UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of LI818-like genes under various stress conditions in the marine diatom Thalassiosira… Zhu, Songhua 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_zhu_songhua.pdf [ 2.11MB ]
Metadata
JSON: 24-1.0067305.json
JSON-LD: 24-1.0067305-ld.json
RDF/XML (Pretty): 24-1.0067305-rdf.xml
RDF/JSON: 24-1.0067305-rdf.json
Turtle: 24-1.0067305-turtle.txt
N-Triples: 24-1.0067305-rdf-ntriples.txt
Original Record: 24-1.0067305-source.json
Full Text
24-1.0067305-fulltext.txt
Citation
24-1.0067305.ris

Full Text

Characterization of LI818-like genes under various stress conditions in the marine diatom Thalassiosira pseudonana  by  Songhua Zhu     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies   (Botany)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  June 2009    © Songhua Zhu, 2009  ii ABSTRACT The diatom Thalassiosira pseudonana has genes for 32 members of the Light-harvesting Complex (LHC) superfamily. Within this superfamily, Lhcx1, Lhcx2, Lhcx4, Lhcx5 and Lhcx6 are found to be highly related to LI818 genes in green algae. Since the gene for PsbS is missing, which is crucial for non-photochemical quenching (NPQ) in higher plants, I am investigating the possibility that one or more of the five LI818-like proteins could be substituting for PsbS in responding to high light (HL) in T. pseudonana. Four LI818-like transcripts (Lhcx1/2/4/6) were transiently accumulated upon HL, suggesting that they were high light inducible genes. However, the level of Lhcx1 protein doubled after 1 h of HL and remained at elevated levels once induced. In parallel, the effect of HL on photophysiological parameters was also examined. After exposure to HL, NPQ was induced rapidly, and reached a maximum after 1 h, and stayed at the constant high level over the rest of HL period. There was an abrupt rise in diatoxanthin within few minutes, followed by a continuous accumulation over the remainder of HL period, suggesting its potential photoprotection role during HL stress. Altogether, the high level of NPQ is accompanied with upregulated Lhcx1 protein and a continuous increase of diatoxanthin after 1 h of HL, suggesting that Lhcx1 may play a role in thermal energy dissipation (NPQ) or it could provide increased stability to the thylakoid membrane assembly during HL. The abundances of most of LI818-like transcripts were down-regulated under iron deficiency. In contrast, Lhcx1 protein was upregulated under iron deficiency, suggesting this gene is independently transcriptionally and translationally regulated. However, copper starvation had less effect on the expression of all Lhc genes relative to iron deprivation, suggesting that iron plays a key role in regulating the expression of Lhc genes. Unlike D1 protein, several PSI subunits were substantially reduced under iron deficiency, demonstrating that PSI reaction center was more affected by iron limitation. My data revealed that the accumulation of Lhcx1 is accompanied by the degradation of PSI proteins under iron limitation, suggesting that Lhcx1 could be involved in the remodeling of PSI.  iii TABLES OF CONTENTS  ABSTRACT................................................................................................... ii TABLES OF CONTENTS .......................................................................... iii LIST OF TABLES ....................................................................................... ix LIST OF FIGURES ...................................................................................... x LIST OF ABBREVIATIONS ................................................................... xiii ACKNOWLEDGEMENTS ....................................................................... xv  Chapter 1 Introduction ................................................................................ 1 1.1 Diatoms-characteristics and taxonomy..................................................................... 2 1.2 Organization of plastids in diatoms and green plants ............................................... 2 1.2.1 Organization of plastids and their evolutionary origins..................................... 2 1.2.2 Organization of thylakoid membranes............................................................... 3 1.2.3 Light-harvesting pigment contents .................................................................... 4 1.3 Light-harvesting complex (LHC) Superfamily......................................................... 5 1.3.1 Chl a/b light-harvesting proteins (CAB) in green plants ................................... 5 1.3.1.1 CAB proteins in higher plants..................................................................... 5 1.3.1.2 CAB proteins in green algae ....................................................................... 7 1.3.2 Red algal LHCs.................................................................................................. 9 1.3.3 FCP proteins in the heterokont algae ............................................................... 10 1.3.4. Stress related proteins ..................................................................................... 11 1.3.4.1 Early light inducible proteins (ELIPs) ...................................................... 11 1.3.4.2 High light inducible proteins (Hlips) ........................................................ 11 1.3.4.3 Stress-enhanced proteins (Seps) ............................................................... 12 1.4 LHC superfamily consists of three major groups in diatoms ................................. 13 1.5 LI818 genes and proteins-Overview....................................................................... 16  iv 1.5.1 LI818 genes and proteins in green algae.......................................................... 16 1.5.2 LI818 genes and proteins in diatoms ............................................................... 17 1.6 Photoprotection in higher plants and green algae ................................................... 18 1.6.1 ΔpH-dependent quenching (qE)....................................................................... 21 1.6.1.1 Low pH in the thylakoid lumen triggers qE.............................................. 21 1.6.1.2 Xanthophyll cycle is involved in the process ........................................... 21 1.6.1.3 PsbS protein is essential for qE in higher plants....................................... 22 1.6.1.4 qE is dependent on the composition of the PSII antenna rather than a single protein......................................................................................................... 23 1.6.1.5 Putative quenching site of qE ................................................................... 24 1.6.2 Sustained thermal dissipation (qI) ................................................................... 25 1.7 Photoprotection in diatoms ..................................................................................... 26 1.7.1 Diadinoxanthin cycle is tightly associated with the NPQ in diatoms.............. 27 1.7.2 ΔpH and diatoxanthin are essential for the development of NPQ in diatoms . 27 1.7.3 Evidence of Ddx and Dtx binding LHC complexes in diatoms....................... 28 1.8 Iron is an essential trace metal element for photosynthesis.................................... 30 1.8.1 The chloroplast is a major sink of transition metal iron .................................. 30 1.8.2 Iron plays a crucial role in high nutrient but low chlorophyll regions of the ocean ......................................................................................................................... 31 1.8.3 Major effects caused by iron deficiency in different photoautotrophic organisms .................................................................................................................. 32 1.9 Thesis objective ...................................................................................................... 33  Chapter 2 General methods....................................................................... 34 2.1 Culture conditions................................................................................................... 35 2.2 RNA extraction and qRT-PCR ............................................................................... 37 2.3 Protein extraction and analysis ............................................................................... 37 2.4 SDS-PAGE and immunoblotting............................................................................ 37 2.5 Chlorophyll fluorescence measurements ................................................................ 38   v Chapter 3 Identification and organization of LI818 homologous genes, standard light-harvesting genes and their proteins in the diatom Thalassiosira pseudonana ........................................................................... 40 3.1 Introduction............................................................................................................. 41 3.2 Materials and methods ............................................................................................ 42 3.2.1 Culture conditions............................................................................................ 42 3.2.2 Gene cloning, sequencing and expression ....................................................... 42 3.2.3 Isolation of thylakoid membranes.................................................................... 42 3.2.4 Extraction of thylakoid membrane proteins..................................................... 43 3.2.5 SDS-PAGE and western immunoblotting ....................................................... 43 3.3 Results..................................................................................................................... 44 3.3.1 Gene analysis ................................................................................................... 44 3.3.2 Gene organization and arrangement ................................................................ 46 3.3.3 Comparison of the 5’UTR and 3’UTR of the Lhcx and Lhcf genes ................ 48 3.3.4 Identification of LI818-like and Lhcf polypeptides......................................... 52 3.3.5 Thylakoid wash................................................................................................ 54 3.3.6 Diurnal expression pattern of Lhcx and Lhcf genes ......................................... 56 3.4 Discussion ............................................................................................................... 59 3.4.1 An intron is located at the same position within the plastid targeting presequence............................................................................................................... 59 3.4.2 Distinctive gene organization in the light harvesting gene superfamily.......... 59 3.4.3 Several closely spaced gene pairs share high homologies............................... 60 3.4.4 Different diurnal expression patterns between Lhcx and Lhcf genes............... 61 3.4.5 Lhcx1 polypeptide is not tightly embedded in the thylakoid membrane compared to the Lhcf proteins .................................................................................. 62  Chapter 4 Effects of high light stress on the expression of LI818-like genes and one LI818-like protein in the marine diatom Thalassiosira pseudonana................................................................................................... 64 4.1 Introduction............................................................................................................. 65  vi 4.2 Materials and methods ............................................................................................ 66 4.2.1 Culture conditions............................................................................................ 66 4.2.2 RNA extraction and qRT-PCR ........................................................................ 67 4.2.3 Protein extraction and analysis ........................................................................ 67 4.2.4 SDS-PAGE and immunoblotting..................................................................... 67 4.3 Results..................................................................................................................... 67 4.3.1 Effects of different light irradiances on the expression of LI818-like genes (Lhcx) ........................................................................................................................ 67 4.3.2 Effects of prolonged high light stress on the expression of LI818-like genes (Lhcx) ........................................................................................................................ 68 4.3.3 Effects of short-term high light stress on the expression of Lhcx genes.......... 70 4.3.4 Effects of high light stress on Lhcx1 protein expression................................. 74 4.3.5 Effects of different light irradiances and different exposures to high light on the expression of the putative “red” Elip-like gene .................................................. 77 4.4 Discussion ............................................................................................................... 82 4.4.1 Kinetic changes of LI818-like transcripts in T. pseudonana during high light acclimation................................................................................................................ 82 4.4.2 Lhcx5 gene has a different function from the other Lhcx genes in the LI818-like gene family................................................................................................................ 83 4.4.3 Expression of LI818-like genes upon high light in comparison with “green” and “red” Elip genes ................................................................................................. 83 4.4.4 Different regulation patterns of LI818-like genes and one LI818-like protein (Lhcx1) during high light stress................................................................................ 85 4.4.5 Dynamic changes of Lhcx1 protein in T. pseudonana in the process of high light acclimation........................................................................................................ 86  Chapter 5 Photoprotection after different exposures to high light stress in the marine diatom Thalassiosira pseudonana ...................................... 87 5.1 Introduction............................................................................................................. 88 5.2 Materials and methods ............................................................................................ 89 5.2.1 Culture conditions............................................................................................ 89  vii 5.2.2 Chlorophyll fluorescence measurements ......................................................... 89 5.2.3 Pigment analysis .............................................................................................. 90 5.3 Results..................................................................................................................... 91 5.3.1 NPQ and operational PSII efficiency in response to increasing photon flux densities (PFD).......................................................................................................... 91 5.3.2 The development of NPQ within 1 h of high light stress ................................ 91 5.3.3 Effect of a longer high light stress on different photosynthetic parameters .... 95 5.3.4 Changes of xanthophyll cycle pigments in response to high light stress......... 98 5.4 Discussion ............................................................................................................. 103 5.4.1 Regulation of light absorption and absorbed energy dissipation ................... 103 5.4.2 Heterogeneous NPQ components in T. pseudonana and their relationship with the Dtx concentration.............................................................................................. 104 5.4.3 LI818-like proteins may be associated with more than one type of NPQ and they are probably involved in binding of the Dtx molecules.................................. 105 5.4.4 Accumulated Lhcx1 protein is correlated with the sustained quenching (qI) during longer term HL stress .................................................................................. 106 5.4.5 D1 protein is not significantly degraded during prolonged high light stress. 107  Chapter 6 Expression of LI818-like genes and Lhcx1 protein under iron and copper deficiency in the marine diatom Thalassiosira pseudonana ..................................................................................................................... 108 6.1 Introduction........................................................................................................... 109 6.2 Materials and methods .......................................................................................... 111 6.2.1 Culture conditions.......................................................................................... 111 6.2.2 RNA extraction and qRT-PCR ...................................................................... 111 6.2.3 Protein extraction and analysis ...................................................................... 112 6.2.4 SDS-PAGE and immunoblotting................................................................... 112 6.2.5 Chlorophyll fluorescence measurements ....................................................... 112 6.3 Results................................................................................................................... 113 6.3.1 Cell growth rates and cell sizes under trace metal starvation ........................ 113 6.3.2 Effects of iron and copper deficiency on gene expression ............................ 114  viii 6.3.3 Effects of iron and copper deficiency on protein expression......................... 116 6.3.4 Chlorophyll fluorescence parameters in response to the trace metal deficiency ................................................................................................................................. 119 6.4 Discussion ............................................................................................................. 121 6.4.1 Physiological adaptations: growth rate and cell size ..................................... 121 6.4.2 Expression of Lhcx and Lhcf genes under trace metal deficiency ................. 122 6.4.3 The down-regulation of Lhcf polypeptides is accompanied by the accumulation of Lhcx1 proteins under iron deficiency .......................................... 123 6.4.4 Effects of iron deficiency on PSII reaction center ......................................... 124 6.4.5 Effects of copper deficiency .......................................................................... 125  Chapter 7 Conclusions and future directions ........................................ 126 7.1 Summary of major findings of this thesis ............................................................. 127 7.2 Distinctive gene organization of Lhc genes in T. pseudonana ............................. 128 7.3 LI818 homologous protein is a unique member of LHCs .................................... 129 7.3.1 Lhcx1 protein is not tightly bound to the thylakoid membranes ................... 129 7.3.2 Accumulation of LI818-like transcripts and Lhcx1 protein in response to high irradiance................................................................................................................. 129 7.4 Dual roles of LI818-like proteins in photoprotection: Involvement in the thermal energy dissipation (NPQ) and in the stabilization of thylakoid membranes under high light stress ................................................................................................................... 131 7.4.1 Possible proton binding sites are found in LI818-like proteins ..................... 131 7.4.2 Lhcx1 protein may be involved in ΔpH-dependent quenching (qE) under excess light.............................................................................................................. 131 7.4.3 Accumulation of Lhcx1 protein is closely correlated with sustained quenching (qI) during longer high light stress.......................................................................... 135 7.4.4 Lhcx1 protein is also associated with the stabilization of the thylakoid membranes during longer-term high light .............................................................. 137 7.5 Remodeling of PSI may occur in T. pseudonana under iron deficiency .............. 137  References.................................................................................................. 141  ix LIST OF TABLES Table 1.1 Features of different plastid types ...................................................................... 4 Table 3.1 Summary of the basic features of five LI818-like genes (Lhcxs)..................... 45 Table 3.2 Summary of the basic features of six standard light harvesting genes (Lhcfs) 45 Table 5.1 The fraction of qE and qI in the NPQ component after different durations of HL exposure.............................................................................................................. 94 Table 6.1 Iron and copper total concentrations in the medium, cell growth rate, cell size and cellular protein content of T. pseudonana grown under three different trace metal conditions................................................................................................................ 114 Table 6.2 Expression of several Lhcx and Lhcf genes under different stress conditions derived from microarray data (Mock et al., 2008).................................................. 123   x LIST OF FIGURES Figure 1.1 Maximum likelihood phylogenetic tree of LHC superfamily in three diatoms ................................................................................................................................... 14 Figure 1.2 Several possible fates of singlet-excited Chl.................................................. 20 Figure 2.1 High irradiance setup illustration ................................................................... 36 Figure 3.1 Organization of several Lhcx and Lhcf genes on the chromosomes in the genome of T. pseudonana. ........................................................................................ 47 Figure 3.2 Comparison of the 5’ untranslated sequences among five Lhcx and five Lhcf genes. ........................................................................................................................ 49 Figure 3.3 Presence of putative promoters in sequences 200-300 bp upstream of the transcription start sites of five Lhcx and three Lhcf genes. ....................................... 50 Figure 3.4 Characterization of Lhcx1/2 and Lhcf proteins from T. pseudonana thylakoid fraction assayed by immunoblotting......................................................................... 53 Figure 3.5 Western immunoblotting analysis of extracted polypeptides from the thylakoid membrane by dissociating treatments....................................................... 55 Figure 3.6 Changes in the transcript levels of Lhcx and Lhcf genes during the day........ 58 Figure 4.1 Changes in mRNA levels of Lhcx (A) and Lhcf2 (B) genes in response to shift from LL (40 μmol m-2s-1) to ML (350 μmol m-2s-1) and HL (700 μmol m-2s-1) using cells in late exponential phase................................................................................... 69 Figure 4.2 Changes in mRNA levels of Lhcx (A) and Lhcf (B) genes in response to shift from LL (40 μmol m-2s-1) to HL (700 μmol m-2s-1) using cells in early exponential phase. ........................................................................................................................ 72 Figure 4.3 Short-term changes in the abundance of Lhcx (A) and Lhcf2 (B) transcripts in response to shift from LL to HL using cells in early exponential phase. ................. 73 Figure 4.4 Changes in the levels of three different proteins after exposure to HL.......... 75 Figure 4.5 Changes in the transcript levels of Elip-like gene (A) and Lhcf2 gene (B) in response to shift from LL (40 μmol m-2s-1) to ML (350 μmol m-2s-1) or to HL (700 μmol m-2s-1) using cells in late exponential growth phase........................................ 78 Figure 4.6 Effects of HL on the accumulation of Elip-like (A) and Lhcf2 (B) transcripts after transition from LL using cells in early exponential growth phase. .................. 80  xi Figure 4.7 Short-term changes in the transcript levels of Elip-like gene and Lhcf 2 after transfer from LL to HL using cells in early exponential growth phase. ................... 81 Figure 4.8 Sequence alignment of predicted second transmembrane helix (TMH) of Elip and Elip-like proteins in both green lineage (Chl a/b) and red lineage (Chl a/c). .... 84 Figure 5.1 Capacity of thermal energy dissipation (NPQ) and operational PSII quantum yield (ΦPSII) as a function of light intensity for a fixed illumination duration of 5 min at the indicated irradiances in dark-adapted T. pseudonana cells. .................... 92 Figure 5.2 NPQ development during 60-min illumination at 700 μmol m-2s-1 after LL- grown cells were shifted into HL.............................................................................. 93 Figure 5.3 Time course of Fv/Fm (A), NPQ (B) and operational PSII quantum yield (C) in T. pseudonana after transition from LL to extended HL...................................... 97 Figure 5.4 Changes of the xanthophyll cycle (XC) pigments after transition from LL to HL for 1 h.................................................................................................................. 99 Figure 5.5 Changes of the xanthophyll cycle (XC) pigments after transition from LL to prolonged HL, normalized to Chl a. ....................................................................... 101 Figure 5.6 Correlation of NPQ and Dtx concentration in T. pseudonana upon high irradiance from 2 to 60 min at 700 μmol m-2s-1. ..................................................... 102 Figure 6.1 Relative expression of Lhcx (A) and Lhcf (B) transcripts when cells were grown under Fe and Cu replete (control, grown at AQUIL medium), and Fe or Cu deplete conditions. .................................................................................................. 115 Figure 6.2 Protein expression under Fe and/or Cu replete or deplete conditions assayed by immunoblotting (A&B) and their corresponding densitometric quantifications (C&D). .................................................................................................................... 118 Figure 6.3 The maximum quantum yield of PSII (Fv/Fm) (A) and capacity for light energy dissipation (NPQ) versus irradiance for a fixed illumination of 5 min (B) in T. pseudonana. ........................................................................................................ 120 Figure 7.1 Amino acid alignment of Lhcxs in T. pseudonana, two LhcIIs in pea and spinach, and PsbS in Arabidopsis thaliana............................................................. 132 Figure 7.2 Schematic model for qE during short-term high light stress in T. pseudonana ................................................................................................................................. 134  xii Figure 7.3 Schematic model for qI during long-term high light stress in T. pseudonana ................................................................................................................................. 136 Figure 7.4 Schematic model for PSI remodeling under iron deficiency in T. pseudonana ................................................................................................................................. 138  xiii LIST OF ABBREVIATIONS  CAB   Chlorophyll a/b binding protein Chl   Chlorophyll Ddx   Diadinoxanthin DPS   De-epoxidation state Dtx   Diatoxanthin ESAW   Enriched seawater artificial seawater FCP   Fucoxanthin chlorophyll a/c protein Fm   Maximal fluorescence yield in the dark Fo   Minimal fluorescence yield in the dark Fv   Variable fluorescence Fv/Fm   Maximum quantum efficiency of photosystem II GAPDH  Glyceraldehyde 3-phosphate dehydrogenase HL   High light LHC   Light harvesting complex LL   Low light NPQ   Non-photochemical fluorescence quenching ORF   Open read frame PAM   Pulse Amplitude Modulated PFD   Photon flux density PSI   Photosystem I PSII   Photosystem II qE   Energy dependent quenching qI   Photoinhibitory quenching  xiv RACE   Rapid amplification of cDNA ends RC   Reaction center RT-PCR  Reverse transcription-PCR SV   Stern-Volmer equation XC   Xanthophyll cycle ΦPSII   Operational quantum yield of PSII ΣXC   Total xanthophyll cycle pool ΔpH   pH gradient across the thylakoid membrane    xv ACKNOWLEDGEMENTS  First, I would like to thank my supervisor Beverley Green for giving me an opportunity for doing my PhD under her supervision. In addition, I would like to thank her for continuing guidance, scientific training and financial support. I also would like to thank my co-supervisor Jin-Gui Chen for his support and valuable advice for my research and for giving me free access to use the real-time PCR machine in his laboratory. I would also like to thank my committee members: Maite Maldonado for her encouragement, helpful discussions, and critical comments on my thesis (also thanks for providing me access to her laboratory and equipment); Ljerka Kunst for her helpful suggestions to my projects and for polishing of my thesis. I am grateful to Terry Crawford and Bilquis Khatoon from cell physiology teaching lab for letting me leave the teaching assistant (TA) job without hesitation when my mother passed away and still paying me the full amount of salary. Without their support and understanding, I could not survive the hardest time of my PhD study. I owe them my most sincere gratitude. Many thanks go to members of the Green lab. I thank Balbir Chaal for teaching me how to make artificial seawaters and grow algae cells. I also thank Yunkun Dang for sharing experimental tips, for overcoming difficulties together and accompanying me throughout this study. I would like to thank Meriem Alami for teaching me how to operate HPLC and helping me to analyze the chromatography data. I would like to thank Santokh Singh and Jarnail Mehroke from plant physiology teaching lab for letting me borrow the high light equipment and use some of their PsbA antibody. I also thank Erhard Rhiel (Carl von Ossietzky University of Oldenburg, Germany) for the Cc-FCP6 antibody, and John Golbeck (Penn State University, USA) for several PSI antibodies. I must thank Dion Durnford who kindly shared the experimental tips and membrane protein extraction and detection procedures. I would like to thank Robert Strzepek for showing me how to use PAM machine and fix the problems. I also thank Jim (Jianjun) Guo for teaching me how to use real-time PCR machine and for helpful suggestions and valuable discussions.  xvi I especially wish to thank my good friends at UBC, Ye Wang, Eryang Li, Qingning Zeng, Jian Guo (also thanks for growing lots of trace metal deficient cell cultures for me), Miao Wen and Sean (Junling) Shang for their help and support. This work was supported by Frances Chave Memorial Scholarship. My heartfelt thanks go to my husband, Shoutao Xu, for his dedication, encouragement, endless support and patience. Finally, I would like to thank my parents and my brother for their understanding and support. This thesis is dedicated to my parents, Qin Zhao and Chaoren Zhu.       1  Chapter 1 Introduction  2 1.1 Diatoms-characteristics and taxonomy Diatoms are unicellular photosynthetic eukaryotic microalgae found throughout the marine and freshwater environments. They are the most important group of eukaryotic phytoplankton, accounting for up to 20% of global carbon fixation and approximately 40% of marine primary productivity (Nelson et al., 1995; Falkowski et al., 1998). There are more than 250 genera of living diatoms with at least 100,000 extant species, constituting the class Bacillariophyceae within the division Heterokontophyta (Hoek et al., 1995; Falkowski et al., 2004). Diatoms are generally classified into two major groups according to the symmetry of their cell wall structure. The centric diatoms are radially symmetrical and usually resemble a petri dish, while the pennate diatoms are enlongated and bilaterally symmetrical (Falciatore and Bowler, 2002). Thalassiosira pseudonana (clone CCMP1335) is a marine centric diatom that was chosen as the first phytoplankton eukaryote for whole genome sequencing. The genome size of T. pseudonana is relatively small at 34 mega base pairs (Armbrust et al., 2004). Its genome sequence was published in 2004 when I just started my project. So this resource provided an excellent opportunity to study this species. In addition to having a complete genome sequence, T. pseudonana can grow easily and rapidly (>1 division per day). For above reasons, T. pseudonana was used as a model organism in my project. 1.2 Organization of plastids in diatoms and green plants 1.2.1 Organization of plastids and their evolutionary origins Plastids are the light harvesting organelles of photosynthetic eukaryotes. Plastids of diatoms and other heterokont algae are surrounded by four distinct membranes (Gibbs, 1979). By contrast, chloroplasts of land plants, green algae, red algae and glaucophytes are enclosed only by two membranes. It shows that diatoms have a fundamentally different evolutionary history from the higher plants. Generally, there are two major types of endosymbiotic plastid acquisition: primary endosymbiosis and secondary endosymbiosis (Ishida, 2005). Higher plants, green algae, red algae and glaucophytes are derived from a primary endosymbiotic event in which a non-photosynthetic eukaryote  3 acquired a chloroplast by engulfing a cyanobacterium-like prokaryote (Moreira et al., 2000). In contrast, heterokont algae such as diatoms acquired their chloroplasts through a secondary endosymbiosis involving a red algal endosymbiont and a non-photosynthetic eukaryote host, resulting in complex chloroplasts (Cavalier-Smith, 2000). The four membranes surrounding the heterokont chloroplast are (from the stromal side) the inner and outer envelope membranes, the periplastid membrane and the chloroplast endoplasmic reticulum (CER). It is believed that the inner and outer envelope membranes correspond to the two membranes of the endosymbiont’s plastid, and the periplastid membrane and CER membranes were derived from the plasma membrane of endosymbiont and the host’s phagosomal membrane respectively (Gibbs, 1981; McFadden, 1999; Cavalier-Smith, 2000). In heterokonts, the most striking feature of a secondary plastid (bound by four membranes) is that the CER membrane is continuous with the endoplasmic reticulum (ER) and the nuclear envelope membrane (Gibbs, 1981; Ishida et al., 2000). The primary plastid (bound by two membranes), resulting from primary endosymbiosis, resides within the cytosol of the host cell, whereas the secondary plastid lies within the rough ER lumen (Archibald and Keeling, 2002). This shows a significant difference between two fundamentally different types of plastids. 1.2.2 Organization of thylakoid membranes In higher plants, the thylakoid membranes are differentiated into granum and stroma regions, also called appressed and non-appressed regions, respectively. To date, numerous studies have shown that photosystem (PS) II is mainly localized in the appressed membranes of the grana, whereas PSI is localized almost exclusively in the non-appressed membranes of the stroma thylakoids (Anderson and Andersson, 1982; Staehelin et al., 1986; Simpson and von Wettstein, 1989). This differential distribution has been termed “lateral heterogeneity” (Andersson and Anderson, 1980). Photosystem segregation is believed to play an important role in balancing the light energy distribution between the two photosystems. However, in most green algae, thylakoid organization is quite different from that seen in higher plants. Thylakoids are tightly appressed and characteristically arranged in extended bands of two to six, although larger stacks are common. It has been demonstrated by immunolabelling that PSI and PSII are  4 approximately equally distributed on the thylakoid membranes in green algae (Song and Gibbs, 1995; Bertos and Gibbs, 1998). In diatoms as well as brown algae, thylakoids are loosely appressed and organized in extended bands of three (Gibbs, 1970), and PSII and PSI are not segregated into different domains (Pyszniak and Gibbs, 1992), which is essentially similar to that found in most green algae. 1.2.3 Light-harvesting pigment contents Photosynthetic eukaryotes always possess chlorophyll a (Chl a) in reaction center proteins and light harvesting antennae, whereas they differ in accessory pigments (Green, 2001). In higher plants and green algae, their chloroplasts contain Chl b as well as Chl a for light harvesting. Diatoms are brown in color due to the predominance of the accessory carotenoid fucoxanthin, which is located together with Chl c and Chl a in their plastids as major light-harvesting pigments (Table 1.1). The presence of Chl c in the plastid of diatoms broadens the absorption spectrum in comparison with that of the higher plants and green algae (Apt et al., 1995).  Table 1.1 Features of different plastid types  Phylum Plastid type Pigments of LHCs Light- harvesting complex Thylakoid characters Envelope membranes Higher plants Primary Chl a, b Zeaxanthin CAB Grana 2 Green algae Primary Chl a, b Zeaxanthin CAB Thylakoids in bands of two to six; grana-like thylakoids present only in streptophytes 2 Diatoms, brown algae, etc. Secondary Chl a, c Fucoxanthin FCP Thylakoids in bands of three 4  5 1.3 Light-harvesting complex (LHC) Superfamily Fucoxanthin and chlorophylls are bound within the light-harvesting antenna complexes by fucoxanthin, chlorophyll a/c binding proteins (FCPs) which are homologous to the chlorophyll a/b binding proteins (CAB) of green algae and higher plants (Green and Durnford, 1996). Since CAB proteins are the most well studied groups among the LHC family, in this section, I will first discuss the characteristics of CAB proteins of green plants in detail. Then I will review the features of FCPs in the heterokont algae. Finally, the characteristics of several stress related proteins in green plants and cyanobacteria will also be covered. 1.3.1 Chl a/b light-harvesting proteins (CAB) in green plants 1.3.1.1 CAB proteins in higher plants In higher plants, there are a number of chlorophyll a/b proteins (CAB) belonging to the LHC superfamily associated with PSII and PSI. CAB proteins are encoded by nuclear genes and bind varying amounts of Chl a, Chl b and xanthophylls including lutein, neoxanthin, violaxanthin, antheraxanthin and zeaxanthin (Sandona et al., 1998; Green and Parson, 2003). The PSII antenna consists of two types of CAB proteins: the major outer LHCII antenna and minor peripheral antenna complexes CP29, CP26 and CP24. LHCII, the most abundant protein complex in chloroplasts, is organized into trimers and binds about half of the chlorophyll associated with PSII (Butler and Kuhlbrandt, 1988). LHCII contains three very similar proteins (encoded by lhcb1, lhcb2 and lhcb3 genes, respectively), which constitute Lhcb1/Lhcb2 and Lhcb1/Lhcb3 heterotrimers and Lhcb1 homotrimers (Jansson, 1994). In contrast, three minor antenna complexes, CP29 (Lhcb4), CP26 (Lhcb5) and CP24 (Lhcb6) usually occur in monomeric aggregation states, accounting for about 15% of the chlorophyll associated with PSII.  They are involved in mediating excitation energy transfer from the LHCII trimer to the PSII core complex. Xanthophylls such as neoxanthin and violaxanthin are enriched in these minor antenna complexes compared with LHCII (Ruban and Horton, 1992; Bassi et al., 1993), suggesting that they might have a role in thermal dissipation.  6 The structure of purified pea LHCII was first resolved by electron crystallography at 3.4 Å resolution (Kuhlbrandt et al., 1994). Each LHCII polypeptide has three membrane- spanning helices (A, B and C) and a short amphipathic helix (D) near the C-terminal end that is exposed to the lumenal surface of the thylakoid membrane. The first (B) and third (A) helices are closely related to each other according to amino acid sequence analysis and they are held together by reciprocal ion pairs involving an Arg on one helix and a Glu on the other. More recently, the structure of the LHCII complex of spinach and pea was elucidated by X-ray crystallography at higher resolution (2.72 Å in spinach and 2.5 Å in pea) (Liu et al., 2004; Standfuss et al., 2005). Each monomer of LHCII binds eight Chl a, six Chl b, two lutein, one neoxanthin and one xanthophyll cycle carotenoid. This structure model provides a general model for the overall folding of all the CAB proteins, since they share substantial regions of sequence conservation (Green and Durnford, 1996). Actually, most members of the extended family of proteins, including fucoxanthin-Chl a/c proteins (FCP) and early light-inducible proteins (ELIPs) and LI818 as well, are predicted to have similar folding pattern. There is a membrane-bound peripheral antenna specific to PSI, called LHCI. The PSI antenna consists of four different polypeptides, Lhca1, Lhca2, Lhca3, Lhca4, which are named to reflect the order in which their corresponding genes were cloned and sequenced (Jansson, 1994). The Lhca polypeptides have molecular masses of about 22-25 kDa. In Arabidopsis thaliana, two additional genes have been identified and named Lhca5 and Lhca6 (Jansson, 1999). However, their expression level is much lower than those of Lhca1-4, and it is unclear if the gene products occur in LHCI. Lhca proteins seem to be organized as dimers (Jansson et al., 1996). While Lhca1 and Lhca4 form heterodimers (Schmid et al., 1997; Schmid et al., 2002), Lhca2 and Lhca3 may form both homodimers and heterodimers (Ganeteg et al., 2001; Croce et al., 2002). It has been suggested based on biochemical studies that each Lhca polypeptide binds 10 Chl a or Chl b, as well as a few xanthophylls (Croce et al., 2002). The X-ray crystal structure of LHCI from pea has been determined at 4.4 Å resolution (Ben-Shem et al., 2003). This model elucidated 12 Chls for Lhca1, Lhca2 and Lhca4, 11 for Lhca3, as well as 9 linker Chls between the monomers of LHCI. In addition to LHCI, a variable amount of LHCII trimers may also be associated with PSI during state transitions. Some evidence suggests that subunit H,  7 on the stromal side of PSI core, is required for LHCII trimers binding and energy transfer to PSI (Lunde et al., 2000; Haldrup et al., 2001). PsbS (also called CP22) is encoded by the psbS gene and has a molecular mass of 22 kDa (Kim et al., 1992; Funk et al., 1994). This protein is extremely hydrophobic and has four- transmembrane helices, one more than other CAB proteins (Kim et al., 1994). PsbS, along with a low lumen pH and the xanthophyll cycle, is essential for pH-dependent thermal dissipation in Arabidopsis thaliana (Li et al., 2000). PsbS serves as a sensor of intrathylakoid lumen pH through the protonation of two acidic amino acid residues located at the lumen side of the protein (Li et al., 2002). To date, the location of this polypeptide within PSII is still unknown. It has been demonstrated that PsbS can be reversibly associated with either the PSII core or the LHCII antenna (Bergantino et al., 2003). Later on, the same group suggested that it may have mobility in the thylakoid membrane (Teardo et al., 2007). It was first reported that isolated PsbS proteins are associated with chlorophylls and carotenoids (Funk et al., 1994; Funk et al., 1995a), but more recently two research groups have demonstrated that purified PsbS appears to contain no chlorophyll or carotenoid (Aspinall-O'Dea et al., 2002; Dominici et al., 2002). Using different methods, evidence of xanthophyll cycle substrate-zeaxanthin binding to PsbS in vitro has been shown (Aspinall-O'Dea et al., 2002). However, unlike most other members of LHC superfamily, this protein is stable in the absence of chlorophylls and carotenoids (Funk et al., 1995b). 1.3.1.2 CAB proteins in green algae In the green alga Chlamydomonas reinhardtii, nine genes (Lhcbm1-6, Lhcbm8, Lhcbm9 and Lhcbm11) have been identified as encoding the major LHC antenna (LHCII) (Elrad and Grossman, 2004). However, Lhcbm polypeptides cannot be differentiated into three distinct subfamilies (Lhcb1, Lhcb2, Lhcb3) as in higher plants (Teramoto et al., 2001). In addition, all the mature Lhcbm proteins share 69%-76% sequence similarities with three Lhcb proteins in the vascular plant A. thaliana. The difference suggests that the different types of LHCII antennae diversified following the split of the green algae and higher plants. Besides the major LHCII antenna, two minor peripheral antenna complexes CP29 and CP26 associated with PSII have been identified in Chlamydomonas reinhardtii  8 (Minagawa et al., 2001; Teramoto et al., 2001). They are encoded by Lhcb4 and Lhcb5, respectively. CP29 and CP26 from C.reinhardtii have 58% and 50% identity at the protein level compared to their counterparts from A. thaliana. However, both of them show less than 25% amino acid level identity to the other members of LHC in C.reinhardtii (Elrad and Grossman, 2004), suggesting that these minor complexes were diverged prior to the separation of the green algae and higher plants. To date, CP24 has not been detected by searching the genome databases or ESTs. In C. reinhardtii it has been revealed that Lhcbm1 protein is important for thermal dissipation during excess light (Elrad et al., 2002). Biochemical investigations demonstrated that CP29, CP26 and Lhcbm5 were found to be associated with PSI-LHCI supercomplex in state 2. These three proteins probably shuttle between PSII and PSI during state transition, suggesting that they act as docking sites for trimeric LHCII complex (Takahashi et al., 2006). In the green alga Dunaliella salina, four major LHCII genes have been cloned and characterized from cDNA libraries (Long et al., 1989; Wei et al., 2006; Wei et al., 2007). The deduced protein sequences share high similarity with other LHCII from C. reinhardtii and A. thaliana. In C. reinhardtii, nine genes (Lhca1-Lhca9) have been predicted to encode LHCI antennas from genomic data (Elrad and Grossman, 2004; Koziol et al., 2007). In early experiments, biochemical studies showed that LHCI consists of at least six distinct polypeptides (Bassi et al., 1992). More recently, a proteomics approach has identified all of the nine Lhca proteins as predicted (Stauber et al., 2003). So these results suggest that the green alga C. reinhardtii contains considerably more polypeptides to form the LHCI antenna complex than those in higher plants. So far, the psbS genes have been identified in two green algae (C. reinhardtii and Volvox carteri) (Anwaruzzaman et al., 2004). It has been suggested that the psbS gene in C. reinhardtii is not highly transcribed based on its low abundance in ESTs and some experimental results (Anwaruzzaman et al., 2004). Moreover, PsbS protein is also not detectable in C. reinhardtii (personal talk with Dr. Niyogi at the Gordon conference, 2008). Consistent with their results, a recent study has shown that PsbS protein cannot be detected in C. reinhardtii under various growth conditions such as high light and cold stress (Bonente et al., 2008). Moreover, no cross-reactions with barley-PsbS antibody  9 have been demonstrated from different unicellular green algae (Bonente et al., 2008). In spite of lacking PsbS protein, some unicellular species exhibit a high capacity for energy dissipation during high light, suggesting that a PsbS-independent energy quenching mechanism is activated. 1.3.2 Red algal LHCs In contrast to green plants containing chlorophyll a/b light-harvesting complexes, red algae possess phycobilisomes, which are attached to the outer surface of the thylakoid membranes and serve as the major antennae for PSII. The existence of an additional, membrane-intrinsic LHC was first demonstrated in the red alga Porphyridium cruentum (Wolfe et al., 1994). This complex is associated only with PSI, and harbours Chl a as the only Chl type and the carotenoids zeaxanthin and β-carotene. The LHCI complex of P. cruentum consists of at least six distinct polypeptides, ranging in size from 19.5 to 23 kDa (Wolfe et al., 1994; Tan et al., 1997b). It has been shown that the polypeptides composing the LHCI of P. cruentum are immunologically related to the polypeptides of Chl a/b and Chl a/c LHCs (Wolfe et al., 1994). In addition, the LHC has been isolated from another red alga Galdieria sulphuraria and has also been found to be exclusively associated with PSI (Marquardt and Rhiel, 1997). LHCI polypeptides have been identified immunologically in seven other red algae (Wolfe et al., 1994; Tan et al., 1997a), indicating that LHCI is widely distributed in the rhodophytes. Similar to the CAB proteins of green plants, the red algal LHCI polypeptides are encoded by the nucleus (Tan et al., 1997a; Marquardt et al., 2000; Marquardt et al., 2001). Seven red algal LHCI cDNAs have been cloned and sequenced from P. cruentum and G. sulphuraria (Tan et al., 1997a; Tan et al., 1997b; Marquardt et al., 2000; Marquardt et al., 2001). The polypeptides encoded by these red algal LHC genes have three predicted membrane- spanning helices, with the first and third helix showing high similarity. Eight putative Chl binding sites are found to be conserved in these LHCI polypeptides. In the predicted model for LHCaR1 and LHCaR2 proteins in P. cruentum (Tan et al., 1997b; Grabowski et al., 2001), the stabilizing residues (Glu ↔Arg, very conserved in the central helices), which are believed to form ionic bonds between helices 1 and 3, are also identical to the consensus residues of green plant LHCs. Therefore, the immunological relatedness found  10 between red algal LHCI and green plant CAB proteins is also reflected by their sequences and conserved regions. 1.3.3 FCP proteins in the heterokont algae In diatoms and other heterokont algae (consisting of brown algae, chrysophytes, raphidophytes) the major light-harvesting complexes (LHCs) are fucoxanthin, chlorophyll a/c binding proteins (FCPs) that are integral to the thylakoid membranes and transfers light energy to chlorophyll a within the photosynthetic reaction center (Scala and Bowler, 2001). The sequence similarities between FCPs and CABs of higher plants have been originally shown by immunological studies (Passaquet et al., 1991; Plumley et al., 1993). The deduced FCP amino acid sequences from the characterized fcp genes have also confirmed their similarity to the CABs (Green and Durnford, 1996). FCPs have been characterized from several diatoms, brown algae, and other heterokont species. Most groups have 1-3 FCP bands on SDS-PAGE gels, ranging in size from 16 to 22 kDa. However, at least 8 distinguishable FCPs separated on gels have been found in Heterosigma akashiwo (Durnford and Green, 1994; Durnford et al., 1996), suggesting that the FCP family of the heterokonts may be just as large and complex as that of higher plants. The fcp genes characterized in heterokonts are nuclear encoded. FCPs appear to be encoded by a multigene family, with some of the fcp genes closely clustered in the nuclear genome (Bhaya and Grossman, 1993; Apt et al., 1994; Apt et al., 1995). Early work has shown that six fcp genes of Phaeodactylum tricornutum are clustered in two loci, separated by short intergenic regions and most probably located on the same chromosome (Grossman et al., 1990; Bhaya and Grossman, 1993). To date, eight fcp genes have been cloned from a centric diatom Cyclotella cryptica. None of the fcp genes exhibit introns within the regions amplified and no gene clusters were found in C. cryptica (Eppard and Rhiel, 1998, 2000). With the completion of genome sequences of two diatoms (T. pseudonana and P. tricornutum), much larger and very diverse FCP families were found and are described in section 1.4.  11 1.3.4. Stress related proteins 1.3.4.1 Early light inducible proteins (ELIPs) Early light inducible proteins (ELIPs) are among the first proteins that accumulate transiently after the transfer of etiolated plants from darkness to light (Meyer and Kloppstech, 1984; Grimm and Kloppstech, 1987). It has been reported that ELIPs are also induced under various environmental stresses, such as high light, drought, cold and nutrient deprivation (Potter and Kloppstech, 1993; Adamska, 1997; Montane and Kloppstech, 2000). ELIPs are encoded by nuclear genes and have three predicted membrane-spanning helices, with the first and third helix showing high similarity. The three-helix ELIPs have been shown to bind Chl a and the xanthophyll lutein (Adamska et al., 1999). So far, ELIPs have been identified in many higher plants and green algae. There are two ELIP gene copies (ELIP1 and ELIP2) found in the A. thaliana genome (Jansson, 1999), which appear to have different regulation patterns (Harari-Steinberg et al., 2001). Moreover, five genes encoding ELIPs have been identified in the green alga C. reinhardtii genome (Elrad and Grossman, 2004). The induction of ELIPs under high light stress suggests that they might function in a photoprotective manner, probably acting as Chl scavengers during the turnover of light-harvesting proteins (Adamska et al., 2001). The photoprotection role of ELIPs has been confirmed in A. thaliana, indicating that ELIPs are involved either in binding of free chlorophyll or in stabilizing the proper assembly of pigment-protein complexes during high light exposure (Hutin et al., 2003). A recent study suggests that ELIPs function as chlorophyll sensors that modulate the chlorophyll content by interfering with the chlorophyll synthesis pathway to prevent accumulation of free chlorophyll during high light stress (Tzvetkova-Chevolleau et al., 2007). 1.3.4.2 High light inducible proteins (Hlips) High light inducible proteins (Hlips), also called Scps (small cab-like proteins), were initially identified in cyanobacteria (Dolganov et al., 1995; Funk and Vermaas, 1999). Hlips contain a single transmembrane helix, with homology to the first and third helix of  12 LHC proteins, suggesting that they may represent an evolutionary progenitor of the LHC superfamily. Genes encoding Hlips have been found in the nuclear genome of A. thaliana (Jansson et al., 2000), and in the nucleomorph genome of a cryptophyte (Douglas et al., 2001), as well as in the chloroplast genome of red algae, glaucophytes and cryptophytes (Green and Kuhlbrandt, 1995). Hlips are induced in response to high light stress and nutrient deprivation that leads to high light stress, indicating their critical roles for the survival of cyanobacteria under high light exposure (He et al., 2001). Based on expression and biochemical data, two different mechanisms of photoprotection have been postulated for Hlips: a transient Chl carrier function (Xu et al., 2004) and an excess energy dissipation function (Havaux et al., 2003). Recently, Hlips have been shown to be involved in the stabilization of PSI trimers to protect cyanobacteria under high light conditions (Wang et al., 2008). One of the two Hlips in A. thaliana can only be triggered by high light stress at the transcript level and has been revealed to be associated with PSI (Andersson et al., 2003). 1.3.4.3 Stress-enhanced proteins (Seps) Stress-enhanced proteins (Seps) have been identified in A. thaliana (Heddad and Adamska, 2000). Seps possess two predicted transmembrane helices, and their first transmembrane helix shares high similarity with the first and third helices of LHCs (CAB/FCP/ELIPs). The two-helix Seps may represent the missing link between one- and three-helix antenna proteins during the course of evolution. Two Sep genes are induced during high light exposure, but are not strongly affected by other physiological stress conditions such as cold, heat, salt, wounding or oxidative stress (Heddad and Adamska, 2000). The functions of Seps are not clear; however, a photoprotection function has been proposed based on the finding that the transcripts of Sep genes are highly upregulated upon high light shift. Because one-helix Hlips, two-helix Seps and three-helix ELIPs are all triggered by high light stress with carotenoid accumulation, it has been suggested that their original role was photoprotection rather than light harvesting (Green and Kuhlbrandt, 1995; Montane and Kloppstech, 2000; Heddad and Adamska, 2002).  13 1.4 LHC superfamily consists of three major groups in diatoms The first diatom genome of T. pseudonana was completely sequenced and released in 2004 (Armbrust et al., 2004). The second diatom genome of Phaeodactylum tricornutum was also completely sequenced and published recently (Bowler et al., 2008). The finished whole genome sequences of two diatoms are available at JGI browser: http://genome.jgi- psf.org/Thaps3/Thaps3.home.html and http://genome.jgi- psf.org/Phatr2/Phatr2.home.html. The genome sequences, along with the availability of a large number of EST sequences (Maheswari et al., 2005) have facilitated the identification of genes in both species. Using the blastp method, we found that the centric diatom T. pseudonana and the pennate diatom P. tricornutum have genes for 32 and 33 distinctive members of the LHC protein superfamily, respectively, all having three predicted transmembrane helices. In addition, eight FCP proteins encoded by different fcp genes (fcp1-7, fcp12) have been characterized in the centric diatom Cyclotella cryptica (Eppard and Rhiel, 1998; Eppard et al., 2000). Based on the available protein sequences in these diatoms as well as LI818 homologous sequences in other organisms, a maximum likelihood tree has been generated (Figure 1.1, Ishida and Green, unpublished). Generally, three distinct clades can be distinguished from this tree (Figure 1.1). The first group is the red algal-like proteins designated as Lhcr proteins. The second group represents the major “standard” light harvesting proteins like the standard FCPs in other heterokont algae. Proteins in this group were named Lhcf proteins. The last group is closely related to the LI818 protein originally found in the green algae C. eugametos and C. reinhardtii but not in higher plants. Since the function of LI818-like proteins is unknown, we named them as Lhcx proteins. I have been involved in the annotating several Lhcf genes and Lhcx genes in T. pseudonana.  14                                   Figure 1.1 Maximum likelihood phylogenetic tree of LHC superfamily in three diatoms  Tp: Thalassiosira pseudonana, a centric diatom, our model organism; Cc: Cyclotella cryptica, another centric diatom; Pt: Phaeodactylum tricornutum, a pennate diatom. Aa: Aureococcus anophagefferens, a marine picophytoplantic heterokont; Chlamydomonas eugametos, Chlamydomonas reinhardtii (Cr), Volvox carteri and Scenedesmus obliquus are unicellular green algae. Physcomitrella patens is a moss.  15 The red algal-like FCP branch contains thirteen Lhcrs from T. pseudonana, fourteen Lhcrs from P. tricornutum and one sequence (FCP4) from C. cryptica (Figure 1.1). All these protein sequences are more closely related to the red algal light harvesting proteins (associated only with PSI) than to the other Chl a/c proteins in heterokonts, which has been also supported by different phylogenetic analyses in previous studies (Durnford et al., 1999; Eppard et al., 2000; Koziol et al., 2007). This provides further evidence that heterokonts acquired their plastids from a red algal endosymbiont. Immuno-electron microscopic studies have shown that the expression of FCP4 protein (a red algal like protein) is not affected by light intensity, so it is different from that of the standard FCP (Becker and Rhiel, 2006). However, it is still unclear whether these red algal-like proteins are truly associated with PSI. So far, the exact function of red algal-like protein (Lhcr) remains unknown. Therefore, genes from this clade were not chosen as my experimental control. The standard FCP clade is composed of fifteen protein members from T. pseudonana and from P. tricornutum, and two proteins from C. cryptica (Eppard and Rhiel, 1998). For identical proteins, such as Lhcf1 and Lhcf2, only one of them was chosen for phylogenetic analysis. Interestingly, most of the Lhcfs in the centric diatoms T. pseudonana and C. cryptica were well clustered and separated from the ones in pennate diatom P. tricornutum. Several Lhcfs in T. pseudonana are highlighted in orange; they were studied as controls, because they showed high similarity to the standard FCPs in other heterokont algae. In addition, there are two new groups with strong bootstrap support (90% or more) within the standard FCP clade. One group contains five members (TpFCP4, TpFCP7, TpFCP9, TpFCP11 and PtLhcf16) from both T. pseudonana and P. tricornutum, and the other has three members (Tp17531, Pt17531 and Cf17531) from three species of diatoms. So far, the function and localization of these proteins are still unknown. Five Lhcxs (Lhcx1, Lhcx2, Lhcx4, Lhcx5 and Lhcx6) have been found in the T. pseudonana genome. Four distinct Lhcxs are shown in the tree and highlighted in gold (Figure 1.1). Four Lhcxs are also found in the genome of P. tricornutum. In C. cryptica, FCP6, FCP7 (identical to FCP6) and FCP12 also belong to this clade, showing higher  16 similarity to LI818 proteins in T. pseudonana than in P. tricornutum. Altogether, LI818- like proteins are present in both centric diatoms and pennate diatoms, probably suggesting their important roles in these organisms. Moreover, the LI818 clade, with high bootstrap support on the tree, contains homologs from a diverse group of photosynthetic organisms, including green algae (C. eugametos, C. reinhardtii, V. carteri and S. obliquus), picoplantic heterokont (A. anophagefferens), and a moss (P. patens). It has also been reported that LI818 homologs are present in haptophytes (Isochrysis galbana) (Richard et al., 2000), and chlorarachniophytes (Bigelowiella natans and Gymnochlora stella) (Koziol et al., 2007; Gile and Keeling, 2008). Taken together, LI818-like homologs are widely distributed in green and red lineages, probably indicating that they are quite ancient (Richard et al., 2000). 1.5 LI818 genes and proteins-Overview 1.5.1 LI818 genes and proteins in green algae LI818 genes were originally discovered in the green algae Chlamydomonas eugametos and Chlamydomonas reinhardtii (Gagne and Guertin, 1992; Savard et al., 1996). In C. reinhardtii grown under 12h light /12h dark cycle, the transcript levels of LI818 gene peak after 1-2 h of illumination, whereas the mRNA abundances of the standard chlorophyll a/b binding light harvesting genes (cab) reach a maximum at noon in the light phase (Savard et al., 1996). With the completion of the genome sequence (Merchant et al., 2007) and the availability of EST databases (Asamiziu et al., 2000; Shrager et al., 2003), three LI818 genes have been found and annotated as LhcSR in C. reinhardtii. LhcSR1, LhcSR2 and LhcSR3 are located on the same scaffold. The expression of LI818 genes under different stress conditions has been intensively studied by microarray analysis and/or RT-PCR. LhcSR1 is highly upregulated under high light stress and low CO2 conditions (Yamano et al., 2008). LhcSR2 is induced under high light stress in both low CO2 and high CO2 (Im et al., 2003), sulfur starvation (Zhang et al., 2004) and phosphorus deprivation (Moseley et al., 2006). LhcSR3 is strongly induced by high light (Yamano et al., 2008), phosphorus deprivation (Moseley et al., 2006) and iron deficiency (Naumann et al., 2007). Together, LhcSR genes in green alga C. reinhardtii are stress response genes and are all induced by light stress. It has been shown that the levels of the  17 LhcSR2 and LhcSR3 proteins increase several fold under iron deficiency as studied by quantitative proteomics (Naumann et al., 2007). Moreover, LhcSR3 is upregulated by high light stress as well. Although the function of LhcSR proteins is still unknown, it has been suggested that they might play a role in photoprotection (Richard et al., 2000; Naumann et al., 2007). 1.5.2 LI818 genes and proteins in diatoms Three FCP proteins encoded by fcp6, fcp7 and fcp12 in the centric diatom C. cryptica share high similarity with LI818 proteins in green algae (Eppard and Rhiel, 1998; Eppard et al., 2000). While the transcript levels of typical fucoxanthin chlorophyll a/c light harvesting genes, fcp1, fcp2, fcp3 and fcp5, are increased under low light (LL) growth conditions, the mRNA abundances of fcp6, fcp7 and fcp12 are increased under high light (HL) growth conditions (Oeltjen et al., 2002). In accordance with their steady state transcript levels, it has been shown by immunoblotting that the amount of FCP2 is about 2-fold higher under LL than under HL growth conditions, whereas the level of FCP6 is upregulated 4 to 5-fold under HL compared to LL. Altogether, the expression of three LI818-like genes and one LI818 homologous protein in C. cryptica is highly induced by high light growth conditions in contrast to the standard fcp genes and proteins, suggesting their possible roles in photoprotection. With the completion of the first whole genome sequence in the centric diatom T. pseudonana (Armbrust et al., 2004), five LI818 homologous genes have been found through phylogenetic analysis and designated as Lhcx1, Lhcx2, Lhcx4, Lhcx5 and Lhcx6 (Refer back to section 1.4 for more detailed information about LI818 proteins).  18 1.6 Photoprotection in higher plants and green algae In natural environments, higher plants and green algae may experience fluctuations in light intensity varying from seconds to days. Under normal light conditions, the photosynthetic apparatus can efficiently capture light energy and utilize excitation energy for CO2 fixation and other assimilation metabolisms. In high light, the absorption of light energy by light harvesting antennas in most plants and algae exceeds their productive utilization for photosynthesis. Under these circumstances, there is a potential to increase the production of damaging reactive oxygen species that can in turn inhibit photosynthesis and photodamage the organisms (Barber and Andersson, 1992). In fact, plants and algae have evolved a number of photoprotective mechanisms to balance the absorption and utilization of light energy and to prevent the photodamage of excess light (Niyogi, 1999, 2000). One of the regulatory mechanisms is to adjust the size of the light harvesting complex antennae (LHC). When plants and algae are grown in different light intensities for long-term acclimation, they are able to regulate the size of LHC through gene expression or/and protein degradation (Walters and Horton, 1994; Escoubas et al., 1995; Lindahl et al., 1995; Maxwell et al., 1995). In addition, plants and algae have ways to dissipate excess energy that has been absorbed. This important photoprotective mechanism is commonly measured as non-photochemical quenching of chlorophyll fluorescence (NPQ) that can get rid of excess absorbed light energy as heat harmlessly (Demmig-Adams and Adams, 1992; Horton et al., 1996; Niyogi, 1999). NPQ is present in nearly all plants and eukaryotic algae for regulation of photosynthesis under excess light. Light is absorbed by chlorophyll-carotenoid binding proteins during photosynthesis. Singlet-excitation state of Chl a (1Chl*) molecule resulting from light absorption can undergo one of four fates (Figure 1.2): it can be re-emitted as light (chlorophyll fluorescence); it can be used to drive the electron transport chain for photosynthesis (photochemistry); it can harmlessly dissipate as heat (NPQ); lastly, it can decay through triplet chlorophyll (3Chl*) (Muller et al., 2001). Up to 75% of absorbed light energy can be quenched through the NPQ process (Demmig-Adams et al., 1996; Bassi and Caffarri, 2000). It has been estimated that 4%-25% of 1Chl* can be dissipated via triplet pathway.  19 However, 3Chl* can transfer energy to O2 to form singlet oxygen (1O2 *), a highly reactive oxygen species resulting in photooxidative damage (Havaux and Niyogi, 1999). De-excitation via photochemistry (qP) and NPQ can limit the yields of steady state fluorescence and 3Chl*, thereby minimizing the production of reactive oxygen species such as 1O2 *. Therefore, NPQ represents an important photoprotective mechanism to prevent photodamage through safe thermal dissipation. There are three distinct components of NPQ based on their relaxation kinetics during dark recovery and their response to different inhibitors: ΔpH-dependent quenching (qE), photoinhibitory quenching (qI) and state transition quenching (qT) (Horton and Hague, 1988). qE, also called energy-dependent quenching or feedback de-excitation, is the most rapidly inducible and reversible component of NPQ, which may take few seconds to minutes to relax. qI, also referred to as sustained thermal dissipation, is caused by photoinhibition and relaxes very slowly in the range of hours when excess light is removed. qT is associated with state transition and relaxes within minutes. State transition usually involves the detachment of phosphorylated LHCII from PSII and movement to PSI for energy redistribution when overexcitation of PSII relative to PSI occurs. qT is rather small in most plants under excess light and is unlikely to be an important factor for photoprotection (Horton et al., 1996; Niyogi, 1999). It has been reported that the light harvesting complex kinase system is inactivated in high light (Rintamaki et al., 1997). In addition, qT is absent in all Chl a/c-containing algae. Therefore, I will focus on the ΔpH-dependent quenching (qE) and sustained quenching (qI) in the following sections.  20                      Figure 1.2 Several possible fates of singlet-excited Chl  When Chl absorbs light energy it becomes excited from its ground state to its singlet excited state, 1Chl*. There are several ways for singlet excited Chl to return to the ground state. It can be re-emitted as light-chlorophyll fluorescence (1). Its excitation can be used to drive photosynthetic reactions (2), or it can be dissipated as heat (3). Finally, 1Chl* is able to produce 3Chl* by intersystem crossing (4), which in turn can produce 1O2*, a damaging reactive oxygen species. (Non-photochemical quenching)Chl 1Chl* Fluorescence Photochemistry (qP) Heat Light 1 2 3 3Chl* 4 O2 1O2 *  21 1.6.1 ΔpH-dependent quenching (qE) 1.6.1.1 Low pH in the thylakoid lumen triggers qE qE is induced by the low pH in the thylakoid lumen which is generated by photosynthetic electron transport in excess light (Horton et al., 1996; Muller et al., 2001). Therefore, this mechanism is considered as a feedback regulation of photosynthesis (Niyogi, 2000; Niyogi et al., 2005). The build-up of ΔpH across the thylakoid membrane controls qE, which make the quenching rapidly inducible or reversible under fluctuating light intensity. Acidification of the thylakoid lumen has two important roles for the induction of qE: activation of xanthophyll conversion through a xanthophyll cycle (Demmig- Adams, 1990) and protonation of lumen-exposed domains of one or more PSII proteins (Horton et al., 1996; Li et al., 2002a; Li et al., 2004). It has been postulated that binding of protons and zeaxanthin (a xanthophyll) to LHC associated with PSII causes the conformational change, which can be monitored by an absorption change at 535 nm (Gilmore, 1997). This conformational change switches LHC into a quenched state and leads to an efficient energy dissipation. It has been demonstrated that qE is strongly correlated with the absorption change at 535 nm (Ruban et al., 1993; Bilger and Bjorkman, 1994). 1.6.1.2 Xanthophyll cycle is involved in the process In plants and green algae, the xanthophyll cycle (also named violaxanthin cycle) is involved in the pH-dependent interconversion of several xanthophyll pigments. Low pH in the thylakoid lumen in excess light activates the lumen-localized violaxanthin de- epoxidase (VDE) (Bugos and Yamamoto, 1996; Eskling et al., 1997), which converts violaxanthin first to antheraxanthin and then to zeaxanthin through the xanthophyll cycle. Under limited light, zeaxanthin epoxidase (ZE), located on the stromal side of the thylakoid membrane, converts zeaxanthin back to violaxanthin via the intermediate antheraxanthin (Bouvier et al., 1996). It has been demonstrated that the amount of zeaxanthin is strongly correlated with the qE capacity in various plants under different conditions (Demmig-Adams, 1990). The role of xanthophylls in the ΔpH-dependent quenching has been investigated in a line of mutants  22 that affect xanthophyll synthesis. Arabidopsis npq1 mutants, which cannot convert violaxanthin to zeaxanthin due to a mutation in the violaxanthin de-epoxidase gene, exhibit greatly reduced qE (Niyogi et al., 1998). Similarly, the Chlamydomonas npq1 mutant is unable to convert violaxanthin to zeaxanthin in excess light. This mutant shows decreased qE compared with the wild type (Niyogi et al., 1997a). Together, these results showed that lower levels of qE are correlated with the lack of zeaxanthin in these npq1 mutants, confirming that zeaxanthin is required for qE. In addition to zeaxanthin, another xanthophyll, lutein, has been suggested to have a role in thermal dissipation. The evidence for this comes from two mutants, the Arabidopsis lut2 and the Chlamydomonas lor1, both of which lack lutein and exhibit less qE than the wild type, respectively (Niyogi et al., 1997b; Pogson et al., 1998). Moreover, the Arabidopsis npq1 lut2 and the Chlamydomonas npq1 lor1 double mutants that lack both lutein and zeaxanthin are totally lacking qE and are very susceptible to high light (Niyogi et al., 1997b; Niyogi et al., 2001). Even though zeaxanthin is required for the maximal level of qE, it is not sufficient. The npq2 mutants of Arabidopsis and Chlamydomonas, which are defective in the gene encoding zeaxanthin epoxidase and therefore cannot convert zeaxanthin to violaxanthin, accumulate zeaxanthin constitutively (Niyogi et al., 1997a; Niyogi et al., 1998). The high level of zeaxanthin is not sufficient to induce qE, demonstrating that ΔpH is also required for the thermal dissipation. 1.6.1.3 PsbS protein is essential for qE in higher plants The Arabidopsis npq4 mutant, which has a complete deletion of the psbS gene, lacks qE (Li et al., 2000). This result revealed that the PsbS protein, encoded by the psbS gene, is essential to the formation of qE in addition to low pH and de-epoxidased xanthophyll such as zeaxanthin. By using site-directed mutagenesis approach, two acidic amino acids (Glu122 and Glu226) in the lumen-exposed domain of PsbS have been shown to be necessary for qE and are critical for PsbS function, suggesting that under high light the protonation of these residues of PsbS is essential for qE (Li et al., 2002a). Biochemical studies have further revealed that double mutants (mutation at Glu122 and Glu226) are devoid of the absorption change at 535 nm and DCCD binding. DCCD is a qE inhibitor  23 and binds to proton active residues. Therefore, this finding strongly suggests that PsbS serves as a sensor of lumen pH (Li et al., 2004). Overexpression of PsbS protein in the transgenetic plants has been demonstrated to enhance the qE capacity, suggesting that the level of PsbS is a determinant of thermal dissipation (Li et al., 2002b). It has been described that homodimers of PsbS are present in the thylakoid membrane and that the ratio of monomer to dimer is dependent on the pH of the lumen and the light intensity (Bergantino et al., 2003). Currently, the exact location of PsbS is still unknown. It has been demonstrated that PsbS can reversibly associate with either the PSII reaction center or the LHC antenna complexes (Bergantino et al., 2003). More recently, the same group found that PsbS has multiple locations in the thylakoid membrane, leading to a suggestion that it may have lateral mobility in the thylakoid membrane (Teardo et al., 2007). Based on biochemical studies, it has been recently proposed that PsbS regulates the macro-organization of PSII core and LHCII antenna in the grana membranes (Kiss et al., 2008). PsbS may function as an antenna “organizer” and likely drives LHCII antennae into the quenched state through conformational change under excess light. 1.6.1.4 qE is dependent on the composition of the PSII antenna rather than a single protein Antisense Arabidopsis plants, which lack Lhcb1 and Lhcb2 proteins, exhibit partially reduced levels of qE (Andersson et al., 2003). Surprisingly, the PSII supercomplex structure and abundance remain unchanged. However, the major trimeric LHCII is replaced by trimers containing CP26, which is usually a monomeric and minor complex (Ruban et al., 2003). The reduction of qE in Lhcb1/2 antisense plants is probably due to the decreased levels of PsbS (Andersson et al., 2003). In plants lacking Lhcb3 protein, NPQ is not affected and the LHCII-PSII supercomplex structure has only small deviations compared with the wild type (Horton et al., 2008). Similarly, the Lhcb5 antisense plant, resulting in the lack of Lhcb5 (CP26) protein, did not show significant changes in NPQ and in the organization of the LHCII-PSII supercomplexes (Andersson et al., 2001; Yakushevska et al., 2003). These results indicate that the supercomplex can assemble and function normally in qE even without CP26. By contrast, when Arabidopsis plants are deficient in CP29 (Lhcb4) or CP24 (Lhcb6), there is a big change in NPQ  24 formation and a marked disruption in the organization of LHCII- PSII supercomplex. The antisense plant depleted of CP29 protein shows lowered levels of qE, especially in the initial rapid phase of NPQ (Andersson et al., 2001). Furthermore, biochemical evidence has shown that no ordered arrays of LHCII-PSII supercomplex can be detected in the CP29-deficient plants, suggesting that supercomplexes are probably either unstable or absent (Yakushevska et al., 2003). In CP24-defective plants, qE can be quickly induced but it is completely abolished in a slow phase during high light (Kovacs et al., 2006). In terms of macroorganization of PSII, there is a dramatic change. Taken together, qE capacity is strongly correlated with the macroorganization of LHCII-PSII, leading to a suggestion that qE is a property of LHCII-PSII supercomplex that consists of LHCII trimer, CP29, CP26 and CP24 instead of any specific protein. These components have been further postulated to form a qE locus (Horton et al., 2008). During excess light, protonation of PsbS may switch LHCII at qE locus into quenched state via conformational change. In conclusion, PsbS functions as a master-switch that turns qE on and off during fluctuating light. 1.6.1.5 Putative quenching site of qE It has been demonstrated in vitro that LHCII, the major trimeric light harvesting protein, has an intrinsic capacity to promote transformation into a dissipative state through conformational change (Pascal et al., 2005). Several chlorophyll pairs observed in the crystal structure of LHCII have potential to be the quenchers for excess energy. Strikingly, one of them, Chl a 611/Chl a 612 pair, together with lutein 620 and Chl a 610, has been confirmed to be a putative quenching site in vivo from purified LHCII proteins, through which energy can be transferred from Chl a to the excited state of lutein (Ruban et al., 2007). More recently, based on site-directed mutagenesis and pigment reconstitution it has been shown that CP29, CP26 and CP24 have identical or similar quenching site as LHCII, indicating that this putative quenching site is conserved in all the subunits of qE locus (Mozzo et al., 2008). Altogether, these results suggest that all LHC antennae may function as quenchers, further supporting the above qE locus model.  25 1.6.2 Sustained thermal dissipation (qI) Sustained (instead of rapidly reversible) thermal dissipation causes the decrease of maximal photosystem II efficiency, and it is therefore generally termed photoinhibitory quenching (qI) that relaxes very slowly in the darkness. During prolonged light stress, qI takes over when qE is impaired, which has been confirmed in the Arabidopsis PsbS- deficient npq4 mutant (Horton et al., 2008). Similar to qE, zeaxanthin is also correlated with qI as a common factor (Demmig et al., 1987; Demmig-Adams et al., 1996). So far, qI has been studied intensively in the overwintering and tropical evergreen species that can survive in the severe cold stress and high light conditions, respectively. Based on its dependency on the trans-thylakoid pH gradient, qI has been divided into two forms: ΔpH- dependent and ΔpH-independent sustained thermal dissipations (Demmig-Adams and Adams, 2006a). It has been demonstrated that ΔpH-dependent sustained quenching is induced by low temperature and persists at a high level in darkness in various plants (Gilmore and Bjorkman, 1995; Ruban and Horton, 1995; Demmig-Adams et al., 2006b). This form of qI can relax quickly by the addition of uncouplers such as nigercin, indicating its pH dependency (Verhoeven et al., 1998; Demmig-Adams et al., 2006b). Furthermore, this kind of thermal dissipation is also reversed rapidly upon warming of leaves (Gilmore and Bjorkman, 1995; Verhoeven et al., 1998). Since this qI is pH-dependent, it is also described as sustained qE, which shows very slow recovery in darkness in contrast to the normal qE. Sustained, ΔpH-independent thermal dissipation mostly characterized in evergreen species is continuously maintained at high levels for 24 h a day (Adams and Barker, 1998; Adams et al., 2002) and is not sensitive to the uncoupler (Verhoeven et al., 1998; Gilmore and Ball, 2000), indicating that it is not dependent on pH. The high level of sustained, ΔpH-independent dissipation is accompanied by massive retention of zeaxanthin and antheraxanthin throughout day and night and/or up-regulation of stress related proteins such as Elips and Hlips but no changes in PsbS (Demmig-Adams et al., 1998; Adams et al., 2002; Zarter et al., 2006a; Demmig-Adams et al., 2006b; Zarter et al., 2006b). When a shade-grown tropical evergreen is shifted to high light, ΔpH-independent  26 thermal dissipation is formed on the first day after transfer and is paralleled with sustained D1 phosphorylation in the PSII reaction center, as well as increasing xanthophyll cycle pool size (Ebbert et al., 2001; Demmig-Adams et al., 2006b). During prolonged high light stress, this sustained thermal dissipation appears to be associated with degradation of D1 protein, accumulation of Hlips and de novo synthesis of zeaxanthin and lutein (Demmig-Adams et al., 2006b). In addition to the tropical evergreens, ΔpH-independent NPQ in the overwintering evergreen conifers under moderate environmental stress is also correlated with sustained phosphorylation state of D1 protein and arrest of the xanthophyll cycle in its photoprotective form (as zeaxanthin + antheraxanthin) (Ebbert et al., 2005). Moreover, when overwintering evergreen plants are grown at high altitude under severe environmental stress, this sustained qI is subsequently associated with a substantial degradation of PSII components (including D1 protein, oxygen evolving complex [OEC], pheophytin) and up-regulation of Elip-like and Hlip-like proteins (Zarter et al., 2006a; Zarter et al., 2006b; Zarter et al., 2006c). These results have revealed that ΔpH-independent thermal dissipation is either correlated with sustained rearrangement of PSII core or degradation of PSII components, leading to a suggestion that this form of qI may be developed through a structural change of PSII reaction center or removal of PSII components rather than being dependent on the actual presence of excess light and ΔpH in the thylakoid lumen (Demmig-Adams and Adams, 2006a). 1.7 Photoprotection in diatoms Diatoms may experience large fluctuations of light irradiance on a time scale of minutes to hours (Harris, 1986). Similar to green plants, diatoms have evolved various mechanisms for photoprotection to prevent photodamage under excess light. Non- photochemical quenching (NPQ) of chlorophyll fluorescence is one of the most important photoprotective mechanisms in diatoms, which can safely dissipate excess absorbed energy into heat and minimize the photodamage. Intensive studies have demonstrated that diatoms possess the capacity to dissipate excess excitation energy as heat harmlessly upon exposure to high light (Ting and Owens, 1993; Arsalane et al., 1994; Olaizola et al., 1994; Casper-Lindley and Bjorkman, 1998). Diatoms exhibit three to five times higher  27 values of NPQ than higher plants in some cases (Lavaud et al., 2002a; Ruban et al., 2004). Estuarine diatom species showed three to five fold higher capacity of NPQ than oceanic and coastal species, indicating that the different photoprotection ability reflects their original habitat (Lavaud et al., 2007). In contrast to green plants, state transition quenching (qT) is absent in diatoms (Owens, 1986). 1.7.1 Diadinoxanthin cycle is tightly associated with the NPQ in diatoms NPQ in diatoms is associated with a reversible conversion of diadinoxanthin (Ddx) and its de-epoxidized form diatoxanthin (Dtx), which are the components of the diadinoxanthin cycle. Under prolonged high light illumination, some Chl a/c- containing algae including diatoms contain both the violaxanthin cycle and the diadinoxanthin cycle (Lohr and Wilhelm, 1999). Under excess light, Ddx is converted to Dtx by diadinoxanthin de-epoxidase (DDE), and Dtx is converted back to Ddx by diatoxanthin epoxidase under limited light or in darkness (Arsalane et al., 1994; Casper-Lindley and Bjorkman, 1998; Wilhelm et al., 2006). DDE exhibits features different from VDE in green plants with respect to pH dependency. DDE becomes activated at higher lumenal pH than green plant VDE and its activity can be found at neutral pH values (Jakob et al., 2001). Consequently, DDE can be triggered by even a weak proton gradient induced by chlororespiration during prolonged darkness (Jakob et al., 1999). On the other hand, diatoxanthin epoxidase is completely inhibited by the light-driven ΔpH across the thylakoid membrane during high light and its activity can be rapidly restored upon shift to low light or addition of uncoupler (Mewes and Richter, 2002; Goss et al., 2006). The complete inactivation of diatoxanthin epoxidase together with the activation of DDE under excess light ensures the fast and efficient de-epoxidation of Ddx to Dtx. 1.7.2 ΔpH and diatoxanthin are essential for the development of NPQ in diatoms In diatoms, both ΔpH and Dtx are mandatory for the formation of NPQ (Lavaud et al., 2002b; Lavaud and Kroth, 2006). NPQ is completely abolished after the addition of uncoupler prior to illumination (Ruban et al., 2004), suggesting that the build-up of ΔpH  28 is required for the induction of NPQ. In addition, the presence of Dtx is also obligatory for the formation of NPQ (Lavaud et al., 2002b; Goss et al., 2006). It has been widely demonstrated that the increase of NPQ is linearly correlated with the accumulation of Dtx among different diatom species during high light illumination (Olaizola et al., 1994; Casper-Lindley and Bjorkman, 1998; Lavaud et al., 2002a; Lavaud et al., 2004; Ruban et al., 2004), although the quenching efficiency for the same amount of Dtx can vary among different species. Once the NPQ is formed, its extent and kinetics are solely correlated with the amount of Dtx and independent of ΔpH across the thylakoid membrane, in contrast to the green plants where zeaxanthin is not sufficient for the thermal dissipation without low lumen pH (Niyogi et al., 1998; Goss et al., 2006). Recently, a transient NPQ in the marine diatom Cyclotella meneghiniana has been observed, which is induced within seconds after exposure to illumination and is comparable with the transient quenching in higher plants (Grouneva et al., 2008). This fast NPQ is dependent on the lumenal ΔpH and modulated by the initial Dtx content of cells, but is independent of accumulation of Dtx via diadinoxanthin cycle. However, the transient thermal dissipation is absent in the model organism P. tricornutum (Grouneva et al., 2008). Besides the antenna-based quenching, reaction center quenching of PSII has been suggested to play a role in the acclimation of diatoms to fluctuating light conditions (Olaizola et al., 1994; Eisenstadt et al., 2008). In addition to the thermal dissipation, cyclic electron transfer around PSII has been suggested to prevent photo-oxidative damage of both accepter-side and donor-side of PSII under high light (Lavaud et al., 2002c). 1.7.3 Evidence of Ddx and Dtx binding LHC complexes in diatoms The increase of Dtx alone appears to be insufficient to increase the NPQ, suggesting that the acidification of lumen is also required to switch the Dtx into an active state through the protonation of LHC proteins under excess light (Lavaud and Kroth, 2006). However, the gene coding for PsbS protein, which is an essential component for the thermal dissipation in higher plants, is completely missing in the diatom genomes of T. pseudonana and P. tricornutum (Armbrust et al., 2004; Montsant et al., 2005; Bowler et al., 2008).  29 Biochemical study has shown that two different LHC complexes (FCPa and FCPb) are organized in trimers and higher oligomers (hexa- or nonamers), respectively, in the diatom C. meneghiniana. FCPa consists of mostly 18 kDa polypeptides, whereas FCPb contains mostly 19 kDa subunits that assemble into high oligomers via trimers (Buchel, 2003). More recently, two FCP complexes with molecular mass of 18 and 19 kDa were isolated in another diatom P. tricornutum by sucrose gradient or gel filtration, and these two complexes consist of trimers and oligomers, respectively (Lepetit et al., 2007). So far, the higher oligomeric antenna proteins are found in both centric and pennate diatoms, indicating a difference from the situation in higher plants. It has been described that Ddx and Dtx are mostly bound to the LHC antennae in diatoms (Lavaud et al., 2003). In P. tricornutum, a major LHC fraction purified from sucrose gradient centrifugation is enriched in Ddx and exhibits higher degree of de-epoxidation upon high light illumination, probably suggesting that this fraction plays an important role in the formation of NPQ (Lavaud et al., 2003). Later on, biochemical investigation based on sucrose gradient and gel filtration has further confirmed that one of the subfractions is highly enriched in Ddx in P. tricornutum (Guglielmi et al., 2005), implying that this Ddx enriched complex may be the place for the de-epoxidation of Ddx into Dtx involved in the photoprotection during excess light exposure. In C. meneghiniana grown under high light intensity, it has been demonstrated that the up-regulation of FCP6/7 polypeptides, that are components of trimeric FCPa, is paralleled by the increase of pool size of diadinoxanthin cycle containing Ddx and Dtx, and two-fold higher rise of degree of de- epoxidation (Beer et al., 2006). Moreover, the chlorophyll fluorescence yield of FCPa isolated from HL culture is quenched compared to the LL FCPa, leading to a suggestion that the increased amount of Dtx in FCPa may function as a quencher and play a role in photoprotection. More recently, in C. meneghiniana, trimeric FCPa purified either by ion exchange chromatography or by a sucrose gradient exhibited up to five fold higher amount of Dtx in HL cells in comparison to the LL cells. Interestingly, the fluorescence yield of FCPa is down-regulated along with the increase of Dtx concentration, whereas such a negative correlation is not observed in the higher oligomeric FCPb (Gundermann and Buchel, 2008). These results further strengthened the crucial role of FCPa in the thermal dissipation probably through the accumulation of Dtx and up-regulation of  30 LI818-like proteins (FCP6/7) under excess light. However, the exact role of LI818-like proteins in diatoms is currently unknown. Therefore, in this work, my goal is to investigate the expression of LI818-like genes and proteins, and their roles under high light in the centric diatom T. pseudonana. 1.8 Iron is an essential trace metal element for photosynthesis Iron plays a crucial role for many core biochemical processes such as photosynthesis, respiration and nitrogen assimilation, which require electron transfer reactions (Geider and Laroche, 1994). In addition to roles in photosynthetic and respiratory electron transfer, iron is involved in oxygen cycling as a cofactor of catalase, peroxidase, and some superoxide dismutase enzymes detoxifying the harmful reactive oxygen species. 1.8.1 The chloroplast is a major sink of transition metal iron In oxygenic photoautotrophic organisms, the chloroplast is a major sink of iron. There are at least 20-23 atoms of iron in a linear photosynthetic electron transport chain depending on the iron availability (Raven, 1990; Raven et al., 1999). Under iron deficiency, the iron-sulfur redox protein ferredoxin is replaced by metal-free flavodoxin in many cyanobacteria and algae (Geider and Laroche, 1994). Moreover, iron-containing cytochrome c6, a soluble electron carrier between cytochrome b6f and PSI, is replaced by copper-containing plastocyanin in cyanobacteria and green plants. However, this substitution does not occur in most diatoms and other Chl c-containing algae under conditions of iron stress (Raven et al., 1999). Therefore, iron is structurally and functionally essential for the photosynthetic apparatus, which exploits its multioxidation states to donate and accept electrons in electron transfer reactions. It has been estimated that approximately 80% of the iron required by phytoplankton is used in the photosynthetic electron transport chain (Raven, 1990). Due to the high iron demand of photosynthetic apparatus, photosynthesis becomes the principal target of iron limitation.  31 1.8.2 Iron plays a crucial role in high nutrient but low chlorophyll regions of the ocean There are vast “high nutrient, low chlorophyll” (HNLC) regions throughout the world’s oceans, including the subarctic Pacific, equatorial Pacific, and Southern Ocean. These regions are characterized by having high plant nutrient concentration (nitrates, phosphates and silicates) but have low phytoplankton biomass. A large body of evidence has demonstrated that iron plays a central role in controlling phytoplankton growth in the ocean, especially in HNLC regions (Martin and Gordon, 1988a; Martin et al., 1989; Martin et al., 1990; Bruland et al., 1991; Martin et al., 1994; Debaar et al., 1995). Several recent in situ iron fertilization experiments have been shown to trigger a massive phytoplankton bloom and cause the concomitant decrease of macronutrients and dissolved carbon dioxide in these high nutrient and low chlorophyll regions (Coale et al., 1996; Boyd et al., 2000; Tsuda et al., 2003). These results provide further compelling evidence in support of the “iron hypothesis”, which was proposed by Martin and coworkers (Martin and Fitzwater, 1988b). Although iron is the fourth most abundant element in the Earth’s crust, dissolved Fe is generally present at only nanomolar levels in the surface waters of the oceans (Johnson et al., 1997). Factors contributing to the extremely low iron concentration in the oceanic surface waters include the low solubility of iron (III) hydroxides and oxyhydroxides, the high biological uptake of available iron species and the low absolute supply of new iron either from ocean floor sediment or upwelling (Duce and Tindale, 1991; Fung et al., 2000; Morel and Price, 2003). Dissolved Fe concentrations in coastal seawater can be 100- to 1000-fold higher than those in the open ocean (Sunda and Huntsman, 1995). A number of studies have demonstrated that oceanic phytoplankton including diatoms has evolved lower iron requirements for growth compared to the coastal species (Sunda et al., 1991; Sunda and Huntsman, 1995; Maldonado and Price, 1996; Price and Morel, 1998), reflecting the differences in their environmental iron availability. Recent work has revealed that the oceanic diatom species T. oceanica is fundamentally different from the coastal species in their photosynthetic architecture, exhibiting a substantial decrease in both PSI and cytochrome b6f under Fe limitation in comparison with coastal diatoms  32 (Strzepek and Harrison, 2004). This adaptation is suggested to facilitate the colonization of the open ocean by diatoms even under iron deficiency. 1.8.3 Major effects caused by iron deficiency in different photoautotrophic organisms A decrease in cellular content of chl a is one of the most noticeable symptoms of iron limitation not just in diatoms, but also in green algae, cyanobacteria and higher plants (Geider and Laroche, 1994). The amount of other light harvesting pigments including Chl c, fucoxanthin and β-carotene relative to Chl a or cell volume is rather constant regardless of the iron concentrations in diatoms (Geider et al., 1993; van Leeuwe and Stefels, 1998). However, the xanthophyll pigments consisting of Ddx and Dtx showed marked increase under iron deficiency in diatoms (Geider et al., 1993; Kosakowska et al., 2004). Iron starvation also causes the reduction of pigment binding proteins, such as D1 protein in the PSII reaction center, which has been described in iron-limited green algae (Vassiliev et al., 1995) and diatoms (Greene et al., 1991; Greene et al., 1992; Geider et al., 1993). Consequently, a decline of the maximum PSII efficiency (Fv/Fm) under iron deficiency has been found to be ubiquitous in diatoms (Greene et al., 1991; Geider et al., 1993), green algae (Greene et al., 1992), cyanobacteria (Guikema and Sherman, 1983, 1984) and higher plants (Morales et al., 1991). Under iron stress conditions, flavodoxin substitutes for iron-containing protein ferredoxin on the acceptor side of PSI as an electron transport catalyst, through which the high cellular iron requirement is partially relieved (Geider and Laroche, 1994; LaRoche et al., 1996; McKay et al., 1997; McKay et al., 1999). Flavodoxin is a well-known small flavoprotein, containing flavin mononucleotide as the redox center. Flavodoxin and ferredoxin have almost equivalent functions, but flavodoxin is two times larger than ferredoxin (22-24 kDa versus 10-12 kDa) (Geider and Laroche, 1994). The induction of flavodoxin and suppression of ferredoxin under iron deficiency is commonly observed in many cyanobacteria (Laudenbach et al., 1988a; Leonhardt and Straus, 1992) and algae including diatoms (McKay et al., 1997; Erdner et al., 1999; McKay et al., 1999; Davey and Geider, 2001). Expression of flavodoxin appears to be an early stage response to iron stress and is specific to the iron limitation, but not to macronutrient deficiency such as  33 nitrate, phosphate and silicate limitations (McKay et al., 1997; Erdner et al., 1999). So far, a bulk of evidence has demonstrated that flavodoxin is a suitable diagnostic indicator of iron nutritional status in marine phytoplankton (LaRoche et al., 1996; McKay et al., 1997; McKay et al., 1999; Inda and Peleato, 2002; Li et al., 2004). However, flavodoxin has not been found in higher plants (Kaul et al., 2000). Transgenic tobacco plants that express cyanobacterial flavodoxin in their chloroplasts are capable of growing under iron starvation conditions where the growth of wild type plants is severely impaired, indicating that flavodoxin enhances plant tolerance to iron deficiency (Tognetti et al., 2007). It has also been reported that the gene encoding flavodoxin is lacking in some coastal photosynthetic microorganisms (Palenik et al., 2003). 1.9 Thesis objective Diatoms may experience large fluctuations in irradiance and different time of exposure to high light, ranging from minutes to hours (Harris, 1986; Fogg, 1991). Like higher plants, diatoms exhibit high capacity of NPQ for photoprotection under excess light. Surprisingly, the gene encoding the PsbS protein, which is essential for NPQ in higher plants and may function as a sensor of low lumenal pH under high light, is absent from the two diatom genomes of T. pseudonana (Armbrust et al., 2004) and P. tricornutum (Bowler et al., 2008). However, several LI818 homologs have been found in these two diatom genomes, and one centric diatom cDNA library. At present, little is known about the function of LI818 in diatoms. The overall objective of my research is to investigate the role of LI818-like proteins in photoprotection during high light stress over different time scales in a coastal diatom species, T. pseudonana. For this purpose, I sequenced five LI818-like candidate genes, determined their organization in the T. pseudonana genome, and studied their diurnal transcription patterns (Chapter 3). After the confirmation of predicted gene models, I studied the expression patterns of five LI818-like genes and one LI818-like protein (Lhcx1) with an antibody during high light stress (Chapter 4). In parallel, I examined the changes in NPQ and xanthophyll cycle pigments (Ddx and Dtx) after exposure of low light grown cells to high light (Chapter 5). Besides high light stress, I also studied the effects of iron and copper deficiency on the expression of LI818-like genes and Lhcx1 protein (Chapter 6).  34 Chapter 2 General methods  35 2.1 Culture conditions An axenic culture of Thalassiosira pseudonana (CCMP1335) was grown at 18°C in sterile ESAW (enriched seawater, artificial seawater) medium (Berges et al., 2001) at 40 μmol photons m-2s-1 under 12h L/12h D cycle with gentle agitation. Unless otherwise noted, cells were harvested in early exponential growth phase. For the high light (HL) shift experiments, a culture grown under low light (LL) at 40 μmol photons m-2s-1 was divided into two parts. One part was transferred to 700 μmol photons m-2s-1 (HL) at L0 (at the beginning of the light phase), and the other part was kept under LL. High light (white light) (700 μmol photons m-2s-1) was provided by homemade equipment with two attached PHILIPS 100 W halogen lamps (Figure 2.1). A plastic cooling water unit was placed in front of the high light equipment to get rid of excess heat. Cells were placed in a flattened glass bottle and put next to the cooling water container (Figure 2.1). After onset of high light treatment, cells were stirred gently by using a stirring bar to ensure uniform exposure.  36              Figure 2.1 High irradiance setup illustration A: Homemade high light equipment with two attached halogen lamps; B: Cooling water unit; C: Cell suspensions were placed in a flattened medium bottle and gently stirred by a stirring bar. Cooling water unit Stirrer High light Equipment Water In Water Out Cell cultures A B C  37 2.2 RNA extraction and qRT-PCR Total RNA was extracted using RNAqueous™ kit (Ambion, Austin, TX, USA) followed by DNase treatment using TURBO-DNA-free kit (Ambion). Purified total RNA (500 ng –1 μg) was reverse transcribed into cDNAs using Superscript II (Invitrogen, Carlsbad, CA, USA). For quantitative RT-PCR (qRT-PCR), gene-specific primers were designed to give products of about 150 bp. RNA levels are expressed relative to that of the actin gene (reference gene). An iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) was used for qRT-PCR. The PCR amplification profile was 95° C for 3 min followed by 40 cycles of 95° C for 15 s, 60° C for 30s, and 72° C for 30 s (MiniOpticon™, Bio-Rad). Genomic sequences and chromosome locations were obtained from http://genome.jgi- psf.org/Thaps3/Thaps3.home.html. 2.3 Protein extraction and analysis For extraction of total cellular proteins, approximately 1×108 cells were harvested and proteins extracted in 500 μL of lysis solution containing 0.2 M Na2CO3, 2% (w/v) SDS, 5 mM aminocaproic acid and 1 mM benzamidine-HCl, pH 10. The mixture was briefly vortexed and incubated at 60 °C for 20 min. Following lysis, all samples were centrifuged at 14,000×g for 5 min and the resulting supernatant was used for protein analyses. The protein concentration was determined by using a BCA Protein Assay kit (Pierce, Rockford, IL, USA). 2.4 SDS-PAGE and immunoblotting Sample loading buffer [125 mM Tris-HCl, pH6.8; 15% (v/v) glycerol; 4% (w/v) SDS; 0.05% (w/v) bromophenol blue with 0.1 M dithiothreitol] was added to an equal volume of the protein extraction supernatant which was then heated at 80 °C for 20 min to denature the proteins. The proteins were separated on 15% Tris-glycine, SDS- polyacrylamide gels using a mini-gel apparatus. Samples were loaded based on equal amount of total proteins. Proteins were electrotransferred onto nitrocellulose membranes (Bio-Rad) for immunodetection. Membranes were blocked with 5% blocking agent (GE Healthcare, Little Chalfont, Buckinghamshire, England) in phosphate-buffered saline  38 supplemented with 0.05% Tween-20 (PBST) for 2h. The blots were then incubated with different primary antibodies diluted in 2% blocking agent in PBST for 1h. The Cc-FCP6 antibody (1:15,000 dilution) was kindly provided by Dr. E. Rhiel (Carl von Ossietzky University of Oldenburg, Germany); the Ha-FCP antibody (1:5,000 dilution) was raised against a fucoxanthin-chlorophyll protein from Heterosigma akashiwo in our lab; D1 (1:20,000 dilution) and PsbO (1:5,000 dilution) antibodies were purchased from Agrisera AB (Vännäs, Sweden); the α-CPI antibody (1:5,000 dilution) against PsaA and PsaB was raised in our lab; the PsaC (1:1,000 dilution) and PsaD (1:1,000 dilution) antibodies were kindly given by Dr. J.H. Golbeck (Penn State University, USA). The blots were further incubated in horse radish peroxidase (HRP) conjugated goat anti rabbit IgG (H+L) secondary antibody (Bio-Rad) with 1:10,000 dilution in 2% blocking agent in PBST for 1h. The blots were detected with ECL™ western blotting detection system (GE Healthcare) using a chemiluminescence substrate. The blots were exposed to autoradiography film and developed. The intensities of protein bands on the film were scanned and quantified by Image J software developed at the US National Institutes of Health (http://rsb.info.nih.gov/nih-image/). 2.5 Chlorophyll fluorescence measurements Variable Chl fluorescence was measured using a PAM 101 fluorometer (Walz, Effeltrich, Germany) at room temperature. Prior to each fluorescence measurement, samples were dark adapted for 30 min and a 2mL sample (from each of the triplicates) was used for each measurement. A pulse of saturating light (2000 μmol photon m-2s-1 for 700 ms) was applied to determine the maximum fluorescence (Fm). Actinic light was applied to the sample at the same intensity as the growth irradiance or as the high light used to treat the cultures. Once steady state fluorescence was achieved (Fs), saturating pulses (at 2000 μmol photon m-2s-1 for 700 ms) were applied every 30 s to measure the maximal fluorescence under actinic light (Fm’). After the actinic light was turned off, the dark relaxation of fluorescence (Fmr) was measured every 1 min by a pulse of saturating light (2000 μmol photon m-2s-1 for 700 ms). The irradiance was measured using a spherical sensor (model QSL-100; Biospherical Instruments Inc., San Diego, CA, USA). The maximum PSII efficiency was expressed as Fv/Fm = (Fm − F0)/Fm (Bradbury and Baker,  39 1981; Schreiber et al., 1995a; Schreiber et al., 1995b), and the PSII operating efficiency as ΦPSII = (Fm’− Fs)/Fm’(Genty et al., 1989). The NPQ coefficient was calculated using the Stern-Volmer equation, NPQ = (Fm − Fm’)/Fm’ (Bilger and Bjorkman, 1990). The energy dependent quenching was calculated as qE = Fm/Fm’ − Fm/Fmr, and the photoinhibitory quenching as qI = Fm/Fmr − 1. Fmr represents maximum fluorescence measured after relaxation in darkness (Farber et al., 1997).  40 Chapter 3 Identification and organization of LI818 homologous genes, standard light-harvesting genes and their proteins in the diatom Thalassiosira pseudonana  41 3.1 Introduction The completed genome sequence and the availability of a large number of EST sequences (Armbrust et al., 2004; Maheswari et al., 2005) have facilitated the identification of genes in Thalassiosira pseudonana. We found that T. pseudonana has genes for 32 members of the LHC protein superfamily, belonging to three distinct clades: the major “standard” Lhcf proteins (also called FCPs in other heterokont algae), the red algal-like Lhcr proteins, and the LI818-like Lhcx proteins (as shown in Figure 1.1). The gene coding for the four-helix PsbS protein, which plays a crucial role in thermal dissipation in higher plants under excess light (Li et al., 2000), is completely missing in T. pseudonana (Armbrust et al 2004). However, five LI818-like genes are found and named as Lhcx1, Lhcx2, Lhcx4, Lhcx5 and Lhcx6. LI818 genes were originally discovered in green algae (Gagne and Guertin, 1992; Savard et al., 1996) and are highly transcriptionally induced in response to several stresses (Zhang et al., 2004; Moseley et al., 2006; Naumann et al., 2007). LI818-like homologs are widely distributed among a diverse group of photosynthetic organisms. Remarkably, LI818 (-like) protein is the only member of the LHC superfamily shared between the green lineage (containing chl a/b) and the red lineage (containing chl a/c), to which diatoms belong. Could one or more of the five diatom Lhcx proteins be taking the place of PsbS in photoprotection? In the present study, I first verified the correctness of gene prediction for Lhcx and Lhcf genes and determined intron positions by RT-PCR. I then investigated the organization of these light-harvesting genes in the genome of T. pseudonana. In parallel, after the identification of LI818-like proteins (Lhcx1/2) by a specific antibody, I examined their mode of association with the thylakoid membranes using different dissociating agents. Finally, I determined the diurnal expression pattern of Lhcx genes relative to that of the standard light-harvesting genes (Lhcfs).  42 3.2 Materials and methods 3.2.1 Culture conditions An axenic culture of T. pseudonana (CCMP1335) was grown at 18°C in sterile ESAW medium at 40 μmol photons m-2s-1 (for the diurnal expression experiment) or at 80 μmol photons m-2s-1 (for the other experiments described in this chapter) under 12h L/12h D cycle with gentle agitation. Cells in late exponential growth phase were harvested for all the experiments described in this chapter. 3.2.2 Gene cloning, sequencing and expression Purified total RNA (500 ng –1 μg) was reverse transcribed into cDNAs using Superscript II (Invitrogen, Carlsbad, CA, USA). Specific primers were used to amplify the partial Lhcx and Lhcf cDNA fragments. The fragments were inserted into the pCR 2.1-TOPO cloning vector (TOPO TA cloning kit, Invitrogen Corp., Carlsbad, CA, USA) and sequenced. The 5’ and 3’ ends of the Lhcx and Lhcf cDNAs were obtained by using rapid amplification of cDNA ends (RACE) technique and amplified fragments were further sequenced as described above. The detailed RNA extraction and qRT-PCR procedures were described in the general methods (Chapter 2). 3.2.3 Isolation of thylakoid membranes The cells were harvested by centrifugation at 10,000 g for 20 min (Sorvall, GSA rotor). All steps were carried out at 4 °C. The cell pellets were resuspended in isolation buffer [626 mM sorbitol, 6 mM Na2-EDTA, 5 mM MgCl2, 10 mM KCl, 1 mM MnCl2, 50 mM Hepes-KOH pH 8.0, 1% (w/v) BSA, 5 mM aminocaproic acid and 1 mM benzamidine- HCl ] in a volume of 25 mL per 4 L algal culture. To break the cells, the suspension was mixed with an equal volume of 0.2~0.3 mm glass beads and votexed vigorously using a BeadBeater (BioSpec Products, Inc. USA) for 4 min. Cell debris, glass beads and unbroken cells were removed by a slow spin (1000g for 10 min, SS-34 rotor), and membranes were pelleted by 1 h of centrifugation at 40,000 g. The crude thylakoid membrane fraction was then resuspended in washing buffer (isolation buffer containing  43 663 mM sorbitol and without BSA), sedimented at 40,000 g for 30 min, resuspended in washing buffer and frozen at –80 °C until use. 3.2.4 Extraction of thylakoid membrane proteins Thawed thylakoid membranes were washed once with washing buffer and then with 20 mM Tricine-NaOH pH 8.0, containing protease inhibitors (5 mM ε-aminocaproic acid and 1 mM benzamidine-HCl). The membranes were resuspended in one of the following media: 20 mM Tricine-NaOH pH 8.0; 20 mM Tricine-NaOH pH 8.0 containing either 1 M NaCl, 2 M NaBr or 2 M NaSCN; 50 mM CAPS pH 11.0. After 4 min vortexing and 40 min incubation at room temperature with continuous agitation using a Labquake® tube shaker, the suspensions were centrifuged at 146, 000×g for 2h at 4 °C. Then the pellets were resuspended in the loading buffer lacking SDS and bromophenol blue. The supernatants were dialyzed overnight using 20 mM Tricine-NaOH pH 8.0 in the presence of protease inhibitors to remove the salts and concentrated with an Amicon filtrating device with a cutoff of 10 kDa. In a separate experiment, twice washed thylakoid membranes were resuspended in 20 mM Tricine-NaOH pH 8.0 and given two repeated freeze/thaw cycles. For this, membranes were frozen at –80 °C and thawed at room temperature (RT). The control treatment of freeze/thaw cycles was that membranes were resuspended in the same buffer (20 mM Tricine-NaOH pH 8.0) and put on ice all the time during the experiment. After the freeze/thaw incubation, the suspensions were separated into pellet and supernatant as described above. The supernatant was concentrated without dialysis because there were no salts added for this experiment. 3.2.5 SDS-PAGE and western immunoblotting Four different primary antibodies were used in this chapter. Cc-FCP6 antibody (1:15,000 dilution) was kindly provided by Dr. E. Rhiel (Carl von Ossietzky University of Oldenburg, Germany). Ha-FCP antibody (1:5,000 dilution) was raised against a purified fucoxanthin-chlorophyll protein from Heterosigma akashiwo in our lab; this antibody is able to recognize a large number of FCP proteins in this species (Harnett, 1998). D1 (1:20,000 dilution) and PsbO (1:5,000 dilution) antibodies were purchased from Agrisera (Sweden). The rest of the procedures were given in general methods (Chapter 2).  44 3.3 Results 3.3.1 Gene analysis With the completion of the first diatom genome sequence (T. pseudonana), this resource provided an excellent opportunity for us to explore the genes of interest in this species. Genomic sequences of the five Lhcx genes and six of the standard Lhcf genes annotated by Dr.B.R.Green and myself were extracted from the T. pseudonana genome database (http://genome.jgi-psf.org/Thaps3/Thaps3.home.html) and used for further analysis. When I started my project in 2004, only the first draft of the genome was available. I therefore used RT-PCR to verify the correctness of gene prediction and determine intron positions. All Lhcx genes and six Lhcf genes were cloned and sequenced (Table 3.1 and Table 3.2). The full transcripts of three Lhcx and three Lhcf genes were successfully obtained by using 5’RACE and 3’RACE. Based on my results, the Lhcx4 gene did not contain any introns in its open reading frame (ORF), in contrast to the predicted gene model having one intron. In addition, Lhcf8 only had one intron in its ORF, different from the predicted gene model having two introns. The other gene models were basically in agreement with my data. The Lhcx transcripts had slightly longer (627-765 bp) open reading frames compared to 597-630 bp for the Lhcf transcripts. This agrees with protein molecular masses of about 22 and 18-19 kDa respectively, determined by western immunoblotting (see below). The completed genomes of the centric diatom T. pseudonana and the pennate diatom P. tricornutum contain fewer than 2 introns per gene on average (Armbrust et al., 2004; Bowler et al., 2008), which was also reflected in the light harvesting genes (LHCs). None of the Lhcx genes contained introns except Lhcx5 in T. pseudonana (Table 3.1). Moreover, it is noteworthy that two thirds of the Lhcf genes studied here contained 1~2 intron(s) in T. pseudonana (Table 3.2). In contrast, all four Lhcx genes contained 1 to 3 introns in the pennate diatom P. tricornutum. However, the intron was rarely found in Lhcf genes of P. tricornutum. Interestingly, my results showed that three Lhcf genes (Lhcf1, Lhcf2 and Lhcf8) in T. pseudonana all contained an intron of 170-230 bp in the coding region between AT and G corresponding to the plastid-targeting presequence, suggesting that these introns may play a role in regulation of gene expression. The  45 alignments of the genomic and cDNA sequences of these genes showed that the intron junctions were the consensus dinucleotides /GT for the 5’ splice site and AG/ for the 3’ splice site. All Lhcx and Lhcf genes have TAA as the stop codon (Armbrust et al., 2004).      Table 3.1 Summary of the basic features of five LI818-like genes (Lhcxs) n.d: not determined;  -: no introns;  i: incomplete     Table 3.2 Summary of the basic features of six standard light harvesting genes (Lhcfs) n.d: not determined;  -: no introns;  i: incomplete   Lhcx1 Lhcx2 Lhcx4 Lhcx5 Lhcx6 5’-noncoding sequence (bp) 49 49 136 70 n.d Protein coding sequence (bp)  627 627 690 708 765 3’-noncoding sequence (bp) 88 n.d. 44 224 69 Poly(A) tail (bp) 15 n.d. 17 18 20 Number of introns - - - 3 - Location in genome Chr_23 Chr_23 Chr_5 Chr_1 Chr_23  Lhcf1 Lhcf2 Lhcf3 Lhcf4 Lhcf5 Lhcf8 5’-noncoding sequence (bp) n.d. 38 n.d. 37 41 n.d. Protein coding sequence (bp)  597 597 588i 612 600 630 3’-noncoding sequence (bp) n.d. 216 n.d. 300 99 114 Poly(A) tail (bp) n.d. 21 n.d. 21 15 16 Number of introns 1 2 2 - - 1 Location in genome Chr_22 Chr_20 Chr_22 Chr_22 Chr_20 Chr_5  46 3.3.2 Gene organization and arrangement Three Lhcx genes (Lhcx1, Lhcx6 and Lhcx2) are closely clustered on chromosome 23, separated by 379 bp and 895 bp of intergenic regions, respectively (Figure 3.1). Similarly, three Lhcf genes (Lhcf6, Lhcf12 and Lhcf7) are adjacent and located on chromosome 3, separated by short intergenic regions ranging from 337 to 663 bp (Figure 3.1). Lhcx1 and Lhcx2, which are transcribed divergently, share 99% identity at the nucleotide level and 100% similarity at the deduced protein level. Interestingly, Lhcx6 was found in between these two almost identical genes (Figure 3.1), suggesting that the gene insertion (Lhcx6) happened after tandem gene duplication. The Lhcf3 and Lhcf4 gene pair on chromosome 22 is separated by a short non-coding intergenic region (372 bp) but arranged with the 5’ ends proximal (Figure 3.1). They are 83% identical at the DNA sequence level and 88% similar at the amino acid level, suggesting that Lhcf3/4 gene pair was the result of relatively recent gene duplication as supported by the phylogenetic analysis (Figure 1.1). Although they are all located on the same chromosome, the Lhcf1 gene is 468 kb away from the Lhcf3/4 gene pair (Figure 3.1). Like the Lhcf3/4 gene pair, the Lhcf6 and Lhcf12 gene pair on chromosome 3 is also separated by a short non-coding spacer (337 bp) and transcribed in opposite directions with the 5’ ends proximal (Figure 3.1). However, these two genes only have 58% identity at the nucleotide level and 48% similarity at the amino acid level. In contrast, the Lhcf12 gene shares higher similarity with another close neighbor gene, Lhcf7, than with Lhcf6 gene. Lhcf12 and Lhcf7 have 76% identity at the DNA sequence level and 81% similarity at the amino acid level. Different from the two gene pairs (Lhcf3/4 and Lhcf6/12), Lhcf5 and Lhcf2 genes located on chromosome 20 are transcribed convergently because the 3’ ends are proximal (Figure 3.1). Although they are separated by a long intergenic sequence (10.5 kb), they still share 84% identity at the nucleotide level and 88% similarity at the deduced protein level,  47 Chromosome 23 Chromosome 3 1000 bp 895 bp 663 bp Lhcf6 Lhcf7 10.5 kb Chromosome 20Lhcf5 Lhcf2 Lhcx1 Chromosome 22 468 kb 372 bp Lhcf4Lhcf3 Lhcf1 Lhcx6 Lhcx2 379 bp Lhcf12 337 bp suggesting that these two genes also resulted from a much earlier gene duplication followed by translocation. Although Lhcx4 and Lhcf8 are located on chromosome 5, these two genes are far apart and separated by a 913 kb intervening sequence (data not shown). Taken together, gene duplication and gene rearrangement were involved in the organization of the Lhcx and Lhcf genes in the centric diatom T. pseudonana.           Figure 3.1 Organization of several Lhcx and Lhcf genes on the chromosomes in the genome of T. pseudonana. Open arrows indicate positions and directions of transcription. Scale bar: 1000bp. Solid lines with // indicate a long distance between genes.  48 3.3.3 Comparison of the 5’UTR and 3’UTR of the Lhcx and Lhcf genes Transcription initiation sites identified by 5’-RACE were 37 to 70 bases upstream of the ATG translation start site, except for that of Lhcx4 which was located 136 bp upstream (Table 3.1 and 3.2). A small conserved motif CA(T/C)A was found at the transcription start site (the sequence from –2 to +2, relative to the underlined transcription start site) in six genes (Figure 3.2). The transcription start site was tentatively assigned for the Lhcx6 gene based on searching for this conserved motif sequence. Similar to my results, the same conserved motif CA(T/C)A was also found at the transcript start site of six fcp genes in P. tricornutum (Bhaya and Grossman, 1993). In all five Lhcf genes examined, another motif consisting of four nucleotides CAA(A/C) upstream of the translation start site (ATG) was conserved but of the Lhcx genes this was true only for Lhcx5. In addition, the CACA motif upstream of the translation start site was also found in two Lhcx genes. However, all these genes follow the “Kozak rules” with an A at the –3 position (relative to ATG) (Kozak, 1986, 1987). For Lhcx genes, transcription termination sites identified by 3’-RACE were 41 to 85 bases downstream of the TAA translation stop site except for that of Lhcx5 which was 221 bp downstream (Table 3.1). However, Lhcf genes showed slightly longer 3’UTR sequences ranging from 96 to 292 bp downstream of the stop codon (Table 3.2). None of them had very high similarity in the 3’ UTR region (from 14 to 51%). All transcripts appeared to have a 15-21 nt long poly(A) tail, although the typical polyadenylation signal (AATAAA) was only found in Lhcf4, 18 bp upstream of the transcription termination site. The nucleotide sequences (200-300 bases) upstream of the transcription start sites of four Lhcx and three Lhcf genes were further searched for the presence of any eukaryotic promoter elements. Putative CAAT boxes were found in almost all of the genes, but TATA boxes were detected in only two (Figure 3.3). In general, there was little similarity among the 5’upstream regions except between Lhcx1 and Lhcx2, which share 98% identity.  49 -3 -1 Lhcf1 ……CACTTCATCGAGCTCACAAATCAAACTTCTGATCAATCAACCCAACTACTTCAAA ATG Lhcf2 CATAATTTGCTCTGCACATCATCAACAAACAATCATCAAA ATG Lhcf4 CACTTTTCATTCTCTCGTGTCAATCAGCAAACTTTCAAC ATG Lhcf5 CATAAAATCACTTCTGTGCTCTTCATCACTCCATTCTTTCAAC ATG Lhcf8 ……..AAGGACGTGTTTTGTTCGCCTTAGGATGTGCTCACAATTCAATTGAACAATCAGCAAA ATG Lhcx1 CATAAATTCATTTCGCTGCACACCGCAACAAACACCCAAACACTCTTCACA ATG Lhcx2 CATAAAATCATTTCGCTGCACACCGCAACAAACACCCAAACACTCTTCACA ATG Lhcx4 CACAATGATGAGAGTGACGATGACGGCGACACTGACTCACTCATCAAACCGAGTCAGTCAGTGCATCGCC AGCTTAGCAACGCCGCAGCACACATTCCTCTCACAATCCCAACATCGTCCACATCAATCAACCAAATC ATG Lhcx5 TACATCACATCATGCAACTCTCCGTCCAAACATTCTCCTCATAAATTCGATTCACGTCCAACTCATCACAAC ATG Lhcx6 ……..CATAAACCAGCACAGCACGATATTTATACAACCCAGCACAACACACACTTCAATC ATG            Figure 3.2 Comparison of the 5’ untranslated sequences among five Lhcx and five Lhcf genes. The four conserved bases from –1 to –4 directly upstream of the ATG start codon are shown underlined. Transcription start sites are highlighted and underlined, and the conserved sequences flanking the transcription start site [CAT/CA] are highlighted in blue.  50 Figure 3.3 Presence of putative promoters in sequences 200-300 bp upstream of the transcription start sites of five Lhcx and three Lhcf genes. Putative CAAT boxes and TATA boxes are highlighted in red and green, respectively. Transcription start sites are highlighted and underlined. The small conserved four- nucleotide motifs upstream of the ATG start codon are shown doubly underlined.  51  Lhcx1 GCCGGGTGCTGGGTGCTGGCGGTGTGATGATGTGTTGTGGCCGACACGCGACAGACATCGGCTCATTTTG TGACTCACTGCCCCCCACAACACGTATCTACAGGCCATGTACCAATTCCCACGCATCCACAAAGATCCAA CTCAGATTCTCATCTCTCACGGTGCACCACCCAACAACGCCGACAGCCGAACGCTTTCGTTCCTCTTCTCA TAAATTCATTTCGCTGCACACCGCAACAAACACCCAAACACTCTTCACA-ATG Lhcx2 GGTAGTCAGTGGAGGACGTGTTGTGCGGAGTGTGAAACGTGCGGTGTCTATGCGGTGTTCGAAATGACTA TGACTCACTGCCCCCCACAACACGTATCTACAGGCCATGTACCAATTCCCACGCATCTACAAAGATCCAA CTCAGATTCTCATCTCTCACGGTGCACCACCCAACAACGCCGACAGTCGAACGCTTTCGTTCCTCTTCTCA TAAAATCATTTCGCTGCACACCGCAACAAACACCCAAACACTCTTCACA-ATG Lhcx4 GAGCACCTCGCATACAAGGAGGCCAGTCGGGACGGTGTGAAGAAGAGAGGGTGCGGAGAACTGACGAG CTCTACTCTTTGCTTTGATCGCAGCACCTACACCATCATCGTCTTAGATCGGCTTGCGGCTCGCAGTTGTA AATGATGGTCGCGGCGCGTGGGCAAGCCCACAACAAGTCAGACGGCGAGGAGCCCACTTACAAGCACTC CCACTTCACACACAATGATGAGAGTGACGATGACGGCGACACTGACTCACTCATCAAACCGAGTCAGTC AGTGCATCGCCAGCTTAGCAACGCCACAGCACACACTCCTCTCACAATCCCAACATAGTCCACATCAATC ATCCAAATC-ATG Lhcx5 GATAGTCTCGGGAAGCAACTGAAAATCGCGGGAAATGTAGGTATCTTCGTTGGCCCGCCAAATCAAAGA AACAAGGGTTCAGAGTCCATTTTCATTTTGGCATATTTTTGTGCTTGAAAAATCCAAATAGCGATAATAAT CCCCGTTAATGTTGCACCAAAGGATATTTAGTTAACCCTAAAAAGGAGACGTGTTCCAACGTCACCAATC CTTCAGCCAGTGGATCCGAACGCTTTTCCAATGCCGGGTGTTCCTCGATACATCACATCATGCAACTCTC CGTCCAAACATTCTCCTCATAAATTCGATTCACGTCCAACTCATCACAAC-ATG Lhcx6 AGAATCTGAGTTGGATCTTTGTGGATGCGTGGGAATTGGTACATGGCCTGTAGATACGTGTTGTGGGGGG CAGTGAGTCACAAAATGAGCCGATGTCTGTCGCGTGTCGGCCACAACACATCATCACACCGCCAGCACCC AGCACCCGGCCAGCACATCACACAAAGATTGAGTCAACATCAATTGCATCGATAGAAGTCAACGTCGTC TCATAAACCAGCACAGCACGATATTTATACAACCCAGCACAACACACACTTCAATC-ATG Lhcf2 TCTCTTGACCCCCACATTGTTGGCTGTTTTCGGGAAATACATTTGATTAAATACGGCCTTTTTATGTTGAC GGCCGCAATACTACCCTATTAATTATCCGTAAAAAGGTCTCTTCATATTTGCTCTTTGGCTCCTCCAGACC CATTGGATCTTCTACTATTCTTCTAGTGTGTTACCCCTCACCAGTCCAAGATACCGCTGCAAGGAGCAAGG CGAACAAAACACAACACGGTGATCATAATTTGCTCTGCACATCATCAACAAACAATCATCAAA-ATG Lhcf4 AGAGGAACAAAAGTTGAGCCGCCGCGTTCCTAAACGACCAATTAAACCCACCAATTTCTCCTGCCTGCCA TTCAATAGTGACAAACTGCTTCCAAAAAGATATAGTCGGTACTTGAGGTCAAATACACCTTAAACCTGCT TCAACCAACCAAAATCGACTGAGGTGGTGTTATTGCTAGCAAAATATCAAGAGAACGAGACCAAATATA AATATCCCGATTACTGCGGTTGAAGATCTTGTGGCCAAAGATCCGGGGGGGGGGCGAACAATGCCGACC GTCCATCAAATGTAACATCTCACTTTTCATTCTCTCGTGTCAATCAGCAAACTTTCAAC-ATG Lhcf5 TGCGTCGCCATGAAGAGAGCTTGTTCAACACGAAAGCGGAGCAGAGCAAGTTCGATTGATGACAAGTGC AATTCCACTATGTCCCCGCCAACCACAATTGACGGGAACTCCCCGTATAAAAGAGTCCCAATTGACCAGA TGGGACTCTAGCCAAAGGGGAAGTTGAACTTTTGGCAACCTCCGATCCAACTTAGTTCGCTTTCGCCATCT CATAAAATCACTTCTGTGCTCTTCATCACTCCATTCTTTCAAC-ATG      52 3.3.4 Identification of LI818-like and Lhcf polypeptides The fcp6 gene characterized in the diatom Cyclotella cryptica is one of the LI818 homologs. The abundance of the fcp6 transcript and the level of its protein FCP6 were upregulated several fold under high light growth conditions compared to low light growth conditions (Oeltjen et al., 2002; Becker and Rhiel, 2006). The Cc-FCP6 antibody was raised against a synthetic peptide based on the C-terminus of Fcp6 in C. cryptica and generously given to us by Dr.E.Rhiel (Westermann and Rhiel, 2005). The Lhcx1/2 proteins were specifically recognized by the Cc-FCP6 antibody (Figure 3.4, Lane I), because they are identical at the C-terminus. Using a Ha-FCP antibody raised against a fucoxanthin-chlorophyll protein from Heterosigma akashiwo in our lab, which recognizes most of the FCP bands in this species (Durnford and Green, 1994; Harnett, 1998), I detected two major bands (18 and 19 kDa) in T. pseudonana thylakoids (Figure 3.4, Lane II). We cannot rule out the possibility that red algal-like Lhcr proteins in T. pseudonana could be detected by Ha-FCP due to its wide cross-reactivity as shown in H. akashiwo. However, the Lhcx1/2 proteins were not recognized by Ha-FCP antisera. In the majority of the Chl c containing algae the standard light harvesting genes (also called fcp) are the most highly expressed among members of the LHC family. Therefore, we assume that the two major bands detected by Ha-FCP in T. pseudonana are Lhcf proteins. These results also showed that the Lhcx1/2 proteins (about 22 kDa) were larger than the Lhcf proteins (18~19 kDa), in accordance with the length of their open reading frames (Table 3.1 and 3.2). Since Lhcx1 and Lhcx2 are 100% identical at the deduced protein levels, these two proteins could be recognized by the same antibody (Cc-FCP6). Therefore, Lhcx1 and Lhcx2 were combined and designated as Lhcx1 in the following thylakoid wash and subsequent western blotting experiments.  53            Figure 3.4 Characterization of Lhcx1/2 and Lhcf proteins from T. pseudonana thylakoid fraction assayed by immunoblotting. Cultures grown under 80 μmol photons m-2s-1 were used for this experiment. Lanes were loaded on an equal protein basis (3μg lane –1). (I): Lhcx1 protein was detected by Cc- FCP6 antibody. (II): Lhcf proteins were recognized by Ha-FCP antibody.  54 3.3.5 Thylakoid wash It was reported that the LI818 protein from C. reinhardtii could be released from the thylakoid membrane by various dissociating agents (Richard et al., 2000). So how does a LI818-like protein (e.g Lhcx1) bind to the thylakoid membrane in T. pseudonana? To investigate the mode of interaction of Lhcx1 polypeptide within the thylakoid membrane, four reagents (NaCl, NaBr, NaSCN and CAPS pH 11) were used to extract Lhcx1 polypeptide. In addition, two repeated freeze and thaw cycles were also applied to see whether this physical treatment would release Lhcx1 protein from the thylakoid membrane. For freeze/thaw treatment, thylakoid membranes were quickly frozen in liquid nitrogen and thawed at RT followed by centrifugation at 146,000×g for 2 h. The separated pellet and supernatant fractions were further analyzed by immunoblotting using different antibodies. Two freeze/thaw cycles caused the release of the Lhcx1 polypeptide (Figure 3.5a). However, a small amount of Lhcx1 was present in the supernatant of freeze/thaw control, which was kept on ice all the time. In contrast to Lhcx1, no Lhcfs were extracted from the membranes by this treatment (Figure 3.5a). D1, an intrinsic protein located in the PSII reaction center, was found exclusively in the membrane fractions. The PsbO polypeptide, a soluble protein located in the lumen, was more easily released from the membranes by repeated freeze/thaw cycles than by the control treatment, suggesting that two freeze and thaw cycles were able to break most of the intact thylakoids. In parallel, thylakoid membranes were vortexed for 4 min, followed by a 40 min incubation at room temperature with solutions containing different dissociating agents, then pelleted by centrifugation as described above. Almost no Lhcf proteins were released from the membrane fraction by these treatments (Figure 3.5b). In contrast to Lhcf proteins, approximately 50% of the Lhcx1 polypeptide was extracted and released at pH 11 (Figure 3.5 b), indicating that this protein was not firmly bound to the thylakoid membrane. No Lhcx1 polypeptide was released by the NaCl and NaBr treatment. It seems that NaCl and NaBr are able to stabilize the Lhcx1 on the thylakoid membranes. A small amount of Lhcx1 polypeptide was released by NaSCN. However, the released amount of this polypeptide was negligible in comparison with the control (Figure 3.5 b).  55         Figure 3.5 Western immunoblotting analysis of extracted polypeptides from the thylakoid membrane by dissociating treatments. Thylakoid membranes were subjected to two freeze/thaw cycles and separated into membrane (pellet, P) and supernatant (S) fractions (a). For this, membranes were frozen at -80°C and thawed at RT. In parallel, thylakoid membranes were also resuspended in buffer containing either 2M NaBr, 2M NaSCN, 0.05M CAPS pH 11.0, 1M NaCl or no additive (b). After vortexing for 4 min and incubation for 40 min at room temperature (RT), the suspensions were separated into membrane (P) and supernatant (S) fractions by centrifugation at 146,000 g for 2 h at 4 °C. Protein samples were then analyzed by western blotting. 3 μg of total proteins were loaded in each lane for panel (a) and (b). F/T: Freeze and thaw. Similar data were obtained from an independent set of experiments (data not shown).  56 Thus we conclude that NaSCN cannot efficiently extract Lhcx1. Similar to the freeze and thaw treatment, D1 was found exclusively in the membrane fractions after various dissociating treatments. The PsbO polypeptide was completely released from the membranes with NaBr, NaSCN and CAPS pH 11. However, it was only partially removed from the membranes with NaCl and control treatments, demonstrating the presence of intact thylakoids in these membrane fractions. It is noteworthy that more polypeptides were extracted from the thylakoid membranes in the control of different dissociating agents (Figure 3.5 b) than the freeze/thaw control (Figure 3.5 a). This could be due to more vigorous treatments used for the former control than the latter one. The control of chaotropic treatments and alkaline pH were treated by 4 min vortex mixing and followed by a continuous shaking for 40 min at RT, whereas the freeze/thaw control was simply left on ice during the experiment. In contrast to my results, the LI818 protein in C. reinhardtii was partially or substantially extracted from the thylakoid membrane when treated with the same dissociating agents, indicating that the way in which LI818(-like) polypeptides bind to the thylakoid membrane was different in the two species. Overall, my results revealed that Lhcx1 polypeptide was not as firmly bound to the membrane as Lhcf and D1 polypeptides in T. pseudonana. 3.3.6 Diurnal expression pattern of Lhcx and Lhcf genes LI818 genes were first discovered because their transcripts were fully expressed several hours earlier than other chlorophyll a/b binding protein genes (cab), after the beginning of illumination in Chlamydomonas eugametos and C. reinhardtii (Gagne and Guertin, 1992; Savard et al., 1996). To determine whether Lhcx genes have the similar expression pattern to the LI818 genes, cultures grown under LL (40 μmol photons m-2s-1) on a 12 h light: 12 h dark cycle were harvested at six different time points during the day. The abundance of Lhcx transcripts was analyzed by quantitative real time RT-PCR (qPCR) and compared with the abundance of several Lhcf transcripts (as control) at each time point. For each gene, the lowest expression was set to 1. Lhcx1 and Lhcx2 share 99% identity at the nucleotide level, so the transcripts of the two genes could not be distinguished and were combined in qRT-PCR experiments.  57 Remarkably, four genes (Lhcx1/2, Lhcx5 and Lhcx6) all peaked at D11 (1 h before the beginning of the light phase) (Figure 3.6). An hour after the start of the light phase, the transcript levels of these genes had dropped many-fold and remained at relatively low levels over the rest of the day. My results also showed that Lhcx1 and Lhcx5 transcripts reached a second small peak after 5 h of light. However, the mRNA level of Lhcx4 did not change significantly over the time course. In contrast to the expression of the LI818-like genes, our two standard light harvesting genes (Lhcf2 and Lhcf5) did not peak in the dark phase (D11). The transcript levels were quite low in the dark phase and at the beginning of the light phase, reached their maximum expression in the middle of the day and declined substantially by the end of the light period (Figure 3.6). This diurnal expression pattern of Lhcf genes was similar to the standard fcp genes of other diatoms (Leblanc et al., 1999; Oeltjen et al., 2002; Oeltjen et al., 2004) and the Chl a/b genes of higher plants (Kellmann et al., 1993; Piechulla, 1993). Overall, Lhcx and Lhcf genes showed different diurnal expression patterns over the time course, suggesting that more than one type of oscillating mechanism was involved in the regulation of these genes.  58  0 20 40 60 80 100 120 D11 L01 L02 L05 L08 L12 R el at iv e ge ne  e xp re ss io n Lhcx1 Lhcx4 Lhcx5 Lhcx6 Lhcf2 Lhcf5               Figure 3.6 Changes in the transcript levels of Lhcx and Lhcf genes during the day. Cells were grown at 40 μmol photons m-2s-1 under 12 h light: 12 h dark regime. Cells in late exponential growth phase were harvested at indicated time points (hours). For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. L: Light phase; D: Dark phase.     59 3.4 Discussion 3.4.1 An intron is located at the same position within the plastid targeting presequence My results reveal that three Lhcf genes (Lhcf1, Lhcf2 and Lhcf8) in T. pseudonana have one intron at the same position between AT and G within plastid-targeting presequence. Moreover, this is the case for two more Lhcf genes (Lhcf3 and Lhcf9) and one red algal like gene (Lhcr3) based on sequence analysis of all Lhc genes in the finished T. pseudonana genome (version 3). In contrast, such an intron is not found in any of Lhc genes including Lhcf, Lhcx and Lhcr in the genome of P. tricornutum, indicating their different characteristics. Similar to T. pseudonana, all the light harvesting genes characterized from different brown algae exhibit an intron located at the plastid targeting presequence, specifically at the junction between the signal sequence domain and the transit peptide domain (Caron et al., 1996; De Martino et al., 2000). In addition to the light harvesting genes, it has been described in red algae that some of the nuclear genes coding for GAPDH located in the chloroplast contain one or more introns in the transit peptide region (Liaud et al., 1993). The distinct location of these introns may indicate that they play a role in the regulation of gene expression. 3.4.2 Distinctive gene organization in the light harvesting gene superfamily The T. pseudonana genome contains 32 Lhc genes scattered on 12 different chromosomes. Within the Lhc gene superfamily, it is of interest to note that three closely spaced and divergently transcribed gene pairs (Lhcx1/6, Lhcf3/4, Lhcf6/12), each of which is located on the same chromosome and separated by short non-coding intergenic regions ranging from 337 to 379 bp, are found in T. pseudonana (Figure3.1). In addition, each of the three red algal-like gene pairs (Lhcr4/14, Lhcr6/7 and Lhcr11/12) arranged on the same chromosome is also adjacent and divergently transcribed with 5’ ends proximal. The intervening spacer regions between these Lhcr gene pairs vary from 291 to 307 bp (data not shown). Similarly, it has been shown in the cryptophyte alga Rhodomonas that four cac genes encoding Chl a/c light harvesting proteins occur in divergent pairs  60 comprising one cac1 and one cac2 gene separated by intergenic regions ranging from 463 to 1235 bp (Broughton et al., 2006). In addition, all six cpeA genes encoding the phycoerythin α subunit have been characterized and also found to be arranged in divergent pairs with 5’ ends proximal in Rhodomonas with 575 to 1203 bp non-coding spacer regions (Broughton et al., 2006). However, genes coding for peridinin Chl a binding light harvesting proteins have been described to occur in multiple adjacent copies in dinoflagellates (Hiller et al., 2001), which are arrayed tandemly rather than divergently. Moreover, adjacent divergently transcribed gene pairs have been reported in the plant and mammalian genomes, which are co-expressed or even regulated by a common bi-directional promoter (Adachi and Lieber, 2002; Trinklein et al., 2004; Williams and Bowles, 2004). Therefore, based on the distinctive gene organization presented in my study, it is possible that closely spaced divergently arranged Lhc gene pairs may be co-ordinatedly regulated or perhaps under the control of the same promoter within the short space region between each gene pair. 3.4.3 Several closely spaced gene pairs share high similarities All the closely spaced light harvesting gene pairs (cac and cpeA) characterized in Rhodomonas share less than 70% identities at both the nucleotide sequence level and the protein level (Broughton et al., 2006). However, in T. pseudonana one divergently arranged gene pair Lhcf3/4 shows quite high similarity at the DNA sequence level (83% identity) and the amino acid level (88% similarity) compared to the ones in Rhodomonas, suggesting that they are derived by a relatively recent gene duplication. Furthermore, two adjacent divergent gene pairs (Lhcr6/7 and Lhcr11/12) in T. pseudonana share higher similarity at the nucleotide sequence level (77-79% identities) and the deduced protein levels (80-84% similarities) than the gene pairs in Rhodomonas, respectively, also suggesting that they are the result of the recent gene duplication. Two other pairs, Lhcf1/2 and Lhcf8/9, share 96% and 100% identities at nucleotide and amino acid levels, respectively, but are located on different chromosomes, suggesting rearrangements that occurred after gene duplication. In addition, gene duplication followed by gene insertion and gene translocation has been also observed in the light harvesting genes in T. pseudonana (Figure 3.1). Similarly, in C. reinhardtii two LI818 genes (LhcSR2 and  61 LhcSR3), which are located on the same scaffold and separated by a 10 kb intergenic space region, share 97% and 100% identities in the DNA sequence level and in the deduced protein level, respectively, suggesting a gene duplication that was followed by a gene translocation. Taken together, the data indicate that both gene duplication and gene rearrangement are involved in the organization of the light harvesting genes in the diatom T. pseudonana and the green alga C. reinhardtii. 3.4.4 Different diurnal expression patterns between Lhcx and Lhcf genes Diurnal oscillation of steady state mRNA levels has been consistently shown for Lhc genes of higher plants and green algae (Kellmann et al., 1993; Piechulla, 1993; Hwang and Herrin, 1994; Savard et al., 1996; Piechulla, 1999). Generally, the transcript levels increase after the transition from darkness to light, reach a maximum around noon and decrease thereafter. In accordance with this, two standard light harvesting genes (Lhcf2 and Lhcf5) exhibit this typical diurnal expression pattern during the day in T. pseudonana. Similar accumulation pattern of several fcp (typical light harvesting gene) transcripts has been previously reported in the diatoms C. cryptica (Oeltjen et al., 2002; Oeltjen et al., 2004) and Thalassiosira weissflogii (Leblanc et al., 1999). In contrast, LI818 genes in green algae show a different oscillation pattern during the day, with their expression peaking 1-2 h after illumination in the light phase, several hours earlier than other Lhc genes (Savard et al., 1996). Moreover, it has been demonstrated in the centric diatom C. cryptica that fcp6, a LI818 homologous gene, reaches maximal expression immediately after the onset of the light period (Oeltjen et al., 2004), indicating a similar diurnal expression pattern as its counterpart in the green algae. However, transcript levels of the three Lhcx genes in T. pseudonana peaked 1 h before the light is turn on. This result is in contrast to the LI818 (-like) gene accumulation pattern in green algae and the centric diatom C. cryptica. This may be due to a 6 or 8-fold lower light intensity used for cell growth in my study, than the light intensity used in experiments with green algae and C. cryptica. Indeed, it has been shown that light controls the amplitude of the increase of LI818 transcript abundance at the onset of light phase in C. reinhardtii (Savard et al., 1996). Although no increase of the LI818-like transcript levels  62 was detected right after illumination under low light (40 μmol photons m-2s-1), a strong induction of transcription of LI818-like genes has been observed upon exposure to high light (700 μmol photons m-2s-1) (Chapter 4). Therefore, my data indicate that the oscillation and the increase in LI818-like gene transcription in T. pseudonana are light intensity dependent. 3.4.5 Lhcx1 polypeptide is not tightly embedded in the thylakoid membrane compared to the Lhcf proteins Chaotropic agents such as NaSCN and NaBr are thought to act mainly by disrupting the structure of water, thereby weakening hydrophobic interactions. They are known to disrupt protein/protein hydrophobic interactions and destabilize folded proteins (Breyton et al., 1994; Zhang and Cremer, 2006). Previous biochemical studies have shown that CAB polypeptides in green algae are integrated in the thylakoid membranes and are resistant to extraction by various chaotropic agents and extreme alkaline pH (Herrin et al., 1987; Breyton et al., 1994; Richard et al., 2000). My thylakoid wash experiments revealed that most of the standard light harvesting proteins (Lhcfs) in T. pseudonana remain in the thylakoid fraction after the extraction by chaotropic agents and alkaline pH (pH 11), indicating a very similar membrane integration behavior for Lhcf proteins and CAB proteins. In contrast to Lhcf proteins, Lhcx1 polypeptide is substantially released from the thylakoid at pH 11, demonstrating that it is less tightly bound to the membranes in T. pseudonana. This result was confirmed by freezing and thawing of thylakoid membranes in the absence of dissociating agents. Similar results have been reported for LI818 protein under high pH in C. reinhardtii (Richard et al., 2000). In addition, different amounts of LI818 protein in C. reinhardtii were released from the thylakoid membrane by all dissociating treatments including NaCl, NaBr and NaSCN (Richard et al., 2000). However, this trend was not observed in my study, suggesting that the mode of association of LI818 (-like) proteins within the thylakoid membranes in green algae and diatoms may not be identical. In higher plants, the thylakoid membranes are differentiated into grana and stroma regions. Numerous studies have shown that PSII is mainly localized in the appressed membranes of the grana, whereas PSI is localized  63 almost exclusively in the non-appressed membranes of stroma thylakoids (Anderson and Andersson, 1982; Staehelin et al., 1986; Simpson and von Wettstein, 1989). In contrast to the thylakoid organization seen in higher plants, in most green algae, thylakoids are tightly appressed and characteristically arranged in extended bands of two to six, although larger stacks are common. However, in diatoms, thylakoids are loosely appressed and organized in extended bands of three (Gibbs, 1970), and PSII and PSI are not segregated into different domains (Pyszniak and Gibbs, 1992). We suggest that the different thylakoid organizations between green algae and diatoms may affect the way that the LI818 (-like) proteins bind to the thylakoid membrane. High ionic strength (such as 1 M NaCl) or alkaline pH is believed to perturb electrostatic interactions. My results show that these treatments have a contrasting effect on the extraction of the Lhcx1 proteins. Whereas 1 M NaCl does not result in any extraction of Lhcx1 polypeptide, treatment with CAPS pH 11 is quite effective. This result may be due to the fact that the concentration of NaCl used in the present study was not high enough to effectively disrupt the electrostatic interactions. A higher concentration of ions (e.g. 2 M NaCl) has been used to extract Cytochrome b6f subunits in C. reinhardtii (Breyton et al., 1994). NaBr and NaSCN are known to disrupt hydrophobic interactions between proteins, but do not result in a significant release of Lhcx1 from the thylakoid membrane. Taken together, my results suggest that the electrostatic interaction participates in anchoring Lhcx1 polypeptide to the thylakoid membrane in T. pseudonana. However, in C. reinhardtii, both hydrophobic and electrostatic interactions are involved in anchoring LI818 polypeptide to the thylakoid membrane (Richard et al., 2000). The different mode of association of LI818 (-like) proteins within the thylakoid membrane could be due to the different thylakoid organizations between green algae and diatoms.  64 Chapter 4 Effects of high light stress on the expression of LI818-like genes and one LI818-like protein in the marine diatom Thalassiosira pseudonana  65 4.1 Introduction LI818 genes were originally discovered in the green algae Chlamydomonas eugametos and Chlamydomonas reinhardtii (Gagne and Guertin, 1992; Savard et al., 1996), but their homologs are absent in higher plants. LI818 transcripts peak several hours before the standard chlorophyll a/b binding light harvesting gene (cab) transcripts upon illumination in C. reinhardtii (Savard et al., 1996). With the completion of the C. reinhardtii genome sequence (Merchant et al., 2007) and the availability of EST databases (Asamiziu et al., 2000; Shrager et al., 2003), three LI818 genes have been found and annotated as LhcSR. A number of studies have revealed that LhcSR genes are highly upregulated under high light stress (Im et al., 2003; Yamano et al., 2008), sulfur starvation (Zhang et al., 2004), phosphorus deprivation (Moseley et al., 2006) and iron deficiency (Naumann et al., 2007). Taken together, the evidence shows that LhcSR genes in C. reinhardtii are stress response genes. At the protein level, LhcSR3 has been reported to be induced under light stress and iron deficiency (Naumann et al., 2007). Although the function of LhcSR proteins is not clear, it has been suggested that they might play a role in photoprotection (Richard et al., 2000; Naumann et al., 2007). Three genes (fcp6, fcp7 and fcp12) in the diatom Cyclotella cryptica share high similarity with the genes encoding LI818 proteins of green algae (Eppard and Rhiel, 1998; Eppard et al., 2000). While the transcript levels of typical fucoxanthin chlorophyll a/c light harvesting genes, fcp1, fcp2, fcp3 and fcp5, are increased under low light (LL) growth condition, the abundances of fcp6, fcp7 and fcp12 transcripts are upregulated under high light (HL) growth condition (Oeltjen et al., 2002). In accordance with their transcription profiles, immunoblotting results have demonstrated that the level of Fcp2 is higher under LL than under HL growth condition, whereas the abundance of the LI818-like protein Fcp6 is upregulated under HL compared to LL growth condition. This has been further confirmed by immunogold-labelling electron microscopy (Becker and Rhiel, 2006). Overall, the expression of three LI818-like genes and one of the corresponding proteins in C. cryptica is highly induced by high light growth condition in contrast to the standard fcp genes and proteins. The elevated expression of LI818-like transcripts and proteins  66 under steady state high light in C. cryptica has led to the suggestion that LI818-like proteins may play a role in photoprotection. With the completion of the first genome sequence of a centric diatom Thalassiosira pseudonana (Armbrust et al., 2004), five LI818 homologous genes have been found through phylogenetic analysis and designated as Lhcx1, Lhcx2, Lhcx4, Lhcx5 and Lhcx6. Moreover, after the second diatom genome sequence was finished (Bowler et al., 2008), four LI818 homologs were found in the pennate diatom P. tricornutum. So far, LI818-like genes are present in both centric diatoms (including C. cryptica and T. pseudonana) and the pennate diatom P. tricornutum. Although the expression of LI818-like genes has been investigated in C. cryptica grown under steady state high light condition (Oeltjen et al., 2002; Becker and Rhiel, 2006), coastal diatoms such as T. pseudonana, originating from a bay, may experience large fluctuations in light intensity and different times of exposure to high light from minutes to hours. In the present work, my goal was to examine kinetic changes of LI818-like mRNAs and proteins in response to various light intensities and different durations of light stress after the shift of low light grown cells to higher irradiance in T. pseudonana. I first used quantitative real-time RT-PCR to monitor the expression pattern of LI818-like transcripts at three different light intensities: low light (LL), medium light (ML) and high light (HL). Then I investigated the expression profiles of LI818-like genes over different time courses including short term HL (within 1 h) and long term HL (up to 6 h). In parallel, the changes in the abundance of one LI818-like protein recognized by a specific antibody were also determined in response to HL stress up to 10 h by immunoblotting. 4.2 Materials and methods 4.2.1 Culture conditions An axenic culture of T. pseudonana (CCMP1335) was grown at 18°C in sterile ESAW medium at 40 μmol photons m-2s-1 under 12 h L/ 12 h D cycle with gentle agitation. Cells were harvested in the early exponential growth phase unless otherwise noted. For the HL shift experiments, a culture grown under LL at 40 μmol photons m-2s-1 was divided into  67 two parts. One part was transferred to 700 μmol photons m-2s-1 (HL) at L0 (at the beginning of the light phase), and the other part was kept under LL. 4.2.2 RNA extraction and qRT-PCR Purified total RNA (500 ng –1 μg) was reverse transcribed into cDNA using Superscript II (Invitrogen, Carlsbad, CA, USA). An iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) was used for qRT-PCR. The PCR amplification profile was 95° C for 3 min followed by 40 cycles of 95° C for 15 s, 60° C for 30s, and 72° C for 30 s. The detailed RNA extraction and qRT-PCR procedures were described in the general methods (Chapter 2). 4.2.3 Protein extraction and analysis See general methods for details (Chapter 2). 4.2.4 SDS-PAGE and immunoblotting Three different antibodies were used in this chapter. The Cc-FCP6 antibody (1:15,000 dilution) was kindly provided by Dr. E. Rhiel (Carl von Ossietzky University of Oldenburg, Germany); the Ha-FCP antibody (1:5,000 dilution) was raised against a fucoxanthin-chlorophyll protein from Heterosigma akashiwo in our lab; D1 (1:20,000 dilution) was purchased from Agrisera AB (Vännäs, Sweden). The rest of the procedures were detailed in the general methods (Chapter 2). 4.3 Results 4.3.1 Effects of different light irradiances on the expression of LI818- like genes (Lhcx) LI818 (-like) genes were shown to be upregulated by high light in C. reinhardtii (Im et al., 2003; Yamano et al., 2008) and C. cryptica (Oeltjen et al., 2002). To test whether the five LI818-like genes in T. pseudonana have a similar regulation pattern, two different light intensities referred to as “medium light” (350 μmol photons m-2s-1) and “high light” (700 μmol photons m-2s-1) were chosen to examine the response of these genes after transition of low light grown cultures (40 μmol photons m-2s-1) to higher irradiance. The  68 transcript levels were determined by quantitative real time RT-PCR (qRT-RCR). For each gene, the lowest expression was set to 1. Due to the high identity (99%) of Lhcx1 and Lhcx2 genes, the transcripts of these two genes could not be distinguished and were combined in qRT-PCR experiments and called Lhcx1. Lhcx1 is not significantly induced by medium light but is strongly induced by high light (HL) (Figure 4.1A). The accumulation of Lhcx4 and Lhcx6 was observed in both medium light and high light (Figure 4.1A). Moreover, the increased amplitudes in their transcript levels were more pronounced under HL than medium light. In contrast, Lhcx5 was not affected by either light treatment (Figure 4.1A). Although more Lhcf2 transcript (a standard light harvesting gene) increased under medium light (Figure 4.1B), Lhcf2 expression was strongly inhibited under HL in contrast to most of the LI818-like genes under the same conditions. Medium light (350 μmol photons m-2s-1) appears to be suitable for cell growth because more Lhcf2 are accumulated for light harvesting. By contrast, HL (700 μmol photons m-2s-1), which causes the strong induction of most LI818-like genes and down-regulation of Lhcf2 genes, reveals its role in stress treatment. Therefore, HL was chosen and used for the stress treatment in all the subsequent experiments. 4.3.2 Effects of prolonged high light stress on the expression of LI818-like genes (Lhcx) In my first experiments, late exponential phase cells were harvested for qRT-PCR in order to have enough material (Figure 4.1). To avoid self-shading in the dense culture and possible nutrient deprivation, the experiments were repeated using early exponential phase cells and only HL treatment (700 μmol photons m-2s-1) was used to see its effect on the expression of LI818-like genes relative to that of Lhcf genes. Figure 4.2A shows that after 1 h of exposure to HL, Lhcx1 was upregulated 3-fold compared to low light (LL, 40 μmol photons m-2s-1), Lhcx4 increased around 12-fold, and Lhcx6 increased 10-fold, indicating that they are all high light inducible genes but vary in the increased amplitudes of their transcripts upon HL shift. In contrast, the expression of the Lhcx5 did not change significantly. With longer exposure to HL, there were similar  69  0 5 10 15 20 25 30 35 40 45 50 40 1H 40 3H 40 6H 350 1H 350 3H 350 6H 700 1H 700 3H 700 6H Re la tiv e  ge ne  e xp re ss io ns Lhcx1 Lhcx4 Lhcx5 Lhcx6 0 20 40 60 80 100 120 140 160 40 1H 40 3H 40 6H 350 1H 350 3H 350 6H 700 1H 700 3H 700 6H R el at iv e  ge n e  ex p re ss io ns Lhcf2 A B                  Figure 4.1 Changes in mRNA levels of Lhcx (A) and Lhcf2 (B) genes in response to shift from LL (40 μmol m-2s-1) to ML (350 μmol m-2s-1) and HL (700 μmol m-2s-1) using cells in late exponential phase. Samples were taken for total RNA extraction after 1, 3 and 6 h. Levels of mRNA examined by quantitative RT-PCR were normalized with respect to that of the actin transcript. Similar results were obtained from another independent experiment (biological replicates). For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. LL: low light; ML: medium light; HL: high light.  70 trends observed in the transcript levels of Lhcx1, Lhcx4 and Lhcx6. They all reached their peaks after 1h, then dropped significantly after 3h, and were almost back to the LL levels after 6 h of HL. This trend is in agreement with my previous results when cells harvested in late exponential phase were treated by HL for 6 h (Figure 4.1A). However, the transcript levels of standard light harvesting genes (Lhcf2/Lhcf4/Lhcf5) increased over the time course and peaked at the middle of the day in both LL and HL cultures (Figure 4.2B), similar to the standard fcp genes (Oeltjen et al., 2002; Oeltjen et al., 2004) and the Chl a/b genes of green plants (Kellmann et al., 1993; Hwang and Herrin, 1994; Savard et al., 1996). In contrast to the Lhcx genes, their expression was markedly depressed under HL stress, suggesting that the amount of antenna was being decreased to protect the reaction centers from photodamage under excess light. It is important to note that the induction of LI818-like genes upon exposure to HL is more pronounced in early exponential phase cells than in late exponential phase cultures. Therefore, early exponential phase cells were used for the subsequent experiments. 4.3.3 Effects of short-term high light stress on the expression of Lhcx genes Because four of the five LI818-like genes reached a maximum after 1 h of light stress (Figure 4.2), I further investigated their expression in response to short term HL (within 1 h). The changes in the transcript levels of the LI818-like genes and Lhcf2 within 60 min after transfer to HL are shown in Figure 4.3. The transcript levels of Lhcx1, Lhcx4, Lhcx6 were low at 0 min, but increased rapidly upon HL transfer and reached their peaks at 15 min. They then dropped substantially at 30 min and almost returned to the starting level at 60 min of HL stress except for the Lhcx4 transcript which remained higher (Figure 4.3A). This experiment demonstrated that Lhcx1, Lhcx4 and Lhcx6 were quickly induced by HL, probably suggesting that their fast response is associated with the photoprotection during HL stress. The abundance of Lhcx1, Lhcx4 and Lhcx6 transcripts appeared low after 1h of HL in comparison with their maximum expressions at 15 min. However, relative to their transcript levels after 1h of LL (data not shown), the increase of these LI818-like transcripts after exposure to 1h of  71 HL is comparable to my previous results (Figure 4.2). It should be noted that there are different y-axis relative gene expression scales in Figure 4.2 and Figure 4.3. In contrast, Lhcx5 was not affected by short term HL stress (Figure 4.3A), in accordance with the results observed during long term HL. However, the mRNA level of Lhcf2 dropped 50% within 5 min, reached a minimum at 15 min, and remained very low over the rest of the 45 min HL treatment (Figure 4.3B).  72 0 10 20 30 40 50 60 70 80 90 40 1H 40 3H 40 6H 700 1H 700 3H 700 6H R el at iv e ge ne  e xp re ss io n Lhcx1 Lhcx4 Lhcx5 Lhcx6 0 500 1000 1500 2000 2500 3000 3500 4000 4500 40 1H 40 3H 40 6H 700 1H 700 3H 700 6H Re la tiv e ge ne  e xp re ss io n Lhcf2 Lhcf4 Lhcf5 A B                   Figure 4.2 Changes in mRNA levels of Lhcx (A) and Lhcf (B) genes in response to shift from LL (40 μmol m-2s-1) to HL (700 μmol m-2s-1) using cells in early exponential phase. Samples were taken after 1, 3 and 6 h exposure to the indicated light intensities. Levels of mRNA examined by qRT-PCR were normalized with respect to that of the actin mRNA. Similar results were obtained from another independent experiment (biological replicates). For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples.  73  0 50 100 150 200 250 300 350 400 450 0 10 20 30 40 50 60 70 Time (Min) Re la tiv e ge ne  e xp re ss io n Lhcx1 Lhcx4 Lhcx5 Lhcx6 0 100 200 300 400 500 600 700 800 900 0 10 20 30 40 50 60 70 Time (Min) Re la tiv e ge ne  e xp re ss io n Lhcf2 A B                   Figure 4.3 Short-term changes in the abundance of Lhcx (A) and Lhcf2 (B) transcripts in response to shift from LL to HL using cells in early exponential phase. Cultures were exposed to HL for 0, 5, 15, 30 and 60 min. Similar results were obtained from another independent experiment (biological replicates). For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. Note the different scale of the y-axis relative gene expression compared to Figure 4.2.  74 4.3.4 Effects of high light stress on Lhcx1 protein expression In order to study the protein expression patterns during HL stress, cells cultured under LL were transferred to HL for 10 hours and sampled at various time points. After 6 h of HL, three aliquots of cell cultures were put back to the dark for recovery (LD4, LD7 and LD15). For SDS-PAGE, equal amount of total proteins were loaded in each lane (Figure 4.4). Cc-FCP6 antibody was raised against a synthetic peptide based on the C-terminus of FCP6 protein in C. cryptica. The Lhcx1 protein of 22 kDa was specifically recognized by Cc-FCP6 because Lhcx1 and FCP6 are identical at the C-terminus. Lhcx1 protein was present at the beginning of the light phase (L0), and increased under both LL and HL cultures after 1 h. However, it was more evident in HL cultures (Figure 4.4A). Under HL stress, the amount of Lhcx1 increased approximately 2.5-fold compared to L0 after 1h and remained high over the next 9 h of the light stress period (Figure 4.4B). The results indicated that more of this protein was accumulated under HL stress and that it remained very constant once it was induced by HL. Moreover, the level of Lhcx1 was still high even after the 6 h HL treated cultures were transferred back to the dark overnight for recovery. This result suggests that Lhcx1 protein may act to stabilize the thylakoid membrane or is involved in repair of photodamage. Using a Ha-FCP antibody raised against a fucoxanthin-chlorophyll protein from H. akashiwo, two major Lhcf bands of 18 and 19 kDa were detected in T. pseudonana (Chapter3). In contrast to Lhcx1, the level of Lhcf was only reduced by 3.18% on average under HL compared to LL (Figure 4.4C). Moreover, the amount of D1 protein was only reduced by 8.60% under HL relative to LL (Figure 4.4D). My results indicate that D1 protein was not significantly degraded under high light stress, suggesting that PSII reaction center may be protected from photooxidative damage through thermal dissipation of excess energy (Chapter 5). In addition, the D1 protein repair cycle may be involved in maintaining the functional PSII reaction center during long-term high light.  75 Figure 4.4 Changes in the levels of three different proteins after exposure to HL. (A) Changes in the amounts of Lhcx1, Lhcf and D1 proteins in response to shift from LL to HL assayed by immunoblotting using cells in early exponential phase.  LL-acclimated cultures (time 0) were shifted into HL for up to 10 h and three aliquots of 6 h HL treated cultures were transferred back to the dark (LD). The corresponding densitometric quantifications of Lhcx1 (B), Lhcf (C) and D1 (D) polypeptides are given in arbitrary units. Lanes were loaded on an equal protein basis (3 μg lane –1). Similar results were obtained from another independent experiment.  76  Lhcx1/2 proteins response to HL treatment 0 2000 4000 6000 8000 10000 12000 14000 16000 L0 L1 L2 L3 L6 L8 L10 LD4 LD7 LD15 Pr ot ei n ex pr es si on L0 LL HL Light transfer to dark Lhcf proteins response to HL treatment 0 10000 20000 30000 40000 50000 60000 70000 L0 L1 L2 L3 L6 L8 L10 LD4 LD7 LD15 Pr ot ei n ex pr es si on L0 LL HL Light transfer to dark D1 protein response to HL treatment 0 2000 4000 6000 8000 10000 12000 14000 L0 L1 L2 L3 L6 L8 L10 LD4 LD7 LD15 Pr ot ei n ex pr es si on L0 LL HL Light transfer to dark A D C B                         77 Taken together, these results also showed that the expression pattern of Lhcx1mRNA was quite different from the expression pattern of its protein (Lhcx1) during long term HL stress. Thus, the Lhcx1 gene is probably regulated at both transcriptional and translational levels. 4.3.5 Effects of different light irradiances and different exposures to high light on the expression of the putative “red” Elip-like gene Early light inducible proteins (ELIPs) are among the first proteins that accumulate transiently after the transfer of etiolated plants from darkness to light (Meyer and Kloppstech, 1984; Grimm and Kloppstech, 1987). In addition, ELIP transcripts and proteins are induced under high light, drought and cold stress conditions (Potter and Kloppstech, 1993; Adamska, 1997; Montane and Kloppstech, 2000). So far, ELIPs have been identified in many higher plants and green algae. Moreover, putative barley ELIP (HV60) homologs have been identified in the red alga Griffithsia japonica and in the cryptophyte Guillardia theta (Gould et al., 2006). These “red” Elip-like gene sequences have been directly deposited in the NCBI GenBank. However, the expression pattern of these ELIP transcripts remains unknown. Interestingly, based on the blast search, a “red” Elip-like gene has been found and annotated by Dr. Ansgar Gruber and Dr. Beverley Green in the T. pseudonana genome. Since the cDNA samples from T. pseudonana treated by different light intensities and different exposures to high light were available, I investigated the expression profiles of “red” Elip-like gene in comparison with the regulation of one standard light harvesting gene Lhcf2 (as control) using qRT-PCR. To examine whether the expression of “red” Elip-like gene is light intensity dependent, cultures acclimated to LL in late-logarithmic phase were transferred to medium light or to high light at the beginning of the light phase for 6 h (The same cDNA tested in Figure 4.1 was used here). The transcript levels of Elip-like gene increased at most time points under ML in comparison with the LL (Figure 4.5A). However, the abundance of Elip-like transcript decreased after 6 h of HL treatment in contrast to the LL control. The levels of Lhf2 mRNA were significantly upregulated under ML but down-regulated under HL at each time point compared to the LL (Figure 4.5B). Overall, Elip-like gene showed similar  78 0 2 4 6 8 10 40 1H 40 3H 40 6H 350 1H 350 3H 350 6H 700 1H 700 3H 700 6H R el at iv e ge ne  e xp re ss io n Elip 0 20 40 60 80 100 120 140 160 40 1H 40 3H 40 6H 350 1H 350 3H 350 6H 700 1H 700 3H 700 6H Re la tiv e ge ne  e xp re ss io n Lhcf2 A B R el at iv e ge ne  e xp re ss io n Re la tiv e ge ne  e xp re ss io n                 Figure 4.5 Changes in the transcript levels of Elip-like gene (A) and Lhcf2 gene (B) in response to shift from LL (40 μmol m-2s-1) to ML (350 μmol m-2s-1) or to HL (700 μmol m-2s-1) using cells in late exponential growth phase. Samples were taken after 1, 3 and 6 h exposure to the indicated light irradiances. Levels of mRNA examined by qRT-PCR were normalized with respect to that of the actin mRNA. Similar results were obtained from another independent experiment. For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. LL: low light; ML: medium light; HL: high light.  79 expression pattern as Lhcf2, a standard chlorophyll a/c light-harvesting gene, upon exposure to higher light irradiances. Therefore, I conclude that Elip-like gene in T. pseudonana is not induced, but rather inhibited by HL, which is different from the regulation of Elip gene in higher plants and green algae. To test whether the cell growth stage will affect the expression of the Elip-like gene, cultures were grown to early-logarithmic phase and were then exposed to HL for 6 h (The same cDNA tested in Figure 4.2 was used here). The abundance of Elip-like transcript was markedly depressed under HL in contrast to the LL control at each indicated time point (Figure 4.6A). The decrease of the Elip-like transcript in early exponential cells (Figure 4.6A) was more evident than in late exponential cells (Figure 4.5A) under HL treatment. The mRNA levels of Lhcf2 substantially decreased during HL (Figure 4.6B), consistent with my result in late exponential cells (Figure 4.5B). Generally, the amplitude of decline in both red Elip-like and Lhcf2 transcripts in early-exponential cells was greater than the one in late-exponential cells under HL treatment. In addition to the long-term (up to 6 h) HL treatment (Figure 4.6A and 4.6B), the changes of the transcript levels of Elip-like gene within 1 h HL were further investigated. Cultures acclimated to LL in early-logarithmic phase were transferred to high light for 1 h (The same cDNA tested in Figure 4.3 was used here). The mRNA levels of both Elip-like and Lhcf2 genes dropped immediately after 5 min, reached a minimum after 15 min and remained low until the end of time course during short-term HL exposure (Figure 4.7). My results showed that the abundance of red Elip-like transcript in T. pseudonana was decreased under high light stress and that the decline occurred within a few minutes upon HL exposure. Therefore, I conclude that red Elip-like gene in T. pseudonana is not an early light inducible gene but instead resembles standard light harvesting genes.  80                Figure 4.6 Effects of HL on the accumulation of Elip-like (A) and Lhcf2 (B) transcripts after transition from LL using cells in early exponential growth phase. Cultures were harvested after 1, 3 and 6 h exposure to the indicated light intensities. Similar results were obtained from another independent experiment. For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. LL: low light; HL: high light. 0 5 10 15 20 25 30 40 1H 40 3H 40 6H 700 1H 700 3H 700 6H Re la tiv e ge ne  e xp re ss io n Elip 0 500 1000 1500 2000 2500 3000 3500 4000 4500 40 1H 40 3H 40 6H 700 1H 700 3H 700 6H R el at iv e ge ne  e xp re ss io n Lhcf2 A B Re la tiv e ge ne  e xp re ss io n R el at iv e ge ne  e xp re ss io n R el at iv e ge ne  e xp re ss io n  81 0 100 200 300 400 500 600 700 800 900 0 10 20 30 40 50 60 70 Time (minutes) Re la tiv e ge ne  e xp re ss io n Lhcf2 Elip                 Figure 4.7 Short-term changes in the transcript levels of Elip-like gene and Lhcf 2 after transfer from LL to HL using cells in early exponential growth phase. Cultures were exposed to HL for 0, 5, 15, 30 and 60 min. Similar results were obtained from another independent experiment. For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples.  82 4.4 Discussion 4.4.1 Kinetic changes of LI818-like transcripts in T. pseudonana during high light acclimation Unlike in previous studies using HL-acclimated diatoms that were grown under high light conditions (Oeltjen et al., 2002; Becker and Rhiel, 2006; Beer et al., 2006), here I investigated the dynamic changes of LI818-like transcripts and one LI818 homologous protein during the process of high light acclimation after the transfer of LL-grown T. pseudonana cells to high irradiance. My results demonstrated that transcripts of four out of the five LI818-like genes transiently accumulated upon high light stress, providing new insights into how LI818-like genes were regulated in response to light stress in T. pseudonana. Complementary to my data, the increase of several LI818-like transcripts has been reported in the diatom C. cryptica after acclimation to HL for a long term (Oeltjen et al., 2002). In addition, the up-regulation of LI818-like genes in T. pseudonana has been recently reported after the cells were shifted to low temperature for several days (Mock et al., 2008). Under cold stress, the metabolism of cells becomes very slow and then the electron transport chain is more reduced, which results in an energy imbalance and leads to increased PSII excitation pressure (Huner et al., 1998). Thus, cold stress is basically equivalent to the high light stress and the increased transcript levels of LI818- like transcripts after exposure to high light in this study is consistent with the data derived from the microarray analysis under cold stress (See summarized data in Table 6.2). Recently, it has been reported that four LI818 homologous genes in the Antarctic diatom Chaetoceros neogracile are rapidly upregulated after exposure of cold-adapted cells (4 °C) to thermal stress (10 °C) (Hwang et al., 2008). My results, along with other findings, suggest that LI818-like genes in diatoms are stress inducible genes as their homologs in green algae.  83 4.4.2 Lhcx5 gene has a different function from the other Lhcx genes in the LI818-like gene family Phylogenetic analysis demonstrated that the Lhcx5 gene of T. pseudonana shares high sequence similarity with fcp12 gene of C. cryptica (Figure 1.1). The latter, together with the other two LI818-like genes in C. cryptica, were all transcriptionally upregulated under continuous high light (Oeltjen et al., 2002). Although most of the LI818-like genes were also strongly induced in T. pseudonana under high light stress, Lhcx5 was not affected, which was different from the expression pattern of its closest homolog, fcp12, in C. cryptica. This suggests that Lhcx5 gene has a different function than the other Lhcx genes in T. pseudonana during evolution. Alternatively, this gene may respond to other stress conditions that I have not tested here. 4.4.3 Expression of LI818-like genes upon high light in comparison with “green” and “red” Elip genes My results showed that four LI818-like genes were transiently expressed after exposure to high light stress, similar to the transient accumulation of Elip transcripts during greening of etiolated plants (Meyer and Kloppstech, 1984; Grimm and Kloppstech, 1987; Potter and Kloppstech, 1993) and during excess light exposure in green algae (Teramoto et al., 2004). However, the putative “red” Elip-like gene in T. pseudonana was not induced but rather inhibited by high light, showing a regulation pattern distinct from that of its homolog in green plants. In addition, based on sequence alignment (Figure 4.8), histidine (polar basic amino acid) in the second transmembrane helix of the putative red Elip-like proteins is conserved in diatoms, cryptophyte and red alga. In contrast, at the same position non-polar amino acid (valine or isoleucine) is found to be conserved in all the green Elips, indicating their different molecular structures between red lineage (Chl a/c) and green lineage (Chl a/b). It has been proposed that the primary function of Elips is involved in photoprotection rather than light harvesting (Montane and Kloppstech, 2000). Therefore, the high light stimulated expression of LI818-like genes observed in my study may suggest that they have a role in photoprotection like Elips. In contrast to the Elip genes, which were specifically induced by high light stress but absent under low light (Potter and Kloppstech, 1993; Heddad and Adamska, 2000), low levels of LI818-like  84 gene transcripts were present also under low light in my experiment, suggesting that LI818-like proteins may have a functional role under different light conditions. The possible role of Lhcx1 in excess energy dissipation under high light and iron/copper deficiency conditions in T. pseudonana will be discussed in more detail in Chapter 5 and Chapter 6, respectively.       ELIP:Tp        TITNERAIILIANVHALMVGL HV60:Gt        PITNERAIILVAHVHVLFVSI HV60:Gj        PISQQRAIVLVAHIHVLFVSI ELIP:Pt        TISNERAIILVANAHFFALSL ELIP:At        WFLGTTAILTLASLVPLFKGI ELIP:Br        WFLGTTAILTLASLVPLFKGI ELIP:Ps        WFLGTSVLLSLASLIPFFQGV ELIP:Ms        WFLGTSVLLSLASLIPFFQGV ELIP:Le        WFLGSSALLTLASLIPLFQGV ELIP:(HV60)Hv  WFAYTVAMLSMASLVPLLQGE ELIP:Zm        WFAYTAAVLSAASLVPLLQGE    Figure 4.8 Sequence alignment of predicted second transmembrane helix (TMH) of Elip and Elip-like proteins in both green lineage (Chl a/b) and red lineage (Chl a/c). In this region as highlighted in the black box, polar basic amino acid histidine (H) is conserved among all red Elip-like proteins, whereas at the same position non-polar amino acid such as valine (V) or isoleucine (I) is conserved in all green Elip proteins. HV60 is a low molecular mass early light-inducible protein and initially identified in Hordeum vulgare (barley). Tp: Thalassiosira pseudonana; Gt: Guillardia theta; Gj: Griffithsia japonica; Pt: Phaeodactylum tricornutum; At: Arabidopsis thaliana; Br: Brassica rapa; Ps: Pisum sativum; Ms: Medicago sativa; Hv: Hordeum vulgare; Le: Lycopersicon esculentum; Zm: Zea mays.   Transmembrane helix 2 Higher plants (Green lineage) Red lineage   85 4.4.4 Different regulation patterns of LI818-like genes and one LI818- like protein (Lhcx1) during high light stress It is of interest that the transient accumulation of LI818-like transcripts in T. pseudonana under high light stress was not accompanied by a similar expression pattern of the LI818- like proteins. My data demonstrated that Lhcx1 protein level doubled after 1 h in high light and remained at that level for at least 10 h, which is comparable to the expression profile of HliC (one of the high light inducible proteins, Hlips) in cyanobacteria after exposure to high light (He et al., 2001). The discrepancy between the abundance of Lhcx1 transcripts and its protein indicates that Lhcx1 was independently regulated at the level of transcript and protein accumulation. The high level of Lhcx1 protein during light stress could be due to faster rates of translation or higher stability. The independent regulation of two Elip genes has been reported from light stress-pretreated or senescent Arabidopsis in response to high light, where the enhanced transcripts are accompanied by the down- regulation of their proteins (Heddad et al., 2006). Overall, these findings suggest that multiple regulatory pathways are involved in controlling the expression of these high light induced genes and proteins. It is notable that the level of four LI818-like transcripts in T. pseudonana substantially decreased after 3 h and 6 h of high light treatment. Such a down-regulation can be interpreted in two ways. One possibility could be that the stability of Lhcx transcripts was lower and then more Lhcx mRNAs were degraded during prolonged HL stress. Alternatively, once the LI818-like proteins (e.g. Lhcx1) were accumulated in the thylakoid membrane during the initial exposure to high light (1 h after HL for Lhcx1), perhaps saturating their sites in the assembly of membrane and function, there may be diminished transcription from Lhcx genes during long term HL stress.  86  4.4.5 Dynamic changes of Lhcx1 protein in T. pseudonana in the process of high light acclimation My data revealed that Lhcx1 protein rapidly accumulated under HL and remained at elevated levels for at least 10 h under extended high light stress, demonstrating the kinetics of a LI818-like protein in the process of HL acclimation. The previous findings, which showed the up-regulation of a LI818 homologous protein (FCP6) in HL- acclimated diatoms C. cryptica (Becker and Rhiel, 2006) and Cyclotella meneghiniana (Beer et al., 2006), are complementary to my results. My findings, in conjunction with previous findings, suggest that these LI818-like proteins are high light inducible proteins. Interestingly, biochemical studies revealed that a trimeric complex including FCP6 and two other typical light harvesting proteins binds more xanthophyll pigments under high light, and has been further suggested to play a crucial role in photoprotection in C. meneghiniana (Beer et al., 2006; Gundermann and Buchel, 2008). Although LI818-like proteins were shown to be up-regulated after exposure to light stress (in my study) or grown under HL (Becker and Rhiel, 2006; Beer et al., 2006) in different diatoms, a higher increased amounts of these proteins were observed in HL-acclimated diatoms (C. cryptica and C. meneghiniana) than in T. pseudonana after transfer to HL. Such a difference may be due to a different sample loading basis for SDS-PAGE. In my study, equal amounts of total protein were loaded for low light grown cells and high light treated cultures, while other two groups used equal amount of total Chl for sample loading where the diatoms were grown under HL for a long term (Becker and Rhiel, 2006; Beer et al., 2006). My preliminary data (not shown) indicated that HL-grown diatoms possess lower total Chl content than LL-grown cells, probably due to the decreased levels of light harvesting proteins. Therefore, the protein levels could be overestimated when sample loading is based on equal amount of total Chl, especially when cultures were grown under high light conditions.  87 Chapter 5 Photoprotection after different exposures to high light stress in the marine diatom Thalassiosira pseudonana  88 5.1 Introduction Diatoms have to cope with large fluctuations in irradiance and exposures to high light ranging from minutes to hours (Harris, 1986; Fogg, 1991). In photosynthetic organisms non-photochemical fluorescence quenching (NPQ) is one of the most important photoprotective mechanisms, which can safely dissipate excess energy as heat and minimize the photodamage (Niyogi, 2000; Muller et al., 2001). A number of studies have shown that diatoms possess the capacity for thermal energy dissipation upon exposure to high light (Ting and Owens, 1993; Arsalane et al., 1994; Olaizola et al., 1994; Casper- Lindley and Bjorkman, 1998); a capacity that is comparable to that of higher plants. Estuarine diatom species showed higher capacity for NPQ than oceanic and coastal species, indicating that different photoprotection ability reflects the species original habitat (Lavaud et al., 2007). In diatoms, NPQ is tightly associated with a single-step xanthophyll cycle, which converts diadinoxanthin (Ddx) to diatoxanthin (Dtx) under high light and Dtx back to Ddx in the darkness or under limited light (Arsalane et al., 1994; Casper-Lindley and Bjorkman, 1998). The accumulation of Dtx is required for the development of NPQ (Lavaud et al., 2002b; Goss et al., 2006). In addition, the light-driven ΔpH across the thylakoid lumen also plays a central role in NPQ formation (Ruban et al., 2004; Lavaud and Kroth, 2006). Therefore, the generation of NPQ in diatoms is dependent on both ΔpH across the thylakoid membranes and Dtx concentrations (Lavaud et al., 2002b; Lavaud and Kroth, 2006). It has been widely demonstrated that the increase of NPQ during high light illumination is linearly correlated with the levels of Dtx among different diatom species (Olaizola et al., 1994; Casper-Lindley and Bjorkman, 1998; Lavaud et al., 2002a; Lavaud et al., 2004; Ruban et al., 2004). In higher plants, the PsbS protein plays a key role in energy dependent quenching (qE) under high irradiance (Li et al., 2000; Li et al., 2004). However, the gene coding for the PsbS protein is missing in the genomes of two diatoms: Thalassiosira pseudonana (Armbrust et al., 2004) and Phaeodactylum tricornutum (Maheswari et al., 2005; Bowler et al., 2008). Interestingly, five LI818-like genes (Lhcx) have been found and characterized in the genome of T. pseudonana (Chapter 3). Could one or more of the five  89 Lhcx proteins be taking the place of PsbS in photoprotection? The regulation pattern of the five Lhcx genes upon high light stress has been investigated in T. pseudonana (Chapter4). The transient transcriptional induction of four LI818-like genes and the up- regulation of one of LI818-like proteins (Lhcx1) in T. pseudonana suggest that they may be involved in photoprotection under high light. In this chapter, my goal is to examine the response of photoprotective thermal energy dissipation under light stress in T. pseudonana. I first studied the kinetics of NPQ formation in different time scales. In parallel, changes in the xanthophyll cycle activity and the state of Ddx de-epoxidation were also determined after high light shift. Finally, these photophysiological results were further compared with the expression pattern of LI818-like genes and one LI818-like protein (Lhcx1) to see whether any correlation exists among them. 5.2 Materials and methods 5.2.1 Culture conditions An axenic culture of T. pseudonana (CCMP1335) was grown at 18°C in sterile ESAW medium at 40 μmol photons m-2s-1 under 12h L/D cycle with gentle agitation. Cells in exponential growth phase were harvested. For the HL shift experiments, a culture grown under LL at 40 μmol photons m-2s-1 was divided into two parts. One part was transferred to 700 μmol photons m-2s-1 (HL) at L0 (at the beginning of the light phase), and the other part was kept under LL. 5.2.2 Chlorophyll fluorescence measurements Variable Chl fluorescence was measured using a PAM 101 fluorometer (Walz, Effeltrich, Germany) at room temperature. Prior to each fluorescence measurement, samples were dark adapted for 30 min and a 2 mL sample was used for each measurement. For NPQ development within 1 h high light, experiments were done directly in the PAM fluorometer and excess irradiance was provided by the actinic light source. For a longer term light stress (up to 6 h), high light (700 μmol photons m-2s-1) was provided by homemade equipment (Refer to general methods, Figure 2.1) and samples were taken at  90 indicated time points and dark adapted for 30 min before PAM measurement. The maximum PSII efficiency was expressed as Fv/Fm = (Fm − F0)/Fm  (Bradbury and Baker, 1981; Schreiber et al., 1995a; Schreiber et al., 1995b), and the PSII operating efficiency as ΦPSII = (Fm’− Fs)/Fm’ (Genty et al., 1989). The NPQ coefficient was calculated using the Stern-Volmer equation, NPQ = (Fm − Fm’)/Fm’ (Bilger and Bjorkman, 1990). The energy dependent quenching was calculated as qE = Fm/Fm’ − Fm/Fmr, and the photoinhibitory quenching as qI = Fm/Fmr − 1. Fmr represents maximum fluorescence measured after relaxation in darkness (Farber et al., 1997). Prestressed Fm was used for the NPQ, qE and qI calculation. See general methods for details (Chapter 2). 5.2.3 Pigment analysis Duplicate aliquots (15 mL) of algal cultures were harvested at each sampling point. Samples were immediately filtered onto 25 mm GF/F filters (Whatman, Maidstone, Kent, England). Filters were quickly frozen in liquid nitrogen and then stored at –80 °C until analysis. Pigments were extracted from the GF/F filters into 4 mL of 90% acetone using a vortex mixer followed by sonication in a water bath for 5 min. Extracts were filtered through a 0.2μm PTFE filter to remove cell debris, and analyzed by HPLC using a reversed-phase C8 column and gradient elution buffer (Zapata et al., 2000) on an Alliance 2695 HPLC system (Waters, Milford, MA, USA). Eluent A was a mixture of methanol: acetonitrile: aqueous pyridine solution (0.25 M pyridine) (50:25:25 v:v:v) while eluent B was methanol: acetonitrile: acetone (20:60:20 v:v:v). Organic solvents employed to prepare mobile phases were HPLC-grade. Eluent A and B were filtered (0.2 μm GNWP nylon membrane filter, MILLIPORE) after mixing. For quantification, calibration curves using the same HPLC system were obtained using pure Chl a, Chl c, fucoxanthin, diadinoxanthin and diatoxanthin purchased from DHI Water and Environment (Hørsholm, Denmark). De-epoxidation state (DPS) was calculated as Dtx/(Ddx+Dtx). ΣXC represents the total xanthophyll cycle pool including diadinoxanthin and diatoxanthin.  91 5.3 Results 5.3.1 NPQ and operational PSII efficiency in response to increasing photon flux densities (PFD) In order to see the light dependency of the thermal dissipation process, the light response curve was determined by using low light grown cultures (40 μmol photons m-2s-1), which were exposed to different light intensity for a fixed duration of 5 min. The NPQ levels increased with increasing light intensities (Figure 5.1). However, NPQ was negligible when the light intensity was below 100 μmol photons m-2s-1 (over two-fold higher than the growth light intensity). Conversely, ΦPSII value decreased even at 100 μmol photons m-2s-1, but did not drop much further at intensities above 300 μmol photons m-2s-1 (Figure 5.1). ΦPSII has been shown to be correlated with carbon fixation (Genty et al., 1989). Therefore, the decreased quantum photon use efficiency of PSII with an increase in PFD may suggest the decreased efficiency of CO2 assimilation, indicating that LL-grown cells need to acclimate to the increasing light irradiance. This result also indicated that HL at 700 μmol photons m-2s-1, which was used to test the response of LI818-like genes and Lhcx1 protein (Chapter4), is high enough to induce a high value of NPQ. 5.3.2 The development of NPQ within 1 h of high light stress After the study of the regulation patterns of Lhcx genes and proteins under HL (Chapter 4), physiological aspects such as thermal dissipation were further investigated during short term HL stress (700 μmol photons m-2s-1) to see how T. pseudonana cells respond to a transition from LL to HL. For this experiment, high light was provided by the actinic light source of the PAM fluorometer. Upon exposure to HL, the induction of NPQ occurred very rapidly with biphasic kinetics (Figure 5.2). There was an abrupt rise in NPQ within one minute, followed by a gradual and continuous increase up to the end of the experiment at 60 min. In another experiment, at the end of each HL illumination period ranging from 5 to 30 min, cells were kept in darkness for 60 min and the relaxed fluorescence was then measured to determine the   92            Figure 5.1 Capacity of thermal energy dissipation (NPQ) and operational PSII quantum yield (ΦPSII) as a function of light intensity for a fixed illumination duration of 5 min at the indicated irradiances in dark-adapted T. pseudonana cells. Cells were grown under LL (40 μmol m-2s-1) and transferred to different light intensities. Fresh cells were used at each PFD. SV stands for Stern-Volmer equation for calculating NPQ. Similar results were obtained from another independent experiment.  0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 0 100 200 300 400 500 600 700 800 PFD N PQ  (S V) 0.0 0.1 0.2 0.3 0.4 0.5 0.6 O pe ra tio na l P SI I q ua nt um  y ie ld NPQ (SV) ΦPSII  93               Figure 5.2 NPQ development during 60-min illumination at 700 μmol m-2s-1 after LL- grown cells were shifted into HL. Data (±SD) are the average of three measurements.   0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 0 5 10 15 20 25 30 35 40 45 50 55 60 Time (min) N PQ (S V)  94 fraction of qE (energy-dependent quenching) and qI (photoinhibitory quenching) in the total NPQ. The dark recovery data showed fast relaxation of quenched fluorescence within 30 min of HL stress (Table 5.1A). Generally, the shorter time the cells were exposed to HL, the faster the maximum fluorescence was recovered. After 30 min HL, Fmr recovered more than 80% of its prestress value, mainly resulting from qE (~80%) in NPQ (Table 5.1A) and allowing fast recovery in the darkness. These results demonstrated that qE is dominant and a major type of NPQ component up to 30 min of HL stress.   Table 5.1 The fraction of qE and qI in the NPQ component after different durations of HL exposure Energy-dependent quenching (qE) and photoinhibitory quenching (qI) ratios and the fractions of recovered maximal fluorescence (Fmr) after short-term HL stress (A) and after long-term HL stress (B) determined by dark relaxation curves.  A  B       Illumination period qE/qI qE% qI% Recovered Fmr compared to Fm before HL 5 min 10.13 91.02% 8.98% 93.65% 15 min 8.62 89.60% 10.40% 91.32% 30 min 3.95 79.79% 20.21% 82.41% Illumination period qE/qI qE% qI% Recovered Fmr compared to Fm before HL HL 1h 1.32 56.95% 43.05% 64.63% HL 3h 0.58 37.01% 62.99% 54.05% HL 6h 0.40 28.59% 71.41% 53.22%  95 5.3.3 Effect of a longer high light stress on different photosynthetic parameters To compare with the expression pattern of LI818-like genes and proteins during long term HL treatment (Chapter 4), the changes in various Chl fluorescence parameters such as Fv/Fm, NPQ and ΦPSII were further measured after exposure of low light grown cultures to HL stress for 1h, 3h and 6h (Figure 5.3), using the high light equipment described in the general methods (Chapter 2). The decline of maximum quantum yield of PSII (Fv/Fm) was more evident in HL cultures than LL cultures (Figure 5.3A). Fv/Fm dropped by 10% and 24% when cells were exposed under HL for 1 h and 6 h compared to time 0 (T0), whereas a slight decrease (1%) of Fv/Fm was observed when cells were grown under LL for 6 h. The drop of Fv/Fm under HL probably indicated the damage or inactivation of PSII. After 1 h of HL exposure, the NPQ had reached its maximum value and did not change over the next 5 h of HL period (Figure 5.3B). The high level of NPQ maintained during HL stress demonstrates that thermal dissipation process continues to be responsible for getting rid of the excess absorbed energy. In contrast, the NPQ value in LL cells was near to zero at each indicated time point. Another indicator is the operational photochemical efficiency (ΦPSII), which dropped by 60% after 1 h of HL compared to T0, and remained low over the next 5 h stress period, also indicating that the efficiency of CO2 assimilation was decreased under HL stress. However, only a slight decline was observed in the ΦPSII of LL cultures over the course of the experiment (Figure 5.3C). These results suggested the pronounced decline of ΦPSII over the first hour of HL is mainly due to the thermal dissipation of absorbed excess energy by NPQ. It is noteworthy that the induction of NPQ and decline of ΦPSII co- occurred after 1h of HL treatment and nothing changed afterwards. Additionally, a slow decline of all photosynthetic parameters investigated was found in LL cultures during a 6 h time course, which could be due to a diurnal phenomenon since cells were grown in 12 h: 12 h light and dark cycles. The dark recovery data after long-term HL stress showed a slower relaxation rate (Table 5.1B) than after short term HL treatment (Table 5.1A). Relaxation of quenched  96 fluorescence was faster in 1 h HL cultures than in 3 h and 6 h HL cultures. After 1 h HL, Fmr recovered ~65% of its prestress value, whereas Fmr recovered only 50% of its prestress value after 3 and 6 h HL treatment. This is mainly due to more qE component in NPQ within 1 h HL (Table 5.1B), allowing fast recovery in the darkness. However, there was more qI (sustained quenching) in NPQ after 3 and 6 h HL stress, which resulted in partial inactivation of PSII and slow relaxation. Taken together, my results revealed that qI started to take over and was dominant during long term HL treatment.   97                    Figure 5.3 Time course of Fv/Fm (A), NPQ (B) and operational PSII quantum yield (C) in T. pseudonana after transition from LL to extended HL. LL-grown cells were transferred to HL (closed squares, solid lines) or maintained under LL (open squares, dashed lines).  Error bars indicate SD over three experiments. HL, high light; LL, low light.  0.00 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0 1 2 3 4 5 6 7 Time (h) F v /F m  -0.10 0.10 0.30 0.50 0.70 0.90 1.10 1.30 1.50 0 1 2 3 4 5 6 7 Time (h) N PQ (s v) 0.00 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0 1 2 3 4 5 6 7 Time (h) O pe ra tio na l P S II qu an tu m  y ie ld  A B C  98 5.3.4 Changes of xanthophyll cycle pigments in response to high light stress In diatoms, NPQ is tightly associated with the xanthophyll cycle, which involves the interconversion of Ddx to its de-epoxidized form Dtx under high light and its reversal under LL. The accumulation of Dtx is mandatory for the generation of NPQ (Lavaud et al., 2002b, 2004). In order to compare with the NPQ under excess light, I performed experiments to examine the changes of xanthophyll cycle pigment contents during short term (within 1 h) (Figure 5.4) and long term (up to 9 h) HL stress (Figure 5.5). Pigment compositions determined by HPLC are normalized to chl a (Figure 5.4). During short term HL stress, there was a quick increase in Dtx after 2 min, followed by a slow increase over the remainder of the HL stress period (Figure 5.4A). The increase of Dtx is inversely related to the decrease of Ddx, suggesting that there is an active xanthophyll cycle conversion from Ddx to Dtx. Moreover, the amount of Dtx is linearly correlated with the NPQ within 1 h short term HL stress (Figure 5.6), in line with the findings reported in other diatom species. In contrast, no significant changes were observed in Dtx in LL cultures over the course of the experiment (Figure 5.4A), indicating the ΔpH across the thylakoid membrane is unable to activate the conversion from Ddx to Dtx under such low light irradiance. Although the total XC pool increased during the time course in both cultures (Figure 5.4B), it was more evident in HL cultures.  99 0 20 40 60 80 100 120 140 0 10 20 30 40 50 60 70 Time (min) m m ol  p ig m en t /  m ol  C hl  a Ddx--LL Ddx--HL Dtx--LL Dtx--HL 0 20 40 60 80 100 120 140 160 0 10 20 30 40 50 60 70 Time (min) m m ol  p ig m en t /  m ol  C hl  a ΣXC-LL ΣXC-HL A B m m ol  p ig m en t /  m ol  C hl  a m m ol  p ig m en t /  m ol  C hl  a               Figure 5.4 Changes of the xanthophyll cycle (XC) pigments after transition from LL to HL for 1 h. LL-grown cells were transferred to HL or maintained under LL for the same period of time. (A) Ddx/Chl in HL (solid diamonds) and LL (open diamonds) cultures; Dtx/Chl in HL (solid circles) and LL (open circles) cultures. (B) Total xanthophylls (ΣXC/Chl) in HL (solid triangles) and LL (open triangles) cells. Results are the average of duplicate samples and mean values are shown. Similar results were obtained from another independent experiment.  100 Xanthophyll cycle pigments were further studied during prolonged high light stress (Figure 5.5). During long term HL stress, there was a gradual and continuous increase in Dtx over the time course up to 9h (Figure 5.5A). However, the continuous increase of Dtx was not accompanied by the decline of Ddx after 1h of HL, probably indicating that the accumulation of Dtx during long term excess light is attributed to de novo synthesis. Although a linear correlation between NPQ and Dtx is not observed during long term HL stress, the continuous increase of Dtx is accompanied by the high level of NPQ (qI), suggesting that Dtx is still important for thermal dissipation during photoinhibition. In contrast, Dtx was very low under LL, and no significant changes were observed in Dtx during the experiment, which is consistent with the unchanged levels of de-epoxidation state (DPS) (Figure 5.5C), showing that the diadinoxanthin cycle conversion from Ddx to Dtx was not activated by the lumenal pH under low irradiance. When pigments were normalized to cell numbers, the changes of Dtx/cell and Ddx/cell showed similar trends (data not shown). The total XC pool (ΣXC/chl a) continuously increased over the course of 9 h experiment under HL stress (Figure 5.5B), and a similar trend was also observed in ΣXC/cell (data not shown). However, under LL, there was an increase in the total XC pool (ΣXC/chl a) within the first 3 h, followed by a drop over the remainder of the experiment (Figure 5.5B). This drop is mainly due to the increase of chl a in LL-grown cells after 3 h of light phase (not shown). The cell concentrations of both LL and HL cultures are quite similar within first 3 h. However, the cell concentration of LL cultures increased more than that of HL cultures after 6 h light period and remained high in the rest of the experiment, suggesting that cell division occurred. During HL stress, there was an abrupt rise in DPS at 30 min of the HL, followed by a quick increase over the next 3 h, then with a slow increase over the rest of 6 h of HL (Figure 5.5C). The XC pool, after induction, continuously increased over the course of HL treatment, suggesting it is still important in photoprotection under HL stress. There were no significant changes in DPS under LL during the experiment.  101                  Figure 5.5 Changes of the xanthophyll cycle (XC) pigments after transition from LL to prolonged HL, normalized to Chl a. LL-grown cells were transferred to HL or maintained under LL for the same period of time. (A) Ddx/Chl in HL (solid diamonds) and LL (open diamonds) cultures; Dtx/Chl in HL (solid circles) and LL (open circles) cultures. (B) Total xanthophylls (ΣXC/Chl) in HL (solid triangles) and LL (open triangles) cells. (C) De-epoxidation state (DPS) in HL (solid squares) and LL (open squares) cells. Shown are the average of duplicate samples and mean values. Similar results were obtained from another independent experiment.   0 50 100 150 200 250 300 350 400 0 1 2 3 4 5 6 7 8 9 10 Time (h) m m ol  p ig m en t /  m ol  C hl  a Ddx-LL Ddx-HL Dtx-LL Dtx-HL 0 50 100 150 200 250 300 350 400 450 500 0 1 2 3 4 5 6 7 8 9 10 Time (h) m m ol  p ig m en t /  m ol  C hl  a ΣXC-LL ΣXC-HL A B 0.00 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0.90 0 1 2 3 4 5 6 7 8 9 10 Time (h) D PS LL HL C m m ol  p ig m en t /  m ol  C hl  a m m ol  p ig m en t /  m ol  C hl  a D PS  102 y = 0.0152x + 0.4003 R2 = 0.8948 0.00 0.20 0.40 0.60 0.80 1.00 1.20 1.40 1.60 1.80 40.00 45.00 50.00 55.00 60.00 65.00 70.00 75.00 Diatoxanthin (mmol pigment/mol Chla ) N PQ             Figure 5.6 Correlation of NPQ and Dtx concentration in T. pseudonana upon high irradiance from 2 to 60 min at 700 μmol m-2s-1.          103 5.4 Discussion 5.4.1 Regulation of light absorption and absorbed energy dissipation Plants, green algae and diatoms grown under different light intensities are able to adjust the size of light harvesting antenna through gene expression and/or protein degradation to balance light absorption and utilization (Walters and Horton, 1994; Escoubas et al., 1995; Lindahl et al., 1995; Maxwell et al., 1995; Oeltjen et al., 2002). Consistent with these findings, changes in the abundance of light harvesting antenna transcripts were observed in this study (Chapter 4). My results showed that the transcript level of several standard light harvesting genes (Lhcfs) was strongly down-regulated after exposure to high light stress, suggesting that the antenna size is dropped to regulate light absorption and protect reaction centers from photooxidative damage under excess light. However, the decreased Lhcf transcripts are not accompanied with a significant down-regulation of Lhcf proteins. This may be due to the higher stability of these light-harvesting proteins once they were synthesized. Besides adjusting light absorption, my results demonstrated that the NPQ is quickly induced after exposure to excess light in T. pseudonana cells, which exhibit high quenching capacity during high irradiance over different time scales, indicating that excess absorbed light energy is safely dissipated as heat. This important photoprotective mechanism is ubiquitous in almost all plants and eukaryotic algae for regulation of photosynthesis under excess light. Moreover, diatoms grown under special conditions show several times higher NPQ than higher plants (Lavaud et al., 2002a; Ruban et al., 2004). In parallel with high NPQ, my data also showed that Dtx is rapidly induced and continuously increased under high light stress, demonstrating that NPQ is associated with the accumulation of Dtx. The fast conversion from Ddx to Dtx under high light is mainly due to the quick activation of diadinoxanthin de-epoxidase (DDE) by low pH in the thylakoid lumen. It has been described that DDE becomes activated at higher lumenal pH than green plants VDE (Jakob et al., 2001), and it can even be triggered by a weak proton gradient induced by chlororespiration (Jakob et al., 1999). On the other hand, the accumulation of Dtx results from the inhibition of diatoxanthin epoxidase (DE) by high ΔpH under excess light (Goss et al., 2006). Therefore, the inactivation of DE, in  104 conjunction with the activation of DDE under excess light, ensures the efficient de- epoxidation of Ddx to Dtx, as observed in my data. 5.4.2 Heterogeneous NPQ components in T. pseudonana and their relationship with the Dtx concentration My results demonstrated that NPQ in T. pseudonana after different exposures to the light stress is heterogeneous and consists of two components. During short-term light stress (within 30 min), quickly inducible and fast reversible qE is the major type of NPQ. However, during long-term high light (up to 6 h), qI (sustained quenching) becomes the dominant component of NPQ after 1 h HL. A linear correlation has been observed between qE and the concentration of Dtx in my study (Figure 5.6), which is in good agreement with the findings in other diatom species upon high light exposure (Casper- Lindley and Bjorkman, 1998; Lavaud et al., 2002a; Lavaud et al., 2004). However, such a linear correlation is not found between qI and the amount of Dtx during long-term high light. My data showed that the constant high level of NPQ is associated with the gradually continuous increase of Dtx molecules probably via de novo synthesis, indicating that the quenching efficiency for the same amount of Dtx is decreased in T. pseudonana after long-term HL exposure in comparison with cells during short-term HL stress. Similarly, the varied Dtx quenching efficiency has been reported in the diatom P. tricornutum when cells were grown at different light intensities (Schumann et al., 2007). On the other hand, my results strongly suggest that the accumulation of Dtx is essential for maintaining high capacity of NPQ under prolonged light stress. Taken together, it is concluded that the accumulation of Dtx is associated with qE and qI in T. pseudonana. In a similar manner, it has been shown that zeaxanthin, as a common factor, is highly correlated with both qE and qI in a large number of higher plants (Demmig-Adams, 1990; Demmig-Adams et al., 1996; Niyogi et al., 1998; Demmig-Adams et al., 2006b). These findings suggest that Dtx and its analogue zeaxanthin in plants play a key role in thermal dissipation. Recently, it has been shown in diatoms that NPQ, once it has been fully developed, is solely determined by the amount of Dtx and independent of ΔpH across the thylakoid membrane (Goss et al., 2006).  105 5.4.3 LI818-like proteins may be associated with more than one type of NPQ and they are probably involved in binding of the Dtx molecules Upon high light stress, my data showed that thermal energy dissipation (NPQ) is the first line of defense in photoprotection. The rapid induction of LI818-like transcripts after exposure to high light suggests that their proteins could be upregulated and related to the energy-dependent quenching (qE). In addition, my results demonstrated that high NPQ is paralleled by the elevated levels of Lhcx1 protein during prolonged high light stress, suggesting that Lhcx1protein is involved in the sustained quenching (qI). Altogether, my data suggest that these LI818-like proteins are probably associated with both types of NPQ in T. pseudonana. Biochemical studies have shown that Ddx and Dtx are mostly bound to the LHC antenna proteins in diatoms (Lavaud et al., 2003). During prolonged high light stress, my results demonstrated that the accumulated Lhcx1 protein is accompanied by the continuous increase of Dtx molecules in T. pseudonana, suggesting that Lhcx1 protein may be involved in the Dtx binding. More recently, the trimeric complex characterized in C. meneghiniana, which is composed of subunits encoded by fcp1-3 (typical light harvesting genes) and fcp6/7 (LI818-like genes), exhibits much higher amount of Dtx in HL cultures in comparison with the LL cultures (Beer et al., 2006). In addition, more fluorescence of the trimeric complex is quenched along with the increase of Dtx concentration, suggesting the crucial role of this complex in the thermal dissipation under light stress (Gundermann and Buchel, 2008). Taken together, my findings, together with biochemical evidence from other diatom species, support the idea that LI818-like proteins could be associated with Dtx binding and play a vital role in excess energy dissipation for photoprotection under excess light. On the other hand, my immunoblotting results demonstrated that Lhcx1 protein is also accumulated under low light growth conditions relative to time 0 (T0) in the darkness (Chapter 4). In contrast, there is no NPQ induced and no Dtx molecules are converted from Ddx under LL conditions. Together, my results suggest that Lhcx1 may be required for the proper assembly of the thylakoid membrane under low light conditions rather than  106 having the function in energy dissipation under excess light as I discussed above. Recent biochemical studies have demonstrated that two different LHC complexes are organized in trimers and higher oligomers (hexamers or nonamers), respectively, in the centric diatom C. meneghiniana (Buchel, 2003) and the pennate diatom P. tricornutum (Lepetit et al., 2007). Based on these findings, similar organization of light harvesting antenna could occur in T. pseudonana. According to these biochemical evidences, LI818-like proteins (such as Lhcx1) may associate with other light harvesting antennae and form trimers or higher oligomers in T. pseudonana. Here I propose that Lhcx1 protein could have a dual function: in proper thylakoid membrane organization under low light or in excess light energy dissipation for photoprotection under high light. 5.4.4 Accumulated Lhcx1 protein is correlated with the sustained quenching (qI) during longer term HL stress In diatoms, most studies focus on shorter time scales (minutes) of photoacclimation and photoprotection. However, diatoms may undergo longer period of high light exposure (up to several hours). In addition to the short-term high light treatment, I also examined how diatoms cope with longer duration of excess light. My data revealed that T.pseudonana cells, after exposure to long-term light stress, exhibit high level of sustained thermal dissipation (qI), which is correlated with the decrease of maximum PSII efficiency, an accumulation of Lhcx1 and newly synthesized Dtx. My findings suggest that Lhcx1 protein is involved in the sustained energy quenching (qI) during longer high light treatment. Recently, the accumulation of Hlip-like proteins has been shown in the shade-grown tropical evergreen after transition to prolonged high light (Demmig-Adams et al., 2006b). Moreover, strong up-regulation of Elip-like and Hlip-like proteins has been demonstrated in overwintering evergreen plants grown at high altitude under severe environmental stress such as high light and cold (Zarter et al., 2006a; Zarter et al., 2006b; Zarter et al., 2006c). Based on these results, it has been hypothesized that these Elip- and Hlip-like proteins may play a role in facilitating sustained energy dissipation (qI) in evergreen plants. Elip-like and Hlip-like genes have been found in the genomes of two diatoms T. pseudonana and P. tricornutum. Although the Elip-like gene is not induced by high light  107 in T. pseudonana (Chapter 4), up-regulation of these Elip-like and Hlip-like genes has been observed in P. tricornutum (personal communication with Dr. Ansgar Gruber), suggesting that their corresponding proteins may cooperate with LI818-like proteins (e.g. Lhcx1) and participate in thermal energy dissipation. In addition, my data showed that Lhcx1 protein, once induced by high light, does not return to its prestress level even after overnight dark recovery (Chapter 4), probably suggesting that they are also important to maintain the stability of thylakoid membrane after reorganization and rearrangement of LHCs under prolonged light stress. 5.4.5 D1 protein is not significantly degraded during prolonged high light stress My results clearly showed that the level of D1 does not change significantly during photoinhibitory quenching. This is not in accordance with the findings in evergreen plants that can survive in the extreme cold stress and high light, where sustained quenching (qI) is usually paralleled by the degradation of D1 protein (Zarter et al., 2006a; Demmig-Adams et al., 2006b; Zarter et al., 2006b). However, the modification of D1 (e.g. phosphorylation) rather than degradation of PSII components has been demonstrated in the tropical evergreen species during short-term light stress (Ebbert et al., 2001; Demmig-Adams et al., 2006b) and overwintering evergreen plants grown at moderate altitude under less severe environment stress (Ebbert et al., 2005). Therefore, my results suggest that the degradation of D1 is not triggered under the given light stress condition and the presence of LI818-like proteins, possibly together with Hlip-like proteins, is able to fulfill the role for photoprotection in T. pseudonana.  108 Chapter 6 Expression of LI818-like genes and Lhcx1 protein under iron and copper deficiency in the marine diatom Thalassiosira pseudonana  109 6.1 Introduction Iron plays a crucial role in many core biochemical processes such as photosynthesis, respiration and nitrogen assimilation, which require electron transfer reactions (Geider and Laroche, 1994). In oxygenic photoautotrophs, the chloroplast is a major sink of iron. There are at least 20-23 atoms of iron in a linear photosynthetic electron transport chain (Raven, 1990; Raven et al., 1999). It has been estimated that approximately 80% of the iron required by phytoplankton is allocated to the photosynthetic apparatus (Raven, 1990). Therefore, iron is structurally and functionally essential for photosynthesis. Copper, another bioactive metal, is also vital for phytoplankton growth. It is involved in photosynthesis (i.e., copper-containing plastocyanin) in many cyanobacteria and Chl b- containing algae (Sandmann et al., 1983) and respiration (cytochrome oxidase) in all phytoplankton (Stryer, 1988). This element also participates in detoxification of active oxygen species (i.e., Cu-containing superoxide dismutases) (Chadd et al., 1996) and nitrogen assimilation (i.e., Cu-containing nitrite reductase) (Merchant et al., 2006) in some phytoplankton. More recent studies have shown that copper is involved in the high- affinity iron transport system (i.e., Cu-containing ferroxidase) in the coastal and oceanic diatoms (Peers et al., 2005; Maldonado et al., 2006). Although iron is the fourth most abundant element in the Earth’s crust, dissolved Fe is present at subnanomolar levels in surface waters of the open ocean (Johnson et al., 1997), limiting primary production in large oceanic regions. Indeed, numerous studies, from early shipboard incubation to recent iron fertilization experiments, have demonstrated that iron plays a central role in controlling phytoplankton growth in 50% of the global ocean, especially in the “high nutrient, low chlorophyll” HNLC regions of the subarctic Pacific, equatorial Pacific, and Southern Ocean (Martin et al., 1990; Bruland et al., 1991; Martin et al., 1994; Debaar et al., 1995; Coale et al., 1996; Boyd et al., 2000; Tsuda et al., 2003). It has also been demonstrated that copper limitation results in the decreased rates of iron uptake in the coastal and open ocean diatoms, suggesting that there is an interactive effect between copper and iron (Peers et al., 2005). Photosystem I (PSI) is a prime target of iron deficiency, probably due to its high content of iron (12 Fe per PSI). In the green alga C. reinhardtii, the loss of PSI under iron  110 starvation is paralleled by a remodeling of PSI-associated light harvesting antenna (LHCI) (Moseley et al., 2002; Naumann et al., 2005). Similarly, the pronounced degradation of PSI and uncoupling of LHC from PSI has also been observed in red algae under iron deficiency (Desquilbet et al., 2003; Doan et al., 2003). In the halotolerant green alga Dunaliella salina, a Chl a/b binding protein homologue, termed Tidi, is clearly induced under iron deprivation and is functionally associated with PSI (Varsano et al., 2003; Varsano et al., 2006). The LI818 gene, originally discovered in green algae Chlamydomonas (Gagne and Guertin, 1992; Savard et al., 1996), is fully expressed several hours before standard chlorophyll a/b binding light harvesting genes (cab) after the beginning of the light period (Savard et al., 1996). A number of studies have shown that three C. reinhardtii LI818 genes are highly induced under various stress conditions, including high light and iron deficiency (Im et al., 2003; Zhang et al., 2004; Moseley et al., 2006; Naumann et al., 2007; Yamano et al., 2008). Recently, two of the three LI818 proteins in C. reinhardtii have been demonstrated to be strongly up-regulated under iron limitation (Naumann et al., 2007). Consistent with the work in C. reinhardtii, most of the LI818-like genes identified in the centric diatom T. pseudonana genome are highly induced by high light stress. In parallel, the accumulation of LI818 protein is also observed under high light (Chapter 4). However, little is known about the effect of iron and copper deficiency on the expression of LI818-like genes and proteins in diatoms. In the present study, we examined the expression pattern of LI818-like genes and one of the LI818-like proteins in response to iron deficiency and copper starvation in T. pseudonana. We monitored the abundance of LI818-like gene transcripts and proteins using quantitative real-time PCR and immunoblotting, respectively, in iron (or copper) starved and sufficient cultures. In addition, the maximum PSII efficiency and non- photochemical quenching (NPQ) were measured to assess the effect of trace metal limitation on PSII reaction center and on the capacity of photoprotection of T. pseudonana under excess light. Possible photosynthetic reorganization of PSI under iron deficiency will be discussed. (This work was performed in collaboration with Jian Guo in Dr. Maldonado’s laboratory.)  111 6.2 Materials and methods 6.2.1 Culture conditions In contrast to the previous chapters, an axenic culture of T. pseudonana (CCMP1335) in this study was cultured in sterile artificial seawater medium AQUIL (Price et al., 1988/1989) with various additions of iron and copper (Table 6.1), under continuous light at 150 μmol photons m-2s-1 at 19 ± 1°C. Except for the addition of iron and copper, the AQUIL medium used in this study was prepared and had identical chemical composition as that described in Maldonado et al. (2006), and trace metal-clean techniques were used during all manipulations. Cultures were acclimated to various Fe and Cu levels in 28mL polycarbonate tubes using semi-continuous batch cultures. Cultures were considered acclimated when the growth rates of five successive transfers varied by less than 15% (Brand et al., 1981). The growth rates (doubling d-1) of the cultures were monitored using daily in vivo Chl fluorescence measurements with a Turner Designs® AU-10 Fluorometer (Sunnyvale, CA, USA). Cell density (cells mL-1) and size (μm) were determined using a Coulter Z2 Particle Count and Size Analyzer. Cell volume (fl per cell, fl=10-15 l) was calculated assuming a spherical cell shape. Cells were harvested during the early exponential growth phase. For RNA isolation and protein extraction, 250 mL of iron and copper replete cultures and copper deplete cultures were collected at a cell density of 4~5 × 105 cells/mL. However, 500 mL of iron starved cultures were harvested at a density of 2~3 × 105 cells/mL. 6.2.2 RNA extraction and qRT-PCR Purified total RNA (500 ng –1 μg) was reverse transcribed into cDNA using Superscript II (Invitrogen, Carlsbad, CA, USA). For qRT-PCR, gene-specific primers were designed to give products of about 150 bp. An iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) was used for qRT-PCR. The PCR amplification profile: 95° C for 3 min followed by 40 cycles of 95° C for 15 s, 60° C for 30s, and 72° C for 30s. The detailed RNA extraction and qRT-PCR procedures were described in the general methods (Chapter 2).  112 6.2.3 Protein extraction and analysis See general methods for details (Chapter 2). 6.2.4 SDS-PAGE and immunoblotting In addition to the investigation of regulation patterns of one LI818-like protein (Lhcx1) and standard light harvesting proteins (Lhcf proteins, as a control) under different trace metal deficient conditions, PSII and PSI reaction center subunits (D1, PsaA/B, PsaC and PsaD) were examined in parallel under identical conditions. Thus, six different primary antibodies were used in this chapter. The Cc-FCP6 antibody (1:15,000 dilution) was kindly provided by Dr. E. Rhiel (Carl von Ossietzky University of Oldenburg, Germany); the Ha-FCP antibody (1:5,000 dilution) was raised against a fucoxanthin-chlorophyll protein from H.akashiwo in our lab; D1 (1:20,000 dilution) antibody was purchased from Agrisera AB (Vännäs, Sweden); the α-CPI antibody (1:5,000 dilution) against PsaA and PsaB was raised in our lab; the PsaC (1:1,000 dilution) and PsaD (1:1,000 dilution) antibodies were kindly given by Dr. J.H. Golbeck (Penn State University, USA). Because the protein concentration per unit cell volume is rather stable in all conditions (Table 6.1), samples were loaded based on an equal amount of total protein instead of equal cell numbers for SDS-PAGE. The rest of the procedures are given in the general methods (Chapter 2). 6.2.5 Chlorophyll fluorescence measurements Variable Chl fluorescence was measured using a PAM 101 fluorometer (Walz, Effeltrich, Germany) at room temperature. For PAM measurements, 20 mL of iron-starved cells were concentrated into 10 mL by gently filtering cells on 2.0-μm polycarbonate membrane filters (Poretics, Livermore, California), resuspended in the growth medium and allowed to recover for 1 h in ambient light. However, no concentration was needed for iron and copper replete and copper deplete cultures. Prior to each fluorescence measurement, samples were dark adapted for 30 min and a 2 mL sample (from each of the triplicates) was used for each measurement. A pulse of saturating light (2000 μmol photon m-2s-1 for 700 ms) was applied to determine the maximum fluorescence (Fm). Continuous actinic light was applied to the sample at the same intensity as the growth  113 irradiance or at higher light intensities. Once steady state fluorescence was achieved (Fs), saturating pulses (at 2000 μmol photon m-2s-1 for 700 ms) were applied every 30 s to measure the maximal fluorescence under actinic yield (Fm’). The irradiance was measured using a spherical sensor (model QSL-100; Biospherical Instruments Inc., San Diego, CA, USA). The maximum quantum efficiency of PSII was expressed as Fv/Fm = (Fm − F0)/Fm (Schreiber et al., 1995a; Schreiber et al., 1995b). The NPQ coefficient was calculated using the Stern-Volmer equation, NPQ = (Fm − Fm’)/Fm’ (Bilger and Bjorkman, 1990). NPQ measurements were performed by exposing cells to three different actinic light intensities (150, 300 and 750 μmol photon m-2s-1). The duration of each irradiance was 5 min and a new sample was used for each irradiance step. 6.3 Results 6.3.1 Cell growth rates and cell sizes under trace metal starvation T. pseudonana cells were grown under Fe and Cu sufficient, and Cu or Fe deficient conditions (Table 6.1). The growth rate of Fe-limited cells decreased more than 2-fold compared to the control (Table 6.1). In contrast, the growth rate of cells grown under low copper did not change, indicating that the cell division was strongly restricted by iron starvation but not by copper starvation. In addition, the cell size was decreased by 17% in the low iron treatment compared to the control (high iron and high copper), but no significant change was observed in the low copper treatment. The total cellular protein concentration varied among different treatments, with the low iron treatment exhibiting the lowest content (1.93 pg/cell). However, when normalized to cell volume, the protein concentration was approximately the same (0.070 pg/fl) for all treatments. Overall, the results demonstrated that the low iron treatment had a stronger effect on cell growth rate and cell size than the low copper treatment.  114 Table 6.1 Iron and copper total concentrations in the medium, cell growth rate, cell size and cellular protein content of T. pseudonana grown under three different trace metal conditions.  6.3.2 Effects of iron and copper deficiency on gene expression To determine whether trace metal deficiency affects the expression of Lhcx genes in cultures grown under different iron and copper conditions (Table 6.1), the expression of Lhcx genes was analyzed by quantitative real time RT-PCR and compared with the expression of standard light harvesting genes (Lhcfs) as in Chapter 3 and 4. Lhcx1, Lhcx5 and Lhcx6 were all down-regulated under iron and copper starvation (Figure 6.1A). In contrast, Lhcx4 was not significantly affected by trace metal deficiency. Lhcx1 was the most strongly affected by iron deficiency among all Lhcx genes, showing a decrease of approximately 4.5-fold in the transcript level. In addition, its mRNA level also dropped 1.8-fold in the low copper treatment. These results demonstrated that the iron deficiency has more effect on Lhcx1 gene expression than the copper deficiency. The transcript levels of Lhcx5 and Lhcx6 were decreased approximately 2-fold and 2.5-fold in the low iron and low copper treatments, respectively, suggesting that the iron deficiency and copper deficiency had similar effects on the expression of these genes. The transcript levels of Lhcf4 and Lhcf5 were down-regulated 2 to 3 fold in the low iron treatment (Figure 6.1B). In contrast, Lhcf2 did not change significantly under either iron or copper deficiency. Similar to Lhcx1, the decrease in the transcript levels of Lhcf4 and Lhcf5 was more evident under iron deficiency. Thus, iron deficiency plays a more Treatments  High Fe high Cu (Control) (+Fe+Cu)  High Fe low Cu (+Fe-Cu)  Low Fe high Cu (-Fe+Cu) Fe concentration 1.37 µM 1.37 µM 12.5 nM Cu concentration 10.2 nM 1.96 nM 10.2 nM Growth rate (division/day) 2.59±0.20 2.52±0.21 1.19±0.13 Cell size (µm) 4.55±0.01 4.70±0.01 3.76±0.00 Protein conc. (pg/cell) 3.39±0.05 3.84±0.82 1.93±0.07 Protein conc. (pg/fL) 0.07±0.00 0.07±0.02 0.07±0.00  115                Figure 6.1 Relative expression of Lhcx (A) and Lhcf (B) transcripts when cells were grown under Fe and Cu replete (control, grown at AQUIL medium), and Fe or Cu deplete conditions. Levels of mRNA examined by quantitative RT-PCR were normalized with respect to that of the actin transcript. Similar results were obtained from another independent experiment (biological replicates). For each gene, error bar represents the standard deviation (SD) of its relative expression in technical duplicate samples. 0 1 2 3 4 5 6 7 High Fe high Cu High Fe low Cu Low Fe high Cu R el at iv e ge ne  e xp re ss io n Lhcx1 Lhcx4 Lhcx5 Lhcx6 0 1 2 3 4 5 6 7 8 High Fe high Cu High Fe low Cu Low Fe high Cu R el at iv e ge ne  e xp re ss io n Lhcf2 Lhcf4 Lhcf5 A B R el at iv e ge ne  e xp re ss io n R el at iv e ge ne  e xp re ss io n  116 important role than copper deficiency in regulating the expression of standard light harvesting genes in T. pseudonana. Overall, most of the LI818-like genes (Lhcx1, Lhcx5, Lhcx6) and standard light harvesting genes (Lhcf4, Lhcf5) were significantly down-regulated by iron deficiency. A slight down-regulation of these genes was also observed under copper deficiency. Although LI818-like genes (Lhcxs) and standard light harvesting genes (Lhcfs) are completely separated in the phylogenetic tree and belong to different clades, these genes showed similar expression patterns under iron and copper deficiency, suggesting that the same signal pathway regulates gene expression in both groups. 6.3.3 Effects of iron and copper deficiency on protein expression To further investigate whether trace metal deficiency affects the expression of light harvesting proteins and reaction center proteins, three cultures grown under iron and copper replete or deplete conditions were analyzed by immunoblotting. The levels of Lhcx1 protein were compared with the expression of standard light harvesting proteins (Lhcfs) under these conditions. In addition, PSII (D1) and PSI (PsaA/B, PsaC and PsaD) proteins were also studied to test whether the reaction centers are affected by the iron and copper deficiency. The amount of Lhcx1 protein was highly up-regulated (approximately 2.5-fold) under low iron conditions relative to the control (iron/copper-replete) (Fig. 6.2A and 6.2C). In contrast, the level of Lhcf proteins was significantly down-regulated (roughly 2-fold) in the low iron treatment (Fig. 6.2A and 6.2C). For D1, no significant differences were observed under iron and copper deficiency. Changes in the protein levels of Lhcx1 and Lhcf were more strongly affected by iron deficiency than copper deficiency, which nicely agrees with their transcript levels (Fig.6.1A and Fig.6.1B). Interestingly, the down- regulation at the transcript level of Lhcx1 was accompanied by the up-regulation of Lhcx1 protein under both low iron and low copper treatments, suggesting that this gene was independently regulated at the transcription level and translation level. An alternative explanation is that the turnover rate of Lhcx1 transcript is much faster than that of Lhcx1 polypeptide under iron and copper deficiency.  117 Three PSI-core proteins (PsaA/B, PsaC and PsaD) were also investigated under these identical trace metal conditions. The levels of all these proteins were down-regulated under iron deficiency conditions (Figure 6.2B). However, their expression did not change significantly under low copper conditions. Compared with iron/copper-replete control treatment, PsaA/B decreased 3-fold under iron deprivation conditions, while PsaC is absent under iron starvation and PsaD dropped 1.5-fold (Fig. 6.2D). The pronounced decline of PsaC under low iron conditions agrees well with our knowledge of the biochemistry of PsaC, which contains two terminal Fe4S4 clusters (FA and FB) and is the most iron rich protein in the PSI reaction center. In contrast, PsaD does not contain any iron cofactor. However, PsaD together with PsaC and PsaE form a stromal ridge on top of PSI and participate in the docking of the stromal electron acceptor, ferredoxin (Amunts and Nelson, 2008). PsaD subunit in our study showed the least decline among PSI-core proteins under iron deprivation. The slight decline of the PsaD protein under iron deficiency in T. pseudonana could be due to the pronounced down-regulation of its neighboring PSI subunits such as PsaA, PsaB and PsaC, which in turn resulted in the decreased stability at PSI reaction center. Overall, the LI818-like protein (Lhcx1) was up-regulated under iron deficiency. In contrast, standard light harvesting proteins (Lhcfs) were down-regulated under iron and copper deficiency. D1 protein, in PSII reaction center, did not change significantly. In contrast to PSII, three PSI core proteins (PsaA/B, PsaC and PsaD) were all down- regulated under iron deficiency but not under copper deficiency. The results also indicate that PSI reaction center was much more affected by iron deficiency than PSII reaction center.  118 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 High Fe high Cu High Fe low Cu Low Fe high Cu Pr ot ei n ex pr es si on  (A .U ) Lhcx1 Lhcf D1 A B DC 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 High Fe high Cu High Fe low Cu Low Fe high Cu Pr ot ei n ex pr es si on  (A .U ) PsaA/B PsaC PsaD Pr ot ei n ex pr es si on  (A .U ) Pr ot ei n ex pr es si on  (A .U )               Figure 6.2 Protein expression under Fe and/or Cu replete or deplete conditions assayed by immunoblotting (A&B) and their corresponding densitometric quantifications (C&D). A: Lhcx1, Lhcf, D1 polypeptides; B: PsaA/B, PsaC, PsaD polypeptides; C: Quantified Lhcx1, Lhcf and D1 polypeptides given in arbitrary units (a.u.); D: Quantified PsaA, PsaC and PsaD polypeptides given in arbitrary units (a.u.). Lanes were loaded on an equal protein basis (3 μg lane –1 for A or 6 μg lane –1 for B). I and II represent biological duplicates for each treatment. For each quantified polypeptide (C&D), error bar represents the standard deviation (SD) of its protein expression in biological duplicate samples.  119 6.3.4 Chlorophyll fluorescence parameters in response to the trace metal deficiency The value of Fv/Fm reflects the maximal quantum yield of PSII and is used as a sensitive indicator of cell photosynthetic performance. No effect of copper starvation was found in Fv/Fm compared with the control (Figure 6.3A). In contrast, Fv/Fm under iron deficiency decreased by 17%, indicating that iron deprivation did affect the PSII reaction center. When the actinic light was adjusted to approximate the growth irradiance (150 μmol photons m-2s-1), only low levels of NPQ were induced in all treatments (Figure 6.3B). By contrast, more NPQ was induced in all the cultures when the actinic light was several times greater than their growth light intensity. Moreover, it is important to note that the NPQ induced by the higher irradiances (higher than the growth light intensity) was more pronounced in the control and the copper-starved cultures than the iron-deplete cultures (Figure 6.3B). In comparison with cultures exposed to the growth irradiance, the NPQ increased 3~4 fold at 300 μmol photons m-2s-1 and 4~5 fold at 750 μmol photons m-2s-1 in the iron/copper replete and the copper-starved cultures, respectively. In iron deficient cultures, the NPQ was only upregulated by 2 to 2.5-fold when exposed to higher irradiance (300 and 750 μmol photons m-2s-1) relative to the growth light. Altogether, our results revealed that the capacity of excess energy dissipation (NPQ) is decreased in iron deficient cultures relative to the copper-starved and control cultures.  120 0.71 0.71 0.59 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 High Fe high Cu High Fe low Cu Low Fe high Cu Fv /F m A B 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 150 300 750 Light intensity N PQ  (S V) High Fe high Cu High Fe low Cu Low Fe high Cu (μmol photons m-2s-1) F v /F m N PQ  (S V)                 Figure 6.3 The maximum quantum yield of PSII (Fv/Fm) (A) and capacity for light energy dissipation (NPQ) versus irradiance for a fixed illumination of 5 min (B) in T. pseudonana. Cells were grown under Fe and Cu replete and Fe or Cu starved mediums. SV stands for Stern-Volmer equation for calculating NPQ. Data (±SD) are the average of three independent measurements (Biological replicates).  121 6.4 Discussion 6.4.1 Physiological adaptations: growth rate and cell size Coastal diatom species require much higher iron concentration for growth than oceanic species (Sunda and Huntsman, 1995; Maldonado and Price, 1996; Price and Morel, 1998). Here we show that T. pseudonana, a coastal species, exhibited a pronounced decrease in growth rate under iron deficiency. Iron is the most important trace metal for phytoplankton metabolism. In iron enrichment experiments in HNLC regions, increased iron supply led to a large increase in phytoplankton stock, among which diatoms often appeared to be the dominant species (Boyd et al., 2007). These findings demonstrate that iron availability plays a key role in controlling diatom productivity. Our results showed that the cell size is also decreased under iron limitation. A reduction in cell size with decreasing iron concentrations has been widely observed in coastal and oceanic phytoplankton species including diatoms, dinoflagellates, haptophytes and green algae (Sunda and Huntsman, 1995). The reduced cell size may decrease cellular iron requirement for growth through the reduction of iron containing proteins in essential metabolic pathways. Under iron-limited conditions several core proteins of PSI, the most iron-demanding component in photosynthesis, are highly diminished to relieve the iron burden (Fig 6.2 B&D). It has been demonstrated that diatom species, isolated from the open ocean, where low iron is a normal condition, exhibit a substantial decrease in PSI and cytochrome b6f complexes in comparison with the coastal diatoms living in iron- enriched environments (Strzepek and Harrison, 2004). This modification in the photosynthetic apparatus may enable oceanic species to decrease the iron requirements for growth. On the other hand, the reduced cell size increases the surface area to volume ratio, which decreases diffusion limitation of iron uptake under iron starvation (Hudson and Morel, 1990; Sunda and Huntsman, 1995, 1997). Indeed, the iron uptake ability of different algae is inversely dependent on the cell size but positively affected by the cell surface area. Therefore, the growth of small cells is favored under iron limitation by generating more favorable surface area for iron uptake relative to their demand (set by  122 their volume). Taken together, reduced cell size seems to be an important physiological adaptation for cells to survive in iron deficient conditions. 6.4.2 Expression of Lhcx and Lhcf genes under trace metal deficiency It is interesting to compare our results with those obtained by microarray analysis (Mock et al., 2008). In that study, T. pseudonana was maintained in natural seawater supplemented with f/2 nutrients under continuous illumination (100 μmol photons m-2s-1), then transferred to seawater but without the addition of one of several nutrients including iron, nitrate and silicic acid. Cells were harvested after four days of growth for RNA isolation when limited cultures stopped growing. Expression results for several of the genes studied in my thesis were extracted from their supplementary data (SI Table 6) and are given in Table 6.2. Three Lhcx genes were strongly down-regulated under iron deficiency in their microarray analysis. Furthermore, similar trends were also observed for T. pseudonana grown under silicon and nitrogen limitation (Table 6.2). However, a higher magnitude decline in Lhcx1, Lhcx2 and Lhcx5 transcripts was observed in the microarray analysis compared to our data, probably due to the short-term exposure (4 days) of the cells to Fe-starvation rather than growing the cells continuously in exponential phase in low iron medium as we did. In contrast to the down-regulation of several Lhcx and Lhcf genes in T. pseudonana under iron deficiency, one LI818 homolog gene (annotated as Lhcx2) and one typical light-harvesting gene (annotated as Lhcf3) are found to be up-regulated in the pennate diatom P. tricornutum under iron starvation (Allen et al., 2008), indicating their quite different expression profiles between two diatom species. In T. pseudonana, the similar expression pattern of both Lhcx and Lhcf genes under trace metal starvation is different from their response to high light stress, where the expressions of Lhcx genes are induced but Lhcf genes are suppressed (Figure 4.1A and B). Although both Lhcx and Lhcf genes are members of the LHC superfamily, they fall into different clades in the phylogenetic tree (Figure 1.1), probably reflecting their different functions. Thus the different expression patterns of Lhcx and Lhcf genes under various environmental stresses suggest that more than one signaling regulatory pathways are involved in controlling these genes at the transcriptional level.  123 Table 6.2 Expression of several Lhcx and Lhcf genes under different stress conditions derived from microarray data (Mock et al., 2008). The change is expressed as Log2 fold change ratios that are relative to the control for each limitation condition; / : represents no significant changes. - : represents the down- regulation.  6.4.3 The down-regulation of Lhcf polypeptides is accompanied by the accumulation of Lhcx1 proteins under iron deficiency On the molecular level, PSI appears to be a principal target of iron starvation, probably because the components constituting PSI are enriched in iron content (12Fe per PSI). Our study supports this as several PSI core subunits are strongly depleted under iron deficiency conditions. Pronounced degradation of PSI under iron stress has been commonly shown in green algae, red algae and cyanobacteria (Moseley et al., 2002; Doan et al., 2003; Kouril et al., 2005; Naumann et al., 2005). In addition to the degradation of PSI, there is a remodeling of PSI-associated LHCI in green alga C. reinhardtii (Moseley et al., 2002; Naumann et al., 2005) and the red alga Rhodella violacea (Doan et al., 2003) under iron deprivation. Dynamic remodeling of the photosynthetic apparatus is involved either in N-terminal processing of Lhca3 followed by depletion and up-regulation of some LHCIs in respect to PSI in the green alga or in the uncoupling of LHCI from the PSI reaction center in the red alga. These structural changes result in the decrease of functional efficiency of energy transfer between LHCI and PSI, thereby minimizing the photo-oxidative stress to the thylakoid membrane. Although fucoxanthin Chl a/c light harvesting proteins (often referred to simply as FCPs) are believed to be equally distributed along the thylakoid membranes (Pyszniak and Gibbs, 1992), recent biochemical studies have demonstrated that some FCPs, functioning Gene Names Protein I.D Low Fe Low Temperature Low Si Low N Lhcx1 264921 -2.46 2.68 -4.12 / Lhcx2 38879 -2.60 2.65 -4.60 / Lhcx4 5533 / 5.00 / / Lhcx5 31128 -4.03 / -4.22 -4.35 Lhcf2 38494 / -2.65 -3.95 -3.64 Lhcf4 38667 / -3.48 -5.92 -4.18  124 as light harvesting complexes, are tightly bound to PSI and can be isolated as a PSI-FCP supercomplex in the pennate diatom, P. tricornutum (Veith and Buchel, 2007), and in the centric diatom, Chaetoceros gracilis (Ikeda et al., 2008). These findings suggest that PSI- bound FCPs may be present in other diatoms such as T. pseudonana. Our results showed a significant down-regulation of Lhcfs under iron deficiency, using an antibody against most of the light harvesting proteins in a heterokont alga. If PSI-bound FCPs do exist in T. pseudonana, their degradation may contribute to the remodeling of the photosynthetic apparatus when PSI is impaired under iron deprivation. Therefore, it is proposed that changes in the composition of Lhcfs under iron deficiency may decrease the efficiency of energy transfer between some PSI-bound FCPs to the PSI reaction center and protect against the photo-oxidative damage in T. pseudonana. In contrast to the decreases in Lhcf polypeptides, iron deficiency strongly induced the accumulation of the Lhcx1 polypeptide in T. pseudonana, which is comparable to the increase of its homologous protein (LI818) in C. reinhardtii under similar stress condition (Naumann et al., 2007). However, the up-regulation of Lhcx1 protein is accompanied by the down-regulation of the abundance of Lhcx1 transcript in T. pseudonana, which is not observed in C. reinhardtii. These results reveal that LI818 (- like) genes can be independently or jointly regulated at the transcriptional level and translational level in diatoms and green algae, respectively. 6.4.4 Effects of iron deficiency on PSII reaction center Despite of the substantial drop of PSI subunits, our results demonstrated that the abundance of PSII reaction center protein D1 is not significantly affected by iron stress in T. pseudonana. This contrasts with previous studies, where decreased levels of D1 have been observed under iron starvation in diatoms and green algae (Greene et al., 1992; Geider et al., 1993; Geider and Laroche, 1994; Vassiliev et al., 1995). Although there are no significant differences in D1 protein abundance under iron deficiency, our results showed that the maximum quantum yield of PSII (Fv/Fm) in T. pseudonana is decreased, consistent with previous findings (Greene et al., 1992; Geider et al., 1993; Geider and Laroche, 1994; Vassiliev et al., 1995). The constant level of D1 protein observed in our study could be due to a fast repair cycle of D1, through which the loss of D1 protein can  125 be compensated during prolonged and steady-state iron limitation, also suggesting that cells are adapted to the low iron environment. 6.4.5 Effects of copper deficiency Although copper-containing plastocyanin has been found in one oceanic diatom, Thalassiosira oceanica (Peers and Price, 2006), it is absent in most diatoms and other Chl c containing algae, which instead use the iron-requiring cytochrome c6 as an electron transfer carrier (Raven et al., 1999). As a consequence, there is no copper demand for photosynthetic components in coastal diatoms such as T. pseudonana. Consistent with this, our results showed that copper deficiency has less effect than iron limitation on the composition of the photosynthetic apparatus and the expression of Lhcf proteins and Lhcx proteins. However, copper is a key component of the high-affinity iron transport system, which is induced under iron deficiency in coastal and oceanic diatoms (Peers et al., 2005; Maldonado et al., 2006). Therefore, copper plays an important role in regulation of iron uptake under iron stress. However, coastal diatom species, such as T. pseudonana, have very low copper demand for growth (Peers et al., 2005) and therefore it is very hard to see an effect of low copper on iron uptake, probably due to copper contamination in the medium. In contrast to T. pseudonana, there is a high copper demand in T. oceanica. Moreover, copper is required for the photosynthetic apparatus (i.e., plastocyanin) in this open ocean species (Peers and Price, 2006).  126 Chapter 7 Conclusions and future directions  127 7.1 Summary of major findings of this thesis A major goal of my PhD thesis was to investigate the expression pattern of five LI818- like transcripts and one LI818-like protein (Lhcx1) in response to high light and during trace metal deficiency in the coastal diatom T. pseudonana. In parallel, I examined the changes of NPQ and xanthophyll cycle contents after exposure to short-term and long- term high light, mimicking the conditions to which diatoms are subjected in natural environment. I then correlated these physiological data with the expression profiles of LI818-like genes and the Lhcx1 protein. Finally, I demonstrated that Lhcx1 is possibly involved in the thermal energy dissipation and in the stabilization of the thylakoid membrane during excess light, suggesting its important role in photoprotection. The major findings are summarized below: 1. Sequence analysis shows that each of the three Lhcx and Lhcf gene pairs is located on the same chromosome and transcribed divergently, and separated by a short non-coding intergenic region, suggesting that this distinctive gene organization may be used to allow the co-ordinated regulation of the members of each pair (Chapter 3). 2. Lhcx1 polypeptide is less firmly integrated into the thylakoid membrane than the Lhcf proteins (Chapter 3). 3. Four of the five LI818-like transcripts are transiently induced by excess light but the amplitude of induction is different among them (Chapter 4). 4. Lhcx1 protein present under low light is upregulated in response to high light stress and remains at elevated level for at least 10 h during longer high light treatment, indicating that it is a high light inducible protein (Chapter 4). 5. NPQ is quickly induced by high light, reaches a maximum after 1h and remains at constantly high level during prolonged light stress. NPQ can be distinguished as qE and qI based on dark recovery data. qE is dominant during short-term (within 30 min) light stress and qI takes over during long-term high light (up to 6 h) when qE is saturated (Chapter 5).  128 6. During long-term high light stress, a high level of NPQ is not only correlated with the elevated abundance of Lhcx1 protein but also associated with the continuous increase of diatoxanthin, suggesting that Lhcx1 and diatoxanthin are involved in thermal energy dissipation (Chapter 5). 7. The down-regulation of Lhcx1 transcript under iron deficiency is accompanied by the up-regulation of its protein, indicating that the regulation of Lhcx1 gene expression occurs at the level of both transcript and protein accumulation (Chapter 6). 8. In contrast to PSII, several PSI core subunits are substantially diminished under iron deprivation (Chapter 6). 7.2 Distinctive gene organization of Lhc genes in T. pseudonana The T. pseudonana genome contains 32 Lhc genes scattered on 12 different chromosomes, which encode members of light-harvesting complex (LHC) superfamily including the major “standard” Lhcf proteins (also called FCP in other heterokont algae), the red algal-like Lhcr proteins, and the LI818-like Lhcx proteins (Figure 1.1). Interestingly, gene analysis showed that each of the three adjacent divergently transcribed gene pairs (Lhcx1/6, Lhcf3/4, Lhcf6/12) is located on the same chromosome and separated by short non-coding intergenic regions in T. pseudonana (Chapter 3). Moreover, each of the three red algal-like gene pairs (Lhcr4/14, Lhcr6/7 and Lhcr11/12) arranged on the same chromosome is also found to be closely spaced and divergently transcribed with 5’ ends proximal in T. pseudonana (data not shown). However, other light harvesting genes have been described to occur in multiple adjacent copies in diatoms and dinoflagellates (Bhaya and Grossman, 1993; Hiller et al., 2001), which are arrayed tandemly rather than divergently. So far, similar gene organization pattern has only been shown in the cryptophyte alga Rhodomonas where a number of light harvesting genes (four cac and six cpeA) occur in divergent pairs with 5’ ends proximal (Broughton et al., 2006). Furthermore, adjacent divergently transcribed gene pairs have been reported in the plant (not Lhc genes) and mammalian genomes, which are co-expressed or in some cases regulated by a common bi-directional promoter (Adachi and Lieber, 2002; Trinklein et al., 2004; Williams and Bowles, 2004). Therefore, such a distinctive gene  129 organization observed in my study may suggest that closely spaced divergently arranged gene pairs may be co-ordinatedly regulated, or possibly under the control of the same promoter within the short space region. 7.3 LI818-like proteins are unique members of LHC family 7.3.1 Lhcx1 protein is not tightly bound to the thylakoid membranes The intriguing result of Chapter 3 is that in contrast to Lhcf proteins, Lhcx1 is substantially released from the thylakoid at high pH, indicating that it is less firmly bound to the membranes in T. pseudonana, as confirmed by my freezing and thawing of thylakoid membrane experiment. This finding is consistent with the observations for LI818 protein in the green alga C. reinhardtii (Richard et al., 2000). In addition to alkaline pH, other dissociating treatments such as NaCl, NaBr and NaSCN all cause the release of variable amounts of LI818 proteins from the thylakoid membrane in C. reinhardtii (Richard et al., 2000). However, this was not the case in my study, suggesting that a different mode of association of LI818 (-like) proteins within the thylakoid membranes occurs in green algae and diatoms. In most green algae, thylakoids are tightly appressed and characteristically arranged in extended bands of two to six, although larger stacks are common. On the other hand, thylakoids in diatoms are loosely appressed and organized in extended bands of three (Gibbs, 1970). Taken together, these findings suggest that the difference in thylakoid organization between green algae and diatoms may affect the binding of LI818 (-like) proteins to the thylakoid membrane. 7.3.2 Accumulation of LI818-like transcripts and Lhcx1 protein in response to high irradiance One of the major findings of this work is that four of the five LI818-like transcripts were transiently expressed under high light stress (Chapter 4), similar to the transient accumulation of Elip transcripts after the transition of etiolated plant seedlings from darkness to light (Meyer and Kloppstech, 1984; Grimm and Kloppstech, 1987; Potter and Kloppstech, 1993), and during excess light exposure in C. reinhardtii (Teramoto et al., 2004). In addition to Elips, another stress related protein, the high light inducible protein (Hlip), also called one-helix protein (Ohp), has been found in cyanobacteria (Dolganov et  130 al., 1995; Funk and Vermaas, 1999) and Arabidopsis (Jansson et al., 2000; Andersson et al., 2003). The transient increase of Hlip transcripts has been reported in cyanobacteria and green plants under high light (Jansson et al., 2000; Teramoto et al., 2004). It has been proposed that the primary function of Elips and Hlips is involved in photoprotection rather than light harvesting (Montane and Kloppstech, 2000). Therefore, the high light stimulated expression pattern of the four LI818-like transcripts (Chapter 4) may suggest their role in photoprotection. In contrast to the Elip genes, low levels of LI818-like gene transcripts were present also at low light condition, similar to expression patterns of two Ohp genes in Arabidopsis (Jansson et al., 2000; Andersson et al., 2003). So far, two different mechanisms of photoprotection have been postulated for Hlips: a transient Chl carrier function (Xu et al., 2004) and an excess energy dissipation function (Havaux et al., 2003). Recently, Ohp2 in Arabidopsis has been revealed to be associated with PSI and its accumulation has been suggested to prevent the photo-oxidative damage around PSI under excess light (Andersson et al., 2003). My study showed that Lhcx1 is upregulated after exposure to high light stress (Chapter 4), indicating that this LI818-like protein is a high light inducible protein. Overall, the up-regulation of Lhcx1 protein, in conjunction with the transient expression of LI818-like genes upon high light exposure supports the idea that LI818-like proteins play a role in photoprotection in T. pseudonana, and suggests that they are new members of stress related proteins in the LHC superfamily. In contrast to the transient accumulation of LI818-like transcripts under high light stress, my data demonstrated that Lhcx1 rapidly accumulated after exposure to high light and remained at that level for at least 10 h (Chapter 4). The discrepancy between the abundance of Lhcx1 transcript and its protein indicates that Lhcx1 was independently regulated at the level of transcript and protein accumulation. At present, precise signals that control the regulation of LI818-like genes under high light are still unknown. To address this question, the following future studies should be considered: (1) Inhibitors and uncouplers such as DCMU and Nigericin, which block the photosynthetic electron flow and interrupt the proton gradient respectively, need to be used to test whether the induction of LI818-like genes under high light is affected; (2) The effect of light quality  131 on the expression of LI818-like genes needs to be further examined to determine whether any specific wavelength is responsible for the induction of these genes in T. pseudonana. 7.4 Dual roles of LI818-like proteins in photoprotection: Involvement in the thermal energy dissipation (NPQ) and in the stabilization of thylakoid membranes under high light stress 7.4.1 Possible proton binding sites are found in LI818-like proteins The novel finding of this work (Chapter 5) is that high NPQ is accompanied by the increased levels of Lhcx1 protein during longer-term excess light, suggesting that Lhcx1 protein is involved in the sustained energy quenching (qI). On the other hand, during short-term high light (within 1 h), the transient accumulation of LI818-like transcripts after exposure to high irradiance suggests that their proteins could be upregulated and associated with the quick inducible energy-dependent quenching (qE). On the basis of these results, it is possible that these LI818-like proteins are associated with both types of NPQ components in T. pseudonana. The increase of Dtx alone is not sufficient to enhance the NPQ in P. tricornutum, suggesting that the acidification of thylakoid lumen is necessary to switch the Dtx into an active state through the protonation of LHC protein under excess light (Lavaud and Kroth, 2006). Interestingly, sequence analysis showed that Lhcx1 has eight acidic amino acids (four glutamate and four aspartate) located near or at its lumen-exposed domain (Figure 7.1). Several acidic amino acids in the lumen-exposed loop have been also found in the deduced protein sequences of Lhcx4 and Lhcx6 (Figure 7.1). Therefore, these acidic amino acids located in the lumen side of LI818-like proteins are possible candidates for proton-binding sites. 7.4.2 Lhcx1 protein may be involved in ΔpH-dependent quenching (qE) under excess light It has been shown that LHC complexes in diatoms are organized into trimers and higher oligomers (hexamers or nonamers) (Buchel, 2003; Lepetit et al., 2007), implying that similar organization of light harvesting antenna could occur in T. pseudonana. In the  132              Figure 7.1 Amino acid alignment of Lhcxs in T. pseudonana, two LhcIIs in pea and spinach, and PsbS in Arabidopsis thaliana. Acidic amino acid residues of Lhcx1/2 (4 glutamates and 4 asparates), Lhcx4, and Lhcx6 near or at the lumen of thylakoid are highlighted in the black boxes. Acidic amino acid residues of PsbS near or at the lumen of thylakoid are marked by vertical arrows. Predicted transmembrane spanning helices are shown in black arrows.  133 centric diatom C. meneghiniana, the trimeric complex consisting of subunits encoded by fcp1-3 (standard light harvesting genes) and fcp6/7 (LI818-like genes) exhibits much higher amount of Dtx in HL cultures relative to the LL ones (Beer et al., 2006). Based on these findings, LI818-like proteins in T. pseudonana may associate with other light harvesting antennae to form trimers and/or higher oligomers, and be involved in the Dtx binding. However, there is still no direct evidence that any of the LI818-like proteins binds chlorophyll or carotenoids. One possibility is that Lhcx1 might be the site of quenching. Protonation of Lhcx1 protein could activate the Dtx binding and induce its conformational change, which results in the qE quenching (Figure 7.2A). Alternatively, Lhcx1 may function as a regulatory subunit of the antenna. Protonation of Lhcx1 may be necessary to switch conformational change of adjacent LHC antennas in the trimeric complex and/or in the higher oligomers, and induce the quenched state in which single excited chlorophyll de- excitation is facilitated (Figure 7.2B). In higher plants, it has been demonstrated that qE is strongly correlated with the absorption change at 535 nm (Ruban et al., 1993; Bilger and Bjorkman, 1994), which is used to monitor the conformational change of LHC. Although absorption change at 535 nm is absent in diatoms, an absorption change at 522 nm has been observed and is linearly correlated with the kinetics of NPQ in P. tricornutum (Ruban et al., 2004), further suggesting that conformational change is related to the energy dissipation in diatoms. In higher plants, PsbS is essential for qE (Li et al., 2000). In addition, a number of studies have shown that qE capacity is correlated with the macroorganization of LHCII-PSII (Andersson et al., 2001; Andersson et al., 2003; Ruban et al., 2003; Yakushevska et al., 2003; Kovacs et al., 2006), leading to a suggestion that qE is a property of this supercomplex including LHCII trimer, CP29, CP26 and CP24, which has been further postulated to form a qE locus (Horton et al., 2008). A putative quenching site has been confirmed from purified LHCII proteins, through which energy can be transferred from Chl a to the excited state of lutein (Ruban et al., 2007). In addition, three minor LHCII proteins (CP29, CP26 and CP24) have been recently found to have identical or similar quenching site as trimeric LHCII (Mozzo et al., 2008), suggesting that all LHCII antennae may function as quenchers. PsbS may act as a “master switch” that controls qE  134 Plastid Lhcx Lhcf Lhcx Lhcf Nucleus Short-term excess light pH<7 (low pH in the lumen) H+ H+ H+H+ H + H+ Lhcx Stroma Lumen Lhcx Heat (qE) Dtx Lhcx Heat (qE) Lhcf Lhcx Lhcf Thylakoid (A) (B) on and off (Horton et al., 2008). Altogether, qE is a co-operative event involving all the subunits of PSII antennae in higher plants. Although the organization of LHC antennae in diatoms is different from higher plants, a co-operative nature of qE could occur in diatoms through the interaction between subunits of different trimers or high oligomers. This explanation is in favor of my second hypothesis, in which protonation of Lhcx1 under light stress enables the conformational change of neighboring LHC proteins in the trimeric complex and/or in the higher oligomers, and promotes their transition into quenched state.             Figure 7.2 Schematic model for qE during short-term high light stress in T. pseudonana Upon high light shift, four of the five Lhcx genes are transiently upregulated, whereas standard light harvesting genes (Lhcf genes) are significantly depressed. In addition, more Lhcx1/2 proteins are accumulated in the thylakoid membrane under HL than LL conditions. The buildup of ΔpH in the thylakoid lumen may trigger the protonation of Lhcx1/2 and further activate the Dtx binding to Lhcx1/2. Therefore, it has been postulated that Lhcx1/2 may function as the quenching site through conformational changes (A). Alternatively, protonation of Lhcx1/2 proteins may cause the conformational changes of their adjacent light harvesting proteins, which could be involved in the thermal dissipation (B).  135 7.4.3 Accumulation of Lhcx1 protein is closely correlated with sustained quenching (qI) during longer high light stress My study showed that T. pseudonana cells after exposure to prolonged high light exhibit high level of sustained quenching (qI), which is correlated with an accumulation of Lhcx1 protein and accompanied by the decrease of maximum PSII efficiency and newly synthesized Dtx (Chapter 5), strongly suggesting that Lhcx1 protein is involved in the qI. Unlike the Lhcx1 protein in T. pseudonana, the level of PsbS protein is not increased in tropical and overwintering evergreen species under high light conditions and/or severe cold stress (Zarter et al., 2006a; Demmig-Adams et al., 2006b; Zarter et al., 2006b), where they possess high levels of sustained energy dissipation (qI). These findings suggest that PsbS protein is more specifically associated with qE than qI. Consistent with this, an Arabidopsis PsbS-deficient mutant is still able to develop comparable sustained quenching (qI) as in the wild type during prolonged illumination, although qE is completely absent (Horton et al., 2008). However, strong up-regulation of Elip-like and Hlip-like proteins has been demonstrated in overwintering evergreen plants grown at high altitude under severe environmental stress such as high light and cold (Zarter et al., 2006a; Zarter et al., 2006b; Zarter et al., 2006c), suggesting that these Elip- and Hlip-like proteins may play a role in facilitating sustained energy dissipation (qI) in evergreen plants. The LHCII-aggregation model has been suggested in higher plants to explain the formation of NPQ (Horton et al., 2005). If this model can be applied to diatoms, an aggregation state may occur through the interaction between trimeric LHC complex (Figure 7.3A) and higher oligomers of LHC antennae (Figure 7.3B) during extended light stress. As overexcitation persists, more LI818-like proteins can be protonated, which would enable the overall conformational change of aggregated LHCs. In parallel, more Dtx is bound to the aggregated light harvesting complexes, which in turn may facilitate direct energy quenching from excited Chl to Dtx. Finally, a stable quenched state is promoted through conformational change within the aggregated LHC supercomplex and is capable of efficient thermal energy dissipation (Figure 7.3C).  136 Plastid Lhcx Lhcf Lhcf Nucleus Lhcx Long-term excess light Lhcf Lhcf Lhcx Lhcf Lhcf Lhcx Heat Heat Thylakoid (A) (B) (C)               Figure 7.3 Schematic model for qI during long-term high light stress in T. pseudonana During long-term high light stress, although the abundance of Lhcx transcripts is decreased, Lhcx1/2 proteins stay at the elevated levels once induced. Here, I propose that the trimeric LHC complex (consisting of Lhcx and Lhcf proteins) (A) may aggregate with the higher oligomer LHC antenna (B) during extended light stress. This aggregated supercomplex (C) may facilitate the quenching of the excessive absorbed light energy. More details are given in the discussion 7.4.3.  137 7.4.4 Lhcx1 protein is also associated with the stabilization of the thylakoid membranes during longer-term high light My data clearly showed that Lhcx1 protein, once induced by high light, does not return to its prestress level even after overnight dark recovery (Chapter 4), also suggesting that it is important to maintain the stability of thylakoid membrane after reorganization and rearrangement of LHCs under prolonged light stress. In T. pseudonana, several acidic amino acid residues at the lumen-exposed domains of LI818-like proteins have been predicted to be possible proton binding sites based on sequence analysis. To understand how LI818-like proteins actually function in NPQ, purification of these proteins together with the use of inhibitor such as DCCD is necessary to determine whether these acidic residues are potential proton- or /and DCCD- binding sites. Moreover, in vitro reconstitution of purified or overexpressed LI818-like proteins with the presence of pigments (Chl a, Chl c and xanthophylls) may provide insights into how these proteins are involved in the thermal energy dissipation during light stress. 7.5 Remodeling of PSI may occur in T. pseudonana under iron deficiency In Chapter 6, my study showed that several PSI core subunits are strongly reduced under iron deficiency (as also shown in Figure 7.4A). Pronounced degradation of PSI has been widely shown in different algae and cyanobacteria under iron stress (Moseley et al., 2002; Doan et al., 2003; Kouril et al., 2005; Naumann et al., 2005). In addition, there is a remodeling of PSI-associated LHCI in C. reinhardtii (Moseley et al., 2002; Naumann et al., 2005) and red alga Rhodella violacea (Doan et al., 2003) under iron deficiency. These structural changes result in the decrease of functional efficiency of energy transfer between LHCI and PSI, thereby minimizing the photo-oxidative stress to the thylakoid membrane. Recent studies have shown that some FCPs are tightly bound to PSI in the diatoms P. tricornutum (Veith and Buchel, 2007), Chaetoceros gracilis (Ikeda et al., 2008) and C. meneghiniana (Veith et al., 2009), implying that PSI-bound FCPs are present in other diatoms such as T. pseudonana.  138 Plastid Lhcf Lhcf Fe limitation Stroma Lumen LhcxLhcx LhcxLhcx Lhcf LhcfLhcx Stroma Lumen Lhcx PSILhcxLhcx PSI Remodeling of PSI              Figure 7.4 Schematic model for PSI remodeling under iron deficiency in T. pseudonana Under iron limitation, several PSI core subunits are substantially reduced (A). On the other hand, the down-regulation of standard light harvesting proteins (Lhcf proteins) (B) is accompanied by the significant accumulation of Lhcx1/2 proteins (C) under iron deficiency. Taken together, I suggest that these Lhcf proteins and Lhcx proteins may be associated with PSI and are involved in the remodeling of PSI under iron stress conditions.    (A) (B) (C)  139  My results (Chapter 6) showed a significant down-regulation of Lhcf proteins under iron deficiency. If PSI-bound FCPs occur in T. pseudonana, their degradation may be involved in the remodeling of PSI when PSI reaction center is impaired under iron deprivation. Thus, I hypothesize that the PSI remodeling through changes in the abundance of Lhcf proteins under iron deficiency may decrease the efficiency of energy transfer between PSI-bound FCPs to PSI reaction center and protect against the photo- oxidative damage in T. pseudonana (Figure 7.4B). In Chapter 6, it is of interest to note that in contrast to the degradation of LHCs, iron deficiency strongly induces the accumulation of Lhcx1 protein in T. pseudonana. Similarly, in the green alga Dunaliella salina a CAB homolog (Tidi) is induced by iron deprivation and functionally associated with PSI-LHCI supercomplex (Varsano et al., 2003). Additionally, in cyanobacteria, IsiA (iron stress-induced) protein is induced by iron deficiency and forms a ring of 18 copies around a trimeric PSI core (Bibby et al., 2001; Boekema et al., 2001). So far, IsiA has been assigned several functions. It may function as light-harvesting antenna for PSI (Melkozernov et al., 2003; Singh and Sherman, 2007). It may act as a Chl sink to prevent the formation of potentially hazardous 3Chl under iron limitation (Burnap et al., 1993). In addition, IsiA has been suggested to function as a dissipater of excess absorbed energy and protect reaction centers against photodamage (Sandstrom et al., 2002; Ihalainen et al., 2005; Ivanov et al., 2006). Although the induced Tidi and IsiA proteins under iron deprivation are all coupled with PSI, the location of Lhcx1 induced by iron stress is yet to be determined in T. pseudonana. Besides the remodeling of PSI-associated Lhcf proteins, here I further propose that Lhcx1 could be also involved in the remodeling of PSI reaction center and may complement the photoprotection through the thermal dissipation of PSI to prevent the photo-oxidative stress under iron deficiency (Figure 7.4C). Taken together, my study showed that the accumulation of Lhcx1 polypeptide is not only found under excess light (Chapter 4), but also under iron limitation (Chapter 6). Therefore, it is postulated that Lhcx1 is capable of dissipating excess excitation energy of both PSII and PSI reaction centers under different stress conditions.  140 Interestingly, my results showed that Lhcx1 protein is highly induced under iron deficiency. However, the exact location of enriched Lhcx1 remains unknown. Will it resemble Tidi in green alga and IsiA in cyanobacteria that are functionally coupled to PSI reaction center during iron limitation? Further biochemical studies on localization of Lhcx1 are essential for a better understanding of its role under iron deprivation.                        141 References Adachi N, Lieber MR (2002) Bidirectional gene organization: A common architectural feature of the human genome. Cell 109: 807-809 Adams WW, Barker DH (1998) Seasonal changes in xanthophyll cycle-dependent energy dissipation in Yucca glauca Nuttall. Plant Cell and Environment 21: 501- 511 Adams WW, Demmig-Adams B, Rosenstiel TN, Brightwell AK, Ebbert V (2002) Photosynthesis and photoprotection in overwintering plants. Plant Biology 4: 545- 557 Adamska I (1997) ELIPs - Light-induced stress proteins. Physiologia Plantarum 100: 794-805 Adamska I, Kruse E, Kloppstech K (2001) Stable insertion of the early light-induced proteins into etioplast membranes requires chlorophyll-alpha. Journal of Biological Chemistry 276: 8582-8587 Adamska I, Roobol-Boza M, Lindahl M, Andersson B (1999) Isolation of pigment- binding early light-inducible proteins from pea. European Journal of Biochemistry 260: 453-460 Allen AE, LaRoche J, Maheswari U, Lommer M, Schauer N, Lopez PJ, Finazzi G, Fernie AR, Bowler C (2008) Whole-cell response of the pennate diatom Phaeodactylum tricornutum to iron starvation. Proceedings of the National Academy of Sciences of the United States of America 105: 10438-10443 Amunts A, Nelson N (2008) Functional organization of a plant photosystem I: Evolution of a highly efficient photochemical machine. Plant Physiology and Biochemistry 46: 228-237 Anderson JM, Andersson B (1982) The Architecture of Photosynthetic Membranes - Lateral and Transverse Organization. Trends in Biochemical Sciences 7: 288-292 Andersson B, Anderson JM (1980) Lateral Heterogeneity in the Distribution of Chlorophyll-Protein Complexes of the Thylakoid Membranes of Spinach- Chloroplasts. Biochimica Et Biophysica Acta 593: 427-440  142 Andersson J, Walters RG, Horton P, Jansson S (2001) Antisense inhibition of the photosynthetic antenna proteins CP29 and CP26: Implications for the mechanism of protective energy dissipation. Plant Cell 13: 1193-1204 Andersson J, Wentworth M, Walters RG, Howard CA, Ruban AV, Horton P, Jansson S (2003) Absence of the Lhcb1 and Lhcb2 proteins of the light- harvesting complex of photosystem II - effects on photosynthesis, grana stacking and fitness. Plant Journal 35: 350-361 Andersson U, Heddad M, Adamska I (2003) Light stress-induced one-helix protein of the chlorophyll a/b-binding family associated with photosystem I. Plant Physiology 132: 811-820 Anwaruzzaman M, Chin BL, Li XP, Lohr M, Martinez DA, Niyogi KK (2004) Genomic analysis of mutants affecting xanthophyll biosynthesis and regulation of photosynthetic light harvesting in Chlamydomonas reinhardtii. Photosynthesis Research 82: 265-276 Apt KE, Bhaya D, Grossman AR (1994) Characterization of Genes Encoding the Light- Harvesting Proteins in Diatoms Biogenesis of the Fucoxanthin Chlorophyll a/c Protein Complex. Journal of Applied Phycology 6: 225-230 Apt KE, Clendennen SK, Powers DA, Grossman AR (1995) The Gene Family Encoding the Fucoxanthin Chlorophyll Proteins from the Brown Alga Macrocystis pyrifera. Molecular & General Genetics 246: 455-464 Archibald JM, Keeling PJ (2002) Recycled plastids: a 'green movement' in eukaryotic evolution. Trends in Genetics 18: 577-584 Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH, Zhou SG, Allen AE, Apt KE, Bechner M, Brzezinski MA, Chaal BK, Chiovitti A, Davis AK, Demarest MS, Detter JC, Glavina T, Goodstein D, Hadi MZ, Hellsten U, Hildebrand M, Jenkins BD, Jurka J, Kapitonov VV, Kroger N, Lau WWY, Lane TW, Larimer FW, Lippmeier JC, Lucas S, Medina M, Montsant A, Obornik M, Parker MS, Palenik B, Pazour GJ, Richardson PM, Rynearson TA, Saito MA, Schwartz DC, Thamatrakoln K, Valentin K, Vardi A, Wilkerson FP, Rokhsar DS (2004) The genome of the diatom Thalassiosira pseudonana: Ecology, evolution, and metabolism. Science 306: 79-86  143 Arsalane W, Rousseau B, Duval JC (1994) Influence of the Pool Size of the Xanthophyll Cycle on the Effects of Light Stress in a Diatom - Competition between Photoprotection and Photoinhibition. Photochemistry and Photobiology 60: 237-243 Asamiziu E, Miura K, Kucho K, Inoue Y, Fukuzawa H, Ohyama K, Nakamura Y, Tabata S (2000) Generation of expressed sequence tags from low-CO2 and high- CO2 adapted cells of Chlamydomonas reinhardtii. DNA Research 7: 305-307 Aspinall-O'Dea M, Wentworth M, Pascal A, Robert B, Ruban A, Horton P (2002) In vitro reconstitution of the activated zeaxanthin state associated with energy dissipation in plants. Proceedings of the National Academy of Sciences of the United States of America 99: 16331-16335 Barber J, Andersson B (1992) Too Much of a Good Thing - Light Can Be Bad for Photosynthesis. Trends in Biochemical Sciences 17: 61-66 Bassi R, Caffarri S (2000) Lhc proteins and the regulation of photosynthetic light harvesting function by xanthophylls. Photosynthesis Research 64: 243-256 Bassi R, Pineau B, Dainese P, Marquardt J (1993) Carotenoid-Binding Proteins of Photosystem-II. European Journal of Biochemistry 212: 297-303 Bassi R, Soen SY, Frank G, Zuber H, Rochaix JD (1992) Characterization of chlorophyll-a/b proteins of photosystem-I from Chlamydomonas reinhardtii. Journal of Biological Chemistry 267: 25714-25721 Becker F, Rhiel E (2006) Immuno-electron microscopic quantification of the fucoxanthin chlorophyll a/c binding polypeptides Fcp2, Fcp4, and Fcp6 of Cyclotella cryptica grown under low- and high-light intensities. International Microbiology 9: 29-36 Beer A, Gundermann K, Beckmann J, Buchel C (2006) Subunit composition and pigmentation of fucoxanthin-chlorophyll proteins in diatoms: Evidence for a subunit involved in diadinoxanthin and diatoxanthin binding. Biochemistry 45: 13046-13053 Ben-Shem A, Frolow F, Nelson N (2003) Crystal structure of plant photosystem I. Nature 426: 630-635  144 Bergantino E, Segalla A, Brunetta A, Teardo E, Rigoni F, Giacometti GM, Szabo I (2003) Light- and pH-dependent structural changes in the PsbS subunit of photosystem II. Proceedings of the National Academy of Sciences of the United States of America 100: 15265-15270 Berges JA, Franklin DJ, Harrison PJ (2001) Evolution of an artificial seawater medium: Improvements in enriched seawater, artificial water over the last two decades. Journal of Phycology 37: 1138-1145 Bertos NR, Gibbs SP (1998) Evidence for a lack of photosystem segregation in Chlamydomonas reinhardtii (Chlorophyceae). Journal of Phycology 34: 1009- 1016 Bhaya D, Grossman AR (1993) Characterization of Gene Clusters Encoding the Fucoxanthin Chlorophyll Proteins of the Diatom Phaeodactylum-Tricornutum. Nucleic Acids Research 21: 4458-4466 Bibby TS, Nield J, Barber J (2001) Iron deficiency induces the formation of an antenna ring around trimeric photosystem I in cyanobacteria. Nature 412: 743-745 Bilger W, Bjorkman O (1990) Role of the Xanthophyll Cycle in Photoprotection Elucidated by Measurements of Light-Induced Absorbency Changes, Fluorescence and Photosynthesis in Leaves of Hedera-Canariensis. Photosynthesis Research 25: 173-185 Bilger W, Bjorkman O (1994) Relationships among Violaxanthin Deepoxidation, Thylakoid Membrane Conformation, and Nonphotochemical Chlorophyll Fluorescence Quenching in Leaves of Cotton (Gossypium-Hirsutum L). Planta 193: 238-246 Boekema EJ, Hifney A, Yakushevska AE, Piotrowski M, Keegstra W, Berry S, Michel KP, Pistorius EK, Kruip J (2001) A giant chlorophyll-protein complex induced by iron defciency in cyanobacteria. Nature 412: 745-748 Bonente G, Passarini F, Cazzaniga S, Mancone C, Buia MC, Tripodi M, Bassi R, Caffarri S (2008) The Occurrence of the psbS Gene Product in Chlamydomonas reinhardtii and in Other Photosynthetic Organisms and Its Correlation with Energy Quenching. Photochemistry and Photobiology 84: 1359-1370  145 Bouvier F, dHarlingue A, Hugueney P, Marin E, MarionPoll A, Camara B (1996) Xanthophyll biosynthesis - Cloning, expression, functional reconstitution, and regulation of beta-cyclohexenyl carotenoid epoxidase from pepper (Capsicum annuum). Journal of Biological Chemistry 271: 28861-28867 Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A, Maheswari U, Martens C, Maumus F, Otillar RP, Rayko E, Salamov A, Vandepoele K, Beszteri B, Gruber A, Heijde M, Katinka M, Mock T, Valentin K, Verret F, Berges JA, Brownlee C, Cadoret JP, Chiovitti A, Choi CJ, Coesel S, De Martino A, Detter JC, Durkin C, Falciatore A, Fournet J, Haruta M, Huysman MJJ, Jenkins BD, Jiroutova K, Jorgensen RE, Joubert Y, Kaplan A, Kroger N, Kroth PG, La Roche J, Lindquist E, Lommer M, Martin- Jezequel V, Lopez PJ, Lucas S, Mangogna M, McGinnis K, Medlin LK, Montsant A, Oudot-Le Secq MP, Napoli C, Obornik M, Parker MS, Petit JL, Porcel BM, Poulsen N, Robison M, Rychlewski L, Rynearson TA, Schmutz J, Shapiro H, Siaut M, Stanley M, Sussman MR, Taylor AR, Vardi A, von Dassow P, Vyverman W, Willis A, Wyrwicz LS, Rokhsar DS, Weissenbach J, Armbrust EV, Green BR, Van De Peer Y, Grigoriev IV (2008) The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 456: 239-244 Boyd PW, Jickells T, Law CS, Blain S, Boyle EA, Buesseler KO, Coale KH, Cullen JJ, de Baar HJW, Follows M, Harvey M, Lancelot C, Levasseur M, Owens NPJ, Pollard R, Rivkin RB, Sarmiento J, Schoemann V, Smetacek V, Takeda S, Tsuda A, Turner S, Watson AJ (2007) Mesoscale iron enrichment experiments 1993-2005: Synthesis and future directions. Science 315: 612-617 Boyd PW, Watson AJ, Law CS, Abraham ER, Trull T, Murdoch R, Bakker DCE, Bowie AR, Buesseler KO, Chang H, Charette M, Croot P, Downing K, Frew R, Gall M, Hadfield M, Hall J, Harvey M, Jameson G, LaRoche J, Liddicoat M, Ling R, Maldonado MT, McKay RM, Nodder S, Pickmere S, Pridmore R, Rintoul S, Safi K, Sutton P, Strzepek R, Tanneberger K, Turner S, Waite A, Zeldis J (2000) A mesoscale phytoplankton bloom in the polar Southern Ocean stimulated by iron fertilization. Nature 407: 695-702  146 Bradbury M, Baker NR (1981) Analysis of the Slow Phases of the Invivo Chlorophyll Fluorescence Induction Curve - Changes in the Redox State of Photosystem-Ii Electron-Acceptors and Fluorescence Emission from Photosystem-I and Photosystem-Ii. Biochimica Et Biophysica Acta 635: 542-551 Brand LE, Guillard RRL, Murphy LS (1981) A Method for the Rapid and Precise Determination of Acclimated Phyto Plankton Reproduction Rates. Journal of Plankton Research 3: 193-202 Breyton C, Devitry C, Popot JL (1994) Membrane Association of Cytochrome B(6)F Subunits - the Rieske Iron-Sulfur Protein from Chlamydomonas-Reinhardtii Is an Extrinsic Protein. Journal of Biological Chemistry 269: 7597-7602 Broughton MJ, Howe CJ, Hiller RG (2006) Distinctive organization of genes for light- harvesting proteins in the cryptophyte alga Rhodomonas. Gene 369: 72-79 Bruland KW, Donat JR, Hutchins DA (1991) Interactive Influences of Bioactive Trace-Metals on Biological Production in Oceanic Waters. Limnology and Oceanography 36: 1555-1577 Buchel C (2003) Fucoxanthin-chlorophyll proteins in diatoms: 18 and 19 kDa subunits assemble into different oligomeric states. Biochemistry 42: 13027-13034 Bugos RC, Yamamoto HY (1996) Molecular cloning of violaxanthin de-epoxidase from romaine lettuce and expression in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 93: 6320-6325 Burnap RL, Troyan T, Sherman LA (1993) The Highly Abundant Chlorophyll-Protein Complex of Iron-Deficient Synechococcus sp. PCC7942 (Cp43') Is Encoded by the isiA Gene. Plant Physiology 103: 893-902 Butler PJG, Kuhlbrandt W (1988) Determination of the Aggregate Size in Detergent Solution of the Light-Harvesting Chlorophyll a/B-Protein Complex from Chloroplast Membranes. Proceedings of the National Academy of Sciences of the United States of America 85: 3797-3801 Caron L, Douady D, QuinetSzely M, deGoer S, Berkaloff C (1996) Gene structure of a chlorophyll a/c-binding protein from a brown alga: Presence of an intron and phylogenetic implications. Journal of Molecular Evolution 43: 270-280  147 Casper-Lindley C, Bjorkman O (1998) Fluorescence quenching in four unicellular algae with different light-harvesting and xanthophyll-cycle pigments. Photosynthesis Research 56: 277-289 Cavalier-Smith T (2000) Membrane heredity and early chloroplast evolution. Trends in Plant Science 5: 174-182 Chadd HE, Newman J, Mann NH, Carr NG (1996) Identification of iron superoxide dismutase and a copper/zinc superoxide dismutase enzyme activity within the marine cyanobacterium Synechococcus sp WH 7803. FEMS Microbiology Letters 138: 161-165 Coale KH, Johnson KS, Fitzwater SE, Gordon RM, Tanner S, Chavez FP, Ferioli L, Sakamoto C, Rogers P, Millero F, Steinberg P, Nightingale P, Cooper D, Cochlan WP, Landry MR, Constantinou J, Rollwagen G, Trasvina A, Kudela R (1996) A massive phytoplankton bloom induced by an ecosystem-scale iron fertilization experiment in the equatorial Pacific Ocean. Nature 383: 495-501 Croce R, Morosinotto T, Castelletti S, Breton J, Bassi R (2002) The Lhca antenna complexes of higher plants photosystem I. Biochimica Et Biophysica Acta- Bioenergetics 1556: 29-40 Davey M, Geider RJ (2001) Impact of iron limitation on the photosynthetic apparatus of the diatom Chaetoceros muelleri (Bacillariophyceae). Journal of Phycology 37: 987-1000 De Martino A, Douady D, Quinet-Szely M, Rousseau B, Crepineau F, Apt K, Caron L (2000) The light-harvesting antenna of brown algae: Highly homologous proteins encoded by a multigene family. European Journal of Biochemistry 267: 5540-5549 Debaar HJW, Dejong JTM, Bakker DCE, Loscher BM, Veth C, Bathmann U, Smetacek V (1995) Importance of Iron for Plankton Blooms and Carbon-Dioxide Drawdown in the Southern-Ocean. Nature 373: 412-415 Demmig-Adams B (1990) Carotenoids and Photoprotection in Plants - a Role for the Xanthophyll Zeaxanthin. Biochimica Et Biophysica Acta 1020: 1-24  148 Demmig-Adams B, Adams WW (1992) Photoprotection and Other Responses of Plants to High Light Stress. Annual Review of Plant Physiology and Plant Molecular Biology 43: 599-626 Demmig-Adams B, Adams WW (2006a) Photoprotection in an ecological context: the remarkable complexity of thermal energy dissipation. New Phytologist 172: 11- 21 Demmig-Adams B, Adams WW, Barker DH, Logan BA, Bowling DR, Verhoeven AS (1996) Using chlorophyll fluorescence to assess the fraction of absorbed light allocated to thermal dissipation of excess excitation. Physiologia Plantarum 98: 253-264 Demmig-Adams B, Ebbert V, Mellman DL, Mueh KE, Schaffer L, Funk C, Zarter CR, Adamska I, Jansson S, Iii WWA (2006b) Modulation of PsbS and flexible vs sustained energy dissipation by light environment in different species. Physiologia Plantarum 127: 670-680 Demmig-Adams B, Gilmore AM, Adams WW (1996) Carotenoids .3. In vivo functions of carotenoids in higher plants. FASEB Journal 10: 403-412 Demmig-Adams B, Moeller DL, Logan BA, Adams WW (1998) Positive correlation between levels of retained zeaxanthin plus antheraxanthin and degree of photoinhibition in shade leaves of Schefflera arboricola (Hayata) Merrill. Planta 205: 367-374 Demmig B, Winter K, Kruger A, Czygan FC (1987) Photoinhibition and Zeaxanthin Formation in Intact Leaves - a Possible Role of the Xanthophyll Cycle in the Dissipation of Excess Light Energy. Plant Physiology 84: 218-224 Desquilbet TE, Duval JC, Robert B, Houmard J, Thomas JC (2003) In the unicellular red alga Rhodella violacea iron deficiency induces an accumulation of uncoupled LHC. Plant and Cell Physiology 44: 1141-1151 Doan JM, Schoefs B, Ruban AV, Etienne AL (2003) Changes in the LHCI aggregation state during iron repletion in the unicellular red alga Rhodella violacea. Febs Letters 533: 59-62 Dolganov NAM, Bhaya D, Grossman AR (1995) Cyanobacterial Protein with Similarity to the Chlorophyll a/B Binding-Proteins of Higher-Plants - Evolution  149 and Regulation. Proceedings of the National Academy of Sciences of the United States of America 92: 636-640 Dominici P, Caffarri S, Armenante F, Ceoldo S, Crimi M, Bassi R (2002) Biochemical properties of the PsbS subunit of photosystem II either purified from chloroplast or recombinant. Journal of Biological Chemistry 277: 22750-22758 Douglas S, Zauner S, Fraunholz M, Beaton M, Penny S, Deng LT, Wu XN, Reith M, Cavalier-Smith T, Maier UG (2001) The highly reduced genome of an enslaved algal nucleus. Nature 410: 1091-1096 Duce RA, Tindale NW (1991) Atmospheric Transport of Iron and Its Deposition in the Ocean. Limnology and Oceanography 36: 1715-1726 Durnford DG, Aebersold R, Green BR (1996) The fucoxanthin-chlorophyll proteins from a chromophyte alga are part of a large multigene family: Structural and evolutionary relationships to other light harvesting antennae. Molecular & General Genetics 253: 377-386 Durnford DG, Deane JA, Tan S, McFadden GI, Gantt E, Green BR (1999) A phylogenetic assessment of the eukaryotic light-harvesting antenna proteins, with implications for plastid evolution. Journal of Molecular Evolution 48: 59-68 Durnford DG, Green BR (1994) Characterization of the Light-Harvesting Proteins of the Chromophytic Alga, Olisthodiscus-Luteus (Heterosigma-Carterae). Biochimica Et Biophysica Acta-Bioenergetics 1184: 118-126 Ebbert V, Adams WW, Mattoo AK, Sokolenko A, Demmig-Adams B (2005) Up- regulation of a photosystem II core protein phosphatase inhibitor and sustained D1 phosphorylation in zeaxanthin-retaining, photoinhibited needles of overwintering Douglas fir. Plant Cell and Environment 28: 232-240 Ebbert V, Demmig-Adams B, Adams WW, Mueh KE, Staehelin LA (2001) Correlation between persistent forms of zeaxanthin-dependent energy dissipation and thylakoid protein phosphorylation. Photosynthesis Research 67: 63-78 Eisenstadt D, Ohad I, Keren N, Kaplan A (2008) Changes in the photosynthetic reaction centre II in the diatom Phaeodactylum tricornutum result in non- photochemical fluorescence quenching. Environmental Microbiology 10: 1997- 2007  150 Elrad D, Grossman AR (2004) A genome's-eye view of the light-harvesting polypeptides of Chlamydomonas reinhardtii. Current Genetics 45: 61-75 Elrad D, Niyogi KK, Grossman AR (2002) A major light-harvesting polypeptide of photosystem II functions in thermal dissipation. Plant Cell 14: 1801-1816 Eppard M, Krumbein WE, von Haeseler A, Rhiel E (2000) Characterization of fcp4 and fcp12, two additional genes encoding light harvesting proteins of Cyclotella cryptica (Bacillariophyceae) and phylogenetic analysis of this complex gene family. Plant Biology 2: 283-289 Eppard M, Rhiel E (1998) The genes encoding light-harvesting subunits of Cyclotella cryptica (Bacillariophyceae) constitute a complex and heterogeneous family. Molecular and General Genetics 260: 335-345 Eppard M, Rhiel E (2000) Investigations on gene copy number, introns and chromosomal arrangement of genes encoding the fucoxanthin chlorophyll a/c- binding proteins of the centric diatom Cyclotella cryptica. Protist 151: 27-39 Erdner DL, Price NM, Doucette GJ, Peleato ML, Anderson DM (1999) Characterization of ferredoxin and flavodoxin as markers of iron limitation in marine phytoplankton. Marine Ecology-Progress Series 184: 43-53 Escoubas JM, Lomas M, Laroche J, Falkowski PG (1995) Light-Intensity Regulation of Cab Gene-Transcription Is Signaled by the Redox State of the Plastoquinone Pool. Proceedings of the National Academy of Sciences of the United States of America 92: 10237-10241 Eskling M, Arvidsson PO, Akerlund HE (1997) The xanthophyll cycle, its regulation and components. Physiologia Plantarum 100: 806-816 Falciatore A, Bowler C (2002) Revealing the molecular secrets of marine diatoms. Annual Review of Plant Biology 53: 109-130 Falkowski PG, Barber RT, Smetacek V (1998) Biogeochemical controls and feedbacks on ocean primary production. Science 281: 200-206 Falkowski PG, Katz ME, Knoll AH, Quigg A, Raven JA, Schofield O, Taylor FJR (2004) The evolution of modern eukaryotic phytoplankton. Science 305: 354-360 Farber A, Young AJ, Ruban AV, Horton P, Jahns P (1997) Dynamics of xanthophyll- cycle activity in different antenna subcomplexes in the photosynthetic membranes  151 of higher plants - The relationship between zeaxanthin conversion and nonphotochemical fluorescence quenching. Plant Physiology 115: 1609-1618 Fogg GE (1991) Tansley Review .30. The Phytoplanktonic Ways of Life. New Phytologist 118: 191-232 Fung IY, Meyn SK, Tegen I, Doney SC, John JG, Bishop JKB (2000) Iron supply and demand in the upper ocean. Global Biogeochemical Cycles 14: 281-295 Funk C, Adamska I, Green BR, Andersson B, Renger G (1995b) The Nuclear- Encoded Chlorophyll-Binding Photosystem-II-S Protein Is Stable in the Absence of Pigments. Journal of Biological Chemistry 270: 30141-30147 Funk C, Schroder WP, Green BR, Renger G, Andersson B (1994) The Intrinsic 22 kDa Protein Is a Chlorophyll-Binding Subunit of Photosystem-II. FEBS Letters 342: 261-266 Funk C, Schroder WP, Napiwotzki A, Tjus SE, Renger G, Andersson B (1995a) The PSII-S Protein of Higher-Plants - a New-Type of Pigment-Binding Protein. Biochemistry 34: 11133-11141 Funk C, Vermaas W (1999) A cyanobacterial gene family coding for single-helix proteins resembling part of the light-harvesting proteins from higher plants. Biochemistry 38: 9397-9404 Gagne G, Guertin M (1992) The Early Genetic Response to Light in the Green Unicellular Alga Chlamydomonas-Eugametos Grown under Light Dark Cycles Involves Genes That Represent Direct Responses to Light and Photosynthesis. Plant Molecular Biology 18: 429-445 Ganeteg U, Strand A, Gustafsson P, Jansson S (2001) The properties of the chlorophyll a/b-binding proteins Lhca2 and Lhca3 studied in vivo using antisense inhibition. Plant Physiology 127: 150-158 Geider RJ, Laroche J (1994) The Role of Iron in Phytoplankton Photosynthesis, and the Potential for Iron-Limitation of Primary Productivity in the Sea. Photosynthesis Research 39: 275-301 Geider RJ, Laroche J, Greene RM, Olaizola M (1993) Response of the Photosynthetic Apparatus of Phaeodactylum-Tricornutum (Bacillariophyceae) to Nitrate, Phosphate, or Iron Starvation. Journal of Phycology 29: 755-766  152 Genty B, Briantais JM, Baker NR (1989) The Relationship between the Quantum Yield of Photosynthetic Electron Transport and Quenching of Chlorophyll Fluorescence. Biochimica Et Biophysica Acta 990: 87-92 Gibbs SP (1970) Comparative Ultrastructure of Algal Chloroplast. Annals of the New York Academy of Sciences 175: 454-& Gibbs SP (1979) Route of Entry of Cytoplasmically Synthesized Proteins into Chloroplasts of Algae Possessing Chloroplast-Er. Journal of Cell Science 35: 253-266 Gibbs SP (1981) The Chloroplasts of Some Algal Groups May Have Evolved from Endosymbiotic Eukaryotic Algae. Annals of the New York Academy of Sciences 361: 193-208 Gile GH, Keeling PJ (2008) Nucleus-encoded periplastid-targeted EFL in chlorarachniophytes. Molecular Biology and Evolution 25: 1967-1977 Gilmore AM (1997) Mechanistic aspects of xanthophyll cycle-dependent photoprotection in higher plant chloroplasts and leaves. Physiologia Plantarum 99: 197-209 Gilmore AM, Ball MC (2000) Protection and storage of chlorophyll in overwintering evergreens. Proceedings of the National Academy of Sciences of the United States of America 97: 11098-11101 Gilmore AM, Bjorkman O (1995) Temperature-Sensitive Coupling and Uncoupling of Atpase-Mediated, Nonradiative Energy-Dissipation - Similarities between Chloroplasts and Leaves. Planta 197: 646-654 Goss R, Pinto EA, Wilhelm C, Richter M (2006) The importance of a highly active and Delta pH-regulated diatoxanthin epoxidase for the regulation of the PSII antenna function in diadinoxanthin cycle containing algae. Journal of Plant Physiology 163: 1008-1021 Gould SB, Sommer MS, Hadfi K, Zauner S, Kroth PG, Maier UG (2006) Protein targeting into the complex plastid of cryptophytes. Journal of Molecular Evolution 62: 674-681 Grabowski B, Cunningham FX, Gantt E (2001) Chlorophyll and carotenoid binding in a simple red algal light-harvesting complex crosses phylogenetic lines.  153 Proceedings of the National Academy of Sciences of the United States of America 98: 2911-2916 Green BR (2001) Was "molecular opportunism" a factor in the evolution of different photosynthetic light-harvesting pigment systems? Proceedings of the National Academy of Sciences of the United States of America 98: 2119-2121 Green BR, Durnford DG (1996) The chlorophyll-carotenoid proteins of oxygenic photosynthesis. Annual Review of Plant Physiology and Plant Molecular Biology 47: 685-714 Green BR, Kuhlbrandt W (1995) Sequence Conservation of Light-Harvesting and Stress-Response Proteins in Relation to the 3-Dimensional Molecular-Structure of LhcII. Photosynthesis Research 44: 139-148 Green BR, Parson WW (2003) Light-harvesting antennas in photosynthesis. Kluwer Academic, Boston Greene RM, Geider RJ, Falkowski PG (1991) Effect of Iron Limitation on Photosynthesis in a Marine Diatom. Limnology and Oceanography 36: 1772-1782 Greene RM, Geider RJ, Kolber Z, Falkowski PG (1992) Iron-Induced Changes in Light Harvesting and Photochemical Energy-Conversion Processes in Eukaryotic Marine-Algae. Plant Physiology 100: 565-575 Grimm B, Kloppstech K (1987) The Early Light-Inducible Proteins of Barley - Characterization of 2 Families of 2-H-Specific Nuclear-Coded Chloroplast Proteins. European Journal of Biochemistry 167: 493-499 Grossman A, Manodori A, Snyder D (1990) Light-Harvesting Proteins of Diatoms: Their Relationship to the Chlorophyll a/b Binding Proteins of Higher Plants and Their Mode of Transport into Plastids. Molecular & General Genetics 224: 91- 100 Grouneva I, Jakob T, Wilhelm C, Goss R (2008) A new multicomponent NPQ mechanism in the diatom Cyclotella meneghiniana. Plant and Cell Physiology 49: 1217-1225 Guglielmi G, Lavaud J, Rousseau B, Etienne AL, Houmard J, Ruban AV (2005) The light-harvesting antenna of the diatom Phaeodactylum tricornutum - Evidence for a diadinoxanthin-binding subcomplex. Febs Journal 272: 4339-4348  154 Guikema JA, Sherman LA (1983) Chlorophyll Protein Organization of Membranes from the Cyanobacterium Anacystis-Nidulans. Archives of Biochemistry and Biophysics 220: 155-166 Guikema JA, Sherman LA (1984) Influence of Iron Deprivation on the Membrane- Composition of Anacystis-Nidulans. Plant Physiology 74: 90-95 Gundermann K, Buchel C (2008) The fluorescence yield of the trimeric fucoxanthin- chlorophyll-protein FCPa in the diatom Cyclotella meneghiniana is dependent on the amount of bound diatoxanthin. Photosynthesis Research 95: 229-235 Haldrup A, Jensen PE, Lunde C, Scheller HV (2001) Balance of power: a view of the mechanism of photosynthetic state transitions. Trends in Plant Science 6: 301-305 Harari-Steinberg O, Ohad I, Chamovitz DA (2001) Dissection of the light signal transduction pathways regulating the two early light-induced protein genes in arabidopsis. Plant Physiology 127: 986-997 Harnett JP (1998) Isolation and characterization of photosystem I and the fucoxanthin- chlorophyll a/c proteins of the chromophyte alga Heterosigma carterae. In. University of British Columbia,, [Vancouver] Harris GP (1986) Phytoplankton ecology : structure, function, and fluctuation. Chapman and Hall, London ; New York Havaux M, Guedeney G, He QF, Grossman AR (2003) Elimination of high-light- inducible polypeptides related to eukaryotic chlorophyll a/b-binding proteins results in aberrant photoacclimation in Synechocystis PCC6803. Biochimica Et Biophysica Acta-Bioenergetics 1557: 21-33 Havaux M, Niyogi KK (1999) The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism. Proceedings of the National Academy of Sciences of the United States of America 96: 8762-8767 He QF, Dolganov N, Bjorkman O, Grossman AR (2001) The high light-inducible polypeptides in Synechocystis PCC6803 - Expression and function in high light. Journal of Biological Chemistry 276: 306-314 Heddad M, Adamska I (2000) Light stress-regulated two-helix proteins in Arabidopsis thaliana related to the chlorophyll a/b-binding gene family. Proceedings of the National Academy of Sciences of the United States of America 97: 3741-3746  155 Heddad M, Adamska I (2002) The evolution of light stress proteins in photosynthetic organisms. Comparative and Functional Genomics 3: 504-510 Heddad M, Noren H, Reiser V, Dunaeva M, Andersson B, Adamska I (2006) Differential expression and localization of early light-induced proteins in Arabidopsis. Plant Physiology 142: 75-87 Herrin DL, Plumley FG, Ikeuchi M, Michaels AS, Schmidt GW (1987) Chlorophyll Antenna Proteins of Photosystem I: Topology, Synthesis and Regulation of the 20-kDa Subunit of Chlamydomonas Light-Harvesting Complex of Photosystem I. Archives of Biochemistry and Biophysics 254: 397-408 Hiller RG, Crossley LG, Wrench PM, Santucci N, Hofmann E (2001) The 15-kDa forms of the apo-peridinin-chlorophyll a protein (PCP) in dinoflagellates show high identity with the apo-32 kDa PCP forms, and have similar N-terminal leaders and gene arrangements. Molecular Genetics and Genomics 266: 254-259 Hoek Cvd, Mann DG, Jahns HM (1995) Algae : an introduction to phycology. Cambridge University Press, Cambridge ; New York Horton P, Hague A (1988) Studies on the Induction of Chlorophyll Fluorescence in Isolated Barley Protoplasts .4. Resolution of Non-Photochemical Quenching. Biochimica Et Biophysica Acta 932: 107-115 Horton P, Johnson MP, Perez-Bueno ML, Kiss AZ, Ruban AV (2008) Photosynthetic acclimation: Does the dynamic structure and macro-organisation of photosystem II in higher plant grana membranes regulate light harvesting states? Febs Journal 275: 1069-1079 Horton P, Ruban AV, Walters RG (1996) Regulation of light harvesting in green plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 655-684 Horton P, Wentworth M, Ruban A (2005) Control of the light harvesting function of chloroplast membranes: The LHCII-aggregation model for non-photochemical quenching. Febs Letters 579: 4201-4206 Hudson RJM, Morel FMM (1990) Iron Transport in Marine-Phytoplankton - Kinetics of Cellular and Medium Coordination Reactions. Limnology and Oceanography 35: 1002-1020  156 Huner NPA, Oquist G, Sarhan F (1998) Energy balance and acclimation to light and cold. Trends in Plant Science 3: 224-230 Hutin C, Nussaume L, Moise N, Moya I, Kloppstech K, Havaux M (2003) Early light-induced proteins protect arabidopsis from photooxidative stress. Proceedings of the National Academy of Sciences of the United States of America 100: 4921- 4926 Hwang SB, Herrin DL (1994) Control of Lhc Gene-Transcription by the Circadian Clock in Chlamydomonas-Reinhardtii. Plant Molecular Biology 26: 557-569 Hwang YS, Jung G, Jin E (2008) Transcriptome analysis of acclimatory responses to thermal stress in Antarctic algae. Biochemical and Biophysical Research Communications 367: 635-641 Ihalainen JA, D'Haene S, Yeremenko N, van Roon H, Arteni AA, Boekema EJ, van Grondelle R, Matthijs HCP, Dekker JP (2005) Aggregates of the chlorophyll- binding protein IsiA (CP43 ') dissipate energy in cyanobacteria. Biochemistry 44: 10846-10853 Ikeda Y, Komura M, Watanabe M, Minami C, Koike H, Itoh S, Kashino Y, Satoh K (2008) Photosystem I complexes associated with fucoxanthin-chlorophyll-binding proteins from a marine centric diatom, Chaetoeeros graeilis. Biochimica Et Biophysica Acta-Bioenergetics 1777: 351-361 Im CS, Zhang ZD, Shrager J, Chang CW, Grossman AR (2003) Analysis of light and CO2 regulation in Chlamydomonas reinhardtii using genome-wide approaches. Photosynthesis Research 75: 111-125 Inda LA, Peleato ML (2002) Immunoquantification of flavodoxin and ferredoxin from Scenedesmus vacuolatus (Chlorophyta) as iron-stress molecular markers. European Journal of Phycology 37: 579-586 Ishida K (2005) Protein targeting into plastids: a key to understanding the symbiogenetic acquisitions of plastids. Journal of Plant Research 118: 237-245 Ishida K, Cavalier-Smith T, Green BR (2000) Endomembrane structure and the chloroplast protein targeting pathway in Heterosigma akashiwo (Raphidophyceae, Chromista). Journal of Phycology 36: 1135-1144  157 Ivanov AG, Krol M, Sveshnikov D, Selstam E, Sandstrom S, Koochek M, Park YI, Vasil'ev S, Bruce D, Oquist G, Huner NPA (2006) Iron deficiency in cyanobacteria causes monomerization of photosystem I trimers and reduces the capacity for state transitions and the effective absorption cross section of photosystem I in vivo. Plant Physiology 141: 1436-1445 Jakob T, Goss R, Wilhelm C (1999) Activation of diadinoxanthin de-epoxidase due to a chlororespiratory proton gradient in the dark in the diatom Phaeodactylum tricornutum. Plant Biology 1: 76-82 Jakob T, Goss R, Wilhelm C (2001) Unusual pH-dependence of diadinoxanthin de- epoxidase activation causes chlororespiratory induced accumulation of diatoxanthin in the diatom Phaeodactylum tricornutum. Journal of Plant Physiology 158: 383-390 Jansson S (1994) The Light-Harvesting Chlorophyll a/B Binding-Proteins. Biochimica Et Biophysica Acta-Bioenergetics 1184: 1-19 Jansson S (1999) A guide to the Lhc genes and their relatives in Arabidopsis. Trends in Plant Science 4: 236-240 Jansson S, Andersen B, Scheller HV (1996) Nearest-neighbor analysis of higher-plant photosystem I holocomplex. Plant Physiology 112: 409-420 Jansson S, Andersson J, Jung Kim S, Jackowski G (2000) An Arabidopsis thaliana protein homologous to cyanobacterial high-light-inducible proteins. Plant Molecular Biology 42: 345-351 Johnson KS, Gordon RM, Coale KH (1997) What controls dissolved iron concentrations in the world ocean? Marine Chemistry 57: 137-161 Kaul S, Koo HL, Jenkins J, Rizzo M, Rooney T, Tallon LJ, Ecker JR, et al. (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815 Kellmann JW, Merforth N, Wiese M, Pichersky E, Piechulla B (1993) Concerted Circadian Oscillations in Transcript Levels of 19 Lha/B (Cab) Genes in Lycopersicon-Esculentum (Tomato). Molecular & General Genetics 237: 439-448 Kim S, Pichersky E, Yocum CF (1994) Topological studies of spinach 22 kDa protein of photosystem-II. Biochimica Et Biophysica Acta-Bioenergetics 1188: 339-348  158 Kim S, Sandusky P, Bowlby NR, Aebersold R, Green BR, Vlahakis S, Yocum CF, Pichersky E (1992) Characterization of a spinach psbs cDNA-encoding the 22 kDa protein of photosystem-II. FEBS Letters 314: 67-71 Kiss AZ, Ruban AV, Horton P (2008) The PsbS protein controls the organization of the photosystem II antenna in higher plant thylakoid membranes. Journal of Biological Chemistry 283: 3972-3978 Kosakowska A, Lewandowska J, Ston J, Burkiewicz K (2004) Qualitative and quantitative composition of pigments in Phaeodactylum tricornutum (Bacillariophyceae) stressed by iron. Biometals 17: 45-52 Kouril R, Arteni AA, Lax J, Yeremenko N, D'Haene S, Rogner M, Matthijs HCP, Dekker JP, Boekema EJ (2005) Structure and functional role of supercomplexes of IsiA and Photosystem I in cyanobacterial photosynthesis. FEBS Letters 579: 3253-3257 Kovacs L, Damkjaer J, Kereiche S, Ilioaia C, Ruban AV, Boekema EJ, Jansson S, Horton P (2006) Lack of the light-harvesting complex CP24 affects the structure and function of the grana membranes of higher plant chloroplasts. Plant Cell 18: 3106-3120 Kozak M (1986) Point Mutations Define a Sequence Flanking the Aug Initiator Codon That Modulates Translation by Eukaryotic Ribosomes. Cell 44: 283-292 Kozak M (1987) An Analysis of 5'-Noncoding Sequences from 699 Vertebrate Messenger-Rnas. Nucleic Acids Research 15: 8125-8148 Koziol AG, Borza T, Ishida KI, Keeling P, Lee RW, Durnford DG (2007) Tracing the evolution of the light-harvesting antennae in chlorophyll a/b- containing organisms. Plant Physiology 143: 1802-1816 Kuhlbrandt W, Wang DN, Fujiyoshi Y (1994) Atomic Model of Plant Light- Harvesting Complex by Electron Crystallography. Nature 367: 614-621 LaRoche J, Boyd PW, McKay RML, Geider RJ (1996) Flavodoxin as an in situ marker for iron stress in phytoplankton. Nature 382: 802-805 Laudenbach DE, Reith ME, Straus NA (1988a) Isolation, Sequence-Analysis, and Transcriptional Studies of the Flavodoxin Gene from Anacystis-Nidulans R2. Journal of Bacteriology 170: 258-265  159 Lavaud J, Kroth PG (2006) In diatoms, the transthylakoid proton gradient regulates the photoprotective non-photochemical fluorescence quenching beyond its control on the xanthophyll cycle. Plant and Cell Physiology 47: 1010-1016 Lavaud J, Rousseau B, Etienne AL (2002b) In diatoms, a transthylakoid proton gradient alone is not sufficient to induce a non-photochemical fluorescence quenching. Febs Letters 523: 163-166 Lavaud J, Rousseau B, Etienne AL (2003) Enrichment of the light-harvesting complex in diadinoxanthin and implications for the nonphotochemical fluorescence quenching in diatoms. Biochemistry 42: 5802-5808 Lavaud J, Rousseau B, Etienne AL (2004) General features of photoprotection by energy dissipation in planktonic diatoms (Bacillariophyceae). Journal of Phycology 40: 130-137 Lavaud J, Rousseau B, van Gorkom HJ, Etienne AL (2002a) Influence of the diadinoxanthin pool size on photoprotection in the marine planktonic diatom Phaeodactylum tricornutum. Plant Physiology 129: 1398-1406 Lavaud J, Strzepek RF, Kroth PG (2007) Photoprotection capacity differs among diatoms: Possible consequences on the spatial distribution of diatoms related to fluctuations in the underwater light climate. Limnology and Oceanography 52: 1188-1194 Lavaud J, van Gorkom HJ, Etienne AL (2002c) Photosystem II electron transfer cycle and chlororespiration in planktonic diatoms. Photosynthesis Research 74: 51-59 Leblanc C, Falciatore A, Watanabe M, Bowler C (1999) Semi-quantitative RT-PCR analysis of photoregulated gene expression in marine diatoms. Plant Molecular Biology 40: 1031-1044 Leonhardt K, Straus NA (1992) An Iron Stress Operon Involved in Photosynthetic Electron-Transport in the Marine Cyanobacterium Synechococcus Sp Pcc-7002. Journal of General Microbiology 138: 1613-1621 Lepetit B, Volke D, Szabo M, Hoffmann R, Garab GZ, Wilhelm C, Goss R (2007) Spectroscopic and molecular characterization of the oligomeric antenna of the diatom Phaeodactylum tricornutum. Biochemistry 46: 9813-9822  160 Li X, Yakunin AF, McKay RML (2004) Fe-responsive accumulation of redox proteins ferredoxin and flavodoxin in a marine cryptomonad. European Journal of Phycology 39: 73-82 Li XP, Bjorkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK (2000) A pigment-binding protein essential for regulation of photosynthetic light harvesting. Nature 403: 391-395 Li XP, Gilmore AM, Caffarri S, Bassi R, Golan T, Kramer D, Niyogi KK (2004) Regulation of photosynthetic light harvesting involves intrathylakoid lumen pH sensing by the PsbS protein. Journal of Biological Chemistry 279: 22866-22874 Li XP, Muller-Moule P, Gilmore AM, Niyogi KK (2002b) PsbS-dependent enhancement of feedback de-excitation protects photosystem II from photoinhibition. Proceedings of the National Academy of Sciences of the United States of America 99: 15222-15227 Li XP, Phippard A, Pasari J, Niyogi KK (2002) Structure-function analysis of photosystem II subunit S (PsbS) in vivo. Functional Plant Biology 29: 1131-1139 Li XP, Phippard A, Pasari J, Niyogi KK (2002a) Structure-function analysis of photosystem II subunit S (PsbS) in vivo. Functional Plant Biology 29: 1131-1139 Liaud MF, Valentin C, Brandt U, Bouget FY, Kloareg B, Cerff R (1993) The GAPDH Gene System of the Red Alga Chondrus Crispus: Promotor Structures, Intron-Exon Organization, Genomic Complexity and Differential Expression of Genes. Plant Molecular Biology 23: 981-994 Lindahl M, Yang DH, Andersson B (1995) Regulatory Proteolysis of the Major Light- Harvesting Chlorophyll a/B Protein of Photosystem-Ii by a Light-Induced Membrane-Associated Enzymatic System. European Journal of Biochemistry 231: 503-509 Liu ZF, Yan HC, Wang KB, Kuang TY, Zhang JP, Gui LL, An XM, Chang WR (2004) Crystal structure of spinach major light-harvesting complex at 2.72 angstrom resolution. Nature 428: 287-292 Lohr M, Wilhelm C (1999) Algae displaying the diadinoxanthin cycle also possess the violaxanthin cycle. Proceedings of the National Academy of Sciences of the United States of America 96: 8784-8789  161 Long ZF, Wang SY, Nelson N (1989) Cloning and Nucleotide-Sequence Analysis of Genes-Coding for the Major Chlorophyll-Binding Protein of the Moss Physcomitrella-Patens and the Halotolerant Alga Dunaliella-Salina. Gene 76: 299-312 Lunde C, Jensen PE, Haldrup A, Knoetzel J, Scheller HV (2000) The PSI-H subunit of photosystem I is essential for state transitions in plant photosynthesis. Nature 408: 613-615 Maheswari U, Montsant A, Goll J, Krishnasamy S, Rajyashri KR, Patell VM, Bowler C (2005) The Diatom EST database. Nucleic Acids Research 33: D344- D347 Maldonado MT, Allen AE, Chong JS, Lin K, Leus D, Karpenko N, Harris SL (2006) Copper-dependent iron transport in coastal and oceanic diatoms. Limnology and Oceanography 51: 1729-1743 Maldonado MT, Price NM (1996) Influence of N substrate on Fe requirements of marine centric diatoms. Marine Ecology-Progress Series 141: 161-172 Marquardt J, Lutz B, Wans S, Rhiel E, Krumbein WE (2001) The gene family coding for the light-harvesting polypeptides of Photosystem I of the red alga Galdieria sulphuraria. Photosynthesis Research 68: 121-130 Marquardt J, Rhiel E (1997) The membrane-intrinsic light-harvesting complex of the red alga Galdieria sulphuraria (formerly Cyanidium caldarium): Biochemical and immunochemical characterization. Biochimica Et Biophysica Acta-Bioenergetics 1320: 153-164 Marquardt J, Wans S, Rhiel E, Randolf A, Krumbein WE (2000) Intron-exon structure and gene copy number of a gene encoding for a membrane-intrinsic light-harvesting polypeptide of the red alga Galdieria sulphuraria. Gene 255: 257- 265 Martin JH, Coale KH, Johnson KS, Fitzwater SE, Gordon RM, Tanner SJ, Hunter CN, Elrod VA, Nowicki JL, Coley TL, Barber RT, Lindley S, Watson AJ, Vanscoy K, Law CS, Liddicoat MI, Ling R, Stanton T, Stockel J, Collins C, Anderson A, Bidigare R, Ondrusek M, Latasa M, Millero FJ, Lee K, Yao W, Zhang JZ, Friederich G, Sakamoto C, Chavez F, Buck K, Kolber Z, Greene  162 R, Falkowski P, Chisholm SW, Hoge F, Swift R, Yungel J, Turner S, Nightingale P, Hatton A, Liss P, Tindale NW (1994) Testing the Iron Hypothesis in Ecosystems of the Equatorial Pacific-Ocean. Nature 371: 123-129 Martin JH, Fitzwater SE (1988b) Iron-Deficiency Limits Phytoplankton Growth in the Northeast Pacific Subarctic. Nature 331: 341-343 Martin JH, Gordon RM (1988a) Northeast Pacific Iron Distributions in Relation to Phytoplankton Productivity. Deep-Sea Research Part a-Oceanographic Research Papers 35: 177-196 Martin JH, Gordon RM, Fitzwater S, Broenkow WW (1989) Vertex - Phytoplankton Iron Studies in the Gulf of Alaska. Deep-Sea Research Part a-Oceanographic Research Papers 36: 649-& Martin JH, Gordon RM, Fitzwater SE (1990) Iron in Antarctic Waters. Nature 345: 156-158 Maxwell DP, Laudenbach DE, Huner NPA (1995) Redox Regulation of Light- Harvesting Complex-Ii and Cab Messenger-Rna Abundance in Dunaliella-Salina. Plant Physiology 109: 787-795 McFadden GI (1999) Plastids and protein targeting. Journal of Eukaryotic Microbiology 46: 339-346 McKay RML, Geider RJ, LaRoche J (1997) Physiological and biochemical response of the photosynthetic apparatus of two marine diatoms to Fe stress. Plant Physiology 114: 615-622 McKay RML, La Roche J, Yakunin AF, Durnford DG, Geider RJ (1999) Accumulation of ferredoxin and flavodoxin in a marine diatom in response to Fe. Journal of Phycology 35: 510-519 Melkozernov AN, Bibby TS, Lin S, Barber J, Blankenship RE (2003) Time-resolved absorption and emission show that the CP43 ' antenna ring of iron-stressed Synechocystis sp PCC6803 is efficiently coupled to the photosystem I reaction center core. Biochemistry 42: 3893-3903 Merchant SS, Allen MD, Kropat J, Moseley JL, Long JC, Tottey S, Terauchi AM (2006) Between a rock and a hard place: Trace element nutrition in  163 Chlamydomonas. Biochimica Et Biophysica Acta-Molecular Cell Research 1763: 578-594 Merchant SS, Prochnik SE, Vallon O, Harris EH, Karpowicz SJ, Witman GB, Terry A, Salamov A, Fritz-Laylin LK, Marechal-Drouard L, Marshall WF, Qu LH, Nelson DR, Sanderfoot AA, Spalding MH, Kapitonov VV, et, al (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science 318: 245-251 Mewes H, Richter M (2002) Supplementary ultraviolet-B radiation induces a rapid reversal of the diadinoxanthin cycle in the strong light-exposed diatom Phaeodactylum tricornutum. Plant Physiology 130: 1527-1535 Meyer G, Kloppstech K (1984) A Rapidly Light-Induced Chloroplast Protein with a High Turnover Coded for by Pea Nuclear-DNA. European Journal of Biochemistry 138: 201-207 Minagawa J, Han KC, Dohmae N, Takio K, Inoue Y (2001) Molecular characterization and gene expression of lhcb5 gene encoding CP26 in the light- harvesting complex II of Chlamydomonas reinhardtii. Plant Molecular Biology 46: 277-287 Mock T, Samanta MP, Iverson V, Berthiaume C, Robison M, Holtermann K, Durkin C, BonDurant SS, Richmond K, Rodesch M, Kallas T, Huttlin EL, Cerrina F, Sussmann MR, Armbrust EV (2008) Whole-genome expression profiling of the marine diatom Thalassiosira pseudonana identifies genes involved in silicon bioprocesses. Proceedings of the National Academy of Sciences of the United States of America 105: 1579-1584 Montane MH, Kloppstech K (2000) The family of light-harvesting-related proteins (LHCs, ELIPs, HLIPs): was the harvesting of light their primary function? Gene 258: 1-8 Montsant A, Jabbari K, Maheswari U, Bowler C (2005) Comparative genomics of the pennate diatom Phaeodactylum tricornutum. Plant Physiology 137: 500-513 Morales F, Abadia A, Abadia J (1991) Chlorophyll Fluorescence and Photon Yield of Oxygen Evolution in Iron-Deficient Sugar-Beet (Beta-Vulgaris L) Leaves. Plant Physiology 97: 886-893  164 Moreira D, Le Guyader H, Philippe H (2000) The origin of red algae and the evolution of chloroplasts. Nature 405: 69-72 Morel FMM, Price NM (2003) The biogeochemical cycles of trace metals in the oceans. Science 300: 944-947 Moseley JL, Allinger T, Herzog S, Hoerth P, Wehinger E, Merchant S, Hippler M (2002) Adaptation to Fe-deficiency requires remodeling of the photosynthetic apparatus. Embo Journal 21: 6709-6720 Moseley JL, Chang CW, Grossman AR (2006) Genome-based approaches to understanding phosphorus deprivation responses and PSR1 control in Chlamydomonas reinhardtii. Eukaryotic Cell 5: 26-44 Mozzo M, Passarini F, Bassi R, van Amerongen H, Croce R (2008) Photoprotection in higher plants: The putative quenching site is conserved in all outer light- harvesting complexes of Photosystem II. Biochimica Et Biophysica Acta- Bioenergetics 1777: 1263-1267 Muller P, Li XP, Niyogi KK (2001) Non-photochemical quenching. A response to excess light energy. Plant Physiology 125: 1558-1566 Naumann B, Busch A, Allmer J, Ostendorf E, Zeller M, Kirchhoff H, Hippler M (2007) Comparative quantitative proteomics to investigate the remodeling of bioenergetic pathways under iron deficiency in Chlamydomonas reinhardtii. Proteomics 7: 3964-3979 Naumann B, Stauber EJ, Busch A, Sommer F, Hippler M (2005) N-terminal processing of Lhca3 is a key step in remodeling of the photosystem I-light- harvesting complex under iron deficiency in Chlamydomonas reinhardtii. Journal of Biological Chemistry 280: 20431-20441 Nelson DM, Treguer P, Brzezinski MA, Leynaert A, Queguiner B (1995) Production and Dissolution of Biogenic Silica in the Ocean - Revised Global Estimates, Comparison with Regional Data and Relationship to Biogenic Sedimentation. Global Biogeochemical Cycles 9: 359-372 Niyogi KK (1999) Photoprotection revisited: Genetic and molecular approaches. Annual Review of Plant Physiology and Plant Molecular Biology 50: 333-359  165 Niyogi KK (2000) Safety valves for photosynthesis. Current Opinion in Plant Biology 3: 455-460 Niyogi KK, Bjorkman O, Grossman AR (1997a) Chlamydomonas xanthophyll cycle mutants identified by video imaging of chlorophyll fluorescence quenching. Plant Cell 9: 1369-1380 Niyogi KK, Bjorkman O, Grossman AR (1997b) The roles of specific xanthophylls in photoprotection. Proceedings of the National Academy of Sciences of the United States of America 94: 14162-14167 Niyogi KK, Grossman AR, Bjorkman O (1998) Arabidopsis mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. Plant Cell 10: 1121-1134 Niyogi KK, Li XP, Rosenberg V, Jung HS (2005) Is PsbS the site of non- photochemical quenching in photosynthesis? Journal of Experimental Botany 56: 375-382 Niyogi KK, Shih C, Chow WS, Pogson BJ, DellaPenna D, Bjorkman O (2001) Photoprotection in a zeaxanthin- and lutein-deficient double mutant of Arabidopsis. Photosynthesis Research 67: 139-145 Oeltjen A, Krumbein WE, Rhiel E (2002) Investigations on transcript sizes, steady state mRNA concentrations and diurnal expression of genes encoding fucoxanthin chlorophyll a/c light harvesting polypeptides in the centric diatom Cyclotella cryptica. Plant Biology 4: 250-257 Oeltjen A, Marquardt J, Rhiel E (2004) Differential circadian expression of genes fcp2 and fcp6 in Cyclotella cryptica. International Microbiology 7: 127-131 Olaizola M, Laroche J, Kolber Z, Falkowski PG (1994) Nonphotochemical Fluorescence Quenching and the Diadinoxanthin Cycle in a Marine Diatom. Photosynthesis Research 41: 357-370 Owens TG (1986) Light-Harvesting Function in the Diatom Phaeodactylum- Tricornutum .2. Distribution of Excitation-Energy between the Photosystems. Plant Physiology 80: 739-746 Palenik B, Brahamsha B, Larimer FW, Land M, Hauser L, Chain P, Lamerdin J, Regala W, Allen EE, McCarren J, Paulsen I, Dufresne A, Partensky F, Webb  166 EA, Waterbury J (2003) The genome of a motile marine Synechococcus. Nature 424: 1037-1042 Pascal AA, Liu ZF, Broess K, van Oort B, van Amerongen H, Wang C, Horton P, Robert B, Chang WR, Ruban A (2005) Molecular basis of photoprotection and control of photosynthetic light-harvesting. Nature 436: 134-137 Passaquet C, Thomas JC, Caron L, Hauswirth N, Puel F, Berkaloff C (1991) Light- Harvesting Complexes of Brown Algae Biochemical Characterization and Immunological Relationships. FEBS Letters 280: 21-26 Peers G, Price NM (2006) Copper-containing plastocyanin used for electron transport by an oceanic diatom. Nature 441: 341-344 Peers G, Quesnel SA, Price NM (2005) Copper requirements for iron acquisition and growth of coastal and oceanic diatoms. Limnology and Oceanography 50: 1149- 1158 Piechulla B (1993) Circadian Clock Directs the Expression of Plant Genes. Plant Molecular Biology 22: 533-542 Piechulla B (1999) Circadian expression of the light-harvesting complex protein genes in plants. Chronobiology International 16: 115-128 Plumley FG, Martinson TA, Herrin DL, Ikeuchi M, Schmidt GW (1993) Structural Relationships of the Photosystem I and Photosystem II Chlorophyll a/b and Chlorophyll a/c Light-Harvesting Apoproteins of Plants and Algae. Photochemistry and Photobiology 57: 143-151 Pogson BJ, Niyogi KK, Bjorkman O, DellaPenna D (1998) Altered xanthophyll compositions adversely affect chlorophyll accumulation and nonphotochemical quenching in Arabidopsis mutants. Proceedings of the National Academy of Sciences of the United States of America 95: 13324-13329 Potter E, Kloppstech K (1993) Effects of Light Stress on the Expression of Early Light- Inducible Proteins in Barley. European Journal of Biochemistry 214: 779-786 Price NM, Harrison GI, Hering JG, Hudson RJ, Nirel PMV, Palenik B, Morel FMM (1988/1989) Preparation and Chemistry of the Artificial Algal Culture Medium Aquil. Biological Oceanography 6: 443-462  167 Price NM, Morel FMM (1998) Biological cycling of iron in the ocean. Metal Ions in Biological Systems, Vol 35 35: 1-36 Pyszniak AM, Gibbs SP (1992) Immunocytochemical Localization of Photosystem-I and the Fucoxanthin-Chlorophyll-a/C Light-Harvesting Complex in the Diatom Phaeodactylum-Tricornutum. Protoplasma 166: 208-217 Raven JA (1990) Predictions of Mn and Fe Use Efficiencies of Phototrophic Growth as a Function of Light Availability for Growth and of C Assimilation Pathway. New Phytologist 116: 1-18 Raven JA, Evans MCW, Korb RE (1999) The role of trace metals in photosynthetic electron transport in O-2-evolving organisms. Photosynthesis Research 60: 111- 149 Richard C, Ouellet H, Guertin M (2000) Characterization of the LI818 polypeptide from the green unicellular alga Chlamydomonas reinhardtii. Plant Molecular Biology 42: 303-316 Rintamaki E, Salonen M, Suoranta UM, Carlberg I, Andersson B, Aro EM (1997) Phosphorylation of light-harvesting complex II and photosystem II core proteins shows different irradiance-dependent regulation in vivo - Application of phosphothreonine antibodies to analysis of thylakoid phosphoproteins. Journal of Biological Chemistry 272: 30476-30482 Ruban AV, Berera R, Ilioaia C, van Stokkum IHM, Kennis JTM, Pascal AA, van Amerongen H, Robert B, Horton P, van Grondelle R (2007) Identification of a mechanism of photoprotective energy dissipation in higher plants. Nature 450: 575-U522 Ruban AV, Horton P (1992) Mechanism of Delta-Ph-Dependent Dissipation of Absorbed Excitation-Energy by Photosynthetic Membranes .1. Spectroscopic Analysis of Isolated Light-Harvesting Complexes. Biochimica Et Biophysica Acta 1102: 30-38 Ruban AV, Horton P (1995) An Investigation of the Sustained Component of Nonphotochemical Quenching of Chlorophyll Fluorescence in Isolated- Chloroplasts and Leaves of Spinach. Plant Physiology 108: 721-726  168 Ruban AV, Lavaud J, Rousseau B, Guglielmi G, Horton P, Etienne AL (2004) The super-excess energy dissipation in diatom algae: comparative analysis with higher plants. Photosynthesis Research 82: 165-175 Ruban AV, Wentworth M, Yakushevska AE, Andersson J, Lee PJ, Keegstra W, Dekker JP, Boekema EJ, Jansson S, Horton P (2003) Plants lacking the main light-harvesting complex retain photosystem II macro-organization. Nature 421: 648-652 Ruban AV, Young AJ, Horton P (1993) Induction of Nonphotochemical Energy- Dissipation and Absorbency Changes in Leaves - Evidence for Changes in the State of the Light-Harvesting System of Photosystem-Ii in-Vivo. Plant Physiology 102: 741-750 Sandmann G, Reck H, Kessler E, Boger P (1983) Distribution of Plastocyanin and Soluble Plastidic Cytochrome c in Various Classes of Algae. Archives of Microbiology 134: 23-27 Sandona D, Croce R, Pagano A, Crimi M, Bassi R (1998) Higher plants light harvesting proteins. Structure and function as revealed by mutation analysis of either protein or chromophore moieties. Biochimica Et Biophysica Acta- Bioenergetics 1365: 207-214 Sandstrom S, Ivanov AG, Park YI, Oquist G, Gustafsson P (2002) Iron stress responses in the cyanobacterium Synechococcus sp PCC7942. Physiologia Plantarum 116: 255-263 Savard F, Richard C, Guertin M (1996) The Chlamydomonas reinhardtii LI818 gene represents a distant relative of the cabI/II genes that is regulated during the cell cycle and in response to illumination. Plant Molecular Biology 32: 461-473 Scala S, Bowler C (2001) Molecular insights into the novel aspects of diatom biology. Cellular and Molecular Life Sciences 58: 1666-1673 Schmid VHR, Cammarata KV, Bruns BU, Schmidt GW (1997) In vitro reconstitution of the photosystem I light-harvesting complex LHCI-730: Heterodimerization is required for antenna pigment organization. Proceedings of the National Academy of Sciences of the United States of America 94: 7667-7672  169 Schmid VHR, Paulsen H, Rupprecht J (2002) Identification of N- and C-terminal amino acids of Lhca1 and Lhca4 required for formation of the heterodimeric peripheral photosystem I antenna LHCI-730. Biochemistry 41: 9126-9131 Schreiber U, Endo T, Mi HL, Asada K (1995a) Quenching Analysis of Chlorophyll Fluorescence by the Saturation Pulse Method - Particular Aspects Relating to the Study of Eukaryotic Algae and Cyanobacteria. Plant and Cell Physiology 36: 873- 882 Schreiber U, Hormann H, Neubauer C, Klughammer C (1995b) Assessment of Photosystem II Photochemical Quantum Yield by Chlorophyll Fluorescence Quenching Analysis. Australian Journal of Plant Physiology 22: 209-220 Schumann A, Goss R, Jakob T, Wilhelm C (2007) Investigation of the quenching efficiency of diatoxanthin in cells of Phaeodactylum tricornutum (Bacillariophyceae) with different pool sizes of xanthophyll cycle pigments. Phycologia 46: 113-117 Shrager J, Hauser C, Chang CW, Harris EH, Davies J, McDermott J, Tamse R, Zhang ZD, Grossman AR (2003) Chlamydomonas reinhardtii genome project. A guide to the generation and use of the cDNA information. Plant Physiology 131: 401-408 Simpson DJ, von Wettstein D (1989) The Structure and Function of the Thylakoid Membrane. Carlsberg Research Communications 54: 55-65 Singh AK, Sherman LA (2007) Reflections on the function of IsiA, a cyanobacterial stress-inducible, Chl-binding protein. Photosynthesis Research 93: 17-25 Song XZ, Gibbs SP (1995) Photosystem I is not segregated from photosystem II in the green alga Tetraselmis subcordiformis - An immunogold and cytochemical study. Protoplasma 189: 267-280 Staehelin LA, Arntzen CJ, Anderson JM (1986) Photosynthesis III : photosynthetic membranes and light harvesting systems. Springer-Verlag, Berlin ; New York Standfuss R, van Scheltinga ACT, Lamborghini M, Kuhlbrandt W (2005) Mechanisms of photoprotection and nonphotochemical quenching in pea light- harvesting complex at 2.5A resolution. EMBO Journal 24: 919-928  170 Stauber EJ, Fink A, Markert C, Kruse O, Johanningmeier U, Hippler M (2003) Proteomics of Chlamydomonas reinhardtii light-harvesting proteins. Eukaryotic Cell 2: 978-994 Stryer L (1988) Biochemistry, Ed 3rd. W.H. Freeman, New York Strzepek RF, Harrison PJ (2004) Photosynthetic architecture differs in coastal and oceanic diatoms. Nature 431: 689-692 Sunda WG, Huntsman SA (1995) Iron Uptake and Growth Limitation in Oceanic and Coastal Phytoplankton. Marine Chemistry 50: 189-206 Sunda WG, Huntsman SA (1997) Interrelated influence of iron, light and cell size on marine phytoplankton growth. Nature 390: 389-392 Sunda WG, Swift DG, Huntsman SA (1991) Low Iron Requirement for Growth in Oceanic Phytoplankton. Nature 351: 55-57 Takahashi H, Iwai M, Takahashi Y, Minagawa J (2006) Identification of the mobile light-harvesting complex II polypeptides for state transitions in Chlamydomonas reinhardtii. Proceedings of the National Academy of Sciences of the United States of America 103: 477-482 Tan S, Cunningham FX, Gantt E (1997a) LhcaR1 of the red alga Porphyridium cruentum encodes a polypeptide of the LHCI complex with seven potential chlorophyll a-binding residues that are conserved in most LHCs. Plant Molecular Biology 33: 157-167 Tan S, Ducret A, Aebersold R, Gantt E (1997b) Red algal LHC I genes have similarities with both Chl a/b- and a/c-binding proteins: A 21 kDa polypeptide encoded by LhcaR2 is one of the six LHC I polypeptides. Photosynthesis Research 53: 129-140 Teardo E, de Laureto PP, Bergantino E, Dalla Vecchia F, Rigoni F, Szabo D, Giacometti GM (2007) Evidences for interaction of PsbS with photosynthetic complexes in maize thylakoids. Biochimica Et Biophysica Acta-Bioenergetics 1767: 703-711 Teramoto H, Itoh T, Ono T (2004) High-intensity-light-dependent and transient expression of new genes encoding distant relatives of light-harvesting  171 chlorophyll-a/b proteins in Chlamydomonas reinhardtii. Plant and Cell Physiology 45: 1221-1232 Teramoto H, Ono T, Minagawa J (2001) Identification of Lhcb gene family encoding the light-harvesting chlorophyll-a/b proteins of photosystem II in Chlamydomonas reinhardtii. Plant and Cell Physiology 42: 849-856 Ting CS, Owens TG (1993) Photochemical and Nonphotochemical Fluorescence Quenching Processes in the Diatom Phaeodactylum-Tricornutum. Plant Physiology 101: 1323-1330 Tognetti VB, Zurbriggen MD, Morandi EN, Fillat MF, Valle EM, Hajirezaei MR, Carrillo N (2007) Enhanced plant tolerance to iron starvation by functional substitution of chloroplast ferredoxin with a bacterial flavodoxin. Proceedings of the National Academy of Sciences of the United States of America 104: 11495- 11500 Trinklein ND, Aldred SF, Hartman SJ, Schroeder DI, Otillar RP, Myers RM (2004) An abundance of bidirectional promoters in the human genome. Genome Research 14: 62-66 Tsuda A, Takeda S, Saito H, Nishioka J, Nojiri Y, Kudo I, Kiyosawa H, Shiomoto A, Imai K, Ono T, Shimamoto A, Tsumune D, Yoshimura T, Aono T, Hinuma A, Kinugasa M, Suzuki K, Sohrin Y, Noiri Y, Tani H, Deguchi Y, Tsurushima N, Ogawa H, Fukami K, Kuma K, Saino T (2003) A mesoscale iron enrichment in the western Subarctic Pacific induces a large centric diatom bloom. Science 300: 958-961 Tzvetkova-Chevolleau T, Franck F, Alawady AE, Dall'Osto L, Carriere F, Bassi R, Grimm B, Nussaume L, Havaux M (2007) The light stress-induced protein ELIP2 is a regulator of chlorophyll synthesis in Arabidopsis thaliana. Plant Journal 50: 795-809 van Leeuwe MA, Stefels J (1998) Effects of iron and light stress on the biochemical composition of Antarctic Phaeocystis sp. (Prymnesiophyceae). II. Pigment composition. Journal of Phycology 34: 496-503  172 Varsano T, Kaftan D, Pick U (2003) Effects of iron deficiency on thylakoid membrane structure and composition in the alga Dunaliella salina. Journal of Plant Nutrition 26: 2197-2210 Varsano T, Wolf SG, Pick U (2006) A chlorophyll a/b-binding protein homolog that is induced by iron deficiency is associated with enlarged photosystem I units in the eucaryotic alga Dunaliella salina. Journal of Biological Chemistry 281: 10305- 10315 Vassiliev IR, Kolber Z, Wyman KD, Mauzerall D, Shukla VK, Falkowski PG (1995) Effects of Iron Limitation on Photosystem II Composition and Light Utilization in Dunaliella tertiolecta. Plant Physiology 109: 963-972 Veith T, Brauns J, Weisheit W, Mittag M, Buchel C (2009) Identification of a specific fucoxanthin-chlorophyll protein in the light harvesting complex of photosystem I in the diatom Cyclotella meneghiniana. Biochim Biophys Acta 1787: 905-912 Veith T, Buchel C (2007) The monomeric photosystem I-complex of the diatom Phaeodactylum tricornutum binds specific fucoxanthin chlorophyll proteins (FCPs) as light-harvesting complexes. Biochimica Et Biophysica Acta- Bioenergetics 1767: 1428-1435 Verhoeven AS, Adams WW, Demmig-Adams B (1998) Two forms of sustained xanthophyll cycle-dependent energy dissipation in overwintering Euonymus kiautschovicus. Plant Cell and Environment 21: 893-903 Walters RG, Horton P (1994) Acclimation of Arabidopsis-Thaliana to the Light Environment - Changes in Composition of the Photosynthetic Apparatus. Planta 195: 248-256 Wang Q, Jantaro S, Lu BS, Majeed W, Bailey M, He QF (2008) The high light- inducible polypeptides stabilize trimeric photosystem I complex under high light conditions in Synechocystis PCC 6803. Plant Physiology 147: 1239-1250 Wei L, Cao Y, Bai LH, Liang X, Deng TT, Li J, Qiao DR (2007) Cloning and expression of a gene coding for the major light-harvesting chlorophyll a/b protein of photosystem II in the green alga Dunaliella salina. Journal of Applied Phycology 19: 89-94  173 Wei L, Cao Y, Liang X, Liu Y, Deng TT, Bai LH, Qiao DR (2006) Identification of two genes encoding the major light-harvesting chlorophyll a/b proteins of photosystem II in green alga Dunaliella salina. DNA Sequence 17: 370-377 Westermann M, Rhiel E (2005) Localisation of fucoxanthin chlorophyll a/c-binding polypeptides of the centric diatom Cyclotella cryptica by immuno-electron microscopy. Protoplasma 225: 217-223 Wilhelm C, Buchel C, Fisahn J, Goss R, Jakob T, LaRoche J, Lavaud J, Lohr M, Riebesell U, Stehfest K, Valentin K, Kroth PG (2006) The regulation of carbon and nutrient assimilation in diatoms is significantly different from green algae. Protist 157: 91-124 Williams EJB, Bowles DJ (2004) Coexpression of neighboring genes in the genome of Arabidopsis thaliana. Genome Research 14: 1060-1067 Wolfe GR, Cunningham FX, Durnford D, Green BR, Gantt E (1994) Evidence for a Common Origin of Chloroplasts with Light-Harvesting Complexes of Different Pigmentation. Nature 367: 566-568 Xu H, Vavilin D, Funk C, Vermaas W (2004) Multiple deletions of small cab-like proteins in the cyanobacterium Synechocystis sp PCC 6803 - Consequences for pigment biosynthesis and accumulation. Journal of Biological Chemistry 279: 27971-27979 Yakushevska AE, Keegstra W, Boekema EJ, Dekker JP, Andersson J, Jansson S, Ruban AV, Horton P (2003) The structure of photosystem II in Arabidopsis: Localization of the CP26 and CP29 antenna complexes. Biochemistry 42: 608- 613 Yamano T, Miura K, Fukuzawa H (2008) Expression analysis of genes associated with the induction of the carbon-concentrating mechanism in Chlamydomonas reinhardtii. Plant Physiology 147: 340-354 Zapata M, Rodriguez F, Garrido JL (2000) Separation of chlorophylls and carotenoids from marine phytoplankton: a new HPLC method using a reversed phase C-8 column and pyridine-containing mobile phases. Marine Ecology-Progress Series 195: 29-45  174 Zarter CR, Adams WW, Ebbert V, Adamska I, Jansson S, Demmig-Adams B (2006a) Winter acclimation of PsbS and related proteins in the evergreen Arctostaphylos uva-ursi as influenced by altitude and light environment. Plant Cell and Environment 29: 869-878 Zarter CR, Adams WW, Ebbert V, Cuthbertson DJ, Adamska I, Demmig-Adams B (2006b) Winter down-regulation of intrinsic photosynthetic capacity coupled with up-regulation of Elip-like proteins and persistent energy dissipation in a subalpine forest. New Phytologist 172: 272-282 Zarter CR, Demmig-Adams B, Ebbert V, Adamska I, Adams WW (2006c) Photosynthetic capacity and light harvesting efficiency during the winter-to- spring transition in subalpine conifers. New Phytologist 172: 283-292 Zhang YJ, Cremer PS (2006) Interactions between macromolecules and ions: the Hofmeister series. Current Opinion in Chemical Biology 10: 658-663 Zhang ZD, Shrager J, Jain M, Chang CW, Vallon O, Grossman AR (2004) Insights into the survival of Chlamydomonas reinhardtii during sulfur starvation based on microarray analysis of gene expression. Eukaryotic Cell 3: 1331-1348          

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0067305/manifest

Comment

Related Items