Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Tumor-specific targeting using oncolytic herpes simplex virus type 1 for prostate cancer treatment Lee, Cleo Yi-Fang 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_lee_cleo.pdf [ 1.9MB ]
Metadata
JSON: 24-1.0067706.json
JSON-LD: 24-1.0067706-ld.json
RDF/XML (Pretty): 24-1.0067706-rdf.xml
RDF/JSON: 24-1.0067706-rdf.json
Turtle: 24-1.0067706-turtle.txt
N-Triples: 24-1.0067706-rdf-ntriples.txt
Original Record: 24-1.0067706-source.json
Full Text
24-1.0067706-fulltext.txt
Citation
24-1.0067706.ris

Full Text

TUMOR-SPECIFIC TARGETING USING ONCOLYTIC HERPES SIMPLEX VIRUS TYPE 1 FOR PROSTATE CANCER TREATMENT  by  CLEO YI-FANG LEE  B.Sc. Honors, The University of British Columbia, 2003  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)  September 2009  © Cleo Yi-Fang Lee, 2009  ABSTRACT Prostate cancer is the most common non-skin cancer, and the second leading cause of cancer-death in men. Current treatments, including androgen withdrawal therapy, are not curative for advanced metastatic disease and new treatment strategies are urgently required. In this regard, oncolytic virotherapy offers a promising new approach. This project aims to provide a proof-of-principle that an oncolytic herpes simplex virus type-1 (HSV-1) virus can be engineered to replicate in a tissue- and tumor-specific fashion through both transcriptional and translational regulation of an essential viral gene. Using the amplicon/helper system, we first generated a prostate-specific amplicon virus by inserting the ARR2PB promoter in front of the ICP4 gene, and two tumor-specific amplicon viruses by incorporating multiple copies of miR-143 or miR-145 complementary target sequences in the 3’ untranslated region (3’UTR) of ICP4. Finally, we generated two prostate tumor-specific recombinant viruses using the bacterial artificial chromosome and the recombineering method. Our results showed that an amplicon system containing a prostate-specific promoter upstream of an essential viral gene can complement a helper virus for lytic replication specifically within prostate tumor cells. We also showed both in vitro and in vivo that viral replication and cell killing occurred only in tumor cells with abundant eIF4E protein or low levels of miR-143/miR-145 when viral gene expression was controlled by a modified 5’UTR or 3’UTR, respectively. Nude mice bearing LNCaP tumors treated with local or systemic injections of these tumor-specific viruses had a >85% reduction in tumor size at day 28 post-viral injection and without extensive toxicity to normal tissues. Quantitative real-time PCR analysis also showed that the majority of the virus was detected in the tumor mass and not within normal tissues. In conclusion, the incorporation of a tissue-specific promoter or a tumor-specific element in an oncolytic HSV-1 virus is a viable strategy to restrict viral replication and oncolysis selectively to tumor cells while sparing normal tissues. This work provides a basis for the development of novel oncolytic HSV-1 viruses for local and systemic treatment of locally advanced and metastatic prostate cancer.  ii  TABLE OF CONTENTS Abstract ........................................................................................................................ ii Table of Contents........................................................................................................ iii List of Tables.............................................................................................................. vii List of Figures ........................................................................................................... viii Acknowledgements ..................................................................................................... x Dedication ................................................................................................................... xi Co-Authorship Statement ......................................................................................... xii  1  Introduction ............................................................................................................ 1 1.1 Prostate cancer .................................................................................................. 1 1.1.1 Epidemiology of prostate cancer.................................................................. 1 1.1.2 Screening and diagnosis.............................................................................. 2 1.1.3 Prevention.................................................................................................... 3 1.1.4 Treatment..................................................................................................... 5 1.1.5 Androgen receptor ....................................................................................... 7 1.2 Herpes simplex virus type 1 ............................................................................... 7 1.3 Oncolytic virotherapy. ......................................................................................... 8 1.3.1 Deletion mutants .......................................................................................... 9 1.3.2 Altering viral tropism .................................................................................. 11 1.3.3 Transcriptional targeting............................................................................. 11 1.3.4 Combination therapies ............................................................................... 13 1.4 MicroRNAs ....................................................................................................... 14 1.4.1 Discovery ................................................................................................... 14 1.4.2 Biogenesis and function............................................................................. 14 1.4.3 MicroRNA and cancer ................................................................................ 15 1.4.4 MicroRNA expression in prostate cancer ................................................... 17 1.4.5 MicroRNA-mediated targeting.................................................................... 18 1.5 Eukaryotic translation initiation factor 4E.......................................................... 19 1.5.1 Function ..................................................................................................... 19 1.5.2 eIF4E and cancer ...................................................................................... 19 1.5.3 Translational targeting by 5’UTR................................................................ 20 1.6 Summary .......................................................................................................... 21 iii  1.7 References ....................................................................................................... 27  2  An HSV-1 amplicon system for prostate-specific expression of ICP4 to  complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells ................................................................................................. 47 2.1 Introduction....................................................................................................... 47 2.2 Materials and methods ..................................................................................... 49 2.2.1 Plasmid preparation ................................................................................... 49 2.2.2 Cell culture conditions................................................................................ 49 2.2.3 Viral preparation......................................................................................... 50 2.2.4 Viral infection ............................................................................................. 50 2.2.5 Cell viability assay ..................................................................................... 51 2.2.6 LNCaP xenograft experiments ................................................................... 51 2.2.7 DNA, RNA isolation and RT-PCR............................................................... 52 2.2.8 Histochemical staining ............................................................................... 52 2.3 Results ............................................................................................................. 53 2.3.1 Prostate-specific expression of ICP4 complements the replication of HSV-1 ICP4¯ helper virus in LNCaP prostate cancer cells in vitro............. 53 2.3.2 ARR2PB-ICP4 amplicon virus with helper virus showed substantial cell kill of the LNCaP cancer cells grown in vitro ................................................... 54 2.3.3 ARR2PB-ICP4 amplicon/helper virus inhibits growth of LNCaP tumor xenografts .................................................................................................. 55 2.3.4 Distribution of the ARR2PB-ICP4 amplicon/helper virus in tumor bearing mice ........................................................................................................... 56 2.4 Discussion ........................................................................................................ 56 2.5 References ....................................................................................................... 67  3  MicroRNA regulation of oncolytic herpes simplex virus type 1 for selective  killing of prostate cancer cells ................................................................................. 71 3.1 Introduction....................................................................................................... 71 3.2 Materials and methods ..................................................................................... 73 3.2.1 Plasmid constructs..................................................................................... 73 3.2.2 Cell cultures ............................................................................................... 73 iv  3.2.3 Viruses....................................................................................................... 73 3.2.4 Transfection of precursor miRNA and viral infection .................................. 74 3.2.5 Western blotting ......................................................................................... 74 3.2.6 DNA, RNA extraction and RT-PCR ............................................................ 75 3.2.7 LNCaP xenograft mouse model ................................................................. 76 3.2.8 Histochemical staining ............................................................................... 76 3.2.9 Statistical analysis...................................................................................... 76 3.3 Results ............................................................................................................. 77 3.3.1 MiR-143 and miR-145 are downregulated in LNCaP cells, but highly expressed in normal mouse prostates ....................................................... 77 3.3.2 Regulation of ICP4 gene expression through inclusion of miR-143 and miR-145 target sequences in the 3’UTR .................................................... 77 3.3.3 MiR-143 and miR-145 inhibit replication of miRNA-regulated amplicon viruses in a dose-dependant manner......................................................... 78 3.3.4 MiRNA-regulated amplicon viruses can selectively suppress LNCaP tumor growth ........................................................................................................ 79 3.3.5 MiR-143 and miR-145 protect normal tissues from miRNA-regulated oncolytic viral infections ............................................................................. 80 3.4 Discussion ........................................................................................................ 80 3.5 References ....................................................................................................... 93  4  Local and systemic delivery of an oncolytic herpes simplex virus type 1 with  transcriptional and translational dual regulation for prostate cancer targeting .. 97 4.1 Introduction....................................................................................................... 97 4.2 Materials and methods ..................................................................................... 99 4.2.1 Construction of recombinant virus ............................................................. 99 4.2.2 Cell culture................................................................................................. 99 4.2.3 Western blotting ....................................................................................... 100 4.2.4 DNA, RNA extraction and RT-PCR .......................................................... 100 4.2.5 Virus growth assays................................................................................. 101 4.2.6 LNCaP xenograft mouse model ............................................................... 101 4.2.7 Statistical analysis.................................................................................... 101 4.3 Results ........................................................................................................... 102 v  4.3.1 eIF4E is overexpressed in prostate cancer cells...................................... 102 4.3.2 ICP27 expression is regulated at both transcriptional and translational level by the ARR2PB promoter and 5’UTR, respectively .......................... 102 4.3.3 Replication of AU27 virus is androgen/AR-regulated and tumor-specific . 103 4.3.4 Local administration of AU27 virus reduced tumor size and prolonged survival in vivo ......................................................................................... 104 4.3.5 Systemic administration of AU27 virus resulted in tumor-specific targeting and killing................................................................................................. 105 4.4 Discussion ...................................................................................................... 106 4.5 References ..................................................................................................... 115  5  Conclusions and future directions ................................................................... 119 5.1 Transcriptional targeting using tissue-specific promoters ............................... 119 5.2 MicroRNA-mediated translational targeting .................................................... 120 5.3 EIF4E-regulated translational targeting .......................................................... 123 5.4 Conclusions.................................................................................................... 126 5.5 References ..................................................................................................... 128  Appendix A............................................................................................................... 131 A.1 Supplementary materials and methods ........................................................ 131 A.1.1 GCV treatment in LNCaP xenograft model ............................................ 131 A.1.2 Generation of stable LNCaP-143 and LNCaP-145 cell lines ................. 131 A.1.3 Cell viability assay ................................................................................. 132 A.1.4 Amplicon plasmid constructs ................................................................. 132 A.1.5 LNCaP-Luciferase xenograft mouse model ........................................... 132 A.2 References................................................................................................... 133  Appendix B............................................................................................................... 134 B.1 Supplementary data ..................................................................................... 134  Appendix C............................................................................................................... 143 C.1 Biohazard approval certificate...................................................................... 143 C.2 UBC animal care certificate.......................................................................... 144 vi  LIST OF TABLES  Chapter 2 Table 2.1 Relative copy number of the ICP0 gene per μg of total cellular DNA as an index for the amount of virus present within normal tissues and LNCaP tumors.......................................................................................................... 66  vii  LIST OF FIGURES  Chapter 1 Figure 1.1 A schematic diagram of the theory behind oncolytic virotherapy for cancer treatment.................................................................................................... 22 Figure 1.2 The biogenesis of microRNAs .................................................................... 23 Figure 1.3 The role of microRNAs as oncogenes or tumor suppressors ..................... 24 Figure 1.4 Selective destruction of tumor cells by microRNA-mediated oncolytic HSV-1 ........................................................................................................ 25 Figure 1.5 Selective destruction of tumor cells by eIF4E-mediated oncolytic HSV-1 ... 26  Chapter 2 Figure 2.1 Structure of the two amplicon plasmids used in these studies.................... 60 Figure 2.2 Prostate-specific expression of ICP4 complements the replication of the ICP4- helper virus in LNCaP cancer cells in an androgen-responsive and amplicon-dependent manner ..................................................................... 61 Figure 2.3 CMV-ICP4 and ARR2PB-ICP4 amplicon/helper viruses showed substantial cell killing of the LNCaP tumor cells in vitro ............................. 62 Figure 2.4 Efficient tumor growth suppression by intratumoral injections of amplicons and helper virus using the LNCaP xenograft model.................. 63 Figure 2.5 Prostate-specific targeting of the ARR2PB-ICP4 amplicon/helper virus in vivo ............................................................................................................ 65  Chapter 3 Figure 3.1 Structure of the three amplicon plasmids used to package replicationcompetent amplicon viruses ...................................................................... 84 Figure 3.2 MiR-143 and miR-145 expression levels in cell lines and mouse tissues ... 85 Figure 3.3 MiR-143 and miR-145 inhibit ICP4 expression at a translational level by targeting the 3’UTR in the amplicons ......................................................... 86 Figure 3.4 MiR-143 and miR-145 suppress amplicon viral replication in LNCaP cells............................................................................................................ 87 Figure 3.5 MiRNA-regulated amplicon viruses suppress prostate tumor growth in a human xenograft mouse model ................................................................. 89 viii  Figure 3.6 MiRNA-regulated amplicon viruses specifically target tumor cells in vivo... 91  Chapter 4 Figure 4.1 Schematic diagrams showing the construction of the recombinant viruses ARR2PB-ICP27 and ARR2PB-5’UTR-ICP27 ............................................ 108 Figure 4.2 eIF4E expression levels in cell lines ......................................................... 109 Figure 4.3 Transcriptional and translational regulation of ICP27 ............................... 110 Figure 4.4 Tumor-specific replication of AU27 virus in vitro ........................................111 Figure 4.5 AU27 virus inhibited tumor growth without causing toxicity to normal tissues in vivo .......................................................................................... 112 Figure 4.6 AU27 virus targeted and killed tumor cells after systemic administration.. 114  Appendix B Figure B.1 Efficient inhibition of tumor growth using a combination of ARR2PB-ICP4 amplicon/helper and GCV treatment in LNCaP xenograft model ............. 134 Figure B.2 The expression of miR-143 and miR-145 in LNCaP stable cell lines ....... 135 Figure B.3 MiRNA expression levels in human normal tissues.................................. 136 Figure B.4 MiR-143 and miR-145 reduced cytotoxicity in LNCaP cells infected with miRNA-regulated amplicon viruses.......................................................... 137 Figure B.5 MiR-124 expression levels in normal mouse tissues................................ 138 Figure B.6 Structure of the two prostate-specific and tumor-specific amplicon plasmids used to package replication-competent amplicon viruses........................ 139 Figure B.7 ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses inhibited LNCaP-Luc tumor growth in xenograft mouse model .............................. 140 Figure B.8 Representative IVIS images of the mice treated with the ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses .............................................. 141 Figure B.9 Biodistribution of the ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses ..................................................................................................... 142  ix  ACKNOWLEDGEMENTS I would like to thank my supervisors, Paul Rennie and William Jia, who gave me the opportunity to work in their labs and provided me with constant support, guidance and patience throughout my research projects. To my supervisory committee members, David Walker, Chris Ong, and Torsten Nielsen, thank you for providing your experience and perspective in the development of this thesis. Thanks to the people working in the Prostate Centre and Brain Research Centre for their assistance and advice during the completion of my thesis project: Guo Yu Liu, Luke Bu, Kevin Zhang, Helen Cheng, Noushin Moshgabadi, Robert Bell and many more. Special thanks to Mary Bowden and Hang Yan for their technical assistance with the animal work. I would also like to acknowledge the funding from the Terry Fox Foundation, the National Cancer Institute of Canada (Canadian Cancer Society Research Institute) and the Prostate Cancer Research Foundation of Canada. A pre-doctoral training award for prostate cancer research was provided by the US Army Department of Defense. To my boyfriend, Gary Evans, thank you for being there for me. Last but not least, to my parents and sister, I am very grateful for all the unconditional support, tolerance, and love! I love you all!  x  To my parents  xi  CO-AUTHORSHIP STATEMENT The experiments were designed, conducted and analyzed by myself, Cleo Lee, and my supervisors, Dr. William Jia and Dr. Paul Rennie. Luke Bu provided technical assistance for the experiments in Chapter 2 and 4. I am responsible for writing the manuscripts as instructed by my supervisors.  xii  1 Introduction  1.1 Prostate cancer Prostate cancer is the most commonly diagnosed non-skin cancer and the second leading cause of cancer death in men (1). It is estimated that over 211,000 men in North America will develop prostate cancer and approximately 33,000 will die from this disease. With the widespread use of prostate-specific antigen (PSA) screening and the rapid increase in the aging population, the prostate cancer incidence is likely to continue rising (2).  1.1.1 Epidemiology of prostate cancer The risk factors for prostate cancer include age, race, family history and diet. Familial clustering of prostate cancer has been suggested by several studies and it has been shown that the risk of developing prostate cancer is twice as high in men with first-degree relatives with prostate cancer compared to men without affected relatives, and this risk increases with an increasing number of affected relatives (3, 4). To further understand the nature of this familial aggregation, multiple segregation analyses were performed and suggested that rare autosomal dominant high-risk genes were predicted to account for 43% of early-onset prostate cancer before age 55 and approximately 9% of all prostate cancer cases (5). Subsequent genome-wide screens of polymorphic DNA markers revealed several regions of linkage (6), and genetic mapping studies identified RNASEL, a candidate hereditary prostate cancer (HPC1) gene, and macrophage scavenger receptor 1 (MSR1) as potential prostate cancer susceptibility genes (7, 8). A wide geographic variation is observed in the incidence and mortality rates of prostate cancer, with the highest rates in North America and Western Europe and the lowest rates in Africa and Asia (2). This variation can be best explained by lifestyle influences, as migratory studies showed that Asian immigrants in North America typically adapt to western diets and thereby adopt higher prostate cancer risks (9-11). The western diet is generally rich in animal fats and meats, and low in fruits and vegetables, and several studies have shown that dietary fats and consumption of red meats are associated with increased prostate cancer risks (12-14). On the other hand, consumptions of antioxidant micronutrients, such as tomatoes that contain lycopene, and vegetables that contain sulforaphan are associated with reduced risks (15, 16). It 1  has also been shown that the risk of developing prostate cancer is about 60% higher in African American men than in white American men (17). The exact reason for this discrepancy is unclear but may be attributable to a variety of factors including nutrition, genetic predisposition, socioeconomic status, and hormones (18).  1.1.2 Screening and diagnosis Prostate cancer is rarely symptomatic at an early stage, because the majority of the adenocarcinomas (~70%) arise from the peripheral zone that is distant from the urethra. As the cancer progresses into the urethra or the bladder neck, urinary symptoms of obstruction or irritations can occur, and the spread of prostate cancer outside the prostate capsule can cause erectile dysfunction due to damaged branches of the pelvic plexus (19). Currently, prostate cancer is being detected at an earlier stage than in the past as a result of widespread combination of digital rectal examination (DRE) and serum PSA screening (20, 21). DRE is a useful tool to assess the shape, symmetry, firmness and nodularity of the prostate and it is evident that DRE can detect prostate cancer in 14-30% of men having a normal PSA level of 4ng / mL or less (22). However, DRE has low reproducibility depending on the experience of the examiners (23), and when used alone, can miss 23-45% of the cancers that are subsequently detected by prostate biopsies performed as a result of serum PSA elevations or transrectal ultrasound abnormalities (24, 25). PSA is an androgen-regulated serum protease and a member of the human kallikrein family encoded by genes located on chromosome 19 (26). It is produced primarily by the epithelial component of the prostate gland (27). Numerous studies have shown that serum PSA values are correlated directly with prostate cancer risk (28), and are more sensitive than DRE. However, diagnostic specificity with regard to cancer is lacking as an elevation of serum PSA levels can occur during both benign (prostatitis, benign prostatic hyperplasia) and malignant prostate diseases (prostate cancer) and also as a result of prostate manipulation (prostate examination and prostate biopsy) (29). Traditionally, prostate biopsies are performed in patients with serum PSA levels greater than 4.0 ng/mL. However, there are problems with total PSA as it lacks sensitivity and specificity, resulting in a high number of false negative and false positive test results. For example, it has been reported that approximately 20-50% of clinically significant prostate cancer occurs in men with PSA levels less than 4 ng/mL. Hence, it is now 2  widely recognized that there is no serum PSA value below which prostate cancer can be excluded (30), and serum PSA testing should only be used as part of a risk assessment that also takes other factors, such as age, race, and family history, into consideration (31, 32). Nonetheless, the implementation of PSA screening with DRE has dramatically increased the detection of early-stage, organ-confined prostate cancer, which is more treatable. As a result of routine PSA screening, the lead time (time by which a cancer diagnosis is advanced) has been estimated to be around 10 years (33, 34). The standard grading of prostate cancer is based on the Gleason grading system, which was first described by Gleason and Mellinger in 1974 (35). The system is used to determine the prognosis of prostate cancer based on its microscopic appearance and the differentiation state. The pathologist assigns a Gleason grade based on the two most common Gleason patterns seen on the prostate samples taken either from a biopsy or after radical prostatectomy. The grade ranges from 1 (least aggressive) to 5 (most aggressive), and the primary and secondary grades are then added together to give the Gleason grade ranging from 2 to 10. Another system used to determine the stage and extent of prostate cancer is the the TNM classification, which is based on T (primary tumor), N (lymph nodes) and M (metastases) categories (36). The T category is based on clinical examination, imaging, endoscopy, biopsy and biochemical tests, and is assigned when the tumor is still confined within the prostate gland or the adjacent seminal vesicles. The N category indicates that the disease has invaded and spread to lymph nodes, and is based on clinical examination or imaging. The M category is based on clinical examination, imaging, skeletal studies and biochemical tests, and is used when metastasis is detected at distant sites.  1.1.3 Prevention Preventive measures against prostate cancer are desirable in light of the high lifetime risks of prostate cancer development, the treatment-associated morbidities, and the inability to cure metastatic disease. Thus far, several large randomized clinical trials are examining the preventive effects of two classes of agents, 5α-reductase inhibitors and antioxidant micronutrients. Since androgens play an important role in the growth of both normal and abnormal human prostates, a decrease in androgen levels should reduce the risk of developing prostate cancer. Testosterone, the main source of androgen, is produced by Leydig cells in the testes, and is converted to 3  dihydrotestosterone (DHT) in the prostate by 5-α reductase (type 1 and type 2) (37, 38). DHT has a five-fold higher affinity for the androgen receptor (AR) than testosterone, and is the predominant agonist of the AR pathway leading to the growth and maintenance of the prostate (39). These data suggest that prostate cancer occurrence and progression may be reduced by inhibiting the activity of 5-α reductase. There are three isoforms of 5-α reductase: type 1 is most prevalent in extraprostatic tissues, type 2 is the predominant form in the prostate, and type 3 is just recently discovered (40-42). Thus far, two 5-α reductase inhibitors have been studied in clinical trials. Finasteride is an inhibitor of type 2 5-α reductase, and dutasteride inhibits both types 1 and 2 5-α reductase (43, 44). In the Prostate Cancer Prevention Trial (PCPT), it was shown that finasteride reduced the risk of prostate cancer by 24.8% relative to a placebo over a 7-year period; however, aggressive forms (Gleason grade 7-10) were more common in the finasteride group (45). In addition, prostate cancer was detected in 18.4% of the men treated with finasteride versus 24.4% of men receiving placebo, and 30% of the patients in finasteride group discontinued the treatment due to undesirable side effects, including reduced ejaculate volume, erectile dysfunction, loss of libido, and gynecomastia (45, 46). As a result, the trial was terminated 15 months before the anticipated completion. Recently, it has been reported that finasteride increases the sensitivity of both DRE and PSA for prostate cancer detection, which may partially explain the increased detection of high-grade tumors in the for-cause biopsies (47, 48). In addition, selective inhibition of low-grade prostate tumors in patients with both low- and high-grade components may have contributed to the increased detection of high-grade tumors in the finasteride group in the PCPT (49). In a bias-adjusted model, the estimated high-grade prostate cancer rate was 8.2% in the placebo group versus 6.0% in the finasteride group, indicating that finasteride treatment did not induce high-grade prostate cancer progression (50). However, it has also been shown recently that continuous finasteride treatment for patients with BPH caused a significantly higher incidence in high-grade (Gleason score >6) tumors (44.5%) when compared to intermitted therapy (25%) and controls (18.2%) (51). Careful considerations should be given before undertaking finasteride treatment. Currently, a phase III clinical trial is investigating the effects of dutasteride, which has been shown to suppress serum DHT by more than 90% in comparison to the 70% seen with finasteride (41, 43, 52), and may prove to be more effective than finasteride in prostate cancer prevention. 4  Several epidemiologic studies have shown that the intake of both selenium and vitamin E might reduce prostate cancer risks (53-55), and currently a phase III randomized, placebo-controlled Selenium and Vitamin E Cancer Prevention Trial (SELECT; N > 32,400) is investigating the effects of these antioxidant micronutrients in preventing prostate cancer for a follow-up of 7-12 years (56). However, a recent report of the SELECT study at a median overall follow-up of roughly 5.5 years showed that selenium, vitamin E, alone or in combination at the tested doses and formulations did not prevent prostate cancer in healthy men (57). These data indicated that the search for new, effective agents for prevention of prostate cancer is urgently required.  1.1.4 Treatment Men with localized prostate cancer face a number of treatment choices, including active surveillance, radical prostatectomy, and radiation therapy. Each treatment option has its side effects, and factors such as age, life expectancy, medical history, Gleason score, and serum PSA level should all be taken into consideration when choosing a treatment with the intent to cure. Although there are no age limits for radical prostatectomy, it is used to treat men who have a life expectancy of at least 5 years, and men aged above 75 years rarely undergo such a treatment (58). Reports from a randomized controlled trial of active surveillance versus radical prostatectomy showed that surgery reduced the risk of metastases and local progression, and improved the disease-specific survival in a group of men aged under 65 years (59). In addition, a study from the Surveillance, Epidemiology, and End Results (SEER) Medicare database, comprising men aged 65-80 years and diagnosed with prostate cancer (Gleason 2-7), showed that after a 12-year study period, 37% of the active surveillance group in comparison with 23.8% of the treatment group undergoing either radiation therapy or surgery had died (60). On the other hand, it has also been suggested that radical prostatectomies have greater adverse impacts on the quality of life, such as sexual incompetence and urinary incontinence, and no effect on overall survival (61, 62). Radiation therapy is administered via external beam radiation therapy (EBRT), interstitial brachytherapy or a combination of the two (63). EBRT is usually delivered with techniques that produce a highly conformal dose to the regions of interest (prostate) and minimize dose to a given volume of other critical organs (bladder, rectum) (64-67). However, it has been reported that the likelihood of second malignancies of the bladder 5  and rectum increased slightly after EBRT (68). Brachytherapy is the implantation of radioactive sources into the prostate under transrectal ultrasound guidance using either low-dose rate implants, such as iodine-125 or palladium-103, or high-dose rate sources, such as iridium-192 (69, 70). The short- and long-term sequelae of brachytherapy for prostate cancer differ from those of EBRT and radical prostatectomy. The most common side effects were nocturia (80%) and dysuria (48%) at 2 months after implantation, and these figures declined to 45% and 20%, respectively, at 12 months after implantation (71-73). Rectal morbidities, such as change in bowel habits, rectal bleeding or ulceration, were also observed after brachytherapy (71, 74). However, an advantage of this treatment is the lower incidence of treatment-associated erectile dysfunction in comparison to EBRT or radical prostatectomy (75-77). Even though prostate cancer is frequently curable by radical prostatectomy or radiotherapy at an early stage when still confined to the organ, many patients diagnosed with locally advanced, recurrent or metastatic disease have concomitantly fewer curative treatment options and a median life expectancy of less than 3 years (78, 79). The primary treatment is usually androgen ablation therapy by either medical castration using LHRH (luteinizing hormone-releasing hormone) agonists, or surgical castration (80, 81). Despite an initial response rate of 80-90% to androgen deprivation therapy, almost all patients advance to an androgen-independent or castration-independent state manifested by increasing PSA levels, and this is often accompanied by high resistance to other chemotherapeutic drugs at 18-24 months after castration (82-85). At this terminal stage, the median survival for patients with metastatic, hormone-refractory prostate cancer is about 10-12 months, and current chemotherapeutic treatments are relatively ineffective (86). For instance, in a 1993 review of 26 chemotherapy trials, it was reported that the objective response rate was only 8.7%, and the median survival was only 6-10 months with no survival benefit for any agent (87). Randomized clinical trials have demonstrated that systemic treatment with mitoxantrone plus prednisone or hydrocortisone reduces bone pain and improves quality of life, but does not prolong survival (88-90). Recently, two clinical trials showed that the median survival can be extended briefly by two months when docetaxel is given every three weeks in combination with prednisone or estramustine (91, 92). As a result of these studies, the role of systemic chemotherapy in hormone-refractory prostate cancer is well established. Several completed trials and ongoing studies are examining 6  the benefits of chemotherapy in patients with locally advanced or metastatic disease in a neoadjuvant or adjuvant setting to improve treatment outcomes (93-98). Thus far, single agent treatment of docetaxel followed by radical prostatectomy in patients with locally advanced prostate cancer demonstrated no complete pathological response (95, 97).  1.1.5 Androgen receptor The androgen receptor (AR) has an important role in the development and progression of prostate cancer (99). It is a 110 kilodalton (kDa) phosphoprotein and functions as the central nuclear receptor transcription factor that mediates androgenic signals in the prostate gland (100). Upon activation by DHT binding to the ligand-binding domain, ARs form homodimers, which translocate to the nucleus and bind to androgen-responsive elements (ARE) to activate the expression of AR-regulated genes (101). It has been demonstrated that most hormone-refractory tumors express higher levels of AR than do androgen-dependent prostate cancer (102, 103), and that AR levels are higher in bone metastasis than in primary tumors (102). An increase in the AR-regulated PSA protein in serum is observed in the progression of prostate cancer towards an androgen-independent state (104). It was further demonstrated that the continuous activation of the AR signaling pathway in the absence of androgen is a result of excessive recruitment of coactivators (105). More recently, Snoek et al. showed that knocking down ARs using a tetracycline inducible shRNA results in the complete regression of castration-resistant C4-2 tumors as well as a reduction of serum PSA levels in 50% of mice (106). These findings suggest that the AR signaling pathway is intact in AR-expressing hormone-refractory tumors and that the knockdown of ARs is a viable strategy to treat castration-resistant prostate cancer (107).  1.2 Herpes simplex virus type 1 Herpes simplex virus type 1 (HSV-1) is a double-stranded DNA virus with a genome size of approximately 152 kilobase pairs (kb) encoding more than 84 genes. The viral genes are divided into three categories: immediate early (IE), early (E) and late (L) genes. There are five immediate-early (IE) genes: ICP0, ICP4, ICP22, ICP27, and ICP47. Of these genes, ICP4 and ICP27 are absolutely essential for viral replication. ICP4 is a sequence-specific DNA-binding protein that activates the transcription of E and L genes, induces viral DNA synthesis, and downregulates IE gene expression (108, 7  109). ICP27 is a multifunctional protein involved in the cooperative transcriptional activation of viral genes with ICP4, the shut-off of host gene expression, the inhibition of precursor mRNA splicing and the promotion of nuclear export of viral transcripts (110). The virus enters host cells via cell receptor-mediated endocytosis through an initial attachment of viral glycoproteins gB and gC with heparin sulfate on the cell surface, followed by the binding of gD to viral entry receptors such as herpesvirus entry mediator (HVEM) and nectins (111). Following entry into host cells, the tegument protein (VP16) and the viral DNA genome are transported into the nucleus where viral genes are expressed in a coordinately regulated and sequentially ordered manner (112). Inside the nucleus, VP16 stimulates the transcription of IE genes, whose products are involved in transcription regulation and stimulation of the expression of E genes, which primarily encode enzymes involved in nucleotide metabolism and viral DNA replication. Upon viral DNA replication initiation, expression of L genes commences. L genes primarily encode for structural components of the virion (113). At the end of the replication cascade, mature viral particles are assembled and released from the host cell, resulting in cell lysis and cell death. HSV-1 has a number of favorable features that make it an attractive viral vector for cancer treatment: 1). it infects a broad range of cell types; 2). it is cytolytic in nature; 3). up to 30kb of the viral genome can be replaced allowing accommodation of multiple therapeutic transgenes (114); 4). availability of the antiherpetic drug ganciclovir (115); 5). it remains as an episome, eliminating concern over insertional mutagenesis (116); 6). it has a much slower mutation rate as a DNA virus in contrast to RNA viruses (117); 7). lack of liver toxicity making it superior to adenoviral vectors.  1.3 Oncolytic virotherapy Oncolytic virotherapy has emerged as a promising approach in the treatment of cancer.  The  rationale  for  using  oncolytic  viruses  is  that  a  tumor-specific  replication-competent virus can preferentially replicate and amplify in tumor cells, causing selective oncolysis while leaving normal surrounding cells unharmed (Figure 1.1). Currently recognized oncolytic viruses are divided into three categories: 1). first-generation, naturally occurring viruses with inherent tumor-specificity (eg. Newcastle diseases virus, vesicular stomatitis virus, reovirus) (118-121); 2). second-generation virus mutants with deletions in genes essential for replication in 8  normal cells but not in cancer cells (eg. adenovirus Onyx-015, herpes virus G207) (122, 123); 3). third-generation virus mutants with viral genes regulated by tissue-specific elements (eg. adenovirus CV706) (124). Several oncolytic agents have been tested in clinical trials, and two agents have been extensively studied, Reolysin from Oncolytics and Onyx-015 (125-127). Results from these clinical trials showed that they were selective for tumors and well-tolerated by the treated patients; however, anti-tumor potency was still limited. Hence, further improvements in efficacy, specificity and delivery of oncolytic viruses are needed. In order to maximize the destruction of tumor cells while minimizing collateral damage to normal tissues, the design of oncolytic viral vectors has been focused on enhancing tumor-specific targeting and killing.  1.3.1 Deletion mutants One targeting approach is to delete viral genes that are required for efficient replication in normal cells but dispensable in tumor cells. One example is the first virus used in clinical trials, adenovirus Onyx-015, which has a deletion of the E1B gene (128). Since the E1B gene product can bind to p53, leading to p53 inhibition or degradation, the theory is that Onyx-015 would be unable to propagate through the inactivation of p53 in normal cells, but would remain active in tumor cells lacking a functional p53 protein. This feature was appealing because 40% of human cancers contain p53 mutations (129). To date, Onyx-015 has been extensively studied in 18 phase I and II clinical trials and is the first virus to undergo clinical trials combined with chemotherapy (126, 127, 130-133). Results from these studies showed that the administration of doses up to 2 x 1012 virus particles (1011 pfu) daily for 5 consecutive days was well tolerated with no toxicity. In some cases, transient anti-tumor response was observed; however, there was no improvement in long-term survival. Thus far, the clinical data with Onyx-015 have shown that concern over toxicity is unwarranted but that its efficacy is questionable. As a result, better strategies to enhance potency are required. In fact, a derivative of Onyx-015 that expresses cytosine deaminase and thymidine kinase have been studied in phase I trials for the treatment of prostate cancer alone or in combination with radiation therapy (134, 135). Again, no long term responses were observed. The greatest achievement in oncolytic virus field was in November 2005 when China approved the world’s first oncolytic virus, a genetically modified adenovirus H101 (Shanghai Sunway Biotech) that is almost identical to Onyx-015, for the treatment 9  of head and neck cancer (136). Another example is the multimutated HSV-1 G207 virus, which has both copies of ICP34.5 deleted and the ICP6 gene inactivated via insertion of the E. coli LacZ gene (123). The ICP34.5 gene product blocks the shut-off of host cell protein synthesis induced by the cellular kinase PKR in virus-infected cells (137). The deletion of ICP34.5 genes ensures a lack of neurovirulence, allowing replicative targeting in tumor cells (138), whereas inactivation of ICP6 offers an additional targeting mechanism for tumor cells with p16 tumor suppressor defects (139). G207 was initially tested in animal models to treat malignant glioma and has been shown to be efficacious and safe (123). It was subsequently shown to cause significant tumor regression in the treatment of a variety of solid tumors, including melanoma, breast, colon, bladder, gastric, head and neck, ovarian, pancreatic, and prostate cancers (140). Based on these promising results, a clinical phase I trial was initiated to test its safety, and it was shown that up to 3 x 109 pfu (plaque forming units) of G207 was safely inoculated into human brain tumors (141). More recently, a phase Ib clinical trial further demonstrated that multiple dose deliveries of 1 x 109 pfu of G207 can be safely inoculated directly into the brain tissue surrounding the tumor resection cavity without development of toxicity, and evidence of in vivo viral replication was also provided (142). More recently, the anti-tumor efficacy of ICP0 mutant HSV-1 has been investigated extensively. The interferon signaling pathway plays a very important role in antiproliferative, antiviral and immunomodulatory activities. Interferons were initially used to treat cancer patients by blocking cell growth and promoting apoptosis (143). It was soon realized that many mutations within cancer cells deregulated the interferon signaling pathway (144), rendering cancer cells incapable of mounting antiviral response during viral infection. Mossman et al. demonstrated that HSV-1 mutants lacking ICP0 are hypersensitive to the antiviral effects of interferon in normal cells (145). It was subsequently demonstrated that the ICP0 mutant KM100 completely eradicates breast tumor cells in 80% of the treated mice and significantly increases survival using an immunocompetent murine model (146). The KM100 virus elicited strong adaptive immune response to tumor antigens as indicated by the high levels of serum IgG1 antibody specific to PyMT tumor antigen. This demonstrates that ICP0-based double mutants may provide a safe and efficacious platform for the development of oncolytic virotherapy and cancer vaccines. 10  1.3.2 Altering viral tropism One major challenge for the systemic delivery of oncolytic viruses is the non-specific infection of both normal and tumor cells. To avoid unnecessary toxicity in normal tissues, the natural tropism of the virus can be ablated and engineered to infect only target cells. For instance, genetic fusion of the coxsackie and adenovirus receptor (CAR) to a single-chain antibody against human carcinoembryonic antigen (CEA) resulted in detargeting in the liver by more than 90% after systemic delivery, and retargeting to CEA-positive tumors and hepatic metastases of colon cancer in nude mice (147). Zhou et al. constructed a recombinant HSV-1 virus, R5111, which has binding sites for heparan sulfate proteoglycans in gB and gC genes ablated, and two copies of IL-13 inserted in gC and gD genes (148). They showed that the virus can use the IL13Rα2 receptor for entry and that it replicates efficiently in a variety of cell lines that express this receptor. Another mutant virus, KgBpK-gC-, deleted for the gC and partial gB genes, was engineered to express gC:preS1 fusion molecules (149). PreS1 is the molecule that human hepatitis B virus uses to bind to hepatocytes specifically, and the virus indeed replicated efficiently and specifically in the hepatoblastoma cell line, HepG2. Recently, Menotti et al. inserted into the HSV-1 viral envelope protein gD a single-chain antibody against the human epidermal growth factor receptor 2/neuregulin (HER2/neu), and showed that this virus can only infect HER2/neu receptor positive cells (150). Altogether, these results provide evidence that viral tropism can be manipulated to infect tumor cells that express specific surface receptors.  1.3.3 Transcriptional targeting Since deletions of viral genes, such as E1A and E1B of adenovirus or ICP34.5 of HSV-1, showed significant attenuation of the virus with reduced cytotoxic effects in tumor cells, attempts have been made to incorporate tissue- or tumor-specific promoters in front of these genes to enhance anti-cancer efficacy and specificity. This strategy was used in the first adenovirus designed for oncolytic virotherapy, CV706, which is an adenovirus 5 (Ad5) that contains the enhancer and promoter of the PSA gene driving the expression of E1A gene (151). It has been shown that viral replication and oncolysis were highly specific to PSA-producing LNCaP cells. E1A is the first gene expressed from the viral genome, and regulates the expression of other viral genes. The incorporation of the PSA promoter in front of E1A restricted viral replication to 11  PSA-expressing cells. In a phase I trial, patients with locally recurrent prostate cancer after radiation therapy were treated with intraprostatic injection of 1011-1013 vp of CV706 viruses (124). The virus was well tolerated and a greater than 50% reduction in PSA was observed in patients treated with the highest doses. Subsequently, several improved versions of CV706 were generated with tissue- or tumor-specific promoters regulating E1A, E1B, E4, and E2. CV764 is an adenovirus variant that has been engineered to contain a prostate-specific enhancer from PSA driving the E1A genes and the human glandular kallikrein (hk2) enhancer/promoter driving the E1B genes; it has been shown to replicate efficiently in prostate tumor cells but is attenuated in nonprostate cells (152, 153). In a clinical phase I trial, patients with hormone-refractory metastatic prostate cancer were treated with systemic administration of CG7870, which has E1A under the probasin promoter and E1B under the PSA promoter (154). The results showed that the virus was well tolerated and a 25-49% reduction in serum PSA was observed. Other promoters have also been tested in various preclinical studies. Matsubara et al. constructed an adenovirus using the promoter of a noncollagenous matrix protein, osteocalcin, to drive the E1A gene, and showed that the virus was effective in eradicating pre-existing androgen-independent prostate tumors from the bone without adverse effects in mice (155). It has been shown that an adenovirus containing PSES (a chimeric enhancer of PSA and prostate-specific membrane antigen enhancer elements) upstream of the E1A and E4 genes was able to dramatically inhibit the growth of CWR22rv prostate tumors after intratumoral or intravenous injections into nude mice (156). The most effective conditionally replicating adenovirus (CRA) examined so far is the telomerase-dependent CRA, which utilizes the human telomerase reverse transcriptase (hTERT) promoter to drive E1A, E1B, and E4 gene expression, and has been shown to exhibit strong anti-tumor selectivity and potency (157-159). More recently, a survivin promoter driving the adenovirus E1A gene has been shown to be superior to the hTERT promoter in terms of anti-cancer specificity (160). Similar targeting strategies have also been incorporated into oncolytic HSV-1 viruses. G92A was constructed by inserting an albumin enhancer/promoter upstream of the ICP4 gene in the thymidine kinase gene locus of a mutant virus d120 that has both copies of ICP4 deleted. This virus has been shown to replicate efficiently only in human hepatoma cells both in vitro and in vivo (161). rQNestin34.5 is an HSV-1 mutant with ICP34.5 gene under control of a synthetic nestin promoter, and has been found to 12  replicate within and kill glioma cells efficiently in animal models (162). Kanai et al. used a replication-defective vector containing the musashi1 promoter driving the ICP34.5 gene with G207 as a helper virus, and showed that this virus exhibited enhanced therapeutic efficacy compared with G207 alone both in vitro and in vivo for the treatment of brain tumors and non-small cell lung cancer (163, 164). All of these strategies capitalize on the overexpression of proteins in tumor cells in relation to normal cells so that their promoters can be used to regulate essential viral gene expression and thus viral replication in order to target tumor cells specifically.  1.3.4 Combination Therapies Conventional therapies such as chemotherapy or radiotherapy has thus far proven to be ineffective in treating advanced cancers due to the narrow range of the therapeutic index, tumor cell resistance and limiting high-dose toxicities. Moreover, tumor cells are known to be genetically heterogeneous and any single agent treatment would select for the resistant phenotypes. One distinctive feature of oncolytic virotherapy is that its maximal effect increases with time as the virus replicates, whereas the activities of drugs decline with time. Since oncolytic virotherapy has proven to be safe and has shown efficacies in many cases, it is feasible to utilize a combination of oncolytic virotherapy with chemotherapy or radiotherapy to achieve synergistic or additive anti-tumor efficacy. In a xenograft mouse model, Chahlavi et al. demonstrated that a combination therapy of G207 plus the chemotherapeutic agent cisplatin resulted in 100% cures in contrast to 42% with G207 or 14% with cisplatin alone in cisplatin-sensitive head and neck tumors (165). A replication-selective HSV-1 ICP34.5 mutant (1716) has been tested in combination with each of four chemotherapeutic agents: mitomycin C, cis-platinum II, methotrexate, or doxorubicin (166). It was demonstrated that the combination of 1716 with common chemotherapeutic agents augmented the effect of HSV-based therapy in the treatment of human non-small cell lung cancer in a murine xenograft model. Ionizing radiation therapy has also been shown to enhance the lytic activity of NV1020, a mutant with multiple gene deletions including one copy of ICP34.5, in human glioma and hepatoma xenograft mouse models (167, 168). It has also been demonstrated that NV1020, when used in combination with 5-fluorouracil, caused inhibition of tumor growth and prolongation of survival when compared with either monotherapy alone in a subcutaneous syngeneic CT-26 tumor 13  model in BALB/c mice (169). This accumulating evidence suggests that utilizing oncolytic virotherapy in combination with chemotherapy or radiotherapy can greatly enhance the anti-tumor efficacy of each therapeutic agent in a synergistic or additive manner.  1.4 MicroRNAs  1.4.1 Discovery The prototypic microRNA (miRNA) was first described 16 years ago when lin-4 was found to be expressed at specific developmental stages in C. elegans (170). The lin-4 product was identified to be a 21-nt RNA containing complementary sequences, which bind to the 3’UTR region of the lin-14 mRNA, and therefore has a negative regulatory effect on the level of LIN-14 proteins by promoting mRNA instability and inhibiting translation (171). The next miRNA to be identified was let-7, which is 21-nt in length and is expressed specifically during the developmental stages of C. elegans from larvae to adult. It negatively regulates the expression of transcripts that have complementary sequences at the 3’UTR end (172, 173). Since then, extensive studies have been carried out in search of additional previously unknown small RNAs. Eight years ago, a newly emerging class of small RNAs, named miRNA, was characterized and identified in worms, flies and humans by three groups simultaneously (174-176). Together, they uncovered nearly 100 previously unknown 21-23-nt miRNAs from non-coding regions of the genome, and potential regulatory roles in gene expression were implicated. The Tuschl lab unexpectedly found 16 and 21 novel miRNAs in Drosophila and Hela cells, respectively, while searching for the endogenous products of the RNA interference (RNAi) mechanism (174). The Bartel (175) and Ambros (176) groups uncovered 60 novel miRNAs in the nematode C. elegans, which had previously been reported to have two short RNAs known to control development. To date, more than 500 miRNAs have been identified in the human genome, and at least 7 DNA viruses have been found to encode miRNAs. As a group, miRNAs are estimated to regulate 30% of the genes in the human genome (177).  1.4.2 Biogenesis and function MicroRNAs are generally transcribed by RNA polymerase II (pol II) in the nucleus to 14  form a long primary transcript known as primary-miRNAs (pri-miRNAs) (178). The pri-miRNAs are capped, polyadenylated, and are usually hundreds of bases or several kilobases in length, and might contain monocistronic or polycistronic miRNAs (179, 180). These transcripts are often spliced and many miRNAs are located within intergenic or intronic segments (Figure 1.2). The miRNA is contained within a 60-80 nucleotide sequence of the pri-miRNA that can form a stem-loop hairpin structure. Inside the nucleus, the stem-loop is cleaved by Drosha to liberate a shorter, roughly 60 nt hairpin, termed a pre-miRNA that contains a 2 nt 3′ overhang (181). Subsequently, the pre-miRNAs are exported to the cytoplasm by the nuclear export factor exportin 5 which depends on the cofactor Ran-GTP (182-184). Further cytoplasmic processing of the pre-miRNA by a second RNase III enzyme, Dicer, generates a 18-24 nucleotide duplex miRNA-miRNA*, bearing 2 nt 3′ overhangs, which is similar in both structure and function to the short interference RNA (siRNA) duplexes that result from Dicer cleavage of long double-stranded RNAs (dsRNAs) (185). After cleavage, the miRNA duplex is loaded onto a large protein complex known as the RNA-induced silencing complex (RISC), which includes the Argonaute proteins (Ago1-4 in humans). A single-strand of the mature miRNA duplex remains stably associated with RISC, whereas the opposite strand, known as the passenger strand (miRNA*), is degraded (186-188). The mature miRNAs then act as guides that direct RISC to target mRNAs (reviewed in (189, 190)), and the degree of complementarity between a miRNA and its target determines the mechanism of regulation. When a miRNA binds to the target mRNA with perfect complementarity, the target mRNA is cleaved by RISC, thereby blocking protein expression, whereas imperfect base pairing between the miRNA and its target leads to translational silencing of the target. However, imperfectly complementary miRNAs can also reduce the number of target mRNAs to varying degrees via degradation (191).  1.4.3 MicroRNA and cancer The first evidence suggesting a correlation between abnormal miRNA expression and cancer was the deletion and downregulation of both miR-15 and miR-16 in the majority of all B cell chronic lymphocytic leukemia (B-CLL) cases. Further analysis showed that miR-15 and miR-16 are located at chromosome 13q14, a region deleted in more than half of B-CLL (192). Subsequently, two papers reported reduced accumulation of  miR-143  and  miR-145  in  colorectal  neoplasia  (193),  and 15  overexpression of precursor miRNA-155/BIC RNA in children with Burkitt's lymphoma (194). It was further found that human miRNA genes are frequently located at fragile sites and genomic regions involved in cancers (195). A correlation between abnormal miRNA expression and lung cancer was first reported by Takamizawa et al. (196). They showed that reduced expression of let-7 miRNA in human lung cancers was associated with poor postoperative survival, and that overexpression of let-7 in the A549 lung adenocarcinoma cell line inhibited lung cancer cell growth in vitro. They further reported that reduced expression of Dicer was associated with a poor prognosis of lung cancer (197). Subsequently, the 3'UTRs of the human RAS genes were identified to contain multiple let-7 complementary sites (LCSs), allowing let-7 to regulate RAS expression. Ras is a well known oncogene, and many human cancers have been found to have elevated levels of RAS expression (198). A lower level of let-7 expression is detected in lung tumors when compared to normal lung tissues, whereas RAS protein is significantly higher in lung tumors, implying a regulatory role of let-7 in tumorigenesis (199). Recently, several groups have demonstrated the regulatory roles of miRNAs in cell proliferation. An anti-apoptotic role of miR-21 was suggested to contribute to malignancies in brain cancer (200). They showed a strong overexpression of miR-21 in the highly malignant human brain tumor, glioblastoma. Knockdown of miR-21 in cultured glioblastoma cells triggered activation of caspases and led to increased apoptotic cell death. A pro-apoptotic role for miRNA has also been demonstrated by the inversely correlated expression of miR-15 and miR-16 and Bcl2 expression in CLL (201). In addition, miR-15a and miR-16-1 have been shown to target CCND1 (encoding cyclin D1) and WNT3A genes to promotes survival, proliferation and invasion of prostate cancer cells (202). Organ or tissue-specific miRNAs have also been reported to regulate cell differentiation. For example, Sempere et al. (203) identified a subset of brain-specific miRNAs whose expression behavior is conserved in both mouse and human differentiating neurons, implicating the regulation of mammalian neuronal development or function by miRNAs. Xi et al. (204) were the first group to report possible regulatory mechanisms of miRNA expression. They investigated the regulation of miRNA expression by p53 because p53 functions as a transcription factor, and they demonstrated that the downregulation of p53 via siRNAs abolished the effect of p53 in regulating miRNAs in 16  the human colon cancer cell line, HCT-116 (wt-p53). In addition, they showed that approximately half of the 326 putative promoters for miRNAs contained p53 binding sites. The oncogene c-myc has also been proposed to directly activate a cluster of six miRNAs, two of them negatively regulating the transcription factor E2F1, suggesting a new mechanism by which c-myc tightly controls cell proliferation in a cell-type specific manner (205). In summary, there is accumulating evidence that suggests a regulatory role for miRNAs in cell proliferation, cell differentiation and tumorigenesis of human cancers. In fact, miRNAs have been proposed to function either as an oncogene or a tumor suppressor (Figure 1.3), and overexpression or downregulation of miRNAs have been reported in the tumorigenesis of a variety of human cancers including brain cancer (200), lung cancer (196, 197, 199), breast cancer (206, 207), colorectal cancer (193, 204, 208), ovarian cancer (209), cervical cancer (210), and prostate cancer (207, 211-213).  1.4.4 MicroRNA expression in prostate cancer MiRNA profiles have been shown to be surprisingly informative, reflecting the developmental lineage and differentiation state of tumors. Lu et al. reported a general downregulation of miRNAs in tumors compared with normal tissues, and that miRNA expression profiles are more accurate in classifying poorly differentiated tumors than mRNA expression profiles (214). High-throughput microarray analysis of the clinical samples obtained from needle core biopsies of prostate cancer and breast cancer exhibited differential miRNA gene profiles between normal and malignant cells (207). Volinia et al. performed a detailed microarray analysis of 540 samples including 363 tumor tissues and 177 normal tissues covering 6 solid tumor types: breast, colon, lung, pancreas, prostate (56 cancer, 7 normal samples), and stomach cancer (215). The miRNA signatures for colon, prostate, stomach and pancreas cancers are most similar with one another, whereas breast and lung cancers are represented by relatively different signatures. They identified 39 upregulated miRNAs and 6 downregulated miRNAs in prostate cancer. Porkka et al. examined the expression of 51 miRNAs in 6 prostate cancer cell lines, 9 prostate cancer xenograft samples, 4 BPH, and 9 prostate carcinoma samples using an oligonucleotide array hybridization method (212). They reported 37 downregulated and 14 upregulated miRNAs in carcinoma samples. Another study by Ozen et al. examined the expression of 480 miRNAs in clinically localized 17  prostate cancer (16 samples) relative to benign peripheral zone tissues (10 samples), and showed a widespread downregulation of miRNAs in tumors (213). Their findings are consistent with the observation that global repression of miRNA expression significantly enhances tumorigenesis (216). Furthermore, it was shown that the androgen responsive LNCaP cells and the androgen unresponsive PC3 cells displayed differential miRNA expressions. Galardi et al. demonstrated that miR-221 and miR-222 are highly expressed in PC3 cells but almost undetectable in LNCaP cells (217). MiR-125b has also been found to stimulate androgen-independent growth of prostate cancer cells by targeting the pro-apoptotic gene, Bak1 (218). In addition, they showed that both miRNAs negatively regulate the cyclin-dependent kinase inhibitor p27Kip1, and that their overexpression may contribute to the growth and progression of prostate cancer to a more aggressive hormone-refractory form. Recently, it was shown that circulating miRNAs are stable blood-based markers for cancer diagnosis as miR-141 expression is readily detectable in the serum of patients with prostate cancer (219). These studies have shown that differential miRNA expression signatures can represent diagnostic and/or prognostic biomarkers for cancer, and are very informative with regards to the specific stage of tumor progression.  1.4.5 MicroRNA-mediated targeting Effective and stringent tissue-specific gene expression can now be achieved due to the discovery of miRNAs. Brown et al. (220) constructed a lentiviral vector by inserting multiple copies of target sequences for miR-142-3p into the 3’UTR region of a green fluorescent protein (GFP) reporter gene, and demonstrated endogenous miRNA regulation of transgene expression. A differential expression of GFP regulated by the 3'UTR at a translational level was observed between hematopoietic lineages and nonhematopoietic cells. This enabled tissue-specific delivery of therapeutic genes under the control of the 3'UTR region without provoking an immune response, thereby increasing the duration of transgene expression, which is a favorable feature for gene therapy. In addition, this tissue-specific targeting by 3’UTR elements may be more effective than the leaky tissue-specific promoters. As a result, this provides new opportunities in the exploration of a miRNA-mediated targeting strategy for transgene expression or oncolysis (Figure 1.4).  18  1.5 Eukaryotic translation initiation factor 4E  1.5.1 Function Translation is the last step in the process of transferring our genetic makeup, DNA, into functional proteins, and is divided into three distinct phases: initiation, elongation, and termination. Since the flow of information from genes to proteins is slow and time consuming, eukaryotes cope with this problem by maintaining a pool of mRNAs that are readily available and can be rapidly translated into proteins that are required for cell growth or survival when given the right stimuli. Under most circumstances, the rate-limiting step in this process is the initiation phase (221). A key player in this phase is the eukaryotic translation initiation factor 4E (eIF4E), which is part of the eIF4F complex that consists of three subunits: eIF4E, the cap binding protein; eIF4A, an ATPase and RNA helicase; eIF4G, a scaffolding protein (222, 223). eIF4E recognizes and binds to the 5’ cap 7-methylguanosine (m7G) that is present on all nuclear transcribed cellular mRNAs (224), and together with the eIF4F complex, unwinds the secondary structures within the 5’ untranslated region (5’UTR) to facilitate the loading of the 40S ribosomal subunit to the mRNA (222). Under normal cellular conditions, eIF4E is sequestered from interaction with eIF4G by the inhibitory 4E binding protein (4EBP). Upon mitogenic activation, 4EBPs are phosphorylated at multiples sites by both the ras-ERK and PI3 kinase/AKT signaling pathways, resulting in the release of eIF4E and thus translational initiation (225). Under normal cellular conditions, there is a limited amount of free eIF4E present within a cell and therefore mRNAs have to compete with each other to gain access to the eIF4F complex. Most cellular mRNAs, such as the housekeeping genes, are strong mRNAs that contain short, unstructured 5’UTRs, and they can be translated with ease even when the presence of eIF4Es is limited. In contrast, weak mRNAs, particularly those of growth factor or proto-oncogenes, contain lengthy, G+C rich, 5’UTRs that form extensive secondary hairpin structures, and which are translated less efficiently, especially when eIF4E levels are low (223, 226).  1.5.2 eIF4E and cancer The link between translational control and tumorigenesis was first established based on the observation that the overexpression of eIF4E promotes cellular transformation and tumorigenesis in immortalized normal cell lines (NIH3T3, CREF or 19  MM3MG), and that eIF4E expression is elevated in many malignant cells (227). Subsequently, it was found that eIF4E elevation causes overexpression of proteins that are known to contribute to the malignant transformation of tumors as a result of the enhanced translation of mRNAs that are normally translationally suppressed by their lengthy 5’UTRs. These mRNAs usually encode for proto-oncogenes such as c-myc, cyclin D1, and ornithine decarboxylase, angiogenesis factors such as fibroblast growth factor (FGF-2) and vascular endothelial growth factor, and enzymes that promote tumor invasiveness such as matrix metalloproteinase-9 (228). Furthermore, eIF4E was demonstrated to be elevated in various types of cancer, including breast, head and neck, lung, prostate, colorectal, bladder, cervical cancer, and lymphoma (229). More recently, it has been shown that eIF4E is most dramatically upregulated in prostate cancers with a Gleason score of greater than 7, and that increased eIF4E expression is associated with poor patient survival rates (230).  1.5.3 Translational targeting by 5’UTR With an increased understanding of the mechanisms by which eIF4E, together with 5’UTR, regulates gene expression through translational controls, and the observation that normal and tumor cells display differentially eIF4E levels, De Benedetti and colleagues developed a new targeting strategy of gene therapy. They inserted the 5’UTR of rat FGF-2 in front of the HSV-1 thymidine kinase (TK) gene, and tested its specificity and efficacy in combination with the pro-drug ganciclovir as a suicide-gene therapy. After systemic administration of this vector through liposomal vehicles, a reduction in subcutaneous breast tumors and lung metastases (>90%) was observed with improved mean survival and no toxicity (231). Subsequently, the utilization of the 5’UTR in combination with suicide-gene has been incorporated into viral based vectors. For example, Yu et al. inserted both the prostate-specific promoter and the 5’UTR from rat FGF-2 upstream of the TK gene in a lentiviral vector, and demonstrated tumor-specific killing of prostate cancer cell lines after ganciclovir treatment (232). Additionally, Mathis et al. used the same strategy in an adenovirus vector and the specific killing of human breast cancer cell lines was also observed (233). They also showed, in a mouse model, that the expression of TK was found primarily in subcutaneous breast tumors with significantly reduced expression in normal liver. Clearly, incorporating the 5’UTR into a viral vector can enhance the specificity of gene 20  therapy and it may also be applicable to oncolytic virotherapy (Figure 1.5).  1.6 Summary Prostate cancer remains the second leading cause of cancer death in men, and current treatment options are not effective in treating advanced states of the disease. For new therapies to have a major impact on patient survival, improvement of anti-cancer efficacy and specificity is urgently needed. In this regard, oncolytic virotherapy offers a new treatment modality for managing advanced cancer as many oncolytic viral agents have been proven safe in a number of clinical trials. However, the efficacy is still quite limited due to the extensive deletions of viral genes, resulting in substantial attenuation of the viruses. To enhance the potency of viral oncolysis, the integrity of the viral genome should be preserved as much as possible. Hence, the goal of this project is to generate a prostate-cancer specific oncolytic HSV-1 by changing only the regulatory elements flanking an essential viral gene, without any deletions of the viral genome, for the treatment of locally advanced, recurrent and metastatic disease. The main hypothesis is that an oncolytic HSV-1 virus can replicate in a tissue-specific and tumor-specific fashion through both transcriptional and translational regulations of an essential viral gene, ICP4 or ICP27, leading to selective HSV-1 replication within and lysis of prostate cancer cells while sparing normal cells. The specific aims are to determine: 1). whether the prostate-specific expression of an essential viral gene can render an oncolytic HSV-1 tissue-specific; 2). whether the 3’UTR region carrying tandem repeats of complementary sequences to a specific miRNA can regulate gene expression at a translational level as determined by the abundance of the specific miRNA present in a cell type; 3). whether the 5’UTR region can regulate gene expression at a translational level as determined by the abundance of endogenous eIF4E; 4). whether tissue- and tumor-specific targeting of an oncolytic virus can be achieved through both transcriptional and translational regulations.  21  Figure 1.1 A schematic diagram of the theory behind oncolytic virotherapy for cancer treatment. A tumor-specific replication-competent virus (oncolytic virus) preferentially replicates and multiply in tumor cells, releasing more viral progenies that can initiate another round of lytic cycle in tumors cells. This eventually leads to the selective lysis of tumor cells while leaving normal surrounding cells unharmed.  22  Esquela-Kerscher et al. Nature Reviews Cancer 6, 259–269 (April 2006) Figure 1.2 The biogenesis of microRNAs. MicroRNAs are transcribed by Pol II in the nucleus to form pri-miRNA, which is further processed by Drosha and Pasha to form pre-miRNA. Pre-miRNA is then transported into the cytoplasm by Exportin 5. Inside the cytoplasm, Dicer cleaves pre-miRNA into mature miRNA, which is then incorporated into RISC to temporarily suppress the expression of their target mRNAs in mammalian cells.  23  Esquela-Kerscher et al. Nature Reviews Cancer 6, 259–269 (April 2006) Figure 1.3 The role of microRNAs as oncogenes or tumor suppressors. (A) In normal cells, microRNAs function to target mRNAs to maintain a balance between cell proliferation, differentiation and cell death. (B) In tumor cells, a downregulation of tumor suppressor microRNAs causes an overexpression of their target mRNAs (oncogenes), resulting in increased rate of tumorigenesis. (C) In tumor cells, oncogenic microRNAs are upregulated leading to suppression of their target mRNAs (tumor suppressors), again promoting tuomrigenesis.  24  Figure 1.4 Selective destruction of tumor cells by microRNA-mediated oncolytic HSV-1. Tumor-specific targeting of an oncolytic virus can be achieved by incorporating multiple copies of the complementary target sequences to a microRNA in the 3’UTR of an essential viral gene, ICP4. The candidate microRNA is downregulated in tumor cells but highly expressed in normal tissues. In normal tissues, the miRNAs bind to the target regions within 3’UTR, leading to destruction of ICP4 mRNA transcript. As a result, there is no viral replication and the normal cells survive. In tumor cells, ICP4 is expressed due to the low levels of miRNAs, leading to lytic viral replication and subsequent cell death.  25  Figure 1.5 Selective destruction of tumor cells by eIF4E-mediated oncolytic HSV-1. Tumor-specific targeting of an oncolytic virus can be achieved by incorporating a complex 5’UTR in front of an essential viral gene, ICP27. In normal tissues where the eIF4E level is limiting, weak mRNAs carrying extensive 5’UTR are not translated efficiently. As a result, ICP27 is not expressed, leading to no viral replication and the normal cells survive. In tumor cells where eIF4E is overexpressed, the 5’UTR is unwound efficiently, resulting in ICP27 expression, lytic viral replication and the subsequent cell death.  26  1.7 References 1.  Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71-96.  2.  Hsing AW, Tsao L and Devesa SS International trends and patterns of prostate cancer incidence and mortality. Int J Cancer 2000;85:60-7.  3.  Steinberg GD, Carter BS, Beaty TH, Childs B, and Walsh PC Family history and the risk of prostate cancer. Prostate 1990;17:337-47.  4.  Spitz MR, Currier RD, Fueger JJ, Babaian RJ, and Newell GR Familial patterns of prostate cancer: a case-control analysis. J Urol 1991;146:1305-7.  5.  Carter BS, Beaty TH, Steinberg GD, Childs B, and Walsh PC Mendelian inheritance of familial prostate cancer. Proc Natl Acad Sci U S A 1992;89:3367-71.  6.  Xu J, Dimitrov L, Chang BL, et al. A combined genomewide linkage scan of 1,233 families for prostate cancer-susceptibility genes conducted by the international consortium for prostate cancer genetics. Am J Hum Genet 2005;77:219-29.  7.  Carpten J, Nupponen N, Isaacs S, et al. Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet 2002;30:181-4.  8.  Xu J, Zheng SL, Komiya A, et al. Germline mutations and sequence variants of the macrophage scavenger receptor 1 gene are associated with prostate cancer risk. Nat Genet 2002;32:321-5.  9.  Haenszel W and Kurihara M Studies of Japanese migrants. I. Mortality from cancer and other diseases among Japanese in the United States. J Natl Cancer Inst 1968;40:43-68.  10.  Shimizu H, Ross RK, Bernstein L, Yatani R, Henderson BE, and Mack TM Cancers of the prostate and breast among Japanese and white immigrants in Los Angeles County. Br J Cancer 1991;63:963-6.  11.  Whittemore AS, Kolonel LN, Wu AH, et al. Prostate cancer in relation to diet, physical activity, and body size in blacks, whites, and Asians in the United States and Canada. J Natl Cancer Inst 1995;87:652-61.  12.  Giovannucci E, Rimm EB, Colditz GA, et al. A prospective study of dietary fat and risk of prostate cancer. J Natl Cancer Inst 1993;85:1571-9.  13.  Chan JM, Stampfer MJ, Ma J, Gann PH, Gaziano JM, and Giovannucci EL Dairy products, calcium, and prostate cancer risk in the Physicians' Health Study. Am J 27  Clin Nutr 2001;74:549-54. 14.  Coffey DS Similarities of prostate and breast cancer: Evolution, diet, and estrogens. Urology 2001;57:31-8.  15.  Gann PH, Ma J, Giovannucci E, et al. Lower prostate cancer risk in men with elevated plasma lycopene levels: results of a prospective analysis. Cancer Res 1999;59:1225-30.  16.  Cohen JH, Kristal AR and Stanford JL Fruit and vegetable intakes and prostate cancer risk. J Natl Cancer Inst 2000;92:61-8.  17.  Reddy S, Shapiro M, Morton R, Jr., and Brawley OW Prostate cancer in black and white Americans. Cancer Metastasis Rev 2003;22:83-6.  18.  Powell IJ Prostate cancer and African-American men. Oncology (Williston Park) 1997;11:599-605; discussion 6-15 passim.  19.  Hsiao CP, Loescher LJ and Moore IM Symptoms and symptom distress in localized prostate cancer. Cancer Nurs 2007;30:E19-32.  20.  Jacobsen SJ, Katusic SK, Bergstralh EJ, et al. Incidence of prostate cancer diagnosis in the eras before and after serum prostate-specific antigen testing. Jama 1995;274:1445-9.  21.  Smith DS, Humphrey PA and Catalona WJ The early detection of prostate carcinoma with prostate specific antigen: the Washington University experience. Cancer 1997;80:1852-6.  22.  Carvalhal GF, Smith DS, Mager DE, Ramos C, and Catalona WJ Digital rectal examination for detecting prostate cancer at prostate specific antigen levels of 4 ng./ml. or less. J Urol 1999;161:835-9.  23.  Smith DS and Catalona WJ Interexaminer variability of digital rectal examination in detecting prostate cancer. Urology 1995;45:70-4.  24.  Catalona WJ, Richie JP, Ahmann FR, et al. Comparison of digital rectal examination and serum prostate specific antigen in the early detection of prostate cancer: results of a multicenter clinical trial of 6,630 men. J Urol 1994;151:1283-90.  25.  Ellis WJ, Chetner MP, Preston SD, and Brawer MK Diagnosis of prostatic carcinoma: the yield of serum prostate specific antigen, digital rectal examination and transrectal ultrasonography. J Urol 1994;152:1520-5.  26.  Yousef GM and Diamandis EP The new human tissue kallikrein gene family: 28  structure, function, and association to disease. Endocr Rev 2001;22:184-204. 27.  Lilja H, Oldbring J, Rannevik G, and Laurell CB Seminal vesicle-secreted proteins and their reactions during gelation and liquefaction of human semen. J Clin Invest 1987;80:281-5.  28.  Cooner WH, Mosley BR, Rutherford CL, Jr., et al. Prostate cancer detection in a clinical urological practice by ultrasonography, digital rectal examination and prostate specific antigen. J Urol 1990;143:1146-52; discussion 52-4.  29.  Klein LT and Lowe FC The effects of prostatic manipulation on prostate-specific antigen levels. Urol Clin North Am 1997;24:293-7.  30.  Thompson IM, Ankerst DP, Chi C, et al. Operating characteristics of prostate-specific antigen in men with an initial PSA level of 3.0 ng/ml or lower. Jama 2005;294:66-70.  31.  Carter HB, Ferrucci L, Kettermann A, et al. Detection of life-threatening prostate cancer with prostate-specific antigen velocity during a window of curability. J Natl Cancer Inst 2006;98:1521-7.  32.  Thompson IM, Ankerst DP, Chi C, et al. Assessing prostate cancer risk: results from the Prostate Cancer Prevention Trial. J Natl Cancer Inst 2006;98:529-34.  33.  Draisma G, Boer R, Otto SJ, et al. Lead times and overdetection due to prostate-specific antigen screening: estimates from the European Randomized Study of Screening for Prostate Cancer. J Natl Cancer Inst 2003;95:868-78.  34.  Tornblom M, Eriksson H, Franzen S, et al. Lead time associated with screening for prostate cancer. Int J Cancer 2004;108:122-9.  35.  Gleason  DF  and  Mellinger  GT Prediction  of  prognosis  for  prostatic  adenocarcinoma by combined histological grading and clinical staging. J Urol 1974;111:58-64. 36.  Bostwick DG Staging prostate cancer--1997: current methods and limitations. Eur Urol 1997;32 Suppl 3:2-14.  37.  Thomas LN, Douglas RC, Lazier CB, Too CK, Rittmaster RS, and Tindall DJ Type 1 and type 2 5alpha-reductase expression in the development and progression of prostate cancer. Eur Urol 2008;53:244-52.  38.  Imperato-McGinley J 5 alpha-reductase deficiency: human and animal models. Eur Urol 1994;25 Suppl 1:20-3.  39.  Allan GF and Sui Z Therapeutic androgen receptor ligands. Nucl Recept Signal 29  2003;1:e009. 40.  Jin Y and Penning TM Steroid 5alpha-reductases and 3alpha-hydroxysteroid dehydrogenases: key enzymes in androgen metabolism. Best Pract Res Clin Endocrinol Metab 2001;15:79-94.  41.  Thomas  LN,  Lazier  CB,  Gupta  R,  et  al.  Differential  alterations  in  5alpha-reductase type 1 and type 2 levels during development and progression of prostate cancer. Prostate 2005;63:231-9. 42.  Uemura M, Tamura K, Chung S, et al. Novel 5 alpha-steroid reductase (SRD5A3, type-3) is overexpressed in hormone-refractory prostate cancer. Cancer Sci 2008;99:81-6.  43.  Clark RV, Hermann DJ, Cunningham GR, Wilson TH, Morrill BB, and Hobbs S Marked suppression of dihydrotestosterone in men with benign prostatic hyperplasia by dutasteride, a dual 5alpha-reductase inhibitor. J Clin Endocrinol Metab 2004;89:2179-84.  44.  Bramson HN, Hermann D, Batchelor KW, Lee FW, James MK, and Frye SV Unique preclinical characteristics of GG745, a potent dual inhibitor of 5AR. J Pharmacol Exp Ther 1997;282:1496-502.  45.  Thompson IM, Goodman PJ, Tangen CM, et al. The influence of finasteride on the development of prostate cancer. N Engl J Med 2003;349:215-24.  46.  Presti JC, Jr., Fair WR, Andriole G, et al. Multicenter, randomized, double-blind, placebo controlled study to investigate the effect of finasteride (MK-906) on stage D prostate cancer. J Urol 1992;148:1201-4.  47.  Thompson IM, Chi C, Ankerst DP, et al. Effect of finasteride on the sensitivity of PSA for detecting prostate cancer. J Natl Cancer Inst 2006;98:1128-33.  48.  Thompson IM, Tangen CM, Goodman PJ, et al. Finasteride improves the sensitivity of digital rectal examination for prostate cancer detection. J Urol 2007;177:1749-52.  49.  Lucia MS, Epstein JI, Goodman PJ, et al. Finasteride and high-grade prostate cancer in the Prostate Cancer Prevention Trial. J Natl Cancer Inst 2007;99:1375-83.  50.  Redman MW, Tangen CM, Goodman PJ, Lucia MS, Coltman CA, Jr., and Thompson IM Finasteride does not increase the risk of high-grade prostate cancer: a bias-adjusted modeling approach. Cancer Prev Res (Phila Pa) 30  2008;1:174-81. 51.  Tarle M, Spajic B, Kraljic I, and Kusic Z Continuous finasteride therapy for benign prostate  hypertrophy  upgrades  both  neuroendorcine  differentiation  and  aggressive prostate cancer. Anticancer Res 2009;29:1797-801. 52.  Andriole G, Bostwick D, Brawley O, et al. Chemoprevention of prostate cancer in men at high risk: rationale and design of the reduction by dutasteride of prostate cancer events (REDUCE) trial. J Urol 2004;172:1314-7.  53.  Brooks JD, Metter EJ, Chan DW, et al. Plasma selenium level before diagnosis and the risk of prostate cancer development. J Urol 2001;166:2034-8.  54.  Chan JM, Stampfer MJ, Ma J, Rimm EB, Willett WC, and Giovannucci EL Supplemental vitamin E intake and prostate cancer risk in a large cohort of men in the United States. Cancer Epidemiol Biomarkers Prev 1999;8:893-9.  55.  Kristal AR, Stanford JL, Cohen JH, Wicklund K, and Patterson RE Vitamin and mineral supplement use is associated with reduced risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 1999;8:887-92.  56.  Lippman SM, Goodman PJ, Klein EA, et al. Designing the Selenium and Vitamin E Cancer Prevention Trial (SELECT). J Natl Cancer Inst 2005;97:94-102.  57.  Lippman SM, Klein EA, Goodman PJ, et al. Effect of selenium and vitamin E on risk of prostate cancer and other cancers: the Selenium and Vitamin E Cancer Prevention Trial (SELECT). Jama 2009;301:39-51.  58.  Arias E United States life tables, 2000. Natl Vital Stat Rep 2002;51:1-38.  59.  Bill-Axelson A, Holmberg L, Ruutu M, et al. Radical prostatectomy versus watchful waiting in early prostate cancer. N Engl J Med 2005;352:1977-84.  60.  Wong YN, Mitra N, Hudes G, et al. Survival associated with treatment vs observation of localized prostate cancer in elderly men. Jama 2006;296:2683-93.  61.  Holmberg L, Bill-Axelson A, Helgesen F, et al. A randomized trial comparing radical prostatectomy with watchful waiting in early prostate cancer. N Engl J Med 2002;347:781-9.  62.  Steineck G, Helgesen F, Adolfsson J, et al. Quality of life after radical prostatectomy or watchful waiting. N Engl J Med 2002;347:790-6.  63.  Zelefsky MJ, Chan H, Hunt M, Yamada Y, Shippy AM, and Amols H Long-term outcome of high dose intensity modulated radiation therapy for patients with clinically localized prostate cancer. J Urol 2006;176:1415-9. 31  64.  Zietman AL, DeSilvio ML, Slater JD, et al. Comparison of conventional-dose vs high-dose conformal radiation therapy in clinically localized adenocarcinoma of the prostate: a randomized controlled trial. Jama 2005;294:1233-9.  65.  DeLaney TF Clinical proton radiation therapy research at the Francis H. Burr Proton Therapy Center. Technol Cancer Res Treat 2007;6:61-6.  66.  Konski A, Speier W, Hanlon A, Beck JR, and Pollack A Is proton beam therapy cost effective in the treatment of adenocarcinoma of the prostate? J Clin Oncol 2007;25:3603-8.  67.  Zietman AL The Titanic and the Iceberg: prostate proton therapy and health care economics. J Clin Oncol 2007;25:3565-6.  68.  Moon K, Stukenborg GJ, Keim J, and Theodorescu D Cancer incidence after localized therapy for prostate cancer. Cancer 2006;107:991-8.  69.  Galalae RM, Martinez A, Mate T, et al. Long-term outcome by risk factors using conformal high-dose-rate brachytherapy (HDR-BT) boost with or without neoadjuvant androgen suppression for localized prostate cancer. Int J Radiat Oncol Biol Phys 2004;58:1048-55.  70.  Sylvester JE, Grimm PD, Blasko JC, et al. 15-Year biochemical relapse free survival in clinical Stage T1-T3 prostate cancer following combined external beam radiotherapy and brachytherapy; Seattle experience. Int J Radiat Oncol Biol Phys 2007;67:57-64.  71.  Kleinberg L, Wallner K, Roy J, et al. Treatment-related symptoms during the first year following transperineal 125I prostate implantation. Int J Radiat Oncol Biol Phys 1994;28:985-90.  72.  Ragde H, Blasko JC, Grimm PD, et al. Interstitial iodine-125 radiation without adjuvant therapy in the treatment of clinically localized prostate carcinoma. Cancer 1997;80:442-53.  73.  Talcott JA, Clark JA, Stark PC, and Mitchell SP Long-term treatment related complications of brachytherapy for early prostate cancer: a survey of patients previously treated. J Urol 2001;166:494-9.  74.  Zelefsky MJ, Hollister T, Raben A, Matthews S, and Wallner KE Five-year biochemical outcome and toxicity with transperineal CT-planned permanent I-125 prostate implantation for patients with localized prostate cancer. Int J Radiat Oncol Biol Phys 2000;47:1261-6. 32  75.  Lee WR, Hall MC, McQuellon RP, Case LD, and McCullough DL A prospective quality-of-life study in men with clinically localized prostate carcinoma treated with  radical  prostatectomy,  external  beam  radiotherapy,  or  interstitial  brachytherapy. Int J Radiat Oncol Biol Phys 2001;51:614-23. 76.  Merrick GS, Butler WM, Wallner KE, et al. The importance of radiation doses to the penile bulb vs. crura in the development of postbrachytherapy erectile dysfunction. Int J Radiat Oncol Biol Phys 2002;54:1055-62.  77.  Stock RG, Kao J and Stone NN Penile erectile function after permanent radioactive seed implantation for treatment of prostate cancer. J Urol 2001;165:436-9.  78.  Oefelein MG, Agarwal PK and Resnick MI Survival of patients with hormone refractory prostate cancer in the prostate specific antigen era. J Urol 2004;171:1525-8.  79.  Fleshner N Defining high-risk prostate cancer: current status. Can J Urol 2005;12 Suppl 1:14-7; discussion 94-6.  80.  Gleave M, Goldenberg SL, Bruchovsky N, and Rennie P Intermittent androgen suppression for prostate cancer: rationale and clinical experience. Prostate Cancer Prostatic Dis 1998;1:289-96.  81.  Albertsen PC, Hanley JA and Fine J 20-year outcomes following conservative management of clinically localized prostate cancer. Jama 2005;293:2095-101.  82.  Goldenberg SL, Gleave ME, Taylor D, and Bruchovsky N Clinical Experience with Intermittent Androgen Suppression in Prostate Cancer: Minimum of 3 Years' Follow-Up. Mol Urol 1999;3:287-92.  83.  Eisenberger MA, Blumenstein BA, Crawford ED, et al. Bilateral orchiectomy with or without flutamide for metastatic  prostate cancer. N Engl J Med  1998;339:1036-42. 84.  Raghavan D, Koczwara B and Javle M Evolving strategies of cytotoxic chemotherapy for advanced prostate cancer. Eur J Cancer 1997;33:566-74.  85.  Scher HI and Sawyers CL Biology of progressive, castration-resistant prostate cancer: directed therapies targeting the androgen-receptor signaling axis. J Clin Oncol 2005;23:8253-61.  86.  Martel CL, Gumerlock PH, Meyers FJ, and Lara PN Current strategies in the management of hormone refractory prostate cancer. Cancer Treat Rev 33  2003;29:171-87. 87.  Yagoda  A  and  Petrylak  D  Cytotoxic  chemotherapy  for  advanced  hormone-resistant prostate cancer. Cancer 1993;71:1098-109. 88.  Ernst DS, Tannock IF, Winquist EW, et al. Randomized, double-blind, controlled trial of mitoxantrone/prednisone and clodronate versus mitoxantrone/prednisone and placebo in patients with hormone-refractory prostate cancer and pain. J Clin Oncol 2003;21:3335-42.  89.  Kantoff PW, Halabi S, Conaway M, et al. Hydrocortisone with or without mitoxantrone in men with hormone-refractory prostate cancer: results of the cancer and leukemia group B 9182 study. J Clin Oncol 1999;17:2506-13.  90.  Tannock IF, Osoba D, Stockler MR, et al. Chemotherapy with mitoxantrone plus prednisone or prednisone alone for symptomatic hormone-resistant prostate cancer: a Canadian randomized trial with palliative end points. J Clin Oncol 1996;14:1756-64.  91.  Petrylak DP, Tangen CM, Hussain MH, et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004;351:1513-20.  92.  Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 2004;351:1502-12.  93.  Ben-Josef E, Porter AT, Han S, et al. Neoadjuvant estramustine and etoposide followed by concurrent estramustine and definitive radiotherapy for locally advanced prostate cancer: feasibility and preliminary results. Int J Radiat Oncol Biol Phys 2001;49:699-703.  94.  Chi KN, Chin JL, Winquist E, Klotz L, Saad F, and Gleave ME Multicenter phase II study of combined neoadjuvant docetaxel and hormone therapy before radical prostatectomy for patients with high risk localized prostate cancer. J Urol 2008;180:565-70; discussion 70.  95.  Febbo PG, Richie JP, George DJ, et al. Neoadjuvant docetaxel before radical prostatectomy in patients with high-risk localized prostate cancer. Clin Cancer Res 2005;11:5233-40.  96.  Kantoff P Recent progress in management of advanced prostate cancer. Oncology (Williston Park) 2005;19:631-6.  97.  Magi-Galluzzi C, Zhou M, Reuther AM, Dreicer R, and Klein EA Neoadjuvant 34  docetaxel treatment for locally advanced prostate cancer: a clinicopathologic study. Cancer 2007;110:1248-54. 98.  Zelefsky MJ, Kelly WK, Scher HI, et al. Results of a phase II study using estramustine phosphate and vinblastine in combination with high-dose three-dimensional conformal radiotherapy for patients with locally advanced prostate cancer. J Clin Oncol 2000;18:1936-41.  99.  Debes JD and Tindall DJ The role of androgens and the androgen receptor in prostate cancer. Cancer Lett 2002;187:1-7.  100.  Lamb DJ, Weigel NL and Marcelli M Androgen receptors and their biology. Vitam Horm 2001;62:199-230.  101.  Heinlein CA and Chang C Androgen receptor in prostate cancer. Endocr Rev 2004;25:276-308.  102.  Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, and Hittmair A Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res 1995;55:3068-72.  103.  Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, and Hittmair A Androgen receptor status of lymph node metastases from prostate cancer. Prostate 1996;28:129-35.  104.  Petros JA and Andriole GL Serum PSA after antiandrogen therapy. Urol Clin North Am 1993;20:749-56.  105.  Gregory CW, He B, Johnson RT, et al. A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy. Cancer Res 2001;61:4315-9.  106.  Snoek R, Cheng H, Margiotti K, et al. In vivo knockdown of the androgen receptor results in growth inhibition and regression of well-established, castration-resistant prostate tumors. Clin Cancer Res 2009;15:39-47.  107.  El Sheikh SS, Domin J, Abel P, Stamp G, and Lalani el N Androgen-independent prostate cancer: potential role of androgen and ErbB receptor signal transduction crosstalk. Neoplasia 2003;5:99-109.  108.  DeLuca NA, Courtney MA and Schaffer PA Temperature-sensitive mutants in herpes simplex virus type 1 ICP4 permissive for early gene expression. J Virol 1984;52:767-76.  109.  DeLuca NA and Schaffer PA Activation of immediate-early, early, and late 35  promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol Cell Biol 1985;5:1997-2008. 110.  Smith RW, Malik P and Clements JB The herpes simplex virus ICP27 protein: a multifunctional post-transcriptional regulator of gene expression. Biochem Soc Trans 2005;33:499-501.  111.  Spear PG and Longnecker R Herpesvirus entry: an update. J Virol 2003;77:10179-85.  112.  Roizman B and D.M. K Herpes simplex viruses and their replication. In: Fields Virology, 4th edition, pp. 2399-459. Philadelphia: Lippincott Williams & Wilkins, 2001.  113.  Mocarski ES and Roizman B Structure and role of the herpes simplex virus DNA termini in inversion, circularization and generation of virion DNA. Cell 1982;31:89-97.  114.  Roizman B The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors. Proc Natl Acad Sci U S A 1996;93:11307-12.  115.  Balfour HH, Jr. Antiviral drugs. N Engl J Med 1999;340:1255-68.  116.  Mellerick DM and Fraser NW Physical state of the latent herpes simplex virus genome in a mouse model system: evidence suggesting an episomal state. Virology 1987;158:265-75.  117.  Drake JW, Charlesworth B, Charlesworth D, and Crow JF Rates of spontaneous mutation. Genetics 1998;148:1667-86.  118.  Stojdl DF, Lichty B, Knowles S, et al. Exploiting tumor-specific defects in the interferon pathway with a previously unknown oncolytic virus. Nat Med 2000;6:821-5.  119.  Liu TC and Kirn D Systemic efficacy with oncolytic virus therapeutics: clinical proof-of-concept and future directions. Cancer Res 2007;67:429-32.  120.  Stojdl DF, Lichty BD, tenOever BR, et al. VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell 2003;4:263-75.  121.  Coffey MC, Strong JE, Forsyth PA, and Lee PW Reovirus therapy of tumors with activated Ras pathway. Science 1998;282:1332-4.  122.  Kirn D Oncolytic virotherapy for cancer with the adenovirus dl1520 (Onyx-015): results of phase I and II trials. Expert Opin Biol Ther 2001;1:525-38. 36  123.  Mineta T, Rabkin SD, Yazaki T, Hunter WD, and Martuza RL Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1995;1:938-43.  124.  DeWeese TL, van der Poel H, Li S, et al. A phase I trial of CV706, a replication-competent, PSA selective oncolytic adenovirus, for the treatment of locally recurrent prostate cancer following radiation therapy. Cancer Res 2001;61:7464-72.  125.  Comins C, Heinemann L, Harrington K, Melcher A, De Bono J, and Pandha H Reovirus: viral therapy for cancer 'as nature intended'. Clin Oncol (R Coll Radiol) 2008;20:548-54.  126.  Chiocca EA, Abbed KM, Tatter S, et al. A phase I open-label, dose-escalation, multi-institutional trial of injection with an E1B-Attenuated adenovirus, ONYX-015, into the peritumoral region of recurrent malignant gliomas, in the adjuvant setting. Mol Ther 2004;10:958-66.  127.  Ganly I, Kirn D, Eckhardt G, et al. A phase I study of Onyx-015, an E1B attenuated adenovirus, administered intratumorally to patients with recurrent head and neck cancer. Clin Cancer Res 2000;6:798-806.  128.  Bischoff JR, Kirn DH, Williams A, et al. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 1996;274:373-6.  129.  Vogelstein B and Kinzler KW Cancer genes and the pathways they control. Nat Med 2004;10:789-99.  130. Khuri FR, Nemunaitis J, Ganly I, et al. a controlled trial of intratumoral ONYX-015, a  selectively-replicating  adenovirus,  in  combination  with  cisplatin  and  5-fluorouracil in patients with recurrent head and neck cancer. Nat Med 2000;6:879-85. 131.  Reid T, Galanis E, Abbruzzese J, et al. Intra-arterial administration of a replication-selective adenovirus (dl1520) in patients with colorectal carcinoma metastatic to the liver: a phase I trial. Gene Ther 2001;8:1618-26.  132.  Rudin CM, Cohen EE, Papadimitrakopoulou VA, et al. An attenuated adenovirus, ONYX-015, as mouthwash therapy for premalignant oral dysplasia. J Clin Oncol 2003;21:4546-52.  133.  Vasey PA, Shulman LN, Campos S, et al. Phase I trial of intraperitoneal injection of the E1B-55-kd-gene-deleted adenovirus ONYX-015 (dl1520) given on days 1 37  through 5 every 3 weeks in patients with recurrent/refractory epithelial ovarian cancer. J Clin Oncol 2002;20:1562-9. 134.  Freytag SO, Khil M, Stricker H, et al. Phase I study of replication-competent adenovirus-mediated double suicide gene therapy for the treatment of locally recurrent prostate cancer. Cancer Res 2002;62:4968-76.  135.  Freytag SO, Stricker H, Pegg J, et al. Phase I study of replication-competent adenovirus-mediated  double-suicide  gene  therapy  in  combination  with  conventional-dose three-dimensional conformal radiation therapy for the treatment of newly diagnosed, intermediate- to high-risk prostate cancer. Cancer Res 2003;63:7497-506. 136. Garber K China approves world's first oncolytic virus therapy for cancer treatment. J Natl Cancer Inst 2006;98:298-300. 137.  Chou J and Roizman B The gamma 1(34.5) gene of herpes simplex virus 1 precludes neuroblastoma cells from triggering total shutoff of protein synthesis characteristic of programed cell death in neuronal cells. Proc Natl Acad Sci U S A 1992;89:3266-70.  138.  Smith KD, Mezhir JJ, Bickenbach K, et al. Activated MEK suppresses activation of  PKR  and  enables  efficient  replication  and  in  vivo  oncolysis  by  Deltagamma(1)34.5 mutants of herpes simplex virus 1. J Virol 2006;80:1110-20. 139.  Aghi M, Visted T, Depinho RA, and Chiocca EA Oncolytic herpes virus with defective ICP6 specifically replicates in quiescent cells with homozygous genetic mutations in p16. Oncogene 2008;27:4249-54.  140.  Varghese S and Rabkin SD Oncolytic herpes simplex virus vectors for cancer virotherapy. Cancer Gene Ther 2002;9:967-78.  141.  Markert JM, Medlock MD, Rabkin SD, et al. Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene Ther 2000;7:867-74.  142.  Markert JM, Liechty PG, Wang W, et al. Phase Ib trial of mutant herpes simplex virus G207 inoculated pre-and post-tumor resection for recurrent GBM. Mol Ther 2009;17:199-207.  143.  Stark GR, Kerr IM, Williams BR, Silverman RH, and Schreiber RD How cells respond to interferons. Annu Rev Biochem 1998;67:227-64.  144.  Abril E, Mendez RE, Garcia A, et al. Characterization of a gastric tumor cell line 38  defective in MHC class I inducibility by both alpha- and gamma-interferon. Tissue Antigens 1996;47:391-8. 145.  Mossman KL, Saffran HA and Smiley JR Herpes simplex virus ICP0 mutants are hypersensitive to interferon. J Virol 2000;74:2052-6.  146.  Hummel JL, Safroneeva E and Mossman KL The role of ICP0-Null HSV-1 and interferon signaling defects in the effective treatment of breast adenocarcinoma. Mol Ther 2005;12:1101-10.  147.  Li HJ, Everts M, Pereboeva L, et al. Adenovirus tumor targeting and hepatic untargeting  by  a  coxsackie/adenovirus  receptor  ectodomain  anti-carcinoembryonic antigen bispecific adapter. Cancer Res 2007;67:5354-61. 148.  Zhou G, Ye GJ, Debinski W, and Roizman B Engineered herpes simplex virus 1 is dependent on IL13Ralpha 2 receptor for cell entry and independent of glycoprotein D receptor interaction. Proc Natl Acad Sci U S A 2002;99:15124-9.  149.  Argnani R, Boccafogli L, Marconi PC, and Manservigi R Specific targeted binding of herpes simplex virus type 1 to hepatocytes via the human hepatitis B virus preS1 peptide. Gene Ther 2004;11:1087-98.  150.  Menotti L, Cerretani A and Campadelli-Fiume G A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J Virol 2006;80:5531-9.  151.  Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW, and Henderson DR Prostate attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res 1997;57:2559-63.  152.  Yu DC, Chen Y, Seng M, Dilley J, and Henderson DR The addition of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant prostate tumor xenografts. Cancer Res 1999;59:4200-3.  153.  Yu DC, Sakamoto GT and Henderson DR Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 1999;59:1498-504.  154.  Small EJ, Carducci MA, Burke JM, et al. A phase I trial of intravenous CG7870, a replication-selective, prostate-specific antigen-targeted oncolytic adenovirus, for 39  the treatment of hormone-refractory, metastatic prostate cancer. Mol Ther 2006;14:107-17. 155.  Matsubara S, Wada Y, Gardner TA, et al. A conditional replication-competent adenoviral vector, Ad-OC-E1a, to cotarget prostate cancer and bone stroma in an experimental model of androgen-independent prostate cancer bone metastasis. Cancer Res 2001;61:6012-9.  156.  Li X, Zhang YP, Kim HS, et al. Gene therapy for prostate cancer by controlling adenovirus E1a and E4 gene expression with PSES enhancer. Cancer Res 2005;65:1941-51.  157.  Hernandez-Alcoceba R, Pihalja M, Qian D, and Clarke MF New oncolytic adenoviruses with hypoxia- and estrogen receptor-regulated replication. Hum Gene Ther 2002;13:1737-50.  158.  Li Y, Idamakanti N, Arroyo T, et al. Dual promoter-controlled oncolytic adenovirus CG5757 has strong tumor selectivity and significant antitumor efficacy in preclinical models. Clin Cancer Res 2005;11:8845-55.  159.  Wirth T, Zender L, Schulte B, et al. A telomerase-dependent conditionally replicating adenovirus for selective treatment of cancer. Cancer Res 2003;63:3181-8.  160.  Kamizono J, Nagano S, Murofushi Y, et al. Survivin-responsive conditionally replicating adenovirus exhibits cancer-specific and efficient viral replication. Cancer Res 2005;65:5284-91.  161.  Miyatake S, Iyer A, Martuza RL, and Rabkin SD Transcriptional targeting of herpes simplex virus for cell-specific replication. J Virol 1997;71:5124-32.  162.  Kambara H, Okano H, Chiocca EA, and Saeki Y An oncolytic HSV-1 mutant expressing ICP34.5 under control of a nestin promoter increases survival of animals  even  when  symptomatic  from  a  brain  tumor.  Cancer  Res  2005;65:2832-9. 163.  Kanai R, Eguchi K, Takahashi M, et al. Enhanced therapeutic efficacy of oncolytic herpes vector G207 against human non-small cell lung cancer--expression of an RNA-binding protein, Musashi1, as a marker for the tailored gene therapy. J Gene Med 2006;8:1329-40.  164.  Kanai R, Tomita H, Shinoda A, et al. Enhanced therapeutic efficacy of G207 for the  treatment  of  glioma  through  Musashi1  promoter  retargeting  of 40  gamma34.5-mediated virulence. Gene Ther 2006;13:106-16. 165.  Chahlavi A, Todo T, Martuza RL, and Rabkin SD Replication-competent herpes simplex virus vector G207 and cisplatin combination therapy for head and neck squamous cell carcinoma. Neoplasia 1999;1:162-9.  166.  Toyoizumi T, Mick R, Abbas AE, Kang EH, Kaiser LR, and Molnar-Kimber KL Combined therapy with chemotherapeutic agents and herpes simplex virus type 1 ICP34.5 mutant (HSV-1716) in human non-small cell lung cancer. Hum Gene Ther 1999;10:3013-29.  167.  Bradley JD, Kataoka Y, Advani S, et al. Ionizing radiation improves survival in mice bearing intracranial high-grade gliomas injected with genetically modified herpes simplex virus. Clin Cancer Res 1999;5:1517-22.  168.  Chung SM, Advani SJ, Bradley JD, et al. The use of a genetically engineered herpes simplex virus (R7020) with ionizing radiation for experimental hepatoma. Gene Ther 2002;9:75-80.  169.  Gutermann A, Mayer E, von Dehn-Rothfelser K, et al. Efficacy of oncolytic herpesvirus NV1020 can be enhanced by combination with chemotherapeutics in colon carcinoma cells. Hum Gene Ther 2006;17:1241-53.  170.  Lee RC, Feinbaum RL and Ambros V The C. elegans heterochronic gene lin-4 encodes  small  RNAs  with  antisense  complementarity  to  lin-14.  Cell  1993;75:843-54. 171.  Moss EG, Lee RC and Ambros V The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 1997;88:637-46.  172.  Feinbaum R and Ambros V The timing of lin-4 RNA accumulation controls the timing of postembryonic developmental events in Caenorhabditis elegans. Dev Biol 1999;210:87-95.  173.  Reinhart BJ, Slack FJ, Basson M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000;403:901-6.  174.  Lagos-Quintana M, Rauhut R, Lendeckel W, and Tuschl T Identification of novel genes coding for small expressed RNAs. Science 2001;294:853-8.  175.  Lau NC, Lim LP, Weinstein EG, and Bartel DP An abundant class of tiny RNAs with  probable  regulatory  roles  in  Caenorhabditis  elegans.  Science  2001;294:858-62. 41  176.  Lee RC and Ambros V An extensive class of small RNAs in Caenorhabditis elegans. Science 2001;294:862-4.  177.  Lewis BP, Burge CB and Bartel DP Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120:15-20.  178.  Lee Y, Jeon K, Lee JT, Kim S, and Kim VN MicroRNA maturation: stepwise processing and subcellular localization. Embo J 2002;21:4663-70.  179.  Cai X, Hagedorn CH and Cullen BR Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. Rna 2004;10:1957-66.  180.  Lee Y, Kim M, Han J, et al. MicroRNA genes are transcribed by RNA polymerase II. Embo J 2004;23:4051-60.  181.  Lee Y, Ahn C, Han J, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 2003;425:415-9.  182.  Bohnsack MT, Czaplinski K and Gorlich D Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. Rna 2004;10:185-91.  183.  Lund E, Guttinger S, Calado A, Dahlberg JE, and Kutay U Nuclear export of microRNA precursors. Science 2004;303:95-8.  184.  Yi R, Qin Y, Macara IG, and Cullen BR Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 2003;17:3011-6.  185.  Hutvagner G and Zamore PD A microRNA in a multiple-turnover RNAi enzyme complex. Science 2002;297:2056-60.  186.  Gregory RI, Chendrimada TP, Cooch N, and Shiekhattar R Human RISC couples microRNA  biogenesis  and  posttranscriptional  gene  silencing.  Cell  2005;123:631-40. 187.  Matranga C, Tomari Y, Shin C, Bartel DP, and Zamore PD Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell 2005;123:607-20.  188.  Rand TA, Petersen S, Du F, and Wang X Argonaute2 cleaves the anti-guide strand of siRNA during RISC activation. Cell 2005;123:621-9.  189.  Bartel DP MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281-97. 42  190.  Cullen BR Transcription and processing of human microRNA precursors. Mol Cell 2004;16:861-5.  191.  He L and Hannon GJ MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 2004;5:522-31.  192.  Calin GA, Dumitru CD, Shimizu M, et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 2002;99:15524-9.  193.  Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, and James RJ Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 2003;1:882-91.  194.  Metzler M, Wilda M, Busch K, Viehmann S, and Borkhardt A High expression of precursor microRNA-155/BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer 2004;39:167-9.  195.  Calin GA, Sevignani C, Dumitru CD, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004;101:2999-3004.  196.  Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004;64:3753-6.  197.  Karube Y, Tanaka H, Osada H, et al. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci 2005;96:111-5.  198.  Galiana C, Lozano JC, Bancel B, Nakazawa H, and Yamasaki H High frequency of Ki-ras amplification and p53 gene mutations in adenocarcinomas of the human esophagus. Mol Carcinog 1995;14:286-93.  199.  Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the let-7 microRNA family. Cell 2005;120:635-47.  200.  Chan JA, Krichevsky AM and Kosik KS MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 2005;65:6029-33.  201.  Cimmino A, Calin GA, Fabbri M, et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A 2005;102:13944-9.  202.  Bonci D, Coppola V, Musumeci M, et al. The miR-15a-miR-16-1 cluster controls prostate  cancer  by  targeting  multiple  oncogenic  activities.  Nat  Med  2008;14:1271-7. 43  203.  Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, and Ambros V Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol 2004;5:R13.  204.  Xi Y, Shalgi R, Fodstad O, Pilpel Y, and Ju J Differentially regulated micro-RNAs and actively translated messenger RNA transcripts by tumor suppressor p53 in colon cancer. Clin Cancer Res 2006;12:2014-24.  205.  O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, and Mendell JT c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005;435:839-43.  206.  Iorio MV, Ferracin M, Liu CG, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005;65:7065-70.  207.  Mattie MD, Benz CC, Bowers J, et al. Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies. Mol Cancer 2006;5:24.  208.  Akao Y, Nakagawa Y and Naoe T let-7 microRNA functions as a potential growth suppressor in human colon cancer cells. Biol Pharm Bull 2006;29:903-6.  209.  Iorio MV, Visone R, Di Leva G, et al. MicroRNA signatures in human ovarian cancer. Cancer Res 2007;67:8699-707.  210.  Lui WO, Pourmand N, Patterson BK, and Fire A Patterns of known and novel small RNAs in human cervical cancer. Cancer Res 2007;67:6031-43.  211.  Saito Y, Liang G, Egger G, et al. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell 2006;9:435-43.  212.  Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, and Visakorpi T MicroRNA expression profiling in prostate cancer. Cancer Res 2007;67:6130-5.  213.  Ozen M, Creighton CJ, Ozdemir M, and Ittmann M Widespread deregulation of microRNA expression in human prostate cancer. Oncogene 2008;27:1788-93.  214.  Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435:834-8.  215.  Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257-61.  216.  Kumar S, Gao L, Yeagy B, and Reid T Virus combinations and chemotherapy for 44  the treatment of human cancers. Curr Opin Mol Ther 2008;10:371-9. 217.  Galardi S, Mercatelli N, Giorda E, et al. miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem 2007;282:23716-24.  218.  Shi XB, Xue L, Yang J, et al. An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells. Proc Natl Acad Sci U S A 2007;104:19983-8.  219.  Mitchell PS, Parkin RK, Kroh EM, et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 2008;105:10513-8.  220.  Brown BD, Venneri MA, Zingale A, Sergi Sergi L, and Naldini L Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med 2006;12:585-91.  221.  Hiremath LS, Webb NR and Rhoads RE Immunological detection of the messenger RNA cap-binding protein. J Biol Chem 1985;260:7843-9.  222.  Pestova TV, Kolupaeva VG, Lomakin IB, et al. Molecular mechanisms of translation initiation in eukaryotes. Proc Natl Acad Sci U S A 2001;98:7029-36.  223.  Gingras AC, Raught B and Sonenberg N eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 1999;68:913-63.  224.  Shatkin AJ mRNA cap binding proteins: essential factors for initiating translation. Cell 1985;40:223-4.  225.  Gingras AC, Raught B and Sonenberg N Regulation of translation initiation by FRAP/mTOR. Genes Dev 2001;15:807-26.  226.  Zimmer SG, DeBenedetti A and Graff JR Translational control of malignancy: the mRNA cap-binding protein, eIF-4E, as a central regulator of tumor formation, growth, invasion and metastasis. Anticancer Res 2000;20:1343-51.  227.  Lazaris-Karatzas A, Montine KS and Sonenberg N Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 1990;345:544-7.  228.  Mamane Y, Petroulakis E, Rong L, Yoshida K, Ler LW, and Sonenberg N eIF4E--from translation to transformation. Oncogene 2004;23:3172-9.  229.  De Benedetti A and Graff JR eIF-4E expression and its role in malignancies and 45  metastases. Oncogene 2004;23:3189-99. 230.  Graff JR, Konicek BW, Lynch RL, et al. eIF4E activation is commonly elevated in advanced human prostate cancers and significantly related to reduced patient survival. Cancer Res 2009;69:3866-73.  231.  DeFatta RJ, Chervenak RP and De Benedetti A A cancer gene therapy approach through  translational  control  of  a  suicide  gene.  Cancer  Gene  Ther  2002;9:505-12. 232.  Yu D, Scott C, Jia WW, et al. Targeting and killing of prostate cancer cells using lentiviral constructs containing a sequence recognized by translation factor eIF4E and a prostate-specific promoter. Cancer Gene Ther 2006;13:32-43.  233.  Mathis JM, Williams BJ, Sibley DA, et al. Cancer-specific targeting of an adenovirus-delivered herpes simplex virus thymidine kinase suicide gene using translational control. J Gene Med 2006;8:1105-20.  46  2  An HSV-1 amplicon system for prostate-specific expression of ICP4 to  complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells ∗ 2.1 Introduction Prostate cancer is the most commonly diagnosed non-skin cancer in men and the second leading cause of cancer death in men (1). It is estimated that over 234,000 men in North America will develop prostate cancer and approximately 27,000 will die from this disease (2). If caught early, when still confined to the prostate, it is frequently curable by surgery or radiotherapy. However, patients who present with metastatic disease have concomitantly fewer curative treatment options and a median life expectancy of <3 years (3-5). The primary treatment for locally advanced, recurrent or metastatic prostate cancer is usually some form of androgen ablation therapy (6, 7). Unfortunately, the effectiveness of androgen withdrawal therapy in advanced prostate cancer is restricted to a duration of about 18-24 months due to progression of tumor cells (8-10). At this lethal end phase, even with the most effective chemotherapy regimens, median survival is only around 19 months (11, 12). Clearly, if we are to have an impact on patient survival, more effective, new approaches for dealing with advanced disease are required. In this regard, gene therapy offers a promising therapeutic option for treating locally advanced, recurrent and metastatic AI prostate cancer (for reviews (13-15)). Prostate cancer lends itself to gene therapy since the prostate is not essential for sustaining life and therefore can be ablated, plus intraprostatic administration of gene therapy via transurethral, transperineal and transrectal routes is technically easy (16). Another advantage is that there are several prostate-specific promoters available which allow for tissue specific targeting. Herpes simplex virus type 1 (HSV-1) has a number of favorable features that make it  an  attractive  viral  vector  for  cancer  treatment,  and  various  forms  of  replication-defective or replication-conditional vectors have been developed for cancer therapy (17). G207, an example of this type of recombinant HSV-1, has been shown to  ∗  A version of this chapter has been published. Lee, C.Y., Bu, L.X., Rennie, P.S., and Jia, W.W. (2007) An HSV-1 amplicon system for prostate-specific expression of ICP4 to complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells. Cancer Gene Therapy; 14(7): 652-660.  47  be efficacious in treating malignant glioma (18) and is being evaluated in clinical trials (19). Other replication-competent HSV-1 vectors are also currently being tested in human clinical trials for treatment of malignant melanoma (20), breast cancer (21), head and neck cancer (22), and metastasis from colorectal cancer (23). Results from the above phase I clinical trials have demonstrated that HSV-1 viral therapy was well tolerated by patients and have shown efficacy in some cases. HSV-1 virus is a double-stranded DNA virus with a genome size of approximately 152 kb encoding more than 84 genes. The viral genes are divided into three categories: immediate early (IE), early (E) and late (L) genes. There are five immediate-early (IE) genes: ICP0, ICP4, ICP22, ICP27, and ICP47. Among them, ICP4 and ICP27 are absolutely essential for viral replication. The virus enters host cells via cell receptor-mediated endocytosis and once in the cell, the tegument protein (VP16) and the viral DNA are transported into the nucleus where viral genes are expressed in a coordinately regulated and sequentially ordered manner (24). Inside the nucleus, VP16 stimulates the transcription of IE genes, whose products are involved in transcription regulation and stimulation of the expression of E genes, which primarily encode enzymes involved in nucleotide metabolism and viral DNA replication. Upon viral DNA replication initiation, expression of L genes commences. L genes mainly code for structural components of the virion (25). At the end of the replication cascade, mature viral particles are assembled and released from the host cell, resulting in cell lysis and cell death. Tissue-specific and tumor-specific control of the expression of viral genes essential for replication could potentially regulate oncolytic virus replication differentially and therefore result in selective killing of cancer cells. We hypothesized that a replication defective HSV-1 mutant lacking one of the essential genes may become oncolytic when the missing gene is supplemented by a co-existing amplicon expressing this viral gene in a cell-type specific fashion. To test this hypothesis, an HSV-1 amplicon structure was constructed containing a prostate-specific promoter inserted in front of the ICP4 gene (26). The helper virus used in this study is a replication-deficient recombinant ICP4¯ helper virus (Cgal 3) which has had both copies of the ICP4 gene deleted and an insertion of the bacterial β-galactosidase gene in an intergenic site of the short unique region (27). The helper virus carries all other necessary genes for viral replication except the ICP4 gene, and therefore it cannot replicate except in the presence of a 48  complementing cell line transfected with ICP4 gene or co-infected with an amplicon virus expressing this gene. The amplicon virus carries both a viral origin of replication and a packaging signal, which allow the construct to replicate and be packaged by the helper HSV-1 virus in host cells (28). ARR2PB is a small composite promoter derived from the prostate-specific rat probasin promoter that has been reported to be expressed in a highly prostate-specific manner in transgenic mice (26, 29, 30). This androgen-responsive promoter has also been shown to direct prostate-specific expression of EGFP and herpes thymidine kinase in human prostate cancer cell lines both in vitro and in vivo using a lentiviral vector system (31, 32). In the present study, our results demonstrated that expression of the ICP4 gene under a prostate-specific promoter in an amplicon virus complemented the ICP4¯ helper virus to enable viral replication and subsequently lead to oncolysis of LNCaP human prostate cancer cells both in vitro and in vivo. 2.2 Materials and Methods 2.2.1 Plasmid preparation The ARR2PB-ICP4 plasmid was constructed and described by Yang et al (33). The CMV-ICP4 plasmid was made by replacing the ARR2PB promoter (465 bp) of the ARR2PB-ICP4 plasmid with the CMV promoter (605 bp), which was excised from the plasmid pHR-CMV-EGFP at ClaI-BamHI sites. The structure of the two amplicon plasmids is represented in Figure 1. 2.2.2 Cell culture conditions Vero and its derivative cell line, 7B (transfected to express ICP4 and ICP27), cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 5% FBS and antibiotics (penicillin and streptomycin). LNCaP prostate cancer cells were grown in DMEM supplemented with 10% FBS and antibiotics. For androgen-regulation experiments, LNCaP cells were maintained in DMEM with 10% charcoal-stripped FBS with or without the addition of 10nM R1881, a synthetic androgen. All cells were maintained in a 5% CO2 incubator at 37℃.  49  2.2.3 Viral preparation The replication-deficient ICP4- helper virus, Cgal 3 (27) was a gift from Dr. Paul Johnson (Neurovir Inc., Vancouver, BC, Canada) and was propagated and tittered in 7B cells (33, 34). Briefly, 7B cells were infected with ICP4¯ helper virus at an MOI of 0.1. Two days after viral infection, cells were scraped from the plates and the medium containing both ICP4¯ helper virus and 7B cells was subjected to three freeze-thaw cycles in order to lyse 7B cells and to release intracellular viral particles. The cell debris was then precipitated by centrifuging at 3,200 x g for 5 minutes (Thermo IEC Centra CL3/CL3R) and the viral supernatant tittered on 7B cells. For amplicon virus production, 7B cells were grown in 100 mm cultural dish containing DMEM with 10% FBS without antibiotics one day before transfection. Monolayer of 90%~95% confluent 7B cells were transfected with 24 μg of the CMV-ICP4 or ARR2PB-ICP4 plasmid DNA using the LipofectamineTM 2000 (Invitrogen) according to the manufacturer's instruction. At 24 h after transfection, the 7B cells were superinfected with the ICP4¯ helper virus at an MOI of 1. Three days after the superinfection, viral supernatant was collected as described above and subjected to further viral amplification by infecting more plates of 7B cells. Finally, the stock virus produced was a mixture of helper and amplicon viruses, and are referred to as CMV-ICP4 amplicon/helper virus and ARR2PB-ICP4 amplicon/helper virus. The virus titer was determined using 7B cells. The helper/amplicon ratio was determined  by  quantitative  real-time  PCR  analysis  using  ICP0  primers  (5’-TTACGTGAACAAGACTATCACGGG-3’ and 5’-TCCATGTCCAGGATGGGC-3’) for determination  of  the  amount  (5’-GGCCTGCTTCCGGATCTC-3’  of and  helper  virus,  and  ICP4  primers  5’-GGTGATGAAGGAGCTGCTGTT-3’)  for  determination of the amount of amplicon virus present in the viral mixture. 2.2.4 Viral infection LNCaP cells (35) were seeded in 6-well plates at a density of 3.5 x 105 cells/well in 2 ml of DMEM medium with 10% charcoal-stripped FBS. After three days, the LNCaP cells were infected with ICP4¯ helper virus, CMV-ICP4 amplicon/helper virus, or ARR2PB-ICP4 amplicon/helper virus at an MOI of 1 and incubated at 37℃ for 1 hour. The medium was then replaced with 2 ml DMEM plus 10% charcoal-stripped FBS with or without R1881 (10 nM). The supernatant was collected and tittered for virus production on 7B cells at 48 hours or 72 hours after infection as described above. The 50  total RNA was extracted from the infected cells at 16 hours after infection by Trizol and subjected to one-step RT-PCR analysis. 2.2.5 Cell viability assay LNCaP cells were seeded in 96-well plates at a density of 3 x 104 cells/well in 50 μL medium and then infected with CMV-ICP4 or ARR2PB-ICP4 amplicon/helper virus at helper virus MOI of 1 on the following day. After 48, 72, 96 and 120 hours of viral infection, live cells were measured by an MTT assay (Cell Proliferation Kit 1; Roche Diagnostics, Indianapolis, IN) for cell viability according to the manufacturer’s instructions (36). 2.2.6 LNCaP xenograft experiments Athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) and LNCaP cancer cells were implanted subcutaneously by injecting 5 x 106 cells in 100 μL of medium with matrigel at four different sites over the shoulders and hind legs on both sides. Animals were monitored for tumor development two times a week by palpation of the injection sites. When detected, tumor volumes were determined by caliper measurements and calculated using the formula volume = width x length x thickness x π/6. When the tumor volume reached approximately 100 mm3 (at ~1 - 1.5 month after tumor inoculation), the mice were treated with two intratumoral injections (second injection at 1 week after first injection) of medium alone, or of 2 x 106 pfu of the ICP4¯ helper virus, CMV-ICP4 amplicon/helper virus, or ARR2PB-ICP4 amplicon/helper virus. Blood was collected by tail-vein bleeding method at days 0, 7 and 14, and the PSA level from the serum was determined using the Abbott’s kits for total PSA MEIA assays on the IMx system. At the end of the treatment period, mice were sacrificed using CO2 asphyxiation, and selected organs (kidney, liver) and the tumors were removed and analyzed. Statistical significance between different treatment groups was determined by Student’s t-test (33). For the study of ARR2PB-ICP4 amplicon/helper virus replication in vivo, a single intratumoral injection of 2 x 106 pfu ARR2PB-ICP4 amplicon/helper virus was administered and tumors were excised from the mice at day 2 (early stage, n = 4) and day 5 (late stage, n = 3). The virus was liberated from the tumors by homogenization in PBS and the virus titer was determined by plaque forming assays on 7B cells. All experimental procedures were approved by the UBC Animal Care 51  Committee and followed the guidelines and policies of the Canadian Council on Animal Care. 2.2.7 DNA, RNA isolation and RT-PCR Total RNA was extracted from LNCaP cells infected with ARR2PB-ICP4 amplicon/helper virus using Trizol (Invitrogen) following manufacturer’s protocol. Two µg of RNA was then converted into cDNA in the one-step RT-PCR reactions. Organs collected from mice were subjected to three freeze-thaw cycles, cut into small pieces and homogenized in 1x PBS buffer using a 2 ml dounce homogenizer. DNA was extracted from the homogenate using the phenol-chloroform extraction method (37). Oligonucleotide primers for ICP0 gene (5’-TTACGTGAACAAGACTATCACGGG-3’ and 5’-TCCATGTCCAGGATGGGC-3’), ICP4 gene (5’-GGCCTGCTTCCGGATCTC -3’ and 5’-GGTGATGAAGGAGCTGCT  GTT-3’),  and  β-actin  gene  (5’-ACGAGGCC  CAGAGCAAGAG-3’ and 5’-TCTCCATGTCGTCCCAGTTG-3’) were designed for one-step RT-PCR and quantitative real-time PCR using the Primer Express 2.0 software (Applied Biosystems, Foster City, CA, USA). All real-time PCR reactions were performed in 25 μL SYBR-green mixture containing the MultiScribe Reverse Transcriptase using the ABI prism 7000 Sequence Detection System (Applied Biosystems). ICP4 mRNA level was first normalized to β-actin mRNA and then compared to the control group (LNCaP infection with ICP4¯ helper virus). DNA copy number was normalized to a standard curve prepared from the stock viral DNA according to the manufacturer’s protocols. 2.2.8 Histochemical staining Harvested tissues were embedded in OCT and 10 μm sections were subjected to X-gal staining (38). Briefly, the sections were fixed with 4% paraformaldehyde for 15 minutes, washed once with 1 x PBS for 5 minutes, and then incubated with 4% X-gal substrate (Invitrogen) in LacZ buffer overnight at 37℃. The following day, the sections were stained with Eosin and pictures were taken using a light microscope.  52  2.3 Results 2.3.1 Prostate-specific expression of ICP4 complements the replication of HSV-1 ICP4- helper virus in LNCaP prostate cancer cells in vitro To test the androgen-responsiveness and the complementing ability of the amplicons to aide in ICP4¯ helper virus replication, LNCaP human prostate cancer cells (35) were infected with ICP4- helper virus alone or ARR2PB-ICP4 (Figure 2.1) at an MOI of 1 (an input virus amount of ~5 x 105 pfu) in the presence or absence of 10 nM of the synthetic androgen, R1881. The virus titer at 72 hours post-infection was determined by plaque forming assays on 7B cells (Figure 2.2A). The results showed that the ICP4¯ helper virus alone was incapable of replicating in LNCaP cells, in keeping with the fact that it lacks the essential IE gene ICP4, whereas both the CMV-ICP4 and ARR2PB-ICP4 amplicons were able to complement the ICP4¯ helper virus to enable its replication in LNCaP cells. Addition of 10 nM of the potent androgen R1881 significantly increased virus titers (t-test, p<0.01) by >2-fold from 2.30±1.69 x106 pfu/ml to 5.88±0.85 x106 for experiments with the ARR2PB-ICP4 amplicon/helper virus but had no effect when the CMV-ICP4 amplicon/helper virus was used. Consistently, ICP4 mRNA was >3-fold higher in the presence of 10 nM R1881 (41.1 ± 2.5) as compared to no androgen treatment (13.4 ± 2.0) (Mean ± SD, n = 4, p<0.01). This is in keeping with the fact that the ARR2PB promoter contains two copies of androgen response elements and is thus very androgen responsive (26). We next determined whether viral replication was dependent on the ratio of helper virus to amplicon. LNCaP cells were infected with ARR2PB-ICP4 amplicon together with helper virus at various helper virus to amplicon ratios (50:1, 100:1, 200:1, 400:1, 800:1, 1600:1) at a final helper virus MOI of 1 in the presence of 10 nM R1881. As shown in Figure 2.2B, virus replication was acutely dependent on the helper to amplicon ratio with an approximately 3.6 and 6-fold increase in the virus titer at a ratio of 50:1 as compared to the virus titer at ratios of 100:1 and 200:1, respectively (5.88±0.85 x106 versus 1.64±0.49 x106 and 0.95±0.27 x106 pfu/ml; p<0.001). It was necessary to confirm that replication of ICP4¯ helper virus was solely dependent on the ARR2PB-ICP4 amplicon and not caused by a reversion to wild-type virus through a recombination event due to the presence of homologous regions (such as OriS and packaging sequence) contained in both the ARR2PB-ICP4 amplicon 53  construct and the ICP4- helper virus. Accordingly, we infected 7B and Vero cells with the ARR2PB-ICP4 amplicon/helper virus stock at various MOI’s from 1 to 10-6. The ICP4¯ helper virus can grow in 7B cells but not in Vero cells, while any recombinant wild-type revertants will grow in both. We speculated that since the amplicon and helper virus must be in the same cell to allow the helper virus to replicate, then by reducing the MOI, the probability of co-existence of both in the same cell would decline to near zero. We found that approximately 1 in 10 amplicons from a stock with a helper to amplicon ratio of 50:1 will infect the same cells with the helper virus enabling the formation of plaques. As expected, no plaques were seen when cells were infected with viral stock at an MOI <10-5 (data not shown). These results support the conclusion that replication of helper virus was entirely dependent on the presence of the amplicon and that no recombinant virus was generated during the preparation of viral stock solutions. Taken together, our results indicated that prostate-specific expression of ICP4 by an amplicon complemented the ICP4¯ helper virus, enabling it to replicate in LNCaP cells, and that with the ARR2PB-ICP4 amplicon, viral replication was androgen-responsive and dependent on the relative amount of amplicon present in the viral infectant. 2.3.2 ARR2PB-ICP4 amplicon virus with helper virus showed substantial cell kill of the LNCaP cancer cells grown in vitro Having found that the ARR2PB-ICP4 amplicon/helper virus was able to complement replication of ICP4¯ helper virus in LNCaP cells, we next used MTT cell kill assays to determine whether the amplicon with helper virus could actually kill the LNCaP cells. With ARR2PB-ICP4 and CMV-ICP4 amplicons approximately 15% and 30% of infected LNCaP cells were killed in the first 72 hours post-infection respectively (Figure 2.3A). By comparison, 75% and 85% of the cells were killed at 96 and 120 hours post-infection respectively, with either amplicon. The delayed cell killing by the amplicons/helper viruses was consistent with the >10-fold increase in the virus titer in LNCaP cell infections. At 48 hours post-infection, the virus titers for ARR2PB-ICP4 and CMV-ICP4 were 2.45±0.041 x105 and 1.875±0.177 x105 pfu/ml respectively (Figure 2.3B). More than a 10-fold increase in the virus number was measured at 72 hours post-infection, with titers of 5.875±0.854 x106 and 2.188±0.178 x106 pfu/ml for ARR2PB-ICP4 and CMV-ICP4 amplicons, respectively.  54  2.3.3 ARR2PB-ICP4 amplicon/helper virus inhibits growth of LNCaP tumor xenografts Since the ARR2PB-ICP4 amplicon/helper virus combination was able to replicate efficiently and kill LNCaP cells in vitro, we next tested the therapeutic efficacy of using this amplicon and helper virus in vivo with the LNCaP xenograft tumor/nude mouse model. When subcutaneous LNCaP tumors grew to approximately 100 mm3 on the flanks of nude mice, two intratumoral viral injections, totaling 2 x 106 pfu viruses, were administered. Subsequently, the size of each tumor was monitored by caliper measurements once every two days, and the fold change in tumor size for each group was determined by comparing the tumor size at each day to the original size at Day 0 (Figure 2.4A). For the control groups treated with either DMEM medium alone or ICP4¯ helper virus alone, a 3 and 3.5-fold increase in tumor size was observed, respectively, at day 22 post-viral treatment. In contrast, mice treated with the CMV-ICP4 and ARR2PB-ICP4 amplicon/helper viruses showed greater than 75% reduction in tumor size at day 16 and at day 20 post-viral treatment, respectively (p < 0.01). These results were consistent with the changes in serum PSA levels (Figure 2.4B), with an approximately 2.5-fold increase in mice treated with ICP4¯ helper virus and a >80% reduction in the serum PSA of mice treated with ARR2PB-ICP4 amplicon/helper virus (p < 0.05). The CMV-ICP4 amplicon/helper virus was highly toxic to the mice as the animals exhibited herpetic lesions on the skin around the viral injection area and had severe hemorrhage in the stomach. As well, two mice in this group died on day 10 and the remainder died on day 16 post-inoculation. By comparison, considerably less toxicity was observed in ARR2PB amplicon/helper virus treated animals. No skin lesions were seen in any of these animals, but gastritis was evident in two out of five animals, resulting in delayed death on day 16 and day 20 post-infection. To assess viral replication within the LNCaP tumor mass in vivo, a total of 2 x 106 pfu of ARR2PB-ICP4 amplicon/helper virus was administered intratumorally in a single dose. Tumors were excised from the mice at day 2 (early stage) and day 5 (late stage) post-viral injection, and the virus was extracted from homogenized tumors. Virus titer (pfu/mg tissue) was determined by plaque assays on 7B cells (Figure 2.4C). At an early stage after viral injection, there was a 2-fold decrease in the amount of virus within LNCaP tumors compared to the amount of input virus, whereas a >10 fold increase was 55  observed at a later stage relative to input virus (p < 0.05). This indicated that ARR2PB-ICP4 amplicon/helper virus was able to replicate within the LNCaP tumors in vivo. 2.3.4 Distribution of the ARR2PB-ICP4 amplicon/helper virus in tumor bearing mice Tissue sections were examined by X-gal staining to determine the presence of viral activity (Figure 2.5). The ICP4¯ helper virus carries the bacterial LacZ gene that encodes β-galactosidase, which can convert the X-gal substrate into a blue form detectable under the microscope. In the tumors, high levels of β-galactosidase activity were  detected  in  animals  treated  with  either  CMV-ICP4  or  ARR2PB-ICP4  amplicon/helper virus. As well, substantial amounts of X-gal staining were evident in both kidney and liver from animals treated with the CMV-ICP4, but not with the ARR2PB-ICP4 amplicon/helper virus (Figure 2.5). Viral DNA in kidney and liver, as well as in the tumor mass, were also identified and quantified by real-time quantitative PCR using the organs collected from mice treated with amplicons and helper viruses at the termination of the experiments (Table 2.1). Viral sequences were detected by real-time PCR in the kidneys and livers from animals infected with CMV-ICP4 or ARR2PB-ICP4 amplicon/helper viruses. While there was a large variation in estimates of viral DNA copy number by quantitative PCR analysis among the samples, higher copy numbers were consistently found in CMV-ICP4 amplicon/helper virus treated animals. 2.4 Discussion The main objective of this study was to determine whether we could selectively direct or restrict the oncolytic activity of a mutated herpes virus to prostate cancer cells by combining it with an amplicon virus which expressed the complementing wild-type gene under a prostate-specific promoter. To achieve this, we exploited the HSV-1 helper virus/amplicon system by inserting the prostate-specific and AR-regulated ARR2PB promoter in front of ICP4, an essential viral gene, in an amplicon to limit its expression to only prostate-derived cells, so that in the presence of ICP4¯ helper virus, lytic viral replication and selective cell killing could only occur in these cells. The HSV-1 amplicon virus contains an HSV-1 replication origin (oriS), a packaging signal sequence, a 56  transgene of interest, and can be packaged into infectious HSV-1 virions in the presence of a transactivating helper virus (28, 39). We constructed two amplicon viruses: CMV-ICP4, a constitutively active, non-tissue selective complementing amplicon; and ARR2PB-ICP4, an AR-enhanced, prostate-specific complementing amplicon (Figure 2.1). We tested the complementing ability of the amplicon viruses to aide in viral replication of the helper virus in LNCaP cells in the presence or absence of the potent, synthetic androgen, R1881. As previously reported (40), the replication-defective ICP4¯ helper virus alone was unable to replicate in the LNCaP cells, but either of the amplicon viruses, CMV-ICP4 or ARR2PB-ICP4, was able to complement the replication of the helper virus in LNCaP cells. In LNCaP cells grown in vitro, CMV-ICP4 amplicon/helper virus was refractory to the addition of androgen, whereas the ARR2PB-ICP4 amplicon/helper virus infection was androgen responsive such that at 72 hours post-infection, the virus titer increased by approximately 2.5-fold in the presence of supplemented androgen (Figure 2.2A). Furthermore, replication of the ARR2PB-ICP4 amplicon/helper virus was dependent on the relative amount of amplicon virus in the viral mixture, as determined by the virus titer obtained from the LNCaP infections with the ARR2PB-ICP4 amplicon/helper virus at various helper:amplicon ratios (Figure 2.2B). To further test this, both 7B (ICP4+) and its parental cell line Vero cells (ICP4¯) were infected with the same stock of CMV-ICP4 amplicon/helper virus and the helper:amplicon ratios in both cells were measured 48hrs after initial infection with the same titer. Interestingly, the ratio of helper:amplicon was significantly reduced in Vero cells but not in 7B cells (data not shown). It is apparent that the dependency of ICP4-expressing amplicon for viral replication generates a selection pressure that is in favor of growth of amplicon since there were approximately 50 helper virus for each amplicon in the initial virus stock and only those cells infected with both helper and the amplicon were permissive for viral replication. Given the reverse correlation between the ratio of helper:amplicon and the oncolytic cytotoxicity of this virus (Figure 2.2 and 2.3), the progressively increased proportion of the amplicon after initial inoculation may enhance the efficiency of the helper/amplicon mixture for tumor lysis when the amplicon complements the helper virus replication in a tumor specific fashion. To determine the potential therapeutic efficacy and relative toxicity of the ARR2PB-ICP4 amplicon/helper virus treatments, we performed in vivo studies using the LNCaP xenograft/nude mouse 57  model (31). The ARR2PB-ICP4 amplicon/helper virus was as effective as the CMV-ICP4 amplicon/helper virus in terms of inhibiting the LNCaP tumor growth, whereas when used alone, the ICP4¯ helper virus had no effect, which is consistent with the fact that the ICP4¯ helper virus is a replication-defective virus incapable of killing tumor cells (Figure 2.4A, 2.4B). The relative amount of virus within the LNCaP tumor mass was found to be 7-fold higher at late stage of viral infection as compared to the input virus, supporting the conclusion that the amplicon was able to complement the replication deficiency in ICP4¯ virus in tumor mass. Together, these results indicate that killing of the tumor cells was a result of viral replication rather than mere cytotoxicity of the virus (Figure 2.4C). With respect to toxicity, the CMV-ICP4 amplicon/helper virus exhibited high levels of toxicity to the treated mice, causing skin lesions, severe hemorrhage in the stomach, and death of all mice within 10 days after the second viral injection. By comparison, the ARR2PB-ICP4 amplicon/helper virus was much less toxic to the mice, although some mild gastritis developed at 10 days after the second viral injection. In order to assess the extent of viral infection to other tissues, histochemical analyses of cross-sections of tumors and normal organs were performed by incubation with X-gal to indicate the presence of the ICP4¯ helper virus, which carries the LacZ gene. Beta-galactosidase activity from both the CMV-ICP4 and ARR2PB-ICP4 amplicon/helper viruses were found extensively throughout the LNCaP tumor mass; with CMV-ICP4 amplicon/helper virus also detected in the normal organs, but not with the ARR2PB-ICP4 amplicon/helper virus (Figure 2.5). However, the relatively more sensitive quantitative real-time PCR substantiated CMV-ICP4 amplicon/helper virus histochemical results and revealed a comparatively small amount of the ARR2PB-ICP4 amplicon/helper virus present in normal tissues, such as liver and kidney (Table 2.1). The reduced activity of ARR2PB-ICP4 amplicon/helper virus in non-prostate normal tissues was unlikely caused by contamination of wild-type virus created by recombination between the amplicon and helper virus during virus production as we have extensively tested this possibility and demonstrated that it was not the case. More likely, the non-prostate specific viral replication may be attributed to the leakage of ARR2PB promoter in the amplicon. Our previous study has shown that HSV-1 ICP0 may interfere with the specificity of some cellular promoters (33), hence, the ICP0 expressed from the helper virus may override the prostate specificity of the ARR2PB promoter to cause low level expression of ICP4 in 58  some cells, resulting in non-prostate specific replication of the virus. To avoid this risk, it may be necessary to create a helper virus with an ICP0¯ backbone, since it has been reported that ICP0 deletion makes the virus capable of replicating in a tumor-specific fashion in some cancer cells (41). This study provides a proof in principle that a tissue-specific promoter driving an essential viral gene in a separate viral construct can complement a replication deficient virus to restrict oncolytic killing to cancer cells derived from the target tissue. The advantages of this approach compared to using recombinant HSV-1 with an essential gene regulated by a tissue-specific exogenous promoter are that 1) the amplicon/helper system is much easier and versatile to create than recombinant HSV-1 viruses; 2) since the regulatory elements of a tissue specific promoter is located outside of the viral genome, less interference from the viral genomic structure may be expected for better control of the transgene expression; and 3) since the oncolytic replication of the helper virus is solely dependent on the presence of amplicon, adjusting the ratio of helper to amplicon can determine the potency of the viral stock for the treatment. Since typically a helper/amplicon ratio from 3 passages is in a range of 1:3 to 3:1, a final ratio for lytic viral replication (50:1 in the present study) can be easily achieved by diluting the stock with various amounts of pure helper virus. In addition, high helper/amplicon ratios reduce the probability of homologous recombination between the amplicon and helper virus. Although outside the scope of the present investigation, to further eliminate the risk, a hybrid viral system could be used (42). For instance, an HSV-1 virus with a complete deletion in the ICP4 region may be used to package an adenovirus-associate virus that carries ARR2PB-ICP4. In this system, the homologous region will be completely eliminated. In conclusion, this study demonstrated that prostate-specific expression of the ICP4 essential gene by an amplicon virus was capable of complementing the replication of an ICP4¯ helper virus in the LNCaP cells, achieving selective killing of the prostate cancer cells both in vitro and in vivo, and that HSV-1 viral replication could be restricted and regulated by incorporating a tissue-specific or tumor-specific element in front of an essential viral gene to achieve oncolytic selectivity.  59  Figure 2.1 Structure of the two amplicon plasmids used in these studies. The CMV-ICP4 amplicon is a constitutive, non-tissue selective complementing amplicon whereas the ARR2PB-ICP4 amplicon is an androgen-regulated, prostate-specific complementing amplicon.  60  A  + R1881  7  - R1881  6  6  Virus Titre (x 10 pfu/ml)  8  5 4 3 2 1 0  ICP4-  CMV-ICP4  ARR2PB-ICP4  B  6  Virus Titre (x 10 pfu/ml)  8 7  ARR2PB-ICP4  6 5 4 3 2 1 0 50  100  200  400  800  1600  Helper/Amplicon Ratio  Figure 2.2 Prostate-specific expression of ICP4 complements the replication of the ICP4- helper virus in LNCaP cancer cells in an androgen-responsive and amplicon-dependent manner. (A) LNCaP cells were infected with ICP4¯ helper virus, CMV-ICP4 or ARR2PB-ICP4 amplicon/helper virus with a helper/amplicon ratio of 50:1 at an MOI of 1 and the virus titer was determined at 72 hours post-infection in the presence or absence of 10 nM R1881. (B) LNCaP cells were infected with ARR2PB-ICP4 amplicon/helper virus at different helper/amplicon ratios in the presence of 10 nM R1881, and the virus titer was determined at 72 hours post-infection. The mean plaque forming units/ml ± SD were calculated from four independent determinations. 61  A 100 90  CMV-ICP4  Cell Viability (% of total cells)  80  ARR2PB-ICP4  70 60 50 40 30 20 10 0 48 hrs  72 hrs  96 hrs  120 hrs  Hours post-infection  B 8 7  72 hrs  5 4  6  Virus Titre  (x10 pfu/ml)  6  48 hrs  3 2 1 0 CMV-ICP4  ARR2PB-ICP4  Figure 2.3 CMV-ICP4 and ARR2PB-ICP4 amplicon/helper viruses showed substantial cell killing of the LNCaP tumor cells in vitro. (A) LNCaP cells were infected with the CMV-ICP4 and ARR2PB-ICP4 amplicon/helper viruses at a helper/amplicon ratio of 50:1 with an MOI of 1. Results from MTT assays for cell viability, performed at 48, 72, 96, and 120 hours post-infection, are expressed as mean ± SD of six determinations. (B) LNCaP cells were infected with CMV-ICP4 or ARR2PB-ICP4 amplicon/helper virus with a helper/amplicon ratio of 50:1 at an MOI of 1 in the presence of 10 nM R1881. The virus titer was determined at 48 and 72 hours post-infection. The mean plaque forming units/ml ± SD were calculated from four independent determinations. 62  A Average fold change in tumor size  6 5 4 3 2 1 0 0  -1  2  4  6  8  10  12  14  16  18  20  22  Days post-viral injection  B  Fold Change in PSA level  4 3.5 3  ICP4- Helper ARR2PB-ICP4  2.5 2 1.5 1 0.5 0 Day 0  Day 7  Day 14  Days post-viral injection  C  4  Virus Titre (x 10 pfu/mg)  18 16 14 12 10 8 6 4 2 0 Input  Early  Late  Stage of Viral Infection  Figure 2.4 Efficient tumor growth suppression by intratumoral injections of amplicons and helper virus using the LNCaP xenograft model. (A) Nude mice with subcutaneous LNCaP tumors were treated with two intratumoral viral injections (Day 0 and Day 6) of medium alone (  ), ICP4¯ helper virus alone (  ), CMV-ICP4 63  amplicon/helper virus (  ), or ARR2PB-ICP4 amplicon/helper virus (  ) (at a  6  helper/amplicon ratio of 50:1) for a total of 2 x 10 pfu. The mean fold change in tumor size was determined by comparing the tumor size from each day to the original size at Day 0 and the average was plotted on the graph (n = 3 - 5 for each group). (B) PSA levels (ng/ml) of the mice treated with ICP4¯ helper virus and ARR2PB-ICP4 amplicon/helper virus were determined by tail vein bleeding at Day 0, 7, and 14 and the sera were subjected to ELISA assays for PSA. The results were expressed as the mean of the fold changes in PSA level as compared to Day 0 (ICP4-, n = 3; ARR2PB-ICP4, n = 5). (C) Virus was extracted from LNCaP tumors treated with 2 x 106 pfu of ARR2PB-ICP4 amplicon/helper virus at Day 2 (Early, n = 4) and Day 5 (Late, n = 3) and the mean titer ± SD was determined by plaque forming assays on 7B cells.  64  Figure 2.5 Prostate-specific targeting of the ARR2PB-ICP4 amplicon/helper virus in vivo. Organs were collected at the time when mice had to be sacrificed due to morbidities or at day 22 post-viral injection. Histochemical analysis of the 10 μm sections of LNCaP tumor, kidney and liver, collected from mice treated with either CMV-ICP4 or ARR2PB-ICP4 amplicon/helper virus were analyzed by X-gal staining for the presence of the ICP4¯ helper virus, which is indicated by the dark blue color.  65  Table 2.1 Relative copy number of the ICP0 gene per μg of total cellular DNA as an index for the amount of virus present within normal tissues and LNCaP tumors Mouse  CMV-ICP4  Mouse  Kidney  Liver  Tumor  1  16.63  1.63  8,464  1  2  157.09  0.09  6,570  2  3  15.10  33.33  ND  Mean ND  62.94  11.68  7,517  ARR2PB-ICP4 Kidney  Liver  Tumor  11.29  0.33  3,702  0.001  0.01  8,878  3  2.23  1.04  2,224  4  12.17  5.90  2,921  6.42  1.82  4,431  Not determined  66  2.5 References 1.  Edwards BK, Brown ML, Wingo PA, et al. Annual report to the nation on the status of cancer, 1975-2002, featuring population-based trends in cancer treatment. J Natl Cancer Inst 2005;97:1407-27.  2.  Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2006. CA Cancer J Clin 2006;56:106-30.  3.  Bagnall S, Klotz L. Conservative versus radical therapy of prostate cancer: how have recent advances in molecular markers and imaging enhanced our ability to prognosticate risk? Semin Oncol 2003;30:587-95.  4.  Fleshner N. Defining high-risk prostate cancer: current status. Can J Urol 2005;12 Suppl 1:14-7; discussion 94-6.  5.  Oefelein MG, Agarwal PK, Resnick MI. Survival of patients with hormone refractory prostate cancer in the prostate specific antigen era. J Urol 2004;171:1525-8.  6.  Gleave M, Goldenberg SL, Bruchovsky N, Rennie P. Intermittent androgen suppression for prostate cancer: rationale and clinical experience. Prostate Cancer Prostatic Dis 1998;1:289-96.  7.  Albertsen PC, Hanley JA, Fine J. 20-year outcomes following conservative management of clinically localized prostate cancer. Jama 2005;293:2095-101.  8.  Martel CL, Gumerlock PH, Meyers FJ, Lara PN. Current strategies in the management of hormone refractory prostate cancer. Cancer Treat Rev 2003;29:171-87.  9.  Kent EC, Hussain MH. The patient with hormone-refractory prostate cancer: determining who, when, and how to treat. Urology 2003;62 Suppl 1:134-40.  10.  So A, Gleave M, Hurtado-Col A, Nelson C. Mechanisms of the development of androgen independence in prostate cancer. World J Urol 2005;23:1-9.  11.  Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 2004;351:1502-12.  12.  Petrylak DP. Future directions in the treatment of androgen-independent prostate cancer. Urology 2005;65:8-12.  13.  Satoh T, Irie A, Egawa S, Baba S. In situ gene therapy for prostate cancer. Curr Gene Ther 2005;5:111-9.  14.  Hsieh CL, Kubo H, Chung LW. Gene therapy for prostate cancer bone metastasis. 67  Gene therapy targeting bone metastasis. Cancer Treat Res 2004;118:231-90. 15.  Foley R, Lawler M, Hollywood D. Gene-based therapy in prostate cancer. Lancet Oncol 2004;5:469-79.  16.  Lu Y. Viral based gene therapy for prostate cancer. Curr Gene Ther 2001;1:183-200.  17.  Lachmann R. Herpes simplex virus-based vectors. Int J Exp Pathol 2004;85:177-90.  18.  Mineta T, Rabkin SD, Yazaki T, Hunter WD, Martuza RL. Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1995;1:938-43.  19.  Markert JM, Medlock MD, Rabkin SD, et al. Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene Ther 2000;7:867-74.  20.  MacKie RM, Stewart B, Brown SM. Intralesional injection of herpes simplex virus 1716 in metastatic melanoma. Lancet 2001;357:525-6.  21.  Liu BL, Robinson M, Han ZQ, et al. ICP34.5 deleted herpes simplex virus with enhanced oncolytic, immune stimulating, and anti-tumor properties. Gene Ther 2003;10:292-303.  22.  Coffin R, Liu B, Han Z, Simpson G, Hu J, Coombes C OncoVEX: A family of oncolytic herpes simplex viruses optimized for therapeutic use. In: ASCO Annual Meeting, Orlando, FL,  23.  2004, pp. 2601.  Kooby DA, Carew JF, Halterman MW, et al. Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207). Faseb J 1999;13:1325-34.  24.  Roizman B, Knipe D Herpes Simplex Viruses and their Replication. Phladelphia: Lippincott Williams & Wilkins, 2001.  25.  Mocarski ES, Roizman B. Structure and role of the herpes simplex virus DNA termini in inversion, circularization and generation of virion DNA. Cell 1982;31:89-97.  26.  Zhang J, Thomas TZ, Kasper S, Matusik RJ. A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoids in vitro and in vivo. Endocrinology 2000;141:4698-710. 68  27.  Johnson PA, Miyanohara A, Levine F, Cahill T, Friedmann T. Cytotoxicity of a replication-defective  mutant  of  herpes  simplex  virus  type  1.  J  Virol  1992;66:2952-65. 28.  Spaete RR, Frenkel N. The herpes simplex virus amplicon: a new eucaryotic defective-virus cloning-amplifying vector. Cell 1982;30:295-304.  29.  Wei C, Willis RA, Tilton BR, et al. Tissue-specific expression of the human prostate-specific antigen gene in transgenic mice: implications for tolerance and immunotherapy. Proc Natl Acad Sci U S A 1997;94:6369-74.  30.  Gotoh A, Ko SC, Shirakawa T, et al. Development of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. J Urol 1998;160:220-9.  31.  Yu D, Jia WW, Gleave ME, Nelson CC, Rennie PS. Prostate-tumor targeting of gene expression by lentiviral vectors containing elements of the probasin promoter. Prostate 2004;59:370-82.  32.  Yu D, Scott C, Jia WW, et al. Targeting and killing of prostate cancer cells using lentiviral constructs containing a sequence recognized by translation factor eIF4E and a prostate-specific promoter. Cancer Gene Ther 2006;13:32-43.  33.  Yang CT, Song J, Bu X, et al. Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells. Gene Ther 2003;10:1494-502.  34.  Krisky DM, Wolfe D, Goins WF, et al. Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits long-term gene expression in neurons. Gene Ther 1998;5:1593-603.  35.  Hasenson M, Hartley-Asp B, Kihlfors C, Lundin A, Gustafsson JA, Pousette A. Effect of hormones on growth and ATP content of a human prostatic carcinoma cell line, LNCaP-r. Prostate 1985;7:183-94.  36.  Curi MA, Skelly CL, Meyerson SL, et al. Sustained inhibition of experimental neointimal hyperplasia with a genetically modified herpes simplex virus. J Vasc Surg 2003;37:1294-300.  37.  Kochl S, Niederstatter H, Parson W. DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR. Methods Mol Biol 2005;297:13-30.  38.  Park F, Ohashi K, Kay MA. The effect of age on hepatic gene transfer with 69  self-inactivating lentiviral vectors in vivo. Mol Ther 2003;8:314-23. 39.  Geller AI, Breakefield XO. A defective HSV-1 vector expresses Escherichia coli beta-galactosidase in cultured peripheral neurons. Science 1988;241:1667-9.  40.  DeLuca NA, McCarthy AM, Schaffer PA. Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. J Virol 1985;56:558-70.  41.  Hummel JL, Safroneeva E, Mossman KL. The role of ICP0-Null HSV-1 and interferon signaling defects in the effective treatment of breast adenocarcinoma. Mol Ther 2005;12:1101-10.  42.  Glauser DL, Ackermann M, Saydam O, Fraefel C. Chimeric herpes simplex virus/adeno-associated virus amplicon vectors. Curr Gene Ther 2006;6:315-24.  70  3  MicroRNA regulation of oncolytic herpes simplex virus type 1 for selective  killing of prostate cancer cells *  3.1 Introduction Prostate cancer is the most commonly diagnosed non-skin cancer in men and one of the leading causes of cancer-death (1). While frequently curable in its early stage by surgical or radiation ablation, many patients will present with locally advanced or metastatic disease for which there are currently no curative treatment options (2-4). Although androgen withdrawal therapies, which block the growth promoting effects of androgens,  are  often  used  to  treat  advanced  disease,  progression  to  a  castration-resistant state is the usual outcome, giving rise to a median survival of ~18 months (5). Brief survival extensions can sometimes be achieved using current docetaxel-based chemotherapy protocols (6). However, to have any major impact on current survival rates, more effective new treatment strategies need to be developed. In this regard, oncolytic virotherapy offers a promising therapeutic option for treating locally advanced as well as recurrent, metastatic, castration-resistant forms of prostate cancer (7, 8). In particular, herpes simplex virus type-1 (HSV-1) has proven to be an excellent viral vector with various forms of replication-defective or replication-conditional vectors having been developed to treat different types of cancer (9, 10). The replicative and oncolytic nature of these viruses permit in situ viral multiplication and spread of the viral infection throughout the tumor mass causing lytic cell death. Several phase I clinical trials have demonstrated that HSV-1 viral therapy was well tolerated by patients and in some cases, showed considerable efficacy (11, 12). A key issue in developing a safe and effective oncolytic virotherapy is the achievement of maximal killing of tumor cells while maintaining tumor specificity of viral targeting (13-15). We have recently shown that a replication defective HSV-1 helper virus (CgalΔ3), lacking the essential ICP4 gene, became oncolytic in a tissue-type specific fashion when the ICP4 gene was provided by an amplicon expressing this gene under the regulation of a prostate-specific promoter, ARR2PB (16). While others have also attempted to incorporate tissue-specific promoters in front of suicide and/or *  A version of this chapter has been published. Lee, C.Y., Rennie, P.S., and Jia, W.W. (2009) MicroRNA regulation of oncolytic herpes simplex virus type 1 for selective killing of prostate cancer cells. Clinical Cancer Research; 15(16): 5126-5135.  71  essential viral genes to achieve specific killing of cancer cells, nonspecific toxicity to normal tissues, due to leaky promoters has remained a problem (17, 18) and suggests improved stringency of oncolytic viral targeting needs to be developed. One approach to achieve this is to take advantage of unique tissues-associated patterns of expression of microRNAs (miRNAs). MiRNAs are ~22 nucleotides, noncoding small RNAs that are known to play important regulatory roles in cell proliferation, cell differentiation, apoptosis and tumorigenesis by binding to the 3’UTR of the targeted mRNAs and thereby promoting either mRNA cleavage or repression of gene expression at the posttranscriptional level (19-21). Differential miRNA expression profiles between normal and cancer cells have been shown by microarray analysis of clinical samples and several miRNA signatures within the genome have been proven to be promising biomarkers for prognosis and diagnosis of cancers (22, 23). Recent studies have also shown that some miRNAs are overexpressed and some are downregulated in several cancer cells as compared to their normal tissues of origin, suggesting that these miRNAs may play a role as oncogenes or tumor suppressors in the tumorigenesis of various human cancers (24-26). Based on these observations, we have developed a novel strategy for targeting tumor cells by taking advantage of the differential miRNA expression level between normal and cancer cells. We hypothesized that tumor-specific targeting of oncolytic HSV-1 virus could be achieved at the translational level by incorporating multiple copies of miRNA target sequences into the 3’UTR of the essential viral gene, ICP4. To test this hypothesis, we constructed an ICP4-expressing amplicon containing 3’UTR target sequence of miR-143 and miR-145, which are expressed in normal tissues but generally downregulated in many types of cancer cells and clinical samples including those from breast cancer (27), colorectal cancer (28, 29), cervical cancer (30), ovarian cancer (31), liver cancer (32), B-cell malignancies (33), and prostate cancer (34, 35). In principle, this should permit unimpeded translation of the ICP4 gene in cancer cells and subsequent oncolysis, but enable protection of normal cells due to degradation of the amplicon transcript by miR-143 or miR-145. In the present study, we demonstrate tumor-specific targeting of miRNA-regulated oncolytic HSV-1 viruses for killing prostate cancer cells both in vitro and in vivo.  72  3.2 Materials and Methods  3.2.1 Plasmid constructs Five tandem copies of miR-143 complementary sequences (143T) and four copies of miR-145 complementary sequence (145T) were generated by PCR reaction from the template  5’-CTCGAGCGGTTAATTAACGTGAGCTACAGTGCTTCATCTCACGATTGA  GCTACAGTGCTTCATCTCAGATCTGAGCTACAGTGCTTCATCTCAGTCATGAGCTAC AGTGCTTCATCTCAGTCATGAGCTACAGTGCTTCATCTCAGCTATCGATGCAGTCTA GA-3’ and 5’-CTCGAGCGGTTAATTAACGAAGGGATTCCTGGGAAAACTGGACCGAT AAGGGATTCCTGGGAAAACTGGACGATCAAGGGATTCCTGGGAAAACTGGACG TCAAAGGGATTCCTGGGAAAACTGGACGCTATCGATGCAGTCTAGA,  respectively  (Integrated DNA Technologies, Coralville, USA). The primers used to PCR amplify these miRT fragments  were  5’-GACGCTCG  AGCGGTTAATTAACG-3’ (forward)  and  5’-GCAGTCTAGACTGCATCGATAGC-3’ (reverse). The ICP4 gene (~4 kb) and the miRT fragments, excised by XhoI and XbaI digestion, were then cloned into the pcDNA3.0-neo vector, which contains the viral packaging signal and deletion of the neomycin gene, to generate CMV-ICP4-143T and CMV-ICP4-145T plasmids (Figure 3.1).  3.2.2 Cell cultures LNCaP (36), DU145, PC-3, 293T human embryo kidney cells, and Vero cells were obtained from American Type Culture Collection (ATCC; Manasas, VA), and 7B was kindly provided by Dr. William Goins (University of Pittsburgh School of Medicine). All cell lines were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS and antibiotics containing penicillin and streptomycin. Vero and 7B cells are monkey kidney cells used to package amplicon viruses as previously described (16). LNCaP, DU145 and PC-3 are human prostate cancer cell lines and LNCaP-Luc is a derived stable cell line that expresses luciferase.  3.2.3 Viruses The replication-deficient ICP4- helper virus (Cgal 3) and all of the amplicon viruses were packaged, propagated and tittered in 7B cells as previously described (16). Briefly, monolayer of 7B cells were transfected with 24 μg of the amplicon plasmid DNA using 73  the LipofectamineTM 2000 (Invitrogen) according to the manufacturer's instruction. At 24 hr after transfection, cells were superinfected with ICP4¯ helper virus at a multiplicity of infectivity (MOI) of 1 and the virus was collected three days after superinfection. The amplicon viruses were then amplified and propagated by infecting more 7B cells. Since the stock virus produced was a mixture of helper and amplicon viruses, virus titer and the helper/amplicon ratio was determined by tittering the virus both in Vero and 7B cells. Amplicon virus titer was determined by plaque forming assay in Vero cells, which does not complement ICP4 gene, and helper virus titer was determined in 7B cells, which expresses the ICP4 gene.  3.2.4 Transfection of precursor miRNA and viral infection LNCaP cells were seeded in 12-well plates at a density of 3 x 105 cells/well in 2 ml DMEM medium with 10% FBS and no antibiotics. The next day, cells were co-transfected with 300 ng of the amplicon plasmid (CMV-ICP4, CMV-ICP4-143T or CMV-ICP4-145T) and precursor miRNA (pre-miR-143 or pre-miR-145; Ambion, Texas, USA) at a concentration of 0 nM, 0.1 nM, 1 nM, 5 nM, 10 nM, 20 nM, and 50 nM using LipofectamineTM 2000. The same cells were then superinfected with ICP4¯ helper virus at an MOI of 1 after 24 hours co-transfection. At 24 hour post-superinfection, protein samples and total RNA were extracted and subjected to Western blot and one-step real-time RT-PCR analysis. Viral supernatant was also collected at 48 hours post superinfection and titered on 7B cells. To study the effect of miRNA on viral replication, LNCaP cells were transfected with 0 nM or 20 nM of miR-143 or miR-145 and 24 hour later the same cells were infected with CMV-ICP4, CMV-ICP4-143T or CMV-ICP4-145T amplicon virus at an MOI of 0.1 (input virus = 104 pfu). At 72 hours post-viral infection, virus was collected and titered in 7B cells.  3.2.5 Western blotting LNCaP cells were lysed with 2X sample buffer (100 mM Tris-HCL, 4% SDS, 20% glycerol, 357 mM β-mercaptoethanol, 0.04% bromophenol blue) and boiled for 5 min. Protein samples were subjected to SDS-PAGE and then transferred to a nitrocellulose membrane. The membrane was blocked in 5% non-fat milk (Bio-Rad Laboratories, Ontario, Canada) at room temperature for 1 hour and then incubated with primary antibodies overnight at 4°C. Next day, the membrane was washed with Tris-Buffered 74  Saline Tween-20 (TBST), incubated with secondary antibody at room temperature for 1 hour, and then washed with TBST again before imaged using ECL reagent (Perkim Elmer, Boston, MA) and VersaDoc imaging system (Bio-Rad). Primary antibodies were prepared in 5% BSA in TBST with the following dilutions: anti-ICP4 (EastCoast Bio Inc., North Berwick, ME) at 1:800 dilution (37), anti-ICP27 (Virusys Corporation, Sykesville, MD) at 1:800 dilution (37, 38), and anti-β-actin (Cell Signaling, Danvers, MA) at 1:1000 dilution. Anti-mouse and anti-rabbit secondary antibodies were prepared in TBST at a 1:2000 dilution (Cell Signaling). Band density was determined using ImageJ software (NIH).  3.2.6 DNA, RNA extraction and RT-PCR DNA was extracted from the organs of the mice treated with amplicon viruses using the phenol-chloroform extraction method and ICP4 copy number was determined by quantitative real-time PCR using the same ICP4 primers and method as previously described (16). Total RNA was extracted from the cell lines and mouse organs using Trizol (Invitrogen) following manufacturer’s protocol. To determine ICP4 mRNA levels in co-transfection studies, 200 ng RNA was used in one-step real-time RT-PCR using the same primers as previously described (16). All RT-PCR reactions were performed in 25 μL SYBR-green mixture containing the MultiScribe Reverse Transcriptase using the ABI prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). ICP4 mRNA level was first normalized to β-actin mRNA level (ΔCT = CTICP4 – CTActin) and then compared to the negative control group where LNCaP cell was infected with ICP4¯ helper virus only (ΔΔCT = ΔCT – ΔCTICP4-). The results were expressed as 2-ΔΔCT. TaqMan miRNA assay kit (Applied Biosystems) was used to determine the expression level of miR-143 and miR-145, which were normalized to U6 (endogenous control for human cells) or snoRNA234 (endogenous control for mouse tissues) to give ΔCT values and then compared to negative control where miRNA was undetectable, to get ΔΔCT values. Reverse transcription (RT) and real-time PCR were performed as instructed by the company. Briefly, 10 ng RNA was first converted into cDNA in 96-well optical plate at the following conditions: 16°C for 30 min., 42°C for 30 min. and 85°C for 5 min. One μL of the RT product was then subjected to real-time PCR assay in 96-well optical plate at 95°C for 10 min., followed by 40 cycles of 95°C for 15 sec. and 60°C for 1 min.  75  3.2.7 LNCaP xenograft mouse model Athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) and LNCaP-Luc cells were inoculated subcutaneously by injecting 5 x 106 cells in 100 μL of medium with matrigel at two different sites on the flanks. Tumor volumes were determined by caliper measurements and calculated using the formula volume = width x length x thickness x π/6. Once the tumor size reached approximately 100 mm3, mice were treated with two intratumoral injections (at Day 0 and Day 7) of 1 x 106 pfu of the ICP4¯ helper virus, CMV-ICP4, CMV-ICP4-143T, and CMV-ICP4-145T amplicon virus. At the end of the experiment, mice were sacrificed using CO2 asphyxiation and several organs (brain, heart, kidneys, liver, lung, spleen, stomach, prostate, bladder, testes) and the tumors were removed and analyzed by histochemical and real-time PCR analysis. For imaging the tumors, mice were injected with D-Luciferin intraperitoneally at a concentration of 150 μg luciferin / g of body weight 15 minutes prior to imaging with the IVIS 200 system (Caliper Life Sciences, Ontario, Canada). All experimental procedures were approved by UBC Animal Care Committee and followed the guidelines and policies of Canadian Council on Animal Care.  3.2.8 Histochemical staining Harvested tissues were embedded in OCT (Sakura Tissue-Tek, Kobe, Japan) and 10 μm sections of the organs were prepared on slides, fixed with 4% paraformaldehyde for 30 minutes, washed with PBS, and then subjected to X-gal staining using a commercial kit (Novagen, Gibbstown, NJ) overnight at 37°C. Next day, the slides were counterstained with eosin. Pictures of the slides were taken at 5X magnification using a light microscope and detection of virus was indicated by a dark blue color.  3.2.9 Statistical analysis Statistical significance (p-value <0.05) is determined using student’s t-test and data are presented as mean ± SD.  76  3.3 Results  3.3.1 MiR-143 and miR-145 are downregulated in LNCaP cells, but highly expressed in normal mouse prostates MiR-143 and miR-145 have been reported to be downregulated in many prostate cancer cells (26, 28, 34, 35). Using quantitative RT-PCR, we verified that the expression of miR-143 and miR-145 are downregulated in LNCaP, DU145 and PC-3 cells (Figure 3.2A). We also confirmed that miR-143 and miR-145 are not expressed in 7B cells. Their absence is essential for efficient packaging of the amplicon viruses containing miR-143 and miR-145 target sequences. Despite their expression being lost in many cell lines (data not shown), an abundance of miR-143 and miR-145 was found in most normal organs including mouse prostate (Figure 3.2B). The expression pattern of miR-143 and miR-145 was similar in all organs examined with the highest levels in bladder and stomach; moderate levels in prostate, heart, lung, spleen and kidney; and relatively lower expression levels in eyes, brain, liver and testes. A similar expression pattern of miR-143 has also been reported in human tissues (39).  3.3.2 Regulation of ICP4 gene expression through inclusion of miR-143 and miR-145 target sequences in the 3’UTR We generated three amplicon constructs carrying the ICP4 gene under the CMV promoter with either five copies of miR-143 or four copies of miR-145 complementary target sequences in the 3’UTRs (Figure 3.1). The amplicons also contained a viral origin of replication and a packaging signal, which facilitated replication and packaging of the amplicon virus by ICP4¯ helper virus in host cells. The helper virus used to package the amplicon viruses in this study was a replication-deficient recombinant ICP4¯ helper virus (Cgal 3), which lacked the ICP4 gene and could not replicate by itself unless in a complementing cell line or in the presence of a complementing amplicon (16, 40). We then investigated the effect of miR-143 and miR-145 on ICP4 expression in LNCaP cells. When pre-miR-143 or pre-miR-145 was co-transfected with the amplicon plasmid into LNCaP cells, miR-143 and miR-145 inhibited ICP4 expression driven by CMV-ICP4-143T  and  CMV-ICP4-145T  amplicons  (Figure  3.1),  in  a  concentration-dependent manner (Figure 3.3A & B). A 50% reduction in ICP4 protein level was observed when CMV-ICP4-143T was co-transfected with 5 nM pre-miR143 77  and when CMV-ICP4-145T was co-transfected with 10 nM pre-miR145 as compared to the controls (p<0.05). In both cases, there was a ~60-70% reduction in ICP4 protein level in the presence of higher miRNA concentrations (20 nM and 50 nM). The expression of ICP27 protein, another essential viral gene (endogenous control), was not affected by the expression of miR-143 or miR-145, indicating that the reduction of ICP4 protein was a direct effect of miR-143 and miR-145 activity on their 3’UTR targets; not a result of reduced viral infectivity. Since miR-143 and miR-145 bind to the target sequences in the 3’UTR of CMV-ICP4-143T and CMV-ICP4-145T with perfect complementarity, ICP4 mRNA would be subjected to degradation by RNA-induced silencing complex (RISC). Indeed, a 62% reduction in ICP4 mRNA level was observed when CMV-ICP4-143T was co-transfected with 10 nM pre-miR143 (Figure 3.3C; p < 0.05) and a 37% reduction in ICP4 mRNA was observed when CMV-ICP4-145T was co-transfected with 20 nM pre-miR145 (Figure 3.3D; p < 0.05). Reciprocally miR-143 had no effect on CMV-ICP4-145T nor did miR-145 on CMV-ICP4-143T; indicating that both microRNAs suppress ICP4 expression in a sequence-specific manner.  3.3.3 MiR-143 and miR-145 inhibit replication of miRNA-regulated amplicon viruses in a dose-dependant manner To demonstrate that miRNA could control viral replication through the regulation of ICP4 expression, virus titers were measured in LNCaP cells first pre-transfected with miR-143 and miR-145 and then followed by infection with amplicon viruses. Approximately a 2-fold decrease in virus titer was observed when LNCaP cells, infected with CMV-ICP4 amplicon virus, were pre-transfected with 20 nM miR-143 or miR-145 as compared to no miRNA transfection (Figure 3.4A). With the CMV-ICP4-143T amplicon virus, the virus titer was 6-fold and 3-fold less when LNCaP cells were pre-transfected with 20 nM miR-143, as compared to 0 nM or 20 nM of miR-145 (p < 0.05). With the CMV-ICP4-145T amplicon virus, the virus titer was 3-fold less when LNCaP cells were pre-transfected with 20 nM miR-145 relative to 0 nM or 20 nM miR-143 (p < 0.05). These results indicate that viral replication is greatly reduced when the infected LNCaP cells express the appropriate miRNA. This inhibition of viral replication was miRNA sequence-specific and dose responsive with increasing miRNA concentration (Figure 3.4B and C). MiR-143 was able to inhibit the complementing ability of CMV-ICP4-143T amplicon, but not CMV-ICP4-145T (Figure 3.4B). The virus titer was 6-fold less when 78  CMV-ICP4-143T was co-transfected with 20 nM and 50 nM of pre-miR143 relative to 0.1 nM of this miRNA. Pre-miR-143 showed no effect on the CMV-ICP4-145T amplicon’s complementing ability. Similarly, a 4-fold reduction in virus titer was observed when CMV-ICP4-145T was co-transfected with 20 nM and 50 nM of pre-miR145 as compared to the titer at 0.1 nM of this miRNA. Pre-miR-145 had no inhibitory effect on CMV-ICP4-143T amplicon (Figure 3.4C). The amount of transfected miRNAs may not reflect actual intracellular miRNA levels required for suppression of viral replication. However, we have created a cell line, LNCaP-miR143, which expresses endogenous miR-143 at similar levels as in normal mouse tissues. Seventy percent of these cells were protected from CMV-ICP4-143T viral infection at 120 hr post infection, whereas 70% of the parental LNCaP cells were dead (data not shown). These results demonstrate that miRNAs can inhibit the ability of amplicons to complement the replication of helper virus in a dose-dependent manner through the presence of specific 3’UTR target sequences and thereby regulate viral replication at the translational level.  3.3.4 MiRNA-regulated amplicon viruses can selectively suppress LNCaP tumor growth The therapeutic efficacy of these miRNA-regulated amplicon viruses was next tested in vivo using immunocompromised nude mice bearing subcutaneous LNCaP-Luc tumors (~120 ± 14 mm3), which are a LNCaP-derived cell line expressing luciferase. The animals were treated with intratumoral injections of 2 x 106 pfu amplicon viruses. Tumor volume was determined by calliper measurements and luciferase in the tumor mass was visualized using an IVIS imaging system. At 28 days post-viral injection, a >3.5-fold increase in tumor volume was observed in mice treated with the non-oncolytic ICP4¯ helper virus and a >80% decrease in tumor size was observed in mice treated with CMV-ICP4, CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses (Figure 3.5A). Mice treated with CMV-ICP4 amplicon virus developed herpetic skin lesions around injection sites which caused death as early as 14 days after viral treatment. In contrast, no herpetic lesions were seen in CMV-ICP4-143T and CMV-ICP4-145T treated animals, although some gastritis developed 28 days after the viral treatment. Furthermore, tumors were almost completely eradicated in three out of the seven mice treated with CMV-ICP4-143T and two out of the five mice treated with CMV-ICP4-145T. Using an IVIS imaging system, a >80% reduction in luciferase activity was observed in mice 79  treated with the miRNA-regulated amplicon viruses (Figure 3.5B). These results showed that the miRNA-regulated amplicon viruses were able to selectively kill LNCaP tumor cells.  3.3.5 MiR-143 and miR-145 protect normal tissues from miRNA-regulated oncolytic viral infections To examine the extent of viral replication outside the tumor mass, several organs were harvested from mice treated with miRNA-regulated amplicon viruses. Ten micrometer sections were stained with x-gal substrate for β-galactosidase activity, as an indicator of the presence of helper virus, which carried a lacZ reporter gene. High levels of β-galactosidase activity were detected in the tumor mass in all treatment groups. LacZ staining was also observed in other organs such as the kidney, prostate and bladder in mice treated with CMV-ICP4 amplicon virus but not in mice treated with CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses (Figure 3.6A). The extent of viral spread was also examined by determining the presence of the ICP4 gene in normal tissues and in LNCaP-Luc tumors using real-time PCR assays (Figure 3.6B). The extent of amplicon virus infection is indicated by the relative copy number of ICP4 (per μg of total DNA) in each organ. With the exception of the stomach, the results indicate that the most amplicon virus was found in tumors for all three treatment groups. Some amplicon virus was also present in the heart, kidney, liver and prostate of mice treated with CMV-ICP4 or CMV-ICP4-145T amplicon virus, whereas no virus was detected in these organs in mice treated with CMV-ICP4-143T amplicon virus except in the stomach. Even in this organ, the ICP4 copy number was >3300-fold less in mice treated with CMV-ICP4-143T than in mice treated with CMV-ICP4 amplicon virus.  3.4 Discussion The microRNAs, miR-143 and miR-145, have been reported to be downregulated in various cancer types (27-35). This is consistent with our findings in the present study (Figure 3.2). Based on these findings, we cloned multiple tandem copies of their complementary target sequences into the 3’UTR region of the viral essential gene, ICP4 (Figure 3.1). The number of copies of miRNA binding sites in the 3’UTR was decided based on previously published work (41, 42), which indicated that approximately 4 copies may be sufficient. In vitro, the presence of 3’UTR target sequences for miR-143 80  and miR-145 specifically and efficiently reduced both ICP4 mRNA and protein expression levels (Figure 3.3). MiR-143 and miR-145 inhibited the complementing ability of the amplicon virus and viral replication in a sequence-specific and dose-dependent manner (Figure 3.4). Interestingly, the virus titers of CMV-ICP4 amplicon virus, which did not carry any 3’ miRNA target sequences were also slightly lower in cells pre-treated with 20 nM miR-143 or miR-145, suggesting that HSV-1 viral infection/replication was somewhat hindered in LNCaP cells transfected to express miR-143 or miR-145. One explanation was that miR-143 and miR-145 directly or indirectly downregulated cellular genes that were required for efficient HSV-1 viral infection or viral replication (39, 43). Another possibility was that miR-143 and miR-145 directly downregulated viral genes carried by the helper virus thereby causing reduced efficiency of viral replication. Nevertheless, the efficacy of using specific miRNA-regulated amplicon viruses to treat prostate tumors was clearly shown. CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses effectively inhibited tumor growth (>80% reduction in tumor volume) without major toxicity to other normal tissues (Figs. 5 and 6). These results demonstrated that incorporating miRNA target sequences in an oncolytic virus is a viable strategy for specifically targeting and killing cancer cells while sparing normal cells. MiR-143 and miR-145-regulated oncolytic viruses may be particularly useful in a wide range of cancers since they are generally downregulated in many types of malignancies, but are quite abundant in normal tissues. In the present study, we focused on using HSV-1 amplicons instead of recombinant virus because amplicons are more easily constructed and therefore ideal for proof of concept. Regulation of viral gene expression and viral replication by miRNA would be expected to be more stringent in the context of a whole virus since the whole virus contains only two copies of ICP4 gene, whereas owing to the fact that approximately 152 kb of viral genome was packaged into one viral particle, the amplicon viruses used in the present study would have ~15 copies of the amplicon plasmid (~10 kb) carrying the ICP4 gene (44). As a result, many more ICP4 mRNA transcripts would be generated from an amplicon virus than from a recombinant whole virus. This could result in a small amount of ICP4 protein being expressed, which would be sufficient to initiate lytic viral replication. Hence our current amplicon virus system may underestimate the regulatory capability of the 3’UTR miRNA target and building the miRNA target sequences as well as other tissue-specific or tumor-specific elements into the whole HSV-1 viral genome 81  should increase the safety margin substantially. The major advantage of the amplicon/helper system is its tremendous flexibility, which offers a quick and easy way to test and fine-tune the efficiency of a specific regulatory element both in vitro and in vivo. Since a significant proportion of men with early prostate cancer are not cured by surgery or radiation therapy, local administration of amplicon viruses through intratumoral/intraprostatic injection may be beneficial for treating primary and high-risk localized or locally advance prostate cancer while limiting the spread of virus to other tissues. This therapeutic approach can be used either alone or in combination with surgery or chemotherapy in a neoadjuvant or adjuvant setting to further enhance efficacy (45). Intratumoral/intraprostatic injection is a feasible approach in that human prostate is easily accessible through transperineal and transrectal routes (46). One advantage of intratumoral injection is that local administration would ensure maximal uptake of virus by tumor cells, but the limitation is that it is probably not effective against treating metastatic tumors at distant sites. Another limitation is that the toxicity of the virus in normal tissues may not be evident because the virus is injected directly into the tumor cells. However, we have shown that mice treated with the wild-type virus, CMV-ICP4, exhibited skin lesions and the virus was detected in several normal tissues. On the other hand, extensive viral spread was not observed in mice treated with miRNA-regulated viruses (Figure 3.6). MiRNA regulated oncolytic viral replication has also been shown recently using a RNA virus, a let-7-sensitive vesicular stomatitis virus (VSV), VSVlet-7wt (47). An advantage of using a DNA virus as opposed to a RNA virus with this miRNA targeting strategy is that replication of a DNA virus occurs at a much slower rate, such that saturation of the miRNA:RISC machinery due to efficient and robust growth of RNA viruses, would not be a problem. Moreover, in the case of HSV-1, miRNA targeted sequences can be incorporated into the 3’UTR of more than one viral gene to increase tumor-specificity. DNA viruses also have much lower mutation rate than RNA viruses (48). To further enhance tumor specificity and to improve regulation of oncolytic viral replication, the copy number of miRNA target sequences can be increased. In addition, target sequences of more than one miRNA species can be incorporated into the 3’UTR region since miRNA expression patterns differ across normal tissues of different origins. 82  For instance, a combination of miRNA target sequences, such as miR-143T + miR-145T, could be incorporated to make the tumor specificity more stringent while increasing the protection of normal tissues. The 3’UTR of each viral construct could be tailored according to the miRNA expression pattern of the cell types that one wants to target. Through synergistic effects of various regulatory elements in the promoter (16), 5’UTR (49, 50) or 3’UTR regions, stringent regulation of viral gene expression and viral replication can likely be achieved to develop a highly effective and tumor specific virotherapy for cancer treatment.  83  Figure 3.1 Structure of the three amplicon plasmids used to package replication-competent amplicon viruses. CMV-ICP4 amplicon was a constitutive, non-tissue  selective  complementing  amplicon,  whereas  CMV-ICP4-143T  and  CMV-ICP4-145T amplicons were tumor-specific miRNA-regulated complementing amplicons. CMV-ICP4-143T amplicon contained five tandem copies of miR-143 complementary sequences (143Tx5) after ICP4 gene and CMV-ICP4-145T amplicon contained four tandem copies of miR-145 complementary sequences (145Tx4).  84  Figure 3.2 MiR-143 and miR-145 expression levels in cell lines and mouse tissues. The expression levels of miR-143 and miR-145 in various cell lines (A) and a panel of organs (B) harvested from nude mice were determined by quantitative RT-PCR assays. 293T-143 and 293T-145 are 293T cells transiently transfected with 20 nM pre-miR143 and pre-miR145 respectively as positive controls. Total RNA from the cells and organs were extracted using the Trizol reagent and 10 ng of RNA was reverse transcribed to cDNA followed by TaqMan real-time PCR assays.  85  Figure 3.3 MiR-143 and miR-145 inhibit ICP4 expression at a translational level by targeting the 3’UTR in the amplicons. LNCaP cells were co-transfected with amplicon plasmid (CMV-ICP4, CMV-ICP4-143T, or CMV-ICP4-145T) and pre-miR143 or pre-miR145 at a concentration of 0 to 50 nM. 24 hours after transfection, LNCaP cells were superinfected with ICP4¯ helper virus at an MOI of 1. Total protein and RNA were extracted at 24 hours post-superinfection. A, ICP4, ICP27 and β-actin protein levels were determined by Western blot analysis. B, Density ratio of ICP4 level was normalized to β-actin. C, and D, ICP4 mRNA level was determined by quantitative RT-PCR analysis (means ± SD, n = 3; * indicates p<0.05 compared to 0 nM control).  86  Figure 3.4 MiR-143 and miR-145 suppress amplicon viral replication in LNCaP cells. (A) MiR-143 and miR-145 inhibited viral replication of the CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses, respectively. LNCaP cells were transfected with miR-143 or miR-145 at a concentration of 0 nM or 20 nM. At 24 hours after transfection, 87  cells were infected with CMV-ICP4, CMV-ICP4-143T or CMV-ICP4-145T amplicon virus at an MOI of 0.1 (input virus = 104 plaque forming units (pfu). At 72 hours post-viral infection, virus was collected and titered in 7B cells. The mean pfu ± SD were calculated from four independent determinations (* denotes p<0.05 relative to 0 nM controls). MiR-143 (B) and miR-145 (C) inhibited the ability of amplicons to complement replication of ICP4-¯ helper virus in a dose-dependent manner. LNCaP cells were co-transfected with amplicon plasmid (CMV-ICP4, CMV-ICP4-143T, or CMV-ICP4-145T) and pre-miR143 or pre-miR145 at a concentration of 0.1 to 50 nM. 24 hours after co-transfection, LNCaP cells were superinfected with ICP4¯ helper virus at an MOI of 1. At 48 hours post-superinfection, virus was collected and titered on 7B cells.  88  Figure 3.5 MiRNA-regulated amplicon viruses suppress prostate tumor growth in a human xenograft mouse model. (A) Intratumoral injections of miRNA-regulated amplicon viruses inhibited tumor growth in LNCaP xenograft mouse model. Nude mice 89  with subcutaneous LNCaP-Luc tumors (~120 ± 14 mm3 ) were treated with two intratumoral injections (at Day 0 and Day 7) of 1 x 106 pfu ICP4¯ helper virus only (♦, n = 5), CMV-ICP4 amplicon virus (■, n = 3), CMV-ICP4-143T amplicon virus (●, n = 7), or CMV-ICP4-145T amplicon virus (▲, n = 5). Tumor volume was determined by caliper measurements and the results were expressed as mean fold change in tumor size. (B) Tumor was imaged using IVIS system and representative images were shown. The luciferase activity was expressed as p/sec/cm2/sr.  90  Figure 3.6 MiRNA-regulated amplicon viruses specifically target tumor cells in vivo. Various organs were harvested from the mice treated with amplicon viruses at the end of the experiment. (A) Organs were embedded in OCT and cut into 10 μm sections 91  which were then subjected to x-gal staining. Blue color indicated the presence of virus. (B) Total DNA was extracted from the organs and ICP4 copy number was determined by real-time PCR assays. The results were expressed as relative copy number of ICP4 / μg DNA which was indicative of the presence of amplicon.  92  3.5 References 1.  Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71-96.  2.  Albertsen PC, Hanley JA, Fine J. 20-year outcomes following conservative management of clinically localized prostate cancer. Jama 2005;293:2095-101.  3.  Martel CL, Gumerlock PH, Meyers FJ, Lara PN. Current strategies in the management of hormone refractory prostate cancer. Cancer Treat Rev 2003;29:171-87.  4.  So A, Gleave M, Hurtado-Col A, Nelson C. Mechanisms of the development of androgen independence in prostate cancer. World J Urol 2005;23:1-9.  5.  Petrylak DP. Future directions in the treatment of androgen-independent prostate cancer. Urology 2005;65:8-12.  6.  Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 2004;351:1502-12.  7.  Satoh T, Irie A, Egawa S, Baba S. In situ gene therapy for prostate cancer. Curr Gene Ther 2005;5:111-9.  8.  Varghese S, Rabkin SD. Oncolytic herpes simplex virus vectors for cancer virotherapy. Cancer Gene Ther 2002;9:967-78.  9.  Lachmann R. Herpes simplex virus-based vectors. Int J Exp Pathol 2004;85:177-90.  10.  Liu BL, Robinson M, Han ZQ, et al. ICP34.5 deleted herpes simplex virus with enhanced oncolytic, immune stimulating, and anti-tumour properties. Gene Ther 2003;10:292-303.  11.  MacKie RM, Stewart B, Brown SM. Intralesional injection of herpes simplex virus 1716 in metastatic melanoma. Lancet 2001;357:525-6.  12.  Markert JM, Medlock MD, Rabkin SD, et al. Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene Ther 2000;7:867-74.  13.  Kanai R, Tomita H, Hirose Y, et al. Augmented therapeutic efficacy of an oncolytic herpes simplex virus type 1 mutant expressing ICP34.5 under the transcriptional control of musashi1 promoter in the treatment of malignant glioma. Hum Gene Ther 2007;18:63-73.  14.  Lam PY, Sia KC, Khong JH, et al. An efficient and safe herpes simplex virus type 93  1 amplicon vector for transcriptionally targeted therapy of human hepatocellular carcinomas. Mol Ther 2007;15:1129-36. 15.  Mullen JT, Kasuya H, Yoon SS, et al. Regulation of herpes simplex virus 1 replication using tumor-associated promoters. Ann Surg 2002;236:502-12; discussion 12-3.  16.  Lee CY, Bu LX, Rennie PS, Jia WW. An HSV-1 amplicon system for prostate-specific expression of ICP4 to complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells. Cancer Gene Ther 2007;14:652-60.  17.  Yang CT, Song J, Bu X, et al. Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells. Gene Ther 2003;10:1494-502.  18.  Zheng X, Rao XM, Snodgrass C, et al. Adenoviral E1a expression levels affect virus-selective  replication  in  human  cancer  cells.  Cancer  Biol  Ther  2005;4:1255-62. 19.  Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281-97.  20.  Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 2006;6:259-69.  21.  Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. Human RISC couples microRNA  biogenesis  and  posttranscriptional  gene  silencing.  Cell  2005;123:631-40. 22.  Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature 2005;435:834-8.  23.  Mattie MD, Benz CC, Bowers J, et al. Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies. Mol Cancer 2006;5:24.  24.  Liu CG, Calin GA, Meloon B, et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 2004;101:9740-4.  25.  Ambros V. The functions of animal microRNAs. Nature 2004;431:350-5.  26.  Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 94  2006;103:2257-61. 27.  Iorio MV, Ferracin M, Liu CG, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005;65:7065-70.  28.  Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 2003;1:882-91.  29.  Slaby O, Svoboda M, Fabian P, et al. Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. Oncology 2007;72:397-402.  30.  Lui WO, Pourmand N, Patterson BK, Fire A. Patterns of known and novel small RNAs in human cervical cancer. Cancer Res 2007;67:6031-43.  31.  Iorio MV, Visone R, Di Leva G, et al. MicroRNA signatures in human ovarian cancer. Cancer Res 2007;67:8699-707.  32.  Gramantieri L, Ferracin M, Fornari F, et al. Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. Cancer Res 2007;67:6092-9.  33.  Akao Y, Nakagawa Y, Kitade Y, Kinoshita T, Naoe T. Downregulation of microRNAs-143 and -145 in B-cell malignancies. Cancer Sci 2007;98:1914-20.  34.  Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T. MicroRNA expression profiling in prostate cancer. Cancer Res 2007;67:6130-5.  35.  Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Widespread deregulation of microRNA expression in human prostate cancer. Oncogene 2008;27:1788-93.  36.  Horoszewicz JS, Leong SS, Chu TM, et al. The LNCaP cell line--a new model for studies on human prostatic carcinoma. Prog Clin Biol Res 1980;37:115-32.  37.  Hubenthal-Voss J, Houghten RA, Pereira L, Roizman B. Mapping of functional and antigenic domains of the alpha 4 protein of herpes simplex virus 1. J Virol 1988;62:454-62.  38.  Ackermann M, Braun DK, Pereira L, Roizman B. Characterization of herpes simplex virus 1 alpha proteins 0, 4, and 27 with monoclonal antibodies. J Virol 1984;52:108-18.  39.  Esau C, Kang X, Peralta E, et al. MicroRNA-143 regulates adipocyte differentiation. J Biol Chem 2004;279:52361-5.  40.  Johnson PA, Miyanohara A, Levine F, Cahill T, Friedmann T. Cytotoxicity of a 95  replication-defective  mutant  of  herpes  simplex  virus  type  1.  J  Virol  1992;66:2952-65. 41.  Doench JG, Petersen CP, Sharp PA. siRNAs can function as miRNAs. Genes Dev 2003;17:438-42.  42.  Brown BD, Venneri MA, Zingale A, Sergi Sergi L, Naldini L. Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med 2006;12:585-91.  43.  Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem 2007;282:32582-90.  44.  Sena-Esteves M, Saeki Y, Fraefel C, Breakefield XO. HSV-1 amplicon vectors--simplicity and versatility. Mol Ther 2000;2:9-15.  45.  Mazhar D, Waxman J. Early chemotherapy in prostate cancer. Nat Clin Pract Urol 2008;5:486-93.  46.  Moore CM, Pendse D, Emberton M. Photodynamic therapy for prostate cancer--a review of current status and future promise. Nat Clin Pract Urol 2009;6:18-30.  47.  Edge RE, Falls TJ, Brown CW, Lichty BD, Atkins H, Bell JC. A let-7 MicroRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replication. Mol Ther 2008;16:1437-43.  48.  Drake JW, Charlesworth B, Charlesworth D, Crow JF. Rates of spontaneous mutation. Genetics 1998;148:1667-86.  49.  DeFatta RJ, Chervenak RP, De Benedetti A. A cancer gene therapy approach through  translational  control  of  a  suicide  gene.  Cancer  Gene  Ther  2002;9:505-12. 50.  Yu D, Scott C, Jia WW, et al. Targeting and killing of prostate cancer cells using lentiviral constructs containing a sequence recognized by translation factor eIF4E and a prostate-specific promoter. Cancer Gene Ther 2006;13:32-43.  96  4  Local and systemic delivery of oncolytic herpes simplex virus type-1 for  targeting prostate tumors * 4.1 Introduction Prostate cancer remains the most commonly diagnosed non-skin cancer in men and the second leading cause of cancer death in men (1). Early stage, locally confined prostate cancer is frequently curable by radical prostatectomy or radiation therapy; however, no curative treatment option is available for patients with locally advanced or metastatic disease (2, 3). While hormone withdrawal therapy is the only effective treatment for advanced/metastatic prostate cancer, the disease will eventually recur and become castration-resistant (hormone refractory). Although promising results have been reported from recent clinical trials using docetaxel-based combination therapies for treatment of hormone-refractory prostate cancer, the median survival is still only ~18 months (4, 5). Hence, more effective, new treatment regimens are urgently needed to improve patient survival. Oncolytic viruses are promising therapeutic agents for treatment of various cancers since they have the potential to specifically replicate in and lyse tumor cells while sparing normal tissues (6). There are several features of herpes simplex virus type 1 (HSV-1) that make it a favorable oncolytic vector for cancer treatment (7). Clinical trials of malignant glioma using G207, a mutant oncolytic HSV-1 virus with deletions of both copies of the ICP34.5 gene and an inactivating insertion of the LacZ gene into the ICP6 locus, showed no maximum tolerated dose while multiple deliveries seemed to be safe (8, 9). However, further improvement of antitumor efficacy observed anecdotally in some virus treated patients is required. Current oncolytic HSV-1 viral vectors in clinical trials contain deletions of genes that are involved in neurovirulence, which may result in a much more attenuated virus with far less viral replication efficiency. Hence, it may be better to maintain as much of the viral genome as possible by modifying only the regulator elements flanking essential viral genes to achieve tumor-specific replication. Replication of the HSV-1 virus relies on cellular transcriptional and translational machinery. Previous studies by our group and others have shown that, by replacing the *  A version of this chapter has been submitted for publication. Lee, C.Y., Bu, L.X., De Benedetti, A., Williams, B.J., Rennie, P.S., and Jia, W.W. Local and systemic delivery of oncolytic herpes simplex virus type-1 for targeting prostate tumors.  97  promoter of an essential viral gene with a tissue-specific promoter, viral replication can be regulated in a tissue-specific fashion (10-12). In searching for more stringent regulatory elements to increase tumor specificity, we hypothesize that HSV-1 replication can be further regulated at the translational level by employing the 5’-untranslated regions (5’UTR) that form complex secondary structures (12, 13). The 5’UTR from genes that are commonly associated with malignant progression and metastasis, such as c-myc, ODC, cyclin D1, VEGF, FGF-2 and some matrix metalloproteases, are rich in GC residues and can form extensive secondary hairpin structures to repress the translation of their downstream mRNAs in normal cells (13-15). These secondary hairpin structures can be unwound in the presence of sufficient eIF4E/eIF4F complexes, leading to translation initiation of the mRNA (16). The eIF4E protein, part of the eIF4F complex, plays a crucial role in the initiation of translation process by binding to the 5’cap (7-methylguanosine) of mRNA transcripts. Its overexpression has been reported in various cancer types, including prostate cancer, and can lead to increased translation of cancer-associated genes to enhance cell proliferation, suppress apoptosis, and induce malignant transformation (16-20). Recent data also suggest that elevated eIF4E activation is common in advanced prostate cancer and is associated with progression to a hormone-refractory state resulting in reduced patient survival (20, 21). These observations point towards a new tumor-specific targeting strategy that could be incorporated into current viral vectors. Indeed, our group and others have shown that when the 5’UTR from the rFGF-2 gene is inserted in front of a suicide gene (HSV-1 thymidine kinase) in a lentiviral vector or an adenoviral vector, the expression of thymidine kinase gene was significantly enriched in tumor cells only, leading to increased tumor-specific killing in combination with ganciclovir (GCV) treatment (20, 22). In the present study, our aim was to demonstrate that through dual regulation of an essential viral gene at both the transcriptional and translational level by the prostate-specific promoter ARR2PB and the rFGF-2 5’UTR, respectively, a recombinant HSV-1 virus would show high selectivity for tumor cells, resulting in tumor-specific oncolysis. To test our hypothesis, we generated two recombinant viruses, ARR2PB-ICP27 (A27) and ARR2PB-5’UTR-ICP27 (AU27), by inserting the ARR2PB promoter in front of the essential ICP27 gene with or without the 5’UTR from rFGF-2 and tested their efficacy and toxicity both in vitro and in vivo. Our results showed that dual 98  regulation of HSV-1 viral replication significantly enhances tumor specificity while retaining high efficiency of tumor lysis. 4.2 Materials and Methods 4.2.1 Construction of recombinant virus The ARR2PB-ICP27 (A27) and ARR2PB-5’UTR-ICP27 (AU27) recombinant viruses were generated by the recombineering method (23), which replaced the endogenous ICP27 promoter with the ARR2PB promoter ± the 5’UTR (619 bp) of rat FGF-2 gene (24) in BAC.p25 (Figure 4.1). The Bacterial Artificial Chromosome (BAC) was inserted into the thymidine kinase (TK) locus by homologous recombination to generate BAC.p25 containing the whole HSV-1 genome (25). This recombineering technique generated two BACs: BAC.AR27 and BAC.ARU27. In order to restore TK activity and remove the BAC from the viral genome, the TK gene was then rescued by homologous recombination in 2-2 cells with Hypoxanthine Aminopterine Thymidine (HAT) selection (26). The packaged A27 and AU27 viruses were then plaque-purified three times in 2-2 cells to ensure successful TK rescue. The presence of the TK gene was then confirmed by PCR and western blotting for TK expression. The recombinant viruses were then propagated in 2-2 cells. The wild-type virus (KOS strain) was propagated in Vero cells and the replication-defective virus ICP27¯ was grown in 2-2 cells. Virus titer was determined by plaque forming assay as previously described (11). 4.2.2 Cell culture RWPE-1 (27), LNCaP (28), DU145 (29), PC-3 (30), H460 (31), MCF-7 (32) and Vero cells were obtained from American Type Culture Collection (ATCC; Manasas, VA). BPH-1 (33) and PNT1B (34) cells were gifts from Dr. Simon Hayward (Vanderbilt University) and Dr. Norman J. Maitland (York, UK), respectively. The 2-2 cell line was kindly provided by Dr. Priscilla A. Schaffer (University of Pennsylvania School of Medicine). All cell lines were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics containing penicillin and streptomycin except for RWPE-1 cell line, which was maintained in Keratinocyte Serum Free Medium (K-SFM) with 0.05 mg/ml bovine pituitary extract and 5 ng/ml human recombinant epidermal growth factor (Invitrogen). PNT1B and LNCaP cells are 99  human normal and tumor prostate cancer cell lines, respectively. They are positive for androgen receptor and are both androgen-responsive. The 2-2 cell line (transfected with ICP27 gene) is a derivative cell line generated from Vero cells. For the androgen-responsive experiments, PNT1B and LNCaP cells were maintained in DMEM with 10% charcoal stripped serum (CSS; HyClone, VWR, West Chester, PA) for two days before infection and then 10 nM R1881 (Perkin Elmer, Boston, MA) was added to the medium 1 hour after viral infection. 4.2.3 Western blotting PNT1B and LNCaP cells were infected with wild-type, A27 and AU27 viruses at a multiplicity of infectivity (MOI) of 3, and total proteins were collected at 8 and 12 hours post-infection. PNT1B and LNCaP cells were lysed with 2X sample buffer (100 mM Tris-HCL, 4% SDS, 20% glycerol, 357 mM β-mercaptoethanol, 0.04% bromophenol blue) and boiled for 5 minutes. Protein samples were subjected to SDS-PAGE and then transferred to a nitrocellulose membrane. The membrane was blocked in 5% non-fat milk (Bio-Rad Laboratories, Ontario, Canada) at room temperature for 1 hour and then incubated with primary antibodies overnight at 4°C. On the next day, the membrane was washed with Tris-Buffered Saline Tween-20 (TBST; 20 mM Tris, 500 mM NaCl, 0.1% Tween-20), incubated with secondary antibody at room temperature for 1 hour, and then washed with TBST again before being imaged using the ECL reagent (Perkin Elmer, Boston, MA) and the VersaDoc imaging system (Bio-Rad). Primary antibodies were prepared in 5% BSA in TBST at the following dilutions: anti-ICP4 (EastCoast Bio Inc., North Berwick, ME) at 1:800 (35), anti-ICP27 (Virusys Corporation, Sykesville, MD) at 1:800 (35, 36), anti-TK (a gift from Dr. William C. Summers, Yale University) at 1:500, anti-eIF4E (BD Transduction Laboratories, Mississauga, ON) at 1:1000, and anti-β-actin (Cell Signaling, Danvers, MA) at 1:1000. Anti-mouse and anti-rabbit secondary antibodies were prepared in TBST at a 1:2000 dilution (Cell Signaling). Band intensities were quantified using ImageJ software (NIH). 4.2.4 DNA, RNA extraction and RT-PCR Total RNA was extracted from cell lines and mouse organs using Trizol (Invitrogen) following the manufacturer’s protocol. To determine ICP27 and β-actin mRNA levels in co-transfection studies, 200 ng RNA was used in one-step real-time RT-PCR as 100  previously described (11). All RT-PCR reactions were performed in 25 μL SYBR-green mixture containing the MultiScribe Reverse Transcriptase, using the ABI prism 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The ICP27 mRNA levels were first normalized to the β-actin mRNA level (ΔCT = CTICP4 – CTActin) and then compared to the negative control group where LNCaP cell was infected with ICP27¯ virus only (ΔΔCT = ΔCT – ΔCTICP27-). The results were expressed as 2-ΔΔCT. DNA was extracted from the organs of the mice treated with viruses using the phenol-chloroform and ICP27 copy number was determined by quantitative real-time PCR  using  the  ICP27  primers  (5’-GTCTGGCGGACATTAAGGACA-3’  and  5’-TGGCCAGAATGACAAACACG-3’). 4.2.5 Virus growth assays PNT1B and LNCaP cells were infected with viruses at an MOI of 0.01 with or without 10 nM R1881 treatment. Total virus was collected at 24 hr, 48 hr and 72 hr post-infection, and virus titer was determined by the plaque-forming assay in 2-2 cells. 4.2.6 LNCaP xenograft mouse model Athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) and were inoculated with LNCaP cells subcutaneously by injecting 5 x 106 cells in 100 μL of medium with matrigel at two different flank sites. Tumor volumes were determined by caliper measurements and calculated using the formula volume = width x length x thickness x π/6 (11). Once the tumor size reached approximately 100 mm3, mice were treated with a single intratumoral injection of 2 x 106 pfu of wild-type, ICP27¯, A27, or AU27 virus at Day 0. For dose response experiment, mice were treated with one single intravenous injection of 5 x 107 pfu of ICP27¯, AU27 or 5 x 105 pfu of AU27 virus at Day 0. At the end of the experiment, mice were sacrificed using CO2 asphyxiation, and organs (eyes, brain, heart, kidneys, liver, lung, spleen, stomach, intestines, prostate, bladder, testes) and the tumors were removed and analyzed by real-time PCR. All experimental procedures were approved by UBC Animal Care Committee and followed the guidelines and policies of the Canadian Council on Animal Care. 4.2.7 Statistical analysis Statistical significance (p-value <0.05) was determined using Student’s t-test and the 101  results are presented as mean ± SD. Kaplan-Meier survival curves were created using GraphPad Prism 5 software and the log-rank (Mantel-Cox) test was used to determine statistical significance. 4.3 Results 4.3.1 eIF4E is overexpressed in prostate cancer cells As we previously reported (20), the eukaryotic initiation factor (eIF)4E expression level was higher in cancer cells than in non-cancerous cells with the highest expression levels observed in LNCaP prostate and MCF-7 breast cancer cell lines (Figure 4.2). When compared to that in LNCaP cells, a 6-fold and 4-fold reduction in eIF4E levels was observed in BPH-1 and PNT1B cells, respectively (p<0.002). While both BPH-1 and PNT1B cells exhibited low eIF4E expression, non-malignant PNT1B cells were chosen as a control cell line to study the transcriptional and translational regulation of ICP27 expression since PNT1B cells express the androgen receptor (AR), which is necessary for ARR2PB promoter activity. 4.3.2 ICP27 expression is regulated at both transcriptional and translational level by the ARR2PB promoter and the rFGF-2 5’UTR respectively a) Transcriptional regulation. We have previously demonstrated prostate-specific expression of another essential viral gene, ICP4, in an amplicon/helper system using the highly androgen/AR-responsive ARR2PB promoter (11). To test the specificity of the ARR2PB promoter and its regulation of the ICP27 gene in the context of a whole virus, we first examined ICP27 mRNA levels by quantitative RT-PCR analysis in LNCaP cells infected with A27 and AU27 viruses in the presence of 0 nM or 10 nM R1881. Consistent with our previous findings (11), ICP27 mRNA levels were >2-fold higher for both A27 and AU27 infections in the presence of 10 nM R1881 when compared with no androgen treatment at 4 hr, 8 hr and 24 hr post-infection (Figure 4.3, A; p<0.03). Therefore, these findings support transcriptional regulation of ICP27 gene expression within the HSV-1 viral genome by the ARR2PB promoter in an androgen/AR-dependent fashion. b) Translational regulation. We next determined ICP27 protein expression level in both normal PNT1B and LNCaP cancer cells infected with A27 and AU27 viruses by 102  Western blot analysis. For A27 virus infections, addition of 10 nM R1881 resulted in a >80% increase in the ICP27 protein in both cell lines at 8 hr post-infection (Figure 4.3, B & C; p<0.04). Similar results were also observed for AU27 virus infections in LNCaP cells, with a ~4-fold increase in ICP27 protein level in the presence of 10 nM R1881 at 8 hr post-infection (Figure 4.3, B). However, A27 and AU27 behave quite differently in PNT1B cells. At the same MOI, the ICP27 protein level was >60% higher after A27 infection than after AU27 infection at 8 hr post-infection (Figure 4.3, C). The expression of another HSV-1 immediate-early gene, ICP4 with its endogenous promoter, remained unchanged in both cells lines. Clearly, the expression of ICP4 was neither dependent on eIF4E level nor AR. To verify that reduced ICP27 expression from AU27 viral infected PNT1B cells was not due to a reduction in transcriptional activity, quantitative RT-PCR analysis of ICP27 mRNA levels was performed in PNT1B and LNCaP cells infected with wild-type, A27, or AU27 viruses. Surprisingly, levels of ICP27 mRNA were consistently higher in PNT1B cells than in LNCaP cells (Figure 4.3, D). Thus, the reduction in ICP27 protein levels in PNT1B cells is consistent with down-regulation at the translational level. Together these results demonstrate that viral ICP27 gene expression from the AU27 virus can be transcriptionally and translationally regulated by the ARR2PB promoter and the 5’UTR element, respectively. Furthermore, while the ARR2PB promoter was able to direct the expression of the ICP27 gene in an androgen/AR-responsive fashion in the presence of a complex 5’UTR, this transcriptional upregulation by androgen could not be translated into increased protein production in cells with low levels of eIF4E. 4.3.3 Replication of AU27 virus is androgen/AR-regulated and tumor-specific To demonstrate that the AU27 virus can differentially replicate in normal and tumor cells, we compared viral growth in PNT1B and LNCaP cells. Wild-type (KOS) virus was able to infect and replicate in both LNCaP and PNT1B cells with similar efficiency when infected at an MOI of 0.01 (Figure 4.4, A). Despite a slight delay in viral growth in PNT1B cells for the first 24 hours, there was no significant difference in viral titers between PNT1B and LNCaP cells by 48 hours post-infection. Hence, both cells have similar infectivity and viral replicability for wild-type HSV-1 virus. The A27 viral titer was approximately 2-fold higher in the presence of 10 nM R1881 when compared to the absence of R1881 in both PNT1B and LNCaP cells, which is 103  consistent with androgen regulation of ICP27 expression from this virus. Interestingly, for the AU27 virus, adding 10 nM R1881 caused an approximately 2-fold increase in virus titer in LNCaP cells, but not in PNT1B cells (Figure 4.4, B & C; p<0.05). Thus, the replication of both viruses was androgen/AR-responsive in cancer cells, but this androgen-driven transcriptional up-regulation in PNT1B cells was overridden by translational suppression by the complex 5’UTR in the AU27 virus in cells with low eIF4E levels, resulting in a 700-fold lower viral titer in PNT1B cells than in LNCaP cells. The 5-10 fold difference in the ICP27 mRNA levels in LNCaP cells infected with A27 and AU27 viruses observed between Figure 4.3A and Figure 4.3D reflects the variations within qRT-PCR reactions carried out at different times. Although the magnitude is different, the experimental trend is the same. Regardless, this demonstrates that the AU27 virus can differentially replicate in LNCaP cells due to differences in endogenous eIF4E level while sparing normal cells with low eIF4E levels. The therapeutic index of this targeted virotherapy is therefore significantly increased. 4.3.4 Intratumoral injection of AU27 virus reduces tumor size and prolongs survival To study the efficacy and toxicity of the A27 and AU27 viruses, nude mice with established LNCaP xenograft tumors (>100 mm3) were treated with one intratumoral injection of 2 x 106 pfu of ICP27¯, wild-type, A27, or AU27 viruses. In comparison to day 0 post-viral injection, a >2.5 fold increase in tumor size was observed in mice treated with ICP27¯ virus at day 31 post-viral injection, while a >90% reduction of tumor volumes was evident in mice treated with wild-type, A27 or AU27 virus (Figure 4.5, A). In many cases, the tumors became barely palpable and complete eradication of the tumors was observed in three out of six mice treated with A27 virus and in four out of eight mice treated with AU27 virus. The treated mice were monitored for two months after initial viral injection. Approximately 60% of the mice treated with ICP27¯ were sacrificed by day 50 post-treatment due to aggressive tumor growth. By comparison, 80% of the mice treated with wild-type virus exhibited signs of toxicity in the gastrointestinal tract and were sacrificed by day 31 post-viral injection, whereas 83% of the mice treated with A27 virus survived 31 days of treatment period (Figure 4.5, B). However, only 33% survived for two months due to similar virulence in the gastrointestinal tract. On the other hand, 88% of the mice treated with AU27 virus exhibited no signs of morbidity and survived for 104  two months, at which time the experiments were terminated. Only one out of eight AU27 treated mice showed toxicity in the intestine at day 28 post-viral injection and was sacrificed early. Thus, the AU27 virus was effective in tumor eradication with remarkably reduced toxicity when compared to wild-type and A27 viruses, resulting in a significantly improved survival (p<0.01). To examine the extent of viral biodistribution, ICP27 gene copy number (per μg of DNA) in various organs was determined by quantitative real-time PCR analysis. The majority of the virus was detected in the tumors of all treatment groups (Figure 4.5, C). In mice treated with wild-type virus, a significant amount of virus was detected in the eyes and small traces were also found in the brain, kidneys and stomach. Similar results were observed in mice treated with A27 virus with detectable virus in the eyes (in 1 of 5 mice) and brain (in 2 of 5 mice). By comparison, no virus was detected in the normal tissues of mice treated with AU27 virus, except that a trace of virus was detected in the stomach and intestine of one mouse that showed virus-related toxicity at day 28 post-viral injection. Interestingly, when the AU27 virus was injected into only one tumor on one flank, the virus was also detectable in the tumor on the other flank in two cases. This suggests that the virus could leak into the blood stream and still specifically target distant tumor cells. 4.3.5 Systemic administration of AU27 virus resulted in tumor-specific targeting and killing Since AU27 virus treatment showed maximal reduction in tumor size with minimal toxicity to normal tissues through intratumoral injections, we next tested its efficacy and dose-dependency through systemic administration. Nude mice with LNCaP tumors were treated with one intravenous injection of low (5 x 105 pfu) or high (5 x 107 pfu) doses of AU27 virus. In the control group, 5 x 107 pfu replication-defective ICP27¯ virus was injected intravenously and a >3-fold increase in tumor size was observed at day 28 post-viral injection (Figure 4.6, A). In contrast, a >60% and >85% reduction in tumor size was observed in mice treated with a single intravenous injection of 5 x 105 pfu and 5 x 107 pfu of AU27 virus, respectively. This demonstrated that systemic targeting of the virus may be dose-dependent. No sign of morbidity or mortality was observed in any of the three treatment groups, which is most likely due to quick clearance of the virus through systemic delivery. Quantitative real-time PCR analysis of various organs 105  harvested from the treated mice showed that the virus was found significantly higher levels in the tumors (Figure 4.6, B). A very small amount of virus was detected in the intestine of one mouse treated with 5 x 107 pfu of AU27 virus, but there was no noticeable toxicity. 4.4 Discussion Prostate cancer patients with locally invasive and metastatic disease have relatively few treatment options, and even these are more palliative than curative in intent (37). Systemic delivery of chemotherapeutic drugs may be limited by toxicity to normal tissues, whereas targeted oncolytic virotherapy can greatly enhance the therapeutic index when the virus is engineered to specifically replicate in and kill tumor cells while sparing normal tissues. In this study, we demonstrated the targeting specificity of a recombinant oncolytic HSV-1 virus through both transcriptional and translational regulation of the essential ICP27 viral gene. We found that the eIF4E protein is overexpressed in LNCaP cells by at least 4-fold when compared to a non-malignant, normal epithelial prostate cell line, PNT1B (Figure 4.2). In addition, androgen stimulation resulted in a consistent ~2-fold increase in ICP27 mRNA transcripts and virus titers when LNCaP cells were infected with A27 or AU27 virus (Figure 4.2 & 4.3). However, some leaky ICP27 expression from the ARR2PB promoter in the absence of androgen was observed and was most likely due to the activity of the promiscuous viral transactivator ICP0 protein, which may interact non-specifically with a variety of viral genes (38, 39). ICP27 mRNA was transcribed efficiently in both PNT1B and LNCaP cell lines, but protein expression was hindered by the complex rFGF-2 5’UTR only in PNT1B cells (Figure 4.3). Moreover, AU27 virus replicated well in LNCaP cells, but not in PNT1B cells irrespective of androgen status (Figure 4.4), demonstrating differential replicability of the virus in normal versus tumor cells. We also showed that after in vivo administration, the AU27 virus was very effective in killing LNCaP xenograft tumor cells and extending survival without causing extensive toxicity to normal tissues (Figure 4.5 & 6). Wild-type virus was very toxic to the mice, causing a major impact on the gastrointestinal system, while AU27 was considerably safer and amplified mainly inside the tumor. Interestingly, the transcriptional upregulation of ICP27 expression by androgen stimulation of the ARR2PB promoter was overpowered by translational suppression by 106  the complex 5’UTR in non-cancer cells. This dominance of translational regulation over transcription provides a significant implication in oncolytic virus design; in that viral gene expression and replication can be selectively enhanced through transcriptional upregulation in tumor cells, as evidenced by the increase in viral titer in the presence of activated androgen receptor, while at the same time being translationally repressed in normal tissues. Previous clinical studies have reported that progression of prostate cancer to a castration-resistant state is frequently accompanied by over-expression or over-activation of the androgen receptor, which allows tumor cell proliferation in the absence of androgen (3, 40-42). In such cases, the oncolytic effect of AU27 virus can be augmented in tumor cells that retain elevated androgen receptor activity without compromising its safety in non-cancer tissues due to translational override. This finding provides a new avenue to solve a long existing conflict in oncolytic viral vector design - a balance between the aggressiveness of an oncolytic virus for cancer cell killing and the safety concern of uncontrolled viral lysis. While a >4-fold elevation of eIF4E levels is observed in LNCaP cells when compared to non-malignant BPH-1 and PNT1B cells, there may be cases where the level of eIF4E is not as dramatically elevated in tumor cells relative to normal tissues [~2-fold increase (22)]. In such cases, other tumor-specific elements can also be used in combination with this targeting strategy to enhance specificity. For instance, recent strategies utilizing endogenous microRNAs to regulate oncolytic viral replication using various viral vectors also showed great promise (43, 44). In our present approach, we have demonstrated that employment of a complex 5’UTR element could confer stringent tumor-specificity and enhance tissue-specificity of an oncolytic HSV-1 virus. This targeting strategy may be particularly useful in treating the most aggressive cancers, as recent data indicate that elevated activation of eIF4E is associated with poor patient survival (21). Furthermore, the advantage of using oncolytic HSV-1 is the lack of liver toxicity, making it superior to adenoviral vectors since liver damage is the major clinical limitation of adenoviral therapy.  107  Figure 4.1 Schematic diagrams showing the construction of the recombinant viruses ARR2PB-ICP27 and ARR2PB-5’UTR-ICP27. (A) BAC was inserted into the TK locus  by  homologous  recombination.  (B)  ARR2PB-ICP27  (A27)  and  ARR2PB-5’UTR-ICP27 (AU27) recombinant viruses were generated by recombineering method which replaced the endogenous ICP27 promoter with ARR2PB promoter (i) or ARR2PB promoter + 5’UTR from FGF-2 (ii). TK gene was then rescued by homologous recombination in 2-2 cells with HAT selection (iii).  108  Figure 4.2 eIF4E expression levels in cell lines. Total protein was extracted from normal human epithelial prostate cell lines (BPH-1, PNT1B, RWPE-1), human prostate cancer cell lines (LNCaP, PC3, DU145), lung caner cell line (H460), and breast cancer cell line (MCF-7). (A) eIF4E and β-actin expression was determined by Western blot analysis. (B) Density ratio of eIF4E levels normalized to β-actin (means ± SD, n = 3).  109  Figure 4.3 Transcriptional and translational regulation of ICP27. (A) LNCaP cells were infected with A27 and AU27 viruses at an MOI of 3 in the presence of 0 nM or 10 nM R1881. Total RNA was extracted at 4 hr, 8 hr and 24 hr post-infection and ICP27 mRNA level was determined by quantitative RT-PCR and normalized with β-actin. (B) LNCaP and (C) PNT1B cells were infected with A27 and AU27 viruses as described above. Total protein was extracted at 8 hr post-infection, and ICP4, ICP27, and β-actin expression were determined by western blot analysis. Density ratio of eIF4E levels normalized to β-actin (means ± SD). (D) ICP27 mRNA level at 4 hr, 8hr and 24 hr post-infection was determined by quantitative RT-PCR using β-actin as an endogenous control.  110  Figure 4.4 Tumor-specific replication of AU27 virus in vitro. Tumor-specific replication of AU27 virus in vitro. (A) PNT1B and LNCaP cells were infected with wild-type virus at an MOI of 0.01 (104 pfu) and virus titer was determined at 24 hr, 48 hr and 72 hr post-infection. (B) PNT1B and (C) LNCaP cells were infected with A27 or AU27 at an MOI of 0.01 with ±10 nM R1881 treatment and virus titer was determined at 48 hr post-infection. Virus titer was plotted as mean ± SD from four determinants (* = p < 0.05; ** = p < 0.005). 111  A  B  C 10000  ICP27 copy # / μg DNA  ICP27WT A27 AU27  1000  100  10  ey Li ve r Lu ng Sp le S t en om ac h In te st in e Pr os ta te B la dd er Te st es Tu m or  t  id n  ea r  ra in  K  H  B  Ey  es  1  Figure 4.5 AU27 virus inhibited tumor growth without causing toxicity to normal tissues in vivo. (A) Nude mice with LNCaP tumors were treated with one intratumoral injection of 2 x 106 pfu of ICP27¯ (n = 7), WT (n = 5), A27 (n = 6) or AU27 (n = 8) at Day 112  0 when tumor size reached approximately 100 ± 20 mm3. Tumor size was determined by caliper measurements. (B) Survival rate of the treated mice mentioned above was monitored for approximately two months and any mouse that showed signs of morbidity due to viral toxicity was sacrificed immediately. Mice in ICP27¯ treatment group were sacrificed due to tumor burden when tumor size exceeded 4-fold increase. (C) Total DNA was extracted from various organs of the treated mice at the end of the experiment. ICP27 copy number (per μg of DNA) was determined by real-time PCR assays to indicate the presence of virus in the tissues.  113  Figure 4.6 AU27 virus targeted and killed tumor cells after systemic administration. (A) Nude mice with LNCaP tumors were treated with a single intravenous injection of 5 x 107 pfu of ICP27¯ (n = 4), AU27 (n = 5) or 5 x 105 pfu (100x less) of AU27 (n = 4) at Day 0 when tumor size reached approximately 140 ± 65 mm3. (B) At day 28 post-viral injection, total DNA was extracted from various organs of the treated mice. ICP27 copy number (per μg of DNA) was determined by real-time PCR assays. 114  4.5 References 1.  Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71-96.  2.  Martel CL, Gumerlock PH, Meyers FJ, and Lara PN Current strategies in the management of hormone refractory prostate cancer. Cancer Treat Rev 2003;29:171-87.  3.  Albertsen PC, Hanley JA and Fine J 20-year outcomes following conservative management of clinically localized prostate cancer. Jama 2005;293:2095-101.  4.  Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 2004;351:1502-12.  5.  Petrylak DP Future directions in the treatment of androgen-independent prostate cancer. Urology 2005;65:8-12.  6.  Varghese S and Rabkin SD Oncolytic herpes simplex virus vectors for cancer virotherapy. Cancer Gene Ther 2002;9:967-78.  7.  Mullen JT and Tanabe KK Viral oncolysis. Oncologist 2002;7:106-19.  8.  Shah A and Benbow S United Kingdom national survey of the views of geriatric psychiatrists on the administration of electroconvulsive therapy to patients with fractures. J Ect 2002;18:203-6.  9.  Markert JM, Liechty PG, Wang W, et al. Phase Ib trial of mutant herpes simplex virus G207 inoculated pre-and post-tumor resection for recurrent GBM. Mol Ther 2009;17:199-207.  10.  Zheng X, Rao XM, Snodgrass C, et al. Adenoviral E1a expression levels affect virus-selective  replication  in  human  cancer  cells.  Cancer  Biol  Ther  2005;4:1255-62. 11.  Lee CY, Bu LX, Rennie PS, and Jia WW An HSV-1 amplicon system for prostate-specific expression of ICP4 to complement oncolytic viral replication for in vitro and in vivo treatment of prostate cancer cells. Cancer Gene Ther 2007;14:652-60.  12.  Yu D, Jia WW, Gleave ME, Nelson CC, and Rennie PS Prostate-tumor targeting of gene expression by lentiviral vectors containing elements of the probasin promoter. Prostate 2004;59:370-82.  13.  Kevil C, Carter P, Hu B, and DeBenedetti A Translational enhancement of FGF-2 by eIF-4 factors, and alternate utilization of CUG and AUG codons for translation 115  initiation. Oncogene 1995;11:2339-48. 14.  Jiang Y and Muschel RJ Regulation of matrix metalloproteinase-9 (MMP-9) by translational efficiency in murine prostate carcinoma cells. Cancer Res 2002;62:1910-4.  15.  De Benedetti A and Graff JR eIF-4E expression and its role in malignancies and metastases. Oncogene 2004;23:3189-99.  16.  Graff JR and Zimmer SG Translational control and metastatic progression: enhanced activity of the mRNA cap-binding protein eIF-4E selectively enhances translation of metastasis-related mRNAs. Clin Exp Metastasis 2003;20:265-73.  17.  Rosenwald IB, Chen JJ, Wang S, Savas L, London IM, and Pullman J Upregulation of protein synthesis initiation factor eIF-4E is an early event during colon carcinogenesis. Oncogene 1999;18:2507-17.  18.  Berkel HJ, Turbat-Herrera EA, Shi R, and de Benedetti A Expression of the translation initiation factor eIF4E in the polyp-cancer sequence in the colon. Cancer Epidemiol Biomarkers Prev 2001;10:663-6.  19.  Seki N, Takasu T, Mandai K, et al. Expression of eukaryotic initiation factor 4E in atypical adenomatous hyperplasia and adenocarcinoma of the human peripheral lung. Clin Cancer Res 2002;8:3046-53.  20.  Yu D, Scott C, Jia WW, et al. Targeting and killing of prostate cancer cells using lentiviral constructs containing a sequence recognized by translation factor eIF4E and a prostate-specific promoter. Cancer Gene Ther 2006;13:32-43.  21.  Graff JR, Konicek BW, Lynch RL, et al. eIF4E activation is commonly elevated in advanced human prostate cancers and significantly related to reduced patient survival. Cancer Res 2009;69:3866-73.  22.  Mathis JM, Williams BJ, Sibley DA, et al. Cancer-specific targeting of an adenovirus-delivered herpes simplex virus thymidine kinase suicide gene using translational control. J Gene Med 2006;8:1105-20.  23.  Liu P, Jenkins NA and Copeland NG A highly efficient recombineering-based method  for  generating  conditional  knockout  mutations.  Genome  Res  2003;13:476-84. 24.  Shimasaki S, Emoto N, Koba A, et al. Complementary DNA cloning and sequencing of rat ovarian basic fibroblast growth factor and tissue distribution study of its mRNA. Biochem Biophys Res Commun 1988;157:256-63. 116  25.  Horsburgh BC, Hubinette MM, Qiang D, MacDonald ML, and Tufaro F Allele replacement: an application that permits rapid manipulation of herpes simplex virus type 1 genomes. Gene Ther 1999;6:922-30.  26.  Morris DJ and Robinson TJ Thymidine kinase (Tk-1) maps below the T42H breakpoint on mouse chromosome 11. Mamm Genome 1991;1:263-4.  27.  Rhim JS, Webber MM, Bello D, et al. Stepwise immortalization and transformation of adult human prostate epithelial cells by a combination of HPV-18 and v-Ki-ras. Proc Natl Acad Sci U S A 1994;91:11874-8.  28.  Horoszewicz JS, Leong SS, Chu TM, et al. The LNCaP cell line--a new model for studies on human prostatic carcinoma. Prog Clin Biol Res 1980;37:115-32.  29.  Stone KR, Mickey DD, Wunderli H, Mickey GH, and Paulson DF Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer 1978;21:274-81.  30.  Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, and Jones LW Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Invest Urol 1979;17:16-23.  31.  Carney DN, Gazdar AF, Bepler G, et al. Establishment and identification of small cell lung cancer cell lines having classic and variant features. Cancer Res 1985;45:2913-23.  32.  Bacus SS, Kiguchi K, Chin D, King CR, and Huberman E Differentiation of cultured human breast cancer cells (AU-565 and MCF-7) associated with loss of cell surface HER-2/neu antigen. Mol Carcinog 1990;3:350-62.  33.  Hayward SW, Dahiya R, Cunha GR, Bartek J, Deshpande N, and Narayan P Establishment and characterization of an immortalized but non-transformed human prostate epithelial cell line: BPH-1. In Vitro Cell Dev Biol Anim 1995;31:14-24.  34.  Degeorges A, Hoffschir F, Cussenot O, et al. Recurrent cytogenetic alterations of prostate carcinoma and amplification of c-myc or epidermal growth factor receptor in subclones of immortalized PNT1 human prostate epithelial cell line. Int J Cancer 1995;62:724-31.  35.  Hubenthal-Voss J, Houghten RA, Pereira L, and Roizman B Mapping of functional and antigenic domains of the alpha 4 protein of herpes simplex virus 1. J Virol 1988;62:454-62.  36.  Ackermann M, Braun DK, Pereira L, and Roizman B Characterization of herpes 117  simplex virus 1 alpha proteins 0, 4, and 27 with monoclonal antibodies. J Virol 1984;52:108-18. 37.  Beardsley EK and Chi KN Systemic therapy after first-line docetaxel in metastatic castration-resistant  prostate  cancer.  Curr  Opin  Support  Palliat  Care  2008;2:161-6. 38.  Lukonis CJ and Weller SK The herpes simplex virus type 1 transactivator ICPO mediates aberrant intracellular localization of the viral helicase/primase complex subunits. Virology 1996;220:495-501.  39.  Yang CT, Song J, Bu X, et al. Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells. Gene Ther 2003;10:1494-502.  40.  Koivisto P, Kononen J, Palmberg C, et al. Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 1997;57:314-9.  41.  Taplin ME, Rajeshkumar B, Halabi S, et al. Androgen receptor mutations in androgen-independent prostate cancer: Cancer and Leukemia Group B Study 9663. J Clin Oncol 2003;21:2673-8.  42.  Taplin ME and Balk SP Androgen receptor: a key molecule in the progression of prostate cancer to hormone independence. J Cell Biochem 2004;91:483-90.  43.  Bell JC and Kirn D MicroRNAs fine-tune oncolytic viruses. Nat Biotechnol 2008;26:1346-8.  44.  Lee CY, Rennie PS and Jia WW MicroRNA regulation of oncolytic herpes simplex virus-1 for selective killing of prostate cancer cells. Clin Cancer Res 2009;15:5126-35.  118  5. Conclusions and future directions  5.1 Transcriptional targeting using tissue-specific promoters Previous studies employing oncolytic HSV-1 targeting have focused mainly on the deletion of viral genes that are dispensable in tumor cells (1-3); however, this usually results in attenuation of the viruses, therefore compromising their efficiency to kill such cells. An alternative method to selectively target tumor cells is to transcriptionally control the expression of essential viral genes. The first attempt to control viral replication transcriptionally through the regulation of an essential HSV-1 viral gene was demonstrated by Miyatake et al., who generated a recombinant HSV-1 virus, G92A, by inserting the ICP4 gene driven by the liver-specific albumin enhancer/promoter at the TK locus (4). The G92A virus replicates efficiently in hepatocellular carcinoma cell lines; however, its application is quite limited in humans because albumin is expressed in both normal and cancerous liver cells. Moreover, this virus is TK-negative and therefore cannot be controlled by antiviral drugs such as acyclovir. Additional research utilizing tumor-related promoters to drive ICP4 gene expression to target tumor cells includes the use of the calponin promoter to target malignant human soft tissue and bone tumors (5), and the use of the β-catenin-dependent promoter to target colorectal cancers or cancers characterized by elevated activation of the β-catenin signaling pathway (6). We are the first to describe an HSV-1 amplicon system that uses a prostate-specific promoter, ARR2PB-ICP4, to control the expression of an essential HSV-1 viral gene, ICP4, which can then complement an ICP4¯ helper virus for efficient replication and destruction of prostate cancer cells both in vitro and in vivo. Previously, it was reported that basal activities of the ARR2PB promoter could be seen in nonprostatic cell lines, but its activity was highly specific for prostatic epithelium in transgenic mice (7). Incidentally, using this promoter in our viral targeting system, we observed a level of viral toxicity in the stomach of mice treated with the ARR2PB-ICP4 amplicon/helper virus, which, in some cases, led to delayed gastritis-related death. One explanation for this finding is that a low level of ICP4 could still be expressed from the leaky promoter and was therefore sufficient to initiate lytic viral replication. This residual toxicity can be completely eliminated by supplemental treatment with ganciclovir (GCV) (Appendix A). GCV can be phosphorylated by the HSV-1 TK enzyme into a monophosphate form that cellular kinases further convert into GCV-triphosphate, thus causing cell death by 119  inhibiting DNA replication (8). Similar to the ARR2PB-ICP4 treatment group, an approximately 70% reduction in tumor size was observed in mice treated with the ARR2PB-ICP4 amplicon/helper virus plus GCV at day 28 post-viral injection, however no morbidity or mortality was observed in these mice (Appendix B, Figure B.1). Thus, supplementary GCV treatment was able to eliminate the toxicity caused by the ARR2PB-ICP4 amplicon/helper virus without compromising the efficiency of inhibiting the growth of LNCaP tumors. Furthermore, the additional GCV treatment can augment the tumor killing efficiency via the “bystander effect”, which causes the death of neighboring cells due to the transfer of phosphorylated GCV through gap junctions (9, 10). This effect has been the principle rationale for suicide gene therapy. In summary, this research further demonstrates a favorable feature of oncolytic HSV-1 viruses whereby GCV can provide a safeguard against unintended viral spread to normal tissues.  5.2 MicroRNA-mediated translational targeting Translational regulation is a fairly new targeting strategy in oncolytic virotherapy. With the recent discovery of miRNAs in 2001, we are the first group to demonstrate that differentially expressed tumor suppressor miRNAs can be utilized to control the replication of an oncolytic DNA virus in a tumor-specific fashion. We provided the first proof of principle that an HSV-1 amplicon/helper virus containing specific miRNA target sequences (miR-143 or miR-145) can be used for oncolytic virotherapy through tumor-specific expression of the ICP4 gene. Tumor suppressor miRNAs such as miR-143 and miR-145 are ideal candidates to be incorporated into oncolytic viral vectors in that they are globally downregulated in tumor cells relative to normal tissues, thereby offering a wide applicability towards the treatment of various cancer types (11-13). In vitro screening using cell lines that express varying levels of tumor-related miRNAs offer a quick and easy way to identify the best complementary miRNA target sites to incorporate into the viral vectors. Accordingly, we examined miR-143 and miR-145 expression levels in various normal and malignant prostate cancer cell lines attempting to find two representative cell lines with high and low miR-143 or miR-145 levels to test our viral constructs, which carry the specific target sequences in the 3’UTR of the ICP4 gene. Unfortunately, the expression of miR-143 and miR-145 was lost in BPH-1 and PNT1B normal prostate cell lines (Appendix B, Figure B.2). Similar results 120  have previously been reported as well and it is most likely an oddity/abnormality that has occurred only in cell lines as miR-143 and miR-145 are highly expressed in normal human tissues (Appendix B, Figure B.3). We did not screen miR-143 and miR-145 expression in normal non-prostate cell lines because they are less relevant to this study. Instead, we created two stable cell lines, LNCaP-143 and LNCaP-145, which express endogenous miR-143 or miR-145 (Appendix A). The expression level of miR-143 in LNCaP-143 cells is equivalent to that seen in the normal mouse tissues, but the expression level of miR-145 in LNCaP-145 is >80 times less than in normal mouse tissues (Appendix B, Figure B.2). Since both of these miRNAs are normally downregulated in tumor cells, and have been suggested to function as tumor suppressors, their re-expression in tumor cells may impart detrimental effects on cellular growth and may change cellular phenotypes. In this regard, miR-143 and miR-145 have been shown to inhibit tumor cell growth by targeting ERK5 and the insulin receptor substrate-1, respectively (14, 15). Subsequently, we infected these stable cell lines with our modified miRNA-mediated amplicon viruses and examined cell viability using the MTT assays (Appendix A). Our results showed that LNCaP cells were protected from CMV-ICP4-143T viral infection by miR-143 with 70% of the cells still alive at 120 hrs post-viral infection, whereas only 30% of the parental LNCaP cells were alive (Appendix B, Figure B.4). In contrast, protection of LNCaP cells by endogenous miR-145 only lasted 96 hours post-viral infection with the CMV-ICP4-145T amplicon virus. Furthermore, our in vivo results showed minimal toxicity in the gastrointestinal (GI) tract (eg. stomach, intestines) of mice treated with CMV-ICP4-143T or CMV-ICP4-145T amplicon viruses. These findings suggest that the efficiency and degree of protection by miRNAs is directly related to the amount of intracellular miRNAs present. Fortunately, a major advantage of this targeting strategy is that several copies of one or multiple miRNA species can be incorporated into the viral genome to further enhance tumor-specificity. In cases where the normal cells do not express a sufficient amount of a particular miRNA, a combination of more than one tumor-specific or tissue-specific miRNA can be used to enhance tumor-specificity (eg. 143T+145T). Another approach is to incorporate an additional tissue-specific miRNA from the organs that are normally more susceptible to viral infections. For example, since HSV-1 is a neurotropic virus and the neuron-specific miR-124 is highly expressed in the human brain and in the eyes and brain of nude mice (Appendix B, Figure B.3 & B.5), the incorporation of miR-124T into 121  the 3’UTR can be beneficially more effective in eliminating viral spread throughout the nervous system, thereby reducing unwanted cytotoxicity in normal tissues. This miRNA-mediated translational targeting strategy can also be used in conjunction with pre-existing targeting approaches. For instance, we have generated two prostate-specific and tumor-specific amplicon viruses, ARR2PB-ICP4-143T and ARR2PB-ICP4-145T (Appendix B, Figure B.6), and tested their efficacies in vivo. A greater than 60% reduction in tumor size and luciferase (reporter protein) activity was observed in mice treated with ARR2PB-ICP4-143T and ARR2PB-ICP4-145T at 28 days post-viral injection (Appendix B, Figure B.7 & B.8). As with the CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses, the ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses efficiently reduced the tumor burden in vivo albeit with an initial delay in response. Quantitative real-time PCR analysis of various organs from the treated mice showed that the majority of the virus was detected in the tumors and only small traces were found in the stomach (Appendix B, Figure B.9). This residual toxicity in the GI tract has always been an issue in our amplicon/helper system, and can partly be explained by the fact that an amplicon virus carries greater than 15 copies of the ICP4 gene, which can easily overwhelm the regulatory controls. From a transcriptional regulation stand point, the chances for the ICP4 gene to be non-specifically expressed from the ARR2PB promoter in the amplicon virus are 15 times greater. In the case of translational control, there could potentially be 15 times more of the ICP4 mRNA transcripts requiring degradation by the endogenous miRNAs. The best way to eliminate this problem would be to generate a recombinant oncolytic virus for the purpose of clinical applications. Nevertheless, our results demonstrate the potential applicability of dually regulating viral replication both at a transcriptional level by the prostate-specific promoter and at a translational level by miRNAs. Recently, similar targeting strategies taking advantage of differentially expressed miRNAs have been reported by three separate groups. Two of these groups utilized tissue-specific miRNAs to retarget adenovirus and picornavirus, respectively, while one group used a tumor-specific miRNA to retarget the vesicular stomatitis virus (VSV). For example, Ylosmaki et al. constructed a recombinant adenovirus that carries three copies of complementary target sequences to the liver-specific miR-122 in the 3’UTR of the E1A gene and demonstrated that viral replication was inhibited in cell lines (Huh7) expressing high levels of miR-122, indicating that this approach could alter the tropism 122  of a virus (16). This application may be particularly useful in the current adenoviral vectors as liver toxicity has always been a concern when delivering these viruses systemically. Further, a similar approach has been demonstrated by Kelly et al., who inserted two copies each of miR-133 and miR-206 target sites into the 3’UTR of the coxsackievirus A21 (CVA21) (17). They showed that this virus inhibited the growth of multiple myeloma tumors and prolonged the survival of treated mice without causing muscle paralysis. On the other hand, and more similar to our approach, Edge et al. demonstrated tumor-specific replication of an oncolytic VSV virus by incorporating three repeats of the complementary target sequence to the tumor suppressor miRNA, let-7, in the 3’UTR of the VSV M gene, which encodes for the matrix protein and is essential for viral growth and replication (18). Let-7 has been shown to be downregulated in lung and breast cancer, and one of its target genes is the oncogene, RAS. Other tumor suppressor miRNAs such as miR-15 and miR-16 could also be tested to direct tumor-selective oncolytic viral targeting. The major disadvantage of employing a miRNA-mediated targeting strategy in an RNA virus is that mutations occurring in the 3’UTR region containing the miRNA target sites may enable the virus to escape from miRNA regulation and this has indeed been reported in one case (17). Altogether, miRNA-mediated targeting has proven to be a promising approach in harnessing viral tropism and transgene expression. Our research, along with others, has demonstrated that oncolytic viruses can be subjected to endogenous miRNA control, thus providing a foundation for the development of a novel and safe targeting strategy towards the treatment of prostate and other cancers. This would create a new category of oncolytic viruses, miRNA-mediated oncolytic viruses, which are safer and more efficient in tumor-specific destruction. This strategy is particularly applicable towards the development of cancer vaccines and virotherapeutics.  5.3 EIF4E-regulated translational targeting Another translational targeting strategy is to control the initiation of protein synthesis through eIF4E regulation. We are the first group to investigate the effect of transcriptional and translational regulation of the essential HSV-1 viral gene, ICP27, on viral replication and tumor-specific targeting. To do this, we replaced the endogenous promoter of the ICP27 gene in a recombinant virus with the prostate-specific and androgen receptor-dependent promoter, ARR2PB, plus the FGF 5’UTR to control viral 123  replication. We showed that both ICP27 gene expression and viral replication are enhanced by elevated androgen receptor activity in vitro. However, this transcriptional upregulation of viral gene expression can be effectively suppressed in normal cells via translational regulation using a complex 5’UTR. Expression of a gene with this type of 5’UTR requires high levels of eIF4E/eIF4F complexes, which are overexpressed in tumor cells, but low in normal cells. Since eIF4E overexpression has recently been shown to be associated with progression to a hormone-refractory state and reduced patient survival, the utilization of 5’UTR as a tumor-specific targeting strategy may be particularly useful for the treatment of advanced disease (19). We found that translational regulation overrides the transcriptional upregulation of the viral gene by androgen and inhibits viral gene expression and viral replication in normal prostate cells, but not in prostate tumor cells. This effect is particularly favorable as the cytolytic activity of a virus can be enhanced in the tumors while at the same time being suppressed to a safe level in normal tissues. Furthermore, our in vivo data demonstrated that the AU27 virus exhibits strong oncolytic activity in prostate tumors while remaining inactive within normal tissues. In the LNCaP xenograft mouse model, a single intravenous injection as low as 5x105 pfu of the AU27 virus was sufficient to cause a greater than 60% reduction in tumor size, whereas 5x107 pfu was able to cause a greater than 85% reduction by day 28 post-viral injection. Furthermore, significant viral replication was found in the tumor mass, but not in any of the normal organs tested by quantitative real-time PCR analysis. Recently, a similar targeting approach has also been demonstrated in a conditionally replicative adenovirus (CRAds) that utilizes the CXCR4 gene promoter plus the FGF 5’UTR to control the expression of the E1A gene for the treatment of breast cancer (20). It was shown that the virus effectively inhibited tumor growth in a breast cancer murine model, and that no liver toxicity was observed when using the human liver tissue slice model. Altogether, our results indicate that a dual transcriptional and translational targeting strategy for viral essential gene expression increases both viral lytic activity and tumor specificity. Moreover, this same approach can be easily adapted to other types of cancer by incorporating an appropriate tissue-specific promoter. In contrast to the amplicon/helper system, no toxicity was seen in the GI tract of the mice treated with the AU27 recombinant virus. There are two possible explanations for this discrepancy: 1). different viral packaging systems, and 2). regulation of two different viral genes. As previously described, one major problem lies in the inherently different 124  properties between the amplicon virus and the recombinant virus in terms of the number of gene copies that they carry. Another possibility is that the ICP27 gene may be a more favorable candidate than the ICP4 gene. Unlike the ICP4 protein, ICP27 is a multifunctional protein that is involved in many processes during the viral life cycle, such as the transcription of viral genes as a co-activator (21), shutoff of host protein synthesis by inhibiting pre-mRNA splicing (22), and promoting viral mRNA processing and export (23). As a result, it is possible that the threshold for ICP27 expression to initiate lytic viral replication is much higher than that for ICP4. Therefore, low levels of ICP27 expression may not be as big of a concern as for leaky ICP4 expression. Caution should be taken when replacing the promoter of a viral gene as this may alter the normal kinetics of gene expression and viral replication. However, the concern over attenuating the virus is not necessary in the case of the ICP27 gene, since it has been shown that alteration in the ICP27 endogenous promoter merely causes a delay in viral gene expression and has no adverse effect on viral replicability (24). On the other hand, retaining the endogenous promoter of the ICP4 gene may be beneficial because this promoter contains both positive and negative regulatory elements for its own protein, thus the ICP4 protein can negatively regulate its own expression through a negative feedback loop (25). By changing its promoter, the ICP4 protein will continue to accumulate and may cause cytotoxic effects in normal tissues. Further detailed studies of the biology of viral genes and its life cycle may reveal other ideal candidate genes for tumor-specific regulation. Due to the systemic nature of most malignancies, the ultimate goal is to deliver oncolytic viral vectors intravenously to target the disseminated disease. Using the LNCaP xenograft mouse model, we have demonstrated that the AU27 virus was able to kill the subcutaneous LNCaP tumors efficiently after intravenous administration. To examine the ability of the AU27 virus in targeting metastases, future studies should test the efficacy of oncolytic viruses using immunocompetent mouse models such as the TRAMP (transgenic adenocarcinoma of mouse prostate) model (26) or the PTEN (phosphatase and tensin homolog deleted on chromosome 10) knockout model (27). Moreover, the use of immunocompetent mouse models can yield more insights into the effect of an immune response against the efficacy of oncolytic viral vectors. It has been shown that innate and adaptive immune responses can either hinder the spread and oncolytic effect of the virus by restricting viral distribution (28) or augment the anti-tumor efficacy through redirected targeting to tumor antigens (29). In addition, pre-existing 125  immunity has been shown to exhibit minimal effects on the efficacy of the oncolytic HSV-1 viruses (3, 30). In light of these observations, further investigation is required to fully understand the role of immunity in oncolytic virotherapy. Before proceeding towards clinical trials, the virus should be tested in immunocompetent mice with a goal set to determine doses, toxicity, route of administration of the virus and the immunological effect on the virus. Immunostimulatory cytokines or other therapeutic genes may also be incorporated into this oncolytic viral backbone to further improve therapeutic efficacy in that the cytolytic effect can be dramatically enhanced by the initial direct lysis of the infected tumor cells followed by the amplification and dissemination of the therapeutic genes encoding anti-angiogenic agents, cytokines, or prodrug-converting enzymes. This could be used in neoadjuvant or adjuvant settings in combination with chemotherapy or radiation therapy.  5.4 Conclusions Even though virotherapy for cancer treatment is still in its infancy, significant progress has been made in the last two decades (1, 31-33). The field of oncolytic virotherapy has evolved around one central theme - capitalizing on the differential cellular properties between normal and tumor cells. Based on data from clinical trials, it is widely recognized that the current oncolytic viral vectors can be safely administered to patients at high doses, but their efficacy is seldom seen. This could be explained by the attenuation of viruses through gene deletions, clearance of virus by the immune system, and ineffective intratumoral spread. However, the anti-tumor efficacy of oncolytic viruses is significantly enhanced when used in combination with chemotherapy or radiation therapy. To improve the effectiveness of an oncolytic viral vector, a major focus has been the enhancement of tumor-selective targeting without compromising viral cytotoxicity. To this end, we have successfully demonstrated that an oncolytic HSV-1 virus can be engineered to target tumor cells specifically without extensive collateral damage to normal tissues through both transcriptional and translational regulation of viral replication. Our results demonstrated that the utilization of the tissue-specific promoter, the miRNA-mediated 3’UTRs, and the eIF4E-regulated 5’UTRs in a targeted virotherapy is a viable approach with significantly enhanced anti-tumor efficacy and specificity. This type of oncolytic virus can be armed with immunostimulatory cytokines to elicit immune responses against tumor antigens. Ultimately, this research provides a 126  fundamental basis for the development of novel oncolytic viruses for the treatment of various cancers through both local and systemic deliveries.  127  5.5 References 1.  Mineta T, Rabkin SD, Yazaki T, Hunter WD, Martuza RL. Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1995;1:938-43.  2.  Randazzo BP, Kucharczuk JC, Litzky LA, et al. Herpes simplex 1716--an ICP 34.5 mutant--is severely replication restricted in human skin xenografts in vivo. Virology 1996;223:392-5.  3.  Yoon SS, Nakamura H, Carroll NM, Bode BP, Chiocca EA, Tanabe KK. An oncolytic herpes simplex virus type 1 selectively destroys diffuse liver metastases from colon carcinoma. Faseb J 2000;14:301-11.  4.  Miyatake S, Iyer A, Martuza RL, Rabkin SD. Transcriptional targeting of herpes simplex virus for cell-specific replication. J Virol 1997;71:5124-32.  5.  Yamamura H, Hashio M, Noguchi M, et al. Identification of the transcriptional regulatory sequences of human calponin promoter and their use in targeting a conditionally replicating herpes vector to malignant human soft tissue and bone tumors. Cancer Res 2001;61:3969-77.  6.  Kuroda T, Rabkin SD, Martuza RL. Effective treatment of tumors with strong beta-catenin/T-cell factor activity by transcriptionally targeted oncolytic herpes simplex virus vector. Cancer Res 2006;66:10127-35.  7.  Zhang J, Thomas TZ, Kasper S, Matusik RJ. A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoids in vitro and in vivo. Endocrinology 2000;141:4698-710.  8.  Moolten FL, Wells JM, Heyman RA, Evans RM. Lymphoma regression induced by ganciclovir in mice bearing a herpes thymidine kinase transgene. Hum Gene Ther 1990;1:125-34.  9.  Freeman SM, Abboud CN, Whartenby KA, et al. The "bystander effect": tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res 1993;53:5274-83.  10.  Vrionis FD, Wu JK, Qi P, Waltzman M, Cherington V, Spray DC. The bystander effect exerted by tumor cells expressing the herpes simplex virus thymidine kinase (HSVtk) gene is dependent on connexin expression and cell communication via gap junctions. Gene Ther 1997;4:577-85. 128  11.  Iorio MV, Ferracin M, Liu CG, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005;65:7065-70.  12.  Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 2003;1:882-91.  13.  Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257-61.  14.  Akao Y, Nakagawa Y, Naoe T. MicroRNAs 143 and 145 are possible common onco-microRNAs in human cancers. Oncol Rep 2006;16:845-50.  15.  Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem 2007;282:32582-90.  16.  Ylosmaki E, Hakkarainen T, Hemminki A, Visakorpi T, Andino R, Saksela K. Generation of a conditionally replicating adenovirus based on targeted destruction of E1A mRNA by a cell type-specific MicroRNA. J Virol 2008;82:11009-15.  17.  Kelly EJ, Hadac EM, Greiner S, Russell SJ. Engineering microRNA responsiveness to decrease virus pathogenicity. Nat Med 2008;14:1278-83.  18.  Edge RE, Falls TJ, Brown CW, Lichty BD, Atkins H, Bell JC. A let-7 MicroRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replication. Mol Ther 2008;16:1437-43.  19.  Graff JR, Konicek BW, Lynch RL, et al. eIF4E activation is commonly elevated in advanced human prostate cancers and significantly related to reduced patient survival. Cancer Res 2009;69:3866-73.  20.  Stoff-Khalili MA, Rivera AA, Nedeljkovic-Kurepa A, et al. Cancer-specific targeting of a conditionally replicative adenovirus using mRNA translational control. Breast Cancer Res Treat 2008;108:43-55.  21.  Roizman B, D.M. K Herpes simplex viruses and their replication. In: Fields Virology, 4th edition, pp. 2399-459. Philadelphia: Lippincott Williams & Wilkins, 2001.  22.  Sciabica KS, Dai QJ, Sandri-Goldin RM. ICP27 interacts with SRPK1 to mediate HSV splicing inhibition by altering SR protein phosphorylation. Embo J 129  2003;22:1608-19. 23.  Sandri-Goldin RM. Viral regulation of mRNA export. J Virol 2004;78:4389-96.  24.  Sun A, Devi-Rao GV, Rice MK, et al. The TATGARAT box of the HSV-1 ICP27 gene is essential for immediate early expression but not critical for efficient replication in vitro or in vivo. Virus Genes 2004;29:335-43.  25.  Leopardi R, Michael N, Roizman B. Repression of the herpes simplex virus 1 alpha 4 gene by its gene product (ICP4) within the context of the viral genome is conditioned by the distance and stereoaxial alignment of the ICP4 DNA binding site relative to the TATA box. J Virol 1995;69:3042-8.  26.  Greenberg NM, DeMayo F, Finegold MJ, et al. Prostate cancer in a transgenic mouse. Proc Natl Acad Sci U S A 1995;92:3439-43.  27.  Wang S, Gao J, Lei Q, et al. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 2003;4:209-21.  28.  Ikeda K, Ichikawa T, Wakimoto H, et al. Oncolytic virus therapy of multiple tumors in the brain requires suppression of innate and elicited antiviral responses. Nat Med 1999;5:881-7.  29.  Todo T, Rabkin SD, Sundaresan P, et al. Systemic antitumor immunity in experimental brain tumor therapy using a multimutated, replication-competent herpes simplex virus. Hum Gene Ther 1999;10:2741-55.  30.  Delman KA, Bennett JJ, Zager JS, et al. Effects of preexisting immunity on the response to herpes simplex-based oncolytic viral therapy. Hum Gene Ther 2000;11:2465-72.  31.  Coffey MC, Strong JE, Forsyth PA, Lee PW. Reovirus therapy of tumors with activated Ras pathway. Science 1998;282:1332-4.  32.  Stojdl DF, Lichty B, Knowles S, et al. Exploiting tumor-specific defects in the interferon pathway with a previously unknown oncolytic virus. Nat Med 2000;6:821-5.  33.  Kirn D. Oncolytic virotherapy for cancer with the adenovirus dl1520 (Onyx-015): results of phase I and II trials. Expert Opin Biol Ther 2001;1:525-38.  130  Appendix A  A.1 Supplementary material and methods  A.1.1 GCV treatment in LNCaP xenograft model Athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) and LNCaP cancer cells were implanted subcutaneously by injecting 5 x 106 cells in 100 μL of medium with matrigel at four different sites over the shoulders and hind legs on both sides. Animals were monitored for tumor development two times a week by palpation of the injection sites. When detected, tumor volumes were determined by caliper measurements and calculated using the formula volume = width x length x thickness x π/6. When the tumor volume reached approximately 100 mm3 (at ~1 - 1.5 month after tumor inoculation), the mice were treated with two intratumoral injections (Day 0 and Day 7) of DMEM medium alone, or of 2 x 106 pfu of the ICP4¯ helper virus, or ARR2PB-ICP4 amplicon/helper virus. Starting at Day 10, ganciclovir (GCV) was administered intraperitoneally at a concentration of 50 μg/g once every two days (1, 2). The mean fold change in tumor size was determined by comparing the tumor size from each day to the original size at Day 0 and the average was plotted on the graph (n = 3 for each group). All experimental procedures were approved by the UBC Animal Care Committee and followed the guidelines and policies of the Canadian Council on Animal Care.  A.1.2 Generation of stable LNCaP-143 and LNCaP-145 cell lines To make miRNA-expression vectors that express miR-143 or miR-145, two pairs of oligonucleotides miR-143S (5’-TGCTGTGAGATGAAGCACTGTAGCTCAGTTTTGG CCACTGACTGACTGAGCTACTGCTTCATCTCA-3’),  miR-143AS  (5’-CCTGTGAGA  TGAAGCAGTAGCTCAGTCAGTCAGTGGCCAAAACTGAGCTACAGTGCTTCATCTC AC-3’) and miR-145S (5-’TGC TGGTCCAGTTTTCCCAGGAATCCCTTGTTTTGGC CACTGACTGACAAGGGATTTGGGAAAACTGGAC-3’), miR-145AS (5’-CCTGGTCC AGTTTTCCCAAATCCCTTGTCAGTCAGTGGCCAAAACAAGGGATTCCTGGGAAAA CTGGACC-3’) were annealed and cloned into the pcDNA6.2-GW-EMGFP vectors (Invitrogen, Vancouver, Canada) following the company’s instructions. LNCaP-143 and LNCaP-145 are stable cell lines that constitutively express miR-143 and miR-145, 131  respectively, as well as GFP protein. To generate these cell lines, LNCaP cells were transfected with miRNA expressing vectors and grown in DMEM media containing 10% FBS and Blasticidin (10 μg / μL) for more than two weeks. All cells were maintained in a 5% CO2 incubator at 37℃.  A.1.3 Cell viability assay LNCaP, LNCaP-143 and LNCaP-145 cells were seeded in 96-well plates at a density of 1 x 104 cells/well in 100 μL medium. The next day, cells were infected with ICP4¯ helper, CMV-ICP4-143T or CMV-ICP4-145T amplicon virus at MOI of 1. Cell viability was then determined at 24, 72, 96 and 120 hours by MTT assay as previously described (3).  A.1.4 Amplicon plasmid constructs ARR2PB-ICP4-143T  and  ARR2PB-ICP4-145T  amplicon  plasmids  were  generated by replacing the CMV promoter of the CMV-ICP4-143T and CMV-ICP4-145T amplicon plasmids with the ARR2PB promoter (4), respectively. A.1.5 LNCaP-Luciferase xenograft mouse model Athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN) and LNCaP-Luc cells were inoculated subcutaneously by injecting 5 x 106 cells in 100 μL of medium with matrigel at two different sites on the flanks. Tumor volumes were determined by caliper measurements and calculated using the formula volume = width x length x thickness x π/6. Once the tumor size reached approximately 100 mm3, mice were treated with two intratumoral injections (at Day 0 and Day 7) of 2 x 106 pfu of the ARR2PB-ICP4-143T (n = 3) or ARR2PB-ICP4-145T (n = 9) amplicon virus. At the end of the experiment, mice were sacrificed using CO2 asphyxiation and several organs (eyes, brain, kidneys, liver, lung, spleen, stomach, prostate, bladder, testicles) and the tumors were removed and analyzed by real-time PCR analysis. For imaging the tumors, mice were injected with D-Luciferin intraperitoneally at a concentration of 150 μg luciferin / g of body weight 15 minutes prior to imaging with the IVIS 200 system (Xenogen). All experimental procedures were approved by UBC Animal Care Committee and followed the guidelines and policies of Canadian Council on Animal Care. 132  A.2 References 1.  DeFatta RJ, Chervenak RP, De Benedetti A. A cancer gene therapy approach through translational control of a suicide gene. Cancer Gene Ther 2002;9:50512.  2.  Cascante A, Huch M, Rodriguez LG, Gonzalez JR, Costantini L, Fillat C. Tat8TK/GCV suicide gene therapy induces pancreatic tumor regression in vivo. Hum Gene Ther 2005;16:1377-88.  3.  Curi MA, Skelly CL, Meyerson SL, et al. Sustained inhibition of experimental neointimal hyperplasia with a genetically modified herpes simplex virus. J Vasc Surg 2003;37:1294-300.  4.  Zhang J, Thomas TZ, Kasper S, Matusik RJ. A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoids in vitro and in vivo. Endocrinology 2000;141:4698-710.  133  Appendix B B.1 Supplementary data Figure B.1 Efficient inhibition of tumor growth using a combination of ARR2PBICP4 amplicon/helper and GCV treatment in LNCaP xenograft model. A >70% reduction in tumor size was observed at day 28 post-viral injection without any morbidity or mortality. Supplemental GCV treatment eliminated the residual toxicity caused by the ARR2PB-ICP4 amplicon/helper virus without compromising anti-tumor efficacy.  Fold Change in Tumor Size  3.5 DMEM 3 ICP4helper  2.5 2  ARR2PBICP4  1.5 1 0.5 0 0  3  5  7  10 12 14 17 19 21 24 26 28 Days post-viral injection  134  Figure B.2 The expression of miR-143 and miR-145 in LNCaP stable cell lines. LNCaP-143 and LNCaP-145 are stable cell lines that constitutively express miR-143 (A) and miR-145 (B) from a CMV promoter. The expression of both miRNAs was lost in the normal prostate epithelial cell lines, BPH-1 and PNT1B. The expression level of miR143 in LNCaP-143 cells is equivalent to that seen in the normal mouse tissues, but the expression level of miR-145 in LNCaP-145 is >80 times less.  135  Figure B.3 MiRNA expression levels in human normal tissues. The expression levels of miR-143, miR-145 and miR-124 in human tissues were determined by quantitative RT-PCR assays and normalized to U6 RNA. Human tissue RNAs were purchased from Ambion. Ten ng of RNA was reverse transcribed to cDNA followed by TaqMan real-time PCR assays. MiR-143 and miR-145 are highly expressed in all normal tissues examined here, whereas miR-124 is a neuron-specific miRNA that is only abundant in the brain.  1.E+07  miR124  1.E+05 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 Ad i po s Bla e dd er Br ain Ce r vi x Co l on Es op ha gu s He ar t Ki dn ey Liv er Lu ng Ov ary Pla ce nta Pr Sk o sta ele te tal mu Sm s all cle int es t in e Sp l ee n Te ste s Th ym us Th yr o i Tra d ch ea  miRNA Expression Level (2  - △△ Ct  )  miR143 miR145  1.E+06  Human tissues  136  Figure B.4 MiR-143 and miR-145 reduced cytotoxicity in LNCaP cells infected with miRNA-regulated amplicon viruses. To demonstrate whether miR-143 and miR145 could protect normal tissues from miRNA-regulated amplicon virus infections, LNCaP, LNCaP-143 and LNCaP-145 cells were infected with the ICP4¯ helper virus and amplicon viruses at an MOI of 1, and cell viability was determined by MTT assays. The results showed that 68 ± 7% of the LNCaP cells were killed by CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses at 120 hr post-viral infection, whereas ICP4¯ helper virus infection showed no significant cytotoxicity. On the other hand, 70 ± 6% of the LNCaP-143 cells infected with CMV-ICP4-143T amplicon virus were still alive at 120 hr post-viral infection (p = 0.0005) and 76 ± 7% of the LNCaP-145 cells survived CMV-ICP4-145T amplicon virus infection at 96 hr post-viral infection (p < 0.005). These results indicated that CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses were able to kill LNCaP cells in vitro and that cell cytotoxicity was reduced when the infected LNCaP cells expressed the corresponding miRNA. In other words, miRNAs were able to protect cells from miRNA-regulated virus infections by inhibiting viral replication at a translational level through 3’UTR.  137  Figure B.5 MiR-124 expression levels in normal mouse tissues. The expression levels of miR-124 in normal mouse organs were determined by quantitative RT-PCR assays and normalized to snoRNA234 RNA. Total RNA from the organs was extracted using the Trizol reagent and ten ng of RNA was reverse transcribed to cDNA followed by TaqMan real-time PCR assays. The results showed that miR-124 is highly  1.E+05 miR124 1.E+04 1.E+03 1.E+02 1.E+01  ra in H ea K rt id ne y Li ve r Lu n Sp g le S t en om ac h B la dd P r er os t Te ate st ic le s  B  es  1.E+00  Ey  miRNA expression level (2  - △△ CT  )  expressed in the eyes and brain of nude mice.  138  Figure B.6 Structure of the two prostate-specific and tumor-specific amplicon plasmids used to package replication-competent amplicon viruses. ARR2PBICP4-143T and ARR2PB-ICP4-145T are both prostate-specific and tumor-specific miRNA-regulated complementing amplicons. ARR2PB -ICP4-143T amplicon contained five tandem copies of miR-143 complementary sequences (143Tx5) and ARR2PBICP4-145T amplicon contained four tandem copies of miR-143 complementary sequences (145Tx4) after the ICP4 gene.  139  Figure B.7 ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses inhibited LNCaP-Luc  tumor  growth  in  xenograft  mouse  model.  Nude mice with  3  subcutaneous LNCaP-Luc tumors (~140 ± 70 mm ) were treated with two intratumoral injections (Day 0 and Day 7) totalling 2 x 106 pfu of the ARR2PB-ICP4-143T or ARR2PB-ICP4-145T amplicon virus. Continued growth of the tumors was observed initially during the first week after viral treatment. Regression of tumors was observed shortly after the second viral injection with tumor size decreasing steadily thereafter. At day 28 post-viral injection, a >65% reduction in the tumor size was observed in both treatment groups. In one of the three mice treated with the ARR2PB-ICP4-145T amplicon virus, the virus did not reduce the tumor size but was able to inhibit further growth. Nonetheless, in comparison with the CMV-ICP4-143T and CMV-ICP4-145T amplicon viruses, the dually regulated ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses were able to significantly inhibit tumor size efficiently.  140  Figure B.8 Representative IVIS images of the mice treated with the ARR2PB-ICP4143T and ARR2PB-ICP4-145T amplicon viruses. The size of the tumor was also visualized by the IVIS imaging system. Luciferase activity was expressed as p/sec/cm2/sr. A >80% reduction in luciferase activity was observed in mice treated with the prostate-specific and miRNA-mediated amplicon viruses at day 17 post-viral injections.  141  Figure B.9 Biodistribution of the ARR2PB-ICP4-143T and ARR2PB-ICP4-145T amplicon viruses. Total DNA was extracted from the organs and the copy number of ICP4 and ICP0 was determined by real-time PCR assays. The results were expressed as relative copy number / μg of DNA. The presence of the amplicon and helper viruses was indicated by the copy number of ICP4 and ICP0, respectively. The majority of the virus was detected in the tumors with over 200 copy numbers of ICP4 or ICP0 genes. A very small amount of the viruses was also detected in the eyes (less than 5 copies) and the stomach (less than 10 copies) of the treated mice.  1000 ARR-ICP4-143T (ICP4) ARR-ICP4-145T (ICP4) ARR-ICP4-143T (ICP0) ARR-ICP4-145T (ICP0)  10  m or Tu  st es Te  en St om ac h Pr os ta te B la dd er  ng Lu  r Li ve  Sp le  K  id n  ey  t ea r H  ra in B  es  1 Ey  Copy # / μg DNA  100  142  Appendix C C.1 Biohazard approval certificate  143  C.2 UBC animal care certificate  144  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067706/manifest

Comment

Related Items