Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Probing the interaction of Aspergillus fumigatus conidia and human airway epithelial cells by transcriptional… Gomez, Pol 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_gomez_pol.pdf [ 2.9MB ]
Metadata
JSON: 24-1.0069080.json
JSON-LD: 24-1.0069080-ld.json
RDF/XML (Pretty): 24-1.0069080-rdf.xml
RDF/JSON: 24-1.0069080-rdf.json
Turtle: 24-1.0069080-turtle.txt
N-Triples: 24-1.0069080-rdf-ntriples.txt
Original Record: 24-1.0069080-source.json
Full Text
24-1.0069080-fulltext.txt
Citation
24-1.0069080.ris

Full Text

PROBING THE INTERACTION OF ASPERGILLUS FUMIGATUS CONIDIA AND HUMAN AIRWAY EPITHELIAL CELLS BY TRANSCRIPTIONAL PROFILING IN BOTH SPECIES   by  POL GOMEZ  B.Sc., The University of British Columbia, 2002     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE STUDIES  (Experimental Medicine)      THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)       January 2010   © Pol Gomez, 2010   ii ABSTRACT The cells of the airway epithelium play critical roles in host defense to inhaled irritants, and in asthma pathogenesis. These cells are constantly exposed to environmental factors, including the conidia of the ubiquitous mould Aspergillus fumigatus, which are small enough to reach the alveoli. A. fumigatus is associated with a spectrum of diseases ranging from asthma and allergic bronchopulmonary aspergillosis to aspergilloma and invasive aspergillosis. Airway epithelial cells have been shown to internalize A. fumigatus conidia in vitro, but the implications of this process for pathogenesis remain unclear. We have developed a cell culture model for this interaction using the human bronchial epithelium cell line 16HBE and a transgenic A. fumigatus strain expressing green fluorescent protein (GFP). Immunofluorescent staining and nystatin protection assays indicated that cells internalized upwards of 50% of bound conidia. Using fluorescence-activated cell sorting (FACS), cells directly interacting with conidia and cells not associated with any conidia were sorted into separate samples, with an overall accuracy of 75%. Genome-wide transcriptional profiling using microarrays revealed significant responses of 16HBE cells and conidia to each other. Significant changes in gene expression were identified between cells and conidia incubated alone versus together, as well as between GFP positive and negative sorted cells. The identification of biologically relevant responses in both species validates this methodology, and motivates further work to characterize the interactions   iii between A. fumigatus conidia and primary airway epithelial cells obtained from normal and asthmatic patients.   iv TABLE OF CONTENTS  ABSTRACT .............................................................................................................................ii TABLE OF CONTENTS........................................................................................................... iv LIST OF TABLES ................................................................................................................... vii LIST OF FIGURES ................................................................................................................ viii LIST OF ABBREVIATIONS ..................................................................................................... ix ACKNOWLEDGEMENTS ..................................................................................................... xiii DEDICATION ...................................................................................................................... xiv CHAPTER 1: INTRODUCTION ............................................................................................... 1 1.1 HOST-PATHOGEN INTERACTIONS IN MICROBIAL PATHOGENESIS ............................ 1 1.1.1 The damage-response framework of microbial pathogenesis .......................... 2 1.1.2 Transcriptional profiling of host-pathogen interactions ................................... 5 1.2 THE AIRWAY EPITHELIUM ......................................................................................... 7 1.2.1 Immune function of the airway epithelium ....................................................... 8 1.2.2 Roles of the airway epithelium in asthma pathogenesis ................................. 10 1.3 ASPERGILLUS FUMIGATUS ...................................................................................... 11 1.3.1 Virulence factors of Aspergillus fumigatus ...................................................... 12 1.3.2 Host defenses against Aspergillus fumigatus .................................................. 13 1.3.3 Diseases caused by Aspergillus fumigatus ....................................................... 14 1.4 OVERVIEW OF EXPERIMENTAL GOALS AND APPROACHES OF THE PRESENT RESEARCH ..................................................................................................................... 17 CHAPTER 2: CO-INCUBATION AND INTERNALIZATION OF ASPERGILLUS FUMIGATUS CONIDIA BY HUMAN BRONCHIAL EPITHELIAL CELLS ........................................................ 18 2.1 INTRODUCTION ....................................................................................................... 18 2.2 METHODS ................................................................................................................ 20 2.2.1 Aspergillus fumigatus strain and growth conditions ....................................... 20 2.2.2 Culture of human bronchial epithelial cells ..................................................... 21 2.2.3 Visualization of conidia uptake by 16HBE and NHBE cells by three dimensional rendering of the cell monolayer ............................................................................... 23 2.2.4 Quantification of conidia uptake by 16HBE cells by immunofluorescent staining ...................................................................................................................... 25 2.2.5 Quantification of conidia uptake by 16HBE cells by nystatin protection assay ................................................................................................................................... 26   v 2.3 RESULTS ................................................................................................................... 28 2.3.1 Localization of Aspergillus fumigatus conidia within 16HBE and NHBE cell monolayers ............................................................................................................... 28 2.3.2 Quantification of internalization of Aspergillus fumigatus conidia by 16HBE cells by immunofluorescent staining ........................................................................ 28 2.3.3 Confirmation and determination of time course of internalization by nystatin protection assay ........................................................................................................ 31 2.4 DISCUSSION ............................................................................................................. 33 2.5 SUMMARY ............................................................................................................... 36 CHAPTER 3: FLOW CYTOMETRIC ANALYSIS AND SORTING OF HUMAN BRONCHIAL EPITHELIAL CELLS INTERACTING WITH ASPERGILLUS FUMIGATUS CONIDIA ................... 38 3.1 INTRODUCTION ....................................................................................................... 38 3.2 METHODS ................................................................................................................ 41 3.2.1 Preparation of cell culture samples for flow cytometric analysis ................... 41 3.2.2 Flow cytometric analysis of 16HBE cells and Aspergillus fumigatus conidia .. 41 3.2.3 Sorting of 16HBE cells co-incubated with conidia into negative and positive cell samples ............................................................................................................... 42 3.3 RESULTS ................................................................................................................... 44 3.3.1 Flow cytometric analysis of samples of Aspergillus fumigatus conidia, 16HBE cells, and cells and conidia co-incubated together .................................................. 44 3.3.2 Sorting and re-analysis of 16HBE cells co-incubated with Aspergillus fumigatus conidia ....................................................................................................................... 44 3.3.3 Microscopic visualization of negative and positive sorted samples of 16HBE cells ........................................................................................................................... 47 3.4 DISCUSSION ............................................................................................................. 50 3.5 SUMMARY ............................................................................................................... 52 CHAPTER 4: TRANSCRIPTIONAL ANALYSIS OF HUMAN BRONCHIAL EPITHELIAL CELLS INTERACTING WITH ASPERGILLUS FUMIGATUS CONIDIA ................................................ 53 4.1 INTRODUCTION ....................................................................................................... 53 4.2 METHODS ................................................................................................................ 55 4.2.1 Overview of experimental design for dual-species transcriptional analysis ... 55 4.2.2 Extraction of RNA from samples of 16HBE cells and Aspergillus fumigatus conidia ....................................................................................................................... 56 4.2.3 Quantitative real-time PCR analysis of human and fungal mRNA signals from co-incubated samples ............................................................................................... 60 4.2.4 Microarray analysis of human and fungal transcriptomes .............................. 61 4.2.5 Statistical analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia ..................................................................................................... 63   vi 4.2.6 Statistical analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells............................................................................................................ 65 4.3 RESULTS ................................................................................................................... 66 4.3.1 Quantification and quality assessment of RNA extracted from samples of 16HBE cells and Aspergillus fumigatus conidia ........................................................ 66 4.3.2 Detection of human and fungal transcripts in co-incubated samples by quantitative real-time PCR ........................................................................................ 68 4.3.3 Analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia ....................................................................................................................... 68 4.3.4 Analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells ........................................................................................................................... 78 4.4 DISCUSSION ............................................................................................................. 82 4.4.1 Analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia ....................................................................................................................... 82 4.4.2 Analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells ........................................................................................................................... 92 4.5 SUMMARY ............................................................................................................... 94 CHAPTER 5: GENERAL CONCLUSIONS AND FUTURE DIRECTIONS .................................... 95 REFERENCES ...................................................................................................................... 99 APPENDIX 1: LIST OF DIFFERENTIALLY EXPRESSED HUMAN GENES IDENTIFIED IN THE UNSORTED EXPERIMENT ................................................................................................ 112 APPENDIX 2: LIST OF DIFFERENTIALLY EXPRESSED HUMAN GENES IDENTIFIED IN THE SORTED EXPERIMENT ..................................................................................................... 123 APPENDIX 3: LIST OF DIFFERENTIALLY EXPRESSED ASPERGILLUS FUMIGATUS GENES .. 155    vii LIST OF TABLES Table 4.1: RNA concentrations of samples from different experimental conditions ..... 67  Table 4.2: Over-represented Gene Ontology terms in the lists of differentially expressed genes between unsorted 16HBE cells incubated with or without conidia..................... 74  Table 4.3: Over-represented Gene Ontology terms in the lists of differentially expressed genes between 16HBE cells sorted as negative or positive ........................................... 75  Table 4.4: Genes showing the highest fold-changes between unsorted 16HBE cells incubated with or without conidia ................................................................................. 76  Table 4.5: Genes showing the highest fold-changes between 16HBE cells sorted as negative or positive......................................................................................................... 77  Table 4.6: Genes showing the highest fold-changes between A. fumigatus conidia incubated with or without human cells .......................................................................... 81   viii LIST OF FIGURES Figure 1.1: The damage-response curve for a Class 4 pathogen ...................................... 4  Figure 2.1: Localization of A. fumigatus conidia within the 16HBE cell monolayer ....... 29  Figure 2.2: Localization of A. fumigatus conidia within the NHBE cell monolayer ........ 30  Figure 2.3: Internalization of A. fumigatus conidia by 16HBE cells determined by immunofluorescent staining ........................................................................................... 32  Figure 2.4: Rates of internalization of A. fumigatus conidia by 16HBE cells determined by nystatin protection assay ................................................................................................ 34  Figure 3.1: FACS analysis of A. fumigatus conidia and 16HBE cells incubated alone or together .......................................................................................................................... 45  Figure 3.2: Re-analysis of negative and positive sorted cell samples to determine the accuracy of sorting .......................................................................................................... 48  Figure 3.3: Microscopic visualization of negative and positive sorted cell samples to determine the accuracy of sorting .................................................................................. 49  Figure 4.1: Experimental design for human and fungal transcriptional profiling .......... 57  Figure 4.2: Identification of fungal and human mRNA signals from unsorted, co- incubated samples .......................................................................................................... 69  Figure 4.3: Hierarchical clustering of human whole-genome microarrays grouped by experimental condition ................................................................................................... 71  Figure 4.4: Hierarchical clustering of individual human whole‐genome microarrays from negative and positive sorted samples ............................................................................ 72  Figure 4.5: Hybridization of human reference RNA to Aspergillus fumigatus specific microarray slide .............................................................................................................. 79   ix LIST OF ABBREVIATIONS 16HBE Immortalized human bronchial epithelial cell line A549 Tumour-derived type II pneumocyte cell line ABPA Allergic bronchopulmonary aspergillosis AIDS Acquired immune deficiency syndrome aRNA Amplified RNA ATCC American Type Culture Collection BEGM Bronchial epithelial growth medium BLAST Basic Local Alignment Search Tool BP Biological process BSA Bovine serum albumin CC Cellular component CCL C-C chemokine ligand CCL20 C-C chemokine ligand 20 CCL3 C-C chemokine ligand 3 CCL5 C-C chemokine ligand 5 CD4 Cluster of differentiation 4 cDNA Complementary DNA cRNA Complementary RNA CXCL3 C-X chemokine ligand 3 DAPI 4',6-diamidino-2-phenylindole DIC Differential interference contrast   x DMEM Dulbecco's Modified Eagle Medium DNA Deoxyribonucleic acid EDTA Ethylenediaminetetraacetic acid EM Extracellular matrix FACS Fluorescence-activated cell sorting FBS Fetal bovine serum FITC Fluorescein isothiocyanate FSC Forward scatter GFP Green fluorescent protein GO Gene Ontology GOEAST Gene Ontology Enrichment Analysis Software Toolkit HNEC Human nasal epithelial cell HUVE Human umbilical vein endothelial cell line IgE Immunoglobulin E IgG Immunoglobulin G IL8 Interleukin 8 IPA Invasive pulmonary aspergillosis LCM Laser capture microdissection LPS Lipopolysaccharide MBL Mannose-binding lectin MEM Minimal essential medium MF Molecular function MGST1 Microsomal glutathione S-transferase 1   xi MIAME Minimum Information About a Microarray Experiment MIP-1α Macrophage inflammatory protein-1α MMP Matrix metallopeptidase MMP1 Matrix metallopeptidase 1 MMP5 Matrix metallopeptidase 5 mRNA Messenger RNA MYPD Growth medium containing malt extract, yeast extract, peptone and dextrose NHBE Normal human bronchial epithelial cell P GDP Glyceraldehyde 3-phosphate dehydrogenase promoter PAMP Pathogen-associated molecular patterns PBS Phosphate-buffered saline PE R-phycoerythrin PRR Pattern-recognition receptor qRT-PCR Quantitative real-time polymerase chain reaction RANTES Regulated upon activation, normal T-cell expressed, and secreted RIN RNA integrity number RNA Ribonucleic acid ROI Reactive oxygen intermediates RPM Revolutions per minute RSV Respiratory syncytial virus SDS Sodium dodecyl sulfate SFTPC Surfactant protein C SLPI Secretory leukocyte proteinase inhibitor   xii SSC Side scatter SV-40 Simian virus 40 TEF1 Transcription elongation factor 1 Th1 Type 1 helper T-cell Th2 Type 2 helper T-cell TIGR The Institute for Genomic Research TLR Toll-like receptor    xiii ACKNOWLEDGEMENTS I would first like to thank Dr. Scott Tebbutt, my supervisor, for the support and guidance he has provided me with throughout these studies. His vision and continued dedication to this project allowed it to be successful, and I am grateful to have had the opportunity to take on such exciting research under his leadership. I wish to also thank Dr. Margo Moore and Dr. Darryl Knight, for their membership on my supervisory committee, and for their collaboration in this project. It is through their contribution of expertise relating to A. fumigatus and human airways that this integrative study was made possible, and I thank them for all the support they have provided for this work. I owe many thanks to Dr. Tillie Hackett, for support, advice, and technical help in many stages of this work. Likewise I wish to thank Linda Pinto, for sharing her years of experience in working with A. fumigatus. I would also like to thank Jian Ruan for his perpetual willingness to help with all aspects of the project. Learning from such positive mentors has greatly contributed to my experience. I would like to thank Martina Mai for her help with flow cytometry, Anne Haegert for her microarray work, and Robert Bell for his assistance with statistical analysis. This multidisciplinary effort could not have been completed without their contributions. I am grateful for the support of the iCAPTURE Centre, and for the funding provided by the National Sanitarium Association and AllerGen NCE.   xiv DEDICATION    For my family and friends, who have always supported me throughout this journey.    1 CHAPTER 1: INTRODUCTION 1.1 HOST-PATHOGEN INTERACTIONS IN MICROBIAL PATHOGENESIS Infectious diseases are, by definition, those that are caused by the presence of microbes in the body that result in damage to host cells, tissues, or organs. The microbes that cause such diseases are considered pathogens, and the traits they possess that allow them to cause disease are termed virulence factors. While this classical understanding of pathogenicity and virulence addresses the role played by the microbe in disease pathogenesis, it fails to reflect the important role that the host response also plays in the disease process. This early view followed from the initial identification of microbes as disease-causing agents, at a time when the variable immune responses of hosts were poorly understood [1]. The role of the host response in disease became gradually more evident, however, as more nuanced host-microbe interactions were identified, including commensalism and opportunism [2]. Advances in medicine over the last century have greatly reduced mortality rates associated with infectious diseases in developed countries, and an increased understanding of the pathology resulting from the host’s immune response to a microbe, rather than from the direct effects of that microbe, has highlighted the dynamic nature of host-microbe interactions [1]. It has thus become clear that disease should be regarded as the result of a given host- pathogen interaction, and not simply as the effects of an active microbe on a passive host.   2 1.1.1 The damage-response framework of microbial pathogenesis Casadevall and Pirofski have proposed the “damage-response framework” to describe the contributions of both the microbe and the host in microbial pathogenesis [3]. This framework is based on the following three tenets. First, that microbial pathogenesis results from an interaction between a host and a microorganism. Second, that the relevant outcome of this interaction is the amount of damage incurred by the host as a result of this interaction. Third, that host damage can result from both microbial factors and/or the host response. This view is neither microbe-centered nor host-centered, but rather damage-centered, allowing contributions from both host and microbe to be considered in the same context. Host factors preventing an appropriate immune response, namely one which prevents microbe-mediated damage without itself inducing host damage, are analogous to microbial virulence factors. This framework also places microbial pathogenesis in the more general context of host-microbe interactions. For example, the only distinction between commensal and pathogenic microorganisms is that host damage results from interactions with the latter but not the former. Thus, the fact that normally commensal organisms may cause disease in some hosts, due to inadequate immunity, is easily incorporated into this framework. Importantly, the damage-response framework motivates a revision of the definition of virulence, to include both host and microbe influences. Since they both contribute to host damage, virulence cannot be considered a simple attribute of a microbe, but rather a function of a given host-microbe interaction [4].   3 The damage-response framework allows microbes to be classified according to how the host damage caused by their presence varies as a function of the host response they induce, represented as a damage-response curve [3]. For example, opportunistic pathogens are those that only cause disease in the context of a weakened immune response. On the other hand, microbes that elicit hypersensitivity reactions are associated with disease in the context of an overly strong immune response. The usefulness of this framework is most evident when considering more complex scenarios, such as microbes that are capable of inducing host damage in the context of an immune response that is either too weak or too strong. These are classified as Class 4 pathogens within the damage-response framework, with a damage-response curve as shown in Figure 1.1. Aspergillus fumigatus is a classic example of such an organism [3, 5]. This ubiquitous mould does not cause disease in most hosts. However, immunosuppressed hosts, including those with AIDS or receiving chemotherapy for cancer, are susceptible to serious mycoses, where invasive fungal growth results in necrotic tissue damage. On the other end of the spectrum, in the context of allergy and asthma, A. fumigatus is associated with allergic bronchopulmonary aspergillosis, where an intense but ineffective immune reaction to fungal antigens results in chronic inflammation and permanent damage to lung tissues. The spectrum of potential outcomes depending on host status highlights the complexity of the host-microbe interaction, and the important role of both host and microbe in pathogenesis.   4 Figure 1.1: The damage-response curve for a Class 4 pathogen.    The damage-response framework of microbial pathogenesis, proposed by Casadevall and Pirofski [3], highlights the dynamic interplay between host and pathogen that results in pathogenesis, and classifies pathogens according to how the host damage they cause varies with the immune response that the host mounts. Class 4 pathogens, exemplified by A. fumigatus, cause damage at the extremes of strong or weak immune responses, but not in the context of an appropriate immune response. (Figure adapted from Casadevall and Pirofski, 2003)    5 1.1.2 Transcriptional profiling of host-pathogen interactions It follows from the damage-response framework that studies on pathogenesis should consider the dynamic interplay between host and pathogen [4]. Transcriptional profiling of both the host and the pathogen in the context of their interaction provides a powerful tool for the analysis of this interaction [6, 7]. This approach is made possible by the availability of full genome sequences for not only humans but also many important pathogens, and by the development of microarray technology to simultaneously interrogate the abundance of thousands of known or predicted transcripts from these genomes. Transcriptional profiling of the pathogen provides insight into its metabolic state, and the mechanisms it uses to thrive during infection. Furthermore, specific pathogen responses may shed light on the microenvironment it faces within the host. The transcriptome response of the host, on the other hand, reveals the mechanisms it activates to combat the microbe, and also indicates what effects the microbe has on it [6]. Both transcriptomes will thus be seen to reflect the complex interplay between host and microbial factors. Only profiling of both the host and the pathogen during their interaction will provide a complete understanding of the mechanisms that mediate disease. This dual-organism transcriptomic approach has previously been applied to the study of the interactions between plants and their parasites. In particular, the interactions between soybean (Glycine max) and two of its major parasites, the oomycete Phytophthora sojae and the nematode Heterodera glycines, have been studied by simultaneous transcriptional profiling of both species [8, 9]. These studies   6 revealed coordinated gene expression patterns in the host and the parasite, corresponding to the major stages of the infection process. While numerous studies have applied whole genome transcriptional profiling to the interactions between mammalian hosts and microbes, very few have investigated both transcriptional profiles simultaneously. Simultaneous host-pathogen profiling in a mammalian model was first reported by Motley et al., who studied Escherichia coli infection using a murine granulomatous pouch model [10]. This work identified key aspects of the response of both host and pathogen, including unexpected stress response genes by the bacteria, and the induction of mediators of innate immunity and acute phase response proteins by the mouse [10]. A more recent study by Lovegrove et al. investigating a murine cerebral malaria model analyzed Plasmodium berghei and mouse transcriptional profiles from the brain, lung, liver and spleen of either resistant or susceptible mouse strains at three time points [11]. The ensuing analysis revealed distinct P. berghei transcriptional signatures not only from the different body sites, but also from susceptible versus resistant hosts, highlighting the profound impact of host genetic background and tissue microenvironment on the pathogen. Furthermore, comparing murine expression profiles from susceptible and resistant mice revealed differences in both baseline expression levels and temporal responses to infection, mostly associated with immune function [11]. Such studies promise a greater understanding of the intricate host-pathogen interactions responsible for disease, and, as more hosts and pathogens are profiled, will highlight both commonalities and differences between different host-pathogen interactions. Given the power of such a   7 systems biology approach, the research presented here aimed to apply simultaneous host-pathogen transcriptional profiling to the interaction between human airway epithelial cells and A. fumigatus conidia. 1.2 THE AIRWAY EPITHELIUM The epithelium of the lung represents an immense surface area of interface between the environment and the internal milieu, estimated to approximate that of a tennis field [12]. It is the first point of contact for inhaled pollutants, airborne allergens, and microorganisms [13]. Studies over the past several decades have made it increasingly clear that beyond providing a critical physical barrier to infection, it also plays an active role in immunity, through environmental sensing and pathogen detection, signaling to modulate both innate and adaptive immune responses, and direct antimicrobial activities [14]. The alveoli account for the vast majority of the surface area of the lung epithelium, and are lined by two predominant cell types: type I and type II pneumocytes. Type I pneumocytes are thin, stretched out cells responsible for gas exchange. Although they are less numerous than type II cells, they cover more than 95% of the alveolar surface. Type II pneumocytes are much smaller than type I cells, release surfactant which reduces surface tension in the alveolus, and differentiate into type I cells to replace these following injury [15]. The airway epithelium, which makes up less than 1% of the surface of the lung epithelium, is pseudostratified, columnar, or cuboidal, and consists mostly of ciliated, undifferentiated, secretory and basal cells [16].   8 The airway epithelium lies on a basement membrane, which provides an anchor to facilitate adhesion and migration of epithelial cells, regulates their phenotype and polarity, and separates them from the underlying mesenchymal tissue [17]. Infiltrating inflammatory and immune cells can move freely through this membrane and between epithelial cells [17]. 1.2.1 Immune function of the airway epithelium The airway epithelium plays a vital role in protecting the human body from foreign particles. First, the tight junctions that fasten together epithelial cells prevent the passage of molecules between adjacent cells, forming a physical barrier that protects underlying tissues [18]. Secondly, the mucociliatory elevator system, consisting of mucus-secreting and ciliated cells, functions to effectively clear inhaled pollutants, allergens and microbes from the lungs [19, 20]. In addition to these well characterized roles, the airway epithelium also participates in innate immune responses [12]. While innate immunity was once regarded as quite non-specific, it is now clear that recognition of pathogens is mediated by specific binding of conserved pathogen- associated molecular patterns (PAMPs) by pattern-recognition receptors (PRRs). These PRRs are present on the surface of leukocytes and airway epithelial cells, and as part of the surfactant secreted by the epithelium [12]. The Toll-like receptor (TLR) family represents the best studied PRRs, with ten members identified in humans, recognizing specific ligands such as lipopolysaccharide (LPS), flagellin, CpG DNA, and other characteristics of viruses, bacteria and fungi [21]. The variety of adaptor molecules, protein kinases, and transcription factors involved in TLR signaling allows diverse   9 downstream effects, and the fact that different cell types express different subsets of TLRs leads to responses that are characteristic of both the cell type and microorganism involved [21]. TLR signaling leads to the up-regulation of genes encoding cytokines, chemokines, and antimicrobial peptides, and can induce increased expression of the TLRs themselves [13]. Furthermore, TLR signaling enhances maturation and antigen presentation in dendritic cells, thus modulating both innate and adaptive immune responses [21]. TLR2 and TLR4 are the best studied members of the TLR family, and show expression in lung epithelial cells, albeit at relatively low levels [12, 22]. They are well known as the principal receptors responsible for recognition of gram-positive and gram- negative bacteria, respectively [13]. They are also important in the recognition of a much wider range of ligands, however, and have been implicated in resistance to insults including Mycobacterium tuberculosis, respiratory syncytial virus (RSV), A. fumigatus, and inhaled particulate matter [21]. Furthermore, TLR4 has been implicated in asthma pathogenesis via the skewing of the adaptive response to a Th2 phenotype [23]. In addition to the TLRs, epithelial cells also secrete soluble PRRs including surfactant proteins A and D, and mannose-binding lectin (MBL) [12]. Recognition of inhaled particles by epithelial cells leads them to secrete mediators such as chemokines and cytokines to attract professional immune cells, but some of their secretions also show direct antimicrobial activity. These include short antimicrobial peptides such as defensins, and larger proteins such as lysozyme, lactoferrin, and secretory leukocyte proteinase inhibitor (SLPI) [24]. These may kill   10 invading microbes, or inhibit their growth until they can be eliminated by the mucociliatory elevator or phagocytosed by professional cells of the immune system [13]. 1.2.2 Roles of the airway epithelium in asthma pathogenesis Asthma is a disorder characterized by bronchial hyperreactivity, chronic airway inflammation and airway wall remodeling, and reversible airway constriction resulting in restricted airflow. Its incidence in industrialized countries has risen dramatically over the past several decades, with estimates of prevalence reaching 10-20% of the population [25]. It is a complex disease generally understood to result from a combination of environmental factors, including infection or allergen exposure, and genetic predisposition. A large body of work has focused on immunological aspects of asthma pathogenesis, and the role of a Th2 biased immune response in asthma is well supported [26]. It has become clear, however, that immune dysregulation is only partly responsible for asthma pathogenesis, and the airway epithelium has gathered increasing attention as a primary driver of asthma [27-29]. This fundamental role of the epithelium in asthma pathogenesis may explain the fact that while immunosuppressive corticosteroid therapy effectively alleviates the asthma symptoms of airway constriction and inflammation, it is not curative and does not alter the long term progression of disease [30]. Indeed, there is evidence that the epithelium of asthmatics is fundamentally abnormal, with increased susceptibility to environmental injury and impaired repair mechanisms [31]. Consequently, asthmatic epithelium releases pro- inflammatory mediators as well as growth factors that will act on underlying fibroblasts, driving airway remodeling [31]. The primary role of the airway epithelium in asthma   11 pathogenesis is supported by the finding that epithelial damage and airway remodeling may predate the onset of asthma symptoms [32, 33]. Furthermore, genetic association studies have identified strong links between asthma and genes expressed by cells of the airway epithelium and underlying mesenchymal tissue [34]. 1.3 ASPERGILLUS FUMIGATUS Aspergillus fumigatus is a filamentous mould in the phylum Ascomycota that is common in every region of the world, universally found in soil and compost heaps, as well as in most indoor environments [35]. It plays an important ecological role as a saprophyte, contributing to carbon and nitrogen recycling through degradation of plant material by secreted hydrolytic enzymes. It grows as septate hyphae, which form a fungal mass known as a mycelium. Although it has recently been shown to reproduce sexually [36], it achieves widespread dispersal by asexual reproduction, through the release of haploid conidia (also known as conidiospores) from conidiophores, the specialized ends of hyphae [36]. Each conidiophore releases thousands of conidia, which are small enough (~2-3 µm) to be buoyant in air, relying on air currents for their dispersal [5]. Although Aspergillus is not the most prevalent genus of fungus worldwide, it is among the most ubiquitous of those that produce airborne conidia. Estimates of 1 to 100 colony forming units of A. fumigatus per cubic meter of air have been reported for indoor and outside air, and this widespread distribution ensures that all humans are likely to inhale at least hundreds of conidia each day [5, 37].   12 1.3.1 Virulence factors of Aspergillus fumigatus It has been suggested that the pathogenicity of A. fumigatus is due to those characteristics that make it an effective saprophyte, including small conidia size, thermotolerance (due to the high temperatures generated by decomposing plant matter), high flexibility in nutrient use, and resistance to oxidative stress [37-40]. Thus the mechanisms that A. fumigatus has evolved to be competitive in its environmental niche also allow it to thrive in a human host that is unable to mount an adequate immune response. However, it is also clear that A. fumigatus possesses specific factors making it especially suited to colonization of human hosts [38]. While environmental and hospital sampling indicate that A. fumigatus is not the most prevalent of the Aspergillus species [41-44], it is by far the most common species to cause disease [45- 49]. The bulk of evidence indicates that virulence is polygenic, and, importantly, strongly dependent upon host status [37]. Indeed, the choice of an animal model greatly impacts the results of studies aiming to identify fungal virulence factors [50]. Genes involved in nutrient synthesis or uptake, iron acquisition, pigment biosynthesis, and production of gliotoxin (which has immunosuppressive and ciliostatic effects on host cells) have all been shown to affect virulence [51-61]. However, these do not fit the definition of a true virulence factor, as mutants showing attenuated virulence generally also have impaired growth rates in vitro [37].   13 1.3.2 Host defenses against Aspergillus fumigatus The first line of defense against inhaled conidia is mucociliary clearance, which limits the number of conidia that are able to reach the small airways. However, the most important mechanisms for the elimination of A. fumigatus are clearance by alveolar macrophages and neutrophils [38]. Alveolar macrophages are the predominant resident phagocytes in the lung, and have been shown to effectively ingest and then kill conidia following the acidification of the phagolysosome and release of reactive oxygen intermediates (ROIs) [62, 63]. This process is slow, however, and seems to depend on the swelling of phagocytosed conidia, and elicits only a weak immunological response [64]. Germination of conidia and growth of hyphae, on the other hand, induces a strong immunological response resulting in the recruitment of neutrophils to the site of infection. Neutrophils adhere to the surface of hyphae, which are too large to internalize, and rapidly kill them via a respiratory burst, degranulation, and the release of ROIs [65, 66]. These innate immunity mechanisms appear to be sufficient to prevent disease caused by A. fumigatus, as mice lacking adaptive immunity do not show higher susceptibility to invasive fungal disease [38, 67]. However, adaptive responses work to provide further protection from infection, and the induction of a Th1 CD4+ lymphocyte response is protective in animal studies of invasive disease [68, 69]. The different responses to A. fumigatus conidia and hyphae have important repercussion for the host. While a strong immunological response to ubiquitous conidia would lead to undesirable chronic inflammation, the presence of hyphae indicates a failure to control conidial germination, and must elicit a robust proinflammatory   14 response to prevent uncontrolled mycelial growth. Immune dysregulation causing either over-abundant activation or insufficient control of fungal growth results in significant damage to the host, leading to its common classification as both an allergen and an opportunistic pathogen [70]. This is described within the damage-response framework as a Class 4 pathogen, as described above [1, 3]. 1.3.3 Diseases caused by Aspergillus fumigatus A. fumigatus causes a spectrum of diseases in humans which are primarily determined by the immune status of the host, ranging from local hypersensitivity reactions to often fatal systemic mycoses [70, 71]. Although infections by A. fumigatus have been described at other sites, the respiratory tract is the main route of entry and site of infection. The three predominant forms of disease caused by A. fumigatus are allergic bronchopulmonary aspergillosis (ABPA), aspergilloma, and invasive pulmonary aspergillosis (IPA) [5, 72]. 1.3.3.1 Allergic bronchopulmonary aspergillosis Allergic bronchopulmonary aspergillosis (ABPA) is a serious condition estimated to occur in about 1-2% of chronic asthmatics and 10% of individuals with cystic fibrosis [73-75], which does not resolve simply by eliminating exposure to A. fumigatus [5]. It is generally associated with hyphal growth in the mucus of the bronchial tree, epithelial cell activation, a vigorous but ineffective Th2 CD4+ lymphocyte response, and IgE and IgG mediated hypersensitivity to conidia [76, 77]. It is thought that hyphae that persist in the mucus release proteases which damage the epithelium and compromise its   15 barrier function. The resulting increased exposure of lymphocytes to A. fumigatus antigens then leads to a skewed Th2 response due to predisposing genetic factors in the host [78, 79]. The ensuing influx of neutrophils and eosinophils causes further tissue damage, bronchiectasis and airway remodeling characteristic of asthma, and may lead to permanent lung injury and fibrosis [76]. Symptoms may extend to fever and hemoptysis. Following diagnosis, treatments combining corticosteroids with antifungal therapy are usually effective, with most patients recovering and maintaining adequate lung function [76]. 1.3.3.2 Aspergilloma Aspergilloma, commonly referred to as a fungal ball, is a non-invasive fungal growth in a pre-existing lung cavity, as may result from tuberculosis, sarcoidosis, or other cavitary lung diseases [80]. It is the most common and best recognized form of aspergillosis, occurring in 10-15% of patients with such cavities [72, 81]. The fungal mass consists of a mycelium within a proteinaceous mucus matrix and is usually stable in size [5, 72]. The majority of patients are mainly asymptomatic, with only mild hemoptysis, but severe and potentially fatal hemoptysis may occur as a result of mechanical or endotoxin-mediated damage to blood vessels surrounding the cavity [81-83]. Antifungal therapy seems to have limited effectiveness, likely due to the inability of drugs to penetrate the fungal mass, and surgical removal is associated with significant mortality [80, 84, 85]. Therefore, treatment is generally not recommended in asymptomatic patients [72].   16 1.3.3.3 Invasive Pulmonary Aspergillosis Invasive pulmonary aspergillosis (IPA) is a serious systemic infection, resulting from the overall failure of the host immune system to control the growth of A. fumigatus [86]. Neutropenia (defined as a blood neutrophil count of less than 500 cells per µl) is the single most significant risk factor, and the estimated risk of IPA increases with the duration of neutropenia at a rate of 1% per day for the first three weeks and 4% per day after that [87]. IPA is estimated to account for 7.5% of all infections in neutropenic individuals following therapy for acute myelogenous leukemia [87]. Chronic granulomatous disease, causing neutrophil dysfunction, is also associated with a high incidence of IPA [88]. Immunosupression following transplantation (especially bone marrow and lung transplantation), cytotoxic chemotherapy for cancer, and AIDS are also major risk factors for IPA [45, 47, 49, 88-91]. The primary site of infection is usually the lower respiratory tract, resulting in symptoms including fever, cough, sputum production and dyspnea, and invasion of the lung parenchyma results in pleuritic chest pain and hemoptysis [72]. Invasion of blood vessels leads to hemorrhaging, and hematogenous spread of the fungus to various sites in the body, including the brain, kidneys, or gastrointestinal tract [92]. Such dissemination is associated with increased morbidity and mortality, and infection of the central nervous system in particular is almost invariably fatal [93, 94]. The outcome of treatment is highly dependent on early diagnosis, aggressive antifungal therapy, and recovery of the host defense mechanisms [72, 95]. Despite improvements in diagnosis and therapy, the various manifestations of IPA are still associated with mortality rates of 50% or more [96-98].   17 1.4 OVERVIEW OF EXPERIMENTAL GOALS AND APPROACHES OF THE PRESENT RESEARCH The important role of airway epithelial cells in both pathogen recognition and asthma pathogenesis, the spectrum of diseases associated with A. fumigatus, and the constant contact between these cells and conidia in vivo motivates the further investigation of their interaction. The overarching hypothesis for this project is that the interaction between human bronchial epithelial cells and A. fumigatus conidia would lead to altered levels of gene expression in both organisms. The main goals were thus to develop a cell culture model for this interaction, and apply whole genome transcriptional profiling to both the human bronchial epithelial cells and A. fumigatus conidia. This work was undertaken in three major steps, which are presented in the following chapters. First, as described in Chapter 2, co-culture experiments were undertaken to establish the cell culture model and to investigate the internalization of conidia by cultured epithelial cells. Secondly, flow cytometry was applied to the cell culture model to refine the analysis of the response of cultured cells to conidia, by isolating from co-incubated cultures those cells that were directly interacting with conidia from those that were not. These experiments are presented in Chapter 3. Thirdly, transcriptional analysis was performed on both the human cells and the A. fumigatus conidia, incubated in isolation or together, to determine each one’s response to the other at the level of gene expression, as detailed in Chapter 4. Finally, overall conclusions and future directions are presented in Chapter 5.   18 CHAPTER 2: CO-INCUBATION AND INTERNALIZATION OF ASPERGILLUS FUMIGATUS CONIDIA BY HUMAN BRONCHIAL EPITHELIAL CELLS 2.1 INTRODUCTION The development of in vitro culture systems modeling human airway epithelial cells has been a great asset in elucidating biochemical and genetic contributions to a variety of lung diseases including cystic fibrosis and cancer [99]. Cell culture systems have also been applied to the study of microbial pathogenesis, where they provide several advantages over more complex models [6]. First, cultured cells are readily available for multiple repeated analyses, ensuring that reproducible results can be obtained. Second, the ratio of cells to microbes can be easily controlled, and can be much higher than would be possible using an animal model. Third, the interaction between a microbe and a single, defined cell type in culture is much simpler than that between a microbe and the complex and dynamic mixture of cell types that would be found in vivo. Thus, cell culture provides a convenient system in which to decipher the basic interactions between a given cell type and a pathogen, and their contribution to disease progression [6]. Internalization of microorganisms by eukaryotic cells is a widespread phenomenon with often important implications for both species involved. For the host, internalization of microbes is the major mechanism for the elimination of invading   19 microbial pathogens, including fungi [100, 101]. Indeed, several differentiated cell types of the immune system are professional phagocytes devoted to this function. However, other cell types have also been observed to internalize microorganisms, but exhibit a much lower ability to destroy them [102]. For the microorganism, there may be several advantages to internalization [103]. The intracellular environment may represent a nutrient-rich setting in which to grow, while protected from the host immune response. Furthermore, internalization within host cells may be important in microbial dissemination, facilitating the crossing of tissue planes or dissemination within circulating blood cells. The end result of internalization is dependent on both the host cell and the invading microbe, and microbial species have evolved mechanisms to avoid degradation and promote a favourable environment in which to reside and/or proliferate following phagocytosis [104]. The importance of professional phagocytes in the clearance of inhaled A. fumigatus conidia has motivated multiple studies on the internalization of conidia by these cells [62, 105-109]. Fewer studies have investigated the internalization of A. fumigatus conidia by non-professional phagocytes [102, 110-114]. Uptake of conidia by non-professional phagocytes was first demonstrated in the tumour-derived type II pneumocyte cell line A549 [110] and in primary tracheal epithelial cells, type II pneumocytes, and umbilical vein endothelial cells [111], by electron microscopy. Further work in Dr. Moore’s laboratory quantified the uptake of conidia by the A549 and human umbilical vein endothelial (HUVE) cell lines and investigated the fate of A. fumigatus conidia following internalization [112, 113]. A549 and HUVE cells were shown to   20 internalize 30% and 50% of bound conidia following 6 hours of co-incubation, respectively [112]. In another study, co-incubation of conidia with primary human nasal epithelial cells (HNEC) for 4 hours yielded an internalization rate of about 20% [114]. These studies showed the delayed germination but long term survival, beyond 24 hours, of internalized conidia, suggesting a role of normally non-phagocytic cells as reservoirs for invading A. fumigatus conidia [112-114]. Furthermore, the finding that diverse non- professional phagocytic cell types internalize A. fumigatus conidia in vitro highlights the potential importance of this process in the interaction of conidia with host cells [111]. Further studies are thus required to determine the importance of internalization of conidia by non-professional phagocytes in vivo, and its implications for pathogenesis. The aims of the research outlined in this chapter were to establish a cell culture model for the interaction between A. fumigatus conidia and human bronchial epithelial cells, and to investigate and quantify the uptake of A. fumigatus conidia by these cells. Given bronchial epithelial cells’ role as the first point of contact for inhaled A. fumigatus conidia, internalization by these cells may have important implications for the progression of disease resulting from their inhalation. 2.2 METHODS 2.2.1 Aspergillus fumigatus strain and growth conditions All experiments were performed using a green fluorescent protein (GFP) expressing strain of A. fumigatus previously developed in Dr. Moore’s laboratory [112]. Briefly, the A. fumigatus strain ATCC 13703 (American Type Culture Collection,   21 Manassas, VA) was transformed by electroporation with a plasmid containing the sequence-optimized sGFP gene driven by the Aspergillus nidulans glyceraldehyde 3- phosphate dehydrogenase promoter (P gdp). This construct yielded stable, high expression of GFP in both conidia and hyphae [112]. For long-term storage, conidia were kept at 4oC on MYPD agar medium (0.3% malt extract, 0.3% yeast extract, 0.5% peptone, 0.5% dextrose, 1.5% agar) supplemented with hygromycin (100µg/ml) to suppress the growth of wild-type fungus. To obtain fresh conidia for each experiment, conidia were dabbed from this stock using sterile cotton swabs, streaked onto MYPD agar plates, and incubated for three days at 37oC. Mature conidia were harvested by gently scrubbing these plates with sterile cotton swabs with phosphate-buffered saline (PBS) with 0.05% Tween-20. The resulting conidia suspension was vortexed and passed through a glass wool-plugged funnel to filter out any hyphae. The suspension was again vortexed, pelletted, and resuspended in 1ml PBS. A 100x dilution of this suspension was obtained by transferring 10µl into 990µl of PBS, and conidia were counted using a hemocytometer. Using this procedure, one MYPD plate typically yielded more than 109 conidia for co-incubation experiments. 2.2.2 Culture of human bronchial epithelial cells The majority of experiments were performed using the 16HBE cell line, an SV-40 transformed immortalized cell line that retains key characteristics of human bronchial epithelium, including the formation of a polarized monolayer, the presence of tight junctions, and directional ion transport, making it a convenient in vitro model of the   22 human bronchial epithelium [115]. 16HBE cells were maintained in Tissue Culture Dishes (Sarstedt, Nümbrecht, Germany) in Dulbecco’s modified Eagle’s medium (DMEM) with high glucose and L-glutamine (Gibco, Carlsbad, CA), supplemented with 10% v/v fetal bovine serum (FBS), Na-pyruvate (110mg/L), penicillin (16mg/L), streptomycin (100mg/L), and NaHCO3 (3.7g/L), at 37oC and 5% CO2 in a Forma Scientific Model 3554 humidified incubator (Thermo Scientific, Waltham, MA). Cells were passaged at confluence by suctioning away the medium and incubating them in 5ml trypsin-EDTA (Sigma-Aldrich, St. Louis, MO) for 5 minutes at 37oC. Gentle shaking ensured thorough disruption of the monolayer, as confirmed by inspection under microscope. Trypsin was inactivated by addition of 10ml cell culture medium, the cell suspension was centrifuged for 6 minutes at 1000RPM (168g) in a Baxter CanLab Megafuge 1.0 (Heraeus Instruments, Waltham, MA) and the pellet was resuspended in fresh medium. Primary normal human bronchial epithelial (NHBE) cells were a kind gift from Dr. Knight’s laboratory at the iCAPTURE Centre (Vancouver, BC). These were obtained from human organ donor lungs deemed unsuitable for transplantation, according to previously described methods [116]. Briefly, lungs were obtained through the International Institute for the Advancement of Medicine (Edison, NJ) or the Pacific Northwest Transplant bank (Portland, OR). Following surgical removal, lungs were washed in Custodiol HTK solution (Odyssey Pharmaceuticals Inc., East Hanover, NJ) and placed on ice for transportation. Trachea and bronchi were dissected into short segments (2-4cm) and rinsed in cold PBS to remove blood and mucus plugs, and epithelium was then dissociated with 1.4mg/ml Pronase and 0.1mg/ml DNase (Roche   23 Diagnostics, Indianapolis, IN) in 100ml minimal essential medium (MEM) for 16 hours at 4oC. The segments were then rinsed in MEM and dissociated cell clumps were strained through a 70 µm nylon mesh (Becton, Dickinson and Company, Franklin Lakes, NJ). Cells were then incubated in MEM with 10% v/v FBS for 10 minutes to neutralize the Pronase and washed twice with MEM at 4oC. Adherent cells were grown in bronchial epithelial growth medium (BEGM; Cambrex, Walkersville, MD). 2.2.3 Visualization of conidia uptake by 16HBE and NHBE cells by three dimensional rendering of the cell monolayer 16HBE cells were seeded in 4-chamber CultureSlides (BD Biosciences, Franklin Lakes, NJ) at 3x104 cells per chamber in 1ml DMEM and incubated for 3 days at 37oC and 5% CO2, allowing them to grow to form a confluent monolayer, with roughly 105 cells per chamber. NHBE cells were seeded at 104 cells per chamber in 1ml BEGM and incubated at 37oC and 5% CO2 until confluent. Chambers with either cell type were blocked with 0.1% bovine serum albumin (BSA) in DMEM or BEGM for one hour at 37oC to reduce non-specific binding of conidia, especially to any exposed portions of the chamber slides. The BSA-supplemented media was then replaced with 500µl of fresh DMEM or BEGM and spiked with 105 A. fumigatus conidia in a small volume (<10µl) of PBS, for a final multiplicity of infection of one conidia per cell. The cells and conidia were co-incubated at 37oC for 6 hours, and then washed three times in PBS with 0.1% Tween- 20 to remove any conidia not bound to cells. Cultures were then fixed in 4% w/v EM   24 grade paraformaldehyde (Fisher Scientific, Ottawa, ON) in PBS for 20 minutes at room temperature, and then stored at 4oC in 0.1% BSA in PBS until immunostaining. Chambers were stained with a primary monoclonal rabbit antibody against the tight-junctional protein E-Cadherin (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:250 in PBS for 2 hours at room temperature, washed three times in PBS with 0.1% Tween-20. Chambers were then incubated with goat anti-rabbit IgG Alexa Fluor 594 (Invitrogen, Carlsbad, CA) diluted 1:500 in PBS for 2 hours at room temperature, and washed three times again. Chambers were then incubated with DAPI (4',6-diamidino-2- phenylindole) in PBS (1µg/ml) for 15 minutes to label cell nuclei. The chamber wells were removed and the slides dried by sequential one minute immersions in 70%, 95%, and 100% ethanol before addition of Cytoseal 60 mounting medium (Electron Microscopy Sciences, Hatfield, PA) and cover-slipping. All specimens were imaged using the Multiphoton Confocal Microscope System at the Core 3 Dynamic Cellular Imaging and Biophysics facility of the iCAPTURE Centre. Images were acquired using a Leica AOBS SP2 laser scanning confocal microscope (Leica, Heidelberg, Germany) with Zeiss LSM 510 software, version 3.2 (Carl Zeiss Canada Inc., Toronto, ON). Series of images were acquired in the Z-plane, allowing for three dimensional reconstruction and visualization of the cell monolayer and associated A. fumigatus conidia.   25 2.2.4 Quantification of conidia uptake by 16HBE cells by immunofluorescent staining 16HBE cells were seeded in 8-chamber CultureSlides at 1.5x104 cells per chamber in 1ml DMEM and grown for 3 days at 37oC and 5% CO2, allowing them to reach confluence, with roughly 5x104 cells per chamber. Chambers were blocked with 0.1% BSA in DMEM for one hour at 37oC, this media was replaced with 250µl of fresh DMEM and spiked with 5x105 A. fumigatus conidia in a small volume (<10µl) of PBS, for a final multiplicity of infection of ten conidia per cell. This higher ratio was chosen to ensure that many conidia would be visible in each field of view, and to ensure that significant amounts of fungal RNA could be extracted for transcriptional analysis in subsequent experiments. The cells and conidia were co-incubated at 37oC for 6 hours, and washed three times in PBS to remove unbound conidia. Chambers were fixed in 4% w/v EM grade paraformaldehyde in PBS for one hour at room temperature, then washed again three times in PBS before immunostaining. Cultures were first treated with a rabbit polyclonal antibody raised against A. fumigatus cell wall components, which was previously developed in Dr. Moore’s laboratory [112]. This primary antibody was diluted 1:75 in PBS with 10% v/v goat serum and incubated with the fixed preparations of co-incubated cultures overnight at 4oC. Chambers were then washed three times with PBS before treatment for two hours at room temperature with goat anti-rabbit IgG Alexa Fluor 594 (Invitrogen) diluted 1:500 in PBS. Following another round of washes, cells were labeled with DAPI in PBS (1µg/ml)   26 for 5 minutes before a single final wash with PBS. The chamber wells were treated as described above (Section 2.2.3) before cover-slipping. All specimens were imaged using confocal microscopy as described in section 2.2.3. Images from differential interference contrast (DIC) microscopy, and blue (DAPI), green (GFP), and red (anti-A. fumigatus antibody) fluorescence channels were acquired and processed using Volocity Software (Improvision, Coventry, England). Quantification of conidia uptake was based on the fact that since the anti-A. fumigatus antibody is unable to cross the cell membrane, extracellular conidia were labeled, but internalized conidia were not. The rate of internalization was therefore calculated as the ratio of the number of conidia showing green fluorescence but not labeled with anti-A. fumigatus antibody (i.e. internalized conidia) to the total number of green fluorescent conidia, labeled with antibody or not (i.e. extracellular plus internalized conidia). 2.2.5 Quantification of conidia uptake by 16HBE cells by nystatin protection assay 16HBE cells were seeded in 6-well culture plates (Corning, NY, NY) at 3x105 cells per well in 2ml DMEM and incubated for 3 days at 37oC and 5% CO2, allowing them to form confluent monolayers of about 106 cells. Wells were blocked with 0.1% BSA in DMEM for one hour at 37oC, and this medium was replaced with 1ml of fresh DMEM spiked with 107 A. fumigatus conidia in a small volume (<10µl) of PBS, yielding a final multiplicity of infection of ten conidia per cell. The cells and conidia were co-incubated   27 at 37oC for 30 minutes, 2 hours, or 6 hours, and then washed three times in PBS to remove unbound conidia. For each time point, cultures were then incubated for 3 hours at 37oC in either 1ml DMEM supplemented with 100µg nystatin, or DMEM alone. This treatment with nystatin was previously shown to completely kill exposed conidia, but showed no toxicity to human cells [112]. Wells were washed again three times with PBS and the cultures were incubated for 10 minutes at 37oC in 3ml lysis buffer consisting of 0.1% sodium dodecyl sulfate (SDS) and 1% Triton X-100 in deionized water. Colony-forming units recovered from each well were counted by collecting 1ml of conidia-containing cell lysates, diluting 10x, 100x, and 1000x in PBS, and plating 100µl of each dilution onto MYPD agar plates. These plates were incubated at 37oC overnight before colonies were counted. The rate of internalization was based on the dilution yielding the greatest number of colonies that could be individually counted. The internalization rate was defined as the number of colonies recovered from nystatin-treated wells divided by the number of colonies recovered from untreated wells. For each time point, the internalization rate was reported as the average, plus or minus standard deviation, of three biological replicates.   28 2.3 RESULTS 2.3.1 Localization of Aspergillus fumigatus conidia within 16HBE and NHBE cell monolayers To assess whether co-incubation would lead to the uptake of A. fumigatus conidia by NHBE and 16HBE cells, co-cultures were first visualized by confocal microscopy. The high resolution and narrow depth of field afforded by confocal microscopy allows the three dimensional rendering of a specimen by capturing a series of images at incremental focal planes, and combining these into a Z-stack to produce a three dimensional image. The expression of GFP by the conidia allows for their localization within the context of the human cell monolayer, defined by specific fluorescent labeling of nuclei and cell membranes. As shown in Figure 2.1, conidia co- incubated with 16HBE cells were found to localize within the 16HBE cells, close to the nucleus and within the area outlined by the cell membranes. Similarly, as shown in Figure 2.2, conidia co-incubated with NHBE cells could be seen lying outside the cell membranes, but some were found in close association with the NHBE cell nuclei. These results did not indicate any difference in association with and uptake of conidia between 16HBE and NHBE cells. 2.3.2 Quantification of internalization of Aspergillus fumigatus conidia by 16HBE cells by immunofluorescent staining To establish the rate of internalization of A. fumigatus conidia by 16HBE cells, quantitative measurements were based on differential immunolabeling of extracellular   29 Figure 2.1: Localization of A. fumigatus conidia within the 16HBE cell monolayer.    GFP-expressing A. fumigatus conidia and 16HBE cells were co-incubated for 6 hours and treated with DAPI and monoclonal E-cadherin Alexa 594 antibody before visualization by confocal microscopy. Labeling of nuclei (blue) and the membrane tight junctional protein E-cadherin (red) allowed visualization of 16HBE cells. GFP-expressing A. fumigatus conidia (green), highlighted by the white arrows in the XY plane and white circles in the XZ and YZ planes, are found within the 16HBE cells. 10µm XY XZ YZ   30 Figure 2.2: Localization of A. fumigatus conidia within the NHBE cell monolayer.    GFP-expressing A. fumigatus conidia and NHBE cells were co-incubated for 6 hours and treated with DAPI and monoclonal E-cadherin Alexa 594 antibody before visualization by confocal microscopy. Labeling of nuclei (blue) and the membrane tight junctional protein E-cadherin (red) allowed visualization of NHBE cells. Some GFP-expressing A. fumigatus conidia (green) are found outside the cells, while others localize within the cell monolayer, in close association with NHBE nuclei. 10µm   31 and internalized conidia. Treatment of the co-culture with an antibody to A. fumigatus conidia, under conditions that maintain cell membrane integrity, resulted in labeling of extracellular conidia but not internalized ones. This allowed the determination of the percentage of bound conidia that were internalized. An unexpected finding was that while monolayers appeared intact following 6 hours of co-incubation with conidia, many cells were lost in the subsequent washes and immunolabeling steps, limiting the number of intact fields of view that could be imaged for analysis. Figure 2.3 shows one representative field. In total, 259 conidia were counted, 63% of which were identified as being internalized by cells. Internalized conidia were often found in clusters of several conidia in close proximity, likely internalized by the same cell. 2.3.3 Confirmation and determination of time course of internalization by nystatin protection assay The nystatin protection assay was previously developed in Dr. Moore’s laboratory to provide a convenient method to measure conidia internalization by cultured cells [112]. Nystatin is a fungicidal agent that disrupts the fungal cell membrane but has low toxicity to mammalian cells, and importantly does not cross their cell membranes. Internalization of conidia by cells thus leads to their protection, and assessment of the number of live conidia recovered following treatment with or without nystatin allows the determination of the rate of internalization. The nystatin protection assay was used to provide independent support for the internalization rate determined by fluorescence microscopy, and to evaluate the rate of internalization over time. As   32 Figure 2.3: Internalization of A. fumigatus conidia by 16HBE cells determined by immunofluorescent staining.    GFP-expressing A. fumigatus conidia and 16HBE cells were co-incubated for 6 hours and treated with DAPI, to label cell nuclei, and a polyclonal anti-A. fumigatus antibody, to label extracellular conidia, before visualization by confocal microscopy. One representative field is shown in the following channels: A) GFP B) Anti-A. fumigatus antibody C) DAPI D) Merged differential interference contrast, GFP, anti-A. fumigatus antibody and DAPI. Conidia not labeled by antibody, and therefore visible in the green but not red channel, are considered to be internalized by 16HBE cells, allowing quantification of internalization. A B C D   33 indicated in Figure 2.4, internalization rates of 38%, 30%, and 41% were calculated at 30 minutes, 2 hours, and 6 hours respectively. There was no statistically significant difference between these internalization rates. 2.4 DISCUSSION The research outlined in this chapter showed that A. fumigatus conidia could be internalized by primary cultures of human airway epithelial cells as well as the 16HBE cell line, and independent methodologies indicated internalization rates by 16HBE cells that were consistent with those previously reported for a variety of other non- professional phagocytes [110-114]. The reported internalization rates, using various cell lines and incubation times, supports the notion that epithelial cells generally internalize upwards of half of the conidia that they bind. Internalization of conidia is likely to be a critical step in the progression of disease, and the demonstration that 16HBE cells efficiently internalize A. fumigatus conidia with which they are co-incubated motivates further studies to investigate the interactions between these conidia and cells of the airway epithelium. The internalization rates determined in this study ranged from 30% according to the nystatin protection assay following 2 hours of co-incubation to 63% after 6 hours as determined by immunofluorescence labeling. The variability between these measures is unlikely to represent a biologically significant phenomenon, as both the nystatin protection assay and immunofluorescence labeling have inherent sources of error. For example, while the internalization ratios obtained from the nystatin protection assay at   34 Figure 2.4: Rates of internalization of A. fumigatus conidia by 16HBE cells determined by nystatin protection assay.    A. fumigatus conidia and 16HBE cells were co-incubated for the indicated times, then treated with nystatin-supplemented or nystatin-free media for 3 hours. Cells were lysed, and recovered conidia were plated to count colony forming units. At each time point, the rate of internalization was determined as the number of colony forming units recovered from nystatin-treated wells divided by the number from control-treated wells. The percent internalization plus or minus standard deviation from three biological replicates are shown for each time point. 38% 30% 41% 0% 10% 20% 30% 40% 50% 30 Minutes 2 Hours 6 Hours P er ce n t o f B o u n d  C o n id ia  In te rn al iz ed Co-Incubation Time Rate of Internalization   35 the three time points were quite consistent, the absolute number of colonies recovered from nystatin and control treated samples at the various time points was quite variable. This highlights the variability across experimental runs and the importance of using carefully matched controls in this method. In the case of immunostaining, incomplete labeling of extracellular conidia may account for the higher rate of internalization calculated by this assay. Despite the variability in the determined internalization rates, all methods indicate that 16HBE cells internalize a large portion of bound A. fumigatus conidia. The quantitative studies on conidia internalization by 16HBE cells were based on the relatively high multiplicity of infection of ten A. fumigatus conidia for every human cell. While this may represent a greater dose than would be found in the lung as a result of environmental exposure, due to the vast surface area of its epithelium, it is in line with previous in vitro studies using cell lines [112-114]. This multiplicity of infection was chosen for technical reasons, to maximize the number of conidia that could be counted for determination of internalization rates, and to allow for the extraction of sufficient A. fumigatus RNA for transcriptome analysis. Moreover, a co-incubation time of six hours was used for these and further studies. According to results obtained from the nystatin protection assay, the length of co-incubation had little effect on conidia internalization. Therefore, six hours was chosen as an early time point in the interaction between the two species, at which transcriptional responses in adaptation to each other could be investigated. Several previous studies on host responses to A. fumigatus have used this time point [64, 117, 118]. Furthermore, six hours is also a significant time point for the   36 germination of A. fumigatus conidia, with conidial swelling beginning within two hours of incubation in culture medium, and germ tube formation typically occurring between four and eight hours [119]. One striking finding from microscopic analysis of co-incubated samples was that conidia were often found in clusters, and that some cells seemed to be associated with large numbers of conidia, while others did not have any nearby. It is likely that the random dispersion of conidia onto the cell monolayer as they settled by gravity contributed to this variability, but it is also possible that there was variability in cells’ ability to bind and internalize conidia. The observation of these clusters suggested that cells may exhibit a different transcriptional response depending on how closely they were associated with conidia. While all co-incubated cells would be exposed to any secreted fungal factors, and would be expected to respond to them, direct binding and/or internalization of A. fumigatus conidia by 16HBE cells may yield a specific response in a subset of the co-incubated cells. FACS methodology was therefore applied to allow investigation of the potentially different responses in these subsets of co- incubated cells. 2.5 SUMMARY  The research presented in this chapter demonstrated the efficient uptake of A. fumigatus conidia by cultured primary and immortalized human bronchial epithelial cells. Using different methodologies, 16HBE cells were confirmed to internalize upwards of half of bound conidia following six hours of co-incubation, consistent with previously   37 reported findings for similar cell types. The number of conidia associated with individual cells varied widely, however, with many cells not in contact with any conidia while others were associated with multiple conidia each. This finding motivated the study of the specific responses of these distinct cell populations.   38 CHAPTER 3: FLOW CYTOMETRIC ANALYSIS AND SORTING OF HUMAN BRONCHIAL EPITHELIAL CELLS INTERACTING WITH ASPERGILLUS FUMIGATUS CONIDIA 3.1 INTRODUCTION A common concern in transcriptional studies is cellular heterogeneity in the analyzed sample. If RNA samples are generated from mixed populations of cells with different levels of gene expression, the measured signal intensities will represent the average gene expression values from the cell population, muting responses present in rare cells [120]. Importantly, the measured signal for each gene will depend not only on its level of expression within each distinct cell type, but also on the relative numbers of the different cell types within the mixed sample [120]. This concern is especially important in the study of gene expression in complex tissues, such as the brain [121], and in rare cell types, such as hematopoietic stem cells [122]. Several methods to reduce sample heterogeneity have been applied in order to alleviate this problem. One approach is to completely remove heterogeneity by sampling RNA from a single cell. Microarray platforms generally require >100ng of mRNA for analysis, which would require 105 to 107 cells to extract. A critical step is therefore the amplification of mRNA, without alteration of the relative amounts of the different transcripts. This has been shown to be achievable by either linear or exponential RNA amplification protocols [123, 124]. The development of microfluidic devices capable of selectively isolating   39 single cells and allowing their analysis in a highly controlled microscopic environment has made this approach more broadly applicable [125]. Another method to reduce sample heterogeneity for transcriptome analysis is laser capture microdissection (LCM) which allows the isolation of particular cells from tissue sections [126, 127]. The ability to capture specific cells from a histological sample without altering their molecular components makes this methodology ideally suited for the precise analysis of complex heterogeneous tissue samples. Finally, flow cytometry has also proven very useful to isolate specific and potentially rare cells for a variety of analyses, including transcriptional profiling. Flow cytometry allows for suspended cells or other particles to be quickly analyzed, counted and sorted, by passing them sequentially past a laser detection unit within a hydro-dynamically focused fluid stream [128, 129]. Each cell passing through the detection unit can be recorded as an “event”, and results in measurable scattering of the light beam, giving an indication of both the size and granularity of the cell. Furthermore, any fluorophores present in or on the cell may be detected, allowing rapid, multi-parametric characterization of cells’ physical and chemical properties. Importantly, the stream can be diverted to sort analyzed cells into separate samples based on their measured characteristics, a process known as fluorescence-activated cell sorting (FACS). FACS has found wide use in the field of stem cell research, where extremely rare stem cells are isolated following fluorescent labeling of specific markers on their surface [130]. Flow cytometry has also successfully been used to purify specific neuronal types from complex brain tissues, based on retrograde labeling [131] or   40 genetic engineering to induce reporter gene expression in cells of interest [132, 133]. Transcriptional profiling using microarrays was then applied to identify differentially expressed genes between the sorted samples, demonstrating the power of this combined approach. The studies presented here were based on the cell culture model described in the previous chapter, using the 16HBE cell line and GFP-expressing A. fumigatus conidia, which does not constitute a heterogeneous sample at baseline. However, as demonstrated by microscopic visualization (see Figure 2.2), there was significant variability among the 16HBE cells with respect to the number of A. fumigatus conidia with which they were interacting following co-incubation. Indeed, many cells were not in contact with any conidia, while others were associated with clusters of conidia. Therefore, although there were no intrinsic differences among the 16HBE cells, their association with conidia varied widely, and the expression of GFP by the conidia could be used to differentiate 16HBE cells with bound or internalized conidia from otherwise identical cells that were not interacting with conidia. Successfully separating these two cell sub-populations would allow their gene expression profiles to be examined separately, providing a higher resolution analysis of the effect of exposure to A. fumigatus conidia on cellular transcriptomes than could be achieved by simply comparing transcriptomes from cells cultured in the presence or absence of conidia.   41 3.2 METHODS 3.2.1 Preparation of cell culture samples for flow cytometric analysis Flow cytometry was performed on cultures of 16HBE cells and A. fumigatus conidia co-incubated for 6 hours as described in Section 2.2.5. Each 6-well plate produced three samples for FACS analysis, each containing over a million cells having been incubated alone or with A. fumigatus conidia. For comparison, a sample of conidia incubated alone in DMEM was also analyzed. 3.2.2 Flow cytometric analysis of 16HBE cells and Aspergillus fumigatus conidia Flow cytometry was performed on a BD FACSAria with BD FACSDiva application software version 5.0.2 (BD Biosciences) paired with FlowJo Version 6.3.2 analysis software (Tree Star Inc., Ashland, OR). The excitation laser was set at 488nm to induce GFP fluorescence in samples containing GFP-expressing conidia. For all samples, forward and side scatter measurements were recorded, as were emitted fluorescence in the FITC (fluorescein isothiocyanate) and PE-Texas Red (R-phycoerythrin, Texas Red conjugate) channels. Forward and side scatter measure the size and granularity of objects passing through the laser beam. FITC is a fluorophore with peak excitation and emission wavelengths of 495nm and 521nm, respectively, close to those of GFP at 488nm and 509nm, respectively. The FITC channel, using a 530/30 emission filter, thus measures GFP fluorescence in these samples. PE-Texas Red, on the other hand, has excitation and emission wavelengths peaking at 589 and 615, respectively. The PE-Texas Red channel,   42 with a 610/20 filter set, therefore represents a control for non-specific fluorescence, since this system does not include a fluorophore emitting in this range of wavelengths. Before analysis, cell suspensions were passed through a BD Falcon 35µm cell strainer (BD Biosciences) to remove larger particles or lumps which could clog the FACS machine, and gently vortexed to ensure cells did not settle to the bottom of the sample tube. Gates to select cells of interest according to scatter and fluorescence emission properties were set manually based on measurements obtained by analyzing 10,000 events from each sample of control cells (having been incubated in the absence of conidia), co-incubated cells, or conidia alone. Cells were distinguished from free conidia and other debris based on their forward and side scatter signals. The large size difference between 16HBE cells and A. fumigatus conidia, namely ~10µm versus ~2µm, allow these to be distinguished unambiguously. Cells were further gated based on fluorescence intensity in both FITC and PE-Texas Red channels. A “negative” gate was set to include the cells showing low fluorescence signals in FITC and PE-Texas Red channels, seen in the control samples and a subset of co-incubated cells, while a “positive” gate included the subset of cells from co-incubated samples that showed increased FITC signals, indicating that they were associated with GFP-expressing conidia. 3.2.3 Sorting of 16HBE cells co-incubated with conidia into negative and positive cell samples The gates identifying cells as either negative or positive were used to sort co- incubated cells into two separate samples, representing cells interacting directly with   43 conidia and cells not interacting directly with conidia. Sorted cells were collected into Falcon Tubes (BD Biosciences) containing 2ml DMEM, ensuring that the cell-containing stream would fall into liquid, rather than impacting the walls of the tube, to minimize cellular damage. Each cell sorting experiment included three samples of co-incubated cells and conidia. These all underwent 6 hour co-incubations at the same time, and were then sorted sequentially at room temperature, each sample taking about one hour and yielding on the order of 105 cells. During this time, the corresponding control samples, and the remaining co-incubated samples, were maintained at room temperature. Upon the completion of all cell sorting, the purity of the collected samples was assessed by reanalyzing each one, counting 1,000 events from each. The percentage of cells in each sample falling within the appropriate gate provided a measure of the accuracy of the initial sort. To further assess the accuracy of cell sorting, representative samples of sorted cells were visualized by fluorescence microscopy to confirm the presence of conidia with cells from the positive samples but not from the negative samples. These samples were centrifuged for six minutes at 1000 RPM (168g) to collect cells, which were then resuspended in 200µl of PBS. Since sorted cell numbers were limited, the entire cell suspension from each sample was deposited onto poly-L-lysine- coated slides and allowed to dry before addition of Cytoseal 60 mounting medium (Electron Microscopy Sciences) and cover-slipping. Specimens were visualized using a Leica DM IRE2 microscope (Leica), equipped with a Hamamatsu ORCA ER digital camera (Hamamatsu Photonics, Bridgewater, NJ) with Wasabi software (Hamamatsu Photonics). Images obtained in differential interference contrast and green fluorescence channels   44 were processed and merged in Adobe Photoshop (Adobe Inc., San Jose, CA) to visualize both sorted 16HBE cells and associated A. fumigatus conidia. 3.3 RESULTS 3.3.1 Flow cytometric analysis of samples of Aspergillus fumigatus conidia, 16HBE cells, and cells and conidia co-incubated together Since only some of the 16HBE cells co-incubated with A. fumigatus conidia appeared to be in contact with conidia, FACS was used to divide these cells into two populations: those cells directly interacting with conidia, and those that were not in direct contact with any conidia. As shown in Figure 3.1, analysis of GFP-expressing A. fumigatus conidia alone, 16HBE cells alone, and cells co-incubated with conidia produced easily distinguished distributions. Analysis of 10,000 events from each sample allowed the placement of gates, based on the fluorescence intensities observed in the FITC and PE-Texas Red channels, to define negative and positive cell populations. These contained cells that were not and were in direct interaction with conidia, respectively. 3.3.2 Sorting and re-analysis of 16HBE cells co-incubated with Aspergillus fumigatus conidia The gates identifying negative and positive cell populations were used to sort and collect 16HBE cells co-incubated with GFP-expressing A. fumigatus conidia into negative and positive samples. On average, 160,580 cells were collected per sorted sample, and the accuracy of sorting was established by re-analyzing 1000 events from each sample.   45 Figure 3.1: FACS analysis of A. fumigatus conidia and 16HBE cells incubated alone or together.  A) Conidia alone  B) Cells alone   C) Cells and conidia   Cultures of GFP-expressing A. fumigatus conidia alone (A), 16HBE cells alone (B), or cells and conidia together (C) were analyzed by flow cytometry. Top row: dot plots representing 10,000 recorded events plotted based on measured forward scatter (FSC) and side scatter (SSC). The small size of conidia (A) results in low forward scatter signals, while cells (B and C) show higher and more variable signals. The gates defining conidia (labeled as “spores”) and cells were set manually based on the observed distributions. Events identified as conidia are coloured green, while those identified as cells are coloured blue or purple, depending on subsequent gating as a function of fluorescence intensity measurements, described below. Middle row: histograms showing the FITC channel signal intensity from the gate-selected conidia (A) or cells (B and C). GFP-   46 expressing conidia consistently display fluorescence intensities near 103, while cells alone show lower fluorescence intensities centered around 102. Cells co-incubated with conidia show a bimodal distribution with two distinct peaks, the first corresponding to that from cells alone, and the second displaying increased fluorescence. This shift in fluorescence results from the association of some cells with GFP-expressing conidia. Bottom row: dot plots showing fluorescence intensity in FITC and PE-Texas Red channels associated with gate-selected cells. This plot is used to set further gates defining negative and positive cell populations, containing cells that are and are not associated with conidia, respectively. The wide margin between the negative and positive gates ensures that cells showing ambiguous fluorescence intensities are excluded from both cell populations.   47 As shown in Figure 3.2, the majority of negative- and positive-sorted cells fell within the respective expected gates upon re-analysis. The average sort accuracy of all samples was 75.7% (standard deviation = 9.3%), although there was a statistically significant difference in the sort accuracy for the negative and positive samples, with average accuracies of 81.6% (standard deviation = 2.7%) and 69.7% (standard deviation = 9.9%), respectively (p = 0.0016). This difference in accuracy is reflected in the plots in Figure 3.2, which, interestingly, also reveal more events classified as conidia in the positive samples. 3.3.3 Microscopic visualization of negative and positive sorted samples of 16HBE cells To ensure that the negative and positive samples generated by FACS actually represented cells without conidia and cells interacting with conidia, respectively, sorted samples were inspected by fluorescence microscopy. Representative images are shown in Figure 3.3. Of 147 negative-sorted cells counted, 90% were not associated with any conidia, while the remaining 10% were associated with either one or two conidia. In contrast, 68% of 152 positive-sorted cells counted were associated with at least one conidium. The number of conidia associated with these cells varied widely, from 1 up to 25, with an average of 5.27 conidia per cell. These data support the accuracy rates determined by re-analyzing the sorted samples, as described above.    48 Figure 3.2: Re-analysis of negative and positive sorted cell samples to determine the accuracy of sorting.  A) Negative samples  B) Positive samples   FACS-sorted negative (A) and positive (B) cell samples were re-analyzed to determine the accuracy of sorting based on fluorescence intensity signals. Top row: dot plots representing 1000 recorded events plotted based on measured forward scatter (FSC) and side scatter (SSC). While the majority of events are identified as cells, the positive sample contains a significant number of events identified as conidia (labeled as “spores”). Middle row: histograms showing the FITC channel signal intensity from the gate-selected cells. Bottom row: dot plots showing fluorescence intensity in FITC and PE- Texas Red channels associated with gate-selected cells. Most cells in the negative and positive samples fall within the appropriate gate, though the positive sample visibly contains a greater proportion of inaccurately sorted cells.   49 Figure 3.3: Microscopic visualization of negative and positive sorted cell samples to determine the accuracy of sorting.  A) Negative cells   B) Positive cells   FACS-sorted negative (A) and positive (B) cell samples were visualized by DIC and fluorescence microscopy to verify the accuracy of sorting based on fluorescence intensity signals. Shown from left to right for each sample are DIC images, green fluorescence images, and merged images of the two, for one representative field. Individual 16HBE cells are clearly visible in the DIC images, while GFP-expressing A. fumigatus conidia present as bright spots in the green fluorescence channel. The majority of cells in the negative samples are free of conidia, while most cells in positive samples are associated with at least one conidium.    50 3.4 DISCUSSION The results shown in this chapter indicate that 16HBE cells co-incubated with GFP-expressing A. fumigatus conidia could effectively be sorted by FACS into conidia- negative and conidia-positive cell samples, allowing further analysis on these distinct cell populations. On average, 75.7% of cells in each sample were accurately sorted, indicating that cells from co-incubated cultures were sorted into samples highly enriched for either negative or positive cells. Although the use of FACS to isolate specific cell types for further analysis is well established, sorting otherwise identical cells based on their association with a pathogen is a novel application for FACS, which could be applied to a range of pathogens and cell types. Comparing control 16HBE cell samples incubated without GFP-expressing A. fumigatus conidia to co-incubated ones revealed a clear fluorescence signal resulting from the association of a subset of co-incubated cells with conidia. The negative gate was set to include co-incubated cells with fluorescence signals similar to the control cells, while the positive gate was set to include those cells showing increased fluorescence. Since the gates were to be used for cell sorting, they were positioned stringently, to exclude cells with potentially ambiguous fluorescence signals. Therefore, the sum of the negative and positive cells does not represent the entire cell population analyzed, since many cells were not identified as either negative or positive. The numbers of negative and positive cells can therefore not be taken as an accurate measure of the proportion of cells in the co-incubated samples that were interacting with conidia. It is likely that this gate placement strategy also enriched positive samples   51 for cells interacting with multiple conidia, as these would be expected to show the highest fluorescence intensities. Although the FACS analysis could not discriminate cells based on the number of conidia with which they were associated, microscopic visualization did indicate that many of the cells from positive samples were associated with high numbers of spores. Furthermore, this analysis does not differentiate conidia bound to the surface of cells from those internalized by cells, and therefore the positive cell population presumably includes cells with conidia bound to their surface, cells having internalized conidia, and cells with both. Staining co-incubated cells with an antibody to A. fumigatus prior to sorting could allow cells with bound conidia to be distinguished from those having internalized conidia only. Such studies, however, were beyond the scope of this work. Verifying the accuracy of cell sorting indicated that while sorting was not 100% accurate, it did lead to a strong enrichment of cells without and with conidia in the negative and positive samples, respectively. Interestingly, the negative sorted samples showed higher sorting accuracy than positive sorted samples, and positive samples appeared to contain more free conidia. This suggests a mechanism which may limit the accuracy of cell sorting. It is possible that binding between 16HBE cells and A. fumigatus conidia was somewhat transient, and thus that cells may have gained or lost conidia over the course of the sorting procedure. Alternatively, the presence of free conidia in close proximity to negative cells may lead to their incorrect assignment as positive cells. This may explain the relatively high numbers of free conidia and negative cells observed upon re-analysis of positive samples, and the inability to obtain truly pure samples of   52 negative and positive cells. Nevertheless, the sorted samples did represent distinct populations enriched for cells without and with conidia, enabling further analysis of their transcriptional profiles, as described in the following chapters. 3.5 SUMMARY  As presented in this chapter, cultured human bronchial epithelial cells were efficiently sorted based on their association with GFP-expressing A. fumigatus conidia. Using flow cytometry, 16HBE cells that had bound and/or internalized conidia could be distinguished from cells that were not associated with any conidia, based on the intensity of their green fluorescence signal. Cell sorting was 75% accurate, yielding distinct cell populations enriched for cells with and without conidia, allowing for their separate analysis.   53 CHAPTER 4: TRANSCRIPTIONAL ANALYSIS OF HUMAN BRONCHIAL EPITHELIAL CELLS INTERACTING WITH ASPERGILLUS FUMIGATUS CONIDIA 4.1 INTRODUCTION The completion of whole genome sequences for human [134] and many species of pathogens, including A. fumigatus [135], has opened the door for a new approach to the study of microbial infections [136]. While traditional research has been reductionist, focusing on individual virulence genes in pathogens, or specific response effectors in the host, the ability to interrogate genome-wide expression levels under various biological conditions allows a holistic understanding of the host-pathogen interaction [137]. Microarrays interrogating transcripts from the entire genome have emerged as powerful tools in this endeavour, eliminating the bias associated with the a priori selection of a subset of genes for study [138, 139]. The fast, automated, and high throughput analysis possible using whole-genome microarrays makes them ideally suited to the study of complex networks of genetic and metabolic interactions, and has found wide use in identifying genes whose expression is correlated with specific phenotypes, as well as to classify samples based on their global gene expression patterns [138, 140]. Despite the great opportunities provided by such microarray technology, the large amount of data generated using whole-genome microarrays presents some   54 significant challenges in analysis. The sheer number of statistical tests performed when analyzing all probes on an array can lead to the identification of a significant number of false positives. For example, if differentially expressed genes between two conditions are selected from an array covering 10,000 transcripts, using a p-value cutoff of 0.05, an average of 500 false positives will be obtained even if there are no true differences in gene expression between the two conditions [140]. It is possible to apply a multiple testing correction to the p-value, to limit the number of false positives obtained, but this in turn increases the number of false negatives, which are genes that are truly differentially expressed but will not be identified as such [138]. In addition to these concerns, the sheer amount of data produced in microarray experiments can make the extraction of biologically meaningful conclusions a daunting task. The major steps involved are typically the identification of significantly regulated genes between the relevant conditions, the identification of global patterns of gene expression, and the determination of the biological significance of both the individual genes and the groups of genes [141]. A powerful tool to gain an understanding of the global features of a gene list is Gene Ontology term enrichment analysis [142]. The Gene Ontology (GO) has been developed to provide a uniform, controlled vocabulary to annotate gene products in terms of their associated biological process, molecular function, and cellular component [143]. The use of consistent terms to annotate all gene products allows global features of gene lists to be easily surveyed. Given a list of genes annotated with GO terms, the statistically significant overrepresentation of specific terms indicates the major biological themes featured in the gene list [142]. Furthermore, by considering gene lists   55 holistically, rather than as a series of individual genes, GO term enrichment analysis alleviates the concerns associated with multiple testing across all the genes on an array. While any one gene in a list may be a false positive, the identification of many genes associated with a given GO term provides strong evidence for the significance of this term. A limited number of studies to date have applied whole-genome transcriptional profiling to interacting human cells and A. fumigatus. Several studies have investigated the transcriptional response of human monocytes to A. fumigatus [64, 117, 118], and one study investigated the transcriptional response of A. fumigatus to exposure to neutrophils [144]. The transcriptional signature of A. fumigatus during invasive growth in a mouse model of aspergillosis has also been reported [145]. However, none of these studies investigated the transcriptomes of both organisms, nor did they specifically address the interactions between conidia and the airway epithelium, which is the first point of contact for inhaled conidia. The research presented in this chapter describes the first application of whole-genome transcriptional profiling to interacting human bronchial epithelial cells and A. fumigatus conidia. 4.2 METHODS 4.2.1 Overview of experimental design for dual-species transcriptional analysis To investigate the interactions between cultured 16HBE cells and A. fumigatus conidia, whole-genome transcriptional profiling was applied to both species. The goal of this analysis was to identify genes in each species showing altered expression levels in   56 response to exposure to the other species. Two separate experimental approaches were used to this end, as shown in Figure 4.1. One experiment was based on comparing gene expression profiles from samples incubated separately as described in Section 2.2.5, while the other made use of the FACS sorted samples described in Chapter 3. In the unsorted experiment, three conditions of incubation were used: cells alone, conidia alone, and cells and conidia together. For each of these, samples were incubated for 6 hours prior to RNA extraction and analysis. In the sorted experiment, two incubation conditions were prepared: cells alone, or cells and conidia together. The cells were trypsinized following 6 hours of incubation and those with conidia were then sorted into two separate samples, negative and positive cells. RNA was extracted from these negative and positive samples, as well as from the control samples of cells having been incubated in the absence of conidia. The unsorted and sorted experiments thus generated six experimental conditions for RNA extraction: unsorted conidia alone, unsorted cells and conidia, unsorted cells alone, sorted positive cells, sorted negative cells, and sorted control cells. Four replicate samples for each condition were selected for human and/or fungal transcriptome analysis. 4.2.2 Extraction of RNA from samples of 16HBE cells and Aspergillus fumigatus conidia The unsorted experiment consisted of samples of A. fumigatus conidia alone, confluent 16HBE cells alone, or cells and conidia together, each incubated in 1ml DMEM at 37oC for 6 hours. Immediately following incubation, samples were harvested in buffer   57 Figure 4.1: Experimental design for human and fungal transcriptional profiling.    Two separate experiments were performed to investigate the transcriptional responses of 16HBE cells and A. fumigatus conidia to one another. In the unsorted experiment, three incubation conditions were used: conidia incubated alone, conidia and cells co- incubated, and cells incubated alone. In the sorted experiment, two incubation conditions were used: conidia and cells co-incubated, and cells incubated alone. FACS was then used to split the co-incubated cells and conidia into negative and positive samples, representing cells without and with conidia, respectively. For human transcriptome analysis, RNA from each condition, except the conidia alone, was hybridized to whole human genome single-colour microarray slides. For fungal transcriptome analysis, RNA from the unsorted samples of conidia alone and with cells was hybridized to A. fumigatus specific, whole-genome two-colour microarray slides.   58 RLT (Qiagen, Hilden, Germany). Buffer RLT contains the chaotropic agent guanidine thiocyanate and the denaturant β-mercaptoethanol, and is used to lyse cells or tissue while protecting RNA via deactivation of RNase enzymes. It has been shown to effectively preserve RNA for subsequent analysis [146]. For samples of conidia incubated alone (107 conidia per well), the DMEM was mixed thoroughly then collected in 1ml microfuge tubes, centrifuged at 13,000 RPM for 10 minutes, and the pelletted conidia were resuspended in 450μl buffer RLT. For samples of cells alone or cells and conidia together(106 cells and 107 conidia per well), the DMEM was removed and replaced with 450μl buffer RLT, lysed cells and associated conidia were collected from the culture dish using Cell Scrapers (Thermo Fisher Scientific, Waltham, MA), and collected into 1ml microfuge tubes. All samples were stored at -80oC until RNA extraction. The sorted experiment consisted of samples of 16HBE cells having been incubated alone, and pairs of sorted 16HBE cells having been incubated with A. fumigatus conidia prior to trypsinization and FACS, as described in Chapter 3. Populations of sorted cells contained around 1.5x105 cells. Upon the completion of cell sorting, each of these samples was centrifuged for 6 minutes at 1000 RPM, the media was removed and pelletted cells were resuspended in 700μl buffer RLT. These samples were also stored at -80oC until RNA extraction. All RNA extractions were performed using the RNeasy Mini Kit with QIAshredder (Qiagen), following the manufacturer’s recommendations. For the unsorted experiment, the protocol “Purification of Total RNA from Plant Cells and Tissues and Filamentous   59 Fungi” (Qiagen) was followed for all samples, with the few modifications described below, to ensure that fungal RNA would be efficiently extracted from conidia present in the appropriate samples. Samples stored at -80oC in 450μl buffer RLT were thawed at room temperature, vortexed, and briefly spun down to gather all the material at the bottom of the tube. Tubes were then immersed in liquid nitrogen for 5 minutes and thoroughly ground using plastic mini-pestles (DiaMed, Mississauga, ON) as they thawed, to physically break open the conidia. Tubes were then incubated in a 56oC water bath for 2 minutes, to maximize tissue disruption, as recommended by the manufacturer. Samples were then passed through the QIAshredder column and the remainder of the manufacturer’s protocol was followed exactly, including the optional 1 minute final spin, and RNA was eluted in 30μl RNase-free water. For the sorted experiment, the extraction of fungal RNA was not necessary, and the protocol “Purification of Total RNA from Animal Cells Using Spin Technology” (Qiagen) was followed. The samples stored at -80oC in 750μl buffer RLT were thawed and directly applied to the QIAshredder column, and the remainder of the manufacturer’s protocol was followed as in the unsorted experiment, again eluting RNA in 30μl RNase-free water. RNA yield from each sample was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE). In addition, the RNA integrity of the samples from the sorted experiment was determined using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), to ensure that the flow cytometry procedure did not reduce the integrity of the extracted RNA. The 2100 Bioanalyzer generates an RNA integrity number (RIN) that indicates the level of degradation in a sample and has been shown to reliably predict the   60 suitability of RNA samples for gene expression analysis [147]. In particular, RNA samples with an RIN ≥ 8 have been shown to be optimal for analysis of gene expression [148]. 4.2.3 Quantitative real-time PCR analysis of human and fungal mRNA signals from co-incubated samples Before proceeding with microarray analysis, co-incubated samples from the unsorted experiment were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) to confirm that sufficient RNA was extracted from both 16HBE cells and A. fumigatus conidia to provide robust gene expression signals from both species. This analysis was performed by the Core 1 Molecular Phenotyping facility at the iCAPTURE Centre. A previously identified A. fumigatus housekeeping gene, translation elongation factor-1 (TEF1) was used to indicate the presence of fungal RNA in each sample [149]. The following primers and TaqMan probe were designed: Forward primer: CCATGTGTGTCGAGTCCTTC Reverse primer: TCTCGACGGACTTGACGACA Probe: [6~FAM]CGCCAGACTGTTGCTGTTGG[BHQ1A~6FAM] These primers were ordered from Integrated DNA Technologies (Coralville, IA), and the TaqMan probe was ordered from Operon Biotechnologies (Huntsville, AL). Human RNA in each sample was identified using the Applied Biosystems β-actin TaqMan assay (ID Hs99999903_m1; Applied Biosystems, Austin, TX). RNA extracted from co-incubated samples, as described above, was linearly amplified using the Ambion Amino Allyl MessageAmp™ II aRNA Amplification Kit (Cat#AM1753; Applied Biosystems), then   61 reverse-transcribed to cDNA. These cDNA samples, along with control A. fumigatus and human cDNA samples, were analyzed in duplicate on an ABI 7900 HT Sequencer with SDS 2.1 software (Applied Biosystems). Amplification plots were generated to indicate with high specificity the presence of Tef-1 and β-actin transcripts in the samples. 4.2.4 Microarray analysis of human and fungal transcriptomes All microarray analyses were conducted at the Prostate Center Microarray Facility (Vancouver, BC). Human gene expression was analyzed using Agilent Whole Human Genome Oligo Microarrays in the 4x44K format (product number G4112F, design ID 014850; Agilent Technologies), hybridizing a single sample per array (one- colour experiment). Cyanine-3 (Cy3) labeled complementary RNA (cRNA) was generated following Agilent’s Low RNA Input Linear Amplification Protocol, and its quantity and specific activity assessed using a NanoDrop ND-1000 (Thermo Scientific). Labeled cRNA (1.65μg) was fragmented for 30 minutes, hybridized to microarrays for 17 hours at 65oC in the Agilent hybridization oven, and washed with Agilent wash buffers. Arrays were scanned using the Agilent DNA Microarray Scanner at a resolution of 5μm and Agilent’s Feature Extraction software version 9.1 was used for quantification of signal intensities and to produce a quality control report for each microarray, using the default protocol for a one-colour array. This algorithm detects and identifies spots, removes outlier pixels for each spot, and applies spatial de-trending to adjust each spot’s intensity, providing a “raw” signal for each feature. In total, twenty arrays were hybridized and analyzed, representing four replicates for each of the five experimental conditions: cells alone and   62 with conidia from the unsorted experiment, and negative, positive, and control cells from the sorted experiment. Fungal transcriptome analysis was performed on conidia-containing samples from the unsorted experiment, using TIGR Aspergillus fumigatus Version 3 microarray slides (Pathogen Functional Genomics Resource Center, Rockville, MD). These contain 10,003 70-mer oligonucleotide probes in duplicate, designed to specifically bind A. fumigatus transcripts, as well as 500 Arabidopsis thaliana-specific 70-mers as controls. Due to the presence of human RNA in the co-infected samples, cross-hybridization of human transcripts to probes on the fungal microarray was a potential concern. Therefore, the specificity of these arrays for A. fumigatus transcripts was verified by performing BLAST searches [150] for each 70-mer probe on the array against the human genome, and by hybridizing a universal human reference RNA sample (Stratagene, La Jolla, CA) to an A. fumigatus slide. Microarray analyses were performed following the Prostate Center Microarray Facility’s aRNA Preparation and Hybridization Protocol, for two-colour microarrays. Briefly, RNA from each sample was amplified via in vitro transcription with aminoallyl-UTP, amplified RNA was coupled to both Cy3 and Cy5, and fragmented prior to hybridization. Samples representing conidia incubated alone and conidia incubated with 16HBE cells were paired using a dye-swap design, and 2μg of RNA from each sample was added to each microarray slide and hybridized overnight at 50oC in 2X formamide buffer (Genisphere, Hatfield, PA). Slides were then washed and scanned on an Axon GenePix 4200AL microarray scanner (Molecular Devices, Sunnyvale, CA), and images were analyzed using ImaGene 8.0 software (BioDiscovery, El Segundo,   63 CA). Eight slides were hybridized and analyzed, representing four samples of conidia incubated alone and four samples of conidia incubated with cells. 4.2.5 Statistical analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia The Feature Extraction files containing raw data from the twenty whole-genome microarrays, covering 41,000 transcripts, were imported into GeneSpring GX 7.3.1 microarray analysis software (Agilent Technologies). Raw signals were first normalized by flooring all values smaller than 1 to 1, then dividing each value by the median intensity value of the array. This removes negative values, and corrects for global differences in signal intensities between arrays. Hierarchical clustering was then performed to generate condition trees, highlighting the relationships in the overall expression levels in the different samples. Pearson Correlation, based on average distance between clusters, was used to generate hierarchical trees based on the normalized intensity signals of the 41,000 probes on each array. To select genes of interest, genes showing differential expression between the control (i.e. cells alone) and co-incubated unsorted samples, and between negative and positive sorted samples, were identified. For the unsorted analysis, a cutoff was first applied to the raw signal intensity, retaining only genes showing a value of greater than 100 in at least 3 of 4 replicates of either the control or co-incubated conditions. This ensured that only genes for which a reliable signal was obtained in either the negative or positive condition were included in the analysis. Genes were then selected with a   64 volcano plot, using a fold-change cutoff of 1.5 and a p-value cutoff of 0.05. Genes matching these conditions were considered to be differentially expressed between control and co-incubated cells. For the sorted analysis, a similar raw intensity cutoff was applied, retaining only genes showing a value of greater than 100 in at least 3 of 4 replicates of either the negative or positive conditions. Since the 4 replicates of the negative and positive conditions represented biologically paired samples, 4 replicate ratios were generated for each probe, each of which was the signal from the positive cells divided by that from the negative cells sorted from the same co-incubation sample. A student’s t-test was then applied to determine if this fold-change ratio differed significantly from 1, at a p-value of less than 0.05, based on the four replicates for each probe. Genes that passed this test and showed a fold change of greater than 1.1 were considered to be differentially expressed between negative and positive samples. This procedure is equivalent to selecting genes based on a volcano plot, but using a paired rather than unpaired t-test, as in the unsorted experiment. The genes identified as up- or down-regulated in the unsorted and sorted experiments were analyzed using the Gene Ontology Enrichment Analysis Software Toolkit (GOEAST) [151]. Significantly over- represented GO terms were identified using the recommended methods (hypergeometric test, Benjamin and Yekutieli false discovery rate correction, threshold p-value of 0.1).   65 4.2.6 Statistical analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells The ImaGene output files for the two dye channels in the eight slides were imported into GeneSpring GX 7.3.1 microarray analysis software (Agilent Technologies). For each array, the channel representing RNA from A. fumigatus conidia incubated alone was assigned as the experimental “control”, while the channel representing RNA from A. fumigatus conidia and 16HBE cells incubated together was assigned as the experimental “signal”. The intensity for each probe in each channel was obtained by first subtracting the “background median” from the “signal median” for each spot, then averaging these values across the two replicate spots per probe. “Signal” and “control” intensities were then normalized using Lowess transformation [152]. Lowess normalization is a widely used method to eliminate the signal intensity-dependent dye bias between Cy3 and Cy5, using a sliding window, locally weighed linear regression to smooth the data [153]. Normalized intensity values were first used to filter out genes that did not show significant expression in co-incubated human and fungal samples. Probes with normalized intensity values in the “signal” (i.e. co-incubated) channel greater than 300 in at least four of the eight arrays were retained for further analysis. For each of these, the ratio of gene expression between co-incubated and control samples was determined from the normalized intensity values for each probe as follows. For each of the four replicates, two ratios were obtained per probe: one from the array in which the co-incubated sample was labeled with Cy3, and the other from the array in which the co-incubated sample was labeled with Cy5. In each case, the intensity from   66 the co-incubated channel was divided by that from the control channel. These two dye- swapped ratios were geometrically averaged, and the four replicate ratios thus obtained, representing the four biological replicates, were used in a t-test to identify significantly differentially expressed genes between co-incubated and control samples, that is genes whose gene expression ratio was significantly different from 1. Genes with a p-value for differential expression of 0.05 or less, and a fold change greater than or equal to 1.5, were defined as significantly differentially expressed between control and co-incubated samples. Probe annotations, including gene product names and associated GO terms, were retrieved from the TIGR Database Aspergillus fumigatus Genome Project (http://www.tigr.org/tdb/e2k1/afu1/), which is now part of the J. Craig Venter Institute. Gene Ontology term enrichment analysis was performed on the up- and down- regulated gene lists using the GOEAST toolkit [151], using the hypergeometric test, no multiple-testing correction, and a threshold p-value of 0.01. 4.3 RESULTS 4.3.1 Quantification and quality assessment of RNA extracted from samples of 16HBE cells and Aspergillus fumigatus conidia The concentrations of RNA extracted from the samples of different incubation conditions are indicated in Table 4.1. These varied widely between conditions, reflecting the numbers of 16HBE cells contributing to each sample, and the much lower RNA content of A. fumigatus conidia relative to human cells. Despite these differences, all samples yielded sufficient RNA for microarray analysis. RNA integrity was determined   67 Table 4.1: RNA concentrations of samples from different experimental conditions.  Experimental Condition RNA Concentration (ng/μl) Unsorted - 16HBE cells alone (n=8) 721.54 ± 188.01 Unsorted - A. fumigatus conidia alone (n=8) 12.39 ± 5.14 Unsorted - Co-incubated cells and conidia (n=8) 749.07 ± 153.03 Sorted - Negative cells (n=9) 154.94 ± 78.08 Sorted - Positive cells (n=9) 106.74 ± 68.18 Sorted - Control cells (n=6) 656.48 ± 79.12  RNA extracted from samples representing the six experimental conditions, and eluted in 30μl water, was quantified using a NanoDrop ND-1000 spectrophotometer. RNA concentrations shown represent the average, plus or minus standard deviation, from all samples of each condition. The amount of RNA extracted reflects the fact that FACS- sorted samples contained far fewer cells than unsorted samples collected directly from cell culture, and the fact that A. fumigatus conidia contain much less RNA than human cells.   68 for samples from the sorted experiment, to ensure that any stress caused by the sorting procedure did not result in degradation of the extracted RNA. The RIN scores obtained with an Agilent Bioanalyzer 2100 (Agilent Technologies) ranged from 7.6 to 10.0, with an average of 9.2 ± 0.8, thus representing high quality RNA, fit for gene expression analysis [148]. 4.3.2 Detection of human and fungal transcripts in co-incubated samples by quantitative real-time PCR Quantitative real-time PCR (qRT-PCR) assays were performed to confirm that both human and fungal gene expression signals could be detected from samples of co- incubated 16HBE cells and A. fumigatus conidia. As shown in Figure 4.2, assays for the fungal and human housekeeping genes, Tef-1 and β-actin, respectively, yielded specific amplification of these transcripts, indicating that the samples contained enough RNA to provide a gene expression signal from both species. While qRT-PCR can be used to quantify the amount of transcript in a sample, either as an absolute concentration or relative to a reference gene, this analysis was not performed, since the aim of the assay was simply to confirm the presence of robust signals from both species. 4.3.3 Analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia Expression data was obtained from 41,000 spots on each of the four arrays representing the five experimental conditions. This dataset comprising twenty microarrays has been submitted to the Gene Expression Omnibus [154], under the   69 Figure 4.2: Identification of fungal and human mRNA signals from unsorted, co- incubated samples.  A) Tef-1     B) β-Actin   RNA extracted from co-incubated A. fumigatus conidia and 16HBE cells was linearly amplified, reverse-transcribed to cDNA, and analyzed by real-time PCR to detect fungal and human signals. Assays for the A. fumigatus housekeeping gene Tef-1 (A) and human β-actin (B) show robust signals from four replicate mixed RNA samples, in blue. Control samples of A. fumigatus and human cDNA are shown in turquoise; the Tef-1 assay only amplified the fungal cDNA sample, while the β-actin assay only amplified the human cDNA sample, confirming the specificity of the assays. 4 co-infected samples 4 co-infected samples A. fumigatus cDNA control Human cDNA control No amplification of A. fumigatus cDNA control No amplification of human cDNA control   70 accession number GSE16637. This public repository provides free access to high- throughput gene expression data and associated annotations as set out in the Minimum Information About a Microarray Experiment (MIAME) standard [155]. To obtain a general overview of the data, normalized signal intensities from all 41,000 spots were used to cluster the arrays by experimental condition, as shown in Figure 4.3. The five conditions showed a high level of concordance, as indicated by their similar gene expression profiles. Clustering revealed that the greatest similarity was found between arrays within each experiment, and that the negative and positive sorted samples were more similar to each other than they were to any other condition. The four replicate arrays representing these sorted negative and positive conditions were clustered separately, as shown in Figure 4.4. This revealed that these arrays clustered into pairs based on their co-incubation sample, indicating that negative and positive samples sorted from individual co-incubated cell cultures were generally more similar to each other than to other sorted samples. Based on this clustering analysis, the most relevant pair-wise comparisons for analysis of differential gene expression were between the control and co-infected samples from the unsorted experiment, and between the negative and positive sorted samples. Furthermore, the finding that the negative and positive sorted samples clustered by co-incubation sample rather than by sort identity (i.e. negative vs. positive) justified the use of a paired statistical test to detect differentially expressed genes between these samples. For both the unsorted and sorted experiments, differentially expressed genes were identified among those that showed significant expression in either of the   71 Figure 4.3: Hierarchical clustering of human whole-genome microarrays grouped by experimental condition.   Unsorted Control Unsorted Co-incubated Sorted Negative Sorted Positive Sorted Control  Normalized signals were used for hierarchical clustering of the arrays by experimental condition. For each condition, a global overview of the signals from the 41,000 spots is shown, with low signals in green and high signals in red. The two experiments are also colour-coded, with the unsorted experiment in purple and the sorted experiment in red. The expression profiles for the five conditions show high similarity, and the primary clustering segregates the samples from the unsorted and sorted experiments. Furthermore, the sorted negative and positive samples are most closely related to each other.   72 Figure 4.4: Hierarchical clustering of individual human whole-genome microarrays from negative and positive sorted samples.   A- A+ C+ C- B- B+ D- D+  Normalized signals were used for hierarchical clustering of the eight individual arrays from the negative and positive sorted samples. For each array, a global overview of the signals from the 41,000 spots is shown, with low signals in green and high signals in red. The arrays are lettered and colour-coded by co-incubation sample, and the sort identity is indicated as positive or negative. The expression profiles for the eight arrays show high similarity, and the clustering reveals that they form pairs based on their co- incubated sample of origin.   73 compared conditions. In the unsorted experiment, 22,523 genes passed the intensity cutoff, indicating significant expression in either control or co-incubated samples, with 340 of these showing differential expression between the two conditions, defined as having a t-test p-value less than or equal to 0.05 and fold-change of 1.5 or greater. Of these, 231 were up-regulated in co-incubated samples relative to controls, while 109 were down-regulated. In the sorted experiment, 20,541 genes passed the intensity cutoff, and 889 of these showed differential expression between matched negative and positive samples, based on having a paired t-test p-value less than or equal to 0.05 and a fold change of 1.1 or greater. Of these, 376 were up-regulated in positive sorted samples relative to negative sorted samples, while 514 were down regulated. Only 23 genes were present in the differentially expressed gene lists from both the unsorted and sorted experiments, which did not represent a statistically significant overlap, and their associated fold changes did not show consistency between the experiments. Gene Ontology (GO) term enrichment analysis was performed on the gene lists identified as up- and down-regulated in the unsorted and sorted experiments. Selected GO terms overrepresented in the up- and down-regulated gene lists from the unsorted and sorted experiments are shown in Table 4.2 and Table 4.3, respectively. The genes showing the greatest up- or down-regulation in the unsorted and sorted experiments are shown in Table 4.4 and Table 4.5, respectively. The complete lists of genes identified as differentially expressed in the unsorted and sorted experiments are shown in Appendix 1 and Appendix 2, respectively.    74 Table 4.2: Over-represented Gene Ontology terms in the lists of differentially expressed genes between unsorted 16HBE cells incubated with or without conidia.  List of Genes Up-Regulated in Co-Incubated Cells (231 genes) GOID Ontology Term P-value GO:0008270 MF zinc ion binding 1.28E-13 GO:0003677 MF DNA binding 4.60E-11 GO:0006350 BP transcription 1.64E-10 GO:0006139 BP nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 6.90E-09 GO:0006355 BP regulation of transcription, DNA-dependent 6.90E-09 GO:0003676 MF nucleic acid binding 9.91E-09 GO:0010556 BP regulation of macromolecule biosynthetic process 1.35E-08 GO:0010468 BP regulation of gene expression 3.38E-08 GO:0005634 CC nucleus 8.43E-08 GO:0004308 MF exo-alpha-sialidase activity 2.46E-03 List of Genes Down-Regulated in Co-Incubated Cells (109 genes) GOID Ontology Term P-value GO:0006882 BP cellular zinc ion homeostasis 3.85E-04 GO:0032844 BP regulation of homeostatic process 1.06E-03 GO:0008009 MF chemokine activity 2.94E-03 GO:0045787 BP positive regulation of cell cycle 4.05E-03 GO:0046968 BP peptide antigen transport 5.58E-03 GO:0001664 MF G-protein-coupled receptor binding 5.77E-03 GO:0045931 BP positive regulation of mitotic cell cycle 7.13E-03 GO:0045597 BP positive regulation of cell differentiation 7.44E-03 GO:0006935 BP chemotaxis 1.16E-02 GO:0005125 MF cytokine activity 1.32E-02  The lists of genes identified as up- and down-regulated in 16HBE cells incubated with A. fumigatus conidia relative to cells incubated alone were subjected to Gene Ontology term enrichment analysis. Selected terms, belonging to the biological process (BP), molecular function (MF), and cellular component (CC) ontologies, are shown, and the p- value for enrichment in the appropriate list is shown.   75 Table 4.3: Over-represented Gene Ontology terms in the lists of differentially expressed genes between 16HBE cells sorted as negative or positive.  List of Genes Up-Regulated in Positive Cells (376 genes) GOID Ontology Term P-value GO:0000786 CC nucleosome 9.52E-12 GO:0006334 BP nucleosome assembly 1.19E-11 GO:0008009 MF chemokine activity 3.10E-05 GO:0001664 MF G-protein-coupled receptor binding 3.30E-05 GO:0006749 BP glutathione metabolic process 3.70E-05 GO:0009611 BP response to wounding 1.08E-03 GO:0005125 MF cytokine activity 5.37E-03 GO:0009605 BP response to external stimulus 5.76E-03 GO:0006954 BP inflammatory response 1.07E-02 GO:0006955 BP immune response 2.16E-02 List of Genes Down-Regulated in Positive Cells (513 genes) GOID Ontology Term P-value GO:0000279 BP M phase 5.07E-13 GO:0043229 CC intracellular organelle 8.96E-13 GO:0022402 BP cell cycle process 5.26E-12 GO:0005634 CC nucleus 1.43E-11 GO:0000278 BP mitotic cell cycle 4.51E-11 GO:0044424 CC intracellular part 8.33E-11 GO:0048285 BP organelle fission 1.59E-10 GO:0005694 CC chromosome 2.54E-07 GO:0006996 BP organelle organization 4.31E-07 GO:0007098 BP centrosome cycle 4.49E-05  The lists of genes identified as up- and down-regulated in 16HBE cells sorted as positive versus negative, based on their association with A. fumigatus conidia, were subjected to Gene Ontology term enrichment analysis. Selected terms, belonging to the biological process (BP), molecular function (MF), and cellular component (CC) ontologies, are shown, and the p-value for enrichment in the appropriate list is shown.   76 Table 4.4: Genes showing the highest fold-changes between unsorted 16HBE cells incubated with or without conidia.  Gene Symbol Gene Name Fold Change P-value HIST1H4J histone cluster 1, H4j 4.24 4.97E-04 MYOZ1 myozenin 3 3.24 3.53E-03 DIDO1 death inducer-obliterator 1 2.65 7.56E-03 LNX2 ligand of numb-protein X 2 2.54 5.82E-04 C21orf96 chromosome 21 open reading frame 96 2.39 1.97E-05 C15orf42 chromosome 15 open reading frame 42 2.08 9.42E-04 ZNF26 zinc finger protein 26 2.07 4.01E-02 CAPRIN2 caprin family member 2 2.01 8.31E-05 C11orf61 chromosome 11 open reading frame 61 2.01 6.15E-05 HIST1H3H histone cluster 1, H3h 1.94 7.85E-03 CXCL3 chemokine (C-X-C motif) ligand 3 -1.84 9.12E-03 ZBP1 Z-DNA binding protein 1 -1.89 5.32E-03 SLC22A23 solute carrier family 22, member 23 -1.91 1.95E-02 NRN1 neuritin 1 -1.94 1.31E-02 ACBD4 acyl-Coenzyme A binding domain containing 4 -1.95 1.86E-02 DNAJC14 DnaJ (Hsp40) homolog, subfamily C, member 4 -1.98 7.90E-03 CCL20 chemokine (C-C motif) ligand 20 -2.00 2.64E-02 LYPD3 LY6/PLAUR domain containing 3 -2.08 1.24E-02 CYB561D1 cytochrome b-561 domain containing 1 -2.08 2.01E-02 IL8 interleukin 8 -2.20 9.29E-03  The ten probes showing the greatest up- and down-regulated gene expression between unsorted 16HBE cells incubated with A. fumigatus conidia and 16HBE cells incubated alone are shown. The fold change is the ratio of the expression level in the two conditions, with positive numbers representing up-regulation in co-incubated samples, while negative numbers indicate down-regulation in the co-incubated samples, compared to controls. The t-test p-value for differential expression is also shown. Probes lacking annotations were excluded from this list.   77 Table 4.5: Genes showing the highest fold-changes between 16HBE cells sorted as negative and positive.  Gene Symbol Gene Name Fold Change P-value MMP1 matrix metallopeptidase 1 (interstitial collagenase) 1.69 2.94E-03 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) 1.63 1.07E-02 CCL5 chemokine (C-C motif) ligand 5 1.60 3.38E-02 CCL3 chemokine (C-C motif) ligand 3 1.58 2.53E-02 ROCK1 Rho-associated, coiled-coil containing protein kinase 1 1.51 5.00E-02 GREM1 gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) 1.50 1.01E-02 ACTN2 actinin, alpha 2 1.46 1.22E-02 FBXO32 F-box protein 32 1.43 1.64E-02 MGST1 microsomal glutathione S-transferase 1 1.43 2.73E-03 EVI2B ecotropic viral integration site 2B 1.40 8.27E-04 LRRFIP1 leucine rich repeat (in FLII) interacting protein 1 -1.33 2.96E-02 SFTPC surfactant protein C -1.34 3.97E-02 C9orf100 chromosome 9 open reading frame 100 -1.35 2.14E-03 LIPE lipase, hormone-sensitive -1.35 2.67E-02 TERT telomerase reverse transcriptase -1.36 1.54E-02 MTERFD3 MTERF domain containing 3 -1.37 3.53E-03 SFTPC surfactant protein C -1.37 2.55E-02 KIAA0802 KIAA0802 -1.37 1.01E-02 SLC1A3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 -1.39 6.14E-04 NDE1 nudE nuclear distribution gene E homolog 1 (A. nidulans) -1.50 2.98E-02  The ten probes showing the greatest up- and down-regulated gene expression between 16HBE cells incubated with A. fumigatus conidia, and sorted as negative versus positive based on their association with conidia, are shown. The fold change is the ratio of the expression level in the two conditions, with positive numbers representing up- regulation in positive samples, while negative numbers indicate down-regulation in the positive samples, compared to negative samples. The paired t-test p-value for differential expression is also shown. Probes lacking annotations were excluded from this list.    78 4.3.4 Analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells Prior to performing microarray analyses on experimental samples, the specificity of the TIGR Aspergillus fumigatus Version 3 microarray slides for A. fumigatus transcripts was investigated, to ensure that human RNA present in the co-incubated samples would not confound the results. The sequences for all probes on the array were compared to the entire human genome using BLAST [150], and no significant alignments were found. A sample of Cy3-labeled universal human RNA was also hybridized to a slide, yielding no positive signals on any spots, as shown in Figure 4.5. These results indicated that cross-hybridization of human transcripts to the A. fumigatus probes should not be a concern. The analysis of RNA samples from A. fumigatus conidia incubated alone or with 16HBE cells yielded intensity measurements from 21,006 spots on each of 8 microarrays, representing 10,003 A. fumigatus transcripts and 500 control sequences, spotted in duplicate. Each spot yielded a fluorescence intensity of Cy3 and Cy5, representing RNA from A. fumigatus conidia incubated alone, or A. fumigatus conidia and 16HBE cells incubated together. This dataset comprising eight microarrays has been submitted to the Gene Expression Omnibus [154], under the accession number GSE16637. To select genes of interest, a signal intensity cutoff was first applied to limit the gene list to those whose expression could reliably be detected in samples containing both human and fungal RNA, identifying a list of 1351 probes for further analysis. Of these, 210 showed differential expression between co-incubated and control conidia,   79 Figure 4.5: Hybridization of human reference RNA to Aspergillus fumigatus specific microarray slide.    To ensure the specificity of the 70-mer probes on the TIGR Aspergillus fumigatus Version 3 microarrays for A. fumigatus transcripts, a Cy3-labeled universal human reference RNA sample was hybridized to the slide. As shown above, no hybridization of the human RNA was detected.   80 defined as having a t-test p-value less than or equal to 0.05 and fold-change of 1.5 or greater. Among these differentially expressed genes, 54 were up-regulated in co- incubated samples relative to controls, while 156 were down-regulated. These gene lists were analyzed for GO term enrichment, but the small numbers of genes in the lists, and the lack of GO annotations for many genes, greatly limited the strength of the analysis. Only 15 of the up-regulated genes and 123 of the down-regulated genes mapped to GO terms, and nearly all terms identified as enriched were associated with only one or two differentially expressed genes, and likely did not represent a meaningful enrichment. Strikingly, the list of genes that were up-regulated in conidia incubated with cells versus alone was greatly enriched for un-annotated genes, when compared to the list of down- regulated genes. Of the 54 genes showing up-regulation, only 14 were annotated with a specific name, the remaining 40 being annotated as “hypothetical protein”, “conserved hypothetical protein”, or lacking annotations entirely. In contrast, of the 156 genes identified as down-regulated, 138 had specific annotations, with the remaining 18 being annotated as “conserved hypothetical protein” or lacking annotations altogether. This represents a highly significant enrichment for un-annotated genes in the up-regulated gene list compared to the down regulated list (p-value = 1.67e-17). The A. fumigatus genes showing the greatest up- and down- regulation are shown in Table 4.6. The full list of genes identified as differentially expressed between A. fumigatus conidia incubated alone versus with 16HBE cells is shown in Appendix 3.    81 Table 4.2: Over-represented Gene Ontology terms in the lists of differentially expressed genes between unsorted 16HBE cells incubated with or without conidia.  List of Genes Up-Regulated in Co-Incubated Cells (231 genes) GOID Ontology Term P-value GO:0008270 MF zinc ion binding 1.28E-13 GO:0003677 MF DNA binding 4.60E-11 GO:0006350 BP transcription 1.64E-10 GO:0006139 BP nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 6.90E-09 GO:0006355 BP regulation of transcription, DNA-dependent 6.90E-09 GO:0003676 MF nucleic acid binding 9.91E-09 GO:0010556 BP regulation of macromolecule biosynthetic process 1.35E-08 GO:0010468 BP regulation of gene expression 3.38E-08 GO:0005634 CC nucleus 8.43E-08 GO:0004308 MF exo-alpha-sialidase activity 2.46E-03 List of Genes Down-Regulated in Co-Incubated Cells (109 genes) GOID Ontology Term P-value GO:0006882 BP cellular zinc ion homeostasis 3.85E-04 GO:0032844 BP regulation of homeostatic process 1.06E-03 GO:0008009 MF chemokine activity 2.94E-03 GO:0045787 BP positive regulation of cell cycle 4.05E-03 GO:0046968 BP peptide antigen transport 5.58E-03 GO:0001664 MF G-protein-coupled receptor binding 5.77E-03 GO:0045931 BP positive regulation of mitotic cell cycle 7.13E-03 GO:0045597 BP positive regulation of cell differentiation 7.44E-03 GO:0006935 BP chemotaxis 1.16E-02 GO:0005125 MF cytokine activity 1.32E-02  The lists of genes identified as up- and down-regulated in 16HBE cells incubated with A. fumigatus conidia relative to cells incubated alone were subjected to Gene Ontology term enrichment analysis. Selected terms, belonging to the biological process (BP), molecular function (MF), and cellular component (CC) ontologies, are shown, and the p- value for enrichment in the appropriate list is shown.    82 4.4 DISCUSSION The research outlined in this chapter investigated the interaction of human bronchial epithelial cells and A. fumigatus conidia by genome-wide transcriptional analysis using gene expression microarrays. Two separate approaches were used to analyze the transcriptional response of 16HBE cells to A. fumigatus. The unsorted experiment, which compared the transcriptomes of cells incubated in the presence or absence of conidia, identified 340 differentially expressed human genes between these conditions. The sorted experiment, which compared the transcriptomes of cells from negative and positive FACS-sorted samples, identified 889 differentially expressed genes between these conditions. Comparing the transcriptomes of A. fumigatus conidia incubated alone or with 16HBE cells revealed the differential expression of 210 fungal genes. These results demonstrated the profound effect that these human cells and A. fumigatus conidia have on each other’s basic transcriptional programming following co- incubation, and global analysis of these responses highlighted the important biological phenomena that define this interaction. 4.4.1 Analysis of 16HBE cell transcriptional responses to Aspergillus fumigatus conidia Initial inspection of global gene expression patterns in 16HBE cells revealed little variation between the different experimental conditions. Indeed, there was a high correlation in the expression profiles in all arrays, and the gene expression differences observed between conditions were generally minor. Different factors may contribute to   83 the limited magnitude of the observed gene expression responses. First, being an SV-40 transformed immortal cell line, 16HBE cells produce less mRNA than comparable primary cells, and may have a decreased ability to respond to external stimuli [personal communication, Dr. Tillie L. Hackett]. Secondly, it is possible that the co-incubation time of 6 hours prior to mRNA extraction did not capture the maximal transcriptional response of the 16HBE cells. Indeed, a recent study investigating the induction of β- defensin expression in 16HBE cells following exposure to A. fumigatus identified stronger responses following longer incubations, up to 18 hours [156]. Nonetheless, the finding that 16HBE cells rapidly internalize bound A. fumigatus conidia, as demonstrated in Chapter 2, indicates that certain aspects of their interaction do not show a lengthy delay. An additional factor limiting the observed fold changes between negative and positive samples in the sorted experiment is the fact that the accuracy of cell sorting was not 100%. The presence of cells interacting with conidia in the negative samples, and cells not interacting with conidia in the positive samples, leads to a reduction in the observed fold changes between these samples. For example, if 20% of cells in the negative sample were in fact positive, and 20% of cells in the positive sample were actually negative, then a gene with a true fold change of 2 between negative and positive cells would show a fold change of only 1.5 between these samples. Therefore, the fold changes reported in the sorted experiment are likely to underestimate the true expression differences between cells that are and are not interacting with A. fumigatus conidia.   84 Due to these considerations, the fold change cutoffs used to generate the differentially expressed gene lists in each experiment were quite low, at 1.1 for the sorted experiment and 1.5 for the unsorted experiment. Previous studies have shown that fold changes of 1.5 indicated significant gene expression differences [157-159]. The p-value cutoff to establish significance of differential expression in the unsorted and sorted experiments was set at 0.05. Given that each probe represents a separate statistical test, multiple testing correction can be applied to adjust the p-values and control the number of false positive genes. However, in this dataset, applying multiple testing correction yielded no significantly differentially expressed genes. Given the small sample size (4 replicates per condition), the large number of genes tested (over 20,000 in both unsorted and sorted experiments), and the limited magnitude of the observed fold changes between conditions, it is not surprising that no genes passed multiple testing correction. While the lack of multiple testing correction decreases the confidence in any single gene showing differential expression, analysis of the gene lists as a whole can identify biologically relevant themes that are robust to the presence of false positives. Analysis of 16HBE cells’ response to conidia by the unsorted and sorted experiments identified lists of 889 and 340 genes, respectively. Importantly, the number of genes identified is dependent on the statistical analysis performed, and the difference in the size of the gene lists does not indicate a more extensive response in the sorted versus unsorted experiments. Indeed, the greater number of genes identified in the sorted experiment can be attributed to the lower fold change cutoff, as well as to   85 the use of a paired t-test to identify differentially expressed genes. Interestingly, the overlap between these two gene lists was no greater than would be expected by chance alone. It is possible that certain differences in the experimental protocols in the two experiments, including trypsinization for flow cytometry in the sorted experiment but not in the unsorted experiment, resulted in the identification of different gene expression responses. Fundamentally, however, the two experiments interrogate distinct biological aspects of the response of 16HBE cells to A. fumigatus conidia. While the unsorted experiment highlights the overall response of cells to the presence of conidia, the sorted experiment specifically identifies genes associated with the direct interaction of cells with conidia. For example, any fungal factors secreted into the culture medium will affect all cells, and cellular responses to these will not be revealed by comparing the transcriptomes of negative and positive sorted cells. On the other hand, cellular responses resulting from direct interaction with conidia will be difficult to discern in unsorted samples, since only a subset of co-incubated cells will express them, limiting the strength of the observed signal. The unsorted and sorted experiments thus represent complementary approaches to investigate the full range of responses of the 16HBE cells to A. fumigatus conidia. Gene Ontology term enrichment analysis was carried out on the differentially expressed gene lists obtained from the unsorted and sorted experiments to highlight important biological themes associated with these gene lists. The identification of statistically significant enrichment for GO terms with high biological plausibility within the gene lists validated the methodology and analysis performed. In the unsorted   86 experiment, the major theme identified in the up-regulated gene list was activation of transcription, while the down-regulated list showed somewhat less significant associations with cellular homeostasis, cell division, and chemokine activity. In the sorted experiment, highly significant enrichments in the list of up-regulated genes included nucleosome assembly, chemokine activity, G-protein coupled receptor binding, and glutathione metabolic process, while the list of down-regulated genes was predominantly enriched for GO terms associated with mitosis and cell division. Thus, both experiments identified the initiation of a profound transcriptional reprogramming and decreased proliferation in cells exposed to conidia, based on GO terms over- represented in the lists of up- and down-regulated genes. The inhibition of cell cycle progression by fungal alkaloids has previously been reported [160, 161], and histone modification and chromatin remodeling are being recognized as important mediators of cellular stress responses [162, 163]. Furthermore, manipulation of chromatin structure by bacterial and fungal effectors is emerging as an important mechanism in host- pathogen interaction [164-166]. The present results suggest that A. fumigatus may modulate host cell transcriptional patterns by altering chromatin structure. Strikingly, chemokine activity, cytokine activity, and G-protein coupled receptor binding were all over-represented in the down-regulated gene list from the unsorted experiment but also over-represented in the up-regulated gene list from the sorted experiment. These contrasting results suggest a general suppression of these specific pathogen-responsive mechanisms in cells co-incubated with A. fumigatus conidia, but an up-regulation in those cells specifically interacting with conidia. Overall, the identification of highly   87 significant over-represented GO terms in the lists of up- and down-regulated genes, and the biological plausibility of these terms, supports the relevance of the lists of differentially expressed genes from the unsorted and sorted experiments, despite the low fold-change cut-offs used to generate them. In particular, these results validate the novel approach of comparing the transcriptomes of cells originating from the same culture but FAC-sorted into two separate samples based on their interaction with a pathogen. The identification of several genes contributing to the over-represented GO terms among the most highly differentially expressed genes in each list (see Table 4.3 and Table 4.4) further supports the biological relevance of the identified themes. Chemokine genes were prominent among the most down-regulated genes in the unsorted experiment and among the most up-regulated genes in the sorted experiment. Chemokines are chemotactic cytokines which induce directed chemotaxis in nearby responsive cells, and are implicated in a variety of biological processes including inflammation and autoimmune diseases, and lymphoid development and migration [167]. Furthermore, they have specifically been implicated in A. fumigatus-related allergic disease [168]. The chemokines IL8, CCL20, and CXCL3, were all among the ten genes showing greatest down-regulation upon exposure of 16HBE cells to A. fumigatus conidia, consistent with the identification of chemokine activity as an over-represented GO term in this gene list. In contrast with these findings, a recent study reported the induction of IL8, responsible for the recruitment and activation of neutrophils, in airway epithelial cells in response to direct contact with swollen conidia but not released   88 soluble molecules [169]. Expression levels of IL8 as well as CCL20, strongly chemotactic for lymphocytes, have also been shown to be increased following exposure of human monocytes to A. fumigatus [64, 117]. The observed down-regulation of chemokines in the unsorted cells exposed to conidia also contrasts with previous findings in epithelial cells, which show induction of immune mediators following exposure to A. fumigatus antigens or secreted proteases [170-172]. It should be noted, however, that there is little consistency between these studies in the specific genes showing regulation, and that transcriptional responses are highly dependent on the developmental stage of A. fumigatus to which cells are exposed. Thus, the lack of immune upregulation in the unsorted experiment may be explained by the fact that the conidia were not swollen following six hours of co-incubation. In the sorted experiment, two of the most up-regulated genes in cells interacting with A. fumigatus conidia were the chemokines CCL3 and CCL5. CCL3, previously known as macrophage inflammatory protein-1α (MIP-1α), is an inflammatory chemokine responsible for recruitment of leukocytes to sites of infection, and promotes a Th1 phenotype in lymphocytes [173, 174]. CCL5, previously known as Regulated upon Activation, Normal T-cell Expressed, and Secreted (RANTES), is strongly chemotactic for eosinophils [175-177]. Expression levels of both CCL3 and CCL5 have been shown to be elevated in the airways of allergic asthmatics relative to controls and to increase following allergen challenge [178, 179]. The expression of CCL3 has also previously been shown to be increased in mouse lungs and in rat alveolar macrophages following exposure to A. fumigatus conidia [180, 181]. CCL5 has been identified as an important   89 mediator of A. fumigatus-induced asthma in mice [182, 183]. In the context of neutropenia, depletion of CCL3 has been associated with increased fungal burden and mortality, supporting the beneficial role of this chemokine in defense against A. fumigatus [184]. These studies highlight the key roles of these chemokines in the spectrum of diseases associated with A. fumigatus. The induction of CCL3 and CCL5 expression by lung epithelial cells in response A. fumigatus conidia, which has not been previously reported, may represent an important contribution of these cells to the host response to A. fumigatus. Also among the most up-regulated genes identified in the sorted experiment were MMP1 and MMP3, two matrix metallopeptidases (also known as matrix metalloproteinases or MMPs). The MMPs are a family of zinc-dependent enzymes that collectively are capable of degrading all extracellular matrix components [185, 186]. Due to their potential to cause significant damage, they are tightly regulated at the transcriptional level, and are secreted as pro-enzymes requiring proteolytic cleavage for activation [187]. Aside from their function in extracellular matrix degradation, MMPs act as key regulators of immune mechanisms, responsible for modulation of cytokine and chemokine activity, establishment of chemokine gradients, and activation of defensins [187, 188]. They have important roles in normal physiological processes including development, wound healing, and cell trafficking, and also in a range of diseases including atherosclerosis, cancer, and various lung diseases [185, 187]. In particular, MMPs play a well documented role in asthma pathogenesis, by influencing inflammatory cell migration and extracellular matrix remodeling [189]. MMP1   90 expression has been shown to be higher in sputum cells of asthmatics relative to controls [190], and a polymorphism in the promoter for MMP1 has been associated with an elevated incidence of asthma with persistent airway obstruction [191]. The specific association between A. fumigatus and MMP activity has previously been shown in a study of corneal infection that showed a correlation between the number of conidia bound to cells, the degree of inflammation, and the levels of MMP9 [192]. The increased expression of MMP1 and MMP3 in response to A. fumigatus conidia is thus consistent with previous reports. Microsomal glutathione S-transferase 1 (MGST1), found to be up-regulated in cells interacting with A. fumigatus conidia, is the prototypical member of the glutathione S-transferase gene family [193]. Glutathione S-transferases catalyze the conjugation of glutathione to both endogenous and xenobiotic toxic substrates, which plays a role in their detoxification and excretion [194]. MGST1 is abundant in endoplasmic reticulum and outer mitochondrial membranes and is especially important in the protection of membranes from oxidative damage [195]. It undergoes a conformational change in response to sensing an oxidative environment, which increases its activity [195]. Furthermore, its expression is under transcriptional control of a promoter that responds to oxidative stress [193]. Its increased expression in cells interacting with A. fumigatus conidia thus suggests that these induce oxidative stress in the cells. Interestingly, one of the genes showing the greatest down-regulation in cells interacting with conidia in the sorted experiment was surfactant protein C (SFTPC).   91 SFTPC is mainly produced and secreted by type II pneumocytes of the alveoli and is important in decreasing surface tension, preventing alveolar collapse [196]. It has also been implicated in defense against inhaled pathogens, and conditions that decrease surfactant functioning have been associated with increased pulmonary infections [197, 198]. Surfactant function has also been shown to be reduced by allergen challenge in asthmatic patients, due partly to increased protein loads in the extracellular fluid [199]. The finding that 16HBE cells directly interacting with A. fumigatus conidia show decreased expression of SFTPC suggests transcriptional regulation as an alternative mechanism by which surfactant function may be reduced following challenge. Among the most highly up-regulated genes in 16HBE cells incubated with A. fumigatus conidia relative to controls in the unsorted experiment were two histones: H4j and H3h. Histones are best known for their fundamental part in the structure of nucleosomes, the basic units of chromatin organization in eukaryotes [200]. There is mounting evidence, however, that they play multiple roles including the regulation of gene transcription, and, outside the nucleus, as signaling molecules and antimicrobial agents [201, 202]. In particular, histone H3h expression has been found to be associated with exposure to dioxin, an important environmental pollutant [203]. The increased expression of these histone proteins in 16HBE cells exposed to A. fumigatus conidia warrants further investigation, to determine their possibly diverse functional roles in this context.   92 4.4.2 Analysis of Aspergillus fumigatus conidia transcriptional responses to 16HBE cells The transcriptional response of A. fumigatus conidia to interaction with 16HBE cells was investigated by comparing RNA samples obtained from conidia incubated in cell culture media, either alone, or with 16HBE cells. The amount of RNA obtained from these conditions varied greatly, as shown in Table 4.1. The RNA content of 16HBE cells is much greater than that of A. fumigatus conidia, resulting in much more RNA being obtained from samples containing both cells and conidia, compared to those containing conidia alone. Furthermore, it could be presumed that the vast majority of RNA isolated from co-incubated samples was of human origin, and that the amount of fungal RNA in these samples roughly matched the amount of RNA obtained from samples of conidia alone, since both conditions included the same number of conidia. qRT-PCR analysis showed that a gene expression signal for both species could be detected in co-incubated samples, confirming that some of the RNA was of fungal origin. Following the confirmation that human RNA would not hybridize to the probes on the A. fumigatus microarray, each slide was hybridized with an equal amount of RNA from conidia incubated alone and conidia incubated with cells. It did not appear that the presence of large amounts of human RNA in the co-incubated samples interfered with the hybridization of fungal transcripts to the array probes, and 1351 of the 10,003 genes on the array were identified as having reliable intensity signals in these samples. This finding is quite consistent with a previous report showing the expression of 844 genes in resting A. fumigatus conidia, and the induction of 598 more genes following 30 minutes   93 of incubation in rich medium to initiate germination [119]. Among the genes showing significant expression, 210 genes were differentially expressed, with 54 showing up- regulation and 156 showing down-regulation upon exposure to 16HBE cells. Annotation of the A. fumigatus genome, including coding sequence prediction and gene identification, was performed by an automated process relying on sequence homology and protein domain identification, and GO terms were assigned to genes by transferring the GO associations from the best protein matches from the Saccharomyces Genome Database [135]. However, comparisons of annotations across related genomes has revealed that such auto-annotation is not yet highly reliable, and further efforts will be required to determine the details of gene structure in A. fumigatus [204]. Due to the very limited number of annotated genes in the up- and down-regulated gene lists, GO term enrichment analysis did not identify significant biological themes associated with interaction of conidia with human cells. In fact, the distribution of un-annotated genes was itself striking, and the list of up-regulated genes was very significantly enriched (p- value = 1.67e-17) for genes lacking descriptive annotations. Given that annotations were derived from homology searches, genes lacking annotations are likely to represent those unique to A. fumigatus, suggesting that A. fumigatus conidia interacting with human cells may preferentially up-regulate genes unique to this species. Indeed, the over-representation of genes specific to A. fumigatus among those up-regulated in a murine model of invasive aspergillosis has previously been reported [145]. These results raise the intriguing possibility that a set of A. fumigatus-specific, host-responsive genes may be responsible for A. fumigatus’ higher pathogenicity than other related species to   94 which humans are also constantly exposed [41-49]. Further research will be required to validate the identity of these genes, and to investigate their functional relevance in the host-pathogen interaction. 4.5 SUMMARY  The results presented in this chapter demonstrate that human bronchial epithelial cells and A. fumigatus conidia, interacting in culture, respond to each other via altered transcriptional regulation. These adaptations are measurable using gene expression microarrays for each species, and in the case of cultured human bronchial epithelial cells, patterns of gene expression can be distinguished between cells in direct interaction with conidia and neighbouring cells from the same culture. The human response included genes associated with immune responses and cellular proliferation, while the fungal response included a large number of uncharacterized genes.   95 CHAPTER 5: GENERAL CONCLUSIONS AND FUTURE DIRECTIONS The aims of the research presented here were to apply whole genome transcriptional profiling to the interaction between human bronchial epithelial cells and A. fumigatus conidia. To this end, a cell culture model for this interaction was developed, using the human SV-40 transformed cell line 16HBE and A. fumigatus conidia which constitutively express green fluorescent protein (GFP). Using this system, it was possible to observe and quantify the internalization of conidia by 16HBE cells, demonstrating that these cultured cells effectively internalized a large portion of the A. fumigatus conidia that bind to their surface. FACS was used to isolate cells that were directly interacting with conidia (positive cells) from those from the same co-incubated cultures that were not directly associated with any conidia (negative cells). Although the negative and positive sorted cell samples were not absolutely pure, the great enrichment of negative and positive cells in these respective samples allowed further characterization of these two distinct cell populations. Genome-wide microarray analysis was performed on both the 16HBE cells and the A. fumigatus conidia, highlighting the effects of their interaction on the transcriptomes of both species. Analysis of gene expression profiles of 16HBE cells from the negative and positive sorted samples revealed specific responses to direct interaction with A. fumigatus conidia, which were distinct from the differential regulation observed between samples of cells incubated in the absence or presence of conidia. The identification of statistically and biologically significant GO term associations with these gene lists, and the presence of   96 individual genes supporting these terms among the most highly differentially expressed genes, validates this methodology to investigate host responses to pathogens at the cellular level. Analysis of gene expression profiles of A. fumigatus conidia incubated alone or in the presence of 16HBE cells revealed the induction of a large proportion of un-annotated genes in response to the presence of cells, suggesting that A. fumigatus may possess a unique set of genes that mediate its interactions with human epithelium. The results of the present study motivate further research in several different avenues. First, to increase the confidence in the gene expression changes observed using microarrays, expression levels should be confirmed using an independent platform. Indeed, while microarrays provide a powerful tool for gene discovery, the levels of expression of genes of interest should be validated using qRT-PCR, which is more sensitive and specific, before conclusions are drawn regarding these genes [205, 206]. Due to the exploratory nature of the present study, this analysis has not been undertaken. Secondly, while the present incomplete annotation of the A. fumigatus genome made interpretation of the observed conidial response to human cells difficult, further analysis of the fungal gene expression dataset may yield insights into the functional relevance of these results. This analysis will be aided by the continued improvements to the genome annotation, as well as the development of tools to make full use of the accumulating genomic data available. Indeed, since its initial publication in 2005 [135], the A. fumigatus genome has been re-annotated in 2008 [207]. The genomes of several other Aspergillus species have also recently been sequenced, allowing for powerful comparative studies. Aspergillus Genomes [208] has been   97 developed as a public resource for the Aspergillus research community, integrating genomic data with medically relevant findings for multiple species, and providing powerful searching methods to cross-link this information. Similarly, the e-Fungi database has been established as a single repository for data on over 30 fungal genomes, including A. fumigatus, and incorporates functional annotations, pathway information, and protein predictions [209]. To further build on the research presented here, it would be useful to extend the use of these methods to more sophisticated cell culture systems. Indeed, it is well accepted that the two-dimensional surface of a culture flask on which cell monolayers are grown does not reflect the tissue micro-environment found in vivo [210]. In particular, the impact of the extracellular environment on the gene expression profiles of epithelial cells is well documented [211]. The use of three-dimensional culture systems that more closely mimic living tissue allow a better representation of cellular mechanisms and responses [210]. Specifically, the culture of airway epithelial cells using an air-liquid interface increases their differentiation [99, 212]. Such cell culture systems have previously been used to study the interactions of airway epithelial cells and particles [213]. The interactions between phagocytes and A. fumigatus conidia have also been shown to depend upon the environmental context present in culture [214]. Furthermore, the application of the methodologies presented here to primary cells may yield greater insights into the interactions between A. fumigatus conidia and the airway epithelium. Grown in the appropriate culture conditions, primary cells can maintain structural and functional characteristics nearly identical to native epithelium [99].   98 Importantly, analyzing the transcriptomes of primary airway epithelial cells from healthy donors and from asthmatics may reveal fundamentally different responses to A. fumigatus conidia in these cells, which could contribute to the development of asthma. Furthermore, the identification of different patterns of gene expression in A. fumigatus conidia co-incubated with normal or asthmatic primary cells could highlight fungal mechanisms important in A. fumigatus-induced asthma. Overall, the research presented here showed the efficient uptake of A. fumigatus conidia by cultured human bronchial epithelial cells, demonstrated the ability to use flow cytometry to sort cells based on their interaction with the GFP-expressing conidia, and indentified significant transcriptional reprogramming in both cells and conidia following six hours of co-incubation. The main significance of this work is two-fold. First, this has shed light on the nature of the interaction between inhaled A. fumigatus conidia and the airway epithelium in vivo. It is likely that this interaction is critical in the development of the range of diseases associated with A. fumigatus, from asthmatic reactions to invasive disease. Secondly, this research represents the successful application of a novel approach, namely the use of flow cytometry to separate cells based on their interaction with a pathogen. The identification of distinguishable gene expression patterns between the negative and positive sorted cell populations confirms the utility of this methodology, which may be applied to a variety of cell types and pathogens. This study thus provides a system for exploring the interactions between human airway epithelium and medically important microbes such as A. fumigatus, which are relevant to clinicians and researchers alike.   99 REFERENCES 1. Casadevall, A. and L.A. Pirofski, Host-pathogen interactions: redefining the basic concepts of virulence and pathogenicity. Infect Immun, 1999. 67(8): p. 3703-13. 2. Casadevall, A. and L.A. Pirofski, Host-pathogen interactions: basic concepts of microbial commensalism, colonization, infection, and disease. Infect Immun, 2000. 68(12): p. 6511-8. 3. Casadevall, A. and L.A. Pirofski, The damage-response framework of microbial pathogenesis. Nat Rev Microbiol, 2003. 1(1): p. 17-24. 4. Casadevall, A. and L. Pirofski, Host-pathogen interactions: the attributes of virulence. J Infect Dis, 2001. 184(3): p. 337-44. 5. Latge, J.P., Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev, 1999. 12(2): p. 310-50. 6. Waddell, S.J., P.D. Butcher, and N.G. Stoker, RNA profiling in host-pathogen interactions. Curr Opin Microbiol, 2007. 10(3): p. 297-302. 7. Cummings, C.A. and D.A. Relman, Using DNA microarrays to study host-microbe interactions. Emerg Infect Dis, 2000. 6(5): p. 513-25. 8. Ithal, N., et al., Parallel genome-wide expression profiling of host and pathogen during soybean cyst nematode infection of soybean. Mol Plant Microbe Interact, 2007. 20(3): p. 293-305. 9. Moy, P., et al., Patterns of gene expression upon infection of soybean plants by Phytophthora sojae. Mol Plant Microbe Interact, 2004. 17(10): p. 1051-62. 10. Motley, S.T., et al., Simultaneous analysis of host and pathogen interactions during an in vivo infection reveals local induction of host acute phase response proteins, a novel bacterial stress response, and evidence of a host-imposed metal ion limited environment. Cell Microbiol, 2004. 6(9): p. 849-65. 11. Lovegrove, F.E., et al., Simultaneous host and parasite expression profiling identifies tissue-specific transcriptional programs associated with susceptibility or resistance to experimental cerebral malaria. BMC Genomics, 2006. 7: p. 295. 12. Zaas, A.K. and D.A. Schwartz, Innate immunity and the lung: defense at the interface between host and environment. Trends Cardiovasc Med, 2005. 15(6): p. 195-202. 13. Bals, R. and P.S. Hiemstra, Innate immunity in the lung: how epithelial cells fight against respiratory pathogens. Eur Respir J, 2004. 23(2): p. 327-33. 14. Kato, A. and R.P. Schleimer, Beyond inflammation: airway epithelial cells are at the interface of innate and adaptive immunity. Curr Opin Immunol, 2007. 19(6): p. 711-20. 15. Castranova, V., et al., The alveolar type II epithelial cell: a multifunctional pneumocyte. Toxicol Appl Pharmacol, 1988. 93(3): p. 472-83. 16. Crystal, R.G., et al., Airway epithelial cells: current concepts and challenges. Proc Am Thorac Soc, 2008. 5(7): p. 772-7.   100 17. Knight, D.A. and S.T. Holgate, The airway epithelium: structural and functional properties in health and disease. Respirology, 2003. 8(4): p. 432-46. 18. Schneeberger, E.E. and R.D. Lynch, Tight junctions. Their structure, composition, and function. Circ Res, 1984. 55(6): p. 723-33. 19. Mall, M.A., Role of cilia, mucus, and airway surface liquid in mucociliary dysfunction: lessons from mouse models. J Aerosol Med Pulm Drug Deliv, 2008. 21(1): p. 13-24. 20. Antunes, M.B. and N.A. Cohen, Mucociliary clearance--a critical upper airway host defense mechanism and methods of assessment. Curr Opin Allergy Clin Immunol, 2007. 7(1): p. 5-10. 21. Basu, S. and M.J. Fenton, Toll-like receptors: function and roles in lung disease. Am J Physiol Lung Cell Mol Physiol, 2004. 286(5): p. L887-92. 22. Harju, K., V. Glumoff, and M. Hallman, Ontogeny of Toll-like receptors Tlr2 and Tlr4 in mice. Pediatr Res, 2001. 49(1): p. 81-3. 23. Piggott, D.A., et al., MyD88-dependent induction of allergic Th2 responses to intranasal antigen. J Clin Invest, 2005. 115(2): p. 459-67. 24. Hiemstra, P.S., Epithelial antimicrobial peptides and proteins: their role in host defence and inflammation. Paediatr Respir Rev, 2001. 2(4): p. 306-10. 25. Umetsu, D.T., et al., Asthma: an epidemic of dysregulated immunity. Nat Immunol, 2002. 3(8): p. 715-20. 26. McGee, H.S. and D.K. Agrawal, TH2 cells in the pathogenesis of airway remodeling: regulatory T cells a plausible panacea for asthma. Immunol Res, 2006. 35(3): p. 219-32. 27. Hackett, T.L. and D.A. Knight, The role of epithelial injury and repair in the origins of asthma. Curr Opin Allergy Clin Immunol, 2007. 7(1): p. 63-8. 28. Holgate, S.T., Pathogenesis of asthma. Clin Exp Allergy, 2008. 38(6): p. 872-97. 29. Holgate, S.T., The airway epithelium is central to the pathogenesis of asthma. Allergol Int, 2008. 57(1): p. 1-10. 30. Adcock, I.M., G. Caramori, and K.F. Chung, New targets for drug development in asthma. Lancet, 2008. 372(9643): p. 1073-87. 31. Kicic, A., et al., Intrinsic biochemical and functional differences in bronchial epithelial cells of children with asthma. Am J Respir Crit Care Med, 2006. 174(10): p. 1110-8. 32. Barbato, A., et al., Epithelial damage and angiogenesis in the airways of children with asthma. Am J Respir Crit Care Med, 2006. 174(9): p. 975-81. 33. Busse, W., et al., Airway remodeling and repair. Am J Respir Crit Care Med, 1999. 160(3): p. 1035-42. 34. Holgate, S.T., et al., Local genetic and environmental factors in asthma disease pathogenesis: chronicity and persistence mechanisms. Eur Respir J, 2007. 29(4): p. 793-803. 35. Warris, A., et al., Molecular epidemiology of Aspergillus fumigatus isolates recovered from water, air, and patients shows two clusters of genetically distinct strains. J Clin Microbiol, 2003. 41(9): p. 4101-6.   101 36. O'Gorman, C.M., H.T. Fuller, and P.S. Dyer, Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature, 2008. 37. Latge, J.P., The pathobiology of Aspergillus fumigatus. Trends Microbiol, 2001. 9(8): p. 382-9. 38. Hohl, T.M. and M. Feldmesser, Aspergillus fumigatus: principles of pathogenesis and host defense. Eukaryot Cell, 2007. 6(11): p. 1953-63. 39. Rhodes, J.C., Aspergillus fumigatus: growth and virulence. Med Mycol, 2006. 44 Suppl 1: p. S77-81. 40. Tekaia, F. and J.P. Latge, Aspergillus fumigatus: saprophyte or pathogen? Curr Opin Microbiol, 2005. 8(4): p. 385-92. 41. Panagopoulou, P., et al., Filamentous fungi in a tertiary care hospital: environmental surveillance and susceptibility to antifungal drugs. Infect Control Hosp Epidemiol, 2007. 28(1): p. 60-7. 42. Panagopoulou, P., et al., Environmental surveillance of filamentous fungi in three tertiary care hospitals in Greece. J Hosp Infect, 2002. 52(3): p. 185-91. 43. Schmitt, H.J., et al., Aspergillus species from hospital air and from patients. Mycoses, 1990. 33(11-12): p. 539-41. 44. Shelton, B.G., et al., Profiles of airborne fungi in buildings and outdoor environments in the United States. Appl Environ Microbiol, 2002. 68(4): p. 1743- 53. 45. Wald, A., et al., Epidemiology of Aspergillus infections in a large cohort of patients undergoing bone marrow transplantation. J Infect Dis, 1997. 175(6): p. 1459-66. 46. Marr, K.A., et al., Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients. Clin Infect Dis, 2002. 34(7): p. 909- 17. 47. Minari, A., et al., The incidence of invasive aspergillosis among solid organ transplant recipients and implications for prophylaxis in lung transplants. Transpl Infect Dis, 2002. 4(4): p. 195-200. 48. Morgan, J., et al., Incidence of invasive aspergillosis following hematopoietic stem cell and solid organ transplantation: interim results of a prospective multicenter surveillance program. Med Mycol, 2005. 43 Suppl 1: p. S49-58. 49. Pagano, L., et al., The epidemiology of fungal infections in patients with hematologic malignancies: the SEIFEM-2004 study. Haematologica, 2006. 91(8): p. 1068-75. 50. Rementeria, A., et al., Genes and molecules involved in Aspergillus fumigatus virulence. Rev Iberoam Micol, 2005. 22(1): p. 1-23. 51. D'Enfert, C., et al., Attenuated virulence of uridine-uracil auxotrophs of Aspergillus fumigatus. Infect Immun, 1996. 64(10): p. 4401-5. 52. Brown, J.S., et al., Signature-tagged and directed mutagenesis identify PABA synthetase as essential for Aspergillus fumigatus pathogenicity. Mol Microbiol, 2000. 36(6): p. 1371-80.   102 53. Panepinto, J.C., et al., Deletion of the Aspergillus fumigatus gene encoding the Ras-related protein RhbA reduces virulence in a model of Invasive pulmonary aspergillosis. Infect Immun, 2003. 71(5): p. 2819-26. 54. Krappmann, S., et al., The Aspergillus fumigatus transcriptional activator CpcA contributes significantly to the virulence of this fungal pathogen. Mol Microbiol, 2004. 52(3): p. 785-99. 55. Liebmann, B., et al., Deletion of the Aspergillus fumigatus lysine biosynthesis gene lysF encoding homoaconitase leads to attenuated virulence in a low-dose mouse infection model of invasive aspergillosis. Arch Microbiol, 2004. 181(5): p. 378-83. 56. Hu, W., et al., Essential gene identification and drug target prioritization in Aspergillus fumigatus. PLoS Pathog, 2007. 3(3): p. e24. 57. Moreno, M.A., et al., The regulation of zinc homeostasis by the ZafA transcriptional activator is essential for Aspergillus fumigatus virulence. Mol Microbiol, 2007. 64(5): p. 1182-97. 58. Sugui, J.A., et al., Gliotoxin is a virulence factor of Aspergillus fumigatus: gliP deletion attenuates virulence in mice immunosuppressed with hydrocortisone. Eukaryot Cell, 2007. 6(9): p. 1562-9. 59. Hissen, A.H., et al., Survival of Aspergillus fumigatus in serum involves removal of iron from transferrin: the role of siderophores. Infect Immun, 2004. 72(3): p. 1402-8. 60. Schrettl, M., et al., Siderophore biosynthesis but not reductive iron assimilation is essential for Aspergillus fumigatus virulence. J Exp Med, 2004. 200(9): p. 1213-9. 61. Tsai, H.F., et al., The developmentally regulated alb1 gene of Aspergillus fumigatus: its role in modulation of conidial morphology and virulence. J Bacteriol, 1998. 180(12): p. 3031-8. 62. Ibrahim-Granet, O., et al., Phagocytosis and intracellular fate of Aspergillus fumigatus conidia in alveolar macrophages. Infect Immun, 2003. 71(2): p. 891- 903. 63. Philippe, B., et al., Killing of Aspergillus fumigatus by alveolar macrophages is mediated by reactive oxidant intermediates. Infect Immun, 2003. 71(6): p. 3034- 42. 64. Loeffler, J., et al., Interaction analyses of human monocytes co-cultured with different forms of Aspergillus fumigatus. J Med Microbiol, 2009. 58(Pt 1): p. 49- 58. 65. Schaffner, A., H. Douglas, and A. Braude, Selective protection against conidia by mononuclear and against mycelia by polymorphonuclear phagocytes in resistance to Aspergillus. Observations on these two lines of defense in vivo and in vitro with human and mouse phagocytes. J Clin Invest, 1982. 69(3): p. 617-31. 66. Levitz, S.M. and T.P. Farrell, Human neutrophil degranulation stimulated by Aspergillus fumigatus. J Leukoc Biol, 1990. 47(2): p. 170-5. 67. Williams, D.M., M.H. Weiner, and D.J. Drutz, Immunologic studies of disseminated infection with Aspergillus fumigatus in the nude mouse. J Infect Dis, 1981. 143(5): p. 726-33.   103 68. Cenci, E., et al., Interleukin-4 causes susceptibility to invasive pulmonary aspergillosis through suppression of protective type I responses. J Infect Dis, 1999. 180(6): p. 1957-68. 69. Kurup, V.P., et al., Cytokines in allergic bronchopulmonary aspergillosis. Res Immunol, 1998. 149(4-5): p. 466-77; discussion 515-6. 70. Barnes, P.D. and K.A. Marr, Aspergillosis: spectrum of disease, diagnosis, and treatment. Infect Dis Clin North Am, 2006. 20(3): p. 545-61, vi. 71. Hope, W.W., T.J. Walsh, and D.W. Denning, The invasive and saprophytic syndromes due to Aspergillus spp. Med Mycol, 2005. 43 Suppl 1: p. S207-38. 72. Soubani, A.O. and P.H. Chandrasekar, The clinical spectrum of pulmonary aspergillosis. Chest, 2002. 121(6): p. 1988-99. 73. Greenberger, P.A., et al., Analysis of bronchoalveolar lavage in allergic bronchopulmonary aspergillosis: divergent responses of antigen-specific antibodies and total IgE. J Allergy Clin Immunol, 1988. 82(2): p. 164-70. 74. Laufer, P., et al., Allergic bronchopulmonary aspergillosis in cystic fibrosis. J Allergy Clin Immunol, 1984. 73(1 Pt 1): p. 44-8. 75. Schonheyder, H., et al., Frequency of Aspergillus fumigatus isolates and antibodies to aspergillus antigens in cystic fibrosis. Acta Pathol Microbiol Immunol Scand [B], 1985. 93(2): p. 105-12. 76. Tillie-Leblond, I. and A.B. Tonnel, Allergic bronchopulmonary aspergillosis. Allergy, 2005. 60(8): p. 1004-13. 77. Wark, P.A. and P.G. Gibson, Allergic bronchopulmonary aspergillosis: new concepts of pathogenesis and treatment. Respirology, 2001. 6(1): p. 1-7. 78. Chauhan, B., et al., The association of HLA-DR alleles and T cell activation with allergic bronchopulmonary aspergillosis. J Immunol, 1997. 159(8): p. 4072-6. 79. Stevens, D.A., et al., Allergic bronchopulmonary aspergillosis in cystic fibrosis-- state of the art: Cystic Fibrosis Foundation Consensus Conference. Clin Infect Dis, 2003. 37 Suppl 3: p. S225-64. 80. Lee, S.H., et al., Clinical manifestations and treatment outcomes of pulmonary aspergilloma. Korean J Intern Med, 2004. 19(1): p. 38-42. 81. Addrizzo-Harris, D.J., et al., Pulmonary aspergilloma and AIDS. A comparison of HIV-infected and HIV-negative individuals. Chest, 1997. 111(3): p. 612-8. 82. Aslam, P.A., C.E. Eastridge, and F.A. Hughes, Jr., Aspergillosis of the lung--an eighteen-year experience. Chest, 1971. 59(1): p. 28-32. 83. Jewkes, J., et al., Pulmonary aspergilloma: analysis of prognosis in relation to haemoptysis and survey of treatment. Thorax, 1983. 38(8): p. 572-8. 84. Kawamura, S., et al., Clinical evaluation of 61 patients with pulmonary aspergilloma. Intern Med, 2000. 39(3): p. 209-12. 85. Pennington, J.E., Aspergillus lung disease. Med Clin North Am, 1980. 64(3): p. 475-90. 86. Denning, D.W., Invasive aspergillosis. Clin Infect Dis, 1998. 26(4): p. 781-803; quiz 804-5. 87. Gerson, S.L., et al., Invasive pulmonary aspergillosis in adult acute leukemia: clinical clues to its diagnosis. J Clin Oncol, 1985. 3(8): p. 1109-16.   104 88. Winkelstein, J.A., et al., Chronic granulomatous disease. Report on a national registry of 368 patients. Medicine (Baltimore), 2000. 79(3): p. 155-69. 89. Bodey, G., et al., Fungal infections in cancer patients: an international autopsy survey. Eur J Clin Microbiol Infect Dis, 1992. 11(2): p. 99-109. 90. Markowitz, G.S., et al., Autopsy patterns of disease among subgroups of an inner- city Bronx AIDS population. J Acquir Immune Defic Syndr Hum Retrovirol, 1996. 13(1): p. 48-54. 91. Minamoto, G.Y., T.F. Barlam, and N.J. Vander Els, Invasive aspergillosis in patients with AIDS. Clin Infect Dis, 1992. 14(1): p. 66-74. 92. Hori, A., et al., Clinical significance of extra-pulmonary involvement of invasive aspergillosis: a retrospective autopsy-based study of 107 patients. J Hosp Infect, 2002. 50(3): p. 175-82. 93. Jantunen, E., et al., Central nervous system aspergillosis in allogeneic stem cell transplant recipients. Bone Marrow Transplant, 2003. 31(3): p. 191-6. 94. Trullas, J.C., et al., Invasive pulmonary aspergillosis in solid organ and bone marrow transplant recipients. Transplant Proc, 2005. 37(9): p. 4091-3. 95. Ribaud, P., et al., Survival and prognostic factors of invasive aspergillosis after allogeneic bone marrow transplantation. Clin Infect Dis, 1999. 28(2): p. 322-30. 96. Warris, A. and P.E. Verweij, Clinical implications of environmental sources for Aspergillus. Med Mycol, 2005. 43 Suppl 1: p. S59-65. 97. Denning, D.W., Therapeutic outcome in invasive aspergillosis. Clin Infect Dis, 1996. 23(3): p. 608-15. 98. Hope, W.W. and D.W. Denning, Invasive aspergillosis: current and future challenges in diagnosis and therapy. Clin Microbiol Infect, 2004. 10(1): p. 2-4. 99. Gruenert, D.C., W.E. Finkbeiner, and J.H. Widdicombe, Culture and transformation of human airway epithelial cells. Am J Physiol, 1995. 268(3 Pt 1): p. L347-60. 100. Krause, K.H., Professional phagocytes: predators and prey of microorganisms. Schweiz Med Wochenschr, 2000. 130(4): p. 97-100. 101. Jutras, I. and M. Desjardins, Phagocytosis: at the crossroads of innate and adaptive immunity. Annu Rev Cell Dev Biol, 2005. 21: p. 511-27. 102. Filler, S.G. and D.C. Sheppard, Fungal invasion of normally non-phagocytic host cells. PLoS Pathog, 2006. 2(12): p. e129. 103. Valentin-Weigand, P., Intracellular invasion and persistence: survival strategies of Streptococcus suis and Mycobacterium avium ssp. paratuberculosis. Berl Munch Tierarztl Wochenschr, 2004. 117(11-12): p. 459-63. 104. Casadevall, A., Evolution of intracellular pathogens. Annu Rev Microbiol, 2008. 62: p. 19-33. 105. Claudia, M., et al., The interaction of fungi with dendritic cells: implications for Th immunity and vaccination. Curr Mol Med, 2002. 2(6): p. 507-24. 106. Gafa, V., et al., Human dendritic cells following Aspergillus fumigatus infection express the CCR7 receptor and a differential pattern of interleukin-12 (IL-12), IL- 23, and IL-27 cytokines, which lead to a Th1 response. Infect Immun, 2006. 74(3): p. 1480-9.   105 107. Gafa, V., et al., In vitro infection of human dendritic cells by Aspergillus fumigatus conidia triggers the secretion of chemokines for neutrophil and Th1 lymphocyte recruitment. Microbes Infect, 2007. 9(8): p. 971-80. 108. Luther, K., et al., Characterisation of the phagocytic uptake of Aspergillus fumigatus conidia by macrophages. Microbes Infect, 2008. 10(2): p. 175-84. 109. Perkhofer, S., et al., In vitro determination of phagocytosis and intracellular killing of Aspergillus species by mononuclear phagocytes. Mycopathologia, 2007. 163(6): p. 303-7. 110. DeHart, D.J., et al., Binding and germination of Aspergillus fumigatus conidia on cultured A549 pneumocytes. J Infect Dis, 1997. 175(1): p. 146-50. 111. Paris, S., et al., Internalization of Aspergillus fumigatus conidia by epithelial and endothelial cells. Infect Immun, 1997. 65(4): p. 1510-4. 112. Wasylnka, J.A. and M.M. Moore, Uptake of Aspergillus fumigatus conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect Immun, 2002. 70(6): p. 3156-63. 113. Wasylnka, J.A. and M.M. Moore, Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci, 2003. 116(Pt 8): p. 1579-87. 114. Botterel, F., et al., Phagocytosis of Aspergillus fumigatus conidia by primary nasal epithelial cells in vitro. BMC Microbiol, 2008. 8: p. 97. 115. Cozens, A.L., et al., A transformed human epithelial cell line that retains tight junctions post crisis. In Vitro Cell Dev Biol, 1992. 28A(11-12): p. 735-44. 116. Karp, P.H., et al., An in vitro model of differentiated human airway epithelia. Methods for establishing primary cultures. Methods Mol Biol, 2002. 188: p. 115- 37. 117. Cortez, K.J., et al., Functional genomics of innate host defense molecules in normal human monocytes in response to Aspergillus fumigatus. Infect Immun, 2006. 74(4): p. 2353-65. 118. Rodland, E.K., et al., Expression of genes in normal human monocytes in response to Aspergillus fumigatus. Med Mycol, 2008. 46(4): p. 327-36. 119. Lamarre, C., et al., Transcriptomic analysis of the exit from dormancy of Aspergillus fumigatus conidia. BMC Genomics, 2008. 9: p. 417. 120. Liu, M., et al., Early days: genomics and human responses to infection. Curr Opin Microbiol, 2006. 9(3): p. 312-9. 121. Glanzer, J.G., P.G. Haydon, and J.H. Eberwine, Expression profile analysis of neurodegenerative disease: advances in specificity and resolution. Neurochem Res, 2004. 29(6): p. 1161-8. 122. Zhong, J.F., Y. Feng, and C.R. Taylor, Microfluidic devices for investigating stem cell gene regulation via single-cell analysis. Curr Med Chem, 2008. 15(28): p. 2897-900. 123. Iscove, N.N., et al., Representation is faithfully preserved in global cDNA amplified exponentially from sub-picogram quantities of mRNA. Nat Biotechnol, 2002. 20(9): p. 940-3.   106 124. Wang, E., et al., High-fidelity mRNA amplification for gene profiling. Nat Biotechnol, 2000. 18(4): p. 457-9. 125. Chao, T.C. and A. Ros, Microfluidic single-cell analysis of intracellular compounds. J R Soc Interface, 2008. 5 Suppl 2: p. S139-50. 126. Simone, N.L., et al., Laser-capture microdissection: opening the microscopic frontier to molecular analysis. Trends Genet, 1998. 14(7): p. 272-6. 127. Resnick, M.B., et al., Global analysis of the human gastric epithelial transcriptome altered by Helicobacter pylori eradication in vivo. Gut, 2006. 55(12): p. 1717-24. 128. Ibrahim, S.F. and G. van den Engh, Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol, 2007. 106: p. 19-39. 129. Jaroszeski, M.J. and G. Radcliff, Fundamentals of flow cytometry. Mol Biotechnol, 1999. 11(1): p. 37-53. 130. Johnson, K.W., M. Dooner, and P.J. Quesenberry, Fluorescence activated cell sorting: a window on the stem cell. Curr Pharm Biotechnol, 2007. 8(3): p. 133-9. 131. Arlotta, P., et al., Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Neuron, 2005. 45(2): p. 207-21. 132. Lobo, M.K., et al., FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat Neurosci, 2006. 9(3): p. 443-52. 133. Marsh, E.D., et al., FACS-array gene expression analysis during early development of mouse telencephalic interneurons. Dev Neurobiol, 2008. 68(4): p. 434-45. 134. Finishing the euchromatic sequence of the human genome. Nature, 2004. 431(7011): p. 931-45. 135. Nierman, W.C., et al., Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature, 2005. 438(7071): p. 1151-6. 136. Huang, S.H., T. Triche, and A.Y. Jong, Infectomics: genomics and proteomics of microbial infections. Funct Integr Genomics, 2002. 1(6): p. 331-44. 137. Ehrenreich, A., DNA microarray technology for the microbiologist: an overview. Appl Microbiol Biotechnol, 2006. 73(2): p. 255-73. 138. Dharmadi, Y. and R. Gonzalez, DNA microarrays: experimental issues, data analysis, and application to bacterial systems. Biotechnol Prog, 2004. 20(5): p. 1309-24. 139. Bryant, P.A., et al., Chips with everything: DNA microarrays in infectious diseases. Lancet Infect Dis, 2004. 4(2): p. 100-11. 140. Simon, R., Microarray-based expression profiling and informatics. Curr Opin Biotechnol, 2008. 19(1): p. 26-9. 141. Olson, N.E., The microarray data analysis process: from raw data to biological significance. NeuroRx, 2006. 3(3): p. 373-83. 142. Huang da, W., B.T. Sherman, and R.A. Lempicki, Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res, 2009. 37(1): p. 1-13. 143. Ashburner, M., et al., Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet, 2000. 25(1): p. 25-9.   107 144. Sugui, J.A., et al., Genes differentially expressed in conidia and hyphae of Aspergillus fumigatus upon exposure to human neutrophils. PLoS ONE, 2008. 3(7): p. e2655. 145. McDonagh, A., et al., Sub-telomere directed gene expression during initiation of invasive aspergillosis. PLoS Pathog, 2008. 4(9): p. e1000154. 146. Mack, E., A. Neubauer, and C. Brendel, Comparison of RNA yield from small cell populations sorted by flow cytometry applying different isolation procedures. Cytometry A, 2007. 71(6): p. 404-9. 147. Schroeder, A., et al., The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol, 2006. 7: p. 3. 148. Fleige, S. and M.W. Pfaffl, RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med, 2006. 27(2-3): p. 126-39. 149. Gravelat, F.N., et al., In vivo analysis of Aspergillus fumigatus developmental gene expression determined by real-time reverse transcription-PCR. Infect Immun, 2008. 76(8): p. 3632-9. 150. Altschul, S.F., et al., Basic local alignment search tool. J Mol Biol, 1990. 215(3): p. 403-10. 151. Zheng, Q. and X.J. Wang, GOEAST: a web-based software toolkit for Gene Ontology enrichment analysis. Nucleic Acids Res, 2008. 36(Web Server issue): p. W358-63. 152. Yang, Y.H., et al., Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res, 2002. 30(4): p. e15. 153. Do, J.H. and D.K. Choi, Normalization of microarray data: single-labeled and dual- labeled arrays. Mol Cells, 2006. 22(3): p. 254-61. 154. Barrett, T., et al., NCBI GEO: archive for high-throughput functional genomic data. Nucleic Acids Res, 2009. 37(Database issue): p. D885-90. 155. Brazma, A., et al., Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat Genet, 2001. 29(4): p. 365- 71. 156. Alekseeva, L., et al., Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms. BMC Microbiol, 2009. 9: p. 33. 157. Brocke-Heidrich, K., et al., Interleukin-6-dependent gene expression profiles in multiple myeloma INA-6 cells reveal a Bcl-2 family-independent survival pathway closely associated with Stat3 activation. Blood, 2004. 103(1): p. 242-51. 158. Kogel, D., et al., Regulation of gene expression by the amyloid precursor protein: inhibition of the JNK/c-Jun pathway. Cell Death Differ, 2005. 12(1): p. 1-9. 159. Lu, T., et al., Gene regulation and DNA damage in the ageing human brain. Nature, 2004. 429(6994): p. 883-91. 160. Koizumi, Y., et al., Fungerin, a fungal alkaloid, arrests the cell cycle in M phase by inhibition of microtubule polymerization. J Antibiot (Tokyo), 2004. 57(7): p. 415- 20.   108 161. Koizumi, Y., et al., Oxaline, a fungal alkaloid, arrests the cell cycle in M phase by inhibition of tubulin polymerization. Biochim Biophys Acta, 2004. 1693(1): p. 47- 55. 162. Johnson, A.B. and M.C. Barton, Hypoxia-induced and stress-specific changes in chromatin structure and function. Mutat Res, 2007. 618(1-2): p. 149-62. 163. Uffenbeck, S.R. and J.E. Krebs, The role of chromatin structure in regulating stress-induced transcription in Saccharomyces cerevisiae. Biochem Cell Biol, 2006. 84(4): p. 477-89. 164. Arbibe, L., Immune subversion by chromatin manipulation: a 'new face' of host- bacterial pathogen interaction. Cell Microbiol, 2008. 10(8): p. 1582-90. 165. Minarovits, J., Microbe-induced epigenetic alterations in host cells: the coming era of patho-epigenetics of microbial infections. A review. Acta Microbiol Immunol Hung, 2009. 56(1): p. 1-19. 166. Hamon, M.A. and P. Cossart, Histone modifications and chromatin remodeling during bacterial infections. Cell Host Microbe, 2008. 4(2): p. 100-9. 167. Rossi, D. and A. Zlotnik, The biology of chemokines and their receptors. Annu Rev Immunol, 2000. 18: p. 217-42. 168. Hartl, D., K.F. Buckland, and C.M. Hogaboam, Chemokines in allergic aspergillosis--from animal models to human lung diseases. Inflamm Allergy Drug Targets, 2006. 5(4): p. 219-28. 169. Balloy, V., et al., Aspergillus fumigatus-induced interleukin-8 synthesis by respiratory epithelial cells is controlled by the phosphatidylinositol 3-kinase, p38 MAPK, and ERK1/2 pathways and not by the toll-like receptor-MyD88 pathway. J Biol Chem, 2008. 283(45): p. 30513-21. 170. Borger, P., et al., Proteases from Aspergillus fumigatus induce interleukin (IL)-6 and IL-8 production in airway epithelial cell lines by transcriptional mechanisms. J Infect Dis, 1999. 180(4): p. 1267-74. 171. Kauffman, H.F., et al., Protease-dependent activation of epithelial cells by fungal allergens leads to morphologic changes and cytokine production. J Allergy Clin Immunol, 2000. 105(6 Pt 1): p. 1185-93. 172. Zhao, J. and X.Y. Wu, Aspergillus fumigatus antigens activate immortalized human corneal epithelial cells via toll-like receptors 2 and 4. Curr Eye Res, 2008. 33(5): p. 447-54. 173. Karpus, W.J. and K.J. Kennedy, MIP-1alpha and MCP-1 differentially regulate acute and relapsing autoimmune encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J Leukoc Biol, 1997. 62(5): p. 681-7. 174. Menten, P., A. Wuyts, and J. Van Damme, Macrophage inflammatory protein-1. Cytokine Growth Factor Rev, 2002. 13(6): p. 455-81. 175. Teran, L.M., et al., Eosinophil recruitment following allergen challenge is associated with the release of the chemokine RANTES into asthmatic airways. J Immunol, 1996. 157(4): p. 1806-12. 176. Alam, R., et al., RANTES is a chemotactic and activating factor for human eosinophils. J Immunol, 1993. 150(8 Pt 1): p. 3442-8.   109 177. Venge, J., et al., Identification of IL-5 and RANTES as the major eosinophil chemoattractants in the asthmatic lung. J Allergy Clin Immunol, 1996. 97(5): p. 1110-5. 178. Alam, R., et al., Increased MCP-1, RANTES, and MIP-1alpha in bronchoalveolar lavage fluid of allergic asthmatic patients. Am J Respir Crit Care Med, 1996. 153(4 Pt 1): p. 1398-404. 179. Holgate, S.T., et al., Release of RANTES, MIP-1 alpha, and MCP-1 into asthmatic airways following endobronchial allergen challenge. Am J Respir Crit Care Med, 1997. 156(5): p. 1377-83. 180. Schelenz, S., D.A. Smith, and G.J. Bancroft, Cytokine and chemokine responses following pulmonary challenge with Aspergillus fumigatus: obligatory role of TNF-alpha and GM-CSF in neutrophil recruitment. Med Mycol, 1999. 37(3): p. 183-94. 181. Shahan, T.A., et al., Concentration- and time-dependent upregulation and release of the cytokines MIP-2, KC, TNF, and MIP-1alpha in rat alveolar macrophages by fungal spores implicated in airway inflammation. Am J Respir Cell Mol Biol, 1998. 18(3): p. 435-40. 182. Schuh, J.M., et al., Intrapulmonary targeting of RANTES/CCL5-responsive cells prevents chronic fungal asthma. Eur J Immunol, 2003. 33(11): p. 3080-90. 183. Schuh, J.M., K. Blease, and C.M. Hogaboam, The role of CC chemokine receptor 5 (CCR5) and RANTES/CCL5 during chronic fungal asthma in mice. Faseb J, 2002. 16(2): p. 228-30. 184. Mehrad, B., T.A. Moore, and T.J. Standiford, Macrophage inflammatory protein-1 alpha is a critical mediator of host defense against invasive pulmonary aspergillosis in neutropenic hosts. J Immunol, 2000. 165(2): p. 962-8. 185. Gueders, M.M., et al., Matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs in the respiratory tract: potential implications in asthma and other lung diseases. Eur J Pharmacol, 2006. 533(1-3): p. 133-44. 186. Thrailkill, K.M., R. Clay Bunn, and J.L. Fowlkes, Matrix metalloproteinases: their potential role in the pathogenesis of diabetic nephropathy. Endocrine, 2009. 35(1): p. 1-10. 187. Elkington, P.T. and J.S. Friedland, Matrix metalloproteinases in destructive pulmonary pathology. Thorax, 2006. 61(3): p. 259-66. 188. Manicone, A.M. and J.K. McGuire, Matrix metalloproteinases as modulators of inflammation. Semin Cell Dev Biol, 2008. 19(1): p. 34-41. 189. Kelly, E.A. and N.N. Jarjour, Role of matrix metalloproteinases in asthma. Curr Opin Pulm Med, 2003. 9(1): p. 28-33. 190. Cataldo, D.D., et al., Matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases mRNA transcripts in the bronchial secretions of asthmatics. Lab Invest, 2004. 84(4): p. 418-24. 191. Huang, C.D., et al., Matrix metalloproteinase-1 polymorphism is associated with persistent airway obstruction in asthma in the Taiwanese population. J Asthma, 2009. 46(1): p. 41-6.   110 192. Dong, X., et al., Roles of adherence and matrix metalloproteinases in growth patterns of fungal pathogens in cornea. Curr Eye Res, 2005. 30(8): p. 613-20. 193. Kelner, M.J., et al., Structural organization of the microsomal glutathione S- transferase gene (MGST1) on chromosome 12p13.1-13.2. Identification of the correct promoter region and demonstration of transcriptional regulation in response to oxidative stress. J Biol Chem, 2000. 275(17): p. 13000-6. 194. Sheehan, D., et al., Structure, function and evolution of glutathione transferases: implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem J, 2001. 360(Pt 1): p. 1-16. 195. Busenlehner, L.S., et al., Stress sensor triggers conformational response of the integral membrane protein microsomal glutathione transferase 1. Biochemistry, 2004. 43(35): p. 11145-52. 196. Walther, F.J., et al., Hydrophobic surfactant proteins and their analogues. Neonatology, 2007. 91(4): p. 303-10. 197. Glasser, S.W., et al., Macrophage dysfunction and susceptibility to pulmonary Pseudomonas aeruginosa infection in surfactant protein C-deficient mice. J Immunol, 2008. 181(1): p. 621-8. 198. Glasser, S.W., et al., Surfactant Protein C Deficient Mice are Susceptible to Respiratory Syncytial Virus Infection. Am J Physiol Lung Cell Mol Physiol, 2009. 199. Enhorning, G., Surfactant in airway disease. Chest, 2008. 133(4): p. 975-80. 200. Luijsterburg, M.S., et al., The major architects of chromatin: architectural proteins in bacteria, archaea and eukaryotes. Crit Rev Biochem Mol Biol, 2008. 43(6): p. 393-418. 201. Kawasaki, H. and S. Iwamuro, Potential roles of histones in host defense as antimicrobial agents. Infect Disord Drug Targets, 2008. 8(3): p. 195-205. 202. Parseghian, M.H. and K.A. Luhrs, Beyond the walls of the nucleus: the role of histones in cellular signaling and innate immunity. Biochem Cell Biol, 2006. 84(4): p. 589-604. 203. McHale, C.M., et al., Microarray analysis of gene expression in peripheral blood mononuclear cells from dioxin-exposed human subjects. Toxicology, 2007. 229(1- 2): p. 101-13. 204. Nierman, W.C., et al., What the Aspergillus genomes have told us. Med Mycol, 2005. 43 Suppl 1: p. S3-5. 205. Provenzano, M. and S. Mocellin, Complementary techniques: validation of gene expression data by quantitative real time PCR. Adv Exp Med Biol, 2007. 593: p. 66-73. 206. VanGuilder, H.D., K.E. Vrana, and W.M. Freeman, Twenty-five years of quantitative PCR for gene expression analysis. Biotechniques, 2008. 44(5): p. 619-26. 207. Fedorova, N.D., et al., Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet, 2008. 4(4): p. e1000046. 208. Mabey Gilsenan, J.E., et al., Aspergillus genomes and the Aspergillus cloud. Nucleic Acids Res, 2009. 37(Database issue): p. D509-14.   111 209. Hedeler, C., et al., e-Fungi: a data resource for comparative analysis of fungal genomes. BMC Genomics, 2007. 8: p. 426. 210. Pampaloni, F., E.G. Reynaud, and E.H. Stelzer, The third dimension bridges the gap between cell culture and live tissue. Nat Rev Mol Cell Biol, 2007. 8(10): p. 839-45. 211. Bissell, M.J. and M.H. Barcellos-Hoff, The influence of extracellular matrix on gene expression: is structure the message? J Cell Sci Suppl, 1987. 8: p. 327-43. 212. Whitcutt, M.J., K.B. Adler, and R. Wu, A biphasic chamber system for maintaining polarity of differentiation of cultured respiratory tract epithelial cells. In Vitro Cell Dev Biol, 1988. 24(5): p. 420-8. 213. Rothen-Rutishauser, B.M., S.G. Kiama, and P. Gehr, A three-dimensional cellular model of the human respiratory tract to study the interaction with particles. Am J Respir Cell Mol Biol, 2005. 32(4): p. 281-9. 214. Behnsen, J., et al., Environmental dimensionality controls the interaction of phagocytes with the pathogenic fungi Aspergillus fumigatus and Candida albicans. PLoS Pathog, 2007. 3(2): p. e13.    112 APPENDIX 1: LIST OF DIFFERENTIALLY EXPRESSED HUMAN GENES IDENTIFIED IN THE UNSORTED EXPERIMENT Probe ID Gene Description Fold Change P-value A_23_P30805 Homo sapiens histone 1, H4j (HIST1H4J), mRNA [NM_021968] 4.24 4.97E-04 A_24_P42308 Homo sapiens cDNA FLJ31887 fis, clone NT2RP7003050. [AK056449] 3.24 3.53E-03 A_23_P395426 Homo sapiens death associated transcription factor 1 (DATF1), transcript variant 1, mRNA [NM_022105] 2.65 7.56E-03 A_32_P113935 Homo sapiens ligand of numb-protein X 2 (LNX2), mRNA [NM_153371] 2.54 5.82E-04 A_24_P65941 Homo sapiens cDNA: FLJ20856 fis, clone ADKA01509. [AK024509] 2.39 1.97E-05 A_32_P65067  2.21 5.21E-03 A_23_P345707 Homo sapiens leucine-rich repeat kinase 1 (MGC45866), mRNA [NM_152259] 2.08 9.42E-04 A_23_P128060 Homo sapiens zinc finger protein 26 (KOX 20) (ZNF26), mRNA [NM_019591] 2.07 4.01E-02 A_24_P548881 Q7QB29 (Q7QB29) ENSANGP00000012888 (Fragment), partial (10%) [THC2281244] 2.07 4.01E-02 A_23_P87532 Homo sapiens C1q domain containing 1 (C1QDC1), transcript variant 1, mRNA [NM_001002259] 2.01 8.31E-05 A_23_P52885 Homo sapiens hypothetical protein FLJ23342 (FLJ23342), mRNA [NM_024631] 2.01 6.15E-05 A_32_P98940  1.96 4.23E-04 A_32_P160670  1.95 1.27E-03 A_32_P87631 Homo sapiens, clone IMAGE:4850148, mRNA. [BC017507] 1.94 3.50E-04 A_23_P333484 Homo sapiens histone 1, H3h (HIST1H3H), mRNA [NM_003536] 1.94 7.85E-03 A_32_P79103  1.93 4.64E-04 A_24_P781846 Homo sapiens cDNA FLJ14030 fis, clone HEMBA1004086. [AK024092] 1.92 7.79E-03 A_23_P379746 Homo sapiens hypothetical protein MGC24039, mRNA (cDNA clone IMAGE:4286826), complete cds. [BC020855] 1.91 1.46E-03 A_24_P128255  1.90 2.56E-03 A_32_P208039 Homo sapiens mRNA; cDNA DKFZp586O1318 (from clone DKFZp586O1318) [AL049390] 1.89 4.83E-04 A_23_P35316 Homo sapiens zinc finger protein SBZF3 mRNA, complete cds. [AF242519] 1.88 3.75E-03 A_32_P109296 Homo sapiens leucine-rich repeat kinase 1 (MGC45866), mRNA [NM_152259] 1.88 1.12E-03 A_23_P106412 Homo sapiens cDNA FLJ27134 fis, clone SPL08315. [AK130644] 1.88 8.81E-03 A_23_P214425 Homo sapiens cDNA: FLJ21548 fis, clone COL06252. [AK025201] 1.85 3.59E-03 A_23_P27636 Homo sapiens hypothetical protein DKFZp434I1610 (DKFZp434I1610), mRNA [NM_144566] 1.85 3.59E-04 A_32_P105940  1.85 6.57E-03 A_24_P329795 Homo sapiens chromosome 10 open reading frame 10 (C10orf10), mRNA [NM_007021] 1.84 2.16E-03 A_23_P54447 Homo sapiens chromosome 15 open reading frame 5 (C15orf5), mRNA [NM_030944] 1.83 9.47E-03   113 Probe ID Gene Description Fold Change P-value A_23_P101476 Homo sapiens zinc finger protein 442 (ZNF442), mRNA [NM_030824] 1.82 1.65E-02 A_23_P27638 Homo sapiens hypothetical protein DKFZp434I1610 (DKFZp434I1610), mRNA [NM_144566] 1.82 9.78E-04 A_32_P105110 Homo sapiens cDNA FLJ32634 fis, clone SYNOV2000177. [AK057196] 1.82 1.05E-03 A_32_P184039  1.82 3.64E-02 A_23_P67278 Homo sapiens zinc finger protein 443 (ZNF443), mRNA [NM_005815] 1.82 4.26E-03 A_23_P39050 Homo sapiens ZFP-36 for a zinc finger protein, mRNA (cDNA clone IMAGE:4992175), partial cds. [BC063560] 1.80 1.79E-02 A_32_P139123  1.80 1.37E-02 A_23_P78628 Homo sapiens mitogen-activated protein kinase kinase 7 (MAP2K7), mRNA [NM_145185] 1.79 2.99E-03 A_23_P104318 Homo sapiens DNA-damage-inducible transcript 4 (DDIT4), mRNA [NM_019058] 1.79 2.28E-03 A_23_P93258 Homo sapiens histone 1, H3b (HIST1H3B), mRNA [NM_003537] 1.78 5.10E-03 A_23_P116602 Homo sapiens mRNA for KIAA1372 protein, partial cds. [AB037793] 1.78 2.27E-03 A_24_P173234 Homo sapiens zinc finger protein 613 (ZNF613), mRNA [NM_024840] 1.78 1.55E-03 A_24_P717586  1.77 2.14E-03 A_32_P41924 Homo sapiens full length insert cDNA clone YW18A11. [AF086011] 1.77 1.71E-02 A_23_P85703 Homo sapiens SRY (sex determining region Y)-box 13 (SOX13), mRNA [NM_005686] 1.77 5.57E-04 A_23_P156198 Homo sapiens PHD finger protein 15 (PHF15), mRNA [NM_015288] 1.76 2.71E-02 A_23_P134946 Homo sapiens leucine rich repeat containing 14 (LRRC14), mRNA [NM_014665] 1.75 8.00E-04 A_23_P219045 Homo sapiens histone 1, H3d (HIST1H3D), mRNA [NM_003530] 1.75 9.39E-03 A_23_P35597 Homo sapiens chromosome 10 open reading frame 10 (C10orf10), mRNA [NM_007021] 1.75 2.49E-02 A_24_P105761 Homo sapiens jumonji domain containing 1A (JMJD1A), mRNA [NM_018433] 1.75 9.79E-04 A_24_P937546 Homo sapiens mRNA; cDNA DKFZp434I2129 (from clone DKFZp434I2129). [AL832450] 1.75 3.06E-02 A_23_P395075 Homo sapiens jumonji domain containing 1A (JMJD1A), mRNA [NM_018433] 1.74 2.10E-03 A_24_P592421 Homo sapiens mRNA; cDNA DKFZp586A0423 (from clone DKFZp586A0423) [AL050185] 1.74 7.23E-03 A_32_P62371  1.74 8.26E-03 A_23_P7301 Homo sapiens Wolf-Hirschhorn syndrome candidate 1 (WHSC1), transcript variant 7, mRNA [NM_133334] 1.74 1.38E-03 A_23_P27649 Homo sapiens zinc finger protein 433 (ZNF433), mRNA [NM_152602] 1.73 5.20E-03 A_23_P308150 Homo sapiens hypothetical protein FLJ39827 (FLJ39827), mRNA [NM_152424] 1.73 1.23E-02 A_23_P75921 Homo sapiens TNF receptor-associated factor 6 (TRAF6), transcript variant 1, mRNA [NM_145803] 1.73 9.36E-03 A_23_P356139 Homo sapiens chromosome 10 open reading frame 6 (C10orf6), mRNA [NM_018121] 1.73 2.78E-03 A_32_P19917 N52413 yv50d11.s1 Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone IMAGE:246165 3', mRNA sequence [N52413] 1.72 4.87E-03 A_23_P206741  1.72 5.77E-03 A_23_P55880 Homo sapiens mRNA; cDNA DKFZp761F06121 (from clone DKFZp761F06121). [AL834146] 1.72 9.43E-04   114 Probe ID Gene Description Fold Change P-value A_24_P281243 Homo sapiens hypothetical protein LOC389072, mRNA (cDNA clone IMAGE:4295234), partial cds. [BC020812] 1.72 3.46E-02 A_23_P135730 Homo sapiens zinc finger protein 627 (ZNF627), mRNA [NM_145295] 1.71 7.53E-04 A_24_P491923  1.71 5.93E-03 A_23_P131935 Homo sapiens chromosome 20 open reading frame 42 (C20orf42), mRNA [NM_017671] 1.70 3.84E-03 A_24_P414446 Homo sapiens hypothetical protein BC007706 (LOC90268), mRNA [NM_138348] 1.70 3.18E-03 A_24_P917015 Homo sapiens G protein interaction factor 1-like mRNA sequence. [AF288405] 1.70 1.02E-02 A_23_P115861 Homo sapiens zinc finger protein 485 (ZNF485), mRNA [NM_145312] 1.70 3.01E-03 A_24_P48057 Homo sapiens iroquois homeobox protein 5 (IRX5), mRNA [NM_005853] 1.70 5.03E-03 A_23_P309996 Homo sapiens BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 2, mRNA [NM_138622] 1.69 5.51E-03 A_23_P65797 Homo sapiens BTB/POZ KELCH domain protein (ENC2), mRNA [NM_022480] 1.69 4.07E-02 A_24_P167614 Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (DDX26), mRNA [NM_012141] 1.69 3.28E-02 A_23_P130965 Homo sapiens arrestin domain containing 2 (ARRDC2), transcript variant 1, mRNA [NM_015683] 1.69 3.56E-03 A_23_P65618 Homo sapiens transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) (TGM1), mRNA [NM_000359] 1.69 1.98E-03 A_23_P80062 Homo sapiens TAF4 RNA polymerase II, TATA box binding protein (TBP)- associated factor, 135kDa (TAF4), mRNA [NM_003185] 1.68 2.26E-04 A_24_P22976 Homo sapiens arrestin domain containing 2 (ARRDC2), transcript variant 1, mRNA [NM_015683] 1.68 7.88E-03 A_24_P235783 Homo sapiens splicing factor 1 (SF1), transcript variant 4, mRNA [NM_201997] 1.68 6.02E-03 A_32_P145385 Homo sapiens cDNA FLJ10256 fis, clone HEMBB1000870. [AK001118] 1.67 6.66E-03 A_23_P108437 Homo sapiens cDNA: FLJ21197 fis, clone COL00201. [AK024850] 1.67 6.58E-04 A_23_P44505 Homo sapiens Kruppel-like factor 11 (KLF11), mRNA [NM_003597] 1.67 1.40E-03 A_32_P229818 Homo sapiens cDNA FLJ11982 fis, clone HEMBB1001335. [AK022044] 1.67 6.16E-03 A_32_P51119 Homo sapiens storkhead box 1 (STOX1), mRNA [NM_152709] 1.66 5.95E-03 A_24_P56281 Homo sapiens C1q domain containing 1 (C1QDC1), transcript variant 1, mRNA [NM_001002259] 1.66 3.76E-03 A_24_P931636 Homo sapiens transforming growth factor beta regulator 1, mRNA (cDNA clone IMAGE:5212572), complete cds. [BC032312] 1.66 3.81E-03 A_32_P55987  1.66 1.82E-02 A_23_P2032  1.65 2.43E-03 A_24_P934435 Homo sapiens full length insert cDNA clone YZ60H05. [AF086077] 1.65 8.14E-03 A_23_P146325 Homo sapiens HSPC054 mRNA, complete cds. [AF161539] 1.65 2.12E-03 A_24_P226278 Homo sapiens PHD finger protein 15 (PHF15), mRNA [NM_015288] 1.64 4.52E-02 A_24_P165816 Homo sapiens cDNA FLJ13583 fis, clone PLACE1009050. [AK023645] 1.64 1.03E-02 A_23_P161686 Homo sapiens Rho GTPase-activating protein (RICS), mRNA [NM_014715] 1.64 5.13E-04 A_24_P491087 Homo sapiens cDNA FLJ34861 fis, clone NT2NE2012847. [AK092180] 1.64 4.05E-02 A_24_P178065 Homo sapiens pleckstrin homology-like domain, family B, member 2, mRNA (cDNA clone IMAGE:5169755), complete cds. [BC038806] 1.63 3.20E-02   115 Probe ID Gene Description Fold Change P-value A_23_P216476 Homo sapiens zinc finger and BTB domain containing 5 (ZBTB5), mRNA [NM_014872] 1.63 3.98E-03 A_23_P128375 Homo sapiens hypothetical protein FLJ14721 (FLJ14721), mRNA [NM_032829] 1.63 3.87E-02 A_24_P268893 Homo sapiens THAP domain containing 6 (THAP6), mRNA [NM_144721] 1.63 3.79E-03 A_24_P344537 Homo sapiens zinc finger protein 625 (ZNF625), mRNA [NM_145233] 1.63 1.10E-03 A_23_P155939 Homo sapiens zinc finger protein 595 (ZNF595), mRNA [NM_182524] 1.62 3.96E-03 A_24_P198820  1.62 8.08E-03 A_32_P35294  1.62 4.00E-03 A_23_P322 Homo sapiens ephrin-A4 (EFNA4), transcript variant 1, mRNA [NM_005227] 1.62 3.65E-03 A_23_P405707 Homo sapiens BCL6 co-repressor (BCOR), transcript variant 2, mRNA [NM_020926] 1.62 2.53E-05 A_24_P934679  1.62 4.79E-03 A_23_P402287 Homo sapiens ligand of numb-protein X 2 (LNX2), mRNA [NM_153371] 1.61 2.38E-02 A_24_P923251 Homo sapiens transglutaminase 2 (C polypeptide, protein-glutamine- gamma-glutamyltransferase) (TGM2), transcript variant 2, mRNA [NM_198951] 1.61 8.62E-03 A_23_P385246 Homo sapiens potassium channel tetramerisation domain containing 6 (KCTD6), mRNA [NM_153331] 1.61 6.16E-03 A_24_P177585 Homo sapiens hypothetical protein FLJ40869 (FLJ40869), mRNA [NM_182625] 1.61 2.72E-03 A_24_P98613 Homo sapiens tetraspanin 14 (TSPAN14), mRNA [NM_030927] 1.61 1.16E-02 A_23_P39263 Homo sapiens hypothetical protein LOC126295 (LOC126295), mRNA [NM_173480] 1.61 3.17E-02 A_23_P205265 Homo sapiens eukaryotic translation initiation factor 5 (EIF5), transcript variant 1, mRNA [NM_001969] 1.60 8.41E-03 A_24_P274615 Homo sapiens arrestin domain containing 3 (ARRDC3), mRNA [NM_020801] 1.60 3.41E-03 A_32_P78783 Homo sapiens hypothetical protein FLJ31875 (FLJ31875), mRNA [NM_182531] 1.60 2.33E-03 A_23_P18384 Homo sapiens armadillo repeat containing 8 (ARMC8), mRNA [NM_213654] 1.60 2.63E-02 A_23_P405942 Homo sapiens La ribonucleoprotein domain family, member 5 (LARP5), mRNA [NM_015155] 1.60 1.05E-02 A_23_P410717 Homo sapiens chromosome 1 open reading frame 51 (C1orf51), mRNA [NM_144697] 1.60 1.72E-03 A_24_P414719 Homo sapiens cDNA FLJ11236 fis, clone PLACE1008524. [AK002098] 1.60 8.62E-03 A_23_P120170 Homo sapiens tigger transposable element derived 1 (TIGD1), mRNA [NM_145702] 1.59 2.83E-03 A_23_P83134 Homo sapiens growth arrest-specific 1 (GAS1), mRNA [NM_002048] 1.59 7.38E-03 A_24_P654792  1.59 1.94E-03 A_32_P24651 Homo sapiens cDNA FLJ38388 fis, clone FEBRA2004485. [AK095707] 1.59 1.08E-03 A_24_P419276 Homo sapiens zinc finger protein 248 (ZNF248), mRNA [NM_021045] 1.59 2.37E-02 A_32_P193378 Homo sapiens cDNA FLJ30808 fis, clone FEBRA2001383. [AK055370] 1.59 2.13E-03 A_23_P258037 Homo sapiens jumonji domain containing 1A (JMJD1A), mRNA [NM_018433] 1.59 4.61E-03 A_23_P311640 Homo sapiens HIV-1 Rev binding protein-like (HRBL), mRNA [NM_006076] 1.59 5.00E-03   116 Probe ID Gene Description Fold Change P-value A_32_P219942 Q9BHC7 (Q9BHC7) Probable transporter (Fragment), partial (8%) [THC2374204] 1.59 2.87E-05 A_23_P92184 Homo sapiens WD repeat domain 5B (WDR5B), mRNA [NM_019069] 1.58 5.79E-03 A_24_P51118 Homo sapiens methylthioadenosine phosphorylase (MTAP), mRNA [NM_002451] 1.58 9.26E-03 A_24_P917026 Homo sapiens clone 24723 mRNA sequence. [AF055023] 1.58 7.59E-04 A_23_P20683 Homo sapiens KIAA0020 (KIAA0020), mRNA [NM_014878] 1.58 2.41E-03 A_24_P532212 Homo sapiens cDNA: FLJ23243 fis, clone COL01757. [AK026896] 1.58 1.02E-02 A_23_P70794 Homo sapiens RAB23, member RAS oncogene family (RAB23), transcript variant 1, mRNA [NM_016277] 1.58 1.62E-03 A_23_P80940 Homo sapiens phosphoribosyl pyrophosphate amidotransferase (PPAT), mRNA [NM_002703] 1.58 3.43E-04 A_23_P32249 Homo sapiens cDNA FLJ10754 fis, clone NT2RP3004544, highly similar to Homo sapiens mRNA for KIAA0554 protein. [AK001616] 1.57 1.20E-02 A_23_P353106 Homo sapiens hypothetical protein BC007706 (LOC90268), mRNA [NM_138348] 1.57 9.48E-03 A_23_P84836 Homo sapiens aminopeptidase puromycin sensitive (NPEPPS), mRNA [NM_006310] 1.57 1.16E-02 A_24_P198629 Homo sapiens lines homolog 1 (Drosophila) (LINS1), transcript variant 3, mRNA [NM_181740] 1.57 1.94E-02 A_23_P91350 Homo sapiens mRNA for KIAA1434 protein, partial cds. [AB037855] 1.57 3.48E-02 A_24_P169544 Homo sapiens zinc finger protein 17 (HPF3, KOX 10) (ZNF17), mRNA [NM_006959] 1.57 3.43E-02 A_24_P376129 Homo sapiens cDNA FLJ31628 fis, clone NT2RI2003344, weakly similar to PRESYNAPTIC PROTEIN SAP97. [AK056190] 1.57 1.87E-02 A_32_P23010 full-length cDNA clone CS0DN002YE07 of Adult brain of Homo sapiens (human). [CR600403] 1.57 6.23E-03 A_23_P55911 Homo sapiens zinc finger protein 440 (ZNF440), mRNA [NM_152357] 1.56 2.36E-02 A_23_P61268 Homo sapiens brain protein 16 (LOC51236), mRNA [NM_016458] 1.56 1.28E-03 A_23_P76901 Homo sapiens pleckstrin homology domain containing, family G (with RhoGef domain) member 3 (PLEKHG3), mRNA [NM_015549] 1.56 4.02E-02 A_24_P917044 Homo sapiens capacitative calcium channel protein Trp1 mRNA, partial cds; alternatively spliced. [AF483645] 1.56 5.98E-03 A_23_P101351 Homo sapiens zinc finger protein 426 (ZNF426), mRNA [NM_024106] 1.56 1.37E-04 A_23_P208325 Homo sapiens zinc finger protein 235 (ZNF235), mRNA [NM_004234] 1.56 4.78E-03 A_23_P80839 Homo sapiens hypothetical protein FLJ12748 (FLJ12748), mRNA [NM_024871] 1.56 1.20E-03 A_23_P87973 Homo sapiens ret finger protein 2 (RFP2), transcript variant 3, mRNA [NM_213590] 1.56 2.34E-02 A_23_P163047 Homo sapiens chromosome 14 open reading frame 150 (C14orf150), transcript variant 1, mRNA [NM_001008726] 1.56 2.75E-04 A_24_P61520 Homo sapiens mutL homolog 3 (E. coli) (MLH3), mRNA [NM_014381] 1.56 8.38E-04 A_23_P155027 Homo sapiens zinc finger, CW type with coiled-coil domain 1 (ZCWCC1), mRNA [NM_014941] 1.56 4.43E-02 A_24_P238578 Homo sapiens KIAA1729 protein (KIAA1729), mRNA [NM_053042] 1.56 3.76E-02 A_24_P662177 O57150 (O57150) H88, partial (32%) [THC2448843] 1.56 3.61E-02 A_24_P466102 GB|AL390143.1|AL390143.1 Homo sapiens mRNA; cDNA DKFZp547N074 (from clone DKFZp547N074) [NP1167346] 1.55 2.20E-03   117 Probe ID Gene Description Fold Change P-value A_24_P91405 Homo sapiens hypothetical protein FLJ38281 (FLJ38281), mRNA [NM_152601] 1.55 3.44E-03 A_32_P174398 Homo sapiens ELISC-1 mRNA, partial cds. [AF085351] 1.55 1.52E-03 A_23_P104138 Homo sapiens hypothetical protein MGC15634, mRNA (cDNA clone MGC:15634 IMAGE:3344302), complete cds. [BC007286] 1.55 7.00E-03 A_23_P23102 Homo sapiens zinc finger protein 31 (KOX 29) (ZNF31), mRNA [NM_145238] 1.55 1.15E-02 A_23_P408768 Homo sapiens DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L), mRNA [NM_032482] 1.55 2.73E-02 A_23_P127522 Homo sapiens hydrolethalus syndrome 1 (HYLS1), mRNA [NM_145014] 1.55 1.49E-02 A_23_P59855 Homo sapiens zinc finger protein 138 (ZNF138), mRNA [NM_006524] 1.55 4.95E-04 A_24_P292831 Homo sapiens lin-10 protein homolog (Lin10), mRNA [NM_025187] 1.55 1.41E-02 A_24_P29401 Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha) (PIK3R1), transcript variant 1, mRNA [NM_181523] 1.55 1.95E-02 A_24_P396105 Homo sapiens inositol hexaphosphate kinase 1 (IHPK1), transcript variant 1, mRNA [NM_153273] 1.55 2.29E-03 A_32_P18073 Q8TC96 (Q8TC96) AE2 protein, partial (10%) [THC2369777] 1.55 1.32E-03 A_23_P74115 Homo sapiens RAD54-like (S. cerevisiae) (RAD54L), mRNA [NM_003579] 1.55 2.08E-04 A_23_P107744 Homo sapiens endothelial differentiation, sphingolipid G-protein- coupled receptor, 8 (EDG8), mRNA [NM_030760] 1.54 1.30E-03 A_23_P108342 Homo sapiens zinc finger protein 571 (ZNF571), mRNA [NM_016536] 1.54 3.63E-03 A_23_P218282 Homo sapiens zinc finger protein 434 (ZNF434), mRNA [NM_017810] 1.54 3.26E-04 A_24_P652700 Homo sapiens mRNA; cDNA DKFZp686C15165 (from clone DKFZp686C15165). [BX648822] 1.54 1.70E-03 A_32_P24709 Homo sapiens zinc finger protein 642 (ZNF642), mRNA [NM_198494] 1.54 1.23E-02 A_23_P122007 Homo sapiens hypothetical gene supported by AF038182; BC009203 (LOC90355), mRNA [NM_033211] 1.54 3.32E-03 A_23_P132738 Homo sapiens crystallin, gamma S (CRYGS), mRNA [NM_017541] 1.54 5.82E-03 A_23_P350689 Homo sapiens zinc finger, DHHC-type containing 23 (ZDHHC23), mRNA [NM_173570] 1.54 1.10E-02 A_23_P41512 Homo sapiens chromosome 4 open reading frame 15 (C4orf15), mRNA [NM_024511] 1.54 4.25E-03 A_23_P8004 Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:4577 IMAGE:3030790), complete cds. [BC007518] 1.54 3.74E-02 A_24_P118011 PREDICTED: Homo sapiens similar to RIKEN cDNA 2010316F05 (LOC344405), mRNA [XM_293034] 1.54 4.97E-02 A_24_P205008 Homo sapiens cDNA FLJ37147 fis, clone BRACE2025316, weakly similar to tRNA-splicing endonuclease subunit. [AK094466] 1.54 1.12E-02 A_23_P140668 Homo sapiens isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), nuclear gene encoding mitochondrial protein, mRNA [NM_005530] 1.54 8.28E-03 A_32_P196287 MUSHOX222 homeobox mh22b-related protein [Mus musculus;], partial (14%) [THC2316688] 1.54 3.83E-02 A_23_P158470 Homo sapiens similar to RIKEN cDNA 6530418L21 (LOC389119), mRNA [NM_203370] 1.54 7.99E-04 A_23_P69738 Homo sapiens RAS-like, family 11, member B (RASL11B), mRNA [NM_023940] 1.54 4.37E-02 A_23_P395555 Homo sapiens zinc finger protein 226 (ZNF226), mRNA [NM_016444] 1.53 8.08E-03 A_23_P8664 Homo sapiens cyclin D binding myb-like transcription factor 1 (DMTF1), mRNA [NM_021145] 1.53 1.86E-03   118 Probe ID Gene Description Fold Change P-value A_23_P16652 Homo sapiens zinc finger protein 555 (ZNF555), mRNA [NM_152791] 1.53 2.61E-02 A_23_P320407 Homo sapiens pp10394 mRNA, complete cds. [AF318318] 1.53 7.96E-03 A_23_P413634 Homo sapiens zinc finger protein 329 (ZNF329), mRNA [NM_024620] 1.53 2.47E-03 A_23_P126197 Homo sapiens splicing factor, arginine/serine-rich 4 (SFRS4), mRNA [NM_005626] 1.53 2.97E-03 A_23_P150841 Homo sapiens zinc finger protein 140 (clone pHZ-39) (ZNF140), mRNA [NM_003440] 1.53 2.28E-02 A_23_P25653 Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (DDX26), mRNA [NM_012141] 1.53 4.28E-02 A_23_P370162 Homo sapiens mRNA; cDNA DKFZp686K09128 (from clone DKFZp686K09128). [CR749605] 1.53 6.04E-04 A_23_P344481 Homo sapiens storkhead box 1 (STOX1), mRNA [NM_152709] 1.53 2.36E-03 A_23_P38677 Homo sapiens chromosome 18 open reading frame 43 (C18orf43), mRNA [NM_006553] 1.53 1.23E-02 A_23_P67312 Homo sapiens zinc finger protein 136 (clone pHZ-20) (ZNF136), mRNA [NM_003437] 1.53 4.87E-03 A_24_P234196 Homo sapiens ribonucleotide reductase M2 polypeptide (RRM2), mRNA [NM_001034] 1.53 2.46E-04 A_23_P115331 Homo sapiens AT hook, DNA binding motif, containing 1 (AHDC1), mRNA [NM_001029882] 1.52 6.87E-04 A_24_P303815 Homo sapiens ubiquitin-like, containing PHD and RING finger domains, 2 (UHRF2), transcript variant 1, mRNA [NM_152306] 1.52 3.61E-03 A_24_P414205 Homo sapiens crystallin, gamma S (CRYGS), mRNA [NM_017541] 1.52 1.45E-02 A_32_P41065 Homo sapiens transmembrane and coiled-coil domain family 1 (TMCC1), transcript variant 1, mRNA [NM_001017395] 1.52 7.26E-03 A_23_P215132 Homo sapiens HSPC049 protein (HSPC049), mRNA [NM_014149] 1.52 3.63E-02 A_24_P222835 Homo sapiens S100P binding protein Riken (S100PBPR), transcript variant 2, mRNA [NM_001017406] 1.52 1.47E-02 A_32_P148047  1.52 4.88E-03 A_32_P171386  1.52 3.64E-03 A_23_P132175 Homo sapiens reticulon 4 receptor (RTN4R), mRNA [NM_023004] 1.52 2.83E-03 A_32_P150950 W86899 zh60b12.s1 Soares_fetal_liver_spleen_1NFLS_S1 Homo sapiens cDNA clone IMAGE:416447 3' similar to gb:L05091 40S RIBOSOMAL PROTEIN S28 (HUMAN);, mRNA sequence [W86899] 1.52 1.26E-03 A_23_P110957 Homo sapiens forkhead box F2 (FOXF2), mRNA [NM_001452] 1.52 2.13E-03 A_23_P165984 Homo sapiens zinc finger, SWIM-type containing 3 (ZSWIM3), mRNA [NM_080752] 1.52 3.54E-03 A_24_P82200 Homo sapiens Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse) (MEIS2), transcript variant d, mRNA [NM_170676] 1.52 1.96E-03 A_23_P132948 Homo sapiens E74-like factor 2 (ets domain transcription factor) (ELF2), transcript variant 1, mRNA [NM_201999] 1.51 2.73E-03 A_23_P162165 Homo sapiens potassium channel tetramerisation domain containing 14 (KCTD14), mRNA [NM_023930] 1.51 2.74E-05 A_23_P314250 Homo sapiens family with sequence similarity 78, member A (FAM78A), mRNA [NM_033387] 1.51 1.03E-02 A_23_P80902 Homo sapiens kinesin family member 15 (KIF15), mRNA [NM_020242] 1.51 1.51E-02 A_23_P97700 Homo sapiens thioredoxin interacting protein (TXNIP), mRNA [NM_006472] 1.51 1.92E-02 A_24_P85300 Homo sapiens mRNA for KIAA1237 protein, partial cds. [AB033063] 1.51 1.41E-03   119 Probe ID Gene Description Fold Change P-value A_32_P203592 Homo sapiens PI-3-kinase-related kinase SMG-1 (SMG1), mRNA [NM_015092] 1.51 3.77E-02 A_23_P51117 Homo sapiens ETAA16 protein (ETAA16), mRNA [NM_019002] 1.51 3.48E-03 A_23_P98884 Homo sapiens ring finger protein 41 (RNF41), transcript variant 2, mRNA [NM_194358] 1.51 5.45E-05 A_24_P100551 Homo sapiens SH3 multiple domains 2 (SH3MD2), mRNA [NM_020870] 1.51 3.64E-03 A_24_P392475 Homo sapiens cDNA: FLJ23531 fis, clone LNG06065. [AK027184] 1.51 2.59E-03 A_24_P58549 Homo sapiens zinc finger protein 273 (ZNF273), mRNA [NM_021148] 1.51 1.93E-03 A_32_P182388 Homo sapiens zinc finger protein 77 (pT1) (ZNF77), mRNA [NM_021217] 1.51 5.75E-03 A_23_P218706 Homo sapiens zinc finger protein 343 (ZNF343), mRNA [NM_024325] 1.51 1.86E-03 A_23_P218751 Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 1-like (GNB1L), mRNA [NM_053004] 1.51 3.89E-02 A_23_P320190 Homo sapiens hypothetical protein FLJ39660 (FLJ39660), mRNA [NM_173646] 1.51 8.20E-04 A_23_P363647 Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B (DDX26B), mRNA [NM_182540] 1.51 2.78E-03 A_24_P24263 Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 4, mRNA [NM_001011515] 1.51 7.32E-03 A_32_P72351 Homo sapiens cDNA: FLJ22487 fis, clone HRC10931. [AK026140] 1.51 6.27E-03 A_23_P35343 Homo sapiens zinc finger protein 248 (ZNF248), mRNA [NM_021045] 1.51 2.19E-02 A_32_P179807  1.51 1.01E-02 A_23_P154962 Homo sapiens KIAA1666 protein, mRNA (cDNA clone MGC:42740 IMAGE:4827837), complete cds. [BC035246] 1.50 2.73E-02 A_24_P304449 Homo sapiens KIAA0152 (KIAA0152), mRNA [NM_014730] 1.50 2.18E-04 A_32_P198295  1.50 3.81E-04 A_24_P246636  -1.50 1.29E-02 A_24_P280497 Homo sapiens XTP9 (XTP9) mRNA, complete cds. [AF490258] -1.50 3.05E-02 A_24_P102456 Homo sapiens, clone IMAGE:5221276, mRNA, partial cds. [BC028232] -1.50 1.55E-02 A_24_P848662 full-length cDNA clone CS0DM002YC17 of Fetal liver of Homo sapiens (human). [CR594528] -1.50 2.30E-02 A_24_P90923 Homo sapiens hypothetical protein FLJ36701 (FLJ36701), mRNA [NM_173617] -1.50 1.49E-02 A_24_P342178 Homo sapiens signal transducer and activator of transcription 5B, mRNA (cDNA clone IMAGE:4605440), complete cds. [BC020868] -1.50 1.48E-02 A_23_P26468 Homo sapiens rhomboid, veinlet-like 1 (Drosophila) (RHBDL1), mRNA [NM_003961] -1.50 3.79E-02 A_24_P169213 PREDICTED: Homo sapiens similar to comment for location 3447-3655: BLASTX gi [XM_375603] -1.50 1.70E-02 A_24_P255609 Homo sapiens mRNA for FLJ00388 protein. [AK090467] -1.50 1.56E-02 A_24_P368943 Homo sapiens eve, even-skipped homeo box homolog 1 (Drosophila) (EVX1), mRNA [NM_001989] -1.51 1.10E-02 A_32_P6769 Homo sapiens hypothetical protein MGC25181, mRNA (cDNA clone MGC:87530 IMAGE:30334929), complete cds. [BC071598] -1.51 4.69E-02 A_24_P329353 Homo sapiens chromosome 7 open reading frame 19 (C7orf19), mRNA [NM_032831] -1.51 6.05E-03 A_32_P77977  -1.51 9.26E-04 A_32_P158253  -1.51 3.51E-02 A_32_P8724  -1.52 1.53E-02   120 Probe ID Gene Description Fold Change P-value A_23_P4400 Homo sapiens keratin associated protein 4-14 (KRTAP4-14), mRNA [NM_033059] -1.52 3.24E-02 A_32_P218228 Homo sapiens LOC150368 protein (LOC150368), mRNA [NM_001002034] -1.52 4.48E-02 A_23_P201156 Homo sapiens immunoglobulin superfamily, member 4B (IGSF4B), mRNA [NM_021189] -1.52 6.44E-03 A_24_P150803 Homo sapiens protease, serine, 8 (prostasin) (PRSS8), mRNA [NM_002773] -1.52 9.05E-03 A_24_P322771 Homo sapiens trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) (TFF1), mRNA [NM_003225] -1.52 4.06E-02 A_32_P96419  -1.52 3.50E-02 A_24_P127425  -1.52 1.88E-02 A_24_P8130 Homo sapiens cDNA FLJ35102 fis, clone PLACE6006474, weakly similar to ADHESIVE PLAQUE MATRIX PROTEIN PRECURSOR. [AK092421] -1.53 1.61E-02 A_32_P194115 Homo sapiens unc-84 homolog B (C. elegans) (UNC84B), mRNA [NM_015374] -1.53 3.93E-03 A_24_P778928 WASL_BOVIN (Q95107) Neural Wiskott-Aldrich syndrome protein (N- WASP), partial (7%) [THC2410279] -1.53 4.46E-02 A_32_P122907  -1.53 3.13E-02 A_24_P22562 Homo sapiens apoptosis related protein, mRNA (cDNA clone MGC:95372 IMAGE:7216911), complete cds. [BC069097] -1.53 2.19E-02 A_32_P39866 Homo sapiens, clone IMAGE:5184855, mRNA. [BC040412] -1.53 3.21E-02 A_24_P127543  -1.54 4.66E-02 A_24_P934355 Homo sapiens nitric oxide synthase 1 (neuronal) (NOS1), mRNA [NM_000620] -1.54 4.10E-02 A_23_P90339 Homo sapiens splicing factor 3a, subunit 2, 66kDa (SF3A2), mRNA [NM_007165] -1.54 9.21E-03 A_23_P140527 Homo sapiens forkhead box B1 (FOXB1), mRNA [NM_012182] -1.55 1.27E-02 A_23_P329212 Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), mRNA [NM_005238] -1.55 2.47E-05 A_32_P199506  -1.55 1.54E-02 A_24_P689119  -1.55 1.64E-02 A_24_P275428 Homo sapiens Fas apoptotic inhibitory molecule 2 (FAIM2), mRNA [NM_012306] -1.55 2.05E-02 A_24_P315581  -1.56 3.03E-02 A_23_P372962 Homo sapiens C3 and PZP-like, alpha-2-macroglobulin domain containing 9 (CPAMD9), mRNA [NM_144670] -1.56 1.38E-02 A_32_P160254  -1.56 1.45E-02 A_23_P114299 Homo sapiens chemokine (C-X-C motif) receptor 3 (CXCR3), mRNA [NM_001504] -1.56 2.64E-03 A_24_P281025  -1.57 1.21E-02 A_24_P180830 Homo sapiens caspase recruitment domain family, member 9, mRNA (cDNA clone MGC:87491 IMAGE:30343821), complete cds. [BC070091] -1.58 2.68E-02 A_24_P247920 Homo sapiens mRNA for KIAA1652 protein, partial cds. [AB051439] -1.58 1.90E-02 A_24_P264383 S52418 GTP-binding regulatory protein Gs alpha-XL chain - rat [Rattus norvegicus;], partial (3%) [THC2251316] -1.58 2.88E-02 A_32_P116219  -1.60 3.24E-02 A_24_P20795 Homo sapiens iroquois homeobox protein 4 (IRX4), mRNA [NM_016358] -1.60 1.88E-02 A_24_P937095 Human hbc647 mRNA sequence. [U68494] -1.60 4.34E-04   121 Probe ID Gene Description Fold Change P-value A_23_P258381 Homo sapiens SPRY domain-containing SOCS box protein SSB-4 (SSB4), mRNA [NM_080862] -1.60 2.69E-02 A_24_P828125  -1.60 2.06E-02 A_32_P145764 Homo sapiens, clone IMAGE:5171873, mRNA. [BC043547] -1.60 2.32E-03 A_24_P278375 W60905 zd27a02.r1 Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:341834 5' similar to gb:X52851_rna1 PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (HUMAN);, mRNA sequence [W60905] -1.61 4.04E-03 A_24_P310009 Homo sapiens cDNA FLJ33502 fis, clone BRAMY2004492, weakly similar to UBIQUITIN CARBOXYL-TERMINAL HYDROLASE 4 (EC 3.1.2.15). [AK090821] -1.62 1.36E-02 A_24_P935819 Homo sapiens superoxide dismutase 2, mitochondrial, mRNA (cDNA clone MGC:21350 IMAGE:4184203), complete cds. [BC016934] -1.62 3.32E-02 A_23_P53838 Homo sapiens insulin receptor substrate 2 (IRS2), mRNA [NM_003749] -1.62 1.67E-02 A_24_P478362  -1.62 4.19E-02 A_24_P770494  -1.63 1.51E-02 A_23_P23815 Homo sapiens solute carrier family 30 (zinc transporter), member 1 (SLC30A1), mRNA [NM_021194] -1.63 2.95E-03 A_24_P316454 Homo sapiens cDNA clone IMAGE:5441030, partial cds. [BC022826] -1.63 2.66E-02 A_24_P65292 Homo sapiens SRY (sex determining region Y)-box 8 (SOX8), mRNA [NM_014587] -1.64 2.91E-02 A_24_P631848 Homo sapiens, clone IMAGE:4816083, mRNA. [BC036435] -1.64 1.85E-02 A_24_P24244 Homo sapiens atrophin 1 (ATN1), transcript variant 1, mRNA [NM_001007026] -1.64 1.30E-02 A_32_P74409 Homo sapiens hypothetical LOC387763, mRNA (cDNA clone IMAGE:6272440), partial cds. [BC052560] -1.64 5.82E-03 A_23_P17030 Homo sapiens arginyl aminopeptidase (aminopeptidase B)-like 1 (RNPEPL1), mRNA [NM_018226] -1.64 3.91E-03 A_24_P269101 Homo sapiens neurogenin 1 (NEUROG1), mRNA [NM_006161] -1.65 2.36E-02 A_24_P322088 full-length cDNA clone CS0DI022YH23 of Placenta Cot 25-normalized of Homo sapiens (human). [CR619805] -1.65 2.42E-02 A_24_P922101 Q6QI74 (Q6QI74) LRRG00134, partial (10%) [THC2269657] -1.66 7.97E-03 A_24_P401294 Homo sapiens FLJ35934 protein (FLJ35934), mRNA [NM_207453] -1.66 1.63E-02 A_23_P122924 Homo sapiens inhibin, beta A (activin A, activin AB alpha polypeptide) (INHBA), mRNA [NM_002192] -1.66 1.55E-03 A_24_P256155  -1.66 2.14E-02 A_23_P136413 Homo sapiens matrix metalloproteinase 17 (membrane-inserted) (MMP17), mRNA [NM_016155] -1.67 1.58E-02 A_24_P331711 Homo sapiens hypothetical protein FLJ37964 (FLJ37964), mRNA [NM_182578] -1.68 1.23E-02 A_24_P166434 Homo sapiens psoriasis susceptibility 1 candidate 2 (PSORS1C2), mRNA [NM_014069] -1.68 9.06E-03 A_23_P136753 AF343666 translocation associated fusion protein IRTA1/IGA1 [Homo sapiens;], partial (81%) [THC2275252] -1.70 3.03E-02 A_23_P78952 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type I, gamma (PIP5K1C), mRNA [NM_012398] -1.70 1.04E-02 A_23_P118370 Homo sapiens cDNA FLJ12190 fis, clone MAMMA1000842. [AK022252] -1.70 1.84E-03 A_32_P126362  -1.71 4.51E-02 A_23_P214565 Homo sapiens MAS1 oncogene-like (MAS1L), mRNA [NM_052967] -1.71 3.27E-02 A_24_P375586  -1.71 3.80E-02   122 Probe ID Gene Description Fold Change P-value A_23_P208482 Homo sapiens C-type lectin domain family 4, member M (CLEC4M), transcript variant 4, mRNA [NM_214677] -1.71 2.28E-02 A_24_P230195  -1.72 1.45E-02 A_23_P54692 Homo sapiens cDNA FLJ12547 fis, clone NT2RM4000634. [AK022609] -1.72 7.51E-03 A_24_P161144 Homo sapiens hypothetical protein MGC46336, mRNA (cDNA clone MGC:46336 IMAGE:5588928), complete cds. [BC036762] -1.72 2.11E-02 A_24_P76288  -1.73 2.53E-02 A_24_P930551 P90534 (P90534) Rsc12 (Fragment), partial (3%) [THC2270208] -1.74 5.49E-03 A_23_P103104 Homo sapiens manic fringe homolog (Drosophila) (MFNG), mRNA [NM_002405] -1.74 2.14E-02 A_23_P34554 Homo sapiens calcium channel, voltage-dependent, alpha 1E subunit (CACNA1E), mRNA [NM_000721] -1.75 3.98E-02 A_32_P206175 PTNI_HUMAN (Q99952) Tyrosine-protein phosphatase, non-receptor type 18 (Brain-derived phosphatase), partial (6%) [THC2429183] -1.76 3.90E-02 A_32_P156776 AA360388 EST69518 T-cell lymphoma Homo sapiens cDNA 5' end similar to EST containing Alu repeat, mRNA sequence [AA360388] -1.76 1.84E-02 A_23_P380318 Homo sapiens early growth response 4 (EGR4), mRNA [NM_001965] -1.79 3.91E-03 A_24_P480206 PREDICTED: Homo sapiens similar to AER176Wp (LOC441825), mRNA [XM_497596] -1.79 1.92E-02 A_24_P752279  -1.80 2.63E-02 A_24_P401270 Homo sapiens cDNA FLJ33940 fis, clone CTONG2018069. [AK091259] -1.81 3.72E-02 A_24_P183150 Homo sapiens chemokine (C-X-C motif) ligand 3 (CXCL3), mRNA [NM_002090] -1.84 9.12E-03 A_32_P89277  -1.85 1.79E-04 A_23_P259141 Homo sapiens Z-DNA binding protein 1 (ZBP1), mRNA [NM_030776] -1.89 5.32E-03 A_24_P252223 Homo sapiens chromosome 6 open reading frame 85 (C6orf85), mRNA [NM_021945] -1.91 1.95E-02 A_23_P82088 Homo sapiens neuritin 1 (NRN1), mRNA [NM_016588] -1.94 1.31E-02 A_24_P366122 Homo sapiens acyl-Coenzyme A binding domain containing 4 (ACBD4), mRNA [NM_024722] -1.95 1.86E-02 A_24_P754989  -1.96 4.61E-02 A_24_P483956  -1.97 9.36E-04 A_24_P15797 Homo sapiens cDNA FLJ34477 fis, clone HLUNG2003833. [AK091796] -1.98 7.90E-03 A_23_P17065 Homo sapiens chemokine (C-C motif) ligand 20 (CCL20), mRNA [NM_004591] -2.00 2.64E-02 A_23_P358370 H.sapiens HFKH4 mRNA for fork head like protein. [X94553] -2.02 2.65E-02 A_24_P306034 Homo sapiens cDNA FLJ25870 fis, clone CBR02141. [AK098736] -2.04 4.80E-02 A_23_P39265 Homo sapiens GPI-anchored metastasis-associated protein homolog (C4.4A), mRNA [NM_014400] -2.08 1.24E-02 A_24_P348885 Homo sapiens cytochrome b-561 domain containing 1 (CYB561D1), mRNA [NM_182580] -2.08 2.01E-02 A_32_P87013 Homo sapiens interleukin 8 (IL8), mRNA [NM_000584] -2.20 9.29E-03 A_24_P910381 GPS2_HUMAN (Q13227) G protein pathway suppressor 2 (GPS2 protein), partial (52%) [THC2428320] -2.25 4.37E-02 A_24_P419028 Homo sapiens mRNA for MOP-1, complete cds. [AB014771] -2.90 2.37E-02   123 APPENDIX 2: LIST OF DIFFERENTIALLY EXPRESSED HUMAN GENES IDENTIFIED IN THE SORTED EXPERIMENT Probe ID Gene Description Fold Change P-value A_32_P164916 Homo sapiens mRNA; cDNA DKFZp666D074 (from clone DKFZp666D074) [AL833005] 1.86 7.15E-04 A_23_P9926 Homo sapiens tetraspanin 10 (TSPAN10), mRNA [NM_031945] 1.83 1.05E-02 A_32_P134634 ALU5_HUMAN (P39192) Alu subfamily SC sequence contamination warning entry, partial (9%) [THC2271582] 1.80 1.85E-03 A_23_P211468 AA837799 oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence [AA837799] 1.78 2.98E-02 A_32_P164917 Homo sapiens mRNA; cDNA DKFZp666D074 (from clone DKFZp666D074) [AL833005] 1.77 7.43E-04 A_23_P1691 Homo sapiens matrix metalloproteinase 1 (interstitial collagenase) (MMP1), mRNA [NM_002421] 1.69 2.94E-03 A_23_P161698 Homo sapiens matrix metalloproteinase 3 (stromelysin 1, progelatinase) (MMP3), mRNA [NM_002422] 1.63 1.07E-02 A_23_P152838 Homo sapiens chemokine (C-C motif) ligand 5 (CCL5), mRNA [NM_002985] 1.60 3.38E-02 A_23_P373017 Homo sapiens chemokine (C-C motif) ligand 3 (CCL3), mRNA [NM_002983] 1.58 2.53E-02 A_24_P852099  1.54 2.81E-02 A_32_P105865  1.51 5.00E-02 A_23_P432947 Homo sapiens gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) (GREM1), mRNA [NM_013372] 1.50 1.01E-02 A_23_P360209 Homo sapiens migration-inducing gene 18 protein mRNA, complete cds. [AY423734] 1.50 2.29E-02 A_23_P115021 Homo sapiens actinin, alpha 2 (ACTN2), mRNA [NM_001103] 1.46 1.22E-02 A_32_P20997 AGENCOURT_10278709 NIH_MGC_82 Homo sapiens cDNA clone IMAGE:6592525 5', mRNA sequence [BU561469] 1.44 3.47E-02 A_23_P82814 Homo sapiens F-box protein 32 (FBXO32), transcript variant 1, mRNA [NM_058229] 1.43 1.64E-02 A_23_P32684 Homo sapiens PRO1051 mRNA, complete cds. [AF116619] 1.43 3.22E-02 A_23_P36658 Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant 1c, mRNA [NM_145791] 1.43 2.73E-03 A_24_P681266  1.41 2.01E-02 A_23_P66694 Homo sapiens ecotropic viral integration site 2B (EVI2B), mRNA [NM_006495] 1.40 8.27E-04 A_23_P23074 Homo sapiens interferon-induced protein 44 (IFI44), mRNA [NM_006417] 1.40 1.15E-03 A_23_P40108 Homo sapiens collagen, type IX, alpha 3 (COL9A3), mRNA [NM_001853] 1.40 1.16E-02 A_24_P918147 Homo sapiens cDNA FLJ13329 fis, clone OVARC1001795. [AK023391] 1.40 1.97E-02 A_23_P56898 Homo sapiens kynureninase (L-kynurenine hydrolase) (KYNU), mRNA [NM_003937] 1.40 1.81E-02 A_23_P219045 Homo sapiens histone 1, H3d (HIST1H3D), mRNA [NM_003530] 1.39 7.77E-03   124 Probe ID Gene Description Fold Change P-value A_23_P97990 Homo sapiens protease, serine, 11 (IGF binding) (PRSS11), mRNA [NM_002775] 1.39 2.37E-02 A_23_P389897 Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA [NM_002507] 1.39 4.26E-02 A_32_P161855 Homo sapiens KIAA1199 (KIAA1199), mRNA [NM_018689] 1.39 3.25E-02 A_24_P257416 Homo sapiens chemokine (C-X-C motif) ligand 2 (CXCL2), mRNA [NM_002089] 1.39 7.19E-03 A_32_P163215 BE272930 601171218F1 NIH_MGC_14 Homo sapiens cDNA clone IMAGE:3544661 5', mRNA sequence [BE272930] 1.39 4.79E-02 A_23_P139912 Homo sapiens insulin-like growth factor binding protein 6 (IGFBP6), mRNA [NM_002178] 1.39 1.42E-03 A_32_P96752 AW946823 RC2-ET0022-080500-012-b10 ET0022 Homo sapiens cDNA, mRNA sequence [AW946823] 1.38 4.97E-03 A_24_P256380 Homo sapiens chromosome 1 open reading frame 139 (C1orf139), transcript variant 1, mRNA [NM_024911] 1.37 7.51E-03 A_24_P170667 Homo sapiens AT rich interactive domain 5B (MRF1-like), mRNA (cDNA clone IMAGE:30345306), partial cds. [BC066345] 1.36 4.16E-02 A_24_P183150 Homo sapiens chemokine (C-X-C motif) ligand 3 (CXCL3), mRNA [NM_002090] 1.36 2.26E-03 A_23_P212800 Homo sapiens fibroblast growth factor 5 (FGF5), transcript variant 1, mRNA [NM_004464] 1.36 1.31E-02 A_32_P146815 Homo sapiens cDNA clone IMAGE:30374677, partial cds. [BC062473] 1.36 3.81E-03 A_23_P149153 Homo sapiens phosphodiesterase 4D interacting protein (myomegalin) (PDE4DIP), transcript variant 3, mRNA [NM_022359] 1.36 7.31E-03 A_23_P169039 Homo sapiens snail homolog 2 (Drosophila) (SNAI2), mRNA [NM_003068] 1.35 3.88E-03 A_24_P82358 Homo sapiens forkhead box C2 (MFH-1, mesenchyme forkhead 1) (FOXC2), mRNA [NM_005251] 1.34 2.94E-02 A_23_P202978 Homo sapiens caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, mRNA [NM_033292] 1.34 4.01E-03 A_24_P316454 Homo sapiens cDNA clone IMAGE:5441030, partial cds. [BC022826] 1.34 2.48E-02 A_23_P428184 Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA [NM_021065] 1.34 5.65E-03 A_24_P37903  1.34 1.21E-02 A_23_P346309 Homo sapiens BCL2-associated X protein (BAX), transcript variant gamma, mRNA [NM_138762] 1.33 3.65E-02 A_23_P30813 Homo sapiens histone 1, H4k (HIST1H4K), mRNA [NM_003541] 1.33 7.83E-03 A_23_P156609  1.33 1.60E-03 A_23_P415984 Homo sapiens neuronal PAS domain protein 2 (NPAS2), mRNA [NM_002518] 1.33 3.17E-02 A_23_P160318 Homo sapiens collagen, type XVI, alpha 1 (COL16A1), mRNA [NM_001856] 1.33 2.01E-02 A_23_P61371 Homo sapiens hypothetical protein LOC340061 (LOC340061), mRNA [NM_198282] 1.33 8.83E-03 A_23_P435029 Homo sapiens, histone gene complex 1, clone MGC:9629 IMAGE:3913365, mRNA, complete cds. [BC015544] 1.33 1.01E-03 A_24_P403016 Homo sapiens cDNA: FLJ21477 fis, clone COL04982. [AK025130] 1.32 3.32E-02 A_23_P421306 Homo sapiens synaptotagmin XII (SYT12), mRNA [NM_177963] 1.32 6.77E-03 A_23_P256470 Homo sapiens neuropeptide Y (NPY), mRNA [NM_000905] 1.32 6.64E-03   125 Probe ID Gene Description Fold Change P-value A_23_P35148 Homo sapiens TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13), mRNA [NM_005645] 1.31 3.87E-03 A_23_P30799 Homo sapiens histone 1, H3f (HIST1H3F), mRNA [NM_021018] 1.31 4.10E-02 A_32_P221799 Homo sapiens histone 1, H2am (HIST1H2AM), mRNA [NM_003514] 1.30 2.88E-02 A_23_P362719 Homo sapiens cDNA clone MGC:61931 IMAGE:6565452, complete cds. [BC054888] 1.30 3.10E-02 A_32_P108420  1.30 3.61E-03 A_23_P93258 Homo sapiens histone 1, H3b (HIST1H3B), mRNA [NM_003537] 1.29 1.63E-02 A_32_P820503 Homo sapiens ferritin, heavy polypeptide 1 (FTH1), mRNA [NM_002032] 1.29 4.29E-02 A_23_P139786 Homo sapiens 2'-5'-oligoadenylate synthetase-like (OASL), transcript variant 1, mRNA [NM_003733] 1.29 1.52E-02 A_23_P401106 Homo sapiens phosphodiesterase 2A, cGMP-stimulated (PDE2A), mRNA [NM_002599] 1.29 3.24E-02 A_23_P251002  1.29 3.47E-02 A_23_P362415 Homo sapiens ubiquitin-conjugating enzyme E2B (RAD6 homolog), mRNA (cDNA clone IMAGE:2967519), partial cds. [BC001694] 1.29 2.00E-02 A_23_P200801 Homo sapiens phosphodiesterase 4D interacting protein (myomegalin) (PDE4DIP), transcript variant 5, mRNA [NM_001002811] 1.29 1.04E-02 A_24_P412486 full-length cDNA clone CS0DC001YJ02 of Neuroblastoma Cot 25- normalized of Homo sapiens (human). [CR601315] 1.29 4.27E-02 A_32_P53633 full-length cDNA clone CS0DI009YA14 of Placenta Cot 25-normalized of Homo sapiens (human). [CR613972] 1.29 1.69E-02 A_23_P82169 Homo sapiens SRY (sex determining region Y)-box 4 (SOX4), mRNA [NM_003107] 1.29 1.20E-02 A_24_P283189 Homo sapiens CD14 antigen (CD14), mRNA [NM_000591] 1.28 1.15E-02 A_23_P315364 Homo sapiens chemokine (C-X-C motif) ligand 2 (CXCL2), mRNA [NM_002089] 1.28 5.24E-03 A_23_P107775 Homo sapiens MDAC1 (MDAC1), mRNA [NM_139172] 1.28 3.34E-02 A_24_P147461 Homo sapiens serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 2, mRNA [NM_198833] 1.27 4.12E-02 A_24_P28722 Homo sapiens radical S-adenosyl methionine domain containing 2 (RSAD2), mRNA [NM_080657] 1.27 6.02E-03 A_23_P71037 Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA [NM_000600] 1.27 2.05E-02 A_23_P404494 Homo sapiens interleukin 7 receptor (IL7R), mRNA [NM_002185] 1.27 3.33E-02 A_32_P46544  1.27 4.90E-02 A_23_P351275 Homo sapiens uridine phosphorylase 1 (UPP1), transcript variant 2, mRNA [NM_181597] 1.27 1.56E-02 A_23_P50919 Homo sapiens serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 (SERPINE2), mRNA [NM_006216] 1.27 5.37E-04 A_23_P160559 Homo sapiens extracellular matrix protein 1 (ECM1), transcript variant 1, mRNA [NM_004425] 1.27 1.84E-02 A_23_P147805 Homo sapiens uridine phosphorylase 1, mRNA (cDNA clone MGC:54255 IMAGE:5549432), complete cds. [BC047030] 1.27 4.78E-02 A_24_P324396 Homo sapiens HSPC088 mRNA, partial cds. [AF161351] 1.27 4.47E-02 A_24_P381199 Homo sapiens tripartite motif-containing 6 (TRIM6), transcript variant 1, mRNA [NM_001003818] 1.26 4.38E-02   126 Probe ID Gene Description Fold Change P-value A_24_P251764 Homo sapiens chemokine (C-X-C motif) ligand 3 (CXCL3), mRNA [NM_002090] 1.26 8.59E-03 A_23_P149301 Homo sapiens histone 3, H2a (HIST3H2A), mRNA [NM_033445] 1.26 2.54E-03 A_23_P122216 Homo sapiens lysyl oxidase (LOX), mRNA [NM_002317] 1.26 1.08E-02 A_23_P24004 Homo sapiens interferon-induced protein with tetratricopeptide repeats 2 (IFIT2), mRNA [NM_001547] 1.26 8.80E-03 A_23_P35309 Homo sapiens TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 1, mRNA [NM_014409] 1.26 3.53E-02 A_24_P157926 Homo sapiens tumor necrosis factor, alpha-induced protein 3 (TNFAIP3), mRNA [NM_006290] 1.25 2.30E-02 A_24_P277657 Homo sapiens guanosine monophosphate reductase (GMPR), mRNA [NM_006877] 1.25 3.50E-02 A_23_P162589 Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), transcript variant 2, mRNA [NM_001017535] 1.25 4.17E-02 A_23_P327156 Homo sapiens cDNA FLJ37574 fis, clone BRCOC2003100. [AK094893] 1.25 1.98E-02 A_32_P165557  1.25 4.00E-02 A_23_P59045 Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA [NM_021052] 1.25 3.27E-04 A_32_P18440 Homo sapiens mRNA; cDNA DKFZp686G23148 (from clone DKFZp686G23148). [BX641020] 1.25 1.17E-03 A_23_P110167 Homo sapiens microsomal glutathione S-transferase 2 (MGST2), mRNA [NM_002413] 1.25 4.77E-02 A_23_P420942 Homo sapiens metallothionein 1E (functional) (MT1E), mRNA [NM_175617] 1.25 4.98E-02 A_32_P101031 Homo sapiens LY6/PLAUR domain containing 1 (LYPDC1), mRNA [NM_144586] 1.25 3.30E-02 A_23_P358597 Homo sapiens popeye domain containing 3 (POPDC3), mRNA [NM_022361] 1.24 9.81E-03 A_23_P151506 Homo sapiens pleckstrin 2 (PLEK2), mRNA [NM_016445] 1.24 2.65E-03 A_24_P367473 Homo sapiens chemokine (C-C motif) receptor 3 (CCR3), transcript variant 1, mRNA [NM_001837] 1.24 1.36E-02 A_23_P111041 Homo sapiens histone 1, H2bi (HIST1H2BI), mRNA [NM_003525] 1.24 3.36E-03 A_23_P35912 Homo sapiens caspase 4, apoptosis-related cysteine protease (CASP4), transcript variant gamma, mRNA [NM_033306] 1.24 2.11E-02 A_32_P41461 Homo sapiens WAS protein family, member 2 (WASF2), mRNA [NM_006990] 1.24 3.87E-02 A_32_P170368 AI878825 au50b09.y1 Schneider fetal brain 00004 Homo sapiens cDNA clone IMAGE:2518169 5', mRNA sequence [AI878825] 1.24 4.99E-02 A_24_P11462 Homo sapiens arginine decarboxylase (ADC), mRNA [NM_052998] 1.24 1.65E-02 A_24_P511686 full-length cDNA clone CS0DF020YJ04 of Fetal brain of Homo sapiens (human). [CR616845] 1.24 3.04E-02 A_23_P54781 Homo sapiens retinoblastoma binding protein 6, mRNA (cDNA clone IMAGE:6214974), complete cds. [BC051317] 1.23 5.38E-03 A_24_P318656 Homo sapiens integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3), mRNA [NM_000212] 1.23 1.52E-02 A_23_P87150 Homo sapiens leupaxin (LPXN), mRNA [NM_004811] 1.23 8.56E-03 A_23_P76529 Homo sapiens integrin, beta 7 (ITGB7), mRNA [NM_000889] 1.23 1.78E-02 A_24_P810290 Homo sapiens cDNA FLJ25802 fis, clone TST07145. [AK098668] 1.23 5.75E-03   127 Probe ID Gene Description Fold Change P-value A_24_P406334 Homo sapiens six transmembrane epithelial antigen of the prostate 1 (STEAP1), mRNA [NM_012449] 1.23 1.21E-02 A_23_P13740 Homo sapiens neuron navigator 3 (NAV3), mRNA [NM_014903] 1.23 7.00E-03 A_24_P51061 Homo sapiens discoidin, CUB and LCCL domain containing 2 (DCBLD2), mRNA [NM_080927] 1.23 4.45E-02 A_32_P171793  1.23 2.20E-02 A_24_P217834 Homo sapiens histone 1, H3d (HIST1H3D), mRNA [NM_003530] 1.23 3.04E-02 A_23_P111701 Homo sapiens guanine nucleotide binding protein (G protein), gamma 11 (GNG11), mRNA [NM_004126] 1.22 2.98E-02 A_24_P699896 Homo sapiens cDNA clone IMAGE:5296862. [BC036637] 1.22 2.68E-03 A_23_P436281 Homo sapiens histone 2, H4 (HIST2H4), mRNA [NM_003548] 1.22 7.65E-03 A_24_P11384 Homo sapiens mitogen-inducible gene 6 (MIG-6), mRNA [NM_018948] 1.22 4.95E-02 A_32_P16204 Homo sapiens hypothetical gene supported by BC013438, mRNA (cDNA clone IMAGE:3899073), partial cds. [BC013438] 1.21 2.27E-03 A_23_P323685 Homo sapiens histone 1, H4h (HIST1H4H), mRNA [NM_003543] 1.21 1.52E-02 A_24_P115762 Homo sapiens cathepsin C (CTSC), transcript variant 2, mRNA [NM_148170] 1.21 5.79E-03 A_23_P136721 Human endogenous retrovirus H protease/integrase-derived ORF1, ORF2, and putative envelope protein mRNA, complete cds. [U88896] 1.21 2.94E-02 A_23_P5435 Homo sapiens clone DNA129535 MRV222 (UNQ3066) mRNA, complete cds. [AY358993] 1.21 2.70E-02 A_23_P16722 Homo sapiens dedicator of cytokinesis 10 (DOCK10), mRNA [NM_014689] 1.21 1.20E-02 A_24_P146138 Homo sapiens protocadherin alpha 1 (PCDHA1), transcript variant 2, mRNA [NM_031410] 1.21 4.44E-02 A_23_P163251 Homo sapiens progestin and adipoQ receptor family member V (PAQR5), mRNA [NM_017705] 1.21 4.07E-05 A_24_P175188 Homo sapiens sterile alpha motif domain containing 9 (SAMD9), mRNA [NM_017654] 1.21 3.24E-02 A_23_P84849 Human N-type calcium channel alpha-1 subunit mRNA, complete cds. [M94173] 1.21 3.87E-02 A_24_P68631 Homo sapiens histone 2, H2ab (HIST2H2AB), mRNA [NM_175065] 1.21 1.84E-02 A_24_P55148 Homo sapiens histone 1, H2bj (HIST1H2BJ), mRNA [NM_021058] 1.21 1.31E-02 A_24_P294233 Homo sapiens glutaminase (GLS), mRNA [NM_014905] 1.21 1.35E-02 A_24_P20873 Homo sapiens histone 1, H4i (HIST1H4I), mRNA [NM_003495] 1.21 3.43E-02 A_23_P120606  1.21 3.46E-02 A_24_P127051  1.21 1.57E-03 A_32_P37592 Q7Z5X4 (Q7Z5X4) Intermediate filament-like protein MGC:2625, isoform 1, partial (12%) [THC2301370] 1.21 2.37E-02 A_24_P544661 Homo sapiens cDNA clone IMAGE:6380649, containing frame-shift errors. [BC068044] 1.21 2.07E-03 A_23_P108948 Homo sapiens dilute suppressor (DSU), mRNA [NM_018000] 1.21 4.16E-02 A_32_P153469 AA298150 EST113740 Bone VII Homo sapiens cDNA 5' end, mRNA sequence [AA298150] 1.21 3.78E-02 A_23_P351556 full-length cDNA clone CS0DF004YO04 of Fetal brain of Homo sapiens (human). [CR594281] 1.20 4.47E-02 A_23_P135568 TNIK_HUMAN (Q9UKE5) TRAF2 and NCK interacting kinase, complete [THC2398745] 1.20 8.22E-03 A_23_P167997 Homo sapiens histone 1, H2bg (HIST1H2BG), mRNA [NM_003518] 1.20 1.70E-02   128 Probe ID Gene Description Fold Change P-value A_23_P123022 Homo sapiens tyrosine 3-monooxygenase/tryptophan 5- monooxygenase activation protein, gamma polypeptide (YWHAG), mRNA [NM_012479] 1.20 4.10E-02 A_23_P71241 Homo sapiens Sec61 gamma subunit (SEC61G), transcript variant 1, mRNA [NM_014302] 1.20 1.54E-02 A_24_P156911 Homo sapiens histone 2, H2be (HIST2H2BE), mRNA [NM_003528] 1.20 1.59E-02 A_24_P146211 Homo sapiens histone 1, H2bd (HIST1H2BD), transcript variant 1, mRNA [NM_021063] 1.20 2.03E-02 A_24_P733083  1.20 3.04E-02 A_24_P196117 Homo sapiens general transcription factor IIH, polypeptide 5 (GTF2H5), mRNA [NM_207118] 1.20 4.72E-02 A_32_P103220 Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12 (ADAMTS12), mRNA [NM_030955] 1.20 4.04E-02 A_32_P231265 AI694800 wd62c03.x1 NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:2336164 3', mRNA sequence [AI694800] 1.20 2.65E-02 A_23_P20122 Homo sapiens zinc finger CCCH-type, antiviral 1 (ZC3HAV1), transcript variant 2, mRNA [NM_024625] 1.20 3.90E-02 A_23_P127394 Homo sapiens cryptochrome 2 (photolyase-like) (CRY2), mRNA [NM_021117] 1.20 1.71E-02 A_23_P102117 Homo sapiens wingless-type MMTV integration site family, member 10A (WNT10A), mRNA [NM_025216] 1.19 1.63E-02 A_24_P355649 Homo sapiens Friend leukemia virus integration 1 (FLI1), mRNA [NM_002017] 1.19 3.31E-02 A_32_P67533 Homo sapiens l(3)mbt-like 3 (Drosophila) (L3MBTL3), transcript variant 1, mRNA [NM_032438] 1.19 4.56E-04 A_24_P416346 Homo sapiens ets variant gene 4 (E1A enhancer binding protein, E1AF) (ETV4), mRNA [NM_001986] 1.19 1.54E-03 A_23_P143285 Homo sapiens cDNA FLJ20802 fis, clone ADSU01223. [AK000809] 1.19 4.08E-02 A_23_P154037 Homo sapiens aldehyde oxidase 1 (AOX1), mRNA [NM_001159] 1.19 7.04E-03 A_32_P20535 AL527314 Homo sapiens NEUROBLASTOMA COT 25-NORMALIZED Homo sapiens cDNA clone CS0DC021YG08 3-PRIME, mRNA sequence [AL527314] 1.19 3.68E-02 A_23_P256205 Homo sapiens actin binding LIM protein family, member 3 (ABLIM3), mRNA [NM_014945] 1.19 1.36E-03 A_23_P42178 Homo sapiens histone 1, H2bf (HIST1H2BF), mRNA [NM_003522] 1.19 1.44E-02 A_23_P153022 Homo sapiens keratin associated protein 2-4 (KRTAP2-4), mRNA [NM_033184] 1.19 4.56E-02 A_32_P15874 Q8INN3 (Q8INN3) CG31415-PA, partial (7%) [THC2383106] 1.19 1.48E-03 A_23_P79622 Homo sapiens FK506 binding protein 7 (FKBP7), transcript variant 1, mRNA [NM_016105] 1.19 2.60E-02 A_24_P144383  1.19 2.97E-02 A_23_P74088 Homo sapiens matrix metalloproteinase 23B (MMP23B), mRNA [NM_006983] 1.19 3.62E-02 A_23_P374689 Homo sapiens glutamate decarboxylase 1 (brain, 67kDa) (GAD1), transcript variant GAD67, mRNA [NM_000817] 1.19 7.24E-03 A_23_P130089 Homo sapiens intraflagellar transport protein IFT20 (IFT20), mRNA [NM_174887] 1.19 2.19E-02   129 Probe ID Gene Description Fold Change P-value A_23_P1962 Homo sapiens retinoic acid receptor responder (tazarotene induced) 3 (RARRES3), mRNA [NM_004585] 1.19 2.65E-02 A_23_P167983 Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730 IMAGE:2988620), complete cds. [BC017379] 1.18 3.58E-02 A_24_P178175 Homo sapiens gamma-glutamyltransferase 2 (GGT2), mRNA [NM_002058] 1.18 3.74E-02 A_23_P350574 Homo sapiens Fc receptor-like and mucin-like 2 (FCRLM2), mRNA [NM_152378] 1.18 2.22E-02 A_23_P402081 Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA [NM_003520] 1.18 2.49E-02 A_24_P110141 Homo sapiens hypothetical protein DKFZp434I1020 (DKFZp434I1020), mRNA [NM_194295] 1.18 2.09E-02 A_24_P381455 Homo sapiens hypothetical protein FLJ11259, mRNA (cDNA clone MGC:21716 IMAGE:4474297), complete cds. [BC018435] 1.18 3.26E-03 A_32_P118568 Homo sapiens RET finger protein-like 1 antisense transcript, partial. [AJ010230] 1.18 4.91E-02 A_23_P360804 Homo sapiens copine V (CPNE5), mRNA [NM_020939] 1.18 7.40E-03 A_24_P255663  1.18 3.16E-02 A_24_P394510 Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA [NM_021066] 1.18 1.85E-02 A_23_P2271 Homo sapiens parathyroid hormone-like hormone (PTHLH), transcript variant 1, mRNA [NM_198965] 1.18 1.45E-02 A_23_P403521 Homo sapiens chromosome 7 open reading frame 36 (C7orf36), mRNA [NM_020192] 1.18 3.58E-03 A_23_P53193 Homo sapiens synaptotagmin-like 2 (SYTL2), transcript variant c, mRNA [NM_206927] 1.18 1.29E-02 A_23_P309991 Homo sapiens BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 2, mRNA [NM_138622] 1.18 1.52E-02 A_23_P344531 Homo sapiens mRNA for KIAA1029 protein, partial cds. [AB028952] 1.18 1.27E-02 A_32_P69149 Homo sapiens six transmembrane epithelial antigen of the prostate 1 (STEAP1), mRNA [NM_012449] 1.18 1.45E-02 A_32_P157504 Homo sapiens cDNA FLJ37310 fis, clone BRAMY2016706. [AK094629] 1.18 1.60E-02 A_24_P659122 Homo sapiens hypothetical LOC401357 (LOC401357), mRNA [NM_001013685] 1.18 3.78E-02 A_32_P119736 O63611 (O63611) NADH dehydrogenase subunit 2, partial (5%) [THC2386560] 1.18 3.60E-02 A_24_P585004  1.18 1.83E-03 A_23_P255076 Homo sapiens RWD domain containing 2 (RWDD2), mRNA [NM_033411] 1.18 3.52E-02 A_23_P105012 Homo sapiens HRAS-like suppressor 2 (HRASLS2), mRNA [NM_017878] 1.17 1.27E-02 A_32_P62211 Homo sapiens mRNA; cDNA DKFZp686J1595 (from clone DKFZp686J1595) [BX538057] 1.17 2.64E-02 A_23_P502520 Homo sapiens interleukin 4 induced 1 (IL4I1), transcript variant 2, mRNA [NM_172374] 1.17 3.26E-02 A_23_P330788 Homo sapiens IQ motif and Sec7 domain 2 (IQSEC2), mRNA [NM_015075] 1.17 3.41E-02 A_23_P40470 Homo sapiens H2B histone family, member S (H2BFS), mRNA [NM_017445] 1.17 2.50E-02 A_23_P51856 Homo sapiens dual specificity phosphatase 10 (DUSP10), transcript variant 1, mRNA [NM_007207] 1.17 1.75E-02 A_32_P162250 Homo sapiens Rho GTPase activating protein 18 (ARHGAP18), mRNA [NM_033515] 1.17 2.46E-02   130 Probe ID Gene Description Fold Change P-value A_23_P23346 Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 (MLLT11), mRNA [NM_006818] 1.17 1.78E-02 A_23_P333484 Homo sapiens histone 1, H3h (HIST1H3H), mRNA [NM_003536] 1.17 1.81E-02 A_23_P104346 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, alpha (PIP5K2A), mRNA [NM_005028] 1.17 3.67E-02 A_23_P111797 Homo sapiens mRNA; cDNA DKFZp434F142 (from clone DKFZp434F142). [AL136837] 1.17 2.87E-02 A_32_P319200 Homo sapiens gamma-glutamyltransferase-like 4 (GGTL4), transcript variant 1, mRNA [NM_199127] 1.17 3.91E-02 A_23_P201459 Homo sapiens interferon, alpha-inducible protein (clone IFI-6-16) (G1P3), transcript variant 3, mRNA [NM_022873] 1.17 7.95E-03 A_23_P406616 Homo sapiens hypothetical protein FLJ36031 (FLJ36031), mRNA [NM_175884] 1.17 2.32E-02 A_24_P233078 Homo sapiens peptide YY, 2 (seminalplasmin) (PYY2), mRNA [NM_021093] 1.17 7.65E-04 A_24_P661641 Homo sapiens hypothetical gene supported by BC047417, mRNA (cDNA clone IMAGE:5288894). [BC047417] 1.17 2.31E-02 A_23_P117912 full-length cDNA clone CS0DI031YH01 of Placenta Cot 25-normalized of Homo sapiens (human). [CR618466] 1.17 4.16E-02 A_24_P230877 Homo sapiens, clone IMAGE:3606519, mRNA, partial cds. [BC009463] 1.17 3.62E-02 A_23_P500381 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant d, mRNA [NM_019859] 1.17 4.77E-02 A_23_P500861 Homo sapiens spectrin repeat containing, nuclear envelope 1 (SYNE1), transcript variant longest, mRNA [NM_182961] 1.16 4.39E-02 A_23_P424561 Homo sapiens ras homolog gene family, member V (RHOV), mRNA [NM_133639] 1.16 4.69E-03 A_23_P332992 Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA [NM_175055] 1.16 2.44E-02 A_24_P220485 Homo sapiens olfactomedin-like 2A (OLFML2A), mRNA [NM_182487] 1.16 4.11E-02 A_23_P93180 Homo sapiens histone 1, H2bc (HIST1H2BC), mRNA [NM_003526] 1.16 3.08E-02 A_23_P218597 Homo sapiens neuronal PAS domain protein 2 (NPAS2), mRNA [NM_002518] 1.16 8.00E-03 A_24_P479645 Homo sapiens cDNA FLJ36321 fis, clone THYMU2005482. [AK093640] 1.16 3.72E-02 A_24_P57977 Homo sapiens SNAP25-interacting protein (SNIP), mRNA [NM_025248] 1.16 2.90E-02 A_23_P205531 Homo sapiens ribonuclease, RNase A family, 4 (RNASE4), transcript variant 1, mRNA [NM_194430] 1.16 1.73E-02 A_23_P71989 Homo sapiens uridine phosphorylase 1 (UPP1), transcript variant 2, mRNA [NM_181597] 1.16 4.25E-02 A_23_P137856 Homo sapiens mucin 1, transmembrane (MUC1), transcript variant 1, mRNA [NM_002456] 1.16 1.46E-02 A_23_P147918 Homo sapiens S100 calcium binding protein A16 (S100A16), mRNA [NM_080388] 1.16 3.93E-02 A_32_P94685 Homo sapiens, clone IMAGE:4819084, mRNA. [BC042589] 1.16 3.05E-03 A_32_P5628  1.16 2.48E-02 A_24_P41918 Homo sapiens, clone IMAGE:3685861, mRNA. [BC030714] 1.16 3.81E-02 A_24_P788772 APE_HUMAN (P02649) Apolipoprotein E precursor (Apo-E), partial (50%) [THC2373524] 1.16 3.72E-02 A_23_P134347 Homo sapiens carboxypeptidase, vitellogenic-like (CPVL), transcript variant 1, mRNA [NM_031311] 1.16 1.84E-02   131 Probe ID Gene Description Fold Change P-value A_23_P134935 Homo sapiens dual specificity phosphatase 4 (DUSP4), transcript variant 1, mRNA [NM_001394] 1.16 2.91E-03 A_24_P178415  1.16 4.97E-02 A_23_P29769 Homo sapiens WW domain containing transcription regulator 1 (WWTR1), mRNA [NM_015472] 1.16 4.68E-02 A_24_P252739 Homo sapiens Kruppel-like factor 6 (KLF6), transcript variant 1, mRNA [NM_001008490] 1.16 2.66E-02 A_23_P205074 Homo sapiens hypothetical protein LOC283537 (LOC283537), mRNA [NM_181785] 1.16 4.47E-02 A_23_P58763 Homo sapiens pelota homolog (Drosophila) (PELO), mRNA [NM_015946] 1.16 1.92E-02 A_23_P37914 Homo sapiens solute carrier family 5 (sodium/glucose cotransporter), member 11 (SLC5A11), mRNA [NM_052944] 1.16 1.25E-02 A_23_P418934 Homo sapiens similar to RIKEN cDNA 8030451K01 (LOC387921), transcript variant 2, mRNA [NM_001017370] 1.16 3.59E-02 A_23_P83007 Homo sapiens chromosome 9 open reading frame 150 (C9orf150), mRNA [NM_203403] 1.15 9.34E-03 A_23_P7402 Homo sapiens PDZ domain containing 3 (PDZK3), transcript variant 1, mRNA [NM_178140] 1.15 6.81E-03 A_24_P252078 Homo sapiens cDNA clone MGC:71335 IMAGE:6088873, complete cds. [BC067086] 1.15 3.41E-02 A_32_P199801 Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 13 (SLC2A13), mRNA [NM_052885] 1.15 1.65E-02 A_23_P129334 Homo sapiens chloride channel 7 (CLCN7), mRNA [NM_001287] 1.15 7.81E-03 A_23_P136573 Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 5 (ST3GAL5), mRNA [NM_003896] 1.15 8.93E-03 A_32_P53311 Homo sapiens cDNA FLJ44257 fis, clone TKIDN2015263. [AK126245] 1.15 2.00E-02 A_24_P101282 Homo sapiens, clone IMAGE:5019307, mRNA. [BC031342] 1.15 3.64E-02 A_24_P917123 Homo sapiens myosin regulatory light chain interacting protein (MYLIP), mRNA [NM_013262] 1.15 2.63E-03 A_24_P818010 Homo sapiens cDNA FLJ39761 fis, clone SPLEN1000083. [AK097080] 1.15 1.86E-02 A_24_P535483 Homo sapiens hypothetical protein LOC284739 (LOC284739), mRNA [NM_207349] 1.15 1.43E-02 A_32_P228348 Homo sapiens FLJ45248 protein (FLJ45248), mRNA [NM_207505] 1.15 3.82E-02 A_23_P105264 Homo sapiens ets variant gene 6 (TEL oncogene) (ETV6), mRNA [NM_001987] 1.15 3.79E-02 A_23_P365738 Homo sapiens activity-regulated cytoskeleton-associated protein (ARC), mRNA [NM_015193] 1.15 3.49E-02 A_23_P429383 Homo sapiens homeo box D9 (HOXD9), mRNA [NM_014213] 1.15 3.61E-02 A_23_P155229 Homo sapiens signal sequence receptor, gamma (translocon-associated protein gamma) (SSR3), mRNA [NM_007107] 1.15 2.14E-02 A_23_P1014 Homo sapiens chromosome 1 open reading frame 97 (C1orf97), mRNA [NM_032705] 1.15 2.77E-02 A_24_P8721 Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA [NM_003517] 1.15 3.10E-02 A_32_P110390 Homo sapiens proline-rich protein PRP2 (PRP2), mRNA [NM_173490] 1.14 1.29E-02 A_23_P46369 Homo sapiens RAB13, member RAS oncogene family (RAB13), mRNA [NM_002870] 1.14 2.07E-02 A_23_P16609 Homo sapiens mRNA; cDNA DKFZp761G18121 (from clone DKFZp761G18121). [AL136548] 1.14 4.23E-02   132 Probe ID Gene Description Fold Change P-value A_23_P214950 Homo sapiens PERP, TP53 apoptosis effector (PERP), mRNA [NM_022121] 1.14 3.28E-02 A_23_P57856 Homo sapiens B-cell CLL/lymphoma 6 (zinc finger protein 51) (BCL6), transcript variant 2, mRNA [NM_138931] 1.14 9.11E-03 A_23_P8013 Homo sapiens histone 1, H2bl (HIST1H2BL), mRNA [NM_003519] 1.14 2.38E-02 A_23_P22765 Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), mRNA [NM_019056] 1.14 3.55E-02 A_23_P15394 Homo sapiens CD68 antigen (CD68), mRNA [NM_001251] 1.14 3.41E-02 A_24_P101722 PREDICTED: Homo sapiens similar to peptidyl-Pro cis trans isomerase (LOC126170), mRNA [XM_497621] 1.14 4.39E-02 A_23_P257423 Homo sapiens hypothetical protein MGC19780 (MGC19780), mRNA [NM_144988] 1.14 1.42E-02 A_24_P124567 Homo sapiens ORM1-like 2 (S. cerevisiae) (ORMDL2), mRNA [NM_014182] 1.14 1.49E-02 A_24_P390096 Homo sapiens glioma pathogenesis-related protein (GliPR) mRNA, complete cds. [U16307] 1.14 2.63E-02 A_23_P77859 Homo sapiens similar to RIKEN cDNA 2600017H02 (LOC92162), mRNA [NM_203411] 1.14 2.56E-02 A_32_P115606 Homo sapiens cDNA FLJ16460 fis, clone BRCAN2018240. [AK131385] 1.14 1.36E-02 A_24_P942589 Homo sapiens mRNA; cDNA DKFZp761G1111 (from clone DKFZp761G1111). [AL137342] 1.14 2.98E-03 A_23_P50368 Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 1, mRNA [NM_206818] 1.14 1.64E-03 A_23_P316472 Homo sapiens hypothetical protein FLJ32752 (FLJ32752), mRNA [NM_144666] 1.14 2.87E-02 A_24_P121642 PREDICTED: Homo sapiens similar to C367G8.3 (novel protein similar to RPL23A (60S ribosomal protein L23A)) (LOC441743), mRNA [XM_497481] 1.14 3.30E-02 A_23_P250042 Homo sapiens selenoprotein T (SELT), mRNA [NM_016275] 1.14 3.19E-02 A_23_P150350 Homo sapiens chromosome 11 open reading frame 1 (C11orf1), mRNA [NM_022761] 1.14 1.17E-02 A_23_P134953 Homo sapiens adipose differentiation-related protein (ADFP), mRNA [NM_001122] 1.14 1.64E-02 A_23_P17074 Homo sapiens hypothetical protein MGC12981 (MGC12981), mRNA [NM_032357] 1.14 3.44E-04 A_23_P104073 Homo sapiens S100 calcium binding protein A3 (S100A3), mRNA [NM_002960] 1.14 2.74E-02 A_32_P86705 Homo sapiens, clone IMAGE:5267797, mRNA. [BC040577] 1.14 2.25E-03 A_24_P58727  1.14 4.21E-02 A_23_P145 Homo sapiens 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase (hydroxymethylglutaricaciduria) (HMGCL), mRNA [NM_000191] 1.13 2.70E-02 A_23_P59069 Homo sapiens histone 1, H2bo (HIST1H2BO), mRNA [NM_003527] 1.13 4.03E-02 A_23_P103756 Homo sapiens oviductal glycoprotein 1, 120kDa (mucin 9, oviductin) (OVGP1), mRNA [NM_002557] 1.13 4.80E-02 A_24_P149314 Homo sapiens UL16 binding protein 2 (ULBP2), mRNA [NM_025217] 1.13 4.11E-02 A_24_P54000 Homo sapiens chromosome 1 open reading frame 71 (C1orf71), mRNA [NM_152609] 1.13 3.41E-02 A_23_P5757 Homo sapiens CGI-121 protein (CGI-121), mRNA [NM_016058] 1.13 4.61E-02 A_23_P50498 Homo sapiens ferritin, light polypeptide (FTL), mRNA [NM_000146] 1.13 1.42E-02   133 Probe ID Gene Description Fold Change P-value A_32_P175715 MEG1_MOUSE (Q61845) Meiosis expressed protein 1, partial (48%) [THC2405198] 1.13 4.46E-02 A_23_P211047 Homo sapiens BTB and CNC homology 1, basic leucine zipper transcription factor 1 (BACH1), transcript variant 1, mRNA [NM_206866] 1.13 4.91E-02 A_24_P161403 RST9844 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence [BG190769] 1.13 2.93E-02 A_24_P917783 H.sapiens mRNA for an acute myeloid leukaemia protein (1793bp). [X90978] 1.13 3.55E-03 A_23_P49546 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C (GRIN2C), mRNA [NM_000835] 1.13 3.39E-02 A_23_P25163 Homo sapiens mitochondrial ribosomal protein L42 (MRPL42), nuclear gene encoding mitochondrial protein, transcript variant 3, mRNA [NM_172178] 1.13 2.36E-02 A_23_P37778 Homo sapiens formin homology 2 domain containing 1 (FHOD1), mRNA [NM_013241] 1.13 5.98E-03 A_24_P347566 Homo sapiens talin 2 (TLN2), mRNA [NM_015059] 1.13 3.01E-02 A_23_P18579 Homo sapiens pituitary tumor-transforming 2 (PTTG2), mRNA [NM_006607] 1.13 7.06E-03 A_23_P380181 Homo sapiens LIM domain only 4 (LMO4), mRNA [NM_006769] 1.13 1.88E-02 A_23_P120809 Homo sapiens gamma-glutamyltransferase-like 4 (GGTL4), transcript variant 2, mRNA [NM_080839] 1.13 2.47E-02 A_24_P341476 AF139893 cyclophilin 18 [Oryctolagus cuniculus;], partial (84%) [THC2301753] 1.13 4.71E-02 A_32_P213637 Homo sapiens cDNA FLJ35623 fis, clone SPLEN2010986. [AK092942] 1.13 2.57E-02 A_23_P170713  1.13 1.21E-02 A_23_P145153 Homo sapiens programmed cell death 2 (PDCD2), transcript variant 1, mRNA [NM_002598] 1.13 4.35E-02 A_23_P154986 Homo sapiens gamma-glutamyltransferase 1 (GGT1), transcript variant 3, mRNA [NM_013430] 1.13 1.00E-02 A_23_P376088 Homo sapiens Lck interacting transmembrane adaptor 1 (LIME1), mRNA [NM_017806] 1.13 2.31E-02 A_32_P53107 full-length cDNA clone CS0DA002YO22 of Neuroblastoma of Homo sapiens (human). [CR609342] 1.13 8.86E-03 A_23_P158880 Homo sapiens START domain containing 5 (STARD5), transcript variant 1, mRNA [NM_181900] 1.13 2.37E-02 A_32_P30760 O39496 (O39496) Phosphoprotein, partial (6%) [THC2438559] 1.12 4.77E-02 A_23_P353085 Homo sapiens hypothetical protein FLJ35119 (FLJ35119), mRNA [NM_175871] 1.12 3.45E-02 A_24_P399694 Homo sapiens zinc finger, CCHC domain containing 3 (ZCCHC3), mRNA [NM_033089] 1.12 4.41E-02 A_23_P7684 Homo sapiens cDNA FLJ16450 fis, clone BRAWH2010552. [AK131381] 1.12 2.89E-02 A_23_P65678 Homo sapiens fibrillin 1 (Marfan syndrome) (FBN1), mRNA [NM_000138] 1.12 1.47E-02 A_23_P408108 Homo sapiens mitochondrial transcription termination factor (MTERF), nuclear gene encoding mitochondrial protein, mRNA [NM_006980] 1.12 1.02E-02 A_32_P204376 Homo sapiens OTTHUMP00000064580 (LOC441430), mRNA [NM_001012421] 1.12 1.74E-02 A_24_P323778  1.12 3.12E-02   134 Probe ID Gene Description Fold Change P-value A_23_P1819 Homo sapiens olfactory receptor, family 8, subfamily B, member 8 (OR8B8), mRNA [NM_012378] 1.12 2.11E-02 A_23_P138507 Homo sapiens cell division cycle 2, G1 to S and G2 to M (CDC2), transcript variant 1, mRNA [NM_001786] 1.12 6.25E-03 A_23_P215484 Homo sapiens chemokine (C-C motif) ligand 26 (CCL26), mRNA [NM_006072] 1.12 3.62E-02 A_32_P79966  1.12 3.79E-02 A_24_P803885 Homo sapiens hypothetical protein LOC149134 (LOC149134), mRNA [NM_207326] 1.12 2.32E-02 A_32_P33723 Homo sapiens, clone IMAGE:5240818, mRNA. [BC028229] 1.12 4.79E-02 A_23_P96350 Homo sapiens PRA1 domain family, member 2 (PRAF2), mRNA [NM_007213] 1.12 4.55E-02 A_23_P307346 Homo sapiens carbonic anhydrase VB, mitochondrial (CA5B), nuclear gene encoding mitochondrial protein, mRNA [NM_007220] 1.12 3.19E-03 A_23_P33809 Homo sapiens IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP3), mRNA [NM_018285] 1.12 2.74E-02 A_24_P342591 Homo sapiens arginine-glutamic acid dipeptide (RE) repeats (RERE), mRNA [NM_012102] 1.12 6.50E-03 A_24_P392231 HSL31 ribosomal protein L31 [Homo sapiens;], complete [THC2360930] 1.12 4.17E-02 A_23_P330070 Homo sapiens tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor), mRNA (cDNA clone MGC:9251 IMAGE:3902987), complete cds. [BC015514] 1.12 4.77E-02 A_23_P27075 Homo sapiens GABA(A) receptor-associated protein (GABARAP), mRNA [NM_007278] 1.12 4.58E-02 A_23_P66599 Homo sapiens hypothetical protein MGC10540 (MGC10540), mRNA [NM_032353] 1.12 2.71E-02 A_23_P144369 Homo sapiens nucleosome assembly protein 1-like 5 (NAP1L5), mRNA [NM_153757] 1.12 1.81E-02 A_24_P114617 Homo sapiens chromatin modifying protein 2B (CHMP2B), mRNA [NM_014043] 1.12 8.92E-03 A_24_P761130 Homo sapiens cDNA FLJ39761 fis, clone SPLEN1000083. [AK097080] 1.12 1.70E-02 A_23_P109677  1.12 4.48E-02 A_32_P11230 Homo sapiens hypothetical LOC399744 (LOC399744), mRNA [NM_001013665] 1.12 1.97E-02 A_24_P208595 Homo sapiens anthrax toxin receptor 1 (ANTXR1), transcript variant 2, mRNA [NM_053034] 1.12 3.05E-02 A_23_P22682 Homo sapiens armadillo repeat containing, X-linked 1 (ARMCX1), mRNA [NM_016608] 1.12 6.63E-03 A_23_P342348 Homo sapiens cytochrome c oxidase subunit IV isoform 1, mRNA (cDNA clone IMAGE:5240622), complete cds. [BC047869] 1.12 3.95E-02 A_32_P10187  1.12 1.33E-02 A_32_P32061 Homo sapiens chromosome 2 open reading frame 27 (C2orf27), mRNA [NM_013310] 1.11 2.78E-02 A_23_P62351 Homo sapiens armadillo repeat containing, X-linked 6 (ARMCX6), transcript variant 1, mRNA [NM_019007] 1.11 1.23E-02 A_23_P48717 Homo sapiens Niemann-Pick disease, type C2 (NPC2), mRNA [NM_006432] 1.11 4.74E-02 A_23_P399112 Homo sapiens myeloid-associated differentiation marker (MYADM), transcript variant 2, mRNA [NM_138373] 1.11 5.74E-03   135 Probe ID Gene Description Fold Change P-value A_23_P60016 Homo sapiens pituitary tumor transforming gene protein 3 (PTTG3) mRNA, complete cds. [AF095289] 1.11 2.58E-03 A_23_P206284 Homo sapiens G protein-coupled receptor 56 (GPR56), transcript variant 3, mRNA [NM_201525] 1.11 2.82E-03 A_23_P325119 Homo sapiens hypothetical gene LOC128439 (LOC128439), mRNA [NM_139016] 1.11 9.06E-03 A_24_P213321  1.11 1.75E-02 A_23_P85893 Homo sapiens chromosome 1 open reading frame 85 (C1orf85), mRNA [NM_144580] 1.11 2.45E-03 A_23_P130865 Homo sapiens hypothetical protein FLJ10374 (FLJ10374), mRNA [NM_018074] 1.11 3.14E-02 A_23_P121396 Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 19 (DNAJC19), transcript variant 1, mRNA [NM_145261] 1.11 2.91E-02 A_23_P139919 Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11 (CHST11), mRNA [NM_018413] 1.11 3.36E-03 A_24_P124558 Homo sapiens homeo box C8 (HOXC8), mRNA [NM_022658] 1.11 2.18E-02 A_23_P205046 Homo sapiens ankyrin repeat domain 10 (ANKRD10), mRNA [NM_017664] 1.11 3.95E-02 A_23_P202484 Homo sapiens zinc finger protein 503 (ZNF503), mRNA [NM_032772] 1.11 5.67E-03 A_24_P339611 Homo sapiens programmed cell death 5 (PDCD5), mRNA [NM_004708] 1.11 4.04E-02 A_23_P91076 full-length cDNA clone CS0DL008YP09 of B cells (Ramos cell line) Cot 25- normalized of Homo sapiens (human). [CR621710] 1.11 3.61E-02 A_24_P168416 Homo sapiens peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3, mRNA [NM_181738] 1.11 4.26E-02 A_32_P155035 Homo sapiens cDNA FLJ39181 fis, clone OCBBF2004235. [AK096500] 1.11 1.33E-02 A_23_P211196 Homo sapiens chromosome 21 open reading frame 67 (C21orf67), mRNA [NM_058188] 1.11 2.70E-02 A_23_P329286 Homo sapiens zinc finger, HIT domain containing 2 (ZNHIT2), mRNA [NM_014205] 1.11 4.81E-03 A_24_P29001 Homo sapiens LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM3), mRNA [NM_014463] 1.11 4.17E-03 A_23_P17998 Homo sapiens hairy and enhancer of split 1, (Drosophila) (HES1), mRNA [NM_005524] 1.11 1.17E-02 A_23_P20384 Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM1), mRNA [NM_014462] 1.11 4.68E-02 A_23_P252201 Homo sapiens ELL associated factor 2 (EAF2), mRNA [NM_018456] 1.10 3.78E-02 A_24_P813520 full-length cDNA clone CS0DI005YB15 of Placenta Cot 25-normalized of Homo sapiens (human). [CR626222] 1.10 7.26E-03 A_24_P694738 Homo sapiens mRNA; cDNA DKFZp686B0328 (from clone DKFZp686B0328). [BX640887] 1.10 2.00E-02 A_23_P202720 Homo sapiens solute carrier family 35, member C1 (SLC35C1), mRNA [NM_018389] 1.10 2.32E-02 A_23_P109636 Homo sapiens leucine-rich repeats and immunoglobulin-like domains 1 (LRIG1), mRNA [NM_015541] 1.10 2.05E-02 A_32_P75425 Homo sapiens hypothetical LOC399744 (LOC399744), mRNA [NM_001013665] 1.10 3.83E-02 A_23_P167096 Homo sapiens vascular endothelial growth factor C (VEGFC), mRNA [NM_005429] 1.10 3.87E-02   136 Probe ID Gene Description Fold Change P-value A_24_P592544 Q5XI42 (Q5XI42) Fatty aldehyde dehydrogenase-like, partial (5%) [THC2399998] 1.10 3.14E-02 A_23_P26916 Homo sapiens histone deacetylase 5 (HDAC5), transcript variant 3, mRNA [NM_001015053] 1.10 1.04E-02 A_23_P89589 Homo sapiens period homolog 1 (Drosophila) (PER1), mRNA [NM_002616] 1.10 2.66E-02 A_23_P79122 Homo sapiens uncharacterized hematopoietic stem/progenitor cells protein MDS032 (MDS032), mRNA [NM_018467] 1.10 2.49E-02 A_23_P252145 Homo sapiens core 1 synthase, glycoprotein-N-acetylgalactosamine 3- beta-galactosyltransferase, 1 (C1GALT1), mRNA [NM_020156] 1.10 4.43E-02 A_23_P112512 Homo sapiens mitochondrial carrier triple repeat 1 (MCART1), mRNA [NM_033412] 1.10 4.17E-02 A_24_P233663 Homo sapiens PCTAIRE protein kinase 1 (PCTK1), transcript variant 2, mRNA [NM_033018] 1.10 3.89E-02 A_32_P61061 Homo sapiens peptidylprolyl isomerase A-like (LOC388817), mRNA [NM_001008741] 1.10 4.41E-02 A_32_P222695 Homo sapiens FLJ41603 protein (FLJ41603), mRNA [NM_001001669] 1.10 4.36E-02 A_23_P63281 Homo sapiens hypothetical protein MGC10334 (MGC10334), mRNA [NM_001029885] -1.10 2.12E-02 A_23_P14157 Homo sapiens DAZ interacting protein 1 (DZIP1), mRNA [NM_198968] -1.10 2.58E-02 A_23_P1676 full-length cDNA clone CS0DK012YH13 of HeLa cells Cot 25-normalized of Homo sapiens (human). [CR593246] -1.10 1.78E-02 A_23_P401380 Homo sapiens KIAA1463 protein (KIAA1463), mRNA [NM_173602] -1.10 1.71E-02 A_23_P2097 Homo sapiens tripartite motif-containing 68 (TRIM68), mRNA [NM_018073] -1.10 4.76E-02 A_24_P56484 Homo sapiens breast cancer metastasis-suppressor 1-like (BRMS1L), mRNA [NM_032352] -1.10 2.32E-02 A_32_P51119 Homo sapiens storkhead box 1 (STOX1), mRNA [NM_152709] -1.10 4.67E-02 A_23_P94911 Homo sapiens cDNA FLJ40856 fis, clone TRACH2016498, moderately similar to ZINC FINGER PROTEIN 184. [AK098175] -1.10 4.96E-02 A_23_P115375 Homo sapiens histone H3/o (H3/o), mRNA [NM_001005464] -1.10 2.03E-03 A_23_P94063 Homo sapiens truncated zinc finger protein 36 mRNA, complete cds. [AY260738] -1.10 4.43E-02 A_23_P396626 Homo sapiens AP1 gamma subunit binding protein 1 (AP1GBP1), transcript variant 1, mRNA [NM_007247] -1.10 1.00E-02 A_23_P136817 Homo sapiens kinetochore associated 1 (KNTC1), mRNA [NM_014708] -1.10 3.26E-02 A_23_P253375 Homo sapiens cut-like 1, CCAAT displacement protein (Drosophila) (CUTL1), transcript variant 2, mRNA [NM_001913] -1.10 4.12E-02 A_23_P250404 Homo sapiens RAD50 homolog (S. cerevisiae) (RAD50), transcript variant 1, mRNA [NM_005732] -1.10 4.21E-02 A_32_P99690 UI-E-CQ1-afy-b-13-0-UI.r1 UI-E-CQ1 Homo sapiens cDNA clone UI-E- CQ1-afy-b-13-0-UI 5', mRNA sequence [BM709498] -1.10 4.32E-02 A_23_P35684 Homo sapiens inositol polyphosphate-5-phosphatase F (INPP5F), transcript variant 1, mRNA [NM_014937] -1.10 6.71E-04 A_23_P118185 Homo sapiens peroxisomal lon protease (LONP), mRNA [NM_031490] -1.10 4.47E-02 A_23_P166609 Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 30 (DHX30), transcript variant 2, mRNA [NM_014966] -1.10 2.54E-02   137 Probe ID Gene Description Fold Change P-value A_23_P170337 Homo sapiens aldehyde dehydrogenase 4 family, member A1 (ALDH4A1), nuclear gene encoding mitochondrial protein, transcript variant P5CDhL, mRNA [NM_003748] -1.10 1.43E-02 A_24_P396105 Homo sapiens inositol hexaphosphate kinase 1 (IHPK1), transcript variant 1, mRNA [NM_153273] -1.10 7.97E-03 A_23_P163047 Homo sapiens chromosome 14 open reading frame 150 (C14orf150), transcript variant 1, mRNA [NM_001008726] -1.10 1.87E-02 A_23_P169112 Homo sapiens cleavage and polyadenylation specific factor 1, 160kDa (CPSF1), mRNA [NM_013291] -1.10 1.09E-02 A_23_P211797 Homo sapiens optic atrophy 1 (autosomal dominant) (OPA1), nuclear gene encoding mitochondrial protein, transcript variant 8, mRNA [NM_130837] -1.10 2.90E-02 A_24_P157165 Homo sapiens mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), transcript variant 2, mRNA [NM_145686] -1.10 4.60E-02 A_23_P164237 Homo sapiens chromosome 17 open reading frame 40 (C17orf40), mRNA [NM_018428] -1.10 6.21E-04 A_23_P216068 Homo sapiens ATPase family, AAA domain containing 2 (ATAD2), mRNA [NM_014109] -1.10 3.13E-02 A_23_P128650 Homo sapiens solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15), nuclear gene encoding mitochondrial protein, mRNA [NM_014252] -1.10 9.12E-03 A_23_P5742 Homo sapiens hypothetical protein FLJ13646 (FLJ13646), mRNA [NM_024584] -1.11 1.52E-02 A_24_P289845 full-length cDNA clone CS0DD008YI13 of Neuroblastoma Cot 50- normalized of Homo sapiens (human). [CR625571] -1.11 2.95E-02 A_23_P9086 Homo sapiens zinc finger, DHHC-type containing 2 (ZDHHC2), mRNA [NM_016353] -1.11 4.27E-03 A_24_P411749 Homo sapiens G protein-coupled receptor 126 (GPR126), mRNA [NM_198569] -1.11 2.44E-02 A_23_P306500 Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), transcript variant a, mRNA [NM_033360] -1.11 3.94E-02 A_23_P79587 Homo sapiens alkaline phosphatase, placental (Regan isozyme) (ALPP), mRNA [NM_001632] -1.11 3.27E-02 A_23_P155301 Homo sapiens NIMA (never in mitosis gene a)- related kinase 11 (NEK11), transcript variant 2, mRNA [NM_145910] -1.11 7.45E-03 A_23_P374389 Homo sapiens PWWP domain containing 2 (PWWP2), mRNA [NM_138499] -1.11 4.11E-02 A_23_P400235 Homo sapiens methylmalonyl Coenzyme A mutase (MUT), nuclear gene encoding mitochondrial protein, mRNA [NM_000255] -1.11 3.42E-02 A_23_P75038 Homo sapiens DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) (DCLRE1A), mRNA [NM_014881] -1.11 8.35E-03 A_23_P364478 Homo sapiens KIAA0157 (KIAA0157), mRNA [NM_032182] -1.11 1.40E-02 A_23_P26905 Homo sapiens polymerase (DNA directed), gamma 2, accessory subunit (POLG2), mRNA [NM_007215] -1.11 3.71E-02 A_23_P203344 Homo sapiens zinc finger protein 91 homolog (mouse) (ZFP91), transcript variant 1, mRNA [NM_053023] -1.11 6.59E-03 A_24_P112750 Homo sapiens transcription factor CP2 (TFCP2), mRNA [NM_005653] -1.11 2.97E-02 A_23_P38860 Q96GV2 (Q96GV2) XTP7, complete [THC2262919] -1.11 1.05E-02 A_23_P37347 Homo sapiens SKI interacting protein (SKIIP), mRNA [NM_012245] -1.11 2.50E-02   138 Probe ID Gene Description Fold Change P-value A_24_P830667 Homo sapiens ribosomal protein L21 (RPL21), mRNA [NM_000982] -1.11 2.11E-02 A_23_P34325 Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 2, mRNA [NM_033300] -1.11 3.64E-02 A_23_P501770 Homo sapiens three prime repair exonuclease 1 (TREX1), transcript variant 5, mRNA [NM_032166] -1.11 2.16E-02 A_23_P145053 Homo sapiens tubulin, epsilon 1 (TUBE1), mRNA [NM_016262] -1.11 7.58E-03 A_23_P143748 Homo sapiens KIAA0153 protein (KIAA0153), mRNA [NM_015140] -1.11 4.99E-02 A_23_P86632 Homo sapiens DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C), mRNA [NM_022487] -1.11 1.95E-02 A_23_P319423 Homo sapiens potassium channel, subfamily K, member 5 (KCNK5), mRNA [NM_003740] -1.11 1.28E-02 A_23_P251196  -1.11 1.92E-02 A_24_P305623 Homo sapiens transmembrane protein 50B (TMEM50B), mRNA [NM_006134] -1.11 2.23E-02 A_24_P291598 Homo sapiens ubiquitin specific protease 4 (proto-oncogene) (USP4), transcript variant 1, mRNA [NM_003363] -1.11 4.01E-02 A_23_P99405 Homo sapiens zinc finger protein 198 (ZNF198), mRNA [NM_003453] -1.11 1.90E-02 A_24_P11965 Homo sapiens Mof4 family associated protein 1 (MRFAP1), mRNA [NM_033296] -1.11 2.93E-02 A_24_P335358 Homo sapiens pseudouridylate synthase 1 (PUS1), transcript variant 1, mRNA [NM_025215] -1.11 1.95E-03 A_32_P1445 Homo sapiens protein tyrosine phosphatase, non-receptor type 2 (PTPN2), transcript variant 3, mRNA [NM_080423] -1.11 3.57E-02 A_23_P138137 Homo sapiens OMA1 homolog, zinc metallopeptidase (S. cerevisiae) (OMA1), mRNA [NM_145243] -1.11 2.20E-02 A_24_P37519 Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), mRNA [NM_020347] -1.11 1.23E-03 A_23_P258972 Homo sapiens golgi autoantigen, golgin subfamily a, 1 (GOLGA1), mRNA [NM_002077] -1.11 3.01E-02 A_24_P913339 Homo sapiens chromosome 2 open reading frame 18, mRNA (cDNA clone IMAGE:3860139), complete cds. [BC016389] -1.11 8.19E-03 A_24_P570583 Homo sapiens zinc finger protein 542 (ZNF542), mRNA [NM_194319] -1.11 2.03E-02 A_23_P502158 Homo sapiens a disintegrin and metalloproteinase domain 11 (ADAM11), transcript variant 1, mRNA [NM_002390] -1.11 4.85E-02 A_23_P258251 Homo sapiens cytosolic ovarian carcinoma antigen 1 (COVA1), transcript variant 2, mRNA [NM_182314] -1.11 6.98E-03 A_24_P693986 Homo sapiens hypothetical LOC388610 (LOC388610), mRNA [NM_001013642] -1.11 1.80E-02 A_23_P379327 Homo sapiens mRNA for KIAA1164 protein, partial cds. [AB032990] -1.11 4.04E-02 A_23_P109436 Homo sapiens adenosine A2a receptor (ADORA2A), mRNA [NM_000675] -1.11 2.04E-04 A_23_P59787 Homo sapiens LUC7-like 2 (S. cerevisiae) (LUC7L2), mRNA [NM_016019] -1.11 3.32E-02 A_23_P71591 Homo sapiens nucleolar protein 8 (NOL8), mRNA [NM_017948] -1.11 3.33E-03 A_23_P151471 Homo sapiens cullin 4A (CUL4A), transcript variant 1, mRNA [NM_001008895] -1.11 1.35E-02 A_23_P323751 Homo sapiens chromosome 20 open reading frame 129 (C20orf129), mRNA [NM_030919] -1.11 1.75E-02 A_23_P169934 Homo sapiens hypothetical protein FLJ39378 (FLJ39378), mRNA [NM_178314] -1.11 1.33E-02   139 Probe ID Gene Description Fold Change P-value A_23_P118327 Homo sapiens THUMP domain containing 1 (THUMPD1), mRNA [NM_017736] -1.11 1.81E-02 A_24_P156113 Homo sapiens EH-domain containing 2 (EHD2), mRNA [NM_014601] -1.11 3.39E-02 A_23_P211207 Homo sapiens adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) (ADARB1), transcript variant DRABA2b, mRNA [NM_015833] -1.11 4.43E-02 A_24_P912856  -1.11 6.49E-03 A_23_P257057 Homo sapiens mesenchymal stem cell protein DSCD75 (LOC51337), mRNA [NM_016647] -1.11 4.31E-03 A_23_P94795 Homo sapiens TEA domain family member 4 (TEAD4), transcript variant 1, mRNA [NM_003213] -1.11 2.97E-02 A_24_P58597  -1.11 1.22E-02 A_23_P156310 Homo sapiens S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2, mRNA [NM_032637] -1.11 3.53E-03 A_23_P75453 Homo sapiens multiple endocrine neoplasia I (MEN1), transcript variant e1E, mRNA [NM_130803] -1.11 3.73E-02 A_24_P47988 Homo sapiens elongation factor RNA polymerase II-like 3 (ELL3), mRNA [NM_025165] -1.11 3.78E-02 A_24_P304760 M2C1_HUMAN (Q9NTJ4) Alpha-mannosidase 2C1 (Alpha-D-mannoside mannohydrolase) (Mannosidase alpha class 2C member 1) (Alpha mannosidase 6A8B), partial (7%) [THC2372800] -1.11 1.15E-02 A_23_P120316 Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, mRNA [NM_006636] -1.11 3.12E-02 A_24_P220058 Homo sapiens microtubule-associated protein, RP/EB family, member 1 (MAPRE1), mRNA [NM_012325] -1.11 3.56E-02 A_23_P37785 Homo sapiens potassium channel tetramerisation domain containing 19, mRNA (cDNA clone IMAGE:5268205). [BC070103] -1.11 4.29E-02 A_23_P310911 Homo sapiens bleomycin hydrolase (BLMH), mRNA [NM_000386] -1.11 1.77E-02 A_23_P54230 Homo sapiens nuclear protein UKp68 (FLJ11806), transcript variant 2, mRNA [NM_207660] -1.12 1.30E-02 A_23_P30275 Homo sapiens hypothetical protein MGC3265 (MGC3265), mRNA [NM_024028] -1.12 4.57E-02 A_23_P353056 Homo sapiens transmembrane protein 24 (TMEM24), mRNA [NM_014807] -1.12 4.01E-02 A_23_P21785 Homo sapiens NOL1/NOP2/Sun domain family, member 3 (NSUN3), mRNA [NM_022072] -1.12 4.62E-02 A_23_P323743 Homo sapiens chromosome 15 open reading frame 20 (C15orf20), mRNA [NM_025049] -1.12 2.43E-02 A_24_P84970 PREDICTED: Homo sapiens similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) (LOC391819), mRNA [XM_498013] -1.12 4.20E-03 A_23_P46748 Homo sapiens conserved helix-loop-helix ubiquitous kinase (CHUK), mRNA [NM_001278] -1.12 4.39E-03 A_23_P129629 Homo sapiens metallothionein 3 (growth inhibitory factor (neurotrophic)) (MT3), mRNA [NM_005954] -1.12 4.60E-02 A_23_P155857 Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 2, mRNA [NM_198041] -1.12 4.24E-02 A_32_P459533 Homo sapiens FCH domain only 1 (FCHO1), mRNA [NM_015122] -1.12 1.93E-02 A_23_P42997 Homo sapiens cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), mRNA [NM_006693] -1.12 4.61E-02   140 Probe ID Gene Description Fold Change P-value A_23_P80902 Homo sapiens kinesin family member 15 (KIF15), mRNA [NM_020242] -1.12 1.40E-02 A_23_P104282 Homo sapiens chromosome 10 open reading frame 6 (C10orf6), mRNA [NM_018121] -1.12 2.79E-02 A_24_P167614 Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (DDX26), mRNA [NM_012141] -1.12 1.00E-02 A_24_P409881 PREDICTED: Homo sapiens similar to hypothetical protein (LOC338756), mRNA [XM_291989] -1.12 2.87E-02 A_23_P5550 Homo sapiens pumilio homolog 2 (Drosophila) (PUM2), mRNA [NM_015317] -1.12 1.62E-02 A_23_P67583 Homo sapiens BPY2 interacting protein 1 (BPY2IP1), mRNA [NM_018174] -1.12 4.01E-03 A_24_P388536 Homo sapiens hypothetical protein PRO2730 (PRO2730), mRNA [NM_025222] -1.12 4.75E-02 A_23_P386 Homo sapiens Rho guanine nucleotide exchange factor (GEF) 10-like (ARHGEF10L), transcript variant 1, mRNA [NM_018125] -1.12 3.87E-02 A_23_P66355 Homo sapiens integrin, beta 4 (ITGB4), transcript variant 1, mRNA [NM_000213] -1.12 4.41E-03 A_24_P248606 Homo sapiens acyl-CoA synthetase long-chain family member 3 (ACSL3), transcript variant 1, mRNA [NM_004457] -1.12 2.67E-02 A_23_P162807 Homo sapiens mitochondrial ribosomal protein S31 (MRPS31), nuclear gene encoding mitochondrial protein, mRNA [NM_005830] -1.12 2.67E-02 A_23_P66158 full-length cDNA clone CS0DI060YI16 of Placenta Cot 25-normalized of Homo sapiens (human). [CR625565] -1.12 3.12E-02 A_24_P379104 Homo sapiens pim-2 oncogene (PIM2), mRNA [NM_006875] -1.12 3.31E-02 A_23_P345820 Homo sapiens WD repeat and FYVE domain containing 3 (WDFY3), transcript variant 1, mRNA [NM_014991] -1.12 1.63E-02 A_23_P414884 Homo sapiens corticotropin releasing hormone receptor 1 (CRHR1), mRNA [NM_004382] -1.12 9.83E-03 A_24_P170874 Homo sapiens cDNA clone IMAGE:2960340. [BC013295] -1.12 1.30E-03 A_23_P122624 Homo sapiens chromosome 6 open reading frame 93 (C6orf93), mRNA [NM_032860] -1.12 1.14E-02 A_23_P325075 Homo sapiens RNA guanylyltransferase and 5'-phosphatase (RNGTT), mRNA [NM_003800] -1.12 2.32E-02 A_23_P395493 Homo sapiens cofilin pseudogene 1, mRNA (cDNA clone IMAGE:5168640). [BC031631] -1.12 4.58E-02 A_23_P207967 Homo sapiens KIAA0427 (KIAA0427), mRNA [NM_014772] -1.12 1.83E-02 A_24_P38081 Homo sapiens FK506 binding protein 5 (FKBP5), mRNA [NM_004117] -1.12 8.06E-03 A_32_P226700 Q6STG2 (Q6STG2) DNA polymerase-transactivated protein 3, partial (13%) [THC2438975] -1.12 1.08E-02 A_23_P107513 Homo sapiens chromosome 18 open reading frame 9 (C18orf9), mRNA [NM_024899] -1.12 1.55E-02 A_23_P99320 Homo sapiens keratin 18 (KRT18), transcript variant 1, mRNA [NM_000224] -1.12 3.35E-02 A_23_P345707 Homo sapiens leucine-rich repeat kinase 1 (MGC45866), mRNA [NM_152259] -1.12 8.74E-03 A_23_P70384 Homo sapiens ring finger protein 8 (RNF8), transcript variant 1, mRNA [NM_003958] -1.12 2.80E-02 A_23_P169358 Homo sapiens syntaxin 17 (STX17), mRNA [NM_017919] -1.12 1.23E-02 A_24_P205268 Homo sapiens KIAA0323 (KIAA0323), mRNA [NM_015299] -1.12 2.53E-02   141 Probe ID Gene Description Fold Change P-value A_23_P148121 Homo sapiens mRNA; cDNA DKFZp762C186 (from clone DKFZp762C186). [AL834433] -1.12 3.42E-02 A_23_P36860 Homo sapiens La ribonucleoprotein domain family, member 4 (LARP4), transcript variant 2, mRNA [NM_199188] -1.12 3.53E-02 A_23_P217968 Homo sapiens suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2, mRNA [NM_016028] -1.12 3.06E-02 A_23_P54605 Homo sapiens ribosomal L1 domain containing 1 (RSL1D1), mRNA [NM_015659] -1.12 8.68E-03 A_23_P327907 Homo sapiens chromosome 8 open reading frame 37 (C8orf37), mRNA [NM_177965] -1.12 4.29E-02 A_23_P82738 Homo sapiens RAD54 homolog B (S. cerevisiae) (RAD54B), transcript variant 1, mRNA [NM_012415] -1.12 4.15E-02 A_23_P31550 Homo sapiens cDNA FLJ11871 fis, clone HEMBA1007052. [AK021933] -1.12 1.56E-02 A_23_P92602 Homo sapiens cDNA FLJ14297 fis, clone PLACE1008941. [AK024359] -1.12 4.33E-02 A_24_P337104 Homo sapiens oxytocin receptor (OXTR), mRNA [NM_000916] -1.12 2.27E-02 A_23_P152919 Homo sapiens nucleoporin 88kDa (NUP88), mRNA [NM_002532] -1.12 2.35E-02 A_23_P4425 Homo sapiens flightless I homolog (Drosophila) (FLII), mRNA [NM_002018] -1.12 1.62E-02 A_24_P305541 Homo sapiens tribbles homolog 3 (Drosophila) (TRIB3), mRNA [NM_021158] -1.12 4.51E-02 A_24_P344307 Homo sapiens proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) (PSME3), transcript variant 2, mRNA [NM_176863] -1.12 9.27E-03 A_23_P102832 Homo sapiens centrosomal protein 2 (CEP2), mRNA [NM_007186] -1.12 5.00E-02 A_32_P74477  -1.13 2.66E-02 A_23_P366468  -1.13 1.11E-02 A_24_P202567 Homo sapiens inositol 1,4,5-trisphosphate 3-kinase C (ITPKC), mRNA [NM_025194] -1.13 1.09E-02 A_24_P237766 Homo sapiens SEC14-like 1 (S. cerevisiae) (SEC14L1), mRNA [NM_003003] -1.13 3.79E-02 A_32_P24965 Homo sapiens zinc finger, FYVE domain containing 26 (ZFYVE26), mRNA [NM_015346] -1.13 2.47E-02 A_23_P408768 Homo sapiens DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L), mRNA [NM_032482] -1.13 3.13E-02 A_24_P381945 Homo sapiens heme oxygenase (decycling) 2 (HMOX2), mRNA [NM_002134] -1.13 3.16E-02 A_24_P229658 PREDICTED: Homo sapiens similar to hypothetical protein (LOC391804), mRNA [XM_498008] -1.13 3.14E-02 A_24_P98613 Homo sapiens tetraspanin 14 (TSPAN14), mRNA [NM_030927] -1.13 2.30E-02 A_24_P50543 Homo sapiens, clone IMAGE:5277162, mRNA. [BC031266] -1.13 3.12E-02 A_32_P68408 Homo sapiens, clone IMAGE:5166482, mRNA, partial cds. [BC028192] -1.13 3.92E-02 A_24_P115007 Homo sapiens aldehyde dehydrogenase 5 family, member A1 (succinate-semialdehyde dehydrogenase) (ALDH5A1), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_170740] -1.13 4.03E-02 A_23_P157600 Homo sapiens DDHD domain containing 2 (DDHD2), mRNA [NM_015214] -1.13 1.92E-02 A_23_P253524 Homo sapiens centromere protein E, 312kDa (CENPE), mRNA [NM_001813] -1.13 9.71E-03   142 Probe ID Gene Description Fold Change P-value A_23_P38115 Homo sapiens hypothetical protein FLJ20291 (FLJ20291), mRNA [NM_017748] -1.13 2.47E-02 A_23_P161091 Homo sapiens zinc finger, MYM domain containing 1 (ZMYM1), mRNA [NM_024772] -1.13 2.87E-02 A_24_P278460 Homo sapiens male sterility domain containing 2 (MLSTD2), mRNA [NM_032228] -1.13 1.89E-03 A_24_P7157 Homo sapiens family with sequence similarity 80, member B (FAM80B), mRNA [NM_020734] -1.13 8.10E-03 A_23_P431981 Homo sapiens high-mobility group protein 2-like 1 (HMG2L1), transcript variant 1, mRNA [NM_005487] -1.13 9.46E-03 A_24_P413470 Homo sapiens tumor protein p73 (TP73), mRNA [NM_005427] -1.13 3.44E-02 A_23_P386942 Homo sapiens DIRAS family, GTP-binding RAS-like 1 (DIRAS1), mRNA [NM_145173] -1.13 1.65E-02 A_23_P380815 Homo sapiens KIAA1279 (KIAA1279), mRNA [NM_015634] -1.13 2.76E-02 A_23_P17444 BG680979 602628792F1 NCI_CGAP_Skn4 Homo sapiens cDNA clone IMAGE:4753583 5', mRNA sequence [BG680979] -1.13 2.72E-02 A_32_P217510 Homo sapiens WD repeat domain 75 (WDR75), mRNA [NM_032168] -1.13 3.68E-02 A_23_P502078 Homo sapiens mitogen-activated protein kinase 8 interacting protein 2 (MAPK8IP2), transcript variant 1, mRNA [NM_012324] -1.13 4.79E-02 A_24_P264644 PREDICTED: Homo sapiens similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) (LOC345430), mRNA [XM_498024] -1.13 4.88E-02 A_24_P195400  -1.13 2.99E-02 A_24_P472455 Homo sapiens mRNA; cDNA DKFZp564M0264 (from clone DKFZp564M0264). [AL117621] -1.13 4.14E-02 A_23_P398073 Homo sapiens protein phosphatase 1B (formerly 2C), magnesium- dependent, beta isoform (PPM1B), transcript variant 2, mRNA [NM_177968] -1.13 2.05E-02 A_23_P334630 Homo sapiens jerky homolog (mouse) (JRK), mRNA [NM_003724] -1.13 6.33E-03 A_24_P942002 Homo sapiens centaurin, beta 2 (CENTB2), mRNA [NM_012287] -1.13 3.72E-02 A_24_P225468 Homo sapiens acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (ANP32E), mRNA [NM_030920] -1.13 1.88E-02 A_23_P104555 Homo sapiens ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), mRNA [NM_020349] -1.13 2.59E-02 A_23_P153676 Homo sapiens transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) (TLE2), mRNA [NM_003260] -1.13 6.77E-03 A_23_P368205 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type I, alpha (PIP5K1A), mRNA [NM_003557] -1.13 2.70E-02 A_24_P415260 Homo sapiens cDNA FLJ36123 fis, clone TESTI2022874, weakly similar to ZINC FINGER PROTEIN 135. [AK093442] -1.13 3.92E-02 A_24_P281443  -1.13 6.33E-03 A_24_P377328 Homo sapiens step II splicing factor SLU7 (SLU7), mRNA [NM_006425] -1.13 4.79E-02 A_24_P35478 Homo sapiens par-3 partitioning defective 3 homolog (C. elegans) (PARD3), mRNA [NM_019619] -1.13 4.86E-02 A_24_P933418 Homo sapiens cDNA FLJ30301 fis, clone BRACE2003217. [AK054863] -1.13 7.69E-03 A_23_P358470 Homo sapiens hypothetical protein FLJ33167 (FLJ33167), mRNA [NM_152683] -1.13 1.34E-02 A_23_P319583 Homo sapiens regulating synaptic membrane exocytosis 3 (RIMS3), mRNA [NM_014747] -1.13 4.02E-02   143 Probe ID Gene Description Fold Change P-value A_23_P117734 Homo sapiens hypothetical protein FLJ33008 (FLJ33008), mRNA [NM_152449] -1.13 3.26E-02 A_24_P204358 Homo sapiens pyrroline-5-carboxylate reductase 1 (PYCR1), transcript variant 2, mRNA [NM_153824] -1.13 4.42E-02 A_23_P101796 Homo sapiens synapse defective 1, Rho GTPase, homolog 1 (C. elegans) (SYDE1), mRNA [NM_033025] -1.13 2.55E-02 A_23_P34176 Homo sapiens KIAA1280 protein (KIAA1280), mRNA [NM_015691] -1.13 1.79E-02 A_23_P154500 Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 1, mRNA [NM_175629] -1.13 2.97E-02 A_24_P210577 Homo sapiens modulator of estrogen induced transcription (FLJ13213), transcript variant 1, mRNA [NM_024755] -1.13 2.17E-02 A_24_P922877 Homo sapiens kinesin light chain mRNA, complete cds. [L04733] -1.13 1.10E-02 A_24_P218979 Homo sapiens cell division cycle associated 3 (CDCA3), mRNA [NM_031299] -1.13 3.53E-02 A_23_P138465 Homo sapiens nucleolar and coiled-body phosphoprotein 1 (NOLC1), mRNA [NM_004741] -1.13 3.73E-02 A_23_P102925 Homo sapiens PWP2 periodic tryptophan protein homolog (yeast) (PWP2H), mRNA [NM_005049] -1.13 3.22E-02 A_24_P114339 full-length cDNA clone CS0DF020YB09 of Fetal brain of Homo sapiens (human). [CR604908] -1.14 2.49E-02 A_23_P358957 Homo sapiens calcium/calmodulin-dependent protein kinase kinase 2, beta (CAMKK2), transcript variant 1, mRNA [NM_006549] -1.14 2.73E-02 A_32_P319880 Homo sapiens KIAA1530 protein (KIAA1530), mRNA [NM_020894] -1.14 3.33E-02 A_23_P54720 Homo sapiens hypothetical protein LOC201725 (LOC201725), mRNA [NM_001008393] -1.14 2.63E-02 A_24_P242609 Homo sapiens kelch-like 12 (Drosophila) (KLHL12), mRNA [NM_021633] -1.14 3.95E-02 A_23_P9768 Homo sapiens LYST-interacting protein LIP8 (LIP8), mRNA [NM_053051] -1.14 3.94E-03 A_32_P231391 Homo sapiens lactate dehydrogenase A (LDHA), mRNA [NM_005566] -1.14 3.27E-02 A_24_P645914 Homo sapiens cDNA: FLJ22256 fis, clone HRC02860. [AK025909] -1.14 3.06E-02 A_24_P220921 Homo sapiens calmodulin binding transcription activator 1 (CAMTA1), mRNA [NM_015215] -1.14 3.15E-02 A_24_P538708 Homo sapiens cDNA FLJ42269 fis, clone TKIDN2015285. [AK124263] -1.14 4.41E-02 A_23_P501961 Homo sapiens l(3)mbt-like (Drosophila) (L3MBTL), transcript variant II, mRNA [NM_032107] -1.14 4.28E-02 A_32_P106944 Homo sapiens zinc finger protein 429 (ZNF429), mRNA [NM_001001415] -1.14 2.16E-02 A_23_P163458 Homo sapiens EH-domain containing 4 (EHD4), mRNA [NM_139265] -1.14 2.48E-02 A_23_P424269 Homo sapiens chromosome 9 open reading frame 102 (C9orf102), mRNA [NM_020207] -1.14 3.88E-02 A_23_P9426 Homo sapiens golgi autoantigen, golgin subfamily a, 2 (GOLGA2), mRNA [NM_004486] -1.14 4.65E-02 A_23_P51051 Homo sapiens zinc finger protein 142 (clone pHZ-49) (ZNF142), mRNA [NM_005081] -1.14 2.63E-02 A_24_P118271  -1.14 1.85E-02 A_24_P412238 Homo sapiens MUS81 endonuclease homolog (yeast) (MUS81), mRNA [NM_025128] -1.14 1.49E-02 A_23_P86731 Homo sapiens zinc finger protein 239 (ZNF239), mRNA [NM_005674] -1.14 2.83E-02 A_23_P130182 Homo sapiens aurora kinase B (AURKB), mRNA [NM_004217] -1.14 3.90E-04 A_24_P942328 Homo sapiens dihydrofolate reductase (DHFR), mRNA [NM_000791] -1.14 3.07E-02   144 Probe ID Gene Description Fold Change P-value A_23_P396194 Homo sapiens ring finger and WD repeat domain 2 (RFWD2), transcript variant 1, mRNA [NM_022457] -1.14 4.42E-02 A_23_P80342 Homo sapiens mitogen-activated protein kinase kinase kinase 7 interacting protein 1 (MAP3K7IP1), transcript variant alpha, mRNA [NM_006116] -1.14 2.77E-02 A_23_P17204 Homo sapiens anaphase promoting complex subunit 1 (ANAPC1), mRNA [NM_022662] -1.14 1.06E-03 A_24_P310630 Homo sapiens UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B), transcript variant 1, mRNA [NM_080632] -1.14 1.13E-02 A_24_P195164  -1.14 7.13E-03 A_23_P78372 Homo sapiens THO complex 1 (THOC1), mRNA [NM_005131] -1.14 3.17E-02 A_23_P170399 Homo sapiens FLJ12716 protein (FLJ12716), transcript variant 1, mRNA [NM_021942] -1.14 5.69E-03 A_24_P338757 Homo sapiens chromosome 13 open reading frame 22 (C13orf22), mRNA [NM_005800] -1.14 4.72E-02 A_23_P154070 Homo sapiens tubulin, alpha 1 (testis specific) (TUBA1), mRNA [NM_006000] -1.14 3.22E-02 A_23_P127522 Homo sapiens hydrolethalus syndrome 1 (HYLS1), mRNA [NM_145014] -1.14 3.20E-02 A_24_P101114 Homo sapiens CCR4-NOT transcription complex, subunit 1 (CNOT1), transcript variant 2, mRNA [NM_206999] -1.14 1.80E-02 A_23_P89509 Homo sapiens sperm associated antigen 5 (SPAG5), mRNA [NM_006461] -1.14 3.29E-02 A_23_P210074 Homo sapiens zinc finger protein 514 (ZNF514), mRNA [NM_032788] -1.14 2.96E-04 A_23_P74115 Homo sapiens RAD54-like (S. cerevisiae) (RAD54L), mRNA [NM_003579] -1.14 5.65E-03 A_24_P288890 Homo sapiens hypothetical protein LOC144347 (LOC144347), mRNA [NM_181709] -1.14 3.50E-02 A_23_P80062 Homo sapiens TAF4 RNA polymerase II, TATA box binding protein (TBP)- associated factor, 135kDa (TAF4), mRNA [NM_003185] -1.14 4.32E-02 A_24_P6135 Homo sapiens l(3)mbt-like 2 (Drosophila) (L3MBTL2), transcript variant 2, mRNA [NM_001003689] -1.14 3.52E-02 A_24_P234415 Homo sapiens SH3 and cysteine rich domain (STAC), mRNA [NM_003149] -1.14 3.82E-02 A_23_P35114 Homo sapiens CK2 interacting protein 1; HQ0024c protein (CKIP-1), mRNA [NM_016274] -1.14 4.34E-02 A_24_P272313 Homo sapiens similar to 2010300C02Rik protein (MGC42367), mRNA [NM_207362] -1.15 2.93E-02 A_24_P696507 Homo sapiens cDNA FLJ35491 fis, clone SMINT2008625, moderately similar to GLYCINE CLEAVAGE SYSTEM H PROTEIN PRECURSOR. [AK092810] -1.15 1.59E-02 A_32_P178966  -1.15 4.34E-02 A_23_P43764 Homo sapiens mitofusin 1 (MFN1), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_033540] -1.15 3.72E-02 A_24_P111912 Homo sapiens hypothetical protein DKFZp564D172 (DKFZP564D172), mRNA [NM_032042] -1.15 2.86E-02 A_23_P73457 Homo sapiens RUN and FYVE domain containing 1 (RUFY1), mRNA [NM_025158] -1.15 1.65E-02 A_23_P2831 Homo sapiens endothelin receptor type B (EDNRB), transcript variant 2, mRNA [NM_003991] -1.15 2.99E-02 A_23_P65230 Homo sapiens hypothetical protein FLJ14624 (FLJ14624), mRNA [NM_032813] -1.15 2.92E-03   145 Probe ID Gene Description Fold Change P-value A_23_P140562 Homo sapiens proto-oncogene 8 (HCC-8), mRNA [NM_022905] -1.15 2.50E-02 A_32_P163469 Homo sapiens mRNA; cDNA DKFZp686K2237 (from clone DKFZp686K2237). [AL833530] -1.15 3.87E-02 A_24_P270376 Homo sapiens nuclear fragile X mental retardation protein interacting protein 1 (NUFIP1), mRNA [NM_012345] -1.15 3.06E-02 A_23_P90211 Homo sapiens interferon regulatory factor 2 binding protein 1 (IRF2BP1), mRNA [NM_015649] -1.15 3.14E-02 A_23_P92213 Homo sapiens abhydrolase domain containing 10 (ABHD10), mRNA [NM_018394] -1.15 3.99E-02 A_24_P25872 Homo sapiens DEP domain containing 1 (DEPDC1), mRNA [NM_017779] -1.15 6.30E-03 A_23_P32165 Homo sapiens LIM homeobox 2 (LHX2), mRNA [NM_004789] -1.15 1.87E-02 A_23_P108376 Homo sapiens thyroid adenoma associated (THADA), transcript variant 1, mRNA [NM_022065] -1.15 4.94E-02 A_24_P222835 Homo sapiens S100P binding protein Riken (S100PBPR), transcript variant 2, mRNA [NM_001017406] -1.15 2.52E-02 A_23_P9513 Homo sapiens metastasis associated 1 (MTA1), mRNA [NM_004689] -1.15 4.80E-02 A_23_P411922 Homo sapiens Huntingtin interacting protein C (HYPC), mRNA [NM_012272] -1.15 4.77E-02 A_23_P398515 Homo sapiens protein kinase, membrane associated tyrosine/threonine 1 (PKMYT1), transcript variant 1, mRNA [NM_004203] -1.15 1.24E-02 A_24_P24645 PREDICTED: Homo sapiens similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) (LOC132391), mRNA [XM_497978] -1.15 1.47E-02 A_24_P548297 Homo sapiens full length insert cDNA clone ZB55F04. [AF086154] -1.15 4.83E-02 A_23_P70249 Homo sapiens cell division cycle 25C (CDC25C), transcript variant 1, mRNA [NM_001790] -1.15 1.33E-02 A_24_P187448  -1.15 4.57E-02 A_23_P128060 Homo sapiens zinc finger protein 26 (KOX 20) (ZNF26), mRNA [NM_019591] -1.15 2.30E-02 A_24_P221724  -1.15 4.77E-03 A_24_P226949 Homo sapiens family with sequence similarity 29, member A (FAM29A), mRNA [NM_017645] -1.15 3.19E-02 A_24_P117672 Homo sapiens serine arginine-rich pre-mRNA splicing factor SR-A1 (SR- A1), mRNA [NM_021228] -1.15 2.90E-02 A_23_P35219 Homo sapiens NIMA (never in mitosis gene a)-related kinase 2 (NEK2), mRNA [NM_002497] -1.15 3.49E-02 A_23_P21706 Homo sapiens CTP synthase (CTPS), mRNA [NM_001905] -1.15 3.59E-02 A_23_P161628 Homo sapiens MUS81 endonuclease homolog (yeast) (MUS81), mRNA [NM_025128] -1.15 4.75E-02 A_23_P39336 Homo sapiens FK506 binding protein 8, 38kDa (FKBP8), mRNA [NM_012181] -1.15 4.44E-03 A_23_P90612 Homo sapiens MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) (MCM6), mRNA [NM_005915] -1.15 1.75E-02 A_23_P404211 Homo sapiens mRNA for KIAA1596 protein, partial cds. [AB046816] -1.15 1.97E-02 A_24_P6850  -1.15 2.32E-02 A_23_P24244 Homo sapiens cDNA FLJ20360 fis, clone HEP16677. [AK000367] -1.16 1.11E-02 A_24_P942945 Homo sapiens G protein-coupled receptor 126 (GPR126), mRNA [NM_198569] -1.16 6.41E-03 A_24_P16230  -1.16 2.25E-02   146 Probe ID Gene Description Fold Change P-value A_23_P146526 Homo sapiens SMC5 structural maintenance of chromosomes 5-like 1 (yeast) (SMC5L1), mRNA [NM_015110] -1.16 2.81E-03 A_24_P306704  -1.16 7.56E-04 A_23_P17593 Homo sapiens cadherin 4, type 1, R-cadherin (retinal) (CDH4), mRNA [NM_001794] -1.16 8.54E-03 A_23_P388812 Homo sapiens hypothetical protein FLJ40629 (FLJ40629), mRNA [NM_152515] -1.16 3.43E-02 A_23_P259797 Homo sapiens hypothetical protein LOC197322 (LOC197322), mRNA [NM_174917] -1.16 3.92E-02 A_23_P212844 Homo sapiens transforming, acidic coiled-coil containing protein 3 (TACC3), mRNA [NM_006342] -1.16 4.49E-02 A_24_P203630 Homo sapiens protein immuno-reactive with anti-PTH polyclonal antibodies (LOC400986), mRNA [NM_001010914] -1.16 3.43E-02 A_23_P96325 Homo sapiens FLJ20105 protein (FLJ20105), transcript variant 2, mRNA [NM_001009954] -1.16 1.04E-02 A_23_P43071 Homo sapiens MTERF domain containing 1 (MTERFD1), mRNA [NM_015942] -1.16 4.66E-02 A_24_P796274  -1.16 2.69E-02 A_23_P112798 Homo sapiens cysteine-rich protein 2 (CRIP2), mRNA [NM_001312] -1.16 3.47E-02 A_23_P109122 Homo sapiens mRNA for KIAA1442 protein, partial cds. [AB037863] -1.16 2.64E-02 A_23_P115313 Homo sapiens torsin family 3, member A (TOR3A), mRNA [NM_022371] -1.16 4.65E-02 A_32_P24382 Homo sapiens keratin associated protein 2-4, mRNA (cDNA clone MGC:74790 IMAGE:3907481), complete cds. [BC063625] -1.16 7.93E-03 A_24_P323664 PREDICTED: Homo sapiens similar to Transcription factor BTF3 homolog 3 (LOC132556), mRNA [XM_067904] -1.16 1.95E-02 A_24_P396327 Homo sapiens chromosome 1 open reading frame 171 (C1orf171), mRNA [NM_138467] -1.16 1.56E-02 A_23_P150919 Homo sapiens cDNA FLJ14466 fis, clone MAMMA1000416. [AK027372] -1.16 2.79E-02 A_24_P15803  -1.16 4.18E-02 A_24_P926125 Homo sapiens similar to protein phosphatase 2A 48 kDa regulatory subunit isoform 1; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit; PP2A, subunit B, PR48 isoform; PP2A B subunit PR48; NY-REN-8 antigen, mRNA (cDNA clone... -1.16 3.72E-02 A_23_P502915 Homo sapiens WD repeat domain 1 (WDR1), transcript variant 1, mRNA [NM_017491] -1.16 1.30E-02 A_23_P101246 Homo sapiens, clone IMAGE:4401841, mRNA. [BC016993] -1.16 4.19E-02 A_23_P124417 Homo sapiens BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) (BUB1), mRNA [NM_004336] -1.16 1.03E-02 A_23_P163858 Homo sapiens zinc and ring finger 1 (ZNRF1), mRNA [NM_032268] -1.16 9.29E-03 A_32_P27917 Homo sapiens kinesin family member 26A, mRNA (cDNA clone MGC:14884 IMAGE:3502885), complete cds. [BC009415] -1.16 4.74E-02 A_23_P162466 Homo sapiens plakophilin 2 (PKP2), transcript variant 2b, mRNA [NM_004572] -1.16 4.70E-02 A_23_P67399 Homo sapiens striatin, calmodulin binding protein 4 (STRN4), mRNA [NM_013403] -1.16 6.58E-03 A_24_P153003  -1.16 2.04E-02 A_23_P30495 Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), mRNA [NM_000859] -1.16 5.18E-03   147 Probe ID Gene Description Fold Change P-value A_23_P371129 Homo sapiens BTB (POZ) domain containing 12 (BTBD12), mRNA [NM_032444] -1.16 1.56E-02 A_24_P181944 Homo sapiens PHD finger protein 20 (PHF20), mRNA [NM_016436] -1.16 2.91E-02 A_24_P93798 Homo sapiens RIO kinase 1 (yeast) (RIOK1), transcript variant 1, mRNA [NM_031480] -1.16 2.32E-02 A_23_P67127 Homo sapiens hypothetical protein FLJ90805 (FLJ90805), mRNA [NM_173633] -1.16 3.52E-02 A_24_P161809  -1.16 1.42E-02 A_23_P61268 Homo sapiens brain protein 16 (LOC51236), mRNA [NM_016458] -1.16 3.10E-02 A_24_P186746  -1.16 1.85E-02 A_24_P256063  -1.17 6.61E-03 A_23_P134454 Homo sapiens caveolin 1, caveolae protein, 22kDa (CAV1), mRNA [NM_001753] -1.17 3.78E-02 A_23_P385861 Homo sapiens cell division cycle associated 2 (CDCA2), mRNA [NM_152562] -1.17 4.61E-02 A_23_P128641 Homo sapiens chromosome 13 open reading frame 22 (C13orf22), mRNA [NM_005800] -1.17 1.22E-02 A_24_P929974  -1.17 3.50E-02 A_23_P52219 Homo sapiens SPFH domain family, member 1 (SPFH1), mRNA [NM_006459] -1.17 2.85E-02 A_24_P392842  -1.17 2.51E-02 A_23_P122775 Homo sapiens reticulon 4 interacting protein 1 (RTN4IP1), nuclear gene encoding mitochondrial protein, mRNA [NM_032730] -1.17 2.89E-02 A_23_P428326 Homo sapiens cDNA FLJ20748 fis, clone HEP05772. [AK000755] -1.17 4.24E-02 A_24_P331704 Homo sapiens hypothetical protein LOC144501 (LOC144501), mRNA [NM_182507] -1.17 3.58E-02 A_23_P55682 Homo sapiens zinc finger protein 447 (ZNF447), mRNA [NM_023926] -1.17 3.17E-02 A_23_P79794 Homo sapiens TGFB-induced factor 2 (TALE family homeobox) (TGIF2), mRNA [NM_021809] -1.17 2.76E-02 A_24_P161733  -1.17 4.21E-02 A_32_P6274  -1.17 8.40E-03 A_24_P350136  -1.17 2.91E-02 A_23_P90333 PREDICTED: Homo sapiens zinc finger protein 404 (ZNF404), mRNA [XM_292765] -1.17 1.08E-02 A_23_P63402 Homo sapiens G-protein signalling modulator 2 (AGS3-like, C. elegans) (GPSM2), mRNA [NM_013296] -1.17 1.87E-02 A_23_P98015 Homo sapiens cutC copper transporter homolog (E.coli) (CUTC), mRNA [NM_015960] -1.17 1.56E-02 A_23_P416468 Homo sapiens DNA helicase homolog (PIF1) mRNA, partial cds. [AF108138] -1.17 3.01E-02 A_24_P89887 Homo sapiens chromosome 9 open reading frame 3 (C9orf3), mRNA [NM_032823] -1.17 1.83E-02 A_23_P82000 Homo sapiens TEA domain family member 3 (TEAD3), mRNA [NM_003214] -1.17 3.56E-02 A_24_P69691 Homo sapiens zinc finger protein 25 (KOX 19) (ZNF25), mRNA [NM_145011] -1.17 3.46E-02 A_32_P125820  -1.17 2.01E-02 A_24_P551028 Homo sapiens hypothetical protein LOC339745 (LOC339745), mRNA [NM_001001664] -1.17 1.55E-02   148 Probe ID Gene Description Fold Change P-value A_24_P12626 Homo sapiens caveolin 1, caveolae protein, 22kDa (CAV1), mRNA [NM_001753] -1.17 4.94E-02 A_24_P375360  -1.18 1.13E-02 A_23_P88194 Homo sapiens survival of motor neuron protein interacting protein 1 (SIP1), transcript variant alpha, mRNA [NM_003616] -1.18 1.55E-03 A_24_P418687  -1.18 2.70E-02 A_23_P259090 Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 12 (NUDT12), mRNA [NM_031438] -1.18 2.45E-02 A_32_P109522 Homo sapiens chromosome 6 open reading frame 113 (C6orf113), mRNA [NM_145062] -1.18 3.90E-02 A_23_P390384 Homo sapiens, clone IMAGE:5259432, mRNA. [BC037316] -1.18 4.48E-02 A_24_P584463  -1.18 1.02E-02 A_23_P104705 Homo sapiens solute carrier family 29 (nucleoside transporters), member 2 (SLC29A2), mRNA [NM_001532] -1.18 2.77E-02 A_23_P250564 Homo sapiens protein kinase C, epsilon (PRKCE), mRNA [NM_005400] -1.18 3.73E-02 A_24_P222997 Homo sapiens zinc finger, RAN-binding domain containing 3 (ZRANB3), mRNA [NM_032143] -1.18 2.35E-02 A_23_P373708 Homo sapiens hypothetical protein FLJ40504 (FLJ40504), mRNA [NM_173624] -1.18 3.17E-02 A_24_P876772 Homo sapiens cDNA clone MGC:40288 IMAGE:5169056, complete cds. [BC032332] -1.18 1.79E-02 A_23_P217120 Homo sapiens euchromatic histone-lysine N-methyltransferase 1 (EHMT1), mRNA [NM_024757] -1.18 5.80E-03 A_24_P317835 Homo sapiens inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), mRNA [NM_019892] -1.18 4.37E-02 A_23_P58321 Homo sapiens cyclin A2 (CCNA2), mRNA [NM_001237] -1.18 6.84E-04 A_24_P792988  -1.18 3.94E-03 A_24_P493116  -1.18 4.86E-02 A_24_P477102 PREDICTED: Homo sapiens similar to FLJ10101 protein (LOC284269), mRNA [XM_209097] -1.18 1.47E-02 A_24_P145316 Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 2, mRNA [NM_183040] -1.18 4.61E-02 A_23_P98884 Homo sapiens ring finger protein 41 (RNF41), transcript variant 2, mRNA [NM_194358] -1.18 3.34E-02 A_24_P103886 Homo sapiens isopentenyl-diphosphate delta isomerase 1 (IDI1), mRNA [NM_004508] -1.18 2.37E-02 A_32_P733356 Homo sapiens cDNA: FLJ22714 fis, clone HSI13646. [AK026367] -1.18 2.68E-02 A_24_P401601  -1.18 1.78E-02 A_24_P264549  -1.18 5.96E-03 A_24_P179467 Homo sapiens solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 (SLC1A6), mRNA [NM_005071] -1.18 1.95E-02 A_24_P176493 Homo sapiens ATM/ATR-Substrate Chk2-Interacting Zn2+-finger protein (ASCIZ), mRNA [NM_015251] -1.18 4.50E-02 A_32_P28685 Homo sapiens small nuclear ribonucleoprotein polypeptide A' (SNRPA1), mRNA [NM_003090] -1.18 6.50E-04 A_23_P20683 Homo sapiens KIAA0020 (KIAA0020), mRNA [NM_014878] -1.18 4.77E-02 A_24_P754086 Homo sapiens nucleolin (NCL), mRNA [NM_005381] -1.18 2.11E-02 A_23_P317800 Homo sapiens anaphase promoting complex subunit 4 (ANAPC4), mRNA [NM_013367] -1.18 2.84E-02   149 Probe ID Gene Description Fold Change P-value A_23_P35617 Homo sapiens phospholipase C, epsilon 1 (PLCE1), mRNA [NM_016341] -1.19 9.38E-04 A_24_P83678 Homo sapiens chromosome 6 open reading frame 167 (C6orf167), mRNA [NM_198468] -1.19 3.35E-02 A_24_P281374 PREDICTED: Homo sapiens similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) (LOC442406), mRNA [XM_498307] -1.19 5.29E-03 A_32_P718498 Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (MLLT6), mRNA [NM_005937] -1.19 4.33E-02 A_32_P89709 Homo sapiens tropomyosin 1 (alpha) (TPM1), transcript variant 3, mRNA [NM_001018004] -1.19 4.70E-02 A_24_P478726 Homo sapiens similar to RIKEN cDNA 2210021J22, mRNA (cDNA clone MGC:87534 IMAGE:30338205), complete cds. [BC067871] -1.19 3.36E-03 A_23_P415443 Homo sapiens barren homolog (Drosophila) (BRRN1), mRNA [NM_015341] -1.19 4.96E-02 A_23_P214156 Homo sapiens SUMO1/sentrin specific protease 6 (SENP6), mRNA [NM_015571] -1.19 2.00E-02 A_32_P97169 Homo sapiens mRNA; cDNA DKFZp686H20120 (from clone DKFZp686H20120). [BX640888] -1.19 2.25E-02 A_24_P419132 Homo sapiens FSH primary response (LRPR1 homolog, rat) 1 (FSHPRH1), mRNA [NM_006733] -1.19 1.51E-02 A_24_P109661  -1.19 4.38E-02 A_23_P77993 Homo sapiens complement component 1, q subcomponent-like 1 (C1QL1), mRNA [NM_006688] -1.19 4.04E-02 A_24_P34505 Homo sapiens hypothetical LOC79954 (FLJ14075), mRNA [NM_024894] -1.19 2.49E-03 A_24_P42136 Homo sapiens keratin 18 (KRT18), transcript variant 1, mRNA [NM_000224] -1.19 3.33E-02 A_23_P413803 Homo sapiens hypothetical protein FLJ35779 (FLJ35779), mRNA [NM_152408] -1.19 1.20E-02 A_24_P99090 Homo sapiens cytoskeleton associated protein 2 (CKAP2), mRNA [NM_018204] -1.19 4.90E-02 A_23_P211212 Homo sapiens collagen, type XVIII, alpha 1 (COL18A1), transcript variant 1, mRNA [NM_030582] -1.19 9.64E-03 A_23_P163148 Homo sapiens chromosome 14 open reading frame 133 (C14orf133), mRNA [NM_022067] -1.19 5.86E-04 A_23_P41327 Homo sapiens hypothetical protein FLJ20425 (LYAR), mRNA [NM_017816] -1.19 4.07E-02 A_32_P62769 Homo sapiens cDNA FLJ34465 fis, clone HLUNG2003061. [AK091784] -1.19 2.60E-02 A_23_P14072 Homo sapiens keratin 8 (KRT8), mRNA [NM_002273] -1.19 4.92E-03 A_24_P92744  -1.19 4.90E-02 A_24_P247454  -1.19 4.13E-02 A_23_P356484 Homo sapiens ribosomal protein S10 (RPS10), mRNA [NM_001014] -1.19 3.42E-02 A_23_P210581 Homo sapiens potassium voltage-gated channel, subfamily G, member 1 (KCNG1), transcript variant 1, mRNA [NM_002237] -1.20 3.13E-02 A_23_P104651 Homo sapiens cell division cycle associated 5 (CDCA5), mRNA [NM_080668] -1.20 1.93E-02 A_32_P96036 Q69Z36 (Q69Z36) MKIAA2009 protein (Fragment), partial (8%) [THC2430293] -1.20 2.66E-02 A_23_P40059 Homo sapiens PMS1 postmeiotic segregation increased 1 (S. cerevisiae) (PMS1), mRNA [NM_000534] -1.20 8.85E-04 A_23_P77321 Homo sapiens KIAA0252 (KIAA0252), mRNA [NM_015138] -1.20 3.38E-02   150 Probe ID Gene Description Fold Change P-value A_23_P351232 Homo sapiens hypothetical protein MGC33584 (MGC33584), mRNA [NM_173680] -1.20 4.53E-02 A_23_P211659 Homo sapiens ceramide kinase (CERK), transcript variant 1, mRNA [NM_022766] -1.20 1.66E-02 A_23_P384056 Homo sapiens coiled-coil domain containing 14 (CCDC14), mRNA [NM_022757] -1.20 2.35E-03 A_23_P367676 Homo sapiens SIN3 homolog A, transcription regulator (yeast) (SIN3A), mRNA [NM_015477] -1.20 3.58E-02 A_24_P227585 Homo sapiens KIAA1704 (KIAA1704), mRNA [NM_018559] -1.20 4.14E-02 A_23_P396981 Homo sapiens hypothetical protein LOC285331 (LOC285331), mRNA [NM_001012506] -1.20 2.14E-02 A_24_P471242  -1.20 8.92E-03 A_23_P2537 Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblB type (MMAB), mRNA [NM_052845] -1.20 1.23E-02 A_24_P75879 Homo sapiens cDNA clone IMAGE:30334866. [BC092503] -1.20 3.05E-02 A_23_P23894 Homo sapiens receptor interacting protein kinase 5 (RIPK5), transcript variant 1, mRNA [NM_015375] -1.20 3.17E-02 A_23_P12733 Homo sapiens H2A histone family, member Y2 (H2AFY2), mRNA [NM_018649] -1.20 1.99E-02 A_24_P337657 Homo sapiens serum response factor (c-fos serum response element- binding transcription factor) (SRF), mRNA [NM_003131] -1.20 7.45E-03 A_32_P19966 Homo sapiens cDNA FLJ45029 fis, clone BRAWH3018326. [AK126976] -1.20 2.75E-02 A_24_P194954  -1.20 1.66E-02 A_24_P161827  -1.20 1.86E-02 A_23_P250735 Homo sapiens chromobox homolog 7 (CBX7), mRNA [NM_175709] -1.20 2.91E-02 A_24_P366656 Homo sapiens SH3 domain protein D19 (SH3D19), mRNA [NM_001009555] -1.21 3.70E-02 A_24_P857404 Homo sapiens cDNA FLJ43493 fis, clone OCBBF3009279. [AK125482] -1.21 1.99E-02 A_32_P396186 Homo sapiens cDNA FLJ10046 fis, clone HEMBA1001133. [AK000908] -1.21 4.48E-02 A_24_P652700 Homo sapiens mRNA; cDNA DKFZp686C15165 (from clone DKFZp686C15165). [BX648822] -1.21 1.35E-02 A_24_P225970 Homo sapiens shugoshin-like 1 (S. pombe) (SGOL1), transcript variant A1, mRNA [NM_001012409] -1.21 2.84E-02 A_23_P259586 Homo sapiens TTK protein kinase (TTK), mRNA [NM_003318] -1.21 4.92E-02 A_23_P42575 Homo sapiens caldesmon 1 (CALD1), transcript variant 1, mRNA [NM_033138] -1.21 1.72E-03 A_32_P109296 Homo sapiens leucine-rich repeat kinase 1 (MGC45866), mRNA [NM_152259] -1.21 3.26E-02 A_32_P183218 Homo sapiens cDNA FLJ33970 fis, clone DFNES2001564. [AK091289] -1.21 1.98E-02 A_24_P137545 Homo sapiens BH3-only member B protein (BOMB), mRNA [NM_024949] -1.21 3.07E-03 A_23_P48835 Homo sapiens kinesin family member 23 (KIF23), transcript variant 1, mRNA [NM_138555] -1.21 1.95E-02 A_24_P350060 PREDICTED: Homo sapiens similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) (LOC391819), mRNA [XM_498013] -1.21 8.86E-03 A_23_P111995 Homo sapiens lysyl oxidase-like 2 (LOXL2), mRNA [NM_002318] -1.21 4.62E-02 A_24_P53985 Homo sapiens zinc finger, MYM domain containing 1 (ZMYM1), mRNA [NM_024772] -1.21 4.25E-02 A_32_P51518 Homo sapiens cDNA FLJ40901 fis, clone UTERU2003704. [AK098220] -1.21 2.79E-02   151 Probe ID Gene Description Fold Change P-value A_23_P27315 Homo sapiens elastin microfibril interfacer 2 (EMILIN2), mRNA [NM_032048] -1.21 4.11E-02 A_24_P8088 Homo sapiens RIO kinase 1 (yeast) (RIOK1), transcript variant 2, mRNA [NM_153005] -1.22 1.77E-02 A_24_P837234 PREDICTED: Homo sapiens similar to ribosomal protein S2 (LOC442426), mRNA [XM_498332] -1.22 3.92E-02 A_23_P60002 Homo sapiens KIAA0103 (KIAA0103), mRNA [NM_014673] -1.22 1.66E-03 A_23_P99172 Homo sapiens hypothetical protein MGC13183 (MGC13183), mRNA [NM_032358] -1.22 2.49E-02 A_23_P155711 Homo sapiens nei endonuclease VIII-like 3 (E. coli) (NEIL3), mRNA [NM_018248] -1.22 2.01E-02 A_24_P248863 Homo sapiens DHHC domain-containing zinc finger protein mRNA, complete cds. [AY629351] -1.22 3.72E-02 A_24_P66522 Homo sapiens 5-azacytidine induced 1 (AZI1), transcript variant 1, mRNA [NM_014984] -1.22 1.92E-02 A_23_P60753  -1.22 4.38E-02 A_23_P112241 Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 5 (DNAJB5), mRNA [NM_012266] -1.22 4.11E-02 A_23_P205228 Homo sapiens ATPase, Cu++ transporting, beta polypeptide (Wilson disease) (ATP7B), transcript variant 1, mRNA [NM_000053] -1.22 1.98E-02 A_24_P27412 Homo sapiens RNA, U transporter 1 (RNUT1), mRNA [NM_005701] -1.22 1.09E-02 A_23_P160460 Homo sapiens UDP-N-acteylglucosamine pyrophosphorylase 1 (UAP1), mRNA [NM_003115] -1.22 4.78E-02 A_24_P383660  -1.22 2.68E-02 A_23_P94546 Homo sapiens G kinase anchoring protein 1 (GKAP1), mRNA [NM_025211] -1.22 8.36E-03 A_23_P140450 Homo sapiens solute carrier family 27 (fatty acid transporter), member 2 (SLC27A2), mRNA [NM_003645] -1.22 1.14E-02 A_23_P333420 Homo sapiens Ran GTPase activating protein 1 (RANGAP1), mRNA [NM_002883] -1.22 4.33E-02 A_23_P74349 Homo sapiens cell division cycle associated 1 (CDCA1), transcript variant 1, mRNA [NM_145697] -1.22 6.50E-03 A_23_P334635 Homo sapiens jerky homolog (mouse) (JRK), mRNA [NM_003724] -1.23 1.98E-02 A_32_P128661 Homo sapiens cDNA clone IMAGE:4500064, partial cds. [BC023274] -1.23 4.41E-02 A_24_P381604 Homo sapiens integral membrane protein 2B (ITM2B), mRNA [NM_021999] -1.23 4.67E-02 A_23_P375 Homo sapiens cell division cycle associated 8 (CDCA8), mRNA [NM_018101] -1.23 1.18E-02 A_23_P308731 Homo sapiens rhomboid, veinlet-like 4 (Drosophila) (RHBDL4), mRNA [NM_138328] -1.23 3.41E-02 A_32_P123966 Homo sapiens KIAA1005 protein (KIAA1005), mRNA [NM_015272] -1.23 3.33E-03 A_23_P212383 Homo sapiens SAC1 suppressor of actin mutations 1-like (yeast) (SACM1L), mRNA [NM_014016] -1.23 2.72E-02 A_23_P204751 Homo sapiens amiloride-sensitive cation channel 2, neuronal (ACCN2), transcript variant 1, mRNA [NM_020039] -1.23 1.21E-03 A_32_P155091 Homo sapiens ataxin 2-like (ATXN2L), transcript variant B, mRNA [NM_145714] -1.23 3.69E-02 A_23_P165927 Homo sapiens stathmin-like 3 (STMN3), mRNA [NM_015894] -1.23 2.95E-02   152 Probe ID Gene Description Fold Change P-value A_32_P19887 Homo sapiens methyltransferase 5 domain containing 1 (METT5D1), mRNA [NM_152636] -1.23 2.17E-02 A_23_P140705 Homo sapiens chromosome 15 open reading frame 23, mRNA (cDNA clone IMAGE:3952251), partial cds. [BC004543] -1.24 1.33E-02 A_24_P332595  -1.24 1.44E-02 A_24_P409420  -1.24 1.30E-02 A_24_P238257 Homo sapiens cDNA FLJ35848 fis, clone TESTI2006894. [AK093167] -1.24 2.12E-02 A_23_P215070 Homo sapiens testis specific, 14 (TSGA14), mRNA [NM_018718] -1.24 2.70E-02 A_23_P99604 Homo sapiens KIAA1333 (KIAA1333), mRNA [NM_017769] -1.24 2.67E-02 A_24_P304439 Homo sapiens serine dehydratase (SDS), mRNA [NM_006843] -1.24 3.73E-02 A_23_P136805 Homo sapiens Rho GTPase activating protein 11A (ARHGAP11A), mRNA [NM_014783] -1.24 2.77E-02 A_23_P55256 Homo sapiens zinc finger protein 652 (ZNF652), mRNA [NM_014897] -1.24 2.53E-02 A_23_P53856 Homo sapiens phosphonoformate immuno-associated protein 5 (PFAAP5), mRNA [NM_014887] -1.25 3.70E-02 A_24_P349151 Homo sapiens spindle assembly abnormal protein 6 (SAS-6), mRNA [NM_194292] -1.25 4.52E-02 A_23_P334218 Homo sapiens WD repeat domain 67 (WDR67), mRNA [NM_145647] -1.25 1.58E-03 A_23_P50108 Homo sapiens kinetochore associated 2 (KNTC2), mRNA [NM_006101] -1.25 1.42E-02 A_23_P52362 Homo sapiens solute carrier family 18 (vesicular acetylcholine), member 3 (SLC18A3), mRNA [NM_003055] -1.25 1.19E-02 A_23_P344000 Homo sapiens beta1,4-N-acetylgalactosaminyltransferases IV (Beta4GalNAc-T4), mRNA [NM_178537] -1.25 3.29E-02 A_24_P41979  -1.25 2.07E-02 A_23_P97853 Homo sapiens chromosome 10 open reading frame 57 (C10orf57), mRNA [NM_025125] -1.25 1.87E-02 A_32_P199252 Homo sapiens heat shock 90kDa protein 1, alpha (HSPCA), transcript variant 2, mRNA [NM_005348] -1.26 1.86E-02 A_23_P129466 Homo sapiens activating transcription factor 7 interacting protein 2 (ATF7IP2), mRNA [NM_024997] -1.26 1.05E-03 A_23_P32707 Homo sapiens extra spindle poles like 1 (S. cerevisiae) (ESPL1), mRNA [NM_012291] -1.26 1.61E-03 A_24_P255954  -1.26 1.92E-02 A_24_P189112 Homo sapiens chromosome 6 open reading frame 182 (C6orf182), mRNA [NM_173830] -1.26 5.16E-03 A_23_P381577 Homo sapiens zinc finger protein 25 (KOX 19) (ZNF25), mRNA [NM_145011] -1.26 3.32E-02 A_24_P322635 Homo sapiens engulfment and cell motility 2 (ced-12 homolog, C. elegans) (ELMO2), transcript variant 3, mRNA [NM_182764] -1.27 2.28E-02 A_23_P116682 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2), transcript variant 2, mRNA [NM_139067] -1.27 3.17E-02 A_32_P151800 Homo sapiens family with sequence similarity 72, member A (FAM72A), mRNA [NM_207418] -1.28 6.44E-03 A_24_P169843  -1.28 1.41E-03 A_23_P160518 Homo sapiens tripartite motif-containing 45 (TRIM45), mRNA [NM_025188] -1.29 1.53E-02 A_23_P114903 Homo sapiens heat shock 70kDa protein 6 (HSP70B') (HSPA6), mRNA [NM_002155] -1.29 2.78E-02   153 Probe ID Gene Description Fold Change P-value A_24_P783679  -1.29 4.06E-02 A_24_P359856 Homo sapiens histone deacetylase 4 (HDAC4), mRNA [NM_006037] -1.29 2.49E-03 A_23_P59358 Homo sapiens chromosome 6 open reading frame 182 (C6orf182), mRNA [NM_173830] -1.30 8.07E-03 A_24_P31627 Homo sapiens potassium voltage-gated channel, Shab-related subfamily, member 1 (KCNB1), mRNA [NM_004975] -1.30 4.13E-02 A_24_P686014  -1.30 2.10E-02 A_24_P104980 Homo sapiens germline mRNA for immunoglobulin lambda-2 chain constant region, Daudi cell line. [AJ319669] -1.31 3.27E-02 A_32_P218707 PREDICTED: Homo sapiens similar to CDNA sequence BC012256 (LOC400969), mRNA [XM_379108] -1.31 3.07E-02 A_23_P411335 Homo sapiens shugoshin-like 2 (S. pombe) (SGOL2), mRNA [NM_152524] -1.31 2.84E-03 A_23_P100141 Homo sapiens chromosome 16 open reading frame 28 (C16orf28), mRNA [NM_023076] -1.32 2.59E-03 A_23_P150935 Homo sapiens trophinin associated protein (tastin) (TROAP), mRNA [NM_005480] -1.32 1.14E-02 A_24_P63522 Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) (HMGCS1), mRNA [NM_002130] -1.32 2.66E-02 A_23_P252664 Homo sapiens fucosyltransferase 6 (alpha (1,3) fucosyltransferase) (FUT6), mRNA [NM_000150] -1.32 3.99E-02 A_24_P230466  -1.32 7.85E-03 A_23_P83328 Homo sapiens endoglin (Osler-Rendu-Weber syndrome 1) (ENG), mRNA [NM_000118] -1.33 4.57E-02 A_24_P80204 Homo sapiens BENE protein (BENE), mRNA [NM_005434] -1.33 3.36E-02 A_23_P435183 Homo sapiens LRR FLI-I interacting protein 1 (LRRFIP1) mRNA, partial cds. [AF115510] -1.33 2.96E-02 A_23_P6561 Homo sapiens hypothetical protein FLJ10213 (FLJ10213), mRNA [NM_018029] -1.33 1.54E-02 A_24_P250666 Homo sapiens surfactant, pulmonary-associated protein C (SFTPC), mRNA [NM_003018] -1.34 3.97E-02 A_32_P215143 Q6PIE2 (Q6PIE2) MGC9515 protein, partial (6%) [THC2306274] -1.34 3.48E-02 A_23_P216517 Homo sapiens chromosome 9 open reading frame 100 (C9orf100), mRNA [NM_032818] -1.35 2.14E-03 A_32_P134580 Homo sapiens high-mobility group box 1 (HMGB1), mRNA [NM_002128] -1.35 3.47E-03 A_23_P38876 Homo sapiens lipase, hormone-sensitive (LIPE), mRNA [NM_005357] -1.35 2.67E-02 A_24_P675947 PREDICTED: Homo sapiens similar to ribosomal protein S3a; 40S ribosomal protein S3a; v-fos transformation effector protein 1 (LOC391706), mRNA [XM_497979] -1.35 1.30E-02 A_23_P68807 Homo sapiens, clone IMAGE:4994346, mRNA. [BC021857] -1.35 1.47E-02 A_24_P649735 Q6PJX0 (Q6PJX0) MADP-1 protein (Fragment), partial (64%) [THC2281176] -1.36 4.15E-02 A_23_P110851 Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 1, mRNA [NM_003219] -1.36 1.54E-02 A_23_P53530 Homo sapiens MTERF domain containing 3 (MTERFD3), mRNA [NM_025198] -1.37 3.53E-03 A_23_P95213 Homo sapiens surfactant, pulmonary-associated protein C, mRNA (cDNA clone MGC:14509 IMAGE:4043169), complete cds. [BC005913] -1.37 2.55E-02   154 Probe ID Gene Description Fold Change P-value A_23_P360605 Homo sapiens KIAA0802, mRNA (cDNA clone MGC:39663 IMAGE:5268201), complete cds. [BC040542] -1.37 1.01E-02 A_24_P286114 Homo sapiens solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), mRNA [NM_004172] -1.39 6.14E-04 A_23_P88848 Homo sapiens dihydrouridine synthase 2-like (SMM1, S. cerevisiae) (DUS2L), mRNA [NM_017803] -1.42 1.30E-02 A_23_P21143 Homo sapiens mRNA; cDNA DKFZp686B0790 (from clone DKFZp686B0790); complete cds. [BX538238] -1.46 8.32E-03 A_32_P189034 BC000698 keratin 18 [Homo sapiens;], partial (19%) [THC2310027] -1.49 8.34E-03 A_23_P206901 Homo sapiens nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), mRNA [NM_017668] -1.50 2.98E-02 A_24_P873659 Homo sapiens clone alpha1 mRNA sequence. [AF001540] -1.70 2.51E-02   155 APPENDIX 3: LIST OF DIFFERENTIALLY EXPRESSED ASPERGILLUS FUMIGATUS GENES Locus Gene Product Name Fold Change P-Value Afu4g09920 conserved hypothetical protein 3.57 1.01E-02 Afu4g04120 protein kinase activator Bem1, putative 3.08 2.71E-02 Obsolete  3.03 9.32E-04 Afu4g08580 mitochondrial peroxiredoxin Prx1, putative 2.84 2.34E-03 Afu4g09420 carbonic anhydrase, putative 2.45 2.18E-02 Afu1g13820 hypothetical protein 2.37 4.01E-03 Afu2g09220 conserved hypothetical protein 2.35 1.24E-04 Afu5g12710 TPR domain protein 2.34 2.59E-03 At1g04710  2.30 1.63E-03 Afu4g08200 GPI transamidase component PIG-U, putative 2.28 9.32E-04 Afu6g02310  2.19 2.43E-02 Afu4g13410 37S ribosomal protein Rsm24, putative 2.08 5.95E-04 Afu6g13200 autophagy regulatory protein Atg2, putative 2.01 1.04E-02 Afu1g16640 conserved hypothetical protein 1.89 9.10E-04 Obsolete  1.83 2.55E-02 Afu3g14660 conserved hypothetical protein 1.82 1.44E-02 Obsolete  1.78 1.57E-02 Obsolete  1.78 3.10E-03 Afu4g00470 MFS multidrug transporter, putative 1.77 6.96E-06 Afu1g11220 GPI anchored protein, putative 1.76 3.57E-04 Afu7g01900 TOM core complex subunit Tom6, putative 1.74 5.42E-03 Afu8g06450 Rieske 2Fe-2S family protein, putative 1.73 1.78E-02 Afu6g03790 conserved hypothetical protein 1.72 9.37E-04 Afu1g14150 conserved hypothetical protein 1.71 3.49E-03 Afu4g10440 conserved hypothetical protein 1.70 4.55E-04 Afu2g05160  1.70 2.26E-04 Afu1g15060  1.67 2.21E-02 Afu5g15080 Rho-associated protein kinase, putative 1.65 1.17E-02 Afu7g06970  1.61 3.15E-02 Afu4g09360 ATP synthase subunit ATP9, putative 1.60 6.81E-03 Afu3g00890  1.59 8.68E-03 Afu2g07850  1.59 2.64E-04 Afu4g13040 clathrin-coated vesicle protein, putative 1.59 4.33E-02 Afu2g12800 hypothetical protein 1.58 5.82E-03 Obsolete  1.58 6.15E-03 Afu2g03300 conserved hypothetical protein 1.58 1.88E-03 Afu5g06320 membrane biogenesis protein (Yop1), putative 1.57 5.24E-03 Afu4g10880 hypothetical protein 1.57 8.07E-03 Afu6g11900 hypothetical protein 1.54 1.98E-02 Obsolete  1.54 3.63E-02   156 Locus Gene Product Name Fold Change P-Value Afu8g01710 antigenic thaumatin domain protein, putative 1.54 4.36E-04 Afu1g03040 conserved hypothetical protein 1.53 1.35E-02 Afu6g05140 sterol delta 5,6-desaturase ERG3 1.53 3.04E-02 Afu3g00880 extracellular conserved serine-rich protein 1.53 1.31E-03 Afu3g11550 LEA domain protein 1.52 2.85E-03 Afu4g03010 conserved hypothetical protein 1.52 1.87E-02 Afu7g06400 pectate lyase, putative 1.52 2.70E-02 Afu5g03300 hypothetical protein 1.52 7.17E-03 Afu7g06530  1.52 5.86E-04 Afu1g02550 tubulin alpha-1 subunit 1.51 1.16E-02 Afu6g10150 hypothetical protein 1.51 4.55E-02 Afu1g15590 succinate dehydrogenase subunit CybS, putative 1.51 1.53E-03 Afu3g06030 ubiquitin conjugating enzyme (UbcD), putative 1.51 5.24E-03 Afu4g03080 C2H2 finger domain protein, putative 1.51 2.17E-02 Afu7g01000 potassium-activated aldehyde dehydrogenase Ald4, putative -1.50 1.45E-03 Afu6g07520 cell wall integrity signaling protein Lsp1/Pil1, putative -1.50 9.05E-03 Afu5g06430 50S ribosomal subunit L7, putative -1.50 3.75E-03 Afu3g10750 acetate kinase, putative -1.50 4.05E-02 Afu2g03580 phenylalanyl-tRNA synthetase beta chain cytoplasmic -1.50 2.51E-02 Afu4g13010 conserved hypothetical protein -1.51 2.04E-02 Afu6g04920 NAD-dependent formate dehydrogenase AciA/Fdh -1.51 4.99E-03 Afu6g14460 haloalkanoic acid dehalogenase, putative -1.51 1.56E-03 Afu6g06740 endoplasmic reticulum calcium ATPase, putative -1.51 6.20E-03 Afu1g09590 conserved hypothetical protein -1.51 2.91E-04 Afu5g06060 sulfur metabolism regulator SkpA, putative -1.51 3.73E-03 Afu2g05650 cytoplasmic asparaginyl-tRNA synthetase, putative -1.51 1.57E-03 Afu8g05660 myosin I MyoA/Myo5 -1.51 8.74E-04 Afu1g11460 1,3-beta-glucanosyltransferase Bgt1 -1.52 1.02E-02 Afu2g03950 serine/threonine protein phosphatase, putative -1.52 3.24E-03 Afu1g02070 cytochrome C1/Cyt1, putative -1.52 1.10E-02 Afu3g04170 pyruvate dehydrogenase E1 beta subunit PdbA, putative -1.53 1.59E-02 Afu4g06690 ribonucleotide reductase large subunit Rnr1, putative -1.54 1.52E-02 Afu4g12060 Vacuolar protein sorting-associated protein 26, putative -1.54 1.06E-02 Afu2g12080 mitochondrial phosphate transporter Pic2, putative -1.54 1.04E-02 Afu3g03610 conserved hypothetical protein -1.54 2.70E-03 Afu5g12160 alpha-1,2-mannosyltransferase (Kre5), putative -1.54 9.76E-03 Afu8g04320 NADH-ubiquinone oxidoreductase 178 kDa subunit, putative -1.54 3.04E-04 Afu4g12390 cell differentiation protein (Rcd1), putative -1.54 4.79E-03 Afu5g02240 NAD dependent epimerase/dehydratase family protein -1.54 1.91E-03 Afu4g11730 glycerol dehydrogenase (GldB), putative -1.55 8.63E-04 Afu3g11070 pyruvate decarboxylase PdcA, putative -1.55 8.02E-03 Afu6g09930 bZIP transcription factor AP-1/Yap1, putative -1.55 5.09E-03 Afu2g13780 splicing factor 3B subunit 1, putative -1.55 3.98E-03 Afu6g13250 60S ribosomal protein L31e -1.55 1.02E-02 Afu2g10750 RNA helicase (Dbp), putative -1.56 1.98E-03 Afu1g13560 conserved hypothetical protein -1.56 2.91E-03 Afu7g02580  -1.56 1.38E-02 Afu3g06970 40S ribosomal protein S9 -1.56 1.03E-02   157 Locus Gene Product Name Fold Change P-Value Afu1g12800 isocitrate dehydrogenase, NAD-dependent -1.56 1.75E-02 Afu3g03090  -1.56 4.16E-04 Afu5g04290 WW domain protein, putative -1.57 6.98E-04 Afu2g12530 carnitine acetyl transferase -1.57 3.35E-02 Afu5g14330 12-oxophytodienoate reductase, putative -1.57 4.15E-03 Afu1g09800 GTP-binding protein YchF -1.57 1.03E-02 Afu2g15760 poly(A)+ RNA transport protein (UbaA), putative -1.57 3.96E-02 Afu3g14270 aldo-keto reductase (AKR), putative -1.58 2.59E-02 Afu6g04110 CLPTM1 domain protein -1.58 2.51E-02 Afu2g10120 YjeF domain protein -1.59 1.16E-02 Afu1g12020 arrestin domain protein -1.59 6.30E-04 Afu2g08080 phospholipid metabolism enzyme regulator, putative -1.60 3.81E-02 Afu8g04920 LEA domain protein -1.60 3.28E-03 Afu3g00900 alpha-amylase, putative -1.60 3.56E-03 Afu5g04330 aminopeptidase, putative -1.60 2.83E-02 Afu2g11560 galactose-1-phosphate uridylyltransferase -1.60 1.95E-04 Afu4g13120 glutamine synthetase -1.60 4.66E-04 Afu3g01850 porphyromonas-type peptidyl-arginine deiminase superfamily -1.60 8.16E-03 Afu5g04230 citrate synthase CitA -1.60 5.82E-03 Afu8g02850 actin binding protein, putative -1.61 9.10E-03 Afu1g11190 eukaryotic translation elongation factor 1 subunit Eef1-beta, putative -1.61 8.93E-05 Afu7g04080 3-ketoacyl-CoA thiolase (POT1), putative -1.61 1.50E-02 Afu3g05370 dihydrolipoamide succinyltransferase, putative -1.62 2.30E-02 Afu4g08070 peptide N-myristoyl transferase (Nmt1) -1.62 8.31E-04 Afu6g03730 2-methylcitrate dehydratase, putative -1.63 1.17E-02 Afu2g01210 ATP dependent RNA helicase (Dbp5), putative -1.64 5.20E-03 Afu1g05490 histone deacetylase complex subunit (Hos4), putative -1.64 6.29E-03 Afu5g02930 lysophospholipase, putative -1.64 4.45E-02 Afu6g12240 glycerophosphoryl diester phosphodiesterase family protein -1.65 1.71E-03 Afu3g04300 actin cytoskeleton organization and biogenesis protein, putative -1.65 6.95E-05 Afu3g05650 trehalose-6-phosphate phosphatase Tpp -1.65 7.03E-03 Afu8g05810 DUF1295 domain protein -1.65 1.76E-03 Afu4g13150 DUF159 domain protein -1.65 1.30E-02 Afu1g04160 aspartate aminotransferase, putative -1.65 3.42E-02 Afu1g03390 60S ribosomal protein L12 -1.65 1.93E-03 Afu4g07030 conserved hypothetical protein -1.66 3.72E-03 Afu2g12870 vesicular-fusion protein sec17 -1.67 1.43E-02 Afu5g02470 thiamine biosynthesis protein (Nmt1), putative -1.67 1.12E-02 Afu1g10510 60S ribosomal protein L35 -1.67 3.58E-03 Afu3g02280 alpha,alpha-trehalose glucohydrolase TreA/Ath1 -1.68 1.96E-02 Afu2g15770 cell wall biogenesis protein/glutathione transferase (Gto1), putative -1.69 3.48E-04 Afu2g05790 oligosaccharyl transferase subunit (alpha), putative -1.71 3.04E-03 Afu6g06440 proteasome component Prs3, putative -1.71 8.52E-04 Afu6g06570 conserved hypothetical protein -1.71 1.11E-02 Afu8g02840 dynamin-like GTPase Dnm1, putative -1.72 8.53E-03 Afu5g13450 triosephosphate isomerase -1.73 2.15E-03 Afu4g13180 TPR repeat protein -1.73 1.08E-02 Afu6g06770 enolase/allergen Asp F 22 -1.74 9.11E-03   158 Locus Gene Product Name Fold Change P-Value Afu6g10380 cullin binding protein CanA, putative -1.74 4.67E-04 Afu1g06790 importin beta-3 subunit, putative -1.74 1.73E-02 Afu2g09910 fatty acid activator Faa4, putative -1.74 4.92E-03 Afu8g07130 AhpC/TSA family thioredoxin peroxidase, putative -1.75 3.87E-03 Afu2g00970 alcohol dehydrogenase, zinc-containing, putative -1.75 1.05E-02 Afu3g09290 phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent -1.76 2.91E-03 Afu3g14240 tRNA splicing protein (Spl1), putative -1.76 4.27E-04 Afu3g10000 cAMP-dependent protein kinase regulatory subunit PkaR -1.77 1.87E-02 Afu5g08930 isovaleryl-CoA dehydrogenase IvdA, putative -1.79 5.32E-05 Afu1g12890 60S ribosomal protein L5, putative -1.80 3.94E-04 Afu1g06630 Golgi phosphoprotein 3 (GPP34) domain containing protein -1.80 1.22E-03 Afu8g04340 cystathionine gamma-lyase -1.80 1.60E-03 Afu1g12150 nucleoside diphosphatase Gda1 -1.80 1.00E-02 Afu4g10620 4-hydroxyphenylpyruvate dioxygenase, putative -1.82 1.04E-02 Afu1g06010  -1.82 1.45E-02 Afu5g05830 CorA family metal ion transporter, putative -1.82 1.67E-02 Afu6g02230 glucokinase GlkA, putative -1.83 4.86E-04 Afu2g02170 nuclear condensin complex subunit Smc4, putative -1.83 1.99E-02 Afu4g08970 PAP2 domain protein -1.84 9.74E-03 Afu1g06110 conserved hypothetical protein -1.84 3.07E-04 Afu7g04580 TBC domain protein, putative -1.86 1.52E-02 Afu2g03120 cell wall glucanase Utr2, putative -1.88 1.54E-03 Afu6g00100  -1.89 7.81E-03 Afu8g05580 acetyl-coA hydrolase Ach1, putative -1.89 5.80E-03 Afu5g06360 60S ribosomal protein L8, putative -1.90 2.98E-04 Afu2g10030 actin cytoskeleton protein (VIP1), putative -1.91 1.27E-03 Afu7g06770 conserved hypothetical protein -1.91 1.56E-03 Afu1g10670 Vacuolar ATP synthase subunit H, putative -1.92 6.22E-03 Afu5g07050 proteasome regulatory particle subunit Rpt2, putative -1.92 4.23E-04 Afu8g01670 bifunctional catalase-peroxidase Cat2 -1.92 8.89E-04 Afu6g13160 serine/threonine protein kinase, putative -1.93 4.17E-04 Afu5g11630 conserved hypothetical protein -1.94 2.54E-02 Afu6g07540 t-complex protein 1, epsilon subunit, putative -1.95 7.94E-03 Afu6g11260 ribosomal protein L26 -1.95 3.89E-03 Afu2g01750 methionine aminopeptidase, type II, putative -1.95 4.01E-02 Afu3g12290 pre-mRNA splicing factor Dim1 -1.96 9.31E-03 Afu2g04990  -1.96 3.55E-04 Afu5g01960 phosphate transporter (Pho88), putative -1.97 1.73E-04 Afu3g04210 fatty acid synthase alpha subunit FasA -1.98 1.88E-03 Afu6g03590 2-methylcitrate synthase McsA -1.98 1.62E-03 Afu7g05840 conserved hypothetical protein -1.98 6.57E-04 Afu5g00650 conserved hypothetical protein -1.98 7.39E-03 Afu2g00310 amino acid transporter, putative -1.99 7.45E-03 Obsolete  -1.99 3.13E-03 Afu3g07850 pheromone maturation dipeptidyl aminopeptidase DapB -2.01 7.40E-03 Afu4g11340 saccharopine dehydrogenase Lys9, putative -2.01 6.07E-03 Afu4g11290 proteasome activator subunit 4, putative -2.04 3.77E-02 Afu6g08050 6-phosphogluconate dehydrogenase Gnd1, putative -2.04 1.79E-04   159 Locus Gene Product Name Fold Change P-Value Afu2g03590 40S ribosomal protein S21 -2.07 2.05E-03 Afu2g13230 universal stress protein family domain protein -2.08 3.02E-02 Afu7g05470 electron transfer flavoprotein alpha subunit, putative -2.10 2.56E-03 Afu1g15760 phosphatidylserine decarboxylase, putative -2.12 2.22E-02 Afu1g10800 thioesterase family protein -2.13 1.90E-03 Afu1g08900 CHY and RING finger domain protein, putative -2.15 4.09E-02 Afu5g04080 oxidosqualene:lanosterol cyclase -2.18 1.70E-02 Afu2g07500 prolidase pepP, putative -2.19 3.92E-03 Afu6g12170 FKBP-type peptidyl-prolyl isomerase, putative -2.21 5.90E-04 Afu2g03490 calcium/calmodulin-dependent protein kinase, putative -2.23 7.65E-03 Afu2g07680 L-ornithine N5-oxygenase SidA -2.26 2.03E-02 Afu4g10410 aspartate aminotransferase, putative -2.27 5.01E-04 Afu3g12330 phosphatidyl synthase -2.30 3.21E-04 Afu8g04800 valyl-tRNA synthetase -2.31 9.57E-03 Afu4g11300 vacuolar ATPase 98 kDa subunit, putative -2.34 3.82E-03 Afu7g01360  -2.35 1.70E-02 Afu4g00660 sensor histidine kinase/response regulator, putative -2.38 1.71E-02 Afu3g12430 guanine nucleotide exchange factor, putative -2.39 3.78E-02 Afu2g04820 translation release factor eRF3, putative -2.43 1.45E-03 Afu3g08010 C2H2 transcription factor (Ace1), putative -2.47 3.31E-04 Afu4g11530 intermembrane space AAA protease IAP-1 -2.47 3.63E-03 Afu7g05930 metallopeptidase MepB -2.54 2.80E-03 Afu2g13610 2-methylcitrate dehydratase (PrpD), putative -2.65 4.46E-02 Afu3g08900 tubulin-specific chaperone c, putative -2.75 1.11E-03 Afu1g14710 beta-glucosidase, putative -2.81 1.12E-03 Afu3g12530 sensor histidine kinase/response regulator, putative -3.96 4.63E-02 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0069080/manifest

Comment

Related Items