Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effects of sub-inhibitory concentrations of cell wall active antibiotics on virulence gene expression… Subrt, Natalia 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2010_spring_subrt_natalia.pdf [ 1.08MB ]
Metadata
JSON: 24-1.0068607.json
JSON-LD: 24-1.0068607-ld.json
RDF/XML (Pretty): 24-1.0068607-rdf.xml
RDF/JSON: 24-1.0068607-rdf.json
Turtle: 24-1.0068607-turtle.txt
N-Triples: 24-1.0068607-rdf-ntriples.txt
Original Record: 24-1.0068607-source.json
Full Text
24-1.0068607-fulltext.txt
Citation
24-1.0068607.ris

Full Text

EFFECTS OF SUB-INHIBITORY CONCENTRATIONS OF CELL WALL ACTIVE ANTIBIOTICS ON VIRULENCE GENE EXPRESSION IN STAPHYLOCOCCUS AUREUS  by  NATALIA SUBRT B.Sc. University of British Columbia, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2009  © Natalia Subrt, 2009  Abstract Infections caused by Staphylococcus aureus are a major concern to public health due to multifactorial virulence of the bacteria and increasing resistance to antimicrobial therapy. The bacterial cell wall continues to be the primary target for antibiotics used to treat staphylococcal infections. I have used promoter-lux reporter constructs to study the effects of sub-inhibitory concentrations of cell wall active antibiotics on virulence gene expression in S. aureus. Constructs made for virulence genes encoding Spa, an adhesin, RNAIII, a regulatory RNA molecule, and LukE, a leukotoxin E, were introduced into several strains of S. aureus. It was found that the effects of sub-inhibitory concentrations of antibiotics differed depending on the strain, and antibiotics affected the expression of virulence genes differently in the same strain. Based on the results with S. aureus strains lacking virulence regulators, SarA and SarS, it was concluded that sub-inhibitory concentrations of antibiotics modulate the expression of virulence regulators, which affects transcription of the downstream genes, spa and lukE. A speculative model for the mechanism of transcription modulation by antibiotics was proposed. The effect of subinhibitory concentrations of antibiotics on S. aureus biofilm formation was also studied. Finally, promoter-lux reporter constructs were used to investigate effects of various antibiotic combinations on gene expression in S. aureus.  ii  Table of contents. Abstract ............................................................................................................................... ii Table of contents................................................................................................................ iii List of tables........................................................................................................................ v List of abbreviations. ........................................................................................................ vii Acknowledgements.......................................................................................................... viii Chapter 1. Introduction. ...................................................................................................... 1 1.1 Antibiotics................................................................................................................. 1 1.2 Transcription modulation by antibiotics ................................................................... 2 1.3 Methods used to study effects of sub-MIC antibiotics ............................................. 3 1.4 Pathogenicity of Staphylococcus aureus. ................................................................. 4 1.5 Virulence regulation in S. aureus ............................................................................. 5 1.6 Virulence modulation by sub-MIC antibiotics in S. aureus ..................................... 7 1.7 Thesis Objective. ...................................................................................................... 9 Chapter 2. Materials and Methods .................................................................................... 10 2.1 Bacterial strains and growth conditions.................................................................. 10 2.2 Construction of plasmids carrying the promoter-lux reporter fusions.................... 11 2.3 Genomic DNA isolation. ........................................................................................ 11 2.4 Plasmid DNA isolation. .......................................................................................... 13 2.5 Transformation of E. coli DH10B. ......................................................................... 13 2.6 Electroporation of S. aureus. .................................................................................. 13 2.7 Verification of transformants.................................................................................. 14 2.8 Disk diffusion assays. ............................................................................................. 14 2.9 Minimal inhibitory concentration determination. ................................................... 14 2.10 Liquid luminescence assay. .................................................................................. 15 2.11 Quantification of transcription.............................................................................. 15 2.12 Biofilm formation assay........................................................................................ 16 Chapter 3. Results ............................................................................................................. 17 3.1 Plasmid construction and assessment of light production ...................................... 17 iii  3.2 Disc diffusion assay ................................................................................................ 17 3.3 Quantification of the transcription modulation....................................................... 21 3.4 Liquid luminescence assay. .................................................................................... 22 3.5 Biofilm formation assay.......................................................................................... 22 Chapter 4. Discussion ....................................................................................................... 25 4.1 Transcription modulation by sub-MIC antibiotics in S. aureus.............................. 25 4.2 Speculative model for the mechanism of transcription modulation by sub-MIC antibiotics................................................................................................................ 28 4.3 Effects of sub-MIC antibiotics on biofilm formation. ............................................ 29 4.4 S. aureus heterogeneity........................................................................................... 30 4.5 Future directions. .................................................................................................... 30 Chapter 5. Antibiotic Interactions..................................................................................... 32 5.1 Introduction............................................................................................................. 32 5.2 Materials and methods. ........................................................................................... 33 5.2.1 Promoter-lux reporter library construction and screening. .............................. 33 5.2.3 Disc diffusion assay. ........................................................................................ 34 5.3 Results..................................................................................................................... 34 5.3.1 Characterization of the selected clones............................................................ 34 5.3.2 Characterization of antibiotic interactions. ...................................................... 35 5.4 Discussion............................................................................................................... 39 Chapter 6. References ....................................................................................................... 43  iv  List of tables. Table 2.1 Strains and plasmids used in this study……………………………………….10 Table 2.2 Primers used in this study……………………………………………………..12 Table 3.1 Light production by promoter-lux reporter constructs in S. aureus in the absence of antibiotics on solid media. ………………………………………..16 Table 4.1 Summary of the difference in effects of antibiotics on transcription modulation of virulence genes in S. aureus………………………..……………………....26 Table 5.1 Annotation for the promoter-lux reporter constructs………………………….35 Table 5.2 Antibiotics, their abbreviation and class……………………………………....35 Table 5.3 Summary for antibiotic interactions…………………………………………..39  v  List of figures. Figure 1.1 Hormetic effects of antibiotics………………………………………………...3 Figure 1.2 Promoter-lux reporter plasmid pAmiLux……………………………………...4 Figure 1.3 Regulation of virulence determinants in S. aureus………………………….....6 Figure 3.1 Transcription modulation of virulence genes in laboratory strains.........…….18 Figure 3.2 Transcription modulation of virulence genes in SarA deficient strain S. aureus ALC 488 by sub-MIC cell wall active antibiotics …………………………..19 Figure 3.3 Transcription modulation of virulence genes in SarA deficient strain S. aureus ALC 488 by sub-MIC cell wall active antibiotics ……………………….…20 Figure 3.4 Transcription modulation of virulence genes in a clinical isolate S. aureus Newman by sub-MIC cell wall active antibiotics ……………….……….…21 Figure 3.5 Biofilm formation by S. aureus………………………………………………24 Figure 4.1 Chemical structures of antibiotics………………..…...……………………...27 Figure 4.2 Speculative model for transcription modulation by sub-MIC antibiotics……28 Figure 5.1 Conventional disc diffusion assay…………………………………………....36 Figure 5.2 Luminescence disc diffusion assay…………………………………………..36 Figure 5.3 Comparison between growth inhibition and promoter activation that portrays synergism and antagonism between antibiotics……………………………...37 Figure 5.4 Endo-β-N-acetyl-glucosaminidase promoter activation……………………...38 Figure 5.5 Endo-β-N-acetyl-glucosaminidase promoter activation……………………...38 Figure 5.6 Antagonistic interactions between penicillin G and gentamicin; ciprofloxacin and gentamicin in S. aureus RN4220.....…………………………………… 40 Figure 5.7 Antagonistic interactions between penicillin G and gentamicin; ciprofloxacin and gentamicin in S. aureus Newman…….…………………………………40  vi  List of abbreviations. AIP  autoinducing peptide  Agr  accessory gene regulator  BAC  bacitracin  CEF  cephalothin  CFP  cefoperazone  CLO  cloxacillin  DNA  deoxyribonucleic acid  IMP  imipenem  LB  Luria Bertani  MET  methicillin  MIC  minimal inhibitory concentrations  NAF  nafcillin  NYE  nutrient yeast extract  OXA  oxacillin  PBP  penicillin-binding protein  PCR  polymerase chain reaction  PEN  penicillin G  PVL  Panton Valentine leukocidin  qRT-PCR  quantitative reverse transcription polymerase chain reaction  QS  quorum sensing  SarA  Staphylococcal accessory regulator A  VAN  vancomycin  vii  Acknowledgements. I would like to express my deepest gratitude to Dr. Julian Davies for providing me his supervision, support and steadfast encouragement that enabled me to complete this thesis work. His passion for science has inspired and motivated my growth as a student, researcher and a scientist. I would like to thank my committee members, Dr. J. Thomas Beatty and Dr. Rachel Fernandez, for our discussions and their thoughts on my work. This thesis would not be possible without the support I received from Dr. Lili Rosana Mesak, who helped me greatly with materials and methods as well as analysis of the results. I would like to express appreciation to Dr. Vivian Miao for the guidance in methodology and discussion of the findings. It is a pleasure to thank past and present members of the Davies Laboratory, particularly, Grace Yim for her advice and support in completing my thesis work, Helena Wang and Manisha Dosanjh for teaching me how to perform luminescence disc diffusion assays, Karen Lu and Ivan Villanueva for helping me to locate various reagents and labware, and to all other post-doctoral fellows, co-op and volunteer students for providing a productive and entertaining work environment.  I am grateful to my parents, Viatcheslav and Nadezda, who have laid a foundation for my learning by surrounding me with love and fostering intellectual pursuit. I would like to thank my sister Elena and cousin Tatiana for their support and care. My deepest gratitude goes to my husband Peter for his advice and help with editing every written word, discussing results, and listening to practice presentations.  Finally I would like to thank all my professors, friends and classmates at University of British Columbia who have helped with the successful realization of my thesis.  viii  Chapter 1. Introduction. 1.1 Antibiotics It is now considered that microorganisms in all environments produce small biologically active molecules (25). Just a small number of these compounds attracted attention when their antibiotic properties were discovered in the 1940s (25). In the middle of the 20th century, antibiotics were defined as compounds produced by microorganisms to kill or inhibit the growth of other microbes, thus ensuring their own survival (25, 104). As such they have been isolated and marketed as drugs to combat infections.  The modes of action of antibiotics have been characterized and each class has a specific cellular target. For example: β-lactam antibiotics target penicillin-binding proteins, fluoroquinolones affect DNA gyrase; aminoglycosides bind to ribosomes. When transcriptome and proteome analysis of whole-cell responses was done, it was found that antibiotics induce changes in genes that do not encode the direct target of the antibiotic (25). Antibiotics from different classes modulate expression of different groups of genes in the same bacteria, whereas the same antibiotic can cause different changes in other bacteria (40, 56, 70). Microorganisms live in dynamic communities, therefore production and use of small signaling molecules as a means of communication seems logical (34, 104).  In many cases bacterial communication occurs via small molecules that are part of quorum sensing (QS) - systems found throughout the bacterial world and have been characterized for Vibrio fischeri, Pseudomonas aeruginosa, Erwinia carotovora, Agrobacterium tumifaciens, Burkholderia cepacia, and various species of Staphylococci, Enterococci and Streptomyces (26, 102). For instance in V. fischeri, LuxI is an autoinducer synthase that makes an acyl-homoserine lactone, which acts on a receptor LuxR to activate transcription of the luciferase operon luxICDEAB (102). In Staphylococcus aureus RNAII encodes a QS system, where AgrC and AgrA form the two-component signal transduction pathway (74). No longer are bacteria seen as just unicellular organisms, but rather as communities. The ability to act as a group presents  1  bacteria with numerous advantages such as: better access to nutrient supplies, and changes in behaviour such as sporulation and biofilm formation (26). It is not yet known if small molecules may act on bacteria similarly to QS autoinducers, however research has shown that low concentrations of antibiotics modulate gene expression, affect genes associated with QS and sometimes enhance or repress the virulence of pathogens (2, 25, 26, 39, 40, 104).  1.2 Transcription modulation by antibiotics It has been shown that sub-MIC (minimal inhibitory concentrations of) penicillin and vancomycin modulate transcription of a number of genes in Streptococcus pneumoniae such as: α-amylase, 4-α-glucotransferase, neuraminidase, adenylate kinase, lysine decarboxylase and others, demonstrating that a number of pathways are affected by subMIC antibiotics (82). Sub-MIC tetracycline, ciprofloxacin and tobramycin affect iron uptake, motility, biofilm formation, and response to oxidative stress in P. aeruginosa (57). Interestingly sub-MIC tobramycin induced biofilm formation in P. aeruginosa and in three clinical isolates of Escherichia coli, suggesting that there may be a common signaling pathway in Gram-negative organisms in response to aminoglycoside antibiotics (46).  Antibiotics exhibit hormesis (Fig. 1.1), a dosage-dependent effect, on biological functions (25, 104). As seen in figure 1.1, cell culture growth was not affected by sub-MIC antibiotics, whereas the transcription of about 5% of genes was modulated in bacteria (25, 104). In S. enterica serovar Typhimurium gene expression is up or downregulated 10-to 100-fold when in the presence of sub-MIC antibiotics (95).  1.3 Methods used to study effects of sub-MIC antibiotics To gain insights into the effects of sub-MIC antibiotics on bacteria, a variety of techniques have been used, including gene expression profiling using proteomic analysis, microarray technology and promoter-reporter constructs (25). While it is possible to learn what genes are expressed in the cell at one specific point in time using microarrays, the 2  promoter-lux reporter fusions (Fig.1.2) show the effects of sub-MIC antibiotics on gene transcription in live bacterial cells and therefore permit dynamic whole cell analysis.  Figure 1.1: Hormetic effects of antibiotics. Transcription level is changing with increase in concentration of the antibiotic that is still below the MIC, however the cell multiplication continues until a threshold is reached. Once the concentration of antibiotic reaches the MIC only a small number of genes are affected, whereas cell multiplication rapidly declines. Reproduced with modifications from Yim et al. (104)  The lux operon consists of five genes (ABCDE): luxCDE encode fatty acid reductase, essential for the conversion of fatty acids into the long-chain aldehyde; and luxAB encode luciferase, an enzyme that catalyzes the oxidation of a reduced flavin mononucleotide and the long-chain aldehyde resulting in the emission of a blue-green light at 490 nm (62). The original luxCDEAB operon was derived from Gram-negative bacteria: marine microorganisms, such as V. fisheri or V. harveyi, or a terrestrial microbe Photorhabdus luminescens. To ensure proper assessment of the gene expression in Gram-positive bacteria using promoter-lux reporters, the luxA, luxC and luxE genes were modified by 3  Figure 1.2 Promoter-lux reporter plasmid pAmiLux.  introducing a Gram-positive ribosome binding site and an appropriate promoter in front of the operon (64). Measuring light production by the cells carrying promoter-lux reporters allows quantification of a specific gene expression under particular conditions (37, 38, 40, 64, 95). Experiments have been done in the Davies laboratory using promoter-lux reporters in S. enterica serovar Typhimurium and E. coli, and it was found that approximately 5% of genes in both species were modulated by any given antibiotic (40, 95, 104). These findings are consistent with the idea that the binding of sub-MIC antibiotics to a cellular component can affect gene expression (40). Assessment of antibiotic treatment has been visualized during pneumococcal and staphylococcal infections in live mice using bacteria that were carrying promoter-lux-reporter constructs (37, 38, 91). Bioluminescence therefore provides a noninvasive and sensitive method for localization of infection and quantification of gene transcription.  Work in this thesis studies the effects of cell wall active antibiotics on virulence gene expression in S. aureus. The effects of sub-MIC antibiotics were tested on virulence gene expression and biofilm formation. The effects on protein interactions and virulence regulation in response to antibiotic stimulus are discussed.  1.4 Pathogenicity of Staphylococcus aureus. Staphylococcus aureus is a Gram-positive bacterium that can have commensal relationships with its host or establish a life-threatening infection. About 25-30% of the 4  human population have S. aureus as part of their normal flora, however this bacterium may also cause a wide range of diseases that include endocarditis, septicaemia, necrotizing pneumonia and toxic shock syndrome (4, 31). S. aureus is now one of the major causes of nosocomial and community-acquired infections, and is also the leading cause of implant-associated infections (3, 84).  S. aureus virulence is multifactorial: it produces a variety of cell-wall associated proteins that facilitate binding and adhesion to host factors, for instance fibronectin-binding, collagen-binding, elastin-binding, and other proteins (58). Staphylococcal protein A, encoded by spa, is a LPXTG anchored cell-wall protein crucial for evasion of the immune system (36). Spa binds Fc and Fab regions of immunoglobulins preventing opsonophagocytosis; and also interacts with von Willebrand factor, mediating intravascular infection (36, 44, 49). Spa expression is stimulated by a DNA-binding SarS protein, which is encoded in a gene upstream of spa (92). Expression of SarS is regulated by SarA and RNAIII, both of which inhibit SarS activity, thus downregulating spa transcription and expression (92).  S. aureus also secretes an array of toxins such as enterotoxins, exfoliating toxins, leukocidins, hemolysins, among others to evade immune system as well as to acquire nutrients by lysing host cells (58). Leukotoxins E and D are transcribed as an operon (78, 90) and their expression is enhanced by RNAIII when S. aureus cell density is high (41, 103). Leukotoxin E binds polymorphonucleocytes first and then leukotoxin D attaches to the cell, upon which both proteins oligomerize to open Ca++ channels, and allow the influx of Na+ and K+ ions thus lysing polymorphonucleocytes (90).  1.5 Virulence regulation in S. aureus Virulence factor expression and biofilm formation are regulated by a well-characterized accessory gene regulator (agr) that produces two transcripts: RNAII and RNAIII, transcribed from divergent promoters P2 and P3 (72). As seen from Figure 1.3, RNAII transcript is expressed to make a two-component QS system and an autoinducing peptide  5  (AIP). AgrD is modified and secreted by a transmembrane protein AgrB to make a peptide with a thiolactone ring that then binds to AgrC. When the concentration of AIP reaches a certain threshold, AgrC transfers a phosphate group to AgrA, a transcription activator, which then binds to both agrP2 and agrP3 promoters to enhance expression of RNAII and RNAIII (74). RNAIII is a regulatory RNA that turns on transcription of exoproteins and downregulates expression of cell-wall associated proteins (50, 72, 75). Through RNAIII, agr facilitates dispersal of bacterial cells from the biofilm by activating expression of secreted proteins that excise the cells from the biofilm (10).  Figure 1.3: Regulation of virulence determinants in S. aureus.  Staphylococcal accessory regulator A (SarA) affects transcription of genes encoding proteins with diverse functions by binding directly to the gene upstream of the –35 promoter box (18). SarA exercises modulatory effects on the agr operon and downregulates expression of a variety of virulence factors including: lipase, nuclease, protein A, fibronectin-binding proteins and other exotoxins and cell-wall associated proteins via agr-dependent and independent ways (14, 18). By binding to the promoter of 6  the gene encoding biofilm associated protein, SarA stimulates biofilm formation (7, 94). Pratten et al. demonstrated that expression of sarA influences how strongly S. aureus binds to a certain surface (77). The ability of S. aureus to form biofilms on implanted devices makes it very difficult to clear the infections, as the bacteria are more protected against antimicrobial compounds, and are also exposed to sub-inhibitory concentrations of antibiotics that facilitate the development of antibiotic resistance (35, 43).  1.6 Virulence modulation by sub-MIC antibiotics in S. aureus Since sub-MIC antibiotics change bacterial transcription, a significant concern is whether this occurs during the treatment of patients, potentially leading to enhanced virulence. Physiological concentrations of antibiotics administered during the treatment of an infection vary depending on the stability of the drug in the body and the method of administration (25, 68). During necrotizing pneumonia S. aureus cells are exposed to sub-MIC antibiotics due to poor drug diffusion in the areas of necrosis (11). It has been proposed that the type of pathogen, the severity of the disease, the patient’s physiology, and the pharmacokinetics and pharmacodynamics of the drug, influence the concentration of antibiotics present during antimicrobial treatment and therefore enhancing or decreasing virulence of a pathogen (25). Upon administration of an antibiotic some of the molecules would be bound by the proteins present in the serum, and only a fraction of the drug that is unbound will exercise the desired effects (68).  A number of virulence factors have been identified in S. aureus, among which PantonValentine leukocidin (PVL), an exoprotein, is arguably considered to be one of the major virulence factors in community-acquired methicillin resistant strains (31, 37, 38). PVL expression was enhanced by sub-MIC oxacillin, whereas clindamycin and fusidic acid downregulated its production (31). Other studies have demonstrated that sub-MIC cerulenin blocked transcription of the global regulators agr and sae (another twocomponent system) in S. aureus, whereas ciprofloxacin and trimethoprim enhanced expression of virulence factors (2, 39). It was suggested that depending on the interaction  7  of antibiotic with host proteins, antibiotic treatment may well lead to negative side effects in patients (28).  Due to the emergence of antibiotic resistant strains, it is becoming more difficult to treat staphylococcal infections (84). Multiple antibiotics are used simultaneously against S. aureus, and yet Ida et al. have found that combinations of aminoglycoside and βlactam antibiotics, that have been successful at treating infections caused by Grampositive cocci, were not effective against some methicillin-resistant S. aureus strains isolated in Japan (47). The proven method of using cell wall inhibitor in combination with a protein synthesis inhibitor to combat staphylococcal infections is no longer effective against the new generation of S. aureus. This case illustrates the need to have a deeper understanding of the physiological processes taking place within bacteria in microbial communities in response to antibiotic therapies.  To investigate the effects of sub-MIC antibiotics on virulence in S. aureus, several virulence genes promoter-luxABCDE reporters were constructed and tested for light production. Genes encoding an adhesin (Spa), a regulatory RNA (RNAIII) and a secreted protein (leukotoxin E) were chosen for transcription modulation by sub-MIC cell wall active antibiotics studies. Bacterial cell wall continues to be the primary target for antimicrobial therapy, therefore compounds from the β-lactam, glycoprotein and cyclic polypeptide classes were chosen for this study. Biofilm formation by S. aureus on biomaterials is an important virulence factor that contributes to numerous infections associated with implanted devices. If gene transcription is modulated by sub-MIC antibiotics, affecting expression of adhesins and secreted proteins, then antibiotics should also affect biofilm formation. Two hypotheses were formed: 1) the effects of sub-MIC cell wall active antibiotics on transcription of spa, rnaiii and lukE will differ; and 2) subMIC cell wall active antibiotics will affect biofilm formation in S. aureus.  8  1.7 Thesis objective. My objective was to investigate the effects of cell wall active antibiotics on virulence gene expression in different strains of S. aureus. This was addressed in the following ways: i) virulence genes promoters were cloned upstream of the luxABCDE operon in the pAmiLux vector; and electroporated into S. aureus NCTC 8325 derivatives and a clinical isolate S. aureus Newman; ii) disc diffusion assays were performed and transcription (the lux expression) was assessed; iii) transcription modulation was confirmed by performing quantitative reverse transcription polymerase chain reaction (qRT-PCR) and iv) effects of cell wall active antibiotics on biofilm formation were evaluated; v) a speculative model for the global effects of β-lactam antibiotic binding to penicillinbinding protein on gene expression was proposed; vi) future directions were suggested.  9  Chapter 2. Materials and methods 2.1 Bacterial strains and growth conditions. S. aureus and E. coli DH10B were grown at 370C in NYE and LB media, respectively. S. aureus strains were used as expression hosts for the promoter-lux reporter fusions (Table 2.1). Antibiotics were obtained from Sigma-Aldrich (Oakville, Ontario) and antibiotic discs were obtained from Becton Dickinson (BD, Mississauga, Ontario) and Difco (Table 2.2).  Table 2.1 Strains and plasmids used in this study Strain name or plasmid construct S. aureus 8325-4  Genetic background  Prophage cured strain of NCTC 8325 harbouring a 11-bp deletion in rsbU 8325-4 (Spa-) spa::kan of 8325-4 I10 hemB- small colony variant of 8325-4 RN4220 mutant strain of 8325-4 that accepts foreign DNA ALC 488 sarA::ermC of RN6390 (laboratory mutant of 8325-4) ALC 1927 sarS::ermC of RN6390 (laboratory mutant of 8325-4) Newman methicillin sensitive clinical isolate Newman (Spa ) spa::kan of Newman III33 hemB- small colony variant mutant of Newman COL methicillin resistant clinical isolate 675 methicillin sensitive clinical isolate  E. coli DH10B Plasmids pAmiLux pAmiSpa pAmiAgrP2 pAmiAgrP3 pAmiHlgC pAmiHlgA pAmiLukE  Ref.  (73) gift from T.J.Foster (98) (73) (73) (73) (32) gift from T.J.Foster (52) laboratory collection gift from L.Silverman (87)  S. aureus – E. coli shuttle vector luxABCDE spa-luxABCDE agrP2-luxABCDE agrP3-luxABCDE hlgC-luxABCDE hlgA-luxABCDE lukE-luxABCDE  (64) (64) This Study This Study This Study This Study This Study  10  2.2 Construction of plasmids carrying the promoter-lux reporter fusions. The nucleotide sequences for the spa, agrP2 and agrP3 promoters were retrieved from the S. aureus NCTC 8325 genome, whereas the nucleotide sequence for the lukE, hlgA and hlgC promoters was retrieved from the S. aureus Newman; and the primers were designed (Integrated DNA Technologies, Coralville, Iowa) to amplify the promoters of interest (Table 2.3). The following polymerase chain reaction (PCR) conditions were used: 940C for 5 minutes (initial denaturation); 35 cycles at 940C for 30 sec, 600C for 30 sec, 720C for 45 seconds and at 720C for 5 minutes. The PCR products were digested with BamHI (New England Biolabs (NEB), Pickering, Ontario), and ligated into the promoter cloning vector pAmiLux (64) using T4 ligase (NEB). Prior to ligation the vector was digested with BamHI and treated with shrimp alkaline phosphatase (NEB). The plasmid DNA constructs were then transformed into E. coli DH10B; and E. coli transformants selected on 1.5 % LB agar supplemented with 100 µg/ml of ampicillin. E. coli plasmid DNA was harvested and the promoter orientation was characterized by sequencing. The plasmid DNA was used to transform S. aureus RN4220. The plasmid DNA was then harvested from S. aureus RN4220 and electroporated into S. aureus 83254, its derivatives and S. aureus Newman using standard procedures (87). The S. aureus transformants were selected on NYE supplemented with 10 µg/ml of chloramphenicol (NYEC). Since the backbone of pAmiLux is pSK5645 (42), the plasmid was maintained at 3-5 copies per cell.  2.3 Genomic DNA isolation. Genomic DNA from S. aureus RN4220 was isolated and purified using DNeasy Tissue kit (Qiagen, Mississauga, Ontario) with some modifications. Once the samples were eluted from the column, the DNA was purified using phenol:chloroform (1:1). 50 µl of 3M sodium acetate was added to 500 µl of the top phase containing DNA and mixed with 350 µl isopropanol. The mixture was placed in the -200C freezer and 10 minutes later genomic DNA was pelleted by centrifugation at 14 000 rpm for 15 minutes at 40C. The supernatant was decanted and the DNA was then washed with 350 µl of 70% ethanol.  11  The genomic DNA was precipitated by centrifugation at 14 000 rpm for 5 minutes and resuspended in 100 µl of TE buffer.  Table 2.2 Primers used in this study Primer Name  Primer sequences (5’ to 3’)  Ref.  LuxAseq R-insert-pSKLux  TTGGGGAGGTTGGTATGTAAGC GGAGGGTGGCGGGCAGGACG  (63) This study  1. spa promoter F-spa-258 R-spa+7  (64) CGCGGATCCCCACTTTATTCTTAAAAA CGCGGATCCTGTATGTATTTGTAAAGTC  2. hlgA promoter F-hlgA R-hlgA  CGCGGATCCGCTCAAGAAACTGCATCATC CGCGGATCCGGCTAAAGGGGCTATTAAAC  3. hlgC promoter F-hlgC R-hlgC  CGCGGATCCGTACATTAAATTTAATAATA CGCGGATCCCATAAGTTTCACTTTCTTTC  4. lukE promoter F-lukE R-lukE  CGCGGATCCCATGTCTGTTCCTGTATGG CGCGGATCCCGGAGATGCTAAAGGTGCAA  5. agrP2 promoter F-agrP2 R-agrP2  This study  This study  This study  This study CGCGGATCCTCTTGTGCCATTGAAATCAC CGCGGATCCCTCTTTTGAAGATACGTGGC  6. agrP3 promoter F-agrP2 R-agrP3  CGCGGATCCTCTTGTGCCATTGAAATCAC CGCGGATCCGCCTAACTGTAGGAAATAAA  Real time – PCR L-luxA R-luxA  AGGTCGCATCTCTGAGGAGT CAATAGCGGCAGTTCCTACA  (64)  L-agrB R-agrB  ATGCTCCTGCAGCAACTAAA TTGAATGAATTGGGCAAATG  This study  L-spa R-spa  TAAACGAAGCGCAACGTAAC TTATCAGCTTTCGGTGCTTG  This study  This study  12  2.4 Plasmid DNA isolation. Plasmid DNA was isolated by alkaline lysis and phenol:chloroform (1:1) extraction from E. coli DH10B overnight cultures (2ml) grown in LB supplemented with 100 µg/ml of ampicillin extractions as previously described (85). Plasmid DNA was purified from 8 ml of S. aureus RN4220 overnight cultures grown in NYEC as previously described by Vriesema et al.(99) and using a plasmid mini kit (Qiagen). Enzymes for enzymatic lysis of S. aureus – lysostaphin, mutanolysin and lysozyme – were obtained from SigmaAldrich (Oakville, Ontario).  2.5 Transformation of E. coli DH10B. Chemically-competent E. coli DH10B cells were prepared as previously described (85). Overnight culture was used to inoculate fresh LB medium with E. coli DH10B and grown till OD600nm reached 0.4-0.6. The cells were pelleted by centrifugation at 4000 rpm for 3 minutes and then washed once in 0.1M CaCl2 chilled to 40C. Once the cells were pelleted by centrifugation, the cell pellet was resuspended in cold 0.1M CaCl2 and left on ice for 30 minutes. The cells were then pelleted by centrifugation at 4000 rpm for 1 minute and resuspended in a mixture of 0.1M CaCl2 and 20% glycerol. The cell suspension was aliquoted (70 µl) and used for transformation or stored at –800C for later use. When required aliquots were thawed on ice, mixed with 1 µl of ligation reaction, the tubes were left on ice for 30 minutes, heat-shocked at 370C for 1 minute and then put back on ice for 5 more minutes. 930 µl of LB was added to each tube and incubated for 1 hour at 370C shaking at 200rpm. The cell suspension was plated on LB agar supplemented with 100 µg/ml of ampicillin; and 24 hours later light production by single colonies was assessed.  2.6 Electroporation of S. aureus. S. aureus cells were prepared as previously described (87). Electrocompetent cells were prepared by inoculating 50 ml of B2 broth (25 g/L NaCl (Fisher), 10 g/L casamino acids (Sigma-Aldrich), 25 g/L yeast extract, 1 g/L K2HPO4 (BDH, Toronto, Ontario); pH was adjusted to 7.5 and after the B2 medium was sterilized and cooled down, 25% glucose (Fisher, Ottawa, Ontario) solution was added to make final concentration of 0.6 (v/v)). 13  The cultures were grown till OD600nm reached 0.4-0.6. The cells were washed three times with sterile distilled water and cells were pelleted by centrifugation at 4000 rpm for 5 minutes. The cells were then washed in 10% glycerol and resuspended in 700 µl of sterile cold 10% glycerol. Aliquots of cell suspension (70 µl) were stored in 1.5 ml eppendorf tubes and kept at –800C for later use. The aliquots were thawed on ice, mixed with 1-1.5 µl of plamid DNA and placed in 0.1cm cuvettes. Cells were electroporated using a BioRad Gene PulserTM (Mississauga, Ontario) at 100 Ω, 25 µF and 2.3 kV, resuspended in 1.0 ml B2 medium and incubated, shaking at 370C for 2 hours. B2 cell suspension was plated on NYEC and incubated for 24-48 hours at 370C. Single colonies were streaked on NYEC and light production was measured 24 hours later.  2.7 Verification of transformants. The orientation of the promoter with respect to the luxABCDE cassette was determined by performing PCR with gene specific primers in combination with the luxA primer (Table 3) using 35 cycles at 940C 30 s, 550C-580C for 30 s, and 720C for 1 min; promoters with the correct orientation were verified by sequencing (Macrogen Inc.).  2.8 Disc diffusion assays. A single colony of S. aureus from NYEC agar was resuspended in 200 µl sterile water. 50 µl of the cell suspension was mixed with 0.7% agar, and overlaid on NYEC agar plates. Paper discs containing selected antibiotics were placed on the overlay and the plates were incubated at 370C. After 20 h, inhibition zones were measured and luminescence responses were detected using a luminograph LB980 photon camera (Berthold).  2.9 Minimal inhibitory concentration determination. MIC for S. aureus was determined by growing overnight culture in 2 ml NYE broth and then diluting it 100 fold. Serial dilutions of antibiotic were prepared in NYE broth and  14  inoculated with diluted overnight culture. MIC was also determined by placing E-test strips (AB Biodisk, Solna, Sweden) on freshly streaked lawn of S. aureus cells.  2.10 Liquid luminescence assay. S. aureus RN4220, Newman and 8325-4 carrying pAmiLux, pAmiSpa, pAmiAgrP3, pAmiLukE were tested for light production in liquid culture. Cultures were grown in NYEC 370C overnight shaking at 200rpm and then diluted to make final OD600nm equal 0.1. 10 µl of methicillin at 1/4 and 1/8 MIC was added to 190 µl of culture. The assay was performed in 96-well microtiter plate and 24-well plates, incubated at 370C shaking at 200 rpm and the measurements were taken every hour for 7 hours. The luminescence (CPS) and cell density (A595nm) was measured using a Victor2 multilabel counter (Perkin-Elmer). Luminescence was also assessed by growing S. aureus Newman in 25 ml of NYEC in 250 ml baffled flasks at 370C shaking at 200rpm. Samples (850 µl) were removed every hour for 7 hours to measure cell density (A595nm) and luminescence (CPS) in a Victor2 multilabel counter.  2.11 Quantification of transcription. The effects of sub-MIC of antibiotics on transcription modulation were assessed using qRT-PCR. S. aureus Newman carrying promoter-lux reporters were spread on NYEC. An antibiotic disc was placed in the center of the plate and incubated at 370C for 16 to 18 hours. The cells surrounding the zone of inhibition were scraped off the plate and placed in RNAProtect Bacteria Reagent solution (Qiagen). As a negative control, the cells were scraped off the area that was not affected by antibiotic. RNA purification was done using Qiagen RNAeasy mini prep kit. QRT-PCR primers are listed in Table 2.2. QRT-PCR was done in 96-well microtiter PCR plates (Sarstedt) at the following conditions: 30 min at 420C for reverse transcription, followed by initial denaturation at 940C for 2 min and then for 40 cycles: 940C for 15 sec, 600C for 15 sec and 600C for 15 sec with data collection at 600C; at the end of the program the samples were held at 940C for 1 min, 600C for 30 sec and 940C for 30 sec in order to get dissociation curves. QRT-PCR was done using S. aureus Newman carrying pAmiSpa, pAmiAgrP3 and pAmiLukE constructs. 15  Amplification of the housekeeping gene encoding pyruvate kinase (pyk) was used to normalize the data. Expression of luxA was used as a positive control to confirm that the light production that is observed when doing disc diffusion assay corresponds to the promoter activation and can be used to measure expression of specific virulence gene. Each experiment was done in duplicate with a minimum of 4 samples for each target gene. Relative standard curve method was used to quantify transcription.  2.12 Biofilm formation assay. The procedure was done as previously described (30). Overnight cultures of S. aureus were adjusted to OD600nm equal 3.0 and then diluted 200-fold into fresh TSB medium supplemented with 0.25% glucose. 10 µl of antibiotic solution or sterile water was pipetted into each well of the 96-well round bottom polystyrene plate (Sarstedt, Nümbrecht, Germany) and then 190 µl diluted culture was dispensed into each well. Planktonic cells were removed 24 hours later, the biofilm washed three times with 300 µl water and stained with 200 µl per well of 0.1% safranin stain for 30 seconds (Fisher Scientific, Ottawa, Ontario). The stain was washed out and the plate was allowed to dry for several hours. The density of the biofilm was evaluated by dissolving it in 100% ethanol for 30 minutes and measuring absorbance at 490 nm using a microplate spectrophotometer SpectraMax 190 (Molecular Devices, Sunnyvale, California).  16  Chapter 3. Results 3.1 Plasmid construction and assessment of light production To investigate the effects of cell wall active antibiotics on transcription modulation of spa, lukE, rnaiii, agrDBAC, hlgA and hlgC promoter-lux reporter fusions were constructed using pAmiLux vector. Plasmids pAmiSpa, pAmiAgrP2, pAmiAgrP3 were obtained from the laboratory collection. The pAmiHlgA, pAmiHlgC and pAmiLukE were constructed in E. coli DH10B and electroporated into S. aureus RN4220, 8325-4 and Newman, as described in materials and methods. The pAmiAgrP2, pAmiHlgA and pAmiHlgC did not produce light in the above S. aureus strains either in the presence or absence of antibiotics, therefore they were not used to electroporate S. aureus ALC 488 (SarA-) or ALC 1927 (SarS-) due to the lack of control strain. The summary for light production in the absence of antibiotics is presented in Table 3.1. Relative light production was recorded a luminograph LB980 photon camera and subjectively judged for the intensity.  Table 3.1 Light production by promoter-lux reporter constructs in S. aureus in the absence of antibiotics on solid media. Strain 8325-4 RN4220 ALC488 (SarA-) pAmiLux pAmiSpa ++ ++ pAmiAgrP2 pAmiAgrP3 ++ pAmiLukE + ++ pAmiHlgA ND pAmiHlgC ND blank no light production + strength of light production ND not done  ALC1927 (SarS-)  Newman +  +  +++ +  ND ND  3.2 Transcription modulation of virulence genes by sub-MIC cell wall active antibiotics. S. aureus is one of the most important nosocomial and community acquired pathogens (3, 84). Using microarray technology it has been shown that sub-MIC cell wall active antibiotics affect a number of genes in S. aureus (61, 69, 96). Here the effects of sub-MIC cell wall active antibiotics: bacitracin, vancomycin, and β-lactam antibiotics including 17  compounds from penicillin, carbapenem and cephalosporin classes on transcription modulation of virulence genes in laboratory strains and a clinical isolate of S. aureus were compared using promoter-lux reporter fusions.  Figure 3.1. Transcription modulation of virulence genes in laboratory strains a) S. aureus RN4220 pAmiSpa; b) S. aureus 8325-4 pAmiLukE by sub-MIC cell wall active antibiotics. The central disc is water control. The pseudo color scale on the right shows light intensity from black (no activation) to white (the strongest light production).  Transcription of spa was slightly modulated by vancomycin in RN4220 strain (Fig. 3.1a). The lukE expression was enhanced by bacitracin, imipenem, cefoperazone, nafcillin, penicillin G and vancomycin in S. aureus 8325-4 (Fig. 3.1b). The stimulation of the lukE promoter by cloxacillin, bacitracin, cephalosporins, imipenem and vancomycin was stronger compared to the effects on the spa promoter in S. aureus ALC 488 (SarA-), (Fig. 3.2a); the effects of nafcillin and penicillin were weaker. The cephalosporins marginally activated the agrP3 promoter; otherwise no stimulatory effects on rnaiii expression could be observed (Fig. 3.2b). Spa expression is activated in early exponential phase, whereas lukE expression is stimulated in the late exponential phase in a cell density dependent manner. The dissimilarities seen in Figure 3.2a and 3.2c between the effects of sub-MIC antibiotics on spa and lukE transcription are consistent with the differences in protein  18  expression and appear to be independent of SarA. A different picture was seen when effects of sub-MIC antibiotics were investigated in S. aureus ALC1927 (SarS-).  Figure 3.2. Transcription modulation of virulence genes in SarA deficient strain S. aureus ALC 488 by sub-MIC cell wall active antibiotics: a) pAmiSpa; b) pAmiAgrP3; c) pAmiLukE. The central disc is water control. This is a representative of at least three independent experiments. The pseudo color scale on the right shows light intensity from black (no activation) to white (the strongest light production).  The agrP3 promoter was upregulated by cephalosporins and vancomycin (Fig. 3.3b), and neither spa nor lukE promoters were activated (Fig 3.3 a and c). SarS is a DNA-binding protein that stimulates spa transcription and downregulates α-toxin production (15, 92). In the SarS deficient strain, the spa and the lukE promoters were not active in the absence of antibiotics (Table 3.1); and sub-MIC antibiotics did not affect lukE or spa expression either (Fig. 3.3a and c). This suggests that antibiotics affect SarS expression first, which in turn influences spa and lukE expression. It is unknown if SarS affects leukotoxin E and D transcription, but because the lukE promoter did not activate luxABCDE expression in  19  the presence or absence of antibiotics and lukE-luxABCDE transcription was active in SarA deficient strain, it is possible that SarS may be implicated in the regulation of leukotoxin production.  Figure 3.3. Transcription modulation of virulence genes in SarS deficient strain S. aureus ALC 1927 by sub-MIC cell wall active antibiotics: a) pAmiSpa; b) pAmiAgrP3; c) pAmiLukE. The central disc is water control. This is a representative of at least three independent experiments. The pseudo color scale on the right shows light intensity from black (no activation) to white (the strongest light production).  It has been reported that expression profiles differ between clinical isolates and laboratory strains (9), therefore the effects of sub-MIC cell wall active antibiotics on virulence gene expression in S. aureus Newman were investigated (Fig. 3.4). Nafcillin, penicillin G, methicillin, imipenem and cephalothin enhanced activity of the spa promoter, whereas vancomycin, bacitracin, cloxacillin and cefoperazone had no effect (Fig. 3.4a). Sub-MIC antibiotics exercised very low stimulatory effects on the agrP3  20  promoter (Fig. 3.4b). The lukE promoter was stimulated by the same antibiotics as the spa promoter, but to a lesser extent (Fig. 3.4).  Figure 3.4. Transcription modulation of virulence genes in a clinical isolate S. aureus Newman by sub-MIC cell wall active antibiotics: a) pAmiSpa; b) pAmiAgrP3; c) pAmiLukE. The central disc is water control. This is a representative of at least three independent experiments. The pseudo color scale on the right shows light intensity from black (no activation) to white (the strongest light production).  It was surprising to observe the difference in the effects on spa and lukE exhibited by cephalosporins. Cephalothin, a first generation of cephalosporin drugs, activated the expression of spa and lukE, whereas cefoperazone, a third generation, showed no activation in S. aureus Newman. Similarly, cloxacillin did not affect expression of either spa or lukE (Fig. 3.4a and c); and vancomycin did not exercise any effects on virulence gene expression in S. aureus Newman either (Fig. 3.4). This suggests that the structure of antibiotic and its binding to the target may effect global transcription patterns.  21  3.3 Quantification of the transcription modulation. QRT-PCR was done on S. aureus Newman to confirm that sub-MIC antibiotics modulate transcription of virulence genes. It was found that spa expression was upregulated by nafcillin and cephalothin by two- and three- fold respectively, which confirms the disc diffusion assay results. QRT-PCR also confirmed that spa expression was not affected by vancomycin or fosfomycin. The agrB transcription was not affected by sub-MIC of these antibiotics, as expected, since expression from agrP2 is directly linked to the expression from the agrP3 promoters (Fig. 1.3); and agrP3 promoter was very weakly affected by sub-MIC of antibiotics when luminescence disc diffusion assays were performed.  3.4 Liquid luminescence assay. The effects of methicillin, cephalothin and nafcillin at a quarter and eighth of MIC were assessed in liquid cultures. S. aureus strains carrying the constructs were cultured in microtiter plates with final volume of 200 µl. No difference in light production was observed in the presence of sub-MIC methicillin, cephalothin or nafcillin, suggesting that these antibiotics do not affect virulence gene expression in liquid culture. S. aureus Newman was also grown in 25 ml of culture in the presence of sub-MIC methicillin, but no changes in light production were observed.  3.5 Biofilm formation assay. It was shown that S. aureus has an ability to make small colony variants, a subtype of bacteria that are resistant to aminoglycoside and β-lactam antibiotics, have decreased production of exotoxins, which allows them to evade detection by immune system and persist intracellularly (79). It has not been shown whether small colony variants can form biofilms and if this process is affected by sub-MIC antibiotics. S. aureus is now the leading cause of implant associated infections. The charge and hydrophobicity of the surface, adhesins, host proteins, α-toxin and other factors facilitate biofilm formation in S. aureus (23). Protein A is an adhesin and spa expression was strongly stimulated by the β-lactam antibiotics in S. aureus Newman, suggesting that exposure to sub-MIC antibiotics may affect S. aureus ability to form biofilms. The spa knock out mutants and 22  small colony variants of S. aureus Newman and 8325-4, strains III33 and I10 respectively, as well as SarS deficient strain ALC 1927 and a clinical isolate 675 strain, were examined for biofilm formation in the presence of sub-MIC methicillin, nafcillin, cephalothin and cefoperazone.  S. aureus Newman and its small colony variant, III33 strain, formed denser biofilms in the presence of sub-MIC cephalothin; the effect was more pronounced at one third and one quarter MIC (Fig. 3.5a). S. aureus 8325-4 was also affected to a lesser extent by subMIC cephalothin, which was observed only at one quarter MIC (Fig. 3.5b). Interestingly, no other antibiotic stimulated biofilm formation in S. aureus 8325-4 greater than 1.5 fold, whereas the small colony variant I10 was strongly affected by sub-MIC cefoperazone and methicillin (Fig.3.5b). The spa knock out mutants did not show any difference in biofilm formation, when compared to the wild type strains, except in the presence of cephalothin. The respective Spa deficient mutants of both the Newman and 8325-4 strains were not affected by cephalothin. This indicates that sub-MIC antibiotics affect biofilm formation in such a way, that in the absence of Spa, the phenotypic response to antibiotics is different compared to the wild type. S. aureus biofilm formation is facilitated by adhesins, and the observed different responses to cephalothin in biofilm formation between Spa knock out and wild type strains are consistent with this proposal (22). SubMIC nafcillin affected biofilm formation only in S. aureus ALC 1927, which formed a denser biofilm in the presence of this antibiotic (Fig. 3.5b). This can be explained since SarS has been characterized as a regulator of Spa expression (16, 92), however because it is part of the sar family, it has been suggested that SarS may be involved in biofilm development (17, 71). Our findings strengthen the notion that SarS may be involved in the process of biofilm formation.  23  Figure 3.5. Biofilm formation by S. aureus a) laboratory strains and b) clinical isolates in the presence of sub-MIC β-lactam antibiotics. This is an average of at least three independent experiments, and each experiment was done in triplicate. The star indicates that the difference is more than two-fold.  24  Chapter 4. Discussion 4.1 Transcription modulation by sub-MIC antibiotics in S. aureus. A number of antibiotics were investigated for their role in transcription modulation of virulence genes in S. aureus (Table 4.1). β-lactam antibiotics and other cell wall inhibitors were chosen for more detailed analysis, because β-lactam antibiotics continue to be the drug of choice either alone or in combination with other antimicrobial agents in treating staphylococcal infections.  SarA is a positive agr regulator and it stimulates RNAIII transcription (67). RNAIII represses protein A expression and other cell wall associated proteins, while enhancing transcription and translation of exotoxins such as leukocidin E and D (48). Transcription modulation by sub-MIC penicillin G and nafcillin was stronger in the SarA deficient strain compared to S. aureus RN4220, suggesting that antibiotics exercise their effect on spa by changing the expression of SarA (Table 4.1 and Fig 3.2a) Spa expression is downregulated by agr and SarA, hence it is possible that in the absence of SarA, sub-MIC antibiotics affect expression of spa activators, and therefore upregulate spa transcription.  SarS is a DNA-binding protein from the sar family that is known to stimulate spa expression (16). SarA inhibits SarS expression which results in spa downregulation (1618). The pAmiSpa did not produce light in S. aureus ALC 1927 strain due to the lack of SarS stimulation as expected (Table 3.1). The fact that antibiotics did not affect spa transcription, suggests that antibiotics affect expression of SarS, which in turn changes the spa transcription. In S. aureus ALC 488 (SarA-) the cephalosporins, as well as vancomycin, bacitracin and cloxacillin, stimulated lukE transcription, indicating that exoprotein production is enhanced by an antibiotic stimulus in the absence of SarA. The pAmiLukE was expressed in SarA deficient strain, but unexpectedly, the construct did not produce light in S. aureus ALC 1927 (SarS-) either in the presence or absence of antibiotics (Table 3.1,  25  Table 4.1 Summary of the difference in effects of antibiotics on transcription modulation of viruelnce genes in S. aureus Clone Antibiotic bacitracin cefoperazone cephalothin ciprofloxacin clindamycin cloxacillin cycloserine daptomycin erythromycin fosfomycin fusidic acid gentamicin imipenem meropenem methicillin minocycline mupirocin nafcillin oxacillin penicillin G polymixin B rifampin tetracycline tobramycin vancomycin  Newman Newman Newman ALC488 ALC488 ALC488 ALC1927 ALC1927 8325-4 8325-4 RN4220 pAmiSpa pAmiAgrP3 pAmiLukE pAmiSpa pAmiAgrP3 pAmiLukE pAmiSpa pAmiAgrP3 pAmiSpa pAmiLukE pAmiSpa 0 0 0 1 0 1 0 0 1 1 0-1 2 1 1 2 0 2 0 0 2 1 2 1 1 2-3 1 2 0 0-1 1 1 0 1 1 2-3 d d d 1 0-1 0-1 0-1 0 0-1 0-1 0 0-1 1 0 0 0 2 1 2 0 0 0 0-1 0 1 1 1 0 0 0 0 0 0 0 3 d d d d 1 2 0 1 2 0 0 2 0 1-2 0 0 0 0 d 0 d d 2 0-1 2 0-1 0-1 1 0 0-1 2-3 0-1 0 1 1 0 3 1 2 1 0-1 0-1 0 0 1 1 0-1 d d d 0 0 0 0 0 0 3 1 2 0 1 0 0 1 0 2 0-1 1 0 0 1 1 0 0 0-1 3 0 1 2 0 1 0 0 1 0 1 0 d 0 0 0 0 d d 0 1-2 0 0 0 1 0 1 0 2 1 2 1  d – downregulation; 0 – no stimulatory or inhibitory effect; 1 through 3 is the strength of upregulation; blank – not done Relative light production was recorded using luminograph LB980 photon camera. A numerical value was assigned to the light intensity based on the pseudo color scale.  26  Fig 3.3c). This suggests that SarS is a LukED positive regulator. It has been proposed that SarS could be involved in regulating other virulence factors (17), and here we show that SarS may be essential for stimulating lukED transcription.  It has been reported that gene expression profiles differ between laboratory and clinical isolates (9). Transcription modulation of virulence genes by sub-MIC of antibiotics was stronger in S. aureus Newman compared to the 8325-4 or RN4220 strains. Vancomycin did not stimulate spa, lukE or agrP3 promoters in S. aureus Newman (Fig. 3.4); and it was verified by performing qRT-PCR that vancomycin did not affect virulence gene transcription. Expression of spa and lukE was stimulated by penicillins and cephalothin in S. aureus Newman, suggesting that β-lactam antibiotics may facilitate bacterial pathogenesis. It has been proposed earlier that sub-MIC antibiotics enhance virulence in staphylococcal infection (24), and the data suggest that there could be an affect on protein interactions that results in changes in transcription patterns.  Figure 4.1. Chemical structures of antibiotics: a) penicillins and b) cephalosporins  The differences seen in the effects of β-lactam antibiotics on virulence gene expression (Fig. 3.4a and c) suggested that the effects on transcription are related to the structure of a given antibiotic. As seen in Figure 4.1 the difference between cloxacillin and oxacillin is the presence of a chlorine substitution at the phenyl ring, yet we find that the effects on spa and lukE transcription are drastically different (Fig. 3.4a and c, Table 4.1). Similar  27  differences are observed in the effects of cephalothin and cefoperazone – antibiotics from group I and II cephalosporins respectively.  4.2 Speculative model for transcription modulation by sub-MIC antibiotics. Studies in E. coli have shown that monofunctional penicillin-binding proteins (PBPs) are involved in cell division and they direct peptidoglycan elongation and insertion of peptidoglycan strands into the cell wall (27). Cell division is initiated by a bacterial homologue of tubulin – FtsZ, which works together with PBPs to ensure proper cell division and determine the cellular shape (97). Similarly, in S. pneumoniae, PBP1a colocalizes at the septum with FtsZ; and in B. subtilis deletion of PBP1 results in increase in cell length, strengthening the importance of FtsZ/PBP1 interaction (59). It was also reported that there is a conserved cell division protein interaction web between E. coli and S. pneumoniae (60). Maggi et al. showed that PBPs in both E. coli and  Figure 4.2 Speculative model for transcription modulation by sub-MIC antibiotics. βlactam antibiotic binds to PBP (solid arrow); which affects immediate interactions between PBP and other proteins (dashed arrow), leads to changes in interactions between other proteins (dotted arrow) and results in transcription modulation.  S. pneumoniae interact with two proteins: one that initiates septum formation (FtsL), and another one is an ATPase (FtsA). The cell division protein interaction web is portrayed in Figure 4.2. FtsA interacts with Z-ring associated protein (ZapA), and a GTPase (FtsZ). FtsL recruits DNA translocalase (FtsK) to cell division septum. FtsK interacts with FtsQ, 28  which in turn interacts with ZapA (60). Additionally, it was shown that PBP interacts with transglycosylases, flippases and other cell division proteins to ensure proper cell wall biosynthesis in E. coli (8). The PBPs bind β-lactam antibiotics via the β-lactam ring, thus the chemical groups surrounding the ring may obscure the sites on PBP which are interacting with other proteins involved in cell wall biosynthesis. Taking this into consideration, it is highly likely, that binding of a β-lactam antibiotic to its target interferes with expression or interactions with other proteins in the cell wall synthesis complex, which in a cascade reaction changes transcription patterns in S. aureus.  4.3 Effects of sub-MIC antibiotics on biofilm formation. It was observed that Spa, an adhesin, was strongly affected by β-lactam antibiotics in S. aureus Newman, and the effects of sub-MIC of antibiotics on biofilm formation were investigated. The clinical isolate Newman and its small colony variant III33 formed denser biofilm in the presence of sub-MIC cephalothin, showing that small colony variant responds to the antibiotic stimulus in a way similar to the wild type. Strangely, there was no such correlation observed with 8325-4 and I10 strains. It was reported that virulence expression differs between clinical isolates and laboratory strains (9), therefore the changes in response to antibiotics observed between wild type and its corresponding small colony variant could be due to the difference in protein expression in the wild type strains, S. aureus Newman and 8325-4.  A number of adhesins are involved in the initial attachment of S. aureus to a surface in order to form a biofilm; and it does not solely rely on Spa (22). Sub-MIC cephalothin did not affect biofilm formation in Spa mutants compared to the stimulation exhibited in wild type strains suggesting that antibiotics may change expression of Spa and other adhesins involved in biofilm formation and therefore it should be further investigated. Interestingly, ALC 1927, a SarS deficient mutant, was the only strain that formed denser biofilms in the presence of sub-MIC nafcillin. Our results suggest that SarS is able to exercise its effect on biofilm formation in the presence of sub-MIC antibiotics, an idea  29  that was proposed by Tegmark et al. (92). Overall, our results indicate that the effects of sub-MIC of antibiotics on bacterial physiology vary between strains.  4.4 S. aureus heterogeneity. All strains used in this study are agr type I, with the exception of S. aureus 675, for which agr type is not known; they are derivatives of NCTC 8325, with the exception of S. aureus Newman, its small colony variant - III33, and 675 strain (73). The link between the agr-type and a clinical syndrome has been shown, and it was concluded that selected virulence factors associate with a specific agr type (51). There is very little difference in the genetic elements that encode virulence factors in genomes of NCTC 8325 and Newman (5), yet significant differences were observed in the effects of sub-MIC antibiotics on transcription of the same virulence factors, exemplifying the importance of using clinical isolates for studying bacterial pathogenesis. It was also assumed that because S. aureus 8325-4 is the parent of S. aureus RN4220, ALC 488 and ALC 1927, the gene expression patterns and transcription modulation should be generally the same, with the exception of those genes that are controlled by either SarA or SarS (73). It is known that there is a mutation in S. aureus RN4220 at the 3’ end of agrA that delays RNAIII expression and results in delayed exoprotein production, when compared to S. aureus 8325-4 (93). This could be the reason why the pAmiSpa construct was expressed in the RN4220 strain, whereas the pAmiLukE was not.  4.5 Future directions. The severity of the disease caused by S. aureus depends on its genetic background, for instance, agr-type, and the pattern of virulence factors expression (51, 55, 76). To determine if an antibiotic will help or harm a patient, it is essential to evaluate which strain of S. aureus is causing the infection. Currently there are a number of ways to genotype S. aureus: spa-typing, PCR-DNA enzyme immunoassays, PCR-restriction endonuclease analysis, and quantitative real-time immuno-PCR (6). It has been documented that infections initiated by S. aureus in a certain geographical location result from one specific clone that has a certain virulence gene expression profile and an 30  antibiotic susceptibility that can be characterized (13). Knowing the genotype of the strain will allow clinicians to prescribe the most effective treatment and prevent virulence augmentation.  Currently a number of researchers use laboratory and clinical strains of S. aureus that were isolated from patients decades ago. S. aureus strains that are causing problems to healthcare community have arisen in the early 1990s (13), and to combat staphylococcal infections, it is crucial to understand the way antibiotics modulate transcription in these clinically relevant strains. Laboratory and clinical isolates of S. aureus produce proteins in different expression patterns, even when cultured in the same conditions (9). It is essential to use recent clinical isolates and make SarA, Rot, agr and knock out strains that lack other regulators, to investigate the effects of antibiotics. This will enhance our understanding of physiological changes that happen in the current S. aureus strains.  Antibiotics are important in saving human and animal lives, but their role in bacterial physiology remains poorly understood. Promoter-lux reporter fusions is a useful tool to study the effects of sub-MIC of antibiotics on gene transcription in vivo, and can be used in both Gram-positive and Gram-negative organisms (64). It allows the investigation of the efficacy of antibiotics, as well as effects of sub-MIC of antimicrobials on transcription modulation (37, 38, 40, 63). It is crucial to understand what genes are expressed when S. aureus is interacting with the host, and how its physiology is affected by the antimicrobial therapy. This can be achieved by making promoter-lux reporter fusions of the genes that are known to be expressed during infection, as well as of the genes that are expressed to regulate virulence, and other metabolic processes, in vivo. This reporting system will enable the visualization of changes in gene transcription when S. aureus is interacting with the host, how it is responding to the antimicrobial therapy; and provide information on potential vaccine targets.  31  Chapter 5. Antibiotic interactions 5.1 Introduction. The rapid emergence of resistance to antibiotics in S. aureus and other bacteria has stimulated the search for new therapeutic approaches to treat pathogenic microorganisms. Combination therapy, the use of two or more established antibiotics that are not effective if used alone, or if bacteria develop resistance rather quickly, became common practice after it was noticed that the use of penicillin, sulfonamides or streptomycin alone could not fully eliminate certain infections (33, 86, 89). Various methods are employed to investigate the efficiency of using two antibiotics simultaneously: checkerboard, disc diffusion, time-kill assays and Epsilometer tests (33). Checkerboard assay gets its name from the pattern that is formed by multiple dilutions of two antibiotics being tested. Time kill assay shows a dynamic picture of the effects of antibiotics, because it involves plate count for sampling of bacterial population at predetermined interval to investigate the bactericidal activity of the compounds. Disc diffusion assay allows observation of antibiotic interactions at the junction by placing discs containing antibiotics on agar plates (Fig. 5.1).  In the 1960s synergistic effects were observed between quinolone antibiotics and oxacillin, as well as between minocycline and rifampin, when used against methicillinresistant or gentamicin-resistant S. aureus (83, 105). Additionally, rifampin and fusidic acid acted synergistically, whereas trimethoprim and rifampin showed antagonism in killing S. aureus (88). Combinations of antibiotics have been recommended for other bacteria, including Klebsiella species, P. aeruginosa (19), B. cepacia (1) and A. baumannii (66). Most recently it was demonstrated that a combination of rifampin, fusidic acid and vancomycin was most effective against infections with staphylococcal biofilms (84). Daptomycin was shown to synergize with β-lactam antibiotics when used against MRSA (81).  Studies of the pharmacodynamics and pharmacokinetics of antibiotics show that the antimicrobial compounds have to reach a certain concentration to kill pathogens, but it is  32  unknown how specific combinations may affect bacteria at sub-inhibitory concentrations. Sub-MIC of ciprofloxacin was shown to induce a DNA repair system in S. aureus that bypasses lesions and errors in DNA to enable DNA replication (20). This process, known as the SOS response, causes changes in metabolism, enhances expression of non-essential polymerases and results in increased mutation rates, thus allowing for the development of antibiotic resistance in S. aureus (20). Sub-MIC of protein synthesis inhibitors affect expression of various genes in Bacillus subtilis involved in carbohydrate metabolism as well as protein synthesis and transport (56). Chait et al. have reported that a combination of two antibiotics used at sub-MIC may be more effective against bacteria, even if the microorganism is resistant to one of the drugs, because the combined effect alleviates the resistance (12). Understanding how sub-MIC antibiotics modulate gene expression allows us to appreciate the wide range of effects exhibited by small molecules in bacterial physiology and apply these in ways to potentiate discovery of active compounds.  Here I describe the use of five promoter-lux reporter constructs to study interactions of sub-MIC antibiotics on transcription modulation in S. aureus RN4220. Promoters for the genes encoding the following proteins were chosen for their light production in response to single antibiotics: thioredoxin A, translation factor EngA, epimerase CapD, peptidoglycan hydrolase endo-β-N-acetyl-glusoamidase (putative NagA), and MarR family transcription regulator.  5.2 Materials and methods. 5.2.1 Promoter-lux reporter library construction and screening. A random promoter-luxABCDE reporter library of 4608 clones (12 x 384-well plates) in S. aureus RN4220 was constructed by partially digesting genomic DNA with Sau3A and ligating the resulting fragments into the BamHI site of the lux-reporter plasmid pAmiLux (Fig. 1.2). Genomic DNA-reporter constructs were transformed into E. coli DH10B, the plasmid DNA was harvested and used to electroporate S. aureus RN4220. Luminescence measurements were taken in 384-well sterile, clear bottom microtiter plates with white opaque walls. Seed cultures were stored at –800C in NYEC supplemented with 20% (v/v) 33  glycerol. The 384-well seed culture plates containing the library were inoculated from the frozen stocks into NYEC medium using a 384-pin replicator and incubated overnight at 370C. The freshly inoculated screening plates were sealed with a Breathable Sealing Membrane (#163349, Nalge Nunc, Naperville, IL) and incubated at 370C, shaking at 200 rpm; absorbance and luminescence measurements were taken every hour using a Victor2 multilabel counter (Perkin-Elmer). The light producing clones were then selected and overnight liquid cultures (4ml) were grown from single colonies. 10 µl of water supplemented with 1, 0.5 and 0.25 ng/ml of penicillin G or vancomycin were pipetted into each designated well. For each clone, overnight culture was diluted to make the final OD600nm equal 0.1 and 190 µl were placed in each well in one column (four wells) of a 96-well plate.  5.2.3 Disc diffusion assay. A single colony of S. aureus from NYEC agar was resuspended in 200 µl sterile water, mixed with 0.7% agar at a dilution of 1:1000, and overlaid on NYEC agar plates. Paper discs containing selected antibiotics were placed on the overlay at specific distance to allow observation of interactions and the plates were incubated at 370C. After 20 h, inhibition zones were measured and luminescence responses were detected using a luminograph LB980 photon camera (Berthold).  5.3 Results. 5.3.1 Characterization of the selected clones. By screening promoter-lux reporter library with sub-MIC of pencillin G and vancomycin two constructs were identified, carrying promoters for thioredoxin A and a GTP-binding protein EngA. The three additional constructs were chosen for this study because of the similarity in responses to rifampin, ciprofloxacin and novobiocin. These three promoterlux reporter strains were made with the pGYLux vector, which is nearly identical to pAmiLux, except it lacks the Pami promoter in front of luxCDE (64). The three constructs carry promoters for putative NagA, mannosyl glycoprotein endo-β-N-acetyl34  glusoamidase, CapD protein, an NAD-dependent-epimerase from dehydratase family, and a gene for a transcription regulator from MarR family (Table 5.1) Table 5.1 Annotation for the promoter-lux reporter constructs Locus Tag Gene ID SAOUHSC_01100 3920742 SAOUHSC_01492 3920247 SAOUHSC_01895 3920842 SAOUHSC_00694 3920998 SAOUHSC_00535 3920815  Gene Name trxA engA marR capD  Protein Function DNA synthesis and protein repair protein translation peptidoglycan turnover transcription regulation polysaccharide biosynthesis  5.3.2 Characterization of antibiotic interactions. In this study a number of antibiotic combinations were tested for their effects on transcription modulation at sub-MIC. The antibiotics were chosen because of the differences in their modes of action (Table 5.2), as well as proposed efficacy in therapy. To characterize the interactions, I measured spatial orientations of the discs to ensure the zones of inhibitions were not overlapping. The results for the interactions are summarized in Table 5.3. The zones of inhibition around each antibiotic were round and sharp (Fig. 5.3). The intensity of the promoter activation was recorded in false color, which ranged from low (black) to high (yellow).  Table 5.2 Antibiotics, their abbreviation and class Antibiotic novobiocin gentamicin kanamycin penicillin G ciprofloxacin naldixic acid ofloxacin vancomycin telithromycin daptomycin erythromycin rosamycin spiramycin rifampicin minocycline fusidic acid  NVB GEN KAN PEN G CIP NA OFL VAN TEL DAP ERY ROS SPR RIF MIN FUS  Class aminocoumarin aminoglycoside aminoglycoside β-lactam fluoroquinolone fluoroquinolone fluoroquinolone glycopeptide ketolide lipopeptide macrolide macrolide macrolide rifampicin tetracycline  Mode of Action (Target) DNA synthesis inhibition (GyrB) Protein synthesis inhibition (30S subunit) Protein synthesis inhibition (30S subunit) Cell wall synthesis inhibition (PBP) DNA synthesis inhibition (GyrA) DNA synthesis inhibition (GyrA) DNA synthesis inhibition (GyrA) Cell wall synthesis inhibition (d-Ala-d-Ala) Protein synthesis inhibition (50S subunit) Cell wall synthesis Protein synthesis inhibition (50S subunit) Protein synthesis inhibition (50S subunit) Protein synthesis inhibition (50S subunit) Transcription inhibition (RNA polymerase) Protein synthesis inhibition (16S r RNA) Protein synthesis inhibition (EF-G) 35  Figure 5.1: Conventional disc diffusion  Figure 5.2: Luminescence disc diffusion  assay. a) no interactions: the zones are  assay. a) conventional result for growth  round and sharp, b) antagonism is  inhibition showing no interaction. Light  portrayed as truncated convex of the  production using promoter – lux reporter  zone produced by one antibiotic on the  showing b) no interaction: zones are  side that is exposed to sub-MIC of  round and sharp, c) synergy: one zone  another antibiotic, c) synergy: the zone  elongates toward the other compound, d)  of inhibition is stretched, showing  antagonism: the light production is  enhanced killing of bacteria, or  decreased in the presence of second  antibiotics produce a clearing at  antibiotic.  concentrations where neither antibiotic alone would have inhibited growth.  Ciprofloxacin and rifampicin exhibited antagonism when activating expression of the capD and marR promoters. This effect is depicted as a straight line in differential light production at the border between the two zones of inhibition (Fig. 5.3.a and c). Synergy was observed between ciprofloxacin and rifampicin when tested using the nagA promoter-lux reporter construct (Fig. 5.3b). In the cases of trxA and engA, antagonism was observed between ciprofloxacin and rifampicin as well as rifampicin and novobiocin, but no interaction was seen between ciprofloxacin and novobiocin (Table 5.3).  36  Figure 5.3: Comparison between growth inhibition and promoter activation that portrays synergism and antagonism between antibiotics. a) CapD; b) endo-β-N-acetylglucosaminidase; c) MarR family transcription regulator. Filled yellow arrows point at synergism, thin non-filled arrow points at antagonism. RIF – rifampicin, CIP – ciprofloxacin, NOV – novobiocin. These results are representative of three independent experiments. The yellow arrows point to the zones of antagonism (a) or synergy (b and c).  The interactions between ciprofloxacin and rifampicin are further portrayed in Figure 5.4, where the distance between the discs was slightly increased. The area between the zones of inhibition is pink for rifampicin, compared to pale blue at the other end of the disc that is the furthest away from the disc containing ciprofloxacin, suggesting that both antibiotics act in synergy at specific sub-MIC. The interaction changed into antagonism with increasing concentrations of rifampin and decreasing concentrations of ciprofloxacin (Fig 5.4a). This effect was not observed between novobiocin and rifampin, where the area between the zones of inhibition produced two-fold stronger light compared to the zone around a single antibiotic, respectively (Fig. 5.4b). The nagA promoter was strongly stimulated by sub-MIC of both rifampicin and erythromycin (Fig. 5.5a). Strong synergy was also observed between minocycline and  37  vancomycin (Fig. 5.5b). The same assay was done with capD and marR promoters, but neither synergy nor antagonism was observed (Table 5.3).  Figure 5.5: Endo-β-N-acetylglucosaminidase promoter activation in response to a combination of two Figure 5.4. Endo-β-N-acetyl-  antibiotics. a) Response to rifampicin  glucosaminidase promoter activation in  (RIF) and erythromycin (ERY); b)  response to a) rifampicin (RIF) and  response to minocycline (MIN) and  ciprofloxacin (CIP); b) rifampicin and  vancomycin (VAN). Representative of  novobiocin (NVB). Representative of  three independent experiments. The  three independent experiments. The  yellow arrows point to the zones of  pseudo color scale on the right shows  synergy that are observed when using  light intensity from black (no activation)  promoter-lux reporter and otherwise not  to white (the strongest light).  visible when assessing only the growth inhibition. The pseudo color scale on the right shows light intensity from black (no activation) to white (the strongest light).  38  Table 5.3 Summary for antibiotic interactions Constructs Antibiotics NagA CapD MarR TrxA CIP + RIF * 2 (-) N RIF + NVB 3 (-) N NVB + CIP N 1 1 RIF + ERY 3 N N ND MIN + RIF 1 ND MIN + NVB 2 0-1 MIN + VAN (-) (-) CIP + ERY (-) (-) (-) ND CIP + ROS (-) (-) (-) ND CIP + FUS (-) (-) (-) ND CIP + GEN (-) (-) (-) CIP + SPR (-) (-) ND NVB + GEN (-) 1 PEN G + GEN (-) (-) (-) PEN G + FOS 1 N 1 PEN G + DAP 1 2 1 RIF + VAN N VAN + GEN N OFL + TEL (-) (-) ND OFL + ROS (-) (-) ND OFL + SPR (-) (-) ND DAP + KAN (-) N ND NA + TEL (-) (-) ND NA + ROS (-) (-) ND NA + SPR (-) (-) ND NA + ERY (-) (-) ND 0-3 strength of synergy ( - ) antagonism N – no interaction Blank – inconclusive data ND – not done *Antibiotic abbreviations are in Table 5.2  EngA  ND ND  ND ND ND (-) ND (-)  ND ND ND ND ND ND ND ND  The antagonistic interactions between gentamicin/penicillin G and gentamicin/ciprofloxacin are portrayed in figure 5.6. Penicillin G and ciprofloxacin upregulated expression of MarR, CapD, TrxA and EngA, but in the presence of gentamicin, stimulation is decreased. Similar results were observed when using S. aureus Newman carrying virulence genes promoter-lux reporter constructs (Fig. 5.7).  39  Figure 5.7. Antagonistic interactions between penicillin G and gentamicin; ciprofloxacin and gentamicin in S. aureus Newman carrying: a) pAmiSpa; b) Figure 5.6. Antagonistic interactions  pAmiAgrP3; c) pAmiLukE.  observed between penicillin G and gentamicin; ciprofloxacin and gentamicin in S. aureus RN4220 carrying promoterreporter fusions for genes encoding: a) NagA, b) MarR, c) CapD, d) TrxA, e) EngA.  5.4 Discussion. Combination therapy has been used for decades to clear infections caused by pathogenic bacteria. The decision to use two or more antibiotics was generally made because the bacteria were resistant to one antibiotic or to decrease the frequency of resistance development (33). 40  Synergistic effects of ciprofloxacin and rifampicin on S. aureus growth inhibition were observed in a rabbit endocarditis model, and later it was recorded in a randomized clinical trial that this antibiotic combination decreased the rate of mutations that may contribute to development of antibiotic resistance (53, 54). Better clearance of staphylococcal infections, both sensitive and resistant to methicillin was observed when rifampin was used together with novobiocin (100, 101).  A number of antibiotic combinations influence different transcription patterns of modulation on various genes bacteria are exposed to sub-MIC. Some antibiotics showed no stimulatory or inhibitory effects on a specific promoter-lux reporter construct, therefore the effects of a combination of antibiotics could not be observed (Table 5.3). It is difficult to predict the interactions of two antibiotics on a specific gene, even when knowing the effects of a single antibiotic. Furthermore, the effect of a combination of two compounds is concentration dependent; for instance, ciprofloxacin and rifampicin stimulated nagA expression to a different extent, yet in the presence of both antibiotics transcription modulation patterns changed from synergy to antagonism (Fig. 5.4a). It has been shown that exposure of bacteria to β-lactam or fluoroquinolone drugs may induce the SOS response, which affects mutation rate and may result in the development of antibiotic resistance (63, 65). The antagonistic effects that are observed in this study between gentamicin and penicillin G or ciprofloxacin suggest that these two antibiotics are successful in clinical therapy not only because of the synergistic inhibitory effects on bacterial growth, but possibly also because of antagonism at the transcription level, which may inhibit the SOS response and therefore decreases the fitness of bacteria.  Low concentrations of antibiotics affect a number of functions in both prokaryotic organisms and their eukaryotic hosts (95). My results are consistent with the idea that antibiotics of various modes of action activate the expression of genes encoding proteins of diverse cellular functions (95). Although the mode of action of antimicrobial compounds is reasonably well understood, it still remains unknown how antibiotics exercise their effects on transcription.  There are a number of reports that show successful application of combination antimicrobial therapy to eradicate Gram-positive bacteria (21, 80, 81). Combinations of antibiotics used at sub41  MIC were shown to be effective at eliminating the pathogen without causing increase in resistance to the drugs (12, 29, 45). For instance, oxacillin was found to be effective against MRSA when used together with sub-MIC of vancomycin (29). Chait et al. have reported that a combination of doxycycline and erythromycin at sub-MIC was synergistic at eliminating both doxycycline-resistant and sensitive E. coli, whereas the wild type survived in the presence of doxycycline and ciprofloxacin at sub-MIC, and the resistant strain perished (12). This suggests that certain combinations may be effective at alleviating antibiotic resistance in bacteria, thus making them more susceptible to antimicrobial therapy (12). Hegreness et al. have found that E. coli develops resistance to a synergistic combination of antibiotics faster than to an antagonistic one, proposing that it may be better to use antagonistic combinations of drugs to forestall emergence of antibiotic resistance (45).  Using promoter-lux reporter constructs I have identified novel antibiotic interactions, for instance, minocycline and novobiocin or vancomycin, fluoroquinolone and macrolide compounds, daptomycin and kanamycin, novobiocin and gentamicin (Table 5.2). These combinations should be further investigated for their inhibitory effects, as well as the incidence of resistance development in S. aureus. Using promoter-lux reporters to study the effects of combinations of sub-MIC antibiotics on gene expression may reveal novel therapeutic approaches for treating bacterial infections, as well as allow discovery of new drugs.  42  Chapter 6. References 1.  Aaron, S. D., W. Ferris, D. A. Henry, D. P. Speert, and N. E. Macdonald. 2000. Multiple combination bactericidal antibiotic testing for patients with cystic fibrosis infected with Burkholderia cepacia. Am J Respir Crit Care Med 161:1206-12.  2.  Adhikari, R. P., and R. P. Novick. 2005. Subinhibitory cerulenin inhibits staphylococcal exoprotein production by blocking transcription rather than by blocking secretion. Microbiology 151:3059-69.  3.  Appelbaum, P. C., and M. R. Jacobs. 2005. Recently approved and investigational antibiotics for treatment of severe infections caused by Gram-positive bacteria. Curr Opin Microbiol 8:510-7.  4.  Arvidson, S., and K. Tegmark. 2001. Regulation of virulence determinants in Staphylococcus aureus. Int J Med Microbiol 291:159-70.  5.  Baba, T., T. Bae, O. Schneewind, F. Takeuchi, and K. Hiramatsu. 2008. Genome sequence of Staphylococcus aureus strain Newman and comparative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J Bacteriol 190:300-10.  6.  Becker, K., G. Bierbaum, C. von Eiff, S. Engelmann, F. Gotz, J. Hacker, M. Hecker, G. Peters, R. Rosenstein, and W. Ziebuhr. 2007. Understanding the physiology and adaptation of staphylococci: a post-genomic approach. Int J Med Microbiol 297:483-501.  7.  Beenken, K. E., P. M. Dunman, F. McAleese, D. Macapagal, E. Murphy, S. J. Projan, J. S. Blevins, and M. S. Smeltzer. 2004. Global gene expression in Staphylococcus aureus biofilms. J Bacteriol 186:4665-84.  8.  Bertsche, U., T. Kast, B. Wolf, C. Fraipont, M. E. Aarsman, K. Kannenberg, M. von Rechenberg, M. Nguyen-Disteche, T. den Blaauwen, J. V. Holtje, and W. Vollmer. 2006. Interaction between two murein (peptidoglycan) synthases, PBP3 and PBP1B, in Escherichia coli. Mol Microbiol 61:675-90.  9.  Blevins, J. S., K. E. Beenken, M. O. Elasri, B. K. Hurlburt, and M. S. Smeltzer. 2002. Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect Immun 70:470-80.  10.  Boles, B. R., and A. R. Horswill. 2008. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 4:e1000052. 43  11.  Cars, O. 1990. Pharmacokinetics of antibiotics in tissues and tissue fluids: a review. Scand J Infect Dis Suppl 74:23-33.  12.  Chait, R., A. Craney, and R. Kishony. 2007. Antibiotic interactions that select against resistance. Nature 446:668-71.  13.  Chambers, H. F., and F. R. Deleo. 2009. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol 7:629-41.  14.  Cheung, A. L., J. M. Koomey, C. A. Butler, S. J. Projan, and V. A. Fischetti. 1992. Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr. Proc Natl Acad Sci U S A 89:6462-6.  15.  Cheung, A. L., K. A. Nishina, M. P. Trotonda, and S. Tamber. 2008. The SarA protein family of Staphylococcus aureus. Int J Biochem Cell Biol 40:355-61.  16.  Cheung, A. L., Schmidt, K., Bateman, B. and Manna, A. C. 2001. SarS, a SarA Homolog Repressible by agr, is an Activator of Protein A Synthesis in Staphylococcus aureus. Infection and Immunity 69:8.  17.  Cheung, A. L., and G. Zhang. 2002. Global regulation of virulence determinants in Staphylococcus aureus by the SarA protein family. Front Biosci 7:d1825-42.  18.  Chien, Y., A. C. Manna, S. J. Projan, and A. L. Cheung. 1999. SarA, a global regulator of virulence determinants in Staphylococcus aureus, binds to a conserved motif essential for sar-dependent gene regulation. J Biol Chem 274:37169-76.  19.  Chow, J. W., and V. L. Yu. 1999. Combination antibiotic therapy versus monotherapy for gram-negative bacteraemia: a commentary. Int J Antimicrob Agents 11:7-12.  20.  Cirz, R. T., M. B. Jones, N. A. Gingles, T. D. Minogue, B. Jarrahi, S. N. Peterson, and F. E. Romesberg. 2007. Complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J Bacteriol 189:531-9.  21.  Cottagnoud, P., M. Johnson, M. Cottagnoud, and L. Piddock. 2005. Preincubation of pneumococci with beta-lactams alone or combined with levofloxacin prevents quinoloneinduced resistance without increasing intracellular levels of levofloxacin. Antimicrob Agents Chemother 49:3517-9.  22.  Cramton, S. E., and Goetz, F. 2004. Biofilm development in Staphylococcus, p. 64-84. In M. Ghannoum, and O'Tolle, G.A. (ed.), Microbial Biofilms. ASM Press, Washington, DC. 44  23.  Cramton, S. E., Gerke, C., Schnell, N. F., Nichols, W. W., Gotz, F. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun 67:5427-33.  24.  Dancer, S. J. 2008. The effect of antibiotics on methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother 61:246-53.  25.  Davies, J., G. B. Spiegelman, and G. Yim. 2006. The world of subinhibitory antibiotic concentrations. Curr Opin Microbiol 9:445-53.  26.  de Kievit, T. R., and B. H. Iglewski. 2000. Bacterial quorum sensing in pathogenic relationships. Infect Immun 68:4839-49.  27.  de Pedro, M. A., J. C. Quintela, J. V. Holtje, and H. Schwarz. 1997. Murein segregation in Escherichia coli. J Bacteriol 179:2823-34.  28.  Dobson, C. M. 2004. Chemical space and biology. Nature 432:824-8.  29.  Domaracki, B. E., A. M. Evans, and R. A. Venezia. 2000. Vancomycin and oxacillin synergy for methicillin-resistant staphylococci. Antimicrob Agents Chemother 44:13946.  30.  Doyle, R. J. 1999. Biofilms, vol. 310. Academic Press.  31.  Dumitrescu, O., S. Boisset, C. Badiou, M. Bes, Y. Benito, M. E. Reverdy, F. Vandenesch, J. Etienne, and G. Lina. 2007. Effect of antibiotics on Staphylococcus aureus producing Panton-Valentine leukocidin. Antimicrob Agents Chemother 51:15159.  32.  Duthie, E. S., and L. L. Lorenz. 1952. Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 6:95-107.  33.  Eliopoulos, G. M., and R. C. Moellering. 1991. Antibiotic combinations, Fourth ed. Williams and Wilkins.  34.  Fajardo, A., and J. L. Martinez. 2008. Antibiotics as signals that trigger specific bacterial responses. Curr Opin Microbiol 11:161-7.  35.  Fitzpatrick, F., H. Humphreys, and J. P. O'Gara. 2005. The genetics of staphylococcal biofilm formation--will a greater understanding of pathogenesis lead to better management of device-related infection? Clin Microbiol Infect 11:967-73.  36.  Foster, T. J., and M. Hook. 1998. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 6:484-8. 45  37.  Francis, K. P., D. Joh, C. Bellinger-Kawahara, M. J. Hawkinson, T. F. Purchio, and P. R. Contag. 2000. Monitoring bioluminescent Staphylococcus aureus infections in living mice using a novel luxABCDE construct. Infect Immun 68:3594-600.  38.  Francis, K. P., J. Yu, C. Bellinger-Kawahara, D. Joh, M. J. Hawkinson, G. Xiao, T. F. Purchio, M. G. Caparon, M. Lipsitch, and P. R. Contag. 2001. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun 69:3350-8.  39.  Goerke, C., J. Koller, and C. Wolz. 2006. Ciprofloxacin and trimethoprim cause phage induction and virulence modulation in Staphylococcus aureus. Antimicrob Agents Chemother 50:171-7.  40.  Goh, E. B., G. Yim, W. Tsui, J. McClure, M. G. Surette, and J. Davies. 2002. Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of antibiotics. Proc Natl Acad Sci U S A 99:17025-30.  41.  Gravet, A., D. A. Colin, D. Keller, R. Girardot, H. Monteil, and G. Prevost. 1998. Characterization of a novel structural member, LukE-LukD, of the bi-component staphylococcal leucotoxins family. FEBS Lett 436:202-8.  42.  Grkovic, S., M. H. Brown, K. M. Hardie, N. Firth, and R. A. Skurray. 2003. Stable low-copy-number Staphylococcus aureus shuttle vectors. Microbiology 149:785-94.  43.  Hall-Stoodley, L., J. W. Costerton, and P. Stoodley. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2:95-108.  44.  Hartleib, J., Kohler, N., Dickinson, R.B., Chhatwal, G.S., Sixma, J.J., Hartford, O.M., Foster, T.J., Peters, G., Kehrel, B.E., Herrmann, M. 2000. Protein A is the von Willebrand factor binding protein on Staphylococcus aureus. Blood 96: 2149–2156.  45.  Hegreness, M., N. Shoresh, D. Damian, D. Hartl, and R. Kishony. 2008. Accelerated evolution of resistance in multidrug environments. Proc Natl Acad Sci U S A 105:1397781.  46.  Hoffman, L. R., D. A. D'Argenio, M. J. MacCoss, Z. Zhang, R. A. Jones, and S. I. Miller. 2005. Aminoglycoside antibiotics induce bacterial biofilm formation. Nature 436:1171-5.  46  47.  Ida, T., R. Okamoto, M. Nonoyama, K. Irinoda, M. Kurazono, and M. Inoue. 2002. Antagonism between aminoglycosides and beta-lactams in a methicillin-resistant Staphylococcus aureus isolate involves induction of an aminoglycoside-modifying enzyme. Antimicrob Agents Chemother 46:1516-21.  48.  Iwatsuki, K., O. Yamasaki, S. Morizane, and T. Oono. 2006. Staphylococcal cutaneous infections: invasion, evasion and aggression. J Dermatol Sci 42:203-14.  49.  Jansson, B., M. Uhlen, and P. A. Nygren. 1998. All individual domains of staphylococcal protein A show Fab binding. FEMS Immunol Med Microbiol 20:69-78.  50.  Janzon, L., and S. Arvidson. 1990. The role of the delta-lysin gene (hld) in the regulation of virulence genes by the accessory gene regulator (agr) in Staphylococcus aureus. Embo J 9:1391-9.  51.  Jarraud, S., Mougel, C., Thioulouse, J., Lina,G., Meugnier, H., Forey, F., Nesme, X., Etienne, J., and Vandenesch, F. 2002. Relationships between Staphylococcus aureus Genetic Background, Virulence Factors, agr Groups (Alleles), and Human Disease. Infection and Immunity 70:631-641.  52.  Jonsson, I. M., C. von Eiff, R. A. Proctor, G. Peters, C. Ryden, and A. Tarkowski. 2003. Virulence of a hemB mutant displaying the phenotype of a Staphylococcus aureus small colony variant in a murine model of septic arthritis. Microb Pathog 34:73-9.  53.  Kaatz, G. W., S. M. Seo, S. L. Barriere, L. M. Albrecht, and M. J. Rybak. 1989. Ciprofloxacin and rifampin, alone and in combination, for therapy of experimental Staphylococcus aureus endocarditis. Antimicrob Agents Chemother 33:1184-7.  54.  Kang, S. L., M. J. Rybak, B. J. McGrath, G. W. Kaatz, and S. M. Seo. 1994. Pharmacodynamics of levofloxacin, ofloxacin, and ciprofloxacin, alone and in combination with rifampin, against methicillin-susceptible and -resistant Staphylococcus aureus in an in vitro infection model. Antimicrob Agents Chemother 38:2702-9.  55.  Karlsson, A., and S. Arvidson. 2002. Variation in extracellular protease production among clinical isolates of Staphylococcus aureus due to different levels of expression of the protease repressor sarA. Infect Immun 70:4239-46.  56.  Lin, J. T., M. B. Connelly, C. Amolo, S. Otani, and D. S. Yaver. 2005. Global transcriptional response of Bacillus subtilis to treatment with subinhibitory  47  concentrations of antibiotics that inhibit protein synthesis. Antimicrob Agents Chemother 49:1915-26. 57.  Linares, J. F., I. Gustafsson, F. Baquero, and J. L. Martinez. 2006. Antibiotics as intermicrobial signaling agents instead of weapons. Proc Natl Acad Sci U S A 103:19484-9.  58.  Lowy, F. D. 1998. Staphylococcus aureus infections. N Engl J Med 339:520-32.  59.  Macheboeuf, P., C. Contreras-Martel, V. Job, O. Dideberg, and A. Dessen. 2006. Penicillin binding proteins: key players in bacterial cell cycle and drug resistance processes. FEMS Microbiol Rev 30:673-91.  60.  Maggi, S., O. Massidda, G. Luzi, D. Fadda, L. Paolozzi, and P. Ghelardini. 2008. Division protein interaction web: identification of a phylogenetically conserved common interactome between Streptococcus pneumoniae and Escherichia coli. Microbiology 154:3042-52.  61.  McCallum, N., G. Spehar, M. Bischoff, and B. Berger-Bachi. 2006. Strain dependence of the cell wall-damage induced stimulon in Staphylococcus aureus. Biochim Biophys Acta 1760:1475-81.  62.  Meighen, E. A. 1993. Bacterial bioluminescence: organization, regulation, and application of the lux genes. Faseb J 7:1016-22.  63.  Mesak, L. R., V. Miao, and J. Davies. 2008. Effects of subinhibitory concentrations of antibiotics on SOS and DNA repair gene expression in Staphylococcus aureus. Antimicrob Agents Chemother 52:3394-7.  64.  Mesak, L. R., G. Yim, and J. Davies. 2009. Improved lux reporters for use in Staphylococcus aureus. Plasmid 61:182-7.  65.  Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer, and S. N. Cohen. 2004. SOS response induction by beta-lactams and bacterial defense against antibiotic lethality. Science 305:1629-31.  66.  Montero, A., J. Ariza, X. Corbella, A. Domenech, C. Cabellos, J. Ayats, F. Tubau, C. Borraz, and F. Gudiol. 2004. Antibiotic combinations for serious infections caused by carbapenem-resistant Acinetobacter baumannii in a mouse pneumonia model. J Antimicrob Chemother 54:1085-91.  48  67.  Morfeldt, E., K. Tegmark, and S. Arvidson. 1996. Transcriptional control of the agrdependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol Microbiol 21:1227-37.  68.  Mueller, M., A. de la Pena, and H. Derendorf. 2004. Issues in pharmacokinetics and pharmacodynamics of anti-infective agents: kill curves versus MIC. Antimicrob Agents Chemother 48:369-77.  69.  Muthaiyan, A., J. A. Silverman, R. K. Jayaswal, and B. J. Wilkinson. 2008. Transcriptional profiling reveals that daptomycin induces the Staphylococcus aureus cell wall stress stimulon and genes responsive to membrane depolarization. Antimicrob Agents Chemother 52:980-90.  70.  Ng, W. L., K. M. Kazmierczak, G. T. Robertson, R. Gilmour, and M. E. Winkler. 2003. Transcriptional regulation and signature patterns revealed by microarray analyses of Streptococcus pneumoniae R6 challenged with sublethal concentrations of translation inhibitors. J Bacteriol 185:359-70.  71.  Novick, R. 2006. Staphylococcal Pathogenesis and Pathogenicity Factors: Genetics and Regulation. In V. A. Fischetti, Novick R. P., Ferretti, J. J., Portnoy, D. A., and Rood J. I. (ed.), Gram-positive pathogens. ASM Press, Washington, DC.  72.  Novick, R. P. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol 48:1429-49.  73.  Novick, R. P. 1990. The Staphylococcus as a molecular genetics system. VCH Publishers, New York, N.Y.  74.  Novick, R. P., and E. Geisinger. 2008. Quorum sensing in staphylococci. Annu Rev Genet 42:541-64.  75.  Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. Moghazeh. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. Embo J 12:3967-75.  76.  Papakyriacou, H., D. Vaz, A. Simor, M. Louie, and M. J. McGavin. 2000. Molecular analysis of the accessory gene regulator (agr) locus and balance of virulence factor expression in epidemic methicillin-resistant Staphylococcus aureus. J Infect Dis 181:9901000.  49  77.  Pratten, J., S. J. Foster, P. F. Chan, M. Wilson, and S. P. Nair. 2001. Staphylococcus aureus accessory regulators: expression within biofilms and effect on adhesion. Microbes Infect 3:633-7.  78.  Prevost, G., B. Cribier, P. Couppie, P. Petiau, G. Supersac, V. Finck-Barbancon, H. Monteil, and Y. Piemont. 1995. Panton-Valentine leucocidin and gamma-hemolysin from Staphylococcus aureus ATCC 49775 are encoded by distinct genetic loci and have different biological activities. Infect Immun 63:4121-9.  79.  Proctor, R. A., C. von Eiff, B. C. Kahl, K. Becker, P. McNamara, M. Herrmann, and G. Peters. 2006. Small colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infections. Nat Rev Microbiol 4:295-305.  80.  Rand, K. H., and H. Houck. 2004. Daptomycin synergy with rifampicin and ampicillin against vancomycin-resistant enterococci. J Antimicrob Chemother 53:530-2.  81.  Rand, K. H., and H. J. Houck. 2004. Synergy of daptomycin with oxacillin and other beta-lactams against methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 48:2871-5.  82.  Rogers, P. D., T. T. Liu, K. S. Barker, G. M. Hilliard, B. K. English, J. Thornton, E. Swiatlo, and L. S. McDaniel. 2007. Gene expression profiling of the response of Streptococcus pneumoniae to penicillin. J Antimicrob Chemother 59:616-26.  83.  Rohner, P., C. Herter, R. Auckenthaler, J. C. Pechere, F. A. Waldvogel, and D. P. Lew. 1989. Synergistic effect of quinolones and oxacillin on methicillin-resistant Staphylococcus species. Antimicrob Agents Chemother 33:2037-41.  84.  Saginur, R., M. Stdenis, W. Ferris, S. D. Aaron, F. Chan, C. Lee, and K. Ramotar. 2006. Multiple combination bactericidal testing of staphylococcal biofilms from implantassociated infections. Antimicrob Agents Chemother 50:55-61.  85.  Sambrook, J. F., E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, vol. 1, 2, 3. Cold Spring Harbor Laboraory Press, New York.  86.  Sande, M. A., and W. M. Scheld. 1980. Combination antibiotic therapy of bacterial endocarditis. Ann Intern Med 92:390-5.  87.  Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Lett 73:133-8.  88.  Simmons, N. A. 1977. Synergy and rifampicin. J Antimicrob Chemother 3:109-11. 50  89.  Smith, P. A., and F. E. Romesberg. 2007. Combating bacteria and drug resistance by inhibiting mechanisms of persistence and adaptation. Nat Chem Biol 3:549-56.  90.  Staali, L., H. Monteil, and D. A. Colin. 1998. The staphylococcal pore-forming leukotoxins open Ca2+ channels in the membrane of human polymorphonuclear neutrophils. J Membr Biol 162:209-16.  91.  Steinhuber, A., R. Landmann, C. Goerke, C. Wolz, and U. Fluckiger. 2008. Bioluminescence imaging to study the promoter activity of hla of Staphylococcus aureus in vitro and in vivo. Int J Med Microbiol 298:599-605.  92.  Tegmark, K., A. Karlsson, and S. Arvidson. 2000. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol Microbiol 37:398-409.  93.  Traber, K., and R. Novick. 2006. A slipped-mispairing mutation in AgrA of laboratory strains and clinical isolates results in delayed activation of agr and failure to translate delta- and alpha-haemolysins. Mol Microbiol 59:1519-30.  94.  Trotonda, M. P., A. C. Manna, A. L. Cheung, I. Lasa, and J. R. Penades. 2005. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. J Bacteriol 187:5790-8.  95.  Tsui, W. H., G. Yim, H. H. Wang, J. E. McClure, M. G. Surette, and J. Davies. 2004. Dual effects of MLS antibiotics: transcriptional modulation and interactions on the ribosome. Chem Biol 11:1307-16.  96.  Utaida, S., P. M. Dunman, D. Macapagal, E. Murphy, S. J. Projan, V. K. Singh, R. K. Jayaswal, and B. J. Wilkinson. 2003. Genome-wide transcriptional profiling of the response of Staphylococcus aureus to cell-wall-active antibiotics reveals a cell-wallstress stimulon. Microbiology 149:2719-32.  97.  Varma, A., and K. D. Young. 2004. FtsZ collaborates with penicillin binding proteins to generate bacterial cell shape in Escherichia coli. J Bacteriol 186:6768-74.  98.  von Eiff, C., C. Heilmann, R. A. Proctor, C. Woltz, G. Peters, and F. Gotz. 1997. A site-directed Staphylococcus aureus hemB mutant is a small-colony variant which persists intracellularly. J Bacteriol 179:4706-12.  51  99.  Vriesema, A. J., S. A. Zaat, and J. Dankert. 1996. A simple procedure for isolation of cloning vectors and endogenous plasmids from viridans group streptococci and Staphylococcus aureus. Appl Environ Microbiol 62:3527-9.  100.  Walsh, T. J., F. Auger, B. A. Tatem, S. L. Hansen, and H. C. Standiford. 1986. Novobiocin and rifampicin in combination against methicillin-resistant Staphylococcus aureus: an in-vitro comparison with vancomycin plus rifampicin. J Antimicrob Chemother 17:75-82.  101.  Walsh, T. J., H. C. Standiford, A. C. Reboli, J. F. John, M. E. Mulligan, B. S. Ribner, J. Z. Montgomerie, M. B. Goetz, C. G. Mayhall, D. Rimland, and et al. 1993. Randomized double-blinded trial of rifampin with either novobiocin or trimethoprimsulfamethoxazole against methicillin-resistant Staphylococcus aureus colonization: prevention of antimicrobial resistance and effect of host factors on outcome. Antimicrob Agents Chemother 37:1334-42.  102.  Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21:319-46.  103.  Woodin, A. M. 1960. Purification of the two components of leucocidin from Staphylococcus aureus. Biochem J 75:158-65.  104.  Yim, G., H. H. Wang, and J. Davies. 2006. The truth about antibiotics. Int J Med Microbiol 296:163-70.  105.  Yourassowsky, E., M. P. van der Linden, M. J. Lismont, and F. Crokaert. 1981. Combination of minocycline and rifampicin against methicillin- and gentamicin-resistant Staphylococcus aureus. J Clin Pathol 34:559-63.  52  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0068607/manifest

Comment

Related Items