Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and characterization of CIS-acting regulatory elements for human x-inactive specific transcript Chang, Chia-Yu 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_chang_chia-yu.pdf [ 2.6MB ]
Metadata
JSON: 24-1.0068452.json
JSON-LD: 24-1.0068452-ld.json
RDF/XML (Pretty): 24-1.0068452-rdf.xml
RDF/JSON: 24-1.0068452-rdf.json
Turtle: 24-1.0068452-turtle.txt
N-Triples: 24-1.0068452-rdf-ntriples.txt
Original Record: 24-1.0068452-source.json
Full Text
24-1.0068452-fulltext.txt
Citation
24-1.0068452.ris

Full Text

IDENTIFICATION AND CHARACTERIZATION OF CIS-ACTING REGULATORY ELEMENTS FOR HUMAN X-INACTIVE SPECIFIC TRANSCRIPT  by  CHIA-YU CHANG  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2009  © Chia-yu Chang, 2009  ABSTRACT Dosage compensation in female mammals is achieved by XIST/Xist RNA mediated transcriptional silencing of one of the two X chromosomes. Several developmental specific cis acting regulatory elements for mouse Xist have been demonstrated. One of these regulatory elements is the mouse Tsix locus, which is transcribed antisense to Xist and represses Xist on one of the X chromosomes at the onset of X inactivation. A transcript antisense to human XIST has been shown; however, its functional significance has been repeatedly challenged. My thesis aims to uncover cis-acting regulatory elements for human XIST and determine whether the elements are comparable to those found in mice.  Currently, multi-copy integrations of a transgene containing human XIST into male mouse embryonic stem (ES) cells or into male human fibrosarcoma cells are the model systems of choice for studying the initiation of human X inactivation because the transcription antisense to human XIST can be detected by RT-PCR from the transgenes. Using DNase I hypersensitivity (HS) mapping, I  found one HS site on the human transgene in mouse ES cells located approximately 11 kb downstream of XIST3’ end. While this HS site does not correspond to the transcription starts of TSIX previously described, it encompasses a small cluster of CTCF binding sites based on in silico  search.  Besides the downstream HS site, I discovered two HS sites in differentiated cell lines. One of the HS sites is immediately upstream of the XlSTtranscription start site. The other HS site (HS 101), located approximately 65 kb upstream of human XIST transcription start, resides within a region that shares above 70% sequence identity with cow and dog but not mouse. I analyzed these upstream HS sites and found that HS 101 exhibits bi-directional promoter and enhancer activity.  My thesis revealed three previously unidentified HS sites flanking the human XIST locus; the presence of only one ES cell specific HS site downstream of XIST3’ end is in sharp contrast to the seven sites reported in mouse. The results suggest that mouse Xist and human XIST are regulated differently. To account for the differences in regulatory elements, I propose an alternative model for human XIST regulation.  III  TABLE OF CONTENTS Abstract  ii  Table of Contents  iv  List of Table  vi  List of Figures  ii  List of Abbreviations  ix  Acknowledgements  Xi  Introduction  1  1.1 1.2 1.3 1.4  Dosage Compensation in Mammals X-Inactive Specific Transcript (XIST/Xist) Significance of XIST Regulation Mouse X Chromosome Inactivation 1.4.1 Downstream Regulatory Elements for Xist 1.4.1.1 Tsix 1.4.1.2 DXPas34 1.4.1.3 CTCF Binding Sites 1.4.1.4 X-inactivation intergenic transcription element (Xite) 1.4.1.5 Pairing 1.4.2 Upstream Regulatory Elements for Xist 1.4.2.1 Xist Promoter 1.4.2.2 Jpx/Enox 1.4.2.3 Between Xist & Jpx/Enox 1.4.2.4 X-Pairing Region (Xpr) 1.4.3 Establishment & Maintenance 1.5 Human X Chromosome Inactivation 1.5.1 XIST Downstream Sequence TSIX 1.5.2 XIST Upstream Sequence 1.6 Bovine X Chromosome Inactivation 1.7 Thesis Objective  2 2 3 4 4 6 8 9 9 10 11 11 12 13 14 14 16 17 19 20 22  Materials & Methods  23  2.1 2.2 2.3 2.4 2.5  24 24 26 27 27  —  2  Tissue Culture & Cell Lines RNA Extraction & Reverse Transcription Polymerase Chain Reaction (PCR) Use of Online Bloinformatics Tools Chromatin Immuno-Precipitation  iv  2.6 DNase I Hypersensitivity Mapping 2.7 Southern Blotting 2.8 Isolation of Plasmid DNA from E. coil Cells 2.9 Plasmid Construction 2.10 Transient Transfection & Luciferase Assay 2.11 Stable Transfection & Colony Assay 3  Searching for cis-acting Regulatory Elements for Human X-inactive Specific Transcript ..34 3.1 Introduction 3.2 Results 3.2.1 X1ST Downstream Sequence Comparison 3.2.2 Antisense Transcription Origin 3.2.3 CTCF Binding 3.2.4 DNase I Hypersensitive Mapping—Downstream of the XIST3’ End 3.2.5 XlSTUpstreamSequenceComparison 3.2.6 DNase I Hypersensitive Mapping Upstream of the XIST Promoter 3.3 Discussion 3.3.1 Downstream of XIST 3.3.2 Upstream of X1ST  35 37 37 37 41 43 48 49 54 54 56  Functional Analyses of DNase I Hypersensitive Sites  58  4.1 Introduction 4.2 Results 4.2.1 Colony Assay —Testing for Enhancer Blocking Ability 4.2.2 Promoter & Enhancer Assays 4.3 Discussion 4.3.1 Colony Assay 4.3.2 Luciferase Assays  59 60 60 63 66 66 68  Summary and Discussion  71  5.1 Summary of Research Findings 5.2 Discussion 5.2.1 Before the Onset of X chromosome Inactivation 5.2.2 XIST Repression 5.2.3 Maintaining XlSTTranscriptional Status  72 74 74 77 78  —  4  5  28 29 31 31 32 33  References  79  Appendices  89  v  LIST OF TABLES Table 2.1  List of primers used in locating the transcription origin of XlSTantisense  26  Table 2.2  List of primers for probe generation  30  Table 2.3  Restriction fragments for DNase I hypersensitivity mapping  31  Table 2.4  List of primers for cloning  32  vi  LIST OF FIGURES Figure 1.1  Mouse X inactivation centre  Figure 1.2  Comparison of X inactivation centre between mouse and human  15  Figure 3.1  Evolutionarily conserved regions downstream of X1ST  38  Figure 3.2  Primer walking & strand-specific RT-PCR  40  Figure 3.3  ChIP for CTCF  42  Figure 3.4  DNase I hypersensitivity mapping downstream ofXISTin ES1O  44  Figure 3.5  Sequence alignment of the SapI/BIpI fragment & CTCF binding sites  45  Figure 3.6  DNase I hypersensitivity mapping downstream of XIST in L1.10.1  46  Figure 3.7  DNase I hypersensitivity mapping downstream of XIST in hybrids  47  Figure 3.8  Evolutionary conserved regions upstream of XIST  48  Figure 3.9  DNase I hypersensitivity mapping upstream ofXISTin ES1O  50  Figure 3.10  DNase I hypersensitivity mapping upstream ofXISTin hybrids  51  Figure 3.11  HS XIST hybrid upstream  52  Figure 3.12  HS site human, cow, dog, mouse sequence alignment  53  Figure 4.1  Colony assay  62  Figure 4.2  Luciferase promoter assay  64  Figure 4.3  Luciferase enhancer assay  65  Figure 4.4  pJCX  68  Figure 5.1  A summary of findings on potential cis-acting regulatory elements for XIST  73  Figure 5.2  Before the onset of X chromosome inactivation  75  Figure A.1  Origin of piC and making of MCS2  90  Figure A.2  Cloning of fragment 0 and fragment 1 for colony assay and luciferase assays  91  Figure A.3  Cloning of fragment 2 for colony assay and luciferase assays  92  —  different restriction enzymes  5  VII  Figure A.4  Cloning of fragment 3 for colony assay and luciferase assays  93  Figure A.5  Cloning of fragment 3’ for colony assay  94  Figure A.6  Cloning of fragment 101 for colony assay and luciferase assays  95  Figure A.7  Colony assay results  96  Figure A.8  Promoter assay results  97  Figure A.9  Enhancer assay results  98  VIII  LIST OF ABBREVIATIONS BF  Blocking Factors  ChIP  Chromatin lmmuno-Precipitation  CTCF  CCCTC-binding Factor  DMEM  Dulbecco Modified Eagle Medium  DMR  Differentially Methylated Region  DNA  Deoxyribonucleic acid  EB  Embryoid Bodies  ECR  Evolutionarily Conserved Region  EED/Eed  Embryonic Ectoderm Development  ES  Embryonic Stem  ENCODE  ENCyclopedia Of DNA Elements  FISH  Fluorescent in situ Hybridization  fl  Firefly Luciferase  H3-K27me3  Trimethylation lysine 27 of histone 3  HS  Hypersensitive  ICR  Imprinting Control Region  lgf2  Insulin-like Growth Factor 2  LCR  Locus Control Region  LIF  Leukemia Inhibitory Factor  LINE  Long Interspersed Nuclear Element  LTR  Long Terminal Repeat  MEM  Minimum Essential Medium  PCR  Polymerase Chain Reaction  PRC2  Polycomb Repressive Complex 2  ix  RepA  Repeat A  rI  Renilla Luciferase  SCID  Severe Combined ImmunoDeficiency  SINE  Short Interspersed Nuclear Element  SRY  Sex-determining Region V  TBP  TATA Binding Protein  Xa  Active X  Xi  InactiveX  XIC  X Inactivation Centre  XIS T/Xist  X-Inactive Specific Transcript  Xite  X-intergenic transcription element  Xp  Paternal X  Xpr  X-Pairing Region  x  ACKNOWLEDGEMENTS I would like to acknowledge the contributions of the following individuals to the completion of this thesis:  Carolyn Brown (Supervisor) Owen Robertson Sonia Ziesche Hugh Brock (Supervisory committee) Dixie Mager (Supervisory committee) Louis Lefebvre (Supervisory committee) Chia-hsin Chang Hsiu-hwa Wang Shu-xian Wang Melissa KrulI Maja Tarailo Arefeh Rouhi Jakub Minks Cheryl Bishop Nancy Thorogood  Sarah Baldry  xi  1 Introduction  1  1.1  Dosage Compensation in Mammals Dosage compensation in mammals has evolved in response to the differentiation of sex  chromosomes. Between 166 and 148 million years ago, one member of the ancestral autosome pair acquired the Sex-determining Region Y (SRY) gene, and the suppression of recombination was favoured to ensure that the male-specific genes accumulated near the SRY locus stayed together [1]. In the absence of recombination, the V chromosome progressively degraded, resulting in XV males and XX females in mammals [1]. In order to compensate for genes lost from the Y chromosome, genes on the X chromosome generate twice the amount of transcriptional product compared to autosomal counterparts [2, 3]. The upregulation of X-linked genes favoured the evolution of X chromosome inactivation, a mechanism by which one of the two X chromosomes in the cells of female mammals is transcriptionally shut down during early development. Furthermore, the X chromosome inactivation mechanism is also able to shut down additional X chromosomes in a cell with X-chromosome aneuploidy. Once X inactivation has been established, the silent X chromosome is stably maintained in somatic cells by epigenetic modifications [4-12].  1.2  X-Inactive Specific Transcript (XIST/Xist)  It was postulated that a single X-inactivation centre is responsible for the differential treatment of the two X chromosomes [13]. Through cytogenetic studies, the location of this X inactivation centre (XIC) was refined [14]. Within the XIC/Xic, the X-Inactive Specific Transcript (XIST/Xist), a 17 kb/15 kb noncoding RNA which is expressed exclusively from, and then coats, the  inactive X (Xi), is used to establish the two functionally distinct forms of the X chromosomes [15-19]. Conservation of XIS T/Xist between human and mouse in terms of chromosomal position and expression exclusively from the inactive X chromosome provided support to the hypothesis that XISTand its mouse homologue are involved in X-chromosome inactivation [16, 18, 20]. The Xist  2  RNA was later demonstrated to be essential for X inactivation based on targeted deletions in the  mouse [21, 22].  XIST/Xist itself evolved from a protein-coding gene [23]. Elisaphenko et al. [24] showed that Xist emerged by integration of mobile elements which gave rise to simple tandem repeats.  Importantly, the combination of gene remnants and mobile elements is not unique to the Xist gene and is found in other non-coding RNA genes within the XIC [24].  1.3  Significance of XIST Regulation In random X inactivation, either of the X chromosomes can be silenced. In principle,  heterozygous females carrying mutations in X-linked genes would have an equal number of cells that inactivate the normal X and cells that inactivate the mutant X; however, skewing of X inactivation can occur, thereby altering this ratio. In rare affected female Duchenne muscular dystrophy patients, for example, the mutant dystrophin gene is located on the active X (Xa) in the majority of muscle cells, while the normal gene is inactivated through skewed X inactivation [25, 26]. Similarly, in X-linked severe combined immunodeficiency (SCID), the obligate carriers preferentially keep the normal, non-mutant X active in cell lineages affected by the gene defect [27, 28].  Skewing can occur as a result of a bias in the initial choice of which X is inactivated (primary) or through cell selection against cells that keep a given X chromosome active (secondary). While the majority of X inactivation skewing pattern observed in the adult population occurs after the establishment of X inactivation [29], in some cases, it is genetically influenced and heritable. Nesterova et al. [30] demonstrated that in mice, elevated levels of sense transcription across the Xist locus at the onset of X inactivation could increase the probability of that allele being chosen as  the inactive X chromosome in heterozygous females (see “Between Xist & Jpx/Enox”, 1.4.2.3). 3  Therefore, understanding how human XIST is regulated in the initiation of dosage compensation would provide insight to certain cases of skewed X inactivation.  1.4  Mouse X Chromosome Inactivation The earliest Xist expression at zygotic genome activation is imprinted, resulting in specific  expression of the paternal Xist allele (i.e. imprinting) from the 2- to the 4-cell stage [31-35]. Thereafter, genome wide reprogramming occurs in cells of the inner cell mass of the blastocyst, resulting in the reactivation of the paternal X (Xp) [34, 36, 37]. The two active X chromosomes in cells of the female epiblast then initiate random X inactivation [36]. Since female mouse embryonic stem (ES) cells, derived from cells of the epiblast, can recapitulate random X inactivation upon differentiation and can be genetically manipulated and then transmitted through the germline [38], these cells are valuable tools in studying the initiation of X inactivation [39-41].  For random X inactivation, Xist is expressed at low levels from all X chromosomes before the onset of X inactivation, even from the single X in male embryos [40]. Upon differentiation, Xist RNA levels increase dramatically and coat the presumptive Xi, while the Xa retains a low-level of Xist RNA that is subsequently extinguished [31, 40]. Although silencing of X-linked genes is induced by the accumulation of Xist on the Xi, Sun et al. [42] showed that the increase in Xist transcript level is not regulated by RNA stabilization. Genes are silenced soon after the Xist transcripts coat the Xi [40]. Once the silenced state is established within a narrow developmental window [43], it is faithfully maintained throughout the lifetime of the individual.  1.4.1  Downstream Regulatory Elements for Xist A heterozygous deletion spanning the 65-kb region located immediately 3’ to Xist (Figure  1.1) has been shown to result in preferential inactivation of the mutated X [41]. The 65-kb deletion 4  CTCF bindir sites [49]  vw Vwv  DNase HS sites [92, 93]  10kb  P0  CTCF bindir sites [79]  Kist  Repeat A  Developmental specific DNase HS sites [771  DXPQF34  Thio mere  Jpx/Enox  i$12X pSi9X  Tsix  Xite  Tsx  3.7kb Tix deletion [54]  5’ Deletion [30]  90kb transgene [461 65 kb deletion 41]  Figure 1.1  —  Mouse X inactivation centre. Black boxes are exons, blue and black arrows indicate direction of transcription, filled blue  triangles show ES cell specific DNase I hypersensitive sites (larger triangle is a more prominent site), unfilled blue triangles are constitutive DNase I hypersensitive sites and red rectangles encompass CTCF binding sites. uS12X and pS19X are pseudogenes. Repeat A is located within Xist exon 1. Tsx, a testis-specific gene of unknown function, spans 10 kb and encodes a protein of 144 amino acids without c.,,  homology to any known gene [441. Key deletions and transgene are marked by black lines below the partial mouse Xic.  is associated with a counting defect, because ectopic initiation of X inactivation occurs in XY differentiated ES cells carrying the deletion [45]. Furthermore, Lee et al. [46] demonstrated that X inactivation can be recapitulated by a 90-kb transgene carrying Xist plus 30 kb upstream and 30 kb downstream (Figure 1.1). Based on these data, Lee et al. [46] suggested that regulators for Xist reside within the 30 kb downstream sequence. Detailed analyses of genomic elements within this region showed several cis-acting regulatory elements, such as Tsix [47], DXPas34 [48], CTCF binding sites [49], and the X-intergenic transcription element (Xite) [50].  1.4.1.1 Tsix The Tsix gene, identified in mouse, encodes an untranslated RNA antisense to Xist and transcribed across the Xist locus (ending at -1401 bp relative to the transcription start site of Xist) [47, 51] (Figure 1.1). The CpG island lying immediately telomeric to the DXPas34 locus (see below) has been proposed to be the major transcription initiation site for Tsix [47]. Subsequently, Sado et al. [52] and Shibata & Lee [53] demonstrated that Tsix is subject to processing and identified its exons. Before the onset of random X inactivation, Tsix expression is bi-allelic in females ES cells [47]. At the onset of random X inactivation, Tsix expression becomes mono-allelic and is associated with the future Xa and persists until Xist is silenced [47]. Although a 3.7 kb targeted deletion of Tsix (Figure 1.1  —  encompassing the Tsix CpG island, transcription start sites, and 1.4 kb of upstream  sequence containing the putative promoter) shows no abnormal X inactivation in males, this deletion in females results in primary non-random inactivation of the mutant X, suggesting Tsix regulates Xist in cis [54]. More importantly, Lee [55] reported that the same 3.7 kb Tsix deletion shows normal paternal but impaired maternal transmission, suggesting that Tsix is an important player in the imprinting of the Xist gene [52, 55]. 6  Panning & Jaenisch [40] examined DNA methyltransferase mutant embryos and ES cells using fluorescence in situ hybridization and observed that DNA hypomethylation can activate Xist expression and silence X-linked genes. In the following decade, several groups have demonstrated that Tsix RNA silences Xist through modification of the chromatin structure in the Xist promoter region [42, 56, 57]. Specifically, Navarro et al. [58] showed that Tsix prevents the euchromatinization of a CTCF-flanked Xist 5’ region, repressing Xist transcription during differentiation. Sun et al. [42] further demonstrated that Xist transcriptional silencing is in part regulated by Tsix RNA-directed DNA methylation at the promoter. Ogawa et al. [59] recently argued that RNAi is involved in regulation of Xist and is dependent on Tsix:Xist forming duplexes required for the RNA1 pathway. Yet, Nesterova et al. [60] showed that although sense and antisense transcription over the Xist promoter can modulate DNA methylation levels, and thereby control Xist expression, this process is independent of the RNA1 pathway.  To determine whether Tsix repression is RNA-mediated or transcription dependent, Luikenhuis et al. [61] introduced a transcriptional stop signal into the transcribed region of Tsix and showed that antisense transcription through the Xist locus is necessary for Tsix repression. Subsequently, Shibata & Lee [62] confirmed the finding. Ohhata et al. [63] terminated Tsix transcription before the transcription proceeded across the 5’ repeat A and the Xist promoter and showed that such truncation of Tsix abolished the antisense regulation of Xist. The elimination of antisense activity in the upstream region of Xist resulted in a failure to establish the repressive chromatin configuration at the Xist promoter on the mutated X, including DNA methylation and repressive histone modifications, especially in extraembryonic tissues. The phenotype is similar to the loss of function mutation of Tsix(i.e. inappropriate activation of Xist) previously reported [57].  7  These results suggest that Tsix has to be transcribed across the Xist promoter to establish silencing of Xist.  Shibata & Lee [53] showed that Xist RNA levels increased by approximately 10-fold when Tsix is deleted; however, Xist RNA increases by approximately two orders of magnitude in female  somatic cells that have undergone X inactivation, suggesting that the repression of Tsix is only sufficient to partially upregulate Xist. Furthermore, Tsix prevents upregulation of Xist in cis in females, yet, in males, Tsix deletion does not abolish Xist repression and the single X chromosome remains active [54, 61, 64]. Finally, mutant male embryos, even though they inherit the Tsix deficiency from the mother, can survive if the wild-type extraembryonic tissue are provided by an experimental reconstruction using wild-type tetraploid embryos, implying the existence of a Tsix independent mechanism for suppressing Xist [65]. Recently, Shibata et al. [66] tackled the conundrum that males can repress Xist without Tsix by demonstrating synergism between Polycomb group proteins and antisense Tsix transcription in regulating Xist.  1.4.1.2 DXPas34 DXPas34 is a 1.2-kb CG-rich region, consisting of multiple 34 bp tandem repeats, located  750 bp downstream of the Tsix promoter [67] (Figure 1.1). This element was first identified due to its unique DNA methylation profile marking specifically the active X [67, 68]. Since the DXPas34 locus displays differential methylation between alleles and is associated with the transcription of a non-coding RNA, it was thought that the DXPas34 is the differentially methylated region (DMR) frequently found in the vicinity of imprinted genes [69]. It was later demonstrated that the methylation marks are established after the onset of X inactivation, arguing that methylation of this region is not involved in imprinted X inactivation [70].  8  Although methylation of DXPas34 might not be involved in imprinted X inactivation, this locus still attracted great interest. While deleting the Tsix promoter did not have any obvious phenotype [71], deletion of DXPas34 eliminated both Xist expression and the antisense transcription present in this region in undifferentiated ES cells [48, 71]. Intriguingly, DXPas34 deletion also led to derepression of Tsix in cis during the late days of differentiation [71]. Cohen et al. [71], therefore, put forth the idea that DXPas34 plays a dual positive-negative function: DXPas34 is one of the Tsix activators through its enhancer activity at the onset of X inactivation [71, 72], and it stably silences Tsix once X inactivation is established. Furthermore, maternal transmission of DXPas34 deletion resulted in embryonic lethality, Cohen et al. [71] concluded that the DXPas34  locus is necessary for both random and imprinted XCI in mice.  1.4.1.3 CTCF Binding Sites  The transcriptional regulator CCCTC-binding factor (CTCF) is a ubiquitously expressed, highly conserved multi-functional nuclear protein [73]. The CTCF protein contains an 11 zinc finger DNA binding domain and is involved in a wide range of gene regulatory functions, including activation, repression, imprinting, and insulation [74]. Chao et al. [49] first reported the link between CTCF and X chromosome inactivation by demonstrating CTCF binding downstream of Xist (Figure 1.1). Since  CTCF regulates enhancer access to the H19-Igf2 imprinted genes [75] and the 5’ end of Tsix contains enhancer-blocking activity, Chao et al.[49] proposed that CTCF and Tsix, together, establish the epigenetic switch for Xist.  1.4.1.4 X-inactivation intergenic transcription element (Xite) Genomic regions hypersensitive to DNase I digestion have been shown to habour cis regulatory elements critical for gene regulation. Morey et al. [76] showed that targeted insertion of  9  Tsix and the terminal exons of Xist back to the 65 kb deleted locus is not sufficient to restore  random X inactivation and argued that random inactivation requires elements outside of Tsix. Ogawa & Lee [50] found X-inactivation intergenic transcription (Xite) in the mouse X-inactivation centre. Xite, which is located upstream of the Tsix promoter, contains both a cluster of DNase I hypersensitive sites and a bidirectional promoter of intergenic transcription [50, 77] (Figure 1.1).  Xite deletion resulted in downregulation of Tsix in cis at the onset of X inactivation and  skewed X inactivation ratios, suggesting that Xite promotes Tsix persistence on the active X [50]. Truncating Xite RNA is inconsequential, indicating that Xite action does not require intact transcripts [50]. Furthermore, Stavropoulos et al. [77] found that the Tsix promoter, when cloned upstream of a promoterless luciferase reporter, is active in differentiated cells; Xite as well as DXPas34, each containing DNase I hypersensitive sites, are necessary to confer developmental specificity to Tsix expression.  1.4.1.5 Pairing  X-chromosome inactivation involves first counting the X chromosomes and subsequently choosing one of the two X chromosomes to be inactivated. This requires “communication” between the two X chromosomes that could occur through homologous chromosome interactions [78]. Xu et al. [79] and Bacher et al. [80] first demonstrated that homologous pairing of a region downstream of Xist, encompassing Tsix/DXPas34 and Xite, is necessary for the initiation of X inactivation. Deletion of Tsix and Xite disrupts pairing and inhibits the initiation of X inactivation; their autosomal insertion, on the other hand, induces de novo X-A pairing which blocks endogenous X-X pairing and perturbs proper initiation of X inactivation [79].  10  Xu et al. [81] then demonstrated that pairing can be recapitulated by 1- to 2 kb subfragments of DXPas34 or Xite, and furthermore, by CTCF knock down, that the protein CTCF is essential for pairing. Although Yyl was identified as cofactor for CTCF [82], it is not required for pairing as demonstrated by knock down experiments [81]. Interestingly, recent findings that CTCF interacts with cohesin [83, 84] might shed light on how this pairing is achieved.  1.4.2  Upstream Regulatory Elements for Xist Lee et al. [46] demonstrated that an Xist-containing yeast artificial chromosome transgene  without the 30 kb region immediately upstream of transcription start site can neither maintain Xist expression nor initiate cis inactivation as shown by inability to induce late replication and H4 hypoacetylation. Using an allele-specific general DNase I sensitivity assay, McCabe et al. [85] showed that, on the inactive X chromosome, the active chromatin domain of the expressed Xist locus extends no farther than 10 kb upstream of the Xist transcription start site. These results suggest the boundary between the Xic and the remainder of the chromosome lies within this region.  1.4.2.1 Xist Promoter  Pillet et al. [86] showed that a 1.2-kb upstream region (-1157 to +917) of the Xist gene has no in vitro sex-specific promoter activity, and a minimal constitutional promoter was assigned to a region from -81 to +1. The identification of “P0” promoter (Figure 1.1) led Johnston et al. [87] to propose that a developmentally regulated promoter switch, which results in stabilization and accumulation of Xist RNA, initiates X inactivation. However, Warshawsky et al. [88] showed that the upstream promoter, which produces an unstable transcript, is an artefact caused by amplification of a pseudogene of the highly expressed ribosomal protein S12 gene Rpsl2 (Figure 1.1). Warshawsky  11  et al. [88] also reported that transcription upstream of Xist promoter, which produces a stable RNA, originates from the DNA strand opposite Xist and represents the 3’ end of the antisense Tsix RNA.  As previously mentioned, Xist upregulation is not based on transcript stabilization demonstrated by RNA half-life measurements [42]. Sun et al. [42] also showed that a 540 bp fragment, containing the Xist P1 promoter, alone was able to significantly increase transcription of a reporter gene in female cells but not male cells during differentiation and proposed that Xist is controlled by transcription in a sex-specific manner. Not surprisingly, the promoter activity of this 540 bp fragment was upregulated during differentiation by only 2 to 10-fold in female cells and could not fully account for the 31-fold increase in steady-state levels [42]. Sun et al. [42], therefore, stated that the 540 bp fragment does not contain all the necessary elements to achieve full activation.  1.4.2.2 Ji,xlEnox  Chureau et al. [89] and Johnston et al. [90] identified Jpx/Enox, a gene that maps 10 kb upstream of Xist (Figure 1.1) and shows homology to the mouse estrogen receptor-binding fragment-associated protein 9 but without an apparent open reading frame. Jpx/Enox is transcribed in the opposite direction to Xist and partially escapes X inactivation in adult mice (i.e. detected from the Xa, and at a low level from the Xi) [90]. Intriguingly, Tsai et al. [91] demonstrated, by DNase I hypersensitivity mapping and chromosome conformation capture, that the Xist promoter and the 5’ end of ipx/Enox make contact. Tsai et al. [91] further found that the contact persisted in female cells and was lost in male cells, suggesting that the interaction takes place only in cells that activate Xist and that a loss of interaction correlates with repression of the Xist gene on the Xa.  12  1.4.2.3 Between Xist & Jx/Enox  Sheardown et al. [92] and Newall et al. [93] have identified, in total, four hypersensitive sites in the mouse (Figure 1.1). One of the HS sites, located just 5’ to the transcription start site, is present in female somatic cells and in ES cells, but not male cells. Another HS site, less than 200 bp upstream is specific to undifferentiated female ES cells. The two HS sites, located -1.4 kb and -3 kb, were found in both male and female ES cells and in male and female somatic cells; deletion of these two sites has no effect on Xist regulation [93]. In addition to hypersensitive sites, there are two ribosomal protein pseudogenes (Figure 1.1), çuSl2X, which lies 4.2 kb from the transcription start site of Xist, and pSl9X, which is located 1972 bp upstream of Xist transcription start; both have an inverse orientation compared with the direction of Xist gene transcription [94].  Nesterova et al. [30] created a series of targeted deletions between Xist and Jpx/Enox in a male ES cell line (Figure 1.1) and generated chimeric mice to analyze the effect of these mutations on X inactivation in vivo. While these deletions affected neither imprinting nor counting, some caused highly skewed Xist expression, with the targeted allele being expressed in the majority of cells [30]. Nesterova et al. [30] found that the Jpx/Enox CpG island possesses bidirectional transcription activity. It is perhaps not surprising that deleting the region between Xist and Jpx/Enox, which brings the prominent CpG island of Jpx/Enox into close proximity to Xist, would  cause ectopic sense transcription across Xist [30]. Nesterova et al. [30] therefore proposed that the sequences deleted normally function to insulate transcription between Xist and Jpx/Enox in both directions.  13  1.4.2.4 X-Pairing Region (Xpr)  Recently, Augui et al. [95] showed that a 136-kb segment of the mouse Xic, located 200 kb 5’ to Xist (Figure 1.2), mediates transient association between the two Xics prior to the onset of X inactivation, and the interaction occurs before and independently of the Tsix/Xite pairing. This region, termed X pairing region (Xpr), provides necessary communications between the homologous chromosomes [95]. Transgenic clones of a Xpr transgene in XY ES cells could not be generated, likely because Xpr induces Xist RNA accumulation on the single X in undifferentiated ES cells, a situation not observed in wild-type male ES cells [95].  1.4.3  Establishment & Maintenance Once the two X chromosomes are counted and the choice of which X to be active is made,  Xist is upregulated on the future Xi and is likely responsible for the recruitment of several histone  modifying complexes which deposit marks to direct transcriptional silencing proteins to compact chromatin as well as to methylate DNA. Specifically, Zhao et al. [96] formally demonstrated that a 1.6 kb RNA transcript (designated RepA for Repeat A), with its transcription start site approximately 300 bp downstream of the Xist promoter (Figure 1.1), targets the polycomb complex PRC2 which induces trimethylation of histone H3 lysine 27 (H3-K27me3). Subsequent to the establishment of silencing, several other features characteristics of heterochromatin were observed on the Xi as well, including recruitment of a histone variant and late replication timing.  Zhang et al. [97] found that subsequent to X-X pairing in mouse ES cells, an increase (i.e. 10% at dO to 40% at d8 post differentiation) in the number of Xs that come into contact with the nucleolus is observed. Zhang et al. [97] also reported that the Xi frequently appeared to embrace the nucleolus, while only 10% of Xa’s demonstrated Xic contact with the nucleolus. Most importantly, Zhang et al. [97] showed Xist-containing transgenes target autosomes to the nucleolus 14  Mouse  Xpr [95] Xpct  200 kb  Ci,bp2  Jpx/Enox  Ftx 1  Cntrornere  1*  Kist  7x Chici NQp112  / Cdx4 /1 /41  Telo mere  Human a 480 kb transgene containir X1ST [104 1051 200  XPCT  Teic mere  CNBP2  Fix  xisr W-TSZ  JPX!EPJOX  lfr  I  •. •. a  •  —  1.  .. a ••4  ._,a..I.........  Purine-pyrirnidine repet [116)  Centrornere  I  F. •• —  CHAC1  TSlXtranscriptiori start [1121  XtST  kb  /‘  ,  /  TSIX transcription starts 110  7 . •  S  •  4•  I —  CTCF binding [119]  F  —  10 kb  CCTCAGCCCCCCCncAGnCrrAAAGcGCTGCAATrCGCTGCTGCAGCCATAn-r +1 C  c4 Figure 1.2  G [1171  A[1iR]  Comparison of X inactivation centre between mouse & human. Mouse Xic showing 9 of 11 genes conserved in human, arrows indicate direction of transcription. X pairing region (Xpr) is marked by a black line above Xpct. Human XIC showing genes conserved in mouse (CDX4 and NAPIL2 are not shown to reduce the crowdedness of the figure). The human XIST containing transgene introduced into mouse ES cells is marked by a black line above the XIC. An enlarged view of XIST and TSIX as well as single-base —  substitution immediately upstream of the XIST promoter and previously identified purine-pyrimidine repeat 25kb upstream ofXIST5’ end are shown below the XIC. The four transcription start sites for TSIX are shown below TSIX transcription starts [110].  and Xist deletion abolishes association with the nucleolus. Surprisingly, Xist deletion results in loss of the repressive H3-K27me3 mark, suggesting that a loss of Xist and/or dissociation from the nucleolus disrupted Xi heterochromatin.  1.5  Human X Chromosome Inactivation While the mouse system provides an excellent framework from which we can understand  the process of X inactivation, how the human X-chromosome inactivation process fits into this framework is not clear. X inactivation initiates early in embryogenesis and is associated with an increase in Xist transcripts in the mouse. Prior to random X inactivation, low levels of Xist are seen from both mouse X chromosomes [98, 99]. Expression of human XISTin 2-cell male and female embryos [100, 101] suggests that the situation may be similar in humans.  One of the differences in the initiation of X chromosome inactivation between mouse and human is the XIST/Xist expression patterns in the preimplantation embryos. As mentioned before, in mouse preimplantation embryos, Xist expression is imprinted, with the paternal allele being preferentially expressed [31]. By contrast, in human preimplantation embryos, XlSTexpression is not demonstrably imprinted [100, 101]; similarly, there is not a strict imprint on X inactivation in extraembryonic tissues [102, 103]. Sequences of the X inactivation center region have been analyzed in mouse, human, and cow, and little conservation is observed in regions farther outside of XIST[23, 89]. Furthermore, Chureau et al. [89] identified 11 genes in the mouse Xic region (Figure 1.2) and all the genes identified in mouse are conserved in human, except Ppnx and Tsix.  Despite such differences, Heard et al. [104] and Migeon et al. [105] demonstrated that multi-copy integration of a 480-kb transgene containing human XIST (Figure 1.2), when introduced into male mouse embryonic stem cells, displays partial X inactivation center function upon in vitro 16  differentiation. Interestingly, Heard et al. [104] also reported that the cis inactivation induced by the XlSTtransgene was incomplete in differentiated cells, suggesting establishment of stable inactivation may require species-specific factors. Furthermore, Heard et al. [104] showed that human XIST RNA coats mouse autosomes in ES cells before in vitro differentiation, in contrast to the mouse Xist gene, which produces an unstable transcript and does not coat the chromosome in undifferentiated ES cells. Most importantly, Heard et al. [104] and Migeon et al. [105] observed that the mouse Xist on the single X chromosome in male, normally repressed in embryoid bodies (EB5, differentiated ES cells), was detected in EBs containing the human XlSTtransgene, suggesting that the human XlSTtransgene is recognized as an XIC.  Whether Xist regulation in mouse models that in human can only be answered from investigation of human XIST expression during early development. Recently, the potential use of human ES cells in studying X inactivation was examined. Hoffman et al. [106], Shen et al. [107], Silva et al. [108], and Hall et al. [109] demonstrated that X inactivation displayed a high degree of variation between cell lines and even between sublines of the same parental line and argued that their use is limited until the culturing condition is optimized to reduce epigenetic instability. Until then, mouse ES cells with human XlSTtransgenes remain the best model to study the developmental regulation of human XIST.  15.1  XIST Downstream Seciuence  —  TSIX  In mouse ES cells carrying a multi-copy integration of a 480-kb XlSTcontaining human transgene, Migeon et al. [110] identified TSIX, encoding an RNA antisense to human XIST, and showed that this antisense differs from its mouse counterpart. This antisense transcript has four transcription starts, all located close to 27 kb downstream of XIST 3’ end (Figure 1.2); with the first  17  three start sites located within repetitive elements of the MER58B, AIuY, and L2 class, respectively. The human TSIX region lacks an equivalent to the mouse CpG island, that is essential for function of Tsix [54, 111]. In contrast to Xist, which is well conserved amongst mouse, cow, and human, neither Tsix exons nor promoter regions are conserved in mammals [891. In addition to sequence variations,  other differences between mouse and human Tsix/TSIX include transcript amount, expression pattern, and extent of antisense across the Xist/XIST promoter.  Chow et al. [112] introduced a human XIST-containing PAC, which contains at least 50 kb of flanking genomic DNA, into an HT1O8O male fibrosarcoma cell line and established several clones. In the transformant clone L1.10.1, XlSTtranscripts from the PAC transgene are expressed at levels similar to those of female somatic cells (2OOO copies/cell) [112]. In the same cell line, an overlapping antisense transcript, present at about 1/10 the levels of the sense transcript, initiates downstream of XISTand extends into exon 1. The antisense transcript level in L1.10.1 is in sharp contrast to that in mouse reported by Shibata & Lee [53] showing Tsix RNA present at >10-100 fold molar excess over Xist RNA.  Migeon et al. [113], used RNA fluorescent in situ hybridization (FISH) to detect the cellular localization of transcripts, and showed that human TSIX transcripts are co-expressed with XISTfrom the inactive X throughout human embryonic development, suggesting that this antisense is unable to repress XIST. Since TSIX is expressed from the Xi of either parental origin, Migeon et aI. [113] also argued that TSIXis not maternally imprinted in placental tissues. Coexpression of XIST and TS1X was also seen in male mouse ES cells containing a human XlSTtransgene and their chimeric mouse derivatives [110], as well as in a male embryonal carcinoma cell line and in clones of a human male cell line transformed with an XIST-containing PAC [112]. Finally, Migeon et al. [110] and Chow et al.  18  [112] showed that the antisense expression does not extend across the entire XIST gene (Figure 1.2). Given that antisense transcription across the mouse Xist promoter region is necessary for antisense function [63], it has been proposed that TSIX is not essential in human [114]. Wutz & Gribnau [115] raised the possibility that there are different molecular mechanisms for regulating random X inactivation in different mammals.  15.2  XIST Upstream Sequence  Comparisons between mouse and human revealed several highly conserved motifs within a 150 bp region 5’ to the Xist transcription start site [116]. Hendrich et al. [116] defined the XIST minimal promoter by luciferase assay and demonstrated that the promoter was constitutively active in human male and female cell lines and in transgenic mice. Using site-directed mutagenesis and electrophoretic mobility shift assays, Hendrich et al. [116] further showed that SP1, TATA binding protein (TBP), and YY1 act as transcriptional activators of XIST. Plenge et al. [117] reported that a mutation in the XIST promoter C(-43)G (Figure 1.2) in two unrelated families resulted in preferential inactivation of the X chromosomes carrying the substitutions. Tomkins et al. [118] also reported an A to C substitution at position -43 in the XIST promoter (Figure 1.2) on the small ring X chromosome in a three and half year old girl whose peripheral blood cells showed no XlSTtranscript from the ring X. Using electrophoretic mobility shift assays and ChIP, Pugacheva et al. [119] demonstrated CTCF binding at the X1ST promoter (-44 to -36) with the -43 position embedded within the DNase I foot print of CTCF (Figure 1.2). While C( 43)G mutation leads to an increase in CTCF binding efficiency, C(-43)A abolishes CTCF binding [119]. It is important to note, however, that some family members of Plenge et al. [117] inherited the C( 43)G substitution, yet showed random X inactivation. As well, the C(-43)A was also found in the three and half year old girl’s grandmother who did not show substantial skewing of X chromosome 19  inactivation [118]. Furthermore, this base is not evolutionarily conserved (i.e. a G in the mouse sequence and an A in rabbits) [116]. XIST expression was found to be modulated by sequences adjacent to the minimal promoter  as well as DNA methylation. Hendrich et al. [116] identified two distinct repeat elements that regulate XIST minimal promoter activity by luciferase assay. One of the repeats is the conserved repeat A, a functional domain within the XIST transcript [120], that increased luciferase activity by at least 3 fold. The other repeat is located approximately 25 kb upstream of the XISTgene (Figure 1.2); this purine-pyrimidine repeat, which extends for 450 bp, caused a 70% reduction in luciferase activity. While Hendrich et al. [116] argued that DNA methylation is not likely to be directly responsible for silencing of XISTon the active X chromosome in somatic cells, Tinker & Brown [121] demonstrated that, similar to mouse, XIST expression can be induced from the human active X chromosome in mouse/human somatic cell hybrids by DNA demethylation.  An interesting feature of the intergenic sequence between XIST and JPX/ENOX is the enrichment of bloinformatically identified matrix attachment regions in human, mouse, and cow [112]. As mentioned earlier, JPX/ENOX is conserved in human; the Jpx/Enox CpG island and exon 1 sequences are found in human located 90 kb 5’ to XIST [89]. Chow et al. [112] further demonstrated that JPX/ENOX is fully expressed from the human inactive X in human/mouse somatic cell hybrids.  1.6  Bovine X Chromosome Inactivation  Although mammalian dosage compensation is achieved by X chromosome inactivation, it is not clear if the mechanism differs in species other than humans and mice. For this reason, De La Fuente et al. [122] examined cows and found the presence of XIST transcripts in adult female  20  somatic tissues and testis in male; the authors further demonstrated that XIST expression precedes the initiation of X chromosome inactivation. In addition to XIST, Chureau et at. [89] identified JPX/ENOX; this gene is located approximately 38 kb upstream of X1ST, consists of three exons as  observed in the mouse, and shares the same orientation.  Xue et at. [123] were the first to described imprinted X inactivation in the placenta of cows by examining the expression of X-linked genes. Subsequently, Dindot et at. [124] reported preferential paternal XIST expression in the chorion of female bovines, providing support for genomic imprinting of the XIST locus in the bovine. To better understand XIST regulation, Dindot et at. [124] carried out sequence analysis of regions adjacent to the XIST locus amongst human, mouse, and bovine and revealed that no conservation existed with the mouse Tsix and no CpG island present. Farazmand et at. [125] further challenged the function of TS1X in cows by showing that both sense and antisense strands are transcribed in female bovine somatic cells, and only TSIX was transcribed in male bovine somatic cells. Although the observations were based solely on the use of one region of the bovine XISTgene for the detection of sense and antisense transcripts, such results differ from mouse studies (see “Tsix”, 1.4.1.1).  Since imprinted XCI in the placenta has also been described in bovines, yet evolutionary changes in the region 3’to the bovine XIST gene suggest that their TSIX may be defective [124], bovine could be an intermediate in terms of X inactivation between mouse and human. Although it is possible to isolate bovine ES cells, suitable conditions for preventing spontaneous differentiation and senescence of these cells are yet to be established [126]. Similarly, validated ES cell lines have not been produced yet in other domestic species [127].  21  1.7  Thesis Obiective Since the discovery of XIST/Xist in 1991, the mouse system has provided an excellent  framework from which we can understand the process of X inactivation. However, cis-acting elements for human XIST regulation still remain unknown. My thesis research aims to determine if human XIST is regulated by elements similar to the mouse DXPas34, Tsix, CTCF sites, and Xite. In Chapter Ill, I examine human XIST upstream and downstream regions in available cell lines searching for regulatory elements. This work provides us with three previously unidentified potential functional elements. In Chapter IV, I analyse these sequences and provide clues as to their function. My thesis is a prelude to the understanding of human XIST regulation.  22  1%)  -‘  0) CD  2.1  Tissue Culture & Cell Lines ES-b cells [105] were maintained in the undifferentiated state by culturing in ES medium  (high-glucose Dulbecco modified Eagle medium [DMEM] (Chemicon)), 2 mM L-glutamine (lnvitrogen), 0.1 mM 13-mercaptoethanol (Sigma), 0.1 mM non-essential amino acids (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 15% fetal calf serum (HyClone), 100U/ml of recombinant leukemia inhibitory factor (LIF) (Invitrogen), and penicillin/streptomycin (final concentration 50 ig/ml each, Invitrogen) on mitomycin C-treated mouse fibroblast feeder cells grown in gelatinized plates (0.1% gelatin).  The human male fibrosarcoma cell line HT-1080 (American Type Culture Collection, CCL-121) and its L1.10.1 transgenic derivative [112] were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 7.5% fetal calf serum, 1% penicillin-streptomycin, and 1% L-glutamine (all from Gibco) at 37°C. Mouse-human somatic cell hybrids tll-4Aaz5 (containing a human Xi as well as six human autosomes in addition to mouse chromosomes) and t60-12 (containing a human Xa) [128] were maintained in alpha-Minimum Essential Medium (MEM) supplemented with 7.5% fetal calf serum, 1% penicillin-streptomycin, and 1% L-glutamine (all from Gibco) at 39°C. When confluent, these cells were passaged by trypsinization and reseeded at a density of 5 x 106 cells per 75 cm 2 flask. For the colony assay, K562 (an immortalized cell line produced from a female patient with chronic myelogenous leukemia) was kindly supplied by Dr. M Lorincz. These K562 cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% penicillin streptomycin, and 1% L-glutamine (all from Gibco) at 37°C.  2.2  RNA Extraction & Reverse Transcrii,tion  The guanidinium thiocyanate-phenol-chioroform extraction was performed essentially as described [129]. Briefly, solution D containing 4M guanidinium thiocyanate, 25 mM sodium citrate, 24  pH 7, 0.5% sarkosyl, and 0.1 M 13-mercaptoethanol was added to the cell pellet for lysing. An equal volume of water (DEPC-treated) saturated phenol and 1/10 volume of 2 M sodium acetate (pH 4) was then added to the lysate and thoroughly mixed. 0.4 volumes of chloroform was then added to remove any traces of phenol and the preparation was placed on ice for 5 -15 mm, followed by centrifugation (10 mm, 13,500 rpm). The top layer containing the RNA was transferred to a fresh 1.5 ml tube. One volume of isopropanol was added to the RNA solution and the sample was stored overnight at -20°C. The tube was centrifuged for 10 mm at 13,500 rpm to pellet the RNA the following day. The pellet was then rinsed with 70% ethanol to remove excess traces of salt, and then centrifuged to repellet the RNA. After removing the alcohol supernatant, the pellet was airdried, and re-suspended in 30 tl DEPC-water.  The RNA sample used for reverse transcription was treated with DNase I to remove DNA. For this,  th 1120  volume of RNase inhibitor (Amersham Pharmacia Biotech) and  th 1110  volume of  RNase-free DNase (Roche) were combined with the RNA in DEPC-ddH O, and incubated for one 2 hour at 37°C. Each RNA preparation was tested for genomic DNA contamination by performing PCR without the addition of reverse transcriptase. The RT reaction contained 5 .ig of RNA, lx firststrand buffer (Invitrogen), 0.01 M Dithiothreitol (DTT) (Invitrogen), 0.0625 mM dNTPs (Invitrogen), 1 il (100 pmole) random hexamers, 2 jil (1U) RNase inhibitor (Amersham), and 1 tl (1U) M-MLV (Moloney Murine Leukemia virus) reverse transcriptase (Invitrogen), brought up to a total volume of 20 uI by DEPC-water. The reaction mix was kept at room temperature for 5 mm followed by incubation at 42°C for 2 hours. The reaction was terminated by heat inactivation at 95°C for 5 minutes and the cDNA was stored at -20°C until further use. For strand-specific RT, first strand synthesis was performed using Superscript II reverse transcriptase (Invitrogen) with 12 tg of total RNA and either a sense or antisense primer (25 pmol) to amplify antisense or sense transcripts, 25  respectively. The sense orientation refers to the orientation originally described for XIST. The reactions were incubated at 50°C for 1 hour with subsequent heat-inactivation of the enzyme at 80°C for 30 mm.  2.3  Polymerase Chain Reaction (PCR) Briefly, PCR was performed using 0.1 tg of genomic DNA template, 1 U Taq polymerase,  0.25 mM dNTP, 2.5 mM MgCI 2 and 50 pmol each of forward and reverse primers in a 25 .iI reaction volume. After initial denaturation at 94°C for 2 mi  PCR was performed for 35 cycles with  denaturation at 94°C for 1 mm, annealing at 56°C for 1 mm and extension at 72°C for 2 mm.  Table 2.1— Primers for locating the transcription origin ofXlSTantisense (all gDNA amplification): Name H19 5’F H 19 5’ Fl I H19 5’R CTCF1F (61660F) CTCF1R (62076R) 22 kb -ye (72537F) 22 kb -ye (72911R) 61416F 61665R 61665F Ml [110] M2 [110] 15 16 17 27 32 5 6 Fol Rol ul [110] u2 [110]  Purpose CTCF control CTCF control CTCF control XIST3’ CTCF XIST3’ CTCF XIST 3’ CTCF XIST 3’ CTCF Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking Primer walking  Sequence (5’ to 3’) TAGTGTGAAACCCTTCTCGCA TG CAG G CTCACACATCACAG GATAATGCCCGACCTGAAGA TGCCAATGGTGGTAGTAGCT CCTGATCTGAGTTATGGCACC ACTGTCCCAGTTACCATGTTGC TTACAGGAAACCCCAACCATG CCTTTGGGGTATCTGGACAGGTTTT TTGGCACCACTGGCACCACT AGTGGTGCCAGTGGTGCCAA AG CCCATCTACATAAAACCAGTG GGCTTGTATCCTCATTAGGGACT TGGCACACGTATGTGGTTCT CTCTGAGTCTCCTATGACC GCCTGCTATCTGTGTGTTC AGACCTGAGAACATGTACCC CAGAGGTAAAACCTGTCCAG TTGGGGATGGAGAATAGGTG CCTGATCTGAGTTATGGCAC TGCCAATGGTGGTAGTAGCT ACCAGAGGTCATAGGTGGAT TTCTGGTGAAACTCGAAGGG AAGAGTGCAAGGCAGATCAATC  26  2.4  Use of Online Bioinformatics Tools We used EMBOSS FUZZNUC (http://bio.dfci.harvard.edu/Tools/EMBOSS/) to search for  potential CTCF binding sites. For the identification of conserved non-coding elements by humanmouse sequence alignments, we used DCODE ECR browsers (http://ecrbrowser.dcode.org/), corresponding to the human May 2004 (hgl7) assembly and the mouse May 2004 (mm5) assembly. Non-coding intergenic and intronic genomic sequences containing a minimum of 100 bases with at least 70% identify were shown. For the alignment of human and mouse promoter sequences, we used DCODE zPicture (http://zpicture.dcode.org).  2.5  Chromatin Immuno-Precipitation (ChIP) 7 cells were harvested and cell pellets washed twice with PBS. Cells were than 1x10  resuspended in 1 ml of media with 1% formaldehyde and incubated at 37°C for 10 minutes. Formaldehyde treated cells were then washed twice in PBS with 1/100 proteinase inhibitor cocktail (Sigma). After washes, cells were pelleted and lysed in 40 mM Tris-HCI pH 8.0, 1% Triton X-100, 4 mM EDTA, 300 mM NaCI, 10 mM sodium butyrate and ‘mini-protease inhibitor cocktail’ (Sigma) on ice for 10 minutes. Cell lysing was facilitated by passing solution through a 25G needle five times (fast first time, slow second time, fast third time, slow fourth time, fast last time), and storing on ice for an additional 5 minutes. The cell lysate was then sonicated 10 times at 30% power for 10 seconds with 1 minute wait between pulses. After centrifugation at 12,000 rpm for 10 minutes at 4°C, the supernatant was diluted to 2 ml with ChIP dilution buffer (0.01% SDS, 1.1% Triton-X 100, 167 mM NaCl, 16.7 mM Tris-HCI, pH 8.1) and pre-cleared with salmon sperm DNA/agarose slurry on a rocker for 30 minute at 4°C. The salmon sperm DNA/agarose slurry was later separated from the supernatant by centrifugation at 1,000 rpm for 10 seconds. The supernatant was split into 3 tubes (input, negative, and positive), with the positive mixed with 5 tl CTCF antibody (Upstate 27  Biotechnology, acquired by Millipore, catalogue number: 07-729) and incubated overnight at 4°C. The next day, salmon sperm DNA/agarose slurry was added to the negative and positive reactions and incubated for 1 hour at 4°C. Agarose slurry was then pelleted and washed sequentially with 1 ml of low salt immune complex (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20 mM Tris-HCI, pH 8.1, 150 mM NaCl), 1 ml of high salt immune complex (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20 mM Tris-HCI, pH 8.1, 500 mM NaCI), 1 ml LiCI immune complex (0.25M LiCI, 1% IGEPAL CA630, 1% deoxycholic acid, 1mM EDTA, 10 mM Tris, pH 8.1), and twice with 1 ml TE buffer (10 mM Tris-HCI, pH 8.0, 1 mM EDTA) for 5 minute at 4°C. The DNA-protein-antibody complex was separated from ) for 15 minutes at 3 the agarose by washing twice with 250 tl elution buffer (1%SDS, 0.1M NaHCO room temperature. Reversal of cross-links was carried out by adding 20 jil of 5M NaCI and incubating for 4 hours at 65°C. Proteins were removed by adding 10 jil of 0.5M EDTA, 20 jil 1M Tris-HCI, and 2 jil of 10 mg/mI proteinase K and incubating for 1 hour at 45°C. RNA was removed with RNase treatment and DNA collected following phenol-chloroform extraction to remove protein.  2.6  DNase I Hypersensitivity Mapping The preparation of nuclei and the DNase I digest were as described [129]. Briefly, cells were  harvested and washed twice in ice-cold PBS, then resuspended at 1x10 7 cells/mi in 10 ml ice-cold sucrose-triton (16 ml of 1M sucrose, 0.5 ml 1M Tris pH7.4, 0.5 ml 1 M MgCI , 0.5 ml Triton X-100, 2 O to final volume of 50 ml). Cells were swelled on ice for 15 minutes, then homogenized 10 2 ddH times in a Dounce homogenizer with a B pestle (7 ml, Wheaton). Homogenized cells were transferred to a 15-mi falcon tube and spun at 1,200 rpm for 15 mm at 4°C to recover nuclei. The supernatant was removed, and the nuclear pellet was resuspended in 1.5 ml of ice cold buffer A (50 mM Tris-CI pH7.9, 100 mM NaCI, 3 mM MgCl , 1 mM dithiothreitol, 0.2 mM phenymethyisulfonyl 2 fluoride) and aliquoted into seven 1.5 ml eppendorf tubes (200 i.tl each). Nuclei were digested with 28  increasing amount of DNase 1(10 U/jil, RNase free, Roche) (i.e. 1/128, 1/64, 1/32, 1/16, 1/8, 1/4  U/jil) at 37°C for 20 minutes. The digestions were stopped and DNA extracted by adding 1 ml DNazol (Invitrogen) following the manufacturer’s protocol. DNase I treated DNA was digested with restriction enzymes and analyzed by Southern blotting.  2.7  Southern Blotting Restriction enzyme digests were carried out according to the manufacturer’s  recommendations. For analysis of DNase I hypersensitive sites, 15  —  30 ig of DNA per lane was  used. Agarose gels (1%) were electrophoresed at 2 V/cm for 16 hr in lx TAE (0.04 M Tris-CI (pH7.5), 0.02 M NaOAc, 0.002 M EDTA), with one or two changes of TAE buffer during the run. Gels were, stained, photographed, denatured in 1.2 M NaCI, 0.5 M NaOH at room temperature for 45 minutes, neutralized twice in 0.6 NaCI, 1.0 M Tris (pH 7.4) for 20 minutes. DNA was transferred to BioTrace TM NT nitrocellulose membranes (Gelman Laboratory, Pall), premoistened in water, by capillary transfer in 3.0 M NaCl, 0.3 sodium citrate. After transfer (7-hr minimum) filters were rinsed twice in 2x SSC, air-dried, then either prehybridized, and hybridized or stored at 4°C. Prehybridization was done at 42°C, for 2 hours minimum in 3 x SSC, 50 mM sodium phosphate buffer (pH 6.5), 5x Denhardt’s (50x Denhardt stock is 1% Ficoll, 1% polyvinylpyrrolidone, 1% BSA), 150 ig/ml sonicated salmon sperm DNA, 50% formamide, and 10 mg/mI glycine powder. Hybridization was also done at 42°C, in prehybridization solution with the addition of 10% dextran sulphate.  The probe was generated using a standard PCR procedure, gel purified (Qiagen), and random primed with ct-dCTP . Briefly, 0.2 32  —  2 tg DNA template was mixed with 2 tl (2 nmole)  random hexamers and H 0 to 10 il. The mix was incubated at 95°C for 10 minutes, cooled on ice 2 for 2 minutes, and centrifuged briefly. The random priming reaction contained 10 jil random  29  primer buffer (1 M HEPES pH 6.6, 1 M Tris-CI pH 8.8, 1 M MgCI2, 12.5 M f3-mercaptoethanol (Sigma), 32 (Amersham) and and 10 mM each of dATP, dTTP, dGTP), 1 jil Kienow (Invitrogen), and 4 tl x-dCTP was incubated at 37°C for at least 45 minutes. The reaction, once completed, was diluted to 100 pA and column purified. Purified random-primed probe was heat-denatured, blocked with 250 ig of sonicated human placental DNA (Sigma) at 65°C for 90 minutes, and added to hybridization solution at 42°C. The hybridization was carried out at 42°C for at least 18 hours. The next day, the filter was rinsed twice with 2X SSC, and washed twice for 15 minutes each at 65°C with solutions A (50 mM Tris-HCI pH 8.6, 2 mM EDTA pH 8.0, 1% SDS, 1 M NaCl), B (0.5% SDS, 0.5 mM NaCI, 25 mM phosphate buffer, pH 6.8), C (50 mM Tris-HCI pH 8.6, 0.5% SDS, 0.5 mM NaCI) and D (0.1% SDS, 0.1X SSC).  Table 2.2 Name 1P368F I P359R 1P453F 1P444R IP1O11F IP1000R U862F U873R U1056F U1068R U1179F U 1190R  —  Primers for probe generation: Symbol 36  Size 921bp  45  874 bp  101  1190 bp  86  1041 bp  105  1209 bp  117  ll4Obp  Purpose HSmappingXIST5’ HS mapping XIST 5’ HS mapping XIST 5’ HS mapping XIST 5’ HS mapping XIST5’ HS mapping XIST 5’ HS mapping X/ST3’ HS mapping X/5T3’ HS mapping X!ST3’ HS mapping XIST 3’ HSmappingXIST3’ HS mapping XIST 3’  Sequence (5’ to 3’) CTTGCTCACCAATTGACTCGTAAG GAGGACGTGTCAAGAAGACACTAGG CATGGGAAAGCAGCAGACTTCT GGGCCTGAATGTGAGCATAGAT GAATAGCTCAACTGCCAGTGTTACT GGTCCTCAATGTCC1TACAAAGC TGGAGTCCAGTCGTTGTGCT ATAATCTTGCTACTGAAGGGGCT TGCTTGAAGGGTTTACTGCTGTC CTATACAATGCTCCTGTGATTCTAGTGC CTTCTGCACTCTGCTMAGTTCTGAC TCTGTGACTTGGCAAGCCTTC  30  Table 2.3  —  Restriction fragments for DNase I hypersensitivity mapping:  Gene Bank Entry AL.353804 Location (bp) Probes Enzymes 36917— 33094 (3823 bp) Scal 36 41259—35006 (6253 bp) 36 Spel 45989—39288 (6701 bp) 45 SapI 52037—44457 (7232 bp) 45 Ndel 101 Bsml 102809—92491(10319bp) 112919 99850(13069 bp) 101 Pstl —  —  2.8  Gene Bank Entry U80460 Probes Enzymes Location (bp) ScaI 77359 87336 (9977 bp) 86 86 Sapl/BIpl 85512—95728(10216bp) 105 Nsil 96076—107206 (11130 bp) 105308—114575 (9267 bp) 105 Xmnl 113318—119742 (6424 bp) 117 Ncol 117 BamHl 117447 123823 (6376 bp) —  —  —  Isolation of Plasmid DNA from E. coil Cells DH5cTM  (lnvitrogen) and JM109 (Promega) were bacterial strains used for cloning  experiments. Plasmid DNA was isolated essentially using the procedure for Alkaline Plasmid MiniPreparation as described [129]. Alternatively the QlAprep Spin Miniprep kit from Qiagen was used, following the recommendations of the manufacturer.  2.9  Plasmid Construction Primers were designed to amplify five DNA fragments of interest by PCR amplification of  human genomic DNA from GM01416 for 35 cycles. PCR fragments were first cloned into pGEM®-T Easy vector (Promega) via TA cloning so that DNA fragments to be inserted into piC (kindly provided by Gala Filipova), MSC2 (derived from piC by inserting additional restriction enzyme sites), and pGL4 series (Promega) could all be isolated from pGEM®-T Easy clones. Briefly, pGEM®-T Easy plasmids containing the DNA fragments of interest were isolated by miniprep kit (Qiagen), digested  with restriction enzymes (New England Biolabs) to generate sticky ends for cloning, and extracted using the QlAquick gel extraction kit (Qiagen). Purified DNA fragments were ligated, in both the sense and antisense orientation of the XIST transcript, into pG L4. 10 and pGL4.23 reporter vectors (Promega) upstream of the firefly luciferase gene, and between the enhancer and the neomycin resistance gene in piC (see appendix A.1 to A.6 for stepwise constructions for each plasmid). The  31  identities of pGL4 clones were confirmed by restriction enzyme digestion and piC clones were confirmed by both restriction enzyme digestion and sequencing.  Table 2.4— Primers for cloning: Name 368 F (0) 360R (0) 376F (1) 368R (1) 388F (2) 381R (2) 399F (3) 388R (3) S101630 (101) K100486 (101) MCS2 F M CS2 R * underlined is  Fragment Content Sequence 5’ to 3’ XIST promoter, TCGAG CTCCTTG CTCACCAATTGACTCGTAAG positive control CGGGTACCGAG GACGTGTCAAGAAGACACTAGG TCGAGCTCCA1TCCACACTTGTAGAAACTTCTAGTAG 1 kb upstream of XIST promoter CGGGTACCCTfACGAGTCAATTGGTGAGCAAG upstream of TCGAGCTCGAGCCAAGCAGTAGTGAAGGTGA 2 kb XIST promoter CGGGTACCGGTTGTCCTGGG1TCTGTGA TCGAGCTCCCCCGTGTTCTCTTTTGATAAACTAG 3 kb upstream of XIST promoter CGGGTACCTCACCTTCACTACTGCTTGGCTC TCGAGCTCGTGGAGTACCCTTTCTATCACAACT 65 kb upstream of XIST, covers HS 101 CGGGTACCTGGCTTGACTTCTAGGGTAAAGA AGAGCTCGATATCCTCGAGGCTAGCCCGCGGGAATTCGATTAATC Cloning sites from AGAGCTCGGCGCGCCGATCCGGATCCATATGGTCGACCTGCAGGC pG E M®-T Easy genomic sequence from NCBI; not underlined is adaptor (i.e. Sad & Kpnl sites)  *  MSC2 primer pair was used to PCR amplify part of the multiple cloning site of the pGEM®-T Easy plasmid and the amplicon was cloned into piC to generate the MCS2 vector  2.10  Transient Transfection & Luciferase Assay Transfection was performed in 24-well plates. When HT1O8O cells were 80% confluent, 0.8  jig of firefly luciferase plasmid (pGL4, Promega) and 80 ng of the Renilla luciferase plasmid TM 2000 (Invitrogen). For each (Promega) were co-transfected into cells using 2 jil Lipofectamine transfection assay, the pGL4.13 vector, which contains a promoter/enhancer element, was used as positive control and the pGL4.10 vector, which contains neither promoter nor enhancer, was used as negative control. Transfection of the pGL4 vector with a basal promoter also served as a control. After 24 h, cell lysates were prepared from each transfected culture using Passive Lysis Buffer supplied with Dual-Luciferase Kit (Promega) and were transferred to a Labsystems White Cliniplate FB (Labsystems) 96-well plate. The firefly and Renilla luciferase activities were analyzed in a 96-well  32  plate luminometer (Perkin Elmer Wallace) according to manufacturer’s protocol in the Dual Luciferase Kit (Promega). Each fragment was tested in triplicate, and each experiment was repeated at least three times. To control for transfection efficiency, the ratio of firefly luciferase signal to Renilla signal was calculated for each transfected sample.  2.11  Stable Transfection & Colony Assay Plasmids for the enhancer-blocking assay were isolated by miniprep kit (Qiagen), cleaved  with ApaLl (New England Biolabs), fractionated by agarose gel, and extracted by gel extraction kit (Qiagen). The K562 cells were split 24 hr before harvesting for transfection. Transfection with each construct was performed in triplicate. On the day of transfection, 4 x  K562 cells were plated in  60mm plate with 5 ml of growth medium without antibiotics. 8 g linearized construct was transfected into K562 cells using 20 ul Lipofectamine TM 2000 (Invitrogen) according to the manufacturer’s protocol. After 48 h of culture, 5 ml of K562 cells were diluted into 27 ml of warmed RPMI containing 750 jig/mI G418 (Invitrogen) and 3.5 ml 3% agar (Difco). The cells were quickly mixed and poured onto 15-cm petri dish. G418-resistant colonies were counted after 20 days of incubation at 37°C.  33  17E  JcI.IJ3SUDJI ,Ii33dS 3A!J30U!-X UWflH  io siuawa Aioeina u!pe-sp oi u!LpJeas E  3.1  Introduction The cis-acting regulatory elements involved in the initiation of X inactivation have been  studied extensively in mice; however, whether these elements are present in human is less clear. If Tsix, for example, is indeed indispensible for the proper initiation of X inactivation, it should also be  present in other eutherians. An antisense RNA was observed by RT-PCR in murine ES cells containing a YAC including human XIST [110], in human embryoid-body-derived cells [113], and in a male embryonal carcinoma cell line [112], as well as by RNA fluorescence in situ hybridization in human embryoid-body-derived cells [113] and in clones of a human male cell line transformed with an X1ST-containing PAC [112]. However, it has been postulated that human XIST is not negatively regulated by its antisense as it is in the mouse, because the antisense transcripts do not fully extend across the XIST locus and were found to be coexpressed with XISTfrom the same X chromosome in certain cell types [110, 112-115].  Similarly, CTCF is involved in many steps of mouse X chromosome inactivation [49, 58, 81, 130]. Yet, genome wide analyses demonstrated that CTCF binding is depleted surrounding the XIST locus in somatic cell lines (less than two CTCF binding sites in the 2 Mb region that encompasses 450 kb upstream and 1.5 Mb downstream of XIST) [131, 132]. Since CTCF binds transiently to DNA sequences downstream of Xist during early stages of mouse development [49], it is possible that CTCF binding occurs within a specific developmental time window in human and was not detected in the genome-wide study using somatic cell lines.  Genomic regions hypersensitive to DNase I digestion often contain cis-regulatory elements important for gene regulation [91, 133, 134]. In the mouse, both DXPas34 and Xite, involved in Tsix regulation and homologous X-X pairing, show DNase I hypersensitivity [77]. It should be possible to identify the human counterpart using the same approach. 35  To better understand the role of the human XlSTantisense in the regulation of X inactivation, I first searched for the origin of the antisense transcript in L1.1O.1, which was generated by transfecting the HT1O8O male fibrosarcoma cell line with a human X1ST-containing PAC [112]. L1.1O.1 was chosen because it is one of the transformant clones in which XlSTantisense transcript can be detected from the transgene [112]. I also inspected CTCF binding in L1.1O.1 by chromatin immunoprecipitation downstream of the X1ST3’ end to determine its involvement in X inactivation in human.  The ES-b cell line, generated by transfecting the ii male mouse embryonic stem cell with a 480-kb human XIC transgene, is an excellent model system to study the regulation of human XIST because the human transgene can induce Xist transcription from the single mouse X chromosome, likely due to the transgene being recognized as a second X inactivation centre [105]. Furthermore, the human XIST-containing transgene can induce inactivation of the endogenous mouse X in somatic cells of chimeric mice derived from ES-b [105]. Finally, the human transgene in ES-b expresses XIST as well as TSIX [110]. Similarly, mouse-human somatic cell hybrids, containing either a human Xi or Xa in addition to mouse chromosomes, provide a unique opportunity to compare the chromatin structure between Xi and Xa independent of each other without requiring allele-specific detection, thereby allowing detailed analyses of the XIC region. I therefore expanded my search for cis-acting regulatory elements downstream of the XIST 3’ end by mapping DNase I hypersensitive (HS) sites in ES-b, L1.10.1, and hybrids. Since it is conceivable that the 90 kb intergenic region between XISTandJPX/ENOXin human, which is approximately 9 times larger than that of mouse, could harbour cis-acting regulatory elements, I mapped HS sites upstream of XISTin available cell lines as well.  36  3.2  Results  3.2.1  XIST Downstream Sequence Comparison  Lee et al. [47] reported two 2-3 kb conserved blocks between human and mouse close to the promoter region of Tsix. Interestingly, the sequences of these two blocks do not correspond to the Tsix exons [52]. Furthermore, these blocks are conserved neither between mouse and cow, nor between human and cow [89]. It is possible that these regions were not selectively constrained and were conserved in human and mouse by chance. Multi-species sequence alignment (Figure 3.1),  using the evolutionarily conserved region (ECR) browser [135], comparing the XIST downstream region supports that there is a higher degree of similarity amongst human, cow, and dog than between human and mouse [89]. This data argues that regulatory elements found in mouse, if present in human, might not be at the same position as in human.  3.2.2  Antisense Transcription Origin Since many regulatory regions do not show sequence conservation (ENCODE Project  Consortium), it is possible that the human TSIX promoter was not detected in silico. Given the proximity of DXPas34 and Xite to Tsix transcription start sites, it is important to identify the extent of transcription of human TSiXto identify cis-acting regulatory elements for XIST. I used several primer pairs to determine the approximate location of TSIX origin in 11.10.1, one of the clones in which antisense transcript was detected [112].  37  XIST  Downstream  JPX/ENOX  I iii iiiii I thiI i i I si 1 J 1 IU L i[t,[:i .4.  1  II .,T  H  FiT  73,000,000  1  II  ••,  i%  ..Ji 1 L__.,:93mn2  “  “r’’”  ..  72,950,000  I  XIST  III  I  Cow  Dog  72,900,000  I  Conserved blocks [46]  ii  —  TSX  TSIX ES1O  Figure 3.1 Evolutionary Conserved Region (ECR) browser shows the alignment of mouse, cow, and dog against human XIST and 60 kb downstream sequence. Black boxes represent XIST exons, blue arrow indicates direction of XlSTtranscription, green dashed box includes region shown on ECR map. On ECR map, pink denotes evolutionary conserved regions, red bars indicate above 70% sequence identity, and green bars are transposons and repeats. Genomic coordinate is shown in base pair. Below ECR map, black boxes are XIST exons, orange boxes are conserved blocks between mouse and human, and blue box is the pseudogene TSX. —  38  RT-PCR results showed that primer pairs M1/M2 [113], 15/16, and 17/32, located 7 kb, 9.5  kb, and 10kb downstream of the XIST3’ end, could detect an RNA transcript in L1.10.1 but not in the parental HT1O8O male fibrosarcoma cell line (Figure 3.2). In comparison, primer pairs 5/6, Fol/Fo2, and ul/u2 [1131, located 11kb, 11.5 kb, and 20kb downstream of the XIST3’ end, showed no trace of RNA transcript in both L1.10.1 and HT1O8O (Figure 3.2). Primer pair 61416F/61665R, located between 17/32 and 5/6, could also amplify the RNA transcript (Figure 3.2). To confirm that the RNA transcript found was the result of antisense transcription, I carried out strand-specific reverse transcription using 61416F for antisense transcript and 61665R for sense transcript. While an L1.10.1 RNA preparation reverse transcribed with 61416F showed a positive PCR signal, a sample reverse transcribed with 61665R did not give any PCR band. These results suggest the origin of antisense transcription is approximately 10 kb downstream of the XIST 3’ end; this is in contrast to the finding in mouse ES cells with human XIST-containing transgenes that TSIX transcription originates 27kb downstream of the X1ST3’ end [110].  39  Downstream  xI5T  JOX  I  M1/M2  II  15/16  17/32  5/6 Fol/Rol  I  ul/u2  \!/  27/32  61416/61665  I I  I M1IM2  15/16  17/32  5/6  ul/ u2  Fol/Rol  I  I b  I  27/32  $3  ,,  4Sf’  q  61416/61665  I  Strand-Specific 61416/61665  1 I  ‘‘  +  .9  1  I I  . I I I I I I I  I I I I I I I  I  I  I  I I I I  I I I  Figure 3.2— RT-PCR and strand-specific RT-PCR with various primer pairs downstream of the XIST3’ end. Black boxes represent XIST exons, blue arrow indicates direction of XlSTtranscription, and pink dashed box shows location of region examined by RT-PCR. The same RNA preparation was used in all reactions except 61416/61665, and all experiment were repeated at least twice from different RNA preparations. Primer pair 27/32, which amplies a smaller fragment within 15/16 and 17/32, was used to check for DNA contamination. M1/M2 and ul/u2 were from Migeon et al. [1101. PCR was carried out for 35 cycles. 40  3.2.3  CTCF Binding & Chromatin ImmunoPrecipitation Using EMBOSS FUZZNUC, I searched for CTCF binding sites based on the consensus  sequence CCGCNNGGNGGCAG [75]. I found two small clusters, each containing four potential CTCF binding sites within 400 bp, located approximately 11kb and 13kb downstream of the XIST3’ end; the location of these two clusters is consistent with that reported by Chao et al. [49]. Since the two clusters are embedded within repetitive elements, I was only able to design primers to examine the first cluster by chromatin immunoprecipitation. L1.10.1 was chosen as the system to analyze CTCF binding because it expresses the XlSTantisense unlike other somatic cell lines. Since the insulin-like growth factor 2 (lgf2) and H19 genes are imprinted and the imprint is regulated by CTCF binding to several sites within the imprinting control region (ICR) [136], I used primers that amplify DNA within the H19-lgf2 ICR as a positive control. A region approximately 22kb downstream of the XIST3’ end showing five putative CTCF binding sites within 8 kb was chosen as negative control. While the positive control amplified, primer pairs CTCF1F/R and negative control showed no amplification of the DNA after ChIP with CTCF antibody (Figure 3.3).  41  XIST  I  I I I  CTCFI  II  I I  Downstream  22kb-ye  I  1kb ,  =  2 CTCF Sites  Ff19  I CTCF I  22kb -ye  I I  ‘0  I  Figure 3.3 Chromatin immunoprecipitation using CTCF antibody on L1.1O.1 and HT1O8O. Black boxes represent XlSTexons, blue arrow indicates direction of XIST transcription, and pink dashed box shows downstream of the XIST 3’ end. Search for individual CTCF binding sites was based on consensus sequence CCGCNNGGNGGCAG. Potential CTCF binding sites are presented by blue balls (two sites per ball due to clustering of sites within few hundred base pair). Pictures shown are gels of PCR products amplifying DNA from ChIP experiments: H19-igf2 ICR as positive control, the first cluster of CTCF-binding sites located 11 kb, and negative control located 22 kb, downstream of the XIST3’ end. PCR was carried out for 35 cycles. —  42  3.2.4  DNase I Hypersensitive Mapping  —  Downstream  The multi-copy integration of a 480-kb human XlCtransgene is recognized as an X1C in the ES-b cell line and expresses XISTas well as TSIX [110]; it is, therefore, logical to carry out DNase I HS mapping with ES-b cells. I generated three probes downstream of XIST detecting six overlapping restriction fragments allowing the analysis of a 43 kb region. Only the SapI/BIpI fragment showed an additional band across all lanes except the first (i.e. without DNase I digestion) (Figure 3.4). The size of the band suggests the presence of a hypersensitive site located approximately 12—13 kb downstream of XIST(Figure 3.4). This HS site does not correspond to any of the four transcription start sites described by Migeon et al. [110]. Instead, the location of this HS site is in close proximity to where antisense transcript was seen in L1.b0.1. I aligned the 1 kb sequence encompassing this HS site to mouse, cow, dog, and monkey and found a stretch of sequence that is primate specific (Figure 3.5A). Intriguingly, a small cluster of putative CTCF binding sites found in silico resides within this region (Figure 3.5B).  HS mapping in L1.10.1 showed that the HS site found in ES-b downstream ofXlSTdid not correspond to the TSIX transcription start in L1.10.1 since this HS site was not found in L1.10.1 (Figure 3.6). Indeed, it was surprising that not a single HS site was detected in L1.10.1 despite detection of XlSTantisense transcript with both RT-PCR and FISH [112]. I carried out RT-PCR to confirm the ongoing presence of antisense transcript (data not shown), and excluded the possibility of loss of expression through culturing/passaging.  43  XIST  Downstream  10kb  II  4,HSsite  Scal  I  I I I  Sapi/Bipi  NsiI  XmnI  NcoI  BamHI Probe —  I  I I  ES1O  I  _I  I  :  I  I I I I I I  I I I I I I  I  I  L  I I  Figure 3.4—DNase I hypersensitive mapping downstream of XISTin ES-lO cells. Black boxes represent XIST exons, blue arrow indicates direction of XlSTtranscription, and green dashed box shows location of region examined. Blue stars represent probes, restriction fragments, shown as orange lines with name of restriction enzyme above, are overlapping to maximize probe to area analyzed ratio. Wedges show increasing concentration of DNase, with no DNase in the first lane. All experiments were carried out at least twice with different cell preparations. One HS fragment, highlighted by the blue arrow, was detected in a fragment generated by Sapl/BIpl digestion; the parental fragment, highlighted by the red arrow, is 10 kb and the fragment resulting from HS and restriction digestion is 7 kb. No HS site was detected in the Xmnl generated fragment which encompasses the four transcription start sites of TSIX previously reported by Migeon et al. [1101.  44  A  *  I  1  HSsite  V  Probe  —  SapI/BIpI 00%  —  -  __I_._____ ———  —  ZZ  —____  —  —__________  JThLF  mouse  _3  2  cow dog monkey  caGACCUATATATrCUA1TrAflTrACTTAGTrATAmGACTATTCTrATTTCCTTGAAAGAGTCAAGAATTGCCAAGATGA AACACC1TrGGGGTATCTGGACAGGTTTACCTCTGTCAACCCTTGCAAGAAAAT1AGAATtGACTTACCUGGGGATGGAG AATAGGTGACACTtGTGAATGAAGAAAATATGTAGTGAAGGCCTGTGATTGGGAAAATCAGAGGGCTGGTGAGGGTA CAAATGUGGCTGTtGCTGAAAAGGCUCTGTGATGGAGAGTGAAGCAACTGGGGTGCAGTGGGGTGGTGGCAGTGGTG CCAGTGGTGCCAATGGTGGTAGTAGCTGCTGAGTGTCAGGCCTCTGAGCCCAAGcctgcacatatacatccagatggcctgaagcaact  cagatcaggggacttcccttgggagatcaatcccctgtcct  Figure 3.5 (A) Sequence alignment of the Sapl/Bipl fragment against mouse, cow, dog, and monkey. On ECR map, pink denotes evolutionary conserved regions, red bars indicate above 70% sequence identity, and green bars are transposons and repeats. Genomic coordinate is shown in base pair. (B) Analysis of human 1 kb sequence encompassing the HS site shows at least four potential CTCF binding sites, marked by red. Lower case sequences are repeats. —  HS mapping in both Xi and Xa hybrids did not show the HS site downstream of the XIST 3’ end found in ES-lO (Figure 3.7), suggesting that the site observed in ES-lO is developmental specific. It is interesting to note that in mouse, there is at least one constitutive HS site downstream of Xist [77], whereas in human, a HS site was not detected on either of the X chromosomes downstream of XIST3’ end in somatic cells.  45  Downstream  xI5T  10kb  :  II ScaI  SapI/BIpI  Ns,1  XmnI  NcoI  : :  BamHI  I I I  Probe  L1.10.1  I I I  V &  I, w  1jt1i ‘  I I  I I  1  .1  Figure 3.6— DNase I hypersensitive mapping downstream of XIST in L1.1O.1. Black boxes represent XlSTexons, blue arrow indicates direction of XIST transcription, and green dashed box shows location of region examined. Blue stars represent probes, restriction fragments, shown as orange lines with name of restriction enzyme above, are overlapping to maximize probe to area analyzed ratio. Wedges show increasing concentration of DNase, with no DNase in the first lane. All experiments were carried out at least twice with different cell preparations. No HS site was detected in the Sapl/Bipl fragment in which a HS site was found in ES-iC. The Sapl/BIpl fragment also encompasses location of where antisense transcription was last found in Li.iO.i.  46  Downstream  xIsT  JPX/ENOX  10kb TS!X L1.1O.1  TS1X ES1O  I  I  I  10kb  Scal  SapI/BIpI  NsiI  XmnI  NcoI  I  BamHI Probe  I  V  Xa  I I I I I I  v  ,  I I I I I I I I I I  I I I I I I I I I I I I I I I I  I I  I I  Xi  I  L  Figure 3.7  —  DNase I hypersensitive mapping downstream of XIST in hybrids. Black boxes represent  XlSTexons, blue arrow indicates direction of XlSTtranscription, and green dashed box shows location of region examined. Blue stars represent probes, restriction fragments, shown as orange lines with name of restriction enzyme above, are overlapping to maximize probe to area analyzed ratio. First row uses mouse-human somatic cell hybrid t60-12 for the analyses of Xa and second row uses tll-4Aaz5 for the analyses of Xi. Wedges show increasing concentration of DNase, with no DNase in the first lane. All experiments were carried out at least twice with different cell preparations. No HS site was detected.  47  3.2.5  XIST Upstream Sequence Comparison  Sequence comparison shows a region 60 kb upstream of XIST that is conserved amongst human, cow, and dog but not mouse (Figure 3.8). I generated 3 probes to examine the epigenetic landscape upstream of human XIST. The restriction fragments cover a total of 39 kb in the 90 kb region. Due to the repetitive nature of the sequence, part of the upstream region was not examined.  Upstream  XIST  —  •  JPX/ENOX  1  TT  i  i £ 1 Iii tj.,1’1L.’i1i., 73,060,000  £111  i Li  I  -  i  iiLA,iji .1  i  I  —  i  i  10kb  Mouse  AI  ,.,kiii 73,040,000  73,020,000  73,000,000  LTR  SINE/LINE  72,980,000  10kb  Figure 3.8 Evolutionary Conserved Region (ECR) browser shows the alignment of mouse, cow, and dog against 70kb upstream of human XIST. Black boxes represent XIST exons, blue arrow indicates direction of XIST transcription, red dashed box indicates region shown on ECR map. On ECR map, pink denotes evolutionary conserved regions, red bars indicate above 70% sequence identity, and green bars are transposons and repeats. Genomic coordinate is shown in base pair. Approximately 80% of the upstream sequence is repetitive; the distribution of 28% short interspersed nuclear element (SINE) and 40% long interspersed nuclear element (LINE), is represented together as orange bar below the ECR map, and 8% long terminal repeat (LTR) is shown as blue bar below the ECR map. Due to the size of the region, the small fraction of LTR present within SINE/LINE and the small fraction of SINE/LINE present within LTR are not shown. —  48  3.2.6  DNase I Hypersensitive Mapping Upstream -  Instead of a single parental band in each lane as seen with mouse-human somatic cell hybrids (e.g. Ndel fragment, Figure 3.10), the analysis of ES-b yielded multiple bands (e.g. NdeI fragment, Figure 3.9). As the bands were also present in the first lane (i.e. without DNase I digestion), it is unlikely that these bands represent HS sites. Instead, the multi-copy transgeries might not contain the same amount of DNA sequence flanking the XIST locus, resulting in multiple bands for probes proximal to XIST.  The SpeI fragment showed a band below the parental fragment in all lanes except the first (Figure 3.9). The size of the band suggests the presence of a hypersensitive site immediately upstream of XIST in ES-b (Figure 3.9). This HS site was also seen on the active X chromosome where XIST is silenced (Figure 3.10). While no other hypersensitive sites were detected upstream of XISTin ES-b, one HS site was found approximately 65 kb upstream ofXlSTtranscription start site  on both active and inactive X chromosomes in somatic cell hybrids (Figure 3.10).  The presence of this HS site 65 kb upstream of XISTwas confirmed with two other restriction enzyme fragments in the Xa hybrid (Figure 3.11). The Xa hybrid was chosen because this cell line gives low background signal as the X chromosome is the only human chromosome in the mouse cell. This HS site was not seen in ES-b, and the appearance only in differentiated cells suggests developmental specificity.  The novel HS site identified on both the Xa and Xi in somatic cell hybrids is located within a region that shows above 70% identity to sequence in cow and dog in a comparable region. Dot-plot analysis, using Mulan [137], further illustrates that the location of the HS site is within a conserved  49  region upstream of XIST(Figure 3.12). Comparison between mouse and human shows lack of similar conservation (Figure 3.12).  Upstream  XIST  I  JPX/ENOX  r  10kb Exon  I III IN  -  II  :10kb Restriction Fragment Probe  HSsite I I I I I I I I I I I I I I I  I I I I I I I  t  PstI  V  ES1O  •  BsmI  -  NdeI  4,  SapI SpeI  _____  0  4  -  Scal  I I I I I I I I I I I I I I  I I I I I I I I  Figure 3.9— DNase I hypersensitive mapping upstream of XIST in ES-b. Black boxes represent XIST exons, blue arrow indicates direction of XIST transcription, and red dashed box shows location of region examined. Blue stars represent probes, restriction fragments, shown as orange lines with name of restriction enzyme above, are overlapping to maximize probe to area analyzed ratio. Wedges show increasing concentration of DNase, with no DNase in the first lane. All experiments were carried out at least twice with different cell preparations. The multi-copy XlSTtransgenes each contains different stretch of flanking DNA sequence as seen by the presence of multiple bands for probes proximal to the XlSTtranscription start site. One HS fragment, highlighted by blue arrow, was detected within the Spel fragment, highlighted by a red arrow. No other HS site was observed.  50  Upstream  XIST  —  10kb  rZZ: : : : := := = =:3:::::’:::z 1 II  10kb  I  Restriction Fragment Probe  4,  HS site  PstI  BsmI  HSsite  NdeI  4,  SapI Spel  Scal  VI  Xi  Figure 3.10— DNase I hypersensitive mapping upstream of XISTin hybrids. Black boxes represent XlSTexons, blue arrow indicates direction of XlSTtranscription, and red dashed box shows location of region examined. Blue stars represent probes, restriction fragments, shown as orange lines with name of restriction enzyme above, are overlapping to maximize probe to area analyzed ratio. Wedges show increasing concentration of DNase, with no DNase in the first lane. One and three HS sites, highlighted by the blue arrow, were detected within Spel fragment, highlighted by the red arrow, for Xa and Xi, respectively. Another HS site, highlighted by the blue arrow, was also found approximately 60 kb upstream of the XIST transcription start in both Xa and Xi hybrids.  51  HS  site Probe  BsmI  10kb  ScaI  BgiII  ‘ii  HS  site BgIII RefSeq Genes 100%  1  mm9 -—  .  --  [jbnjau3  COW  f32  dog  -J 73,057,500  73,055,500  73,053,500  mouse  -  73,051,500  73,049,500  Figure 3.11— DNase I hypersensitive mapping upstream of XISTin Xa hybrid. Black boxes represent XlSTexons, and blue arrow indicates direction of XIST transcription. Blue stars represent probes, restriction fragments are shown as orange lines with name of restriction enzyme to the left. Wedges show increasing concentration of DNase, with no DNase in the first lane. The location of the HS site was refined by5cal and BgIll restriction fragments. The BgIll fragment, highlighted by the red arrow, is 9.3 kb and the fragment resulting from HS and restriction digestion, highlighted by the blue arrow, is 5 kb. The Scal fragment, also highlighted by the red arrow, is 11.8 kb and the fragment resulting from HS and restriction digestion, highlighted by the blue arrow, is 8 kb. Sequence alignment of human BgIll fragment against mouse, cow, and dog shows a stretch of sequence that is conserved. Genomic coordinate is shown in base pair. 52  Upstream  XIST  —  10kb  I,  I  •  I III[  JE_-:_:_-_-_-_:-_:_-j_:_-j_..  —  TSIX 11,10.1  38kb  TSIX 1510  35kb  4-  29 kb  27 kb  ,  ‘  I  E  a)  1  19kb  ECo  18kb 0. -  ,  .z  \.  CO tfl  10kb  .0 i  •‘\‘  .‘‘\  Lfl en  0  .  0 C_I  \ ,  .  .  .  9kb’ \  I  ,  I  I  \. 92kb  69kb Human 91.6  23kb  46kb  kb  0kb  92kb  upstream of Xist  69kb  46kb  23kb  0kb  Human 91.6 kb upstream of Xist  10kb 4-  -vs I_I..  oIu  ‘I—  ‘  0  ECo a)  0.  5kb!  .0 0  3kb 0  I  92kb  69kb  46kb  23kb  0kb  Human 91.6 kb upstream of Xist  Figure 3.12 Dot-plot analyses showing DNA sequence between X1ST and JPX/ENOX of cow, dog, and mouse against that of human. Each dot is based on 100 bp of at least 70% sequence identity. Red bar marks location of HS site identified on both Xa and Xi in somatic hybrids. Comparison between mouse and human shows virtually no conservation. —  53  3.3  Discussion  3.3.1  Downstream of XIST The lack of a HS site corresponding to the TSIX transcription start in ES-b (Figure 3.4) is an  interesting finding because the expression of human TSIX persists in ES-b cells long after their differentiation into EBs and in the fetal somatic cells derived from ES-b chimeric foetuses [113]. Similarly, no HS was found downstream of the XIST3’ end in L1.1O.1, even though presence of antisense RNA transcript was repeatedly confirmed. It is possible that TSIX was transcribed at a very low level and only detectable by RT-PCR. It has been demonstrated in A. thaliana that Pol V dependent transcripts, detectable only by RT-PCR, can serve as scaffolds for transcriptional gene silencing of overlapping and adjacent genes [138]. However, the coexpression ofXlSTand TSIX from the same genomic region [112, 113] (i.e. lack of XIST silencing in the presence of TSIX) argues that TSIX is not a negative regulator for XIST. Recently, the ENCODE consortium determined that the majority of the DNA in the human genome is transcribed. In the transformant clone L1.1O.1, for example, the level of antisense transcript (2OO copies per cell) [112] could simply be the result of background transcription. Furthermore, in mouse, the region downstream of Xist harbours at least seven developmental specific HS and one constitutive HS sites whereas only one developmental specific HS site was found in human. Such differences in cis-acting regulatory elements between mouse and human XIST are consistent with the idea that mouse Xist and human XIST are regulated differently.  The function of the downstream HS site is unclear, yet, sequence analyses provided valuable clues. The HS site contains several CTCF binding motifs, some with one to two mismatches. It is plausible that an ES cell-specific CTCF co-factor could increase the binding affinity of CTCF to target sites, even those with mismatches; such modulation of DNA binding would allow CTCF to be 54  recruited to the HS site downstream of XIST before differentiation. It is also interesting to note that this HS site coincides with one of the degenerate A repeats (the consensus sequence  —  GCNNCNNGGNGGCAGG), which corresponds to the mouse A repeat in DXPas34 [71]. DXPas34 in mouse not only regulates random and imprinted X inactivation, but also participates, through interaction with CTCF, in homologous X-X pairing that is essential for the initiation of X inactivation. It would be logical to carry out ChIP at this HS site in ES-b to test for CTCF binding.  In ES-lO, mouse Xist RNA was expressed from the single X chromosome in male EBs containing the human XlSTtransgene, suggesting that the human XlSTtransgene is recognized as an X1C and able to induce counting. As mentioned in the introduction, the counting step at the onset  of X inactivation requires “communication”, which can be accomplished through pairing. Since the downstream HS site in ES-b harbours putative CTCF binding sites and shows developmental specificity (i.e. not found in somatic cells), it is possible that this HS site is responsible for pairing between the human XlSTtransgene and the male mouse DXPas34 region on the single X chromosome. This is testable using chromosome conformation capture and fluorescent in situ hybridization.  It is intriguing that the sequence of the downstream HS site shows no homology to other species examined except rhesus monkey. If this HS site is indeed the functional equivalent to the mouse DXPas34, it would support the idea that mechanism of X inactivation varies amongst different species [104, 114]. My finding might also provide evidence that inefficient X inactivation by human XIST in mouse is due to the inability of species-specific regulatory elements to function properly. This hypothesis would be difficult to examine though because: (1) the lack of knowledge as to the identity of the regulatory proteins and therefore the target sequences cannot be identified  55  in silico, and (2) the species specificity of these elements prevents their discovery by simply  introducing human transgenes into the mouse ES cells. Only when the culturing condition is optimized for human ES cells to reduce epigenetic instability can we determine the identity of species-specific regulatory elements for X1ST.  3.3.2  Upstream of XIST The region between XIST and JPX/ENOX is approximately 90 kb in human and contains  stretches of sequences that are conserved amongst human, cow, and dog but not mouse. It was surprising to find only one HS site immediately upstream of XIST in ES-b. It is possible that some cis-acting regulatory elements for XIST in the upstream region are species-specific and not activated in mouse ES cells. The only HS site detected in ES-b probably corresponds to one of the HS sites, that was also identified upstream of the XIST promoter, on the Xi and Xa in somatic cell hybrids.  Another HS site (101), located further upstream of XIST, was detected on both the Xa and Xi in somatic cell hybrids, It is unlikely that the presence of HS 101 was the result of mouse proteins specifically targeting a region upstream of human XIST because the same HS was not found in ES-b. Since this HS site was not seen in ES-b, it may be specific to differentiated cells. Interestingly, HS 101 resides within a region that shows above 70% sequence identity to cow and dog in a comparable region. Further inspection of this region reveals homology to the Rasilic gene. Rasilic, located upstream of the chicken Lnx3 gene from which XIS T/Xist have evolved [23], has  become a pseudogene with one exon in human and four exons in cow and dog upstream of XIST [23]. It is possible that HS 101 is also present in cow and dog. The role of these upstream HS sites will be investigated and discussed in the next chapter.  56  An interesting phenomenon worth mentioning is that the human XIST transcript in Xi somatic cell hybrid does not localize to the X chromosome [139, 140]. If one accepts the assertion that the cis-spreading of XIST RNA requires chromatin entry sites along the entire chromosome, it is conceivable that the number of HS sites detected in somatic cell hybrids where XIST does not localize would be an underestimation. However, the recent genome-wide DNase I HS mapping in primary human CD4 T cells [141] not only validated the presence of two HS sites between XIST and JPX/ENOX in somatic cells but also showed that XIST localization to the X chromosome does not  create additional HS sites between XIST and JPX/ENOX.  Curiously, there were three HS sites identified immediately upstream of the XIST promoter on the Xi in one preparation of cells from somatic hybrid, yet I could not obtain the same results even on different cultures of the same Xi hybrid or in a different Xi somatic cell hybrid (data not shown). It is possible that the three observed HS sites on the Xi were experimental artefacts, as the genome-wide HS mapping in human CD4 T cells showed only one HS site immediately upstream of the XIST promoter. Given that the probe is specific (Figure 3.9  —  first lane (with no DNase) did not  show any signal other than the parental fragment), we could not exclude the possibility that the three HS sites observed on the Xi are cell-type specific (i.e. not found in human CD4 T cells). Since XIST expression is not necessary for maintenance of X inactivation [142, 143], it is conceivable that losing these HS sites involved in XIST regulation is not deleterious in the hybrids. HS mapping in female human cells other than CD4 T cells would address the authenticity of the HS sites on the Xi in somatic cell hybrids.  57  Lfl Co  U)  CD  CD  U) —.  CD  -‘ U)  CD  1<  —  CD  U)  0)  z  -Ii  0  U)  CD  U)  0)  0)  5.  n 4-I.  -n  4.1  Introduction  The inactivation of an entire X chromosome requires a high level of XIST, and this presents a paradox. As the transcriptionally active XIST domain is intercalated with the silent chromatin of an Xi and vice versa, spreading of silencing complexes is likely blocked by genomic insulators or boundary elements. Several studies have shown a functional correlation between DNase I hypersensitive sites and boundary elements or insulators [144-148]. The transcriptional regulator CTCF is the only insulator protein known in vertebrates and Filippova et al. [1301 have formally demonstrated the involvement of CTCF in insulating genes that escape X-inactivation from the surrounding heterochromatic environment of the Xi. Similarly, Pugacheva et al. [119] and Navarro et al. [58] have argued for a role for CTCF in the regulation of XIST/Xist. It is possible that the identified HS sites upstream of XIST transcription start possess the ability to protect genes from inappropriate signals emanating from their surrounding environment.  The colony assay, designed to assess the boundary activity of a DNA sequence, was first established to analyze the f3-globin domain [149]. Since then, the colony assay has been used as a standard for testing the boundary activity of DNA sequence [49, 119, 150]. In most cases, the sequence of interest is cloned into the Sad site between the mouse globin H52 enhancer and the neomycin gene that has its transcription driven by a basal promoter (Figure 4.1B). If the DNA inserted harbours boundary activity, the HS2 enhancer would not be able to activate the basal promoter to drive the transcription of neomycin, and there will be no resistance to G418 resulting in cell death when maintained under selection. On the other hand, inserts with no boundary activity would allow the enhancer to activate transcription of the neomycin gene and therefore cells would stay alive under G418 selection.  59  It is important to note that not all HSs contain binding sites for boundary elements or insulators. Specifically, some hypersensitive sites show promoter activity while others behave as enhancers or suppressors [151]. Given that multiple transcription start sites and transcripts have been identified to regulate Xist expression in mice, it is possible that the HS sites identified upstream of XIST are origins of transcripts that have important functional roles in human XIST expression. To determine whether these HS sites act as promoters or enhancers, I used the dual luciferase reporter assay system. The reporter assay system contains the firefly luciferase (fI) and the Renilla luciferase (rI) that are expressed simultaneously in each cell. The fI shows the effects of DNA sequence of interest inserted upstream of the reporter gene; and the ri as a co-transfected control reporter provides an internal control. Normalizing the activity of the experimental reporter to that of the internal control minimizes the variability caused by differences in cell viability and transfection efficiency.  4.2  Results  4.2.1  Colony Assay DNA fragments containing the identified HS site upstream of XISTto be tested for functional  assays were generated by PCR and then TA cloned into the pGEM®T Easy vector. Primers used were designed to have a Sad site at the 5’ end of the forward primer and a Kpnl site at the 5’ end of the reverse primer. During the cloning process, some fragments showed a cloning orientation preference and required directional cloning. However, piC has been modified several times, such that there are no restriction enzyme sites available for directional cloning. I therefore created MCS2 by introducing a multiple cloning fragment derived from pGEM®-T Easy vector into the Sad site of piC (MCS2 is essentially piC, but with additional restriction sites in 108 bp). 60  K562 cells transfected with linearized constructs were maintained in liquid media for 48 hours before being mixed with agar and plated onto petri dishes. Colonies were counted after three weeks and results are shown as a ratio of test fragment divided by original vector (i.e. piC test / piC, MCS2  +  +  test / MCS2). Data collected from two independent colony assays, carried out in  triplicate, suggested that fragment 3 might act as enhancer in the X!ST orientation and fragment 1 could act as enhancer blocker also in the XIST orientation (Figure 4.1). No other fragments showed changes in colony number compared to their respective backbone vectors.  61  A  iPX  XIST  I’ll  ?ft 101  3210  B  Novel HS  piC  C 3.5 3 2.5  f  T I i i  iliflEiE[ i •fli i i i i i i 0 1O1R  1O1F  3R  3F  2R  2F  1R  iF  OR  OF  pJC&MCS2  HS4  Figure 4.1— Colony assay. (A) The line indicates the region between XIST and JPX/ENOX, with white arrows showing the direction of transcription for the two genes, and red arrows demonstrating the locations of HS sites and DNA fragments cloned into pJC/MCS2. (B) Organization of plasmid constructs, mouse globin HS2 is the enhancer coloured in green, neomycin gene is coloured orange with orange arrow showing the direction of transcription, and chicken 3-globin HS4 insulator coloured in blue, and fragment of interest inserted coloured in black. (C) Summary of the ratios of colony number for each insert derived from dividing absolute colony number by number of colonies observed with the backbone vector (i.e. piC + 101 / pJC & MCS2 + 101 / MCS2). pJC and MCS2 are set as 1. The HS4 insert was used as a positive control that should show a reduction in colony forming units, fragment 1 in the XIST orientation (i.e. same orientation as the XIST transcript, iF) also showed enhancer blocking ability. Fragment 3 in the XIST orientation (3F) showed an increase in colony forming units. Each fragment was tested in triplicate and experiments were carried out twice independently. Error bars represent the standard deviation of two trials. 62  4.2.2  Promoter & Enhancer Assays I cloned the fragments containing the identified HS site, generated for the colony assays,  upstream of either a promoterless luciferase reporter (pGL4.1O) or a luciferase reporter with a minimal promoter (pGL4.23). Fragment 3 showed a very strong cloning orientation preference; specifically, all twenty-two and twenty-five positive clones, for pGL4.1O and pGL4.23, respectively, are in the antisense orientation (i.e. reverse orientation as the XlSTtranscript). Several attempts of directional cloning also did not yield any colonies, fragment 3 in the XIST orientation was therefore not examined.  While fragments upstream of the XIST promoter containing HS sites showed background luciferase activity, fragment 101 displayed five fold and seven fold increases in promoter activity in the XIST and antisense orientation, respectively (Figure 4.2C). Although such an increase by fragment 101 is low compared to the eighty-two fold increase mediated by the XIST promoter (see Appendix A.8), it is nevertheless statistically significant (two-sample t-test, p  <  0.05) compared to  the pGL4.10 promoterless vector, Interestingly, fragment 101 also showed ten fold and six fold increases in enhancer activity in the XIST and antisense orientation, respectively (Figure 4.3C). Fragment 0, containing the X/STtranscription start, was used as control and showed a sixty-five fold increase in enhancer activity compared to pGL4.23 (see Appendix A.9).  63  A  jpx  X1ST  III  7ff 101  321  B  poly(A) signal  C 9 8 7  6 5 4 3 2  I 0  .  1O1R  1O1F  3R  2R  2F  1R  iF  pGL4.iO  Figure 4.2 Luciferase assay for promoter activity. In (A) the red line indicates the region between XIST and JPX/ENOX, the white arrows show the direction of transcription for the two genes, and the red arrows are locations of HS sites and DNA fragments cloned into pGL4.1O. In (B) the backbone vector pGL4.1O from Promega is shown. The pGL4.1O vector contains the synthetic firefly iuc2, which does not have any promoter driving its transcription. In (C) histogram shows summary ratio of luciferase activity for each insert derived from dividing the firefly luciferase (fI) to renilla luciferase (rI) ratio of insert by the fl/rI ratio of pGL4.1O. Each fragment was tested in triplicate and experiments were carried out three times independently. Error bars represent the standard deviations of three trials. —  64  A  jp  XIST  III  101  321  B  poly(A) signal  minimal promoter C 16  14 12 10 8 6 4  2  0  1O1R  1O1F  3R  2R  2F  1R  iF  pGL4.23  Figure 4.3 Luciferase assay for enhancer activity. In (A) the red line indicates the region between XIST and JPX/ENOX, the white arrows show the direction of transcription for the two genes, and the red arrows are locations of HS sites and DNA fragments cloned into pGL4.23. In (B) the backbone vector pGL4.23 from Promega is shown. The pGL4.23 vector contains the synthetic firefly Iuc2, which has a minimal promoter but no enhancer driving its transcription. In (C) histogram shows summary ratio of luciferase activity for each insert derived from dividing the firefly Iuciferase (fI) to renilla Iuciferase (rI) ratio of insert by the fl/ri ratio of pGL4.23. Each fragment was tested in triplicate and experiments were carried out three times independently. Error bars represent the standard deviations of three trials. —  65  4.3  Discussion  4.3.1  Colony Assay  When a DNA fragment that possesses enhancer-blocking activity is inserted between the mouse globin HS2 enhancer and the neomycin gene of piC, this construct no longer confers G418 resistancy when transfected into K562 cells. This would result in a significant reduction in colony number while under selection. Only the fragment containing HS site 1 showed a reduction in colony number when inserted into piC in XIST orientation. However, this fragment did not reduce colony number in an independent experiment in which the positive control piC failed to keep K562 cells alive under G418 selection (see Appendix A.7). Since G418, at a concentration above 400 pg/ml, is very effective in mammalian cell selection, the inability of the HS site 1 to consistently reduce colony number suggests that this HS site does not possess enhancer blocking ability. Consistent with results reported by Pugacheva et al. [119] that neither the wild-type nor the C(-43)A mutant XIST promoter displayed any significant chromatin insulator function, our XIST promoter inserts were unable to block the interaction between the enhancer and the neomycin gene.  It is worth noting that for each of the DNA fragments tested, the colony numbers were comparable amongst the three replicates within each trial (i.e. small error bars, see Appendix A.7), and yet, the combined results of the trials showed much greater variation (Figure 4.1). Given that different DNA preparations were used for each trial, the failure of the positive control in the first trial and large error bars for the combined results could be caused by impurities in DNA preparation. Also, as the colony assay is dependent on neomycin gene expression at the protein level, there are caveats that need to be considered, such as the number of passages for cells (i.e. cell health) and differences in transgene copy numbers. The colony assay results underscore the importance of controlling for transfection efficiency. Zhong and Krangel [152] demonstrated that the colony assay 66  could be modified by cotransfecting the linearized test construct with linearized pTK-hyg to control for transfection efficiency; specifically, following hyg selection, test construct integration and copy number can be determined by slot blot analysis.  There are two ways in which insulators protect an expressing gene from its surroundings: 1) by blocking the action of a distal enhancer on a promoter, and 2) by acting as barriers that prevent the advance of nearby condensed chromatin that might otherwise silence expression. Some insulators are able to act both as enhancer blockers and barriers while others serve either as enhancer blockers or barriers. For example, Recillas-Targa et al. [145] showed, by deletion and mutation of different protein binding sites within the 1.2 kb sequence at the 5’ end (5’HS4) of the chicken 3-globin locus, that protection against position-effect and enhancer blocking by the chicken 13-globin insulator are separate activities, It is conceivable that the identified HS sites upstream of XlSTtranscription start can act as barriers that demarcate chromatin domains even though these sites did not show enhancer blocking ability. A potential future experiment is to clone fragment 101 into pJCX vector at the Xbal site (Figure 4.4) and evaluate its ability to confer protection against silencing effects of adjacent heterochromatin.  It is important to note that not all the transition from euchromatic to heterochromatic regions is marked by DNase I HS sites. For instance, the transitions in DNA accessibility both upstream and downstream of the mouse 3-globin genes in adult erythroid tissue do not coincide with the DNase I HS sites [153]. The boundary for the XIST domain might not be detectable by DNase I HS mapping.  67  Novel HS  Enhancer  pJCX  Neo  Figure 4.4— The organization of pJCX plasmid constructs to test for the ability of DNA sequence to confer protection against silencing effects of adjacent heterochromatin. The mouse globin HS2 is the enhancer coloured in green, neomycin gene is coloured orange with orange arrow showing the direction of transcription, and fragment of interest inserted at the Xbal site coloured in black.  4.3.2  Luciferase Assays Each DNA fragment that contains one of the HS sites upstream of XIST was tested for  promoter and enhancer activity in both the XIST orientation (i.e. same orientation as the XIST transcript) and the antisense orientation (i.e. reverse orientation as the XlSTtranscript). Fragment 3 that contains the HS site immediately upstream of XIST could not be tested in XIST orientation because of a very strong cloning orientation preference. Such an orientation preference could be the consequence of either ineffective ligation between the insert and the vector or instability of the ligated plasmid. It has been suggested that the stability of ligated plasmid is dependent on the orientation of the insert with respect to the direction of replication because the G/C-rich strands behave differently as leading and lagging strand templates [154]. Specifically, the lagging strand template is transiently single-stranded in the region between Okazaki fragments, increasing the propensity for G-rich secondary structure to form. It is conceivable that templates difficult to replicate would be lost from the plasmid population.  The identification of bidirectional promoter and enhancer activity within fragment 101 suggests the existence of a transcriptional unit in that 1 kb sequence. In an attempt to identify 68  transcription factors that bind at the HS site within the fragment, I used TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH.html) and found 130 high-scoring sites. It seems unlikely that the transcription factors in this region can be identified by computational search.  RT-PCR was able to detect the XlSTantisense transcript in L1.10.1 (described in Chapter 3) despite the lack of HS site corresponding to the origin of transcription. Given the sensitivity of RT PCR, we should be able to determine whether a transcript is generated from HS 101, a region that shows not only DNase I hypersensitivity but also bidirectional promoter and enhancer activity. We employed the primer pair 101 used to generate the 1 kb probe for HS mapping to search for such transcript and found none (data not shown). Since we might have overlooked potential transcripts with just one primer pair in our search, it would be worthwhile to continue the analysis. One possibility of not detecting a transcript with primer pair 101 is that the RNA produced is much smaller than 1kb.  Small RNAs of 20-30 nucleotides have been demonstrated to participate in a wide range of epigenetic regulation of gene expression [155]. Separated by less than 1 kb, bidirectional promoters have been found to be abundant in mammalian genomes [156]. A subset of these promoters, located on different strands, can produce overlapping transcripts that form double stranded (ds) RNA by sense-antisense hybridization [157]. An interesting future experiment will be to determine if transcripts are generated from HS 101 and whether these transcripts are transcribed from two overlapping promoters or one bidirectional promoter. The first step of such an experiment would be to clone subfragments of fragment 101 into pGL4.10 plasmid and measure luciferase activity. If the promoter on the reverse strand is located downstream with reference to  69  the other promoter, it would suggest that the transcripts overlap and the bidirectional promoters could function as an origin of dsRNAs. It is also possible that HS 101 does not behave as a bidirectional promoter in vivo despite its promoter and enhancer activity in the Iuciferase assay. The f3-globin locus control region (LCR), manifested as a cluster of DNase I HS sites, incorporates the functions of both enhancer and insulator to promote gene expression and buffer the position effect [1581. In erythroid cells, the  f3-  globin ICR is actively transcribed in the direction of the cis-linked promoter and this intergenic transcription correlates with the recruitment of RNA polymerase II [159-161]. Johnson et al. [159] proposed that the 3-gIobin LCR activates gene expression first by recruiting RNA polymerase II and then transferring the transcription factors to the promoter via DNA looping. Whether DNA sequences within the HS 101 site are functionally comparable to the -gIobin LCR can be examined by chromatin immunoprecipitation using antibody against RNA polymerase II and by chromosome conformation capture testing for chromatin loop formation.  70  5.  cm) C (1) U)  9.  0.  0)  1  3 3  C  Id,  U,  5.1  Summary of Research Findings The lack of sequence similarity in regions farther outside of XIST between mouse and  human poses a formidable obstacle in the indentification of regulatory elements for human X1ST, and DNase I hypersensitivity mapping provides an unbiased approach for this task. The transcription starts of the human antisense identified by RT-PCR and FISH in ES-b and L1.1O.1 did not show DNase I hypersensitivity (Figure 5.1). Taken together with the observations that human TSIX transcripts are co-expressed with XIST from the inactive X and do not extend across the XIST promoter [110, 112, 113], my results further argue against the functional significance of TSIX in XIST regulation and raise the possibility of a TSIX-independent mechanism for XlSTsilencing during early development in human (see “XIST Repression”, 5.2.2). Overall, there are far fewer DNase I HS sites downstream of human XIST (Figure 5.1) compared to the region downstream of mouse Xist (Figure 1.1). Nevertheless, it is still plausible that counting and choice in human X chromosome inactivation are mediated via homologous pairing of the X1Cs. The developmental-specific HS site downstream of human XIST could be the consequence of the XIC/Xic pairing. The presence of putative CTCF binding sites and degenerate A repeats corresponding to the mouse DXPas34 repeats, in close proximity to the downstream HS site supports such a possibility.  The 90 kb intergenic region between XIST and JPX/ENOX in human, which is approximately 9 times larger than that of mouse, could harbour cis-acting regulatory elements. Consistent with this idea, there is one HS site specific to differentiated cells between XIST and JPX/ENOX (Figure 5.1). The significance of bidirectional promoter and enhancer activity from the 1-kb fragment 65 kb upstream of XlSTtranscription start in the regulation of human XISTIs unclear. However, recent genome-wide histone modification studies in human have demonstrated monomethylation of histone H3 lysine 4 of the DNA sequences immediately flanking the HS 101 site [162], suggesting the 72  Telomere  CTCF consensus motifs 4 No CTCF bindrig in Li 10 1.  U  CTCF binding [119]  V  V  V  DNase HS sites TSlXtranscription starts (110]  Purine-pyrimidine repeat [116] 10kb  TSIX transcription start [112]  xIsT  /  vi  I’ll—I’  JPX/ENQX I  I  I HS mappiri of 20kb, 57kb upstream of XIST  HS mapping of 20 kb uostream of XIST  HS mappin,g of 47kb downstream of XIST  One HS site on both theXa and Xi in somatic cell hybrid 4 HS site shows bi-directional promoter and enhancer activities  4 One HS site an the human transgene in mouse ES cells 4 OneHSsiteontheXa in somatic cell hybrid  4 One HS site on the human transgene in mouse ES cells No HS site at the transcription starts of TS1X 4 No HS site in somatic cell hybrids  -  -  A summary of findings from thesis research on potential cis-acting regulatory elements for human XIST. Black boxes are exons, blue and black arrows indicate direction of transcription, dark blue triangle shows the HS site on the human transgene in mouse ES cells, unfilled blue triangle shows the constitutive HS site, light blue triangle indicates the HS site found on the Xa and the Xi in somatic cell hybrids, and red rectangle indicate potential CTCF binding motifs. Figure 5.1  w  —  presence of a transcriptional enhancer within this HS site. All in all, my findings provide evidence for a different regulatory mechanism for human XiSTthan for mouse Xist.  5.2  Discussion  When dosage compensation is achieved by imprinted X-inactivation, it is always the paternal X chromosome that is silenced while the maternal X stays transcriptionally active. Dosage compensation becomes a challenge in female epiblast cells where random X-inactivation takes place following implantation. These cells first need to measure the X chromosome:autosome ratio and then choose one of the two X chromosomes to keep active. How one X in diploid cells escapes inactivation and is chosen to be the future active X remains enigmatic.  5.2.1  Before the Onset of X Chromosome Inactivation It has been postulated that a trans-acting factor(s) from the autosomes participates in  random X-inactivation [163]. Such trans-acting molecules, or blocking factors (BF), are targeted to repress only one XlSTallele in diploid cells of both sexes, permitting the chromosome on which BF resides to remain active, as the second unprotected X in a female is inactivated by default by XIST coating [164]. Migeon et al. [165] illustrated that more than one X is active in human 69, XXY and 69, XXX triploid cells and argued that it is the extra set of autosomes that protect the X chromosome from inactivation. One way that the extra set of autosomes in triploids could enable the activity of more than one X is if they provide an extra dose of trans-acting factor, and if the trans factor is an XIST repressor [165]. In other words, two doses of this XIST repressor can silence only one XIST gene, but three doses can silence more than one XIST gene. Most likely, these are diffusing molecules, functional in small numbers and subject to cooperativity.  74  .  .  .  .  ••  . •  . •  .  . •  .  • .  • •  > •  .  •  •  •  • •  •  Xa  •  • •  •  •  •  .T  • • • • •. • • •. • •  ••  • •  Xa  Xa  •  —>  •  • •  • • • • • • Xa  • •  • ••  Xa  •  . •  • •• • • • • • • • •  •  •  •  •  V  Xa  •.• •  •  .  •  •  A  •  .. •  • •  •  .1 •  4  •  •  • • Xi  •  • Xa  Figure 5.2 Before the onset of X chromosome inactivation. Blocking factors (BF), shown as red dots, produced by autosomes are bound to the X chromosome at the XIC with low affinity. Homologous pairing between the two XIC brings bound BF together and thereby increases the binding efficiency of these BF at that region. As the two XICs move apart, asymmetric breaking results in one of the X chromosome retaining more BF, which then allows recruitment of even more BF. As for the X chromosome that ends up with less BF, the affinity to BF remains low and no further accumulation of BF occurs. The X with sufficient BF can repress XlSTexpression and stay active, whereas the remaining X without BF upregulates XIST and becomes inactive. —  75  Nicodemi & Prisco [166] carried out a computational analysis that simulates initiation of X inactivation based on the blocking factor model. In their model, the blocking factor complex breaks the symmetry between X chromosomes by binding preferentially to the Xic of the future Xa, thereby initiating Xist upregulation and X-inactivation (Figure 5.2). Nicodemi & Prisco [1671 further demonstrated that only when the X’s colocalize can the complex be assembled in a time short enough to be useful on the cell-cycle time scales; this finding is consistent with empirical data [7981, 95]. The significance of pairing is further demonstrated as the introduction of the mouse Xpr into male mouse ES cells induces Xist expression in undifferentiated ES cells [95]. Augui et al. [95] proposed that Xpr-mediated X-X trans-association initiates X chromosome inactivation by inducing bi-allelic Xist expression.  I hypothesize that the onset of X inactivation in human females is also marked by transient pairing of the X inactivation centre, and the developmental specific HS site downstream of XIST in ES-b identified in this thesis (Figure 5.1) is involved in that interaction. Subsequent to pairing, XIST on one of the two X chromosomes is silenced to keep the X chromosome active. Intriguingly, while the 480-kb human XIST-containing transgene (Figure 1.2) is recognized as an XIC when introduced into male mouse ES cells and can induce the expression of male mouse Xist that is normally repressed in EBs, only the multi-copy integration (six copies) of the transgene was able to induce cis-inactivation [168]. Given that the low-copy integration (one or two copies) of the same transgene introduced into the same ES cell line was unable to induce cis-inactivation, it is likely that additional XIC sequences are normally required (e.g. Xpr equivalent). A potential future experiment would be to generate a larger human XIST-containing transgene (i.e.  >  480 kb) to include additional  XIC sequences and introduce the transgene into male mouse ES cells to determine if the inclusion is  necessary for the low-copy integration to induce cis-inactivation. 76  5.2.2  XIST Repression  In female mice, Xist repression is achieved by Tsix transcription through the X!st promoter [63]. However, in human, the functional role of TSIX in XIST repression has been repeatedly challenged. How else could XlSTsilencing be achieved? An even more intriguing question: how does XIS T/Xist not silence itself? As mentioned in the introduction, XIS T/Xist is the only gene known to be expressed from the Xi but not the Xa. Since genes that escape X inactivation are bi-allelically expressed whereas XIST/Xist repression does occur on the Xa, the mechanism used by XIST/Xist to escape silencing is likely different from that employed by other escapees on the X chromosome.  In mouse, males with a Tsix knockout can silence Xist through recruitment of Eed [66], which is an essential component of the Polycomb repressive complex 2 (PRC2). PRC2 is responsible for the trimethylation of H3-K27 [169, 170]. Shibata et al. [66] proposed that Eed alone can effectively block ectopic Xist activation. Therefore, XIST repression by EED in human is an attractive model. Recently, Zhao et al. [96] demonstrated in mice that RepA, a 1.6 kb RNA with the transcription start site approximately 300 bp downstream of the Xist promoter (Figure 1.1), recruits PRC2 which then methylates Xist at H3-K27. Given that PRC2 is the only protection remaining against inappropriate Xist expression in Tsix deficient male mice, I hypothesize that RepA deletion in these mice would abolish the trimethylation of H3-K27 at the Xist locus and thereby allowing Xist to be expressed, mimicking the phenotype of Eed null combined with Tsix mutations in male ES cells described by Shibata et al. [66].  If the XIS T/Xist RNA transcriptionally silences itself on the Xa, how does the XIS T/Xist locus on the Xi remain active? Zhang et al. [97] formally demonstrated distinct localization of Xa and Xi within the nucleus following X-X pairing. Given that repositioning of some genes to the nuclear lamina induces transcriptional repression of those genes [171], and that the Xi is also attached to 77  the nuclear envelope [1721, it is possible that the transcriptional state of Xist is dependent on nuclear position as well as histone modifications. In species without functional TSIX, XIST repression could be accomplished through XIST dependent recruitment of PRC2, and hence, deposition of H3K27me3 on itself in a nuclear environment that is permissive to transcriptional silencing.  5.2.3  Maintaining XlSTTranscriDtional Status Given that JPX/ENOX is fully expressed from the Xi [112], perhaps it is not a surprise that the  HS site found upstream of XIST in hybrids showed no boundary activity. It is possible that the boundary is further upstream of XIST. Alternatively, the upstream HS sites might form a domain via looping DNA and the transcriptional state of XISTis independently maintained within the domain. Recently, Tsai et al. [91] showed that Xist and Jpx/Enox forms a domain via looping DNA. Chromosome conformation capture can be used to determine whether the upstream HS sites in human form such a domain and the observed bidirectional promoter and enhancer activity of HS 101 is a byproduct of open chromatin structure.  78  REFERENCES 1.  2. 3.  4.  5.  6. 7.  8.  9.  10.  11.  12. 13. 14.  15.  Wallis, M.C., Waters, P.O., and Graves, J.A., Sex determination in mammals--before and after the evolution of SRY. Cell Mol Life Sd, 2008. 65(20): 3182-3195. Nguyen, D.K., and Disteche, C.M., Dosage compensation of the active Xchromosome in mammals. Nat. Genet., 2006. 38(1): 47-53. Lin, H., Gupta, V., Vermilyea, M.D., Falciani, F., Lee, J.T., O’Neill, L.P., Turner, B.M., Dosage compensation in the mouse balances up-regulation and silencing of X-linked genes. PLoS Biol, 2007. 5(12): e326. Valley, C.M., Pertz, L.M., Balakumaran, B.S., Willard, H.F., Chromosome-wide, allele-specific analysis of the histone code on the human Xchromosome. Hum. Mol. Genet., 2006. 15(15): 2335-2347. Rougeulle, C., Chaumeil, J., Sarma, K., Allis, C.D., Reinberg, D., Avner, P., Heard, E., Differential histone H3 Lys-9 and Lys-27 methylation profiles on the X chromosome. Mol. Cell. Biol., 2004. 24(12): 5475-5484. Keohane, A.M., O’Neill, L.P., Balyaev, N.D., Lavender, J.S., Turner, B.M., X-inactivation and histone H4 acetylation in embryonic stem cells. Dev. Biol., 1996. 180: 618-630. Costanzi, C., and Pehrson, J.R., Histone macroH2Al is concentrated in the inactive X chromosome offemale mammals. Nature, 1998. 393: p. 599-601. Goto, Y., Gomez, M., Brockdorff, N., Fell, R., Differential patterns of histone methylation and acetylation distinguish active and repressed alleles at X-linked genes. Cytogenet Genome Res, 2002. 99(1-4): 66-74. Chaumeil, J., Okamoto, I., Guggiari, M., Heard, E., Integrated kinetics of X chromosome inactivation in differentiating embryonic stem cells. Cytogenet Genome Res, 2002. 99(1-4): 75-84. Fang, J., Chen, T., Chadwick, B., Li, E., Zhang, Y., Ringi b-mediated H2A ubiquitination associates with inactive X chromosomes and is involved in Initiation of X-inactivation. i Biol Chem, 2004. 279(51): 52812-52815. Brinkman, A.B., Roelofsen, T., Pennings, S.W., Martens, i.H., Jenuwein, T., Stunnenberg, H.G., Histone modification patterns associated with the human X chromosome. EMBO Rep, 2006. 7(6): 628-634. Salstrom, J.L., X-inactivation and the dynamic maintenance of gene silencing. Mol Genet Metab, 2007. 92(1-2): 56-62. Gartler, S.M., and Riggs, A.D., Mammalian X-chromosome inactivation. Ann. Rev. Genet., 1983. 17: 155-190. Brown, C.J., Lafreniere, R.G., Powers, V.E., Sebastio, G., Ballabio, A., Pettigrew, A.L., Ledbetter, D.H., Levy, E., Craig, l.W., Willard, H.F., Localization of the Xinactivation centre on the human X chromosome in Xq13. Nature, 1991. 349(6304): 82-84. Brown, C.J., Ballabio, A., Rupert, J.L., Lafreniere, R.G., Grompe, M., Tonlorenzi, R., Willard, H. F., A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature, 1991. 349(6304): 38-44.  79  16.  17.  18.  19.  20. 21. 22.  23.  24.  25.  26. 27.  28.  29.  30.  31.  Brockdorff, N., Ashworth, A., Kay, G.F., Cooper, P., Smith, S., McCabe, V.M., Norris, D.P., Penny, G.D., Patel, D., Rastan, S., Conservation of position and exclusive expression of mouse Xist from the inactiveXchromosome. Nature, 1991. 351(6324): 329-331. Brown, C.J., Hendrich, B.D., Rupert, J.L., Lafreniere, R.G., Xing, Y., Lawrence, i., Willard, H.F., The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell, 1992. 71(3): 527-542. Brockdorff, N., Ashworth, A., Kay, G.F., McCabe, V.M., Norris, D.P., Cooper, P.J., Swift, S., Rastan, S., The product of the mouse Xist gene is a 15kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell, 1992. 71(3): 515-526. Clemson, C.M., McNeil, J.A., Willard, H.F., Lawrence, J.B., XISTRNA paints the inactiveX chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J. Cell Biol., 1996. 132(3): 259-275. Hendrich, B.D., C.J. Brown, and H.F. Willard, Evolutionary conservation of possible functional domains of the human and murine XIST genes. Hum. Mol. Genet., 1993. 2(6): 663-672. Penny, G.D., Kay, G.F., Sheardown, S.A., Rastan, S., Brockdorff, N., RequirementforXistinX chromosome inactivation. Nature, 1996. 379(6561): 131-137. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R., Xist-deficient mice are defective in dosage compensation but not sperm atogenesis. Genes & Dev., 1997. 11(2): 156166. Duret, L., Chureau, C., Samain, S., Weissenbach, J., Avner, P., The Xist RNA gene evolved in eutherians by pseudogenization of a protein-coding gene. Science, 2006. 312(5780): 16531655. Elisaphenko, E.A., Kolesnikov N.N., Shevchenko, A.l., Rogozin, l.B., Nesterova, T.B., Brockdorff, N., Zakian, S.M., A dual origin of the Xist gene from a protein-coding gene and a set of transposable elements. PLoS ONE, 2008. 3(6): e2521. Azofeifa, J., Voit, T., Hubner, C., Cremer, M., X-chromosome methylation in manifesting and healthy carriers of dystrophinopathies: concordance of activation ratios among first degree female relatives and skewed inactivation as cause of the affected phenotypes. Hum. Genet., 1995. 96(2): 167-176. Yoshioka, M., T. Yorifuji, and I. Mituyoshi, SkewedXinactivation in manifesting carriers of Duchenne muscular dystrophy. Clin Genet, 1998. 53(2): 102-107. Puck, J.M., Nussbaum, R.L., and Conley, M.E., Carrier detection in X-linked severe combined immunodeficiency based on patterns of X chromosome inactivation. J. Clin. Invest., 1987. 79(5): 1395-1400. Conley, M.E., Lavoie, A., Briggs, C., Brown, P., Guerra, C., Puck, J.M., Nonrandom X chromosome inactivation in B cells from carriers of X chromosome-linked severe combined immunodeficiency. Proc. NatI. Acad. Sci., USA, 1988. 85(9): 3090-3094. Bolduc, V., Chagnon, P., Provost, S., Dube, M.P., Belisle, C., Gingras, M., Mollica, L., Busque, L., No evidence that skewing of X chromosome inactivation patterns is transmitted to offspring in humans. J Clin Invest, 2008. 118(1): 333-341. Nesterova, T.B., Johnston, C.M., Appanah, R., Newall, A.E., Godwin, J., Alexiou, M., Brockdorff, N., Skewing X chromosome choice by modulating sense transcription across the Xist locus. Genes Dev, 2003. 17(17): 2177-2190. Kay, G.F., Penny, G.D., Patel, D., Ashworth, A., Brockdorff, N., Rastan, S., Expression of Xist during mouse development suggests a role in the initiation of X chromosome inactivation. Cell, 1993. 72(2): 171-182. 80  32.  33. 34. 35.  36.  37.  38. 39.  40. 41. 42. 43. 44.  45.  46. 47. 48. 49.  50.  Zuccotti, M., Boiani, M., Ponce, R., Guizzardi, S., Scandroglio, R., Garagna, S., Redi, C.A., Mouse Xist expression begins at zygotic genome activation and is timed by a zygotic clock. Mol Reprod Dev, 2002. 61(1): 14-20. H uynh, K. D., and Lee, J .T., Inheritance of a pre-inactivated paternal X chromosome in early mouse embryos. Nature, 2003. 426(6968): 857-862. Okamoto, I., Otte, A.P., Allis, C.D., Reinberg, D., Heard, E., Epigenetic dynamics of imprinted X inactivation during early mouse development. Science, 2004. 303(5658): 644-649. Okamoto, I., Arnaud, D., Le Baccon, P., Otte, A.P., Disteche, C.M., Avner, P., Heard, E., Evidence for de novo imprinted X-chromosome inactivation independent of meiotic inactivation in mice. Nature, 2005. 438(7066): 369-373. Kay, G.F., Barton, S.C., Surani, M.A., Rastan, S., Imprinting andX chromosome counting mechanisms determine Xist expression in early mouse development. Cell, 1994. 77(5): 639650. Mak, W., Nesterova, T.B., de Napoles, M., Appanah, R., Yamanaka, S., Otte, A.P., Brockdorff, N., Reactivation of the paternaiX chromosome in early mouse embryos. Science, 2004. 303(5658): 666-669. Eggan, K., Akutsu, H., Hochedlinger, K., Rideout, w 3, Yanagimachi, R., Jaenisch, R., X Chromosome inactivation in cloned mouse embryos. Science, 2000. 290(5496): 1578-1581. Lee, J.T., Strauss, W.M., Dausman, J.A., Jaenisch, R., A 450kb transgene displays properties of the mammalian X-inactivation center. Cell, 1996. 86: 83-94. Panning, B., and Jaenisch, R., DNA hypomethylation can activate Xist expression and silence X-linked genes. Genes & Dev., 1996. 10: 1991-2002. Clerc, P., and Avner, P., Role of the region 3’ to Xist exon 6 in the counting process of X chromosome inactivation. Nat. Genet., 1998. 19: 249-253. Sun, B.K., Deaton, A.M., and Lee, J.T., A transient heterochromatic state in Xist preempts X inactivation choice without RNA stabilization. Mol. Cell, 2006. 21(5): 617-628. Wutz, A., and Jaenisch, R., A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol. Cell, 2000. 5: 695-705. Simmler, M.C., Cunningham, D.B., Clerc, P., Vermat, T., Caudron, B., Cruaud, C., Pawlak, A., Szpirer, C., Weissenbach, i., Claverie, J.M., Avner, P., A 94 kb genomic sequence 3’ to the murine Xist gene reveals an AT rich region containing a new testis specific gene Tsx. Hum. Mol. Genet., 1996. 5(11): 1713-1726. Morey, C., Navarro, P., Debrand, E., Avner, P., Rougeulle, C., Clerc, P., The region 3’ to Xist mediates X chromosome counting and H3 Lys-4 dimethylation within the Xist gene. Embo i, 2004. 23(3): 594-604. Lee, J.T., Lu, N., and Han, Y., Genetic analysis of the mouse X inactivation center defines an 80-kb multifunction domain. Proc. Nati. Acad. Sci., USA, 1999. 96(7): 3836-41. Lee, J.T., Davidow, L.S., and Warshawsky, D., Tsix, a gene antisense to Xist at the X inactivation center. Nat. Genet., 1999. 21: 400-404. Debrand, E., Chureau, C., Arnaud, 0., Avner, P., Heard, E., Functional analysis of the DXPas34 locus, a 3’ regulator of Xist expression. Mol. Cell. Biol., 1999. 19(12): 8513-8525. Chao, W., Huynh, K.D., Spencer, R.J., Davidow, L.S., Lee, J.T., CTCF, a candidate trans-acting factor for X-inactivation choice. Science, 2002. 295(5553): 345-347. Ogawa, Y., and Lee, J.T., Xite, X-inactivation intergenic transcription elements that regulate the probability of choice. Mol. Cell, 2003. 11(5553): 731-743.  81  51.  52. 53. 54. 55. 56.  57. 58.  59. 60.  61. 62. 63.  64. 65.  66. 67.  68. 69. 70.  Mise, N., Goto, V., Nakajima, N., Takagi, N., Molecular cloning of antisense transcripts of the mouse Xist gene. Biochem. Biophys. Res. Comm., 1999. 258: 537-541. Sado, T., Wang, Z., Sasaki, H., Li, E., Regulation of imprinted X-chromosome inactivation in mice by Tsix. Development, 2001. 128(8): 1275-1286. Shibata, S., and Lee, J.T., Characterization and quantitation of differential Tsix transcripts: implications for Tsix function. Hum. Mol. Genet., 2003. 12: 125-136. Lee, J.T., and Lu, N., Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell, 1999. 99: 47-57. Lee, J.T., Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Cell, 2000. 103: 17-27. Navarro, P., Pichard, S., Ciaudo, C., Avner, P., Rougeulle, C., Tsix transcription across the Xist gene alters chromatin conformation without affecting Xist transcription: implications for X chromosome inactivation. Genes Dev, 2005. 19(12): 1474-1484. Sado, T., Hoki, V., and Sasaki, H., Tsix silences Xist through modification of chromatin structure. Dev Cell, 2005. 9(1): 159-165. Navarro, P., Page, D.R., Avner, P., Rougeulle, C., Tsix-mediated epigenetic switch of a CTCF flanked region of the Xist promoter determines the Xist transcription program. Genes Dev, 2006. 20(20): 2787-2792. Ogawa, Y., Sun, B.K., and Lee, J.T., Intersection of the RNA interference and X-inactivation pathways. Science, 2008. 320(5881): 1336-1341. Nesterova, T.B., Popova, B.C., Cobb, B.S., Norton, S., Senner, C.E., Tang, Y.A., Spruce, T., Rodriguez, T.A., Sado, T., Merkenschlager, M., Brockdorff, N., Dicer regulates Xist promoter methylation in ES cells indirectly through transcriptional control of Dnmt3a. Epigenetics Chromatin, 2008. 1(1): 2. Luikenhuis, S., Wutz, A., and Jaenisch, R., Antisense transcription through the Xist locus mediates Tsix function in embryonic stem cells. Mol. Cell. Biol., 2001. 21: 8512-8520. Shibata, S., and Lee, i.T., Tsix transcription- versus RNA -based mechanisms in Xist repression and epigenetic choice. Curr Biol, 2004. 14(19): 1747-1754. Ohhata, T., Hoki, Y., SasaKi, H., Sado, T., Crucial role of antisense transcription across the Xist promoter in Tsix-mediatedXist chromatin modification. Development, 2008. 135(2): 227235. Sado, T., Li, E., and Sasaki, H., Effect of TSIX disruption on XIST expression in male ES cells. Cytogenet Genome Res, 2002. 99(1-4): 115-118. Ohhata, T., Hoki, V., Sasaki, H., Sado, T., Tsix-deficient X chromosome does not undergo inactivation in the embryonic lineage in males: implications for Tsix-independent silencing of Xist. Cytogenet Genome Res, 2006. 113(1-4): 345-349. Shibata, S., Yokota, T., and Wutz, A., Synergy of Eed and Tsix in the repression of Xist gene and X-chromosome inactivation. Embo i, 2008. 27(13): 1816-1826. Avner, P., Prissette, M., Arnaud, D., Courtier, B., Cecchi, C., Heard, E., Molecular correlates of the murine Xce locus. Genet. Res. Camb., 1998. 72: 217-224. Courtier, B., Heard, E., and Avner, P., Xce haplotypes show modified methylation in a region of the active X chromosome lying Y to Xist. Proc. NatI. Acad. Sd., 1995. 92(8): 3531-3535. Reik, W., and Walter, i., Imprinting mechanisms in mammals. Curr Opin Genet Dev, 1998. 8(2): 154-164. Prissette, M., El-Maarri, 0., Arnaud, D., Walter, J., Avner, P., Methylation profiles of DXPas34 during the onset of X-inactivation. Hum. Mol. Genet., 2001. 10(1): 31-38. 82  71. 72.  73.  74. 75. 76. 77.  78. 79. 80.  81. 82. 83.  84.  85. 86. 87.  Cohen, D.E., Davidow, L.S., Erwin, J.A., Xu, N., Warshawsky, D., Lee, i.T., The DXPas34 repeat regulates random and imprinted X inactivation. Dev. Cell, 2007. 12(1): 57-71. Vigneau, S., Augui, S., Navarro, P., Avner, P., Clerc, P., An essential role for the DXPas34 tandem repeat and Tsix transcription in the counting process of X chromosome inactivation. Proc. NatI. Acad. Sci., USA, 2006. 103(19): 7390-7395. Lobanenkov, V.V., Nicolas, R.H., Adler, V.V., Paterson, H., Klenova, E.M., Polotskaja, A.V., Goodwin, G.H., A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5 ‘-flanking sequence of the chicken c-myc gene. Oncogene, 1990. 5(12): 1743-1753. Filippova, G.N., Genetics and epigenetics of the multifunctional protein CTCF. Curr Top Dev Biol, 2008. 80: 337-360. Bell, A.C., and Felsenfeld, G., Methylation of a CTCF-dependent boundary controls imprinted expression of the lgf2 gene. Nature, 2000. 405(6785): 482-485. Morey, C., Arnaud, D., Avner, P., Clerc, P., Tsix-mediated repression of Xist accumulation is not sufficient for normal random X inactivation. Hum. Mol. Genet., 2001. 10(13): 1403-1411. Stavropoulos, N., Rowntree, R.K., and Lee, J.T., Identification of developmentally specific enhancers for Tsix in the regulation of X chromosome inactivation. Mol. Cell. Biol., 2005. 25(7): 2757-2769. Marahrens, Y., X-inactivation by chromosomal pairing events. Genes Dev, 1999. 13(20): 2624-2632. Xu, N., Tsai, C.L., and Lee, J.T., Transient homologous chromosome pairing marks the onset of X inactivation. Science, 2006. 311(5764): 1149-1152. Bacher, C.P., Guggiari, M., Brors, B., Augui, S., Clerc, P., Avner, P., Eils, R., Heard, E., Transient colocalization of X-inactivation centres accompanies the initiation of X inactivation. Nat Cell Biol, 2006. 8(3): 293-299. Xu, N., Donohoe, M.E., Silva, S.S., Lee, J.T., Evidence that homologous X-chromosome pairing requires transcription and Ctcf protein. Nat. Genet., 2007. 39(11): 1390-1396. Donohoe, M.E., Zhang, L.F., Xu, N., Shi, Y., Lee, J.T., Identification of a Ctcf cofactor, Yyl, for theX chromosome binaryswitch. Mol. Cell, 2007. 25(1): 43-56. Parelho, V., Hadjur, S., Spivakov, M., Leleu, M., Sauer, S., Gregson, H.C., Jarmuz, A., Canzonetta, C., Webster, Z., Nesterova, T., Cobb, B.S., Yokomori, K., Dillon, N., Aragon, L., Fisher, A.G., Merkensch lager, M., Cohesins functionally associate with CTCF on mammalian chromosome arms. Cell, 2008. 132(3): 422-433. Wendt, K.S., Yoshida, K., Itoh, T., Bando, M., Koch, B., Schirghuber, E., Tsutsumi, S., Nagae, G., Ishihara, K., Mishiro, T., Yahata, K., Imamoto, F., Aburatani, H., Nakao, M., Imamoto, N., Maeshima, K., Shirahige, K., Peters, J.M., Cohesin mediates transcriptional insulation by CCCTC-binding factor. Nature, 2008. 451(7180): 796-801. McCabe, V., Formstone, E.J., O’Neill, L.P., Turner, B.M., Brockdorff, N., Chromatin structure analysis of the mouse Xist locus. Proc. NatI. Acad. Sd., USA, 1999. 96(13): 7155-7160. Pillet, N., Bonny, C., and Schorderet, D.F., Characterization of the promoter region of the mouse Xist gene. Proc. NatI. Acad. Sci., 1995. 92(13): 12515-12519. Johnston, C.M., Nesterova, T.B., Formstone, E.J., Newall, A.E., Duthie, S.M., Sheardown, S.A., Brockdorff, N., Developmentally regulated Xist promoter switch mediates initiation of X inactivation. Cell, 1998. 94(6): 809-817.  83  88.  89.  90. 91. 92. 93.  94. 95.  96.  97. 98.  99. 100. 101.  102.  103. 104.  105.  Warshawsky, D., Stavropoulos, N., and Lee, J.T., Further examination of the Xist promoterswitch hypothesis in X inactivation: evidence against the existence and function of a P(O) promoter. Proc. NatI. Acad. Sci., USA, 1999. 96(25): 14424-14429. Chureau, C., Prissette, M., Bourdet, A., Barbe, V., Cattolico, L., Jones, L., Eggen A., Avner, P., Duret, L., Comparative sequence analysis of the X-inactivation center region in mouse, human and bovine. Genome Res., 2002. 12(6): 894-908. Johnston, C.M., Newall, A.E., Brockdorff, N., Nesterova, T.B., Enox, a novel gene that maps 10 kb upstream of Xist and partially escapes X inactivation. Genomics, 2002. 80: 236-244. Tsai, C.L., Rowntree, R.K., Cohen, D.E., Lee, J.T., Higher order chromatin structure at the X inactivation center via looping DNA. Dev Biol, 2008. 319(2): 416-425. Sheardown, S.A., Newall, A.E., Norris, D.P., Rastan, S., Brockdorff, N., Regulatory elements in the minimal promoter region of the mouse Xist gene. Gene, 1997. 203: 159-168. Newall, A.E., Duthie, S., Formstone, E., Nesterova, T., Alexiou, M., Johnson, C., Caparros, M.L., Brockdorff, N., Primary non-random X inactivation associated with disruption of Xist promoter regulation. Hum. Mol. Genet., 2001. 10(6): 581-589. Romer, J.T., and Ashworth, A., The upstream region of the mouse xist gene contains two ribosomal protein pseudogenes. Mamm Genome, 2000. 11(6): 461-463. Augul, S., Filion, G.J., Haurt, S., Nora, E., Guggiari, M., Maresca, M., Stewart, A.F., Heard, E., Sensing X chromosome pairs before X inactivation via a novel X-pairing region of the Xic. Science, 2007. 318(5856): 1632-1636. Zhao, J., Sun, B.K., Erwin, J.A., Song, J.J., Lee, J.T., Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science, 2008. 322(5902): 750-756. Zhang, L.F., Huynh, K.D., and Lee, J.T., Perinucleolar targeting of the inactive X during S phase: evidence for a role in the maintenance of silencing. Cell, 2007. 129(4): 693-706. Sheardown, S.A., Duthie, S.M., Johnston, C.M., Newall, A.E., Formstone, E.J., Arkell, R.M., Nesterova, T.B., Alghisi, G.C., Rastan, S., Brockdorff, N., Stabilisation of Xist RNA mediates initiation of X chromosome inactivation. Cell, 1997. 91: 99-107. Panning, B., Dausman, J., and Jaenisch, R., X chromosome inactivation is mediated by RNA stabilization. Cell, 1997. 90: 907-916. Daniels, R., Zuccotti, M., Kinis, T., Serhal, P., Monk, M., XIST expression in human oocytes and preimplantation embryos. Am. J. Hum. Genet., 1997. 61: 33-39. Ray, P.F., Winston, R.M., and Handyside, A.H., XlSTexpression from the maternalX chromosome in human male preimplantation embryos at the blastocyst stage. Hum. Mol. Genet., 1997. 6(8): 1323-1327. Looijenga, L.H., Gillis, A.J., Verkerk, A.J., van Putten, W.L., Oosterhuis, J.W., HeterogeneousX inactivation in trophoblastic cells of human full-term female placentas. Am J Hum Genet, 1999. 64(5): 1445-1452. Zeng, S.M. and Yankowitz, J., X-inactivation patterns in human embryonic and extraembryonic tissues. Placenta, 2003. 24: 270-275. Heard, E., Mongelard, F., Arnaud, D., Chureau, C., Vourc’h, C., Avner, P., Human XIST yeast artificial chromosome transgenes show partial X inactivation center function in mouse embryonic stem cells. Proc. NatI. Acad. Sci., USA, 1999. 96(12): 6841-6846. Migeon, B.R., Kazi, E., Haisley-Royster, C., Hu, J., Reeves, R., Call, L., Lawler, A., Moore, C.S., Morrison, H., Jeppesen, P., Human X inactivation center induces random X chromosome inactivation in male transgenic mice. Genomics, 1999. 59: 113-121.  84  106.  107.  108.  109.  110.  111. 112. 113.  114. 115. 116.  117.  118.  119.  120.  121.  122.  Hoffman, L.M., Hall, L., Batten, J.L., Young, H., Pardasani, D., Baetge, E.E., Lawrence, J., Carpenter, M.K., X-inactivation status varies in human embryonic stem cell lines. Stem Cells, 2005. 23(10): 1468-1478. Shen, Y., Matsuno, Y., Fouse, S.D., Rao, N., Root, S., Xu, R., Pellegrini, M., Riggs, A.D., Fan, G., X-inactivation in female human embryonic stem cells is in a nonrandom pattern and prone to epigenetic alterations. Proc. NatI. Acad. Sci., USA, 2008. 105(12): 4709-4714. Silva, S.S., Rowntree, R.K., Mekhoubad, S., Lee, J.T., X-chromosome inactivation and epigenetic fluidity in human embryonic stem cells. Proc. NatI. Acad. Sci., USA, 2008. 105(12): 4820-4825. Hall, L.L., Byron, M., Butler, J., Becker, K.A., Nelson, A., Amit, M., ltskovitz-Eldor, J., Stein, J., Stein, G., Ware, C., Lawrence, J.B., X-inactivation reveals epigenetic anomalies in most hESC but identifies sublines that initiate as expected. J Cell Physiol, 2008. 216(2): 445-452. Migeon, B.R., Chowdhury, A.K., Dunston, J.A., McIntosh, I., Identification of TSIX, encoding an RNA antisense to human XIST, reveals differences from its murine counterpart: implications forX inactivation. Am. i. Hum. Genet., 2001. 69(5): 951-960. Lee, J.T., Homozygous Tsix mutant mice reveal a sex-ratio distortion and revert to random X inactivation. Nat. Genet., 2002. 32: 195-200. Chow, i.C., and Brown, C.J., Forming facultative heterochromatin: silencing of an X chromosome in mammalian females. Cell Mol Life Sci, 2003. 60(12): 2586-2603. Migeon, B.R., Lee, C.H., Chowdhury, A.K., Carpenter, H., Species differences in TSIX/Tsix reveal the roles of these genes in X-chromosome inactivation. Am J Hum Genet, 2002. 71: 286-293. Migeon, B.R., Is Tsix repression of Xist specific to mouse? Nat. Genet., 2003. 33: 337. Wutz, A., and Gribnau, J., X inactivation Xplained. Curr Opin Genet Dev, 2007. 17(5): 387393. Hendrich, B.D., Plenge, R.M., and Willard, H.F., Identification and characterization of the human XIST gene promoter: implications for models of X chromosome inactivation. Nucleic Acids Res., 1997. 25: 2661-2671. Plenge, R.M., Hendrich, B.D., Schwartz, C., Arena, J.F., Naumova, A., Sapienza, C., Winter, R.M., Willard, H.F., A promoter mutation in the XIST gene in two unrelated families with skewed X-chromosome inactivation. Nat. Genet., 1997. 17: 353-356. Tomkins, D.J., McDonald, H.L., Farrell, S.A., Brown, C.J., Lack of expression ofXlSTfrom a small ring X chromosome containing the XIST locus in a girl with short stature, facial dysmorphism and developmental delay. Eur J Hum Genet, 2002. 10(1): 44-51. Pugacheva, E.M., Tiwari, V.K., Abdullaev, Z., Vostrov, A.A., Flanagan, P.T., Quitschke, W.W., Loukinov, D.l., Ohlsson, R., Lobanenkow, V.V., Familial cases of point mutations in the XIST promoter reveal a correlation between CTCF binding and pre-emptive choices of X chromosome inactivation. Hum. Mol. Genet., 2005. 14(7): 953-965. Wutz, A., Rasmussen, T.P., and Jaenisch, R., Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat. Genet., 2002. 30(2): 167-174. Tinker, A.V. and Brown, C.i., Induction of XIST expression from the human activeX chromosome in mouse/human somatic cell hybrids by DNA demethylation. Nucleic Acids Res., 1998. 26: 2935-2940. De La Fuente, R., Hahnel, A., Basrur, P.K., King, W.A., X inactive-specific transcript (Xist) expression and X chromosome inactivation in the preattachment bovine embryo. Biol Reprod, 1999. 60(3): 769-775. 85  123.  124.  125.  126. 127.  128.  129. 130.  131.  132.  133.  134. 135.  136.  137. 138.  Xue, F., Tian, X.C., Du, F., Kubota, C., Taneja, M., Dinnyes, A., Dal, Y., Levine, H., Pereira, L.V., Yang, X., Aberrant patterns of X chromosome inactivation in bovine clones. Nat. Genet., 2002. 31(2): 216-220. Dindot, S.V., Kent, K.C., Evers, B., Loskutoff, N., Womack, J., Piedrahita, J.A., Conservation of genomic imprinting at the XIST, IGF2, and GTL2 loci in the bovine. Mamm Genome, 2004. 15(12): 966-974. Farazmand, A., Basrur, P.K., Stranzinger, G., Graphodatskaya, D., Reyes, E.R., King, W.A., Expression of XIST sense and antisense in bovine fetal organs and cell cultures. Chromosome Res, 2004. 12(3): 275-283. Munoz, M., Diez, C., Caamano, J.N., Jouneau, A., Hue, I., Gomez, E., Embryonic stem cells in cattle. Reprod Domest Anim, 2008. 43 Suppl 4: 32-37. Keefer, C.L., Pant, D., Blomberg, 1., Talbot, N.C., Challenges and prospects for the establishment of embryonic stem cell lines of domesticated ungulates. Anim Reprod Sci, 2007. 98(1-2): 147-168. Brown, C.J., and Willard, H.F., Noninactivation of a selectable human X-linked gene that complements a murine temperature-sensitive cell cycle defect. Am. J. Hum. Genet., 1989. 45: 592-598. Sambrook, i., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A laboratory manual. 1989, Cold Spring Harbor Laboratory: Cold Spring Harbor. Filippova, G.N., Cheng, M.K., Moore, J.M., Truong, J.P., Hu, Y.J., Nguyen, D.K., Tsuchiya, K.D., Disteche, C.M., Boundaries between chromosomal domains of X inactivation and escape bind CTCF and lack CpG methylation during early development. Dev. Cell, 2005. 8: 3 1-42. Kim, T.H., Abdullaev, Z.K., Smith, A.D., Ching, K.A., Loukinov, D.l., Green, R.D., Zhang, M.Q., Lobanekov, V.V., Ren, B., Analysis of the vertebrate insulator protein CTCF-binding sites in the human genome. Cell, 2007. 128(6): 1231-1245. Xie, X., Mikkelsen, T.S., Gnirke, A., Lindblad-Toh, K., Kellis, M., Lander, E.S., Systematic discovery of regulatory motifs in conserved regions of the human genome, including thousands of CTCF insulator sites. Proc. Nati. Acad. Sci., USA, 2007. 104(17): 7145-7150. Pauler, F.M., Stricker, S.H., Warczok, K.E., Barlow, D.P., Long-range DNase I hypersensitivity mapping reveals the imprinted lgf2r and Air promoters share cis-regulatory elements. Genome Res., 2005. 15(10): 1379-1387. hang, S., Moghimi, B., Yang, T.P., Strouboulis, J., Bungert, J., Locus control region mediated regulation of adult beta-globin gene expression. J Cell Biochem, 2008. 105(1): p.9-16. Ovcharenko, I., Nobrega, M.A., Loots, G.G., Stubbs, L., ECR Browser: a toolfor visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res, 2004. 32(Web Server issue): W280-W286. Hark, A.T., Schoenherr, C.J., Katz, D.J., Ingram, R.S., Levorse, J.M., Tilghman, S.M., CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/lgf2 locus. Nature, 2000. 405(6785): 486-489. Loots, G.G., and Ovcharenko, I., Dcode.org anthology of comparative genomic tools. Nucleic Acids Res, 2005. 33(Web Server issue): W56-W64. Wierzbicki, A.T., Haag, J.R., and Pikaard, C.S., Noncoding transcription by RNA polymerase PollVb/Pol V mediates transcriptional silencing of overlapping and adjacent genes. Cell, 2008. 135(4): 635-648.  86  139.  140.  141.  142. 143.  144. 145.  146.  147. 148. 149.  150.  151. 152.  153.  154.  155. 156.  Hansen, R.S., Canfield, T.K., Stanek, A.M., Keitges, E.A., Gartler, S.M., Reactivation ofXlSTin normal fibroblasts and a somatic cell hybrid: abnormal localization of XIST RNA in hybrid cells. Proc. NatI. Acad. Sd. USA, 1998. 95: 5133-5138. Clemson, C.M., Chow, i.C., Brown, C.i., Lawrence, J.B., Stabilization and localization of Xist RNA are controlled by separate mechanisms and are not sufficient for X inactivation. J. Cell Biol., 1998. 142: 13-23. Boyle, A.P., Davis, S., Shuiha, H.P., Meltzer, P., Margulies, E.H., Weng, Z., Furey, T.S., Crawford, G.E., High-resolution mapping and characterization of open chromatin across the genome. Cell, 2008. 132(2): 311-322. Brown, C.J., and Willard, H.F., The human X inactivation center is not required for maintenance of X inactivation. Nature, 1994. 368: 154-156. Rack, K.A., Chelly, J., Gibbons, R.J., Rider, S., Benjamin, D., Lafrenlere, R.G., Oscier, D., Hendriks, R.W., Craig, l.W., Willard, H.F., Monaco, A.P., Buckle, V.J., Absence of the XIST gene from late-replicating isodicentric X chromosomes in leukemia. Hum. Mol. Genet., 1994. 3(7): 1053-1059. Noma, K., Allis, C.D., and Grewal, 5.1., Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science, 2001. 293(5532): 1150-1155. Recillas-Targa, F., Pikaart, M.J., Burgess-Beusse, B., Bell, A.C., Litt, M.D., West, A.G., Gaszner, M., Felsenfeld, G., Position-effect protection and enhancer blocking by the chicken beta globin insulator are separable activities. Proc. NatI. Acad. Sci., USA, 2002. 99(10): 6883-6888. Farrell, C.M., West, A.G., and Felsenfeld, G., Conserved CTCF insulator elements flank the mouse and human beta-globin loci. Mol. Cell. Biol., 2002. 22(11): 3820-3831. Kuhn, E.J., and Geyer, P.K., Genomic insulators: connecting properties to mechanism. Curr Opin Cell Biol, 2003. 15(3): 259-265. Blackledge, N.P., Carter, E.J., Evans, J.R., Lawson, V., Rowntree, R.K., Harris, A., CTCF mediates insulator function at the CFTR locus. Biochem i, 2007. 408(2): 267-275. Chung, J.H., Whiteley, M., and Felsenfeld, G., A 5’ element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell, 1993. 74(3): 505-514. Bell, A.C., West, A.G., and Felsenfeld, G., The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell, 1999. 98(3): 387-396. Elgin, S.C., The formation and function of DNase I hypersensitive sites in the process of gene activation. J Biol Chem, 1988. 263(36): 19259-19262. Zhong, X.P., and Krangel, M.S., An enhancer-blocking element between alpha and delta gene segments within the human T cell receptor alpha/delta locus. Proc. NatI. Acad. Sci., USA, 1997. 94(10): 5219-5224. Bulger, M., Schubeler, D., Bender, M.A., Hamilton, J., Farrell, C.M., Hardison, R.C., Groudine, M., A complex chromatin landscape revealed by patterns of nuclease sensitivity and histone modification within the mouse beta-globin locus. Mol. Cell. Biol., 2003. 23(15): 5234-5244. Hirst, M.C., and White, P.J., Cloned human FMR1 trinucleotide repeats exhibit a length- and orientation-dependent instability suggestive of in vivo lagging strand secondary structure. Nucleic Acids Res, 1998. 26(10): 2353-2358. Chu, C.Y., and Rana, T.M., Small RNAs: regulators and guardians of the genome. J Cell Physiol, 2007. 213(2): 412-419. Trinklein, N.D., Aldred, S.F., Hartman, S.J., Schroeder, D.l., Otillar, R.P., Myers, R.M., An abundance of bidirectional promoters in the human genome. Genome Res., 2004. 14: 62-66. 87  157.  158. 159.  160.  161. 162.  163. 164. 165.  166. 167. 168.  169. 170.  171. 172.  Yang, N., and Kazazian, HH Jr., Li retrotransposition is suppressed by endogenously encoded small interfering RNA5 in human cultured cells. Nat. Struct. Mol. Biol., 2006. 13(9): 763-771. Tang, Y., Liu, D.P., and Liang, C.C., Further understanding of the beta-globin locus regulation at the molecular level: looping or linking models? Genes Cells, 2002. 7(9): 889-900. Johnson, K.D., Christensen, H.M., Zhao, B., Bresnick, E.H., Distinct mechanisms control RNA polymerase II recruitment to a tissue-specific locus control region and a downstream promoter. Mol. Cell, 2001. 8(2): 465-471. Johnson, K.D., Grass, J.A., Park, C., Im, H., Chol, K., Bresnick, E.H., Highly restricted localization of RNA polymerase II within a locus control region of a tissue-specific chromatin domain. Mol. Cell. Biol., 2003. 23(18): 6484-6493. Mahajan, M.C., Karmakar, S., and Weissman, S.M., Control of beta globin genes. i Cell Biochem, 2007. 102(4): 801-810. Heintzman, N.D., Hon, G.C., Hawkins, R.D., Kheradpour, P., Stark, A., Harp, L.F., Ye, Z., Lee, L.K., Stuart, R.K., Ching, C.W., Ching, K.A., Antosiewicz-Bourget, J.E., Liu, H., Zhang, X., Green, R.D., Lobanenkov, V.V., Stewart, R., Thomson, J.A., Crawford, G.E., Kellis, M., Ren, B., Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature, 2009. 459(7243): 108-112. Lyon, M.F., Possible mechanisms of X chromosome inactivation. Nature N. Biol., 1971. 232: 229-232. Migeon, B.R., X chromosome inactivation: theme and variations. Cytogenet Genome Res, 2002. 99(1-4): 8-16. Migeon, B.R., Pappas, K., Stetten, G., Trunca, C., Jacobs, P.A., X inactivation in triploidy and trisomy: the search for autosomal transfactors that choose the active X. Eur J Hum Genet, 2008. 16(2): 153-162. Nicodemi, M., and Prisco, A., Symmetry-breaking modelforX-chromosome inactivation. Phys Rev Lett, 2007. 98(10): 108104. Nicodemi, M., and Prisco, A., Self-assembly and DNA binding of the blocking factor in x chromosome inactivation. PLoS Comput Biol, 2007. 3(11): e210. Migeon, B.R., Winter, H., Kazi, E., Chowdhury, A.K., Hughes, A., Haisley-Royster, C., Morrison, H., Jeppesen, P., Low-copy-number human transgene is recognized as an X inactivation center in mouse ES cells, but fails to induce cis-inactivation in chimeric mice. Genomics, 2001. 71(2): 156-162. Cao, R., and Zhang, V., SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Mol. Cell, 2004. 15(1): 57-67. Montgomery, N.D., Yee, D., Chen, A., Kalantry, S., Chamberlain, S.J., Otte, A.P., Magnuson, T., The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol, 2005. 15(10): 942-947. Reddy, K.L., Zullo, i.M., Bertolino, E., Singh, H., Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature, 2008. 452(7184): 243-247. Eils, R., Dietzel, S., Bertin, E., Schrock, E., Speicher, M.R., Ried, T., Robert-Nicoud, M., Cremer, C., Cremer, T., Three-dimensional reconstruction of painted human interphase chromosomes: active and inactive X chromosome territories have similar volumes but differ in shape and surface structure. J. Cell Biol., 1996. 135: 1427-1440.  88  APPENDICES  89  EcoRl Sad BamHl Xbal  I  Sad  Enhaj  piC  Novel HS  or  Neo  Multiple Cloning Sites  II Sad EcoRVXhol NheI Sacll EcoRl Spel EcoRl Notl PstI Sail Nedl BsaBI BspEI AscI Sad  I MCS2  -  nsuiatori  Novel HS  Figure A.1  Origin of pJC and making of MCS2. piC was kindly provided by Gala Filipova. The mouse globin HS2 is the enhancer coloured green, neo-resistance gene coloured orange, chicken 13globin HS4 insulator coloured in blue, and fragment of interest inserted coloured in black. I —  generated the multiple cloning sites fragment from pGEM®-T Easy vector via PCR amplification and cloned into piC at Sad site in the orientation shown. 90  Fragment 0 & Fragment 1 Kpnl  Sad  Notl/Sacll EcoRl Spel EcoRl Notl Pstl Sail Ndel Sad .  I Notl/Sacll EcoRl Kpnl  Sad Spel EcoRl Notl Pstl Sail Ndel Sad  Notl flipped  Notl EcoRl Spel Sad  Kpnl EcoRl NotI Pstl Sail Ndel Sad  Sad digested Cloned into Sad 1. 2. 3.  pJC XIST orientation (colony assay) pG L4. 10 both orientation (promoter assay) pGL4.23 both orientation (enhancer assay) —  4.  Figure A.2  Sad I & Notl digested  MCS2  —  Cloned into SaclI & Notl  XIST reverse orientation (colony assay)  Stepwise construction of plasmids for colony assay and luciferase assays. PCR fragments were first cloned into pGEM®-T Easy vector (Promega) via TA cloning so that DNA fragments to be inserted into pJc, Msc2, and pGL4 series (Promega) could all be isolated from —  pGEM®-T Easy clones. Notl/Sacll indicates that Notl and Sacll restriction enzyme recognition sequences overlap each other. 91  GEMT Eas  Fragment 2 Kpnl  Sad  cIonin Notl/Sacll EcoRl Spel EcoRl Notl Pstl Sail Ndel Sad .  Noti/Sacli EcoRl Sad  Kpnl Spel EcoRl NotI Pstl Sail Ndel Sad  Sad digested Cloned into Sad 1. 2. 3.  piC X1ST orientation (colony assay) pGL4.1O both orientation (promoter assay) pGL4.23 both orientation (enhancer assay) —  NotI & Spel digested  Cloned into Notl & Nhel 4.  Figure A.3  —  MCS2  —  XIST reverse orientation (colony assay)  Stepwise construction of plasmids for colony assay and luciferase assays. PCR fragment  was first cloned into pGEM®-T Easy vector (Promega) via TA cloning so that the DNA fragment to be inserted into pJC, MSC2, and pGL4 series (Promega) could all be isolated from pGEM®-T Easy clones. Notl/Sacll indicates that Notl and Sacll restriction enzyme recognition sequences overlap each other. 92  Fragment 3 Sad  KpnI  Noti/Sacli EcoRl Spel EcoRl Notl Pstl Sail Ndel Sad .  NotI/SaclI EcoRl KpnI  Sad Spel EcoRl Notl Pstl Sail Ndel Sad SaclI & Notl digested Cloned into Sacll & NotI  1.  MCS2  —  XIST reverse orientation (colony assay) Sad digested Cloned into Sad  2. 3.  pGL4.lOXlSTreverse orientation (promoter assay) pGL4.23 XIST reverse orientation (enhancer assay)  Figure A.4  Stepwise construction of plasmids for colony assay and luciferase assays. PCR fragment was first cloned into pGEM®-T Easy vector (Promega) via TA cloning so that the DNA fragment to be inserted into MSC2 and pGL4 series (Promega) could all be isolated from pGEM®-T Easy clones. NotI/Sacll indicates that Notl and Sacll restriction enzyme recognition sequences overlap each other. —  93  cpGEM  Fragment 3’ Sacll Sad  I  Kpnl Notl  2)  T Easy  NotI/Sacil EcoRl Spel EcoRl Notl Pstl Sail Ndel Sad .  TA cloning  I  Noti/Sacil EcoRl NotI Kpnl  Sad Sacli Spel EcoRl Noti Pstl Sail  SacIl & NotI digested Cloned into Sacll & Notl 1.  MCS2  Figure A.5  —  —  XIST orientation (colony assay)  Stepwise construction of plasmid for colony assay. PCR fragment was first cloned into  pGEM®-T Easy vector (Promega) via TA cloning so that the DNA fragment to be inserted into MSC2 could be isolated from pGEM®-T Easy clones. Notl/Sacll indicates that Notl and Sacll restriction enzyme recognition sequences overlap each other. 94  Fragment 101 Sad  KpnI  Noti/Sacil EcoRl Spel EcoRl Not! PstI Sail Ndel Sac! .  Notl/SacII EcoRl Kpnl  Sac! Spel EcoRl Notl Pstl Sail Ndel Sad  Not! flipped  NotI EcoRl Spel Sad  I  Kpnl EcoRl Not! Pstl Sail NdeI Sac!  Sac! digested  Not! & Spel digested  into Sac! 1. 2. 3.  piC X1ST reverse orientation (colony assay) pGL4.10 both orientation (promoter assay) pGL4.23 both orientation (enhancer assay) —  4.  Figure A.6  —  MCS2  —  Cloned into Not! & Nhel  X1ST orientation (colony assay)  Stepwise construction of plasmids for colony assay and !uciferase assays. PCR fragment  was first cloned into pGEM®-T Easy vector (Promega) via TA cloning so that the DNA fragment to be inserted into pJC, MSC2, and pGL4 series (Promega) could all be isolated from pGEM®-T Easy clones. Notl/Sacll indicates that Notl and Sacll restriction enzyme recognition sequences overlap each other. 95  Trial 1 4500  pJC+1O1  MCS2+1O1  1O1R  MCS2+3  1O1F  3R  MCS2+3’  3F  MSC2+2  2R  pJC÷2  MSC2±1  2F  1R  piC+1  MSC2+O  iF  OR  pJC+O  piC  HS4  OF  Trial 2 1800 1600 1400 1200 1000  LpJC+1O1 1O1R  piC+2  2F  pJC+1  iF  piC+O  Ii piC  1S4  OF  Trial 3 4000 3500  3000  2500 -______________  2000 -  -  1500 1000 500 pJC+1O1  piC+2  1O1R  2F  Figure A.7  pJC+1  iF  piC+O  OF  plC  HS4  0  -  MCS2+1O1 MCS2+3  1O1F  3R  —-  MCSZ+3’  3F  __._____  -  MSCZ+2  MSC2+1  MSC2+O  2R  1R  OR  ___j MSC2  Colony assay results. Histograms show the absolute colony number for the various plasmids. Each trial was carried out independently in triplicates. Since piC failed to confer G418 resistance and MCS2 control was not included in trial 1, the results from that experiment were not —  used in the analysis. Note that “iF” in trial 1 did not cause a reduction in colony number compared to other plasmids, suggesting that the fragment inserted does not have enhancer-blocking ability. 96  Promoter Trial 1 12 10 8 6 4 2 0 -2  1O1R  1O1F  3R  2R  2F  1R  iF  OR  OF  4.10  3R  2R  2F  1R  iF  OR  OF  4.10  3R  2R  2F  1R  iF  OR  OF  4.10  Promoter Trial 2 80 70 60 50 40 30 20 10 0  1O1R  1O1F  Promoter Trial 3 120 100 80 60 40 20 0  1O1R  1O1F  Figure A.8 Promoter assay results. Fragment 0 contains the XIST minimal promoter (see “XIST Upstream Sequence”, 1.5.2). Histograms show the absolute ratio of firefly luciferase divided by renilla luciferase for the various plasmids. Each trial was carried out independently in triplicates. —  97  Enhancer Trial 1 80 70 60 50 40 30 20 10 0  1O1R  1O1F  3R  2R  2F  1R  iF  OR  OF  4.23  3R  2R  2F  1R  iF  OR  OF  4.23  3R  2R  2F  1R  iF  OR  OF  4.23  Enhancer Trial 2 35 30 25 20 15 10 5 0  1O1R  1O1F  Enhancer Trial 3 60 50 40 30 20 10 0  1O1R  1O1F  Figure A.9 Enhancer assay results. Fragment 0 contains the XIST minimal promoter (see “XIST Upstream Sequence”, 1.5.2). Histograms show the absolute ratio of firefly luciferase divided by renilla luciferase for the various plasmids. Each trial was carried out independently in triplicates. —  98  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0068452/manifest

Comment

Related Items