Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of innate immune responses to enteric bacterial pathogens in intestinal epithelial cells Khan, Mohammed Aatif 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_khan_mohammed.pdf [ 3.55MB ]
Metadata
JSON: 24-1.0068218.json
JSON-LD: 24-1.0068218-ld.json
RDF/XML (Pretty): 24-1.0068218-rdf.xml
RDF/JSON: 24-1.0068218-rdf.json
Turtle: 24-1.0068218-turtle.txt
N-Triples: 24-1.0068218-rdf-ntriples.txt
Original Record: 24-1.0068218-source.json
Full Text
24-1.0068218-fulltext.txt
Citation
24-1.0068218.ris

Full Text

CHARACTERIZATION OF INNATE IMMUNE RESPONSES TO ENTERIC BACTERIAL PATHOGENS IN INTESTINAL EPITHELIAL CELLS by MOHAMMED AATIF KHAN M.Sc., The University of British Columbia, 2003  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2009  © Mohammed Aatif Khan, 2009  Abstract Enteropathogenic Escherichia coli (EPEC) belongs to the attaching and effacing (A/E) family of bacterial pathogens, which infect intestinal enterocytes with type three secretion system (T3SS), leading to diarrheal disease. While A/E bacteria also express flagellin (F1iC) which induces secretion of pro-inflammatory interleukin (IL)-8 from intestinal epithelial cells (IECs), it is unclear if flagellin is the sole trigger of epithelial responses. IECs express innate toll-like receptors (TLRs) to recognize flagellin and trigger inflammatory responses. Activation of TLRs is strictly controlled in IECs producing a state of hyporesponsiveness which prevents unwanted inflammation. The Single IgG IL-i related receptor (Sigirr) is described as a negative regulator of IL-1f3 and TLR4 responses. While IECs express Sigirr, it is unknown if Sigirr inhibits innate responses to bacterial flagellin. The aims of this study were to characterize the role of flagellin in innate responses to EPEC infection and determine how Sigirr regulates these responses. Following infection of Caco-2 IECs by wild type and 4fliC EPEC, activation of several proinflammatory genes including IL-8, MCP-i and MIP3CL occurred in a F1iC-dependent manner. At later time points, a subset of these pro-inflammatory genes (IL-8, MlP3ct) was also induced in cells infected with AfliC EPEC. The mouse adapted A/E pathogen Citrobacter Rodentium, triggered a similar innate response through a TLR5-independent but partially NF-kB-dependent mechanism. Moreover, the EPEC F1iC-independent responses increased in the absence of T3SS, suggesting that translocated bacterial effectors attenuated these response. While exploring regulatory mechanisms, we found that exposure of non-transformed TECs to bacterial flagellin transiently downregulated Sigirr expression correlating with IL-8 response. Transient silencing of the Sigirr gene augmented IL-S responses to flagellin, whereas stable over-expression of Sigirr diminished the NF-icB mediated IL-8 response to TLR ligands and inflammatory cytokines. The expression of  11  Sigirr increased as IECs differentiated in tissue culture. Similarly, Sigirr expression was prominent in differentiated cells on the apex while diminished at the base of intestinal crypts in human colonic tissues. Thus, we demonstrate that A/E pathogens trigger pro-inflammatory responses through both F1iC-dependent and -independent pathways that are regulated by Sigirr in differentiated human JEC, with clinical implications for infectious and inflammatory bowel diseases.  111  TABLE OF CONTENTS  ABSTRACT  .  TABLE OF CONTENTS  ii  iv  LIST OF TABLES  vii  LIST OF FIGURES  viii  LIST OF ABBREVIATIONS  xi  ACKNOWLEDGEMENT  xiv  DEDICATION  xv  CO-AUTHORSHIP STATEMENT  xvi  CHAPTER 1: Introduction  1  1.1 Intestinal epithelial cells: the frontline of host defense and homeostasis  3  1.1.1 The anatomy of differentiated intestinal epithelial cells  3  1.1.2 The role of epithelial barrier in colonic homeostasis  6  1.2 Host defense and intestinal epithelial cells  iv  12  1.2.1 Toll-like receptor signaling pathways in the colonic epithelium  15  1.2.2 Intracellular innate receptors in intestinal epithelial cells  21  1.2.3 The regulation of innate responses in intestinal epithelial cells  25  1.3 The microbial challenges to intestinal epithelial cells  27  1.3.1 The interaction of the epithelium with enteric microbes  27  1.3.2 The virulence factors in diarrheagenic E.coli  30  1.4 Objectives  39  1.5 Hypothesis and aims  40  1.5.1 Hypothesis  40  1.5.2 Specific aim 1  40  1.5.3 Specific aim 2  41  1.6 References  42  CHAPTER 2: Flagellin-dependent and -independent inflammatory responses following  infection with Enteropathogenic Escherichia coli and Citrobacter rodentium.. .57 .  2.1 Introduction  57  2.2 Materials and Methods  60  2.3 Results  68  2.4 Discussion  92  2.5 References  99  V  CHAPTER 3: Differentiation dependent expression of Single IgG II-l related receptor (Sigirr) controls Toll-like receptor and cytokine responses in human intestinal epithelial cells  103  3.1 Introduction  103  3.2 Materials and Methods  105  3.3 Results  108  3.4 Discussion  136  3.5 References  139  CHAPTER 4: Conclusions  142  4.1. Bacterial flagellin and epithelial biology  142  4.2 Bacterial factors in human inflammatory disorders  146  4.3 EPEC virulence factors and diarrhea! disease  150  4.4 The regulation of innate responses in intestinal epithelium  155  4.5 Future directions  164  4.6 References  168  Appendices  176  vi  LIST OF TABLES 1. Table 1.1 Summary of virulence factors in WT EPEC strain 2348/69  37  2. Table 2.1(a) Primers designed for generating EPEC and C. rodentium mutants  61  3. Table 2.1 (b) List of oligonucleotide primers used for chemokine gene expression...62 4. Table 3.1 List of oligonucleotide primers  106  5. Table Al: Optimization of experimental conditions for Sigirr semi-quantitative RT-PCR analysis  179  vii  LIST OF FIGURES  1. Figure 1.1: Intestinal epithelial cells in the gastrointestinal mucosa  8  2. Figure 1.2: Intestinal epithelial cells and intercellular junction  10  3. Figure 1.3: MyD88 dependent and independent Toll-like receptor pathways  17  4. Figure 1.4: A model of EPEC infection of IECs  32  5. Figure 2.1A: EPEC supernatants induce IL-8 secretion from Caco-2 cells  69  6. Figure 2.1B: Direct infection by EPEC bacteria triggers IL-8 secretion in a partially flagellin dependent manner  71  7. Figure 2.2A: Wild type and flagellin deficient EPEC activate p38 MAP kinase and induce I-icBcx degradation in Caco-2 cells  73  8. Figure 2.2B: IL-8 secretion by flagellin deficient EPEC is mediated preferentially by NF-ici3 in Caco-2 cells  74  9. Figure 2.2C: Summary of Toll-like receptor 5 mediated pathways  75  10. Figure 2.3A: Flagellin expression in LB culture supernatant of wild type, mutant EPEC and wild type C. rodentium  77  11. Figure 2.3B: AlE bacterial motility assay in 0.3% Agar  77  12. Figure 2.3C: Bacterial adherence assay in Caco-2 cells  78  13. Figure 2.4: Infection by flagellin deficient EPEC and C. rodentium but not exposure to their supernatants induce IL-8 secretion  80  11. Figure 2.5: NF-kB is activated by supernatant of WT EPEC but not 4fliC EPEC or C. rodentium  81  12. Figure 2.6: Infection with WT EPEC increases MCP-1 and Beta defensin-2 gene expression in Caco-2 cells  83  13. Figure 2.7A: IL-8 secretion by flagellin deficient AfliC EPEC and C. rodentium after 4 h of infection in Caco-2 cells  84  14. Figure 2.7B: MIP-3a secretion by flagellin deficient EPEC and C. rodentium after 4 Ii of infection in Caco-2 cells  85  viii  LIST OF FIGURES (Continued) 15. Figure 2.8A: Infection by C. rodentium activates NF-cB dependent pathway in Caco-2 cells  87  16. Figure 2.8B: IL-8 secretion by flagellin deficient EPEC requires NF-iB in Caco-2 cells  88  17. Figure 2.9A: C. rodentium infection is associated with increased chemokine gene expression in the infected colon  90  18. Figure 2.9B and 2.9C: C. rodentium infection leads to dendritic cell recruitment to the infected colon  90  19. Figure 3. 1A: Exposure to bacterial flagellin induces Sigirr protein expression in non-transformed human colonic (NCM) IEC  109  20. Figure 3.1B: EPEC infection down-regulates Sigirr expression in Caco-2 JEC  109  21. Figure 3.1 C: EPEC infection increases IL-8 gene expression in Caco-2 IEC  110  22. Figure 3.2A: Transient gene silencing reduces Sigirr protein levels in Caco-2 cells  111  23. Figure 3.2B: Sigirr gene silencing augments flagellin induced IL-8 chemokine secretion from Caco-2 cells  111  24. Figure 3.2C: Transient gene Silencing decreases Sigirr gene expression in HT-29 cells  113  25. Figure 3.2D: Sigirr gene silencing augments TLR5 mediated IL-8 secretion  114  26. Figure 3.2E: Sigirr gene silencing enhances diverse TLR responses in IEC  115  27. Figure 3.2F: EPEC infection up-regulates chemokine response in Sigirr deficient HT-29 cells  116  28. Figure 3.2G: Sigirr deficiency in TEC increases chemokine response to inflammatory cytokines  117  29. Figure 3.3: Immunofluorescent staining for Sigirr expression in HEK293T cells and human intestinal epithelial cells 119 and 120 30. Figure 3.4A: Stable over-expression of Sigirr in HT-29 and Caco-2 cells  121  31. Figure 3.4B: Sigirr over-expression abrogates NF-id3 activity  122  ix  LIST OF FIGURES (Continued) 32. Figure 3.4C: Sigirr over-expression attenuates F1iC induced chemokine response  123  33. Figure 3.4D and E: Over-expression of Sigirr blunts IL-8 responses to TLR ligands and inflammatory cytokines  124  34. Figure 3.5A: Stimulation of NOD1 receptor up-regulates 1L-8 secretion from Sigirr deficient IEC  126  35. Figure 3.5B: Sigirr over-expressing 1EC are less responsive to NOD1 stimulation  127  36. Figure 3.5C: Sigirr co-immunoprecipitates with intracellular Rip2 adapter protein  127  37. Figure 3.6A: Sigirr expression in Caco-2 cells is dependent on the differentiation state  128  38. Figure 3.6B: Caco-2 cells express the differentiation marker Dipeptidyl dipeptidase (DPP) in IEC monolayers  129  39. Figure 3.6C: Sigirr co-localizes with the differentiation marker DPP in Caco-2 cells  130  40. Figure 3.7A: Immunohistochemical analysis of Sigirr expression in human colonic tissues  132  41. Figure 3.7B: Epithelial Sigirr expression co-localizes with Claudin-3 tight junction protein in human colon  133  42. Figure 3.7C: Indian Hedgehog (IHH) expression by IEC coincides with Sigirr expression in human colon  134  43. Figure 3.7D: Simultaneous expression of TLR5 and Sigirr in colonic crypts  135  44. Figure Al: Effect of DMSO (vehicle) on IL-8 secretion from Caco-2 IECs  176  45. Figure A2: EPEC infection does not activate ERK and JNK in Caco-2 1ECs  177  46. Figure A3: Sigirr knockdown amplifies flagellin and CpG ODN responses in lECs  178  x  LIST OF ABBREVIATIONS OTT  Gastrointestinal tract  TLR  Toll-like receptor  lED  Inflammatory bowel disease  IECs  Intestinal epithelial cells  DC  Dendritic cells  Wnt  Wingless  thh  Indian hedgehog  MyD88  Myeloid differentiation factor  JAM  Junctional adhesion complex  ZO  Zona occludens  PAMPs  Pathogen associated molecular pattern  GM 1  Monosialotetrahexosylganglioside, a ganglioside  PMA  Phorbol Myristate acetate  PKC  Protein kinase C  Camps  Cationic antimicrobial peptides  Relm  Resistin-like molecule  PRR  Pattern recognition receptor  LPS  Lipopolysaccharide  F1iC  bacterial flagellin protein  NF-kB  Nuclear factor kappa B  LRR  Leucine rich repeats  TIR  Toll Interleukin- 1 receptor  Tir  Translocated intimin receptor  MAPK  Mitogen activated protein kinase  +  Tnt-i (genes involved in embryogenesis)  xi  ERK  Extracellular signal regulated kinase  JNK  Janus kinase  IgG  Immunoglobulin G  IFN  Interferon  MD-2  Myeloid differentiation factor 2  IRAK  Interleukin- 1 receptor associated kinase  Tollip  Toll interacting protein  TNFc  Tumor necrosis factor alpha  TRAF6  TNF receptor associated factor 6  IKK  Inhibitory kappa B kinase  NEMO  NF-icB essential modulator  AP- 1  Activated protein 1  IRF  Interferon regulatory factor  TSLP  Thymic stromal lyomphopoeitin  NOD  Nucleotide oligomerization domain  NLR  NOD-like receptor  CARD  Caspase recruitment domain  DAP  Diaminopimelic acid  A]EC  Adherent invasive Escherichia coli  SOCS  Suppressor of cytokine signaling  PPAR  Peroxisome proliferated activated receptor  Sigirr  Single IgG IL-i related receptor  IL-1R  Interleukin-1 receptor  M1P3c  Macrophage inflammatory protein 3 alpha  KC  Mouse CXC chemokine xii  SCFA  Short chain fatty acid  EAEC  Enteroaggregative Escherichia coli  EPEC  Enteropathogenic Escherichia coli  EHEC  Enterohemorrhagic Escherichia coli  ETEC  Enterotoxigenic Escherichia coli  ETEC  Enteroinvasive Escherichia coli  DAEC  Diffusely adherent Escherichia coli  T3SS  Type three secretion system  AlE  Attaching and effacing lesion  LA  Localized adherence  DA  Diffuse adherence  EAF  Escherichia coli adherence factor  BFP  Bundle forming pilin  LEE  Locus of enterocyte effacement  Esp  Escherichia coli secreted protein  Stx  Shiga toxin  STEC  Shiga toxin Escherichia coli  CR  Citrobacter rodentium  Caspase  Cysteine-aspartic acid proteases  G-CSF  Granulocyte colony stimulating factor  KLF  Kruppel-like factor  APRIL  A proliferation inducing ligand  TEL  Intraepithelial lymphocytes  xlii  ACKNOWLEDGEMENTS  This project would not be complete without the guidance and support of my supervisor Dr. Bruce Valiance. Bruce always provided a calming influence and helped in so many ways that are too numerous to mention. He has been a source of inspiration and motivation throughout my time in the laboratory, but especially when my experiments were not successful. I wish to thank Bruce and other committee members Drs. Gerry Krystal and Ted Steiner, whose valuable contributions ensured completion of this project. Their insight and suggestions helped improve this study, and their feedback facilitated smooth progression of my thesis. In addition, several colleagues and members of the Valiance laboratory provided assistance in conducting experiments and data analysis. Importantly, the trainees in GI the research laboratories, especially Kirk Bergstrom, Andy Sham and Chuan Ben Dai always nurtured and supported me through difficult and challenging times. I am grateful to technicians Caixia Ma and Tina Huang for educating me in technical aspects of this work including RT-PCR analysis and immunostaining methods. I always found them to be kind, polite and ever ready to lend a hand at even at short notice. I wish to also thank Deanna Gibson and Lisa Mansson for their comments, suggestions and encouragement during my doctoral studies.  xiv  DEDICATIONS  This thesis is dedicated to my parents who have always wished and prayed for my success. I also wish to dedicate this achievement to my beloved wife Ruhi with my sons Saad and Moiz. They have comforted me throughout and a provided tranquility in my life. Without their unstinting support and continuous encouragement, I would not have undertaken or been able to complete graduate studies.  xv  CO-AUTHORSHIP STATEMENT I am responsible for identification, planning and experimental design of all studies undertaken in this project. The experimental work and most of the studies presented in this thesis were primarily conducted by me with some help from the co-authors. The writing and preparation of the thesis was also completed by me with critical reviews provided by some co-authors. Mohammed Aatif Khan.  xvi  Chapter 1: Introduction The human intestine is a microcosm of diverse life forms that co-exist in a mutually beneficial relationship between the host and the environment. In a healthy subject, the intestinal flora consists of numerous species of anaerobic bacteria colonizing the large intestine that are introduced into the host soon after birth and tolerated by the indigenous immune system. In this milieu, numerous digestive functions proceed and provide the host with nutrition as well as promoting health and supporting the intestinal microflora. In this setting, there is ongoing cross talk between the luminal bacteria known as commensals and the intestinal epithelium. Recent studies have increased our understanding of the underlying molecular mechanisms that support homeostasis and promote tolerance in the human intestine. Several studies in the last decade have outlined signaling pathways in the host that are regulated both endogenously and from input derived from the commensal microbes as well as the pathogenic bacteria. Humans as well as other mammals are largely dependent on the immune system in the gastrointestinal tract (GIT) to recognize the presence of commensal and pathogenic bacteria which cause enteric infections. The intestinal immune system is distinctly different from the systemic immune system which functions to maintain a relatively sterile environment within the circulation and soft tissues such as muscle. The gastrointestinal immune system relies on innate responses which function as an early warning system entrusted with the initial detection of foreign and harmful stimuli. The innate immune system consists of a germline encoded family of receptors known as toll-like receptors (TLRs) that are present at birth and capable of sensing pathogenic bacteria, viruses and other microbes. Activation of the innate receptors protects the host and also stimulates the adaptive arm of the immune system that develops over time and retains a memory of the molecular signature of infecting microorganisms. The innate and adaptive responses are 1  complementary and function to protect the host against subsequent encounters with pathogens and harmful agents. An important consequence of the host immune response is the onset of inflammation, characterized by infiltration of professional immune cells to the site of infection with the aim of restricting the spread of pathogens and limiting the ensuing damage to surrounding tissues. Gastrointestinal inflammation is a predominant finding that characterizes most intestinal diseases in humans. When inflammatory responses are dysregulated, there is damage to host tissues and loss of normal GI functions. This inflammation contributes to the pathogenesis of inflammatory bowel disease (IBD) as well as diarrheal diseases, cancer and allergic disorders  such  as celiac disease.  GI inflammation is therefore a common  pathophysiology that characterizes most human diseases of the colon. The onset of inflammation in the GIT is triggered by intestinal epithelial cells (1ECs) and dendritic cells (DC5) that form the first line of host defense in the mammalian GIT and based on their location are in close proximity with commensal bacteria and antigens in the lumen of the gut. Because of their unique site, IECs and DCs act as sentinels against harmful microorganisms and activate protective innate defenses. The columnar epithelial cells form a monolayer on the surface of the villi in the small intestine, whereas in the large intestine, epithelial cells are located on the surface of crypts. The IEC are uniquely adapted to the diversity of life at the interface of the host and intestinal luminal environment. For example, they form microvilli on the apical surface of the intestinal brush border which acts as a structural impediment and its constant motion prevents pathogens from colonizing the epithelial surface. An integral role of JECs in colonic homeostasis is to maintain a barrier against luminal contents by forming tight intercellular junctions between cells. The epithelial barrier functions to separate the host internal  2  environment from foreign antigens as well as the effects of digestive enzymes in the lumen and prevents the loss of water and solutes. During enteric bacterial infections, such as shigellosis, the pathogen typically disrupts the epithelial barrier, with resulting loss of water and electrolytes into the lumen, leading to diarrheal disease. Similarly, in chronic inflammation, IECs are exposed to pro-inflammatory endogenous mediators such as cytokines, leukotrienes and prostaglandins which cause damage and disruption of the epithelial layer. In many GI diseases, IECs bear the brunt of the pathology and consequently the host loses fluids and electrolytes such as sodium and bicarbonate, resulting in alteration of intestinal homeostasis. Disruption of the epithelial layer also exposes underlying intestinal tissues to repeated cycles of inflammation. A better understanding of how innate responses are triggered and subsequently regulated in IECs should help clarify the cytoprotective mechanisms which may be supported during therapy for GI diseases.  1.1 Intestinal epithelial cells: frontline of host defense and homeostasis 1.1.1 The anatomy of differentiated intestinal epithelial cells The human gut arises from a primitive endodermal tube and develops into the pharynx, esophagus, stomach, small intestine and colon. Endodermal buds grow into mesenchyme and associate with the tube leading to the formation of liver and pancreas (93). The key signaling molecules required for the development of GI structures include Hedgehog (Hh), bone morphogenetic protein (BMP), Notch and Wnt/13-catenin signaling pathways and others. Patterned gene expression inside the endoderm and surrounding mesoderm subsequently regulates morphogenesis, differentiation and boundaries formed by these organs. The cross talk between the endoderm and mesoderm is required for morphogenesis and differentiation and later 3  promotes radial patterning in the developing digestive tract. Hh signals are a vital component of this cross talk and thus required for the normal patterning of the GI tract along anterior-posterior, dorsal-ventral and radial axes (57). A blockade of Hh signaling pathway with cyclopamine, a naturally occurring alkaloid (200), markedly alters the nucleus and cytoplasm in terminally differentiated enterocytes. In the absence of Hh activity, enterocytes at the luminal surface of the crypt exhibit an enlarged nucleus and bloated cytoplasm. Expression of molecular markers of enterocyte differentiation is significantly altered with redistribution of villin to the cytoplasm, decreased carbonic anhydrase, and increased intestinal trefoil factor (93). Conversely, treatment of HT-29 IECs with butyrate induces the expression of villin, Cip-1 and increases Indian Hedgehog expression (Ihh). IIih is a marker of terminally differentiated epithelial cells at the apex of crypts (191). Inhibition of Hh signaling with cyclopamine decreases butyrate induced Cip-1 and villin induction. Addition of recombinant Sonic Hedgehog-Shh (homologous to Ihh) leads to induction of Cip-l and villin. These data suggest a role for Ihh in regulating colonic epithelial differentiation in vivo and in vitro. 13-Catenin-TCF, a member of the Wnt pathway, is inhibited by [hh in colon cancer cells. If Wnt signaling is constitutively active, as in adenomatous polyposis coli (APC) gene mutations, Ihh expression is diminished. This phenomenon is observed in familial adenomatous polyposis (FAP) resected colonic specimens that contain both normal and dysplastic epithelial cells. Normal Ihh expression is noted in IECs, while Ihh expression is decreased in dysplastic cells. Inhibition of f3-catenin-TCF signaling in colon cancer cells causes rapid induction of thh expression (93). Collectively, these data suggest that activation of Ihh signaling in mature  4  epithelial cells on the apical surface of colonic crypts is antagonistic to the 13-catenin-TCF pathway, thus preventing proliferation and promoting differentiation/maturation in IECs. In the classical pathway, Wnt signaling inactivates glycogen synthase kinase3l3 (GSK3f3), a component of the multi-protein destruction complex, which includes APC and axin. This results in de-phosphorylation and stabilization of 13-catenin, leading to nuclear translocation of 13catenin and activation of target genes (101). It is believed that activation of the canonical Wnt pathway is essential to maintain the crypt cell population in a proliferative state. The nuclear accumulation of 13-catenin is observed mostly in cells located at the base of crypts and decreases as cells move towards the apex of crypts (190). Studies indicate that the transition of IECs along the crypt-villus axis is under the influence of the Wnt signaling pathway, whereas in terminally differentiated cells, the canonical Wnt signal is inactive. In 13-catenin or TCF4 knockout mice, or when Wnt signaling is inhibited by Dkkl (a cell permeable inhibitor of Wnt), there is a significant loss of proliferative epithelial cells (71, 89). Conversely, when the Wnt pathway is overactive as in APC mutations, epithelial cells exhibit a proliferative state and are unable to differentiate (4, 157, 173). The functions of the intestinal epithelium such as digestion and host defense are supported by epithelial cells of multiple lineages organized into the crypt-villus axis. In the small intestine, the epithelium is comprised of four principle lineages-i.e. absorptive enterocytes and three secretory cell types comprising goblet cells, enteroendocrine cells, secretory crypt cells and Paneth cells. The colonic epithelium principally consists of absorptive enterocytes and goblet cells. This multicellular organization is coordinated through the actions of stem cells lying at the base of the crypt in the human gut (109, 127, 205).  5  1.1.2 Role of epithelial barrier in colonic homeostasis Previously thought to serve as a simple barrier, recent studies have revealed a key role for IECs in colonic homeostasis. The colonic epithelium is located at an interface that separates an antigen rich luminal environment from mucosal immune system that is capable of recognizing and responding to microbes. The ability of the epithelium to perform its varied functions depends to a large degree on its capacity to maintain and restore its integrity in the face of challenges such as microbes and foreign antigens in the diet. If the epithelial barrier is breached, the intestinal epithelium is repaired by a host of factors which act to restore the normal integrity of the epithelial layer. Some of these factors include the mucin Muc3 which promotes cell migration, inhibits apoptosis and accelerates healing in cell lines and in a mouse model of acute colitis (63). Growth factors have a well defined role in maintaining epithelial integrity. For example, Insulinlike growth factor-i decreases apoptosis of epithelial cells after thermal injury (74). In experimental necrotizing enterocolitis, heparin binding epidermal growth factor was shown to increase IEC migration, proliferation and restitution (42). Recent studies have also revealed that prostaglandins and myeloid differentiation factor-88 (MyD88) signaling pathways play a key role in epithelial proliferation following injury (15). Since the lifetime of the IECs is relatively short (5-7 days), the above mechanisms are critical for replenishing the intestinal epithelium by supporting a continuous cycle of cell growth and restitution of the crypt-villus axis. The sheet of columnar cells on the epithelial surface is joined together by circumferential intercellular junctions forming a permeable barrier that allows selective passage of luminal contents. Components of the epithelial barrier also includes mucus which is secreted on the apical surface of epithelial cells, lipid plasma membranes of IECs, specific membrane transport systems responsible for trans-epithelial passage of different molecules such as the NHE3 (sodium hydrogen  6  exchanger) and the stromal compartment below the epithelial layer, known as lamina propria. The mechanisms that have evolved to regulate these physiological events are complex. While the structural and functional properties of the intestinal epithelium are designed to limit the amount of antigens reaching the lamina propria, specialized cells of the follicle-associated epithelium (M cells) and DCs sample luminal antigens for delivery to cells of the mucosal immune system thereby establishing immunosurveillance of luminal contents. A critical functional component of the epithelial barrier is the formation of tight junctions between adjacent epithelial cells, which forms a continuous cell layer facing the lumen of the gut. An outline of the intestinal epithelial cells and their specific role in the G1T mucosa is depicted in Figure 1.1  The tight junction is a macromolecular structure located at the apical surface of the lateral intercellular space and is essential for regulating paracellular movement of fluid and solutes (14). While the paracellular space contains different types of tight junctions, it is the junction that is closest to the apical surface that is principally responsible for regulating paracellular permeability. Adherens junctions and desmosomes are also important in cellular functions providing anchorage of cells through cytoplasmic actin filaments. The tight junction was studied using electron microscopic (EM) techniques, which revealed a series of pinpoint contacts between the apical and lateral membranes of adjacent cells. Freeze-fracture EM showed that the pinpoint contacts formed a continuous belt of branching fibrils which surrounded each cell (119). The tight junction fibrils are made up of a complex of integral membrane proteins, which bind to a group of cytoplasmic plaque proteins. The latter are responsible for tethering the cytoplasmic component of the tight junction to the cytoskeleton (182).  7  4  CorINnenaIbactcth C  a IEC  I  I  .1  1 I I I I I I  :1  I  Peyctspalch  I I I I I I I  DC /II  — a——— ——  Figure 1.1: Intestinal epithelial cells (JECs) in the gastrointestinal mucosa. IECs express (a) microvilli, (b) tight junctions, (c) secrete mucus and (d) antimicrobial peptides. Bacteria and their products translocate through (e) M-microfold IECs and presented to (f) dendritic cells resident in Peyer’s patches (6).  Integral membrane proteins within the epithelial tight junction include occludin, claudins, and junctional adhesion molecule (JAM). These proteins share similar structures including two extracellular loops that bind with other integral membrane proteins in neighboring cells. Integral proteins also possess cytoplasmic tails that interact with cytoplasmic plaque proteins via specific binding domains. Occludin, a 65-kDa protein was the first integral membrane protein shown to be localized to tight junction fibrils (44). Subsequently, a group of 20 integral membrane proteins called claudins (—22 kDa) were discovered that are expressed in a tissue-specific manner and possibly reflect regional differences in epithelial permeability (124). Site-specific claudin expression has also been recognized in the mammalian gut. For example, both claudin-3 and 8  claudin-5 are expressed in villi and intestinal crypts in rats, whereas claudin-2 is expressed specifically in crypts and claudin-4 is expressed solely in villi (144). The 35 kDa integral membrane protein JAM is known to modulate monocyte migration (110). The formation of tight junctions by integral proteins requires the presence of fibrils, which are approximately 10 nm in diameter and similar to gap junction connexons (119).  The cytoplasmic plaque is composed of a series of proteins known as zona occiudens ZO-1, ZO-2 and ZO-3, which belonging to the membrane-associated guanylate kinase (MAGUK) superfamily. This family also includes other proteins for example cingulin, and lymphocytic leukemia fusion-6. Tight junction-associated cell membranes contains high concentrations of lipids including cholesterol and sphingolipids, resulting in the formation of membrane microdomains described as detergent-insoluble glycolipid raft in the brush border of intestinal epithelial cells (29, 133). A summary of tight junction proteins in IECs is presented in  Figure 1.2.  Brush borders are specialized apical cell surface domains of epithelial cells that consist of numerous microvilli (up to 3000/cell), which are tubular projections of the plasma membrane that increase the cell surface area. Brush borders are found on small intestinal enterocyte, kidney proximal tubule cells and placental syncytiotrophoblast. In addition, brush borders with lesser degrees of organization are also found on surfaces of many other cell types, including cells of the pancreas, liver and colonic epithelial cells (122). The apical brush border of IECs contain membrane associated structures known as lipid rafts (29).  9  IEC membrane  Claudin  lEO -n Ti  Aini ring Al  Cytokeratin Dcsines.me filaments Plakophilin  Desmosonial dherms  Figure 1.2: Intestinal epithelial cells and intercellular junctions. TJ-tight junction proteins are Claudin, Occiudin, Junctional adhesion complex (JAM-A), Coxsackie adenoviral receptor (CAR), Afadin and Zona occiudens (ZO 1/2/3) proteins. AJ-adherens junction consists of E cadherin and cytoplasmic cx/J3/y catenins. TJ and AJ are anchored to pen-junctional actin-myosin  10  ring. Desmosomes (DE) comprise of JAM-C and desmosomal cadherins. These proteins bind cellular 7-catenin, desmoplakin, plakophilin and linked to cytoskeletal intermediate filaments (22).  Recent studies indicate that these rafts are targeted by many pathogens for adhesion and/or invasion of host cells. A number of pathogens, including bacteria, viruses, fungi, parasites and toxins specifically recognize raft components when making their initial contact with the target cell in the host (23, 26, 37). The presence of lipid rafts in the vicinity of tight junctions possibly reflects a host derived mechanism that clusters membrane bound innate (TLRs) receptors which act as sensors of pathogen associated molecular patterns (PAMPs). The apical border of polarized epithelial cells is composed of separate sub-domains such as plasma membrane protrusions including microvillus and primary cilium, as well as a non-protruding region. This region contains a variety of lipid species that have distinct physical and chemical properties. Using the cholesterol-binding protein prominin-1 (CD 133) as a specific marker, Weigmann et al proposed the co-existence of different cholesterol-based lipid rafts (202).  A number of studies have demonstrated that TLRs are condensed into lipid rafts of epithelial cells at different sites in humans. For example, TLR2 was translocated to apical lipid raft complex in the airway epithelial cells following infection with Pseudomonas aeroginosa (167). In IECs, intracellular recognition of LPS activated the formation of lipid rafts via a clathrin dependent mechanism in the Golgi complex (66). Interestingly, Escherichia coli enterotoxin activation of TLR2 signaling requires a lipid raft associated ganglioside GD 1 in epithelial cells (98). The role of ganglioside in flagellin responses in IEC remains controversial. Gangliosides such as GM1, GD1a and asialo-GM1 were initially thought to function as co  11  receptors for flagellin and were required for anti-microbial host defense (41, 137). However, a later study by West et al clarified that membrane bound gangliosides inhibit the signaling pathways induced by bacterial flagellin, without affecting flagellin interaction with host TLR5 (203). Regardless of its role, it is clear that lipid rafts harboring gangliosides influence the effects of flagellin and modulate TLR5 signaling in host cells. Further studies are needed to clarify the specific role of gangliosides in TLR5 signaling pathway in IECs.  1.2 Host defense and Intestinal epithelial cells  Several human colonic carcinoma cells lines have been used to model human intestinal epithelium in the laboratory for investigating host immune responses and digestive functions, such as absorption, transport of nutrients as well as the metabolism of drugs (112, 174, 189, 196). These cell lines include Caco-2, HT-29 and T84 IECs which undergo varying degrees of enterocytic and colonic differentiation in culture (68, 155, 213). A desirable feature of Caco-2 IECs, first isolated by Fogh et al (43), is that they undergo spontaneous differentiation in culture which begins when cells become confluent and form a continuous monolayer. The monolayer is characterized by formation of numerous dome-like structures which corresponds with the ability to conduct transepithelial ionic transport. Differentiated Caco-2 cells resemble the apical surface of the intestinal epithelium by possessing a well-defined brush border and tight cellular junctions (28, 188). Furthermore, differentiation in Caco-2 IECs is associated with expression of brush border enzymes such as sodium hydrogen exchanger-NHE3, as well as hydrolases including alkaline phosphatase and dipeptidyl dipeptidase (97, 164). A component of lipid rafts known as Alpha-kinase 1 is expressed concomitantly with the Caco-2 cell differentiation marker sucrase  12  isomaltase (60). As such, lipid rafts are critical for some homeostatic functions such as absorption (131) and host defense against enteric pathogens (76).  Like Caco-2 IECs, T84 cells spontaneously differentiate in culture after confluency, but their brush border is not well developed and they do not express microvillous enzymes such as alkaline phosphatase and dipeptidyl dipeptidase (38). T84 cells also resemble adult colonic crypt cells in their morphology with tight junctions and ionic transport characteristics (61). In contrast, HT-29 IECs do not differentiate spontaneously under normal culture conditions. However, they can be induced to differentiate by addition of agents such as butyrate (47) and phorbol 12myristate 13-acetate (PMA), which induces PKC dependent mucin gene expression in HT-29 cells. The HT-29 cell is a useful model for in-vitro studies, and may be utilized for investigating the role of the mucus layer in host defense andlor homeostasis.  The GI mucosa has developed several physical adaptations for host defense which impair translocation of pathogens and microbial products across the epithelium. In addition to the brush border microvilli, the epithelial barrier is reinforced by a continuous sheet of mucus and glycocalyx which covers the apical surface of IECs. The mucus is widely distributed throughout the GI tract and is produced by specialized epithelial cells known as goblet cells (99). Goblet cells are found in colonic crypts, as well as in small intestine, and secrete mucus that is mostly composed of mucins. The mucins provide attachment sites for microbes by forming a polysaccharide network that is rigid and sticky, so that pathogens are trapped and removed by peristalsis. The mucus layer in the GI tract therefore constitutes a physical shield that prevents pathogens from colonizing the epithelium (130).  13  In addition to the physical barrier, the mucosa in the GI tract expresses a broad spectrum of cationic anti-microbial peptides (Camps) that are produced by specialized epithelial cells known as Paneth cells in the terminal ileum and released into the lumen. The Camps include alpha and beta defensins, cathelicidins and resistin-like molecule (Relm) beta (30). Together, these Camps target various components of pathogenic microbes through disruption and permeabilization of the bacterial cell wall and inhibition of viral nucleic acid production (45). The secretion of Camps is possibly disseminated in the lumen of the intestine by the mucus layer, thus protecting the host against infection and disease.  The ability of IEC to distinguish between the diverse elements of intestinal flora as well as responding to pathogens has been the subject of intense study. It is known that germ-line encoded pattern recognition receptors (PRRs) are the principal sensors of microbes and their  products. PRR recognize conserved bacterial and viral signature motifs and form an integral part of the innate immune system in the gut. Metchnikoff first described the innate immune system more than a century ago; however, research on innate immunity was largely overshadowed by the discovery of antibodies, B and T cells, and other components of the adaptive immune system (166). Recent work has increased our insight into innate immunity and how it functions at different sites. By utilizing an intricate network of effector mechanisms, innate immune responses lead to either clearance or restriction of pathogen replication until the adaptive immune system mounts a more specific and robust response. In 1993, Janeway proposed that innate effector mechanisms are initiated via the specific detection of microbes by germline encoded, non-clonal receptors, which are essential for early detection and subsequent control of infection in mammals (73). This response is triggered by microbial products including lipopolysaccharide (LPS), bacterial flagellin, lipoproteins, and viral or bacterial nucleic acids. 14  Signaling through PRR induces a cascade of events including the production of proinflammatory chemokines and cytokines, activation of complement, recruitment of phagocytic cells, and mobilization of professional antigen-presenting cells which constitute the adaptive immune response (92). In the late 1990s, three key discoveries significantly advanced our understanding of the function of PRRs in innate immunity. In 1996, the Drosophila melanogaster protein Toll, identified previously for its role in dorso-ventral embryonal patterning, was shown to be critical for effective immune responses in adult flies against the fungus Aspergillus fumigates (94). A mammalian homolog of the Drosophila Toll receptor, initially called human Toll and now known as Toll-like receptor 4 (TLR4), was then identified. A constitutively active form of TLR4 could activate the key transcription factor NF-KB, leading to the expression of pro-inflammatory genes encoding IL-113, IL-6, IL-8 and co-immunostimulatory molecules (117). The discovery of a point mutation in the Tlr4 gene that made mice less responsive to LPS challenge and more susceptible to Gram-negative bacterial sepsis, definitively established the protective role of TLRs in innate responses (143).  1.2.1 Toll-like receptor signaling pathways in the colonic epithelium TLRs are type I transmembrane proteins of the IL-i receptor (IL-1R) family that possess: a) an N-terminal leucine-rich repeat (LRR) domain for ligand binding, b) a single transmembrane domain and c) a C-terminal intracellular signaling domain. IL-i receptors and TLRs are members of a large super-family of phylogenetically conserved proteins involved in innate immunity and inflammation (100). The members of this family share a conserved sequence of proteins in their cytoplasmic region, known as the ToI1JIL-1R (Tifi) domain that is involved in the activation of the canonical signaling pathway leading to NF-icB activation as well as  15  activation of the MAP kinase pathway involving p38, JNK and ERK. There is however, an important difference in the structure of the extracellular domain of TLRs and IL-1R. Whereas TLRs contain sequences known as leucine-rich repeats (LRR) motifs that recognize PAMPS, the IL-iRs bear immunoglobulin (IgG) like domains which bind their corresponding interleukins. TLRs are widely expressed in many cell types, including professional immune cells such as macrophages where TLR function has been intensively examined. TLRs are also expressed by non-hematopoietic epithelial and endothelial cells, although most cell types express only a select subset of these receptors. Thus far, 13 mammalian TLRs, 10 in humans and 13 in mice, have been identified. TLRs 1-9 are conserved among humans and mice, whereas TLR1O is present only in humans and TLR1 1 is functional only in mice. Although much is known about the ligands and signaling pathways of TLRs 1-9 and 11, the biological roles of TLRs 10, 12, and 13 remain unknown. Furthermore, their expression patterns, ligands, and signaling pathways are yet to be identified (156). Most TLRs require MyD88 as an adaptor to relay signals downstream from the receptor. TLR3 signaling, on the other hand, requires the TRW adaptor protein, which can also signal for TLR4 (204). Whereas TLR activation leads to secretion of inflammatory cytokines such as IL-6 and IL-8, ligation of TLR3, TLR7 and TLR9 leads to activation of IFN inducible genes. As mentioned earlier, TLR4 activation can stimulate inflammatory cytokines in addition to type 1 IFN genes. A summary of MyD88-dependent and independent pathway is presented in Figure 1.3.  16  8 dep. pathway yDB TM  MyD 88 indep. pathway  ThiN  TLR216  TLRII2  ThR5  TLR719 •  MYD IRAK4  Type 1 WN genes WN inducible genes  IRAF6  Type 1 IFN genes JflfifflmflatoTy  cytokme genes  IFN inducible genes  Figure 1.3: MyD88 dependent and independent Toll-like receptor signaling pathways (77). In contrast to professional immune cells, IECs express only a subset of TLRs and maintain a state of hyporesponsiveness to microbial and inflammatory stimuli. To date, a number of mechanisms have been proposed to explain the hyporesponsivess seen in colonic IECs. Several groups have shown that IECs express low levels of TLR4JMD-2 complex as well as TLR2, and therefore quiescent to their ligands (2, 18, 118). The induction of tolerance to commensal bacteria has been shown to involve decreased MyD88 and IL-1R-associated kinase (IRAK) expression and activity (116). An emerging role for negative regulators of TLR signaling was described for Toll-interacting protein (Tollip) expression in IEC (211).  17  IECs have been reported to develop tolerance by downregulating some TLRs and increasing the expression of negative regulators such as Tollip (138). Another mechanism explaining the limited responsiveness of IEC to commensal bacteria is the polarity of the intestinal epithelial cells and differential expression patterns of various TLRs in apical compartments versus basolateral orientation in differentiated epithelial cells.  In IECs, TLR5 specifically binds bacterial flagellin, TLR4 binds LPS, TLR2 binds bacterial cell wall lipoprotein and TLR9 recognizes bacterial DNA. These cells also express TLR3 to detect double stranded RNA viruses while TLR7 and TLR8 are not expressed in human IECs. Caco-2 and T84 IECs exhibit a polarized phenotype with apical and basolateral surfaces, when grown on transwell supports. This model of polarized epithelia has been utilized to identify the apical versus basolateral expression of TLRs and their adaptor proteins. For instance, TLR2 expression in intestinal epithelial cells has been shown to be localized at the apical membrane (17) while other authors have reported TLR5 expression on basolateral membranes. In this model, only pathogenic flagellated bacteria that could translocate across the intestinal epithelial lining will be recognized by basolateral TLR5 and induce an innate immune response. In contrast, other studies suggested that TLR5 is expressed on the apical surface of IEC in mice (9).  Currently, our understanding of TLR5 expression in human colonic epithelia remains very limited, with a single report demonstrating that TLR5 expression is confined to the basolateral surface of human intestinal explants (148). The dearth of data about TLR5 expression in the colon is partly due to the lack of specific antibodies for human studies, however our understanding of TLR5 expression will become clearer as new antibodies and molecular techniques become available. Nevertheless, TLR5 has been intensively studied in IEC in tissue  18  culture and a brief description of our current understanding of the biology of TLR5 is warranted. The first evidence of TLR5 expression in-vivo was reported by Uematsu et a! (184). These authors suggested that TLR5 is mainly expressed in a subset of murine DCs known as intestinal CD1 lc+ lamina propria cells. The CD1 lc+ DCs do not express TLR4 and are unresponsive to LPS. These cells respond to flagellin by secreting IL-12, TL-6 but not IL-lO or TNFc. Since lamina propria DCs extend their dendrites to sample the luminal contents, low expression of TLR4 might be useful for avoidance of innate response to commensal bacteria (132).  The recent availability of TLR5 knock-out mice has revealed important roles for this TLR in enteric infections and intestinal inflammation. The deletion of the TLR5 gene in mice results in spontaneous colitis, possibly as a consequence of increased TLR4 mediated intestinal inflammation (194). A lack of TLR5 also produced a dyregulated host response to Salmonella induced typhoid-like disease and diminished host defense following Pseudomonas aeroginosa infection (145, 193). These data indicate that TLR5 plays a key role in controlling some bacterial infections and possibly protects against radiation and chemical injury (16). The detection of unmethylated CpG motifs of bacterial DNA by TLR9 on the apical surface of human IEC was first investigated by Lee et al (91). These authors reported that activation of apical TLR9 stabilized NF-icB whereas basolateral TLR9 stimulation produced NF-icB mediated proinflammatory cytokine response in JECs. The mechanism of apical TLR9 unresponsiveness could be due to the specific expression of negative regulators on the apical surface of JECs. Our knowledge about TLR activation and subsequent signaling events has increased dramatically in recent years. Activation of TLRs leads to two types of signaling events based on the involvement of MyD88. TLR signaling that is dependent on MyD88 leads to recruitment of IRAK1 to the TLR cytoplasmic region. Once IRAK1 is phosphorylated and activated by IRAK4, 19  it dissociates from MyD88 and activates TRAF6, a member of TNF receptor family. TRAF6 complexes with Ubcl3 and UevlA ligases and promotes activation of TAK1, a MAPKKK (MAP kinase kinase kinase). TAK1 in combination with TAB 1, 2 and 3 activates two downstream pathways involving the IKK complex and MAPK family. The IKK complex, composed of the catalytic subunits IKKc and IKKf3 and a regulatory subunit IKKy/NEMO, catalyzes the phosphorylation of I-icB proteins. This phosphorylation is necessary for the degradation of I-id3 and the subsequent nuclear translocation of NF-id3 which leads to the trancription of various inflammatory genes. Members of the MAPK family include the p38 MAP kinase, ERK and JNK. These proteins phosphorylate and activate the downstream transcription factor AP-1, a dimer of basic region leucine zipper (bZIP) proteins (77). Both AP-1 and NF-iB transcription factors are required for transcriptional activation of the IL-8 promoter (64). Currently, it is believed that almost all TLRs, with the exception of TLR3, depend on the MyD88 adaptor protein for downstream signaling. TLR3 signaling requires the TRW adaptor protein to relay signals to the TRAF family of proteins which converge on the transcription factor IRF, instead of the canonical NF-icB pathway. Similarly, TLR7 and TLR9 activation leads to MyD88-dependent pathway leading to activation of IRF (77). The overall function of NF-icB and IRF activation is induction of cytokines such as IL-i, IL-6 and the chemokine IL-8, as well as the release of anti-microbial peptides such as Camps. Recently, commensal driven secretion of IL-25 by IECs was demonstrated as critical for regulation of the IL-17 axis in chronic intestinal inflammation (210). IEC derived IL-25 was shown to limit the proliferation of IL-17 producing CD4÷ T cells by inhibiting the expression of macrophage derived IL-23. In this manner, IECs are able to exert an inhibitory effect on macrophage function in the lamina propria. Further, IECs secrete the cytokine Thymic Stromal 20  Lymphopoietin (TSLP) which targets lamina propria DCs, inducing a non-inflammatory quiescent state (149). The crosstalk between JECs, DCs and macrophages facilitates mucosal homeostasis and may be perturbed in chronic inflammatory disorders such as IBD.  1.2.2 Intracellular innate receptors in intestinal epithelial cells The nucleotide oligomerization domain (NOD) proteins are cytoplasmic sensors of microbes that invade host cells. The NOD-like receptor (NLR) family consists of approximately 25 members expressed in humans with a characteristic triad structure of a C-terminal leucine-rich repeat domain, a central nucleotide-binding domain, and an N-terminal protein/protein interaction domain. The leucine-rich repeat domain of NOD proteins binds to bacterial ligands, whereas the N-terminal domain interacts with and activates signaling pathways for the induction of innate defenses and in some cases apoptosis (70). Many NOD proteins are expressed in myeloid cells throughout the body including the gastrointestinal tract and their functions in health and disease  are beginning to be understood. Two of the best characterized NOD proteins are NOD 1 (CARD4) and NOD2 (CARD15).  NOD 1 is expressed in multiple tissues and particularly in epithelial cells within the GI tract. It senses a specific diaminopimelic acid (DAP)—containing peptidoglycan motif expressed by gram-negative but not gram-positive bacteria (20, 49). The NOD 1 receptors are required for host defense against intracellular pathogens such as Shigella flexneri, enteroinvasive Esherichia coli and Pseudomonas aeroginosa (51, 81, 180). These pathogens invade IECs and activate NF id3 in a NOD1-dependent manner. Mice deficient in NOD1 are unable to release chemokines or recruit neutrophils, when challenged with NOD1 ligands (111). Interestingly, a peptidoglycan fragment known as tracheal cytotoxin or TCT was not detected by human NOD1 or NOD2. In contrast, TCT activated NOD 1 in murine macrophages. Similarly, differences have emerged in 21  the activation of murine and human cells by synthetic NOD1 ligands (103). These data suggest that there are species specific differences in NOD1 signaling pathways (50). Epithelial NOD1 receptors also constitute an important class of innate sensors that recognize bacteria which may have evaded surface TLRs in IECs.  The structure of NOD2 is similar to NOD1 with the exception that it contains two instead of one N-terminal CARD domain. NOD2 is expressed predominantly in myeloid cells such as macrophages and dendritic cells, including Paneth cells in the G1T (90). The expression of NOD2 can be induced in TECs when the cells are stimulated with the pro-inflammatory cytokines TNFo and IFNy’ (153). Accordingly, the expression of NOD2 in IEC is elevated in chronic intestinal inflammation (13). Interestingly, a NOD2 frame-shift mutation is associated with Crohns disease in some patients. This results in truncation of the terminal LRR protein product such that it is no longer able to detect peptidoglycan (70). Although the implications of these findings are still not fully understood, it appears that impaired bacterial sensing may contribute to the pathology of Crohn’s disease. It has been shown that expression of mutant NOD2 diminishes the clearance of Salmonella from human IECs (62). Moreover, the clearance of invasive bacteria is dependent on NF-icB activation via the cell-death regulatory protein GRIM 19 which interacts with NOD2 (10). Another mechanism by which NOD2 deficiency could contribute to the pathogenesis of Crohn’s disease is explained by its role in Paneth cells. The secretion of antimicrobial peptides (Camps) from Paneth cells in the terminal ileum is dependent on NOD2. A deficiency of NOD2 would decrease Camp secretion and therefore possibly increase the burden of pathogenic bacteria such as Adherent Invasive Escherichia coli (AlEC) as reported in some patients with Crohn’s disease (31, 87). In support of this hypothesis, targeted deletion of NOD2 in mice decreases a 22  defensin production and enhances susceptibility to experimental Listeria monocytogenes infection (90).  In humans, mutations in the NOD2 gene are confined to the leucine-rich repeat domain and abolish, in many cases, the ability to sense bacterial components and activate NF-icB. Consistent with the loss-of-function phenotype, many of the Crohn’s disease—associated NOD2 mutations appear to act in a recessive manner (201). However, some mutations are not associated with a loss-of-function phenotype, suggesting that defective sensing of microbial products may not be a consequence of mutated NOD2. In fact, mutations in the nucleotide-binding region of the NOD2 protein lead to constitutive, ligand-independent activation of the downstream NF-icB pathways and cause a chronic systemic inflammatory disorder, Blau syndrome, in a dominant fashion (19). Thus, NOD2 mutations can span a spectrum of phenotypes from complete loss of function to inappropriate gain of function. The specific impact of NOD2 mutations on the development of human IBD remains controversial and further studies are needed to clarify how mutations of this intracellular receptor contribute to the pathogenesis of CD or UC (31, 87).  As noted above, NOD2 mutation may diminish the innate response required against bacterial infections, leading to an increase in bacterial burden and a prolonged inflammatory response, perhaps sustained by TLR ligands. This concept is supported by a study in patients with CD, where reduced IL-8 secretion by PBMC derived macrophages corresponded with reduced neutrophil recruitment and persistence of subcutaneous E. co/i infections (108). Furthermore, impaired dendritic cell function and production of cytokines has been reported in response to MDP but not to TLR ligands in some CD patients (88). Similarly, cytokine production by macrophages from NOD2 knockout mice is diminished following stimulation with  23  MDP but not by TLR ligands (87). These studies suggested that loss of NOD2 would be expected to abolish the pro-inflammatory responses to MDP and should produce less inflammatory response, in contrast to IBD where intestinal inflammation is a predominant feature of the disease.  Further insight was gained by the generation of the transgenic mice which carried the human form of NOD2 mutation. Macrophages from transgenic mice harboring the most common NOD2 mutation-3O2OinsC, which encodes a truncated protein lacking 33 amino acids (69, 136) exhibited elevated NF-icB activation with increased processing and secretion of IL-113, suggesting that this mutation is associated with a gain of function phenotype (102). This gain of function concept, however, is in contrast with data on human peripheral blood monocytes that exhibit reduced rather than increased IL-i 13 production (96). It remains to be determined if these conflicting findings are due to species differences between humans and mice.  A recent development about NOD2 function came to light with the discovery by Watanabe et a! that deficiency of NOD2 may impact TLR2 signaling. These authors found that NOD2 deficient antigen presenting cells such as DCs produced increased amounts of proinflammatory IL-12 when exposed to peptidoglycan, a TLR2 ligand. Mice deficient in NOD2 also developed colitis when challenged with MDP (199), suggesting that NOD2 possibly functions as a negative regulator of TLR2 signaling while sparing other TLRs. Interestingly, the same group recently showed that MDP activation of NOD2 protects mice against experimental colitis (198). The above finding suggests an increasingly important role of innate receptors such as NOD2 in immunoregulation, loss of which may predispose some individuals to developing IBD.  24  1.2.3 The regulation of innate response in intestinal epithelial cells  The role of negative regulators of LPS signaling were described for the first time in 2002, when IRAK-M was shown to inhibit TLR signaling in macrophages and monocytes (86). Simultaneously, two independent groups identified the suppressor of cytokine signaling (SOCS) as an inhibitor of LPS signaling in macrophages. SOCS-l knock-out mice were hypersensitive to septic shock with increased production of TNFo and other inflammatory cytokines compared to WT littermates (82, 126). Since the identification of SOCS, several negative regulators of TLRs have been described in macrophages as well as other immune cells whose function varies from inhibition of TLR signaling at the cell membrane, to activation of adaptor proteins in the cytoplasm and transcription factors involved in inflammatory gene expression. For example in mice, a soluble alternatively spliced form of TLR4 mRNA is expressed as 20 kDa protein. This secreted protein interrupts TLR4 responses and inhibits LPS induced TNFc production in a mouse macrophage cell line (72). IRAK-M is a negative regulator that inhibits cytoplasmic IRAK-l binding with TRAF6 thereby impeding TLR signaling to NF-id3 (86). Another example is PPAR’y, which functions to prevent nuclear translocation of activated NF-id3 in epithelial cells (36). The existence of these regulators clearly indicates that inflammatory signaling is strictly controlled with check points at multiple levels within the mammalian cells to prevent dysfunctional responses and potentially limit undesirable inflammation in steady state conditions.  To date, the only negative regulator known to specifically inhibit TLR signaling in human JECs is Tollip which prevents TLR2 and TLR4 signaling by suppressing the activation of IRAK (211). Since the expression of these TLRs is relatively lower in IECs, it is unknown if  25  Sigirr regulates other TLRs such TLR5 and TLR9 known to be expressed by ]EC. Furthermore, it is unknown if Sigirr expression in LECs is altered during differentiation or migration of IECs from the base to the surface of colonic crypts. To date, the expression pattern of innate receptors such as TLR5 and their negative regulators in cultured human IECs has not been elucidated. Therefore, the effect of phenotypical changes in spontaneously differentiating and maturing cells such as Caco-2 IECs, on innate receptors and host defense is yet to be ascertained.  The single IgG IL-i-related receptor (Sigirr) was identified as a negative regulator of TLR4 signaling that is highly expressed in the human colon as well as in other tissues of the gastrointestinal tract (197). Sigirr attenuates TLR signaling by binding IRAK and TRAF6 thereby sequestering these critical proteins and interrupting the transduction of signal to NF-icB (134). The expression of Sigirr has also been reported in the immune system i.e. DCs, macrophages and neutrophils as well as by other epithelial tissues in the kidney and lungs (142). The structure of Sigirr protein shares similarities with other members of the superfamily of IL-i receptors such as IL-18 and TLRs. In comparison to the extracellular region of the IL-1R which consists of three IgG domains, the extracellular region of Sigirr is composed of a single IgG region. Further, the cytoplasmic tail of Sigirr protein is relatively longer with 268 amino acids compared to IL-1R which has 216 amino acids. The first evidence of regulation of TLRs by Sigirr was demonstrated by Wald et al who observed that Sigirr negatively regulated LPS responses (197). These authors showed that the inflammatory response to LPS challenge was enhanced in Sigirr deficient mice. Splenic thymocytes and renal epithelial cells from Sigirr knock-out mice demonstrated hyper responsiveness to IL-i 3 and LPS stimulation. Since then, several studies have investigated the role of Sigirr in human inflammatory diseases such as psoriatic arthritis and septic shock, as well 26  as in infectious diseases due to Mycobacterium tuberculosis and in Pseu4omonas aeruginosa keratitis (3, 11, 46, 67). Recently, the role of Sigirr in the gut was investigated by Xiao et al in Sigirr knock-out mice and these authors showed that Sigirr plays a central role in colonic homeostasis, inflammation and tumorigenesis (206). Colonic IECs from Sigirr deficient mice exhibited constitutive activation of inflammatory genes that was dependent on conmiensal flora. Levels of pro-inflammatory cytokines TNFo and IFNy, as well as chemokines MIP2 and KC were significantly augmented. Sigirr deficient mice were highly susceptible to DSS challenge, suffering higher mortality, epithelial damage and increased inflammatory cell infiltration into colonic tissues. Increased inflammatory gene expression in the colon was also a consistent finding with up-regulation of JL-113, IL-12p40, IL-6 and IL-17. These findings supported a key role for Sigirr in regulating innate responses and colonic inflammation with possible implications for human diseases. The role of Sigirr in human GI disease is yet to be addressed and given the complexity of the relationship between the commensal bacteria and colonic homeostasis, further studies are needed to elucidate the role of negative regulators in GI inflammatory disorders such as IBD.  1.3 The microbial challenges to intestinal epithelial cells. 1.3.] The interaction of the epithelium with enteric microbes The human colonic commensal microbiota consists of greater than 500 species of bacteria that plays a central role in many functions in the GI tract including human nutrition and health, generating nutrient supplies, preventing pathogen colonization, while shaping and maintaining mucosal immunity (207). Following bacterial colonization, significant changes take place in the human intestine with selective expansion and phenotypic differentiation of specific cell lineages within the mucosal immune system (65, 208). The influence of this postnatal period in intestinal  27  immunity is thought to persist throughout life and impacts general health. It is believed that commensal bacteria are pivotal in the development and maintenance of gut-associated lymphoid tissues (186). The increasingly recognized role of comniensal flora in human health is consistent with the hygiene hypothesis which suggests that reduced exposure to important gut bacteria may lead to the rising incidence of human allergies and autoimmune diseases (151). In the future, it may be possible to exploit the mutually beneficial co-existence between commensal bacteria and the healthy host for treatment of diseases, such as IBD, where inappropriate immune responses to commensal flora is thought to contribute to pathogenesis of the disease.  The identification of a number of genes in commensal bacteria that modulate host immune system has been investigated in a several studies. For example, the immunomodulatory effect of Bijidobacterium iongum may involve the eukaryotic-type serine protease inhibitor (serpin), which inhibits pancreatic and neutrophil elastase in their natural habitat and protect the host against exogenous proteolysis (163). The mucinase activity of fucose-rich polysaccharides in Bacteroides thetaiotaomicron may permit close contact with intestinal epithelial cells and exert immunosuppressive effects (25, 78). The normal commensal flora can efficiently block intrusion of many pathogenic bacteria into host epithelial cells. This has been termed ‘microbial interference’ or ‘colonization resistance’ (192). Deficiency of commensal microbiota (e.g. axenic mice raised under sterile conditions and antibiotic-treated mice) exhibit dramatically increased susceptibility to enteric infection by Salmonella and Shigella flexneri (104). Conversely, some commensal species, such as Lactobacillus spp. or Bifidobacterium spp. have therapeutic and/or prophylactic effects against enteric bacterial infections (48). A number of commensal bacteria  are also available commercially as probiotics or live microbial food supplements with health promoting properties. The molecular basis of colonization resistance can therefore be 28  summarized as (i) the production of antimicrobial or toxic substances by the flora (bacteriocins, short chain fatty acids [SCFA]), (ii) competition with pathogens for adhesion receptors, (iii) stimulation of mucin secretion or antimicrobial peptide production by sodium butyrate (59, 146) (iv) stabilization of the gut mucosal barrier and improvement of gut motility and (v) overall nutrient limitation by the elaborate microbial food-web (48, 195).  In contrast to the beneficial actions of commensal bacteria, enteric bacterial pathogens largely account for diarrheal diseases. According to World Health Organization (WHO) estimates, diarrheal diseases account for 18% of all deaths in children under the age of 5 years worldwide. The frequency of isolation of a specific pathogen from children depends on several factors such as the level of development in a region; geographic location; age group, infants versus young children; immune status e.g. immunocompetent versus immunocompromised individuals; between breastfed and non-breastfed infants; rural and urban settings; and even over time in the same location and population (141). Sometimes, even in the best of studies, no enteric pathogen is identifiable and in many cases multiple putative enteric pathogens are seen frequently in the clinic. In spite of these variables, it is important to ascertain the cause of diarrhea in children in developing countries, as this is the predominant group that suffers its complications such as malnutrition and as a result is likely to have long term growth deficits. Enteric pathogens responsible for causing the most severe acute diarrhea and mortality  worldwide include Vibrio cholera, Shigella spp., Salmonella spp., Enteropathogenic Escherichia coli and Enteroaggregative Escherichia coli.  Escherichia coli are a member of the genus Escherichia within the family Enterobacteriaceae, and consist of mostly motile, gram-negative bacilli. This bacterium  29  colonizes the gut of newborns soon after birth and thereafter continues to be present in the intestine of humans functioning as a commensal. E. coli was recognized as a pathogen that caused diarrhea with the finding in 1898 that serum from diarrhea patients agglutinated isolates of E. coli from other patients in the same outbreak but not those of controls (129). Before the virulence factors of E. coli were identified, pathogenic strains were distinguished mainly by serotyping. A scheme was proposed by Kauffman in 1944 by which E. coli were serotyped on the basis of their 0 (somatic), H (flagellar) and K (capsular) surface antigen profiles (129). A total of 170 different 0 antigens, each defining a serogroup, are recognized presently. A specific combination of 0 and H antigens defines the serotype of an isolate. To identify a diarrheagenic strain of E. coli, the organism must be differentiated from nonpathogenic gut flora. To a limited extent, serotypic markers correlate with specific categories of diarrheagenic E. coli. However, these markers are generally not reliable by themselves to accurately identify a strain as diarrheagenic E. coli (an exception is the serotype 0157:H7, which serves as a marker for virulent Enterohemorrhagic E. coli). Serotyping has limited sensitivity and specificity, is tedious, and is performed reliably only in a small number of reference laboratories. Therefore, the detection of diarrheagenic E. coli has become increasingly dependent on identification of virulence characteristics of these organisms. This may include in vitro phenotypic assays, which correlate with the presence of specific virulence traits such as adherence, toxins, or the detection of genes encoding these traits.  1.3.2 The virulence factors in diarrheagenic Escherichia coli Like most enteric pathogens, E. coli follows a defined strategy of intestinal infection beginning with evasion of host defenses, colonization of a mucosal site, multiplication and expression of virulence factors which finally result in host damage. A highly conserved feature of  30  diarrheagenic E. coli strains is their ability to colonize the intestinal mucosal surface in the host despite the actions of peristalsis and competition for nutrients with commensal flora. The surface adherence fimbriae are present in virtually all E. coli strains, including non-pathogenic varieties. The six major categories of diarrheagenic E. coli strains are Enteropathogenic E. coli (EPEC), Enterohemorrhagic E. coli (EHEC), Enterotoxigenic E. coli (ETEC), Enteroaggregative E. coli (EAEC), Enteroinvasive E. coli (EIEC) and Diffusely adhering E. coli (DAEC) (135). This group of enteric pathogens causes diarrheal disease by a variety of mechanisms that leads to intestinal damage and pathology. Amongst diarrheagenic E. coli, the attaching and effacing (AlE) pathogens EPEC and EHEC intimately attach to the host epithelial surface and introduce effector proteins into the host through a molecular syringe-like structure known as a type three secretion system (T3SS). This approach allows them to subvert host cell functions after infection (179). An animal model of AlE bacterial pathogen has been intensively studied to elucidate the molecular mechanisms of enteric infection and intestinal inflammation (colitis) (187). Infection of mice with the Citrobacter rodentium, an A/E pathogen causes colitis and diarrhea-like disease with crypt hyperplasia, intimate attachment and effacement of microvilli in host cells. The A/E bacteria are luminal pathogens and the only group of diarrheagenic E. coli for which an animal model of colitis exists and therefore provides researchers with a model for studying enteric bacterial infection. A brief outline of ALE pathogenesis and mechanisms of diarrheagenic E. coli infection will be described here.  The hallmark of EPEC infections is the attaching-and-effacing (ALE) histopathology which can be observed on human epithelial cells. This distinctive ultra-structural lesion was first noted by Staley et al (170) and was later described in colonic biopsies from infants infected by EPEC by Ulshen and Rothbaum et al (154, 185). However, it was only following the report by 31  Moon et al (121) that the phenotype became widely associated with EPEC and the term ‘attaching-and-effacing’ was coined. Numerous studies have since confirmed the characteristic AlE phenotype in animal models (183), tissue culture cells (84) and in humans infected with EPEC (176). Examination of infected epithelial cells under the EM showed that EPEC induces profound cytoskeletal alterations including disruption of the brush border cytoskeleton and accumulation of filamentous actin beneath adherent bacteria. Effacement of microvilli and intimate adherence between the bacterium and the epithelial cell membrane are also observed. The epithelial membrane beneath the adherent bacteria is raised locally in a characteristic pedestal shape which may extend up to 10 p.m outwards from the cell surface to form pseudopod-like structures (152). An outline of EPEC infection of IECs is summarized in Figure 1.4.  Fbgdlm  EA  cS/  Bfp  \  Tflh1F11[ffhf[[fflh1 IEC  1  2  4  Figure 1.4: A model of EPEC infection of IECs. EPEC expresses Flagellin, EspA and bundle forming pilin (Bfp) filaments for initial adherence to JECs (1). The bacterial intimin is inserted into the host cell (2) membrane and serves as a receptor for binding Tir and formation of the type 32  three secretion system (T3SS) (3 and 4). EPEC effectors such as Map are introduced into the JECs and disrupt host cell function and tight junction (TJ). Actin filaments are mobilized under the bacteria during AlE lesion formation (24).  In severe infections, EPEC causes destruction of the absorptive surface of the intestinal epithelium, with extensive villus atrophy and thinning of the mucosal lining. These observations of lesion formation were crucial in identifying adherence as an important factor for EPEC pathogenesis. Knutton et al (84) proposed that a dense cluster of microfilaments in the apical cytoskeleton immediately under the attached bacteria was actin filaments. In 1979, Cravioto et al showed that 80% of the EPEC strains as defined by serotype were capable of adhering to cultured human epithelial HEp-2 cells, while most non-EPEC E. coli strains did not adhere. Prior to this observation, EPEC had been identified solely on the basis of serotyping. The HEp-2 adherence assay (34) involves inoculating the test strain on a semi-confluent HEp-2 monolayer followed by incubation for 3 hr at 37°C in 5% CO . The monolayer is then washed, fixed, 2 stained and examined by oil-immersion light microscopy. This phenotypic assay soon became one of the most useful phenotypic assays and the gold standard for the detection of diarrheagenic E. coli. Scaletsky et al showed that E. coli strains attach to HeLa cells in two different stages-(1) localized adherence (LA) in which bacteria adhere in discrete micro-colonies and (2) diffuse adherence (DA) in which bacteria adhere uniformly over the entire cell surface (162). The LA phenotype strongly correlated with EPEC serogroups isolated from patients with diarrhea and most serogroups e.g. 055,086, Olliab, 0119,0125, 0128ab and 0142 showed LA (161).  Based on the HEp-2 assay, Baldini et al showed that the ability of EPEC strain E2348/69 (0127:H6) LA pattern was associated with a 60 MDa plasmid pMAR2 (8). E2348/69 that lacked  33  pMAR2 lost the LA phenotype, whereas transfer of the plasmid to non-adherent E. coli K12 conferred adherence to HEp-2 cells (8). The term EPEC adherence factor (EAF) refers to the plasmid-mediated adhesin that conferred HEp-2 adherence. In further support of the role of the EAF plasmid in EPEC pathogenesis, E. coli strains isolated from outbreaks of infantile gastroenteritis in the United States and from stools of infants with diarrhea in Brazil almost invariably possessed the EAF plasmid (128).  A small fragment isolated from the plasmid proved to be a highly sensitive and specific DNA probe and has been used extensively in epidemiological studies to identify EPEC that contain the plasmid (33, 128). In addition, the probe revealed that HEp-2 adherence was more frequent in some 0 serogroups of EPEC than in others, designated Class I and Class II respectively. These classes are also more commonly termed typical and atypical EPEC (140). The importance of the EAF plasmid in human disease was demonstrated by the work of Levine et al in human challenge studies (95). Diarrhea occurred in 9 out of 10 volunteers who ingested the wild-type E2348/69 strain possessing the EAF plasmid; in contrast, only two of the nine volunteers who took the cured derivative showed mild symptoms of diarrhea. All volunteers who were exposed to the wild-type strain mounted an antibody response to a 94 kD membrane protein. Despite the recognition of the importance of EAF in pathogenesis, the molecular mechanism of localized adherence remained elusive for many years. In 1993, Giron et al (53) described 7 nm fimbriae that are produced by EPEC strains, which aggregated and appeared to bind bacteria together. When EPEC strains were cured of the plasmid, they failed to express the fimbriae and did not grow as adherent colonies. Moreover, antiserum against the fimbriae reduced EPEC’s ability to colonize cultured epithelial cells. These fimbriae were termed the ‘bundle-forming pilus’ (BFP) and were produced only under certain culture conditions. 34  The first stage in EPEC pathogenesis involves the initial adherence of bacteria to epithelial cells. While previous studies suggested that BFP was the initial EPEC attachment factor (54), direct evidence of this has been lacking. Recent studies have revealed that besides adherence, BFP plays a role in biofilm formation in EPEC (123). In addition to BFP, other EPEC structures such as rod-like fimbriae and fibrillae produced by EPEC strain B 171 may play a role in attachment to the host (53). Interestingly, the whip-like flagella in EPEC was also shown to mediate adherence to host epithelial cells (55), suggesting the process of LA is a complex phenomenon requiring interaction of multiple appendages on EPEC.  Enteric pathogens such as EPEC can be differentiated from the non-pathogenic strains of E.coli that are part of the intestinal flora by clusters of genes known as pathogenicity islands, such as the locus of enterocyte effacement (LEE) in EPEC (113). The LEE of EPEC strain E2348/69 (0127:H6) when cloned into E. coli K12, leads to attaching and effacing lesions, providing evidence that the LEE is a functional gene cassette that is both necessary and sufficient for EPEC virulence (114). The complete sequence of the LEE in EPEC strain 2348/69, showed that the LEE contains 41 open reading frames (ORFs) arranged in five polycistronic operons LEE1 to LEE5 (40). These genes are separated into three functional domains  —  a region that  encodes intimate adherence (Tir and intimin), a region encoding the EPEC secreted proteins (including EspA, EspB, EspD and EspF) and their putative chaperones and the region encoding a type III secretion system.  The discovery that EPEC secreted a number of proteins directly into host cells was an important milestone in EPEC pathogenesis. These proteins known as Esp (EPEC secreted proteins) are introduced via a type-three secretion (T3SS) system (79, 80). The T3SS secretion  35  apparatus is found in many enteric pathogens; it acts as a macromolecular syringe to inject effector proteins directly into host cells and is involved in virulence (169). Several studies have investigated the effector proteins secreted by EPEC and their identification is based on homology  with other T3SS. There are 12 LEE-encoded genes (termed esc or sep) currently known to be involved in T3SS biogenesis (40). The secretion of specific proteins, including Tir, EspA, EspB and EspD which are essential for the subversion of host cell signal transduction pathways and the formation of A/E lesions (24). Several studies in cultured epithelial cells and animal models have examined the role of other EPEC effector proteins that alter cellular functions and contribute to EPEC pathogenesis. A summary of virulence factors and their putative functions in EPEC infection are listed in Table 1.1.  Host responses to EPEC infection were initially investigated by infecting epithelial cells with different strains of EPEC by Klapproth et al in 1995 (83). Later work by Savkovic et al revealed that EPEC induced IL-8 secretion from cultured IEC involved NF-icB activation (158, 159). These authors also demonstrated that EPEC activation of the MAP kinase pathway involving ERK was required for the resulting inflammatory response but not for tight junction barrier disruption (160). Further studies suggested that EPEC induced IL-8 secretion required activation of MAP kinases, p38, ERK and JNK and was dependent on the T3SS (27, 32). The above studies collectively indicated that the EPEC T3SS played an important role in stimulating pro-inflammatory responses by stimulating MAP kinase pathways in host epithelial cells during direct infection.  36  Table 1.1: List of virulence factors described in EPEC.  Virulence factor  Encoding region  Function  Reference  -Type 1 fimbrae  fim operon  (150)  -Type TV pilus (Bfp) -OmpA -Epec Adh.fact. (Efa) -Flagellin  EAF plasmid ompA lifA fliC  Adherence to mannose glycoprotein Initial LA adherence Mediates adherence Motility & adherence  1. Adhesins:  (54) (178) (7) (55)  2. LEE encoded -Intimin -TIR  eae (LEE5) tir (LEE5)  -Map  map (LEES)  -EspF  espF (LEE4)  -EspH -EspG -EspZ (SepZ)  espH(LEE3) espG(LEE]) sepZ (LEE2)  Intimate attachment Intimate attachment, A/E lesion, Actin polymerization Disruption of TER, Mitochondrial func. Disruption of TER, Mitochond. Potential cell death Cytoskeletal changes Cytoskeletal changes Unknown  (35, 85) (139)  (115) (181)  (39) (75)  3. Non-LEE coded -Secreted ser. Protease  espC  Tight junction disrupt.  (171)  -Cycle inhibit fact. (Cif) -EspIJNleA  cf (lambdoid phage)  Mucinase,  (106)  espl  Cytomodulin  (125)  -N1eCID  nieC/nieD  (107)  -EspJ  espJ  Unknown, localizes to golgi apparatus Inhibits phagocytosis  37  (105)  The role of bacterial flagellin in enteric infection assumed importance by the finding that EAEC, which causes traveler’s diarrhea, produced a novel flagellin that induced IL-8 secretion from human IEC (172). This finding significantly advanced our understanding of host responses because it suggested that bacterial flagellin isolated from the whole EAEC was capable of inducing host responses, in the absence of the bacteria. The relevance of this finding in enteric infections was significant because it meant that the host was capable of sensing shed bacterial products well before bacteria made close contact with epithelial surfaces. Since this discovery, the role of flagellin in innate responses to flagellated pathogens has been intensively investigated by researchers.  It is now accepted that flagellin is critical in inducing early pro-inflammatory responses against important enteric pathogens that cause diarrheal illness including Salmonella (147),  Vibrio cholera (58) and some diarrheagenic E. coli such as DAEC (5). Iii contrast, flagellin does not appear to be a major pro-inflammatory factor for other enteric pathogens like Shigella, Campylobacter and Clostridium difficile, even though flagellin expression in these bacteria has been documented (52, 56, 175). Amongst attaching and effacing pathogens, a pro-inflammatory role for flagellin was first described for the EHEC 0157:117 strain, a known cause of hemorrhagic colitis and associated with the consumption of undercooked beef in developed countries (12). EHEC elaborates the shiga toxin (Stx) which led to coining of the term STEC (Shiga toxin producing E. coli). Some groups reported that Stx is an important pro-inflammatory factor during EHEC infection of IEC (177, 209). The relative contributions of flagellin and Stx in chemokine responses in IEC had remained controversial until Berm C et al clarified that pro inflammatory responses induced by EHEC did not involve shiga toxin or intimin and instead  38  required H7 flagellin. This finding was validated by Miyamoto Y et al by direct comparison of Stx and flagellin responses in human colonic xenografts and IECs (120).  Initial studies of IECs responses to EPEC infection suggested a role for intimin and the T3SS apparatus in MAP kinase activation and IL-8 secretion (27). Simultaneously, assessment of host responses by gene array analysis identified the expression of early growth response transcription factor (Egr-1) in HeLa cells infected with EPEC that was dependent on the T3SS (32). These findings indicated a rolefor the T3SS in pro-inflammatory responses leading to IL-8 secretion from human IECs. Later, it was shown that EPEC infection of human IECs also resulted in flagellin dependent IL-8 release (212). Since expression of flagellin in EPEC likely occurs prior to intimate attachment, the roles of flagellin and T3SS remained unresolved in EPEC infection of TECs. Furthermore, it is unknown if EPEC infection can elicit other innate responses besides the neutrophil chemokine IL-8, so that other immune cells such as DCs and macrophages are recruited to combat EPEC infection in the human G1T.  1.4 Objectives Gram negative enteric pathogens express several factors that enable colonization, adherence and infection of the intestinal mucosa. The role of specific virulence factors such as flagellin and the T3SS in attaching and effacing pathogens such as EPEC is not clear. Furthermore, how innate responses are dampened in the host cells after the resolution of enteric infection has not been examined in human IECs. While some studies have suggested that flagellin from EPEC is critical for initial recognition, the role of the T3SS in chemokine responses has not been clearly defined. It is important to clarify the role of the T3SS as AlE pathogens become immotile during attachment, and deliver effector proteins through the T3SS  39  into IECs. Furthermore, the mouse adapted A/E pathogen Citrobacter rodentium (CR), possesses virulence genes with homology to human EPEC and leads to acute colitis. While CR is believed to be immotile, it is unknown if it expresses flagellin, although it does stimulate IL-8 secretion from TECs, as described in EPEC and EHEC infection. Enteric infection with CR was shown to involve DCs, macrophages as well as moderate neutrophil recruitment in the intestinal tissues (21, 168). Whether EPEC infection also leads to the release of chemokines that potentially attract DCs and macrophages to the site of infection has not been examined. While JEC respond to flagellin, they are generally believed to be hypo responsive to LPS and do not express important co-receptors such as MD-2 and CD14 (1). The hyporesponsiveness of JEC is critical in the maintenance of intestinal homeostasis and the tolerance of commensal bacteria. Since JECs express other innate TLR5 and TLR9, it is not known how the activation and signaling of these specific receptors is regulated in epithelial cells. In part, this may depend on the expression of negative regulators such as Sigirr, which is known to inhibit TLR4 and IL-13 responses (165).  1.5 Hypothesis and aims 1.5.1 Hypothesis: Innate responses to attaching and effacing EPEC infection is initiated by flagellin stimulation of TLR5 and regulated by single IgG IL-i related receptor (Sigirr) in human intestinal epithelial cells. 1.5.2 Specific aim 1: To determine the role of flagellin and TLR5 in A/E bacterial infections. This project will assess the ability of EPEC and Cr to induce interleukin (IL)-8 secretion from TLR5 expressing Caco-2 colonic epithelial cells that are generally non-responsive to LPS, as well as CHO cells transiently expressing TLR5. We will generate EPEC and CR mutants deficient in flagellin production (tXfliC) in our laboratory and examine their ability to induce IL-8 40  secretion, in comparison to the responses seen following infection with WT strains. To ensure that the observed responses are TLR-dependent, signaling via IRAK and NF-iB will be assessed by immunoblotting and luciferase reporter assay. While IEC release IL-8 after flagellin exposure, we will assess whether TLR5 recognition of flagellin also induces expression of other genes, such as inducible nitric oxide synthase, and other chemokines and antimicrobial peptides. The expression of these genes will be measured in IECs infected with WT and compared with the response to flagellin deficient bacteria. Finally, a role for TLR5 and flagellin recognition has yet to be demonstrated in colitis, we have an opportunity to address this role using the CR model of infectious colitis to assess the potential role of flagellin in a model of in vivo enteric infection.  1.5.3 Specific aim 2. To investigate the role of SIGIRR as a negative regulator of toll-like receptor responses in intestinal epithelial cells. Once we have characterized the innate epithelial response to A/E bacteria, we will evaluate the impact of SIGIRR on these responses, which is known to interact with several TLRs including TLR4 and TLR9. While SIGIRR suppresses TLR4-LPS signaling, its effect on TLR5 activation has not been tested. First, we will examine whether flagellin activation of TLR5 alters SIGIRR expression during IL-8 secretion from Caco 2 cells. The specificity of this response will be evaluated using neutralizing antibodies to TLR5. Using SiRNA, we will assess whether reducing SIGIRR expression enhances IEC innate responses, testing TLR5 and other TLRs critical in epithelial host defense. Lastly, since SIGIRR mRNA is strongly expressed in epithelial cells, we will analyze Sigirr protein expression by  western analysis and immunocytochemistry in transformed and non transformed human intestinal cell lines. The clinical relevance of Sigirr will be further examined by immunohistochemistry in human colonic biopsy sections to clarify its potential functions in the human intestine.  41  1.6 References: 1. 2.  3.  4.  5.  6. 7.  8.  9.  10.  11.  12.  13.  Abreu, M. T., M. Fukata, and M. Arditi. 2005. TLR signaling in the gut in health and disease. J Immunol 174:4453-4460. Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, and M. Arditi. 2001. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol 167:1609-1616. Adib-Conquy, M., C. Adrie, C. Fitting, 0. Gattolliat, R. Beyaert, and J. M. Cavaillon. 2006. Up-regulation of MyD88s and SIGIRR, molecules inhibiting Toll-like receptor signaling, in monocytes from septic patients. Crit Care Med 34:2377-2385. Andreu, P., S. Colnot, C. Godard, S. Gad, P. Chafey, M. Niwa-Kawakita, P. Laurent Puig, A. Kahn, S. Robine, C. Perret, and B. Romagnolo. 2005. Crypt-restricted proliferation and commitment to the Paneth cell lineage following Apc loss in the mouse intestine. Development 132:1443-1451. Arikawa, K., I. M. Meraz, Y. Nishikawa, J. Ogasawara, and A. Hase. 2005. Interleukin-8 secretion by epithelial cells infected with diffusely adherent Escherichia coli possessing Afa adhesin-coding genes. Microbiol Immunol 49:493-503. Artis, D. 2008. Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat Rev Immunol 8:411-420. Badea, L., S. Doughty, L. Nicholls, J. Sloan, R. M. Robins-Browne, and E. L. Hartland. 2003. Contribution of Efal/LifA to the adherence of enteropathogenic Escherichia coli to epithelial cells. Microb Pathog 34:205-215. Baldini, M. M., J. B. Kaper, M. M. Levine, D. C. Candy, and H. W. Moon. 1983. Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J Pediatr Gastroenterol Nutr 2:534-538. Bambou, J. C., A. Giraud, S. Menard, B. Begue, S. Rakotobe, M. Heyman, F. Taddei, N. Cerf-Bensussan, and V. Gaboriau-Routhiau. 2004. In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain. J Biol Chem 279:42984-42992. Bamich, N., T. Hisamatsu, J. E. Aguirre, R. Xavier, H. C. Reinecker, and D. K. Podolsky. 2005. GRIM- 19 interacts with nucleotide oligomerization domain 2 and serves as downstream effector of anti-bacterial function in intestinal epithelial cells. J Biol Chem 280: 19021-19026. Batliwalla, F. M., W. Li, C. T. Ritchlin, X. Xiao, M. Brenner, T. Laragione, T. Shao, R. Durham, S. Kemshetti, E. Schwarz, R. Coe, M. Kern, E. C. Baechler, T. W. Behrens, P. K. Gregersen, and P. 5. Gulko. 2005. Microarray analyses of peripheral blood cells identifies unique gene expression signature in psoriatic arthritis. Mol Med 11:21-29. Ben M. C., A. Darfeuille-Michaud, L. J. Egan, Y. Miyamoto, and M. F. Kagnoff. 2002. Role of EHEC 0157:H7 virulence factors in the activation of intestinal epithelial cell NF kappaB and MAP kinase pathways and the upregulated expression of interleukin 8. Cell Microbiol 4:635-648. Berrebi, D., R. Maudinas, J. P. Hugot, M. Chamaillard, F. Chareyre, P. De Lagausie, C. Yang, P. Desreumaux, M. Giovannini, J. P. Cezard, H. Zouali, D. Emilie, and M. Peuchmaur. 2003. Card 15 gene overexpression in mononuclear and epithelial cells of the inflamed Crohn’s disease colon. Gut 52:840-846. 42  14. 15.  16.  17.  18.  19. 20.  21.  22. 23.  24. 25. 26.  27.  28. 29.  Blikslager, A. T., A. J. Moeser, J. L. Gookin, S. L. Jones, and J. Odle. 2007. Restoration of barrier function in injured intestinal mucosa. Physiol Rev 87:545-564. Brown, S. L., T. E. Riehl, M. R. Walker, M. J. Geske, J. M. Doherty, W. F. Stenson, and T. S. Stappenbeck. 2007. Myd88-dependent positioning of Ptgs2-expressing stromal cells maintains colonic epithelial proliferation during injury. J Clin Invest 117:258-269. Burdelya, L. G., V. I. Krivokrysenko, T. C. Tallant, E. Strom, A. S. Gleiberman, D. Gupta, 0. V. Kurnasov, F. L. Fort, A. L. Osterman, J. A. Didonato, E. Feinstein, and A. V. Gudkov. 2008. An agonist of toll-like receptor 5 has radioprotective activity in mouse and primate models. Science 320:226-230. Cario, E., D. Brown, M. McKee, K. Lynch-Devaney, G. Gerken, and D. K. Podolsky. 2002. Commensal-associated molecular patterns induce selective toll-like receptortrafficking from apical membrane to cytoplasmic compartments in polarized intestinal epithelium. Am J Pathol 160:165-173. Cario, E., I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H. C. Reinecker, and D. K. Podoisky. 2000. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J lirimunol 164:966-972. Carneiro, L. A., J. G. Magalhaes, I. Tattoli, D. J. Philpott, and L. H. Travassos. 2008. Nod-like proteins in inflammation and disease. J Pathol 214:136-148. Chamaillard, M., M. Hashimoto, Y. Hone, J. Masumoto, S. Qiu, L. Saab, Y. Ogura, A. Kawasaki, K. Fukase, S. Kusumoto, M. A. Valvano, S. J. Foster, T. W. Mak, G. Nunez, and N. Inohara. 2003. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat Immunol 4:702-707. Chen, C. C., S. Louie, B. A. McCormick, W. A. Walker, and H. N. Shi. 2006. Helminth primed dendritic cells alter the host response to enteric bacterial infection. J Immunol 176:472-483. Chin, A. C., and C. A. Parkos. 2007. Pathobiology of neutrophil transepithelial migration: implications in mediating epithelial injury. Annu Rev Pathol 2:111-143. Clarke, M. B., and V. Sperandio. 2005. Events at the host-microbial interface of the gastrointestinal tract III. Cell-to-cell signaling among microbial flora, host, and pathogens: there is a whole lot of talking going on. Am J Physiol Gastrointest Liver Physiol 288:G1 105-1109. Clarke, S. C., R. D. Haigh, P. P. Freestone, and P. H. Williams. 2003. Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin Microbiol Rev 16:365-378. Coyne, M. J., B. Rem, M. M. Lee, and L. E. Comstock. 2005. Human symbionts use a host-like pathway for surface fucosylation. Science 307:1778-1781. Cuadras, M. A., and H. B. Greenberg. 2003. Rotavirus infectious particles use lipid rafts during replication for transport to the cell surface in vitro and in vivo. Virology 3 13:308321. Czerucka, D., S. Dahan, B. Mograbi, B. Rossi, and P. Rampal. 2001. Implication of mitogen-activated protein kinases in T84 cell responses to enteropathogenic Escherichia coli infection. Infect Immun 69:1298-1305. Danielsen, E. M., and G. H. Hansen. 2006. Lipid raft organization and function in brush borders of epithelial cells. Mol Membr Biol 23:71-79. Danielsen, E. M., and G. H. Hansen. 2003. Lipid rafts in epithelial brush borders: atypical membrane microdomains with specialized functions. Biochim Biophys Acta 1617:1-9.  43  30. 31.  32.  33. 34. 35.  36.  37. 38.  39.  40.  41.  42.  43. 44.  Dann, S. M., and L. Eckmann. 2007. Innate immune defenses in the intestinal tract. Curr Opin Gastroenterol 23:115-120. Darfeuille-Michaud, A., J. Boudeau, P. Bulois, C. Neut, A. L. Giasser, N. Barnich, M. A. Bringer, A. Swidsinski, L. Beaugerie, and J. F. Colombel. 2004. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohns disease. Gastroenterology 127:412-421. de Grado, M., C. M. Rosenberger, A. Gauthier, B. A. Valiance, and B. B. Finlay. 2001. Enteropathogenic Escherichia coli infection induces expression of the early growth response factor by activating mitogen-activated protein kinase cascades in epithelial cells. Infect Immun 69:6217-6224. Donnenberg, M. S., and J. B. Kaper. 1992. Enteropathogenic Escherichia coli. Infect Immun 60:3953-396 1. Donnenberg, M. S., and J. P. Nataro. 1995. Methods for studying adhesion of diarrheagenic Escherichia coli. Methods Enzymol 253:324-336. Donnenberg, M. S., C. 0. Tacket, S. P. James, G. Losonsky, J. P. Nataro, S. S. Wasserman, J. B. Kaper, and M. M. Levine. 1993. Role of the eaeA gene in experimental enteropathogenic Escherichia coli infection. J Clin Invest 92:1412-1417. Dubuquoy, L., E. A. Jansson, S. Deeb, S. Rakotobe, M. Karoui, J. F. Colombel, J. Auwerx, S. Pettersson, and P. Desreumaux. 2003. Impaired expression of peroxisome proliferator-activated receptor gamma in ulcerative colitis. Gastroenterology 124:12651276. Duncan, M. J., J. S. Shin, and S. N. Abraham. 2002. Microbial entry through caveolae: variations on a theme. Cell Microbiol 4:783-79 1. Dyer, J., K. Daly, K. S. Salmon, D. K. Arora, Z. Kokrashvili, R. F. Margoiskee, and S. P. Shirazi-Beechey. 2007. Intestinal glucose sensing and regulation of intestinal glucose absorption. Biochem Soc Trans 35:1191-1194. Elliott, S. J., E. 0. Krejany, J. L. Mellies, R. M. Robins-Browne, C. Sasakawa, and J. B. Kaper. 2001. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect Immun 69:40274033. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng, L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol Microbiol 28:1-4. Feldman, M., R. Bryan, S. Rajan, L. Scheffler, S. Brunnert, H. Tang, and A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection. Infect Immun 66:43-5 1. Feng, J., 0. N. El-Assal, and G. E. Besner. 2006. Heparin-binding epidermal growth factor-like growth factor reduces intestinal apoptosis in neonatal rats with necrotizing enterocolitis. J Pediatr Surg 4 1:742-747; discussion 742-747. Fogh, J., W. C. Wright, and J. D. Loveless. 1977. Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J Natl Cancer Inst 58:209-2 14. Furuse, M., T. Hirase, M. Itoh, A. Nagafuchi, S. Yonemura, S. Tsukita, and S. Tsukita. 1993. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 123:1777-1788.  44  45. 46.  47.  48. 49.  50.  51.  52. 53. 54. 55.  56. 57. 58.  59.  60.  Ganz, T. 2003. Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 3:710-720. Garlanda, C., D. Di Liberto, A. Vecchi, M. P. La Manna, C. Buracchi, N. Caccamo, A. Salerno, F. Dieli, and A. Mantovani. 2007. Damping excessive inflammation and tissue damage in Mycobacterium tuberculosis infection by Toll IL-i receptor 8/single Ig IL-irelated receptor, a negative regulator of IL-1/TLR signaling. J Immunol 179:3 1 19-3 125. Gaudier, E., A. Jarry, H. M. Blottiere, P. de Coppet, M. P. Buisine, J. P. Aubert, C. Laboisse, C. Cherbut, and C. Hoebler. 2004. Butyrate specifically modulates MUC gene expression in intestinal epithelial goblet cells deprived of glucose. Am J Physiol Gastrointest Liver Physiol 287:G1168-1174. Gill, H. S. 2003. Probiotics to enhance anti-infective defences in the gastrointestinal tract. Best Pract Res Clin Gastroenterol 17:755-773. Girardin, S. E., I. G. Boneca, L. A. Carneiro, A. Antignac, M. Jehanno, J. Viala, K. Tedin, M. K. Taha, A. Labigne, U. Zahringer, A. J. Coyle, P. 5. DiStefano, J. Bertin, P. J. Sansonetti, and D. J. Philpott. 2003. Nodi detects a unique muropeptide from gramnegative bacterial peptidoglycan. Science 300:1584-1587. Girardin, S. E., M. Jehanno, D. Mengin-Lecreulx, P. J. Sansonetti, P. M. Aizari, and D. J. Philpott. 2005. Identification of the critical residues involved in peptidoglycan detection by Nodi. J Biol Chem 280:38648-38656. Girardin, S. E., R. Tournebize, M. Mavris, A. L. Page, X. Li, G. R. Stark, J. Bertin, P. S. DiStefano, M. Yaniv, P. J. Sansonetti, and D. J. Philpott. 2001. CARD4INod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2:736-742. Giron, J. A. 1995. Expression of flagella and motility by Shigella. Mol Microbiol 18:6375. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1993. Characterization of fimbriae produced by enteropathogenic Escherichia coli. 3 Bacteriol 175:7391-7403. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1991. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science 254:710-713. Giron, J. A., A. G. Torres, E. Freer, and J. B. Kaper. 2002. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol 44:361-379. Guerry, P. 2007. Campylobacter flagella: not just for motility. Trends Microbiol 15:456461. Harmon, E. B., A. H. Ko, and S. K. Kim. 2002. Hedgehog signaling in gastrointestinal development and disease. Cuff Mol Med 2:67-82. Harrison, L. M., P. Rallabhandi, J. Michaiski, X. Zhou, S. R. Steyert, S. N. Vogel, and J. B. Kaper. 2008. Vibrio cholerae flagellins induce Toll-like receptor 5-mediated interleukin-8 production through mitogen-activated protein kinase and NF-kappaB activation. Infect Immun 76:5524-5534. Hatayama, H., J. Iwashita, A. Kuwajima, and T. Abe. 2007. The short chain fatty acid, butyrate, stimulates MUC2 mucin production in the human colon cancer cell line, LS 174T. Biochem Biophys Res Commun 3 56:599-603. Heine, M., C. I. Cramm-Behrens, A. Ansari, H. P. Chu, A. G. Ryazanov, H. Y. Naim, and R. Jacob. 2005. Aipha-kinase 1, a new component in apical protein transport. J Biol Chem 280:25637-25643.  45  61.  62.  63.  64. 65.  66.  67.  68.  69.  70. 71.  72.  73. 74.  75.  Hershberg, R. M. 2002. The epithelial cell cytoskeleton and intracellular trafficking. V. Polarized compartmentalization of antigen processing and Toll-like receptor signaling in intestinal epithelial cells. Am I Physiol Gastrointest Liver Physiol 283:G833-839. Hisamatsu, T., M. Suzuki, H. C. Reinecker, W. J. Nadeau, B. A. McCormick, and D. K. Podoisky. 2003. CARD15JNOD2 functions as an antibacterial factor in human intestinal epithelial cells. Gastroenterology 124:993-1000. Ho, S. B., L. A. Dvorak, R. E. Moor, A. C. Jacobson, M. R. Frey, J. Corredor, D. B. Polk, and L. L. Shekels. 2006. Cysteine-rich domains of muc3 intestinal mucin promote cell migration, inhibit apoptosis, and accelerate wound healing. Gastroenterology 131:150115 17. Hoffmann, E., 0. Dittrich-Breiholz, H. Holtmann, and M. Kracht. 2002. Multiple control of interleukin-8 gene expression. J Leukoc Biol 72:847-855. Hooper, L. V., M. H. Wong, A. Thelin, L. Hansson, P. G. Falk, and J. I. Gordon. 2001. Molecular analysis of commensal host-microbial relationships in the intestine. Science 291:881-884. Hornef, M. W., B. H. Normark, A. Vandewalle, and S. Normark. 2003. Intracellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells. J Exp Med 198:1225-1235. Huang, X., L. D. Hazlett, W. Du, and R. P. Barrett. 2006. SIGIRR promotes resistance against Pseudomonas aeruginosa keratitis by down-regulating type- 1 immunity and IL iRl and TLR4 signaling. I Immunol 177:548-556. fluet, C., C. Sahuquillo-Merino, B. Coudrier, and D. Louvard. 1987. Absorptive and mucus-secreting subclones isolated from a multipotent intestinal cell line (HT-29) provide new models for cell polarity and terminal differentiation. J Cell Biol 105:345357. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Cezard, J. Belaiche, S. Almer, C. Tysk, C. A. OMorain, M. Gassull, V. Binder, Y. Finkel, A. Cortot, R. Modigliani, P. Laurent-Puig, C. Gower-Rousseau, J. Macry, J. F. Colombel, M. Sahbatou, and G. Thomas. 2001. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature 411:599-603. Inohara, N., and G. Nunez. 2003. NODs: intracellular proteins involved in inflammation and apoptosis. Nat Rev Immunol 3:37 1-382. Ireland, H., R. Kemp, C. Houghton, L. Howard, A. R. Clarke, 0. J. Sansom, and D. J. Winton. 2004. Inducible Cre-mediated control of gene expression in the murine gastrointestinal tract: effect of loss of beta-catenin. Gastroenterology 126:1236-1246. Iwami, K. I., T. Matsuguchi, A. Masuda, T. Kikuchi, T. Musikacharoen, and Y. Yoshikai. 2000. Cutting edge: naturally occurring soluble form of mouse Toll-like receptor 4 inhibits lipopolysaccharide signaling. J Immunol 165:6682-6686. Janeway, C. A., Jr. 1993. How the immune system recognizes invaders. Sci Am 269:7279. Jeschke, M. G., and D. N. Herndon. 2007. The combination of IGF-I and KGF cDNA improves dermal and epidermal regeneration by increased VEGF expression and neovascularization. Gene Ther 14:1235-1242. Kanack, K. J., J. A. Crawford, I. Tatsuno, M. A. Karmali, and J. B. Kaper. 2005. SepZ/EspZ is secreted and translocated into HeLa cells by the enteropathogenic Escherichia coli type III secretion system. Infect Immun 73:4327-4337. 46  76.  77. 78.  79.  80.  81.  82.  83.  84.  85.  86.  87.  88.  89.  Kansau, I., C. Berger, M. Hospital, R. Amsellem, V. Nicolas, A. L. Servin, and M. F. Bernet-Camard. 2004. Zipper-like internalization of Dr-positive Escherichia coli by epithelial cells is preceded by an adhesin-induced mobilization of raft-associated molecules in the initial step of adhesion. Infect Immun 72:3733-3742. Kawai, T., and S. Akira. 2007. TLR signaling. Semin Immunol 19:24-32. Kelly, D., J. I. Campbell, T. P. King, G. Grant, E. A. Jansson, A. G. Coutts, S. Pettersson, and S. Conway. 2004. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and Re1A. Nat Immunol 5:104-112. Kenny, B., and B. B. Finlay. 1995. Protein secretion by enteropathogenic Escherichia coli is essential for transducing signals to epithelial cells. Proc Nati Acad Sci U S A 92:799 17995. Kenny, B., L. C. Lai, B. B. Finlay, and M. S. Donnenberg. 1996. EspA, a protein secreted by enteropathogenic Escherichia coli, is required to induce signals in epithelial cells. Mol Microbiol 20:313-323. Kim, J. G., S. J. Lee, and M. F. Kagnoff. 2004. Nodi is an essential signal transducer in intestinal epithelial cells infected with bacteria that avoid recognition by toll-like receptors. Infect Immun 72: 1487-1495. Kinjyo, I., T. Hanada, K. Inagaki-Ohara, H. Mori, D. Aki, M. Ohishi, H. Yoshida, M. Kubo, and A. Yoshimura. 2002. SOCS 1/JAB is a negative regulator of LPS-induced macrophage activation. Immunity 17:583-591. Klapproth, J. M., M. S. Donnenberg, J. M. Abraham, H. L. Mobley, and S. P. James. 1995. Products of enteropathogenic Escherichia coli inhibit lymphocyte activation and lymphokine production. Infect Immun 63:2248-2254. Knutton, S., D. R. Lloyd, and A. S. McNeish. 1987. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect Immun 55:69-77. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, 6. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. Embo J 17:2166-2176. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr., R. Medzhitov, and R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-like receptor signaling. Cell 110:191-202. Kobayashi, K. S., M. Chamaillard, Y. Ogura, 0. Henegariu, N. Inohara, G. Nunez, and R. A. Flavell. 2005. Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307:731-734. Kramer, M., M. G. Netea, D. J. de Jong, B. J. Kullberg, and 6. J. Adema. 2006. Impaired dendritic cell function in Crohn’s disease patients with NOD2 3O2OinsC mutation. J Leukoc Biol 79:860-866. Kuhnert, F., C. R. Davis, H. T. Wang, P. Chu, M. Lee, I. Yuan, R. Nusse, and C. J. Kuo. 2004. Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf- 1. Proc Natl Acad Sci U S A 101:266-27 1.  47  90.  91.  92. 93.  94.  95. 96.  97.  98.  99.  100. 101. 102.  103.  104.  105.  Lala, S., Y. Ogura, C. Osborne, S. Y. Hor, A. Bromfield, S. Davies, 0. Ogunbiyi, 0. Nunez, and S. Keshav. 2003. Crohn’s disease and the NOD2 gene: a role for paneth cells. Gastroenterology 125:47-57. Lee, J., J. H. Mo, K. Katakura, I. Alkalay, A. N. Rucker, Y. T. Liu, H. K. Lee, C. Shen, 0. Cojocaru, S. Shenouda, M. Kagnoff, L. Eckmann, Y. Ben-Neriah, and E. Raz. 2006. Maintenance of colonic homeostasis by distinctive apical TLR9 signalling in intestinal epithelial cells. Nat Cell Biol 8:1327-1336. Lee, M. S., and Y. J. Kim. 2007. Signaling pathways downstream of pattern-recognition receptors and their cross talk. Annu Rev Biochem 76:447-480. Lees, C., S. Howie, R. B. Sartor, and J. Satsangi. 2005. The hedgehog signalling pathway in the gastrointestinal tract: implications for development, homeostasis, and disease. Gastroenterology 129:1696-1710. Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, and J. A. Hoffmann. 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86:973-983. Levine, M. M. 1985. Escherichia coli infections. N Engl J Med 3 13:445-447. Li, J., T. Moran, E. Swanson, C. Julian, J. Harris, D. K. Bonen, M. Hedl, D. L. Nicolae, C. Abraham, and J. H. Cho. 2004. Regulation of IL-8 and IL-ibeta expression in Crohns disease associated NOD2/CARD15 mutations. Hum Mol Genet 13:17 15-1725. Li, X., S. Leu, A. Cheong, H. Zhang, B. Baibakov, C. Shih, M. J. Birnbaum, and M. Donowitz. 2004. Akt2, phosphatidylinositol 3-kinase, and PTEN are in lipid rafts of intestinal cells: role in absorption and differentiation. Gastroenterology 126:122-135. Liang, S., M. Wang, R. I. Tapping, V. Stepensky, H. F. Nawar, M. Triantafilou, K. Triantafilou, T. D. Connell, and G. Hajishengallis. 2007. Ganglioside GD1a is an essential coreceptor for Toll-like receptor 2 signaling in response to the B subunit of type fib enterotoxin. J Biol Chem 282:7532-7542. Lievin-Le Moal, V., and A. L. Servin. 2006. The front line of enteric host defense against unwelcome intrusion of harmful microorganisms: mucins, antimicrobial peptides, and microbiota. Clin Microbiol Rev 19:315-337. Liew, F. Y., D. Xu, E. K. Brint, and L. A. O’Neill. 2005. Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 5:446-458. Logan, C. Y., and R. Nusse. 2004. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20:781-810. Maeda, S., L. C. Hsu, H. Liu, L. A. Bankston, M. limura, M. F. Kagnoff, L. Eckmann, and M. Karin. 2005. Nod2 mutation in Crohn’s disease potentiates NF-kappaB activity and IL- lbeta processing. Science 307:734-738. Magalhaes, J. G., D. J. Philpott, M. A. Nahori, M. Jehanno, I. Fritz, L. Le Bourhis, J. Viala, J. P. Hugot, M. Giovannini, J. Bertin, M. Lepoivre, D. Mengin-Lecreulx, P. J. Sansonetti, and S. E. Girardin. 2005. Murine Nodi but not its human orthologue mediates innate immune detection of tracheal cytotoxin. EMBO Rep 6:1201-1207. Magalhaes, J. G., I. Tattoli, and S. E. Girardin. 2007. The intestinal epithelial barrier: how to distinguish between the microbial flora and pathogens. Semin Immunol 19:106115. Marches, 0., V. Covarelli, S. Dahan, C. Cougoule, P. Bhatta, G. Frankel, and B. Caron. 2008. EspJ of enteropathogenic and enterohaemorrhagic Escherichia coli inhibits opsono phagocytosis. Cell Microbiol 10:1104-1115. 48  106.  107.  108.  109. 110.  111.  112. 113.  114.  115.  116.  117. 118.  119.  Marches, 0., T. N. Ledger, M. Boury, M. Ohara, X. Tu, F. Goffaux, J. Mainil, I. Rosenshine, M. Sugai, J. De Rycke, and E. Oswald. 2003. Enteropathogenic and enterohaemorrhagic Escherichia coli deliver a novel effector called Cif, which blocks cell cycle G2/M transition. Mol Microbiol 50: 1553-1567. Marches, 0., S. Wiles, F. Dziva, R. M. La Ragione, S. Schuller, A. Best, A. D. Phillips, E. L. Hartland, M. J. Woodward, M. P. Stevens, and G. Frankel. 2005. Characterization of two non-locus of enterocyte effacement-encoded type Ill-translocated effectors, N1eC and N1eD, in attaching and effacing pathogens. Infect Immun 73:8411-8417. Marks, D. J., M. W. Harbord, R. MacAllister, F. Z. Rahman, J. Young, B. Al-Lazikani, W. Lees, M. Novelli, S. Bloom, and A. W. Segal. 2006. Defective acute inflammation in Crohn’s disease: a clinical investigation. Lancet 367:668-678. Marshman, E., C. Booth, and C. S. Potten. 2002. The intestinal epithelial stem cell. Bioessays 24:91-98. Martin-Padura, I., S. Lostaglio, M. Schneemann, L. Williams, M. Romano, P. Fruscella, C. Panzeri, A. Stoppacciaro, L. Ruco, A. Villa, D. Simmons, and E. Dejana. 1998. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. I Cell Biol 142:117-127. Masumoto, I., K. Yang, S. Varambally, M. Hasegawa, S. A. Tomlins, S. Qiu, Y. Fujimoto, A. Kawasaki, S. J. Foster, Y. Hone, T. W. Mak, G. Nunez, A. M. Chinnaiyan, K. Fukase, and N. Inohara. 2006. Nod 1 acts as an intracellular receptor to stimulate chemokine production and neutrophil recruitment in vivo. J Exp Med 203:203-213. McCole, D. F., and K. E. Barrett. 2007. Varied role of the gut epithelium in mucosal homeostasis. Curr Opin Gastroenterol 23:647-654. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci U S A 92:1664-1668. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on B. coli K-12. Mol Microbiol 23:399-407. McNamara, B. P., and M. S. Donnenberg. 1998. A novel proline-rich protein, EspF, is secreted from enteropathogenic Escherichia coli via the type III export pathway. FEMS Microbiol Lett 166:71-78. Medvedev, A. E., A. Lentschat, L. M. Wahl, D. T. Golenbock, and S. N. Vogel. 2002. Dysregulation of LPS-induced Toll-like receptor 4-MyD88 complex formation and IL-i receptor-associated kinase 1 activation in endotoxin-tolerant cells. J Immunol 169:520952 16. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394-397. Melmed, G., L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, Y. Zhou, B. Hu, M. Arditi, and M. T. Abreu. 2003. Human intestinal epithelial cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands: implications for host microbial interactions in the gut. J Immunol 170: 1406-1415. Mitic, L. L., C. M. Van Itallie, and J. M. Anderson. 2000. Molecular physiology and pathophysiology of tight junctions I. Tight junction structure and function: lessons from mutant animals and proteins. Am J Physiol Gastrointest Liver Physiol 279:G250-254. 49  120.  121.  122. 123.  124. 125.  126.  127. 128.  129. 130. 131.  132. 133.  134. 135. 136.  Miyamoto, Y., M. limura, J. B. Kaper, A. 0. Torres, and M. F. Kagnoff. 2006. Role of Shiga toxin versus H7 flagellin in enterohaemorrhagic Escherichia coli signalling of human colon epithelium in vivo. Cell Microbiol 8:869-879. Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Giannella. 1983. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect Immun 41:1340-1351. Mooseker, M. S. 1985. Organization, chemistry, and assembly of the cytoskeletal apparatus of the intestinal brush border. Annu Rev Cell Biol 1:209-241. Moreira, C. 0., K. Palmer, M. Whiteley, M. P. Sircili, L. R. Trabulsi, A. F. Castro, and V. Sperandio. 2006. Bundle-forming pili and EspA are involved in biofilm formation by enteropathogenic Escherichia coli. J Bacteriol 188:3952-3961. Morita, K., H. Sasaki, M. Furuse, and S. Tsukita. 1999. Endothelial claudin: claudin 5/TMVCF constitutes tight junction strands in endothelial cells. J Cell Biol 147:185-194. Mundy, R., C. Jenkins, J. Yu, H. Smith, and G. Frankel. 2004. Distribution of espl among clinical enterohaemorrhagic and enteropathogenic Escherichia coli isolates. J Med Microbiol 53:1145-1149. Nakagawa, R., T. Naka, H. Tsutsui, M. Fujimoto, A. Kimura, T. Abe, E. Seki, S. Sato, 0. Takeuchi, K. Takeda, S. Akira, K. Yamanishi, I. Kawase, K. Nakanishi, and T. Kishimoto. 2002. SOCS-1 participates in negative regu’ation of LPS responses. Immunity 17:677-687. Nakamura, T., K. Tsuchiya, and M. Watanabe. 2007. Crosstalk between Wnt and Notch signaling in intestinal epithelial cell fate decision. J Gastroenterol 42:705-7 10. Nataro, J. P., M. M. Baldini, J. B. Kaper, R. E. Black, N. Bravo, and M. M. Levine. 1985. Detection of an adherence factor of enteropathogenic Escherichia coli with a DNA probe. J Infect Dis 152:560-565. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin Microbiol Rev 11: 142-201. Newberry, R. D., and R. G. Lorenz. 2005. Organizing a mucosal defense. Immunol Rev 206:6-21. Nguyen, H. T., L. Charrier-Hisamuddin, G. Dalmasso, A. Hiol, S. Sitaraman, and D. Merlin. 2007. Association of PepTl with lipid rafts differently modulates its transport activity in polarized and nonpolarized cells. Am J Physiol Gastrointest Liver Physiol 293:G1 155-1165. Niess, J. H., and H. C. Reinecker. 2005. Lamina propria dendritic cells in the physiology and pathology of the gastrointestinal tract. Curr Opin Gastroenterol 21:687-691. Nusrat, A., J. R. Turner, and J. L. Madara. 2000. Molecular physiology and pathophysiology of tight junctions. IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune cells. Am J Physiol Gastrointest Liver Physiol 279:G85 1-857. O’Neill, L. A. 2003. SIGIRR puts the brakes on Toll-like receptors. Nat Immunol 4:823824. O’Ryan, M., V. Prado, and L. K. Pickering. 2005. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis 16:125-136. Ogura, Y., D. K. Bonen, N. Inohara, D. L. Nicolae, F. F. Chen, R. Ramos, H. Britton, T. Moran, R. Karaliuskas, R. H. Duerr, J. P. Achkar, S. R. Brant, T. M. Bayless, B. S.  50  137.  138.  139.  140.  141.  142.  143.  144.  145.  146.  147.  148.  149.  Kirschner, S. B. Hanauer, G. Nunez, and J. H. Cho. 2001. A frameshift mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 411:603-606. Ogushi, K., A. Wada, T. Niidome, T. Okuda, R. Lianes, M. Nakayama, Y. Nishi, H. Kurazono, K. D. Smith, A. Aderem, J. Moss, and T. Hirayama. 2004. Gangliosides act as co-receptors for Salmonella enteritidis F1iC and promote F1iC induction of human beta defensin-2 expression in Caco-2 cells. J Biol Chem 279: 12213-12219. Otte, J. M., E. Cario, and D. K. Podoisky. 2004. Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells. Gastroenterology 126:1054-1070. Papatheodorou, P., G. Domanska, M. Oxle, J. Mathieu, 0. Seichow, B. Kenny, and J. Rassow. 2006. The enteropathogenic Escherichia coli (EPEC) Map effector is imported into the mitochondrial matrix by the TOM/Hsp7O system and alters organelle morphology. Cell Microbiol 8:677-689. Pelayo, J. S., I. C. Scaletsky, M. Z. Pedroso, V. Sperandio, J. A. Giron, G. Frankel, and L. R. Trabulsi. 1999. Virulence properties of atypical EPEC strains. J Med Microbiol 48:41-49. Petri, W. A., Jr., M. Miller, H. J. Binder, M. M. Levine, R. Dillingham, and R. L. Guerrant. 2008. Enteric infections, diarrhea, and their impact on function and development. J Clin Invest 118:1277-1290. Polentarutti, N., G. P. Rol, M. Muzio, D. Bosisio, M. Camnasio, F. Riva, C. Zoja, A. Benigni, S. Tomasoni, A. Vecchi, C. Garlanda, and A. Mantovani. 2003. Unique pattern of expression and inhibition of IL- 1 signaling by the IL-i receptor family member TIR8/STGJRR. Eur Cytokine Netw 14:2 1 1-2 18. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, and B. Beutler. 1998. Defective LPS signaling in C3H/HeJ and C57BL/lOScCr mice: mutations in T1r4 gene. Science 282:2085-2088. Rahner, C., L. L. Mitic, and J. M. Anderson. 2001. Heterogeneity in expression and subcellular localization of claudins 2, 3, 4, and 5 in the rat liver, pancreas, and gut. Gastroenterology 120:411-422. Ramphal, R., V. Balloy, J. Jyot, A. Verma, M. Si-Tahar, and M. Chignard. 2008. Control of Pseudomonas aeruginosa in the lung requires the recognition of either lipopolysaccharide or flagellin. J Immunol 18 1:586-592. Raqib, R., P. Sarker, P. Bergman, G. Ara, M. Lindh, D. A. Sack, K. M. Nasirul Islam, G. H. Gudmundsson, J. Andersson, and B. Agerberth. 2006. Improved outcome in shigellosis associated with butyrate induction of an endogenous peptide antibiotic. Proc Nati Acad Sci U S A 103:9178-9183. Reed, K. A., M. E. Hobert, C. E. Kolenda, K. A. Sands, M. Rathman, M. O’Connor, S. Lyons, A. T. Gewirtz, P. J. Sansonetti, and J. L. Madara. 2002. The Salmonella typhimurium flagellar basal body protein F1iE is required for flagellin production and to induce a proinflammatory response in epithelial cells. J Biol Chem 277:13346-13353. Rhee, S. H., E. Tm, M. Riegler, E. Kokkotou, M. O’Brien, and C. Pothoulakis. 2005. Pathophysiological role of Toll-like receptor 5 engagement by bacterial flagellin in colonic inflammation. Proc Natl Acad Sci US A 102:13610-13615. Rimoldi, M., M. Chieppa, V. Salucci, F. Avogadri, A. Sonzogni, G. M. Sampietro, A. Nespoli, G. Viale, P. Allavena, and M. Rescigno. 2005. Intestinal immune homeostasis is 51  150.  151. 152.  153.  154. 155. 156. 157.  158.  159.  160.  161.  162. 163.  164. 165.  regulated by the crosstalk between epithelial cells and dendritic cells. Nat Immunol 6:507-514. Roe, A. J., C. Currie, D. G. Smith, and D. L. Gaily. 2001. Analysis of type 1 fimbriae expression in verotoxigenic Escherichia coli: a comparison between serotypes 0157 and 026. Microbiology 147:145-152. Rook, G. A., and L. R. Brunet. 2005. Microbes, immunoregulation, and the gut. Gut 54:317-320. Rosenshine, I., S. Ruschkowski, M. Stein, D. J. Reinscheid, S. D. Mills, and B. B. Finlay. 1996. A pathogenic bacterium triggers epithelial signals to form a functional bacterial receptor that mediates actin pseudopod formation. Embo J 15:2613-2624. Rosenstiel, P., M. Fantini, K. Brautigam, T. Kuhbacher, G. H. Waetzig, D. Seegert, and S. Schreiber. 2003. TNF-alpha and IFN-gamma regulate the expression of the NOD2 (CARD15) gene in human intestinal epithelial cells. Gastroenterology 124:1001-1009. Rothbaum, R. J., R. A. Giannella, and J. C. Partin. 1982. Diarrhea caused by adherent enteropathogenic B. coli. J Pediatr 101:486. Rousset, M. 1986. The human colon carcinoma cell lines HT-29 and Caco-2: two in vitro models for the study of intestinal differentiation. Biochimie 68:1035-1040. Sabroe, I., L. C. Parker, S. K. Dower, and M. K. Whyte. 2008. The role of TLR activation in inflammation. J Pathol 214: 126-135. Sansom, 0. J., K. R. Reed, A. J. Hayes, H. freland, H. Brinkmann, I. P. Newton, E. Bathe, P. Simon-Assmann, H. Clevers, I. S. Nathke, A. R. Clarke, and D. J. Winton. 2004. Loss of Apc in vivo immediately perturbs Wnt signaling, differentiation, and migration. Genes Dev 18:1385-1390. Savkovic, S. D., A. Koutsouris, and G. Hecht. 1997. Activation of NF-kappaB in intestinal epithelial cells by enteropathogenic Escherichia coli. Am J Physiol 273:C1 1601167. Savkovic, S. D., A. Koutsouris, and G. Hecht. 1996. Attachment of a noninvasive enteric pathogen, enteropathogenic Escherichia coli, to cultured human intestinal epithelial monolayers induces transmigration of neutrophils. Infect Immun 64:4480-4487. Savkovic, S. D., A. Ramaswamy, A. Koutsouris, and G. Hecht. 2001. EPEC-activated ERK1/2 participate in inflammatory response but not tight junction barrier disruption. Am J Physiol Gastrointest Liver Physiol 281:G890-898. Scaletsky, I. C., M. L. Silva, M. R. Toledo, B. R. Davis, P. A. Blake, and L. R. Trabulsi. 1985. Correlation between adherence to HeLa cells and serogroups, serotypes, and bioserotypes of Escherichia coli. Infect Immun 49:528-532. Scaletsky, I. C., M. L. Silva, and L. R. Trabulsi. 1984. Distinctive patterns of adherence of enteropathogenic Escherichia cohi to HeLa cells. Infect Immun 45:534-5 36. Schell, M. A., M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, M. C. Zwahlen, F. Desiere, P. Bork, M. Delley, R. D. Pridmore, and F. Arigoni. 2002. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc Natl Acad Sci U S A 99:14422-14427. Sgambati, S. A., G. A. Turowski, and M. D. Basson. 1997. Peptide YY selectively stimulates expression of the colonocytic phenotype. J Gastrointest Surg 1:561-568. Shibolet, 0., and D. K. Podolsky. 2007. TLRs in the Gut. IV. Negative regulation of Toll like receptors and intestinal homeostasis: addition by subtraction. Am J Physiol Gastrointest Liver Physiol 292: G 1469-1473. 52  166. 167.  168.  169. 170.  171.  172.  173.  174. 175.  176.  177.  178. 179. 180.  181.  Silverstein, A. M. 2003. Cellular versus humoral immunology: a century-long dispute. Nat Immunol 4:425-428. Soong, G., B. Reddy, S. Sokol, R. Adamo, and A. Prince. 2004. TLR2 is mobilized into an apical lipid raft receptor complex to signal infection in airway epithelial cells. J Clin Invest 113:1482-1489. Spahn, T. W., C. Maaser, L. Eckmann, J. Heidemann, A. Lugering, R. Newberry, W. Domschke, H. Herbst, and T. Kucharzik. 2004. The lymphotoxin-beta receptor is critical for control of murine Citrobacter rodentium-induced colitis. Gastroenterology 127:14631473. Spears, K. J., A. J. Roe, and D. L. GaIly. 2006. A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis. FEMS Microbiol Lett 255:187-202. Staley, T. E., E. W. Jones, and L. D. Corley. 1969. Attachment and penetration of Escherichia coli into intestinal epithelium of the ileum in newborn pigs. Am J Pathol 56:37 1-392. Stein, M., B. Kenny, M. A. Stein, and B. B. Finlay. 1996. Characterization of EspC, a 1 10-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous to members of the immunoglobulin A protease-like family of secreted proteins. J Bacteriol 178:6546-6554. Steiner, T. S., J. P. Nataro, C. E. Poteet-Smith, J. A. Smith, and R. L. Guerrant. 2000. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest 105:1769-1777. Su, L. K., K. W. Kinzler, B. Vogeistein, A. C. Preisinger, A. R. Moser, C. Luongo, K. A. Gould, and W. F. Dove. 1992. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 256:668-670. Sun, H., E. C. Chow, S. Liu, Y. Du, and K. S. Pang. 2008. The Caco-2 cell monolayer: usefulness and limitations. Expert Opin Drug Metab Toxicol 4:395-411. Tasteyre, A., M. C. Barc, A. Collignon, H. Boureau, and T. Karjalainen. 2001. Role of F1iC and FliD flagellar proteins of Clostridium difficile in adherence and gut colonization. Infect Immun 69:7937-7940. Taylor, C. J., A. Hart, R. M. Batt, C. McDougall, and L. McLean. 1986. Ultrastructural and biochemical changes in human jejunal mucosa associated with enteropathogenic Escherichia coli (0111) infection. J Pediatr Gastroenterol Nutr 5:70-73. Thorpe, C. M., B. P. Hurley, L. L. Lincicome, M. S. Jacewicz, G. T. Keusch, and D. W. Acheson. 1999. Shiga toxins stimulate secretion of interleukin-8 from intestinal epithelial cells. Infect Immun 67:5985-5993. Tones, A. G., and J. B. Kaper. 2003. Multiple elements controlling adherence of enterohemorrhagic Escherichia coli 0157:H7 to HeLa cells. Infect Immun 7 1:4985-4995. Tones, A. G., X. Zhou, and J. B. Kaper. 2005. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun 73:18-29. Travassos, L. H., L. A. Carneiro, S. E. Girardin, I. 6. Boneca, R. Lemos, M. T. Bozza, R. C. Domingues, A. J. Coyle, J. Bertin, D. J. Philpott, and M. C. Plotkowski. 2005. Nodi participates in the innate immune response to Pseudomonas aeruginosa. J Biol Chem 280:367 14-367 18. Tu, X., I. Nisan, C. Yona, E. Hanski, and I. Rosenshine. 2003. EspH, a new cytoskeleton modulating effector of enterohaemonhagic and enteropathogenic Escherichia coli. Mol Microbiol 47:595-606. 53  182. 183.  184.  185. 186.  187.  188. 189. 190.  191.  192.  193.  194.  195. 196.  Turner, J. R. 2006. Molecular basis of epithelial barrier regulation: from basic mechanisms to clinical application. Am J Pathol 169:1901-1909. Tzipori, S., R. M. Robins-Browne, G. Gonis, J. Hayes, M. Withers, and E. McCartney. 1985. Enteropathogenic Escherichia coli enteritis: evaluation of the gnotobiotic piglet as a model of human infection. Gut 26:570-578. Uematsu, S., M. H. Jang, N. Chevrier, Z. Guo, Y. Kumagai, M. Yamamoto, H. Kato, N. Sougawa, H. Matsui, H. Kuwata, H. Hemmi, C. Coban, T. Kawai, K. J. Ishii, 0. Takeuchi, M. Miyasaka, K. Takeda, and S. Akira. 2006. Detection of pathogenic intestinal bacteria by Toll-like receptor 5 on intestinal CD11c+ lamina propria cells. Nat Immunol 7:868-874. Ulshen, M. H., and J. L. Rollo. 1980. Pathogenesis of escherichia coli gastroenteritis in man--another mechanism. N Engi J Med 302:99-101. Umesaki, Y., H. Setoyama, S. Matsumoto, A. Imaoka, and K. Itoh. 1999. Differential roles of segmented filamentous bacteria and clostridia in development of the intestinal immune system. Infect Immun 67:3504-3511. Vallance, B. A., W. Deng, L. A. Knodler, and B. B. Finlay. 2002. Mice lacking T and B lymphocytes develop transient colitis and crypt hyperplasia yet suffer impaired bacterial clearance during Citrobacter rodentium infection. Infect Immun 70:2070-2081. van Breemen, R. B., and Y. Li. 2005. Caco-2 cell permeability assays to measure drug absorption. Expert Opin Drug Metab Toxicol 1:175-185. van de Kerkhof, E. G., I. A. de Graaf, and G. M. Groothuis. 2007. In vitro methods to study intestinal drug metabolism. Curr Drug Metab 8:658-675. van de Wetering, M., E. Sancho, C. Verweij, W. de Lau, I. Oving, A. Hurlstone, K. van der Horn, E. Bathe, D. Coudreuse, A. P. Haramis, M. Tjon-Pon-Fong, P. Moerer, M. van den Born, G. Soete, S. Pals, M. Eilers, R. Medema, and H. Clevers. 2002. The beta catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111:241-250. van den Brink, G. R., S. A. Bleuming, J. C. Hardwick, B. L. Schepman, G. J. Offerhaus, J. J. Keller, C. Nielsen, W. Gaffield, S. J. van Deventer, D. J. Roberts, and M. P. Peppelenbosch. 2004. Indian Hedgehog is an antagonist of Wnt signaling in colonic epithelial cell differentiation. Nat Genet 36:277-282. van der Waaij, D., J. M. Berghuis-de Vries, and L.-v. Lekkerkerk. 1971. Colonization resistance of the digestive tract in conventional and antibiotic-treated mice. J Hyg (Lond) 69:405-411. Vijay-Kumar, M., J. D. Aitken, A. Kumar, A. S. Neish, S. Uematsu, S. Akira, and A. T. Gewirtz. 2008. Toll-like receptor 5-deficient mice have dysregulated intestinal gene expression and nonspecific resistance to Salmonella-induced typhoid-like disease. Infect Immun 76:1276-128 1. Vijay-Kumar, M., C. J. Sanders, R. T. Taylor, A. Kumar, J. D. Aitken, S. V. Sitaraman, A. S. Neish, S. Uematsu, S. Akira, I. R. Williams, and A. T. Gewirtz. 2007. Deletion of TLR5 results in spontaneous colitis in mice. J Clin Invest 117:3909-3921. Vollaard, E. J., and H. A. Clasener. 1994. Colonization resistance. Antimicrob Agents Chemother 38:409-4 14. Volpe, D. A. 2008. Variability in Caco-2 and MDCK cell-based intestinal permeability assays. J Pharm Sci 97:712-725.  54  197.  198.  199.  200. 201.  202.  203.  204. 205.  206.  207. 208.  209.  210.  211.  Wald, D., J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, J. Towne, J. E. Sims, G. R. Stark, and X. Li. 2003. SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol 4:920-927. Watanabe, T., N. Asano, P. J. Murray, K. Ozato, P. Tailor, I. J. Fuss, A. Kitani, and W. Strober. 2008. Muramyl dipeptide activation of nucleotide-binding oligomerization domain 2 protects mice from experimental colitis. J Clin Invest 118:545-559. Watanabe, T., A. Kitani, P. J. Murray, Y. Wakatsuki, I. J. Fuss, and W. Strober. 2006. Nucleotide binding oligomerization domain 2 deficiency leads to dysregulated TLR2 signaling and induction of antigen-specific colitis. Immunity 25 :473-485. Watkins, D. N., and C. D. Peacock. 2004. Hedgehog signalling in foregut malignancy. Biochem Pharmacol 68:1055-1060. Weersma, R. K., H. M. van Dullemen, G. van der Steege, I. M. Nolte, J. H. Kleibeuker, and G. Dijkstra. 2007. Review article: Inflammatory bowel disease and genetics. Aliment Pharmacol Ther 26 Suppi 2:57-65. Weigmann, A., D. Corbeil, A. Heliwig, and W. B. Huttner. 1997. Prominin, a novel microvilli-specific polytopic membrane protein of the apical surface of epithelial cells, is targeted to plasmalemmal protrusions of non-epithelial cells. Proc Nat! Acad Sci U S A 94:12425-12430. West, A. P., B. A. Dancho, and S. B. Mizel. 2005. Gangliosides inhibit flagellin signaling in the absence of an effect on flagellin binding to toll-like receptor 5. J Biol Chem 280:9482-9488. West, A. P., A. A. Koblansky, and S. Ghosh. 2006. Recognition and signaling by toll-like receptors. Annu Rev Cell Dev Biol 22:409-437. Wong, M. H., I. R. Saam, T. S. Stappenbeck, C. H. Rexer, and J. I. Gordon. 2000. Genetic mosaic analysis based on Cre recombinase and navigated laser capture microdissection. Proc Nat! Acad Sci US A 97:12601-12606. Xiao, H., M. F. Gulen, J. Qin, J. Yao, K. Bulek, D. Kish, C. Z. Altuntas, D. Wald, C. Ma, H. Zhou, V. K. Tuohy, R. L. Fairchild, C. de la Motte, D. Cua, B. A. Vallance, and X. Li. 2007. The Toll-interleukin-1 receptor member SIGIRR regulates colonic epithelial homeostasis, inflammation, and tumorigenesis. Immunity 26:461-475. Xu, J., and J. I. Gordon. 2003. Inaugural Article: Honor thy symbionts. Proc Natl Acad Sci U S A 100: 10452-10459. Yamanaka, T., L. Helgeland, I. N. Farstad, H. Fukushima, T. Midtvedt, and P. Brandtzaeg. 2003. Microbial colonization drives lymphocyte accumulation and differentiation in the follicle-associated epithelium of Peyer’s patches. J Immunol 170:816-822. Yamasaki, C., Y. Natori, X. T. Zeng, M. Ohmura, S. Yamasaki, Y. Takeda, and Y. Natori. 1999. Induction of cytokines in a human colon epithelial cell line by Shiga toxin 1 (Stxl) and Stx2 but not by non-toxic mutant Stxl which lacks N-glycosidase activity. FEBS Lett 442:231-234. Zaph, C., Y. Du, S. A. Saenz, M. G. Nair, J. G. Perrigoue, B. C. Taylor, A. E. Troy, D. E. Kobuley, R. A. Kastelein, D. J. Cua, Y. Yu, and D. Artis. 2008. Commensal-dependent expression of IL-25 regulates the IL-23-IL-17 axis in the intestine. J Exp Med 205:21912198. Zhang, G., and S. Ghosh. 2002. Negative regulation of toll-like receptor-mediated signaling by Tollip. J Biol Chern 277:7059-7065. 55  212.  213.  Thou, X., J. A. Giron, A. 0. Torres, J. A. Crawford, E. Negrete, S. N. Vogel, and J. B. Kaper. 2003. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun 7 1:2120-2129. Zweibaum, A., M. Pinto, G. Chevalier, E. Dussaulx, N. Triadou, B. Lacroix, K. Haffen, J. L. Brun, and M. Rousset. 1985. Enterocytic differentiation of a subpopulation of the human colon tumor cell line HT-29 selected for growth in sugar-free medium and its inhibition by glucose. J Cell Physiol 122:21-29.  56  Chapter 2: Flagellin-dependent and -independent inflammatory responses following infection with Enteropathogenic Escherichia coli and Citrobacter rodentium. 2.1 Introduction Enteropathogenic Escherichia coli (EPEC) are a prominent cause of diarrheal disease, causing the deaths of hundreds of thousands of children each year in developing countries (8, 9). Belonging to a family of related Gram-negative pathogenic bacteria that includes enterohemorrhagic  E. coli (EHEC) and the mouse pathogen Citrobacter rodentium (27), EPEC are non-invasive, infecting their hosts by attaching to JECs, effacing the epithelial microvilli and producing pedestallike structures (2, 28). The formation of attaching and effacing (AlE) lesions is required for these microbes to cause diarrheal disease (8, 33, 42), thus many studies have characterized the virulence factors used by AlE bacteria to infect their hosts. The formation of AlE lesions depends on T3SS encoded within the LEE, a pathogenicity island that contains all the genes required for A/E lesion formation (9). These pathogens use the LEE encoded T3SS to inject an array of effector proteins, including the Translocated intimin receptor (Tir) into host cells where they interfere with normal cellular function (9). Footnote: Re: Manuscript status A version of this chapter has been published as follows: Flagellin-dependent  and  -independent  inflammatory  responses  following  infection  by  enteropathogenic Escherichia coli (EPEC) and Citrobacter rodentium. Mohammed A. Khan, Saeid Bouzari, Caixia Ma, Carrie M. Rosenberger, Kirk S. B. Bergstrom, Deanna L. Gibson, Theodore S. Steiner and Bruce A. Valiance. Infection and Immunity. 2008 Apr;76(4): 14 10-22.  57  Although the mechanisms by which A/E bacteria cause disease remain elusive, part of the symptomatology suffered by infected hosts reflects the subsequent host inflammatory and immune response to infection. EPEC infection in vivo leads to intestinal tissue damage, including neutrophil infiltration into the infected mucosa and damage to the gut epithelium (6, 25, 35). Much of this pathology has been linked to inflammatory responses by the infected epithelium, including the production of the chemokine IL-8. Although studies have implicated the EPEC T3SS in triggering IL-8 release by epithelial cells (13, 34), no effector protein has yet been identified to play this role. Instead, any possible pro-inflammatory role for the T3SS has been overshadowed by discovery of bacterial flagellins, monomeric structural repeating proteins that comprise flagella. Like lipopolysaccharide, flagellins contain pathogen associated molecular patterns (PAMPs) that are recognized by the innate immune system, triggering an inflammatory response (17). A study by Zhou et al, demonstrated that flagellin is the major bacterial component responsible for the ability of EPEC supernatants to trigger IL-8 release from epithelial cells (47). Moreover, this inflammatory response required the activation of Mitogen-activated protein kinases (MAPK), a group of serine threonine kinases central to many host responses, including cytokine responses. Phosphorylation of MAPK and activation of NF-id3 is required for induction of IL-8 production in epithelial cells (19). While the discovery that EPEC flagellin causes IL-8 release has advanced our understanding of EPEC induced gastroenteritis, other EPEC factors may also contribute to the inflammation, since bacterial pathogens can express more than one PAMP. To date, the role of the innate immune response to EPEC flageflin, as well as the impact of this system on host defense or other inflammatory genes is not well defined. Furthermore, studies based on bacterial supernatants alone do not account for any direct pro-inflammatory actions resulting from the intimate attachment of EPEC to host cells, including possible T3SS-dependent effects. This is particularly relevant given  58  that intimate attachment to epithelial cells is a hallmark of EPEC infection. Understanding the scope of the inflammatory response elicited in epithelial cells by EPEC infection has also been limited by the human-specificity of EPEC, with most researchers finding it unable to infect laboratory animals. The need for a relevant animal model to explore in vivo pathogenesis and disease mechanisms has been addressed through the use of related veterinary pathogens including rabbit specific strains of EPEC (26) as well as C. rodentium, a natural murine A/B pathogen (27). This bacterium colonizes the intestinal epithelium of mice using a similar set of T3SS effectors to those used by EPEC and EHEC. Interestingly, these infections are accompanied by an influx of many types of inflammatory cells, as well as the induction of antimicrobial peptides and enzymes, some of which we and others have localized to colonic epithelial cells (20, 27, 43). These findings suggest that infection by A/E pathogens may induce a more complex host response than has so far been attributed to EPEC flagellin. Our goal in this study was to assess the impact of EPEC F1iC as well as its locus of enterocyte encoded (LEE) T3SS on the inflammatory response generated by JECs directly infected by EPEC, and further characterize the scope of the resulting inflammatory response generated by these virulence factors. We demonstrate that EPEC infection strongly activates Toll-like receptor 5, triggering a spectrum of innate chemokine and antimicrobial responses within epithelial cells in a predominantly FliC-dependent and MAPK dependent manner. However, we also find that direct infection of epithelial cells induces a pro-inflammatory response even in the absence of FliC, and while this response is more marked at later time points, it is not dependent on the LEE encoded effectors. Interestingly, a similar inflammatory response is triggered in JECs following infection by  C. rodentium, as well as in the colons of C. rodentium infected mice. These findings thus expand our current knowledge of the responses produced by epithelial cells following EPEC infection, and  59  indicate that while F1iC may be the first and predominant pro-inflammatory stimulus, direct infection by these pathogens can also induce an innate inflammatory response in epithelial cells through other, non-F1iC dependent mechanisms.  2.2 Materials and Methods Cell culture Caco-2 JECs were obtained from the American Type Culture Collection (ATCC, USA) and grown in Dulbecco’s modified Eagle’s minimal essential medium (DMEM) with 4.5 g/l D-glucose, 1 x nonessential amino acids, 2 n-th’l glutamine, penicillin (100 U/mi) and streptomycin (100 ig/ml) and 10% fetal bovine serum (Sigma). Human Embryonic Kidney (HEK 293) cells were obtained from ATCC and maintained in MEM with 1 mM non-essential amino acids, mM sodium pyruvate, penicillin/streptomycin and 10% fetal bovine serum. Cells were seeded at 5 x 106 in polystyrene T75 cm 2 culture flasks, 0.5 X 10 /well in 6 well plates (6WP), and 10 6 /weil in 12 well plates (12WP) 5 and used for experiments 3-5 days after becoming confluent.  Bacterial strains and growth conditions  Wild type bacterial strains used in this study were EPEC strain 2348/69, and C. rodentium (formerly known as C. freundii biotype 4280), strain DBS 100. AescN EPEC was generated by Gauthier et al as described (15). AfliC EPEC was generated in our laboratory by using the sacB based positive-selection suicide vector pCVD442. Three sets of primers were used for generation of  AfliC EPEC (Table 1). Two 1.5 kb fragments flanking the fliC gene in WT EPEC 2348/69 were amplified by primers sets Fl, Ri and F2 and R2. The third set of primers, F3 and R3 were used to amplify the fliC gene and including the two flanking fragments to confirm deletion of the gene. The  60  double mutant AfliC/iXescN EPEC was generated using the same strategy as AfliC in the AescN EPEC background strain. A similar approach was used to generate mutant strains of C. rodentium lacking the flagellin genes fliC (primers 1-3) and lafA (primers 4-6) in Citrobacter rodentium.  Table 2.1: (a) Primers designed for generating EPEC and C. rodentium bacterial mutants. EPEC Forward (F)  Reverse (R)  1. 5’ gtcaagcttcagggtcttactaacgccatcgg3’  5’ ctgctagccgacagcgcagactggttcttg3’  2. 5’ gcgctagccagcaggccggtaactccgtac3’  5’ ccgagctccggcacaatgccgcccatgattg3’  3. 5’ cagggttgacggcgattgag3’  5’ cctgataagcgcagcgcatc3’  C. rodentium 1. 5’ gtggtacccagctgcgtaaactgggcggtg3’  5’ ccgctagcagagcccagtgcggactgag 3’  2. 5’ cggctagctctgttctggcgcaggctaacc3’  5’ ccgagctccgcatgattagagatgctgaagg3’  3. 5’cct gagcctacgcccagcgaag 3’  5’cgccagttggttcatgatgaacg3’  4. 5’ gtggtaccacttcctgatacataacag 3’  5’ ccgctagcgttgatggcattaaccgctgc3’  5. 5’ cggctagccagtccaacagcatgtccagc3’  5’ ccgagctcgccgttgctggagtcgag3’  6. 5’ gctattagagcggtggccaacg3’  5’ gctggcggtgttgtgtagcg3’  61  (b) List of oligonucleotide primers used for chemokine gene expression.  Target Gene  Forward  Reverse  GAPDH  5’ atgaccttgcccacagcc3’  5’ cccatcaccatcttccag3’ (5)  MIP3a  S’gcaagcaactttgactgctg3  5’ tgggctatgtccaattccat3’  IL-8  5’ tctgcagctctgtgtgaaggt3’  5’ gcttgaagtttcactggcatc3’  MCP- 1  5’ tctgtgcctgctgctcatagc3’  5’ gggtagaactgtggttcaagagg3’ (30)  Beta Defensin-2  5’ ccagccatcagccatgagggt3’  5’ ggagccctttctgaatccgca3’ (29)  Murine MIP2  5’ tcctcgggcactccagac 3’  5’gccttgcctttgttcagtat3’ (21)  Murine MIP3 u  5’ tgctcttccttgctttggca3’  5’ tctgtgcagtgatgtgcagg3’ (21)  For routine cloning, transformation and infections, bacteria were grown in Luria—Bertani (LB) agar or LB broth supplemented with appropriate antibiotics at 37°C. Antibiotics were used at the following concentrations, ampicillin 100 ig/ml, kanamycin 50 ig/ml and chloramphenicol 30 ig/ml. When assaying for bacterial colonization in mice infected by C. rodentium, MacConkey lactose agar (Difco Laboratories), which is selective for Gram-negative bacteria, was used to plate 62  serial dilutions of mouse colonic contents for quantifying bacterial burdens. Complementation of flagellin deficient EPEC was performed using the full-length F1iC gene cloned into pQE-30 UA vector (Qiagen). Briefly, flagellin deficient competent EPEC was transformed by heat-shock method at 42 °C with pQE-30 UA vector carrying the full length FliC gene, sequenced and used in assessing pro-inflammatory responses.  Oligonucleotide sequences, molecular techniques, DNA cloning and sequence analysis  For PCR and cloning experiments, the proof-reading Elongase Amplification System (Gibco BRL/Life Technologies) was utilized to minimize PCR error rate. PCR products were cloned using the TOPO TA Cloning Kit (Invitrogen) with either pCR2. 1-TOPO or pCRII-TOPO. DNA sequence was determined at the Nucleotide and Protein Sequencing Unit (NAPS), University of British Columbia using the Taq Dye-terminator method and an automated 373A DNA Sequencer (Applied Biosystems). M13 reverse and —20 primers complementary to the PCR cloning vectors and subcloning vector pBluescript II SK(+) (Stratagene) as well as primers designed from available DNA sequences were used for sequencing. Analysis of sequences was performed using software or web-based programs such as  DNA STRIDER, GENE JOCKEY  and  CLUSTALW,  National Center for Biotechnology Information (NCBI). NCBI’s  BLAST  as well as tools of the  search server was used for  nucleotide and protein sequence homology searches with the filter checked off. Oligonucleotide primer sequences indicated in this study are listed in Table 1.  infection of Caco-2 intestinal epithelial cells by attaching and effacing (AlE) bacteria Caco-2 cells cultured in 6 and 12 WP were infected by A/E pathogens in DMEM Nutrient Mixture F12 Ham (DMEM-F12) for 3-4 h. At the end of 3-4 h of A/E infection, the MOI ranged between 30-40. After infection, cells were washed twice with DMEM-F12 and gentamycin (1 g/ml) 63  added to prevent host cell death and overgrowth of extracellular bacteria. At different time-points after infection, supernatant was collected for sandwich ELISA (24 h) or cell lysates (2-8 h) were prepared for western immunoblots.  Pharmacological inhibition ofIL-8 and MIP-3 a secretion SB 203580 (SB) and Bay 11-7085 (Bay 11) were purchased from Calbiochem and dissolved in DMSO. Caco-2 cells cultured in a 6 WP or 12 WP were fed with 2 mL of fresh warm DMEM-F12 media and treated with inhibitors for 1 hr at 37° prior to infection by A/E bacteria. Subsequently, 10 il of ALE bacteria (grown overnight in LB) was then added to the media and incubated for various time points. Th-8 and MIP3cc was measured in the supernatant by sandwich ELISA using a kit, according to manufacturer’s instructions (BD OptElA, BD Biosciences, USA). SB is a cell permeable specific inhibitor of p38 MAP kinase with an 1C 50 of 34 tiM, whereas Bay-li inhibits NF-id3 nuclear translocation by retaining it in the cytoplasm (31).  Assessment of bacterial adherence to Caco-2 cells To assess bacterial adhesion, Caco-2 cells were infected with bacteria for 3-4 h. Cells were then washed with warm DMEM three times and finally scraped into warm PBS and mixed by pipetting. Serial dilutions were performed and aliquots of the scraped cells were streaked on agar plates and incubated in 37°C overnight. Bacterial colonies (CFU) were counted the next day. Similarly, Caco-2 cells pre-treated with the above described pharmacological inhibitors were infected with bacteria and scraped in PBS before plating on agar.  64  Western blotting and immunoprecipitation Following infection with A/E bacteria, cells were washed twice with 2 ml of ice-cold Hank’s Balanced Salt Solution (Sigma). Cells were then lysed in 350—500 l of lysis buffer (50 mM Tris, pH 7.5,  150 mM NaC1,  1 m EDTA,  1 mM EGTA,  1% Triton X-l00, 2.5 mM sodium  pyrophosphate, 1 mlvi -glycero-phosphate, 1 nm4 Na VO, 1 ig/ml leupeptin and 1 mM PMSF) on 3 ice for 5—10 mm and then scraped into microcentrifuge tubes. The tubes were centrifuged at 13000 g for 5 mm to pellet debris, and the supernatant was transferred to another tube for Western blots and immunoprecipitation. Caco-2 proteins (50 g in cleared cell lysate) were resolved by 9-11% sodium dodecyl sulphate—polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to 0.2 im polyvinylidene fluoride (PVDF) membranes. Blots were then blocked for 1 hr with 5% nonfat milk in Tris-buffered saline (Tris 20 mM and NaC1 0.3 M, pH 7.4) with 0.05% Tween-20 (TBST). Membranes were then incubated with primary antibody in TBST overnight at 4°C and probed with the respective secondary antibody next day for 1 h at room temperature. Rabbit polyclonal phospho p38 MAP kinase and I-ld3cL antibodies (Cell Signal Technology) were used in this study. Mouse monoclonal antibodies against phospho-ERK and phospho-JNK (Santa Cruz Biotechnology) were used in western blots to examine the role of these MAP kinases in Caco-2 cells.  Conventional semi-quantitative reverse transcriptase-polymerase chain reaction Mouse colonic tissue (distal colon) was isolated and stored in RNAlater (Qiagen) according to manufacturer’s instructions. Sections of distal colon weighing 2-5 mg were homogenized in 2 mL of RLT lysis buffer (Qiagen) for 30 seconds in a 15 mL tube, centrifuged for 5 mm at 13000g at room temperature. 1-2 mL of supematant was used for extraction of RNA using the RNeasy Protect Minikits (Qiagen) spin columns, according to the specifications of the manufacturer. Total RNA  65  from Caco-2 cells grown in 24 well plates was extracted by RNeasy Protect Minikits as per manufacturer’s recommendations.  1-2 micrograms of RNA were reverse transcribed into  complementary DNA for 60 mm at 37°C in 20-pt reaction buffer containing 10 mM Tris-HC1 (pH 8.3), 50 mmol/L KCI, 5.0 mmolfL MgC1 , 100 iimol/L pooled deoxynucleotide triphosphates U of 2 Moloney murine leukemia virus reverse transcriptase (RT), 4-fig random hexamer primers and 20 U of ribonuclease inhibitor. Random hexamers were used to provide a “one-step” RT reaction that yielded complementary DNA for amplification by polymerase chain reaction (PCR). A semiquantitative conventional PCR method of amplification was used because the target messenger RNA was expressed at low copy numbers. Aliquots of reverse-transcribed complementary DNA were added to PCR reaction buffer to obtain a reaction mixture containing 20 mmolfL Tris-HC1 (pH 8.3), 50 mmolJL KC1, 1.5 mmol/L MgC1 , 100 imol/L pooled deoxynucleotide triphosphates, 1-2 U of 2 Taq DNA polymerase, and 0.25 imolJL each of GAPDH and gene specific oligonucleotide primers (NAPS unit, UBC). PCR conditions were optimized for different genes of interest.  TLR5 activation HEK 293 cells were obtained from ATCC and cultured at 37°C in a 5% CO 2 incubator in DMEM containing 10% calf serum (Hyclone, Logan, UT). The day prior to transfection, HEK 293 cells were plated in a 96 well plate at density of 5 x i0 4 per well. Transient transfection was performed using a polyfect reagent (Qiagen). Cells were transfected with 150 ng NF-KB reporter (endothelial leukocyte molecule-l, ELAM-l firefly luciferase construct), 15 ng of thymidine kinase  Renilla luciferase vector (Promega) to control for transfection efficiency and 20 ng EF6 hTLR5. The empty vector pEF6 was used as a control and to normalize the DNA concentrations for all transfections to 250 ng per well. Twenty hours after transfection, cells were stimulated with 10% supernatant from an overnight culture of EPEC or C. rodentium in LB broth, 10 ng/ml of Ultrapure  66  Salmonella F1iC (Calbiochem) or LB alone. Cells were lysed after 4 h using passive lysis buffer and the luciferase activity quantified using the dual luciferase reporter assay system (Promega). Firefly luciferase units were divided by Renilla units to normalize for transfection efficiency between wells.  Immunofluorescence staining of colon tissues Immunofluorescence staining of infected tissues was performed according to method described previously (43). In brief, tissues were rinsed in ice-cold PBS, embedded in optimal cutting temperature compound (OCT, Sakura, Finetech), frozen with isopentane (Sigma) and liquid N , and 2 stored at -70°C. Serial sections were cut at a thickness of 6-8 Im and fixed in ice-cold acetone for 10 minutes. Tissue sections were directly blocked with 1% bovine serum albumin, followed by the addition of antibodies against the dendritic cell marker CD1 ic (Biolegend) (dilution 1:100) and Tir (dilution 1:1000) (43). Following extensive washing with Tris-buffered saline, Alexa 488 conjugated goat anti-mouse and Alexa 568 conjugated goat anti-rat IgG antibodies (all at a dilution of 1:300) were added. Images were taken using a Zeiss Axioimager microscope.  Data presentation and statistical analysis All the results are expressed as the mean value ± standard error of the mean. Results presented are from one representative infection out of at least three different batches of cells. Statistical analysis was performed using the one-way ANOVA test and student t-test with p <0.05 considered as significant.  67  2.3 Results EPEC supernatants induce IL-8 secretion from Caco-2 cells Previous studies suggest that flagellin is the major factor within the EPEC supernatant that triggers IL-8 secretion from T84 IECs (47). To determine if WT EPEC culture supernatant produces a similar response in LPS hypo-responsive Caco-2 JECs, filter sterilized bacterial culture supernatants were prepared from bacteria grown overnight in LB. Exposure to 200-400 pL of WT EPEC supematant for 3 h produced a significant amount of IL-8 (1007.5  62 pg/mi) from Caco-2  cells (Figure 2.1A) 24 h after initial infection. These levels were 40-50 fold higher than unstimulated controls and comparable to IL-i f3-induced IL-8 secretion, included as a positive control. In contrast, zifliC EPEC supernatant caused only a modest IL-8 release (147.9 ± 27.3 pg/mi), approximately 10-fold lower than that seen with WT EPEC supernatant. EscN is an ATPase required for the functioning of the EPEC T3SS (13), which is a molecular needle-like structure used by EPEC to insert bacterial effector proteins into host cells. We tested the /iescN EPEC mutant which is impaired in the generation of the T3SS and is thus unable to translocate bacterial effectors into host cells, but is fully capable of producing flagellin. Exposure of Caco-2 cells to supernatant from ziescN EPEC produced a similar induction of IL-8 secretion as WT EPEC (1080 ± 79 pg/ml). These data confirm the prominent pro-inflammatory role played by EPEC flagellin, and demonstrate that the T3SS does not affect the ability of EPEC supematant to induce IL-8 in Caco-2 cells.  Direct infection by EPEC can trigger IL-8 secretion in a FIiC-independent manner While flagellin is the major factor in the EPEC supernatant that stimulates IL-8 secretion from epithelial cells, it is unknown if the same is true when intestinal epithelial cells undergo direct  68  infection by EPEC. To address this question, Caco-2 cells were infected by different EPEC strains are far more complex than that seen with EPEC supernatant. 1400 1200 1000 800 IL-8 pg/mi  600 400 200  *  0  Unstimulated  WT  AfliC  &scN  IL-i 13  Figure 2.1A: EPEC supernatants induce IL-8 secretion from Caco-2 cells. Bacterial culture supernatant from overnight cultures of WT and mutant EPEC grown in LB were filter sterilized. 2OO-4OOiL/well of supernatant were added to growth medium of Caco-2 cell monolayers in 6 or 12WP for 3h, washed and fresh media added. Cell culture supernatant was collected after 24 h and IL-8 concentration quantified by ELISA. Bacteria were grown overnight in LB. IL-113 (10 ng/ml) was included as a positive control. Error bars p<0.05 vs. Unstimulated. As shown in Figure 2.1B, WT EPEC infection induced 836.6 ± 97.4 pg/ml of IL-8 (24 h after initial infection), significantly less than the response to its supernatant in Figure 1A (p<O.O5). The flagellin deficient 4fliC EPEC infection produced a 20-fold higher response than the uninfected control and while this was two-fold lower than WT, it was significantly higher than the IL-8 response to its supernatant in Fig 2.1A (408.9 ± 42.6 vs. 147.9 ± 27.3 pg/mI, p<O.O5).  69  To confirm that the impaired inflammatory response elicited by iXfliC EPEC was due to the loss of flagellin expression, we complemented the L\fliC EPEC strain with a plasmid carrying the full-length fliC gene (46) and measured the IL-8 response from Caco-2 cells. As shown in Figure 2.1B, levels of IL-8 were found to be significantly increased compared to the 4fliC EPEC (671 85.5 pg/ml vs. 409  +  +  27 pg/mi, p<O.O5). The amount of IL-8 released by Caco-2 cells due to  complemented AfliC EPEC was approximately 80% of the amount induced by WT EPEC infection. This finding is consistent with Zhou et al (47) who earlier reported partial restoration of IL-8 secretion from T84 cells following complementation of flagellin deficient EPEC. Our data indicate that flagellin is required for full induction of chemokine release from intestinal epithelial cells. The EPEC T3SS suppresses the F1iC-independent IL-8 response Previous studies have implicated the LEE-encoded T3SS (and the bacterial effector proteins that depend on its function to translocate into host cells) in causing (13, 34) as well as suppressing the inflammatory response by EPEC infected epithelial cells (36). Interestingly, the loss of the LEEencoded T3SS (AescN) did not attenuate IL-8 levels (Figure 2.1B), but instead led to significantly greater IL-8 release compared to WT EPEC (1162.2 ± 71 vs. 836.6 ± 97.4 pg/ml, p<O.O ). These 5 data indicate that the mechanisms underlying the inflammatory response to direct EPEC infection are more complex than reported previously. To assess if the JL-8 response to direct infection by \fliC EPEC was linked either directly or indirectly to the LEE-encoded T3SS, a double AfliC/AescN mutant was generated. As shown in Figure 2.1B, infection with the AfliC/AescN mutant bacteria yielded approximately two-fold higher levels of IL-8 when compared to \fliC bacteria (783 ± 67 vs. 408.9 ± 42.6 pg/ml, p<O.O5), indicating that the IL-8 response was augmented by loss of the T3SS. 70  1600 1400  1200 1000  IL-8 pg/mi  t  800 600 400 200 0 Uninfected  WT  4fliC  Comp AfliC  tXescN  L\fliC/ t\escN  IL-I 13  Figure 2.1B: Direct infection by EPEC bacteria triggers IL-8 secretion in a partially flagellin dependent manner. wild-type EPEC (WT), F1iC deficient EPEC (AfliC), Complemented AfliC EPEC (Comp (AfliC), T3SS deficient EPEC (AescN EPEC) and a double mutant lacking F1iC and T3SS (4fliC/AescN) were grown overnight in LB as described in materials and methods. 10 pL of bacterial culture was used to infect Caco-2 cells in 2 mL of DMEM in the absence of antibiotics and serum. After 3 h, cells were washed twice with DMEM, replaced with media containing serum and antibiotics with gentamycin added to prevent growth of extracellular bacteria. Cell culture supernatant was collected for IL-8 ELISA. Error bars and Uninfected,  **  p<O.O5 vs. AfliC EPEC,  ***  *  p<O.05 vs.  p<O.O5 vs. WT EPEC, p<O.05 vs. AfliC EPEC.  Considering that EPEC lacking escN do not translocate effector proteins, it is plausible that suppression of the fliC independent response is caused by a T3SS-dependent translocated effector. Moreover, these results demonstrate that even in the absence of flagellin, EPEC is capable of  71  triggering a strong IL-8 response from infected Caco-2 cells that does not require the translocation of bacterial effectors into host cells.  p.38 MAP Kinase and NF- id3 differentially regulate WT and AfliC EPEC induced JL-8 secretion from Caco-2 cells The next study examined which signaling pathways were involved in the IL-8 response to infection by WT and AfliC EPEC, focusing on p38 MAP kinase and NF-KB activation. Previous studies have shown that purified A/E flagellin and bacterial supernatants containing flagellin activate both pathways (4). Using a rabbit polyclonal antibody that detects the active phosphorylated tyrosine and threonine p38 MAP kinase, EPEC infection was observed to cause significant activation of p38 MAP kinase after 2 h of infection (Figure 2.2A) as indicated by an intense 43 kDa band. Furthermore, the ziJliC EPEC also activated p38 MAP kinase when compared to uninfected control. IL-113 treatment for 2 h caused p38 activation and was included as a positive control. To assess activation of the NF-icB signaling pathway by EPEC, we examined the stability of I-icBo protein following infection with WT and 4fliC EPEC after infection. A time-course of I-1CBcL stability was studied beginning at 2 h and followed until 8 h post-infection. As shown in Figure 2.2A, both strains caused degradation of I-iBct, beginning at 4 h and maximal at 8 h after infection as indicated by loss of band intensity. Next, we investigated if ERK and JNK MAP kinases were activated between 1-8 h of WT EPEC infection. Using antibodies specific against the phosphorylated species of these kinases, we found ERK and JNK were not significantly activated in Caco-2 cells during the time points studied (appendix A).  72  phospho-p38 MAPK  total-p38MAPK  I--—  -  Actin  —  WT  Uninfected  1fliC  2h  I kBc  —-  IL-13 2h  jtr  Actin Uninfected  WT  tfliC  WT  AfliC 4h  2h  WT  tfliC 8h  Figure 2.2A: Wild type and flagellin-deficient EPEC activate p38 MAP kinase and induce I-icBo degradation in IECs. Caco-2 IECs were infected with wild type (WT) and flagellin deficient (AfliC) EPEC for 2-8 h. Cell lysates were prepared as described in Materials and Methods. 50 tg of cleared whole cell lysate was subjected to SDS-PAGE in western blots. Membranes were probed with rabbit polyclonal primary antibodies against human phospho-p38 MAP kinase, total p38 MAP kinase (upper panel) and I-icBo (lower panel). Mouse monoclonal antibody was used for detection of Actin (internal loading control). Blots were finally developed by ECL.  We next examined the effect of pharmacological inhibition of these pathways on IL-8 secretion caused by EPEC infection. We pre-treated Caco-2 cells with the p38 MAP kinase pharmacological inhibitor SB 203580 (10 tiM) and the NF-icB inhibitor Bay 11-7082 (20 !IM) for 1 h and then infected these cells with WT EPEC for 3 h. As shown in Figure 2.2B, p38 MAP kinase  73  inhibition significantly decreased IL-8 secretion by 66% (882 ± 69 vs. 290 ± 81 pg/mi,  p<O.05).  Inhibition of NF-id3 also caused a 30% decrease in IL-8 secretion compared to MAP kinase  1000 900 800 700 600 IL-8 pg/mi  500 400 ***  300 200 100 0  SB EPEC  zfliC EPEC  +  WT  SB +  zfliC  Bay ii +  tfliC  Figure 2.2B: IL-8 secretion by flagellin-deficient EPEC is mediated preferentially by NF-icB in Caco-2 cells. Cells were pre-treated with 10 pM SB 203580 (p 38 MAP kinase inhibitor) and 20 iM Bay 11-7085 for 1 h and infected with wild type (WT) and flagellin-deficient (lxfliC) EPEC for 3 h. Cells were washed twice and fresh warm media was added. Supernatant was collected as above for IL-8 ELISA. Error bars, * and  **  p<O.OS vs. WT,  ***  p<O.O5 vs. zXfliC EPEC. SB 203580 and Bay-il  were prepared in DMSO which did not cause significant IL-8 secretion (see Figure 4 in appendix). inhibition (882 ± 69 vs. 620.4 ± 34 pg/ml, p<O.O5). These results indicate that p38 MAP kinase plays a critical role in EPEC induced IL-8 secretion, while NF-iB activation contributes only modestly to 74  chemokine secretion. We next examined the role of these two pathways in the F1iC-independent response. As above, Caco-2 cells were pre-treated with pharmacological inhibitors followed by infection with 4fliC EPEC. As indicated in Figure 2.2B, NF-icB inhibition produced a 50% decrease in IL-8 levels following 4fliC EPEC (432.4 ± 43 vs. 219.3 ± 38,  p<O.05), whereas p38 MAP kinase  inhibition did not significantly affect IL-8 secretion (375.6 ± 87 vs. 432.4 ± 43), clarifying that although the IL-8 response to WT EPEC infection is predominantly MAPK dependent, the IL-8 response to AfliC EPEC is pre-dominantly NF-id3 dependent. A summary of the NF-icB and p38 MAP kinase signaling pathways is depicted in Figure 2.2C.  TLR5  fl tethi 1 ep Uk diuni  PAIc: TAT’.] V  IKK  NKB  1ro-]nf1anirntery Cytokin IL$,114, T-cz / /  huiuit. ad ap tPt in (1 aHttIni(rbiaIun1nhtI1c iepoiise  Figure 2.2C: An outline of Toll-like receptor 5 mediated NF-icB and MAP kinase signaling pathway in human IEC undergoing infection by WT EPEC. 75  Flagellin is expressed by EPEC but not by C. rodentium in LB culture C. rodentium is a related A/E pathogen that infects mice and has recently proven a valuable animal model of human EHEC and EPEC infection and disease. While described as non-motile, the genome of C. rodentium was recently released, and two flagellin genes (F1iC and Flag-2) were found within the C. rodentium genome (32). To clarify whether C. rodentium is truly flagellin deficient, we assessed flagellin expression through immunoblotting using a mouse monoclonal antibody raised against pathogenic Escherichia coli flagella (and broadly cross reactive against most flagellin types). Blotting of culture supernatants of WT EPEC and z\escN EPEC grown overnight in LB (Figure 2.3A) detected a single intense 65kDa band corresponding to F1iC protein. In contrast, we saw no expression of flagellin in the culture supernatant of 4fliC EPEC or in the culture supernatant from C. rodentium. Motility of these microbes was then assessed using 0.3% motility agar plates. Both WT and AescN EPEC were motile (Figure 2.3B), whereas the AfliC EPEC and C. rodentium were non-motile on agar plates. These data confirm that the AfliC EPEC generated in our laboratory was deficient in flagellin protein and indicate that C. rodentium does not express detectable flagellin or flagella when grown in LB broth. To compare how bacterial strains adhered to IECs, we performed a bacterial adherence assay using Caco-2 cells. We infected these cells with WT EPEC, 4fliC EPEC and C. rodentium for 3-4 h. Caco-2 cells were then washed repeatedly, scraped and collected in PBS. An aliquot of the cells was streaked on agar plates and bacterial colonies (CFU) counted the following day. As shown (Figure 2.3C), all strains were found to adhere to Caco-2 cells with maximum adherence (105.3 ± 6 X CFU) noted for WT EPEC. Interestingly, while both 4fliC EPEC and C. rodentium also adhered to Caco-2 cells, their adherence was attenuated compared to WT EPEC.  76  FIiC WT  WT EPEC  zfliC EPEC  \fliC EPEC  AescN EPEC  CR  &scN EPEC  WT CR  Figure 2.3A (upper panel): Flagellin expression in LB culture supernatant of wild type, mutant EPEC and wild type C. rodentium. Flagellin expression was assessed in wild type EPEC (WT EPEC), Flagellin deficient EPEC (zfliC EPEC), T3SS deficient EPEC (AescN EPEC) and  Citrobacter rodentium (CR) grown overnight in LB as described above. Bacterial culture supernatants were filter sterilized and 100 jig of protein subjected to SDS-PAGE in Western blots. Blots were probed with a mouse monoclonal antibody raised against Escherichia coli flagellin and subsequently developed in ECL.  Figure 2.3B (lower panel): AlE bacterial motility assay in 0.3% Agar: LB-Agar (0.3%) plates were inoculated with WT, FIiC deficient EPEC (AfliC), T3SS deficient EPEC (/\escN) and Citrobacter rodentium (CR) and incubated for 48 h at 37°C.  77  120  *  100  80  Bacterial Adherence (1O CFU)  60 40 20 0 WT EPEC  CR  LVZiC EPEC  3h  4h  Figure 2.3C: Bacterial adherence assay in Caco-2 IECs. WT EPEC, AfliC EPEC and Citrobacter rodentium (CR) were used to infect Caco-2 cells for 3-4 h. After infection, cells were washed with DMEM three times and scraped in sterile warm PBS. Serial dilution were prepared, plated on agar plates and incubated overnight. Y-axis: colony forming units (CFU). X-axis: bacterial strains plated at dilution of lOs. Error bars and  *  p<O.O5 vs. AfliC EPEC.  The adherence of C. rodentium was significantly delayed and impaired even compared to z\fliC EPEC. These findings suggest that adherence to intestinal epithelial cells occurs by different mechanisms amongst A/F pathogens and may be attributed to structures such as flagella, pili and fimbriae during the infectious cycle of these microbes in their hosts.  78  Infection by zlfliC EPEC and C. rodentium but not exposure to their supernatants induces IL-8 secretion To date, it is not known if C. rodentium is able to trigger a pro-inflammatory response in TECs in vitro. To assess this, culture supernatants and whole AfliC EPEC and C. rodentium bacteria were added to Caco-2 cells for 3 h. As shown in Figure 2.4, infection with AfliC EPEC bacteria caused a significant 10-fold greater IL-8 secretion compared to its culture supernatant alone (420.5 ± 45 vs. 42.3 ± 7 pg/ml, p<O.O5). Similarly, infection with C. rodentium also yielded IL-8 secretion three-fold higher than its culture supernatant alone (246.3 ± 33.3 vs. 79.4 ± 10 pg/ml, p<0.O5). The IL-8 response elicited by 4fliC EPEC and C. rodentium bacteria was significantly greater than that caused by the laboratory E. coli strain K12 (C. rodentium vs. K12, 242.7 ± 38 vs. 165.7 ± 20 pg/ml, p<0.05. Even so, exposure of Caco-2 cells to K12 induced IL-8 release that was higher than the uninfected control (127  +  18 vs. 38  +  12 pg/ml, p<O.O5). These data suggest that direct infection by  AfliC deficient EPEC and C. rodentium, but not their supematants, induces a significant release of IL-8 from Caco-2 cells.  Toll-like receptorS is activated by WT EPEC but not zXfliC EPEC or C. rodentium supernatant We next assessed whether mammalian TLR5 senses and is activated by bacterial products from EPEC and C. rodentium. HEK 293 cells were transiently transfected with an ELAM-luciferase  reporter (to measure NF-icB activity) and co-transfected with TLR5. We assessed NF-KB activity by measuring luminescence of transfected cells following exposure to purified F1iC or to the supematant taken from the overnight cultures of WT EPEC, tifliC EPEC and C. rodentium. Ultrapure FliC (10 ng/ml, Calbiochem) activated NF-iB in TLR5-transfected cells 50-60 fold when compared to unstimulated cells or cells transfected with an empty vector (Figure 2.5). 79  *  500 450 400 350  **  IL-8 pg/mi  300 250 200 150 100 50 0 Uninfected  LfliC EPEC  1.fliC EPEC Sup  WT CR  CR Sup  K12  Figure 2.4: Infection by flagellin deficient EPEC and C. rodentium but not exposure to their supernatants induces IL-8 secretion. Bacterial culture supematant (Sup) and whole bacteria were prepared as described (Figure 1). 10 p.L of bacterial culture and 200 pL of filter-sterilized bacterial culture supernatant were added to Caco-2 cells in growth media for 3 h. Subsequently, cells were washed, replaced with fresh warm media and treated with gentamycin. Cell culture supernatant was subsequently collected for IL-8 ELISA. Error bars and  *  p<O.O5  vs. uninfected cells and cells  exposed to K12. Similarly, EPEC supematants activated the TLR5 reporter by 20-25 fold relative to TLR5 transfectants treated with an equal volume of LB. In contrast, z\fliC EPEC supernatant activated TLR5 by only 3 fold and C. rodentium supernatant did not cause any significant increase in reporter activity, demonstrating that only WT EPEC supernatant activates cells through TLR5.  80  70 60 50 Fold 40 induction of NF-kB luciferase 30  20 10 0  t  I  Uninfected EPEC  zfliC EPEC  WT CR  Ultra-pure flagellin  Figure 2.5: NF-KB is activated by supernatant of WT EPEC but not AJ7iC EPEC or C. rodentium. HEK 293 cells transiently transfected with ELAM-luciferase NF-icB reporter human TLR5 were exposed to wild type EPEC (WT EPEC), F1iC deficient (4fliC EPEC) EPEC, wild type Citrobacter Rodentium (CR) or exposed to ultrapure Salmonella typhimurium flagellin preparation. NF-id3 activity is represented as fold induction. This activation was specific since WT EPEC supernatant did not activate NF-icB in HEK 293 cells transfected with TLR8, while stimulation with a TLR8 agonist-R484 led to 5-8 fold increase in NF-icB-dependent luciferase activity (data not shown). No significant activity was measured in cells transfected with an empty vector and stimulated under the same conditions. To further clarify whether the inflammatory response generated against C. rodentium is flagellin-independent, we generated a double mutant deficient in the two flagellin genes (F1iC and Flag-2) known to exist in C. rodentium. This mutant strain was then compared to WT C. rodentium for IL-8 response from Caco 81  2 cells. We observed that IL-8 secretion from the mutant strain was similar to that from WT C. rodentium (429 ± 54 vs. 393.5 ± 69 pg/mi). This led us to conclude that flagellin is unlikely to be involved in IL-8 secretion from cultured lECs infected with C. rodentium.  EPEC infection increases MCP-1, MIP3a and /3 defensin-2 gene expression To date, most studies examining epithelial inflammatory responses to EPEC infection have focused on secretion of the neutrophil chemoattractant IL-8 as EPEC infection is associated with neutrophil infiltration (Savkovic SD et a! 1996). Less is known about the recruitment of other inflammatory cells within the human intestine during EPEC infection. Based on the in vivo C. rodentium model, infection may also lead to the influx of macrophages (21) and the upregulated expression of antimicrobial peptides (20). While dendritic cells play an important role in innate responses at the mucosal barrier (10), their role and function in the C. rodentium model of infectious colitis (39) has not been assessed. To address whether epithelial cells could be initiating a similar inflammatory response following EPEC infection, the expression of the monocyte chemoattractant protein MCP- 1, the dendritic cell chemoattractant MIP3a, and the antimicrobial peptide f3-defensin-2 was assessed, and compared to IL-113 treatment as a positive control. As shown in Figure 2.6, infection led to the increased expression of both MCP- 1 and beta defensin-2, in an almost completely FliC-dependent manner. In contrast, significant expression of MIP3cL expression was noted following both WT and AfliC EPEC infection. Interestingly, infection with AescN EPEC was accompanied by the exaggerated expression of all three genes to levels exceeding the expression due to WT EPEC infection, confirming the suppressive role of the LEE encoded T3SS.  82  MCP-I  MIP3c Beta defensin-2  —  __-*  .—  —  Uninf.  WT EPEC  zfliC EPEC  AescN EPEC  IL-i 13  GAPDH —+  Figure 2.6: Infection with WT EPEC increases MCP-1, MlP3ct and Beta defensin-2 gene expression in Caco-2 cells. Cells were grown to confluence in 12 WP and subsequently infected with wild type (WT) and F1iC deficient EPEC (zXfliC), T3SS deficient (AescN) EPEC for 3 h in 2 mL DMEM without antibiotics and serum. After infection, cells were washed twice and fresh media added with gentamycin treatment. Total RNA was extracted from uninfected (Uninf.) and infected cells 6 h after initial infection and subjected to semi-quantitative RT-PCR analysis to assess gene expression as described in Materials and Methods. GAPDH was included as internal control.  4fliC EPEC and C. rodentium induce IL-8 and MlP3asecretion after prolonged infection Since we observed a delayed attachment of 4fliC EPEC and C. rodentium to Caco-2 cells, we assayed the inflammatory response induced after a longer 4 h infection, focusing on IL-8 and MIP3ct secretion from Caco-2 cells. The double mutant AfliC/L\escN EPEC was included to verify our earlier data and exclude possible effects of the T355. As predicted, we found increased IL-8 secretion following zfliC EPEC infection, compared to uninfected controls (584.1 ± 41 vs. 48 ± 23,  p<O.O5) (Figure 2.7A). Similarly, C.  rodentium induced IL-8 secretion was also significantly higher  83  than controls (409 ± 92 vs. 48 ± 23 pg/mI,  p<O.O5).  Importantly, infection for 4 h with both AfliC  and C. rodentium resulted in a substantial increase in IL-8 secretion when compared to 3 h infection (see Figure 4), (z\fliC 584.1 ±41 vs. 420.5 ±4 pg/mi, p<O.05 and C. rodentium 409 ±92 vs. 246.3 ± 33.3, p<O.O5). As expected, the 4fliC/&scN EPEC infection yielded even a greater IL-8 response, when compared to both zXfliC EPEC and C. rodentium. Interestingly, WT EPEC infection for 4 h (compared to 3 h infection-Figure 2.1B and 2.2B) did not significantly affect IL-8 release from Caco-2 cells, suggesting it had reached a plateau.  1200 1000 800 IL-8 pg/mi  600  -  400 200 0 Uninfected  WT EPEC  zfliC EPEC  zfliC/&scN EPEC  WT CR  Figure 2.7A: TL-8 secretion by flagellin deficient AfliC EPEC and C. rodentium after 4 h of infection in Caco-2 cells. Cells grown in 6WP were infected with wild type EPEC (WT EPEC), FliC deficient EPEC (AfliC EPEC), double EPEC mutant lacking F1iC and T3SS (AfliC/escN EPEC) and wild type C. rodentium (CR) for 4 h. After infection, cells were washed and fresh media was added  84  with gentamycin as above. Cell culture supernatant was collected for IL-8 ELISA. Error bars and  *  p<O.05 vs. Uninfected. The secretion of MJP3c from Caco-2 cells after 4 hour infection followed a similar trend to the IL-8 response (Figure 2.7B). Whereas WT EPEC caused a ten-fold increase in MIP3c (1048.3 ± 43 vs. 125 ± 24 pg/ml, p<O.O5), fliC infection produced a seven-fold increase over control (717.5 ± 78 pg/mI, p<O.O5) and C. rodentium infection caused a four-fold increase (479 ± 56 pg/ml, p<O.05). As expected, the double mutant yielded a greater response, similar to that triggered by WT EPEC infection. We conclude that EPEC FIiC triggers a rapid inflammatory response, but that given sufficient time to attach to host cells, both AfliC EPEC and C. rodentium can cause significant IL-8 and M1P3o release from epithelial cells.  1200  1000 800 MIP3o pg/mI  600 400  200  0—  Uninfected  —  WT EPEC  —,  zfliC  E.fliCI&scN EPEC  WT CR  EPEC  Figure 2.7B: MIP3ct secretion by flagellin deficient EPEC and C. rodentium after 4 h of infection in Caco-2 cells. M1P3o protein level in cell culture supematant was quantified by ELISA using the same samples as in Figure 7A. * p<0.05 vs. Uninfected. 85  C. rodentium activates both p38 MAP kinase and NF- B in epithelial cells Based on the similarities in the inflammatory responses triggered by AfliC EPEC and C. rodentium, we tested the possibility that C. rodentium may also preferentially signal through NF-iB rather than p38 MAP kinase. As shown in Figure 2.8A, while C. rodentium activated p38 MAP kinase as shown with an increased 43 kDa band, the activation was modest, and as expected, it was much less than that induced by the supernatant from WT EPEC. In contrast, while both WT EPEC supernatant and C. rodentium decreased I-icB stability in Caco-2 cells after 8 h infection, the band corresponding to C. rodentium infection is of lower intensity compared to the supernatant, suggesting that NF-w.B is a major contributor to the inflammatory response to C. rodentium infection. To test this hypothesis, we assessed the impact of p38 MAP kinase and NF-iB inhibition on the IL-8 response in Caco-2 cells infected with C. rodentium for 4 h, comparing the results to those obtained from cells stimulated for the same duration with t’XfliC EPEC as well as the supernatant from WT EPEC cultures. Exposure to WT EPEC supernatant induced significant IL-8 release that declined three-fold with MAP kinase inhibition (931.8 ± 73 vs. 315.4±28,  p<O.O5)  (Figure 2.8B)  whereas NF-KB inhibition caused only a modest decrease in 1L-8 (931.8 ± 73 vs. 747 ± 92), similar to the results obtained with 3 h stimulation in Figure 2B. NF-icB inhibition yielded a more dramatic decline in the IL-8 release triggered by AfliC EPEC and C. rodentium after 4 h infection, with the  AfliC EPEC IL-8 response infection decreased to approximately 50% in the presence of NF-iB inhibitor (644 ± 97 vs. 339 ± 58, p<O.OS) when compared to AfliC alone. Inhibition of the NF-icB also abrogated C. rodentium IL-8 response approximately 45% (450 ± 48 vs. 247.7 ± 60, p<O.OS). In contrast, MAP kinase inhibition of cells exposed to AfliC EPEC or C. rodentium caused only a 20% 86  decrease in IL-8 levels. The above data support our hypothesis that like 4fliC EPEC, NF-icB contributes to the C. rodentium-induced pro-inflammatory response in Caco-2 cells.  phospho-p38 MAP kinase  —  total-p38 MAP kinase  _If[ Uninfected  WT CR 4h  LJTIIF..  I-kBc, Actin—  Sup WT EPEC 4h  LII  .,.  .  —.  Uninfected  Sup WT EPEC 4h  Sup WT EPEC 8h  .,_,,iF CR 4h  Tr CR 8h  Figure 2.8A: C. rodentium infection activates NF-id3 dependent pathway in Caco-2 cells. Caco-2 cells grown to confluence were exposed to filter-sterilized WT EPEC bacterial culture supernatant (Sup WT EPEC) grown overnight in LB. Similarly, an inoculum of 10 tL from wild type C. rodentium (WT CR) culture grown overnight in LB was used to infect Caco-2 cells for 4 h. Subsequently, cell lysates were prepared as described after 4 h and 8 h of infection. 50 tg of cleared cell lysates were subjected to SDS-PAGE and probed with rabbit polyclonal antibodies to phospho p38 MAP kinase, total MAP kinase (upper panel) and I-id3a (lower panel). Mouse monoclonal antibody was used for detection of Actin (internal loading control). Blots were developed by ECL.  87  1200 1000 800 IL-8 600 pg/mi  -  -  -  -  400 200 0 Uninf.  Sup WT  SB  Bay 11  +  +  Sup WT  Sup WT  lxfliC  Ilili SB  Bay 11  +  +  1fliC  fliC  CR  SB  Bayll  +  +  CR  CR  Figure 2.8B: IL-8 secretion by flagellin-deficient EPEC requires NF-iB in Caco-2 cells. Caco-2 cells grown to confluence were pre-treated with p38 MAP kinase inhibitor (SB 203580, SB-10!iM) and 20 tM NF-xB inhibitor (Bay 11-7085) for 1 h. Cells were subsequently exposed to filter sterilized supernatant from WT EPEC (Sup WT) or infected with FliC-deficient EPEC (AfliC) or C. rodentium (CR) for 4 h. Cells were washed as above and treated with gentamycin. IL-8 was quantified in the cell culture supernatant 24 h after infection. vs. Bay 11  +  4fliC and  t p<0.O5 vs. Bay 11  +  *  p<O.OS vs. SB + Sup WT,  t  p<O.O5  CR.  In vivo C. rodentium infection is associated with rapid MIP3a induction and dendritic cell recruitment As outlined above, EPEC and C. rodentium infection of Caco-2 cells leads to increased expression and release of the dendritic cell chemokine MIP3a. However, it is unclear if a similar response occurs during in vivo A/E bacterial infections, particularly since reports have yet to  88  characterize dendritic cell recruitment into the intestinal mucosa during these infections. To determine the potential in vivo relevance of these findings, C3H/HeJ mice were infected with C.  rodentium and tissues assessed for chemokine responses at day 2 P1. Compared to uninfected tissues, MJP3a expression showed a 5 fold increase in the distal colon by day 2 P1 (Figure 9A). Since mice  do not express IL-8 (38), we also assessed MIP2, another neutrophil chemokine that is expressed by mice and observed a similar 5 fold increase in expression (Figure 2.9B). We have already demonstrated that neutrophil recruitment into the colons of C. rodentium infected mice coincides with an upregulation in MIP2a expression (21). To assess whether the increased MJP3a expression had a functional impact, colonic tissues were immunostained for the dendritic cell marker, CD1 ic (shown in green) and the bacterial Tir protein which is required for the attachment of ALE pathogens to epithelial cells (shown in red). As shown in Figure 9B, few CD1 ic +ve cells were identified within uninfected colonic tissues and no immunoreactivity to Tir is seen, but by day 2 P1, numerous CD1 1C +ve cells were observed within the mucosa often just beneath apical epithelial cells as well as at the base of colonic crypts and in the submucosa (Figure 2.9C). As expected, we detected bacterial Tir in the infected colon mostly localised to the apical surface of epithelial cells, and often in proximity to the CD 1 ic +ve cells. These results clarify that in vivo C. rodentium infection is associated with the recruitment of dendritic cells, putatively in response to increased expression of MIP3cL during infection.  89  A  10 81  C 0  w .  I,  Control  *  Day 2 P1  B  C  Figure 2.9A: C. rodentium infection is associated with increased chemokine gene expression in the infected colon. MIP3u (open bars) and M1P2o (filled bars) expression in control and day 2 postinfected (P1) mice was assessed by q-RT-PCR. As shown, MIP3cL and MIP2o expression at day 2 P1 was significantly increased (* p<O.O5) over control levels. Figure 2.9B and 2.9C: C. rodentium infection leads to dendritic cell recruitment to the infected colon. In contrast to control colon tissues (9B) where few if any CD1 ic +ve cells are detected (green) and no bacterial Tir (a T3SS protein) is 90  seen (red). However, by day 2 P1 (9C), numerous CD1 ic +ve cells are detected in the infected colon (see arrows) and immunoreactive bacterial Tir protein is seen on the apical surface. These putative dendritic cells were predominantly localized near to the colonic lumen as well as at the base of crypts.  91  2.4 Discussion Our data confirm that EPEC flagellin is the major pro-inflammatory molecule found within EPEC culture supernatant. However, aside from inducing IL-8 release from epithelial cells, EPEC infection also activates a spectrum of pro-inflammatory genes including the dendritic cell chemokine MJP3c, monocyte chemoattractant MCP-1 and the anti-microbial peptide f3-defensin-2. Moreover, our studies demonstrate that direct infection by WT EPEC leads to a complex host response involving both the epithelial response to flagellin as well as a delayed inflammatory response that is FliC-independent. This F1iC-independent response includes a subset of F1iC-induced inflammatory genes, including IL-8 and MIP3ci. Like many other Gram-negative bacterial pathogens, both EPEC and C. rodentium possess a T3SS which delivers bacterial effector proteins into host cells (12). While earlier studies have raised the possibility that the EPEC LEE-encoded effectors contribute to pro-inflammatory chemokine secretion (12, 13), our results instead demonstrate that the LEEencoded T3SS does not cause the FliC-independent response, but rather it inhibits both the F1iCdependent and -independent epithelial inflammatory responses. Interestingly, infection with the related mouse specific A/E pathogen C. rodentium also generated an inflammatory response in epithelial cells similar to that raised against 4fliC EPEC. Based on these findings, we were able to identify an early MIP3ct response in vivo that correlates with a rapid influx of dendritic cells into the colonic mucosa of C. rodentium infected mice. Since the discovery that flagellin from enteroaggregative E. coli induces IL-8 release from IECs (40), flagellin from many bacterial pathogens, including EPEC flagellin, have been assessed for their pro-inflammatory roles. These earlier studies found that purified EPEC flagellin induces IL 8 expression in intestinal epithelial cells (47), while similar findings were made with EHEC flagellin (4). While these studies correctly highlighted the importance of EPEC flagellin as the major pro 92  inflammatory bacterial product within the supernatant, it has remained unclear whether AlE pathogens can cause significant inflammatory responses from epithelial cells in the absence of flagellin expression. We propose that simple exposure of epithelial cells to bacterial supernatants is not representative of an actual AlE bacterial infection. While epithelial cells are undergoing direct infection by A/E bacteria, these cells are also exposed to numerous bacterial products, as well as the LEE-encoded T3SS dependent injection of translocated bacterial effector proteins into host cells. Addressing the potential for non-F1iC dependent inflammation is an important question since several studies suggest that EPEC deregulates F1iC expression when exposed to culture media and/or epithelial cells. For example, integration host factor (THF) was found to repress the expression of flagellin in EPEC and EHEC when grown in DMEM (45). Similarly, studies of other bacterial pathogens suggest that while flageflin expression may occur at early stages of infection, or at specific tissue sites, flagellin expression may be reduced or even absent at later stages of infection as was described with Salmonella typhimurium (11). While our demonstration of an inflammatory response occurring in the absence of F1iC was not surprising, it was unexpected that over time it reached a similar intensity to that seen with F1iC expressing WT EPEC, suggesting that Caco-2 cells may rapidly reach a plateau in their inflammatory response. At present it is unclear what bacterial products are responsible for the IL-8 response elicited by AfliC EPEC. Our studies demonstrate that T3SS-translocated effector proteins are not responsible since the AescN strain induces a strong IL-8 response yet is unable to translocate effector proteins into host cells. EPEC does elaborate other virulence factors including Bundle forming pilin (Bfp) and fimbriae (24, 41), thus it is tempting to speculate that these bacterial factors, as well as others may be involved.  93  It is also unclear what host factors are involved in triggering the F1iC-independent IL-8 response. Our assessment of TLR5 activation suggests that neither AfliC EPEC nor C. rodentium significantly induce TLR5 activation. Moreover, we ruled out the possibility that the host response against C. rodentium was directed against flagella by generating C. rodentium mutants deficient in both F1iC and Flag-2 flagellin genes, and testing them for their ability to induce an IL-8 response which was similar to WT C. rodentium infection. Other TLRs could be involved, and in a previous study we showed that both C. rodentium and EPEC activate the LPS receptor TLR4 (19). While we reported that TLR4 activation did contribute to the inflammatory response to C. rodentium, the role of TLR4 in the inflammatory response by IECs during enteric infections remains controversial. Moreover, TLR4 is unlikely to be involved in the IL-8 response we detected in Caco-2 cells since this cell line is known to be hypo-responsive to LPS (1). Others studies have also found that TLR4 expression is very low in Caco-2 cells and these cells lack MD-2 which is required for activation of TLR4 (14). In addition, we found that Caco-2 cells secrete only insignificant quantities of IL-8 when exposed to LPS (data not shown).  Therefore the IL-8 response against zifliC EPEC and C.  rodentium infection is unlikely to involve TLR4. Another explanation for the flagellin-independent responses seen in this study may be that they occur through stimulation of innate NOD2 receptors that detect bacterial muramyl dipeptide (MDP), a component of bacterial pepditoglycan (3) in Caco-2 cells. Since both EPEC and  Citrobacter species possess MDP in their cell walls (7, 16), these components may be shed by bacteria and sensed by NOD2 in Caco-2 cells. Outer membrane proteins of EPEC have also been implicated in iNOS induction in Caco-2 cells (22). However, a specific receptor for recognition of these proteins has yet to be identified. One may surmise that the inflammatory response we detect is  94  multifactorial, and will require significant additional studies to tease out the specific roles of bacterial as well as host factors. Previous studies and our results suggest that the release of chemokines following EPEC infection is dependent on activation of p38 MAP kinase and NF-id3 in Caco-2 cells (Figure 2C). Other groups have also shown activation of ERK and JNK in addition to p38 MAP kinase as a result of EPEC infection in T84 cells (12). In contrast, we found that p38 MAP kinase is the major MAP kinase activated by direct EPEC infection in Caco-2 cells, while only modest activation of ERK and JNK was detected. These results may be explained by the specific characteristics of Caco-2 intestinal epithelial cells. While ERK and JNK were not significantly activated by EPEC in Caco-2 cells, these MAP kinases could be important in the innate responses elicited in other types of IEC such as T84 or HT-29 cells, which are LPS responsive. It is known that p38 MAP kinase activates AP-l and stabilizes IL-8 mRNA transcripts during cytokine induced IL-8 secretion from epithelial cells (19). Interestingly, iXfliC EPEC and C. rodentium both induced lL-8 and MIP3a secretion in epithelial cells in large part through the NF-id3 pathway. Activation of the NF-icB pathway during C. rodentium was also demonstrated in a recent study investigating hyperplasia of colonic epithelial cells (44). In our experiments, the adherence of bacterial strains to Caco-2 cells were unaffected by the pharmacological inhibitors we used to assess the role of MAP kinase and NF-icB. Based on our results, we propose a paradigm whereby flagellin monomers released by EPEC during infection activate p38 MAP kinase and NF-icB pathways, whereas later, non-F1iC dependent responses largely involve NF-icB signaling. We also show that EPEC is able to suppress both F1iC dependent and independent epithelial responses in a LEE-encoded T3SS-dependent manner. Our results further suggest that the LEE-encoded T3SS-mediated suppression of both types of  95  inflammatory responses seen in our study could be a result of blunting NF-id3 signaling since this transcription factor is involved in both flagellin dependent and independent responses. Moreover, Maresca et al (23) showed that EPEC suppression of antimicrobial iNOS in Caco-2 cells is mediated by alteration of NF-iB activity. These authors also found that suppression of iNOS is dependent on EPEC adherence as non-adherent bacteria were unable to modulate NF-xB. The aim of our study was to determine the scope and nature of epithelial pro-inflammatory responses to EPEC and C. rodentium.  We also asked the question whether these responses are  triggered solely by bacterial flagellin, or if other virulence factors, including the LEE encoded T3SS were involved. For our studies, we used the Caco-2 human IECs in which the innate mechanisms and TLR signaling are better characterized. Moreover, these cells are hypo-responsive to LPS, which is thought to be reflective of colonocytes in vivo (1). While C. rodentium would normally infect murine epithelial cells, not much is known about the expression of TLR signaling pathways in murine IEC. Furthermore, results obtained from murine TEC are difficult to interpret due to the lack of specific IL-8 homolog that is characteristic of the innate response in human IEC. Therefore, we reasoned that since C. rodentium can infect human IEC in vitro, infection of Caco-2 cells and direct comparison with the pro-inflammatory response against EPEC was warranted. It will be interesting however, in future studies, to determine if C. rodentium induces any differential responses in murine IEC. We should note that previous studies have also examined the contributions of virulence factors in EPEC that induce inflammatory responses from human intestinal epithelial cells. For example, Czerucka et al (12) tested the role of EPEC LEE encoded T3SS and intimin on IECs responses focusing on phospho-activation of MAP kinase p38 and ERK. However, their studies  96  assessed IL-8 release from LPS responsive T84 cells. Further, these studies were limited as other important chemokines such as MIP3x and antimicrobial peptides were not tested. Some groups have found that C. rodentium colitis is characterized by significant intestinal inflammation in this murine model of colitis, including inflammatory responses by epithelial cells (21, 37). Considering the important role attributed to flagellin in intestinal inflammation and since C. rodentium has been described as a non-motile pathogen, it has remained uncertain how this pathogen causes intestinal inflammation. We confirmed that C. rodentium is not motile in vitro, nor does it activate TLR5 under in vitro conditions.  Despite this, our results indicate that C. rodentium  infection of IEC leads to significant chemokine secretion, comparable to that observed in response to flagellin-deficient EPEC. Since C. rodentium does not activate TLR5 in vitro, another TLR or innate receptor may well be involved in this response. As FliC plays an important role in the recruitment of neutrophils in mucosal inflammation and bacterial colitis (46), the absence of FliC protein expression in C. rodentium may explain why infection by this murine pathogen causes a modest granulocyte infiltration of the infected colon (18). Our findings support the putative role of the intestinal epithelium as the cell population that initiates and directs the inflammatory response against A/E pathogens. While the host response to these pathogens is not well understood, the increased expression of both chemokines as well as antimicrobial peptides has been detected in infected tissues (31, 47). Our data suggest that the expression of these mediators during A/E pathogen infections may be initially due to epithelial cells. Moreover, although neutrophils have been associated with A/E bacterial infections, our data show that EPEC and C. rodentium infected epithelial cells are capable of releasing additional chemokines which signal to and attract DCs to the site of colonic infection and inflammation. At present, the role of DCs in C. rodentium infection is unclear, but these host cells are known to often play a key role in  97  the development of adaptive immunity and have been previously associated with the phagocytosis of other intestinal bacterial pathogens including Salmonella typhimurium. In summary, our data advance the current understanding of epithelial inflammatory responses to AlE pathogens, clarifying that EPEC flagellin can activate TLR5 and induce chemokine and antimicrobial gene expression. As well, we demonstrate that AlE pathogens can trigger a robust epithelial inflammatory response even in the absence of flagellin expression. Dissecting out what will undoubtedly be a complex mix of bacterial and host factors involved in this F1iC independent response will be the focus of future studies. Our data also support findings by Sharma et al (36) that the presence of T3SS inhibits rather than induces epithelial inflammatory responses. Thus, AlE pathogens not only trigger epithelial inflammatory responses, but they may also be able to locally limit these responses, creating protected niches that permit growth and survival of these bacteria in the face of the host response. This protection and development of prolonged infections may lead to greater intestinal inflammation and tissue damage in infected hosts. Addressing both actions and clarifying their in vivo relevance will provide us with a better understanding of the pathogenesis of these infections, and perhaps reveal novel approaches for therapies or vaccination against AlE pathogens.  98  2.5 References: 1. 2.  3.  4.  5.  6.  7.  8. 9. 10. 11.  12.  13.  14. 15.  Abreu, M. T., M. Fukata, and M. Arditi. 2005. TLR signaling in the gut in health and disease. J Immunol. 174:4453-4460. Allen-Vercoe, E., M. C. Toh, B. Waddell, H. Ho, and R. DeVinney. 2005. A carboxy terminal domain of Tir from enterohemorrhagic Escherichia coli 0157:H7 (EHEC 0157:H7) required for efficient type III secretion. FEMS Microbiol Lett. 243:355-364. Barnich, N., J. E. Aguirre, H. C. Reinecker, R. Xavier, and D. K. Podoisky. 2005. Membrane recruitment of NOD2 in intestinal epithelial cells is essential for nuclear factor-kappa B activation in muramyl dipeptide recognition. J Cell Biol. 170:21-26. Ben M. C., A. Darfeuille-Michaud, L. J. Egan, Y. Miyamoto, and M. F. Kagnoff. 2002. Role of EHEC 0157:H7 virulence factors in the activation of intestinal epithelial cell NF kappaB and MAP kinase pathways and the upregulated expression of interleukin 8. Cell Microbiol. 4:635-648. Bramley, A. M., M. A. Khan, H. E. Manson, and R. G. Hegele. 2003. Development of respiratory syncytial virus “bronchiolitis” in guinea pigs does not reflect an allergic predisposition in the host. Chest. 124:671-681. Chakravortty, D., and K. S. Kumar. 1999. Interaction of lipopolysaccharide with human small intestinal lamina propnia fibroblasts favors neutrophil migration and peripheral blood mononuclear cell adhesion by the production of proinflammatory mediators and adhesion molecules. Biochim Biophys Acta. 1453:261-272. Chart, H., and B. Rowe. 1989. The outer membrane protein of enteropathogenic Escherichia coli, described as the ‘localised adherence factor’, is OmpF and probably not involved in adhesion to HEp-2 cells. FEMS Microbiol Lett. 52:29 1-295. Chen, H. D., and G. Frankel. 2005. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol Rev. 29:83-98. Clarke, S. C., R. D. Haigh, P. P. Freestone, and P. H. Williams. 2003. Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin Microbiol Rev. 16:365-378. Colonna, M., B. Pulendran, and A. Iwasaki. 2006. Dendritic cells at the host-pathogen interface. Nat Immunol. 7:117-120. Cummings, L. A., W. D. Wilkerson, T. Bergsbaken, and B. T. Cookson. 2006. In vivo, fliC expression by Salmonella enterica serovar Typhimurium is heterogeneous, regulated by C1pX, and anatomically restricted. Mol Microbiol. 61:795-809. Epub 2006 Jun 2027. Czerucka, D., S. Dahan, B. Mograbi, B. Rossi, and P. Rampal. 2001. Implication of mitogen-activated protein kinases in T84 cell responses to enteropathogenic Escherichia coli infection. Infect Immun. 69:1298-1305. de Gnado, M., C. M. Rosenberger, A. Gauthier, B. A. Valiance, and B. B. Finlay. 2001. Entenopathogenic Eschenichia coii infection induces expression of the early growth response factor by activating mitogen-activated protein kinase cascades in epitheliai cells. Infect Immun. 69:6217-6224. Eckmann, L. 2004. Innate immunity and mucosal bacterial interactions in the intestine. Cuff Opin Gastroenterol. 20:82-88. Gauthier, A., J. L. Puente, and B. B. Finlay. 2003. Secnetin of the enteropathogenic Escherichia coli type III secretion system requires components of the type III apparatus for assembly and localization. Infect Immun. 71:3310-3319.  99  16.  17. 18.  19. 20.  21.  22.  23.  24.  25.  26. 27. 28. 29.  30.  31.  Genereux, C., D. Dehareng, B. Devreese, J. Van Beeumen, J. M. Frere, and B. Joris. 2004. Mutational analysis of the catalytic centre of the Citrobacter freundii AmpD N acetylmuramyl-L-alanine amidase. Biochem J. 377:111-120. Gewirtz, A. T. 2006. Flag in the crossroads: flagellin modulates innate and adaptive immunity. Cuff Opin Gastroenterol. 22:8-12. Higgins, L. M., G. Frankel, G. Douce, G. Dougan, and T. T. MacDonald. 1999. Citrobacter rodentium infection in mice elicits a mucosal Th 1 cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect Immun. 67:303 13039. Hoffmann, E., 0. Dittrich-Breiholz, H. Holtmann, and M. Kracht. 2002. Multiple control of interleukin-8 gene expression. J Leukoc Biol. 72:847-855. limura, M., R. L. Gallo, K. Hase, Y. Miyamoto, L. Eckmann, and M. F. Kagnoff. 2005. Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J Immunol. 174:4901-4907. Khan, M. A., C. Ma, L. A. Knodler, Y. Valdez, C. M. Rosenberger, W. Deng, B. B. Finlay, and B. A. Vallance. 2006. Toll-like receptor 4 contributes to colitis development but not to host defense during Citrobacter rodentium infection in mice. Infect Immun. 74:2522-2536. Malladi, V., M. Puthenedam, P. H. Williams, and A. Balakrishnan. 2004. Enteropathogenic Escherichia coli outer membrane proteins induce iNOS by activation of NF-kappaB and MAP kinases. Inflammation. 28:345-353. Maresca M, M. D., Quitard S, Dean P, Kenny B. 2005. Enteropathogenic Escherichia coli (EPEC) effector-mediated suppression of antimicrobial nitric oxide production in a small intestinal epithelial model system. Cell Microbiol 7:1749-1762. Melo, A. R., E. B. Lasunskaia, C. M. de Almeida, A. Schriefer, T. L. Kipnis, and W. Dias da Silva. 2005. Expression of the virulence factor, BfpA, by enteropathogenic Escherichia coli is essential for apoptosis signalling but not for NF-kappaB activation in host cells. Scand J Immunol. 61:511-519. Michail, S. K., D. R. Halm, and F. Abernathy. 2003. Enteropathogenic Escherichia coli: stimulating neutrophil migration across a cultured intestinal epithelium without altering transepithelial conductance. J Pediatr Gastroenterol Nutr. 36:253-260. Muon, A., E. Oswald, and J. De Rycke. 1999. Rabbit EPEC: a model for the study of enteropathogenic Escherichia coli. Vet Res. 30:203-2 19. Mundy, R., T. T. MacDonald, G. Dougan, G. Frankel, and S. Wiles. 2005. Citrobacter rodentium of mice and man. Cell Microbiol. 7:1697-1706. Nougayrede, J. P., P. J. Fernandes, and M. S. Donnenberg. 2003. Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol. 5:359-372. O’Neil, D. A., E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz, and M. F. Kagnoff. 1999. Expression and regulation of the human beta-defensins hBD-1 and hBD-2 in intestinal epithelium. J Immunol. 163:6718-6724. Parhar, K., A. Ray, U. Steinbrecher, C. Nelson, and B. Salh. 2003. The p38 mitogen activated protein kinase regulates interleukin- ibeta-induced IL-8 expression via an effect on the IL-8 promoter in intestinal epithelial cells. Immunology. 108:502-512. Ramirez, K., R. Huerta, E. Oswald, C. Garcia-Tovar, J. M. Hernandez, and F. Navarro Garcia. 2005. Role of EspA and intimin in expression of proinflammatory cytokines from  100  32.  33. 34.  35.  36.  37. 38.  39.  40.  41.  42. 43.  44.  45.  enterocytes and lymphocytes by rabbit enteropathogenic Escherichia coli-infected rabbits. Infect Immun. 73:103-113. Ren, C. P., 5. A. Beatson, J. Parkhill, and M. J. Pallen. 2005. The Flag-2 locus, an ancestral gene cluster, is potentially associated with a novel flagellar system from Escherichia coli. J Bacteriol. 187:1430-1440. Rothbaum, R. J., R. A. Giannella, and J. C. Partin. 1982. Diarrhea caused by adherent enteropathogenic E. coli. J Pediatr. 101:486. Savkovic, S. D., A. Koutsouris, and G. Hecht. 1997. Activation of NF-kappaB in intestinal epithelial cells by enteropathogenic Escherichia coli. Am J Physiol. 273:C1 1601167. Savkovic, S. D., A. Koutsouris, and G. Hecht. 1996. Attachment of a noninvasive enteric pathogen, enteropathogenic Escherichia coli, to cultured human intestinal epithelial monolayers induces transmigration of neutrophils. Infect Immun. 64:4480-4487. Sharma, R., S. Tesfay, F. L. Tomson, R. P. Kanteti, V. K. Viswanathan, and G. Hecht. 2006. Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol. 290:G685-694. Epub 2005 Dec 2001. Sherman, M. A., and D. Kalman. 2004. Initiation and resolution of mucosal inflammation. Immunol Res. 29:241-252. Song, F., K. Ito, T. L. Denning, D. Kuninger, J. Papaconstantinou, W. Gourley, G. Klimpel, E. Balish, J. Hokanson, and P. B. Ernst. 1999. Expression of the neutrophil chemokine KC in the colon of mice with enterocolitis and by intestinal epithelial cell lines: effects of flora and proinflammatory cytokines. J Immunol 162:2275-2280. Spahn, T. W., C. Maaser, L. Eckmann, J. Heidemann, A. Lugering, R. Newberry, W. Domschke, H. Herbst, and T. Kucharzik. 2004. The lymphotoxin-beta receptor is critical for control of murine Citrobacter rodentium-induced colitis. Gastroenterology. 127:14631473. Steiner, T. S., J. P. Nataro, C. E. Poteet-Smith, J. A. Smith, and R. L. Guerrant. 2000. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest. 105:1769-1777. Tatsuno, I., R. Mundy, G. Frankel, Y. Chong, A. D. Phillips, A. G. Torres, and J. B. Kaper. 2006. The lpf gene cluster for long polar fimbriae is not involved in adherence of enteropathogenic Escherichia coli or virulence of Citrobacter rodentium. Infect Immun. 74:265-272. Ulshen, M. H., and J. L. Rollo. 1980. Pathogenesis of escherichia coli gastroenteritis in man--another mechanism. N Engl J Med. 302:99-10 1. Vallance, B. A., W. Deng, M. De Grado, C. Chan, K. Jacobson, and B. B. Finlay. 2002. Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen citrobacter rodentium in infected mice. Infect Immun. 70:6424-6435. Wang, Y., G. S. Xiang, F. Kourouma, and S. Umar. 2006. Citrobacter rodentium-induced NF-kappaB activation in hyperproliferating colonic epithelia: role of p65 (Ser536) phosphorylation. Br J Pharmacol. 148:814-824. Epub 2006 Jun 2005. Yona-Nadler, C., T. Umanski, S. Aizawa, D. Friedberg, and I. Rosenshine. 2003. Integration host factor (IHF) mediates repression of flagella in enteropathogenic and enterohaemorrhagic Escherichia coli. Microbiology. 149:877-884.  101  46. 47.  Yu, Y., S. Sitaraman, and A. T. Gewirtz. 2004. Intestinal epithelial cell regulation of mucosal inflammation. Immunol Res. 29:55-68. Thou, X., J. A. Giron, A. G. Torres, J. A. Crawford, E. Negrete, S. N. Vogel, and J. B. Kaper. 2003. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun. 71:2120-2129.  102  Chapter 3: Differentiation dependent expression of Single IgG IL-i related receptor (Sigirr) inhibits Toll-like receptor and cytokine responses in human intestinal epithelial cells. 3.1 Introduction The TECs lining the human colon undergo continuous transition from an undifferentiated and proliferative state at the base of colonic crypts to a mature and differentiated phenotype at the crypt apex (5). Throughout this transition, IECs are exposed to a multitude of commensal and pathogenic microbes, including their products such as LPS and flagellin. Under steady state conditions, IECs remain generally quiescent and tolerant of these products, as they have evolved critically important yet poorly defined mechanisms to remain hypo-responsive to these stimuli (3). In part, this tolerance is maintained by limiting the activation of innate receptors in IECs, which express a specific subset of TLRs such as TLR5 and TLR9 (required for detecting bacterial flagellin and CpG DNA respectively) (1, 17), and low levels of TLR2 and TLR4 (2). In addition to these cell surface receptors, the intracellular innate receptor NOD 1 is also expressed constitutively by JECs, whereas NOD2 is only expressed during inflammation (12). Numerous studies have shown that these innate receptors are involved in the host’s recognition of enteric  pathogens such as Shigella, Salmonella typhimurium and Enteroaggregative Escherichia coli (3, 9, 26) triggering inflammation and playing a central role in host defense. Footnote: Re: Manuscript status A version of this chapter has been submitted for publication to the Journal of Immunology in January 2009 titled: Differentiation dependent expression of Single IgG IL-i related receptor (Sigirr) inhibits Toll-like receptor and cytokine responses in human intestinal epithelial cells. Mohammed A. Khan, Jingtian T. Huang, Theodore S. Steiner, Kiran Assi, Bill Salh, Isabella T. Tai, Xiaoxia Li and 103  Bruce A.Vallance. Considering that dysregulated activation of TLRs in the GIT could impair host defense as well as lead to chronic inflammation and cancer, it is not surprising that IECs have evolved strategies to control innate sensing, including the expression of negative regulators of TLRs. Negative regulators inhibit TLRs by binding key adaptor proteins such as IRAK thereby impeding downstream signaling to NF-icB (25). To our knowledge, negative regulators of innate receptors expressed by IECs such as TLR5 and TLR9 have not been previously reported. However, it seems likely that the function of these regulators controls a broad range of innate and inflammatory responses elicited in the GIT. Identifying negative regulators, clarifying their roles and expression patterns in human IECs could significantly increase our understanding of gastrointestinal health and disease. The single IgG IL-i receptor (Sigirr) was first described as a negative regulator of IL-i 1 and TLR4 signaling (29). Expressed throughout the human 01 tract with highest expression in the colon (27), Sigirr was recently shown to regulate inflammation as well as mucosal homeostasis in a mouse model of chemical colitis (30); however, the mechanisms involved as well as the cellular distribution of Sigirr within the intestine remains obscure. The objectives of this study were therefore to characterize the expression and elucidate the role of Sigirr in regulating the immune responsiveness of human JEC. We show that Sigirr inhibits responses to several TLR ligands as well as signaling from the intracellular receptor NOD 1. Moreover, the innate response to infection by the attaching and effacing bacterial pathogen Enteropathogenic  Escherichia coli (EPEC), which causes diarrheal disease, was also modulated by Sigin. In addition, responses to several pro-inflammatory cytokines e.g. IL-l7, which like TLRs require IRAK and TRAF6 for signaling, were abrogated by Sigirr. In contrast, IEC responses to IFN7 104  and PMA stimulation were unaffected by Sigirr. Interestingly, we found that Sigirr expression directly correlated with the differentiation state of cultured IECs, a finding that was corroborated in the epithelium of human colonic biopsies. These findings designate SIGIRR as a critical modulator of IEC inflammatory responses within the human colon and highlight the need to address Sigirr function in the context of host responses to enteric pathogens and idiopathic intestinal diseases including IBD.  3.2 Materials and Methods Cell culture Caco-2, HT-29 IECs (ATCC) and TLR5 expressing 1-IEK 293T cells (Invivogen) were grown in DMEM with 10% serum and antibiotics. NCM46O is a human non-transformed colonic mucosal IEC line (20) grown in M3 medium. CHO cells stably co-transfected with human TLR5 and NF-icB luciferase reporter were gifted by Dr. Stuart Turvey (department of Pediatrics, UBC) and maintained as described (4). WC were used for experiments 3-5 days after confluence.  Sigirr gene silencing and over-expression studies Gene silencing was performed with Sigirr and control siRNA duplexes for transient transfection with Hiperfect (Qiagen). The uptake of duplexes by IECs was confirmed by fluorochrome-tagged control SiRNA. Two sets of Sigirr 27-mers siRNA (NAPS, UBC) duplexes were tested simultaneously with negative control siRNA. A single duplex that produced greater knockdown of target gene was selected for transfection. IECs were assessed 48-72 hours post transfection. The pUNO-Sigirr mammalian expression vector and empty pUNO control vector (Invivogen) were used to generate stable clones. These were selected and maintained in media  105  with serum and blasticidin (20-40 pg/ml). Sigirr knockdown and over-expression was analyzed by western blot and RT-PCR.  Western analysis, ELISA and semi-quantitative RT-PCR Exposure of Caco-2 cells to TLR ligands, infection, ELISA and western immunoblotting were performed as described previously (13). IECs were lysed in RLT buffer (Qiagen) and RNA extracted with RNeasy Minikits (Qiagen) as recommended by manufacturer. 1-2 micrograms of RNA were reverse transcribed into eDNA and RT-PCR conditions were optimized as described (13). Primers in this study are listed below.  Table 3.1: List of oligonucleotide primers used in this study Target Gene  Forward  Reverse  GAPDH  5’ atgaccttgcccacagcc3’  5’ cccatcaccatcttccag3’ (13)  Sigirr  5’ gctgactgcaaggacagaga3’  5’ actcgtggaggctgtagtgg3’ (27)  IL-8  5’ tctgcagctctgtgtgaaggtgcagtt3’  5’ ttcctttgacccacgtctcccaa3’ (21)  Stimulation and infection of JEC Recombinant purified and LPS free bacterial flagellin (Enteroaggregative Escherichia coli and Salmonella Typhimurium), LPS, Pam3Cys, ieDAP and TLR5 neutralizing antibody (Invivogen) were prepared according to manufacturer’s specifications. Recombinant IL-113, IL-  106  17, TNFc and PMA (Sigma) were prepared according to manufacturer’s specification. The wildtype Enteropathogenic Escherichia co/i (EPEC) strain 2348/69 was used in this study (8).  Intestinal biopsy sampling and immunofluorescent staining Two human colonic biopsies were obtained at a single pass using standard crocodile biopsy forceps. Informed consent was obtained from all patients undergoing diagnostic colonoscopy for lower gastrointestinal symptoms such as abdominal pain and altered bowel movements. Study approval was obtained from the UBC Clinical Ethics Review Board. Tissue samples were rapidly processed for immunofluorescence, with staining of colonic tissues performed as described previously (10) with a rabbit polyclonal and a goat polyclonal antibody to Sigirr (R&D), mouse monoclonal antibody to Claudin-3 (Invitrogen), rabbit polyclonal antibody to Indian Hedgehog (Santa Cruz Biotechnology), and rabbit polyclonal antibody to TLR5 (Proscience) all at 1:200 dilution. These were followed by secondary Alexa 568/488conjugated goat anti-rabbit IgG antibodies (Molecular Probes) and Prolong® Gold antifade reagent containing DAPI (Invitrogen). Cells and tissues were visualized at 350 and 594 nm using a Leica DM 4000B microscope (Leica Microsystems).  Data presentation and statistical analysis All the results are expressed as the mean value ± standard error of the mean. Results are from one representative experiment out of at least three. Statistical analysis was performed using the one-way ANOVA test and student t-test with p<0.05 considered significant. Quantity-one software (Chemidoc XRS-Bio-Rad, USA) was used for densitometry.  107  3.3 Results Bacterialflagellin induces Sigirr expression in human IECs While Sigirr has been shown to regulate the inflammatory response to LPS, it is unclear if it regulates the responses to other TLR ligands such as flagellin. We exposed human NCM (non transformed colonic mucosal) IECs to flagellin (F1iC), which transiently decreased Sigirr protein levels by 50% after 12 h. However, prolonged exposure to flagellin (24-48 h) significantly increased Sigirr protein levels by 50-100% over baseline (Figure 3.1A). To assess if enteric bacterial infection also alters Sigirr expression, we infected Caco-2 IECs with Enteropathogenic  E. coli (EPEC). We recently showed that the inflammatory response to EPEC is triggered by flagellin activation of TLR5 in TECs (13). Through RT-PCR analysis, we observed transient down regulation of Sigirr message by approximately 30% after 6 h, which subsequently increased by  50-60% over baseline at 24-48 h of EPEC infection (Figure 3.1B). The suppression of Sigirr was found to correlate with the induction of IL-8 mRNA in Caco-2 IECs infected with EPEC for 6 h  (Figure 3.1C). These results indicate that Sigirr expression is dynamically regulated during innate response to flagellin, and this regulation inversely correlates with IL-8 gene expression.  108  -  Sigirr  —  Actin  I  —  Unstim.  12h  24h  48h  HT-29  FIiC  Figure 3.1A: Exposure to bacterial flagellin induces Sigirr protein expression in nontransformed human colonic (NCM) IECs. NCM were grown in M3 growth media and exposed to 10 ng/ml purified flagellin (FliC). Cell lysates were prepared as described in materials and methods. 30-50ig of cleared cell lysates were subjected to SDS-PAGE and probed with rabbit polyclonal antibody to Sigirr. Blots were developed in ECL. Result representative of three experiments.  Sigirr  1  GAPDH Uninf.  6h  12h  24h  HT-29  WT EPEC  Figure 3.1B: EPEC infection down-regulates Sigirr expression in Caco-2 IECs. Cells were grown to confluence in 12 WP and infected with WT EPEC for 3 h. After infection, cells were washed twice and fresh media added with gentamycin to prevent bacterial growth. Total RNA extracted at different time-points was subjected to semi-quantitative RT-PCR to measure gene expression as described in Materials and Methods. GAPDH was included as internal control. Blot representative of three independent experiments.  109  -  IL-8 GAPDH Uninf.  6h  12h  24h  WT EPEC  Figure 3.1C: EPEC infection increases IL-8 expression in Caco-2 JECs. Cells were grown to confluence in 12 WP and infected with WT EPEC for 3 h as above. Afterwards, cells were washed twice and fresh media added with gentamycin. Total RNA was extracted and subjected to semi-quantitative IL-8 RT-PCR. GAPDH was included as internal control. Blot representative of two separate experiments. Sigirr gene silencing augments responses to bacterial flagellin The transient downregulation of Sigirr gene expression and its correlation with IL-8 release suggests an intrinsic mechanism in IECs, in which a temporary reduction of Sigirr protein allows TLR activation leading to chemokine responses. We therefore assessed if Sigirr gene silencing would lead to augmentation of TLR responses in JECs. Transient gene silencing reduced Sigirr protein levels by 50% in Caco-2 IECs (Figure 3.2A), and following exposure to F1iC, these cells produced a two-fold increase in IL-8 secretion compared to cells transfected with non-silencing control SiRNA (NSC) (1280.25 ± 68.6 vs. 615 ± 152.9 pg/ml, (Figure 3.2B).  110  p<O.05)  Sigirr Actin  4500  NSC SiRNA  Sig SiRNA  4000 3500 Arbitrary density units  3000  *  2500 2000 1500 1000  500 0  Figure 3.2A: Transient gene silencing reduces Sigirr protein in Caco-2 cells. IECs (2 X 10 /well) 5 were seeded in 24 WP. After 48h, cells were transfected with Sigirr and non-silencing control (NSC) SiRNA in Hiperfect transfection reagent. Sigirr protein was analyzed by SDS-PAGE as described in materials and methods and developed in ECL. Bands were quantified by densitometry by Bio-rad quantity-one software.  1600 *  1400 1200 1.000  IL-8 pg/mi  800 600  400 20:  +  FliC  Figure 3.2B: Sigirr gene silencing augments flagellin induced IL-8 chemokine secretion from Caco-2 cells. Sigirr and NSC SiRNA transfected Caco-2 cells were exposed to 10 ng/ml purified flagellin (FliC) in DMEM with serum and antibiotics. Cell culture supernatant was collected after 6h and IL-8 quantified by ELISA. Error bars and  *  p<O.05 vs. NSC SiRNA + F1iC.  Sigirr gene silencing augments diverse TLR signaling To ensure the actions of Sigirr were not cell line specific, we silenced Sigirr in the HT-29 enterocytic IECs. After 70% knockdown of Sigirr mRNA (Figure 3.2C), we noted that IL-8 release doubled in response to F1iC (971 ± 143.8 vs. 423.67 ± 85.5 pg/mi, p<O.O5) as shown in  Figure 3.2D. To confirm TLR5 involvement, we examined the F1iC response in the presence of a neutralizing antibody to TLR5 which abolished IL-8 release in Sigirr deficient HT-29 IECs (971  143.8 vs. 153 ± 52 pg/ml, p.<O.O5) (Figure 3.2D), but did not affect IL-1 dependent  responses. To address whether the inhibition of innate signaling by Sigirr was limited to TLR5, we also tested other TLR ligands in the LPS responsive enterocytic HT-29 cells (18). In these IECs (Figure 3.2E), we saw a three-fold increase in their F1iC response (1108 ± 149.9 vs. 392.3 ±  72.5 pg/ml, p<O.O5), a two-fold increase in their LPS response (870.6 ± 66.9 vs. 435.3 ± 57.7 pg/ml, p<O.OS), and a four-fold increase in response to Pam3Cys (833.3 ± 123.5 vs. 154.6 ± 20.4 pg/ml, p<O.O5). We also tested TLR9 responses and found similar elevations in IL-8 release (data not shown). Notably, while Sigirr gene silencing amplified inflammatory responses to TLR ligands, it had no effect on IL-8 responses to PMA (Figure 3.2E). To assay the potential impact of Sigirr in regulating the IL-8 response to an enteric bacterial pathogen, we infected HT-29 cells with EPEC. We noted that EPEC induced a significantly higher IL-8 response in Sigirr deficient  112  cells (609.79 ± 163 vs. 281.5 ± 67.3 pg/mi,  p<O.O5)  (Figure 3.2F), demonstrating that loss of  Sigirr enhances the chemokine response to this bacterial pathogen.  Sigirr  ,  GAPDH  .  NSC SiRNA  Sigi SiRNA  Sig2 SiRNA  NCM  4500 4000 3500  Arbitrary density units  3000  -  2500 2000 1500 1000 500  -  -  0-  Figure 3.2C: Transient gene Silencing decreases Sigirr gene expression in HT-29 cells. IEC (2 x /well) were seeded in 24 WP and transfected after 48 h with Sigirr and non-silencing control 5 10 (NSC) SiRNA. Total RNA was extracted and Sigirr gene expression measured by semiquantitative RT-PCR. GAPDH was included as internal control. Blot is representative of three experiments and bands were analyzed by densitometry.  113  1600  1400 1200  IL-8 n/m1 t  000  800 600 400 200 0  NeutT5  NSC SiRNA + FIiC  NeutT5  NeutT5  +  +  +  Sig SiRNA  IL-i f3  NSC SiRNA  +  FIiC  +  +  FIiC  F1iC  NeutT5  IL-I 13  Figure 3.2D: Sigirr gene silencing augments TLR5 mediated IL-8 secretion. SiRNA transfected HT-29 cells were exposed to F1iC (10 ng/ml), in presence and absence of a specific TLR5 neutralizing antibody. Cell culture supernatant was collected after 6 h and IL-8 quantified by ELISA. IL-113 (5 ng/ml) was included as positive control. Error bars and SiRNA + F1iC and Sig SiRNA + F1iC.  é# 114  *  p<O.O5  vs. NSC  1400  *  1200 *  1000  IL-8 pg/mi  800 600 400 200 0 NSC SiRNA  Sig SiRNA  NSC SiRNA  Sig SiRNA  Sig SIRNA  SRNA +  +  PMA  PMA  +  +  +  +  +  +  FIiC  FIiC  LPS  LPS  Pam  Pam  Figure 3.2E: Sigirr gene silencing augments diverse TLR responses in IECs. SiRNA transfected HT-29 cells were exposed to FIiC (10 ng/ml), LPS (20 ng/ml), Pam3Cys (Pam-20 ug/ml) and Phorbol myristate acetate (PMA-50 ng/ml) for 6 hours in DMEM with serum and antibiotics. Cell culture supernatant was collected and IL-8 quantified by ELISA. Error bars and NSC SiRNA + F1iC, NSC SiRNA + LPS and NSC SiRNA + Pam.  115  *  p<O.05 vs.  900  -  *  800 700 600 IL-8 pg/mi  H -  500 400  H  300  T  200 100 0NSC SiRNA  Sig SiRNA  +  +  EPEC  EPEC  Figure 3.2F: EPEC infection up-regulates chemokine response in Sigirr deficient HT-29 cells. IEC were grown to confluence and infected with wild type EPEC for 3 h. After infection, cells were washed twice and fresh media added with gentamycin treatment. Cell culture supernatant was collected after 12 h for IL-8 ELISA. Error bars and  *  p<O.O5 vs. NSC SiRNA + EPEC.  Sigirr suppresses pro-inflammatory cytokine responses While IEC encounter a number of TLR ligands within the gut, they are also exposed to pro-inflammatory cytokines, particularly during chronic inflammatory disorders, e.g. IBD. As Sigirr negatively regulates IL-13, we hypothesized that Sigirr deficiency would also augment responses to other pro-inflammatory cytokines i.e. IL-17, that require IRAK and TRAF6 for signaling to NF-icB. Knockdown of Sigirr in HT-29 cells caused a two-fold increase in IL-8 secretion after stimulation with IL-113 (1492.6 ± 223.3 vs. 721.6 ± 107.3 pg/ml, p<O.O5), IL-17  (2145.66 ± 150 vs. 1047 ± 141 pg/mi, p<O. ) and TNFct (933.82 ± 44.07 vs. 369.41 ± 93.52 05 116  pg/mi, p.<O.05) compared to controls (Figure 3.2G). In contrast, the IL-8 response to WNy stimulation, which predominantly involves the JAK-STAT pathway instead of IRAK and TRAF, was unaffected by Sigirr knockdown.  2500  2000 *  I  1500  IL-8 pg/mi  *  1000  NSC SiRNA  Sig S’RNA  +  +  IL-13  IL-13  NSC SiRNA  Sig SiRNA  NSC SIRNA  +  +  +  +  +  +  IL-17  IL-17  TNFc  TNFa  IFN  IFN  Sig SiRNA  NSC SiRNA  Sig SiRNA  Figure 3.2G: Sigirr deficiency in IEC increases chemokine response to inflammatory cytokines. SiRNA transfected HT-29 cells were exposed to IL-1 (5 ng/ml), IL-17 (20 pg/ml, TNFo (10 ng/ml) and IFN gamma (10 ng/ml) for 6-12 hrs. Cell culture supernatant was collected and IL-8 quantified by ELISA. Error bars and  *  p<O.O5  vs. NSC SiRNA + IL-1f, NSC SiRNA + IL-17  and NSC SiRNA + TNFo.  117  Immunocytochemical analysis of Sigirr expression in human IECs While IEC express Sigirr, it is unknown if this is related to cell density or confluency of 1EC. We first assessed Sigirr staining in HEK 293T cells. While no signal was detected in cells transfected with control vector (Figure 3 .3A), immunostaining of cells stably overexpres sing Sigirr revealed a homogenous cytoplasmic green signal corresponding to Sigirr protein (Figure 3.3B). Specificity was confirmed by incubation with the Sigirr peptide, which abolished Sigirr immunoreactivity (Figure 3.3C vs. Figure 3.3D). Next, we stably over-expressed Sigirr in Caco-2 and HT-29 IECs and analyzed the pattern of Sigirr expression by immunocytochemistry. Interestingly, unlike in HEK 293T cells, Sigirr expression in native spontaneously differentiating Caco-2 cells was found to be patchy and clustered in cells growing in smaller colonies (Figure  3.3B), with staining localized to the cell membrane as well as in a punctate pattern within the cytoplasm. We observed increased Sigirr immunoreactivity in Caco-2 cells seeded at higher cell densities (Figure 3.3F vs. 3.3E), and in Sigirr over-expressing Caco-2 (Figure 3.3H vs. 3.3G) and HT-29 (Figure 3.3J vs. 3.3!) cells relative to controls.  118  611  Figure 3.3: Immunofluorescent staining for Sigirr expression in HEK 293T cells and human IECs. HEK 293T cells grown on coverslips were stably transfected with pUNO Sigirr overexpression vector (b) and the control vector (b). After formalin fixation, Sigirr expression was analyzed using a rabbit polyclonal antibody and Alexafluor 468 (green) conjugated secondary antibody. Sigirr antibody was pre-incubated with full length Sigirr peptide and used for staining Sigirr over-expressing cells (d) vs. Sigirr antibody alone (c), nuclei (blue) stained with prolongGold dapi. Native Caco-2 cells grown on coverslips were assessed for Sigirr expression with a goat polyclonal primary Sigirr antibody and Alexa fluor 568 conjugated (red) and dapi nuclear stain (blue). Caco-2 cells seeded at lower density (e) and higher density (f). Immunostaining in Caco-2 cells over-expressing Sigirr (h) and control (g). HT-29 cells overexpressing Sigirr (j) and control vector (i). Magnification 20X. Over-expression of Sigirr dampens NF-id? mediated TLR and cytokine responses To assess the impact of increased Sigirr levels on TLR and cytokine induced responses, we stably overexpressed Sigirr in Caco-2 and HT-29 IECs, as well as in CHO cells (Figure 3.4A) (transfected with NF-id3 luciferase reporter) and in TLR5 expressing HEK 293T cells. NF KB luciferase activity decreased by approximately 25% in CHO cells over-expressing Sigirr  (Figure 3.4B), while in Caco-2 IEC, IL-8 release in response to F1iC declined by 30% (Figure 120  3.4C-upper panel) compared to control (581.6 ± 103 vs. 870.33 ± 150 pg/mi,  p<O.05).  These  data were reproduced in HEK 293T cells stably co-expressing TLR5 and Sigirr (295.8 ± 90.3 vs. 571.6 ± 109.4 pg/mi, p<O.O5) (Figure 3.4C-lower panel). Over-expression of Sigirr in HT-29  IECs also reduced IL-8 responses to F1iC, LPS and Pam3Cys (Figure 3.4D), as well as responses to IL-113 and IL-17, which declined by 25% and 60% respectively (Figure 3.4E). These results confirm that increasing Sigirr expression attenuates TLR signaling and depresses responses to pro-inflammatory stimuli in IECs.  Sigirr GAPDH  —  pUNO 1  Y  NCM  pUNO Sig  S -Ji  Sigirr Ac tin  pUNO  pUNQ Sig  Figure 3.4A: Stable over-expression of Sigirr in HT-29 and Caco-2. IECs were stably transfected with pUNO Sigirr mammalian expression vector or empty pUNO vector with Effectene transfection reagent. Clones over-expressing Sigirr were maintained in blastocidin and subsequently assessed for Sigirr by RT-PCR and immunoblotting. Blots are representative of at least two experiments.  121  45000 40000 35000 30000 Relative Luciferase units  -  --  -  *  25000 20000 15000 10000 5000  —  H H -  j  Unstim.  F1iC  Figure 3.4B: Sigirr over-expression abrogates NF-iB activity. CHO cells containing a NF-icB luciferase reporter were stably transfected with Sigirr over-expressing pUNO vector and control vector. Clones were maintained in blastocidin and subsequently tested for flagellin (F1iC) responses. Whole cells lysate was collected after 6 h and relative luciferase activity measured by luminometry.  *  p<O.O5 vs. pUNO + FliC and unstimulated cells.  122  1200  -  1000  800-  IL-8 pg/mi  600  400  200 7  0— Unstim.  pUNO +  FIiC  pUNO Sig +  FIiC 800 700  600  —  1  500 *  IL-8 pg/mi  300 200 100 -  0 Unstim.  pUNO +  FIiC  Figure 3.4C: Over-expression of Sigirr blunts F1iC induced chemokine response. HT-29 IECs (upper panel) and HEK 293T cells (lower panel) overexpressing Sigirr were exposed to 10 ng/ml of flagellin (FliC) for 6 h and IL-8 quantified by ELISA in cell culture supernatant. Error bars and  *  p<O.05 vs. pUNO + F1iC. 123  1000 900 800  600 500 400 300  -  -  700  IL-8 pg/mi  -  -  -  -  -  -  *  200 100  -  -  0-  pUNO +  LPS FIiC  1600 1400 1200  pUNO Sig  pUNO  +  Pam  pUNO Sig  +  +  Pam  LPS  -  -  -  *  1000 1•1  *  0  1I-0  pg/mi 600 400 200 0  I  pUNO +  IL-113  I  I  pUNO Sig  pUNO  +  IL-17  +  pUNO Sig +  IL-17  IL-113  Figure 3.4 (D and E): (D-upper panel) Over-expression of Sigirr blunts IL-8 responses to TLR ligands and inflammatory cytokines. Stably transfected HT-29 cells over-expressing Sigirr were exposed to 10 ng/ml Flagellin (F1iC), 20 ng/ml of LPS and 20 ug/mi of Pam3Cys (Pam) for 6 h  124  in DMEM, and JL-8 secretion quantified by ELISA. Error bars and pUNO  +  LPS and pUNO  +  *  p<O.05  vs. pUNO  +  F1iC,  Pam. (E-lower panel) IECs over-expressing Sigirr were exposed to  IL-1f3 (5 ng/ml) and IL-17 (20 pg/mI) for 6-12 hr and IL-8 quantified as above. Error bars and p<O.05 vs. pUNO  +  IL-1j3 and pUNO  +  *  IL-17.  Sigirr regulates intracellular Nucleotide Oligomerization Domain 1 (NOD]) innate receptor Colonic IECs are known to express NOD1 (14) and to a lesser degree NOD2 receptors, which requires the adaptor protein-RIP2 for signaling from the cell membrane (16). As Sigirr likely functions in closely proximity to membrane TLRs (25), we asked whether the NOD1 and NOD2 signaling pathways are also modulated by Sigirr. Stimulation of NOD 1 with its ligand ieDAP (Figure 3.5A) caused a two-fold increase in IL-8 secretion from Sigirr deficient Caco-2 cells vs. control (1249.7 ± 208 vs. 497 ± 35 pg/mi, p<O.O5), while NOD2 responses to MDP were unaffected, possibly because of low NOD2 expression by these cells. Moreover, over-expression of Sigirr expression (Figure 3.5B) decreased the NOD1-ligand-induced IL-8 secretion (644  +  57 vs. 360.6  +  92.33 pg/ml, p<O.O5),  whereas the NOD2 response was again not altered. We speculate that Sigirr likely binds the NOD1 adapter-Rip2, and confirmed this interaction by immunoprecipitating Sigirr with a Rip2 antibody and immunoblotting for Sigirr (Figure 3.5C). Our results suggest that in Caco-2 cells, NOD1 is likely to be expressed in the cell membrane and negatively regulated by Sigirr.  125  1600  t  1400 1200  1000  IL-8 pg/mi  200  600 400  I  200 0  Unstim.  ieDAP  Sig SiR  NSC +  ieDAP  MDP  i NSC +  MDP  +  ieDAP  I Sig SiR +  MDP  Figure 3.5A: Stimulation of NOD1 receptor up-regulates IL-8 secretion from Sigirr deficient IECs. Native Caco-2 and SiRNA transfected monolayers were exposed to NOD1 ligand-ieDAP (20 igIml) or NOD2 ligand-MDP (25 igIml) for 12 h. IL-8 secretion in cell culture supernatant  was quantified by ELISA. Error bars and  *  p<O.O5  ieDAP.  126  vs. unstimulated and t p<O.05 vs. NSC +  900 800 700 600  IL-8 pg/mi  500 400 300 200  r  100 0  Unstim.  ieDAP  pUNO +  pUNO Sig  ieDAP  MDP  pUNO +  MDP  +  ieDAP  pUNO Sig +  MDP  Figure 3.5B: Sigirr over-expressing TEC are less responsive to NOD1 stimulation. Stably overexpressing HT-29 cells are stimulated with NOD1 ligand-ieDAP (20 tg/m1) or NOD2 ligand MDP (25 gIm1) for 12 h. IL-8 secretion in cell culture supernatant was quantified by ELISA. Error bars and  *  p<O.O5 vs. unstimulated and * p <0.05 vs. pUNO + ieDAP.  IPRi2 WB Sigirr  1E1  WB Rip2 pUNO Sigirr  pUNO  Figure 3.5C: Sigirr co-immunoprecipitates with intracellular Rip2 adapter protein. 300ug of total proteins from Sigirr over-expressing HT-29 (pUNO Sig) and control cells (pUNO) was 127  incubated with a mouse monoclonal antibody to Rip2 in Agarose A-plus beads and subjected to SDS-PAGE (upper panel). Blots were probed for Sigirr with rabbit polyclonal antibody by western immunoblotting. Membranes were stripped and re-probed with a mouse monoclonal antibody to total Rip2 (lower panel).  Sigirr expression depends on the differentiation state of IECs The patchy staining for Sigirr observed in the midst of spontaneously differentiating Caco-2 cell colonies (Figure 3B) suggested that Sigirr expression was possibly related to the differentiation state of IECs. We examined this possibility using sodium butyrate, an agent known to induce IEC differentiation (11). Exposure to sodium butyrate progressively increased Sigirr protein levels in Caco-2 cells after 24 h and 72 h (Figure 3.6A). Sigirr expression also increased significantly in untreated spontaneously differentiating Caco-2 cells (Figure 3E-J). These results indicate that the level of Sigirr expression in IECs is linked to their differentiation state. To verify this, we investigated dipeptidyl dipeptidase expression (DPP), a brush border associated marker of differentiation in colonic IECs (22). Immunocytochemical analysis revealed that DPP was patchy and confined to small clusters of cells (Figure 3.6B), remarkably similar to Sigirr staining pattern (as in Figure 3.5B). Further, Sigirr staining co-localized with DPP expression (Figure 3.6C), suggesting that Sigirr expression coincides with this brush border enzyme.  Sigirr Actin  J. Pre-confluent control  24h  48h  72h —1  Sodium Butyrate  128  Post confluent  Figure 3.6A: Sigirr expression in Caco-2 cells is dependent on the differentiation state. (A) Caco-2 monolayers were exposed to sodium butyrate (2 mM) for 24-72 h in DMEM supplemented with serum and antibiotics. 30-50 ig of total protein from pre-confluent, sodium butyrate treated and spontaneously differentiating post-confluent cells were probed with Sigirr rabbit polyclonal antibody in western blots. Result representative of two experiments.  Figure 3.6B: Caco-2 cells express the differentiation marker Dipeptidyl dipeptidase (DPP) in IEC monolayers. Formalin fixed Caco-2 monolayers grown on coverslips were incubated with  mouse monoclonal DPP antibody conjugated with Alexa fluor-488 (green). Cell nuclei stained with dapi. Magnification 40X. Result representative of three independent experiments.  129  Figure 3.6C: Sigirr co-localizes with the differentiation marker DPP in Caco-2 cells. Cells grown low density (10 /well) were fixed in 4% formalin and incubated simultaneously with goat 4 polyclonal Sigirr antibody (a-red) with mouse monoclonal DPP antibody conjugated to Alexa fluor 488 (b-green) and nuclear dapi stain (c-blue). Images taken with Zeiss fluorescent microscope were merged to show co-localization (d). Result representative of two independent experiments. Magnification 20X. Sigirr is expressed by differentiated IECs in the human colon Next, we stained for Sigirr expression in human colonic biopsy sections. By immunofluorescence, we detected maximal Sigirr expression on the apical surface of colonic crypts (Figure 3.7A), with the signal diminishing in cells at their base. Additional sporadic staining was also observed in the colonic lamina propria. To address whether Sigirr expression was localized to IECs, we stained for the tight junction protein claudin-3 (23). As expected, claudin-3 staining was maximal on the lateral intercellular junctions of the IEC, while Sigirr 130  staining was most intense on the apical surface of these TEC (Figure 3.7B). To confirm that Sigirr was predominantly expressed by differentiated epithelial cells, we further stained for Indian hedgehog (Ihh), a marker of differentiated apical JECs (19). We found abundant Ihh protein  in  epithelial cells  that  were  also  expressing  Sigirr  (Figure  3.7C).  Since  immunolocalization for TLR5 has been reported previously on the surface epithelium in human colonic tissues (7), we investigated if TLR5 expression is similar to Sigirr expression in human tissues sections. As in Figure 3.7D, expression of TLR5 was most intense in surface of the colonic crypts compared to isotype control, and occurred in cells that were expressing Sigirr. These findings are consistent with our data in cultured IEC, and confirm that within the human colon, Sigirr is predominantly expressed by differentiated TEC.  131  Figure 3.7A: linmunohistochemical analysis of Sigirr expression in human colonic tissues. Colonic tissues obtained at biopsy were fixed in formalin and prepared as described in materials and methods. 6-8 uM sections were mounted on slides and incubated with either control antibody  132  (a), or goat polyclonal antibody to Sigirr (b and c). Immunoreactivity to epithelial Sigirr (red) is prominent on apical surface (arrows).  Figure 3.7B: Epithelial Sigirr expression co-localizes with Claudin-3 tight junction protein in human colon. Colonic tissues from biopsy were prepared as described. 8-10 microns sections were mounted on slide and double immunostaining performed with goat polyclonal Sigirr and mouse monoclonal Claudin-3 antibody. Sigirr immunoreactivity (a-red) co-localized with Claudin-3 (b-green) in epithelial cells on crypt surface (d-arrow). Nuclei stained with dapi (blue) stain.  133  Figure 3.7C: Indian Hedgehog (11TH) expression by IEC coincides with Sigirr expression in human colon. Colonic tissues from biopsy were prepared as described. Double immunostaining was performed with a goat polyclonal Sigirr antibody and a rabbit polyclonal antibody to IHH. Sigirr immunoreactivity (a-red) co-localized with 11TH (b-green) in epithelial cells on crypt surface (d-arrow). Nuclei stained with dapi (blue) stain.  134  Figure 3.7D: Staining for TLR5 is detected in cells also expressing Sigirr on the surface of colonic crypts. Isotype control (a). Double immunostaining for TLR5 with a rabbit polyclonal antibody and Sigirr with goat polyclonal antibody was performed. Sigirr (b-red) staining is observed in TLR5 (c-green) expressing epithelial cells (e-arrow), Dapi nuclear stain (d-blue). Magnification 20X.  135  3.4 Discussion This study is aimed at elucidating the inhibitory functions of Sigirr in the human colonic epithelium. Our results indicate that Sigirr may play a major role in maintaining the hypo responsiveness of IECs to a variety of pro-inflammatory stimuli. We show for the first time that bacterial flagellin as well as direct infection of IECs with the enteric bacterial pathogen EPEC causes a transient decrease in Sigirr expression that temporally correlates with the expression and release of the neutrophil chemokine IL-8. Sigirr gene silencing in IECs significantly and selectively enhanced IL-8 secretion in response to TLR ligands and augmented responses to proinflammatory cytokines that also signal through TRAF6 and IRAK. Conversely, stable overexpression of Sigirr diminished the same TLR and cytokine responses. Furthermore, we demonstrate that Sigirr negatively regulates intracellular NOD1 responses, in concert with its association with the adapter protein-Rip2. While exploring different cell density of JECs, we determined that Sigirr expression increases with the differentiation state of these cells in culture. Correspondingly, Sigirr expression was found to be minimal in cells at the base of human colonic crypts and maximal in the mature epithelial cells at the crypt apex, providing a basis for the previously identified hypo-responsiveness of mature IECs to bacterial products. The recent demonstration of exaggerated colitis and tumorigenesis in Sigirr deficient mice designated this receptor as potentially important in gastrointestinal inflammation; however the underlying mechanism remained unclear. Although Sigirr is known to suppress TLR4 and IL-i 13 signaling, whether exaggerated signaling through these receptors led to the resulting pathology was unknown. In part, this is because the potential role of Sigirr in regulating other innate receptors expressed at higher levels, such as TLR5 within the gut epithelium, has not been examined. It is now evident that the function of important innate receptors as well as pro 136  inflammatory cytokines including IL-17 and TNFc are regulated by Sigirr within JECs. Based on the broad actions of Sigirr, we speculate that it likely affects responses to other members of the IL-i superfamily such as IL-22 (32), as well as other cytokines such as IL-25 (31), that require IRAK and TRAF6 for downstream signaling in IECs. Moreover, as our findings suggest negative regulation of NOD 1 receptor by Sigirr, the structural basis for these interactions requires further investigation. Since IECs are known to differentiate while migrating apically in colonic crypts, the expression of Sigirr in differentiating IECs was previously unknown. Interestingly, we found that the differentiation agent sodium butyrate (15) induced expression of Sigirr in TECs. We noted a similar increase in Sigirr expression in spontaneously differentiating Caco-2 monolayers, indicating that differentiation of 1EC promoted Sigirr expression. Immunohistochemical analysis of human colonic tissues confirmed that Sigirr protein levels were maximal in differentiated IECs. These data are consistent with earlier studies in which IEC differentiation down-regulated IL-113 induced chemokine secretion (5). Furthermore, epithelial differentiation is also known to be a key determinant of antimicrobial peptides secretion, a defense mechanism that protects hyporesponsive differentiated IECs (11). Taken together, these findings support our hypothesis that Sigirr expression within IECs is related to their differentiation state. We propose that in  differentiated IEC, innate responses are controlled to prevent unwanted inflammatory responses against commensal microbes, whereas in less differentiated cells, lack of Sigirr leads to heightened epithelial responses, which may relate to the more sterile environment found at the base of crypts. Presumably the broad regulatory actions of Sigirr in differentiated IECs prove beneficial by limiting maladaptive inflammatory responses against commensal microbes encountered by 137  IECs within the human colon. However as recently shown, limited activation still occurs and plays a critical role in the maintenance of colonic mucosal integrity (6, 10). In fact, TLR2, TLR4 and TLR9 signaling have all been shown to contribute to normal IEC function, at least in mice, and this TLR stimulation may in fact be regulated by Sigirr, as epithelial homeostasis appears dysregulated in the absence of Sigirr (30). It is less certain what role Sigirr may play in enteric host defense. The observed transient downregulation of Sigirr in response to flagellin and EPEC reflects a measured host chemokine response induced in IECs that potentially leads to the moderate neutrophil recruitment required for clearance of enteric bacterial pathogens, limiting these illnesses to a few days in most cases.  Certainly, TEC expression of TLR5 have been  respectively shown to play a critical role, at least in vitro in recognizing and responding to flagellated enteric pathogens (28). Based on our findings, Sigirr dysregulation could contribute to the development of chronic inflammation, as seen in IBD, not only based on responses to microbes, but also to endogenous cytokines such as TNFo and IL-17 that damage JECs (24). Some individuals may possess single nucleotide polymorphisms in the Sigirr gene altering the function and/or distribution. As such, identifying single nucleotide polymorphisms and possible defects of Sigirr gene in human subjects should be a priority. These findings also indicate that Sigirr modulation may prove to be of therapeutic benefit. In steady state conditions, IECs are exposed to minimal amounts of flagellin and butyrate derived from commensal bacteria in the gut. Both factors may facilitate the expression of Sigirr and perhaps other negative regulators and thereby offer attractive targets in developing therapy of inflammatory disorders.  138  3.5 References: 1. 2.  3. 4.  5.  6. 7.  8.  9. 10.  11.  12. 13.  14.  Abreu, M. T., M. Fukata, and M. Arditi. 2005. TLR signaling in the gut in health and disease. J Immunol 174:4453-4460. Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, and M. Arditi. 2001. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol 167:1609-1616. Artis, D. 2008. Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat Rev Immunol 8:411-420. Blohmke, C. J., R. E. Victor, A. F. Hirschfeld, I. M. Elias, D. G. Hancock, C. R. Lane, A. G. Davidson, P. 0. Wilcox, K. D. Smith, J. Overhage, R. E. Hancock, and S. E. Turvey. 2008. Innate immunity mediated by TLR5 as a novel antiinflammatory target for cystic fibrosis lung disease. J Immunol 180:7764-7773. Bocker, U., A. Schottelius, J. M. Watson, L. Holt, L. L. Licato, D. A. Brenner, R. B. Sartor, and C. Jobin. 2000. Cellular differentiation causes a selective down-regulation of interleukin (IL)-lbeta-mediated NF-kappaB activation and IL-8 gene expression in intestinal epithelial cells. J Biol Chem 275:12207-12213. Cario, E., G. Gerken, and D. K. Podolsky. 2007. Toll-like receptor 2 controls mucosal inflammation by regulating epithelial barrier function. Gastroenterology 132:1359-1374. Cario, E., and D. K. Podoisky. 2000. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun 68:7010-7017. de Grado, M., C. M. Rosenberger, A. Gauthier, B. A. Valiance, and B. B. Finlay. 2001. Enteropathogenic Escherichia coii infection induces expression of the early growth response factor by activating mitogen-activated protein kinase cascades in epithelial cells. Infect Immun 69:6217-6224. Fritz, J. H., R. L. Ferrero, D. J. Philpott, and S. E. Girardin. 2006. Nod-like proteins in immunity, inflammation and disease. Nat Immunol 7:1250-1257. Gibson, D. L., C. Ma, C. M. Rosenberger, K. S. Bergstrom, Y. Vaidez, J. T. Huang, M. A. Khan, and B. A. Valiance. 2008. Toll-like receptor 2 plays a critical role in maintaining mucosal integrity during Citrobacter rodentium-induced colitis. Cell Microbiol 10:388-403. Hase, K., L. Eckmann, J. D. Leopard, N. Varki, and M. F. Kagnoff. 2002. Cell differentiation is a key determinant of cathelicidin LL-37/human cationic antimicrobial protein 18 expression by human colon epithelium. Infect Immun 70:953-963. Hruz, P., and L. Eckmann. 2008. Caspase recruitment domain-containing sensors and adaptors in intestinal innate immunity. Curr Opin Gastroenterol 24:108-114. Khan, M. A., S. Bouzari, C. Ma, C. M. Rosenberger, K. S. Bergstrom, D. L. Gibson, T. S. Steiner, and B. A. Valiance. 2008. Flagellin-dependent and -independent inflammatory responses following infection by enteropathogenic Escherichia coli and Citrobacter rodentium. Infect Immun 76: 1410-1422. Kim, J. G., S. J. Lee, and M. F. Kagnoff. 2004. Nodi is an essential signal transducer in intestinal epithelial cells infected with bacteria that avoid recognition by toll-like receptors. Infect Immun 72:1487-1495.  139  15.  16.  17.  18.  19.  20.  21.  22.  23.  24. 25.  26.  27.  28. 29.  Laprise, P., M. J. Langlois, M. J. Boucher, C. Jobin, and N. Rivard. 2004. Downregulation of MEK/ERK signaling by E-cadherin-dependent PI3KJAkt pathway in differentiating intestinal epithelial cells. J Cell Physiol 199:32-39. Lecine, P., S. Esmiol, J. Y. Metais, C. Nicoletti, C. Nourry, C. McDonald, G. Nunez, J. P. Hugot, J. P. Borg, and V. Ollendorff. 2007. The NOD2-RICK complex signals from the plasma membrane. J Biol Chem 282:15197-15207. Lee, J., J. H. Mo, K. Katakura, I. Alkalay, A. N. Rucker, Y. T. Liu, H. K. Lee, C. Shen, G. Cojocaru, S. Shenouda, M. Kagnoff, L. Eckmann, Y. Ben-Neriah, and E. Raz. 2006. Maintenance of colonic homeostasis by distinctive apical TLR9 signalling in intestinal epithelial cells. Nat Cell Biol 8:1327-1336. Lee, S. K., T. Ii Kim, Y. K. Kim, C. H. Choi, K. M. Yang, B. Chae, and W. H. Kim. 2005. Cellular differentiation-induced attenuation of LPS response in HT-29 cells is related to the down-regulation of TLR4 expression. Biochem Biophys Res Commun 337:457-463. Madison, B. B., K. Braunstein, E. Kuizon, K. Portman, X. T. Qiao, and D. L. Gumucio. 2005. Epithelial hedgehog signals pattern the intestinal crypt-villus axis. Development 132:279-289. Moyer, M. P., L. A. Manzano, R. L. Merriman, J. S. Stauffer, and L. R. Tanzer. 1996. NCM46O, a normal human colon mucosal epithelial cell line. In Vitro Cell Dev Biol Anim 32:315-317. Parhar, K., A. Ray, U. Steinbrecher, C. Nelson, and B. Salh. 2003. The p38 mitogen activated protein kinase regulates interleukin-ibeta-induced IL-8 expression via an effect on the IL-8 promoter in intestinal epithelial cells. Immunology 108:502-5 12. Peiffer, I., M. F. Bernet-Camard, M. Rousset, and A. L. Servin. 2001. Impairments in enzyme activity and biosynthesis of brush border-associated hydrolases in human intestinal Caco-21TC7 cells infected by members of the AfaIDr family of diffusely adhering Escherichia coli. Cell Microbiol 3:341-357. Prasad, S., R. Mingrino, K. Kaukinen, K. L. Hayes, R. M. Powell, T. T. MacDonald, and J. E. Collins. 2005. Inflammatory processes have differential effects on claudins 2, 3 and 4 in colonic epithelial cells. Lab Invest 85:1139-1162. Sands, B. E. 2007. Inflammatory bowel disease: past, present, and future. J Gastroenterol 42:16-25. Shibolet, 0., and D. K. Podoisky. 2007. TLRs in the Gut. IV. Negative regulation of Tolllike receptors and intestinal homeostasis: addition by subtraction. Am J Physiol Gastrointest Liver Physiol 292:G 1469-1473. Steiner, T. S., J. P. Nataro, C. E. Poteet-Smith, J. A. Smith, and R. L. Guerrant. 2000. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest 105:1769-1777. Thomassen, E., B. R. Renshaw, and J. E. Sims. 1999. Identification and characterization of SIGIRR, a molecule representing a novel subtype of the IL-1R superfamily. Cytokine 11:389-399. Vijay-Kumar, M., and A. T. Gewirtz. 2008. Guardians of the gut: newly appreciated role of epithelial toll-like receptors in protecting the intestine. Gastroenterology 135:351-354. Wald, D., J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, I. Towne, J. E. Sims, G. R. Stark, and X. Li. 2003. SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol 4:920-927. 140  30.  31.  32.  Xiao, H., M. F. Gulen, J. Qin, J. Yao, K. Bulek, D. Kish, C. Z. Altuntas, D. Wald, C. Ma, H. Zhou, V. K. Tuohy, R. L. Fairchild, C. de la Motte, D. Cua, B. A. Vallance, and X. Li. 2007. The Toll-interleukin-1 receptor member SIGIRR regulates colonic epithelial homeostasis, inflammation, and tumorigenesis. Immunity 26:461-475. Zaph, C., Y. Du, S. A. Saenz, M. G. Nair, J. G. Perrigoue, B. C. Taylor, A. E. Troy, D. E. Kobuley, R. A. Kastelein, D. J. Cua, Y. Yu, and D. Artis. 2008. Commensal-dependent expression of IL-25 regulates the IL-23-IL-17 axis in the intestine. J Exp Med 205:21912 198. Zheng, Y., P. A. Valdez, D. M. Danilenko, Y. Hu, S. M. Sa, Q. Gong, A. R. Abbas, Z. Modrusan, N. Ghilardi, F. J. de Sauvage, and W. Ouyang. 2008. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 14:282289.  141  Chapter 4: Conclusions 4.1 Bacterial flagellin and epithelial biology In recent years, several studies have elucidated the roles played by commensal microbes in normal gastrointestinal physiology and pathology. These studies have revealed that the beneficial effects of commensal bacteria on the host are mediated through a direct effect on the IECs, which express TLRs to sense bacterial products. It is known that signals emanating from IECs are relayed to the underlying immune cells that continuously communicate with the epithelial layer. It is believed that antigen presenting DCs resident in the lamina propria of the intestine, are distinct from the DCs from other sites as they are involved the sampling of luminal contents including commensal bacteria. As JECs and DCs are the only type of cells that interact with the commensal flora, these interactions are thought to be required for the maintenance of homeostasis and normal digestive functions in the GI tract. The commensal bacterial population is curtailed temporarily during enteric infection by bacterial pathogens such as EPEC, a process that is referred to as loss of colonization resistance. Loss of commensal microbes and the expression of virulence factors contribute to the pathology as seen in infectious gastroenteritis. It is clear that both commensal flora and IECs are important not only for host defense against enteric pathogens, but also for normal physiological functions in the large intestine. Enteric pathogens infect IECs in many different ways, utilizing a variety of mechanisms involving virulence factors that subvert cellular functions and lead to epithelial barrier disruption. Virulence factors such as flagellin, T3SS and pili were traits acquired during evolution by pathogenic bacteria to colonize and infect hosts. Although perceived as harmful, some beneficial effects of these virulence factors have come to light in recent studies. The rationale for these beneficial effects may be explained by the concept that during bacterial  142  infection, the pathogen attempts to prolong the survival of host cells in order to extract maximum beneficial effects for its own growth and multiplication. This is perhaps more relevant for invasive pathogens such as EIEC, which are able to escape the harsher environment of the lumen to safer niches within the JEC. Once inside the cytoplasm of TECs, these bacterial pathogens inhibit innate receptors and escape immune surveillance. This microbial strategy is especially applicable to JECs since intracellular killing mechanisms are not as well developed in these cells as compared to professional phagocytic immune cells such i.e. macrophages. While recognition of flagellin by TLR5 is essential for host defense against flagellated bacterial pathogens, recent studies have revealed a protective role of flagellin acting on IECs. Several groups have independently demonstrated that bacterial flagellin from enteric pathogens promotes survival of IECs. For example, while infection with flagellin-deficient strains of Salmonella reduced pro-inflammatory responses, it also diminished the anti-apoptotic signals in EEC when compared to infection with wild type strains, in murine models of Salmonellosis (91). Similarly, aflagellate Salmonella activated epithelial Caspase-3 and diminished the levels of the anti-apoptotic protein c-TAP in ileal tissues of C3HIHeN mice compared to WT controls. These findings were reproduced in cultured IECs where Caspase-8 and Caspase-9 pathways were significantly accelerated following infection with aflagellate Salmonella, compared to infection with the WT strain (91). It is unknown if flagellin from attaching and effacing pathogens like EPEC are also able to enhance survival of TECs. Since EPEC intimately attaches to host cells and introduces effector proteins through the T3SS, it is possible that EPEC flagellin may act in a similar manner to facilitate survival of EEC, at least until the bacterium is intimately attached to host cells. Extension of the life span of TECs would facilitate EPEC’s targeting of vital organelles  143  such as mitochondria by introducing the Map effector, and prolong the subversive activities within IECs. The beneficial effects resulting from activation of TLR5 were investigated by Burdelya et al in murine and primate models of radiation injury. They showed that pretreatment with CBLB5O2, a synthetic polypeptide that selectively activates TLR5, protected animals from radiation-induced injury that occurs in the GI tract and bone marrow (11). Exposure to full body radiation specifically induces apoptosis of the stem cells located at the base of intestinal crypts. This leads to loss of height in intestinal villi and decreased ability to absorb nutrients. The mechanism of radioprotection following TLR5 stimulation is believed to involve G-CSF and IL6 induction in IECs, both of which promote proliferation of crypt epithelial cells. Similarly, administration of flagellin also protected mice from DSS colitis and enteric rotaviral infection (90). Interestingly, LPS pretreatment was found to protect against chemical injury; but in contrast to flagellin, LPS also caused acute lung injury and sepsis. These findings suggest that TLR5 stimulation leads to relatively selective host responses that promote cytoprotection and survival. A recent study also showed that flagellin induced oxidant stress leads to the expression of the protective heat shock protein (Hsp)25 in non-transformed rat IEC-18 cells (71). Hsp are an immunoregulatory family of proteins induced in the response to cellular stress, infection and chronic inflammation (88). By inducing anti-inflammatory cytokines such as IL-lO, Hsps are believed to suppress inflammatory responses. While invasive Salmonella induces expression of Hsp, it is not known if flagella from luminal pathogens like EPEC and EAEC can also stimulate Hsp production in IEC. It is unclear how TLR5 stimulation can generate innate responses and at the same time also prolong the survival of JECs. These effects likely involve NF-iB, which has 144  pleitropic downstream effects including innate responses, cell survival and differentiation (48). More studies are needed to examine the possible beneficial effects of EPEC flagellin in JECs. In addition to TLR5 expressed on the cell membrane, cytosolic recognition of flagellin is an important host defense mechanism against invasive pathogens such as Salmonella typhimurium. The intracellular Nod-like receptor (NLR) known as IPAF, is required for sensing flagellin in the host cell cytoplasm and contributes to innate responses (64). Salmonella typhimurium activates IPAF by injecting flagellin into the cytoplasm of host macrophages, leading to IL-13 production (82). In contrast, Shigella infection of macrophages leads to IPAF induced activation of Caspase-l, pyroptosis and autophagy, independently of flagellin (83). While the role of IPAF is better understood in macrophages, its expression in human TECs has not been investigated. There is a single report of IPAF expression in the airway epithelial cell line A549 (92). In this study, infection of A549 cells with Legionella pneumophila increased mRNA levels of IPAF, whereas knockdown resulted in increased bacterial replication. Since IPAF is required for sensing Salmonella flagellin in macrophages and for host defense in airway epithelial cells, it is quite likely that IPAF is also expressed by human IECs. Although innate responses to EPEC infection in IEC is largely determined by TLR5 signaling, small amounts of flagellin could leak into the IEC through the T3SS, especially if there are abundant flagellin monomers synthesized in the bacteria. Interestingly, there is evidence that T3SS in Salmonella and Shigella is required for injecting SipB and Ipa proteins, respectively, to induce inflammasome mediated Caspase-1 activation (27). The T3SS assembly, which is initiated by disruption of the host cell membrane is a common molecular event during infection of IEC by A/E bacteria and invasive pathogens. Given this dual role of T3SS in infection, EPEC effectors that are injected into IECs would be expected to activate cytoplasmic innate NLRs. These 145  mechanisms are important because they may account for flagellin independent responses observed during EPEC and Citrobacter rodentium infection of IECs, as presented in this thesis. Together, these findings suggest that although innate recognition of flagellin is important for sensing enteric pathogens, host innate sensing also occurs independently of flagellin and may contribute to diarrheal disease.  4.2 Bacterial factors in human inflammatory disorders Acquisition of virulence traits is not restricted to true pathogens and has also been identified in commensal bacteria isolated from the GI tract. A role of bacterial flagellin in IBD was first proposed by Lodes et al in 2004 (55). Since then other studies have also described the bacterial flagellin CBirl derived from commensal populations as an important antigen that activates adaptive immunity in Crohn’s disease (70, 84). The Escherichia coli MG1655 is a commensal that expresses flagellin and is capable of activating apical TLR5 in mouse ileal tissues (5). Studies based on murine ileal loops mounted in Ussing chambers suggest that  Escherichia coli MG1655 induces the secretion of pro-inflammatory KC (a homolog of human IL-8) and also activates NF-kB during chemokine release in Caco-2 and HT-29 JECs. Serological expression cloning identified the flagellated bacteria from the Clostridium cluster XIVA, which are members of the Firmicutes family of commensal bacteria (23). Serum IgG from patients with Crohn’s disease as well from colitic mice reacted with flagellin from this strain and sequence analysis indicated resemblance to Salmonella FliC. Collectively, the findings from these studies indicate that flagellin synthesized by commensal bacteria is capable of stimulating innate responses in host cells. It is important to mention that although both pathogens and commensal bacteria may express flagella, only pathogenic bacteria are able to disrupt the epithelial barrier and increase the permeability of the epithelium. These alterations in the 146  epithelial layer lead to an influx of bacterial derived products which overwhelms host defenses and subsequently results in inflammation. Commensal bacteria generally lack the pathogenicity islands that encode the expression of some virulence factors, and therefore generally do not disrupt the epithelial barrier. Recently, flagellin independent responses were also proposed to account for IL-8 secretion by JEC infected with an E. coli strain isolated from Crohn’s disease patients (81). These authors found that flagellin shed from mucosa associated-AlEC induced IL-8 release only when the epithelial integrity was compromised in HT-29 IEC. In contrast, some AlEC isolates that induced IL-8 secretion independently of flagellin, were able to do so only if the mucosal integrity was preserved and not compromised. Both flagellin dependent and independent responses depended on MAP kinases and did not significantly involve NF-iB pathway. Some researchers have identified specific strains of E. coli that are frequently isolated from 1RD patients. The first evidence of an E. coti that adhered to ileal mucosa in patients with Crohn’s disease was reported by Boudeau et al in 1999 (10). This group of bacteria, referred to as adherent invasive E. coli (AlEC), was able to replicate and survive within macrophages (35). Exposure to the commensal lactobacillus casei DN 114001 inhibited the adherent and invasive ability of AlEC in human IECs (43). Interestingly, AlEC isolated from LBD patients produced granulomas in vitro (62) and bound to the CEACAM6 receptor during colonization of the ileal mucosa (7). CEACAMs are a family of proteins involved in both intercellular adhesion and in signaling events leading to cellular differentiation (36). CEACAMs expressed by Caco-2 IEC are required for internalization of diffusely adherent E. coli (DAEC) expressing the AfafDr family of adhesions (Dr+). Internalization of Dr+ DAEC also requires P1-3K, lipid raft and microtubule rearrangement in Caco-2 cells (37) and bladder epithelial cells (47). Cross linking of 147  CEACAM6, also known as CD66b, leads to secretion of IL-8 from neutrophils (75). It is not known if cross-linking or activation of CEACAM6 would produce a similar IL-8 response in IECs. Although the involvement of CEACAMs in EPEC infection has not been addressed, a diffuse form of Afa adhesion has been previously identified in the 055 serogroup of EPEC (45). The mechanisms outlined above may lead to the flagellin-independent responses observed during EPEC infection of EEC, and in the CR model of colitis. While flagellin has been identified as an important antigen in IBD, it is still not clear how flagellin translocates across the epithelial barrier to activate basolateral TLR5. Further, the signaling events arising from TLR5 activation leading to acute and/or chronic inflammation are  poorly understood. One possibility is that flagellin may be responsible for causing acute flare ups in IBD, leading to the recruitment of neutrophils to the intestinal mucosa. The presence of neutrophils is associated with much of the tissue damage and subsequent pathological changes seen in lED. The finding that commensal bacteria are required for the development of experimental colitis supports a role for microbial products in triggering acute inflammation. While TLR expression in the human gut is poorly characterized, it is generally believed that TLR5 is expressed on the basolateral surface of the columnar epithelium. However, other studies have described apical stimulation of the murine intestine with flagellin, leading to chemokine responses (5). It may be hypothesized that TLR5 expression is significantly higher on the basolateral surface the EEC, whereas minimal expression of TLR5 occurs on the apical surface of the human intestinal epithelium. A differential expression of TLR5 may explain how the beneficial effects of flagellin are generated, enhancing the survival of IECs and protecting against excessive inflammation by inducing Hsp25. In contrast, enteric pathogens are likely to increase epithelial 148  permeability leading to an influx of flagellin and profound TLR5 activity at the basolateral membrane. In support of this concept, it has been reported that stimulation of apical TLR9 prevents pro-inflammatory responses by unknown mechanisms, whereas activation of basolateral TLR9 leads to NF-icB mediated inflammation in polarized epithelia as well as in TLR9 knockout mice (52). In chronic intestinal inflammation, the apical versus basolateral TLR expression pattern could be reversed and there may be an increase in TLR4 levels, which are expressed minimally under steady state conditions in IECs. As to why stimulation of apically expressed TLRs would produce less inflammatory responses is not known. One reason could be the existence of gangliosides, a family of sialic acid containing sphingolipids in the outer plasma membrane of epithelial cells (78, 96). Gangliosides such as asialoGM 1, which inhibit TLR5 signaling, may be preferentially expressed on the apical surface of intestinal epithelium. Interestingly, the addition of exogenous gangliosides abolish TLR2, TLR3 and TLR6 responses by up-regulating IRAK-M, a negative regulator of TLR in PBMC (78). Previous studies have also reported an inhibitory role for gangliosides in TLR4 signaling in DCs and monocytes (14). Interestingly, supplementation of infant milk formula with gangliosides has been shown to modify the microbial flora of the intestine (74), facilitating expansion of Bifidobacteria and also lowering the numbers of pathogenic E. coli strains. We have shown that EPEC infection suppresses IL-8 responses in IECs. This may potentially involve upregulation of gangliosides that are targeted by a T3SS delivered effector, thereby blunting or delaying host inflammatory responses. Such a strategy would allow the bacterial pathogen to colonize and infect host cells relatively unopposed until neutrophils are recruited to the site of infection through other signals. It is therefore tempting to suggest that gangliosides may be an attractive therapeutic approach to prevent excessive TLR activation in the gut. It is also possible 149  that gangliosides function in concert with negative regulators such as Sigirr in IECs to prevent exacerbations in innate and inflammatory pathways.  These are interesting topics for  investigation in future studies and would increase our understanding of gangliosides and host defense in the epithelium.  4.3 EPEC virulence factors and diarrheal disease The attaching and effacing pathogen-EPEC possesses a number of virulence factors that are expressed in a sequential manner in response to environmental signals. In the large intestine, EPEC infection is likely to be initiated via flagellin, for motility through the mucus layer, which forms a sheet-like covering on the epithelial surface. This would be followed by the localized adherence pattern that is regulated by BFP and leads to the formation of micro-colonies on IECs (22). Subsequently, LEE genes encoding the T3SS are activated and allow EPEC to intimately attach to the epithelial surface. While these events are well described in cultured IECs, it is unknown if a similar pattern of infection proceeds to diarrheal diseases in humans. Since EPEC does not infect mice reliably, further studies are needed in the mouse model of attaching and effacing Citrobacter rodentium infection to dissect the contribution of various virulence genes in these pathogens. In vitro studies have provided insights into how the virulence genes are regulated during EPEC infection of epithelial cells. Giron and colleagues described EPEC flagellin as an adhesin that mediates microcolony formation in cultured IEC (34). Interestingly, Yona-Nadler et el showed that an integration host factor was capable of suppressing flagellin expression when EPEC was grown in DMEM (98). Although DMEM was shown to suppress flagellin in overnight cultures, we and others have found that infection of human IECs by EPEC in high  150  glucose media (DMEM) still results in inflammatory responses (46, 77). The suppression of flagellin expression is more likely to occur when EPEC are grown in DMEM alone compared to preconditioned media from cultured TEC. It is possible that preconditioned media or the presence of JECs provides a signal for flagellin expression in EPEC. Alternatively, EPEC may suppress flagellin expression when culture media is deficient in glucose, especially in mid to late log phase of growth as observed by Yona-Nadler et al. We found that the expression of flagellin was similar when JEC were infected with EPEC in DMEMJF12 media or DMEM alone. The interaction between flagellin and the T3SS in EPEC was further investigated by Sperandio et al in HeLa epithelial cells (79). These authors found that the quorum sensing (QS) and luxS genes regulated T3SS and flagellin expression, and EPEC mutants deficient in these genes (QS and luxS) were unable to adhere (LA) and formed smaller micro-colonies. The QS system represents an inter-bacterial communications system and utilizes autoinducers, which function like hormones to regulate bacterial gene expression. There is significant evidence that the neuroendocrine hormone noradrenaline (NA), a neurotransmitter in the 61 tract, can induce EHEC growth, fimbriae and toxin production (12,  16, 56). Whether NA or other  neurotransmitters abundant in the gut such as serotonin are also able to promote flagellin expression in EPEC is unknown. In a study by Giron et al, mammalian cells could induce the expression of flagellin in motile and non-motile EPEC (34). In this study, isogenic strains of EPEC deficient in perA (a transcriptional activator), bfpA type IV pilin, luxS autoinducer gene and T3SS exhibited reduced motility in DMEM motility agar. Growth of these mutants in preconditioned cell culture medium (DMEM) restored their motility and ability to produce flagella. These findings illustrate the complexity of flagellin expression and the inter-dependence of different virulence factors as well as environmental stimuli in A/E pathogens.  151  Some enteric pathogens like Salmonella are known to translocate flagellin across polarized epithelial cells and elicit TLR5 activation (32). While this may be an active process involving the T3SS or the flagellar secretion system, it may also be a consequence of epithelial barrier disruption. In this scenario, loss of epithelial integrity could allow flagellin to leak into the intercellular junctions and therefore access basolateral TLR5. The passage of flagellin through intercellular epithelial junctions may allow the host to recognize enteric pathogens that compromise epithelial integrity as a prelude to infection. It is not known if EPEC flagellin functions as a secretion system. However, the adhesive properties and binding capacity of EPEC and EHEC were investigated by Erdem et al (24). In this study, flagella from EPEC strain  E2348169 (0127:116), but not EHEC (0157:H7) bound in a dose dependent manner to collagen, laminin and fibronectin. Both EPEC and EHEC flagella and flagellin monomers were also shown to bind mucins and freshly isolated bovine mucus. Collectively, these findings suggest that A/E pathogens have developed various mechanisms to adhere to epithelial cells and adapt to changes in their environment. The development of an attaching and effacing phenotype is recognized as a hallmark of AlE pathogenesis. The eae (intimin) and bfp (bundle forming pilus) genes in EPEC have been used for identification of EPEC and for classification into typical and atypical strains (65). The emergence and increasing number of atypical isolates of EPEC presents a challenge to researchers in understanding diarrheal diseases. Most atypical EPEC are considered to be eae positive but bfp negative and as such lack the LA pattern in epithelial cells (58). While typical EPEC is recognized as a leading cause of infantile diarrhea in developing countries, atypical EPEC is becoming more important as a cause of diarrheal diseases in developed regions (1, 86). Recent studies based on molecular diagnosis of EPEC suggest a change in this trend with  152  atypical EPEC increasingly isolated from developing regions (3, 4, 89). Furthermore, the duration of diarrheal illness due to atypical EPEC infection is often found to be longer than 14 days, generally referred to as persistent. diarrhea in children (2, 66). These reports suggest a growing incidence of atypical EPEC infections and provide a basis for research into emerging enteric pathogens. Some atypical EPEC strains such as the 0125 serogroup have been reported to display an aggregative adherence phenotype in HEp-2 (a characteristic of EAEC), Caco-2 and other IECs. Genetic analysis of this strain revealed the presence of LEE genes and the expression of Tir and intimin. However, attachment was not detected in vitro (8). Analysis of another atypical EPEC strain 1551-2 revealed that a novel intimin known as omicron was required for localized adherence (LA) in HeLa and HEp-2 cells (41). The atypical EPEC 1551-2 exhibited the LA and invaded epithelial cells, whereas eae-deficient mutants formed loose microcolonies and lost their invasiveness. These findings demonstrate that emerging EPEC pathogens possess unique virulence characteristics, making them more difficult to detect and manage during outbreaks of infectious diarrhea. It is important to identify the virulence mechanisms in atypical EPEC and compare them with typical EPEC strains to understand how emerging enteric pathogens are transforming and acquiring new virulence traits.  The role of the T3SS in EPEC infection was addressed by Sharma et al, who found that EPEC possessed both pro-inflammatory and anti-inflammatory factors that were utilized in a sequential manner during infection of IEC (77). Accordingly, EPEC flagellin and a putative T3SS effector were capable of inducing pro-inflammatory responses in human IEC. Interestingly, down-regulation of this early pro-inflammatory response by EPEC required a functional T3SS, possibly also involving the secreted effector EspB which induced pore 153  formation in the cell membrane (77). In contrast, other studies indicate that the antiinflammatory effect of EPEC could occur independently of the T3SS and prior to disruption of barrier function (73). The inhibition of chemokine response possibly allows EPEC to attach for a longer period and subvert host cellular functions leading to epithelial barrier disruption, loss of water and solutes and ultimately diarrheal disease.  The studies performed in this thesis have helped increase our understanding of the role of flagellin and the T3SS in EPEC infection of epithelial cells. We have shown that in EPEC infection, both flagellin dependent and independent responses contribute to IL-8 secretion from IECs (46). Using the Caco-2 IEC model, we saw that the early innate response to EPEC infection (at 2 h) is principally due to EPEC flagellin, which involves p38 MAP kinase dependent IL-8 secretion. At later time-points of infection (4 h), IL-8 secretion occurs independently of flagellin and partially involves NE-kB activation. This finding is supported by our data with the  Citrobacter rodentium (CR) colitis model, in which recruitment of DCs to the epithelial surface occurs independently of flagellin. Importantly, both flagellin dependent and independent responses are equally suppressed by EPEC, whereas a T3SS deficient mutant is unable to suppress the chemokine responses. These results are evidence that the T3SS in EPEC performs an anti-inflammatory role during infection of IEC, possibly by introducing an unknown effector that targets innate signaling pathways. The mechanisms of flagellin independent responses were not investigated and may be examined in future studies.  In summary, the above studies indicate that the chemokine responses to EPEC were pre dominantly caused by flagellin with the T3SS apparatus functioning as a bacterial inhibitor of the host responses. The role of other virulence factors produced in EPEC, such as BFP, in regulating  154  chemokine responses is unclear. The flagellin independent responses are relevant to host defense, as intimately attached EPEC is likely to shut down flagellin production while it exploits host cell function and metabolic pathways. Our results demonstrate that the host has the capability to recognize the intimately attached EPEC, during which the bacteria is immotile. By sensing such pathogens, IEC have developed mechanisms that helps combat other enteric pathogens that infect hosts in a flagellin independent manner such as Shigella. Assessment of flagellin independent responses in the host, which may involve lipid rafts or surface receptors such as CEACAM, would require a detailed examination of these molecular platforms in IECs. These objectives are beyond the scope of this thesis and may be addressed in future studies.  4.4 The regulation of innate responses in intestinal epithelium  The human intestinal epithelium is faced with a huge number of antigens that are derived from commensal bacteria as well as those present in our daily diet. Given the diverse nature of these stimuli, it is remarkable that the intestinal epithelium has evolved intrinsic mechanisms to remain hypo-responsive while retaining the capacity to combat bacterial pathogens in a controlled manner, so as not to impact and diminish commensal flora. IECs are derived from a stem cell population at the base of the colonic crypts and are known to migrate apically to the surface. Surprisingly, the potential effect of this transition on the expression of innate receptors such as TLRs has not been rigorously investigated by researchers. For example, it is unclear to what degree epithelial responses may be different in cells located at the base of the crypt to those in cells on the surface epithelium. To date, the expression profiles of specific TLRs such as TLR5 have not been examined at these sites, partly because of the difficulty in isolating epithelial cell populations from the base of the crypt that are relatively free from other cell types.  155  However, with advances in microscopic techniques, it is possible to dissect and obtain specific populations of cells using laser capture micro-dissection technology and analyze the expression of TLRs and other innate genes in formalin-fixed tissues (25, 31). These approaches will hopefully allow researchers to focus studies on different cell types situated along the crypt villus axis in the colon.  IL-i 1 induced IL-8 responses were found to be down-regulated in HT-29 IECs as they differentiated in culture. This was attributed to reduced JNK and NF-icB activation and DNA binding compared to undifferentiated IECs (9). The authors proposed that the mechanism for the differences in chemokine responses likely involves TRAF6 and/or MyD88 function which is altered during differentiation/maturation of these cells. Another study has demonstrated that butyrate-induced differentiation of HT-29 IECs causes the attenuation of LPS responses as a result of a decrease in TLR4 mRNA and protein levels (53). These data support our findings presented in Chapter 3, where we demonstrated that the state of IEC differentiation increased Sigirr expression. Increased Sigirr levels would be expected to rapidly bind IRAK and TRAF6, therefore impairing TLR and pro-inflammatory cytokine signaling to NF-KB.  Recent studies have identified novel signaling pathways that facilitate the maturation and differentiation of epithelial cells on the surface of colonic crypts. For example, Kruppel-like factors (KLFs) are a group of evolutionary conserved family of zinc finger transcription factors that are expressed in several epithelial surfaces including the intestine (60). KLFs are known to regulate diverse biological processes including proliferation, differentiation and development. KLFs can be induced by bacterial products such as LPS in IEC. For example, KLF5 is induced by exposing IEC-6 cells to LPS, whereas silencing the KLF5 gene inhibited LPS-induced NF-i.B  156  activation (15). These data suggest that KLF5 is involved in regulating pro-inflammatory responses, and may also contribute to host defense against enteric pathogens. The role of KLF4 in IEC maturation and differentiation was recently demonstrated in the small and large intestine of mice (26). A tissue fractionation technique demonstrated that expression of KLF4 was higher in the differentiated compartment of the mouse intestine including the villus tip and crypt surface compared to cells at the base in both small and large intestine. Interestingly, KLF4 expression also increased during spontaneous differentiation or following sodium butyrate treatment of Caco-2 and HT-29 IECs (26). These findings suggest that KLF4 could be considered as a marker of differentiation that is expressed on the apical surface of the colon and may be expressed in conjunction with innate receptors such as TLRs.  While KLF4 is found in post-mitotic terminally differentiated  IECs,  the expression of  KLF5 has been identified in actively proliferating epithelial cells located in the lower region of colonic crypts (60). An inverse relationship has been proposed for differential expression of KLF4 and KLF. Furthermore, KLF5 was also shown to inhibit the expression of the KLF4 gene in proliferating cells (18). Importantly, KLF5 was determined to be a key factor for the induction of transmissible murine colonic hyperplasia (TMCH), a widely recognized histopathology associated with Citrobacter rodentium (CR) colitis (61). This report also suggested that the development of TMCH during CR colitis occurs independently of flagellin expression since CR is considered to be a non-motile enteric pathogen. It is possible that TMCH is a phenotype that is dependent on a T3SS secreted CR effector, or alternatively the host immune response activates KLF5 in cells at the base of crypts. Nevertheless, further studies are needed to clearly establish a link between the T3SS and TMCH. The relevance of CR-induced TMCH in other A/E pathogens such as EPEC and EHEC is unknown, and the effect of colonic hyperplasia as a host defense 157  mechanism in human diarrheal disease is yet to be determined. It is possible that expression of KLF4 in differentiated IEC is induced by an unknown signal from commensal flora. However, further studies are needed to determine how KLF and Indian hedgehog are expressed in JECs and to define their respective functions in epithelial biology.  It is not known whether KLF expression occurs as a consequence of TLR activation or is linked to negative regulators in IECs. The association of negative regulators with epithelial differentiation and other studies suggest that KLF4, like Sigirr, could be expressed simultaneously in differentiated JECs. In this manner, mature IECs would develop tolerance and control the responsiveness to various inflammatory stimuli in the gut. It is intriguing to propose that there is cross-talk between KLF4 and TLRs in differentiated IECs. While such interactions have not been explored to date, KLF4 function has been associated with immunosuppressive activity. In this context, exposure of RAW267.4 macrophages to E. coli LPS has been shown to increase the expression of KLF4 protein levels and leads to the secretion of anti-inflammatory cytokine IL-lO (54). Over-expression of KLF4 in macrophages promoted the release of IL-lO, whereas inhibition of KLF4 abolished this response. Similarly, pro-inflammatory cytokine IL-113 and sheer stress induced the expression of KLF4 in endothelial cells. While over-expression of KLF4 led to an increase of anti-inflammatory factors such as MMP- 1 and MMP-2 thereby suppressing inflammatory responses (38). Taken together, the above studies underline a regulatory role for KLF4 by activating IL-lO, and thus modifying inflammatory responses. This is an emerging research topic that requires further investigation to identify if there is cross-talk between KLF4 and negative regulators like Sigirr and Tollip in IEC.  158  The dietary derived short chain fatty acids butyrate and bacterial LPS are known to induce KLF4 in the gastrointestinal epithelium (26, 38). Interestingly, we have also presented evidence in this thesis that bacterial flagellin and exposure to butyrate are able to induce the expression of Sigirr in Caco-2 IECs. In view of these findings, it is conceivable that bacterial derived factors such as LPS and dietary components produced from fatty acids influence the maturation of IECs, and contribute to the acquisition of tolerance and homeostasis in the GI tract. Furthermore, the above data also highlight a key role for commensal bacteria in generating short chain fatty acids like butyrate in the human gut (17). Other important effects of butyrate on TECs include an increase in the number of epithelial sodium channels for absorption of sodium (100). It is obvious to note that alteration or depletion of commensal flora have serious implications affecting not only the host innate responses but also for epithelial physiology.  While the implications of inhibiting TLR responses by Sigirr in IECs have been discussed earlier, the significance of regulating the NOD1 pathway in IECs are not clear. The function of NOD 1 in epithelial responses to invasive pathogens such as Shigella has been examined in epithelial cells. The epithelial IL-8 responses to Shigella flexneri infection requires NOD 1, which forms a complex with Rip2 and IKK, leading to NF-iB activation (33). Other studies have demonstrated an important role for NOD 1 in sensing live and formalin-fixed Campylobacter jejuni in Caco-2 JECs (102). While these studies suggested that bacterial infection leads to NOD 1 activation, how its ligand (ieDAP) is transported into the cytoplasm remains unclear. While the peptide transporter hPepTl has been suggested to selectively transport the NOD2 ligand Muramyl dipeptide (MDP) in Caco-2 IECs, it does not appear to be involved in transporting the NOD1 ligand ieDAP (44).  159  While some studies have suggested that NOD receptors are activated exclusively by invasive bacterial pathogens, there are several studies indicating that exposure to NOD ligands generates pro-inflammatory responses in epithelial cells. Synthetic preparations of DAP and MDP were shown to result in IL-8, IL-6 and TNFa secretion in a NOD 1-dependent manner in cultured SW620 TECs (87). Stimulation of human LoVo JEC with various commercial NOD1 preparations also caused chemokine secretion in a dose-dependent manner when added into the culture medium (59). These studies suggest that NOD receptors can be stimulated by their respective ligands when applied to IECs in culture. While most studies have reported NODs as intracellular and cytoplasmic receptors, these receptors could be expressed on or near the cell membrane of IECs. Moreover, two independent groups have described that membrane recruitment of NOD2 is required for subsequent NF-id3 activation and NOD2 forms a complex with its adaptor RICK to signal from the membrane of TECs (6, 51). In this context, overexpressed porcine NOD 1 receptor was recruited to the inner surface of the cell membrane in HEK-293 cells, when analyzed by immunocytochemistry (85).  The above mentioned reports indicate that NOD receptors could be expressed near the cell membrane and perhaps are negatively regulated by Sigirr which is also proposed to function as an inhibitor of TLR signaling at the cell membrane. Although our study is limited in scope, because we did not show that Sigirr directly binds NOD1, Sigirr might associate with the NOD1 adaptor, the serine threonine kinase-Rip2. It is known that TIR domains of Sigirr bind IRAK, another serine threonine kinase (42, 93). A similar interaction could explain the basis of NOD1 inhibition. Our data support a role for Sigirr in moderating host responses to invasive bacterial pathogens such as Shigella and Campylobacter, as well as to cell wall peptidoglycans released  160  from other bacterial pathogens, as may occur following increased epithelial permeability or disruption of the epithelial barrier.  Another negative regulator that is reported to be highly expressed in IECs is the Toll inhibitory protein (Tollip) which inhibits TLR2 and TLR4 responses (63). Since TLR4 expression is relatively low in IEC, Tollip may be more relevant to TLR2-mediated maintenance of epithelial integrity in the gut. It has been suggested that Tollip may be required for the development of IEC hyporesponsiveness (68). Tollip levels were up-regulated when IECs were stimulated with LPS and lipoteichoic acid (LTA), leading to hypo-responsiveness to other TLR ligands. Further evidence about the regulatory function of Tollip was gained from the generation of Tollip knock-out mice (20). These mice developed normally and did not develop colitis. Tollip-deficient mice produced lower levels of IL-6 and TNFo when challenged with IL-l3 and LPS. The deficiency of Tollip did not impair innate responses to TLR3, TLR9 and TLR5 stimulation in splenocytes derived from these mice. These in vivo findings are in contrast to earlier studies in cultured IECs and suggest that perhaps the function of Tollip is confined to specific regulation of TLR2 responses in  TECs.  However, Tollip could be important in  dampening innate responses in immune cells including macrophages and other epithelial cells (80, 97).  Besides Tollip, the zinc finger protein A20 inhibits NF-kB and is also described as a negative regulator of inflammatory responses. During inflammation, NF-kB is known to decrease apoptotic pathways induced by TNFx, which is a protective response that involves suppression of the JNK signaling pathway. Interestingly, there is concurrent up-regulation of the X-linked inhibitor of apoptosis protein (XIAP), A20 and the prevention of reactive oxygen  161  species (ROS), all of these effects primarily mediated by NF-icB (69).  A20 is induced in  response to TNFc as well as IL-i f3 in macrophages and B lymphocytes (21). The mechanism of A20 inhibition is not well understood but likely involves inhibition of IKK (NEMO) function, which prevents subsequent I-icB degradation and NF-icB activation (101). In the context of innate responses, A20 has been shown to inhibit NF-icB and AP-1 and thus decrease secretion of IL-8 from HEK 293 cells (67). Interestingly, butyrate increased A20 expression independently of I-kB phosphorylation in Caco-2 IEC, and decreased Pam3Cys (TLR2 ligand) induced IL-8 secretion (95). Although, the effect of A20 has not been assessed in IEC responses to other TLRs, the above findings suggest an inhibitory role for TLR2 responses. Furthermore, while Tollip inhibits TLR2 signaling at the level of the membrane, the mechanism of A20 is exerted downstream targeting the activation of NF-icE. The expression of A20 in IECs has not been addressed and it is not known if its expression changes with differentiation of EEC in the colon. The answer to these questions will have to be addressed in future studies of negative regulators that target NF-icB in epithelial cells.  Some groups have examined the expression of specific TLRs in human colonic tissue sections. While examining the role of TLR3 and TLR4, Cario et al (13) identified TLR5 on the apical surface of human colonic tissue sections by immunostaining. Similarly, recent reports by Fukata et al (29) describing the role of TLR4 in colitis associated cancer revealed TLR4 expression on the surface epithelium in human colonic sections. The increased expression of TLR4 and TLR2 was demonstrated in colonic biopsies obtained from EBD patients, suggesting that dysregulation of these receptors may contribute to colitis (28).  162  It is reasonable to expect that Sigirr would be specifically expressed in the same gut epithelial cells where TLRs are also located. The identification of TLR5 and TLR4 on the apical surface of colonic crypts is consistent with our findings demonstrating the expression of Sigirr in human colonic sections. The above findings also illustrate the relevance of the increased IEC responsiveness to bacterial flagellin, LPS and Pam3Cys, seen after Sigirr gene silencing in human JECs in Chapter 3. It is therefore clear that mature IECs express negative regulators which function to dampen the activity of innate receptors by bacterial products derived from both commensal and enteric pathogens.  In summary, the findings presented in this thesis have expanded our knowledge about how enteric bacterial pathogens elaborate virulence factors that enable colonization and infection of specific sites within the intestine. By expressing virulence factors such as flagellin and T3SS in a sequential manner, the AlE pathogens adhere and attach to epithelial cells and subvert cell functions. The host on the other hand is able to sense the different stages of the infection cycle and in concert with other immune cells, mounts an appropriate and proportionate innate response designed to eradicate these pathogens. The innate responses produced in the host subsequently lead to inflammation that subsides after the clearance of the pathogen. Our findings regarding Sigirr are particularly relevant to the resolution of the inflammatory response, ensuring that it eventually leads to healing and the repair of the damaged epithelium.  Complete or partial loss of Sigirr function could dramatically exacerbate the duration and intensity of innate responses in IEC and may contribute to inflammatory disorders such as TBD. An increase in epithelial permeability which occurs in diarrheal disease and in the pathogenesis of 113D may lead to the translocation of bacterial products and activate TLRs in JECs. The  163  regulatory function of Sigirr therefore allows IECs to attenuate host responses and prevent exacerbation of inflammation. Since butyrate is a fermentation product of commensal bacteria, any disorder that depletes the commensal population may theoretically lead to a deficiency of Sigirr in IECs. One such example may be the long term or indiscriminate use of antibiotics which can destroy commensal flora and indirectly lower Sigirr levels. It will be interesting to examine if chronic antibiotic therapy can directly or indirectly alter the expression of negative regulators in the colon.  4.5 Future directions  The studies presented in this thesis have focused on how innate pathways are triggered in IECs, which allow the host to recognize bacterial products in the gut. Our findings also highlight the importance of resolving innate and inflammatory events in an efficient manner at the colonic mucosal surface. However, under disease conditions, a deficiency in Sigirr may lead to dysregulated inflammation that would damage not only the epithelium but also diminish the commensal habitat in the gut. The function of negative regulators like Sigirr is therefore important in controlling innate and inflammatory responses in the mucosal epithelium as well as other epithelial surfaces like the upper GI tract. Perhaps the most clinically relevant investigation regarding Sigirr is to assess its role in susceptibility to developing IBD. These studies can be carried out by examining the levels of Sigirr expression in colonic tissues obtained from patients being investigated for LBD. A comparison of Sigirr gene expression between IBD patients and healthy subjects or others patients undergoing colonoscopy for unrelated causes would clarify the role of negative regulators in these inflammatory disorders.  164  Another approach is to screen for single nucleotide polymorphisms (SNPs) in the Sigirr gene. With the completion of the human genome project, it is now possible to carry out such studies and potentially identify people at risk for developing IBD. Another interesting project would be to determine if the presence of Sigirr deficiency can differentiate between Crohn’s disease that generally involves the terminal ileum versus Ulcerative colitis which only affects the colon. As the number of commensal bacteria increases in the distal region of the large intestine, it may be argued that Sigirr expression would be higher in the descending colon and colorectal epithelium. These possibilities would have to be explored in future studies involving human subjects at research institutions where basic scientists would collaborate with gastroenterologists.  Although Sigirr is expressed in the colon, its highest expression was previously noted in the kidneys. Since kidneys are considered to be in a sterile environment, Sigirr may be involved in other functions such as fluid and electrolyte balance. The role of Sigirr in the kidneys is beginning to receive the attention from researchers, with a single report of its expression induced by LPS, TNFo and IFN gamma in myeloid cells residing in the kidneys (50). Since, urinary tract infections (UTIs) are a common post-operative complication in some diabetic patients, Sigirr may potentially limit host responses in UTI. Further, it was recently shown that the expression of flagella coincided with the migration of Uropathogenic E.coli (UPEC) from the bladder towards the kidneys in an animal model of UTI (49). It may be speculated that flagellated bacterial pathogens that cause UTI facilitate the expression of Sigirr in the kidneys, thus dampening inflammatory responses and preserving normal renal functions. The induction of Sigirr and its possible roles in renal functions would be an attractive area of study.  165  An important consequence of the innate chemokine response in epithelial cells is the recruitment of neutrophils by the chemokine IL-8. While neutrophils are important for innate responses, IECs have been  shown  to  secrete other types  of cytokines  that exert  immunomodulatory effects on DCs and T cells. Secretion of the IL-7 like thymic stromal lymphopoietin (TSLP) by IECs is considered as critical for conditioning of mucosal DCs and also required for intestinal homeostasis (72). Conditioning by epithelial TSLP, referred to as “education of DCs’ by some authors (94), leads to secretion of immunosuppressive IL-b  and  IL-6 but not IL-12 after exposure to Thi-inducing pathogens. These epithelial-derived cytokines target lamina propria DCs and confer an immunosuppressive phenotype away from a Thl response (72). Furthermore, a regulatory role for TSLP was recently described in allergic airway inflammation (40). A reduction of TSLP may contribute to enhanced Thi responses as in TED. Interestingly, exposure to bacterial flagellin suppressed the secretion of IL-7 in colonic DLD-1  IECs (99). Since TSLP is similar to IL-7, it is possible that TLR5 inhibition by Sigirr could help maintain the constitutive baseline levels of TSLP secretion by IECs. By decreasing flagellin responses, Sigirr would indirectly enhance IL-7 and TSLP cytokine expression and thus maintain populations of conditioned DCs in the gut.  It has been suggested that unknown signals derived from commensal bacteria lead to secretion of the cytokine APRIL (a proliferation inducing ligand) which is critical for T-cell independent class-switching and secretion of IgA in the intestinal mucosa (39). It would be logical to assess if Sigirr regulates secretion of APRIL from IECs in future studies and explore its subsequent effects on IgA secretion. Since secretion of APRIL is dependent on commensal derived signals involving TLR4 (76) in IEC, it may be speculated that Sigirr deficiency would lead to excessive TLR4-mediated IgA secretion which would diminish the commensal bacterial 166  population and lead to a disruption of immune homeostasis. This hypothesis would have to be tested in future studies to define the role of Sigirr in regulating intestinal homeostasis.  Besides innate responses, it is not known if Sigirr function would also affect allergeninduced enteropathy in the gut. In Celiac disease, toxic peptides derived from the gluten in wheat triggers an innate epithelial response (57) characterized by secretion of IL-15 from IECs and DCs (30). The epithelial-derived IL-15 acts on the IL-l5Ralpha receptor on intra epithelial lymphocytes (]ELs) leading to proliferation, perforin/granzyme dependent cytotoxicity and apoptosis of IELs (19). Whether IL-l5 secretion from IECs is altered by changes in the levels of Sigirr expression is unknown. It is therefore important to address the role of Sigirr in IEC secretion of TSLP, APRTh and IL-15 in future studies. Addressing these questions will increase our understanding of how IECs interact with DCs, and whether Sigirr dysfunction may contribute to the pathogenesis seen in GI disorders, besides host defense and intestinal inflammation.  In summary, the main findings in this thesis elucidate the onset of innate epithelial responses to flagellated and non-flagellated bacterial pathogens. These mechanisms lead to the recruitment of professional immune cells to the gut epithelium during enteric bacterial infections. An intrinsic control mechanism exists in epithelial cells that serve to dampen immune responses, contributes to resolution of inflammation and maintenance of homeostasis. This regulatory function develops as epithelial cells become mature and differentiated while transiting the crypts villus axis in G1T. The data presented also suggests that loss of regulatory mechanisms in epithelial cells may exacerbate host responses and could ultimately contribute to chronic intestinal diseases.  167  4.6 References: 1.  2.  3.  4.  5.  6.  7.  8.  9.  10.  11.  12.  13.  Afset, J. E., K. Bergh, and L. Bevanger. 2003. High prevalence of atypical enteropathogenic Escherichia coli (EPEC) in Norwegian children with diarrhoea. J Med Microbiol 52: 1015-1019. Afset, J. E., L. Bevanger, P. Romundstad, and K. Bergh. 2004. Association of atypical enteropathogenic Escherichia coli (EPEC) with prolonged diarrhoea. J Med Microbiol 53:1137-1144. Alikhani, M. Y., A. Mirsalehian, and M. M. Aslani. 2006. Detection of typical and atypical enteropathogenic Escherichia coli (EPEC) in Iranian children with and without diarrhoea. J Med Microbiol 55:1159-1163. Araujo, J. M., G. F. Tabarelli, K. R. Aranda, S. H. Fabbricotti, U. Fagundes-Neto, C. M. Mendes, and I. C. Scaletsky. 2007. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol 45:3396-3399. Bambou, J. C., A. Giraud, S. Menard, B. Begue, S. Rakotobe, M. Heyman, F. Taddei, N. Cerf-Bensussan, and V. Gaboriau-Routhiau. 2004. In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain. J Biol Chem 279:42984-42992. Barnich, N., I. E. Aguirre, H. C. Reinecker, R. Xavier, and D. K. Podoisky. 2005. Membrane recruitment of NOD2 in intestinal epithelial cells is essential for nuclear factor-{kappa}B activation in muramyl dipeptide recognition. J Cell Biol 170:21-26. Barnich, N., F. A. Carvalho, A. L. Glasser, C. Darcha, P. Jantscheff, M. Allez, H. Peeters, G. Bommelaer, P. Desreumaux, J. F. Colombel, and A. Darfeuille-Michaud. 2007. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest 117:1566-1574. Barros, S. F., C. M. Abe, S. P. Rocha, R. M. Ruiz, L. Beutin, L. R. Trabulsi, and W. P. Elias. 2008. Escherichia coli 0125ac:H6 encompasses atypical enteropathogenic E. coli strains that display the aggregative adherence pattern. J Clin Microbiol 46:4052-4055. Bocker, U., A. Schottelius, J. M. Watson, L. Holt, L. L. Licato, D. A. Brenner, R. B. Sartor, and C. Jobin. 2000. Cellular differentiation causes a selective down-regulation of interleukin (IL)-lbeta-mediated NF-kappaB activation and IL-8 gene expression in intestinal epithelial cells. J Biol Chem 275:12207-12213. Boudeau, J., A. L. Glasser, E. Masseret, B. Joly, and A. Darfeuille-Michaud. 1999. Invasive ability of an Escherichia coli strain isolated from the ileal mucosa of a patient with Crohn’s disease. Infect Immun 67:4499-4509. Burdelya, L. G., V. I. Krivokrysenko, T. C. Tallant, E. Strom, A. S. Gleiberman, D. Gupta, 0. V. Kurnasov, F. L. Fort, A. L. Osterman, J. A. Didonato, E. Feinstein, and A. V. Gudkov. 2008. An agonist of toll-like receptor 5 has radioprotective activity in mouse and primate models. Science 320:226-230. Burton, C. L., S. R. Chhabra, S. Swift, T. J. Baldwin, H. Withers, S. J. Hill, and P. Williams. 2002. The growth response of Escherichia coli to neurotransmitters and related catecholamine drugs requires a functional enterobactin biosynthesis and uptake system. Infect Immun 70:59 13-5923. Cario, E., and D. K. Podolsky. 2000. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun 68:7010-7017. 168  14.  15.  16. 17. 18.  19.  20.  21.  22.  23.  24.  25.  26. 27. 28.  Cavaillon, J. M., C. Fitting, B. Hauttecoeur, and N. Haeffner-Cavaillon. 1987. Inhibition by gangliosides of the specific binding of lipopolysaccharide (LPS) to human monocytes prevents LPS-induced interleukin- 1 production. Cell Immunol 106:293-303. Chanchevalap, S., M. 0. Nandan, B. B. McConnell, L. Charrier, D. Merlin, J. P. Katz, and V. W. Yang. 2006. Kruppel-like factor 5 is an important mediator for lipopolysaccharide-induced proinflammatory response in intestinal epithelial cells. Nucleic Acids Res 34:1216-1223. Clarke, M. B., and V. Sperandio. 2005. Transcriptional regulation of flhDC by QseBC and sigma (FliA) in enterohaemorrhagic Escherichia coli. Mol Microbiol 57:1734-1749. Cummings, J. H. 1981. Short chain fatty acids in the human colon. Gut 22:763-779. Dang, D. T., W. Zhao, C. S. Mahatan, D. E. Geiman, and V. W. Yang. 2002. Opposing effects of Kruppel-like factor 4 (gut-enriched Kruppel-like factor) and Kruppel-like factor 5 (intestinal-enriched Kruppel-like factor) on the promoter of the Kruppel-like factor 4 gene. Nucleic Acids Res 30:2736-2741. Di Sabatino, A., R. Ciccocioppo, F. Cupelli, B. Cinque, D. Millimaggi, M. M. Clarkson, M. Paulli, M. G. Cifone, and G. R. Corazza. 2006. Epithelium derived interleukin 15 regulates intraepithelial lymphocyte Thi cytokine production, cytotoxicity, and survival in coeliac disease. Gut 55:469-477. Didierlaurent, A., B. Brissoni, D. Velin, N. Aebi, A. Tardivel, E. Kaslin, J. C. Sirard, G. Angelov, J. Tschopp, and K. Bums. 2006. Tollip regulates proinflammatory responses to interleukin-1 and lipopolysaccharide. Mol Cell Biol 26:735-742. Dixit, V. M., S. Green, V. Sarma, L. B. Holzman, F. W. Wolf, K. O’Rourke, P. A. Ward, E. V. Prochownik, and R. M. Marks. 1990. Tumor necrosis factor-alpha induction of novel gene products in human endothelial cells including a macrophage-specific chemotaxin. J Biol Chem 265:2973-2978. Donnenberg, M. S., J. A. Giron, J. P. Nataro, and J. B. Kaper. 1992. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol Microbiol 6:3427-3437. Duck, L. W., M. R. Walter, J. Novak, D. Kelly, M. Tomasi, Y. Cong, and C. 0. Elson. 2007. Isolation of flagellated bacteria implicated in Crohns disease. Inflamm Bowel Dis 13:1191-1201. Erdem, A. L., F. Avelino, J. Xicohtencatl-Cortes, and J. A. Giron. 2007. Host protein binding and adhesive properties of H6 and H7 flagella of attaching and effacing Escherichia coli. J Bacteriol 189:7426-7435. Flanagan, K., Z. Modrusan, J. Cornelius, A. Chavali, I. Kasman, L. Komuves, L. Mo, and L. Diehi. 2008. Intestinal epithelial cell up-regulation of LY6 molecules during colitis results in enhanced chemokine secretion. J Immunol 180:3874-3881. Flandez, M., S. Guilmeau, P. Blache, and L. H. Augenlicht. 2008. KLF4 regulation in intestinal epithelial cell maturation. Exp Cell Res 314:3712-3723. Freche, B., N. Reig, and F. G. van der Goot. 2007. The role of the inflammasome in cellular responses to toxins and bacterial effectors. Semin Immunopathol 29:249-260. Frolova, L., P. Drastich, P. Rossmann, K. Klimesova, and H. Tlaskalova-Hogenova. 2008. Expression of Toll-like receptor 2 (TLR2), TLR4, and CD14 in biopsy samples of patients with inflammatory bowel diseases: upregulated expression of TLR2 in terminal ileum of patients with ulcerative colitis. J Histochem Cytochem 56:267-274.  169  29.  30.  31.  32.  33.  34.  35.  36. 37.  38.  39.  40.  41.  Fukata, M., A. Chen, A. S. Vamadevan, J. Cohen, K. Breglio, S. Krishnareddy, D. Hsu, R. Xu, N. Harpaz, A. J. Dannenberg, K. Subbaramaiah, H. S. Cooper, S. H. Itzkowitz, and M. T. Abreu. 2007. Toll-like receptor-4 promotes the development of colitisassociated colorectal tumors. Gastroenterology 133:1869-1881. Garrote, J. A., E. Gomez-Gonzalez, D. Bernardo, E. Arranz, and F. Chirdo. 2008. Celiac disease pathogenesis: the proinflammatory cytokine network. J Pediatr Gastroenterol Nutr47 Suppi 1:S27-32. George, M. D., J. Wehkamp, R. J. Kays, C. M. Leutenegger, S. Sabir, I. Grishina, S. Dandekar, and C. L. Bevins. 2008. In vivo gene expression profiling of human intestinal epithelial cells: analysis by laser microdissection of formalin fixed tissues. BMC Genomics 9:209. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, and J. L. Madara. 2001. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol 167:1882-1885. Girardin, S. E., R. Tournebize, M. Mavris, A. L. Page, X. Li, G. R. Stark, J. Bertin, P. S. DiStefano, M. Yaniv, P. J. Sansonetti, and D. J. Philpott. 2001. CARD4INod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2:736-742. Giron, J. A., A. G. Torres, E. Freer, and J. B. Kaper. 2002. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol 44:361-379. Glasser, A. L., J. Boudeau, N. Barnich, M. H. Perruchot, J. F. Colombel, and A. Darfeuille-Michaud. 2001. Adherent invasive Escherichia coli strains from patients with Crohn’s disease survive and replicate within macrophages without inducing host cell death. Infect Immun 69:5529-5537. Gray-Owen, S. D., and R. S. Blumberg. 2006. CEACAM1: contact-dependent control of immunity. Nat Rev Immunol 6:433-446. Guignot, J., M. F. Bernet-Camard, C. Pous, L. Plancon, C. Le Bouguenec, and A. L. Servin. 2001. Polarized entry of uropathogenic AfaJDr diffusely adhering Escherichia coli strain Hi 1128 into human epithelial cells: evidence for alpha5betai integrin recognition and subsequent internalization through a pathway involving caveolae and dynamic unstable microtubules. Infect Immun 69:1856-1868. Hamik, A., Z. Lin, A. Kumar, M. Balcells, S. Sinha, J. Katz, M. W. Feinberg, R. E. Gerzsten, E. R. Edelman, and M. K. Jam. 2007. Kruppel-like factor 4 regulates endothelial inflammation. J Biol Chem 282:13769-13779. He, B., W. Xu, P. A. Santini, A. D. Polydorides, A. Chiu, J. Estrella, M. Shan, A. Chadburn, V. Villanacci, A. Plebani, D. M. Knowles, M. Rescigno, and A. Cerutti. 2007. Intestinal bacteria trigger T cell-independent immunoglobulin A(2) class switching by inducing epithelial-cell secretion of the cytokine APRIL. Immunity 26:812-826. He, R., M. K. Oyoshi, L. Garibyan, L. Kumar, S. F. Ziegler, and R. S. Geha. 2008. TSLP acts on infiltrating effector T cells to drive allergic skin inflammation. Proc Natl Acad Sci USA 105:11875-11880. Hernandes, R. T., R. M. Silva, S. M. Carneiro, F. A. Salvador, M. C. Fernandes, A. C. Padovan, D. Yamamoto, R. A. Mortara, W. P. Elias, M. R. da Silva Briones, and T. A. Gomes. 2008. The localized adherence pattern of an atypical enteropathogenic Escherichia coli is mediated by intimin omicron and unexpectedly promotes HeLa cell invasion. Cell Microbiol 10:415-425. 170  42. 43.  44.  45.  46.  47.  48. 49.  50.  51.  52.  53.  54.  55.  Hu, J., R. Jacinto, C. McCall, and L. Li. 2002. Regulation of IL-i receptor-associated kinases by lipopolysaccharide. J Immunol 168:3910-3914. Ingrassia, I., A. Leplingard, and A. Darfeuille-Michaud. 2005. Lactobacillus casei DN 114 001 inhibits the ability of adherent-invasive Escherichia coli isolated from Crohn’s disease patients to adhere to and to invade intestinal epithelial cells. Appi Environ Microbiol 71:2880-2887. Ismair, M. 0., S. R. Vavricka, G. A. Kullak-Ublick, M. Fried, D. Mengin-Lecreulx, and S. E. Girardin. 2006. hPepTl selectively transports muramyl dipeptide but not Nodl activating muramyl peptides. Can I Physiol Pharmacol 84:1313-1319. Keller, R., J. 0. Ordonez, R. R. de Oliveira, L. R. Trabulsi, T. J. Baldwin, and S. Knutton. 2002. Afa, a diffuse adherence fibrillar adhesin associated with enteropathogenic Escherichia coli. Infect Immun 70:2681-2689. Khan, M. A., S. Bouzari, C. Ma, C. M. Rosenberger, K. S. Bergstrom, D. L. Gibson, T. S. Steiner, and B. A. Vallance. 2008. Flagellin-dependent and -independent inflammatory responses following infection by enteropathogenic Escherichia coli and Citrobacter rodentium. Infect Immun 76: 1410-1422. Korotkova, N., Y. Yarova-Yarovaya, V. Tchesnokova, N. Yazvenko, M. A. Carl, A. E. Stapleton, and S. L. Moseley. 2008. Escherichia coli DraE adhesin-associated bacterial internalization by epithelial cells is promoted independently by decay-accelerating factor and carcinoembryonic antigen-related cell adhesion molecule binding and does not require the DraD invasin. Infect Immun 76:3869-3880. Krakauer, T. 2008. Nuclear factor-kappaB: fine-tuning a central integrator of diverse biologic stimuli. mt Rev Immunol 27:286-292. Lane, M. C., C. J. Alteri, S. N. Smith, and H. L. Mobley. 2007. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Nati Acad Sci U S A 104:16669-16674. Lech, M., C. Garlanda, A. Mantovani, C. J. Kirschning, D. Schlondorff, and H. I. Anders. 2007. Different roles of TiR8/Sigirr on toll-like receptor signaling in intrarenal antigenpresenting cells and tubular epithelial cells. Kidney Tnt 72:182-192. Lecine, P., 5. Esmiol, J. Y. Metais, C. Nicoletti, C. Nourry, C. McDonald, G. Nunez, I. P. Hugot, J. P. Borg, and V. Ollendorff. 2007. The NOD2-RICK complex signals from the plasma membrane. J Biol Chem 282: 15197-15207. Lee, J., J. H. Mo, K. Katakura, I. Alkalay, A. N. Rucker, Y. T. Liu, H. K. Lee, C. Shen, G. Cojocaru, S. Shenouda, M. Kagnoff, L. Eckmann, Y. Ben-Neriah, and E. Raz. 2006. Maintenance of colonic homeostasis by distinctive apical TLR9 signalling in intestinal epithelial cells. Nat Cell Biol 8:1327-1336. Lee, S. K., T. Ii Kim, Y. K. Kim, C. H. Choi, K. M. Yang, B. Chae, and W. H. Kim. 2005. Cellular differentiation-induced attenuation of LPS response in HT-29 cells is related to the down-regulation of TLR4 expression. Biochem Biophys Res Commun 337:457-463. Liu, J., H. Zhang, Y. Liu, K. Wang, Y. Feng, M. Liu, and X. Xiao. 2007. KLF4 regulates the expression of interleukin-lO in RAW264.7 macrophages. Biochem Biophys Res Commun 362:575-581. Lodes, M. J., Y. Cong, C. 0. Elson, R. Mohamath, C. J. Landers, S. R. Targan, M. Fort, and R. M. Hershberg. 2004. Bacterial flagellin is a dominant antigen in Crohn disease. J Clin Invest 113:1296-1306. 171  56. 57.  58. 59.  60.  61.  62.  63.  64.  65. 66.  67. 68.  69. 70.  71.  Lyte, M., and S. Ernst. 1992. Catecholamine induced growth of gram negative bacteria. Life Sci 50:203-2 12. Maiuri, L., C. Ciacci, I. Ricciardelli, L. Vacca, V. Raia, S. Auricchio, J. Picard, M. Osman, S. Quaratino, and M. Londei. 2003. Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease. Lancet 362:30-37. Marcos, L. A., and H. L. DuPont. 2007. Advances in defining etiology and new therapeutic approaches in acute diarrhea. J Infect 55:385-393. Masumoto, J., K. Yang, S. Varambally, M. Hasegawa, S. A. Tomlins, S. Qiu, Y. Fujimoto, A. Kawasaki, S. J. Foster, Y. Hone, T. W. Mak, G. Nunez, A. M. Chinnaiyan, K. Fukase, and N. Inohara. 2006. Nodi acts as an intracellular receptor to stimulate chemokine production and neutrophil recruitment in vivo. J Exp Med 203:203-213. McConnell, B. B., A. M. Ghaleb, M. 0. Nandan, and V. W. Yang. 2007. The diverse functions of Kruppel-like factors 4 and 5 in epithelial biology and pathobiology. Bioessays 29:549-557. McConnell, B. B., J. M. Klapproth, M. Sasaki, M. 0. Nandan, and V. W. Yang. 2008. Kruppel-like factor 5 mediates transmissible murine colonic hyperplasia caused by Citrobacter rodentium infection. Gastroenterology 134:1007-1016. Meconi, S., A. Vercellone, F. Levillain, B. Payre, T. Al Saati, F. Capilla, P. Desreumaux, A. Darfeuille-Michaud, and F. Altare. 2007. Adherent-invasive Escherichia coli isolated from Crohns disease patients induce granulomas in vitro. Cell Microbiol 9:1252-126 1. Melmed, G., L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, Y. Zhou, B. flu, M. Arditi, and M. T. Abreu. 2003. Human intestinal epithelial cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands: implications for hostmicrobial interactions in the gut. J Immunol 170: 1406-1415. Miao, E. A., E. Andersen-Nissen, S. E. Warren, and A. Aderem. 2007. TLR5 and Ipaf: dual sensors of bacterial flagellin in the innate immune system. Semin Immunopathol 29:275-288. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin Microbiol Rev 11:142-201. Nguyen, R. N., L. S. Taylor, M. Tauschek, and R. M. Robins-Browne. 2006. Atypical enteropathogenic Escherichia coli infection and prolonged diarrhea in children. Emerg Infect Dis 12:597-603. O’Reilly, S. M., and P. N. Moynagh. 2003. Regulation of Toll-like receptor 4 signalling by A20 zinc finger protein. Biochem Biophys Res Commun 303:586-593. Otte, J. M., E. Cario, and D. K. Podolsky. 2004. Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells. Gastroenterology 126:1054-1070. Papa, S., F. Zazzeroni, C. G. Pham, C. Bubici, and G. Franzoso. 2004. Linking JNK signaling to NF-kappaB: a key to survival. J Cell Sci 117:5197-5208. Papadakis, K. A., H. Yang, A. Ippoliti, L. Mei, C. 0. Elson, R. M. Hershbeng, E. A. Vasiliauskas, P. R. Fleshner, M. T. Abneu, K. Taylor, C. J. Landers, J. I. Rotter, and S. R. Targan. 2007. Anti-flagellin (CBirl) phenotypic and genetic Crohn’s disease associations. Inflamm Bowel Dis 13:524-530. Petrof, E. 0., M. W. Musch, M. Ciancio, J. Sun, M. E. Hobert, E. C. Claud, A. Gewirtz, and E. B. Chang. 2008. Flagellin is required for salmonella-induced expression of heat  172  72.  73.  74. 75.  76.  77.  78.  79.  80.  81.  82. 83.  84.  shock protein Hsp25 in intestinal epithelium. Am J Physiol Gastrointest Liver Physiol 294:G808-8 18. Rimoldi, M., M. Chieppa, V. Salucci, F. Avogadri, A. Sonzogni, G. M. Sampietro, A. Nespoli, G. Viale, P. Allavena, and M. Rescigno. 2005. Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat linmunol 6:507-514. Ruchaud-Sparagano, M. H., M. Maresca, and B. Kenny. 2007. Enteropathogenic Escherichia coli (EPEC) inactivate innate immune responses prior to compromising epithelial barrier function. Cell Microbiol 9:1909-1921. Rueda, R. 2007. The role of dietary gangliosides on immunity and the prevention of infection. Br J Nutr 98 Suppi 1:S68-73. Schroder, A. K., P. Uciechowski, D. Fleischer, and L. Rink. 2006. Crosslinking of CD66B on peripheral blood neutrophils mediates the release of interleukin-8 from intracellular storage. Hum Immunol 67:676-682. Shang, L., M. Fukata, N. Thirunarayanan, A. P. Martin, P. Arnaboldi, D. Maussang, C. Ben J. C. Unkeless, L. Mayer, M. T. Abreu, and S. A. Lira. 2008. Toll-like receptor signaling in small intestinal epithelium promotes B-cell recruitment and IgA production in lamina propria. Gastroenterology 135:529-538. Sharma, R., S. Tesfay, F. L. Tomson, R. P. Kanteti, V. K. Viswanathan, and G. Hecht. 2006. Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 290:G685-694. Shen, W., K. Stone, A. Jales, D. Leitenberg, and S. Ladisch. 2008. Inhibition of TLR activation and up-regulation of IL-1R-associated kinase-M expression by exogenous gangliosides. J Immunol 180:4425-4432. Sircili, M. P., M. Walters, L. R. Trabulsi, and V. Sperandio. 2004. Modulation of enteropathogenic Escherichia coli virulence by quorum sensing. Infect Immun 72:23292337. Stroinigg, N., and M. D. Srivastava. 2005. Modulation of toll-like receptor 7 and LL-37 expression in colon and breast epithelial cells by human beta-defensin-2. Allergy Asthma Proc 26:299-309. Subramanian, S., J. M. Rhodes, C. A. Hart, B. Tam, C. L. Roberts, S. L. Smith, J. E. Corkill, C. Winstanley, M. Virji, and B. J. Campbell. 2008. Characterization of epithelial IL-8 response to inflammatory bowel disease mucosal E. coli and its inhibition by mesalamine. Inflamm Bowel Dis 14:162-175. Sun, Y. H., H. G. Rolan, and R. M. Tsolis. 2007. Injection of flagellin into the host cell cytosol by Salmonella enterica serotype Typhimurium. J Biol Chem 282:33897-3390 1. Suzuki, T., L. Franchi, C. Toma, H. Ashida, M. Ogawa, Y. Yoshikawa, H. Mimuro, N. Inohana, C. Sasakawa, and G. Nunez. 2007. Differential regulation of caspase-1 activation, pyroptosis, and autophagy via Ipaf and ASC in Shigella-infected macrophages. PLoS Pathog 3:el 11. Targan, S. R., C. J. Landers, H. Yang, M. J. Lodes, Y. Cong, K. A. Papadakis, E. Vasiliauskas, C. 0. Elson, and R. M. Hershberg. 2005. Antibodies to CBinl flagellin define a unique response that is associated independently with complicated Crohn’s disease. Gastroenterology 128:2020-2028.  173  85.  86. 87.  88. 89.  90.  91.  92.  93.  94. 95. 96.  97.  98.  99.  Tohno, M., W. Ueda, Y. Azuma, T. Shimazu, S. Katoh, J. M. Wang, H. Aso, H. Takada, Y. Kawai, T. Saito, and H. Kitazawa. 2008. Molecular cloning and functional characterization of porcine nucleotide-binding oligomerization domain-2 (NOD2). Mol Immunol 45:194-203. Trabulsi, L. R., R. Keller, and T. A. Tardelli Gomes. 2002. Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8:508-5 13. Uehara, A., Y. Fujimoto, A. Kawasaki, S. Kusumoto, K. Fukase, and H. Takada. 2006. Meso-diaminopimelic acid and meso-lanthionine, amino acids specific to bacterial peptidoglycans, activate human epithelial cells through NOD1. J Immunol 177:17961804. van Eden, W., R. van der Zee, and B. Prakken. 2005. Heat-shock proteins induce T-cell regulation of chronic inflammation. Nat Rev Immunol 5:318-330. Vidal, M., E. Kruger, C. Duran, R. Lagos, M. Levine, V. Prado, C. Toro, and R. Vidal. 2005. Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol 43:5362-5365. Vijay-Kumar, M., J. D. Aitken, C. J. Sanders, A. Frias, V. M. Sloane, J. Xu, A. S. Neish, M. Rojas, and A. T. Gewirtz. 2008. Flagellin treatment protects against chemicals, bacteria, viruses, and radiation. J Immunol 180:8280-8285. Vijay-Kumar, M., H. Wu, R. Jones, G. Grant, B. Babbin, T. P. King, D. Kelly, A. T. Gewirtz, and A. S. Neish. 2006. Flagellin suppresses epithelial apoptosis and limits disease during enteric infection. Am J Pathol 169:1686-1700. Vinzing, M., J. Eitel, J. Lippmann, A. C. Hocke, J. Zahlten, H. Slevogt, D. N’Guessan P, S. Gunther, B. Schmeck, S. Hippenstiel, A. Flieger, N. Suttorp, and B. Opitz. 2008. NAIP and Ipaf control Legionella pneumophila replication in human cells. J Immunol 180:6808-6815. Wald, D., J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, J. Towne, J. E. Sims, 0. R. Stark, and X. Li. 2003. SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol 4:920-927. Wang, J., and F. Xing. 2008. Human TSLP-educated DCs. Cell Mol Immunol 5:99-106. Weng, M., W. A. Walker, and I. R. Sanderson. 2007. Butyrate regulates the expression of pathogen-triggered IL-8 in intestinal epithelia. Pediatr Res 62:542-546. West, A. P., B. A. Dancho, and S. B. Mizel. 2005. Gangliosides inhibit flagellin signaling in the absence of an effect on flagellin binding to toll-like receptor 5. J Biol Chem 280:9482-9488. Yeo, S. J., J. G. Yoon, S. C. Hong, and A. K. Yi. 2003. CpG DNA induces self and cross hyporesponsiveness of RAW264.7 cells in response to CpG DNA and lipopolysaccharide: alterations in IL-i receptor-associated kinase expression. J Immunol 170:1052-1061. Yona-Nadler, C., T. Umanski, S. Aizawa, D. Friedberg, and I. Rosenshine. 2003. Integration host factor (IHF) mediates repression of flagella in enteropathogenic and enterohaemorrhagic Escherichia coli. Microbiology 149:877-884. Yoshioka, A., R. Okamoto, S. Oshima, J. Akiyama, K. Tsuchiya, T. Nakamura, T. Kanai, and M. Watanabe. 2008. Flagellin stimulation suppresses IL-7 secretion of intestinal epithelial cells. Cytokine 44:57-64.  174  100.  101.  102.  Zeissig, S., A. Fromm, J. Mankertz, J. Weiske, M. Zeitz, M. Fromm, and J. D. Schulzke. 2007. Butyrate induces intestinal sodium absorption via Sp3-mediated transcriptional upregulation of epithelial sodium channels. Gastroenterology 132:236-248. Zhang, S. Q., A. Kovalenko, G. Cantarella, and D. Wallach. 2000. Recruitment of the IKK signalosome to the p55 TNF receptor: RIP and A20 bind to NEMO (IKKgamma) upon receptor stimulation. Immunity 12:301-311. Zilbauer, M., N. Dorrell, A. Elmi, K. J. Lindley, S. Schuller, H. E. Jones, N. J. Klein, G. Nunez, B. W. Wren, and M. Bajaj-Elliott. 2007. A major role for intestinal epithelial nucleotide oligomerization domain 1 (NOD 1) in eliciting host bactericidal immune responses to Campylobacterjejuni. Cell Microbiol 9:2404-2416.  175  Appendix Appendix A (supplementary data)  1000  900 800 -1 700 IL-8 pg/mI  600 500  -  -  400 300 200 100 0•--• Control  DMSO  FliC  Figure Al: Effect of DMSO (vehicle) on IL-8 secretion from Caco-2 cells. IECs were exposed to DMSO (0.5 nM) and FliC (5 nM) for 6 h. Supernatant was collected for IL-8 quantification by ELISA.  176  phospho-ERK  !Z  phospho-JNK  Actin  —*  Uninfected  lh  2h  4h  EPEC  Figure A2: EPEC infection does not activate JNK and ERK in IECs. Caco-2 cells were infected for different time point as shown. After infection, cells washed in ice-cold HBSS buffer and lysates prepared as described in Materials and Methods. 50 jig of cleared whole cell lysate was subjected to SDS-PAGE in western blots. Membranes were probed with mouse monoclonal primary antibodies against human phospho-ERK (upper panel) and human phospho-JNK (lower panel). Mouse monoclonal antibody was used for detection of Actin (internal loading control). Blots were developed by ECL.  177  1800 1600 1400 1200 IL-8 pg/mi  ° 800 600 400 200  -  -  -  -  -  -  -  -  -  0NSC SIRNA  Sig SiRNA  NSC SiRNA  Sig SiRNA  +  +  +  +  FliC  FIiC  CpG  CpG  Figure A3: Sigirr knockdown amplifies flagellin and CpG ODN responses in IECs. HT-29 cells were transiently transfected with either control (NSC) or Sigirr (Sig) SiRNA and exposed to FIiC (10 ng/ml) and CpG oligonucleotides (1 tiM) for 6-12 h. Supernatants were collected and IL-8 quantified by ELISA.  *  p<O.05 vs. NSC SiRNA + F1iC and NSC SiRNA + CpG.  178  Table Al: Optimization of experimental conditions for Sigirr semi-quantitative RT-PCR analysis. 1. Denaturation at 94°C for 30 seconds. 2. Annealing at 58°C for 30 seconds. 3. Elongation at 72°C for 1 minute 4. Final extension at 72°C for 5 minute  5. PCR product size 200 bp.  179  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0068218/manifest

Comment

Related Items