UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Expression of duplicated genes in a polyploid plant in response to abiotic stress Dong, Shaowei 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_dong_shaowei.pdf [ 746.46kB ]
Metadata
JSON: 24-1.0067705.json
JSON-LD: 24-1.0067705-ld.json
RDF/XML (Pretty): 24-1.0067705-rdf.xml
RDF/JSON: 24-1.0067705-rdf.json
Turtle: 24-1.0067705-turtle.txt
N-Triples: 24-1.0067705-rdf-ntriples.txt
Original Record: 24-1.0067705-source.json
Full Text
24-1.0067705-fulltext.txt
Citation
24-1.0067705.ris

Full Text

EXPRESSION OF DUPLICATED GENES IN A POLYPLOID PLANT IN RESPONSE TO ABIOTIC STRESS  by  SHAOWEI DONG B. Sc., Shandong University, 2007  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Plant Science)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  September 2009 © Shaowei Dong 2009      ABSTRACT  Polyploidy, or genome doubling, is an important process in plant evolution that has effects on phenotypes, such as changes in flowering time.  Allopolyploidy can result in  considerable genetic changes including alterations to genome structure, DNA methylation patterns, and gene expression. Although the expression of duplicated genes in polyploid plants has been extensively studied, little is known about the effects of abiotic stress conditions on homeologous gene expression. In this thesis, I examined the expression of 30 homeologous gene pairs in response to five abiotic stress treatments, using a single strand conformation polymorphism (SSCP) assay in allotetraploid Gossypium hirsutum. Twenty-two genes showed stress-induced changes in the expression ratio of the two homeologs, and eight genes showed reciprocal expression changes in response to different abiotic stress treatments, suggesting quantitative subfunctionalization.  I also  examined the expression of ten homeologous gene pairs in response to three abiotic stress treatments in a synthetic Gossypium allotetraploid.  Eight genes showed stress-induced  expression changes. Comparison of the expression changes showed that there was little correspondence in the stress-induced homeolog expression patterns between the natural and synthetic Gossypium polyploids. The results of this study indicate that abiotic stress conditions can have considerable effects on expression of homeologous genes. Some of those expression changes might help plants survive abiotic stresses.  ii     TABLE OF CONTENTS  Abstract……………………………………………………………………………….iiii Table of Contents…………………………………………………………………….iiiiii List of Tables………………………………………………………………………….vv List of Figures……………………………………………………………………….. vi vii Acknowledgements…………………………………………………………………….. 1  Introduction……………………………………………………………………….11  2  Materials and Methods…………………………………………………………...5  5  2.1 2.2 2.3 2.4 2.5 2.6  3  Gene choices, sequence alignments, phylogenetic analyses, and primer design……………55 Plant materials and stress treatments………………………………………………………..55 Nucleic acid extraction, reverse transcription and polymerase chain Reaction……………..7 7 SSCP (Single Strand Conformation Polymorphism)…………………………………….....88 DNA sequencing to identify homeologs………………………………………………….....9 9 Statistical analysis……………………………………………………………………….....10 10  11 Results…………………………………………………………………………….11 3.1  Identification of duplicated genes in Gossypium species…………………………………11 11  3.2  Duplicate gene expression in response to cold and water submersion stresses in 12 G. hirsutum……………………………………………………………………………….12  3.3  Duplicate gene expression in response to heat, salt and drought stresses in  15 G. hirsutum……………………………………………………………………………….15  3.4 Comparisons of duplicate gene expression in response to five abiotic stresses…………..17 17 3.5  Duplicate gene expression in response to abiotic stresses in a synthetic 19 Gossypium allotetraploid…………………………………………………………………24  4  Discussion………………………………………………………………………….22 4.1  Abiotic stress induced changes in homeologous gene expression and stress-specific quantitative subfunctionalization………………………………………………………….  4.2  22  Effects of abiotic stress on gene expression in synthetic vs. natural allopolyploids………. 26 iii      4.3  Possible mechanisms of stress-induced expression changes in homeologous genes  4.4  Interspecific hybridization and its affects on allelic expression………………………….. 28 Conclusions…………………………………………………………………………………..31  Bibliography……………………………………………………………………………. 42  iv     LIST OF TABLES  Table 1  List of Gossypium genes surveyed for homeologousgene expression……………….  Table 2  Primers used for gene amplification and urea concentration for SSCP……………...  Table 3  At/Dt expression ratio changes in G. hisutum………………………………………..  33 34 35  v     LIST OF FIGURES Figure 1 Phylogenetic trees and homeologous gene alignments………………………………… Figure 2 Examples of SSCP gel pictures…………………………………………………………. Figure 3 Ratios of At/Dt expression vary under cold stress and water-submersion stress in G. hirsutum…………………………………………………………………………….. Figure 4 Ratios of At/Dt expression vary under heat stress, salt stress and drought stress in G. hirsutum…………………………………………………………………………… Figure 5 Ratios of At/Dt expression vary under salt stress, cold stress and heat stress in synthetic Gossypium allopolyploid………………………………………………………  36 38 39 40  41  vi     ACKNOWLEDGEMENTS I would like to express my sincere appreciation to Dr. Keith Adams, for his guidance, and for giving me the opportunity to work with him. I would also like to thank my supervisory and examining committee members, Dr. Quentin Cronk, Dr. Naomi Fast, Dr. Sean Graham, and Dr. Jeannette Whitton for their suggestions.  Great thanks to Dr. Zhenlan Liu, who provided cold stress and water-submersion stress treated G. hirsutum RNAs, and Allen Liu, who helped me a lot in my statistical analyses. I also want to thank the fellow graduate students: Greg Baute, Graeme Bell, Noushin Moshgabadi, James Robertson, Peter Zhang and Renchao Zhou. I enjoyed the interactions with them, both academically and personally. Finally, thanks to my dear fiancée Yazheng Liu and my family, who offered me love and the strongest inspirations all the way long.  vii     Introduction  Polyploids are produced by the duplication of a single genome (autopolyploid) or by the combination of two genomes from different organisms (allopolyploid) in a common nucleus (Chen and Ni, 2006), and in natural populations, estimates indicated that allopolyploidy was more prevalent than autopolyploidy (Levin, 2002). Studies showed that over 70% of angiosperms have at least one event of genome doubling during their evolutionary history and many diploid species are in fact ancient polyploids (Levin, 2002; Simillion et al., 2002; Blanc et al., 2004; reviewed in Hegarty et al., 2008). Many important agricultural crops are polyploid plants, such as wheat, canola, soybean, potatoes, sugarcane, and cotton (Wendel, 2000). Polyploidy can contribute to the rapid emergence of new species because different chromosome numbers could cause reproductive isolation between the polyploids and their parents (Tate et al., 2005). The increased heterozygosity in allopolyploids could help them occupy broader niches and colonize areas where the diploids are not found (Stebbins, 1950; Stebbins, 1985). Polyploidy can result in novel phenotypes, such as changes in flowering time (Schranz and Osborn, 2000).  Polyploidy can result in extensive genetic and epigenetic changes, which have been shown in resynthesized polyploids (e.g., Liu et al., 1998; Shaked et al., 2001; Kashkush et al., 2002).  Studies in resynthesized allopolyploid Brassica species and 1      wheat showed that there were loss and gain of many DNA restriction fragments, both in the coding and noncoding regions, in the generations immediately following polyploid formation (Feldman et al., 1997; Liu et al., 1998; Ozkan et al., 2001; Shaked et al., 2001; Kashkush et al., 2002), likely caused by rearrangements (Gaeta et al., 2008).  Previous studies also revealed frequent epigenetic changes, including  DNA methylation, histone modification and chromatin packaging in newly synthesized allopolyploids of Arabidopsis, Brassica, and wheat (Song et al., 1995; Liu et al., 1998; Shaked et al., 2001; Kashkush et al., 2002; Madlung et al., 2002).  Besides genetic and epigenetic changes, polyploidy can result in changes to duplicate gene expression. Studies of duplicate gene expression in allopolyploids and their progenitors have shown biased expression patterns and silencing of duplicate genes in newly created synthetic Brassica napus, wheat, Arabidopsis suecica, and Senecio cambrensis (Comai et al., 2000; Kashkush et al., 2002; Wang et al., 2004; Hegarty et al., 2005; Albertin et al., 2006) as well as in natural polyploids (Lee and Chen, 2001; Bottley et al., 2006). The fates of homeologs (genes duplicated by polyploidy), after polyploidization usually falls into one of four categories: non-functionalization, where one homeolog is silenced or completely lost; neofunctionalization, where one homeolog gains a new function; subfunctionalization, where the expression or function is partitioned between the homeologs so that both copies are needed by the organisms, or retention of both copies for dosage or other reasons (Ohno., 1970; Force et al., 1999; Lynch and Force, 2000). 2     Cotton (Gossypium) is a useful group for studying polyploidy. There are approximately 40 diploid and 5 natural polyploid Gossypium species recognized (Percival et al., 1999; Wendel et al., 1999; Liu et al., 2001). All five polyploids are allotetraploids (AADD; 2n=4x=52) which originated by hybridization between an A genome diploid (genome AA; 2n=26) and a D genome diploid (genome DD; 2n=26) about 1.5 million years ago (Senchina et al., 2003; Brubaker and Wendel., 1994; Bourland and Wendel., 1999). Homeologous genes in polyploid cotton are designated At and Dt for the genes derived from the A-genome diploid progenitor and the D-genome progenitor, respectively. Homeologous gene expression changes have been found in polyploid Gossypium hirsutum (Adams et al., 2003; Liu and Adams, 2007; Hovav et al., 2008; Flagel et al., 2008; Chaudhary et al., 2009).  For example  Adams et al. (2003) showed there was organ-specific silencing of AdhA (alcohol dehydrogenase gene A) homeologs in Gossypium hirsutum, and Hovav et al. (2008) used homeolog-specific microarrays to demonstrate that around 30% of homeologs showed biased expressed in natural allopolyploid cotton. Also in new synthetic allopolyploid cotton, biased expression and silencing of the homeologous genes were found (Adams et al., 2004; Chaudhary et al., 2009).  There can be changes in homeologous gene expression patterns in polyploid plants in response to abiotic stresses. Liu and Adams (2007) found that in Gossypium hirsutum under water-submersion treatment, At copy (derived from the A genome parent) of the 3     AdhA gene was silenced in hypocotyls and roots, and under cold-stress treatment the Dt copy (derived from the D genome parent) was silenced in hypocotyls, which together showed reciprocal silencing of the AdhA homeologs and indicated subfunctionalization. This was the first and only study so far of homeologous gene expression in response to abiotic stresses. Thus, the extent of homeologous gene expression changes in response to abiotic stresses remains nearly unknown.  In this study I investigated the expression of pairs of homeologs in response to abiotic stresses in natural allotetraploid Gossypium hirsutum and a newly synthesized allotetraploid, designated 2(A2D3). I designed a series of experiments to determine: (1) whether changes in the expression levels of homeologs, relative to each other, under abiotic stresses is a common phenomenon in Gossypium hirsutum; (2) what kinds of stress-specific and organ-specific patterns are observed; (3) whether changes in the expression levels of homeologs under abiotic stresses can occur in a newly synthesized allotetraploid.  4     2 MATERIALS AND METHODS  2.1  Gene choices, sequence alignments, phylogenetic analyses, and primer  design The stress regulated genes in cotton were retrieved from Zhao et al. (2003) and Qin et al. (2004), Wang et al. (2007), Ni et al. (2008) and Guo et al. (2009) and the stress regulated genes in Arabidopsis thaliana were retrieved from Swindell (2006) and Kilian et al. (2007) through NCBI. BLAST searches of NCBI were used to identify cotton homologs of the stress-regulated genes in Arabidopsis.  Sequences were  aligned in ClustalX and analyzed with parsimony analysis using PAUP 4.0 with default settings. From the phylogenetic trees the At and Dt homeologs were identified or inferred when possible, and other paralogs were also identified. Primers were designed to amplify about 200 bp products that contain several SNPs (single nucleotide polymorphisms) which can be used to distinguish homeologs with SSCP (Single Strand Conformation Polymorphism). There were no introns in the amplified regions so that amplification from genomic DNA could be used as a control for band locations on the gels.  5     2.2  Plant materials and stress treatments  Gossypium hirsutum cultivar TM1 (Texas Marker-1), and a synthetic allopolyploid created by doubling the chromosomes of a G. arboreum × G. davidsonii F1 hybrid (studied in Adams et al., 2004) were used for expression experiments. For Gossypium hirsutum cultivar TM1, the stress treatments were separated into two sets. The first set included water-submersion stress, cold stress and control plants as grown in Liu and Adams (2007), and the second set included heat stress, salt stress, drought stress and control plants. For each stress treatment and control, there were three replicates, and for each replicate, there were six plants. The seedlings were grown in a peat-vermiculite soil mixture under fixed day/night (16 hour day/ 8 hour night) and temperatures of 24℃. For water-submersion stress, the seedlings were completely submerged under distilled water for 2 days to simulate flooding; for cold-stress treatment, the seedlings were put in a cold room (4℃) for 2 days; both stress treatments were done in Liu and Adams (2007). For heat-stress treatment the seedlings were put in a growth chamber at 43℃ for 2 days, which is an intermediate temperature between 41℃ (Law et al., 2001) and 45℃(Fender and O’Connell, 1989); for drought-stress treatment, the seedlings were removed from the pots and placed on a dry filter paper for 2 days, as done in Jin and Liu (2007); for salt-stress treatment, the roots of the seedlings were submerged in an aqueous soil-extract solution with 400 mM NaCl for 2 days, as performed in Jin and Liu (2007). All the above stresses were performed from 6 to 8 days post-planting (dpp). For the stress treatments, all the other conditions of plant growth conditions were the same as the controls. After the stress 6     treatments, the abnormal seedlings (compared with the other seedlings in the replicate) were discarded; this was never more than 2 out of 6 seedlings per replicate. For the synthetic Gossypium allopolyploids, plant growth, cold stress, heat stress and salt stress were performed from 6 to 8 days post-planting (dpp) as above.  2.3  Nucleic acid extraction, reverse transcription and polymerase chain  reaction Genomic DNA was extracted with the QIAGEN DNeasy Plant Mini Kit according to the manufacturer’s instructions, and RNA was extracted from tissues with a hot borate method (Adams et al., 2003). DNA and RNA concentrations and purities were measured with a NanoDrop spectrophotometer.  RNA quality was checked on an  agarose gel to identify strong ribosomal RNA bands.  RNAs were treated with DNaseI to remove genomic DNA before reverse transcription, and single-stranded cDNA was synthesized by M-MLV reverse transcriptase (Invitrogen) according to the manufacturer’s protocol. Negative controls were made with DEPC-treated water instead of reverse transcriptase to check for any remaining genomic DNA.  PCR conditions were optimized with genomic DNA for each primer. PCR reactions were performed in a reaction mixture (10 µl) containing 1µl of template (genomic DNA or cDNA), 1 µl of 10X PCR buffer, 0.1 µl of 2.5 mM dNTPs, 0.5 µl of each 0.4 7     uM forward and reverse primer, 0.1 µl of Paq polymerase (Stratagene) and 6.8 µl of ddH2O. 35 cycles of PCR were carried out, and the conditions for each cycle were as follows: 30 seconds at 94℃, 30 seconds at the optimized annealing temperature, 1 minute at 72℃. PCR products were run on 2% agarose gels (0.5×TBE buffer) for band separation and stained with ethidium bromide for visualization.  2.4  SSCP (Single Strand Conformation Polymorphism)  After PCR amplification, QIAGEN quick spin columns were used for cleaning PCR products to remove primers, and around 2-4 ng of clean, double-stranded PCR product was used for SSCP labeling reactions.  The labeling reactions were  performed in a reaction mixture (10 µl) containing 4 ng of double-stranded PCR product (diluted to 6 µl with water), 0.5 µl (10 uM stock) primer, 1.0 µl 10 X PCR buffer, 0.8 µl (2.5mM) dNTPs, 0.5 µl (50mM) MgCl2, 1.04 µl dH2O, 0.08 µl Taq polymerase and 0.08 µl (32P) dCTP, 3000 Ci/mmol stock. The labeling conditions were as follows: 2 minutes at 94℃; 25 cycles of 30 sec at 94℃, 30 sec at 54-57℃ (depending on predicted primer Tm), 1 min at 72℃; a final extension for 5 minutes at 72℃  After labeling, the samples were denatured by mixing 2 ul of PCR product with 8 µl of denaturation solution (0.05% bromophenol blue, 0.05% xylene cyanol, 95% formamide, 20 mM EDTA), heated to 95℃ for 5 minutes, then snap cooled on ice until loaded on the gel. Up to 4 µl of each sample was loaded into polyacrymide gels 8     (25% MDE® gel solution, from Lonza, 0.1 X TBE, 0.033% g/v ammonium persulfate and 0.05% v/v TEMED). Electrophoresis was performed in 0.5 X TBE at 8W for approximately 20 hours at room temperature. Following electrophoresis, the gels were dried and placed on phosphorimaging screens for 2 days and then the images were visualized on a Bio-Rad phosporimager. Band intensities of homeologs were measured using Quantity One software (Bio-Rad) with background corrections.  2.5  DNA sequencing to identify homeologs  After PCR amplification, the products were purified by QIAGEN columns, and then loaded into the SSCP gel without isotope labeling. After the electrophoresis was finished, the gel was fixed in 10% acetic acid for 30 min, washed with distilled water three times, and then incubated in silver staining solution (0.1% silver nitrate and 0.15% formaldehyde) for 30 min, briefly washed with distilled water, and incubated in pre-cooled developing solution (3% Na2CO3, 0.15% formaldehyde, 0.024% Na2SO3). When clear bands were seen, the developing solution was poured out and 10% acetic acid was added to stop development.  For DNA sequencing, a single silver-stained band was directly excised from the gel and was vigorously rinsed with 500 µl extractant (2.5% sodium thiosulfate, 1% potassium hexacyanoferrate) for 5 min to remove the silver from gel. The rinsing process was repeated five times until the gel became transparent. After another rinse with distilled water, the DNA was extracted from the gel with 30 µl of distilled water 9     at 80℃ for 15 min. The DNA was re-amplified with a 20 cycle PCR and subjected to Sanger sequencing on an ABI 3730 with ABI Big Dye Version 3.1 (Applied Biosystems) at the Nucleic Acid Protein Service Unit at the University of British Columbia.  2.6  Statistical analysis  SSCP data from three replicates, or in a few cases two replicates, were analyzed for each stress treatment and organ type. T tests, one-way ANOVA, and two-way ANOVA tests, performed with R software, were used for determining significant differences in expression ratios (the percentage of transcripts derived form the At homeolog vs the Dt homoelog) between normal plants and abiotic stress treated plants. The stress-specific significant changes were determined by t-tests, and organ-specific significant differences were determined by one-way ANOVA and two-way ANOVA tests. 5% false discovery rate (FDR) was used to correct the multiple testing results.  10     3  RESULTS  3.1 Identification of duplicated genes in Gossypium species I assayed homeologous gene expression in response to abiotic stress conditions using a total of 30 gene pairs. Genes and their functions or putative functions are listed in Table 1.  I used 12 genes from polyploid Gossypium species (G. hirsutum and G.  barbadense) that had previously been shown to be up- or down-regulated by one or more abiotic stresses (Zhao et al., 2003; Qin et al., 2004; Wang et al., 2007; Ni et al., 2008; Guo et al., 2009). Also I used cotton homologs of 18 genes known to be upor down-regulated in Arabidopsis thaliana in response to abiotic stresses, obtained from microarray studies (William, 2006; Kilian et al., 2007).  The cotton homologs  were identified by using tblastx searches of expressed sequence tags (ESTs) from GenBank with the gene from Arabidopsis as a query. I attempted to find homologs from polyploid G. hirsutum, the A-genome diploid G. arboretum which is similar to the A-genome progenitor, and the D-genome diploid G. raimondii which is similar to the D-genome progenitor.  Paralogs and homeologs of each gene within Gossypium were identified by constructing phylogenetic trees from sequence alignments.  Paralogs were identified  by separate and distinct clades in the trees. Homeologs, designated At for the one  11     derived from the A-genome parent and Dt for the one derived from the D-genome parent, were identified by finding G. hirsutum sequences that branch with sequences from the diploids G. raimondii and G. arboreum, indicating Dt and At homeologs, respectively. In some cases a sequence from one of the diploids, more often G. arboreum, was not available due to the lower number of available ESTs, and the corresponding homeolog from G. hirsutum was inferred by the phylogenetic tree structure.  Two examples of the phylogenetic trees are shown in Figure 1. In Figure 1A, AV823701 is a drought, cold and salt stress responsive gene from Arabidopsis thaliana, which was defined as an outgroup together with sequences from Brassica napus and Populus trichocarpa. The topology of the phylogenetic tree suggests the relationship between the sequences from the A-genome diploid and its counterpart A-subgenome (At) of the allotetraploid as well as the relationship between sequences from the D-genome diploid and its counterpart D-subgenome (Dt) from the allotetraploid.  The sequence alignment in Figure 1C showed a high similarity  between the At and Dt homeologs except for several SNPs (single nucleotide polymorphisms), which were used for SSCP (next section). In Figure 1B, AY572463 is a salt-stress related gene from Gossypium hirsutum and a paralog was used in my study.  The homeologous relationships among the cotton sequences were inferred by  the placement of the G. hirsutum sequences compared with the sequences from the diploids. 12     3.2 Duplicate gene expression in response to cold and water submersion stresses in G. hirsutum To study the expression of 30 homeologous gene pairs, the single stranded confirmation polymorphism (SSCP) method was used (Cronn and Adams, 2003). SSCP can separate duplicated genes with very similar sequences and the technique has been used previously for assaying homeologous gene expression (e.g., Adams et al., 2003; Pumphrey et al., 2009). PCR primers were designed to co-amplify the two homeologs from G. hirsutum, a region of the genes with SNPs between the two homeologs (Figure 1; Table 2). RT-PCR was conducted for each gene pair and the products were separated by SSCP. For each gene, the SSCP gel conditions were optimized by adjusting the running time and urea concentration (Table 2) so that two bands were visible for each gene, one for each homeolog, when a single labeling primer was used (or four bands, corresponding to both strands if two labeling primers were used). Figure 2 shows examples of SSCP gels. The two bands were quantified with a PhosphorImager and sequenced to determine which was the At copy vs. the Dt copy  The stress treatments of G. hirsutum seedlings were divided into two sets. The first set included assaying homeologous gene expression patterns in response to cold stress and water submersion stress as a follow-up to Liu and Adams (2007), with more genes, using RNAs from that study. Among the 30 homoeologus gene pairs that were 13     examined by SSCP separation and PhosphorImager quantification, 15 gene pairs showed significant changes in the At/Dt expression ratio in response to stress treatments in at least one organ, among which 10 genes showed changes in At/Dt expression in at least one organ under cold stress treatment and 10 gene pairs showed changes in At/Dt expression in at least one organ after the water-submersion stress treatment. This indicates that the changes in expression patterns of homeologous genes varied under different stress treatments. Five genes showed significant responses to both cold and water submersion stresses. Among the three different organ types examined, 11 genes showed changes in the At/Dt expression ratio in hypocotyls under at least one stress treatment, seven genes in cotyledons, and seven genes in roots. Three genes showed changes in all three organs, four genes showed changes in two organs and eight genes showed changes in one organ under at least one stress treatment.  Among the 12 homeologous genes that showed changes in the At/Dt expression ratio in response to cold and water submersion stresses in at least one organ, 5 genes showed large changes, where the difference between stress and control is more than 20% (for example, 60:40 vs. 80:20) after abiotic stress treatments (Figure 3). Among the largest changes, gene 7 (an aminomethyltransferase) showed a great increase in the At/Dt expression ratio in hypocotyls under cold stress treatment and the Dt copy was almost silenced (At/Dt ratio 90:10) compared with equal expression of both copies under normal conditions. The other gene with the largest change was 14     gene 9 (coenzyme binding function) that showed a dramatic decrease in the At/Dt expression ratio in hypocotyls under cold stress treatment because the expression of At copy was strongly depressed (At/Dt ratio 15:85) compared with preferential expression of the At copy under normal conditions (At/Dt ratio 65:35).  Another  example of a gene with a large change in expression in response to the stresses was gene 14 (a MAP kinase) that showed a considerable decrease in the At/Dt ratio in cotyledons under water-submersion stress treatment from preferential expression of the At copy (At/Dt ratio 74:26) under normal conditions to almost equal expression of both copies under water submersion stress. Two genes showed reciprocal changes in the At/Dt expression ratio; that is, an increase under one stress and a decrease under the other stress.  Gene 11 (a peptide methionine sulfoxide reductase) showed  reciprocal changes in the At/Dt expression ratios in response to cold and water submersion stresses: there was an increase in the At/Dt ratio after cold treatment in hypocotyls (83:17, from 65:35 under normal conditions) and a decrease in the At/Dt ratios after water submersion treatment in hypocotyls (to almost 50:50).  Also, gene  20 (a late embryogenesis-abundant protein) also showed reciprocal changes in the At/Dt expression ratio in response to these two stresses, where in cotyledons the expression ratio greatly increased (80:20) after cold stress compared to normal conditions (53:47) but decreased after water-submersion stress (40:60).  15     3.3 Duplicate gene expression in response to heat, salt and drought stresses in G. hirsutum After having documented many genes with changes in the At/Dt expression ratio in response to cold and water submersion stresses, we decided to examine three other abiotic stresses. The second set of stresses included three abiotic stress treatments: heat, salt and drought stress.  The expression patterns of 30 homeologous genes were  examined in three organ types of G. hirsutum seedlings (Figure 4). Twenty genes showed changes in the At/Dt expression ratio in at least one organ after one of the abiotic stress treatments. Among the 20 homeologous genes, 14 gene pair showed changes in at least one organ under the heat stress treatment, 15 genes showed changes under the salt stress treatment, and 10 genes showed changes under the drought stress treatment. Also the expression patterns of the homeologous genes in response to heat, salt and drought stresses were compared in different organ types. Eleven gene pairs showed changes in the At/Dt expression ratio in hypocotyls under at least one stress treatment, 14 gene pairs in cotyledons, and 10 gene pairs in roots.  Of the 19 homeologous genes that showed significant changes in the At/Dt expression ratio in response to abiotic stresses, 10 genes showed large (over 20 percent; e.g, 60:40 to 80:20) changes after abiotic stress treatments. Among them, two genes showed dramatic increases (genes 10 and 20). Gene 10 (a phenylcoumaran benzylic ether reductase-like protein) showed large increases in the At/Dt ratio under different stresses. In hypocotyls and cotyledons, under heat stress treatment, expression was 16     greatly biased towards the At copy (At/Dt ratio 82:18) compared with strongly biased Dt expression (At/Dt ratio 20:80) under normal conditions. In roots, under drought stress treatment, there was also a very large increase (At/Dt ratio 85:15) compared with normal conditions (At/Dt ratio 18:82).  Gene 20 (a late embryogenesis abundant  protein) showed large increases in the At/Dt ratio from biased expression of the Dt copy (At/Dt ratio 30:70) to preferential expression of the At copy (At/Dt ratio 62:38) in all three organs after heat stress treatment.  Three genes showed reciprocal  expression changes in response to stress treatments. Gene 19 (a zinc finger family protein) showed reciprocal expression ratio changes in cotyledons in response to heat stress and salt stress treatments: there was an increase in the At/Dt ratio after heat stress treatment (70:30, from 40:60 under normal conditions) and a decrease after salt stress treatment (At/Dt ratio 17:83). Gene 15 (MAP kinase 6) also showed reciprocal expression ratio changes in cotyledons: there was an increase after heat stress treatment (75:25, from 45:55 under normal conditions), and decreases after salt stress treatment (At/Dt ratio 37:63) and drought stress treatment (At/Dt ratio 32:68). Finally gene 14 (a MAP kinase) showed reciprocal changes under salt stress among different organs: there was an increase in cotyledons (At/Dt ratio 35:65 from 10:90 under normal conditions) and a decrease in roots (At/Dt ratio 15:85 from 31:69 under normal conditions).  17     3.4 Comparisons of duplicate gene expression in response to five abiotic stresses Overall, among the 30 homeologous genes examined after abiotic stress treatments, 22 genes showed significant changes in the At/Dt expression ratio after abiotic stress treatments in at least one organ type compared with the untreated control plants. Cold, water-submersion, heat, salt and drought stresses induced 10, 10, 14, 15, and 10 homeologous gene expression ratio changes, respectively, in at least one organ, which indicates that heat and salt stresses had the largest effect on duplicate gene expression levels. Among the three different organ types examined, 17 genes showed changes in At/Dt expression ratio after at least one stress treatment in hypocotyls, compared with 16 genes in cotyledons and 13 genes in roots.  Among the five abiotic stress treatments there was variation in the number of genes that showed organ-specific changes: 4 homeologous gene pairs (genes 6, 9, 11, and 19) after cold stress, 6 homeologous genes (genes 6, 11, 12, 16, 18, and 19) after water-submersion stress, 3 homeologous genes (gene 8, 10, and 15) after heat stress, 2 homeologous genes (genes 6 and 20) after salt stress, and 4 homeologous genes (genes 9, 10, 17, and 26) after drought stress. Overall, 7% (under salt stress treatment, 2 out of 30 genes) to 20% (under water-submersion stress treatment, 6 out of 30 genes) of the homeologous genes were influenced in an organ-specific manner under abiotic stress treatments, and 7% (2 in 30 genes) showed organ-specific, reciprocal, homeologous expression changes (organ-specific quantitative subfunctionalization) 18     under abiotic stress treatments. These results indicate that abiotic stress-induced, organ-specific, expression changes and quantitative subfunctionalization may be a common phenomenon in polyploid G. hirsutum.  Further analyses of the expression pattern changes of the 30 homeologous genes are shown in Table 3. Seven genes showed reciprocal At/Dt ratio changes in one organ after different abiotic stress (stress specific) treatments (“+” and “-” in same row: genes 4, 10, 11, 14, 15, 19 and 20), and 3 genes showed reciprocal At/Dt ratio changes among different organs (organ-specific) after one stress treatment (“+” and “-” in same column: gene 3 under water-submersion stress, gene 11 under cold stress and water-submersion stress, and gene 14 under salt stress). Two genes showed both the stress-specific and organ-specific reciprocal At/Dt ratio changes (genes 11 and 14).  All comparisons of results from the abiotic stress treatments above were made between the stressed and the untreated control plants from within a set.  The absolute  At/Dt ratios between sets could not be compared because the plants in the two sets were grown at the different times. Thus, all of the comparisons of the five stress treatments were relative comparisons based on comparing the stress treatment with the corresponding control grown under normal conditions, not the stress treatments compared directly to each other.  There were a few genes that showed differences in  homeologous gene expression under untreated normal conditions between the two sets. The inconsistency might be explained by differences in the developmental stages of 19     the plants upon tissue harvesting between the two sets, perhaps caused by differences in seed germination rates. Homeologous gene expression can vary during organ development, as shown in Liu and Adams (2007).  3.5 Duplicate gene expression in response to abiotic stresses in a synthetic Gossypium allotetraploid Synthetic allopolypoids are useful for examining genetic changes that take place immediately upon and within a few generations after allopolyploidy. The expression patterns of 10 homeologous genes that showed significant changes after one or more abiotic stress treatment in natural allopolyploid G. hirsutum were examined in a synthetic allopolyploid, designated 2 (A2D3), under salt, cold and heat stress treatments (Figure 5).  Eight genes showed changes in the At/Dt expression ratio in  at least one organ after one or more abiotic stress treatments. Among the 8 genes, 7 genes showed expression changes under salt stress treatment in at least one organ, while 3 genes were affected by cold stress treatment, and 2 by heat stress treatment. In hypocotyls, 6 genes showed changes in response to at least one abiotic stress treatment, in cotyledons it was 5 genes, but in root no genes showed changes in At/Dt expression ratios, surprisingly.  Among the 8 homeologous genes that had At/Dt ratio changes, only 2 of them showed large changes (20% or greater; for example, 60:40 to 80:20) in response to stress. Gene 8 (GDSL-motif lipase) showed a considerable decrease in the At/Dt ratio in 20     hypocotyls after heat stress treatment (At/Dt ratio 27:73) compared with the normal conditions (At/Dt ratio 55:45) in the synthetic allopolyploid, whereas in natural allopolyploid G. hirsutum, there were dramatic decreases in At/Dt ratio that happened in cotyledons under both heat (At/Dt ratio 38:62) and salt (At/Dt ratio 40:60) stresses compared with normal conditions (At/Dt ratio 62:38). Gene 20 (late embryogenesis-abundant protein) showed large increases under salt stress treatment in hypocotyls (At/Dt ratio 74:26) and cotyledons (At/Dt ratio 68:32) compared with normal conditions (At/Dt ratio 48:52), which was similar to the expression pattern changes in natural allopolyploid G. hirsutum under heat stress treatment, but the dramatic changes in response to cold and heat stress treatments seen in natural G. hirsutum were not found in the synthetic allopolyploid.  Comparison of the expression patterns of the 10 homeologous genes between the natural and synthetic Gossypium allopolyploids showed that only 2 genes with parallel expression changes under certain stress treatments in certain organs: gene 12 showed a decrease in the At/Dt ratio under salt stress in cotyledons, both in natural and synthetic Gossypium, but changes in other organs and stress treatments were not in parallel; and gene 20 showed increases in the At/Dt ratio under salt stress in hypocotyls and cotyledons in both natural and synthetic Gossypium, but changes in other organs and stress treatments were in parallel. All the other genes showed different expression patterns between natural and synthetic Gossypium allopolyploids.  21     Another interesting finding is the large differences in the At/Dt ratios in all organs under all stresses between the synthetic and natural allopolyploids for gene 4 and gene 12. Gene 4 (ATP synthase Delta Chain) showed great down-regulation or even silencing of the At copy in all the organs under all the stresses in the synthetic allopolyploid compared with the almost equal expression of both copies in natural G. hirsutum. Gene 12 (ethylene responsive element binding protein) also showed considerable down-regulation of the At copy (although not as dramatic as gene 4) in the synthetic allopolyploid compared with the almost equal expression of both copies in natural G. hirsutum.  22     4  Discussion  4.1 Abiotic stress induced changes in homeologous gene expression and stress-specific quantitative subfunctionalization  In my project, five abiotic stresses were performed for the natural allopolyploid G. hirsutum, and the At/Dt expression ratio was compared with untreated control plants grown under normal conditions. Overall, in the 30 homeologous gene pairs examined by SSCP, 22 gene pairs (73%) showed At/Dt expression ratio changes under at least one stress treatment in at least one organ compared with the controls. Given the fact that all of the genes used in my study are abiotic stress-regulated or homologs of genes regulated by at least one abiotic stress, 73% might not be generally applicable when applied to the whole allopolyploid G. hirsutum transcriptome, but still we can get the sense that abiotic stress-induced duplicate gene expression changes are likely to be a major phenomenon in natural allopolyploid cotton. Among the 22 gene pairs that showed expression changes under abiotic stresses, 12 gene pairs had large changes, defined as an expression ratio difference of more than 20% (e.g., 60:40 to 80:20) compared with the control. Seven of those homeologous gene pairs had reciprocal expression changes where the At/Dt expression ratio was considerably up-regulated under one stress treatment and down-regulated under another stress treatment in the same organ compared with the control. An increase in the level of 23     expression of one duplicate gene relative to the other has been described as quantitative subfunctionalization (Force et al., 1999; Duarte et al., 2006). Quantitative subfunctionalization differs from qualitative subfunctionalization, where expression or function of duplicated genes is completely partitioned between the duplicates (Force et al., 1999; Hahn, 2009).  The abiotic stress treatments used in my study had effects on homeologous gene expression that varied by organ type. I found that 13 out of 30 homeologous gene pairs examined had organ-specific responses to the stress treatments. Among the 13 genes, 2 genes (gene 11 and gene 14) showed reciprocal changes in the At/Dt ratio among different organs under the same stress treatment, that is, in one organ there was an increase in the At/Dt ratio and there was a decrease in another organ after the same abiotic stress treatment, which indicates organ-specific quantitative subfunctionalization. Overall there were a total of 8 genes that showed quantitative subfunctionalization (3 organ-specific and 7 stress-specific, with two genes showing both).  In the only previous study of the effects of abiotic stress treatments on homeologous gene expression in a polyploid plant, qualitative subfunctionalization in response to stress conditions was discovered (Liu and Adams, 2007). In that study, one homeolog of the alcohol dehydrogenase gene AdhA was expressed in hypocotyls under water-submersion treatment and only the other copy was expressed in 24     hypocotyls under cold stress treatment (Liu and Adams, 2007). In my study I found many cases of stress-specific quantitative subfunctionalization, but no cases of qualitative subfunctionalization. These results suggest that stress induced quantitative subfunctionalization could be a prevalent phenomenon while stress-specific qualitative subfunctionalization could be relatively rare and may appear only for a small percentage of genes under certain organ and stress combinations. My findings of altered homeologous gene expression and quantitative subfunctionalization in response to abiotic stress treatments demonstrate that abiotic stresses can have a major influence on the expression of duplicated genes, which may help lead to the preservation of duplicated genes over evolutionary time.  In addition to the changes in homeologous gene expression in response to abiotic stress treatments, that were in some cases organ-specific, I also found evidence for organ-specific variation in the expression of the two homeologs in G. hirsutum under normal conditions. These results are consistent with previous studies of polyploid cotton and other polyploids (e.g., Adams et al., 2003; Adams et al., 2004; Hovav et al., 2007; Chaudhary et al., 2009). Cases of qualitative subfunctionalization were rare in the previous studies. Adams et al. (2003) showed two cases of organ-specific qualitative subfunctionalization out of 40 genes examined, and Hovav et al. (2007) showed 4 cases of developmental stage-specific subfunctionalization in 1484 genes in a microarray study. These results indicate that qualitative subfunctionalization probably is not a prevalent phenomenon in G. hirsutum. 25     The homeologous gene expression changes in response to abiotic stresses in G.hirsutum could have evolved after the polyploidy event that happened about 1.5 million years ago. It has been proposed that gene duplication can create a redundant locus and more mutations that were “forbidden” in the previous singletons are now allowed in polyploids because of relaxed selective constraints (Ohno, 1970; Lynch and Katju, 2004). In natural allopolyploid G. hirsutum, during the time since the polyploidy event genes could accumulate mutations in regulatory elements which could provide selective advantages in response to changing environments.  Those  mutations that were helpful in accommodating the organisms to the new and changing environmental stress conditions could be possibly fixed.  That could be one  explanation for the significant changes in the At/Dt ratios of some genes in response to abiotic stress treatments in the natural Gossypium polyploids.  4.2 Effects of abiotic stress on gene expression in synthetic vs. natural allopolyploids  In my experiments stress-induced homeologous gene expression changes were also found in the new synthetic Gossypium polyploids, where 8 of 10 genes examined showed changes in expression patterns in response to one or more abiotic stress treatments. Among the 10 genes examined, only 2 of them had similar expression pattern changes under certain stress treatments in certain organs between the two 26     genotypes, while the other 8 genes showed different expression pattern changes in response to stress treatments. The plants were grown under the same controlled environmental conditions and the stress treatments were done using the same conditions; thus, experimental variability is unlikely to account for the differences. Overall, there does not appear to be much correspondence between the stress-induced changes in homeologous gene expression in the synthetic and natural allopolyploids. This finding suggests that the phenomenon is not caused by merger of the A and D genomes in allopolyploid cotton per se. Instead it is likely that that the process is largely random in terms of which genes are affected. It is possible that the allopolyploidization process could have played a role in the homeologous gene expression changes in response to abiotic stress treatments in the synthetic polyploid. Previous studies have shown that gene silencing and biased expression can occur following the allopolyploidization in new synthetic Gossypium polyploids (Adams et al., 2004; Chaudhary et al., 2009). Also gene expression changes were also found in synthetic allotetraploid Arabidopsis and wheat (Madlung et al., 2002; Kashkush et al., 2002). These observations suggest that the immediate genetic or epigenetic changes caused by allopolyploidization might play a role in the stress-induced homeologous gene expression changes found in the synthetic allopolyploid.  My study did not determine if the stress-responsiveness of the eight homeolog pairs occurred after polyploid formation or it was present in the diploids from which the synthetic polyploid was derived. It could be interesting in the future to study gene 27     expression patterns under abiotic stress treatments in diploid parents compared with the interspecific diploid hybrids, and make comparisons among the diploids, diploid hybrids and the synthetic polyploids; such experiments could provide more information on the specific roles that genome merger and duplication played in stress-induced expression pattern changes.  4.3 Possible mechanisms of stress-induced expression changes in homeologous genes  Although the mechanisms for organ-specific and stress-induced expression alteration in natural and new synthetic allopolyploid cotton are not well understood, there could be many mechanisms responsible for these phenomena, such as cis-regulatory variation,  regulatory network changes, genomic changes, and epigenetic changes  (Birchler et al., 2003; Comai et al., 2000, Osborn et al., 2003; Riddle and Birchler, 2003). Below I discuss each of these possible factors in turn.  Cis-regulatory elements are major constituents effecting gene expression and they are predominantly located within the 5’ upstream region of genes. Several studies have shown a positive correlation between cis-element variation and duplicate gene expression divergence. Haberer et al. (2004) showed that in Arabidopsis thaliana there was a continuous divergence within the regulatory regions after duplication, and Evangelisti and Wagner (2004) found both loss and gain of transcription factor 28     binding sites in yeast after gene duplication. The changes in the cis-regulatory elements played a significant role in duplicate gene divergence and could be an explanation for the expression differences between duplicate genes. That possibility was further supported by microarray studies in Gossypium that demonstrated that variation in gene expression following genome merger was the likely the result of cis-regulatory element changes (Flagel et al., 2008; Chaudhary et al., 2009). The relationship between cis-element changes and stress responsive duplicate genes has been investigated in Arabidopsis thaliana, Walter et al. (2007) found the density of cis-elements increased with the differential gene expression diversity in response to stresses, and Zou et al. (2009) showed that differences in cis-elements between duplicate genes played a role in expression variation in response to stresses. These observations from other studies collectively indicate that cis-regulatory elements may contribute to homeologous gene expression changes in response to abiotic stress treatments in the Gossypium polyploids examined in my study.  The expression of most genes depends on networks of regulators, such as transcription factors (Birchler et al., 2001; Osborn et al., 2003). In diploids, the regulation network is complex, but it is even more complex in the allopolyploids. For example in an allotetraploid, all of the regulators derived from the two diploids can interact to affect gene expression. The functioning of the regulators in allopolyploids depends on not only the two regulation networks, but also the interactions between the two networks (Osborn et al., 2003); thus allopolyploidy can result in changes in regulation networks 29     compared with the diploid progenitors. The changing regulation networks could in part explain some of the expression changes of duplicate genes in allopolyploids, and might be responsible for some of the expression patterns documented in this study.  There is evidence for rapid genetic changes in resynthesized allopolyploids of Brassica species (Song et al., 1995; Gaeta et al., 2008) and wheat (Liu et al., 1998; Ozkan et al., 2001; Shaked et al., 2001; Kashkush et al., 2002) where loss and gain of many DNA restriction fragments were found. Chromosome rearrangements, gene loss, point mutation, and gene conversion could be responsible for these observations (Song et al., 1995). Gene losses have been reported in synthetic wheat allopolyploids. Although most of the gene losses in newly synthesized allopolyploids had no homology to known genes and were probably noncoding sequences (Feldman et al., 1997; Liu et al., 1998; Ozkan et al., 2001; Shaked et al., 2001), Kashkush et al. (2002) found one gene (RAIF32) which was identical to wheat Acc-2 gene was missing from tetraploid wheat. Chromosome rearrangements have been reported in synthetic Nicotiana tabacum and Brassica napus allopolyploids (Lim et al., 2006; Gaeta et al., 2007) and reciprocal exchanges between homeologs have been detected in Brassica allopolyploids (Gaeta et al., 2007). In contrast to other polyploid systems that have been studied, cotton does not show gene loss or chromosome rearrangements (Liu et al., 2001); thus such phenomena are unlikely to be responsible for the gene expression patterns shown here in synthetic cotton allopolyploids. 30     Also epigenetic changes could play a role in the duplicate gene expression changes in polyploids such as histone modifications and DNA methylation (Osborn et al., 2003; Chen., 2007). Studies revealed that there were changes in DNA methylation patterns between allopolyploid and the diploid parents in Spartina (Salmon et al., 2005) and synthetic Arabidopsis allotetraploids (Madlung et al., 2002). Notably, treatment of aza-dC, a chemical inhibitor for DNA methylation, reactivated some genes that were active in parent plants and fully or partially silenced in synthetic Arabiodopsis allotetraploid (Madlung et al., 2002). Chen et al. (2008) showed many previously identified cases of genome specific gene silencing were caused or related to methylation by RNAi of met1, which is a cytosine methyltransferase. These studies demonstrated that epigenetic changes could in part explain the expression changes of duplicate genes in allopolyploids compared with their progenitors. Although rapid epigenetic changes were not found in synthetic Gossypium allopolyploids (Liu et al., 2001), epigenetic changes could still in part explain the homeolog expression changes in other allopolyploids compared with their progenitors.  4.4 Conclusions  In this study, I found that abiotic stresses can have a considerable effect on homeologous gene expression both in natural and synthetic Gossypium polyploids. In 31     natural G. hirsutum, different expression pattern changes were found among the 30 homeologous genes in response to abiotic stress treatments.  Also for some genes,  there were different expression changes under different abiotic stress treatments. Even under the same abiotic stress treatment, different expression changes were found among organ types. In natural G. hirsutum I found several cases of stress-induced quantitative subfunctionalization, suggesting that stress-induced quantitative subfunctionalization is relatively common. In the synthetic Gossypium polyploids, I also found stress-specific and organ specific expression changes in response to abiotic stress treatments, and there was little correspondence in the homeologous gene expression changes in response to abiotic stresses in natural and synthetic Gossypium polyploids.  32     Gene #  Function or putative function  Accession#  1  Ultraviolet-B-repressible protein  DV850210  2  photosystem II subunit X  ES839555  3  photosystem II subunit X  DN780680  4  ATP Synthase Delta Chain  AI728201  5  ATP Synthase Delta Chain  ES811921  6  Aminomethyltransferase  ES804546  7  Aminomethyltransferase  DW242796  8  GDSL-motif lipase  ES845029  9  Coenzyme binding  DN780968  10  Phenylcoumaran benzylic ether reductase-like protein  DW484270  11*  Peptide methionine sulfoxide reductase  DW227959  12*  Ethylene responsive element binding protein ERF2  ES809854  13*  Ethylene responsive element binding protein ERF2  ES837957  14*  MAP kinase  DT558090  15*  MAP kinase 6  EX167377  16*  Alcohol dehydrogenase B  AF226633  17*  Alcohol dehydrogenase C  AF036575  18*  Alcohol dehydrogenase D  AF250204  19  Zinc finger family protein  DT571829  20  Group 4 late embryogenesis-abundant protein  DW514110  21  Unknown function  DW505445  22  Cold regulated plasma membrane  DW504511  23  Unknown function  DW505445  24*  Ethylene responsive element binding protein ERF2  DT459748  25*  Peptide methionine sulfoxide reductase  DW487846  26  Manganese ion binding  DR454806  27  Aminomethyltransferase  DT545047  28  Transferase, transferring hexosyl groups  DW482030  29*  Zinc finger transcription factor  AY887895  30*  Homeobox protein  EF151309  Table 1 List of Gossypium genes assayed for homeologous gene expression Accession # refers to a GenBank accession ID. One accession number is provided per gene. *Paralogs of stress related genes from polyploid Gossypium (Zhao et al., 2003; Qin et al., 2004; Wang et al., 2007; Ni et al., 2008; Guo et al., 2009). The other genes are homologs of stress regulated genes from Arabidopsis thaliana (William., 2006; Kilian et al., 2007).  33     Gene # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Table 2  Forward Primer  Reverse Primer  Urea%  GCTCCAACAATGGCGACCAGAA  GGGCGGTGTTAAAAGACCCAAC  5%  CTGAGGCATTCTTTAAGCCACT  GACACACCAATTACGGCTCCAA  5%  CAAGGAAAAGGCGGTGACGGGG  AGGTCCGCTTGACAGGGTCGAA  5%  CCAACAACACCCTTGATGCCAC  TGTAAACCAACTCGAACTCTTT  5%  GTCCAACAACACCCTTGATGCC  GCCAGCTCTGTATCCGTCAGCT  5%  GAAGTCTTTGGCAACTTGGGCA  CCACCATTCTCCCTGCAATTCA  2%  GGCAATGACATGGAACAACACA  GGCTAAATCCTCCGCTGGTGAT  5%  ACAACAGCAAGCGAAGCATGTT  TCAAAGATTACGAAGTTGTT  2%  GTTGATCCGAAGAGTAGGCACA  GGAATTGGAATAGGGCGACC  5%  ATGGCTGAAAAGAGCAAGGTTT  GTACATATCCCCTAACAACAAA  5%  GGAATGATGTGGGAACACAGTA  TGCTGGTGATATTCCTCTGCTC  2%  ATCAATTGTTCCGACTATGGCT  CAACAGCTCGTCCGACAAGGTC  5%  CTGCGAGAGCTTATGATGCTGA  ATAGACGTAGGAACAGGGTCCA  5%  GTACTTTCTATATCAGATTTTA  ATGCACATAGTCTCTTCCAGGG  2%  ATCTTACGTGGGCTGAAGTATA  CGATCCATCAATTCCATAAAAA  2%  GAGGGCGTGACTGATCTAAAGC  GGCGACCTGACCGACATGGACG  5%  TCATGTTCTACCTATCTTCACC  CCTGGCCGACATGGACAACAGT  2%  TGTGGGTGAGGGTGTGACAC  TAGAGATGCCACAGCTGAGAAT  5%  ATGGCATCGAAGTTGTGTGACTC  AGCAAGAGGGTTGGCGGAGTGGA  5%  GGGATAGCATCAGGGACAATAC  GAGAGGGATAGTGAAGTTCCCC  2%  ATGTTTGAGCATAAGGAACTTG  AATGAGAGTGAGAATAAGATAG  2%  GATTGGCTGGAACTTCCTGGAG  CAAGCAGGGTAAACCAACAGAA  5%  TCAGTGGTTTTCATTCTGCTTA  GATTAAGATGGAAGGGATAAAG  2%  ATGGTCAAGCTGAGAAATGTG  CTCGTTAGGGAAGTTCACCTT  5%  TCTAGGCTTCGGAGCCAACAAC  CCGTACACACGTCTTCATAGCT  5%  ACACCAGCCTTTTCGGCTCAAT  TTGCCTGCATTGATTTGGAAAT  5%  ATCATGGACTCAACTGTGAATT  CAATGTGAGCCAGATCCTTATC  2%  TACTTGGACGGCGACATTCAGG  GCAAATGGGGTAGGTTGTGTGA  5%  ATTTCCGTATGTACGAGTTCAA  ACAACAAGTACCGTCCTTGCAT  5%  GGGGAGGATGATTTATCAGATG  AGCTTTTGGTTCTGAGCTTGGA  5%  Primers used for gene amplification and urea concentration for SSCP. Primer sequences  are listed 5’ to 3’.  34     Table 3 At/Dt expression ratio changes between the stress treatment and normal conditions in G. hirsutum. “+” indicates an increase in the At/Dt ratio after stress treatment; “-” indicates a decrease in the At/Dt ratio after stress treatment; “0” indicates there is no statistical difference in the At/Dt ratio between the stress treatment and the untreated plants.  35     Figure 1 Phylogenetic trees and homeologous gene alignments (A) Phylogenetic analysis of gene5 resulting from parsimony analysis, rooted with genes from A. thaliana, B. napus and P. trichocarpa. CO087574 and CO087573 are from Gossypium raimondii (DD genome diploid), and BG403845 is from Gossypium arboreum (AA genome diploid). All the other cotton sequences were from G. hirsutum. (B) Phylogenetic analysis of gene 24 resulting from parsimony analysis, rooted with genes from A. thaliana, B. napus and P. trichocarpa. BG443984 is from Gossypium arboreum (AA genome diploid), CO081291,CO112016 and CO115074 is from Gossypium raimondii (DD genome diploid). All of the rest of the cotton sequences are from G. hirsutum. (C) Sequence alignment of a region of the At and Dt copies from gene 5. (D) Sequence alignment of a region of the At and Dt copies from gene 24.  36     Figure 1  A  B  C  D  37     Figure 2 Examples of SSCP gel pictures. “At” and “Dt” indicate two homeologous genes from the A or D genome of the natural allopolyploid G.hirsutum. The numbers indicate transcript percentages as determined by the PhosphorImager. gDNA lane is the band position control and the H2O lane is the PCR contamination control. CS indicates cold stress, WS indicates water-submersion stress, DS indicates drought stress,, SS indicates salt stress, 8D indicates untreated plants at 8 days. Hy indicates hypocotyls, and Co indicates cotyledons. The number 1, 2, 3 after the organ indicates replicates 1, 2, and 3, respectively.  38     Figure 3  Ratios of At/Dt expression vary under cold stress and water-submersion stress in G. hirsutum  Graphs showing the percentage of transcripts derived from the At homeolog (y axis) in seedling organs of G. hirsutum. “C” indicates cold stress, “W” indicates water submersion, and “N” means untreated control plants. Error bars represent standard deviations among replicates. The treatments with “*” mean a statistically significant difference compared with untreated plants, detected by T-tests (P<0.05).  39     Fi Figure 4  Ratios of At/Dt expression vary under heat stress, salt stress and drought stress in G. hirsutum  Graphs showing the percentage of transcripts derived from the At homeolog (y axis) in seedling organs of G. hirsutum. “H” indicates heat stress, “S” indicates salt stress, “D” indicates drought stress, and “N” means untreated control plants. Error bars represent standard deviations among replicates. The treatments with “*” mean a statistically significant difference compared with untreated plants, detected by T-tests (P<0.05).  40     Figure 5 Ratios of At/Dt Expression vary under salt stress, cold stress and heat stress in a synthetic Gossypium allopolyploid. Graphs showing the percentage of transcripts derived from the At homeolog (y axis) in seedling organs of the synthetic Gossypium allopolyploid. “S” indicates salt stress, “C” indicates cold stress, “H” indicates heat stress, and “N” means untreated control plants. Error bars indicate standard deviations among replicates. The treatments with “*” indicate a significant difference compared with control plants, detected by T-tests (P<0.05).  41     BIBLIOGRAPHY  ADAMS, K. L., R. CRONN, R. PERCIFIELD and J. F.WENDEL, 2003 Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proc. Natl. Acad. Sci. USA 100: 4649-4654 ADAMS, K. L., R. PERCIFIELD and J. F. WENDEL, 2004 Organ-specific silencing of duplicated genes in a newly synthesized cotton allotetraploid. Genetics 168: 2217-2226 ADAMS, K. L., and J. F. WENDEL, 2005 Allele-specific, bidirectional silencing of an Alcohol Dehydrogenase gene in different organs of interspecific diploid cotton hybrids. Genetics 171: 2139-2142 ALBERTIN W., T. BALLIAU, P. BRABANT, A. M. CHEVRE, F. EBER et al., 2006 Numerous and rapid nonstochastic modifications of gene products in newly synthesized Brassica napus allotetraploids. Genetics 173: 1101-1113 BIRCHELER, J. A., 1979 A study of enzyme activities in a dosage series of the long arm of chromosome one in maize. Genetics 92: 1211-1229 BIRCHLER, J. A., D. L. AUGER, and N. C. RIDDLE, 2003 In search of the molecular basis of heterosis. Plant Cell. 15(10): 2236-9 BIRCHLER, J. A., U. BHADRA, M. P. BHADRA and D. L. AUGER, 2001 Dosage-dependent gene regulation in muticellular eukaryotes: implications for dosage compensation, aneuploid syndromes, and quantitative traits. Developmental Biology 234: 275-288 42     BIRCHLER, J. A., U. BHADRA, L. RABINOW, R. LINSK, and A. T. NGUYEN-HUYNH, 1994 Weakener of white(WOW)- a gene that modifies the expression of the white eye color locus and that suppresses position effect variegation in Drosophila. Genetics 137: 1057-1070 BLANC, G., and K. H. WOLFE, 2004 Widespread palepolyploidy in model plant species inferred from age distributions of duplicate genes. Plant Cell 16:1667-1678 BOTTLEY, A., G. M. XIA and R. M. D. KOEBNER, 2006 Homoeologous gene silencing in hexaploid wheat. Plant J. 47:897-906 BROCHMANN, C. and R., ELVEN, 1992 Ecological and genetic consequences of polyploidy in Arctic Draba (Brassicaceae). Evol. Trends Plants 6: 111-124 BRUBAKER, C. L., A. H. PATERSON and J. F. WENDEL, 1999 Comparative genetic mapping of allotetraploid cotton and its diploid progenitors. Genome 42: 184-203 CHAUDHARY, B., L. FLAGEL, R. M. STUPAR, J. A. UDALL, N. VERMA, N. M. SPRINGER, and J. F. WENDEL, 2009 Reciprocal silencing, transcriptional bias and functional divergence of homeoeologs in polyploid cotton (Gossypium) Genetics 182(2): 503-17 CHEN, M., M. HA, E. LACKEY, J. WANG and Z. .J. CHEN, 2008 RNAi of met1 reduces DNA methylation and induces genome-specific changes in gene expression and centromeric small RNA accumulation in Arabidopsis allopolyploids. Genetics 178: 1845-1858 CHEN, Z. J., 2007 Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. ANN. Rev. Plant Biol. 58: 377-406 CHEN,Z. J., Z. F. NI., 2006 Mechanisms of genomic rearrangements and gene expression changes in plant polyploids. Bioessays 28: 240-252 COMAI, L., A. P. TYAGI, K. WINTER, R. HOLMES-DAVIS, S. H. REYNOLDS, Y. STEVENS and 43     B. BYERS, 2000 Phenotypic instability and rapid gene silencing in newly formed Arabidopsis allotetraploids. Plant Cell 12: 1551-1567 CRONN, R. C., and K. L. ADAMS, 2003 Quantitative analysis of transcript accumulation from genes duplicated by polyploidy using cDNA-SSCP. Biotechniques 34: 726-734 DOEBLEY, J. F., A. STEC, and L. HUBBARD, 1997 The evolution of apical dominance in maize. Nature 386: 485-488 DUARTE, J. M., L. CUI, P. K. WALL, Q. ZHANG, J. LEEBENS-MACK, H. MA, N. ALTMAN, and C. W. DEPAMPHILIS, 2006 Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. Mol. Biol. Evol. 23(2): 469-278 EHRENDORFER, F., 1980 Polyploidy and distribution in polyploidy: Biological relevance. New York: Plenum Press 45-60 EVANGERLISTI. A. M ., and A. WAGNER, 2004 Molecular evolution in the yeast transcriptional newwork. Journal of Experimental Zoology 302:392-411 FELDMAN, M., B. LIU, G. SEGAL., S. ABBO, A. A. LEVY et al., 1997 Rapid eliminatio of low-copy DNA sequences in polyploid wheat: a possible mechanism for differentiation of homoeologous chromosomes. Genetics 147:1381-1387 FORCE, A., 1999 Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151: 1531-1545 FRARY, A., 2000 fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289: 85-88 GAUT, B. S., 2001 Patterns of chromosomal duplication in maize and their implications for 44     comparative maps of the grasses. Genome Res. 11(1):55-66 GUO, Y. H., Y. P. YU, D. WANG, C. A. WU, G. D. YANG, J. G. HUANG and C. C. ZHENG, 2009 GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5. New Phytologist 183: 62-75 HABERER, G., T. HINDERMITT, B. C. MEYERS, K. F. MAYER, 2004 Transcriptional similarities, dissimilarities, and conservation of cis-elements in duplicated genes of Arabidopsis. Plant Phsiol. 136: 3009-3022 HAHN, M. W., 2009 Distinguishing among evolutionary models for the maintenance of gene duplicates. Journal of Heredity 200(5): 605-617 HEGARTY, M. J., J. M. JONES, I. D. WILSON, G. L. BARKER, J. A. COGHILL, P. SANCHEZ-BARACALDO, G. LIU, R. W. DOERGE, L. COMAI, R. J. ABBOTT, K. J. EDWARDS et al., 2005 Development of anonymous cDNA microarrays to study changes to the Senecio floral transcriptome during hybrid speciation. Mol. Ecol. 14: 2493-2510 HEGARTY., M. J., and J. H. SIMON, 2008 Genomic clues to the evolutionary success of polyploidy plants. Curr. Biol. 18: 435-444 HOVAV, R., J. A. UDALL, B. CHAUDHARY, R. RAPP, L. FLAGEL et al., 2008 Partitioned expression of duplicated genes during development and evolution of a single cell in a polyploid plant. Proc. Natl. Acad. Sci. USA 105: 6191-6195 JENUWEIN, T. and C. D. ALLIS, 2001 Translating the histone code. Science 293: 1074-1080 JIN, L. G., and J. Y. LIU, 2006 Molecular cloning, expression profile and promoter analysis of a novel ehthylene responsive transcription factor gene GhERF4 from cotton (Gossypium hirsutum). 45     Plant Physiology and Biochemistry 46: 46-53 KASHKUSH, K., M. FELDMAN and A. A. LEVY, 2002 Gene loss, silencing and activation in a newly synthesized wheat allotetraploid. Genetics 160: 1651-1659 KOVARIK, A., R. MATYASEK, K. Y. LIM, K. SKALICKA, B. KOUKALOVA, S. KNAPP, M. CHASE and A. R. LEITCH, 2004 Concerted evolution of 18-5.8-26S rDNA repeats in Nocotiana allotetraploids. Biol. J. Linn. Soc. Lond. 82: 615-625 KOVARIK, A., J. C. PIRES, A. R. LEITCH, K. Y. LIM, A. M. SHERWOOD, R. MATYASEK, J. ROCCA, D. E. SOLTIS and P. S. SOLTIS, 2005 Rapid concerted evolution of nuclear ribosomal DNA in two Tragopogon allopolyploids of recent and recurrent origin. Genetics 169: 931-944 KILIAN, J. K., D.WHITEHEAD, J. HORAK, S. WEINL, O. BATISTIC, C. D'ANGELO, E. BORNBERG-BAUER, J. KUDLA, and K. HARTER, 2007 The AtGenExpress global stress expression data set: protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. The Plant Journal 50: 347-363 LAW, R. D., S. J. CRAFTS-BRANDNER and M. E. SALVUCCI, 2001 Heat stress induces the synthesis of a new form of ribulose-1,5-bisphosphate carboxylase/oxygenase activase in cotton leaves. Planta 214: 117-125 LEE,H.S,and Z.J. CHEN., 2001 Protein-coding genes are epigenetically regulated in Arabidopsis polyploids. Proc. Natl. Acad. Sci. USA 98: 6753-6758 LEITCH, I. L., and BENNETT, M. D., 1997 Polyploidy in angiosperms. Trends Plant Sci. 2:460-76 LEVIN, D. A., 2002 The role of chromosomal change in plant evolution. New York: Oxford University Press 46     LEVY, A. A., and M. FELDMAN, 2002 The impact of polyploidy on grass genome evolution. Plant Physiol. 130(4): 1587-93 LIU, B., C. L. BRUBAKER, G. MERGEAI, R.C. CRONN and J. F. WENDEL, 2001 Polyploid formation in cotton is not accompanied by rapid genomic changes. Genome 44: 321-330 Liu, B., J. M. VEGA, M. FELDMAN, 1998 Rapid genomic changes in newly synthesized amphiploids of Triticum and Aegilops. II. changes in low-copy coding DNA sequences. Genome 41(4): 535-42 LIU, B., G. SEGAL., J. M. VEGA, M. FELDMAN and S. ABBO, 1997 Isolation and characterization of chromosome-specific DNA sequences from a chromosome arm genomic library of common wheat. Plant J. 11:959-965 LIU, Z., and K. L. ADAMS, 2007 Expression partitioning between genes duplicated by polyploidy under abiotic stress and during organ development. Curr. Biol. 17:1669-1674 LWEIS, W. H., 1980 Polyploidy: biological relevance. Plenum, New York LYNCH, M. and A. FORCE, 2000 Gene duplication and the origin of interspecific genomic incompatibility. Am. Nat. 156: 590-605 LYNCH, M., and V. KATJU, 2004 The altered evolutionary trajectories of gene duplicates. Trends in Genetics. 20(11): 544-9 MADLUNG, A., R. W. MASUELLI, B., WATSON, S. H. REYNOLDS, J. DAVISON et al., 2002 Remodeling of DNA methylation and phenotypic and transcriptional changes in synthetic Arabidopsis allotetraploids. Plant Physiol. 129: 733-746 MASTERSON., J., 1994 Stomatal size in fossil plants: evidence for polyploidy in majority of angiosperms. Science 264:421-424 47     MICHAELS, S. D., and R. M. AMASINO, 1999 Flowering Locus C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-956 NI, Y. X., X. L. WANG, D. D. LI, Y. J. WU, W. L. XU, and X. B. LI, 2008 Novel cotton homeobox gene and its expression profiling in root development and in response to stresses and phytohormones. Acta.Biochim.Biophys.Sin. 40(1): 78-84 OHNO, S., 1970 Evolution by gene duplication. New York: Springer-Verlag. OSBORN, T. C., J. C. PIRES, J. A. BIRCHLER, D. L. AUGER, Z. J. CHEN, H. S. LEE, L. COMAI, A. MADLUNG, R. W. DOERGE, V. COLOT, and R. A. MARTIENSSEN, 2003 Understanding mechanisms of novel gene expression in polyploids. Trends in Genetics 19(3):141-147 OZKAN, H., A. A. LEVY and M. FELDMAN, 2001 Allopolyploidy-induced rapid genome evolution in the wheat (Aegilops-Triticum) group. Plant Cell 13:1735-1747 PERCIVAL, A. E., J. M. STEWART and J. F. WENDEL, 1999 Taxonomy and germplasm resources in cotton: origin, history, technology and production. New York. 33-63 PIKAARD, C. S., 2000 Translating the histone code. Science 293: 481-486 PUMPHREY, M., J. BAI, D. LAUDENCIA-CHINGCUANCO, O. ANDERSON, B. S. GILL, 2009 Nonadditive expression of homoeologous genes is established upon polyploidization in hexaploid wheat. Genetics 181(3): 1147-57 QIN, J., J. Y. ZHAO, K. J. ZUO, Y. F. CAO, H. LING, X. F. SUN, and K. X. TANG, 2004 Isolation and characterization of an ERF-like gene from Gossypium barbadense. Plant Science 167: 1383-1389 RIDDLE, N. C., and J. A. BIRCHLER, 2003 Effects of reunited diverged regulatory hierarchies in allopolyploids and species hybrids. Trends Genet. 19(11): 597-600 48     SABL, J. F., and J. A. BIRCHLER, 1993 Dosage dependent modifiers of white alleles in Drosophila melanogaster. Genet. Res. 62: 15-22 SALMON, A., M. L. AINOUCHE and J. F. WENDEL, 2005 Genetic and epigenetic consequences of recent hybridization and polyploidy in Spartina(Poaceae). Mol. Ecol. 14:1163-1175 SHAKED, H., K. KASHRUSH, H. OZAKAN, M. FELDMAN and A. A. LEVY,2001 Sequence elimination and cytosine methylation are rapid and reproducible responses of the genome to wide hybridization and allopolyploidy in wheat. Plant Cell 13: 1749-1759 SIMILLION, C. K., K. VANDEPOELE, M. C. VAN MONTAGU, M. ZABEAU. and Y. VAN DE PEER, 2002 The hidden duplication past of Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 99(21): 13627-32 SONG, K., 1995 Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution. Proc. Natl. Acad. Sci. USA. 92:7719-7723 STEBBINS, G. L., 1950 Variation and evolution in plants. New York : Columbia University Press STEBBINS, G. L., 1985 Polyploidy, hybridization, and the invasion of new habitats. Ann. Missouri Bot. Gard. 72: 824-832 SWINDELL, W. R., 2006 The association among gene expression responses to nine abiotic stress treatments in Arabidopsis thaliana. Genetics 174:1811-1824 WALTHER, D., R. BRUNNEMANN, J. SELBIG, 2007 The regulatory code for transcriptional response diversity and its relation to genome structural properties in A. tahliana. PLoS. Genet. 3(2): e11 WANG, J., L. TIAN, A. MADLUNG, H. S. LEE, M. CHEN et al., 2004 Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids. Genetics 167: 1961-1973 49     WANG, M. M., Y. ZHANG, J. WANG, X. L. WU, and X. Q. GUO, 2006 A novel MAP kinase gene in cotton(Gossypium hirsutum L.), GhMAPK, is involved in response to diverse environmental stresses. Journal of Biochemistry and Molecular Biology 40(3): 325-332 WENDEL, J. F., 2000 Genome evolution in polyploids. Plant Mol. Biol. 42:225-249 WINGE., O., 1997 The chromosomes: their number and general importance. Polyploidy 131-275 WOLFFE, A. P., and M. A. MATZKE,1999 Epigenetics: regulation through repression. Science 286: 481-486 ZHAO, J. Y., K. J. ZUO, J. WANG, Y. F. CAO, L. D. ZHANG, and K. X. TANG, 2003 cDNA cloning and characterization of a cotton peptide methionine sulfoxide reductase (cMsrA) DNA Sequence 14(4): 303-310 ZOU, C., M. D. LEHTI-SHIU, M. THOMASHOW, S. H. SHIU, 2009 Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana. PLoS Genetics. 5(7): e1000581  50     51     

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067705/manifest

Comment

Related Items