Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The Rap GTPases regulate B cell polarity and morphology by controlling the localization of Scribble and… Lei, Victor 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2010_spring_lei_victor.pdf [ 6.32MB ]
JSON: 24-1.0069111.json
JSON-LD: 24-1.0069111-ld.json
RDF/XML (Pretty): 24-1.0069111-rdf.xml
RDF/JSON: 24-1.0069111-rdf.json
Turtle: 24-1.0069111-turtle.txt
N-Triples: 24-1.0069111-rdf-ntriples.txt
Original Record: 24-1.0069111-source.json
Full Text

Full Text

THE RAP GTPASES REGULATE B CELL POLARITY AND MORPHOLOGY BY CONTROLLING THE LOCALIZATION OF SCRIBBLE AND THE ACTIVATION OF COFILIN  by  VICTOR LEI  B.Sc., The University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  January 2010  © Victor Lei, 2010  Abstract Naïve resting B cells circulate throughout the body and enter secondary lymphoid organs (SLOs) in response to chemical cues known as chemokines. Within SLOs, B cells scan for foreign antigens, and antigen-induced clustering of the B cell receptor (BCR) initiates B cell activation. This clustering is enhanced through the formation of an immune synapse between the B cell and antigen presenting cell, which greatly amplifies BCR signaling and B cell activation. We have previously shown that activation of the Rap GTPases is important for the cytoskeletal changes that underlie B cell spreading, migration, and immune synapse formation. We have also shown that stimulating Blymphocytes with a model particulate antigen, anti-BCR-coated polystyrene beads, causes cells to polarize and form actin-rich cups at sites of cell:bead contacts, and that the formation of these cups enhance B cell activation. Although a number of downstream targets of activated Rap (Rap-GTP) have been identified, the mechanisms by which RapGTP promotes cell polarization, actin polymerization, reorganization of the actin cytoskeleton, and changes in cell morphology are not completely understood. The establishment of cell polarity often involves complexes of evolutionarily conserved polarity proteins. One such polarity complex includes the Scribble protein. In this thesis, I show that Rap-GTP is important for generating an asymmetric distribution of Scribble when B cells encounter particulate antigens and form cups. The ability of leukocytes to assume a polarized morphology also requires that the cortical F-actin cytoskeleton be disassembled so that new F-actin filaments that contribute to the formation of a leading edge, F-actin-rich cup, or immune synapse can be assembled. Since cofilin plays a major  ii  role in severing and depolymerizing F-actin filaments, I tested the hypothesis that the Rap GTPases regulate changes in cell shape by controlling the activation of cofilin, a process that requires its dephosphorylation by the Slingshot phosphatase. I show that BCR clustering leads to cofilin dephosphorylation, and hence activation, which is dependent on activation of the Rap GTPases. This suggests that an early step underlying BCRinduced changes in B cell morphology that involve reorganization of the actin cytoskeleton is the Rap-dependent activation of the actin-severing protein cofilin.  iii  Table of contents Abstract .........................................................................................................ii
 Table of contents.......................................................................................... iv
 List of tables ...............................................................................................viii
 List of figures ............................................................................................... ix
 List of abbreviations.................................................................................... xi
 Acknowledgments...................................................................................... xiv
 Dedication.................................................................................................... xv
 1. Introduction .............................................................................................. 1
 1.1. The immune system ................................................................................................. 1
 1.2. Innate and adaptive immunity.................................................................................. 1
 1.3. B cells in immunity.................................................................................................. 3
 1.3.1. B cells secrete protective antibodies................................................................. 3
 1.3.2. B cell development ............................................................................................ 3
 1.3.3. Assembly of the B cell receptor......................................................................... 4
 1.4. Chemoattractants and B cell migration.................................................................... 6
 1.4.1. B cell homing to secondary lymphoid organs................................................... 6
 1.4.2. Chemoattractant receptor signaling ................................................................. 9
 1.4.3. The role of the Rho and Ras families of GTPases in chemotaxis ................... 12
 1.5. B cell receptor signaling ........................................................................................ 14
 1.5.1 BCR signaling pathways .................................................................................. 14
 1.5.2. BCR microclusters are important for signaling.............................................. 16
 1.6. Antigen encounter by B cells................................................................................. 17
  iv  1.6.1. B cells encounter different forms of antigens ................................................. 17
 1.6.2. Soluble antigens .............................................................................................. 17
 1.6.3. Particulate antigens ........................................................................................ 17
 1.6.4. Membrane-bound antigens ............................................................................. 21
 1.7. The role of the Rap GTPases in B cell activation.................................................. 22
 1.7.1. The Rap GTPases............................................................................................ 22
 1.7.2. RapGEFs......................................................................................................... 24
 1.7.3. RapGAPs......................................................................................................... 25
 1.7.4. Rap effectors ................................................................................................... 26
 1.8. The role of Rap in immune functions .................................................................... 29
 1.8.1. Integrin-mediated cell adhesion ..................................................................... 29
 1.8.2. The role of Rap in cell polarity and migration ............................................... 32
 1.8.3. Rap in B cell spreading and immune synapse formation................................ 34
 1.9. Lymphocyte polarity.............................................................................................. 35
 1.9.1. Polarity in epithelial cells............................................................................... 35
 1.9.2 The Par complex .............................................................................................. 35
 1.9.3 The Crb complex .............................................................................................. 37
 1.9.4. The Scribble complex...................................................................................... 38
 1.9.5. Interactions between polarity complexes........................................................ 38
 1.9.6. Polarity complexes in lymphocytes................................................................. 39
 1.10. B cell cytoskeletal changes .................................................................................. 40
 1.10.1. B cells must change morphology to function ................................................ 40
 1.11 Cofilin ................................................................................................................... 41
 1.11.1 Cofilin overview ............................................................................................. 41
 1.11.2. Regulation of cofilin activity......................................................................... 41
  v  1.11.3. Slingshot activates cofilin ............................................................................. 43
 1.11.4. The role of cofilin in cell migration .............................................................. 44
 1.12. Hypothesis............................................................................................................ 46
  2. Materials and Methods .......................................................................... 47
 2.1 Cell culture.............................................................................................................. 47
 2.2. RT-PCR ................................................................................................................. 47
 2.3. Immunoblot analysis of polarity protein expression.............................................. 49
 2.4. Chemoattractants and inhibitors ............................................................................ 49
 2.5. Antibody-coated beads and antibody-coated plates............................................... 50
 2.6. Cell stimulation for immunoblotting analysis........................................................ 50
 2.7. Cofilin and LIMK phosphorylation ....................................................................... 51
 2.8. Confocal microscopy ............................................................................................. 51
 2.9. Statistics ................................................................................................................. 52
  3. Results...................................................................................................... 53
 3.1. Polarity proteins in B cells..................................................................................... 53
 3.1.1 All three members of the Scribble/Dlg/Lgl complex are expressed in primary B cells and in B cell lines ............................................................................................. 53
 3.1.2. Changes in the subcellular localization of Scrib1 upon the binding of particulate antigens by B cells.................................................................................. 57
 3.1.3. Anti-Ig-induced Scrib1 relocalization depends on Rap activation ................. 57
 3.2. Cofilin activation in B cells ................................................................................... 61
 3.2.1. Cofilin is phosphorylated upon chemokine stimulation in B and T cells........ 61
 3.2.2. Rap activation is not required for in chemokine-induced cofilin phosphorylation ........................................................................................................ 64
 3.2.3. BCR and TCR signaling promote the dephosphorylation of cofilin ............... 66
 3.2.4. Global decrease in P-cofilin following BCR stimulation ............................... 69
  vi  3.2.5. Cofilin dephosphorylation following antigen-receptor stimulation is dependent on Rap activation but does not involve changes in LIMK activity .......... 71
 3.2.6. Integrin signaling does not alter cofilin phosphorylation .............................. 74
 3.2.7. Actin polymerization is necessary and sufficient for cofilin phosphorylation 77
 3.2.8. Antigen receptor signaling overrides chemokine-induced cofilin phosphorylation ........................................................................................................ 79
  4. Discussion ................................................................................................ 82
 4.1. Rap activation regulates the localization of the Scribble, a member of an evolutionarily-conserved polarity complex .................................................................. 82
 4.2. BCR-induced cofilin activation is dependent on Rap activation ........................... 88
 4.3. Chemokine receptor signaling increases cofilin phosphorylation in a Rapindependent manner ...................................................................................................... 92
  References.................................................................................................... 97
  vii  List of tables Table 2.1: Polarity protein PCR primers ...................................................... 48
  viii  List of figures Figure 1.1. B cell receptor structure and proximal signaling. ........................ 5 Figure 1.2. B cell maturation in the lymph nodes .......................................... 7 Figure 1.3. G-protein-coupled chemokine receptor signaling ...................... 10 Figure 1.4. F-actin organization and localization of polarity determinants in migrating cells .............................................................................................. 13 Figure 1.5. B cells encounter antigens in several forms in secondary lymphoid organs ........................................................................................... 18
 Figure 1.6. B cells respond differently to surface-bound and particulate antigens......................................................................................................... 20
 Figure 1.7. The Rap signaling pathway in B cells........................................ 27
 Figure 1.8. Interactions between polarity complexes ................................... 36
 Figure 1.9. Cofilin function .......................................................................... 42
 Figure 1.10. Regulation of cofilin activity ................................................... 45
 Figure 3.1. Splenic B cells and B cell lines express all three members of the Scribble/Lgl/Dlg complex ............................................................................ 55
 Figure 3.2. Splenic B cells and B cell lines express all three members of the Scribble/Lgl/Dlg complex ............................................................................ 56
 Figure 3.3. Scrib1 localizes to the cell:bead interface early during conjugation, then later to the back of the cell.............................................. 58
 Figure 3.4. Scrib1 localization during cell:bead interactions is dependent on Rap activation ............................................................................................... 60
 Figure 3.5. Cofilin is phosphorylated upon CXCL12 stimulation in splenic B cells, splenic T cells and the Jurkat T cell line ............................................. 63
  ix  Figure 3.6. Cofilin is phosphorylated upton CXCL12 stimulation in the A20 B cell line and this is not dependent on Rap activation................................ 65
 Figure 3.7. Cofilin is dephosphorylated upon antigen receptor stimulation in splenic B cells and Jurkat T cells.................................................................. 68
 Figure 3.8. Global decrease in phospho-cofilin in B cells encountering antiIg coated beads ............................................................................................. 70
 Figure 3.9. Cofilin is dephosphorylated in cells stimulated through the BCR, and this is dependent on Rap activation ....................................................... 72
 Figure 3.10. The global decrease in B cell phospho-cofilin following anti-Igcoated bead stimulation is dependent on Rap activation .............................. 73
 Figure 3.11. Cofilin is dephosphorylated in cells stimulated through the TCR and CD28, and this is dependent on Rap activation ..................................... 75
 Figure 3.12. Integrin activation does not affect cofilin phosphorylation ..... 76
 Figure 3.13. Actin polymerization is necessary and sufficient for cofilin activation in A20 cells .................................................................................. 78
 Figure 3.14. Antigen receptor stimulation overrides chemokine-induced cofilin phosphorylation................................................................................. 80
 Figure 4.1. Proposed pathway linking BCR signaling to cofilin activation . 91
  x  List of abbreviations Actin depolymerizing factor  ADF  Antigen presenting cell  APC  Atypical protin kinase C  aPKC  B cell receptor  BCR  Central supramolecular activation complex  cSMAC  Crk-associated substrate  CAS  Diacylglycerol  DAG  Discs large  Dlg  Enhanced chemoluminescence  ECL  Extracellular matrix  ECM  Ezrin-radixin-moesin  ERM  Focal adhesion kinase  FAK  Follicular dendritic cell  FDC  GTPase activating proteins  GAP  Guanine-nucleotide exchange factor  GEF  High endothelial venule  HEV  Horseradish peroxidase  HRP  Immunoglobulin  Ig  Intracellular adhesion molecule  ICAM  Immunoreceptor tyrosine acvivation motif  ITAM  Inositol-3,4,5-trisphosphate  IP3  Interleukin  IL  Lethal giant larvae  Lgl  xi  LIM kinase  LIMK  Lipopolysaccharide  LPS  Lymphocyte function-associated antigen-1  LFA-1  Leukocyte Adhesion Deficiency III  LAD-III  Major histocompatibility complex  MHC  Microtubule organizing centre  MTOC  Marginal zone  MZ  Myotonic dystrophy kinase-related Cdc42-binding kinase α  MRCKα  Multi-PDZ domain protein 1  Mupp1  Natural killer  NK  p21-activated kinase  PAK  Pattern recognition receptor  PRR  Pathogen-associated molecular pattern  PAMPs  Peripheral supramolecular activation complex  pSMAC  Phorbol 12-myristate 13-acetate  PMA  Phospholipase C  PLC  Phosphoinosotide-4,5-bisphosphate  PIP2  Phosphoinosotide-3,4,5-trisphosphate  PIP3  Phosphotidylinosotide-3-kinase  PI3K  Polymerase chain reaction  PCR  RhoA-activated kinase  ROCK  Secondary lymphoid organ  SLO  Slingshot  SSH  Sphingosine-1-phosphate  S1P  Toll-like receptor  TLR  xii  Terminal deoxynucleotidyl transferase  TdT  Total internal reflection fluorescence microscopy  TIRFM  T cell receptor  TCR  Testicular kinase  TESK  Vesicular stomatitis virus  VSV  Vasodilator-stimulated phosphoprotein  VASP  Zonula-occludens 3  ZO-3  xiii  Acknowledgments I would like to thank all of the wonderful people that have helped me throughout my educational years, without whom these results would not be reproducible. Firstly, I want to thank my supervisor Dr. Michael R. Gold for his guidance and unwavering support. I never asked for what the R. stood, but if I were to hazard a guess, it would be “receptive,” “responsive,” or “radical.” I am very grateful to have had the opportunity to work with great labmates, such as (in alphabetical order): Kathrin Brenker, Kate Choi, Sonja Christian, Dr. Caylib Durand, Caren Jang, Dr. Kevin Lin, Steve Machtaler, Zinaida Tebaykina, and Kathy Tse, who made strolling into the lab every day a real treat. Special thanks to the multi-talented Spencer Freeman for his enthusiasm and scientific insight, and May Dang-Lawson for her knowledge and ingenuity. I would also like to thank all of our work study and directed studies students and volunteers (Alex, Crystal, Denny, Frank, Jeff, John, STX, et al.) for their tireless labour and numerous instances of unintended comedic relief. Of course, I owe enormous gratitude to my parents, who have always supported (or at least tolerated) everything I wanted to do in life. I thank them for providing me chronological, financial, and psychological support and, most importantly, a fully functioning lineup of small GTPases. I want to thank my brother Allen Lei, and my very good friends Stanley Cheong, Wilson Ho, Allan “Faith” Jarata, Angela Lai, Lisa Tom, Andy “The Head” Tse, and Ricco “Nature Boy” Yeung for their encouragement, unrealistic expectations of me, and for more than balancing out work with good times. Finally, good reader, I would like to thank you for taking the time to browse my thesis, at least up to this page. I hope you enjoy reading it as much as I enjoyed doing it.  xiv  Dedication I have been incredibly fortunate to not yet have lost anyone important to me. Therefore, I dedicate this thesis to past, current, and future graduate students. Remember always that no matter how bleak things may seem - even Victor Lei managed to finish. You can do it!  xv  1. Introduction 1.1. The immune system Humans are exposed to potential pathogens every moment of their lives. These microbial invaders, of which there are an estimated 100 million species (1), include bacteria, viruses, fungi, and parasites. However, despite this seemingly hostile environment, most humans manage to spend the majority of their days free from disease. Fortunately, we possess an evolutionarily-conserved and tightly regulated immune system that prevents infection and eliminates pathogens (2). Once epithelial barriers, such as the skin, esophageal lining, gut and respiratory tract epithelia are breached, the immune system begins to battle the infection and prevent disease. (3).  1.2. Innate and adaptive immunity The immune system can be divided into two overlapping branches, innate and adaptive immunity. For the most part, the innate immune system is capable of clearing infections before they become problematic. A feature of some innate immune cells, such as macrophages and neutrophils, is their ability to phagocytose foreign microbes such as bacteria (4, 5). Virus-infected cells are dealt with by natural killer (NK) cells, which recognize changes in cell surface molecules that occur following infection (6). Innate immune cells make the distinction between self and non-self through Toll-like receptors (TLRs) and other pattern recognition receptors (PRRs) (7). Originally identified due to their sequence homology with the Drosophila melanogaster Toll receptor (8), TLRs are a family of transmembrane proteins that recognize broadly shared, conserved components  1  of microbes, also known as pathogen-associated molecular patterns (PAMPs). Collectively, receptors that recognize common microbial structures are classified as PRRs (9). Examples of PAMPs include bacterial lipopolysaccharide (LPS) (recognized by TLR4), viral RNA (TLR3), bacterial DNA (TLR9), and flagellin (TLR5) (10-14). At the same time, cells of the innate immune system such as macrophages and dendritic cells can capture foreign antigens and present them to cells of the adaptive immune system, activating them and promoting the differentiation of memory cells that fight future infections. These cells are known collectively as antigen presenting cells (APCs) (15-17). In this way, innate immunity helps pave the way for adaptive immune responses. For infections that overwhelm the innate immune system, the adaptive immune response becomes critical. The two main subsets of cells involved in adaptive immunity are T cells and B cells. Together they are also commonly referred to as lymphocytes (18). These cells are named after the organs in which they were first found to develop, the thymus for T cells and the bursa of Fabricius in birds for B cells (18). In mammals, however, B cells initiate their development in the bone marrow. Mature lymphocytes circulate between lymph nodes and the spleen, where they scan for antigens presented by APCs (19). A key feature distinguishing lymphocytes from cells of the innate immune system is antigen-specific receptors. Unlike innate immune cells, which possess common receptors for frequently-expressed microbial components, lymphocytes are clonal, in that each cell specifically recognizes a single unique epitope via a clonally-restricted antigen receptor (20). This diversity in antigen recognition specificity is achieved through a process known as V(D)J recombination during development, which will be described later.  2  1.3. B cells in immunity 1.3.1. B cells secrete protective antibodies B cells are best known for their role in producing protective antibodies that form the basis of the humoral immune response. Antibodies are effective at fighting infections in several ways. First, they can bind to the surfaces of microbes such as bacteria and viruses, thereby inhibiting them from binding to cells in the body and thereby preventing colonization, invasion, and infection (21-23). Similarly, antibodies can also bind to toxins and neutralize their effects (24, 25). Second, phagocytic cells such as macrophages possess receptors that bind to the constant regions of antibodies, (FcRs), and these receptors facilitate efficient antigen capture and engulfment (26). Some bacteria possess complex polysaccharide coats and are not readily phagocytosed unless bound by antibodies (27, 28). Finally, antibodies attached to the surface of bacteria serve as docking sites for complement proteins (29). This event initiates the complement cascade, whereby a protein complex assembles on the surface of the bacteria, forming a transmembrane channel that results in osmotic lysis of the bacterial cell (30). 1.3.2. B cell development In adult vertebrates, B cells develop in the bone marrow. After passing through a series of checkpoints to ensure that immature B cells are not self-reactive (31, 32), cells exit the bone marrow and migrate to the spleen where they complete their development into mature B cells (33, 34). The key steps in B cell development are described in the next sections.  3  1.3.3. Assembly of the B cell receptor The B cell receptor (BCR) is comprised of two identical immunoglobulin (Ig) heavy (H) chains and two identical Ig light (IgL) chains, in conjunction with the Ig-α/β signaling subunit (35) (Figure 1.1). As a population, BCRs exhibit specificity for an enormous range of antigens, and this diversity of receptor specificity is achieved through a process known as V(D)J recombination. The generation of BCR variable regions (the regions involved in antigen binding) depends on random recombination of Ig variable (V), diversity (D), and joining (J) gene segments in the IgH gene locus, and the V and J gene segments in the IgL genes loci (36-39). Further diversity in this binding region is accomplished through the action of terminal deoxynucleotidyl transferase (TdT), an enzyme that inserts a random number of nucleotides between V, D, and J segments (40), as well as exonucleases that remove nucleotides between junctions (41-43). B cells that have successfully assembled a complete BCR, consisting of a membrane-bound Ig molecule associated with the Igα/β signaling subunit, are exported from the bone marrow after undergoing a negative selection process. Immature B cells with receptors that recognize self-antigens are potentially autoreactive. To avoid autoimmune responses that could be initiated by the activation of such cells, self-reactive B cells are eliminated by apoptosis (clonal deletion), inactivation (anergy), or additional rounds of V(D)J rearrangement (receptor editing) (4446).  4  Figure 1.1. B cell receptor structure and proximal signaling The B cell receptor (BCR) consists of two identical Ig heavy and light chains as well as a transmembrane Igα/β signaling subunit. At the distal ends of the receptor are two identical antigen binding sites, which are unique for any particular B cell. Binding of antigen to the BCR initiates phosphorylation of tyrosines at sequences called immunoreceptor tyrosine acvivation motifs (ITAMs) on the Igα and Igβ subunits. This event promotes the recruitment of Src family kinases such as Lyn, and other tyrosine kinases such as Syk, which possess SH2 domains for binding to phosphorylated ITAMs. This, in turn, leads to downstream signaling events important for B cell survival, proliferation, spreading, adhesion, and migration.  5  1.4. Chemoattractants and B cell migration 1.4.1. B cell homing to secondary lymphoid organs Antigens are concentrated in secondary lymphoid organs (SLOs) such as the lymph nodes and spleen either by being captured from the blood or lymph, or by active transport by dendritic cells that home from the periphery to SLOs. This is critical for adaptive immunity (47, 48) as B and T cells circulate continuously between SLOs in order to scan for their specific antigens (49). The lymph nodes collect antigens from the lymph while blood-borne antigens pass through the spleen (50, 51). Within SLOs, follicular dendritic cells (FDCs) present intact antigen to B cells while bone marrow-derived dendritic cells present antigenic peptides on major histocompatibility complex (MHC) molecules to T cells. Lymphocytes enter the lymph nodes through structures called high endothelial venules (HEVs) (Figure 1.2). This requires sequential steps of selectin-mediated rolling, integrinmediated adhesion, and extravasation between endothelial cells of the HEV into the lymphoid tissue (19, 52). Lymphocytes are directed to SLOs by chemical cues, or chemokines. Chemokines comprise a family of about 40 proteins which are detected through G-protein coupled surface receptors (53, 54). B cells recognize the homeostatic chemokines CCL19, CCL21, and CXCL12 (also known as stromal cell-derived factor 1 or SDF-1), which are presented on the surface of HEVs. Detection of these chemokines by their receptors, CCR7 for CCL19/CCL21, and CXCR4 for CXCL12 (55) results in the activation of integrins such as lymphocyte  6  Figure 1.2. B cell maturation in the lymph nodes (A) B cells are directed to the lymph nodes by chemokines produced by endothelial cells lining HEVs. Sequential steps of selectin-mediated rolling, followed by integrin-mediated adhesion and finally extravasation between/through cells allows B cells to enter SLOs. (B) Following entry into the SLO through HEVs (1), B cells travel through the T cell zone and are directed into the B cell follicles by the chemokine CXCL13, where they scan FDCs for antigen (2). Upon antigen recognition, B cells either become antibody-producing cells (2) or form germinal centers where they proliferate and undergo the process of affinity maturation in order to enhance antibody specificity for their cognate antigen. After this process, B cells either become plasmablasts that egress from the SLO (4) and migrate to the bone marrow and produce high-affinity antibodies for long periods of time (5), or memory B cells that will serve to fight similar infections in the future.  7  function-associated antigen-1 (LFA-1), which bind to intracellular adhesion molecule (ICAM)1 and ICAM2 on the endothelial cells that line the HEV (56, 57). These strong integrin-ligand interactions arrest B cells, facilitating their transmigration between or through the endothelial cells, and into the lymphoid tissue. Prior to this, other adhesion molecules called selectins (specifically L-selectin) expressed on B cells bind to glycosylated ligands on HEVs, reducing B cell speed such that they begin “rolling” along the endothelial lining, allowing integrin-mediated adhesion to take place (56-58). Once within the SLO, B cells migrate and congregate in the lymphoid follicles, zones that are packed with FDCs that can present antigen to B cells. This homing to lymphoid follicles requires the sensing of CXCL13 (also known as B lymphocyte chemoattractant or BLC) through the CXCR5 receptor (59, 60). CXCL13 is produced mainly by stromal cells and FDCs within the follicles (59-62). Following activation by antigen, B cells that become antibody-producing plasmablasts downregulate their CXCR5 receptors and increase their expression of CXCR4 (63-65). CXCR4 detects CXCL12 in the medulla of lymph nodes and the red pulp of the spleen, which are the sites of immediate, but short-lived antibody secretion by plasmablasts (66). During secondary immune responses, the differentiation of activated B cells into longlived plasma cells and memory B cells occurs within the lymphoid follicles, where massive B cell proliferation creates what is called a germinal center. The formation of germinal centers also depends on CXCL13. Mice deficient in CXCL13 or its receptor, CXCR5, form germinal centers that are much smaller than normal and these germinal centers are mislocalized to the T cell zone (67). Germinal centers consist of two regions, a dark zone and a light zone. The dark zone is the site for rapid 8  lymphocyte proliferation and somatic hypermutation (the process of making point mutations in the variable regions of the Ig V region gene segments in order to refine binding specificity for their respective antigen) while the light zone is the site where antigens presented on FDCs are scanned by B cells that have undergone somatic hypermutation (68), a mechanism for selecting the B cells with the highest affinity BCR for the antigen. CXCL12 is more abundant in the dark zone while CXCL13 is expressed more in the light zone (69) and B cells have recently been shown through real-time intravital imaging to cycle back and forth between these two zones (70-72) due to reciprocal downregulation and upregulation of CXCR4 (69). Once high affinity B cells that are generated by somatic hypermutation bind antigens presented on the FDCs, they differentiate into long-lived antibody-producing plasma cells and are directed by CXCL12 to the bone marrow, where they can survive and secrete antibodies for long periods of time (66, 73). 1.4.2. Chemoattractant receptor signaling In order to migrate from the bone marrow to secondary lymphoid organs, and between different lymphoid organs, B cells must receive cues from chemoattractant gradients and migrate accordingly. The detection of chemoattractants is achieved through heterotrimeric G protein-coupled receptors (Figure 1.3) (74). Heterotrimeric G-proteins consist of three subunits, Gα, Gβ, and Gγ (75, 76). Gβ and Gγ are always associated with each other, whereas Gα can exist on its own or in a trimeric complex with Gβ and Gγ. Gα’s activity is determined by binding to either GDP or GTP. When bound to GDP, Gα is inactive, whereas it is activated following GTP binding. Upon chemokine binding, the Gprotein coupled chemokine receptor acts as a guanine exchange factor for Gα, promoting  9  Figure 1.3. G-protein-coupled chemokine receptor signaling Signaling through the G-protein-coupled chemokine receptor activates a number of signaling pathways, including the phosphotidylinosotide-3-kinase (PI3K) and phospholipase C (PLC) pathways. GTPases such as Ras, Rap, and Rho are also activated upon chemokine receptor signaling. These results ultimately lead to the expression of genes and the activation of proteins that promote cell survival, proliferation, adhesion, spreading, and migration.  10  the exchange of GDP for GTP. When bound to GTP, Gα undergoes a conformational change, allowing Gα and Gβ/γ to separate and interact with different downstream signaling effectors (77). Of the G proteins, Gi appears to be the most important for lymphocyte migration as pertussis toxin, which blocks the exchange of GDP for GTP on Giα, inhibits chemokineinduced integrin activation and the entry of B and T cells into lymph nodes (78-80). GiαGTP also promotes chemotaxis by inactivating the adenylate cyclases. This reduces levels of cAMP in the cell, which inhibit chemotaxis (76, 81). The Gβγ subunit activates phospholipase C (PLC)-β (82). PLC-β generates the second messengers inositol-3,4,5-trisphosphate (IP3) and diacylglycerol (DAG) by cleaving phosphoinosotide-4,5-bisphosphate (PIP2) in the cell membrane. IP3 stimulates the release of Ca2+ from intracellular stores, a hallmark of chemokine receptor signaling. Another target of Gβγ is the γ isoform of phosphoinosotide-3-kinase (PI3K) (83, 84), which contains the p110γ catalytic subunit of this enzyme. p110γ is important for neutrophil, T cell, and macrophage migration, but does not appear to be involved in B cell migration (85, 86). Instead, PI3K enzymes containing the p110δ subunit are most important for B cell migration (86, 87). PI3K is responsible for generating phosphoinosotide-3,4,5-trisphosphate (PIP3) from PIP2, and an intracellular gradient of PIP3 is important establishing an asymmetric intracellular gradient of activated small GTPases that are involved in establishing polarity and cell motility.  11  1.4.3. The role of the Rho and Ras families of GTPases in chemotaxis The Rho family of GTPases (Rho, Rac, and Cdc42), which regulate cell polarization and migration, are activated following chemokine stimulation in lymphocytes (88-91). In adherent cells, Rac is important for the formation of lamellipodia, Cdc42 is important for producing filopodia, and Rho is involved in actin stress fiber formation and contraction (92, 93). Overexpression of activated forms any of these molecules results in loss of polarity and poor chemotaxis towards CXCL12, whereas dominant negative variants result in cells exhibiting a constitutively round morphology (94). For the most part, Rac and Cdc42 are localized to protrusions at the front of the cell while Rho is present at the sides and back of migrating cells (95) (Figure 1.4). Rac and Cdc42 are important for the activation of WASP and WAVE, respectively. This leads to the formation of the WASP/WAVE complex, which activates Arp2/3 and thereby promotes the formation of new branched actin filaments (96, 97). Mice deficient in Rac2 exhibit reduced B cell migration towards the chemokines CXCL12 and CXCL13 (88). Similarly, loss of the RacGEF, DOCK2, also impairs B and T lymphocyte migration towards CXCL12 (91). Furthermore, neutrophils in which Cdc42 activity is blocked are unable to form a persistent leading edge and cannot migrate (93). CXCL12 signaling also activates RhoA in leukocytes (90). RhoA effectors include ROCK (p160 Rho-coiled coiled kinase), which is involved in myosin phosphorylation and stress fiber contraction (98), and mDia, which promotes the assembly of linear filamentous actin (F-actin) filaments. RhoA signaling is crucial for cell motility (90, 99). Activation of RhoA in T cells results in actin stress fiber formation at the rear of the cell,  12  Figure 1.4. F-actin organization and localization of polarity determinants in migrating cells (A) The leading edge protrusions of a cell are generated by the polymerization of new branched actin filaments, through activation of the Arp2/3 complex by Rac and Cdc42 via WASP/WAVE. Myosin binds to linear actin filaments at the midbody and rear of the cell and are responsible for contraction and the retrograde flow of existing F-actin filaments that propel the cell forward during migration. (B) Rac and Cdc42 are localized to the leading edge of a migrating cell and are important for the formation of forward cell protrusions. The Rap1 GTPase is also found at the leading edge associated with the Par3 polarity protein, and is crucial for Rac and Cdc42 activation. The polarity proteins Crumbs, Lgl and Par6 are found at the midbody and their interactions help maintain cell polarization. Scribble and Dlg are found at the rear of polarized cells and are important for the activation of RhoA, which is critical for formation of the uropod and contraction at the rear of the cell. Adapted from Krummel and Macara (100)).  13  and contraction of these fibers through RhoA-mediated myosin-IIA activation pushes the cell forward during ameboid-like movement (101). Our lab has focused on the small Rasfamily GTPase Rap1, which has been implicated in B and T cell migration. Following CXCL12 treatment in both B and T cells, Rap1 becomes activated (102, 103). Blocking Rap1 activation impairs the ability of B cells to migrate towards the chemokines CXCL12 and CXCL13, as well as the lipid chemoattractant sphingosine-1-phosphate (S1P) (102, 104). Moreover, disrupting the gene encoding the Rap effector RapL (regulator of adhesion and cell polarization enriched in lymphoid tissues) results in impaired B and T cell adhesion and impaired lymphocyte homing to secondary lymphoid organs in mice (105). Rap1 also regulates the actin cytoskeleton and cell motility, which is described in more detail in section 1.7.  1.5. B cell receptor signaling 1.5.1 BCR signaling pathways Once B cells enter SLOs, they scan for the presence of the antigen that they recognize. B cells recognize antigen via their BCR. Within each SLO, there are three distinct regions, each with their own characteristic cell populations (Figure 1.2). Underneath the subcapsular sinus is the B cell zone, where B cells aggregate into clusters known as follicles. There, B cells scan for antigens displayed on the surface of FDCs (106, 107). In addition to the B cell zone in lymph nodes there is a T cell zone containing T cells and APCs, and the medulla, where both B and T cells are co-localized with a large number of APCs (108).  14  As described earlier, the BCR consists of a membrane-bound Ig which binds antigen and the non-covalently associated Ig-α/β signaling subunit (Figure 1.1). BCR clustering by antigen activates Src family tyrosine kinases and leads to tyrosine phosphorylation of the immunoreceptor tyrosine acvivation motifs (ITAMs) on Ig-α and Ig-β. Phosphorylation of the tyrosine residues within the ITAMs allows recruitment of additional Src family kinases such as Lyn, Fyn, and Blk via their SH2-domains (which bind to sequence motifs containing phosphorylated tyrosines) (109, 110). These Src family kinases, in turn, phosphorylate additional tyrosine residues on the Ig-α and Ig-β chains, leading to the recruitment and activation of the Syk tyrosine kinase, which has two SH2 domains, each of which binds a phosphorylated ITAM tyrosine residue (111, 112). Syk phosphorylates and activates downstream adaptor and effector molecules, leading to activation of conserved signaling pathways, including those regulated by Ras, PI3K, and PLCγ (discussed in more detail below) (113). Ultimately, this BCR signaling cascade leads to B cell activation through changes in gene expression, cell metabolism, and the cytoskeleton (114-116) (Figure 1.1). B cells can also function as potent APCs. They can present peptides from antigens that they have internalized and activate CD4+ T cells (117-119). Recognition of these peptide-MHC II complexes by T cells results in the expression of cytokines and B cell co-stimulatory molecules such as interleukin 4 (IL-4) and CD40 ligand (CD40L). These co-strimulatory signals synergize with BCR signaling, leading to B cell activation and the initiation of the humoral immune response (120, 121). Immune synapse formation was first observed in CD4+ T cells (122-124), but it is now known to be a common step in immune recognition by T cells, B cells and NK cells (125, 15  126). The immune synapse consists of two major features, the central supramolecular activation complex (cSMAC) which contains aggregated antigen receptor-ligand complexes, and the peripheral SMAC (pSMAC) which is a ring of integrins and adhesion molecules surrounding the cSMAC (124). Although the synapse appears to be important for B cell activation (125), it is formed quite a while after initial receptor signaling, suggesting it is not involved in the initiation of antigen receptor signaling (127). 1.5.2. BCR microclusters are important for signaling Following BCR activation, it is thought that smaller cell surface molecules (such as the BCR) aggregate, while larger membrane molecules (e.g. the CD45 tyrosine phosphatase) are excluded, and that this leads to the formation of BCR microclusters (128-130). Similar microclusters have been observed for the TCR on T cells (131). Using total internal reflection fluorescence microscopy (TIRFM), microclusters consisting of 10-100 BCR complexes have been detected on the surfaces of B cells (132), even in the absence of antigen. Upon antigen engagement, the sequential recruitment of Syk and PLCγ to the BCR microclusters is observed, suggesting that these microclusters act as signaling complexes (132, 133). Active BCR signaling, as detected by staining with antiphosphotyrosine antibodies is associated with BCR microclusters outside the immune synapse, as well as those in the pSMAC. BCR microclusters appear to move towards the cSMAC in an actin-dependent manner (134). Interestingly, BCR microclusters in the cSMAC do not appear to be involved in active signal transduction and it has been suggested that the primary function of the cSMAC is for receptor internalization (125).  16  1.6. Antigen encounter by B cells 1.6.1. B cells encounter different forms of antigens B cells recognize antigens in three major forms: soluble antigens, particulate antigens such as bacteria or viruses, and antigens that are presented on the surface of an antigen presenting cell (APC) such as an FDC, a macrophage or a dendritic cell. These cellassociated antigens may be integral membrane proteins on foreign cells, as in the case of transplant immunity, or foreign antigens that are captured by APCs, often in the form of immune complexes or complement-coated antigens. 1.6.2. Soluble antigens B cells can become activated by soluble antigens that diffuse into B cells zones in the lymph node. Antigens are carried by the lymph into the subcapsular regions of lymph nodes within minutes following immunization (135) (Figure 1.5). From there, pores of 0.1 -1 µm in diameter (136-138) allow small molecules, such as toxins, to enter the follicles, where they are can be examined by resident B cells. This was recently visualized by small fluorescently-tagged proteins administered into mice. The antigen was seen to diffuse out of the subcapsular sinus and be taken up by B cells within minutes after injection (139) (Figure 1.5). 1.6.3. Particulate antigens Particulate antigens such as bacteria and viruses possess multiple repeating epitopes on their surfaces that can cluster BCRs and induce strong activation of B cells (140). While  17  Figure 1.5. B cells encounter antigens in several forms in secondary lymphoid organs Small soluble antigens (<70kDa) (small brown boxes) are able to diffuse into the follicles of lymphoid tissues from the subcapsular region through tiny pores (1). These antigens can then be presented on the surface of APCs to B cells. Directly underneath the subcapsular region there iss a layer of macrophages that are able to reach into the subcapsular region and capture larger antigens (>70kDa), as well as particulate antigens (star) such as viruses (2). These antigens can then be presented to B cells within the lymphoid follicle. Follicular dendritic cells express receptors for Ig molecules (Fc receptors) and for complement proteins (the C1 and C2 C’ receptors) that have bound to antigens as part of immune complexes. These complexes are presented on the surfaces of the FDCs, which B cells then scan (3).  18  pores in the subcapsular region provide access to small antigens, larger particulate antigens are not able to freely diffuse into the lymphoid tissues. Beneath the subcapsular region exists a dense layer of macrophages that have been shown to extend processes into the subcapsular region in order to capture intact antigens for presentation to B cells (141143). Interestingly, these macrophages have limited phagocytic capacity and can retain intact antigen on their surfaces for up to 72 hours (141, 144) (Figure 1.5). A series of studies has shown that following immunization these subcapsular sinus macrophages are responsible for capturing particulates (e.g. microspheres) (145), immune complexes (146), and viruses (147), which can be presented to B cells. Depletion of macrophages, including those at the subcapsular sinus, renders mice unable to retain vesicular stomatitis virus (VSV) at the supcapsular region (147). Marginal zone (MZ) B cells are also involved in antigen presentation to follicular B cells. As their name suggests, MZ B cells do not circulate between lymph nodes as conventional B cells do, but remain exclusively within the marginal zone of the spleen, which is the interface between the white and red pulp. These cells are among the first to encounter antigens that enter the spleen from the bloodstream (148). MZ B cells bind to antigen-immune complexes and transfer them to FDCs for subsequent presentation to follicular B cells (149) (Figure 1.5). When B cells encounter particulate antigens, they undergo morphological changes that may facilitate their activation. For example, B cells that bind anti-Ig-coated polystyrene beads, a model particulate antigen, form F-actin-rich membrane cups at the cell:bead interface (150) (Figure 1.6). This cup may increase the area of the cell:antigen contact site and allow more BCRs to bind epitopes on the surface of the particulate antigen.  19  Figure 1.6. B cells respond differently to surface-bound and particulate antigens (A) Prior to antigen encounter, BCRs and integrin are diffusely distributed on the surface of B cells (1). Upon antigen recognition, B cells spread and BCRs bound to antigen aggregate into microclusters (2). The B cell then retracts its membrane protrusions into a single focus, the B cell synapse, consisting of an accumulation of BCR microclusters (the cSMAC) surrounded by a ring of integrin-ligand complexes that stabilize the synapse (the pSMAC) (3). (B) B cells that encounter particulate antigens captured on the surface of subcapsular macrophages or antigen-coated beads do not form immune synapses, as the epitopes bound by the BCR are immobile. Instead, an actin-rich cup is formed at the site of B cell:antigen encounter.  20  1.6.4. Membrane-bound antigens While B cells may encounter soluble antigens, recent studies have shown that membranebound antigens on APCs are more effective at activating B cells. (132, 151). It has been proposed that the activation of B cells by soluble antigens most often occurs after these antigens have been captured by APCs and displayed as a membrane-bound array. Macrophages and FDCs can capture soluble antigens in several ways. They can bind and present antigen-antibody “immune complexes,” as well as antigens coated with complement proteins (107, 152, 153) (Figure 1.5). These complexes can be bound via the FcγIIB receptor (154, 155) and their CR1 and CR2 complement receptors (156-158) (Figure 1.5). Following antigen recognition on the surface of an APC, B cells undergo a two-step process whereby they spread upon the surface of the APC, then retract their membrane protrusions into a small focus, presumably to gather as much antigen in one location as possible (133, 159) (Figure 1.6B). This aggregation and concentration of antigen is why it is believed that membrane bound antigens are much more effective than soluble ones at activating B cells (132). BCR-antigen microclusters are collected into a cSMAC surrounded by a ring of integrin-ligand complexes to form an immune synapse. This is different than for particulate antigens, for which their epitopes are not mobile (e.g. beads coated with anti-Ig). Since these antigens are fixed and cannot be gathered into a single focus, actin-rich cups are formed at the site of cell:antigen contact, instead of an immune synapse (Figure 1.6A). To undergo the spreading and contraction associated with immune synapse formation, or to form F-actin-rich cups with particulate antigen, B cells must make significant 21  modifications to their cell cytoskeleton. Inhibition of actin polymerization by latrunculin A or cytochalasin D completely prevents the spreading response to membrane-bound antigen (159) and inhibits B cell activation by antigens presented in this manner. Similarly, disrupting the actin cytoskeleton also impairs the ability of anti-Ig-coated beads to activate BCR signaling pathways (150).  1.7. The role of the Rap GTPases in B cell activation 1.7.1. The Rap GTPases Members of the Ras family of small GTPases, which include the R-Ras, Rap, and Ral GTPases, are activated by a wide variety of receptors and serve to couple these receptors to a diverse array of cellular functions including development, proliferation, survival and differentiation. In recent years, our lab has focused on the Rap GTPases, which are key regulators of integrin activation, cytoskeletal organization, cell polarity, and cell motility. The Rap1 GTPase was first described in 1989 by Kitayama et al. as a suppressor of Rasmediated oncogenesis in fibroblasts, that was thought to function by binding and sequestering the Ras effector protein Raf-1 (160, 161). Naturally, this generated interest in Rap1’s role in cell proliferation. Over time, however, Rap has been found to participate in signaling pathways and cellular responses that are independent of Ras. Its role as an antagonist of Ras remains controversial. Like all small GTPases, Rap’s signaling activity is determined by whether it is bound to either GDP or GTP. When bound to GTP, Rap is active, while it is inactive when bound to GDP. Two groups of proteins regulate this process. Guanine-nucleotide exchange factors (GEFs) promote Rap activation by facilitating the exchange of GDP for GTP,  22  whereas GTPase activating proteins (GAPs) promote inactivation by enhancing Rap’s intrinsic GTPase activity, accelerating the conversion of GTP to GDP. In this way, Rap acts as a molecular switch in its ability to quickly cycle between an inactive GDP-bound state and an active GTP-bound state (162). In mammals, there are 5 Rap family members, Rap1A, Rap1B, Rap2A, Rap2B, and Rap2C. Rap2 is by far the less well studied of the two isoforms. While for the most part both Rap1 and Rap2 share the same GAPs and GEFs, Rap2 is found localized mainly in the endoplasmic reticulum, whereas Rap1 is found predominantly at the Golgi apparatus (163-165). However, both Rap1 and Rap2 have been detected at the plasma membrane after receptor signaling (163). It is not entirely clear whether Rap1 and Rap2 have overlapping or distinct functions. A recent paper by Miertzschke et al (166) suggested that Rap1 is involved in cell adhesion whereas Rap2 is more important for directional cell migration. Although Rap2 knockout mice have not been generated, Rap1A knockout mice are deficient in myeloid and T cell migration whereas Rap1B-null mice display defects in platelet aggregation during wound healing (167, 168). In terms of B cell functions, Rap1A knockout mice have minor defects in B cell trafficking in vivo (169) whereas Rap1B knockout mice have more severe defects in B cell trafficking and lack splenic marginal zone B cells (170), a specialized subset of B cells that requires high levels of integrin-mediated adhesion for their development and proper localization. It is not clear whether this reflects a unique function of Rap1B in B cells or the fact that Rap1B is much more abundant that Rap1A in B cells (171).  23  1.7.2. RapGEFs Multiple signaling pathways converge on the GEFs that activate Rap. The three RapGEFs that have been well-studied are: C3G, Epac (or cyclic AMP GEF (cAMP-GEF)), and CalDAG-GEF1 (also known as RasGRP3) (172-174). C3G is activated downstream of receptor tyrosine kinase signaling. In neuronal cells, the activation of Src family kinases leads to recruitment of the adaptor protein Crk to the cell membrane. C3G binds to Crk, becomes activated through tyrosine phosphorylation, and then activates Rap that has been recruited by the same complex. In epithelial cells, C3G interacts with E-cadherin during the early phases of cell junction formation. Interestingly, mechanical stretching leads to C3G-dependent Rap activation and junction stabilization in epithelial cells (175). C3G is also a target of BCR signaling, with Crk/C3G complexes binding to the Cbl adaptor protein following BCR stimulation (176). However, the functional significance is not known, as dominant-negative forms of C3G do not appear to block BCR-induced Rap activation (Gold lab, unpublished data). Epac1 and Epac2 are regulated by signals that increase cAMP levels. In leukocytes, such signals include prostaglandins, serotonin, β2-andrenergic agonists and adenosine, all of which are found at sites of infection (177, 178). Recently, Epac1-mediated Rap activation has been implicated in the adhesion and migration of monocytes, Fc receptor-mediated phagocytosis in macrophages and integrin-mediated cell adhesion in ovarian cancer cells (179). CalDAG-GEFI and CalDAG-GEFIII contain binding motifs for Ca2+ and DAG, both second messengers generated by PLC-mediated cleavage of the membrane lipid PIP2  24  (180-182). PLC is activated in B and T cells following antigen receptor engagement as well as stimulation by growth factors (183-186). CalDAG-GEF1 knockout mice exhibit impaired platelet aggregation and thrombus formation, a phenotype similar to that of the Rap1B knockout mouse (168, 187). Chemokine- and BCR-induced Rap activation in B cells are thought to be mediated by CalDAG family GEFs since synthetic DAGs, as well as phorbol esters that mimic DAGs, cause strong activation of Rap1 and Rap2 in B cells (102, 173). Moreover, the PLC inhibitor U73122 blocks chemokine-induced Rap activation in B cells (102). Interestingly, IP3-induced Ca2+ release does not appear to be important for Rap activation in B cells (173). 1.7.3. RapGAPs There are two major families of RapGAP, the aptly named RapGAPs (consisting of RapGAP and RapGAPII), and the Spa-1 family (which include Spa-1, Spa-L1, E6TP1) (162). The tuberin protein has also been shown to exhibit RapGAP activity (188). RapGAP was the first RapGAP to be discovered (189). The RapGAPII isoform is encoded by the same gene but possesses an additional G-protein α subunit-binding domain that allows it to translocate to the cell membrane and inactivate Rap there, making it a more effective GAP (190). Spa-1 knockout mice exhibit stem cell proliferative disorders such as chronic myelogenous leukemia and hyperactivation of B-1 cells, which leads to B-1 cell leukemias (191, 192). This suggests that Spa-1 may be the most important endogenous Rap-specific GAP in B cells. Conversely, Spa-1 overexpression prevents  25  myeloproliferative disease and HeLa cell adhesion (193). In T cells, conditional overexpression of Spa-1 in blocks αβ T cell development (194). 1.7.4. Rap effectors There are multiple known Rap effectors which, as a group, regulate cell adhesion (RapL, RIAM), polarity (AF-6, Tiam1, Vav2, Arap3), and cytoskeletal dynamics (AF-6, RIAM) (Figure 1.7). AF-6 is an adaptor protein that consists of multiple interaction domains. In epithelial cells, AF-6 binds to F-actin as well as to nectins and p120 catenin, adhesion molecules found in adherens junctions (195). AF-6 associates with profilin, which catalyzes the exchange of ADP bound to actin monomers to ATP, thereby priming actin monomers for addition to existing F-actin filaments (196, 197). AF-6 also regulates the activation of Rap and the Rho GTPases Rac and Cdc42, suggesting a role of AF-6 in controlling cell polarity (198). Zhang et al. showed that AF-6 bridges Rap to RapGAP, and may therefore be a negative regulator of Rap activation (199). Indeed in T cells, AF-6 negatively regulates integrin-mediated adhesion (199) RapL interacts with Rap1 as well as the alpha chain of αLβ2 (LFA-1) integrin molecules. Expression of a dominant negative form of RapL prevents Rap-mediated integrin clustering and cell adhesion to ICAM in both B and T cells. As a result, these cells display a poor ability to migrate to secondary lymphoid organs in vivo (105, 200). Another important link between Rap and integrin-mediated adhesion is the protein RIAM. Overexpression of RIAM leads to exaggerated non-polarized cell spreading, even when Rap activity is blocked by the expression of RapGAP (201). Conversely, siRNA26  Figure 1.7. The Rap signaling pathway in B cells Following BCR, chemokine receptor, or integrin signaling, RapGEFs are activated (green box), and in turn activate Rap. Several proteins inactivate Rap (red box). Rap has a number of known effectors, all of which are involved in mediating either actin dynamics and/or cell adhesion. See text for detailed descriptions of the Rap effectors.  27  mediated knockdown of RIAM in Jurkat T cells severely inhibits integrin activation and cell adhesion. RIAM appears to carry out this function by recruiting talin, a protein that links integrins to the actin cytoskeleton at sites of adhesion (202). In addition to integrin activation, RIAM may also regulate actin polymerization, as a 40% decrease in F-actin content is seen in cells treated with RIAM siRNA. This may reflect the ability of RIAM to bind profilin and vasodilator-stimulated phosphoprotein (VASP), both of which promote actin polymerization. As mentioned earlier, profilin primes actin monomers for polymerization by inducing the exchange of GDP for GTP on actin monomers. VASP is important for Arp2/3 complex-mediated actin nucleation (201, 203). Arap3 is a dual-GAP for both RhoA and Arf6, which is a protein involved in plasma membrane protein endocytosis recycling. Arap3 inactivates RhoA in a Rap-dependent manner, but only in the presence of PI3K signaling (204, 205). Thus, Arap3 couples Rap activation to the inactivation of RhoA. This may be important for establishing an anterior protrusive zone controlled by Rap and a posterior contractile zone controlled by RhoA in migrating leukocytes (see Figure 1.4B). Rap can also bind to two Rac-GEFs, Tiam1 and Vav2, through their DH-PH catalytic regions. These molecules relocate to cell protrusions following Rap activation and mediate cell spreading and adhesion (206, 207). The binding of Tiam1 and Vav2 to RapGTP does not directly affect their catalytic activities, but rather recruits them to membrane protrusions to establish future sites of cell polarity (208).  28  1.8. The role of Rap in immune functions 1.8.1. Integrin-mediated cell adhesion Integrins are cell-surface adhesion molecules that mediate the attachment of cells to other cells and to the extracellular matrix (ECM) (209). Structurally, integrins are transmembrane heterodimers of two distinct subunits, termed α and β. In vertebrates, there are 24 known alpha/beta integrin heterodimers, 11 of which are expressed in human immune cells (210, 211). In resting lymphocytes, integrins exist in a state of low binding affinity for their ligands. “Inside-out signaling” following BCR, TCR or chemokine receptor stimulation is the process by which receptor-induced intracellular signaling events lead to enhanced integrin activation and integrin-mediated cell adhesion (212-214). Integrin activation involves both integrin clustering and conformational changes. These conformational changes involve physical separation between the α-β subunits, which results in changes to the extracellular domains that enhance binding affinity (209, 215, 216). The signaling pathways thought to be involved in inside-out signaling include those involving Rap, RhoA, PI3K, and PKC (Reviewed in (211)). Integrins are essential for B function. Lymphocytes must be able to bind to HEVs following selectin-mediated rolling in order to extravasate into SLOs (52, 55). B cell homing is impaired in LFA-1 and VLA-4 double-knockout mice, but not in mice lacking only LFA-1 (217, 218). Moreover, the formation of immune synapses between B cells and APCs requires sustained cell:cell adhesion provided by integrin binding on the B cell  29  to ligands on the APC. The establishment of a pSMAC, a ring of integrin:ligand complex, during immune synapse formation enhances B cell activation considerably (124). Activation of the Rap GTPases following BCR and chemokine receptor stimulation in both B and T cells is required for integrin activation. In A20 B lymphoma cells in which Rap activation is blocked via the expression of RapGAPII, there is a dramatic reduction in the ability of the cells to adhere to plate-bound ligands for the LFA-1 and VLA-4 integrins (150). Rap regulates integrin-mediated adhesion in lymphocytes via the RapL adaptor protein. Upon TCR stimulation, Rap-GTP associates with RapL and translocates to the cell membrane where it binds to the alpha chain of LFA-1, leading to its activation (i.e. conversion to a clustered high-affinity form). Expressing a dominant negative form of RapL prevents Rap-mediated integrin cluster and cell adhesion to ICAM and this severely impairs T cell homing to lymphoid organs (105, 200). Rap-RapL complexes also enhance cell adhesion by promoting the trafficking of additional integrins to the immune synapse. This is thought to be mediated by the kinase Mst1, which associates with RapRapL complexes that are found on microtubule-associated vesicles containing LFA-1 (219). The adaptor protein talin links integrins to the cell cytoskeleton through its ability to bind integrins, actin, and vinculin (220-222). Rap1 activation leads to the formation of an integrin activation complex consisting of Rap, talin, and RIAM. Upon binding to RIAM, there is a conformational change in talin  30  that reveals an integrin-binding site. The subsequent association of talin with beta integrin subunits leads to integrin activation (223). With respect to leukocytes, it was previously shown that patients deficient in the Rap GEF CalDAG-GEFI suffer from Leukocyte Adhesion Deficiency III (LAD-III) syndrome, in which immune cells are unable to activate their beta 1, 2, and 3 integrins and therefore cannot bind to endothelial vessels at sites of infection or extravasate into infected tissue (224, 225). Recently, it was shown that a lack of the putative Rap effector protein Kindlin3, rather than CalDAG-GEFI deficiency, is the cause of LAD-III in some patients (226). Once integrins bind their ligands, they can act as signaling receptors. This “outside-in integrin signaling” often leads to cytoskeletal reorganization. For example, integrin engagement in T cells and NK cells leads to reorientation of the secretion apparatuses to the site of adhesion (227, 228). B cells spread dramatically when plated on the integrin ligand ICAM1 (212). Sites of integrin engagement often exhibit high levels of tyrosine phosphorylation. Integrin signaling has been studied mainly in adherent cells, where integrin activation is required for forming stable adhesions. During cell migration, small focal “dots” are formed with the ECM, consisting of integrin-based molecular complexes (229), and these dots mature into larger, elongated structures also containing myosin-containing actinfilament bundles are known as focal adhesions (230). Upon integrin engagement, the tyrosine kinase focal adhesion kinase (FAK) is recruited to the cytoplasmic domain of the integrin (231). FAK can then bind to, phosphorylate, and activate Src family tyrosine  31  kinases (232-234) which then phosphorylate the docking proteins paxillin and p130CAS (Crk-associated substrate) (235-237). Phosphorylated CAS and paxillin then recruit the adaptor protein Crk which binds to the RapGEF C3G, leading to Rap activation (235, 238-240), which promotes further integrin activation as well as cytoskeletal reorganization. 1.8.2. The role of Rap in cell polarity and migration Chemotaxis is a complex process that requires sensing of the chemoattractant, polarization of the cell in the direction of the chemoattractant gradient, and cellular movement towards the signal. The initial sensing of signal is achieved by binding of the chemoattractant to a heterotrimeric serpentine G-protein-coupled receptor (241). A common step in the establishment of polarity is the conversion of PIP2 to PIP3 by PI3K. Upon receptor stimulation, PI3K is activated and recruited to the leading edge of a cell, causing a PIP3 gradient to be generated within the cell. This leads to recruitment of PIP3-binding proteins, many of which are involved in cytoskeletal reorganization (e.g. the Rac activator Vav), and the establishment of pseudopodia (242-245). In migrating Dictyostelium discoideum, Rap1 is activated at the leading edge of the cell (246). The same is true in T cells (247) and recent work has shown that PI3K activity is required for Rap activation in B cells (104, 248). In epithelial cells, the establishment of apical-basal polarity is attributed to the actions of evolutionarily-conserved signaling complexes, a major one being the Par/aPKC polarity complex. In T cells, Rap-GTP binds to the Par/atypical protin kinase C (aPKC) complex (208), which also contains the Rac activator Tiam1 (249). This leads to activation of  32  Tiam1 and subsequent activation of Rac, which is important for formation of the leading edge. Cdc42 is required to activate aPKC in the Par/aPKC complex, and is essential for proper leukocyte migration (100). Cdc42 activation is regulated by Rap in T cells (208). Similarly, in the yeast Saccharomyces cerevisae, the Rap orthologue Bud1 determines the site of bud formation by recruiting a GEF for the polarity protein Cdc42. This redirects vesicle trafficking to the putative bud location, and promotes the assembly of F-actin filaments at the new site (250, 251). Thus Rap1 may control the establishment of cell polarity by acting upstream of Cdc42-dependent actin filament assembly. The Rho family of GTPases (Rho, Rac, and Cdc42) are activated through stimulation of the T and B cell receptors, and correct regulation of these GTPases is essential for proper cell polarization. Rap1 appears to act upstream of Rac, Cdc42, and Rho (details below), and in this sense is a master regulator of cell cytoskeletal organization and polarity. Overexpression of any of these molecules resulted in loss of polarity and poor chemotaxis towards SDF-1. Conversely, dominant negative variants result in cells exhibiting a constitutively round morphology (94). For the most part, Rac and Cdc42 are localized to cell protrusions at the front of the cell while Rho is present toward the sides and back of migrating cells (95). Rac and Cdc42 activation lead to formation of the WAVE/WASP complex, which ultimately promotes polymerization and branching of new actin filaments (96, 97). The continuous extension of pseudopods at the front of the cell by Rac and Cdc42, combined with periodic Rho-mediated retraction of the tail are thought to be the major processes involved in cell migration on ECM. Activation of RhoA in T cells is required  33  to produce stress fibers at the rear of the cell. Contraction of these fibers through myosin IIA activity helps push the cell forward during ameboid-like movement (101). 1.8.3. Rap in B cell spreading and immune synapse formation As mentioned previously, multiple Rap effectors are implicated in cytoskeletal dynamics. AF-6 binds to profilin (196, 197), and RIAM binds to both profilin and VASP, proteins involved in promoting actin polymerization (203). RapL and RIAM are important for integrin activation, which is required for cell spreading (105, 200, 201). Furthermore, Rap is important for the activation of Cdc42 (described in more detail later) and Rac, which are essential for cell spreading and the formation of pseudopodia at the leading edge (206, 207). B cells spread when plated on immobilized anti-Ig antibodies that cluster the BCR, form F-actin-rich cups when they bind particulate Ags (modeled by anti-Ig-coated beads), and form immune synapses. The formation of immune synapses at the site of B cell:APC contact and the formation of F-actin-rich cups at the site of B cell contact with anti-Igcoated beads can be considered as the establishment of a polarized cell morphology. All of these responses are impaired when Rap activation is blocked either by expressing RapGAPII or the dominant negative Rap1N17. In the case of immune synapse formation, blocking Rap activation prevents pSMAC formation and reduces the aggregation of BCR:antigen complexes (150).  34  1.9. Lymphocyte polarity 1.9.1. Polarity in epithelial cells In addition to the Par/aPKC complex described above, there are several other evolutionarily –conserved protein complexes that regulate cell polarity. These complexes have been studied most extensively in epithelial cells, as these cells possess two very distinct “halves”: the basal and apical regions (Figure 1.8). The apical and basal surfaces of epithelial cells are distinct from each other, containing unique lipid and protein determinants. The partitioning of a cell’s surface into apical and basal membrane domains is accomplished through the formation of intercellular junctions. These junctions effectively form physical barriers between the two halves of the cell that are impassable to membrane lipids and proteins. Each membrane domain is able to retain its characteristic membrane constituents and therefore, its identity and function. The establishment of apical-basal polarity rests on the asymmetrical distribution of proteins as well as apical versus basal targeting of secretory vesicles (252-254). This is achieved through the actions of polarity complexes, primarily the Par, Crb, and Scribble complexes, which are described below. 1.9.2 The Par complex The Par complex consists of Par3 (known as Bazooka in Drosophila), Par6, and aPKC. Par3 is an adaptor protein that binds to tight junctions at the lateral regions of epithelial cells and is important for their formation. Mutation of any of the members of this Par3/Par6/aPKC complex result in loss of apical-basal polarity in Drosophila (255-257). Par6 binds to both aPKC and Par3, and is important for the recruitment of Cdc42, which  35  Figure 1.9. Interactions between polarity complexes The Par complex, consisting of Par3, Par6, and atypical protein kinase C (aPKC) are localized to tight junctions in epithlial cells and are important for the formation of these structures. Par6 is involved in establishing and maintaining polarity in two ways. First, it pairs with Pals1 and recruits the Crumb (Crb) complex, which includes Crb, Pals1, PatJ, and MuppI, to tight junctions (black squiggles). Crb, a peripheral membrane protein, confers apical properties to the regions of the cell to which it is localized. Second, Par6 binds to and excludes the basolateral determinant Lgl from the apical portion of the cell by recruiting Cdc42. Cdc42 activates aPKC, which in turn phosphorylates Lgl. Phosphorylated Lgl then diffuses into the basolateral domain where it associates with Scribble and Dlg. Crb has also been implicated in excluding Lgl from the apical side of the cell, but the mechanism by which it does this is not known. It is likely due to the ability of Pals1 to bind Par6 and, as a result, indirectly oppose Lgl.  36  activates aPKC (258, 259). Activated aPKC in turn activates the RacGEF Tiam1, leading to Rac activation and the promotion of tight junction formation (260). 1.9.3 The Crb complex The Crb complex consists of Crumbs (Crb), Pals1 (Stardust in Drospholia), and PatJ. The transmembrane protein Crb is a major apical determinant in epithelial cells. This is strikingly evident in D. melanogaster, as re-directing Crb to the basal plasma membrane is sufficient to confer apical-like properties to that region. Furthermore, overexpressing Crb leads to an increase in the size of the apical region while the basal domain is smaller than normal (261). Mutating genes involved in endocytosis in D. melanogaster results in cells that are unable to recycle Crb from the cell membrane, and the subsequent accumulation of Crb results in a similar expansion of the apical domain (262). Thus, endocytotic processes are critical for maintaining cell polarity. In mammals, there are 3 orthologues of Crb. Crb1 is expressed mainly in the eye and brain, Crb2 is found in the retina, brain, and kidney, and Crb3 is expressed in epithelial tissues (263-265). Pals1 interacts directly with Crb through a PDZ binding domain, and is important for the formation of tight junctions (266-269). PatJ appears to be important for the stability and localization of Crb complexes in human intestinal cells, as a knockout of PatJ impairs Crb3 accumulation at the cell membrane (270). PatJ is found at tight junctions and can bind to the junctional molecules zonula-occludens 3 (ZO-3) and claudin-1 (271). MultiPDZ domain protein 1 (Mupp1) is a paralogue of PatJ and can also bind junctional proteins called claudins, but its function is not well understood (272).  37  1.9.4. The Scribble complex The Scribble complex is comprised of three scaffolding proteins: Scribble (Scrib), Discs large (Dlg) and Lethal giant larvae (Lgl) (273). Unlike the Par and Crb complexes, which are found in the apical portion of the cell and are responsible for conferring apical-like properties to their locales, the Scribble complex localizes specifically to the basolateral compartment (274, 275). As is the case with the other polarity proteins mentioned here, knockout of any member of this complex leads to destabilization of cell junctions and the loss of cell polarity (276). In T cells, loss of Scribble or Dlg blocks uropod formation, and Scribble knockdown by siRNA impairs cell migration and polarization in response to the chemokine CXCL12 (277). 1.9.5. Interactions between polarity complexes While the three polarity complexes are each restricted to distinct sites within the cell, they do interact and regulate each other’s localization in order to achieve this distribution. There appears to be active mutual exclusion between the apical (Par, Crb) and basolateral (Scrib) complexes within the cell, which facilitates correct development of polarity (278, 279). In Drosophila, the Scrib complex excludes the Par complex from the basolateral domain, while Par prevents Scrib from localizing in the apical region of the cell (278, 279). The key mediator in these interactions appears to be Par6. In addition to associating with Par3 and aPKC (at the apical domain), Par6 is able to bind to Pals1 of the Crb complex as well Lgl from the Scrib complex (280-282). The ability of Par6 to bind directly to Lgl and indirectly to Pals1 results in Lgl being excluded from the apical domain.  38  Exclusion of Lgl from the apical domain is mediated by Par6-dependent aPKC activation and subsequent phosphorylation of Lgl (282). Lgl has been shown to diffuse into the apical zone when not phosphorylated in mammalian cells (275). Following phosphorylation, Lgl detaches from Par6 and returns to the basolateral portion of the cell to associate with Scrib and Dlg at adherens junctions. The reverse is also true. In Lgl-deficient mutants, the resulting loss of cell polarity is rescued when aPKC is also knocked out, suggesting that Lgl is important for inhibiting the Par complex (283). An explanation for this may lie in the observation that Par3 and Lgl cannot bind Par6 simultaneously, suggesting the presence of overlapping binding regions for the two proteins on Par6 (281, 284). Therefore, Lgl may exclude the Par complex from the basolateral domain simply through antagonistic binding to Par6 (285). The Crb complex also excludes the Scrib complex from the apical side (278, 279). As mentioned earlier, Pals1 can bind to Par6, and it has been suggested that the exclusion of Lgl from the apical domain by the Crb complex could be due to the presence of Par6 that has associated with Pals1 (280). Par complex formation is known to precede Crb recruitment during Drosophila epithelial development whereas during later stages, the presence of Crb is important for the stabilization of the Par complex, further illustrating the interaction between these two complexes (286) (Figure 1.8). 1.9.6. Polarity complexes in lymphocytes In T cells, components of the Par complex are found in the mid-body of the cell (277). Par6 can bind to the ubiquitin E3 ligase Smurf1, one of the targets of which is RhoA  39  (287). Thus, Par signaling may be involved in degradation of RhoA in the middle of the cell, thereby preventing stress fibre contraction in that area. The Scrib/Dlg/Lgl complex is found in the uropod of migrating Jurkat T cells, and knockout of Scrib impairs T cell motility (277). Why this occurs is not clear. One hint is the observation that Lgl can bind to myosin II, which is important for the contraction of actin stress fibres at the back of the cell (288).  1.10. B cell cytoskeletal changes 1.10.1. B cells must change morphology to function The abilities to polarize and rapidly change cell shape are required for many essential B cell processes. For instance, B lymphocytes must form a leading edge in order to migrate to SLOs where they encounter foreign antigens. Chemokines such as CXCL12, CCL19, and CCL21 are expressed on the surface of HEVs lining SLOs (52, 289). Extensions of the cell membrane allow B cells to crawl along the endothelial surface until they find a suitable place to extravasate (290). Once in the lymph node, B cells spread upon and extend membrane processes across the surface of APCs in order to scan for antigens recognized by their BCR (70, 291). Upon antigen recognition, cytoskeletal remodeling takes place and F-actin-rich cups are formed with particulate antigens, or immune synapses are formed between the B cell and the APC. Together, these processes facilitate B cell activation (159). The critical initial step in remodeling the actin cytoskeleton is actin severing, which allows for the formation of branched actin filaments that can support membrane protrusion. A key actin-severing protein is cofilin.  40  1.11 Cofilin 1.11.1 Cofilin overview Members of the cofilin/actin depolymerizing factor (ADF) family bind to and sever Factin, promoting its depolymerization and freeing up actin monomers for the formation of new filaments (292-294) (Figure 1.9). In addition to depolymerizing F-actin, cofilin/ADF activity is thought to be important for the de-novo assembly of new F-actin fibers, as the resulting barbed ends generated by cofilin/ADF activity are preferentially used by the Arp2/3 complex as nucleation sites for the formation of branched F-actin filaments (294, 295). Cofilin possesses a PIP2-binding domain, and in resting cells remains associated with PIP2 at the cell membrane (296, 297). Upon T cell receptor (TCR) signaling, PLCγ is activated (298-300), cleaving PIP2 into IP3 and DAG. When PIP2 is cleaved, cofilin that was sequestered at the cortical membrane and rendered inactive via its binding of PIP2 is released, and can become activated. Cofilin activation depends on the hydrolysis of PIP2, but not on IP3-dependent calcium release (301, 302). 1.11.2. Regulation of cofilin activity The pathways regulating the activity of cofilin are shown in Figure 1.10. Cofilin is phosphorylated at Ser3, and in this phosphorylated state it is inactive and unable to interact with F-actin. Dephosphorylation of this site restores cofilin’s actindepolymerization activity. Two families of kinases phosphorylate and turn off cofilin: the LIM kinases (LIMK) and testicular kinases (TESK). Of these, only the LIM kinases are ubiquitously expressed (303-306). LIMK is activated as a result of PI3K signaling,  41  Figure 1.9. Cofilin function Dephosphorylated (active) cofilin binds to and cleaves F-actin filaments, generating free barbed ends that are preferential sites for Arp2/3 binding and branched F-actin polymerization. In this way, cofilin is both responsible for the breakdown of existing actin filaments through its F-actin severing activity, as well as indirectly promoting the formation of new F-actin filaments, making it a potent regulator of actin dynamics. From Wang et al. (307).  42  through the activation of the Rho GTPases Rho, Rac, and Cdc42. The RhoA kinase (ROCK), myotonic dystrophy kinase-related Cdc42-binding kinase α (MRCKα), and the p21-activated kinases 1 and 4 (PAK1 and PAK4) act downstream of Rho, Cdc42 and Rac signaling, respectively, and are all capable of phosphorylating and activating LIMK (308310). The activation of cofilin is carried out by the Slingshot (SSH) family of phosphatases. In humans and mice, there are three Slingshot genes, SSH-1, SSH-2, and SSH-3. Of these, SSH-3 is less effective than the others at dephosphorylating cofilin (311, 312). Actin-binding proteins such as tropomyosin can also compete with cofilin for F-actin binding and can therefore block cofilin’s F-actin severing ability (313, 314). The transduction into cells of short peptides that compete with cofilin for actin binding also prevents F-actin depolymerization, further illustrating the need for cofilin to bind to actin in order to sever actin filaments (315). 1.11.3. Slingshot activates cofilin SSH appears to be controlled by PI3K signaling, as the PI3K inhibitors wortmannin and Ly 294002 block cofilin dephosphorylation and SSH localization to membrane protrusions (316, 317). In addition, PLCγ –mediated Ca2+ increases are important for SSH activation, as the Ca2+-dependent phosphatase calcineurin dephosphorylates and activates SSH (318). SSH possesses an F-actin binding region, which is exposed upon activation, and the presence of F-actin is critical for SSH’s phosphatase activity. A ten-fold increase in SSH activity is observed when it binds F-actin, suggesting that the accumulation of F-actin 43  filaments promotes depolymerization and reorganization of the cytoskeleton (319). When phosphorylated, SSH is inactive and bound by 14-3-3 proteins in the cytoplasm such that it is unable to interact with F-actin (319-321) (Figure 1.10). Upon EGF or insulin stimulation in MCF7 mammary epithelial cells, SSH rapidly disassociates from 14-3-3 and accumulates in the growing lamellipodia, where it can activate cofilin and promote actin severing and cytoskeletal reorganization (316, 319). Conversely, phosphorylation of SSH by PAK4, a LIMK activator, can inactivate SSH (321). In addition to dephosphorylating and activating cofilin, SSH can bind to and dephosphorylate LIMK, which phosphorylates cofilin on inhibitory sites. This highlights SSH’s dual role in both initiating and sustaining the activation of cofilin (321). SSH not only activates cofilin by dephosphorylating it at its N-terminal Ser3, but at the same time prevents the inactivation of cofilin by turning off LIMK. Thus, the activity of cofilin, LIMK, and SSH is coordinately regulated in a complex manner (Figure 1.10). 1.11.4. The role of cofilin in cell migration Both too little and too much cofilin activity inhibits the formation of membrane protrusions and reduces migration in EGF-stimulated mammary carcinoma cells (322). However, there are conflicting reports regarding the effects of either knocking down or overexpressing cofilin or LIMK on cell migration (307). For example, mammary carcinoma cell lines expressing constitutively active LIMK show impaired migration in vitro (323), and siRNA knockdown of LIMK in the Jurkat T cell line inhibits motility (324). However, overexpression of LIMK in prostate epithelial cells enhances migration (325). A modest overexpression of cofilin increases the velocity of Dictyostelium  44  Figure 1.10. Regulation of cofilin activity Upon stimulation through G-protein-coupled receptors such as chemokine receptors, PI3K and PLC are activated. Production of PIP3 by PI3K leads to activation of the Rac and Cdc42 GTPases. Downstream effectors of Rac and Cdc42 are the kinases PAK1, PAK4, and MRCKα. RhoA-GTP activates the kinase ROCK. These kinases all phosphorylate and activate LIMK, which phosphorylates and inactivate cofilin. PAK4 enhances cofilin inactivation by simultaneously inactivating the cofilin phosphatase Slingshot (SSH). In a resting cell, cofilin is associated with PIP2 and sequestered at the cell membrane. PLC cleaves PIP2 into the second messengers IP3 and DAG, releasing cofilin. IP3 signaling leads to intracellular calcium release and activation of calcineurin, which is important for activating SSH. SSH dephosphorylates cofilin, increasing its enzymatic activity and allowing it to sever F-actin filaments. SSH also promotes cofilin activation by dephosphorylating and inactivating LIMK.  45  motility, but higher cofilin levels decrease motility (326). Suffice it to say, controlling the relative levels of phosphorylated and non-phosphorylated cofilin appears to be critical for proper cell polarity sensing and migration.  1.12. Hypothesis As mentioned above, activation of the Rap GTPases is important for the cytoskeletal changes that underlie B cell spreading, migration, and immune synapse formation. Blocking Rap activation by overexpressing RapGAPII prevents cytoskeletal remodeling and actin turnover and results in a static cytoskeleton in some cells. Although a number of Rap effectors that regulate the cytoskeleton have been identified (200, 201, 219, 223), the mechanisms by which Rap-GTP promotes actin polymerization, reorganization of the actin cytoskeleton, and changes in cell morphology are not completely understood. In order for a cell to change its morphology, the cortical F-actin cytoskeleton must first be disassembled before new F-actin filaments that contribute to the formation of a leading edge or immune synapse are assembled (327). Since cofilin plays a major role in severing and depolymerizing F-actin filaments, I tested the hypothesis that the Rap GTPases regulate changes in lymphocyte morphology by controlling the activation of cofilin. In this report, I show that clustering the BCR or TCR leads to cofilin dephosphorylation, and that this is dependent on activation of the Rap GTPases. In addition, because Rap-GTP promotes cell polarization, I investigated the expression of polarity complex proteins in B cells, in order to formulate hypotheses as to which might be regulated by Rap.  46  2. Materials and Methods 2.1 Cell culture Murine primary splenic B and T cells were purified from C57BL/6 mice by lysing erythrocytes with Tris-buffered NH4Cl, followed by negative selection of non-B or non-T cells using MACS B or T cell isolation kits (Miltenyi Biotech, Auburn, CA). Resulting B cell populations were >95% B cells, as determined by FACS staining with FITCconjugated anti-CD19 (BD Pharmingen, San Diego, CA). The A20 IgG+ mature murine B cell line, the WEHI-231 IgM+ immature murine B cell line, and the Jurkat E6.1 human T cell line were obtained from the American Type Culture Collection (ATCC, Manassas, VA). Cell lines were cultured in RPMI-1640 supplemented with 10% fetal calf serum, 50 µM 2-mercaptoethanol, 2 mM glutamine, 2 mM pyruvate, 15 U/ml penicillin and 50 µg/m streptomycin. WEHI-231 and A20 cells that were stably-transduced with pMSCVpuro (BD Biosciences Clontech, Palo Alto, CA) or pMSCVpuro-FLAGRapGAPII by retrovirus-mediated gene transfer were established previously (102, 104, 150, 212) and cultured in medium containing 0.4 µg/ml puromycin for WEHI231 cells or 4 µg/ml puromycin for A20 cells. Transient transfections of Jurkat cells were performed by nucleofection using Amaxa kit V (Lonza, Walkersville, MD) according to the manufacturer’s instructions.  2.2. RT-PCR Total RNA was isolated from A20 cells, WEHI-231 cells, and splenic B cells using TRIzol LS Reagent (Invitrogen, Carlsbad, CA). RNA from embryonic day 10.5 mouse  47  brain was a gift from the Roskams lab (University of British Columbia, Vancouver, BC). cDNA was generated by combining 5µg of total RNA with random nucleotide primers, 5X 1st strand buffer, 0.1 M DTT, 10 mM dNTP mix and SuperScript II polymerase (Invitrogen, Carlsbad, CA). cDNA was then amplified by polymerase chain reaction (PCR) using PuReTaq Ready-To-Go PCR Beads (GE Healthcare, Little Chalfont Buckinghamshire, UK) and primers complementary to genes encoding for various polarity proteins (Invitrogen, Carlsbad, CA, see Table 2.1). PCR was performed on a PTC-100 Tetrad thermal cycler (MJ Research, Waltham, MA) using the following cycling protocol: 1 minute 95oC melting step followed by 35 cycles of: 45 sec @ 95oC: melting step 45 sec @ 60oC: annealing step 1 min @ 72oC: elongation step Followed by one last elongation step @ 72oC for 5 min.  Table 2.1. Polarity protein PCR primers Gene Crb1 Crb2 Crb3 PraJ Mupp1 Lgl1 Lgl2 Dlg1 Dlg2 Dlg3 Scrib1 Pals1 Par3 Par6  Forward Primer (5’  3’) CAGGTCCTTGCCAAAACAAT CTCCAAGTGTCTGTGCCTCA CCAACTCGTCGCCTAAACTC CCTACAGAGCTCCATCTGCA GCAGACTCTCCGTCTTCCAC AGCAAGCGAGCTGATACCAT GAACCTCTGCGCAGCTCTAT GGAAGATTGCGGGTAAATGA ACTCACCAATTCCCAAGCAC CACAGTCACAGGTCTCTTTGTCAC CCTTGAGTGGAGGCTCTGTC GGGACCTTGACTTGTTTGGA CAGACTCAAGGCAGGAGACC TGACAGTAGCGATGACAGCA  Reverse Primer (5’  3’) TGGCAGTTTCACAGTTCAGC TGGCACTCGTAGTGATCTGC TTTCGCATGAGCAGAAACAG GACAGGTCTTCCGGTTTGGA CCGTGCTCAGTTAGGCTTTC CAGGTTCCGCAGTTCTTCTC ATGACACGGGAGGTGAAGTC CAATGCTGAACCCAAGACCT CATGTCAGAGTCAGGGAGCA AGCGGTCTGGTCCACGTTGGCGATGA CTCAGGCTGTCCCTCTTCAC CCCTTCTCTCAATCCCATGA GGGTGTGAGAACAACGTGCT AGAGGCTGAATCCGCTAACA 48  2.3. Immunoblot analysis of polarity protein expression A20 cells, WEHI-231 cells, and murine splenic B cells were lysed in RIPA buffer (30 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Igepal, 0.5% sodium deoxycholate, 0.1% SDS, 2 mM EDTA, 1 mM PMSF, leupeptin, 1 µg/ml aprotinin, 1mM Na3VO4, 25 mM βglycerophosphate). Embryonic day 10.5 mouse brain extracts were a gift from the Roskams lab (University of British Columbia, Vancouver, BC). Cell extracts were separated on SDS-PAGE gels and transferred to nitrocellulose membranes. Immunoblotting was performed with rabbit antibodies against mouse Scrib1 (from Dr. Patrick Humbert, University of Melbourne, Australia), Lgl1 (Cell Signaling Technology, Danvers, MA), and Dlg1 (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000 dilutions in Tris buffered saline (TBS), pH 7.4 with 0.1% Tween 20 (TBST) plus 5% BSA. Blots were probed with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (BioRad), and immunoreactive bands were visualized using ECL.  2.4. Chemoattractants and inhibitors Recombinant mouse CXCL13 (R&D Systems, Minneapolis, MN) was resuspended to 25 µg/ml in PBS and stored as 25 µl aliquots as -80oC. CXCL12 (R&D Systems) was stored at 100 µg/ml in PBS at -80oC. Jasplakinolide and latrunculin A (Calbiochem, San Diego, CA) were resuspended to 1 mM and 2 mM, respectively, in DMSO and stored at -20oC. The ROCK Inhibitor Y-27632 (Calbiochem, San Diego, CA) was stored at -20oC at a concentration of 10 mM in DMSO. The calcineurin inhibitor FK506 (Interomex Biopharmaceuticals Inc, Vancouver, BC) and the PI3K inhibitor Ly294002 were diluted to 50 mM in DMSO and stored at -20oC. Immediately prior to experiments, inhibitors  49  and chemokines were diluted to working concentrations in modified HEPES-buffered saline (mHBS; 25 mM Na-HEPES, pH 7.2, 125 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM NaH2PO4, 0.5 mM MgSO4, 1 g/l glucose, 2 mM L-glutamine, 1 mM Na-pyruvate, and 50 µM 2-mercaptoethanol) (328).  2.5. Antibody-coated beads and antibody-coated plates Goat anti-mouse IgG antibodies (Jackson Immunoresearch Laboratories, West Grove, PA) or goat anti-kappa light chain antibodies (Southern Biotech, Birmingham, AL) were diluted to 20 µg/ml in 1 ml of 20 mM Tris-HCl pH 8.0 and bound to 4 x 107 4.5-micron polystyrene beads (Polysciences Inc., Warrington, PA) for 1 hr at 37oC, followed by a blocking step of 30 min with 2% BSA in 20 mM Tris-HCl pH 8.0. Beads were used right away or stored at 4oC for up to 1 week. Plastic tissue culture-treated 6 well cell culture plates (BD Biosciences, San Jose, CA) were coated with goat-anti mouse IgG or goat anti-kappa light chain antibodies in PBS at a concentration of 2 µg/cm2 for 1 hr at room temperature, then blocked with 2 µg/cm2 BSA for 1hr and used on the same day.  2.6. Cell stimulation for immunoblotting analysis Murine splenic B cells and A20 cells (5 x 106 in 0.5 ml mHBS) were stimulated with 20 µg/ml soluble goat anti-mouse anti-IgM antibodies or goat anti-mouse kappa light chain antibodies. Alternatively, the cells were added to 6 well plates coated with these antibodies at a concentration of 2 µg/cm2 or mixed with 107 anti-Ig-coated beads. Murine splenic T cells and Jurkat cells were stimulated with 5 µg/ml anti-CD3 plus 1 µg/ml antiCD28 antibodies (BD Pharmingen, San Diego, CA). CXCL12 was used at 100 nM and CXCL13 at 200 nM. 50  2.7. Cofilin and LIMK phosphorylation Cells were lysed in RIPA buffer. Cell extracts were separated on SDS-PAGE gels and transferred to nitrocellulose membranes. The membranes were probed with rabbit antibodies against cofilin that is phosphorylated on Ser3 (phospho-cofilin), LIMK1/2 phosphorylated on Thr508/Thr505 (phospho-LIMK), or Akt that is phosphorylated on Ser473 (phospho-Akt) (all from Cell Signaling Technology, Danvers, MA). Immunoreactive bands were visualized using horseradish peroxidase-conjugated antibodies (Bio-Rad, Hercules, CA) and enhanced chemoluminescence (ECL) detection. The blots were then stripped with TBS-HCl, pH 2 and reprobed with antibodies against cofilin, LIMK1, or Akt (all from Cell Signaling Technology, Danvers, MA).  2.8. Confocal microscopy Cells (2 x 105 cells in 0.1 ml mHBS supplemented with 2% FBS) were mixed with beads at a 1:2 ratio and incubated at 37oC. Cells were then placed on glass coverslips coated with 0.1% poly-L lysine and fixed with 3% paraformaldehyde. After fixation for 20 min, cells were permeabilized for 10 min using TBS plus 0.5% Triton X-100 and then blocked for 10 min in TBS with 10 µg/ml BSA and 0.1% Triton X-100. The cells were then incubated with antibodies to Scrib1, phospho-cofilin, or total cofilin for 40 min at room temperature. Rhodamine-phalloidin and Alexafluor 647-conjugated goat anti-rabbit IgG secondary antibodies (Molecular Probes, Eugene, OR) were added for 20 min, followed by mounting of the coverslips onto glass microscope slides using Prolong Gold antifade reagent with DAPI (Molecular Probes, Eugene, OR). After curing overnight, coverslips were sealed with nail polish and imaged using an Olympus FV1000 microscope.  51  Olympus Fluoview ASW Viewer 1.6 was used to analyze and save images. Quantification of fluorescence intensity was done using ImageJ software.  2.9. Statistics Student’s paired two-tailed T tests were performed to compare sets of matched samples.  52  3. Results 3.1. Polarity proteins in B cells 3.1.1 All three members of the Scribble/Dlg/Lgl complex are expressed in primary B cells and in B cell lines In epithelial cells, there are three major evolutionarily-conserved polarity complexes, the Crumbs complex, the Scribble complex, and the Par complex. We were interested in knowing which of these polarity proteins were expressed in B cells and whether RapGTP promotes B cell polarization (e.g. in response to anti-Ig-coated beads) by modulating the localization or activation of these complexes. We first wished to determine which of these polarity complexes were expressed in B cells. To do this, RTPCR was performed using primers specific for the following polarity genes: Crb, Pals1, PatJ and Mupp1 of the Crb complex, Scribble, Dlg, and Lgl of the Scribble complex, and Par3 and Par6 of the Par complex. RNA was isolated from murine splenic B cells as well as A20 and WEHI-231 murine B lymphoma cell lines. RNA from embryonic mouse brain was used as a positive control. The results from these RT-PCR analyses are shown in Figure 3.1. Although mRNA encoding the PatJ and Mupp1 components of the Crb complex (Crb, Pals1, PatJ, Mupp1) were present in splenic B cells as well as the WEHI-231 and A20 cell lines, Crb1 and Crb2 mRNA were detectable only in splenic B cells and Pals1 mRNA was not detected in any of these cells. This suggests that the Crb complex may not be important for B cell polarization since the WEHI-231 and A20 B cell lines undergo robust chemokine-induced migration and form polarized F-actin-rich cups in response to anti-Ig-coated beads.  53  Par6 mRNA was present in both the primary B cells and the B cell lines, but Par3 mRNA was detected only in the splenic B cells. This suggests that Par3/Par6aPKC complexes may play a role in primary B cells but are not required for the polarization or migration of B lymphoma cell lines. In contrast to these results for the Crb and Par complexes, I found that A20, WEHI-231, and splenic B cells expressed mRNA for all three members of the Scribble complex, Scrib1, Dlg, and Lgl (Figure 3.1). Immunoblotting was used to confirm that the Scribble complex proteins Scrib1, Dlg, and Lgl were all expressed in the splenic B cells as well as the WEHI-231 and A20 cell lines (Figure 3.2). Scrib1, also referred to as hScrib, is the mammalian homologue of Drosophila Scrib1, and to date is the only Scribble protein identified in mammals. The B cell lines exhibited multiple bands that reacted with the Scrib1 antibody whereas splenic B cells expressed only a single form corresponding to the highest molecular weight bands seen in the cell lines. Interesting, the lowest molecular weight Scrib1 band was the main band seen in E10.5 brain cells. Two isoforms of Scrib1 have been described in Drosophila, with the larger isoform being expressed in the central nervous system while the shorter form is expressed in the periphal nervous system (329). Two isoforms have also been seen in humans, but the specific functions of each have not been explored (330).  54  Figure 3.1. Splenic B cells and B cell lines express all three members of the Scribble/Lgl/Dlg complex RT-PCR using primers specific for mouse polarity protein genes was performed on cDNA extracted from embryonic mouse brain, WEHI-231 and A20 murine B lymphoma cells, and murine splenic B cells. Primers were designed to generate bands of approximately 200bp. For each panel, similar results were obtained in at least 2 experiments.  55  Figure 3.2. Splenic B cells and B cell lines express all three members of the Scribble/Lgl/Dlg complex Western blot of cell lysates (30 µg protein) from embryonic mouse brain, WEHI-231 and A20 murine B lymphoma cells, and murine splenic B cells were probed on separate blots with antibodies to either Scrib1, Lgl1, or Dlg1. For each panel, similar results were obtained in at least 2 independent experiments.  56  3.1.2. Changes in the subcellular localization of Scrib1 upon the binding of particulate antigens by B cells In T cells, Scrib1 localizes to the T cell:APC synapse for a short period of time before moving to the T cell uropod. Therefore, I asked whether a similar redistribution of the Scribble protein occurs when B cells bind a polarized stimulus, anti-Ig-coated beads, which serve as a model for a particulate antigen. I used immunofluorescence to visualize the subcellular distribution of Scrib1 at different times after adding anti-Ig beads to splenic B cells (Figure 3.3). F-actin was also imaged in order to visualize the F-actin-rich cup that forms when B cells bind anti-Ig-coated beads. In resting cells that were not mixed with anti-Ig-coated beads, Scrib1 was localized cortically around the plasma membrane of the cell. Within 5 min after contact with beads, Scrib1 is enriched at the site of cell:bead interaction. By 20-30 min, Scrib1 translocated first to the lateral parts of the cell, and finally to the back of the cell (Figure 3.3). Interestingly, it appears that Scrib1 disassociates from the cell membrane when it moves to the rear of the cell. 3.1.3. Anti-Ig-induced Scrib1 relocalization depends on Rap activation Because the Rap GTPases have been implicated in cell polarization, I asked whether Rap activation was required for the BCR-induced re-localization of Scribble in B cells that bind anti-Ig-coated beads. To test this, we made use of A20 B lymphoma cells that were stably transduced with vector encoding RapGAPII, a Rap-specific GAP protein that we, and others have used to selectively suppress the activation of Rap1 and Rap2 (104, 150, 212, 331). RapGAPII converts the active GTP-bound forms of Rap1 and Rap2 to the inactive GDP-bound forms, but does not affect other GTPases such as Ras (190), Rac1 (102), and RhoA (189). To address the role of Rap in BCR-induced Scrib1  57  Figure 3.3. Scrib1 localizes to the cell:bead interface early during conjugation, then later to the back of the cell Single confocal slice images of splenic B cells incubated with anti-Ig coated beads then fixed and stained for actin (Red) and Scrib1 (Green). Scale bars represent 10 µm. Representative images of cell:bead conjugates at different times after mixing cells and beads are shown. Similar results were obtained for at least 10 cells imaged for each time point in 2 independent experiments.  58  relocalization, I incubated vector control and RapGAPII-expressing A20 cells with antiIg coated beads, then fixed and stained them for Scrib1 and F-actin. As was the case for splenic B cells, Scrib1 accumulated at the site of cell:bead contact after about 5 min in the vector control cells. Approximately 10 min later, Scrib1 was seen at the sides of the cell, and after 30 min, Scrib1 was localized towards the back of the cell, with some of the Scribble appearing to dissociate from the plasma membrane. Strikingly, when Rap activation was blocked via the expression of RapGAPII, Scrib1 did not appear to translocate from its uniform initial cortical localization in resting cells (Figure 3.4). This suggests that Rap activation regulates the localization of the Scrib polarity protein complex and that this could be one mechanism by which Rap-GTP establishes cell polarity.  59  Figure 3.4. Scrib1 localization during cell:bead interactions is dependent on Rap activation Single confocal slice images of A20 cells stably transduced with pMSCV-RapGAPII or the empty pMSCV vector incubated with anti-Ig coated beads, then fixed and stained for actin (Red) and Scribble (Green). Scale bars represent 10 µm. Representative images of cell:bead conjugates at different times after mixing cells and beads are shown. Similar results were obtained for at least 10 cells imaged in each time point in 2 independent experiments.  60  3.2. Cofilin activation in B cells 3.2.1. Cofilin is phosphorylated upon chemokine stimulation in B and T cells B cell responses to chemokines or antigens often involve dramatic changes in cell shape. Stimulation with chemokines causes B cells to form distinct leading edges, with membrane protrusions at the front of the cell (332). Following encounter with membranebound antigens, B cells spread on the surface of the APC, eventually leading to formation of an immune synapse (133, 159). B cells also form actin-rich cups with particulate antigens (150). These processes require substantial changes in the cell cytoskeleton, which is dependent on the rapid turnover and remodeling of F-actin filaments. The Rap GTPases promote F-actin polymerization following B cell activation. Inhibiting Rap activation via RapGAPII-expression significantly reduces F-actin levels in phorbolester-stimulated B cells (212). Blocking Rap activation also prevents actin incorporation at the site of contact between B cells and anti-Ig-coated beads (S. Freeman and M. Gold, unpublished data) as well as the formation of actin-rich cups at the cell:bead interface (150). Furthermore, Rap activation is required for the depolymerization of F-actin filamentsthat occurs when B cells spread on immobilized anti-Ig (S. Freeman and M. Gold, unpublished data). These findings emphasize the importance of Rap activation in regulating actin turnover and remodeling in B cells, and as a result, their morphology. A key protein involved in F-actin turnover is the actin depolymerizing factor (ADF) family member cofilin. Cofilin binds to and severs F-actin filaments, contributing to the breakdown of exisiting filaments (292). In addition, cofilin-mediated F-actin cleavage generates barbed ends that act as nucleation sites for de novo branched actin  61  polymerization mediated by the Arp2/3 complex (293, 294). Thus cofilin plays an important role in regulating the turnover of F-actin filaments by both directly depolymerizing actin through its severing activity, as well as promoting the formation of new branched F-actin filaments by generating barbed ends following F-actin cleavage. Cofilin activity is regulated through phosphorylation at Ser3, which is part of its actin binding site. Phosphorylation at this residue blocks the ability of cofilin to bind to and sever F-actin filaments. Kinases such as LIMK phosphorylate and inactivate cofilin, whereas phosphatases such as SSH are responsible for dephosphorylating and activating cofilin (303, 311). Since Rap is strongly implicated in regulating actin dynamics, and because cofilin is a major factor in F-actin turnover, we hypothesized that Rap mediates cytoskeletal changes following B cell activation by regulating cofilin activation. To test this, we used B cell lines stably transduced with RapGAPII, a Rap-specific GAP that converts Rap1 and Rap2 to their inactive GDP-bound forms, and assessed the activation state of cofilin following chemokine treatment and BCR clustering. To assess cofilin activation, we made use of antibodies specific for the phosporylated, inactive form of cofilin. To determine the effect of chemokine signaling on cofilin activity, splenic B cells from C57BL/6 mice were incubated with either CXCL12 (SDF-1) or CXCL13 (BLC). Within 5 minutes of adding either chemokine, the levels of the inactive, phosphorylated cofilin increased substantially (Figures 3.5A and B). This CXCL12-induced increase in cofilin phosphorylation was also observed in the A20 B-lymphoma cell line (Figures 3.6A and B) as well as in splenic T cells and the Jurkat human T cell line (Figures 3.5C and D).  62  Figure 3.5. Cofilin is phosphorylated upon CXCL12 stimulation in splenic B cells, splenic T cells and the Jurkat T cell line Primary splenic B cells were incubated with 100 ng/mL CXCL12 (A) or CXCL13 (B) for 1-30 min. Splenic T cells (C) and Jurkat T cells (D) were incubated with 100 ng/mL CXCL12 for 1-30 min. Mean values for P-cofilin, normalized to total cofilin levels for the same sample, are indicated below each lane and P-cofilin level at time 0 was defined as 1.0. For all panels, the data shown are representative of three independent experiments. (E) ROCK is important for the inactivation of cofilin. Splenic B cells were treated with either DMSO or 20 µM of the ROCK inhibitor Y-27362 for 20 min then administered CXCL12 for the indicated times. Lysates were probed for the inactive phosphorylated form of cofilin. Mean values for P-cofilin, normalized to total cofilin levels for the same sample, are indicated below each lane and P-cofilin level at time 0 was defined as 1.0.  63  Chemokine-induced increases in cofilin phosphorylation in T cells have been reported previously (324). Total cofilin levels remained unchanged, suggesting an overall drop in actin severing activity after chemokine stimulation. This could reflect localized stabilization of the actin cytoskeleton, perhaps at the rear of the cell where forces for forward motility are generated. The RhoA-activated kinase (ROCK) phosphorylates and activates LIMK in the COS-7 kidney cell line, ultimately resulting in the phosphorylation and inactivation of cofilin. To see whether this was the case in B cells, we treated splenic B cells with either the ROCK inhibitor Y-27362 or DMSO prior to incubation with CXCL12. I found that chemokinemediated induction of cofilin phosphorylation was blocked by treating cells with Y27362, suggesting that cofilin phosphorylation in B cells is mediated primarily by a ROCK-dependent pathway that presumably involves LIMK (Fig. 3.5E). 3.2.2. Rap activation is not required for in chemokine-induced cofilin phosphorylation Because Rap is important for chemokine-directed B and T cell migration, I asked whether it was required for chemokine-induced cofilin phosphorylation. Our lab has previously shown that both CXCL12 and CXCL13 stimulate Rap activation in B cells, including the A20 B-lymphoma cell line, and that these responses are completely suppressed in RapGAPII-expressing A20 cells (212). I found that preventing Rap activation via the expression of RapGAPII did not alter the kinetics or magnitude of CXCL12-induced cofilin phosphorylation, compared to the response seen in control cells transduced with the empty vector (Figures 3.6A and B).  64  Figure 3.6. Cofilin is phosphorylated upton CXCL12 stimulation in the A20 B cell line and this is not dependent on Rap activation (A) A20 cells stably transfected with control vector or pMSCV-RapGAPII were incubated with 100 ng/mL CXCL12 for 1-30 min. (B) Lysates from vector or pMSCV-RapGAPII A20 cells stimulated with CXCL12 were probed for phosphorylated LIMK. Data were quantified as in Figure 3.5 and in panels B and D are presented as the mean + SEM for three independent experiments. Results are based on three independent experiments.  65  LIMK is activated by phosphorylation on several residues including Thr508 (310) , and this active, phosphorylated form of LIMK phosphorylates cofilin. To see whether LIMK was activated after chemokine stimulation, I performed immunoblotting with antibodies specific for LIMK that is phosphorylated on Thr508. I found that LIMK did indeed become phosphorylated, and presumably activated, after treating A20 cells with CXCL12. The kinetics of CXCL12-induced LIMK phosphorylation was similar to that for cofilin, consistent with the idea that LIMK is responsible for CXCL12-induced phosphorylation of cofilin. Moreover, I found that CXCL-12 induced LIMK phosphorylation was not dependent on Rap activation, as this response was similar in vector control and RapGAPII-expressing A20 cells (Figure 3.6C and D). 3.2.3. BCR and TCR signaling promote the dephosphorylation of cofilin B and T cells scan the surface of APCs for antigens. The antigen receptor signaling that ensues after the binding of cognate antigen usually acts as a stop signal that abrogates chemokine receptor signaling so that the lymphocyte is retained at this site (333). At the same time, the lymphocyte forms immunological synapses with the APC bearing the cognate antigen and this promotes the activation of the lymphocyte. The cytoskeletal reorganization that occurs when lymphocytes form an immune synapse, or when B cells contact a particulate antigen and form an F-actin-rich cup, likely involves actin severing. Therefore I tested whether antigen receptor signaling activates cofilin by inducing its dephosphorylation, thereby reversing the chemokine-induced phosphorylation of cofilin. To compare the effects of BCR signaling and chemmokine signaling on cofilin phosphorylation, I stimulated A20 B-lymphoma cells with CXCL12 or with anti-Ig  66  antibodies as a surrogate antigen that can cluster the BCR. Unlike CXCL12, which increased cofilin phosphorylation, anti-Ig stimulation resulted in a sustained decrease in cofilin phosphorylation (Figure 3.7A). I then compared the effects of soluble anti-Ig, anti-Ig-coated beads that mimic a particulate antigen, and plate-bound anti-Ig antibodies to determine if cofilin dephosphorylation was differentially regulated by spatially uniform versus polarized engagement of the BCR. Plate-bound anti-Ig was used to mimic the presentation of antigen on the presence of an APC. Although this is an artificial system because platebound antigens are not mobile, unlike antigens displayed on the surface of a cell, such systems have widely been used to simulate cell:cell interactions. I found that soluble, bead-bound, and plate-bound anti-Ig antibodies all caused a significant decrease in phospho-cofilin levels compared to unstimulated cells (Figures 3.7B-E). Both soluble antigen and spatially restricted forms of antigen induced cofilin dephosphorylation to a similar extent. These results suggest that cofilin activation and F-actin severing are common sequels to BCR signaling and could be involved in BCR-induced cytoskeletal reorganization. To determine whether BCR-induced cofilin dephosphorylation was due to inactivation of LIMK, the kinase that likely phosphorylates cofilin, I used antibodies specific for the active form of LIMK, which is phosphorylated on Thr508. No change in the constitutive level of P-LIMK was observed after anti-Ig stimulation (see Figure 3.9D, left four lanes), even though P-cofilin levels declined. Thus, BCR signaling either inhibits other kinases that can phosphorylate cofilin or regulates cofilin phosphorylation by increasing the activity of cofilin phosphatases such as Slingshot (SSH). 67  Figure 3.7. Cofilin is dephosphorylated upon antigen receptor stimulation in splenic B cells and Jurkat T cells (A) A20 cells were stimulated with either anti-Ig or CXCL12 and lysates were probed for phospho-cofilin. (B-D) Splenic B cells were given soluble anti-Ig (B), anti-Ig-coated beads (C), or plated on anti-Ig (D) for the indicated times and lysates probed for phospho-cofilin. (E) Quantification of P-cofilin levels was done as in Figure 3.5. Results are based on two (t = 60’) or three (t = 0’, 5’, 15’, and 30’) independent experiments with each form of anti-Ig stimulus. * = p < 0.05 and ** = p < 0.01. Jurkat cells were treated with 5 µg/ml anti-CD3 plus 1 µg/ml anti-CD28 either in soluble (F) or plate-bound form (G).  68  Antigen receptor-induced cofilin dephosphorylation was also observed after treating Jurkat T cells with soluble or plate-bound anti-CD3 plus anti-CD28 (Figures 3.7F and G). Anti-CD3 clusters the TCR whereas anti-CD28 engages the main co-stimulatory receptor on T cells. Signaling from both these receptors is required for full T cell activation. Soluble anti-CD3/anti-CD28 caused transient cofilin dephosphorylation whereas platebound anti-CD3/anti-CD28, which may better mimic the presentation of Ags by APCs, caused sustained cofilin dephosphorylation (Fig. 3.7F and G). This result is consistent with previous work showing that cofilin-mediated F-actin severing is important for T cells to form immune synapses with antigen-bearing APCs (315). 3.2.4. Global decrease in P-cofilin following BCR stimulation Because cofilin dephosphorylation could be induced by particulate BCR ligands such as anti-Ig-coated beads, we were interested in whether the BCR-induced cofilin dephosphorylation occurred exclusively at the site of bead:cell contact, where the B cell reorganizes its actin cytoskeleton and forms F-actin-rich cups. To test this, I used fluorescence microscopy to visualize the pattern of cofilin phosphorylation in bead:cell conjugates (Figure 3.8). In cells that were not in contact with beads, phospho-cofilin was evenly distributed throughout the cell body, as well as cortically (Figure 3.8A). In contrast, phospho-cofilin levels were dramatically reduced throughout cells that formed F-actin-rich-cups after being incubated with anti-Ig-coated beads for 15 min (Figures 3.8B and C). Consistent with my Western blotting results, there was no change in the amount or localization of total cofilin after the binding of anti-Ig-coated beads (Figures 3.8B and C). Thus the loss of phospho-cofilin most likely represents dephosphorylation of cofilin, as opposed to its degradation. This loss of phospho-cofilin  69  Figure 3.8. Global decrease in phospho-cofilin in B cells encountering anti-Ig coated beads (A and B) Splenic B cells were incubated with anti-Ig coated beads and then stained for actin (red) and either phospho-cofilin (P-cofilin) or total cofilin (green). Scale bars represent 10 µm. Each panel shows a different representative image. (C) Quantification of the mean fluorescence intensity (arbitrary units generated by Olympus Fluoview 1.6 analysis software) of phospho-cofilin or total cofilin in splenic B cells that were in contact with anti-Ig coated beads, relative to control cells that were not in contact with beads. Bars indicate mean +/- SEM for 50 cells analyzed in each of three independent experiements. ** = p < 0.01.  70  was seen globally throughout the cell, and no distinct localization (e.g. at the bead:cell contact site) of activated/dephosphorylated cofilin was observed at these time points. 3.2.5. Cofilin dephosphorylation following antigen-receptor stimulation is dependent on Rap activation but does not involve changes in LIMK activity The ability of B cells to spread on plate-bound anti-Ig and to form F-actin-rich cups upon encountering antigens or anti-Ig coated beads is dependent on Rap activation. Because these morphological changes require reorganization of the actin cytoskeleton (150), I asked whether Rap activation was required for BCR-induced cofilin dephosphorylation. I found that blocking Rap activation via the expression of RapGAPII blocked the ability of soluble, bead-bound, and plate-bound anti-Ig to induce cofilin dephosphorylation at all time points examined (Figures 3.9A-C). I confirmed these findings using fluorescence microscopy. I observed a global decrease in phospho-cofilin levels in vector control A20 cells that had bound anti-Ig-coated beads, compared to cells that were not in contact with beads (Figures 3.10A). However, RapGAPII-expressing cells had similar levels of phospho-cofilin, regardless of whether they were in contact with beads or not (Figures 3.10B and C). To rule out the possibility that RapGAPII blocks antigen receptor-induced dephosphorylation of cofilin by interfering with processes other than Rap activation, we expressed the dominant negative Rap1N17 protein in the readily transfectable Jurkat T cell line as an alternative method of blocking Rap activation. To minimize the possibility that cells adapt to stable expression of Rap1N17, we analyzed the cells 48 hr after transient transfection. Similar to what is shown in Figure 3.7G, Jurkat cells exhibited a  71  Figure 3.9. Cofilin is dephosphorylated in cells stimulated through the BCR, and this is dependent on Rap activation (A-C) A20 cells stably transfected with control vector or pMSCV-RapGAPII were incubated with soluble (A), beadbound (B), or plate-bound (C) anti-Ig for the indicated periods. Representative blots from three independent experiments using each form of anti-Ig stimulation are shown. Quantification of P-cofilin was done as in Figure 3.5. Bars indicate mean and +/- SEM relative to the 0’ time point vector control. * = p < 0.05 compared to same timepoint in RapGAPII-expressing cells. (D) Lysates from vector control or pMSCV-RAPGAPII-expressing cells were probed for the active phosphorylated form of LIMK.  72  Figure 3.10. The global decrease in B cell phospho-cofilin following anti-Ig-coated bead stimulation is dependent on Rap activation (A and B) Vector or RapGAPII-expressing A20 cells were mixed with anti-Ig coated beads and stained for F-actin (red) and either phospho-cofilin or total cofilin (green). Scale bars represent 10 µm. White stars indicate the location of beads. (C) Quantification of the mean fluorescence intensity (arbitrary units generated by Fluoview software) of phospho-cofilin or total cofilin in splenic B cells that were in contact with anti-Ig coated beads, relative to control cells that were not in contact with beads. ** = p < 0.01.  73  substantial decrease in phospho-cofilin levels following co-stimulation with plate-bound anti-CD3 plus anti-CD28 (Figures 3.11A and B). Importantly, this TCR/CD28-induced cofilin dephosphorylation was completely blocked in Jurkat cells expressing Rap1N17 (Figures 3.11A and B). These findings support the idea that Rap activation is required for antigen receptor-induced dephosphorylation of cofilin. To test whether the Rap-dependent decrease in the levels of phospho-cofilin could reflect an inhibition of LIMK, the kinase that likely phosphorylates cofilin, we probed cell lysates with antibodies specific for the activated form of LIMK. I found that BCR clustering had no effect on the constitutive levels of LIMK phosphorylation in both A20/vector and A20/RapGAPII (Figure 3.9D). Thus, the BCR-induced decrease in cofilin phosphorylation is not due to inhibition of LIMK. 3.2.6. Integrin signaling does not alter cofilin phosphorylation We have previously shown that B cells spread when plated on immobilized antibodies to the LFA-1 integrin and that antibody-induced clustering of LFA-1 initiates signals that activate Pyk2 and FAK, kinases that regulate cell morphology (331). Both this integrinmediated cell spreading and Pyk2/FAK phosphorylation are dependent on Rap activation (150, 334). Therefore, I asked whether the spreading of B cells on integrin-coated wells induced Rap-dependent cofilin dephosphorylation, similar to what happens when B cells spread on immobilized anti-Ig antibodies (see Figures 3.7D and E). I found that integrin clustering alone did not cause a significant alteration in cofilin phosphorylation (Figure 3.12). Thus cofilin dephosphorylation and activation is associated with BCR-induced spreading but not integrin-induced spreading.  74  Figure 3.11. Cofilin is dephosphorylated in cells stimulated through the TCR and CD28, and this is dependent on Rap activation Jurkat cells transiently transfected with control vector or pcDNA3.1-Rap1N17 were incubated with platebound anti-CD3 and anti-CD28 for the indicated periods. Quantification of blots for phospho-cofilin in vector control or Rap1N17-expressing Jurkat cells, standardized to the 0’ time point controls was done as in Figure 3.5. Results are from three independent experiments. Densitometry was performed using ImageJ software. * = p < 0.05.  75  Figure 3.12. Integrin activation does not affect cofilin phosphorylation A20 cells transduced with control vector or pMSCV-RapGAPII were plated on immobilized anti-LFA-1 and lysates were probed for phospho-cofilin by Western blotting. Results are representative of two independent experiments.  76  3.2.7. Actin polymerization is necessary and sufficient for cofilin phosphorylation Polymerized F-actin is required for the enzymatic activity of the cofilin phosphatase SSH, and for its ability to dephosphorylate cofilin (321). Thus SSH acts as a sensor of the amount of F-actin within the cell. In vitro studies have shown that SSH activity is increased ten-fold in the presence of polymerized F-actin (319, 321). Because Rap activation is required for BCR-induced cofilin dephosphorylation, and Rap-GTP promotes actin polymerization (212), we hypothesized that BCR-induced cofilin dephosphorylation is mediated by Rap-dependent actin polymerization To test this, vector control and RapGAPII-expressing A20 cells were treated with jasplakinolide, a compound that binds to and stabilizes filamentous actin, preventing their disassembly (335). A20 cells treated with jasplakinolide displayed a complete loss of P-cofilin (Figure 3.13A), suggesting that SSH was highly activated in these cells. Interestingly, blocking Rap activation by expressing RapGAPII did not prevent jasplakinolide-induced cofilin dephosphorylation, regardless of whether or not the cells were stimulated with anti-Ig antibodies. This suggests that F-actin acts downstream of Rap activation, supporting our proposed pathway of BCR  Rap-GTP  F-actin  activated SSH  cofilin dephosphorylation/activation. Consistent with this idea, inhibiting actin polymerization by treating A20 cells with latrunculin A for 20 min, which results in a complete loss of F-actin within these cells, caused a large increase in cofilin phosphorylation that could not be reversed by BCR clustering. (Figure 3.13B). Again, this effect was independent of Rap activation. Thus an intact F-actin cytoskeleton is required for BCR-induced cofilin dephoshorylation, presumably reflecting an F-actin requirement for the activation SSH (321). Thus Rap  77  Figure 3.13. Actin polymerization is necessary and sufficient for cofilin activation in A20 cells (A) Vector or pMSCV-RapGAPII-expressing A20 cells were treated with jasplakinolide then stimulated with soluble anti-Ig. Lysates were probed for phospho-cofilin by Western blotting. (B) Vector or pMSCVRapGAPII-expressing A20 cells were treated with latrunculin A then stimulated with soluble anti-Ig. Lysates were probed for phospho-cofilin by Western blotting.  78  may modulate cofilin dephosphorylation and activation primarily through its ability to promote the formation of F-actin, which is required for activation of the SSH phosphatase that dephosphorylates cofilin. 3.2.8. Antigen receptor signaling overrides chemokine-induced cofilin phosphorylation Because antigen encounter marks the endpoint of migration, I hypothesized that antigen receptor signaling would reverse and overcome chemokine-induced cofilin phosphorylation. Specifically, I proposed that antigen receptor engagement would terminate chemokine-induced increases in cofilin phosphorylation and cause a Rapdependent decrease in cofilin phosphorylation to a level below that in unstimulated cells, even in the continued presence of chemokine. To test this, I treated vector control or RapGAPII-expressing A20 cells with CXCL12 for 15 min, then subsequently clustered the BCR with anti-Ig antibodies. In vector control cells, CXCL12 stimulation increased phospho-cofilin levels (Figure 3.14), as seen previously. When PBS was added to the cells after an initial 15 min treatment with CXCL12, phospho-cofilin levels fell slightly. However, adding anti-Ig antibodies for 15 min after an initial 15 min CXCL12 stimulation caused phospho-cofilin levels to drop dramatically, to a level considerably lower than in unstimulated cells (Figure 3.14). This effect of anti-Ig appeared to be largely dependent on Rap activation since the anti-Ig-induced drop in phospho-cofilin levels was much smaller in RapGAPII-expressing A20 cells than in the control cells (Figure 3.14). This finding reiterates the importance of Rap activation for BCR-induced cofilin dephosphorylation. Thus, antigen binding appears to reverse effects of  79  Figure 3.14. Antigen receptor stimulation overrides chemokine-induced cofilin phosphorylation (A-B) Vector control (A) or RapGAPII-expressing A20 cells (B) were treated with CXCL12 for 15 min before the addition of either PBS or soluble anti-Ig for an additional 15 min. Lysates were assessed for phospho-cofilin levels by Western blotting. (C) Quantification of blots from 2 independent experiments. Bars indicate mean and +/- SD relative to time 0.  80  chemokines on cofilin phosphorylation, consistent with the observation that antigen receptor signaling acts as a stop signal that terminates chemokine-induced migration.  81  4. Discussion 4.1. Rap activation regulates the localization of the Scribble, a member of an evolutionarily-conserved polarity complex I found that mRNA encoding members of the Par, Crb, and Scrib signaling complexes were present in both splenic B cells and B cell lines. However, not every component of each complex was found in all cell types. Notably, Pals1 and Crb from the Crb complex were not detected in the A20 and WEHI-231 B cell lines. Similarly, Par6 of the Par complex was not detected in A20 or WEHI-231 cells. Since A20 and WEHI-231 cells polarize dramatically upon chemokine stimulation and can form actin-rich cups with antigen-coated beads, this finding suggests that the Crb and Par complexes may not be important for B cell polarity. Conversely, I found that both splenic B cells, as well as the A20 and WEHI-231 B cell lines expressed every member of the Scrib complex, namely Scrib1, Dlg, and Lgl. It has yet to be established whether the Scrib complex is important for B cell polarity. Now that we have established that Rap is important for regulating the subcellular localization of Scrib1, we hope to determine whether Scrib1 plays a role in B cell polarization events. Transfecting B cell lines with a dominant-negative form of Scrib1 missing its leucine-rich repeat region (and unable to localize to the cell membrane (336)) or knocking down Scrib1 expression using siRNA directed against the Scrib1 mRNA would allow us to assess the effect of decreased Scrib1 levels on the ability of B cells to form actin-rich cups with antigen-coated beads or to polarize and migrate in response to chemokine stimulation.  82  In murine T cells, members of the Scribble complex are localized to the uropod during cell migration and to the immunological synapse during initial synapse formation. (277). At the same time, the Par complex associates with Cdc42 at the front of the cells and is important for pseudopod formation and immune synapse formation (208) . In epithelial cells, the Par and Scrib complexes mutually exclude each other in order to maintain cell polarity and this may explain how Scrib is localized to the uropod (278, 279). Thus one can speculate that Rap-GTP at the immune synapse recruits the Par complex and that the localization of Par complexes at the synapse drives the movement of Scrib complexes to the rear of the cell, which becomes the uropod. How Par complexes direct the relocalization of the Scribble complex is not known, but it likely depends on the reorganization of the cytoskeleton that occurs as cell polarity is set up. Once localized to the rear of the cell, Scrib1 may contribute to the formation of the uropod, perhaps by regulating the activation of RhoA. Myosin II assembly and actomyosin contraction are necessary for uropod formation in T cells, and these processes are dependent on RhoA activity (337). T cells fail to generate uropods in response to CXCL12 when Scrib1 is knocked down using siRNA (277), suggesting that Scrib1 plays an important role in regulating RhoA-mediated uropod formation. We can test this hypothesis by knocking down Scrib1 expression in B cells and determining whether uropod formation is blocked and whether RhoA activation at the rear of the cell is blocked. In B cells, RhoA is important for B cell integrin activation following chemokine stimulation, but the localization of RhoA-GTP in B cells has not been examined (338). Scrib1 may regulate RhoA activation through the Scrib complex protein Dlg1, which binds to the RhoA GEF Net1 and prevents its degradation (339).  83  The Scribble complex may also regulate cell polarity by acting via the ezrin-radixinmoesin (ERM) proteins, peripheral membrane proteins that link the transmembrane proteins to the actin cytoskeleton. The Dlg component of the Scrib complex binds ERM proteins and ERM proteins interact with RhoA and Rac1 to promote uropod formation in migrating lymphocytes (98). This suggests that Scrib1 may regulate cell polarity by mediating the activation of Rho GTPases. The formation of actin-rich cups by B cells is in many ways analogous to the formation of immune synapses. By fluorescence imaging, I found that Scrib1 localized at the cortical cell membrane in resting B cells. Upon encountering antigen-coated latex beads, a model for particulate antigen, B cells form actin-rich cups at the sites of contact with beads, and in our studies, Scrib1 appeared to disassociate from the plasma membrane and localized near the sites of cup formation. After about 10 min, Scrib1 moved laterally to one side of the cell, and finally to the rear of the cell after about 30 min. Because Scrib1 translocation does not precede cup formation, and continues while the cup is still intact, Scrib1 does not appear to affect the cup itself but may potentially play a role in signaling events following the initiation of cup formation. It remains to be determined whether there are unique signaling events at the rear of the cell (distal to the site of bead binding) or whether the relocalization of the Scribble complex to the rear of the cell allows it to remove negative regulators of signaling from the contact site. The removal of negative regulators may facilitate enhanced and prolonged signaling at the contact site, perhaps analogous to the way that PTEN relocalizes to the rear of migrating leukocytes, allowing the development of a steep intracellular gradient of PI3K signaling. Futhermore, in CD8+ T cells, knocking down Scrib1 expression using shRNA dramatically reduces the number  84  of conjugates observed between cells and antigen-coated beads after 10 min (277), suggesting that Scrib1 could play a role in maintaining a stable immunological synapse. In our study, blocking Rap activation by expressing RapGAPII prevented the normal Scrib1 pattern of movement within the B cell following antigen encounter. Scrib1 remained at the cortical cell membrane in RapGAPII-expressing B cells following bead contact, suggesting that Rap regulates Scrib1 translocation from the cell membrane after cell activation. While Rap has been clearly implicated in cell polarization and migration, how it regulates these processes has not been well investigated. In T cells, Rap1 associates with the Par polarity complex at the leading edge of cells and activates Cdc42 (208). Cdc42 then activates the two members of the atypical protein kinase C family, PKCζ and PKCλ/ι, part of the Par complex, resulting in recruitment the Rac effector Tiam1 (249). We showed that Rap activation is required for transient Scrib1 translocation from the cell membrane to the site of antigen contact then to the back of the cell. Since Rap is found at the front of polarized cells and not at the rear following cell activation (208), the question remains how Rap regulates Scrib1 translocalization from the cell membrane, to the site of cup formation, and finally to the back of the cell. One possibility is that Rap-dependent translocation of Scrib1 to the back of anti-Ig stimulated A20 cells is due to the mutual repulsion between the Scrib and Par complexes that has been described in epithelial cells. Blocking Rap activation could inhibit activation of the Par complex at the prospective leading edge of the cell, which would disrupt cell polarization events as a whole.  85  The early translocation pattern of the MTOC in activated CD8+ T cells is similar to what we observed with Scrib1 following B cell activation, suggesting that Scribble either associates with the MTOC and regulates its translocation, or vice versa. The centrosome is the main microtubule organizing centre (MTOC) in polarized cells. Lymphocytes that have encountered antigen reorient the MTOC and the Golgi is essential for proper positioning of the cell protein secretion apparatus towards the leading edge (340). Previous studies have shown that in CD8+ T cells, the MTOC immediately moves to the site of antigen contact following TCR signaling. Following arrival at the contact site, the MTOC then oscillates laterally towards the sides of the cell (341). MTOC movement in CD8+ T cells has only been defined several minutes post-encounter, however, and its localization later on during stimulation has not been well described. Interestingly, during T cell migration, the MTOC is found in the uropod while actin accumulates at the leading edge, allowing for greater cell deformability at the back of the cell (342-344). To test whether Scrib1 follows the localization pattern of the MTOC, we can disrupt microtubules in B cells by treatment with colchicine and seeing whether Scrib1 fails to translocate following BCR stimulation. Since B cells proliferate following antigen encounter, Scrib1 localization towards the back of the cell may be involved in initiating cell division and cell differentiation. A recent study in CD8+ T cells showed that following antigen encounter and TCR signaling, specific polarity proteins are asymmetrically segregated into distinct proximal and distal portions of the cell (345). The cell markers CD3 and CD8 are proximal to the site of encounter with an infected cell, and PKC zeta is found at the distal end of the cell.  86  Following this redistribution, cell division occurs and results in the generation of a synapse-proximal cell having characteristics of an effector cell, and the synapse distal cell possessing traits of a memory cell. Thus, the relocalization of Scrib1 to the rear of an activated B cell may play a role in cell differentiation and division. When analyzing bead-stimulated B cells in the future, it would be interesting to see whether the beaddistal daughter B cell becomes a memory cell, and if so, whether B cell-specific Scrib1 knockout or knockdown impairs memory cell formation. In Drosophila, loss of Scrib1, Lgl or Dlg leads to hyperproliferation of imaginal disc cells and brain cells, suggesting that Scrib1 is important for suppressing cell growth (274, 346). This overgrowth can be rescued by reintroducing Scrib1 into Scrib1-deficient mutants, suggesting that Scribble is involved in inhibiting proliferation (273). Consistent with this, overexpression of Dlg in 3T3 fibroblasts leads to an arrest of cells at the G1 phase, inhibiting cell division (347, 348). Because lymphocytes proliferate following antigen stimulation, translocation of Scrib1 to the rear of the cell may prevent its growth inhibitory functions. Another interesting future experiment would be to track the localization of Rap-GTP during B cell stimulation and examine whether its translocation pattern matches that of Scrib1. This would give clues as to whether Rap associates with Scrib1 during B cell activation. We can also knock down the expression of Rap effectors such as RapL (which binds to both microtubules as well as Rap1 (349)) to tease out the specific mechanism by which Rap controls Scrib1 localization.  87  As I have shown, the Scrib complex is expressed in splenic B cells as well as the A20 and WEHI B cell lines, and that its pattern of translocation following B cell encounter with antigen-coated beads is regulated by the Rap GTPases. Whether Scrib1 activity is important for B cell polarity remains to be established. Future studies should include knocking down Scrib1 using shRNA and examining how decreased levels of Scrib1 affect cell polarity-dependent events such as cup formation with antigen-coated beads, migration in response to chemokines, and the formation of bona fide immune synapses between B cells and antigen-presenting cells or planar lipid bilayers containing antigens and integrin ligands. To summarize, Rap activation is important for normal Scribble translocation in response to BCR engagement. Because defects in components of the Scrib1 complex are found in a large number of cancers, proper regulation of Scrib1 may be crucial for normal B cell function and limiting excessive proliferation that can lead to monogenic transformation. 4.2. BCR-induced cofilin activation is dependent on Rap activation In this study, I showed that B cells stimulated through the BCR with either soluble, particulate, or plate-bound anti-Ig antibodies exhibited a decrease in the levels of phosphorylated cofilin, suggesting that cofilin becomes activated following BCR clustering. A similar decrease in phospho-cofilin levels was detected in T cells costimulated with anti-CD3 and anti-CD28 antibodies. Unlike the response to chemokines, antigen receptor-mediated cofilin dephosphorylation was dependent on Rap activation. Blocking Rap activation by expressing RapGAPII in A20 cells or by expressing  88  Rap1N17 in Jurkat cells completely inhibited cofilin dephosphorylation in response to antigen receptor stimulation. While Rap’s role in cofilin activation has not been established, these findings are perhaps not surprising, since Rap has long been known to be important for cell cytoskeleton remodeling and actin dynamics. In B cells, Rap is required for cell adhesion, spreading, synapse formation, and migration (102, 104, 150). All of these processes require a significant and rapid change in cell morphology. As of now, there are no well-established links between Rap activity and cofilin activation. However, since I showed that the levels of phosphorylated (and presumably activated) LIMK did not change in response to BCR engagement in A20 cells, the decrease in phospho-cofilin levels following antigen receptor signaling could either be due to inactivation of another cofilin kinase, or the increased activity of a cofilin phosphatase such as SSH. Since LIMK and SSH are the only known direct regulators of cofilin phosphoryation that are present in all cell types, it is more likely that Rap somehow controls SSH activity (or its access to cofilin) following antigen receptor signaling and that this results in the decrease in phospho-cofilin levels. SSH activity is inhibited when it is phosphorylated. Phosphorylation of SSH allows 14-33 proteins to bind SSH and sequester it in the cytoplasm, preventing it from acting on cofilin. Thus Rap could promote the dephosphorylation of SSH, facilitating its release from 14-3-3 proteins and promoting SSH-mediated cofilin dephosphorylation (activation). In order to test this idea, our lab will examine the activation (dephosphorylation) of SSH following antigen receptor signaling, and correlate this with cofilin activation (dephosphorylation). This can be done using a SSH activation assay described by Mizuno 89  et al. (350). If SSH activity increases following antigen receptor signaling, as we suspect, we can then determine whether inhibiting Rap activation by RapGAPII expression results in blocking SSH activation. The next question then would be how Rap could regulate SSH activity. A common link between the two proteins is filamentous actin (F-actin). Rap activation leads to increased F-actin levels in B cells, as phorbol 12-myristate 13-acetate (PMA)-induced actin polymerization in A20 cells is significantly reduced when Rap activation is blocked by expressing RapGAPII (102). Additionally, SSH activity in vitro is increased 10-fold when F-actin is present (321). We showed that F-actin is required for cofilin dephosphorylation (an indirect readout of SSH activity) in B cells. Stabilizing F-actin filaments by treating A20 cells with jasplakinolide was sufficient to cause a complete loss of cofilin phosphorylation. Conversely, depolymerizing cellular F-actin by treating A20 cells with latrunculin A led to a significant increase in the inactive, phosphorylated form of cofilin and prevented anti-Ig-induced cofilin dephosphorylation. These results are consistent with a pathway in which BCR-induced Rap activation leads to actin polymerization, and the resulting F-actin assembly promotes the release of SSH from 14-3-3 proteins (presumably through the activation of a SSH phosphatase), such that SSH can then dephosphorylate and activate cofilin (Figure 4.1). Our future goal is to determine the mechanism by which this may occur. Because cofilin plays a central role in cytoskeletal reorganization, any Rap effector involved in actin polymerization could also be a regulator of cofilin. AF-6 binds directly to the actin 90  Figure 4.1. Proposed pathway linking BCR signaling to cofilin activation BCR stimulation leads to Rap activation, which promotes F-actin polymerization (known). Localized Factin assembly activates a SSH phosphatase, promoting the release of SSH from 14-3-3. The released SSH could then bind F-actin, which enhances its activity, allowing it to dephosphorylate and activate nearby cofilin molecules. Chemokine receptor-mediated cofilin phosphorylation is not regulated by Rap.  91  cytoskeleton and has been known to interact with profilin (197), which catalyzes the exchange of GDP to GTP on actin monomers, priming them for polymerization onto growing fibers (351). Profilin acts synergistically with cofilin to increase the rate of actin turnover, specifically the rapid barbed end growth of F-actin filaments (352). Furthermore, the Rap effector RIAM is capable of binding profilin as well as the Ena/VASP proteins (201), which regulate the actin cytoskeleton by preventing the capping of barbed ends on growing filaments, promoting their elongation (353). Thus, Rap-regulated assembly of new actin filaments through profilin and Ena/VASP activation, in conjunction with cofilin-mediated severing of existing filaments may be responsible for the dynamic turnover of the cell cytoskeleton and rapid changes in morphology observed in activated B cells. 4.3. Chemokine receptor signaling increases cofilin phosphorylation in a Rapindependent manner Following chemokine stimulation, I found that cofilin was phosphorylated, and presumably inactivated, in splenic B and T cells, the A20 and WEHI-231 B cell lines, and the Jurkat T cell line. This was accompanied by increased phosphorylation and presumably activation of LIMK, the kinase that phosphorylates cofilin. Morevoer, we found that the RhoA-activated kinase ROCK was important for LIMK activation following CXCL12 treatment. Although Rap activation is important for chemokineinduced B cell migration, blocking Rap activation had no effect on chemokine-mediated cofilin phosphorylation, at least in the A20 B cell line. Although Rap-GTP appears not to participate in the phosphorylation-dependent inactivation of cofilin in response to chemokines, it is critical for B cells to migrate 92  towards a variety of chemoattractants, including CXCL12, CXCL13, and S1P (102, 104). Rap-dependent cofilin activation and actin severing may be required for the formation of a leading edge, which requires cytoskeletal remodeling at the front of the cell (354). Thus, one possibility is that cofilin is activated at the leading edge of a chemokinestimulated cell, but inactivated at the rear of the cell such that Western blotting shows an overall increased in cofilin phosphorylation. Consistent with this idea, the active nonphosphorylated form of cofilin is found at the leading edge of CXCL12-stimulated Jurkat T cells, but not at the midbody or uropod (277). If the active form of cofilin exhibits a polarized distribution, then localized Rap-mediated cofilin dephosphorylation and activation could play a role in lymphocyte migration, despite an overall increase in the amount of the inactive phosphorylated form of cofilin. Although Rap-dependent cofilin activation may be important for leading edge dynamics, Rap-independent inactivation of cofilin may also be important for cell polarization and migration, by retaining F-actin networks at the rear of the cell, which are used by myosin II to generate contractile forces for amoeboid activity. Myosin-IIA-dependent contraction of actin stress fibers is a major mode of lymphocyte motility (101), and cofilin inactivation may be necessary for RhoA-mediated formation of actin stress fibers, and for Myosin-mediated contraction at the back and sides of cells during migration. Rap does not appear to affect LIMK activation following chemokine treatment, but it is important for Myosin-IIA activity in Dictyostelium (246). Thus it could be Rap  Myosin IIA and RhoA activation/cofilin inactivation  stress fiber formation that allows acto-myosinbased contractility associated with lymphocyte motility.  93  From immunofluorescence imaging, we determined that when B cells encounter particulate antigen, there is cofilin dephosphorylation throughout the entire cell, and not specifically at a particular region. As mentioned earlier, active cofilin localizes only to the leading edge in migrating Jurkat cells (277). However, a polarized distribution of phospho-cofilin was not observed in our antigen-stimulated B cells. This may not necessarily indicate that cofilin is activated throughout the cell. Van Rheenen et al. (355) have recently shown that cofilin bound at cell membrane can be dephosphorylated, yet remains unable to cleave actin. Cofilin must first be released from the membrane, presumably through cleavage of PIP2. This represents an additional level of control on cofilin action. Thus cofilin may be dephosphorylated throughout the cell but only able to cleave actin where localized signaling, perhaps PLC-mediated cleavage of PIP2, releases it from the membrane. Such sites would include the immune synapse and the site of bead contact, where cytoskeletal remodeling is required. Antigen receptor signaling is a stop signal that overcomes chemokine-induced migration. This response allows lymphocytes to remain in one location once they have encountered antigen and facilitates their activation (356). Thus, I hypothesized that BCR-induced cofilin dephosphorylation would overcome chemokine-induced cofilin phosphorylation. Indeed, we showed that cofilin inactivation brought on by chemokine signaling can be arrested and reversed following sequential stimulation with antigen. This suggests that antigen encounter can override chemokine induced signaling and may serve as the stop point for chemotaxis. Hence, cofilin may act as a molecular switch that gets turned off during migration and then turned on to initiate cytoskeletal remodeling upon encounter with antigen. 94  Many questions arise from these studies. First, why does Rap activation not cause cofilin inactivation in B cells stimulated with chemokines? Rap may control only one arm of cofilin regulation, mainly its activation through SSH. Presumably, cells require some level of cytoskeletal remodeling in order to chemotax, despite the overall decrease in cofilin activation. If Rap promotes localized cofilin activation in chemokine-stimulated cells, this could could explain why RapGAPII cells are impaired in their migration, even though the overall levels of phosphorylated, inactive cofilin are increased. To explore this, we will need to visualize the localization of activated cofilin in B cells treated with chemokine, which we have only done with B cells incubated with anti-Ig-coated beads. Next, how does Rap regulate cofilin activation? It is likely through regulation of SSH activation but this has yet to be determined. We have shown an indirect link, as polymerized F-actin is important for cofilin activation in A20 cells and it has been previously found that Rap influences levels of cellular F-actin and that polymerized Factin is important for SSH activity. As mentioned earlier, we plan to assess SSH activation levels following antigen receptor stimulation in B and T cells and then test whether Rap activation is important for this process. If Rap does indeed activate SSH, we plan to elucidate the Rap effectors involved for SSH regulation. AF-6, Tiam1 and Vav2 are potential candidates, based on their functions and their close association with the cell cytoskeleton and polarization. Studies using siRNA to knock down these proteins and assessing the effects on SSH activation levels would accomplish this purpose.  95  Finally, although we have shown that Rap is important cofilin activation in B and T cells, we have not yet shown that cofilin plays a role in B and T cell cytoskeletal dynamics, although it is extremely likely based on studies in leukocytes such as neutrophils (357). We can test this by expressing a dominant-negative form of SSH (319), by using cellpermeable small peptides that bind to actin and therefore prevent cofilin-mediated actin cleavage (315), or by using siRNA against SSH or cofilin. All of these approaches would prevent cofilin dephosphorylation and reduce cofilin-mediated actin severing. We can then test whether this impairs cell migration, adhesion, and synapse formation in B and T cells. In summary, I have found that Rap activation is important for the dephosphorylation and activation of cofilin in B and T cells following antigen receptor stimulation. Because cofilin plays a major role in cell cytoskeletal dynamics, this finding may form the basis for new insights into how the the Rap GTPases regulate changes in the cytoskeleton.  96  References 1. 2. 3. 4. 5. 6. 7.  8. 9. 10. 11.  12. 13. 14. 15. 16.  Gallo, R. L., and V. Nizet. 2008. Innate barriers against infection and associated disorders. Drug Discov Today Dis Mech 5:145. Chaplin, D. D. 2003. 1. Overview of the immune response. J Allergy Clin Immunol 111:S442. Hayday, A. C., and J. Spencer. 2009. Barrier immunity. Semin Immunol 21:99. Aderem, A. 2001. Role of Toll-like receptors in inflammatory response in macrophages. Crit Care Med 29:S16. Gregory, S. H., and E. J. Wing. 2002. Neutrophil-Kupffer cell interaction: a critical component of host defenses to systemic bacterial infections. J Leukoc Biol 72:239. Cerwenka, A., and L. L. Lanier. 2001. Natural killer cells, viruses and cancer. Nat Rev Immunol 1:41. Hume, D. A., D. M. Underhill, M. J. Sweet, A. O. Ozinsky, F. Y. Liew, and A. Aderem. 2001. Macrophages exposed continuously to lipopolysaccharide and other agonists that act via toll-like receptors exhibit a sustained and additive activation state. BMC Immunol 2:11. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu Rev Immunol 20:197. Anderson, K. V. 2000. Toll signaling pathways in the innate immune response. Curr Opin Immunol 12:13. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413:732. Dalpke, A., J. Frank, M. Peter, and K. Heeg. 2006. Activation of toll-like receptor 9 by DNA from different bacterial species. Infect Immun 74:940. Ramos, H. C., M. Rumbo, and J. C. Sirard. 2004. Bacterial flagellins: mediators of pathogenicity and host immune responses in mucosa. Trends Microbiol 12:509. Brossart, P., and M. J. Bevan. 1997. Presentation of exogenous protein antigens on major histocompatibility complex class I molecules by dendritic cells: pathway of presentation and regulation by cytokines. Blood 90:1594. Toujas, L., J. G. Delcros, E. Diez, N. Gervois, G. Semana, G. Corradin, and F. Jotereau. 1997. Human monocyte-derived macrophages and dendritic cells are comparably effective in vitro in presenting HLA class I-restricted exogenous peptides. Immunology 91:635.  97  17. 18. 19. 20. 21. 22.  23. 24.  25. 26. 27. 28. 29.  30. 31. 32.  Svensson, M., B. Stockinger, and M. J. Wick. 1997. Bone marrow-derived dendritic cells can process bacteria for MHC-I and MHC-II presentation to T cells. J Immunol 158:4229. Roitt, I. M., M. F. Greaves, G. Torrigiani, J. Brostoff, and J. H. Playfair. 1969. The cellular basis of immunological responses. A synthesis of some current views. Lancet 2:367. Cyster, J. G. 2005. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu Rev Immunol 23:127. von Boehmer, H. 1997. Aspects of lymphocyte developmental biology. Immunol Today 18:260. Burton, D. R. 2002. Antibodies, viruses and vaccines. Nat Rev Immunol 2:706. Winner, L., 3rd, J. Mack, R. Weltzin, J. J. Mekalanos, J. P. Kraehenbuhl, and M. R. Neutra. 1991. New model for analysis of mucosal immunity: intestinal secretion of specific monoclonal immunoglobulin A from hybridoma tumors protects against Vibrio cholerae infection. Infect Immun 59:977. Michetti, P., M. J. Mahan, J. M. Slauch, J. J. Mekalanos, and M. R. Neutra. 1992. Monoclonal secretory immunoglobulin A protects mice against oral challenge with the invasive pathogen Salmonella typhimurium. Infect Immun 60:1786. Peachman, K. K., M. Rao, C. R. Alving, R. Burge, S. H. Leppla, V. B. Rao, and G. R. Matyas. 2006. Correlation between lethal toxin-neutralizing antibody titers and protection from intranasal challenge with Bacillus anthracis Ames strain spores in mice after transcutaneous immunization with recombinant anthrax protective antigen. Infect Immun 74:794. Pirro, F., L. H. Wieler, K. Failing, R. Bauerfeind, and G. Baljer. 1995. Neutralizing antibodies against Shiga-like toxins from Escherichia coli in colostra and sera of cattle. Vet Microbiol 43:131. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu Rev Immunol 19:275. Raff, H. V., D. Devereux, W. Shuford, D. Abbott-Brown, and G. Maloney. 1988. Human monoclonal antibody with protective activity for Escherichia coli K1 and Neisseria meningitidis group B infections. J Infect Dis 157:118. McKinlay, A. W., A. Young, R. I. Russell, and C. G. Gemmell. 1993. Opsonic requirements of Helicobacter pylori. J Med Microbiol 38:209. Zlatarova, A. S., M. Rouseva, L. T. Roumenina, M. Gadjeva, M. Kolev, I. Dobrev, N. Olova, R. Ghai, J. C. Jensenius, K. B. Reid, U. Kishore, and M. S. Kojouharova. 2006. Existence of different but overlapping IgG- and IgM-binding sites on the globular domain of human C1q. Biochemistry 45:9979. Frank, M. M., and L. F. Fries. 1991. The role of complement in inflammation and phagocytosis. Immunol Today 12:322. Norvell, A., and J. G. Monroe. 1996. Acquisition of surface IgD fails to protect from tolerance-induction. Both surface IgM- and surface IgD-mediated signals induce apoptosis of immature murine B lymphocytes. J Immunol 156:1328. Allman, D. M., S. E. Ferguson, V. M. Lentz, and M. P. Cancro. 1993. Peripheral B cell maturation. II. Heat-stable antigen(hi) splenic B cells are an immature developmental intermediate in the production of long-lived marrow-derived B cells. J Immunol 151:4431.  98  33. 34.  35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48.  49. 50.  Melchers, F., A. Rolink, U. Grawunder, T. H. Winkler, H. Karasuyama, P. Ghia, and J. Andersson. 1995. Positive and negative selection events during B lymphopoiesis. Curr Opin Immunol 7:214. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, and R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J Exp Med 190:75. Reth, M. 1995. The B-cell antigen receptor complex and co-receptors. Immunol Today 16:310. Hardy, R. R., and K. Hayakawa. 2001. B cell development pathways. Annu Rev Immunol 19:595. Igarashi, H., S. C. Gregory, T. Yokota, N. Sakaguchi, and P. W. Kincade. 2002. Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow. Immunity 17:117. Melchers, F. 2005. The pre-B-cell receptor: selector of fitting immunoglobulin heavy chains for the B-cell repertoire. Nat Rev Immunol 5:578. Tonegawa, S. 1988. Nobel lecture in physiology or medicine--1987. Somatic generation of immune diversity. In Vitro Cell Dev Biol 24:253. Basu, M., M. V. Hegde, and M. J. Modak. 1983. Synthesis of compositionally unique DNA by terminal deoxynucleotidyl transferase. Biochem Biophys Res Commun 111:1105. Gauss, G. H., and M. R. Lieber. 1996. Mechanistic constraints on diversity in human V(D)J recombination. Mol Cell Biol 16:258. Nadel, B., and A. J. Feeney. 1995. Influence of coding-end sequence on codingend processing in V(D)J recombination. J Immunol 155:4322. Nadel, B., and A. J. Feeney. 1997. Nucleotide deletion and P addition in V(D)J recombination: a determinant role of the coding-end sequence. Mol Cell Biol 17:3768. Samuels, J., Y. S. Ng, C. Coupillaud, D. Paget, and E. Meffre. 2005. Human B cell tolerance and its failure in rheumatoid arthritis. Ann N Y Acad Sci 1062:116. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor editing: an approach by autoreactive B cells to escape tolerance. J Exp Med 177:999. Retter, M. W., and D. Nemazee. 1999. Receptor editing: genetic reprogramming of autoreactive lymphocytes. Cell Biochem Biophys 31:81. Lakkis, F. G., A. Arakelov, B. T. Konieczny, and Y. Inoue. 2000. Immunologic 'ignorance' of vascularized organ transplants in the absence of secondary lymphoid tissue. Nat Med 6:686. Rennert, P. D., P. S. Hochman, R. A. Flavell, D. D. Chaplin, S. Jayaraman, J. L. Browning, and Y. X. Fu. 2001. Essential role of lymph nodes in contact hypersensitivity revealed in lymphotoxin-alpha-deficient mice. J Exp Med 193:1227. Kim, C. H. 2005. The greater chemotactic network for lymphocyte trafficking: chemokines and beyond. Curr Opin Hematol 12:298. van Nierop, K., and C. de Groot. 2002. Human follicular dendritic cells: function, origin and development. Semin Immunol 14:251.  99  51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63.  64. 65.  66. 67.  Mellman, I., and R. M. Steinman. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell 106:255. Miyasaka, M., and T. Tanaka. 2004. Lymphocyte trafficking across high endothelial venules: dogmas and enigmas. Nat Rev Immunol 4:360. Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121. Rot, A., and U. H. von Andrian. 2004. Chemokines in innate and adaptive host defense: basic chemokinese grammar for immune cells. Annu Rev Immunol 22:891. Okada, T., V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and J. G. Cyster. 2002. Chemokine requirements for B cell entry to lymph nodes and Peyer's patches. J Exp Med 196:65. Butcher, E. C., M. Williams, K. Youngman, L. Rott, and M. Briskin. 1999. Lymphocyte trafficking and regional immunity. Adv Immunol 72:209. Kraal, G., and R. E. Mebius. 1997. High endothelial venules: lymphocyte traffic control and controlled traffic. Adv Immunol 65:347. Rosen, S. D. 2004. Ligands for L-selectin: homing, inflammation, and beyond. Annu Rev Immunol 22:129. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, and M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037. Ansel, K. M., V. N. Ngo, P. L. Hyman, S. A. Luther, R. Forster, J. D. Sedgwick, J. L. Browning, M. Lipp, and J. G. Cyster. 2000. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature 406:309. Ansel, K. M., R. B. Harris, and J. G. Cyster. 2002. CXCL13 is required for B1 cell homing, natural antibody production, and body cavity immunity. Immunity 16:67. Cyster, J. G., K. M. Ansel, K. Reif, E. H. Ekland, P. L. Hyman, H. L. Tang, S. A. Luther, and V. N. Ngo. 2000. Follicular stromal cells and lymphocyte homing to follicles. Immunol Rev 176:181. Hauser, A. E., G. F. Debes, S. Arce, G. Cassese, A. Hamann, A. Radbruch, and R. A. Manz. 2002. Chemotactic responsiveness toward ligands for CXCR3 and CXCR4 is regulated on plasma blasts during the time course of a memory immune response. J Immunol 169:1277. Hargreaves, D. C., P. L. Hyman, T. T. Lu, V. N. Ngo, A. Bidgol, G. Suzuki, Y. R. Zou, D. R. Littman, and J. G. Cyster. 2001. A coordinated change in chemokine responsiveness guides plasma cell movements. J Exp Med 194:45. Wehrli, N., D. F. Legler, D. Finke, K. M. Toellner, P. Loetscher, M. Baggiolini, I. C. MacLennan, and H. Acha-Orbea. 2001. Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur J Immunol 31:609. Cyster, J. G. 2003. Homing of antibody secreting cells. Immunol Rev 194:48. Voigt, I., S. A. Camacho, B. A. de Boer, M. Lipp, R. Forster, and C. Berek. 2000. CXCR5-deficient mice develop functional germinal centers in the splenic T cell zone. Eur J Immunol 30:560.  100  68. 69. 70. 71.  72. 73. 74. 75. 76. 77. 78. 79. 80.  81. 82. 83.  84.  MacLennan, I. C. 1994. Somatic mutation. From the dark zone to the light. Curr Biol 4:70. Allen, C. D., K. M. Ansel, C. Low, R. Lesley, H. Tamamura, N. Fujii, and J. G. Cyster. 2004. Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5. Nat Immunol 5:943. Allen, C. D., T. Okada, H. L. Tang, and J. G. Cyster. 2007. Imaging of germinal center selection events during affinity maturation. Science 315:528. Hauser, A. E., T. Junt, T. R. Mempel, M. W. Sneddon, S. H. Kleinstein, S. E. Henrickson, U. H. von Andrian, M. J. Shlomchik, and A. M. Haberman. 2007. Definition of germinal-center B cell migration in vivo reveals predominant intrazonal circulation patterns. Immunity 26:655. Schwickert, T. A., R. L. Lindquist, G. Shakhar, G. Livshits, D. Skokos, M. H. Kosco-Vilbois, M. L. Dustin, and M. C. Nussenzweig. 2007. In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446:83. Kunkel, E. J., and E. C. Butcher. 2003. Plasma-cell homing. Nat Rev Immunol 3:822. Marinissen, M. J., and J. S. Gutkind. 2001. G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci 22:368. Neer, E. J. 1995. Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249. Offermanns, S., and M. I. Simon. 1996. Organization of transmembrane signalling by heterotrimeric G proteins. Cancer Surv 27:177. Luttrell, L. M., Y. Daaka, and R. J. Lefkowitz. 1999. Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr Opin Cell Biol 11:177. Cyster, J. G., and C. C. Goodnow. 1995. Pertussis toxin inhibits migration of B and T lymphocytes into splenic white pulp cords. J Exp Med 182:581. Spangrude, G. J., B. A. Braaten, and R. A. Daynes. 1984. Molecular mechanisms of lymphocyte extravasation. I. Studies of two selective inhibitors of lymphocyte recirculation. J Immunol 132:354. Han, S. B., C. Moratz, N. N. Huang, B. Kelsall, H. Cho, C. S. Shi, O. Schwartz, and J. H. Kehrl. 2005. Rgs1 and Gnai2 regulate the entrance of B lymphocytes into lymph nodes and B cell motility within lymph node follicles. Immunity 22:343. Hidi, R., S. Timmermans, E. Liu, C. Schudt, G. Dent, S. T. Holgate, and R. Djukanovic. 2000. Phosphodiesterase and cyclic adenosine monophosphatedependent inhibition of T-lymphocyte chemotaxis. Eur Respir J 15:342. Kehrl, J. H. 2004. G-protein-coupled receptor signaling, RGS proteins, and lymphocyte function. Crit Rev Immunol 24:409. Stephens, L. R., A. Eguinoa, H. Erdjument-Bromage, M. Lui, F. Cooke, J. Coadwell, A. S. Smrcka, M. Thelen, K. Cadwallader, P. Tempst, and P. T. Hawkins. 1997. The G beta gamma sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell 89:105. Suire, S., J. Coadwell, G. J. Ferguson, K. Davidson, P. Hawkins, and L. Stephens. 2005. p84, a new Gbetagamma-activated regulatory subunit of the type IB phosphoinositide 3-kinase p110gamma. Curr Biol 15:566.  101  85.  86.  87. 88.  89.  90.  91.  92. 93. 94.  95. 96.  97.  Sasaki, T., J. Irie-Sasaki, R. G. Jones, A. J. Oliveira-dos-Santos, W. L. Stanford, B. Bolon, A. Wakeham, A. Itie, D. Bouchard, I. Kozieradzki, N. Joza, T. W. Mak, P. S. Ohashi, A. Suzuki, and J. M. Penninger. 2000. Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science 287:1040. Reif, K., K. Okkenhaug, T. Sasaki, J. M. Penninger, B. Vanhaesebroeck, and J. G. Cyster. 2004. Cutting edge: differential roles for phosphoinositide 3-kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J Immunol 173:2236. Ortolano, S., I. Y. Hwang, S. B. Han, and J. H. Kehrl. 2006. Roles for phosphoinositide 3-kinases, Bruton's tyrosine kinase, and Jun kinases in B lymphocyte chemotaxis and homing. Eur J Immunol 36:1285. Croker, B. A., D. M. Tarlinton, L. A. Cluse, A. J. Tuxen, A. Light, F. C. Yang, D. A. Williams, and A. W. Roberts. 2002. The Rac2 guanosine triphosphatase regulates B lymphocyte antigen receptor responses and chemotaxis and is required for establishment of B-1a and marginal zone B lymphocytes. J Immunol 168:3376. Haddad, E., J. L. Zugaza, F. Louache, N. Debili, C. Crouin, K. Schwarz, A. Fischer, W. Vainchenker, and J. Bertoglio. 2001. The interaction between Cdc42 and WASP is required for SDF-1-induced T-lymphocyte chemotaxis. Blood 97:33. Vicente-Manzanares, M., M. Rey, M. Perez-Martinez, M. Yanez-Mo, D. Sancho, J. R. Cabrero, O. Barreiro, H. de la Fuente, K. Itoh, and F. Sanchez-Madrid. 2003. The RhoA effector mDia is induced during T cell activation and regulates actin polymerization and cell migration in T lymphocytes. J Immunol 171:1023. Fukui, Y., O. Hashimoto, T. Sanui, T. Oono, H. Koga, M. Abe, A. Inayoshi, M. Noda, M. Oike, T. Shirai, and T. Sasazuki. 2001. Haematopoietic cell-specific CDM family protein DOCK2 is essential for lymphocyte migration. Nature 412:826. Schoenwaelder, S. M., and K. Burridge. 1999. Bidirectional signaling between the cytoskeleton and integrins. Curr Opin Cell Biol 11:274. Srinivasan, S., F. Wang, S. Glavas, A. Ott, F. Hofmann, K. Aktories, D. Kalman, and H. R. Bourne. 2003. Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J Cell Biol 160:375. del Pozo, M. A., M. Vicente-Manzanares, R. Tejedor, J. M. Serrador, and F. Sanchez-Madrid. 1999. Rho GTPases control migration and polarization of adhesion molecules and cytoskeletal ERM components in T lymphocytes. Eur J Immunol 29:3609. Nobes, C. D., and A. Hall. 1999. Rho GTPases control polarity, protrusion, and adhesion during cell movement. J Cell Biol 144:1235. Xu, J., F. Wang, A. Van Keymeulen, P. Herzmark, A. Straight, K. Kelly, Y. Takuwa, N. Sugimoto, T. Mitchison, and H. R. Bourne. 2003. Divergent signals and cytoskeletal assemblies regulate self-organizing polarity in neutrophils. Cell 114:201. Bompard, G., and E. Caron. 2004. Regulation of WASP/WAVE proteins: making a long story short. J Cell Biol 166:957.  102  98. 99. 100. 101. 102.  103. 104.  105. 106. 107. 108. 109. 110. 111. 112. 113. 114.  Lee, J. H., T. Katakai, T. Hara, H. Gonda, M. Sugai, and A. Shimizu. 2004. Roles of p-ERM and Rho-ROCK signaling in lymphocyte polarity and uropod formation. J Cell Biol 167:327. Bardi, G., V. Niggli, and P. Loetscher. 2003. Rho kinase is required for CCR7mediated polarization and chemotaxis of T lymphocytes. FEBS Lett 542:79. Krummel, M. F., and I. Macara. 2006. Maintenance and modulation of T cell polarity. Nat Immunol 7:1143. Jacobelli, J., F. C. Bennett, P. Pandurangi, A. J. Tooley, and M. F. Krummel. 2009. Myosin-IIA and ICAM-1 regulate the interchange between two distinct modes of T cell migration. J Immunol 182:2041. McLeod, S. J., A. H. Li, R. L. Lee, A. E. Burgess, and M. R. Gold. 2002. The Rap GTPases regulate B cell migration toward the chemokine stromal cell-derived factor-1 (CXCL12): potential role for Rap2 in promoting B cell migration. J Immunol 169:1365. Kinashi, T., and K. Katagiri. 2005. Regulation of immune cell adhesion and migration by regulator of adhesion and cell polarization enriched in lymphoid tissues. Immunology 116:164. Durand, C. A., J. Westendorf, K. W. Tse, and M. R. Gold. 2006. The Rap GTPases mediate CXCL13- and sphingosine1-phosphate-induced chemotaxis, adhesion, and Pyk2 tyrosine phosphorylation in B lymphocytes. Eur J Immunol 36:2235. Katagiri, K., N. Ohnishi, K. Kabashima, T. Iyoda, N. Takeda, Y. Shinkai, K. Inaba, and T. Kinashi. 2004. Crucial functions of the Rap1 effector molecule RAPL in lymphocyte and dendritic cell trafficking. Nat Immunol 5:1045. Klaus, G. G., J. H. Humphrey, A. Kunkl, and D. W. Dongworth. 1980. The follicular dendritic cell: its role in antigen presentation in the generation of immunological memory. Immunol Rev 53:3. Mandel, T. E., R. P. Phipps, A. Abbot, and J. G. Tew. 1980. The follicular dendritic cell: long term antigen retention during immunity. Immunol Rev 53:29. Gretz, J. E., A. O. Anderson, and S. Shaw. 1997. Cords, channels, corridors and conduits: critical architectural elements facilitating cell interactions in the lymph node cortex. Immunol Rev 156:11. Burg, D. L., M. T. Furlong, M. L. Harrison, and R. L. Geahlen. 1994. Interactions of Lyn with the antigen receptor during B cell activation. J Biol Chem 269:28136. DeFranco, A. L. 1997. The complexity of signaling pathways activated by the BCR. Curr Opin Immunol 9:296. Hutchcroft, J. E., M. L. Harrison, and R. L. Geahlen. 1991. B lymphocyte activation is accompanied by phosphorylation of a 72-kDa protein-tyrosine kinase. J Biol Chem 266:14846. Hutchcroft, J. E., M. L. Harrison, and R. L. Geahlen. 1992. Association of the 72kDa protein-tyrosine kinase PTK72 with the B cell antigen receptor. J Biol Chem 267:8613. Scharenberg, A. M., L. A. Humphries, and D. J. Rawlings. 2007. Calcium signalling and cell-fate choice in B cells. Nat Rev Immunol 7:778. Dal Porto, J. M., S. B. Gauld, K. T. Merrell, D. Mills, A. E. Pugh-Bernard, and J. Cambier. 2004. B cell antigen receptor signaling 101. Mol Immunol 41:599.  103  115. 116. 117. 118. 119. 120. 121.  122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132.  Kurosaki, T. 1999. Genetic analysis of B cell antigen receptor signaling. Annu Rev Immunol 17:555. Cambier, J. C., C. M. Pleiman, and M. R. Clark. 1994. Signal transduction by the B cell antigen receptor and its coreceptors. Annu Rev Immunol 12:457. Lanzavecchia, A. 1985. Antigen-specific interaction between T and B cells. Nature 314:537. Lanzavecchia, A., and S. Bove. 1985. Specific B lymphocytes efficiently pick up, process and present antigen to T cells. Behring Inst Mitt:82. Rock, K. L., B. Benacerraf, and A. K. Abbas. 2007. Pillars article: Antigen presentation by hapten-specific B lymphocytes. I. Role of surface immunoglobulin receptors. 1984. J Immunol 179:7194. Klaus, S. J., L. M. Pinchuk, H. D. Ochs, C. L. Law, W. C. Fanslow, R. J. Armitage, and E. A. Clark. 1994. Costimulation through CD28 enhances T celldependent B cell activation via CD40-CD40L interaction. J Immunol 152:5643. Cambier, J. C., D. C. Morrison, M. M. Chien, and K. R. Lehmann. 1991. Modeling of T cell contact-dependent B cell activation. IL-4 and antigen receptor ligation primes quiescent B cells to mobilize calcium in response to Ia crosslinking. J Immunol 146:2075. Grakoui, A., S. K. Bromley, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen, and M. L. Dustin. 1999. The immunological synapse: a molecular machine controlling T cell activation. Science 285:221. Krummel, M. F., M. D. Sjaastad, C. Wulfing, and M. M. Davis. 2000. Differential clustering of CD4 and CD3zeta during T cell recognition. Science 289:1349. Monks, C. R., B. A. Freiberg, H. Kupfer, N. Sciaky, and A. Kupfer. 1998. Threedimensional segregation of supramolecular activation clusters in T cells. Nature 395:82. Batista, F. D., D. Iber, and M. S. Neuberger. 2001. B cells acquire antigen from target cells after synapse formation. Nature 411:489. Davis, D. M., I. Chiu, M. Fassett, G. B. Cohen, O. Mandelboim, and J. L. Strominger. 1999. The human natural killer cell immune synapse. Proc Natl Acad Sci U S A 96:15062. Lee, K. H., A. D. Holdorf, M. L. Dustin, A. C. Chan, P. M. Allen, and A. S. Shaw. 2002. T cell receptor signaling precedes immunological synapse formation. Science 295:1539. Gupta, N., and A. L. DeFranco. 2007. Lipid rafts and B cell signaling. Semin Cell Dev Biol 18:616. Pierce, S. K. 2002. Lipid rafts and B-cell activation. Nat Rev Immunol 2:96. Sohn, H. W., S. K. Pierce, and S. J. Tzeng. 2008. Live cell imaging reveals that the inhibitory FcgammaRIIB destabilizes B cell receptor membrane-lipid interactions and blocks immune synapse formation. J Immunol 180:793. Davis, S. J., and P. A. van der Merwe. 2006. The kinetic-segregation model: TCR triggering and beyond. Nat Immunol 7:803. Depoil, D., S. Fleire, B. L. Treanor, M. Weber, N. E. Harwood, K. L. Marchbank, V. L. Tybulewicz, and F. D. Batista. 2008. CD19 is essential for B cell activation by promoting B cell receptor-antigen microcluster formation in response to membrane-bound ligand. Nat Immunol 9:63.  104  133.  134. 135. 136. 137. 138. 139. 140. 141.  142. 143.  144. 145. 146. 147.  Weber, M., B. Treanor, D. Depoil, H. Shinohara, N. E. Harwood, M. Hikida, T. Kurosaki, and F. D. Batista. 2008. Phospholipase C-gamma2 and Vav cooperate within signaling microclusters to propagate B cell spreading in response to membrane-bound antigen. J Exp Med 205:853. Harwood, N. E., and F. D. Batista. 2008. New insights into the early molecular events underlying B cell activation. Immunity 28:609. Nossal, G. J., A. Abbot, J. Mitchell, and Z. Lummus. 1968. Antigens in immunity. XV. Ultrastructural features of antigen capture in primary and secondary lymphoid follicles. J Exp Med 127:277. van Ewijk, W., P. J. Brekelmans, R. Jacobs, and E. Wisse. 1988. Lymphoid microenvironments in the thymus and lymph node. Scanning Microsc 2:2129. Clark, S. L., Jr. 1962. The reticulum of lymph nodes in mice studied with the electron microscope. Am J Anat 110:217. Farr, A. G., Y. Cho, and P. P. De Bruyn. 1980. The structure of the sinus wall of the lymph node relative to its endocytic properties and transmural cell passage. Am J Anat 157:265. Pape, K. A., D. M. Catron, A. A. Itano, and M. K. Jenkins. 2007. The humoral immune response is initiated in lymph nodes by B cells that acquire soluble antigen directly in the follicles. Immunity 26:491. Storni, T., T. M. Kundig, G. Senti, and P. Johansen. 2005. Immunity in response to particulate antigen-delivery systems. Adv Drug Deliv Rev 57:333. Szakal, A. K., K. L. Holmes, and J. G. Tew. 1983. Transport of immune complexes from the subcapsular sinus to lymph node follicles on the surface of nonphagocytic cells, including cells with dendritic morphology. J Immunol 131:1714. Humphrey, J. H., and D. Grennan. 1981. Different macrophage populations distinguished by means of fluorescent polysaccharides. Recognition and properties of marginal-zone macrophages. Eur J Immunol 11:221. Martinez-Pomares, L., M. Kosco-Vilbois, E. Darley, P. Tree, S. Herren, J. Y. Bonnefoy, and S. Gordon. 1996. Fc chimeric protein containing the cysteine-rich domain of the murine mannose receptor binds to macrophages from splenic marginal zone and lymph node subcapsular sinus and to germinal centers. J Exp Med 184:1927. Unanue, E. R., J. C. Cerottini, and M. Bedford. 1969. Persistence of antigen on the surface of macrophages. Nature 222:1193. Carrasco, Y. R., and F. D. Batista. 2007. B cells acquire particulate antigen in a macrophage-rich area at the boundary between the follicle and the subcapsular sinus of the lymph node. Immunity 27:160. Phan, T. G., I. Grigorova, T. Okada, and J. G. Cyster. 2007. Subcapsular encounter and complement-dependent transport of immune complexes by lymph node B cells. Nat Immunol 8:992. Junt, T., E. A. Moseman, M. Iannacone, S. Massberg, P. A. Lang, M. Boes, K. Fink, S. E. Henrickson, D. M. Shayakhmetov, N. C. Di Paolo, N. van Rooijen, T. R. Mempel, S. P. Whelan, and U. H. von Andrian. 2007. Subcapsular sinus macrophages in lymph nodes clear lymph-borne viruses and present them to antiviral B cells. Nature 450:110.  105  148. 149. 150.  151. 152. 153. 154. 155. 156.  157. 158. 159. 160. 161. 162. 163.  Pillai, S., A. Cariappa, and S. T. Moran. 2005. Marginal zone B cells. Annu Rev Immunol 23:161. Ferguson, A. R., M. E. Youd, and R. B. Corley. 2004. Marginal zone B cells transport and deposit IgM-containing immune complexes onto follicular dendritic cells. Int Immunol 16:1411. Lin, K. B., S. A. Freeman, S. Zabetian, H. Brugger, M. Weber, V. Lei, M. DangLawson, K. W. Tse, R. Santamaria, F. D. Batista, and M. R. Gold. 2008. The rap GTPases regulate B cell morphology, immune-synapse formation, and signaling by particulate B cell receptor ligands. Immunity 28:75. Carrasco, Y. R., and F. D. Batista. 2006. B cell recognition of membrane-bound antigen: an exquisite way of sensing ligands. Curr Opin Immunol 18:286. Chen, L. L., A. M. Frank, J. C. Adams, and R. M. Steinman. 1978. Distribution of horseradish peroxidase (HRP)-anti-HRP immune complexes in mouse spleen with special reference to follicular dendritic cells. J Cell Biol 79:184. Tew, J. G., R. P. Phipps, and T. E. Mandel. 1980. The maintenance and regulation of the humoral immune response: persisting antigen and the role of follicular antigen-binding dendritic cells as accessory cells. Immunol Rev 53:175. Qin, D., J. Wu, K. A. Vora, J. V. Ravetch, A. K. Szakal, T. Manser, and J. G. Tew. 2000. Fc gamma receptor IIB on follicular dendritic cells regulates the B cell recall response. J Immunol 164:6268. Tew, J. G., J. Wu, M. Fakher, A. K. Szakal, and D. Qin. 2001. Follicular dendritic cells: beyond the necessity of T-cell help. Trends Immunol 22:361. Yoshida, K., T. K. van den Berg, and C. D. Dijkstra. 1993. Two functionally different follicular dendritic cells in secondary lymphoid follicles of mouse spleen, as revealed by CR1/2 and FcR gamma II-mediated immune-complex trapping. Immunology 80:34. Fang, Y., C. Xu, Y. X. Fu, V. M. Holers, and H. Molina. 1998. Expression of complement receptors 1 and 2 on follicular dendritic cells is necessary for the generation of a strong antigen-specific IgG response. J Immunol 160:5273. Barrington, R. A., O. Pozdnyakova, M. R. Zafari, C. D. Benjamin, and M. C. Carroll. 2002. B lymphocyte memory: role of stromal cell complement and FcgammaRIIB receptors. J Exp Med 196:1189. Fleire, S. J., J. P. Goldman, Y. R. Carrasco, M. Weber, D. Bray, and F. D. Batista. 2006. B cell ligand discrimination through a spreading and contraction response. Science 312:738. Kitayama, H., Y. Sugimoto, T. Matsuzaki, Y. Ikawa, and M. Noda. 1989. A rasrelated gene with transformation suppressor activity. Cell 56:77. Hu, C. D., K. Kariya, G. Kotani, M. Shirouzu, S. Yokoyama, and T. Kataoka. 1997. Coassociation of Rap1A and Ha-Ras with Raf-1 N-terminal region interferes with ras-dependent activation of Raf-1. J Biol Chem 272:11702. Bos, J. L., H. Rehmann, and A. Wittinghofer. 2007. GEFs and GAPs: critical elements in the control of small G proteins. Cell 129:865. Ohba, Y., N. Mochizuki, K. Matsuo, S. Yamashita, M. Nakaya, Y. Hashimoto, M. Hamaguchi, T. Kurata, K. Nagashima, and M. Matsuda. 2000. Rap2 as a slowly responding molecular switch in the Rap1 signaling cascade. Mol Cell Biol 20:6074.  106  164. 165. 166. 167.  168. 169. 170. 171. 172. 173. 174. 175.  176. 177. 178.  Beranger, F., B. Goud, A. Tavitian, and J. de Gunzburg. 1991. Association of the Ras-antagonistic Rap1/Krev-1 proteins with the Golgi complex. Proc Natl Acad Sci U S A 88:1606. Beranger, F., A. Tavitian, and J. de Gunzburg. 1991. Post-translational processing and subcellular localization of the Ras-related Rap2 protein. Oncogene 6:1835. Miertzschke, M., P. Stanley, T. D. Bunney, F. Rodrigues-Lima, N. Hogg, and M. Katan. 2007. Characterization of interactions of adapter protein RAPL/Nore1B with RAP GTPases and their role in T cell migration. J Biol Chem 282:30629. Li, Y., J. Yan, P. De, H. C. Chang, A. Yamauchi, K. W. Christopherson, 2nd, N. C. Paranavitana, X. Peng, C. Kim, V. Munugalavadla, R. Kapur, H. Chen, W. Shou, J. C. Stone, M. H. Kaplan, M. C. Dinauer, D. L. Durden, and L. A. Quilliam. 2007. Rap1a null mice have altered myeloid cell functions suggesting distinct roles for the closely related Rap1a and 1b proteins. J Immunol 179:8322. Chrzanowska-Wodnicka, M., S. S. Smyth, S. M. Schoenwaelder, T. H. Fischer, and G. C. White, 2nd. 2005. Rap1b is required for normal platelet function and hemostasis in mice. J Clin Invest 115:680. Duchniewicz, M., T. Zemojtel, M. Kolanczyk, S. Grossmann, J. S. Scheele, and F. J. Zwartkruis. 2006. Rap1A-deficient T and B cells show impaired integrinmediated cell adhesion. Mol Cell Biol 26:643. Chu, H., A. Awasthi, G. C. White, 2nd, M. Chrzanowska-Wodnicka, and S. Malarkannan. 2008. Rap1b regulates B cell development, homing, and T celldependent humoral immunity. J Immunol 181:3373. Chen, Y., M. Yu, A. Podd, R. Wen, M. Chrzanowska-Wodnicka, G. C. White, and D. Wang. 2008. A critical role of Rap1b in B-cell trafficking and marginal zone B-cell development. Blood 111:4627. Altschuler, D. L., S. N. Peterson, M. C. Ostrowski, and E. G. Lapetina. 1995. Cyclic AMP-dependent activation of Rap1b. J Biol Chem 270:10373. McLeod, S. J., R. J. Ingham, J. L. Bos, T. Kurosaki, and M. R. Gold. 1998. Activation of the Rap1 GTPase by the B cell antigen receptor. J Biol Chem 273:29218. Zwartkruis, F. J., R. M. Wolthuis, N. M. Nabben, B. Franke, and J. L. Bos. 1998. Extracellular signal-regulated activation of Rap1 fails to interfere in Ras effector signalling. Embo J 17:5905. Sawada, Y., K. Nakamura, K. Doi, K. Takeda, K. Tobiume, M. Saitoh, K. Morita, I. Komuro, K. De Vos, M. Sheetz, and H. Ichijo. 2001. Rap1 is involved in cell stretching modulation of p38 but not ERK or JNK MAP kinase. J Cell Sci 114:1221. Smit, L., G. van der Horst, and J. Borst. 1996. Sos, Vav, and C3G participate in B cell receptor-induced signaling pathways and differentially associate with ShcGrb2, Crk, and Crk-L adaptors. J Biol Chem 271:8564. Vikenes, K., M. Farstad, and J. E. Nordrehaug. 1999. Serotonin is associated with coronary artery disease and cardiac events. Circulation 100:483. Takayama, K., G. K. Sukhova, M. T. Chin, and P. Libby. 2006. A novel prostaglandin E receptor 4-associated protein participates in antiinflammatory signaling. Circ Res 98:499.  107  179.  180.  181. 182. 183. 184. 185. 186. 187. 188. 189. 190. 191.  192.  Rangarajan, S., J. M. Enserink, H. B. Kuiperij, J. de Rooij, L. S. Price, F. Schwede, and J. L. Bos. 2003. Cyclic AMP induces integrin-mediated cell adhesion through Epac and Rap1 upon stimulation of the beta 2-adrenergic receptor. J Cell Biol 160:487. Kawasaki, H., G. M. Springett, S. Toki, J. J. Canales, P. Harlan, J. P. Blumenstiel, E. J. Chen, I. A. Bany, N. Mochizuki, A. Ashbacher, M. Matsuda, D. E. Housman, and A. M. Graybiel. 1998. A Rap guanine nucleotide exchange factor enriched highly in the basal ganglia. Proc Natl Acad Sci U S A 95:13278. Yamashita, S., N. Mochizuki, Y. Ohba, M. Tobiume, Y. Okada, H. Sawa, K. Nagashima, and M. Matsuda. 2000. CalDAG-GEFIII activation of Ras, R-ras, and Rap1. J Biol Chem 275:25488. Ebinu, J. O., D. A. Bottorff, E. Y. Chan, S. L. Stang, R. J. Dunn, and J. C. Stone. 1998. RasGRP, a Ras guanyl nucleotide- releasing protein with calcium- and diacylglycerol-binding motifs. Science 280:1082. Ishiai, M., M. Kurosaki, R. Pappu, K. Okawa, I. Ronko, C. Fu, M. Shibata, A. Iwamatsu, A. C. Chan, and T. Kurosaki. 1999. BLNK required for coupling Syk to PLC gamma 2 and Rac1-JNK in B cells. Immunity 10:117. Fu, C., and A. C. Chan. 1997. Identification of two tyrosine phosphoproteins, pp70 and pp68, which interact with phospholipase Cgamma, Grb2, and Vav after B cell antigen receptor activation. J Biol Chem 272:27362. Ishiai, M., H. Sugawara, M. Kurosaki, and T. Kurosaki. 1999. Cutting edge: association of phospholipase C-gamma 2 Src homology 2 domains with BLNK is critical for B cell antigen receptor signaling. J Immunol 163:1746. Weiss, A., G. Koretzky, R. C. Schatzman, and T. Kadlecek. 1991. Functional activation of the T-cell antigen receptor induces tyrosine phosphorylation of phospholipase C-gamma 1. Proc Natl Acad Sci U S A 88:5484. Crittenden, J. R., W. Bergmeier, Y. Zhang, C. L. Piffath, Y. Liang, D. D. Wagner, D. E. Housman, and A. M. Graybiel. 2004. CalDAG-GEFI integrates signaling for platelet aggregation and thrombus formation. Nat Med 10:982. Wienecke, R., A. Konig, and J. E. DeClue. 1995. Identification of tuberin, the tuberous sclerosis-2 product. Tuberin possesses specific Rap1GAP activity. J Biol Chem 270:16409. Polakis, P. G., B. Rubinfeld, T. Evans, and F. McCormick. 1991. Purification of a plasma membrane-associated GTPase-activating protein specific for rap1/Krev-1 from HL60 cells. Proc Natl Acad Sci U S A 88:239. Mochizuki, N., Y. Ohba, E. Kiyokawa, T. Kurata, T. Murakami, T. Ozaki, A. Kitabatake, K. Nagashima, and M. Matsuda. 1999. Activation of the ERK/MAPK pathway by an isoform of rap1GAP associated with G alpha(i). Nature 400:891. Ishida, D., K. Kometani, H. Yang, K. Kakugawa, K. Masuda, K. Iwai, M. Suzuki, S. Itohara, T. Nakahata, H. Hiai, H. Kawamoto, M. Hattori, and N. Minato. 2003. Myeloproliferative stem cell disorders by deregulated Rap1 activation in SPA-1deficient mice. Cancer Cell 4:55. Ishida, D., L. Su, A. Tamura, Y. Katayama, Y. Kawai, S. F. Wang, M. Taniwaki, Y. Hamazaki, M. Hattori, and N. Minato. 2006. Rap1 signal controls B cell receptor repertoire and generation of self-reactive B1a cells. Immunity 24:417.  108  193. 194.  195.  196.  197.  198.  199. 200. 201.  202. 203. 204. 205.  Tsukamoto, N., M. Hattori, H. Yang, J. L. Bos, and N. Minato. 1999. Rap1 GTPase-activating protein SPA-1 negatively regulates cell adhesion. J Biol Chem 274:18463. Kometani, K., M. Moriyama, Y. Nakashima, Y. Katayama, S. F. Wang, S. Yamasaki, T. Saito, M. Hattori, and N. Minato. 2008. Essential role of Rap signal in pre-TCR-mediated beta-selection checkpoint in alphabeta T-cell development. Blood 112:4565. Asakura, T., H. Nakanishi, T. Sakisaka, K. Takahashi, K. Mandai, M. Nishimura, T. Sasaki, and Y. Takai. 1999. Similar and differential behaviour between the nectin-afadin-ponsin and cadherin-catenin systems during the formation and disruption of the polarized junctional alignment in epithelial cells. Genes Cells 4:573. Su, L., M. Hattori, M. Moriyama, N. Murata, M. Harazaki, K. Kaibuchi, and N. Minato. 2003. AF-6 controls integrin-mediated cell adhesion by regulating Rap1 activation through the specific recruitment of Rap1GTP and SPA-1. J Biol Chem 278:15232. Boettner, B., E. E. Govek, J. Cross, and L. Van Aelst. 2000. The junctional multidomain protein AF-6 is a binding partner of the Rap1A GTPase and associates with the actin cytoskeletal regulator profilin. Proc Natl Acad Sci U S A 97:9064. Miyata, M., Y. Rikitake, M. Takahashi, Y. Nagamatsu, Y. Yamauchi, H. Ogita, K. Hirata, and Y. Takai. 2009. Regulation by afadin of cyclical activation and inactivation of Rap1, Rac1, and RhoA small G proteins at leading edges of moving NIH3T3 cells. J Biol Chem 284:24595. Zhang, Z., H. Rehmann, L. S. Price, J. Riedl, and J. L. Bos. 2005. AF6 negatively regulates Rap1-induced cell adhesion. J Biol Chem 280:33200. Katagiri, K., A. Maeda, M. Shimonaka, and T. Kinashi. 2003. RAPL, a Rap1binding molecule that mediates Rap1-induced adhesion through spatial regulation of LFA-1. Nat Immunol 4:741. Lafuente, E. M., A. A. van Puijenbroek, M. Krause, C. V. Carman, G. J. Freeman, A. Berezovskaya, E. Constantine, T. A. Springer, F. B. Gertler, and V. A. Boussiotis. 2004. RIAM, an Ena/VASP and Profilin ligand, interacts with Rap1GTP and mediates Rap1-induced adhesion. Dev Cell 7:585. Lee, H. S., C. J. Lim, W. Puzon-McLaughlin, S. J. Shattil, and M. H. Ginsberg. 2009. RIAM activates integrins by linking talin to ras GTPase membranetargeting sequences. J Biol Chem 284:5119. Skoble, J., V. Auerbuch, E. D. Goley, M. D. Welch, and D. A. Portnoy. 2001. Pivotal role of VASP in Arp2/3 complex-mediated actin nucleation, actin branchformation, and Listeria monocytogenes motility. J Cell Biol 155:89. Krugmann, S., R. Williams, L. Stephens, and P. T. Hawkins. 2004. ARAP3 is a PI3K- and rap-regulated GAP for RhoA. Curr Biol 14:1380. Krugmann, S., K. E. Anderson, S. H. Ridley, N. Risso, A. McGregor, J. Coadwell, K. Davidson, A. Eguinoa, C. D. Ellson, P. Lipp, M. Manifava, N. Ktistakis, G. Painter, J. W. Thuring, M. A. Cooper, Z. Y. Lim, A. B. Holmes, S. K. Dove, R. H. Michell, A. Grewal, A. Nazarian, H. Erdjument-Bromage, P. Tempst, L. R. Stephens, and P. T. Hawkins. 2002. Identification of ARAP3, a  109  206. 207. 208. 209. 210. 211. 212.  213. 214.  215. 216. 217.  218. 219. 220.  novel PI3K effector regulating both Arf and Rho GTPases, by selective capture on phosphoinositide affinity matrices. Mol Cell 9:95. Arthur, W. T., L. A. Quilliam, and J. A. Cooper. 2004. Rap1 promotes cell spreading by localizing Rac guanine nucleotide exchange factors. J Cell Biol 167:111. Maillet, M., S. J. Robert, M. Cacquevel, M. Gastineau, D. Vivien, J. Bertoglio, J. L. Zugaza, R. Fischmeister, and F. Lezoualc'h. 2003. Crosstalk between Rap1 and Rac regulates secretion of sAPPalpha. Nat Cell Biol 5:633. Gerard, A., A. E. Mertens, R. A. van der Kammen, and J. G. Collard. 2007. The Par polarity complex regulates Rap1- and chemokine-induced T cell polarization. J Cell Biol 176:863. Luo, B. H., C. V. Carman, and T. A. Springer. 2007. Structural basis of integrin regulation and signaling. Annu Rev Immunol 25:619. Hynes, R. O. 2002. Integrins: bidirectional, allosteric signaling machines. Cell 110:673. Abram, C. L., and C. A. Lowell. 2009. The ins and outs of leukocyte integrin signaling. Annu Rev Immunol 27:339. McLeod, S. J., A. J. Shum, R. L. Lee, F. Takei, and M. R. Gold. 2004. The Rap GTPases regulate integrin-mediated adhesion, cell spreading, actin polymerization, and Pyk2 tyrosine phosphorylation in B lymphocytes. J Biol Chem 279:12009. Dustin, M. L., and T. A. Springer. 1989. T-cell receptor cross-linking transiently stimulates adhesiveness through LFA-1. Nature 341:619. Postigo, A. A., R. Pulido, M. R. Campanero, A. Acevedo, A. Garcia-Pardo, A. L. Corbi, F. Sanchez-Madrid, and M. O. De Landazuri. 1991. Differential expression of VLA-4 integrin by resident and peripheral blood B lymphocytes. Acquisition of functionally active alpha 4 beta 1-fibronectin receptors upon B cell activation. Eur J Immunol 21:2437. Carman, C. V., and T. A. Springer. 2003. Integrin avidity regulation: are changes in affinity and conformation underemphasized? Curr Opin Cell Biol 15:547. Davis, D. M. 2009. Mechanisms and functions for the duration of intercellular contacts made by lymphocytes. Nat Rev Immunol 9:543. Carlos, T., N. Kovach, B. Schwartz, M. Rosa, B. Newman, E. Wayner, C. Benjamin, L. Osborn, R. Lobb, and J. Harlan. 1991. Human monocytes bind to two cytokine-induced adhesive ligands on cultured human endothelial cells: endothelial-leukocyte adhesion molecule-1 and vascular cell adhesion molecule-1. Blood 77:2266. Schwartz, B. R., E. A. Wayner, T. M. Carlos, H. D. Ochs, and J. M. Harlan. 1990. Identification of surface proteins mediating adherence of CD11/CD18-deficient lymphoblastoid cells to cultured human endothelium. J Clin Invest 85:2019. Katagiri, K., M. Imamura, and T. Kinashi. 2006. Spatiotemporal regulation of the kinase Mst1 by binding protein RAPL is critical for lymphocyte polarity and adhesion. Nat Immunol 7:919. Tadokoro, S., S. J. Shattil, K. Eto, V. Tai, R. C. Liddington, J. M. de Pereda, M. H. Ginsberg, and D. A. Calderwood. 2003. Talin binding to integrin beta tails: a final common step in integrin activation. Science 302:103.  110  221. 222. 223.  224.  225.  226.  227. 228. 229.  230. 231. 232. 233. 234.  Calderwood, D. A., B. Yan, J. M. de Pereda, B. G. Alvarez, Y. Fujioka, R. C. Liddington, and M. H. Ginsberg. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277:21749. Calderwood, D. A., R. Zent, R. Grant, D. J. Rees, R. O. Hynes, and M. H. Ginsberg. 1999. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J Biol Chem 274:28071. Han, J., C. J. Lim, N. Watanabe, A. Soriani, B. Ratnikov, D. A. Calderwood, W. Puzon-McLaughlin, E. M. Lafuente, V. A. Boussiotis, S. J. Shattil, and M. H. Ginsberg. 2006. Reconstructing and deconstructing agonist-induced activation of integrin alphaIIbbeta3. Curr Biol 16:1796. Pasvolsky, R., S. W. Feigelson, S. S. Kilic, A. J. Simon, G. Tal-Lapidot, V. Grabovsky, J. R. Crittenden, N. Amariglio, M. Safran, A. M. Graybiel, G. Rechavi, S. Ben-Dor, A. Etzioni, and R. Alon. 2007. A LAD-III syndrome is associated with defective expression of the Rap-1 activator CalDAG-GEFI in lymphocytes, neutrophils, and platelets. J Exp Med 204:1571. Bergmeier, W., T. Goerge, H. W. Wang, J. R. Crittenden, A. C. Baldwin, S. M. Cifuni, D. E. Housman, A. M. Graybiel, and D. D. Wagner. 2007. Mice lacking the signaling molecule CalDAG-GEFI represent a model for leukocyte adhesion deficiency type III. J Clin Invest 117:1699. Svensson, L., K. Howarth, A. McDowall, I. Patzak, R. Evans, S. Ussar, M. Moser, A. Metin, M. Fried, I. Tomlinson, and N. Hogg. 2009. Leukocyte adhesion deficiency-III is caused by mutations in KINDLIN3 affecting integrin activation. Nat Med 15:306. Wulfing, C., and M. M. Davis. 1998. A receptor/cytoskeletal movement triggered by costimulation during T cell activation. Science 282:2266. Bryceson, Y. T., M. E. March, D. F. Barber, H. G. Ljunggren, and E. O. Long. 2005. Cytolytic granule polarization and degranulation controlled by different receptors in resting NK cells. J Exp Med 202:1001. Bershadsky, A. D., I. S. Tint, A. A. Neyfakh, Jr., and J. M. Vasiliev. 1985. Focal contacts of normal and RSV-transformed quail cells. Hypothesis of the transformation-induced deficient maturation of focal contacts. Exp Cell Res 158:433. Geiger, B., and A. Bershadsky. 2001. Assembly and mechanosensory function of focal contacts. Curr Opin Cell Biol 13:584. Schwartz, M. A., M. D. Schaller, and M. H. Ginsberg. 1995. Integrins: emerging paradigms of signal transduction. Annu Rev Cell Dev Biol 11:549. Schaller, M. D., J. D. Hildebrand, J. D. Shannon, J. W. Fox, R. R. Vines, and J. T. Parsons. 1994. Autophosphorylation of the focal adhesion kinase, pp125FAK, directs SH2-dependent binding of pp60src. Mol Cell Biol 14:1680. Xing, Z., H. C. Chen, J. K. Nowlen, S. J. Taylor, D. Shalloway, and J. L. Guan. 1994. Direct interaction of v-Src with the focal adhesion kinase mediated by the Src SH2 domain. Mol Biol Cell 5:413. Polte, T. R., and S. K. Hanks. 1995. Interaction between focal adhesion kinase and Crk-associated tyrosine kinase substrate p130Cas. Proc Natl Acad Sci U S A 92:10678.  111  235. 236.  237. 238. 239. 240. 241. 242. 243. 244. 245. 246. 247. 248.  249. 250.  Vuori, K., H. Hirai, S. Aizawa, and E. Ruoslahti. 1996. Introduction of p130cas signaling complex formation upon integrin-mediated cell adhesion: a role for Src family kinases. Mol Cell Biol 16:2606. Owen, J. D., P. J. Ruest, D. W. Fry, and S. K. Hanks. 1999. Induced focal adhesion kinase (FAK) expression in FAK-null cells enhances cell spreading and migration requiring both auto- and activation loop phosphorylation sites and inhibits adhesion-dependent tyrosine phosphorylation of Pyk2. Mol Cell Biol 19:4806. Thomas, J. W., M. A. Cooley, J. M. Broome, R. Salgia, J. D. Griffin, C. R. Lombardo, and M. D. Schaller. 1999. The role of focal adhesion kinase binding in the regulation of tyrosine phosphorylation of paxillin. J Biol Chem 274:36684. Schlaepfer, D. D., M. A. Broome, and T. Hunter. 1997. Fibronectin-stimulated signaling from a focal adhesion kinase-c-Src complex: involvement of the Grb2, p130cas, and Nck adaptor proteins. Mol Cell Biol 17:1702. Cary, L. A., D. C. Han, T. R. Polte, S. K. Hanks, and J. L. Guan. 1998. Identification of p130Cas as a mediator of focal adhesion kinase-promoted cell migration. J Cell Biol 140:211. Turner, C. E. 1998. Paxillin. Int J Biochem Cell Biol 30:955. Franca-Koh, J., and P. N. Devreotes. 2004. Moving forward: mechanisms of chemoattractant gradient sensing. Physiology (Bethesda) 19:300. Funamoto, S., R. Meili, S. Lee, L. Parry, and R. A. Firtel. 2002. Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109:611. Huang, Y. E., M. Iijima, C. A. Parent, S. Funamoto, R. A. Firtel, and P. Devreotes. 2003. Receptor-mediated regulation of PI3Ks confines PI(3,4,5)P3 to the leading edge of chemotaxing cells. Mol Biol Cell 14:1913. Iijima, M., Y. E. Huang, and P. Devreotes. 2002. Temporal and spatial regulation of chemotaxis. Dev Cell 3:469. Parent, C. A., B. J. Blacklock, W. M. Froehlich, D. B. Murphy, and P. N. Devreotes. 1998. G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95:81. Jeon, T. J., D. J. Lee, S. Merlot, G. Weeks, and R. A. Firtel. 2007. Rap1 controls cell adhesion and cell motility through the regulation of myosin II. J Cell Biol 176:1021. Bivona, T. G., H. H. Wiener, I. M. Ahearn, J. Silletti, V. K. Chiu, and M. R. Philips. 2004. Rap1 up-regulation and activation on plasma membrane regulates T cell adhesion. J Cell Biol 164:461. Arana, E., A. Vehlow, N. E. Harwood, E. Vigorito, R. Henderson, M. Turner, V. L. Tybulewicz, and F. D. Batista. 2008. Activation of the small GTPase Rac2 via the B cell receptor regulates B cell adhesion and immunological-synapse formation. Immunity 28:88. Chen, X., and I. G. Macara. 2005. Par-3 controls tight junction assembly through the Rac exchange factor Tiam1. Nat Cell Biol 7:262. Kang, P. J., A. Sanson, B. Lee, and H. O. Park. 2001. A GDP/GTP exchange factor involved in linking a spatial landmark to cell polarity. Science 292:1376.  112  251. 252. 253. 254. 255. 256. 257. 258. 259. 260.  261. 262. 263.  264.  265.  Park, H. O., P. J. Kang, and A. W. Rachfal. 2002. Localization of the Rsr1/Bud1 GTPase involved in selection of a proper growth site in yeast. J Biol Chem 277:26721. Mostov, K., T. Su, and M. ter Beest. 2003. Polarized epithelial membrane traffic: conservation and plasticity. Nat Cell Biol 5:287. Martin-Belmonte, F., and K. Mostov. 2008. Regulation of cell polarity during epithelial morphogenesis. Curr Opin Cell Biol 20:227. Shin, K., V. C. Fogg, and B. Margolis. 2006. Tight junctions and cell polarity. Annu Rev Cell Dev Biol 22:207. Harris, T. J., and M. Peifer. 2005. The positioning and segregation of apical cues during epithelial polarity establishment in Drosophila. J Cell Biol 170:813. Wodarz, A., A. Ramrath, A. Grimm, and E. Knust. 2000. Drosophila atypical protein kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. J Cell Biol 150:1361. Petronczki, M., and J. A. Knoblich. 2001. DmPAR-6 directs epithelial polarity and asymmetric cell division of neuroblasts in Drosophila. Nat Cell Biol 3:43. Lin, D., A. S. Edwards, J. P. Fawcett, G. Mbamalu, J. D. Scott, and T. Pawson. 2000. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat Cell Biol 2:540. Joberty, G., C. Petersen, L. Gao, and I. G. Macara. 2000. The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat Cell Biol 2:531. Mertens, A. E., T. P. Rygiel, C. Olivo, R. van der Kammen, and J. G. Collard. 2005. The Rac activator Tiam1 controls tight junction biogenesis in keratinocytes through binding to and activation of the Par polarity complex. J Cell Biol 170:1029. Wodarz, A., U. Hinz, M. Engelbert, and E. Knust. 1995. Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell 82:67. Lu, H., and D. Bilder. 2005. Endocytic control of epithelial polarity and proliferation in Drosophila. Nat Cell Biol 7:1232. den Hollander, A. I., J. R. Heckenlively, L. I. van den Born, Y. J. de Kok, S. D. van der Velde-Visser, U. Kellner, B. Jurklies, M. J. van Schooneveld, A. Blankenagel, K. Rohrschneider, B. Wissinger, J. R. Cruysberg, A. F. Deutman, H. G. Brunner, E. Apfelstedt-Sylla, C. B. Hoyng, and F. P. Cremers. 2001. Leber congenital amaurosis and retinitis pigmentosa with Coats-like exudative vasculopathy are associated with mutations in the crumbs homologue 1 (CRB1) gene. Am J Hum Genet 69:198. van den Hurk, J. A., P. Rashbass, R. Roepman, J. Davis, K. E. Voesenek, M. L. Arends, M. N. Zonneveld, M. H. van Roekel, K. Cameron, K. Rohrschneider, J. R. Heckenlively, R. K. Koenekoop, C. B. Hoyng, F. P. Cremers, and A. I. den Hollander. 2005. Characterization of the Crumbs homolog 2 (CRB2) gene and analysis of its role in retinitis pigmentosa and Leber congenital amaurosis. Mol Vis 11:263. den Hollander, A. I., J. B. ten Brink, Y. J. de Kok, S. van Soest, L. I. van den Born, M. A. van Driel, D. J. van de Pol, A. M. Payne, S. S. Bhattacharya, U. Kellner, C. B. Hoyng, A. Westerveld, H. G. Brunner, E. M. Bleeker-Wagemakers,  113  266. 267.  268. 269. 270. 271. 272.  273. 274. 275.  276. 277.  278. 279.  A. F. Deutman, J. R. Heckenlively, F. P. Cremers, and A. A. Bergen. 1999. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet 23:217. Straight, S. W., K. Shin, V. C. Fogg, S. Fan, C. J. Liu, M. Roh, and B. Margolis. 2004. Loss of PALS1 expression leads to tight junction and polarity defects. Mol Biol Cell 15:1981. Roh, M. H., O. Makarova, C. J. Liu, K. Shin, S. Lee, S. Laurinec, M. Goyal, R. Wiggins, and B. Margolis. 2002. The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost. J Cell Biol 157:161. Makarova, O., M. H. Roh, C. J. Liu, S. Laurinec, and B. Margolis. 2003. Mammalian Crumbs3 is a small transmembrane protein linked to protein associated with Lin-7 (Pals1). Gene 302:21. Roh, M. H., S. Fan, C. J. Liu, and B. Margolis. 2003. The Crumbs3-Pals1 complex participates in the establishment of polarity in mammalian epithelial cells. J Cell Sci 116:2895. Michel, D., J. P. Arsanto, D. Massey-Harroche, C. Beclin, J. Wijnholds, and A. Le Bivic. 2005. PATJ connects and stabilizes apical and lateral components of tight junctions in human intestinal cells. J Cell Sci 118:4049. Roh, M. H., C. J. Liu, S. Laurinec, and B. Margolis. 2002. The carboxyl terminus of zona occludens-3 binds and recruits a mammalian homologue of discs lost to tight junctions. J Biol Chem 277:27501. Hamazaki, Y., M. Itoh, H. Sasaki, M. Furuse, and S. Tsukita. 2002. Multi-PDZ domain protein 1 (MUPP1) is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule. J Biol Chem 277:455. Humbert, P., S. Russell, and H. Richardson. 2003. Dlg, Scribble and Lgl in cell polarity, cell proliferation and cancer. Bioessays 25:542. Bilder, D., and N. Perrimon. 2000. Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403:676. Musch, A., D. Cohen, C. Yeaman, W. J. Nelson, E. Rodriguez-Boulan, and P. J. Brennwald. 2002. Mammalian homolog of Drosophila tumor suppressor lethal (2) giant larvae interacts with basolateral exocytic machinery in Madin-Darby canine kidney cells. Mol Biol Cell 13:158. Bilder, D. 2004. Epithelial polarity and proliferation control: links from the Drosophila neoplastic tumor suppressors. Genes Dev 18:1909. Ludford-Menting, M. J., J. Oliaro, F. Sacirbegovic, E. T. Cheah, N. Pedersen, S. J. Thomas, A. Pasam, R. Iazzolino, L. E. Dow, N. J. Waterhouse, A. Murphy, S. Ellis, M. J. Smyth, M. H. Kershaw, P. K. Darcy, P. O. Humbert, and S. M. Russell. 2005. A network of PDZ-containing proteins regulates T cell polarity and morphology during migration and immunological synapse formation. Immunity 22:737. Bilder, D., M. Schober, and N. Perrimon. 2003. Integrated activity of PDZ protein complexes regulates epithelial polarity. Nat Cell Biol 5:53. Tanentzapf, G., and U. Tepass. 2003. Interactions between the crumbs, lethal giant larvae and bazooka pathways in epithelial polarization. Nat Cell Biol 5:46.  114  280. 281.  282. 283. 284. 285. 286. 287. 288.  289. 290. 291. 292. 293. 294. 295.  Hurd, T. W., L. Gao, M. H. Roh, I. G. Macara, and B. Margolis. 2003. Direct interaction of two polarity complexes implicated in epithelial tight junction assembly. Nat Cell Biol 5:137. Yamanaka, T., Y. Horikoshi, Y. Sugiyama, C. Ishiyama, A. Suzuki, T. Hirose, A. Iwamatsu, A. Shinohara, and S. Ohno. 2003. Mammalian Lgl forms a protein complex with PAR-6 and aPKC independently of PAR-3 to regulate epithelial cell polarity. Curr Biol 13:734. Betschinger, J., K. Mechtler, and J. A. Knoblich. 2003. The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422:326. Rolls, M. M., R. Albertson, H. P. Shih, C. Y. Lee, and C. Q. Doe. 2003. Drosophila aPKC regulates cell polarity and cell proliferation in neuroblasts and epithelia. J Cell Biol 163:1089. Plant, P. J., J. P. Fawcett, D. C. Lin, A. D. Holdorf, K. Binns, S. Kulkarni, and T. Pawson. 2003. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat Cell Biol 5:301. Macara, I. G. 2004. Parsing the polarity code. Nat Rev Mol Cell Biol 5:220. Hutterer, A., J. Betschinger, M. Petronczki, and J. A. Knoblich. 2004. Sequential roles of Cdc42, Par-6, aPKC, and Lgl in the establishment of epithelial polarity during Drosophila embryogenesis. Dev Cell 6:845. Wang, H. R., Y. Zhang, B. Ozdamar, A. A. Ogunjimi, E. Alexandrova, G. H. Thomsen, and J. L. Wrana. 2003. Regulation of cell polarity and protrusion formation by targeting RhoA for degradation. Science 302:1775. Strand, D., R. Jakobs, G. Merdes, B. Neumann, A. Kalmes, H. W. Heid, I. Husmann, and B. M. Mechler. 1994. The Drosophila lethal(2)giant larvae tumor suppressor protein forms homo-oligomers and is associated with nonmuscle myosin II heavy chain. J Cell Biol 127:1361. von Andrian, U. H., and T. R. Mempel. 2003. Homing and cellular traffic in lymph nodes. Nat Rev Immunol 3:867. Melchers, F., A. G. Rolink, and C. Schaniel. 1999. The role of chemokines in regulating cell migration during humoral immune responses. Cell 99:351. Huang, N. N., S. B. Han, I. Y. Hwang, and J. H. Kehrl. 2005. B cells productively engage soluble antigen-pulsed dendritic cells: visualization of live-cell dynamics of B cell-dendritic cell interactions. J Immunol 175:7125. Ichetovkin, I., J. Han, K. M. Pang, D. A. Knecht, and J. S. Condeelis. 2000. Actin filaments are severed by both native and recombinant dictyostelium cofilin but to different extents. Cell Motil Cytoskeleton 45:293. Ichetovkin, I., W. Grant, and J. Condeelis. 2002. Cofilin produces newly polymerized actin filaments that are preferred for dendritic nucleation by the Arp2/3 complex. Curr Biol 12:79. Ghosh, M., X. Song, G. Mouneimne, M. Sidani, D. S. Lawrence, and J. S. Condeelis. 2004. Cofilin promotes actin polymerization and defines the direction of cell motility. Science 304:743. Lorenz, M., V. DesMarais, F. Macaluso, R. H. Singer, and J. Condeelis. 2004. Measurement of barbed ends, actin polymerization, and motility in live carcinoma cells after growth factor stimulation. Cell Motil Cytoskeleton 57:207.  115  296. 297. 298. 299. 300.  301. 302. 303. 304.  305.  306. 307. 308. 309.  Yonezawa, N., Y. Homma, I. Yahara, H. Sakai, and E. Nishida. 1991. A short sequence responsible for both phosphoinositide binding and actin binding activities of cofilin. J Biol Chem 266:17218. Yonezawa, N., E. Nishida, K. Iida, I. Yahara, and H. Sakai. 1990. Inhibition of the interactions of cofilin, destrin, and deoxyribonuclease I with actin by phosphoinositides. J Biol Chem 265:8382. Samstag, Y., C. Eckerskorn, S. Wesselborg, S. Henning, R. Wallich, and S. C. Meuer. 1994. Costimulatory signals for human T-cell activation induce nuclear translocation of pp19/cofilin. Proc Natl Acad Sci U S A 91:4494. Samstag, Y., A. Bader, and S. C. Meuer. 1991. A serine phosphatase is involved in CD2-mediated activation of human T lymphocytes and natural killer cells. J Immunol 147:788. Ambach, A., J. Saunus, M. Konstandin, S. Wesselborg, S. C. Meuer, and Y. Samstag. 2000. The serine phosphatases PP1 and PP2A associate with and activate the actin-binding protein cofilin in human T lymphocytes. Eur J Immunol 30:3422. Ma, H. T., R. L. Patterson, D. B. van Rossum, L. Birnbaumer, K. Mikoshiba, and D. L. Gill. 2000. Requirement of the inositol trisphosphate receptor for activation of store-operated Ca2+ channels. Science 287:1647. Mouneimne, G., V. DesMarais, M. Sidani, E. Scemes, W. Wang, X. Song, R. Eddy, and J. Condeelis. 2006. Spatial and temporal control of cofilin activity is required for directional sensing during chemotaxis. Curr Biol 16:2193. Mizuno, K., I. Okano, K. Ohashi, K. Nunoue, K. Kuma, T. Miyata, and T. Nakamura. 1994. Identification of a human cDNA encoding a novel protein kinase with two repeats of the LIM/double zinc finger motif. Oncogene 9:1605. Ikebe, C., K. Ohashi, T. Fujimori, O. Bernard, T. Noda, E. J. Robertson, and K. Mizuno. 1997. Mouse LIM-kinase 2 gene: cDNA cloning, genomic organization, and tissue-specific expression of two alternatively initiated transcripts. Genomics 46:504. Toshima, J., K. Ohashi, I. Okano, K. Nunoue, M. Kishioka, K. Kuma, T. Miyata, M. Hirai, T. Baba, and K. Mizuno. 1995. Identification and characterization of a novel protein kinase, TESK1, specifically expressed in testicular germ cells. J Biol Chem 270:31331. Toshima, J., T. Koji, and K. Mizuno. 1998. Stage-specific expression of testisspecific protein kinase 1 (TESK1) in rat spermatogenic cells. Biochem Biophys Res Commun 249:107. Wang, W., R. Eddy, and J. Condeelis. 2007. The cofilin pathway in breast cancer invasion and metastasis. Nat Rev Cancer 7:429. Edwards, D. C., L. C. Sanders, G. M. Bokoch, and G. N. Gill. 1999. Activation of LIM-kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cytoskeletal dynamics. Nat Cell Biol 1:253. Dan, C., A. Kelly, O. Bernard, and A. Minden. 2001. Cytoskeletal changes regulated by the PAK4 serine/threonine kinase are mediated by LIM kinase 1 and cofilin. J Biol Chem 276:32115.  116  310. 311. 312.  313. 314. 315.  316.  317.  318. 319.  320.  321.  322.  Ohashi, K., K. Nagata, M. Maekawa, T. Ishizaki, S. Narumiya, and K. Mizuno. 2000. Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine 508 within the activation loop. J Biol Chem 275:3577. Niwa, R., K. Nagata-Ohashi, M. Takeichi, K. Mizuno, and T. Uemura. 2002. Control of actin reorganization by Slingshot, a family of phosphatases that dephosphorylate ADF/cofilin. Cell 108:233. Ohta, Y., K. Kousaka, K. Nagata-Ohashi, K. Ohashi, A. Muramoto, Y. Shima, R. Niwa, T. Uemura, and K. Mizuno. 2003. Differential activities, subcellular distribution and tissue expression patterns of three members of Slingshot family phosphatases that dephosphorylate cofilin. Genes Cells 8:811. DesMarais, V., I. Ichetovkin, J. Condeelis, and S. E. Hitchcock-DeGregori. 2002. Spatial regulation of actin dynamics: a tropomyosin-free, actin-rich compartment at the leading edge. J Cell Sci 115:4649. Ono, S. 2007. Mechanism of depolymerization and severing of actin filaments and its significance in cytoskeletal dynamics. Int Rev Cytol 258:1. Eibert, S. M., K. H. Lee, R. Pipkorn, U. Sester, G. H. Wabnitz, T. Giese, S. C. Meuer, and Y. Samstag. 2004. Cofilin peptide homologs interfere with immunological synapse formation and T cell activation. Proc Natl Acad Sci U S A 101:1957. Nishita, M., Y. Wang, C. Tomizawa, A. Suzuki, R. Niwa, T. Uemura, and K. Mizuno. 2004. Phosphoinositide 3-kinase-mediated activation of cofilin phosphatase Slingshot and its role for insulin-induced membrane protrusion. J Biol Chem 279:7193. Wabnitz, G. H., G. Nebl, M. Klemke, A. J. Schroder, and Y. Samstag. 2006. Phosphatidylinositol 3-kinase functions as a Ras effector in the signaling cascade that regulates dephosphorylation of the actin-remodeling protein cofilin after costimulation of untransformed human T lymphocytes. J Immunol 176:1668. Wang, Y., F. Shibasaki, and K. Mizuno. 2005. Calcium signal-induced cofilin dephosphorylation is mediated by Slingshot via calcineurin. J Biol Chem 280:12683. Nagata-Ohashi, K., Y. Ohta, K. Goto, S. Chiba, R. Mori, M. Nishita, K. Ohashi, K. Kousaka, A. Iwamatsu, R. Niwa, T. Uemura, and K. Mizuno. 2004. A pathway of neuregulin-induced activation of cofilin-phosphatase Slingshot and cofilin in lamellipodia. J Cell Biol 165:465. Kligys, K., J. N. Claiborne, P. J. DeBiase, S. B. Hopkinson, Y. Wu, K. Mizuno, and J. C. Jones. 2007. The slingshot family of phosphatases mediates Rac1 regulation of cofilin phosphorylation, laminin-332 organization, and motility behavior of keratinocytes. J Biol Chem 282:32520. Soosairajah, J., S. Maiti, O. Wiggan, P. Sarmiere, N. Moussi, B. Sarcevic, R. Sampath, J. R. Bamburg, and O. Bernard. 2005. Interplay between components of a novel LIM kinase-slingshot phosphatase complex regulates cofilin. Embo J 24:473. Mouneimne, G., L. Soon, V. DesMarais, M. Sidani, X. Song, S. C. Yip, M. Ghosh, R. Eddy, J. M. Backer, and J. Condeelis. 2004. Phospholipase C and cofilin are required for carcinoma cell directionality in response to EGF stimulation. J Cell Biol 166:697.  117  323. 324. 325. 326. 327. 328.  329. 330.  331.  332. 333.  334.  335.  Zebda, N., O. Bernard, M. Bailly, S. Welti, D. S. Lawrence, and J. S. Condeelis. 2000. Phosphorylation of ADF/cofilin abolishes EGF-induced actin nucleation at the leading edge and subsequent lamellipod extension. J Cell Biol 151:1119. Nishita, M., C. Tomizawa, M. Yamamoto, Y. Horita, K. Ohashi, and K. Mizuno. 2005. Spatial and temporal regulation of cofilin activity by LIM kinase and Slingshot is critical for directional cell migration. J Cell Biol 171:349. Davila, M., A. R. Frost, W. E. Grizzle, and R. Chakrabarti. 2003. LIM kinase 1 is essential for the invasive growth of prostate epithelial cells: implications in prostate cancer. J Biol Chem 278:36868. Aizawa, H., K. Sutoh, and I. Yahara. 1996. Overexpression of cofilin stimulates bundling of actin filaments, membrane ruffling, and cell movement in Dictyostelium. J Cell Biol 132:335. Pollard, T. D., and G. G. Borisy. 2003. Cellular motility driven by assembly and disassembly of actin filaments. Cell 112:453. Saxton, T. M., I. van Oostveen, D. Bowtell, R. Aebersold, and M. R. Gold. 1994. B cell antigen receptor cross-linking induces phosphorylation of the p21ras oncoprotein activators SHC and mSOS1 as well as assembly of complexes containing SHC, GRB-2, mSOS1, and a 145-kDa tyrosine-phosphorylated protein. J Immunol 153:623. Li, M., J. Marhold, A. Gatos, I. Torok, and B. M. Mechler. 2001. Differential expression of two scribble isoforms during Drosophila embryogenesis. Mech Dev 108:185. Barrios-Rodiles, M., K. R. Brown, B. Ozdamar, R. Bose, Z. Liu, R. S. Donovan, F. Shinjo, Y. Liu, J. Dembowy, I. W. Taylor, V. Luga, N. Przulj, M. Robinson, H. Suzuki, Y. Hayashizaki, I. Jurisica, and J. L. Wrana. 2005. High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307:1621. Tse, K. W., M. Dang-Lawson, R. L. Lee, D. Vong, A. Bulic, L. Buckbinder, and M. R. Gold. 2009. B cell receptor-induced phosphorylation of Pyk2 and focal adhesion kinase involves integrins and the Rap GTPases and is required for B cell spreading. J Biol Chem. Sanchez-Madrid, F., and M. A. del Pozo. 1999. Leukocyte polarization in cell migration and immune interactions. Embo J 18:501. Guinamard, R., N. Signoret, M. Ishiai, M. Marsh, T. Kurosaki, and J. V. Ravetch. 1999. B cell antigen receptor engagement inhibits stromal cell-derived factor (SDF)-1alpha chemotaxis and promotes protein kinase C (PKC)-induced internalization of CXCR4. J Exp Med 189:1461. Tse, K. W., M. Dang-Lawson, R. L. Lee, D. Vong, A. Bulic, L. Buckbinder, and M. R. Gold. 2009. B Cell Receptor-induced Phosphorylation of Pyk2 and Focal Adhesion Kinase Involves Integrins and the Rap GTPases and Is Required for B Cell Spreading. J Biol Chem 284:22865. Bubb, M. R., A. M. Senderowicz, E. A. Sausville, K. L. Duncan, and E. D. Korn. 1994. Jasplakinolide, a cytotoxic natural product, induces actin polymerization and competitively inhibits the binding of phalloidin to F-actin. J Biol Chem 269:14869.  118  336. 337. 338.  339. 340. 341. 342. 343. 344. 345.  346. 347.  348. 349.  Metais, J. Y., C. Navarro, M. J. Santoni, S. Audebert, and J. P. Borg. 2005. hScrib interacts with ZO-2 at the cell-cell junctions of epithelial cells. FEBS Lett 579:3725. Sanchez-Madrid, F., and J. M. Serrador. 2009. Bringing up the rear: defining the roles of the uropod. Nat Rev Mol Cell Biol 10:353. Giagulli, C., E. Scarpini, L. Ottoboni, S. Narumiya, E. C. Butcher, G. Constantin, and C. Laudanna. 2004. RhoA and zeta PKC control distinct modalities of LFA-1 activation by chemokines: critical role of LFA-1 affinity triggering in lymphocyte in vivo homing. Immunity 20:25. Carr, H. S., C. Cai, K. Keinanen, and J. A. Frost. 2009. Interaction of the RhoA exchange factor Net1 with discs large homolog 1 protects it from proteasomemediated degradation and potentiates Net1 activity. J Biol Chem 284:24269. Kupfer, A., and S. J. Singer. 1989. Cell biology of cytotoxic and helper T cell functions: immunofluorescence microscopic studies of single cells and cell couples. Annu Rev Immunol 7:309. Kuhn, J. R., and M. Poenie. 2002. Dynamic polarization of the microtubule cytoskeleton during CTL-mediated killing. Immunity 16:111. Lowin-Kropf, B., V. S. Shapiro, and A. Weiss. 1998. Cytoskeletal polarization of T cells is regulated by an immunoreceptor tyrosine-based activation motifdependent mechanism. J Cell Biol 140:861. Ratner, S., W. S. Sherrod, and D. Lichlyter. 1997. Microtubule retraction into the uropod and its role in T cell polarization and motility. J Immunol 159:1063. Serrador, J. M., M. Nieto, and F. Sanchez-Madrid. 1999. Cytoskeletal rearrangement during migration and activation of T lymphocytes. Trends Cell Biol 9:228. Chang, J. T., V. R. Palanivel, I. Kinjyo, F. Schambach, A. M. Intlekofer, A. Banerjee, S. A. Longworth, K. E. Vinup, P. Mrass, J. Oliaro, N. Killeen, J. S. Orange, S. M. Russell, W. Weninger, and S. L. Reiner. 2007. Asymmetric T lymphocyte division in the initiation of adaptive immune responses. Science 315:1687. Wodarz, A. 2000. Tumor suppressors: linking cell polarity and growth control. Curr Biol 10:R624. Hanada, N., K. Makino, H. Koga, T. Morisaki, H. Kuwahara, N. Masuko, Y. Tabira, T. Hiraoka, N. Kitamura, A. Kikuchi, and H. Saya. 2000. NE-dlg, a mammalian homolog of Drosophila dlg tumor suppressor, induces growth suppression and impairment of cell adhesion: possible involvement of downregulation of beta-catenin by NE-dlg expression. Int J Cancer 86:480. Ishidate, T., A. Matsumine, K. Toyoshima, and T. Akiyama. 2000. The APChDLG complex negatively regulates cell cycle progression from the G0/G1 to S phase. Oncogene 19:365. Fujita, H., S. Fukuhara, A. Sakurai, A. Yamagishi, Y. Kamioka, Y. Nakaoka, M. Masuda, and N. Mochizuki. 2005. Local activation of Rap1 contributes to directional vascular endothelial cell migration accompanied by extension of microtubules on which RAPL, a Rap1-associating molecule, localizes. J Biol Chem 280:5022.  119  350. 351. 352. 353. 354. 355.  356. 357.  Kaji, N., K. Ohashi, M. Shuin, R. Niwa, T. Uemura, and K. Mizuno. 2003. Cell cycle-associated changes in Slingshot phosphatase activity and roles in cytokinesis in animal cells. J Biol Chem 278:33450. Carlsson, L., L. E. Nystrom, I. Sundkvist, F. Markey, and U. Lindberg. 1977. Actin polymerizability is influenced by profilin, a low molecular weight protein in non-muscle cells. J Mol Biol 115:465. Wolven, A. K., L. D. Belmont, N. M. Mahoney, S. C. Almo, and D. G. Drubin. 2000. In vivo importance of actin nucleotide exchange catalyzed by profilin. J Cell Biol 150:895. Krause, M., E. W. Dent, J. E. Bear, J. J. Loureiro, and F. B. Gertler. 2003. Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu Rev Cell Dev Biol 19:541. Lauffenburger, D. A., and A. F. Horwitz. 1996. Cell migration: a physically integrated molecular process. Cell 84:359. van Rheenen, J., X. Song, W. van Roosmalen, M. Cammer, X. Chen, V. Desmarais, S. C. Yip, J. M. Backer, R. J. Eddy, and J. S. Condeelis. 2007. EGFinduced PIP2 hydrolysis releases and activates cofilin locally in carcinoma cells. J Cell Biol 179:1247. Dustin, M. L. 2004. Stop and go traffic to tune T cell responses. Immunity 21:305. Hirayama, A., R. Adachi, S. Otani, T. Kasahara, and K. Suzuki. 2007. Cofilin plays a critical role in IL-8-dependent chemotaxis of neutrophilic HL-60 cells through changes in phosphorylation. J Leukoc Biol 81:720.  120  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items