Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Involvement of mitogen-activated protein kinase signalling in plant microtubule function Walia, Ankit 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_walia_ankit.pdf [ 3.83MB ]
Metadata
JSON: 24-1.0069307.json
JSON-LD: 24-1.0069307-ld.json
RDF/XML (Pretty): 24-1.0069307-rdf.xml
RDF/JSON: 24-1.0069307-rdf.json
Turtle: 24-1.0069307-turtle.txt
N-Triples: 24-1.0069307-rdf-ntriples.txt
Original Record: 24-1.0069307-source.json
Full Text
24-1.0069307-fulltext.txt
Citation
24-1.0069307.ris

Full Text

Involvement of Mitogen-activated Protein Kinase Signalling in Plant Microtubule Function  by  Ankit Walia  A THESIS SUBMIflED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2009 © Ankit Walia, 2009  ABSTRACT Plants have developed sophisticated signalling networks that are involved in mediating developmental transitions and environmental signals. Mitogen-activated protein kinases (MPKs) are a class of signalling proteins that are involved in cellular processes that help plants to detect and initiate appropriate responses to numerous development and environmental inputs. The microtubule cytoskeleton plays a pivotal role in plant development and morphogenesis, although the mechanisms that regulate the microtubule-associated proteins and microtubule functions in plant cells are not well understood. I investigated whether perturbations in the microtubule organization triggered by the MICROTUBULE ORGANIZATION] temperature-sensitive mutant (mon-i) could lead to altered transcriptional activity, with a particular interest in the genes  encoding signal transduction components. I showed that perturbations in the microtubule cytoskeleton, achieved through the microtubule disruption phenotype of mon-i, led to changes in the expression of gene transcripts associated with diverse cellular processes, including changes in the expression of the PROPYZAMIDE HYPERSENSITIVE 1(PHS1) gene, a member of MPK-specific signal transduction pathway, which has been previously implicated in mediating cortical microtubule functions in plant cells. Through biochemical, cell biological and genetic tools, I identified MPK1 8 as one of the MPKs that interacts with the PHS 1 phosphatase and demonstrated through reverse genetics analysis that manipulation of MPK 18 results in conditional and subtle defects in the microtubule functionality. In contrast, analysis of MPK 12, which was shown to also interact with PHS 1, identified no microtubule-specific function. My live cell imaging studies revealed that the absence of MPK 18 protein appears to have no effect on microtubule plus end growth and shrinkage rates, indicating that MPK1 8 indirectly influences microtubule functions. Based on the genetic analysis, MOR1 itself does not appear to be a target  of the putative MPK1 8 signalling module. Preliminary attempts to obtain evidence for direct impacts of PHS activity on MOR1 failed to demonstrate that manipulation ofPHS1 altered either subcellular localization or phosphorylation status of the MOR1 protein. These results provide a platform that should facilitate future investigations aimed at understanding the role of MPK signalling in the regulation of plant microtubule functions.  III  TABLE OF CONTENTS ABSTRACT  .  TABLE OF CONTENTS  ii  iv  LIST OF TABLES  viii  LIST OF FIGURES  ix  LIST OF ABBREVIATIONS  xi  ACKNOWLEDGEMENTS  xiii  CHAPTER 1. General introduction  1  INTRODUCTION  1  MITOGEN-ACTIVATED PROTEIN KINASES  1  Mitogen-activated Protein Kinase Kinase Kinases (MKKKs)  6  Mitogen-activated Protein Kinase Kinases (MKKs)  7  Mitogen-activated Protein Kinases (MPKs)  8  MPK-SPECIFIC PROTEIN PHOSPHATASES (MKPs)  12  MICROTUBULE STRUCTURE AND DYNAMICS  16  Cortical Microtubule Arrays  17  Mitotic Microtubule Arrays  18  Microtubule-associated and Regulatory Proteins  20  Mitogen-activated Protein Kinases and Microtubule Organization  24  OBJECTIVES  26  CHAPTER 2. Transcriptional response to microtubule disorganization stimulus triggered by the mon-i temperature-sensitive mutant 28 INTRODUCTION  28  RESULTS  31  Transcriptional Profiling of Differentially Expressed Genes  31  Gene Ontology of Differentially Expressed Genes  46  Real-time PCR Validation of Microarray Results  51  iv  DISCUSSION  .  MATERIAL AND METHODS  .  55 60  Plant Materials and Growth Conditions  60  RNA Extraction for Microarray Analysis  60  cDNA Labelling  61  Hybridization  61  Microarray Data Analysis  62  Real-time PCR Analysis  63  CHAPTER 3. Identification of a specific mitogen-activated protein kinase, MPK 18, as a substrate ofPHS1  65  INTRODUCTION  65  RESULTS  67  Identification of MPK18 as Substrate ofPHS1  67  PHS1 and MPK18 share Similar Expression Patterns  70  Mutant mpkl8-1 Plants Display Differential Sensitivity to Microtubule-disrupting Drugs. 74 Organization of Cortical Microtubule Arrays in mpkl8-1 Roots  78  Absence ofMPK18 Partially Rescues phsl-] Phenotypes  80  DISCUSSION  83  MATERIALS AND METHODS  88  Plant Materials and Growth Conditions  88  Yeast Two-Hybrid Assays  88  Transient Tobacco Infiltration Assays  88  Recombinant Protein Production and In Vitro De-phosphorylation Assay  91  Generation of Constructs and Transgenic Plants  90  RNA Isolation and RT-PCR  91  Immunohistochemistry and Microscopy  91 V  CHAPTER 4. Effects of conditional suppression of PHS 1 and MPK 12 on microtubule-related functions 92 INTRODUCTION  92  RESULTS  94  PHS1-RNAi Seedlings Displayed Phenotypic Defects in Cell Elongation and Growth  ..  94  The Organization of Cortical Microtubules is Perturbed in PHS 1 -RNAi plants  96  MPKJ2 Gene Transcripts are Specifically Expressed in Guard Cells  98  Microtubule Array Organization in Guard Cells ofMPK12-RNAi Plants  100  DISCUSSION  102  MATERIALS AND METHODS  106  Plant Materials and Growth Conditions  106  Immunohistochemistry and Microscopy  106  Histochemical Analysis of GUS Activity  107  CHAPTER 5. The role of a PHS1-MPK18 signalling module in mediating MOR1 functions 108 INTRODUCTION  108  RESULTS  111  The Spatial Organization and Plus End Microtubule Growth and Shrinkage Rates in the mpkl8-1 Mutant 111 MOR1 Functions are not Altered in the Absence of MPK18  114  MOR1 Remains Associated with Microtubules in phsl-1 Mutant  116  MOR1 Protein does not appear to be Phosphorylated in the phsl-1 Mutant  118  DISCUSSION  120  MATERIALS AND METHODS  126  Plant Materials and Growth Conditions  126  Live Cell Imaging  126  Immunolabelling of Microtubules and MOR1  128  Western Blotting  128 vi  CHAPTER 6. Conclusion and future directions  129  SUMMARY OF THE RESULTS  129  FUTURE DIRECTIONS  130  Diverse Cellular Processes are Engaged when the Microtubule Cytoskeleton is Perturbed 130 Identification of a Specific Mitogen-activated Protein Kinase, MPK1 8, as an Interactor of PHS1 132 Identification of Targets of the MPK18 Signalling Module  136  Relationship between MOR1 and PHS1  137  BIBLIOGRAPHY  139  APPENIJIX. List of publications  160  VII  LIST OF TABLES Table 2.1 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°C for2hours 33 Table 2.2 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°C 34 for 4 hours Table 2.3 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°Cfor 8 hours  36  Table 2.4 Genes down-regulated in the mon-i mutant relative to wild type after incubation at3O°C for 2 hours 37 Table 2.5 Genes down-regulated in the mon-i mutant relative to wild type after incubation at 30°C for 4 hours 42 Table 2.6 Genes down-regulated in the mon-i mutant relative to wild type after incubation at 44 30°Cfor8h Table 2.7 Differentially expressed signalling gene transcripts in the mon-i mutant relative to wild type after incubation at 30°C for 2h 45 Table 2.8 Differentially expressed signalling gene transcripts in the mon-i mutant relative to wild type after incubation at 30°C for 4h 45 Table 2.9 Differentially expressed signalling gene transcripts in the mon-i mutant relative to wild-type after incubation at 30°C for 8h 45  VI I I  LIST OF FIGURES Figure 1.1 Phylogenetic tree and domain structures of plant MPKs  4  Figure 1.2 Phylogenetic relationships of Arabidopsis, poplar and rice MPK genes  5  Figure 1.3 Microtubule arrays through plant cell cycle  19  Figure 2.1 Differentially expressed gene transcripts in the microarray analysis  32  Figure 2.2 GO annotations of whole genome characterization  48  Figure 2.3 GO annotations of genes up-regulated in the microarray analysis  49  Figure 2.4 GO annotations of genes down-regulated in the microarray analysis  50  Figure 2.5 Real time PCR validation of the microarray data  53  Figure 2.6 Semi-quantitative PCR to determine the expression pattern of MR/V and PHSJ  54  Figure 3.1 PHS1 interaction with Arabidopsis MPK18  68  Figure 3.2 Expression pattern of PHSJ and MPKI8  71  Figure 3.3 Subcellular localization ofPHS1 and MPK18  73  Figure 3.4 Loss-of-function mutation in MPKJ8 leads to defects in microtubule-related functions in Arabidopsis 76 Figure 3.5 Molecular complementation of mpkl8-1 plants with 35S::GFP-MPKJ8  77  Figure 3.6 Microtubule stability in mpkl8-1 roots  79  Figure 3.7 Genetic interaction between mpkl8-1 and phsl-1  81  Figure 3.8 Interaction of PHS 1-1 (R64C) with MPK 18  82  Figure 4.1 PHS 1 -RNAi seedlings display defects in cell elongation and growth  95  Figure 4.2 Organization of microtubules in PHS1-RNAi roots  97  Figure 4.3 GUS activity controlled by the MPKJ2 promoter throughout plant development.... 99 Figure 4.4 Radial microtubule array organization in guard cells of EV and MPK 1 2-RNAi plants 101 Figure 5.1 Spatial organization and plus end growth and shrinkage of cortical microtubules. 112 ix  Figure 5.2 Plus end microtubule growth and shrinkage rates are not significantly different in mpkl8-1 compared to the wild type 113 Figure 5.3 Genetic interaction between mon-i and mpki8-i mutants  115  Figure 5.4 Double immunofluorescence labelling of microtubules and MOR1 in cotyledon epidermal cells 117 Figure 5.5 Immunoblotting analysis ofwild-type,phsi-iandphsinull allele protein extracts with phospho-serine and phospho-threonine antibodies 119  x  LIST OF ABBREVIATIONS 3AT 6X ABA ACC ACS ANP BiFC BR CA CaM CaMV CDPK DNA EGF ET GA GFP GO GOF GST GUS HIS IAA JA LB LEU LOF MAP MKP MT MPK MPKK MPKKK MBP MeJA miRNA mRNA NIMA ORF PAGE PBS PCR  3-amino-i, 2, 4-triazole radioactive isotope of phosphorus hexameric histidine tag abscisic acid 1 -aminocyclopropane- 1 -carboxylic acid ACC synthase Arabidopsis NPK 1-related protein kinase bimolecular fluorescence complementation brassinosteroids constitutively active calmodulin-binding protein cauliflower Mosaic Virus calcium dependant protein kinase deoxyribonucleic acid Elongation growth factor ethylene gibberellic acid green fluorescent protein gene ontology gain-of-function glutathione-S-transferase f3-glucuronidase histidine indole-3 -acetic acid jasmonic acid luria-Broth leucine loss-of-function microtubule associated protein mitogen activated protein kinase phosphatase microtubule mitogen activated protein kinase mitogen activated protein kinase kinase mitogen activated protein kinase kinase kinase myelin basic protein methyl jasmonate micro RNA messenger RNA never in mitosis, gene.A open reading frame polyacrylamide gel electrophoresis phosphate buffer saline polymerase chain reaction  xi  PR RNA RNAi RFP RT SC TAIR TF TRP URA WT X-gluc Y2H YFP  pathogenesis-related ribonucleic acid RNA interference red fluorescent protein reverse transcription synthetic complete The Arabidopsis Information Resources transcription factor tryptophan uracil wild-type 5-bromo-4-chloro-3-ondoyl-glucuronide yeast two hybrid yellow fluorescent protein  xi  ACKNOWLEDGEMENTS I would like to thank several people who have contributed and helped me during my Ph.D. program. First of all, I am thankful to my supervisors, Dr. Geoffrey Wasteneys and Dr. Brian Ellis for providing me with the opportunity to pursue graduate work in their respective labs. I sincerely appreciate their contributions in setting up the research project, sharing and encouraging the research ideas and stimulating my interest in signalling and plant cytoskeleton. The weekly meetings with Geoff were very important and I enjoyed this opportunity to learn about the diverse functions of the plant cytoskeleton. I would also like to thank my committee members, Dr. Leonard Foster and Dr. Jim Kronstad, for their input into this research project. Thanks to Jin Suk Lee, Hardy Hall, Apurv Bhargava, QingNing Zeng, Jia Cheng, Doris Wong and Adrienne for their assistance with biochemical work and gene profiling experiments. Also, I thank Eiko Kawamura, Miki Fujita, and Chris Ambrose for their assistance with using microscopes and developing imaging methods. Thanks to Eric Johnson and Yi Zhang for teaching me crossing and their assistance with gene expression studies. I appreciate the assistance from Christopher Keeling and Philip (Joerg Bohlmann lab) with regard to the purification of recombinant proteins. I would like to thank Dr. Takashi Hashimoto, NAIST Japan, for plisl-1 seeds and sharing unpublished results. I greatly appreciate the kind gift of BiFC vectors from Dr. Joachim Uhrig (University of Cologne, Germany). I would like to thank UBC Bioimaging facility, especially Kevin Hodgson for his assistance with confocal microscopy. I thank Rick White and other members of the Arabidopsis Microarray project, UBC, where I performed the microarray experiments. Special thanks to Dr. Santokh Singh with whom, as a teaching assistant, I learned and taught Plant Physiology experiments to the undergraduate students. Finally, I am grateful to my family members for their support. I thank my parents and wife, Pallavi Walia, for their constant encouragement, positive attitude, emotional and moral support throughout this endeavour.  XIII  CIL&PTER 1. General introduction INTRODUCTION Plants have evolved a wide range of mechanisms that help them in development, growth and protection from abiotic and biotic challenges. The success of these mechanisms has relied upon quick and efficient detection of developmental inputs and changes in the environmental conditions and the subsequent ability of plants to initiate a rapid cellular response. One of the earliest responses to developmental transitions and environmental conditions is initiation of an efficient signal transduction network that can rapidly mediate inter- and intra-cellular changes in the cellular homeostasis to evoke appropriate responses. Many such mechanisms are present in plants, including altered redox responses, hormone-based signalling networks, lipid signalling networks and protein phosphorylation-dephosphorylation mechanisms (Galletti et al., 2008; Worrall et al., 2008; Yasuda et a!., 2008; Yoo et al., 2008). Protein phosphorylation networks have been extensively studied in various organisms and involve multiple types of protein kinases, including mitogen-activated protein kinases (MAPK Group, 2002; Zhang and Dong, 2007; Hematy and Hofte, 2008).  MITOGEN-ACTIVATED PROTEIN KINASE PATHWAYS The Mitogen-activated Protein kinase (MPK) family is highly conserved across all eukaryotic taxa (Hamel et al., 2006). Three classes of protein kinases form a typical MPK signalling module: a MPK kinase kinase (MKKK), a MPK kinase (MKK) and a MPK group. Within each group of protein kinases there exists a family of multiple members. The activation of MKKKs occurs through phosphorylation by upstream factors that primarily include receptor kinases and 1  signals perceived at the cell surface. Once the MKKKs are activated, they activate MKKs by phosphorylation of two conserved serine/threonine residues in a —S/T-X -S/T- conserved motif 35 within the activation ioop present in MKKs. Activation of MPKs is then regulated via dual phosphorylation of the conserved TXY- motif located in the activation loop by upstream -  kinases (MKKs). The activated MPKs are capable of phosphorylating downstream substrates, at one or more serine and/or threonine residues within a consensus S/TP motif, and these substrates can include transcription factors, enzymes or microtubule-associated proteins (Liu and Zhang, 2004; Sasabe et al., 2006; Jo 0 et al., 2008; Yoo et al., 2008). Several factors determine the biological outcomes of signalling through MPK cascades. For most of the MPKs, there are specific substrate(s) being regulated within different physiological contexts; however, the determination of substrate specificity remains a complex and poorly understood process (Good et al., 2009) Furthermore, additional regulatory proteins, which .  include phosphoproteins, phosphatases, scaffold and adapter proteins, contribute to control of the magnitude and duration of MPK-based phosphorelay activation. Finally, the spatio-temporal patterns of expression and localization of various members of MPKs in different tissue types are important determinants in specifying outcomes of MPKs signalling cascades (Karlsson et al., 2006; Zhang and Dong, 2007). In mammals, thirteen MPKs have been characterized, and based on their functions and structures these MPKs are divided into three major groups: the extracellular signal-regulated protein kinases (ERKs), the p38 MPKs and the c-Jun NH -terminal kinases (INKs) (Cohen, 1997). The 2 members of the ERK family share a conserved motif -TEY- in their activation loop and mediate responses to the growth factors such as EGF (Morrison and Davis, 2003). In contrast, p38 MPKs and members of INK MPKs possess a -TGF- and -TPY- conserved motif in their activation ioop, 2  respectively. Both p38 MPKs and JNK MPKs are mainly involved in the cellular responses to osmotic stress, inflammatory cytokines, and endotoxins (Kumar et al., 2003; Waetzig and Herdegen, 2005). There are five MPKs in Saccharomyces cerevisiae (yeast), and all of these MPKs contain the conserved -TXY- motif in the activation loop. Yeast MPK Fus3, Kssl, and S1t2 contain a similar -TEY-motif (Chen and Thorner, 2007). The cellular responses to pheromones are mediated by Fus3, while adjustments to nutrient-limiting conditions are mediated by Kssl (Roberts and Fink, 1994; Maleri et al., 2004). Cell wall repair and budding processes are primarily mediated by the Slt2 MPK in yeast (Dardalhon et al., 2009). A homologue of p38 MPK in yeast, Hogi, contains a -TGY- motif and participates primarily in osmotic stress signalling (Yaakov et al., 2009). The Arabidopsis thaliana genome encodes more than 60 members within the MKKK family, 10 members within the MKK family and 20 members within the MPK gene family. All of the Arabidopsis MPKs are homologues of human ERKs. Based on the protein sequence similarity, these MPKs can be divided into four groups (Figure 1.1). Furthermore, based on the sequence comparison of the conserved amino acid motif, -TXY-, which gets phosphorylated by upstream MKKs, these 20 MPKs can be further divided into two sub-types: MPKs containing a TEY motif and MPKs containing a TDY motif (MAPK Group, 2002; Hamel et al., 2006). This complex network of IVIKKKs, MKKs and MPKs makes this family of phosphoproteins very interesting to study because the potential permutations of this module could provide plants with a wide range of combinations that could be used to deal with developmental transitions and environmental signals. The availability of complete genome sequences for rice and poplar now makes it possible to further examine the evolution and gene expression patterns of this family in a broader evolutionary context (Hamel et al., 2006) (Figure 1.2). However, this complexity also 3  highlights the potential for functional redundancy that may exist within ]V]PK family and poses challenges to dissect the biological functions of individual members of the IVIPK family.  T*Y (Subgroup) Group motif  TOY  -  Ttt’ TtW TOY  TO  •  Glutamic acid.rich region • CD domain Kinase domain Lj Serine-rich region  0  lOOaa TRENDS  .i  PI,t Sa.ncr  Figure 1.1 Phylogenetic tree and domain structures of plant MPKs [From Ichimura et al. (2002)]. Arabidopsis MPKs are highlighted in red. 4  7ENDSinS.’en.e  Figure 1.2 Phylogenetic relationships of Arabidopsis, poplar and rice MPK genes [From Hamel  et al. (2006)].  5  Mitogen-activated Protein Kinase Kinase Kinases (MKKKs) Plant MPK-based signalling networks have been shown to regulate a number of important biological processes, including developmental transitions, responses to environmental stresses and phytohormone signalling (Bergmann et al., 2004; Colcombet and Hirt, 2008; Fiil et al., 2009). At the MKKK level, a putative Raf-like MPK kinase kinase, CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1), has been implicated as a negative regulator of ethylene signalling (Kieber et al., 1993). Recently, CTR1 has been shown to act as a concentration-dependent repressor of a biosynthesis-dependent auxin gradient that modulates planar polarity in the root tip (Ikeda et al., 2009). Mutations in three related MKKKs, ANPJ-3, led to developmental defects in Arabidopsis cytokinesis (Krysan et al., 2002). The tobacco orthologue of ANP1-3, NPK1, has been shown to be a regulator of cell plate formation in plant cytokinesis (Nishihama et al., 2001) and plant innate immunity (Jin et al., 2002). Over-expression of a FERTILIZATION-RELATED KfNASE 2 (ScFRK2), a MAP kinase kinase kinase from Solanum chacoense, led to defects in ovule and  pollen development (O’Brien et al., 2007). A mutation in the Arabidopsis YODA locus, which encodes a MKKK, has been shown to display defects in embryo and stomatal development (Bergmann et al., 2004; Lukowitz et al., 2004). Recently, a report by Bayer and colleagues (2009) identified a gene, SHORT SUSPENSOR (5SF), which acts as an upstream factor triggering YODA signalling, thereby providing an essential temporal cue to initiate the asymmetric first division of the zygote. SSP encodes an interleukin- 1 receptor-associated kinase (IRAK)/Pelle-like kinase and functions through a unique parent-of-origin effect: SSP mRNA is present in mature pollen but does not get translated. Instead the mRNA is delivered to the zygote and endosperm during fertilization where SSP protein transiently accumulates (Bayer et al., 2009). 6  Several members of the MKKK family are also reported to mediate responses to abiotie and biotic insults (Suarez-Rodriguez et al., 2007; Gao and Xiang, 2008; Gao et al., 2008). MEKK1 was shown to regulate redox homeostasis, and a number of genes involved in maintaining cellular redox control were misregulated in mutant mekkl seedlings (Nakagami et al., 2006). Although these studies provide strong genetic and biochemical evidence for MKKKs being involved in mediating developmental and stress biology, the precise molecular mechanisms that link perception of signals arriving at the cell periphery with activation of MKKKs remains poorly understood in plant cells (He et al., 2006; Lehti-Shiu et al., 2009).  Mitogen-activated Protein Kinase Kinases (MKKs)  In Arabidopsis, eight out of 10 MKKs have now been characterized and shown to mediate hormonal signalling and stress biology. Mutations in MKK7 were shown to impair auxin transport mechanisms and mutant mkk7 seedlings develop few lateral roots, altered leaf venation patterns and perturbed curvatures in gravitropism assays (Dai et al., 2006). Expression of the MKK7 gene is enhanced in response to pathogen infection (Zhang et al., 2007). Overexpression  of MKK7 led to accumulation of elevated levels of salicylic acid, increased pathogenesis-related (PR) gene expression and enhanced resistance to pathogens. Similarly, functional characterization of MKK1 and MKK2 demonstrated their biological functions in salt-induced signalling and innate plant immunity (Meszaros et al., 2006; Brader et al., 2007; Gao et al., 2008). MKK3 was shown to be upstream of group Cl MPKs and involved in mediating jasmonic acid signalling and disease resistance (Doczi et al., 2007; Takahashi et al., 2007). Interestingly, four MKKs, MKK4, MKK5, MKK7 and MKK9 have all been shown to regulate ethylene biosynthesis and signalling (Liu and Zhang, 2004; Liu et al., 2008; Yoo et al., 2008). Ethylene 7  serves as a major stress hormone in plants, so it is perhaps not surprising that the signalling with which it is involved is tightly controlled by multiple members of the MPK family. Yoo and colleagues (2008) demonstrated that a MKK9-MPK3IMPK6 cascade promoted ETHYLENEINSENSITIVE 3 (EJN3)-mediated transcription during ethylene signalling. Furthermore, the MKK9-GFP reporter protein was found to be translocated from the cytoplasm into the nucleus in  response to 1 -aminocyclopropane- 1 -carboxylic acid (ACC) treatment, suggesting that MKK9mediated control of EIN3 expression occurs in nucleus. Although most of the MKKs have been shown to mediate environmental and hormonal signalling pathways, only LOF in mkk6 mutant  has been implicated in mediating developmental transitions. A tobacco MKK, NQK1, which is an orthologue of Arabidopsis MKK6, has been shown to regulate cytokinesis (Takahashi et al., 2004). Preliminary evidence indicates that MKK6 in Arabidopsis also regulates cytokinesis, and that mutant mkk6 plants are severely dwarfed and compromised in maintaining proper cell divisions  (Q. Zeng and B. Ellis, Michael Smith Laboratory, pers comm.).  Mitogen-activated Protein Kinases (MPKs) Although there are 20 MPKs in Arabidopsis, our knowledge of MPK-based regulatory processes is dominated by information about the functions of the MPK3/MPK6 pair of MPKs, which have been shown to regulate a wide range of biological processes (Djamei et al., 2007; Wang et al., 2007c; Lampard et al., 2008; Wang etal., 2008; Yoo et al., 2008). Similarly, MPK3/6 orthologues in other plant species regulate a spectrum of phenomena (Samuel and Ellis, 2002; Cheong et al., 2003; Samuel et al., 2005; Mishra et al., 2006). Several upstream MPKKs have been shown to phosphorylate MPK3/6 in both in vitro and in vivo kinase assays (Lee et al., 2008; Popescu et al., 2009). Liu and Zhang (2004) showed that MPK6 phosphorylates the ethylene 8  biosynthetic enzyme, ACC synthase (ACS2/6). The phosphorylation of ACS leads to its stabilization and thus promotes ethylene synthesis. Stomatal development and patterning is also regulated by MPK3/6 (Wang et al., 2007b). Loss-of-function of MPK3I6 disrupted the cell fate specification between stomata and pavement cells, and led to clustering of stomata in the leaf epidermis. Recently, Lampard and colleagues (2008) showed that a transcription factor, SPEECHLESS, which mediates epidermal cell fate specification and is involved in stomatal development, is a direct target of 1V1PK316 in vitro. Mutational manipulations of the putative phosphorylated residues within SPEECHLESS protein led to further insights into the phosphorylation-dependant regulation of stomatal development. Similarly, loss-of-function of MPK3/6 results in disruption of cell division in the integument specifically during ovule development. This phenomenon was linked to the haplo-insufficiency of MPK3 operating in the mpk6 mutant background (Wang et al., 2008). Suppression of MPK6 was earlier shown to lead to enhanced disease susceptibility and to compromise the expression of pathogen-inducible genes (Menke et al., 2004). In this case the MPK3/6 activation is believed to occur through the upstream activity of MKK4I5. However, activation of the MPK3/6 pathway by signals initiated at the MKK9 level also led to accumulation of camalexin, a major phytoalexin, and to upregulation of camalexin biosynthetic genes. Camalexin accumulation provides protection against infection by specific groups of pathogen inArabidopsis (Ren et al., 2008). Another MPK, MPK4, has been shown to negatively regulate systemic acquired resistance and mpk4 mutants have defects in salicylic acid and jasmonic acid signalling. The mutant mpk4 plants are severely dwarfed, unlike mpk3 and mpk6 single mutants, and several genes involved in pathogen signalling and cell wall modification are differentially regulated in mpk4 plants (Petersen et al., 2000). Further studies identified MKS 1 (MAP kinase 4 substrate 1), as a 9  substrate of MPK4 (Andreasson et al., 2005). Overexpression and loss-of-function of MKS 1 compromised pathogen resistance and PR (Pathogenesis related) gene expression. Recently, it was shown that MPK4 forms a complex with MKS 1 and a WRKY transcription factor, WRKY33. MKS1 and WRKY33 are released from the MPK4 complex upon challenge with Pseudomonas syringae or flagellin. The released WRKY33 then binds to the PRYTOALEXIN  DEFICIENT 3 (PAD3) promoter and facilitates the accumulation of the antimicrobial camalexin (Qiu et a!., 2008). Collectively, these elegant studies demonstrate that MPK4 forms a functional macromolecular complex and participates in regulation of disease resistance through a coordinated control ofMKS1 and WRK33 to control expression of genes involved in defence against bacterial effectors. Using pair-wise yeast two-hybrid assays, Lee and co-workers identified a novel MPK, MPK12, which interacts with a MPK-specific phosphatase, INDOLE-3-BUTYRIC ACID-RESPONSE5 (IBR5). In transgenic plants with reduced MPK 12 expression, root growth was hypersensitive to exogenous auxin, suggesting that MPK12 is a negative regulator of auxin signalling in roots (Lee et a!., 2009). Using pair-wise yeast two hybrid assays, novel interactions are also reported for several MKK-MPK combinations (Lee et a!., 2008). Functional characterization of the biological significance of these novel interactions will further expand our knowledge about MPK-based control of cellular processes (B. Ellis, Michael Smith Laboratories, pers comm.). Although biological functions of specific MPKs are frequently reported, very few studies have identified complete MKKK-MKK-MPK modules participating in a particular biological context. Asai and colleagues (2002) reported a complete plant MAP kinase cascade (MEKK1, MKK4/MKK5 and MPK3/MPK6) involved in flagellin-mediated disease resistance; whereas a  MEKK1, MKK1/MKK2, MPK4 kinase cascade was shown to regulate innate immunity in plants 10  (Gao et a!., 2008). A major challenge to identifying complete modules is that there may exist a wide range of combinations of MKKKs-MKKS-MPKs through which plants can transduce various signals perceived at the cell surface. Adding to the complexity may be the requirement for scaffold and adapter proteins to further fine-tune these regulatory networks. Surprisingly, compared to other systems, few scaffold and adapter proteins have so far been described that mediate signalling pathways in plants (Qiu et al., 2002; Robert et al., 2008; Ullah et al., 2008; He et a!., 2009). Identification of scaffold and adapter proteins that may facilitate MPK signalling cascades would be highly informative in helping us to understand the full complexity of this group of signalling proteins.  11  MPK-SPECIFIC PROTEIN PIIOSPIIATASES (MKPs) The activation of MPKs can be reversed by dephosphorylation through the action of phosphoprotein phosphatases, including Tyr-specific phosphatases, Ser/Thr phosphatases and dual-specificity phosphatases such as the MPK-specific phosphatases (MKPs) (Keyse, 2000). The phosphorelay that begins in response to external or internal cues is tightly regulated by the precise duration and magnitude of MPK activation, and timely dephosphorylation of MPKs by  the phosphatases. Any perturbation in this phosphorelay, either through altered activity status of kinases and phosphatases, or perturbed kinase-phosphatase physical association, could lead to misregulation of downstream substrates (Owens and Keyse, 2007; Popescu et al., 2009). Thus, control of phosphoproteins by phosphatases is another important regulatory mechanism that plays a pivotal role in determination of cellular output initiated through phosphorelay signalling. Research in mammalian systems first identified a group of dual-specificity phosphatases as specific negative regulators of MPKs. These phosphatases, which were later named MPK specific phosphatases (MKPs) can dephosphorylate both pTyr and pSer/pThr residues. Consequently, they inactivate MPKs through dephosphorylation of these residues within the  -  TXY- motif located in the activation loop of MPKs (Theodosiou and Ashworth, 2002). In  mammals, the MKP gene family consists of thirteen members. Most of these members have been characterized, and based on the current information, MKPs are involved in complex regulatory networks involving specific substrates and dynamic expression and localization patterns (Karlsson et al., 2006). Based on their MPK substrate preference, mammalian phosphatases are divided into four different groups (Zhang and Dong, 2007). Group one phosphatases consists of phosphatases that can dephosphorylate ERKs. Members of this group control stress and developmental processes 12  and include VHR, MKP2, MKP3, MKP4 and MKP6 (Owens and Keyse, 2007). Group two phosphatases prefer JNKs as their substrates and consist of four members (VH5, Pac-1, MKP5 and MKP7). MKP5 has been reported to be an important regulator of inflammatory cytokine production (Zhang et al., 2004), and regulation of innate and immune responses is a general feature of members of this group. Group three phosphatases include MKP1 and DSP2, which have a substrate preference for p38 MPKs (Abraham and Clark, 2006). Group four consists of VH3 and PYST2 but the substrate preference of members of group four remains unknown. In  yeast, two MKPs have been identified. Msg5 mediates the pheromone response by dephosphorylating the Fus3 MAPK (Andersson et al., 2004). The other MKP, Sdpl, shares high sequence similarity to Msg5 but has been shown to target S1t2 MPK in response to heat shock (Hahn and Thiele, 2002). Based on protein sequence similarity within the catalytic domains to mammalian MPK-specific phosphatases, there are five MPK-specific phosphatases predicted to be encoded in the Arabidopsis genome (Kerk et al., 2002). This implies that each MKP family member is likely to regulate multiple MPKs under specific sets of physiological conditions. In Arabidopsis, all five MKPs are now being functionally characterized and it is clear that they regulate a wide range of  biological processes. AtMKP1 has been shown to interact with MPK6 and is involved in salinity and genotoxic stress responses. Mutant mkpl seedlings are hypersensitive to genotoxic stress and resistant to high salinity (Ulm et al., 2002). Furthermore, AtMKP1 was shown to be a calmodulin-binding protein (CaM) (Lee et al., 2008). Gupta and colleagues showed that AtDsPTP1 could dephosphorylate MPK4 in vitro (Gupta et al., 1998); however, not much is known about the biological functions regulated by AtDsPTP 1. Similar to AtMKP 1, AtDsPTP 1 also physically interacts with CaM 13  family proteins (Yoo et al., 2004). Overall, these studies provide evidence that calcium signalling and MAPK signalling may converge under specific physiological conditions. AtMKP2 has been reported to dephosphorylate MPK3/MPK6 in vitro and to be involved in ozone and harpin-induced cell death processes. Interestingly, recombinant MPK3 and MPK6 were also found to stimulate the catalytic activity of MKP2 in vitro (Lee and Ellis, 2007). Using pair-wise yeast two-hybrid assays, AtMKP2 was shown to physically interact with MPK8 and MPK 15 (Lee JS and Ellis, unpublished results). What biological functions might be regulated  through the MKP2-MPK8/MPK15 complex remains to be determined but functional characterization of AtMKP2 points towards the regulation of trichome development (Jia Cheng and Brian Ellis, unpublished results). Collectively, these studies highlight the fact that members of MKPs regulate different sets of MPKs during stress and developmental pathways. A mutation in the MKP, INDOLE-3-BUTYRIC ACID-RESPONSE5 (U3R5), was earlier reported to confer reduced sensitivity to auxin and abscisic acid (ABA) in Arabidopsis roots (Monroe-Augustus et al., 2003). IBR5 was found to interact with MPK12 in yeast two-hybrid assays, and the IBR5-MPK12 dyad was shown to mediate auxin sensitivity, but not ABA responses, in Arabidopsis roots (Lee et al., 2009). Interestingly, IBR5 has been shown to promote auxin responses using a signal pathway distinct from TIR1 -mediated repressor degradation (Strader et al., 2008). It remains to be seen whether MPK12 function also uses a mechanism distinct from TIR1 -mediated degradation to regulate auxin reponses. Mutations in another MKP, PROPYZAMIDE HYPERSENSITIVE 1 (PHS1), led to defects in cortical microtubule organization and ABA-mediated regulation of stomatal cell movements (Naoi and Hashimoto, 2004; Quettier et al., 2006). Naoi and Hashimoto identified plisl-1 through forward genetic screens, and reported that phsl-1 to be a point mutation in which a 14  conserved Arg residue within the putative MPK-binding motif of the MKP is exchanged with Cys. The phsl-1 seedlings exhibit phenotypes indicative of compromised cortical microtubule functions. Quettier and coworkers reported that the phsl-3 allele (a T-DNA insertion within the promoter region) provokes a hypersensitive response to ABA and leads to upregulation of ABAresponsive genes. Specifically, the ‘in planta’ aperture ofphsl-3 stomata is reduced and the inhibition of light-induced opening of stomata by ABA is stronger inphsl-3 compared to wildtype leaves. Furthermore, there is a genetic interaction between MICROTUBULE ORGANIZATION 1 mutant allele mon-i and phsl-1 at the permissive temperature suggesting that MOR1 functions might be influenced by PHS1 signalling (Naoi and Hashimoto, 2004). Despite extensive evidence of MPK cascades being involved in mediating a wide range of biological processes, the identification of direct downstream targets of activated MPKs has been limited to only a few proteins. However, recent work by Feilner et al (2005) and Popescu and colleagues (2009), using high-density protein microarrays, identified a large set of proteins that could be the direct targets of MPK pathways (Popescu et al., 2009). There were no specific microtubule-associated proteins found in these large scale protein microarrays, except an isoform of MAP65 family of MAPs, MAP65-1, which was shown to be weakly phosphorylated by MPK6 (Popescu et al., 2009). Definition of the determinants of specificity among MPK-based networks and of MPK-substrate interactions, the biological significance of a particular MPK substrate complex and the mechanisms by which these combinations are fine-tuned to allow integration of multiple environmental and developmental inputs, remain fundamental challenge in the study of MPK-based signalling networks.  15  MICROTUBULE STRUCTURE AND DYNAMICS  The plant cytoskeleton is a network of filamentous proteins that includes microtubules and actin microfilaments, and helps organize the structures and activities of the cell (Wasteneys and Galway, 2003). While the classical cytoskeleton is found in eukaryotes, orthologues of tubulin and actin have also been identified in bacteria (Errington, 2003). Microtubules are dynamic polymers that consist of af3-tubulin heterodimers that continuously undergo growth (polymerization) and shrinkage (depolymerization) within the cell. The end at which 13-tubulin is exposed is called ‘plus end’ whereas the other end, where nucleation of microtubules initiates, is called ‘minus-end’. Most of the polymerization occurs at the plus ends, while the minus ends are biased for slow depolymerization (Mitchison and Kirschner, 1984; Sammak and Borisy, 1988). GTP-bound 3-tubulin is added at the growing end (i.e. plus end), forming a sheet-like structure that closes into a hollow tube, typically consisting of 13 protofilaments. The GTP bound to 13tubulin is hydrolysed to GDP upon contact with the exposed surface of an o-tubulin subunit at the polymer end. Protofilaments containing GDP bound 13-tubulin are protected from depolymerization by a GTP-cap structure at the growing ends (Mitchison, 1993). Loss of this GTP-cap converts growing microtubules to depolymerising polymers (i.e. catastrophe), while gain of a GTP-cap restores microtubule growth (i.e. rescue). In addition to growth and shrinkage states, mierotubules also display ‘pausing’, a state in which there is no significant net growth or shrinkage (Hashimoto, 2003; Howard and Hymann, 2003). This process is called dynamic instability and is important for many cellular functions such as cell elongation, division and determination of cell polarity. When the ‘minus-ends’ are not covered with the nucleation complex containing ‘y-tubulin, the increased rates of polymerization at ‘plus-end’ and depolymerization at ‘minus-end’ result in cycling of tubulin subunits through the polymer, 16  referred to as ‘treadmilling’. Thus, the net length of microtubules undergoing treadmilling can remain constant (Shaw et a!., 2003). Cortical Microtubule Arrays In expanding interphase plant cells, microtubules usually form parallel arrays in the cell cortex. Cell elongation is perpendicular to the orientation of these cortical microtubules, whose close correspondence with the movement of cellulose synthase complexes in the plasma membrane (Paredez et al., 2006; Lloyd and Chan, 2008) is thought to regulate the properties of cellulose microfibrils, and to thereby control the direction of cell expansion (Wasteneys, 2002; Smith and Oppenheimer, 2005). However, the relationship between cortical microtubule arrays, cellulose microfibrils and cell expansion is more complex than previously thought. The most accepted view supports the cellulose synthase constraint model in which the cortical microtubules constrain the movement of cellulose synthase complexes at the plasma membrane (Giddings and Staehelin, 1991). Simultaneous live cell imaging with cellulose synthase proteins (CESA)- and tubulin-reporters provides strong evidence that CESA complexes do track on microtubules and that depolymerization of microtubules using microtubule-disrupting drugs changes the distribution and pattern of CESA complexes in the plasma membrane (Paredez et al., 2006). The relationship between CESA-complexes and cortical microtubules was further analyzed by two recent studies that provide independent evidence to support the presence of small CESA-labelled compartments that show transient localization with microtubules. On one hand, Crowell and co workers have identified small CESA-containing compartments and shown that secretion of cellulose synthase complexes is mediated by Golgi bodies that transiently pause on microtubules (Crowell et al., 2009). Gutierrez and colleagues, on the other hand, have demonstrated that cortical microtubules position the delivery of cellulose synthase to the plasma membrane and 17  also have identified small CESA-containing compartments that transiently associate with depolymerising microtubule ends (Gutierrez et al., 2009). Overall, these studies demonstrate a potential functional relationship between cortical microtubules and CESA complexes. Temperature-sensitive mutant alleles of the MICROTUBULE ORGANIZATION] (MOR]) locus show strong defects in microtubule organization and cell expansion. The temperature-sensitive mon-i allele contains a point mutation in one of the MOR1 N-terminal HEAT repeats, resulting  in the leucine at position 174 being changed to phenylalanine (Whittington et al., 2001). Subsequently, it was reported that, despite strong disorganization of cortical microtubule arrays achieved either through use of the mon-i mutant or drugs that depolymerise microtubules, the parallel cellulose microfibril deposition was not altered (Sugimoto et al., 2003). In light of studies with the mon-i mutant, Wasteneys (2004) proposed a ‘microfibril length regulation’ model where cortical microtubules may be involved in the regulation of chemical properties and overall length of microfibrils rather than controlling their parallel orientation (Wasteneys, 2004). Taking advantage of the availability of several cytoskeleton-defective mutants, a detailed analysis aimed at understanding the relationship between cortical microtubule dynamics and changes in cellulose microfibrils properties would be useful to gain further insight into the role of cortical microtubules in regulation of cell wall properties.  Mitotic Microtubule Arrays The acentrosomal microtubule arrays in plants are strikingly different from the arrays found in other eukaryotes. In plant cells undergoing mitosis, the microtubules also behave differently from those in other eukaryotes. A cortical array of microtubules known as the preprophase band is formed as cells attempt to enter mitosis and also marks the position of the future division site 18  (Mineyuki, 1999). Upon initiation of mitosis, the preprophase band (PPB) disappears and the mitotic spindle forms (Wick and Duniec, 1984). Mitosis culminates in the gradual centrifugal expansion of the phragmoplast, a cylindrical array composed of microtubules and actin, and formation of the cell plate leading to cytokinesis (Figure 1.3). As cytokinesis proceeds, the expanding phragmoplast and cell plate fuse with the mother cell wall at the site previously marked by the preprophase band (Wasteneys, 2002; Lloyd and Chan, 2004).  F  Figure 1.3 Microtubule arrays through plant cell cycle. (A) Formation of the Preprophase Band (PPB) as cell attempts to enter mitosis, (B) Mitotic spindle formation, (C) Formation of phragmoplast, (D) Centrifugal expansion of phragmoplast and cell plate to the site previously marked by PPB, (E) Microtubules extend from the nucleus towards the cell cortex, (F) Formation of cortical microtubule arrays beneath the plasma membrane as cell expands [From Wasteneys (2002)].  19  In plants, cells do not migrate but are embedded in a matrix of wall material. The factors that control the division planes and orientations are thus critical for the development and morphogenesis of plant tissues. Surprisingly, not much is known about how division planes are established in plant cells or about the formation of the PPB. Only a handful of proteins have been implicated in these processes. The TANGLED (TAN) gene plays an important role in spatial control of cytokinesis. The TANGLED protein colocalizes with the PPB and persists at the division site throughout the remainder of cell cycle. In the tan LOF mutant of Zea mays, cell divisions are aberrantly orientated as the expanding phragmoplast fails to properly fuse to the original site previously marked by PPB. Thus, the TANGLED protein serves as an important cue that retains the memory of the PPB location throughout the cell cycle (Walker et al., 2007). Similarly, the TON2 gene, which encodes a putative protein phosphatase 2A (PP2A) subunit, is involved in the formation of the PPB and in establishing division planes. In the Arabidopis tonneau2/fass mutant, cells do not form a PPB and they divide along random planes (Camilleri et  al., 2002). Dong and colleagues recently identified BASL, a novel regulator of asymmetric divisions in Arabidopsis (Dong et al., 2009). BASL, a novel stomatal-lineage specific protein, accumulates in a polarized fashion at the cell periphery before division, and mediates asymmetric cell divisions in stomatal-lineage cells. Identification of the molecular mechanisms that control the location of the cortical division site and polarity is an active area of research in plant developmental biology.  Microtubule-associated and Regulatory Proteins The properties of microtubule arrays during cell elongation and division are mediated primarily by microtubule-associated proteins (MAPs). A protein is defined as a MAP if it either 20  biochemically binds with tubulin to promote assembly in vitro or if it colocalizes with microtubule arrays. Several families of MAPs have been identified in plants (Hamada, 2007; Sedbrook and Kaloriti, 2008). In other taxa, these proteins modulate microtubule dynamic properties, cross-linking and bundling, severing, and gamma-tubulin-dependent microtubule nucleation. The role of MAPs in controlling the dynamic properties and organization of microtubules in plants are now being analyzed through mutational analysis but the precise mechanisms that regulate plant MAP activities remain poorly characterized. MOR1/GEM1 is member of the XMAP215 family and plays a pivotal role in both cell division and cell expansion (Whittington et al., 2001; Twell et al., 2002). In mon-i mutant cells at the restrictive temperature, the formation of the PPB is perturbed and the structure of spindles and phragmoplasts is distorted. As a result, it takes longer to complete mitosis in mon-i cells (Kawamura et al., 2006). Microtubule dynamics are also severely affected in the mon-i mutant: the growth and shrinkage rates are reduced and microtubules spend more time in pause (Kawamura and Wasteneys, 2008). The CLASP protein is involved, like MOR1, in both cell division and cell expansion (Ambrose et al., 2007; Kink et al., 2007) and modulates microtubule-cortex interactions during self organization of microtubules (Ambrose and Wasteneys, 2008). EB 1 (End binding protein 1) preferentially localizes to the plus ends of microtubules (Chan et al., 2003; Mathur et al., 2003). The Anabidopsis genome encodes three isoforms of the EB 1 protein (EBIa, EB1b and EB1c). EB1 mutant roots display delayed responses to touch and gravity signals and they deviate to the left when grown on vertical agar plates and viewed from above (Bisgrove et al., 2008). The SPIRAL proteins are involved in the regulation of cell expansion and cortical microtubule organization, and mutations in SPIRAL 1 and SPIRAL 2 21  genes lead to defects in cell elongation while inducing a right-handed twisting in roots, petioles and petals (Furutani et al., 2000; Sedbrook et al., 2004). Several members of the MAP65 family of proteins have been reported to mediate microtubule related functions. MAP65 proteins form homodimers and are shown to make cross-bridges between microtubules. In Arabidopsis, there are nine MAP65 isoforms having differential expression levels and localization patterns. For example, AtMAP65- 1 and AtMAP65-5 were expressed throughout the cell cycle, whereas the expression of AtMAP65 -4 peaked at mitosis. Furthermore, AtMAP65- 1 and AtMAP65-5 associate with cortical microtubules and mitotic microtubule arrays, while AtMAP65-4 was exclusively found on spindles (Van Damme et al., 2004). AtMAP65-1 has been shown to possess microtubule bundling activity (Smertenko et al., 2004), whereas AtMAP65-2 acts as microtubule stabilizer (Li et al., 2009). AtMAP65-3IPLE is required for the cytokinetic phragmoplast function, and pie mutant cells have a distorted phragmoplast and unusual expansion in the region where oppositely oriented microtubules overlap (Muller et al., 2002). AtMAP65-6 has been demonstrated to induce microtubules to form a mesh-like ‘network but, unlike AtMAP65-1, does not promote bundling and tubulin polymerization (Mao et al., 2005). Recently, it was reported that the MAP65 C-terminal variable region is important in specifying the dynamic properties of members of this family (Smertenko et al., 2008). Katanin proteins function as microtubule-severing proteins. Animal katanin is a hetero-dimeric protein composed of a catalytic subunit of 60 kDa (p60) and a regulatory subunit of 80 kDa. Several mutants of the p60 subunit homolog have been described in Arabidopsis (Stoppin-Mellet et al., 2003) In Arabidopsis, the BOTEROJ/ FRAGILE FIBRE 2 encode a putative katanin-like .  protein, and the mutant is compromised in cell elongation and microtubule organization (Bichet 22  et a!., 2001; Burk et al., 2001). Other studies have revealed that katanin is involved in the regulation of microtubule dynamics and in mediating hormonal responses (Bouquin et a!., 2003; Stoppin-Mellet et a!., 2006). The process of microtubule nucleation in plants is not well understood and, like formation of the PPB, remains largely elusive. In animal and fungal cells, gamma-tubulin (y-tubulin) is involved in microtubule nucleation. Nucleation of microtubules along existing microtubules in plant cells has been described as early as 1989 (Wasteneys and Williamson, 1989), and recent studies have provided further evidence for this phenomenon in Arabidopsis cells (Murata et a!., 2005; Pastuglia and Bouchez, 2007). Pastuglia and coworkers utilized a reverse genetic approach to understand the role of two isoforms of Arabidopsis y-tubulin (Pastuglia et a!., 2006). Disruption of both ‘-tubulin genes led to severe defects in spindle and phragmoplast structures, resulting in altered nuclear division in gametophytes. The organization of microtubules was more strongly affected in mitotic microtubule arrays, while in elongating cells depletion of y-tubulin led to changes in the orientation of microtubules. The LOF seedlings displayed severe development defects and died within a few days. Kinesins are motor proteins that use the energy of ATP hydrolysis to transport various vesicles and organelles along microtubules. There are at least 61 kinesins encoded in the Arabidopsis genome (Reddy and Day, 2001), includingAtNACKi/HINKEL and AtNACK1/STUD/TETRASPORE, functionally redundant kinesins that are specifically involved in cytokinesis (Strompen et a!., 2002; Tanaka et a!., 2004). POK1 and POK2 are members of the Kin 12 family and are involved in the spatial control of cytokinesis in Arabidopsis (Muller et a!., 2006), whereas ATK5 belongs to the Kin 14 family and is involved in spindle organization (Ambrose and Cyr, 2007). Armadillo repeat-containing kinesins have been shown to interact 23  with NIMA (never in mitosis, gene A)-related kinase(s) and mediate epidermal cell morphogenesis in Arabidopsis (Sakai et al., 2008). Thus, Kinesins are an important family of IVIAPs that mediate microtubule properties (Richardson et al., 2006).  Mitogen-activated Protein Kinases and Microtubule Organization  As dynamic structures, the location, orientation and subunit cycling of microtubules all appear to be regulated in concert with cellular changes, including the growth phase, cell division, and responses to environmental and developmental signals. In some cases, the MAPs that control these microtubule activities have been shown to be regulated through phosphorylation and dephosphorylation switches, mediated by protein kinases and phosphoprotein phosphatases. One of the families of animal protein kinases that can control this switch is the MPK family, whose first member was originally identified as a microtubule-associated protein MAP kinase (Ray and Sturgill, 1987; Reszka et al., 1995). The role of MPK signalling in regulating microtubule functions in animal cells has been extensively documented (Hoshi et al., 1992; Mandelkow et al., 1995; Morishima-Kawashima and Kosik, 1996; Terret et al., 2003; Zhao and Chen, 2006; Liu et al., 2007; Yu et al., 2007; Fuentealba et al., 2008; Sun et al., 2008). There is also evidence that connects microtubule disruption stimulus to the activation of MAPKs and subsequent changes in the gene expression (Subbaramaiah et al., 2000; Manavathi et al., 2006). Evidence for the potential involvement of MAPK signalling in regulation of plant microtubule functions is also beginning to emerge. Both protein kinase inhibitors and inhibitors of phosphatases are reported to disorganize plant cortical microtubule arrays (Baskin et al., 2004; Yemets et al., 2008). More specifically, a tobacco mitogen-activated protein kinase (MAPK) cascade that includes the MPK, NRK1/NTF6, has 24  been shown to positively regulate expansion of the phragmoplast (Sasabe et al., 2006). Furthermore, it was demonstrated that NRK1/NTF6 phosphorylates NtMAP65-la, a microtubule-associated protein, and that this post-translational modification leads to the down regulation of its microtubule bundling activity (Sasabe et al., 2006). Smertenko and colleagues also showed that the Arabidopsis NtMAP65-la orthologue, AtMAP65-l, when ectopically expressed in tobacco cells, is hyperphosphorylated during prometaphase and metaphase, and that both cyclin-dependent kinases (CDK) and MPKs are involved in this phosphorylation. As in the tobacco system, phosphorylation of AtMAP65-1 was found to inhibit its ability to bind with microtubules (Smertenko et al., 2006).  25  OBJECTIVES  The work in this thesis was motivated by the following questions: 1. What are the transcriptional responses in plant cells in which microtubule polymer status has been disrupted? The role of microtubules in mediating structural properties of cells has been well characterized, and many elegant experiments have demonstrated the dynamic nature of the microtubule cytoskeleton. However, these studies have generally focused upon the behaviour of the cytoskeleton and its components, without considering other cellular processes that might be engaged when the cytoskeleton is perturbed. Since the cytoskeleton integrity might be integral to the ability of the cell to respond appropriately to incoming signals and maintain homeostasis, I hypothesized that there would be sensing and signalling systems that allow the cell to detect, and respond to, cytoskeleton perturbations. One mechanism by which the cell can rapidly respond is through transcription of genes whose products will assist in re-establishing cellular homeostasis. To test this hypothesis, I undertook a transcriptional profiling study of cells in which microtubule organization has been altered through the action of a temperature-sensitive mutant allele of the MOR1 microtubule-associated protein. Of particular interest would be genes encoding signal transduction components. 2. Are there specific MPKs that interact with the previously described MPK-specific phosphatase PROPYZAMIDE HYPERSENSITIVE 1 (PHS1), and if so, how might these MPKs influence microtubule-related functions? A point mutation in the MPK-specific phosphatase, PHS 1, has been previously shown to result in microtubule-related defects in Arabidopsis. Since MKPs are predicted to act upon MPKs, I  26  hypothesized that PHS 1 will interact with one or more of the Arabidopsis MPKs, and be capable of altering the activity of the kinase. 3. Is MICROTUBULE ORGANIZATION 1 (MOR1) one of the targets of a putative PHS1MPKs signalling complex?  The ability ofphsl-1 to alter microtubule function suggests that it could be interacting in some way with proteins that play a direct or indirect role in controlling microtubule structure or function. Previously, it has been shown that there is a genetic interaction between mon-i and phsl-1 at the permissive temperature, and the results of my investigations to address Question 1,  above, also identified PHS1 as one of the genes that responded to mon-i-induced cytoskeleton perturbation. I therefore hypothesized that a functional connection exists between PHS 1 and MOR1, and that this could involve any MPK partner(s) that might be identified as substrate/interactor of PHS 1.  27  ChAPTER 2. Transcriptional response to microtubule disorganization stimulus triggered by the mon-i temperature-sensitive mutant INTRODUCTION The plant cytoskeleton is a network of filamentous proteins that includes microtubules and actin microfilaments. This network organizes the structures and activities of the cell. In animal cells, the cytoskeleton has been shown to play a pivotal role in mediating signaling pathways, and it is assumed that it plays an analogous role in plants, although experimental evidence for this is less extensive. Microtubules are dynamic structures whose location, orientation and subunit cycling all appear to be regulated in concert with cellular change, including growth phase, cytokinesis, and responses to environmental and developmental signals. The regulatory mechanisms involved include Rho GTPases and their effectors, and post-translational modifications of cytoskeleton protein structures. One such modification is the conversion between phosphorylated and dephosphorylated forms of a protein, a switch that is mediated by protein kinases and phosphoprotein phosphatases, respectively (Drewes, 2004b; Rosales-Nieves et al., 2006). The pivotal role of microtubules in mediating the structural properties of cells has been demonstrated by many elegant experiments both in animal and plant cells. These studies have generally focused upon the dynamic behaviour nature of the microtubule cytoskeleton, spatial organization of microtubules, and the role of microtubule-associated proteins (MAPs) in regulating these processes. However, not much consideration has been given to other cellular processes that might be engaged when the microtubule cytoskeleton is perturbed. One mechanism by which the cell can rapidly respond to such perturbations is through transcription of genes whose products will assist in re-establishing cellular homeostasis. These proposals were first discussed by Wasteneys (2004) that perturbations in the microtubule organization, as a 28  response to abiotic signals (Abdrakhamanova et al., 2003; Sivaguru, 2003), could lead to changes at the transcriptome level in plant cells (Wasteneys, 2003; Wasteneys, 2004). Similar kind of mechanisms has been described in animal systems. For example, Ziegelbauer and colleagues (2001) demonstrated that a mammalian transcription factor, MIZ- 1, which associates with microtubules in the cytoplasm, is involved in the activation of gene products that re establish cellular homeostasis upon microtubule disorganization. As a consequence of microtubule disruption, MIZ-1 migrates from the cytoplasm to nucleus where it binds to the promoter region of the LDLR promoter and several other genes to activate their transcription (Ziegelbauer et al., 2001). Furthermore, inhibition of the extracellular signal-regulated kinase (ERK) pathway inhibited microtubule-disruption-induced nuclear accumulation of MIZ-1 and activation of LDLR (Ziegelbauer et al., 2004). Thus, MIZ- 1 appears to be regulated by its association with microtubules and may activate gene transcription in response to changes in the cytoskeleton that are mediated through signalling components. Plant cells are embedded in a matrix of wall material and, unlike animal cells, are not capable of migration. The close proximity of cortical microtubules to the cell wall and adjoining apoplastic space makes them ideal candidates to participate in sensing of extracellular perturbations impinging upon the cell and/or modifying cell wall properties in response to altered intracellular homeostasis. Based on the observations that certain abiotic stresses could lead to modulations in microtubule organization, a hypothesis was put forward that microtubule disruption as a consequence of certain abiotic signals might lead to altered transcriptional activity (Wasteneys, 2004). In this model, plants would possess sensing and signalling mechanisms that allow the cell to detect, and respond to, microtubule perturbations to re-establish cellular homeostasis (Cyr and Palevitz, 1995; Wasteneys and Galway, 2003; Wasteneys, 2004). To test this hypothesis, I 29  undertook a transcriptional profiling study of Arabidopsis tissues in which microtubule organization has been altered through the action of a temperature-sensitive mutant allele of the MOR1 microtubule-associated protein. Of particular interest would be changes in the expression of genes encoding signal transduction components. Among the characterized microtubule-associated proteins (MAPs), Microtubule Organization 1 (MOR1) has been extensively studied in higher plants, as have its orthologues in other eukaryotic taxa. MOR1 belongs to the highly conserved XMAP215 protein family, whose members have a general function in regulating microtubule dynamics (Whittington et al., 2001; Kawamura and Wasteneys, 2008). In Arabidopsis, MOR1 is essential for establishing and maintaining normal microtubule dynamics and spatial organization. The mon-i and moni-2 mutants were initially discovered through a screen for temperature-dependent cortical microtubule disorganization (Whittington et al., 2001). The mutations lead to rapid disorganization and shortening of the microtubules within minutes of shifting the mutated plants to a temperature of 30° C (restrictive temperature). Since mon-i is a conditional mutant, and MOR1 plays a pivotal role in regulation of microtubule functions, this mutant offers a convenient system in which to identify gene products that might be functionally linked with microtubule organization and maintenance of cellular homeostasis. To examine this question, I took advantage of the temperature-inducibility of the mon-i phenotype and carried out a full genome expression profiling analysis at three early time-points (2h, 4h and 8h) following the temperature shift to 3 0°C.  30  RESULTS Transcriptional Profiling of Differentially Expressed Genes  Using a 70-mer long oligo full transcriptome microarray, gene expression profiles of 10-day-old mon-i seedlings were compared at indicated time-points with those of wild-type seedlings after  transfer of both genotypes to the mon-i phenotype-inducing restrictive temperature. In experiments comparing wild-type with mon-i plants, four biological replicates were performed, each containing a dye-swap for technical replication. After applying the filtering parameters of P-values  =  0.05 or smaller and the fold-change cut-off  of >2-fold up- and down-regulation, lists of differentially expressed genes were generated (Figure 2.1). This revealed that 9, 79, and 26 genes were up-regulated in the mon-i plants relative to wild-type at 2h, 4h and 8h, respectively (Table 2.1, Table 2.2 and Table 2.3). A larger number of down-regulated genes were detected with 232, 92, and 21 genes down-regulated in mon-i relative to wild-type at 2h, 4h and 8h, respectively (Table 2.4, Table 2.5 and Table 2.6).  However, only a small number of signalling gene transcripts were identified showing >2-fold up and down-regulation in the mon-i relative to wild-type (Table 2.7, Table 2.8 and Table 2.9).  31  • Up.rgulated • Dow -regulated  8h  4h  . 2h 200  150  50  100  I  0  50  100  Number of genes  Figure 2.1 Differentially expressed gene transcripts in the microarray analysis. A fold-change cutoff of 2.0 and a p-value cutoff of 0.05 were used to generate this list.  32  Table 2.1 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°C for 2 hours. A fold-change cutoff of 2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number Annotation At5g42600 pentacyclic triterpene synthase, putative At2gl 6510 vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p 1) At1g52690 late embryogenesis abundant protein At2g37870 lipid transfer protein (LTP) family protein At5g04 120 phosphoglycerate/bisphosphoglycerate mutase family protein At2g47770 benzodiazepine receptor-related protein At2g39310 jacalin lectin family protein At5g36 150 pentacyclic triterpene synthase At1g06380 ribosomal protein-related  33  Fold change 4.4 2.6 2.4 2.3 2.3 2.3 2.0 2.0 2.0  P-value <0.00 1 0.03 <0.001 <0.001 <0.00 1 <0.00 1 <0.00 1 <0.00 1 0.05  Table 2.2 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°C  for 4 hours. A fold-change cutoff of 2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number At4g14960 At2g29370 At4g21960 At3g44310 At4g37800 At2g37180 At2g40080 At3g16420 At5g02380 At4g09320 AtSgl 7920 Atlg3 1580 At5g13490 At3g13740 At1g07590 At2g26020 At3g03 780 At2g37870 At3g14600 At2g36460 At5g45775 At5g67250 At5g61 160 Atlg6 1800 Atig3 1330 At5g66570 At1g49400 At3gl 1940 At3g20670 At2g22470 At4g00810 At3g06250 At5g09420 At4g12500 At2g30160 At3g28917 At2g37170 At5g10390 At2g32i90 At5g13930 At3gi 8740  Annotation encodes alpha-tubulin tropmone reductase Encodes a peroxidase Nitrilasel (NIT1) xyloglucan:xyloglucosyl transferase a member of the plasma membrane intrinsic protein PJP2 Early Flowering 4 (ELF4) jacalin lectin family protein, similar to myrosinase binding protein cysteine-rich protein with copper-binding activity nucleoside diphosphate kinase type 1 (NDPK1) gene, complete Encodes a protein having methionine synthase activity Encodes cell wall protein (ECS1) ADP, ATP carrier protein 2 URF 4-related pentatricopeptide (PPR) repeat-containing protein plant defensin-fusion protein 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase lipid transfer protein (LTP) family protein 60S ribosomal protein L18A (RPL18aC) fructose-bisphosphate aldolase 60S ribosomal protein Lii (RPL1 1D), SKP1 interacting partner 2 (SKIP2) mRNA, complete cds transferase family protein glucose-6-phosphate/phosphate translocator photosystem I reaction center subunit Ill family protein 33 Kd Component of PS II Oxygen-Evolving Complex ribosomal protein S17 family protein One of two genes encoding the ribosomal protein S5 histone H2A, putative arabinogalactan-protein (AGP2) 60S acidic ribosomal protein P1 (RPP1B) far-red impaired responsive protein chloroplast outer membrane translocon subunit lipid transfer protein (LTP) family protein mitochondrial substrate carrier family protein zinc finger homeobox family protein a member of the plasma membrane intrinsic protein subfamily PIP2 histoneH3 expressed protein Participates in the biosynthesis pathway of all flavonoids 60S ribosomal protein L30 (RPL3OC)  34  Fold change 5.9 4.2 3.7 3.7 3.5 3.3 3.3 3.2 3.0 3.0 3.0 3.0 2.9 2.9 2.9 2.8 2.8 2.8 2.8 2.8 2.7 2.7 2,7 2.7 2.7 2.6. 2.6 2.6 2.6 2.5 2.5 2.5 2.5 2.5 2.4 2.4 2.4 2.4 2.4 2.4 2.4  P-value 0.03 <0.00 1 0.01 0.05 0.01 0.01 0.02 0.01 0.02 0.01 0.01 0.01 0.01 0.01 0.02 0.01 0.03 <0.001 <0.001 0.04 <0.00 1 <0.00 1 <0.00 1 <0.001 0.04 0.03 <0.001 0.05 <0.001 0.03 0.04 0.02 0.01 <0.001 0.02 0.03 0.03 0.02 <0.001 <0.001 0.04  Accession Number At5gO 1330 At3g13720 At1g70600 At5g44420 At4g35 100 At5g60390 At1g76930 At4g21 140 At3g22 150 At1g30990 At2g34430 At3g15356 At3g61430 At5g57020 At2g22170 At5g50140 At5g47700 At5g10360 At5g44430 Atigi 5850 At1g27690 At4g28520 At1g73 120 At1g76020 At4g23670 At4g39250 At5g643 10 At1g74500 At3g57870 At1g295 10 At2g28920 At4g27960 At4g33550 At3g04840 At5g09280  Annotation pyruvate decarboxylase prenylated rab acceptor (PRA1) family protein 60S ribosomal protein L27A (RPL27aC) Encodes an ethylene- and jasmonate-responsive plant defensin a member of the plasma membrane instrinsic protein PIP1 elongation factor 1-alpha / EF-1-alpha ABO3 1820 Arabidopsis thaliana atExt4 niRNA for extensin 4 expressed protein pentatricopeptide (PPR) repeat-containing protein major latex protein-related / MLP-related Photosystem II type I chlorophyll a/b-binding protein legume lectin family protein a member of the plasma membrane intrinsic protein subfamily PIP1 Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. lipid-associated family protein ankyrin repeat family protein, contains ankyrin repeat domains 60S acidic ribosomal protein P1 (RPP1C) 40S ribosomal protein S6 (RPS6B) plant defensin-fusion protein transducin family protein / WD-40 repeat family protein Protein of unknown function (DUF62O) 12S seed storage protein expressed protein expressed protein major latex protein-related / IvELP-related myb family transcription factor arabinogalactan-protein (AGP 1) bHLH family protein ubiguitin-conjugating enzyme auxin-responsive protein zinc finger (C3HC4-type RING finger) family protein ubiguitin conjugating enzyme mRNA, complete cds lipid transfer protein (LTP) family protein 40S ribosomal protein S3A (RPS3aA) pectate lyase family protein  35  Fold change 2.3 2.3 2.3 2.3 2.2 3.2 2.2 2.2 2.2 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.1 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0  P-value <0.001 <0.001 0.03 0.02 0.05 0.03 0.05 0.05 0.02 <0.001 0.01 <0.001 <0.001 <0.001 <0.001 <0.001 0.04 0.03 0.02 0.05 0.04 <0.00 1 0.01 0.00 0.02 0.04 0.02 <0.001 0.01 0.02 <0.00 1 <0.00 1 <0.001 0.03 0.03  Table 2.3 Genes up-regulated in the mon-i mutant relative to wild type after incubation at 30°C for 8 hours. A fold-change cutoff of 2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number At1g15850 At5g42600 At5g41300 At1g23080 At1g30990 At1g56190 At5g44120 At1g73 190 At4g15340 At2g35300 At2g37870 At1g48 130 At5g44120 At5g04120 At5g57540 At2g34430 At5g42580 At5g37970 At4gl 1190 At2g17500 At4g30280 At3g20090 At3g20130 At4gl 1210 At5g47990 At5g03230  Annotation transducin family protein / WD-40 repeat family protein pentacyclic triterpene synthase receptor-like protein kinase-related auxin transport protein (P1N7) major latex protein-related! MLP-related phosphoglycerate kinase Encodes a 12S seed storage protein tonoplast intrinsic protein, alpha! alpha-TIP (TIP3. 1) pentacycic triterpene synthase late embryogenesis abundant group 1 domain-containing protein lipid transfer protein (LTP) family protein encodes a protein similar to the 1-cysteine family of antioxidants Encodes a 12S seed storage protein. phosphoglycerate/bisphosphoglycerate mutase family protein xyloglucan:xyloglucosyl transferase Photosystem II type I chlorophyll a/b-binding protein a member of the cytochrome P450 family S-adenosyl-L-methionine:carboxyl methyltransferase family protein disease resistance-responsive family protein / dirigent family protein auxin efflux carrier family protein xyloglucan:xyloglucosyl transferase member of CYP7O5A member of CYP7O5A disease resistance-responsive family protein / dirigent family protein member of CYP7O5A expressed protein, contains Pfam profile PF04520  36  Fold change 6.4 3.2 3.1 3.1 3.0 3.0 2.9 2.9 2.7 2.7 2.6 2.6 2.5 2.4 2.3 2.2 2.2 2.1 2.1 2.1 2.1 2.1 2.1 2.0 2.0 2.0  P-value <0.001 <0.001 <0.001 0.01 <0.001 0.01 <0.001 <0.001 <0.00 1 0.01 <0.001 <0.001 <0.001 <0.001 <0.00 1 0.01 <0.00 1 <0.001 <0.001 <0.00 1 <0.00 1 <0.001 <0.001 <0.001 <0.001 <0.001  Table 2.4 Genes down-regulated in the mon-i mutant relative to wild type after incubation at  30°C for 2 hours. A fold-change cutoff of—2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number  Annotation  At3g22240 At3g54590 At1g02700 At1g14880 At4g27670 At3g23840 At3g10950 At5g05090 At2g21330 At4g12500 At2g14580 At3g07560 At3g26450 At3g55170 At1g68725 At2g27050 At3g23720 At3g15353 At5g12330 At5g03850 At2g14610 At5g361 10 At5g52060 At5g66590 At3g55590 At1g23050 At4g08400 At2g16600 At5g56670 At3g2223 1 At2g255 10 At5g59880 At3g46320 Atlg6 1520 AtSglS600 At5g54230 At5g17530 At3g08940 At2g27720 At1g21245 At5g245 10  expressed protein Arabidopsis thaliana mRNA for hydroxyproline-rich glycoprotein expressed protein expressed protein chloroplast located small heat shock protein. transferase family protein 60S ribosomal protein L37a (RPL37aB) myb family transcription factor fructose-bisphosphate aldolase lipid transfer protein (LTP) family protein pathogenesis related protein, encodes a basic PR1-like protein. glycine-rich protein major latex protein-related! MLP-related 60S ribosomal protein L35 (RPL35C) arabinogalactan-protein ethylene-insensitive3-likel (EIL1) mRNA, complete cds hypothetical protein metallothionein, binds to and detoxifies excess copper and other metals Protein of unknown function and induced by auxin 40S ribosomal protein S28 (RPS28B) PR1 gene expression is induced in response to a variety of pathogens. member of CYP716A BAG domain-containing protein allergen V5/Tpx-1-related family protein GDP-mannose pyrophosphorylase hydroxyproline-rich glycoprotein family protein proline-rich extensin-like family protein cytosolic cyclophilin (ROC3) mRNA, complete cds 40S ribosomal protein S30 (RPS3OC), Encodes a member of a novel 6 member Arabidopsis gene family expressed protein actin-depolymerizing factor 3 (ADF3) histone H4, nearly identical to histone H4 (Arabidopsis thaliana) PSI type Ill chlorophyll a/b-binding protein expressed protein putative transcription factor (MYB49) mRNA, complete cds phosphoglucosamine mutase family protein Lhcb4.2 protein (Lhcb4.2) mRNA, complete cds 60S acidic ribosomal protein P2 (RPP2A) wall-associated kinase-related 60s acidic ribosomal protein P1, putative 37  Fold change  P-value  -5.6 -4.4 -3.9 -3.8 -3.8 -3.7 -3.7 -3.6 -3.6 -3.6 -3.6 -3.6 -3.6 -3.5 -3.4 -3.4 -3.4 -3.4 -3.4 -3.4 -3.3 -3.3 -3.2 -3.2 -3.2 -3.2 -3.2 -3.1 -3.1 -3.0 -3.0 -3.0 -2.9 -2.9 -2.9 -2.9 -2.9 -2.9 -2.9 -2.9 -2.8  <0.001 0.04 0.01 <0.001 <0.001 <0.001 0.03 0.02 0.05 <0.001 <0.001 <0.001 0.02 <0.001 0.02 0.01 0.03 0.01 <0.001 0.01 0.04 0.01 <0.001 0.03 0.00 0.02 0.01 0.01 0.04 0.01 <0.001 <0.001 0.01 0.02 0.04 0.02 0.01 0.01 0.02 <0.001 0.05  Accession Number At1g69620 At4g32610 At2g181 10 At3g62740 At2g19740 At5g14920 At3g50480 At4g33970 At3g59270 At5g13650 At3g47480 At3g42130 At1g05340 At4g02700 At2g02930 Ati gi 5850 At5g10390 At3g44950 At1g32290 At5g60390 At4g12480 At4g32270 At2g41 100 At4g27090 At5g06630 At5g37640 At1g53540 At5g44420 At3g59930 At2g34430 At5g63 650 At2g29350 At2g3 6400 At4g35 100 At1g65980 At2g43410 At2g34420 At2g32520 At1g08380 At3g09480 At5g27770 At2g02320 At2g33540 At2g30620 At1g35710 At5g28640  Annotation putative 60S ribosomal protein L34 mitochondrial glycoprotein family protein elongation factor 1-beta, putative I EF-1-beta glycosyl hydrolase family 1 protein, contains Pfam PF00232 60S ribosomal protein L3 1 (RPL3 1A) gibberellin-regulated family protein Homolog of RPW8 leucine-rich repeat family protein / extensin family protein syntaxin-related family protein elongation factor family protein calcium-binding EF hand family protein glycine-rich protein expressed protein sulfate transporter Encodes glutathione transferase belonging to the phi class of GSTs. transducin family protein / WD-40 repeat family protein histoneH3 glycine-rich protein, hypothetical protein elongation factor 1-alpha / EF-1-alpha pEARL! 1 mRNA, complete cds IJDP-sugar transporter-related encodes a calmodulin-like protein 60S ribosomal protein L14 (RPL14B) proline-rich extensin-like family protein polyubiquitin gene with 4 ubiquitin repeats. 17.6 kDa class I small heat shock protein Encodes an ethylene- and jasmonate-responsive plant defensin. expressed protein Photosystem II type I chlorophyll a/b binding protein serine/threonine protein kinase senescence-associated gene SAG13 Growth regulating factor encoding transcription activator. a member of the plasma membrane instrinsic protein PIP. peroxiredoxin TPx1 mRNA, complete cds FPA. Mutations in FPA result in extremely delayed flowering. Photosystem II type I chlorophyll dienelactone hydrolase family protein expressed protein histone H2B, putative 60S ribosomal protein L22 (RPL22C) F-box family protein CTD phosphatase-like protein 3 (CPL3) histone H1.2 leucine-rich repeat transmembrane protein kinase Arabidopsis thaliana GRF1 -interacting factor 1 (GIF1) mRNA 38  Fold change -2.8 -2.8 -2.8 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.6 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5 -2.5  P-value <0.001 0.01 0.02 <0.00 1 0.02 0.04 <0.001 0.02 0.03 0.01 <0.00 1 <0.001 0.03 0.04 0.03 0.01 0.01 0.03 0.04 0.02 <0.001 0.02 <0.001 <0.001 0.02 0.05 0.03 0.01 <0.001 <0.00 1 0.02 <0.001 0.05 0.03 0.04 0.04 0.05 <0.00 1 0.01 0.05 <0.001 0.05 <0.001 0.05 0.01 0.01  Accession Number  Annotation  At2g43970 At5g50010 At1g19530 At5g40370 At4g00755 At1g58380 At4gl 8880 At3g25900 At2g21620 At3g09840 At5g03350 At1g03790 At1g76960 Atlg6 1800 At1g13930 At5g14800 At5g06640 At2g20490 At5g08040 At1g73840 At3g59600 At1g083 15 At4g34265 At1g19250 At3g23 170 At1g21600 At4g09000 At4g04360 At3gl 1500 At5g24200 At3g19760 At2gO 1800 At5g62400 At3g28930 At5g48720 At3g49780 At3g60420 Ati g76930 At5g02610 At5g47700 At1g07810 At1g43 170 At5g24760 At1g02500 At1g16080 At2g21 140  La domain-containing protein expressed protein expressed protein glutaredoxin, putative F-box family protein XW6 mRNA, complete cds heat shock transcription factor 21 (HSF2I) homocysteine S-methyltransferase 1 (HMT-1) Encodes gene that is induced in response to dessication member of AAA-type ATPases legume lectin family protein zinc finger (CCCH-type) family protein expressed protein glucose-6-phosphate/phosphate translocator expressed protein Delta 1-pyrroline-5-carboxylate reductase proline-rich extensin-like family protein nucleolar RNA-binding NoplOp family protein expressed protein hydroxyproline-rich glycoprotein family protein DNA-directed RNA polymerase I, II, and ifi armadillo/beta-catenin repeat family protein expressed protein flavin-containing monooxygenase family protein / FMO family protein expressed protein expressed protein 14-3-3 gene hypothetical protein small nuclear ribonucleoprotein G expressed protein eukaryotic translation initiation factor 4A COP 1-interacting protein-related hypothetical protein avrRpt2-induced AIG2 protein (AIG2) expressed protein Phytosulfokine 3 precursor expressed protein ABO3 1820 Arabidopsis thaliana atExt4 mRNA for extensin 4 60S ribosomal protein L35 (RPL35D) 60S acidic ribosomal protein P1 (RPPIC) ER-type Ca2+-pumping ATPase (ECA1) mRNA 60S ribosomal protein L3 (RPL3A) alcohol dehydrogenase S-adenosylmethionine synthetase gene sam-i expressed protein Proline-rich protein 39  Fold change  P-value  -2.5 -2.5 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.4 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3 -2.3  <0.001 0.03 <0.001 0.02 0.03 0.05 0.04 0.05 0.03 0.04 <0.001 0.02 <0.001 <0.00 1 0.01 0.01 0.03 <0.001 <0.001 0.03 <0.00 1 0.02 0.04 <0.001 0.01 <0.001 <0.001 0.01 0.02 <0.001 <0.001 0.01 0.03 0.02 0.03 0.02 0.01 0.04 0.03 0.03 0.03 0.03 0.01 0.03 0.04 0.04  Accession Number At2g04700 At1g43800 At4g34670 At5g37600 At3g14600 At1g79040 At3g24900 At5g54160 At3g62030 At2g371 10 At1g48920 At4g19350 At5gO 1600 At3g43 180 At5g42890 At5gl 5130 At4g02520 At5g44430 At4g12490 At1g75000 At3g54590 At3g02090 At1g07620 At1g06400 At1g65930 At3g44880 At2g39010 At2g18390 At4g3 1750 At1g62500 At2g46870 At2g28 160 At5g06360 AtiglOl 10 At1g550 10 Ati g70990 At5g64100 At1g08500 At1g76940 At3g50540 At4g30620 At2g478 10 At5g67250 At3gl 9320 At1g02920 At5g10360  Annotation ferredoxin thioredoxin reductase catalytic beta chain family protein acyl-(acyl-carrier-protein) desaturase 40S ribosomal protein S3A (RPS3aB) encodes a glutamate ammonia lyase 60S ribosomal protein L18A (RPL18aC) photosystem II 10 kDa polypeptide disease resistance family protein / LRR family protein A caffeic acid/5-hydroxyferulic acid 0-methyltransferase nuclear-encoded chioroplast stromal cyclophilin (ROC4) expressed protein nucleolin, putative expressed protein Encodes a ferretin protein that is targeted to the chloroplast. zinc finger (C3HC4-type RiNG finger) family protein sterol carrier protein 2 (SCP-2) family protein member of WRKY Transcription Factor; Group lI-b Encodes glutathione transferase belonging to the phi class of GSTs. plant defensin-fusion protein, putative (PDF 1 .2c) protease inhibitor/seed storage/lipid transfer protein (LTP) family protein GNS1/SUR4 membrane family protein Arabidopsis thaliana mRNA for hydroxyproline-rich glycoprotein mitochondrial processing peptidase beta subunit GTP1/OBG family protein Ras-related GTP-binding protein (ARA-2) isocitrate dehydrogenase Rieske (2Fe-2S) domain-containing protein aquaporin, putative Encodes protein related to ADP ribosylation factors (ARFs) protein phosphatase 2C protease inhibitor/seed storage/lipid transfer protein (LTP) family protein DNA-binding protein basic helix-loop-helix (bHLH) family protein ribosomal protein SSe family protein F-box family protein plant defensin-fusion protein proline-rich family protein peroxidase plastocyanin-like domain-containing protein RNA recognition motif (RRM)-containing protein hypothetical protein, expressed protein histone-like transcription factor (CBFINF-Y) family protein SKP1 interacting partner 2 (SKIP2) mRNA leucine-rich repeat family protein Encodes glutathione transferase belonging to the phi class of GSTs 40S ribosomal protein S6 (RPS6B) 40  Fold change -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.2 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1  P-value <0.001 <0.001 0.01 0.05 0.02 0.03 0.01 0.04 0.03 0.04 0.03 0.04 <0.001 <0.001 <0.001 0.01 0.02 0.02 0.03 0.01 0.04 0.05 0.01 0.02 0.04 0.03 0.02 0.03 0.01 0.05 0.02 <0.001 <0.001 <0.001 0.01 0.02 0.01 <0.001 0.01 0.05 <0.001 0.02 0.00 0.03 <0.001 0.03  Accession Number At2g04630 At3g46010 At4g35090 At4g14365 At5g10760 At5g3 8980 At1g72120 At4g22 150 At5g48290 At2g35870 At1g76990 At4g33720 At4g36020 At1g78860 At4g10270 At3g05920 At1g06680 At1g06760 At1g32580 At3gO 1950 At2g17240 At5g26130 At5g59770 At3g15840 At4g30910 At5g45775 Atigi 5190 At1gi8540 At3g09500 At2g30860 At5g08290 At2g05 100  Annotation DNA-directed RNA polymerase II actin-depolymerizing factor 1 (ADF1) Encodes a peroxisomal catalase, highly expressed in bolts and leaves. zinc finger (C3HC4-type RiNG finger) family protein aspartyl protease family protein expressed protein proton-dependent oligopeptide transport (POT) family protein UBX domain-containing protein heavy-metal-associated domain-containing protein expressed protein, ACT domain containing protein pathogenesis-related protein cold-shock DNA-binding family protein curculin-like (mannose-binding) lectin family protein wound-responsive family protein heavy-metal-associated domain-containing protein Encodes a 23 kD extrinsic protein that is part of photosystem II histone Hi, putative plastid developmental protein DAG expressed protein expressed protein pathogenesis-related protein expressed protein expressed protein cytosol aminopeptidase family protein 60S ribosomal protein Lii (RPL1 iD) hypothetical protein 60S ribosomal protein L6 (RPL6A) 60S ribosomal protein L35 (RPL35A) Encodes glutathione transferase belonging to the phi class of GSTs AB04781 1 Arabidopsis thaliana YLS8 mRNA for Dimi homolog Lhcb2 protein (Lhcb2.3) mRNA  41  Fold change -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0  P-value 0.01 0.03 0.02 <0.001 0.01 0.02 0.03 0.02 0.04 0.01 <0.001 0.01 0.02 0.04 0.02 <0.001 0.04 0.02 0.03 <0.001 <0.001 0.03 0.04 <0.00 1 <0.001 0.01 0.05 0.04 0.05 0.02 0.04 0.03  Table 2.5 Genes down-regulated in the mon-i mutant relative to wild type after incubation at  30°C for 4 hours. A fold-change cutoff of—2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession number At5g67180 At3g06520 At5g39430 At4g19680 At2g27250 At3g42620 At4g20680 At5g02940 At1g07050 At1g77160 At1g34410 At1g63610 At3g42380 At3g5 1950 At4g16660 At3g52870 At2g24850 At5g47910 At1g62080 At3g56860 At5g266 10 At5g08420 At5g24240 At3g57720 At2g03 840 At4g29900 At3g04000 At4g12380 At2g3 1040 At5g55920 At1g26700 At5g13470 At2g24410  Annotation AP2 domain-containing transcription factor agenet domain-containing protein hypothetical protein encodes an iron transporter Putative ligand for the CLAVATA1 (CLV!) receptor-kinase. hypothetical protein receptor-like protein kinase-related expressed protein, CONSTANS-like protein-related hypothetical protein auxin-responsive factor AUX/IAA-related expressed protein hypothetical protein, zinc finger (CCCH-type) family protein heat shock protein 70, putative / HSP7O, putative calmodulin-binding family protein Encodes a tyrosine aminotransferase responsive to JA respiratory burst oxidase protein D (RbohD) mRNA, complete expressed protein UBP1 interacting protein 2a (UBA2a) Dli 1/0-patch domain-containing protein expressed protein phosphatidylinositol 3- and 4-kinase family protein protein kinase senescence-associated family protein calcium-transporting ATPase short-chain dehydrogenase/reductase (SDR) family protein hypothetical protein ATP synthase protein I -related nucleolar protein AF369575 Arabidopsis thaliana membrane protein Mlol4 mRNA expressed protein hypothetical protein,  42  Fold Change -4.2 -3.4 -3.2 -3.2 -3.1 -3.1 -2.8 -2.7 -2.7 -2.7 -2.7 -2.7 -2.7 -2.6 -2.6 -2.6 -2.5 -2.5 -2.5 -2.4 -2.4 -2.4 -2.4 -2.3 -2.3 -2.3 -2.3 -2.3 -2.2 -2.2 -2.2 -2.2 -2.2  P-value 0.01 <0.001 <0.001 0.01 0.01 0.01 <0.001 <0.001 <0.001 <0.001 0.02 <0.001 <0.001 <0.001 <0.001 0.01 <0.001 <0.00 1 <0.001 <0.001 0.01 <0.00 1 0.01 0.04 0.01 <0.00 1 <0.00 1 <0.001 0.02 0.01 <0.00 1 0.01 0.01  Accession number At5g06690 At3g05060 At5g19220 At2g36390 At2g30 840 At5g48960 At5g56620 At1g04300 AtSgl 1880 At3g6 1390 At3g26730 At3g26 150 At5g65060 At3g15960 At4g19060 At2g43 900 AtSgO 1400 At5g01840 At3g20 190 At5g65180 At3g63390 AtSgi 8620 Atigi733O At3g29390 At1g29790 At2g40430 At3g14470 At4g36400 At4g23800 At5g08450 At5g09850 At2g30770 At3g14205 Atig08520 At5g44570 At3g13225 At5g24620 At5g58200 At5g16030 At1g08540 At3g06400 At1g27070  Annotation thioredoxin family protein SAR DNA-binding protein glucose-i -phosphate adenylyltransferase large subunit 1 (APL1) Encodes a starch branching enzyme 2-oxoglutarate-dependent dioxygenase 5’ nucleotidase family protein no apical meristem (NAM) family protein meprin and TRAF homology domain-containing protein diaminopimelate decarboxylase U-box domain-containing protein zinc finger (C3HC4-type RiNG finger) family protein putative cytochrome P450 MADS domain protein flowering regulator like FLC DNA mismatch repair MutS family protein disease resistance protein-related endonuclease/exonuclease/phosphatase family protein expressed protein ovate family protein leucine-rich repeat transmembrane protein kinase expressed protein expressed protein DNA-dependent ATPase metal-dependent phosphohydrolase hydroxyproline-rich glycoprotein family protein expressed protein expressed protein disease resistance protein (NBS-LRR class) FAD linked oxidase family protein high mobility group (HMG1/2) family protein expressed protein transcription elongation factor-related putative cytochrome P450 phosphoinositide phosphatase family protein magnesium-chelatase subunit chlD, chloroplast hypothetical protein WW domain-containing protein Thaumatin-like protein expressed protein expressed protein Subunit of chloroplast RNA polymerase DNA-dependent ATPase 5’-AI4P-activated protein kinase-related -  43  Fold Change -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.1 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0 -2.0  P-value <0.001 <0.001 <0.001 <0.00 1 <0.00 1 <0.001 <0.001 0.01 <0.001 0.03 0.01 <0.00 1 0.02 0.04 <0.001 0.01 <0.001 0.01 0.01 <0.001 0.01 0.01 <0.001 <0.001 0.02 <0.00 1 0.01 0.01 0.03 <0.001 0.01 0.04 <0.001 0.01 0.01 <0.001 0.01 <0.001 0.01 <0.00 1 0.01 <0.001  Table 2.6 Genes down-regulated in the mon-i mutant relative to wild type after incubation at 30°C for 8h. A fold-change cutoff of —2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number At5g10570 At2g24850 At1g70990 At5g59880 At5g4 1440 At5g40450 At3g50480 At2g255 10 At1g53240 At1g26420 At1g20380 At1g76960 At1g63540 At1g02930 At5g60840 At4g33720 At5gl 0760 At4g14390 At2g46860  Annotation basic helix-loop-helix (bHLH) family protein Encodes a tyrosine aminotransferase responsive tojasmonic acid proline-rich family protein actin.depolymerizing factor 3 (ADF3) zinc finger (C3HC4-type RiNG finger) family protein expressed protein Homolog of RPW8 expressed protein malate dehydrogenase (NAD) FAD-binding domain-containing protein prolyl oligopeptidase expressed protein hydroxyproline-rich glycoprotein family protein mRNA for glutathione S-transferase, complete cds expressed protein pathogenesis-related protein aspartyl protease family protein ankyrin repeat family protein inorganic pyrophosphatase  44  Fold change -6.9 -3.4 -3.3 -3.3 -3.2 -3.1 -2.9 -2.8 -2.7_ -2.5 -2.5 -2.3 -2.3 -2.1 -2.1 -2.1 -2.1 -2.0 -2.0  P-value <0.001 <0.00 1 <0.001 <0.001 0.01 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.00 1 0.01 0.01 0.01 <0.001 0.01  Table 2.7 Differentially expressed signalling gene transcripts in the mon-I mutant relative to  wild type after incubation at 30°C for 2h. A fold-change cutoff of ±2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number  Annotation  At1g21245 At5g63650 At1g35710 At2g33540 At4g3 1750  wall-associated kinase-related serine/threonine protein kinase leucine-rich repeat transmembrane protein kinase CTD phosphatase-like protein 3 (CPL3) protein phosphatase 2C  Fold-change  -2.9 -2.4 -2.4 -2.4 -2.0  P-value  <0.001 0.02 0.01 <0.00 1 0.01  Table 2.8 Differentially expressed signalling gene transcripts in the mon-i mutant relative to wild type after incubation at 30°C for 4h. A fold-change cutoff of ±2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number  Annotation  At4g09320 At4g20680 At3g20 190 At3g14205  nucleoside diphosphate kinase type 1 (NDPK1) receptor-like protein kinase-related leucine-rich repeat transmembrane protein kinase phosphoinositide phosphatase family protein  Fold-change  3.0 -2.8 -2.1 -2.0  P-value  0.01 <0.001 0.01 <0.001  Table 2.9 Differentially expressed signalling gene transcripts in the mon-i mutant relative to  wild-type after incubation at 30°C for 8h. A fold-change cutoff of ±2.0 and a P-value cutoff of 0.05 were used to generate this list. Accession Number At5g41300 At1g56190  Annotation  Fold-change  receptor-like protein kinase-related phosphoglycerate kinase  45  3.1 3.0  P-value  <0.001 0.01  Gene Ontology of Differentially Expressed Genes  To further define the possible biological processes affected by a MOR1 -mediated microtubule disruption stimulus, gene ontology (GO) reports were generated from the list of genes that were differentially expressed in mon-i relative to the wild type (Figure 2.3, and Figure 2.4), and compared with the GO reports generated for the whole genome characterization (TAR; www.arabidopsis.org; (Gene Ontology Consortium, 2004) (Figure 2.2). Under the GO annotations, there are categories that provide information about predicted associations of each gene product with the ‘cellular component’, the ‘biological process’ and the ‘molecular function’. For the up-regulated genes, under the cellular component category, there was an increase in the number of gene products associated with ribosomes (6.53% compared with 1.64% for whole genome categorization), the cytosol (6.5 3% compared with 1.76% for whole genome categorization) and cell walls (3.12% compared with 1.36%). Under the biological process category, the number of gene products associated with the response to stress (10.79% compared with 4.34% for whole genome categorization), response to the abiotic and biotic stimulus (10.07% compared with 4.10% for whole genome categorization) and transport processes (7.55% compared with 3.68% for whole genome categorization) were increased. Under the molecular function category, the greatest increase was in the gene products associated with structural molecule activity (8.3 8% compared with 1.07% for whole genome categorization) and transporter activity (8.38% compared with 3.64% for whole genome categorization), respectively. As with the up-regulated genes, the largest number of down-regulated gene products was reported to be targeted to the cytosol (4.77% compared with 1.76% for whole genome 46  categorization), ribosomes (5.89% compared with 1.64% for whole genome categorization) and cell walls (2.33% compared with 1.36% for whole genome categorization). Furthermore, a link to stress biology was also evident in the down-regulated gene products: response to the stress (9.64% compared with 4.34% for whole genome categorization), response to the abiotic and biotic stimulus (9.04% compared with 4.10% for whole genome categorization). Overall, the GO analysis revealed that transcriptional activity associated with diverse cellular processes is engaged when the microtubule cytoskeleton is perturbed.  47  Functional Cat.gorlzatlon by annotation for: GO Cellular Component  I I  I  I  unknown cellular components’ 31 688% (raw value: 15535 other intracellular components Ii 871% (raw value 5820) chloroplast: 8783% (raw value 4306) other cytoplasmic components: 849% ( raw value :4162) other cellular components 9 308% ( raw value :4073) other membranes. 7912%) raw value :3879) nucleus. 5 646% ( raw value 2769) plasma membrane 4 332% ( raw value 2124) plastid 3.398% (raw value: 1666) mitocliondna 2601% (raw value: 1275) cytosol 1.764% 1 raw value 865) ribosome, I 644% ( raw value : 806 ceKwall 1365%) rawvalue 669) eritracellular, 0 908% ( raw value 445 E 0.789% ( rawvalUe 387) Dolgi apparatus 0 5% (raw value : 245  Functional Categorization by annotation for: GO Biological Process  I I  I  I  unknown biological processes: 25482%) raw va(ue: 16111) other cear processes 20 185% (raw value 12772) other metatohc processes. 18496% (raw value: 11703 protein metabolism 6829% (raw value :4321) developmental processes 4487% ( raw value : 2839) response to stress: 4,362% (raw value :2760) response to abiotic or biobc stimuluS’ 4.125% (raw value : 2610) transport 3684% (raw va(ue 2331  other biological processes’ 3.583% (raw value 2287) transcnpbon 3017%(rawvalue: 1909) cell organization and biogenesis’ 2.445% (raw value 1547) signal transduction 2.034%) raw value: 1267) DNA or RNA metabolism 0.732% (raw value :463) electron transport or energy pathways 0 559% (raw value 354  Functional Categorization by annotation for: GO Molecular Function  Ni I  unknown molecularfunctions 30291% (raw vllue: 15284) other binding 10355% (raw value 5219 other enzyme activity 8 845% (raw value = 4457 transferase actIvity 7.813%) raw value 3937) hydrolase actIvity 6376%) raw value :3213) DNA or RNA binding: 5 646% (raw value 2845 kinase activity 5.554% ( raw value 2799) protein binding 5.336%) raw value :2689) nucleobde binding 4.876% (raw value :2457) transporter activity. 3.653% ( raw value: 1841) transcnpbon factor actrvlty 3332%) raw value: 1679) nucleic acid binding 3.211% ( rawvalue: 1618) other molecular functions 3 169%) raw value: 1597) structural molecule acirvity I 07% ( raw value 539) receptor binrig or activity 0474% ( raw value : 239)  Figure 2.2 GO annotations of whole genome characterization. Pie charts represent the total gene counts for each given GO term (TAIR; www.arabidopsis.org; (Gene Ontology Consortium, 2004).  48  Functional Categorization by annotation for : GO Cellular Compon.nt  I I  I p  other intracellular components 18 75% ( raw value other cytoplasmic components. 15341%) rawvalue cliloroplast 9 659% (raw value: 34)  66) 54)  other membranes 9 659% (raw value = 34) cytoso[ 6.534% (raw value = 23) nbosome. 6 534% 1 raw value 23) plasma membrane 5 682% (raw value 20) plastid. 5.114%) raw value 18) other cellular components 5 114% ( raw value t8) unknown cellular components 4.83%) raw value: 17) nucleus 3409%) raw value 12) cefl w: 3.125%) rawvalue ii) mitOchondria 284l%(rawvalue: 10) eictraceltular 2.557%) raw value 9) ER 0.852% (raw value = 3)  Functional Categorization by annotation for: GO Biological Process  I  other cellular processes 19424% (raw value: 54) other metabohc processes 19424% (raw value :54) response to stress 10791%) rawvalue:30) response to abiotic or biottc stImulus. 10.072% (raw value : 28) other biological processes 7 914% 1 raw value : 22) transport 7554%) raw value :21) unknown bIological processes 6,835%) raw value: 19) protein metabolism 6475% (raw value: 18) developmental processes. 5.396% (raw value: 15) electron transport or energy pathways 2.878% (raw value : 8) cell organizatIon and biogenesis: 2158%) raw value :6) transcription’ 0.719%) raw value :2) signal transductIon 0 36% (raw value 1)  Functional Categorization by annotation tor: GO Molecular Function  I I  I I  other binding 18.71%) raw value :29) otherenzyrne activity 16129%) rawvalue :25) unknown molecular functions 14.839% (raw value 23) transferase activity. 10.988%) raw value: 17) transporter activity 8387%) raw value: 13) structural molecule activity- 8.387% (raw value: 131 hydrolase activity 6452% (raw value: 10) ONAor RNA binding. 5161%) rawvalue:8) other molecular functions 4 516% 1 raw value: 7) protein binding’ 1.935% (raw value: 3) kinase activity 129% 1 rawvalue :2) nucleotide binding I .29% ( raw value 2) transcnpbon factor activity I 29% ( raw value : 2 I nucleic acid binding. 0.645% (raw value: I  Figure 2.3 GO annotations of genes up-regulated in the microarray analysis. The up-regulated gene transcripts were analyzed using Gene ontology by TAR. Pie charts represent the total gene counts for each given GO term. 49  Functional CategorIzatIon by annotation for: GO C.lIuIar Component other ir6racetular components 20325% ( raw value other cytoplasmic components: 1.3.72% (raw value  I  I  I  I  200) 135) chioroplast Ii 687%) raw value 115) other membranes 7419%) rawvalue 73) tsicleus 7215%) raw value 71) unknown ceSular components 7.012% (raw value 691 ribosome 5894%) raw value ‘68) plastid 5488%)rawvalue 54) plasma membrane 4 96% ( raw value 49) eplosol 4776%)rawvaluev47) other cellular components 4 776% (raw value 47) cellwall 2337%) rawvalue 23) mitochondna 1.829% (raw value ‘18) elitracellular I 829%) raw value 18) ER 0508%(rawvalue5) Golgi apparatus. 0 203%) raw value 2)  Functional Categorization by annotation for: GO Biological Process  I I  I •  other cellular processes’ 21 905%) raw value 154) other metabolic processes 18.333% (raw value 154) unknown biological processes: 10833%) raw value 91) response to stress. 9643% (raw value ‘81) response to abiobc or biotic stimulus- 9948% ( raw value = 76 protein metabolism 6 19%) raw value 52) other biological processes: 6.238% (raw value ‘44 ccl organization and biogenetrs 4.762% (raw value 40) developmental processes 4.643%) raw value 39) ttanscripborl: 3452% (raw value = 29) transport 2976%) raw value 25) signal transduction. I 31% ( raw value II) electron transport or energy pathways. 1.19% (raw value’ tO) DNA or RF4A metabolism 0.476% (raw value 4)  Functional Cat.gorlzatlon by annotation for: GO Molecular Function  I I  I :.  I  unknown molecular hjnctions. 18.089%) raw value 89 1 ottierbindirig 15.041% (raw value = 74) other enome activity 11,789% ( rawvalue ‘58) DNA or RNA binding 7.52%) raw value 37) structural molecule activity 6 911% (raw value = 34) protein binding’ 6.594% (raw value = 32) transterase activity 8.594%) raw value 32) hydrolase activity: 5.894%) raw value ‘29) nucleotide binding. 4878%) raw value:24) transcription factor activity 4.878%) raw value ‘24) transporter activity 3.455%) raw value’ 17) other molecular functions, 3455% ( raw value 17) nucleic acid binding. 2642%) raw value’ 13) kinase activity 2 033% (raw value = tO) receptor binding or activIty 0407%) raw value 2)  Figure 2.4 GO annotations of genes down-regulated in the microarray analysis. The down-  regulated gene transcripts were analyzed using Gene ontology by TAIR. Pie charts represent the total gene counts for given GO term.  50  Real-time PCR Validation of Microarray Results  Several gene products shown to be involved in cell wall modification, flowering, circadian rhythms, RNA-binding, metabolic enzyme activity and signalling were identified through microarray analysis. To verify the expression patterns of differentially-expressed genes identified through microarray analysis, I performed real-time quantitative PCR on selected genes. These genes were selected randomly to represent different time-points and involvement in diverse biological processes. I was able to successfully validate the expression patterns observed in the microarray analysis for the up-regulated gene products; however, fewer of down-regulated genes were validated (Figure 2.5). One possibility could be that the selected down-regulated gene products were being expressed at a very low level, which can introduce an increase in random noise into microarray analyses. During the course of validation of gene products by quantitative real-time PCR, it became clear that there might be certain gene products in the 4 h list of microarray analysis that were false negatives and thus not representative of differentially expressed gene products. For example, the MARNERAL SYNTHASE transcripts (At5g42600, initially identified as a pentacyclic triterpene  synthase) were differentially expressed in the 2h and 8h microarray lists but not differentially expressed in the 4h gene list. However, real-time PCR analysis demonstrated that MARNERAL SYNTHASE transcripts were, in fact,> 10-fold up-regulated at the 4h time-point (Figure 2.4).  Since gene transcripts of a MPK-specific phosphatase, PROPYZAMIDE HYPERSENSITIVE 1, which has been previously shown to be involved in mediating cortical microtubule functions in plant cells, were differentially expressed at moderate levels (—1.5 fold) at the 2h time-point (data not shown); I further investigated whether, like MARNERAL SYNTHASE, the PHS1 transcripts  51  were also differentially expressed at the 4h time-point. Real-time PCR analysis demonstrated that PHSltranscripts were >4-fold upregulated at 4h time-point (Figure 2.5). I further examined if the changes in PHS1 gene expression is a specific consequence of microtubule disruption rather than the specific effect of MOR1 dysfunction. If this assumption is correct, microtubule disruption induced by other means will also lead to the same pattern of gene expression changes. To test this hypothesis, I used semi-quantitative RT-PCR to check whether the PHS1 gene also shows differential expression when wild-type plants are treated with the microtubule disrupting drug oryzalin. These results revealed that disruption of microtubules through oryzalin treatment led to up-regulation of M4RNERAL SYNTHASE transcripts, just as did the mon-i mutation, but that the transcript levels of PHS1 were unaffected (Figure 2.6). This suggests that changes in PHSJ gene expression might be connected to the process by which the cell monitors aspects of microtubule polymer status that are specifically regulated by the MOR1 protein.  52  • Real Time • Microarray  ELF4 TPR FHSJ (4h) PHSI (2h) MRN (4h) MRN (2h) CYP7IAI6 CYP7O5A 12  -2  0  2  4  6  8  10  Fold-change  Figure 2.5 Real time PCR validation of the microarray data. The expression profile of EARLY FLOWERING 4 (ELF4), TROPIONONE REDUCTASE (TPR), PROPYZAMIDE HYPERSENSITIVE] (PHSJ), MARNERAL SThTHASE (MRA[), and two members of cytochrome P450 family, CYP7JA16 and CYP7O5AJ2, was determined using quantitative real-time PCR.  53  MRN  PHSI Act/n 8 Solvent  luM Oryzalin  Figure 2.6 Semi-quantitative PCR to determine the expression pattern of MARNERAL SYNTHASE (Ml??’)) and PROPYZAMIDE HYPERSENSITIVE 1 (PHS1) in five-day old wild-type seedlings treated with 1 jiM of the microtubule-disrupting drug oryzalin for 4h. There was no obvious change in the expression pattern of PHS1 transcripts, whereas MRN expression was upregulated in response to oryzalin treatment.  54  DISCUSSION I took advantage of the mon-i mutant’s temperature-sensitive conditional phenotype in an attempt to identify early transcriptional responses in plant cells in which microtubule polymer status has been disrupted. My rationale was built on the proposals put forward by Wasteneys (2004) that if normal microtubule function in plant cells were dependent on participation of sensing and signalling components then there might be a rapid feedback mechanism from a disrupted microtubule network that would stimulate changes in the transcription/translation of essential regulatory proteins as the cell attempted to deal with the microtubule interference. Several genes that are predicted to mediate the responses to stress conditions, including biotic and abiotic stress, or to be involved in structural molecule activity, membrane and intracellular transport, cell wall modifications, flowering and circadian rhythms were identified in this microarray analysis. These results indicate that when microtubules are disrupted, the cells respond in a multi-faceted fashion. The role of the actin cyto skeleton in mediating signalling networks in plants has been relatively well documented (Volkmann and Baluska, 1999; Staiger, 2000; Staiger and Blanchoin, 2006). The dynamic organization of microtubules is important for maintaining the structural integrity of the microtubule cytoskeleton, yet its role in influencing other biological activities within plant cells such as signalling, transcription and translational is not well understood. In animal systems, disruption of microtubule status has been shown to dislodge the transcription factors from the microtubule lattice and allow them to accumulate in the nucleus, where they are involved in the transcription of gene products essential to re-establish altered cellular homeostasis (Giannakakou et al., 2000; Ziegelbauer et al., 2001). It is tempting to speculate that similar mechanisms connecting microtubule-derived stimuli with transcription factor-mediated control of gene 55  products essential for re-establishing cellular homeostasis may exist in plant cells. Chuong and co-workers (2004) identified several Arabidopsis transcription factors as tubulin-binding proteins by using the tubulin affinity chromatography (Chuong et al., 2004). Several RNA-binding proteins, signalling proteins and metabolic enzymes were also identified as tubulin-binding proteins in their study. Members of the ovate family proteins (AtOFPs), have been shown to associate with the cytoskeleton and to regulate TALE homeodomain proteins in plants (Hackbusch et al., 2005). Movement protein binding protein 2C (MPBP2C) has been identified as a protein that interacts with the KNOTTED 1 (KN1)-like homeobox domain (a sequencespecific DNA-binding protein) in plants. The MPBP2C-KN1 complex is believed to regulate the cell-to-cell trafficking of KN1 by sequestering that protein on microtubules (Curin et al., 2007; Bolduc et al., 2008). Several transcription factors were identified in my microarray analysis, and further investigation should shed more light on the function of these transcription factors in mediating cellular processes that might be engaged when microtubule functions are perturbed. Several genes associated with ribosomal functions were also identified in the microarray analysis, suggesting that microtubule integrity somehow influences ribosomal proteins and/or the process of translation. EMAP, an echinoderm microtubule-associated protein was earlier found in a microtubule-ribosome complex (Suprenant et al., 1993), and depletion of EMAP led to the dissociation of ribosomes from the microtubules Similarly, BOP1, a protein involved in ribosome biogenesis was found to associate with Microtubule End Binding (EB1) Protein 1 in protozoan cells (Kim et al., 2008). Recently, it was reported that miRNA-mediated translational repression in plant cells, a biological process involving the ARGONAUTE proteins, AGO1 and AGO 10, requires the activity of the microtubule-severing enzyme, katanin, suggesting that the 56  polymer status of the microtubule is somehow involved in miRNA action (Brodersen et al., 2008). Despite these studies pointing to strong correlations between ribosome function and microtubule activity, the exact mechanisms connecting microtubule dynamics and translational processes remain elusive. Disruption of microtubules in the mon-i mutant also led to changes in the expression of gene transcripts associated with the stress biology. These results corroborate recent findings suggesting a role for the microtubule cytoskeleton in mediating abiotic stress responses. For example, Shoji and co-workers reported that cytoplasmic salt imbalance compromises cortical microtubule functions in Arabidopsis cells (Shoji et al., 2006). Furthermore, salt stress has been shown to lead to the depolymerization of cortical microtubules in a calcium-dependent manner (Wang et al., 2007a). Transient microtubule disassembly was reported to be a trigger for cold acclimation in wheat varieties (Abdrakhamanova et al., 2003); whereas Aluminum stress was reported to rapidly depolymerize the cortical microtubules in a calcium-dependant manner in Arabidopsis roots (Sivaguru et al., 2003) Wymer and co-workers reported that protoplasts from .  tobacco respond to mechanical stresses by using microtubules as sensing elements (Wymer et al., 1996), and more recently, Hamant and co-workers reported that morphogenesis at the Arabidopsis shoot apex depends on the microtubule cytoskeleton, which in turn is regulated by the mechanical stress (Hamant et al., 2008). The challenge of understanding how different stress stimuli are transmitted to microtubules and incorporated into dynamic spatio-temporal feedback, which may involve complex gene networks, is still ahead. The relationship between microtubule organization and cell wall functions has been studied extensively. The fact that several of the gene transcripts that are involved in cell wall functions were differentially expressed in the mon-i microarray analysis reinforces the idea that 57  microtubules may act as part of a cell wall integrity sensor, and any perturbations in microtubule integrity will trigger transcriptional responses aimed at re-establishing cell wall integrity. Most of the differentially expressed cell wall genes detected in this study were members of families such as xyloglucan transferase, extensin-like proteins, and arabinogalactan proteins that are involved in cross-linking cell walls, in controlling cell expansion and in mediating structural cell wall properties. Since I was particularly focused on the genes encoding signal transduction components that might be engaged when the microtubules are perturbed, the identification of PHS1 as one of the differentially expressed transcript was very interesting. The fact that PHS1 gene expression is apparently enhanced in the mon-i background, but not when microtubule function is disrupted by oryzalin, suggests that PHS1 gene expression is involved in a process by which the cell monitors the changes in the microtubule integrity affected through the MOR1 protein. This observation corroborates the previously observed genetic relationship between MOR1 and PHS1. The morl-1/phsl-ldouble mutant plants in which both MOR1 and PHS1 protein functions are compromised) show defects in overall morphology and growth, even at mon-i’s permissive temperature (Naoi and Hashimoto, 2004). This suggests that the mon-i mutation may alter PHS 1 functions or vice versa. Based on my results, further analyses of a possible functional connection between PHS1 and MOR1 seemed warranted. As part of this next study, I wished to identify any MPK partner(s) that might be acting as substrate/interactors of PHS 1, information that could potentially provide a foothold from which to understand the role of MPK signalling in the regulation of plant microtubule functions. Identification of potential signals that may emerge as a consequence of a disrupted microtubule network along with potential transcription factors and signalling components involved in this process is the next key step to understanding the 58  precise regulatory mechanisms connecting microtubule dynamics with specific biological processes.  59  MATERIAL AND METHODS Plant Materials and Growth Conditions  For the microarray analysis, 10-day-old mon-i and wild-type whole seedlings grown aseptically on Hoagland’s medium solidified with 0.8% agar at 21°C with a 16-h-light/8-h-dark cycle were shifted to 30° Celsius and tissue was harvested at 2h, 4h and 8h. For the drug treatments, Anabidopsis thaliana seeds were cold-treated for 2-3 days and grown aseptically on the Hoagland’s medium solidified with 1.2% agar at 21°C with a 16-h-light/8-hdark cycle. Five day old seedlings grown on the Hoagland’s medium were then transferred to the Hoagland’s plates supplemented with drugs at the indicated concentrations and time-periods. Stock solutions were prepared in solvent dimethylsulfoxide (DMSO). Stocks were 10 mM oryzalin (Sigma-Aldrich).  RNA Extraction for Microarray Analysis  The RNA extraction, eDNA synthesis, and hybridizations were prepared as described (Lampard, 2006). For each biological replicate, lg of tissue (10-d-old whole seedlings) was ground in liquid nitrogen and the powder was mixed with 10 ml of Trizol reagent (Invitrogen). The supematant was collected after the cell debris was pelleted by centrifugation at 12,000 rpm (20 mm; 4°C). Chloroform (20% v/v) was added to the supernatant followed by quick vortexing, incubation at room temperature for 5 minutes, and centrifugation at 4000 rpm for 30 minutes. The aqueous phase was collected and the chloroform step repeated. The RNA was successively precipitated and resuspended in 0.5 volumes each of isopropanol and 0.8 M sodium citrate with resuspension in 500 l RNase-free water. This was followed by resuspension of RNA in 0.1 volumes 3 M sodium acetate and 2.5 volumes 100% ethanol. Finally, the RNA pellet was resuspended in 60  RNase-free water at a concentration of 5j.ig/j.d. The RNA quality was assessed using a Bioanalyzer (Agilent Technologies, Canada).  cDNA Labelling  The eDNA was prepared through the reverse transcription reaction by using the SuperScriptll reverse transcriptase (Invitrogen). The labelling reaction contained 5X First Strand Buffer, 0.5 mM each of dATP, dCTP, and dGTP, 0.05 mM dTTP, 3.75 j.tM oligo dT-anchor primer, 0.01 M DTT, 0.3 l human spike-RNA, 0.025 nM Cy-dUPT (GE Healthcare, Canada), 80 .tg total RNA and RNase-free water to a total volume of 37 p1 RNase inhibitor (Invitrogen) and SuperScriptll RT (Invitrogen) were added to each reaction. Reverse transcription reactions were carried out at 42 °C for 2h followed by termination by the addition of NaOH (final concentration: 175 mM) and incubation at 65 °C for 15 minutes. The labelled cDNA samples were neutralized by the addition of HC1 (final concentration: 150 mM) and Tris-HCL, pH 7.5 (final concentration: 65 mM). Each sample was diluted to a volume of 100 j.tl prior to the probe purification. The purification of the labelled probe was performed using the QiaQuick PCR purification kit (Qiagen, Canada) followed by pooling the paired cDNA samples. These samples were spiked with a Cy5-labeled GFP marker and kept overnight at -20°C in 0.1 volumes of sodium acetate and 2.5 volumes 100% ethanol for precipitation. The precipitated probe was then resuspended in 3.5 j.tl EDTA and washed with 70% ethanol.  Hybridization  The probes were denatured at 95°C for two minutes and added to the 50 j.tl of hybridization buffer maintained at 48°C (Ambion), and kept at 65°C until ready to be laid on the microarray 61  slides (Arabidopsis Genome Oligo Set Version 1.0 [Operon Biotechnologies, Huntsville, AL, USA] consists of 26,090 70mer oligonucleotides). The microarray slides (Provided by the Treenomix project of genome British Columbia) were prepared by incubation in pre hybridization solution (5X SSC, 0.1% (w/v) SDS and 0.2% (w/v) BSA) for one hour at 48°C with gentle shaking. The slides were then washed twice with autoclaved water for ten seconds, dipped in isopropanol and placed inside a 50 ml polypropylene tube to be dried by centrifugation at 2000 rpm. The labelled probes were applied to the microarray slides, covered with glass coverslips (Fisher, Canada) and mounted in slide holder cassettes. Hybridization was carried out for 14 hours in a water bath maintained at 42°C with gentle shaking. The slides were then successively washed in 2X SSC, 0.5% (w/v) SDS and then 0.5X SSC, 0.5 % (w/v) SDS solution at 42°C with gentle shaking. The slides were washed for one minute in 0. 1X SSC at room temperature prior to drying the arrays by centrifugation. The microarrays were scanned using a Scan Array Express model ASCEXOO (Perkin-Elmer, Canada) scanner. The spot intensities were quantified by linaGene software (BioDiscovery, CA, USA) using 95% laser power and photomultiplier tube set to 5070%.  Microarray Data Analysis  The raw intensities derived from the ImaGene quantification software were background corrected and normalized using the variance stabilizing normalization (VSN) to compensate for non linearity of intensity distributions (Ehlting et al., 2005). This procedure yielded log2  -  transformed expression ratios and fold-changes comparing the expression of a given gene in the mon-i mutant to its expression in wild-type seedlings. Statistics for each probe and each 62  replicate ratio were generated using customized scripts for R (The R Development Core Team, www.r-project.org). GO annotations were generated by using the GO annotation search engine (TAR; www.arabidopsis.org). The locus identifiers of differentially expressed genes were pasted into the textbox of the search engine and submitted for the analysis. GO annotations were generated for the submitted genes, and further functional characterization grouped these genes into broad functional categories.  Real-time PCR Analysis Total RNA from whole seedlings of morl-1 and wild-type (two biological replicates pooled) was isolated using RNeasy plant mini kit (Qiagen, Canada) for real-time and semi-quantitative PCR  analysis. Two jig of total RNA was used to synthesize cDNA using Superscript II (Invitrogen) and the final product was diluted 10 fold. Real-time quantitative PCR was performed using the SYBR Green PCR kit (Qiagen) and 5 jil cDNA per 20 jil PCR reaction. PCR reactions were carried out in triplicate for each primer pair. A MJ Mini (Personal Thermal cycler) with a Continuous Fluorescence Detector (BlO-RAD, Canada) was used for thermo-cycling and data were analyzed using Opticon MONITOR Analysis software (MJ Research, Canada). Average ACT8 levels for each sample were calculated based on the amplification reaction. Expression  levels for each test gene were obtained from four independent amplification reactions per replicate sample. The obtained values were normalized to the mean ACT8 (test gene signal/mean ACT8 signal) expression level and then a mean normalized expression level was calculated for  each gene. The following primers were used for the analysis: ACT8 forward, 5’ATTAAGGTCGTGGCA-3’; ACT8 reverse, 5’-TCCGAGTTTGAAGAGGCTAC-3’ ELF4 forward, 5’ -GAGCTTAATGAACCGGAATC-3’; ELF4 reverse, 5’63  CCACGGATTATTCTAACGAC-3’; TROPINONE REDUCTASE forward, 5’GTCCATGGTTCATTACAACTC-3’; TROPINONE RED UCTASE reverse, 5’AGCTGCGGGAAGACATAGAA-3’; PHS1 forward, 5’-GTAGGCAGAGTTCAGAGATfAG 3’; PHSJ reverse, 5’ATTCACAGTAACCTCAAGTGGT-3’; PENTACYCLIC TRITERPENE SThTTHASE forward, 5’-GCAACTCTGAAGCTATACGT-3’; PENTACYCLIC TRITERPENE SYNTHASE reverse, 5’ -GCAAGAGAGAGCACTTTCTC-3’; CYP7O5A forward, 5’-CTCAAGGTTCTCCTCGTGTfC-3’; CYP7O5A reverse, 5’CTTTGCCTTATCAGTGAAGCTCT-3’; CYP71AJ6 forward, 5’CTTCCAGCGTCTCCSTCAATAG-3’; CYP71A16 reverse, 5’GATCACGAAATCTGCCCATAAA-3’,  64  -  CHAPTER 3. Identification of a specific mitogen-activated protein kinase, MPK18, as a substrate of PHS1 INTRODUCTION Forward genetic screens for Arabidopsis mutants hypersensitive to propyzamide (a microtubule disrupting drug) originally identified phsl -1 , which carries a mis-sense point mutation in a putative MAPK-specific phosphatase-encoding gene, PROPYZAMIDE HYPERSENSITIVE 1 (PHS1). The phsl-1 mutation results in reduced root length and a severe left-handed root twisting phenotype; whereas a second mutation (phsl-3), a T-DNA insertion in the promoter region, leads to altered stomatal movements and hypersensitivity to Abscisic acid (Naoi and Hashimoto, 2004; Quettier et al., 2006). These genetic studies provide strong initial indications about some of the biological processes that might be regulated by PHS1, but the underlying mechanisms remain unclear. The role of PHS 1 signalling in mediating microtubule-related functions is further corroborated by microarray analysis of mon-i plants grown at the restrictive temperature, which revealed that the expression of PHS1 mRNA is transiently upregulated in response to this physiological stimulus. As a putative MPK phosphatase, PHS 1 would be predicted to participate in a physical complex with MPKs to form a signalling module. However, the identity of specific MAPKs that might interact with PHS1 and participate in the phosphatase’s regulation of plant biological functions remains unknown. To further characterize the putative PHS1 signalling module, and determine how it might integrate MAPK cascades with microtubule functions, I initially wished to identify IVIPKs that interacted with PHS 1. A directed yeast two-hybrid screen of PHS 1 against all twenty Arabidopsis MPKs had reported that PHS1 could interact with MPK12 and MPK18 (Lee, 2008). I was able to confirm and extend 65  this original observation, to show that MPK1 8 does serve as both a regulator of microtubule functions and a substrate of PHS 1. I demonstrate that MPK1 8 specifically interacts with PHS 1 in vivo, and that phosphorylated MPK 18 can be dephosphorylated by the PHS 1 phosphatase in vitro. I also show that mutant mpkl8-1 seedlings have defects in microtubule-related functions and possess moderately hyper-stabilized microtubules. My results reveal that this novel MPK, MPK18, is likely to form a functional component of the proposed PHS1 complex, and that it helps mediate cortical microtubule functions in plant cells.  66  RESULTS Identification of MPK18 as Substrate of PHS1  To identify Arabidopsis MPKs that might interact directly with PHS 1, a pair-wise yeast twohybrid assay was used to evaluate the ability of PHS 1 to physically interact with each of the 20  members of the Arabidopsis MPK family. For these assays, PHS1 fused to the DNA-binding domain of GAL4 was used as the bait protein, whereas individual MPKs fused to the transcriptional activation domain of GAL4 were used as the prey proteins. We found that, of the 20 MPKs tested, only MPK12 and IvIPK18 strongly interacted with PHS1 (Figure 3.la). To test whether PHS1 could also associate with MPK12 and IvIPK18 in vivo, I performed bimolecular fluorescence complementation (BiFC) assays in Nicotiana leaf epidermal cells. In BiFC putative bait and prey partners are fused separately to the N- and C-terminal regions of the yellow fluorescent protein (YFP) (Walter et al., 2004). A physical association between bait and prey brings the N- and C-terminal fragments of split YFP together and allows the functional reassembly of the fluorescent protein. When PHS1-YC and MPK18-YN were co-expressed, a positive YFP signal was detected in the cytoplasm (Figure 3. ib). However, no YFP fluorescence was detected for the PHS 1 -YC and MPK 1 2-YN pair, or in the negative control (PHS 1 -YC and Empty vector-YN). These observations confirm that PHS1 and MPK18 are able to physically interact both in vitro and in vivo.  67  (a)  (b)  YN-E’  YN-NtPKI2  YCPHSI SC.Leu.Trp  YC-PHS  YN-NIPKI8 YC-PIISI  SC.Lcu.l’rp-Ura  (c)  (d) PHSI:  —  CBB  tPk4  i4PkI  MPKs:  Autoradiography  PHS1: MPKIK:  +  I  +  ÷  +  +  +  NIBP  I __  —  CBB  I  Figure 3.1 PHS1 interaction with Arabidopsis MPK18 (a) PHS1 interacts specifically with MPK12 and MPK18 in yeast. PHS1 fused with Ga14 DNA binding (BD) and 20 MAPKs fused with Gal4 transactivation (AD) fusion constructs were co transformed into yeast MaV2O3 cells. Activities of reporter genes were determined by growth on selective marker SD-Leu-Trp-Ura. (b) PHS1 interacts with MPK18 in tobacco leaf epidermal cells, as shown by BiFC. Bar = 10 jiM (c) Autophosphorylated MPK18 (p-MPK18) but not autophosphorylated MPK4 (p-MPK4) is dephosphorylated by PHS1 in vitro. Purified GST-MPK18 protein (1 jig) or GST-MPK4 protein (1 jig) was incubated in the kinase buffer in the presence of [yP] for 30 mm at 30°C. Purified 32 GST-PHS1 (1 jig) was then added and the reaction was incubated an additional 30 mm at 30°C. The products were analyzed using SDS-PAGE, autoradiography, and Coomassie Brilliant Blue (CBB) staining. (d) Inactivation of MPK18 by PHS1 in vitro. Autophosphorylated MPK18 (1 jig) was incubated with PHS 1 [0.5(center lane) or 1 (right lane) jig] essentially as described above. The samples were then incubated (30 mm; 30°C) in kinase buffer containing 2 jig Myelin Basic Protein (MBP). The reaction was stopped by adding SDS-PAGE sample buffer, and the phosphorylation of MBP was analyzed by autoradiography.  68  To determine whether MPK18 is a substrate ofPHS1, I checked the ability of recombinant PHS1 to dephosphorylate phospho-MPK18 in vitro. For this purpose, I allowed recombinant MPK18 protein to autophosphorylate itself, since the identity of the endogenous MKK that normally activates MPK18 is unknown. Incubation in vitro of autophosphorylated MPK18 with the generic MAPK substrate, myelin basic protein (MBP), confirmed that the autophosphorylated MPK was catalytically activated (Figure 3.1 d). Treatment of 32 P-autophosphorylated MPK1 8  with purified recombinant PHS 1 results in the removal of most of the incorporated label (Figure 3.1 c), and this treatment also reduces the ability of activated MPK1 8 to phosphorylate MBP in vitro (Figure 3.ld), despite the on-going re-activation of the kinase through autophosphorylation. PHS 1 displays specificity towards MPK1 8, since the recombinant phosphatase failed to dephosphorylate another autophosphorylated MPK, pMPK4, in vitro (Figure 3.1 c). Taken together, these results demonstrate that MPK 18 is a catalytically active kinase and substrate of PHS 1.  69  PHS1 and MPK18 share Similar Expression Patterns To investigate the biological significance of PHS I -MPK 18 interaction, I first examined the expression pattern of both PHS1 and MPK18. If the interaction between PHS1 and MPK18 influences biological processes in vivo, it is expected that the expression patterns of the PHSJ and MPK18 genes would overlap during different development stages in plant cells. Based on RT-PCR analysis, PHS1 gene expression was earlier reported to occur in all major organs (Naoi and Hashimoto, 2004). To obtain a more fine-grained view of this pattern, I used a PHSJ promoter::GUS construct to monitor PHSJ promoter activity at different time-points throughout Arabidopsis development. Expression of GUS was detected in all major tissue types, with the strongest signal observed in the root and leaf vasculature, hypocotyls, the hypocotyl-root junction, guard cells, the inflorescence stem and stigma (Figure 3 .2a). Reverse Transcriptase PCR (RT-PCR) analysis detected MPK18 mRNA in all the major tissues of Arabidopsis tested, indicating that, like PHS 1, MPK 18 has the potential to be active in most parts of the plant (Figure 3.2b). Thus, both PHSJ and MPK18 are ubiquitously expressed in major organs and throughout development. I further extended the expression analysis by examining the subcellular distribution of the PHS 1 and MPK18 proteins. For this purpose, the full length PHSJ and MPK]8 coding sequences were each fused to the 5’ end of the GFP-encoding gene and the resulting constructs were placed downstream of the cauliflower mosaic virus 35S promoter. Transient expression of either GFP PHSJ or GFP-MPKJ8 in tobacco leaf epidermal cells revealed strong cytosolic localization with no apparent labelling in the nucleus (Figure 3 .3b, c).  70  (a)  (b)  —  MPK18  —  Actin8  — — 4) C  C  —  —— — — —  —  — — — — —  %_  ¼_  —  —  S.  —  —  Figure 3.2 Expression pattern of PHS1 and MPK18. (a) Histochemical analysis of the GUS reporter gene expression driven by the PHSJ promoter. GUS signal is detected in all the major organs and throughout development. (b) RT-PCR analysis of MFK18 gene expression in various organs of the Arabidopsis plant. Expression of the Arabidopsis Actin 8 gene was used as an internal control.  71  If PHS 1 and MPK 18 interact with proteins at the microtubule polymer surface and thereby directly influence microtubule functions, I hypothesized that GFP-PHS1 and GFP-MPK18 would be observed to co-localize with cortical microtubules. However, when GFP-PHS1 or GFP MPK18 constructs were transiently co-expressed with mRFP-TUB6 in tobacco epidermal cells, neither GFP-PHS1 fluorescence nor GFP-MPK18 fluorescence co-localized with mRFP-tubulin labelled microtubules (Figure 3.3e and Figure 3.3f). It therefore appears either that PHS 1 and MPK 18 do not interact with proteins at the microtubule surface, or that their association with  microtubules is very transient. To further define the subcellular distribution of functional MPK1 8 and PHS 1, I generated transgenic Arabidopsis plants stably expressing GFP-MPK18 in the mpkl8 mutant background, and GFP-PHS1 in the phsl-1 mutant background. The GFP-IvIPK18 protein showed  predominantly cytoplasmic labelling in epidermal root cells of these transgenic plants, consistent with the localization observed in tobacco leaf epidermis transient expression assays (Figure 3.3d). In contrast, I could detect little or no GFP fluorescence in Ti-progeny when the GFP PHS1 construct was integrated into phsl-1 plants. It is possible that expression of PHSJ-cDNA under a strong CaMV35S promoter is not stable in Arabidopsis and that native regulatory regions would be required (T. Hashimoto, NAIST, Japan, pers comm.). Overall, however, these expression studies demonstrate that the tissue distribution patterns of PHSJ and MPKJ8 expression overlap, and that these two proteins are both located in the cytoplasm.  72  GFP  GFP-MPK18  GFP-PHS1  mRFP-TUB6  GFP-PHS1  GFP-MPK18  Merge  Figure 3.3 Subcellular localization of PHS 1 and MPK 18. Transient tobacco infiltration assays were used for generating (a), (b), (c), (e) and (f), whereas (d) represents stable expression in transgenic Arabidopsis roots. Bars = 10 jiM (a) 35S-GFP control showing cytoplasmic (arrow) and nucleus (arrowhead) localization in tobacco cells (b) 35S-GFP-PHS1 showing predominantly cytoplasmic localization in tobacco cells (c) 35S-GFP-MPK18 cytoplasmic localization in tobacco cells (d) 35 S-GFP-MPK 18 localization in root epidermal cells of stably transformed mpkl8-1 Arabidopsis plants (e) Test of co-localization of mRFP-labelled microtubules with GFP-PHS 1  (0 Test of co-localization of mRFP-labelled microtubules with GFP-MPK 18 73  Mutant mpkl8-1 Plants Display Differential Sensitivity to Microtubule-disrupting Drugs  In order to establish a functional link between MPK1 8 and microtubule organization, I examined the effect of loss-of-function of MPK1 8 on microtubule-dependent biological processes. Two mpkl8 T-DNA insertional mutant lines were obtained from the SALK T-DNA insertion  collection (SALK accession number SALK_069399; herein named mpkl8-1 and SALK ,  accession number SALK_112260; named mpkl8-2) with an insertion in exon 3 and the 5’ promoter region, respectively (Figure 3.4a). Complete absence of MPKJ8 mRNA in the mpkl8-1 line was confirmed by RT-PCR (Figure 4b), but substantial levels (-50%) of MPKJ8 transcript could still be detected in the mpkl8-2 line. Since the mpkl8-1 line likely represents a null allele, it was used for further phenotypic analysis. Homozygous mpkl8-1 mutant plants were morphologically similar to wild-type plants at all stages of development, but they displayed a subtle, yet informative, root growth phenotype when treated with low doses of microtubule-disrupting drugs. The Arabidopsis root has emerged as a useful system for studies of the microtubule cytoskeleton and the process of directional cell expansion. Directional biases in root growth have been specifically associated with changes in microtubule stability (Ishida et al., 2007a; Sedbrook and Kaloriti, 2008), whether induced by mutation or by treatment with chemicals that impact microtubule dynamics. Treatment of growing roots with low doses of microtubule-disrupting inhibitors oryzalin and propyzamide, as well as the microtubule-stabilizing drug taxol, can alter root elongation and generate left-handed root twisting. These responses appear as leftward root skewing in seedlings grown on vertical agar plates, when viewed from above the plates. When I compared the sensitivity of mutant mpkl8-1 roots and wild-type roots to two microtubule-destabilizing drugs, oryzalin and  propyzamide, I observed leftward root skewing in the wild type roots. A much lower degree of 74  leftward root skewing was induced in mpkl8-1 roots by application of the 0.12 iM oryzalin and 2 j.tM propyzamide (Figure 3.4c and Figure 3.4d). In contrast, root elongation in mpkl8-1 seedlings was moderately inhibited at 0.12 jiM and slightly higher oryzalin concentrations (0.15 jiM and 0.2 jiM oryzalin) than wild-type plants (Figure 3.4e). Interestingly, the skewing response of mpkl8-1 mutants to low taxol was not significantly different from that of wild-type plants. This pattern of responses leads to the hypothesis that microtubules in the mpkl8 mutant are more resistant to microtubule-disrupting drugs but show no altered sensitivity to the MT stabilizing agent, taxol. Stable expression of 35S::GFP-MPK18 in the mpkl8-1 line was able to rescue the altered root growth phenotype (Figure 3.5), confirming that the drug sensitivity phenotype was specifically caused by the loss of MPK1 8. These data are consistent with a role for MPK1 8, indirectly or directly, in mediating root skewing and elongation processes, possibly through regulation of microtubule organization and dynamics.  75  (a)  (c)  .t is-:  %ALK  5-  I21s4  IlI IlUl Solvent %‘.LK  wJ3r)  (b) 0J2 iM Oryzalin wr  ,,,i’A IM.1 mpk 18.2  (d)  (e) 45 40  4’ N  ILN .  —  to  iai.  Sottent  IjiM Tavol  0.12 tM  OrzaIltt  20 —  Is  10 5  0  2 IOM PPM  Solvent  012 tM  0.15 iM  Oryzalin  OrzaIi,i  U.! pM OrzaIin  0.33 pM Orvzalin  Figure 3.4 Loss-of-function mutation in MPK18 leads to defects in microtubule-related  functions in Arabidopsis. (a) Structure of the MPK18 gene and position of T-DNA insertions. (b) RT-PCR showing lack of MPKJ8 transcript in 7-day-old whole seedlings of mpkl8-1 mutants. (c) Roots of mpkl8-1 seedlings show a differential response to low doses of microtubule disrupting drugs. Seven-day-old seedlings of wild type and mpkl8-1 grown on DMSO control, 0.12 .tM oryzalin, 1 i.tM taxol, or 2 1 iM propyzamide (PPM). (d) Root skewing angles of 7-day-old wild type and mpkl8-1 seedlings grown on DMSO control as well as low doses of microtubule disrupting drugs. Treatments with 0.12 M oryzalin and 2 iM propyzamide significantly reduced the root skewing angle of mpkl8-1 roots compared to the 1 wild-type (P<0.001 by Student’s t test). Data represent means ± SD (n?: 30). (e) Root length of 6-day-old wild type and mpkl8-1 seedlings grown on DMSO and different concentrations of oryzalin. Treatments with 0.12 j.tM, 0.15 iM and 0.2 tM oryzalin significantly reduced the root length of mpkl8-1 roots compared to the wild-type (P 0.005 for 0.12 jiM treatment, P<0.00 1 for 0.15 jiM and 0.2 jiM treatments by Student’s t test). Data represent means ±SD(n>30) =  76  OA5iM Oryzalin WT  mpkl8-1  35S-GFP-MPK18  Figure 3.5 Molecular complementation of mpkl8-1 plants with 35S::GFP-MPK18. Over-expression of MPK18 complements the root phenotype of mpkl8-1. Plants were grown on 0.15 tM oryzalin and photographed at five days.  77  Organization of Cortical Microtubule Arrays in mpkl8-1 Roots  Since mutant mpkl8-1 seedlings show altered responses to low doses of microtubule-disrupting drugs, I hypothesized that the mpkl8-1 mutation might be affecting the stability of microtubules. When I examined cortical microtubule arrays in wild-type and mpkl8-1 fixed roots labelled with anti-tubulin antibodies, the overall organization of the cortical arrays appeared to be normal in mpkl8-1 roots. Throughout much of the root elongation zone, cortical microtubules remained  transverse and well organized in both mpkl 8-1 mutants and wild-type seedlings (Figure 3 .6a). Next, I asked whether alterations in the stability of microtubules could be detected in mpkl8-1 roots by subjecting them to short-term oryzalin treatments that affect microtubules rapidly enough for convenient observation without obscuring genotypic differences (Bannigan et al., 2006; Collings et al., 2006). When I treated wild-type and mpkl8-1 roots for short periods (20 mm) with 0.6 jiM oryzalin and checked the stability of microtubules in epidermal cells of the root elongation zone of the fixed tissue, wild-type cells possessed only very few microtubules. In contrast, mpkl8-1 roots treated in the same manner retained significantly more microtubules, and these were better co-aligned (Figure 3.6b). These observations suggest that loss of MPKJ8 function is associated with a moderate increase in microtubule stabilization. Taken together, my data support a model in which both MPK18 and PHS1 form a functional signalling module which helps mediate microtubule-related functions in plant cells, perhaps through regulation of microtubule dynamic instability.  78  (b)  (a)  WT Us  E  0,6MM OryzlIn  I.e  US  2 I.  WT  ifli)k 18-I  Figure 3.6 Microtubule stability in mpkl8-1 roots. (a) Confocal fluorescence micrographs showing microtubule organization in the elongation zone of wild-type and mpkl8-1 root epidermal cells and comparing the effects of 0.6 .tM oryzalin treatment for 20 mm on wild-type and mpkl8-1 roots. Bar = 10 jiM (b) Number of microtubules remaining per unit area after oryzalin treatment. The figure at the top represents an enlarged image from (a) comparing the effects of 0.6 jiM oryzalin treatment for 20 mi Microtubules that crossed the mid-line of a cell’s long axis were counted. Data represents mean ± SD (n=1 0).  79  Absence of MPK18 Partially Rescues phsl-1 Phenotypes To verify a functional relationship between MPK1 8 and PHS 1, I utilized a genetic approach to ask whether absence of MPK18 protein would help to rescue the reduced root length and leftward root skewing phenotypes observed in the phsl-1 allele background. When double mutant, mpkl8/phsl-1, plants were examined for the effectiveness of MPK18 removal in complementing the phsl-1 root growth defects, I found that both the root growth and root skewing responses of the phsl-1 mutant were partially rescued (Figure 3 .7a, Figure 3 .7b, and Figure 3 .7c). Taken together, the genetic data reveal the biological significance of the physical interaction we observed between PHS1 and MPK18. The root skewing phenotype observed in phsl-1 plants was earlier suggested to be a consequence of the location of the phsl-1 point mutation (R64C) within the putative MAPK interaction motif of PHS 1 (Naoi and Hashimoto, 2004). However, when I reconstructed the PHS 1-1 (R64C) cDNA and tested its ability to interact with MPK18, I found that PHS1-1(R64C) and MPK18 continue to show positive interactions both in yeast 2-hybrid and BiFC assays (Figure 3.8). This indicates that the effect of the phsl-1 mutation on microtubule function in planta is not being directly mediated through interaction of PHS1 with MPK18 at its putative docking motif.  80  (b)  (a) *  rnpkl8-1  phsl-1  rnpkl8-1 phsl-1  (c) nipk iS-I  phxl-1  mpklS4 phsl-I  *  5III mpkl8-l  Figure  phsl-1  ntj,klB-I phsl-1  3.7 Genetic interaction between mpkl8-1 and phsl-1.  (a) Seedlings were grown for six days on vertically placed agar plates. Genotypes are indicated below the seedlings. (b) Root skewing angles of 6-day-old mpkl8-1,phsl-], and double mutant mpkl8-1/phsl-1 seedlings. The root skewing angle in the double mutant was significantly reduced compared to the phsl-1 (P<O.OO1 by Student’s t test). Data represent means ± SD (n35). (c) Root length of 6-day-old mpkl8-1,phsl-1, and mpkl8-1/phsl-1 seedlings. The root length in the double mutant was significantly increased compared to the phsl-1 (P<O.OO 1 by Student’s t test). Data represent means ± SD (n=35).  81  (a)  (b) S(-I.u-Trp  EV PHSI-1  1R64C)  MPK 18 pus’-’ (R64C)  YN-EV  VN-MPKI8  YC-PHSI-I(R64C)  YC’-PHSI-l(R64C)  Figure 3.8 Interaction of PHS1-l(R64C) with MPK18. (a) PHS 1-1 (R64C) interacts with MPK1 8 in yeast. (b) PHS 1-1 (R64C) interacts with MPK1 8 in tobacco leaf epidermal cells, as shown by BiFC. Bars1O .iM  82  DISCUSSION A combination of genetic and biochemical analyses have shown that PHS 1 and its kinase partner MPK1 8 might act together to modulate cortical mierotubule function in Arabidopsis cells. PUS 1 is one of five putative MPK-specific phosphatases found in Arabidopsis. Loss-of-function mutations in each of the other four MKPs, IBR5, AtMKP1, AtMKP2 and DsPTP1, have been reported to impair a wide range of biological processes including auxin signalling, stress biology, and responses to abiotic and biotic stimuli (Gupta et al., 1998; Ulm et al., 2001; Ulm et al., 2002; Monroe-Augustus et al., 2003; Lee and Ellis, 2007), but PHS1 appears to be unique in its connection to cytoskeletal function. A number of pharmacological and genetic studies have pointed to the involvement of protein phosphorylation and dephosphorylation in mediating plant microtubule organization (Baskin and Wilson, 1997; Camilleri et al., 2002; Naoi and Hashimoto, 2004; Sasabe et aL, 2006; Smertenko et al., 2006; Yemets et al., 2008). PHSI was originally identified in a screen for Arabidopsis mutants displaying altered sensitivity to the microtubule disrupting drug propyzamide. Left-handed root twisting, a phenomenon frequently associated with reduced stability of cortical microtubule arrays (Ishida and Hashimoto 2007), is one of the obvious phenotypic features ofphsl-1 seedlings. I have now shown that PHS1 interacts with two Arabidopsis MPKs, MPK12 and MPK18, but that only MPK18 shows physical interaction with PHS 1 in vivo in a heterologous transient expression system. The observations that phospho-MPK 18 can be de-phosphorylated by PHS 1, that both proteins physically interact in the same cellular compartment, and that the phsl-l and mpkl8-1 mutant phenotypes are partially complementary, lend strength to the idea that IvIPK18 is an endogenous substrate of PHS 1 and participates in the biological processes regulated by PHS 1. However, there are two caveats attached to this simple hypothesis. The relatively weak biochemical 83  efficiency (at —1 :1 enzyme: substrate ratio) observed in the dephosphorylation and kinase assays indicates that recombinant MPK18 may not be an efficient substrate for recombinant PHS 1 in vitro, although it remains unknown how much of the native phosphatase activity is being retained in the recombinant PHS 1. It is also possible that other enzyme-substrate physical  relationships are required for full PHS 1 activity in planta. Second, the observation that the mutant PHS 1-1 protein can continue to interact with MPK1 8 suggests that the relationship between PHS 1, MPK 18 and microtubules is not a simple one. The potential complexity is highlighted by the fact that, although the phsl-1 allele has obvious microtubule-related defects and compromised phosphatase activity in vitro (Naoi and Hashimoto, 2004), aphsl null allele apparently has no obvious phenotypes (T. Hashimoto, pers comm.). This would imply that PHS1-1 is acting as a dominant negative gene product, rather than reflecting a loss-of-function situation. The ability of PHS 1-1 to continue interacting with MPK 18 demonstrates either that substitution of a single residue (R64C) within the putative docking motif is not sufficient to interfere with effective docking, or possibly that the MPK 1 8-PHS 1 interaction occurs outside of PHS l’s putative docking motif. PHS1 possesses a uniquely long N-terminal extension, which may be involved in facilitating interaction with substrates, scaffold and adapter proteins, and allowing PHS1 to play both regulatory and catalytic roles through dephosphorylation and sequestration of its substrates. This kind of regulation is well described in other systems (Zervas et al., 2001; Mackinnon et al., 2002; Dard and Peter, 2006; Koyama et al., 2008; Eulenfeld and Schaper, 2009) and has been recently shown for one of the other MAPK-specific phosphatases, IBR5, in Arabidopsis (Strader et al., 2008) If a PHS1-MPK18 module normally functions within a multi .  84  component complex, identification of additional PHS 1 interactors would be expected to shed more light on the exact signalling mechanisms mediated by this phosphatase. My analysis of MPK 18 suggests that this pathway is involved in the stabilization of cortical microtubule arrays. In contrast to the destabilized microtubule arrays observed in the phsl-1 mutant (Naoi and Hashimoto, 2004), I show here that the loss-of-function mutation in mpkl8-1 results in moderately hyper-stabilized microtubule arrays that resist drug-induced depolymerization. Several studies have linked the microtubule cytoskeleton to the growth processes that govern root waving, root skewing and slanting, and organ twisting (Ishida et al., 2007b; Sedbrook and Kaloriti, 2008). Low doses of microtubule-targeted drugs have been shown to alter microtubule dynamics and to induce left-handed root twisting (Nakamura et al., 2004). Similarly, temperature-sensitive morl-1/rid5 mutants (Whittington et al., 2001; Konishi and Sugiyama, 2003), and numerous tubulin mutants (Thitamadee et al., 2002; Ishida et al., 2007a), also produce strong left-handed root twisting. In contrast, other tubulin mutants (Ishida et al., 2007) and mutations in the SPIRAL1 and SPIRAL2/TORTIFOLIA, WAVE DAMPENED2 and the ARMADILLO REPEAT KINESJN2 genes result in right-handed root twisting (Furutani et al.,  2000; Buschmann et al., 2004; Perrin et al., 2007; Sakai et al., 2008; Yao et al., 2008). Thus, experimental evidence from both pharmacological and genetic studies suggests that altered microtubule dynamics may be the most important determinant governing processes like root skewing and organ twisting, although the precise molecular mechanisms remain unclear (Ishida et al 2007; Wasteneys and Ambrose 2009). The observation that cortical microtubules appear to be moderately hyper-stabilized in mpkl8-1 would suggest that microtubule dynamic behaviour might be reduced in the absence of MPK18. This apparent change in microtubule stability is consistent with the reduced sensitivity mpkl8-1 roots show to low doses of microtubule 85  disrupting drugs, but more detailed examination of microtubule dynamics in mpkl8-1 plants may help to clarifS’ this phenotype. How might MPK 18 mediate microtubule-related functions? It is generally assumed that posttranslational phosphorylation reduces MAP-microtubule binding affinity, leading to MAP detachment and microtubule destabilization. This phenomenon is well documented for mammalian microtubule-stabilizing neural proteins, including MAP2, MAP4 and tau, whose stabilizing properties are inactivated through MPK-catalyzed phosphorylation of the MAPs (Hoshi et al., 1992; Drewes et al., 1997; Ebneth et al., 1999; Drewes, 2004a). Two recent studies demonstrate that similar mechanisms may occur in dividing plant cells (Sasabe et al., 2006; Smertenko et al., 2006). My observations lead us to propose a model whereby sustained and de regulated activation of MPK18 would lead to hyper-phosphorylation of downstream substrate(s). These may be proteins such as MOR1, or members of the MAP65 family, both of which possess canonical S/TP MPK phosphorylation sites. The effect of such a phosphorylation would be to suppress the association of the modified MAPs with the polymer surface of microtubules, thereby destabilizing cortical microtubules and altering their dynamics. In the absence of IvIPK1 8, the ability of MAPs to efficiently dissociate from the polymer surface of the microtubules could be compromised, thereby leading to enhanced stability of cortical microtubules. Since MAPK signalling pathways are also known to mediate responses to environmental stresses and phytohormone signalling, the MPK1 8 signalling module may also be involved in integrating signalling pathways that target the microtubule cytoskeleton. In contrast to the ‘classical’ MAPs that associate strongly with the microtubule polymer surface in a structural role, the observed lack of direct association of MPK 18 with the microtubule polymer surface supports the notion 86  that this signalling module may be associating in a transient manner and thereby integrate signalling pathways with microtubule organization. The fact that a loss-of-function mutation in MPKJ8 does not create strong morphological phenotypes, and only partially complements the phsl-1 root phenotypes, strongly suggests that functional redundancy exists among Group D MPK family members. Indeed, the genetic and physical interactions among MPK family  members are likely to be complex (Lee et al., 2008b), and it is also possible that other kinases, including members of non-MPK families, may be involved in one or more complexes that mediate phosphorylation-dependent regulation of cortical microtubule organization (Smertenko et al., 2006; Ben-Nissan et al., 2008; Motose et al., 2008; Sakai et al., 2008). Identification of in vivo substrates for MPK1 8 would therefore be an important step towards defining the molecular mechanisms involved in the phosphorylation-dependent regulation of plant cortical microtubules.  87  MATERIALS AND METHODS Plant Materials and Growth Conditions Arabidopsis thaliana seedlings were grown as described in chapter 2 on Hoagland medium  solidified with 1.2% agar. Two to three-week-old plants were transferred to soil and grown on under the same environmental conditions. Double mutant plants were screened by PCR in the F 2 generation. For drug treatments, seedlings were grown on medium containing drugs at the indicated concentrations for 5-7 d. Stock solutions of oryzalin (10 mM) (Sigma-Aldrich), propyzamide (10 mM) (Sigma-Aldrich) and taxol (10 mM) (Sigma-Aldrich) were prepared in dimethylsulfoxide (DMSO). Yeast Two-Hybrid Assays Yeast two-hybrid assays were performed as described by the ProQuest yeast two-hybrid system (Invitrogen). Briefly, pDEST32-PHSJ and each of 20 Arabidopsis MPKs (in the pDEST22 vector) were co-transformed into the yeast strain, MaV2O3. The ability of PHS 1 and MPKs to alone self-activate the reporter constructs was determined before setting up the assays between PHS1 and all MPKs on selective plates (Lee, 2008). PHS1 and MPKs alone failed to selfactivate the reporter constructs. The positive clones between PHS 1 and all MPKs were isolated on the basis of a selectable marker: URA3. An empty vector was used as a control. The interaction between PHS1 and MPK12 and MPK18 was further confirmed by switching the prey and bait vectors.  Transient Tobacco Infiltration Assays BiFC assays were performed as described previously (Bracha-Drori et al., 2004; Hackbusch et al., 2005) The P19 viral suppressor of gene silencing was co-expressed (Voinnet et al., 2003) .  88  with the YFP constructs to enhance transient expression of BiFC fusion proteins. Proteins fused to the N- or C-terminal part of YFP in respective BiFC vectors (pBatTL) were co-expressed transiently in Nicotiana benthamiana leaves. For co-expression experiments, an equal volume of each transformed Agrobacterium tumefaciens GV3 101 culture (OD 600 = 0.5) was mixed with P1 9-transformed culture (0D 600 of 0.7) before infiltration. YFP fluorescence was analysed 40-48 h after infiltration by laser scanning confocal microscopy. For GFP and mRFP-TUB6 coexpression, bacterial cultures (0D 600  0.5) were mixed before infiltration, infiltrated as  described previously (Sparkes et al., 2006), and analysed after 48 h.  Recombinant Protein Production and In Vitro De-phosphorylation Assay GST-PHS1, GST-MPK18, and GST-IVIPK4 were expressed as glutathione S-transferase (GST) fusion proteins in E. coli BL2 1 (DE3) cells. An overnight culture was diluted by transferring to new LB medium supplemented with ampicillin and shaken at 30°C until the absorbance at 600  nm was between 0.4 and 0.6. Isopropyl-1-thio-B-D-galactopyranoside (IPTG) was then added to a final concentration of 0.5-1 mM, and the culture was incubated at 25°C for 4 hr (GST-MPK4 and GST-MPK1 8) or 16°C for overnight (GST-PHS 1). Bacterial cultures were pelleted, lysed by sonication, and the fusion proteins were purified on a glutathione Sepharose 4B column as recommended by the manufacturer (Pharmacia). The protein concentrations of the recombinant proteins were determined using a Bradford assay with BSA as a standard. For the in vitro de-phosphorylation assay, GST-MPK18 (1 .tg) was incubated in 25 l of kinase buffer ( 50 mM Tris-HC1, pH 7.5, 2 mM DTT, 10 mM MgC1 , 0.1 mlvi ATP and 5 Ci of [y2 P] 32 ATP) at 30°C for 30 mm. To de-phosphorylate the autophosphorylated-IvIPK18 protein, recombinant PHS1 protein (1 jig) was then mixed with the autophosphorylated MPK18 (1 jig) 89  and the reaction was incubated an additional 30 mm at 30°C. Autophosphorylated GST-MPK4 (1 jig) prepared in a similar fashion was also incubated with PHS1 (1 jig). The reactions were terminated by addition of concentrated SDS-PAGE sample buffer followed by boiling for 5 mm. Reaction products were analyzed using SDS-PAGE, autoradiography, and Coomassie Brilliant blue (CBB) staining. For kinase activity assays, autophosphorylated MPK1 8 (1 jig) was incubated with PHS1 (0.5 or 1 jig) essentially as described above. The samples were then incubated (30 mm; 3OC) in kinase buffer containing 2 jig MBP. The reaction was stopped by adding SDS-PAGE sample buffer, and the phosphorylation of MBP was assessed by SDS-PAGE followed by autoradiography. Generation of Constructs and Transgenic Plants Full-length cDNAs corresponding to PHS1 and MPKJ8 were amplified by PCR, cloned into the pCR8/GW/TOPO (Invitrogen), and subcloned into Gateway® binary vectors by LR recombination (Invitrogen). For GFP analysis, PHSJ and MPK18 were subcloned into pMDC43 and pMDC83 destination vectors to generate N- and -C terminal fusions with GFP. The constructs were transformed into p/is] -1 and mpkl8-1 plants by Agrobacterium-mediated  transformation through the floral dip method (dough and Bent, 1998). The vector pDEST15 (Invitrogen), which expresses the recombinant protein with an N-terminal GST tag, was used to produce GST-PHS1 and GST-MPK18 constructs. The PHS1 promoter (—700 bp upstream of the coding sequence) was amplified by PCR and cloned into the pCAMBIA1381Z binary vector to generate the PromoterPHSl-GUS fusion which was transformed into wild-type (Col) Arabidopsis plants (Lee, 2008). Homozygous T 3 generation plants were used for histochemical GUS analysis as described previously (Malamy and Benfey, 1997). The R64C mutant PHS1 cDNA was generated by QuickChange site-directed mutagenesis (Stratagene, 90  http://www.stratagene.com) and confirmed by sequencing. RNA Isolation and RT-PCR Total RNA from different plant tissues was isolated using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using a First-  strand eDNA Synthesis Kit (Invitrogen). The following primers were used for the RT-PCR analysis: ACT8 forward, 5’-ATTAAGGTCGTGGCA-3’; ACT8 reverse, 5’TCCGAGTTTGAAGAGGCTAC-3’ MPK18 forward, 5’-ATGCAACAAA ATCAAGTGAAG 3’; MPK18 reverse, 5’-CTATGATGCTGCGCTGTAAC -3’; PHSJ forward, 5’ATGGCGGAACCTGAGAAGAAG -3’; PHSJ reverse, 5’-CTAACCAGGATGAGATTGGAA  -  3’. For mpkl8-1 genotyping by PCR, the primers RP (5’-GATCAAAAGCATTATGCTGCC -3’) and LP (5’- TTTTGGTGTGCCAAGAAGATC -3’), and LBa1 (5’TGGTTCACGTAGTGGCCATCG-3’) were used to detect the T-DNA insertion in genomic DNA isolated from leaves of 2-week-old seedlings. Immunohistochemistry and Microscopy For immunolabelling of intact roots, specimens were prepared as described (Collings et al., 2006). Anti--tubulin (clone B512 diluted 1/1,000; Sigma-Aldrich) was used as primary antibody and IgG: Alexa-488 was used as secondary antibody. For light microscopy, a Leica stereomicroscope (M216FA) equipped with DC500 was used. Confocal imaging was performed with a 63x NA 1.4 oil-immersion objective mounted on a Zeiss LSM 510 microscope, using the 488-nm line from an argon laser. GFP, YFP and IgG:Alexa-488 fluorescence was observed using a 505- to 545-nm emission filter. Image analysis was performed using ImageJ software (http://rsb.info.nih.gov/ij/).  91  CHAPTER 4. Effects of conditional suppression of PHS1 and MPK12 on microtubule-related functions INTRODUCTION The PHS 1 phosphatase is a unique MPK-specific phosphatase because of its long N-terminal region that bears no significant resemblance to other MPK-specific phosphatases. It was reported that the semi-dominant point mutation ofphsl-1 seedlings causes microtubule-related defects; whereas one of the T-DNA alleles, phsl-2, presumed to eliminate transcript, was embryonic lethal (Naoi and Hashimoto, 2004). These observations led to the proposal that the PHSlgene is critical for plant development. In an independent research project, Lee and Ellis (2007) generated dexamethasone (DEX) inducible RNA interference suppression (RNAi) transgenic lines for all five Arabidopsis MPK specific phosphatases in order to study the role of MPK-specific phosphatases in plant development (Lee and Ellis, 2007). This conditional suppression of PHS1 led to defects in development, resulting in dwarf stature (Lee and Ellis, unpublished results). Furthermore, it was shown that the RNAi construct was specifically targeted to the suppression of PHSJ transcripts because there was no reduction in the transcript levels of the other four MPK-specific phosphatases in two independent lines ofPHS1-RNAi plants (Lee and Ellis, 2007). In an attempt to dissect the role of MPK12 in hormone signalling, Lee and co-workers also reported that DEX inducible MPK12-RNAi lines were indistinguishable from wild-type plants in terms of overall growth and development, although they displayed a conditional auxin response phenotype in root growth assays (Lee et al., 2009). In this chapter, I took advantage of the available PHS1-RNAi lines to further our understanding of the function ofPHS1 in mediating microtubule-related defects. Since PHS1 was found to 92  interact with MPK12 in pair-wise yeast two hybrid assays, but did not interact according to BiFC assay, I also analyzed the detailed expression pattern of MPKJ2 to identify the specific tissues and developmental stages where MPK12 and PHSJ expression might overlap, and examined the MPK 1 2-RNAi lines to see if they displayed any defects in micrôtubule-related functions in  specific cell types.  93  RESULTS PHS1-RNAi Seedlings Displayed Phenotypic Defects in Cell Elongation and Growth I examined the role of PHS 1 in mediating microtubule-related functions by using inducible RNAi suppression to specifically down-regulate the expression of PHSJ in vivo. In the absence of DEX, the empty-vector and PHS 1 -RNAi lines were morphologically indistinguishable and did  not display any defects in terms of overall growth and development. Because the developmental phenotypes of two PHS1-RNAi lines (L17 and L15) were comparable (Lee and Ellis, 2007), I used these lines for my studies. I determined the short-term impact on the directional cell expansion and elongation in roots in the PHSI-RNAi seedlings. Primary root elongation was significantly reduced in PHS1-RNAi seedlings when treated with DEX for 24-36 hrs. The mean length of the elongation zone and division zone (EZ+DZ) was reduced in PHS1-RNAi seedlings compared to the empty-vector seedlings (Figure 4.la, b), but the reduction in root elongation was primarily caused by reduced cell length in the root elongation zone. To quantify this effect, I measured the mean length of root epidermal cells in PHS 1 -RNAi seedlings, compared to the empty-vector seedlings (Figure 4.lc). There was also an intense induction of root hair growth in PHS1-RNAi lines compared to the empty-vector lines over the 3 6-48 hr of DEX-induced PHS1 suppression. Similarly, the PHS 1 -RNAi seedlings displayed developmental defects in the cotyledon and foliar tissues, resulting in misshapen organs (Figure 4.ld).  94  (d)  EV  PHSI-RNAi  (b)  ldpg  (c)  l2dpg  I Figure 4.1 PHS1-RNAi seedlings display defects in cell elongation and growth. (a) Images of typical empty-vector (EV) and PHS1-RNAi seedlings on DEX-supplemented media. Four-day-old EV and PHS1-RNAi seedlings were transferred to the Hoagland’s media with DEX (ijim) and photographed after 36-48 hr. The division zone (DZ) and elongation zone (EZ) are highlighted with a bar. Bar = 0.1mm (b) Root division zone plus elongation zone lengths. Data represent mean ± SD (n25). (c) Lengths of cells in the root elongation zone. Data represent mean ± SD (n?25). (d) Seven-clay-old and twelve-day-old EV and PHSI-RNAi seedlings. The EV and PHS1-RNAi seedlings were grown directly on Hoagland’s media supplemented with DEX (1 tim).  95  The Organization of Cortical Microtubules is perturbed in PHS1-RNAi plants  Since the integrity of the cortical microtubule arrays is closely associated with cell elongation, I determined the overall organization of cortical microtubules arrays in root tip cells of PHS 1RNAi seedlings. In comparison to the empty vector control, cortical microtubule orientation in the elongation zone of the PHS 1 -RNAi line was more dispersed about the transverse axis of cells (Figure 4.2a). In contrast to the cortical microtubule arrays, the microtubule arrays in the root dividing cells were indistinguishable from those in the empty vector control (Figure 4.2b). There were no obvious defects in the formation of preprophase band, spindle structure and phragmoplast formation and expansion. These data indicate that the primary effect of PHS 1 depletion is associated with the disorganization of cortical microtubules.  96  (c)  EV  PHS1-RNAi  Cortical MTs  Preprophase Band  Phtagmoplast  Figure 4.2 Organization of microtubules in PHS1-RNAi roots.  (a) Confocal fluorescence micrographs (projection of confocal z-series) showing microtubule organization in the elongation zone of empty-vector (EV) and PHS 1 -RNAi root epidermal cells. Five-day-old EV and PHS1-RNAi seedlings grown on Hoagland’s medium supplemented with DEX (1 jim) were used for immunofluorescence labelling with anti-tubulin antibodies (n=5 roots). Bar = 10 jiM (b) An enlarged image from (a) to show the more dispersed cortical microtubule orientation in the PHS 1 -RNAi roots compared to the EV. (b) Confocal fluorescence micrographs (projection of confocal z-series) showing mitotic and cytokinetic microtubule arrays in the dividing cells of EV and PHS1-RNAi root cells. Five-day old EV and PHS1-RNAi seedlings grown on Hoagland’s media supplemented with DEX (ijim) were used for anti-tubulin immunofluorescence staining of root tip squashes (n5 roots). DAPI was used to stain DNA (blue). Bar = 5 jiM 97  MPK12 Gene Transcripts are Specifically Expressed in Guard Cells  In order to explore the functional interaction between PHS 1 and MPK1 2, I first determined if the expression of the two genes overlaps. MPKJ2 promoter-mediated GUS expression was detected in mature guard cells and isolated cells located in leaf and inflorescence vascular tissues. MPK12 expression was detected in the mature guard cells as early as one day post germination (1 dpg) and could be seen throughout development in all the organs that have guard cells (Figure 4.3). There was no expression detected in roots at any time point. Apart from the mature guard cells, expression of MPK12 was also detected in isolated cells of the leaf and inflorescence vasculature tissue. MPKJ2 expression in the isolated leaf vascular tissue can be detected around 14 dpg and continued in later stages of leaf and inflorescence development. Similar expression was not detected in the vascular tissue of roots at any time point. MPK12 ‘s very specific expression in guard cells and a small set of cells within the aerial  vascular tissue is in contrast to the PHSJ gene, which was generally expressed throughout development and in most tissues, including roots, hypocotyl, leaf vascular tissues and guard cells (shown in Figure 3.2 of chapter 3). Based on the yeast two hybrid analysis showing that MPK12 and PHS 1 physically interact, and the fact that PHS1 and MPK12 genes have overlapping expression in mature guard cells, I hypothesized that MPK12 might interact with PHS1 in guard cells to regulate microtubule organization. To test this hypothesis, I examined microtubule arrays in the guard cells of loss-of-function mutant mpkl2 plants.  98  ldpg  2dpg  3dpg  7dpg  l4dpg  28 dpg  35 dpg  Figure 4.3 GUS activity controlled by the MPK12 promoter throughout plant development. GUS staining patterns indicate that MPK12 gene transcripts are specifically expressed in mature guard cells and isolated cells in the leaf and inflorescence vasculature tissue. Expression was not detected in roots at any time point.  99  Microtubule Array Organization in Guard Cells of MPK12-RNA1 Plants The MPK12 transcripts have been reported to be suppressed in the MPK12-RNAi seedlings upon DEX treatment (Lee et al., 2009), and the MPK12-RNAi plants are morphologically indistinguishable from the control plants. Since the MPKJ2 gene is most highly expressed in mature guard cells, I analyzed the microtubule organization in mature guard cells of MPK12RNAi lines using immunoflurosence labelling with tubulin antibodies. The microtubules form highly ordered arrays in guard cells originating from the aperture side of the cell. This leads to the formation of radially arranged microtubule arrays in mature guard cells. The radial microtubule array organization in guard cells of mutant MPK12-RNAi plants appears to have no obvious defects when compared to the empty-vector control plants (Figure 4.4). There seems to be no obvious defects related to the overall development of guard cells. The parallel alignment of microtubules was well-maintained in the guard cells of MPK12-RNAi plants.  100  MPK12-RNAi  EV  Figure 4.4 Radial microtubule array organization in guard cells of empty-vector (EV) and MPK1 2-RNAi plants. Confocal fluorescence micrographs (projection of confocal z-series) showing microtubule organization in the EV and MPK12-RNAi mature guard cells. Five-day-old EV and MPK12-RNAi seedlings grown on Hoagland’s media supplemented with DEX (1im) were used for immunoflurosence labelling with anti-tubulin antibodies (n=5). Bar = 5 tM  101  DISCUSSION Several observations suggest that the PHSJ locus mediates microtubule-related functions; however, the relationship between PHS 1-based signalling and microtubule functions is likely to be more complex than previously thought. On the one hand, a semi-dominant point mutation, phsl-1, displays microtubule-related defects including hypersensitivity to microtubule-disrupting  drugs, and one of the T-DNA alleles, phsl-2, has been reported to be embryonic lethal (Naoi and Hashimoto, 2004). On the other hand, it was subsequently reported that, unlike phsl-1 andphsl 2, several null alleles of phsl have no defects in overall growth and microtubule-related  functions (Hashimoto and Kato, 2006) (T. Hashimoto, NAIST, Japan, pers comm.). I analyzed two of the null allele of phsl (SALK_070121 and SALK_062457) and confirmed that they indeed were morphologically indistinguishable from wild-type plants (data not shown). These observations suggest that the phosphatase activity of PHS 1 might be dispensable and/or is functionally redundant. The PHS1-RNAi lines showed strong developmental defects including reduced cell elongation, root hair growth, and disorganized cortical microtubule arrays. Yemets and co-workers recently reported that treatment of Arabiclopsis roots with the tyrosine phosphatase (PTP) inhibitor sodium orthovanadate resulted in intense induction of root hair growth and reduction in the size of the elongation zone (Yemets et al., 2008). Therefore, at least some of the PHS 1 -RNAi defects could be attributed to the perturbed phosphatase activity. The apparent discrepancy between the null-alleles of PHS 1 and PHS1 -RNAi phenotypes is difficult to explain. First, the possibility exists that the PHS 1 -RNAi construct also targets other phosphatase(s) and/or gene transcripts. Although, the 300 bp fragment of the PHS1 5 ‘-end selected to generate the PHS1RNAi construct bears the highest sequence divergence from all other MKP genes and the transcript abundance of 102  the other four MPK-specific phosphatases was not affected in PHS 1 -RNAi lines (Lee and Ellis, 2007), it still remains possible that PHS1-RNAi construct might be co-suppressing other gene transcripts. As a consequence, the potential functional redundancy might be unmasked in PHS1RNAi lines and leads to the observed defects in development and cortical microtubule organization. Second, the possibility exists that PHS 1 -RNAi suppression lines may allow partial expression of non-targeted regions, thus creating a potential dominant-negative effect. In that regard, it is interesting to note that the engineered PHS 1 phosphatase-dead allele causes severe cortical microtubule disruption in a dominant-negative manner (T. Hashimoto, NAIST, Japan, pers comm.). Taken together, my preliminary analysis of PHS 1 -RNA1 lines indicate that conditional suppression of PHS 1 leads to defects in cell elongation and cortical microtubule organization. However, further studies are required to clarify the phenotypes of PHS 1 -RNAi lines and address the observed discrepancy between the null allele and PHS 1 -RNAi phenotypes to understand the complex mechanisms involved in PHS 1-signalling based control of microtubule functions. The possibility that PHS 1 and MPK1 2 proteins interact in vivo cannot be conclusively ruled out based only on BiFC assays. Since the PHS 1 locus is implicated in mediating microtubule-related functions, I screened MPK1 2-RNAi lines for the microtubule-related defects. I first performed a detailed analysis of MPKJ2 expression throughout development to identify tissues types in which PHS1 and MPKJ2 expression might overlap. Based on the information gained from the expression studies, I focused on the specific cell-types in MPK12-RNAi lines to look for perturbed microtubule function. My expression analysis of MPKJ2 revealed that this gene is highly expressed in mature guard cells, cells adjacent to the mature guard cells and isolated cells of leaf and inflorescence vascular 103  tissue. The mature guard cell expression was consistent with the previously reported MPKJ2 expression (Lee et al., 2009), although no expression was observed in roots and hypocotyls in my analysis. The exact reasons for some of the differences in the expression pattern between my analysis and by Lee and co-workers (2009) are not clear but it may be due to the differences in the length of the promoter regions chosen for the generation of MPKJ2: GUS reporter construct. Furthermore, I observed a unique pattern in the expression of MPK12 in isolated cells of leaf and inflorescence vascular tissue. This pattern of expression is reminiscent of the Arabidopsis TGG1, which encodes a myrosinase gene that is highly expressed in mature guard cells and isolated cells of leaf and inflorescence vascular tissues (Husebye et al., 2002). Based on the TGG1 expression data that the isolated cells in the vascular tissues were phloem cells, it is tempting to speculate that the identity of cells expressing MPK12: GUS within vascular tissues might also be phloem cells, raising an interesting possibility that MPK 12 might function in mediating local and long-range signalling in plants. TGG1 has been recently shown to be involved in inhibition of light-induced stomatal opening by ABA (Zhao et a!., 2008) and ABA-, methyl jasmonate (MeJA)-, and hydrogen peroxide-induced stomatal closure (Islam et al., 2009). The observations that both PHS1 (phsl-3 mutants) and MPK12 loci have been implicated in mediating ABA signalling (Quettier et al., 2006; Jammes et al., 2009) in mature guard cells and that both MPK12 and PHS1 are highly expressed in mature guard cells, generates a tantalizing hypothesis that a PHS1- MPK12 dyad might mediate ABA and/or other hormonal signalling in the mature guard cells. Further genetic and biochemical work is required to address this hypothesis. Since PHSJ and MPKJ2 expression patterns were found to overlap in mature guard cells, I analyzed the MPK12-RNAi lines for defects in the radial microtubule arrays in guard cells. The role of microtubule cytoskeleton in development of guard cells has been well documented 104  (Galatis, 1980; Lucas et al., 2006; Apostolakos et a!., 2009). Similarly, it has been proposed that microtubule-dependant signalling events might be involved in regulating stomatal physiological responses (Marcus et al., 2001; Yu et al., 200 1).Using the freeze-shattering immunolabelling technique with anti-tubulin antibodies (Wasteneys et al., 1997), I was able to visualize the radial microtubule arrays in mature guard cells. These arrays appeared to be normal in MPK12-RNAi guard cells compared to the empty-vector guard cells, indicating that the MPK12 protein is not required to maintain the radial microtubule arrays or development of guard cells. However, the possibility that MPK12 might be involved in mediating microtubule function in mature guard cells when treated with regulators of guard cell function still exists. Some of the guard cell regulators like calcium and light/dark regimes have been shown to influence the microtubule arrays (Cyr and Palevitz, 1995; Sivaguru et al., 2003; Lahav et a!., 2004), whereas the potential connection between other regulators of guard cells such as ABA and hydrogen peroxide with microtubule organization is less clear. Nonetheless, in future work, treatment ofphsl mutant and MPK 1 2-RNAi seedlings with guard cell regulators and subsequent analysis of microtubule  arrays may be worth considering in elucidating any potential role for a PHS1-MPK12 dyad in guard cell functions.  105  MATERIALS AND METHODS Plant Materials and Growth Conditions  The empty-vector (Line 1 and 4), PHS1-RNAi (Linel5 and 17), and MPK12-RNAi (Line 9 and 17) were cold-treated for 2-3 days and grown aseptically on Hoagland medium supplemented with dexamethasone (DEX; Sigma-Aldrich) at 21°C with a 1 6-h-lightl8-h-dark cycle. For short term experiments, five-day-old seedlings grown on Hoagland’s medium were transferred to medium supplemented with dexamethasone for 24-4 8 hours. Stock solutions of dexamethasone (10 mM) were prepared in 100% ethanol.  Immunohistochemistry and Microscopy For immunolabelling of intact roots and guard cells, specimens were prepared as described (Wasteneys et al., 1997; Collings et al., 2006). Anti--tubulin (clone B5 12 diluted 1/1,000; Sigma-Aldrich) was used as primary antibody and IgG: Alexa-488 was used as secondary antibody. For root tip squashes, seedlings were fixed and processed as described (Kawamura et al., 2006). To measure root cell sizes, roots were imaged with a Zeiss microscope (Axiovert 200M) using Nomarski optics under a 40x objective. For light microscopy, a Leica stereomicroscope (M21 6FA) equipped with a Leica DC500 digital camera was used. Confocal imaging was performed as described in chapter 3 with the following modification. A Zeiss microscope (Meta 510) equipped with a MaiTai sapphire laser was used to simultaneously image DAPI-stained DNA and Alexa-488-labelled microtubules. Image analysis was performed using ImageJ software (http://rsb. info.nih.gov/ij/).  106  Histochemical Analysis of GUS Activity The intergenic region between the MPK12 (At2g46070) coding sequence and the coding sequence of the neighboring gene comprising 342 base pairs was isolated from wild-type genomic DNA by PCR amplification using Platinum Taq HIFI (Invitrogen) and K12F (5’ AAT CAC TGC TCT CTT TGT AGT G 3’) and K12R (5’GAT GAT GCA ATG ATC AGA  CCG 3’) primers. The amplified MPK12 promoter sequences were subcloned into the cloning vector pCR8/GW/TOPO (Invitrogen), and subsequently cloned into the Gateway® binary vector pGWB3 (Nakagawa et al., 2007) by LR recombination (Invitrogen). The MPKl2promoter:GUS fusion construct was transformed into wild-type (Col) Arabidopsis plants by the floral dip method (Clough and Bent, 1998). Two independent T MPKl2promoter:GUS lines were used to 2 analyze the expression patterns of MPK12 gene throughout development using the histochemical GUS analysis as described previously (Malamy and Benfey, 1997). Images were taken by using a Leica DMR light microscope and a Leica stereomicroscope (Leica Microsystems) and processed using ImageJ software.  107  ChAPTER 5. The role of a PHS1-MPK18 signalling module in mediating MOR1 functions INTRODUCTION The ability of both PHS 1 and MPK1 8 to alter microtubule functions suggest that this signalling module could be interacting in some way with proteins that play a direct or indirect role in controlling microtubule assembly dynamics and/or functions. Since many microtubule associated proteins (MAPs) play a pivotal role in controlling microtubule structure and functions, the PHS1-MPK18 signalling module might be directly or indirectly involved in regulation of these MAPs. Phosphorylation of MAPs has been extensively studied in mammalian and other systems. For example, phosphorylation of the neural microtubule-stabilizing proteins such as MAP2, MAP4, and tau has been shown to reduce their association with the polymer surface of the microtubule lattice. As a consequence of this reduced MAP-microtubule binding affinity, microtubules are subjected to destabilization by various destabilizing factors (Hoshi et al., 1992; Drewes et al., 1997; Ebneth et al., 1999; Drewes, 2004b). Vasquez and colleagues examined the effect of the phosphorylation of XMAP2 15, a microtubule-associated protein isolated from Xenopus eggs, by CDK1 on the assembly of purified tubulin in vitro. Phosphorylation ofXMAP215 led to a reduction in the elongation rates at the plus end, whereas XMAP2 15 binding to taxol microtubules was not changed by phosphorylation (Vasquez et al., 1999). Fission yeast Dis 1 belongs to the Dis1IXMAP215/TOG family and, like its orthologues, plays a pivotal role in regulating microtubule dynamics. Disi is regulated by CDC2-mediated phosphorylation, and this phosphorylation regulates the localization ofDisl during anaphase and metaphase to ensure the fidelity of chromosome segregation (Aoki et al., 2006). Thus, phosphorylation of MAPs can 108  dramatically alter the MAP-microtubule binding affinity, microtubule dynamics and the localization of MAPs, and thereby profoundly affect overall cell development and morphogenesis. There is also evidence that phosphorylation of MAPs in plants regulates microtubule functions. Two recent studies in tobacco cells demonstrate that phosphorylation-dependant control of MAP65-1 influences the microtubule bundling and microtubule-MAP65-1 binding processes, leading to defects in cell division (Sasabe et al., 2006; Smertenko et al., 2006). Phosphorylation of the tubulin subunits of microtubules might also be an important feature in the regulation of microtubule dynamics and function. Ben-Nissan and co-workers (2008) reported that Arabidopsis Casein kinase 1-like 6 (CKL6), a member of casein kinase 1 family (CK1), associates with cortical microtubules in vivo and phosphorylates tubulins in vitro. Overexpression of CKL6 led to shorter and more randomized microtubule arrays, while the microtubule arrays were more organized and formed long parallel microtubule bundles in the CKL6-kinase inactive plants (Ben-Nissan et al., 2008). A recent study by Blume and co-workers suggested that tyrosine phosphorylation of tubulin in tobacco cells could be involved in modulating the properties of plant microtubules (Blume et al., 2008). This is particularly intriguing since, unlike mammalian systems, few canonical tyrosine kinases are encoded in plant genomes. Overall, the role of phosphorylation-dependant control of microtubule functions is beginning to emerge in plant cells. To further understand how a MPK18 signalling module might mediate microtubule-related functions, I wished to first determine how absence of MPK1 8 protein might affect the overall spatial organization of cortical microtubule arrays and/or plus end growth and shrinkage rates. To achieve this, I first introduced GFP-TUB6 reporter into mpkl8 mutant background and then 109  monitored the overall spatial organization of microtubule arrays a measuring the growth and shrinkage rates at the plus end of the microtubules. Second, I wished to determine if the MOR1 protein might be a target of the MPK 18 signalling module. Although formal identification of in vivo substrates for MPK1 8 is required to fully define the molecular mechanisms involved in the phosphorylation-dependent regulation of plant cortical microtubules, certain observations suggest that MOR1 might be a potential target of the PHS1-MPK18 signalling module. For instance, phsl-1 and mon-i genetically interact at permissive temperature (Naoi and Hashimoto, 2004), which raises the possibility that kinases that interact with PHS 1 might be regulating MOR1 functions. Furthermore, the observation that PHS1 gene expression is transiently enhanced in the mon-i mutant strengthens the model of a potential relationship between a PHS1 signalling module and MOR1 function. I therefore hypothesized that a functional connection exists between PHS1 and MOR1, and that this could involve MPK18, since it has been identified as one of the substrates/interactors of PHS 1. I took a genetic approach to analyze the phenotypic consequence of removal of MPK1 8 protein in mon-i plants, and utilized a cell biological and biochemical approach to monitor the changes in the localization pattern and phosphorylation status of MOR1 inphsi-i plants.  110  RESULTS The Spatial Organization and Plus End Microtubule Growth and Shrinkage Rates in the mpkl8-1 Mutant  To understand the potential role of MPK1 8 in influencing the spatial organization of cortical microtubule arrays, I compared the microtubule behaviour in the wild-type and mpkl8-1 cells. Analysis of the microtubule behaviour in the living cells expressing the GFP-TUB6 reporter protein revealed that in cotyledon epidermal cells, mpkl8-1 microtubules were well organized and, like wild-type, formed varied orientations. In agreement with the previous immunofluorescence data for roots, the overall spatial organization of microtubules in mpkl8-1 cotyledon cells do not appeared to be different from the wild-type (Figure 5. la). To further examine the possibility that loss of MPK1 8 might lead to some subtle changes at the plus-end of microtubules, I measured the microtubule growth and shrinkage rates in the cotyledon cells by tracking the changes in length of microtubules at the plus end. The mpkl8-1 mutant and wild type microtubule plus-end growth (mpkl8-1: 5.99±2.05 jim/minute; wild type: 5.68±2.0 1 jim/minute) and shrinkage rates (mpkl8-1: 13.34±6.02 jim/minute; wild type: 12.67±6.89 jim/minute) were not significantly different (Figure 5.1 b, 5.1 c and Figure 5.2). Overall, the spatial organization and plus end growth and shrinkage rates of microtubules do not appear to be altered in the mpkl8-1 mutant.  111  (a)  (b)  wild-type  Figure 5.1 Spatial organization and plus end growth and shrinkage of cortical microtubules.  (a) Spatial organization of cortical microtubules in wild-type and mpkl8-1 cotyledon pavement cells visualized through use of GFP-TUB6 reporter protein. The overall organization of microtubules in mpkl8-1 cells is similar to wild-type cells. Bar = 5im (b) Time lapse images of microtubules labelled with GFP-TUB6 in wild-type to illustrate plus end growth and shrinkage events. Microtubule plus ends marked with green and blue dots represent growth events while shrinkage event at the microtubule plus end is marked with a purple dot. Bar = 5tm (c) Time lapse images of microtubules labelled with GFP-TUB6 in mpkl8-1 to identify plus end growth and shrinkage events. Some of the microtubule plus ends are indicated on the micrographs with coloured markers. The white dot indicates a plus end growth event, while the green dot indicates a shrinkage event. Bar = 5j.im  112  ii  wild..type  l7  Iii  I  • ,npk 184  —  ‘U  2:  Growth  Shrinkage  Figure 5.2 Plus end microtubule growth and shrinkage rates are not significantly different in mpkl8-1 compared to the wild type according to a Student t-test. The growth rates and shrinkage rates were calculated from the time-lapse images of microtubules expressing GFP-TUB6. Data represent means ± SD. Data were collected from 40 microtubules from 5 different plants for wild-type and mpkl8-1 respectively. ,  113  MOR1 Functions are not Altered in the Absence of MPK18  To address the possibility that the MPK1 8 protein may be involved in a signalling pathway that specifically controls MOR1 functions, I took a genetic approach and generated double morl 1/mpkl8-1 mutant plants to determine whether MOR1 functions could be altered in the absence of the MPK18 protein. If the MPK18 signalling pathway somehow modulates MOR1 functions, I expect to see either enhancement or suppression of mon-i phenotypes at its permissive and/or restrictive temperatures in the absence of the MPK1 8 protein. The morl-1/mpki8-1 plants did not display any abnormal or developmental defects at mon-i’s permissive temperature (Figure 5.3a). The primary root length of morl-1/mpkl8-1 seedlings was not significantly different from both mon-i and mpki8-i single mutant seedlings (Figure 5.3b). The root elongation inhibition, twisting and swelling phenotype of mon-i observed at the restrictive temperature was neither enhanced nor suppressed in the moni-i/mpki8-i, roots (Figure 5.3c). From genetic studies, it appears that MPK1 8 protein might not be involved in controlling MOR1 functions.  114  (c)  inpkl8-1  nsorl-1  rnorl4 inpkl8-I  (b) 21  E II II  — —  — — —  — snpkIR.1  II  mon—I  rnpkl8-l  nwrl-I  ,,wrl—1  ,,wri—I  mpkl8.I  Figure 5.3 Genetic interaction between mon-i and mpki8-i mutants.  (a) Seedlings were grown for five days on vertically placed agar plates. Genotypes are indicated below the seedlings. (b) Root length of 5-day-old mpkl8-i, mon-i , and morl-1/mpkl8-i seedlings. The root length in the double mutant was not significantly different compared to that of monl-1(Student t-test). Data represent means ± SD (n ? 32). (c) Root phenotypes of mpkl8-1 , mon-i and mori-lImpkl8-1 at the permissive and restrictive temperature. The seedlings were grown for five days at permissive temperature and then transferred to the restrictive temperature for a period of 20-24 hours. Bar = 0.5mm.  115  MOR1 Remains Associated with Microtubules in phsl-1 Mutant Given the genetic interaction between mon-i and phsi-i mutant it remains possible that a yet-  to-be identified interactor/substrate of PHS 1 might modulate MOR1 functions. Regardless of the identification of these interactors/substrates, it is not clear how MOR1 functions might be regulated by the PHS1 phosphatase. One possibility is that with the loss ofPHS1’s ability to target and dephosphorylate its target substrates in the phsl-1 mutant background, the MOR1 protein remains hyperphosphorylated, leading to a reduced affinity for the microtubule polymer surface. To test this hypothesis, I took a cell biological approach to double-label microtubules with MOR1 and f3-tubulin-specific antibodies to assess whether the association of MOR1 with -  microtubules is altered in phsi-i plants. In agreement with previous reports (Kawamura et al., 2006), MOR1 was found to co-localize along the entire length of microtubules in wild-type cotyledon cells. There were no obvious changes in the association of MOR1 with microtubules in the phsi-1 background (Figure 5.4). This result indicates that neither the amount of MOR1 protein nor the association of MOR1 with microtubules appears to be altered in the p/is] -1 mutant.  116  Microtubules  MORJ  Merge  WT  phsl4  Figure 5.4 Double immunofluorescence labelling of microtubules and MOR1 in cotyledon epidermal cells. Microtubules were labelled by -tubulin antibody and MOR1 antibody was used to detect MOR1 protein. (a) MOR1 is bound to microtubules along their entire length in wild-type cells. (b) Inphsl-1 cells, MOR1 remains associated with microtubules in a similar pattern as in wild type cells. Bars = 10 jim  117  MOR1 Protein does not appear to be Phosphorylated in the phsl-1 Mutant  In an attempt to determine whether the MOR1 protein is hyper-phosphorylated in phsl-1 plants, I carried out immunoblotting analysis of wild-type and phsl-1 protein extracts with phospho serine and phospho-threonine antibodies. MOR1 appears as a high molecular weight protein band of about 210 kDa when probed with anti-MOR1 antibody on a one-dimensional SDS PAGE gel (Kawamura et al., 2006). If the MOR1 protein is a target of the PHS1 signalling complex, then one of the possibility is that it might get phosphorylated at several of the -S/TP residues, and appear as a hyperphosphorylated band of around 210 kDa inphsl-1 protein extracts compared to wild-type. When protein extracts were probed with anti-phospho-serine or anti-phospho-threonine antibodies, there was no obvious increase in the intensity of any band around 210 kDa in protein extracts from phsl -1 or in a phsl null allele (Figure 5.5). There was no band present at 21 OkDa in protein extracts from wild-type either. This result indicates that the phosphorylation status of MOR1, as assessed using anti-phospho-serine and anti-phospho threonine antibodies, does not appear to be altered in the phsl-1 background.  118  (a) 250 kDa  1  2  3  1 (b)  2  3  —  150 kDa  250 kDa  —  150 kfla  Figure 5.5 Immunoblotting analysis ofwild-type,phsl-landphslnull allele protein extracts with phospho-serine and phospho-threonine antibodies.  (a) Total proteins from wild-type (lane 1) and phsl-1 (lane 2) and p/is] null allele (lane3) extracts were probed with phospho-serine antibody (Top panel). Immunoblotting shows that the phospho-serine antibody does not recognize any obvious phospho-protein band at MOR1 ‘5 predicted molecular mass of 210 kDa. Coomassie Brilliant blue (CBB) staining of the same blot to illustrate equal loading of protein and protein size ladder (Lower panel). (b) Total proteins from wild-type (lane 3) and phsl-1 (lane 2) and phsl null allele (lane 1) extracts were probed with phospho-threonine antibody (Top panel). As with phospho-serine antibody, immunoblotting shows that the phospho-threonine antibody also does not recognize any obvious phospho-protein band at MOR1 ‘s predicted molecular mass. Coomassie Brilliant blue (CBB) staining of the same blot (Lower panel). Note that the proteins recognized by phospho-threonine antibody are quite different from proteins recognized by phospho-serine antibody.  119  DISCUSSION  Microtubule dynamics has been suggested to be one of the key factors that influence the organization of cortical microtubules (Ehrhardt and Shaw, 2006; Kawamura and Wasteneys, 2008); however, the exact mechanisms of how microtubule dynamics contributes to the final organization of microtubule arrays is yet to be fully understood. One proposal was that perturbed growth and shrinkage rates at the plus ends of cortical microtubules might predispose the microtubules in their response to microtubule-disrupting drugs in the mpkl8-1 mutant. However, my observations with live cell analysis in the mpkl8-1 mutant do not provide strong support for this proposal. The data obtained from the live cell analysis in the mpkl8-1 mutant suggests that under normal conditions, the function of the MPK18 signalling module might not be to influence the spatial organization of microtubules, and microtubules are not biased to modulate either plus end growth and/or shrinkage behaviour in the absence of MPK18. Therefore, whatever signalling modules MPK1 8 may be involved in are likely to participate in the biological processes that indirectly and subtly influence microtubule functions. These results are in agreement with the localization analysis of MPK1 8; where MPK 18 protein was not found to be colocalized with microtubules or show enrichment at the microtubule plus ends. Generally, proteins that have been reported to control plus end microtubule dynamics either physically associate along the entire length of microtubules or are preferentially localized at the plus ends (Kawamura et al., 2006; Ishida et al., 2007a; Ehrhardt, 2008; Yao et al., 2008). Based on my observations that the MPK1 8 protein does not show any colocalization with microtubule plus ends, and that the overall spatial organization and the plus end growth and shrinkage rates do not appear to be dramatically altered in mpkl8-1, further detailed analysis of measuring other aspect of  120  microtubule dynamics at the plus end may not yield much information about the functional connection that might exist between MPK18 signalling module and microtubule functions. Further investigation is required, however, to explore whether during certain physiological conditions (such as abiotic stress conditions), the effect of MPK1 8 signalling on the spatial organization and/or plus end growth and shrinkage behaviour may become perceptible. Recent studies have provided evidence that salt, cold and osmotic stress could lead to changes in the spatial organization of cortical microtubules (Abdrakhamanova et al., 2003; Nyporko et al., 2003; Zhao et al., 2003; Shoji et al., 2006; Wang et al., 2007a). Since IvIPK signalling pathways are known to mediate responses to environmental stresses, one of the interesting possibilities could be that during stress conditions, the MPKI 8 signalling complex might transiently associate with microtubules and influence microtubule-related functions. Such a mechanism has been observed with cellulose synthase complexes, which have been shown to be retracted from the plasma membrane and associate with cortical microtubules during osmotic stress conditions (Crowell et al., 2009; Gutierrez et al., 2009). From that perspective, measuring the microtubule dynamics in mpkl8-1 cells during stress stimuli that has been reported to modulate microtubule functions might be useful to determine if some aspect of the microtubule dynamics is perturbed in the absence of MPK1 8 protein. Based on my genetic analysis, MOR1 does not appear to be a target of the MPK1 8 signalling module. The double mutant morl-1/mpkl8-1 seedlings were phenotypically indistinguishable from the single mon-i mutant at the permissive and restrictive temperatures. This indicates that MPK1 8, one of the substrate/interactors of PHS 1, may not participate with PHS 1 to form a functional connection with MOR1. However, the possibility that yet-to-be identified kinases, including members of non-MPK families, may be involved in one or more complexes with PHS1 121  to influence MOR1 cannot be ruled out. The observation that the absence of MPK1 8 expression  can only partially rescue the phsl-1 phenotype supports the idea that PHS1 might be interacting with other substrates/interactors. Identification of full spectrum of interactors that interact with PHS1 is required to fully understand the functional connection that might exist between PHS1 signalling module and MOR1. Although the phenotype of the mon-i mutant is indistinguishable from the wild-type plants at the permissive temperature, detailed examination of plus end microtubule dynamics revealed that microtubules in mon-i grew and shrank more slowly than in wild type, even at the permissive temperature (Kawamura et al., 2006). This may provide an alternative explanation to interpret the previously reported stronger phenotype of the monl-1/phsi-ldouble mutant plants observed at the permissive temperature. Perhaps the slightly altered microtubule dynamics in the mon-i mutant are responsible for enhancing the phsi -1 phenotype at the permissive temperature. Since both the phsi-i and mon-i mutations are influencing cortical microtubule functions at the permissive temperature, the results of combining these two mutations (mori-i/phsi-i) leads to stronger defects in cortical microtubule functions and the overall morphology. Studies with ARMADILLO REPEAT KINESIN1 (ARK1), which is involved in the root-hair morphogenesis (Sakai et al., 2008), point towards a similar mechanism in which altered microtubule dynamics in mon-i at the permissive temperature might be enhancing the ark] root-hair phenotype (G. Wasteneys, UBC, pers comm.). To further understand how the PHS1 phosphatase may influence MOR1 functions, I examined two possibilities: first, that in the p/is]-] mutant, the localization pattern of MOR1 protein might be altered; and second, that MOR1 might be hyperphosphorylated in the phsi-imutant. If MOR1’s association with microtubules and/or phosphorylation status of MOR1 had been found 122  to be altered in the phs]-1 mutant, this would have provided indirect evidence that the PHS1 signalling module somehow affects MOR1 functions. In mammalian and other systems, phosphorylation-dependent changes in the localization of MAPs include altered MAP microtubule association, sequestration of MAPs, and changes in their stability parameters. For example, phosphorylation of tau and MAP2 causes the detachment of these proteins from microtubules (Illenberger et al., 1996). Stathmin is also a phosphorylation-regulated tubulin binding protein, but it affects microtubule functions by sequestration of tubulin, rather than by affecting microtubule dynamics (Amayed et al., 2002). Phosphorylation of MAP2c in HeLa cells disrupts the MAP2c-microtubule interaction and promotes MAP2c localization to peripheral membrane ruffles enriched in actin (Ozer and Halpain, 2000). Consistent with previous observations (Kawamura et al., 2006), the MOR1 protein was detected along the entire length of microtubules in my immunolabelling experiments. This pattern of association of MOR1 with microtubules did not appear to change in the phsl-lmutant, indicating that the localization pattern of MOR1 is not altered. Since no fluorescent reporter linked to the MOR1 protein is currently available, live-cell studies aimed at understanding the dynamic nature of MOR1 localization patterns are not possible. Overall, however, these double-labelling studies enabled me to demonstrate that the localization pattern of MOR1 shows no obvious alteration in the phsl-1 mutant. Although MOR1 does not appear to lose affinity for microtubules in the phsl 1 mutant background, the possibility that the functions of MOR1 are not perturbed inphsl-1 carmot be definitively ruled out. The possibility exists that the p/is]-] mutation perturbs the MOR1 -mediated regulation of microtubule dynamics rather than polymer affinity. A more detailed examination of microtubule dynamics in phsl-1/morl-1 plants may help to clarify this possibility. 123  Using phospho-serine and phospho-threonine antibodies to determine the phosphorylation status of MOR1 protein in wild-type and phsl-1 protein extracts is a technically challenging task but I reasoned that at least this approach might enable me to define whether some level of phosphorylation could be detected. From, western blotting analysis, it does not appear that MOR1 is phosphorylated either in wild-type protein extracts or in phsl -1 and phsl null allele protein extracts. However, as is generally the case with using non-specific antibodies, the degree of specificity and sensitivity of phospho-serine and phospho-threonine antibodies to detect subtle changes in the phosphorylation status of 210 kDa protein is unknown. It is noteworthy that there were no protein bands that showed any obvious differences in the phosphorylation abundance in the phsi-i compared to the wild-type protein extracts. The failure to detect the increased phosphorylation of any protein band in phsl-1 extracts could be result of several factors. First, the sensitivity of the antibodies was insufficient to detect any changes in the phosphorylation pattern of proteins in phsl-l extracts. Second, a perhaps less likely possibility exists that while the phsl-1 mutation has been shown in-vitro to reduce the phosphatase activity (Naoi and Hashimoto, 2004); the phsl-1 mutation might not reduce phosphatase activity in vivo. If this were true, the phsl-1 mutation might not influence the microtubule functions in a phosphorylation-dephosphorylation manner in-vivo; rather, it might function as an adapter/scaffolding factor or involved in other regulatory mechanism within one or more complexes such as the sequestration of its substrates. In future work, the use of anti-MOR1 antibodies to immunoprecipitate native MOR1 from the wild-type and p/is]-] protein extracts and subsequent LC-MS/MS analysis using mass spectrometry may be worth considering in checking the phosphorylation status of MOR1. In the 124  absence of availability of sufficient MOR1 antibody, I am presently unable to defmitively demonstrate that the phosphorylation status of MOR1 is altered in the phsl-1 protein extracts.  125  MATERIALS AND METHODS Plant Materials and Growth Conditions  Seeds were planted on petri plates containing Hoagland’s medium solidified with 1.2% agar as described in chapter 3. Plates were stored at 4°C for 2-3 days before being transferred to a growth chamber. The plants were grown at 21°C under l6hr light for given period of time and where required moved to 30°C. Wild-type seeds expressing GFP-f3-tubulin6 (Nakamura et al., 2004) were obtained as a gift from T. Hashimoto (NAIST, Japan) and crossed to mpkl8-lplants. This reporter line (GFP-TUB6) enabled the full length of microtubules to be observed in hypocotyl and leaf tissues, and has been reported to have no obvious side effects, unlike the GFP-MBD reporter line, on plant morphology (Nakamura et al., 2004; Ambrose and Wasteneys, 2008; Kawamura and Wasteneys, 2008). For generating double mutant plants, mpkl8-1 was crossed to mon-i plants, and F3 segregants that were homozygote for both mpkl8-1 and mon-i were used in this study.  Live Cell Imaging  Cotyledons were excised from 5-7 day-old seedlings and mounted between slide and cover slip in water to enable imaging at 22°C. Images were acquired using a spinning disc confocal microscope (Perkin- Elmer systems) in conjunction with Volocity software (Improvision) with a 63x 1.3 NA glycerol-immersion lens and lasers and filters appropriate for visualizing GFP. GFP was excited at 491 nm by solid-state lasers and typical exposure times were 800 ms for GFP TUB6. Images were taken every 8 seconds over 3 minutes for GFP-TUB6. Images were processed with ImageJ software (http://rsb.jnfo.nih.gov/jj/) for contrast adjustment and production of movies from time lapse imaging. Microtubules minus ends were very static 126  compared to their plus ends in mpkl8-1 and wild-type cells. Plus end microtubule growth and shrinkage rates were measured with using ImageJ Manual Tracking plug-in. Changes in length of less than ±0.4 j.m between two time-points were not included to calculate the plus end microtubule growth and shrinkage rates.  Immunolabelling of Microtubules and MOR1  Cotyledons were processed for immunolabelling by freeze shattering in liquid nitrogen as described (Wasteneys et al., 1997) Briefly, 6-7 day-old cotyledons were fixed in the fixation .  buffer [(4 % (v/v) formaldehyde and 0.5% (v/v) glutaraldehyde in PEMT buffer (50 mM PIPES, 2 mlvi EGTA, 2 mM MgSO , 0.05% (v/v) Triton X-100, pH 7.2)] for one hour. The cotyledons 4 were washed in PEMT buffer three times for five minutes. The cotyledons were placed between two glass slides and immersed in the liquid nitrogen for several seconds. Then using cold pliers, gentle pressure was applied on the frozen cotyledons to achieve shattering. The shattered cotyledons were placed in the permealization buffer (50 mlvi PIPES, 2 mM EGTA, 2 mlvi MgSO 4 1% triton X- 100, pH 7.2) for 1 to 2 hours, subsequently washed in the phosphate-buffered saline (PBS) for ten minutes. To reduce the autofluorescence caused by the free aldehydes from glutaraldehyde fixation, cotyledons were incubated in 1 mg/ml NaBH in PBS for twenty minutes. Cotyledons were incubated with the primary antibodies against f3-tubulin and MOR1 at 4°C overnight, rinsed in PBS three times for ten minutes, and the secondary antibodies applied for three hours at 37°C. After a final rinsing in PBS three times, cotyledons were mounted in Citifluor AFI antifade agent (Citifluor, London, UK). For double labelling of microtubules and MORiprotein, rabbit anti-MOR1 (1/30) and mouse anti-f3-tubulin (clone N357, diluted 1/100, Amersham, UK) were applied together. For labelling 127  with the secondary antibodies, cy5- goat anti-mouse IgO (1/200) and FITC- sheep anti-rabbit IgG (1/50) were applied together. Fluorescent images were collected with a 63x NA 1.4 oilimmersion lens mounted on a Zeiss Pascal confocal microscope. The 488 nm line of an argon laser and the 633 nm line of a HeNe laser were used for FITC and Cy5 excitation, respectively. Images were processed using ImageJ software.  Western Blotting  Whole seedlings (100 mg) were ground in liquid nitrogen and immediately added to the boiling 2X-sample buffer (125 mM Tris, 0.8 mM EDTA, 20 mM DTT, 10% glycerol, 4% SDS, 0.00 1% bromophenol blue, pH 6.8) for three minutes. Extracts were centrifuged at 13,500 rpm for five minutes at 4°C and the supernatant was applied to the SDS-PAGE gel for separation by electrophoresis. A 4%-20% gradient gel (BlO-RAD, Canada) was used to resolve the proteins. Proteins were blotted onto PVDF membrane (prerinsed in methanol) using transfer buffer (12.5 mM Tris, 96 mM glycine, 0.5% SDS and 20% methanol). The membrane was blocked in blocking solution (5% skim milk or 5% BSA dissolved in 1X-TBST buffer) for two hours at 4°C. Membrane-bound proteins were probed with anti-phospho-serine (Sigma, P3430) and anti phospho-threonine (Cell Signalling Technology, 9381) primary antibodies at a dilution of 1/500 and 1/1000 overnight at 4°C, respectively. Following three successive five minutes washes with 1X-TBST; membranes were probed with the secondary antibodies, the horseradish peroxidase coupled anti-mouse IgG and anti-rabbit IgG at a dilution of 1:5000, respectively for two hours at room temperature. Blots were then washed three times (five minutes each) in 1X-TBST prior to exposing them to the chemiluminescent detection reagent, ECL (Amersham), for 30 seconds in the dark followed by exposure to film (Kodak). 128  ChAPTER 6. Conclusion and future directions SUMMARY OF THE RESULTS In this thesis, I investigated at the transcriptional level what cellular processes might be engaged when the microtubule cytoskeleton is perturbed, with a particular interest in the responses of genes encoding signal transduction components. In chapter 2, I showed that perturbations in the microtubule cytoskeleton, achieved through the conditional microtubule disruption phenotype of mon-i, led to changes in the expression of gene transcripts associated with diverse cellular  processes. These results indicate that microtubule organization plays an important role in mediating an array of cellular processes. Of particular note was the change induced in the expression of PHS1, whose encoded protein is predicted to function as a modulator of MPK specific signal transduction components. PHS1 had been previously implicated in mediating cortical microtubule functions in plant cells, an observation that pointed to an intriguing possible link with the transcriptional response of PHSJ to microtubule disruption. In Chapter 3, I asked whether the PHS 1 phosphatase could be used to identif’ potential MPKs partner(s) that might be acting as substrate/interactor of PHS 1. I identified MPK1 8 as one of the kinases that interacts directly with PHS 1, and demonstrated through reverse genetics analysis that manipulation of MPK1 8 results in conditional defects in microtubule-related functions. These results suggested that a MPK18 signalling module might be involved directly or indirectly in influencing microtubule functionality. lii contrast, analysis of MPK12, as shown in chapter 4, which was shown to also interact with PHS1 in yeast two-hybrid assays, identified no microtubule-specific function. In chapter 5, I showed that a MPK1 8 signalling module is likely to participate in the biological processes that indirectly and subtly influence microtubule functions. Previous genetic analysis indicated a potential interaction between PHS 1 and the microtubule-associated protein 129  MOR1, suggesting that MPK18’s connection to microtubule function could be via MOR1. Based on my genetic analysis, however, MOR1 itself does not appear to be a target of this putative MPK1 8 signalling module. Preliminary attempts to obtain evidence for direct impacts of PHS 1 activity on MOR1 were unable to demonstrate that manipulation of PHS 1 altered either subcellular localization or phosphorylation status of the MOR1 protein.  FUTURE DIRECTIONS Diverse Cellular Processes are engaged when the Microtubule Cytoskeleton is perturbed The use of the mon-i allele offered an excellent system to identify genes whose products might be functionally connected with processes that monitor microtubule integrity status and help in re establishing the cellular homeostasis. However, since the exact molecular basis for the mon-i phenotype has yet to be established, it is not clear what aspect(s) of the mon-i phenotype might be triggering these transcriptional responses. This question could be explored by using other strategies for disrupting microtubule function in more defined ways. For example, transcriptional profiling of seedlings treated with microtubule-disrupting drugs such as oryzalin or propyzamide, or environmental treatments that dc-polymerize microtubules (Wasteneys, 2003), such as cold shock, would provide additional insight into the identity of those genes whose products are functionally connected with maintenance of microtubule integrity. In the mammalian systems, an elegant mechanism that connects the microtubule disruption stimulus to transcriptional events has been reported (Giannakakou et al., 2000; Ziegelbauer et al., 2001); however, the presence of a similar mechanism in plant cells is yet to be discovered. The plant homologues of MIZ-1 in Arabidopsis (TAIR, blastp) encode zinc-finger domain containing proteins such as EARLY FLOWERiNG 6 (ELF6), RELATIVE OF EARLY FLOWERiNG 6 130  (REF6) and a transcription factor lilA (TFIIIA), which are shown to be involved in brassinosteroid signalling and ribosome biogenesis, respectively (Mathieu et al., 2003; Yu et al., 2008). These zinc-finger domain containing proteins could be exploited to generate insights into the plant responses. To understand the mechanisms that might connect the microtubule disruption stimulus with changes at the transcriptional level, it would be very informative to identify and characterize any transcription factors that consistently show differential expression in my microarray analyses. Since the relevant transcription factors may not necessarily change their expression in response to microtubule perturbation, it would also be worthwhile to examine transcription factors that specifically bind to the microtubules or tubulin dimers, where they can potentially serve as sensors of microtubule integrity. Chuong and co-workers used tubulin affinity chromatographic fractionation of Arabidopsis protein extracts to identify a Scarecrowlike transcription factor as a tubulin-binding protein (Chuong et al., 2004). It would be very interesting to explore the possibility that transcription factors, identified in my microarray analyses and by Chuong and co-workers, might shuttle in and out of the nucleus in response to the perturbations in the microtubule cytoskeleton and help regulate transcription of essential genes. Although transcriptional profiling is a useful tool for identifying the genes that are differentially expressed when the microtubule cytoskeleton is perturbed, these candidate gene products must then be further examined at the protein level. In addition, since changes in transcription are not necessarily directly reflected in increased translation, it would be worthwhile to directly examine the protein profiles of tissues in which microtubule organization had been perturbed. Not only would this provide a direct read-out of up or down regulation within the protein complement of the cell, but it offers the possibility to detect changes in post-translational modification of 131  existing proteins, such as increases or decreases in phosphorylated isoforms. One approach would be to examine the full range of differentially expressed proteins using 2D-gel electrophoresis techniques such as difference gel electrophoresis (DIGE) (Marouga et al., 2005), comparing the wild-type and mon-i extracts at the restrictive temperature. Incorporation of several time points, similar to the design of my mon-i microarray analysis, would allow us to draw informative correlations between changes observed at the transcriptional level and at the protein levels.  Identification of a Specific Mitogen-activated Protein Kinase, MPK18, as an Interactor of PHS1 The biochemical, cell biological and the reverse genetics approaches described in Chapter 3 revealed that MPK1 8 is one of the MPKs that interact with PHS 1. Furthermore, manipulation of MPK18 expression results in subtle defects in microtubule-related functions, which points to a  functional role for the PHS 1 -MPK1 8 signalling complex in directly or indirectly influencing the microtubule functions in plant cells. However, an assay of pair-wise yeast two-hybrid interactions between PHS 1 and all 20 MPKs revealed that both MPK12 and MPK1 8 are specific interactors of PHS 1. The discrepancy between the yeast two-hybrid interaction data and the Bimolecular Fluorescence complementation (BiFC) data regarding the PHS 1 interaction with MPK12 remains to be resolved. Further genetic analysis and application of other available protein-protein interaction techniques such as in vivo pull-down assays using Arabidopsis guard cell protoplasts are required to establish the in vivo relevance and characteristics of the interaction between PHS1 and MPK12. It is intriguing that, unlike MPK18, MPK12 expression appears to be concentrated mainly in mature guard cells, which suggests that a MPK 1 2-PHS 1 132  interaction might be contributing in some way to guard cell function. Consistent with this model, MPK12 has recently been found to play a role in controlling guard cell ion flux and stomatal responsiveness in Arabidopsis (Jammesa et al., 2009). Whether this guard cell function for MPK 12 involves the cytoskeleton has yet to be established.  Functional characterization of genes of unknown function, like MPKJ8, involves the use of various reverse genetic approaches. The phenotypic analysis of a single gene loss-of-function mutant within a large gene family is often ineffective, since the genetic redundancy that exists amongst gene family members masks the deficiency phenotype. In addition, gene families such as the MPK family have often evolved to perform highly specialized functions, which demands well-focused phenotypic analysis if relevant biological effects are to be detected in LOF or GOF mutants. Therefore, it was not surprising that the loss-of-function mutant of MPK18 did not display any obvious morphological defects at the macroscopic level. Several key experiments would help to better characterize the biological role of the MPK1 8 signalling module. A) A tissue-specific analysis of MPKJ8 expression needs to be performed at a fine scale. Although my RT-PCR analysis indicates that the MPK18 gene is broadly expressed in all the major organs, it does not provide any details about the tissue- or cell-specific expression patterns. Therefore, transgenic plants harboring a MPKJ8 promoter: GUS reporter construct need to be generated in order to study the tissue- and developmental-specific changes in the MPK18 expression. This analysis would make it possible to identifi tissue-types and a developmental window where the MPK18 signalling module might be biologically relevant. Further details regarding the possible conditional functions of MPK18 could be obtained by monitoring the changes in the MPKJ8 expression using a time-course in response to stimuli like challenge with various forms of stresses and hormones. Reverse genetics approaches could then be focused 133  only on these specific tissue-types and/or conditions. The other advantage of performing these kinds of experiments would be to compare the MPKJ8 expression profile with the increasingly availability of expression profiles of other members of the MPK family. Identification of other MPKs that share similar expression patterns with MPK18 might help identify functionally redundant MPKs that share functions with MPK1 8. B) It would be very useful to generate transgenic lines that harbor a MPKJ8 promoter:MPK18GFP reporter construct. Although my data using the constitutive CaMV35S promoter indicated that MPK 18 is localized to the cytoplasm, a detailed analysis of native MPK 18 protein localization was not possible using this strong promoter. Two potential problems with using the CaMV35S promoter to drive a reporter construct fused to the gene-of-interest include the  generation of artifacts associated with the high levels of overexpression and the potential suppression of expression of the transgene. Analysis of MPK1 8 localization using its native promoter could shed more light on possible transient interactions that might be involved between the MPK1 8 protein and cellular organelles. Two recent reports have demonstrated that the association of cellulose synthase complexes with microtubule ends is transiently enhanced during osmotic stress conditions, with a potential involvement of Golgi bodies (Crowell et al., 2009; Gutierrez et al., 2009). Osmotic stress is believed to perturb the cell wall integrity and this has been used as a tool to explore the potential connections between cell wall remodelling and microtubule organization (Hamann et al., 2009). Similar functional connections between osmotic stress and the microtubule organization are well described in the yeast system (Robertson and Hagan, 2008). In addition, evidence for roles of hormones such as brassinosteroids and gibberellins in influencing cell elongation through modulation of the microtubule functions is beginning to emerge (Wenzel et al., 2000; Catterou et 134  a!., 2001; Foster et a!., 2003) My present data indicate that the MPK18 signalling module .  influences microtubule function but rather indirectly, and through unknown mechanisms. Two experiments that would further our understanding with regard to the potential role of the MPK 18 signalling module in controlling microtubule-related functions are: 1) to examine the detailed dynamics of MPK1 8 localization in cells to test the idea that MPK1 8 may transiently associate with microtubules, tubulin dimers and/or vesicle-bound trafficking compartments; and 2). to conduct live-cell imaging experiments to monitor the changes in the localization patterns of MPK18 protein in response to stress and hormonal stimuli that has been shown to modulate microtubule functions. C) It will be instructive to evaluate the ability of certain stimuli to affect the activity status of MPK1 8, using phosphorylation of the artificial substrate, myelin basic protein (MBP), as a IVIPK1 8 activity assay. Pull-down assays of immunoprecipitated MPK1 8 from cells treated with various stimuli could be performed in protoplasts and/or transgenic plants that express an  epitope- tagged version of MPK1 8. Of particular interest would be various stimuli that have been reported to influence the organization of cortical microtubules such as cold shock and salt stress. The results of such experiments would shed some light on the upstream signals that could activate the MPK 18 pathway in vivo. D) The functional redundancy that exists amongst gene family members of the MPK group needs to be resolved by generating the combinatorial loss-of-function multiple mutants. Expression data indicates that the other members of Group D MPKs, like MPK16 and MPK2O, are highly co-expressed with tubulin isoforms, microtubule-associated proteins, proteins involved in cell expansion and CESA proteins (www.genevestigator.com). Since MPK18 belongs to the Group D 135  MPK members, and the mpkl8 mutant has defects in microtubule-related functions, it is  tempting to speculate that other members of Group D MPK might be functionally connected in influencing the microtubule function and/or cell wall properties. Therefore, it would be very useful to generate combinatorial loss-of-function mutants amongst Group D MPK members and to screen these for defects in microtubule function and cell wall properties. E) In the context of the MPK signalling modules, experiments aimed at analyzing the physiological effects of manipulating the strength of a signalling pathway are very informative. A loss-of-function allele of a gene-of-interest usually generates a situation where a particular signalling pathway is non functional; however, making a signalling pathway always active is rather difficult to achieve. One of the ways to make a MPK signalling module always active is to generate a transgenic line that expresses the constitutively-active form of the upstream double MPKK (CA-MKK) that normally phosphorylates a particular MPK. To avoid the pleiotropic effects of CA-MKKs, it would be beneficial to express the CA-MKKs under the native promoter of the MPK in question. Using in-vitro and in-vivo phosphorylation assays, the upstream IVIKKs that can phosphorylate MPK1 8 need to be identified. Once these upstream MKKs are identified, use of transgenic lines in which the MPK1 8 signalling module is always active can be generated to study the biological effects of overexpression of this signalling module on cellular processes.  Identification of Targets of the MPK18 Signalling Module  It should be a high priority to identify the potential target genes and proteins of the MPK1 8 signalling module. The most promising avenues currently available include a combination of unbiased global analyses such as transcriptional and protein profiling, and yeast two hybrid screens. Utilizing global approaches such as these could be very helpful to design hypothesis 136  driven experiments, and the biological function of the identified targets can then be verified further using additional genetic, biochemical and cell biological techniques. Since the MPK1 8 pathway is likely to be involved in a phosphorylation-dependent regulation of its target substrates, it is imperative to design global analysis experiments in a way that can help to increase the enrichment of candidate phosphoprotein targets in cells. Three experiments that could help to identify the candidate targets of the MPK1 8 signalling module described below. 1) Microarray-based transcriptional profiling of mpkl8-1 plants and plants in which the MPK18 signalling module is constitutively-active would help to identify candidate targets of MPK1 8 signalling dependant gene regulation. 2) Yeast two-hybrid cDNA library screening with full-length MPK18 as bait would be useful to identify MPK1 8 substrates/interactors. 3) Phospho-proteomics analysis can be conducted using plants in which MPK18 signalling is constitutively-active.  Relationship between MOR1 and PIIS1 The apparent relationship between PHS 1-mediated signalling and MOR1 should be further explored using a combination of biochemical and cell biological tools. The use of phospho-serine and phospho-threonine antibodies to assess the phosphorylation status of MOR1 in different phsl mutant backgrounds did not yield meaningful information. A more refined approach using immunoprecipitation of native MOR1 from the wild-type and several p/is] mutant backgrounds for analysis of the potential phosphorylation of MOR1 residues using LC-MS/JvlS might be more informative. Using site-directed mutagenesis, subsequent manipulation of key phospho-residues in MOR1, as identified by LC-MS/MS, could help establish the functional importance of direct 137  phosphorylation of MOR1 in plant cells. On the other hand, to identify additional substrate(s) of PHS1 that might be involved in influencing MOR1 functions, an unbiased global approach such as yeast two-hybrid screening using an appropriate cDNA library may prove to be useful. The advantage of such a global screen would be that non MPK-family substrates could also be identified. Finally, quantitative assessment of the different aspects of microtubule dynamics should be performed in the relevant mutant background to address the possibility that perturbations in the PHS1 protein could influence the mechanisms through which MOR1 specifically influences microtubule dynamics. This would require the introduction of reporter constructs such as GFP TUB6 and GFP-EB1, into the phsl/morl-1 double mutant background to facilitate observing the changes in the microtubule dynamics.  138  BIBLIOGRAPHY Abdrakharnanova A., Wang Q.Y., Khokhlova L., and Nick P. (2003). Is microtubule disassembly a trigger for cold acclimation? Plant Cell Physiol. 44, 676-686. Abraham S.M. and Clark A.R. (2006). Dual-specificity phosphatase 1: a critical regulator of innate immune responses. Biochem. Soc. Trans. 34, 1018-1023.  Amayed P., Pantaloni D., and Carlier M.F. (2002). The effect of stathmin phosphorylation on microtubule assembly depends on tubulin critical concentration. J. Biol. Chem. 277, 2271822724. Ambrose J.C. and Cyr R. (2007). The kinesin ATK5 functions in early spindle assembly in Arabidopsis. Plant Cell 19, 226-236. Ambrose J.C., Shoji T., Kotzer A.M., Pighin J.A., and Wasteneys G.O. (2007). The Arabidopsis CLASP gene encodes a microtubule-associated protein involved in cell expansion and division. Plant Cell 19, 2763-2775. Ambrose J.C. and Wasteneys G.O. (2008). CLASP modulates microtubule-cortex interaction during self-organization of acentrosomal microtubules. Mol. Biol. Cell 19, 4730-4737. Andersson J., Simpson D.M., Qi M., Wang V., and Elion E.A. (2004). Differential input by Ste5 scaffold and Msg5 phosphatase route a MAPK cascade to multiple outcomes. EMBO J. 23, 2564-2576. Andreasson E., Jenkins T., Brodersen P., Thorgrimsen S., Petersen N.H., Zhu S., Qiu J.L., Micheelsen P., Rocher A., Petersen M., Newman M.A., Bjorn Nielsen H., Hirt H., Somssich I., Mattsson 0., and Mundy J. (2005). The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J. 24, 2579-2589. Aoki K., Nakaseko V., Kinoshita K., Goshima G., and Yanagida M. (2006). CDC2 phosphorylation of the fission yeast disi ensures accurate chromosome segregation. Curr. Biol. 16, 1627-1635.  Apostolakos P., Livanos P., and Galatis B. (2009). Microtubule involvement in the deposition of radial fibrillar callose arrays in stomata of the fern Asplenium nidus L. Cell Motil. Cytoskeleton 66, 342-349. Bannigan A., Wiedemeier A.M., Williamson R.E., Overall R.L., and Baskin T.I. (2006). Cortical microtubule arrays lose uniform alignment between cells and are oryzalin resistant in the Arabidopsis mutant, radially swollen 6. Plant Cell Physiol. 47, 949-958.  139  Baskin T.I. and Wilson J.E. (1997). Inhibitors of protein kinases and phosphatases alter root morphology and disorganize cortical microtubules. Plant Physiol. 113, 493-502.  Baskin T.I., Beemster G.T., Judy-March J.E., and Marga F. (2004). Disorganization of cortical microtubules stimulates tangential expansion and reduces the uniformity of cellulose microfibril alignment among cells in the root of Arabidopsis. Plant Physiol. 135, 2279-2290. Bayer M., Nawy T., Giglione C., Galli M., Meinnel T., and Lukowitz W. (2009). Paternal control of embryonic patterning in Arabidopsis thaliana. Science 323, 1485-1488. Ben-Nissan G., Cui W., Kim D.J., Yang V., Yoo B.C., and Lee J.Y. (2008). Arabidopsis casein kinase 1-like 6 contains a microtubule-binding domain and affects the organization of cortical microtubules, Plant Physiol. 148, 1897-1907. Bergmann D.C., Lukowitz W., and Somerville C.R. (2004). Stomatal development and pattern controlled by a MAPKK kinase. Science 304, 1494-1497. Bichet A., Desnos T., Turner S., Grandjean 0., and Hofte H. (2001). BOTERO1 is required for normal orientation of cortical microtubules and anisotropic cell expansion in Arabidopsis. Plant J. 25, 137-148. Bisgrove S.R., Lee Y.R., Liu B., Peters N.T., and Kropf D.L. (2008). The microtubule plusend binding protein EB1 functions in root responses to touch and gravity signals in Arabidopsis. Plant Cell 20, 396-410. Blume V., Yemets A., Sulimenko V., Sulimenko T., Chan J., Lloyd C., and Draber P. (2008). Tyrosine phosphorylation of plant tubulin. Planta 229, 143-150.  Bolduc N., Hake S., and Jackson D. (2008). Dual functions of the KNOTTED 1 homeodomain: sequence-specific DNA binding and regulation of cell-to-cell transport. Sci. Signal. 1, pe28. Bouquin T., Mattsson 0., Naested H., Foster R., and Mundy J. (2003). The Arabidopsis luel mutant defines a katanin p60 ortholog involved in hormonal control of microtubule orientation during cell growth. J. Cell. Sd. 116, 791-801. Bracha-Drori K., Shichrur K., Katz A., Oliva M., Angelovici R., Yalovsky S., and Ohad N. (2004). Detection of protein-protein interactions in plants using bimolecular fluorescence complementation. Plant J. 40, 4 19-427. Brader G., Djamei A., Teige M., Palva E.T., and Hirt H. (2007). The MAP kinase kinase MKK2 affects disease resistance in Arabidopsis. Mol. Plant Microbe Interact. 20, 5 89-596. Brodersen P., Sakvarelidze-Achard L., Bruun-Rasmussen M., Dunoyer P., Yamamoto Y.Y., Sieburth L., and Voinnet 0. (2008). Widespread translational inhibition by plant miRNAs and siRNAs. Science 320, 1185-1190. 140  Burk D.H., Liu B., Zhong R., Morrison W.H., and Ye Z.H. (2001). A katanin-like protein regulates normal cell wall biosynthesis and cell elongation. Plant Cell 13, 807-827. Buschmann H., Fabri C.O., Hauptmann M., Hutzler P., Laux T., Lloyd C.W., and Schaffner A.R. (2004). Helical growth of the Arabidopsis mutant tortifolial reveals a plantspecific microtubule-associated protein. Cuff. Biol. 14, 15 15-1521. Camilleri C., Azimzadeh J., Pastuglia M., Bellini C., Grandjean 0., and Bouchez D. (2002). The Arabidopsis TONNEAU2 gene encodes a putative novel protein phosphatase 2A regulatory subunit essential for the control of the cortical cytoskeleton. Plant Cell 14, 833-845.  Cafterou M., Dubois F., Schaller 11., Aubanelle L., Vilcot B., Sangwan-Norreel B.S., and Sangwan R.S. (2001). Brassinosteroids, microtubules and cell elongation in Arabidopsis thaliana. II. Effects of brassinosteroids on microtubules and cell elongation in the bull mutant. Planta 212, 673-683. Chan J., Calder G.M., Doonan J.H., and Lloyd C.W. (2003). EB1 reveals mobile microtubule nucleation sites in Arabidopsis. Nat. Cell Biol. 5, 967-971.  Chen R.E. and Thorner J. (2007). Function and regulation in MAPK signaling pathways: lessons learned from the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta 1773, 13111340. Cheong Y.H., Moon B.C., Kim J.K., Kim C.Y., Kim M.C., Kim I.H., Park C.Y., Kim J.C., Park B.0., Koo S.C., Yoon H.W., Chung W.S., Lim C.O., Lee S.Y., and Cho M.J. (2003). BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol. 132, 1961-1972. Chuong S.D., Good A.G., Taylor G.J., Freeman M.C., Moorhead G.B., and Muench D.G. (2004). Large-scale identification of tubulin-binding proteins provides insight on subcellular trafficking, metabolic channeling, and signaling in plant cells. Mol. Cell. Proteomics 3, 970-983. Clough S.J. and Bent A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.  Cohen P. (1997). The search for physiological substrates of MAP and SAP kinases in mammalian cells. Trends Cell Biol. 7, 353-361. Colcombet J. and flirt H. (2008). Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochem. J. 413, 2 17-226. Collings D.A., Lill A.W., Himmeispach R., and Wasteneys G.0. (2006). Hypersensitivity to cytoskeletal antagonists demonstrates microtubule-microfilament cross-talk in the control of root elongation in Arabidopsis thaliana. New Phytol. 170, 275-290. 141  Crowell E.F., Bischoff V., Desprez T., Rolland A., StierhofY.D., Schumacher K., Gonneau M., Hofte H., and Vernhettes S. (2009). Pausing of Golgi bodies on microtubules regulates secretion of cellulose synthase complexes in Arabidopsis. Plant Cell 21, 1141-1154.  Curin M., Ojangu E.L., Trutnyeva K., IIau B., Truve E., and Waigmann E. (2007). MPB2C, a microtubule-associated plant factor, is required for microtubular accumulation of tobacco mosaic virus movement protein in plants. Plant Physiol. 143, 801-811. Cyr R.J. and Palevitz B.A. (1995). Organization of cortical microtubules in plant cells. Cuff. Opin. Cell Biol. 7, 65-71.  Dai Y., Wang H., Li B., Huang J., Liu X., Zhou Y., Mou Z., and Li J. (2006). Increased expression of MAP K1NASE K1NASE7 causes deficiency in polar auxin transport and leads to plant architectural abnormality in Arabidopsis. Plant Cell 18, 308-320. Dard N. and Peter M. (2006). Scaffold proteins in MAP kinase signaling: more than simple passive activating platforms. Bioessays 28, 146-156. Dardaihon M., Agoutin B., Watzinger M., and Averbeck D. (2009). Slt2 (Mpkl) MAP kinase is involved in the response of Saccharomyces cerevisiae to 8-methoxypsoralen plus UVA. J. Photochem. Photobiol. B. 95, 148-155.  Djamei A., Pitzschke A., Nakagami B., Rajh I., and flirt H. (2007). Trojan horse strategy in Agrobacterium transformation: abusing MAPK defense signaling. Science 318, 453-456. Doczi R., Brader G., Pettko-Szandtner A., Rajh I., Djamei A., Pitzschke A., Teige M., and Hirt B. (2007). The Arabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group C mitogen-activated protein kinases and participates in pathogen signaling. Plant Cell 19, 3266-3279. Dong J., MacAlister C.A., and Bergmann D.C. (2009). BASL controls asymmetric cell division in Arabidopsis. Cell 137, 1320-1330. Drewes G., Ebneth A., Preuss U., Mandelkow E.M., and Mandelkow E. (1997). MARK, a novel family of protein kinases that phosphorylate microtubule-associated proteins and trigger microtubule disruption. Cell 89, 297-308.  Drewes G. (2004a). MARKing tau for tangles and toxicity. Trends Biochem. Sci. 29, 548-555. Drewes G. (2004b). MARKing tau for tangles and toxicity. Trends Biochem. Sci. 29, 548-555. Ebneth A., Drewes G., Mandelkow E.M., and Mandelkow E. (1999). Phosphorylation of MAP2c and MAP4 by MARK kinases leads to the destabilization of microtubules in cells. Cell Motil. Cytoskeleton 44, 209-224. 142  Ehiting J., Mattheus N., Aeschliman D.S., Li E., Hamberger B., Cullis I.F., Zhuang J., Kaneda M., Mansfield S.D., Samuels L., Ritland K., Ellis B.E., Bohlmann J., and Douglas C.J. (2005). Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. Plant J. 42, 618-640. Ehrhardt D.W. and Shaw S.L. (2006). Microtubule dynamics and organization in the plant cortical array. Annu. Rev. Plant. Biol. 57, 859-875. Ehrhardt D.W. (2008). Straighten up and fly right: microtubule dynamics and organization of non-centrosomal arrays in higher plants. Curr. Opin. Cell Biol. 20, 107-116. Errington J. (2003). Dynamic proteins and a cytoskeleton in bacteria. Nat. Cell Biol. 5, 175178. Eulenfeld R. and Schaper F. (2009). A new mechanism for the regulation of Gabi recruitment to the plasma membrane. J. Cell. Sci. 122, 55-64. Feilner T., Hultschig C., Lee J., Meyer S., Immink R.G.H., Koenig A., Possling A., Seitz H., Beveridge A., Scheel D., Cahill D.J., Lehrach H., Kreutzberger J., and Kersten B. (2005). High Throughput Identification of Potential Arabidopsis Mitogen-activated Protein Kinases Substrates. Molecular & Cellular Proteomics. 4, 1558-1568. Fiil B.K., Petersen K., Petersen M., and Mundy J. (2009). Gene regulation by MAP kinase cascades. Curr. Opin. Plant Biol. 12, 615-621. Foster R., Mattsson 0., and Mundy J. (2003). Plants flex their skeletons. Trends Plant Sci. 8, 202-204. Fuentealba L.C., Eivers E., Geissert D., Taelman V., and Dc Robertis E.M. (2008). Asymmetric mitosis: Unequal segregation of proteins destined for degradation. Proc. Natl. Acad. Sci. U. S. A. 105, 7732-7737. Furutani I., Watanabe Y., Prieto R., Masukawa M., Suzuki K., Naoi K., Thitamadee S., Shikanai T., and Hashimoto T. (2000). The SPIRAL genes are required for directional control of cell elongation in Aarabidopsis thaliana. Development 127, 4443-4453. Galatis B. (1980). Microtubules and guard-cell morphogenesis in Zea mays L. J. Cell. Sci. 45, 211-244. Galletti R., Denoux C., Gambetta S., Dewdney J., Ausubel F.M., Dc Lorenzo G., and Ferrari S. (2008). The AtrbohD-mediated oxidative burst elicited by oligogalacturonides in Arabidopsis is dispensable for the activation of defense responses effective against Botrytis cinerea. Plant Physiol. 148, 1695-1706. 143  Gao L. and Xiang C.B. (2008). The genetic locus At1g73660 encodes a putative MAPKKK and negatively regulates salt tolerance in Arabidopsis. Plant Mo!. Biol. 67, 125-134.  Gao M., Liu J., Bi D., Zhang Z., Cheng F., Chen S., and Zhang V. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res. 18, 1190-1198. Giannakakou P., Sackett D.L., Ward Y., Webster K.R., Blagoskionny M.V., and Fojo T. (2000). P53 is Associated with Cellular Microtubules and is Transported to the Nucleus by Dynein. Nat. Cell Biol. 2, 709-7 17.  Giddings T. and Staehelin L. (1991). Microtubule-mediated control of microfilament deposition: a re-examination of the hypothesis. In The Cytoskeletal Basis ofPlant Growth and Form, ed. CW Lloyd, pp. 85—99. New York: Academic. Good M., Tang G., Singleton J., Remenyi A., and Lim W.A. (2009). The SteS scaffold directs mating signaling by catalytically unlocking the Fus3 MAP kinase for activation. Cell 136, 10851097. Gupta R., Huang Y., Kieber J., and Luan 5. (1998). Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J. 16, 58 1-589. Gutierrez R., Lindeboom J.J., Paredez A.R., Emons A.M., and Ehrhardt D.W. (2009). Arabidopsis cortical microtubules position cellulose synthase delivery to the plasma membrane and interact with cellulose synthase trafficking compartments. Nat. Cell Biol.11, 797-806. Hackbusch J., Richter K., Muller J., Salamini F., and Uhrig J.F. (2005). A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins. Proc. Nat!. Acad. Sci. U. S. A. 102, 4908-49 12. Hahn J.S. and Thiele D.J. (2002). Regulation of the Saccharomyces cerevisiae Slt2 kinase pathway by the stress-inducible Sdpl dual specificity phosphatase. J. Biol. Chem. 277, 2 127821284. Hamada T. (2007). Microtubule-associated proteins in higher plants. J. Plant Res. 120, 79-98. Hamann T., Bennett M., Mansfield J., and Somerville C. (2009). Identification of cell-wall stress as a hexose-dependent and osmosensitive regulator of plant responses. Plant J. 57, 10151026. Hamant 0., Heisler M.G., Jonsson H., Krupinski P., Uyttewaal M., Bokov P., Corson F., Sahlin P., Boudaoud A., Meyerowitz E.M., Couder V., and Traas J. (2008). Developmental patterning by mechanical signals in Arabidopsis. Science 322, 1650-1655.  144  Hamel L.P., Nicole M.C., Sritubtim S., Morency M.J., Ellis M., Ehlting J., Beaudoin N., Barbazuk B., Klessig D., Lee J., Martin G., Mundy J., Ohashi V., Scheel D., Sheen J., Xing T., Zhang S., Seguin A., and Ellis B.E. (2006). Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci. 11, 192-198.  Hashimoto T. (2003). Dynamics and regulation of plant interphase microtubules: a comparative view. Cuff. Opin. Plant Biol. 6, 568-576. Hashimoto T. and Kato T. (2006). Cortical control of plant microtubules. Cuff. Opin. Plant Biol. 9,5-11. He P., Shan L., Lin N.C., Martin G.B., Kemmerling B., Nurnberger T., and Sheen J. (2006). Specific bacterial suppressors of MAMP signaling upstream of MAPKKK in Arabidopsis innate immunity. Cell 125, 563-575. He X.J., Hsu Y.F., Zhu S., Wierzbicki A.T., Pontes 0., Pikaard C.S., Liu H.L., Wang C.S., Jin H., and Zhu J.K. (2009). An effector of RNA-directed DNA methylation in arabidopsis is an ARGONAUTE 4- and RNA-binding protein. Cell 137,498-508.  Hematy K. and Hofte H. (2008). Novel receptor kinases involved in growth regulation. Cuff. Opin. Plant Biol. 11, 32 1-328. Hoshi M., Ohta K., Gotoh V., Mon A., Murofushi H., Sakai H., and Nishida E. (1992). Mitogen-activated-protein-kinase-catalyzed phosphorylation of microtubule-associated proteins, microtubule-associated protein 2 and microtubule-associated protein 4, induces an alteration in their function. Eur. J. Biochem. 203, 43-52. Howard J. and Hymann A.A. (2003). Dynamics and mechanics of the microtubule plus end. Nature 422, 753-758.  Husebye H., Chadchawan S., Winge P., Thangstad O.P., and Bones A.M. (2002). Guard celland phloem idioblast-specific expression of thioglucoside glucohydrolase 1 (myrosinase) in Arabidopsis. Plant Physiol. 128, 1180-1188. Ikeda Y., Men S., Fischer U., Stepanova A.N., Alonso J.M., Ljung K., and Grebe M. (2009). Local auxin biosynthesis modulates gradient-directed planar polarity in Arabidopsis. Nat. Cell Biol. 11, 73 1-738. Illenberger S., Drewes G., Trinczek B., Biernat J., Meyer H.E., Olmsted J.B., Mandelkow E.M., and Mandelkow E. (1996). Phosphorylation of microtubule-associated proteins MAP2 and MAP4 by the protein kinase p11 Omark. Phosphorylation sites and regulation of microtubule dynamics. J. Biol. Chem. 271, 10834-10843.  145  Ishida T., Kaneko Y., Iwano M., and llashimoto T. (2007a). Helical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana. Proc. Nat!. Acad. Sci. U. S. A. 104, 8544-8549. Ishida T., Thitamadee S., and Hashimoto T. (2007b). Twisted growth and organization of cortical microtubules. J. Plant Res. 120, 6 1-70. Islam M.M., Tani C., Watanabe-Sugimoto M., Uraji M., Jahan M.S., Masuda C., Nakamura Y., Mon I.C., and Murata Y. (2009). Myrosinases, TGG1 and TGG2, redundantly function in ABA and MeJA signaling in Arabidopsis guard cells. Plant Cell Physiol. 50, 11711175.  Jammesa F., Songa C., Shina D., Munemasab S., Takedaa K., Gua D., Choa D., Leea S., Giordoa R., Sritubtimd S., Leonhardte N., Ellis B.E., Muratab Y., and Kwak J.M. (2009). MAP kinases IVIPK9 and MPK12 are preferentially expressed in guard cells and positively regulate ROS-mediated ABA signaling. Proc. Nat!. Acad. Sci. U. S. A. 106, 2052020525. Jin H., Axtell M.J., Dahibeck D., Ekwenna 0., Zhang S., Staskawicz B., and Baker B. (2002). NPK1, an MEKK1-like mitogen-activated protein kinase kinase kinase, regulates innate immunity and development in plants. Dev. Cell. 3, 291-297.  Joo S., Liu Y., Lueth A., and Zhang S. (2008). MAPK phosphorylation-induced stabilization of ACS6 protein is mediated by the non-catalytic C-terminal domain, which also contains the cis-determinant for rapid degradation by the 26S proteasome pathway. Plant J. 54, 129-140. Karisson M., Mandi M., and Keyse S.M. (2006). Spatio-temporal regulation of mitogen activated protein kinase (MAPK) signalling by protein phosphatases. Biochem. Soc. Trans. 34, 842-845. Kawamura E., Himmeispach R., Rashbrooke M.C., Whittington A.T., Gale K.R., Collings D.A., and Wasteneys G.0. (2006). MICROTUBULE ORGANIZATION 1 regulates structure and function of microtubule arrays during mitosis and cytokinesis in the Arabidopsis root. Plant Physiol. 140, 102-1 14. Kawamura E. and Wasteneys G.0. (2008). MOR1, the Arabidopsis thaliana homologue of Xenopus MAP2 15, promotes rapid growth and shrinkage, and suppresses the pausing of microtubules in vivo. J. Cell. Sci. 121, 4114-4123.  Kerk D., Bulgrien J., Smith D.W., Barsam B., Veretnik S., and Gribskov M. (2002). The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol. 129, 908-925. Keyse S.M. (2000). Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curt. Opin. Cell Biol. 12, 186-192. 146  Kieber J.J., Rothenberg M., Roman G., Feldmann K.A., and Ecker J.R. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72, 427-441. Kim J., Sim S., Yong T.S., and Park S.J. (2008). Interaction of BOP1, a protein for ribosome biogenesis, with EB1 in Giardia lamblia. Parasitol. Res. 103, 1459-1464. Kink V., Herrmann U., Parupalli C., Sedbrook J.C., Ehrhardt D.W., and Huiskamp M. (2007). CLASP localizes in two discrete patterns on cortical microtubules and is required for cell morphogenesis and cell division in Arabidopsis. J. Cell. Sci. 120, 44 16-4425. Konishi M. and Sugiyama M. (2003). Genetic analysis of adventitious root formation with a novel series of temperature-sensitive mutants of Arabidopsis thaliana. Development 130, 56375647. Koyama T., Nakaoka Y., Fujio Y., Hirota H., Nishida K., Sugiyama S., Okamoto K., Yamauchi-Takihara K., Yoshimura M., Mochizuki S., Hon M., Hirano T., and Mochizuki N. (2008). Interaction of scaffolding adaptor protein Gabl with tyrosine phosphatase SHP2 negatively regulates IGF-I-dependent myogenic differentiation via the ERK1/2 signaling pathway. J. Biol. Chem. 283, 24234-24244. Krysan P.J., Jester P.J., Gottwald J.R., and Sussman M.R. (2002). An Arabidopsis mitogen activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell 14, 1109-1120. Kumar S., Boehm J., and Lee J.C. (2003). p 38 IVIAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. 2, 717-726. Lahav M., Abu-Abied M., Belausov E., Schwartz A., and Sadot E. (2004). Microtubules of guard cells are light sensitive. Plant Cell Physiol. 45, 573-582. Lampard G.R. (2006). Analysis of Signalling from an Unusual MAPKK (AtMKK3) in Arabidopsis thaliana. Ph.D. Thesis, Department of Plant Science, University of British Columbia,Vancouver, BC. Lampard G.R., Macalister C.A., and Bergmann D.C. (2008). Arabidopsis stomatal initiation is controlled by MAPK-mediated regulation of the bHLH SPEECHLESS. Science 322, 11131116. Lee J.S. (2008). Role of phosphatases in controlling Arabidopsis MAPK Signalling cascades. Ph.D. Thesis, Department of Botany, University of British Columbia, Vancouver, BC. Lee J.S. and Ellis B.E. (2007). Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 IVIAPKs. J. Biol. Chem. 282, 25020-25029. 147  Lee J.S., Huh K.W., Bhargava A., and Ellis B.E. (2008). Comprehensive analysis of proteinprotein interactions between Arabidopsis MAPKs and IVIAPK kinases helps define potential MAPK signalling modules. Plant. Signal. Behav. 3, 1037-1041. Lee J.S., Wang S., Sritubtim S., Chen J.G., and Ellis B.E. (2009). Arabidopsis mitogen activated protein kinase MPK12 interacts with the MAPK phosphatase IBR5 and regulates auxin signaling. Plant J. 57, 975-985. Lee K., Song E.H., Kim H.S., Yoo J.H., Han H.J., Jung M.S., Lee S.M., Kim K.E., Kim M.C., Cho M.J., and Chung W.S. (2008). Regulation of MAPK phosphatase 1 (AtMKP1) by calmodulin in Arabidopsis. J. Biol. Chem. 283, 2358 1-23588.  Lehti-Shiu M.D., Zou C., Hanada K., and Shiu S.H. (2009). Evolutionary history and stress regulation of plant receptor-like kinase/pelle genes. Plant Physiol. 150, 12-26. Li H., Zeng X., Liu Z.Q., Meng Q.T., Yuan M., and Mao T.L. (2009). Arabidopsis microtubule-associated protein AtMAP65-2 acts as a microtubule stabilizer. Plant Mol. Biol. 69, 3 13-324. Liu H., Wang Y., Xu J., Su T., Liu G., and Ren D. (2008). Ethylene signaling is required for the acceleration of cell death induced by the activation of AtMEK5 in Arabidopsis. Cell Res. 18, 422-432. Liu Y. and Zhang 5. (2004). Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16, 3386-3399. Liu Y., Lagowski J., Sundholm A., Sundberg A., and Kulesz-Martin M. (2007). Microtubule disruption and tumor suppression by mitogen-activated protein kinase phosphatase 4. Cancer Res. 67, 10711-10719.  Lloyd C. and Chan J. (2004). Microtubules and the shape of plants to come. Nat. Rev. Mol. Cell Biol. 5, 13-22. Lloyd C. and Chan J. (2008). The parallel lives of microtubules and cellulose microfibrils. Cuff. Opin. Plant Biol. 11, 64 1-646. Lucas J.R., Nadeau J.A., and Sack F.D. (2006). Microtubule arrays and Arabidopsis stomatal development. J. Exp. Bot. 57, 7 1-79. Lukowitz W., Roeder A., Parmenter D., and Somerville C. (2004). A MAPKK kinase gene regulates extra-embryonic cell fate in Arabidopsis. Cell 116, 109-119.  148  Mackinnon A.C., Qadota H., Norman K.R., Moerman D.G., and Williams B.D. (2002). C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Cun. Biol. 12, 787-797.  Malamy J.E. and Benfey P.N. (1997). Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124, 33-44. Maleri S., Ge Q., Hackett E.A., Wang V., Dohlman H.G., and Errede B. (2004). Persistent activation by constitutive Ste7 promotes Kss 1-mediated invasive growth but fails to support Fus3-dependent mating in yeast. Mol. Cell. Biol. 24, 922 1-9238. Manavathi B., Acconcia F., Rayala SK., and Kumar R. (2006). An inherent role of microtubule network in the action of nuclear receptor. Proc. Natl. Acad. Sci. U. S. A. 103, 15981-15986. Mandelkow E.M., Biernat J., Drewes G., Gustke N., Trinczek B., and Mandelkow E. (1995). Tau domains, phosphorylation, and interactions with microtubules. Neurobiol. Aging 16, 355-62; discussion 362-3.  Mao T., Jin L., Li H., Liu B., and Yuan M. (2005). Two microtubule-associated proteins of the Arabidopsis MAP65 family function differently on microtubules. Plant Physiol. 138, 654-662. MAPK Group (2002). Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci. 7, 301-308.  Marcus A.I., Moore R.C., and Cyr R.J. (2001). The role of microtubules in guard cell function. Plant Physiol. 125, 3 87-395. Marouga R., David S., and Hawkins E. (2005). The development of the DIGE system: 2D fluorescence difference gel analysis technology. Anal. Bioanal Chem. 382, 669-678.  Mathieu 0., Yukawa V., Prieto J.L., Vaillant I., Sugiura M., and Tourmente S. (2003). Identification and characterization of transcription factor lilA and ribosomal protein L5 from Arabidopsis thaliana. Nucleic Acids Res. 31, 2424-2433. Mathur J., Mathur N., Kernebeck B., Srinivas B.P., and Hulskamp M. (2003). A novel localization pattern for an EB 1-like protein links microtubule dynamics to endomembrane organization. Curr. Biol. 13, 1991-1997. Menke F.L., van Pelt J.A., Pieterse C.M., and Klessig D.F. (2004). Silencing of the mitogen activated protein kinase MPK6 compromises disease resistance in Arabidopsis. Plant Cell 16, 897-907.  149  Meszaros T., Heifer A., Hatzimasoura E., Magyar Z., Serazetdinova L., Rios G., Bardoczy V., Teige M., Koncz C., Peck S., and Bogre L. (2006). The Arabidopsis MAP kinase kinase MKK1 participates in defence responses to the bacterial elicitor flagellin. Plant J. 48, 485-498. Mineyuki Y. (1999). The preprophase band of microtubules: its function as a cytokinetic apparatus in higher plants. Tnt Rev Cytol 187: 1—49.  Mitchisoñ T.J. (1993). Localization of an exchangeable GTP binding site at the plus end of microtubules. Science. 261, 1044-1047. Mitchison T.J. and Kirschner M. (1984). Dynamic instability of microtubule growth. Nature 312, 237-242. Mishra N.S., Tuteja R., and Tuteja N. (2006). Signaling through MAP kinase networks in plants. Arch. Biochem. Biophys. 452, 55-68. Monroe-Augustus M., Zoiman B.K., and Bartei B. (2003). IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15, 2979-299 1. Morishima-Kawashima M. and Kosik K.S. (1996). The pool of map kinase associated with microtubules is small but constitutively active. Mol. Biol. Cell 7, 893-905. Morrison D.K. and Davis R.J. (2003). Regulation of MAP kinase signaling modules by scaffold proteins in mammals. Annu. Rev. Cell Dev. Biol. 19, 91-118. Motose H., Tominaga R., Wada T., Sugiyama M., and Watanabe V. (2008). A NIMA-related protein kinase suppresses ectopic outgrowth of epidermal cells through its kinase activity and the association with microtubules. Plant J. 54, 829-844. Muller S., Fuchs E., Ovecka M., Wysocka-Diiier J., Benfey P.N., and Hauser M.T. (2002). Two new loci, PLEIADE and HYADE, implicate organ-specific regulation of cytokinesis in Arabidopsis. Plant Physiol. 130, 312-324. Muller S., Han S., and Smith L.G. (2006). Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana. Cuff. Biol. 16, 888-894.  Murata T., Sonobe S., Baskin T.I., Hyodo S., Hasezawa S., Nagata T., Horio T., and Hasebe M. (2005). Microtubule-dependent microtubule nucleation based on recruitmçnt of gamma tubulin in higher plants. Nat. Cell Biol. 7, 96 1-968. Nakagami H., Soukupova H., Schikora A., Zarsky V., and Hirt H. (2006). A Mitogen activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J. Biol. Chem. 281, 38697-38704. 150  Nakagawa T., Kurose T., Hino T., Tanaka K., Kawamukai M., Niwa Y., Toyooka K., Matsuoka K., Jinbo T., and Kimura T. (2007). Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosci. Bioeng. 104, 34-41.  Nakamura M., Naoi K., Shoji T., and Hashimoto T. (2004). Low concentrations of propyzamide and oryzalin alter microtubule dynamics in Arabidopsis epidermal cells. Plant Cell Physiol. 45, 1330-1334. Naoi K. and Hashimoto T. (2004). A semidominant mutation in an Arabidopsis mitogen activated protein kinase phosphatase-like gene compromises cortical microtubule organization. Plant Cell 16, 1841-1853. Nishihama R., Ishikawa M., Araki S., Soyano T., Asada T., and Machida V. (2001). The NPK1 mitogen-activated protein kinase kinase kinase is a regulator of cell-plate formation in plant cytokinesis. Genes Dev. 15, 352-363. Nyporko A.Y., Demchuk O.N., and Blume Y.B. (2003). Cold adaptation of plant microtubules: structural interpretation of primary sequence changes in a highly conserved region of alpha tubulin. Cell Biol. mt. 27, 241-243. O’Brien M., Gray-Mitsumune M., Kapfer C., Bertrand C., and Matton D.P. (2007). The ScFRK2 MAP kinase kinase kinase from Solanum chacoense affects pollen development and viability. Planta 225, 1221-1231. Owens D.M. and Keyse S.M. (2007). Differential regulation of MAP kinase signalling by dualspecificity protein phosphatases. Oncogene 26, 3203-3213. Ozer R.S. and Halpain S. (2000). Phosphorylation-dependent localization of microtubule associated protein MAP2c to the actin cytoskeleton. Mol. Biol. Cell 11, 3573-3587. Paredez A.R., Somerville C.R., and Ehrhardt D.W. (2006). Visualization of cellulose synthase demonstrates functional association with microtubules. Science 312, 1491-1495. Pastuglia M., Azimzadeh J., Goussot M., Camilleri C., Beicram K., Evrard J.L., Schmit A.C., Guerche P., and Bouchez D. (2006). Gamma-tubulin is essential for microtubule organization and development in Arabidopsis. Plant Cell 18, 14 12-1425. Pastuglia M. and Bouchez D. (2007). Molecular encounters at microtubule ends in the plant cell cortex. Cuff. Opin. Plant Biol. 10, 5 57-563. Perrin R.M., Wang Y., Yuen C.Y., Will J., and Masson P.R. (2007). WVD2 is a novel microtubule-associated protein in Arabidopsis thaliana. Plant J. 49, 961-971.  151  Petersen M., Brodersen P., Naested IL, Andreasson E., Lindhart U., Johansen B., Nielsen H.B., Lacy M., Austin M.J., Parker J.E., Sharma S.B., Kiessig D.F., Martienssen R., Mattsson 0., Jensen A.B., and Mundy J. (2000). Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103, 1111-1120. Popescu S.C., Popescu G.V., Bachan S., Zhang Z., Gerstein M., Snyder M., and Dinesh Kumar S.P. (2009). MAPK target networks in Arabidopsis thaliana revealed using functional protein microarrays. Genes Dev. 23, 80-92. Qiu J.L., Jilk R., Marks M.D., and Szymanski D.B. (2002). The Arabidopsis SPIKE 1 gene is required for normal cell shape control and tissue development. Plant Cell 14, 101-118. Qiu J.L., Fiil B.K., Petersen K., Nielsen H.B., Botanga C.J., Thorgrimsen S., Palma K., Suarez-Rodriguez M.C., Sandbech-Clausen S., Lichota J., Brodersen P., Grasser K.D., Mattsson 0., Glazebrook J., Mundy J., and Petersen M. (2008). Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus. EMBO J. 27, 22142221. Quettier A.L., Bertrand C., Habricot Y., Miginiac E., Agnes C., Jeannette E., and Maldiney R. (2006). The phs 1-3 mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in Arabidopsis thaliana. Plant J. 47, 711-719.  Ray L.B. and Sturgill T.W. (1987). Rapid stimulation by insulin of a serine/threonine kinase in 3T3-L1 adipocytes that phosphorylates microtubule-associated protein 2 in vitro. Proc. Natl. Acad. Sci. U. S. A. 84, 1502-1506. Reddy A.S. and Day I.S. (2001). Kinesins in the Arabidopsis genome: a comparative analysis among eukaryotes. BMC Genomics 2, 2. Ren D., Liu Y., Yang K.Y., Han L., Mao G., Glazebrook J., and Zhang 5. (2008). A fungal responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 105, 563 8-5643. Reszka A.A., Seger R., Diltz C.D., Krebs E.G., and Fischer E.H. (1995). Association of mitogen-activated protein kinase with the microtubule cytoskeleton. Proc. Natl. Acad. Sci. U. S. A. 92, 8881-8885. Richardson D.N., Simmons M.P., and Reddy A.S. (2006). Comprehensive comparative analysis of kinesins in photosynthetic eukaryotes. BMC Genomics 7, 18. Robert u.S., Quint A., Brand D., Vivian-Smith A., and Offringa R. (2008). BTB AND TAZ DOMAiN scaffold proteins perform a crucial function in Arabidopsis development. Plant J.58, 109-121.  152  Roberts R.L. and Fink G.R. (1994). Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8, 2974-2985.  Robertson A.M. and Hagan I.M. (2008). Stress-regulated kinase pathways in the recovery of tip growth and microtubule dynamics following osmotic stress in S. pombe. J. Cell. Sci. 121, 4055-4068. Rosales-Nieves A.E., Johndrow J.E., Keller L.C., Magic C.R., Pinto-Santini D.M., and Parkhurst S.M. (2006). Coordination of microtubule and microfilament dynamics by Drosophila Rhol, Spire and Cappuccino. Nat. Cell Biol. 8, 367-376. Sakai T., Honing H., Nishioka M., Uehara Y., Takahashi M., Fujisawa N., Saji K., Seki M., Shinozaki K., Jones M.A., Smirnoff N., Okada K., and Wasteneys G.O. (2008). Armadillo repeat-containing kinesins and a NIMA-related kinase are required for epidermal-cell morphogenesis in Arabidopsis. Plant J. 53, 157-171. Samuel M.A. and Ellis B.E. (2002). Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Cell 14, 2059-2069. Samuel M.A., Hall H., Krzymowska M., Drzewiecka K., Hennig J., and Ellis B.E. (2005). SIPK signaling controls multiple components of harpin-induced cell death in tobacco. Plant J. 42, 406-4 16. Sammak P. J. and Borisy G. G. (1988). Direct observation of microtubule dynamics in living cells. Nature 332, 724-726. Sasabe M., Soyano T., Takahashi Y., Sonobe S., Igarashi H., Itoh T.J., Ilidaka M., and Machida Y. (2006). Phosphorylation of NtMAP65-1 by a MAP kinase down-regulates its activity of microtubule bundling and stimulates progression of cytokinesis of tobacco cells. Genes Dev. 20, 1004-10 14. Sedbrook J.C., Ehrhardt D.W., Fisher S.E., Scheible W.R., and Somerville C.R. (2004). The Arabidopsis sku6/spirall gene encodes a plus end-localized microtubule-interacting protein involved in directional cell expansion. Plant Cell 16, 1506-1520. Sedbrook J.C. and Kaloriti D. (2008). Microtubules, MAPs and plant directional cell expansion. Trends Plant Sci. 13, 303-3 10. Shaw S.L., Kamyar R., and Ehrhardt D.W. (2003). Sustained microtubule treadmilling in Arabidopsis cortical arrays. Science 300, 1715-1718.  153  Shoji T., Suzuki K., Abe T., Kaneko V., Shi H., Zhu J.K., Rus A., Hasegawa P.M., and Hashimoto T. (2006). Salt stress affects cortical microtubule organization and helical growth in Arabidopsis. Plant Cell Physiol. 47, 1158-1168. Sivaguru M., Pike S., Gassmann W., and Baskin T.I. (2003). Aluminum rapidly depolymerizes cortical microtubules and depolarizes the plasma membrane: evidence that these responses are mediated by a glutamate receptor. Plant Cell Physiol. 44, 667-675. Smertenko A.P., Chang H.Y., Wagner V., Kaloriti D., Fenyk S., Sonobe S., Lloyd C., Hauser M.T., and Ilussey P.J. (2004). The Arabidopsis microtubule-associated protein AtMAP65-1: molecular analysis of its microtubule bundling activity. Plant Cell 16, 2035-2047. Smertenko A.P., Chang H.Y., Sonobe S., Fenyk S.I., Weingartner M., Bogre L., and Hussey P.J. (2006). Control of the AtMAP65-1 interaction with microtubules through the cell cycle. J. Cell. Sci. 119, 3227-3237. Smertenko A.P., Kaloriti D., Chang H.Y., Fiserova J., Opatrny Z., and Hussey P.J. (2008). The C-terminal variable region specifies the dynamic properties of Arabidopsis microtubule associated protein MAP65 isotypes. Plant Cell 20, 3346-3358. Smith L.G. and Oppenheimer D.G. (2005). Spatial control of cell expansion by the plant cytoskeleton. Annu. Rev. Cell Dev. Biol. 21, 271-295. Sparkes l.A., Runions J., Kearns A., and Hawes C. (2006). Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat. Protoc. 1, 2019-2025. Staiger C.J. (2000). Signaling to the Actin Cytoskeleton in Plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51, 257-288. Staiger C.J. and Blanchoin L. (2006). Actin dynamics: old friends with new stories. Cuff. Opin. Plant Biol. 9, 554-562. Stoppin-Mellet V., Gaillard J., and Vantard M. (2003). Plant katanin, a microtubule severing protein. Cell Biol. Tnt. 27, 279. Stoppin-Mellet V., Gaillard J., and Vantard M. (2006). Katanin’s severing activity favors bundling of cortical microtubules in plants. Plant J. 46, 1009-1017. Strader L.C., Monroe-Augustus M., and Bartel B. (2008). The IBR5 phosphatase promotes Arabidopsis auxin responses through a novel mechanism distinct from TIR1 -mediated repressor degradation. BMC Plant. Biol. 8, 41.  154  Strompen G., El Kasmi F., Richter S., Lukowitz W., Assaad F.F., Jurgens G., and Mayer U. (2002). The Arabidopsis H1NKEL gene encodes a kinesin-related protein involved in cytokinesis and is expressed in a cell cycle-dependent manner. Cuff. Biol. 12, 153-158. Suarez-Rodriguez M.C., Adams-Phillips L., Liu Y., Wang H., Su S.H., Jester P.J., Zhang S., Bent A.F., and Krysan P.J. (2007). MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. Plant Physiol. 143, 66 1-669.  Subbaramaiah K., Hart J.C., Norton L., and Dannenberg A.J. (2000). Microtubule interfering Agents Stimulate the Transcription of Cyclooxygenase-2. J. Biol Chem. 275, 1483845. Sugimoto K., Himmelspach R., Williamson R.E., and Wasteneys G.O. (2003). Mutation or drug-dependent microtubule disruption causes radial swelling without altering parallel cellulose microfibril deposition in Arabidopsis root cells. Plant Cell 15, 1414-1429. Sun S.C., Xiong B., Lu S.S., and Sun Q.Y. (2008). MEK1/2 is a critical regulator of microtubule assembly and spindle organization during rat oocyte meiotic maturation. Mol. Reprod. Dev. 75, 1542-1548.  Suprenant K.A., Dean K., McKee J., and Hake 5. (1993). EMAP, an echinoderm microtubule-associated protein found in microtubule-ribosome complexes. J. Cell. Sci. 104, 445450. Takahashi F., Yoshida R., Ichimura K., Mizoguchi T., Seo S., Yonezawa M., Maruyama K., Yamaguchi-Shinozaki K., and Shinozaki K. (2007). The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19, 805-8 18.  Takahashi Y., Soyano T., Sasabe M., and Machida V. (2004). A MAP kinase cascade that controls plant cytokinesis. J. Biochem. 136, 127-132. Tanaka H., Ishikawa M., Kitamura S., Takahashi Y., Soyano T., Machida C., and Machida Y. (2004). The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis. Genes Cells 9, 1199-1211. Terret M.E., Lefebvre C., Djiane A., Rassinier P., Moreau J., Maro B., and Verlhac M.H. (2003). DOC 1 R: a MAP kinase substrate that control microtubule organization of metaphase II mouse oocytes. Development 130, 5169-5 177.  Theodosiou A. and Ashworth A. (2002). MAP kinase phosphatases. Genome Biol. 3, REVIEWS3009.  155  Thitamadee S., Tuchihara K., and Hashimoto T. (2002). Microtubule basis for left-handed helical growth in Arabidopsis. Nature 417, 193-196. Twell D., Park S.K., Hawkins T.J., Schubert D., Schmidt R., Smertenko A., and Hussey P.J. (2002). MOR1/GEM1 has an essential role in the plant-specific cytokinetic phragmoplast. Nat. Cell Biol. 4, 711-714. Ullah H., Scappini E.L., Moon A.F., Williams L.V., Armstrong D.L., and Pedersen L.C. (2008). Structure of a signal transduction regulator, RACK 1, from Arabidopsis thaliana. Protein Sd. 17, 1771-1780. Ulm R., Revenkova E., di Sansebastiano G.P., Bechtold N., and Paszkowski J. (2001). Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev. 15, 699-709. UIm R., Ichimura K., Mizoguchi T., Peck S.C., Zhu T., Wang X., Shinozaki K., and Paszkowski J. (2002). Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J. 21, 6483-6493. Van Damme D., Van Poucke K., Boutant E., Ritzenthaler C., Inze D., and Geelen D. (2004). In vivo dynamics and differential microtubule-binding activities of MAP65 proteins. Plant Physiol. 136, 3956-3967. Vasquez R.J., Gard D.L., and Cassimeris L. (1999). Phosphorylation by CDK1 regulates XMAP215 function in vitro. Cell Motil. Cytoskeleton 43, 3 10-321.  Voinnet 0., Rivas S., Mestre P., and Baulcombe D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33, 949-956. Volkmann D. and Baluska F. (1999). Actin cytoskeleton in plants: from transport networks to signaling networks. Microsc. Res. Tech. 47, 135-154. Waetzig V. and Herdegen T. (2005). Context-specific inhibition of iNKs: overcoming the dilemma of protection and damage. Trends Pharmacol. Sci. 26, 455-461. Walker K.L., Muller S., Moss D., Ehrhardt D.W., and Smith L.G. (2007). Arabidopsis TANGLED identifies the division plane throughout mitosis and cytokinesis. Cuff. Biol. 17, 1827-1836. Walter M., Chaban C., Schutze K., Batistic 0., Weckermann K., Nake C., Blazevic D., Grefen C., Schumacher K., Oecking C., Harter K., and Kudla J. (2004). Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant J. 40, 428-438. 156  Wang C., Li J., and Yuan M. (2007a). Salt tolerance requires cortical microtubule reorganization in Arabidopsis. Plant Cell Physiol. 48, 1534-1547.  Wang H., Ngwenyama N., Liu V., Walker J.C., and Zhang S. (2007b). Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19, 63-73. Wang H., Ngwenyama N., Liu Y., Walker J.C., and Zhang S. (2007c). Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19, 63-73. Wang H., Liu Y., Bruffett K., Lee J., Bause G., Walker J.C., and Zhang S. (2008). Haplo insufficiency of MPK3 in MPK6 mutant background uncovers a novel function of these two MAPKs in Arabidopsis ovule development. Plant Cell 20, 602-6 13. Wasteneys GO. and Williamson R.E. (1989). Reassembly of Microtubules in Nitella Tasmanica Assembly of Cortical Microtubules in Branching Clusters and its Relevance to Steady-State Microtubule Assembly. J. Cell. Sci. 93, 705-714. -  Wasteneys G.O., Willingale-Theune J., and Menzel D. (1997). Freeze shattering: a simple and effective method for permeabilizing higher plant cell walls. J. Microsc. 188, 51-61. Wasteneys G.O. (2002). Microtubule organization in the green kingdom: chaos or self-order? J. Cell. Sci. 115, 1345-1354. Wasteneys G.O. (2003). Microtubules show their sensitive nature. Plant Cell Physiol. 44, 653654. Wasteneys G.O. and Gaiway M.E. (2003). Remodeling the cytoskeleton for growth and form: an overview with some new views. Annu. Rev. Plant. Biol. 54, 691-722. Wasteneys G.O. (2004). Progress in understanding the role of microtubules in plant cells. Cuff. Opin. Plant Biol. 7, 651-660. Wenzel C.L., Williamson R.E., and Wasteneys G.O. (2000). Gibberellin-induced changes in growth anisotropy precede gibberellin-dependent changes in cortical microtubule orientation in developing epidermal cells of barley leaves. Kinematic and cytological studies on a gibberellin responsive dwarf mutant, M489. Plant Physiol. 124, 8 13-822.  Whittington A.T., Vugrek 0., Wei K.J., Hasenbein N.G., Sugimoto K., Rashbrooke M.C., and Wasteneys G.0. (2001). MOR1 is essential for organizing cortical microtubules in plants. Nature 411, 610-613.  157  Wick S. and Duniec J. (1984). Immunofluorescence microscopy of tubulin and microtubule arrays in plant cells. II. Transition between the pre-prophase band and the mitotic spindle. Protoplasma. 122:45—55. Worrall D., Liang Y.K., Alvarez S., Holroyd G.H., Spiegel S., Panagopulos M., Gray J.E., and Hetherington A.M. (2008). Involvement of sphingosine kinase in plant cell signalling. Plant J. 56, 64-72.  Wymer C.L., Wymer S.A., Cosgrove D.J., and Cyr R.J. (1996). Plant cell growth responds to external forces and the response requires intact microtubules. Plant Physiol. 110, 425-430. Yaakov G., Duch A., Garcia-Rubio M., Clotet J., Jimenez J., Aguilera A., and Posas F. (2009). The Stress-activated Protein Kinase Hogl Mediates S-phase Delay in Response to Osmostress. Mol. Biol. Cell.15, 3572-3582. Yao M., Wakamatsu Y., Itoh T.J., Shoji T., and Hashimoto T. (2008). Arabidopsis SPRAL2 promotes uninterrupted microtubule growth by suppressing the pause state of microtubule dynamics. J. Cell. Sci. 121, 2372-238 1. Yasuda M., Ishikawa A., Jikumaru V., Seki M., Umezawa T., Asami T., Maruyama Nakashita A., Kudo T., Shinozaki K., Yoshida S., and Nakashita H. (2008). Antagonistic interaction between systemic acquired resistance and the abscisic acid-mediated abiotic stress response in Arabidopsis. Plant Cell 20, 1678-1692. Yemets A., Sheremet V., Vissenberg K., Van Orden J., Verbelen J.P., and Blume Y.B. (2008). Effects of tyrosine kinase and phosphatase inhibitors on microtubules in Arabidopsis root cells. Cell Biol. Int. 32, 630-637. Yoo J.H., Cheong M.S., Park C.Y., Moon B.C., Kim M.C., Kang V.11., Park H.C., Choi M.S., Lee J.IL, Jung W.V., Yoon H.W., Chung W.S., Lim C.O., Lee S.Y., and Cho M.J. (2004). Regulation of the dual specificity protein phosphatase, DsPTP1, through interactions with calmodulin. J. Biol. Chem. 279, 848-858.  Yoo S.D., Cho V.11., Tena G., Xiong V., and Sheen J. (2008). Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature 451, 789-795. Yu L.Z., Xiong B., Gao W.X., Wang C.M., Zhong Z.S., Huo L.J., Wang Q., Hou V., Liu K., Liu X.J., Schatten H., Chen D.Y., and Sun Q.Y. (2007). MEK1/2 regulates microtubule organization, spindle pole tethering and asymmetric division during mouse oocyte meiotic maturation. Cell. Cycle 6, 330-338. Yu R., Huang R.F., Wang X.C., and Yuan M. (2001). Microtubule dynamics are involved in stomatal movement of Vicia faba L. Protoplasma 216, 113-118.  158  Vu X., Li L., Li L., Guo M., Chory J., and Yin Y. (2008). Modulation of brassinosteroid regulated gene expression by Jumonji domain-containing proteins ELF6 and REF6 in Arabidopsis. Proc. Nat!. Acad. Sci. U. S. A. 105, 76 18-7623.  Zervas C.G., Gregory S.L., and Brown N.H. (2001). Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J. Cell Biol. 152, 1007-1018. Zhang X., Dai V., Xiong V., DeFraia C., Li J., Dong X., and Mou Z. (2007). Overexpression of Arabidopsis MAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance. Plant J. 52, 1066-1079. Zhang V., Blattman J.N., Kennedy N.J., Duong J., Nguyen T., Wang V., Davis R.J., Greenberg P.D., Flavell R.A., and Dong C. (2004). Regulation of innate and adaptive immune responses by MAP kinase phosphatase 5. Nature 430, 793-797. Zhang V. and Dong C. (2007). Regulatory mechanisms of mitogen-activated kinase signaling. Cell Mo!. Life Sci. 64, 277 1-2789. Zhao J.L., Li X.J., Zhang H., and Li V. (2003). Chilling stability of microtubules in root-tip cells of cucumber. Plant Cell Rep. 22, 32-37. Zhao V. and Chen R.H. (2006). Mpsl phosphorylation by MAP kinase is required for kinetochore localization of spindle-checkpoint proteins. Cuff. Biol. 16, 1764-1769. Zhao Z., Zhang W., Stanley B.A., and Assmann S.M. (2008). Functional proteomics of Arabidopsis thaliana guard cells uncovers new stomata! signaling pathways. Plant Cell 20, 32 103226. Ziegelbauer J., Shan B., Yager D., Larabell C., Hoffmann B., and Tjian R. (2001). Transcription factor MIZ- 1 is regulated via microtubule association. Mo!. Cell 8, 339-349. Ziegelbauer J., Wei J., and Tjian R. (2004). Myc-interacting protein 1 target gene profile: a link to microtubules, extracellular signal-regulated kinase, and cell growth. Proc. Natl. Acad. Sci. U. S. A. 101, 458-463.  159  APPENDIX. List of publications Parts of chapter 3 have been published. The reported Yeast two hybrid screening between PHS 1 and all the MPKs was initially performed by JinSuk Lee. Walia A, Lee JS, Wasteneys GO, Ellis BE (2009). Arabidopsis mitogen-activated protein kinase MPK18 mediates cortical microtubule functions in plant cells. Plant J. 59(4):565-75.  160  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0069307/manifest

Comment

Related Items