UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Y-box binding protein-1 induces MET, CD44, and CD49f thereby promoting the capacity for tumour initiation. To, Karen Ka-Yan 2009

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2009_fall_to_karen.pdf [ 3.47MB ]
Metadata
JSON: 1.0067723.json
JSON-LD: 1.0067723+ld.json
RDF/XML (Pretty): 1.0067723.xml
RDF/JSON: 1.0067723+rdf.json
Turtle: 1.0067723+rdf-turtle.txt
N-Triples: 1.0067723+rdf-ntriples.txt
Original Record: 1.0067723 +original-record.json
Full Text
1.0067723.txt
Citation
1.0067723.ris

Full Text

   Y-BOX BIglyph1197DIglyph1197G PROTEIglyph1197-1 Iglyph1197DUCES MET, CD44, Aglyph1197D CD49F THEREBY PROMOTIglyph1197G THE CAPACITY FOR TUMOUR Iglyph1197ITIATIOglyph1197  by   Karen Ka-Yan To  B.Sc. (Hon.), University of British Columbia, 2006     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF    MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE STUDIES   (Experimental Medicine)     THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)   SEPTEMBER 2009     © Karen Ka-Yan To, 2009  ii ABSTRACT  Y-box binding protein-1 (YB-1) is an oncogenic transcription/translation factor expressed in >40% of breast cancers, where its expression correlates with enhanced tumour cell growth and drug resistance.  YB-1 is also significantly associated with disease recurrence, suggesting links to tumour-initiating cells (TICs).  We recently reported that YB-1 binds to the promoters of genes associated with a stem/progenitor-like phenotype through a chromatin immunoprecipitation (ChIP)-on-chip screen, including genes encoding the MET receptor, CD44, and CD49f.  We first confirmed that YB-1 induces oncogene MET by activating its promoter.  Further, both YB-1 and MET expression were detected in purified populations of primary human mammary progenitor cells.  Similarly, we confirmed that YB-1 binds the gene promoters of reported TIC markers CD44 and the stem cell marker CD49f (α6 integrin) using conventional ChIP.  Human breast TICs, reportedly CD44+/CD24-/low, self-renew, grow in mammospheres, and may evade current drug therapies, leading to increased relapse rates in patients.  We observed that P-YB-1S102 co-localized to a CD44High breast cancer cell subpopulation with increased growth capacities.  Silencing YB-1 down-regulated MET, CD44 and CD49f, while overexpression of wild-type (YB-1WT) or a constitutively activated form (YB-1S102D) increased MET, CD44 and CD49f transcripts and proteins.  Consistent with these findings, the mammary glands of YB-1 transgenic mice had elevated CD44 and CD49f protein with associated hyperplasia.  Moreover, the expression of YB-1S102D in SUM 149 cells, enhanced mammosphere formation and growth in soft agar.  Conversely, silencing either CD44 or CD49f in these cells reversed YB-1S102D enhanced growth.  Consistent with a role for TICs in relapse, Paclitaxel activated YB-1 and this correlated with induced CD44.  Further, expression of YB-1WT enhanced mammosphere growth in the presence of Paclitaxel.  Taken together, our data suggests that YB-1 induces MET, CD44, and CD49f expression which may be a part of the mechanism used to enhance tumour cell growth, disease relapse, and drug resistance.   iii TABLE OF COglyph1197TEglyph1197TS  ABSTRACT .................................................................................................................................................ii LIST OF TABLES.......................................................................................................................................iv LIST OF FIGURES......................................................................................................................................v LIST OF ABBREVIATIOglyph1197S.......................................................................................................................vi ACKglyph1197OWLEDGEMEglyph1197TS.........................................................................................................................vii CO-AUTHORSHIP STATEMEglyph1197T...............................................................................................................x CHAPTER Oglyph1197E :   Iglyph1197TRODUCTIOglyph1197 ........................................................................................................1 1.1 BREAST CAglyph817CER.................................................................................................................................1 1.2 CURREglyph817T TREATMEglyph817T OPTIOglyph817S...................................................................................................2 1.3 TRAglyph817SCRIPTIOglyph817 FACTORS Iglyph817 CAglyph817CER........................................................................................8 1.4 Y-BOX BIglyph817DIglyph817G PROTEIglyph817-1 (YB-1)..................................................................................................9 1.5 MEMBRAglyph817E RECEPTORS Iglyph817 CAglyph817CER..........................................................................................13 1.6 MET RECEPTOR.................................................................................................................................14 1.7 CD44......................................................................................................................................................16 1.8 CD49F (ALPHA-6 Iglyph817TEGRIglyph817)...........................................................................................................18 1.9 glyph817ORMAL Aglyph817D CAglyph817CER STEM CELLS...........................................................................................20 1.10 THESIS HYPOTHESIS Aglyph817D OBJECTIVES.....................................................................................24 REFEREglyph817CES.....................................................................................................................................................25 CHAPTER TWO :  PROFILIglyph1197G YB-1 TARGET GEglyph1197ES Uglyph1197COVERS A glyph1197EW MECHAglyph1197ISM FOR MET RECEPTOR REGULATIOglyph1197 Iglyph1197 glyph1197ORMAL Aglyph1197D MALIGglyph1197Aglyph1197T HUMAglyph1197 MAMMARY CELLS...............38 2.1 Iglyph817TRODUCTIOglyph817.................................................................................................................................39 2.2 MATERIALS Aglyph817D METHODS...........................................................................................................41 2.3 RESULTS..............................................................................................................................................48 2.4 DISCUSSIOglyph817.......................................................................................................................................54 2.5 FIGURES Aglyph817D TABLES.....................................................................................................................57 2.6 SUPPLEMEglyph817TARY MATERIALS Aglyph817D METHODS........................................................................63 2.7 SUPPLEMEglyph817TARY FIGURES...........................................................................................................67 REFEREglyph817CES.....................................................................................................................................................69 CHAPTER THREE :  YB-1 Iglyph1197DUCES EXPRESSIOglyph1197 OF CD44 Aglyph1197D CD49F LEADIglyph1197G TO Eglyph1197HAglyph1197CED SELF-REglyph1197EWAL, MAMMOSPHERE GROWTH, Aglyph1197D DRUG RESISTAglyph1197CE........................................72 3.1 Iglyph817TRODUCTIOglyph817.................................................................................................................................73 3.2 MATERIALS Aglyph817D METHODS...........................................................................................................73 3.3 RESULTS..............................................................................................................................................83 3.4 DISCUSSIOglyph817.......................................................................................................................................83 3.5 FIGURES Aglyph817D TABLES.....................................................................................................................91 3.6 SUPPLEMEglyph817TARY MATERIALS Aglyph817D METHODS......................................................................101 3.7 SUPPLEMEglyph817TARY FIGURES.........................................................................................................102 REFEREglyph817CES...................................................................................................................................................105 CHAPTER FOUR :  DISCUSSIOglyph1197 Aglyph1197D FUTURE DIRECTIOglyph1197S...........................................................107 4.1 COglyph817TRIBUTIOglyph817S Aglyph817D SIGglyph817IFICAglyph817CE......................................................................................107 4.2 IMPLICATIOglyph817S Aglyph817D FUTURE DIRECTIOglyph817S.............................................................................108 4.3 LIMITATIOglyph817S OF STUDIES...........................................................................................................116 4.4 COglyph817CLUDIglyph817G REMARKS...............................................................................................................118 REFEREglyph817CES...................................................................................................................................................119  iv LIST OF TABLES  Table 2.1.  Select putative YB-1 target genes identified in the COC screen that are common to one another in that they each are associated with a stem cell signature……..58           Table 3.1.  Treatment of SUM 149 cells with chemotherapeutic agents enriches for a CD44High subset………………………………………………………………………….. 99    v LIST OF FIGURES  Figure 2.1.  Categorization of YB-1 COC data into functional groups and schematic presentation of the possible interactions among the select genes that are linked to primitive cells and tumor initiation…………………………………………………........ 57    Figure 2.2.  YB-1 and MET receptor expression levels are positively correlated in basal-like breast cancer cell lines and primary normal mammary progenitor cells……... 59    Figure 2.3.  Traditional ChIP and EMSA localize YB-1 binding to the -1018 YRE……60  Figure 2.4.  MET mRNA and protein levels and reporter activity can be modulated via YB-1……………………………………………………………………………………... 61  Figure 2.5.  Inhibition of YB-1 disrupts HGF/MET receptor signaling and anchorage-independent growth……………………………………………………………………… 62  Supplementary Figure 2.1.  Stable Lentiviral down-regulation of YB-1 (Lenti-shYB-1) in SUM149 and its effect on MET expression………………………………………...67   Supplementary Figure 2.2.  CGH analysis using SMRT high resolution tiling arrays on primary BLBC………………………………………………………………………...68  Supplementary Table 2.1.  Full COC screen list of putative YB-1 target genes  (Table not included in this thesis due to excessive length and is accessible online through the website of scientific journal, Oncogene, http://www.nature.com/onc/index.html.  A concise list is represented in Table 2.1.)  Figure 3.1.  YB-1 binds to the promoters of CD44 as well as CD49f and expression of CD44  correlates with the presence of P-YB-1S102……………………………………….91  Figure 3.2.  Silencing YB-1 down-regulates the expression of CD44 and CD49f…….... 93  Figure 3.3.  YB-1 overexpression induces CD44 and CD49f expression…………….....94  Figure 3.4.  CD44 and CD49f are essential for breast cancer cell growth in 3-dimensional in vitro assays……………………………………………………………… 96  Figure 3.5.  Paclitaxel treatment preferentially selects for breast cancer cells with elevated P-YB-1S102 expression..………………………………………………………..100  Supplementary Figure 3.1.  Targeted induction of YB-1 in the mammary gland leads to elevations in CD49f.………………………………………………………………….102  Supplementary Figure 3.2.  Validation of purified rat anti-mouse CD44 antibody…..104   vi LIST OF ABBREVIATIOglyph1197S   4-OHT   4-hydroxytamoxifen  7-AAD    7-Amino-actinomycin D AML    Acute myeloid leukemia BSA    Bovine serum albumin ChIP    Chromatin immunoprecipitation CML    Chronic myeloid leukemia COC    ChIP-on-chip CSD    Cold-shock domain DAPI    4',6-Diamidino-2-phenylindole DMEM   Dulbecco’s modified essential medium EGF    Epidermal growth factor EGFR    Epidermal growth factor receptor EMSA    Electrophoretic mobility shift assay EMT    Epithelial mesenchymal transition ER    Estrogen receptor FBS    Fetal bovine serum FGF    Fibroblast growth factor HGF    Hepatocyte growth factor HGFR    Hepatocyte growth factor receptor IGF-1    Insulin-like growth factor-1 JAK    Janus kinases  LCK    Leukocyte-specific protein tyrosine kinase MAPK   Mitogen-activated protein kinase MDR-1   Multidrug resistance-1 MET    Mesenchymal epithelial transition PARP    Poly (ADP-ribose) polymerase PBS    Phosphate buffer saline PCglyph1197A    Proliferating cell nuclear antigen PDK-1   Phosphoinositide-dependent kinase-1 PI    Propidium iodide PI3K    Phosphoinositide 3-kinase PKC    Protein kinase C PR    Progesterone receptor RSK    Ribosomal S6 kinase SERM    Selective estrogen receptor modulator STAT3   Signal transducers and activators of transcription TKI    Tyrosine kinase inhibitors YB-1    Y-box binding protein-1   vii ACKglyph1197OWLEDGEMEglyph1197TS  This thesis was written by me on behalf of many who have contributed to it in so many ways and deserve to be acknowledged formally.  To Sandi.  It has been an absolute pleasure to have been in your lab the past 4 years.  I have learned from you so so much within and beyond the realm of science because you took extra care and time to share your knowledge, experiences, and stories with me.  I will be forever grateful for your understanding, unwavering support, and hugs through the decisions, circumstances, and unknowns the past couple of years.  You have been a true mentor.  I thank you so much for believing in me from the very beginning as I think that has made all the difference.  I will always remember your inspiring enthusiasm for scientific discoveries and your love for your students.          To Abbas, Kristen, Jennifer, Kaiji, and Lawrence.  Without your expert assistance and intellectual input, the bulk of my Master’s thesis would have never been completed.  I thank you from the bottom of my heart your patience with me, your priceless scientific contributions to this thesis, and your friendship.  To Mel, Jessie, Arezoo, Alastair, Cathy, Anna, Mary, and Sam also.  It has been so wonderful to belong to lab with so many inspiring people and true friends.  I thank you all for everything that you have taught me both scientifically and personally.  I will miss you all dearly for the endless support, talks, silly moments, advice, outings, and shared laughter through the years.  Thank you all for the memories.  I look forward to hearing the successes of your future endeavours.  To former members of the Dunn lab, Michelle, Joyce, Goli, Yuan-yuan, Nancy, and Dan, your contributions to my experience at the Dunn lab is long from forgotten.          To members of my thesis committee.  To Connie.  You have been a constant presence in my research career from the very beginning.  I thank you deeply for your support, guidance, and advice scientific or otherwise the past 5 years.  I have learned so much from you.  It has been such a great privilege.  To Dr. Roskelley.  I thank you for your valued input and scientific stimulation.  It has been great having you on my thesis committee.  To Afshin.  You had the patience to teach me when I knew nothing about research.  You shared with me your contagious passion for science.  You have continued to mentor me long after you stopped being my supervisor.  I will forever be grateful for the opportunities you helped me to realize and for your friendship all these years.     To Lisa Xu from the CFRI FACS Facility, Peter Eirew from the Terry Fox Laboratory, Michel Roberge and Pauline Johnson from the Life Sciences Institute, and Vincent Duronio from the Prostate Center.  I thank you for your support in your own ways the past couple of years.  I am fortunate to have crossed paths with you.  To Ann, Min, Ben, and Gary.  To the people who I used to talk research and science with first, my dear undergrad co-op friends and now fellow grad students/researchers.   viii Sometimes all one needs is a person going through or who have gone through the exact same thing.  Thanks you guys for the conversations all these years, the shared research victories and disasters, however major or minor.  To my parents & Jennie.  For your unconditional love and support for me and my adventures, research or otherwise, even when it is something you don’t understand.  And for trying over and over to understand them.  I will always be indebted to you.    To Gordon.  For being my best friend through it all. ix DEDICATIOglyph1197        To Gordon, my parents, and Jennie.   x CO-AUTHORSHIP STATEMEglyph1197T  Chapter 2:   The manuscript in this chapter was published in Oncogene in March 2009.  The work described was designed by Sandra Dunn, Melanie Finkbeiner, Arezoo Astanehe, and me.  I had designed, conducted and analyzed data from the quantitative real-time PCR experiments using isolated primary normal mammary progenitors, the chromatin immunoprecipitation (ChIP) using SUM 149 xenograft tissues, the experiments characterizing the SUM 149 stable shYB-1 cell line, and all experiments involving small molecule compound OSU-03012.  Melanie Finkbeiner analyzed the ChIP-on-chip data.  Additionally with Arezoo Astanehe, Melanie Finkbeiner designed, performed, analyzed all YB-1 knockdown western blots, YB-1 overexpression western blots, quantitative real-time PCRs, ChIP experiments, EMSAs, luciferase promoter activity experiments, HGF-stimulation experiments, and soft agar experiments.  Immuno-fluorescence experiments were performed by Abbas Fotovati.  Alastair Davies analyzed the ChIP-on-chip data using the Ingenuity Pathway Analyses software.  Yang Lucy Zhao first established the SUM 149 stable shYB-1 cell line.  Helen Jiang performed the ChIP for microarray chip analysis.  Anna Stratford constructed the plasmid encoding YB-1S102D.  Ashleen Shadeo performed the array comparative genomic hybridization.  Carla Boccaccio and Paolo Comoglio provided the MET promoter reporter construct.  Peter Mertens provided the phospho-YB-1S102 antibody.  Peter Eirew assisted with establishment of SUM 149 tumours in mice.  Afshin Raouf isolated the primary normal mammary progenitor cells.  Connie Eaves provided the mice for the establishment of SUM 149 xenografts as well as the primary normal mammary progenitor cell samples.  The manuscript was written and prepared by Melanie Finkbeiner, Arezoo Astanehe, Abbas Fotovati, Connie Eaves, and Sandra Dunn.  Chapter 3:  The work described in this chapter is a manuscript just submitted to a peer-reviewed journal.  The research program was identified and designed jointly by Sandra Dunn and me.  I designed, conducted, and analyzed the ChIP assays, experiments involving cell sorting by FACS, mammosphere assays, soft agar assays, mammosphere passaging self-renewal assays, YB-1 knockdown and overexpression western blots and quantitative real-time PCRs, flow cytometry analyses, immunofluorescence experiments, CD44 and CD49f knockdown experiments, Matrigel assays, and Taxol treatment characterizations.  Abbas Fotovati designed and conducted the staining protocol and imaging of all immunofluorescence photographs.  Kristen Reipas provided technical assistance to cell culture assays.  Jennifer Law and Kaiji Hu performed and analyzed the chemotherapy drug screen.  Jing Wang and Isabelle Berquin bred the YB-1 transgenic mice, provided histological sections, and conducted the H&E staining as well as imaging.  Hans-Dieter Royer originally established the YB-1 transgenic mice, and gave editorial guidance.  Pauline Johnson, Afshin Raouf, Connie Eaves provided intellectual and editorial input.  The manuscript was written and prepared jointly by Sandra Dunn and me.   1 CHAPTER Oglyph1197E :   Iglyph1197TRODUCTIOglyph1197   1.1 BREAST CAglyph1197CER Cancer is a disease that arises when the tightly regulated programming governing the life cycle of a cell has been disrupted, leading to uncontrolled cell growth and the disease burden of an accumulating mass.  It is a clonal disease where a cell’s genetic programming is sufficiently disturbed such that the normal cell’s plethora of preventative and repair mechanisms are unable to recover.  A cancer cell achieves such genetic aberrations through the combination of accumulated contact with harmful mutagens in its surrounding environment and/or innate inherited mutations in its genome.  In some cancers, the malignant cells in growing tumours can acquire new properties due to genomic instability to disseminate from the primary tumour.  The cell or group of cells can metastasize to a distant site or sites with hospitable microenvironments and generate tumours at a secondary site.  Metastasis is the sole cause of death in breast cancer patients.  Breast cancer stems from the epithelial cells of the mammary gland, which are composed of two lineages of cells, luminal and myoepithelial cells1, 2.  In the past decade, breast cancer has been demonstrated to be a heterogeneous disease.  Seminal gene expression studies on large cohorts of breast cancer patients have resulted in a classification of breast cancers into 5 major subtypes based on well characterized breast cancer receptors for which treatment is available 3, 4.  Breast cancer is first dissected into two main branches based on the expression of estrogen receptor (ER).  Under the ER positive breast cancers are the “Luminal A” and “Luminal B” subtypes.  ER negative breast cancers are sub-divided into the “Normal-like”, “Basal-like”, and “Her-2+” subtypes.  More recently a new subtype termed “Claudin-low” related to the “Basal-like”  2 group has also been identified5.  It is hypothesized then that similar to leukemias and lymphomas for which the theory has been validated, the different subtypes of breast cancer represent the diversity of differentiation stage and lineage of the originating cancer clone6, 7.  Thus, understandably, the current field of breast cancer research is closely linked to the status of mammary gland biology research.   1.2 CURREglyph1197T TREATMEglyph1197T OPTIOglyph1197S  The American Cancer Society estimates that globally over 1.3 million women will be diagnosed with breast cancer each year.  With the current clinically available therapeutics, the 10-year survival rate in the United States was quoted at approximately 80% in 2007 by the National Cancer Institute.  The survival rate however drops significantly in the presence of local and distant disease relapse, the 10-year survival rate dropping to 60% and 10% respectively, leaving better treatment options to be desired.  An overview of currently available breast cancer treatments will be discussed and a select number of specific drugs will be highlighted.  Mastectomies, lumpectomies, and lymph node dissections, if the cancer has spread, are the primary treatment option for most breast cancer patients.  Surgery is accompanied by a combination of radiation therapy, chemotherapy, hormone therapy, and/or targeted therapy.  There is currently a movement in the clinic towards “personalized medicine”, where diseases like cancers can be classified into subtypes based on clinically relevant parameters innate to the properties of the tumour type, like drug response and overall prognosis4, 8.  This trend is therefore made possible by much basic, translational, and  3 clinical research focused on stratifying patient tumours in response to the combinations of currently available therapies.        Solid tumours were once viewed by many as homogeneous cell masses in which all cells divided uncontrollably.  Treatments available currently were thus designed to simply target dividing cells.  Chemotherapeutic drugs were generated to prevent cell division, where dosing allowed a differential window to kill the fastest dividing cells, believed to be the most aggressive cancer cells, leaving normal cells relatively unscathed.  Alkylating agents (mustard gas derivatives, platinum-based), plant alkaloids (vinca alkaloids, taxanes, podophyllotoxins, camptothecan analogs), anti-tumour antibiotics (anthracyclines), anti-metabolites (folic acid antagonist, pyrimidine antagonist), PARP inhibitors, and topoisomerase inhibitors, are all (with the exception of the alkylating agents) cell cycle specific and work to compete with normal molecules in the cell during cell division to prevent the normal mechanisms from being manipulated by a cancer cell.  In breast cancers, the approved chemotherapies used in adjuvant and neoadjuvant settings in various combinations include doxorubicin and epirubicin (anthracyclines), paclitaxel and docetaxel (taxanes), cyclophosphamide (alkylating agent), 5-fluorouracil and gemcitabine (anti-metabolite), and vinorelbine (vinca alkaloid).  Paclitaxel and docetaxel specifically are taxane compounds that target the metaphase of mitosis by hyper-stabilizing the β subunit of tubulin in microtubules, preventing their dissociation and causing apoptosis9.  Chemotherapies are generally used in adjuvant settings except for very aggressive late stage breast cancers.   4 Historically, the mainstay of breast cancer hormone therapy is tamoxifen which targets ER.  Thus, tamoxifen though successful in ER+ patients, resulting in very high survival rates for the ER+ breast cancer subtype, precludes the 40% of ER- patients3, 4.  Tamoxifen itself has little affinity to ER10.  Its liver metabolite 4-hydroxytamoxifen (4-OHT), however, has much greater affinity to the receptor10.  The 4-OHT/ER complexes then compete with and inhibit normal estrogen/ER complexes to translocate into the nucleus to transactivate downstream growth enhancing genes10.  Further, the 4-OHT/ER complexes recruit other co-repressors to the promoters of genes with identified estrogen response elements10.  As ER is often overexpressed in ER+ cancers10, the prevention of estrogen to promote cell proliferation is only partially effective.  Since the first conception of estrogen, many small molecules have been developed to inhibit the estrogen/ER signaling pathway.  Of note, raloxifene, another compound belonging to the family of selective estrogen receptor modulators (SERMs), is FDA-approved for the treatment of some invasive breast cancers, and acts directly on the estrogen receptor11, 12.  Additionally, aromatase inhibitors, like anastrozole, which prevents the synthesis of estrogen, are approved for the treatment of localized breast cancers12.   Tyrosine kinase inhibitors (TKIs) have in recent years accrued much achievement in the clinic.  The one major example is imatinib, a TKI against BCR-ABL, a fusion constitutively active oncoprotein frequently found in chronic myeloid leukemias (CML)13.  It has since been shown that imatinib is not BCR-ABL specific but also targets other tyrosine kinases important in cancers including c-Kit, and this multi-target specificity has proven to be potent against these leukemias14.  In breast cancers, small  5 molecule tyrosine kinase inhibitors, gefitinib and erlotinib, designed against the active site of EGFR were effective in pre-clinical studies15 but eventually failed in later clinical trials16.  Still, there is more recent evidence to show that basal-like breast cancers, over 60% of which overexpress EGFR, may be sensitive to EGFR TKIs in combination with chemotherapy or downstream signaling inhibitors17, 18.  In contrast, they have been successful in the clinical management of advanced of metastatic non-small cell lung cancer (NSCLC), as well as malignancies of the ovaries, head, and neck16.  Lapatinib, which is designed against both the tyrosine kinase active sites against EGFR and Her-2, however, showed promise early on in pre-clinical studies19 and have since been approved to use in combination with capecitabine20.    Trastuzumab was the success story of targeted therapies for breast cancer in the 1990s.  It is a monoclonal antibody that binds to Her-2 (erbB2) of the erbB family of tyrosine kinase receptors, all of which often overexpressed in breast and ovarian cancers15.  Her-2 specifically is overexpressed in 15 to 25% of all breast cancers and forms heterodimers with other membrane receptors including other erbB family members, EGFR, and Her-3, to signal downstream activating cell growth pathways15.  Trastuzumab has been shown via various physical mechanisms to decrease Her-2 signaling intracellularly and affect tumour growth in patients15.  Signal transduction inhibitors also include a class of compounds that inhibit signaling downstream of membrane receptors intracellular.  One example is OSU-03012, a small molecule inhibitor to phosphoinositide-dependent kinase-1 (PDK-1), one of two upstream  6 kinases to Akt21.  OSU-03012 is a derivative of Celecoxib, designed against COX-2, originally intended for inflammatory diseases but are currently undergoing Phase II clinical trials for the treatment of breast cancers22.  OSU-03012 inhibits the Akt signaling pathway in breast cancer cells leading to cell growth inhibition and apoptosis21, 22.  It is also potent in cells of imatinib-resistant CML23, rhabdomyosarcomas24, glioblastomas25, myelomas26, NSCLCs27, pancreatic cancers28, and hepatocellular carinomas29.               Much research currently lies in further stratifying patients that would respond well to the above mentioned drugs, as well as unique combinations of them.  To achieve that, new biomarkers are constantly proposed to better treat the patient groups and minimize over-treatment.  For example, overexpression of β3-tubulin isoform30 and presence of β-tubulin mutations31 have been associated with paclitaxel resistance, whereas one study showed Her-2 overexpression and ER negativity defined a population of patients with increased sensitivity to paclitaxel32.  Importantly, activation of the anti-apoptotic PI3k/Akt pathway has been cited to promote resistance to many chemotherapeutic drug classes, including taxanes, as well as targeted therapies such as trastuzumab and tamoxifen33, 34.  Moreover, IGF-1R and EGFR signaling downstream through the PI3k/Akt and MAPK pathways have also been attributed to tamoxifen resistance34, 35.  Thus, clinical trials for new compounds that target the PI3k/Akt pathway members, other tyrosine kinase receptors, membrane receptors, kinases, and phosphatases, are currently being developed.     7 This is especially important for the basal-like subtype of breast cancer patients.  As they are ER-, PR-, and Her-2-, prognosis is much poorer for these patients4.  For the basal-like breast cancers, EGFR and c-Kit, which are both expressed in high proportions of this tumour subtype, have been promising targets in pre-clinical models18, 36, 37.  Interestingly, dasatinib, the small molecule which has achieved much success in targeting c-Kit activity in BCR-ABL+ CML patients has shown early efficacy against basal-like breast cancer cells38.  More recently, the Notch signaling pathways have also been implicated in breast cancer cells39, and in particular, basal-like breast cancers40, 41.  Additionally, basal-like tumours have been demonstrated to share biological similarities to BRCA1-associated tumours42.  Studies suggest that BRCA1-related defective DNA-repair pathways confer sensitivity to platinum-based and PARP inhibiting chemotherapies43-46, and thus could be an avenue to explore for the treatment of these cancers.  Finally, as it has been alluded before, the development of the current breast cancer therapy options was based on the concept that solid tumours are a homogeneous cell mass.  It has since been demonstrated that tumours are heterogeneous within themselves atop of patient genome heterogeneity47.  Cells derived clonally from a tumour have been shown to have very different growth rates, differentiation status, tumourigenic ability, radiation and drug responsiveness6, 19, 47, 48.  Therefore, there is much more biology that needs to be unravelled to fully understand the resistance of ER+ cancers to tamoxifen, Her-2+ tumours to trastuzumab, and tumours of all types to currently available chemotherapies.   8 1.3 TRAglyph1197SCRIPTIOglyph1197 FACTORS Iglyph1197 CAglyph1197CER Transcription factors are biological molecules that can alter gene expression.  It is one of the largest classes of biological molecules with an estimated 2000 genes encoding transcription factors49.  Transcription factors have long been implicated in human diseases.  Transcriptional regulation is an exquisitely specific and monitored phenomenon that governs every cell phenotype.  As such, transcription factors in turn are also tightly monitored by genetic and epigenetic controls.  As transcription factors often regulate many genes supporting many different phenotypes, it is conceivable that aberrations in these molecules could be potentially dangerous in any biological setting.  In cancer cells, transcription factors that elicit genes governing growth, proliferation, invasion, motility, drug resistance, and/or cell cycle inhibition often become overexpressed or constitutively activated such that cells acquire an abnormal and uncontrolled survival and growth capacity.  Some examples of transcription factors that are targets of developing anti-cancer peptides and small molecules include the ETS family, AP-1 family, FoxO family, NFκB, Stat family, c-Myc, and, b-Myb50.  For example, there exist Stat3-specific peptide inhibitors and Stat3-targeted oligonucleotide decoy inhibitors that reduce the ability of Stat3 homodimers to interact with downstream gene promoters51, 52.  Similarly, c-Myc peptides have been found to reduce the expression of downstream genes, including p5353.  Because transcription factors are upstream of their target genes, they make powerful targets for therapy as one molecule frequently regulates many downstream genes, which often work collaboratively.  While mutations, amplifications, and activation by phosphorylation are often the cause of oncogene overexpression, transcriptional activation often play an important role.  For example, 70  9 to 80% of all metastatic breast carcinomas overexpress EGFR54 and its overexpression in these breast cancer cases has been sited to be frequently caused by transcriptional activation55.  As known EGFR transcription factors include YB-118, 56, SP-157, and c-Jun58, they may be good prospective anti-cancer targets.  More importantly, many studies have repeatedly shown that the overexpression of EGFR is associated with poorer prognosis in breast cancer patients15.  It is important that the molecular mechanisms that drive oncogene overexpression in these malignant cells be elucidated.  Further, transcription factors are often the convergence of multiple signaling pathways originating from even more membrane receptors and/or receptor tyrosine kinases.  Therefore, transcription factors make powerful molecules to better understand in cancer initiation and progression.            1.4 Y-BOX BIglyph1197DIglyph1197G PROTEIglyph1197-1 (YB-1)  Y-box binding protein-1 (YB-1) is an oncogenic transcription/translation factor in the Y-box family of proteins.  This family of proteins has a well-characterized and higly conserved cold-shock domain (CSD), flanked by a N-terminal domain and a C-terminal domain.  The N-terminal domain is alanine and proline rich, believed to be involved in gene transactivation59, while the C-terminal domain is a set of 4 repeats of alternating approximately 30 acidic and 30 basic residues60.  The prokaryotic Y-box proteins were first identified in bacteria for their ability to sustain protein synthesis in cold temperatures61.  It was later discovered that in both prokaryotes and eukaryotes, the CSD has a strong affinity for nucleic acids, both single and double-stranded DNA and RNA62.  The CSD of YB-1 was later found to be crucial to the protein’s affinity for nucleic  10 acids60.  The CSD of YB-1 is believed to bind to the inverted CAAT box motif, ATTG63, 64 and is also responsible for nuclear transport65.  Expectedly, YB-1 was later discovered to have a major role in the regulation of transcription and translation59, 66.  Of note, while YB-1 has major roles in translation, this literature review will focus on its transcriptional roles in cancer as it is our research focus and more frequently documented.    YB-1 is an important player in many known cancer related pathways.  As a multi-functional regulator of gene expression, YB-1 was first reported to be putatively involved in cell proliferation and transformation in 199567.  Since then, YB- 1’s speculated roles in cancer have been better characterized in a variety of cell types.  YB-1 is known to interact directly with p53 at gene promoters and can negatively modulate its ability to transactivate downstream gene p2168, suggesting an interplay between oncogenic and tumour suppressive phenotypic regulation.  YB-1 is regulated by c-Myc by direct promoter occupancy69.  YB-1 was identified as a novel downstream Akt substrate by our lab group in 200570.  Since then, we have also found it to be a target of the p90 ribosomal S6 kinase (RSK), and demonstrated using a kinase assay that RSK has a higher affinity for YB-1 than Akt does, where both kinases competes for the Serine 102 (Ser102) site of YB-171.  Our lab has evidence to show that phosphorylation of YB-1 enhances its movement into the nucleus and increases its affinity for nucleic acids70, 71, suggesting a mechanism by which its activation leads to altered gene expression profiles and aggressive phenotypes.  One mechanism by which this occurs is through its regulation of the STAT3 pathway72.     11 YB-1 is consistently associated with increased cell growth rates and drug resistance in cancers of different origins.  It correlates positively with the expression of proliferating cell nuclear antigen (PCNA), a highly proliferative cell marker, in colorectal tumors73 as well as Ki67 in breast cancers56.  YB-1 is not expressed at high levels in normal breast tissues but is highly expressed in breast tumours74.  Likewise, YB-1 is overexpressed in cancers of the prostate75, colon73, ovary76, bone77, lung78, myelomas79, and rhabdomyosarcomas80 but undetectable or detected at low levels in their normal tissue counterparts.  In addition, YB-1 knockdown with RNAi in breast, melanoma, adenocarcinoma, hepatoma, fibrosarcoma and colon cancer cells results in cell death81.  The focus of this review will be on evidence suggesting YB-1 as an oncogene in breast cancers.  Transgenic mice with targeted YB-1 expression in their mammary glands developed invasive tumors with 100% penetrance82.  YB-1 also stimulates the proliferation of pre-neoplastic breast cancer cells by inducing cyclin A and cyclin B mRNA transcripts65.  More recently, our lab has reported that overexpressing wild-type YB-1 in breast cancer cells of different subtypes enhanced tumor cell growth in monolayer and 3-dimensional assays, while overexpressing a mutant form of YB-1 (S102A) had no effect70, 83, 84.  Further, we found that the overexpression of wild-type YB-1 leads to the induction of EGFR56, Her-256, MET83, and PIK3CA (the gene encoding the α-subunit of the p110 activating subunit of the PI3k)84, which are often overexpressed and/or activated in human breast cancers.  More specifically, YB-1 activates these genes transcriptionally18, 21, 56, 83, 84.  YB-1 is expressed at comparable levels in all breast cancer subtypes; however, we find that the activated form of YB-1, phosphorylated by Akt or RSK or PKC at Serine 102, more frequently in the ER- breast cancer subtypes and/or the  12 basal-like subtype83.  We have demonstrated YB-1 is essential to all the different subtypes of breast cancers in vitro18, 56, 72, 83, 84, and it is important for xenograft growth in vivo72.  Further, it has been reported that YB-1 is expressed in cancers of the breast at onset and early stages of the disease82, 85.  There, YB-1 enhances cancer progression through its contribution to mitotic failure and centrosome amplification, leading to chromosomal instability82.    In addition, YB-1 transcriptionally activates MDR-1 (multi-drug resistance gene-1, also known as p-glycoprotein) which can protect cancer cells from chemotherapeutic agents74.  YB-1 has been associated with chemoresistance to paclitaxel and other chemotherapeutic agents in breast cancer cells74, 86, 87, synovial sarcomas77, head and neck cancer cells88, ovarian cancer cells76, 89, 90, rhabdomyosarcomas cells80, prostate cancer cells91, glioma cells91, and myeloma cells79, 92.  Most recently, in a study of 4000 cases of breast cancers, our group showed a significant correlation between high YB-1 expression and poor prognosis and cancer recurrence across all breast cancer subtypes93, suggesting a link to chemoresistance.  Taken together, YB-1 is a strong oncogenic factor in the breast and other cancers.  While there is clear evidence that YB-1 contributes to cell and tumour growth in human cancers, there has also been reports of its exhibiting growth suppressive effects in chicken embryo fibroblasts94.  Therefore, it can be concluded that YB-1 is involved in many signaling pathways that may be tissue and cell type-specific.  Most recently, we have explored the expression of YB-1 in normal mammary progenitor cells.  While YB-1 has  13 been previously demonstrated to be expressed at very low levels in normal mammary tissue74, we and others were able to find YB-1 transcripts in this rare primitive population83, 95, and have further found infrequent but detectable expression of YB-1 localizing to the basal layers of normal mouse mammary glands (unpublished data), suggesting that YB-1 may have a developmental role in the mammary gland as it does in embryogenesis96-101 and neural development101, 102.      1.5 MEMBRAglyph1197E RECEPTORS Iglyph1197 CAglyph1197CER Membrane receptors make up approximately 20% of cellular molecules and 60% of current drug targets103, highlighting their significance in biological outcomes.  All cells depend on their environment for signals for every activity, including proliferation, motility, metabolism, and death.  Membrane receptors then are extremely important in cell fates and decisions.  In cancers, membrane receptors, whether adhesion molecules or receptor tyrosine kinases, are often characterized by heightened signals promoting growth, proliferation, motility, as well as survival, and down-regulating signals for apoptosis, offsetting an equilibrium of controlled cell numbers and cell cycles.  As all cells depend on extracellular signals to grow, membrane receptors are crucial to the survival of cancer cells as well.  Further, cell surface receptors also adhere to and interact with adjacent epithelial, stromal and immune cells, all of which can contribute to tumour formation.  Importantly, membrane receptors are easily accessible by small molecules, and thus make attractive targets for therapy.   14 1.6 MET RECEPTOR The MET (mesenchymal-epithelial transition) receptor, also known as c-Met or the hepatocyte growth factor receptor (HGFR), is a membrane receptor that binds strictly binds the hepatocyte growth factor, also known as scatter factor104.  MET in response to its ligand HGF have important roles in physiological invasive growth observed in embryonic development and would healing104.  In mouse embryogenesis, HGF and MET are co-expressed in endodermal and mesodermal structures105.  In organogenesis and matured developmental stages, MET is expressed solely by epithelial cells and myoblast progenitors while HGF is expressed by mesenchymal cells105-107.  Upon stimulation by HGF, MET induces a scatter phenotype, which has been compared to an epithelial mesenchymal transition108.  EMT is a biological process that occurs in embryonic development and tissue regeneration, where cells transiently adopt a spindle-shaped morphology and increased motility to regulate ordered cell migration and morphogenesis of new tissues109.  As demonstrated by knock-out mice, HGF and MET are essential to the development of the placenta and the liver110.  MET mediates physiological invasive growth upon the binding of ligand HGF, activating downstream signaling pathways to the tyrosine kinase membrane receptor104.  The MET kinase phosphorylates and forms complexes with integrins, including α6β4111, and other membrane receptors, like EGFR112-114 and CD44115, 116.  The heterodimers signal through adaptor proteins thereby activating downstream cell survival and proliferation effectors, the PI3k/Akt, the MAPK pathways, and the JAK-STAT pathway104.      15 Recent studies have drawn similarities between cancer cell survival and proliferation mechanisms and that of primitive cell populations, including embryonic cells117.  Aberration of MET expression and activation suggests that cancer cells can adopt the invasive properties induced by MET to promote their own growth, migration, and survival.  MET mutations are rare in human cancers though germline missense mutations are found in hereditary kidney cancers118, and activation mutations are observed in non-hereditary tumours including sporadic papillary renal cancers, childhood hepatocellular carcinomas, and gastric cancers119.  The most frequent type of MET aberration in human cancers however is overexpression of MET in the absence of mutations and increased production of autocrine HGF120.  Overexpression of MET is found in carcinomas including those of the breast113, 121, colon122, 123, prostate124, lung125, and ovary126.  MET overexpression in epithelial cells then favours HGF ligand activation in addition to crosstalk with other membrane receptors, increased signaling downstream, and consequently a heightened invasive and motile phenotype.  MET is associated with poor prognosis and a metastatic phenotype120.  In recent years, not unlike other oncogenes, MET has also been speculated to mediate a more primitive, early embryonic pro-survival, proliferative, and migratory phenotype to cancer cells as it has been reported to function biologically in more stem-like populations of the brain, liver, and skeletal muscles104.  MET has also been used as a marker for liver stem cells that differentiate into its two lineages, hepatocytes and cholangiocytes127.  Importantly, MET inhibitors are currently in pre-clinical and clinical trials128.   16 1.7 CD44  CD44 is a trans-membrane receptor expressed ubiquitously in human tissues mostly known for its role as a cell adhesion molecule.  A major receptor for hyaluronan or hyaluronic acid (HA), CD44 has also been reported to bind other extracellular matrix components of the human basement membrane including fibronectin, laminin, collagen, osteopontin, and serglycin129.  CD44 pre-mRNA is encoded by 20 exons, ten of which are regulated by alternate splicing mechanisms which results in the 18 CD44 variants encoding for extracellular domains of variable size129.  In particular, YB-1 is involved in splicing CD44v4 and CD44v5130-132, both variants reportedly associated with tumourigenesis133-135.  In addition to this, the extracellular portion of CD44 is glycosylated variably depending on the variant, allowing the receptor to assume many different roles, binding to a wide range of substrates and forming heterodimers with a host of membrane receptors.  Intracellularly, CD44 has 2 known serine sites that are regulated by protein kinase C (PKC)136.  PKC has been demonstrated to de-phosphorylate Ser325 but phosphorylate Ser291136.  The phosphorylation status of CD44 in relation to its function is mostly unknown but has been associated with its ability to bind its intracellular binding partners, ankyrin, as well as ezrin, radixin, and moesin, also known as the ERM proteins136.  Cytoplasmic CD44 along with its recruited proteins have functions in altering actin and other cytoskeletal interactions adjacent to the cell membrane137, 138, which consequently affects the extracellular binding affinities, ultimately changing cell motility, adhesion, and migration.  CD44 thus has important roles in tissues where adhesion in hyaluronin-rich areas is important.  An example of this is in leukocytes, where CD44 is crucial to the homing of normal hematopoietic and  17 leukemic stem cells in normal development and in immune responses139-144.  Elevated CD44 and its variant isoforms have been documented in AML cells141, 142.  Thus, it is not surprising that targeting CD44 is effective at depleting tumour-initiating cells140, 145.  While CD44 functions mainly as a cell adhesion molecule, it partners with kinase receptors at the cell membrane to facilitate signaling downstream.  Its common co-receptors include EGFR146, Her-2147, 148, MET115, 116, as well as Rhamm149, another hyaluronan receptor.  In forming heterodimers with these known tyrosine kinase receptors, CD44-ECM ligand interactions also mediates extracellular signals to affect major downstream growth and apoptotic pathways such as the MAPK pathway and the PI3k/Akt pathway.  Similarly, signaling by ligands of CD44 partnering receptors, EGF, Heregulin, and scatter factor/hepatocyte growth factor (SF/HGF), are mediated by CD44 expression.  In addition to signaling with other membrane receptors, it is speculated that CD44 itself can signal without intrinsic catalytic activity in its cytoplasmic tail129.  CD44 has been reported to recruit Src138, Rho GTPase150, Rho kinase151, PKC136, 146, and proto-oncogenic kinases, LCK137, 152 and FYN152 to its cytoplasmic region.  However, while hyaluronin-CD44 interactions and anti-CD44 antibodies have been demonstrated to affect downstream intracellular signaling, no concrete evidence has demonstrated that CD44 can act alone.  In the breast epithelium, CD44 is transcriptionally induced by the presence of insulin-like growth factor-1 (IGF-1) and epidermal growth factor (EGF) in mice153.  CD44v6 has been associated with proliferation marker Ki67 in normal breast tissues of both luminal  18 and myoepithelial lineages154.  The CD44 splice variants with more extensive extracellular amino acid chains have been found frequently in cancer tissues, although they are expressed on normal breast tissue as well154.  It has been hypothesized that the longer protein structure allow for more opportunities for glycosylation and thus enhanced invasive and motile capabilities, however association between CD44 variants and cancerous tissue has been controversial154.  CD44 is negatively transcriptionally regulated by p53 in transformed and untransformed breast cells155.  In these cells, CD44 is reportedly involved in cell proliferation, invasion, motility, metastasis, and chemotherapy resistance155.  CD44 is also reported to interact with and activate known oncogene Stat3156, 157.  Further, CD44 is classified as a basal-marker for breast epithelial cells6, 95, 158.  In most recent years, CD44 has been reported to be a marker for isolating the most tumourigenic cell populations in breast47, ovarian159, prostate160, colon161, stomach162, and blood-related cancers139, 140, termed the tumour-initiating cells.  CD44 expression has also been reported to confer radiation163 and chemotherapy resistance19, 145, 156, 156 in these cells.  Relatedly, independent gene expression profile studies have found that the gene signature of CD44+ primary breast cells normal and cancerous include highly expressed genes overlapping with that of stem cells, genes involved in cell motility and angiogenesis, and genes that correlated with a poorer clinical outcome in patients6, 164.     1.8 CD49F (ALPHA-6 Iglyph1197TEGRIglyph1197)  CD49f, also known as α6 integrin, belong to the integrin family of cell surface receptors with roles mainly in cell polarity, extracellular matrix and cell-cell interactions.  Integrins are the main receptors by which the extracellular matrix affects intracellular signaling  19 pathways.  Integrin are heterodimers comprised of 2 trans-membrane receptors, an α and a β subunit165.  To date, 18 α and 8 β subunits have been identified, and 24 combinations have been reported, allowing cells to bind and respond to all the ligand components in its extracellular microenvironment165.  Integrins transmit signals both mechanically and chemically, through its interactions with cytokeratin intermediate filaments (by α6β4) and actin cytoskeleton (all others), which consequently regulate downstream cell survival and proliferative pathways, including the JAK-STAT, PI3k/Akt, and MAPK pathways165.    CD49f in the mammary gland mainly interacts with β4 integrin (CD104) in humans, and β1 integrin (CD29) in mice166.  The human α6β4 integrin is the receptor for laminin, thereby connecting the basally-located myoepithelial and/or luminal cells to the laminin in extracellular matrix.  As such, the α6β4 integrin is important for cell polarity, and breast cells with normal α6β4 forms a spheroid in a laminin-rich Matrigel culture in vitro, with the basal ends of the cell outwards in contact with the Matrigel167.  The loss of α6β4 integrin function disrupts the ability of cells to form polarized structures in the presence of basement membrane proteins167.  Furthermore, α6β4 integrins not only respond intracellularly to their major ligand, but also to ligands of their binding partners.  The α6β4 heterodimer also associates with receptor tyrosine kinases, including EGFR168-170, Her-2169, 171-173, Her-3174, and the MET receptor111.  Consequently, the interactions of α6β4 to laminin also mediates downstream EGFR, Her-2, and MET receptor signaling, and thus the crosstalk between these receptor tyrosine kinases and α6β4 have important implications for the major signaling pathways modulating cell survival, growth, proliferation, apoptosis, polarity, and migration.  In cancer cells, its overexpression up- 20 regulates these downstream pathways causing increased migration and proliferation165, 175.  In breast cancers, it has been demonstrated that the overexpression of α6 is correlated to poor survival176.  In recent years, CD49f has been published as a marker for human and mouse mammary stem/progenitor cells177-179.  Intriguingly, mammary tissue deficient in the gene encoding for α6 integrin develop and function normally, with both lineages present180.  Still, CD49f has also been implicated in tumour-initiating cells179, 181, 182, allowing this rare population to mediate survival and growth responses to its important niche signals.    1.9 glyph1197ORMAL Aglyph1197D CAglyph1197CER STEM CELLS It has been demonstrated that breast and other solid tumours are a bulk collection of a heterogeneous population of cells, all with varying morphologies, growth kinetics, drug and radiation resistance abilities, and in vivo tumourigenic properties when injected into immuno-compromised mice19, 47, 48, 161, 163, 183-185.  Cancer is a clonal disease, requiring a cell or cell population to be dividing for a duration of time sufficient for the accumulation of mutations at random, It is thought that only a cell population with a longer lifespan can cause disease.  And so it has been hypothesized that there exists a cell population, with acquired or innate properties associated traditionally to normal stem cells, which may be the originating clone of the tumour186.  The term cancer stem cell does not preclude or imply that the cell originates definitively from a stem cell.  The cancer stem cell is defined as a cancer cell with related properties to a normal stem cell, including long-term self-renewal and proliferative capabilities186.  This is measured by phenotypic assays  21 prospectively where the cell must be able to generate tumours in vivo with a small starting number of cells, and be able to generate tumours through several passages47.  Thus, cancer stem cells are more accurately termed tumour-initiating cells, based on their prospective identification by functional assays.  In breast cancers, tumour-initiating cells have been reported to be CD44+CD24lowEpCAM+47 and/or ALDH1+187.  Further, in vitro mammosphere assays that promote the preservation of normal mammary primitive cell populations have been adapted to imitate the in vivo tumourigenicity assay where breast cancer cells are challenged to grow in a non-adherent manner in a scarcely supplemented environment with stem cell-responsive growth factors fibroblast growth factor (FGF) and EGF components188.  This assay implies a shared phenotype between normal and cancerous primitive populations.  Similar to in vivo tumour passaging, to demonstrate the ability to self-renew over time, a cell must be able to produce new mammospheres through passaging several times.  The mammosphere-forming efficiency of cells in this in vitro assay has in recent years proven to correlate well with the outcome of in vivo tumourigenicity assays155, 185, 189, as well as patient response to chemotherapy where the mammosphere forming efficiency negatively correlates to the likelihood of chemotherapy response in patients19.  On top of using this assay in attempts to enrich for tumour-initiating cells, groups have also tried to use the mammosphere assay to decipher the active signaling pathways of tumour-initiating cells, and to determine drug response of tumour-initiating cells39, though its actual efficacy is uncertain.  The cancer stem cell model has emerged as an increasingly accepted hypothesis that at least complements the existing clonal evolution model for cancer initiation, progression, metastasis, and recurrence in a growing list of leukemias, sarcomas, and carcinomas186, 190, 191.    22 The hypothesis of the cancer stem cell originates in the field of the hematopoietic system, where the hierarchy of normal stem cell development and differentiation is well characterized and ahead of research in other human tissues and organs186.  There, in the blood, John Dick and his group first identified a cancer stem cell population in acute myeloid leukemia patients capable of initiating leukemia in immuno-compromised mice and expresses the same primitive hematopoietic stem cell marker profile CD34+CD38-,192.  As technological advances and the development of functional assays with increased sophistication in the past decades has allowed for the identification and isolation of primitive populations of tumour cells with self-renewal abilities, this has enabled initial observations of the molecular underpinnings and gene signatures of these unique and deadly cells in recent years.  For example, the Akt pathway has been nominated as an important target for cancer-initiating cells193-197.  In systems with historically more robust wealths of knowledge in their stem cell research fields, like leukemias, proteins for targeting the primitive genetic programs have been proposed14, 193, 196, 198-201.  There is a need for breast cancer and other solid tumours, with more recent isolations of cancer stem cells, to also elucidate the driving molecules of cancer origins.  The limitation to understanding breast cancer stem cells is tied to understanding the normal development of the mammary gland.  The mammary stem cell has only recently been isolated and assayed in the human and in the mouse177, 178 but evidence for this distinct subpopulation of cells in the mammary gland arose over a decade earlier202, 203.  Finally, epigenetic patterning has most recently been demonstrated to also underlie the differences between more primitive and differentiated subsets of the mammary epithelial cell compartments95 and so it is likely to play a role in the malignant counterparts as well.  Further  23 understanding the molecules underlying differentiation into the two mammary epithelial lineages and finding markers for the stages of differentiation would be crucial to elucidating the origin of tumour growths.    It is likely that the cancer stem cell and clonal evolution theories are over-simplified.  Some have hypothesized that tumour progression is probably a combination of the two hypotheses at an unknown ratio.  A cell with the capacity to divide long term over time, or have acquired the mutation to divide extensively over time, may likely have acquired other mutations to arm itself against chemotherapies and radiation.  Chemotherapies19 and radiation therapies163 may in turn may select for its own resistant clones within the tumour-initiating cell population.  In addition, acquired genetic instability over the time required for tumour burden to arise may have resulted in a varied tumour cell population possibly too different from the original clone for comparison.  Taken together, like leukemias, it is possible that breast cancers arise from primitive cell populations in the mammary gland, and better molecular characterization of this population may be key to finding better treatments to breast cancers.             24 1.10 THESIS HYPOTHESIS Aglyph1197D OBJECTIVES Hypothesis:  YB-1 confers an enhanced growth and survival phenotype in breast cancers by inducing stem cell-associated receptors, MET, CD44 and CD49f.  Objectives:  I. To query an association between YB-1 and stem cell-associated genes.  II. To validate a relationship between YB-1 and the MET receptor in normal and cancerous breast epithelial cells. III. To assess the relationship between YB-1 and two receptors associated with the tumour-initiating cell phenotype, CD44 and CD49f.  IV. To evaluate the functional importance of CD44 and CD49f in three-dimensional culture systems in vitro. V. To determine YB-1’s role in the drug-resistance of CD44+/CD24-/low breast cancer cells.  25 REFEREglyph1197CES  1. Stingl J, Emerman JT, Eaves CJ. Enzymatic dissociation and culture of normal human mammary tissue to detect progenitor activity. Methods Mol Biol. 2005;290:249-263. 2. Stingl J, Raouf A, Emerman JT, Eaves CJ. Epithelial progenitors in the normal human mammary gland. J Mammary Gland Biol glyph817eoplasia. 2005;10:49-59. 3. Perou CM, Sorlie T, Eisen MB, et al. Molecular portraits of human breast tumours. glyph817ature. 2000;406:747-752. 4. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc glyph817atl Acad Sci U S A. 2001;98:10869-10874. 5. Hennessy BT, Gonzalez-Angulo AM, Stemke-Hale K, et al. Characterization of a naturally occurring breast cancer subset enriched in epithelial-to-mesenchymal transition and stem cell characteristics. Cancer Res. 2009;69:4116-4124. 6. Shipitsin M, Campbell LL, Argani P, et al. Molecular definition of breast tumor heterogeneity. Cancer Cell. 2007;11:259-273. 7. Stingl J, Caldas C. Molecular heterogeneity of breast carcinomas and the cancer stem cell hypothesis. glyph817at Rev Cancer. 2007;7:791-799. 8. Sims AH, Howell A, Howell SJ, Clarke RB. Origins of breast cancer subtypes and therapeutic implications. glyph817at Clin Pract Oncol. 2007;4:516-525. 9. Pusztai L. Markers predicting clinical benefit in breast cancer from microtubule-targeting agents. Ann Oncol. 2007;18 Suppl 12:xii15-20. 10. MacGregor JI, Jordan VC. Basic guide to the mechanisms of antiestrogen action. Pharmacol Rev. 1998;50:151-196. 11. Jordan VC. Tamoxifen: Catalyst for the change to targeted therapy. Eur J Cancer. 2008;44:30-38. 12. Dunn BK, Ford LG. Hormonal interventions to prevent hormonal cancers: Breast and prostate cancers. Eur J Cancer Prev. 2007;16:232-242. 13. Druker BJ. Translation of the philadelphia chromosome into therapy for CML. Blood. 2008;112:4808-4817. 14. Belloc F, Airiau K, Jeanneteau M, et al. The stem cell factor-c-KIT pathway must be inhibited to enable apoptosis induced by BCR-ABL inhibitors in chronic myelogenous leukemia cells. Leukemia. 2009;23:679-685. 15. Hynes NE, Lane HA. ERBB receptors and cancer: The complexity of targeted inhibitors. glyph817at Rev Cancer. 2005;5:341-354. 16. Albanell J, Gascon P. Small molecules with EGFR-TK inhibitor activity. Curr Drug Targets. 2005;6:259-274. 17. Rakha EA, Reis-Filho JS, Ellis IO. Basal-like breast cancer: A critical review. J Clin Oncol. 2008;26:2568-2581. 18. Stratford AL, Habibi G, Astanehe A, et al. Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res. 2007;9:R61. 19. Li X, Lewis MT, Huang J, et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J glyph817atl Cancer Inst. 2008;100:672-679.  26 20. Zhou X, Cella D, Cameron D, et al. Lapatinib plus capecitabine versus capecitabine alone for HER2+ (ErbB2+) metastatic breast cancer: Quality-of-life assessment. Breast Cancer Res Treat. 2009. 21. To K, Zhao Y, Jiang H, et al. The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phen yl]-acetamide (OSU-03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol. 2007;72:641-652. 22. Kucab JE, Lee C, Chen CS, et al. Celecoxib analogues disrupt akt signaling, which is commonly activated in primary breast tumours. Breast Cancer Res. 2005;7:R796-807. 23. Tseng PH, Lin HP, Zhu J, et al. Synergistic interactions between imatinib mesylate and the novel phosphoinositide-dependent kinase-1 inhibitor OSU-03012 in overcoming imatinib mesylate resistance. Blood. 2005;105:4021-4027. 24. Cen L, Hsieh FC, Lin HJ, Chen CS, Qualman SJ, Lin J. PDK-1/AKT pathway as a novel therapeutic target in rhabdomyosarcoma cells using OSU-03012 compound. Br J Cancer. 2007;97:785-791. 25. McCubrey JA, Lahair MM, Franklin RA. OSU-03012 in the treatment of glioblastoma. Mol Pharmacol. 2006;70:437-439. 26. Zhang S, Suvannasankha A, Crean CD, et al. OSU-03012, a novel celecoxib derivative, is cytotoxic to myeloma cells and acts through multiple mechanisms. Clin Cancer Res. 2007;13:4750-4758. 27. Wang YC, Kulp SK, Wang D, et al. Targeting endoplasmic reticulum stress and akt with OSU-03012 and gefitinib or erlotinib to overcome resistance to epidermal growth factor receptor inhibitors. Cancer Res. 2008;68:2820-2830. 28. Li J, Zhu J, Melvin WS, Bekaii-Saab TS, Chen CS, Muscarella P. A structurally optimized celecoxib derivative inhibits human pancreatic cancer cell growth. J Gastrointest Surg. 2006;10:207-214. 29. Gao M, Yeh PY, Lu YS, et al. OSU-03012, a novel celecoxib derivative, induces reactive oxygen species-related autophagy in hepatocellular carcinoma. Cancer Res. 2008;68:9348-9357. 30. Mozzetti S, Ferlini C, Concolino P, et al. Class III beta-tubulin overexpression is a prominent mechanism of paclitaxel resistance in ovarian cancer patients. Clin Cancer Res. 2005;11:298-305. 31. Hari M, Loganzo F, Annable T, et al. Paclitaxel-resistant cells have a mutation in the paclitaxel-binding region of beta-tubulin (Asp26Glu) and less stable microtubules. Mol Cancer Ther. 2006;5:270-278. 32. Hayes DF, Thor AD, Dressler LG, et al. HER2 and response to paclitaxel in node-positive breast cancer. glyph817 Engl J Med. 2007;357:1496-1506. 33. Huang WC, Hung MC. Induction of akt activity by chemotherapy confers acquired resistance. J Formos Med Assoc. 2009;108:180-194. 34. Law JH, Habibi G, Hu K, et al. Phosphorylated insulin-like growth factor-i/insulin receptor is present in all breast cancer subtypes and is related to poor survival. Cancer Res. 2008;68:10238-10246. 35. Santen RJ, Fan P, Zhang Z, Bao Y, Song RX, Yue W. Estrogen signals via an extra-nuclear pathway involving IGF-1R and EGFR in tamoxifen-sensitive and -resistant breast cancer cells. Steroids. 2009;74:586-594.  27 36. Nielsen TO, Hsu FD, Jensen K, et al. Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res. 2004;10:5367-5374. 37. Cheang MC, Voduc D, Bajdik C, et al. Basal-like breast cancer defined by five biomarkers has superior prognostic value than triple-negative phenotype. Clin Cancer Res. 2008;14:1368-1376. 38. Finn RS, Dering J, Ginther C, et al. Dasatinib, an orally active small molecule inhibitor of both the src and abl kinases, selectively inhibits growth of basal-type/"triple-negative" breast cancer cell lines growing in vitro. Breast Cancer Res Treat. 2007;105:319-326. 39. Farnie G, Clarke RB, Spence K, et al. Novel cell culture technique for primary ductal carcinoma in situ: Role of notch and epidermal growth factor receptor signaling pathways. J glyph817atl Cancer Inst. 2007;99:616-627. 40. Lee CW, Simin K, Liu Q, et al. A functional notch-survivin gene signature in basal breast cancer. Breast Cancer Res. 2008;10:R97. 41. Lee CW, Raskett CM, Prudovsky I, Altieri DC. Molecular dependence of estrogen receptor-negative breast cancer on a notch-survivin signaling axis. Cancer Res. 2008;68:5273-5281. 42. Turner NC, Reis-Filho JS. Basal-like breast cancer and the BRCA1 phenotype. Oncogene. 2006;25:5846-5853. 43. Farmer H, McCabe N, Lord CJ, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. glyph817ature. 2005;434:917-921. 44. De Soto JA, Deng CX. PARP-1 inhibitors: Are they the long-sought genetically specific drugs for BRCA1/2-associated breast cancers? Int J Med Sci. 2006;3:117-123. 45. Rottenberg S, Jaspers JE, Kersbergen A, et al. High sensitivity of BRCA1-deficient mammary tumors to the PARP inhibitor AZD2281 alone and in combination with platinum drugs. Proc glyph817atl Acad Sci U S A. 2008;105:17079-17084. 46. Drew Y, Calvert H. The potential of PARP inhibitors in genetic breast and ovarian cancers. Ann glyph817 Y Acad Sci. 2008;1138:136-145. 47. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc glyph817atl Acad Sci U S A. 2003;100:3983-3988. 48. Diehn M, Cho RW, Lobo NA, et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. glyph817ature. 2009;458:780-783. 49. Venter JC, Adams MD, Myers EW, et al. The sequence of the human genome. Science. 2001;291:1304-1351. 50. Brennan P, Donev R, Hewamana S. Targeting transcription factors for therapeutic benefit. Mol Biosyst. 2008;4:909-919. 51. Turkson J, Ryan D, Kim JS, et al. Phosphotyrosyl peptides block Stat3-mediated DNA binding activity, gene regulation, and cell transformation. J Biol Chem. 2001;276:45443-45455. 52. Leong PL, Andrews GA, Johnson DE, et al. Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth. Proc glyph817atl Acad Sci U S A. 2003;100:4138-4143.  28 53. Giorello L, Clerico L, Pescarolo MP, et al. Inhibition of cancer cell growth and c-myc transcriptional activity by a c-myc helix 1-type peptide fused to an internalization sequence. Cancer Res. 1998;58:3654-3659. 54. Reis-Filho JS, Milanezi F, Carvalho S, et al. Metaplastic breast carcinomas exhibit EGFR, but not HER2, gene amplification and overexpression: Immunohistochemical and chromogenic in situ hybridization analysis. Breast Cancer Res. 2005;7:R1028-35. 55. Kersting C, Tidow N, Schmidt H, et al. Gene dosage PCR and fluorescence in situ hybridization reveal low frequency of egfr amplifications despite protein overexpression in invasive breast carcinoma. Lab Invest. 2004;84:582-587. 56. Wu J, Lee C, Yokom D, et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res. 2006;66:4872-4879. 57. Kageyama R, Merlino GT, Pastan I. Epidermal growth factor (EGF) receptor gene transcription. requirement for Sp1 and an EGF receptor-specific factor. J Biol Chem. 1988;263:6329-6336. 58. Mialon A, Sankinen M, Soderstrom H, et al. DNA topoisomerase I is a cofactor for c-jun in the regulation of epidermal growth factor receptor expression and cancer cell proliferation. Mol Cell Biol. 2005;25:5040-5051. 59. Kuwano M, Uchiumi T, Hayakawa H, et al. The basic and clinical implications of ABC transporters, Y-box-binding protein-1 (YB-1) and angiogenesis-related factors in human malignancies. Cancer Sci. 2003;94:9-14. 60. Kloks CP, Spronk CA, Lasonder E, et al. The solution structure and DNA-binding properties of the cold-shock domain of the human Y-box protein YB-1. J Mol Biol. 2002;316:317-326. 61. La Teana A, Brandi A, Falconi M, Spurio R, Pon CL, Gualerzi CO. Identification of a cold shock transcriptional enhancer of the escherichia coli gene encoding nucleoid protein H-NS. Proc glyph817atl Acad Sci U S A. 1991;88:10907-10911. 62. Koike K, Uchiumi T, Ohga T, et al. Nuclear translocation of the Y-box binding protein by ultraviolet irradiation. FEBS Lett. 1997;417:390-394. 63. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, Schwartz BD. Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc glyph817atl Acad Sci U S A. 1988;85:7322-7326. 64. Sakura H, Maekawa T, Imamoto F, Yasuda K, Ishii S. Two human genes isolated by a novel method encode DNA-binding proteins containing a common region of homology. Gene. 1988;73:499-507. 65. Jurchott K, Bergmann S, Stein U, et al. YB-1 as a cell cycle-regulated transcription factor facilitating cyclin A and cyclin B1 gene expression. J Biol Chem. 2003;278:27988-27996. 66. Evdokimova V, Ovchinnikov LP, Sorensen PH. Y-box binding protein 1: Providing a new angle on translational regulation. Cell Cycle. 2006;5:1143-1147. 67. Ladomery M, Sommerville J. A role for Y-box proteins in cell proliferation. Bioessays. 1995;17:9-11. 68. Okamoto T, Izumi H, Imamura T, et al. Direct interaction of p53 with the Y-box binding protein, YB-1: A mechanism for regulation of human gene expression. Oncogene. 2000;19:6194-6202.  29 69. Uramoto H, Izumi H, Ise T, et al. p73 interacts with c-myc to regulate Y-box-binding protein-1 expression. J Biol Chem. 2002;277:31694-31702. 70. Sutherland BW, Kucab J, Wu J, et al. Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene. 2005;24:4281-4292. 71. Stratford AL, Fry CJ, Desilets C, et al. Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res. 2008;10:R99. 72. Lee C, Dhillon J, Wang MY, et al. Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res. 2008;68:8661-8666. 73. Shibao K, Takano H, Nakayama Y, et al. Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer. 1999;83:732-737. 74. Bargou RC, Jurchott K, Wagener C, et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. glyph817at Med. 1997;3:447-450. 75. Gimenez-Bonafe P, Fedoruk MN, Whitmore TG, et al. YB-1 is upregulated during prostate cancer tumor progression and increases P-glycoprotein activity. Prostate. 2004;59:337-349. 76. Yahata H, Kobayashi H, Kamura T, et al. Increased nuclear localization of transcription factor YB-1 in acquired cisplatin-resistant ovarian cancer. J Cancer Res Clin Oncol. 2002;128:621-626. 77. Oda Y, Ohishi Y, Saito T, et al. Nuclear expression of Y-box-binding protein-1 correlates with P-glycoprotein and topoisomerase II alpha expression, and with poor prognosis in synovial sarcoma. J Pathol. 2003;199:251-258. 78. Gessner C, Woischwill C, Schumacher A, et al. Nuclear YB-1 expression as a negative prognostic marker in nonsmall cell lung cancer. Eur Respir J. 2004;23:14-19. 79. Chatterjee M, Rancso C, Stuhmer T, et al. The Y-box binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood. 2008;111:3714-3722. 80. Oda Y, Kohashi K, Yamamoto H, et al. Different expression profiles of Y-box-binding protein-1 and multidrug resistance-associated proteins between alveolar and embryonal rhabdomyosarcoma. Cancer Sci. 2008;99:726-732. 81. Lasham A, Lindridge E, Rudert F, Onrust R, Watson J. Regulation of the human fas promoter by YB-1, puralpha and AP-1 transcription factors. Gene. 2000;252:1-13. 82. Bergmann S, Royer-Pokora B, Fietze E, et al. YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res. 2005;65:4078-4087. 83. Finkbeiner MR, Astanehe A, To K, et al. Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene. 2009;28:1421-1431. 84. Astanehe A, Finkbeiner MR, Hojabrpour P, et al. The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene. 2009.  30 85. Evdokimova V, Tognon C, Ng T, et al. Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell. 2009;15:402-415. 86. Saji H, Toi M, Saji S, Koike M, Kohno K, Kuwano M. Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human breast carcinoma. Cancer Lett. 2003;190:191-197. 87. Fujita T, Ito K, Izumi H, et al. Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res. 2005;11:8837-8844. 88. Ohga T, Uchiumi T, Makino Y, et al. Direct involvement of the Y-box binding protein YB-1 in genotoxic stress-induced activation of the human multidrug resistance 1 gene. J Biol Chem. 1998;273:5997-6000. 89. Huang X, Ushijima K, Komai K, et al. Co-expression of Y box-binding protein-1 and P-glycoprotein as a prognostic marker for survival in epithelial ovarian cancer. Gynecol Oncol. 2004;93:287-291. 90. Basaki Y, Hosoi F, Oda Y, et al. Akt-dependent nuclear localization of Y-box-binding protein 1 in acquisition of malignant characteristics by human ovarian cancer cells. Oncogene. 2007;26:2736-2746. 91. Shiota M, Izumi H, Tanimoto A, et al. Programmed cell death protein 4 down-regulates Y-box binding protein-1 expression via a direct interaction with Twist1 to suppress cancer cell growth. Cancer Res. 2009;69:3148-3156. 92. Schittek B, Psenner K, Sauer B, Meier F, Iftner T, Garbe C. The increased expression of Y box-binding protein 1 in melanoma stimulates proliferation and tumor invasion, antagonizes apoptosis and enhances chemoresistance. Int J Cancer. 2007;120:2110-2118. 93. Habibi G, Leung S, Law JH, et al. Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res. 2008;10:R86. 94. Bader AG, Felts KA, Jiang N, Chang HW, Vogt PK. Y box-binding protein 1 induces resistance to oncogenic transformation by the phosphatidylinositol 3-kinase pathway. Proc glyph817atl Acad Sci U S A. 2003;100:12384-12389. 95. Bloushtain-Qimron N, Yao J, Snyder EL, et al. Cell type-specific DNA methylation patterns in the human breast. Proc glyph817atl Acad Sci U S A. 2008;105:14076-14081. 96. Shibahara K, Uchiumi T, Fukuda T, et al. Targeted disruption of one allele of the Y-box binding protein-1 (YB-1) gene in mouse embryonic stem cells and increased sensitivity to cisplatin and mitomycin C. Cancer Sci. 2004;95:348-353. 97. Gaudreault I, Guay D, Lebel M. YB-1 promotes strand separation in vitro of duplex DNA containing either mispaired bases or cisplatin modifications, exhibits endonucleolytic activities and binds several DNA repair proteins. glyph817ucleic Acids Res. 2004;32:316-327. 98. Lu ZH, Books JT, Ley TJ. YB-1 is important for late-stage embryonic development, optimal cellular stress responses, and the prevention of premature senescence. Mol Cell Biol. 2005;25:4625-4637. 99. Lu ZH, Books JT, Ley TJ. Cold shock domain family members YB-1 and MSY4 share essential functions during murine embryogenesis. Mol Cell Biol. 2006;26:8410-8417.  31 100. Fan L, Jones SN, Padden C, Shen Q, Newburger PE. Nuclease sensitive element binding protein 1 gene disruption results in early embryonic lethality. J Cell Biochem. 2006;99:140-145. 101. Uchiumi T, Fotovati A, Sasaguri T, et al. YB-1 is important for an early stage embryonic development: Neural tube formation and cell proliferation. J Biol Chem. 2006;281:40440-40449. 102. Ohba H, Chiyoda T, Endo E, et al. Sox21 is a repressor of neuronal differentiation and is antagonized by YB-1. glyph817eurosci Lett. 2004;358:157-160. 103. Overington JP, Al-Lazikani B, Hopkins AL. How many drug targets are there? glyph817at Rev Drug Discov. 2006;5:993-996. 104. Boccaccio C, Comoglio PM. Invasive growth: A MET-driven genetic programme for cancer and stem cells. glyph817at Rev Cancer. 2006;6:637-645. 105. Andermarcher E, Surani MA, Gherardi E. Co-expression of the HGF/SF and c-met genes during early mouse embryogenesis precedes reciprocal expression in adjacent tissues during organogenesis. Dev Genet. 1996;18:254-266. 106. Sonnenberg E, Meyer D, Weidner KM, Birchmeier C. Scatter factor/hepatocyte growth factor and its receptor, the c-met tyrosine kinase, can mediate a signal exchange between mesenchyme and epithelia during mouse development. J Cell Biol. 1993;123:223-235. 107. Yang Y, Spitzer E, Meyer D, et al. Sequential requirement of hepatocyte growth factor and neuregulin in the morphogenesis and differentiation of the mammary gland. J Cell Biol. 1995;131:215-226. 108. Savagner P, Yamada KM, Thiery JP. The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol. 1997;137:1403-1419. 109. Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. glyph817at Rev Cancer. 2009;9:265-273. 110. Birchmeier C, Gherardi E. Developmental roles of HGF/SF and its receptor, the c-met tyrosine kinase. Trends Cell Biol. 1998;8:404-410. 111. Trusolino L, Bertotti A, Comoglio PM. A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell. 2001;107:643-654. 112. Bonine-Summers AR, Aakre ME, Brown KA, et al. Epidermal growth factor receptor plays a significant role in hepatocyte growth factor mediated biological responses in mammary epithelial cells. Cancer Biol Ther. 2007;6:561-570. 113. Mueller KL, Hunter LA, Ethier SP, Boerner JL. Met and c-src cooperate to compensate for loss of epidermal growth factor receptor kinase activity in breast cancer cells. Cancer Res. 2008;68:3314-3322. 114. Guo A, Villen J, Kornhauser J, et al. Signaling networks assembled by oncogenic EGFR and c-met. Proc glyph817atl Acad Sci U S A. 2008;105:692-697. 115. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is required for two consecutive steps in HGF/c-met signaling. Genes Dev. 2002;16:3074-3086. 116. Matzke A, Sargsyan V, Holtmann B, et al. Haploinsufficiency of c-met in cd44-/- mice identifies a collaboration of CD44 and c-met in vivo. Mol Cell Biol. 2007;27:8797-8806.  32 117. Ben-Porath I, Thomson MW, Carey VJ, et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. glyph817at Genet. 2008;40:499-507. 118. Schmidt L, Duh FM, Chen F, et al. Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas. glyph817at Genet. 1997;16:68-73. 119. Danilkovitch-Miagkova A, Zbar B. Dysregulation of met receptor tyrosine kinase activity in invasive tumors. J Clin Invest. 2002;109:863-867. 120. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. Met, metastasis, motility and more. glyph817at Rev Mol Cell Biol. 2003;4:915-925. 121. Welm AL, Kim S, Welm BE, Bishop JM. MET and MYC cooperate in mammary tumorigenesis. Proc glyph817atl Acad Sci U S A. 2005;102:4324-4329. 122. Boon EM, van der Neut R, van de Wetering M, Clevers H, Pals ST. Wnt signaling regulates expression of the receptor tyrosine kinase met in colorectal cancer. Cancer Res. 2002;62:5126-5128. 123. Di Renzo MF, Olivero M, Giacomini A, et al. Overexpression and amplification of the met/HGF receptor gene during the progression of colorectal cancer. Clin Cancer Res. 1995;1:147-154. 124. Humphrey PA, Zhu X, Zarnegar R, et al. Hepatocyte growth factor and its receptor (c-MET) in prostatic carcinoma. Am J Pathol. 1995;147:386-396. 125. Olivero M, Rizzo M, Madeddu R, et al. Overexpression and activation of hepatocyte growth factor/scatter factor in human non-small-cell lung carcinomas. Br J Cancer. 1996;74:1862-1868. 126. Di Renzo MF, Olivero M, Katsaros D, et al. Overexpression of the Met/HGF receptor in ovarian cancer. Int J Cancer. 1994;58:658-662. 127. Suzuki A, Zheng YW, Kaneko S, et al. Clonal identification and characterization of self-renewing pluripotent stem cells in the developing liver. J Cell Biol. 2002;156:173-184. 128. Comoglio PM, Giordano S, Trusolino L. Drug development of MET inhibitors: Targeting oncogene addiction and expedience. glyph817at Rev Drug Discov. 2008;7:504-516. 129. Ponta H, Sherman L, Herrlich PA. CD44: From adhesion molecules to signalling regulators. glyph817at Rev Mol Cell Biol. 2003;4:33-45. 130. Stickeler E, Fraser SD, Honig A, Chen AL, Berget SM, Cooper TA. The RNA binding protein YB-1 binds A/C-rich exon enhancers and stimulates splicing of the CD44 alternative exon v4. EMBO J. 2001;20:3821-3830. 131. Watermann DO, Tang Y, Zur Hausen A, Jager M, Stamm S, Stickeler E. Splicing factor Tra2-beta1 is specifically induced in breast cancer and regulates alternative splicing of the CD44 gene. Cancer Res. 2006;66:4774-4780. 132. Allemand E, Hastings ML, Murray MV, Myers MP, Krainer AR. Alternative splicing regulation by interaction of phosphatase PP2Cgamma with nucleic acid-binding protein YB-1. glyph817at Struct Mol Biol. 2007;14:630-638. 133. Helliwell TR. Molecular markers of metastasis in squamous carcinomas. J Pathol. 2001;194:289-293. 134. Wielenga VJ, van der Neut R, Offerhaus GJ, Pals ST. CD44 glycoproteins in colorectal cancer: Expression, function, and prognostic value. Adv Cancer Res. 2000;77:169-187.  33 135. Stickeler E, Kittrell F, Medina D, Berget SM. Stage-specific changes in SR splicing factors and alternative splicing in mammary tumorigenesis. Oncogene. 1999;18:3574-3582. 136. Legg JW, Lewis CA, Parsons M, Ng T, Isacke CM. A novel PKC-regulated mechanism controls CD44 ezrin association and directional cell motility. glyph817at Cell Biol. 2002;4:399-407. 137. Wong NK, Lai JC, Birkenhead D, Shaw AS, Johnson P. CD45 down-regulates lck-mediated CD44 signaling and modulates actin rearrangement in T cells. J Immunol. 2008;181:7033-7043. 138. Lee JL, Wang MJ, Sudhir PR, Chen JY. CD44 engagement promotes matrix-derived survival through the CD44-SRC-integrin axis in lipid rafts. Mol Cell Biol. 2008;28:5710-5723. 139. Krause DS, Lazarides K, von Andrian UH, Van Etten RA. Requirement for CD44 in homing and engraftment of BCR-ABL-expressing leukemic stem cells. glyph817at Med. 2006;12:1175-1180. 140. Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. Targeting of CD44 eradicates human acute myeloid leukemic stem cells. glyph817at Med. 2006;12:1167-1174. 141. Khan NI, Cisterne A, Devidas M, et al. Expression of CD44, but not CD44v6, predicts relapse in children with B cell progenitor acute lymphoblastic leukemia lacking adverse or favorable genetics. Leuk Lymphoma. 2008;49:710-718. 142. Ghaffari S, Smadja-Joffe F, Oostendorp R, et al. CD44 isoforms in normal and leukemic hematopoiesis. Exp Hematol. 1999;27:978-993. 143. Deguchi T, Komada Y. Homing-associated cell adhesion molecule (H-CAM/CD44) on human CD34+ hematopoietic progenitor cells. Leuk Lymphoma. 2000;40:25-37. 144. Khaldoyanidi S, Karakhanova S, Sleeman J, Herrlich P, Ponta H. CD44 variant-specific antibodies trigger hemopoiesis by selective release of cytokines from bone marrow macrophages. Blood. 2002;99:3955-3961. 145. Marangoni E, Lecomte N, Durand L, et al. CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer. 2009;100:918-922. 146. Kim Y, Lee YS, Choe J, Lee H, Kim YM, Jeoung D. CD44-epidermal growth factor receptor interaction mediates hyaluronic acid-promoted cell motility by activating protein kinase C signaling involving akt, Rac1, phox, reactive oxygen species, focal adhesion kinase, and MMP-2. J Biol Chem. 2008;283:22513-22528. 147. Xu FJ, Stack S, Boyer C, et al. Heregulin and agonistic anti-p185(c-erbB2) antibodies inhibit proliferation but increase invasiveness of breast cancer cells that overexpress p185(c-erbB2): Increased invasiveness may contribute to poor prognosis. Clin Cancer Res. 1997;3:1629-1634. 148. Bourguignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. Interaction between the adhesion receptor, CD44, and the oncogene product, p185HER2, promotes human ovarian tumor cell activation. J Biol Chem. 1997;272:27913-27918. 149. Hamilton SR, Fard SF, Paiwand FF, et al. The hyaluronan receptors CD44 and rhamm (CD168) form complexes with ERK1,2 that sustain high basal motility in breast cancer cells. J Biol Chem. 2007;282:16667-16680.  34 150. Bourguignon LY. Hyaluronan-mediated CD44 activation of RhoGTPase signaling and cytoskeleton function promotes tumor progression. Semin Cancer Biol. 2008;18:251-259. 151. Bourguignon LY, Gilad E, Brightman A, Diedrich F, Singleton P. Hyaluronan-CD44 interaction with leukemia-associated RhoGEF and epidermal growth factor receptor promotes Rho/Ras co-activation, phospholipase C epsilon-Ca2+ signaling, and cytoskeleton modification in head and neck squamous cell carcinoma cells. J Biol Chem. 2006;281:14026-14040. 152. Ilangumaran S, Briol A, Hoessli DC. CD44 selectively associates with active src family protein tyrosine kinases lck and fyn in glycosphingolipid-rich plasma membrane domains of human peripheral blood lymphocytes. Blood. 1998;91:3901-3908. 153. Hebbard L, Steffen A, Zawadzki V, et al. CD44 expression and regulation during mammary gland development and function. J Cell Sci. 2000;113 ( Pt 14):2619-2630. 154. Cooper NL, Bardy P, Bacani J, et al. Correlation of CD44 expression with proliferative activity of normal human breast epithelial cells in culture. Breast Cancer Res Treat. 1998;50:143-153. 155. Godar S, Ince TA, Bell GW, et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell. 2008;134:62-73. 156. Bourguignon LY, Peyrollier K, Xia W, Gilad E. Hyaluronan-CD44 interaction activates stem cell marker nanog, stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem. 2008;283:17635-17651. 157. Lee JL, Wang MJ, Chen JY. Acetylation and activation of STAT3 mediated by nuclear translocation of CD44. J Cell Biol. 2009;185:949-957. 158. Charafe-Jauffret E, Ginestier C, Monville F, et al. Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene. 2006;25:2273-2284. 159. Zhang S, Balch C, Chan MW, et al. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res. 2008;68:4311-4320. 160. Li H, Chen X, Calhoun-Davis T, Claypool K, Tang DG. PC3 human prostate carcinoma cell holoclones contain self-renewing tumor-initiating cells. Cancer Res. 2008;68:1820-1825. 161. Dalerba P, Dylla SJ, Park IK, et al. Phenotypic characterization of human colorectal cancer stem cells. Proc glyph817atl Acad Sci U S A. 2007;104:10158-10163. 162. Takaishi S, Okumura T, Tu S, et al. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells. 2009;27:1006-1020. 163. Phillips TM, McBride WH, Pajonk F. The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. J glyph817atl Cancer Inst. 2006;98:1777-1785. 164. Liu R, Wang X, Chen GY, et al. The prognostic role of a gene signature from tumorigenic breast-cancer cells. glyph817 Engl J Med. 2007;356:217-226. 165. Guo W, Giancotti FG. Integrin signalling during tumour progression. glyph817at Rev Mol Cell Biol. 2004;5:816-826. 166. Taddei I, Faraldo MM, Teuliere J, Deugnier MA, Thiery JP, Glukhova MA. Integrins in mammary gland development and differentiation of mammary epithelium. J Mammary Gland Biol glyph817eoplasia. 2003;8:383-394.  35 167. Weaver VM, Lelievre S, Lakins JN, et al. Beta4 integrin-dependent formation of polarized three-dimensional architecture confers resistance to apoptosis in normal and malignant mammary epithelium. Cancer Cell. 2002;2:205-216. 168. Mainiero F, Pepe A, Yeon M, Ren Y, Giancotti FG. The intracellular functions of alpha6beta4 integrin are regulated by EGF. J Cell Biol. 1996;134:241-253. 169. Yoon SO, Shin S, Lipscomb EA. A novel mechanism for integrin-mediated ras activation in breast carcinoma cells: The alpha6beta4 integrin regulates ErbB2 translation and transactivates epidermal growth factor receptor/ErbB2 signaling. Cancer Res. 2006;66:2732-2739. 170. Gilcrease MZ, Zhou X, Lu X, Woodward WA, Hall BE, Morrissey PJ. Alpha6beta4 integrin crosslinking induces EGFR clustering and promotes EGF-mediated rho activation in breast cancer. J Exp Clin Cancer Res. 2009;28:67. 171. Falcioni R, Antonini A, Nistico P, et al. Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp Cell Res. 1997;236:76-85. 172. Gambaletta D, Marchetti A, Benedetti L, Mercurio AM, Sacchi A, Falcioni R. Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J Biol Chem. 2000;275:10604-10610. 173. Hintermann E, Yang N, O'Sullivan D, Higgins JM, Quaranta V. Integrin alpha6beta4-erbB2 complex inhibits haptotaxis by up-regulating E-cadherin cell-cell junctions in keratinocytes. J Biol Chem. 2005;280:8004-8015. 174. Folgiero V, Bachelder RE, Bon G, Sacchi A, Falcioni R, Mercurio AM. The alpha6beta4 integrin can regulate ErbB-3 expression: Implications for alpha6beta4 signaling and function. Cancer Res. 2007;67:1645-1652. 175. Lipscomb EA, Simpson KJ, Lyle SR, Ring JE, Dugan AS, Mercurio AM. The alpha6beta4 integrin maintains the survival of human breast carcinoma cells in vivo. Cancer Res. 2005;65:10970-10976. 176. Friedrichs K, Ruiz P, Franke F, Gille I, Terpe HJ, Imhof BA. High expression level of alpha 6 integrin in human breast carcinoma is correlated with reduced survival. Cancer Res. 1995;55:901-906. 177. Stingl J, Eirew P, Ricketson I, et al. Purification and unique properties of mammary epithelial stem cells. glyph817ature. 2006;439:993-997. 178. Eirew P, Stingl J, Raouf A, et al. A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. glyph817at Med. 2008;14:1384-1389. 179. Cariati M, Naderi A, Brown JP, et al. Alpha-6 integrin is necessary for the tumourigenicity of a stem cell-like subpopulation within the MCF7 breast cancer cell line. Int J Cancer. 2008;122:298-304. 180. Klinowska TC, Alexander CM, Georges-Labouesse E, et al. Epithelial development and differentiation in the mammary gland is not dependent on alpha 3 or alpha 6 integrin subunits. Dev Biol. 2001;233:449-467. 181. Vassilopoulos A, Wang RH, Petrovas C, Ambrozak D, Koup R, Deng CX. Identification and characterization of cancer initiating cells from BRCA1 related mammary tumors using markers for normal mammary stem cells. Int J Biol Sci. 2008;4:133-142. 182. Honeth G, Bendahl PO, Ringner M, et al. The CD44+/CD24- phenotype is enriched in basal-like breast tumors. Breast Cancer Res. 2008;10:R53.  36 183. Diehn M, Clarke MF. Cancer stem cells and radiotherapy: New insights into tumor radioresistance. J glyph817atl Cancer Inst. 2006;98:1755-1757. 184. Li C, Heidt DG, Dalerba P, et al. Identification of pancreatic cancer stem cells. Cancer Res. 2007;67:1030-1037. 185. Fillmore CM, Kuperwasser C. Human breast cancer cell lines contain stem-like cells with the capacity to self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res. 2008;10:R25. 186. Dick JE. Stem cell concepts renew cancer research. Blood. 2008;112:4793-4807. 187. Ginestier C, Hur MH, Charafe-Jauffret E, et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 2007;1:555-567. 188. Dontu G, Abdallah WM, Foley JM, et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 2003;17:1253-1270. 189. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704-715. 190. Cho RW, Clarke MF. Recent advances in cancer stem cells. Curr Opin Genet Dev. 2008. 191. Dick JE. Looking ahead in cancer stem cell research. glyph817at Biotechnol. 2009;27:44-46. 192. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. glyph817at Med. 1997;3:730-737. 193. Yilmaz OH, Morrison SJ. The PI-3kinase pathway in hematopoietic stem cells and leukemia-initiating cells: A mechanistic difference between normal and cancer stem cells. Blood Cells Mol Dis. 2008. 194. Korkaya H, Paulson A, Iovino F, Wicha MS. HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion. Oncogene. 2008;27:6120-6130. 195. Eyler CE, Foo WC, LaFiura KM, McLendon RE, Hjelmeland AB, Rich JN. Brain cancer stem cells display preferential sensitivity to akt inhibition. Stem Cells. 2008;26:3027-3036. 196. Copland M, Pellicano F, Richmond L, et al. BMS-214662 potently induces apoptosis of chronic myeloid leukemia stem and progenitor cells and synergizes with tyrosine kinase inhibitors. Blood. 2008;111:2843-2853. 197. Bleau AM, Hambardzumyan D, Ozawa T, et al. PTEN/PI3K/Akt pathway regulates the side population phenotype and ABCG2 activity in glioma tumor stem-like cells. Cell Stem Cell. 2009;4:226-235. 198. Bellodi C, Lidonnici MR, Hamilton A, et al. Targeting autophagy potentiates tyrosine kinase inhibitor-induced cell death in philadelphia chromosome-positive cells, including primary CML stem cells. J Clin Invest. 2009;119:1109-1123. 199. Jin L, Lee EM, Ramshaw HS, et al. Monoclonal antibody-mediated targeting of CD123, IL-3 receptor alpha chain, eliminates human acute myeloid leukemic stem cells. Cell Stem Cell. 2009;5:31-42. 200. Zhao C, Chen A, Jamieson CH, et al. Hedgehog signalling is essential for maintenance of cancer stem cells in myeloid leukaemia. glyph817ature. 2009;458:776-779.  37 201. van Rhenen A, van Dongen GA, Kelder A, et al. The novel AML stem cell associated antigen CLL-1 aids in discrimination between normal and leukemic stem cells. Blood. 2007;110:2659-2666. 202. Smith GH. Label-retaining epithelial cells in mouse mammary gland divide asymmetrically and retain their template DNA strands. Development. 2005;132:681-687. 203. Boulanger CA, Wagner KU, Smith GH. Parity-induced mouse mammary epithelial cells are pluripotent, self-renewing and sensitive to TGF-beta1 expression. Oncogene. 2005;24:552-560. 38 CHAPTER TWO :  PROFILIglyph1197G YB-1 TARGET GEglyph1197ES Uglyph1197COVERS A glyph1197EW MECHAglyph1197ISM FOR MET RECEPTOR REGULATIOglyph1197 Iglyph1197 glyph1197ORMAL Aglyph1197D MALIGglyph1197Aglyph1197T HUMAglyph1197 MAMMARY CELLS*    This chapter presents work which introduces the novel finding of YB-1 expression in a normal primitive mammary cell population.  We validate a chromatin immunoprecipitation-on-chip screen which suggests that YB-1 occupies the promoter of a cassette of genes associated with stem cells by elucidating the molecular biology behind a new relationship between YB-1 and MET, one of the resulting genes from the ChIP-on-chip screen.  Further, we were able to demonstrate that YB-1 transcript levels are detected in a purified population of normal human mammary progenitor cells that correlated to Met transcript levels.  This study verified that YB-1 may possibly be a regulator of other stem cell-associated genes on the ChIP-on-chip screen list.     *A version of this chapter has been published.  Finkbeiner MR, Astanehe A, To K, Fotovati A, Davies AH, Zhao Y, Jiang H, Stratford AL, Shadeo A, Boccaccio C, Comoglio P, Mertens PR, Eirew P, Raouf A, Eaves CJ, and Dunn SE. (2009) Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene. 28(11):1421-31.  39 2.1 Iglyph1197TRODUCTIOglyph1197  Basal-like breast cancers (BLBCs) remain one of the greatest challenges given that the probability of survival beyond 2 years is only 30%1.  Because BLBCs do not express estrogen receptors (ERs), progesterone receptors (PRs) or HER-2, they are unresponsive to anti-estrogens2 or Herceptin that target these gene products3.  Therefore, much effort is now focused on identifying new molecular targets in BLBCs.  One target of current interest is the transcription/translation factor Y-box binding protein (YB-1) because of its documented high expression in approximately 70% of BLBCs4 and its association with poor survival5.  YB-1 is consistently associated with high rates of relapse in virtually all breast cancer subtypes including BLBC5.  Complimenting the strength of YB-1 as a biomarker of aggressive cancer we reported that inhibiting with siRNAs attenuates the growth of BLBC cell lines6.  YB-1 is known to stimulate cell growth by binding to inverse CAAT boxes of many genes, thereby inducing their expression.  Examples include EGFR (epidermal growth factor receptor)7, HER-27, and TOPOII (topoisomerase 2)8.  It has been suggested that such YB-1-mediated activation of EGFR transcription also promotes the growth of BLBCs4.  The induction of EGFR expression is dependent on phosphorylation of YB-1 at S1024, 7 which is achieved by serine/threonine kinases Akt9 or RSK10 leading to nuclear translocation.  Importantly, nuclear YB-1 has been reported in many instances to be a universal biomarker for drug resistance thus understanding how it regulates gene expression is essential11.  Given this, it is of particular interest to understand the specific target genes responsible for the growth dysregulation of YB-1 over-expressing BLBC cells.    40 Another gene associated with poor outcomes and a greater risk of metastasis in BLBCs is MET12.  The MET gene encodes a cell surface tyrosine kinase receptor for hepatoctye growth factor (HGF, also known as scatter factor).  HGF is a pleiotropic cytokine with pro-migratory, anti-apoptotic, and mitogenic activities13-15.  Once activated, MET can promote cancer cells to proliferate and migrate and it has thus become another potential therapeutic target16.    To understand how YB-1 regulates the growth of BLBC at the transcriptional level, we performed genome-wide chromatin immunoprecipitation (ChIP) on chip (COC) analyses using promoter arrays.  These revealed a subset of YB-1 target genes associated with the basal-like signature including MET and other genes expressed by normal progenitor and malignant mammary cells such as CD44, CD49f and several members of the glyph817OTCH and Wglyph817T families.  Further studies were then undertaken to investigate how YB-1 regulates MET expression.  41 2.2 MATERIALS Aglyph1197D METHODS  Cell lines SUM149 cells were obtained from Asterand (Ann Arbor, MI) and grown according to the supplier's recommendations.  HCC1937 cells were obtained from Dr. W.D. Foulkes (McGill University, Montreal, Quebec) and were cultured in RPMI-1640 (Invitrogen) supplemented with 10 mM HEPES pH 7.6, 4.5 g/L glucose (Sigma), 1 mM sodium pyruvate (Sigma) and 10% FBS. BT474-M1 cells were obtained from Dr. Mien-Chie Hung (University of Texas, M.D. Anderson Cancer Center, Houston, TX).  All other breast cancer cell lines were purchased from the American Tissue culture collection (Rockwood MD) and cultured as recommended.    ChIP on Chip (COC) SUM149 cells were grown to 80% confluency on 15-cm diameter plates (8 x 106 cells).  Chromatin immunoprecipitation (ChIP) was performed on the pooled lysates from 12 plates of cells.  YB-1:DNA complexes were isolated as previously described7 using a anti-chicken antibody (Dr. Isabella Berquin, Wake Forest University, North Carolina).  Following elution of the DNA from the beads, the DNA was amplified using the protocol provided by NimbleGen (additional details can be found in the supplemental Materials and Methods).  From the ChIP on chip hybridization, a list of accession numbers of genes with promoters to which YB-1 potentially binds was generated.  Using the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/), the accession numbers were decoded and all genes with a greater than log 2-fold change  42 were identified.  Data was analyzed using Ingenuity Pathway Analysis software (Redwood City, CA).  Immunoblotting Breast cancer cell lines were harvested and immunoblotting was performed as described previously7 by probing the blots with anti-MET (Santa Cruz Biotechnology clone C-12, Santa Cruz, CA), P-YB-1S102 (Cell Signaling Technologies (CST), Danvers, MA) and total YB-1 (Abcam, Cambridge, MA).  Transient transfections were performed with 2 µg of empty vector, Flag:YB-1(WT), Flag:YB-1(D102) or Flag:YB-1(A102) into SUM149 or HCC1937 cells as previously described9 and 72 hours later MET receptor levels were evaluated by immunoblotting.  Flag YB-1 was detected with an anti-Flag antibody (Sigma) and total YB-1 levels were determined.  Actin (CST) was used as a loading control.  YB-1 knockdowns were performed as described below, proteins harvested after 96 hours, immunoblotted, and MET and YB-1 levels determined using Vinculin (Sigma clone Vin 11-5, V4505 antibody) or actin as loading controls.  Intensity of the signals was quantified using ImageJ 1.38X image analyzing software.  Immunocytochemistry for P-YB-1(S102) SUM149 and MDA-MB-231 cells (1.0x105) were seeded on glass coverslips, washed with phosphate-buffered saline (PBS), fixed with 2% formaldehyde for 20 min, rinsed twice with PBS, and then incubated with PBS containing 0.1% Triton X-100 (Sigma) for 30 min.  Next, the coverslips were washed with PBS, incubated with rabbit anti-Met (Santa Cruz Biotechnology clone C-12, Santa Cruz, CA) P-YB-1(S102) (CST) antibodies  43 dissolved in buffer containing 10% BSA and 2% goat serum for 1 hour at room temperature in a humidified container.  After washing three times with PBS, glass slides were incubated with Alexa 488 anti- rabbit antibody for 1 hour, washed three times and then mounted using Vectashield mounting medium (Vector Laboratories, CA).  DAPI was used for nuclear staining.    Isolation of primary progenitor cells Bipotent progenitor-enriched fractions were isolated from freshly thawed vials of three reduction mammoplasty samples, as previously described17 (see Supplemental Materials and methods for more detail).  We also isolated also bipotent progenitor-enriched fractions from 3 different reduction mammoplasty samples, as previously described18. To assess the transcript levels of YB-1 and MET, 40 to 60 ng of RNA from each sample were reverse transcribed into cDNA as described19.  For comparison, RNA was isolated from MDA-MB-231, MDA-MB-468, HCC1937, and SUM149 cells grown in log phase using the Qiagen RNeasy Mini Kit (Qiagen) and its prescribed protocol.  1 µg of extracted RNA was reverse-transcribed using Superscript III Reverse Transcriptase and its prescribed protocol (Invitrogen).  QRT-PCR (7000 Sequence Detection System, Applied Biosystems) was performed using TaqMan Gene Expression Assays designed against human YB-1 (Custom TAMRA probe, sequence: 6FAM-AAGCCCGGCACTACGGGCAGC-TAMRA, Applied Biosystems), human MET (Assay ID: Hs00179845_m1, Applied Biosystems), and human TATA-box binding protein (TBP) as an endogenous control (Part No. 4326322E, Applied Biosystems).  Relative expression of YB-1 and MET transcript levels was determined by normalizing to TBP.  44 Traditional Chromatin Immunoprecipitation (ChIP) SUM149 and HCC1937 cells were grown until 90% confluent in a 15-cm dish (1 x 107 cells) and ChIP was performed as previously described7 to isolate the YB-1-promoter complexes.  Fifteen potential YB-1 binding sites were identified on the first 2 kb of the MET promoter.  Therefore we designed three sets of primers to narrow down where YB-1 binds to the MET promoter using ChIP.  PCR was carried out using 6 µl of purified DNA.  Primer sequences were as follows. MET 1:  TTGACCTTCACACACCCAGAT (forward), TTCTGAGTTTGAGTGCCATGA (reverse); MET 2:  TCATGGCACTCAAACTCAGAA (forward), CCAGTCAGGTGTCCTTCACA (reverse); MET 3:  GCAAAATGGTTCAATGCAAG (forward), GGGCCTCGGTGAACTCTATT (reverse). PCR conditions were optimized for the primer sets as follows: 94°C for 3 minutes, 40 cycles of 94°C for 30 seconds, 58°C for 30 seconds and 70°C for 30 seconds, followed by 70°C for 10 minutes.  PCR products were visualized by agarose gel electrophoresis (2% gel) and DNA stained with ethidium bromide (Invitrogen, Burlington, Ontario, Canada).  The YB-1:MET  promoter complex was also chromatin immunoprecipitated from a SUM149 xenograft.  Briefly, NOD/SCID mice were injected with 5x105 cells into the mammary fat pad and the tumors were allowed to develop over a 14-week period.  Endogenous YB-1 was subjected to ChIP from the SUM149 xenografts as previously described by us20 and the DNA was amplified for MET promoter binding using the primers indicated above.    45 Electrophoretic mobility shift assay (EMSA) Nuclear proteins were isolated from SUM149 and MDA-MB-231 cells using NE-PER extraction kit (Pierce Biotechnology, Rockford, Illinois, USA) according to the manufacturer’s protocol.  The Lightshift Chemiluminescent EMSA kit (Pierce Biotechnology) was used to perform EMSAs using oligonucleotides corresponding to potential YB-1 binding sites according to our previously published methods4.  Briefly, binding reactions contained 1x binding buffer, 50 ng/µl poly dIdC, 20 fmol biotin-labeled double stranded DNA and 6 µg nuclear extract.  Unlabelled oligonucleotide (16 pmol) was used as competition.  Chicken anti-YB-1 antibody (1 µg) was used to determine YB-1 involvement and CREB antibody (1 µg) acted as a negative control. Oligo1:TAACCCATGACTTTCAATAACGAAGATATC , Oligo 1 mutant:TAACCCATGACTTTCCCCAACGAAGATATC, Oligo 4: ACTCTTGTAGGTGCCAATTTTTATAGCGAA, Oligo 4 mutant: ACTCTTGTAGGTGCCCCCTTTTATAGCGAA.  Inhibition of YB-1and MET using siRglyph817A or OSU-03012 The siRNAs targeting YB-1 or MET were diluted in 500 µl serum-free OPTI-MEM (Invitrogen) to achieve a final concentration of 20 nM and 6 µl Lipofectamine RNAiMAX (Invitrogen) was then added.  The mixtures were incubated at room temperature for 20 minutes in the wells of a 6-well plate to each of which 4 x 105 cells were then added in 2 ml of media.  After 96 hours, cells were harvested.  Small inhibitory RNAs targeting YB-1, referred to as siYB-1#2, and siYB-1#3, were obtained from Dharmacon as previously described4, and Qiagen (Catalog number SI03019191)  46 respectively.  The siMET oligonucleotide was obtained from Qiagen (Catalog number SI00604821).  Stable knockdowns were performed using shYB-1 previously described21 in the SUM149 cells.  SUM149 cells were seeded at 85% confluence into 6-well plates 24-hours before OSU-03012 treatment.  OSU-03012 was added into the media to achieve final concentrations of 10 µM.  Equal volumes of DMSO were added as vehicle control treatments.  SUM149 cells were harvested at 6 hours of OSU-03012 treatment.  Western blotting and RT-PCR analyses were performed as previously described20.  At later time points, OSU-03012 killed the cells; therefore we were not able to collect the cells after longer exposure times.  Luciferase assays To determine the effect of YB-1 expression on MET promoter activity –3.1kB portion of the receptor was cloned into a pGL2 reporter22.  Forty-eight hours (MDA-MB-231 cells) or 72 hours (SUM149 cells) after siRNA treatment, cells were transfected with this MET promoter construct, a renilla expression vector, pRL-TK (Promega, Madison, Wisconsin, USA), or an empty vector.  After an additional 48 hours (MDA-MB-231 cells) or 24 hours (SUM149 cells), cells were harvested in 1x Passive Lysis buffer (Promega) and luciferase activity was measured using the Dual Luciferase kit (Promega).  Additional cells were lysed in ELB buffer with protease inhibitor cocktail to check for evidence of YB-1 knockdown.  Experiments were performed in triplicate on two separate occasions and the results were averaged.      47 YB-1 over-expression and site-directed mutagenesis Over-expression of wild type and mutated YB-1A102 was performed as previously described9. The YB-1 S102D was generated by site-directed mutagenesis (Stratagene, Windsor, ON, USA) of the WT-YB-1 construct using the following primer: 5’-ccaggaagtaccttcgcgatgtaggagatggagagactgtgg-3’. These three constructs have the 3x FLAG tag. The plasmid transfections were performed with 2 µg of DNA and Lipofectamine 2000 (Invitrogen), and maintained for 72-96 hours.  Effect of siYB-1 on MET receptor signaling and tumor cell growth in soft agar In order to understand the impact of silencing YB-1 expression on HGF-dependent stimulation of MET receptor signaling, MDA-MB-231 cells were exposed to siYB-1#2 or siYB-1#3 for 96 hours. Cells were then serum starved over night and then stimulated for 15 minutes with HGF (20 ng/ml).  Proteins were isolated and evaluated for changes in the MET receptor adaptor protein P-Gab-1(Y307) (CST, cat number 3234)23.  Total Gab-1 was used as a loading control (CST, Cat 3232).  To study anchorage independent growth, cells were plated at a density of 1 x 104 cells/well (SUM149 cells) and 2.5 x 103 cells/well (MDA-MB-231 cells) in a 24-well plate in 0.6% agar plus 40 ng/ml HGF (R&D Systems, Minneapolis, MN) on top of a 1.2% cell-free agar.  After 28 days, colonies were counted.  Experiments were performed in replicates of four on two separate occasions and results averaged.   48 2.3 RESULTS  COC suggests YB-1 regulates MET  COC was undertaken to systematically identify a full list of potential targets of YB-1 in SUM149 BLBC cells.  The results revealed that YB-1 potentially interacts with >6000 candidate promoters.  A high proportion of these encode enzymes, kinases, transporters and known or potential growth factor receptors (Figure 2.1, A) (for a complete list, see Supplementary Table 2.1).  Notable amongst the latter was MET (Table 2.1).  CD4424 and CD49f 25 were also found to be potential YB-1 target genes and notably both are previously reported to bind to and enhance MET activation26.  Several members of the NOTCH and WNT pathways were also identified (Table 2.1).  Their potential functional relationships to one another in terms of signal transduction activation are illustrated using Ingenuity Pathway Analysis software (Figure 2.1B).  We highlight that two major signaling nodes are created using this approach; one that involves the MET/CD44/CD49f signaling complex and the other that includes WNT/NOTCH interactions.  While it is beyond the scope of this work to validate all of the YB-1 target genes associated with these signaling networks, this preliminary analysis does suggest that there are common features of YB-1 responsive genes that could have an important bearing on cell growth control.    P-YB-1(S102) and MET are coordinately expressed in BLBC cell lines To investigate if there is a relationship between levels of MET and YB-1 protein, a panel of breast cancer cell lines was screened. Levels of total YB-1 protein were consistent across all cell lines, but P-YB-1(S102) levels were higher in the BLBC cells.  Strikingly,  49 MET was expressed exclusively in the BLBC cell lines.  Like many transcription factors, YB-1’s access to the genome is governed by phosphorylation9.  Herein we show that P-YB-1(S102) was intensely expressed in the nucleus of SUM149 and MDA-MB-231 cells.  MET was also expressed at considerable levels in both SUM149 and MDA-MB-231 based on immunofluorescence (Figure 2.2B).  This was further confirmed by immunoblotting (data not shown).   Total YB-1 and MET are co-expressed in normal human mammary progenitor cells We asked whether YB-1 transcripts are present in populations of the most primitive normal human mammary progenitors that can be reproducibly isolated at high purities (30-50%)18; i.e., bipotential progenitors that produce mixed colonies containing both mature luminal and myoepithelial cell progeny.  Suspension cultures containing bipotent progenitors were isolated from freshly thawed aliquots of reduction mammoplasty cells taken from three different individuals.  The mRNA from these samples was amplified for YB-1 and MET by qRT-PCR.  In addition, we evaluated the expression of YB-1 and MET in mammoplasty cells that were isolated and subsequently cultured for three days in media that specifically enriches for progenitors where the proportion of progenitors increased from ~5% in the freshly thawed isolates to 30-50% in the selective media.  YB-1 and MET mRNA was expressed in the bipotential progenitor populations regardless of the culturing method (Figure 2.2C).  However, the levels of YB-1 transcripts in these cells were up to 2000 times lower than in the cancer cell lines and the levels of MET mRNA were as much as 300 times lower (data not shown).  Nevertheless, there was a strong correlation (r2=0.8785) between the levels of YB-1 and MET mRNA in the normal  50 progenitor-enriched samples (Figure 2.2D).  This indicates for the first time that YB-1 and MET transcripts are both detectable in a very primitive normal mammary subpopulation albeit at very low levels compared to cancer cell lines.   Verification that YB-1 binds to the promoter of MET To obtain more direct evidence that YB-1 binds to the MET promoter in BLBC cells, traditional ChIP experiments were carried out on extracts of three BLBC (SUM149, MDA-MB-213 and MDA-MB-468) cell lines, as well as, from a primary tumor that developed from SUM149 cells injected into a NOD/SCID mouse.  PCR amplifications were performed using 3 primer sets designed to flank potential YB-1 binding sites on the MET promoter referred to as MET 1, MET 2 and MET 3 (Figure 2.3A, top).  YB-1:MET promoter binding was validated using MET 1 primers and this was evident in each of the BLBC cell lines and the xenograft cells (Figure 2.3A, bottom, left).  Yet the putative YB-1-responsive elements (YREs) that would have been amplified by the MET 2 and MET 3 primers were not authentic binding sites based on a lack of amplification (Figure 2.3A, bottom, right).  Using this strategy, we localized YB-1 binding sites to the MET 1 region that contains six potential binding sites.  To determine which of the potential YB-1 binding sites was most important, five oligonucleotides (oligo 2 contained two YREs in close proximity to one another) were designed to the putative binding sites in the MET 1 region and EMSA was then performed (data not shown).  The results of these assays revealed that oligo 1 (-1151 to -1180) and 4 (-1006 to -1035) elicited the strongest shifts in the presence of a nuclear extract from SUM149 cells (Figure 2.3B).  This was confirmed with MDA-MB-231 nuclear extracts (data not shown).  Both oligos showed a  51 strong supershift with the addition of the YB-1 antibody but not a CREB antibody, indicating the specificity of the YB-1 binding.  Furthering this observation, mutation of the YRE in oligo 4 resulted in loss of binding, whereas this was not the case with oligo1 (Figure 2.3C).  Therefore, it can be concluded that a bona fide YRE on the MET promoter resides -1018 bp upstream of the translational start site while YB-1 binding to the oligo 1 region must be indirect.  To investigate this apparent association further, the introduction of either Flag:YB-1 or constitutively active Flag:YB-1(D102) increased MET protein levels in SUM149 and HCC1937 cells compared to the empty vector yet the inactive A102 mutant did not (Figure 2.4A).  The introduction of siRNA designed to silence YB-1 reduced MET protein and mRNA expression by 40-60% in SUM149 and MDA-MB-231 cells (Figure 2.4B-C).  Similarly, stable inhibition of YB-1 using a shYB-1 approach suppressed the expression of MET protein and mRNA (Figure 2.4B-C).  The same effect was observed when the cells were infected with a lentiviral vector expressing shYB-1 (Figure 2.1 supplemental).  In all of these studies, MET mRNA decreased by ~50%.  Consistent with this finding, the treatment of the cells with siYB-1 #2 caused a 54% reduction in MET promoter activity (Figure 2.4D).  In contrast, wild type YB-1 and Flag:YB-1(D102) increased MET promoter activity Flag:YB-1(A102) did not (Figure 2.4E).  Likewise, treating SUM149 cells with the PDK-1 inhibitor OSU-03012 for 6 hrs decreased P-AktS473, P-YB-1S102 and attenuated MET protein (Figure 2.4F, left) and mRNA (Figure 2.4F, right).  Thus, inhibiting a major signal transduction pathway known to activate YB- 52 1 also perturbs MET protein expression20.  These data provide evidence that YB-1 phosphorylation is important for its control of MET expression.  Silencing YB-1 or MET with siRglyph817A inhibits HGF-stimulated signaling and anchorage-independent growth Because HGF is the major stimulus for MET receptor, we expected that inhibiting YB-1 would interfere with this important signaling pathway.  In support of this idea, silencing YB-1 for 96 hrs inhibited HGF-mediated signaling through MET given that Gab-1 phosphorylation was suppressed (Figure 2.5A).  Silencing YB-1 with siYB-1#3 remarkably suppressed the expression of the MET receptor and therefore HGF-induced signaling through Gab-1.  We also silenced MET itself as a positive control to show that HGF must use this receptor to elicit signaling through Gab-1 (Figure 2.5A).  Of note, the partial suppression of MET with siYB-1#2 was not enough to fully block HGF-induced signaling.  This is likely because there was enough residual MET receptor present to transmit the signal.  Taken together, these results indicate that the expression and activity of MET in BLBC cells is at least partly dependent on YB-1.  To study the effect of YB-1 and MET knockdown on the proliferative activity of BLBC cell lines, the clonogenic ability of siRNA-treated SUM149 and MDA-MB-231 cells in soft agar assays was analyzed in cultures enriched with HGF.  Both cell lines showed greater sensitivity to the loss of YB-1 than MET interference, with up to a 90% reduction in colony-forming ability by siYB-1 #2 –treated SUM149 cells (Figure 2.5B).  However, a reduction of up to 57% in clonogenic ability of these cells was seen when MET was directly targeted.  MDA-MB-231 cells were slightly less sensitive to either of these treatments (72%  53 reduction with siYB-1 #2 and 34% with siMET, Figure 2.5C).  These data indicate that disruption of YB-1 leads to a remarkable suppression of anchorage-independent growth, some of which is attributable to loss of MET expression.    Our data collectively supports the idea that MET is transcriptionally up-regulated by YB-1 in BLBC.  One could argue that high levels of MET may be due to gene amplification.  To begin to address this, we performed comparative genomic hybridization on MDA-MB-231 and reported that amplifications were not found in the 7q31.1 where the MET gene resides27. Similarly, MET is not commonly amplified in primary BLBC based on the analysis of ten tumors (Figure 2.2, supplemental).  These findings do not support a role of gene amplification causing the increased MET expression that is characteristic of these cells and reinforce the potential importance of other mechanisms such as YB-1-mediated up-regulation.    54 2.4 DISCUSSIOglyph1197  In this study, we present results of the first global COC analysis of genes potentially regulated by YB-1 in BLBC cells.  This analysis revealed approximately 6000 candidate targets including many genes encoding growth factor receptors and their signaling intermediates.  One of these was MET, which encodes the tyrosine kinase cell surface receptor for HGF and has been previously implicated in primary human BLBCs28.  In addition, forced over-expression of MET together with Myc in murine mammary cells has been found to produce BLBC in mice12.  While many aspects of MET activity have been well studied29, surprisingly little has been uncovered about its transcriptional regulation with the exception of evidence for a role of ETS22, hypoxia inducible factor-1 a30 and b- catenin31.  In the studies described herein, using traditional ChIP and EMSA, we now demonstrate that MET expression is transcriptionally up-regulated in BLBC cells by direct binding of YB-1 to the MET promoter at –1018 bp from the transcriptional start site.  In addition, we showed that inhibition of YB-1 in these cells decreased MET mRNA and protein levels, and attenuated HGF-induced signaling.  Interestingly, examination of MET expression in different breast cancer cell lines showed MET to be up-regulated in four BLBC cell lines, but not in the three representative luminal and HER-2 expressing cell lines tested.  Further, our data suggest that MET signaling is important to the growth of BLBC cells, based on the level of suppression of BLBC colony formation obtained from siRNA-treated cells.  These results provide strong support for an important role of MET as a downstream effecter of YB-1-mediated transformation of BLBC cells.  Our present finding indicates that primary samples of this subgroup of breast cancer do not show amplification of the MET gene, in spite of their up-regulated expression of MET  55 expression12, 28.  This observation underscores the likelihood that this is a downstream consequence of the enhanced expression and trans-regulatory activity of YB-1 on the MET promoter.    It should be noted that inhibiting YB-1 consistently had a greater effect on attenuating MET protein than it did on modulating MET mRNA levels.  For example, when YB-1 expression was stably inhibited with shRNA, the levels of MET protein became virtually undetectable, yet MET mRNA was reduced by only ~40-50%.  This observation was confirmed using two different MET receptor antibodies.  Consistent with these results, silencing YB-1 with a lentiviral shRNA vector yielded identical findings; the levels of MET protein were inhibited to a greater extent than could be explained by changes in mRNA.  While we demonstrate herein that the MET promoter is a direct target of YB-1, it may also influence its translation.  Thus, additional regulatory avenues need to be explored to more fully understand the relationship between YB-1 and MET.  As predicted by such a model, inhibiting YB-1 also markedly suppressed the growth of the BLBC cells under anchorage-independent conditions.  Indeed, the inhibition obtained was even greater than that achieved by inhibiting MET alone, consistent with the COC findings indicating likely effects of YB-1 on other genes important to the growth of BLBC cells.  These data suggest that targeting MET, as well as, YB-1 could be useful therapeutic strategies for improving the treatment of BLBC in patients.  In this regard, it is interesting to note that inhibitors of MET are already available and in clinical trials in other types of patients29.  Our group is actively developing inhibitors to YB-1.  56 Some of the other genes that YB-1 bound reportedly have stem/progenitor associations; e.g., CD44, CD49f, c-KIT, BMI-1, and both glyph817OTCH and Wglyph817T pathway elements18, 32-34.  It is interesting to note that high expression of many of these genes has also been associated with human breast cancer cells that have an ability to initiate tumor formation in immunodeficient mice35-37.  It might be speculated, therefore, that heightened expression of YB-1 is a key mechanism used by normal mammary stem cells to maintain their primitive status and one that is used and/or high jacked by breast cancer stem cells.  Further validation of the genes that YB-1 regulates in normal and malignant breast cells should therefore be of interest to understand why YB-1 expression correlates so strongly with breast cancer recurrence.  57 2.5 FIGURES Aglyph1197D TABLES   Figure 2.1.  Categorization of YB-1 COC data into functional groups and schematic presentation of the possible interactions among the select genes that are linked to primitive cells and tumor initiation.  A) Genes were grouped into 15 functional categories. The largest known group was represented by genes that encode enzymes using Ingenuity Pathway Analyses.  Enumeration of the genes in each category is found in the list.  B) From the ~6000 potential YB-1 targets identified by COC, a group of genes involved in self-renewal and tumor initiation were identified.  The way in which the protein products of these genes interact with one another and thereby influence cell signaling is depicted.  From this analysis, it is clear that there are several members of two common signaling nodes that are potentially regulated by YB-1.  These nodes involve MET/CD44/CD49f and the WNT/NOTCH networks.  Solid arrows indicate direct interactions whereas broken arrows represent indirect relationships.  58  Gene name Accession number Fold change Bmi-1 NM_005180 3.5 CD44 NM_000610, NM_001001389, NM_001001390, NM_001001391, NM_001001392 2.6 CD49f (ITGA6) NM_000210 5.3 C-Kit NM_000222 3.8 Met NM_000245 6.6 glyph817otch2 NM_024408 2.4 glyph817otch3 NM_000435 8.3 glyph817otch4 NM_004557 11.9 P21/CDKglyph8171A/Cip1 NM_000389, NM_078467 7.1 Wglyph817T1 NM_005430 4.7 Wglyph817T2B NM_024494 9.4 Wglyph817T4 NM_030761 6.9 Wglyph817T3A NM_033131 4.9 Wglyph817T5B NM_032642 5.5 Wglyph817T10A NM_025216 7.2 Wglyph817T11 NM_004626 4.3 Wglyph817T16 NM_057168 6.4   Table 2.1.  Select putative YB-1 target genes identified in the COC screen that are common to one another in that they each are associated with a stem cell signature.  From this list of genes, the MET receptor was selected for validation because it forms a network with other proteins in this list such as CD44 and CD49f.     59  Figure 2.2.  YB-1 and MET receptor expression levels are positively correlated in basal-like breast cancer cell lines and primary normal mammary progenitor cells.  A) Investigation of MET and YB-1 protein levels in a panel of breast cancer cell lines corresponding to BLBC, HER-2 over-expressing, and luminal subtypes. This comparison included four BLBC cell lines (SUM149, MDA-MB-231, HCC1937 and MDA-MB-468), as well as three additional lines representing other breast cancer subtypes; i.e., MDA-MB-453 (a model for the HER-2 over-expressing subtype), BT474-M1 (a model of the luminal B subtype), and MCF-7 (a model of the luminal A subtype).  MET expression was restricted to the BLBC cells lines, subtypes where P-YB-1(S102) levels were also higher.  B) P-YB-1(S102) was localized to the nucleus of the SUM149 and MDA-MB-231 cells.  Levels of Met receptor protein were also visualized in the cell lines by immunofluorescence.  DAPI was used for nuclear staining.  C-D) YB-1 and MET receptor transcript levels in normal mammary progenitor cells isolated from three different reduction mammoplasties.  Cells were either isolated from freshly thawed tissues or from cells cultured in media that enriches for mammary progenitors.  Samples were analyzed by qRT-PCR assays for YB-1 and MET mRNA and normalized to endogenous TBP.  YB-1 and MET mRNA tightly correlated across these samples (R2=0.8785).  60   Figure 2.3.  Traditional ChIP and EMSA localize YB-1 binding to the -1018 YRE.  A) Analysis of the MET promoter indicated 15 putative YB-1 binding sites where the black boxes indicate 5’-ATTG-3’ sequences and white boxes indicates 5’-CAAT-3’ sites.  Primers were designed to amplify portions of the MET receptor that captured several non-overlapping YRE’s referred to as MET 1, MET 2, and MET 3.  Solid and open boxes refer to ATTG and CAAT binding regions, respectively.  In addition, the location of confirmatory oligonucleotides used for subsequent gel shift assays described below referred to as oligo1 and 4 is also illustrated.  Traditional ChIP analysis showed strong binding of YB-1 in the MET 1 region in both SUM149 and MDA-MB-468 extracts.  In addition, ChIP from a SUM149 xenograft showed YB-1 binding in vivo at this site.  Binding was not observed using primers to the MET2 or MET3 regions, for example in MDA-MB-468 cells.  B) EMSA analysis with MET oligos 1 and 4. The regions corresponding to these oligos were -1151 to -1180 for oligo1 and -1006 to -1035 for oligo 4.  In the absence of nuclear protein (lane 1&6) no binding was observed.  In contrast, the addition of nuclear extracts (lane 2&7) resulted in binding which could be competed with cold oligonucleotide (lane 3&8) or by incubating the nuclear extracts with YB-1 antibody (lane 4&9).  Addition of YB-1 antibody causes a supershift (lane 4&9), while addition of a CREB antibody did not (lane 5&10) indicating site specificity.  C) Mutant oligonucleotides were next introduced to oligos 1 (-1151 to -1180) and 4 (-1006 to -1035) where the YB-1 binding site was changed to 5’-CCCC-3’. Loss of the putative YB-1 response element causes a reduction in YB-1 binding in oligo 4 (lane 7) but not oligo 1 (lane 3).  61   Figure 2.4.  MET mRglyph1197A and protein levels and reporter activity can be modulated via YB-1.  A) SUM149 and HCC1937 cells were transiently transfected for 72 hrs with empty vector, Flag:YB-1(WT), Flag:YB-1(D102) or Flag:YB-1(A102).  MET levels increased following the expression of Flag:YB-1(WT) and more so with Flag:YB-1(D102), while Flag:YB-1(A102) was unable to cause the same effect.  B) YB-1 knockdown with either siYB-1#2 or siYB-1#3 reduced MET protein expression in the SUM149 and MDA-MB-231 cell lines.  Vinculin was used as a loading control.  Similarly, shYB-1 expression lead to decreased MET receptor protein in SUM149 cells. C) QRT-PCR revealed that transcript levels of MET were also reduced in YB-1 knockdown samples compared to cells treated with control siRNA for all cell lines. D) SUM149 and MDA-MB-231 cells treated with siYB-1#2 or siYB-1#3 decreased MET reporter activity by 45% and 54%, respectively.  Inhibition of YB-1 had no effect on the activity of empty vector, pGL2 basic, as expected.  E) In contrast, over-expression of wild type YB-1 increased MET promoter activity which again was more so with Flag:YB-1(D102).  Similar to transcription level, Flag:YB-1(A102) was unable to increase the promoter activity F) OSU-03012 attenuated Akt activation resulting in reduced P-YB-1S102 and eventually reduction of MET protein expression in SUM149 cells.  Inhibition of PDK-1 signalling via OSU-03012 treatment also significantly inhibited MET mRNA levels based on qRT-PCR.  SUM149 cells were treated with DMSO (black) or OSU-03012 (white) for 6 hours.  MET transcripts were significantly reduced by OSU-03012 compared to the DMSO treated cells (p < 0.05).  62   Figure 2.5.  Inhibition of YB-1 disrupts HGF/MET receptor signaling and anchorage-independent growth. A) MDA-MB-231 cells were transfected with siYB-1 for 96 hours then stimulated with HGF for 15 minutes.  The impact on signal transduction was evaluated via decreased P-Gab-1Y307 levels.  B-C) Soft agar assays with YB-1 knockdown show that the loss of either protein results in a marked reduction in anchorage-independent growth in both SUM149 and MDA-MB-231 cells by 80-90%.  Decreased MET receptor expression by siRNA suppressed anchorage-independent growth of both cell lines by approximately 50%.  63 2.6 SUPPLEMEglyph1197TARY MATERIALS Aglyph1197D METHODS  Lentiviral down-regulation of YB-1   A pSuper plasmid harboring an established sh-YB-1 sequence21, a gift from Dr. Peter Mertens, Aachen, Germany, was digested with EcoRI and HindIII to eject and isolate the approximately 200 bp H1 RNA promoter and YB-1-specific RNAi sequence.  The 200 bp fragment was cloned into a pSuper shuttle vector, and further digested with BamHI and NheI.  The RNAi sequence and corresponding promoter was finally inserted at position 2376 into the KA391 lentivector38 with a modified yellow fluorescence protein (YFP).  A Lenti-EV plasmid was also constructed by inserting the H1 promoter with no sh-RNA sequence into the KA391 lentivector at the same location.  Lenti-EV and Lenti-shYB-1 viruses were produced, purified, and titred as previously described38.  SUM149 cells were grown in log-phase in their described medium and infected with either the purified Lenti-EV or Lenti-sh-YB-1 virus as previously described38.  Successful transfectants were selected based on fluorescence analysis by the BD FACSVantage flow cytometry system, and the top 20% of YFP+ cells were isolated and propagated in culture.  The pSuper shuttle vector, KA391 lentivector with modified YFP, virus production reagents, virus purification reagents, and selection of successfully infected SUM149 cells materials were gifts from Dr. Connie Eaves, Vancouver, Canada.  Western blotting and quantitative PCR for MET and YB-1 were performed as it described in Materials and Methods.  Acknowledgement: Dr. Yun Zhao, PhD, Vancouver, Canada, for lentivector cloning advice.   64 Array CGH analysis  Ten primary tumors were characterized as being basal-like by immunohistochemistry (negative for ER, PR and Her-2 while positive for EGFR) and then DNA was extracted from the tumors and analyzed for gain or loss of copy number by SMRT tiling arrays as previously described4.   Detailed description of primary progenitor isolations Bipotent progenitor-enriched fractions were isolated from freshly thawed vials of three reduction mammoplasty samples, as previously described17.  In this case, an aliquot of the initially obtained single cell suspension were fractionated immediately by FACS after staining with antibodies against human EpCAM, CD49f, CD31 and CD45.  The basal fraction (CD49f+EpCAM-/lowCD31-CD45-) isolated by this method comprises mainly mature myoepithelial cells, and also bipotent and myoepithelial-restricted progenitors.  The luminal fraction (CD49f+EpCAM+CD31-CD45-) comprises mainly mature luminal epithelial cells, and also luminal-restricted progenitors.  An average of 5% of cells in fractions isolated using this methodology are progenitors17. We also isolated bipotent progenitor-enriched fractions from 3 different reduction mammoplasty samples, as previously described18.  In this case, the culture condition enrich for the expansion of progenitors.  Briefly, cryopreserved organoid-enriched human mammary cells were defrosted, enzymatically dissociated to generate a single cell suspension and cultured for 3 days in EGF-containing medium.  An Epithelial Cell Adhesion Molecule (EpCAM)+ fraction was isolated immunomagnetically, and the cells were further fractionated by fluorescence activated cell sorting (FACS) after staining with antibodies against human  65 CD49f, CD10, Thy1, Mucin 1 (MUC1) and AC133.  This method yields progenitor purities of 30-50% in the EpCAM+CD49f+(CD10/Thy1)+ (bipotent progenitor enriched) isolates18. To assess the transcript levels of YB-1 and MET, 40 to 60 ng of RNA from each sample were reverse transcribed into cDNA as described19.  For comparison, RNA was isolated from MDA-MB-231, MDA-MB-468, HCC1937, and SUM149 cells grown in log phase using the Qiagen RNeasy Mini Kit (Qiagen) and its prescribed protocol.  1 µg of extracted RNA was reverse-transcribed using Superscript III Reverse Transcriptase and its prescribed protocol (Invitrogen).  QRT-PCR (7000 Sequence Detection System, Applied Biosystems) was performed using TaqMan Gene Expression Assays designed against human YB-1 (Custom TAMRA probe, sequence: 6FAM-AAGCCCGGCACTACGGGCAGC-TAMRA, Applied Biosystems), human MET (Assay ID: Hs00179845_m1, Applied Biosystems), and human TATA-box binding protein (TBP) as an endogenous control (Part No. 4326322E, Applied Biosystems).  Relative expression of YB-1 and MET transcript levels was determined by normalizing to TBP.  COC SUM149 cells were grown to 80% confluency on 15-cm diameter plates (8 x 106 cells).  Chromatin immunoprecipitation (ChIP) was performed on the pooled lysates from 12 plates of cells.  YB-1:DNA complexes were isolated as previously described7 using a anti-chicken antibody (Dr. Isabella Berquin, Wake Forest University, North Carolina).  Following elution of the DNA from the beads, the DNA was amplified using the protocol provided by NimbleGen.  Briefly, DNA end blunting was performed by T4 DNA polymerase (NEB, #203L) for 20 minutes at 12°C on eluates and input controls.  3 M  66 NaOAc, 20 mg/ml glycogen and phenol/chloroform was added and samples were vortexed for one minute.  Aqueous supernatants were removed, DNA precipitated in ethanol and the pellet suspended in 25 µl water.  T4 DNA ligase (NEB, #202L) ligated the blunted DNA to 15 µmol/L of annealed linkers oJW102 (5’ – GCGGTGACCCGGGAGATCTGAATTC) and oJW103 (5’ – GAATTCAGATC).  The samples were incubated at 16°C overnight and precipitated in ethanol.  The oJW102 primer was used to perform ligation-mediated PCR (LM-PCR).  PCR conditions were 55°C for 2 minutes, 72°C for 5 minutes, and 95°C for 2 minutes, then 22 cycles of 95°C for 1 minute, 60°C for 1 minute and 72°C for 5 minutes.  QIAQuick PCR Purification Kit (#28104) was used to purify the samples and NanoDrop ND-1000 Spectrophotometer was used to quantify the DNA.  From the ChIP on chip hybridization, a list of accession numbers of genes with promoters to which YB-1 potentially binds was generated.  Using the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/), the accession numbers were decoded and all genes with a greater than log 2-fold change were identified.  Data was analyzed using Ingenuity Pathway Analysis software (Redwood City, CA).  67 2.7 SUPPLEMEglyph1197TARY FIGURES       Supplementary Figure 2.1. Stable Lentiviral down-regulation of YB-1 (Lenti-shYB-1) in SUM149 and its effect on MET expression.  Silencing YB-1 using a lentiviral shYB-1 approach reduced MET receptor A) protein and B) mRNA levels.  The protein was reduced by ~90% while the mRNA was decreased by approximately 50%.  This was consistent with the effect observed by stable shYB-1 silencing using plasmid DNA and siRNA targeting approaches.   68    Supplementary Figure 2.2. CGH analysis using SMRT high resolution tiling arrays on primary BLBC. Array CGH analysis indicating that MET is not commonly amplified in primary BLBC. Gain or loss of copy number was considered significant if the levels were – or + 0.5 from the norm.  A small segmental gain was observed only in sample J, yet not considerable increases were observed in the other nine primary tumors.   69 REFEREglyph1197CES  1. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc glyph817atl Acad Sci U S A. 2001;98:10869-10874. 2. Dunn BK, Ford LG. Hormonal interventions to prevent hormonal cancers: Breast and prostate cancers. Eur J Cancer Prev. 2007;16:232-242. 3. Colozza M, de Azambuja E, Personeni N, Lebrun F, Piccart MJ, Cardoso F. Achievements in systemic therapies in the pregenomic era in metastatic breast cancer. Oncologist. 2007;12:253-270. 4. Stratford AL, Habibi G, Astanehe A, et al. Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res. 2007;9:R61. 5. Habibi G, Leung S, Law JH, et al. Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res. 2008;10:R86. 6. Lee C, Dhillon J, Wang MY, et al. Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res. 2008;68:8661-8666. 7. Wu J, Lee C, Yokom D, et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res. 2006;66:4872-4879. 8. Shibao K, Takano H, Nakayama Y, et al. Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer. 1999;83:732-737. 9. Sutherland BW, Kucab J, Wu J, et al. Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene. 2005;24:4281-4292. 10. Stratford AL, Fry CJ, Desilets C, et al. Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res. 2008;10:R99. 11. Kuwano M, Uchiumi T, Hayakawa H, et al. The basic and clinical implications of ABC transporters, Y-box-binding protein-1 (YB-1) and angiogenesis-related factors in human malignancies. Cancer Sci. 2003;94:9-14. 12. Welm AL, Kim S, Welm BE, Bishop JM. MET and MYC cooperate in mammary tumorigenesis. Proc glyph817atl Acad Sci U S A. 2005;102:4324-4329. 13. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. Met, metastasis, motility and more. glyph817at Rev Mol Cell Biol. 2003;4:915-925. 14. Leo C, Horn LC, Einenkel J, Hentschel B, Hockel M. Tumor hypoxia and expression of c-met in cervical cancer. Gynecol Oncol. 2007;104:181-185. 15. Trusolino L, Comoglio PM. Scatter-factor and semaphorin receptors: Cell signalling for invasive growth. glyph817at Rev Cancer. 2002;2:289-300. 16. Yoshida S, Harada T, Mitsunari M, et al. Hepatocyte growth factor/Met system promotes endometrial and endometriotic stromal cell invasion via autocrine and paracrine pathways. J Clin Endocrinol Metab. 2004;89:823-832.  70 17. Eirew P, Stingl J, Raouf A, et al. A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. glyph817at Med. 2008;14:1384-1389. 18. Raouf A, Zhao Y, To K, et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell. 2008;3:109-118. 19. Zhao Y, Raouf A, Kent D, et al. A modified polymerase chain reaction-long serial analysis of gene expression protocol identifies novel transcripts in human CD34+ bone marrow cells. Stem Cells. 2007;25:1681-1689. 20. To K, Zhao Y, Jiang H, et al. The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phen yl]-acetamide (OSU-03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol. 2007;72:641-652. 21. van Roeyen CR, Eitner F, Martinkus S, et al. Y-box protein 1 mediates PDGF-B effects in mesangioproliferative glomerular disease. J Am Soc glyph817ephrol. 2005;16:2985-2996. 22. Gambarotta G, Boccaccio C, Giordano S, Ando M, Stella MC, Comoglio PM. Ets up-regulates MET transcription. Oncogene. 1996;13:1911-1917. 23. Sachs M, Brohmann H, Zechner D, et al. Essential role of Gab1 for signaling by the c-met receptor in vivo. J Cell Biol. 2000;150:1375-1384. 24. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is required for two consecutive steps in HGF/c-met signaling. Genes Dev. 2002;16:3074-3086. 25. Trusolino L, Bertotti A, Comoglio PM. A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell. 2001;107:643-654. 26. Boccaccio C, Comoglio PM. Invasive growth: A MET-driven genetic programme for cancer and stem cells. glyph817at Rev Cancer. 2006;6:637-645. 27. Shadeo A, Lam WL. Comprehensive copy number profiles of breast cancer cell model genomes. Breast Cancer Res. 2006;8:R9. 28. Charafe-Jauffret E, Ginestier C, Monville F, et al. Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene. 2006;25:2273-2284. 29. Comoglio PM, Giordano S, Trusolino L. Drug development of MET inhibitors: Targeting oncogene addiction and expedience. glyph817at Rev Drug Discov. 2008;7:504-516. 30. Pennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM. Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell. 2003;3:347-361. 31. Boon EM, van der Neut R, van de Wetering M, Clevers H, Pals ST. Wnt signaling regulates expression of the receptor tyrosine kinase met in colorectal cancer. Cancer Res. 2002;62:5126-5128. 32. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704-715. 33. Shipitsin M, Campbell LL, Argani P, et al. Molecular definition of breast tumor heterogeneity. Cancer Cell. 2007;11:259-273. 34. Stingl J, Eirew P, Ricketson I, et al. Purification and unique properties of mammary epithelial stem cells. glyph817ature. 2006;439:993-997. 35. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc glyph817atl Acad Sci U S A. 2003;100:3983-3988.  71 36. Dontu G, Jackson KW, McNicholas E, Kawamura MJ, Abdallah WM, Wicha MS. Role of notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res. 2004;6:R605-15. 37. Farnie G, Clarke RB, Spence K, et al. Novel cell culture technique for primary ductal carcinoma in situ: Role of notch and epidermal growth factor receptor signaling pathways. J glyph817atl Cancer Inst. 2007;99:616-627. 38. Raouf A, Brown L, Vrcelj N, et al. Genomic instability of human mammary epithelial cells overexpressing a truncated form of EMSY. J glyph817atl Cancer Inst. 2005;97:1302-1306.   72 CHAPTER THREE :  YB-1 Iglyph1197DUCES EXPRESSIOglyph1197 OF CD44 Aglyph1197D CD49F LEADIglyph1197G TO Eglyph1197HAglyph1197CED SELF-REglyph1197EWAL, MAMMOSPHERE GROWTH, Aglyph1197D DRUG RESISTAglyph1197CE **    This chapter draws on a manuscript that further validates the findings of Chapter 2, where we first introduced YB-1 as a regulator of genes associated with primitive stem cell populations.  CD44 and CD49f were two of the candidate genes that were suggested by the ChIP-on-chip screen to be putatively regulated by YB-1.  In Chapter 3, we discover two novel relationships between YB-1 and CD44, as well as YB-1 and CD49f.  We characterize their interactions and find a regulatory relationship.  Further, we demonstrate functional roles for these relationships in the context of tumour cell growth in 3-dimensional assays.  Finally, we show for the first time the important role of YB-1, an oncogene, in breast cancer cells cultured in a mammary stem cell associated mammosphere non-adherent assay and a related self-renewal assay.       **A version of this chapter has been submitted for publication.  To K, Fotovati A, Reipas KM, Law JH, Hu K, Lee L, Johnson P, Wang J, Berquin IM, Royer HD, Raouf A, Eaves CJ, and Dunn SE. YB-1 induces CD44 and CD49f thereby promoting the capacity for tumour initiation.    73 3.1 Iglyph1197TRODUCTIOglyph1197  Breast cancer relapse confers a poor prognosis, decreasing survival rates from 80% to 60% when the recurrence is local, and from 80% to 10% for metastatic disease.  Relapse is postulated to be mediated by the persistence of cancer stem cells that have survived an initial treatment regimen with radiation1 and/or chemotherapy2-4 possibly due to a selective resistance of the cancer stem cells to these agents.  Human breast cancer stem cells have been identified as a phenotypically restricted subset of CD44+CD24-/low cells that form tumours in immuno-compromised mice in limiting dilution transplant assays5.  The same CD44+CD24-/low subset has also been associated with breast tumour mammosphere generation in vitro3.  However, the nature of the essential molecular properties of breast cancer stem cells has remained poorly defined.  Recently, Weinberg’s group showed that p53 inhibits CD44 expression in untransformed and transformed mammary epithelial cells2 suggesting that higher levels of CD44 would also be an expected consequence of p53 inactivation.  YB-1 (Y-box binding protein-1) is a transcription/translation factor that is commonly overexpressed in many cancers, including human breast cancer (40%)6-8.  This elevated expression of YB-1 in human breast cancer correlates with high rates of relapse6.  Targeted overexpression of YB-1 in the mouse mammary gland leads to the development of mammary tumours9, confirming a role of YB-1 as an oncogene in that tissue.  YB-1 is directly phosphorylated, and therefore activated, on its serine 102 site by Akt10 and even more potently by RSK11, a major component of the MAP kinase pathway.  Thus, YB-1 is positioned as a key player in both the PI3K/Akt and MAPK pathways.  YB-1 regulates  74 genes that promote breast cancer cell growth and survival including EGFR7, Her-27, PIK3CA12, and MET13 and biologically, is essential for breast cancer cell growth in vitro7, 10, 11, 14 and in vivo15.  YB-1 expression has also been shown to be associated with drug resistance via the induction of genes such as MDR-116, 17.  Consistent with this, inhibition of YB-1 was found to sensitize breast cancer cells to Paclitaxel16, a chemotherapeutic agent commonly used in the clinic to treat advanced breast cancer.  As a first step towards defining the transcriptional programming activity of YB-1, we performed chromatin immunoprecipitation-on-chip (ChIP-on-chip) assays13.  This screen revealed a subset of genes known to be active in and important to a number of stem cell populations, including c-KIT, BMI-1, members of the Wglyph817T and glyph817OTCH signaling pathways, as well as CD44 and CD49f (also known as α-6 integrin)13.  We also found that YB-1 transcripts were present in purified CD44+CD49f+ subpopulations of primitive human mammary progenitor cells populations isolated from normal reduction mammoplasties13.  Taken together, this led us to design a series of experiments to test the hypothesis that YB-1 plays a key role as an oncogene by transactivating genes associated with a cancer stem cell phenotype.  3.2 MATERIALS Aglyph1197D METHODS Cell lines and culturing  Human breast cancer cell lines, MDA-MB-231 and MDA-MB-468, were purchased from the American Tissue Culture Collection (ATCC, Rockwood, MD), and were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS, Invitrogen).  SUM 149 cells were purchased from  75 Astrand (Ann Arbor, MI) and were grown in Ham’s F12 medium (Invitrogen) supplemented with 5 µg/mL insulin (Sigma Aldrich, St. Louis, MO), 1 µg/mL hydrocortisone (Sigma Aldrich), 10 mM pH 7.6 Hepes (Sigma Aldrich), and 5% fetal bovine serum (FBS).  SUM 149 cells are a heterogeneous basal-like breast cancer cell line that are maintained by a subpopulation of CD44+CD24-EpCAM+ cells3.  For all cell lines, the medium was changed twice a week, and cells were maintained in log-phase growth at 37ºC, 5% CO2.    Chromatin immunoprecipitation (ChIP) Cells were maintained in log-phase until 90% confluency was reached in a 15 cm tissue culture dish.  ChIP using a polyclonal chicken antibody to precipitate endogenous YB-1 was performed as previously described7.  Three primer sets were designed to flank seven putative YB-1 binding sites (ATTG) in the first two kilobases of the CD44 promoter, and similarly, two primer sets flanking eight putative YB-1 binding sites in the first two kilobases of the CD49f promoter were also designed.  The sequences, annealing positions, and optimized annealing temperatures (Ta) of the 4 sets of primer sequences were as follows: CD44 (a), -721 to -1067, Forward (F) – TGCGTTTGATTTCCAAACAT, Reverse (R) – TCCACCATCCTCTTCTCCAC, Ta = 57ºC; CD44 (b), -1645 to -2022, F – CCCCATACCTGTAACCTCATGT, R – CCAAACCCTATTATGGCTGCT, Ta = 59ºC; CD44 (c), -1657 to -1900, F – TCAAACACAATTTTGCTTTTAGTAATG, R – TGGCTGCTTCTTAGTTGTGTG, Ta = 59ºC; CD49f (a), -151 to -389, F – CCCACTTTCACACTGATGTTCT, R – ATTCCCCAAAGTGGCACTAA, Ta = 59ºC; CD49f (b), -615 to -863, F –  76 GAAGGGATAGCAAAGAAAAGAGG, R – TGAATGGCTAACCTCCATGT, Ta = 57ºC.  Immunofluorescence assay MDA-MB-231 and SUM 149 cells were seeded atop of glass cover slips in 6-well plate wells to achieve 70% confluence 24 hours later.  The next day, the glass slides were incubated with phosphate buffered saline (PBS) for 5 minutes, fixed with 2% formaldehyde for 20 minutes, and rinsed twice further with PBS.  The slides were then blocked with 2% goat serum in PBS and incubated with either rat anti-human and anti-mouse fluorescein isothiocyanate (FITC)-conjugated anti-CD49f antibody (1:25, Clone GoH3, #555735, BD Pharmingen), rat anti-human phycoerythrin (PE)-conjugated anti-CD44 antibody (1:100, Clone 515, #550989, BD Pharmingen), or unconjugated rabbit anti-human phospho-YB-1S102 antibody (P-YB-1S102, 1:100, Clone C34A2, #2900, Cell Signaling Technology) diluted in 1% bovine serum albumin (BSA) in phosphate buffer saline (PBS) for 1 hour at room temperature.  Unconjugated anti-P-YB-1S102 was followed by a PBS-diluted secondary anti-rabbit FITC antibody incubation (1:200, #711-096-152, Jackson ImmunoResearch Laboratories, Inc, West Grove, PA) for 1 hour at room temperature.  All slides were further washed three times with PBS, stained with Hoechst33342 (Sigma Aldrich) or 4',6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) at 1 µg/mL in PBS, and mounted with cover slips using ProLong Gold mounting medium (Molecular Probes, Invitrogen).  Slides were visualized using an Olympus BX61 Fluorescent Microscope and photographed using an Olympus DP71 digital camera (Olympus, Japan).  77 Fluorescence-activated cell sorting (FACS) and analysis Cells were harvested by scraping and digested with a dispase solution (Stem Cell Technologies, Vancouver, BC) and DNase (Sigma Aldrich) at 37ºC for 10 minutes.  Cells were then diluted into a 2% FBS PBS buffer and passed through a 40 µm cell strainer to achieve a single cell suspension.  Cells were subsequently stained with anti-CD44 conjugated to PE (BD Pharmingen, same as in drug screen).  7-aminoactinomycin D (7-AAD) viability dye (AnnexinV:PE Apoptosis Detection Kit I, BD Pharmingen) was added to a final 2% FBS PBS resuspension buffer.  Data acquisition was performed on a BD FACS Calibur using Cell Quest Pro software and further analyzed using FlowJo software.  For cell sorting, the top and bottom 10% of cells with the highest and lowest CD44-PE fluorescence were collected into 50% FBS PBS buffer and seeded subsequently into a 96-well plate for immunofluorescence staining or into growth assays.  In all cases, cell events that were negative for 7-AAD, with high forward and side light scatters were gated, and analyzed.  Mammosphere assay MDA-MB-231 and SUM 149 cells were made into a single cell suspension by enzymatic dissociation with dispase digestion and mechanical dissociation by repeated pipetting.  Cells were seeded at 5 × 103 and 2 × 104 per well into Ultra-Low Attachment coated 6-well culture plates (Corning, Lowell, MA) in a 1:1 DMEM/F12 (Invitrogen) basal media freshly supplemented with 20 ng/mL human basic fibroblast growth factor (bFGF, Invitrogen), 20 ng/mL epidermal growth factor (EGF, Invitrogen), 10 µg/mL heparin (Sigma Aldrich), 1:50 B27 supplement without Vitamin A (Sigma Aldrich).  Spheres  78 containing at least 15 cells were counted 7 days after seeding.  In the self-renewal serial passaging experiments, all cells from primary mammosphere cultures were collected, centrifuged at 350 g for 5 minutes and dissociated into a single cell suspension with 0.25% trypsin for 5 minutes at 37ºC and counted.  The single cells were then seeded into new cultures under the same conditions at 2 x 104 cells/well and the number of spheres present counted after another 7 days of incubation.    Soft agar anchorage-independent growth assay MDA-MB-231 and SUM 149 cells were mixed with 0.3% agar at densities of 5 × 103 and 1.5 × 104 cells/well, respectively, and placed on top of a preformed layer of 0.6% agar in a 24-well plate.  Agar solutions were made with the same media used for cell line propagation.  Colonies formed were counted between Day 21 and 28 post-seeding.  Small-interfering Rglyph817A (siRglyph817A) transfection  siRNAs were transfected into cells using the Lipofectamine RNAiMAX transfection reagent (Invitrogen) according to the manufacturer’s protocol.  Cells were seeded into a 6-well plate 24 hours before transfection at 3 × 105 cells/well for MDA-MB-231 and MDA-MB-468 cells, and 4 × 105 cells/well for SUM 149 cells.  For all experiments, 20 nM of either a scrambled control (AllStars Negative Control siRNA, #1207820, Qiagen, Hilden, Germany), YB-1 siRNA oligonucleotides #1 and #2 (custom designed as previously described12), YB-1 siRNA oligonucleotide #3 (Hs_YBX1_1_HP Validated siRNA, #SI03019191, Qiagen), CD44 siRNA (Hs_CD44_5_HP Validated siRNA, #SI00299705, Qiagen), and CD49f siRNA (Hs_ITGA6_6_HP Validated siRNA,  79 #SI02654078, Qiagen) were incubated with the cells for 96 hours before assessment of biochemical or biological effects.  Quantitative real-time PCR RNA isolation, cDNA synthesis, and real-time PCR experiments were performed as described13.  TaqMan Gene Expression Assays designed for CD44 (Hs00153304_m1, Applied Biosystems, Foster City, CA), CD49f (Hs00173952_m1, Applied Biosystems), and the human TATA-box binding protein (TBP) endogenous control (Part No. 4326322E, Applied Biosystems) were used.  Immunoblotting Log-phase growing cells were harvested by scraping, resuspended in Egg Lysis Buffer (ELB) and extracts used in immunoblotting analyses as described previously7.  Primary immunoblotting antibodies used were as follows: anti-total YB-1 (T-YB-1; 1:2000, #ab12148, Abcam, Cambridge, MA; 1:1000, #2749, Cell Signaling Technology, Danvers, MA; 1:2000, a polyclonal antibody designed against the C-terminus of YB-1, produced by and a generous gift from Dr. Colleen Nelson, University of British Columbia, Vancouver, BC), anti-P-YB-1S102 (1:1000, Clone C34A2, #2900, Cell Signaling Technology), anti-CD44 (1:500, Clone EPR1013Y, #ab51037, Abcam), anti-CD49f (1:1000, #3750, Cell Signaling Technology), anti-Flag (1:2000, Clone M2, #F3165, Sigma Aldrich), anti-total Akt (T-Akt; 1:1000, #9272, Cell Signaling Technology), anti-pan-Actin (1:1000, #4968, Cell Signaling Technology), and anti-vinculin (1:1000, Clone hVIN-1, #V9131, Sigma Aldrich).    80 Matrigel semi-fluid basement membrane growth assay Matrigel basement membrane (BD Biosciences) were added at 40 µL per well in a 96-well plate and incubated briefly at 37ºC for the gel to solidify.  MDA-MB-231 and SUM 149 cells in single cell suspension were added in their respective media at 2 x 103 and 5 x 103 cells/well.  Growth was assessed in photographed fields 7 days after seeding.  Dglyph817A plasmid transfection In a 6-well plate format, 2 or 4 µg of a Flag:EV, Flag:YB-1WT, or Flag:YB-1S102D plasmid construct as described previously17, 21 were transfected into cells at 80 to 90% confluence with 5 or 10 µL of Lipofectamine 2000 (Invitrogen) respectively as specified by the recommended manufacturer’s protocol.  Transfection reagent and DNA complexes were replaced with fresh media 5 hours post-transfection, and cells were harvested 96 hours post-transfection.        Stable transfectant cell lines Stable EV, shYB-1, Flag:EV, Flag:YB-1WT, and Flag:YB-1S102D cell lines were established by transfecting 4 µg of DNA constructs with 10 µL of Lipofectamine 2000 into cells in a 6-well plate, and expanding the transfectant cell lines to a 80% confluence in a 10 cm tissue culture dish.  Then, 400 µg/mL of G418 (Calbiochem, EMD Chemicals, San Diego, CA) was introduced to the culture media and replaced every 3 to 4 days.  Cells were continually split at low density to allow for optimal selection of transfectants with acquired G418 resistance.   81 YB-1 transgenic mouse and mammary gland sectioning YB-1 transgenic (Tg 2 line) and wild-type (WT) mice were revived from cryopreserved embryos generated previously9.  YB-1 transgenic mice have previously been shown to develop hyperplastic nodules in the mammary glands by 6-8 months of age followed by the appearance of diverse breast carcinomas in all mice by 52 weeks9.  For our study, histological sections were obtained from the mammary glands of 6 to 8-month old female mice post-lactation after two cycles of mating and nursing.  The mice were mated twice and nursed their pups for 3 weeks each time.  They were euthanized at the end of their second lactation (day 20 to 22 after the birth of the pups) and mammary gland tissues were then collected.  The mammary glands were dipped into Tissue-Tek O.C.T. Compound (Sakura Finetek USA, Torrance, CA), frozen, and kept at -80ºC.  OCT-embedded tissues were sectioned (6 µM) using a Cryostat and placed on Fisherbrand Superfrost Plus glass slides (Thermo Fisher Scientific, Waltham, MA) and kept at -80ºC.  The sections were defrosted at room temperature and incubated with phosphate-buffered saline (PBS) for 5 minutes, fixed with 2% formaldehyde for 20 minutes, rinsed twice with PBS.  Subsequent immunofluorescence staining and imaging protocol was performed as described above.  The only exception was the primary purified rat anti-mouse CD44 antibody (1:100, Clone IM7, #550538, BD Pharmingen), and the CD44 slides were stained with a secondary anti-rat Alexa 546 antibody (Molecular Probes, Invitrogen) diluted in 1% BSA PBS for 1 hour at room temperature.     82 Anti-cancer drug screen and further evaluation of Paclitaxel treatment SUM 149 cells were seeded onto collagen-coated 96-well plates at 5000 cells/well.  An initial screen was conducted using commonly employed chemotherapeutic agents at a fixed concentration of 10 µM and cell viability was assessed using Hoechst33342 (Sigma Aldrich) staining 72-hour later.  The cells were also stained with anti-CD44 conjugated to PE (1:5, Clone G44-26, #555479, BD Pharmingen).  Plates were read on a Cellomics ArrayScan instrument (Cellomics, Pittsburgh, PA).  Following the screen, we questioned whether lower, more physiologically relevant doses of Paclitaxel would have a reproducible effect on CD44 induction.  Thus, SUM 149 cells were treated in monolayer with 10 nM of Paclitaxel dissolved in DMSO (Paclitaxel, Sigma Aldrich) for 24 hours and harvested for immunoblotting.  MDA-MB-231 Flag:EV and Flag:YB-1WT cells were treated in monolayer or in the mammosphere assay in the presence of 0 nM or 10 nM of Paclitaxel with DMSO as vehicle control for 7 days.  Cells grown in monolayer had the media changed at Day 4 and cells were harvested for immunoblotting on Day 7.    Statistical Analysis All quantitative data are represented as mean ± standard error of the mean (s.e.m.) of 3 independent experiments.  P-values were generated using the paired Student’s T-test where * denotes p <0.05, ** denotes p <0.01, and *** denotes p <0.001.  83 3.3 RESULTS  YB-1 binds to upstream regulatory regions of the genes encoding CD44 and CD49f, and regulates their expression   Several putative YB-1 binding sites were identified 2 kilobases upstream of the transcriptional start site of the CD44 and CD49f genes initially identified in a ChIP-on-Chip screen13 (Figure 3.1A, upper panel).  To validate these results, we performed conventional ChIP analyses and provide direct evidence of the ability of YB-1 to bind to the promoters of both genes in two human breast cancer cell lines (MDA-MB-468 and SUM 149, Figure 3.1A, lower panel).  To investigate whether YB-1 plays a role in controlling CD44 and CD49f expression in these cells, we first asked whether the expression of CD44 would fluctuate concordantly with changes in P-YB-1S102.  Immunohistochemical analysis of SUM 149 cells grown either in monolayer cultures or as xenografts illustrated coincident staining of P-YB-1S102 and CD44 protein in individual cells (Figure 3.1B).  Quantification of this association of CD44 expression with the presence of P-YB-1S102 was demonstrated by isolating the highest and lowest 10% of CD44-expressing viable cells by FACS sorting and co-staining with CD44 and P-YB-1S102 antibody.  There, we observed a >2-fold difference in P-YB-1S102 levels between the subsets expressing the highest and lowest levels of CD44 (Figure 3.1C, upper panels), corresponding to enhanced growth in mammosphere cultures and soft agar (Figure 3.1C, lower panels).    We next asked whether YB-1 is a determining regulator of CD44 and CD49f expression in breast cancer cells by assessing the immediate effect of knocking down YB-1  84 expression in MDA-MB-231 and SUM 149 cells using three separate siRNA oligonucleotides designed to target YB-1 transcripts specifically.  The result was a consistent and significant decrease in both transcript and protein levels of CD44 and CD49f (Figure 3.2A and 3.2B, respectively).  To obtain stable inhibition of YB-1 expression, SUM 149 cells were transfected with anti YB-1 shRNAs.  This produced sustained decreases in CD44 and CD49f transcript and protein levels as compared to control cells transfected with an empty vector (EV, Figure 3.2C).  Stable knockdown of YB-1 transcripts also resulted in a decreased expression of CD104 (β4 integrin), a beta chain partner of CD49f (Figures 3.2B and 3.2C).    Conversely, when we forced a transient elevation in the expression of either Flag:YB-1WT or a constitutively active Flag:YB-1S102D, increases in both CD44 and CD49f transcript levels were obtained in both cases, with the largest increases resulting from the constitutively active YB-1 construct (Figure 3.3A).  A similar result was seen when these constructs were stably expressed in the same cells (Figure 3.3B and data not shown).  Importantly, we confirmed that a heightened expression of CD44 and CD49f was concomitantly induced in the same transfected YB-1-overexpressing cells (Figure 3.3C).    To determine whether elevated YB-1 expression would have a similar effect on the expression of CD44 and CD49f in primary mammary epithelial cells in vivo, we evaluated the mammary glands of 6 to 8-month old YB-1 transgenic mice (9).  The mammary cells in these transgenic mice expressed markedly higher levels of CD49f and CD44 protein (Figure 3.3D and Supplementary Figure 3.1A) as compared to mammary  85 cells from wild-type animals (n=4/group).  The increased expression of CD49f in the YB-1 transgenic mice was further validated with a second antibody (Supplementary Figure 3.1B).  The specificity of the CD44 antibody staining was confirmed by the lack of staining obtained on B6/129 CD44-/- mouse kidney cells (Supplementary Figure 3.2).  Interestingly, we also noted that the cells in the mammary glands from the YB-1 transgenic mice were hyperplastic and displayed atypical nuclei by comparison to those in the wild-type controls (Figure 3.3D).  Taken together, these findings indicate that YB-1 regulates the expression of CD44 and CD49f both in human transformed mammary cells in vitro and in primary mouse mammary cells generated in vivo.  YB-1-regulated expression of CD44 and CD49f controls the anchorage-independent growth of transformed breast cells We have previously demonstrated that YB-1 is essential for cancer cells to grow in soft agar assays in vitro10, 14, 15 and for tumourigenesis in vivo15.  To test whether the ability of YB-1 to regulate CD44 and/or CD49f expression was important for this altered growth activity, we next examined the effect of treating MDA-MB-231 cells with anti-CD44 and anti-CD49f siRNAs on mammosphere formation (Figure 3.4A).  SiRNAs directed against transcripts for YB-1 as well as CD44 and CD49f all inhibited primary mammosphere formation by >50%.  Conversely, forced increased expression of Flag:YB-1WT or Flag:YB-1S102D increased the yield of mammospheres by 2 and 8-fold, respectively (Figure 3.4B).  Moreover, this effect was inhibited if the Flag:YB-1S102D expressing cells were treated with either CD44 or CD49f siRNAs (Figure 3.4B).  The ability of the siRNA treatments to induce specific decreases in CD44 and CD49f protein expression in these  86 experiments was confirmed by immunoblotting (Figure 3.4B).  Further, this effect is perpetuated over time through passaging as SUM 149 cells transduced to obtain stable high expression of either Flag:YB-1WT or Flag:YB-1S102D also produced a higher number of cells in mammospheres in secondary non-adherent cultures than control cells transduced with an empty vector plasmid (Flag:EV) (Figure 3.4B).  Consistent with the mammosphere assays, analogous experiments with siRNA-treated MDA-MB-231 and SUM 149 cells, showed both CD44 and CD49f to be required for the clonal anchorage-independent growth of both of these cell lines in soft agar (Figure 3.4C).  Conversely, forced expression of Flag:YB-1S102D increased the ability of transfected cells to grow in soft agar and this was again blocked when the expression of either CD44 or CD49f was silenced (Figure 3.4C).  The ability of MDA-MB-231 cells to proliferate and form extensive structures in Matrigel cultures was also inhibited when the cells were pre-treated with CD44 or CD49f or YB-1 siRNAs (Figure 3.4D).  These findings demonstrate a critical role of YB-1 in enabling breast cancer cells to grow in 3-dimensional assays that is dependent on the downstream up-regulation of CD44 and CD49f.   Paclitaxel-treated SUM 149 cells show increased expression of YB-1 and CD44 The preceding findings suggested that the increased expression of YB-1 associated with breast cancer relapse in patients might be due to a selection of cells showing an increased expression of CD44.  To investigate this possibility, we first screened a panel of commonly used anti-cancer drugs (all at 10 µM) for their ability to kill SUM 149 cells in vitro in parallel with an assessment of the proportion of CD44High cells present 72 hours later.  All compounds killed >80% of the input cells and the percentage of CD44High cells  87 amongst the survivors was consistently higher than in the control treatment cells (Table 3.1).  The most marked effect in this regard was obtained with paclitaxel treatment which produced an almost 10-fold increase in the proportion of viable CD44High cells (Table 3.1).  Next, we determined that paclitaxel at a much lower and more clinically relevant concentration of 10 nM was able to increase YB-1 binding to the CD44 promoter after 48 hrs (Figure 3.5A).  Consistent with this, exposing the cells to paclitaxel (10 nM) for 48 hours induced P-YB-1S102 which correlated with activation of the RSK pathway (Figure 3.5A).  To further confirm RSK activation, a second substrate, P-GSKβS9 was detected (Figure 3.5A).  The induction of this pathway then led to increased CD44 after 72 hours (Figure 3.5B).  When Flag:YB-1WT was stably expressed in MDA-MB-231 cells (pooled clones) there was a further increase in CD44 expression after 10 nM paclitaxel treatment (Figure 3.5C).  We also noted that following paclitaxel treatment, there was a greater amount of Flag:YB-1WT detected per cell on the whole and this is thought to be because the drug positively selected for cells with more YB-1 because it provides a significant protective advantage.  Finally, the Flag:YB-1WT-transfected MDA-MB-231 cells formed more mammospheres in the presence of paclitaxel (10 nM) as compared to control transduced cells (Figure 3.5D).    88 3.4 DISCUSSIOglyph1197  Here we present evidence that YB-1 utilizes CD44 and CD49f to promote self-renewal, mammosphere growth and colony formation in soft agar.  In addition we demonstrate that these downstream mediators play an important role in controlling resistance of breast cancer cells to conventional chemotherapeutic agents.  CD44 is a widely recognized marker of many cells with cancer-initiating5, 18-20 and, in some cases, metastatic activity21-23.  Furthermore, both CD44 and CD49f are selectively expressed on normal stem cells in the breast and other tissues24-27.  However, little is known about their regulation in breast cancer or the role they play in this disease.  YB-1 is the first oncogene identified which induces both CD44 and CD49f.  It is foreseeable that it induces other genes associated with cancer stem cells as well.  We evaluated of over 4,000 cases of primary invasive breast cancer and reported that elevated YB-1 expression in the primary tumour is consistently associated with high rates of recurrence6.  However, the role of YB-1 in causing relapses and its mechanism of action remains unclear.  One possibility is that the regulation of CD44 and CD49f by YB-1 is a feature of normal mammary epithelial cells that is retained by or reactivated in cells that acquire cancer-propagating activity.  An alternative, but not mutually exclusive, possibility is that YB-1 expression and/or activation is the result of a preceding oncogenic event.  This may then lead to a perturbation of its effects on CD44 and CD49f regulation as part of a broader program of epithelial-mesenchymal transition (EMT) characteristic of many advanced carcinomas.  Snail, Twist and TGFβ are all examples of EMT-inducing factors8, 28.  Transfection of immortalized human mammary epithelial  89 cells or transformed mammary cells with all of these resulted in the expression of higher levels of CD44, enhanced ability to form mammospheres in liquid suspension cultures, colonies in soft agar, and tumours in vivo29.  Here we provide new and direct evidence that these altered biological properties are regulated by YB-1 expression through its ability to control expression of requisite levels of CD44 and CD49f.  The fact that YB-1 has been reported to be regulated by Twist30, 31, implicates YB-1 activation as the mechanism by which CD44 is up-regulated in Twist-induced EMT.    Novel mechanisms to suppress the growth of cancers have emerged from the idea that they are propagated by a small subset of cells that are innately less drug sensitive than the bulk of the tumour.  YB-1 expression has already been reported to be associated with chemoresistance16, 17 perhaps through the regulation of MDR-1.  Here we show that treatment of a breast cancer cell line with Paclitaxel (and other chemotherapeutic drugs commonly used to treat invasive breast cancer) selects for cells expressing high levels of CD44 and that this is enhanced in stably YB-1-transfected cells.  These findings are consistent with previous reports showing that YB-1 is found in the nucleus of tumour cells taken from breast cancer patients treated with Paclitaxel and that the drug stimulates the nuclear translocation of YB-1 in breast cancer cells in vitro32.  Together, this supports previous claims that activated YB-1 is a relevant target to overcome multi-drug resistance.    YB-1 is also a direct target of Akt10 and RSK11, and hence these pathways are also likely to have roles in mediating drug resistance mechanisms involving both MDR-1 and CD44.   90 Our lab and others have reported the role of YB-1 in the responsiveness of cancer cells to Gefitinib14, Paclitaxel16, and an experimental therapeutic, OSU-0301233.  Here we demonstrated that YB-1 overexpressed in the murine mammary gland was able to increase the number of cells expressing high levels of CD44 and CD49f, suggesting that the molecular relationships between YB-1/CD44/CD49f and their biological outcomes are well conserved between human and mouse.  Thus, in the future, YB-1 transgenic mice may be extremely useful to assess potential agents that have the ability to suppress the transforming properties mediated by increased expression of CD44 and CD49f.  We conclude that YB-1 inhibition may be a new approach to eliminating tumour-initiating cells and by extension possibly cancer recurrence.  91 3.5 FIGURES Aglyph1197D TABLES    Figure 3.1.  YB-1 binds to the promoters of CD44 as well as CD49f and expression of CD44  correlates with the presence of P-YB-1S102.  A. Schematic diagrams of the human CD44 and CD49f promoters displaying putative YB-1 binding sites, an inverted CAAT box, ATTG, and the amplification regions of ChIP primers used (upper panel).  Representative ethidium bromide-stained agarose gel pictures of PCR reactions amplifying DNA templates from ChIP experiments in MDA-MB-468 and SUM 149 cells (lower panel).  DNA templates were pulled down with either a YB-1 or non-immune IgY antibody, and amplified using primers flanking regions of the human CD44 or CD49f promoters.  Input designates isolated DNA from input cross-linked DNA/protein complexes that were used for the immuno-precipitations.  B. SUM 149 cells in monolayer in vitro (upper panels) and in fixed tumour xenograft (lower panels) preparations stained with antibodies against P-YB-1S102 (FITC, green) and CD44 (PE, red) and then with DAPI to identify all nuclei.    92   C. Analysis of subsets of SUM 149 cells isolated by FACS according to their expression of CD44.  The highest and lowest 10% of CD44-expressing viable (7AAD-) cells were collected and mean fluorescence intensities determined for the staining of CD44 (PE, red) and P-YB-1S102 (FITC, green) in both subsets.  The abilities of the same isolates to generate mammospheres in non-adherent cultures (7 days) and soft agar (28 days) were also assayed.    93   Figure 3.2.  Silencing YB-1 down-regulates the expression of CD44 and CD49f.  A-B. Quantitative real-time PCR and immunoblotting results of MDA-MB-231 and SUM 149 cells harvested after 96-hour treatment with 20 nM of either a control or one of 3 unique YB-1 siRNA oligonucleotides.  Data shows altered YB-1, CD44, and CD49f mRNA transcripts and protein levels.  T-YB-1 denotes total YB-1 protein.  Actin served as loading control.  C. CD44 and CD49f expression analyses of an established SUM 149 shYB-1 cell line and its empty vector (EV) counterpart using quantitative real-time PCR, FACS, and immunoblotting techniques.  Single cell suspensions of EV and shYB-1 lines were stained with a CD44-PE antibody for FACS.  FACS analyses are represented in a dot plot and a histogram.  CD104 (β4 integrin), the partnering β chain for CD49f (α6 integrin), was also probed in the same preparations.  Actin served as loading control.     94   Figure 3.3.  YB-1 overexpression induces CD44 and CD49f expression.  A. Transient, incremental exogenous Flag:YB-1WT and Flag:YB-1S102D expression in MDA-MB-231, MDA-MB-468, and SUM 149 cells was achieved via transfection of 2 and 4 µg of plasmid, visualized by immunoblotting with a Flag antibody, and affected CD44 and CD49f transcript levels measured by quantitative real-time PCR experiments.  Vinculin served as loading control.  B. MDA-MB-231 cells stably expressing Flag:EV, Flag:YB-1WT, Flag:YB-1S102D were analyzed for long term Flag, CD44, and CD49f expression by immunoblotting.  Actin served as loading control.  C. CD44 and CD49f protein expression was induced by Flag:YB-1S102D in SUM 149 cells. 95    D. BGL-YB-1/HA and WT counterpart mammary glands were collected from 6 to 8-month old female mice post-lactation after two cycles of mating and nursing, frozen in O.C.T. compound, and sectioned.  Slides were stained with primary CD49f-FITC (green) or unconjugated CD44 with secondary Alexa 546 fluor antibody (red) and DAPI.  Representative images of cells from 4 mice are shown.  Insets show enlarged photographs of the CD44 and CD49f membrane-localized staining.  The number of CD44+ cells per field was counted.     96  Figure 3.4.  CD44 and CD49f are essential for breast cancer cell growth in 3-dimensional in vitro assays.  A. MDA-MB-231 (and SUM 149 cells, data not shown) were incubated with 20 nM of CD44 and CD49f siRNA oligonucleotides for 96 hours and their respective transcript expression levels were monitored.  The ability of MDA-MB-231 cells to form mammospheres was challenged by knocking down CD44, CD49f, and YB-1 individually with their corresponding siRNA oligonucleotides at 20 nM for 96 hours prior to seeding into the assay.      97  B. Stable G418-selected lines of MDA-MB-231 and SUM 149 cells expressing Flag:EV, Flag:YB-1WT, Flag:YB-1S102D were assayed for their abilities to form mammospheres.  The Flag:YB-1S102D lines of both cell lines were first subjected to 96-hour treatment of 20 nM of CD44 and CD49f siRNA gene knockdowns and their mammosphere-forming abilities quantified.  Gene overexpression and subsequent knockdowns in the stable YB-1-overexpressing lines were confirmed by immunoblotting for CD44 and CD49f as shown.  Actin served as loading control.  Further, SUM 149 Flag:EV, Flag:YB-1WT, Flag:YB-1S102D cells were placed in mammosphere cultures.  After 7 days, the spheres were dissociated into single cells, counted and the calculated yield of cells obtained after 7 days in secondary non-adherent cultures.   98     C. The functional roles of both receptors in anchorage-independent growth were analyzed in a soft agar assay by single CD44 or CD49f gene knockdowns (20 nM for 96 hours).  MDA-MB-231 Flag:EV, Flag:YB-1WT, Flag:YB-1S102D cells, as well as Flag:YB-1S102D cells treated with Control, CD44 or CD49f siRNAs (20 nM for 96 hours), were examined for their ability to form colonies in soft agar subsequent to the gene knockdowns.  D. MDA-MB-231 cell growth in Matrigel was challenged by pre-treating the cells with 20 nM of YB-1, CD44, and CD49f siRNA oligonucleotides for 96 hours.  Photographs were taken on Day 7 of the assay post-seeding into Matrigel.     99  Class Drug % of viable CD44+ cells % of viable CD44+ cells normalized to control treatment % of viable cells normalized to control treatment  Control 8.0 100.0 100.0 Anticancer Daunorubicin hydrochloride 30.0 375.0 1.7 Anticancer Azacytidine-5 30.3 378.1 18.0 Anticancer Etoposide 35.0 437.8 19.2 Anticancer Nocodazole 59.6 744.4 10.3 Anticancer Doxorubicin hydrochloride 78.9 986.3 6.3 Anticancer Paclitaxel 82.0 1025.3 5.3      Table 3.1.  Treatment of SUM 149 cells with chemotherapeutic agents enriches for a CD44High subset.  A. A panel of cancer chemotherapeutic agents was screened against SUM 149, a heterogeneous CD44-expressing cell line for 72 hours at 10 µM.  Cell viability and CD44 expression were monitored.  Cells were stained with CD44-PE antibody and Hoechst33342 and compared to DMSO vehicle control. 100    Figure 3.5.  Paclitaxel treatment preferentially selects for breast cancer cells with elevated P-YB-1S102 expression.  A. Treatment of SUM 149 cells with paclitaxel for 48 hours increased YB-1 binding to the CD44 promoter based on ChIP.  The same cells were harvested for immunoblotting to detect P-RSKS221/S227, P-YB-1S102, total YB-1, and P-GSK3βS9.  Vinculin served as loading control.  B. SUM 149 cells were treated with 10 nM paclitaxel for 72 hours to examine CD44 levels.  C. In MDA-MB-231 cells, where empty vector (EV) and YB-1 expression vectors were stably overexpressed, cells were treated with 10 nM paclitaxel for 7 days and harvested for immunoblotting to assess CD44, exogenous Flag:YB-1, and endogenous total YB-1 levels.  Endogenous total YB-1 served as loading control.  D. MDA-MB-231 EV and YB-1-overexpressing cells were grown in mammosphere cultures in the presence of DMSO or 10 nM paclitaxel for 7 days.  Bar graph represents the percent of spheres obtained in the paclitaxel treated cultures as compared to DMSO for each cell type.      101 3.6 SUPPLEMEglyph1197TARY MATERIALS Aglyph1197D METHODS  Immunofluorescence  A second CD49f antibody, unconjugated anti-CD49f (1:200, #3750, Cell Signaling Technology, same as immunoblotting), was used for validation of the YB-1 transgenic mouse mammary gland staining results.  Immunohistochemistry  B6/129 WT and CD44-/- mice were previously described and supplied by Dr. Pauline Johnson35.  For immunohistochemical analysis, kidney samples excised from wild type and mutant mice were fixed with 10% buffered formalin and embedded in paraffin.  Sections (5 µm thick) were cut and mounted on Fisherbrand Superfrost Plus glass slides (Thermo Fisher Scientific, Waltham, MA).  After routine deparaffinization and rehydration through gradient ethanol immersions, the slides were steam-heated for 10 minutes for antigen retrieval.  Endogenous peroxidase activity was quenched using 3% (v/v) H2O2 followed by three 5 minute washes in PBS containing 0.2% (v/v) Triton X-100.  The sections were blocked with 10% (v/v) normal goat serum in PBS.  Specimens were incubated for 1 hour with purified rat anti-mouse CD44 antibody (1:100, Clone IM7, #550538, BD Pharmingen) diluted in PBS containing 0.3% (v/v) Triton X-100 and 0.1% (w/v) bovine serum albumin.  Signal detection was performed using Dako LSAB 2 System-HRP (Dako, Glostrup, Denmark) according to manufacturer protocol.  Specimens were counterstained with haematoxylin for 30 seconds and washed with tap water.  The sections were then mounted with Glycergel Mounting Medium (Dako) and cover slips.  Slides were visualized using an Olympus BX61 Fluorescent Microscope and photographed using an Olympus DP71 digital camera (Olympus, Japan).   102 3.7 SUPPLEMEglyph1197TARY FIGURES      Supplemental Figure 3.1.  Targeted induction of YB-1 in the mammary gland leads to elevations in CD49f.  A-B. BGL-YB-1/HA and the WT counterpart mammary glands were collected from 6 to 8-month old female mice post-lactation after two cycles of mating and nursing, frozen in O.C.T. compound, and sectioned.  Slides were stained with primary CD49f-FITC (green) or unconjugated CD49f with secondary Alexa 546 fluor antibody (red) and DAPI.  Staining for 4 sets of WT and transgenic mice are shown in Supplemental Figure 3.1A.   103   104     Supplemental Figure 3.2.  Validation of purified rat anti-mouse CD44 antibody.  B6/129 WT and CD44-/- mouse kidneys were sectioned and stained with CD44 and visualized by immunohistochemistry techniques.  CD44-/- knockout mice were characterized previously35.     105 REFEREglyph1197CES   1. Phillips TM, McBride WH, Pajonk F. The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. J glyph817atl Cancer Inst. 2006;98:1777-1785. 2. Godar S, Ince TA, Bell GW, et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell. 2008;134:62-73. 3. Fillmore CM, Kuperwasser C. Human breast cancer cell lines contain stem-like cells with the capacity to self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res. 2008;10:R25. 4. Li X, Lewis MT, Huang J, et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J glyph817atl Cancer Inst. 2008;100:672-679. 5. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc glyph817atl Acad Sci U S A. 2003;100:3983-3988. 6. Habibi G, Leung S, Law JH, et al. Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res. 2008;10:R86. 7. Wu J, Lee C, Yokom D, et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res. 2006;66:4872-4879. 8. Evdokimova V, Tognon C, Ng T, et al. Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell. 2009;15:402-415. 9. Bergmann S, Royer-Pokora B, Fietze E, et al. YB-1 provokes breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res. 2005;65:4078-4087. 10. Sutherland BW, Kucab J, Wu J, et al. Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene. 2005;24:4281-4292. 11. Stratford AL, Fry CJ, Desilets C, et al. Y-box binding protein-1 serine 102 is a downstream target of p90 ribosomal S6 kinase in basal-like breast cancer cells. Breast Cancer Res. 2008;10:R99. 12. Astanehe A, Finkbeiner MR, Hojabrpour P, et al. The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene. 2009. 13. Finkbeiner MR, Astanehe A, To K, et al. Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene. 2009;28:1421-1431. 14. Stratford AL, Habibi G, Astanehe A, et al. Epidermal growth factor receptor (EGFR) is transcriptionally induced by the Y-box binding protein-1 (YB-1) and can be inhibited with iressa in basal-like breast cancer, providing a potential target for therapy. Breast Cancer Res. 2007;9:R61. 15. Lee C, Dhillon J, Wang MY, et al. Targeting YB-1 in HER-2 overexpressing breast cancer cells induces apoptosis via the mTOR/STAT3 pathway and suppresses tumor growth in mice. Cancer Res. 2008;68:8661-8666.  106 16. Bargou RC, Jurchott K, Wagener C, et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. glyph817at Med. 1997;3:447-450. 17. Chatterjee M, Rancso C, Stuhmer T, et al. The Y-box binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood. 2008;111:3714-3722. 18. Takaishi S, Okumura T, Tu S, et al. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem Cells. 2009;27:1006-1020. 19. Li H, Chen X, Calhoun-Davis T, Claypool K, Tang DG. PC3 human prostate carcinoma cell holoclones contain self-renewing tumor-initiating cells. Cancer Res. 2008;68:1820-1825. 20. Li F, Tiede B, Massague J, Kang Y. Beyond tumorigenesis: Cancer stem cells in metastasis. Cell Res. 2007;17:3-14. 21. Dalerba P, Clarke MF. Cancer stem cells and tumor metastasis: First steps into uncharted territory. Cell Stem Cell. 2007;1:241-242. 22. Klingbeil P, Marhaba R, Jung T, Kirmse R, Ludwig T, Zoller M. CD44 variant isoforms promote metastasis formation by a tumor cell-matrix cross-talk that supports adhesion and apoptosis resistance. Mol Cancer Res. 2009;7:168-179. 23. Stingl J, Eirew P, Ricketson I, et al. Purification and unique properties of mammary epithelial stem cells. glyph817ature. 2006;439:993-997. 24. Raouf A, Zhao Y, To K, et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell. 2008;3:109-118. 25. Eirew P, Stingl J, Raouf A, et al. A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. glyph817at Med. 2008;14:1384-1389. 26. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell. glyph817ature. 2008;456:804-808. 27. Moody SE, Perez D, Pan TC, et al. The transcriptional repressor snail promotes mammary tumor recurrence. Cancer Cell. 2005;8:197-209. 28. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704-715. 29. Shiota M, Izumi H, Onitsuka T, et al. Twist promotes tumor cell growth through YB-1 expression. Cancer Res. 2008;68:98-105. 30. Shiota M, Izumi H, Onitsuka T, et al. Twist and p53 reciprocally regulate target genes via direct interaction. Oncogene. 2008. 31. Fujita T, Ito K, Izumi H, et al. Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res. 2005;11:8837-8844. 32. Marangoni E, Lecomte N, Durand L, et al. CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer. 2009;100:918-922. 33. To K, Zhao Y, Jiang H, et al. The phosphoinositide-dependent kinase-1 inhibitor 2-amino-N-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phen yl]-acetamide (OSU-03012) prevents Y-box binding protein-1 from inducing epidermal growth factor receptor. Mol Pharmacol. 2007;72:641-652. 34. Khan AI, Kerfoot SM, Heit B, et al. Role of CD44 and hyaluronan in neutrophil recruitment. J Immunol. 2004;173:7594-7601.  107 CHAPTER FOUR :  DISCUSSIOglyph1197 Aglyph1197D FUTURE DIRECTIOglyph1197S   4.1 COglyph1197TRIBUTIOglyph1197S Aglyph1197D SIGglyph1197IFICAglyph1197CE Basal cells in the mammary gland directly interact and cooperate with components of the extracellular matrix through the expression of cell surface membrane receptors.  The breast epithelium is surrounded by a very stromal-enriched environment, with which it mutually exchanges information and materials.  It is conceivable that as membrane receptors relay extracellular signals into the cell, cell fates and decisions in normal, cancer, or transition tissues, undifferentiated or specialized, depend on the functional status of these cell surface proteins.  The bulk of this work primarily investigates the contributions of transcription/translation factor YB-1 to the orchestration of these receptors on aptly located basal breast cancer cells.  The first chapter of this thesis relates YB-1 to MET, which we report also for the first time as both a novel basal cancer cell interaction and a normal progenitor cell interaction.  There we also narrate the importance of MET in basal breast cancer cell growth.  Coupled to these findings are our other data showing that YB-1 putatively binds to the promoters of stem cell associated genes (including CD44 and CD49f) in breast cancer cells.  This work importantly relates YB-1 directly to a primitive cell population in the normal mammary gland whereas it has only previously been detected in cancer tissues, implying a role in normal development that may contribution to perturbation in breast cancers.  The third chapter of this thesis validates the idea that YB-1 maintains the expression of CD44 and CD49f, two known basal cell markers.  This work is a description of a novel interaction showing the induction of the two genes important to normal breast development by an oncogene in vitro and in vivo, in both a human and mouse model.  Further, we reveal for the first time  108 the heterogeneous expression of phosphorylated YB-1 and downstream gene CD44 in a breast cancer cell line and their association to distinct phenotypes.  Next, we correlated YB-1, CD44, and CD49f, expression with the ability for cells to grow in non-adherent mammosphere cultures long term in vitro, a property of tumour-initiating cells in patients.  Finally, the roles of CD44 and CD49f in cell growth and CD44 in drug resistance in basal breast cancer cells were also investigated.  Here we have presented evidence that a single transcription factor YB-1 can regulate a panel of proteins that all individually mediate a tumourigenic phenotype in breast cancer tissues that could potentially be related to primitive cell properties.  Together, this thesis provides a detailed possible mechanism by which YB-1 is associated to poor prognosis and recurrence.  4.2 IMPLICATIOglyph1197S Aglyph1197D FUTURE DIRECTIOglyph1197S  YB-1 regulates partnering signal transducing receptors We have shown that YB-1 individually induces CD44, CD49f, and MET.  Previous reports by our group has also shown YB-1 inducing EGFR and Her-2 receptors in breast cancer cells1.  While we have demonstrated that breast cancer cells are dependent on each surface receptor for growth irrespective of the other receptors, there is substantial evidence that these receptors do not act alone.  In our work, while it was not surprising that the expressions of CD49f (α6 integrin) and its β chain partner, CD104 (β4 integrin), were associated, we noticed that CD44 and CD49f expression were also at least partially dependent on one another.  For example, when we incubated cells with CD44 siRNA, decline in CD49f expression was seen, and conversely, CD44 was down-regulated with CD49f siRNA treatment.  Moreover, by overexpressing YB-1 in our cell line models, we  109 noticed that CD44 and CD49f induction frequently occurred in the same cells, further suggesting an associated expression mechanism.  Relatedly, a CD44 variant and α4β1 have been shown to interact in chronic leukemic B cells2.  In the literature, CD44 has been shown to directly interact and cooperatively signal with EGFR in melanoma cells3, as well as, Her-2 in ovarian tumour cells4.  Additionally, MET forms heterodimers with CD445, 6, and EGFR7 in breast cancer cell models.  And finally, the α6β4 integrin (as well as the α3β1 and α2β1 integrins) have also been reported to cross-talk with EGFR8, Her-29-12, and MET13.  In addition to cooperative signaling, these receptors also compensate for the loss of their partners where it has been shown that inhibition of more than one of these surface proteins had an additive effect on managing cancer cell growth.  For example, both CD44 and CD49f are reported to activate the focal adhesion kinase (FAK)3, 14, 15 and possibly the integrin-linked kinase (ILK)16, thus perhaps the cross-talk between the two receptors contributes to the regulation of this activation and consequently downstream pathways leading to an invasive phenotype.  Interestingly, in the work presented in this thesis, upon overexpression of a constitutively activated mutant of YB-1 (YB-1S102D), where we’ve previously shown that other YB-1 downstream genes are all up-regulated, including EGFR1, Her-21, PIK3CA17, and MET18, singly knocking down individual CD44 and CD49f was able to abrogate the enhanced cell growth significantly.  While we do not know the expression status of the other YB-1 downstream genes, it is possible that the expressions of the said surface proteins are all co-dependent at least partially.  It remains to be determined whether this is a cancer cell model or basal-like breast cancer subtype dependent effect, or whether targeting the other genes alone would also achieve the same level of growth inhibition.  Taken together, we  110 hypothesize that YB-1-regulated important cancer growth receptors EGFR, Her-2, MET, CD44, and CD49f are coordinated to seamlessly form interchangeable signaling partners depending on the presentation of extracellular signals, allowing for the adapting nature of aggressive cancer cells.  Therefore, cancer cell growth is likely manageable by using a combination of inhibitory agents against these receptors.  The challenge of course lies in the heterogeneity within and between tumours and the fluidity of the unstable genome.  Perhaps transcription factors like YB-1 which direct the expression of many such genes unique to cancers would be a good therapeutic target.  p53/CD44 interactions and basal phenotype Robert Weinberg’s group recently reported that p53 regulates CD4419.  They demonstrated that CD44 mediates tumour growth and Doxorubicin-resistance in transformed breast cells, supporting our findings.  Further, they show that p53 directly negatively regulates CD44 by binding to a promoter region within 500 bp of the promoter region in our experiments.  As p53 and YB-1 have been reported to directly interact to modulate gene expression20, the presence of two opposing transcription factors at the CD44 promoter is intriguing.  In our studies, we have focused on triple-negative breast cancer cell lines, which primarily reside in the basal-like breast cancer subtype classification of breast cancer21-23.  As p53 mutation is frequent in this subtype23, 24, it appears then that the absence of wild-type p53 allows for YB-1 to transactivate CD44, suggesting a mechanism by which CD44 is not only mediating a possible primitive phenotype but also associated with the basal-like subtype.  In fact, the MDA-MB-231 and SUM 149 cell lines both harbour p53 mutations25, 26.  Another possibility is that YB-1  111 prevents the binding of wild-type p53 to its downstream gene promoters, as it has been reported that YB-1 reduced the transactivation of p21 by p5320, suggesting that YB-1 overexpression in cancers likely affects wild-type p53 function.    Other mechanisms of MET, CD44, and CD49f regulation Besides our report of YB-1 and MET, the latter has been shown to be regulated by the ETS1 transcription factor27, a regulator of basal-like breast cancer poor prognosis marker alphaB-crystallin28, further associating MET to a basal phenotype.  In addition to the report of p53 negatively regulating CD44, there is one other publication that shows the transcriptional induction of mouse CD44 by IGF-1 and EGF29.  As IGF-1 and EGF are activators of the Akt and MAPK pathway, both of which phosphorylate YB-1, this mechanism implicates YB-1’s role in the up-regulation of mouse CD44 expression, complementing our findings in the mouse in vivo model.  To our knowledge, we are the first to show the transcriptional activation of CD44 by an oncogene and the regulation of CD49f by any transcription factor.  While we focus on the transcriptional role of YB-1, it also translationally regulates many genes in cancer cells30, 30, 31.  In fact, it has been reported that CD44 mRNA is also bound more frequently by ribosomes with the overexpression of YB-131.  Thus, while CD44, CD49f , MET, expression appears to be sensitive to YB-1 levels in the basal breast cancer cell models in our work, it remains to be seen whether YB-1 has other co-factors with which it interacts or other mechanisms like epigenetics also have a role.  Finally, because YB-1 activation by phosphorylation is essential to its function as a transcription factor, manipulating upstream kinases Akt or  112 RSK, could also be an important avenue to regulating the roles of YB-1 in promoting MET, CD44, and CD49f.  Cancer stem cells As an important extension, we also wish to propose a working hypothesis that YB-1 putatively manages a protein expression profile that resembles that of a cell of a more primitive origin in normal development, and thus YB-1 also has a putative role in normal stem cells.  Tumours have now been demonstrated to be heterogeneous populations that are driven by cells with properties traditionally characterizing stem cells.  In addition to this, using mouse models of tumour initiation and progression, many reports also suggest that the clonal origin of cancers lie in a normal stem/progenitor cell or a cell that has accumulated enough mutations to acquire properties of those cells.  Therefore, it has become more apparent in recent years that tumour-initiating cells though perhaps with an unstable genome could still bare resemblance to the genotypic and phenotypic composition of its precursor cell.  Very recently, we reported that YB-1 expression was detected in purified populations of normal human mammary progenitor cells18, and it was positively correlated to that of MET in those cells.  YB-1 expression in primitive progenitor cell subsets in the mammary gland has also been verified by another group32.  Importantly, this suggests that our studies of YB-1’s roles in cancer cells were also found in normal primitive subsets.  Further, MET, CD44, CD49f, and EGFR, have all been directly detected on isolated stem cells.  Taking into consideration our previous and current reports of YB-1 in normal and cancerous breast cells, we hypothesize that YB-1 governs an undifferentiated cell state, which includes cells that co-express EGFR, MET,  113 CD44 and CD49f, on their cell surface, with said receptors cooperatively signaling in the cell3, 6, 33.  This cell population then putatively offers a mechanism for and translates into our findings of YB-1’s correlation to poor prognosis and disease recurrence.  It would be intriguing to determine whether YB-1 or phospho-YB-1S102 is expressed and assume a functional role in the CD44+/CD24-/EpCAM+ cell populations of breast cancer patients.  In addition, as an extension, detecting YB-1 protein in purified primary mammary stem/progenitor populations upon isolation and through the differentiation process would be very interesting.    YB-1, EMT, and the stem cell-associated phenotype We evaluated of over 4,000 cases of primary invasive breast cancer and reported that elevated YB-1 expression in the primary tumour is consistently associated with high rates of recurrence34.  However, the role of YB-1 in causing relapses and its mechanism of action remains unclear.  One possibility is that the regulation of CD44 and CD49f by YB-1 is a feature of normal mammary epithelial cells that is retained by or reactivated in cells that acquire cancer-propagating activity.  An alternative, but not mutually exclusive, possibility is that YB-1 expression and/or activation is the result of a preceding oncogenic event.  This may then lead to a perturbation of its effects on CD44 and CD49f regulation as part of a broader program of epithelial-mesenchymal transition (EMT) characteristic of many advanced carcinomas.  Snail, Twist and TGFβ are all examples of EMT-inducing factors31, 35, 35.  Transfection of immortalized human mammary epithelial cells or transformed mammary cells with all of these resulted in the expression of higher levels of CD44, enhanced ability to form mammospheres in liquid suspension cultures,  114 colonies in soft agar, and tumours in vivo36.  Here we provide new and direct evidence that these altered biological properties are regulated by YB-1 expression through its ability to control expression of requisite levels of CD44 and CD49f.  The fact that YB-1 has been reported to be regulated by Twist37, 38, implicates YB-1 activation as the mechanism by which CD44 is up-regulated in Twist-induced EMT.  Finally, as HGF is capable of inducing EMT39, YB-1-regulated MET may also be an important player in this phenomenon of breast carcinoma progression.  Using cell line models of tumour cell heterogeneity In primary tumours, there exists a subpopulation of cells that have the capacity for self-renewal over time to maintain the tumour cell mass.  In breast tumour, these have been identified to exhibit a CD44+/CD24-/EpCAM+ surface profile40.  These cells have been demonstrated to be able to form non-adherent spheres in vitro41, to be resistant to current chemotherapies41, to survive radiation therapy42, and to form tumours in immuno-compromised mice in low numbers at injection40.  While cell lines are traditionally clonal in origin and are treated as a bulk homogeneous population, there is accumulating evidence that cell lines are propagated in vitro as a heterogeneous population with a subpopulation that have distinct stem-like properties43, 44.  In our work, we demonstrate that in the SUM 149 cells, there is a CD44High population that are resistant to chemotherapies, can form more and larger mammospheres, soft agar colonies, and Matrigel growths in vitro than the CD44Low population.  We have also shown that phospho-YB-1S102 is higher in that CD44High population, suggesting there are cell subsets with distinct signaling features within a cell line, like a tumour.  Paclitaxel has been  115 shown to cause the nuclear localization of YB-145, and thus allowing it to up-regulate P-glycoprotein45, MDR-146, and CD44.  Perhaps YB-1 mediates its drug resistance phenotype through CD44, as its expression has been linked to chemo-resistance and specifically paclitaxel14, 47.  Cell lines are artificial in nature as they have often been cultured in a simulated environment for much longer than the lifespan of a tumour.  They have accumulated many more mutations than in a human cancer, and their likeliness to tumour heterogeneity still needs further elucidation.  Still, they offer an alternative model to the scarcity and limited in vitro longevity of primary tumour samples.            Animal model implications As the cancer research field faces the emergence and acceptance of the cancer stem cell model, it will be important to see if patients will benefit from the development of novel therapeutics for new targets in these TICs.  As we demonstrated that YB-1 induced in the murine mammary gland was also able to overexpress downstream CD44 and CD49f, this proposes that the relationship between YB-1/CD44/CD49f could be conserved between human and mouse.  As CD49f have been used as markers for human and mouse mammary stem cells48-50, the TICs in both models may also retain similar surface marker profiles to their normal precursors.  In the future, the YB-1 transgenic mice could be used to assess potential agents that have the ability to suppress the CD44+/CD49f+ TICs.    Global applications Though we have focused on breast cancer cells of the basal-like subtype, which express higher levels of CD44 and CD49f, YB-1 overexpression in breast cancer is not subtype- 116 specific.  It also regulates EGFR, Her-2, MET, and PIK3CA, all key players of breast cancer progression which have been implicated in stem cell and cancer stem cell populations33, 51-55.  Furthermore, YB-1, a downstream gene product of c-Myc and p7356, has been associated with poor prognosis in cancers of the prostate57, colon58, blood59, lung60, skin61, ovarian62, 63, and brain64 as well as drug resistance globally37, 45, 46, 59, 61, 65-72.  Thus its function in cancers is not tissue specific, implicating its putative mechanistic role in mediating a poorly differentiated cell population or tumourigenic phenotype could be globally validated.   Clinical and therapeutic implications As YB-1 is overexpressed in 40% of all breast cancer patients and is associated to poor prognosis and disease recurrence34, there is an obvious need to better understand the mechanisms of this transcription/translation factor.  Here we show a mechanism by which YB-1 regulates cell membrane receptors that are all individually and synergistically important for the growth of carcinoma cells.  Importantly, we offer a new concept whereby with sufficient validation and further studies, YB-1 could be a target in cancer stem cells, which are traditionally resistant to chemotherapies.  We had found a dramatic difference between the YB-1 transcript levels in cancer cells and normal progenitor cells, offering an opportunistic therapeutic window.      4.3 LIMITATIOglyph1197S OF STUDIES Improvements that could be made to the described studies include:  • Verifying YB-1’s regulatory relationships in primary human breast cancer cell samples.  This may require transient immortalization of these cells using lentiviral  117 delivery of the YB-1 expression plasmids and shYB-1 expression plasmids for gene overexpression and knockdown experiments respectively.    • Constructing CD44 and CD49f promoter reporter plasmids to verify the transactivating role of YB-1 using luciferase assays.  • Repeating our experiments in the human breast cancer models with mouse mammary cancer models to determine if the relationship is conserved across species.  This could include further investigating the mammary cells from the YB-1 transgenic mice, constructing a conditional knockout YB-1 transgenic mouse, and/or the use of mouse mammary cancer cell lines derived from various transgenic mice.    • Characterizing the in vivo YB-1 transgenic mouse mammary gland cells further by dissociating the YB-1 transgenic mammary glands to analyze activated signaling pathways.  Further injecting at limiting dilutions the YB-1 transgenic mammary epithelial cells along with the wild-type counterparts into cleared mammary fat pads of immuno-compromised mice to assess tumourigenic potential of individual tumour-initiating cell populations.   • Passaging the mammospheres after YB-1, CD44, and CD49f knockdown may have addressed the stem cell-like capacities of the cancer cells in question.  Although the gene knockdown of the surviving cells would be questionable, lentiviral delivery of shRNA expression plasmids could circumvent that problem.    • Tracking YB-1 translocation into the nucleus of SUM 149 cells with paclitaxel treatment could be accomplished with a fluorescently-tagged YB-1 protein and real-time fluorescent microscope monitoring.  • Determining an enrichment of chemotherapy-resistant tumourigenic population by injecting paclitaxel-resistant SUM 149 cells into mice along side DMSO-resistant SUM 149 cells   • Validating the effects of another chemotherapy agent on SUM 149 cells other than paclitaxel.    118 4.4 COglyph1197CLUDIglyph1197G REMARKS We have accumulated a body of evidence to suggest that YB-1 is an oncogene that could be mediating a tumourigenic phenotype to breast cancers by overexpressing genes that are also shared by normal primitive cell populations for propagation and survival.  We nominate YB-1 as a good target for cancer therapy.  119 REFEREglyph1197CES  1. Wu J, Lee C, Yokom D, et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res. 2006;66:4872-4879. 2. Redondo-Munoz J, Ugarte-Berzal E, Garcia-Marco JA, et al. Alpha4beta1 integrin and 190-kDa CD44v constitute a cell surface docking complex for gelatinase B/MMP-9 in chronic leukemic but not in normal B cells. Blood. 2008;112:169-178. 3. Kim Y, Lee YS, Choe J, Lee H, Kim YM, Jeoung D. CD44-epidermal growth factor receptor interaction mediates hyaluronic acid-promoted cell motility by activating protein kinase C signaling involving akt, Rac1, phox, reactive oxygen species, focal adhesion kinase, and MMP-2. J Biol Chem. 2008;283:22513-22528. 4. Xu FJ, Stack S, Boyer C, et al. Heregulin and agonistic anti-p185(c-erbB2) antibodies inhibit proliferation but increase invasiveness of breast cancer cells that overexpress p185(c-erbB2): Increased invasiveness may contribute to poor prognosis. Clin Cancer Res. 1997;3:1629-1634. 5. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 is required for two consecutive steps in HGF/c-met signaling. Genes Dev. 2002;16:3074-3086. 6. Matzke A, Sargsyan V, Holtmann B, et al. Haploinsufficiency of c-met in cd44-/- mice identifies a collaboration of CD44 and c-met in vivo. Mol Cell Biol. 2007;27:8797-8806. 7. Guo A, Villen J, Kornhauser J, et al. Signaling networks assembled by oncogenic EGFR and c-met. Proc glyph817atl Acad Sci U S A. 2008;105:692-697. 8. Gilcrease MZ, Zhou X, Lu X, Woodward WA, Hall BE, Morrissey PJ. Alpha6beta4 integrin crosslinking induces EGFR clustering and promotes EGF-mediated rho activation in breast cancer. J Exp Clin Cancer Res. 2009;28:67. 9. Hintermann E, Yang N, O'Sullivan D, Higgins JM, Quaranta V. Integrin alpha6beta4-erbB2 complex inhibits haptotaxis by up-regulating E-cadherin cell-cell junctions in keratinocytes. J Biol Chem. 2005;280:8004-8015. 10. Yoon SO, Shin S, Lipscomb EA. A novel mechanism for integrin-mediated ras activation in breast carcinoma cells: The alpha6beta4 integrin regulates ErbB2 translation and transactivates epidermal growth factor receptor/ErbB2 signaling. Cancer Res. 2006;66:2732-2739. 11. Falcioni R, Antonini A, Nistico P, et al. Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp Cell Res. 1997;236:76-85. 12. Gambaletta D, Marchetti A, Benedetti L, Mercurio AM, Sacchi A, Falcioni R. Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J Biol Chem. 2000;275:10604-10610. 13. Trusolino L, Bertotti A, Comoglio PM. A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell. 2001;107:643-654. 14. Fujita Y, Kitagawa M, Nakamura S, et al. CD44 signaling through focal adhesion kinase and its anti-apoptotic effect. FEBS Lett. 2002;528:101-108. 15. Nakayamada S, Okada Y, Saito K, Tamura M, Tanaka Y. Beta1 integrin/focal adhesion kinase-mediated signaling induces intercellular adhesion molecule 1 and receptor activator of nuclear factor kappaB ligand on osteoblasts and osteoclast maturation. J Biol Chem. 2003;278:45368-45374.  120 16. Guo W, Giancotti FG. Integrin signalling during tumour progression. glyph817at Rev Mol Cell Biol. 2004;5:816-826. 17. Astanehe A, Finkbeiner MR, Hojabrpour P, et al. The transcriptional induction of PIK3CA in tumor cells is dependent on the oncoprotein Y-box binding protein-1. Oncogene. 2009. 18. Finkbeiner MR, Astanehe A, To K, et al. Profiling YB-1 target genes uncovers a new mechanism for MET receptor regulation in normal and malignant human mammary cells. Oncogene. 2009;28:1421-1431. 19. Godar S, Ince TA, Bell GW, et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell. 2008;134:62-73. 20. Okamoto T, Izumi H, Imamura T, et al. Direct interaction of p53 with the Y-box binding protein, YB-1: A mechanism for regulation of human gene expression. Oncogene. 2000;19:6194-6202. 21. Rakha EA, Tan DS, Foulkes WD, et al. Are triple-negative tumours and basal-like breast cancer synonymous? Breast Cancer Res. 2007;9:404; author reply 405. 22. Voduc D, Nielsen TO. Basal and triple-negative breast cancers: Impact on clinical decision-making and novel therapeutic options. Clin Breast Cancer. 2008;8 Suppl 4:S171-8. 23. Rakha EA, Reis-Filho JS, Ellis IO. Basal-like breast cancer: A critical review. J Clin Oncol. 2008;26:2568-2581. 24. Manie E, Vincent-Salomon A, Lehmann-Che J, et al. High frequency of TP53 mutation in BRCA1 and sporadic basal-like carcinomas but not in BRCA1 luminal breast tumors. Cancer Res. 2009;69:663-671. 25. Neve RM, Chin K, Fridlyand J, et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell. 2006;10:515-527. 26. Chin K, DeVries S, Fridlyand J, et al. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies. Cancer Cell. 2006;10:529-541. 27. Gambarotta G, Boccaccio C, Giordano S, Ando M, Stella MC, Comoglio PM. Ets up-regulates MET transcription. Oncogene. 1996;13:1911-1917. 28. Bosman JD, Yehiely F, Evans JR, Cryns VL. Regulation of alphaB-crystallin gene expression by the transcription factor Ets1 in breast cancer. Breast Cancer Res Treat. 2009. 29. Hebbard L, Steffen A, Zawadzki V, et al. CD44 expression and regulation during mammary gland development and function. J Cell Sci. 2000;113 ( Pt 14):2619-2630. 30. Evdokimova V, Ovchinnikov LP, Sorensen PH. Y-box binding protein 1: Providing a new angle on translational regulation. Cell Cycle. 2006;5:1143-1147. 31. Evdokimova V, Tognon C, Ng T, et al. Translational activation of snail1 and other developmentally regulated transcription factors by YB-1 promotes an epithelial-mesenchymal transition. Cancer Cell. 2009;15:402-415. 32. Bloushtain-Qimron N, Yao J, Snyder EL, et al. Cell type-specific DNA methylation patterns in the human breast. Proc glyph817atl Acad Sci U S A. 2008;105:14076-14081. 33. Boccaccio C, Comoglio PM. Invasive growth: A MET-driven genetic programme for cancer and stem cells. glyph817at Rev Cancer. 2006;6:637-645. 34. Habibi G, Leung S, Law JH, et al. Redefining prognostic factors for breast cancer: YB-1 is a stronger predictor of relapse and disease-specific survival than estrogen receptor or HER-2 across all tumor subtypes. Breast Cancer Res. 2008;10:R86.  121 35. Moody SE, Perez D, Pan TC, et al. The transcriptional repressor snail promotes mammary tumor recurrence. Cancer Cell. 2005;8:197-209. 36. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704-715. 37. Shiota M, Izumi H, Onitsuka T, et al. Twist promotes tumor cell growth through YB-1 expression. Cancer Res. 2008;68:98-105. 38. Shiota M, Izumi H, Onitsuka T, et al. Twist and p53 reciprocally regulate target genes via direct interaction. Oncogene. 2008. 39. Savagner P, Yamada KM, Thiery JP. The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol. 1997;137:1403-1419. 40. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc glyph817atl Acad Sci U S A. 2003;100:3983-3988. 41. Li X, Lewis MT, Huang J, et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J glyph817atl Cancer Inst. 2008;100:672-679. 42. Phillips TM, McBride WH, Pajonk F. The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. J glyph817atl Cancer Inst. 2006;98:1777-1785. 43. Fillmore CM, Kuperwasser C. Human breast cancer cell lines contain stem-like cells with the capacity to self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res. 2008;10:R25. 44. Cariati M, Naderi A, Brown JP, et al. Alpha-6 integrin is necessary for the tumourigenicity of a stem cell-like subpopulation within the MCF7 breast cancer cell line. Int J Cancer. 2008;122:298-304. 45. Fujita T, Ito K, Izumi H, et al. Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res. 2005;11:8837-8844. 46. Bargou RC, Jurchott K, Wagener C, et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. glyph817at Med. 1997;3:447-450. 47. Marangoni E, Lecomte N, Durand L, et al. CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer. 2009;100:918-922. 48. Raouf A, Zhao Y, To K, et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell. 2008;3:109-118. 49. Eirew P, Stingl J, Raouf A, et al. A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. glyph817at Med. 2008;14:1384-1389. 50. Stingl J, Eirew P, Ricketson I, et al. Purification and unique properties of mammary epithelial stem cells. glyph817ature. 2006;439:993-997. 51. Asselin-Labat ML, Shackleton M, Stingl J, et al. Steroid hormone receptor status of mouse mammary stem cells. J glyph817atl Cancer Inst. 2006;98:1011-1014. 52. Korkaya H, Paulson A, Iovino F, Wicha MS. HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion. Oncogene. 2008;27:6120-6130.  122 53. Bleau AM, Hambardzumyan D, Ozawa T, et al. PTEN/PI3K/Akt pathway regulates the side population phenotype and ABCG2 activity in glioma tumor stem-like cells. Cell Stem Cell. 2009;4:226-235. 54. Eyler CE, Foo WC, LaFiura KM, McLendon RE, Hjelmeland AB, Rich JN. Brain cancer stem cells display preferential sensitivity to akt inhibition. Stem Cells. 2008;26:3027-3036. 55. Yilmaz OH, Morrison SJ. The PI-3kinase pathway in hematopoietic stem cells and leukemia-initiating cells: A mechanistic difference between normal and cancer stem cells. Blood Cells Mol Dis. 2008. 56. Uramoto H, Izumi H, Ise T, et al. p73 interacts with c-myc to regulate Y-box-binding protein-1 expression. J Biol Chem. 2002;277:31694-31702. 57. Gimenez-Bonafe P, Fedoruk MN, Whitmore TG, et al. YB-1 is upregulated during prostate cancer tumor progression and increases P-glycoprotein activity. Prostate. 2004;59:337-349. 58. Shibao K, Takano H, Nakayama Y, et al. Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer. 1999;83:732-737. 59. Chatterjee M, Rancso C, Stuhmer T, et al. The Y-box binding protein YB-1 is associated with progressive disease and mediates survival and drug resistance in multiple myeloma. Blood. 2008;111:3714-3722. 60. Gessner C, Woischwill C, Schumacher A, et al. Nuclear YB-1 expression as a negative prognostic marker in nonsmall cell lung cancer. Eur Respir J. 2004;23:14-19. 61. Schittek B, Psenner K, Sauer B, Meier F, Iftner T, Garbe C. The increased expression of Y box-binding protein 1 in melanoma stimulates proliferation and tumor invasion, antagonizes apoptosis and enhances chemoresistance. Int J Cancer. 2007;120:2110-2118. 62. Basaki Y, Hosoi F, Oda Y, et al. Akt-dependent nuclear localization of Y-box-binding protein 1 in acquisition of malignant characteristics by human ovarian cancer cells. Oncogene. 2007;26:2736-2746. 63. Huang X, Ushijima K, Komai K, et al. Co-expression of Y box-binding protein-1 and P-glycoprotein as a prognostic marker for survival in epithelial ovarian cancer. Gynecol Oncol. 2004;93:287-291. 64. Faury D, Nantel A, Dunn SE, et al. Molecular profiling identifies prognostic subgroups of pediatric glioblastoma and shows increased YB-1 expression in tumors. J Clin Oncol. 2007;25:1196-1208. 65. Kuwano M, Uchiumi T, Hayakawa H, et al. The basic and clinical implications of ABC transporters, Y-box-binding protein-1 (YB-1) and angiogenesis-related factors in human malignancies. Cancer Sci. 2003;94:9-14. 66. Oda Y, Kohashi K, Yamamoto H, et al. Different expression profiles of Y-box-binding protein-1 and multidrug resistance-associated proteins between alveolar and embryonal rhabdomyosarcoma. Cancer Sci. 2008;99:726-732. 67. Oda Y, Ohishi Y, Basaki Y, et al. Prognostic implications of the nuclear localization of Y-box-binding protein-1 and CXCR4 expression in ovarian cancer: Their correlation with activated akt, LRP/MVP and P-glycoprotein expression. Cancer Sci. 2007;98:1020-1026.  123 68. Shibahara K, Uchiumi T, Fukuda T, et al. Targeted disruption of one allele of the Y-box binding protein-1 (YB-1) gene in mouse embryonic stem cells and increased sensitivity to cisplatin and mitomycin C. Cancer Sci. 2004;95:348-353. 69. Oda Y, Ohishi Y, Saito T, et al. Nuclear expression of Y-box-binding protein-1 correlates with P-glycoprotein and topoisomerase II alpha expression, and with poor prognosis in synovial sarcoma. J Pathol. 2003;199:251-258. 70. Saji H, Toi M, Saji S, Koike M, Kohno K, Kuwano M. Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human breast carcinoma. Cancer Lett. 2003;190:191-197. 71. Yahata H, Kobayashi H, Kamura T, et al. Increased nuclear localization of transcription factor YB-1 in acquired cisplatin-resistant ovarian cancer. J Cancer Res Clin Oncol. 2002;128:621-626. 72. Oda Y, Sakamoto A, Shinohara N, et al. Nuclear expression of YB-1 protein correlates with P-glycoprotein expression in human osteosarcoma. Clin Cancer Res. 1998;4:2273-2277.  

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 18 0
China 9 1
Germany 6 20
Netherlands 5 30
Canada 5 0
Brazil 3 0
Republic of Korea 1 0
Iran 1 0
Israel 1 0
City Views Downloads
Unknown 22 51
Shenzhen 5 0
Berlin 4 0
Seattle 3 0
Ashburn 3 0
Wilmington 2 0
Mountain View 2 0
Houston 2 0
San Diego 1 0
Worcester 1 0
Waterloo 1 0
Atlanta 1 0
Sunnyvale 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067723/manifest

Comment

Related Items