Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of the function of lipoprotein-associated phospholipase A₂ in lipid metabolism Yang, Ming 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2009_fall_yang_ming.pdf [ 1.88MB ]
Metadata
JSON: 24-1.0067484.json
JSON-LD: 24-1.0067484-ld.json
RDF/XML (Pretty): 24-1.0067484-rdf.xml
RDF/JSON: 24-1.0067484-rdf.json
Turtle: 24-1.0067484-turtle.txt
N-Triples: 24-1.0067484-rdf-ntriples.txt
Original Record: 24-1.0067484-source.json
Full Text
24-1.0067484-fulltext.txt
Citation
24-1.0067484.ris

Full Text

  Investigation of the function of lipoprotein-associated phospholipase A2 in lipid metabolism    by   Ming Yang    MD, China Medical University, 2001    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY   in  THE FACULTY OF GRADUATE STUDIES (Pathology and Laboratory Medicine)     THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2009     © Ming Yang, 2009   ii Abstract Lipoprotein-associated phospholipase A2 (Lp-PLA2) has been recognized in many population studies as an independent risk factor for cardiovascular and cerebrovascular disease. However, it remains unclear if there is a direct mechanistic link between Lp- PLA2 function and atherogenesis. The complexity of this issue is related to the fact that the catalytic products of the enzymatic reaction catalyzed by Lp-PLA2 namely lysophosphatidylcholine (lysoPC) and oxidized fatty acids, as well as the substrates of Lp-PLA2, including oxidized phospholipids and platelet-activating factor that can be considered to be proatherogenic. Lp-PLA2 is secreted by macrophages, hepatocytes and platelets, and circulates primarily with LDL, HDL, and Lp(a). Whether these native and oxidized forms of lipoproteins affect Lp-PLA2 expression from macrophages and hepatocytes is largely unknown. Furthermore, the specific role of Lp-PLA2 in lipoprotein metabolism remains unclear.  In the present study, we observed that oxidized phospholipids, oxysterols and oxidized fatty acids decreased Lp-PLA2 activity without affecting Lp-PLA2 mRNA and protein expression from human monocyte-derived macrophages (MDM) or HepG2 cells. For the investigation of the role of Lp-PLA2 in lipid metabolism, we constructed Lp-PLA2 Gain- of-Function and Loss-of-Function lentivirus, and purified 2 types of human recombinant Lp-PLA2 proteins, active Lp-PLA2 and catalytically inactive Lp-PLA2. Human Lp-PLA2 protein decreased the cellular association of oxLDL and oxLp(a) by human MDM and HepG2 cells whereas the inactive form of Lp-PLA2 did not significantly change oxidized  iii lipoprotein cellular association by either cell type. OxLDL pretreated with Pefabloc (serine esterase inhibitor) increased oxLDL uptake by MDM and HepG2 cells compared to untreated oxLDL. To assess whether the reduced cellular association mediated by Lp- PLA2 was due to the hydrolysis of the scavenger receptor ligands, i.e. oxPCs by Lp- PLA2, we measured the concentration of lysophosphatidylcholine (lysoPC) in lipoprotein fractions after Lp-PLA2 treatment. LysoPC was increased by active Lp-PLA2 compared to inactive Lp-PLA2 for oxLDL and oxLp(a), respectively.  In summary, we report the ability of endogenous and exogenous Lp-PLA2 to reduce oxidized lipoprotein cellular association in human-derived macrophages and HepG2 cells, a phenomenon likely resulting from the removal of ligands from lipoproteins for cell surface scavenger receptors.   iv Table of Contents Abstract ............................................................................................................................... ii Table of Contents............................................................................................................... iv List of Tables ..................................................................................................................... ix List of Figures ..................................................................................................................... x Abbreviations.................................................................................................................... xii Acknowledgements.......................................................................................................... xiv Dedication ........................................................................................................................ xvi 1 Introduction...................................................................................................................... 1 1.1 Atherosclerosis.......................................................................................................... 1 1.2 Proatherogenic properties of LDL and lipoprotein(a) .............................................. 4 1.3 Lipoprotein metabolism in the human macrophage.................................................. 6 1.4 Lipoprotein metabolism in the hepatocyte.............................................................. 10 1.5 The Phospholipase A2 family.................................................................................. 11 1.6 Lp-PLA2.................................................................................................................. 12 1.6.1 Physical properties of Lp-PLA2 ....................................................................... 12 1.6.2 Biochemical properties of Lp-PLA2 ................................................................ 16 1.6.3 Substrates of Lp-PLA2 ..................................................................................... 18 1.6.4 Products of Lp-PLA2........................................................................................ 20 1.6.5 Clinical studies of Lp-PLA2............................................................................. 21 1.6.6 Animal studies about Lp-PLA2........................................................................ 30 1.6.7 The role of Lp-PLA2 in lipid metabolism........................................................ 31  v 1.7 Rationale ................................................................................................................. 33 1.8 Hypotheses.............................................................................................................. 34 1.9 Main objectives....................................................................................................... 34 2 Methods.......................................................................................................................... 36 2.1 Cell culture.............................................................................................................. 36 2.1.1 Primary human macrophages........................................................................... 36 2.1.2 HepG2 cells...................................................................................................... 36 2.1.3 THP-1 cells ...................................................................................................... 37 2.2 Lipoprotein preparation .......................................................................................... 37 2.2.1 LDL isolation from plasma.............................................................................. 37 2.2.2 Lp(a)................................................................................................................. 37 2.2.3 Dialysis ............................................................................................................ 38 2.2.4 Pefabloc treatment ........................................................................................... 38 2.2.5 LDL/oxLp(a) oxidation.................................................................................... 38 2.2.6 DiI labeling of oxLDL/oxLp(a) ....................................................................... 38 2.2.7 PD-10 column purification .............................................................................. 39 2.2.8 Evaluation of oxidation degree of LDL........................................................... 39 2.3 Virus generation...................................................................................................... 42 2.3.1 Loss-of-Function (LOF) virus.......................................................................... 42 2.3.2 Gain-of-Function (GOF) virus......................................................................... 46 2.3.3 Target cell line transduction............................................................................. 47 2.4 Recombinant Lp-PLA2 Protein purification ........................................................... 47 2.4.1 Strategy of Lp-PLA2 purification..................................................................... 47  vi 2.4.2 Subcloning PLA2G7 (gene name of Lp-PLA2) cDNA from vector pCMV6-XL6 into vector pcDNA5/FRT ......................................................................................... 49 2.4.3 Mutagenesis ..................................................................................................... 49 2.4.4 Transfection of pcDNA/FRT/Lp-PLA2 into 293/FLP cells............................. 49 2.4.5 Collection of conditioned medium................................................................... 50 2.4.6 Lp-PLA2 protein purification by FPLC ........................................................... 50 2.4.7 Lp-PLA2 mass determination by ELISA and BCA assay................................ 51 2.4.8 Purified Lp-PLA2 activity determination by PAF-AH assay........................... 51 2.4.9 Specific activity of purified Lp-PLA2.............................................................. 51 2.5 PAGE gel running................................................................................................... 52 2.6 Turbidity assay........................................................................................................ 52 2.7 Cytotoxicity assay................................................................................................... 52 2.8 Lipoprotein cellular association assay .................................................................... 53 2.9 Foam cell formation................................................................................................ 53 2.10 Liquid phase uptake assay .................................................................................... 54 2.11 Cholesterol efflux.................................................................................................. 54 2.12 Real time PCR quantification by ABI 7900 ......................................................... 55 2.13 Real time PCR quantification by QuantiGene ...................................................... 56 2.14 Western blotting.................................................................................................... 56 2.15 Flow cytometry ..................................................................................................... 56 2.16 Statistics ................................................................................................................ 57 3 Results............................................................................................................................ 58 3.1 LDL/Lp(a) modification ......................................................................................... 58  vii 3.2 Oxidized lipid treatment of human macrophages and HepG2 cells is associated with a decrease in lipoprotein-associated phospholipase A2 activity ........................... 64 3.3 Lp-PLA2 LOF lentivirus generation ....................................................................... 69 3.4 Lp-PLA2 GOF lentivirus generation....................................................................... 71 3.5 Endogenerous Lp-PLA2 expression induced by GOF and LOF lentivirus did not affect cholesterol efflux and oxLDL cellular association in THP-1 macrophages....... 73 3.6 Purification of recombinant Lp-PLA2 enzymes (both active form and inactive form) ............................................................................................................................. 76 3.7 Lp-PLA2 reduced oxLDL/oxLp(a) cellular association in MDM and HepG2 cells80 3.8 Recombinant Lp-PLA2 enzyme reduced foam cell formation................................ 85 3.9 HepG2/MDM cells took up more pefabloc-pretreated oxLDL than untreated oxLDL........................................................................................................................... 86 3.10 Lp-PLA2 did not change LDL/oxLDL physical properties .................................. 88 3.11 LysoPC generation in oxLDL/oxLp(a) treated with Lp-PLA2 ............................. 90 3.12 LysoPC treatement of MDM and HepG2 cells was associated with an increase in cellular association of oxLDL and oxLp(a) .................................................................. 91 3.13 LysoPC did not affect liquid phase uptake in either MDM or HepG2 cells......... 95 3.14 LysoPC affected cholesterol efflux in MDM........................................................ 96 4 Discussion ...................................................................................................................... 98 4.1 Oxidized lipid treatment of human macrophages and HepG2 cells is associated with a decrease in lipoprotein-associated phospholipase A2 activity ........................... 98 4.2 Switching cell models from THP-1 cells to monocyte-derived macrophages........ 99  viii 4.3 Lipoprotein-associated phospholipase A2 decreases oxidized lipoprotein cellular association in human macrophages and hepatocytes .................................................. 100 4.4 Is there a discrepancy between the results of human and animal studies? ........... 111 References....................................................................................................................... 114 Appendices...................................................................................................................... 137 Appendix I .................................................................................................................. 137 Appendix II ................................................................................................................. 139 Appendix III................................................................................................................ 141    ix List of Tables Table 1.1 PAF-AH family................................................................................................ 12 Table 1.2 Collection of studies indicating Lp-PLA2 is biomarker of cardiovascular and cerebrovascular diseases ............................................................................... 22 Table 1.3 Collection of studies showing Lp-PLA2 was not associated with cardiovascular and cerebrovascular diseases......................................................................... 26 Table 1.4 Clinical studies about Lp-PLA2 genetic polymorphism................................... 28 Table 1.5 Collection of animal studies suggesting Lp-PLA2 is anti-atherogenic ............ 30 Table 1.6 Animal study suggesting Lp-PLA2 is pro-atherogenic .................................... 31 Table 2.1 Oligos designed for Lp-PLA2 pre-miRNA ...................................................... 42 Table 3.1 Recovery and purity of recombinant active-Lp-PLA2 ..................................... 78 Table 3.2 Specific activity of recombinant Lp-PLA2....................................................... 78   x List of Figures Figure 1.1 Mutation sites in the human PLA2G7 gene. ..................................................... 13 Figure 1.2 Catalytic reaction of Lp-PLA2......................................................................... 17 Figure 2.1 Hydrolysis of PAF by pooled human plasma.................................................. 41 Figure 2.2 Recombinant Lp-PLA2 enzyme purification. .................................................. 48 Figure 3.1 Evaluation of the effects of oxidation on lipoprotein charge by agarose gel electrophoresis............................................................................................... 59 Figure 3.2 Evaluation of the effects of Pefabloc pre-treatment on lipoprotein charge by agarose gel electrophoresis............................................................................ 59 Figure 3.3 Measurement of endogenous fluorescence following copper oxidation of LDL. ....................................................................................................................... 60 Figure 3.4 Measurement of lysoPC content in oxidized lipoproteins............................... 61 Figure 3.5 Lp-PLA2 enzyme activity associated with lipoproteins. ................................. 63 Figure 3.6 Relative Lp-PLA2 activity secreted from macrophages and HepG2 cells following treatment with selected oxidized lipids......................................... 65 Figure 3.7 Lp-PLA2 mRNA expression in monocyte-derived macrophages following treatment with oxidized lipids. ...................................................................... 66 Figure 3.8 Western blot of Lp-PLA2 protein from monocyte-derived macrophages treated with oxidized lipids. ...................................................................................... 67 Figure 3.9 Reduced Lp-PLA2 activity in enzyme enriched medium treated with oxidized lipids. ............................................................................................................. 68 Figure 3.10 Reduced Lp-PLA2 activity in LOF lentivirus transduced THP-1 cells. ........ 70 Figure 3.11 Reduced Lp-PLA2 mRNA in LOF lentivirus transduced THP-1 cells.......... 70 Figure 3.12 Western blot for Lp-PLA2 protein in LOF lentivirus transduced THP-1 cells. ....................................................................................................................... 71 Figure 3.13 Lp-PLA2 activity in GOF lentivirus transduced THP-1 cells........................ 72 Figure 3.14 Lp-PLA2 mRNA in GOF lentivirus transduced THP-1 cells. ....................... 72 Figure 3.15 Endogenous Lp-PLA2 expression in THP-1 cells transduced with GOF/LOF virus did not affect cholesterol efflux. .......................................................... 75  xi Figure 3.16 Endogenous Lp-PLA2 expression in THP-1cells transduced with GOF/LOF virus did not affect oxLDL cellular association. ........................................... 76 Figure 3.17 AKTA purification map for recombinant active-Lp-PLA2 protein. .............. 77 Figure 3.18 Lp-PLA2 activity volume comparison among all the steps during purification. ....................................................................................................................... 77 Figure 3.19 Coomassie blue stained SDS-PAGE for purified recombinant Lp-PLA2. .... 79 Figure 3.20 Western blot for purified recombinant Lp-PLA2........................................... 80 Figure 3.21 Active Lp-PLA2 reduced oxLDL and oxLp(a) cellular association in MDM cells................................................................................................................ 82 Figure 3.22 Active Lp-PLA2 reduced oxLDL and oxLp(a) cellular association in HepG2 cells................................................................................................................ 83 Figure 3.23 Active Lp-PLA2 reduced oxLDL cellular association in MDM cells. .......... 84 Figure 3.24 Active Lp-PLA2 reduced oxLDL cellular association in HepG2 cells.......... 85 Figure 3.25 Active Lp-PLA2 reduced cholesterol accumulation in MDM....................... 86 Figure 3.26 Pefabloc treated oxLDL increased cellular association in HepG2 cells (panel A) and MDM (panel B)................................................................................. 87 Figure 3.27 Assessment of the effect of Lp-PLA2 treatment on lipoprotein charge......... 89 Figure 3.28 Assessment of the effect of Lp-PLA2 treatment on lipoprotein size. ............ 90 Figure 3.29 LysoPC content in oxLDL and oxLp(a) treated with Lp-PLA2 or pefabloc. 91 Figure 3.30 LysoPC enhanced oxLDL and oxLp(a) cellular association by MDM and HepG2 cells. .................................................................................................. 94 Figure 3.31 CD36 expression in MDM after lysoPC treatment. ...................................... 95 Figure 3.32 LysoPC did not change Lucifer yellow cellular association in HepG2 cells. 96 Figure 3.33 LysoPC treatment of MDM increased non-acceptor mediated cholesterol efflux. ............................................................................................................ 97 Figure 3.34 LysoPC treatment of MDM decreased HDL mediated cholesterol efflux. ... 97 Figure 4.1 Model of conclusions .................................................................................... 111  xii Abbreviations ABCA1 ATP-binding cassette, sub-family A, member 1 ABCG1 ATP-binding cassette, sub-family G, member 1 ABCG5 ATP-binding cassette, sub-family G, member 5 ABCG8 ATP-binding cassette, sub-family G, member 8 act Active apoAI apolipoprotein AI apoB apolipoprotein B CAD coronary artery disease CV Cardiovascular GOF Gain-of-Function HDL high density lipoprotein inact Inactive LCAT lecithin-cholesterol acyltransferase LDL low density lipoprotein Lp(a) lipoprotein(a) LOF Loss-of-Function Lp-PLA2 lipoprotein-associated phospholipase A2 LXR liver X receptor lysoPC lysophosphatidylcholine M-CSF macrophage colony-stimulating factor MDM human monocyte-derived macrophages MI myocardial infarction miRNA micro RNA MOI multiplicity of infection natLDL native low density lipoprotein natLp(a) native lipoprotein(a) oxFAs oxidized fatty acids oxLDL oxidized low density lipoprotein  xiii oxLp(a) oxidized lipoprotein(a) oxPC oxidized phosphatidylcholine PAF platelet-activating factor PAF-AH platelet-activating factor acetylhydrolase PGPC 1-palmitoyl-2-glutaroyl-sn-glycero-3-phosphocholine PLA2 phospholipase A2 PLA2G7 phospholipase A2, group VII PMA phorbol-12-myristate-13-acetate PON-1 paraoxonase 1 POVPC 1-palmitoyl-2-(5'-oxo-valeroyl)-sn-glycero-3-phosphocholine PPAR peroxisome proliferator-activated receptor SR-A scavenger receptor class A SR-BI scavenger receptor class B type I VLDL very low density lipoprotein 7-KC 7-ketocholesterol 7β-OC 7 beta-hydroxycholesterol 9-HODE 9-hydroxy-10E,12Z-octadecadienoic acid 15-HETE 5,8,11,13-eicosatetraenoic acid    xiv Acknowledgements This has been a long journey for me. Frankly, this PhD study is the biggest test I’ve ever experienced in my life, woven with hope, excitement, disappointment, exhaustedness, pains and joys. Compared with the knowledge I’ve generated in this study, the most valuable gem I got after this test is how to THINK, and how to persistently carry out a project from zero towards completeness to some degree.  The first thankfulness goes to my supervisor Dr. John Hill. I sincerely appreciated that he would like to give this precious study opportunity to me who was full of curiosity, passion, and dreams in medical research, but knew very little about research 4 years ago. His incredible patience, great encouragement, very supportive guidance, positive thinking and breezy kindness, indispensably assist me complete this thesis.  The second thankfulness goes to my committee members Dr. Alice Mui, Dr. David Granville, and my chair Dr. Haydn Pritchard. I am wholeheartedly grateful for their great suggestions for my research and even how to build up my career after study. Once of the most precious things I learned from Dr. Pritchard is in graduate 500 class, he encouraged us to be a critical thinker and urged us to actively involve in class by asking questions no matter how poor your English is and if authorities are sitting around. I am also very grateful to Dr. Angelo Scanu, Dr. Celina Edelstein for providing Lp(a) and oxPC measurement,  and to Dr. Muriel Caslake for Lp-PLA2 quantification.   xv The third thankfulness goes to my lab mates. GuoSong Qiu gave me some basic instructions when I first came in the lab. Willie Yu helped me with vector works. Rita Tory liked to have to be the subject I was making jokes on (good jokes). Eugene Chu, a very nice guy, liked to share with me macrophages and LDL, as well as coffee and snacks.  The last and weighty thankfulness goes to my mother ShuLan Huang, father Jie Yang, and my husband MingEn Li. The UNCONDITIONAL love from my parents waters me no matter where I am, when I am, and how I am. The angelic Love from MingEn is such a blessing given by God. MingEn brand food, and MingEn brand funny troubleshooting to my research (he almost knows nothing about life science) accompanied me go through my PhD study.    xvi Dedication  To my mom, dad, and husband… …       1 1  Introduction 1.1  Atherosclerosis Cardiovascular disease is the leading cause of death with more than 7.2 million deaths each year worldwide reported by WHO in 2004. Atherosclerosis is the primary cause of cardiovascular disease and results from a complex interaction of genetic, metabolic, environmental, and psychosocial factors. The pathogenesis of atherosclerosis is thought to be initiated by endothelial dysfunction, which in turn can be triggered, by a variety of risk factors such as diabetes, hyperlipidemia, hypertension, chronic inflammation, or smoking. Once activated by these risk factors, the endothelium can produce increased quantities of proteins including surface molecules such as selectins and adhesion molecules as well as secreted proteins such as chemoattractants. Cumulatively, these changes result in the accumulation of immune cells to the targeted site.[1-3]  Another critical aspect of the pathogenesis of atherosclerosis is the accumulation of lipid within the arterial intima. Concurrent with endothelial dysfunction, low density lipoprotein (LDL) can accumulate, become modified, and be consumed by macrophages. Lipid accumulation within macrophages results in the creation of foam cells which marks the first stage of an atherosclerotic lesion, the fatty streak.  Fatty streaks may be present in early life but typically decades are required for more complex lesions to develop. A typical mature atherosclerotic plaque contains a variety of immune cells, particularly macrophages, and a lipid core [4] surrounded by  2 subendothelial matrix generated from smooth muscle cells that have migrated from the media. The importance of macrophages in atherogenesis is emphasized by the observation that hypercholesterolemic mice become resistant to atherosclerosis in the context of macrophage deficiency.[5] The secreted products of the inflammatory process can also promote oxidation, enzyme modification and aggregation of LDL, all of which further promote accumulation of lipid and foam cell formation. The generation of collagen by smooth muscle cells within the lesion is associated with the formation of a fibrous cap, providing stability to the lesion. However, matrix metalloproteinases along with cysteine proteases[6, 7] can degrade collagen which is associated with thinning of the fibrous cap and decreased lesion stability. Clinical consequences of complex lesion development typically arise when unstable lesions rupture resulting in cardiovascular and cerebrovascular events.  Although the conventional notion that atherosclerosis has dyslipidemia as its root cause, there is a large body of evidence that implicates inflammatory mechanisms in the pathogenesis of atherosclerosis. Inflammatory mediators are thought to be produced by endothelial cells and immune cells which may also help to ameliorate these pathways as well. In addition to macrophages, other critical players of the innate and acquired immune response such as T cells, B cells, dendritic cells, and mast cells are all present in lesion and play complex roles.[8-10] In a similar manner to macrophage-deficient mice, lymphocyte-deficient mice also exhibit reduced atherosclerosis.[11] The Th1 subtype generates many cytokines which can mediate local inflammation whereas Th2 cells produce cytokines that can reduce inflammation.  3  The appearance of antibodies specific for oxLDL systemically and locally also strongly implicates an adaptive immune response in atherogenesis.[12-14] Patients with cardiovascular disease have a higher oxLDL antibody titer than healthy people.[14] Specifically, LDL isolated from atherosclerotic lesions was shown to be tightly bound to IgG that recognized oxLDL.[15, 16] The T15 and E06 antibodies recognize oxidized phosphatidylcholine (oxPC) and have been found bound to oxLDL in the circulation and within the lesion.[17]  So far, over 300 variables have been shown to be associated with cardiovascular morbidity and mortality[18] whereas transgenic animal studies have disclosed over 100 genes involved in atherogenesis.[19] The genetic basis of atherosclerosis in both lesion and system has been summarized by Lusis, most of which are related to the overall lipid metabolism and inflammation locally and systemically.[19]  Atherosclerosis is frequently considered a fatal disease given the severity of the clinical consequences. However, there is much clinical evidence indicating that regression of the disease can occur.[20-22] Lipid lowering medications, lifestyle changes such as regular exercise, adherence to dietary guidelines, and cessation of smoking are the most established treatment strategies for atherosclerosis.  4 1.2  Proatherogenic properties of LDL and lipoprotein(a) Hyperlipidemia is believed to be one of the major causes of atherosclerosis. In the circulation, lipid is carried by lipoproteins, such as very low density lipoprotein (VLDL), LDL, high density lipoprotein (HDL), and lipoprotein (a) (Lp(a)). Elevated circulating LDL and Lp(a) are considered to be strongly atherogenic.  Typically, LDL is the dominant carrier of lipid and is primarily responsible for the delivery of cholesterol to peripheral tissues. However an excess of circulating LDL directly contributes to atherosclerosis through its increased deposition, retention, modification and ultimate uptake by tissue macrophages. Modified forms of LDL include oxidized LDL, glycated LDL, enzyme modified LDL, and aggregated LDL.[23] In the subendothelial space, LDL has been observed to have an elevated concentration compared to plasma and undergo oxidation.[16, 24-29] Endothelial cells are also able to modifiy LDL by increasing its net negative charge as reflected by changes in its electrophoretic mobility as well as a reduction in phosphatidylcholine and increased metabolism by macrophages.[30] The secreted products of macrophages are also able to oxidize and modify LDL.[31, 32] Modified LDL in turn can cause endothelial dysfunction, and promote foam cell formation.  Lp(a) is a LDL-like particle with apolipoprotein(a) protein covalently linked to apoB.[33] Apo(a) is synthesized by the liver, secreted in a free form and then linked to apoB to form Lp(a) in the circulation and thus Lp(a) is not simply a metabolite of other lipoproteins in the circulation.[34-36] The half life of Lp(a) in serum varied from 35 hours to 3.52  5 days[37, 38] and the tissue degradation sites[39] and rate are similar between Lp(a) and LDL.[40] VLDL receptors have been shown to mediate Lp(a) internalization in addition to the LDL receptor.[41] The circulating Lp(a) level appears to be determined primarily by the Lp(a) synthesis rate.[42]  Lp(a) has been shown in many studies to be a biomarker of cardiovascular disease.[43] Typically, Lp(a) is very low in healthy populations, however, in cardiovascular patients, Lp(a) may be elevated above 30mg/dL.[44, 45] Free apo(a),[46] apo(a) mRNA[47] and Lp(a) have been shown to accumulate in atherosclerotic lesions, co-localizing with apoB, foam cells and fibrin.[46] Also, after normalization for plasma concentration, apo(a) accumulates in twice the amount compared with apoB within atherosclerotic lesions.[48]  The specific physiological role of Lp(a) is still unknown. However, four possible mechanistic roles of Lp(a) related to cardiovascular disease have been proposed. Firstly, Lp(a) has been shown to have high affinity to intimal proteoglycans,[49] which could promote its retention and subsequent uptake by macrophages. Secondly, apo(a) structurally mimics plasminogen,[50] which may promote thrombosis.[51] However, one study showed a lack of an association between elevated Lp(a) level and thrombolysis.[52] Thirdly, Lp(a) has a lower capacity to bind LDL receptors possibly due to apo(a) masking some epitopes of apoB for the LDL receptor[53-55] or the facilitation of apoB degradation by apo(a),[56] and thus reducing its rate of degradation.[57] Finally, Lp(a) has been shown to induce reactive oxygen species generation in human monocytes.[58]   6 Lp(a) has 1.5-2-fold more Lp-PLA2 mass and 7-fold more Lp-PLA2 activity compared to LDL.[59, 60] However in patients with coronary artery disease (CAD), Lp(a) has a much reduced Lp-PLA2 mass and activity compared with LDL.[60] The majority of circulating oxidized phosphatidylcholine (oxPC) is bound to Lp(a).[61] The plasma oxPC/apoB ratio strongly predicts CAD independent of all the conventional risk factors except Lp(a).[43, 62] Unfortunately, statin treatment is not able to reduce circulating Lp(a) levels to any great extent.[63, 64] 1.3  Lipoprotein metabolism in the human macrophage Although macrophages play a variety of roles in atherogenesis, their ability to accumulate lipid has received the most attention. Macrophages have specific qualities that permit them to scavenge potential cellular toxins, including the catabolism of modified or excess lipoproteins within lesions. Several mechanisms have been identified that permit macrophages to take up lipoproteins including receptor mediated uptake, pinocytosis (fluid phase endocytosis), and phagocytosis (solid phase endocytosis). [65]  Pinocytosis may also be subclassified into micropinocytosis and macropinocytosis. Macropinocytosis is characterized by cell surface membrane ruffling and fusion facilitating the uptake of particles with a size range of 0.2-5 µm.[65] By contrast, micropinocytosis is characterized by the uptake of particles with a size less than 0.2 µm via clathrin-coated vesicles or small uncoated vesicles.[65] Phagocytosis is usually related to the uptake of larger sized particles in a zipper-like interaction between particles and the cell surface.[66] Macrophages have been observed to transform into foam cells  7 through the uptake of native LDL in cell culture by means of macropinocytosis after stimulation with either phorbol-12-myristate-13-acetate (PMA) and macrophage colony- stimulating factor.[67, 68] Specific molecules such as liver X receptor (LXR),[69] actin, protein kinase C, Rho and Phosphoinositide 3-kinases (PI-3K) have been reported to be involved in macropinocytosis.[70] oxLDL is also able to stimulate macropinocytosis by macrophages.[71]  One of the primary mechanisms by which macrophages take up lipoproteins is through cell surface receptors. The most studied scavenger receptors expressed by macrophages are CD36, SR-A[72, 73], and SR-BI[74] which are all expressed in lesional macrophages. Scavenger receptors in macrophages can recognize both modified lipid[75] and modified protein.[76] Specifically, oxPC is the ligand of CD36.[77, 78] However, the elimination of CD36 or SR-A did not ameliorate atherosclerosis in hyperlipidemic mice.[79] Native LDL and oxLDL increased CD36 expression as opposed to HDL, which reduced expression in macrophages.[80] Although lesional macrophages do not appear to express the LDL receptor,[81] the LDL receptor has been shown to mediate the metabolism of oxLDL by scavenger receptors in macrophages.[82] The VLDL receptor has also been detected in macrophage-derived foam cells in human atherosclerotic plaques[83] and foam cells from human lesions are able to take up beta-VLDL.[26]  It has been suggested that a large portion of LDL is in an aggregated form within a lesion.[84] This may be related to either its accumulation and/or oxidation status.[85] Macrophages take up aggregated LDL in an SR-A dependent pathway[86] as well as  8 through pinocytosis and phagocytosis.[87, 88] Macrophages may also take up immune- complexed LDL,[89-91] and proteoglycan bound LDL.[92, 93]  A variety of enzymes are able to modify LDL resulting in altered LDL metabolism by macrophages. Macrophages take up Group V secretory phospholipase A2 modified LDL in a SR-A and CD36 independent pathway involving cellular proteoglycans.[79] In addition, Group V secretory phospholipase A2 has been shown to promote LDL aggregation.[94] Phospholipase D-modified LDL is taken up by macrophages more readily compared to untreated LDL[95] and cholesterol oxidase treated LDL also increased macrophage uptake.[96] The combined effects of lipoxygenase and phospholipase A2 modifed LDL was associated with a more efficient degradation.[97] Additionally, platelet modified LDL induced macrophage cholesterol accumulation.[98]  Typically, native LDL is taken up by receptor-mediated endocytosis where the endosome ultimately fuses with a lysosome containing a variety of enzymes that will degrade LDL into its constituents, such as cholesterol, fatty acids, phospholipids, and protein. However, the lysosome has an incomplete ability to degrade oxLDL resulting in either a prolonged degradation process or oxLDL accumulation.[99-103] Aggregated LDL has also been shown to have compromised degradation compared with native LDL.[104] Lipids accumulated in the lysosomes of foam cells increase from 20% in fatty streak up to 70% in advanced atherosclerotic lesions.[105]   9 The accumulation of intracellular cholesterol normally leads to the promotion of cholesterol efflux (the first step of reverse cholesterol transport), so that cells will be protected against toxicity induced by excess cholesterol. Whole body reverse cholesterol transport will bring excess cholesterol back to liver for excretion because peripheral cells, unlike hepatocytes, are not able to catabolize sterol rings. Macrophage reverse cholesterol transport is specified as cholesterol removal from macrophages, which will have a direct effect on atherosclerosis regression.  In general, there are three types of cholesterol efflux that can be utilized by cells, passive diffusion, facilitated bi-directional efflux, and facilitated unidirectional efflux. Passive diffusion is determined by the net gradient of cholesterol content within peripheral membranes and an extracellular recipient. Such acceptors could include lipoproteins such as HDL or LDL but also proteins such as albumin[106] and globulins.[107] By contrast, SR-BI mediated bidirectional movement of cholesterol typically involves lipoproteins.[108, 109] Since SR-BI also plays an important role to take up cholesteryl ester from HDL and LDL, the net cholesterol equilibrium will depend on specific cell conditions. The cholesterol efflux facilitated by ABCA1 and ABCG1 is unidirectional. As one of the major components of HDL, apoAI is thought to have a critical role in allowing the efflux of excess cholesterol from peripheral tissues back to liver. The majority of ABCA1 is expressed by the liver and through its interaction with apoAI is largely responsible for newly synthesized HDL particles.[110] ABCA1 knock-out mice or patients with Tangier Disease (ABCA1 deficiency) have undetectable HDL levels.[111, 112] ABCA1 expressed by peripheral cells, particularly macrophages will  10 play an initial role to facilitate free cholesterol efflux, giving rise to pre-β HDL. In tandem with ABCA1, ABCG1 is thought to continue to promote efflux to spherical HDL particles.[113] Double knock-out ABCA1 and ABCG1 mice are associated with a reduction in cholesterol efflux by 60%-100%.[114, 115]  In contrast to ABCA1, ABCG1 has also been observed to be able to efflux 7- ketocholesterol, a cytotoxic oxysterol from cells.[116] ABCG5 and ABCG8 transporters are expressed by liver and responsible for the excretion of cholesterol, and plant sterols into bile.[117-119] Oxysterols derived from intracellular cholesterol metabolism is the agonist of LXR/retinoid X receptor (RXR), which will up regulate a set of genes including ABCA1, ABCG1, and apoE to facilitate cholesterol removal.[120, 121] 1.4  Lipoprotein metabolism in the hepatocyte The liver is the central organ responsible for systemic lipid metabolism as it generates and metabolizes the majority of circulating lipoproteins. Exogenous lipid derived from the diet represents the source for intestinally derived chylomicrons (CM), which are degraded by lipoprotein lipase producing CM remnants. Hepatocytes take up CM remnants primarily by the LDL receptor and the LDL receptor related protein (LRP).[122] The majority of circulating lipid in humans is derived from VLDL particles synthesized by hepatocytes. Hepatocytes also secrete a variety of apolipoproteins such as apoB, apoA1 and apo(a), all of which are critical components to ultimately generate LDL, HDL and Lp(a) in the circulation.   11 Besides generating lipids, hepatocytes also have a major role in metabolizing lipids. LDL, HDL, Lp(a) are metabolized by a variety of surface receptors including the LDL receptor, SR-BI, and a yet to be identified receptor for Lp(a). SR-BI mediates cholesteryl ester selective uptake from LDL[123]  and HDL. A portion of the recycled lipids will be reconstituted into VLDL or newly synthesized HDL which will enter the circulation. A portion of the recycled lipids will also be excreted in the form of bile acid.  Hepatocytes are also able to metabolize oxidized lipoproteins efficiently through CD36 and SR-BI receptors.[123, 124] Both non-parenchymal and parenchymal liver cells contribute to oxLDL uptake either through receptor-dependent or receptor-independent pathways.[125-127] As an example, 90% of injected oxLDL was cleared by mice within 5 min, most of which was recovered in the liver.[128] Similarly, the liver took up and degraded oxLp(a) through scavenger receptors in rats.[129] Hepatocytes have also been shown to have the ability of fluid-phase micropinocytosis.[130] However, in comparison, Kupffer cells and endothelial cells have higher pinocytotic ability than hepatocytes.[131] 1.5  The Phospholipase A2 family Phospholipase A2 (PLA2) enzymes hydrolyze the sn-2 ester bond of phospholipids into lysophospholipids (lysoPLs) and free fatty acids (free FAs). Dr. Edward Dennis has classified the PLA2 super family into 15 groups.[132] He has also suggested that there are five distinct types of PLA2 enzymes across these 15 groups, namely the secreted PLA2s (sPLA2), cytosolic PLA2s (cPLA2), the Ca2+ independent PLA2s (iPLA2), the platelet- activating factor acetylhydrolases (PAF-AH), and the lysosomal PLA2s (LPLA2).[132]  12 Considering the close relationship between Lp-PLA2 (also named plasma PAF-AH) and other members of the PAF-AH family, the description of these enzymes is found in Table 1.1. Table 1.1 PAF-AH family Group Alternate name Source Major functions VIIA Lp-PLA2, Plasma PAF- AH Human murine, procine, bovine Plasma Hydrolyze PAF and oxPC with short sn-2 chain in plasma, giving rise to lysoPC and short oxFAs. VIIB PAF-AH II Human, bovine Liver, kidney VIIIA PAF-AH Ib α1 Human Brain VIIIB PAF-AH Ib α2 Human Brain 1.6  Lp-PLA2 1.6.1  Physical properties of Lp-PLA2 The gene corresponding to the Lp-PLA2 protein (PLA2G7) is localized on chromosome 6p12-21.1, and comprises 12 exons.[133] Seven mutations crossing the entire PLA2G7 gene have been described which potentially affect Lp-PLA2 secretion, catalytic ability, and binding to lipoproteins. (Figure 1.1) The influences of the mutated Lp-PLA2 will be reviewed later in this thesis. Lp-PLA2 is a 45.4 kDa protein with 441 amino acids.[134] N-linked glycosylation of Lp-PLA2 determines its association to HDL, without affecting its catalytic ability and association with LDL.[135] The crystal structure of Lp-PLA2 was just recently solved and contains elements that place it the lipase family including an alpha/beta-hydrolase fold and catalytic triad. Two clusters of hydrophobic residues and an acidic patch of 10 carboxylate residues characterized in this study shed light on how  13 this enzyme binds to lipoproteins and the different enzyme binding pattern between HDL and LDL [136]  Figure 1.1 Mutation sites in the human PLA2G7 gene. Modified from [137] Lp-PLA2 is mainly secreted by monocytes, macrophages, and hepatocytes,[138] and is co-localized with VLDL,[139] LDL, HDL, and Lp(a) in the circulation. Lp-PLA2 activity was observed to increase by 260-fold during monocyte differentiation to macrophages with a 90% reduction in the concentration of intracellular PAF.[140] It is believed that the majority of plasma Lp-PLA2 originates from hematopoietic stem cell derived cells, but not hepatocytes, as subjects who received a bone marrow transplantation from Lp- PLA2 deficient donors did not display Lp-PLA2 activity following the transplant.[141] HepG2 cells secrete Lp-PLA2 associated with lipoproteins with the same density as HDL.[138] In the rat liver, there is no Lp-PLA2 mRNA detected, except when stimulated by LPS.[142] Although hepatocytes do not appear to be a major source of plasma-derived Lp-PLA2, they do appear to be the major source of Lp-PLA2 in bile.[142, 143] Dendritic  14 cells which may be derived from monocytes, secrete little Lp-PLA2 compared with macrophages.[144] There appear to be two types of Lp-PLA2 in terms of their association status with lipoproteins, one of which is dissociable and another one that is non- dissociable.[145]  Although there is not a great deal known about the regulation of Lp-PLA2 synthesis, some reports have identified a role for selected molecules. In mice, PAF stimulated Lp- PLA2 secretion from macrophages,[146] however, PAF decreased Lp-PLA2 secretion from decidual macrophages in humans.[147] By contrast, PAF stimulates Lp-PLA2 secretion in HepG2 cells.[148] Estrogens reduce Lp-PLA2 activity in plasma,[138] and decrease Lp-PLA2 secretion by HepG2 cells.[149] HDL reduces Lp-PLA2 production from HepG2[150] whereas Lp-PLA2 mRNA and protein was increased by LPS, IL-1β, GM-CSF, TNF-α, and advanced glycated end products (AGE) in peripheral blood mononuclear cells from the pig.[151] Lp-PLA2 synthesis by human monocyte derived macrophages was inhibited by IFNγ and LPS, whereas IFNα, IL1a, IL4, IL6, TNF-α, M- CSF and GM-CSF had little effect.[152] Lp-PLA2 pretreatment inhibited the production of tumor necrosis factor, interleukin 8, prostaglandin E2, and procoagulant in rabbit alveolar macrophages followed by LPS challenge, through NF-κβ.[153] Post-treatment of PAF-AH also inhibited TNF production. Thus, PAF could be the mediator for the generation of those inflammatory mediators in LPS stimulated macrophages.[153] LPS stimulates Lp-PLA2 transcriptional expression through p38 MAPK pathway in RAW264.7 and THP-1 macrophages.[154] 15-deoxy-prostaglandin J2 and pioglitazone, two kinds of ligands of peroxisome proliferators-activated receptor gamma (PPARγ)  15 stimulate Lp-PLA2 mRNA expression in THP-1 cells, whereas the PPAR inhibitor prostaglandin F2α abolished the upregulation.[155]  Approximately two-thirds of Lp-PLA2 resides on LDL, with the other one-third associates with HDL.[156] Structurally, Lp-PLA2 (tyrosine 205, residues 115 and 116) binds to the C-terminal end of apoB on LDL.[157] By contrast, it appears that C-terminal residues of Lp-PLA2 are important for determining its affinity for HDL.[158] Lp-PLA2 is able to transfer from LDL to HDL at pH of 6, and transfer back when the pH is 9.[159] Patients with either abetalipoproteinemia or Tangier disease have normal or even little higher Lp-PLA2 levels in the circulation reported by Stafforini’s group.[160] Dr. Prichard’s group found patients with Tangier disease had 3.3 fold more Lp-PLA2 activity compared to controls.[161] In the case of abetalipoproteinemia all the plasma Lp-PLA2 resides on HDL whereas in Tangier disease all of the Lp-PLA2 is associated with LDL.[160] Subsequently, it has been described that a significant proportion of Lp-PLA2 binds to small dense or negatively charged LDL and larger sized HDL particles.[162] More recently, Lp-PLA2 has been found to bind to Lp(a) with 7-fold more activity and 2- fold more mass than it does on LDL suggesting that when present, Lp(a) may be a major carrier of Lp-PLA2.  Lp-PLA2 accumulates within human atherosclerotic lesions, especially in the necrotic core and co-localizes with apoptotic cells and macrophages in the shoulder region of the plaque.[163] Also, PLA2G7 mRNA was detected in plaque macrophages in both humans and rabbits.[73]  16  In dyslipidemic subjects, atorvastatin reduced LDL Lp-PLA2 levels dependently from changes in LDL cholesterol.[164, 165] However, simvastatin and atorvastatin treatment did not affect or even somewhat increased Lp-PLA2 secretion by human monocyte- derived macrophages.[164-166] Lp-PLA2 activity was higher in LDL in hypercholesterolimic subjects compared to normal subjects, however HDL associated Lp- PLA2 activity was similar among the two groups.[165] Patients with stable angina presented higher plasma copper oxLDL antibody titer than healthy people. The antibody titer from oxLDL pretreated with Lp-PLA2 inhibitor prior to copper oxidation was higher than the antibody titer from non-inhibitor-treated oxLDL in both healthy and angina patients.[167] 1.6.2  Biochemical properties of Lp-PLA2 The physiological role of Lp-PLA2 identified so far is to hydrolyze platelet activating factor and phosphotidylcholine with short sn-2 chain including oxidized phosphotidylcholine,[168] giving rise to lysophosphatidylcholine (lysoPC) and fatty acid. (Figure 1.2) This catalytic activity may positively or negatively contribute to certain diseases, such as cardiovascular disease, asthma, and sepsis, likely due to the variety of pathological properties of both substrate and catalytic products of Lp-PLA2 in different disease settings.  17  Figure 1.2 Catalytic reaction of Lp-PLA2 Modified from [169] Lp-PLA2 has a GXSXG motif, which is conserved in most of the lipases and esterases. A catalytic triad formed by Ser-273, Asp-296 and His-351, is the catalytic machinery for Lp-PLA2.[134] The absence of 54 amino acids of N-terminal and 21 amino acids of C- terminal regions of Lp-PLA2 are associated with a loss of catalytic activity.[134] The Lp- PLA2 enzyme accesses substrates from aqueous phase and exerts its full hydrolytic ability independently of whether the enzyme is bound to lipoproteins,[170] although it is a hydrophobic enzyme.[156, 171] There is no precise minimal substrate requirement. Generally speaking, the substrate of Lp-PLA2 is to have relatively short sn-2 ester and a hydrophobic sn-1 chain. The composition of the sn-3 chain does not appear to be critical. In regards to substrate preference, a longer sn-2 chain could be tolerated by a shortened sn-1 chain.[172] In contrast to other PLA2 enzymes, calcium is not required for Lp-PLA2 hydrolysis.[156] Besides its acetylhydrolase property, Lp-PLA2 also exhibits transacetylation activity and PLA1 activity.[172, 173] The inhibitors of Lp-PLA2  18 identified so far include serine esterase inhibitors such as diisopropylfluorophosphate and Pefabloc,[159, 174] and SB-222657,[175, 176] SB-677116,[177] SB-480848,[178] and Darapladib (i.e. SB-480848).[179, 180]  Oxidation will damage Lp-PLA2 activity.[181] Specifically, peroxynitrite oxidation dissociates Lp-PLA2 from LDL and inactivates the free form.[182] Lp-PLA2 does not prevent lipid peroxidation of LDL, but protects apoB against modification by degrading oxPC.[181, 183] However, purified Lp-PLA2 inhibited LDL oxidation evaluated by agarose gel electrophoresis.[181]  Paraoxonase 1 (PON1) and lecithin-cholesterol acyltransferase (LCAT) were shown to have Lp-PLA2 activity.[184-186] However, Kriska T et al suggested that the PAF-AH activity on PON1 reported before is due to the contaminating Lp-PLA2 during PON1 purification.[187] The Lp-PLA2 activity on plasma LCAT only presents in the state of oxidative stress, by which LCAT loses the cholesterol esterification activity, and only PLA2 activity remains.[188] 1.6.3  Substrates of Lp-PLA2 1.6.3.1 Platelet-activating factor PAF is a type of phospholipid, 1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine with diverse and potent biological activities. PAF is secreted by endothelial cells and a variety of leucocytes such as monocytes/macrophages, neutrophils, eosinophils, basophiles, and platelets.[169] PAF can be taken up in receptor-dependent and independent pathways.[146, 189, 190] PAF receptors are expressed by a variety of cells such as  19 smooth muscle cells, cardiomyocytes, neutrophils, monocytes/macrophages, eosinophils, endothelial cells and kupffer cells[191] The diverse roles that PAF plays include stimulating contraction of smooth muscle and myocytes, promoting oxygen species generation, promoting platelet aggregation, and increasing leukocyte adherence to endothelial cells[191]. PAF can effectively be hydrolyzed by PAF-acetylhydrolyse into lysoPAF and unesterized fatty acid, which can reduce some of the inflammatory effects of PAF.[191] 1.6.3.2  Oxidized phospholipids Oxidized phospholipids are present in plasma and atherosclerotic lesions in cardiovascular patients.[192-194] It has been known for some time that the majority of plasma oxidized phospholipids resides on HDL.[195] Recently, Lp(a) has also been recognized as a dominant carrier of circulating oxidized phospholipids.[61] The ratio of oxidized phospholipid to apoB has been reported to be a very promising risk marker of cardiovascular disease.[43] Oxidized phospholipids are thought to be involved in direct causative roles in atherogenesis. For instance, oxidized phospholipids stimulate endothelial cells to bind leukocytes,[196, 197] especially monocytes.[198] Oxidized phospholipids upregulate cytokine and chemokine expression by a variety of cell types.[199-205] Also, oxidized phospholipids have been shown to switch endothelial cells to a procoagulant status[206-208] and induce reactive oxidative species (ROS) generation.[209, 210] The receptors of oxidized phospholipid include PAF receptors[211, 212] if its sn-2 chain is relatively short whereas G-protein-linked receptors,[213] PPARs,[214, 215] CD36[78, 216] can also be activated by oxidized phospholipids. Signaling pathways that have been associated with oxidized phospholipid function  20 include cAMP,[217] early growth response factor (EGR),[206] signal transducer and activator of transcription 3 (STAT3) and sterol regulatory element binding protein (SREBP).[7, 218] However there is little information about the composition of the sn-2 chain of oxidized phospholipid found in the circulation, which is critical for considering if Lp-PLA2 is able to degrade them.  Interestingly, oxidized phospholipids have also been shown to have a strong anti- inflammatory role against endotoxin by inhibiting LPS binding to LPS binding proteins and CD14.[219] This might provide new insight into the pathophysiological roles of oxidized phospholipid. 1.6.4  Products of Lp-PLA2 1.6.4.1 LysoPC LysoPC can be generated by LCAT and a variety of phospholipases including Lp-PLA2. LysoPC has a very high concentration in the circulation of approximately 150 µM[220], three-fifths of which is bound to albumin and the remaining two-fifths is associated with lipoproteins.[221] LysoPC is found at a 34-fold higher concentration in human aorta atherosclerotic lesions than normal aorta.[222] Thus far, there do not appear to be studies which assess the contribution of Lp-PLA2 to the generation of lysoPC in the circulation and atherosclerotic lesions. LysoPC has been purported to play a variety of proatherogenic roles by increasing chemotaxis, generating reactive oxygen species, stimulating inflammatory cytokine and chemokine secretion, inducing cell proliferation in vascular smooth muscle cells and apoptosis in macrophages, T-cells, endothelial cells and even smooth muscle cells in vasculature. (Recently reviewed by Matsumoto T et  21 al.[223]) The receptor(s) for lysoPC are still not clearly defined. But certain pathways are associated with lysoPC action, such as protein kinase C,[224] MAP kinase,[225] phosphatidylinositol 3-kinase,[226] and RhoA.[227] The role that lysoPC plays in lipid metabolism will be reviewed later in this thesis. 1.6.4.2  Oxidized fatty acids OxFAs are also generated by Lp-PLA2. However the characterization of these fatty acids is yet to be reported. A single study showed that oxFAs generated by Lp-PLA2 increased monocyte chemoattractant activity.[175] However, little is known about how oxFAs enter cells, are metabolized and which metabolic pathways may be affected. 1.6.4.3  F2-isoprostanes F2-isoprostanes are produced from arachidonic acid in phospholipids non- enzymatically.[228] The measurement of free isoprostanes in biological fluid is a commonly used method for assessment of oxidant stress in vivo.[229] The mechanism by which isoprostanes are released from oxidized membrane phospholipids is largely unknown. It has been reported by Stafforini and colleagues that Lp-PLA2 is able to release F2-isoprostanes from esterified phospholipids.[230] Lp-PLA2 has been shown to have a high affinity but much lower catalytic rate to produce F2-isoprostanes compared with other substrates such as PAF or POVPC.[230] F2-isoprostanes are also present within human atherosclerotic lesions.[192, 231] 1.6.5  Clinical studies of Lp-PLA2 An increasing number of clinical studies show that Lp-PLA2 is a biomarker for predicting cardiovascular and cerebrovascular diseases in a variety of populations, independent of  22 conventional risk factors and hs-CRP (Table 1.2 and Table 1.3).[232] This raises a question as to whether Lp-PLA2 is a direct causative factor for cardiovascular disease or simply an indirect marker. Since both the substrates and products of the Lp-PLA2 reaction have been attributed pro-atherogenic qualities, it remains a complex issue to resolve. Furthermore, the net effect of Lp-PLA2 in humans may vary depending on the specific disease stage.  To better address whether Lp-PLA2 is a causal factor or not, an inhibitor of Lp-PLA2 was developed and tested clinically. The recent clinical trial on darapladib shows that Lp- PLA2 may have direct causative effects on the development of atherosclerosis.[179] 1.6.5.1  Collection of studies indicating Lp-PLA2 is biomarker of cardiovascular and cerebrovascular diseases So far, about 40 clinical studies showed that elevated level of plasma Lp-PLA2 is associated with a variety of cardiovascular and cerebrovascular risks in different populations. Table 1.2 Collection of studies indicating Lp-PLA2 is biomarker of cardiovascular and cerebrovascular diseases Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Caslake MJ et al [233] 2000 Lp-PLA2 mass Male with CAD and Post MI, and healthy control 94/54 1.16 Packard CJ et. al [234] 2000 Lp-PLA2 mass Men with a coronary event, and control 580/1160 1.67  23 Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Blanken berg S et al [235] 2003 Lp-PLA2 activity Patients with stable angina pectoris and acute coronary syndrome, and control 496/477 1.19-1.30 1.8 Ballanty ne CM et al [236] 2004 CAD Healthy middle-aged men and women  12,819 2.08, when LDL-C below 130 mg/dL. Koenig W et al [237] 2004 CAD Healthy middle-aged men 934  1.23 Iribarren C et al [238] 2005 Lp-PLA2 mass Patients with calcified coronary plaque, and control 266/266  1.28 Brilakis ES et al [239] 2005 CAD events Patients undergoing angiography 504  1.28 Winkler k ea al [240] 2005 CAD Patients with angiographic CAD, and control 2454/694  1.25 Khusevi nova N et al [241] 2005 Lp-PLA2 mass Patients with CAD, and control 312/479  1.91 Ballanty ne CM et al [242] 2005 Ischemic stroke Healthy middle-aged men and women 12762  1.9 Oei HHS et al [243] 2005 Lp-PLA2 activity Patients with CAD and ischemic stroke, and control 308/110/1 820 1.39-1.97 for CAD, 1.08-1.97 for stroke Yang EH et al [244] 2006 Coronary endothelial dysfunction Patients with no significant CAD 172  3.3   24 Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio O’Dono ghue M et al [245] 2006 Recurrent CV events Patients after acute coronary syndromes 3648  1.33 Koenig W et al[246] 2006 Recurrent cardiovascular events Patients with CAD 1051 1.81 for activity, 2.09 for mass Corsetti JP et al [247] 2006 Recurrent coronary event Postinfarction patients 766  1.9 Gerber Y et al [248] 2006 Mortality after myocardial infarction Patients experienced MI 271  5.35 Van vark LC et al [249] 2006 Incident heart failure Random elderly subjects 1820  2.2 Elkind MS et al [250] 2006 Recurrent ischemic stroke Patients with first ischemic stroke 467  2.08 May HT et al [251] 2006 CAD, and CAD death Patients undergone coronary angiography 1493 2.44 for CAD, 1.73 for CAD death Persson M et al [252] 2007 ultrasound determined carotid intima-media thickness men and women aged 45–69 years 5402 Lavi S et al [253] 2007 Endothelial dysfunction Patients with mild coronary atherosclerosis, and controls 15/15 Kiechl S et al [43] 2007 CV events 40-79-year old men and women 765 Persson M et al[254] 2007 CAD event Subjects without CAD 4480  1.54  25 Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Winkler K et al [255] 2007 5-year cardiac mortality Patients with or without angiographically confirmed CAD 2513/719  2 Mockel M et al [256] 2007 Early risk stratification Patients with suspected acute coronary syndrome 429  2.6-3.9 Sabatine MS et al [257] 2007 CV events Patients with stable CAD 3766  1.41 Wassert heil- Smoller S et al [258] 2008 Incident ischemic stroke Stroke patients, and controls 929/935 1.55  in nonusers of hormone therapy Daniels LB et al [259] 2008 CAD Community-dwelling people without known CAD 1077  1.89 Robins SJ et al [260] 2008 CV events Men with low HDL-C and LDL-C 1451  1.17 Raichlin E et al [261] 2008 CV events Cardiac transplant recipients 112 2.4 Serruys PW et al [179] 2008 Necrotic core volume Patients with angiographic CAD 330 Kim JY et al [262] 2008 CAD Patients with angiographic CAD, and controls 799/925  2.47 Gerber Y et al [263] 2008  Community residence 646  1.57 Raichlin e. et al [261] 2008 Progression of cardiac allograft vasculopathy, and incidence of CV events Heart transplant recipients 112  2.4  26 Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Kim JY et al[262] 2008 Lp-PLA2 activity level Patients with angiographically confirmed CAD 799/925  2.47 Gerber Y et al[264] 2009 Mortality Patients with heart failure 646  1.57 Brilakis ES et al[265] 2008 Coronary artery calcium population-based probability participants 2171  1.2 in men Elkind MS et al[266] 2009 Stroke recurrence First ischemic stroke patients 467  2.54 Tsimikas S et al[267] 2009 metabolic syndrome, incident fatal and non-fatal CVD Participants at age 45-84 765  2.9 1.6.5.2  Collection of studies showing Lp-PLA2 was not associated with cardiovascular and cerebrovascular diseases Seven clinical studies so far did not find the association between Lp-PLA2 level and CV diseases after adjusted by conventional risk factors. Table 1.3 Collection of studies showing Lp-PLA2 was not associated with cardiovascular and cerebrovascular diseases Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Blake GJ et al [268] 2000 Future cardiovascular risk Healthy middle aged women 28,263  1.17 Kiortsis DN et al [269] 2005 Carotid intima media thickness Patients with primary hyperlipidemia, and controls 100/67  27 Study Year Lp-PLA2 level or CV End Point Population Cases/ Controls Relative Risk Hazard/ Odds Ratio Kardys I et al [270] 2006 Extracoronary atherosclerosis (carotid intima- media thickness, carotid plaques, ankle-arm index, and aortic calcification) Random participants from the Rotterdam Study (elderly people) 1820  0.86-1.15 Allison MA et al [271] 2007 Cardiovascular desease and CAD death Patients experienced noninvasive lower extremity arterial test 508  1.12 Kardys I et al [272] 2007 Coronary calcification Young adults 520  0.8-1.1 Oldgren J et al [273] 2007 Future CV events Patients with acute coronary syndromes, and healthy controls 2266/435  1.1-1.3 Persson M et al [274] 2008 CV (CAD and stroke) Participants at age 45-69 5393 1.48 for activity, 0.95 for mass  1.6.5.3  Lp-PLA2 and other diseases Lp-PLA2 has been found to be associated with a variety of diseases. In a review by Karasawa,[275] low levels of Lp-PLA2 have been observed in asthma, systemic lupus erythematosus, juvenile rheumatoid arthritis, post injury multiple organ failure, sepsis and Crohn’s disease. By contrast, higher Lp-PLA2 levels were identified in many cardiovascular and cerebrovascular diseases, diabetes, chronic cholestasis, rheumatoid arthritis, essential hypertension, habitual cigarette smokers, and peripheral vascular disease.  28 1.6.5.4  Genetic polymorphism of Lp-PLA2 in populations So far, seven mutation sites on the PLA2G7 gene have been identified in a number of ethnic groups (Table 1.4). All of these could potentially affect Lp-PLA2 secretion, binding to lipoproteins, or its catalytic ability. Regarding the relationship with cardiovascular disease, several reports show that the Val279->Phe mutation is positively associated with cardiovascular disease; however others report no difference or negative association. This could be due to the differences among ethnic backgrounds as well as different disease settings and outcomes being studied. Table 1.4 Clinical studies about Lp-PLA2 genetic polymorphism Study Year Mutation site Population Cases/ Controls Associated clinical events Yamada Y et al [276] 1997 Gln281->Arg Japanese, CV patients and controls 985/477 Loss of function of enzyme Hiramot o M et al [277] 1997 Val279->Phe Japanese, patients with cerebral thrombosis and controls 120/134 stroke Yamada Y et al [278] 1998 Val279->Phe Japanese, patients with MI and controls 454/602 MI in male Yoshida H et al [279] 1998 Val279->Phe Japanese, patients with essential hypertension, brain hemorrhage and control 138/99/ 270 Brain hemorrhage Ichihara S et al [280] 1998 Val279->Phe Japanese, patients with familial dilated cardiomyopathy and control 122/226 dilated cardiomyopathy (Left ventricular mass and index) Yamada Y et al [281] 2000 Val279->Phe Japanese, patients with MI, stroke or atherosclerosis risk factors, and controls 850/1398 /1684 MI, stroke and atherosclerosis  29 Study Year Mutation site Population Cases/ Controls Associated clinical events Unno N et al [282] 2000 Val279->Phe Japanese, patients with atherosclerotic occlusive disease and controls 104/114 Stroke and ischemic heart disease Yamada Y et al [283] 2001 Val279->Phe Japanese, patients with nonfamilial hypertrophic cardiomyopathy  and healthy controls 142/284 Exacerbated cardiac damage Unno N et al [284] 2002 Val279->Phe Japanese, patients with abdominal aortic aneurysm and controls 131/106 abdominal aortic aneurysm Abuzeid AM et al [285] 2003 Ala379->Val European, post-MI men and controls 527/566 Less MI events Shimok ata D et al [286] 2004 Val279->Phe Japanese, patients with CAD and controls 3085/216 3 CAD in men with hypercholesterolemia Ninio E et al [287] 2004 Ala379->Val Japanese, patients with CAD and healthy controls 1314/485 Less CAD frequency, and less CV events Ishihara M et al [288] 2004 InsA191, and I317N Japanese 2 Half Lp-PLA2 secretion of and failed Lp-PLA2 secretion. Campo S et al [289] 2004 Arg92His, Ile198Thr, Ala379->Val Sicilian, hypercholesterolemic patients 190 No association with intima media wall thickness Zhang X et al [290] 2005 Val279->Phe Chinese, patients with atherosclerotic cerebral infarction, lacunar infarction, and cerebral embolism, and normal controls 108/215 Atherosclerotic cerebral infarction, but not for lacunar infarction Liu PY et al [291] 2006 Ala379->Val Chinese, patients with premature MI, and controls 200/200 Premature MI Wang B et al [166] 2006 Val279->Phe Chinese, patients with dilated cardiomyopathy and healthy controls 89/110 No association   30 Study Year Mutation site Population Cases/ Controls Associated clinical events Sekuri C ea al [292] 2006 Val279->Phe Turkish, patient with premature CAD and controls 115/128 No association with CAD Jang Y et al [293] 2006 Val279->Phe, Ala379->Val Korean, patients with CAD and controls 532/670 F279 showed less CAD risk in men Campo S et al [294] 2008 Arg92His, Ile198Thr, Ala379Val Sicilian, octogenarian and healthy controls 100/200 No association with age Hou L et tal[295] 2009 V279F and I198T Han Chinese, CAD patients, MI patients, and controls 827/512 /947 Reduced Lp-PLA2 activity, but no association with CAD Hou L et tal[295] 2009 the promoter rs13210554 polymorphism Han Chinese, CAD patients, MI patients, and controls 827/512 /947 MI 1.6.6  Animal studies about Lp-PLA2 Because of the ease of manipulating Lp-PLA2 expression, animal studies may provide more insights on the specific pathophysiological roles of Lp-PLA2. The tables below (Table 1.5 and Table 1.6) show majority of the published animal studies on Lp-PLA2 thus far and include a variety of animal species, including mouse, rabbit, and swine.  Table 1.5 Collection of animal studies suggesting Lp-PLA2 is anti-atherogenic Study Year Animal type Approach Observation Morgan EN et al [296] 1999 New Zealand white rabbits Recombinant human PAF- AH protein Reduced necrotic core, greater wall thickness Theilmeier G et al [297] 2000 ApoE -/- mice Adenovial gene transfer of human PAF-AH Reduced macrophage adhesion, macrophage homing  31 Study Year Animal type Approach Observation Quarck R et al [298] 2001 ApoE -/- mice Adenovirus directing liver- specific expression of human PAF-AH; injury induced after PAF-AH overexpression Reduced oxidized lipoprotein, macrophages, SMC in arterial wall; reduced neointimal area; reduced atherosclerotic lesions Hase M et al [299] 2002 ApoE -/- mice Human PAF-AH cDNA was introduced into skeletal muscle Reduced thickness of aortic wall Turunen P et al [15] 2004 Rabbits Injection of adenovirus encoding human Lp-PLA2 OxLDL with overexpressed Lp-PLA2 decreased degradation in RAW 264 macrophages; decreased foam cell formation. Turunen P et al [300] 2005 New Zealand white rabbits Balloon-denuded, then intra-arterial gene transfer of human Lp-PLA2 Reduced intima/media radio; reduced apoptosis in vessels Arakawa H et al [275] 2005 Rabbits Balloon-injured rabbit carotid arteries were infected at the time of jury with adenovirus expression human PAF-AH Reduced shear stress induced thrombosis; reduced intimal area and intima/media ratio; reduced oxLDL accumulation;  Table 1.6 Animal study suggesting Lp-PLA2 is pro-atherogenic Study Year Animal type Approach Observation Wilensky RL et al [180] 2008 Diabetic and hypercholester olemic swine Lp-PLA2 inhibitor Darapladib Decreased plaque area; reduced necrotic core area; fewer lesion with an unstable phenotype 1.6.7  The role of Lp-PLA2 in lipid metabolism 1.6.7.1  Lp-PLA2 and lipid metabolism Given that dyslipidemia is one of the primary causes of atherogenesis and that Lp-PLA2 is associated with lipoproteins, Lp-PLA2 may have an important role in lipid metabolism.  32 RAW 264 macrophages had lesser degradation of Lp-PLA2-enriched LDL isolated from rabbits that were transfected with Lp-PLA2 adenovirus and lesser degree of foam cell formation.[15] Mouse peritoneal macrophages had higher oxidized diisopropylfluorophosphate-treated LDL degradation. (diisopropylfluorophosphate is serine esterase inhibitor).[301] HDL from Lp-PLA2 transfected mice inhibited foam cell formation through enhancing cholesterol efflux.[302] LDL from PAF-AH deficient patients was more readily oxidized and able to induce adhesion molecule expression compared with LDL from normal subjects.[303] Inhibition of PLA2 activity in LDL by p- bromophenacyl bromide resulted in endothelial cell modified LDL being degraded to a greater degree by macrophages.[304] However, these studies did not provide a clear conclusion on whether Lp-PLA2 induces or ameliorates human monocyte derived foam cell formation. 1.6.7.2  LysoPC and lipid metabolism As one of the catalytic products of Lp-PLA2, besides the proinflammatory role, lysoPC has shown to mediate lipid metabolism as well. First, apoAI complexed with lysoPC promoted release of cellular cholesterol from human skin fibroblasts.[305] Also, lysoPC increased cholesterol efflux in mouse peritoneal macrophages in a apoE-dependent manner.[306] Subsequently, the PPARγ-LXRα-ABCA1 pathway was identified which may mediate the lysoPC-induced increase in cholesterol efflux.[307] It has also been suggested that lysoPC mediates PON-1 enhanced cholesterol efflux.[308]  Additionally, lysoPC facilitates association of plasma LDL with vascular tissue.[309] LysoPC increased oxLDL uptake by endothelial cells, smooth muscle cells and T cells  33 through the LOX-1 receptor.[310-312] LysoPC has also been shown to regulate proteoglycan synthesis, and thus could influence the retention and modification of LDL.[313, 314] Interestingly, lysoPC has also been shown to increase monocyte binding to matrix by altering matrix in a heparanase-like manner.[315] Also, lysoPC was shown to increase apoB secretion by HepG2 cells, accompanied by increased triglyceride and phospholipid synthesis and secretion.[316] Taken together, lysoPC can influence both cholesterol efflux and uptake. The specific physiological role of how lysoPC may influence cholesterol homeostasis requires further study. 1.7  Rationale A large number of clinical studies have shown that Lp-PLA2 is a biomarker for cardiovascular disease. However, it is unclear if this association represents either a direct causative link to disease or rather represents an indirect association. Since the catalytic substrate and products of this reaction can be considered proatherogenic, the issue remains complex. Very recent reports[179, 180] of studies using a specific inhibitor of Lp-PLA2 suggest there may be a direct mechanistic link to the development of atherosclerosis.  The complexity of both the substrates and products of Lp-PLA2 in proinflammatory settings has drawn most of the research attention. However, considering the close relationship between Lp-PLA2 and lipids, it is emerging an important question if Lp-PLA2 will affect the metabolism of lipids, which in turn could affect Lp-PLA2 expression in cells.   34 In the present series of studies described within this thesis, we first investigated if oxidized lipids will affect Lp-PLA2 expression. Then we investigated the potential role that Lp-PLA2 may play in lipid metabolism in macrophages and hepatocytes, two key cell types which can have a significant impact on the development of atherosclerosis. 1.8  Hypotheses 1. Treatment with oxidized lipids will influence the expression of Lp-PLA2 in macrophages and hepatocytes.  2. Manipulating Lp-PLA2 expression either endogenously or exogenously in macrophages and hepatocytes will alter oxidized LDL and oxidized Lp(a) cellular association and cholesterol efflux.  3. Lp-PLA2 may affect oxidized LDL and oxidized Lp(a) cellular association through both catalytic and non-catalytic functions. 1.9  Main objectives 1. To investigate if the constituents of oxidized lipoprotein will alter Lp-PLA2 expression in human monocyte-derived macrophages and HepG2 cells.  2. To construct Lp-PLA2 Gain-of-Function and Loss-of-Function lentivirus for the purpose of transducing THP-1 cells, and then investigate the effect of endogenous Lp- PLA2 to the cellular association of oxidized lipoprotein and cholesterol efflux.  35  3. To purify two forms of human recombinant Lp-PLA2 proteins, a wild type form and a mutated catalytically inactive form, and then investigate the effect of exogenous Lp-PLA2 to the cellular association of oxLDL/oxLp(a) in human monocyte-derived macrophages and HepG2 cells.  4. To investigate the effect of inhibiting endogenous Lp-PLA2 to the cellular association of oxLDL/oxLp(a) in human monocyte-derived macrophages and HepG2 cells.   36 2  Methods 2.1  Cell culture 2.1.1  Primary human macrophages Human primary peripheral CD14+ monocytes were purchased from Stem Cell Technologies (Vancouver, BC). Alternatively, human primary blood mononuclear cells were isolated from the peripheral blood of healthy volunteers using LymphoPrep® tubes according to the manufacturer’s protocol in our lab. CD14 positive monocytes were isolated using CD14 magnetic microbeads (Miltenyi Biotec) and an AutoMACS instrument. Monocytes (150,000) were seeded in each well of a 48-well plate in the presence of RPMI medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (Invitrogen), 1 mM sodium pyruvate, 1.5% sodium bicarbonate and 10ng/mL M-CSF at 37°C, 95% air and 5% CO2. Cell culture medium was changed every 4 days. At day 8, macrophages were ready for functional assays. For some functional assays, cells were kept in lipoprotein deficient serum (Biomedical Technologies, Inc.) medium for designated period for the purpose of avoiding Lp-PLA2 present in serum. 2.1.2  HepG2 cells HepG2 cells (American Type Culture Collection, catalogue no. HB-8065) were cultured in DMEM supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (Invitrogen). HepG2 cells (150,000) were seeded in each well of a 48-well plate and functional assays were performed after 2 days of culture.  37 2.1.3  THP-1 cells THP-1 monocytes (American Type Culture Collection) were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (Invitrogen), 1 mM sodium pyruvate, and 1.5% sodium bicarbonate at 37°C, 95% air and 5% CO2, and used within 20 passages for experiments. Phorbol 12-myristate 13-acetate (PMA, P8139, Sigma Aldrich) was added at a final concentration of 100 nM for 48 hours to differentiate THP-1 monocytes into macrophages. THP-1 macrophages were used after a minimum of 48 hours after PMA stimulation. 2.2  Lipoprotein preparation 2.2.1  LDL isolation from plasma Purified human LDL was either purchased from Biomedical Technologies Inc. or isolated from pooled human plasma.  VLDL (density below 1.019 g/mL) was first removed from plasma after ultracentrifugation in NaBr buffer (1mM EDTA) using a Beckman, rotor 50.2, 50,000rpm, 24 hours, 8°C. The LDL fraction (density 1.019-1.063 g/mL) was then isolated after a 24 hour spin at 50,000 rpm. 2.2.2  Lp(a) Lp(a) was gift from Dr. Angelo Scanu’s lab in the University of Chicago.[317, 318] Briefly, human plasma was collected from the Lipid Clinic at the University of Chicago. After ultracentrifugation at 20°C for 24 h, the top fraction which included Lp(a) was then passed through a lysine-Sepharose affinity chromatography column. The absorbed fraction was Lp(a), as opposed to the non-absorbing fraction, which was LDL.  38 2.2.3  Dialysis LDL/Lp(a) was dialyzed against PBS buffer (EDTA free) using a dialysis cassette with a molecular weight cutoff of 7,000 (Pierce) for 3 times at 4°C. The first two times were 2 hours long before changing to fresh buffer. The final buffer exchange was performed overnight. 2.2.4  Pefabloc treatment A portion of LDL was incubated with 1 mM freshly-made Pefabloc for 30 minutes at 37°C, which allowed full inhibition of serine esterases including Lp-PLA2 on LDL. Afterwards, a PAF-AH assay was done to confirm that Lp-PLA2 activity was reduced by greater than 99%. 2.2.5  LDL/oxLp(a) oxidation In this current study, we used copper oxidized LDL. Lp(a) has similar sensitivity to lipid peroxidation and comparable composition of lipid compared with LDL. OxLp(a) has been reported to be taken up by scavenger receptors of macrophages. The EDTA free LDL/Lp(a) was oxidized by CuSO4 (5µM) for 20 hours at 37°C (5 nmol of CuSO4/200 µg LDL). EDTA (1 mM) was used to stop oxidation after the desired period of time, followed by 3 dialysis exchanges against PBS plus 1 mM EDTA to remove copper ions. 2.2.6  DiI labeling of oxLDL/oxLp(a) DiI (Invitrogen) was used to label oxLDL. Thirty mg of DiI was dissolved in 1 ml DMSO as stock DiI reagent. DiI was added into oxLDL (300 µg DiI for each mg oxLDL). Mixture was incubated at 37°C for overnight.[319]  39 2.2.7  PD-10 column purification A PD-10 column (GE Healthcare) was used to purify DiI labeled oxLDL/oxLp(a), followed by filtering (0.45 µM, Millipore). A BCA kit (Pierce) was used for protein concentration determination. 2.2.8  Evaluation of oxidation degree of LDL Four approaches were used to evaluate the extent of oxidation of oxLDL: agarose gel electrophoresis, endogenous fluorescence, the concentration of lysoPC, and Lp-PLA2 activity evaluation by PAF-AH assay. 2.2.8.1  Agarose gel Paragon lipoprotein electropheresis gel system (Beckman Instruments Inc) was used to assess changes in LDL charge following oxidation. Briefly, three µL of LDL, oxLDL, or enzyme pretreated oxidized lipoproteins with protein concentration over 100 µg/mL were loaded on the thin agarose gel, followed by 45 minutes electropheresis in Corning cassette. Lipoprotein bands were visualized on the gel by Sudan black staining. 2.2.8.2  Fluorescence reading Following oxidation, the endogenous fluorescence of LDL increases.[320, 321] The fluorescence of oxLDL was measured at excitation/emission of 360/430 nm using a microplate reader. 2.2.8.3  LysoPC assay LysoPC was measured by the AZWELL lysoPC assay kit (Cosmo Bio co.) according to the manufacturer’s instructions. Briefly, 50 µL of lysoPC containing medium was  40 hydrolyzed by lysophospholipase, glycerophosphorylcholine phosphodiesterase, and choline oxidase, sequentially. Subsequently, the generated hydrogen peroxides were colourimetrically measured in the presence of peroxidase. 2.2.8.4  Lp-PLA2 activity determination by PAF-AH assay The PAF-AH assay applied in this thesis project is a well established assay in the iterature.[167, 322, 323] Briefly, we incubated aliquots of Lp-PLA2 containing medium with 0.0465 µmol/L 3H-PAF (Perkin Elmer), 99.9635 µmol/L C16-PAF (giving finial 3H concentration as 10 µCi/µmol), and HEPES buffer (100 mM HEPES, 150 mM NaCl, pH 7.4 ) in a total volume of 100 µL. The reaction was stopped by the addition of chloroform: methanol (2:1 (v/v)) after a 20 min incubation at 37°C. The mixture was centrifuged at 1500×g for 10 min after a brief vortex. An aliquot (100 µL) was removed from the upper layer for scintillation counting. We evaluated assay linearity in aspects of catalytic reaction time and Lp-PLA2 concentration in this reaction system using pooled human plasma. As Figure 2.1 shows the enzyme reaction is linear when the reaction time is 20 minutes and Lp-PLA2 activity is less than 10 µl human plasma equivalency. The Km and Vmax of a variety of lipoprotein bound forms of Lp-PLA2 in hydrolyzing PAF were tested by Tselepis et. al. [324] Also, the catalytic Km and Vmax of Lp-PLA2 purified from human LDL towards a variety of PC species were tested by Stafforini. [156]      41 A Reaction Time Curve (1µl of plasma) 0 20 40 60 80 0 20 40 60 80 100 120 140 minutes Lp -P LA 2 ac tiv ity (n m ol /m L)  B Lp-PLA2 Dose Curve (20min incubation) 0 1 2 3 4 5 6 7 0 10 20 30 40 50 plasma volume (µl) Lp -P LA 2 ac tiv ity  (n m ol /m in /m L)  Figure 2.1 Hydrolysis of PAF by pooled human plasma. Panel A, one µl of pooled human plasma was incubated with PAF for varied time (0- 120min) as described in Methods. Plasma Lp-PLA2 activity was presented as nmol of 3H released from PAF per mL of reaction volume.  Panel B, varied volume of human plasma (0-40µl) was incubated with PAF for 20min. Plasma Lp-PLA2 activity was presented as nmol of 3H released from PAF per minute per mL of reaction volume.  42 2.3  Virus generation 2.3.1  Loss-of-Function (LOF) virus BLOCK-iT Lentiviral RNAi Expression System (Invitrogen) was used to create Lp-PLA2 LOF virus. This system is used to deliver miRNA into dividing or non-dividing mammalian cells to generate corresponding siRNA for knocking down the gene of interest. Unless specified, all the reagents used in LOF virus generation were from Invitrogen. 2.3.1.1  Pre-miRNA design BLOCK-iT™ RNAi Designer from Invitrogen was used to design Pre-miRNA for Lp- PLA2 knock-down. The designed oligos by Invitrogen were then compared with the ones designed by Dharmacon and Cold Spring Harbor Laboratory. The two sets of oligos that best matched across different algorithms were chosen (Table 2.1). Two sets of oligonucleotides including the top and bottom strands were ordered from Invitrogen. Table 2.1 Oligos designed for Lp-PLA2 pre-miRNA No. Start Oligo sequence (5’-3’) 1 Top TGCTGTACAGCAGCAACTATAAACCCGTTTTGGCCACTGACTGACGGGTTTATTTGCTGCTGTA 1 Bottom CCTGTACAGCAGCAAATAAACCCGTCAGTCAGTGGCCAAAACGGGTTTATAGTTGCTGCTGTAC 2 Top TGCTGTATTTCTGCAGCAGATTGGTCGTTTTGGCCACTGACTGACGACCAATCCTGCAGAAATA 2 Bottom CCTGTATTTCTGCAGGATTGGTCGTCAGTCAGTGGCCAAAACGACCAATCTGCTGCAGAAATAC  43 2.3.1.2  Entry clone generation Pre-miRNA oligonucleotides annealing Oligonucleotides (50 µM) representing the top and bottom strands of the targeted sequence were mixed with Oligo Annealing Buffer in DNAse/RNAse-free water for 4 minutes at 95°C. Annealing of oligonucletides was facilitated by a 5-10 min of cooling at room temperature. Successful annealing of oligonucleotides was assessed by 4% agarose gel electrophoresis. Ligating double-stranded pre-miRNA into pENTR/U6 Five µg/µl of linearized pcDNA6.2-GW/EmGFP-miR, and 10nM annealed double strand oligonucleotides were incubated with 1 U/µL T4 DNA ligase in ligation buffer and Dnase/Rnase-free water for 5 minutes at room temperature. pcDNA6.2-GW/EmGFP-miR /NEG was provided by Invitrogen for generating control miRNA without targeting on any known human mRNA. E.coli transforming and entry clone selection Two µL of the ligation reaction was incubated with One Shot TOP10 chemically competent E. coli (Invitrogen) for 30 minutes on ice, followed by 30 seconds at 42°C. After returning the reaction to ice, 250 µL of S.O.C. medium was added and incubated at 37°C for 1 hour. One hundred µL of the S.O.C. medium was spread on LB agar plate with 50 µg/mL spectinomycin and the plates were incubated 16 hours at 37°C. 2.3.1.3  Expression clone generation Typically, 10 colonies were selected individually from the LB plate and cultured in LB medium with 50 µg/mL spectinomycin overnight at 37°C. After 16 hours, a Miniprep kit  44 (Qiagen) was used to isolate plasmid DNA from each colony culture. The sequence of selected constructs was confirmed by DNA sequencing. 2.3.1.4  LR recombination The vector pcDNA6.2-GW/EmGFP-miR was linearized by digestion with the restriction enzyme Bam HI. Subsequently, 150 ng of the linearized plasmid was mixed with 150 µg of the donor vector pDONR221 in BP Clonase II enzyme mix in TE buffer and incubated at 25°C for 1 hour. Subsequently, 3 µL of this mixture was added to 150 µg pLenti6/V5- DEST, LR Clonase II enzyme mix, and incubated at 25°C for 3 hours. Subsequently, one µL of Proteinase K solution was added into the reaction and incubated at 37°C for 10 minutes. The sequence of selected constructs was confirmed by restriction enzyme Bam HI cutting and DNA sequencing. (Appendix I) 2.3.1.5  E. coli transforming and destination clone selection Two µL of above mixture was transformed into One Shot TOP10 chemically competent E. coli (Invitrogen) followed by positive colony selection as described above. 2.3.1.6  Plasmid DNA isolation Positive colonies were chosen and cultured overnight in 500 mL LB medium. The following day, plasmid DNA was isolated using a plasmid DNA purification kit (Qiagen). Agarose gel electrophoresis was used to verify the size and quality of the plasmid. The DNA concentration was determined by spectrophotometry.  45 2.3.1.7  Cell culture of 293T 293T cells were cultured in DMEM medium supplemented with 10% FBS, and 1% penicillin/streptomycin, at 37°C, 95% air and 5% CO2. Cell culture medium was changed every 3 days. 2.3.1.8  Transfection of 293T Nine µg of the ViralPower Packaging mix and 3µg of pLenti6/BLOCK-iT-DEST expression plasmid DNA were mixed in Opti-MEM medium. Meanwhile, 36 µl Lipofectamine 2000 was diluted in Opti-MEM medium. After 5 minutes, the 2 mixtures were combined. After 20 minutes, this mixture was first added into Opti-MEM plus 10% FBS, then mixed with a 293T cell suspension followed by seeding into cell culture dishes. The next day, the medium was removed and replaced by DMEM containing 10% FBS. After 24 hours, Opti-MEM medium was used to replace the DMEM. One day later the cell culture medium was collected as virus containing medium for 5 days in a row. Once collected the conditioned medium was centrifuged at 2500 × g for 10 minutes, followed by filtering through a 0.45 µm PVDF filter to remove cell debris and storage in -80°C. 2.3.1.9  Purification and Concentration of Lentivirus We used two approaches for virus concentration. One way was to concentrate virus by centrifugal filtration (Centricon Plus-20 Centrifugal Filter Units, with cutoff 100 kD, Millipore). A second method was to combine virus-containing cell culture medium with PEG-8000 and NaCl to a final concentration of 5% and 0.15 M, respectively. The mixture was rotated overnight at 4°C. After centrifugation at 4100 × g for 10 minutes, a  46 “fluffy” white pellet containing virus was formed and subsequently resuspended in appropriate serum-containing medium or PBS and stored in -80°C. 2.3.1.10  Lentivirus titration 293 cells were seeded in a 6-well plate. On the day of virus transduction, the number of 293 cells in an individual well was counted. Ten µL of virus stock was diluted by 100, 1,000, 10,000, 100,000, and 1,000,000 times in series in serum free medium plus 8ng/mL Polybrene. One mL of each dilution was added to 293 cells after removing the culture medium. After 4 hours incubation, equal volume of DMEM medium with 10% FBS was added, followed by a 3-day incubation. On the day of titration, cells were trypsinized, and kept in PBS for GFP positive cell counting using flow cytometry. GFP counting percentage between 5-20% of total cell number was believed to most reliably reflect virus transduction. We used this for titration calculation. Titration was presented as: transduction units (TU) / mL = (% of GFP positive cells / 100 X infected cell numbers) X dilution factor. Usually, the titration for the virus concentrated by concentrator was about 108 whereas, the titration for the virus from PEG-8000 precipitation ranged from 108 to 109. We aliquoted virus into small volumes to minimize freeze-thaw cycles for later usage in the functional studies. 2.3.2  Gain-of-Function (GOF) virus The full length PLA2G7 (gene name of Lp-PLA2) cDNA was cloned into the vector pCMV6-XL4 (Origene, Cat. No. SC127916). Lp-PLA2 cDNA was subsequently subcloned into vector pWPI (gift from Trono’s lab). No insertion in pWPI operated as the control. Along with two other packaging vectors pMD.2G and psPAX2 (gift from Dr.  47 Trono’s lab), the plasmids were cotransfected into 293T cells for the generation of Lp- PLA2 GOF virus, separately. Transfection, virus concentration, titration, and transduction were performed as described above. 2.3.3  Target cell line transduction On the day of transduction, the cell confluency was approximately 60%. GOF virus and LOF virus with known transduction unit concentration were diluted in serum-free medium plus 8 ng/mL Polybrene, with MOI 10 and 30 respectively, which were previously optimized by flow cytometry following virus transduction of THP-1 cells. After removing conditioned culture medium, new virus-containing medium was added to the cells and 16 hours later, an equal volume of DMEM with 10% FBS was added. Then after two days of PMA stimulation, cells were ready for further treatments or functional assays. For human primary monocyte derived macrophages, besides the method above, we also centrifuged cells at 2000 g for 2 hours after adding virus, or pretreated MDM with 1 nM As2O3 for 18 hours before virus addition. The best transduction efficiency for MDM was 20% after trying all the above methods. Virus showed somewhat better transduction efficiency in matured macrophages compared to monocytes. 2.4  Recombinant Lp-PLA2 Protein purification 2.4.1  Strategy of Lp-PLA2 purification The strategy of Lp-PLA2 purification is summarized below, and depicted in Figure 2.1. 1. Purchase Full-length Lp-PLA2 in vector pCMR6-XL4 2. Sub clone Lp-PLA2 cDNA into vector pcDNA5/FRT  48 3. HIS-tag insertion into vector pcDNA5/FRT/Lp-PLA2 4. In addition, create a site mutation in Lp-PLA2 gene in vector pcDNA5/FRT 5. Transfection of both pcDNA5/FRT vectors (Lp-PLA2 wild type and mutated type) into 293/FLP cells, respectively. 6. Screen the successfully transfected cells, culture positively transfected cells, and collect medium for Lp-PLA2 protein purification. (wild type and mutated type)  Approach – protein purification Lp-PLA2 pcDNA5/ FRT pCMV6- XL4 Lp-PLA2 pcDNA5/ FRT Lp-PLA2-HIS pcDNA5/ FRT Muta-Lp-PLA2-HIS pOG44 pOG44 293T/FLP 293T/FLP  Figure 2.2 Recombinant Lp-PLA2 enzyme purification. Full length of Lp-PLA2 cDNA was transferred from vector pCMR6-XL4 into vector pcDNA5/FRT, followed by HIS tag insertion right before the stop codon of Lp-PLA2 cDNA. The newly generated vector was used to create a site mutation (S273A) in the PLA2G7 cDNA. The two vectors containing wild type and mutated cDNA were transfected into 293/FLP cells along with pOG44, respectively. Cell culture medium enriched in Lp-PLA2 enzyme was collected for FPLC purification.  49 2.4.2  Subcloning PLA2G7 (gene name of Lp-PLA2) cDNA from vector pCMV6-XL6 into vector pcDNA5/FRT The full length PLA2G7 cDNA was subcloned into the vector pCMV6-XL4 (Origene, Cat. No. SC127916). Using the restriction enzyme Not I (New England BioLabs) pCMV-6- XL4 was linearized releasing the PLA2G7 cDNA. Subsequently the cDNA was ligated into Not I digested pcDNA5/FRT. To confirm the correct orientation of the PLA2G7 cDNA in pcDNA5-FRT, the newly generated pcDNA5/FRT/Lp-PLA2 was digested with Blp1 and Xho1 (New England BioLabs) to assess the generation of fragments of proper length. In addition, the subcloned pcDNA5/FRT/Lp-PLA2 was confirmed by sequencing. (Appendix II) Ultimately, the chosen clone was sequenced to validate the plasmid. 2.4.3  Mutagenesis To simplify the purification of recombinant Lp-PLA2, a six residue histidine tag was inserted just prior to the stop codon. The correct insertion was confirmed by sequencing (Appendix III). Also, to create a catalytically inactive form of the enzyme, the active site serine 273 was converted to an alanine residue. The correct mutation was confirmed by sequencing (Appendix III). Mutagenesis was completed by Mutagenex Inc. 2.4.4  Transfection of pcDNA/FRT/Lp-PLA2 into 293/FLP cells. The two vectors (incorporating wild type and mutated PLA2G7 cDNA) were then transfected separately into 293/FLP cells using the FLP-IN system (Invitrogen). The successfully transfected colonies were selected using antibiotics of hygromycin and Zeocin, and confirmed by the measurement of PAF hydrolysis, protein staining, and  50 Western blot analysis. Pooled positive colonies and single clone colonies of each transfected cell type were stored in liquid nitrogen. 2.4.5  Collection of conditioned medium Transfected cells were grown in T-175 flasks containing twenty five mL of Opti-MEM medium per flask. Conditioned medium was collected everyday for 10 days in a row, and then stored at –80°C until purification. 2.4.6  Lp-PLA2 protein purification by FPLC On the day of purification, half liter of each type of conditioned medium was thawed in a water bath at room temperature. Subsequently, the conditioned medium was filtered by vacuum filter units. One mL of the filtered medium was kept for enzyme activity analysis and protein concentration determination. The remainder of the medium was mixed with an equal volume of 50 mM NaH2PO4, 1.85 M NaCl, 20 mM imidazole, pH 8. The purification column consisted of a 15 mL Ni-NTA Superflow agarose (Qiagen). An FPLC (ATKA, GE Healthcare) system was used with the following parameters:  1. Start with Pump A and B wash, and sample pump wash using binding buffer (50 mM NaH2PO4, 1 M NaCl, 10 mM imidazole, pH 8) at port A1, elution buffer 50 mM NaH2PO4, 1 M NaCl, 1 M imidazole, pH 8) at port B, and binding buffer at sample pump port. 2. Column equilibration using 10 volumes of binding buffer. 3. Sample loading at speed of 10 mL/min.  51 4. Column washing using 10 volumes of washing buffer (50 mM NaH2PO4, 1 M NaCl, 20 mM imidazole, pH 8) at port A2. 5. Gradient elution using elution buffer (gradient from 0-100%, 150 mL in total) at speed of 10 mL/min. Ten fractions were kept with 15 mL in each. 6. Tracking protein peak by both UV curve and measuring Lp-PLA2 activity for the 10 fractions.  The peak fractions (fraction 2-4) of purified Lp-PLA2 from FPLC (confirmed by Lp- PLA2 activity) were pooled, purified and concentrated by Centricon Plus-70 Centrifugal Filter Units with cutoff 30 kDa (Millipore) with 2 times of PBS washes. The final purified Lp-PLA2 protein was aliquoted and stored at -80°C. 2.4.7  Lp-PLA2 mass determination by ELISA and BCA assay Lp-PLA2 mass was measured with a sandwich ELISA using the PLAC2™ kit from daiDexus (California, USA) in Dr. Muriel Caslake’s lab, University of Glasgow. Briefly, Lp-PLA2 was captured by antibodies Mab 2C10 and 4B4 subsequently, followed by fluorimeter reading. 2.4.8  Purified Lp-PLA2 activity determination by PAF-AH assay Refer to 2.2.8.4 2.4.9  Specific activity of purified Lp-PLA2 The specific activity of this recombinant Lp-PLA2 was presented as Lp-PLA2 activity/Lp- PLA2 mass. The plasma Lp-PLA2 specific activity is about 200 nmol/µg /min.  52 2.5  PAGE gel running SDS-PAGE gels (10%) were used to assess the purity of isolated recombinant Lp-PLA2. One µg of each of purified active Lp-PLA2 and inactive Lp-PLA2 as well as 50 µL of conditioned medium were loaded onto the gel. After 1 hour of electrophoresis at 100 V, a Colloidal Blue Staining Kit (Invitrogen) was used to visualize the proteins.  Native gradient gels (2-7.5%) were made to evaluate the size of various treated LDL fractions. Four µg of oxLDL pretreated with Lp-PLA2 was preincubated with the same volume of Sudan black (0.1% w/v in ethyleneglycol) and 5µL of saccharose (50% w/v), then loaded in the gel, with pooled human plasma as a control. After 30 min of electrophoresis at 50 V, gels were running for 5 hours at 100 V. 2.6  Turbidity assay Native LDL or oxLDL (100 µg/ml) was treated with PBS (as control), active Lp-PLA2 (5 nmol/min/ml), inactive Lp-PLA2 or lysoPC (0-40 µM) for 4 hours at 37°C. Turbidity of pretreated oxLDL was measured at 450 nm by flurometer in a 96 well microplate.[325] 2.7  Cytotoxicity assay Cytotoxicity was determined by the CytoTox-ONE™ Homogeneous Membrane Integrity Assay (Promega co.) according to the manufacturer’s instructions. Briefly, 50 µL cell culture medium from the treated cells and control cells were mixed with CytoTox- ONE™ reagent in a 96-well plate, and incubated at room temperature for 10 minutes.  53 After adding 50 µL stopping buffer, the microplate was read at an excitation wavelength of 560 nm and an emission wavelength of 590 nm. 2.8  Lipoprotein cellular association assay MDM or HepG2 cells were incubated with lipoprotein deficient medium for 24 hours. Subsequently, we incubated the cells with 10 µg/mL DiI-oxLDL or DiI-oxLp(a) in the presence of active wild type Lp-PLA2 (3 nmol/min/mL) or inactive Lp-PLA2 (same protein concentrations as active-wild type Lp-PLA2) or PBS in serum-free medium as a control condition. After 4 hours, medium was removed, cells were washed twice by ice cold PBS, followed by RIPA buffer to facilitate cellular lysis. Cellular lysate (100 µL) was used to measure DiI-related fluorescence at 520 nm/580 nm excitation and emission wavelengths in a microplate reader. Cellular lysate (25 µL) was used for protein concentration determination by the BCA kit to facilitate normalization of the data. For GOF/LOF studies, THP-1 cells were transduced with GOF/LOF lentivirus followed by PMA stimulation for 3 days. After starvation in lipoprotein deficient medium for 24 hours, lipoprotein cellular association in THP-1 cells was performed in the same way as MDM and HepG2. 2.9  Foam cell formation MDM were treated with 50 µg/mL oxLDL in the presence of active Lp-PLA2 (5 nmol/min/mL), inactive Lp-PLA2 (same protein concentration as active-Lp-PLA2) or PBS as the control condition in serum lipoprotein deficient medium for 24 hours. Subsequently, the cells were washed twice with PBS and lysed by treatment with RIPA  54 buffer. Cellular lysate (100 µl) was used for cholesterol mass determination by the Amplex Red cholesterol Kit (Invitrogen) according to the manufacturer’s instructions and protein concentration was measured by the BCA kit to facilitate normalization of the data. 2.10  Liquid phase uptake assay We chose Lucifer Yellow (Sigma)  as liquid phase uptake marker.[326-328] MDM or HepG2 cells were incubated with lipoprotein deficient medium for 24 hours. Subsequently, we incubated the cells with 500 mg/mL Lucifer yellow in the presence of active wild type Lp-PLA2 (3nmol/min/mL), inactive Lp-PLA2 (same protein concentrations as active-wild type Lp-PLA2), PBS (negative control) in serum-free medium as a control condition, or lysoPC with ethanol (negative control) as control condition. After 4 hours, medium was removed, cells were washed twice by ice cold PBS, followed by RIPA buffer to facilitate cellular lysis. Cellular lysate (100 µL) was used to measure Lucifer Yellow related fluorescence at 430/540 µm excitation and emission wavelengths in a microplate reader. Cellular lysate (25 µL) was used for protein concentration determination by the BCA kit to facilitate normalization of the data. 2.11  Cholesterol efflux Monocytes (1.5 × 105 cells) were seeded into 48-well plates. Treatments were done after cells were fully differentiated. Meantime, nitrogen-dried 3H-cholesterol (GE Healthcare) was dissolved in 100% ethanol, and diluted into a final concentration of 1µCi/mL in basal medium (RMPI 1640, 0.2% BSA, and 1% antibiotics-antimycotics) supplemented by 50  55 µg/mL oxLDL for overnight. Next day, the 3H labeled oxLDL was loaded to macrophages for 24 hours. Subsequently, 3H-cholesterol-containing medium was replaced with basal medium and incubated for 2 hours for equilibration prior to the replacement with efflux medium (10 µg/mL of apoAI (Sigma) or 25 µg/mL HDL into basal medium) for an overnight incubation. An aliquot (200 µL) of efflux medium (medium cholesterol) was collected for scintillation counting, and cellular cholesterol was released by RIPA buffer, and 200 µL aliquots (cellular cholesterol) were used for scintillation counting. Cholesterol efflux was presented as the percentage of medium cpm of total cpm (medium cpm + cellular cpm). 2.12  Real time PCR quantification by ABI 7900 RNeasy plus mini kit (Qiagen) was used to extract total RNA according to the manufacturer’s instructions. QuantiTectTM Probe RT-PCR master mix and RT mix (Qiagen) with either primer sets of 18S RNA or targeted gene (Applied Biosystems) were mixed in a 9 µL reaction system following the manufacturer’s instructions, and 1 µl of RNA sample (concentration was about 0.5µg/µl) was added for RT-PCR amplification. Real-time quantitative RT-PCR was performed on ABI Prism® 7900 platform with reaction parameters set as the following: 50°C for 30 min for cDNA synthesis, 95°C for 15 min to inactivate reverse polymerase, and then 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. A standard curve was created from serially diluted samples from concentrated RNA. mRNA levels were normalized by the use of an internal control (18S RNA).  56 2.13  Real time PCR quantification by QuantiGene The QuantiGene 2.0 kit (Panomics) was used to quantify mRNA of the human PLA2G7 and β-actin and Peptidylpropyl isomerase B (PPIB) genes (last two are house keeping genes) according to the manufacturer’s protocol. Briefly, 20 µL of cell lysate was analyzed for the presence of PLA2G7 and β-actin/PPIB mRNA using specific probes for PLA2G7 and β-actin/PPIB genes (Panomics). The data are expressed as a ratio of the signals obtained for PLA2G7 and β-actin/PPIB for the same sample. 2.14  Western blotting Equal amounts of cellular protein (1-10 µg) from control, specific treatments or purified Lp-PLA2 were loaded onto a 10% acrylamide Bis-Tris Gel. Gels were electrophoresed for 1 hour at 200 volts then transferred to PVDF membrane overnight at 4°C, 30 volts. After 1hour of blocking (SuperBlock blocking buffer from Pierce), membranes were coincubated with the primary antibodies of Lp-PLA2 (Rabbit anti Human, 1:1000 dilution, Cayman, Cat No. 160603) for 1 hour, followed by 1 hour incubation with a secondary antibody (anti-rabbit IgG, Pierce). Membranes were developed by chemiluminescence using supersignal west femto maximum sensitivity substrate (Pierce). Total cellular protein was measured by the BCA kit (Pierce). 2.15  Flow cytometry After 24 hours lysoPC treatment or enzyme treatment, cells were harvested by PBS/1 mM EDTA, followed by a 30 min incubation with human PE conjugated anti human CD36 antibody (BD Biosciences, Cat No. 555455) at 4°C in the dark. Mouse PE  57 conjugated IgM (BD Biosciences, Cat No. 555584) was used as an isotype control. After two PBS washes, cells were fixed in 1% paraformaldehyde for 20 minutes and FACS flow cytometry was performed. The difference in CD36 expression between control and treatment was presented as (PE signal intensity) X (cell number with positive signal). 2.16  Statistics Measurements were performed in triplicate for each experiment in at least 3 independent experiments, and results expressed as mean ± standard error of the mean. Differences between mean values were assessed by the student’s t test or ANOVA followed by post- hoc Tukey test where a p value <0.05 was considered significant.    58 3  Results 3.1  LDL/Lp(a) modification We evaluated LDL/Lp(a) modification in aspects of lipoprotein charge, fluorescence generation, lysoPC generation, and loss of Lp-PLA2 activity.  The difference in lipoprotein migration distance observed from agarose gel electrophoresis was based on the alteration of charge by oxidation as shown in Figure 3.1. Native LDL and commercially obtained oxLDL served as negative and positive controls, respectively. After 45 min of electrophoresis, oxLDL migrated approximately twice the distance from the origin in comparison to native LDL. Similarly, oxLp(a) migrated twice the distance from the origin in comparison to native Lp(a) (Figure 3.1). Typically, native Lp(a) migrated a greater distance from the origin in comparison to native LDL, which may indicate Lp(a) is more negatively charged than LDL by nature, or that it is more readily oxidized in comparison to native LDL. Pefabloc pretreatment did not appear to affect the net charge of LDL (Figure 3.2).  A fluorescence reading at 360/430 nm was used to measure fluorescence generated following LDL oxidation.[320, 321] Typical fluorescence readings for native LDL and oxLDL is shown in Figure 3.3 where oxLDL has about 10 times more fluorescence than native LDL.  59  Figure 3.1 Evaluation of the effects of oxidation on lipoprotein charge by agarose gel electrophoresis. Three µL of each lipoprotein sample (with concentration above 100 µg/mL) was loaded on the agarose gel. Purchased oxLDL and native LDL were run as controls. After 45 minutes of electrophoresis the agarose gel was fixed and stained by sudan black.   Figure 3.2 Evaluation of the effects of Pefabloc pre-treatment on lipoprotein charge by agarose gel electrophoresis. Three µl of each lipoprotein (with concentration above 100 µg/mL) was loaded on the agarose gel. Purchased oxLDL and natLDL were run as positive and negative controls. After 45 minutes of electrophoresis the agarose gel was fixed and stained by Sudan black.  60  Figure 3.3 Measurement of endogenous fluorescence following copper oxidation of LDL. Native LDL or oxLDL (100 µL with protein concentration of approximately 600 µg/mL) was loaded onto a 96-well plate followed by fluorescence reading at 360/430 nm. The data are represented in triplicate for three independent experiments. Data were normalized by protein concentration. Statistical significance between control and treatment groups was assessed by student’s t-test, and indicated by *** P<0.001.  During LDL oxidation, lysoPC is generated and PC content is reduced due to the hydrolysis of oxPC by Lp-PLA2. As a result, the amount of lysoPC present is an indirect measure of the extent of lipoprotein oxidation. The amount of lysoPC present in oxLDL and oxLp(a) was compared with their corresponding native lipoprotein fractions and is shown in Figure 3.4. The oxidation reaction generated about 10 times more lysoPC in oxidized lipoproteins compared with native lipoproteins. Also, per apoB particle, native Lp(a) has more lysoPC content than native LDL. Again, this may indicate Lp(a) has more lysoPC content than LDL or that native Lp(a) is more readily oxidized than native LDL.   61  Figure 3.4 Measurement of lysoPC content in oxidized lipoproteins. Lipoprotein fractions (50 µL) were treated with lysophospholipase, glycerophosphorylcholine phosphodiesterase, and choline oxidase, sequentially. The generated hydrogen peroxides were colorimetrically measured in the presence of peroxidase and read at 500 nm. After comparisons with a positive control (purified lysoPC) and negative control (PBS), the lysoPC content in different lipoprotein fractions was calculated and normalized by protein concentration. Panel A is lysoPC content for natLDL/oxLDL. Panel B is lysoPC content for natLp(a)/oxLp(a). The data are represented in triplicate for three independent experiments. Statistical significance between control and treatment groups was assessed by student’s t-test, and indicated by *P<0.05, ** P<0.01.  62  Endogenous Lp-PLA2 loses catalytic activity during the oxidation process. Figure 3.5 demonstrates that oxLDL has much less Lp-PLA2 catalytic activity in comparison to native LDL, consistent with previous reports.[181, 182, 329] Pefabloc pretreated LDL is associated with a nearly complete loss of Lp-PLA2 activity compared to native LDL. (Figure 3.5)  63  Figure 3.5 Lp-PLA2 enzyme activity associated with lipoproteins. Lipoprotein fractions (10 µL) were used to measure the amount of Lp-PLA2 activity. Lp- PLA2 activity was normalized by protein concentration. The data are represented in triplicate for three independent experiments. Statistical significance between control and treatment groups was assessed by student’s t-test, and indicated by * P<0.05.  64 3.2  Oxidized lipid treatment of human macrophages and HepG2 cells is associated with a decrease in lipoprotein-associated phospholipase A2 activity Oxidized lipid treatment was associated with decreased Lp-PLA2 activity in monocyte-derived macrophages and HepG2 cells. Following a minimum of 10 days of culture for monocyte-derived macrophages and 72 hours of culture of HepG2 cells, cells were treated with PGPC (5 µg/mL), POVPC (5 µg/mL), 7-KC (5 µg/mL), 7β-OC (2.5 µg/mL), 9-HODE (2.5 µg/mL) and 15-HETE (2.5 µg/mL) in lipoprotein deficient medium for 48 hours. The trend of decreasing Lp-PLA2 activity for all oxidized lipid treatments for macrophages and HepG2 cells were observed (Figure 3.6).  Oxidized lipid treatment did not affect PLA2G7 mRNA expression in monocyte- derived macrophages The mRNA corresponding to the human genes PLA2G7 and β-actin were measured from cell lysate extracts harvested after 48 hours of oxidized lipid treatment. Due to the reduced expression of PLA2G7 in HepG2 cells, mRNA levels could not be measured reliably. A similar observation in HepG2 cells has been reported previously.[142, 330] Analysis of the mRNA levels from treated monocyte-derived macrophages did not show any significant changes among treated cells compared to the control condition (Figure 3.7).  65  Figure 3.6 Relative Lp-PLA2 activity secreted from macrophages and HepG2 cells following treatment with selected oxidized lipids. Conditioned culture medium (using lipoprotein deficient medium) from monocyte- derived macrophages and HepG2 cells 48 hours after lipid treatment was assayed for the ability to hydrolyze PAF. Panel A, Lp-PLA2 activity from the conditioned medium of culture monocyte-derived macrophages. Panel B, Lp-PLA2 activity from the conditioned medium of cultured HepG2 cells. The data are represented as a mean of the percentage of untreated cells performed in triplicate.  66   Figure 3.7 Lp-PLA2 mRNA expression in monocyte-derived macrophages following treatment with oxidized lipids. Cellular lysate was harvested after 48 hours of treatment with oxidized lipids and mRNA measured according to procedures described in Materials and Methods.   Oxidized lipid treatment did not affect Lp-PLA2 protein secretion from monocyte- derived macrophages. Culture medium from monocyte-derived macrophages and HepG2 cells following treatment with oxidized lipids was subjected to Western blotting. As shown in Figure 3.8, there was no marked difference in the amount of protein detected following treatment with oxidized lipid, although some modest reduction was noted. Much weaker signals for Lp-PLA2 protein were observed for HepG2 cells (data not shown) but similarly no marked differences in protein concentration were observed following treatment with oxidized lipids.  67  Figure 3.8 Western blot of Lp-PLA2 protein from monocyte-derived macrophages treated with oxidized lipids. Aliquots of conditioned culture medium normalized by cellular protein concentration were loaded onto a SDS-PAGE gel prior to blotting and probing with a polyclonal antibody for Lp-PLA2.   Oxidized lipids impair Lp-PLA2 catalytic activity. To determine if the decrease in catalytic activity observed in conditioned medium from treated cells was related to a direct catalytic effect on Lp-PLA2, we incubated conditioned medium from untreated monocyte-derived macrophages and HepG2 cells with the same concentration of oxidized lipids used previously. Following a 30 minute incubation at 37°C with the oxidized lipids, we observed decreased Lp-PLA2 activity for all treatments (Figure 3.9).  68  Figure 3.9 Reduced Lp-PLA2 activity in enzyme enriched medium treated with oxidized lipids. Conditioned medium (lipoprotein deficient medium) from untreated MDM (panel A) or HepG2 cells (panel B) was incubated with oxidized lipids and assayed for enzyme activity following 30 min incubation. The data are expressed as a percentage relative to the absence of oxidized lipid and represent the mean of triplicate measurements. (* p<0.05, ** p<0.01, *** p<0.001)  69 3.3  Lp-PLA2 LOF lentivirus generation In order to investigate the function of endogenous Lp-PLA2, we designed and constructed Lp-PLA2 Loss-of-Function (LOF) lentivirus and Gain-of-Function (GOF) lentivirus.  In order to test the efficiency of the LOF virus of knocking down Lp-PLA2 gene in our targeting cells, we first evaluated MOI for THP-1 cells. We transduced THP-1 cells by LOF virus at different MOI (30 and 50). The transduction efficiency of the LOF virus construct was 91% at MOI of 30 and 94% at MOI of 50. For THP-1 cells, the LOF virus at a MOI of 30 was chosen to be used in subsequent experiments.  The efficiency of the LOF virus was assessed in THP-1 macrophages by measuring Lp- PLA2 activity (Figure 3.10), mRNA expression (Figure 3.11) and protein expression (Figure 3.12). Regarding the natural Lp-PLA2 mRNA and activity expression pattern, Lp-PLA2 expression in THP-1 cells is highest during the first 24 hours and decreases in subsequent days (data not shown). After virus transduction followed by 48 hours PMA stimulation, Lp-PLA2 activity was reduced by 50% whereas mRNA levels were reduced by 83%. This knock-down efficiency remained after the 7th day following PMA stimulation (data not shown). Protein expression was also decreased as observed in Western blots.   70  Figure 3.10 Reduced Lp-PLA2 activity in LOF lentivirus transduced THP-1 cells. THP-1 cells were transduced with LOF lentivirus at MOI 30. Control virus transduction at the same MOI served as a control. After a 3-day incubation, Lp-PLA2 activity in cell culture medium (lipoprotein deficiency medium) in the different conditions was measured by PAF-AH assay. Statistical significance between control and LOF group was assessed by a student’s t-test, and indicated by * P<0.05.   Figure 3.11 Reduced Lp-PLA2 mRNA in LOF lentivirus transduced THP-1 cells. THP-1 cells were transduced with LOF lentivirus at MOI 30. Control virus transduction at the same MOI served as a control. After a 3-day incubation, Lp-PLA2 mRNA was quantified by QuantiGene as described in Materials and Methods, and normalized by house keeping mRNA Peptidylpropyl isomerase B (PPIB). Statistical significance between control and LOF group was assessed by a student’s t-test, and indicated by *** P<0.001.  71  Figure 3.12 Western blot for Lp-PLA2 protein in LOF lentivirus transduced THP-1 cells. Aliquots of conditioned culture medium normalized by cellular protein concentration were loaded onto a SDS-PAGE gel prior to blotting and probing with a polyclonal antibody for Lp-PLA2. 3.4  Lp-PLA2 GOF lentivirus generation To evaluate the transduction efficiency of GOF virus in THP-1 cells, we performed GOF virus infection at different MOIs 5 and 10 achieving 66% and 81% transduction efficiency, respectively. In subsequent experiments we used an MOI of 10 which resulted in significant increases in enzyme activity (Figure 3.13) and mRNA (Figure 3.14)    72  Figure 3.13 Lp-PLA2 activity in GOF lentivirus transduced THP-1 cells. THP-1 cells were transduced with GOF lentivirus at MOI 10. Control virus transduction at the same MOI served as a control. After a 3-day incubation, Lp-PLA2 activity in cell culture medium (lipoprotein deficiency medium) in the different conditions was measured by PAF-AH assay. Statistical significance between control and GOF group was assessed by a student’s t-test, and indicated by ** P<0.01.   Figure 3.14 Lp-PLA2 mRNA in GOF lentivirus transduced THP-1 cells. THP-1 cells were transduced with GOF lentivirus at MOI 10. Control virus transduction at the same MOI served as a control. After a 3-day incubation, Lp-PLA2 mRNA was quantified by real-time PCR, and normalized by house keeping RNA 18S. Statistical significance between control and GOF group was assessed by a student’s t-test, and indicated by * P<0.05.  73 3.5  Endogenerous Lp-PLA2 expression induced by GOF and LOF lentivirus did not affect cholesterol efflux and oxLDL cellular association in THP-1 macrophages After we successfully created GOF/LOF lentivirus, the first thing we pursued was to see whether changes in the endogenous Lp-PLA2 expression affect cholesterol efflux in THP- 1 cells. However, no differences were detected among efflux experiments either in the presence or absence of physiological acceptors (Figure 3.15).  The cellular association of oxLDL was also measured following transduction with GOF/LOF virus. Figure 3.16 shows that neither GOF nor LOF virus treatment affected oxLDL cellular association in THP-1 cells. However, we observed THP-1 cells took up less oxLDL in cell culture medium which was from Lp-PLA2 transfected 293 cells and enriched in Lp-PLA2 activity. This made us realize the likely limitation of lentivirus usage in our experimental system and hypothesize that Lp-PLA2 protein could affect oxLDL cellular association.  74  75  Figure 3.15 Endogenous Lp-PLA2 expression in THP-1 cells transduced with GOF/LOF virus did not affect cholesterol efflux. THP-1 macrophages were transduced with GOF and LOF virus. Transduction of control virus served as a control. Transduced THP-1 cells were loaded by 50 µg/mL oxLDL plus 1 µCi/mL 3H-cholesterol, followed by 4 hours cholesterol efflux in the absence and presence of cholesterol acceptor, apoAI and HDL. Panel A, non-acceptor mediated cholesterol efflux in THP-1 cells. Panel B, apoAI-mediated cholesterol efflux in THP-1 cells. Panel C, HDL-mediated cholesterol efflux in THP-1 cells. Data represent the mean of triplicate assays from 4 independent experiments.   76  Figure 3.16 Endogenous Lp-PLA2 expression in THP-1cells transduced with GOF/LOF virus did not affect oxLDL cellular association. THP-1 macrophages were transduced with GOF and LOF virus. Transduction of control virus served as a control. Transduced THP-1cells were treated with 10 µg/mL DiI labeled oxLDL for 4 hours. Data represent 3 independent experiments performed in triplicate. 3.6  Purification of recombinant Lp-PLA2 enzymes (both active form and inactive form) Due to limitations associated with the use of lentivirus in THP-1 cells, an inability to efficiently transduce primary monocytes with lentivirus, and the observed oxLDL cellular association alteration in THP-1 cells exposed to Lp-PLA2 enriched medium, we investigated the role of exogenous Lp-PLA2 in MDM and HepG2 cells, which is purified human recombinant Lp-PLA2 protein.  A typical purification run of conditioned medium containing recombinant Lp-PLA2 is shown in Figure 3.17. Lp-PLA2 peak fractions were fractions 2 to 4. More specifically, the Lp-PLA2 activity distribution along the entire FPLC purification is shown in Figure 3.18. Table 3.1 indicates that approximately 19% of Lp-PLA2 was recovered from the  77 conditioned medium with a 266-fold increase in purity compared with conditioned medium.  Figure 3.17 AKTA purification map for recombinant active-Lp-PLA2 protein. UV curve and Lp-PLA2 activity curve are depicted in the map.  Lp-PLA2 activity volume comparison 0 50 100 150 200 250 300 350 raw  m ed ium flo w thr ou gh wa sh  ou t fra cti on  1 fra cti on  2 fra cti on  3 fra cti on  4 fra cti on  5 fra cti on  6 fra cti on  7 fra cti on  8 fra cti on  9 fra cti on  10 wa sh ou t in  Et OH co nc en tra ted  en zy me  Figure 3.18 Lp-PLA2 activity volume comparison among all the steps during purification. The total Lp-PLA2 activities for conditioned medium, flow-through, washout, 10 sequential fractions, EtOH-wash-out and concentrated Lp-PLA2 enzyme (from pooled fraction 2-4) were measured.  78 Table 3.1 Recovery and purity of recombinant active-Lp-PLA2  Volume (mL) Activity (nmol/min/mL) Total Activity (nmol/min) Protein (µg/mL) Specific Activity (nmol/min/µg) Recovery (%) Purifity (fold) Culture medium 500 0.298 297.51 390 0.76285 100 1 Pooled peak fractions (2, 3, 4) 45 2.791 125.61   42.22 Concentrated enzyme 1 57.552 57.55 283.6*10 -3 202.9 19.34 266  We evaluated the purity of the recombinant protein using Commassie blue staining and western blotting for Lp-PLA2 protein. Figure 3.19 shows that the purified enzyme was represented by a single band on the Commasie-stained gel. The Western blot (Figure 3.20) indicates that this protein was immunoreactive for antibody raised against Lp-PLA2 and with the appropriate molecular weight. The specific protein Lp-PLA2 mass was measured using ELISA in Dr. Muriel Caslake’s lab. We calculated Lp-PLA2 specific activity by dividing Lp-PLA2 activity by Lp-PLA2 mass. The specific activity of the purified Lp-PLA2 was similar to those values obtained from human plasma.[318] (Table 3.2) Table 3.2 Specific activity of recombinant Lp-PLA2  Lp-PLA2 activity (nmol/min/mL) Lp-PLA2 mass (ng/mL) Lp-PLA2 specific activity (nmol/min/µg) Active-Lp-PLA2 (1) 37.412 113.3 330 Active-Lp-PLA2 (2) 57.5 283.6 200 Active-Lp-PLA2 (3) 41 470.1 90 Inactive-Lp-PLA2 (1) 1.786 550.7 3 Inactive-Lp-PLA2 (2) 0.423 2420 0.17 NOTE: Three batches of purified active-Lp-PLA2, and two batches of inactive-Lp-PLA2.   79   Figure 3.19 Coomassie blue stained SDS-PAGE for purified recombinant Lp-PLA2. From left to right, 1, 50 µL of conditioned medium from 293 cells stably transfected with wild type Lp-PLA2; 2, one µg of purified active recombinant Lp-PLA2; 3, 50 µL of conditioned medium from 293 cells stably transfected with an inactive mutant form of Lp-PLA2; and 4, one µg of purified inactive recombinant Lp-PLA2. Gel was visualized after Commassie blue staining.   80  Figure 3.20 Western blot for purified recombinant Lp-PLA2. From left to right, 1, 50 µL of conditioned medium from 293 cells stably transfected with wild type Lp-PLA2; 2, one µg of purified active recombinant Lp-PLA2; 3, 50 µL of conditioned medium from 293 cells stably transfected with an inactive mutant form of Lp-PLA2; and 4, one µg of purified inactive recombinant Lp-PLA2. The gel was probed using anti-human Lp-PLA2 antibody. 3.7  Lp-PLA2 reduced oxLDL/oxLp(a) cellular association in MDM and HepG2 cells Matured human MDM were incubated with 10 µg/mL DiI-labeled oxLDL or 10 µg/mL DiI-labeled oxLp(a) in the presence of active-Lp-PLA2 (3 nmol/min/mL) and equally concentrated inactive-Lp-PLA2. PBS was added in the control condition group. There is approximately 1 nmol/min/mL per every 10 µg/mL of LDL in circulation based on calculation. Therefore, we added approximately twice the amount of Lp-PLA2 enzyme (based on activity and some losses in sample handling) per fraction of LDL used in the  81 experimental system. After a 4 hours incubation, we observed that active-Lp-PLA2 reduced oxLDL and oxLp(a) cellular association by 31% and 38%, respectively. However, treatment with inactive-Lp-PLA2 did not show any appreciable effect. (Figure 3.21)  We also observed a similar finding in HepG2 cells. Active-Lp-PLA2 decreased oxLDL and oxLp(a) cellular association by 34% and 41%, respectively whereas inactive-Lp- PLA2 had no effect (Figure 3.22).  In order to investigate potential differences in cellular association under different ratios of enzyme to lipoprotein concentration, the effect of different concentrations of enzyme were evaluated. From Figure 3.23 we can see that macrophages treated with 10 µg/mL oxLDL and active-Lp-PLA2 ranging from 3-9 nmol/min/mL decreased oxLDL cellular association to a similar degree. Also, using the same amount of Lp-PLA2 (3 nmol/min/mL) and different concentrations of oxLDL (10, 30, and 50 µg/mL), similar relative reductions were observed.  82  Figure 3.21 Active Lp-PLA2 reduced oxLDL and oxLp(a) cellular association in MDM cells. MDM were treated with 10 µg/mL DiI labeled oxLDL (Panel A) or DiI-oxLp(a) (Panel B) in the presence of PBS (as control), active recombinant Lp-PLA2 (3 nmol/min/mL) or inactive recombinant Lp-PLA2 for 4 hours. Data are presented as a percentage of the control condition and represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and is indicated by * P<0.05, *** P<0.001.   83  Figure 3.22 Active Lp-PLA2 reduced oxLDL and oxLp(a) cellular association in HepG2 cells. HepG2 were treated with 10 µg/mL DiI labeled oxLDL (Panel A) or DiI-oxLp(a) (Panel B) in the presence of PBS (as control), active recombinant Lp-PLA2 (3 nmol/min/mL) or inactive recombinant Lp-PLA2 for 4 hours. Data are presented as a percentage of the control condition and represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by ** P<0.01, *** P<0.001.   84   Figure 3.23 Active Lp-PLA2 reduced oxLDL cellular association in MDM cells. MDM were treated with DiI labeled oxLDL at different concentration (10, 30, 50 µg/mL) in the presence of PBS (as control), active recombinant Lp-PLA2 at different concentration (3 or 9 nmol/min/mL) or inactive recombinant Lp-PLA2 (protein concentration consistent to the active-Lp-PLA2) for 4 hours. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by * P<0.05, *** P<0.001.  In HepG2 cells, the effect of Lp-PLA2 was observed only at higher concentrations of oxLDL (Figure 3.24) which may be related to a lesser degree of uptake of modified LDL in comparison to macrophages. Incubations of longer duration (overnight) were also performed with similar results to the 4 hour incubation. The difference caused by Lp- PLA2 was in the same extent as 4 hours association (data not shown). This suggests that a functional effect of the exogenous Lp-PLA2 occurs in a relatively short time.   85  Figure 3.24 Active Lp-PLA2 reduced oxLDL cellular association in HepG2 cells. HepG2 cells were treated with DiI labeled oxLDL at different concentration (10, 30, 50 µg/mL) in the presence of PBS (as control), active recombinant Lp-PLA2 (3 nmol/min/mL) or inactive recombinant Lp-PLA2 (same concentration as the active-Lp- PLA2) for 4 hours. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by ** P<0.01. 3.8  Recombinant Lp-PLA2 enzyme reduced foam cell formation If Lp-PLA2 could reduce oxLDL cellular association in a 4 hour biological assay we then wanted to assess whether Lp-PLA2 could influence the development of foam cells, conditions associated with higher concentrations of oxLDL over longer incubation times. We incubated macrophages with 50 µg/mL oxLDL for 24 hours in the presence of 5 nmol/min/mL Lp-PLA2 enzyme activity. Lp-PLA2 reduced cholesterol accumulation by 29% compared with either control condition or inactive-Lp-PLA2 (Figure 3.25).   86  Figure 3.25 Active Lp-PLA2 reduced cholesterol accumulation in MDM. MDM were loaded with 50 µg/mL oxLDL in the presence of either PBS, active recombinant Lp-PLA2 (5 nmol/min/mL) or inactive recombinant Lp-PLA2 for 24 hours. Data are presented as a percentage of the control condition and represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by *** P<0.001. 3.9  HepG2/MDM cells took up more pefabloc-pretreated oxLDL than untreated oxLDL To assess the influence of endogenous Lp-PLA2 already present on lipoproteins we used Pefabloc, a serine esterase inhibitor, to inhibit Lp-PLA2 activity on LDL prior to oxidation. There was nearly no Lp-PLA2 activity remaining after 30 min treatment of 1mM Pefabloc. We observed in macrophages and HepG2 cells that pefabloc-oxLDL was associated with a greater degree of cellular association compared with untreated oxLDL (Figure 3.26).   87   Figure 3.26 Pefabloc treated oxLDL increased cellular association in HepG2 cells (panel A) and MDM (panel B). Cells were treated with 10 µg/mL DiI-labeled oxLDL or Pefabloc pretreated DiI-oxLDL for 4 hours. Data are presented as a percentage of control (i.e. oxLDL cellular association) and represent 3 independent experiments performed in triplicate. Statistical significance was tested by student’s t-test, and indicated by ** P<0.01 *** P<0.001.  88 3.10  Lp-PLA2 did not change LDL/oxLDL physical properties To assess the mechanism by which the catalytic properties of Lp-PLA2 influenced oxLDL cellular association, we analyzed the size, charge, and aggregation status of oxLDL following Lp-PLA2 treatment. Changes in either one of them would potentially affect lipoprotein cellular association by cells.  We hypothesized that oxLDL charge may be modified by active-Lp-PLA2. However, there was no difference among PBS treated, active-Lp-PLA2 treated and inactive-Lp- PLA2 treated oxLDL based on migration in agarose gels (Figure 3.27) Also, no differences were observed for the treatment of native LDL.  The size of oxLDL after Lp-PLA2 treatment was evaluated by native PAGE gradient gels (2-7.5%). (Figure 3.28) We hypothesized that Lp-PLA2 could change oxLDL size by hydrolyzing oxPC and even some of the native PC with short sn-2 fatty acid chain. However, Lp-PLA2 did not obviously affect oxLDL size as reflected by this gel, compared with PBS treated and inactive-Lp-PLA2 treated. Also, the size of native LDL did not appear to be effected by Lp-PLA2 treatment.  The last physical property we analyzed was the aggregation status of oxLDL after Lp- PLA2 treatment. We hypothesized that Lp-PLA2 might cause oxLDL aggregation by degrading oxPC given the fact that some of the other PLA2 enzymes have been shown to promote LDL aggregation.[94, 331-333] However, from the OD 450 reading, there was no significant difference observed (data not shown). It is possible that more subtle  89 physical changes of oxLDL occurred that were not detectable using the applied methods. [334]  In MDM treated with oxLDL and Lp-PLA2 enzyme for 24 hours, we did not observe altered CD36 expression compared with control conditions, assessed by flow cytometry. (data not shown)   Figure 3.27 Assessment of the effect of Lp-PLA2 treatment on lipoprotein charge. Native LDL and oxLDL (50 µg/mL) were treated with PBS (as control), active Lp-PLA2 (5 nmol/min/mL) and inactive-Lp-PLA2 (same concentration as act-Lp-PLA2) for 4 hours. Six µl of each lipoprotein was loaded on the agarose gel. Native LDL was run as a control. After 45 minutes of electrophoresis, the agarose gel was fixed and stained by Sudan black.  90  Figure 3.28 Assessment of the effect of Lp-PLA2 treatment on lipoprotein size. Native LDL and oxLDL (50 µg/mL) were treated with PBS (as control), active Lp-PLA2 (5 nmol/min/mL) and inactive Lp-PLA2 (same concentration as active Lp-PLA2) for 4 hours. Four µg of each lipoprotein was mixed with sudan black and sucrose and loaded on a native PAGE gradient gel (2-7.5%) followed by running 30 min at 50V and 5 hours at 100V. Pooled human plasma was run as a control. 3.11  LysoPC generation in oxLDL/oxLp(a) treated with Lp-PLA2 In experiments involving the treatment of oxLDL with purified Lp-PLA2, it is expected that a portion of oxPC would be hydrolysed releasing lysoPC and oxFAs. To assess the degree of hydrolysis we quantified the amount of lysoPC following Lp-PLA2 treatment of oxLDL. Treatment of oxLDL with active-Lp-PLA2 was associated with 30% more lysoPC compared with the control condition or inactive-Lp-PLA2 (Figure 3.29). Pefabloc pretreated oxLDL was associated with 40% less lysoPC compared with the control condition. Lp-PLA2 did not generate lysoPC significally when native LDL was used as a  91 substrate (data not shown). After Lp-PLA2 treatment, Lp-PLA2 generated 87% more lysoPC in oxLp(a), a greater amount compared to oxLDL (Figure 3.29).  Figure 3.29 LysoPC content in oxLDL and oxLp(a) treated with Lp-PLA2 or pefabloc. oxLDL (10 µg/mL) or oxLp(a) (10 µg/mL) were either pretreated with Pefabloc or PBS as a control condition prior to oxidation, then treated with either PBS (control condition), active recombinant Lp-PLA2 (3 nmol/min/mL) or inactive recombinant Lp-PLA2 for 4 hours prior to lysoPC measurement. Data are presented as a percentage of control and represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by * P<0.05, ** P<0. 01, and *** P<0.001. 3.12  LysoPC treatement of MDM and HepG2 cells was associated with an increase in cellular association of oxLDL and oxLp(a) As one of the Lp-PLA2 hydrolysis products, lysoPC could have a role in lipoprotein cellular association in both macrophages and HepG2 cells. We performed experiments assessing the effect of lysoPC on lipoprotein cellular association using a concentration  92 range from 5 to 40 µM (a range not associated with cellular toxicity). Figure 3.30 indicates that lysoPC increased oxLDL and oxLp(a) cellular association in both macrophages and HepG2 cells dose-dependently. LysoPC also increased the cellular association of native LDL and HDL (data not shown).  We evaluated whether lysoPC could affect some physical properties of oxLDL and native LDL. We performed the same assays as described earlier to evaluate the effects of Lp- PLA2 treatment on lipoproteins. Neither the size, charge, nor aggregation state appeared to be affected by lysoPC treatment (data not shown).  To investigate whether the increased oxLDL and oxLp(a) cellular association was mediated by a change in scavenger receptor expression, we assessed CD36 expression by flow-cytometry. The concentration of CD36 did not appear to be changed by lysoPC in MDM (Figure 3.31). The expression of CD36 in HepG2 cells was too low to reliably assess using this method. In addition, lysoPC did not affect Lp-PLA2 expression by either HepG2 cells or MDM (data not shown).  The other products of the Lp-PLA2 reaction, namely oxidized fatty acids (oxFAs) are likely to be more heterogeneous and have not been characterized. In the absence of any commercially available products, we were unable to assess the influence of oxFAs. However, we performed preliminary experiments using long chain oxFAs, namely 9- HODE and 15-HETE, and observed reductions in oxLDL cellular association in both HepG2 cells and THP-1 cells (data not shown).  93   94  Figure 3.30 LysoPC enhanced oxLDL and oxLp(a) cellular association by MDM and HepG2 cells. Cells were starved in lipoprotein deficient medium for 1 day before a 4-hour lipoprotein association assay. LysoPC (5-40 µM) dissolved in ethanol was co-incubated with oxLDL (10 µg/mL) or oxLp(a) (10 µg/mL) in the culture medium. Ethanol treatment alone (0.4%) served as control. Panel A, oxLDL cellular association in MDM, Panel B oxLp(a) cellular association in MDM, Panel C, oxLDL cellular association in HepG2, Panel D, oxLp(a) cellular association in HepG2. Data are presented as a percentage of the control condition and represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test, and indicated by ** P<0.01.  95   Figure 3.31 CD36 expression in MDM after lysoPC treatment. Matured MDM were treated with 20 µM lysoPC for 4 hours. Ethonal served as a control. MDM were then fixed and analyzed by flow cytometry to evaluate CD36 expression as descrbed in the Materials and Methods. 3.13  LysoPC did not affect liquid phase uptake in either MDM or HepG2 cells As described in the introduction, there are many ways by which cells can take up lipoproteins. We hypothesized that liquid phase uptake or pinocytosis could be altered by lysoPC treatment. We co-incubated cells with Lucifer Yellow and different concentrations of lysoPC. No differences in Lucifer Yellow cellular association were observed for HepG2 cells (Figure 3.32) or MDM (data not shown). We also exposed HepG2 cells to lysoPC, Lucifer Yellow and DiI labeled oxLDL together in order to track the Lucifer Yellow uptake and DiI-oxLDL uptake at the same time. We saw the increased DiI labeled oxLDL uptake as always, by not Lucifer Yellow. Therefore, it did not seem that an increased liquid phase uptake was responsible for the increased oxLDL/oxLp(a) cellular association associated with lysoPC treatment.  96   Figure 3.32 LysoPC did not change Lucifer yellow cellular association in HepG2 cells. Cells were starved in lipoprotein deficient medium for 1 day before a 4-hour Lucifer yellow association assay. LysoPC (5-40 µM) dissolved in ethanol was co-incubated with Lucifer yellow (500 mg/mL) in the culture medium. Ethanol treatment alone (0.4%) served as control. Data represent 3 independent experiments performed in triplicate. Statistical significance between control and treatment groups was assessed by one way ANOVA followed by a post-hoc Tukey test. 3.14  LysoPC affected cholesterol efflux in MDM We also assessed whether lysoPC influences cholesterol efflux in human MDM. We cholesterol loaded macrophages with 50 µg/mL oxLDL containing 1 µCi/mL 3H- cholesterol. Subsequently, we performed cholesterol efflux under 3 conditions, non- acceptor-mediated, apoAI-mediated and HDL-mediated, all in the presence of lysoPC. LysoPC (20 µM) increased cholesterol efflux in the non-acceptor-mediated condition by 1.6-fold (Figure 3.33). However, lysoPC decreased HDL-mediated cholesterol efflux by 60% (Figure 3.34). For apoAI-mediated efflux, there was no consistent difference (data not shown).  97  Figure 3.33 LysoPC treatment of MDM increased non-acceptor mediated cholesterol efflux. MDM were loaded by 50 µg/mL oxLDL and 1 µCi/mL 3H-cholesterol for 1 day. Overnight cholesterol efflux assay was performed in the presence of lysoPC (10-20 µM). Same volume of ethanol was used as a control.   Figure 3.34 LysoPC treatment of MDM decreased HDL mediated cholesterol efflux. MDM were loaded by 50 µg/mL oxLDL and 1 µCi/mL 3H-cholesterol for 1 day. Overnight cholesterol efflux assay was performed in the presence of lysoPC (10-20 µM) and 25 µg/mL HDL. Same volume of ethanol was served as a control for lysoPC. ** P<0.01   98 4  Discussion 4.1  Oxidized lipid treatment of human macrophages and HepG2 cells is associated with a decrease in lipoprotein-associated phospholipase A2 activity Although specific substrates of Lp-PLA2 have been described, much less is known about how this enzyme is regulated at a cellular level. In the present study, we investigated the influence of specific oxidized lipids known to exist in human atherosclerotic lesions on the expression of Lp-PLA2 in monocyte-derived macrophages and HepG2 cells.  We report that bioactive oxidized lipids such as PGPC, POVPC, 7-KC, 7β-OC, 9-HODE, and 15-HETE did not change Lp-PLA2 expression as assessed by mRNA and protein measurements. There is little information on the mechanisms that can influence the transcriptional control of Lp-PLA2. However, one study has shown that the p38 MAPK pathway mediates transcriptional activation of the plasma PAF-AH gene in macrophages stimulated with lipopolysaccharide.[154] In the present study, although there was little evidence that the selected oxidized lipids could influence the transcription or translation of Lp-PLA2 in the applied in vitro cell models, a direct catalytic effect of these compounds could be observed.  Whether the enzyme originated from monocyte-derived macrophages or HepG2 cells, the presence of oxidized lipids was associated with a significant decrease in Lp-PLA2 enzyme activity. Since PGPC and POVPC are known substrates of Lp-PLA2, it possible that they may have competed with 3H-PAF in the enzyme assay system despite the molar  99 excess of PAF. In any case, the mechanisms responsible for the observed decrease in Lp- PLA2 activity require further investigation and may involve interference with the lipid binding domain and/or active site region of the enzyme. Results from the present study as well as previous reports identifying free oxygen radicals and peroxynitrite [182, 335] reducing Lp-PLA2 activity indicate that function of this enzyme could be seriously compromised under conditions of oxidative stress.  In conclusion, the oxidized lipids PGPC, POVPC, 7-KC, 7β-OC, 9-HODE, and 15-HETE did not appear to appreciably affect Lp-PLA2 mRNA and protein levels in monocyte- derived macrophages and HepG2 cells but could significantly impair Lp-PLA2 enzyme activity. 4.2  Switching cell models from THP-1 cells to monocyte-derived macrophages In the initial studies of this thesis project using THP-1 cells and GOF/LOF lentivirus, we failed to see a consistent difference in oxLDL cellular association in THP-1 cells after over expression or knocking down endogenous Lp-PLA2 expression. However, we observed reduced oxLDL cellular association in MDM treated with purified recombinant Lp-PLA2.  There are four proposed reasons for the differences observed. Firstly, THP-1 cells are a transformed cell line derived from cancerous cells. Cancer-derived cell lines do not always accurately represent the qualities of primary cells. Secondly, PMA or similar synthetic agent is needed to differentiate THP-1 cells into mature THP-1 macrophages.  100 However, this stimulation is potent and artificial and is likely to have different properties compared to more physiological differentiation conditions. Thirdly, we transduced THP- 1 macrophages by lentivirus in order to manipulate Lp-PLA2 expression. Virus infected macrophages are likely to have qualities that correspond to the infection of the virus. As an example, we observed that lentivirus infected THP-1 cells had an increase in cellular indicators of oxidative stress (data not shown). Also, it is been shown that HIV infected macrophages have altered lipid metabolism.[336, 337] Taken together, these limitations may have influenced our ability to properly address the assessment of the effect of Lp- PLA2 on lipid metabolism in these cells. Lastly, given the constitutive secretion of Lp- PLA2 by macrophages and the presence of endogenous Lp-PLA2 associated with lipoproteins, we found that the use of purified recombinant Lp-PLA2 combined with primary monocyte-derived macrophages offered the best model to achieve the greatest differences in Lp-PLA2 concentration in our experimental system. 4.3  Lipoprotein-associated phospholipase A2 decreases oxidized lipoprotein cellular association in human macrophages and hepatocytes Although Lp-PLA2 is recognized as a biomarker of cardiovascular diseases, it remains unclear what direct mechanisms may exist to explain the relationship between Lp-PLA2 and cardiovascular disease. In earlier studies, Lp-PLA2, also known as PAF-AH has been recognized to degrade PAF. Therefore, Lp-PLA2 is able to diminish the pro-inflammatory role of PAF in a variety of diseases, such as asthma, systemic lupus erythematosus, juvenile rheumatoid arthritis.[137] In the past two decades, oxPC containing short sn-2 chains have also been reported to be the substrate of Lp-PLA2.[168] Oxidation of PC on LDL is believed to occur under conditions of oxidative stress in both the circulation and  101 within atherosclerotic lesions. An excess of oxPC can be attributed to pro-coagulant properties observed for endothelial cells, and act as a chemoattractant to leukocytes.[197, 206] Therefore, the degradation oxPC by Lp-PLA2 was initially anticipated to be beneficial.  The in vitro evidence described above provided a rationale to initiate animal studies to investigate the effect of over-expression Lp-PLA2 in diseased animal models. So far, in all studies involving rodents, over-expression of Lp-PLA2 reduced local inflammation and atherogenesis in selected models.[15, 275, 296-300] These findings are consistent with the properties of Lp-PLA2 associated with its ability to degrade pro-inflammatory factors, such as PAF and oxPC.  However, since most of the human clinical studies have indicated that Lp-PLA2 is a biomarker for cardiovascular disease, there was an interest in the development of specific inhibitors of Lp-PLA2. In the past year, three prominent studies investigating the utility of a specific Lp-PLA2 inhibitor (Darapladip) have been described. In a human clinical trial, patients given Darapladib for 1 year demonstrated the elimination of necrotic core expansion compared to the progression in the placebo group. However, the atheroma volume in the treatment group did not appear to be altered by the Lp-PLA2 inhibitor.[179] Twelve months of Darapladib treatment also reduced IL-6 and hs-CRP by 12% and 13% in CAD patients, respectively.[338] Using the same inhibitor in an atherosclerotic pig model, reductions in the necrotic core and plaque area, and fewer unstable plaques were observed compared with the control group.[180]  102  A number of questions arise when one compares the results of human clinical studies with rodent studies. What are the possible explanations for the differences observed between human studies and rodent studies? Is there a direct proatherogenic role of Lp- PLA2 in humans? Other than the previously described anti-inflammatory role (degradation of PAF and oxPC), could Lp-PLA2 play additional roles in lipoprotein metabolism that could promote atherogenesis?  In the present study, we examined the role of endogenous and exogenous sources of Lp- PLA2 on the metabolism of oxidized lipoproteins in both MDM and HepG2 cells. From our data it appears that through the hydrolysis of oxPC, Lp-PLA2 can reduce the cellular association of oxidized LDL and Lp(a) by MDM and HepG2 cells.  Circulating levels of LDL and Lp(a) are positively associated with atherogenesis. The oxidative modification of lipoproteins is thought to be one of the key mechanisms that contribute to the development of atherosclerotic lesions. There is evidence that antibodies specific for oxLDL develop and are present in the circulation.[16, 339] The same oxidative modification may also occur within individuals who have elevated levels of Lp(a). Antibodies specific for oxLDL, oxidized lipids and immune complexes have been identified within atherosclerotic lesions.[16] Therefore, the metabolism of oxLDL and oxLp(a) are likely to influence the accumulation of cholesterol within atherosclerotic lesions.   103 In the current study, we chose to study human primary monocyte-derived macrophages as it is key cell type involved in lipoprotein metabolism and atherogenesis. We also chose to study HepG2 cells as hepatocytes play a dominant role in the synthesis and catabolism of lipoproteins, including oxLDL. As much as 90% of injected oxLDL was cleared by the liver within 5 minutes in a mouse model.[128] Therefore, hepatocytes are likely to play an important role in determining the concentration of circulating oxLDL. Interestingly, macrophages and hepatocytes are the major cell types to generate Lp-PLA2 in vivo as well.[138, 140]  We observed that catalytically active Lp-PLA2 decreased the cellular association of oxLDL and oxLp(a) in MDM and HepG2 cells whereas inactive enzyme did not have any appreciable effect. Furthermore, cholesterol accumulation in MDM was reduced when oxLDL was treated with active recombinant Lp-PLA2. From these findings, we concluded that in contrast to our initial hypothesis, there was no significant catalytic- independent function of Lp-PLA2 that influenced oxidized lipoprotein metabolism in either cell type. These results are in contrast to those observed for other lipases such as lipoprotein lipase and endothelial lipase.[340, 341] This finding may favor measuring Lp- PLA2 activity as opposed to Lp-PLA2 mass in clinical studies given that there is mechanistic link between active Lp-PLA2 and lipid metabolism from our current study.  As such, it appeared that the catalytic activity of Lp-PLA2 was necessary to mediate these effects and that change in the biophysical properties such as charge, size or state of lipoprotein aggregation did not occur following enzyme treatment. Previous studies have  104 indicated that the physical properties of lipoproteins can be modified by a variety of PLA2 treatments.[94, 331-333] The hydrolysis of PC on LDL particles caused alteration of particle size, charge and aggregation status. Changes in any one of these properties may affect lipoprotein metabolism by macrophages. More specifically, alteration in affinity to the LDL receptor have been associated with smaller particle size and an increased negative charge.[342, 343] Aggregated LDL is usually associated with increased cellular uptake by means of phagocytosis,[87] and is LDL receptor independent.[104]  In our experimental model, about half of the PC is proposed to be oxPC and related fragments in copper-oxidized LDL according to the study done by Meyer DF and his colleagues.[344] A portion of this oxPC would be expected to be species containing a short sn-2 chain, a substrate for Lp-PLA2. As such, degradation of such oxPC by Lp- PLA2 may theoretically alter the physical properties of oxLDL and thus its subsequent cellular association. However, we did not observe any visible difference of size, charge and aggregation status after Lp-PLA2 treatment. Nevertheless, it is possible that more subtle changes could have occurred such as modification of apoB secondary structure as has been described previously in phospholipase-treated native LDL.[334]  In our experimental models, we observed a measured increase in lysoPC production following Lp-PLA2 treatment suggesting that Lp-PLA2 was hydrolyzing oxPC. Similarly, Pefabloc (an inhibitor of serine esterases) treated oxLDL was associated with an increased cellular association in HepG2 cells and MDM. Therefore, we hypothesize that  105 the most likely explanation of reduced cellular association of oxidized lipoproteins observed in our study is due to a reduction in ligands for cell surface scavenger receptors which mediate oxLDL uptake.[77, 216] The observation that Lp-PLA2 also reduced the cellular association of oxLp(a) suggests that similar ligands exist on this modified lipoprotein as has been previously described in an in vivo rat model.[129]  Several scavenger receptors characterized so far including CD36, SR-A, SR-BI, and LOX-1 are able to recognize modified lipoproteins, such as oxLDL and acLDL.[226, 345] However, the function of scavenger receptors in hepatocytes are less studied than that of receptors present on macrophages. There are reports that SR-BI[346] and CD36[347, 348] are expressed on hepatocytes. As such, hepatocytes may share common pathways with macrophages related to the metabolism of oxLDL. For oxLDL recognition, both modified apoB and oxPC may be recognized as ligands.[75, 76] However it remains unknown about any differences in affinity between long-chain oxPC and short-chain oxPC for scavenger receptors. A report by Davis et al. [349] shows that long chain oxPC is dominant (around 50 times more) in oxLDL compared with short chain oxPC in copper oxidized LDL. It would be of interest to see how Lp-PLA2 affects the oxPC composition (oxPC with different length of sn-2 chain) given that our recombinant Lp-PLA2 generates 20-30% lysoPC. Could some of long chain oxPC also be the Lp-PLA2 substrate, which are still uncharacterized so far? ApoB-oxPC adducts play a significant role for scavenger receptor recognition.[216] It would be of interest to investigate whether degradation of oxPC by Lp-PLA2 would also affect the concentration and conformation of the apoB-oxPC adduct.  106  The ability of active Lp-PLA2 to reduce the cellular association of oxidized lipoproteins was statistically significant but still relatively modest at about a 30-40% reduction. This observation is consistent with the substrate preference of Lp-PLA2 for oxidized phospholipids containing only short sn-2 chains.[168, 172] As a result, long chain oxPC and oxidized forms of apoB would remain intact and facilitate the recognition and metabolism of these lipoproteins by scavenger receptors.  The ability of Lp-PLA2 to reduce the cellular association of oxLDL by macrophages would likely limit foam cell formation within atherosclerotic lesions and may correspond to anti-atherogenic effects attributed to Lp-PLA2 which have been observed in short-term animal model studies.[300] However, the ability of Lp-PLA2 to reduce oxLDL cellular association by hepatocytes could promote the accumulation of Lp-PLA2 modified oxidized lipoproteins in the circulation.  These in vitro data are also supported by human population studies which describe an inverse relationship between Lp-PLA2 activity and oxPC, and a positive relationship between Lp-PLA2 activity and oxLDL in circulation.[350] Also in human carotid atherosclerotic plaques, there is positive correlation between Lp-PLA2 (both mass and activity) with oxLDL.[351] However overall, there are not many clinical studies in which both oxLDL and Lp-PLA2 were monitored in patients under different diseased conditions. Lp-PLA2 modified oxLDL (reduced oxPC concentration) might alter its recognition by oxLDL antibodies, which may be specific for either epitopes of oxidized  107 apoB, oxPC or apoB/oxPC adduct. As a result, such studies may not reflect perfectly an association between Lp-PLA2 levels and oxLDL concentration.  Beyond the possibility of reduced oxLDL cellular association by macrophages mediated by Lp-PLA2, are there some other pro-atherogenic or anti-atherogenic effects of the Lp- PLA2-modified-oxLDL? More specifically, can Lp-PLA2-modified-oxLDL mediate endothelial dysfunction differently from regular oxLDL? Can the Lp-PLA2-modified- oxLDL influence apoptosis of local cells within the lesion differently from regular oxLDL? Can Lp-PLA2-modified-oxLDL promote local inflammation by inducing cytokines or reactive oxygen species generation by the local cells differently from regular oxLDL? To better understand the role of Lp-PLA2, these questions will need to be addressed in the future.  Lp-PLA2 is naturally secreted by monocytes, macrophages and hepatocytes. In cases such as inflammation or cytokine treatment, Lp-PLA2 secretion was modified. Normally, only about 1% LDL has Lp-PLA2 on. It is not clear the proportion of Lp-PLA2 bound HDL and Lp(a). The physiological reason for the distribution of Lp-PLA2 among lipoproteins is worth investigation. Dampening oxPC in LDL appears to be one of the most likely positive roles played by Lp-PLA2 in both normal and diseased conditions. However, Lp- PLA2 modified oxLDL has the lower cellular association ability by MDM and HepG2 cells, which potentially causes oxLDL accumulation in lesion and circulation. The physiopathological meaning of this apparent pros and cons of Lp-PLA2 in this scenario is worth investigating.  108  It has been suggested that the generation of lysoPC and/or oxidized fatty acids by Lp- PLA2 may mediate its atherogenic potential, as reviewed in introduction. We observed in the present study that lysoPC can markedly increase the cellular association of oxLDL and oxLp(a) in MDM and HepG2 cells. The physical properties (particle size, charge and aggregation status) of lysoPC treated oxLDL were not changed. The expression of the major scavenger receptors CD36 did not appear to be changed by lysoPC. We further investigated whether lysoPC induced pinocytosis, which is another mechanism that macrophages may use to take up lipoproteins.  Using a liquid phase uptake marker, Lucifer yellow, we did not observe any significant changes in pinocytosis in MDM or HepG2 cells associated with lysoPC treatment. It has been reported previously that lysoPC increased oxidized LDL uptake by inducing scavenger receptor LOX-1 expression in bovine endothelial cells[310] and smooth muscle cells.[311] In addition, lysoPC has been shown to stimulate proteoglycan synthesis, which could facilitate lipoprotein binding and uptake, as well as lipoprotein retention in the subendothelial space of atherosclerotic plaques.[130, 313, 352-354] However, the specific mechanisms by which lysoPC facilitated lipoprotein uptake in the present cellular model remains unclear and requires further study.  In order for macrophages to become foam cells, cholesterol efflux plays an important role which determines net cholesterol accumulation. In the current study, we found that lysoPC not only increased oxLDL cellular association, but also affected cholesterol  109 efflux. LysoPC increased non-acceptor-mediated cholesterol efflux in macrophages whereas lysoPC reduced HDL-mediated cholesterol efflux. Two other groups have reported that lysoPC can enhance non-acceptor mediated cholesterol efflux by increasing apoE expression and stimulating PPARγ-LXRα-ABCA1pathway in mouse macrophages.[306, 307] We speculate that the same mechanism may be involved in human macrophages. If the cholesterol effluxed out by macrophages dominates over the lipoprotein cellular association under lysoPC treatment, this may explain in part the reduced oxLDL accumulation in the presence of Lp-PLA2. With regards to HDL- mediated cholesterol efflux, we speculate that an increase in lysoPC will result in inhibition of lecithin: cholesterol acyltransferase (LCAT) activity which could reduce the cholesterol gradient promoting efflux. Also, from our preliminary data, lysoPC increased HDL uptake by cells as well. Less HDL left in the medium likely reduces HDL- medicated cholesterol efflux. LysoPC could alter some physical properties of HDL which are initially favorable for cholesterol efflux. ABCG1 expression might also be affected by lysoPC treatment resulting in less HDL-medicated cholesterol efflux.  OxFAs generated from oxLDL by Lp-PLA2 are very poorly studied so far. This might be because of the heterogenous nature of oxFAs. In our current study, we used 2 types of oxFAs, 15-HETE and 9-HODE to make a preliminarily investigation on their effects on oxLDL cellular association. Both 15-HETE and 9-HODE reduced oxLDL cellular association remarkably in HepG2 cells and macrophages, which was the opposite of the lysoPC effect, but consistent with the reduced cellular association after Lp-PLA2 treatment. However, 15-HETE and 9-HODE belong to long-chain oxFAs. This could  110 behave differently from short chain oxFAs generated from short-chain oxPC by Lp- PLA2. The production of oxFAs mediated by Lp-PLA2 hydrolysis of oxPC may have also contributed the observed reduction of the cellular association of oxidized lipoproteins following treatment of active Lp-PLA2.  Many studies have shown that lysoPC can contribute to a variety of proatherogenic roles, such as increasing monocyte chemotaxis, generating reactive oxygen species, generating inflammatory cytokines and chemokines, and promoting smooth muscle cell proliferation (recently reviewed by Matsumoto T et al.[223]). As a result, the production of lysoPC or oxidized fatty acids by Lp-PLA2 in chronic inflammatory conditions existing in human atherosclerosis may contribute to its association with cardiovascular disease in human population studies.   111 Model of conclusion Macrophages or Hepatocytes Scavenger receptors Scavenger receptors Native LDL oxLDL Lp- PLA2 modified oxLDL PC oxPC apoB ox apoB oxFAs lysoPC Lp- PLA2 Recognition ability Figure 4.1 Model of conclusions In conditions of oxidative stress, native LDL will be oxidized into oxLDL, where PC will first become oxPC, along with apoB. OxPC and ox-apoB are the ligands for scavenger receptors expressed by macrophages and hepatocytes, by which oxLDL is taken up by cells. In the presence of excess Lp-PLA2, short-chain oxPC will be hydrolyzed, giving rise to lysoPC and oxFAs. Less oxPC on oxLDL results in less recognition by scavenger receptors, therefore less cellular association by cells. 4.4  Is there a discrepancy between the results of human and animal studies? As discussed in the Introduction, there is a potential discrepancy about conclusions related to the role of Lp-PLA2 between human studies and rodent studies, or even between swine and rodents. There are several possible explanations which may account for these divergent results. The development of lesions in susceptible rodent models occurs over a relatively short time period with remarkably acute inflammation taking place. In this scenario, PAF could be the dominating pro-disease factor. Therefore,  112 degradation of PAF by Lp-PLA2 might help ameliorate atherogenesis. In prolonged chronic inflammatory conditions associated with human atherosclerosis, hydrolytic products of Lp-PLA2 may accumulate overtime and dominate the diseased condition. Also, rodents carry most of their lipid in HDL particles where the function of Lp-PLA2 may differ in comparison to its dominant association with LDL in humans. In fact, a number of studies suggest HDL bound Lp-PLA2 could be more protective compared to LDL bound Lp-PLA2.[165, 176, 355-357] In hypercholesterolemia patients, there is a reduced ratio between HDL bound Lp-PLA2 activity and that of LDL.[357] One could also argue that the elevated levels of Lp-PLA2 present in patients with cardiovascular disease may reflect a protective response. However, the early investigation of Lp-PLA2 inhibitor Darapladib[179, 180] demonstrating a potential benefit provides some support to a direct proatherogenic effect of Lp-PLA2.  In the current study, we report the ability of endogenous and exogenous Lp-PLA2 to reduce foam cell formation by catalytic function in human-derived macrophages, a phenomenon likely to improve atherosclerosis. However, the reduced cellular association of oxLDL by hepatocytes might cause the Lp-PLA2 modified oxLDL accumulation in circulation, which may increase the likelihood to cause endothelial dysfunction. The overexpression of Lp-PLA2 caused macrophage death in our experiment. Similar study was also reported by others,[176] which could indicate too much Lp-PLA2 cause unnecessary macrophage death, therefore worsening atherosclerosis. The production of lysoPC mediated by Lp-PLA2 in oxLDL may also initiate a variety of proatherogenic  113 effects, which over an extended period of chronic inflammation may promote atherogenesis.  Therefore, Lp-PLA2 may have a dual nature in regard to its relative role in atherogenesis. In cardiovascular disease, whether Lp-PLA2 has a direct mechanistic link requires further study. Lp(a) and oxPC/apoB are the strong cardiovascular disease markers disclosed in recent years. Lp(a) is enriched in Lp-PLA2 and oxPC compared to other lipoproteins in the circulation. This leads to the question of whether Lp-PLA2 is able to hydrolyze oxPC in Lp(a) particles. If such activity does exist, does it promote or protect against the progression of cardiovascular disease?  The specific relationship of Lp-PLA2 and Lp(a) represents an important area of future research.   114 References 1. Choudhury, R.P., V. Fuster, and Z.A. Fayad, Molecular, cellular and functional imaging of atherothrombosis. Nat Rev Drug Discov, 2004. 3(11): p. 913-25. 2. Hansson, G.K., Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med, 2005. 352(16): p. 1685-95. 3. Hansson, G.K. and P. Libby, The immune response in atherosclerosis: a double- edged sword. Nat Rev Immunol, 2006. 6(7): p. 508-19. 4. Skalen, K., et al., Subendothelial retention of atherogenic lipoproteins in early atherosclerosis. Nature, 2002. 417(6890): p. 750-4. 5. Smith, J.D., et al., Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proc Natl Acad Sci U S A, 1995. 92(18): p. 8264-8. 6. Jones, C.B., D.C. Sane, and D.M. Herrington, Matrix metalloproteinases: a review of their structure and role in acute coronary syndrome. Cardiovasc Res, 2003. 59(4): p. 812-23. 7. Yeh, M., et al., Role for sterol regulatory element-binding protein in activation of endothelial cells by phospholipid oxidation products. Circ Res, 2004. 95(8): p. 780-8. 8. Jonasson, L., et al., Regional accumulations of T cells, macrophages, and smooth muscle cells in the human atherosclerotic plaque. Arteriosclerosis, 1986. 6(2): p. 131-8. 9. Bobryshev, Y.V. and R.S. Lord, S-100 positive cells in human arterial intima and in atherosclerotic lesions. Cardiovasc Res, 1995. 29(5): p. 689-96. 10. Kaartinen, M., A. Penttila, and P.T. Kovanen, Accumulation of activated mast cells in the shoulder region of human coronary atheroma, the predilection site of atheromatous rupture. Circulation, 1994. 90(4): p. 1669-78. 11. Dansky, H.M., et al., T and B lymphocytes play a minor role in atherosclerotic plaque formation in the apolipoprotein E-deficient mouse. Proc Natl Acad Sci U S A, 1997. 94(9): p. 4642-6. 12. Beckman, J.S., et al., Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci U S A, 1990. 87(4): p. 1620-4. 13. Palinski, W., et al., Cloning of monoclonal autoantibodies to epitopes of oxidized lipoproteins from apolipoprotein E-deficient mice. Demonstration of epitopes of oxidized low density lipoprotein in human plasma. J Clin Invest, 1996. 98(3): p. 800-14. 14. Salonen, J.T., et al., Autoantibody against oxidised LDL and progression of carotid atherosclerosis. Lancet, 1992. 339(8798): p. 883-7. 15. Turunen, P., et al., Adenovirus-mediated gene transfer of Lp-PLA2 reduces LDL degradation and foam cell formation in vitro. J Lipid Res, 2004. 45(9): p. 1633-9. 16. Yla-Herttuala, S., et al., Evidence for the presence of oxidatively modified low density lipoprotein in atherosclerotic lesions of rabbit and man. J Clin Invest, 1989. 84(4): p. 1086-95.  115 17. Shaw, P.X., et al., The autoreactivity of anti-phosphorylcholine antibodies for atherosclerosis-associated neo-antigens and apoptotic cells. J Immunol, 2003. 170(12): p. 6151-7. 18. Poulter, N., Coronary heart disease is a multifactorial disease. Am J Hypertens, 1999. 12(10 Pt 2): p. 92S-95S. 19. Lusis, A.J., A.M. Fogelman, and G.C. Fonarow, Genetic basis of atherosclerosis: part I: new genes and pathways. Circulation, 2004. 110(13): p. 1868-73. 20. Brousseau, M.E. and E.J. Schaefer, Diet and coronary heart disease: clinical trials. Curr Atheroscler Rep, 2000. 2(6): p. 487-93. 21. Schell, W.D. and J.N. Myers, Regression of atherosclerosis: a review. Prog Cardiovasc Dis, 1997. 39(5): p. 483-96. 22. Sipahi, I., et al., Coronary atherosclerosis can regress with very intensive statin therapy. Cleve Clin J Med, 2006. 73(10): p. 937-44. 23. Tabas, I., Nonoxidative modifications of lipoproteins in atherogenesis. Annu Rev Nutr, 1999. 19: p. 123-39. 24. Smith, E.B. and E.M. Staples, Distribution of plasma proteins across the human aortic wall--barrier functions of endothelium and internal elastic lamina. Atherosclerosis, 1980. 37(4): p. 579-90. 25. Schimke, I., et al., Influence of long-term supplementation with alpha-linolenic acid on myocardial lipid peroxidation and antioxidative capacity in spontaneously hypertensive rats. Prostaglandins Leukot Essent Fatty Acids, 1997. 57(6): p. 545-50. 26. Jaakkola, O., et al., Macrophage foam cells from human aortic fatty streaks take up beta-VLDL and acetylated LDL in primary culture. Atherosclerosis, 1989. 79(2-3): p. 173-82. 27. Rosenfeld, M.E., et al., Distribution of oxidation specific lipid-protein adducts and apolipoprotein B in atherosclerotic lesions of varying severity from WHHL rabbits. Arteriosclerosis, 1990. 10(3): p. 336-49. 28. Steinbrecher, U.P. and M. Lougheed, Scavenger receptor-independent stimulation of cholesterol esterification in macrophages by low density lipoprotein extracted from human aortic intima. Arterioscler Thromb, 1992. 12(5): p. 608-25. 29. Esterbauer, H., et al., The role of lipid peroxidation and antioxidants in oxidative modification of LDL. Free Radic Biol Med, 1992. 13(4): p. 341-90. 30. Steinbrecher, U.P., et al., Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci U S A, 1984. 81(12): p. 3883-7. 31. Fuhrman, B., et al., Increased uptake of LDL by oxidized macrophages is the result of an initial enhanced LDL receptor activity and of a further progressive oxidation of LDL. Free Radic Biol Med, 1997. 23(1): p. 34-46. 32. Leake, D.S. and S.M. Rankin, The oxidative modification of low-density lipoproteins by macrophages. Biochem J, 1990. 270(3): p. 741-8. 33. Fless, G.M., M.E. ZumMallen, and A.M. Scanu, Physicochemical properties of apolipoprotein(a) and lipoprotein(a-) derived from the dissociation of human plasma lipoprotein (a). J Biol Chem, 1986. 261(19): p. 8712-8.  116 34. White, A.L., D.L. Rainwater, and R.E. Lanford, Intracellular maturation of apolipoprotein[a] and assembly of lipoprotein[a] in primary baboon hepatocytes. J Lipid Res, 1993. 34(3): p. 509-17. 35. Higgins, J.A., L.H. Munro, and J. Wilkinson, Investigation of the association of intracellular apolipoprotein (a) with apolipoprotein B in human liver. Z Gastroenterol, 1996. 34 Suppl 3: p. 41-3. 36. Krempler, F., et al., Lipoprotein (a) is not a metabolic product of other lipoproteins containing apolipoprotein B. Biochim Biophys Acta, 1979. 575(1): p. 63-70. 37. Krempler, F., et al., Studies on the metabolism of the lipoprotein Lp (a) in man. Atherosclerosis, 1978. 30(1): p. 57-65. 38. Krempler, F., et al., Turnover of lipoprotein (a) in man. J Clin Invest, 1980. 65(6): p. 1483-90. 39. Ye, S.Q., et al., Tissue distribution of [3H]cholesteryl linoleyl ether-labeled human Lp(a) in different rat organs. Biochim Biophys Acta, 1988. 963(3): p. 534- 40. 40. Nielsen, L.B., K. Juul, and B.G. Nordestgaard, Increased degradation of lipoprotein(a) in atherosclerotic compared with nonlesioned aortic intima-inner media of rabbits: in vivo evidence that lipoprotein(a) may contribute to foam cell formation. Arterioscler Thromb Vasc Biol, 1998. 18(4): p. 641-9. 41. Argraves, K.M., et al., The atherogenic lipoprotein Lp(a) is internalized and degraded in a process mediated by the VLDL receptor. J Clin Invest, 1997. 100(9): p. 2170-81. 42. Krempler, F., et al., Studies on the role of specific cell surface receptors in the removal of lipoprotein (a) in man. J Clin Invest, 1983. 71(5): p. 1431-41. 43. Kiechl, S., et al., Oxidized phospholipids, lipoprotein(a), lipoprotein-associated phospholipase A2 activity, and 10-year cardiovascular outcomes: prospective results from the Bruneck study. Arterioscler Thromb Vasc Biol, 2007. 27(8): p. 1788-95. 44. Bostom, A.G., et al., Elevated plasma lipoprotein(a) and coronary heart disease in men aged 55 years and younger. A prospective study. JAMA, 1996. 276(7): p. 544-8. 45. Assmann, G., H. Schulte, and A. von Eckardstein, Hypertriglyceridemia and elevated lipoprotein(a) are risk factors for major coronary events in middle-aged men. Am J Cardiol, 1996. 77(14): p. 1179-84. 46. Beisiegel, U., et al., Lipoprotein(a) in the arterial wall. Eur Heart J, 1990. 11 Suppl E: p. 174-83. 47. Fu, L., et al., Gene expression of apolipoprotein(a) within the wall of human aorta and carotid arteries. Atherosclerosis, 2001. 158(2): p. 303-11. 48. Pepin, J.M., J.A. O'Neil, and H.F. Hoff, Quantification of apo[a] and apoB in human atherosclerotic lesions. J Lipid Res, 1991. 32(2): p. 317-27. 49. Pillarisetti, S., et al., Subendothelial retention of lipoprotein (a). Evidence that reduced heparan sulfate promotes lipoprotein binding to subendothelial matrix. J Clin Invest, 1997. 100(4): p. 867-74. 50. Karadi, I., et al., Lipoprotein (a) and plasminogen are immunochemically related. Biochim Biophys Acta, 1988. 960(1): p. 91-7.  117 51. Caplice, N.M., et al., Lipoprotein (a) binds and inactivates tissue factor pathway inhibitor: a novel link between lipoproteins and thrombosis. Blood, 2001. 98(10): p. 2980-7. 52. Tranchesi, B., et al., Lack of association between raised serum lipoprotein(a) and thrombolysis. Lancet, 1990. 336(8730): p. 1587-8. 53. Gries, A., et al., Interaction of LDL, Lp[a], and reduced Lp[a] with monoclonal antibodies against apoB. J Lipid Res, 1988. 29(1): p. 1-8. 54. Zawadzki, Z., et al., The linkage with apolipoprotein (a) in lipoprotein (a) modifies the immunochemical and functional properties of apolipoprotein B. Biochemistry, 1988. 27(22): p. 8474-81. 55. Snyder, M.L., et al., Comparative binding and degradation of lipoprotein(a) and low density lipoprotein by human monocyte-derived macrophages. J Biol Chem, 1992. 267(1): p. 339-46. 56. Chulkova, T.M. and V.V. Tertov, Degradation of human apolipoprotein B-100 by apolipoprotein(a). FEBS Lett, 1993. 336(2): p. 327-9. 57. Snyder, M.L., et al., Binding and degradation of lipoprotein(a) and LDL by primary cultures of human hepatocytes. Comparison with cultured human monocyte-macrophages and fibroblasts. Arterioscler Thromb, 1994. 14(5): p. 770-9. 58. Riis Hansen, P., et al., Induction of oxygen free radical generation in human monocytes by lipoprotein(a). Eur J Clin Invest, 1994. 24(7): p. 497-9. 59. Blencowe, C., et al., Enhanced association of platelet-activating factor acetylhydrolase with lipoprotein (a) in comparison with low density lipoprotein. J Biol Chem, 1995. 270(52): p. 31151-7. 60. Tsironis, L.D., et al., Reduced PAF-acetylhydrolase activity associated with Lp(a) in patients with coronary artery disease. Atherosclerosis, 2004. 177(1): p. 193- 201. 61. Bergmark, C., et al., A novel function of lipoprotein [a] as a preferential carrier of oxidized phospholipids in human plasma. J Lipid Res, 2008. 49(10): p. 2230-9. 62. Tsimikas, S., et al., Oxidized phospholipids, Lp(a) lipoprotein, and coronary artery disease. N Engl J Med, 2005. 353(1): p. 46-57. 63. Kostner, G.M., et al., HMG CoA reductase inhibitors lower LDL cholesterol without reducing Lp(a) levels. Circulation, 1989. 80(5): p. 1313-9. 64. Berg, K. and T.P. Leren, Unchanged serum lipoprotein (a) concentrations with lovastatin. Lancet, 1989. 2(8666): p. 812. 65. Swanson, J.A. and C. Watts, Macropinocytosis. Trends Cell Biol, 1995. 5(11): p. 424-8. 66. Amyere, M., et al., Origin, originality, functions, subversions and molecular signalling of macropinocytosis. Int J Med Microbiol, 2002. 291(6-7): p. 487-94. 67. Kruth, H.S., et al., Macrophage foam cell formation with native low density lipoprotein. J Biol Chem, 2002. 277(37): p. 34573-80. 68. Zhao, B., et al., Constitutive receptor-independent low density lipoprotein uptake and cholesterol accumulation by macrophages differentiated from human monocytes with macrophage-colony-stimulating factor (M-CSF). J Biol Chem, 2006. 281(23): p. 15757-62.  118 69. Buono, C., et al., Liver X receptors inhibit human monocyte-derived macrophage foam cell formation by inhibiting fluid-phase pinocytosis of LDL. J Lipid Res, 2007. 48(11): p. 2411-8. 70. Kruth, H.S., et al., Macropinocytosis is the endocytic pathway that mediates macrophage foam cell formation with native low density lipoprotein. J Biol Chem, 2005. 280(3): p. 2352-60. 71. Jones, N.L. and M.C. Willingham, Modified LDLs are internalized by macrophages in part via macropinocytosis. Anat Rec, 1999. 255(1): p. 57-68. 72. de Winther, M.P., et al., Macrophage scavenger receptor class A: A multifunctional receptor in atherosclerosis. Arterioscler Thromb Vasc Biol, 2000. 20(2): p. 290-7. 73. Gough, P.J., et al., Analysis of macrophage scavenger receptor (SR-A) expression in human aortic atherosclerotic lesions. Arterioscler Thromb Vasc Biol, 1999. 19(3): p. 461-71. 74. Han, J., et al., Oxidized low density lipoprotein decreases macrophage expression of scavenger receptor B-I. J Biol Chem, 2001. 276(19): p. 16567-72. 75. Terpstra, V., D.A. Bird, and D. Steinberg, Evidence that the lipid moiety of oxidized low density lipoprotein plays a role in its interaction with macrophage receptors. Proc Natl Acad Sci U S A, 1998. 95(4): p. 1806-11. 76. Bird, D.A., et al., Receptors for oxidized low-density lipoprotein on elicited mouse peritoneal macrophages can recognize both the modified lipid moieties and the modified protein moieties: implications with respect to macrophage recognition of apoptotic cells. Proc Natl Acad Sci U S A, 1999. 96(11): p. 6347-52. 77. Podrez, E.A., et al., A novel family of atherogenic oxidized phospholipids promotes macrophage foam cell formation via the scavenger receptor CD36 and is enriched in atherosclerotic lesions. J Biol Chem, 2002. 277(41): p. 38517-23. 78. Podrez, E.A., et al., Identification of a novel family of oxidized phospholipids that serve as ligands for the macrophage scavenger receptor CD36. J Biol Chem, 2002. 277(41): p. 38503-16. 79. Moore, K.J., et al., Loss of receptor-mediated lipid uptake via scavenger receptor A or CD36 pathways does not ameliorate atherosclerosis in hyperlipidemic mice. J Clin Invest, 2005. 115(8): p. 2192-201. 80. Han, J., et al., Native and modified low density lipoproteins increase the functional expression of the macrophage class B scavenger receptor, CD36. J Biol Chem, 1997. 272(34): p. 21654-9. 81. Yla-Herttuala, S., et al., Gene expression in macrophage-rich human atherosclerotic lesions. 15-lipoxygenase and acetyl low density lipoprotein receptor messenger RNA colocalize with oxidation specific lipid-protein adducts. J Clin Invest, 1991. 87(4): p. 1146-52. 82. Keidar, S., et al., Involvement of the macrophage low density lipoprotein receptor-binding domains in the uptake of oxidized low density lipoprotein. Arterioscler Thromb, 1992. 12(4): p. 484-93. 83. Multhaupt, H.A., et al., Expression of very low density lipoprotein receptor in the vascular wall. Analysis of human tissues by in situ hybridization and immunohistochemistry. Am J Pathol, 1996. 148(6): p. 1985-97.  119 84. Aviram, M., et al., Lesioned low density lipoprotein in atherosclerotic apolipoprotein E-deficient transgenic mice and in humans is oxidized and aggregated. Biochem Biophys Res Commun, 1995. 216(2): p. 501-13. 85. Hoff, H.F., T.E. Whitaker, and J. O'Neil, Oxidation of low density lipoprotein leads to particle aggregation and altered macrophage recognition. J Biol Chem, 1992. 267(1): p. 602-9. 86. Asmis, R., et al., Lipoprotein aggregation protects human monocyte-derived macrophages from OxLDL-induced cytotoxicity. J Lipid Res, 2005. 46(6): p. 1124-32. 87. Kruth, H.S., Sequestration of aggregated low-density lipoproteins by macrophages. Curr Opin Lipidol, 2002. 13(5): p. 483-8. 88. Tertov, V.V., et al., Lipoprotein aggregation as an essential condition of intracellular lipid accumulation caused by modified low density lipoproteins. Biochem Biophys Res Commun, 1989. 163(1): p. 489-94. 89. Morganelli, P.M., et al., Enhanced metabolism of LDL aggregates mediated by specific human monocyte IgG Fc receptors. J Lipid Res, 1995. 36(4): p. 714-24. 90. Griffith, R.L., et al., Low density lipoprotein metabolism by human macrophages activated with low density lipoprotein immune complexes. A possible mechanism of foam cell formation. J Exp Med, 1988. 168(3): p. 1041-59. 91. Klimov, A.N., et al., Lipoprotein-antibody immune complexes. Their catabolism and role in foam cell formation. Atherosclerosis, 1985. 58(1-3): p. 1-15. 92. Halvorsen, B., et al., Proteoglycans in macrophages: characterization and possible role in the cellular uptake of lipoproteins. Biochem J, 1998. 331 ( Pt 3): p. 743-52. 93. Salisbury, B.G., D.J. Falcone, and C.R. Minick, Insoluble low-density lipoprotein- proteoglycan complexes enhance cholesteryl ester accumulation in macrophages. Am J Pathol, 1985. 120(1): p. 6-11. 94. Wooton-Kee, C.R., et al., Group V sPLA2 hydrolysis of low-density lipoprotein results in spontaneous particle aggregation and promotes macrophage foam cell formation. Arterioscler Thromb Vasc Biol, 2004. 24(4): p. 762-7. 95. Aviram, M. and I. Maor, Phospholipase D-modified low density lipoprotein is taken up by macrophages at increased rate. A possible role for phosphatidic acid. J Clin Invest, 1993. 91(5): p. 1942-52. 96. Aviram, M., Low density lipoprotein modification by cholesterol oxidase induces enhanced uptake and cholesterol accumulation in cells. J Biol Chem, 1992. 267(1): p. 218-25. 97. Sparrow, C.P., S. Parthasarathy, and D. Steinberg, Enzymatic modification of low density lipoprotein by purified lipoxygenase plus phospholipase A2 mimics cell- mediated oxidative modification. J Lipid Res, 1988. 29(6): p. 745-53. 98. Aviram, M., et al., Platelet-modified low density lipoprotein induces macrophage cholesterol accumulation and platelet activation. J Clin Chem Clin Biochem, 1989. 27(1): p. 3-12. 99. Brown, A.J., et al., Cholesterol and oxysterol metabolism and subcellular distribution in macrophage foam cells. Accumulation of oxidized esters in lysosomes. J Lipid Res, 2000. 41(2): p. 226-37.  120 100. Jessup, W., E.L. Mander, and R.T. Dean, The intracellular storage and turnover of apolipoprotein B of oxidized LDL in macrophages. Biochim Biophys Acta, 1992. 1126(2): p. 167-77. 101. Lougheed, M., H.F. Zhang, and U.P. Steinbrecher, Oxidized low density lipoprotein is resistant to cathepsins and accumulates within macrophages. J Biol Chem, 1991. 266(22): p. 14519-25. 102. Mander, E.L., et al., Apolipoprotein B of oxidized LDL accumulates in the lysosomes of macrophages. Biochim Biophys Acta, 1994. 1212(1): p. 80-92. 103. Yancey, P.G. and W.G. Jerome, Lysosomal sequestration of free and esterified cholesterol from oxidized low density lipoprotein in macrophages of different species. J Lipid Res, 1998. 39(7): p. 1349-61. 104. Zhang, W.Y., P.M. Gaynor, and H.S. Kruth, Aggregated low density lipoprotein induces and enters surface-connected compartments of human monocyte- macrophages. Uptake occurs independently of the low density lipoprotein receptor. J Biol Chem, 1997. 272(50): p. 31700-6. 105. Jessup, W. and L. Kritharides, Metabolism of oxidized LDL by macrophages. Curr Opin Lipidol, 2000. 11(5): p. 473-81. 106. Zhao, Y. and Y.L. Marcel, Serum albumin is a significant intermediate in cholesterol transfer between cells and lipoproteins. Biochemistry, 1996. 35(22): p. 7174-80. 107. Ho, Y.K., M.S. Brown, and J.L. Goldstein, Hydrolysis and excretion of cytoplasmic cholesteryl esters by macrophages: stimulation by high density lipoprotein and other agents. J Lipid Res, 1980. 21(4): p. 391-8. 108. Jian, B., et al., Scavenger receptor class B type I as a mediator of cellular cholesterol efflux to lipoproteins and phospholipid acceptors. J Biol Chem, 1998. 273(10): p. 5599-606. 109. Rothblat, G.H., et al., Cell cholesterol efflux: integration of old and new observations provides new insights. J Lipid Res, 1999. 40(5): p. 781-96. 110. Timmins, J.M., et al., Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest, 2005. 115(5): p. 1333-42. 111. Rader, D.J., et al., Rapid in vivo transport and catabolism of human apolipoprotein A-IV-1 and slower catabolism of the apoA-IV-2 isoprotein. J Clin Invest, 1993. 92(2): p. 1009-17. 112. Aiello, R.J., D. Brees, and O.L. Francone, ABCA1-deficient mice: insights into the role of monocyte lipid efflux in HDL formation and inflammation. Arterioscler Thromb Vasc Biol, 2003. 23(6): p. 972-80. 113. Gelissen, I.C., et al., ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arterioscler Thromb Vasc Biol, 2006. 26(3): p. 534-40. 114. Yvan-Charvet, L., et al., Combined deficiency of ABCA1 and ABCG1 promotes foam cell accumulation and accelerates atherosclerosis in mice. J Clin Invest, 2007. 117(12): p. 3900-8. 115. Out, R., et al., Combined deletion of macrophage ABCA1 and ABCG1 leads to massive lipid accumulation in tissue macrophages and distinct atherosclerosis at relatively low plasma cholesterol levels. Arterioscler Thromb Vasc Biol, 2008. 28(2): p. 258-64.  121 116. Terasaka, N., et al., High-density lipoprotein protects macrophages from oxidized low-density lipoprotein-induced apoptosis by promoting efflux of 7- ketocholesterol via ABCG1. Proc Natl Acad Sci U S A, 2007. 104(38): p. 15093- 8. 117. Yu, L., et al., Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest, 2002. 110(5): p. 671-80. 118. Berge, K.E., et al., Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science, 2000. 290(5497): p. 1771-5. 119. Salen, G., et al., Sitosterolemia. J Lipid Res, 1992. 33(7): p. 945-55. 120. Tall, A.R., P. Costet, and N. Wang, Regulation and mechanisms of macrophage cholesterol efflux. J Clin Invest, 2002. 110(7): p. 899-904. 121. Tontonoz, P. and D.J. Mangelsdorf, Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol, 2003. 17(6): p. 985-93. 122. Beisiegel, U., et al., The LDL-receptor-related protein, LRP, is an apolipoprotein E-binding protein. Nature, 1989. 341(6238): p. 162-4. 123. Rhainds, D., et al., The role of human and mouse hepatic scavenger receptor class B type I (SR-BI) in the selective uptake of low-density lipoprotein-cholesteryl esters. Biochemistry, 2003. 42(24): p. 7527-38. 124. Fluiter, K., et al., Scavenger receptor BI mediates the selective uptake of oxidized cholesterol esters by rat liver. J Biol Chem, 1999. 274(13): p. 8893-9. 125. Harkes, L. and J.C. Van Berkel, Quantitative role of parenchymal and non- parenchymal liver cells in the uptake of [14C]sucrose-labelled low-density lipoprotein in vivo. Biochem J, 1984. 224(1): p. 21-7. 126. Carew, T.E., R.C. Pittman, and D. Steinberg, Tissue sites of degradation of native and reductively methylated [14C]sucrose-labeled low density lipoprotein in rats. Contribution of receptor-dependent and receptor-independent pathways. J Biol Chem, 1982. 257(14): p. 8001-8. 127. Pittman, R.C., et al., Receptor-dependent and receptor-independent degradation of low density lipoprotein in normal rabbits and in receptor-deficient mutant rabbits. J Biol Chem, 1982. 257(14): p. 7994-8000. 128. Ling, W., et al., Oxidized or acetylated low density lipoproteins are rapidly cleared by the liver in mice with disruption of the scavenger receptor class A type I/II gene. J Clin Invest, 1997. 100(2): p. 244-52. 129. de Rijke, Y.B., et al., In vivo fate and scavenger receptor recognition of oxidized lipoprotein[a] isoforms in rats. J Lipid Res, 1992. 33(9): p. 1315-25. 130. Sasaki, A.W., et al., Mechanism of sucrose uptake by isolated rat hepatocytes. J Cell Physiol, 1987. 133(1): p. 175-80. 131. Kjeken, R., et al., Fluid phase endocytosis of [125I]iodixanol in rat liver parenchymal, endothelial and Kupffer cells. Cell Tissue Res, 2001. 304(2): p. 221-30. 132. Schaloske, R.H. and E.A. Dennis, The phospholipase A2 superfamily and its group numbering system. Biochim Biophys Acta, 2006. 1761(11): p. 1246-59. 133. Stafforini, D.M., et al., Platelet-activating factor acetylhydrolase deficiency. A missense mutation near the active site of an anti-inflammatory phospholipase. J Clin Invest, 1996. 97(12): p. 2784-91.  122 134. Tjoelker, L.W., et al., Plasma platelet-activating factor acetylhydrolase is a secreted phospholipase A2 with a catalytic triad. J Biol Chem, 1995. 270(43): p. 25481-7. 135. Tselepis, A.D., et al., N-linked glycosylation of macrophage-derived PAF-AH is a major determinant of enzyme association with plasma HDL. J Lipid Res, 2001. 42(10): p. 1645-54. 136. Samanta, U. and B.J. Bahnson, Crystal structure of human plasma platelet- activating factor acetylhydrolase: structural implication to lipoprotein binding and catalysis. J Biol Chem, 2008. 283(46): p. 31617-24. 137. Karasawa, K., et al., Plasma platelet activating factor-acetylhydrolase (PAF-AH). Prog Lipid Res, 2003. 42(2): p. 93-114. 138. Tarbet, E.B., et al., Liver cells secrete the plasma form of platelet-activating factor acetylhydrolase. J Biol Chem, 1991. 266(25): p. 16667-73. 139. Ostermann, G., et al., The role of lipoproteins in the degradation of platelet- activating factor. Thromb Res, 1986. 44(3): p. 303-14. 140. Elstad, M.R., et al., Platelet-activating factor acetylhydrolase increases during macrophage differentiation. A novel mechanism that regulates accumulation of platelet-activating factor. J Biol Chem, 1989. 264(15): p. 8467-70. 141. Asano, K., et al., Cellular source(s) of platelet-activating-factor acetylhydrolase activity in plasma. Biochem Biophys Res Commun, 1999. 261(2): p. 511-4. 142. Svetlov, S.I., et al., Secretory PAF-acetylhydrolase of the rat hepatobiliary system: characterization and partial purification. Am J Physiol, 1998. 274(5 Pt 1): p. G891-900. 143. Svetlov, S.I., et al., Hepatic regulation of platelet-activating factor acetylhydrolase and lecithin:cholesterol acyltransferase biliary and plasma output in rats exposed to bacterial lipopolysaccharide. Hepatology, 1999. 30(1): p. 128-36. 144. Al-Darmaki, S., et al., Differential expression of platelet-activating factor acetylhydrolase in macrophages and monocyte-derived dendritic cells. J Immunol, 2003. 170(1): p. 167-73. 145. McCall, M.R., et al., Dissociable and nondissociable forms of platelet-activating factor acetylhydrolase in human plasma LDL: implications for LDL oxidative susceptibility. Biochim Biophys Acta, 1999. 1437(1): p. 23-36. 146. Ohshima, N., et al., Receptor-dependent metabolism of platelet-activating factor in murine macrophages. J Biol Chem, 2002. 277(12): p. 9722-7. 147. Narahara, H., et al., Platelet-activating factor inhibits the secretion of platelet- activating factor acetylhydrolase by human decidual macrophages. J Clin Endocrinol Metab, 2003. 88(12): p. 6029-33. 148. Satoh, K., et al., Platelet-activating factor (PAF) stimulates the production of PAF acetylhydrolase by the human hepatoma cell line, HepG2. J Clin Invest, 1991. 87(2): p. 476-81. 149. Satoh, K., et al., Effect of 17 beta-estradiol on secretion of platelet-activating factor acetylhydrolase by HepG2 cells. Metabolism, 1993. 42(6): p. 672-7. 150. Satoh, K., et al., High-density lipoprotein inhibits the production of platelet activating factor acetylhydrolase by HepG2 cells. J Lab Clin Med, 1994. 123(2): p. 225-31.  123 151. Shi, Y., et al., Role of lipoprotein-associated phospholipase A2 in leukocyte activation and inflammatory responses. Atherosclerosis, 2007. 191(1): p. 54-62. 152. Cao, Y., et al., Expression of plasma platelet-activating factor acetylhydrolase is transcriptionally regulated by mediators of inflammation. J Biol Chem, 1998. 273(7): p. 4012-20. 153. Bulger, E.M., et al., The macrophage response to endotoxin requires platelet activating factor. Shock, 2002. 17(3): p. 173-9. 154. Wu, X., et al., The p38 MAPK pathway mediates transcriptional activation of the plasma platelet-activating factor acetylhydrolase gene in macrophages stimulated with lipopolysaccharide. J Biol Chem, 2004. 279(34): p. 36158-65. 155. Sumita, C., et al., Pioglitazone induces plasma platelet activating factor- acetylhydrolase and inhibits platelet activating factor-mediated cytoskeletal reorganization in macrophage. Biochim Biophys Acta, 2004. 1673(3): p. 115-21. 156. Stafforini, D.M., S.M. Prescott, and T.M. McIntyre, Human plasma platelet- activating factor acetylhydrolase. Purification and properties. J Biol Chem, 1987. 262(9): p. 4223-30. 157. Stafforini, D.M., et al., Molecular basis of the interaction between plasma platelet-activating factor acetylhydrolase and low density lipoprotein. J Biol Chem, 1999. 274(11): p. 7018-24. 158. Gardner, A.A., et al., Identification of a domain that mediates association of platelet-activating factor acetylhydrolase with high density lipoprotein. J Biol Chem, 2008. 283(25): p. 17099-106. 159. Stafforini, D.M., et al., Human macrophages secret platelet-activating factor acetylhydrolase. J Biol Chem, 1990. 265(17): p. 9682-7. 160. Stafforini, D.M., et al., Lipoproteins alter the catalytic behavior of the platelet- activating factor acetylhydrolase in human plasma. Proc Natl Acad Sci U S A, 1989. 86(7): p. 2393-7. 161. Pritchard, P.H., A. Chonn, and C.C. Yeung, The degradation of platelet- activating factor in the plasma of a patient with familial high density lipoprotein deficiency (Tangier disease). Blood, 1985. 66(6): p. 1476-8. 162. Tsoukatos, D.C., et al., Copper-catalyzed oxidation mediates PAF formation in human LDL subspecies. Protective role of PAF:acetylhydrolase in dense LDL. Arterioscler Thromb Vasc Biol, 1997. 17(12): p. 3505-12. 163. Kolodgie, F.D., et al., Lipoprotein-associated phospholipase A2 protein expression in the natural progression of human coronary atherosclerosis. Arterioscler Thromb Vasc Biol, 2006. 26(11): p. 2523-9. 164. Grundy, S.M., HMG-CoA reductase inhibitors for treatment of hypercholesterolemia. N Engl J Med, 1988. 319(1): p. 24-33. 165. Tsimihodimos, V., et al., Atorvastatin preferentially reduces LDL-associated platelet-activating factor acetylhydrolase activity in dyslipidemias of type IIA and type IIB. Arterioscler Thromb Vasc Biol, 2002. 22(2): p. 306-11. 166. Wang, B., et al., [Correlation between desmin gene, platelet-activating factor acetylhydrolase gene and dilated cardiomyopathy]. Sichuan Da Xue Xue Bao Yi Xue Ban, 2006. 37(3): p. 391-4. 167. Lourida, E.S., et al., The low-density lipoprotein (LDL)-associated PAF- acetylhydrolase activity and the extent of LDL oxidation are important  124 determinants of the autoantibody titers against oxidized LDL in patients with coronary artery disease. Prostaglandins Leukot Essent Fatty Acids, 2006. 75(2): p. 117-26. 168. Stremler, K.E., et al., Human plasma platelet-activating factor acetylhydrolase. Oxidatively fragmented phospholipids as substrates. J Biol Chem, 1991. 266(17): p. 11095-103. 169. Prescott, S.M., et al., Platelet-activating factor and related lipid mediators. Annu Rev Biochem, 2000. 69: p. 419-45. 170. Min, J.H., et al., Membrane-bound plasma platelet activating factor acetylhydrolase acts on substrate in the aqueous phase. Biochemistry, 1999. 38(39): p. 12935-42. 171. Yamada, Y., et al., Characterization of the platelet-activating factor acetylhydrolase from human plasma by heterologous expression in Xenopus laevis oocytes. Proc Natl Acad Sci U S A, 1994. 91(22): p. 10320-4. 172. Min, J.H., et al., Platelet-activating factor acetylhydrolases: broad substrate specificity and lipoprotein binding does not modulate the catalytic properties of the plasma enzyme. Biochemistry, 2001. 40(15): p. 4539-49. 173. Tsoukatos, D.C., et al., Platelet-activating factor acetylhydrolase and transacetylase activities in human aorta and mammary artery. J Lipid Res, 2008. 49(10): p. 2240-9. 174. Dentan, C., et al., Pefabloc, 4-[2-aminoethyl]benzenesulfonyl fluoride, is a new, potent nontoxic and irreversible inhibitor of PAF-degrading acetylhydrolase. Biochim Biophys Acta, 1996. 1299(3): p. 353-7. 175. MacPhee, C.H., et al., Lipoprotein-associated phospholipase A2, platelet- activating factor acetylhydrolase, generates two bioactive products during the oxidation of low-density lipoprotein: use of a novel inhibitor. Biochem J, 1999. 338 ( Pt 2): p. 479-87. 176. Carpenter, K.L., et al., Inhibition of lipoprotein-associated phospholipase A2 diminishes the death-inducing effects of oxidised LDL on human monocyte- macrophages. FEBS Lett, 2001. 505(3): p. 357-63. 177. Rosenson, R.S., M. Vracar-Grabar, and I. Helenowski, Lipoprotein associated phospholipase A2 inhibition reduces generation of oxidized fatty acids: Lp-LPA2 reduces oxidized fatty acids. Cardiovasc Drugs Ther, 2008. 22(1): p. 55-8. 178. Blackie, J.A., et al., The identification of clinical candidate SB-480848: a potent inhibitor of lipoprotein-associated phospholipase A2. Bioorg Med Chem Lett, 2003. 13(6): p. 1067-70. 179. Serruys, P.W., et al., Effects of the direct lipoprotein-associated phospholipase A(2) inhibitor darapladib on human coronary atherosclerotic plaque. Circulation, 2008. 118(11): p. 1172-82. 180. Wilensky, R.L., et al., Inhibition of lipoprotein-associated phospholipase A2 reduces complex coronary atherosclerotic plaque development. Nat Med, 2008. 14(10): p. 1059-66. 181. Stafforini, D.M., et al., The platelet-activating factor acetylhydrolase from human plasma prevents oxidative modification of low-density lipoprotein. Trans Assoc Am Physicians, 1992. 105: p. 44-63.  125 182. MacRitchie, A.N., et al., Molecular basis for susceptibility of plasma platelet- activating factor acetylhydrolase to oxidative inactivation. Faseb J, 2007. 21(4): p. 1164-76. 183. Schnitzer, E., et al., LDL-associated phospholipase A does not protect LDL against lipid peroxidation in vitro. Free Radic Biol Med, 1998. 24(7-8): p. 1294- 303. 184. Rodrigo, L., et al., Hydrolysis of platelet-activating factor by human serum paraoxonase. Biochem J, 2001. 354(Pt 1): p. 1-7. 185. Liu, M. and P.V. Subbaiah, Hydrolysis and transesterification of platelet- activating factor by lecithin-cholesterol acyltransferase. Proc Natl Acad Sci U S A, 1994. 91(13): p. 6035-9. 186. Aron, L., S. Jones, and C.J. Fielding, Human plasma lecithin-cholesterol acyltransferase. Characterization of cofactor-dependent phospholipase activity. J Biol Chem, 1978. 253(20): p. 7220-6. 187. Kriska, T., et al., Phospholipase action of platelet-activating factor acetylhydrolase, but not paraoxonase-1, on long fatty acyl chain phospholipid hydroperoxides. J Biol Chem, 2007. 282(1): p. 100-8. 188. Subbaiah, P.V. and M. Liu, Disparate effects of oxidation on plasma acyltransferase activities: inhibition of cholesterol esterification but stimulation of transesterification of oxidized phospholipids. Biochim Biophys Acta, 1996. 1301(1-2): p. 115-26. 189. Stafforini, D.M., et al., The platelet-activating factor acetylhydrolase from human erythrocytes. Purification and properties. J Biol Chem, 1993. 268(6): p. 3857-65. 190. Yoshida, H., et al., Platelet-activating factor acetylhydrolase activity in red blood cell-stroma from patients with cerebral thrombosis. Acta Neurol Scand, 1992. 86(2): p. 199-203. 191. Montrucchio, G., G. Alloatti, and G. Camussi, Role of platelet-activating factor in cardiovascular pathophysiology. Physiol Rev, 2000. 80(4): p. 1669-99. 192. Gniwotta, C., et al., Prostaglandin F2-like compounds, F2-isoprostanes, are present in increased amounts in human atherosclerotic lesions. Arterioscler Thromb Vasc Biol, 1997. 17(11): p. 3236-41. 193. Itabe, H., et al., Appearance of cross linked proteins in human atheroma and rat pre-fibrotic liver detected by a new monoclonal antibody. Biochim Biophys Acta, 1998. 1406(1): p. 28-39. 194. Itabe, H., et al., A monoclonal antibody against oxidized lipoprotein recognizes foam cells in atherosclerotic lesions. Complex formation of oxidized phosphatidylcholines and polypeptides. J Biol Chem, 1994. 269(21): p. 15274-9. 195. Bowry, V.W., K.K. Stanley, and R. Stocker, High density lipoprotein is the major carrier of lipid hydroperoxides in human blood plasma from fasting donors. Proc Natl Acad Sci U S A, 1992. 89(21): p. 10316-20. 196. Watson, A.D., et al., Structural identification by mass spectrometry of oxidized phospholipids in minimally oxidized low density lipoprotein that induce monocyte/endothelial interactions and evidence for their presence in vivo. J Biol Chem, 1997. 272(21): p. 13597-607.  126 197. Watson, A.D., et al., Protective effect of high density lipoprotein associated paraoxonase. Inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest, 1995. 96(6): p. 2882-91. 198. Berliner, J.A., et al., Minimally modified low density lipoprotein stimulates monocyte endothelial interactions. J Clin Invest, 1990. 85(4): p. 1260-6. 199. Subbanagounder, G., et al., Epoxyisoprostane and epoxycyclopentenone phospholipids regulate monocyte chemotactic protein-1 and interleukin-8 synthesis. Formation of these oxidized phospholipids in response to interleukin- 1beta. J Biol Chem, 2002. 277(9): p. 7271-81. 200. Furnkranz, A., et al., Oxidized phospholipids trigger atherogenic inflammation in murine arteries. Arterioscler Thromb Vasc Biol, 2005. 25(3): p. 633-8. 201. Lee, H., et al., Role for peroxisome proliferator-activated receptor alpha in oxidized phospholipid-induced synthesis of monocyte chemotactic protein-1 and interleukin-8 by endothelial cells. Circ Res, 2000. 87(6): p. 516-21. 202. Subbanagounder, G., et al., Hydroxy alkenal phospholipids regulate inflammatory functions of endothelial cells. Vascul Pharmacol, 2002. 38(4): p. 201-9. 203. Reddy, S.T., et al., Identification of genes induced by oxidized phospholipids in human aortic endothelial cells. Vascul Pharmacol, 2002. 38(4): p. 211-8. 204. Kadl, A., et al., Analysis of inflammatory gene induction by oxidized phospholipids in vivo by quantitative real-time RT-PCR in comparison with effects of LPS. Vascul Pharmacol, 2002. 38(4): p. 219-27. 205. Gargalovic, P.S., et al., The unfolded protein response is an important regulator of inflammatory genes in endothelial cells. Arterioscler Thromb Vasc Biol, 2006. 26(11): p. 2490-6. 206. Bochkov, V.N., et al., Oxidized phospholipids stimulate tissue factor expression in human endothelial cells via activation of ERK/EGR-1 and Ca(++)/NFAT. Blood, 2002. 99(1): p. 199-206. 207. Ishii, H., et al., Oxidized phospholipids in oxidized low-density lipoprotein down- regulate thrombomodulin transcription in vascular endothelial cells through a decrease in the binding of RARbeta-RXRalpha heterodimers and Sp1 and Sp3 to their binding sequences in the TM promoter. Blood, 2003. 101(12): p. 4765-74. 208. Ohkura, N., et al., Oxidized phospholipids in oxidized low-density lipoprotein reduce the activity of tissue factor pathway inhibitor through association with its carboxy-terminal region. Antioxid Redox Signal, 2004. 6(4): p. 705-12. 209. Rouhanizadeh, M., et al., Oxidized-1-palmitoyl-2-arachidonoyl-sn-glycero-3- phosphorylcholine induces vascular endothelial superoxide production: implication of NADPH oxidase. Free Radic Biol Med, 2005. 39(11): p. 1512-22. 210. Gharavi, N.M., et al., Role of endothelial nitric oxide synthase in the regulation of SREBP activation by oxidized phospholipids. Circ Res, 2006. 98(6): p. 768-76. 211. Marathe, G.K., et al., Oxidized LDL contains inflammatory PAF-like phospholipids. Trends Cardiovasc Med, 2001. 11(3-4): p. 139-42. 212. Marathe, G.K., et al., Inflammatory platelet-activating factor-like phospholipids in oxidized low density lipoproteins are fragmented alkyl phosphatidylcholines. J Biol Chem, 1999. 274(40): p. 28395-404. 213. Li, R., et al., Identification of prostaglandin E2 receptor subtype 2 as a receptor activated by OxPAPC. Circ Res, 2006. 98(5): p. 642-50.  127 214. Davies, S.S., et al., Oxidized alkyl phospholipids are specific, high affinity peroxisome proliferator-activated receptor gamma ligands and agonists. J Biol Chem, 2001. 276(19): p. 16015-23. 215. Delerive, P., et al., Oxidized phospholipids activate PPARalpha in a phospholipase A2-dependent manner. FEBS Lett, 2000. 471(1): p. 34-8. 216. Boullier, A., et al., The binding of oxidized low density lipoprotein to mouse CD36 is mediated in part by oxidized phospholipids that are associated with both the lipid and protein moieties of the lipoprotein. J Biol Chem, 2000. 275(13): p. 9163-9. 217. Leitinger, N., et al., Structurally similar oxidized phospholipids differentially regulate endothelial binding of monocytes and neutrophils. Proc Natl Acad Sci U S A, 1999. 96(21): p. 12010-5. 218. Yeh, M., et al., Oxidized phospholipids increase interleukin 8 (IL-8) synthesis by activation of the c-src/signal transducers and activators of transcription (STAT)3 pathway. J Biol Chem, 2004. 279(29): p. 30175-81. 219. Bochkov, V.N., et al., Protective role of phospholipid oxidation products in endotoxin-induced tissue damage. Nature, 2002. 419(6902): p. 77-81. 220. Subbaiah, P.V., et al., Substrate specificity of plasma lysolecithin acyltransferase and the molecular species of lecithin formed by the reaction. J Biol Chem, 1985. 260(9): p. 5308-14. 221. Croset, M., et al., Characterization of plasma unsaturated lysophosphatidylcholines in human and rat. Biochem J, 2000. 345 Pt 1: p. 61-7. 222. Thukkani, A.K., et al., Identification of alpha-chloro fatty aldehydes and unsaturated lysophosphatidylcholine molecular species in human atherosclerotic lesions. Circulation, 2003. 108(25): p. 3128-33. 223. Matsumoto, T., T. Kobayashi, and K. Kamata, Role of lysophosphatidylcholine (LPC) in atherosclerosis. Curr Med Chem, 2007. 14(30): p. 3209-20. 224. Ohara, Y., et al., Lysophosphatidylcholine increases vascular superoxide anion production via protein kinase C activation. Arterioscler Thromb, 1994. 14(6): p. 1007-13. 225. Yamakawa, T., et al., Lysophosphatidylcholine stimulates MAP kinase activity in rat vascular smooth muscle cells. Hypertension, 1998. 31(1 Pt 2): p. 248-53. 226. Nishioka, H., et al., Lysophosphatidylcholine generates superoxide anions through activation of phosphatidylinositol 3-kinase in human neutrophils. FEBS Lett, 1998. 441(1): p. 63-6. 227. Galle, J., et al., Oxidized LDL and its compound lysophosphatidylcholine potentiate AngII-induced vasoconstriction by stimulation of RhoA. J Am Soc Nephrol, 2003. 14(6): p. 1471-9. 228. Morrow, J.D., et al., A series of prostaglandin F2-like compounds are produced in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism. Proc Natl Acad Sci U S A, 1990. 87(23): p. 9383-7. 229. Roberts, L.J. and J.D. Morrow, Measurement of F(2)-isoprostanes as an index of oxidative stress in vivo. Free Radic Biol Med, 2000. 28(4): p. 505-13. 230. Stafforini, D.M., et al., Release of free F2-isoprostanes from esterified phospholipids is catalyzed by intracellular and plasma platelet-activating factor acetylhydrolases. J Biol Chem, 2006. 281(8): p. 4616-23.  128 231. Pratico, D., et al., Localization of distinct F2-isoprostanes in human atherosclerotic lesions. J Clin Invest, 1997. 100(8): p. 2028-34. 232. Anderson, J.L., Lipoprotein-associated phospholipase A2: an independent predictor of coronary artery disease events in primary and secondary prevention. Am J Cardiol, 2008. 101(12A): p. 23F-33F. 233. Caslake, M.J., et al., Lipoprotein-associated phospholipase A(2), platelet- activating factor acetylhydrolase: a potential new risk factor for coronary artery disease. Atherosclerosis, 2000. 150(2): p. 413-9. 234. Packard, C.J., et al., Lipoprotein-associated phospholipase A2 as an independent predictor of coronary heart disease. West of Scotland Coronary Prevention Study Group. N Engl J Med, 2000. 343(16): p. 1148-55. 235. Blankenberg, S., et al., Plasma PAF-acetylhydrolase in patients with coronary artery disease: results of a cross-sectional analysis. J Lipid Res, 2003. 44(7): p. 1381-6. 236. Ballantyne, C.M., et al., Lipoprotein-associated phospholipase A2, high- sensitivity C-reactive protein, and risk for incident coronary heart disease in middle-aged men and women in the Atherosclerosis Risk in Communities (ARIC) study. Circulation, 2004. 109(7): p. 837-42. 237. Koenig, W., et al., Lipoprotein-associated phospholipase A2 adds to risk prediction of incident coronary events by C-reactive protein in apparently healthy middle-aged men from the general population: results from the 14-year follow-up of a large cohort from southern Germany. Circulation, 2004. 110(14): p. 1903-8. 238. Iribarren, C., et al., Association of lipoprotein-associated phospholipase A2 mass and activity with calcified coronary plaque in young adults: the CARDIA study. Arterioscler Thromb Vasc Biol, 2005. 25(1): p. 216-21. 239. Brilakis, E.S., et al., Association of lipoprotein-associated phospholipase A2 levels with coronary artery disease risk factors, angiographic coronary artery disease, and major adverse events at follow-up. Eur Heart J, 2005. 26(2): p. 137- 44. 240. Winkler, K., et al., Platelet-activating factor acetylhydrolase activity indicates angiographic coronary artery disease independently of systemic inflammation and other risk factors: the Ludwigshafen Risk and Cardiovascular Health Study. Circulation, 2005. 111(8): p. 980-7. 241. Khuseyinova, N., et al., Association between Lp-PLA2 and coronary artery disease: focus on its relationship with lipoproteins and markers of inflammation and hemostasis. Atherosclerosis, 2005. 182(1): p. 181-8. 242. Ballantyne, C.M., et al., Lipoprotein-associated phospholipase A2, high- sensitivity C-reactive protein, and risk for incident ischemic stroke in middle-aged men and women in the Atherosclerosis Risk in Communities (ARIC) study. Arch Intern Med, 2005. 165(21): p. 2479-84. 243. Oei, H.H., et al., Lipoprotein-associated phospholipase A2 activity is associated with risk of coronary heart disease and ischemic stroke: the Rotterdam Study. Circulation, 2005. 111(5): p. 570-5. 244. Yang, E.H., et al., Lipoprotein-associated phospholipase A2 is an independent marker for coronary endothelial dysfunction in humans. Arterioscler Thromb Vasc Biol, 2006. 26(1): p. 106-11.  129 245. O'Donoghue, M., et al., Lipoprotein-associated phospholipase A2 and its association with cardiovascular outcomes in patients with acute coronary syndromes in the PROVE IT-TIMI 22 (PRavastatin Or atorVastatin Evaluation and Infection Therapy-Thrombolysis In Myocardial Infarction) trial. Circulation, 2006. 113(14): p. 1745-52. 246. Koenig, W., et al., Lipoprotein-associated phospholipase A2 predicts future cardiovascular events in patients with coronary heart disease independently of traditional risk factors, markers of inflammation, renal function, and hemodynamic stress. Arterioscler Thromb Vasc Biol, 2006. 26(7): p. 1586-93. 247. Corsetti, J.P., et al., High lipoprotein-associated phospholipase A2 is a risk factor for recurrent coronary events in postinfarction patients. Clin Chem, 2006. 52(7): p. 1331-8. 248. Gerber, Y., et al., Lipoprotein-associated phospholipase A2 and prognosis after myocardial infarction in the community. Arterioscler Thromb Vasc Biol, 2006. 26(11): p. 2517-22. 249. van Vark, L.C., et al., Lipoprotein-associated phospholipase A2 activity and risk of heart failure: The Rotterdam study. Eur Heart J, 2006. 27(19): p. 2346-52. 250. Elkind, M.S., et al., High-sensitivity C-reactive protein, lipoprotein-associated phospholipase A2, and outcome after ischemic stroke. Arch Intern Med, 2006. 166(19): p. 2073-80. 251. May, H.T., et al., Lipoprotein-associated phospholipase A2 independently predicts the angiographic diagnosis of coronary artery disease and coronary death. Am Heart J, 2006. 152(5): p. 997-1003. 252. Persson, M., et al., The epidemiology of Lp-PLA(2): distribution and correlation with cardiovascular risk factors in a population-based cohort. Atherosclerosis, 2007. 190(2): p. 388-96. 253. Lavi, S., et al., Local production of lipoprotein-associated phospholipase A2 and lysophosphatidylcholine in the coronary circulation: association with early coronary atherosclerosis and endothelial dysfunction in humans. Circulation, 2007. 115(21): p. 2715-21. 254. Persson, M., et al., Elevated Lp-PLA2 levels add prognostic information to the metabolic syndrome on incidence of cardiovascular events among middle-aged nondiabetic subjects. Arterioscler Thromb Vasc Biol, 2007. 27(6): p. 1411-6. 255. Winkler, K., et al., Lipoprotein-associated phospholipase A2 predicts 5-year cardiac mortality independently of established risk factors and adds prognostic information in patients with low and medium high-sensitivity C-reactive protein (the Ludwigshafen risk and cardiovascular health study). Clin Chem, 2007. 53(8): p. 1440-7. 256. Mockel, M., et al., Lipoprotein-associated phospholipase A2 for early risk stratification in patients with suspected acute coronary syndrome: a multi-marker approach: the North Wuerttemberg and Berlin Infarction Study-II (NOBIS-II). Clin Res Cardiol, 2007. 96(9): p. 604-12. 257. Sabatine, M.S., et al., Prognostic utility of lipoprotein-associated phospholipase A2 for cardiovascular outcomes in patients with stable coronary artery disease. Arterioscler Thromb Vasc Biol, 2007. 27(11): p. 2463-9.  130 258. Wassertheil-Smoller, S., et al., Lipoprotein-associated phospholipase A2, hormone use, and the risk of ischemic stroke in postmenopausal women. Hypertension, 2008. 51(4): p. 1115-22. 259. Daniels, L.B., et al., Lipoprotein-associated phospholipase A2 is an independent predictor of incident coronary heart disease in an apparently healthy older population: the Rancho Bernardo Study. J Am Coll Cardiol, 2008. 51(9): p. 913- 9. 260. Robins, S.J., et al., Cardiovascular events with increased lipoprotein-associated phospholipase A(2) and low high-density lipoprotein-cholesterol: the Veterans Affairs HDL Intervention Trial. Arterioscler Thromb Vasc Biol, 2008. 28(6): p. 1172-8. 261. Raichlin, E., et al., Lipoprotein-associated phospholipase A2 predicts progression of cardiac allograft vasculopathy and increased risk of cardiovascular events in heart transplant patients. Transplantation, 2008. 85(7): p. 963-8. 262. Kim, J.Y., et al., Lipoprotein-associated phospholipase A2 activity is associated with coronary artery disease and markers of oxidative stress: a case-control study. Am J Clin Nutr, 2008. 88(3): p. 630-7. 263. Gerber, Y., et al., Plasma lipoprotein-associated phospholipase A2 levels in heart failure: Association with mortality in the community. Atherosclerosis, 2008. 264. Gerber, Y., et al., Plasma lipoprotein-associated phospholipase A2 levels in heart failure: association with mortality in the community. Atherosclerosis, 2009. 203(2): p. 593-8. 265. Brilakis, E.S., et al., Association of lipoprotein-associated phospholipase A2 mass and activity with coronary and aortic atherosclerosis: findings from the Dallas Heart Study. Clin Chem, 2008. 54(12): p. 1975-81. 266. Elkind, M.S., et al., Lipoprotein-associated phospholipase A2 activity and risk of recurrent stroke. Cerebrovasc Dis, 2009. 27(1): p. 42-50. 267. Tsimikas, S., et al., Lipoprotein-associated phospholipase A2 activity, ferritin levels, metabolic syndrome, and 10-year cardiovascular and non-cardiovascular mortality: results from the Bruneck study. Eur Heart J, 2009. 30(1): p. 107-15. 268. Blake, G.J., et al., A prospective evaluation of lipoprotein-associated phospholipase A(2) levels and the risk of future cardiovascular events in women. J Am Coll Cardiol, 2001. 38(5): p. 1302-6. 269. Kiortsis, D.N., et al., Lack of association between carotid intima-media thickness and PAF-acetylhydrolase mass and activity in patients with primary hyperlipidemia. Angiology, 2005. 56(4): p. 451-8. 270. Kardys, I., et al., Lipoprotein-associated phospholipase A2 and measures of extracoronary atherosclerosis: the Rotterdam Study. Arterioscler Thromb Vasc Biol, 2006. 26(3): p. 631-6. 271. Allison, M.A., et al., The association between lipoprotein-associated phospholipase A2 and cardiovascular disease and total mortality in vascular medicine patients. J Vasc Surg, 2007. 46(3): p. 500-6. 272. Kardys, I., et al., Lipoprotein-associated phospholipase A2 and coronary calcification. The Rotterdam Coronary Calcification Study. Atherosclerosis, 2007. 191(2): p. 377-83.  131 273. Oldgren, J., et al., Lipoprotein-associated phospholipase A2 does not predict mortality or new ischaemic events in acute coronary syndrome patients. Eur Heart J, 2007. 28(6): p. 699-704. 274. Persson, M., et al., Lp-PLA2 activity and mass are associated with increased incidence of ischemic stroke: a population-based cohort study from Malmo, Sweden. Atherosclerosis, 2008. 200(1): p. 191-8. 275. Arakawa, H., et al., Local expression of platelet-activating factor-acetylhydrolase reduces accumulation of oxidized lipoproteins and inhibits inflammation, shear stress-induced thrombosis, and neointima formation in balloon-injured carotid arteries in nonhyperlipidemic rabbits. Circulation, 2005. 111(24): p. 3302-9. 276. Yamada, Y. and M. Yokota, Loss of activity of plasma platelet-activating factor acetylhydrolase due to a novel Gln281-->Arg mutation. Biochem Biophys Res Commun, 1997. 236(3): p. 772-5. 277. Hiramoto, M., et al., A mutation in plasma platelet-activating factor acetylhydrolase (Val279-->Phe) is a genetic risk factor for stroke. Stroke, 1997. 28(12): p. 2417-20. 278. Yamada, Y., et al., Identification of the G994--> T missense in exon 9 of the plasma platelet-activating factor acetylhydrolase gene as an independent risk factor for coronary artery disease in Japanese men. Metabolism, 1998. 47(2): p. 177-81. 279. Yoshida, H., et al., A mutation in plasma platelet-activating factor acetylhydrolase (Val279Phe) is a genetic risk factor for cerebral hemorrhage but not for hypertension. Thromb Haemost, 1998. 80(3): p. 372-5. 280. Ichihara, S., Y. Yamada, and M. Yokota, Association of a G994-->T missense mutation in the plasma platelet-activating factor acetylhydrolase gene with genetic susceptibility to nonfamilial dilated cardiomyopathy in Japanese. Circulation, 1998. 98(18): p. 1881-5. 281. Yamada, Y., et al., Correlations between plasma platelet-activating factor acetylhydrolase (PAF-AH) activity and PAF-AH genotype, age, and atherosclerosis in a Japanese population. Atherosclerosis, 2000. 150(1): p. 209- 16. 282. Unno, N., et al., Plasma platelet-activating factor acetylhydrolase deficiency is associated with atherosclerotic occlusive disease in japan. J Vasc Surg, 2000. 32(2): p. 263-7. 283. Yamada, Y., et al., Association of a G994 --> T (Val279 --> Phe) polymorphism of the plasma platelet-activating factor acetylhydrolase gene with myocardial damage in Japanese patients with nonfamilial hypertrophic cardiomyopathy. J Hum Genet, 2001. 46(8): p. 436-41. 284. Unno, N., et al., Association of a G994 -->T missense mutation in the plasma platelet-activating factor acetylhydrolase gene with risk of abdominal aortic aneurysm in Japanese. Ann Surg, 2002. 235(2): p. 297-302. 285. Abuzeid, A.M., et al., Association between the Ala379Val variant of the lipoprotein associated phospholipase A2 and risk of myocardial infarction in the north and south of Europe. Atherosclerosis, 2003. 168(2): p. 283-8.  132 286. Shimokata, K., et al., Association of gene polymorphisms with coronary artery disease in individuals with or without nonfamilial hypercholesterolemia. Atherosclerosis, 2004. 172(1): p. 167-73. 287. Ninio, E., et al., Platelet-activating factor-acetylhydrolase and PAF-receptor gene haplotypes in relation to future cardiovascular event in patients with coronary artery disease. Hum Mol Genet, 2004. 13(13): p. 1341-51. 288. Ishihara, M., et al., Functional impairment of two novel mutations detected in lipoprotein-associated phospholipase A2 (Lp-PLA2) deficiency patients. J Hum Genet, 2004. 49(6): p. 302-7. 289. Campo, S., et al., Platelet-activating factor acetylhydrolase is not associated with carotid intima-media thickness in hypercholesterolemic Sicilian individuals. Clin Chem, 2004. 50(11): p. 2077-82. 290. Zhang, X., et al., [Analysis of 994(G--> T) mutation in the plasma platelet- activating factor acetylhydrolase gene in the patients with cerebral infarction]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 2005. 22(4): p. 450-2. 291. Liu, P.Y., et al., Platelet-activating factor-acetylhydrolase A379V (exon 11) gene polymorphism is an independent and functional risk factor for premature myocardial infarction. J Thromb Haemost, 2006. 4(5): p. 1023-8. 292. Sekuri, C., et al., Association of platelet-activating factor acetylhydrolase gene polymorphism with premature coronary artery disease in Turkish patients. Anadolu Kardiyol Derg, 2006. 6(2): p. 132-4. 293. Jang, Y., et al., The Val279Phe variant of the lipoprotein-associated phospholipase A2 gene is associated with catalytic activities and cardiovascular disease in Korean men. J Clin Endocrinol Metab, 2006. 91(9): p. 3521-7. 294. Campo, S., et al., Platelet activating factor-acetylhydrolase (PAF-AH) activity and HDL levels, but not PAF-AH gene polymorphisms, are associated with successful aging in Sicilian octogenarians. Aging Clin Exp Res, 2008. 20(2): p. 171-7. 295. Hou, L., et al., Associations of PLA2G7 gene polymorphisms with plasma lipoprotein-associated phospholipase A2 activity and coronary heart disease in a Chinese Han population: the Beijing atherosclerosis study. Hum Genet, 2009. 125(1): p. 11-20. 296. Morgan, E.N., et al., Platelet-activating factor acetylhydrolase prevents myocardial ischemia-reperfusion injury. Circulation, 1999. 100(19 Suppl): p. II365-8. 297. Theilmeier, G., et al., HDL-associated PAF-AH reduces endothelial adhesiveness in apoE-/- mice. FASEB J, 2000. 14(13): p. 2032-9. 298. Quarck, R., et al., Adenovirus-mediated gene transfer of human platelet-activating factor-acetylhydrolase prevents injury-induced neointima formation and reduces spontaneous atherosclerosis in apolipoprotein E-deficient mice. Circulation, 2001. 103(20): p. 2495-500. 299. Hase, M., et al., Reduction in the extent of atherosclerosis in apolipoprotein E- deficient mice induced by electroporation-mediated transfer of the human plasma platelet-activating factor acetylhydrolase gene into skeletal muscle. Prostaglandins Other Lipid Mediat, 2002. 70(1-2): p. 107-18.  133 300. Turunen, P., et al., Intravascular adenovirus-mediated lipoprotein-associated phospholipase A2 gene transfer reduces neointima formation in balloon-denuded rabbit aorta. Atherosclerosis, 2005. 179(1): p. 27-33. 301. Steinbrecher, U.P. and P.H. Pritchard, Hydrolysis of phosphatidylcholine during LDL oxidation is mediated by platelet-activating factor acetylhydrolase. J Lipid Res, 1989. 30(3): p. 305-15. 302. Noto, H., et al., Human plasma platelet-activating factor acetylhydrolase binds to all the murine lipoproteins, conferring protection against oxidative stress. Arterioscler Thromb Vasc Biol, 2003. 23(5): p. 829-35. 303. Subramanian, V.S., et al., Role of lecithin-cholesterol acyltransferase in the metabolism of oxidized phospholipids in plasma: studies with platelet-activating factor-acetyl hydrolase-deficient plasma. Biochim Biophys Acta, 1999. 1439(1): p. 95-109. 304. Parthasarathy, S., et al., Essential role of phospholipase A2 activity in endothelial cell-induced modification of low density lipoprotein. Proc Natl Acad Sci U S A, 1985. 82(9): p. 3000-4. 305. Stein, O., M. Fainaru, and Y. Stein, The role of lysophosphatidylcholine and apolipoprotein A in the cholesterol-removing capacity of lipoprotein-deficient serum in tissue culture. Biochim Biophys Acta, 1979. 574(3): p. 495-504. 306. Hara, S., et al., Lysophosphatidylcholine promotes cholesterol efflux from mouse macrophage foam cells. Arterioscler Thromb Vasc Biol, 1997. 17(7): p. 1258-66. 307. Hou, M., et al., Lysophosphatidylcholine promotes cholesterol efflux from mouse macrophage foam cells via PPARgamma-LXRalpha-ABCA1-dependent pathway associated with apoE. Cell Biochem Funct, 2007. 25(1): p. 33-44. 308. Rosenblat, M., et al., Paraoxonase 1 (PON1) enhances HDL-mediated macrophage cholesterol efflux via the ABCA1 transporter in association with increased HDL binding to the cells: a possible role for lysophosphatidylcholine. Atherosclerosis, 2005. 179(1): p. 69-77. 309. Portman, O.W. and M. Alexander, Influence of lysophosphatidylcholine on the metabolism of plasma lipoproteins. Biochim Biophys Acta, 1976. 450(3): p. 322- 34. 310. Aoyama, T., et al., Induction of lectin-like oxidized LDL receptor by oxidized LDL and lysophosphatidylcholine in cultured endothelial cells. J Mol Cell Cardiol, 1999. 31(12): p. 2101-14. 311. Aoyama, T., et al., LOX-1 mediates lysophosphatidylcholine-induced oxidized LDL uptake in smooth muscle cells. FEBS Lett, 2000. 467(2-3): p. 217-20. 312. Hara, Y., et al., Lysophosphatidylcholine upregulates LOX-1, chemokine receptors, and activation-related transcription factors in human T-cell line Jurkat. J Thromb Thrombolysis, 2007. 313. Chang, M.Y., et al., Lysophosphatidylcholine regulates synthesis of biglycan and the proteoglycan form of macrophage colony stimulating factor. Arterioscler Thromb Vasc Biol, 2003. 23(5): p. 809-15. 314. Chang, M.Y., et al., Antioxidants inhibit the ability of lysophosphatidylcholine to regulate proteoglycan synthesis. Arterioscler Thromb Vasc Biol, 2006. 26(3): p. 494-500.  134 315. Sivaram, P., J.C. Obunike, and I.J. Goldberg, Lysolecithin-induced alteration of subendothelial heparan sulfate proteoglycans increases monocyte binding to matrix. J Biol Chem, 1995. 270(50): p. 29760-5. 316. Zhou, Z., et al., Lysophosphatidylcholine increases apolipoprotein B secretion by enhancing lipid synthesis and decreasing its intracellular degradation in HepG2 cells. Biochim Biophys Acta, 1998. 1391(1): p. 13-24. 317. Fless, G.M., et al., Subunit composition of lipoprotein(a) protein. Biochemistry, 1994. 33(45): p. 13492-501. 318. Saougos, V.G., et al., Differential effect of hypolipidemic drugs on lipoprotein- associated phospholipase A2. Arterioscler Thromb Vasc Biol, 2007. 27(10): p. 2236-43. 319. Stephan, Z.F. and E.C. Yurachek, Rapid fluorometric assay of LDL receptor activity by DiI-labeled LDL. J Lipid Res, 1993. 34(2): p. 325-30. 320. Jurgens, G., et al., Modification of human serum low density lipoprotein by oxidation--characterization and pathophysiological implications. Chem Phys Lipids, 1987. 45(2-4): p. 315-36. 321. Cominacini, L., et al., A simple test for predisposition to LDL oxidation based on the fluorescence development during copper-catalyzed oxidative modification. J Lipid Res, 1991. 32(2): p. 349-58. 322. Tew, D.G., et al., Purification, properties, sequencing, and cloning of a lipoprotein-associated, serine-dependent phospholipase involved in the oxidative modification of low-density lipoproteins. Arterioscler Thromb Vasc Biol, 1996. 16(4): p. 591-9. 323. Stafforini, D.M., T.M. McIntyre, and S.M. Prescott, Platelet-activating factor acetylhydrolase from human plasma. Methods Enzymol, 1990. 187: p. 344-57. 324. Tselepis, A.D., et al., PAF-degrading acetylhydrolase is preferentially associated with dense LDL and VHDL-1 in human plasma. Catalytic characteristics and relation to the monocyte-derived enzyme. Arterioscler Thromb Vasc Biol, 1995. 15(10): p. 1764-73. 325. Suits, A.G., et al., Phagocytosis of aggregated lipoprotein by macrophages: low density lipoprotein receptor-dependent foam-cell formation. Proc Natl Acad Sci U S A, 1989. 86(8): p. 2713-7. 326. Araki, N., M.T. Johnson, and J.A. Swanson, A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages. J Cell Biol, 1996. 135(5): p. 1249-60. 327. Berthiaume, E.P., C. Medina, and J.A. Swanson, Molecular size-fractionation during endocytosis in macrophages. J Cell Biol, 1995. 129(4): p. 989-98. 328. Racoosin, E.L. and J.A. Swanson, M-CSF-induced macropinocytosis increases solute endocytosis but not receptor-mediated endocytosis in mouse macrophages. J Cell Sci, 1992. 102 ( Pt 4): p. 867-80. 329. Mavridis, I.M. and E. Hadjoudis, The crystal structure of the inclusion complex of cyclomaltoheptaose (beta-cyclodextrin) with 4-tert-butyltoluene. Carbohydr Res, 1992. 229(1): p. 1-15. 330. Howard, K.M., et al., Cell-specific regulation of expression of plasma-type platelet-activating factor acetylhydrolase in the liver. J Biol Chem, 1997. 272(44): p. 27543-8.  135 331. Hakala, J.K., et al., Lipolytic modification of LDL by phospholipase A2 induces particle aggregation in the absence and fusion in the presence of heparin. Arterioscler Thromb Vasc Biol, 1999. 19(5): p. 1276-83. 332. Oorni, K., et al., Sphingomyelinase induces aggregation and fusion, but phospholipase A2 only aggregation, of low density lipoprotein (LDL) particles. Two distinct mechanisms leading to increased binding strength of LDL to human aortic proteoglycans. J Biol Chem, 1998. 273(44): p. 29127-34. 333. Murugesan, G. and P.L. Fox, Role of lysophosphatidylcholine in the inhibition of endothelial cell motility by oxidized low density lipoprotein. J Clin Invest, 1996. 97(12): p. 2736-44. 334. Asatryan, L., et al., LDL phospholipid hydrolysis produces modified electronegative particles with an unfolded apoB-100 protein. J Lipid Res, 2005. 46(1): p. 115-22. 335. Ambrosio, G., et al., Oxygen radicals inhibit human plasma acetylhydrolase, the enzyme that catabolizes platelet-activating factor. J Clin Invest, 1994. 93(6): p. 2408-16. 336. Mujawar, Z., et al., Human immunodeficiency virus impairs reverse cholesterol transport from macrophages. PLoS Biol, 2006. 4(11): p. e365. 337. Juompan, L., et al., Study of LDL and acetylated LDL endocytosis by mononuclear cells in HIV infection. Biochim Biophys Acta, 1995. 1272(1): p. 21- 8. 338. Mohler, E.R., 3rd, et al., The effect of darapladib on plasma lipoprotein- associated phospholipase A2 activity and cardiovascular biomarkers in patients with stable coronary heart disease or coronary heart disease risk equivalent: the results of a multicenter, randomized, double-blind, placebo-controlled study. J Am Coll Cardiol, 2008. 51(17): p. 1632-41. 339. Shoenfeld, Y., et al., Are anti-oxidized low-density lipoprotein antibodies pathogenic or protective? Circulation, 2004. 110(17): p. 2552-8. 340. Fuki, I.V., et al., Endogenously produced endothelial lipase enhances binding and cellular processing of plasma lipoproteins via heparan sulfate proteoglycan- mediated pathway. J Biol Chem, 2003. 278(36): p. 34331-8. 341. Merkel, M., et al., Catalytically inactive lipoprotein lipase expression in muscle of transgenic mice increases very low density lipoprotein uptake: direct evidence that lipoprotein lipase bridging occurs in vivo. Proc Natl Acad Sci U S A, 1998. 95(23): p. 13841-6. 342. Lund-Katz, S., et al., Apolipoprotein B-100 conformation and particle surface charge in human LDL subspecies: implication for LDL receptor interaction. Biochemistry, 1998. 37(37): p. 12867-74. 343. Galeano, N.F., et al., Small dense low density lipoprotein has increased affinity for LDL receptor-independent cell surface binding sites: a potential mechanism for increased atherogenicity. J Lipid Res, 1998. 39(6): p. 1263-73. 344. Meyer, D.F., et al., Time-course studies by synchrotron X-ray solution scattering of the structure of human low-density lipoprotein during Cu(2+)-induced oxidation in relation to changes in lipid composition. Biochem J, 1996. 319 ( Pt 1): p. 217-27.  136 345. Itabe, H., Oxidized low-density lipoproteins: what is understood and what remains to be clarified. Biol Pharm Bull, 2003. 26(1): p. 1-9. 346. Webb, N.R., et al., Alternative forms of the scavenger receptor BI (SR-BI). J Lipid Res, 1997. 38(7): p. 1490-5. 347. Maeno, Y., et al., Ultrastructural localization of CD36 in human hepatic sinusoidal lining cells, hepatocytes, human hepatoma (HepG2-A16) cells, and C32 amelanotic melanoma cells. Exp Parasitol, 1994. 79(3): p. 383-90. 348. Rhainds, D., et al., Uptake and fate of class B scavenger receptor ligands in HepG2 cells. Eur J Biochem, 1999. 261(1): p. 227-35. 349. Davis, B., et al., Electrospray ionization mass spectrometry identifies substrates and products of lipoprotein-associated phospholipase A2 in oxidized human low density lipoprotein. J Biol Chem, 2008. 283(10): p. 6428-37. 350. Ky, B., et al., The influence of pravastatin and atorvastatin on markers of oxidative stress in hypercholesterolemic humans. J Am Coll Cardiol, 2008. 51(17): p. 1653-62. 351. Vickers, K.C., et al., Relationship of lipoprotein-associated phospholipase A2 and oxidized low-density lipoprotein in carotid atherosclerosis. J Lipid Res, 2009. 352. Chang, M.Y., et al., Oxidized low density lipoproteins regulate synthesis of monkey aortic smooth muscle cell proteoglycans that have enhanced native low density lipoprotein binding properties. J Biol Chem, 2000. 275(7): p. 4766-73. 353. Camejo, G., et al., Binding of low density lipoproteins by proteoglycans synthesized by proliferating and quiescent human arterial smooth muscle cells. J Biol Chem, 1993. 268(19): p. 14131-7. 354. Cardoso, L.E. and P.A. Mourao, Glycosaminoglycan fractions from human arteries presenting diverse susceptibilities to atherosclerosis have different binding affinities to plasma LDL. Arterioscler Thromb, 1994. 14(1): p. 115-24. 355. Watson, A.D., et al., Effect of platelet activating factor-acetylhydrolase on the formation and action of minimally oxidized low density lipoprotein. J Clin Invest, 1995. 95(2): p. 774-82. 356. De Geest, B., et al., Effect of overexpression of human apo A-I in C57BL/6 and C57BL/6 apo E-deficient mice on 2 lipoprotein-associated enzymes, platelet- activating factor acetylhydrolase and paraoxonase. Comparison of adenovirus- mediated human apo A-I gene transfer and human apo A-I transgenesis. Arterioscler Thromb Vasc Biol, 2000. 20(10): p. E68-75. 357. Tsimihodimos, V., et al., Altered distribution of platelet-activating factor- acetylhydrolase activity between LDL and HDL as a function of the severity of hypercholesterolemia. J Lipid Res, 2002. 43(2): p. 256-63.   137 Appendices Appendix I  Sequencing result for pLenti6DEST-LOF-1 nnnnnnttcgnnnncgtcgatcgtnnnnnggaggtagtgagtcgaccagtggatcctggaggcttgctgaagnnnnnnnn ngtacagcagcaactataaacccgttttggccactgactgacgggtttatttgctgctgtacaggacacaaggcctgttactagca ctcacatggaacaaatggcccagatctggccgcactcgagatatctagacccagctttcttgtacaaagnggttgatatccngca cagtggcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgt accggttagtaatgagtttggaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcaga agtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaag catgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctc cgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggct tttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcat cggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccct cattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacgg ccgcatcttcactggngtcaatgtatatcattttactgggggancttgtgcanaactcgtgngctgggcnntgctgctgctgcggc agctggcaanntgacttgnatcgtcgcgatcggaaatgagancagggcatcttgagcccctgnnnnggtgccgacnggtgct tcncgatctgcatcctggnntcaagccatnntgaangacnnngatnnacagccgangn  NOTE: The short sequence in grey shade is the inserted pre-miRNA.    138  Sequencing result for pLenti6DEST-LOF-2 nnnnnnnnngnnnntcgatcgtttaagggaggnagtgagtcgaccagtggatcctggaggcttgctgaaggctgtatgctgt atttctgcagcagattggtcgttttggccactgactgacgaccaatcctgcagaaatacaggacacaaggcctgttactagcactc acatggaacaaatggcccagatctggccgcactcgagatatctagacccagctttcttgtacaaagtggttgatatccagcacagt ggcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtacc ggttagtaatgagtttggaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagt atgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcat gcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgc cccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggctttttt ggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcgg catagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcatt gaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccg catcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagc tggcaacctgacttgtatcgtcgcgatcggaaatgagacaggggcatcntgagccctgngnnggtgccgacnggtgcttctcg anntgcatcctgggatcaagcatagtgaaggannntgatggacagccgacgnnagttggnntcnnnnn  NOTE: The short sequence in grey shade is the inserted pre-miRNA.  Sequencing result for pLenti6DEST-LOF-neg-ctrl Nnnnnntnnnggcgtcgatcgtttaagggaggtagtgagtcgaccagtggatcctggaggcttgctgaaggctgtatgctgaa atgtactgcgcgtggagacgttttggccactgactgacgtctccacgcagtacatttcaggacacaaggcctgttactagcactca catggaacaaatggcccagatctggccgcactcgagatatctagacccagctttcttgtacaaagtggttgatatccagcacagtg  139 gcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccg gttagtaatgagtttggaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtat gcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgc atctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccc catggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttgg aggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcat agtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaa agagcaacggctacaatcnacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcat cttcactggtgtcantgtatatcattttactgggggancttgtgcagaactcgtgngctgggcactgctgctgctgcggcagctgg caacctgacttgtatcgtcgcgatcggaaatganaacaggggcatcntgagccctgcngacggngccnacaggtgctnctcg ancngcatcctgggatcaaagccntantgaannnn  NOTE: The short sequence in grey shade is the inserted miRNA control which was not targeting any human mRNA.  Appendix II  Sequencing result for pcDNA5/FRT/PLA2G7 Cgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactgg cttatcgaaattaatacgactcactatagggagacccaagctggctagcgtttaaacttaagcttggtaccgagctcggatccacta gtccagtgtggtggaattctgcagatatccagcacagtggcggccgcgaattcggcaccaggccagagctgctcggcccgca gccagggggacagcggctggtcggaggctcgcagtgctgtcggcgagaagcagtcgggtttggagcgcttgggtcgcgttg gtgcgcggtggacacgagggaccccagttcccgcgagcagctccgcgccggccctgagagactaagctgaaactgctgctc  140 agctcccaagatggtgccacccaaattgcatgtgcttttctgcctctgcggctgcctggctgtggtttatccttttgactggcaata cataaatcctgttgcccatatgaaatcatcagcatgggtcaacaaaatacaagtactgatggctgctgcaagctttggccaaa ctaaaatcccccggggaaatgggccttattccgttggttgtacagacttaatgtttgatcacactaataagggcaccttcttgcg tttatattatccatcccaagataatgatcgccttgacaccctttggatcccaaataaagaatatttttggggtcttagcaaatttctt ggaacacactggcttatgggcaacattttgaggttactctttggttcaatgacaactcctgcaaactggaattcccctctgaggc ctggtgaaaaatatccacttgttgttttttctcatggtcttggggcattcaggacactttattctgctattggcattgacctggcatct catgggtttatagttgctgctgtagaacacagagatagatctgcatctgcaacttactatttcaaggaccaatctgctgcagaa ataggggacaagtcttggctctaccttagaaccctgaaacaagaggaggagacacatatacgaaatgagcaggtacggc aaagagcaaaagaatgttcccaagctctcagtctgattcttgacattgatcatggaaagccagtgaagaatgcattagattta aagtttgatatggaacaactgaaggactctattgatagggaaaaaatagcagtaattggacattcttttggtggagcaacggt tattcagactcttagtgaagatcagagattcagatgtggtattgccctggatgcatggatgtttccactgggtgatgaagtatatt ccagaattcctcagcccctcttttttatcaactctgaatatttccaatatcctgctaatatcataaaaatgaaaaaatgctactcac ctgataaagaaagaaagatgattacaatcaggggttcagtccaccagaattttgctgacttcacttttgcaactggcaaaata attggacacatgctcaaattaaagggagacatagattcaaatgcagctattgatcttagcaacaaagcttcattagcattctta caaaagcatttaggacttcataaagattttgatcagtgggactgcttgattgaaggagatgatgagaatcttattccagggacc aacattaacacaaccaatcaacacatcatgttacagaactcttcaggaatagagaaatacaattaggattaaaataggtttttt aaaaaaaaaaaaaaaaaactcgactctagattgcggccgctcgagtctagagggcccgtttaaacccgctgatcagcctcgact gtgccttctag  NOTE: The short sequences with underline at beginning and end are CMV forward priming site and BGH reverse priming site, respectively. The long sequence in grey shade is the full-length Lp-PLA2 cDNA.   141 Appendix III  Sequencing result for pcDNA5/FRT/Lp-PLA2/HIS gcggccgcgaattcggcaccaggccagagctgctcggcccgcagccagggggacagcggctggtcggaggctcgcagtg ctgtcggcgagaagcagtcgggtttggagcgcttgggtcgcgttggtgcgcggtggacacgagggaccccagttcccgcgag cagctccgcgccggccctgagagactaagctgaaactgctgctcagctcccaagatggtgccacccaaattgcatgtgcttttc tgcctctgcggctgcctggctgtggtttatccttttgactggcaatacataaatcctgttgcccatatgaaatcatcagcatgggt caacaaaatacaagtactgatggctgctgcaagctttggccaaactaaaatcccccggggaaatgggccttattccgttggtt gtacagacttaatgtttgatcacactaataagggcaccttcttgcgtttatattatccatcccaagataatgatcgccttgacacc ctttggatcccaaataaagaatatttttggggtcttagcaaatttcttggaacacactggcttatgggcaacattttgaggttactc tttggttcaatgacaactcctgcaaactggaattcccctctgaggcctggtgaaaaatatccacttgttgttttttctcatggtcttg gggcattcaggacactttattctgctattggcattgacctggcatctcatgggtttatagttgctgctgtagaacacagagatag atctgcatctgcaacttactatttcaaggaccaatctgctgcagaaataggggacaagtcttggctctaccttagaaccctgaa acaagaggaggagacacatatacgaaatgagcaggtacggcaaagagcaaaagaatgttcccaagctctcagtctgatt cttgacattgatcatggaaagccagtgaagaatgcattagatttaaagtttgatatggaacaactgaaggactctattgatag ggaaaaaatagcagtaattggacattcttttggtggagcaacggttattcagactcttagtgaagatcagagattcagatgtg gtattgccctggatgcatggatgtttccactgggtgatgaagtatattccagaattcctcagcccctcttttttatcaactctgaata tttccaatatcctgctaatatcataaaaatgaaaaaatgctactcacctgataaagaaagaaagatgattacaatcaggggtt cagtccaccagaattttgctgacttcacttttgcaactggcaaaataattggacacatgctcaaattaaagggagacatagatt caaatgcagctattgatcttagcaacaaagcttcattagcattcttacaaaagcatttaggacttcataaagattttgatcagtg ggactgcttgattgaaggagatgatgagaatcttattccagggaccaacattaacacaaccaatcaacacatcatgttacag aactcttcaggaatagagaaatacaatcaccaccaccaccaccactaggattaaaataggttttttaaaaaaaaaaaaaaaaa actcgactctagattgcggccgc   142 NOTE: The short sequence with underline is the primer. The long sequence in grey shade is the full-length Lp-PLA2 cDNA. The bolded sequence right after the Lp-PLA2 cDNA is the inserted HIS tag.  Sequencing result for pcDNA5/FRT/mutated Lp-PLA2/HIS gcggccgcgaattcggcaccaggccagagctgctcggcccgcagccagggggacagcggctggtcggaggctcgcagtg ctgtcggcgagaagcagtcgggtttggagcgcttgggtcgcgttggtgcgcggtggacacgagggaccccagttcccgcgag cagctccgcgccggccctgagagactaagctgaaactgctgctcagctcccaagatggtgccacccaaattgcatgtgcttttc tgcctctgcggctgcctggctgtggtttatccttttgactggcaatacataaatcctgttgcccatatgaaatcatcagcatgggt caacaaaatacaagtactgatggctgctgcaagctttggccaaactaaaatcccccggggaaatgggccttattccgttggtt gtacagacttaatgtttgatcacactaataagggcaccttcttgcgtttatattatccatcccaagataatgatcgccttgacacc ctttggatcccaaataaagaatatttttggggtcttagcaaatttcttggaacacactggcttatgggcaacattttgaggttactc tttggttcaatgacaactcctgcaaactggaattcccctctgaggcctggtgaaaaatatccacttgttgttttttctcatggtcttg gggcattcaggacactttattctgctattggcattgacctggcatctcatgggtttatagttgctgctgtagaacacagagatag atctgcatctgcaacttactatttcaaggaccaatctgctgcagaaataggggacaagtcttggctctaccttagaaccctgaa acaagaggaggagacacatatacgaaatgagcaggtacggcaaagagcaaaagaatgttcccaagctctcagtctgatt cttgacattgatcatggaaagccagtgaagaatgcattagatttaaagtttgatatggaacaactgaaggactctattgatag ggaaaaaatagcagtaattggacatgcttttggtggagcaacggttattcagactcttagtgaagatcagagattcagatgtg gtattgccctggatgcatggatgtttccactgggtgatgaagtatattccagaattcctcagcccctcttttttatcaactctgaata tttccaatatcctgctaatatcataaaaatgaaaaaatgctactcacctgataaagaaagaaagatgattacaatcaggggtt cagtccaccagaattttgctgacttcacttttgcaactggcaaaataattggacacatgctcaaattaaagggagacatagatt caaatgcagctattgatcttagcaacaaagcttcattagcattcttacaaaagcatttaggacttcataaagattttgatcagtg ggactgcttgattgaaggagatgatgagaatcttattccagggaccaacattaacacaaccaatcaacacatcatgttacag aactcttcaggaatagagaaatacaatcaccaccaccaccaccactaggattaaaataggttttttaaaaaaaaaaaaaaaaa actcgactctagattgcggccgc  143  NOTE: The short sequence with underline is the primer. The long sequence in grey shade is the full-length Lp-PLA2 cDNA. The bolded sequence right after the Lp-PLA2 cDNA is the inserted HIS tag. The gct in grey and bold is the mutated site. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0067484/manifest

Comment

Related Items