UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The low-density lipoprotein receptor knock-out mouse : a model for the study of energy balance Ngai, Ying Fai Tiffany 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_ngai_yingfai.pdf [ 2.79MB ]
Metadata
JSON: 24-1.0069670.json
JSON-LD: 24-1.0069670-ld.json
RDF/XML (Pretty): 24-1.0069670-rdf.xml
RDF/JSON: 24-1.0069670-rdf.json
Turtle: 24-1.0069670-turtle.txt
N-Triples: 24-1.0069670-rdf-ntriples.txt
Original Record: 24-1.0069670-source.json
Full Text
24-1.0069670-fulltext.txt
Citation
24-1.0069670.ris

Full Text

THE LOW-DENSITY LIPOPROTEIN RECEPTOR KNOCK-OUT MOUSE: A MODEL FOR THE STUDY OF ENERGY BALANCE  by  YING FAI TIFFANY NGAI B.Sc., The University of British Columbia, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2010  © Ying Fai Tiffany Ngai, 2010  Abstract The discovery of leptin and other humoral signals which regulate food intake and energy expenditure has greatly contributed to our understanding of molecular pathways controlling energy homeostasis. Leptin produced by adipocytes, insulin produced by the pancreas, and ghrelin produced by the stomach all contribute to the body’s energy balance. One question remaining is whether the lipid transport system also plays a role. Our hypothesis is that lipid clearance is important in the maintenance of energy homeostasis. The low-density lipoprotein receptor (Ldlr) is a key molecule involved with lipid clearance. The experiments presented in this thesis used the Ldlr-/- mouse to study the Ldlr’s role in energy balance. One aim of this thesis was to provide a detailed analysis of the energy balance phenotype of the Ldlr-/- mouse. Another aim of this thesis was to use the Ldlr-/- mouse to study the potential interaction between Ldlr and the leptin signaling pathway. Adult Ldlr-/- mice and Ldlr+/+ controls on a C57BL/6J background were fed either a chow or a high-fat, high-sucrose Western-type diet (WTD) for eight weeks. Physiological studies of food intake, energy expenditure, activity, heat production, insulin sensitivity, and leptin responsiveness were performed. As well, the effect of these diet interventions on circulating leptin and on leptin gene expression was examined. On the chow diet, Ldlr-/- mice had lower energy expenditure and higher activity levels relative to controls. On the WTD, Ldlr-/- mice gained less weight relative to Ldlr+/+ mice, specifically gaining less fat mass. Increased thermogenesis in Ldlr-/- mice fed the WTD was detected. Additionally, leptin responsiveness was blunted in chow-fed Ldlr-/- mice, suggesting a novel role for the Ldlr pathway that extends to leptin’s regulation of energy balance. In addition to its known role in lipid transport, these results from the Ldlr-/mouse demonstrate the importance of the Ldlr in regulating energy homeostasis and suggest a direct physiological link between dyslipidemia and energy balance.  ii  Table of Contents Abstract.................................................................................................................................................. ii Table of Contents .................................................................................................................................iii List of Tables ......................................................................................................................................... v List of Figures....................................................................................................................................... vi List of Abbreviations and Symbols...................................................................................................viii Acknowledgements .............................................................................................................................. ix CHAPTER 1: Introduction.................................................................................................................. 1 1.1  The Ldlr-/- Mouse to Study Energy Balance............................................................................... 1  1.2 Obesity: Implications for Human Health..................................................................................... 2 1.2.1 Obesity Defined...................................................................................................................... 2 1.2.2 Epidemiology of Obesity........................................................................................................ 2 1.2.3 Pathophysiology of Obesity.................................................................................................... 3 1.3 Regulators of Energy Balance ..................................................................................................... 4 1.3.1 Adipose Expansion in Obesity................................................................................................ 4 1.3.2 The Discovery of Leptin......................................................................................................... 5 1.3.3 The Leptin Receptor ............................................................................................................... 6 1.3.4 Leptin in the Hypothalamus.................................................................................................... 7 1.3.5 Other Adipokines.................................................................................................................... 8 1.3.6 Other Hormones Involved in Energy Balance ........................................................................ 9 1.4 Lipid Transport System and Lipoprotein Receptors.................................................................. 10 1.4.1 Lipid Metabolism ................................................................................................................. 10 1.4.2 Structure of Lipoprotein Receptors....................................................................................... 11 1.4.3 Lipoprotein Receptors and Cholesterol Synthesis ................................................................ 12 1.5  Role of Lipid Transport System in Energy Balance .................................................................. 13  1.6 The Low-density Lipoprotein Receptor .................................................................................... 14 1.6.1 Discovery of LDLR and Significance in Disease ................................................................. 14 1.6.2 The Ldlr-/- Mouse ................................................................................................................ 15 1.7 Review of the Ldlr-/- Mouse and Energy Balance............................................................................. 16 1.7.1 Energy Balance in the Ldlr-/- Mouse ................................................................................... 16 1.7.2 Leptin Deficient Ldlr-/- Mice ............................................................................................... 17 1.7.3 Weight Gain in the Ldlr-/- Mouse ........................................................................................ 18 1.7.4 Conclusions from Reports of Weight Gain in Ldlr-/- Mice.................................................. 19 1.7.5 Other Energy Balance Phenotypes of the Ldlr-/- Mouse...................................................... 20 1.8  Rationale for Hypothesis ........................................................................................................... 20  CHAPTER 2: Materials and Methods .............................................................................................. 28 2.1 Introduction to the Study of Energy Balance ............................................................................ 28 2.1.1 Energy Balance..................................................................................................................... 28 2.1.2 Energy Expenditure .............................................................................................................. 29 2.1.3 Energy Intake........................................................................................................................ 29 2.1.4 Energy Stored ....................................................................................................................... 30 2.1.5 Further Indicators of Energy Balance................................................................................... 30 2.2  Experimental Animals and Diets............................................................................................... 31  2.3 Characterization in Metabolic Chambers .................................................................................. 32 2.3.1 Metabolic Chambers............................................................................................................. 32  iii  2.3.2 2.3.3 2.3.4 2.3.5  Indirect Calorimetry ............................................................................................................. 32 Activity Levels ..................................................................................................................... 33 Food and Water Intake.......................................................................................................... 33 Thermogenesis and Cold Challenge ..................................................................................... 33  2.4  Body Composition..................................................................................................................... 34  2.5  Serum Protein Concentrations................................................................................................... 34  2.6  Energy Content of Mouse Fecal Matter..................................................................................... 35  2.7  Glucose Homeostasis ................................................................................................................ 36  2.8  Quantifying Physiological Response to Leptin Administration ................................................ 36  2.9  Quantitative Reverse-Transcriptase Polymerase Chain Reaction.............................................. 37  2.10  Statistics .................................................................................................................................... 38  CHAPTER 3: Energy Balance in the Ldlr-/- Mouse ........................................................................ 40 3.1 Energy Balance of Ldlr-/- Mice on Chow ................................................................................. 40 3.1.1 Ldlr-/- Mice at 10 Weeks Age .............................................................................................. 40 3.1.1 Ldlr-/- Mice on a Chow Diet at 18 Weeks Age .................................................................... 40 3.2 Ldlr-/- Mice Gain Less Weight on WTD .................................................................................. 41 3.2.1 Acute Response to WTD Feeding ........................................................................................ 41 3.2.2 Response to Chronic WTD Feeding ..................................................................................... 43  CHAPTER 4: Leptin Signaling in Ldlr-/- Mice................................................................................ 59 4.1 Endogenous Leptin in Ldlr-/- Mice ........................................................................................... 59 4.1.1 Serum Leptin Levels............................................................................................................. 59 4.1.2 Leptin Gene Expression in Adipocytes ................................................................................ 59 4.2 Leptin Responsiveness and Functioning in Ldlr-/- Mice........................................................... 60 4.2.1 Leptin Administration........................................................................................................... 60 4.2.2 Hypothalamic Gene Expression............................................................................................ 61  CHAPTER 5: General Discussion ..................................................................................................... 69 5.1 Reliability of Methods............................................................................................................... 69 5.1.1 Energy Expenditure .............................................................................................................. 69 5.1.2 Body Composition................................................................................................................ 69 5.1.3 Fecal Energy Content ........................................................................................................... 70 5.1.4 Glucose Sensitivity ............................................................................................................... 70 5.1.5 Quantitative Reverse-Transcriptase Polymerase Chain Reaction......................................... 71 5.1.6 Leptin Administration........................................................................................................... 71 5.2 The Energy Balance Phenotype in Ldlr-/- Mice........................................................................ 72 5.2.1 Phenotype of Ldlr-/- Mice on Chow..................................................................................... 72 5.2.3 Phenotype of Ldlr-/- Mice on WTD ..................................................................................... 73 5.3 The Ldlr and Leptin................................................................................................................... 76 5.3.1 Leptin Levels in Ldlr-/- Mice ............................................................................................... 76 5.3.2 Leptin Responsiveness in Ldlr-/- Mice................................................................................. 77 5.3.3 Expression of Hypothalamic Neuropeptides ........................................................................ 78 5.4  Conclusion of Findings and Future Directions .......................................................................... 79  References............................................................................................................................................ 82 Appendix A: Ethical Approval of Animal Studies ........................................................................... 91 Appendix B: Validation of Methods.................................................................................................. 95  iv  List of Tables  Table 1.1  Neuropeptides implicated in the control of energy homeostasis……………....22  Table 1.2  Properties of the seven LDL receptor family members…………….….……... 23  Table 2.1  Primers for qRT-PCR..……..……….……………………………………….... 39  v  List of Figures  Figure 1.1  Control of energy homeostasis by arcuate nucleus neurons. ………………… 24  Figure 1.2  Humoral factors affecting energy balance……………….……..……….……. 25  Figure 1.3  Schematic representation of the seven mammalian LDL receptor (LDLR) family members. ………………..…………..…………..………….. 26  Figure 1.4  Model for the interaction of apoE with leptin and POMC in the control of food intake and body weight.....… ....… ....… ....… ....… ....… ....… ....… 27  Figure 3.1  Body weight and food intake in 10-week old Ldlr-/- mice on chow diet…….. 46  Figure 3.2  Energy expenditure in 10-week old Ldlr-/- mice on chow……..……….……. 47  Figure 3.3  Glucose homeostasis of 10-week old Ldlr-/- mice on a chow ……………….. 48  Figure 3.4  Body composition and food intake in 18-week old Ldlr-/- mice on chow....… 49  Figure 3.5  Energy expenditure in 18-week old Ldlr-/- mice fed chow...………………… 50  Figure 3.6  Glucose homeostasis in 24-week old Ldlr-/- mice on chow.............................. 51  Figure 3.7  Food intake of Ldlr-/- mice acutely exposed to WTD at 10-weeks................... 52  Figure 3.8  Energy expenditure in Ldlr-/- mice acutely exposed to WTD at 10-weeks…... 53  Figure 3.9  Activity levels in Ldlr-/- mice acutely exposed to WTD at 10-weeks. ……… 54  Figure 3.10  Body composition and food intake in Ldlr-/- mice fed a WTD. ……………... 55  Figure 3.11  Energy expenditure in Ldlr-/- mice on WTD. ……………...………………… 56  Figure 3.12  Thermoregulation in Ldlr-/- mice on WTD……………………………..…..... 57  Figure 3.13  Glucose homeostasis of Ldlr-/- mice fed WTD. ……………………………... 58  Figure 4.1  Endogenous leptin levels in Ldlr-/- mice...…………………………………… 62  Figure 4.2  Leptin transcripts in Ldlr-/- mice………………………...……..……….……. 63  Figure 4.3  Serum leptin levels following IP leptin administration ……..………………... 64  Figure 4.4  Effects of leptin on body weight and food intake in Ldlr-/- mice……….....…. 65  Figure 4.5  Energy expenditure after leptin administration………………………………. 66  vi  Figure 4.6  Activity levels after leptin administration……………….................................. 67  Figure 4.7  Hypothalamic gene expression of leptin-responsive neuropeptides……....….. 68  Figure 5.1  Regulators of energy balance……………….……..………………………….. 81  vii  List of Abbreviations and Symbols  α-MSH  =  α-Melanocyte-stimulating  Ldlr  =  hormone Agrp  =  Low density lipoprotein receptor  Agouti-related protein  LH  =  Lateral hypothalamus  Apoa-IV =  Apolipoprotein a-IV  LPL  =  Lipoprotein lipase  ApoB-100 =  Apolipoprotein b-100  Lrp1  =  LDL receptor-related protein  Apoe  =  Apolipoprotein e  Mch  =  Melanin concentrating  BBB  =  Blood brain barrier  BMI  =  Body mass index  Mc4r  =  Melanocortin 4 receptor  Cart  =  Cocaine- and amphetamine-  MDCT  =  Multi-detector computed  hormone  regulated transcript  tomography  CCK  =  Cholecystokinin  Npy  =  Neuropeptide y  CNS  =  Central nervous system  ob/ob  =  Obese leptin-deficient  db/db  =  Diabetic leptin receptor-  DEXA  =  genotype  deficient genotype  Pomc  =  Pro-opio melanocortin  Dual energy X-ray  PVH  =  Paraventricular hypothalamus  absorptiometry  QMR  =  Quantitative magnetic  EE  =  Energy expenditure  EGF  =  Epidermal growth factor  FH  =  Familial hypercholesterolemia  transcriptase polymerase chain  3-Hydroxy-3-methylglutaryl  reaction  HMG CoA=  resonance qRT-PCR =  Quantitative reverse  coenzyme A  REE  =  Resting energy expenditure  ICV  =  Intracerebroventricular  RER  =  Respiratory exchange ratio  IDL  =  Intermediate density  SREBP  =  Sterol regulatory element  lipoprotein  binding protein  IL-6  =  Interleukin-6  TEF  =  Thermic effect of food  IPGTT  =  Intraperitoneal glucose  TNF-α  =  Tumor necrosis factor-α  tolerance test  Ucp1  =  Uncoupling protein 1  Intraperitoneal insulin  VLDL  =  Very low density lipoprotein  tolerance test  WHO  =  World health organization  Low density lipoprotein  WTD  =  Western type diet  IPITT LDL  = =  viii  Acknowledgements  There are many people who have helped immensely in the formation of this thesis. First and foremost, I would like to thank Dr. William Gibson for his consistent encouragement and mentorship over my years as a graduate student. He has been an excellent teacher in many aspects and I have greatly appreciated the opportunity to work with him. I would also like to sincerely thank my supervisory committee members, Drs. Louis Lefebvre and Neal Boerkoel, whose advice, insight, and support have been invaluable over the years. Additionally, many thanks are required for my lab mates, Sandra Babich and Melissa Glier, who have been incredibly helpful in providing ideas and assisting in animal and molecular biology techniques. Melissa was also extremely helpful and played a key role in the experiments pertaining to thermogenesis. I would also like to thank Whitney Quong for her role in the experiments presented in this thesis. She has been a wonderful student and a pleasure to work with. In addition, I would like to recognize Pallavi Walia and Ellen Ni from Dr. JP Chanoine’s Laboratory for their kindness and support. Post-doctoral fellow Dr. Maria Glavas from Dr. Timothy Kieffer’s Laboratory was also crucial in the planning of experiments on leptin responsiveness presented in this thesis. I would also like to thank Janette King and Roger Dyer from Dr. Sheila Innis’s Laboratory for their assistance in the direct calorimetry studies. The experiments in this thesis were made possible with funding support from the Natural Sciences and Engineering Council of Canada and by the Canucks for Kids Fund. Lastly, I would very much like to thank my family: my mother, Brandon, Benson, and Michelle, and JP. I am incredibly grateful to have their continued support.  ix  CHAPTER 1: Introduction  1.1  The Ldlr-/- Mouse to Study Energy Balance  Obesity is rapidly becoming an issue of serious concern worldwide1,2. Research in recent decades has uncovered multiple and complex pathways controlling food intake and energy expenditure (EE) which have contributed to our understanding of energy balance. Of particular importance is the hormone leptin, which is produced by adipocytes and is central in the regulation of body weight. The overall purpose of this thesis was to investigate the role that the Ldlr pathway holds in the maintenance of energy homeostasis. To achieve this, a transgenic mouse knockout model lacking the lowdensity lipoprotein receptor (Ldlr) was utilized.  My specific aims were to determine: 1) Are differences in body composition, food intake, EE, activity levels, and heat production present between Ldlr-/- mice and wildtype controls? 2) Does Ldlr gene ablation lead to changes in leptin physiology and signaling?  In this introduction I will provide the relevant background information pertaining to obesity in humans and the molecular pathways which regulate energy balance. I will then review our current knowledge of the lipid transport system and research suggesting its involvement with energy homeostasis. Lastly, I will discuss the Ldlr and provide a rationale to support my hypothesis for the Ldlr’s significance in energy balance.  1  1.2  Obesity: Implications for Human Health  1.2.1 Obesity Defined The World Health Organization (WHO) defines obesity as an “abnormal or excessive fat accumulation that presents a risk to health”3. Excessive body fat increases risk for various diseases4-6. Thus, research regarding obesity and its development has significant implications for human health. Body mass index (BMI) is often used for assessing obesity in humans, particularly for its reproducibility and ease of acquisition7. BMI is calculated by dividing the weight of an individual in kilograms by the height in meters squared (kg/m2). In adults, a BMI>25 is considered overweight, whereas a BMI>30 is considered obese7. Differences in the rates of obesity-associated comorbidities between ethnicities also suggest that ethnic-specific BMI cut-offs may more accurately predict risk for adverse consequences of obesity8. Other anthropometric methods such as waist-to-hip ratio and waist circumference are currently being assessed for sensitivity and efficacy in measuring obesity9,10. While anthropometric measures of body weight are easily attainable, body composition analysis using dual energy X-ray absorptiometry (DEXA) and quantification of abdominal adiposity using multi-detector computed tomography (MDCT) provide more information regarding the phenotype of obese patients11,12. To date, however, BMI is still the most commonly accepted method to diagnose obesity3.  1.2.2  Epidemiology of Obesity Over recent decades, obesity has become increasingly prominent in Canada as  well as globally3,13. In 2005, the WHO estimated that 1.6 billion adults were overweight  2  and at least 400 million adults were obese worldwide3. By the year 2015, the WHO predicts that approximately 2.3 billion adults will be overweight and over 700 million obese. In Canada, it was estimated in 2004 that 5.5 million adults had a BMI greater than 30, qualifying these individuals as obese. From 1978 to 2004, the prevalence of obesity in Canada rose dramatically from 13.8% to 23.1%14. Pediatric obesity is also a major issue of concern15. In 2007, the WHO estimated 22 million children under the age of 5 years were overweight throughout the world; over 75% of these children live in low-to-middle income countries3. From 1978 to 2004, the rate of childhood obesity in Canada tripled from 3% to 9%14. This dramatic increase in obesity worldwide is creating a financial burden for many healthcare programs16. Thus, it is important and justified to study the fundamental differences between the physiological state considered normal weight and that considered obese. With the advance of medical research concerning obesity, better management and treatment regimens may be designed to combat this growing global problem.  1.2.3  Pathophysiology of Obesity The increase in prevalence of obesity in many countries over recent years has  contributed to an increase in cardiovascular disease6, certain forms of cancer4, and type 2 diabetes5. In fact, evidence clearly supports the strong correlation between type 2 diabetes and obesity17. Obesity combined with hypercholesterolemia and hypertriglyceridemia is often seen in patients who develop type 2 diabetes18. Specifically, central visceral adiposity predisposes more strongly to type 2 diabetes and cardiovascular disease than does subcutaneous adiposity19. This is why measures that specifically address the  3  individual’s regional fat distribution, such as waist-to-hip ratio or MDCT-based volumetric quantification of abdominal adiposity, may be better indicators of metabolic health than measures of overall adiposity20. Understanding the physiology and pathology of obesity will allow the development of therapies to treat it and improve the lives of the many people who are affected by it.  1.3 1.3.1  Regulators of Energy Balance  Adipose Expansion in Obesity Obesity is characterized by a substantial increase in fat tissue. Adipocytes have a  unique architecture, whereby a large lipid droplet accumulates and stores triglycerides in a manner not harmful to the cell21,22. Due to this large lipid droplet, most other organelles in the cell appear displaced, making the function of adipocyte as a lipid storage cell readily ascertainable21,22. Over recent years, however, research has shifted the view of adipose tissue from an inert energy storage depot to a dynamic organ that secretes autocrine, paracrine and endocrine factors which regulate many aspects of physiology23. Adipose tissue is a critical regulator of energy balance through modulation of both food intake and EE24. While the details of how obesity directly increases the risk for various diseases remain unknown, researchers have investigated the changes in physiology which occur as adiposity increases. These changes include alterations in levels of circulating adipocyte-secreted factors termed “adipokines”25, which affect functioning of various nonadipose organs as well as whole-organism biology23.  4  1.3.2  The Discovery of Leptin Leptin is a hormone secreted by adipocytes and acts as a key indicator of the  body’s energy stores26. The study of leptin has provided a clearer understanding of the pathways which regulate energy balance and to date leptin remains the best studied adipokine27. The genetically obese (ob/ob) mouse mutant was first isolated at the Jackson Laboratory in 195028. ob/ob mice are hyperphagic, develop spontaneous obesity, and have deficits in fertility29 and in thermoregulation30. The mutated leptin gene causing the obese phenotype was later mapped by positional cloning and found to be a circulating factor that is secreted by adipocytes31. Leptin expression has also been detected at low levels in various other tissues, including skeletal muscle, pancreas, and brain32. When exogenous leptin was administered to leptin-deficient ob/ob mice, their food intake decreased and EE increased, resulting in substantial and impressive weight loss33,34. Mutations in leptin have also been described in obese humans. The remarkable success of leptin therapy for these patients with congenital leptin-deficiency has been welldocumented, with both weight loss and improved metabolic status observed post treatment35-37. In “common” obesity that is not caused by leptin deficiency, serum leptin levels show a positive correlation with fat mass38-40. Leptin is generally elevated in obese individuals suggesting resistance to leptin’s weight-lowering effects develops concurrently with obesity. Leptin gene expression in adipose tissue is also positively correlated with adiposity38,41. Interestingly, hyperleptinemia that occurs with obesity results from increased leptin secretion by subcutaneous adipose tissue more so than by visceral adipose tissue42. This difference in response to weight gain observed between  5  subcutaneous and visceral adipose tissue may contribute to the differences in metabolic risk associated with expansion of these two fat depots.  1.3.3  The Leptin Receptor Leptin exerts its anorectic effects through the leptin receptor. Leptin receptor  deficient (db/db) mice have an obese phenotype largely identical to that of ob/ob mice. However, db/db mice are extremely leptin resistant, due to lack of the crucial leptin receptor. The leptin receptor is most highly expressed the mediobasal hypothalamus, predominantly in the ventromedial nucleus, dorsomedial nucleus, and the arcuate nucleus43,44. Activation of the leptin receptor results in transduction of leptin’s signal to downstream neural pathways, triggering decreased food intake and increased EE in ob/ob mice. Transgenic mice with a neuronal-specific deletion of the leptin receptor showed obesity and a metabolic profile similar to db/db mice, suggesting that most of leptin’s actions on energy balance are centrally mediated 45. While the cause of leptin resistance in common obesity is currently unknown, research has suggested decreased transport of leptin across the blood brain barrier (BBB) as a potential mechanism46. To enter the brain interstitial fluid, leptin must be actively transported across the BBB endothelial cells by leptin receptors, which act as leptin transporters46. Researchers have shown that in obese humans leptin in the cerebrospinal fluid does not correlate with circulating serum plasma levels47, supporting the hypothesis of decreased transport and delivery of leptin to the brain. Decreased intracellular signal transduction at the post-receptor level may also contribute to leptin resistance48.  6  1.3.4  Leptin in the Hypothalamus Early brain stimulating and brain lesioning studies suggested specific centers in  the hypothalamus were responsible for mediating food intake49. Further studies at the molecular level have shown that these regions are regulated by leptin46. Specifically, the arcuate nucleus is a major region in the hypothalamus responsible for the integration and transduction of the leptin signal to downstream neural pathways46,50. In the arcuate nucleus there are two distinct leptin-responsive neuronal populations that express the leptin receptor, illustrated in Figure 1.1. These populations act as first order neurons to leptin’s signal. One subpopulation coexpresses the orexigenic molecules neuropeptide Y (Npy) and agouti-related protein (Agrp), which act to decrease EE and promote food intake51. Activation of the leptin receptor in Npy/Agrp neurons causes decreased expression and decreased release of Npy and Agrp, increased EE, and decreased food intake. The second subpopulation of neurons coexpress the anorexigenic molecules pro-opio melanocortin (Pomc) and cocaine- and amphetamine- regulated transcript (Cart)52,53. Pomc encodes for the precursor transcript to α–melanocytestimulating hormone (α-MSH). Both α-MSH and Cart are neuropeptides that increase EE and decrease food intake46. Activation of the leptin receptor in Pomc/Cart neurons increases expression and release of these anorexigenic molecules. The neuropeptides produced by first order leptin neurons then act as effector molecules, activating or inhibiting second order neurons downstream46,50. Brain centers which contain second order leptin neurons include the paraventricular hypothalamus (PVH) and lateral hypothalamus (LH)46. Early studies showed that stimulating the PVH inhibited food intake, whereas stimulating the LH  7  decreased food intake46. In contrast, PVH lesions resulted in hyperphagia and obesity, whereas LH lesions resulted in hypophagia and weight loss46. Under normal conditions, activation of second order leptin neurons promotes transcriptional changes of neuropeptides that regulate energy balance. These include molecules such as melanin concentrating hormone (Mch) and orexins A and B54. Table 1.1 lists neuropeptides that have been implicated in energy balance. One well-characterized example of how leptin exerts it effects on energy balance involves the melanocortin pathway. The receptor for α-MSH is the melanocortin 4 receptor (Mc4r), which is expressed in the PVH54. When leptin activates α-MSH production in the arcuate nucleus, α-MSH activates Mc4rs located at the PVH, triggering decreased food intake55. Furthermore, Agrp is a Mc4r antagonist that is repressed in the presence of leptin, minimizing Mc4r inhibition55. Mutations in Mc4r have been isolated in both mouse models and in human patients; in both cases, severe obesity is associated with Mc4r deficiency56-58.  1.3.5  Other Adipokines Since leptin’s discovery, other adipocyte-derived factors have also been isolated  and studied. Another well-defined adipokine is adiponectin59. Adiponectin is a 30kDa protein known to circulate in several multimeric forms. The high molecular-weight form of adiponectin has been suggested to be the most physiologically relevant and active form59. Adiponectin also exists in circulation at very high levels, comprising approximately 0.01% of total plasma protein23. In contrast to leptin, serum adiponectin levels correlate inversely with adiposity levels60. Adiponectin loss-of-function models  8  have shown varying effects of adiponectin deficiency on body weight and metabolic function61,62. Adiponectin has been demonstrated to have anti-inflammatory properties25. As well, when adiponectin is administered to obese diabetic mice, improvements in insulin sensitivity and fatty acid oxidation have been documented59. Emerging evidence suggests that obesity is a state of inflammation25 and that adipocytes play a role in mediating inflammatory responses. Cytokines secreted from adipose tissue play an important role during the pathogenesis of obesity. Specifically, tumor necrosis factor-α (TNF-α) secreted from adipose tissue has important effects on glucose homeostasis. TNF-α induces insulin resistance63 and TNF-α serum levels are elevated in obese and insulin resistant individuals64, although most of the TNF-α secreted by adipocyte tissue derives from resident macrophages which have infiltrated the adipose depot25. Interleukin-6 (IL-6) is another cytokine produced by adipocytes, with effects similar to TNF-α25. Lastly, resistin is another adipokine whose function is thus far not well-characterized. Like TNF-α, resistin is highly expressed in human macrophages65. Studies from rodents suggest that resistin may have hyperglycaemic action23. However, it is controversial whether resistin may have these effects in humans23.  1.3.6 Other Hormones Involved in Energy Balance In addition to adipocyte derived factors, various other hormones are also involved with body weight regulation50. Insulin administered directly to the brain reduces food intake, much like leptin does46. Insulin levels circulating in brain interstitial fluid correlate with insulin levels circulating in serum50, and neurons of the arcuate nucleus express the insulin receptor and respond to insulin administered to the central nervous  9  system (CNS). Activation of the insulin receptor at these arcuate neurons elicits responses similar to activation of the leptin receptor50. Thus, insulin (produced by pancreatic β-cells) acts as an anorectic hormone much like leptin (produced by adipocytes)46. In addition, neurons in the arcuate nucleus also express the ghrelin receptor50. Ghrelin is a hormone produced by the stomach that reaches peak levels just prior to meal initiation. When ghrelin activates its receptor, food intake is stimulated50. Another hormone mediating energy balance is cholecystokinin (Cck), which is secreted by intestinal endocrine cells and activates receptors on the afferent vagus nerve to terminate feeding50. Thus, the brain integrates adipocyte-derived, pancreas-derived and gut-derived signals with signals from inflammatory cells and other tissues to regulate energy balance. Figure 1.2 summarizes these regulators. The discovery of multiple and complex pathways for food intake and energy expenditure have contributed much to our understanding of energy homeostasis. However, questions remain as to whether other physiological systems also contribute to these energy homeostasis pathways. In this thesis, I will explore specifically the role that the lipid transport system may have.  1.4 1.4.1  Lipid Transport System and Lipoprotein Receptors  Lipid Metabolism Circulating hydrophobic lipids are transported in biochemical particles called  lipoproteins. Lipoproteins consist of a hydrophilic phospholipid monolayer surrounding a hydrophobic lipid core66. Lipoproteins are classified by their density and relative triglyceride to cholesterol content. High-density lipoproteins (HDLs) and low-density  10  lipoproteins (LDLs) have the highest cholesterol and lowest triglyceride content, whereas very-low-density lipoproteins (VLDLs) have the lowest cholesterol and highest triglyceride content67. As dietary triglycerides are absorbed from the intestine, they are packaged into chylomicrons. Chylomicrons are hydrolyzed by lipoprotein lipase (LPL) to produce cholesterol-rich chylomicron remnants, which are then removed from circulation by the liver68. The liver also releases endogenous triglycerides packaged in VLDLs. VLDLs are also hydrolyzed by LPL, eventually becoming cholesterol-rich LDLs, which are then cleared from circulation by the liver68. Cholesterol contained in LDL particles has been well studied for its contribution to the development of atherosclerosis69. As excess cholesterol collects in circulation, cholesterol is deposited in the arterial wall, leading to formation and expansion of atherosclerotic plaques70. Atherosclerosis is a complex disease affected by both genetic and environmental factors71 and is important in the development of cardiovascular disease. Sclerosis describes the thickening of arterial walls due to formation of plaques, and the prefix athero- denotes that these plaques are made up of fatty materials, particularly cholesterol72. Lipoproteins are unable to cross the BBB73. Thus, lipoproteins within the brain and cerebrospinal fluid are thought to remain separate from those in the systemic lipoprotein system. The distinct lipoprotein pool of the CNS is produced by glial cells73.  1.4.2  Structure of Lipoprotein Receptors Apolipoproteins are found embedded in the outer phospholipid monolayer of  lipoproteins66 and function as ligands for receptor-mediated endocytosis and delivery of  11  lipids to target cells74. The receptors for apolipoproteins belong to the low-density lipoprotein receptor (LDLR) gene family are expressed ubiquitously, but those in the liver play a significant role in lipid clearance and lipoprotein metabolism75. Deficient lipoprotein clearance by the liver results in dyslipidemia. Seven mammalian LDLR gene family members have been identified76. Table 1.2 (adapted from Hertz, 200177) and Figure 1.3 (from Beffert et al., 200476) displays the properties of the LDLR gene family members. All lipoprotein receptors share common structural domains characteristic of this class of proteins, including a ligand binding domain, epidermal growth factor (EGF) homology domains, a transmembrane domain, and a cytoplasmic tail containing at least one NPxY motif76. Each LDLR gene family member displays slightly altered affinities for the different apolipoprotein classes68. Thus, each lipoprotein receptor has a slightly different role in the clearance of the various classes of lipoproteins.  1.4.3 Lipoprotein Receptors and Cholesterol Synthesis In addition to the uptake of lipoproteins, the role of lipoprotein receptors in regulating intracellular cholesterol synthesis has been well defined. While cholesterol is important for many cellular processes, excess cholesterol within cells is toxic70. Genes involved with cholesterol synthesis are transcriptionally regulated to maintain cellular cholesterol levels in a tightly controlled range. Cholesterol biosynthesis is regulated by a feedback system, which integrates information from intracellular cholesterol levels with the availability of cholesterol in the circulation. This pathway is regulated by sterol regulatory element binding proteins (SREBPs), a family of membrane-bound transcription factors associated with the endoplasmic reticulum70. SREBPs regulate many  12  genes involved with cholesterol synthesis and cellular uptake78. In particular, SREBPs control transcription of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG CoA reductase), the rate-determining enzyme in the cholesterol synthesis pathway78. Statins are a popular class of drugs which inhibit HMG CoA reductase74. As HMG CoA reductase activity is reduced by statins, intracellular cholesterol synthesis decreases in the liver, resulting in increased production of lipoprotein receptors and clearance of cholesterol-rich lipoproteins from the bloodstream74. Overall, this results in a decrease in atherosclerotic plaque formation74. The effectiveness of statins for decreasing cardiovascular events has been well documented79. Thus, understanding the role of lipoprotein receptors and genes involved with cholesterol synthesis has yielded important treatment modalities for diseases involving dyslipidemia.  1.5  Role of Lipid Transport System in Energy Balance  Because obesity and hypertriglyceridemia often occur concurrently18, researchers have examined the molecules central to lipid metabolism for a role in regulating energy balance. Apolipoprotein a-IV (Apoa-IV), which is expressed in the liver, intestine, and hypothalamus, controls food intake and body weight through interaction with the hypothalamic melanocortin system80,81. Central infusion of another apolipoprotein, Apolipoprotein e (Apoe), caused reduced food intake in a dose dependent manner. Expression of Apoe transcripts decreases upon fasting and normalizes upon refeeding, and is also altered in states of diet-induced obesity and in ob/ob mice82. Intracerebroventricular (ICV) leptin administration blocks the effect of fasting on Apoe  13  transcript levels83. Figure 1.4 shows the interpretation of these results by researchers presented in a model of how Apoe is involved with leptin signaling. Apoe-/- mice gain less weight than wild-type mice when given a high-fat diet84,85. Improved glucose tolerance in Apoe-/- mice relative to Apoe+/+ mice was also reported after high-fat diet feeding85. This suggests that gene ablation of Apoe partially ameliorates the effects of high-fat diets on metabolic profile. Both the Ldlr and the LDL receptor-related protein-1 (Lrp1) are receptors for Apoe77. Transgenic mice lacking Lrp1 have an early embryonic lethal phenotype86. However, mice lacking Lrp1 specifically in adipose tissue are viable. These mice were found to have decreased body weight relative to wildtype mice when fed either a high-fat diet or a chow diet87. Adipose-tissue specific knock-down of mouse Lrp1 also improved glucose tolerance and increased EE. Increased muscle thermogenesis was thought to be the reason for increased EE87. However, Lrp1 adipocyte-specific knockout mice had substantial impairment in regulating body temperature87. From this evidence, the authors of this study suggested that Lrp1 in adipose tissue is an important regulator of energy homeostasis.  1.6 1.6.1  The Low-density Lipoprotein Receptor  Discovery of LDLR and Significance in Disease The LDLR was discovered by Drs. Joseph L. Goldstein and Michael S. Brown.  The study of the LDLR resulted in the emergence of “receptor-mediated endocytosis” as a new fundamental concept in cellular biology. The research by Drs. Goldstein and Brown on the regulation of cholesterol metabolism earned them the Nobel Prize in  14  Medicine in 1985. Mutations in LDLR cause the autosomal dominant human disease familial hypercholesterolemia (FH). Patients heterozygous for a non-functioning LDLR allele have a two-fold increase in LDL plasma levels and generally develop heart attacks before age 60 years74. Approximately one in one million individuals are homozygous for mutations in LDLR. FH homozygotes have between six- to eight- fold elevations in plasma LDL levels and generally develop heart attacks before age 20 years74. The LDLR gene is expressed ubiquitously, but highly in the liver and in the brain88,89. The LDLR is key for the clearance of lipids from circulation90,91 and has an affinity for LDL particles containing ApoB-100, and for VLDL particles and chylomicron remnants containing ApoE74 (refer to Table 1.2).  1.6.2 The Ldlr-/- Mouse The Ldlr-/- mouse was generated in 1991 by Ishibashi and colleagues92. Thus far, the Ldlr-/- mouse model has helped to elucidate basic processes of lipid metabolism and atherosclerosis. Hyperlipidemia and hypertriglyceridemia are major contributors to atherosclerosis in humans72, though mice are generally resistant to atherosclerosis71. Dietary challenges of levels of cholesterol as high as 1.25% (wt/wt) in mice resulted in only moderate levels of atherosclerosis and did not recapitulate the scenario in humans71,93. However, the generation of the Ldlr-/- mouse produced an excellent research model to study the development of atherosclerotic plaques. In Ldlr-/- mice fed a standard rodent chow diet (<0.04% wt/wt cholesterol), total plasma cholesterol levels were elevated twofold92. This elevation was due specifically to an increase in intermediate density lipoproteins (IDL) and LDLs, while HDLs levels remained unchanged92.  15  Research has shown that HDL cholesterol is protective against atherosclerotic plaque formation94. Thus the increase in serum cholesterol in Ldlr-/- mice was solely due to an increase in atherosclerosis promoting IDLs and LDLs. When Ldlr-/- mice were fed moderate levels of dietary cholesterol (0.2% wt/wt cholesterol), a threefold increase in IDL and LDL serum cholesterol levels and atherosclerotic plaque formation were observed in Ldlr-/- mice, which did not occur in Ldlr+/+ mice92. Since their publication, Ldlr-/- mice have become a model to test the effectiveness of therapeutics or nutritional regimes to decrease atherosclerosis71,95,96. The role of the Ldlr in energy balance has yet to be thoroughly assessed. Previous data has suggested that molecules involved in the apolipoprotein-lipoprotein system may be involved with maintaining energy balance80-83,87. However, the role of the Ldlr in the context of energy homeostasis pathways has yet to be explored. The Ldlr-/- mouse is an excellent opportunity to study the function that this major fat receptor may play in maintaining energy homeostasis. Besides understanding the direct role the Ldlr plays in energy balance, studies in the Ldlr-/- mouse can also serve as research model to understand the effect of impaired lipid transport or dyslipidemia on energy balance.  1.7 Review of the Ldlr-/- Mouse and Energy Balance 1.7.1  Energy Balance in the Ldlr-/- Mouse Experiments in this thesis focus on Ldlr-/- mice on a C57BL/6J strain  background. In this section, I will provide a brief review of how the Ldlr-/- mouse has been utilized to study energy balance, first with a review of the experiments and the phenotype of the ob/ob;Ldlr-/- double knockout mouse. Thereafter, I will review the  16  literature previously reported regarding body weight and energy balance phenotypes of the Ldlr-/- mouse.  1.7.2  Leptin Deficient Ldlr-/- Mice The basis for generating the ob/ob;Ldlr-/- double knockout mouse was to study  how obesity can further enhance defects of lipid transport97-100. Despite the fact that leptin deficient ob/ob mice and leptin-receptor deficient db/db mice develop severe obesity and dyslipidemia, ob/ob and db/db mice do not develop atherosclerotic lesions101,102. This is due to an increase in serum atheroprotective HDLs, as opposed to atherogenic LDLs94. In contrast, ob/ob;Ldlr-/- double knockout mice develop severe hypercholesterolemia, hypertriglyceridemia, and atherosclerosis that was similar to the phenotype found in Ldlr-/- mice97. VLDL clearance was further impaired in ob/ob;Ldlr-/- mice compared to Ldlr-/- mice97. In examining energy balance in ob/ob;Ldlr-/- double knockout mice, the authors of these studies found no detectable differences in body weight or adipose depot weights compared with the severely obese ob/ob mice98,103. Thus, it appears that in leptindeficient Ldlr-/- mice, the obesity observed can be attributed to loss of leptin, with the further loss of the Ldlr being insufficient to further alter the obese phenotype. Though the Ldlr may be involved with energy homeostasis, the Ldlr may function at a level downstream of leptin’s effects on energy balance and may not be detectable in ob/ob;Ldlr-/- double knockout mice.  17  1.7.3  Weight Gain in the Ldlr-/- Mouse Selected studies have investigated the energy balance phenotype in Ldlr-/- mice.  While Ldlr-/- mice have been reported to exhibit diet-induced weight gain and glucose intolerance with high-fat diet feeding, many of these reports have used Ldlr-/- mice exclusively without direct comparison to Ldlr+/+ mice97,104-107. In this thesis, I wish to address how the Ldlr may contribute to energy balance through comparing Ldlr-/- mice with Ldlr+/+ mice. I will first review the reports that have compared their energy balance phenotypes directly. Schreyer et al.108 examined the weight gain of Ldlr-/- mice relative to Ldlr+/+ controls when both genotypes were fed a high-energy diabetogenic diet (5.45 kcal/g: 27% kcal from carbohydrate and 56% kcal from fat) and found that Ldlr-/- mice gained more weight relative to wildtype controls after 16 weeks of feeding108. No differences were observed between Ldlr+/+ mice and Ldlr-/- mice in calories consumed or in dietary fat absorption during the period measured108. Ldlr-/- mice alone developed severe hypertriglyceridemia, hyperleptinemia, and atherosclerosis relative to Ldlr+/+ mice108. However, despite the severe obese and dislipidemic state of Ldlr-/- mice on the diabetogenic diet, fasting glucose and insulin levels were only moderately elevated in Ldlr-/- mice after 16 weeks on the diabetogenic diet108. During the collection of data for this thesis, a paper was published coincidentally examining the Ldlr-/- mice using the same diet as in my experiments. Karagiannides et al.85 examined weight gain in Ldlr-/- mice and Ldlr+/+ mice fed a “Western-type diet” (WTD) (4.5Cal/g, 42.7% kcal from carbohydrate and 42% kcal from fat) for 15 weeks85. The WTD is less energy dense than the diabetogenic diet used in the experiments by  18  Schreyer et al.108. Interestingly, this study found that Ldlr-/- mice gained less weight relative to wild-type mice on the WTD85, the opposite phenotype as described for Ldlr-/mice on the diabetogenic diet108. In terms of glucose tolerance and insulin sensitivity, Ldlr-/- mice on the WTD were found to have a slightly improved metabolic profile than wild-type mice85. In this study, Apoe-/- mice were found to gain less weight on the WTD than Ldlr-/- mice and wild-type mice, whereas Apoe3 knock-in mice gained more weight than wild-type mice on the WTD. Because Ldlr is a major receptor for Apoe, and Ldlr-/mice demonstrated an intermediate phenotype between wild-type mice and Apoe-/animals, the authors of this study hypothesized that the Ldlr mediates some of the effects of Apoe on energy balance85. The activity of other receptors which also have an affinity for Apoe (see Table 1.2) likely account for the observed differences between the Apoe-/and Ldlr-/- mouse models85.  1.7.4  Conclusions from Reports of Weight Gain in Ldlr-/- Mice The observed differences in weight gain between Ldlr-/- mice fed each of these  high-fat diets suggest that Ldlr gene knockout alters susceptibility to diet-induced obesity, but in a manner that depends on the energy density and macronutrient content of the diet. Regardless of inconsistencies among reports, current evidence from studies with the Ldlr-/- mouse suggests that signaling through Ldlr may modulate aspects of energy balance. However, in-depth studies of obese and diabetic phenotypes in Ldlr-/- mice are required to elucidate this relationship more fully. Studies have shown that an absolute increase in energy consumption is not a requirement for weight gain on high-fat diets109. Animals fed high-fat diets may consume less energy than animals fed low-fat diets and  19  still gain more weight, an effect attributable to a concomitant decrease in EE provoked by energy dense high-fat diets. Since increased caloric consumption has not been reported in Ldlr-/- mice relative to wild-type mice, it is possible that different types of high-fat diets affect the EE of Ldlr-/- mice differently than Ldlr+/+ mice.  1.7.5  Other Energy Balance Phenotypes of the Ldlr-/- Mouse Physical activity is an important contributor to total EE in animals110. A study by  Edler et al.111 examined the behavioural and developmental phenotype of Ldlr-/-111. The authors of this study rationalized that because Ldlr is expressed in the brain, Ldlr deficiency might affect behaviour. While Ldlr-/- mice did not show deficits in spatial memory or major developmental defects, activity levels were increased in Ldlr-/- mice111. This suggests that Ldlr may be involved in central regulation of activity, a significant source of EE in animals. In addition to the differences in body weight gain reported in Ldlr-/- mice, impaired glucose tolerance in Ldlr-/- mice relative to Ldlr+/+ mice has been reported with high-fat diet feeding108,112. Adiposity is known to have a profound impact on insulin sensitivity113. Thus, I hypothesized that if Ldlr-/- mice have altered weight gain in response to energy dense diets, insulin sensitivity would also be affected by knockout of the Ldlr gene. 1.8  Rationale for Hypothesis  Thus far, research suggests a role of lipoprotein transport molecules in control of appetite and leptin signaling. My hypothesis is that the Ldlr is an important regulator of energy balance. The Ldlr is a strong candidate for mediating the lipid transport system’s  20  effects on energy balance because: 1) the Ldlr has a significant role in the clearance of lipoproteins from circulation and 2) the Ldlr has a high affinity for Apoe, which has anorectic effects when administered to rodents. The Ldlr-/- mice used in my experiments were from a congenic inbred strain. Such strains provide an excellent means to study the effects that removal of a single gene can have on physiology, as the contribution of genetic variability at other loci is minimized. While the Ldlr-/- mouse has been tested extensively as a model for atherosclerosis, the energy balance phenotype of this mouse model has not been thoroughly examined. Particularly, characteristics important to energy balance such as food intake and EE have not been thoroughly studied. In this thesis, I examined the phenotype of Ldlr-/- mice on a standard rodent chow diet and on a WTD. Using the methods described in Chapter II, I surveyed energy balance in Ldlr-/- mice. Initially, Ldlr-/- mice were characterized while consuming a “standard” laboratory chow diet to identify baseline differences between Ldlr-/- mice and Ldlr+/+ mice in the absence of a high-fat diet challenge. I next analyzed Ldlr-/- mice on a WTD to elucidate how Ldlr-/- mice respond when challenged with an energy dense diet. Data on weight gain, body composition, EE, and glucose homeostasis was collected. These results are presented in Chapter III. In addition, I examined circulating leptin levels and leptin responsiveness, results which are presented in Chapter IV.  21  Table 1.1. Neuropeptides implicated in the control of energy homeostasis. Molecule OREXIGENIC NPY* Agrp* MCH Hypocretin 1 and 2/orexin A and B Galanin Noradrenaline ANOREXIGENIC α-MSH* CRH* TRH* Cart IL-1β* Urocortin* Glucagon-like peptide 1 Oxytocin Neurotensin Serotonin  Regulation by leptin ↓ ↓ ↓ ↓ ? ? ↑ ↑ ↑ ↑ ↑ ? ? ? ? ?  Orexigenic molecules promote increased energy intake, anorexigenic molecules promote the opposite effect. An asterisk designates documented, coordinated effects on both food intake and energy expenditure that promotes a change in energy stores. Arrows indicate direction of effect exerted by leptin. This table is from Schwartz et al., 2000., used with permission from the Nature Publishing Group.  22  Table 1.2. Properties of the seven LDL receptor family members. Receptor  Ligands  Functions  Mutational Phenotypes  LDL receptor  ApoB, ApoE  Lipoprotein/cholesterol uptake  Familial hypercholesterolemia, atherosclerosis, heart disease  LRP  ApoE, α2-macroglobulin, plasminogen activators, protease/inhibitor complexes, lipase, amyloid precursor protein  Lipoprotein and protease uptake, synaptic transmission, modulation of amyloid precursor protein processing?  Conventional knockout is early embryonic lethal; liver specific knockout viable, lipoprotein clearance defect  Megalin  ApoB, ApoE, proteases and inhibitors, carrier proteins for lipophilic vitamins, parathyroid hormones  Embryonic cholesterol homeostasis?, Ca2+homeostasis, required for forebrain development,  Holoprosencephaly, vitamin D deficiency  ApoE, Reelin  Cortical lamination, neuronal migration, predominant Reelin receptor in the cerebellum  Rostral cerebellar foliation defects  ApoER2  ApoE, Reelin  Cortical lamination, neuronal migration, predominant Reelin receptor in the neocortex  Severe cortical and hippocampal lamination defects, vldlr/aper2 double mutants are phenotypically indistinguishable from reeler mice  LRP1B  Unknown, ApoE binding likely  MEGF7  Unknown, ApoE binding likely  VLDL receptor  Frequently deleted in tumors, role in tissue remodeling and metastasis? Expression in the brain suggests possible roles during development and maintenance of the CNS  Unknown  Unknown  Table adapted from Herz, 2001  23  Figure 1.1. Control of energy homeostasis by arcuate nucleus neurons. Two sets of neurons in the arcuate nucleus — Agrp/Npy and Pomc/Cart neurons — are known to be regulated by circulating hormones. Agrp (agouti-related protein) and Npy (neuropeptide Y) are neuropeptides that stimulate food intake and decrease energy expenditure, whereas alpha-melanocyte stimulating hormone (a post-translational derivative of proopiomelanocortin, Pomc) and Cart (cocaineand amphetamine-regulated transcript) are neuropeptides that inhibit food intake and increase energy expenditure. Leptin is a hormone that circulates in proportion to body adipose stores; it inhibits Agrp/Npy neurons and stimulate adjacent Pomc/Cart neurons. This figure is adapted from Barsh & Schwartz, 2002., used with Nature Publishing Group's permission.  24  Figure 1.2. Humoral factors affecting energy balance. Adipose tissue, pancreas, and stomach produce humoral factors which affect the overall energy balance phenotype of animals. Adipose tissue produces leptin, adiponectin, TNF-α, and IL-6. The pancreas produces insulin. The gastrointestinal tract produces ghrelin and CCk. These images are adapted from Barsh & Schwartz, 2002., used with Nature Publishing Group's permission.  25  Figure 1.3. Schematic representation of the seven mammalian LDL receptor (LDLR) family members. Each LDLR member contains one or more ligand binding domains, epidermal growth factor (EGF)-precursor like propeller domains, a single transmembrane segment, and a cytoplasmic tail containing one or more NPxY motifs. The latter serves as both endocytosis signals and docking sites for adaptor proteins that couple the receptors to intracellular signaling pathways. This figure is from Beffert et al., 2004.  26  Figure 1.4.  Model for the interaction of Apoe with leptin and Pomc in the control of food intake and body weight. This figure is a model hypothesized by Shen et al., 2009 and is used with permission. Apoe gene expression in the hypothalamus is stimulated by leptin. The secreted Apoe is hypothesized to bind its receptors located on Pomc neurons and stimulate Pomc gene expression, resulting in more α-MSH cleaved and released. The secreted α-MSH presumably binds to MC3/4 receptors and consequently reduces the food intake and body weight.  27  CHAPTER 2: Materials and Methods 2.1 2.1.1  Introduction to the Study of Energy Balance  Energy Balance To study the interaction between lipid metabolism and energy homeostasis, the  Ldlr-/- mouse strain was used as an animal model for dyslipidemia. The overall aim of these experiments was to investigate the effect of deletion of the mouse Ldlr gene on energy balance. Both physiological measurements and molecular biological techniques were employed to compare Ldlr-/- mice to wildtype Ldlr+/+ mice. From these results, the impact on energy homeostasis due to the loss of an important receptor for lipoprotein clearance can be elucidated. Total energy usage, energy intake, and energy stored were analyzed to obtain a global understanding of the energy balance phenotype in Ldlr-/mice. The energy balance status of an animal can be expressed mathematically by the simple equation: Energy Intake = Energy Expenditure + Energy Stored Based on this equation derived from the First Law of Thermodynamics23, the energy which is accumulated by the animal in adipose stores is a result of excess energy intake relative to energy use23. However, because organisms have evolved to compensate for perturbations to homeostasis, the above variables are not independent in biological systems. For instance, should ingested calories decrease, most animal systems respond with a compensatory decrease in EE. Thus, energy balance is not static, but depends on  28  continuous feedback systems that respond to the body’s energetic status, needs, and demands23. 2.1.2  Energy Expenditure The total energy expended by an animal is largely accounted for by its resting  metabolic rate (RMR)110. RMR refers to the energy required to maintain basal level of functioning when the animal is well-rested, fasting, and in a thermoneutral environment110. The RMR represents the most minimal amount of energy that is used to preserve the cells comprising an individual. In addition to RMR, total energy expended by an animal is affected by the activity level of the animal and by adaptive thermogenesis23. The process of adaptive thermogenesis involves physiological adjustments to maintain body temperature in cold environments, as well as the thermic effect of food (TEF). TEF describes the phenomenon of increased heat production observed in animals after consumption of a meal110. The methods described below used an open-circuit indirect calorimetry system to determine total EE in mice.  2.1.3  Energy Intake The total energy consumed was also examined in mice. While the absolute  number of calories consumed is important, total energy intake, EE, and energy balance are also strongly affected by macronutrient composition of diets114. Therefore, the effect of variation in macronutrient diet composition was tested on Ldlr-/- mice, in order to study whether impaired lipid transport might alter the usual responses elicited by a highfat, high-carbohydrate diet. In addition, to address absorption of calories from diet  29  consumed, caloric content of fecal matter was examined to ensure that ingested calories correlated with calories absorbed in Ldlr-/- mice relative to wildtype controls.  2.1.4  Energy Stored Animals store energy in order to prepare for times of energy deprivation23. Energy  storage results from a higher level of energy intake than energy expenditure. The amount of energy stored by an organism is sensitive to cumulative effects. Therefore, even a small increase in energy consumed over energy used can have major consequences on energy balance if this discrepancy is chronic23. Obesity manifests in cases where excessive energy stored in fat depots becomes serious enough to pose a risk for health. To examine total energy stored in mice, scale weight measurements as well as body composition data were collected from Ldlr+/+ mice and Ldlr-/- mice. Body composition was determined using quantitative magnetic resonance (QMR) technology, a technique which provides quantitative information on the total lean muscle mass and the total body fat mass stored in individual animals115.  2.1.5 Further Indicators of Energy Balance The association between obesity and type 2 diabetes is widely recognized and obesity is known to contribute to insulin resistance and hyperinsulinemia113. Glucose clearance and insulin sensitivity are crucial indicators of metabolic functioning. Thus, in addition to measures of energy balance, physiological data on glucose homeostasis were obtained from Ldlr-/- mice. Response to leptin administration in Ldlr-/- mice was also evaluated. Leptin is an important hormone regulating glucose homeostasis and energy  30  balance, and leptin responsiveness may serve as an indicator of leptin pathway functioning in Ldlr-/- animals. Furthermore, serum protein levels and gene expression levels of molecules important in the regulation of energy balance were studied.  2.2  Experimental Animals and Diets  Ldlr+/+ mice and Ldlr-/- mice on a C57BL/6 background (Jackson Laboratories, Stock Nos. 000664 and 002207) were housed under a standard 12-hour light/dark cycle. Male mice were used in experiments to avoid possible confounding effects of estrous cycling. Separate cohorts of mice were analyzed at 10 weeks age and at 18 weeks age from each genotype. All mice were weaned onto a standard rodent chow diet (5P76, Research Diets, New Brunswick, NJ: 3.46 kcal/g of diet, 14%kcal from fat, 26.0% kcal from protein, and 60.0% kcal from carbohydrates). For cohorts of mice analyzed at 18 weeks age, mice were either maintained on the chow diet or switched at 10 weeks age to a Western-Type diet (TD.88137 Harlan Teklad, Madison, WI: 4.5 kcal/g of diet, 42.0% kcal from fat, 15.2% kcal from protein, 42.7% kcal from carbohydrate). During periods of diet exposure, mice were housed in groups of three to five animals per cage, and weight gain was documented weekly. Animals were transitioned from group-housing to single housing at least three days before placement in metabolic cages, so that they would be pre-acclimatized prior to metabolic studies (see below). Mice were sacrificed via rapid cervical dislocation and organs were dissected out, weighed, and snap-frozen in liquid nitrogen. All procedures were performed according to guidelines and with the approval of the University of British Columbia Animal Care Committee.  31  2.3 2.3.1  Characterization in Metabolic Chambers  Metabolic Chambers Ldlr+/+ mice and Ldlr-/- mice were placed in metabolic cages designed to mimic  the home-cage environment (LabMaster, TSE Systems, Germany), and were provided with nestlet bedding material. It was necessary to house animals singly to obtain accurate measurements of respiratory exchange ratio (RER), EE, activity levels, and food intake on individual mice. Metabolic cages were located at the Child and Family Research Institute Animal Facility. In total, eight metabolic cages were housed in a temperature control unit, with the capacity to regulate temperatures between 0ºC and 40ºC. Ambient room temperature was maintained between 24ºC – 25ºC. Animals were allowed at least one dark phase to acclimatize to the metabolic cage conditions; continuous monitoring graphs in this thesis display this initial acclimatization period. All calculated values for RER, EE, resting energy expenditure (REE), activity, and food intake only use measurements obtained post-acclimatization.  2.3.2  Indirect Calorimetry O2 consumption and CO2 production were measured via an open-circuit indirect  calorimetry system, with sensors sampling air from each cage once every fifteen minutes. RER, an indicator of fuel metabolism, was calculated from the ratio of VCO2 (ml/hr) produced to VO2 (ml/hr) consumed116. EE per gram of lean body mass (kcal/kg/hr) was calculated from the equation: VO2 * [3.815 + 1.232 * RER] * 0.001 / lean body mass (kg)116. (Lean body mass was quantified by QMR – see below). REE was estimated from the average of the five lowest EE recordings for each animal during the light phase117.  32  2.3.3  Activity Levels Infrared beams along the x, y, and z axis of metabolic cages collected data on  activity levels. Activity was assayed by automatic recording of infrared beam breakage by animals traveling within their cages. Repeated breakage of the same beam was defined as fine movement. Consecutive breaking of adjacent beams was defined as locomotor activity. Absolute number of beam breaks was recorded automatically.  2.3.4 Food and Water Intake Food intake and water intake were monitored through weight sensors directly associated with food baskets and water holders. The weights of the food and water holders in each metabolic cage were recorded automatically every fifteen minutes. Food and water intake were inferred from the recorded change in weight. The bottoms of the cages were examined daily to document unconsumed food or water that had been removed from the baskets.  2.3.5  Thermogenesis and Cold Challenge Body temperature was monitored continuously by temperature transmitters (Mini-  Mitter, Bend, OR) implanted under the skin in the interscapular region in Ldlr+/+ and Ldlr-/- mice. For the implantation surgery, animals were anesthetized using gaseous isofluorane. Body temperature transmitters were inserted into the subcutaneous tissue through a 0.5 cm incision, which was closed via sutures. Animals were given at least two days to recover after the surgery before body temperature was recorded. With the body temperature transmitters implanted, mice were also subjected to a cold-challenge  33  experiment. Mice were placed in the temperature control unit, set to maintain temperature at 4°C. Thermogenic adaptation to this temperature was observed over a four hour period.  2.4  Body Composition  Total body composition was measured in live conscious animals using QMR technology, which distinguishes differential proton states between lipids, lean tissues, and free water (EchoMRI-100 Echo Medical Systems, Houston, TX)115. Conscious animals were placed individually in the QMR system for approximately one minute while the machine collected body composition data. Lean mass and fat mass were quantified, and residual mass was calculated by subtracting the lean and fat mass QMR readings from the total scale weight of the animal.  2.5  Serum Protein Concentrations  Blood was collected either through the saphenous vein after a four-hour fast or through a cardiac puncture and allowed to clot at room temperature for 15 minutes. Serum was extracted after centrifugation at 3000 rpm for 10 min and stored at –20ºC. Samples were tested for leptin and insulin levels using enzyme linked immunosorbent assays (ELISA, ALPCO Salem, NH) within one month of collection. The insulin ELISA (Cat# 90080) and leptin ELISA (Cat# 90030) were used according to manufacturer’s protocol.  34  2.6  Energy Content of Mouse Fecal Matter  Direct calorimetric analysis of Ldlr+/+ and Ldlr-/- mouse fecal matter was conducted using the 1241 Oxygen Bomb Calorimeter (Parr Instrument Company, Moline, IL). Mouse fecal matter was frozen upon collection. Before calorimetric analysis samples were dried at room temperature for at least three days. Standardization of the bomb calorimeter was conducted using one gram benzoic acid pellets (Fisher Scientific, Waltham, MA). Butanol was used as an accelerant for the reaction. Approximately 300 mg of fecal sample and 200ul of butanol were used in each combustion reaction. The sample was placed in the bomb in association with the fuse wire. The bomb was then immersed in exactly one liter of water. Baseline water temperature was recorded for six minutes prior to ignition and deemed stable. Post-ignition, the temperature of the water was recorded for 10 min. Samples were examined following each reaction to ensure complete combustion had occurred. The interior of the bomb was then washed with distilled water. The washings were titrated with 0.0709N sodium carbonate solution using methyl red as an indicator. Titrating the washings of the interior surface of the bomb allowed for quantification of nitric acid formed during combustion. The energy of the sample was calculated using the following equation:  Hg = tW – e1 – e2 - Hbut m  Hg  =  gross heat of combustion (calories per gram)  t  =  net temperature rise recorded  35  W  =  energy equivalent of the calorimeter, as determined through standardization through benzoic acid pellets.  e1  =  correction in calories for heat of nitric acid formation  e2  =  correction in calories for heat of combustion of fused wire  Hbut =  heat from combustion of 200ul of butanol.  m  dry fecal mass (g)  =  2.7  Glucose Homeostasis  Intraperitoneal glucose tolerance tests (IPGTTs) and insulin tolerance tests (IPITTs) were conducted in Ldlr-/- mice to examine glucose homeostasis. Group-housed Ldlr+/+ and Ldlr-/- mice were fasted for four hours prior to IPGTTs and IPITTs118. For both tests, blood glucose was measured at baseline and at 15 min, 30 min, 60 min, 90 min, and 120 min post injection using a standard glucometer (Breeze Glucometer Bayer, Toronto, Ontario). For all glucose measurements, animals were restrained and a blood droplet was isolated from the saphenous vein and analyzed with the glucometer. For IPGTTs, 50% dextrose solution (anhydrous dextrose, Fisher Scientific, Waltham, MA) was injected at a dose of 1.5g/kg of body weight. For IPITTs, insulin (Novolin ge Toronto, Novo Nordisk Canada Inc., Mississauga, ON) was injected at a dose of 0.75U/kg of body weight.  2.8  Quantifying Physiological Response to Leptin Administration  To allow animals to become accustomed to temporary restraint, mice were routinely handled for one month prior to the start of these physiological studies. All injections were administered one hour before the dark phase. Animals were sham injected  36  for four days prior to treatment injections. Thereafter, animals were injected with either 2µg/g of mouse recombinant leptin (Peprotech, Rocky Hill, NJ) or an equal volume of saline vehicle each day for two days. Mice were then allowed four days to recover to baseline conditions, during which time sham injections continued. Subsequently, mice received two consecutive days of the crossover treatment. Mice were weighed daily and housed in metabolic cages (see above) during treatment days. Each saline-treated animal acted as its own control for analysis of this crossover experiment.  2.9  Quantitative Reverse-Transcriptase Polymerase Chain Reaction  RNA isolation was performed using the RNeasy Mini-kit (Qiagen, Germantown, MD) following manufacturer’s instructions. A Nanodrop2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, MA) was used to check RNA purity (A260/A280 ratio between 1.9 – 2.1) and concentration. Quality of the RNA was also confirmed via agarose gel electrophoresis and visual confirmation of intact 18S and 28S rRNA bands. cDNA was synthesized using the RT-Transcribe Kit (Invitrogen, Carlsbad, CA), and was again checked using the Nanodrop2000c for concentration and purity (A260/A280 ratio between 1.7 – 1.9). All quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) primers are listed in Table 2.1. Proper efficiency of all primers (Invitrogen, Carlsbad, CA) was examined by generating a standard curve using serial dilutions of cDNA sample. qRT-PCR was performed using the ABI3500 Fast Machine (Applied Biosystems, Carlsbad, CA). qRT-PCR was set up using the Express SYBR GreenER master mix (Invitrogen, Carlsbad, CA). All primer reactions required an annealing temperature of 62ºC. The presence of non-specific PCR products was ruled out using  37  melt-curve analysis for every reaction. Expression of genes relative to β-actin was determined using the ΔΔCt method119.  2.10  Statistics  t-tests were used for standard comparison of two groups. One-way ANOVAs and two-way ANOVAs were conducted with Bonferroni post-tests to account for multiple testing. Repeated-measures ANOVA statistics were used for leptin responsive experiments, IPGTTs, IPISTs, and data generated in the metabolic cages. Calculated pvalues less than 0.05 were chosen to be considered significant.  38  Table 2.1. Primers for qRT-PCR. Gene  Forward Primer  Reverse Primer  Product Size  β-actin  ACGGCCAGGTCATCACTATTG  CAAGAAGGAAGGCTGGAAAAGA  70  Leptin  GAGACCCCTGTGTCGGTTC  CTGCGTGTGTGAAATGTCATTG  139  Ucp1  AGGCTTCCAGTACCATTAGGT  CTGAGTGAGGCAAAGCTGATTT  133  Npy  CGCCACGATGCTAGGTAACA  GCCAGAATGCCCAAACACA  84  Pomc  ATGCCGAGATTCTGCTACAGT  TCCAGCGAGAGGTCGAGTTT  170  Ldlr  GTTGACGGCTCCCATGAGTG  GTCCTTGCAGTCTGCCTCG  156  Apoe  AACAGACCCAGCAAATACGCC  CTCATTGATTCTCCTGGGCC  154  All primers displayed 5’Æ 3’.  39  CHAPTER 3: Energy Balance in the Ldlr-/- Mouse  3.1 3.1.1  Energy Balance of Ldlr-/- Mice on Chow  Ldlr-/- Mice at 10 Weeks Age Mice with genotypes of either Ldlr+/+ or Ldlr-/- were originally ordered from  Jackson Laboratories and were maintained in breeding colonies at the CFRI Animal Research Facility, as described in Chapter II. A cohort of male Ldlr+/+ and Ldlr-/- mice were analyzed in metabolic cages at 10 weeks of age, after bone maturation and sexual maturity had been reached120. At this age, no differences in body weight or body composition were detected between knockout mice and wild-type mice (Figure 3.1A). However, continuous monitoring of food intake in the metabolic cages revealed that Ldlr-/- mice consumed 9% fewer calories of the standard chow diet than Ldlr+/+ mice (Figure  3.1B)  (Ldlr+/+:  3.90g/mouse/day,  Ldlr-/-:  3.57g/mouse/day,  p=0.02).  Additionally, despite no differences in body weight REE and dark phase EE was slightly reduced in Ldlr-/- mice (Figure 3.2A & B). RER and activity levels, both fine and locomotor, were not different between the Ldlr-/- mice and Ldlr+/+ mice at this age (Figure 3.2C, D, & E). Fasting blood glucose levels and glucose tolerance in Ldlr-/mice were also not different from Ldlr+/+ mice at 10 weeks of age (Figure 3.3).  3.1.1  Ldlr-/- Mice on a Chow Diet at 18 Weeks Age In a different cohort of Ldlr+/+ or Ldlr-/- mice, animals were maintained in  group-housed conditions on the chow diet until 18 weeks of age. At 18 weeks, the mice were analyzed in the QMR machine and in the metabolic cages. Ldlr-/- mice did not  40  weigh differently from Ldlr+/+ mice and total lean mass and total fat mass were also not significantly different at this age (Figure 3.4A). Dissected epididymal fat pads weighed less in Ldlr-/- mice, but inguinal fat pad weights did not differ between knockout and wildtype animals (Figure 3.4B). Interestingly, average interscapular brown fat pads of Ldlr-/- mice weighed more than those of Ldlr+/+ mice (Figure 3.4C). In addition, decreased food intake in Ldlr-/- mice, which was observed at 10 weeks of age, was further decreased to 40% fewer calories than Ldlr+/+ mice at 18 weeks of age (Figure 3.4D, Ldlr+/+: 3.80g/mouse/day, Ldlr-/-: 2.28g/mouse/day). Indirect calorimetric analysis showed that REE was decreased in Ldlr-/- mice (Figure 3.5A). Continuous monitoring of oxygen use and carbon dioxide production showed that Ldlr-/- mice had decreased EE in the light and dark phase relative to Ldlr+/+ mice (Figure 3.5B). RER was decreased in Ldlr-/- mice in the dark phase (Figure 3.5C). As well, Ldlr-/- mice had increased fine movement and locomotor activity in the day time (Figure 3.5D & E). In a separate cohort of Ldlr+/+ and Ldlr-/- mice fed a chow diet, fasting glucose levels were measured at 24 weeks of age. Fasting glucose levels were not different in Ldlr-/- mice than in Ldlr+/+ mice (Figure 3.6A). In addition, IPGTTs performed in group-housed animals showed no differences in glucose clearance between Ldlr+/+ mice and Ldlr-/- mice on the chow diet (Figure 3.6B).  3.2 3.2.1  Ldlr-/- Mice Gain Less Weight on WTD  Acute Response to WTD Feeding Next, the response of Ldlr-/- mice fed a WTD was examined. A group of Ldlr+/+  mice and Ldlr-/- mice that were weaned onto the chow diet at approximately three weeks  41  of age were switched WTD starting at 10 weeks of age. Acute responses to the WTD were monitored using metabolic cages. The 10-week old mice were placed in the metabolic cages and allowed four days to acclimatize before the standard rodent chow diet was removed and replaced with the WTD. In the first day following the switch, both genotypes consumed more calories per day compared to the prior chow-feeding day (Figure 3.7A & B). Analysis of each individual day following the switch to WTD feeding revealed that the initial increase in caloric intake occurs in the first day of WTD feeding. Caloric intake on WTD gradually declines to previous levels (on chow) by day 4 after the switch to WTD feeding (Figure 3.7B). While the initial caloric consumption on a chow diet was significantly lower in Ldlr-/- mice relative to Ldlr+/+ mice, after WTD feeding began the caloric consumption became equal between the genotypes. Ldlr-/- mice were consuming the same number of calories as did Ldlr+/+ mice within the first 4 days of WTD feeding (Figure 3.7C – data from Figure 3.7B re-graphed for comparison). Data from the metabolic cages during the initial switch to WTD also showed that indirect calorimetry parameters were significantly altered by acute exposure to WTD in both Ldlr+/+ and Ldlr-/- mice: Light phase EE was increased in both genotypes following WTD exposure, suggesting partial compensation by homeostatic responses to energy dense diets (Figure 3.8A). Dark phase EE was also affected with acute diet switch in Ldlr+/+ and Ldlr-/- mice (Figure 3.8A). Average light phase RER was increased in both Ldlr+/+ and Ldlr-/- mice in second day of WTD feeding, but was lowered to preWTD RER by the third day of WTD (Figure 3.8B). Very acute decreases in dark phase locomotor and fine movement activity levels were also observed in both genotypes immediately following diet switch (Figure 3.9A & B).  42  3.2.2  Response to Chronic WTD Feeding Ldlr-/- mice weighed significantly less than controls after just five weeks  exposure to the WTD (Figure 3.10A). After eight weeks on the WTD, Ldlr-/- mice weighed significantly less; this difference in body mass was attributable to a specific failure to gain fat mass, with lean mass and residual mass not differing between the two genotypes (Figure 3.10B). Dissection of visceral and inguinal fat pads showed that both white adipose depots were significantly reduced on the WTD in Ldlr-/- mice (Figure 3.10C). However, interscapular brown adipose tissue weights did not differ between Ldlr-/- mice and Ldlr+/+ mice after exposure to the eight weeks of WTD feeding (Figure 3.10D). To test whether the failure of Ldlr-/- mice to gain weight on WTD was due to malabsorption of nutrients, direct calorimetry to determine energy content of fecal matter in Ldlr+/+ mice and Ldlr-/- mice was performed with the assistance of W. Quong. The energy content of fecal matter did not differ between the two genotypes (Figure 3.10E). After chronic WTD exposure, food intake of Ldlr-/- mice was identical to controls. After eight weeks, Ldlr+/+ and Ldlr-/- mice had similar total energy intakes on the WTD (Figure 3.10F). REE and total EE were reduced in Ldlr-/- mice fed the WTD (Figure 3.11A & B). However, a difference in response to the WTD was detected between the genotypes. 18-week old Ldlr+/+ mice fed the WTD for eight weeks had an average dark phase EE of 26.18 kcal/hr/kg (Figure 3.11B), while Ldlr+/+ mice fed chow had an average dark phase EE of 22.80 kcal/hr/kg (Figure 3.5B). This signifies a 14.8% increase in EE caused by WTD feeding which was not significantly different (p>0.05 with Bonferroni post-test). Ldlr-/- mice fed the WTD for eight weeks had an average dark phase EE of 22.33 kcal/hr/kg (Figure 3.11B), while Ldlr-/- mice fed chow had an  43  average dark phase EE of 16.52 kcal/hr/kg (Figure 3.5B). This signifies a 35.2% increase in EE caused by WTD feeding in Ldlr-/- mice, a difference that was statistically significant (p<0.01 with Bonferroni post-test). No differences in RER or activity levels were seen between Ldlr-/- mice and wildtype mice after WTD feeding (Figure 3.11C, D, & E). Because I detected differences in body weight and white adipose tissue mass without significant differences in food intake or energy expenditure between knockout and wildtype animals, thermogenesis was examined in Ldlr-/- mice. In a new group of mice fed the WTD for 2-6 weeks, body temperature transmitters were implanted subcutaneously in the interscapular region. Thereafter, the mice were placed singly housed in the metabolic cages to monitor body temperature. This monitoring showed that Ldlr-/- mice had a higher average body temperature than did Ldlr+/+ mice during the dark phase (Figure 3.12A). After three days of monitoring body temperature, mice were exposed to a 4°C cold challenge experiment for four hours. During exposure to 4°C, no differences in ability to regulate body temperature were observed between Ldlr-/- mice and Ldlr+/+ mice (Figure 3.12B). With differences in brown adipose tissue (Figure 3.4C) and differences in thermogenesis (Figure 3.12A) observed between Ldlr+/+ and Ldlr-/- mice, the functioning of brown adipose tissue thermoregulation in Ldlr-/- was studied next. Uncoupling protein 1 (Ucp1) is a mitochondrial inner-membrane protein expressed in brown adipose tissue and is important for thermogenesis in brown fat121. Ucp1 functions to decouple the proton transport chain from the ATP synthesis121; thus, energy is dissipated in the form of heat as opposed to ATP generation. To examine whether brown-adipose tissue thermogenesis was different in Ldlr-/- mice, brown adipose  44  expression of Ucp1 was examined using qRT-PCR. Expression levels of Ucp1 in brown adipose tissue were not different between Ldlr-/- mice and Ldlr+/+ mice (Figure 3.12C). I also examined glucose homeostasis after WTD feeding in 24 week old mice. Ldlr-/- mice had significantly lower fasting glucose levels relative to wildtype mice after 14 weeks WTD exposure (Figure 3.13A). IPGTTs showed that Ldlr-/- mice cleared exogenous glucose from circulation more readily than Ldlr+/+ mice (Figure 3.13B). Fasting insulin levels in Ldlr-/- mice were significantly higher than in wildtype mice, suggesting improved insulin secretion may be the mechanism for improved glucose tolerance (Figure 3.13C). However, IPITTs showed no differences in global insulin sensitivity (Figure 3.13D).  45  Figure 3.1:  Body weight and food intake in 10-week old Ldlr-/- mice on chow. A. Body weight and body composition of 10-week old mice did not differ between wildtype and Ldlr-/- mice. B. Continuous monitoring of food intake showed that Ldlr-/- mice consumed slightly fewer calories (9%) relative to Ldlr+/+ mice. Grey bars represent the dark phase. n=6 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. *p<0.05. Data represent mean ± SEM.  46  Figure 3.2: Energy expenditure in 10-week old Ldlr-/- mice on chow. Ldlr-/mice had lower resting energy expenditure (A) and energy expenditure (B) than wildtype mice. Respiratory exchange ratio (C), locomotor activity (D), and fine movement (E) was not different between genotypes. Grey bars represent the dark phase. n=6 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. *p<0.05, **p<0.01. Data represent mean ± SEM.  47  Figure 3.3:  Glucose homeostasis of 10-week old Ldlr-/- mice on a standard chow diet. A. Fasting serum glucose levels were not different between Ldlr-/- mice and wildtype mice at 10-weeks of age. B. IPGTTs showed no differences in glucose clearance at 10 weeks of age between the two genotypes. n=5 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. Data represent mean ± SEM.  48  Figure 3.4: Body composition and food intake in 18-week old Ldlr-/- mice on chow. A. Body weight and body composition of 18-week old mice did not differ between Ldlr+/+ and Ldlr-/- mice. B. Weights of the epididymal visceral fat pad and inguinal subcutaneous fat pad dissected from mice. C. Weights of the interscapular brown fat pad dissected from mice, showing increased brown fat mass in Ldlr-/- mice. D. Continuous food intake monitoring demonstrated that Ldlr-/- mice consumed significantly less calories relative to Ldlr+/+ mice. Grey bars represent the dark phase. n=4 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. Data represent mean ± SEM. *p<0.05, ***p<0.001.  49  Figure 3.5: Energy expenditure in 18-week old Ldlr-/- mice fed chow. The energy balance phenotype of Ldlr+/+ mice and Ldlr-/- mice at 18 weeks of age was analyzed. Grey bars represent the dark phase. Ldlr-/- mice showed decreased resting energy expenditure (A), decreased energy expenditure (B), and decreased RER (C). Locomotor activity (D) and fine movement (E) were also increased in Ldlr-/- mice at this age. n=4 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. *p<0.05, **p<0.01, ***p<0.001. Data represent mean ± SEM.  50  Figure 3.6: Glucose homeostasis of 24-week old Ldlr-/- mice on chow. A. Fasting serum glucose levels were not different between Ldlr-/- mice and wildtype mice at 24 weeks of age. B. IPGTTs showed no differences in glucose clearance at 24 weeks of age between the two genotypes. n=5 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. Data represent mean ± SEM.  51  Figure 3.7: Food intake of Ldlr-/- mice acutely exposed to WTD at 10-weeks. A. Continuous food intake monitoring of Ldlr+/+ and Ldlr-/- mice when chow diet was switched to WTD (arrowed line). Grey bars represent the dark phase. B. Comparison of caloric consumption in Ldlr+/+ mice and Ldlr-/- mice over the first four days of WTD feeding. C. Comparison of caloric consumption between Ldlr+/+ mice and Ldlr-/- mice during the first four days of WTD feeding. n=4 for Ldlr+/+ mice, n=6 for Ldlr-/mice. *p<0.05, ***p<0.001. Data represent mean ± SEM.  52  Figure 3.8: Energy expenditure in Ldlr-/- mice acutely exposed to WTD at 10weeks. Continuous monitoring of energy expenditure and RER was conducted when Ldlr+/+ and Ldlr-/- mice were switched from a chow diet to WTD (arrowed line). Grey bars represent the dark phase. A. Energy expenditure of both Ldlr+/+ mice and Ldlr-/- mice was acutely affected with WTD diet feeding. B. Respiratory exchange ratio of both Ldlr+/+ and Ldlr-/- mice was also acutely affected with switching to WTD feeding. n=4 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. *p<0.05, **p<0.01, ***p<0.001. Data represent mean ± SEM.  53  Figure 3.9: Activity levels in Ldlr-/- mice acutely exposed to WTD at 10-weeks. Continuous monitoring of activity levels was conducted when Ldlr+/+ and Ldlr-/- mice were switched from a chow diet to WTD (arrowed line). Grey bars represent the dark phase. A. Dark phase locomotor activity was acutely lowered after switch to WTD feeding in Ldlr+/+ and Ldlr-/mice. B. Fine movement was also lowered following the initial switch from chow to WTD in Ldlr+/+ and Ldlr-/- mice. n=4 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. *p<0.05, **p<0.01, ***p<0.001. Data represent mean ± SEM.  54  Figure 3.10: Body composition and food intake in Ldlr-/- mice fed a WTD. A. Ldlr-/- mice gained significantly less weight on WTD than Ldlr+/+ mice did. (n=16-20.) B. Body weight and body composition after 8 weeks on the WTD shows that Ldlr-/- mice specifically failed to gain fat mass relative to wildtype mice. C. Weights of the epididymal visceral fat pad and inguinal subcutaneous fat pad, dissected from mice. Ldlr-/- mice had decreased epididymal and inguinal fat pad masses relative to Ldlr+/+ mice. D. Weight of interscapular brown fat pad dissected from mice. No significant difference was observed between Ldlr-/- mice and Ldlr+/+ mice. E. No difference in caloric content of mouse fecal matter was observed. F. Continuous monitoring of food intake showed that Ldlr-/- mice were consuming more calories per gram of mouse on the WTD than Ldlr+/+ mice. Grey bars represent the dark phase. n=8 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. *p<0.05, **p<0.01. Data represent mean ± SEM. Data in Figure 3.10E was obtained with the assistance of W. Quong  55  Figure 3.11: Energy expenditure in Ldlr-/- mice on WTD. The energy balance phenotype of Ldlr+/+ mice and Ldlr-/- mice after eight weeks of WTD feeding was examined. Grey bars represent the dark phase. Resting energy expenditure (A) and energy expenditure (B) were decreased in Ldlr-/- mice. No differences were detected in RER (C), locomotor activity (D), or fine movement (E) between Ldlr-/- mice and wildtype mice after eight weeks exposure to the WTD. n=8 for Ldlr+/+ mice, n=6 for Ldlr-/- mice. *p<0.05, **p<0.01. Data represent mean ± SEM.  56  Figure 3.12: Thermoregulation in Ldlr-/- mice on WTD. A. Continuous monitoring of body temperature showed that after 2-6 weeks of WTD feeding, Ldlr/- mice had higher body temperature during the dark phase relative to Ldlr+/+ mice. Grey bars represent the dark phase. n=5 per genotype. B. 4-hr cold challenge experiment showed no significant deficits in regulation of body temperature during exposure to 4°C in Ldlr-/- mice. n=5 per genotype. C. qRT-PCR analysis showed no differences in Ucp1 expression in BAT. n=6 for Ldlr+/+, n=5 for Ldlr-/- mice. **p<0.01. Data represent mean ± SEM.  57  Figure 3.13: Glucose homeostasis of Ldlr-/- mice on WTD A. Ldlr-/- mice had lower fasting blood glucose levels relative to wildtype mice after 14weeks exposure to the WTD. B. IPGTTs and area under the curve analysis showed that Ldlr-/- mice had slightly better glucose clearance than Ldlr+/+ mice. C. Fasting insulin levels were also elevated in Ldlr-/mice. D. IPITTs and area under the curve analysis showed no significant differences in insulin sensitivity at this timepont between Ldlr-/- mice and Ldlr+/+ mice. n=10 for Ldlr+/+ mice and n=10 for Ldlr-/- mice. *p<0.05. Data represent mean ± SEM.  58  CHAPTER 4: Leptin Signaling in Ldlr-/- Mice  4.1 4.1.1  Endogenous Leptin in Ldlr-/- Mice  Serum Leptin Levels As described in Chapter 3, Ldlr-/- mice did not gain as much fat mass when fed  the WTD as Ldlr+/+ mice. To investigate the possibility of differences in endocrine activity of Ldlr-/- white adipose tissue depots on WTD, I studied serum leptin levels in Ldlr-/- mice and in Ldlr+/+ controls. After twelve weeks of WTD feeding, Ldlr+/+ mice had increased leptin levels relative to chow fed mice, which correlated with their increased fat mass (Figure 4.1A). However, Ldlr-/- mice also had increased serum leptin levels after twelve weeks of WTD feeding, despite their failure to gain significant amounts of adipose mass on the WTD (Figure 4.1A). When serum leptin levels were corrected per gram of fat mass, as detected by QMR, Ldlr-/- mice on the WTD appeared to be secreting more leptin per gram of fat tissue relative to chow fed mice, whereas wildtype mice do not secrete more leptin per gram of fat tissue on the WTD (Figure 4.1B). Serum leptin levels were also plotted as a dependent variable of fat mass to examine the correlation of fat mass and leptin levels in the different groups by visual means (Figure 4.1C).  4.1.2  Leptin Gene Expression in Adipocytes qRT-PCR of leptin gene expression in white adipose tissue of Ldlr+/+ mice was  performed with the assistance of W. Quong. These experiments showed that leptin gene expression was up-regulated with WTD feeding, both in the epididymal visceral fat pad 59  (Figure 4.2A) and in the inguinal subcutaneous fat pad (Figure 4.2B). However, analysis of Ldlr-/- mice showed that WTD feeding did not provoke an increase in leptin gene expression in the epididymal visceral fat pad (Figure 4.2A) or in the inguinal subcutaneous fat pad (Figure 4.2B) relative to levels in chow-fed animals.  4.2  Leptin Responsiveness and Functioning in Ldlr-/- Mice  4.2.1 Leptin Administration I next sought to examine how gene ablation of Ldlr would affect leptin responsiveness by examining acute response to intrapertioneal (IP) leptin administration in Ldlr+/+ and Ldlr-/- mice fed a chow diet. Prior to these experiments, I performed a pilot study to determine the effectiveness of IP leptin administration at a dose of 2µg/g for increasing serum leptin levels in wildtype and Ldlr-/- mice. Leptin was injected in a different group of mice, and serum was collected at 15 min, 30 min, 1 hr, 2 hr, and 3 hr post-injection and analyzed for leptin concentration by ELISA. Serum leptin levels were confirmed to be elevated to over 160ng/ml (40x physiological levels, Figure 4.3A) in mice of both genotypes half an hour after leptin administration. No differences in serum leptin levels were detected between Ldlr+/+ and Ldlr-/- mice two hours after the IP leptin injection (Figure 4.3B). As expected, leptin administration significantly decreased body weight in Ldlr+/+ mice (Figure 4.4A). However, the same dose of injected leptin did not elicit this effect in Ldlr-/- mice (Figure 4.4A). Two days of leptin administration also significantly decreased food intake in Ldlr+/+ mice. However, like body weight, decreased food intake was not observed in Ldlr-/- mice when treated with leptin when compared to treatment with saline (Figure 4.4B). In addition, leptin also significantly  60  decreased respiratory exchange ratio (Figure 4.5A, B & C) and energy expenditure (Figure 4.5D, E & F) in wildtype mice, but not in Ldlr-/- animals. Leptin administration had no effect on locomotor activity or fine movement levels in wildtype mice or in Ldlr-/- mice (Figure 4.6).  4.2.2  Hypothalamic Gene Expression Since leptin signaling appeared to be altered in Ldlr-/- animals, gene expression  of neuropeptides downstream of leptin were examined. Specifically, orexigenic Npy and anorexigenic Pomc expression was studied. Initially, hypothalamic blocks were collected from wildtype animals which were freely fed or 48-hour fasted. Gene expression analysis showed that, as predicted, Npy expression increased after a 48-hour fast (Figure 4.7A) and Pomc expression decreased significantly after a 48-hour fast (Figure 4.7B), validating the qRT-PCR assay. However, examination of Npy and Pomc expression in Ldlr-/- mice showed no alterations in Npy (Figure 4.7C) and Pomc (Figure 4.7D) expression, either in chow-fed or WTD-fed animals. Previous studies have shown that a 48-hour fast can induce changes in hypothalamic gene expression of neuropeptides regulating energy balance. I have demonstrated that Npy expression increased and Pomc expression decreased after a 48hour fast. I chose to examine expression of Ldlr and Apoe in the hypothalamus in freelyfed or 48-hour fasted wildtype mice, to study whether changes in gene expression of these two molecules involved with lipid transport are mediated by energy status. With assistance from W. Quong, qRT-PCR showed that Ldlr and Apoe expression in the hypothalamus was not responsive to 48-hour fasting in wildtype mice (Figure 4.7E & F).  61  Figure 4.1: Endogenous leptin levels in Ldlr-/- mice. A. Serum leptin levels were higher in both genotypes after exposure to WTD. B. Serum leptin levels corrected per gram of fat mass showed that Ldlr-/- mice on the WTD had higher circulating levels of leptin than would be expected from their adiposity. C. Serum leptin levels plotted relative to fat mass per individual mouse. Serum leptin levels: n=4-5/group. *p<0.05, **p<0.01. Data represent mean ± SEM.  62  Figure 4.2:  Leptin transcripts in Ldlr-/- mice. Leptin gene expression in the inguinal fat pad (A) and in the epididymal fat pad (B) were higher in wildtype mice on the WTD, but not in Ldlr-/- mice on the WTD. QRTPCR data: n=6-8 per group. *p<0.05, **p<0.01. Data represent mean ± SEM. Data in Figure 4.2A & B was obtained with the assistance of W. Quong.  63  Figure 4.3:  Serum leptin levels following IP leptin administration. A. Serum leptin level were increased half an hour following IP leptin administration, and this elevation persisted to three hours post-injection (n=2-4). B. Two hours following IP leptin administration, serum leptin levels were not significantly different between Ldlr+/+ mice and Ldlr-/- mice. n=4 per genotype. n.s. = not significant. Data represent mean ± SEM.  64  Figure 4.4: Effects of leptin on body weight and food intake in Ldlr-/- mice. 26week old male mice received intraperitoneal injections of leptin for two consecutive days. A. Ldlr+/+ mice had significantly reduced body weight after two days of leptin injections, but Ldlr-/- mice did not have decreased body weight following leptin injections. B. Ldlr+/+ mice had decreased food intake after leptin administration, whereas food intake of Ldlr-/- mice was unchanged. n=8 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. Data represent mean ± SEM. *p<0.05.  65  Figure 4.5: Energy expenditure after leptin administration. 26-week old male mice received intraperitoneal injections of leptin (black-dotted lines) for two consecutive days. In graphs A, B, D, & E : white circles represent salinetreated mice and black circles represent leptin-treated mice. EE was decreased after the second leptin injection in Ldlr+/+ mice (A), but was unchanged in Ldlr-/- mice (B). C. Average EE in dark phase in response to two leptin injections. RER was also decreased in Ldlr+/+ mice following leptin injections (D), but remained the same in Ldlr-/- mice (E). F. Average EE in the dark phase in response to two leptin treatments. n=8 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. *p<0.05, **p<0.01. Data represent mean ± SEM.  66  Figure 4.6: Activity levels after leptin administration. 26-week old male mice received intraperitoneal injections of leptin (black-dotted lines) for two consecutive days. Grey bars represent the dark phase. Locomotor activity was not affected by leptin injections in Ldlr+/+ mice (A) or in Ldlr-/mice (B). C. Average locomotor activity in dark phase in response to two leptin injections. Fine movememt was also unchanged in Ldlr+/+ mice (D) and Ldlr-/- mice (E) following leptin injections. F. Average fine movement in the dark phase after two leptin treatments. n=8 for Ldlr+/+ mice, n=7 for Ldlr-/- mice. Data represent mean ± SEM.  67  Figure 4.7: Hypothalamic gene expression of leptin-responsive neuropeptides. A. Orexigenic Npy expression was significantly increased in mice fasted 48 hours. B. Anorectic Pomc expression was significantly decreased in mice fasted 48 hours. C. Npy expression was not significantly different between Ldlr+/+ and Ldlr-/- mice on the chow or WTD. D. Pomc expression was also not significantly different between Ldlr+/+ and Ldlr-/mice on the chow or WTD. E. Ldlr expression was not altered with fasting in wildtype animals. F. Apoe expression was also not altered with fasting in wildtype animals. n=4-13. Data represent mean ± SEM. *p<0.05, **p<0.01. Data in Figure 4.7E & F was obtained with the assistance of W. Quong.  68  CHAPTER 5: General Discussion  5.1 5.1.1  Reliability of Methods  Energy Expenditure Indirect calorimetry is a method to assess the energy consumed by an animal  through measurement of respiratory exchanges involving oxygen consumption and carbon dioxide production110,122. These gaseous exchanges are associated with the oxidation of macronutrients (carbohydrates, protein, fat and occasionally ethanol) as energetic substrates. Therefore, indirect calorimetry is a useful method to assess energy expenditure of an organism122. In addition to indirect calorimetry, the use of infrared beam-breaks to measure activity levels and temperature telemetry transmitters to measure heat production allow assessment of specific subcomponents of energy expenditure.  5.1.2  Body Composition Methods for in vivo analysis of rodent body composition have been developed to  provide an alternative to chemical carcass analysis. Though carcass analysis is the gold standard, it is expensive, time-consuming and requires sacrifice of the animal, precluding longitudinal studies. QMR technology to study animal body composition in vivo has been used as an inexpensive yet highly reliable method115,123-126. Other technologies such as DEXA have also been used to study rodent body composition.127-130 Studies have shown the reliability and comparability of results from both the QMR and DEXA systems with more traditional methods of rodent body composition, including whole carcass chemical analytical methods131. We validated the QMR system used in these studies by measuring the correlation between scale weights and QMR readings for mixtures of lean tissue and 69  fat (see Appendix B). Based on these data I believe that the QMR body composition method provides accurate non-invasive analysis of whole body composition in live animals.  5.1.3  Fecal Energy Content To examine mouse fecal energy content, direct bomb calorimetry was used. While  bomb calorimetry allowed quantitation of total energy content of fecal matter, analysis of lipid composition in mouse feces using mass spectrometry132 may also provide a greater level of resolution of the absorptive phenotype of Ldlr-/- mice. A previous report examined lipid absorption of Ldlr-/- mice on a calorie dense-diet by administering a radiolabeled retinol gavage and analyzing the appearance of radioactivity in the plasma. This study did not find differences in fat absorption between Ldlr-/- mice and Ldlr+/+ mice 108.  5.1.4  Glucose Sensitivity To study glucose clearance and insulin sensitivity, IPGTTs and IPITTs were used.  While IPGTTs did detect a difference between Ldlr-/- mice and Ldlr+/+ mice on the WTD, IPITTs did not demonstrate a difference between the two genotypes in insulin sensitivity. IPITTs examine the physiological response of the entire organism, and do not provide information on the response of specific organs to insulin. Hyperinsulinemic euglycemic clamps133,134 are the gold standard method for assessing insulin sensitivity in living animals, though this technique was not used in my studies due to the difficulty of the technique and the highly specialized training required.  70  5.1.5  Quantitative Reverse-Transcriptase Polymerase Chain Reaction qRT-PCR is a widely used method to analyze gene expression119. Npy and Pomc  are only expressed within specific nuclei of the hypothalamus46. In the studies presented here, qRT-PCR was used to examine gene expression in whole hypothalamic blocks, without specific microdissection of nuclei. Even with the specificity of expression, I believe that the assaying Npy and Pomc expression across all nuclei contained in the hypothalamic blocks would not obscure real changes in gene expression. Nevertheless, microdissection of specific nuclei prior to RNA isolation would be one way to improve the sensitivity and specificity of my qRT-PCR studies. RNA in situ hybridization is another technique that is used to detect changes in gene expression caused by alterations in energy balance (alterations that may be more sensitive to changes within specific populations of neurons in the brain). Visualization through in situ hybridization of leptin responsive transcripts like, Npy and Pomc, Ldlr, and Apoe, in specific neuronal populations may yield higher resolution answers than qRT-PCR. Because differences in gene expression were not detected using qRT-PCR, RNA in situ hybridization would be another means to confirm these results.  5.1.6 Leptin Administration In my experiments, I administered acute injections of leptin over two days. Other studies have used methods that deliver leptin more slowly and over longer periods. These methods appear to be more potent in eliciting leptin’s anorectic effects26. For example, when leptin is delivered to rodents through implanted mini-osmotic pumps slowly over  71  several weeks, the anorectic effects are greater relative to bolus injections26,34,135. Thus, while the studies described in this thesis found that Ldlr-/- mice were resistant to acute leptin injections, Ldlr-/- mice may be in fact sensitive to the effects of chronic leptin administration. Additionally, I administered leptin peripherally via an intraperitoneal injection. Leptin has been shown to elicit a more potent physiological response when delivered centrally136,137. When a cannula is implanted into the third ventricle of the brain, leptin may be targeted toward the arcuate nucleus136. Testing of central leptin sensitivity in Ldlr-/- mice would be a means to address whether the leptin resistance I observed in Ldlr-/- mice specifically included a component of central leptin resistance.  5.2 5.2.1  The Energy Balance Phenotype in Ldlr-/- Mice  Phenotype of Ldlr-/- Mice on Chow The Ldlr is best known for its significant role in lipid clearance and in the  pathogenesis of atherosclerosis. Thus, the Ldlr-/- mouse92 has been studied extensively as a model for atherosclerotic lesion formation. In the work described here, I investigated the role of the Ldlr in modulating parameters of energy balance, including EE, activity levels, and response to a WTD. Other molecules in the lipoprotein system have also been implicated in energy balance. Centrally, apolipoproteins Apoe and ApoaIV have anorectic effects in the brain81,82. Peripherally, the low density lipoprotein receptorrelated protein 1 (Lrp1) receptor in adipocytes appears important in maintaining body weight87. My experiments suggest that whole-body knockout of Ldlr in mice results in decreased food intake, decreased energy expenditure, decreased respiratory exchange  72  ratio, and increased activity levels when mice are fed a standard rodent diet. Interestingly, these changes in various aspects of EE were not accompanied by differences in body weight or body composition between Ldlr-/- mice and Ldlr+/+ mice on a standard chow diet. Prior to my studies, Ldlr-/- mice had been reported to show increased locomotor activity during an open field test111. My findings complement these results using alternative methods to assay mouse activity. The observed global differences in energy balance between Ldlr-/- mice and Ldlr+/+ mice suggest an important role for Ldlr in maintaining energy homeostasis.  5.2.3  Phenotype of Ldlr-/- Mice on WTD Transgenic animals with perturbations in lipid transport have demonstrated  interesting energy balance phenotypes when exposed to energy dense high-fat diets. In particular, Apoe-/- mice are less susceptible to diet-induced obesity when compared with Apoe+/+ mice84,85. In my studies, I did not detect differences in body weight or body composition between Ldlr+/+ and Ldlr-/- mice fed standard rodent chow. However, when Ldlr-/- mice were given a WTD, differences emerged in body weight and body composition, with Ldlr-/- mice accumulating significantly less fat than wildtype mice. In previous studies, Ldlr-/- mice have been reported to have increased weight gain on a diabetogenic diet108 and decreased weight gain on a less calorie dense WTD85. My studies showed that Ldlr-/- mice gain less weight than Ldlr+/+ mice after 8 weeks of consuming a WTD. The data on weight gain in Ldlr-/- mice I generated was obtained prior to the publication of the article by Karagiannides et al.85, reporting decreased weight gain in Ldlr-/- mice fed a WTD compared to Ldlr+/+ mice fed the same diet. Coincidentally, the  73  WTD I used was identical to the WTD used by Karagiannides et al.85, with identical results obtained from both studies. My analysis of body composition and dissection of adipose depots found that Ldlr-/- mice failed to expand their fat mass. The differences in weight gain between Ldlr-/- and Ldlr+/+ mice fed different high-energy diets suggest that Ldlr gene knockout alters body weight and energy balance, but in a manner that depends on the energy density and macronutrient content of the diet. Additionally, I found that WTD-fed Ldlr-/- mice had improved glucose homeostasis relative to WTD-fed Ldlr+/+ mice, which I believe is due to the decreased weight gain of Ldlr-/- mice fed the WTD. However, molecular mechanisms specific to the pancreas are also plausible and were not investigated in these experiments. Ldlr-/- mice consumed the same amount of energy as Ldlr+/+ mice when fed the WTD, but showed diminished weight gain. The lower weight gain could not be attributed to impaired absorption, since fecal energy excretion was not different between Ldlr+/+ mice and Ldlr-/- mice. A previous report had also shown no differences in fat absorption between Ldlr-/- mice and Ldlr+/+ mice108. Collectively, the available data indicate that fat malabsorption does not explain the lower body weight gain in WTD fed Ldlr-/- mice. This suggests physiological differences in energy metabolism are the most likely reason for the altered response observed in Ldlr-/- mice fed the WTD. In both chow-fed and WTD-fed mice, Ldlr-/- animals consistently had lower EE, despite gaining less fat mass relative to wildtype animals on the WTD. Interestingly, a differential metabolic response to the WTD was observed between Ldlr-/- mice and wildtype mice. Ldlr-/- mice fed the WTD had 35.2% higher EE when compared with Ldlr-/- mice fed chow, whereas WTD feeding did not elicit a significant increase in EE in  74  wildtype animals. This differential response to the WTD may decrease the sensitivity of Ldlr-/- mice to diet induced obesity, and thereby explain the decreased weight-gain phenotype observed in Ldlr-/- mice. My experiments showed increased body temperature in Ldlr-/- mice on the WTD at ambient temperatures (24ºC – 25ºC), indicating the Ldlr may be involved in regulating thermogenesis. However, the absence of Ldlr mediated lipid transport in multiple tissues may activate compensatory pathways that do not necessarily rely on Ldlr. The overall phenotype observed in the Ldlr-/- mouse is a result of the complex interplay between these pathways as the organism attempts to achieve homeostasis. In addition, the major tissue site at which compensatory pathways act may not be identical to the tissue most greatly affected by the genetic defect. An example of this concept can be found in the Lrp1 pathway, wherein the deletion of Lrp1 specifically from adipocytes activated compensatory pathways in muscle87. In my experiments, Ldlr-/- mice on the chow diet had increased brown adipose tissue weight compared to Ldlr+/+ mice on the same diet, suggesting differences between Ldlr-/- mice and Ldlr+/+ mice in the differentiation and maintenance of brown adipose tissue. Adaptive thermogenesis is a major contributor to an organism’s overall energy expenditure121. Brown adipose tissue in rodents is known to regulate heat production through expression of Ucp1, a mitochondrial protein which acts to decouple the proton gradient generated by the electron transport chain from ATP synthesis121. This decoupling causes energy to be dissipated as heat22,121. Ucp1 activity is regulated by the sympathetic nervous system, which activates β3- adrenergic receptors in brown adipose tissue22,121. In addition to Ucp1, Ucp2 and Ucp3 are homologous proteins expressed in skeletal muscle121. Decoupling of the proton gradient from ATP synthesis in  75  muscle fibers by Ucp2 and Ucp3 activity is also thought to be a mechanism whereby adaptive thermogenesis is mediated121. In my experiments, Ucp1 gene expression in brown adipose tissue of Ldlr-/- mice was unchanged relative to Ldlr+/+ brown adipose tissue. While the means whereby the Ldlr may affect the function of brown adipose tissue were not elucidated, influences of the Ldlr on the sympathetic nervous system and skeletal muscle are attractive candidate mechanisms.  5.3 5.3.1  The Ldlr and Leptin  Leptin Levels in Ldlr-/- Mice Leptin is an adipokine which plays a vital role in body weight regulation46,135.  Due to the energy balance phenotype of Ldlr, I decided to examine whether loss of the Ldlr would affect leptin signaling or function. My experiments illustrate that Ldlr-/- mice have increased serum leptin levels per gram of fat mass. Under normal circumstances, leptin is secreted in proportion to adiposity levels, and leptin gene expression also increases in proportion to fat mass38,39. However, I detected that serum leptin levels are elevated in Ldlr-/- mice fed a WTD, despite no detectable increase in fat mass on the WTD. This suggests that serum leptin levels in Ldlr-/- mice on the WTD are not correlated with adiposity levels as they are in Ldlr+/+ mice. To understand this further, leptin mRNA in visceral and subcutaneous adipose tissue was analyzed. However, leptin mRNA was not elevated in Ldlr-/- mice on chow or on WTD. These observations are in sharp contrast to what is seen in Ldlr+/+ mice, in which circulating leptin levels and leptin gene expression are generally correlated. Therefore, while leptin levels are observed to be elevated in Ldlr-/- mice on the WTD, this is likely not due to changes in  76  leptin gene transcription. Instead, a reduction in leptin clearance may be responsible for the increased leptin levels in Ldlr-/- mice.  5.3.2  Leptin Responsiveness in Ldlr-/- Mice The discovery and understanding of leptin biology has revealed the significance  of these pathways mediating energy balance. I chose to examine leptin function in the context of the Ldlr-/- mouse. As leptin is a crucial regulator of energy balance, deregulation of energy homeostasis in Ldlr-/- mice might be expected to correlate with altered leptin signaling. Exogenous administration of leptin to Ldlr-/- mice demonstrated that whole-body gene ablation of the Ldlr blunts leptin’s anorectic and weight-lowering effects. Interestingly, I also found that leptin administration to wildtype mice decreased RER and EE. While leptin has been shown to increase EE in leptin deficient ob/ob mice, reports of leptin’s effects on EE in wildtype mice have suggested either an increase138,139 or no change140,141 in EE. In my experimental paradigm, two daily IP injections of leptin acutely lowered EE and RER in wildtype mice. Since leptin is known to increase EE in ob/ob mice, I hypothesize that decreased EE and RER in response to leptin administration is a secondary effect of decreased caloric consumption and weight loss elicited by leptin injections142. I did not observe these effects on EE and RER in Ldlr-/- mice, which I believe is due to their resistance to leptin’s food- and body weight-lowering effects. Experiments indicating decreased leptin responsiveness in Apoe-/- mice were also reported recently83. These studies showed that Apoe expression in the hypothalamus was decreased when leptin was administered via ICV injections83. ICV injections of leptin, when targeted at the third ventricle, allow delivery directly to the arcuate nucleus. These  77  results suggest that Apoe-/- mice show central leptin resistance. My studies did not directly address central leptin sensitivity in Ldlr-/- mice, as I used a peripheral method of leptin administration. Regardless, there is concordance of evidence between Apoe-/- and Ldlr-/- mice with respect to decreased leptin sensitivity. Thus, Apoe signaling through Ldlr may regulate feeding behavior via leptin-mediated pathways.  5.3.3  Expression of Hypothalamic Neuropeptides As leptin is a hormone that is critical for energy balance and body weight  regulation, data suggesting that the Ldlr mediates leptin’s signal serves as important evidence that lipid transport pathways are directly involved in energy homeostasis. Because altered leptin sensitivity was detected in Ldlr-/- mice, I examined leptinresponsive hypothalamic neuropeptides in Ldlr-/- mice. I hypothesized that, because leptin sensitivity is decreased in Ldlr-/- mice relative to Ldlr+/+ mice, differences might emerge in expression of leptin responsive neuropeptides. Before performing these studies, I first validated that the qRT-PCR assay was able to detect fasting-induced changes in Npy and Pomc mRNA. Ultimately, no differences in basal expression of Npy or Pomc were detected in ad-libitum fed Ldlr-/- mice. The qRT-PCR method I used may not have been sensitive enough to detect subtle differences in hypothalamic Npy and Pomc levels between Ldlr-/- mice and Ldlr+/+ mice in the fed state. Other methods may be more sensitive to subtle differences, as discussed earlier (Section 5.1.5). In addition, states of fasting may elicit differences in hypothalamic Npy and Pomc levels between Ldlr+/+ and Ldlr-/- mice that are more readily detectable by qRT-PCR.  78  To examine the potential interaction between Ldlr and Apoe in mediating the anorectic effects of Apoe previously reported82,83, I studied Ldlr gene expression in the hypothalamus of fasted and freely fed wildtype mice. However, I did not find that fasting elicited changes in Ldlr expression in the hypothalamus. A previous paper had reported that hypothalamic Apoe levels increased after a 36-hour fast in rats82, which suggests transcriptional regulation through energy status occurs at the level of the ligand, Apoe. Yet I was not able to replicate the decrease in Apoe gene expression by qRT-PCR in mice fasted 48 hours. These contrasting results of hypothalamic Apoe gene expression may be due to differences in length of fasting, or to differences between rats and mice in hypothalamic Apoe gene regulation.  5.4  Conclusion of Findings and Future Directions  Globally, obesity is becoming increasingly prominent and dangerous to population health. Studies of the regulation of body weight are necessary to understand the molecular pathways perturbed in states of energy imbalance. In this thesis, interactions between the Ldlr pathway and energy homeostasis were examined. This research has provided novel evidence suggesting the Ldlr is involved with maintaining energy balance. Taken together with previous reports, my data suggest that interactions between lipid transport molecules and energy balance pathways contribute to energy homoeostasis. Figure 5.1 summarizes these findings in the context of other energy balance systems. My studies showed that Ldlr-/- mice have altered energy expenditure and decreased body weight gain on a WTD relative to wildtype mice. The direct mechanism  79  whereby the Ldlr affects body weight, fat mass accumulation, and energy expenditure is yet to be determined. However, my experiments suggest that the Ldlr mediates energy expenditure by regulating thermogenesis. Further studies are required to identify the interaction between Ldlr and thermoregulation. Another important finding from my thesis includes leptin resistance in Ldlr-/- mice. This suggests that the Ldlr mediates energy balance partially through leptin signaling and that leptin’s effects on energy homeostasis may partially depend on molecules involved with lipid transport. Leptin is a key mediator of energy balance secreted by adipocytes. The fact that leptin signaling may depend on the Ldlr suggests that signals of adiposity are also incorporated from systemic circulation by organisms, although how this occurs requires further investigation. Leptin’s regulation of Apoe, a major ligand for the Ldlr, appears to be a likely mediator. Additional research is required to understand the mechanisms whereby these interactions take place. In conclusion, the studies in my thesis support a direct connection between lipid transport and energy homeostasis. Understanding of the influences of dyslipidemia on energy balance is critical to revealing the fundamental properties of energy homeostasis as well as for the discovery of potential anti-obesity drug targets. Future studies on the interactions between dyslipidemia, obesity, and T2D are critical to enhance our understanding of these widespread diseases and for the development of therapies to manage the obesity epidemic.  80  Figure 5.1. Regulators of energy balance. Same representation of the energy balance regulation as depicted in Figure 1.2, with the addition of the lipid transport system. Specifically, studies from the Ldlr-/- mouse in this thesis suggest that the Ldlr is a key regulator of the overall energy status of the organism.  81  References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.  13. 14. 15. 16. 17. 18. 19.  Kopelman, P.G. Obesity as a medical problem. Nature 404, 635-643 (2000). Wang, Y. & Lobstein, T. Worldwide trends in childhood overweight and obesity. International Journal of Pediatric Obesity 1, 11-25 (2006). WHO. http://www.who.int/topics/obesity/en/. (Accessed January 12, 2010). Hjartaker, A., Langseth, H. & Weiderpass, E. Obesity and diabetes epidemics: cancer repercussions. Innovative Endocrinology of Cancer 630, 72-93 (2008). Pradhan, A. Obesity, metalic syndrome, and type 2 diabetes: Inflammatory basis of glucose metabolic disorders. Nutrition Reviews 65, S152-S156 (2007). Sowers, J.R. Obesity as a cardiovascular risk factor. American Journal of Medicine 115, 37-41 (2003). Brown, C.D. et al. Body mass index and the prevalence of hypertension and dyslipidemia. Obesity Research 8, 605-619 (2000). Lear, S.A., Toma, M., Birmingham, C.L. & Frohlich, J.J. Modification of the relationship between simple anthropometric indices and risk factors by ethnic background. Metabolism-Clinical and Experimental 52, 1295-1301 (2003). Huxley, R. et al. Waist circumference thresholds provide an accurate and widely applicable method for the discrimination of diabetes. Diabetes Care 30, 31163118 (2007). Janssen, I., Katzmarzyk, P.T. & Ross, R. Body mass index, waist circumference, and health risk. Archives of Internal Medicine 162, 2074-2079 (2002). Luu, Y.K. et al. In vivo quantification of subcutaneous and visceral adiposity by micro-computed tomography in a small animal model. Medical Engineering & Physics 31, 34-41 (2009). Maurovich-Horvat, P. et al. Comparison of anthropometric, area- and volumebased assessment of abdominal subcutaneous and visceral adipose tissue volumes using multi-detector computed tomography. International Journal of Obesity 31, 500-506 (2007). Tremblay, M.S., Katzmarzyk, P.T. & Willms, J.D. Temporal trends in overweight and obesity in Canada, 1981-1996. International Journal of Obesity 26, 538-543 (2002). Tjepkema, M. Adult obesity in Canada: Measured height and weight. http://www.statcan.gc.ca/pub/82-620-m/2005001/article/adults-adultes/8060eng.htm. (2008). Nathan, B., Moran, A. Metabolic complications of obesity in childhood and adolescence: more than just diabetes. Current Opinion in Endocrinology, Diabetes & Obesity 15, 9 (2008). Ryan, J.G. Cost and Policy Implications From the Increasing Prevalence of Obesity and Diabetes Mellitus. Gender Medicine 6, 86-108 (2009). Colditz, G.A. et al. Weight as a Risk Factor for Clinical Diabetes in Women. American Journal of Epidemiology 132, 501-513 (1990). Reaven, G.M. Pathophysiology of Insulin-Resistance in Human-Disease. Physiological Reviews 75, 473-486 (1995). Kissebah, A.H. & Krakower, G.R. Regional Adiposity and Morbidity. Physiological Reviews 74, 761-811 (1994).  82  20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32.  33.  34. 35.  36.  Lane, J.T. et al. Comparison of CT and dual-energy DEXA using a modified trunk compartment in the measurement of abdominal fat. Endocrine 27, 295-299 (2005). Murphy, S., Martin, S. & Parton, R.G. Lipid droplet-organelle interactions; sharing the fats. Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids 1791, 441-447 (2009). Redinger, R.N. Fat storage and the biology of energy expenditure. Translational Research 154, 52-60 (2009). Rosen, E.D. & Spiegelman, B.M. Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444, 847-853 (2006). Flier, J.S. Obesity wars: Molecular progress confronts an expanding epidemic. Cell 116, 337-350 (2004). Rasouli, N. & Kern, P.A. Adipocytokines and the Metabolic Complications of Obesity. Journal of Clinical Endocrinology & Metabolism 93, S64-S73 (2008). Friedman, J.M. & Halaas, J.L. Leptin and the regulation of body weight in mammals. Nature 395, 763-770 (1998). Ahima, R.S. & Flier, J.S. Leptin. Annual Review of Physiology 62, 413-437 (2000). Ingalls, A.M., Dickie, M.M. & Snell, G.D. Obese, a New Mutation in the House Mouse. Journal of Heredity 41, 317-318 (1950). Chehab, F.E., Lim, M.E. & Lu, R.H. Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nature Genetics 12, 318-320 (1996). Jurgens, H.S. et al. Hyperphagia, lower body temperature, and reduced running wheel activity precede development of morbid obesity in New Zealand obese mice. Physiological Genomics 25, 234-241 (2006). Zhang, Y.Y. et al. Positional Cloning of the Mouse Obese Gene and Its Human Homolog. Nature 372, 425-432 (1994). Freeman, T.C., Dixon, A,K., Campbell, E.A., Tait, T.M., Richardson, P.J., Rice, K.M. Maslen, G.L., Metcalfe, A.D. Streuli, C.H., Bentley, D.R. . Expression Mapping of Mouse Genes in MGI Direct Data Submission (Mouse Genome Informatics, 1998). Levin, N., Nelson, C., Gurney, A., Vandlen, R. & DeSauvage, F. Decreased food intake does not completely account for adiposity reduction after ob protein infusion. Proceedings of the National Academy of Sciences of the United States of America 93, 1726-1730 (1996). Pelleymounter, M.A. et al. Effects of the Obese Gene-Product on Body-Weight Regulation in Ob/Ob Mice. Science 269, 540-543 (1995). Gibson, W.T. et al. Congenital leptin deficiency due to homozygosity for the Delta 133G mutation: Report of another case and evaluation of response to four years of leptin therapy. Journal of Clinical Endocrinology & Metabolism 89, 4821-4826 (2004). Montague, C.T. et al. Congenital leptin deficiency is associated with severe earlyonset obesity in humans. Nature 387, 903-908 (1997).  83  37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54.  Strobel, A., Issad, T., Camoin, L., Ozata, M. & Strosberg, A.D. A leptin missense mutation associated with hypogonadism and morbid obesity. Nature Genetics 18, 213-215 (1998). Considine, R.V. et al. Serum immunoreactive leptin concentrations in normalweight and obese humans. New England Journal of Medicine 334, 292-295 (1996). Frederich, R.C. et al. Leptin Levels Reflect Body Lipid-Content in Mice Evidence for Diet-Induced Resistance to Leptin Action. Nature Medicine 1, 13111314 (1995). Minocci, A. et al. Leptin plasma concentrations are dependent on body fat distribution in obese patients. International Journal of Obesity 24, 1139-1144 (2000). Maffei, M. et al. Leptin Levels in Human and Rodent - Measurement of Plasma Leptin and Ob Rna in Obese and Weight-Reduced Subjects. Nature Medicine 1, 1155-1161 (1995). Van Harmelen, V. et al. Leptin secretion from subcutaneous and visceral adipose tissue in women. Diabetes 47, 913-917 (1998). Balthasar, N. et al. Divergence of melanocortin pathways in the control of food intake and energy expenditure. Cell 123, 493-505 (2005). Fei, H. et al. Anatomic localization of alternatively spliced leptin receptors (ObR) in mouse brain and other tissues. Proceedings of the National Academy of Sciences of the United States of America 94, 7001-7005 (1997). McMinn, J.E. et al. Neuronal deletion of Lepr elicits diabesity in mice without affecting cold tolerance or fertility. American Journal of PhysiologyEndocrinology and Metabolism 289, E403-E411 (2005). Schwartz, M.W., Woods, S.C., Porte, D., Seeley, R.J. & Baskin, D.G. Central nervous system control of food intake. Nature 404, 661-671 (2000). Caro, J.F. et al. Decreased cerebrospinal-fluid/serum leptin ratio in obesity: A possible mechanism for leptin resistance. Lancet 348, 159-161 (1996). Bjorbaek, C., Elmquist, J.K., Frantz, J.D., Shoelson, S.E. & Flier, J.S. Identification of SOCS-3 as a potential mediator of central leptin resistance. Molecular Cell 1, 619-625 (1998). Hetherington, A.W. & Ranson, S.W. Hypothalamic-Lesions and Adiposity in the Rat. Nutrition Reviews 41, 124-127 (1983). Barsh, G.S. & Schwartz, M.W. Genetic approaches to studying energy balance: Perception and integration. Nature Reviews Genetics 3, 589-600 (2002). Hahn, T.M., Breininger, J.F., Baskin, D.G. & Schwartz, M.W. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nature Neuroscience 1, 271-272 (1998). Kristensen, P. et al. Hypothalamic CART is a new anorectic peptide regulated by leptin. Nature 393, 72-76 (1998). Schwartz, M.W. et al. Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46, 2119-2123 (1997). Balthasar, N. Genetic dissection of neuronal pathways controlling energy homeostasis. Obesity 14, 222-227 (2006).  84  55. 56. 57. 58. 59. 60. 61. 62. 63. 64.  65. 66. 67. 68. 69. 70. 71.  72.  Barsh, G.S., Farooqi, I.S. & O'Rahilly, S. Genetics of body-weight regulation. Nature 404, 644-651 (2000). Huszar, D. et al. Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88, 131-141 (1997). Vaisse, C., Clement, K., Guy-Grand, B. & Froguel, P. A frameshift mutation in human MC4R is associated with a dominant form of obesity. Nature Genetics 20, 113-114 (1998). Yeo, G.S.H. et al. A frameshift mutation in MC4R associated with dominantly inherited human obesity. Nature Genetics 20, 111-112 (1998). Dridi, S. & Taouis, M. Adiponectin and energy homeostasis: consensus and controversy. Journal of Nutritional Biochemistry 20, 831-839 (2009). Kadowaki, T. & Yamauchi, T. Adiponectin and adiponectin receptors. Endocrine Reviews 26, 439-451 (2005). Kubota, N. et al. Disruption of adiponectin causes insulin resistance and neointimal formation. Journal of Biological Chemistry 277, 25863-25866 (2002). Ma, K. et al. Increased beta-oxidation but no insulin resistance or glucose intolerance in mice lacking adiponectin. Journal of Biological Chemistry 277, 34658-34661 (2002). Plomgaard, P. et al. Tumor necrosis factor-alpha induces skeletal muscle insulin resistance in healthy human subjects via inhibition of Akt substrate 160 phosphorylation. Diabetes 54, 2939-2945 (2005). Kern, P.A., Ranganathan, S., Li, C.L., Wood, L. & Ranganathan, G. Adipose tissue tumor necrosis factor and interleukin-6 expression in human obesity and insulin resistance. American Journal of Physiology-Endocrinology and Metabolism 280, E745-E751 (2001). Nogueiras, R., Novelle, M.G., Vazquez, M.J., Lopez, M., Dieguez, C. Resistin: Regulation of Food Intake, Glucose Homeostasis and Lipid Metabolism. Endocr Dev 17, 10 (2010). Ribalta, J., Vallve, J.C., Girona, J. & Masana, L. Apolipoprotein and apolipoprotein receptor genes, blood lipids and disease. Current Opinion in Clinical Nutrition and Metabolic Care 6, 177-187 (2003). Stryer, L. Biochemistry, (W. H. Freeman and Company, USA, 1988). Marschang, P. & Herz, J. Mouse models as tools for dissecting disorders of lipoprotein metabolism. Seminars in Cell & Developmental Biology 14, 25-35 (2003). Stein, E.A. Managing dyslipidemia in the high-risk patient. American Journal of Cardiology 89, 50c-57c (2002). Brown, M.S. & Goldstein, J.L. The SREBP pathway: Regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331-340 (1997). Wouters, K., Shiri-Sverdlov, R., van Gorp, P.J., van Bilsen, M. & Hofker, M.H. Understanding hyperlipidemia and atherosclerosis: lessons from genetically modified apoe and ldlr mice. Clinical Chemistry and Laboratory Medicine 43, 470-479 (2005). Glass, C.K. & Witztum, J.L. Atherosclerosis: The road ahead. Cell 104, 503-516 (2001).  85  73. 74. 75. 76. 77. 78. 79.  80. 81. 82. 83. 84. 85. 86. 87. 88.  89. 90.  Vance, J.E., Karten, B. & Hayashi, H. Lipid dynamics in neurons. Biochemical Society Transactions 34, 399-403 (2006). Goldstein, J.L. & Brown, M.S. Lipoprotein Receptors and the Control of Plasma Ldl Cholesterol Levels. European Heart Journal 13, 34-36 (1992). May, P., Herz, J. & Bock, H.H. Molecular mechanisms of lipoprotein receptor signalling. Cellular and Molecular Life Sciences 62, 2325-2338 (2005). Beffert, U., Stolt, P.C. & Herz, J. Functions of lipoprotein receptors in neurons. Journal of Lipid Research 45, 403-409 (2004). Herz, J. The LDL receptor gene family: (Un)expected signal transducers in the brain. Neuron 29, 571-581 (2001). Goldstein, J.L. & Brown, M.S. Regulation of the Mevalonate Pathway. Nature 343, 425-430 (1990). Rifkind, B.M. The Lipid Research Clinics Coronary Primary Prevention Trial Results .2. The Relationship of Reduction in Incidence of Coronary Heart-Disease to Cholesterol Lowering. Jama-Journal of the American Medical Association 251, 365-374 (1984). Shen, L. et al. Characterization of apolipoprotein A-IV in brain areas involved in energy homeostasis. Physiology & Behavior 95, 161-167 (2008). Gotoh, K. et al. Apolipoprotein A-IV interacts synergistically with melanocortins to reduce food intake. American Journal of Physiology-Regulatory Integrative and Comparative Physiology 290, R202-R207 (2006). Shen, L. et al. Brain apolipoprotein E: an important regulator of food intake in rats. Diabetes 57, 2092-2098 (2008). Shen, L. et al. Up-regulation of apolipoprotein E by leptin in the hypothalamus of mice and rats. Physiology & Behavior 98, 223-228 (2009). Hofmann, S.M. et al. Defective lipid delivery modulates glucose tolerance and metabolic response to diet in apolipoprotein E-deficient mice. Diabetes 57, 5-12 (2008). Karagiannides, I., Abdou, R., Tzortzopoulou, A., Voshol, P.J. & Kypreos, K.E. Apolipoprotein E predisposes to obesity and related metabolic dysfunctions in mice. Febs Journal 275, 4796-4809 (2008). Herz, J., Clouthier, D.E. & Hammer, R.E. Ldl Receptor-Related Protein Internalizes and Degrades Upa-Pai-1 Complexes and Is Essential for Embryo Implantation. Cell 71, 411-421 (1992). Hofmann, S.M. et al. Adipocyte LDL receptor-related protein-1 expression modulates postprandial lipid transport and glucose homeostasis in mice. Journal of Clinical Investigation 117, 3271-3282 (2007). Swanson, L., Simmons, D., Hofmann, S., Goldstein, J. & Brown, M. Localization of mRNA for low density lipoprotein receptor and a cholesterol synthetic enzyme in rabbit nervous system by in situ hybridization. Proc. Natl. Acad. Sci. USA 85, 5 (1988). Brown, M. & Gidlstein, J. The receptor model for transport of cholesterol plasma. Ann N Y Acad Sci 454, 4 (1985). Hobbs, H., Russell, D., Brown, M. & Gidlstein, J. The LDL receptor locus and familial hypercholesterolemia: mutational analysis of a membrane protein. Annu Rev Genet 24, 38 (1990).  86  91. 92. 93. 94. 95. 96. 97. 98. 99.  100.  101. 102. 103. 104.  Kypreos, K.E. & Zannis, V.I. LDL receptor deficiency or apoE mutations prevent remnant clearance and induce hypertriglyceridemia in mice. Journal of Lipid Research 47, 521-529 (2006). Ishibashi, S. et al. Hypercholesterolemia in Low-Density-Lipoprotein Receptor Knockout Mice and Its Reversal by Adenovirus-Mediated Gene Delivery. Journal of Clinical Investigation 92, 883-893 (1993). Paigen, B., Morrow, A., Brandon, C., Mitchell, D. & Holmes, P. Variation in Susceptibility to Atherosclerosis among Inbred Strains of Mice. Atherosclerosis 57, 65-73 (1985). Silver, D.L., Wang, N. & Tall, A.R. Defective HDL particle uptake in ob/ob hepatocytes causes decreased recycling, degradation, and selective lipid uptake. Journal of Clinical Investigation 105, 151-159 (2000). Kennedy, D.J. et al. Dietary Cholesterol Plays a Role in CD36-Mediated Atherogenesis in LDLR-Knockout Mice. Arteriosclerosis Thrombosis and Vascular Biology 29, 1481-U171 (2009). Lewis, M.J. et al. Immunoglobulin M Is Required for Protection Against Atherosclerosis in Low-Density Lipoprotein Receptor-Deficient Mice. Circulation 120, 417-U101 (2009). Coenen, K.R., Gruen, M.L., Chait, A. & Hasty, A.H. Diet-induced increases in adiposity, but not plasma lipids, promote macrophage infiltration into white adipose tissue. Diabetes 56, 564-573 (2007). Hasty, A.H. et al. Severe hypercholesterolemia, hypertriglyceridemia, and atherosclerosis in mice lacking both leptin and the low density lipoprotein receptor. Journal of Biological Chemistry 276, 37402-37408 (2001). Verreth, W. et al. Weight loss-associated induction of peroxisome proliferatoractivated receptor-alpha and peroxisome proliferator-activated receptor-gamma correlate with reduced atherosclerosis and improved cardiovascular function in obese insulin-resistant mice. Circulation 110, 3259-3269 (2004). Verreth, W. et al. Peroxisome proliferator-activated receptor-alpha,gammaagonist improves insulin sensitivity and prevents loss of left ventricular function in obese dyslipidemic mice. Arteriosclerosis Thrombosis and Vascular Biology 26, 922-928 (2006). Nishina, P.M., Lowe, S., Wang, J.L. & Paigen, B. Characterization of PlasmaLipids in Genetically-Obese Mice - the Mutants Obese, Diabetes, Fat, Tubby, and Lethal Yellow. Metabolism-Clinical and Experimental 43, 549-553 (1994). Nishina, P.M., Naggert, J.K., Verstuyft, J. & Paigen, B. Atherosclerosis in Genetically-Obese Mice - the Mutants Obese, Diabetes, Fat, Tubby, and Lethal Yellow. Metabolism-Clinical and Experimental 43, 554-558 (1994). Gruen, M.L. et al. Plasma insulin levels predict atherosclerotic lesion burden in obese hyperlipidemic mice. Atherosclerosis 186, 54-64 (2006). Merat, R., Raoul, H., Leste-Lasserre, T., Sonigo, P. & Pancino, G. Variable constraints on the principal immunodominant domain of the transmembrane glycoprotein of human immunodeficiency virus type 1. Journal of Virology 73, 5698-5706 (1999).  87  105. 106. 107.  108.  109. 110. 111. 112.  113. 114. 115. 116.  117.  118.  Bernal-Mizrachi, C. et al. Dexamethasone induction of hypertension and diabetes is PPAR-alpha dependent in LDL receptor-null mice. Nature Medicine 9, 10691075 (2003). Schreyer, S.A., Lystig, T.C., Vick, C.M. & LeBoeuf, R.C. Mice deficient in apolipoprotein E but not LDL receptors are resistant to accelerated atherosclerosis associated with obesity. Atherosclerosis 171, 49-55 (2003). Towler, D.A., Bidder, M., Latifi, T., Coleman, T. & Semenkovich, C.F. Dietinduced diabetes activates an osteogenic gene regulatory program in the aortas of low density lipoprotein receptor-deficient mice. Journal of Biological Chemistry 273, 30427-30434 (1998). Schreyer, S.A., Vick, C., Lystig, T.C., Mystkowski, P. & LeBoeuf, R.C. LDL receptor but not apolipoprotein E deficiency increases diet-induced obesity and diabetes in mice. American Journal of Physiology-Endocrinology and Metabolism 282, E207-E214 (2002). Townsend, K.L., Lorenzi, M.M. & Widmaier, E.P. High-fat diet-induced changes in body mass and hypothalamic gene expression in wild-type and leptin-deficient mice. Endocrine 33, 176-188 (2008). DeLany, J.P.L., J.C. Energy Expenditure. in Endocrinology and Metabolism Clinics of North America, Vol. 25 831–846 (1996). Elder, G.A. et al. Increased locomotor activity in mice lacking the low-density lipoprotein receptor. Behavioural Brain Research 191, 256-265 (2008). Bonfleur, M.L., Vanzela, E.C., Ribeiro, R.A., & Dorighello, G., Carvalho, C., Collares-Buzato, C.B., Carneiro, E.M., Boschero, A.C., Oliveira, H. Primary hypercholesterolaemia impairs glucose homeostasis and insulin secretion in lowdensity lipoprotein receptor knockout mice independently of high-fat diet and obesity. Biochim. Biophys. Acta (2009). Kahn, B.B. & Flier, J.S. Obesity and insulin resistance. Journal of Clinical Investigation 106, 473-481 (2000). Foreyt, J.P. et al. Weight-reducing diets: Are there any differences? Nutrition Reviews 67, S99-S101 (2009). Tinsley, F.C., Taicher, G.Z. & Heiman, M.L. Evaluation of a quantitative magnetic resonance method for mouse whole body composition analysis. Obesity Research 12, 150-160 (2004). Ravussin, E., Lillioja, S., Anderson, T.E., Christin, L. & Bogardus, C. Determinants of 24-Hour Energy-Expenditure in Man - Methods and Results Using a Respiratory Chamber. Journal of Clinical Investigation 78, 1568-1578 (1986). Dupuis, L., Oudart, H., Rene, F., de Aguilar, J.L.G. & Loeffler, J.P. Evidence for defective energy homeostasis in amyotrophic lateral sclerosis: benefit of a highenergy diet in a transgenic mouse. Proceedings of the National Academy of Sciences of the United States of America 101, 11159-11164 (2004). Wideman, R.D. et al. Improving function and survival of pancreatic islets by endogenous production of glucagon-like peptide 1 (GLP-1). Proceedings of the National Academy of Sciences of the United States of America 103, 13468-13473 (2006).  88  119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135.  Livak, K.J. & Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402-408 (2001). Eisen, E.J. Results of Growth Curve Analyses in Mice and Rats. Journal of Animal Science 42, 1008-1023 (1976). Lowell, B.B. & Spiegelman, B.M. Towards a molecular understanding of adaptive thermogenesis. Nature 404, 652-660 (2000). Even, P.C., Mokhtarian, A. & Pele, A. Practical Aspects of Indirect Calorimetry in Laboratory-Animals. Neuroscience and Biobehavioral Reviews 18, 435-447 (1994). Gao, Z.G. et al. Inactivation of PKC theta leads to increased susceptibility to obesity and dietary insulin resistance in mice. American Journal of PhysiologyEndocrinology and Metabolism 292, E84-E91 (2007). Isken, F. et al. Deficiency of glucose-dependent insulinotropic polypeptide receptor prevents ovariectomy-induced obesity in mice. American Journal of Physiology-Endocrinology and Metabolism 295, E350-E355 (2008). Isken, F. et al. Metabolic effects of diets differing in glycaemic index depend on age and endogenous glucose-dependent insulinotrophic polypeptide in mice. Diabetologia 52, 2159-2168 (2009). Nogueiras, R. et al. Direct Control of Peripheral Lipid Deposition by CNS GLP-1 Receptor Signaling Is Mediated by the Sympathetic Nervous System and Blunted in Diet-Induced Obesity. Journal of Neuroscience 29, 5916-5925 (2009). Chen, A.S. et al. Inactivation of the mouse melanocortin-3 receptor results in increased fat mass and reduced lean body mass. Nature Genetics 26, 97-102 (2000). Iida-Klein, A. et al. Precision, accuracy, and reproducibility of dual X-ray absorptiometry measurements in mice in vivo. Journal of Clinical Densitometry 6, 25-33 (2003). Masinde, G.L. et al. Quantitative trait loci for bone density in mice: The genes determining total skeletal density and femur density show little overlap in F-2 mice. Calcified Tissue International 71, 421-428 (2002). Nagy, T.R. & Clair, A.L. Precision and accuracy of dual-energy X-ray absorptiometry for determining in vivo body composition of mice. Obesity Research 8, 392-398 (2000). Taicher, G. Quantitative magnetic resonance (QMR) for whole body composition analysis of mice, rats and infants. Obesity Research 11, A48-A48 (2003). Setchell, K.D.R., Lawson, A.M., Tanida, N. & Sjovall, J. General-Methods for the Analysis of Metabolic Profiles of Bile-Acids and Related-Compounds in Feces. Journal of Lipid Research 24, 1085-1100 (1983). Kim, H.J. et al. Differential effects of interleukin-6 and-10 on skeletal muscle and liver insulin action in vivo. Diabetes 53, 1060-1067 (2004). Kim, J.K. et al. Redistribution of substrates to adipose tissue promotes obesity in mice with selective insulin resistance in muscle. Journal of Clinical Investigation 105, 1791-1797 (2000). Halaas, J.L. et al. Weight-Reducing Effects of the Plasma-Protein Encoded by the Obese Gene. Science 269, 543-546 (1995).  89  136.  137.  138. 139.  140. 141. 142.  Bowen, H., Mitchell, T.D. & Harris, R.B.S. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice. American Journal of Physiology-Regulatory Integrative and Comparative Physiology 284, R87-R100 (2003). Gullicksen, P.S., Flatt, W.P., Dean, R.G., Hartzell, D.L. & Baile, C.A. Energy metabolism and expression of uncoupling proteins 1, 2, and 3 after 21 days of recovery from intracerebroventricular mouse leptin in rats. Physiology & Behavior 75, 473-482 (2002). Scarpace, P.J., Matheny, M., Pollock, B.H. & Tumer, N. Leptin increases uncoupling protein expression and energy expenditure. American Journal of Physiology-Endocrinology and Metabolism 36, E226-E230 (1997). Rosenbaum, M., Murphy, E.M., Heymsfield, S.B., Matthews, D.E. & Leibel, R.L. Low dose leptin administration reverses effects of sustained weight-reduction on energy expenditure and circulating concentrations of thyroid hormones. Journal of Clinical Endocrinology & Metabolism 87, 2391-2394 (2002). Halaas, J.L. et al. Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proceedings of the National Academy of Sciences of the United States of America 94, 8878-8883 (1997). Hwa, J.J. et al. Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice. American Journal of Physiology-Regulatory Integrative and Comparative Physiology 41, R1204-R1209 (1997). Leibel, R.L., Rosenbaum, M. & Hirsch, J. Changes in Energy-Expenditure Resulting from Altered Body-Weight. New England Journal of Medicine 332, 621-628 (1995).  90  Appendix A: Ethical Approval of Animal Studies  91  92  93  94  Appendix B: Validation of Methods  95  96  97  98  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069670/manifest

Comment

Related Items