whether the amastigote secretome is similar to or distinct from that of stationary phase promastigotes is not known at this time, but given the relatively low stage-specific differences in gene expression that have been described (85), we do not expect that significant differences are likely. Third, targeting of virulence factors into host cell cytosol has been shown to be an effective strategy used by intracellular  51  pathogens to remodel the environment and to influence host cell function (17;86-89). After invading their macrophage hosts, leishmania have been shown to block cell activation, to inhibit microbicidal activity (90-92) and to attenuate antigen presenting cell function (60;93;94). A broad picture of the proteins secreted by leishmania in cell free culture provides a basis for investigation of effector proteins that may be active in host cells either within the phagolysosome or within host cytosol.  2.5 Conclusions This quantitative proteomic analysis identified a large and diverse pool of proteins in leishmania Cm and allowed us to define the leishmania secretome based upon measurements of relative protein abundance in Cm that could only be explained by active secretion. The identities of proteins within the secretome revealed many candidates for further studies concerned with potential contributions to virulence and pathogenesis as well as to investigate mechanisms of secretion. Moreover, the data also indicate clearly that leishmania use pre-dominantly non-classical targeting mechanisms to direct protein export. This leads us to propose a model in which protein export occurs largely through the release of microvesicles, perhaps including exosome-like vesicles, apoptotic vesicles and glycosomes.  2.6 Materials and methods 2.6.1 Cell culture Leishmania donovani Sudan strain 2S promastigotes were cultured in medium M199 supplemented with 10% fetal bovine serum (Gibco, Invitrogen Cell Culture), 1% penicillin and streptomycin, 20 mM HEPES (Stem Cell Technologies, Vancouver, BC, Canada), 6 µg/ml hemin, 2 mM L-glutamine, 10 µg/ml folic acid, and 100 µM adenosine at 26oC in a EchoTherm Chilling Incubator (Torrey Pines Scientific, San Marcos, CA). Every third day the organisms were split 1:10 into fresh medium in 25 or 75 cm3 cell culture flasks. For SILAC analysis, promastigotes were transferred to custom made M199 without Larginine and L-lysine (Caisson Laboratories, North Logan, UT) supplemented with 10% partially dialyzed FBS (Gibco), 1% penicillin and streptomycin, 20 mM HEPES (Stem Cell Technologies, Vancouver, BC,  52  Canada), 6 µg/ml hemin, 2 mM L-glutamine, 10 µg/ml folic acid, 100 µM adenosine, and one of two SILAC media formulations: 1) normal isotopic abundance arginine (42 mg/L) and lysine (73 mg/L), and 2) 13  C6-arginine (43.5 mg/L) and 2H4-lysine (75 mg/L) at 26oC. Organisms were cultured in this medium for  at least 14 days and split 1:10 every 3rd day, in order to achieve 100% labeling of cellular proteins before analysis. Stable isotope-labeled amino acids were purchased from Cambridge Isotope Laboratories (Andover, MA). Except where otherwise noted, reagents were obtained from the Sigma-Aldrich Chemical Company. 2.6.2 Isolation of promastigote conditioned medium Stationary phase promastigotes that had been grown either in medium containing normal isotopic abundance arginine and lysine or in medium containing 13C6-arginine 2H4-lysine L were collected by centrifugation at 300 x g for 10 min in a Beckman GS-6R centrifuge and washed in Hanks Balanced Salt Solution (HBSS). Organisms were then concentrated 10-fold by resuspension in medium M199 without FBS and supplemented with 2 mM L-glutamine, 10 mM HEPES, 10 µg/ml soya bean trypsin inhibitor (Sigma-Aldrich) and either normal isotopic arginine and lysine or 13C6-Arg and 2H4 –Lys in the concentrations given above for 4 to 6 h at 26oC. Conditioned media (Cm) was isolated from cells by centrifugation at 300 x g for 10 min in a Beckman GS-6R. Supernatant was then subjected to centrifugation once more to ensure no cells remained in suspension. Cm and cell pellets were either used immediately for enzymatic analysis or stored at -20oC for MS analysis. A minimum of 5 x 108 promastigotes in culture was required to generate Cm with signals of adequate strength for MS analysis. Four times as many stationary phase organisms were required to generate sufficient Cm for detection of proteins by either metabolic labeling and autoradiography or by Western blotting. Two billion organisms were cultured in M199 containing normal isotopic arginine and lysine (Sigma-Aldrich). For autoradiography, cells were collected and washed as above, then starved of methionine by  53  resuspension in RPMI-1640 medium without methionine and cysteine (Sigma-Aldrich) with 1% FBS. After 1 h, 50 Ci/ml of 35S methionine (Sigma-Aldrich) was added and cells were cultured for a further 2 h to allow labeling to occur. After washing to remove serum, cells were incubated for 4 h in serum free RPMI-1640 medium without methionine and cysteine, containing 10 mM L-glutamine, 1 mM HEPES, and 10 g/l Soya bean trypsin inhibitor, at which point the cells were separated from the conditioned medium by low speed centrifugation to avoid mechanical lyses of cells. Pelleted cells were lysed on ice in lysis buffer (50 mM Tris, pH 7.4, 1% Triton X-100, 0.15 M NaCl, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg of aprotinin/ml, and 10 µg of leupeptin/ml). Cell lysates were clarified by centrifugation in a microcentrifuge at maximum speed for 20 min at 4°C. The resulting WCL supernatants and the Cm were precipitated with trichloroacetic acid (TCA) at 10% final concentration. The precipitates were solubilized in Laemmli sample buffer and equal counts per minute (cpm) of Cm and WCL were separated by SDS-PAGE (5-20% gradient) followed by autoradiography. For Western blotting, Cm was collected as above, but organisms were concentrated in normal isotopic M199. After separating Cm from the cells, WCLs were generated by sonicating the cell pellets to mimic lysis that may have occurred inadvertently during culture or centrifugation. Briefly, cell pellets were solubilized in 0.5 mM Tris Laemmli sample buffer without either SDS, bromophenol blue (BB) or βmercaptoethanol (ME), but including protease inhibitors leupeptin and aprotinin both at 1 µg/ml and 10 µg/ml PMSF. The solution was sonicated three times at a power setting of 3 for 10 sec. The lysate was cleared of insoluble material by centrifugation for 5 min at 10,000 x g. Following clarification the supernatant proteins were precipitated following the procedure bellow. The pellet was resuspended in Laemmli sample buffer without ME or BB. 2.6.3 Protein precipitation For Western blotting and metabolic labeling analysis, proteins present within promastigote Cm were precipitated using pyrogallol red as described previously (95). Briefly, sodium deoxycholate was  54  added to Cm to a final concentration of 0.02% and the solution was mixed for 30 min at 4oC to facilitate precipitation. Conditioned medium was then mixed with an equal volume of pyrogallol red solution [containing 0.05 mM pyrogallol red, 0.16 mM sodium molybdate, 1.0 mM sodium oxalate, 50 mM succinic acid and 20% methanol (v/v)] and the pH adjusted to 2.0 with 2N HCL. The resulting solution was incubated at RT for 1-2 h followed by 12-24 h at 4oC. The Cm protein precipitates were harvested by centrifugation at 11,000 x g for 60 min at 4oC followed by 2 washes with ice cold acetone. The pellets were allowed to air dry before solubilization in Laemmli sample buffer without BB or ME at 95˚C for 30 min. Protein concentrations of the Cm and WCLs were measured using the BioRad DC Protein Assay (BioRad Laboratories Inc., Hercules, CA). 2.6.4 Glucose-6-phosphate dehydrogenase assay Promastigote cell pellets were lysed by sonication to generate a WCL in 1 ml medium M199 with the appropriate concentrations of either normal isotope or non-radioactive isotope Arg and Lys, 1 mM L-glutamine, 1 mM HEPES, 10 µg/ml SBTI, protease inhibitors leupeptin and aprotinin both at 1 µg/ml and 10 µg/ml PMSF. After clearance by centrifugation at 11,000 x g, serial two-fold dilutions of the lysate were made in medium M199 supplemented as above to yield final concentrations of 50, 25, 10, 5 and 1% (v/v). The concentrations of glucose-6-phosphate dehydrogenase (G6PD) in 100 µl of Cm and in serial dilutions of WCL were assayed in 55 mM Tris-HCl and 3.3 mM MgCl2 buffer at pH 7.8, containing 3.3 mM glucose-6-phosphate, 2 mM NADP. Enzyme was obtained from the Sigma Chemical Company for a positive control. To generate a reference, 0.01 units of G6PD were stabilized in 5.0 mM glycine with 0.01% bovine serum albumin, pH 8.0, and assayed along with sample and WCL dilutions. Enzyme reactions were carried out at 30oC and the change in absorbance, due to changing NADP concentration, over 5 min was measured at 340 nm. 2.6.5 LC-MS/MS of promastigote conditioned medium and data analysis To identify proteins specifically secreted by leishmania into culture medium, direct quantitative comparisons of protein abundance in Cm versus CA were made on a protein-by-protein basis. The Cm 55  was collected from leishmania grown in medium containing heavy isotopes of arginine and lysine and compared with cell-associated material prepared from promastigotes grown in medium containing normal isotopic abundance amino acids. In some cases the reciprocal analysis was also carried out as well with identical results. Approximately equal amounts of labeled and unlabeled protein (estimated from a preliminary LC-MS/MS analysis) from Cm and CA were mixed together and analyzed either by gel-enhanced liquid chromatography/tandem mass spectrometry (GeLC-MS/MS) exactly as described (96) or by peptide-level isoelectric focusing (IEF) combined with LC-MS/MS. For IEF, the protein mixture was solubilized in digestion buffer (50 mM NH4OH, 1% sodium deoxycholate, pH 8.0), denatured by heating to 99˚C for 5 min, reduced by incubation with 1 µg dithiothreitol for 30 min at 37˚C, alkylated with 5 µg iodoacetamide for 30 min at 37˚C and finally digested by the addition of 1 µg porcine trypsin (Promega) overnight at 37˚C. Following digestion, the sample was acidified by addition of an equal volume of sample buffer (3% acetonitrile, 1% trifluoroacetic acid, 0.5% acetic acid) and the deoxycholate that fell out of solution was pelleted at 16,100 x g for 5 min. Peptide mixtures were then desalted on STop-And-Go Extraction (STAGE) tips (97) prior to being resolved into 24 fractions from pH 3 to 10 on an OFFGEL IEF system (Agilent) according to the manufacturer’s instructions. Fractions from the IEF were diluted with an equal volume of sample buffer and each was desalted again on a STAGE tip. Each gel or OFFGEL fraction was analyzed on a linear trapping quadrupole-Fourier transform (LTQFT) tandem mass spectrometer as described (19). Fragment spectra were extracted with ExtractMSN.exe (v3.2) using the default parameters (ThermoFisher), monoisotopic peak assignments were corrected with DTASuperCharge (default parameters (98)) and the resulting peak list was searched against the protein database for L. major plus the sequences of all human keratins and porcine trypsin (Nov. 5th, 2006 version, 8,324 sequences) using Mascot (v2.1 (99)). MSQuant (98) was used to parse Mascot result files, to recalibrate mass measurements and to extract quantitative ratios. The final non-redundant list of proteins was generated using finaList.pl, an in-house script available on our website (100). The false discovery rate for protein identifications based on two or more peptides 56  with a measured mass accuracy <3 ppm (the overall average was 0.61 ppm), a Mascot score ≥ 25 and length ≥ 8 residues, was estimated to be less than 0.5%, using reversed database searching. All identified peptides with their associated parameters can be found in Additional Data Table 1. SILAC ratios were extracted exactly as described (19). The mean loge transformed ratios from four independent analyses and the relative standard deviations can be found in Additional Data Table 2. 2.6.6 Western blotting Following isolation of Cm, lysis of the corresponding cell pellet and precipitation of proteins in both fractions, equivalent amounts of protein from the Cm and WCL were fractionated by SDS-PAGE. Proteins were transferred to nitrocellulose and probed with anti-EF-1α (Upstate Biotechnologies Inc., Lake Placid, NY) following the manufacturer’s instructions, as well as leishmania specific antibodies to histidine secreted acid phosphatase (101), and against HSPs 70 and 90 (102), a kind gift from Dr. Joachim Clos. 2.6.7 Scanning electron microscopy Stationary phase promastigotes were washed in PBS and fixed in 2.5% gluteraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) containing 0.146 M sucrose, and 5 mM CaCl2 at 22˚C under vacuum in a microwave: 2 min with 100W, 2 min without microwaves, 2 min with 100W and then repeated. Subsequently, fixed organisms were rinsed in the same buffer in the microwave for 40 sec at 100W two times and post-fixed in 1% OsO4 in 0.1 M sodium cacodylate containing 2 mM CaCl2, 0.8% potassium ferricyanide (Polysciences) at 22˚ under vacuum in a microwave following the same steps used in the gluteraldehyde fixation. Cells were washed in distilled water at room temperature and allowed to adhere to poly-L-lysine (Sigma) coated coverslips. Subsequently the coverslips were dehydrated through an ascending ethanol series from 50% to 100%, each for 40 sec at 100W in a microwave. The fixed cells were critically point dried with liquid CO2 in a Balzars 020 Critical Point Dryer (Balzars Union Ltd, Lichtenstein) and coated with gold palladium using a Nanotech SEMPrep II sputter coater. Samples were observed and imaged using a Hitachi S-2600 VPSEM at the UBC Bioimaging Facility. 57  2.6.8 Bioinformatics screen of the genome of L. major to identify candidate secreted proteins The genome of L. major was accessed at the GeneDB Leishmania major database (29). Predictions of signal peptides and signal peptidase cleavage sites were made by SignalP (103). Once these were provisionally identified, a filter was applied to remove those that contained more than one transmembrane (TM) region predicted by TMpd (104). Proteins with just one TM region were again screened to filter out those whose single TM domain did not overlap with the signal peptide coordinates. Finally, these putative classically secreted, non-transmembrane proteins were screened for GPI attachment sites at the C-terminus using the GPI prediction program GPI-SOM (105). 2.6.9 Gene ontology Gene Ontology (GO) (30) annotations were performed using Blast2GO (31). A non-redundant database was used as reference for Blastp searches with an expectation value minimum of 1e-3 and a high scoring segment pair cutoff of 33. Annotations were made with default parameters. Briefly, the pre-eValue-Hit-Filter was 1e-6, the Annotation cutoff was 55, and the GO Weight was 5. The statistical framework GOSSIP (32) was used to identify statistically enriched GO terms associated with leishmania secreted proteins when compared to the GO terms associated with all the proteins identified in leshmania Cm. GOSSIP generates 2 x 2 contingency tables for each GO term in the test group and uses a Fisher’s exact test to calculate p-values for each term. The p-values are then adjusted for multiple testing by calculation of the False Discovery Rate and the Family Wise Error Rate (32). 2.6.10 Statistical analysis Statistical analyses of Cm/CA ratios and G6PD concentrations were performed using GraphPad Prism version 4.00 for Windows, GraphPad Software, San Diego California USA.  58  2.7 Additional data files The following additional data files are available with the online version of this paper at http://genomebiology.com/2008/9/2/R35#IDAVCQWN. Additional Data File 1 is a table listing all the proteins, and the peptides contributing to their identification, detected in leishmania Cm. Additional Data File 2 is a table showing a complete list of the SILAC ratios calculated for each Cm protein in each experiment, including the means of the four experiments. Additional Data File 3 is a table listing all the gene ontology terms associated with the leishmania Cm proteins. Additional Data File 4 is a table listing the proteins predicted by bioinformatics to be secreted under the control of an N-terminal secretion signal peptide. Also shown here are the proteins with predicted GPI attachment sites and those proteins determined to be present in leishmania Cm by the SILAC LC-MS/MS analysis. Additional Data File 5 is a table listing the leishmania Cm proteins, their mean SILAC ratios, and any documented microvesicle associations for these proteins.  59  2.8 Bibliography (1) Chappuis F, Sundar S, Hailu A, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol 2007 Nov;5(11):873-82. (2) Anis E, Leventhal A, Elkana Y, Wilamowski A, Pener H. Cutaneous leishmaniasis in Israel in the era of changing environment. Public Health Rev 2001;29(1):37-47. (3) Costa CH, Werneck GL, Rodrigues L, Jr., et al. Household structure and urban services: neglected targets in the control of visceral leishmaniasis. Ann Trop Med Parasitol 2005 Apr;99(3):229-36. (4) Croft SL, Vivas L, Brooker S. Recent advances in research and control of malaria, leishmaniasis, trypanosomiasis and schistosomiasis. East Mediterr Health J 2003 Jul;9(4):518-33. (5) Sinha PK, Pandey K, Bhattacharya SK. Diagnosis & management of leishmania/HIV co-infection. Indian J Med Res 2005 Apr;121(4):407-14. (6) Wolday D, Berhe N, Akuffo H, Desjeux P, Britton S. Emerging Leishmania/HIV co-infection in Africa. Med Microbiol Immunol (Berl) 2001 Nov;190(1-2):65-7. (7) Mishra J, Saxena A, Singh S. Chemotherapy of leishmaniasis: past, present and future. Curr Med Chem 2007;14(10):1153-69. (8) Spath GF, Garraway LA, Turco SJ, Beverley SM. The role(s) of lipophosphoglycan (LPG) in the establishment of Leishmania major infections in mammalian hosts. Proc Natl Acad Sci U S A 2003 Aug 5;100(16):9536-41. (9) McConville MJ, Mullin KA, Ilgoutz SC, Teasdale RD. Secretory pathway of trypanosomatid parasites. Microbiol Mol Biol Rev 2002 Mar;66(1):122-54. (10) Vergnes B, Sereno D, Madjidian-Sereno N, Lemesre JL, Ouaissi A. Cytoplasmic SIR2 homologue overexpression promotes survival of Leishmania parasites by preventing programmed cell death. Gene 2002 Aug 21;296(1-2):139-50. (11) Descoteaux A, Avila HA, Zhang K, Turco SJ, Beverley SM. Leishmania LPG3 encodes a GRP94 homolog required for phosphoglycan synthesis implicated in parasite virulence but not viability. EMBO J 2002 Sep 2;21(17):4458-69. (12) Ma D, Russell DG, Beverley SM, Turco SJ. Golgi GDP-mannose Uptake Requires Leishmania LPG2. A member of a eukaryotic family of putative nucleotide-sugar transporters. Journal of Biological Chemistry 1997 Feb 7;272(6):3799-805. (13) Overath P, Stierhof YD, Wiese M. Endocytosis and secretion in trypanosomatid parasites tumultuous traffic in a pocket. Trends in Cell Biology 1997 Jan;7(1):27-33. (14) Bates PA, Dwyer DM. Biosynthesis and secretion of acid phosphatase by Leishmania donovani promastigotes. Mol Biochem Parasitol 1987 Dec;26(3):289-96. (15) Rogers ME, Ilg T, Nikolaev AV, Ferguson MA, Bates PA. Transmission of cutaneous leishmaniasis by sand flies is enhanced by regurgitation of fPPG. Nature 2004 Jul 22;430(6998):463-7. 60  (16) Shakarian AM, Dwyer DM. The Ld Cht1 gene encodes the secretory chitinase of the human pathogen Leishmania donovani. Gene 1998 Feb 27;208(2):315-22. (17) Nandan D, Yi T, Lopez M, Lai C, Reiner NE. Leishmania EF-1alpha activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem 2002 Dec 20;277(51):50190-7. (18) Sereno D, Vanhille L, Vergnes B, Monte-Allegre A, Ouaissi A. Experimental study of the function of the excreted/secreted Leishmania LmSIR2 protein by heterologous expression in eukaryotic cell line. Kinetoplastid Biol Dis 2005 Jan 24;4(1):1. (19) Foster LJ, Rudich A, Talior I, et al. Insulin-dependent Interactions of Proteins with GLUT4 Revealed through Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC)*. J Proteome Res 2006 Jan 6;5(1):64-75. (20) Ong SE, Mann M. A practical recipe for stable isotope labeling by amino acids in cell culture (SILAC). Nat Protoc 2006;1(6):2650-60. (21) Ong SE, Blagoev B, Kratchmarova I, et al. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol Cell Proteomics 2002 May;1(5):376-86. (22) Bates PA, Gottlieb M, Dwyer DM. Leishmania donovani: identification of glycoproteins released by promastigotes during growth in vitro. Exp Parasitol 1988 Dec;67(2):199-209. (23) Ralton JE, Naderer T, Piraino HL, Bashtannyk TA, Callaghan JM, McConville MJ. Evidence that intracellular beta1-2 mannan is a virulence factor in Leishmania parasites. J Biol Chem 2003 Oct 17;278(42):40757-63. (24) Thery C, Boussac M, Veron P, et al. Proteomic analysis of dendritic cell-derived exosomes: a secreted subcellular compartment distinct from apoptotic vesicles. J Immunol 2001 Jun 15;166(12):7309-18. (25) van Zandbergen G, Bollinger A, Wenzel A, et al. Leishmania disease development depends on the presence of apoptotic promastigotes in the virulent inoculum. PNAS 2006 Sep 12;103(37):13837-42. (26) Foster LJ, Zeemann PA, Li C, Mann M, Jensen ON, Kassem M. Differential expression profiling of membrane proteins by quantitative proteomics in a human mesenchymal stem cell line undergoing osteoblast differentiation. Stem Cells 2005 Oct;23(9):1367-77. (27) Foster LJ, de Hoog CL, Zhang Y, et al. A mammalian organelle map by protein correlation profiling. Cell 2006 Apr 7;125(1):187-99. (28) Shakarian AM, Joshi MB, Ghedin E, Dwyer DM. Molecular dissection of the functional domains of a unique, tartrate-resistant, surface membrane acid phosphatase in the primitive human pathogen Leishmania donovani. J Biol Chem 2002 May 17;277(20):17994-8001. (29) The Leishmania major Genome Database. website 2007Available from: URL: http://www.genedb.org/genedb/leish/ 61  (30) Ashburner M, Ball CA, Blake JA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000 May;25(1):25-9. (31) Conesa A, Gotz S, Garcia-Gomez JM, Terol J, Talon M, Robles M. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005 Sep 15;21(18):3674-6. (32) Bluthgen N, Brand K, Cajavec B, Swat M, Herzel H, Beule D. Biological profiling of gene groups utilizing Gene Ontology. Genome Inform 2005;16(1):106-15. (33) Gomez M, Johnson S, Gennaro ML. Identification of secreted proteins of Mycobacterium tuberculosis by a bioinformatic approach. Infect Immun 2000 Apr;68(4):2323-7. (34) Ivens AC, Peacock CS, Worthey EA, et al. The genome of the kinetoplastid parasite, Leishmania major. Science 2005 Jul 15;309(5733):436-42. (35) Chen DQ, Kolli BK, Yadava N, et al. Episomal expression of specific sense and antisense mRNAs in Leishmania amazonensis: Modulation of gp63 level in promastigotes and their infection of macrophages in vitro. Infection and Immunity 2000;68(1):80-6. (36) Joshi MB, Rogers ME, Shakarian AM, et al. Molecular characterization, expression, and in vivo analysis of LmexCht1: the chitinase of the human pathogen, Leishmania mexicana. J Biol Chem 2005 Feb 4;280(5):3847-61. (37) Shakarian AM, Ellis SL, Mallinson DJ, Olafson RW, Dwyer DM. Two tandemly arrayed genes encode the (histidine) secretory acid phosphatases of Leishmania donovani. Gene 1997 Sep 1;196(1-2):127-37. (38) Raposo G, Nijman HW, Stoorvogel W, et al. B lymphocytes secrete antigen-presenting vesicles. J Exp Med 1996 Mar 1;183(3):1161-72. (39) Aoki N, Jin-no S, Nakagawa Y, et al. Identification and characterization of microvesicles secreted by 3T3-L1 adipocytes: redox- and hormone-dependent induction of milk fat globule-epidermal growth factor 8-associated microvesicles. Endocrinology 2007 Aug;148(8):3850-62. (40) Michels PA, Bringaud F, Herman M, Hannaert V. Metabolic functions of glycosomes in trypanosomatids. Biochim Biophys Acta 2006 Dec;1763(12):1463-77. (41) Moyersoen J, Choe J, Fan E, Hol WG, Michels PA. Biogenesis of peroxisomes and glycosomes: trypanosomatid glycosome assembly is a promising new drug target. FEMS Microbiol Rev 2004 Nov;28(5):603-43. (42) Opperdoes FR, Szikora JP. In silico prediction of the glycosomal enzymes of Leishmania major and trypanosomes. Mol Biochem Parasitol 2006 Jun;147(2):193-206. (43) Beatty WL, Russell DG. Identification of mycobacterial surface proteins released into subcellular compartments of infected macrophages. Infect Immun 2000 Dec;68(12):6997-7002.  62  (44) Ilg T. Generation of myo-inositol-auxotrophic Leishmania mexicana mutants by targeted replacement of the myo-inositol-1-phosphate synthase gene. Molecular and Biochemical Parasitology 2002 Mar;120(1):151-6. (45) Soto M, Requena JM, Garcia M, Gomez LC, Navarrete I, Alonso C. Genomic organization and expression of two independent gene arrays coding for two antigenic acidic ribosomal proteins of Leishmania. Journal of Biological Chemistry 1993 Oct 15;268(29):21835-43. (46) Carvalho LP, Passos S, Dutra WO, et al. Effect of LACK and KMP11 on IFN-gamma Production by Peripheral Blood Mononuclear Cells from Cutaneous and Mucosal Leishmaniasis Patients. Scandinavian Journal of Immunology 2005;61(4):337-42. (47) Flaster H, Bernhagen J, Calandra T, Bucala R. The Macrophage Migration Inhibitory FactorGlucocorticoid Dyad: Regulation of Inflammation and Immunity. Mol Endocrinol 2007 Jun 1;21(6):1267-80. (48) Colgan J, Asmal M, Yu B, Luban J. Cyclophilin A-Deficient Mice Are Resistant to Immunosuppression by Cyclosporine. J Immunol 2005 May 15;174(10):6030-8. (49) Vanegas G, Quinones W, Carrasco-Lopez C, Concepcion JL, Albericio F, Avilan L. Enolase as a plasminogen binding protein in Leishmania mexicana. Parasitol Res 2007 Nov;101(6):1511-6. (50) Chakraborty D, Banerjee S, Sen A, Banerjee KK, Das P, Roy S. Leishmania donovani Affects Antigen Presentation of Macrophage by Disrupting Lipid Rafts. J Immunol 2005 Sep 1;175(5):3214-24. (51) Johnson BJ, Le TTT, Dobbin CA, et al. Heat Shock Protein 10 Inhibits Lipopolysaccharide-induced Inflammatory Mediator Production. Journal of Biological Chemistry 2005 Feb 11;280(6):403747. (52) Aga E, Katschinski DM, van ZG, et al. Inhibition of the spontaneous apoptosis of neutrophil granulocytes by the intracellular parasite Leishmania major. J Immunol 2002 Jul 15;169(2):898905. (53) Ruhland A, Leal N, Kima PE. Leishmania promastigotes activate PI3K/Akt signalling to confer host cell resistance to apoptosis. Cell Microbiol 2007 Jan;9(1):84-96. (54) Rappu P, Shin BS, Zalkin H, Mantsala P. A Role for a Highly Conserved Protein of Unknown Function in Regulation of Bacillus subtilis purA by the Purine Repressor. J Bacteriol 1999 Jun 15;181(12):3810-5. (55) Al-Salabi MI, de Koning HP. Purine Nucleobase Transport in Amastigotes of Leishmania mexicana: Involvement in Allopurinol Uptake. Antimicrob Agents Chemother 2005 Sep 1;49(9):3682-9. (56) Descoteaux A, Turco SJ, Sacks DL, Matlashewski G. Leishmania donovani lipophosphoglycan selectively inhibits signal transduction in macrophages. J Immunol 1991 Apr 15;146(8):2747-53. (57) Nandan D, Lo R, Reiner NE. Activation of phosphotyrosine phosphatase activity attenuates mitogen-activated protein kinase signaling and inhibits c-FOS and nitric oxide synthase 63  expression in macrophages infected with Leishmania donovani. Infect Immun 1999 Aug;67(8):4055-63. (58) Nandan D, Reiner NE. Attenuation of gamma interferon-induced tyrosine phosphorylation in mononuclear phagocytes infected with Leishmania donovani: selective inhibition of signaling through Janus kinases and Stat1. Infect Immun 1995 Nov;63(11):4495-500. (59) Nandan D, Knutson KL, Lo R, Reiner NE. Exploitation of host cell signaling machinery: activation of macrophage phosphotyrosine phosphatases as a novel mechanism of molecular microbial pathogenesis. J Leukoc Biol 2000 Apr;67(4):464-70. (60) Olivier M, Gregory DJ, Forget G. Subversion mechanisms by which Leishmania parasites can escape the host immune response: a signaling point of view. Clin Microbiol Rev 2005 Apr;18(2):293-305. (61) Krsmanovic T, Pawelec A, Sydor T, Kolling R. Control of Ste6 Recycling by Ubiquitination in the Early Endocytic Pathway in Yeast. Mol Biol Cell 2005 Jun 1;16(6):2809-21. (62) Girard M, Allaire PD, McPherson PS, Blondeau F. Non-stoichiometric Relationship between Clathrin Heavy and Light Chains Revealed by Quantitative Comparative Proteomics of Clathrincoated Vesicles from Brain and Liver. Mol Cell Proteomics 2005 Aug 1;4(8):1145-54. (63) Clayton A, Turkes A, Navabi H, Mason MD, Tabi Z. Induction of heat shock proteins in B-cell exosomes. J Cell Sci 2005 Aug 15;118(16):3631-8. (64) Faure J, Lachenal G, Court M, et al. Exosomes are released by cultured cortical neurones. Mol Cell Neurosci 2006 Apr;31(4):642-8. (65) Wubbolts R, Leckie RS, Veenhuizen PT, et al. Proteomic and biochemical analyses of human B cell-derived exosomes. Potential implications for their function and multivesicular body formation. J Biol Chem 2003 Mar 28;278(13):10963-72. (66) Denny PW, Morgan GW, Field MC, Smith DF. Leishmania major: clathrin and adaptin complexes of an intra-cellular parasite. Experimental Parasitology 2005 Jan;109(1):33-7. (67) Gokool S. {sigma}1- and {micro}1-Adaptin Homologues of Leishmania mexicana Are Required for Parasite Survival in the Infected Host. Journal of Biological Chemistry 2003 Aug 8;278(32):29400-9. (68) Fevrier B, Raposo G. Exosomes: endosomal-derived vesicles shipping extracellular messages. Curr Opin Cell Biol 2004 Aug;16(4):415-21. (69) Van NG, Porto-Carreiro I, Simoes S, Raposo G. Exosomes: a common pathway for a specialized function. J Biochem (Tokyo) 2006 Jul;140(1):13-21. (70) Blott EJ, Griffiths GM. Secretory lysosomes. Nat Rev Mol Cell Biol 2002 Feb;3(2):122-31. (71) Blanc L, de Gassart A, Geminard C, Bette-Bobillo P, Vidal M. Exosome release by reticulocytes-An integral part of the red blood cell differentiation system. Blood Cells, Molecules, and Diseases 2005;35(1):21-6. 64  (72) Andre F, Chaput N, Schartz NE, et al. Exosomes as potent cell-free peptide-based vaccine. I. Dendritic cell-derived exosomes transfer functional MHC class I/peptide complexes to dendritic cells. J Immunol 2004 Feb 15;172(4):2126-36. (73) Andre F, Andersen M, Wolfers J, et al. Exosomes in cancer immunotherapy: preclinical data. Adv Exp Med Biol 2001;495:349-54. (74) Zitvogel L, Fernandez N, Lozier A, et al. Dendritic cells or their exosomes are effective biotherapies of cancer. Eur J Cancer 1999 Aug;35 Suppl 3:S36-S38. (75) Zitvogel L. Eradication of established murine tumors using a novel cell-free vaccine: dendritic cell-derived exosomes. Nature Med 1998;4:594-600. (76) Mullin KA, Foth BJ, Ilgoutz SC, et al. Regulated Degradation of an Endoplasmic Reticulum Membrane Protein in a Tubular Lysosome in Leishmania mexicana. Mol Biol Cell 2001 Aug 1;12(8):2364-77. (77) Caby MP, Lankar D, Vincendeau-Scherrer C, Raposo G, Bonnerot C. Exosomal-like vesicles are present in human blood plasma. Int Immunol 2005 Jul;17(7):879-87. (78) Van NG, Porto-Carreiro I, Simoes S, Raposo G. Exosomes: a common pathway for a specialized function. J Biochem (Tokyo) 2006 Jul;140(1):13-21. (79) Kurosaka K, Takahashi M, Watanabe N, Kobayashi Y. Silent Cleanup of Very Early Apoptotic Cells by Macrophages. J Immunol 2003 Nov 1;171(9):4672-9. (80) Colasante C, Ellis M, Ruppert T, Voncken F. Comparative proteomics of glycosomes from bloodstream form and procyclic culture form Trypanosoma brucei brucei. Proteomics 2006 Jun;6(11):3275-93. (81) Zhang WW, Matlashewski G. In vivo selection for Leishmania donovani miniexon genes that increase virulence in Leishmania major. Mol Microbiol 2004 Nov;54(4):1051-62. (82) Lodge R, Descoteaux A. Modulation of phagolysosome biogenesis by the lipophosphoglycan of Leishmania. Clin Immunol 2005 Mar;114(3):256-65. (83) Lerm M, Holm A, Seiron A, Sarndahl E, Magnusson KE, Rasmusson B. Leishmania donovani requires functional Cdc42 and Rac1 to prevent phagosomal maturation. Infect Immun 2006 May;74(5):2613-8. (84) Scianimanico S, Desrosiers M, Dermine JF, Meresse S, Descoteaux A, Desjardins M. Impaired recruitment of the small GTPase rab7 correlates with the inhibition of phagosome maturation by Leishmania donovani promastigotes. Cell Microbiol 1999 Jul;1(1):19-32. (85) Srividya G, Duncan R, Sharma P, Raju BV, Nakhasi HL, Salotra P. Transcriptome analysis during the process of in vitro differentiation of Leishmania donovani using genomic microarrays. Parasitology 2007 Oct;134(Pt 11):1527-39. (86) Marti M, Good RT, Rug M, Knuepfer E, Cowman AF. Targeting malaria virulence and remodeling proteins to the host erythrocyte. Science 2004 Dec 10;306(5703):1930-3. 65  (87) Fossati G, Izzo G, Rizzi E, et al. Mycobacterium tuberculosis Chaperonin 10 Is Secreted in the Macrophage Phagosome: Is Secretion Due to Dissociation and Adoption of a Partially Helical Structure at the Membrane? J Bacteriol 2003 Jul 15;185(14):4256-67. (88) Reiner NE. Targeting cell regulation promotes pathogen survival in macrophages. Clin Immunol 2005 Mar;114(3):213-5. (89) Roy CR, Salcedo SP, Gorvel JP. Pathogenendoplasmic-reticulum interactions: in through the out door. Nat Rev Immunol 2006 Feb;6(2):136-47. (90) Nandan D, Reiner NE. Leishmania donovani engages in regulatory interference by targeting macrophage protein tyrosine phosphatase SHP-1. Clin Immunol 2005 Mar;114(3):266-77. (91) Blanchette J, Racette N, Faure R, Siminovitch KA, Olivier M. Leishmania-induced increases in activation of macrophage SHP-1 tyrosine phosphatase are associated with impaired IFNgamma-triggered JAK2 activation. Eur J Immunol 1999 Nov;29(11):3737-44. (92) Dasgupta B, Roychoudhury K, Ganguly S, Akbar MA, Das P, Roy S. Infection of human mononuclear phagocytes and macrophage-like THP1 cells with Leishmania donovani results in modulation of expression of a subset of chemokines and a chemokine receptor. Scand J Immunol 2003 Apr;57(4):366-74. (93) Overath P, Aebischer T. Antigen Presentation by Macrophages Harboring Intravesicular Pathogens. Parasitology Today 1999 Aug 1;15(8):325-32. (94) Solbach W, Laskay T. The host response to Leishmania infection. Adv Immunol 2000;74:275317. (95) Caldwell RB, Lattemann CT. Simple and Reliable Method To Precipitate Proteins from Bacterial Culture Supernatant. Appl Environ Microbiol 2004 Jan 1;70(1):610-2. (96) Chan QWT, Howes CG, Foster LJ. Quantitative Comparison of Caste Differences in Honeybee Hemolymph. Mol Cell Proteomics 2006 Dec 1;5(12):2252-62. (97) Rappsilber J, Ishihama Y, Mann M. Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal Chem 2003 Feb 1;75(3):663-70. (98) MSquant. website 2008 February 4Available from: URL: http://MSquant.sourceforge.net (99) The Matrix Sicence Website. Electrophoresis 2008 February 11Available from: URL: www.matrixscience.com/ (100) The Foster Lab. website 2008 February 11Available from: URL: www.proteomics.ubc.ca/foster/software (101) Bates PA, Kurtz MK, Gottlieb M, Dwyer DM. Leishmania donovani: generation of monospecific antibody reagents to soluble acid phosphatase. Exp Parasitol 1987 Oct;64(2):157-64.  66  (102) Hubel A, Brandau S, Dresel A, Clos J. A member of the ClpB family of stress proteins is expressed during heat shock in Leishmania spp. Mol Biochem Parasitol 1995 Mar;70(1-2):10718. (103) Emanuelsson O, Brunak S, von HG, Nielsen H. Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2007;2(4):953-71. (104) The Tmpred Website. website 2008Available from: URL: www.ch.embnet.org/software/TMPRED_form.html (105) Fankhauser N, Maser P. Identification of GPI anchor attachment signals by a Kohonen selforganizing map. Bioinformatics 2005 May 1;21(9):1846-52.  67  3. An Exosome-based Secretion Pathway is Responsible for Protein Export from Leishmania and for Communication with Macrophages‡ 3.1 Summary Specialized secretion systems are used by numerous bacterial pathogens to export virulence factors into host target cells. Leishmania and other eukaryotic intracellular pathogens also deliver effector proteins into host cells; however, the mechanisms involved have remained elusive. In this report we identify a general mechanism for protein secretion by leishmania, exosome-based secretion, and show that exosomes are involved in the delivery of proteins into host target cells. Comparative quantitative proteomics unambiguously identified 329 proteins in leishmania exosomes, accounting for >52% of global protein secretion from these organisms. Our findings demonstrate that infection-like stressors (37°C + pH 5.5) both up-regulated exosome release by > 2-fold and modified exosome protein composition. Leishmania exosomes and exosomal proteins were detected in the cytosolic compartment of infected macrophages and incubation of macrophages with exosomes selectively induced IL-8 secretion, but not that of TNF-. To our knowledge, this is the first direct evidence for an apparent broad-based mechanism of protein export by leishmania. Moreover, this is the first description of a mechanism for direct delivery of leishmania molecules into macrophages. These findings suggest that, similar to mammalian exosomes, leishmania exosomes function in long-range communication and immune-modulation.  ‡  A version of this chapter has been accepted for publication. Silverman, J. M., J. Clos, C.C. de’Oliveira, O. Shirvani, Y. Fang, C. Wang, L. J. Foster, and N. E. Reiner. 2009. An Exosome-based Secretion Pathway is Responsible for Protein Export from Leishmania and for Communication with Macrophages. J. Cell Sci. EPub, Feb. 2010.  68  3.2 Background Leishmania spp. are the causative agents of a group of tropical and sub-tropical infections termed the leishmaniases. These chronic, largely non-resolving infections affect an estimated twelve million people worldwide and two million new cases are believed to occur each year (1). Recent environmental changes such as urbanization, deforestation, and new irrigation schemes have expanded endemic regions and have led to sharp increases in the number of reported cases (2). Progress in controlling the leishmaniases requires an improved appreciation of the cell biology of infection. For example, the role of secreted proteins in leishmania pathogenesis is poorly understood and no general mechanism of protein secretion by leishmania has been identified. In a recent analysis of the secretome of Leishmania donovani, we found only 14% of the proteins contained an N-terminal classical secretion signal peptide (3). This surprising result correlated with our results from a pharmacologic screen investigating the mechanism of secretion, by which classical inhibitors of eukaryotic protein secretion, such as Brefeldin A (BFA), showed no effect on leishmania protein secretion (unpublished data). Surprisingly, the leishmania secretome contained 100% of the proteins (for which there is a leishmania ortholog) previously identified in exosomes secreted by B lymphocytes and dendritic cells (3). Moreover, using scanning electron microscopy (EM) we detected 50 nm vesicles budding from the flagellar pocket of L. donovani (3). These results led us to hypothesize that leishmania use an exosome-based mechanism to actively regulate protein release from the cell. Exosomes are 30-100 nm organelles now known to be released by numerous mammalian cell types including reticulocytes, B and T lymphocytes, dendritic cells, and macrophages (4-7). These vesicles are formed within endosomes, by invagination of the limiting membrane, resulting in the formation of multi-vesicular bodies (MVBs). Exosomes are then released into the extracellular environment by fusion of MVBs with the plasma membrane (8). Exosome biogenesis and release is an intricate process, involving multiple protein complexes (8). This process has been proposed to be dependent upon the  69  endosomal sorting complex required for transport (ESRCT) (9), though ESRCT-dependence remains controversial (10). Bioactive exosomes have been shown to be released by cells infected with both bacteria and viruses (7;11) as well as by diverse tumor cells (12;13). To our knowledge, only two non-mammalian cell types have been shown to release exosomes, C. elegans (14) and Cryptococcus neoformans (15). In addition, some members of the phylum Ascomycota have been shown to export proteins using secreted vesicles, although these have not yet been fully characterized (16). Though much remains to be learned, we are beginning to appreciate the functions of mammalian exosomes as intercellular signaling and communication devices, and to unravel their complex roles in immune-modulation and immune surveillance. We report here that exosome release is a general mechanism for protein secretion by leishmania. Moreover, we show that these vesicles deliver cargo to and communicate with macrophages. As far as we are aware this is the first evidence reported for exosome release by a protozoan pathogen as well as the first direct evidence for an apparent broad-based mechanism of protein export from leishmania.  3.3 Results 3.3.1 Protein secretion by leishmania involves the release of exosome-like vesicles To determine whether release of exosomes was the major mechanism of protein export from leishmania, conditioned medium from both L. donovani and L. major was subjected to differential centrifugation with a final speed of 110,000xg (17), the characteristic exosome pelleting speed. The pellets were found to contain exosomal markers (18) such as heat shock protein (HSP) 70, HSP90, and elongation factor-1EF-1 (Fig. 3.1A). Additionally, the 110,000xg pellets had distinct protein profiles when compared to the cells from which they were collected and the cellular debris that pelleted prior to collection of exosomes (Fig. 3.1B, P4 compared with P1-3).  70  We investigated whether these high-speed pellets contained intact vesicles, as opposed to membrane fragments, using three independent approaches: 1) trypsin sensitivity, 2) density gradients, and 3) microscopy. We treated the 110,000xg pellets with trypsin in the presence or absence of a  71  detergent (Fig. 3.1C) to determine whether the proteins detected via Western blotting (Fig. 3.1A) were indeed luminal to vesicles. Unlike trypsin treatment alone, which had a minimal effect on the amount of HSP70, HSP90 or EF-1, the combination of detergent and trypsin completely abolished exosomal marker signals (Fig. 3.1C). These results indicate that the 110,000xg pellets contained intact vesicles in that their cargo was protected from enzymatic degradation by a membrane. Exosomes migrate to a specific density (1.08-1.15 g/ml) in a linear sucrose density gradient. Consistent with this, leishmania secreted vesicles migrated to densities of 1.06-1.17 g/ml (Fig. 3.1D - E). Moreover, examination of the secreted vesicles after sucrose density purification by transmission EM showed them to contain vesicles ranging from 30-70 nm in diameter (Fig. 3.1F-G) with the cup-shaped morphology characteristic of mammalian exosomes (8). In addition, we detected the exosomal marker HSP70 within these vesicles by immunoEM (Fig. 3.1G). Secondary antibody controls confirmed that the gold labeling was specific to HSP70 in the exosomes. Based upon our observation by SEM of 50 nm vesicles budding from the flagellar pocket of L. donovani promastigotes (3), we carried out further ultrastructural analysis of vesicle release and this included both L. donovani and Leishmania mexicana. This analysis identified 50 nm vesicles and MVBs budding from the plasma membrane of L. mexicana (Fig. S3.1), and similar vesicles within the flagellar pocket of L. donovani promastigotes. Taken together, these biochemical and ultrastructural findings indicate that leishmania release microvesicles with all of the characteristic properties of bona fide exosomes. 3.3.2 Leishmania exosome release at elevated temperature and low pH Leishmania experience heat shock when they are delivered to a mammalian host (37°C) by the bite of a sandfly (26°C). To investigate heat shock induced changes in exosome release, we collected vesicles from stationary phase populations of L. donovani promastigotes incubated at either 37°C or 26°C for 24 h. Populations cultured at the two temperatures were counted and adjusted before  72  exosome collection to ensure equivalent numbers. After collection, exosomes from the two treatment groups were resuspended in equal volumes of lysis buffer. When equal volumes were analyzed, it was clear that exosomes collected from cells at 37°C had a significant increase in exosomal marker proteins (Fig. 3.2).  When an equal amount of protein from the two samples was analyzed, no difference was observed, indicating the high temperature induced exosome release, as opposed to increased secretion of HSPs per se. To confirm that this finding was not an artifact of a global increase in production of the heat shock proteins, we probed whole cell lysates (WCL) generated from the cells that produced the 73  exosomes and found no difference in HSPs between the two conditions (data not shown). It is well known that incubating stationary phase leishmania at 37°C induces a growth arrest (19) and that the lowering of the pH is required for full differentiation into amastigotes. Our results were consistent with this. After a 24 h exosome collection, the 26°C sample had consistently expanded to more than 6.0E+07 cells/mL, while the population cultured at 37°C was static at 4.5E+07 to 5.0E+07 cells/mL (data not shown). In order to account for the observed 2.2 fold increase in HSP70 release at 37°C (Fig. 3.2B) each organism at 37°C would have had to release roughly three times the number of vesicles as an organism cultured at 26°C. This applies as well to HSP90 (Fig. 3.2C). In contrast to heat shock, lowering the pH of the medium from 7.5 to 5.5 to reflect conditions in a maturing phagolysosome, had no effect on the number of vesicles released when compared to secretion at neutral pH (Fig. 3.3).  74  Unexpectedly, we reliably detected significantly less of the exosomal marker EF-1 in vesicles harvested from cells incubated at low pH (Fig. 3.3D). This finding was concordant with a quantitative proteomic analysis (discussed below), where EF-1 had a pH 7.5/pH 5.5 ratio higher than the overall mean indicating relative enrichment at pH 7.5 (Fig. 3.3D and Table S3.4). Taken together, these results suggest that while an acidic environment did not influence bulk exosome release from L. donovani at 37°C, it did affect the cargo of these vesicles. To control for the possibility that cell death resulting from the heat shock and reduced pH was responsible for the increase in vesicles release, we analyzed the viability of the treated leishmania populations by flow cytometry. We found that increasing the temperature from 26°C to 37°C and 37°C+pH 5 resulted in a slight increase in the number of dead cells, from ≈5% at 26°C to ≈8% at both 37°C and 37°C+pH 5. Clearly, this 3% increase in cell death could not have accounted for the 100% increase in exosomal protein released brought about by heat shock (Figs. 3.2 and 3.3). 3.3.3 Proteomic analysis of L. donovani exosomes Two quantitative proteomic analyses of exosomes secreted by L. donovani under early infectionlike conditions were conducted. The first analysis compared the proteomes of vesicles collected at 26°C versus 37°C (both at pH 7.5). The second analysis compared vesicles collected in media at pH 7.5 versus pH 5.5 while holding the temperature constant at 37°C. In both cases, exosomes collected from equal volumes of culture medium were compared. In six individual 37°C/26°C comparative liquid chromatography-tandem mass spectrometry (LCMS/MS) analyses over 400 proteins were identified in leishmania exosomes. For inclusion in the exosome proteome and the quantitative analysis a protein must have been identified in at least two of the analyses. Using these parameters the relative amounts of 233 exosome proteins secreted at 37°C and at 26°C were quantified (Fig. 3.4A and Table S3.1).  75  76  The ratios ranged from 15 to 0.15, a clear indication that specific enrichment of proteins into vesicles occurred in response to changes in temperature. In every analysis performed, the proteins with the highest 37°C/26°C ratios were - and -tubulins: LmjF13.0280, LmjF33.0792, and LmjF21.1860 (Table S3.1). Furthermore, HSP90 (LmjF33.031) had a ratio of 5, placing it in the top 75th percentile of all 37°C/26°C ratios. Four different heat shock protein 70 homologues were identified (LmjF30.2460, LmjF28.2770, LmjF28.1200, LmjF26.1240) all of which had ratios indicating their relative enrichment in the 37°C exosomes (Fig. 3.4 and Table S3.1). In addition to illustrating that changes in temperature brought selective enrichment of certain proteins, these quantitative proteomic data are concordant with the findings reported in Figure 3.2 showing that high temperature resulted in the secretion of more vesicles. Using similar parameters for inclusion in the quantitative analysis, 175 exosomal proteins were identified in vesicles collected under the conditions of neutral pH versus low pH medium (Fig. 3.4B and Table S3.1) at 37°C. - and -tubulin proteins had ratios around 1 (Table S3.1), indicating they were present in approximately equal amounts in either condition. This was also true of the HSPs; HSP90 (LmjF33.0312) had a ratio of 0.9, HSP70 (LmjF26.1240) had a ratio of 1. However, not all heat shock proteins followed this pattern, heat shock protein 10 (LmjF26.0620) had a ratio of 0.7, placing it within the bottom 25th percentile (Fig. 3.4B and Table S3.1). Again, these results agree with the Western blotting results (Fig. 3.3) indicating that acidic pH influenced exosome cargo, but not exosome release. We amalgamated the two quantitative comparisons to generate a global leishmania exosome proteome (Table S3.1). Proteins that were identified in at least two of ten experiments were included, bringing the sub-total to 329 proteins (Table S3.1). These inclusion parameters are conservative when compared to similar studies in the literature (20;21) where for example, only one peptide detected in a single experiment was required for inclusion. The exosome proteome of L. donovani accounted for over half (52%, Fig. 3.4C and Table S3.3) of the total secretome of stationary phase L. donovani (3). 77  Considering the strict inclusion parameters imposed on both the secretome and exosome analyses, this is most likely an underestimation of their similarity. In fact, several of the individual exosome LCMS/MS analyses overlapped with the secretome by more than 70%. The high protein overlap between the leishmania secretome and the exosomes suggests the novel finding that these vesicles are the primary mechanism of protein release from leishmania. When compared to a recently compiled list of common mammalian exosomal proteins (21), we found that leishmania exosomes contained orthologs for approximately 52% of the mammalian exosome proteome (Fig. 3.4D and Table S3.4). In addition to characterized orthologs, such as Rab1 (LmjF27.0760) and Rab11 (LmjF10.0910) (22), this included three leishmania exosome-associated hypothetical proteins identified by BLAST analysis as similar to mammalian exosomal proteins involved in exosome biogenesis: LmjF23.0990 had high similarity to the ESCRT-3 subunit Chmp2; LmjF27.1640 was highly similar to Alix, and LmjF29.0110 had high similarity to Radixin (21). 3.3.4 Functional annotation of exosomes released at elevated temperature and low pH Using the results of the quantitative proteomics, we carried out a functional characterization of leishmania exosomes released under either normal culture conditions (26°C) or under infection-like conditions (37°C and acidic pH). The results depicted in Fig. S3.2 show that exosomes were enriched in a wide variety of functions including the process of Vesicle-mediated Transport, and intracellular membrane-bound organelles (Table S3.5). Interestingly, for exosomes harvested at 37°C, Kinase Activity was enriched in vesicles at neutral pH, in direct contrast to the enrichment of Phosphatase Activity in acidic pH exosomes (Fig. S3.2B). The concentration of specific and sometimes opposing functions within exosomes harvested under different conditions provides additional evidence that leishmania exosome-mediated protein secretion is an active process subject to regulation.  78  3.3.5 Leishmania exosomes are released into infected macrophages and are taken up by naïve cells from the extracellular environment Based upon our findings that the majority of leishmania protein secretion appeared to be mediated by exosomes, we hypothesized that leishmania expressing green fluorescent protein (GFP) would secrete GFP in exosomes. This turned out to be correct. Western blotting and fluorimetery confirmed the presence of GFP in exosomes harvested from the GFP-Ld. As shown in Figure 3.5, we found that as early as 2 h post infection, infected macrophages contained GFP-labeled punctate structures with the morphology of vesicles ≈ 200 nm in diameter (Fig. 3.5A-D). Exosomes are too small to be resolved individually with a confocal microscope, however, the punctuate structures visible (concave arrowheads) were of an appropriate size for MVBs containing multiple GFP+ exosomes. Moreover, we observed actin rings (convex arrowhead) encircling GFP+ vesicles (concave arrowhead) in the processes of blebbing off internalized leishmania (asterix) into the infected macrophage (Fig. 3.5A-B). In Figure 3.5A it is evident that the macrophage contains at least three other leishmania derived vesicles. Figure 3.5C also depicts a cell with multiple leishmania derived vesicles apparently secreted by the internalized leishmania. Figure 3.5D shows an infected cell of the left, and an uninfected cell on the right. The uninfected cell contains a GFP+ vesicle, indicating that the macrophage has engulfed vesicles released by un-internalized leishmania into the extracellular environment. To examine further the extent to which macrophages take up leishmania exosomes from the extracellular environment, we treated macrophages with GFP+ exosomes harvested and purified from GFP-Ld under endotoxin free conditions. Similar to what we observed when we infected cells with GFPLd (Fig. 3.5A-D), macrophage actin rings (convex arrowhead) were seen mediating engulfment of GFP+ exosomes (Fig. 3.5E-F). Furthermore, the GFP+ exosomes appeared to be accessing the cytoplasm of the host cell (Fig. 3.5E arrow). It is noteworthy that no GFP fluorescence was detectable at time points later than 2 h, indicating that the internalized leishmania proteins were degraded, or that the exosomal GFP is no longer detectable after it diffuses throughout the comparatively vast host cytoplasm.  79  We used fluorescent labeling of leishmania surface proteins (such as leishmanolysin GP63, which was consistently present in leishmania exosomes, Table S3.1), as an orthogonal approach to show that leishmania export vesicles into the cytoplasm of infected macrophages (Fig. 3.6A). This analysis showed that surface proteins released from FITC-leishmania accumulated in the host cell cytoplasm with punctate morphology in a time-dependent manner (Fig. 3.6A, concave arrowheads). These punctate structures were of an appropriate size for MVBs containing multiple FITC-labeled exosomes (Fig. 3.6A) and ultrastructural studies provided additional support for this.  80  81  Examination of leishmania infected cells by TEM after high-pressure cryopreservation provided direct ultrastructral evidence that leishmania mediate protein release into infected cells using exosomes. We observed vesicles with the morphology of exosomes apparently budding from the phagolysosomal membrane (PLM) of internalized leishmania, both as lone vesicles 30-70 nm in diameter with the classic cup shape of exosomes (Fig. 3.6B and B’), and also within MVBs (Fig. 3.6C). Note that the intraluminal vesicles of the MVB in Figure 3.6C are uniform in size, ranging from 30-50 nm, as well as in electron density; similar to the purified leishmania exosomes described earlier (Fig. 3.1 F-G). In contrast, in Figure 3.6 D is shown a dead leishmania undergoing early degeneration where no exosomal budding can be seen. This implies, as would be expected, that exosome release from the phagosome requires intact, viable amastigotes. Moreover, Figure 3.6D shows an apparent MVB (white arrowhead) associated with the PLM. However, its morphology is highly disorganized and strikingly different from the MVB in Figure 3.6C, consistent with the degenerative state of the organism in the phagolysosome. To examine whether leishmania exosomal cargo is delivered to the cytoplasm of infected or exosome treated cells, we used leishmania-specific antibodies against HSP70 and HSP90. Both proteins were detected in the cyotosolic compartment of leishmania infected macrophages (Fig. 3.6E). It is important to note that this finding was not an artifact due to disruption of the phagosome during subcellular fractionation, as the phagolysosomal marker mature cathepsin D was not detected in these cytosolic fractions (Fig. 3.6E). In contrast, none of the leishmania exosomal markers (HSP70, HSP90) found in the cytosol of infected cells (including EF-1α and aldolase (23;24)) were detected by Western blotting in the cytosol or WCLs of exosome treated cells. This may seem contradictory to our findings that leishmania GFP+ exosomes bind to and appear to be internalized by treated macrophages (Fig. 3.5 E-F). However, we believe these results indicate that once leishmania exosomes are bound to naïve macrophages, they are rapidly internalized and subsequently undergo processing and degradation.  82  Whatever these events involve, it appears that the fate of these exosomes is somewhat different from exosomes that arise from within an infected cell. In summary, we have observed 1) the release of leishmania GFP+ vesicles into infected cells (Fig. 3.5A-D), 2) isolated vesicles with exosome morphology and MVBs containing similar vesicles budding from the phagolysosome of live internalized leishmania (Fig. 3.6B-C), 3) the uptake of GFP+ exosomes by treated, uninfected cells (Fig. 3.5E-F) and 4) leishmania exosomal proteins in the cytosol of infected macrophages (Fig. 3.6E). Together these data suggest that leishmania use exosomes to deliver molecular messages to infected as well as neighboring uninfected macrophages. In addition, our data suggests that leishmania may use these vesicles to deliver cargo to the cytoplasm of infected cells. 3.3.6 Leishmania exosomes selectively induce macrophage secretion of IL-8 Having shown internalization of leishmania exosomes by treated macrophages, we then examined whether exosome treatment altered macrophage cytokine production. Incubation of differentiated THP-1 cells with endotoxin-free leishmania exosomes did not result in induction of TNF-α secretion, although both LPS and IFN-γ brought about such a response (data not shown). In contrast, exosome treatment did induce macrophage secretion of IL-8 in a dose-dependent manner (Fig. 3.7).  83  This effect was qualitatively similar to what was observed with infection per se. IL-8 was induced by vesicles harvested at both neutral and acidic pH (Fig. 3.7). Moreover, this was true for both L. donovani (Fig. 3.7) and L. major exosomes. It is clear from this data that leishmania exosomes modify the specific cytokine profile of treated macrophages.  3.4 Discussion The findings reported above indicate that L. donovani, L. mexicana and L. major release microvesicles possessing the known biochemical and morphological characteristics of mammalian exosomes. These leishmania organelles contain exosomal markers, display exosome morphology, and migrate through a linear sucrose gradient exactly as do classical exosomes (Fig. 3.1). Moreover, the protein cargo of these exosomes accounts for over half - and very likely more - of total protein secretion by L. donovani (Fig. 3.4). This provides strong evidence for a model in which exosome release is the major mechanism of protein secretion from Leishmania spp. During the past decade, a large number of proteomic studies of mammalian exosomes have been performed (for a review see (21)). A common pattern has emerged from these with approximately 60 proteins or protein families (e.g., Histones, Annexins) having been identified as classical exosomal markers, while other exosomal proteins are recognized as cell type specific. Our results show that the leishmania exosome proteome overlaps with the common mammalian exosome proteome >50% (Fig. 3.4D and Table S3.4), firmly establishing the leishmania secreted microvesicles as exosomes. 3.4.1 Exosome phenotype is modulated in response to infection-like conditions It was of interest to examine whether heat shock, or both heat shock and acidic pH would bring about changes in exosome cargo and release, perhaps reflecting a role for exosomes in the initial infection of a mammalian host. Exosome release increased significantly in response to temperature elevation (Fig. 3.2). Additionally, the cargo of leishmania exosomes was found to be both temperature and pH sensitive. Not only was there specific packaging of individual proteins, we also detected specific 84  functional enrichments based on changes in both temperature and pH (Fig. S3.2 and Table S3.5). This may likely reflect a sophisticated packaging of virulence factors by leishmania in response to specific environments. Table 3.1 lists a few of the most interesting candidate virulence factors identified in leishmania exosomes based on their increased secretion at 37°C or at acidic pH. Additional study is required to elucidate the role of individual exosomal proteins in leishmania pathogenesis. Table 3.1 Leishmania exosomes carry candidate virulence factors  Intracellular survival  GeneDB Accession No. LmjF10.0460 LmjF26.0620 LmjF26.1240 LmjF15.1040  T cell antigens  LmjF11.0350 LmjF35.2210  Functional Class Immune evasion/suppression  LmjF28.2740 LmjF08.1110  Protein Identity GP63, leishmanolysin Heat shock protein 10 Heat shock protein 70 TRYP1, tryparedoxin peroxidase 14-3-3 like protein kinetoplastid membrane protein-11 activated protein kinase c receptor (LACK) stress-induced protein sti1  Enriched in acidic pH + +  References (25;26) (27;28) (29;30) (31)  + -  (32) (33)  -  (33)  -  (34)  3.4.2 Leishmania exosomes are delivered to host cells and facilitate pathogen-host communication In the present study, using GFP-leishmania we observed the release of leishmania derived vesicles into infected cells (Fig.3.5A-D). Furthermore, after infecting cells with FITC-surface labeled organisms, we detected the time-dependent accumulation of FITC+ vesicles in cell cytosol with a size range consistent with MVB’s (Fig. 3.6A). In addition, we observed the uptake of leishmania exosomes from the extracellular environment by naïve cells (Fig. 3.5D-F and 3.6A). Taken together, these results suggest a model in which leishmania exosomes deliver cargo to host cells. This model is supported by the detection, both in this report and two previous reports, of the exosomal markers HSP70 and HSP90 (Fig. 3.6E) as well as EF-1α and aldolase in the cytosol of infected cells (23;24). Moreover, our results clearly show that these exosomes selectively induced IL-8 secretion (Fig. 3.7). In summary, these  85  results strongly support the conclusion that leishmania utilize exosomes to deliver effector molecules to host cells as well as to communicate with the wider host cellular environment. Induction by leishmania exosomes of macrophage IL-8 may be of importance to disease pathogenesis. A model has emerged recently to suggest that leishmania use neutrophils as Trojan horses to deliver themselves to macrophages via a “silent phagocytosis” pathway to avoid cell activation (35). Clearly, our results show that exosomes from L. donovani, as was true for infection per se, induced IL-8 secretion (Fig. 3.7), a response which is likely to bring about the early recruitment of neutrophils to the site of infection (36). Understanding the full impact of the interaction of leishmania exosomes with host cells and the molecules responsible for these interactions is the focus of ongoing work. Our results suggest three possible mechanisms for delivery of exosomes or exosomal cargo to infected cells. First, as shown in Figure 3.6B and B’, leishmania exosomes may bud off the PLM as de novo microvesicles. In this case, the exosomal cargo could be transported to the host cytosol either by membrane transporters embedded in the exosomal membrane (see Fig. 3.8, mechanism 1, and Table 3.2) or via retrograde trafficking to the Golgi. Table 3.2: Transmembrane transport related proteins in leishmania exosomes Transporter Category  Transported compounds  GeneDB Accession No.  ATP-binding Cassette transporters  Lipids and sterols Metabolic products Drugs  ATPase subunits  Cations  Nucleoside transport  Nucleobases and Nucleosides Glucose  LmjF29.0620 LmjF27.0980 LmjF15.0890 LmjF06.0080 LmjF25.1170 LmjF35.2080 LmjF05.0500 LmjF31.1220 LmjF10.0380 LmjF36.1940 LmjF36.6290  Glucose transport  86  In this regard, leishmania exosomes contain many proteins involved in direct membrane transport (Table 3.2 and Tables S3.1, S3.5 and S3.6) and these transporters could be used to transport exosomal cargo into the macrophage cytosol. Conversely, depending upon their orientation, the transporters could move host anti-leishmania effectors into exosomes, effectively sequestering them within these vesicles thereby abrogating their effects. Second, the ultrastructural findings of Figure 3.6C, depicting an MVB associated with the phagosome, in particular support a mechanism whereby exosomes could be reverse endocytosed out of the phagosome as MVBs into the cell, similar to what was observed with trichosanthin loaded exosomes (37). From this location, they could hijack the host retrograde trafficking pathway to deliver leishmania exosomes to the host trans-Golgi (Fig. 3.8, mechanism 2). Here, the cargo would have access to the entire host secretion system, including the cytosol (38). Third, as demonstrated by Figure 3.5D-F, leishmania exosomes released by promastigotes or amastigotes could bind to and perhaps fuse with respectively the plasma or phagolysosome membrane, directly dumping exosomal cargo into the host cell (see Fig. 3. 8, mechanism 3).  87  3.5 Conclusion For many years, a mechanism accounting for protein secretion from leishmania has remained elusive. The findings presented in this report identify a novel exosome-based pathway as a general mechanism of protein secretion used by Leishmania spp. Moreover, our data suggests this pathway participates in pathogen-to-host communication and in the delivery of exosomal cargo into macrophages. The results also show that leishmania up-regulate exosome production and modify exosomal cargo in response to environmental factors that mimic infection. The specific identities of the cargo proteins within leishmania exosomes suggest that they have the potential to modulate macrophage cell regulation and functional properties. Indeed, the finding that these vesicles selectively induced IL-8 secretion provided direct evidence to support this. While this study by design focused on the protein cargo found in leishmania exosomes, it is also highly likely that other classes of bioactive molecules may contribute to the biological properties of these microvesicles. It has recently been shown that exosomes from human mast cells are a source of bioactive shuttle RNA’s -both mRNAs and microRNAs- that can be transferred between cell types (39). Our initial unpublished results show that leishmania exosomes indeed contain RNA’s and these vesicles could serve as an excellent delivery mechanism into host cytosol. The implications for the discovery of exosomes as the major mechanism of secretion from leishmania are significant. For example, our preliminary data show that leishmania isolates of the same species, but causing divergent disease phenotypes clinically, displayed distinct exosome proteomic profiles. This suggests that exosome-based secretion may contribute to different disease phenotypes. In addition, investigation of leishmania exosomes has the potential to highlight important drug targets that are active in the host cytoplasm and are released extracellularly, relatively accessible locations for drug targeting. Finally, the biological similarity between leishmania and other trypanosomatids is very high, and insights from leishmania exosome biology may inform typanosome biology more generally  88  and, for that matter, may have relevance to other eukaryotic intracellular pathogens such as Toxoplasma and Plasmodia spp.  3.6 Materials and methods 3.6.1 Reagents, materials, and antibodies Except where otherwise noted, reagents were obtained from the Sigma-Aldrich Inc. FBS and RPMI1640 were purchased from Invitrogen. All ultracentrifugation hardware including tubes, rotors and centrifuges were purchased from Beckman Coulter. Leishmania specific -HSP70 and -HSP90 were described previously (40). Leishmania specific anti-histidine secreted acid phosphatase (SAcP) was from Dennis Dwyer. -cathepsin-D was purchased from CalBiochem; -EF-1 from Upstate Biotechnologies, -mouse, -rabbit, and -goat HRP-conjugated IgG from CedarLane; HRP-conjugated and 4nm Goldconjugated α-chicken IgY from Jackson ImmunoResearch. 3.6.2 Cell culture L. donovani Sudan S2, L. mexicana MNYC/BZ/62/M379 and L. major Fredlin (MHOM/IL/80/Friedlin) promastigotes were cultured as described (3;40). The murine macrophage cell lines RAW264.7 and J774, and the human pro-monocytic cell line THP-1 were cultured in RPMI-1640 + 10% FBS as described (7;24). Leishamania were transfected with pXG-eGFP (a kind gift from Dr. Stephen Beverley) as described and selected for by semi-solid plating (41). GFP expression was maintained with 0.5-1 µg/mL G418. 3.6.3 Isolation of exosomes Stationary phase promastigotes, ≈ 50.0E+6 cells/mL, were washed 3X with HBSS to remove FBS and re-suspended in buffered exosome collection media (ECM). To collect exosomes under conditions of neutral pH, RPMI-1640 was buffered with 20 mM HEPES and supplemented with 2 mM L-Glutamine, 1% Penicillin/Streptomycin, and 1% D-Glucose. For collection under acidic conditions RPMI-1640 was  89  buffered with 25mM MES (42) and supplemented as above. The pH of MES-buffered ECM was lowered to pH 5.5 using HCL. Exosomes were isolated as described (17) with minor modifications. After 24 h, promastigotes were removed from ECM via centrifugation at 300xg for 10 min. Cell pellets were washed 3X in PBS + 1mM EDTA and 10µg/mL PMSF and stored at -70°C. The cell free ECM was spun at 700xg for 30 min and 15,000xg for 45min to remove residual cells and debris. Exosomes were pelleted from the cleared ECM at 110,000xg for 1 h in a Type 70ti rotor followed by re-suspension in either 1mL cold PBS, or 1 mL 2.5 M sucrose (20mM HEPES, pH 7.4). For immediate analysis, exosomes in PBS were concentrated further by ultracentrifugation at 110,000xg for 1.5-2 h in a TLA-100.3 rotor and re-suspended in 50-100 μl PBS. 3.6.4 Purification of exosomes Exosomes were purified by flotation in a linear sucrose gradient as previously described (17). Briefly, pelleted exosomes were re-suspended in 2.5 M sucrose, which was overlaid with a step-wise gradient (2.5 M-0.25 M sucrose, 20 mM HEPES, pH 7.4) followed by ultracentifugation at 200,000xg for 15-20 h at 4°C in a SW40 rotor. Gradient fractions (1 mL) were harvested from the bottom of the tube with a 23 gauge needle. Fraction densities were read with a hand held refractometer followed by dilution in 23 mL PBS and ultracentrifugation at 110,000xg for 2 h in a Type 70 Ti rotor to pellet vesicles. Pellets were immediately solubilized by boiling for 10 min in 100 l reducing Laemmli sample buffer. Samples were either stored at -20°C or immediately resolved by SDS-PAGE followed by Western blotting using standard procedures as previously described (3). 3.6.5 Exosome isolation for proteomic analysis To increase yield and purity of the exosomes we substituted the 110,000xg spins with filterconcentration (43). The cleared conditioned media (see Isolation of Exosomes) was concentrated in a 100kDa MWCO Centricon Plus-70 (Millipore), and purified in a sucrose cushion consisting of 4 mL PBS  90  layered on top of 0.5 mL 2.5 M sucrose (20mM Tris pH 7.4/D2O) underlying 0.75 mL 1M sucrose. The cushions were ultracentrifuged (SW55 rotor) at 200,000xg for 3 hours. Cushion fractions were collected from the bottom of the tube and the 1 M sucrose, exosome containing, fraction was washed and concentrated with a 100 kDa MWCO Ultrafree-15 filter (Millipore), followed by pelleting at 110,000xg in a TLA-100.3 rotor for 1.5h. The exosome pellet was solubilized in digestion buffer (50 mM NH4OH, 1% Na-deoxycholate, pH 8.0), denatured by boiling for 10 min, and adjusted to a protein concentration of 1 g/mL using the Pierce Micro-BCA Protein Assay. 25 µg of exosome protein was trypsinized as previously described (3). 3.6.6 Peptide labeling and mass spectrometry Tryptic peptide digests were desalted and concentrated as described previously (44) and reductive dimethylation using formaldehyde isotopologues was performed to differentially label peptides from the different growth conditions. Peptides from pH 5.5 cultures and from 26°C cultures were labeled with light formaldehyde (CH2O) while peptides from pH 7 cultures and from 37°C cultures were labeled with heavy formaldehyde (C2H2O). The labeling reactions were performed as described (45) and combined peptide samples were analyzed by LC-MS/MS with a linear trapping quadrupole-OrbitrapXL (ThermoFisher Scientific). 3.6.7 LC-MS/MS data analysis Fragment spectra were searched against the L. major (May 2006 compilation, 17392 sequences) protein database using Mascot (v2.2, Matrix Science) with the following parameters; trypsin specificity allowing up to one missed cleavage, cysteine carbamidomethylation as a fixed modification and heavy and light dimethylated lysine side chains and peptide amino termini as variable modifications, ESI-trap fragmentation characteristics, 3-ppm mass tolerance for precursor ion masses, 0.8 Da tolerance for fragment ion masses. As we have published previously (3) proteins were considered identified when at least two unique peptides of eight or more amino acids and with Mascot IonsScores > 25 resulting in an estimated false discovery rate of less than 0.5% based on reversed database searching. All peptide and 91  protein identification information acquired in this study can be found in Table S3.1 and all quantitative information can be found in Table S3.2. 3.6.8 Gene ontology annotation enrichment analysis The AmiGO term enrichment tool (46;47) performed the GO enrichment analysis. Test sets examined were proteins with peptide ratios falling above the 75th percentile, >3.789 in the 37°C/26°C analysis and >1.258 in the pH comparison, and below the 25th percentile, <1.884 in the temperature analysis and <0.861 in the pH comparison. The exosome proteomes (n=233 for 37°C/26°C; n=175 for pH 7.5/pH 5.5) were the reference data sets. Only 159 of 175 proteins from the pH experiment and 216 of 233 proteins from the temperature experiment had assigned annotations (Table S3.5). The remaining proteins were hypothetical and have no assigned GO terms. 3.6.9 Exosome isolation for macrophage treatments Endotoxin free exosomes were isolated following the procedure for proteomic analysis substituting all reagents with culture grade solutions. In addition, concentration of vesicles prior to sucrose purification was performed using 100,000 kDa MWCO VivaCell 100 filtration devices (Sartorius AG). The 1M sucrose was filtered through Mustange E endotoxin removal filters (Pall Corporation). The Ultraclear 5 mL tubes were incubated with 30% H2O2 for 4 h to remove endotoxin, followed by extensive washing with water. 2 mL PBS was underlayed with 0.75 mL 1M sucrose and concentrated samples were then overlayed. After ultracentrifugation, the exosome fractions were collected from the top. After re-suspension in 15 mL PBS, sucrose was removed by concentration to ≈ 200 µl with 100,000 kDa MWCO Vivaspin 20 filtration devices (Sartorius AG). 20 µl 1M sucrose was added to exosomes prior to storage at -80°C. 3.6.10 Leishmania viability after exosome collection After removal of supernatant for exosome isolation, 50 million leishmania were washed in PBS and re-suspended in 100 µl PBS + 1 ng/mL fluorescein diacetate. After 15 min in the dark the cells were  92  washed and re-suspended in 200 µl PBS/0.4% PFA + 2 ng/mL Propidium iodide. The populations were analyzed on a FACSCanto Flow Cytometer (BD Biosciences) using FL1 and FL3. Dead cell controls were generated by incubation with 10% PFA for 30 min followed by washing and staining. 3.6.11 Macrophage infection and exosome treatment Infection of macrophages, confocal microscopy and isolation of cytosolic fractions were performed as described (24). For confocal surface proteins of stationary phase promastigotes were covalently labeled (or not) with a FITC-succinimidyl ester (Invitrogen) following the manufacturer’s instructions. Washed stationary phase L. donovani were incubated in dye solution in the dark for 1 h at RT. Leishmania (+GFP or +FITC) were resuspended in 1 mL of RPMI-1640 and added to macrophages (RAW or J774) grown on sterile glass cover slips at a moi of 20:1. The infection proceeded at 37°C. Infected cells were washed, fixed with 4% PFA, permeablized with 0.01% Triton X-100, incubated with either 5 U/mL Alexa-546 Phalliodin (Invitrogen) or 10 ng/mL Hoechst33342 and mounted in Prolong Gold with DAPI (Invitrogen) or SlowFade (CalBiochem) respectively. GFP-Ld infections were imaged at 100x with a Leica TCS SP2 inverted microscope at the iCapture Institute (Vancouver, BC, Canada). Time course images were captured at 63x, with a BioRad Radiance 2000 scanning confocal system coupled to a Nikon Eclipse TE300 inverted epi-fluorescence microscope. Brightest Point projections of serial z-stacks were generated with ImageJ software Endotoxin-free exosomes collected from L. donovani at 37°C+pH5.5 were incubated with differentiated THP-1 cells in 96 well plates. In parallel, cells were treated with1 µg/mL E.coli 0111:B4 LPS, 1 ng/mL hIFN-γ (BioSource International) and L. donovani at an moi of 10:1 as positive controls. Cell-free supernatants were collected at indicated times and stored at -80°C. Cytokines were quantified by ELISA: IL-8 ELISA Kit (BD Biosciences Pharmingen), TNF-α ELISA reagents (EBiosciences).  93  3.6.12 Electron microscopy For analysis by electron microscopy, purified exosomes were fixed in 2% glutarahdehyde/4% PFA in cacodylate buffer for 2 h at RT. Samples were washed and absorbed onto formvar/carbon-coated copper grids for 10 min. Grids were washed and stained with 1% aqueous UA (Ted Pella Inc.). Samples were viewed on a JEOL 1200EX TEM (JEOL USA, Peabody, MA). Immuno-labeling was done following the procedure in (48), and primary antibodies were detected with 4 nm Gold α-chicken. Grids were imaged with a 1K AMT side mount camera on a Hitachi H7600 TEM operated at 80 kV. Midlog L. mexicana promastigotes were washed twice in Dulbecco's PBS and then fixed for 24 h (4°C, 1% paraformaldehyde, 0.025% glutaraldehyde, 0.2 M sodium cacodylate-HCl, pH 7.2). Sections were stained with 2% UA and Reynold’s lead citrate (49), followed by examination with a Philips CM 10 TEM at room temperature. Negative images were digitalized using a Nikon Super Coolscan 4000 film scanner and processed using Adobe Photoshop CS3. THP-1 cells were infected with stationary phase L. donovani promastigotes as described (50). After 24 h, cells were dislodged by up and down pipetting in cold PBS without Mg2+ and Ca2+, pelleted by centrifugation at 300xg and, and re-suspended in 25 µl 20% BSA in PBS. 1-2 µl of this material was high pressure frozen, freeze substituted in 1% osmium and 0.1% UA, embedded and polymerized in Spurr/Epon resin as described (49). Grids with 60 nm sections were imaged as for immuno-labeled exosomes. 3.6.13 Graphics and statistical analysis Except where noted, all micrographs were processed with Adobe Photoshop Elements 7. All graphs and statistical analyses were generated in GraphPad Prism 4.00. Proportional Venn diagrams were created with the DrawVenn Application (51).  3.7 Additional data files Six supplemental tables and two supplemental figures are available along with this manuscript. 94  Table S3.1: The proteome of leishmania exosomes. 329 proteins had at least two non-overlapping peptides that were detected and quantified in two or more individual analyses of leishmania exosomal proteins. The number of LC-MS/MS analyses in which each protein was detected is given in (No. of experiments observed in). After determining which proteins were to be considered for analysis as described in Methods, the means of the measured 37˚C/26˚C ratios for each protein identity were calculated (Overall Mean 37˚C/26˚C ratio). The standard deviations (SD) of the peptide ratios across the six analyses are included. Similarly, after determining which proteins were to be considered for analysis the means of the measured pH 7.5/pH 5.5 ratios for each protein identity were calculated (Overall Mean pH 7.5/pH 5.5 ratio). The standard deviations (SD) of the peptide ratios across the three analyses are included. Protein identities were determined as described in Materials and Methods and for Tables S3.1-2. The peptides corresponding to each identification are shown and the number of peptides is given. Table S3.2: Leishmania exosome peptide quantitation. A table listing all the peptides contributing to the identification of the proteins detected in leishmania exosomes and their corresponding properties used to calculate relative abundance ratios including mass charge ratio (MCR), charge, score, left and right flanking amino acid (AA) and relative mass error. Table S3.3: Exosomes account for 52% of the leishmania secretome. The leishmania secretome proteins and the proteins that were also detected in leishmania exosomes as indicated by a (√). Table S3.4: Proteins commonly found in mammalian and leishmania exosomes. The mammalian exosome proteome (Simpson et al., 2008) and the corresponding number of orthologs found in leishmania exosomes (No. Identified in leishmania exosomes). Table S3.5: Functional enrichments in exosomes harvested under normal culture conditions (26°C) versus 37°C at pH 7.5 or pH 5.5. Statistically enriched GO terms from each condition were determined as described in Methods. Tables were generated by Amigo. [GO Term] lists the gene 95  ontology identification number and the corresponding GO term annotated to the exosome proteins listed under [Genes], [Aspect] provides the GO term category: C=cellular compartment, P=biological process, F=molecular function, the p-values (see Methods) are given. Table S3.6: Leishmania exosomes contain mediators of vesicle transport. Exosome proteins with GO terms indicating involvement in vesicular transport are listed. [Functional Class] is the GO term and the GO accession numbers are given. Figure S3.1  96  Figure S3.2  97  3.8 Bibliography (1) Chappuis F, Sundar S, Hailu A, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol 2007 Nov;5(11):873-82. (2) Croft SL, Vivas L, Brooker S. Recent advances in research and control of malaria, leishmaniasis, trypanosomiasis and schistosomiasis. East Mediterr Health J 2003 Jul;9(4):518-33. (3) Silverman JM, Chan SK, Robinson DP, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol 2008;9(2):R35. (4) Wang GJ, Liu Y, Qin A, et al. Thymus Exosomes-Like Particles Induce Regulatory T Cells. J Immunol 2008 Oct 15;181(8):5242-8. (5) Wubbolts R, Leckie RS, Veenhuizen PT, et al. Proteomic and biochemical analyses of human B cell-derived exosomes. Potential implications for their function and multivesicular body formation. J Biol Chem 2003 Mar 28;278(13):10963-72. (6) Thery C, Regnault A, Garin J, et al. Molecular characterization of dendritic cell-derived exosomes. Selective accumulation of the heat shock protein hsc73. J Cell Biol 1999 Nov 1;147(3):599-610. (7) Bhatnagar S, Shinagawa K, Castellino FJ, Schorey JS. Exosomes released from macrophages infected with intracellular pathogens stimulate a proinflammatory response in vitro and in vivo. Blood 2007 Nov 1;110(9):3234-44. (8) Keller S, Sanderson MP, Stoeck A, Altevogt P. Exosomes: From biogenesis and secretion to biological function. Immunology Letters 2006 Nov 15;107(2):102-8. (9) de Gassart A, Geminard C, Hoekstra D, Vidal M. Exosome Secretion: The Art of Reutilizing Nonrecycled Proteins? Traffic 2004;5(11):896-903. (10) Trajkovic K, Hsu C, Chiantia S, et al. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008 Feb 29;319(5867):1244-7. (11) Nguyen DG, Booth A, Gould SJ, Hildreth JEK. Evidence That HIV Budding in Primary Macrophages Occurs through the Exosome Release Pathway. Journal of Biological Chemistry 2003 Dec 26;278(52):52347-54. (12) Graner MW, Alzate O, Dechkovskaia AM, et al. Proteomic and immunologic analyses of brain tumor exosomes. FASEB J 2008 Dec 24. (13) Liu C, Yu S, Zinn K, et al. Murine Mammary Carcinoma Exosomes Promote Tumor Growth by Suppression of NK Cell Function. J Immunol 2006 Feb 1;176(3):1375-85. (14) Liegeois S, Benedetto A, Garnier JM, Schwab Y, Labouesse M. The V0-ATPase mediates apical secretion of exosomes containing Hedgehog-related proteins in Caenorhabditis elegans. J Cell Biol 2006 Jun 19;173(6):949-61.  98  (15) Rodrigues ML, Nakayasu ES, Oliveira DL, et al. Extracellular Vesicles Produced by Cryptococcus neoformans Contain Protein Components Associated with Virulence. Eukaryotic Cell 2008 Jan 1;7(1):58-67. (16) Albuquerque PC, Nakayasu ES, Rodrigues ML, et al. Vesicular transport in Histoplasma capsulatum: an effective mechanism for trans-cell wall transfer of proteins and lipids in ascomycetes. Cell Microbiol 2008 Aug;10(8):1695-710. (17) Raposo G, Nijman HW, Stoorvogel W, et al. B lymphocytes secrete antigen-presenting vesicles. J Exp Med 1996 Mar 1;183(3):1161-72. (18) Stoorvogel W, Kleijmeer MJ, Geuze HJ, Raposo G. The biogenesis and functions of exosomes. Traffic 2002 May;3(5):321-30. (19) Barak E, min-Spector S, Gerliak E, !Lost Data, Holland N, Zilberstein D. Differentiation of Leishmania donovani in host-free system: analysis of signal perception and response. Mol Biochem Parasitol 2005 May;141(1):99-108. (20) Gilchrist A, Au CE, Hiding J, et al. Quantitative Proteomics Analysis of the Secretory Pathway. Cell 2006 Dec 15;127(6):1265-81. (21) Simpson RJ, Jensen SS, Lim JW. Proteomic profiling of exosomes: current perspectives. Proteomics 2008 Oct;8(19):4083-99. (22) Savina A, Vidal M, Colombo MI. The exosome pathway in K562 cells is regulated by Rab11. J Cell Sci 2002 Jun 15;115(12):2505-15. (23) Nandan D, Tran T, Trinh E, Silverman JM, Lopez M. Identification of leishmania fructose-1,6bisphosphate aldolase as a novel activator of host macrophage Src homology 2 domain containing protein tyrosine phosphatase SHP-1. Biochemical and Biophysical Research Communications 2007 Dec 21;364(3):601-7. (24) Nandan D, Yi T, Lopez M, Lai C, Reiner NE. Leishmania EF-1alpha activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem 2002 Dec 20;277(51):50190-7. (25) Kulkarni MM, McMaster WR, Kamysz E, Kamysz W, Engman DM, McGwire BS. The major surface-metalloprotease of the parasitic protozoan, Leishmania, protects against antimicrobial peptide-induced apoptotic killing. Mol Microbiol 2006 Dec;62(5):1484-97. (26) Joshi PB, Kelly BL, Kamhawi S, Sacks DL, McMaster WR. Targeted gene deletion in Leishmania major identifies leishmanolysin (GP63) as a virulence factor. Mol Biochem Parasitol 2002 Mar;120(1):33-40. (27) Johnson BJ, Le TTT, Dobbin CA, et al. Heat Shock Protein 10 Inhibits Lipopolysaccharide-induced Inflammatory Mediator Production. Journal of Biological Chemistry 2005 Feb 11;280(6):403747.  99  (28) Galli G, Ghezzi P, Mascagni P, Marcucci F, Fratelli M. Mycobacterium tuberculosis heat shock protein 10 increases both proliferation and death in mouse P19 teratocarcinoma cells. In Vitro Cell Dev Biol Anim 1996 Jul;32(7):446-50. (29) Cho JA, Lee YS, Kim SH, Ko JK, Kim CW. MHC independent anti-tumor immune responses induced by Hsp70-enriched exosomes generate tumor regression in murine models. Cancer Lett 2008 Nov 24. (30) Elsner L, Muppala V, Gehrmann M, et al. The Heat Shock Protein HSP70 Promotes Mouse NK Cell Activity against Tumors That Express Inducible NKG2D Ligands. J Immunol 2007 Oct 15;179(8):5523-33. (31) Reiner NE, Malemud CJ. Arachidonic acid metabolism by murine peritoneal macrophages infected with Leishmania donovani: in vitro evidence for parasite-induced alterations in cyclooxygenase and lipoxygenase pathways. J Immunol 1985 Jan;134(1):556-63. (32) Porter GW, Khuri FR, Fu H. Dynamic 14-3-3/client protein interactions integrate survival and apoptotic pathways. Seminars in Cancer Biology 2006 Jun;16(3):193-202. (33) Carvalho LP, Passos S, Dutra WO, et al. Effect of LACK and KMP11 on IFN-gamma Production by Peripheral Blood Mononuclear Cells from Cutaneous and Mucosal Leishmaniasis Patients. Scandinavian Journal of Immunology 2005;61(4):337-42. (34) Webb JR, Campos-Neto A, Skeiky YAW, Reed SG. Molecular characterization of the heatinducible LmSTI1 protein of Leishmania major. Molecular and Biochemical Parasitology 1997 Nov;89(2):179-93. (35) van Zandbergen G., Klinger M, Mueller A, et al. Cutting edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages. J Immunol 2004 Dec 1;173(11):6521-5. (36) Peters NC, Sacks DL. The impact of vector-mediated neutrophil recruitment on cutaneous leishmaniasis. Cell Microbiol 2009 Sep;11(9):1290-6. (37) Zhang F, Sun S, Feng D, Zhao WL, Sui SF. A novel strategy for the invasive toxin: hijacking exosome-mediated intercellular trafficking. Traffic 2009 Apr;10(4):411-24. (38) Vago R, Marsden CJ, Lord JM, et al. Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells. FEBS J 2005 Oct 1;272(19):4983-95. (39) Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 2007 Jun;9(6):654-9. (40) Hubel A, Brandau S, Dresel A, Clos J. A member of the ClpB family of stress proteins is expressed during heat shock in Leishmania spp. Mol Biochem Parasitol 1995 Mar;70(1-2):10718. (41) Ha DS, Schwarz JK, Turco SJ, Beverley SM. Use of the green fluorescent protein as a marker in transfected Leishmania. Mol Biochem Parasitol 1996 Apr;77(1):57-64.  100  (42) Debrabant A, Joshi MB, Pimenta PF, Dwyer DM. Generation of Leishmania donovani axenic amastigotes: their growth and biological characteristics. Int J Parasitol 2004 Feb;34(2):205-17. (43) Lamparski HG, Metha-Damani A, Yao JY, et al. Production and characterization of clinical grade exosomes derived from dendritic cells. Journal of Immunological Methods 2002 Dec 15;270(2):211-26. (44) Chan QWT, Howes CG, Foster LJ. Quantitative Comparison of Caste Differences in Honeybee Hemolymph. Mol Cell Proteomics 2006 Dec 1;5(12):2252-62. (45) Chan QW, Foster LJ. Changes in protein expression during honey bee larval development. Genome Biol 2008 Oct 29;9(10):R156. (46) Boyle EI, Weng S, Gollub J, et al. GO::TermFinder--open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinformatics 2004 Dec 12;20(18):3710-5. (47) Carbon S, Ireland A, Mungall CJ, Shu S, Marshall B, Lewis S. AmiGO: online access to ontology and annotation data. Bioinformatics 2009 Jan 15;25(2):288-9. (48) Brandau S, Dresel A, Clos J. High constitutive levels of heat-shock proteins in human-pathogenic parasites of the genus Leishmania. Biochem J 1995 Aug 15;310 ( Pt 1):225-32. (49) Giddings TH. Freeze-substitution protocols for improved visualization of membranes in highpressure frozen samples. J Microsc 2003 Oct;212(Pt 1):53-61. (50) Nandan D, Lo R, Reiner NE. Activation of phosphotyrosine phosphatase activity attenuates mitogen-activated protein kinase signaling and inhibits c-FOS and nitric oxide synthase expression in macrophages infected with Leishmania donovani. Infect Immun 1999 Aug;67(8):4055-63. (51) Chow S, Rogers P. Constructing Area-Proportional Venn and Euler Diagrams with Three Circles. 2005.  101  4. Leishmania Exosomes Modulate Innate and Adaptive Immune Responses through Effects on Monocytes and Dendritic Cells§ 4.1 Summary We recently reported that leishmania use exosomes as a general mechanism for protein secretion and that these vesicles are involved in the delivery of proteins to host target cells (In press, J. Cell Sci.). In the present study, we investigated the properties of leishmania exosomes with respect to influencing innate and adaptive immune responses mediated by primary human myeloid cells. Although we found that exosomes from L. donovani were mostly null with respect to inducing cytokine production by monocytes (TNF-, IL-10), these vesicles did modulate monocyte cytokine responses to γ-interferon. Moreover, leishsmania exosomes were generally inhibitory with respect to cytokine production (IL12p70, TNF-α, IL-10) by monocyte-derived dendritic cells (MoDCs). Consistent with this generally inhibitory phenotype, leishmania exosomes promoted Th2 cell polarization in vivo and caused exacerbation of disease in infected BalB/c mice. Exosomes from wild-type L. donovani were also ineffective at priming MoDCs to drive the differentiation of naïve CD4 cells into γ-interferon producing Th1 cells. In contrast, vesicles from HSP100 null L. donovani showed a dichotomous gain-of-function phenotype that was largely pro-inflammatory with the ability to drive naïve CD4 lymphocytes to differentiate into Th1 cells producing γ-interferon.  Moreover, proteomic analysis showed that  exosomes from wild-type and HSP100 null leishmania had distinct differences in protein cargo. These findings demonstrate that leishmania exosomes are capable of immune-modulation and that they are predominantly immunosuppressive. They also indicate that packaging of protein cargo into leishmania exosomes is regulated at least in part by the presence of amastigote-specific HSP100. Moreover, to our knowledge, this is the first evidence to show that changes in the exosome proteome influence the impact of these vesicles on myeloid cell function.  §  A version of this chapter will be submitted for publication. Silverman, J.M., J.Clos, A. Wang, M.M. Lynn, I. Kelly, R.W. McMaster, M.K. Levings, L.J. Foster, N.E. Reiner. Leishmania Exosomes Modulate Innate and Adaptive Immune Responses through Effects on Monocytes and Dendritic Cells.  102  4.2 Background Leishmania donovani is the causative agent of Old World visceral leishmaniasis (VL), a disease characterized by hepatosplenomegaly, fever and weight loss. A variety of treatment regimens have been described for VL and while these can be highly effective, they represent a significant expense in the developing world. Moreover, responses can be variable and drug resistance is a significant challenge in endemic foci (1;2). In the absence of effective chemotherapy, substantial morbidity and mortality ensue. A more comprehensive understanding of the biology of leishmania-host interactions would assist in the design of more effective therapeutics and a long sought vaccine strategy. Thus far, no leishmania vaccines have received regulatory approval, although scarification with live, attenuated organisms has been used in several endemic regions and has been linked anecdotally with protection against homologous infection (1). It is widely appreciated that leishmania secrete bio-active compounds that are involved in pathogenesis (3). For example, the surface metallopeptidase GP63, known to be necessary for virulence in mice (4;5), was recently shown to directly inhibit MAP kinase signaling in host cells (6), presumably after secretion into the host cytoplasm. Additionally, leishmania secrete cysteine peptidases like cathepsins B and L which have been shown to play a role in virulence through activation of TGF-β (7;8). Work from this laboratory has demonstrated that leishmania secrete elongation factor1α (EF-1α) into host cytosol where it selectively activates the SH-2 domain containing tyrosine phosphatase-1 (SHP-1) in host cells, leading to inhibition of IFN- signaling and prevention of macrophage activation (9). Indeed, a hallmark of leishmaniasis is persistent infection of macrophages which display a deactivated phenotype (10-12). Until recently, the mechanism(s) of release of leishmania effector proteins into host cells was unknown. Recently, we identified a general mechanism for protein export by leishmania based upon the secretion of exosomes and showed that exosomes are involved in the delivery of proteins into host  103  target cells (In press, J. Cell Sci.). Exosomes are 30-100 nm microvesicles, formed by invagination of endosomal membranes leading to the formation of multivesicular bodies. These microvesicles then released into extracellular spaces upon fusion of multivesicular bodies with the plasma membrane (13). Multiple mammalian cell types have been shown to release exosomes including dendritic cells (DCs), macrophages, T and B cells, and a wide variety of tumor cells (14). These microvesicles have been shown to function in cell-to-cell communication via receptor mediated activation of signaling pathways, in antigen presentation, and in the delivery of surface receptors and exosomal shuttle RNA to recipient cells (13). In this report, we examined the immunomodulatory properties of leishmania exosomes. Our findings show that these organelles are generally immunosuppressive and that their effects on myeloid cells are influenced by their protein cargo. To our knowledge this is the first report of a mechanism for delivery of leishmania immunosuppressive molecules to host cells and the first description of immunomodulatory exosomes secreted by non-mammalian cells.  4.3 Results 4.3.1 Leishmania exosomes modulate cytokine production by human monocytes. Incubation of human monocytes with exosomes harvested under amastigote-like conditions demonstrated that these cells responded with increased secretion of IL-8 (Fig 4.1A). In contrast, no impact on the secretion of either TNF-α or IL-10 (Fig. 4.1B-C) was observed. These results were in keeping with our earlier findings with THP-1 cells (In press, J. Cell Sci.). Notably, IL-12p70 was not reliably detected in supernatants of human monocytes, even following LPS stimulation.  104  We also examined the effect of leishmania exosomes on IFN-γ-induced cytokine production by naïve and infected monocytes. Pre-incubation of monocytes with exosomes did not affect subsequent  105  cytokine production in response to IFN-γ (Fig. 4.1D-F). In contrast, when cells were pre-treated with exosomes before infection with leishmania, significant inhibition of IL-8 and TNF-α production in response to IFN-γ was observed (Fig. 4.1D-E). Rather than inhibition, exposure of monocytes to exosomes prior to infection significantly potentiated IFN-γ-induced IL-10 production (Fig. 4.1F). These findings show that with the exception of directly promoting IL-8 secretion, the effects of leishmania exosomes on human monocytes generally favored immune suppression. 4.3.2 Leishmania exosomes attenuate a fully polarized Th1 response. Monocyte-derived dendritic cells (MoDC) found at the site of L. major infection have recently been shown to control the induction of a functional Th1 response in mice (15). In light of this finding and also their multiple other roles in the adaptive immune response, we investigated the effects of leishmania exosomes on MoDC phenotype and function. Incubation of immature MoDCs with leishmania exosomes brought about no changes in surface expression of HLA-DR, CD80, or CD86 (data not shown). However, exosome pre-treatment modestly impaired the differentiation of MoDC in response to CD40L as reflected by changes in the expression of both CD80 and CD86 (Fig. 4.2A), though no changes in HLA-DR were detected (data not shown). In contrast, the cytokine profile of exosometreated MoDCs clearly demonstrated significant, dose-dependent inhibitory effects (Fig 4.2B-D). Under all conditions, exosome treatment inhibited MoDC production of IL-12p70, TNF-α, and IL-10. Results for IL-6 were somewhat more complex (Fig. 4.2E); IL-6 production by immature DCs was not significantly affected by exosome treatment, whereas mature DCs displayed a bimodal response with slight induction of IL-6 at low concentrations and significant inhibition at higher concentrations. To control for the possibility that exosome treatment was toxic to DCs, cells were incubated with 7AAD to stain dead cells and no toxicity was apparent (Fig. 4.2F).  106  Although DC maturation per se did not appear to be affected by exosomes (based upon the parameters examined in Figure 4.2), this did not rule out the possibility that specific DC functional properties might be impaired. To examine this further, MoDCs were pulsed with L. donovani exosomes and then examined for their ability to support the differentiation of a Th1 response using an allogeneic model system. The latter consisted of co-culture of exosome-pulsed MoDCs from one donor with naïve  107  CD4+ T cells isolated from an unrelated donor with the readout being the number of IFN-γ-producing CD4 T cells. In parallel, we measured the allogeneic Th1 response driven by MoDCs that had been infected with L. donovani rather than treated with exosomes. We found that L. donovani infection of mature MoDCs (as well as immature MoDCs, data not shown) did not significantly influence the frequency of allo-reactive T cells (Fig. 4.3). Likewise, exosome-pulsed mature MoDCs did not induce an increase in the number of IFN-γ positive CD4 T cells when compared to control mature MoDCs (Fig. 4.3). Taken together, these findings suggest that similar to L. donovani infection, L. donovani exosomes have limited capacity to promote the differentiation of naïve human CD4 cells into Th1 cells through effects on MoDCs.  4.3.1 Exosomes exacerbate leishmania disease progression in vivo. The in vitro findings discussed above, painted a picture in which leishmania exosomes were seen to be generally inhibitory to monocyte and DC responses. To examine the properties of these vesicles further, we chose an in vivo model. Balb/c mice were injected subcutaneously with 15 μg of Leishmania major exosomes on two occasions separated by two weeks prior to subcutaneous challenge 108  with virulent L. major three weeks later. As shown in Figure 4.4, exposure of mice to exosomes markedly exacerbated disease throughout the course of infection. Five weeks post infection the mice were killed and their organs harvested for analysis. Notably, when compared with infected control mice, exosome-treated mice showed higher frequencies of IL-4 producing CD4 T cells in both spleen and draining lymph nodes (Fig. 4.4).  Moreover exosome treatment resulted in a reduction in the number of IFN-γ producing CD4 T cells in these organs. Interestingly, the number of Foxp3 expressing cells was also reduced after exosome treatment, indicating that, at least in this system, exosomes did not promote expansion of regulatory T 109  cells. No differences between control and exosome treatment were found when we examined the expression of IL-10 and IL-12p35 mRNA transcripts in the spleen, draining lymph node and lesional tissue (data not shown). These findings demonstrated clearly that exposure to exosomes in vivo was deleterious to the host and enhanced disease progression. 4.3.2 Immunemodulation by leishmania exosomes is influenced by vesicle composition. The immunomodulatory properties of leishmania exosomes observed thus far might have been related to the effects of specific protein cargo of these vesicles, to the display of surface exposed molecules or to both. To explore this, we took advantage of two L. donovani null mutants, HSP100-/and LPG2-/- (16;17). We were particularly interested in these two strains because we had previously found both LPG2 and HSP100 to be cargo of leishmania exosomes (In press, J. Cell Sci.). The LPG2 gene encodes a Golgi GDP-mannose transporter that is required for the synthesis of various phosphoglycans including LPG, proteophosphoglycan and glycoinositol-phospholipids (17). As a result, LPG2 null mutants are known to have reduced surface expression of these phosphoglycans (18-20) and would thus be expected to have reduced expression on exosomes. Moreover, LPG2-/- L. donovani show reduced infection rates both in vitro in macrophages and in vivo in murine models of infection (21) suggesting that surface phosphoglycans are important for virulence. HSP100-/- L. donovani had reduced virulence in vitro, and equivalent null-mutants of L. major were avirulent in vivo while showing no reduced viability as axenic culture forms (16;22). This led us to investigate the effects of HSP100 null mutations on vesicle packaging. We examined composition of high-speed (200,000xg) pellets from wild type (WT) and HSP100-/- L. donovani cell supernatants using high resolution 2D-gel analysis and found that specific heat shock proteins – HSP90, HSP70.4, chaperonin (CPN) 60.3 and CPN60.2, and TRAP1 (HSP75) - were apparently missing from the null mutants’ vesicles (Fig. 4.5A). Together with our earlier findings showing that multiple leishmania HSPs including HSP100 were secreted via exosomes (In press, J. Cell Sci.), this suggested the potential involvement of HSP100 in vesicle packaging of multiple HSPs 110  and perhaps other proteins as well. We examined this hypothesis using quantitative mass spectrometry and the results confirmed the reduced presence of HSP90 and HSP70.4 in exosomes secreted by HSP100-/- null mutants (Fig. 4.5 and Table S4.1). Wild type exosomes were also enriched relative to mutant vesicles in multiple validated or candidate virulence factors including GP63 (23), kinetoplast membrane protein 11 (24), and a putative homologue of iron superoxide dismutase (Fig. 4.5 and Table 4.1). Conversely, exosomes from HSP100 null mutants were found to be enriched in histone proteins which are considered to be exosomal markers (14).  111  It should be noted that while detected in the 2-D gel analysis, neither CPN60.3 nor TRAP1 was detected in the quantitative proteomic analysis (Fig. 4.5B and Table S4.1). This was likely due to the stringent inclusion requirement for MS identification. This required that there be quantifiable peptides found for each protein in all paired samples (HSP100 WT vs HSP100-/-) for an identification to be made. Furthermore, for reasons that are not clear, the relative abundance ratios for CPN60.2 were nonconcordant by 2-D gel vs quantitative MS. Despite these minor discrepancies, these parallel proteomic analyses were largely in agreement and confirmed that the presence or absence of HSP100 had a major impact on the specific protein composition of exosomes. Table 4.1: HSP100-/- exosomes have irregular cargo profiles. -/-  GeneDB Acession No. LmjF10.0870  Protein Identification histone h3  HSP100 / WT ratio 6.46  LmjF15.0010  histone h4  5.80  LmjF09.1340  histone h2b  4.26  LmjF16.1425  3.46  LmjF10.0460  paraflagellar rod protein 2C surface antigen-like protein GP63  LmjF35.2210  KMP11  0.59  LmjF14.1160  enolase  0.71  LmjF26.1240  HSP70.4  0.84  LmjF33.0312 LmjF17.0080  HSP83 (90) EF-1α  0.87 0.84  LmjF23.1220  CPN60/TCP1  0.88  LmjF04.0190  0.40 0.51  Functions in Leishmania and Leishmania infected cells DNA packaging, potential vaccine candidate DNA packaging, potential vaccine candidate DNA packaging, potential vaccine candidate Cytoskeletal support to flagellum Unknown Immune evasion, compliment deactivation, signal transduction interference Modulates cytokine responses, T cell antigen Glycolytic enzyme, plasminogen binding protein Molecular chaperone, candidate virulence factor Molecular chaperone Signal transduction interference, translation Molecular chaperone  References (57) (57) (57) (58) (58) (5;6;25;30)  (24;59) (60) (61;62) (62) (9) (62)  Further comparison of WT and HSP100-/- exosomes showed that these mutants do in fact have distinct phenotypes. As can be seen in Figure 4.6A-B, infection of human monocytes with either WT, HSP100-/- or LPG2-/- strains of leishmania, indicated that these were all three null with respect to 112  inducing either TNF-α or IL-10 production. On the other hand, WT exosomes induced modest production of TNF-α with no IL-10, but in both cases, these responses were markedly enhanced by exposure of cells to HSP100-/- exosomes. Thus, knock out of HSP100 appeared to impart a gain-offunction stimulatory phenotype to leishmania exosomes. On the other hand, removal of LPG2 from exosomes resulted in loss-of-function with respect to induction of TNF-α (Fig. 4.6). These results indicate that leishmania exosomes are capable of markedly influencing host cell cytokine production and their specific composition influences the phenotype of these responses.  In light of these findings, we examined the properties of HSP100-/- exosomes further using the allogeneic Th1 differentiation system described above in Figure 4.3. Monocyte-derived DCs were infected with promastigotes of L. donovani, either WT or HSP100-/-. In parallel, other MoDCs were incubated with exosomes isolated from these two strains. As shown in Figure 4.7, when mature MoDCs were used, under basal conditions, ≈ 22% of allo T cells were IFN-γ positive. This response was not significantly altered when the MoDCs had been infected with WT leishmania.  113  114  In contrast, compared with control MoDCs, the signal was boosted by nearly 100% when MoDCs had been infected with HSP100-/- organisms. Equally striking dichotomous phenotypes were observed when exosome-loaded, CD40L-differentiated DCs were used to drive T cell responses. As shown in Fig. 4.7A and B, the allo T cell response was not affected by loading MoDCs with WT exosomes, however, incubation of MoDCs with HSP100-/- vesicles brought about a near doubling of the frequency of IFN-γ producing T cells. This change in phenotype was specific to the HSP100-/-, as it was not seen with the LPG2-/- strain (data not shown). Furthermore, the altered functional properties of HSP100-/- exosome-treated DCs could not be explained by changes in the expression of maturation markers. Examination of surface expression of CD80, CD86 and HLA-DR on exosome-pulsed MoDCs before and after maturation showed no substantial effects of exosome treatment (Fig. 4.8).  115  Taken together, these findings clearly indicate that exosomes from HSP100-/- leishmania were able to significantly upregulate the accessory cell properties of mature DCs. In contrast, either the structural or biochemical properties or both of vesicles from WT leishmania prevented these effects from being seen.  4.4 Discussion 4.4.1 Leishmania produce exosomes with immunomodulatory properties. Leishmania are known to express a number of molecules with immunomodulatory properties. These diverse proteins and glycolipids have been shown to contribute to immune suppression (9;19;25), and in most instances organisms rendered null for these factors show reduced virulence (4;20). When this involves leishmania surface molecules, it is believed that these interact with receptors on either the plasma membrane, the phagolysosomal membrane or both of host cells (2629). While engagement of membrane receptors is able to explain some observations such as inactivation of complement and protection from antimicrobial peptides afforded respectively by cellsurface LPG and GP63 (5;19;25;30), it does not explain how certain soluble factors such as leishmania cathepsin B, EF-1α, and cell-free GP63 disrupt host cell signaling in the cytoplasm of infected cells (6;7;9). Accordingly, alternative models are required to explain the diverse immunomodulatory properties of leishmania secreted molecules. We demonstrated previously that leishmania not only release a wide variety of potentially immunomodulatory compounds (31), but also that the majority of these are secreted in exosomes (In press, J. Cell Sci.), including the candidate effectors mentioned above. Moreover, we have also shown that leishmania exosomes are secreted into host cells as a means of delivering effector proteins (In press, J. Cell Sci.). Here, we examined the functional properties of leishmania exosomes in detail and the results show that these vesicles were predominantly null or inhibitory with respect to regulating cytokine production by human monocytes (Fig. 4.1). A notable exception was IL-8, the production of  116  which was triggered by exosomes. While not “inhibitory” per se, the production of IL-8 may in fact favor pathogenesis, since recent evidence suggests that leishmania use neutrophils as “safe portals” or as Trojan horses to gain access to macrophages without activating host microbicidal properties (32-35). Likewise, our in vivo evidence indicates that leishmania exosomes acted to promote disease pathogenesis and this correlated with the promotion of Th2 polarization (Fig. 4.4). 4.4.2 Multiple signals, including exosomes combine to regulate cytokine production during leishmania infection. Our results show that leishmania exosomes predominantly inhibited pro-inflammatory cytokine production by human monocytes and MoDCs (Figs. 4.1 and 4.2). This was with the exception of IL-8 which was directly induced in monocytes by exosome treatment (Fig. 4.1). Other than IL-8, we found no evidence that these vesicles stimulated cytokine production directly which is consistent with previous reports concerning monocyte cytokine production in response to leishmania infection. Induction of TNF-α by leishmania in naïve monocytes has been shown to be species specific. L. infantum infection was reported to be null for TNF-α production while L. major infection induced TNFα, and the literature is contradictory with respect to L. donovani (36-39). Likewise, with respect to induction of IL-10, the null phenotype we observed (Fig. 4.1C) is consistent with reports indicating that leishmania infection per se does not stimulate monocyte IL-10 production (36;40). In fact, additional signals, such as Pam3Cys or LPS, were required to induce IL-10 production in leishmania infected human monocytes (36;40). We have proposed a model of leishmania infection (In press, J. Cell Sci.) in which leishmania exosomes, interact with and functionally prime naïve host cells for infection. These vesicles may be released from either recently inoculated promastigotes, by free amastigotes after cell rupture, or both. Based on this model, in the present study we pre-treated human monocytes with exosomes prior to direct infection with leishmania and this was followed 12 hours later by incubation with IFN-γ. Cell supernatants were then analyzed to determine if exosome pre-treatment affected the phenotype of 117  IFN-γ treated cells. Indeed, our findings are consistent with a model in which multiple signals, including exosomes, combine to regulate cytokine production in response to leishmania. Thus, while leishmania infection followed by IFN-γ boosted production of both TNF-α and IL-8 by human monocytes, pretreatment of monocytes with exosomes prior to infection and subsequent incubation with IFN-γ directly inhibited production of these cytokines (Fig. 4.1). Conversely, IL-10 production was enhanced under these conditions (Fig. 4.1). Given that IL-10 is recognized to be a potent anti-inflammatory cytokine involved in mediating immune suppression during leishmania infection (40-42), enhanced production of this cytokine as a result of exposure to exosomes suggests a potential role for these vesicles in pathogenesis. Previous work from this laboratory showed that leishmania infection attenuated IFN-γ-induced macrophage activation through disruption of the IFN-γR signal transduction pathway (9;43). In fact, we found exosomes to contain at least one of the leishmania proteins responsible for this effect - EF-1α (In press, J. Cell Sci.). The results in Figure 4.1D-F show that exposure of cells to exosomes prior to infection altered subsequent responses to IFN- with inhibition of IL-8 and TNF- production while conversely boosting that of IL-10. These findings add support to a model in which leishmania exosomes deliver virulence factors to host cells which disrupt host cell signaling pathways necessary to control infection. Further support for this model comes from our in vivo investigation of the immunomodulatory properties of leishmania exosomes, using a mouse model of L. major infection. Exposure of mice to exosomes prior to infection significantly exacerbated disease progression and this appeared to involve promotion of Th2 polarization (Fig. 4.4). These findings indicate that leishmania exosomes are capable of biasing the immune response to make it permissive for infection, perhaps through their generally inhibitory effects on monocytes as well as MoDCs.  118  In addition to TNF-α, IL-8 and IL-10, the influence of exosomes on IL-12 production was of considerable interest because of its critical role in resistance to leishmania infection. We were unable, however, to detect IL-12p70 in supernatants of human monocytes, even after LPS stimulation. This was not entirely surprising since the literature indicates that IL-12p70 production by monocytes is not a consistent finding (40;44;45). On the other hand, it is well known that DCs are principal sources of IL12p70 and our results clearly showed up to 50% inhibition of IL-12p70 production by MoDCs after leishmania exosome treatment (Fig. 4.2). In addition to inhibition of IL-12p70, we found exosome dosedependent inhibition of TNF-α, IL-10, and IL-6 from both immature and CD40L-matured MoDCs (Fig. 4.2). This general inhibition of both pro- and anti- inflammatory cytokines suggests that exosomes mediate some broadly inhibitory mechanism yet to be elucidated. Nevertheless, exosome-mediated inhibition of pro-inflammatory cytokine production by both MoDCs and leishmania infected, IFN-γ treated monocytes suggests that these vesicles are predominantly immunosuppressive. In light of the generally inhibitory properties observed for leishmania exosomes, it was of interest to examine their effects on the production of TGF-β, an inhibitory cytokine produced by suppressor macrophages (M2 or M2-like) and tolerogenic DCs known to promote leishmania pathogenesis (8). In response to treatment of MoDCs with exosomes, we saw no changes in the surface expression of latent activating peptide of TGF-β (data not show). This finding suggests that leishmania exosomes do not augment the amount of active TGF-β secreted from MoDCs. To address how leishmania exosomes may influence the development of acquired immune responses, we examined their influence on MoDC-dependent differentiation of naïve CD4 cells into T helper cell subpopulations. Both leishmania infected MoDCs and exosome-pulsed MoDCs showed little to no capacity to support the differentiation of naïve CD4 lymphocytes into interferon- producing Th1 cells (Fig. 4.3). These results suggested that either the exosomes were null with respect to promoting Th1 polarization via allo-DCs or possibly they were inhibitory. To address this question, we took  119  advantage of mutant strains of leishmania lacking either HSP100 or LPG2. The rationale for examining HSP100 null leishmania in this context was based on the knowledge that they release exosomes with distinctly altered protein cargo (Fig. 4.5). On the other hand, we elected to use LPG2-/- null leishmania because they are defective in expression of the major surface molecule LPG and would be expected to secrete exosomes lacking LPG. Though we did not examine directly the expression of LPG by WT exosomes, several lines of evidence suggest that this is likely: 1) we found that leishmania exosomes contain a large number of known leishmania surface proteins, both transmembrane and, like LPG, GPIlinked (In press, J. Cell Sci.), 2) we also found that leishmania exosomes contain LPG2 (In press, J. Cell Sci.), which is required for cell surface expression of LPG by L. donovani (21), and 3) leishmania exosomes appeared to be predominantly immunosuppressive, a known property of LPG (19;21). When MoDCs were pulsed with HSP100-/- exosomes, these cells induced a nearly 100% increase in the number of IFN-γ producing T cells (Fig. 4.7). In contrast, as seen before, WT exosomes generated a negligible signal in this assay (Fig. 4.7) as was the case for exosomes from LPG-deficient leishmania (data not shown). These results indicate that while WT exosomes per se were not seen to stimulate an allo-T cell response, this would appear to reflect their specific composition rather than an intrinsic inability to do so. In fact, quantitative mass spectrometry showed that exosomal protein packaging by HSP100 null leishmania was quite distinct from that of WT exosomes (Fig. 4.5, Table 4.1, and Table S4.1). Exosomes from HSP100-/- leishmania were enriched in histone proteins, paraflagellar rod proteins, proteasome subunits, chaperonins TCP20 and CPN60.2 and deficient in HSP70.4, HSP90, EF-1αGP63, kinetoplast membrane protein 11, and iron superoxide dismutase (Fig. 4.5 and Table 4.1). It is highly likely that this altered exosome composition accounted for the ability of the HSP100-/- exosomes to potentiate IFN-γ production by CD4 T cells in response to allo-DCs, in contrast to their wild type counterparts. The finding that L. donovani HSP100-/- exosomes promoted Th1 polarization through effects on DCs raised a myriad of interesting questions including the potential immunogenic properties of these vesicles.  120  4.4.3 WT vs HSP100-/- exosomes: modulation of signaling pathways. With respect to the role of exosomes in the biology of leishmania infection, two important questions emerged from these findings: 1) what are the mechanisms involved in exosome production, release and packaging, and 2) how do these vesicles bring about changes in monocytes and MoDCs. With respect to the first of these questions, traditional genetic techniques of investigation appeared not to be suitable to study mechanisms of leishmania vesicle trafficking. This is related to the fact that mutations to vesicle trafficking machinery in leishmania, and kinetoplastids in general, result in either a severe growth defect or lethality (44-46). In light of this we focused on the importance of exosomal packaging and our quantitative proteomics data suggests that leishmania HSP100 is likely involved in packaging of specific proteins (Fig. 4.5 ans Table 4.1). Additional study and improved approaches will required to identify other proteins involved in exosomal packaging and to fully elucidate the cellular mechanisms governing leishmania exosome production and release. To address how exosomes bring about changes in monocytes and MoDCs, we examined the potential roles of exosome surface molecules and exosome cargo, using vesicles harvested respectively from LPG2-/- and HSP100-/- L. donovani. As discussed above, the former are deficient in LPG surface expression (16) and the latter show evidence of altered exosome packaging (Fig. 4.5). Notably, in contrast to WT exosomes, HSP100-/- exosomes were markedly stimulatory for cytokine production (Fig. 4.6), whereas LPG2-/- vesicles behaved liked their WT counterparts. These findings suggest that the null phenotype of WT exosomes is a property specific to the protein composition of these vesicles, perhaps reflecting the presence of inhibitory cargo, the packaging of which is dependent upon HSP100. The potential contribution of HSP100 to virulence is also supported by our previous observation that HSP100-/- leishmania showed defective amastigote differentiation, were unable to survive and replicate within cultured macrophages and were avirulent in mice (15;21;47). It is clear that HSP100 mediates some essential function, without which a mature anti-leishmanial Th1 response effectively clears the infection. Based on our observations, we propose that the function of HSP100 involves at least the 121  regulation of protein packaging into exosomes, and that this cargo influences the behavior of the vesicles upon interaction with host cells. Another important question is how WT leishmania exosomes prime host cells for infection and inhibit cytokine production by infected and IFN-γ treated monocytes and MoDCs (Figs. 4.1 and 4.2). We postulate that this is the result of interference in host cell signaling pathways. Here again, this is likely mediated by specific cargo proteins, both novel and previously characterized, delivered to host cell cytoplasm by exosomes. For example, our findings suggest that exosomes are the likely mechanism by which GP63 is delivered to infected cells (In press, J. Cell Sci.), wherein it has been shown to interfere with p38-MAP kinase signaling (6). In this report, we have shown that GP63 packaging into HSP100-/exosomes was impaired (Fig. 4.5, Table 4.1). In addition, we have recently found that WT exosomes alone induced an activating phosphorylation of Akt, at serine473, in human monocytes and GM-CSF differentiated macrophages. In contrast, HSP100-/- exosomes did not induce Akt phosphorylation (data not shown). This finding is of significant interest since Akt, a signal transducer downstream of phosphoinositol-3 kinase, is a regulatory node for many immunosuppressive cellular immune responses including the production of IL-10 by macrophages (51). Differential effects on Akt may represent an important mechanistic disparity between WT and HSP100-/- vesicles and may account for their distinct phenotypes in influencing cytokine production. Ongoing work is focused on identifying the proteins, both host and leishmania, responsible for the immunomodulatory properties of leishmania exosomes. 4.4.4 Potential for vaccine development To date, there are no standardized leishmania vaccines that have passed regulatory review and been brought to the clinic. One of the main barriers to leishmania vaccine development has been the lack of safe Th1 adjuvants (52). Lipid adjuvants have been attracting attention and it was recently shown that encapsulating leishmania antigens in liposomes generated greater protective immunity against visceral leishmaniasis when compared to the use of soluble antigen only (53). Given that  122  leishmania exosomes are de facto liposomes encapsulating leishmania antigens, it was reasonable to predict that they might be immunogenic and induce protective immunity. Paradoxically, using WT exosomes, rather than inducing protection we observed that they caused disease exacerbation (Fig. 4.4) and this appeared to be linked to the promotion of Th2 polarization. However, the dichotomous phenotypes of WT and HSP100-/- exosomes, in particular the ability of the latter to promote Th1 differentiation (Fig. 4.7), suggest that there may be value in investigating the vaccine potential of the vesicles from HSP100 null leishmania.  4.5 Conclusion The findings of this study show that while exosomes from L. donovani were for the most part null with respect to inducing cytokine production in naïve human monocytes, under certain conditions modeling infection and the initiation of an immune response leishmania exosomes were observed to induce production of the immunosuppressive cytokine IL-10 while inhibiting pro-inflammatory cytokine production. Moreover, they were generally inhibitory with respect to cytokine responses by MoDCs. Likewise, WT vesicles were also ineffective at priming MoDCs to drive the differentiation of naïve CD4 cells into γ-interferon producing Th1 cells. Consistent with this generally immunosuppressive phenotype, L. major exosomes promoted Th2 cell polarization in vivo and caused exacerbation of leishmania infection. Of special interest was the finding that in comparison to WT exosomes, vesicles from HSP100 null L. donovani showed a dichotomous phenotype that was largely proinflammatory with the ability to drive naïve CD4 lymphocytes to differentiate into Th1 cells. This suggests that the properties of these vesicles are influenced by the specificities of cargo packaging in an HSP100dependent manner and that exosomes from HSP100 null leishmania may be attractive candidates for vaccine development.  123  4.6 Methods 4.6.1 Reagents Except where otherwise noted, reagents were obtained from the Sigma-Aldrich Inc. PBS and RPMI1640 were purchased from StemCell Technologies (Vancouver, Canada). FBS (GIBCO) was purchased from Invitrogen. All ultracentrifugation hardware including tubes, rotors and centrifuges were purchased from Beckman Coulter. 4.6.2 Cell culture Generation of leishmania HSP100 and LPG2 null mutants was previously described (16;21). L. donovani Bob and BobLPG2-/- were a gift from Dr. Stephen Beverley. All leishmania parasites (L. donovani Sudan S2, 1SR, 1SR HSP100-/0, Bob, BobLPG2-/-, and L. major Fredlin (MHOM/IL/80/Friedlin)) were cultured in Medium 199 + 10% FBS as previously reported (29). 4.6.3 Cell purification and differentiation Peripheral blood was obtained from healthy volunteers following approval by the University of British Columbia Clinical Research Ethics Board and after obtaining written informed consent. PBMCs were isolated by Ficoll separation. CD14(+) monocytes were isolated either by adherence for 1h followed by washing or by positive or negative selection (StemCell Technologies). Naïve CD4+ T cells were purified by negative selection (StemCell Technologies). Immature DCs were generated by culturing monocytes for 5 days in RPMI 1640 supplemented with 10% FBS, 10 mM HEPES, 2 mM glutamine, 1 mM sodium pyruvate (StemCell Technologies), 1 mM MEM nonessential amino acid solution (StemCell Technologies), 50 mM β-mercaptoethanol (Bio-Rad) and 100 U/ml each of penicillin G and streptomycin with 50ng/mL recombinant human GM-CSF (StemCell Technologies) and IL-4. DC medium plus cytokines was replenished every 2 days. The immature DCs demonstrated a high expression level of CD11c, medium expression level of HLA-DR and CD80, low expression level of CD86, and negative for CD83 (data not shown).  124  4.6.4 Isolation of leishmania exosomes Endotoxin free exosomes were harvested exactly as previously (In press, J. Cell Sci.). Briefly, cells were washed and resuspended in RPMI-1640 supplemented with 10 mM HEPES, 2-4 µM MES (to bring the pH down slowly to 5.5), 2 mM L-glutamine, 0.2% D-Glucose, and 100 U/ml each of penicillin G and streptomycin Exosomes were collected for 24 h and then isolated using all culture grade solutions. After removal of cells by low speed centrifugation and debris by filtration through a 0.2 µm Stericup vacuum filter unit (Milipore), vesicles were concentrated using 100,000 kDa MWCO VivaCell 100 filtration devices (Sartorius AG) from 400 mL to 0.5-0.2 mL. This was layered on top of a 1M sucrose cushion (In press, J. Cell Sci.) after the following efforts to remove endotoxin. The 1M sucrose was filtered through Mustange E endotoxin removal filters (Pall Corporation). Beckman Ultraclear 5 mL tubes were incubated with 30% H2O2 for 4 h to remove endotoxin, followed by extensive washing with water. 2 mL PBS was underlayed with 0.75 mL 1M sucrose and concentrated samples were then overlayed. After ultracentrifugation, the exosome fractions were collected from the top. After resuspension in 15 mL PBS, sucrose was removed by concentration to ≈ 200 µl with 100,000 kDa MWCO Vivaspin 20 filtration devices (Sartorius AG). 20 µl of 1M sucrose was added to exosomes prior to storage at -80°C. 4.6.5 Exosome treatments and DC maturation Endotoxin-free exosomes collected from leishmania at 37°C+pH5.5 were incubated with monocytes (100,000 cell/well) in 96 well plates. In parallel, cells were treated with1 µg/mL E.coli 0111:B4 LPS, 1 ng/mL recombinant human IFN-γ (BioSource International) and L. donovani at a moi of 10:1 as positive controls. For some experiments, after 2-12 h of exosome treatment, 2 ng/mL rhIFN-γ was added to the wells for 24 h. Cell-free supernatants were collected at indicated times and stored at -80°C. After 5 days of differentiation, DCs were collected and plated (100,000-200,000 cells/well) in 96 well plates and treated with exosomes. After 12-15 h DCs were matured by transfer onto wells containing irradiated CD40L expressing fibroblasts at a ratio of 1:4 and incubated for 24 h (T cell co125  culture) or 48 h. The mature DCs showed a high expression level of CD11c, HLA-DR, CD80 and CD86, and moderate expression level of CD83 (data not shown). After 48 h, supernatants were collected and stored at -80°C and cells were processed for flow cytometric analysis. 24 hours after DC maturation, immature and mature DC cell free supernatants were removed, leaving DCs behind, and cells were resuspended in fresh medium containing naïve CD4(+) T cells at a DC/T cell ratio of 1:5. After 5 days, supernatants were collected and stored at -80°C and cells were processed for flow cytometric analysis. 4.6.6 Animals and exosome vaccination Balb/c mice were purchased from and housed in the University of British Columbia Animal Care Facility at Jack Bell Research Center following animal welfare guidelines. 4 week old mice received subcutaneous injections of 50 µL of PBS containing 15 µg of L. major exosomes or not. After 2 weeks the mice received another injection of exosomes or not. After an additional 3 weeks, mice were challenged subcutaneously with L. major. Lesion size, length and width, were recorded weekly. After 5 weeks mice were euthanized and the spleen, draining lymph nodes and lesional tissues were harvested. After homogenization, some cells were lysed and mRNA was collected using the total RNA isolation kit (Promega) following the manufacturer's recommendations. Remaining cells were processed for flow cytometric analysis. 4.6.7 Flow cytometric analysis After exosome treatment and 48 h of maturation or not, DCs were stained for cell surface markers CD11c (BD Pharmingen), HLA-DR (BD Pharmingen), CD80 (BD Pharmingen), CD86 (BD Pharmingen), and/or LAP (BD Pharmingen). Samples were acquired on a BD FACSCanto and analyzed with FCS Express Pro Software Version 3 (De Novo Software, Thornhill, Canada). For analysis of intracellular cytokine production, both human and mouse T cells were activated with 10 ng/mL PMA and 500 ng/mL Ca2+ ionophore for 6h. Brefeldin A (10µg/mL, Sigma-Aldrich) was added half-way through activation. Staining for cell-surface markers CD4 (eBiosciences), CD11c (BD  126  Pharmingen), and CD25 (BD Pharmingen), was carried out prior to intracellular staining. Following surface staining, cells were fixed in 2% formaldehyde and permeabilized with 0.5% saponin. For analysis of Foxp3 expression, cells were resuspended in ice cold 2x Foxp3 specific Fix/Perm buffer (eBiosciences). Intracellular cytokine staining was performed with antibodies against IFN-γ (BD Pharmingen), IL-2 (BD Pharmingen), IL-4 (BD Pharmingen), IL-10 (BD Pharmingen), Foxp3 (eBiosciences), and/or IL-17 (eBiosciences or R&D Systems). Samples were acquired and analyzed as stated above. 4.6.8 Determination of cytokine concentration ELISA was used to determine the concentrations of TNF-α (eBiosciences), IL-6 (BD Pharmingen), IL12p70 (eBiosciences), IL-10 (BD Pharmingen), IFN-γ (eBiosciences), IL-4 (eBiosciences), and/or IL-8 (BD Pharmingen) in supernatants of monocytes, DCs, and DC-T cell co-cultures, following the manufactures instructions. 4.6.9 2-D gel electrophoresis and MALDI-TOF mass spectrometry Leishmania, ≈ 1x109, were sedimented (10 min, 690xg, 4°C) and washed twice with PBS (137 mM NaCl, 8 mM Na2HPO4, 2.7 mM KCl, 1.5 mM KH2PO4, pH 7.0 or 5.5). Following resuspension in 50 μl of 40 mM Tris pH 9.5 supplemented with protease inhibitors (1 mM EDTA, 1 mM 1,10 phenanthroline, 0.01 mM E-64), cells were subjected to five freeze-thaw cycles using solid CO2/ethanol. The lysate was then subjected to clearance by centrifugation (30 min, 20,000xg, 4°C). The supernatant was transferred to ultracentrifuge tubes and subjected to precipitation at >200,000xg (55,000 rpm, 60 min, 4°C, Beckman Optima TL-100, TLS-55 rotor). The sediment was resuspended in 50 μl PBS and 150 μl rehydration buffer (8 M urea, 2 M thiourea, 4% CHAPS, 2.4% aminosulfobetaine-14) was added. 2Dprotein electrophoresis was performed essentially as described (51). Spots were identified in three independent sets of 2-D gels as overrepresented in the pellet of WT L. donovani versus HSP100-/- mutants. The proteins in the gel plugs were destained, digested with trypsin (Promega), extracted, purified on a C18 reverse phase matrix, and eluted in 8 μl of 60%  127  acetonitrile, 0.1% trifluor-acetic acid (51). 2.5 μl of the eluted peptides were spotted onto a 378-well, 400 μm Anchor Plate (Bruker Daltonics, Bremen). When the solvent was almost evaporated, 1 μl of matrix solution (saturated alpha-cyano-4-hydroxy-cinnamic acid solution in 50 % acetonitrile, 0.1 % trifluor acetic acid) was added. The plate was air dried. Matrix-assisted laser desorption/ionisation Time-Of-Flight mass spectrometry (MALDI-TOF-MS) was performed on a Bruker Autoflex Mass Spectrometer (Bruker Daltonics). Measurements were performed in the reflection mode using the following settings: Ion source 1 voltage: 19 kV; ion source 2 voltage: 16.5 kV; reflector voltage 20 kV; lens voltage 8 kV; 40 ns pulse time, 120 ns pulse extraction time, matrix suppression < 500 Da. Spectra were analyzed using the XTOF analysis software package, version 5.1.5 (Bruker Daltonics). The mass spectra were calibrated internally, using a mix of four peptides (Sigma). Monoisotopic masses generated by MALDI-TOF-MS were searched against peptide masses of eukaryotes in the Matrix Science Data Base 20060831 using the MASCOT program (www.matrixscience.com). One missed cleavage per peptide and a mass tolerance of 80 ppm were allowed. Carbamidomethylation of cysteine residues was set as a fixed modification. 4.6.10 Quantitative mass spectrometry Quantitative tandem mass spectrometry of WT vs. HSP100-/- exosomes was conducted exactly as described previously (In press, J. Cell Sci.). Briefly tryptic peptide digests were desalted and concentrated as described previously (52) and reductive dimethylation using formaldehyde isotopologues was performed to differentially label peptides from different growth conditions Peptides from WT exosomes were labeled with light formaldehyde (CH2O) while peptides from HSP100-/- were labeled with heavy formaldehyde (CD2O). The labeling reactions were performed as described (53) and combined peptide samples were analyzed by liquid chromatography-tandem mass spectrometry (LCMS/MS) with a linear trapping quadrupole-Orbitrap (LTQ-OrbitrapXL, ThermoFisher Scientific) (52).  128  4.6.11 LC-MS/MS data analysis Fragment spectra were searched against the Leishmania major (May 2006 compilation, 17392 sequences) protein database using Mascot (v2.2, Matrix Science) with the following parameters; trypsin specificity allowing up to one missed cleavage, cysteine carbamidomethylation as a fixed modification and heavy and light dimethylated lysine side chains and peptide amino termini as variable modifications, ESI-trap fragmentation characteristics, 10-ppm mass tolerance for precursor ion masses, 0.8 Da tolerance for fragment ion masses. As we have published previously (29), proteins were considered identified when at least two unique peptides of eight or more amino acids and with Mascot IonsScores > 25 resulting in an estimated false discovery rate of less than 0.5% based on reversed database searching. All peptide and protein identification information acquired in this study can be found in Tables S4.1 and S4.2. 4.6.12 mRNA detection by RT-PCR mRNA detection for the cytokines IL-10, and IL-12(p40), as well as a housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), were performed using a semiquantitative RTPCR method previously described (23), with minor modifications. Briefly, 100 ng of RNA was treated with DNAse (Fermentas) for 30 min and the DNAse was subsequently inactivated for 10 min at 65°C. First strand DNA was synthesised using SuperScript™ II Reverse Transcriptase (Invitrogen). Gene amplification was conducted in a semiquantitative PCR with GoTaq® Green Master Mix (Promega). Samples were incubated for 3 min at 94°C and were then amplified with an experimentally determined annealing/polymerizing cycle (94°C for 0.5 min, 60°C for 0.5 min, and 72°C for 0.75 min). 32 cycles were used for IL-10, IL-12p40 and GAPDH. PCR products were separated in a 2% agarose gel and images were obtained with a GelDoc Scanning System. The signals were analyzed using Un-Scan-it software (Silk Scientific Corp.). The primers and probes used for amplification and detection were as follows: IL-10 Forward 5' AGAAGCATGGCCCAGAAATCA 3' Reverse 5' GGCCTTGTAGACACCTTGGT 3' 129  IL-12 Forward 5' TGGTTTGCCATCGTTTTGCTG 3' Reverse 5' ACAGGTGAGGTTCACTGTTTCT 3' GAPDH Forward 5' TGACCACAGTCCATGCCATC 3' Reverse 5' GACGGACACATTGGGGGTAG 3' 4.6.13 Statistical analysis Data was analyzed with Graph Pad Prizm Version 4. Either unpaired Students t-test or one way Anova was used to determine statistically significant differences. p-Values of less than 0.05 were considered significant. All error bars represent standard errors.  130  4.7 Additional data files Two supplemental tables are available along with this manuscript at http://www.id.med.ubc.ca/Faculty/Faculty_Reiner/Lab_Reiner.htm. Table S4.1: The effect of a HSP100 null mutation on the proteome of leishmania exosomes. 341 proteins had at least two non-overlapping peptides that were detected and quantified in one or more individual analyses of leishmania exosomal proteins. The number of LC-MS/MS analyses in which each protein was detected is given in (No. of experiments observed in). After determining which proteins were to be considered for analysis as described in Methods, the means of the measured HSP100-/-/WT ratios for each protein identity were calculated (Overall Mean HSP100-/-/WT ratio). The standard deviations (SD) of the peptide ratios across the analyses are included. Table S4.2: Leishmania exosome peptide quantitation. A table listing all the peptides contributing to the identification of the proteins detected in leishmania exosomes and their corresponding properties used to calculate relative abundance ratios including mass charge ratio (MCR), charge, score, left and right flanking amino acid (AA) and relative mass error.  131  4.8 Bibliography (1) Chappuis F, Sundar S, Hailu A, et al. Visceral leishmaniasis: what are the needs for diagnosis, treatment and control? Nat Rev Microbiol 2007 Nov;5(11):873-82. (2) Gramiccia M, Gradoni L. The current status of zoonotic leishmaniases and approaches to disease control. International Journal for Parasitology 2005 Oct;35(11-12):1169-80. (3) Wilson ME, Jeronimo SM, Pearson RD. Immunopathogenesis of infection with the visceralizing Leishmania species. Microb Pathog 2005 Apr;38(4):147-60. (4) Joshi PB, Kelly BL, Kamhawi S, Sacks DL, McMaster WR. Targeted gene deletion in Leishmania major identifies leishmanolysin (GP63) as a virulence factor. Mol Biochem Parasitol 2002 Mar;120(1):33-40. (5) Brittingham A, Morrison CJ, McMaster WR, McGwire BS, Chang KP, Mosser DM. Role of the Leishmania surface protease gp63 in complement fixation, cell adhesion, and resistance to complement-mediated lysis. J Immunol 1995 Sep 15;155(6):3102-11. (6) Halle M, Gomez MA, Stuible M, et al. The Leishmania surface protease GP63 cleaves multiple intracellular proteins and actively participates in p38 mitogen-activated protein kinase inactivation. J Biol Chem 2009 Mar 13;284(11):6893-908. (7) Somanna A, Mundodi V, Gedamu L. Functional analysis of cathepsin B-like cysteine proteases from Leishmania donovani complex. Evidence for the activation of latent transforming growth factor beta. J Biol Chem 2002 Jul 12;277(28):25305-12. (8) Gantt KR, Schultz-Cherry S, Rodriguez N, et al. Activation of TGF-beta by Leishmania chagasi: importance for parasite survival in macrophages. J Immunol 2003 Mar 1;170(5):2613-20. (9) Nandan D, Yi T, Lopez M, Lai C, Reiner NE. Leishmania EF-1alpha activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem 2002 Dec 20;277(51):50190-7. (10) Awasthi A, Mathur RK, Saha B. Immune response to Leishmania infection. Indian J Med Res 2004 Jun;119(6):238-58. (11) Dogra N, Warburton C, McMaster WR. Leishmania major Abrogates Gamma InterferonInduced Gene Expression in Human Macrophages from a Global Perspective. Infection and Immunity 2007 Jul 1;75(7):3506-15. (12) Reiner NE. Targeting cell regulation promotes pathogen survival in macrophages. Clin Immunol 2005 Mar;114(3):213-5. (13) Thery C, Ostrowski M, Segura E. Membrane vesicles as conveyors of immune responses. Nat Rev Immunol 2009 Aug;9(8):581-93. (14) Simpson RJ, Jensen SS, Lim JW. Proteomic profiling of exosomes: current perspectives. Proteomics 2008 Oct;8(19):4083-99.  132  (15) Leon B, Lopez-Bravo M, Ardavin C. Monocyte-derived dendritic cells formed at the infection site control the induction of protective T helper 1 responses against Leishmania. Immunity 2007 Apr;26(4):519-31. (16) Krobitsch S, Brandau S, Hoyer C, Schmetz C, Hubel A, Clos J. Leishmania donovani heat shock protein 100. Characterization and function in amastigote stage differentiation. J Biol Chem 1998 Mar 13;273(11):6488-94. (17) Ma D, Russell DG, Beverley SM, Turco SJ. Golgi GDP-mannose uptake requires Leishmania LPG2. A member of a eukaryotic family of putative nucleotide-sugar transporters. J Biol Chem 1997 Feb 7;272(6):3799-805. (18) Goyard S, Segawa H, Gordon J, et al. An in vitro system for developmental and genetic studies of Leishmania donovani phosphoglycans. Mol Biochem Parasitol 2003 Aug 11;130(1):31-42. (19) Spath GF, Garraway LA, Turco SJ, Beverley SM. The role(s) of lipophosphoglycan (LPG) in the establishment of Leishmania major infections in mammalian hosts. Proc Natl Acad Sci U S A 2003 Aug 5;100(16):9536-41. (20) Descoteaux A, Avila HA, Zhang K, Turco SJ, Beverley SM. Leishmania LPG3 encodes a GRP94 homolog required for phosphoglycan synthesis implicated in parasite virulence but not viability. EMBO J 2002 Sep 2;21(17):4458-69. (21) Gaur U, Showalter M, Hickerson S, et al. Leishmania donovani lacking the Golgi GDP-Man transporter LPG2 exhibit attenuated virulence in mammalian hosts. Exp Parasitol 2009 Jul;122(3):182-91. (22) Krobitsch S, Clos J. A novel role for 100 kD heat shock proteins in the parasite Leishmania donovani. Cell Stress Chaperones 1999 Sep;4(3):191-8. (23) Yao C, Donelson JE, Wilson ME. The major surface protease (MSP or GP63) of Leishmania sp. Biosynthesis, regulation of expression, and function. Mol Biochem Parasitol 2003;132:1-16. (24) Carvalho LP, Passos S, Dutra WO, et al. Effect of LACK and KMP11 on IFN-gamma Production by Peripheral Blood Mononuclear Cells from Cutaneous and Mucosal Leishmaniasis Patients. Scandinavian Journal of Immunology 2005;61(4):337-42. (25) Lieke T, Nylen S, Eidsmo L, et al. Leishmania surface protein gp63 binds directly to human natural killer cells and inhibits proliferation. Clin Exp Immunol 2008 Aug;153(2):221-30. (26) Flandin JF, Chano F, Descoteaux A. RNA interference reveals a role for TLR2 and TLR3 in the recognition of Leishmania donovani promastigotes by interferon-gamma-primed macrophages. Eur J Immunol 2006 Feb;36(2):411-20. (27) Kropf P, Freudenberg MA, Modolell M, et al. Toll-like receptor 4 contributes to efficient control of infection with the protozoan parasite Leishmania major. Infect Immun 2004 Apr;72(4):1920-8. (28) Kedzierski L. A leucine-rich repeat motif of Leishmania parasite surface antigen 2 binds to macrophages through the complement receptor 3. J Immunol 2004;172:4902-6. 133  (29) de Veer MJ, Curtis JM, Baldwin TM, et al. MyD88 is essential for clearance of Leishmania major: possible role for lipophosphoglycan and Toll-like receptor 2 signaling. Eur J Immunol 2003 Oct;33(10):2822-31. (30) Kulkarni MM, McMaster WR, Kamysz E, Kamysz W, Engman DM, McGwire BS. The major surface-metalloprotease of the parasitic protozoan, Leishmania, protects against antimicrobial peptide-induced apoptotic killing. Mol Microbiol 2006 Dec;62(5):1484-97. (31) Silverman JM, Chan SK, Robinson DP, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol 2008;9(2):R35. (32) Peters NC, Sacks DL. The impact of vector-mediated neutrophil recruitment on cutaneous leishmaniasis. Cell Microbiol 2009 Sep;11(9):1290-6. (33) Peters NC, Egen JG, Secundino N, et al. In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science 2008 Aug 15;321(5891):970-4. (34) van Zandbergen G., Klinger M, Mueller A, et al. Cutting edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages. J Immunol 2004 Dec 1;173(11):6521-5. (35) Aga E, Katschinski DM, van ZG, et al. Inhibition of the spontaneous apoptosis of neutrophil granulocytes by the intracellular parasite Leishmania major. J Immunol 2002 Jul 15;169(2):898-905. (36) Meddeb-Garnaoui A, Zrelli H, Dellagi K. Effects of tropism and virulence of Leishmania parasites on cytokine production by infected human monocytes. Clin Exp Immunol 2009 Feb;155(2):199-206. (37) Arena A, Capozza AB, Delfino D, Iannello D. Production of TNF alpha and interleukin 6 by differentiated U937 cells infected with Leishmania major. New Microbiol 1997 Jul;20(3):23340. (38) Arena A, Capozza AB, Marino F, Zummo S, Iannello D, Mastroeni P. Granulocyte-macrophage colony stimulating factor modulates the production of TNF alpha by differentiated U937 cells infected with Leishmania major. New Microbiol 1999 Jan;22(1):31-9. (39) Reiner NE, Ng W, Wilson CB, McMaster WR, Burchett SK. Modulation of in vitro monocyte cytokine responses to Leishmania donovani. Interferon-gamma prevents parasite-induced inhibition of interleukin 1 production and primes monocytes to respond to Leishmania by producing both tumor necrosis factor-alpha and interleukin 1. J Clin Invest 1990 Jun;85(6):1914-24. (40) Chandra D, Naik S. Leishmania donovani infection down-regulates TLR2-stimulated IL-12p40 and activates IL-10 in cells of macrophage/monocytic lineage by modulating MAPK pathways through a contact-dependent mechanism. Clin Exp Immunol 2008 Nov;154(2):224-34. (41) Anderson CF, Stumhofer JS, Hunter CA, Sacks D. IL-27 regulates IL-10 and IL-17 from CD4+ cells in nonhealing Leishmania major infection. J Immunol 2009 Oct 1;183(7):4619-27.  134  (42) Murray HW, Lu CM, Mauze S, et al. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infect Immun 2002 Nov;70(11):6284-93. (43) Nandan D, Reiner NE. Leishmania donovani engages in regulatory interference by targeting macrophage protein tyrosine phosphatase SHP-1. Clin Immunol 2005 Mar;114(3):266-77. (44) Bhaumik S, Basu R, Sen S, Naskar K, Roy S. KMP-11 DNA immunization significantly protects against L. donovani infection but requires exogenous IL-12 as an adjuvant for comparable protection against L. major. Vaccine 2009 Feb 25;27(9):1306-16. (45) Konecny P, Stagg AJ, Jebbari H, English N, Davidson RN, Knight SC. Murine dendritic cells internalize Leishmania major promastigotes, produce IL-12 p40 and stimulate primary T cell proliferation in vitro. Eur J Immunol 1999 Jun;29(6):1803-11. (46) Besteiro S, Williams RA, Morrison LS, Coombs GH, Mottram JC. Endosome sorting and autophagy are essential for differentiation and virulence of Leishmania major. !Lost Data 2006 Apr 21;281(16):11384-96. (47) Clayton C, Hausler T, Blattner J. Protein trafficking in kinetoplastid protozoa. Microbiol Rev 1995 Sep 1;59(3):325-44. (48) McConville MJ, Mullin KA, Ilgoutz SC, Teasdale RD. Secretory pathway of trypanosomatid parasites. Microbiol Mol Biol Rev 2002 Mar;66(1):122-54. (49) Hubel A, Krobitsch S, Horauf A, Clos J. Leishmania major Hsp100 is required chiefly in the mammalian stage of the parasite. Mol Cell Biol 1997 Oct;17(10):5987-95. (50) Reiling L, Jacobs T, Kroemer M, Gaworski I, Graefe S, Clos J. Spontaneous recovery of pathogenicity by Leishmania major hsp100-/- alters the immune response in mice. Infect Immun 2006 Nov;74(11):6027-36. (51) Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell 2007 Jun 29;129(7):1261-74. (52) Coler RN, Reed SG. Second-generation vaccines against leishmaniasis. Trends in Parasitology 2005 May;21(5):244-9. (53) Bhowmick S, Ravindran R, Ali N. Leishmanial antigens in liposomes promote protective immunity and provide immunotherapy against visceral leishmaniasis via polarized Th1 response. Vaccine 2007 Aug 29;25(35):6544-56. (54) Bente M, Harder S, Wiesgigl M, et al. Developmentally induced changes of the proteome in the protozoan parasite Leishmania donovani. Proteomics 2003 Sep;3(9):1811-29. (55) Chan QWT, Howes CG, Foster LJ. Quantitative Comparison of Caste Differences in Honeybee Hemolymph. Mol Cell Proteomics 2006 Dec 1;5(12):2252-62. (56) Chan QW, Foster LJ. Changes in protein expression during honey bee larval development. Genome Biol 2008 Oct 29;9(10):R156. 135  (57) Iborra S, Soto M, Carrin J, Alonso C, Requena JM. Vaccination with a plasmid DNA cocktail encoding the nucleosomal histones of Leishmania confers protection against murine cutaneous leishmaniosis. Vaccine 2004 Sep 28;22(29-30):3865-76. (58) The Leishmania major Genome Database. website 2007Available from: URL: http://www.genedb.org/genedb/leish/ (59) Basu R, Roy S, Walden P. HLA class I-restricted T cell epitopes of the kinetoplastid membrane protein-11 presented by Leishmania donovani-infected human macrophages. J Infect Dis 2007 May 1;195(9):1373-80. (60) Vanegas G, Quinones W, Carrasco-Lopez C, Concepcion JL, Albericio F, Avilan L. Enolase as a plasminogen binding protein in Leishmania mexicana. Parasitol Res 2007 Nov;101(6):1511-6. (61) Rey-Ladino JA, Reiner NE. Expression of 65- and 67-kilodalton heat-regulated proteins and a 70-kilodalton heat shock cognate protein of Leishmania donovani in macrophages. Infect Immun 1993 Aug;61(8):3265-72. (62) Brandau S, Dresel A, Clos J. High constitutive levels of heat-shock proteins in humanpathogenic parasites of the genus Leishmania. Biochem J 1995 Aug 15;310 ( Pt 1):225-32.  136  5. Discussion 5.1 Significance for the field The original goal of my research was to address mechanisms of protein secretion by leishmania with the expectation that this would lead to an improved general understanding of leishmania pathogenesis. The findings presented in Chapters 2-4 show that progress was made towards this goal and they expand current knowledge of leishmania biology. First, while previously fewer than 10 leishmania secreted proteins had been identified and characterized, in the course of this research I have shown that leishmania secrete at least 300 proteins and that certain proteins are secreted to a greater extent than others [Fig 2.2 and Additional Data Files 1-2 (1)]. Second, the mechanism by which leishmania secrete/release proteins had been purely hypothetical for decades, but my research has now clearly shown that leishmania utilize exosome-based secretion, and that these vesicles act as a pathogen to host delivery system (Figs. 3.5 and 3.6, in press J. Cell Sci.). One of the more pressing unanswered questions in the study of eukaryotic pathogens, such as Plasmodium spp., Toxoplasma spp., Trypanosoma spp., Leishmania spp. etc, has been how these organisms introduce virulence factors into host cells. The findings presented in this thesis (Chapters 3 and 4) are the first description of a generalized protein secretion mechanism used by a eukaryotic pathogen to deliver multiple virulence factors at once to host cells. I have shown that leishmania exosomes contain all of the previously identified and characterized leishmania secreted proteins, notably including those known to have major immune modulating effects on host cells (Table 3.1). Consistent with this, my results show that leishmania exosomes have generally immunosuppressive properties both in vitro and in vivo (Figs. 4.1, 4.2, 4.4, 4.6 and 4.7, manuscript submitted for publication). Moreover, my results show –perhaps not surprisingly- that exosomal packaging was critical to these properties since they were abrogated when packaging was altered based upon deletion of both alleles for HSP100 (Fig. 4.6 and 4.7). In contrast to their WT counterparts, exosomes from HSP100-/- leishmania were strongly pro-  137  inflammatory. This implies that the phenotypic effects of these vesicles are determined by their specific cargo. The results presented in Chapters 2-4 should help advance progress of leishmania pathogenesis research. For example, clear differences in promastigote vs amastigote exosomal protein expression were shown as specific proteins were enriched within exosomes harvested under conditions mimicking the early stages of infection (Table S3.1, in press J. Cell Sci.). Previous work had certainly found differences in the biology of amastigotes and promastigotes (2-8), however, there was no obvious way to relate these differences to stage-specific profiles of protein expression. In fact, genomic expression profiling comparing promastigotes and amastigotes had revealed gene expression differences of less than 5% (9;10). This had left the field with little to move forward on as far as examining specific immune modulation by amastigotes. In contrast, the work presented here highlights at least 100 proteins that are secreted to a greater extent by leishmania under environmental conditions which mimic those experienced by amastigotes (Table 3.1 and Table S3.1). Furthermore, in contrast to previous studies of the phenotypic effects of amastigote specific proteins, my findings identify an exosome-based secretion mechanism by which these proteins might gain access to the cytoplasm of infected host cells (Figs. 3.5 and 3.6). This has been a key question in the cell biology of leishmania-host cell interactions. My results also now demonstrate that exosomes released by leishmania under amastigote-like conditions have anti-inflammatory and pro-parasitic properties both in vivo and in vitro (Figs. 4.1, 4.4, 4.7). Thus, the work presented in this thesis provides additional support to the well established theory that differences in amastigote and promastigote biology and protein expression correlate with differences in host-pathogen interactions. In addition to identifying amastigote-specific proteins with immune modulating potential for future investigation, my findings show that leishmania exosomes are capable of immune modulation. Cargo packaged within exosomes appeared to have multiple immunosuppressive effects. WT exosome were  138  shown (Fig. 4.1) to: 1) enhance IL-10 production in monocytes while inhibiting TNF-α production in response to IFN-γ stimulation, 2) inhibit IL-12p70 production by both immature and mature DCs (Fig. 4.2), and 3) have a null phenotype with respect to promoting the differentiation of IFN-γ-producing CD4 T cells in an allogeneic system, unlike treatment with differentially packaged (HSP100-/-) exosomes which greatly enhanced the allo-response (Figs. 4.3 and 4.7). Taken together, these results suggest that through interaction with exosomes, leishmania may be capable of inducing suppressor cell phenotypes in uninfected, bystander cells. In a similar vein, it is now well established that IL-10 plays a critical role in parasite-mediated suppression of a variety of host effector cells including: activated M1 macrophages, cytotoxic CD8 T cells and anti-leishmania Th1 cells. Not long ago it was believed that infected macrophages were the main source of IL-10 in leishmania infections, however, this turned out to not be the whole story. As discussed in Chapter 1, antigen specific CD4(+)CD25(-)Foxp3(-) Th1 cells (distinct from naturally occurring or induced “T regs”) are now considered the major source of IL-10 in both mouse and human models of non-healing leishmania infection (17;18), and these cells are often producing IFN-γ as well. Recently, IL-10 production by these Th1 cells during L. major infection in C57Bl/6 mice was show to be regulated by the IL-12-like cytokine, IL-27, which is produced by macrophages and dendritic cells, and appears to be involved in blocking inappropriate Th17 cell development (19). To date, the mechanisms responsible for leishmania-driven IL-10 induction remain unknown. Although I did not find that treatment of DCs with leishmania exosomes affected IL-10 production by allo-reactive IFN-γ-producing CD4 T cells (data not shown), I did find that monocytes incubated with exosomes became primed for enhanced production of IL-10 during subsequent infection and interferon- treatment (Fig. 4.1) The results reported in this thesis describing exosome secretion provide for a simple and elegant mechanism to explain how leishmania effectors may gain access to host cells. Thus, exosome-mediated delivery of putative effectors to host cells, both naïve and infected, may be involved in re-programming  139  cytokine production by a variety of immune cell types to promote chronic infection. My finding that exosomes primed monocytes for IL-10 production in vitro (Fig. 4.1F) partially speaks to this. Logically, it also leads to the question of whether leishmania exosomes and their cargo are involved in driving either IL-10 production or the differentiation of suppressor cell phenotypes or both in vivo during infection. Germaine to this, I found differences in the protein cargo between exosomes released under conditions mimicking the phagolysosomal lumen (37°C+pH5.5) and exosomes harvested under early infection-like conditions (37°C+pH7.5) (Table 3.1) as well as differences in protein cargo between WT and HSP100-/- exosomes (Fig. 4.5). Based upon these differences it is possible to propose numerous candidate proteins that may be involved in mediating immune-modulation during infection. For example, the potent immunosuppressive protein HSP10 was highly enriched in exosomes harvested under conditions mimicking the phagolysosome (Table 3.1). Likewise, HSP70, HSP90 as well as leishmanolysin GP63, all known to posses immune-modulatory properties (Table 2.3, Table 3.1, Table 4.1) were more abundantly expressed in WT exosomes, which were predominantly immunosuppressive, when compared to HSP100-/- exosomes (Fig. 4.5 and Table 4.1), which were proinflammatory (Figs. 4.6-4.7). These differing exosome phenotypes provide a platform from which to launch a comprehensive investigation of the role of exosomes in IL-10 production in vivo. For example, using mouse models, the influence of exosomes on IL-10 production (or for that matter IL-12p70, TGF, TNF- or any other cytokine of interest) by various cell types can be examined, pre- and postinfection. Likewise, by targeting the candidate virulence factors I have identified, and generating leishmania null mutants for these proteins, it would be possible to learn more about the role of individual cargo proteins in exosome-mediated immune-modulation.  5.2 Limitations To provide formal proof that exosome secretion by leishmania is linked to virulence, disruption of exosome formation, secretion or both would have been an ideal experimental strategy. It is well  140  known that ESCRT proteins are involved in the formation of vesicles within endosomes, resulting in the generation of MVBs (20;21). Moreover, ESCRT proteins have been shown to be required for the budding of some viruses, a process that resembles the secretion of exosomes (22). We hypothesized that expression of dominant negative (DMN) VPS4, an essential element in ESCRT III mediated vesicle fission and MVB formation (23-25), would inhibit leishmania exosome formation, exosome release or both. Unfortunately, leishmania expressing DNM VPS4 had a severe growth defect and expression of DNM VPS4 at high levels was lethal. This limitation appears to be the case with all mutations to vesicle trafficking in leishmania and kinetoplastids in general (26;27). Consequently, it was not possible to ablate exosome release without compromising leishmania viability. As an alternative approach we investigated the effects of exosomes on immune activation parameters after removal of certain exosomal surface molecules and cargo proteins using LPG2 and HSP100 null mutants (Figs. 4.5-4.8). Changes in phosphoglycan expression based upon the LPG2 knock out, did not result in a change in the phenotype of exosome-treated cells. On the other hand, when compared with WT exosomes, exosomes from HSP100 knockout leishmania had altered protein cargo and showed a shift from an anti-inflammatory to a pro-inflammatory phenotype. These findings are of significant interest and suggest that the HSP100 knock out leishmania should be a useful tool for dissecting the molecular mechanisms of exosome pathogenesis.  5.3 Future directions While the work presented here largely answered the original goals of the project, inevitably we are left with more questions than answers. To begin with, it would certainly be of interest to know whether or not leishmania exosomes are capable of eliciting antigen specific responses. We have shown that WT exosomes had a generally suppressive effect on monocytes and dendritic cells and that they did not boost allogenic responses of naïve CD4 T cells (Figs. 4.1-4.3). Ongoing work using PBMCs from patients with cutaneous leishmaniasis, whose blood should contain expanded anti-leishmania T  141  cell populations, is aimed at determining if leishmania exosomes are suppressive in an antigen-specific manner. Moreover, this approach is also being used to test whether the enhanced allo-reactivity of CD4 T cells seen in response to HSP100-/- exosomes is also seen in response to specific antigen and in the absence of an allogeneic component. From a slightly different perspective, there is the issue of leishmania vaccine development and the potential role of exosomes. Presently, there are no anti-leishmania vaccines that have received regulatory approval and been brought to the clinic. This is in part due to lack of funding for “Neglected Diseases”, the World Heath Organizations term for diseases like leishmaniasis and sleeping sickness which are financially unattractive to large pharmaceutical companies (28;29). Over the past decade exosomes secreted by DCs have garnered attention in anti-cancer vaccine design, due in part to their antigen presentation capabilities (30;31). In fact, two Phase I clinical trials have been conducted with DC exosomes, both involving melanomas (32). Furthermore, exosomes harvested from DCs pulsed with Toxoplasma gondii antigens were recently shown to be protective against toxoplasmosis in a mouse model (33), the first indication that exosomes may be useful in protection against infectious diseases. Since the results reported in this thesis are the first to describe exosome secretion by a primary human pathogen, the vaccine potential of these organelles has yet to be evaluated. My finding that human DCs pulsed with HSP100-/- exosomes significantly enhanced IFN-γ production in an allogeneic system, suggests that further study of the vaccine potential of leishmania exosomes is warranted. It is also worth noting that exosomes released from bacterially infected macrophages have been reported to be pro-inflammatory (34;35). It was beyond the scope of this thesis to conduct a full characterization of exosomes released by leishmania-infected macrophages. Nevertheless, my preliminary results suggests that, in contrast to the previous studies on macrophages infected with mycobacteria or toxoplasma, exosomes released by leishmania infected macrophages were antiinflammatory, as they inhibited TNF-α production by naïve macrophages (data not shown). Additional  142  study of the functional properties of exosomes released from leishmania infected macrophages should improve our understanding of immune modulation by leishmania. Another perspective that has opened up as a result of my thesis research concerns the possibility that leishmania exosomes may serve as a source of shuttle RNA’s. Thus, in pilot studies, we found that leishmania exosomes contain multiple RNA molecules. This finding is consistent with a recent study reporting that exosomes from human mast cells contained bioactive shuttle RNA’s -both mRNAs and microRNAs- that could be transferred between cell types (36). Although the prevailing view has been that leishmania do not use microRNA or siRNA-based regulatory mechanisms (37), a genomic analysis of L. braziliensis showed that these parasites encode the machinery required for such processing (38). At this point, the role of RNA interference in leishmania biology and the putative identities of leishmania inhibitory microRNAs are unknown. In collaboration with colleagues at Simon Fraser University, I have initiated a study to characterize a leishmania transciptome for L. donovani, which has not yet been fully characterized. The intention is to expand this analysis to produce a picture of the RNA cargo of leishmania exosomes. It is tempting to speculate that, if indeed microRNAs are part of the cargo of leishmania exosomes, these vesicles could serve as an excellent delivery mechanism into host cytoplasm (Figs. 3.5 and 3.6), wherein the RNA molecules could secondarily access the cytosol via one or more mechanisms (Fig. 3.8 and Table 3.2) to influence the expression of target genes and promote parasite persistence.  5.4 In closing Protozoa are unglamorous to many in the scientific field, due to technical difficulties and a lack of immediacy to our western scientific agendas. New technologies have made research into leishmania biology significantly more accessible, but it is imperative that we not forget the global influence of these organisms. Leishmania disfigure, disable, ostracize, and kill hundreds of thousands of individuals every year, and are directly responsible for loss of economic productivity in highly endemic areas. In a 143  very tangible manner, parasitic protozoa exert a huge influence on the geopolitics of the Indian subcontinent, the Middle East, much of Central and South America, and Africa. One aim of the work carried out in this thesis was to mitigate our ignorance concerning fundamental aspects of leishmania cell biology, including interactions with host cells. This new knowledge is of value in its own right, but it is also possible that the lessons learned may have broader implications for the biology of other eukaryotic pathogens that invade host cells. I hope that the findings presented here have opened up new vistas into the biology of the leishmaniases. This effort will have been more than worthwhile if these fresh perspectives should foster the development of new areas of research, whether these are focused on pathogenesis, therapeutics or vaccine development. Ultimately, it is my hope that these efforts will bring benefits to the multitudes affected by the leishmaniases and perhaps other protozoan diseases.  144  5.5 Bibliography (1) Silverman JM, Chan SK, Robinson DP, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol 2008;9(2):R35. (2) Spath GF, Garraway LA, Turco SJ, Beverley SM. The role(s) of lipophosphoglycan (LPG) in the establishment of Leishmania major infections in mammalian hosts. Proc Natl Acad Sci U S A 2003 Aug 5;100(16):9536-41. (3) Farajnia S, Alimohammadian MH, Reiner NE, Karimi M, Ajdari S, Mahboudi F. Molecular characterization of a novel amastigote stage specific Class I nuclease from Leishmania major. Int J Parasitol 2004 Jul;34(8):899-908. (4) Piani A, Ilg T, Elefanty AG, Curtis J, Handman E. Leishmania major proteophosphoglycan is expressed by amastigotes and has an immunomodulatory effect on macrophage function. Microbes Infect 1999 Jul;1(8):589-99. (5) Saar Y, Ransford A, Waldman E, et al. Characterization of developmentally-regulated activities in axenic amastigotes of Leishmania donovani. Mol Biochem Parasitol 1998 Sep 1;95(1):9-20. (6) Krobitsch S, Brandau S, Hoyer C, Schmetz C, Hubel A, Clos J. Leishmania donovani heat shock protein 100. Characterization and function in amastigote stage differentiation. J Biol Chem 1998 Mar 13;273(11):6488-94. (7) Zhang WW, Charest H, Ghedin E, Matlashewski G. Identification and overexpression of the A2 amastigote-specific protein in Leishmania donovani. Mol Biochem Parasitol 1996 Jun;78(12):79-90. (8) Joshi M, Dwyer DM, Nakhasi HL. Cloning and characterization of differentially expressed genes from in vitro-grown 'amastigotes' of Leishmania donovani. Molecular and Biochemical Parasitology 1993 Apr;58(2):345-54. (9) Matlashewski G. Leishmania infection and virulence. Med Microbiol Immunol (Berl) 2001 Nov;190(1-2):37-42. (10) Srividya G, Duncan R, Sharma P, Raju BV, Nakhasi HL, Salotra P. Transcriptome analysis during the process of in vitro differentiation of Leishmania donovani using genomic microarrays. Parasitology 2007 Oct;134(Pt 11):1527-39. (11) Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL. CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 2002 Dec 5;420(6915):502-7. (12) Liu D, Kebaier C, Pakpour N, et al. Leishmania major Phosphoglycans Influence the Host Early Immune Response by Modulating Dendritic Cell Functions. Infection and Immunity 2009 Aug 1;77(8):3272-83. (13) Carvalho EM, Barral A, Pedral-Sampaio D, et al. Immunologic markers of clinical evolution in children recently infected with Leishmania donovani chagasi. J Infect Dis 1992 Mar;165(3):53540.  145  (14) Peters NC, Egen JG, Secundino N, et al. In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science 2008 Aug 15;321(5891):970-4. (15) Nylen S, Maurya R, Eidsmo L, Manandhar KD, Sundar S, Sacks D. Splenic accumulation of IL-10 mRNA in T cells distinct from CD4+CD25+ (Foxp3) regulatory T cells in human visceral leishmaniasis. The Journal of Experimental Medicine 2007 Apr 16;204(4):805-17. (16) Peters N, Sacks D. Immune privilege in sites of chronic infection: Leishmania and regulatory T cells. Immunol Rev 2006 Oct;213:159-79. (17) Nylen S, Maurya R, Eidsmo L, Manandhar KD, Sundar S, Sacks D. Splenic accumulation of IL-10 mRNA in T cells distinct from CD4+CD25+ (Foxp3) regulatory T cells in human visceral leishmaniasis. The Journal of Experimental Medicine 2007 Apr 16;204(4):805-17. (18) Anderson CF, Oukka M, Kuchroo VJ, Sacks D. CD4(+)CD25(-)Foxp3(-) Th1 cells are the source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis. J Exp Med 2007 Feb 19;204(2):285-97. (19) Anderson CF, Stumhofer JS, Hunter CA, Sacks D. IL-27 regulates IL-10 and IL-17 from CD4+ cells in nonhealing Leishmania major infection. J Immunol 2009 Oct 1;183(7):4619-27. (20) Yang M, Coppens I, Wormsley S, Baevova P, Hoppe HC, Joiner KA. The Plasmodium falciparum Vps4 homolog mediates multivesicular body formation. J Cell Sci 2004 Aug 1;117(17):3831-8. (21) Yoshimori T, Yamagata F, Yamamoto A, et al. The Mouse SKD1, a Homologue of Yeast Vps4p, Is Required for Normal Endosomal Trafficking and Morphology in Mammalian Cells. Mol Biol Cell 2000 Feb 1;11(2):747-63. (22) Taylor GM, Hanson PI, Kielian M. Ubiquitin Depletion and Dominant-Negative VPS4 Inhibit Rhabdovirus Budding without Affecting Alphavirus Budding. J Virol 2007 Dec 15;81(24):136319. (23) Fujita H, Yamanaka M, Imamura K, et al. A dominant negative form of the AAA ATPase SKD1/VPS4 impairs membrane trafficking out of endosomal/lysosomal compartments: class E vps phenotype in mammalian cells. J Cell Sci 2003 Jan 15;116(2):401-14. (24) Taylor GM, Hanson PI, Kielian M. Ubiquitin Depletion and Dominant-Negative VPS4 Inhibit Rhabdovirus Budding without Affecting Alphavirus Budding. J Virol 2007 Dec 15;81(24):136319. (25) Yoshimori T, Yamagata F, Yamamoto A, et al. The Mouse SKD1, a Homologue of Yeast Vps4p, Is Required for Normal Endosomal Trafficking and Morphology in Mammalian Cells. Mol Biol Cell 2000 Feb 1;11(2):747-63. (26) Besteiro S, Williams RA, Morrison LS, Coombs GH, Mottram JC. Endosome sorting and autophagy are essential for differentiation and virulence of Leishmania major. !Lost Data 2006 Apr 21;281(16):11384-96. (27) Clayton C, Hausler T, Blattner J. Protein trafficking in kinetoplastid protozoa. Microbiol Rev 1995 Sep 1;59(3):325-44. 146  (28) Hotez PJ, Molyneux DH, Fenwick A, Ottesen E, Ehrlich Sachs S, Sachs JD. Incorporating a RapidImpact Package for Neglected Tropical Diseases with Programs for HIV/AIDS, Tuberculosis, and Malaria. PLoS Medicine 2006 May 1;3(5):e102. (29) Coler RN, Reed SG. Second-generation vaccines against leishmaniasis. Trends in Parasitology 2005 May;21(5):244-9. (30) Chen W, Wang J, Shao C, et al. Efficient induction of antitumor T cell immunity by exosomes derived from heat-shocked lymphoma cells. Eur J Immunol 2006 Jun;36(6):1598-607. (31) Andre F, Chaput N, Schartz NE, et al. Exosomes as potent cell-free peptide-based vaccine. I. Dendritic cell-derived exosomes transfer functional MHC class I/peptide complexes to dendritic cells. J Immunol 2004 Feb 15;172(4):2126-36. (32) Thery C, Ostrowski M, Segura E. Membrane vesicles as conveyors of immune responses. Nat Rev Immunol 2009 Aug;9(8):581-93. (33) Beauvillain C, Juste MO, Dion S, Pierre J, mier-Poisson I. Exosomes are an effective vaccine against congenital toxoplasmosis in mice. Vaccine 2009 Mar 10;27(11):1750-7. (34) Bhatnagar S, Shinagawa K, Castellino FJ, Schorey JS. Exosomes released from macrophages infected with intracellular pathogens stimulate a proinflammatory response in vitro and in vivo. Blood 2007 Nov 1;110(9):3234-44. (35) Bhatnagar S, Schorey JS. Exosomes Released from Infected Macrophages Contain Mycobacterium avium Glycopeptidolipids and Are Proinflammatory. Journal of Biological Chemistry 2007 Aug 31;282(35):25779-89. (36) Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 2007 Jun;9(6):654-9. (37) Robinson KA, Beverley SM. Improvements in transfection efficiency and tests of RNA interference (RNAi) approaches in the protozoan parasite Leishmania. Mol Biochem Parasitol 2003;128:217-28. (38) Peacock CS, Seeger K, Harris D, et al. Comparative genomic analysis of three Leishmania species that cause diverse human disease. Nat Genet 2007 Jul;39(7):839-47.  147  Appendix A.1  Presentations and awards  Poster presentations UBC-CIHR Science Showcase, 2007 Society of Leukocyte Biology Annual Meeting, 2007 Society of Leukocyte Biology Annual Meeting, 2008 Canadian Proteomics Institute Annual Meeting, 2008 Invited oral presentations Society of Leukocyte Biology Annual Meeting, 2008 BC proteomics Network and Canadian Proteomics Institute Annual Meeting, 2008 Host Pathogen Interactions Gordon Conference, 2008 Seattle Parasitology Conference, 2009 Awards and honors UBC: 2008 John Richard Turner Fellowship in Microbiology 2004 Dorothy Helmer Scholarship in Medicine 2004 Graduate Entrance Scholarship External Awards: 2008 Society of Leukocyte Biology, Presidential Student Award, 2nd Place  A.2  List of publications  Nandan D, Tran T, Trinh E, Silverman JM, Lopez M. Identification of leishmania fructose-1,6bisphosphate aldolase as a novel activator of host macrophage Src homology 2 domain containing protein tyrosine phosphatase SHP-1. Biochemical and Biophysical Research Communications 2007 Dec 21;364(3):601-7. Silverman JM, Chan SK, Robinson DP, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol 2008;9(2):R35. Silverman, JM, Clos J, de’Oliveira CC, Shirvani O, Fang Y, Wang C, Foster LJ, and Reiner NE. An Exosome-based Secretion Pathway is Responsible for Protein Export from Leishmania and for Communication with Macrophages. J Cell Sci 2010 Feb;Epub ahead of print.  148  A.3  Ethics approval  149  A.4  Biohazard approval  150  A.5  Animal care approval  151  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069776/manifest

Comment

Related Items