Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of Cpn60.2 as a surface ligand of Mycobacterium tuberculosis that facilitates bacterial… Hickey, Tyler Bruce Malcolm 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_hickey_tyler.pdf [ 2.31MB ]
Metadata
JSON: 24-1.0067306.json
JSON-LD: 24-1.0067306-ld.json
RDF/XML (Pretty): 24-1.0067306-rdf.xml
RDF/JSON: 24-1.0067306-rdf.json
Turtle: 24-1.0067306-turtle.txt
N-Triples: 24-1.0067306-rdf-ntriples.txt
Original Record: 24-1.0067306-source.json
Full Text
24-1.0067306-fulltext.txt
Citation
24-1.0067306.ris

Full Text

IDENTIFICATION OF CPN60.2 AS A SURFACE LIGAND OF MYCOBACTERIUM TUBERCULOSIS THAT FACILITATES BACTERIAL ASSOCIATION WITH MACROPHAGES VIA CD43. by  TYLER BRUCE MALCOLM HICKEY BSc.H, The University of Guelph, 2002  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Pathology and Laboratory Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2009  © Tyler Bruce Malcolm Hickey, 2009  Abstract Mycobacterium tuberculosis bacilli initially contact host cells with elements of their outer cell wall, or capsule. We have shown that capsular proteins from the surface of M. tuberculosis competitively inhibit the non-opsonic binding of whole M. tuberculosis bacilli to macrophages in a dose-dependent manner that is not acting through a global inhibition of macrophage binding. CD43 is a large sialylated glycoprotein that is found on the surface of macrophages and has been shown in previous studies to be necessary for efficient macrophage binding and immunological responsiveness to M. tuberculosis. Using capsular proteins and recombinant CD43, we have employed affinity chromatography to show that Cpn60.2 (Hsp65, GroEL2), and to a lesser extent DnaK (Hsp70), bind to CD43. We subsequently demonstrated that both Cpn60.2 and DnaK can be identified on the surface of M. tuberculosis bacilli. Furthermore, we performed recombinant protein competitive inhibition and polyclonal F(ab')2 antibody-mediated epitope masking studies to show that Cpn60.2, but not DnaK, acts as a mycobacterial adhesin for macrophage binding. We then compared M. tuberculosis binding of CD43+/+ versus CD43-/macrophages and found that the adhesin function of Cpn60.2 is CD43-dependent. Additionally, the binding between Cpn60.2 and CD43 can be saturated; however the binding affinity is comparatively weak, near one micromolar. We have also shown that the ability of Cpn60.2 to competitively inhibit M. tuberculosis binding to macrophages is shared by the Escherichia coli homologue GroEL, but not by the mouse and human Hsp60 homologues. These findings add to a growing field of research that implicates molecular chaperones as having extracellular functions, including mediating bacterial adherence to host cells, distinct from their welldescribed protein folding activities within the cytosol.  ii  Table of Contents  Abstract ...................................................................................................................................................................... ii  Table of Contents ..................................................................................................................................................... iii  List of Tables .............................................................................................................................................................. x  List of Figures ............................................................................................................................................................xi  List of Abbreviations and Acronyms ..................................................................................................................... xii  Acknowledgements..................................................................................................................................................xvi  Dedication ...............................................................................................................................................................xvii  Chapter 1: Introduction........................................................................................................................................... 1 1.1  Tuberculosis & Mycobacterium tuberculosis ..................................................................................................... 1  1.1.1 Mycobacteria .................................................................................................................................................. 1 1.1.2 History of tuberculosis ................................................................................................................................. 2 1.1.3  Tuberculosis in the modern era (1950→) .................................................................................................... 4  1.1.3.1 Anti-tuberculous therapeutics and drug resistance ................................................................................. 4 1.1.3.2 Tuberculosis & human immunodeficiency virus .................................................................................... 5 1.1.3.3 The World Health Organization and ‘DOTS’ ......................................................................................... 6 1.1.4 Global long-term solutions for tuberculosis ................................................................................................... 6 1.2 Host infection, spread, and general immune response to M. tuberculosis infection............................................... 8 1.3  Overview of the cellular immune response to M. tuberculosis infection.......................................................... 11  iii  1.3.1 T-lymphocyte responses ............................................................................................................................... 11 1.3.1.1 CD4+ T cells ......................................................................................................................................... 11 1.3.1.2 CD8+ T cells ......................................................................................................................................... 12 1.3.1.3 γδ T cells ............................................................................................................................................... 13 1.3.2 Professional phagocytes ............................................................................................................................... 13 1.3.2.1 Neutrophils ........................................................................................................................................... 13 1.3.2.2 Dendritic cells ....................................................................................................................................... 15 1.3.2.3 Macrophages ......................................................................................................................................... 16 1.4 Macrophage interactions with M. tuberculosis .................................................................................................... 17 1.4.1 Complement receptors .................................................................................................................................. 17 1.4.2 Collectins ...................................................................................................................................................... 18 1.4.3 Scavenger receptors ...................................................................................................................................... 19 1.4.4 Mannose receptor ......................................................................................................................................... 19 1.4.5 Dectin-1 ........................................................................................................................................................ 20 1.4.6 Toll-like receptors ........................................................................................................................................ 21 1.4.7 Fc receptor .................................................................................................................................................... 22 1.4.8 CD43 ............................................................................................................................................................ 23 1.5 CD43 .................................................................................................................................................................... 23 1.5.1 CD43 structure & expression ....................................................................................................................... 23 1.5.2 Roles of CD43 in the host ............................................................................................................................ 26 1.5.2.1 Anti-adhesive roles ............................................................................................................................... 26 1.5.2.2 Pro-adhesive roles ................................................................................................................................. 27 1.5.2.3 CD43 and cell activation....................................................................................................................... 27 1.5.2.4 CD43 and apoptosis .............................................................................................................................. 28 1.5.3 CD43 and disease ......................................................................................................................................... 29 1.5.3.1 Wiscott-Aldrich syndrome .................................................................................................................... 29 1.5.3.2 HIV/AIDS ............................................................................................................................................. 29  iv  1.5.3.3 CD43 and mycobacteria........................................................................................................................ 30 1.6 Mycobacterial ligands .......................................................................................................................................... 32 1.6.1 The cell wall & capsule of M. tuberculosis .................................................................................................. 32 1.6.1.1 The inner cell wall of M. tuberculosis .................................................................................................. 33 1.6.1.2 The capsule of M. tuberculosis ............................................................................................................. 33 1.6.2 Interaction of M. tuberculosis with the macrophage .................................................................................... 36 1.6.2.1 Carbohydrate and lipidic ligands .......................................................................................................... 36 1.6.2.3 Protein ligands ...................................................................................................................................... 38 1.7 Project goals ......................................................................................................................................................... 39 1.7.1 Hypothesis .................................................................................................................................................... 39 1.7.2 Project objectives.......................................................................................................................................... 40 1.7.2.1 Evaluation of the M. tuberculosis capsule as a source for candidate adhesins ..................................... 40 1.7.2.2 Evaluation of the mycobacterial ligands that interact with CD43 ........................................................ 40 1.7.2.3 Confirm that moieties identified in Objective 2 can act as ligands for M. tuberculosis binding to macrophages ..................................................................................................................................................... 40 1.7.2.4 Confirm that ligands identified in objectives 2 and 3 interact with CD43 on the macrophage............. 41 1.7.2.5 Characterize the binding affinity and specificity of candidate CD43 ligands ....................................... 41  Chapter 2: Materials & Methods ............................................................................................................................ 42 2.1 Materials............................................................................................................................................................... 42 2.1.1 Bacteria......................................................................................................................................................... 42 2.1.2 Preparation of capsule .................................................................................................................................. 42 2.1.3 Capsule fractionation .................................................................................................................................... 43 2.1.4 Mice and cell culture .................................................................................................................................... 45 2.1.5 Construction and expression of CD43-Fc chimeric proteins ........................................................................ 47 2.1.6 CD43-Fc chimeric protein purification ........................................................................................................ 49 2.1.7 Recombinant molecular chaperones ............................................................................................................. 50  v  2.1.8 Preparation of anti-Cpn60.2, anti-DnaK (F(ab’)2-fragment) and anti-capsule polyclonal antibodies .......... 52 2.2 Methods ................................................................................................................................................................ 54 2.2.1 Interaction of M. tuberculosis and other compounds with MΦ .................................................................... 54 2.2.2 Two-dimensional polyacrylamide gel electrophoresis of capsular proteins ................................................. 56 2.2.3 Characterization of CD43-Fc chimeric protein ............................................................................................ 56 2.2.4 CD43-Fc association with M. tuberculosis bacilli and capsule .................................................................... 58 2.2.5 Affinity chromatography .............................................................................................................................. 59 2.2.6 Mass spectrometry analysis of affinity chromatography eluate.................................................................... 60 2.2.7 Detection of capsule-associated Cpn60.2 and DnaK .................................................................................... 60 2.2.8 Cpn60.2 and DnaK binding to the macrophage surface ............................................................................... 62 2.2.9 Flow cytometry............................................................................................................................................. 62 2.2.10 Saturation binding ELISA .......................................................................................................................... 63 2.2.11 Glycan array analysis ................................................................................................................................. 64 2.2.12 Imaging....................................................................................................................................................... 64 2.2.13 Statistical analyses ...................................................................................................................................... 65  Chapter 3 - M. tuberculosis Capsular Proteins Mediate Macrophage Association ............................................ 66 3.1 Introduction .......................................................................................................................................................... 66 3.2 Rationale .............................................................................................................................................................. 67 3.3.1 The M. tuberculosis capsule contains adhesins for macrophage binding ..................................................... 67 3.3.2 Capsule-mediated inhibition of M. tuberculosis uptake is not due to a global inhibition of macrophage particle binding ...................................................................................................................................................... 68 3.3.3 The inhibitory component of the capsule is proteinaceous ........................................................................... 68 3.4 Discussion and summary ...................................................................................................................................... 69  Chapter 4: CD43-Fc Binds to Capsular Proteins on the M. tuberculosis Surface .............................................. 76  vi  4.1 Introduction .......................................................................................................................................................... 76 4.2 Rationale .............................................................................................................................................................. 77 4.3 Results .................................................................................................................................................................. 78 4.3.1 Confirmation of Fc domain presence ........................................................................................................... 78 4.3.2 Confirmation of carbohydrate presence........................................................................................................ 79 4.3.2.1 Wheat germ agglutinin capture ............................................................................................................. 79 4.3.2.2 Periodic acid Schiff staining ................................................................................................................. 79 4.3.2.3 Confirmation of sialic acid presence..................................................................................................... 80 4.3.3 Antibody-based identification of CD43 epitopes ......................................................................................... 80 4.3.4 CD43-Fc binds to proteins present in the M. tuberculosis capsule............................................................... 80 4.4 Discussion and summary ...................................................................................................................................... 82  Chapter 5: Cpn60.2 and DnaK are Localized on the Bacterial Surface and Bind to CD43-Fc in vitro ........... 88 5.1 Introduction .......................................................................................................................................................... 88 5.2 Rationale .............................................................................................................................................................. 91 5.3 Results .................................................................................................................................................................. 92 5.3.1 Capture of candidate M. tuberculosis ligands for CD43 using affinity chromatography ............................. 92 5.3.2 Mass spectrometry identification of candidate proteins ............................................................................... 92 5.3.3 Western blot analysis of mycobacterial proteins bound during affinity chromatography ............................ 93 5.3.4 Two-dimensional polyacrylamide gel electrophoresis of M. tuberculosis capsule proteins ......................... 93 5.3.5 ELISA detection of Cpn60.2 and DnaK on M. tuberculosis bacteria ........................................................... 94 5.3.6 Immunofluorescent detection of Cpn60.2 and DnaK on the surface of M. tuberculosis .............................. 95 5.4 Discussion and summary ...................................................................................................................................... 95  Chapter 6: The Roles of Cpn60.2 and DnaK in M. tuberculosis Association with Macrophages ................... 104  vii  6.1 Introduction ........................................................................................................................................................ 104 6.2 Rationale ............................................................................................................................................................ 106 6.3 Results ................................................................................................................................................................ 107 6.3.1 Binding of recombinant Cpn60.2 and DnaK to the macrophage surface ................................................... 107 6.3.2 Competitive-inhibition of M. tuberculosis binding using recombinant Cpn60.2 and DnaK ...................... 107 6.3.3 Binding-Inhibition using antibody epitope-masking of Cpn60.2 and DnaK on the surface of M. tuberculosis ......................................................................................................................................................... 109 6.3.4 Differences in surface binding of recombinant Cpn60.2 and DnaK to CD43+/+ vs. CD43-/- macrophages using flow cytometry ........................................................................................................................................... 110 6.3.5 Competitive-inhibition and epitope-masking of Cpn60.2 to assess M. tuberculosis binding to CD43+/+ vs. CD43-/- macrophages ........................................................................................................................................... 111 6.4 Discussion and summary .................................................................................................................................... 113  Chapter 7: Characterization of the Cpn60.2 and CD43 Interaction ................................................................ 130 7.1 Introduction ........................................................................................................................................................ 130 7.2 Rationale ............................................................................................................................................................ 133 7.3 Results ................................................................................................................................................................ 134 7.3.1 Saturation curve of Cpn60.2 binding to CD43-Fc ...................................................................................... 134 7.3.2 Evaluation of M. tuberculosis/macrophage binding inhibition by various Cpn60.2 homologues .............. 135 7.3.3 Evaluation of Cpn60.2 and DnaK binding to carbohydrates using a glycan array ..................................... 136 7.4 Discussion and summary .................................................................................................................................... 137  Chapter 8: Final Discussion and Summary ........................................................................................................ 143 Future Directions ................................................................................................................................................. 151  viii  References ............................................................................................................................................................... 153  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array .......................................................... 183  ix  List of Tables  Table 1: Compilation of published studies that have shown surface localization and adhesin function of Cpn60.2 (Hsp65, GroEL) and DnaK (Hsp70) homologues in bacteria .................................................................................. 103  x  List of Figures Figure 1: Host infection and pathological progression of TB .................................................................................... 10 Figure 2: The M. tuberculosis cell wall ..................................................................................................................... 35 Figure 3: M. tuberculosis capsule inhibits the ability of M. tuberculosis bacilli to bind macrophages ..................... 73 Figure 4: M. tuberculosis capsule does not cause a global inhibition of macrophage particle binding/phagocytosis and the inhibitory moiety in the capsule is soluble in aqueous solvent ...................................................................... 74 Figure 5: The water soluble inhibitory moiety within the M. tuberculosis capsule is a protein and not either of the two major capsular glycans ........................................................................................................................................ 75 Figure 6: Diagram of the CD43-Fc chimera.............................................................................................................. 85 Figure 7: Characterization of the CD43-Fc chimera ................................................................................................. 86 Figure 8: CD43-Fc binds to the M. tuberculosis surface, specifically capsular proteins .......................................... 87 Figure 9: Cpn60.2 and DnaK sourced from the M. tuberculosis capsule bind to CD43-Fc .................................... 100 Figure 10: Two dimensional-polyacrylamide gel electrophoresis analysis of M. tuberculosis capsular proteins ... 101 Figure 11: Cpn60.2 and DnaK are associated with the surface of M. tuberculosis bacilli ....................................... 102 Figure 12: Cpn60.2 and DnaK bind to the macrophage surface.............................................................................. 121 Figure 13: Cpn60.2, but not DnaK, can competitively inhibit the association of M. tuberculosis bacilli with macrophages in a dose-dependent manner ............................................................................................................... 122 Figure 14: Analysis of polyclonal anti-Cpn60.2 and anti-DnaK cross-reactivity ................................................... 123 Figure 15: Evaluation of function and specificity of polyclonal anti-Cpn60.2 and anti-DnaK ............................... 125 Figure 16: M. tuberculosis association with macrophages after Cpn60.2 and DnaK epitope-masking .................. 126 Figure 17: Surface binding by Cpn60.2 and DnaK is reduced in CD43-/- macrophages ......................................... 127 Figure 18: Competitive-inhibition and epitope-masking of Cpn60.2 to assess M. tuberculosis association with CD43+/+ and CD43-/- macrophages ........................................................................................................................... 129 Figure 19: Saturation curve of Cpn60.2 binding to CD43-Fc ................................................................................. 141 Figure 20: M. tuberculosis/macrophage binding inhibition by various Cpn60.2 homologues ................................ 142  xi  List of Abbreviations and Acronyms 2D-PAGE  two-dimensional - PAGE  ABTS  2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)  AEC  anion-exchange chromatography  AIDS  acquired immunodeficiency syndrome  AG  arabinogalactan  AP  alkaline phosphatase  APC  antigen presenting cell  ATCC  American Type Culture Collection  AraLAM  arabinose-capped lipoarabinomannan  B cell  Bursa of Fabricius/bone-marrow lymphocyte  BCE  before common era  BCG  Bacille Calmette-Guérin  BMMΦ  bone marrow-derived macrophage  BSA  bovine serum albumin  C3b  complement component 3b  CCL  (C-C motif) chemokine ligand  CD  cluster of differentiation  CFG  Centre for Functional Glycomics  CFRI  Child & Family Research Institute  CFU  colony forming unit  CHAPS  3-[(3-Cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate  CMI  cell mediated immunity  Cpn60  60 kDa Chaperonin (molecular chaperone)  CR  complement receptor  DAPI  4',6-diamidino-2-phenylindole  DC  dendritic cell  DEAE  diethylaminoethyl  DnaK  70kD molecular chaperone  DOTS  Directly Observed Treatment, Short Course xii  EDTA  ethylenediaminetetraacetic acid  ELISA  enzyme-linked immunosorbent assay  FACS  fluorescence-activated cell sorter  Fc  IgG Fc domain  FcR  IgG Fc domain receptor  FCS  fetal calf serum  G-CSF  granulocyte - colony stimulating factor  Galgp  galactoglycoprotein  GFP  green fluorescent protein  GM-CSF  granuluocyte macrophage - colony stimulating factor  GroEL2  60kd Chaperonin protein (E.coli)  GST  glutathione-S-tranferase  HA  hemagglutinin  His  histidine  HIV  human immunodeficiency virus  HRP  horseradish peroxidase  iC3b  inactivated complement component 3b  ICAM  intercellular adhesion molecule  IFNγ  interferon gamma  Ig  immunoglobulin  IL  interleukin  INH  isonicotinyl hydrazine (isoniazid)  IP-10  interferon-inducible protein-10  IPTG  isopropyl β-D-1-thiogalactopyranoside  kD/kDa  kiloDalton  LAL  Limulus amoebocyte lysate  LC  liquid chromatography  LDL  low density lipoprotein  LFA  lymphocyte function-associated antigen  LM  lipomannan  LPS  lipopolysaccharide xiii  LRR  leucine-rich repeat  MΦ  macrophage  mAb  monoclonal antibody  MA  mycolic acid  ManLAM  mannose-capped lipoarabinomannan  MBL  mannose binding lectin  MCP-1  monocyte chemotactic protein-1  M-CSF  monocyte - colony stimulating factor  MDR  multi-drug resistant  MHC  major histocompatability complex  MIP-1  macrophage inflammatory protein-1  MOI  multiplicity of infection  MPI  mannosyl-phophatidylinositol  MR  mannose receptor  MS  mass spectrometry  NHS  N-hydroxyl succinimide  NIAID  National Institute of Allergy and Infectious Dieases  NIH  National Institutes of Health  OADC  oleic acid, albumin, dextrose complex  PAGE  polyacrylamide gel electrophoresis  PAMP  pathogen-associated molecular pattern  pBS  BlueScript plasmid  PB&T  Proskauer and Beck medium, supplemented with Tween 80  PBMC  peripheral blood mononuclear cell  PBS  phosphate-buffered saline  PCR  polymerase chain reaction  PILAM  phosphatidyl-inositol lipoarabinomannan  PIM  Phosphatidyl-inositol mannosides  PMN  polymorphonucleocyte  PPD  purified protein derivative  Pr-ase K  proteinase K xiv  PRR  pattern recognition receptor  RFU  relative fluorescence units  RIA  radioimmunoassay  SDS  sodium dodecyl sulfate  siRNA  short interfering RNA  SEM  standard error of the mean  SNP  single nucleotide polymorphism  SP  surfactant protein  SPR  surface plasmon resonance  SR  scavenger receptor  Tat  twin arginine translocation  TB  Tuberculosis  T cell  thymus lymphocytic cell  TCR  T cell receptor  TDM  trehalose dimycolate  TEM  transmission electron microscopy  TGFβ  transforming growth factor β  TH  T helper lymphocyte  TIR  Toll/IL-1 receptor  TLR  toll-like receptor  TMC  Trudeau mycobacterial collection  TNFα  tumour necrosis factor alpha  UBC  University of British Columbia  UV  ultraviolet light  v/v  volume per volume  w/v  weight per volume  WAS  Wiscott-Aldrich Syndrome  WASp  Wiscott-Aldrich Syndrome protein  WGA  wheat germ agglutinin  WHO  World Health Organization  XDR  extensively drug resistant xv  Acknowledgements  I offer my sincere gratitude to my primary supervisor, Dr. Richard Stokes, who recognized my potential to become a competent scientist based on limited lab experience. Dr. Stokes has taught me the value of paying attention to the details and understanding that most great discoveries begin with experiments exploring basic science. Additionally, aspects of the research for this thesis were aided through the use of recombinant tools provided by another lab as well as important preliminary studies that served as the basis for the direction of experiments chosen in this research description. The NSF60 cell line-derived CD43-Fc chimera used extensively in this work was created by former UBC MSc student Jeanne Yang and the tranfected cell line was graciously made available by her supervisor, Dr. Hermann Ziltener (UBC). Preliminary studies showing that some capsular proteins act as adhesins necessary for efficient macrophage binding were completed by former technicians Dan Doxsee and Lisa Thorson of the Stokes laboratory. I also thank my parents, Wendy and Peter, and my wife Christine for their ongoing support of my academic training, both morally and financially.  xvi  Dedication  This work is dedicated to my grandparents, Dr. Malcolm A. Hickey and Mary P. Hickey, who nurtured my interest in studying the natural world from a young age and passed to me their interest and experiences in the ongoing study of Tuberculosis.  xvii  Chapter 1: Introduction 1.1 Tuberculosis & Mycobacterium tuberculosis  “Tuberculosis stands as one of the most able lieutentants of the Grim Reaper” - Charles Atkinson (1922) [1] 1.1.1 Mycobacteria Tuberculosis (TB) is the chronic disease that results from an active infection of the bacterial pathogen Mycobacterium tuberculosis. M. tuberculosis is a non spore-forming, rodshaped, facultative anaerobic bacterium.  The Mycobacterial genus is part of the  Mycobacteriaceae family, which is turn is part of the Corynebacteriaceae sub-order, and the Actinomycetales order of Actinobacteria.  M. tuberculosis is naturally a human pathogen;  however it has the capacity to cause disease within other mammals. The mycobacteria are a notable branch of bacterial species in that they have a high G+C nucleotide content within their genome in addition to having a complex cell wall that is composed of a variety of mycobacterial-specific lipid-based compounds.  While the  mycobacteria are often classified outside of the standard Gram positive and Gram negative designations (due to their limited ability to hold Gram stains), they are more closely aligned with Gram positive bacteria as they only contain a single plasma membrane. The more common staining method for mycobacteria is termed Ziehl-Neelsen, and relies upon the inability to destain a primary treatment of carbolfuschin dye with an acid-alcohol wash, thus the term, ‘acidfast bacteria’ [2]. The genome of M. tuberculosis is contained on a single, circular chromosome that contains approximately 4 million base pairs, giving rise to 3959 annotated genes [3]. Other 1  notable pathogens related to M. tuberculosis include the primarily bovine pathogen (which can cause disease in humans) Mycobacterium bovis (99.9% genome similarity to M. tuberculosis [4]), and the causative agent of Leprosy, Mycobacterium leprae. M. bovis is notable for being the source species for the only widely used M. tuberculosis vaccine, Bacille Calmette-Guerin (BCG). M. leprae has the distinction of having the slowest doubling time of any mycobacterial species. This is attributed to its highly fragmented genome which has roughly 1200 fewer protein coding sequences than M. tuberculosis [5].  1.1.2 History of tuberculosis It is thought that TB has been associated with humans for at least as long as any other bacterial pathogen. This estimation is supported by the presence of tuberculous lesions within the bodies of prehistoric humans dating back to 8000 BCE and also within the spines (Pott’s Disease) of mummified bodies from Egyptian tombs, dating back between 2500-1000 BCE [6]. Through the 18th and 19th centuries, TB as a disease was romanticized and often associated with characters depicted in both plays and paintings. This is likely a byproduct of the fact that TB afflicted many well-known poets, writers, and musicians [7]. Commonly described in earlier times as ‘Consumption’, or ‘White Plague’, the observed symptoms of severe wasting, coughing bloody sputum, and general malaise were often trivialized in artistic depictions of those afflicted [8]. In fact, TB came to be associated with artistic genius and providing an ‘enlightening experience’ for those affected [7]. As little was known about the cause of the affliction, or how to treat it, many patients were bedridden during the course of the disease, receiving only palliative care through the latter stages of the disease prior to death. It is  2  estimated that the mortality of those who contracted TB was 50-60% in the pre-chemotherapy era [9]. Efforts to better understand TB as a disease were aided in the 1880s when the eminent Prussian scientist Robert Koch was successful in isolating the causative agent of the disease, the rod shaped bacterium later named M. tuberculosis for the inflammatory tubercles within the lung that it causes [7]. While the identification of a transmissible organism assuaged earlier beliefs that the disease was a result of one’s ‘poor constitution’ [1], Koch’s finding proved to be of limited short term utility as effective chemotherapeutics for treating the disease would not materialize until 65 years later [10]. Pre-chemotherapeutic efforts to limit the progression of, or to cure the disease, relied primarily upon changes to an individual’s nutrition and environment. One of the prominent therapies employed through the late 1800s and well into the 1900s were TB sanitorium institutions [1]. Sanitoria were often set in remote locations at high elevation based on the belief that the cool, dry air found in the mountains was a more hospitable environment for the patient than the polluted air of the cities. The sanitoria movement began in Germany in the late 1850s (for the wealthy), and later spread throughout Europe and North America in the early 20th century due to the encouraging results of the many patients who showed improvement from the experience [7].  While more esoteric treatments such as  heliotherapy (sunbathing) and high calorie meals were offered, part of the benefit of sanatoria likely stemmed from the adoption of more modern principles of hygienist urban design and protocols, and patient rest [7,11]. Additionally, resection of diseased (granulomatous) lung tissue was also completed for many individuals. However, for those who recovered, reduced lung capacity was a lifelong consequence.  3  1.1.3 Tuberculosis in the modern era (1950→) 1.1.3.1 Anti-tuberculous therapeutics and drug resistance The dawn of chemotherapeutic treatments for TB began in the late 1940s when the first clinical trials were conducted using streptomycin therapy against pulmonary infection with M. tuberculosis. The results were promising, although evidence that M. tuberculosis had the capacity to develop drug resistance was evident within the first few years of drug studies [12]. Drug resistance to M. tuberculosis is defined as the presence of resistance to at least one type of anti-tuberculous drug [13]. The means by which an individual develops a resistant infection occurs in one of two ways: Acquired resistance is that which arises within the host after initially habouring a drug susceptible M. tuberculosis strain. It is commonly due to poor adherence to a drug treatment regimen. Primary resistance is the presence of a drug resistant mycobacterial strain within an individual who has not received prior anti-tuberculous treatment. Hence, it is assumed that those with primary resistance were infected with a drug resistant strain at the outset. Regardless of how one acquires a drug resistant strain of M. tuberculosis, it is a dangerous situation. The most efficacious means of overcoming and preventing M. tuberculosis drug resistance is to have patients follow a complete regimen of treatment that includes 2-3 ‘front-line’ TB therapies. Front line drug treatments for TB have commonly included Isoniazid (INH), Rifampicin, Ethambutol and Pyrazinamide. However, the progression of M. tuberculosis towards resistance never ceases, and strains that are defined as having multi-drug resistance (MDR) have consistently developed over the years. The term MDR-TB is applied to strains that show resistance to at least two of the front line therapeutics, commonly Rifampicin & Isoniazid. Treatment for cases of MDR-TB is generally more costly, up to $250,000 per patient in the US, due to the longer duration of 4  treatment and attention to drug choices that need to be selected to effect an improvement in health [14]. To treat MDR-TB, it is more common for physicians to select drugs from within the ‘second line’ TB therapeutics that include aminoglycosides (e.g. amikacin, kanamycin), polypeptides, fluoroquinolones (e.g. ciprofloxacin, moxifloxacin), thioamides (e.g. ethionamide) and p-aminosalicylic acid (PAS) [10]. This broad range of potential therapeutics may lead one to believe that TB would have limited opportunity to develop resistance to all potential therapies. However, strains have emerged in recent years that show resistance to front line therapies (i.e. MDR-TB), as well as to various second line therapies. These latter strains, termed extensively drug resistant TB (XDR-TB), currently represent the greatest challenge for the public health system with regards to both treatment options and minimizing spread within a population. 1.1.3.2 Tuberculosis & human immunodeficiency virus The spread of human immunodeficiency virus (HIV) and the associated condition of acquired immunodeficiency syndrome (AIDS) has greatly exacerbated both progression of symptomatic TB disease within the host, as well as the spread of TB between individuals. Whereas a healthy individual carrying non-active TB has ≤1% annual risk of progressing to active infection, those with both HIV & non-active TB have a 5-10% annual risk of progression to active TB [15]. The lethal relationship between HIV/AIDS and TB primarily stems from the fact that HIV infection causes depletion of one of the most important cells involved in defense against TB, the CD4+ T lymphocyte.  Extending from this observation, many  immunomodulatory conditions (diseases or therapeutic strategies) that decrease the levels of CD4+ T lymphocytes, or the cytokines TNFα and IFNγ, have the potential to leave individuals at higher risk of developing progressive TB. 5  1.1.3.3 The World Health Organization and ‘DOTS’ The high increase in TB rates throughout the world in the 1990s provided the impetus to re-evaluate the strategies being employed to control the disease.  The World Health  Organization (WHO) recognized that while efficacious anti-tuberculous drugs existed, the spread of disease and ongoing development of drug-resistant strains were largely a byproduct of infected individuals not adhering to a consistent and complete drug regimen. To overcome this lack of patient compliance, the WHO developed and promoted the Directly Observed Treatment, Short-Course (DOTS) program. While the DOTS program includes a number of framework criteria, the basic goal of the program is to increase patient drug compliance through the daily monitoring and administration of a consistently available supply of anti-tuberculous medications [16].  By 2001, 155 countries had adopted the DOTS program, and it was found  that cure, or completion of treatment was attained for 82% of those treated under DOTS in that year [16]. 1.1.4 Global long-term solutions for tuberculosis While the HIV/AIDS epidemic and the spread of MDR- and XDR-TB have greatly heightened the morbidity and mortality resulting from TB, industrialization and urbanization have also contributed to the worldwide TB epidemic. Those afflicted with TB are generally the poor, forced to live in overcrowded environments with a lack of effective waste management and sanitation and are commonly malnourished [6]. Furthermore, challenges in accessing the public health system for monitoring and treatment make matters worse. Indeed, the case rate of those living in the lowest median income group is eight times higher than those living in the highest median income group [17]. Thus, continued improvement in healthcare access and  6  delivery for the lower socioeconomic populations are a key means of alleviating the harm caused by TB. Additionally, continued research and development of new anti-tuberculous therapies is necessary. It is apparent that this pathogen will develop resistance to nearly every drug over time, thus, a consistent pipeline of new anti-tuberculous compounds will offer treatment providers new tools to control these bacteria. Ideally, a broad range of drug options would allow physicians to cycle through therapies over a broad timeline, perhaps allowing the pathogen’s ability to resist certain medications to ‘lapse’ after a certain period of time. Lastly, the development of an effective TB vaccine would be an incredible development for the worldwide community. The currently available BCG vaccine (an attenuated strain of M. bovis) provides some protection against the severity of childhood TB (i.e. reduced incidence of meningitis and miliary spread) [18], and perhaps against childhood infection in general [19]. However, the effectiveness of the vaccine during adulthood seems unreliable, providing protection for some individuals [20], but appearing to lose efficacy beyond 10 years [21]. In addition, BCG vaccination precludes the use of the cost-effective and widely available Mantoux, or purified protein derivative (PPD), skin test to monitor TB prevalence within a population. This is because BCG and M. tuberculosis are so closely related that the PPD test cannot distinguish them. Newer, more expensive monitoring systems such as the Quantiferon Gold assay (which detects antigens present in M. tuberculosis, but not BCG) may overcome this issue. However, the development of a more reliably protective vaccine, that is efficacious for youths and adults alike, would provide a better means of providing prophylactic protection to all people.  7  1.2 Host infection, spread, and general immune response to M. tuberculosis infection Is it estimated that humans can become infected with M. tuberculosis after inhaling between 5-200 airborne bacilli. It is understood that ‘droplet nuclei’ containing viable bacteria are expelled via the coughing of an individual with productive infection. To remain airborne and be inhaled deep into the alveolar spaces of a naïve individual, each droplet nuclei must contain only 1-3 bacilli [22]. With increased size, droplets are more apt to fall to the ground, or only reach the naïve host’s bronchial tree, whereby the offending pathogen is moved back to the pharynx and eventually (harmlessly) swallowed [22]. When several small droplet nuclei access the inner spaces (alveoli) of the lung, the deposited bacilli encounter tiny chambers that are composed of pneumocyte epithelium and the lung’s primary sentinel cell, the alveolar macrophage (MΦ). If the bacilli are ingested by the alveolar MΦ, they will eventually follow one of two courses; either be killed and digested, or eventually replicate to increased numbers within the non-activated cell. This first interaction with the host is termed ‘Stage 1’ of infection. Progression to Stage 2 involves bacillary multiplication within the non-activated cell, eventually causing cell lysis and spread to neighbouring MΦ, many of which arrive from the bloodstream as monocytes and differentiate into MΦ at the site of inflammation. Inability of the MΦ to restrict bacterial growth results in the formation of a predominantly MΦ-filled lesion, termed a tubercle.  Stage 3 of pulmonary tuberculosis is characterized by a cellular infiltrate of  monocytes, lymphocytes and neutrophils. The bacilli are walled off by the influx of new cells, becoming retained within a mixture of necrotic caseous material at the center of the consolidation. The collective input of various immune response components, and increasingly hypoxic environment of cellular debris leads to a reduction in bacterial growth. However, the vigorous cellular immune responses that are stimulated by mycobacterial antigens cause chronic 8  inflammation, leading to local tissue damage around the site of infection. The lesion continues to evolve, developing a solid caseous center (possibly containing both replicating and nonreplicating bacilli [23]). The lesion is surrounded by a mixture of non-activated and partially activated MΦ, termed epitheloid cells, as well the so-called foamy MΦ which are named for their lipid-rich vaculoes. At Stage 4 the infection would normally become clinically apparent and progressive infection or containment relies upon whether or not functional cell mediated immunity (CMI) is established. Poor CMI allows for the spread of bacilli away from the caseous center of the lesion, with seeding at new tissue sites, allowing the inflammatory damage to spread. Effective CMI leads to establishment of an enclosing ring of activated MΦ and M. tuberculosis-specific lymphocytes around the contained bacilli. Thus, although the encased bacilli may not be killed, they are contained from further spread. This organized arrangement of cell layers around the necrotic center is termed a granuloma (see Figure 1). Without organized granuloma development, pulmonary TB can progress to Stage 5, whereby the caseous center (containing viable bacteria) liquefies and bacterial growth becomes unrestricted, reaching high concentrations within these lung lesions. The high levels of mycobacterial antigens released during this phase trigger progressively damaging delayed-type hypersensitivity (DTH) responses, eventually eroding the lining of the bronchial walls and allowing the liquefied material (containing many bacteria) to access the bronchial lumen. Coughing by the host is well established due to the ongoing bronchial aggravation, and M. tuberculosis bacilli are expelled into the local environment during this phase, causing spread to new individuals.  9  Figure 1: Host infection and pathological progression of TB This diagram provides an illustration of the common events during TB disease. First, M. tuberculosis bacilli are normally taken into the host via inhalation into the deep alveolar spaces of the lungs (1). The alveolar MΦ binds and phagocytoses the bacilli. If adequate MΦ activation does not occur, the bacilli persist within MΦ while an influx of other immune cells chemotax to the infected site. This aggregation of cells, which eventually includes T-cells, foamy giant cells, and infected MΦ makes up the primary lesion, or granuloma (2). Ongoing immunopathology results in a central necrotic lesion that is initially caseous. If the bacteria are not adequately killed and/or contained within the granuloma, these persisting bacteria can move to newly infected sites within the lungs (3a) or associated lymph nodes (3b). Progressive disease can eventually erode the lining of the lung airway; allowing infectious liquefied material from cavitated lesions to exit the host via aerosolization (4). (Image used with permission - Stewart et al, Nature Reviews (2003), [24])  10  1.3 Overview of the cellular immune response to M. tuberculosis infection The immunological response to an infection with M. tuberculosis is a complex process that involves a series of stimuli and subsequent responses from a variety of cells that initially represent the innate arm of host immunity and subsequently represent the adaptive arm of host immunity. Within the adaptive immune response, it is recognized that CMI is more protective to the host than a humoral immune response [25]. Furthermore, the cytokine profile associated with a TH1 CMI response is more effective in controlling M. tuberculosis infection than is a TH2 response. The primary cells understood to be involved in this process are briefly reviewed here.  1.3.1 T-lymphocyte responses 1.3.1.1 CD4+ T cells The CD4+/αβ/TCR+ T lymphocyte cell (CD4+ T cell) is considered to be the most vital cell population for an ongoing protective host response to M. tuberculosis infection. In mice lacking CD4+ T cells, the initial (innate) response to infection proceeds comparatively normally, but the importance of CD4+ T cells in the formation and maintenance of the protective granuloma is obvious [26]. In humans, the importance of CD4+ T cells in controlling TB infection is demonstrated by the high rates of TB in those populations co-infected with HIV [27]. The high capacity of CD4+ T cells to secrete an array of immunomodulatory cytokines is important for directing the involvement of other immune cells.  Upon receiving  proinflammatory signals (e.g. IL-12, TNFα) from M. tuberculosis-stimulated MΦ, CD4+ T cells secrete the TH1-associated cytokines IFNγ and TNFα into the local environment of the infection. While IFNγ is vital for the stimulation of bactericidal mechanisms within the MΦ (e.g. production of reactive oxygen and nitrogen intermediates), TNFα seems to have a role in the 11  formation and maintenance of the bacteria-sequestering granuloma as well as direct roles on MΦ with respect to anti-mycobacterial apoptosis events [28,29]. Indeed, individuals receiving anti-TNFα treatments are more susceptible to the development of active TB disease [30]. Working to oppose CD4+ T cell proliferation and function are the cytokines IL-6, IL-10 and TGFβ and it appears that M. tuberculosis-stimulated MΦ secrete varying quantities of these molecules that act to limit the T cell responsiveness [31,32,33,34]. 1.3.1.2 CD8+ T cells For many years the role of CD8+/αβ/TCR+ T lymphocyte cells (CD8 T cells) was not appreciated because it was assumed that the confinement of M. tuberculosis bacilli within MΦ endosomal compartments would restrict the ability of mycobacterial antigens to be presented via the CD8+ T cell-specific MHC class I pathway [35]. However, it was recognized that mice deficient in the capacity to present antigens via MHC class I were very susceptible to M. tuberculosis infection, suggesting a relevant role for CD8+ T cells [36]. It has more recently been found that CD8+ T cells, like their CD4+ counterparts, migrate to the site of mycobacterial infection where they are effective producers of MΦ-activating IFNγ and also have the capacity to promote killing of infected MΦ [37,38]. Assuming that M. tuberculosis does not readily exit the phagosomal compartment in host MΦ, cross-presentation machinery is likely engaged to sort mycobacterial antigens to the MHC class I pathway, however employment of an ‘alternate MHC class I pathway’ and secretion of antigenic material from M. tuberculosis also appear to be involved [39,40]. The so-called ‘nonclassically CD1+/αβ/TCR+ restricted T cells’ are important for receiving CD1-presented antigens from antigen-presenting cells. CD1 is distinct from the MHC molecules as it has an altered binding site that allows it to present polar hydrophobic antigens to 12  T cells, including lipids and glycolipids [41]. With respect to M. tuberculosis antigens, CD1 has been associated with the presentation of both mycolic acids and phosphatidyl-inositol mannosides (PIM) [42]. CD1-restricted T cells are able to secrete IFNγ and are cytotoxic towards M. tuberculosis infected MΦ [42]. 1.3.1.3 γδ T cells The γδ/TCR+ T lymphocyte cells (γδ T cells) are characterized by their unique TCR. While it is recognized that γδ T cells have the capacity to recognize M. tuberculosis infected MΦ, leading to IFNγ secretion and MΦ lysis, the exact mechanism by which the γδ TCR interacts with the MΦ is not understood (MHC molecules do not appear to be involved) [43,44,45]. The γδ T cells recognize small phosphate containing antigens that are thought to be sourced from non-secreted nuclear/cytosolic locations within M. tuberculosis [45]. Hence, the means by which these phospho-molecules are presented to the γδ TCR has not been elucidated.  1.3.2 Professional phagocytes 1.3.2.1 Neutrophils Neutrophils, also known as polymorphonucleocytes (PMN), are rapid responders to sites of infection, often the first type of innate cell found in higher densities [46]. Their role in providing an initial assault against M. tuberculosis has been demonstrated in both lab and clinical settings [47,48,49].  Neutrophils are endowed with a variety of tools to combat  microbes. As professional phagocytes, neutrophils are able to bind and phagocytose foreign particles through both opsonic and non-opsonic means [46]. This results in triggering a strong respiratory burst that produces reactive oxygen intermediates, such as hydrogen peroxide, that 13  are toxic to microbes. Myeloperoxidase, found in the neutrophil azurophilic granules, can convert hydrogen peroxide to the highly toxic hypochlorous acid [50]. Once engulfed, foreign particles are normally trafficked to lysosomal compartments for degradation. Aiding in the degradation process are specialized cytoplasmic granules that release antimicrobial compounds into the lysosomal compartment which include α-defensins, proteases, iron and siderophorebinding compounds (e.g. lactoferrin and lipocalin, respectively) [51,52]. In addition to these intracellular functions, neutrophils also play a role in orchestrating the local immune response where they secrete both chemokines (e.g. IP-10, MCP-1, MIP-1α/β, IL-8) and other proinflammatory cytokines (e.g. IFNγ, TNFα) to enhance the recruitment and activation of other immune cells [46]. The absence of a specific neutrophil knock-out animal model has made it challenging to understand the exact contributions of neutrophils to M. tuberculosis infections.  Instead,  antibody-mediated neutrophil depletion studies have served as the primary means of evaluation. However, the lack of specificity of antibodies used for some studies has been problematic [46]. Regardless, the results of these studies have provided conflicting lines of evidence about the role of neutrophils during the course of TB. Multiple studies have found that neutrophils are important for the initial containment and killing of M. tuberculosis [53,54]. One interesting study has found that apoptotic neutrophils can be phagocytosed by M. tuberculosis-containing MΦ, resulting in the trafficking of neutrophil granules to M. tuberculosis-containing compartments whereby neutrophil-derived defensins enhance bacterial killing [55]. Neutrophils also seem to contribute to the formation of the protective granuloma [56]. However, other studies have found that neutrophils do not significantly contribute to host protection after M. tuberculosis challenge, and actually cause increased local tissue damage instead [57,58]. This 14  may be especially true during the chronic stage of infection when neutrophils continue to traffic to the site of infection in humans, yet do not contribute to bacterial killing [46]. Overall, it seems likely that neutrophils can be helpful during the initial phase of infection, but have a lesser, or even damaging role during the chronic stage of infection. 1.3.2.2 Dendritic cells Dendritic cells (DC) are a type of phagocytic cell that reside near areas of the body that have a higher chance of encountering pathogens (e.g. mucosal surfaces of the gut, skin, lungs). While they exist in comparably smaller numbers than MΦ, they have a greater capacity for antigen presentation due to the higher levels of MHC class II and co-stimulatory proteins (e.g. CD40, CD80. CD86) on their surface [59]. While residing in the peripheral spaces, DC exist in an immature state whereby they have high phagocytic ability, but low antigen presentation capacity [60]. Once DC become stimulated by phagocytosing M. tuberculosis bacilli or soluble antigens, they migrate to local draining lymph nodes where they ‘mature’, resulting in an enhanced ability to present antigens to T cells [61]. DC carrying M. tuberculosis are able to elicit proinflammatory cytokines such as IL-12, IL-6 and TNFα, but also produce antiinflammatory IL-10 [62]. Thus, DC have the capacity to provide a balanced cytokine release. Another balance that DC seem to maintain is the ability to limit intracellular M. tuberculosis growth without effective killing, even after IFNγ activation [63]. While this situation may allow the bacteria to survive within this cellular niche, there is some benefit to the host as an ongoing supply of antigenic material is made available to the DC for T cell presentation [59].  M.  tuberculosis appears to have the ability to alter the normal differentiation of monocytes into DC. While monocytes can normally be differentiated into immature DC via GM-CSF and IL-4 exposure, M. tuberculosis-infected monocytes receiving this treatment differentiate into a 15  variant DC that lacks CD1 expression [64]. This CD1 negative DC is unable to elicit an IFNγ and IL- 4 response from T cells [64]. Thus, while immature DC have the ability to effectively present mycobacterial antigens to T cells, it seems likely that M. tuberculosis also employ DC as one means of immune evasion.  1.3.2.3 Macrophages By most accounts, the alveolar MΦ is the most important phagocytic cell that is involved in the host control of M. tuberculosis. If the bacteria spread from the lungs, other tissue MΦ may come into play such as the Kupffer cell (hepatic MΦ), splenic MΦ, peritoneal MΦ, or microglia (central nervous system MΦ). MΦ are able to bind M. tuberculosis via both opsonic and non-opsonic means, whereby an apparent variety of receptors can be employed to bind and phagocytose these bacteria. Once phagocytosed, MΦ begin processing the M. tuberculosiscontaining phagosome through the phago-lysosome pathway.  However, in the absence of  stimulatory IFNγ, viable M. tuberculosis bacilli can limit this intracellular progression of events. Not only can these bacteria avoid lysosomal exposure, they can also alter other processes within the MΦ, including cytokine secretion, MHC antigen loading, expression of reactive oxygen and nitrogen intermediates, and cell death pathways [65]. While many of these effects result from mycobacterial stimuli within the phagosomal compartment, some of these effects are elicited through the initial interactions of mycobacterial ligands with MΦ receptors. The primary ligandreceptor interactions employed during M. tuberculosis association with the MΦ are briefly reviewed here:  16  1.4 Macrophage interactions with M. tuberculosis 1.4.1 Complement receptors The complement receptors (CR) compose a set of four phagocytic integrins that play an important role in the binding, phagocytosis and signaling associated with the detection of microbial species. Of the four identified complement receptors, CR1, CR3 and CR4 have been implicated in the recognition and uptake of M. tuberculosis bacilli. While CR1 (CD35) is a monovalent transmembrane protein, CR3 and CR4 are heterodimeric receptors that both employ a common β-chain (CD18) and distinct α-chains (CD11b and CD11c, respectively). While each of these CR can bind M. tuberculosis via the deposition of serum opsonins on the bacterial surface (CR1 recognizes C3b and C4b, while CR3 and CR4 primarily recognize iC3b), CR3 and CR4 have the additional capacity of binding M. tuberculosis non-opsonically [66,67,68,69]. As the natural site of infection for M. tuberculosis is the alveolus of the lung, where serum opsonins are less common, non-opsonic binding of the bacteria via CR3 and CR4 would appear to be the more relevant interactions with respect to disease [70]. When expressed, CR3 appears to be the most important CR with respect to bacterial binding, as the absence of CR3 reduces non-opsonic binding by up to 50% [71]. However, murine alveolar MΦ do not efficiently express CR3 on their surface, suggesting that this receptor may have limited in vivo function during primary infection [72]. The mycobacterial ligands that have been reported to interact with CR3 in nonopsonic (direct) binding include Antigen 85c and the α-glucan present on the mycobacterial surface [73,74,75]. While earlier reports suggested that mycobacterial entry via CR3 fails to activate an oxidative burst, and thus allows M. tuberculosis to access the MΦ in a ‘stealth’ capacity [68,76], latter studies with MΦ from CR3-/- mice have provided evidence that while the  17  absence of CR3 reduces bacterial uptake, there is little difference in the intracellular growth rate, survival, and generation of reactive oxygen & nitrogen intermediates [71,77]. 1.4.2 Collectins Surfactant Proteins (SP) A & D and mannose binding lectin (MBL) are part of the ‘collectin’ protein family. Collectins are large oligomeric secreted glycoproteins that contain Ctype lectin domains and collagenous properties. SP-A and MBL commonly form groups of four subunits, while SP-D oligomerizes into clusters of six subunits [78]. Oligomerization of the collectins is thought to be necessary because the affinity of single binding sites is comparatively weak compared to the multimeric forms [79]. The collectins reside in the surfactant fluid of the alveolus, where their primary role is to bind microorganisms entering the lung, leading to enhanced agglutination and uptake of these foreign particles by pulmonary phagocytes [78]. The epitopes bound by collectins are neutral sugars or lipids that are arranged in patterns unique to microbial species, thus avoiding binding to ‘self’ sugars [80]. With respect to mycobacteria, it has been demonstrated that both SP-A and SP-D can bind to M. tuberculosis, where SP-A increases MΦ uptake, and SP-D decreases MΦ uptake [81,82]. It seems apparent that SP have potent receptor regulatory properties on MΦ as they have been shown to alter the expression/function of toll-like receptors (TLR) [83], CR3 [84], and most predominantly, upregulation of mannose receptor (MR) [85]. It has been proposed that SP-A binds to a 210kDa receptor on MΦ to mediate binding between the pathogen and the phagocyte [86], and the immunomodulatory effects of collectins are attributed to both CD14dependent and independent pathways [87,88,89,90,91]  18  1.4.3 Scavenger receptors The scavenger receptors (SR) are comprised of three classes (A,B,C) of surface receptors that serve to bind and facilitate the ingestion of large polyanionic macromolecules and particles, including host low density lipoproteins (LDLs). In this regard, they ‘scavenge’ host debris and effect its removal via phagocytic digestion. However, it was subsequently shown that MΦ SRA can bind lipopolysaccharide (LPS) from Gram negative bacterial species as well as lipotechoic acid from Gram positive species [92,93]. Later studies indicated that SR-A can also mediate mycobacterial binding, with sulfolipids suspected to be the relevant mycobacterial ligand [94,95].  1.4.4 Mannose receptor The mannose receptor (MR, CD207) is a C-type lectin that has been shown to have a role in the phagocytosis of M. tuberculosis, where it is associated with an anti-inflammatory signaling response [96,97]. While MR is expressed in abundance on alveolar MΦ, monocytederived MΦ and immature DC, it is not expressed on monocytes [98,99]. The mycobacterial ligands that naturally interact with MR have been difficult to identify with certainty.  A  commonly cited mycobacterial product that has the capacity to interact with MR is mannosecapped lipoarabinomannan (ManLAM).  Purified ManLAM interacts with MR to elicit a  downregulation of IL-12 and also has downstream effects of limiting phagosome-lysosome fusion after internalization of M. tuberculosis bacilli [100]. However, definitive proof that ManLAM is accessible on the surface of the M. tuberculosis bacillus has not been forthcoming. In addition, LAM coated spheres have commonly been employed as a surrogate for whole bacteria [100,101,102] and whether this truly represents the bacteria is questionable. Some 19  efforts to identify LAM on the bacterial surface have shown it is predominantly localized to the interior aspect of the cell wall [2], and when it has been detected on the surface of M. tuberculosis, the anti-LAM antibodies employed have shown cross-reactivity with other mannosylated compounds within the cell wall [103,104]. More recent work by Appelmelk et al (2008) has shown that BCG mutants that lack mannosyl-capping of LAM do not demonstrate a significant reduction of binding to human DC [105]. It was reasoned that these BCG mutants did not show reduced binding because alternate mannosylated residues (e.g. mycobacterial lipoglycans and glycoproteins) were mediating the mannose-dependent binding [105].  1.4.5 Dectin-1 Dectin-1 is a type II C-type mammalian lectin that is expressed on monocytes, MΦ, neutrophils, DC, and Langerhans cells [106]. Dectin-1 was first identified as a MΦ receptor for β-glucan structures based on its ability to bind the β-glucan-rich yeast particle, zymosan [107]. This finding suggested that Dectin-1, not CR3, was the primary receptor involved with β-glucan binding [108]. Binding of M. tuberculosis to Dectin-1 has been implicated in the release of TNF-α, CCL5, IL-6, IL-12 and G-CSF from phagocytes [106,109]. However, it is not clear how Dectin-1 binds M. tuberculosis due the absence of β-glucan residues in the cell wall. Intriguingly, while there is evidence that Dectin-1 works in concert with TLR2 to promote TNFα release [106], it has also been found that Dectin-1 has a functional association with both TLR2 and TLR4 when stimulated with C. alibicans [110].  20  1.4.6 Toll-like receptors The toll-like receptors (TLR) constitute a group of at least 11 members that have a role in the detection and signaling response towards (generally) microbial antigens. In this regard, the TLR typify the so-called pattern recognition receptors (PRR) of host cells that function through the ligation of conserved microbial motifs, often referred to as pathogen associated molecular patterns (PAMP). Structurally, the TLR are defined as type I transmembrane proteins that contain an extracellular region with 19-25 copies of leucine-rich repeats (LRR) in addition to an intracellular Toll/IL-1 receptor (TIR) domain that is capable of cytoplasmic signaling [111]. To respond to a broad range of potential pathogenic compounds, the TLR show a degree of promiscuity towards the PAMP they can identify, and identification of multiple mycobacterial moieties has been conducted. The most relevant TLR for cell surface detection of mycobacterial products seem to be TLR2 and TLR4, with an absence of evidence to suggest the involvement of other TLR [112].  While TLR2 function requires the formation of a  heterodimer with either TLR1 or TLR6, TLR4 forms a homodimer and can also interact with the accessory proteins CD14 and MD2. Additionally, TLR2 has been implicated in the function of Dectin-1 [106]. Of these two relevant TLR, TLR2 has been shown to have the greater capacity to bind a variety of mycobacterial moieties, with reports of signaling in response to phosphatidyl-inositol LAM (PILAM), lipomannan (LM), PIM, and the 19kD mycobacterial lipoprotein [113,114,115,116,117]. Additionally, ManLAM appears to activate TLR2 via CD14 ligation [118]. While CD14/TLR4 is well described as an LPS receptor with regards to Gram negative bacterial species, the mycobacteria lack LPS. Instead, CD14/TLR4 has been implicated as the 21  receptor for the mycobacterial molecular chaperones Cpn60.2 (Hsp65, GroEL) and DnaK (Hsp70) [119]. However, studies that have employed more thorough methods to exclude the presence of contaminating LPS have shown Cpn60.2 signaling in a PBMC model is CD14independent [120] although Cpn60.2 signaling in endothelial cells is MD2-dependent [121]. These results suggest that if Cpn60.2 does interact with TLR4, it does so in a manner distinct from LPS. Lending support to the suggestion that Cpn60.2 does not signal through TLR4, it has been shown that GroEL stimulation of bone resorption was not altered in the C3H/HeJ mouse, which contains a non-functional TLR4 receptor. This illustrates that TLR4 is not involved in some types of host cell stimulation by this molecular chaperone [122]. Most of the studies investigating this relationship have taken measures to exclude the presence of contaminating LPS in the protein preparations, but concerns about this compromising issue persist [123]. The relevance of TLR to the host’s ability to control a TB infection is unclear [112]. Experimental infections in the mouse model have shown a protective role for TLR2 [124] and TLR4 [125,126]. However, other studies have shown TLR2 and TLR4 to be dispensable for murine control of M. tuberculosis infection [127,128,129,130]. Moreover, CD14 does not appear to play a role in host protection against TB [127]. However, recent studies assessing SNPs in TLR genes within human populations have supported a role for TLR function with regards to susceptibility to TB [131,132].  1.4.7 Fc receptor The Fc Receptor (FcR) is the cognate receptor for binding the Fc-domain of immunoglobulin (Ig) proteins that have bound onto specific sites of foreign particles in the host, commonly microbial pathogens. Ig binding to microbes is one of the host’s primary methods of 22  opsonizing unwanted organisms and directing their uptake into phagocytic cells for degradation. However, the role of antibodies during TB infection has received comparatively little attention as these bacteria primarily reside within host cells. Supporting this view, B cell deficient mice showed no defects in their host response to a M. tuberculosis infection [25]. However, another study has shown that adoptively transferred B cells to B cell-deficient mice confers protectiveness against M. tuberculosis infection [133].  Moreover, although the in vivo  mechanisms have not been clearly delineated, the FcR appears to have a role in promoting an effective immune response after M. tuberculosis challenge, as demonstrated in FcγR deleted mice [134].  1.4.8 CD43 CD43 (leukosialin, sialophorin, gpL115) is one of the more recently proposed MΦ receptors that interacts with M. tuberculosis [135,136], and it will be discussed in detail in the following section.  1.5 CD43 1.5.1 CD43 structure & expression CD43 is a sialoglycoprotein that is primarily expressed on the surface of cells from the hematopoietic lineage [137], including murine bone-marrow derived macrophages (BMMΦ) [138]. While hematopoietic cells express CD43 to varying degrees, it has not been found on mature B cells or erythrocytes, but has been found on the surface of adenocarcinoma cells [139,140].  Sometimes termed a sialomucin, CD43 is characterized by the presence of many  mucin-type O-linked glycans along the length of its extracellular domain (70-90 23  oligosaccharides) in addition to having terminal sialic acid residues [139,141].  O-linkage  glycosylation of glycoproteins is conferred by the covalent bonding between Nacetylgalactosamine and serine or threonine residues of the polypeptide backbone. The fact that more than 40% of the extracellular domain of CD43 is composed of serine and threonine residues allows CD43 to receive extensive O-linked glycosylation, resulting in an overall weight composition of 60% carbohydrate and 40% protein [139,141]. There are also 1-2 sites on the extracellular domain of CD43 that may allow for N-linked glycosylation (N-linked glycosylation involves N-acetylglucosamine bonding to asparagine) [137,141], and it has been found that CD43 can be sulfated [142]. CD43 is a comparatively large glycoprotein (115-135 kDa) that naturally exists as a type 1 transmembranous monomer.  Based on cellular  localization, CD43 can be divided into a cytoplasmic domain (123 aa in humans, 124 aa in mice), a transmembrane domain (22 aa) and a large extracellular domain (234 aa in humans, 228 aa in mice). The many polypeptides in the extracellular domain, coupled with the presence of sialic acid residues at the termini of the O-linked oligosaccharides, create a diffuse negative charge along the length of the extracellular domain of CD43. These qualities are thought to result in the rigid, rod-like structure that extends 45 nm out from the cell surface when analyzed by rotary shadowing electron microscopy [143]. On T cells, CD43 has the longest projection among the various surface glycoproteins [143]. The locus for the CD43 gene in humans is found on chromosome 16, located near the loci for the α-subunits of LFA (CD11a), CR3 (CD11b) and CR4 (CD11c), suggesting some functional significance of CD43 as an adhesion molecule [139,144]. In mice, the gene for CD43 is located on chromosome 7 [145]. The presence of CD43 on the cell surface can be altered by various mechanisms. Evidence shows that CD43 can be released or ‘shed’ from the cell surface and can subsequently 24  be found in the blood plasma in a form known as galactoglycoprotein (Galgp) [146,147]. The release of the extracellular domain of CD43 is mediated by proteolytic cleavage events [148,149,150]. Alternatively, CD43 ‘capping’ has been observed during T cell interaction with antigen presenting cells (APC), where membrane bound CD43 becomes sequestered to a localized region, providing ‘CD43 free’ areas for cell to cell contact [151,152]. Furthermore, it has been shown on DC that CD43 crosslinking causes a receptor-mediated endocytosis event whereby CD43 becomes internalized within endosomes and vacuoles [153].  Intracellular  trafficking of CD43 is thought to result from the interaction of the CD43 cytoplasmic tail with ezrin, radixin and moesin, the so called ‘ERM’ proteins that link type I transmembrane proteins to the actin cytoskeleton [154,155]. It is well described that the O-linked oligosaccharides of CD43 can exist in two different complexities, or glycoforms [156]. The smaller of these glycoforms is of a tetrasaccharide structure  (NeuAc(α2-3)Gal(β1-3)[NeuAc(α2-6)]GalNAc),  and  is  the  predominant  oligosaccharide associated with CD43 on resting T-cells and erythroid precursor cells [156]. Upon T-cell activation (e.g. ligation with IL-2 or anti-CD3 antibodies), there is upregulation of a glycosyltransferase enzyme called Core 2-β-1,6-N-acetylglucosaminyl transferase (C2GnT) [157].  C2GnT functions to expand the tetrameric oligosaccharides of CD43 to larger  hexasaccharide  structures  (NeuAc(α2-3)Gal(β1-3)[NeuAc(α2-3)Gal(β1-4)GlcNAc(β-  6)]GalNAc) that are associated with the surface of activated T cells, neutrophils and platelets [156,158].  CD43 composed predominantly of tetrasaccharides has a molecular weight of  approximately 115kDa, while the presence of primarily hexasaccharide residues increases the weight to approximately 135kDa [157].  Myeloid cells, including MΦ, maintain a more  25  heterogeneous mixture of tetra- and hexasaccharide glycoforms, leading to a CD43 molecular weight between 115-135 kDa [159,160].  1.5.2 Roles of CD43 in the host CD43 has been associated with a variety of functional roles in the host, with cell type and glycosylation state being important determinants in the many described functions of the glycoprotein. The primary functions of CD43 in the host appear to include modulation of cell to cell interactions, with both anti-adhesive and pro-adhesive roles described, as well as an association with intracellular signaling events; including cell activation and apoptotic pathways.  1.5.2.1 Anti-adhesive roles In the absence of specific ligands for binding CD43, the basic structural characteristics of the glycoprotein (extended bulky structure with large negative charge) would suggest that CD43 hinders, or even repels, intercellular interactions. Experiments to test this hypothesis have provided support for an anti-adhesive role of CD43. In mice that were engineered to overexpress O-linked glycans, it was found that interactions between T-cells and APCs became less efficient, and the T-cells from these mice showed reduced interactions with both ICAM-1 and fibronectin, compared to control cells [161]. Conversely, T cells from CD43-/- mice were shown to have increased levels of interaction with both ICAM-1, fibronectin, and HIV gp120, resulting in enhanced cytotoxic T cell responsiveness [162,163]. Furthermore, CD43-/- lymphocytes showed increased levels of trafficking in the host, including more effective ‘tether, roll and stick’ activity on endothelium which was attributed to decreased steric hindrance of L-selectin on the T cell surface [164]. 26  1.5.2.2 Pro-adhesive roles While the anti-adhesive nature of CD43 relies upon the non-specific traits of molecular size and charge, multiple ligands have been described that bind directly to the extracellular domain of CD43 in a specific manner. While confirmation of the in vivo importance of these ligands has not always been forthcoming, various studies have shown direct CD43 binding by ICAM-1 [165], complement factor C1q [166], E-selectin [167], Galectin-1 [168], MHC class I [169], and sialoadhesin (Siglec-1) [170]. Additionally, endothelial binding by T cells and monocytes can be inhibited with anti-CD43 antibodies [171,172]. The varying lines of evidence on the role of CD43 and intercellular interactions suggest that this glycoprotein can play divergent roles in different situations and environments in the host.  1.5.2.3 CD43 and cell activation Antibody ligation of CD43 has been shown to induce the activation of several types of leukocytes, including T cells, myeloid cells and neutrophils. While ligation of lymphocyte CR3 stimulates the secretion of several cytokines, antibody co-stimulation of CD43 results in significantly higher levels of cytokine release [173]. In natural killer (NK) T cells, engagement of CD43 increases the secretion of chemokines and NK cell cytotoxicity via a tyrosine kinase pathway [174]. Antibody ligation of CD43 on peripheral blood mononuclear cells (PBMC) acts synergistically with the mitogen phorbol 12-myristate 13-acetate (PMA) to stimulate monocyte cellular proliferation [175]. This latter study also found that CD43 and CR3 co-precipiated under a mild detergent extraction, suggesting cellular colocalization of CR3 and CD43. A separate study showed that antibody ligation of CD43 in PBMCs, monocytes and T cells elicits 27  a CD3-independent upregulation of intracellular Ca+2 levels that occurs concurrently with protein kinase C translocation from the cytosol to the cell membrane [176]. Lastly, antibody ligation of CD43 in neutrophils stimulates the formation of an oxidative burst and increased homotypic adhesion [177].  1.5.2.4 CD43 and apoptosis One of the primary intracellular events associated with CD43 is the cascade of molecular interactions that cause programmed cell death, or apoptosis. Interestingly, CD43 has been associated with both pro-apoptotic as well as anti-apoptotic functions, apparently dependent on the cell type and level of CD43 expression. In a T-lymphoblastoid cell line it was found that antibody ligation of CD43 resulted in a higher induction of Fas-mediated apoptosis [178], and antibody ligation of CD43 in both  myeloid- and hematopoietic-progenitor cell lines also  initiates apoptosis [179,180,181]. Interestingly, increased levels of CD43 on T cells confers protectiveness against Fas-mediated apoptosis, suggested to be due to CD43-mediated steric hindrance of FasL interaction with the cell surface [182]. Lastly, Randhawa et al (2008) found that CD43-/- MΦ that had phagocytosed M. tuberculosis showed greater levels of necrosis (versus apoptosis) than their CD43+/+ counterparts, further suggesting that CD43 plays an important role in mediating apoptosis [29]. Additionally, the decreased apoptosis observed in these M. tuberculosis experiments was attributed to a reduction in TNFα secretion by the MΦ, leading to speculation that CD43 is involved in the TNFα-mediated apoptosis pathway(s) that have been described previously for M. tuberculosis-infected MΦ [183,184].  28  1.5.3 CD43 and disease 1.5.3.1 Wiscott-Aldrich syndrome Wiscott-Aldrich Syndrome (WAS) is a rare X-linked recessive disorder that is characterized by developmental defects of platelets, lymphocytes and other hematopoietic cells [185,186].  Clinical  manifestations  of  the  disease  present  as  immunodeficiency,  thrombocytopenia, eczema and susceptibility to malignancies [186]. The mutated gene in WAS codes for a namesake protein called WASp [187,188]. It has been elucidated that WASp plays an important role in the regulation of CD43, as WAS patients show reduced and/or abnormal expression of CD43 on their blood cells [160,189]. One of the results of this dysregulated CD43 expression is altered leukocyte trafficking, including reduced MΦ chemotaxis [190,191]. 1.5.3.2 HIV/AIDS Acquired  immunodeficiency  syndrome  (AIDS)  is  caused  by  the  human  immunodeficiency virus (HIV). Analysis of serum from HIV-affected patients shows that these individuals are prone to producing anti-CD43 antibodies that can bind to CD43 on the surface of normal T cells [192,193]. The production of these antibodies may be related to the finding that HIV-infected T cells produce hyposialylated forms of CD43, or alternatively, due to the fact that HIV can directly bind soluble CD43 [194,195]. The relationship between CD43 and HIV is further illustrated by the finding that HIV virion contain cytoplasmic fragments of the CD43 tail, suggesting HIV employs the cytoplasmic domain of CD43 for intracellular purposes such as trafficking [196]. It is easy to hypothesize that one or more of these relationships between CD43 and HIV are related to the dramatic loss of functional CD4+ T cells that partially defines the AIDS condition. 29  1.5.3.3 CD43 and mycobacteria The first research description implicating CD43 as having a role in the interaction between mycobacteria and host cells was made by Fratazzi et al (2000) [135]. These authors were interested in investigating the regulatory role of CD43 in the binding and uptake of mycobacteria because of CD43’s “known ability to interfere with adhesion processes”. Thus, their hypothesis was that the presence of CD43 limits the efficient association of MΦ and mycobacteria. This hypothesis was not supported after several lines of analysis. For one, HeLa cells gained the ability to bind M. avium after they had been stably transfected to express CD43. This result was apparently mycobacterial specific, as Salmonella typhimurium and Shigella flexneri did not bind to the CD43-transfected HeLa cells. Moreover, analyses showed that various mycobacterial species (M. avium, M. tuberculosis (strain H37Rv) and BCG) all had a significantly reduced ability to bind murine splenic CD43-/- MΦ, and this reduced association was not due to a global defect in binding or phagocytosis. Of interest, it was also noted that the deficiency in binding seen with CD43-/- MΦ could be overcome with the addition of a soluble form of the extracellular domain of CD43 (Galgp), but not with other glycoproteins. The authors suggested this may be indicative of CD43 acting as an intermediary element that promotes or stabilizes other mycobacterial/MΦ interactions.  Finally, it was described by  Fratazzi et al that CD43-/- MΦ have a deficient TNFα response when challenged with M. avium, however, introduction of soluble Galgp corrected this deficiency, suggesting a relationship between mycobacterial binding, CD43, and TNFα responsiveness [135]. Two additional research descriptions exploring the role of CD43 during M. tuberculosis infection were contributed by Randhawa et al [29,136].  The first series of experiments  confirmed and extended the findings of Fratazzi et al concerning the importance of CD43 for 30  mycobacterial association with host cells. Specifically, it was found that CD43-/- MΦ sourced from (murine) spleens, peritoneum, lungs, and differentiated from bone marrow were all deficient in their ability to associate with M. tuberculosis. This deficiency could be abrogated if serum opsonins were present [136]. The previous suggestion that this interaction is specific to mycobacteria was also supported, as neither S. typhimurium nor Listeria monocytogenes binding was altered between CD43+/+ and CD43-/- BMMΦ [136]. It was also noted that while CD43-/MΦ take up comparatively fewer bacilli, these intracellular bacteria replicate more rapidly than those in CD43+/+ MΦ. However, IFNγ activation of the CD43-/- MΦ overcame their inherent deficiency in limiting bacterial growth [29]. Comparisons of CD43+/+ and CD43-/- littermate mice that received a low-dose aerosol infection of M. tuberculosis provided interesting in vivo data about the role of CD43 during infection [136].  These experiments showed that CD43-/-  mice handled infection less well during the acute phase of infection (< 21 days), resulting in a greater than two fold increase of M. tuberculosis colony forming units (CFU) in the lungs and spleen [136]. This disparity of bacterial loads was roughly equalized after 21 days which correlates with the time period when the adaptive arm of immunity provides protection through the IFNγ-activation of MΦ [136].  Supporting this contention, in vitro studies of M.  tuberculosis-infected CD43-/- BMMΦ showed that the growth advantage of mycobacteria in these cells is lost upon IFNγ-activation [29]. However, CD43-/- mice are unable to limit an increasing bacterial load in the lungs during the chronic stage of infection (i.e. 60 - 210 days post infection), suggesting that CD43 is necessary for long term control of TB [136]. Analysis of the granuloma morphology of CD43-/- mice suggests that ineffective containment of viable bacteria is part of the immune deficiency of these mice. In general, CD43-/- mice developed granulomas more rapidly than did CD43+/+ mice. The CD43-/- granulomas contained more 31  extensive cellular infiltrates with much higher numbers of foamy MΦ, the reasons for which are not yet understood [136]. Foamy MΦ contain numerous lipid bodies and are thought to provide an environment supportive of mycobacterial growth [197], which may partially explain the susceptibility of CD43-/- mice. A partial analysis of the CD43-/- MΦ cytokine profile suggests that CD43 is necessary for proinflammatory responsiveness after M. tuberculosis uptake, and the lack of TNFα release results in increased MΦ necrosis, and reduced MΦ apoptosis (apoptosis promotes bacterial killing) [29]. Thus, several lines of evidence indicate that CD43 plays a role in both the binding/uptake and the cellular responsiveness of MΦ towards mycobacterial bacilli.  1.6 Mycobacterial ligands 1.6.1 The cell wall & capsule of M. tuberculosis Perhaps the most distinguishing feature of the mycobacteria, in comparison to other bacterial species, is their complex multi-layered cell wall. M. tuberculosis has several lipidbased compounds that are found exclusively within the mycobacterial family, and some of these lipidic compounds are only associated with pathogenic species of mycobacteria. Thus, the cell wall of M. tuberculosis contains many compounds that likely have roles in determining how M. tuberculosis interacts with host cells and causes disease. The cell wall of M. tuberculosis can be roughly divided into three regions (see Figure 2): 1) A single phospholipid bilayer plasma membrane that interfaces with the cytosolic compartment. 2) A densely packed inner cell wall that is primarily composed of (hydrophobic) lipidic structures that are anchored into the plasma membrane via carbohydrate extensions. 3) A  32  loosely adhered outer cell wall, or ‘capsule’, that is primarily composed of long chain carbohydrates with a variety of associated proteins and glycolipids. 1.6.1.1 The inner cell wall of M. tuberculosis Closely associated with the single plasma membrane of M. tuberculosis is the inner aspect of the complex cell wall. The inner cell wall is dominated by the arrangement of several carbohydrate/lipid constituents that are covalently linked and represent a sturdy encasement for the bacterium. The primary compounds that make up the inner cell wall complex are the mycolic acids (MA), arabinogalactan (AG), and peptidoglycan (Figure 2) [198].  In this  proposed scheme, the cross-linked peptidoglycan exists against the plasma membrane interface and is covalently bonded to AG via phosphoryl-N-acetylglucosaminosyl-rhamnosyl linkages. The AG is subsequently attached to MA via ester linkages [198]. The MA layer is thought to form a densely hydrophobic region within the central aspect of the cell wall; leading to the slow diffusion of many compounds (e.g. nutrients, pharmacologics) both into and out of the cell. While not covalently linked within the inner cell wall, another lipoglycan called trehalose 6,6'dimycolate (TDM) is thought to intercalate with the mycolic acid layer to further contribute to the hydrophobicity of this region [199].  It is not certain if TDM is also surface-associated,  however, the findings that TDM mediates ‘cording’ of clustered bacilli and is efficiently released from bacteria, suggests that it spans the capsular region to reach the bacterial surface [200]. 1.6.1.2 The capsule of M. tuberculosis Early reports suggested that the outer surface of mycobacteria was composed of mycosides [201,202]. However, later studies indicated the presence of an outer polysaccharide33  rich layer [203,204] which could explain the presence of the so-called electron transparent zone often seen in electron micrographs of mycobacteria inside MΦ [205,206] and more recently in axenically grown bacteria [207,208,209,210,211]. Support for this contention has come from studies describing the presence of an outer surface capsule on M. tuberculosis [212]. Carbohydrates make up 85% of the capsule, of which the predominant sugar is glucan (approximately 70% of all sugars present). Arabinomannan and mannan are also present in significant quantities, as are a number of proteins, some of which are glycosylated. While about 10% of the capsule is composed of proteins, there is very little lipid present [103,213].  The  presence of LAM in the capsule has not been readily demonstrated, though PIM has been shown [2,214]. The presence of a glycan rich capsule surrounding intracellular mycobacteria has been confirmed using specific monoclonal antibodies against glucan and AM [215,216]. Stokes et al have previously shown that mechanical removal of capsular material from M. tuberculosis results in a tenfold increase in bacterial binding to MΦ, suggesting that the capsule can act as an anti-phagocytic barrier that limits the interaction of M. tuberculosis with MΦ [217]. However, even though removal of capsular material greatly enhances binding of M. tuberculosis to MΦ, a percentage of intact, encapsulated bacteria can readily bind MΦ. These observations, along with earlier studies showing that only certain populations of MΦ efficiently bind M. tuberculosis [69,218], suggest that the M. tuberculosis capsule modulates the interaction of bacteria with host cells, preventing uptake by some populations of MΦ and directing the bacteria to specific MΦ types or particular receptor-ligand interactions.  34  Figure 2: The M. tuberculosis cell wall Aspects of the M. tuberculosis cell wall are visible when a transverse cross section of a bacillus is observed under TEM with ruthenium red staining (A). Each of the primary layers of the cell wall can be schematically shown in a simplified form (B). These layers include (medial to distal), a single plasma membrane, an inner layer of petidoglycan and arabinogalactan, a lipidrich mycolic acid layer, and a non-covalently adhered capsule.  (A – Image used with permission - Stokes et al, Infection & Immunity (2004), [219] ) (B – Image used with permission - Abdallah et al, Nature Reviews Microbiology (2007), [220] )  35  1.6.2 Interaction of M. tuberculosis with the macrophage Various compounds derived from M. tuberculosis have been implicated in the interactions occurring between the outer surfaces of the bacteria and the MΦ. Some of these described bacterial ligands are carbohydrate and/or lipidic while others are proteinaceous. Although debate exists as to whether all the proposed ligands are actually accessible on the bacterial surface, a summary of the mycobacterial surface ligands (i.e. not ‘secreted’ ligands) that have been implicated in the interaction with MΦ are provided here.  1.6.2.1 Carbohydrate and lipidic ligands The cell wall of M. tuberculosis contains several unique lipid structures and many of these have been investigated with regards to their effect on the MΦ when presented in a pure form (e.g. in solution, or upon the surface of an inert carrier particle). One of the most researched compounds derived from the M. tuberculosis cell wall is LAM.  Termed a  lipoglycan, all versions of LAM have a mannosyl-phophatidylinositol (MPI) anchor that is associated with a D-mannan core and a D-arabinan domain as well.  Inter-mycobacterial  comparisons have shown that the slow growing pathogenic mycobacterial species such as M. tuberculosis and M. bovis commonly have mannosyl-capping on the arabinan domain (ManLAM), while fast growing saprophytic mycobacteria such as M. smegmatis can have phosphoinositide capping (PILAM), or no mannosyl capping at all (AraLAM) [221]. Although several studies have shown that purified LAM can directly interact with host cells, there are divergent reports about how LAM is localized within the bacterium and which cell receptors are LAM specific. ManLAM coated beads, but not AraLAM or LM coated beads, have been shown to bind to MR [222], and these beads do not fuse with lysosomes as a result [100]. Moreover, it 36  has been shown that mycobacterial mutants that overexpress LAM, LM and PIM result in higher levels of mannan-based MΦ association [223]. Conversely, although another report confirmed that purified ManLAM can bind to sites on the MΦ, it was determined that both ManLAM and AraLAM can inhibit M. tuberculosis binding in a dose dependent manner [224]. This result suggests that MR is not the dominant receptor involved with LAM binding, which is in agreement with a more recent study that showed BCG mutants which lack LAM mannosylation do not have a significant impairment in uptake by DC or any altered pathology in mice [105]. A publication by Stokes & Speert (1995) instead showed that the common PI anchor of these lipoglycans acted as the ligand for MΦ binding [224]. Two other mycobacterial lipoglycans that contain PI anchors and have been implicated in MΦ binding are LM and PIM [117,225]. It has also been reported that ManLAM, AraLAM, LM and PIM have the capacity to engage TLR2 signaling [116,117,226]. Whether LAM acts as a ligand mediating the binding of M. tuberculosis to MΦ is also impacted by the possibility that LAM is not located on the surface of M. tuberculosis. The localization of LAM within the M. tuberculosis cell wall has been the subject of conflicting reports. While one study employing immuno-gold transmission electron microscopy (TEM) showed that LAM is primarily associated with the inner aspect of the cell wall, other studies using enzyme-linked immunosorbent assay (ELISA) and flow cytometry have shown that LAM is accessible on the surface of the M. tuberculosis clinical isolates [2,227]. These differences may be explained by the lack of specificity of some antibodies recognizing LAM [103,104]. Of the mycobacterial carbohydrates that are associated with the cell wall, α-glucan and AM have been shown to be the predominant sugars present on the surface of both in vitro and in vivo grown M. tuberculosis [213,215,228].  Of these carbohydrates, glucan has received 37  comparatively more attention due to a report that it can directly interact with CR3-transfected HeLa cells [75].  It should be noted that these studies were performed with CHO cells  transfected with CR3 which may not truly reflect the way a MΦ interacts with mycobacteria. Moreover, many unrelated compounds such as α-glucan, β-glucan, mannan and Nacetylglucosamine were shown to mediate the inhibition of M. tuberculosis to the transfected cells which is hard to reconcile with a specific receptor-ligand interaction [75]. A more recent study employing M. tuberculosis mutants that lack a putative α-1,4-glucosyltransferase, resulting in a two-fold reduction of α-glucan production, found that these mutants do not have a deficiency in MΦ binding, but show reduced in vivo growth in the mouse [229].  1.6.2.3 Protein ligands There have been several proteins implicated in the surface interaction of M. tuberculosis and MΦ. One that has received a significant amount of attention (partly due to its high immunogenicity) is the 19kD lipoprotein. It is not yet understood if the 19kD lipoprotein has a role within the bacillus, however this lipoprotein has multiple immunomodulatory effects in the host. Purified 19kD lipoprotein has been found to interact with TLR2 to promote IL-12 p40 and IL-1 release while downregulating the expression of MHC class II on phagocytes [115]. These findings were supported with a 19kD deletion mutant, and it was also shown that the absence of the 19kD lipoprotein does not affect uptake into IFNγ-activated MΦ [230]. Although 19kD deletion mutants of M. tuberculosis do not have a growth deficiency in broth culture, they show limited growth within cultured cells and within mice [230,231]. The finding that deletion of the 19kD lipoprotein in a related mycobacterial pathogen, M. intracellulare, did  38  not affect growth during mouse infection suggests that this lipoprotein may have functional differences between mycobacterial species [232] Other mycobacterial proteins have been described as surface localized entities that help bacilli to interact with the host MΦ, however, each of these proteins has comparatively limited research associated with it. For example, an apparent mannan-binding lectin termed ‘mycotin’ was described by Goswami et al (1994) [233], but this work was never revisited. Also, one of the few M. tuberculosis glycoproteins, Apa, has been shown to bind SP-A, leading to a type of alveolar opsonisation which enhances MΦ uptake [234].  1.7 Project goals 1.7.1 Hypothesis Based on the research descriptions of Fratazzi et al [235], and Randhawa et al [136] the mammalian glycoprotein CD43 has the capacity to stabilize the association between MΦ and mycobacteria. This stabilization of bacterial binding to the host cell can result through the efficient surface expression of CD43 on the MΦ, or through the addition of the soluble CD43 extracellular fragment Galgp. Thus, it seems apparent that CD43 acts to form a bridge between the MΦ and the M. tuberculosis bacillus. The overriding hypothesis of my research was that an as yet unidentified mycobacterial ligand(s) exists that mediates M. tuberculosis binding to CD43, and therefore, to the MΦ. In light of the demonstration that CD43 has a critical role in the pathogenesis of M. tuberculosis [29,136], identification of the ligand(s) for CD43 is of great importance.  39  1.7.2 Project objectives 1.7.2.1 Evaluation of the M. tuberculosis capsule as a source for candidate adhesins Objective 1: It was hypothesized that the capsule contains ligands necessary for host cell binding, also termed adhesins.  Therefore, our initial goal was to establish whether or not the  capsule is a viable source of mycobacterial adhesins, and further, to determine whether candidate adhesins existed within the lipidic, carbohydrate and/or proteinaceous fractions of the capsule. 1.7.2.2 Evaluation of the mycobacterial ligands that interact with CD43 Objective 2: The central inquiry of this research study was the search for mycobacterial ligands that interact directly with CD43. It was hypothesized that immobilization of a purified CD43-Fc chimera would allow the specific binding of relevant mycobacterial ligands sourced from the M. tuberculosis capsule using an affinity chromatography method. 1.7.2.3 Confirm that moieties identified in Objective 2 can act as ligands for M. tuberculosis binding to macrophages Objective 3: Candidate mycobacterial ligands that showed an in vitro ability to bind CD43 within the affinity chromatography system would be tested for their ability to function as M. tuberculosis adhesins to the primary cell of interest, the MΦ. This would be tested using purified ligand to competitively inhibit bacterial binding as well as the use of a ligand depletion strategy (e.g. bacterial mutants or epitope masking) to also inhibit macrophage binding.  40  1.7.2.4 Confirm that ligands identified in objectives 2 and 3 interact with CD43 on the macrophage Objective 4: Candidate mycobacterial ligands that demonstrated MΦ adhesin function would further be evaluated to determine if CD43 is the primary MΦ receptor required for efficient bacterial binding. This would be tested using the binding inhibition strategies described in Objective 3 on both CD43+/+ and CD43-/- MΦ to evaluate whether or not CD43-/- MΦ show a null result of binding inhibition.  1.7.2.5 Characterize the binding affinity and specificity of candidate CD43 ligands Objective 5: M. tuberculosis capsular ligands that show a dependency on CD43 as a receptor for mediating bacterial binding to the MΦ would be further analyzed to determine the binding kinetics of their molecular interaction.  If homologous moieties to those found in M.  tuberculosis exist in other bacterial strains or species, these could be tested for binding inhibitory function. Lastly, determination of the functional epitopes on CD43 and/or the M. tuberculosis ligand would be evaluated if feasible.  41  Chapter 2: Materials & Methods 2.1 Materials 2.1.1 Bacteria M. tuberculosis, strain Erdman (Trudeau Mycobacterial Collection (TMC) No. 107; American Type Culture Collection (ATCC) No. 35801), was grown to late log phase in Proskauer and Beck medium supplemented with 0.05% (v/v) Tween 80 (PB&T) either as a “static” culture (standing culture briefly agitated every 2-3 days) for volumes of 100 mL or less, or, in a roller bottle system (set at 2 rpm) for volumes over 100 mL [236]. For capsule preparation, late log phase cultures were processed immediately. However, batch cultures used for MΦ infections were aliquoted, stored and colony forming units (CFU) quantitated before their use in binding assays. For fluorescent bacterial microscopy and bacterial ELISAs (used to detect surface localization of Cpn60.2 and DnaK), frozen aliquots of the above preparations were grown for four days in PB&T prior to assaying. 2.1.2 Preparation of capsule Brief sonication or syringe passage was used to remove capsular material from M. tuberculosis. Prior to removal of capsule, roller bottle cultures were grown to late-log phase in PB&T, centrifuged, washed in PBS + 0.05% (v/v) Tween 80 and finally resuspended at 0.25x original volume in distilled water (for lyophilization end-treatment) or 20 mM Tris-HCl (pH 8.5) (for anion-exchange chromatography (AEC) end-treatment). For the sonication procedure, 5 mL aliquots of the bacterial suspension were dispersed with a single 15 sec sonication exposure using a VC50T 50 W + 3 mm probe (Sonics & Materials, Danbury, CT) tuned to the manufacturer’s recommendations (referred to throughout as “sonicated”).  The “syringe” 42  passage treatment involves the transfer of 5 mL aliquots of bacterial suspension through a 25G syringe needle ten times. After capsular sloughing, bacteria were removed by centrifugation and the resultant supernatant was sterilized via 0.2 µm filtration (NalgeNunc, Rochester, NY) and lyophilized (Virtis Freezemobile, Gardiner, NY) for long-term storage, or kept in solution at 4°C prior to AEC. As measured by release of the intracellular enzyme, isocitrate dehydrogenase (ICD), these procedures result in minimal lysis of the bacteria [217], while releasing significant amounts of capsular material. 2.1.3 Capsule fractionation Capsular proteins used for ELISA analysis were purified from sonication-derived capsule via AEC. This procedure was conducted at 4°C using diethylaminoethyl (DEAE) Sephadex medium that was introduced into a 1.5 x 10 cm glass column (BioRad), fitted with a flow adapter (BioRad) and washed extensively with 20 mM Tris-HCl (pH 8.5) prior to the introduction of soluble capsule under gravity flow (~30 mL hr-1). After flow-through of soluble capsule, the column was washed with two column volumes of 20 mM Tris-HCl (pH 8.5) prior to an additional two column volumes of 20 mM Tris-HCl + 50 mM NaCl (pH 8.5), to elute any weakly-associated capsular constituents. Finally, a strong ionic elution of 4 column volumes of 20 mM Tris-HCl + 1 M NaCl (pH 8.5) was introduced to release capsular components that had been bound within the column due to electronegative charge characteristics. Elution fractions of ~5 mL were collected in glass vials using a RediFrac automated fraction collector (Pharmacia Biotech). Protein presence within the collected fractions was assessed spectrophotometrically using UV absorbance at 280nm. Partial purification of the lipid, protein and carbohydrate components of capsule was performed in order to investigate each component separately.  An aliquot of capsule was 43  dissolved in distilled water and mixed with methanol and chloroform at a ratio of 3:4:3 respectively. The suspension was thoroughly mixed and allowed to stand overnight. Three layers were obvious: a cloudy upper phase, an intermediate cloudy phase and a clear lower chloroform phase. The upper two phases were removed and pooled. Fresh water and methanol were added to the lower phase to give a 3:4:3 ratio again. Following agitation, the mixture was allowed to settle for 4 hrs and the upper and intermediate phases were again removed and pooled with the original upper and intermediate phase. The lower chloroform phase was dried over N2(g). The pooled upper phases were lyophilized and represented the water soluble proteins and carbohydrates. Thin layer chromatography confirmed the presence of lipids in the lower chloroform phase (data not shown). Both phases were reconstituted in binding medium to the starting volume of unfractionated capsule.  These fractions (the lipid fraction and the  protein/carbohydrate fraction) were compared to unfractionated capsule for their ability to inhibit the association of MΦ with M. tuberculosis. To obtain a partially purified protein fraction, capsule was solubilized in PBS at 1 mg mL-1 (protein content ~70 µg mg-1 capsule) and precipitated with 4 volumes of 10% (v/v) trichloroacetic acid (TCA) + 0.07% (v/v) mercaptoethanol in acetone overnight at 4oC. The suspension was centrifuged at 14900 x g for 15 min at 4oC, and the resulting pellet was washed two times in PBS and dissolved in 500 µL of 8 M urea + 2% (w/v) 3-[(3cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) + 100 mM  dithiothreitol  (DTT). The solution was dialysed against PBS over 3 days at 4oC with several changes of PBS. Finally, the volume was adjusted to the equivalent of the original 1 mg mL-1 capsule solution. For protein digestion experiments, this protein preparation was mixed 1:1 (v/v) with Proteinase K-agarose (Sigma) which had been prewashed and suspended in binding medium. The mixture 44  was incubated at 37oC for 18 hrs, after which the immobilized enzyme was removed by centrifugation at 2300 x g. The resultant protein digest was used at the equivalent concentration as the undigested protein preparation (above). The efficiency of protein digestion with this treatment was confirmed by polyacrylamide gel electrophoresis (PAGE) (data not shown). Arabinomannan and glucan were purified from capsular material obtained from M. tuberculosis using methods described previously [213]. 2.1.4 Mice and cell culture Bone marrow-derived macrophages (BMMΦ), peritoneal MΦ and alveolar MΦ were prepared from 6-24 wk old mice.  Female CD1 mice were sourced from Charles River  Laboratories (Wilmington, MA) and maintained at the Child & Family Research Institute (CFRI) at the University of British Columbia (UBC) Animal Care Facility for >2 weeks prior to use [136]. Wild-type control mice (CD43+/+) and knockout mice (CD43-/-) on a C57BL/6 background [237] were maintained at the Biomedical Research Centre (UBC) prior to use. Each animal care facility was maintained in accordance with Canadian Council on Animal Care and UBC standards. Additionally, all animal protocols employed were approved by UBC. For experiments with C57BL/6 mice; age- and sex-matched littermates, from the breeding of CD43+/- heterozygotes, were used for each experimental comparison between CD43+/+ and CD43-/- genotypes. To generate BMMΦ, mice were euthanized via cervical dislocation and bone marrow from femurs and tibias was washed with bone marrow medium (RPMI 1640 medium (Gibco, Grand Island, NY) + 10% (v/v) heat inactivated fetal calf serum (∆FCS) (Gibco) + 10% (v/v) L929 cell medium + 2 mM glutamine + 1 mM sodium pyruvate). L929 cell medium provides a source of murine monocyte-colony stimulating factor (M-CSF) and was obtained by growing 45  L929 cells in RPMI + 10% (v/v) ∆FCS + 2 mM glutamine + 10 U mL-1 penicillin & streptomycin prior to reserving the filtered supernatant. Erythrocytes from the marrow were lysed with a 10 min exposure to 0.17 M NH4Cl and the remaining cells were resuspended in bone marrow medium and added to a T150 tissue culture flask (BD Falcon) for 3 hrs at 37°C and 5% CO2.  After this time, non-adherent hemapoietic stem cells were quantified via  hemocytometer counts and seeded onto the surface of 12 mm (acid-washed) glass coverslips set within the wells of a 24-well tissue culture plate, where each well received 2.5 x 105 cells in a volume of 1 mL bone marrow medium. After four days, 0.5 mL additional bone marrow medium was added to all wells and the cells were used for assays on day seven. Murine peritoneal MΦ were obtained from 6-8 wk old female BALB/c mice, as described previously [238]. In brief, mice were killed by cervical dislocation and the skin reflected to expose the abdominal wall. Five mL of supplemented RPMI (RPMI (Gibco) + 10% (v/v) ∆FCS (Gibco) + 10 mM L-glutamine + 10 mM sodium pyruvate)) was injected into the peritoneal cavity. The abdomen was massaged for 30 sec and the peritoneal washings removed. Peritoneal contents that had visible erythrocyte contamination were discarded. Washings from mice treated identically were pooled and their leukocyte content counted and adjusted to the desired concentration in supplemented RPMI. The cells were maintained in supplemented RPMI at 5% CO2 and 37°C for 18 hrs prior to use. Murine alveolar MΦ were acquired as described previously [72]. In brief, 6-8 wk old female BALB/c mice were injected with a lethal dose of pentabarbitol, and the heart and lung were dissected out into cold PBS and washed free of blood. A 22G catheter (Critikon, Tampa, FL) was inserted into the trachea and tied off. While supporting the lungs in a jig, they were lavaged with 10 mL of PBS, containing 0.1% ethylenediaminetetraacetic acid (EDTA), in 1-2 46  mL aliquots (preliminary studies showed that the inclusion of EDTA increased the yield of MΦ, but did not affect subsequent MΦ functions). Pooled washings were pelleted and washed with supplemented RPMI. The final pellet was resuspended in supplemented RPMI at 5 x 105 cells mL-1, and 100 µL aliquots were placed onto 12 mm coverslips. The cells were allowed to adhere for 1 hr at 37°C in 5% CO2, washed, and used immediately. The THP-1 macrophage-like cell line was obtained from the ATCC (No. TIB-202) and was grown in supplemented RPMI, as described previously [239]. In brief, a stock batch of cells was frozen down in liquid nitrogen for use throughout the experiments. A vial of this stock batch was seeded into supplemented RPMI at 5 x 105 - 1 x 106 cells mL-1 and grown up for five days to a concentration of 4-5 x 106 cells mL-1, at which time the culture was passaged into fresh supplemented RPMI (1:5 dilution).  Subculturing was repeated a maximum of five times,  whereupon a fresh vial of the frozen stock batch was grown up. 2.1.5 Construction and expression of CD43-Fc chimeric proteins (* The methods described in section 2.1.5 were completed by UBC MSc graduate Jeanne Yang (1996) of the Ziltener Lab and are described in her MSc Thesis [240]. These methods have not been published in a peer reviewed journal and are therefore included here for reader reference. Ms. Yang constructed the cell lines for expression of CD43-Fc and Tyler Hickey completed all cell culture and subsequent purification of the chimeric proteins.)  Murine genomic CD43 and human IgG (hIgG) were each cloned into individual Bluescript plasmids (pBS). PCR (using Vent polymerase) was used to amplify the extracellular domain of CD43 from the pBS(CD43) as well as the constant (Fc) domain from the pBS(Fc). To achieve this, four oligonucleotide primers were prepared: The sequence of the sense primer 47  of CD43 was 5’CCGTCGACAGATGGCCTTGCACCTTCTC3’ and that of the anti-sense primer was 5’TCGGTTCTTAGTTCACCGTCTAGAAC3’. A Sal I site was added to the sense primer and a Bgl II site was added to the anti-sense primer. Conversely, a Bgl II site was added to the sense primer of hIgG, 5’GCAGATCTTGTGACAAAACTCACACAT3’ and a Sal I site was added to the hIgG anti-sense primer, 5’GACAGAGGCCCATTTACTCAGCTGCC3’. The two amplified products, 758 bp for CD43 and 914 bp for Fc were separated on a 1% agarose gel and visualized with 5 µg mL-1 ethidium bromide. The single bands were excised and the PCR products were extracted using a Gene Clean kit (MP Biomedical) according to manufacturer’s instructions. The two gene fragments were then subcloned into EcoRV linearized BS plasmids by blunt end ligation. Correctly oriented plasmids were purified using a Maxi Prep kit (QIAGEN). The pBS(CD43-Fc) were propagated using Escherichia coli strain DH5α. For this study, the murine myeloid cell line, NSF60, was selected as the means of expressing the CD43-Fc chimeric proteins. Suspended in PBS, NSF60 cells were prepared to a concentration of 1 x 107 cells mL-1 and were mixed with 30-50 ng of purified pBS(CD43-Fc) DNA. Using electroporation apparatus (BioRad), the system was pulsed at a capacitance of 250 µF and 350 V. Cells were then moved into RPMI medium at a concentration of 104 cells mL-1 and incubated for 2-3 days before transferring cells into a 96-well plate and introducing 0.21 mg mL-1 of the eukaryotic antibiotic, G418 (Gibco). Cells resistant to G418 were identified over 10-21 days, during which time the supernatant from wells with viable cells was tested for the presence of soluble CD43-Fc using a sandwich ELISA. This ELISA employed well-adsorbed anti-human IgG(Fc) followed by the introduction of the NFS60 supernatant. Rat-derived S11 (pan anti-CD43) monoclonal antibody (mAb) was then added followed by secondary detection with a goat-anti-rat IgG conjugated with horseradish peroxidase (HRP). Colorimetric detection 48  of wells containing CD43-Fc was completed through the addition of the 2,2'-azino-bis(3ethylbenzthiazoline-6-sulphonic acid) (ABTS) substrate and observing colour development after 30 min with a spectrophotometer at 405 nm. The clones that showed the highest production of CD43-Fc were selected as the seed cells for the stock culture of the NSF60(CD43-Fc) cell line. 2.1.6 CD43-Fc chimeric protein purification CD43-Fc chimeric proteins produced from the murine myeloid cell line NSF60 (described above) were maintained in NSF60 culture medium (RPMI + 10% (v/v) ∆FCS + 2 mM glutamine + 10 U mL-1 penicillin & streptomycin + 1% (v/v) WEHI cell medium). WEHI cell medium provides a source of murine IL-3 and was obtained by growing WEHI cells in simple cell medium (RPMI + 10% (v/v) ∆FCS + 2 mM glutamine + 10 U mL-1 penicillin & streptomycin) prior to reserving filtered supernatant. NSF60(CD43-Fc) culture volumes < 30 mL were maintained in T150 tissue culture flasks and volumes ≥ 30 mL were maintained in CytoStir™ bioreactors (Kimble/Kontes, Vineland, NJ), at a stir rate of 20 rpm. Roughly 80% of the culture volume was exchanged with fresh NSF60 culture medium every 3-4 days and the reserved culture volume was 0.2 µm filtered and frozen to -20°C. During each exchange, a small volume of NSF60(CD43-Fc) supernatant was reserved prior to filtration to confirm sterility on sheep blood agar plates. Soluble CD43-Fc chimeric proteins were purified from the NSF60(CD43-Fc) supernatant via a two-step affinity chromatography procedure; first using Protein A capture, and then Wheat Germ Agglutinin (WGA) capture.  For Protein A capture,  the filtered NSF60(CD43-Fc) supernatant was twice passed through a glass chromatography tube (BioRad) of 1 cm diameter that had been prepared with a 1 cm bed height of Protein ASepharose (Pharmacia) and fitted with a flow-adapter (BioRad) to facilitate controlled gravity flow.  After NSF60(CD43-Fc) supernatant passage, the bed was washed with 20 column 49  volumes of PBS prior to the introduction of a 0.1 M Glycine elution buffer (pH 2.8). Ten-drop eluted fractions were collected with tubes that had been prepared with 175 µL of 1 M Tris neutralizing buffer (pH 9.0) using a RediFrac collector. Relative protein concentration within eluted fractions was monitored via 280 nm absorbance. WGA purification was performed using a Glycoprotein Purification Kit (Pierce), as per manufacturer’s recommendations. In brief, 200 µL of the WGA resin was introduced into a micro spin column fitted with a 0.2 µm filter, and the resin was washed three times. The NSF60 Protein A-purified proteins were then diluted 1:4 into Pierce binding/wash buffer (proprietary recipe) and added to the WGA resin. This mixture was incubated on an end-over-end rotator for 15 min at 4°C. Unbound compounds where then removed by spinning the column at 1000 x g, and 500 µL of binding/wash buffer was added, and a second spin to remove unbound material was conducted. Finally, 200 µL of Pierce elution buffer (proprietary recipe) was introduced into the spin tube, and this was incubated with endover-end mixing for 15 min at 4°C. Released compounds were subsequently collected by spinning the column at 1000 x g. Purity of final CD43-Fc chimeric proteins was assessed by polyacrylamide gel electrophoresis (PAGE) analysis. 2.1.7 Recombinant molecular chaperones Recombinant Cpn60.2 and DnaK were derived using plasmids pMRLB1 and pMRLB.6, respectively, provided through the NIH/NIAID TB Resource Contract (HHSN266200400091c) at Colorado State University. The pMRLB1 (rv0440, cpn60.2) and pMRLB.6 (rv0350, dnaK) plasmids were designed to include a 6xHis tag on the gene product and encode for ampicillin resistance. Each of these plasmids was transformed and expressed using BL21Star (DE3) pLysS E.coli competent cells (Invitrogen, Carlsbad, CA). These E.coli strains contain the λ DE3 lysogen (prophage) which enhances T7 promoter function. Additionally, the BL21Star 50  (DE3) pLysS cells contain a truncated RNase E enzyme, which promotes mRNA stability, as well as a pLysS plasmid, which produces T7 lysozyme that leads to reduced basal expression of the transformed genes and also confers resistance to chloramphenicol. After successful heat shock transformation of pMRLB1 and pMRLB.6 into respective BL21Star (DE3) pLysS bacteria, 1 L volumes of transformed E.coli, grown at 225 rpm and 37°C, were induced with 120 mg mL-1 isopropyl β-D-1-thiogalactopyranoside (IPTG) to express the recombinant proteins at early log phase, and the cultures were then grown to late log phase over 3-4 hrs. Growth phases were evaluated throughout, using optical density at 600 nm. After logarithmic growth was exhausted, the cultures were centrifuged using 600 mL centrifuge jars (NalgeNunc, Rochester, NY) spun at 10,000 x g. Sedimented bacteria were resuspended in bacterial lysis buffer (200 µg mL-1 Lysozyme (Sigma), 250 U L-1 DNase I (Invitrogen), one tablet of EDTAfree protease inhibitor cocktail (Roche), dissolved in 1x Binding Buffer (Calbiochem) and ≥18 MΩ H2O). The E. coli mixture was then kept on ice throughout a probe-sonication lysis treatment involving exposures of 6 x 45 sec. The E. coli lysate was then spun down at 48,400 x g for 1 hr and the supernatant was reserved. A His-Bind Resin kit (Novagen, Madison, WI) was used for recombinant protein purification, as per manufacturer’s recommendations, and the proteins were washed extensively in the Ni+2 column including a 0.5% (w/v) amidosulfobetaine (ASB)-14 detergent (Calbiochem, San Diego, CA) treatment to help minimize residual endotoxin presence.  Endotoxin levels of the purified Cpn60.2 and DnaK proteins were  evaluated using a Limulus amoebocyte lysate (LAL) assay (Hbt, Uden, Netherlands), as per manufacturer’s recommendations. The final polypeptide sequence of both recombinant Cpn60.2 and DnaK was confirmed using mass spectrometry (MS) at the University of Victoria (BC). The recombinant proteins 51  were run on PAGE and the single resultant bands were excised prior to trypsin digestion. The extracted peptides were then analyzed by LC-MS/MS using a QStar Pulsari, which employs a Hybrid Quadrupole-TOF LC-MS/MS mass spectrometer equipped with nano-electrospray ionization source (Applied Biosystems). The sample was first separated by reverse phase chromatography over a 30 min gradient as it was spraying into the mass spectrometer. All data was analyzed using MASCOT, a protein identification search engine algorithm [241]. Fluorescent forms of the recombinant Cpn60.2 and DnaK proteins were prepared using an Alexa Fluor 488 Fluorescent Labeling Kit (Invitrogen) as per manufacturer’s recommendations. In brief, 0.5 mL of 2 mg mL-1 preparations of Cpn60.2 and DnaK were incubated with the Alexa Fluor 488 dye at room temp for 1 hr on a rocker before the reaction was stopped with hydroxylamine. This mixture was diluted with 1 mL PBS and was passed through a size exclusion chromatography resin under gravity flow to separate unbound fluorescent dye from labeled protein.  The separation of these components within the  chromatography resin was monitored with UV light and the faster running band (labeled protein) was collected for quantification and use. Recombinant E.coli GroEL and low-endotoxin preparations of mouse and human Hsp60 (expressed in E.coli) were sourced from Assay Designs/Stressgen (Ann Arbour, MI). The GroEL solution was dialyzed prior to use with a 3 kD cutoff membrane in 2 L of PBS with multiple buffer exchanges to minimize presence of sodium azide, a cytotoxic preservative. 2.1.8 Preparation of anti-Cpn60.2, anti-DnaK (F(ab’)2-fragment) and anti-capsule polyclonal antibodies New Zealand white rabbits were inoculated intramuscularly at 2-3 wk intervals with 0.5 mg of purified recombinant Cpn60.2, DnaK or unfractionated M. tuberculosis capsule that were 52  each emulsified with Freund’s incomplete adjuvant (Sigma). When maximal antisera titres were reached (~15 wks), the rabbits were exsanguinated and the resulting antisera was reserved after blood clotting. Pepsin-derived IgG(F(ab’)2) fragments were generated and purified using an Immuopure F(ab’)2 Preparation Kit (Pierce, Rockford, IL) as per manufacturer’s recommendations. In brief, polyclonal anti-Cpn60.2 or anti-DnaK rabbit antisera were first passed through a Protein A column to purify and concentrate the IgG fraction. PAGE analysis of the resulting IgG material showed an absence of contaminating proteins and was subsequently concentrated using standard ammonium sulphate precipitation. The precipitated proteins were initially solubilized with H2O, and subsequently dialyzed into 1 mL of 20 mM Naacetate (pH 4.4) at an estimated protein concentration of 3 mg mL-1. The soluble samples were then rotary incubated with 125 µL of Pierce pepsin-conjugated agarose for 4 hrs at 37°C. The pepsin-degraded IgG was then moved through an equilibrated chromatography column containing 0.5 mL of Protein A-Sepharose. The flow through material (non-Fc domain IgG fragments, including F(ab’)2) was collected in 750 µL fractions and assessed for protein concentration using 280 nm absorbance as an indicator. Material bound within the column (Fc domain fragments) was subsequently eluted with a 0.1 M glycine buffer (pH 2.5) and retained for analysis. Lastly, the fractions containing F(ab’)2 fragments were dialyzed using 50 kD cutoff dialysis tubing which allowed the release of non-F(ab’)2 fragments as well as moving the F(ab’)2 fragments into PBS. Purity of the F(ab’)2 fragments was confirmed with PAGE, and F(ab’)2 functionality and specificity were confirmed with Western blot (see Figure 15)  53  2.2 Methods 2.2.1 Interaction of M. tuberculosis and other compounds with MΦ To assess the effects of capsule, molecular chaperones (Cpn60.2, DnaK, GroEL, mouse Hsp60, human Hsp60), anti-Cpn60.2(F(ab’)2), anti-DnaK(F(ab’)2) and control compounds (Polymyxin B (Sigma, St. Louis, MO), LPS (E. coli origin, Sigma), bovine serum albumin (BSA) (Fisher Scientific, Nepean, ON)) on mycobacterial association with BMMΦ, each material was dissolved in binding medium (138 mM NaCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 2.7 mM KCl, 0.6 mM CaCl2, 1 mM MgCl2, and 5.5 mM D-glucose [242]) to the desired concentration and 250 µL was added to either glass coverslip-adhered MΦ, or polystyreneadhered (24-well tissue culture plate (BD, Franklin Lakes, NJ)) MΦ, each of which had been previously washed 2x with binding medium. To control for potential LPS contamination, the Cpn60.2, DnaK and BSA preparations were also mixed with 16 µg mL-1 of the endotoxin binding compound Polymyxin B. After 15-20 mins at 37oC and 5% CO2, 250 µL of M. tuberculosis at stated multiplicity of infections (MOI) in binding medium was added to these cells and to control cells that had been preincubated with 250 µL of binding medium alone. For the epitope-masking experiment, M. tuberculosis bacilli were preincubated for 20 mins with 1:100 dilutions of either anti-Cpn60.2(F(ab’)2) or anti-DnaK(F(ab’)2) prior to the addition of these mixtures to the BMMΦ. The MOI is defined as the number of CFU of bacteria that were incubated with the cultured MΦ. In our hands, ~1% of the seeded CFU became associated with MΦ after 3 hrs of non-opsonic incubation. For all experiments, the infecting inoculum was dispersed by drawing up and expelling the bacterial suspension 10x through a 25G needle attached to a 1 mL syringe. This procedure has previously been shown by the Stokes lab to be an effective means of dispersing mycobacterial bacilli without causing detectable cell lysis 54  [219]. To produce infections of ≥1 bacterium per MΦ, the MOI of bacteria added to MΦ was 75:1 for CD1 BMMΦ. Previous work by Randhawa et al (2005) showed that CD43-/- MΦ have a reduced capacity to bind M. tuberculosis, but that increasing the CFU inoculum overcame this limitation [136]. For the present studies two M. tuberculosis MOI of 60:1 & 100:1 were used for infections of the C57BL/6 BMMΦ, as preliminary work showed that an MOI of 60:1 for CD43+/+ cells and 100:1 for CD43-/- cells resulted in a similar level of bacterial binding in binding medium alone, a MOI ratio consistent with that described previously [136]. The MOI in individual experiments was confirmed retrospectively by plating out the inocula on Middlebrook 7H10 agar (BD, Franklin Lakes, NJ) supplemented with glycerol and OADC (oleic acid, albumin, dextrose complex), incubating over 3-4 weeks at 37°C and counting the resultant CFU. After 3 hrs exposure between the bacteria and the BMMΦ (1 hr nutator, 2 hrs static) at 37oC, 5% CO2, the BMMΦ monolayers were washed 3x with binding medium and prepared for either microscopic evaluation or CFU enumeration. The effect of capsule on the inhibition of control particle binding to MΦ was also tested. The binding of latex (non-specific binding), zymosan (a yeast cell wall particle that probes for lectin-like receptors), IgG-coated sheep erythrocytes (EIgG - probes for Fc receptors) and complement coated sheep erythrocytes (EIgMC - probes for complement receptors (CR), predominantly CR3, but also CR1 and CR4) was tested as described previously [69]. For microscopic evaluation, the coverslip-adhered monolayers were fixed (90% (v/v) ethanol, 10% (v/v) paraformaldehyde) and stained (first with Kinyoun’s Carbol Fuschin, followed by malachite green counterstain) and the association of mycobacteria with MΦ was assessed by counting 100 MΦ per coverslip, as described previously [69,71,218].  55  For CFU enumeration, total well contents including a 2 mL PB&T overlay and adherent MΦ were sonicated for 15 sec using VC-750 sonicator (Sonics and Materials) fitted with a sixmultiprobe adapter (6 mm probes) at an amplitude of 40, a procedure which lyses the MΦ but not M. tuberculosis bacilli and disperses clumped bacteria [219].  The resultant bacterial  suspension was inoculated onto Middlebrook 7H10 agar supplemented with glycerol and OADC and incubated over 3-4 wks at 37°C before enumerating colonies. 2.2.2 Two-dimensional polyacrylamide gel electrophoresis of capsular proteins Protein content of the capsule was measured using the Bradford assay (BioRad, Hercules, CA), employing BSA as a reference protein. Two-dimensional-PAGE (2D-PAGE) was performed on capsular proteins using an Ettan IPGphor II & Dalt-six system (Amersham Biosciences, Piscataway, NJ). Briefly, capsular proteins were isolated using TCA precipitation and resuspended in pH 4-7 rehydration buffer (8 M urea, 2% (w/v) CHAPS, 0.5% (v/v) Amersham IPG buffer, 0.002% (w/v) bromophenol blue), solubilized overnight at 4oC, loaded onto 24 cm (pH 4-7) Immobiline Drystrips (Amersham Biosciences) and separated using a step voltage program (14 hrs @ 30 V, 1 hr @ 200 V, 1hr @ 500 V, 1 hr @ 4000 V, 10 hrs @ 8000 V and hold @ 300 V). The 1D strips were then stored in mineral oil at -20oC prior to 2nd dimension separation.  The SDS-PAGE 2nd dimension separation was run on a 15%  polyacrylamide gel at 8 V (constant) for 16 hrs followed by silver staining to visualize the proteins. 2.2.3 Characterization of CD43-Fc chimeric protein To determine if the purified CD43-Fc proteins were properly formed, with appropriate glycosylation, affinity-purified CD43-Fc proteins were evaluated by PAGE and Western blot 56  methods to determine: molecular weight, glycosylation features, the presence of antibodydetectable CD43 epitopes and a human IgG Fc domain. The affinity chromatography methods (section 2.1.6) of purifying these proteins confirmed the presence of a Protein A binding domain (i.e. an IgG(Fc) domain) as well as WGA-binding epitopes (i.e. N-acetylglucosamine and/or sialic acid [243]).  To analyze the  purified proteins further, they were mixed 1:1 (v/v) with PAGE sample buffer and boiled for 5 mins. When using reducing conditions, 2% (v/v) β-mercaptoethanol was added to the PAGE sample buffer. Next, the samples were loaded onto a 1 mm thick, 7.5% polyacrylamide gel and separated at 90 V over 2 hrs using a Mini-Protean II system (BioRad). As a general detection of carbohydrate presence, the purified proteins were subjected to Periodic Acid Schiff (PAS) staining. In this method, periodic acid is employed to oxidize glucose residues, leading to the formation of aldehyde functional groups. Schiff reagent is a soluble preparation of decolourized basic fuschin that reacts with aldehydes to form a magenta precipitate. For this procedure the PAGE gel was first washed in a solution of 40% (v/v) methanol and 7% (v/v) acetic acid overnight at 4°C. The gel was then incubated in the dark with a mixture of 1% (v/v) periodic acid and 7.5% (v/v) acetic acid for 1 hr. The gel was then washed 6 x 10 mins with an aqueous solution of 7.5% (v/v) acetic acid before incubation with prepared Schiff’s reagent (200 mM HCl, 0.5% (w/v) basic fuschin, 1% (w/v) sodium metabisulphate) in the dark for 1 hr at 4°C. Lastly, the gel was washed two times with an aqueous solution of 0.5% (w/v) sodium metabisulphate and preserved in a solution of 7.5% (v/v) acetic acid. For Western blots, the proteins were wet-transferred to a nitrocellulose blot membrane (BioRad) at 90 V over 90 mins using a Mini Protean II system. The blot was blocked for 2 hrs 57  with 1% (w/v) skim milk powder and 0.05% (v/v) Tween 20 in Tris-buffered saline (50 mM TrisHCl, 150 mM NaCl, pH 8). Immunoblotting was conducted using a biotinylated version of the pan anti-CD43 S11 mAb (rat IgG2a) that was sourced from Dr. J Kemp (University of Iowa) and has been described previously [244]. Alternatively, a goat-anti-human IgG(Fc) antibody, conjugated to HRP (Zymed), was used to detect the Fc domain of the CD43-Fc protein. All antibodies were diluted at 1:1000 in blocking buffer, and an anti-biotin(HRP) secondary antibody (Cell Signaling) was used to detect the S11 antibody. Visualization of identified proteins was achieved via a HRP-catalyzed reaction of chemiluminescent substrate (Sigma) and exposure of the blot membranes to X-OMAT scientific imaging film (Kodak). Sialic acid presence on the CD43-Fc proteins was evaluated indirectly by treating the CD43-Fc proteins with a sialidase (neuraminidase) derived from either Vibrio cholerae (Calbiochem) or Clostridium perfringens (Sigma) and comparing the size of these enzymetreated proteins with untreated proteins. Cleavage of sialic acid residues was performed by exposing separate preparations of Protein A-Dynabead® (Invitrogen) immobilized CD43-Fc proteins to 1 U mL-1 of sialidase, which was solubilized in PBS (pH 6.0). Enzymatic cleavage of sialic acid residues was allowed to occur over 30 mins at 37°C. Afterwards, the Protein ADynabeads® (with CD43-Fc) were washed two times with PBS (pH 7.2) and the CD43-Fc proteins were released with acidic glycine buffer as described earlier. The loss of sialic acid residues was evaluated through an alteration in the migration pattern during non-reducing PAGE. 2.2.4 CD43-Fc association with M. tuberculosis bacilli and capsule The ability of the CD43-Fc chimeric proteins to interact with the surface of M. tuberculosis was evaluated using a whole-bacteria ELISA.  M. tuberculosis was grown from 58  frozen stock as a static culture for 4 days in PB&T medium at 37°C and 5% CO2. Bacteria were pelleted for 3 min at 500 x g, washed with PBS and then resuspended via syringe passage in 0.25 M carbonate buffer (pH 9) to facilitate their adherence to 96-well CoStar RIA plates (Corning, NY). A 1% (w/v) BSA (Fisher Scientific) solution in carbonate buffer was used as a negative control. Wells were blocked with 1% (w/v) BSA + 0.05% (v/v) Tween 20 in PBS for 1 hr prior to the addition of blocker + CD43-Fc, or blocker alone, for 1 hr. The wells were then washed (PBS + 0.05% (v/v) Tween 20) 3x before the addition of goat-anti-hIgG(Fc), conjugated with alkaline phosphatase (AP) (1:1000), diluted in blocker, for 1 hr. Finally, the wells were washed 3x and AP substrate (Sigma) was added to the wells for 30 min prior to measuring absorbance at 405nm with a spectrophotometer. 2.2.5 Affinity chromatography Protein A-Dynabeads® (2.8 µm magnetic polystyrene beads conjugated with Protein A) were employed as a means of immobilizing the CD43-Fc proteins onto a solid support. Prior to each solution exchange, the Protein A-Dynabeads® were sequestered using a Dynal magnet (Invitrogen). As Protein A binds the Fc domain of the chimeric protein, the CD43 domain should be oriented away from the bead and should be accessible to functional bacterial ligands. Using a 1.5 mL polypropylene tube (Sarstedt), 50 µL of washed Protein A-Dynabeads® were mixed with 100 µL of a 50 µg mL-1 CD43-Fc solution (in PBS) for 30 mins at 4°C. Binding of the CD43-Fc proteins to the Protein A-Dynabeads® was confirmed by assessing the absence of CD43-Fc in the soluble phase after 30 mins. The Protein A-Dynabeads® with immobilized CD43-Fc were then washed 2x with PBS prior to the introduction of 200 µL of a 300 µg mL-1 M. tuberculosis soluble capsule solution (dissolved in PBS). This mixture was incubated for 1 hr on a rotator at 4°C. Afterwards, the CD43-Fc + Protein A-Dynabeads® were washed 3x with 59  500 µL PBS for 10 min each on a rotator at 4°C. Lastly, bound proteins were eluted from the Protein A-Dynabeads® using 25 µL of a PAGE denaturing buffer (200 mM Tris-HCl, 0.5 M sucrose, 10% (w/v) SDS, 0.01% (w/v) EDTA, 0.01% (w/v) bromophenol blue, and 1% (w/v) methionine) and heating to 65°C for 10 mins. Eluted proteins were evaluated using standard PAGE analysis with silver stain. 2.2.6 Mass spectrometry analysis of affinity chromatography eluate The most prominent bacterial protein band (~60kD) present after the CD43-Fc affinity chromatography procedure was identified via MS analysis. To prepare this protein sample, the final affinity chromatography eluate was again separated via PAGE; however the proteins were visualized with the MS-compatible SYPRO Ruby stain (Invitrogen). In brief, the gel was fixed with 50% (v/v) methanol + 7.5% (v/v) acetic acid for 15 min, and then the gel was immersed in SYPRO Ruby stain and microwaved for 3 x 30 sec before incubating for an additional 30 mins on an orbital shaker. The stained gel was then washed with a solution of 10% (v/v) methanol + 7.5% (v/v) acetic acid. Visualization of protein banding was conducted with the use of a UVtransilluminator (UVP, Upland, CA) and bands of interest were excised with a clean scalpel and forwarded to the Genome BC Protein Centre (University of Victoria, BC). The samples were then analyzed by MS as described in section 2.1.7. 2.2.7 Detection of capsule-associated Cpn60.2 and DnaK Cpn60.2 and DnaK were identified in M. tuberculosis capsule preparations by Western blot. In brief, syringe-dispersed capsular material was dissolved at 10 mg mL-1 in PBS, and then mixed 1:1 (v/v) with PAGE sample buffer containing 2% (v/v) β-mercaptoethanol). Capsular protein was loaded onto a 1 mm thick, 10% polyacrylamide gel and separated at 90 V over 2 hrs 60  using a Mini-Protean II system (BioRad). Proteins were transferred to a nitrocellulose blot membrane (BioRad) at 90 V over 90 mins. The blot was blocked for 2 hrs with 1% (w/v) skim milk powder and 0.05% (v/v) Tween 20 in Tris-buffered saline (50 mM TrisHCl, 150 mM NaCl) (pH 8). Cpn60.2 was detected with mAb IT-70 (1:500) and DnaK was detected with mAb IT-41 (1:2000), both acquired through the NIH/NIAID TB Resource Contract (HHSN266200400091c).  Secondary detection was made using HRP-conjugated goat-anti-  mouse antibody (1:2000) (Jackson Immunoresearch, West Grove, PA).  Chemiluminescent  substrate (Sigma, St.Louis, MO) and XAR plain film (Kodak, Rochester, NY) were used to detect identified proteins. Additionally, the protein bands aligned with the expected molecular weights of both Cpn60.2 and DnaK on PAGE were excised and analyzed by MS at the University of Victoria (BC). The methods used for the MS procedure are described in section 2.1.7. For detection of surface-localized Cpn60.2 and DnaK, M. tuberculosis was grown from frozen stock as a static culture for 4 days in PB&T medium at 37°C and 5% CO2. Bacteria were pelleted for 3 min at 500 x g, washed with PBS and then resuspended via syringe passage in 0.25 M carbonate buffer (pH 9) to facilitate their adherence to 96-well CoStar RIA plates (Corning, NY). A 1% (w/v) BSA (Fisher Scientific) solution in carbonate buffer and an appropriate IgG isotype (not shown) were used as negative controls. Wells were blocked with 1% (w/v) BSA + 0.05% (v/v) Tween 20 in PBS. Cpn60.2 was detected with mAb IT-70 (1:500) and DnaK was detected with mAb IT-41 (1:2000). Bound antibody was detected with APconjugated goat-anti-mouse antibody (1:2000) (Sigma). AP substrate (Sigma) was used to observe colour development and plates were read spectrophotometrically at 405nm.  61  For fluorescence-based analysis of surface-localized Cpn60.2 and DnaK, the washed bacilli were mixed with an immobilizing solution containing 1% (w/v) BSA and 4% (v/v) formaldehyde. This mixture was then applied to the surface of a glass slide and allowed to dry, creating an immobilized sheet of bacteria upon the slide. The primary antibodies used were the same as for the bacterial ELISA (see above); however, a goat-anti-mouse (Alexa Fluor 488) fluorescent secondary antibody was used at 1:500 dilution (Invitrogen). All antibodies used were mixed with 1% (w/v) BSA and 0.05% (v/v) Tween 20 in PBS. 2.2.8 Cpn60.2 and DnaK binding to the macrophage surface Confirmation of the capacity of Cpn60.2 and DnaK to bind directly to the MΦ surface was investigated using coverslip-adhered murine BMMΦ that were washed with cold PBS and kept cold throughout the procedure to minimize fluorescent protein uptake via pinocytosis. First, the MΦ received a 10 min blocking treatment with 1% BSA (w/v) in PBS. After blocking, 5 µg mL-1 of Alexa Fluor 488 fluorescently-labeled recombinant Cpn60.2 or DnaK, mixed with 1% (w/v) BSA in PBS, was incubated with the cells for 10 min. The MΦ were then washed with PBS to remove unbound fluorescent protein and the cells were fixed with 4% (v/v) formaldehyde in ethanol.  The coverslips were mounted onto slides using ProLong Gold  mounting adhesive coupled with DAPI nuclear stain (Invitrogen). 2.2.9 Flow cytometry The ability of fluorescently labeled Cpn60.2 and DnaK to bind to the surface of CD43+/+ and CD43-/- BMMΦ was assessed using flow cytometric analysis. Seven-day differentiated BMMΦ were chilled over ice and washed with cold RPMI + 10% (v/v) FCS before being gently detached from the plastic surface of a T25 tissue culture flask (BD Falcon) using a cell scraper 62  (BD Falcon). Collected cells were spun down (1000 x g for 10 min at 4°C) and resuspended in RPMI + 10% (v/v) FCS. They were counted in a haemocytometer and were found to be >95% viable, as assessed by trypan blue exclusion. Keeping cells at 4°C throughout the procedure, groups of 5 x 105 cells were resuspended in FACS buffer (PBS + 10% (v/v) FCS) with either 5 µg mL-1 of Alexa Fluor 488-labeled Cpn60.2, 10 µg mL-1 of Alexa Fluor 488-labeled DnaK, or no mycobacterial protein. A higher concentration of DnaK was employed as the moles of Alexa Fluor 488 dye per protein, were lower for DnaK than Cpn60.2. After incubation in the dark for 10 min at 4°C, the cells were spun down, the supernatant was discarded, and the cells were washed 2x with binding medium (138 mM NaCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 2.7 mM KCl, 0.6 mM CaCl2, 1 mM MgCl2, and 5.5 mM D-glucose [242]) before final resuspension in FACS buffer. Surface binding of the fluorescently-labeled bacterial proteins was assessed immediately using a FACScalibur Flow Cytometry system (BD) and counting 10,000 events per sample. 2.2.10 Saturation binding ELISA Using 96-well CoStar RIA polystyrene plates, 0.1 µg of Protein A in 50 µL was first adsorbed within both test and control wells. The wells were then blocked with 5% (w/v) BSA and 0.1% (v/v) Tween 20 in PBS before the introduction of 0.1µg of CD43-Fc in blocking solution to allow CD43-Fc to become immobilized via Protein A. Recombinant Cpn60.2 at indicated concentrations was diluted with blocking agent prior to incubation with the Protein Aimmobilized CD43-Fc. After several washes with 0.1% (v/v) Tween 20 in PBS, bound Cpn60.2 was detected with an anti-tetra-His antibody (QIAGEN) (1:1000) followed by addition of an anti-mouse-AP secondary antibody (Jackson Immunoresearch, West Grove, PA) and colorimetric detection with AP substrate and reading absorbance at 405 nm. Control wells 63  showing background binding of Cpn60.2 to adsorbed Protein A were subtracted from the experimental values prior to processing data for graphing and statistical analyses. 2.2.11 Glycan array analysis To evaluate whether Cpn60.2 and/or DnaK exhibit lectin-type binding activity, we employed the use of a printed Glycan Array (version 3.0) developed by the Centre for Functional Glycomics (CFG). This array is comprised of 320 glycans arranged in replicates of six that are printed onto N-hydroxysuccinimide (NHS)-activated glass microscope slides to form covalent amide linkages. Initially we tested the ability of Alexa Fluor 488-labeled Cpn60.2 to bind to this array, and subsequent tests were made with fluorescently-labeled anti-penta-His and anti-tetra-His antibodies (QIAGEN) to detect the presence of (His-tagged) Cpn60.2 and DnaK on the array. In each case, 200 µg mL-1 of recombinant Cpn60.2 or DnaK were diluted in PBS binding buffer (PBS + 1% (w/v) BSA + 0.05% (v/v) Tween 20). For each assay, 70 µL of Cpn60.2 or DnaK were incubated on the array under a cover slip in a dark humidified chamber for 1 hr. Specific binding to individual glycans was measured using relative fluorescence units (RFU). 2.2.12 Imaging Microscopy-based evaluation was conducted using a Leica DM4000 fluorescenceequipped microscope with an L5 band pass filter cube having an excitation range of 460-500 nm and an emission range of 512-542 nm, under oil-immersion conditions. Images were captured using a Qimaging Retiga 1300i digital camera and image processing was completed using both OpenLab (Improvision, Waltham, MA) and Photoshop CS2, version 9.0 (Adobe, San Jose, CA).  64  PAGE gels and Western blot films were scanned using an Agfa Arcus 1200 flatbed scanner with Agfa Fotolook software, version 3.50, at 300dpi. 2.2.13 Statistical analyses Unless indicated otherwise, data are expressed as mean ± standard error of the mean (SEM). When applicable, the Student's two-tailed t-test for independent means was performed. Also, non-linear regression calculations based on single-site binding were employed to generate a best fit saturation curve as well as Bmax and KD values for Cpn60.2 binding to CD43. All statistics were processed using GraphPad Prism, version 4.01 for Windows, (GraphPad Software, San Diego, CA)  65  Chapter 3 - M. tuberculosis Capsular Proteins Mediate Macrophage Association (* The results described in sections 3.3.2 and 3.3.3 were completed by technicians Lisa Thorson and Dan Doxsee of the Stokes’ laboratory. These results are published in Hickey et al (2009) [245] and are included here as they provide important groundwork for the subsequent thesis research.) 3.1 Introduction When a M. tuberculosis bacillus comes in contact with a MΦ, interactions occur between surface elements on each cell that dictate the following course of events (e.g. binding and phagocytosis). Thus, mycobacterial ligands involved in the attachment of M. tuberculosis to the MΦ must be accessible on the surface of the bacterium. The layer of material that covers the surface of M. tuberculosis is referred to as the capsule and material from the capsule can be isolated through mechanical extraction methods without lysing the bacteria [103,219]. It has been shown that mechanical removal of capsular material from M. tuberculosis results in a tenfold increase in bacterial binding to MΦ, suggesting that the capsule can act as an antiphagocytic barrier that limits the interaction of M. tuberculosis with MΦ [219]. However, even though the capsule reduces binding of M. tuberculosis to MΦ, it does not eliminate it and it is clear that at least some bacteria maintain the capacity to bind to MΦ. These observations, along with earlier studies showing that only certain populations of MΦ efficiently bind M. tuberculosis [69,218], suggest that the M. tuberculosis capsule modulates the interaction of bacteria with host cells, preventing uptake by some populations of MΦ and directing the bacteria to specific MΦ types or particular receptor-ligand interactions. Based on reports of several different MΦ receptors being involved in the recognition and uptake of mycobacteria, 66  there are likely multiple bacterial ligands involved in these interactions (see sections 1.4 and 1.6, respectively).  Early studies by the Stokes’ group showed that the addition of isolated M.  tuberculosis capsule to cultured MΦ reduces the subsequent association of M. tuberculosis bacteria in a dose-dependent manner. This finding suggests that bacterial ligands necessary for MΦ binding and uptake are found within the capsule. As the capsule of M. tuberculosis contains carbohydrate, lipidic and proteinacous compounds, it was not known which of these compounds were involved in the interaction of M. tuberculosis with MΦ in the context of binding and uptake.  3.2 Rationale The overriding hypothesis of this thesis is that M. tuberculosis contains ligand(s) that bind directly to CD43. The process of evaluating candidate ligands can therefore be made more efficient by determining which class of organic compounds (i.e. carbohydrate, lipid, or protein) most likely contains ligands for CD43. Once this information is known, the analysis methods for identifying candidate CD43 ligands can be chosen more appropriately.  3.3.1 The M. tuberculosis capsule contains adhesins for macrophage binding The effect of capsular material on the binding and uptake of M. tuberculosis to human macrophage-like THP-1 cells and murine BMMΦ, alveolar MΦ, and peritoneal MΦ in the absence of serum (non-opsonic association) was tested. It was determined that pretreatment of all MΦ types with capsule resulted in a dose-dependent reduction of subsequent bacterial association (Figure 3). The capsule-mediated inhibition of bacterial association was evident 67  through microscopic counts as both a reduction in the percentage of the MΦ population binding at least one bacillus (Figure 3A,B,C) and as a reduction in the average number of bacteria bound by any given MΦ (Figure 3A,C). Furthermore, CFU-based analyses of bacterial association with BMMΦ also showed a dose-dependent reduction of viable bacterial numbers in the presence of capsular material (Figure 3D). At higher concentrations of capsule (≥1 mg mL-1), microscopic examination of monolayers revealed some rounding of the MΦ but enumerating cell density of the monolayers showed that no significant cell loss had occurred [245]. 3.3.2 Capsule-mediated inhibition of M. tuberculosis uptake is not due to a global inhibition of macrophage particle binding Though the dose curves (Figure 3A,C) suggested that the capsule acted by competitive inhibition, it was possible that the capsule was having a global effect on the ability of MΦ to bind particles. We therefore investigated the effect of capsule on the binding of other particles (Figure 4A).  Capsule from M. tuberculosis significantly inhibited the binding of M.  tuberculosis and zymosan particles (P < 0.05 when compared to untreated control MΦ) but had no affect on the binding of latex, IgG-coated sheep erythrocytes (EIgG), or complement coated sheep erythrocytes (EIgMC) (P > 0.05 when compared to untreated control MΦ) demonstrating that capsule-mediated inhibition is not the result of a generalized inability of treated MΦ to bind other particles. 3.3.3 The inhibitory component of the capsule is proteinaceous To initiate the identification of the moiety(ies) within capsule that mediate competitive inhibition of M. tuberculosis binding to MΦ, we separated the capsule into a chloroform soluble fraction (lipids) and a methanol/water soluble fraction (carbohydrates and proteins).  The 68  chloroform soluble fraction of capsule did not reproduce the inhibition observed with unfractionated capsule whereas the methanol/water soluble fraction did (Figure 4B). Mixing the two fractions together also reproduced the inhibitory activity of unfractionated capsule (Figure 4B). The water-soluble components were investigated further. Glycans make up the major component of capsule and have been previously suggested to act as ligands for the binding of M. tuberculosis to CR3. We tested the ability of the two major glycans of the capsule, glucan and AM, to inhibit the binding of M. tuberculosis (Figure 5A). Neither purified glycan had any significant effect on the binding of M. tuberculosis to MΦ even at 5 mg mL-1 (P > 0.05 compared with controls). In addition, neither glycan inhibited the binding of zymosan, EIgG or EIgMC (data not shown). Partially purified capsular proteins were able to inhibit the binding of M. tuberculosis to MΦ at comparable levels as that seen for whole capsule, while protease treatment of the purified proteins abrogated their ability to inhibit binding (Figure 5B).  3.4 Discussion and summary Our results demonstrate that elements of the mycobacterial capsule play an important role in the interaction of M. tuberculosis with MΦ. We found that soluble M. tuberculosis capsule has the capacity to inhibit M. tuberculosis bacterial association with MΦ in a dose dependent manner and this was not due to a global inhibition of MΦ binding/uptake (Figure 3 & 4). This reduction in cellular association was evident through both microscopy counts of bacterial association with the MΦ and in the number of viable bacterial CFU present (Figure 3). Competitive inhibition studies with whole capsule indicated that at least one moiety within the 69  capsule was mediating binding of M. tuberculosis to a variety of MΦ types. Crude fractionation of the capsule suggested that the inhibitory moiety was not a lipid and was not glucan or AM, but was proteinaceous (Figure 4B & 5). It is noted that we were unable to achieve complete inhibition of binding of M. tuberculosis to MΦ through the addition of capsule. At higher concentrations, capsule caused the MΦ to ‘round up’, an indication of either toxicity or interference with the means by which the MΦ maintains its binding to the solid support. Our finding that monolayer density and MΦ viability were unaffected by capsule indicated that toxicity was not the explanation for the rounded morphology observed. The rounding up of the MΦ was possibly due to competitiveinhibition of the receptors mediating the attachment and spread of the phagocytes on the support surface (glass coverslips or tissue culture-treated polystyrene) as can be seen, for instance, using antibodies against CR3 [246]. Our results demonstrating that capsule did not have a general effect on the ability of MΦ to bind other particles as diverse as latex beads, EIgG and EIgMC, further indicates that the activity of capsule was not through toxicity to the MΦ or through a global inhibition of phagocytic pathways. That capsule could also inhibit the binding of zymosan (a yeast cell wall preparation containing high levels of glucan and lesser amounts of mannan and protein) could be due to M. tuberculosis and zymosan sharing a receptor. Zymosan is thought to bind to CR3 [247] which M. tuberculosis also binds non-opsonically [69]. However, more recent studies suggest that nonopsonic binding of zymosan is independent of CR3 and is mediated by Dectin-1 [108] though, again, Dectin-1 is involved in the interaction of mycobacteria with macrophages [106]. Alternatively, it could be that different components of the capsule inhibit the binding of the two particles.  It was interesting to note that mycobacterial glucan and AM did not inhibit the 70  binding of zymosan to MΦ, presumably due to the differences in the glycan structures. Mycobacterial glucan is an α(1-4/1-6) glucan whereas that of zymosan (derived from Saccharomyces cerevisiae) is a β(1-3/1-6) glucan. Our studies showed that mycobacterial glucan and AM, the two most prevalent glycans in the capsule of M. tuberculosis [103,213,248], did not inhibit the binding of M. tuberculosis to MΦ even at ten times the concentration that capsule was able to inhibit binding. Previous studies had indicated that mycobacterial glucan could inhibit the binding of M. tuberculosis to CR3 [75], indicating that glucan was the ligand mediating this binding. An explanation for the significant difference between our results and the previous studies may reside in the fact that the earlier studies were performed with CHO cells transfected with CR3 which may not truly reflect the way a MΦ interacts with mycobacteria. Moreover, many unrelated compounds such as αglucan, β-glucan, mannan and N-acetylglucosamine were shown to mediate the inhibition of M. tuberculosis to the transfected cells [75]. This is hard to reconcile with a specific receptorligand interaction. It has been shown that surface-exposed mycobacterial PIM and polar glycopeptidolipid (phenolphthiocerol dimycocerosate) participate in the receptor-dependent internalization of M. smegmatis by human MΦ [249,250].  PIM has also been shown to mediate binding of  mycobacteria to endothelial cells [225]. Whether capsular glycolipids also play a role in the binding of M. tuberculosis to MΦ remains to be determined. Although we found no evidence for the lipid fraction of our capsule preparations mediating any inhibition of M. tuberculosis binding, the possibility that some polar glycolipids may have been present in the inhibitory aqueous phase (Figure 4B) cannot be discounted.  71  However, in our studies the prominent inhibitory component resided within the capsular protein fraction. This knowledge, paired with the hypothesis that a mycobacterial lectin would be the most likely moiety that would bind a mammalian glycoprotein based on other bacterial adhesion methods [251], directed our subsequent evaluation of candidate M. tuberculosis ligands for CD43 towards a proteinaceous entity.  72  Figure 3: M. tuberculosis capsule inhibits the ability of M. tuberculosis bacilli to bind macrophages Various concentrations of syringed capsule preparation from M. tuberculosis were first added to A) murine peritoneal MΦ, B) alveolar MΦ (Alv), differentiated human macrophage-like THP-1 cells (THP-1), or C) & D) bone marrow derived macrophages (BMMΦ). The subsequent ability of the MΦ to bind and ingest syringed M. tuberculosis bacilli was assessed microscopically (AC), or via CFU enumeration (D). In A-C, association between the bacilli and MΦ was assessed by counting 100 MΦ per coverslip, and each data point shows the percentage of the MΦ population able to bind ≥1 (A & C - solid circle, B - each bar), or >10 (A & C - open circle) bacteria. Each point represents the mean ± SEM from eight (A), two (B) or three (C & D) experiments, each with 2-3 replicate coverslips (* P < 0.05; ** P < 0.01; *** P < 0.001, when compared with the associated control (0 mg mL-1) which received no capsule). For some points in A) & C), the error bars do not exceed the width of the symbol. 73  Figure 4: M. tuberculosis capsule does not cause a global inhibition of macrophage particle binding/phagocytosis and the inhibitory moiety in the capsule is soluble in aqueous solvent A) Capsular material prepared from M. tuberculosis by sonication was added to peritoneal MΦ at a final concentration of 250 µg mL-1 in binding medium (white bars). Control MΦ received binding medium alone (black bars). The subsequent association of syringed M. tuberculosis (TB), latex beads (Latex), yeast zymosan particles (Zym), IgG-coated SRBC (EIgG) or complement-coated SRBC (EIgMC) to these macrophages was assessed microscopically. The association of M. tuberculosis is expressed as the mean ± SEM percentage of the MΦ population able to bind ≥1 bacillus and that of all other particles is expressed as the mean ± SEM number of particles associated with 100 MΦ (Association Index). B) Capsular material prepared from M. tuberculosis by sonication was added to peritoneal MΦ following no treatment (Capsule) or separation into a chloroform soluble component (Organic) and methanol/water soluble component (Aqueous). Control MΦ received binding medium alone (Control) or a mixture of the chloroform soluble component and the methanol/water soluble component (Org + Aq). All capsular components were added at the equivalent of 250 µg mL-1 of whole capsule. The percentage of the MΦ population able to bind ≥1 (black bars) or >10 (white bars) bacteria was subsequently determined by counting 100 MΦ per coverslip. For both A) & B), the mean ± SEM is shown for two experiments, each with 2-3 coverslips (* P < 0.05, ** P < 0.01 when compared to the binding level in the corresponding control group). 74  Figure 5: The water soluble inhibitory moiety within the M. tuberculosis capsule is a protein and not either of the two major capsular glycans A) Arabinomannan (AM) and B) glucan (Gn) purified from M. tuberculosis were added to peritoneal MΦ at a final concentration of 5 mg mL-1. Control MΦ received binding medium alone (Con). The subsequent association of syringed M. tuberculosis to these MΦ was assessed microscopically. The mean ± SEM percentage of the MΦ population able to bind ≥1 bacillus is shown for A) three experiments, each with 2 coverslips, or B) four experiments, each with 2 coverslips. No significant difference in binding was observed. C) Five hundred µg mL-1 of capsule (Capsule) or the TCA-precipitated protein from that same amount of capsule (Protein) was added to peritoneal MΦ prior to adding M. tuberculosis. Control MΦ received binding medium alone (Control) or protein that had been treated with Proteinase K (Digest). The subsequent association of syringed M. tuberculosis to these MΦ was assessed. The mean ± SEM percentage of the MΦ population able to bind ≥1 (black bars) or >10 (white bars) bacteria is shown for two experiments, each with 3 coverslips (* P < 0.05 when comparing treated groups with the corresponding untreated group).  75  Chapter 4: CD43-Fc Binds to Capsular Proteins on the M. tuberculosis Surface 4.1 Introduction Chimeric proteins, also known as fusion proteins, are proteins that have been created through a ‘genetic graft’ of two or more gene segments, which originally functioned to produce separate and distinct gene products. Hence, a chimeric protein may represent a fusion of two or more whole proteins, or may be composed of smaller peptide portions of two of more proteins. In Greek mythology, the “Chimera” was a creature that was formed from multiple animals, deriving benefit from the various components of its makeup. In general, chimeric proteins are designed to follow a similar principle, whereby their component protein domains provide distinct functions. One common reason for creating a chimeric protein is to introduce a means of identifying, capturing, or immobilizing a protein of interest. This process is commonly referred to as ‘protein tagging’.  Perhaps the most common tag which is added to readily identify the  location of a given protein in a biological system is the green fluorescent protein (GFP) tag. Alternatively, many protein tags rely on the ability of a second compound to bind the tag, and in these situations a good tag is one which can be specifically and stably bound by a known binding partner. This latter group are called ‘affinity tags’ and some common options include: Gluathione-S-Transferase (GST), Hemagglutinin (HA), FLAG-tag, Maltose Binding Protein (MBP), Histidine (His), Biotin, and IgG(Fc). Affinity tagging of proteins commonly serves two purposes; it allows for capture and purification of the protein of interest from a complex biological mixture (e.g. a cell lysate or culture supernatant), and also allows for immobilization  76  of the protein of interest to a solid support, which is a common requirement for many studies evaluating interactions between biological molecules. In addition to selecting a tagging method when designing a chimeric protein (although a chimeric protein by definition does not require a tag per se), it is also necessary to select an appropriate expression system that will satisfy the researcher’s needs for both yield and fidelity of the final protein product. That is, does the recombinantly expressed chimera adequately represent the relevant features of the naturally expressed protein(s)?  Attributes such as  enzymatic activity, maintenance of binding sites, and addition of appropriate post-translational modifications (e.g. glycosylation) may be considerations of the researcher.  Commonly,  functional tests of the chimeric protein are necessary to confirm that the recombinant protein reasonably approximates its naturally expressed parent protein(s). Potential expression systems for chimeric proteins include both transformed bacteria and transfected cell lines. While a bacterial expression system normally provides the benefit of a rapid and high yield of recombinant protein, the bacterial machinery for post-translational modifications may not adequately mimick mammalian cell machinery.  As such, expression of mammalian  glycoproteins (e.g. CD43) commonly requires a relevant mammalian cell line for expression. The trade off for appropriately glycosylated proteins is that mammalian expression systems inherently require longer growth times and/or volumes of culture to obtain necessary concentrations of purified recombinant proteins. 4.2 Rationale CD43 naturally exists in two general locations within the host; anchored within the plasma membrane of associated hematopoietic cells, or, in a soluble form within the serum after cleavage of the extracellular domain. Each of these host derived forms of CD43 is difficult to 77  work with in regards to affinity chromatograpy analysis. Purification of unaltered glycoproteins anchored in plasma membranes is prohibitively challenging, and purification of soluble CD43 from serum requires large volumes of donor blood. Also, the genetic variability between human donors and the absence of a defined CD43 immobilization tag add additional challenges to the collection and use of blood-derived CD43 for affinity chromatography work. The challenges described above have been largely circumvented through the use of a recombinantly produced form of CD43 that is expressed in a cell line.  Through this process,  we have developed a form of CD43 that is readily expressed in a myeloid cell line in a soluble form, only contains the relevant extracellular domain of CD43, and contains an Fc tag for predictable immobilization for use in affinity chromatography. A conceptualized structure of CD43-Fc is shown in Figure 6. To ensure that this CD43-Fc chimeric glycoprotein reasonably approximates the naturally expressed form of CD43 found on macrophages, we have completed several lines of analysis to evaluate the relevant characteristics of the final CD43-Fc product.  4.3 Results 4.3.1 Confirmation of Fc domain presence After the supernatant from the NSF60(CD43-Fc) culture was collected (see section 2.1.5) and pooled over several weeks, it was filtered and first moved through a Protein ASepharose column. As Protein A has high specificity for the Fc domain of IgG proteins, the material that specifically bound within this column likely represented proteins from the original supernatant that contain functional hIgG(Fc) domains. Western blot analysis employing anti78  hIgG(Fc) antibody detection confirmed the presence of two bands that existed at the appropriate molecular weight locations of the dimeric and monomeric forms of the CD43-Fc chimeric glycoprotein (Figure 7A). 4.3.2 Confirmation of carbohydrate presence The presence and identity of carbohydrates (glycosylation) on the expressed CD43-Fc glycoprotein was evaluated via three separate means: PAS stain for general carbohydrate presence, WGA binding to indicate the presence of N-acetylglucosamine and/or sialic acid residues, and a sialidase treatment to test for the presence of cleavable sialic acids. 4.3.2.1 Wheat germ agglutinin capture As it was possible that truncated CD43-Fc proteins, without the CD43 domain, were picked up by the Protein A capture procedure, we exposed the Protein A column eluate to a second affinity purification with WGA conjugated to a solid support resin. WGA is a plantderived lectin that has high affinity for GlcNAC residues as well as terminal sialic acids, both of which are found within appropriately glycosylated CD43 oligosaccharides. Thus, the protein that was retained after this second purification step likely contained one or both of these carbohydrate residues. 4.3.2.2 Periodic acid Schiff staining As an additional indication that the purified protein from the two-step purification procedure was of a glycoprotein structure, PAGE separation followed by PAS staining was employed as a non-specific means of confirming the presence of carbohydrate residues. Periodic acid oxidizes glucose residues, thus forming aldehydes that are reactive with Schiff  79  reagent, leading to formation of a magenta stain. As shown in Figure 7B, this analysis resulted in a single band in the appropriate molecular weight range for the monomeric glycoprotein. 4.3.2.3 Confirmation of sialic acid presence To specifically confirm the presence of terminal sialic acid residues on the attached oligosaccharides, we completed two separate sialidase treatments on the affinity purified proteins.  Exposure of the supposed CD43-Fc glycoproteins to either V. cholerae or C.  perfringens derived sialidases resulted in an altered migration pattern of the protein when separated by PAGE. As shown in Figure 7C, when the CD43-Fc proteins were probed with an anti-CD43 mAb (S11), it was found that the desialylated form of CD43-Fc did not migrate as deeply into the acrylamide gel as did the untreated CD43-Fc. While it initially appeared that the molecular weight of the CD43-Fc proteins increased after desialylation, this unique migration pattern has been published previously and is attributed to the overall loss of negative charge, thus limiting the electrophoretic capacity of the PAGE system to induce migration [139,252]. 4.3.3 Antibody-based identification of CD43 epitopes Following from the finding shown in Figure 7C, the fact that anti-CD43 mAb S11 was able to bind the purified glycoprotein products provided additional support that our CD43-Fc chimera contains epitopes specific for CD43. 4.3.4 CD43-Fc binds to proteins present in the M. tuberculosis capsule Based on earlier findings, it was hypothesized that CD43 expressed on the MΦ surface interacts with a surface element of the M. tuberculosis bacillus [135,136]. Thus, we anticipated that our CD43-Fc chimeric protein would interact with mycobacterial bacilli in a similar manner. To test this, we employed a whole-bacteria ELISA strategy, whereby early growth 80  phase bacteria (4 day growth) were adsorbed to polystyrene wells. To reduce the potential of compounds from the culture filtrate (CF) being involved in this ELISA, we first pelleted the bacteria, discarded the soluble CF, and subsequently resuspended the washed bacteria using either syringe- or sonication-dispersion. As shown in Figure 8A, the CD43-Fc proteins showed efficient binding to the wells containing dispersed M. tuberculosis, but not to the BSA control. Furthermore, our detection antibody, anti-hIgG(Fc), showed limited background binding in the absence of CD43-Fc (Figure 8A). This assay also showed that sonication of the bacteria, compared to syringe dispersion, leads to an increased level of CD43-Fc binding within the wells. While we suspected this was due to the more aggressive sonication method ‘revealing’ more surface proteins than syringing, as has been described previously [217], the possibility that sonication resulted in higher numbers of bacilli adsorbing to the well cannot be discounted. As the M. tuberculosis capsule should contain elements that are presented on the surface of the bacterium, we evaluated whether the CD43-Fc proteins were also able to bind to capsular material that was sloughed off the bacteria via syringe passage. In particular, we hypothesized that a capsular protein would be the most likely type of bacterial compound that would interact with a mammalian glycoprotein as previous findings showed that the protein fraction of the capsule contains MΦ adhesins (see section 3.3.3).  Thus, the protein fraction of the M.  tuberculosis capsule was isolated using anion-exchange chromatography (AEC), a technique that helps preserve the native conformation of proteins. The AEC-purified capsular proteins were adsorbed to 96-well polystyrene plates and the binding of CD43-Fc to these proteins was measured using ELISA (Figure 8B). To gain insight into the specificity of CD43-Fc binding to capsular proteins, we digested the capsular proteins with Proteinase K prior to adsorption onto the ELISA plate and evaluated whether CD43-Fc binding was maintained. As shown in Figure 81  8B, protease digestion of the capsular proteins significantly reduced the ability of CD43-Fc to bind to the AEC-derived capsular material, suggesting a full-length, conformational-dependent M. tuberculosis capsular protein(s) mediates binding to CD43-Fc.  4.4 Discussion and summary Prior to employing the constructed CD43-Fc chimera for subsequent assay work, it was important to ensure that necessary components of the CD43-Fc gene product were present; including a hIgG(Fc) domain as well as an appropriately glycosylated extracellular domain of CD43. The presence of the hIgG(Fc) domain was verified via two strategies. First, it can be reasoned that the CD43-Fc proteins must have a viable Fc domain as the initial purification method to pull these proteins from the NSF60 cellular supernatant relied upon the specific binding interaction between Protein A-Sepharose and the Fc domain. However, the presence of a hIgG(Fc) domain was subsequently verified through the use of a Western blot to show that anti-hIgG(Fc) specifically binds to the purported CD43-Fc proteins (Figure 7A). Additionally, the inclusion of the hinge domain of hIgG(Fc), which contains cysteine residues capable of forming disulfide bridges between homologous monomer proteins, accounts for the fact that the CD43-Fc proteins are secreted as dimers which can be made to form monomeric proteins under reducing conditions. We also evaluated components within the CD43 domain of the CD43-Fc chimera. Firstly, the apparent molecular weight of the final CD43-Fc product (~250kD dimer, ~125kD monomer) is in line with the expected weight of a chimeric protein that is composed of the extracellular domain of a myeloid-derived CD43 domain and a hIgG(Fc) domain [240]. 82  Additionally, the final CD43-Fc product contained carbohydrate residues as detected by PAS staining (Figure 7B). This finding was supported by the fact that the CD43-Fc molecules were purified via the use of a lectin, WGA. It is known that WGA shows specific binding to both Nacetyleglucosamine and sialic acid residues, both of which are found within the extracellular domain of CD43.  Additionally, the oligosaccharides localized on CD43-Fc appear to contain  terminal sialic acid residues, as treatment of these glycoproteins with sialidase causes a shift in the migration pattern on PAGE analysis (Figure 7C). It is notable that the ‘loss’ of sialic acid residues from CD43 leads to reduced mobility on PAGE, which is normally associated with an increase in molecular weight. However, this phenomenon has been seen previously with CD43 desialylation, and it is thought that the reduced electrophoretic mobility results from the loss of (negatively charged) sialic acids without a concomitant increase in the number of SDS molecules bound to a given CD43 molecule [139]. Additionally, the purified CD43-Fc glycoproteins were reactive with mAb S11, an antibody that has been shown previously to be reactive with myeloid versions of CD43 that carry both tetra and hexasaccharide oligomers [244]. Also, the results of earlier analyses of the NSF60(CD43-Fc) chimera by their creator, UBC MSc graduate Jeannie Yang (1993) [240], found that the mAb S7, which is specific for the tetrameric oligosaccharide variant of CD43, showed specific binding to the affinity purified protein from NSF60(CD43-Fc) [252,253]. Additionally, mAb 1B11, which is specific for the hexasaccharide variant of CD43 that is produced by Core 2 glycosyltransferase, also showed binding to the affinity purified protein from NSF60(CD43-Fc) [240,252]. Thus, a mixed oligosaccharide population of tetra and hexameric sugars are present on the CD43-Fc chimeric protein, as has been shown on CD43 naturally expressed on the surface of myeloid cells [137]. As such, several lines of analysis 83  provide evidence that the expressed and purified CD43-Fc molecules appropriately mimick the extracellular domain of a myeloid form of CD43 that has been fused with a functional hIgG(Fc) domain. We also confirmed that CD43-Fc proteins have the capacity to bind to the surface of M. tuberculosis bacilli (Figure 8A), which suggests the CD43-Fc mimick the function of MΦexpressed CD43. Additionally, the CD43-Fc proteins were able to bind to proteins purified from the M. tuberculosis capsule Figure 8B. The results of Chapter 3 also showed that the capsular protein fraction contains adhesins necessary for MΦ binding. This knowledge, paired with the hypothesis that a mycobacterial lectin would be the most likely moiety that would bind a mammalian glycoprotein, directed our subsequent evaluation of candidate M. tuberculosis ligands for CD43 towards a proteinaceous entity. This hypothesis was partially validated when it was found that CD43-Fc binding to the M. tuberculosis capsule was maintained when capsular proteins were purified, and largely lost when capsular proteins were protease digested (Figure 8B).  84  Figure 6: Diagram of the CD43-Fc chimera This theoretical structure of the CD43-Fc chimera is based on reports that the extensive sialylation (red hexagons) of the extracellular domain of CD43 confers a rigid linear structure [143]. Also, antibody analysis supports the presence of two oligosaccharide glycoforms (tetraand hexa-), consistent with CD43 expression of myeloid cells [240].  Additionally, the  illustrated Fc domain is shown with the standard disulfide bridge region, including the hIgG hinge region which confers a dimeric structure. (Not to scale) 85  Figure 7: Characterization of the CD43-Fc chimera Purified CD43-Fc glycoproteins were analyzed via multiple methods to evaluate the presence of appropriate molecular domains and glycosylation. A) Western blot employing anti-IgG(Fc) detection of the human Fc domain of CD43-Fc. The location of both the dimeric (upper band) and monomeric (lower band) forms of the CD43-Fc glycoprotein are evident. B) Periodic Acid Shiff stain of reduced CD43-Fc showing the presence of carbohydrate residues on the CD43-Fc structure (right lane). C) Western blot of non-reduced CD43-Fc using the CD43-specific mAb S11. Lane 1 shows the location of native (sialic acid bearing) CD43, while lanes 2 and 3 show the vertical shift that is associated with desialylation after treatment with sialidases from V.cholerae and C. perfringens, respectively. (Molecular weight ladders are shown in the left lanes of B and C).  86  Figure 8: CD43-Fc binds to the M. tuberculosis surface, specifically capsular proteins Purified CD43-Fc glycoprotein was evaluated for its ability to interact with both the surface of M. tuberculosis bacilli as well as elements within the M. tuberculosis capsule. A) Whole bacteria ELISA was employed whereby syringe-dispersed (Syr M.tb) or sonication-dispersed (Son M.tb) bacteria were first adsorbed to polystyrene wells. These wells were subsequently blocked and soluble CD43-Fc was introduced into indicated wells. Alkaline phosphataseconjugated anti-hIgG(Fc) was used to detect the presence of bound CD43-Fc. B) The ability of CD43-Fc to interact with M. tuberculosis capsular proteins (Cap proteins) was evaluated by ELISA. Capsular proteins were purified via AEC and were subsequently digested with Proteinase K (Pr-ase K) before adsorbtion to polystyrene wells and binding was assessed as for A). BSA-based blocker was used for a control (** P > 0.01, *** P > 0.001).  87  Chapter 5: Cpn60.2 and DnaK are Localized on the Bacterial Surface and Bind to CD43Fc in vitro 5.1 Introduction The identification of individual ligand-receptor interactions is a common goal when attempting to understand how two cells interact. Some ligand-receptor interactions are relevant within the context of how a host’s cells interact with one another (e.g. the presentation of antigens from a MΦ MHC receptor to a cognate T cell TCR) while other ligand-receptor relationships exist between cells of different organisms.  The interaction of bacteria with  sentinel cells of the host is a good example of this. It is common in scientific research for each ‘half’ of the ligand-receptor relationship to be discovered at different times. There are multiple methods that can be employed to identify which bacterial ligands interact with binding partners on the MΦ surface, and the effectiveness of each technique needs to be evaluated empirically. Two common methods for identifying ligand-receptor interactions include covalent protein-protein coupling and affinity chromatography. Covalent protein-protein coupling is commonly employed using whole cells (containing an unknown ligand or receptor of interest) and exposing these cells to a suspected ligand or receptor that has been purified in a soluble state. However, this technique can also be completed employing two separate types of cells that are allowed to interact with one another. Using the former strategy, the goal of the procedure is to allow ligation of the purified ligand/receptor to specific sites on the cell surface. Once these interactions have reached a stable level, a chemical is introduced into the system that induces cross-linking reactions between many organic molecules within the system that are in close proximity to one another. As such, there is a reasonable probability that the soluble ligand/receptor of interest will become covalently bound 88  (strongly associated) to its binding partner(s) on the cell surface. To purify the relevant pair(s) of covalently bound molecules, the cells in the system are normally lysed, and the technique of immunoprecipitation (antibody-based precipitation) is employed to purify these relevant pairings. Lastly, the identity of the captured ligand/receptor (originally expressed on the cell surface) can normally be identified by a technique such as Edman degradation or MS. One benefit of the protein-protein coupling technique is that it allows at least one of the proteins in the binding pair to be oriented more naturally, since it is being expressed in its native state on the cell surface.  However, the non-specific nature of the covalent coupling chemistry  commonly produces a ‘messy’ result with both biologically relevant and irrelevant proteins being captured with this strategy. Affinity chromatography is an alternate methodology for identifying ligand-receptor relationships, where again, one of the two binding partners needs to first be identified. Affinity chromatography relies upon the immobilization of one half of the binding pair to a solid support surface. Support surfaces used in this technique commonly include reasonably inert materials such as cross-linked dextran (e.g. Sephadex), cross-linked glucose (e.g. Sepharose), cross-linked agarose, gold (e.g. Biacore surface plasmon resonance (SPR) chips) or polystyrene (e.g. Dynabeads®), each of which needs to be ‘activated’ with some type of functional group (e.g. RCOOH). Immobilization of the known ligand/receptor to the solid support surface then relies upon a coupling chemistry with the functional group. The simplest method of immobilization is a bonding of the unaltered purified protein directly to the solid support surface. While this direct-binding technique can work for some proteins, there is the potential for the biological binding site(s) on the immobilized protein to become compromised due to steric hindrance effects resulting from the close association of the protein with the solid support. If this is a 89  problem, the introduction of extension compounds can be introduced to increase the separation between the solid support and the protein, or, an intermediary protein can be introduced into the system. Intermediary proteins used in this capacity are often one of two protein classes; antibodies or tag-binding proteins. Immobilized antibodies are a common choice as their broad capacity for specificity allows them to be customized for the specific capture of nearly any type of protein. Additionally, the protein to be captured need not be in a pure state to begin with, as the antibody specificity allows for the protein of interest to be purified from a cell lysate or other biological mixture and be captured on the solid support surface in a single step. Tag-binding proteins, as defined in this work, include a variety of proteins that specifically bind to a range of common protein tags (described in section 4.1). Examples of tagbinding proteins include (binding partners in parentheses): Streptavidin (Biotin), Hemagglutinin Binding Protein (Hemagglutinin), Glutathione (Glutathione-S-Transferase) and Protein A (Fcdomain of IgG). As their name indicates, the choice of a tag-binding protein as an intermediary protein in an affinity chromatography scheme normally requires the molecular engineering of the ligand/receptor of interest. However, the additional preparation time that goes into the production of a recombinantly-tagged ligand/receptor provides the researcher a predictable means of immobilization, with the issues of steric hindrance being limited, and often a greater density of ligand/receptor can be immobilized on a molar basis because many tag-binding proteins have multiple binding sites for the tagged-protein. However one chooses to immobilize a ligand/receptor of interest, the basic sequence of events in affinity chromatography is straightforward: 1. Solid support material is washed and equilibrated. 90  2. Known receptor (for example) is immobilized onto the solid support in a pure form. 3. Biological mixture containing suspected ligand(s) is mixed with the immobilized receptor. 4. Compounds remaining in the soluble phase are washed away from the solid support and weakly adhered proteins are released through additional washing steps. 5. The final introduction of an eluting solution (commonly containing chaotropes, detergents, high ionic strength, or chelating agents) is used to release one or both of the ligand/receptor binding pair. 6. Identification of compounds bound from the original biological mixture can be made using standard protein identification techniques. 5.2 Rationale Published evidence suggests the extracellular domain of CD43 has the capacity to bind moieties present on the surface of mycobacteria [135,136]. It was therefore hypothesized that relevant mycobacterial ligands for CD43 could be identified if an appropriate experimental system was designed.  The CD43-Fc chimeric glycoproteins described in Chapter 4 were  therefore immobilized on an affinity chromatography format employing Protein A-Dynabeads® along with soluble M. tuberculosis capsule as a source of candidate ligands to interact with CD43. Capsule was chosen as it is the outermost layer of the mycobacterial cell wall.  91  5.3 Results 5.3.1 Capture of candidate M. tuberculosis ligands for CD43 using affinity chromatography To identify the proteinaceous ligand(s) within the M. tuberculosis capsule that are able to specifically interact with CD43-Fc, we used an affinity chromatography system. CD43-Fc (the ‘bait’) was immobilized to the surface of Protein A-Dynabeads®.  Whole capsule was  solubilized in PBS and added to the prepared Protein A-Dynabeads®. After washing away unbound and weakly adhered capsular components, bound proteins were eluted using SDS and heating and were analyzed by PAGE (Figure 9A). There was negligible background binding of the capsular material to the Protein A-Dynabead® support medium, however Protein ADynabeads® with immobilized CD43-Fc strongly bound one capsular protein (Figure 9A, white arrow) along with other proteins that associated with CD43-Fc in lesser quantitites (e.g. Figure 9A, black arrow). This result was repeated three times using different batches of both M. tuberculosis capsule and CD43-Fc and the single prominent protein band was reproduced each time. 5.3.2 Mass spectrometry identification of candidate proteins To identify the most abundant capsular protein that bound to CD43-Fc, we excised the single band of interest and analyzed it using MS. The protein was identified from two separate affinity isolations as Cpn60.2 (Hsp65, GroEL, UniProt accession number P0A520). The MS identified 9 unique peptide sequences with ion scores >49, each of which indicated extensive homology (P < 0.05) with Cpn60.2. It is notable that the M. tuberculosis 60kD chaperonin homologue, Cpn60.1, was not identified in the MS analysis. Attempts to identify a second, less 92  prominant M. tuberculosis protein (Figure 9A, black arrow), were unsuccessful as we were not able to obtain this second protein in sufficient quantity for SYPRO Ruby staining. 5.3.3 Western blot analysis of mycobacterial proteins bound during affinity chromatography During an initial evaluation of the proteins that were eluted after affinity chromatography it was noted that both of the protein bands described in section 5.3.1 showed very strong levels of antibody binding when they were incubated with a polyclonal anti-M. tuberculosis capsule antisera using Western blot (Figure 9B). This result suggested that each of these proteins were highly immunogenic, consistent with the known immunogenicity of Cpn60.2 [254]. Additionally, DnaK (Hsp70) is highly immunogenic [254], and has a molecular weight of 67 kD, in the appropriate molecular weight range of the unknown protein band that was unsuccessfully visualized via SYPRO Ruby staining. To further investigate the identity of the two proteins, mAbs raised against Cpn60.2 (mAb IT-70) and DnaK (mAb IT-41) were used to probe Western blots of affinity purified capsular proteins. The results in Figure 9C confirmed the dominant band as Cpn60.2 and identified the weaker band as DnaK. 5.3.4 Two-dimensional polyacrylamide gel electrophoresis of M. tuberculosis capsule proteins In order to gain a general understanding of the diversity of proteins in the capsule, as well as the relative mass contributions of Cpn60.2 and DnaK, we performed a high resolution 2D-PAGE analysis of the M. tuberculosis capsular proteome. For this analysis, syringe-derived capsule was employed and the protein fraction of the capsule was semi-purified via the use of TCA and acetone extractions. The results from this analysis demonstrated that the capsule of M. 93  tuberculosis contains over 200 different protein species (Figure 10). Using published 2D-PAGE protein maps from the Statens Serum Institute (http://www.ssi.dk/sw14644.asp) and Max Planck Institute for Infection Biology (http://www.mpiib-berlin.mpg.de/2D-PAGE/) as references, the prominent 60kD and 70kD protein regions appeared to be in the appropriate molecular weight and pH range (4.5-5.0) to be the Cpn60.2 and DnaK protein species. If accurate, it is notable that both Cpn60.2 and DnaK represent a significant proportion of the protein presence found within the M. tuberculosis capsule. 5.3.5 ELISA detection of Cpn60.2 and DnaK on M. tuberculosis bacteria We next evaluated whether Cpn60.2 and DnaK were present on the surface of M. tuberculosis bacilli.  To evaluate this question, we employed M. tuberculosis bacilli from an  early in vitro growth phase (4 days), when bacterial autolysis has been shown to be minimal [255]. The soluble CF fraction was reserved before the bacilli were washed and resuspended via syringe passage. Whole-bacteria ELISA, using the mAbs IT-70 and IT-41, were then performed to evaluate whether Cpn60.2 and/or DnaK, respectively, could be detected on the surface of M. tuberculosis bacilli. As shown in Figure 11, Cpn60.2 and DnaK were found to be present in significant levels on the surface of M. tuberculosis bacilli (P < 0.05 & P < 0.001 compared to BSA control, respectively).  When the sloughed material (M. tuberculosis capsule) from  syringe-dispersion was analyzed (Figure 11A and B), it was found that significant amounts of soluble DnaK were released (P < 0.01 when compared to BSA control), whereas soluble Cpn60.2 was not detected in significant levels (P > 0.05 when compared to BSA control). Notably, the 4 day CF of bacteria prior to syringing did not contain significant levels of these proteins (Figure 11A and B) (P > 0.05 when compared to BSA control), supporting the  94  contention that the presence of Cpn60.2 and DnaK in the capsule was not due to its absorption from the CF. 5.3.6 Immunofluorescent detection of Cpn60.2 and DnaK on the surface of M. tuberculosis The described ELISA findings were supported by fluorescence microscopy analysis of whole bacteria, whereby the surface localization of the IT-70 and IT-41 mAbs on individual bacteria was demonstrated (Figure 11C).  Taken together, these findings show that M.  tuberculosis bacilli from short-term culture have both Cpn60.2 and DnaK on their surface, and Cpn60.2 predominantly remains associated with the bacterial surface after syringe dispersion while DnaK has a greater propensity to be released from the bacterial surface into the surrounding environment.  5.4 Discussion and summary The findings of Chapter 3 showed that the protein fraction of the M. tuberculosis capsule contains adhesins necessary for MΦ binding. The findings of Chapter 4 demonstrated that recombinant CD43-Fc appropriately mimicks naturally expressed myeloid CD43, and CD43-Fc binds to surface of M. tuberculosis, specifically to capsular proteins.  Thus, even though  unfractionated (whole) capsule was incubated with Protein A-immobilized CD43-Fc, we felt confident limiting our initial analyses of CD43-bound bacterial compounds to proteins. PAGEbased evaluation of mycobacterial proteins that had specifically bound to CD43-Fc showed that comparatively few proteins associated with CD43-Fc within the affinity system, and there was a negligible amount of background binding to the Protein A-Dynabead® support. Of the few proteins that appeared to bind CD43-Fc directly, one protein of ~60kD showed a dominant 95  presence with regards to its density on PAGE analysis. The high concentration of this ~60kD protein was sufficient for MS analysis, and it was subsequently identified as the Cpn60.2 protein. Moreover, when analyzing the mycobacterial proteins that bound to CD43-Fc with anti-capsule antisera on Western blot, it was apparent that two of the captured proteins were very immunogenic. While the Cpn60.2 protein is known to be immunodominant, the higher molecular weight protein appeared to be localized around 70kD where another immunodominant protein, DnaK, is normally found. This hypothesis was tested with an antiDnaK mAb, and the resultant single band suggests that mycobacterial DnaK has the capacity to bind CD43, albeit with an apparently lesser ability than Cpn60.2. While our initial observation of the capsular localization of what are classically considered to be cytosol-associated molecular chaperones [256] was unexpected, we found we were able to routinely produce capsular material that lacked indicators of bacterial lysis (as assessed by release of the cytosolic enzyme, ICD [219]) but contained significant quantities of both Cpn60.2 and DnaK. Indeed, both Cpn60.2 and DnaK have been found in the ‘cell wall’ fraction of M. tuberculosis [257], lending support to the notion that these proteins can naturally transgress the plasma membrane. Of interest, the absence of zinc in bacterial culture medium has been found to cause the efficient release of Cpn60.2 from M. tuberculosis [258]. The means by which these molecular chaperones (and many other cell wall and culture filtrate proteins) exit the mycobacterial cytosol are not currently understood. Our demonstration that Cpn60.2 and DnaK could not be detected in the CF of short-term cultured bacteria (Figure 11A and B) suggests that their surface presence is not dependent on non-specific mechanisms such as release during autolysis, followed by surface adherence, as suggested for the 60kD molecular chaperone homologues in H. ducreyi [259] and H. pylori [260]. However, their egress may be 96  due to their hydrophobic surfaces allowing them to interact with membrane phospholipids and other lipidic molecules within the largely hydrophobic milieu of the mycobacterial cell wall, as suggested elsewhere [261]. Indeed, one report has shown that GroEL, human Hsp70, Cpn60.2 and DnaK all have the capacity to induce the formation of pores in lipid bilayers [262], while another study found that GroEL can promote lipid bilayer stability during protein folding activity [263]. Alternatively, molecular chaperones may engage somewhat more specific export mechanisms such as ‘hitch-hiker’-based export via the recently described mycobacterial TwinArginine Translocation (Tat) pathway [264,265,266], or an as-yet-uncharacterized secretion mechanism (e.g. type VII/ESX secretion [220]). A clue may exist within the structure of the M. tuberculosis Cpn10 protein which appears to be secreted from the bacterium, and shares some structural elements common to the N-terminal region of Cpn60.1 [267]. However chaperone release happens, it is likely to be an ancient mechanism that has been retained across a wide breadth of species. This hypothesis is supported by the finding that mammalian cells can localize their mitochondrial-derived Hsp60 to the cellular plasma membrane [268], the cell surface [269], or even release it from the cell in a non-lytic fashion [270]. Additionally, some plant cells localize their chloroplast-derived Hsp60 homologues to the cytoplasm [271]. Thus, the capacity of bacterial-derived molecular chaperones to passage across plasma membranes appears to have developed during an early evolutionary period. It is worth noting that homologues of Cpn60.2 have been demonstrated on the surface of mycobacteria previously. Rao et al [272] used a biotin-based method to show that M. avium has surface-exposed Hsp65, and immunogold staining was used successfully by Esaguy & Aguas [273] to demonstrate the presence of Hsp65 on the surface of both M. avium and M. leprae. Furthermore, homologues of Cpn60.2 have been found on the surface of Haemophilus ducreyi 97  [259,274,275], Helicobacter pylori [276,277], Bordetella pertussis [278], Neisseria gonorrheae [279], S. typhimurium [280], Clostridium difficile [261], Lactobacillus johnsonii  [281],  Brucella abortus [282], Actinobacillus actinomycetemcomitans [283], Plesiomonas shigelloides [284] and Legionella pneumophila [278]. Additionally, homologues of Hsp70 have been found on the surface of M. avium [285], H. influenza [286], and L. pneumophila [278] (see Table 1). Also, Histoplasma capsulatum, a dimorphic fungal pathogen that affects the lungs, has also been shown to have Hsp60 present on its surface [287]. In order to determine whether it is feasible that one or both of these molecular chaperones could act as adhesins, we determined whether we could show the presence of these proteins on the surface of bacteria derived from short-term cultures that are generally considered to show minimal evidence of bacterial lysis [255]. Notably, the CF from these short-term cultures had insignificant levels of Cpn60.2 and DnaK (Figure 11A and B), consistent with previously published observations [255,256]. We found, following syringe-dispersion of the bacteria, the presence of both Cpn60.2 and DnaK on the bacillary surface, with proportionately higher levels of DnaK being released into the surrounding environment by this mechanical dispersion (Figure 11A and B). This was an intriguing result as both syringe-dispersion and sonication of cultures are common preparatory treatments that are employed to generate singlebacilli suspensions before experimental use of mycobacteria.  Although there was the  appearance of a disparity between the amount of Cpn60.2 present in the capsule used for 2DPAGE (Figure 10), compared to the amount of Cpn60.2 present in the capsule released during the whole bacteria ELISA (Figure 11A and B), it is difficult to compare these data sets due to the different techniques involved and the fact that the capsule used for the PAGE work was greatly concentrated from a high volume of late-log phase bacterial culture whereas capsule 98  from the bacterial ELISA was derived from a comparatively small volume of 4-day old bacterial culture. Additionally, we were unable to quantify relative surface expression levels between Cpn60.2 and DnaK because of inherent limitations in the antibody-based methodology. In conclusion we have shown that the mycobacterial molecular chaperones, Cpn60.2 and DnaK, both have the capacity to bind CD43-Fc in an affinity chromatography format. Additionally, both of these proteins appear to be components of the capsule of M. tuberculosis and each is accessible on the surface of cultured bacilli.  99  Figure 9: Cpn60.2 and DnaK sourced from the M. tuberculosis capsule bind to CD43-Fc After M. tuberculosis capsule was incubated with immobilized CD43-Fc, the proteins that bound elements within the affinity chromatography system were analyzed by PAGE and Western Blot. A) Protein A-Dynabeads® were either incubated with M. tuberculosis capsule alone (left lane), or CD43-Fc was first immbilized to the Protein A-Dynabeads® before the introduction of Capsule (right lane). The resultant bound proteins were eluted and separated via 10% acrylamide reducing PAGE followed by silver staining. B) Western blot of the eluate from the CD43 + capsule fraction. Proteins were separated by 10% acrylamide reducing PAGE and then transferred to a nitrocellulose blot membrane. Rabbit anti-M. tuberculosis capsule (antiCapsule) (1:10,000) was used to detect immunogenic proteins within the CD43 + capsule eluate (right lane). A molecular weight ladder is shown in the left lane. C) Western blot of the eluate from the CD43 + Capsule fraction (see A). Monoclonal antibodies specific for Cpn60.2 (IT-70, ‘anti-Cpn60.2’ - middle lane) and DnaK (IT-41, ‘anti-DnaK’ - right lane) were each tested for their ability to bind to the prominent immunogenic proteins within the CD43 + Capsule eluate. A molecular weight ladder is shown in the left lane.  100  Figure 10: Two dimensional-polyacrylamide gel electrophoresis analysis of M. tuberculosis capsular proteins Syringe-derived capsule was subjected to TCA treatment to precipitate protein content prior to protein resolubilization in 2D-PAGE rehydration buffer. One hundred micrograms of protein was separated isoelectrically across a pH 4-7 (left-right) range, and then separated vertically with a 15% SDS-PAGE gel. Silver staining was used to visualize individual proteins. The molecular weight scale was generated using calibrated protein standards. Protein mapping suggested the presence of the 70kD DnaK protein (black arrow) and the 60kD Cpn60.2 protein (open arrow) in the capsular proteome.  101  Figure 11: Cpn60.2 and DnaK are associated with the surface of M. tuberculosis bacilli A,B) Whole-bacteria ELISA evaluating the presence of Cpn60.2 and DnaK on the surface of M. tuberculosis (M.tb bacilli), within capsular material sloughed off during syringing (M.tb capsule) and in the original soluble culture filtrate (CF). A) Cpn60.2 was detected with mAb IT-70 (1:500) and B) DnaK was detected with mAb IT-41 (1:2000). Secondary detection of bound antibody was made with goat-anti-mouse(AP) (1:1000), followed by addition of AP substrate. BSA was included as a negative control and received both primary and secondary antibody treatments. Results show the mean ± SEM of four individual experiments done in triplicate (* P < 0.05, ** P < 0.01, *** P < 0.001, when compared with BSA control). C) Merged visible light and fluorescent light image-captures of M. tuberculosis bacilli. Only the bacteria receiving the primary antibodies IT-70 (anti-Cpn60.2) or IT-41 (anti-DnaK) demonstrated a clear increase in fluorescence compared with the negative control, which only received the Alexa Fluor 488 secondary antibody. 102  Table 1: Compilation of published studies that have shown surface localization and adhesin function of Cpn60.2 (Hsp65, GroEL) and DnaK (Hsp70) homologues in bacteria Role in host Species  Molecular chaperone  cell adhesion?  Localization  References  Hsp65  Not shown  Cell Wall  [273]  Mycobacterium smegmatis  Cell Wall & 68kD GroEL homologue, Mycobacterium avium  Hsp65  Yes  Surface  [272,273]  Mycobacterium avium  Hsp70  Yes  Surface  [285]  Mycobacterium leprae  Hsp65  Not shown  Surface  [273,288]  Haemophilus ducreyi  58.5 kDa GroEL Hsp  Yes  Surface  [259,274,275]  Helicobacter pylori  Hsp60  Yes  Surface  [276,277]  Bordetella pertussis  Hsp60  Not shown  Surface  [278]  Neisseria gonorrheae  60kD GroEL homologue  Yes  Surface  [279]  66kD HSP  Yes  Surface  [280]  Clostridium difficile  GroEL  Yes  Surface  [261]  Lactobacillus johnsonii  GroEL  Yes  Surface  [281]  Brucella abortus  Hsp60  Yes  Surface  [282]  GroEL-like  Not shown  Membrane  [283]  GroEL  Yes  Surface  [284]  Haemophilus influenzae  Hsp70  Yes  Surface  [286]  Legionella pneumophila  Hsp60, Hsp70  Yes  Surface  [278]  Salmonella typhimurium  Actinobacillus actinomycetemcomitans Plesiomonas shigelloides  103  Chapter 6: The Roles of Cpn60.2 and DnaK in M. tuberculosis Association with Macrophages 6.1 Introduction To determine the biological relevance of proposed ligand/receptor binding partners that have been identified via in vitro methods (e.g. affinity chromatography), it is necessary to test the functionality of such molecular interactions within a model that approximates the natural interactions between the pathogen and host cells. Cell culture methods provide one model system for evaluating such interactions. Isolated cell systems allow the researcher to work within highly controlled conditions, allowing for reproducibility of experiments that commonly become more challenging when one moves to a whole animal host model. Within this work, the term in vivo (“within the living”) is reserved for experimentation done within a host animal and work employing cells/tissues removed from the host ≥24 hrs are termed in vitro (“within the glass”). As such, all primary results described in this work evaluating pathogen association with host cells are considered in vitro experiments. When employing in vitro conditions to evaluate binding parameters between bacteria and host cells, there is the opportunity to alter the natural interactions between bacterial ligands and host cell receptors. Broadly, there are four different approaches to altering the ligandreceptor relationship. The density of cell receptors can be decreased or increased, and the density of bacterial ligands can likewise be decreased or increased. Commonly, only one of these parameters is adjusted during a given experiment. The methods by which the ligand and/or receptor densities can be altered include both intracellular and extracellular alterations. Intracellular-based methods utilized to adjust the surface expression of a ligand or receptor normally rely upon alterations to genetic transcription and/or translation of a given 104  gene-product. Alternatively, the movement of ligand/receptor from intracellular stores to the cell surface can be altered. With respect to alterations at the gene transcription level, it is often feasible to ‘knock out’ or mutate the gene of interest, thereby removing the cell’s ability to produce a functional gene product. Additionally, recent advances in ‘transcript silencing’, or short interfering RNA (siRNA) allow for functional transcripts to be produced from a given gene, but the translational events leading to formation of a protein are inhibited. While each of the strategies involving nucleic acid alterations deal with ‘reducing’ the levels of expressed ligand/receptor, it is also possible to increase the concentrations of expressed ligand/receptor via the  introduction  of  additional  copies  of  the  relevant  genes  (e.g.  plasmid  transduction/transfection), or, through the alteration of the cellular environment such that promoter-based expression is increased (e.g. introducing cell stress via heating, pH alterations, ionic changes, etc.).  Non-genetic intracellular methods of altering the localization of  ligands/receptors normally rely upon the introduction of substances that inhibit the intracellular trafficking pathways used within cells, of which there are a vast variety of small molecule inhibitors. Not all cells are amenable to intracellular changes to their expression of intracellular ligands/receptors. This is especially true when altering the expression of the ligand/receptor results in gross phenotypic changes to the cell, or worse, non-viability. In these situations, it is often possible to circumvent the problems of intracellular alterations through the introduction of changes to the extracellular environment. There are two general strategies to achieve this: either introduce higher concentrations of the ligand/receptor of interest, or effectively decrease the availability of functional ligand/receptor. One means of introducing more ligand/receptor into the system is through the addition of purified soluble ligand/receptor into the surrounding 105  environment of the cell. Conversely, it is also possible to effectively reduce the availability of ligand/receptor by blocking, or masking, the epitopes that the ligand/receptor relies upon for interacting with its binding partner. A common and specific means of conducting this ‘epitope masking’ strategy is through the use of antibodies that have been raised against the ligand/receptor of interest. While each of the above strategies of altering the ligand/receptor availability will provide information about the involvement of a particular protein in the binding between two cells, the use of more than one strategy to investigate this phenomenon enhances the overall confidence of the experimental findings. For example, if a bacterium relies upon receptor X on the host cell for binding, then knocking out the gene for receptor X would be expected to result in less bacterial binding. Coupled with this, if the same bacterium employs ligand Y to bind receptor X, then blocking the expression of ligand Y should also result in less binding to the host cell. Lastly, if knocking out receptor X and blocking ligand Y results in an equivalent reduction in binding to the two previous strategies, it would be a reasonable assumption that host cell receptor X only interacts with bacterial ligand Y.  6.2 Rationale The goal of the following series of experiments was to determine whether recombinant Cpn60.2 and/or DnaK have the capacity to bind to MΦ, and more specifically, bind to CD43 expressed on the MΦ surface. If this was found to occur, we would next determine whether surface localized Cpn60.2 and/or DnaK interact with MΦ CD43, and whether CD43 is the primary MΦ receptor that binds to these M. tuberculosis proteins.  106  6.3 Results 6.3.1 Binding of recombinant Cpn60.2 and DnaK to the macrophage surface It has been demonstrated previously that both M. tuberculosis Cpn60.2 and DnaK can bind to the MΦ surface [289,290]. To confirm this observation in our model, Alexa Fluor 488labeled recombinant M. tuberculosis Cpn60.2 and DnaK proteins were incubated with murine BMMΦ. To avoid the potential of fluorescent protein uptake via pinocytosis, the BMMΦ were maintained on ice (~4°C) throughout the experiment. Non-bound Cpn60.2 and DnaK were then removed via washing and the BMMΦ were fixed and analyzed via fluorescent microscopy. The ability of both Cpn60.2 and DnaK to adhere to the surface of the BMMΦ was readily apparent and representative images of these cells, and the BSA-only control, are shown in Figure 12. 6.3.2 Competitive-inhibition of M. tuberculosis binding using recombinant Cpn60.2 and DnaK In order to determine whether Cpn60.2 and/or DnaK have a role in facilitating the association of M. tuberculosis with MΦ, purified recombinant Cpn60.2 and DnaK were produced for competitive inhibition analyses. The purity of the recombinant proteins was confirmed by PAGE analysis (Figure 13A). While it has been shown previously that LPS concentrations of up to 25 µg mL-1 do not affect M. tuberculosis binding to MΦ [291], we sought to reduce the likelihood of LPS having any effects on our binding-inhibition tests. To this end, we used an ASB-14 detergent wash during the His-tag purification procedure of the recombinant proteins to help reduce background levels of endotoxin. Moreover, the purified Cpn60.2 and DnaK proteins were tested for LPS presence using a Limulus amoebocyte lysate (LAL) assay and the presence of LPS was below the level of detection for this assay, (<2 pg mL107  1  - data not shown). Additionally, Polymyxin B, an endotoxin binding molecule, was included  with both Cpn60.2 and DnaK in our binding inhibition experiments at 16 µg mL-1. This concentration of Polymyxin B has been found not to have an observable effect on MΦ function while functionally removing up to 20 ng mL-1 of LPS [290]. Lastly, we included a control to which 10 ng mL-1 LPS was added to the BMMΦ prior to the introduction of bacteria. Separately, in preliminary tests we observed that levels of Cpn60.2 >10 µg mL-1 led to mild ‘rounding up’ of the BMMΦ, which was associated with low levels (<10%) of cell death as assessed by trypan blue staining. At >20 µg mL-1, Cpn60.2 caused most of the BMMΦ to detach from the support surface and there were increased levels of cell death. For DnaK, a similar progression of events occurred, though rounding up was observed only at concentrations >20 µg mL-1 and BMMΦ detachment associated with cell death was not observed until >50 µg mL-1. In order to avoid these phenomena playing a role in our binding-inhibition studies, we tested protein concentration levels only up to 5 µg mL-1, where cells appeared healthy and efficiently excluded trypan blue (>98% viability). In addition to testing the effects of soluble Cpn60.2 and DnaK on binding, BSA was chosen as a control protein due to its similar molecular weight (65kD) to our molecular chaperones. The results shown in Figure 13B demonstrate that Polymyxin B (16 µg mL-1), LPS (10 ng mL-1), BSA (5 µg mL-1) and DnaK (0.05, 0.5 and 5 µg mL-1) did not significantly affect bacterial binding to the BMMΦ (P > 0.05 compared to medium alone control). Although not statistically significant (P > 0.05 compared to medium alone control), increasing concentrations of DnaK appeared to trend towards increased bacterial association Figure 13B.  However, the presence of recombinant Cpn60.2 caused a dose-  dependent reduction in bacterial association with BMMΦ, leading up to approximately a 57% reduction in bacterial binding at 5 µg mL-1 (P < 0.001 when compared to binding medium-alone 108  control).  In order to further demonstrate that it is the functional Cpn60.2 protein that is  required to competitively inhibit bacterial association with BMMΦ, we compared the inhibitory potential of recombinant (native) Cpn60.2 with Proteinase K-degraded Cpn60.2. As shown in Figure 13B, protease digestion of Cpn60.2 completely abrogates the inhibitory capacity of this protein. Additionally, the inhibitory effect of recombinant Cpn60.2 is not likely due to the presence of the His-tag, since recombinant His-tagged DnaK did not demonstrate inhibitory effects (Figure 13B). Taken as a whole, these experiments suggest that Cpn60.2 has the capacity to competitively inhibit the association of M. tuberculosis bacilli with BMMΦ. 6.3.3 Binding-Inhibition using antibody epitope-masking of Cpn60.2 and DnaK on the surface of M. tuberculosis In order to obtain a more complete evaluation of whether Cpn60.2 and/or DnaK have a role in facilitating the association of M. tuberculosis with MΦ, we attempted to “mask” the surface presentation of these bacterial molecular chaperones using polyclonal antibodies that were raised against either purified Cpn60.2 or DnaK. Due to the high immunogenicity of these proteins, we were able to generate high-titre rabbit antisera that showed negligible crossreactivity between the two proteins on ELISA analysis (Figure 14A and B). In order to avoid the potential for these antibodies to act as opsonins after bacterial binding (possibly mediating binding to MΦ Fc receptors), we cleaved the Fc-domain of the IgG structure to create (dimeric) F(ab’)2 antibody fragments. We confirmed the efficient cleavage of the Fc domain with PAGE analysis (Figure 14C) and also confirmed the binding functionality and specificity of the F(ab’)2 fragments by allowing them to bind to the capsular proteins on Western Blot (Figure 14D). Furthermore, we confirmed that the (F(ab’)2 fragment) anti-Cpn60.2 and anti-DnaK were able to 109  bind to the surface of syringed-dispersed bacteria in a manner similar to earlier tests with monoclonal antibodies (Figure 15). Syringe-dispersed M. tuberculosis bacilli preincubated with anti-Cpn60.2(F(ab’)2) prior to the bacteria’s addition to BMMΦ resulted in a significant decrease in bacterial binding, as assessed by both microscopy counts (Figure 16A) and CFU growth (Figure 16B) (P < 0.001 and P < 0.05 compared with group controls, respectively). In comparison, anti-DnaK(F(ab’)2) treatment of M. tuberculosis did not show a significant reduction in BMMΦ association in either the microscopy or CFU analyses (P > 0.05 compared with group controls) (Figure 16). In an effort to ensure that the F(ab’)2 fragments were not having a direct effect on the BMMΦ, we included controls where the BMMΦ were preincubated with F(ab’)2 fragment antibodies in a manner similar to the bacterial incubation. After the 15-20 min incubation period, the free F(ab’)2 fragments were washed away from these BMMΦ, and untreated M. tuberculosis bacilli were introduced. As shown in Figure 16, this treatment did not appear to have an adverse effect on the ability of the BMMΦ to bind bacteria (P > 0.05 compared with non-(F(ab’)2) treated control).  6.3.4 Differences in surface binding of recombinant Cpn60.2 and DnaK to CD43+/+ vs. CD43-/- macrophages using flow cytometry To evaluate whether recombinant Cpn60.2 and/or DnaK bind to MΦ-presented CD43, we compared the ability of fluorescently-labeled Cpn60.2 and DnaK to bind to the surface of BMMΦ that were derived from CD43+/+ or CD43-\- mice (Figure 17). Using flow cytometry, we found that incubation of chilled CD43+/+ BMMΦ with 5 µg mL-1 of Alexa Fluor 488-conjugated 110  Cpn60.2 protein showed a comparable level of binding to the MΦ surface (GMF = 16.59) as observed in similar studies with J774A.1 and RAW264.7 cells [292]. Fluorescent Cpn60.2 showed higher baseline binding to CD43+/+ MΦ than fluorescent DnaK (GMF of 16.59 vs. 15.52, respectfully), even though DnaK was employed at twice the concentration. However, it cannot be discounted that these differences may in part be a product of uneven levels of Alexa Fluor 488 labeling on these recombinant proteins. It was found that CD43-/- BMMΦ showed a 45% reduction of fluoresecent Cpn60.2 binding (Figure 17), as assessed by the difference in net GMF between CD43+/+ and CD43-/groups, calculated after deduction of the background autofluorescence value. For fluorescent DnaK, the reduction in GMF between CD43+/+ and CD43-/- was a lesser reduction of 32% (Figure 17). Combining both fluorescent Cpn60.2 and DnaK resulted in an enhanced GMF of 24.42; however, this value only represents 76% of the calculated sum of the two independent GMFs (32.11). It appeared that surface-expressed CD43 on MΦ bound Cpn60.2, and to a lesser extent, DnaK. However, each of these molecular chaperones apparently interacts with other MΦ surface entitites in addition to CD43. 6.3.5 Competitive-inhibition and epitope-masking of Cpn60.2 to assess M. tuberculosis binding to CD43+/+ vs. CD43-/- macrophages While our affinity-based analysis suggested that Cpn60.2 is the primary mycobacterial entity that CD43 interacts with, we wanted to determine whether CD43 is the primary MΦ moiety that mycobacterial Cpn60.2 interacts with, in the context of bacterial adhesion. As described in sections 6.3.2 and 6.3.3, M. tuberculosis association with CD43+/+ BMMΦ can be partially inhibited through competitive-inhibition with recombinant Cpn60.2, or through epitope 111  masking of M. tuberculosis Cpn60.2 using a polyclonal anti-Cpn60.2(F(ab’)2) pretreatment. Here, we sought to determine whether these binding inhibition treatments show a limited, or null, effect when employing CD43-/- BMMΦ. To develop these tests, it was first necessary to determine the bacterial MOI that was necessary to overcome the inherent deficiency of CD43-/- BMMΦ with regards to M. tuberculosis association [136]. For CD43+/+ BMMΦ, it was determined that an MOI of 60:1 gave a desirable level of cell association in the control groups, and employing a 60:1 MOI in the CD43-/- cells resulted in an association reduction of ~30% based on microscopy assessment (Figure 18A) and ~25% based on CFU assessment (Figure 18B). It was further determined that CD43-/- BMMΦ at an MOI of 100:1 gave an equivalent level to the CD43+/+ BMMΦ at 60:1 (Figure 18A and B). Binding of M. tuberculosis to CD43+/+ MΦ was inhibited by 5 µg mL-1 of recombinant Cpn60.2 by 39% and 27% based on microscopy counts and CFU counts, respectively, compared to the untreated CD43+/+ control (Figure 18A and B). As was observed in earlier studies (section 6.3.2), protease digestion of Cpn60.2 abrogated these inhibitory effects (Figure 18A and B). However, these levels of inhibition were not reproduced within the CD43-/- MΦ group where neither the microscopy nor CFU analyses showed significant reductions of bacterial association after Cpn60.2 treatment (P > 0.05 compared to the untreated CD43-/- control) (Figure 18A and B). Similarly, anti-Cpn60.2(F(ab’)2) pretreatment of M. tuberculosis reduced the association of M. tuberculosis with CD43+/+ MΦ by 37% and 23% based on microscopy counts and CFU counts, respectively (Figure 18A and B). As was seen previously (section 6.3.3), the inhibitory effects of anti-Cpn60.2(F(ab’)2) treatment only resulted when the bacteria were preincubated 112  with this antisera and not when the MΦ received the pretreatment (Figure 18A and B). Again, this epitope-masking treatment of M. tuberculosis resulted in no significant changes in bacterial association with CD43-/- MΦ at both MOIs tested (P > 0.05 compared to the untreated CD43-/control) (Figure 18A and B). Lastly, consistent with the results described in section 6.3.2 and 6.3.3, the introduction of a generic protein, BSA, had no effect on M. tuberculosis association with the BMMΦ in any of the experimental combinations tested (P > 0.05 compared to the untreated MΦ control of the same genotype) (Figure 18A and B). . 6.4 Discussion and summary Our analyses exploring the interaction between the M. tuberculosis molecular chaperones Cpn60.2 and DnaK, and MΦ-expressed CD43 provide support for the contention that Cpn60.2 has the capacity to bind to CD43 in a biologically functional manner. Several previous studies have provided indirect evidence that Cpn60.2 and DnaK can bind to elements of the MΦ surface, but many of these studies have relied upon the elicitation of MΦ responses, such as cytokine release, as an indication of cellular binding. However, mycobacterial Hsp70 (DnaK) has been shown to physically interact with both CD40 as well as CCR5, in a CD14/TLR-4-independent manner, to elicit cytokine release from monocyte-derived macrophages and dendritic cells [293,294,295]. Additionally, DnaK from L. monocytogenes has been implicated in mediating the phagocytosis of these bacteria by macrophages, although this event was not ascribed to any particular cell receptor involvement [296]. Moreover, mammalian Hsp70 has been suggested to interact with scavenger receptors to mediate binding and uptake events [297]. With respect to the 60 kD molecular chaperone, Habich et al [298,299] demonstrated MΦ surface binding of Alexa Fluor 488-labeled Hsp60 using flow cytometry, 113  however this study employed human Hsp60 (hHsp60). While the Habich et al studies did not elucidate a dominant MΦ epitope for hHsp60 binding, it seemed apparent that while hHsp60 can signal through TLR4 within the MΦ, the absence of TLR4 expression did not result in an appreciable reduction of hHsp60 surface binding. Thus, for hHsp60, TLR4 does not appear to be a significant mediator of bulk hHsp60 binding to the MΦ. In our studies, we found that while both recombinant M. tuberculosis Cpn60.2 and DnaK have the capacity to bind to elements on the MΦ surface, Cpn60.2 showed an apparently higher MΦ binding capacity (Figure 17). When we evaluated whether recombinant Cpn60.2 and DnaK retain the capacity to bind CD43-/- (vs. CD43  +/+  ) MΦ, it was found that each of these molecular chaperones still  interact with elements on the MΦ surface, however there were binding reductions of 45% and 32%, respectively. Thus, the absence of CD43 on the MΦ surface affected Cpn60.2 binding more greatly than DnaK binding. Additionally, allowing both Cpn60.2 and DnaK to bind the MΦ surface at the same time resulted in an enhanced GMF, but this value did not equal the sum of the independent GMFs from Cpn60.2 and DnaK alone. Thus, there appears to be some overlap of the MΦ moieties that these molecular chaperones bind to, but each of these molecular chaperones likely engages independent moieties as well. To assess whether Cpn60.2 and/or DnaK have roles in facilitating the efficient association of M. tuberculosis bacilli with BMMΦ, we employed two different experimental strategies in an attempt to alter the bacterial binding/uptake in a specific manner. First, we determined whether the introduction of soluble molecular chaperones could ‘compete’ with the naturally expressed molecular chaperones of the bacterial surface for binding sites on the BMMΦ. We hypothesized that we could competitively inhibit M. tuberculosis binding/uptake if either Cpn60.2 or DnaK are normally employed by the bacterium for stabilizing binding to the 114  host cell.  Our results from the recombinant protein binding inhibition study (Figure 13)  provided evidence to suggest that M. tuberculosis employs Cpn60.2 as a means of stabilizing bacterial association with the MΦ; however, DnaK did not function in this respect at any of the concentrations tested. The finding that Cpn60.2 appears to function as a bacterial adhesin was not unexpected as several other labs have provided evidence that Cpn60.2 homologues in other bacterial species employ this protein in a similar manner (see Table 1).  However, our  hypothesis that DnaK would function in a similar manner was not supported. While there are published studies that have shown DnaK homologues in other bacterial species act as adhesins, recent evidence about M. tuberculosis DnaK suggests that treating MΦ with purified DnaK actually leads to an increased level of latex bead binding/uptake [300]. Indeed, while our competitive binding studies with DnaK did not show a significant change in binding, there was the appearance of a trend that increased concentrations of recombinant DnaK led to greater bacterial uptake (Figure 13).  If this observation is accurate, the mechanism causing this  alteration is not yet understood, however, it may result from an elicited alteration of the MΦ surface receptors after DnaK-mediated signaling events. Consequently, it is therefore possible that Cpn60.2 is not inhibiting bacterial uptake via competitive inhibition, but was actually mediating reduced bacterial binding/uptake through a MΦ signaling event(s) that caused alterations to the receptors being displayed on the MΦ surface. The possibility that altered receptor expression can occur following incubation with E. coli GroEL, a homologue of Cpn60.2, has been previously investigated with endothelial cells, where intercellular adhesion molecule-1 (ICAM-1, or CD54) expression was upregulated [301].  However, significant  upregulation of ICAM-1 in response to GroEL did not occur until after 4 hrs, and our  115  experiments were completed in 3 hrs. Additionally, although ICAM-1 is expressed on MΦ, it has not been associated with having a role in facilitating MΦ binding of M. tuberculosis. Regardless, we wished to evaluate the roles of Cpn60.2 and DnaK in mediating MΦ association with a technique that did not require the introduction of additional quantities of molecular chaperones. An initial consideration was the use of gene deleted mutants, however, both Cpn60.2 and DnaK appear to be essential genes necessary for bacterial viability [302,303]. Indeed, the fact that these proteins are conserved throughout most species suggests their necessity for viability. Thus, we considered alternative means of ‘removing’ Cpn60.2 and DnaK from M. tuberculosis and attempted to achieve this objective by masking their surface presentation via antibody blockade. In some ways the epitope masking technique is superior to gene deletion because it is unlikely to cause intracellular artefacts, where both Cpn60.2 and DnaK have important roles, and should only affect the function of these proteins on the bacterial surface. To ensure that the epitope masking treatment did not have a net effect of opsonising the bacteria (potentially facilitating bacterial uptake via FcR), F(ab’)2 fragments were used. The results from the epitope masking experiments provided evidence that M. tuberculosis relies upon the availability of surface localized Cpn60.2, and not DnaK, to allow efficient MΦ association (Figure 16). The discovery that molecular chaperones can exist, and have functional roles, on cell surfaces is not without precedent as this has been shown for both mammalian [269,304] and bacterial cells (see Table 1). As proteins normally have specific functions associated with their localization within the cell, it is not surprising that surface-localized Cpn60.2 and DnaK homologues of other bacteria have been associated with adhesin functionality. With regards to mycobacteria, Rao et al. [272] demonstrated that M.avium binding to monocyte-derived 116  macrophages can be competitively-inhibited through the use of purified molecular chaperones. Similar to our results, these authors found that soluble M. avium Hsp65 was a more effective competitive inhibitor (≤ 42% reduction) than Hsp70. Moreover, their findings that Hsp65 homologues from different bacterial sources, including M. bovis Hsp65 (≤ 14.6% reduction), varied in efficacy, suggests that not all homologues of Hsp65 interact with MΦ in the same manner. Further support for this contention was provided in a previous demonstration that mammalian and bacterial versions of Hsp60/65 rely upon different sites of the MΦ surface for binding [298]. While supportive evidence that bacterial molecular chaperones can act as adhesins continues to grow, there is still a lack of clear evidence describing specific binding partners for these proteins on the host cell surface. Henderson & Mesher [123] have recently reviewed some of the controversy surrounding reports of 60kD molecular chaperone, or ‘chaperonin’, binding partners in addition to probing myeloid cells for Cpn60.1 binding partners. While there is limited information as to the MΦ moiety(ies) that mediate MΦ binding to M. tuberculosis (via Cpn60.2), there have been reports that Cpn60.2 homologues in other bacteria bind to glycosylated structures such as glycosphingolipids [275] and intestinal mucus [280]. Additionally, H. capsulatum has been shown to employ surface localized Hsp60 to bind CR3 on MΦ [287].  Although we did not investigate whether Cpn60.2 interacts with CR3, CD43 is a  glycoprotein that has a mucin structure, so the results of our studies appear to share some common attributes with related studies conducted in other labs. On a related matter, studies analyzing the stimulatory effect of recombinantly expressed Cpn60.2 have suggested that Cpn60.2 can stimulate myeloid cells via TLR4 signaling, suggesting that Cpn60.2 can bind to CD14 on the MΦ surface. Consequently, the surface expression of CD14, TLR4 and MD2 on 117  CD43-/- BMMΦ were all assessed by flow cytometry and found to be equal with the levels found on CD43+/+ BMMΦ, thus, the alterations in bacterial association seen with CD43-/BMMΦ are not likely due to differences in the surface expression of the CD14/TLR4 receptors (unpublished observations).  This confirmation may be moot as other studies have found  Cpn60.2 signaling, including TNFα release, in human monocytes is CD14-independent [120]. Thus, it can be hypothesized that CD43 is the mediator of this non-TLR4 signaling, as it has been reported that an absence of CD43 leads to reduced M. tuberculosis-induced TNFα signaling [29]. If true, this would support the previously stated suggestions that CD43 functions as a PRR and Cpn60.2 acts as a PAMP [29,305]. However Cpn60.2 interacts with the MΦ, it should be noted that molecular chaperones, by nature, are able to interact with a diversity of misfolded proteins and this is believed to be mediated through the interaction of exposed hydrophobic regions on the two proteins [306]. As such, it seems feasible that Cpn60.2 would demonstrate a degree of promiscuity as to which MΦ surface elements it can bind and it has been proposed that Cpn60.2 likely interacts with multiple MΦ receptors [305]. However, our finding that incubation of MΦ with purified capsule (which contains Cpn60.2) did not affect the MΦ capacity to bind opsonized erythrocytes or latex beads (Figure 4A) clearly demonstrates that there are receptors on the MΦ surface that are not bound by this potentially promiscuous molecular chaperone. Additionally, the finding that another molecular chaperone, DnaK, did not consistently inhibit binding of M. tuberculosis demonstrates that the inhibition mediated by Cpn60.2 is not inherent of molecular chaperones. Regardless, it will be of value to identify the range of epitopes on the MΦ surface that can be bound by both Cpn60.2 and DnaK. Furthermore, it would be of interest to evaluate whether inducing a stress response in M.  118  tuberculosis causes an increase in the surface localization of molecular chaperones, and if so, whether this response mechanism leads to greater uptake by host cells. Perhaps the most informative experiments conducted in this study were those comparing the association of M. tuberculosis and MΦ where the presence of CD43 and Cpn60.2 were each varied. To develop these tests, it was first necessary to determine the MOI that was required to overcome the inherent deficiency of CD43-/- BMMΦ with regards to M. tuberculosis binding. During the studies conducted by Randhawa et al [29,136], it was determined that an M. tuberculosis MOI of 30:1 in CD43-/- BMMΦ was required to obtain equivalent bacterial association as that seen in CD43+/+ BMMΦ at 20:1, i.e. CD43-/- BMMΦ require 1.5x the number of bacteria to gain equivalent binding/uptake as CD43+/+ MΦ. During the development of the experiments described herein, it was determined that comparatively larger numbers of M. tuberculosis bacilli were necessary to obtain an average association rate of ≥1 bacillus per MΦ. For CD43+/+ BMMΦ, it was determined that an MOI of 60:1 gave a desirable level of bacterial association in the control groups, whereas an MOI of 100:1 was needed to give an equivalent level of association in the CD43-/- BMMΦ. While efforts were made to follow the same protocols as described in the Randhawa et al publications, these differences may be attributed in part to differences between researcher technique and possible variability between M. tuberculosis batches used for stock aliquots. Notably, while higher MOI were used for this current work, the number of bacteria necessary to gain equivalent binding in CD43-/-, versus CD43+/+, was a comparable value 1.67x.  The results of the binding experiments in the  (C57BL/6 mice) CD43+/+ BMMΦ groups were similar to those described in sections 6.3.2 and 6.3.3, where the BMMΦ were sourced from CD1 mice.  That is, recombinant Cpn60.2  competitive inhibition and anti-Cpn60.2(F(ab’)2) epitope masking both resulted in statistically 119  significantly reductions of association between the bacteria and the BMMΦ sourced from CD1 and CD43+/+ C57BL/6 mice.  Additionally, BSA, Proteinase-K degraded Cpn60.2 and  pretreatment of the MΦ with anti-Cpn60.2(F(ab’)2) did not result in statistically significant changes in the levels of bacterial association with BMMΦ sourced from CD1 or C57BL/6 mice. These results suggest that comparable levels of CD43 expression on both MΦ results in comparable binding levels of Cpn60.2 on the bacterial surface. This interpretation is supported by the competitive inhibition and epitope masking studies showing that the binding of Cpn60.2 seen with CD43+/+ BMMΦ was lost when using CD43-/- BMMΦ. This observation suggests that CD43 is the primary receptor that Cpn60.2 on the bacterial surface relies upon for mediating a stable association with the MΦ. This result is intriguing because it suggests that even though Cpn60.2 apparently interacts with other sites on the MΦ in addition to CD43 (as per Figure 17), CD43 appears to retain a unique interaction with Cpn60.2 that promotes M. tuberculosis adherence to the MΦ.  120  Figure 12: Cpn60.2 and DnaK bind to the macrophage surface Murine BMMΦ were washed with cold PBS and kept cold throughout the procedure. First, the MΦ received a 10 min blocking treatment with 1% BSA (w/v) in cold PBS. After blocking, 5 µg mL-1 of Alexa Fluor 488 fluorescently-labeled recombinant Cpn60.2 or DnaK, mixed with 1% (w/v) BSA in PBS was incubated with the cells. The MΦ were washed to remove unbound fluorescent protein before the cells were fixed. The coverslips were mounted using adhesive coupled with DAPI nuclear stain. Separate image captures of the DAPI stain (blue) and the Alexa-488 stain (green) were merged to demonstrate cellular nuclei and bound Cpn60.2 (middle image) and DnaK (right image). Control BMMΦ (left image) received only BSA blocker and showed primarily DAPI-stained nuclei with limited autofluorescence of the cell bodies. Reference lines represent 10µm.  121  Figure 13: Cpn60.2, but not DnaK, can competitively inhibit the association of M. tuberculosis bacilli with macrophages in a dose-dependent manner A) Recombinant Cpn60.2 and DnaK were expressed in transformed E.coli and the recombinant proteins were Ni+2-captured via 6x His tags. Protein quantities of 0.5 µg (Lanes 1 & 4), 1 µg (Lanes 2 & 5) and 2 µg (Lanes 3 & 6) were run on an 8% reducing PAGE gel and stained with Coomassie Blue to confirm purity. B) Binding of M. tuberculosis bacilli to BMMΦ was evaluated in the presence of varying concentrations of control and test compounds. The BMMΦ were pre-incubated with the indicated compounds (Polymyxin B, LPS, BSA, Cpn60.2, DnaK and Proteinase K-degraded Cpn60.2 (Pr-aseK Cpn60.2) – concentration in µg mL-1 shown in brackets) in binding medium for 20 min before introducing M. tuberculosis bacilli. After 3 hrs of interaction, unbound bacteria were removed and the BMMΦ were lysed with brief sonication to allow the bound/ingested bacteria to be plated and subsequently enumerated via CFU growth. Results show the mean ± SEM of 3 individual experiments each with duplicate wells for each group (*** P < 0.001 when compared with the control (medium alone)).  122  Figure 14: Analysis of polyclonal anti-Cpn60.2 and anti-DnaK cross-reactivity Polyclonal antisera from rabbits that were immunized with either recombinant Cpn60.2 (antiCpn60.2 (Final)), or DnaK (anti-DnaK (Final)) were tested for their ability to bind to the inoculated mycobacterial immunogen as well cross-reactive binding to the alternate molecular chaperone.  Prebleed sera from each indicated rabbit (Naïve) was reserved prior to the  introduction of the mycobacterial immunogens. For A), recombinant Cpn60.2 was adsorbed to polystyrene wells prior to use of a BSA-based blocker and subsequent introduction of the stated antisera dilutions in blocker. In B), recombinant DnaK was adsorbed to the polystyrene wells followed by BSA-blocking and introduction of stated antisera dilutions in blocker. Reactivity of the antibody preparations was analyzed using an anti-rabbit AP-conjugated antibody followed by introduction of an AP substrate to observe colour development. C) Protein-A purified IgG from immunized rabbit antisera was run on a non-reducing 10% PAGE gel (Lanes 1 & 5). After pepsin-based cleavage of the IgG proteins, the resulting Fc-fragments were run in Lanes 2 & 6. Five & 10 µg quantities of the resulting anti-Cpn60.2(F(ab’)2) fragments (Lanes 3 & 4), and 123  anti-DnaK(F(ab’)2) fragments (Lanes 7 & 8) were included. Evidence of whole IgG was absent from the F(ab’)2 fragment lanes. D) 5 µg (Lanes 1 & 4), 10 µg (Lanes 2 & 5) and 20 µg (Lanes 3 & 6) of syringe-derived capsule was separated on an 8% reducing PAGE gel (20µg of capsule on corresponding Coomassie-stained PAGE gel shown on left) before transfer to blot membrane. Anti-Cpn60.2(F(ab’)2) (lanes 1-3) and anti-DnaK(F(ab’)2) (lanes 4-6) diluted to 1:20,000 in blocker were allowed to independently bind to elements within the capsule prior to detection with a goat-anti-rabbit (Fab-specific) secondary antibody. Lastly, an anti-goat antibody conjugated to horseradish peroxidase was employed prior to chemiluminescent detection on film. Additional bands indicative of polyclonal cross reactivity were absent.  124  Figure 15: Evaluation of function and specificity of polyclonal anti-Cpn60.2 and antiDnaK Sequential dilutions of anti-Cpn60.2(F(ab’)2) and anti-DnaK(F(ab’)2) were tested for their ability to bind to the surface of M. tuberculosis bacilli in an ELISA format. Detection of bound antibody was made using an anti-rabbit (Fab-specific) antibody followed by use of an anti-rabbit antibody conjugated to AP before introducting AP substrate to observer colour development at 405 nm. BSA was used as a negative control.  125  Figure 16: M. tuberculosis association with macrophages after Cpn60.2 and DnaK epitope-masking Polyclonal anti-Cpn60.2(F(ab’)2) or anti-DnaK(F(ab’)2) were pre-incubated for 20 min with either MΦ, M. tuberculosis, or not included (MΦ + M.tb alone). After 3 hrs of interaction between M. tuberculosis and MΦ, unbound bacilli were removed and discarded before the MΦ were prepared for either A) microscope analysis, or B) CFU analysis of bound bacteria. Microscope counts show the percentage of MΦ associated with ≥1 bacteria. Results show the mean ± SEM of three individual experiments each with two replicates for microscope counts, or three replicates for CFU counts (* P < 0.05, ** P < 0.01 when comparing test group with the untreated control group).  126  Figure 17: Surface binding by Cpn60.2 and DnaK is reduced in CD43-/- macrophages Flow cytometry was used to measure the amount of Alexa Fluor 488-labeled Cpn60.2 and DnaK that was able to bind to the surface of both CD43+/+ and CD43-/- BMMΦ. The background signal (autofluorescence) is shown with a red dotted line and the increased fluorescence that occurred with the addition of the bound recombinant proteins is shown with a solid green line. The geometric mean fluorescence (GMF) from 10,000 events is listed in each histogram box.  127  128  Figure 18: Competitive-inhibition and epitope-masking of Cpn60.2 to assess M. tuberculosis association with CD43+/+ and CD43-/- macrophages Murine C57BL/6 BMMΦ from CD43+/+ and CD43-/- littermates were differentiated upon coverslips over 7 days prior to use. Binding of M. tuberculosis bacilli to BMMΦ at two different MOI (shown in parenthesis) was evaluated in the presence of control and test compounds. Where indicated, the BMMΦ were pre-incubated with 5 µg mL-1 of the indicated compounds (BSA, Cpn60.2, Proteinase K-degraded Cpn60.2 (Pr-ase Cpn60.2)) for 20 min before adding M. tuberculosis. Alternatively, the BMMΦ were incubated with 1:100 dilutions of anti-Cpn60.2(F(ab’)2 (MΦ + anti-Cpn60.2)) for 20 min before adding M. tuberculosis. Additionally, M. tuberculosis bacilli were pre-incubated in a 1:100 dilution of antiCpn60.2(F(ab’)2 (M.tb + anti-Cpn60.2) for 20 min before incubating the M. tuberculosis bacilli with the BMMΦ. After 3 hrs of interaction, unbound bacteria were washed away and the BMMΦ were either fixed for microscopy-based association counts (A), or lysed with brief sonication to allow the bound/ingested bacteria to be plated and subsequently enumerated via CFU growth (B). Results show the mean ± SEM of 3 individual experiments each with two replicates (* P < 0.05, ** P < 0.01 when compared with corresponding control (medium alone) of the same genotype and MOI).  129  Chapter 7: Characterization of the Cpn60.2 and CD43 Interaction 7.1 Introduction While providing biological evidence of a receptor-ligand relationship suggests relevance of the proposed interaction, there is value in analyzing the proposed receptor-ligand interaction in an assay that provides quantitative information about attributes such as the strength (affinity/avidity) and specificity of the bond. For example, Cpn60.2 may associate with CD43 quite strongly, like Protein A binding to IgG(Fc), such that this interaction has relevance even when low molar concentrations of the two proteins are present. Alternatively, the individual bond strength between Cpn60.2 and CD43 may be comparatively weak; yet, the ability of many of these weak bonds to form may provide a functional result. The SP-A receptor is an example of a protein that relies upon a multimeric structure, needing multiple binding sites to become functional [307,308]. The specificity of the interaction between Cpn60.2 and CD43 is also of interest, and determining the epitopes (binding sites) involved in this interaction would be helpful in developing ways to alter this interaction to benefit the host. While the evaluation and identification of peptide epitopes on Cpn60.2 was outside the scope of this project, we evaluated whether homologues of Cpn60.2 sourced from different species were able to reproduce the binding inhibitory effects seen with recombinant M. tuberculosis Cpn60.2. This information would provide insight into whether the Cpn60.2 and CD43 interaction is specific to M. tuberculosis (or perhaps mycobacteria), or whether a variety of Cpn60.2 homologues have the capacity to bind CD43. For instance, if mammalian-derived Hsp60 interacts with CD43, this finding could have implications for better understanding how CD43 interacts with other host proteins. While evaluation of binding specificity between different Cpn60.2 homologues should 130  provide information about the ligand of interest, it would also be of value to elucidate the relevant site(s) on CD43 that play a role in this interaction.  In this regard, the many  glycosylation residues of CD43 represent potential binding epitopes that can be evaluated. One way to conduct this analysis is to deplete the glycosylation of CD43 through the use of glycosidases or other chemical treatments. Alternatively, purified forms of the oligosaccharide sugars on CD43 can be immobilized to test their ability to bind Cpn60.2. While it cannot be assumed with certainty that the carbohydrates of CD43 play a role in binding Cpn60.2, it is reasonable to hypothesize that they do since carbohydrates represent a dominant feature of CD43 and many lectin adhesins have been described for other human pathogens. To evaluate whether the interaction between Cpn60.2 and CD43 is of a specific nature, we performed two evaluations. First we tested whether binding of Cpn60.2 to CD43-Fc can be saturated using ELISA. For a binding saturation assay, the binding constant (KD) is taken to be the halfway point between zero and the saturation concentration. We also tested whether homologues of Cpn60.2 can competively inhibit binding of M. tuberculosis to BMMΦ. Previous studies provided information to suggest that bacterial binding to CD43 is mycobacterial-specific, with M. avium, M. bovis, and M. tuberculosis all showing functional interactions with CD43, while Gram positive species (L. monocytogenes) and Gram negative species (S. typhimurium, S. flexneria) did not appear to interact with CD43 in the context of bacterial association with host cells [135,136]. As the affinity-binding studies of this research description found that Cpn60.2 is the dominant mycobacterial surface protein functionally binding to CD43, we sought to explore whether it is the unique structure of M. tuberculosis Cpn60.2 that distinguishes it from Cpn60.2 (Hsp60) homologues from other species. While Cpn60.2 homologues are highly conserved across species, many differences in amino acid 131  sequence do exist between and these small differences seem to confer a wide range of different functional capacities, as explored in several excellent review articles [254,309,310]. To conduct an evaluation of whether Cpn60.2 homologues from other species function in a similar manner to M. tuberculosis Cpn60.2, we chose to evaluate another well-studied bacterial homologue, GroEL from E. coli, as well as the mouse and human Hsp60 proteins.  Each of these  recombinant proteins, including M. tuberculosis DnaK (which did not mediate binding inhibition as per section 6.3) was evaluated for the capacity to inhibit M. tuberculosis binding to BMMΦ sourced from CD43+/+ and CD43-/-, as per the procedure described in section 6.3.5. In order to gain insight into any specific carbohydrate arrangements that Cpn60.2 can interact with, we employed the use of a glycan array. The use of simple carbohydrate arrays dates back over two decades, whereby a range of unique carbohydrate structures were adsorbed within separate wells of a microtitre plate for subsequent exposure to suspected lectins [311]. The past ten years have seen numerous publications describing various improved methodologies for adsorbing small volumes of carbohydrates, either covalently or non-covalently, onto a range of different surfaces [312]. The most common use of carbohydrate arrays to date has been the evaluation of various lectins for carbohydrate binding specificity. It is not uncommon for an identified lectin to bind more than one arrangement of linked sugar residues [313]. However, the potential use for carbohydrate arrays continues to expand. One novel use of the carbohydrate array is the ability to identify unique lectins by probing a large, relatively unbiased pool of carbohydrate structures with a unique protein population (e.g. whole bacteria or bacterial cell wall proteins) [314,315]. One of the primary challenges of creating high density carbohydrate arrays (ie. with several hundred unique carbohydrate species) is the difficulty of acquiring pure forms of each 132  carbohydrate species for deposition on the array slide. While it is possible to create certain synthetic carbohydrate structures, the absence of specific glycosyltransferases and chemical methodologies have restricted the synthetic creation of many forms of carbohydrates. As a result, many carbohydrates need to be purified from their native sources. This is often a time consuming undertaking, which has restricted many labs from independently producing high throughput carbohydrate arrays. Fortunately, the potential benefits of carbohydrate arrays have been recognized by multiple government organizations and funding for the focused creation and sharing of carbohydrate arrays has been made available. The largest organization to create a reproducible and widely available carbohydrate array is the Consortium for Functional Glycomics (CFG), based in the US. The CFG was created through a 10 yr funding grant from the National Institute of General Medical Sciences (NIGMS) with the directive of creating tools with which to analyze carbohydrates and carbohydrate binding proteins, and to act as a hub for the sharing of related knowledge to researchers around the world [316].  7.2 Rationale In order to obtain information about the specific binding characteristics between Cpn60.2 and CD43, we chose to incorporate three assessment methods; competitive inhibition using various homologues of Cpn60.2, saturation binding of Cpn60.2 to CD43-Fc and a glycan array. The competitive inhibition assay should provide information about whether or not the binding of Cpn60.2 to CD43 is specific to mycobacteria. The attempt to saturate binding of Cpn60.2 to CD43-Fc should provide information about the the affinity of the bond between these proteins, specifically the binding constant, KD. Lastly, it was anticipated that the glycan array would provide us with information about whether or not Cpn60.2 interacts with specific carbohydrate 133  arrangements; both those found on CD43 and on other types of oligosaccharides. While these three techniques do not allow an exhaustive analysis of the binding between Cpn60.2 and CD43, they should provide a good initial exploration about this bimolecular interaction.  7.3 Results 7.3.1 Saturation curve of Cpn60.2 binding to CD43-Fc As most molecular chaperones, including Cpn60.2, bind to a multitude of different proteinaceous species [317], albeit at comparatively low affinities, we investigated the strength of binding between Cpn60.2 and CD43-Fc. The binding affinity between these two proteins was assessed using ELISA, where CD43-Fc was immobilized via polystyrene-adsorbed Protein A and a dose curve of Cpn60.2 in solution was subsequently added. Control wells were included with adsorbed Protein A without the subsequent addition of CD43-Fc to assess background binding. Also, the presence of immobilized CD43-Fc in the system was confirmed using the CD43-specific S11 mAb (data not shown). Three experiments were completed, each with two replicate wells per test value and the Cpn60.2 background binding levels were subtracted from the associated test well values before analysis. As shown in Figure 19, the SEM of the experimental values showed close alignment (R2 = 0.9) with the best fit curve for a nonlinear integration model assuming single-site binding (Y = (BmaxX / (KD + X)) between Cpn60.2 and CD43-Fc. Based on these results, Cpn60.2 binding to CD43-Fc has a Bmax of 0.477 and a KD of 1.3 µM.  134  7.3.2 Evaluation of M. tuberculosis/macrophage binding inhibition by various Cpn60.2 homologues As interspecies homologues of the 60kD molecular chaperone retain a high degree of sequence similarity, we evaluated whether several different 60kD molecular chaperones were able to mediate M. tuberculosis binding inhibition in the same manner as Cpn60.2 (sections 5.3.2 and 5.3.5). In addition to retesting M. tuberculosis Cpn60.2, we also chose to evaluate the function of E. coli GroEL as well as mouse and human Hsp60, all prepared at 5 µg mL-1 in binding medium. As M. tuberculosis DnaK did not function to reduce bacterial association in previous tests, we included this protein in our assay as an expected negative control.  All  proteins were added to both CD43+/+ and CD43-/- BMMΦ prior to the addition of M. tuberculosis at MOIs of 60:1 or 100:1. The levels of bacterial association with the BMMΦ after 3 hrs were evaluated through both microscopic bacilliary counts (Figure 20A) as well as CFU growth (Figure 20B) after 3 wks. Closely reproducing the results observed in section 6.3.5, we found that M. tuberculosis Cpn60.2 was able to inhibit the subsequent association of M. tuberculosis bacilli in the CD43+/+ BMMΦ, but this effect was largely lost in the CD43-/BMMΦ. Also, mycobacterial DnaK was not able to significantly inhibit bacterial association in either CD43+/+ or CD43-/- BMMΦ (P > 0.05 compared to binding medium alone of associated genotype).  The mammalian versions of Hsp60 did not show inhibitory function at the  concentrations tested in either CD43+/+ or CD43-/- BMMΦ (P > 0.05 compared to binding medium alone of associated genotype). However, E. coli GroEL mediated a significant level of binding inhibition to the CD43+/+ BMMΦ (P < 0.05 versus medium alone control of CD43+/+ BMMΦ).  The level of inhibition caused by GroEL in the CD43+/+ BMMΦ for both the  microscopy and CFU analyses (24% and 16%, respectively) was less than that seen with 135  Cpn60.2 (33% and 24%, respectively). However, the levels of bacterial association reduction caused by Cpn60.2 versus GroEL for both analysis methods employing CD43+/+ BMMΦ were not significantly different (P > 0.05). Additionally, neither GroEL, nor Cpn60.2 significantly reduced the association of M. tuberculosis with CD43-/- (P > 0.05 compared to binding medium alone control of CD43-/- BMMΦ). Based on the types of 60kD molecular chaperones tested in our studies, we found that the two bacterial homologues mediated inhibition of M. tuberculosis association with MΦ that is largely CD43-dependent, while the mammalian homologues did not. 7.3.3 Evaluation of Cpn60.2 and DnaK binding to carbohydrates using a glycan array The evaluation of whether Cpn60.2 and/or DnaK specifically bind to carbohydrate residues was explored through the use of a printed glycan array containing 320 unique glycan arrangements commonly found within mammalian cells. For this work, Alexa Fluor 488-labeled Cpn60.2 protein was first employed. This fluorescently labeled protein was allowed to incubate with the various glycans on the array and sites where Cpn60.2 bound were assessed via fluorimetry. The results from this initial analysis did not indicate that Cpn60.2 was able to reproducibly adhere to any of the array glycans with strong affinity. This test was repeated with both unlabeled Cpn60.2 and DnaK and detection of molecular chaperone binding to the glycan array was attempted using two different antibodies against the His-tags of the recombinant proteins. However, no substantial binding to specific carbohydrate residues was observed in any of these tests. Furthermore, due to the unavailability of a positive control for these analyses, these results were deemed inconclusive. The results of this work, including the descriptions of the glycans that were present on the array are shown in Appendix I.  136  7.4 Discussion and summary Upon determining that the M. tuberculosis molecular chaperones, Cpn60.2 and DnaK, are surface associated (Chapter 5) and Cpn60.2 functions as as adhesin for CD43 (Chapter 6), we chose to begin characterizing the Cpn60.2/CD43 interaction on a molecular level. As it is a widely held view that molecular chaperones are ‘sticky’ proteins, our first goal was to determine whether the binding of Cpn60.2 to CD43 could be shown to be specific and saturable. To analyze this we designed an ELISA that contained a set quantity of immobilized CD43-Fc and subsequently added a range of Cpn60.2 concentrations. In an attempt to keep the ELISA system simple, we originally attempted to adsorb CD43-Fc directly to the polystyrene well but found that it could not effectively be immobilized. Alternatively, by first adsorbing Protein A and then introducing CD43-Fc, CD43-Fc remained fixed within the system. This latter procedure likely had an additional benefit of reducing issues of steric hindrance as the CD43-Fc proteins would be oriented away from the bottom of the wells. Although we had fluorescently-labeled versions of Cpn60.2 available, we decided to employ an antibody-based colorimetric detection method as we had much greater quantities of unlabeled Cpn60.2 available.  Although we originally  observed increased levels of background binding (i.e. Cpn60.2 binding to Protein A), this problem was largely overcome by using a more stringent blocking agent containing 5% BSA with 0.1% Tween 20 in PBS. After subtracting residual levels of background binding, we were able to generate a set of values showing binding of Cpn60.2 to CD43-Fc.  Although  comparatively high concentrations of Cpn60.2 were required to approach levels of CD43 saturation, we were able to generate a range of values that showed a good fit (R2 = 0.9) with a saturation curve based on a model of single-site binding. As the Bmax of this model suggested binding saturation would occur at an absorbance of 0.477, taking the Cpn60.2 concentration at 137  1/2 of the Bmax (i.e. 0.2385) provided a calculated KD value of 1.3 µM. As the affinity between Cpn60.2 and CD43 is of a low micromolar level, it appears that the binding between these two compounds is comparatively weak on a molar basis. Notably, one study that investigated the affinity of human Hsp60 binding to MΦ determined a KD of 300 nM, a value within one order of magnitude of our findings [298].  Thus, although the individual molecular interactions  between Cpn60.2 and CD43 appear to be comparatively weak, they do appear to be specific and saturable. As homologues of the 60kD molecular chaperone between species retains a high degree of sequence conservation, we wished to determine whether similar proteins from other species could function to competively inhibit binding of M. tuberculosis through binding of MΦ CD43. As the 60kD molecular chaperone (GroEL) from E. coli is well characterized and shares 59% sequence identity with Cpn60.2 [318], we chose to examine this protein as a comparative bacterial homologue. We also examined whether mammalian (murine and human) homologues of the 60kD molecular chaperone, termed Hsp60, can mimick the effects of soluble Cpn60.2 with regards to competitively inhibiting mycobacterial binding. Mammalian Hsp60 proteins commonly share 40-50% amino acid sequence homology with Cpn60.2 [319,320]. Published research suggested that mammalian and bacterial homologues of Hsp60/65 bind to the MΦ at different sites [292]. We therefore wanted to investigate this further in our bacterial association assay. The findings from our competitive inhibition assay (Figure 20) show that the mouse and human Hsp60 proteins do not significantly alter the subsequent association of M. tuberculosis to either CD43+/+ or CD43-/- BMMΦ. Conversely, Cpn60.2, and to a lesser extent GroEL, both showed the capacity to competitively inhibit the subsequent association of M. tuberculosis with BMMΦ. Thus, in agreement with other reports [292], our results provide evidence that bacterial 138  homologues of the 60kD molecular chaperone interact with the MΦ differently than mammalian homologues. Furthermore, both Cpn60.2 and GroEL lost their ability to competitively inhibit M. tuberculoisis binding to BMMΦ in the absence of CD43 expression. These results suggest that non-mycobacterial species can employ surface localized homologues of Cpn60.2 to bind MΦ CD43, which appears to run counter to previous findings showing that S. flexneri, S. typhimurium and L. monocytogenes do not rely upon MΦ CD43 for host cell binding. However, E. coli GroEL has not been shown to be localized on the bacterial surface, and it cannot be assumed that the aforementioned bacteria have homologues of Cpn60.2 that also bind CD43. Thus, further research in this area should elucidate whether or not other bacteria employ homologues of Cpn60.2 as a means of facilitating MΦ binding via CD43. Lastly, as CD43 is highly glycosylated, we investigated whether or not Cpn60.2 and DnaK have the capacity to bind directly to isolated oligosaccharides. To conduct this analysis in a comprehensive fashion, we employed the use of a glycan array which contains 320 immobilized oligosaccharides that are relevant to mammalian cells, including the oligosaccharides found on CD43. To simplify this analysis, we first tried to use an Alexa Fluor 488-conjugated form of Cpn60.2 to bind to relevant oligosachharides on the array. However, this method of analysis did not yield results indicating strong and specific binding to any of the array oligosaccharides. Considering that the addition of the fluorescent dye may have altered the binding capacity of Cpn60.2, we completed this test two more times with both Cpn60.2 and DnaK using two versions of anti-His antibodies to detect bound proteins. Unfortunately, these strategies did not yield conclusive information about whether or not these molecular chaperones can bind to carbohydrates. Although the results of five test methods (three with Cpn60.2, two with DnaK – see Appendix I) did not provide results that showed strong and specific binding of 139  either Cpn60.2 and DnaK to any of the 320 oligosaccharides, these results were deemed to be inconclusive as we were not able to include a positive control for defined Cpn60.2 and DnaK binding. To summarize the results of this Chapter, Cpn60.2 appears to bind to CD43 in a specific manner, although the affinity is comparatively weak in the 1 µM range. Furthermore, the interaction of Cpn60.2 with MΦ in the context of M. tuberculosis binding is strongest with mycobacterial Cpn60.2, although GroEL from E.coli shows some function in this regard as well. Both Cpn60.2 and GroEL mediate mycobacterial binding inhibition in a CD43-dependent manner. The mammalian Hsp60 proteins did not mediate mycobacterial binding inhibition. Lastly, Cpn60.2 and DnaK do not appear to solely mediate strong binding to the CD43 carbohydrate domains.  140  Figure 19: Saturation curve of Cpn60.2 binding to CD43-Fc CD43-Fc was immobilized to polystyrene via adsorbed Protein A. All wells were blocked with 5% (w/v) BSA and 0.1% (v/v) Tween 20 in PBS. Cpn60.2 at indicated concentrations was diluted with blocking agent prior to incubation with Protein A-immobilized CD43-Fc. After several washes with 0.1% (v/v) Tween 20 in PBS, bound Cpn60.2 was detected with an anti-His antibody (1:1000) followed by addition of an anti-mouse-AP secondary antibody and colorimetric detection with AP substrate and reading absorbance at 405nm. Control wells showing background binding of Cpn60.2 to adsorbed Protein A were subtracted from the experimental values. Data points show the mean and SEM of three experimental results, each having two replicates. A non-linear regression curve assuming single site binding was applied to the data set (solid line) and the 95% CI is shown (dashed lines). R2 = 0.9 and best fit values of Bmax = 0.477 and KD = 1.3 µM.  141  Figure 20: M. tuberculosis/macrophage binding inhibition by various Cpn60.2 homologues Murine C57BL/6 BMMΦ from CD43+/+ and CD43-/- littermates were differentiated upon coverslips over 7 days prior to use. Binding of M. tuberculosis bacilli to BMMΦ at two different MOI was evaluated in the presence of control and test compounds. Where indicated, the BMMΦ or M. tuberculosis bacilli were pre-incubated with 5 µg mL-1 of the indicated compounds (M. tuberculosis Cpn60.2, E. coli GroEL, murine Hsp60, human Hsp60, M. tuberculosis DnaK). After 3 hrs of interaction, unbound bacteria were washed away and the BMMΦ were either fixed for microscopy-based association counts, where the MΦ population able to bind ≥1 bacteria was assessed (A), or lysed with brief sonication to allow the bound/ingested bacteria to be plated and subsequently enumerated via CFU growth (B). Results show the mean ± SEM of three individual experiments done in duplicate (* P < 0.05, ** P < 0.01 when compared with binding medium alone control of the same genotype and MOI).  142  Chapter 8: Final Discussion and Summary If the term success can be paralleled with longevity, then M. tuberculosis is one of the most successful documented human pathogens. Subtlety and persistence appear to be the hallmark features that are employed by M. tuberculosis to find a viable niche to survive within the human host. Just as growth of these bacteria is exceptionally slow, so is the progression of TB disease. Indeed, a truly successful pathogen must ensure that the host does not succumb to infection prior to passing the infectious agent to a new carrier. In this regard, M. tuberculosis seems to have established an effective strategy that includes a progressive chronic infection with an effective airborne transmission route (via coughing) to infect naïve individuals. The cycle of infection and transmission involves many steps and it is reasonable to define the arrival of a M. tuberculosis bacillus into the lungs of a naïve individual as being the first step of infection. Thus, understanding how this initial interaction between the pathogen and host progresses may provide clues as to how an infection can be stopped, or altered, from the outset. This research description has been designed to provide insights into the initial molecular interactions between a sentinel cell that is found in the lung, the MΦ, and the pathogen of interest, M. tuberculosis. More specifically, the experiments described herein provide information about the roles of a MΦ surface moiety named CD43 and two M. tuberculosis molecular chaperones, Cpn60.2 and DnaK. At the outset of this study, published findings provided evidence to suggest that CD43 plays a role in the association of M. tuberculosis with MΦ [29,135,136] and in the host’s ability to control survival and growth of M. tuberculosis [29,136]. These results were intriguing because CD43 had not previously been implicated as a site of microbial attachment to host cells. However, it was found that CD43 is necessary for allowing efficient mycobacterial attachment 143  to a variety of MΦ types [136], in addition to conferring mycobacterial-binding capacity to CD43-transfected HeLa cells [135]. Thus, CD43 appears to function in a mycobacterial binding capacity across a variety of cell types. Of further interest, it seems that the role of CD43 in mediating bacterial association is currently limited to the mycobacteria, as efforts to identify a role for CD43 in binding Gram positive and Gram negative bacteria were unsuccessful [135,136]. Thus, these previous reports suggest that CD43 exists as a unique MΦ receptor that interacts only with mycobacteria, a contention which is without precedent. However, when one considers the many unique structural elements that exist within mycobacteria, perhaps it is not surprising that a mycobacterial-specific MΦ receptor exists. The overriding hypothesis of my research was that an as yet unidentified mycobacterial ligand(s) exists that mediates M. tuberculosis binding to CD43, and therefore, to the MΦ. To address this inquiry, a CD43-Fc chimera was characterized prior to its use in an affinity chromatography system where moieties from the capsule of M. tuberculosis were allowed to interact with the immobilized CD43-Fc. The results from this assay demonstrated that Cpn60.2 is the predominant capsular protein that binds CD43-Fc, with DnaK showing binding at a lesser extent (Chapter 5). It was somewhat unexpected that the candidate mycobacterial ligands for CD43 were identified as molecular chaperones that share homologues amongst nearly every type of species found on earth [309]. Due to their ubiquity and capacity to protect cells against stresses, this class of proteins has received a comparatively large amount of research attention. The most studied bacterial chaperone is the E.coli GroEL (Hsp60/65) protein, and its gene product was first described in the 1970s when it was associated with viability and growth at increased temperatures [321,322,323]. In E.coli, GroEL confers viability by facilitating the correct folding of many intracellular proteins through the formation of a large ATP-dependent 144  multimeric complex with GroES [324]. DnaK (Hsp70) also promotes intracellular protein folding, and works with the smaller protein, DnaJ, in this capacity [325]. For these activities, both GroEL and DnaK function through the recognition of exposed hydrophobic areas on misfolded proteins [325]. The mycobacteria are part of a limited number of high G+C bacterial species that retain multiple copies of Cpn60 [326]. Phylogenetic analysis suggests that these genes resulted from one or more gene duplication events followed by varied rates of evolutionary change [327,328].  M. leprae, M. bovis and M. tuberculosis all have two  paralogues of Cpn60; designated Cpn60.1 (GroEL1) and Cpn60.2 (GroEL2, Hsp65). The two gene products of Cpn60.1 and Cpn60.2 from M. tuberculosis share 61% sequence identity and this difference seems to confer several divergent functions for these two proteins [318]. Like GroEL in E.coli, Cpn60.2 also shows hydrophobicity-based protein folding activity.  This  function seems to result from the formation of a Cpn60.2 homodimer that is less ATP-dependent than the GroE  (GroEL + GroES) complex [329].  While it is apparent that molecular  chaperones are necessary for viability (baseline expression of GroEL in non-stressed E. coli represents 1-2% of the total protein content [330]), their levels of expression increase following various stresses.  Environmental changes to pH, temperature, ionic concentrations, and  oxygen/nitrogen intermediates can all cause several-fold increases in the intracellular concentrations of molecular chaperones such as Hsp60 and Hsp70 [331]. However, research across many separate fields has provided support for the contention that molecular chaperones have additional functional roles besides aiding intracellular protein folding. Prior to the elucidation of the protein folding roles of molecular chaperones, some of these proteins were already recognized as being potent antigens.  In fact, several bacterial  Hsp60 homologues had come to be termed ‘common antigen’ as they each invoked a robust 145  immune response in mammalian hosts [332].  It has been shown that up to 20% of the  mycobacterial-reactive CD4+ T cells from mice immunized with killed M. tuberculosis were specific for Cpn60 [333]. There is often cross reactivity between antibodies raised against a particular Hsp60 for homologous Hsp60 proteins from other species [288]. However, responses to pathogen derived Hsp70 are more generally restricted and are commonly species-specific [254]. The finding that an immune response raised against a bacterial Hsp60 protein can result in cross reactivity against Hsp60 homologues from other species has led to speculation this quality could have divergent implications for the host, potentially being harmful (e.g. autoimmune conditions), or beneficial (e.g. vaccination potential). There is a wealth of research that has investigated the relationship between autoimmune diseases and cross reactive immunity between host and microbial antigens and unfortunately conflicting reports abound.  For  example, adjuvant arthritis in mice (which resembles rheumatoid arthritis (RA) in humans) can be induced with complete Freund’s adjuvant [334], which is a mixture of mycobacterial compounds within an oil immersion [335]. It was later shown that the arthritogenic T-cell clone for this condition was specific for a mycobacterial Hsp60 epitope [336]. However, separate studies have found immunization with peptides that contain this same Hsp60 epitope, with recombinant Hsp60, or with virally expressed Hsp60 can confer both suppression and/or protection from this same condition [337,338,339,340]. Hsp60 has also been implicated in autoimmunity causing insulin-dependent diabetes mellitus (IDDM) in non-obese diabetic (NOD) mice. One study has found that adoptive transfer of CD4+ T cell clones raised against mycobacterial Hsp60 accelerates the onset of IDDM [341], yet the same research group has also shown that the incidence of IDDM in NOD mice can be reduced by immunizing these mice with mycobacterial Hsp60 [342]. Likely related, NOD mice are less likely to develop IDDM if 146  they have been infected with M. avium [343]. While few conclusive answers exist, bacteriallycaused autoimmunity to human Hsps has been implicated in many diseases, including: RA [334,344], reactive arthritis [345], systemic lupus erythematosus (SLE) [346,347], multiple sclerosis (MS) [348,349], Kawasaki disease [350], Behcet’s disease [351], psoriasis [352], and atherosclerosis [353,354]. The exact mechanisms that result in bacterially-stimulated autoimmunity are not fully understood, but it seems apparent that more frequent interactions with microbial antigens, especially parasitic pathogens, that contain proteins with a high similarity to self antigens can skew the host’s ability to distinguish between self and non-self antigens [355]. This hypothesis, coupled with the fact that mycobacterial and mammalian Hsp60 homologues share 40-50% homology [320], and that mycobacterial infections are normally chronic, may provide some insight as to why mycobacterial molecular chaperones are commonly implicated in the causes of autoimmune diseases.  Moreover, the paradigm of ‘self versus non-self’ may not be an  appropriate way to evaluate the development of mammalian immunity, and the ‘Danger’ model may better explain why autoimmunity to self molecular chaperones develops [356]. In the Danger model it is reasoned that the host mounts immune responses when it receives particular damage signals from host cells. These endogenous signals include the release, or surface presentation, of compounds from stressed or damaged cells [356]. In this regard mammalian host molecular chaperones that are normally concentrated within the cytosol represent a potential signal of cellular damage [356]. Indeed it has been found that mammalian molecular chaperones are localized to the surface of stressed cells [268], and necrotic cells efficiently release cytosolic molecular chaperones while apoptotic cells do not [357]. Thus, while the host may retain a natural level of self molecular chaperone recognition, this delicate balance may be 147  influenced by ongoing exposure to certain bacterial molecular chaperones. Alternatively, it may be that bacteria have evolved a type of molecular mimicry of host molecular chaperones to elicit an immune response that favours the bacterium. There are some interesting examples to suggest that bacterial molecular chaperones have the capacity to retain their chaperone functions while evolving to their environmental niche with additional functionality.  The oral bacterium  Actinobacillus actinomycetemcomitans has been found to employ its Cpn60 protein as a means of stimulating osteoclast function that results in the breakdown of periodontal bone [122,358]. For unclear reasons, the Hsp60 proteins from both humans and some other bacteria (e.g. E. coli) also have this function [359,360], as well as M. tuberculosis Cpn10 [361]. M. tuberculosis Cpn60.2 does not function in this regard and M. tuberculosis Cpn60.1 actually inhibits this function [362]. Perhaps the most interesting functions of bacterial Hsp60 are those involving insect symbiosis [363]. In one example, the lacefly larvae, termed an antlion (or doodlebug), immobilizes its prey through the delivery of a neurotoxin upon biting. It has been determined that the actual source of this neurotoxin is an oral bacterium harboured by the antlion called Enterobacter aerogenes. Furthermore, the toxin itself is the bacterial GroEL protein, and it’s been shown that a single amino acid substitution in E. coli GroEL confers this insect neurotoxin function [364]. As introduced in Chapter 5 (section 5.4), in addition to the many non-folding functions of bacterial molecular chaperones listed above, adhesin function has been identified for many bacterial species as well (see Table 1). Indeed, one of the primary findings of this thesis is that M. tuberculosis appears to employ Cpn60.2 as an adhesin. However, an unanswered inquiry across many of these research descriptions is an understanding of why and how these classically cytosolic proteins began accessing the extracytosolic space. 148  The recent finding that the GroE complex is necessary for the formation and maintenance of the E. coli cell wall suggests that these proteins may have originally localized to the cell wall as a need for simple cellular maintenance [365]. Also, GroEL (Cpn60.1) from M. smegmatis has been implicated in the formation of mycolic acids, again suggesting a functional role within the cell wall [366]. If these reports are accurate, they suggest that part of the reason that bacterial molecular chaperones leave the cytosolic space is due to required construction and maintenance of the cell wall. Thus, the additional roles that molecular chaperones have outside of the bacterium (e.g. host cell binding) may have evolved as a byproduct of this extracellular localization. An additional means by which the Cpn60 proteins may have attained additional functions is the fact that the mycobacteria contain multiple copies of these proteins. The finding that only Cpn60.2 is necessary for viability suggests that Cpn60.1 and Cpn60.2 have unique roles within the bacterium [303]. Moreover, the observation that Cpn60.1 has unique extracellular functional attributes provides evidence to suggest that a molecular chaperone can evolve to have non-traditional functions if another functional copy is retained for the necessary mechanisms that confer cellular viability [303]. It is notable that M. tuberculosis does not appear to mediate intracellular protein folding in the same fashion as E. coli (i.e. with the multimeric GroE complex), yet mycobacteria contains a homologous bicistronic pairing of molecular chaperone proteins, Cpn60.1 and Cpn10, respectively. While both of these latter proteins are dispensible for M. tuberculosis viability, it has been found that the Cpn60.1/Cpn10 operon is upregulated under heat stress in M. smegmatis, suggesting that they have retained the same environmental stimulus as that found in E. coli [367]. Genetic evolution analyses provide evidence that an ancient mycobacterial ancestor gained an additional Cpn60 copy at some point (i.e. Cpn60.2), and since that time Cpn60.1 has undergone a more rapid level of nonsynonomous 149  mutation, apparently leading to a form that is not strictly required for protein folding, while Cpn60.2 has evolved to facilitate protein folding without the need of Cpn10 [267,329]. The mechanism through which molecular chaperones passage across the plasma membrane remains poorly defined. While multiple hypotheses can be presented (see section 5.4), it is anticipated that ongoing research in this area will provide more definitive information about the mechanism(s) through which molecular chaperones are exported from the cytosol. While the primary finding of this research description is that M. tuberculosis employs surface associated Cpn60.2 to mediate MΦ association via CD43, there are still outstanding questions that, if answered, will provide an improved understanding of the relationship between mycobacterial Cpn60.2 and CD43 in the context of how M. tuberculosis interacts with the MΦ. For example, while the affinity chromatography study suggested that Cpn60.2 (and DnaK) can interact with purified CD43-Fc directly, this finding should not lead to the assumption that these molecular chaperones interact with MΦ-expressed CD43 in a singular fashion. The possibility remains that CD43 naturally functions within the context of a group of MΦ surface molecules, akin to the finding by Triantafilou et al (2001) that LPS interacts with a CD14-independent cluster of four different surface proteins [368].  Just as many of the TLRs function as  heterodimers with accessory proteins, it cannot be discounted that CD43 relies upon other surface proteins to mediate effective bacterial binding and/or signal transduction. The finding that CD43 can passage across the cell membrane suggests that it has the capacity to form molecular rafts with other surface proteins [151]. Additionally, the demonstration that soluble CD43 can overcome the deficiency of mycobacterial binding in CD43-/- MΦ suggests that while M. tuberculosis can bind CD43 directly, CD43 appears to interact with other MΦ entities itself [135]. Potential binding partners of CD43 on the MΦ surface, as per published data, include 150  sialoadhesin (Siglec-1) [170,369], ICAM-1 [165], MHC class I [169], and Galectin-1 [168]. Alternatively, it may be the case that Cpn60.2 and CD43 do not form strong independent bonds, but this interaction may be necessary to allow subsequent ligand-receptor interactions to effectively take place. Much of the knowledge about CD43 suggests that it often plays the role of an intercellular binding modulator, allowing some receptor-ligand interactions to take place more readily, while limiting other interactions [370]. In this regard, the apparently weak bond between Cpn60.2 and CD43 may provide a ‘tethering’ association between the bacillus and the MΦ (loosely comparable to the ‘tether, roll and stick’ events of leukocytes upon stimulated endothelium [164]), that allows for stronger subsequent bonds to occur, such as binding by the phagocytic CR3 receptor, or signaling via TLRs. Of course, even weak bonds can have greater relevance when there are many of them, the strong adhesiveness of the synthetic textile Velcro®, or the ‘burrs’ of a burdock plant are visual examples of this. Working toward a more complete understanding of the greater context of how Cpn60.2 and CD43 interact during M. tuberculosis association with the MΦ will require continued research on this interesting topic. Thus far, our data provide experimental groundwork that indicates that these two enigmatic molecules, M. tuberculosis Cpn60.2 and MΦ CD43, interact in a functional manner to promote bacterial adherence. Future Directions 1. Identification of the epitopes of both Cpn60.2 and CD43 involved in binding. Although we have provided information to show that Cpn60.2 binds to CD43 in a specific and saturatable manner, the epitope(s) of Cpn60.2 involved in this association are unknown at present. Furthermore, as the results of our glycan array were inconclusive, it is still not known if the relevant epitopes on CD43 involve carbohydrates and/or peptides. 151  2. Relevance of Cpn60.1, the M. tuberculosis homologue of Cpn60.2, for MΦ binding. All the studies completed in this research description only analyzed Cpn60.2 (due to Cpn60.2 being identified via the affinity chromatography analysis), however the fact that Cpn60.1 shares 61% sequence homology with Cpn60.2 suggests that it may have a similar role with regards to MΦ interactions.  3. Evaluation of the M. tuberculosis surface levels of Cpn60.2 upon bacterial stresses. It is well established that various bacterial stresses (e.g. heating, oxidative challenges) lead to increased expression of the 60kD molecular chaperone. It would be interesting to determine whether or not the surface levels of Cpn60.2 are increased upon bacterial stress, and if so, whether increased levels of Cpn60.2 enhance bacterial uptake into MΦ.  4. Is CD43 a PRR and is Cpn60.2 a PAMP? The findings to date suggest that CD43 recognizes bacterial homologues of the 60kD molecular chaperone, but not mammalian homologues. Furthermore, the studies of Randhawa et al. show that MΦ have reduced TNFα release and are less bactericidal in the absence of CD43 [29].  Continued analysis of Cpn60.2-mediated CD43 signalling should provide additional  information about whether or not CD43 can be considered a PRR and whether or not molecular chaperones can be termed PAMPs.  152  References 1. Atkinson CE (1922) Lessons on tuberculosis and consumption. New York: Funk & Wagnalls Company. 2. van der Wel NN, Fluitsma DM, Dascher CC, Brenner MB, Peters PJ (2005) Subcellular localization of mycobacteria in tissues and detection of lipid antigens in organelles using cryo-techniques for light and electron microscopy. Curr Opin Microbiol 8: 323-330. 3. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537 544. 4. Gordon SV, Eiglmeier K, Garnier T, Brosch R, Parkhill J, et al. (2001) Genomics of Mycobacterium bovis. Tuberculosis (Edinb) 81: 157-163. 5. Eiglmeier K, Parkhill J, Honore N, Garnier T, Tekaia F, et al. (2001) The decaying genome of Mycobacterium leprae. Lepr Rev 72: 387-398. 6. Dutt A (2006) Epidemiology and Host Factors. In: Schlossberg D, editor. Tuberculosis & Nontuberculous Mycobacterial Infections. 5th ed. Toronto: McGraw-Hill. pp. 1-17. 7. Gandy M, Zumla A (2003) Introduction. In: Gandy M, Zumla A, editors. The Return of the White Plague. New York: Verso. pp. 7-14. 8. Chalke HD (1962) The impact of tuberculosis on history, literature and art. Medical History. pp. 301-318. 9. Murray CJ, Styblo K, Rouillon A (1990) Tuberculosis in developing countries: burden, intervention and cost. Bull Int Union Tuberc Lung Dis 65: 6-24. 10. Gandy M (2003) Life without Germs: Contested Episodes in the History of Tuberculosis. In: Gandy M, Zumla A, editors. The Return of the White Plague. New York: Verso. pp. 1538. 11. Keers RY, Rigden BG, Young FH (1945) Pulmonary Tuberculosis: A Handbook for Students and Practitioners. Edinburgh: E. & Livingston. 12. Lewontin R, Lewis R (2003) Prologue: The Return of Old Diseases and the Appearance of New Ones. In: M. G, A. Z, editors. The Return of the White Plague. New York: Verso. pp. 1-6. 13. Bloom B (1994) Tuberculosis: Pathogenesis, Protection, and Control. Washington, DC: ASM Press. 637 p.  153  14. Kochi A, Vareldzis B, Styblo K (1993) Multidrug-resistant tuberculosis and its control. Res Microbiol 144: 104-110. 15. Narain JP, Raviglione MC, Kochi A (1992) HIV-associated tuberculosis in developing countries: epidemiology and strategies for prevention. Tuber Lung Dis 73: 311-321. 16. Corbett EL, Raviglione M (2005) Global Burden of Tuberculosis: Past, Present, and Future. In: Cole ST, Eisenach KD, McMurray DM, Jacobs Jr WR, editors. Tuberculosis and the Tubercle Bacillus. Washington, DC: ASM Press. pp. 3-12. 17. Braun MM, Truman BI, Maguire B, DiFerdinando GT, Jr., Wormser G, et al. (1989) Increasing incidence of tuberculosis in a prison inmate population. Association with HIV infection. Jama 261: 393-397. 18. Trunz BB, Fine P, Dye C (2006) Effect of BCG vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of costeffectiveness. Lancet 367: 1173-1180. 19. Soysal A, Millington KA, Bakir M, Dosanjh D, Aslan Y, et al. (2005) Effect of BCG vaccination on risk of Mycobacterium tuberculosis infection in children with household tuberculosis contact: a prospective community-based study. Lancet 366: 1443-1451. 20. Brewer TF (2000) Preventing tuberculosis with bacillus Calmette-Guerin vaccine: a metaanalysis of the literature. Clin Infect Dis 31 Suppl 3: S64-67. 21. Sterne JA, Rodrigues LC, Guedes IN (1998) Does the efficacy of BCG decline with time since vaccination? Int J Tuberc Lung Dis 2: 200-207. 22. Schlossberg D (2006) Tuberculosis and Nontuberculous Mycobacterial Infections. Toronto: McGraw-Hill. 523 p. 23. Gill WP, Harik NS, Whiddon MR, Liao RP, Mittler JE, et al. (2009) A replication clock for Mycobacterium tuberculosis. Nat Med 15: 211-214. 24. Stewart GR, Robertson BD, Young DB (2003) Tuberculosis: a problem with persistence. Nat Rev Microbiol 1: 97-105. 25. Johnson CM, Cooper AM, Frank AA, Bonorino CB, Wysoki LJ, et al. (1997) Mycobacterium tuberculosis aerogenic rechallenge infections in B cell-deficient mice. Tuber Lung Dis 78: 257-261. 26. Saunders BM, Frank AA, Orme IM, Cooper AM (2002) CD4 is required for the development of a protective granulomatous response to pulmonary tuberculosis. Cell Immunol 216: 65-72. 27. Selwyn PA, Hartel D, Lewis VA, Schoenbaum EE, Vermund SH, et al. (1989) A prospective study of the risk of tuberculosis among intravenous drug users with human immunodeficiency virus infection. N Engl J Med 320: 545-550. 154  28. Flynn JL, Goldstein MM, Chan J, Triebold KJ, Pfeffer K, et al. (1995) Tumor necrosis factor-alpha is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2: 561-572. 29. Randhawa AK, Ziltener HJ, Stokes RW (2008) CD43 controls the intracellular growth of Mycobacterium tuberculosis through the induction of TNF-alpha-mediated apoptosis. Cell Microbiol 10: 2105-2117. 30. Keane J (2005) TNF-blocking agents and tuberculosis: new drugs illuminate an old topic. Rheumatology (Oxford) 44: 714-720. 31. VanHeyningen TK, Collins HL, Russell DG (1997) IL-6 produced by macrophages infected with Mycobacterium species suppresses T cell responses. J Immunol 158: 330-337. 32. Gong JH, Zhang M, Modlin RL, Linsley PS, Iyer D, et al. (1996) Interleukin-10 downregulates Mycobacterium tuberculosis-induced Th1 responses and CTLA-4 expression. Infect Immun 64: 913-918. 33. Rojas RE, Balaji KN, Subramanian A, Boom WH (1999) Regulation of human CD4(+) alphabeta T-cell-receptor-positive (TCR(+)) and gammadelta TCR(+) T-cell responses to Mycobacterium tuberculosis by interleukin-10 and transforming growth factor beta. Infect Immun 67: 6461-6472. 34. Hirsch CS, Ellner JJ, Blinkhorn R, Toossi Z (1997) In vitro restoration of T cell responses in tuberculosis and augmentation of monocyte effector function against Mycobacterium tuberculosis by natural inhibitors of transforming growth factor beta. Proc Natl Acad Sci U S A 94: 3926-3931. 35. Flynn JL, Chan J (2001) Immunology of tuberculosis. Annu Rev Immunol 19: 93-129. 36. Flynn JL, Goldstein MM, Triebold KJ, Koller B, Bloom BR (1992) Major histocompatibility complex class I-restricted T cells are required for resistance to Mycobacterium tuberculosis infection. Proc Natl Acad Sci U S A 89: 12013-12017. 37. Serbina NV, Flynn JL (1999) Early emergence of CD8(+) T cells primed for production of type 1 cytokines in the lungs of Mycobacterium tuberculosis-infected mice. Infect Immun 67: 3980-3988. 38. Serbina NV, Liu CC, Scanga CA, Flynn JL (2000) CD8+ CTL from lungs of Mycobacterium tuberculosis-infected mice express perforin in vivo and lyse infected macrophages. J Immunol 165: 353-363. 39. Canaday DH, Ziebold C, Noss EH, Chervenak KA, Harding CV, et al. (1999) Activation of human CD8+ alpha beta TCR+ cells by Mycobacterium tuberculosis via an alternate class I MHC antigen-processing pathway. J Immunol 162: 372-379.  155  40. Lewinsohn DM, Grotzke JE, Heinzel AS, Zhu L, Ovendale PJ, et al. (2006) Secreted proteins from Mycobacterium tuberculosis gain access to the cytosolic MHC class-I antigen-processing pathway. J Immunol 177: 437-442. 41. Porcelli SA, Modlin RL (1999) The CD1 system: antigen-presenting molecules for T cell recognition of lipids and glycolipids. Annu Rev Immunol 17: 297-329. 42. Boom WH, Canaday DH, Fulton SA, Gehring AJ, Rojas RE, et al. (2003) Human immunity to M. tuberculosis: T cell subsets and antigen processing. Tuberculosis (Edinb) 83: 98106. 43. Tsukaguchi K, Balaji KN, Boom WH (1995) CD4+ alpha beta T cell and gamma delta T cell responses to Mycobacterium tuberculosis. Similarities and differences in Ag recognition, cytotoxic effector function, and cytokine production. J Immunol 154: 17861796. 44. Dieli F, Troye-Blomberg M, Ivanyi J, Fournie JJ, Krensky AM, et al. (2001) Granulysindependent killing of intracellular and extracellular Mycobacterium tuberculosis by Vgamma9/Vdelta2 T lymphocytes. J Infect Dis 184: 1082-1085. 45. Morita CT, Beckman EM, Bukowski JF, Tanaka Y, Band H, et al. (1995) Direct presentation of nonpeptide prenyl pyrophosphate antigens to human gamma delta T cells. Immunity 3: 495-507. 46. Korbel DS, Schneider BE, Schaible UE (2008) Innate immunity in tuberculosis: myths and truth. Microbes Infect 10: 995-1004. 47. Condos R, Rom WN, Liu YM, Schluger NW (1998) Local immune responses correlate with presentation and outcome in tuberculosis. Am J Respir Crit Care Med 157: 729-735. 48. Lasco TM, Turner OC, Cassone L, Sugawara I, Yamada H, et al. (2004) Rapid accumulation of eosinophils in lung lesions in guinea pigs infected with Mycobacterium tuberculosis. Infect Immun 72: 1147-1149. 49. Schluger NW, Rom WN (1998) The host immune response to tuberculosis. Am J Respir Crit Care Med 157: 679-691. 50. Borelli V, Banfi E, Perrotta MG, Zabucchi G (1999) Myeloperoxidase exerts microbicidal activity against Mycobacterium tuberculosis. Infect Immun 67: 4149-4152. 51. Appelberg R (2007) Neutrophils and intracellular pathogens: beyond phagocytosis and killing. Trends Microbiol 15: 87-92. 52. Segal AW (2005) How neutrophils kill microbes. Annu Rev Immunol 23: 197-223. 53. Pedrosa J, Saunders BM, Appelberg R, Orme IM, Silva MT, et al. (2000) Neutrophils play a protective nonphagocytic role in systemic Mycobacterium tuberculosis infection of mice. Infect Immun 68: 577-583. 156  54. Sugawara I, Udagawa T, Yamada H (2004) Rat neutrophils prevent the development of tuberculosis. Infect Immun 72: 1804-1806. 55. Tan BH, Meinken C, Bastian M, Bruns H, Legaspi A, et al. (2006) Macrophages acquire neutrophil granules for antimicrobial activity against intracellular pathogens. J Immunol 177: 1864-1871. 56. Seiler P, Aichele P, Bandermann S, Hauser AE, Lu B, et al. (2003) Early granuloma formation after aerosol Mycobacterium tuberculosis infection is regulated by neutrophils via CXCR3-signaling chemokines. Eur J Immunol 33: 2676-2686. 57. Seiler P, Aichele P, Raupach B, Odermatt B, Steinhoff U, et al. (2000) Rapid neutrophil response controls fast-replicating intracellular bacteria but not slow-replicating Mycobacterium tuberculosis. J Infect Dis 181: 671-680. 58. Eruslanov EB, Lyadova IV, Kondratieva TK, Majorov KB, Scheglov IV, et al. (2005) Neutrophil responses to Mycobacterium tuberculosis infection in genetically susceptible and resistant mice. Infect Immun 73: 1744-1753. 59. Martino A (2008) Mycobacteria and innate cells: critical encounter for immunogenicity. J Biosci 33: 137-144. 60. Reis e Sousa C (2004) Activation of dendritic cells: translating innate into adaptive immunity. Curr Opin Immunol 16: 21-25. 61. Dudziak D, Kamphorst AO, Heidkamp GF, Buchholz VR, Trumpfheller C, et al. (2007) Differential antigen processing by dendritic cell subsets in vivo. Science 315: 107-111. 62. Hickman SP, Chan J, Salgame P (2002) Mycobacterium tuberculosis induces differential cytokine production from dendritic cells and macrophages with divergent effects on naive T cell polarization. J Immunol 168: 4636-4642. 63. Bodnar KA, Serbina NV, Flynn JL (2001) Fate of Mycobacterium tuberculosis within murine dendritic cells. Infect Immun 69: 800-809. 64. Mariotti S, Teloni R, Iona E, Fattorini L, Giannoni F, et al. (2002) Mycobacterium tuberculosis subverts the differentiation of human monocytes into dendritic cells. Eur J Immunol 32: 3050-3058. 65. Hope JC, Thom ML, McCormick PA, Howard CJ (2004) Interaction of antigen presenting cells with mycobacteria. Vet Immunol Immunopathol 100: 187-195. 66. Schlesinger LS (1998) Mycobacterium tuberculosis and the complement system. Trends Microbiol 6: 47-49; discussion 49-50. 67. Hirsch CS, Ellner JJ, Russell DG, Rich EA (1994) Complement receptor-mediated uptake and tumor necrosis factor-alpha-mediated growth inhibition of Mycobacterium tuberculosis by human alveolar macrophages. J Immunol 152: 743-753. 157  68. Schlesinger LS, Bellinger-Kawahara CG, Payne NR, Horwitz MA (1990) Phagocytosis of Mycobacterium tuberculosis is mediated by human monocyte complement receptors and complement component C3. J Immunol 144: 2771-2780. 69. Stokes RW, Haidl ID, Jefferies WA, Speert DP (1993) Mycobacteria-macrophage interactions. Macrophage phenotype determines the nonopsonic binding of Mycobacterium tuberculosis to murine macrophages. J Immunol 151: 7067-7076. 70. Velasco-Velazquez MA, Barrera D, Gonzalez-Arenas A, Rosales C, Agramonte-Hevia J (2003) Macrophage--Mycobacterium tuberculosis interactions: role of complement receptor 3. Microb Pathog 35: 125-131. 71. Melo MD, Catchpole IR, Haggar G, Stokes RW (2000) Utilization of CD11b knockout mice to characterize the role of complement receptor 3 (CR3, CD11b/CD18) in the growth of Mycobacterium tuberculosis in macrophages. Cell Immunol 205: 13-23. 72. Stokes RW, Thorson LM, Speert DP (1998) Nonopsonic and opsonic association of Mycobacterium tuberculosis with resident alveolar macrophages is inefficient. J Immunol 160: 5514-5521. 73. Hetland G, Wiker HG (1994) Antigen 85C on Mycobacterium bovis, BCG and M. tuberculosis promotes monocyte-CR3-mediated uptake of microbeads coated with mycobacterial products. Immunology 82: 445-449. 74. Cywes C, Godenir NL, Hoppe HC, Scholle RR, Steyn LM, et al. (1996) Nonopsonic binding of Mycobacterium tuberculosis to human complement receptor type 3 expressed in Chinese hamster ovary cells. Infect Immun 64: 5373-5383. 75. Cywes C, Hoppe HC, Daffe M, Ehlers MR (1997) Nonopsonic binding of Mycobacterium tuberculosis to complement receptor type 3 is mediated by capsular polysaccharides and is strain dependent. Infect Immun 65: 4258-4266. 76. Wright SD, Silverstein SC (1983) Receptors for C3b and C3bi promote phagocytosis but not the release of toxic oxygen from human phagocytes. J Exp Med 158: 2016-2023. 77. Rooyakkers AW, Stokes RW (2005) Absence of complement receptor 3 results in reduced binding and ingestion of Mycobacterium tuberculosis but has no significant effect on the induction of reactive oxygen and nitrogen intermediates or on the survival of the bacteria in resident and interferon-gamma activated macrophages. Microb Pathog 39: 57-67. 78. Hickling TP, Clark H, Malhotra R, Sim RB (2004) Collectins and their role in lung immunity. J Leukoc Biol 75: 27-33. 79. Weis WI, Drickamer K (1996) Structural basis of lectin-carbohydrate recognition. Annu Rev Biochem 65: 441-473.  158  80. Clark HW, Reid KB, Sim RB (2000) Collectins and innate immunity in the lung. Microbes Infect 2: 273-278. 81. Gaynor CD, McCormack FX, Voelker DR, McGowan SE, Schlesinger LS (1995) Pulmonary surfactant protein A mediates enhanced phagocytosis of Mycobacterium tuberculosis by a direct interaction with human macrophages. J Immunol 155: 53435351. 82. Ferguson JS, Voelker DR, McCormack FX, Schlesinger LS (1999) Surfactant protein D binds to Mycobacterium tuberculosis bacilli and lipoarabinomannan via carbohydratelectin interactions resulting in reduced phagocytosis of the bacteria by macrophages. J Immunol 163: 312-321. 83. Henning LN, Azad AK, Parsa KV, Crowther JE, Tridandapani S, et al. (2008) Pulmonary surfactant protein A regulates TLR expression and activity in human macrophages. J Immunol 180: 7847-7858. 84. Gil M, McCormack FX, Levine AM (2009) Surfactant protein-A modulates cell surface expression of CR3 on alveolar macrophages and enhances CR3-mediated phagocytosis. J Biol Chem. 85. Beharka AA, Gaynor CD, Kang BK, Voelker DR, McCormack FX, et al. (2002) Pulmonary surfactant protein A up-regulates activity of the mannose receptor, a pattern recognition receptor expressed on human macrophages. J Immunol 169: 3565-3573. 86. Chroneos ZC, Abdolrasulnia R, Whitsett JA, Rice WR, Shepherd VL (1996) Purification of a cell-surface receptor for surfactant protein A. J Biol Chem 271: 16375-16383. 87. Garcia-Verdugo I, Sanchez-Barbero F, Soldau K, Tobias PS, Casals C (2005) Interaction of SP-A (surfactant protein A) with bacterial rough lipopolysaccharide (Re-LPS), and effects of SP-A on the binding of Re-LPS to CD14 and LPS-binding protein. Biochem J 391: 115-124. 88. Alcorn JF, Wright JR (2004) Surfactant protein A inhibits alveolar macrophage cytokine production by CD14-independent pathway. Am J Physiol Lung Cell Mol Physiol 286: L129-136. 89. Augusto LA, Synguelakis M, Johansson J, Pedron T, Girard R, et al. (2003) Interaction of pulmonary surfactant protein C with CD14 and lipopolysaccharide. Infect Immun 71: 61-67. 90. Sano H, Chiba H, Iwaki D, Sohma H, Voelker DR, et al. (2000) Surfactant proteins A and D bind CD14 by different mechanisms. J Biol Chem 275: 22442-22451. 91. Chiba H, Sano H, Iwaki D, Murakami S, Mitsuzawa H, et al. (2001) Rat mannose-binding protein a binds CD14. Infect Immun 69: 1587-1592. 159  92. Krieger M, Acton S, Ashkenas J, Pearson A, Penman M, et al. (1993) Molecular flypaper, host defense, and atherosclerosis. Structure, binding properties, and functions of macrophage scavenger receptors. J Biol Chem 268: 4569-4572. 93. Dunne DW, Resnick D, Greenberg J, Krieger M, Joiner KA (1994) The type I macrophage scavenger receptor binds to gram-positive bacteria and recognizes lipoteichoic acid. Proc Natl Acad Sci U S A 91: 1863-1867. 94. Zimmerli S, Edwards S, Ernst JD (1996) Selective receptor blockade during phagocytosis does not alter the survival and growth of Mycobacterium tuberculosis in human macrophages. Am J Respir Cell Mol Biol 15: 760-770. 95. Ernst JD (1998) Macrophage receptors for Mycobacterium tuberculosis. Infect Immun 66: 1277-1281. 96. Schlesinger LS (1993) Macrophage phagocytosis of virulent but not attenuated strains of Mycobacterium tuberculosis is mediated by mannose receptors in addition to complement receptors. J Immunol 150: 2920-2930. 97. Chieppa M, Bianchi G, Doni A, Del Prete A, Sironi M, et al. (2003) Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J Immunol 171: 4552-4560. 98. Speert DP, Silverstein SC (1985) Phagocytosis of unopsonized zymosan by human monocyte-derived macrophages: maturation and inhibition by mannan. J Leukoc Biol 38: 655-658. 99. Taylor PR, Martinez-Pomares L, Stacey M, Lin HH, Brown GD, et al. (2005) Macrophage receptors and immune recognition. Annu Rev Immunol 23: 901-944. 100. Kang PB, Azad AK, Torrelles JB, Kaufman TM, Beharka A, et al. (2005) The human macrophage mannose receptor directs Mycobacterium tuberculosis lipoarabinomannanmediated phagosome biogenesis. J Exp Med 202: 987-999. 101. Kang BK, Schlesinger LS (1998) Characterization of mannose receptor-dependent phagocytosis mediated by Mycobacterium tuberculosis lipoarabinomannan. Infect Immun 66: 2769-2777. 102. Schlesinger LS, Kaufman TM, Iyer S, Hull SR, Marchiando LK (1996) Differences in mannose receptor-mediated uptake of lipoarabinomannan from virulent and attenuated strains of Mycobacterium tuberculosis by human macrophages. J Immunol 157: 45684575. 103. Ortalo-Magne A, Dupont MA, Lemassu A, Andersen AB, Gounon P, et al. (1995) Molecular composition of the outermost capsular material of the tubercle bacillus. Microbiology 141: 1609-1620. 160  104. Ozanne V, Ortalo-Magné A, Vercellone A, Fournié JJ, Daffé M (1996) Cytometric detection of mycobacterial surface antigens - exposure of mannosyl epitopes and of the arabinan segment of arabinomannans. Journal of Bacteriology 178: 7254-7259. 105. Appelmelk BJ, den Dunnen J, Driessen NN, Ummels R, Pak M, et al. (2008) The mannose cap of mycobacterial lipoarabinomannan does not dominate the Mycobacterium-host interaction. Cell Microbiol 10: 930-944. 106. Yadav M, Schorey JS (2006) The beta-glucan receptor dectin-1 functions together with TLR2 to mediate macrophage activation by mycobacteria. Blood 108: 3168-3175. 107. Brown GD, Gordon S (2001) Immune recognition. A new receptor for beta-glucans. Nature 413: 36-37. 108. Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL, et al. (2002) Dectin-1 Is A Major ß-Glucan Receptor On Macrophages. J Exp Med 196: 407-412. 109. Rothfuchs AG, Bafica A, Feng CG, Egen JG, Williams DL, et al. (2007) Dectin-1 interaction with Mycobacterium tuberculosis leads to enhanced IL-12p40 production by splenic dendritic cells. J Immunol 179: 3463-3471. 110. Ferwerda G, Meyer-Wentrup F, Kullberg BJ, Netea MG, Adema GJ (2008) Dectin-1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages. Cell Microbiol 10: 2058-2066. 111. Kawakami K, Kinjo Y, Uezu K, Miyagi K, Kinjo T, et al. (2004) Interferon-gamma production and host protective response against Mycobacterium tuberculosis in mice lacking both IL-12p40 and IL-18. Microbes Infect 6: 339-349. 112. Quesniaux V, Fremond C, Jacobs M, Parida S, Nicolle D, et al. (2004) Toll-like receptor pathways in the immune responses to mycobacteria. Microbes Infect 6: 946-959. 113. Jones BW, Means TK, Heldwein KA, Keen MA, Hill PJ, et al. (2001) Different Toll-like receptor agonists induce distinct macrophage responses. J Leukoc Biol 69: 1036-1044. 114. Aliprantis AO, Yang RB, Mark MR, Suggett S, Devaux B, et al. (1999) Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 285: 736-739. 115. Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, et al. (1999) Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science 285: 732-736. 116. Gilleron M, Nigou J, Nicolle D, Quesniaux V, Puzo G (2006) The acylation state of mycobacterial lipomannans modulates innate immunity response through toll-like receptor 2. Chem Biol 13: 39-47.  161  117. Quesniaux VJ, Nicolle DM, Torres D, Kremer L, Guerardel Y, et al. (2004) Toll-Like Receptor 2 (TLR2)-Dependent-Positive and TLR2-Independent-Negative Regulation of Proinflammatory Cytokines by Mycobacterial Lipomannans. J Immunol. pp. 4425-4434. 118. Means TK, Lien E, Yoshimura A, Wang S, Golenbock DT, et al. (1999) The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J Immunol 163: 6748-6755. 119. Qazi KR, Oehlmann W, Singh M, Lopez MC, Fernandez C (2007) Microbial heat shock protein 70 stimulatory properties have different TLR requirements. Vaccine 25: 10961103. 120. Lewthwaite JC, Coates ARM, Tormay P, Singh M, Mascagni P, et al. (2001) Mycobacterium tuberculosis Chaperonin 60.1 Is a More Potent Cytokine Stimulator than Chaperonin 60.2 (Hsp 65) and Contains a CD14-Binding Domain. Infection and Immunity 69: 7349-7355. 121. Bulut Y, Michelsen KS, Hayrapetian L, Naiki Y, Spallek R, et al. (2005) Mycobacterium tuberculosis heat shock proteins use diverse Toll-like receptor pathways to activate proinflammatory signals. J Biol Chem 280: 20961-20967. 122. Kirby AC, Meghji S, Nair SP, White P, Reddi K, et al. (1995) The potent bone-resorbing mediator of Actinobacillus actinomycetemcomitans is homologous to the molecular chaperone GroEL. J Clin Invest 96: 1185-1194. 123. Henderson B, Mesher J (2007) The search for the chaperonin 60 receptors. Methods 43: 223-228. 124. Drennan MB, Nicolle D, Quesniaux VJ, Jacobs M, Allie N, et al. (2004) Toll-like receptor 2-deficient mice succumb to Mycobacterium tuberculosis infection. Am J Pathol 164: 49-57. 125. Abel B, Thieblemont N, Quesniaux VJ, Brown N, Mpagi J, et al. (2002) Toll-like receptor 4 expression is required to control chronic Mycobacterium tuberculosis infection in mice. J Immunol 169: 3155-3162. 126. Branger J, Leemans JC, Florquin S, Weijer S, Speelman P, et al. (2004) Toll-like receptor 4 plays a protective role in pulmonary tuberculosis in mice. Int Immunol 16: 509-516. 127. Reiling N, Holscher C, Fehrenbach A, Kroger S, Kirschning CJ, et al. (2002) Toll-Like Receptor (TLR)2- and TLR4-Mediated Pathogen Recognition in Resistance to Airborne Infection with Mycobacterium tuberculosis. J Immunol 169: 3480-3484. 128. Sugawara I, Yamada H, Li C, Mizuno S, Takeuchi O, et al. (2003) Mycobacterial infection in TLR2 and TLR6 knockout mice. Microbiol Immunol 47: 327-336.  162  129. Shim TS, Turner OC, Orme IM (2003) Toll-like receptor 4 plays no role in susceptibility of mice to Mycobacterium tuberculosis infection. Tuberculosis (Edinb) 83: 367-371. 130. Kamath AB, Alt J, Debbabi H, Behar SM (2003) Toll-Like Receptor 4-Defective C3H/HeJ Mice Are Not More Susceptible than Other C3H Substrains to Infection with Mycobacterium tuberculosis. Infect Immun 71: 4112-4118. 131. Caws M, Thwaites G, Dunstan S, Hawn TR, Lan NT, et al. (2008) The influence of host and bacterial genotype on the development of disseminated disease with Mycobacterium tuberculosis. PLoS Pathog 4: e1000034. 132. Cubillas-Tejeda AC, Ruiz-Arguelles A, Bernal-Fernandez G, Quiroz-Compean L, LopezDavila A, et al. (2003) Cytokine production and expression of leucocyte-differentiation antigens by human mononuclear cells in response to Mycobacterium tuberculosis antigens. Scand J Immunol 57: 115-124. 133. Maglione PJ, Xu J, Chan J (2007) B Cells Moderate Inflammatory Progression and Enhance Bacterial Containment upon Pulmonary Challenge with Mycobacterium tuberculosis. J Immunol 178: 7222-7234. 134. Maglione PJ, Xu J, Casadevall A, Chan J (2008) Fc gamma receptors regulate immune activation and susceptibility during Mycobacterium tuberculosis infection. J Immunol 180: 3329-3338. 135. Fratazzi C, Manjunath N, Arbeit RD, Carini C, Gerken TA, et al. (2000) A macrophage invasion mechanism for mycobacteria implicating the extracellular domain of CD43. Journal of Experimental Medicine 192: 183-192. 136. Randhawa AK, Ziltener HJ, Merzaban JS, Stokes RW (2005) CD43 is required for optimal growth inhibition of Mycobacterium tuberculosis in macrophages and in mice. J Immunol 175: 1805-1812. 137. Carlsson SR, Fukuda M (1986) Isolation and characterization of leukosialin, a major sialoglycoprotein on human leukocytes. J Biol Chem 261: 12779-12786. 138. Keller R, Joller PW, Keist R (1989) Surface phenotype of rat bone marrow-derived mononuclear phagocytes. Cell Immunol 120: 277-285. 139. Fukuda M, Tsuboi S (1999) Mucin-type O-glycans and leukosialin. Biochim Biophys Acta 1455: 205-217. 140. Baeckstrom D, Zhang K, Asker N, Ruetschi U, Ek M, et al. (1995) Expression of the leukocyte-associated sialoglycoprotein CD43 by a colon carcinoma cell line. J Biol Chem 270: 13688-13692. 141. Remold-O'Donnell E, Davis AE, 3rd, Kenney D, Bhaskar KR, Rosen FS (1986) Purification and chemical composition of gpL115, the human lymphocyte surface 163  sialoglycoprotein that is defective in Wiskott-Aldrich syndrome. J Biol Chem 261: 75267530. 142. Giordanengo V, Limouse M, Peyron JF, Lefebvre JC (1995) Lymphocytic CD43 and CD45 bear sulfate residues potentially implicated in cell to cell interactions. Eur J Immunol 25: 274-278. 143. Cyster JG, Shotton DM, Williams AF (1991) The dimensions of the T lymphocyte glycoprotein leukosialin and identification of linear protein epitopes that can be modified by glycosylation. Embo J 10: 893-902. 144. Corbi AL, Larson RS, Kishimoto TK, Springer TA, Morton CC (1988) Chromosomal location of the genes encoding the leukocyte adhesion receptors LFA-1, Mac-1 and p150,95. Identification of a gene cluster involved in cell adhesion. J Exp Med 167: 15971607. 145. Dorfman KS, Litaker W, Baecher CM, Frelinger JG (1990) The nucleotide sequence of Ly 48 (mouse leukosialin, sialophorin): the mouse homolog of CD43. Nucleic Acids Res 18: 4932. 146. Rieu P, Porteu F, Bessou G, Lesavre P, Halbwachs-Mecarelli L (1992) Human neutrophils release their major membrane sialoprotein, leukosialin (CD43), during cell activation. Eur J Immunol 22: 3021-3026. 147. Schmid K, Mao SK, Kimura A, Hayashi S, Binette JP (1980) Isolation and characterization of a serine-threonine-rich galactoglycoprotein from normal human plasma. J Biol Chem 255: 3221-3226. 148. Weber S, Babina M, Hermann B, Henz BM (1997) Leukosialin (CD43) is proteolytically cleaved from stimulated HMC-1 cells. Immunobiology 197: 82-96. 149. Mambole A, Baruch D, Nusbaum P, Bigot S, Suzuki M, et al. (2008) The cleavage of neutrophil leukosialin (CD43) by cathepsin G releases its extracellular domain and triggers its intramembrane proteolysis by presenilin/gamma-secretase. J Biol Chem 283: 23627-23635. 150. Andersson CX, Fernandez-Rodriguez J, Laos S, Baeckstrom D, Haass C, et al. (2005) Shedding and gamma-secretase-mediated intramembrane proteolysis of the mucin-type molecule CD43. Biochem J 387: 377-384. 151. de Petris S (1984) Lectin-binding and spontaneous capping characteristics of the thymocyte glycophorin-like glycoprotein. Exp Cell Res 152: 510-519. 152. Cullinan P, Sperling AI, Burkhardt JK (2002) The distal pole complex: a novel membrane domain distal to the immunological synapse. Immunol Rev 189: 111-122.  164  153. Fanales-Belasio E, Zambruno G, Cavani A, Girolomoni G (1997) Antibodies against sialophorin (CD43) enhance the capacity of dendritic cells to cluster and activate T lymphocytes. J Immunol 159: 2203-2211. 154. Delon J, Kaibuchi K, Germain RN (2001) Exclusion of CD43 from the immunological synapse is mediated by phosphorylation-regulated relocation of the cytoskeletal adaptor moesin. Immunity 15: 691-701. 155. Allenspach EJ, Cullinan P, Tong J, Tang Q, Tesciuba AG, et al. (2001) ERM-dependent movement of CD43 defines a novel protein complex distal to the immunological synapse. Immunity 15: 739-750. 156. Carlsson SR, Sasaki H, Fukuda M (1986) Structural variations of O-linked oligosaccharides present in leukosialin isolated from erythroid, myeloid, and T-lymphoid cell lines. J Biol Chem 261: 12787-12795. 157. Piller F, Piller V, Fox RI, Fukuda M (1988) Human T-lymphocyte activation is associated with changes in O-glycan biosynthesis. J Biol Chem 263: 15146-15150. 158. Andersson LC, Gahmberg CG (1978) Surface glycoproteins of human white blood cells. Analysis by surface labeling. Blood 52: 57-67. 159. Fukuda M, Carlsson SR (1986) Leukosialin, a major sialoglycoprotein on human leukocytes as differentiation antigens. Med Biol 64: 335-343. 160. Remold-O'Donnell E, Zimmerman C, Kenney D, Rosen FS (1987) Expression on blood cells of sialophorin, the surface glycoprotein that is defective in Wiskott-Aldrich syndrome. Blood 70: 104-109. 161. Tsuboi S, Fukuda M (1997) Branched O-linked oligosaccharides ectopically expressed in transgenic mice reduce primary T-cell immune responses. Embo J 16: 6364-6373. 162. Manjunath N, Correa M, Ardman M, Ardman B (1995) Negative regulation of T-cell adhesion and activation by CD43. Nature 377: 535-538. 163. Manjunath N, Johnson RS, Staunton DE, Pasqualini R, Ardman B (1993) Targeted disruption of CD43 gene enhances T lymphocyte adhesion. J Immunol 151: 1528-1534. 164. Stockton BM, Cheng G, Manjunath N, Ardman B, von Andrian UH (1998) Negative regulation of T cell homing by CD43. Immunity 8: 373-381. 165. Rosenstein Y, Park JK, Hahn WC, Rosen FS, Bierer BE, et al. (1991) CD43, a molecule defective in Wiskott-Aldrich syndrome, binds ICAM-1. Nature 354: 233-235. 166. Guan EN, Burgess WH, Robinson SL, Goodman EB, McTigue KJ, et al. (1991) Phagocytic cell molecules that bind the collagen-like region of C1q. Involvement in the C1qmediated enhancement of phagocytosis. J Biol Chem 266: 20345-20355. 165  167. Zhang K, Baeckstrom D, Brevinge H, Hansson GC (1997) Comparison of sialyl-Lewis acarrying CD43 and MUC1 mucins secreted from a colon carcinoma cell line for Eselectin binding and inhibition of leukocyte adhesion. Tumour Biol 18: 175-187. 168. Baum LG, Pang M, Perillo NL, Wu T, Delegeane A, et al. (1995) Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J Exp Med 181: 877-887. 169. Stockl J, Majdic O, Kohl P, Pickl WF, Menzel JE, et al. (1996) Leukosialin (CD43)-major histocompatibility class I molecule interactions involved in spontaneous T cell conjugate formation. J Exp Med 184: 1769-1779. 170. van den Berg TK, Nath D, Ziltener HJ, Vestweber D, Fukuda M, et al. (2001) Cutting edge: CD43 functions as a T cell counterreceptor for the macrophage adhesion receptor sialoadhesin (Siglec-1). J Immunol 166: 3637-3640. 171. McEvoy LM, Jutila MA, Tsao PS, Cooke JP, Butcher EC (1997) Anti-CD43 inhibits monocyte-endothelial adhesion in inflammation and atherogenesis. Blood 90: 35873594. 172. McEvoy LM, Sun H, Frelinger JG, Butcher EC (1997) Anti-CD43 inhibition of T cell homing. J Exp Med 185: 1493-1498. 173. Montufar-Solis D, Garza T, Klein JR (2005) Selective upregulation of immune regulatory and effector cytokine synthesis by intestinal intraepithelial lymphocytes following CD43 costimulation. Biochem Biophys Res Commun 338: 1158-1163. 174. Nieto M, Rodriguez-Fernandez JL, Navarro F, Sancho D, Frade JM, et al. (1999) Signaling through CD43 induces natural killer cell activation, chemokine release, and PYK-2 activation. Blood 94: 2767-2777. 175. Alvarado M, Klassen C, Cerny J, Horejsi V, Schmidt RE (1995) MEM-59 monoclonal antibody detects a CD43 epitope involved in lymphocyte activation. Eur J Immunol 25: 1051-1055. 176. Silverman LB, Wong RC, Remold-O'Donnell E, Vercelli D, Sancho J, et al. (1989) Mechanism of mononuclear cell activation by an anti-CD43 (sialophorin) agonistic antibody. J Immunol 142: 4194-4200. 177. Rosenkranz AR, Majdic O, Stockl J, Pickl W, Stockinger H, et al. (1993) Induction of neutrophil homotypic adhesion via sialophorin (CD43), a surface sialoglycoprotein restricted to haemopoietic cells. Immunology 80: 431-438. 178. Kim HJ, Park HJ, Park WS, Bae Y (2006) CD43 cross-linking increases the Fas-induced apoptosis through induction of Fas aggregation in Jurkat T-cells. Exp Mol Med 38: 357363. 166  179. Cermak L, Simova S, Pintzas A, Horejsi V, Andera L (2002) Molecular mechanisms involved in CD43-mediated apoptosis of TF-1 cells. Roles of transcription Daxx expression, and adhesion molecules. J Biol Chem 277: 7955-7961. 180. Bazil V, Brandt J, Chen S, Roeding M, Luens K, et al. (1996) A monoclonal antibody recognizing CD43 (leukosialin) initiates apoptosis of human hematopoietic progenitor cells but not stem cells. Blood 87: 1272-1281. 181. Bazil V, Brandt J, Tsukamoto A, Hoffman R (1995) Apoptosis of human hematopoietic progenitor cells induced by crosslinking of surface CD43, the major sialoglycoprotein of leukocytes. Blood 86: 502-511. 182. He YW, Bevan MJ (1999) High level expression of CD43 inhibits T cell receptor/CD3mediated apoptosis. J Exp Med 190: 1903-1908. 183. Keane J, Shurtleff B, Kornfeld H (2002) TNF-dependent BALB/c murine macrophage apoptosis following Mycobacterium tuberculosis infection inhibits bacillary growth in an IFN-gamma independent manner. Tuberculosis (Edinb) 82: 55-61. 184. Balcewicz-Sablinska MK, Keane J, Kornfeld H, Remold HG (1998) Pathogenic Mycobacterium tuberculosis evades apoptosis of host macrophages by release of TNFR2, resulting in inactivation of TNF-alpha. J Immunol 161: 2636-2641. 185. Thrasher AJ, Burns S (1999) Wiskott-Aldrich syndrome: a disorder of haematopoietic cytoskeletal regulation. Microsc Res Tech 47: 107-113. 186. Rocca B, Bellacosa A, De Cristofaro R, Neri G, Della Ventura M, et al. (1996) WiskottAldrich syndrome: report of an autosomal dominant variant. Blood 87: 4538-4543. 187. Derry JM, Kerns JA, Weinberg KI, Ochs HD, Volpini V, et al. (1995) WASP gene mutations in Wiskott-Aldrich syndrome and X-linked thrombocytopenia. Hum Mol Genet 4: 1127-1135. 188. Derry JM, Ochs HD, Francke U (1994) Isolation of a novel gene mutated in WiskottAldrich syndrome. Cell 78: 635-644. 189. Remold-O'Donnell E, Rosen FS (1990) Sialophorin (CD43) and the Wiskott-Aldrich syndrome. Immunodefic Rev 2: 151-174. 190. Jones GE, Zicha D, Dunn GA, Blundell M, Thrasher A (2002) Restoration of podosomes and chemotaxis in Wiskott-Aldrich syndrome macrophages following induced expression of WASp. Int J Biochem Cell Biol 34: 806-815. 191. Zicha D, Allen WE, Brickell PM, Kinnon C, Dunn GA, et al. (1998) Chemotaxis of macrophages is abolished in the Wiskott-Aldrich syndrome. Br J Haematol 101: 659665. 167  192. Giordanengo V, Limouse M, Desroys du Roure L, Cottalorda J, Doglio A, et al. (1995) Autoantibodies directed against CD43 molecules with an altered glycosylation status on human immunodeficiency virus type 1 (HIV-1)-infected CEM cells are found in all HIV1+ individuals. Blood 86: 2302-2311. 193. Ardman B, Sikorski MA, Settles M, Staunton DE (1990) Human immunodeficiency virus type 1-infected individuals make autoantibodies that bind to CD43 on normal thymic lymphocytes. J Exp Med 172: 1151-1158. 194. Lefebvre JC, Giordanengo V, Limouse M, Doglio A, Cucchiarini M, et al. (1994) Altered glycosylation of leukosialin, CD43, in HIV-1-infected cells of the CEM line. J Exp Med 180: 1609-1617. 195. Orentas RJ, Hildreth JE (1993) Association of host cell surface adhesion receptors and other membrane proteins with HIV and SIV. AIDS Res Hum Retroviruses 9: 1157-1165. 196. Ott DE, Coren LV, Johnson DG, Kane BP, Sowder RC, 2nd, et al. (2000) Actin-binding cellular proteins inside human immunodeficiency virus type 1. Virology 266: 42-51. 197. Peyron P, Vaubourgeix J, Poquet Y, Levillain F, Botanch C, et al. (2008) Foamy macrophages from tuberculous patients' granulomas constitute a nutrient-rich reservoir for M. tuberculosis persistence. PLoS Pathog 4: e1000204. 198. Crick DC, Mahapatra S, Brennan PJ (2001) Biosynthesis of the arabinogalactanpeptidoglycan complex of Mycobacterium tuberculosis. Glycobiology 11: 107R-118R. 199. Daffe M (2000) The mycobacterial antigens 85 complex - from structure to function and beyond. Trends Microbiol 8: 438-440. 200. Hunter RL, Venkataprasad N, Olsen MR (2006) The role of trehalose dimycolate (cord factor) on morphology of virulent M. tuberculosis in vitro. Tuberculosis (Edinb) 86: 349356. 201. Draper P (1971) The walls of Mycobacterium lepraemurium: chemistry and ultrastructure. J Gen Microbiol 69: 313-324. 202. Draper P (1974) The mycoside capsule of Mycobacterium Avium 357. J Gen Microbiol 83: 431-433. 203. Picard B, Frehel C, Rastogi N (1984) Cytochemical characterization of mycobacterial outer surfaces. Acta Leprologica 2: 227-235. 204. Rastogi N, Fréhel C, David HL (1986) Triple-layered structure of mycobacterial cell wall: evidence for the existence of a polysaccharide rich outer layer in 18 mycobacterial species. Curr Microbiol 13: 237-242. 205. Draper P, Rees RJ (1973) The nature of the electron-transparent zone that surrounds Mycobacterium lepraemurium inside host cells. J Gen Microbiol 77: 79-87. 168  206. Frehel C, Ryter A, Rastogi N, David H (1986) The electron-transparent zone in phagocytized Mycobacterium avium and other mycobacteria: formation, persistence and role in bacterial survival. Annales de l'Institut Pasteur - Microbiology 137B: 239-257. 207. Frehel C, Rastogi N, Benichou J-C, Ryter A (1988) Do test tube grown pathogenic mycobacteria possess a protective capsule? FEMS Microbiol Lett 56: 225-230. 208. Rastogi N, Hellio R (1990) Evidence that the capsule around mycobacteria grown in axenic media contains mycobacterial antigens: implications at the level of cell envelope architecture. FEMS Microbiology Letters 58: 161-166. 209. Paul TR, Beveridge TJ (1992) Reevaluation of envelope profiles and cytoplasmic ultrastructure of mycobacteria processed by conventional embedding and freezesubstitution protocols. Journal of Bacteriology 174: 6508-6517. 210. Paul TR, Beveridge TJ (1994) Preservation of surface lipids and determination of ultrastructure of Mycobacterium kansasii by freeze substitution. Infection and Immunity 62: 1542-1550. 211. Takade A, Umeda A, Matsuoka M, Yoshida S, Nakamura M, et al. (2003) Comparative studies of the cell structures of Mycobacterium leprae and M. tuberculosis using the electron microscopy freeze-substitution technique. Microbiol Immunol 47: 265-270. 212. Draper P, Daffé M (2005) The cell envelope of Mycobacterium tuberculosis with special reference to the capsule and outer permeability barrier. In: S.T. Cole KDE, D.N. McMurray and W.R. Jacobs Jr, editor. Tuberculosis and the tubercle bacillus. Washington, DC: American Society for Microbiology Press. pp. 261-273. 213. Lemassu A, Daffe M (1994) Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis. Biochem J 297 ( Pt 2): 351-357. 214. Ortalo-Magne A, Lemassu A, Laneelle MA, Bardou F, Silve G, et al. (1996) Identification of the surface-exposed lipids on the cell envelopes of Mycobacterium tuberculosis and other mycobacterial species. Journal of Bacteriology 178: 456-461. 215. Schwebach JR, Casadevall A, Schneerson R, Dai Z, Wang X, et al. (2001) Expression of a Mycobacterium tuberculosis arabinomannan antigen in vitro and in vivo. Infect Immun 69: 5671-5678. 216. Schwebach JR, Glatman-Freedman A, Gunther-Cummins L, Dai Z, Robbins JB, et al. (2002) Glucan is a component of the Mycobacterium tuberculosis surface that is expressed in vitro and in vivo. Infection and Immunity 70: 2566-2575. 217. Stokes RW, Norris-Jones R, Brooks DE, Beveridge TJ, Doxsee D, et al. (2004) The glycan rich outer layer of the cell wall envelope of Mycobacterium tuberculosis acts as an antiphagocytic capsule limiting the association of the bacterium with macrophages. Infect Immun 72: 5676-5686. 169  218. Stokes RW, Thorson LM, Speert DP (1998) Nonopsonic and opsonic association of Mycobacterium tuberculosis with resident alveolar macrophages is inefficient. J Immunol 160: 5514-5521. 219. Stokes RW, Norris-Jones R, Brooks DE, Beveridge TJ, Doxsee D, et al. (2004) The glycan-rich outer layer of the cell wall of Mycobacterium tuberculosis acts as an antiphagocytic capsule limiting the association of the bacterium with macrophages. Infect Immun 72: 5676-5686. 220. Abdallah AM, Gey van Pittius NC, Champion PA, Cox J, Luirink J, et al. (2007) Type VII secretion--mycobacteria show the way. Nat Rev Microbiol 5: 883-891. 221. Alderwick LJ, Birch HL, Mishra AK, Eggeling L, Besra GS (2007) Structure, function and biosynthesis of the Mycobacterium tuberculosis cell wall: arabinogalactan and lipoarabinomannan assembly with a view to discovering new drug targets. Biochem Soc Trans 35: 1325-1328. 222. Schlesinger LS, Hull SR, Kaufman TM (1994) Binding of the terminal mannosyl units of lipoarabinomannan from a virulent strain of Mycobacterium tuberculosis to human macrophages. J Immunol 152: 4070-4079. 223. McCarthy TR, Torrelles JB, MacFarlane AS, Katawczik M, Kutzbach B, et al. (2005) Overexpression of Mycobacterium tuberculosis manB, a phosphomannomutase that increases phosphatidylinositol mannoside biosynthesis in Mycobacterium smegmatis and mycobacterial association with human macrophages. Mol Microbiol 58: 774-790. 224. Stokes RW, Speert DP (1995) Lipoarabinomannan inhibits nonopsonic binding of Mycobacterium tuberculosis to murine macrophages. J Immunol 155: 1361-1369. 225. Hoppe HC, de Wet BJ, Cywes C, Daffe M, Ehlers MR (1997) Identification of phosphatidylinositol mannoside as a mycobacterial adhesin mediating both direct and opsonic binding to nonphagocytic mammalian cells. Infect Immun 65: 3896-3905. 226. Means TK, Lien E, Yoshimura A, Wang S, Golenbock DT, et al. (1999) The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. Journal of Immunology 163: 6748-6755. 227. Torrelles JB, Knaup R, Kolareth A, Slepushkina T, Kaufman TM, et al. (2008) Identification of Mycobacterium tuberculosis clinical isolates with altered phagocytosis by human macrophages due to a truncated lipoarabinomannan. J Biol Chem 283: 3141731428. 228. Schwebach JR, Glatman-Freedman A, Gunther-Cummins L, Dai Z, Robbins JB, et al. (2002) Glucan is a component of the Mycobacterium tuberculosis surface that is expressed in vitro and in vivo. Infect Immun 70: 2566-2575.  170  229. Sambou T, Dinadayala P, Stadthagen G, Barilone N, Bordat Y, et al. (2008) Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice. Mol Microbiol 70: 762-774. 230. Stewart GR, Wilkinson KA, Newton SM, Sullivan SM, Neyrolles O, et al. (2005) Effect of deletion or overexpression of the 19-kilodalton lipoprotein Rv3763 on the innate response to Mycobacterium tuberculosis. Infect Immun 73: 6831-6837. 231. Henao-Tamayo M, Junqueira-Kipnis AP, Ordway D, Gonzales-Juarrero M, Stewart GR, et al. (2007) A mutant of Mycobacterium tuberculosis lacking the 19-kDa lipoprotein Rv3763 is highly attenuated in vivo but retains potent vaccinogenic properties. Vaccine 25: 7153-7159. 232. Mahenthiralingam E, Marklund BI, Brooks LA, Smith DA, Bancroft GJ, et al. (1998) Sitedirected mutagenesis of the 19-kilodalton lipoprotein antigen reveals No essential role for the protein in the growth and virulence of Mycobacterium intracellulare. Infect Immun 66: 3626-3634. 233. Goswami S, Sarkar S, Basu J, Kundu M, Chakrabarti P (1994) Mycotin: a lectin involved in the adherence of Mycobacteria to macrophages. FEBS Lett 355: 183-186. 234. Ragas A, Roussel L, Puzo G, Riviere M (2007) The Mycobacterium tuberculosis cellsurface glycoprotein apa as a potential adhesin to colonize target cells via the innate immune system pulmonary C-type lectin surfactant protein A. J Biol Chem 282: 51335142. 235. Fratazzi C, Arbeit RD, Carini C, Balcewicz-Sablinska MK, Keane J, et al. (1999) Macrophage apoptosis in mycobacterial infections. J Leukoc Biol 66: 763-764. 236. Wayne LG (1976) Dynamics of submerged growth of Mycobacterium tuberculosis under aerobic and microaerophilic conditions. Am Rev Respir Dis 114: 807-811. 237. Carlow DA, Corbel SY, Ziltener HJ (2001) Absence of CD43 fails to alter T cell development and responsiveness. J Immunol 166: 256-261. 238. Stokes RW, Haidl ID, Jefferies WA, Speert DP (1993) Mycobacteria-macrophage interactions. Macrophage phenotype determines the nonopsonic binding of Mycobacterium tuberculosis to murine macrophages. J Immunol 151: 7067-7076. 239. Stokes RW, Doxsee D (1999) The receptor-mediated uptake, survival, replication, and drug sensitivity of Mycobacterium tuberculosis within the macrophage-like cell line THP-1: a comparison with human monocyte-derived macrophages. Cell Immunol 197: 1-9. 240. Yang JC (1996) Characterization of mouse CD43 recombinant proteins secreted by EL4, CTL2c, CTLL and NSF60 cells. [Traditional]. Vancouver: University of British Columbia. 93 p. 171  241. Hirosawa M, Hoshida M, Ishikawa M, Toya T (1993) MASCOT: multiple alignment system for protein sequences based on three-way dynamic programming. Comput Appl Biosci 9: 161-167. 242. Smith RJ, Iden SS (1981) Properties of calcium ionophore-induced generation of superoxide anion by human neutrophils. Inflammation 5: 177-192. 243. Nagata Y, Burger MM (1974) Wheat germ agglutinin. Molecular characteristics and specificity for sugar binding. J Biol Chem 249: 3116-3122. 244. Baecher-Allan CM, Kemp JD, Dorfman KS, Barth RK, Frelinger JG (1993) Differential epitope expression of Ly-48 (mouse leukosialin). Immunogenetics 37: 183-192. 245. Hickey TBM, Thorson LM, Daffe M, Speert DP, Stokes RW (2009) Mycobacterium tuberculosis Cpn60.2 and DnaK are located on the bacterial surface, where Cpn60.2 facilitates efficient bacterial association with macrophages. Infect Immun (submitted). 246. Rosen H, Gordon S (1987) Monoclonal antibody to the murine type 3 complement receptor inhibits adhesion of myelomonocytic cells in vitro and inflammatory cell recruitment in vivo. J Exp Med 166: 1685-1701. 247. Thornton BP, Vetvicka V, Pitman M, Goldman RC, Ross GD (1996) Analysis of the sugar specificity and molecular location of the beta-glucan-binding lectin site of complement receptor type 3 (CD11b/CD18). J Immunol 156: 1235-1246. 248. Ortalo-Magne A, Andersen AB, Daffé M (1996) The outermost capsular arabinomannans and other mannoconjugates of virulent and avirulent tubercle bacilli. Microbiology 142: 927-935. 249. Villeneuve C, Etienne G, Abadie V, Montrozier H, Bordier C, et al. (2003) Surfaceexposed Glycopeptidolipids of Mycobacterium smegmatis Specifically Inhibit the Phagocytosis of Mycobacteria by Human Macrophages: Identification of a novel family of glycopeptidolipids. J Biol Chem 278: 51291-51300. 250. Villeneuve C, Gilleron M, Maridonneau-Parini I, Daffe M, Astarie-Dequeker C, et al. (2005) Mycobacteria use their surface-exposed glycolipids to infect human macrophages through a receptor-dependent process. J Lipid Res 46: 475-483. 251. Sakarya S, Oncu S (2003) Bacterial adhesins and the role of sialic acid in bacterial adhesion. Med Sci Monit 9: RA76-82. 252. Jones AT, Federsppiel B, Ellies LG, Williams MJ, Burgener R, et al. (1994) Characterization of the activation-associated isoform of CD43 on murine T lymphocytes. J Immunol 153: 3426-3439. 253. Wells SM, Kantor AB, Stall AM (1994) CD43 (S7) expression identifies peripheral B cell subsets. J Immunol 153: 5503-5515. 172  254. Zugel U, Kaufmann SH (1999) Role of heat shock proteins in protection from and pathogenesis of infectious diseases. Clin Microbiol Rev 12: 19-39. 255. Andersen P, Askgaard D, Ljungqvist L, Bennedsen J, Heron I (1991) Proteins released from Mycobacterium tuberculosis during growth. Infect Immun 59: 1905-1910. 256. Sonnenberg MG, Belisle JT (1997) Definition of Mycobacterium tuberculosis culture filtrate proteins by two-dimensional polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and electrospray mass spectrometry. Infect Immun 65: 45154524. 257. Rosenkrands I, Weldingh K, Jacobsen S, Hansen CV, Florio W, et al. (2000) Mapping and identification of Mycobacterium tuberculosis proteins by two-dimensional gel electrophoresis, microsequencing and immunodetection. Electrophoresis 21: 935-948. 258. De Bruyn J, Bosmans R, Nyabenda J, Van Vooren JP (1989) Effect of zinc deficiency of the appearance of two immunodominant protein antigens (32 kDa and 65 kDa) in culture filtrates of mycobacteria. Journal of General Microbiology 135: 79-84. 259. Frisk A, Ison CA, Lagergard T (1998) GroEL heat shock protein of Haemophilus ducreyi: association with cell surface and capacity to bind to eukaryotic cells. Infect Immun 66: 1252-1257. 260. Phadnis SH, Parlow MH, Levy M, Ilver D, Caulkins CM, et al. (1996) Surface localization of Helicobacter pylori urease and a heat shock protein homolog requires bacterial autolysis. Infect Immun 64: 905-912. 261. Hennequin C, Porcheray F, Waligora-Dupriet A, Collignon A, Barc M, et al. (2001) GroEL (Hsp60) of Clostridium difficile is involved in cell adherence. Microbiology 147: 87-96. 262. Alder GM, Austen BM, Bashford CL, Mehlert A, Pasternak CA (1990) Heat shock proteins induce pores in membranes. Biosci Rep 10: 509-518. 263. Torok Z, Horvath I, Goloubinoff P, Kovacs E, Glatz A, et al. (1997) Evidence for a lipochaperonin: association of active protein-folding GroESL oligomers with lipids can stabilize membranes under heat shock conditions. Proc Natl Acad Sci U S A 94: 21922197. 264. McDonough JA, Hacker KE, Flores AR, Pavelka MS, Jr., Braunstein M (2005) The twinarginine translocation pathway of Mycobacterium smegmatis is functional and required for the export of mycobacterial beta-lactamases. J Bacteriol 187: 7667-7679. 265. Lee PA, Tullman-Ercek D, Georgiou G (2006) The bacterial twin-arginine translocation pathway. Annu Rev Microbiol 60: 373-395.  173  266. Perez-Rodriguez R, Fisher AC, Perlmutter JD, Hicks MG, Chanal A, et al. (2007) An essential role for the DnaK molecular chaperone in stabilizing over-expressed substrate proteins of the bacterial twin-arginine translocation pathway. J Mol Biol 367: 715-730. 267. Hughes AL (1993) Contrasting evolutionary rates in the duplicate chaperonin genes of Mycobacterium tuberculosis and M. leprae. Mol Biol Evol 10: 1343-1359. 268. Belles C, Kuhl A, Nosheny R, Carding SR (1999) Plasma membrane expression of heat shock protein 60 in vivo in response to infection. Infect Immun 67: 4191-4200. 269. Soltys BJ, Gupta RS (1997) Cell surface localization of the 60 kDa heat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol Int 21: 315-320. 270. Bassan M, Zamostiano R, Giladi E, Davidson A, Wollman Y, et al. (1998) The identification of secreted heat shock 60 -like protein from rat glial cells and a human neuroblastoma cell line. Neurosci Lett 250: 37-40. 271. Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci 9: 244-252. 272. Rao SP, Ogata K, Morris SL, Catanzaro A (1994) Identification of a 68 kd surface antigen of Mycobacterium avium that binds to human macrophages. J Lab Clin Med 123: 526535. 273. Esaguy N, Aguas AP (1997) Subcellular localization of the 65-kDa heat shock protein in mycobacteria by immunoblotting and immunogold ultracytochemistry. J Submicrosc Cytol Pathol 29: 85-90. 274. Parsons LM, Limberger RJ, Shayegani M (1997) Alterations in levels of DnaK and GroEL result in diminished survival and adherence of stressed Haemophilus ducreyi. Infect Immun 65: 2413-2419. 275. Pantzar M, Teneberg S, Lagergard T (2006) Binding of Haemophilus ducreyi to carbohydrate receptors is mediated by the 58.5-kDa GroEL heat shock protein. Microbes Infect 8: 2452-2458. 276. Yamaguchi H, Osaki T, Kurihara N, Taguchi H, Hanawa T, et al. (1997) Heat-shock protein 60 homologue of Helicobacter pylori is associated with adhesion of H. pylori to human gastric epithelial cells. J Med Microbiol 46: 825-831. 277. Amini HR, Ascencio F, Cruz-Villacorta A, Ruiz-Bustos E, Wadstrom T (1996) Immunochemical properties of a 60 kDa cell surface-associated heat shock-protein (Hsp60) from Helicobacter pylori. FEMS Immunol Med Microbiol 16: 163-172. 278. Garduno RA, Faulkner G, Trevors MA, Vats N, Hoffman PS (1998) Immunolocalization of Hsp60 in Legionella pneumophila. J Bacteriol 180: 505-513. 174  279. Benkirane R, Guinet R, Delaunay T (1992) Purification and immunological studies of the cross-reaction between the 65-kilodalton gonococcal parietal lectin and an antigen common to a wide range of bacteria. Infect Immun 60: 3468-3471. 280. Ensgraber M, Loos M (1992) A 66-kilodalton heat shock protein of Salmonella typhimurium is responsible for binding of the bacterium to intestinal mucus. Infect Immun 60: 3072-3078. 281. Bergonzelli GE, Granato D, Pridmore RD, Marvin-Guy LF, Donnicola D, et al. (2006) GroEL of Lactobacillus johnsonii La1 (NCC 533) is cell surface associated: potential role in interactions with the host and the gastric pathogen Helicobacter pylori. Infect Immun 74: 425-434. 282. Watarai M, Kim S, Erdenebaatar J, Makino S, Horiuchi M, et al. (2003) Cellular prion protein promotes Brucella infection into macrophages. J Exp Med 198: 5-17. 283. Paju S, Goulhen F, Asikainen S, Grenier D, Mayrand D, et al. (2000) Localization of heat shock proteins in clinical Actinobacillus actinomycetemcomitans strains and their effects on epithelial cell proliferation. FEMS Microbiol Lett 182: 231-235. 284. Tsugawa H, Ito H, Ohshima M, Okawa Y (2007) Cell adherence-promoted activity of Plesiomonas shigelloides groEL. J Med Microbiol 56: 23-29. 285. Ratnakar P, Rao SP, Catanzaro A (1996) Isolation and characterization of a 70 kda protein from mycobacterium avium. Microbial Pathogenesis 21: 471-486. 286. Hartmann E, Lingwood C (1997) Brief heat shock treatment induces a long-lasting alteration in the glycolipid receptor binding specificity and growth rate of Haemophilus influenzae. Infect Immun 65: 1729-1733. 287. Long KH, Gomez FJ, Morris RE, Newman SL (2003) Identification of heat shock protein 60 as the ligand on Histoplasma capsulatum that mediates binding to CD18 receptors on human macrophages. J Immunol 170: 487-494. 288. Gillis TP, Miller RA, Young DB, Khanolkar SR, Buchanan TM (1985) Immunochemical characterization of a protein associated with Mycobacterium leprae cell wall. Infect Immun 49: 371-377. 289. Habich C, Kempe K, Gomez FJ, Lillicrap M, Gaston H, et al. (2006) Heat shock protein 60: identification of specific epitopes for binding to primary macrophages. FEBS Lett 580: 115-120. 290. Retzlaff C, Yamamoto Y, Hoffman PS, Friedman H, Klein TW (1994) Bacterial heat shock proteins directly induce cytokine mRNA and interleukin-1 secretion in macrophage cultures. Infect Immun 62: 5689-5693.  175  291. Stokes RW, Speert DP (1995) Lipoarabinomannan inhibits nonopsonic binding of Mycobacterium tuberculosis to murine macrophages. J Immunol 155: 1361-1369. 292. Habich C, Kempe K, van der Zee R, Burkart V, Kolb H (2003) Different heat shock protein 60 species share pro-inflammatory activity but not binding sites on macrophages. FEBS Lett 533: 105-109. 293. Wang Y, Kelly CG, Karttunen JT, Whittall T, Lehner PJ, et al. (2001) CD40 is a cellular receptor mediating mycobacterial heat shock protein 70 stimulation of CC-chemokines. Immunity 15: 971-983. 294. Whittall T, Wang Y, Younson J, Kelly C, Bergmeier L, et al. (2006) Interaction between the CCR5 chemokine receptors and microbial HSP70. Eur J Immunol 36: 2304-2314. 295. Floto RA, MacAry PA, Boname JM, Mien TS, Kampmann B, et al. (2006) Dendritic cell stimulation by mycobacterial Hsp70 is mediated through CCR5. Science 314: 454-458. 296. Hanawa T, Fukuda M, Kawakami H, Hirano H, Kamiya S, et al. (1999) The Listeria monocytogenes DnaK chaperone is required for stress tolerance and efficient phagocytosis with macrophages. Cell Stress Chaperones 4: 118-128. 297. Theriault JR, Adachi H, Calderwood SK (2006) Role of scavenger receptors in the binding and internalization of heat shock protein 70. J Immunol 177: 8604-8611. 298. Habich C, Baumgart K, Kolb H, Burkart V (2002) The receptor for heat shock protein 60 on macrophages is saturable, specific, and distinct from receptors for other heat shock proteins. J Immunol 168: 569-576. 299. Habich C, Kempe K, Burkart V, Van Der Zee R, Lillicrap M, et al. (2004) Identification of the heat shock protein 60 epitope involved in receptor binding on macrophages. FEBS Lett 568: 65-69. 300. Anande PK, Anande E, Bleck CKE, Griffiths G (2008) Exogenous Hsp70 treatment of macrophages promotes increased uptake and maturation of latex-bead phagosomes. Tuberculosis: Biology, Pathology and Therapy. Keystone, CO: Keystone Symposia. 301. Galdiero M, de l'Ero GC, Marcatili A (1997) Cytokine and adhesion molecule expression in human monocytes and endothelial cells stimulated with bacterial heat shock proteins. Infect Immun 65: 699-707. 302. Sassetti CM, Boyd DH, Rubin EJ (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 48: 77-84. 303. Hu Y, Henderson B, Lund PA, Tormay P, Ahmed MT, et al. (2008) A Mycobacterium tuberculosis mutant lacking the groEL homologue cpn60.1 is viable but fails to induce an inflammatory response in animal models of infection. Infect Immun 76: 1535-1546. 176  304. Graner MW, Cumming RI, Bigner DD (2007) The heat shock response and chaperones/heat shock proteins in brain tumors: surface expression, release, and possible immune consequences. J Neurosci 27: 11214-11227. 305. Ranford JC, Coates AR, Henderson B (2000) Chaperonins are cell-signalling proteins: the unfolding biology of molecular chaperones. Expert Rev Mol Med 2: 1-17. 306. Qamra R, Mande SC (2004) Crystal structure of the 65-kilodalton heat shock protein, chaperonin 60.2, of Mycobacterium tuberculosis. J Bacteriol 186: 8105-8113. 307. Pasula R, Downing JF, Wright JR, Kachel DL, Davis TE, Jr., et al. (1997) Surfactant protein A (SP-A) mediates attachment of Mycobacterium tuberculosis to murine alveolar macrophages. Am J Respir Cell Mol Biol 17: 209-217. 308. Hall-Stoodley L, Watts G, Crowther JE, Balagopal A, Torrelles JB, et al. (2006) Mycobacterium tuberculosis binding to human surfactant proteins A and D, fibronectin, and small airway epithelial cells under shear conditions. Infect Immun 74: 3587-3596. 309. Ranford JC, Henderson B (2002) Chaperonins in disease: mechanisms, models, and treatments. Mol Pathol 55: 209-213. 310. Henderson B, Allan E, Coates AR (2006) Stress wars: the direct role of host and bacterial molecular chaperones in bacterial infection. Infect Immun 74: 3693-3706. 311. Tang PW, Gool HC, Hardy M, Lee YC, Feizi T (1985) Novel approach to the study of the antigenicities and receptor functions of carbohydrate chains of glycoproteins. Biochem Biophys Res Commun 132: 474-480. 312. Sambandamurthy VK, Derrick SC, Hsu T, Chen B, Larsen MH, et al. (2006) Mycobacterium tuberculosis ∆RD1 ∆panCD: A safe and limited replicating mutant strain that protects immunocompetent and immunocompromised mice against experimental tuberculosis. Vaccine 24: 6309-6320. 313. Feizi T, Fazio F, Chai W, Wong CH (2003) Carbohydrate microarrays - a new set of technologies at the frontiers of glycomics. Curr Opin Struct Biol 13: 637-645. 314. Disney MD, Seeberger PH (2004) The use of carbohydrate microarrays to study carbohydrate-cell interactions and to detect pathogens. Chem Biol 11: 1701-1707. 315. Blixt O, Head S, Mondala T, Scanlan C, Huflejt ME, et al. (2004) Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc Natl Acad Sci U S A 101: 17033-17038. 316. Raman R, Venkataraman M, Ramakrishnan S, Lang W, Raguram S, et al. (2006) Advancing glycomics: implementation strategies at the consortium for functional glycomics. Glycobiology 16: 82R-90R. 177  317. Houry WA, Frishman D, Eckerskorn C, Lottspeich F, Hartl FU (1999) Identification of in vivo substrates of the chaperonin GroEL. Nature 402: 147-154. 318. Qamra R, Mande SC, Coates AR, Henderson B (2005) The unusual chaperonins of Mycobacterium tuberculosis. Tuberculosis (Edinb) 85: 385-394. 319. Tasci B, Direskeneli H, Serdaroglu P, Akman-Demir G, Eraksoy M, et al. (1998) Humoral immune response to mycobacterial heat shock protein (hsp)65 in the cerebrospinal fluid of neuro-Behcet patients. Clin Exp Immunol 113: 100-104. 320. Jindal S, Dudani AK, Singh B, Harley CB, Gupta RS (1989) Primary structure of a human mitochondrial protein homologous to the bacterial and plant chaperonins and to the 65kilodalton mycobacterial antigen. Mol Cell Biol 9: 2279-2283. 321. Georgopoulos CP (1971) Bacterial mutants in which the gene N function of bacteriophage lambda is blocked have an altered RNA polymerase. Proc Natl Acad Sci U S A 68: 2977-2981. 322. Georgopoulos CP (1977) A new bacterial gene (groPC) which affects lambda DNA replication. Mol Gen Genet 151: 35-39. 323. Georgopoulos CP, Hohn B (1978) Identification of a host protein necessary for bacteriophage morphogenesis (the groE gene product). Proc Natl Acad Sci U S A 75: 131-135. 324. Ellis RJ (2005) Chaperomics: in vivo GroEL function defined. Curr Biol 15: R661-663. 325. Young JC, Agashe VR, Siegers K, Hartl FU (2004) Pathways of chaperone-mediated protein folding in the cytosol. Nat Rev Mol Cell Biol 5: 781-791. 326. Kong TH, Coates AR, Butcher PD, Hickman CJ, Shinnick TM (1993) Mycobacterium tuberculosis expresses two chaperonin-60 homologs. Proc Natl Acad Sci U S A 90: 2608-2612. 327. Hughes AL (1993) Contrasting Evolutionary Rates in the Duplicate Chaperonin Genes of Mycobacterium Tuberculosis and M-Leprae. Molecular Biology and Evolution 10: 1343-1359. 328. Goyal K, Qamra R, Mande SC (2006) Multiple gene duplication and rapid evolution in the groEL gene: functional implications. J Mol Evol 63: 781-787. 329. Qamra R, Srinivas V, Mande SC (2004) Mycobacterium tuberculosis GroEL homologues unusually exist as lower oligomers and retain the ability to suppress aggregation of substrate proteins. J Mol Biol 342: 605-617. 330. Hendrix RW (1979) Purification and properties of groE, a host protein involved in bacteriophage assembly. J Mol Biol 129: 375-392. 178  331. Shinnick TM (1991) Heat shock proteins as antigens of bacterial and parasitic pathogens. Curr Top Microbiol Immunol 167: 145-160. 332. Thole JE, Hindersson P, de Bruyn J, Cremers F, van der Zee J, et al. (1988) Antigenic relatedness of a strongly immunogenic 65 kDA mycobacterial protein antigen with a similarly sized ubiquitous bacterial common antigen. Microb Pathog 4: 71-83. 333. Kaufmann SH, Vath U, Thole JE, Van Embden JD, Emmrich F (1987) Enumeration of T cells reactive with Mycobacterium tuberculosis organisms and specific for the recombinant mycobacterial 64-kDa protein. Eur J Immunol 17: 351-357. 334. McLean IL, Archer JR, Cawley MI, Pegley FS, Kidd BL, et al. (1990) Specific antibody response to the mycobacterial 65 kDa stress protein in ankylosing spondylitis and rheumatoid arthritis. Br J Rheumatol 29: 426-429. 335. Cohen IR (1991) Autoimmunity to chaperonins in the pathogenesis of arthritis and diabetes. Annu Rev Immunol 9: 567-589. 336. van Eden W, Thole JE, van der Zee R, Noordzij A, van Embden JD, et al. (1988) Cloning of the mycobacterial epitope recognized by T lymphocytes in adjuvant arthritis. Nature 331: 171-173. 337. Billingham ME, Carney S, Butler R, Colston MJ (1990) A mycobacterial 65-kD heat shock protein induces antigen-specific suppression of adjuvant arthritis, but is not itself arthritogenic. J Exp Med 171: 339-344. 338. Yang XD, Gasser J, Feige U (1992) Prevention of adjuvant arthritis in rats by a nonapeptide from the 65-kD mycobacterial heat shock protein: specificity and mechanism. Clin Exp Immunol 87: 99-104. 339. Lopez-Guerrero JA, Ortiz MA, Paez E, Bernabeu C, Lopez-Bote JP (1994) Therapeutic effect of recombinant vaccinia virus expressing the 60-kd heat-shock protein on adjuvant arthritis. Arthritis Rheum 37: 1462-1467. 340. Haque MA, Yoshino S, Inada S, Nomaguchi H, Tokunaga O, et al. (1996) Suppression of adjuvant arthritis in rats by induction of oral tolerance to mycobacterial 65-kDa heat shock protein. Eur J Immunol 26: 2650-2656. 341. Elias D, Reshef T, Birk OS, van der Zee R, Walker MD, et al. (1991) Vaccination against autoimmune mouse diabetes with a T-cell epitope of the human 65-kDa heat shock protein. Proc Natl Acad Sci U S A 88: 3088-3091. 342. Elias D, Markovits D, Reshef T, van der Zee R, Cohen IR (1990) Induction and therapy of autoimmune diabetes in the non-obese diabetic (NOD/Lt) mouse by a 65-kDa heat shock protein. Proc Natl Acad Sci U S A 87: 1576-1580.  179  343. Bras A, Aguas AP (1996) Diabetes-prone NOD mice are resistant to Mycobacterium avium and the infection prevents autoimmune disease. Immunology 89: 20-25. 344. de Graeff-Meeder ER, Voorhorst M, van Eden W, Schuurman HJ, Huber J, et al. (1990) Antibodies to the mycobacterial 65-kd heat-shock protein are reactive with synovial tissue of adjuvant arthritic rats and patients with rheumatoid arthritis and osteoarthritis. Am J Pathol 137: 1013-1017. 345. Deane KH, Jecock RM, Pearce JH, Gaston JS (1997) Identification and characterization of a DR4-restricted T cell epitope within chlamydia heat shock protein 60. Clin Exp Immunol 109: 439-445. 346. Erkeller-Yuksel FM, Isenberg DA, Dhillon VB, Latchman DS, Lydyard PM (1992) Surface expression of heat shock protein 90 by blood mononuclear cells from patients with systemic lupus erythematosus. J Autoimmun 5: 803-814. 347. Marengo EB, de Moraes LV, Faria M, Fernandes BL, Carvalho LV, et al. (2008) Administration of M. leprae Hsp65 interferes with the murine lupus progression. PLoS ONE 3: e3025. 348. Birnbaum G, Kotilinek L, Albrecht L (1993) Spinal fluid lymphocytes from a subgroup of multiple sclerosis patients respond to mycobacterial antigens. Ann Neurol 34: 18-24. 349. Salvetti M, Buttinelli C, Ristori G, Carbonari M, Cherchi M, et al. (1992) T-lymphocyte reactivity to the recombinant mycobacterial 65- and 70-kDa heat shock proteins in multiple sclerosis. J Autoimmun 5: 691-702. 350. Yokota S, Tsubaki K, Kuriyama T, Shimizu H, Ibe M, et al. (1993) Presence in Kawasaki disease of antibodies to mycobacterial heat-shock protein HSP65 and autoantibodies to epitopes of human HSP65 cognate antigen. Clin Immunol Immunopathol 67: 163-170. 351. Pervin K, Childerstone A, Shinnick T, Mizushima Y, van der Zee R, et al. (1993) T cell epitope expression of mycobacterial and homologous human 65-kilodalton heat shock protein peptides in short term cell lines from patients with Behcet's disease. J Immunol 151: 2273-2282. 352. Rambukkana A, Das PK, Witkamp L, Yong S, Meinardi MM, et al. (1993) Antibodies to mycobacterial 65-kDa heat shock protein and other immunodominant antigens in patients with psoriasis. J Invest Dermatol 100: 87-92. 353. Kleindienst R, Xu Q, Willeit J, Waldenberger FR, Weimann S, et al. (1993) Immunology of atherosclerosis. Demonstration of heat shock protein 60 expression and T lymphocytes bearing alpha/beta or gamma/delta receptor in human atherosclerotic lesions. Am J Pathol 142: 1927-1937.  180  354. Xu Q, Luef G, Weimann S, Gupta RS, Wolf H, et al. (1993) Staining of endothelial cells and macrophages in atherosclerotic lesions with human heat-shock protein-reactive antisera. Arterioscler Thromb 13: 1763-1769. 355. Moudgil KD, Sercarz EE (1994) The T cell repertoire against cryptic self determinants and its involvement in autoimmunity and cancer. Clin Immunol Immunopathol 73: 283-289. 356. Gallucci S, Matzinger P (2001) Danger signals: SOS to the immune system. Curr Opin Immunol 13: 114-119. 357. Basu S, Binder RJ, Suto R, Anderson KM, Srivastava PK (2000) Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-kappa B pathway. Int Immunol 12: 1539-1546. 358. Henderson B, Nair SP, Ward JM, Wilson M (2003) Molecular pathogenicity of the oral opportunistic pathogen Actinobacillus actinomycetemcomitans. Annu Rev Microbiol 57: 29-55. 359. Meghji S, Lillicrap M, Maguire M, Tabona P, Gaston JS, et al. (2003) Human chaperonin 60 (Hsp60) stimulates bone resorption: structure/function relationships. Bone 33: 419425. 360. Tabona P, Reddi K, Khan S, Nair SP, Crean SJ, et al. (1998) Homogeneous Escherichia coli chaperonin 60 induces IL-1 beta and IL-6 gene expression in human monocytes by a mechanism independent of protein conformation. J Immunol 161: 1414-1421. 361. Meghji S, White PA, Nair SP, Reddi K, Heron K, et al. (1997) Mycobacterium tuberculosis chaperonin 10 stimulates bone resorption: a potential contributory factor in Pott's disease. J Exp Med 186: 1241-1246. 362. Winrow VR, Mesher J, Meghji S, Morris CJ, Maguire M, et al. (2008) The two homologous chaperonin 60 proteins of Mycobacterium tuberculosis have distinct effects on monocyte differentiation into osteoclasts. Cell Microbiol 10: 2091-2104. 363. Fares MA, Moya A, Barrio E (2004) GroEL and the maintenance of bacterial endosymbiosis. Trends Genet 20: 413-416. 364. Yoshida N, Oeda K, Watanabe E, Mikami T, Fukita Y, et al. (2001) Protein function. Chaperonin turned insect toxin. Nature 411: 44. 365. McLennan N, Masters M (1998) GroE is vital for cell-wall synthesis. Nature 392: 139. 366. Ojha A, Anand M, Bhatt A, Kremer L, Jacobs WR, Jr., et al. (2005) GroEL1: a dedicated chaperone involved in mycolic acid biosynthesis during biofilm formation in mycobacteria. Cell 123: 861-873. 367. Aravindhan V, Christy AJ, Roy S, Ajitkumar P, Narayanan PR, et al. (2009) Mycobacterium tuberculosis groE promoter controls the expression of the bicistronic 181  groESL1 operon and shows differential regulation under stress conditions. FEMS Microbiol Lett 292: 42-49. 368. Triantafilou K, Triantafilou M, Dedrick RL (2001) A CD14-independent LPS receptor cluster. Nat Immunol 2: 338-345. 369. Crocker PR, Kelm S, Dubois C, Martin B, Mcwilliam AS, et al. (1991) Purification and Properties of Sialoadhesin, a Sialic Acid-Binding Receptor of Murine Tissue Macrophages. EMBO Journal 10: 1661-1669. 370. Ostberg JR, Barth RK, Frelinger JG (1998) The Roman god Janus: a paradigm for the function of CD43. Immunology Today 19: 546-550.  182  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array The results of five different glycan array analyses are presented, three evaluating Cpn60.2 binding, and two evaluating DnaK binding. Graphs present the average RFU and SEM (error bars) of six replicates per analysis, with the highest and lowest points from each set of six replicates having been removed so the average is of four values rather than six. The structure of the numbered glycans included on the array is shown in tabular format following the graphs. Strong and reproducible binding of Cpn60.2 and DnaK to the included glycans was not observed.  183  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array  184  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array  185  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array  186  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array  187  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array  188  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  1  Neu5Acα2-8Neu5Acα-Sp8  2  Neu5Acα2-8Neu5Acβ-Sp17  3  Neu5Acα2-8Neu5Acα2-8Neu5Acβ-Sp8  4  Neu5Gcβ2-6Galβ1-4GlcNAc-Sp8  5  Galβ1-3GlcNAcβ1-2Manα1-3(Galβ1-3GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp19  6  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  7  α-D-Gal–Sp8  8  α-D-Glc–Sp8  9  α-D-Man–Sp8  10  α-GalNAc–Sp8  11  α-L-Fuc–Sp8  12  α-L-Fuc–Sp9  13  α-L-Rhα–Sp8  14  α-Neu5Ac–Sp8  15  α-Neu5Ac–Sp11  16  β-Neu5Ac-Sp8  17  β-D-Gal–Sp8  18  β-D-Glc–Sp8  19  β-D-Man–Sp8  20  β-GalNAc–Sp8  21  β-GlcNAc–Sp0  22  β-GlcNAc–Sp8  23  β-GlcN(Gc)-Sp8  24  (Galβ1-4GlcNAcβ)2-3,6-GalNAcα–Sp8  25  GlcNAcβ1-3(GlcNAcβ1-4)(GlcNAcβ1-6)GlcNAc-Sp8  26  [3OSO3][6OSO3]Galβ1-4[6OSO3]GlcNAcβ-Sp0  27  [3OSO3][6OSO3]Galβ1-4GlcNAcβ-Sp0  28  [3OSO3]Galβ1-4Glcβ-Sp8  29  [3OSO3]Galβ1-4(6OSO3)Glcβ–Sp0  30  [3OSO3]Galβ1-4(6OSO3)Glcβ–Sp8  31  [3OSO3]Galβ1-3(Fucα1-4)GlcNAcβ–Sp8  32  [3OSO3]Galβ1-3GalNAcα–Sp8  33  [3OSO3]Galβ1-3GlcNAcβ–Sp8  34  [3OSO3]Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  189  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  35  [3OSO3]Galβ1-4[6OSO3]GlcNAcβ-Sp8  36  [3OSO3]Galβ1-4GlcNAcβ–Sp0  37  [3OSO3]Galβ1-4GlcNAcβ-Sp8  38  [3OSO3]Galβ–Sp8  39  [4OSO3][6OSO3]Galβ1-4GlcNAcβ-Sp0  40  [4OSO3]Galβ1-4GlcNAcβ-Sp8  41  6-H2PO3Manα–Sp8  42  [6OSO3]Galβ1-4Glcβ–Sp0  43  [6OSO3]Galβ1-4Glcβ–Sp8  44  [6OSO3]Galβ1-4GlcNAcβ–Sp8  45  [6OSO3]Galβ1-4[6OSO3]Glcβ-Sp8  46  NeuAcα2-3[6OSO3]Galβ1-4GlcNAcβ–Sp8  47  [6OSO3]GlcNAcβ–Sp8  48  9NAcNeu5Acα-Sp8  49  9NAcNeu5Acα2-6Galβ1-4GlcNAcβ-Sp8  50  Manα1-3(Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp13  51  GlcNAcβ1-2Manα1-3(GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp13  52  Galβ1-4GlcNAcβ1-2Manα1-3(Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp13  53  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp13  54  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp8  55  Fucα1-2Galβ1-3GalNAcβ1-3Galα-Sp9  56  Fucα1-2Galβ1-3GalNAcβ1-3Galα1-4Galβ1-4Glcβ-Sp9  57  Fucα1-2Galβ1-3(Fucα1-4)GlcNAcβ–Sp8  58  Fucα1-2Galβ1-3GalNAcα–Sp8  59  Fucα1-2Galβ1-3GalNAcβ1-4(Neu5Acα2-3)Galβ1-4Glcβ-Sp0  60  Fucα1-2Galβ1-3GalNAcβ1-4(Neu5Acα2-3)Galβ1-4Glcβ-Sp9  61  Fucα1-2Galβ1-3GlcNAcβ1-3Galβ1-4Glcβ–Sp10  62  Fucα1-2Galβ1-3GlcNAcβ1-3Galβ1-4Glcβ–Sp8  63  Fucα1-2Galβ1-3GlcNAcβ–Sp0  64  Fucα1-2Galβ1-3GlcNAcβ–Sp8  65  Fucα1-2Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  66  Fucα1-2Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  67  Fucα1-2Galβ1-4(Fucα1-3)GlcNAcβ–Sp0  68  Fucα1-2Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  190  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  69  Fucα1-2Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAc–Sp0  70  Fucα1-2Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  71  Fucα1-2Galβ1-4GlcNAcβ–Sp0  72  Fucα1-2Galβ1-4GlcNAcβ–Sp8  73  Fucα1-2Galβ1-4Glcβ–Sp0  74  Fucα1-2Galβ–Sp8  75  Fucα1-3GlcNAcβ-Sp8  76  Fucα1-3GlcNAcβ-Sp8  77  Fucα1-4GlcNAcβ–Sp8  78  Fucβ1-3GlcNAcβ-Sp8  79  GalNAcα1-3(Fucα1-2)Galβ1-3GlcNAcβ-Sp0  80  GalNAcα1-3(Fucα1-2)Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  81  GalNAcα1-3(Fucα1-2)Galβ1-4GlcNAcβ-Sp0  82  GalNAcα1-3(Fucα1-2)Galβ1-4GlcNAcβ–Sp8  83  GalNAcα1-3(Fucα1-2)Galβ1-4Glcβ-Sp0  84  GalNAcα1-3(Fucα1-2)Galβ–Sp8  85  GalNAcα1-3GalNAcβ–Sp8  86  GalNAcα1-3Galβ–Sp8  87  GalNAcα1-4(Fucα1-2)Galβ1-4GlcNAcβ-Sp8  88  GalNAcβ1-3GalNAcα–Sp8  89  GalNAcβ1-3(Fucα1-2)Galβ-Sp8  90  GalNAcβ1-3Galα1-4Galβ1-4GlcNAcβ-Sp0  91  GalNAcβ1-4(Fucα1-3)GlcNAcβ-Sp0  92  GalNAcβ1-4GlcNAcβ–Sp0  93  GalNAcβ1-4GlcNAcβ–Sp8  94  Galα1-2Galβ–Sp8  95  Galα1-3(Fucα1-2)Galβ1-3GlcNAcβ-Sp0  96  Galα1-3(Fucα1-2)Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  97  Galα1-3(Fucα1-2)Galβ1-4GlcNAc-Sp0  98  Galα1-3(Fucα1-2)Galβ1-4Glcβ-Sp0  99  Galα1-3(Fucα1-2)Galβ–Sp8  100  Galα1-3(Galα1-4)Galβ1-4GlcNAcβ-Sp8  101  Galα1-3GalNAcα-Sp8  102  Galα1-3GalNAcβ–Sp8  191  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  103  Galα1-3Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  104  Galα1-3Galβ1-3GlcNAcβ-Sp0  105  Galα1-3Galβ1-4GlcNAcβ–Sp8  106  Galα1-3Galβ1-4Glcβ–Sp0  107  Galα1-3Galβ–Sp8  108  Galα1-4(Fucα1-2)Galβ1-4GlcNAcβ-Sp8  109  Galα1-4Galβ1-4GlcNAcβ–Sp0  110  Galα1-4Galβ1-4GlcNAcβ–Sp8  111  Galα1-4Galβ1-4Glcβ–Sp0  112  Galα1-4GlcNAcβ–Sp8  113  Galα1-6Glcβ-Sp8  114  Galβ1-2Galβ–Sp8  115  Galβ1-3(Fucα1-4)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  116  Galβ1-3(Fucα1-4)GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  117  Galβ1-3(Fucα1-4)GlcNAc–Sp0  118  Galβ1-3(Fucα1-4)GlcNAc–Sp8  119  Galβ1-3(Fucα1-4)GlcNAcβ–Sp8  120  Galβ1-3(Galβ1-4GlcNAcβ1-6)GalNAcα-Sp8  121  Galβ1-3(GlcNAcβ1-6)GalNAcα-Sp8  122  Galβ1-3(Neu5Acα2-6)GalNAcα-Sp8  123  Galβ1-3(Neu5Acβ2-6)GalNAcα-Sp8  124  Galβ1-3(Neu5Acα2-6)GlcNAcβ1-4Galβ1-4Glcβ-Sp10  125  Galβ1-3GalNAcα-Sp8  126  Galβ1-3GalNAcβ–Sp8  127  Galβ1-3GalNAcβ1-3Galα1-4Galβ1-4Glcβ-Sp0  128  Galβ1-3GalNAcβ1-4(Neu5Acα2-3)Galβ1-4Glcβ-Sp0  129  Galβ1-3GalNAcβ1-4Galβ1-4Glcβ–Sp8  130  Galβ1-3Galβ–Sp8  131  Galβ1-3GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  132  Galβ1-3GlcNAcβ1-3Galβ1-4Glcβ–Sp10  133  Galβ1-3GlcNAcβ–Sp0  134  Galβ1-3GlcNAcβ–Sp8  135  Galβ1-4(Fucα1-3)GlcNAcβ–Sp0  136  Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  192  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  137  Galβ1-4(Fucα1-3)GlcNAcβ1-4Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  138  Galβ1-4(Fucα1-3)GlcNAcβ1-4Galβ1-4(Fucα1-3)GlcNAcβ1-4Galβ1-4(Fucα1-3)GlcNAcβ–Sp0  139  Galβ1-4[6OSO3]Glcβ–Sp0  140  Galβ1-4[6OSO3]Glcβ–Sp8  141  Galβ1-4GalNAcα1-3(Fucα1-2)Galβ1-4GlcNAcβ-Sp8  142  Galβ1-4GalNAcβ1-3(Fucα1-2)Galβ1-4GlcNAcβ-Sp8  143  Neu5Acα2-3Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-3Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  144  Galβ1-4GlcNAcβ1-3GalNAcα–Sp8  145  Galβ1-4GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  146  Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ–Sp0  147  Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ–Sp0  148  Galβ1-4GlcNAcβ1-3Galβ1-4Glcβ–Sp0  149  Galβ1-4GlcNAcβ1-3Galβ1-4Glcβ–Sp8  150  Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα–Sp8  151  Galβ1-4GlcNAcβ1-6GalNAcα–Sp8  152  Galβ1-4GlcNAcβ–Sp0  153  Galβ1-4GlcNAcβ–Sp8  154  Galβ1-4Glcβ–Sp0  155  Galβ1-4Glcβ–Sp8  156  GlcNAcα1-3Galβ1-4GlcNAcβ-Sp8  157  GlcNAcα1-6Galβ1-4GlcNAcβ-Sp8  158  GlcNAcβ1-2Galβ1-3GalNAcα–Sp8  159  GlcNAcβ1-3(GlcNAcβ1-6)GalNAcα–Sp8  160  GlcNAcβ1-3(GlcNAcβ1-6)Galβ1-4GlcNAcβ–Sp8  161  GlcNAcβ1-3GalNAcα–Sp8  162  GlcNAcβ1-3Galβ-Sp8  163  GlcNAcβ1-3Galβ1-3GalNAcα-Sp8  164  GlcNAcβ1-3Galβ1-4GlcNAcβ–Sp0  165  GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp8  166  GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  167  GlcNAcβ1-3Galβ1-4Glcβ–Sp0  168  GlcNAcβ1-4MDPLys  169  GlcNAcβ1-4(GlcNAcβ1-6)GalNAcα-Sp8  170  GlcNAcβ1-4Galβ1-4GlcNAcβ-Sp8  193  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  171  (GlcNAcβ1-4)6β-Sp8  172  (GlcNAcβ1-4)5β-Sp8  173  GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ–Sp8  174  GlcNAcβ1-6(Galβ1-3)GalNAcα–Sp8  175  GlcNAcβ1-6GalNAcα–Sp8  176  GlcNAcβ1-6Galβ1-4GlcNAcβ-Sp8  177  Glcα1-4Glcβ–Sp8  178  Glcα1-4Glca–Sp8  179  Glcα1-6Glcα1-6Glcβ-Sp8  180  Glcβ1-4Glcβ-Sp8  181  Glcβ1-6Glcβ-Sp8  182  G-ol-Sp8  183  GlcAa-Sp8  184  GlcAβ-Sp8  185  GlcAβ1-3Galβ-Sp8  186  GlcAβ1-6Galβ-Sp8  187  KDNα2-3Galβ1-3GlcNAcβ–Sp0  188  KDNα2-3Galβ1-4GlcNAcβ–Sp0  189  Manα1-2Manα1-2Manα1-3Manα-Sp9  190  Manα1-2Manα1-3(Manα1-2Manα1-6)Manα-Sp9  191  Manα1-2Manα1-3Manα-Sp9  192  Manα1-6(Manα1-2Manα1-3)Manα1-6(Manα2Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  193  Manα1-2Manα1-6(Manα1-3)Manα1-6(Manα2Manα2Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  194  Manα1-2Manα1-2Manα1-3(Manα1-2Manα1-3(Manα1-2Manα1-6)Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  195  Manα1-3(Manα1-6)Manα–Sp9  196  Manα1-3(Manα1-2Manα1-2Manα1-6)Manα-Sp9  197  Manα1-6(Manα1-3)Manα1-6(Manα2Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  198  Manα1-6(Manα1-3)Manα1-6(Manα1-3)Manβ1-4GlcNAcβ1-4 GlcNAcβ-Sp12  199  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-3Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  200  Manβ1-4GlcNAcβ-Sp0  201  Fucα1-3(Galβ1-4)GlcNAcβ1-2Manα1-3(Fucα1-3(Galβ1-4)GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp20  202  Neu5Acα2-3Galβ1-3GalNAcα-Sp8  203  NeuAcα2-8NeuAcα2-8NeuAcα2-8NeuAcα2-3(GalNAcβ1-4)Galβ1-4Glcβ-Sp0  204  Neu5Acα2-8Neu5Acα2-8Neu5Acα2-3(GalNAcβ1-4)Galβ1-4Glcβ-Sp0  194  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  205  Neu5Acα2-8Neu5Acα2-8Neu5Acα2-3Galβ1-4Glcβ–Sp0  206  Neu5Acα2-8Neu5Acα2-3(GalNAcβ1-4)Galβ1-4Glcβ–Sp0  207  Neu5Acα2-8Neu5Acα2-8Neu5Acα-Sp8  208  Neu5Acα2-3(6-O-Su)Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  209  Neu5Acα2-3(GalNAcβ1-4)Galβ1-4GlcNAcβ-Sp0  210  Neu5Acα2-3(GalNAcβ1-4)Galβ1-4GlcNAcβ-Sp8  211  Neu5Acα2-3(GalNAcβ1-4)Galβ1-4Glcβ–Sp0  212  NeuAcα2-3(NeuAcα2-3Galβ1-3GalNAcβ1-4)Galβ1-4Glcβ-Sp0  213  Neu5Acα2-3(Neu5Acα2-6)GalNAcα–Sp8  214  Neu5Acα2-3GalNAcα–Sp8  215  Neu5Acα2-3GalNAcβ1-4GlcNAcβ-Sp0  216  Neu5Acα2-3Galβ1-3(6OSO3)GlcNAc-Sp8  217  Neu5Acα2-3Galβ1-3(Fucα1-4)GlcNAcβ–Sp8  218  NeuAcα2-3Galβ1-3(Fucα1-4)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ Sp0  219  Neu5Acα2-3Galβ1-3(Neu5Acα2-3Galβ1-4)GlcNAcβ-Sp8  220  Neu5Acα2-3Galβ1-3[6OSO3]GalNAcα-Sp8  221  Neu5Acα2-3Galβ1-3(Neu5Acα2-6)GalNAcα–Sp8  222  Neu5Acα2-3Galβ-Sp8  223  NeuAcα2-3Galβ1-3GalNAcβ1-3Galα1-4Galβ1-4Glcβ-Sp0  224  NeuAcα2-3Galβ1-3GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  225  Neu5Acα2-3Galβ1-3GlcNAcβ–Sp0  226  Neu5Acα2-3Galβ1-3GlcNAcβ–Sp8  227  Neu5Acα2-3Galβ1-4[6OSO3]GlcNAcβ-Sp8  228  Neu5Acα2-3Galβ1-4(Fucα1-3)(6OSO3)GlcNAcβ–Sp8  229  Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ–Sp0  230  Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ–Sp0  231  Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ–Sp8  232  Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ-Sp8  233  Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp8  234  Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAc-Sp0  235  Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ–Sp0  236  Neu5Acα2-3Galβ1-4GlcNAcβ–Sp0  237  Neu5Acα2-3Galβ1-4GlcNAcβ–Sp8  238  Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  195  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  239  Neu5Acα2-3Galβ1-4Glcβ–Sp0  240  Neu5Acα2-3Galβ1-4Glcβ–Sp8  241  Galβ1-4GlcNAcβ1-2Manα1-3(Fucα1-3(Galβ1-4)GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp20  242  Neu5Acα2-6GalNAcα–Sp8  243  Neu5Acα2-6GalNAcβ1-4GlcNAcβ-Sp0  244  Neu5Acα2-6Galβ1-4[6OSO3]GlcNAcβ-Sp8  245  Neu5Acα2-6Galβ1-4GlcNAcβ–Sp0  246  Neu5Acα2-6Galβ1-4GlcNAcβ–Sp8  247  Neu5Acα2-6Galβ1-4GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  248  Neu5Acα2-6Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ-Sp0  249  Neu5Acα2-6Galβ1-4Glcβ–Sp0  250  Neu5Acα2-6Galβ1-4Glcβ–Sp8  251  Neu5Acα2-6Galβ–Sp8  252  Neu5Acα2-8Neu5Acα-Sp8  253  Neu5Acα2-8Neu5Acα2-3Galβ1-4Glcβ–Sp0  254  Neu5Acβ2-6GalNAcα–Sp8  255  Neu5Acβ2-6Galβ1-4GlcNAcβ-Sp8  256  Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp21  257  Neu5Gca2-3Galβ1-3(Fucα1-4)GlcNAcβ-Sp0  258  Neu5Gca2-3Galβ1-3GlcNAcβ-Sp0  259  Neu5Gca2-3Galβ1-4(Fucα1-3)GlcNAcβ-Sp0  260  Neu5Gcα2-3Galβ1-4GlcNAcβ–Sp0  261  Neu5Gcα2-3Galβ1-4Glcβ–Sp0  262  Neu5Gcα2-6GalNAcα–Sp0  263  Neu5Gcα2-6Galβ1-4GlcNAcβ–Sp0  264  Neu5Gcα–Sp8  265  [3OSO3]Galβ1-4(Fucα1-3)(6OSO3)Glc-Sp0  266  [3OSO3]Galβ1-4(Fucα1-3)Glc-Sp0  267  [3OSO3]Galβ1-4[Fucα1-3][6OSO3]GlcNAc-Sp8  268  [3OSO3]Galβ1-4[Fucα1-3]GlcNAc-Sp0  269  Fucα1-2[6OSO3]Galβ1-4GlcNAc-Sp0  270  Fucα1-2Galβ1-4[6OSO3]GlcNAc-Sp8  271  Fucα1-2[6OSO3]Galβ1-4[6OSO3]Glc-Sp0  272  Fucα1-2-(6OSO3)-Galβ1-4Glc-Sp0  196  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  273  Fucα1-2-Galβ1-4[6OSO3]Glc-Sp0  274  Galβ1-3(Fucα1-4)GlcNAcβ1-3Galβ1-3(Fucα1-4)GlcNAcβ-Sp0  275  Galβ1-3-(Galβ1-4GlcNacβ1-6)GalNAc-Sp14  276  Galβ1-3(GlcNacβ1-6)GalNAc-Sp14  277  Galβ1-3-(Neu5Aa2-3Galβ1-4GlcNacβ1-6)GalNAc-Sp14  278  Galβ1-3GalNAc-Sp14  279  Galβ1-3GlcNAcβ1-3Galβ1-3GlcNAcβ-Sp0  280  Galβ1-4[Fucα1-3][6OSO3]GlcNAc-Sp0  281  Galβ1-4[Fucα1-3][6OSO3]Glc-Sp0  282  Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-3(Fucα1-4)GlcNAcβ-Sp0  283  Galβ1-4GlcNAcβ1-3Galβ1-3GlcNAcβ-Sp0  284  Neu5Acα2-3Galβ1-3GlcNAcβ1-3Galβ1-3GlcNAcβ-Sp0  285  Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-3GlcNAcβ-Sp0  286  [3OSO3]Galβ1-4[6OSO3]GlcNAcβ-Sp0  287  [3OSO3][4OSO3]Galβ1-4GlcNacβ-SpSp0  288  [6OSO3]Galβ1-4[6OSO3]GlcNacβ-Sp0  289  6-H2PO3Glcβ-Sp10  290  Galα1-3(Fucα1-2)Galβ–Sp18  291  Galα1-3GalNAcα-Sp16  292  Galβ1-3GalNAcα-Sp16  293  Galβ1-3(Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ1-6)GalNAc–Sp14  294  Galβ1-3Galβ1-4GlcNAcβ-Sp8  295  Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  296  Galβ1-4GlcNAcβ1-3(Galβ1-4GlcNAcβ1-6)Galβ1-4GlcNAc-Sp0  297  Galβ1-4GlcNAcβ1-3(GlcNAcβ1-6)Galβ1-4GlcNAc-Sp0  298  Galβ1-4GlcNAcα1-6Galβ1-4GlcNAcβ-Sp0  299  Galβ1-4GlcNAcβ1-6Galβ1-4GlcNAcβ-Sp0  300  GalNAcα-Sp15  301  GalNAcα1-3(Fucα1-2)Galβ–Sp18  302  GalNAcβ1-3Galβ-Sp8  303  GlcAβ1-3GlcNAcβ-Sp8  304  GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  305  GlcNAcβ1-2Manα1-3(GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  306  GlcNAcβ1-3Man-Sp10  197  Appendix 1: Results of Cpn60.2 and DnaK Binding on a Glycan Array Glycan number  Glycan name  307  GlcNAcβ1-4GlcNAcβ-Sp10  308  GlcNAcβ1-4GlcNAcβ-Sp12  309  HOOC(CH3)CH-3-O-GlcNAcβ1-4GlcNAcβ-Sp10  310  Manα1-3(Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  311  Manα1-6Manβ-Sp10  312  Manα1-6(Manα1-3)Manα1-6(Manα1-3)Manβ-Sp10  313  Manα1-2Manα1-2Manα1-3(Manα1-2Manα1-6(Manα1-3)Manα1-6)Manα-Sp9  314  Manα1-2Manα1-2Manα1-3(Manα1-2Manα1-6(Manα1-2Manα1-3)Manα1-6)Manα-Sp9  315  Neu5Acα2-3Galβ1-3(Neu5Acα2-3Galβ1-4GlcNAcβ1-6)GalNAc–Sp14  316  Neu5Acα2-3Galβ1-3(Neu5Acα2-6)GalNAc-Sp14  317  Neu5Acα2-3Galβ1-3GalNAc–Sp14  318  Neu5Acα2-3Galβ1-4GlcNAcβ1-2Manα1-3(Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  319  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(Galβ1-4GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  320  Neu5Acα2-6Galβ1-4GlcNAcβ1-2Manα1-3(GlcNAcβ1-2Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ-Sp12  198  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067306/manifest

Comment

Related Items