Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of Annexin II as a carbohydrate associated novel mediator of airway epithelial would repair Patchell, Benjamin John 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_fall_patchell_benjamin.pdf [ 6.97MB ]
Metadata
JSON: 24-1.0067272.json
JSON-LD: 24-1.0067272-ld.json
RDF/XML (Pretty): 24-1.0067272-rdf.xml
RDF/JSON: 24-1.0067272-rdf.json
Turtle: 24-1.0067272-turtle.txt
N-Triples: 24-1.0067272-rdf-ntriples.txt
Original Record: 24-1.0067272-source.json
Full Text
24-1.0067272-fulltext.txt
Citation
24-1.0067272.ris

Full Text

Identification of Annexin II as a Carbohydrate Associated Novel Mediator of Airway Epithelial Wound Repair by Benjamin John Patchell B.Sc. The University of Victoria, 2002  A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in The Faculty of Graduate Studies (Experimental Medicine)  The University of British Columbia (Vancouver) April 2009 © Benjamin John Patchell, 2009  Abstract Epithelial cells line the conducting airways of the lung and act as a protective barrier to the daily challenges such as viral particles, pollutants and allergens. As a result, the epithelium is routinely damaged which is followed by rapid and effective repair. This highlights the importance of understanding the mechanisms involved in normal airway epithelial repair such that diseases like asthma can be better understood. Our laboratory has highlighted the role of carbohydrates structural modification as essential in mediating epithelial repair. The identity of the functional carbohydrate structures and their associated protein(s) remain unknown. The principal goals of my research were to take a glycomics based approach to identify mediators of airway epithelial repair. This work is broken down into three sections where we (1) investigated the identity of the Cicer arietinum agglutinin (CPA) associated protein ligand, (2) investigated the identity of the Allomyrina dichotoma agglutinin (AlloA) associated protein ligand on the surface of airway epithelial cells, and (3) began to characterize their potential role in airway epithelial wound repair. We have identified two novel carbohydrate epitopes using the lectins CPA and AlloA and their associated proteins as candidates that participate in airway epithelial wound repair. Using CPA to precipitate lectin associated protein(s), Annexin II (AII) was isolated and enriched when precipitated from wounded monolayers of airway epithelial cells. The expression of AII and its presentation on the surface of epithelial cells closely resembled our initial cell surface CPA staining. Simultaneous work identified fetuin as an AlloA associated protein. Fetuin is a serum glycoprotein previously shown to bind AII on the surface of epithelial cells. Our subsequent work ii  focused on the role of AII, specifically cell surface AII, in this process. As a receptor for tenascin-C, we followed wound repair activation following AII/tenascin-C binding in our model of repair. We found that AII facilitated tenascin-C binding which stimulated epithelial cell wound closure rates. This study is the first to identify AII as a mediator of epithelial wound repair and identify the potential role of cell surface AII as a receptor for tenascin-C binding.  iii  Table of Contents Abstract.......................................................................................................................ii Table of Contents .......................................................................................................iv List of Tables .............................................................................................................ix List of Figures .............................................................................................................x Abbreviations ...........................................................................................................xiii Acknowledgements .................................................................................................xvii Dedication ..............................................................................................................xviii Co-authorship Statement...........................................................................................xix CHAPTER 1 - INTRODUCTION ................................................................................1 1.1 THE AIRWAY EPITHELIUM.......................................................................................1 1.1.1 The Structure of the Airways..................................................................................1 1.1.2 The Function of the Airway Epithelium..................................................................5  1.2 ASTHMA .................................................................................................................6 1.2.1 Incidence and Epidemiology ..................................................................................6 1.2.2 Pathology and Pathophysiology of Asthma.............................................................6 1.2.3 Clinical Subtypes of Asthma ..................................................................................7 1.2.4 Airway Remodelling and the Epithelium in Asthma .............................................10  1.3 AIRWAY EPITHELIAL WOUND REPAIR ...................................................................15 1.3.1 Cellular Events in Airway Epithelial Wound Repair .............................................15 1.3.2 Molecular Events During Epithelial Wound Repair ..............................................18  1.4 GLYCOMICS ..........................................................................................................25 iv  1.4.1 Protein Glycosylation...........................................................................................25 1.4.2 Glycosylation and Protein Regulation...................................................................27 1.4.3 Lectins as a Tool in Glycobiology ........................................................................29  1.5 ANNEXINS ............................................................................................................30 1.5.1 The Annexin Family of Proteins...........................................................................30 1.5.2 Annexin II............................................................................................................34 1.5.3 Regulation of Annexin II......................................................................................38 1.5.4 Cell Surface Annexin II........................................................................................42  1.6 EXTRACELLULAR MATRIX AND WOUND REPAIR....................................................43 1.6.1 Reticular Basement Membrane and Extracellular Matrix ......................................43 1.6.2 Tenascin-C...........................................................................................................46 1.6.3 Matricellular Protein Signalling............................................................................51  1.7 RATIONALE, HYPOTHESES AND SPECIFIC AIMS ......................................................53 Hypothesis....................................................................................................................53  REFERENCES ..............................................................................................................57 CHAPTER 2 - IDENTIFICATION OF ANNEXIN II AS A CICER ARIETINUM AGGLUTININ SPECIFIC MEDIATOR OF WOUND REPAIR .............................87 2.1 INTRODUCTION .....................................................................................................87 2.2 MATERIALS AND METHODS...................................................................................90 2.2.1 Cell Culture .........................................................................................................90 2.2.2 Monolayer Wound Creation and Lectin Cytochemistry.........................................90 2.2.3 Monolayer Wound Repair Assay..........................................................................91 2.2.4 Lectin Precipitation Assay....................................................................................91 2.2.5 Protein Purification and Sequencing .....................................................................92  v  2.2.6 Annexin II Biotinylation and Detection ................................................................94 2.2.7 Annexin II Elution with EGTA ............................................................................94 2.2.8 Annexin II Immuno-staining ................................................................................94 2.2.9 Statistics ..............................................................................................................96  2.3 RESULTS...............................................................................................................97 2.3.1 Lectin Staining of Wounded Airway Epithelial Cell Monolayers. .........................97 2.3.2 The Effect of CPA on Wounded Airway Epithelial Monolayer Repair................102 2.3.3 The Purification of CPA Specific Glycoprotein Ligands. .................................... 105 2.3.4 Annexin II Expression and Recovery with CPA. ................................................ 107 2.3.5 Cell Surface Presentation of Annexin II.............................................................. 110 2.3.6 The Inhibition of Glycosylation..........................................................................116  2.4 DISCUSSION ........................................................................................................ 118 REFERENCES ............................................................................................................ 124 CHAPTER 3 - IDENTIFICATION OF A CANDIDATE SERUM GLYCOPROTEIN LIGAND FOR CELL SURFACE ANNEXIN II USING ALLOMYRINA DICHOTOMA AGGLUTININ........................................................ 131 3.1 INTRODUCTION ................................................................................................... 131 3.2 MATERIALS AND METHODS................................................................................. 135 3.2.1 Cell Culture .......................................................................................................135 3.2.2 Monolayer Wound Creation and Lectin Cytochemistry.......................................135 3.2.3 Monolayer Wound Repair Assays ......................................................................136 3.2.3 Lectin Precipitation Assay..................................................................................136 3.2.4 Protein Purification and Sequencing ...................................................................138 3.2.5 Statistics ............................................................................................................139  vi  3.3 RESULTS............................................................................................................. 140 3.3.1 Lectin Staining of Wounded Airway Epithelial Cell Monolayers. .......................140 3.3.2 Effect of AlloA on Wounded Airway Epithelial Monolayer Repair.....................142 3.3.3 Purification of AlloA Specific Glycoproteins .....................................................146 3.3.4 Effect of Serum Glycoproteins on Wound Closure .............................................148  3.4 DISCUSSION ........................................................................................................ 150 REFERENCES ............................................................................................................ 155 CHAPTER 4 - INTERACTION OF CELL SURFACE ANNEXIN II AND TENASCIN-C AUGMENTS AIRWAY EPITHELIAL WOUND REPAIR. ......... 161 4.1 INTRODUCTION ................................................................................................... 161 4.2 MATERIALS AND METHODS................................................................................. 165 4.2.1 Cell Culture .......................................................................................................165 4.2.2 Gene silencing ...................................................................................................165 4.2.3 Western Blot Analysis of Protein Expression and Phosphorylation ..................... 166 4.2.4 Wound Repair Assay Following Gene Silencing ................................................ 166 4.2.5 Immunofluorescence and Confocal Microscopy .................................................167 4.2.6 Tenascin-C Stimulation of Airway Epithelial Wound Closure ............................168 4.2.7 Tenascin-C Exposure to Wounded Monolayers Following Gene Silencing .........168 4.2.8 Statistics ............................................................................................................169  4.3 RESULTS............................................................................................................. 170 4.3.1 Gene Silencing Optimization and Wound Closure Assays .................................. 170 4.3.2 Tenascin-C Confocal Microscopy ......................................................................176 4.3.3 Effect of Tenascin-C on Airway Epithelial Cell Wound Closure Rates ...............178  4.4 DISCUSSION ........................................................................................................ 182 vii  REFERENCES ............................................................................................................ 190 CHAPTER 5 - CONCLUSIONS AND FUTURE DIRECTIONS ........................... 202 REFERENCES ............................................................................................................ 209 APPENDIX – LIST OF PUBLICATIONS............................................................... 213  viii  List of Tables Table 1.1 - Clinical Sub-types of asthma based on severity....................................10 Table 1.2 - Proteins that interact with vertebrate annexins......................................33  ix  List of Figures Figure 1.1 - Lower respiratory tract system......................................................................3 Figure 1.2 -Histologic section of intrapulmonary bronchus of a normal airway. .............13 Figure 1.3 - The ultrastructure of a severe asthmatic airway...........................................14 Figure 1.4 - Proposed model of epithelial repair.............................................................16 Figure 1.5 - Early and late response following epithelial injury...................................... 18 Figure 1.6 -Focal Adhesion Complex ............................................................................20 Figure 1.7 - The domain structure of SHP-2 protein.......................................................23 Figure 1.8 - Schematic of eukaryotic cell protein glycosylation.. ...................................26 Figure 1.9 - Lectins cluster glycoproteins for apical sorting.. .........................................28 Figure 1.10 - Domain structures of representative annexin proteins. .............................. 31 Figure 1.11 - The functional domains of Annexin II. .....................................................34 Figure 1.12 -The 3D ribbon structure of Annexin II heterotetramaer (AIIt)....................36 Figure 1.13 - The structure of Src kinase.. .....................................................................40 Figure 1.14 - An illustration of the structure of tenascin................................................. 46 Figure 1.15 -The domain structure of tenascin-C. ..........................................................49 Figure 1.16 -EGFR signalling pathway. .........................................................................50 Figure 2.1- Cicer arietinum agglutinin (CPA) binding to the surface of 1HAEo- cell monolayers....................................................................................................................99 Figure 2.2 - Vicia villosa agglutinin (VVA) binding to the surface of 1HAEo- cell monolayers.................................................................................................................. 100 Figure 2.3 – Negative control staining of the surface of 1HAEo- cell monolayers........ 101 x  Figure 2.4 - Wound closure of 1HAEo- monolayers in the presence of CPA................ 104 Figure 2.5 - Lectin precipitation profiles of 1HAEo- monolayer protein extracts.. ....... 106 Figure 2.6 - AII expression in mechanically wounded monolayers of 1HAEo- cells. ... 108 Figure 2.7 - CPA precipitation profiles of wounded 1HAEo- monolayers protein extracts collected serially.......................................................................................................... 109 Figure 2.8 - Membrane protein biotinylation of AII on the surface of wounded 1HAEomonolayers.................................................................................................................. 112 Figure 2.9 - Immunofluorescent detection of cell surface AII on 1HAEo- cells............ 113 Figure 2.10 - Immunohistochemical detection of cell surface AII on primary airway epithelial cells. ............................................................................................................ 114 Figure 2.11 - AII recovery following tunicamycin treatments. ..................................... 115 Figure 2.12 - Annexin II and CPA double staining of mechanically wounded 1HAEomonolayers.................................................................................................................. 117 Figure 3.1 - AlloA and GSα-1 lectin binding on the surface of 1HAEo- monolayers. .. 141 Figure 3.2 - Representative phase-contrast images of wounded 1HAEo- and wound closure inhibition caused by AlloA at the indicated times. ........................................... 144 Figure 3.3 - Closure of 1HAEo- wounds in the presence of lectins. ............................. 145 Figure 3.4 - Lectin precipitation profiles of 1HAEo- monolayers protein extracts. ....... 147 Figure 3.5 - Wound closure stimulation by serum glycoproteins. ................................. 149 Figure 4.1 -Gene silencing (siRNA) optimization of 1HAEo- cells. ............................. 172 Figure 4.2 - Following gene silencing, AII protein expression is significantly decreased. .................................................................................................................................... 173 Figure 4.3 -Wound closure of 1HAEo- cells following AII siRNA at 24 h. .................. 174 xi  Figure 4.4 -Silencing of p11 and wound closure rates following siRNA knockdown in 1HAEo- cells. .............................................................................................................. 175 Figure 4.5 –Tenascin-C staining of mechanically wounded 1HAEo- cells. .................. 177 Figure 4.6 -Wound closure of 1HAEo- cells following Tenascin-C (TN-C) stimulation at 24 h. Cells were grown to confluence and small circular wounds were created.. .......... 180 Figure 4.7 - Exogenous tenascin-C (TN-C) does not stimulate wound closure rates following AII or p11 siRNA.. ...................................................................................... 181  xii  Abbreviations 1HAEo-  Human Airway Epithelial Cell Line  ABC  Avidin-biotin complex  ADAM33  A Disintegrin And Metalloprotease 33  AEC  Airway Epithelial Cell  AHR  Airway Hyperresponsiveness  AII  Annexin II  AIId  Annexin II heterodimer  AIIt  Annexin II heterotetramer  AlloA  Allomyrina dichotoma agglutinin  Anxa  Annexin  APAAP  Alkaline Phosphatase-Anti-Alkaline Phosphatase  ASGPR  Asialo glycoprotein receptor  Asn  Asparagine  ATS  American Thoracic Society  BAL  Bronchoalveolar lavage  BSA  Bovine serum albumin  C-SH2  C-terminal SH2 domain  Ca2+  Calcium  CD44  Cluster of differentiation 44  Cdc42  Cell division cycle 42  CDK  Cyclin-dependent kinases  CHCA  α-Cyano-4-hydroxycinnamic acid  Cl-  Chlorine  CPA  Cicer arietinum agglutinin/ Chick pea agglutinin  cPLA2  Cytoplasmic phospholipase A2 xiii  CRHSP-28  Calcium-Responsive Heat Stable Protein 28  Ctl  Control  DAB  Diaminobenzoic Acid  DMEM  Dulbecco's Modified Essential Medium  DMSO  Dimethyl sulfoxide  DNA  Deoxyribonucleic acid  DNMT1  DNA (cytosine-5-)-methyltransferase 1  ECL  Enhanced chemiluminescence  ECM  Extracellular Matrix  EGF  Epidermal growth factor  EGFR  Epidermal growth factor receptor  EGTA  Ethylene Glycol Tetra acetic Acid  ER  Endoplasmic Reticulum  F-actin  Filamentous actin  FAK  Focal Adhesion Kinase  FBS  Fetal Bovine Serum  FEV1  Forced expiratory volume in 1 second  FITC  Fluorescein isothiocyanate  FN  Fibronectin  FNIII  Fibronectin type III domain  g  gravity  GalNac  N-acetylgalactosamine  GlcNac  N-acetylglucosamine  GPI  Glycosylphosphatidylinositol  GSα-1  Griffonia simplicifolia agglutinin 1  GTP  Guanosine Triphosphate  GTPases  Guanosine Triphosphate Hydrolases  h  Hour (s)  HBS  HEPES Buffered Saline  HEPES  4 (2-hydroxyethyl)-1-piperazineethanesulfonic acid xiv  HRP  Horseradish Peroxidase  ILK  Integrin Linked Kinase  kDa  Kilodalton  MALDI  Matrix Assisted Laser Desorption Ionization  MMP  Matrix Metalloprotease  mRNA  Messenger Ribonucleic acid  N-SH2  N-terminal SH2 domain  Na+  Sodium  Na3VO4  Sodium Vanadate  NaCl  Sodium Chloride  Na-DOC  Sodium Deoxycholate  NEDD4  Neural precursor cell expressed, developmentally down-regulated 4  NP-40  Nonidet P-40  p11  Annexin II light chain/ S100A10  PAGE  Poly Acrylamide Gel Electrophoresis  PAR  Protease-activated receptor  PBS  Phosphate Buffered Saline  PDCD6  Programmed cell death 6  PDGFR  Platelet-derived growth factor receptor  PFA  Paraformaldehyde  PGE2  Prostaglandin E2  PKC  Protein Kinase C  PLA2  Phospholipase A2  PMSF  Phenylmethanesulphonylfluoride  PTP  Protein tyrosine phosphatase  Rac  Ras-related C3 botulinum toxin substrate  RGD  Arginine – Glycine - Aspartic acid  Rho  Ras homolog gene family  RSV  Rous Sarcoma Virus  RTK  Receptor Tyrosine Kinase xv  SDS  Sodium Dodecyl Sulphate  Ser  Serine  SH  Src Homology  SH2  Src Homology 2 domain  SHP2  SH2 domain containing phosphatase 2  siRNA  Short interfering RNA  SNP  Single nucleotide polymorphism  Src  Sarcoma kinase  TFA  Trifluoroacetic acid  TGF-B  Transforming Growth Factor B  Thr  Threonine  TOF  Time Of Flight  t-PA  Tissue specific plasminogen activator  TSP-1  Thrombospondin-1  Tyr  Tyrosine  UDP  Uridine diphosphate  VVA  Vicia villosa agglutinin  WAVE  WASP-family verprolin-homologous protein  WASP  Wiskott-Aldrich syndrome protein  WGA  Wheat Germ Agglutinin  xvi  Acknowledgements The work outlined in this dissertation would not have been possible without the guidance of my mentor, Dr. Delbert Dorscheid. You have created an amazing work environment that is a perfect balance of leadership and independent research. I have always appreciated the time you took to discuss ideas and keep me focused on the important tasks. Your passion and positive attitude were inspiring and something that I will take with me in my future aspirations. A tremendous thank you goes to all or my advisory committee members, Drs. Tony Bai, Vince Duronio and Rick Hegele. I thank you all for the mentorship and guidance I have received throughout my studies. Your experience and knowledge were incredibly valuable and kept me on track. I am very grateful to Drs. Gurpeet Singhera, Sima Allahverdian, Ruth MacRedmond and Sam Wadsworth for their assistance in experimental design, management and manuscript review. None of this work would have been possible without the generous personal support of the funding agencies, the Canadian Institutes for Health Research and the Michael Smith Foundation for Health Research. Finally, thank you to all of the undergraduate students who worked with me over the years.  xvii  Dedication  This dissertation is dedicated to my loving family, my closest friends and to my amazing wife Sydney. I could not have done it without you all. Thank you for everything.  xviii  Co-authorship Statement Chapter II Chapter II is a modified version of a paper published in The American Journal of Physiology – Lung Cellular and Molecular Physiology [Patchell BJ, Wojcik KR, Yang TL, White SR,  Dorscheid DR. “Glycosylation and Annexin II cell surface translocation mediate airway epithelial wound repair.”Am J Physiol Lung Cell Mol Physiol. 2007 May 18]. This manuscript is the result of contributions of ideas and initial project development by Delbert Dorscheid, Kimberly Wojcik, Steve White and myself. I was responsible for the experimental data generation and analysis for all of the figures as they are presented. I assembled the data and wrote the manuscript. Ting-Lin Yang, a summer student, aided in performing the experiments for Figures 2.6 and 2.7.  Chapter III Chapter III is a modified version of a paper published in The Journal of Clinical and Experimental Allergy [Patchell BJ, Dorscheid DR. “Repair of the injury to respiratory  epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins.” Clin Exp Allergy. 2006 May; 3 (5):585-93]. This manuscript is the result of contributions of ideas and initial project development by Delbert Dorscheid and myself. Delbert Dorscheid performed the experiments for Figure 3.1 and I was responsible for generating the remaining figures, data analysis and manuscript preparation.  Chapter IV Chapter IV in its current form is a version of a manuscript in preparation for submission. This manuscript is the result of contributions of ideas and initial project development by Delbert  xix  Dorscheid and myself. I was responsible for generating the data, data analysis and manuscript preparation.  xx  Chapter 1 - Introduction 1.1 The Airway Epithelium 1.1.1 The Structure of the Airways The respiratory system consists of two anatomical portions: the conducting airways and the distal respiratory regions. The distal regions of the lung are the sites of gas exchange and the more proximal conducting airways are areas where no gas exchange occurs. By definition the airways consist of the nose, pharynx, larynx and trachea, bronchi and some types of bronchioles. The trachea branches into two main stem bronchi followed by airways of progressively smaller diameter. The most distal airways are the terminal bronchioles which in humans are separated from the alveolar ducts by respiratory bronchioles (Figure 1.1). The bronchial wall is composed of four major components: the mucosa, submucosa, muscularis and adventitia. The mucosa consists of the epithelial cells that line the airway lumen, the underlying basement membrane and the lamina propria. The submucosa is composed primarily of a network of elastic fibres. The muscularis is the layer of circular smooth muscle cells that are observed proximal to the cartilaginous plates in large airways. Finally, the adventitia is the outermost layer of the airway wall and includes fibrous connective tissue and cartilage. Changes such as a decrease in the thickness of the respiratory epithelial cell layer, the number of submucosal glands, cartilaginous plates and basal cells are observed between proximal and distal airways of the bronchial tree. 1  The bronchial epithelium is a pseudostratified (i.e., all cells are attached to the underlying matrix but not all cells reach the airway lumen) epithelial structure that consists of a variety of cells, each with specific functions. The luminal surface of the airway is primarily made up of ciliated columnar epithelial cells. These cells are attached to the basal lamina and extend to the airway lumen. Their primary function is clearance of inhaled foreign materials through the action of their cilia. Studies in primates have shown that ciliated cells are highly susceptible to injury from inhaled irritants (1, 2).  2  Figure 1.1 - Lower respiratory tract system. Airway branching in human lung by regularized dichotomy from trachea (generation Z=0) to alveolar ducts and sacs (generations 20 to 23). The first 16 generations are purely conducting; transitional airways lead into the respiratory zone made of alveoli. Image re-printed with permission from Fishman AP. Fishman’s Pulmonary Disease and Disorders. McGraw-Hill; 1998 (3). 3  Airways also contain secretory cells which include goblet (mucus) cells and Clara cells. Goblet cells are characterized by their acidic-mucin granules and are responsible for the production of airway mucus. The secretion of airway mucus is a primary defence mechanism to trap and remove foreign particles. Clara cells are present in both the bronchial and bronchiolar airway. They are characterized by their electron-dense granules as visualized by electron microscopy. These granules are believed to consist of bronchiolar surfactant. The specific role of Clara cells is unknown, however, studies have suggested that these cells have the capacity to metabolize lipophilic compounds through cytochrome P450-mediated oxidation (4). More recent evidence suggests that Clara cells play an important stem cell role, serving as a progenitor cell for the ciliated epithelial cells of the airway (5). Basal cells are the small flattened cells attached to the basal lamina. The number of basal cells decreases with airway size (6). Basal cells are also thought to represent a multipotent stem cell of the airway, giving rise to mucous and ciliated epithelial cells (7). These cells do not extend to the luminal surface and are considered a primary progenitor cell of the airway epithelium (7, 8). Basal cells play an important role in the attachment of columnar cells to the basal lamina (9-11). Following injury to the epithelium, basal cells are the most abundant remaining epithelial cell type. These cells flatten out and cover the denuded site to re-establish the epithelial barrier function (12), highlighting the importance of basal cells in epithelial wound repair.  4  1.1.2 The Function of the Airway Epithelium The primary function of the airway epithelium is to provide a protective barrier to the underlying tissue from the external environment. As the cells that line the airways, the epithelium is routinely exposed to a variety of challenges such as virus particles, allergens and pollutants. Epithelial cells form strong linkages with one another and to the underlying protein matrix via cell-cell and cell-matrix connections (13). The effectiveness of epithelial cells in forming a barrier is the result of strong cell-cell and cell-matrix interactions such as tight junctions in between neighbouring cells (14, 15). The epithelium is also responsible for the removal of foreign particles. Particles are removed from the airway by cilia on the columnar epithelial cells. Mucus secreted into the airway lumen traps foreign particles and ciliary motion drives mucus along with the inhaled particles upward towards the mouth (16). The epithelium also participates in the maintenance of the osmolarity of the airway lumen. Airway epithelial cells have two major active transport processes: Cl- secretion and Na+ absorption (17). Although the cells that line the airway form junctions with one another, these cells are not simply a passive barrier; the airway epithelium is recognized as a highly organized multifunctional system that plays a regulatory role in complex events. It is actively involved in the production and release of mediators that can have profound effects on neighbouring cells. This includes prostaglandins and leukotrienes that can have significant effects on smooth muscle function and leukocyte migration respectively. Prostaglandin E2 (PGE2) is the most abundant arachidonic acid metabolite produced by airway epithelial cells (18, 19) and has been shown to effect a variety of cellular mechanisms including epithelial cell migration and wound repair (20). Airway epithelial 5  cells produce extracellular matrix proteins such as fibronectin and tenascin-C as well as growth factors such as TGF-β and EGF (21-24). The production of these molecules may play important roles in cell adhesion and directed cell migration and will be discussed in detail. 1.2 Asthma 1.2.1 Incidence and Epidemiology Asthma is a condition that affects an increasing number of individuals each year. In the United States there are approximately 20 million asthmatics, it is the 6th leading cause of hospitalization and approximately 5000 deaths each year occur where asthma is reported as the underlying cause of death (25). There are nearly 300 million cases of asthma worldwide (26). According to Health Canada, approximately 2.7 million Canadian adults and children (ages 4 years and over) have asthma and 287 Canadians died of asthma in 2003. The number of asthma cases continues to increase worldwide, with the most dramatic increases occurring in the developed world. This has lead to the hypothesis that asthma is the result of genetically predisposed individuals who are exposed to an environment that leads to the appearance of symptoms. As a result, much research has focused on both the genetic and the environmental factors that contribute to the development of asthma. 1.2.2 Pathology and Pathophysiology of Asthma Asthma is a complex disease often described as a chronic inflammatory disease of the airways. Asthma is characterized by periods of reversible airflow obstruction and 6  wheeze, chest tightness and cough. Structural changes observed in the asthmatic airway increase smooth muscle cell mass, goblet cell metaplasia (27), increased sub-epithelial fibrosis (28, 29), increased inflammation and damage to the airway epithelial cells (3034). Many of these changes are observed in patients where the disease is considered mild (35, 36). Studies on children with asthma have revealed that the ultrastructural changes can occur very early and in some cases prior to the development of symptoms (37-39). A genetic predisposition to develop asthma is widely accepted (40). The genetic study of asthma has been difficult due to the heterogeneity of the disease. The inheritance pattern of asthma does not follow the classical inheritance patterns. Recently susceptibility genes have been identified such as the metalloproteinase ADAM 33 (41). Functional analysis has shown that ADAM33 is associated with angiogenesis and is in part regulated by TGF-β (42). It is unknown how genetic variation in the ADAM33 gene contributes to the pathogenesis of asthma. Asthma is considered a complex disorder that likely involves several genetic factors in combination with environmental exposures that lead to the development of asthma. Despite the recent advances, the underlying mechanism to the development of asthma remains elusive. Continued efforts should focus on determining how the structural changes seen in asthma affect normal functions of the airway and the potential contribution to disease. These efforts in combination with genetic studies will expand our understanding of such a complex disorder. 1.2.3 Clinical Subtypes of Asthma Asthma is not clearly defined by a single set of symptoms and criteria. In fact individual cases of asthma are divided into several sub-classes to account for the 7  heterogeneity of the disease. Different phenotypes of asthma can be defined by clinical and physiological criteria. These include phenotypes that are defined by severity such as severe moderate and mild asthmatics. The clinical differences are outlined below (Table 1.1). Studies have shown that these definitions are not adequate to predict the course of the disease, control of the disease, or the response to therapy (43, 44). Clinically, asthma can also be defined by frequency of asthma exacerbations, level of airflow obstruction, resistance to treatment and age of onset. Some patients experience frequent exacerbations with a wide range of lung functions. By contrast, some patients experience very few exacerbations but present with marked airflow restriction (45). Asthma that is resistant to treatment, usually corticosteroids, is commonly found in patients with severe disease (46, 47). Finally patients with early onset asthma (defined as the development of symptoms before 12 years of age) have a greater likelihood of allergic sensitization relative to lateonset disease (48). Asthma can be further broken down into two categories: atopic and non-atopic. Atopy, defined as hypersensitivity against common environmental antigens, has long been considered a risk factor for the development of asthma. Studies have identified differences in airway hyper-responsiveness between atopic and non-atopic asthmatics (49, 50). It is estimated that between 66% and 75% of asthmatics are atopic which suggest that factors other than IgE associated-inflammation contribute in the development of asthma. The heterogeneity of asthma relates to the trigger-related phenotypes, this includes allergic asthma which is defined by a positive skin-prick test and a history of allergic symptoms following exposure to that trigger. Other potential trigger defined phenotypic subtypes of asthma include occupational asthma, aspirin-induced and 8  exercised-induced asthma. Finally, asthma can also be categorized by the inflammatory phenotype. These categories are based on the predominant cell type involved: eosinophilic, neutrophilic, and paucigranulocytic (51). The different inflammatory phenotypes of asthma are associated with distinct clinical and physiological inflammatory and repair processes (48, 51-54).  9  Table 1.1 - Clinical Sub-types of Asthma based on severity. Severe  Severe asthmatics represent less than 10% of all cases of asthma, however, these patients manifest significant morbidity associated with their asthma. In 2000, the American Thoracic Society (ATS) severe asthma was described as asthma with high medication requirements to maintain good disease control or persistent symptoms, asthma exacerbations, or airflow obstruction despite high medication use.  Moderate  Moderate asthmatic typically experience exacerbations several times a week. Exacerbations often occur at night and the symptoms include coughing and wheezing. Symptoms can last for several days and in some cases requires hospitalization. Treatment of moderate asthma includes beta agonists during symptomatic periods and inhaled corticosteroids to control the inflammation in the airways.  Mild  Mild asthma is generally thought of as a seasonal condition where periods of breathlessness and wheezing occurs a couple of times per month. Exacerbations are triggered by events such as exposure to allergen or exercise and the symptoms are considered mild. Treatment for mild asthma can be the use of a rescue drug such as a bronchodilator to alleviate symptoms.  1.2.4 Airway Remodelling and the Epithelium in Asthma Airway remodelling is the term used to describe the structural changes that occur in the airway wall in asthma. Specific changes that have been observed in asthma include 10  increased sub-epithelial fibrosis, smooth muscle cell hypertrophy and hyperplasia, goblet cell hyperplasia, inflammatory cell infiltration and epithelial denudation (32, 55). The sum of these structural changes results in long term irreversible airflow limitation. Asthmatics also have a faster rate of decline in FEV1 relative to non-asthmatics (56). The decline in lung function was observed despite the use of corticosteroids (57). The consequences of airway remodelling include increased airway hyperresponsiveness (AHR), fixed airflow obstruction and irreversible loss of lung function. The increase in airway smooth muscle volume, deposition of collagen, and mucus secretion, result in reduced cross sectional area of the airway lumen and thus contribute to the airflow limitation associated with asthma. One of the more controversial findings described in the asthmatic airway is the presence of a chronically damaged epithelial layer. Initial reports of epithelial damage in asthmatic patients were obtained from post-mortem studies (58). Studies of bronchial biopsies later confirmed the presence of epithelial desquamation in the asthmatic airway (34). These findings were controversial in that it was proposed that epithelial damage was an artefact of the bronchial biopsy sampling process. Despite rigorous controls which included a reproducible sampling protocol and using the same individual to carry out the sampling procedure for entire studies, there has been an ongoing debate regarding epithelial damage in the asthmatic airway. Changes in protein expression such as increased CD44 and epidermal growth factor receptor (EGFR) expression in areas proximal to epithelial injury suggest that epithelial damage in asthma is a true finding and not artefact (59, 60). Epithelial damage correlates with airway hyperreactivity in asthmatic patients (55), and is seen in about half of subjects with mild asthma and in 11  almost all subjects with persistent asthma (61). Epithelial damage is also present in patients with newly diagnosed asthma (62). Furthermore, epithelial damage has been shown in both allergic and non-allergic asthmatics. In both cases, the asthmatic epithelium was shown to be altered at the ultrastructural level (29). Some of the structural changes in the asthmatic airway are highlighted below in histologic sections healthy normal (Figure 1.2) and severe asthmatic airways (Figure 1.3). Despite an understanding of the pathological features of airway remodelling, the mechanism and regulation of remodelling, and the order in which these changes develop are poorly understood. Further investigation is required to determine how a chronically damaged epithelium contributes to disease progression. This includes determining how some of the changes observed in the asthmatic airway can affect epithelial repair. An understanding of the molecular events that regulate these processes may lead to the development of novel therapeutic strategies that target these structural changes and the development of asthma.  12  Figure 1.2 -Histologic section of intrapulmonary bronchus of a normal airway. The ultrastructure of a normal airway shows an intact surface pseudostratified ciliated columnar epithelium. The underlying reticular basement membrane is indistinct, very few inflammatory cells and small amounts of smooth muscle are present. Image re-printed with permission from Bousquet et. al. 2000 (58).  13  Figure 1.3 - The ultrastructure of a severe asthmatic airway. This histologic section of intrapulmonary bronchi demonstrated the altered structure and inflammation of the airway wall. In fatal asthma there is sloughing of the surface epithelium, a prominent homogeneous thickened reticular basement membrane, and infiltration of inflammatory cell and smooth muscle cell hypertrophy. Image re-printed with permission from Bousquet et. al. 2000(58)  14  1.3 Airway Epithelial Wound Repair 1.3.1 Cellular Events in Airway Epithelial Wound Repair As a surface that is exposed to the environment and its challenges with every breath, the airway epithelium has a highly ordered and efficient method to repair itself. The reports of the accumulation of damage and increased inflammation in the asthmatic airway highlight the importance of epithelial repair. Initial epithelial repair studies were carried out in vitro using culture models to understand wound repair. Work by Erjefalt et. al. in guinea pigs were the first studies that looked at airway epithelial wound repair in vivo on an intact basement membrane (63, 64). The authors described the ordered series of events that occur following epithelial loss (Figure 1.4).  15  Figure 1.4 - Proposed model of epithelial repair. Following epithelial injury, neighbouring cells flatten, spread and migrate to cover the site of injury. Subsequent proliferation and differentiation restores the epithelial structure and barrier function. Current models propose these processes may involve multiple factors derived from local resident cells to complete the repair. Image re-printed with permission from Allahverdian, Patchell and Dorscheid, 2006 (65). Guinea pig airways were subjected to mechanical injury in vivo. Following injury, the integrity of the basement membrane was evaluated by electron microscopy (64). An intact structure absent of red blood cells was considered intact. Cells at the wound edge become flat and spread to cover the denuded membrane. It was observed that the migratory cells responsible for wound closure were ciliated columnar cells that appeared to lose their cilia. A similar study in rats has shown that cells proximal to the wound appear to “de-differentiate” to a basal like cell and complete repair (66). Once the denuded basement membrane was covered, those cells that migrated and spread to cover the wound differentiated and began to form the elements of an epithelial layer such as 16  tight junctions and desmosomes (64). Interestingly, despite an intact basement layer and no visible bleeding, exudation of plasma derived factors such as fibronectin occured following epithelial loss in less than 10 min (63). After injury, fibrin and fibronectin fibers, along with other plasma proteins, formed a gel-like network (63, 64). The extravasation of plasma derived molecules was localized primarily to the deepithelialized area resulting in an altered extracellular environment at the site of injury. By immunohistochemistry, the production and secretion of fibronectin at the denuded site and in the lamina propria was observed and leukocytes were recruited to the site of injury. Repair of mechanically wounded airway epithelium in vivo close much faster than those in vitro (64). The authors suggested that the extravasation of plasma derived macromolecules, a characteristic that cannot be easily reproduced in vitro, acts as a protective cap along with proteins that also facilitate re-epithelialization (Figure 1.5). Studies of cutaneous wounds in mice that are fibrinogen (the soluble pre-cursor form of fibrin) deficient had no difference in wound closure rates relative to wild type mice; however, defects in wound tissue organization were observed (67). Degradation of the protective protein cap is also essential in the process of wound repair. In a corneal model of epithelial wound repair, mice lacking plasminogen (Plg-/-), the precursor of the fibrinolytic enzyme plasmin, had impaired repair resulting in persistent fibrin deposition in injured corneas. Mice with a combined deficiency in plasminogen and fibrinogen resulted in the restoration of normal healing similar to wild type (68). Similar results were shown in skin wounds where loss in fibrinogen improved wound repair kinetics of plasminogen deficient mice (69, 70). These studies highlight the role that serum-derived molecules and their processing can have on epithelial wound repair. 17  Figure 1.5 - Early and late response following epithelial injury. Immediately following epithelial loss, plasma exudate accumulates in the airway lumen, providing a protective protein cap and barrier (1). Present in the plasma are serum glycoproteins, cytokines and growth factors that in turn, induce a response in the neighbouring resident epithelial cells (2). Inflammatory cells are then recruited to the site of injury to remove cellular debris and participate in the repair (3). Similar signals may recruit distant cells to the epithelium to participate in the repair in addition to the contribution of resident cells. The cells would include epithelial progenitor or stem cells. Image re-printed with permission from Allahverdian, Patchell and Dorscheid, 2006 (65). 1.3.2 Molecular Events During Epithelial Wound Repair At the molecular level, several different proteins coordinate and regulate directional cellular migration. It is a very dynamic process that when broken down into its simplest elements, cell migration is the result of irregular forward projections, called 18  lamellipodia, in the direction of migration which generates tension at the rear of the cell. The cytoskeleton, which consists of actin microfilaments, microtubules and intermediate filaments, is responsible for maintaining cell shape. It is also an essential element of cell migration in the generation of cellular protrusions. New sites of adhesions to the extracellular matrix (ECM) must be formed at the front of the cells while sites of adhesion at the back of the cells are broken. The protrusion at the leading edge of the cell generates tension ultimately resulting in pulling the cell forward. The polymerization of G-actin to filamentous actin (F-actin) leads to the bundling of F-actin in the lamellipodia of the flattened migrating cells. Treatment of cells with cytochalasin B, a inhibitor of actin polymer assembly, inhibits directional cell migration highlighting the importance of cytoskeletal re-arrangements (71). Some of the elements of focal adhesion complexes are shown below (Figure 1.6) Proceeding from the outside of the cell to the intracellular environment, the initial regulatory element of epithelial cell migration is the extracellular matrix (ECM) which is discussed in detail below (Section 1.6). The ECM acts as the structure upon which the cells adhere and its composition and remodelling can act as a signal to activate promigratory events (72, 73). Integrins are the primary cellular receptors that bind ECM proteins and link the extracellular environment to the cell and cellular cytoskeleton. Integrins are a large family of cell surface receptors that are composed of two subunits, α and β. Each αβ combination has its own ligand specificity and downstream signalling. ECM proteins such as fibronectin, laminins, collagens and vitronectin, bind to several integrins. Adherent cells, such as fibroblasts and epithelial cells, must be anchored to an appropriate ECM to survive. 19  Figure 1.6 -Focal Adhesion Complex. Focal adhesions are sites that link the extracellular matrix (ECM) to the cytoskeleton. Integrin receptors bind the ECM and cluster, resulting in the recruitment of focal adhesion proteins such as focal adhesion kinase (FAK), talin, vinculin and paxillin. Each integrin subunit consists of a large N-terminal extracellular domain, a single transmembrane and helix and a small cytoplasmic domain (reviewed in Hynes 2002 (74)). Integrins bind the ECM via their extracellular domains. Following binding to the ECM, integrins form clusters that promote the formation of focal adhesions which are complexes that contain structural proteins such as vinculin, talin, and α-actinin, and signaling molecules, including FAK, Src, and paxillin (Figure 1.6) (75, 76). The formation of focal adhesions results in a high local concentration of these signalling molecules, facilitating protein-protein interactions. Integrin signalling is tightly linked to the cytoskeleton. Upon adhesion to ECM, integrins and a selective group of cytoskeletal and signaling proteins are recruited to cell matrix contact sites where they link the actin 20  cytoskeleton to the ECM and mediate downstream integrin signalling (76). The short cytoplasmic tails of integrins lack enzymatic function and therefore rely on adapter proteins to transduce signals to the cytoskeleton, cytoplasmic kinases and growth factor receptors. There are numerous adaptor proteins that affect cytoplasmic integrin signalling, the discussion below will be limited to those associated with cell migration. Talin, vinculin and α-actinin are three structural proteins found at integrin/actin cytoskeleton adhesion sites. These proteins contribute to adhesion dynamics and depletion of these elements compromises the integrity of adhesions and can lead to their disassembly. Cells depleted of talin expression were unable to form strong adhesions during spreading (77). Talin mutant cells resistant to activation by calpain, a calcium dependant protease, have stronger adhesions and impaired focal adhesion disassembly (78). Fibroblasts from vinculin knockout mice had increased rates of cell migration and reduced adhesion to fibronectin (79). The dynamic regulation of sites of adhesion is a requirement for cellular migration. New sites of adhesion need to be assembled, stabilized and turned over as cell migration proceeds. Furthermore, adhesions at the trailing edge of the cell are broken down. The co-ordination at these sites requires subcellular localization of regulatory elements and their activation. Proteins such as the annexins that can interact with regulatory elements of migration, and whose localization can be quickly altered, may participate in this sub-cellular compartmentalization. Identifying novel mediators of repair will potentially expand the understanding the organization of these events within the cell. Regulatory elements of focal adhesions include focal adhesion kinase (FAK), paxillin, SHP2 and Src kinases. The activation of FAK is coupled with the remodelling of 21  adhesions. The recruitment of FAK to sites of adhesion is via its binding to talin and paxillin which are associated with the cytoplasmic tail of the β integrin receptor. FAK becomes phosphorylated upon integrin mediated binding to the ECM; however, fibroblasts isolated from FAK null mice had decreased migration and spreading rates relative to wild type and increased numbers of peripheral adhesions (80). During cellular migration, FAK participates in adhesion activation or turnover to allow cellular movement. It is the co-ordinated turnover of these sites of adhesions that is essential to allow cellular migration and as a result, mammalian cells have complex regulatory machinery for their regulation. Tyr397 is the major auto-phosphorylation site of FAK and acts as a binding site for the SH2 containing Src kinases. Phosphorylated FAK is localized in adhesion sites that are actively turning over and Src kinases are also required for the active turnover of adhesions (81). Two of the targets of FAK-Src kinase activity are the scaffolding proteins paxillin and p130CAS (82, 83). These two proteins are responsible for actin organization and the recruitment of molecules to sites of adhesion. Phosphorylation of paxillin results in two SH2 binding sites that recruits other signalling molecules (84). The importance of SHP-2 with respect to FAK-mediated cell migration has been reported (85). In the absence of SHP-2, cells displayed an increased number of focal adhesions and condensed F-actin aggregation at the cell periphery and dephosphorylation was significantly reduced (86). SHP-2 is a protein tyrosine phosphatase (PTP) that contains Src homology 2 (SH2) domain and plays an important role in biological functions in response to various growth factors, hormones or cytokines. Unlike several other phosphatases, SHP-2 is a PTP that promotes activation, rather than down 22  regulation, of intracellular signalling pathways (Figure 1.7). In the basal state, the Nterminal SH2 (N-SH2) site binds the PTP site, inhibiting its own catalytic activity (87). The C-terminal SH2 (C-SH2) site remains unobstructed to survey the cellular environment for phosphorylated tyrosine ligands. Binding of the appropriate bisphosphorylated ligand frees the PTP domain and results in enzyme activation.  Figure 1.7 - The domain structure of SHP-2 protein. Adapted from Neel, 2003 (88).  SHP-2 is a positive effector of most receptor tyrosine kinase (RTK) signalling and essential for sustained activation of the Erk MAP kinase pathway (89, 90). SHP-2 is required for integrin induced cell spreading, migration and Erk activation (86, 91, 92). SHP-2-mutant cells also have increased stress fibers and enhanced activation of the small G protein Rho, which controls stress-fiber formation (93). Studies on SHP-2 mutants have shown that SHP-2 de-phosphorylates focal adhesion kinase (FAK) (86, 92). A report in 2007 demonstrated that AII interacts with SHP-2 (94). It was also shown that changes in cell confluence in culture affect the interaction of SHP-2 with annexin II (AII) (95). As endothelial cells reached confluence, a complex containing SHP-2 and AII was found to be recruited to intercellular junctions by a novel, cholesterol-dependent, 23  mechanism. This recruitment of SHP-2 to these sites is important in down-regulating receptor tyrosine kinase signalling once cellular confluence is achieved. Thus the role of SHP-2 binding proteins that alter SHP-2 intracellular localization, such as AII, which is discussed in Section 1.5, may help functionally regulate the activation of adhesions. The published model of AII mediated SHP-2 recruitment to the plasma membrane was based on a sub-confluent/confluent cell culture model. A similar mechanism may exist in other cell systems following injury and loss of neighboring cells. In parallel with adhesion dynamics, actin assembly is an essential element of cell migration. The Rho family of small GTPases is well characterized with respect to their role in the reorganization of the actin cytoskeleton in cell migration. This family of proteins includes Rho, Rac and Cdc42 and they all play an essential role in the assembly and breakdown of actin filaments essential for directional cell migration (96). Specifically, Rac and Cdc42 regulate the polymerization of actin to form peripheral lamellipodial and filopodial protrusions respectively, while Rho is associated with focal adhesion assembly and cell contractility (73, 97). Downstream of Rho GTPase activation are the adaptor and signalling proteins such as the Wiskott-Aldrich syndrome protein (WASP) and WASP-family verprolin-homologous protein (WAVE), which in turn activate the Arp2/3 complex. This complex nucleates actin-filament branches, and results in a broad dendritic-like actin network (98-100). In filopodia, Cdc42 promotes linear actin polymerization via formins and vasodilator-stimulated phosphoprotein (VASP), and organizes polymerized actin into elongated filaments (101, 102). Several reports describe AII as a protein on the inner leaflet of the plama membrane at site of F-actin bundling  24  (103, 104). It is unknown whether AII is required for F-actin bundling or if, following assembly, AII is recruited to these sites in a regulatory role.  1.4 Glycomics 1.4.1 Protein Glycosylation Glycosylation is the addition of carbohydrate structures to proteins. Glycans are the most-abundant and structurally diverse biopolymers within the cell. They are a major component of the outer surface of eukaryotic cells. Unlike proteins, carbohydrate structures are not gene products, they are synthesized by a series of glycosyltransferases within the cell. Glycosylation events occur in the ER or in the lumina of the cis-, medialor trans-Golgi cisternae. There are two main categories of glycosylation, O-linked and Nlinked glycosylation, which are characterized by different carbohydrate structures and consist of very different sugars (Figure 1.8). O-linked glycosylations are attached to the amino acid sequence via a hydroxyl group of serine or threonine via Nacetylgalactosamine (GalNac) or in some cases to the hydroxyl group of hydroxylysine via galactose. Conversely, all N-linked glycosylations are linked via the amide nitrogen of asparagine. N- and O-linked glycosylations also differ in size and content. O-linked carbohydrates are typically smaller while N-linked always contain mannose as well as Nacetylglucosamine and usually have several branches each terminating with a negatively charged sialic acid residue (reviewed by Lis and Sharon (105) and Szymanski and Wren (106)). Using the global N-glycosylation inhibitor tunicamycin in an in vitro model of  25  wound repair, our laboratory has previously shown that N-glycosylation mediates airway epithelial repair (107).  Figure 1.8 - Schematic of eukaryotic cell protein glycosylation. The mechanisms of both types of eukaryotic protein glycosylation a. N-linked glycosylation N-linked glycosylation is proposed to proceed through the sequential addition of nucleotide-activated sugars onto a lipid carrier, resulting in the formation of a branched heptasaccharide. This glycan is then 'flipped' across the inner membrane into the ER by a putative ATP-binding cassette (ABC) transporter. The sugars are further processed to a 14-mer that is then transferred to the growing polypeptide by a complex of proteins collectively known as the oligosaccharyltransferase (OTase). The oligosaccharide is the processed further by glycosyltransferases and glycosidases to produce the final product. b. O-linked glycosylation proceeds through the step-wise transfer of nucleotide-activated monosaccharides to serine or threonine residues on proteins in the Golgi that can then be further modified by processes such as sulphation or O-acetylation Image re-printed with permission from Szymanski 2005 (106). N-linked glycosylation is carried out in several highly regulated steps. The initial step occurs in the rough ER with the addition of a large pre-formed carbohydrate 26  complex from dolichol, a long-chain polyisoprenoid lipid oligosaccharide carrier that is firmly embedded in the membrane. The dolichol bound structure is formed through a series of reactions catalyzed by enzymes on the cytosolic and luminal surface of the ER. The initial step, the addition of UDP bound N-acetylglucosamine (GlcNac) to dolichol phosphate, is the step that is inhibited by tunicamycin. The entire dolichol linked oligosaccharide structure is transferred to an asparagine residue of a nascent peptide at the consensus sequences of Asn-X-Ser and Asn-X-Thr (where X is any amino acid except proline); however, not all Asn-X-Ser/Thr sequences are glycosylated. The carbohydrate structure is processed further by a series of glycosyltransferase enzymes as the protein passes from the ER to the Golgi apparatus. Differences in protein glycosylation are the result of changes in the availability of saccharides for processing. 1.4.2 Glycosylation and Protein Regulation Protein post translational modification plays a vital role in a variety of cell functions such as the activation of signalling cascades through kinase phosphorylation. Glycosylation of proteins is an essential step in protein processing. During intracellular processing of viral proteins, when glycosylation is inhibited the hemagglutinin precursor protein does not fold correctly and as a result is retained in the ER and eventually degraded (108). A protein’s glycosylation can affect stability as well. Fibronectin is a highly glycosylated matrix protein. In the presence of tunicamycin, fibronectin is produced and secreted; however, the non-glycosylated protein is much more susceptible to proteolytic degradation (109). Protein glycosylation also plays a role in protein sorting. 27  Lysosomal enzymes are often highly glycosylated, these structures can be phosphorylated in a series of two steps resulting in a mannose-6-phosphate. These structures remain bound to the mannose 6-phosphate receptors of the trans Golgi network which fuse with the sorting vesicle to form a “late endosome”. The drop in pH to ~ 5.5 results in the release within the lysosome of the mannose 6-phosphate structure from its receptor.  Figure 1.9 - Lectins cluster glycoproteins for apical sorting. A proposed role for lectins in establishing an apical sorting platform. Multivalent lectins crosslink different apical cargo proteins and glycolipids to stabilize weak individual interactions between proteins and lipid microdomains. Image reprinted with permission from Fullekrug, 2004 (110). It has also been proposed that glycosylated structures are important in the protein targeting and organization within lipid rafts (110) (Figure 1.9). Lipid rafts are ordered microdomains within the plasma membranes. They are regions with increased concentration of sphingolipids and cholesterol. Cholesterol and sphingolipids carrying saturated hydrocarbon chains assemble to form tightly packed sub-domains corresponding to liquid-ordered phases (111, 112). Proteins strongly associating with lipid rafts include glycosylphosphatidylinositol (GPI)-anchored proteins, doubly acylated proteins, and several transmembrane proteins. This ordered structure within the plasma 28  membrane is thought to increase the local concentration of raft associated proteins and facilitate protein-protein interactions and downstream cell signalling cascades through proximity of signalling proteins. 1.4.3 Lectins as a Tool in Glycobiology The study of glycomics has been limited by the tools available for their study. As mentioned, the level of complexity in carbohydrate structures is far greater than what can be achieved with combinations of four DNA nucleotides or twenty one amino acids. This is due to the number of saccharide molecules and the differences in oligosaccharide bonds and branching. Lectins are naturally occurring proteins that have a carbohydrate binding domain. They are found in many plants and insects; several are commercially available. Mammalian cells also express lectins such as galectins and selectins that play a role in the adhesion or “rolling” of immune cells on the endothelium prior to their migration into areas of inflammation. Lectins can have very broad specificity, binding a variety of carbohydrate structures or very specific carbohydrate ligands. Experimentally lectins can be used to characterize the glycosylation profile presented on the surface of cells (113, 114). Furthermore, the addition of lectins to cell culture media has previously been used to disrupt the function of their carbohydrate ligand(s) (115). The lectin Allomyrina dichotoma agglutinin (AlloA) is a lectin isolated from a Japanese beetle. It is a lectin that specifically binds β-galactose residues (116). The lectin isolated from Cicer arietinum (Chick pea agglutinin, CPA) has a complex carbohydrate binding specificity that has not been characterized. Both of these lectins have been shown to bind airway epithelial cells (113). Using a series of lectins, we have identified that 29  these two lectins bind airway epithelial cell surface carbohydrates ligands in a dynamic fashion with respect to epithelial wounds (117, 118). 1.5 Annexins 1.5.1 The Annexin Family of Proteins The annexin proteins are a large family of proteins with 12 members identified to date in vertebrates (Annexin 1-11 & 13, Figure 1.10). The annexins are a family of Ca2+/lipid-binding proteins. Annexins have a unique structure that allows them to bind and dock onto membranes in a reversible manner and have classically been defined as proteins that bind to anionic phospholipids in a Ca2+ dependent manner. The primary structure of annexin proteins consists of four homologous annexin repeats, the annexin core domain or the ‘annexin fold’, each of 70 residues in length (119). The highly αhelical property of the annexin repeats results in a two faced protein structure consisting of a concave and convex surface. The convex surfaces harbours the Ca2+ and lipid binding sites and the concave side remains available for protein interactions as it is directed away from the membrane (120). The annexin core domain makes up a large portion of the protein and is highly conserved throughout the annexin family of proteins. The N-terminal domain of annexins precedes the annexin core. Within the annexin family of proteins N-terminal tails are diverse in sequence and in length. With such a conserved annexin core within the annexin family, the variable N-terminus is the site of unique regulatory interactions responsible for membrane and ligand interactions for the different annexin proteins. Annexins are widely expressed in cells from all eukaryotic phyla.  30  Figure 1.10 - Domain structures of representative annexin proteins. The 12 human annexins (ANXA) are shown in with the highly conserved repeats in the core regions highlighted (black) and variation in length and sequence in the amino-terminal regions (shaded). Human ANXA1 and ANXA2 are shown as dimers with the member of the S100 protein family that they interact with. P, known phosphorylation sites; K, KGD synapomorphy (a conserved, inherited characteristic of proteins); I, codon insertions (+x denotes the number of codons inserted); S-A/b, nonsynonymous coding polymorphisms (SNPs) with the amino acid in the major variant (A) and that in the minor variant (b); N, putative nucleotide-binding sites; D, codon deletions (-x denotes the number of codons deleted); A, alternatively spliced exons; Myr, myristoylation. The total length of each protein is indicated on the right. Image re-printed with permission from Moss and Morgan Genome Biology 2004 5:219 (121). The difficulty in working with annexins is that despite large amounts of experimental research, their vital physiological function in vivo is unknown. Initially, the ability of annexins to bind lipid membrane led to the hypothesis that they participate in 31  membrane events such as endo- (122) and exo-cytosis (123-127). Several other functions have also been associated with annexins such as inhibitors of phospholipaseA2 (PLA2) (128-130), as well as regulators of cell-matrix (131-133) and cell-cell interactions (134136). Below is a table that highlights several proteins that have been identified as annexin interacting proteins (Table 1.2).  32  Annexin  Interacting proteins  Annexin I  Epithelial growth factor receptor, formyl peptide receptor, selectin, actin, integrin A4  Annexin II  Tissue plasminogen activator, angiostatin, insulin receptors, tenascin-C, caveolin 1  Annexin III  None known  Annexin IV  Lectins, glycoprotein 2  Annexin V  Collagen type 2, vascular endothelial growth factor receptor2, integrin B5, protein kinase C, cellular modulator of immune recognition (MIR), G-actin, helicase, DNA (cytosine-5-)methyltransferase 1 (DNMT1)  Annexin VI  Calcium-responsive heat stable protein-28 (CRHSP-28), ras GTPase activating protein, chondroitin, actin  Annexin VII  Sorcin, galectin  Annexin VIII  None known  Annexin IX  None known  Annexin X  None known  Annexin XI  Programmed cell death 6 (PDCD6), sorcin  Annexin XIII  Neural precursor cell expressed, developmentally downregulated 4 (NEDD4)  Table 1.2 - Proteins that interact with vertebrate annexins. Adapted from Moss and Morgan Genome Biology 2004 5:219 (121).  33  1.5.2 Annexin II Annexin II (AII) is an abundantly expressed member of the annexin family of proteins. It was originally considered as strictly an intracellular protein due to the lack of a signal peptide within the protein sequence. AII has also been identified on the surface of a variety of cells and implicated in extracellular events (137-139). The multifunctional AII has been described as a co-receptor for t-Pa and plasminogen in the generation of plasmin (140-143) as well as a candidate viral receptor (144, 145). Furthermore, AII has also been identified in the nucleus associated with actively translating ribosomes and therefore may play a role in gene expression (146). Regulatory N-terminal Domain  CarboxylDomain -Membrane/Phospholipid binding -F-actin binding and bundling sites -Heparin binding sites  Protein Kinase C Ser25  I  Np11 Binding Domain Tyr23 Src Kinase  II  III  IV  -C  Annexin Fold – (I – IV): Approx 70 a.a. repeated sequences Annexin Consensus Sequences - 17 a.a.  Figure 1.11 - The functional domains of Annexin II. Adapted from Waisman D.M. 1995 – Annexin II Tetramer: structure and function (147). Similar to the other members of the annexin family, AII consists of 2 functional domains, an amino-terminal domain rich in regulatory elements and the carboxy domain. The carboxy domain of AII contains the sites for Ca2+, phospholipid (148, 149) and F34  actin binding (Figure 1.11) (150, 151). It is an abundant protein that has been shown to exist as a monomer (36 kDa), a heterodimer (AIId) or a heterotetramer (AIIt). The heterotetramer is composed of two AII subunits bridged together by two annexin II light chain molecules (p11) (Figure 1.12). In its monomeric form, AII is thought to be largely cytosolic. The heterodimer, which consists of one subunit of AII and one 3phosphoglycerate kinase subunit, associates with the nucleus and may play a regulatory role on DNA polymerase α. AII forms a dimer with the glycolytic enzyme 3phosphoglycerate kinase and plays a role in the association of single stranded DNA template and primer (152). As a heterotetramer, AII and p11 can be localized to the inner leaflet and the extracellular surface of the plasma membrane (103). It is in this form, the heterotetramer, that AII likely mediates cell migration and wound repair through its localization to the plasma membrane and interaction with migratory proteins such as Factin, SHP-2, RhoA at the membrane and tenascin-C, t-Pa and plasminogen on the cell surface. These interactions are discussed below (Section 1.5.4).  35  Figure 1.12 -The 3D ribbon structure of Annexin II heterotetramaer (AIIt). Two molecules of AII (gray) are bridged together by two molecules of p11 (white and black). Image re-printed with permission from Gerke, 2005 (153). It has been reported that AII plays a role in the endocytic pathway and was identified on the surface of endosomes (154). There have also been reports that link AII, specifically the AIIt, to Cl- channels (155). One of the more intriguing associations of intracellular AII is its role in the organization of membrane domains. Lipid microdomains (rafts) have been characterized as platforms for signalling events (reviewed in Simons, 2000 (156)). The inner leaflet of these lipid domains is less well characterized. AII associates with lipid rafts in several cell types such as MDCK, polarized mammary 36  epithelial, and smooth muscle cells (157, 158). Disruption of lipid rafts results in the release of AII and cortical cytoskeletal elements such as actin, -actinin, ezrin, and moesin (159). AII binds F-actin and therefore may participate in membrane cytoskeletal links and reorganization (160). The importance of adhesion sites is discussed in detail below (Section 1.6).  Annexin II has been used as a marker of ordered lipid  microdomains. Lipid rafts are rich in cholesterol and sphingolipids. During the purification of lipid rafts from membrane isolations, successful purifications were evaluated based on the presence of AII within the fractions (161). As mentioned, the carbohydrate binding of AIIt that may be in part regulated by phosphorylation has also been proposed to have a role in the organization of lipid raft proteins. Recent studies have shown that AII plays an essential role in the exocytic transport of lipid raft containing vesicles that are targeted to the apical surface of polarized cells (162). In addition, AII has been shown to be associated with CD44, the hyaluronic acid receptor, in lipid rafts and the interaction of AII and CD44 stabilizes the actin cytoskeleton (158). Within cholesterol rich lipid structures AII is likely more than simply a biomarker. The ability of AII to bind several proteins such as SHP-2 and F-actin may be to promote protein-protein interactions by increasing their local concentration resulting in changes in activation or phosphorylation of adhesion elements. In a culture model of endothelial cells, AII recruits SHP-2 to the plasma membrane in a cholesterol dependant manner (95). Although the work demonstrates how changes in cell number in culture can regulate AII localization, it is unknown if a similar model exists following changes in cell number as a result of wounding or epithelial injury.  37  1.5.3 Regulation of Annexin II Annexin II lacks an enzymatic or transmembrane domain, however, AII interacts with several proteins. It is through these interactions that AII is regulated and carries out its regulatory role of cellular events. The primary AII associated protein is the annexin II light chain (p11). The annexin II light chain is a member of the S100 EF-hand family of Ca2+ binding proteins (S100A10) (147). S100 proteins represent the largest group of EFhand super-family of Ca2+ binding proteins. There are 19 known S100 protein family members and most of the S100 genes are clustered on chromosome 1q21 (163). These proteins typically form homo- or heterodimers. Dimerization appears to be essential for protein function. S100 proteins are considered signal transmitters that respond to increases in Ca2+ concentration. The interaction of AII with Ca2+ results in a conformational change that exposes hydrophobic domains allowing the interaction with effector proteins. Unlike the other S100 family of protein, p11 is a calcium insensitive member of the S100 proteins. A single amino acid mutation in the calcium binding domain of p11 has altered the 3-D structure of the protein such that p11 does not require Ca2+ to interact with the membrane. The interaction of p11 with AII has been well studied. AII and p11 form a heterotetramer that consists of two molecules of AII and two molecules of p11 to form the annexin II heterotetramer (AIIt) (160, 164). There are distinct biochemical differences between AII as a monomer relative to AII as in its heterotetramer form that affect the physiological function of the protein. In the presence of Ca2+, AIIt has a much higher affinity for anionic phospholipids relative to the monomer (165). It has been concluded that the formation of the AIIt complex mediates the interaction with the plasma membrane (103). The association of AII with p11 38  regulates protein localization within the cell and affects the distinct physiological functions of the two subpopulations of AII. Work by Goulet et al. (166) demonstrated that AII is a glycosylated protein. The initial report demonstrated that AII was retained in lectin affinity concanavalin A columns. Concanavalin A is a lectin that recognizes D-mannose and D-glucose residues. Furthermore, AII incorporated D-[2,6-3H]mannose and D-[6-3H]glucose when they were biosynthesized by a human squamous carcinoma cell line. During cell migration, where cellular microenvironments, such as the leading edge, trailing edge and the extracellular environment, carry out unique functions, protein localization within individual cells plays an important role. It remains unknown how the glycosylation of AII regulates its function and localization within the cell, and if this glycosylated form of AII is present in other cell types such as airway epithelial cells. Protein kinases are enzymes that modify protein ligands through the addition of a phosphate group. The addition of a phosphate group results in a functional change in the substrate such as increasing enzyme activity, altering localization within the cell and affecting protein-protein interactions. AII is a ligand for protein kinases, which play a role in both its regulation and localization. Phosphorylation results in changes in protein interaction and association with cellular plasma membranes. Tyrosine (Tyr) 23 is a site for Src kinase phosphorylation (147). Src kinase is a protein tyrosine kinase that plays a regulatory role in a variety of cellular functions such as differentiation, motility, proliferation and cell survival. Src kinase has several domains including a N-terminal 14 carbon myristoyl group, SH4, SH3, SH2 and tyrosine kinase domain and a C-terminal regulatory tail (Figure 1.13) (167) 39  Figure 1.13 - The structure of Src kinase. Src kinase has a C-terminal kinase domain as well as N-terminal SH2, SH3 and SH4 domains. Adapted from Roskoski 2005 (167). Phosphorylation of AII at Tyr 23 has been identified as an essential element of cell surface presentation when endothelial cells are exposed to heat stress (138). Following mutation of Tyr 23, cell surface translocation is inhibited. Phosphorylation by Src kinase inhibits the ability of AII and AIIt to bind and bundle F-actin. The phosphorylation of AII by Src may be a key regulatory step in AII function as a mediator of epithelial wound repair. Src is an important regulator of adhesion dynamics (81), and as a regulator of AII localization may disrupt the intracellular role of AII at adhesion sites and promote the cell surface role of AII. Tyr 23 of AII is also important in other functions of AII. For example, the ability of AIIt to bridge granule membranes and the plasma membrane is lost following Tyr 23 phosphorylation, and phosphorylation inhibited the ability of AIIt to bind the carbohydrate heparin. AII also has a protein kinase C (PKC) phosphorylation site at Serine (Ser) 25; however the regulatory role of PKC phosphorylation has not been characterized. The association of AII with pro-migratory elements, such as Src, RhoA, 40  and SHP-2, and the ability to regulate its localization within the cell make it a candidate protein potentially involved in several aspects of cell migration and wound repair. Annexins are also regulated by intra- and extracellular calcium concentrations. Annexins bind to cellular membranes and anionic phospholipids in a Ca2+-dependent manner (147, 168, 169). Unlike AII, the association of p11 with the membrane is independent of the concentration of Ca2+. The calcium binding site of AII is found within the four highly conserved four annexin repeats called the annexin fold. Each repeat is made up of 70-80 conserved amino acids and the highly conserved 17 amino acid endonexin fold. The highly α helical structure of AII forms a two faced domain, a convex and concave face. X-ray crystallographic studies have demonstrated a single type II Ca2+ binding site in the second, third and fourth annexin repeat and two type II Ca2+ binding sites in the first annexin repeat of annexin II. These calcium domains are essential in mediating Ca2+ phospholipid binding. Interestingly, the regions of heparin and F-actin binding are located on the opposing concave face of AII. The binding of heparin requires Ca2+, but heparin binding is independent of the five calcium binding domains described here (170). Changes in calcium concentration are in part responsible for the sub-cellular localization regulation of AII and its association with other molecules such as carbohydrates. A scratch wounding model of urothelial cells revealed that following wounding, cells proximal to the wound edge have elevated Ca2+ as a result of increased uptake of extracellular Ca2+ that persists for several hours (171). The Ca2+ signal propagates in a wave like fashion to neighboring cells. In this study, cells at the wound edge that experience an elevated rise in intracellular calcium are induced to migrate, while those cells further back that experience a brief rise in calcium may be primed to 41  proliferate at the completion of wound closure (171). Changes in Ca2+ plays an important regulatory role in AII signalling (170), the work described in this thesis demonstrates that these changes may coordinate wound repair to activate specific subsets of cells to carry out the required elements of repair. 1.5.4 Cell Surface Annexin II AII was originally considered strictly an intracellular protein that remains in the cytosol or associated with the inner leaflet of the plasma membrane. It lacks a signal peptide and therefore is not secreted via the classical Golgi pathway. It was later shown that AII can be presented on the surface of several different cell types; however, its role on the cell surface was unclear and its mechanism of transport to the cell surface was also unknown. There are other proteins such as galectin-1, whose export mechanism does not depend on the classical ER/Golgi apparatus–dependent secretory pathway (172, 173). Galectin-1 is a carbohydrate binding protein whose extracellular localization and function are dependant on its lectin activity. Extracellular transport of galectin-1 requires the intracellular interaction with counter-receptors to promote secretion (174). To date, counter-receptors responsible for the extracellular transport of AII have not been identified. AII presented on the surface of endothelial cells acts as a co-receptor for t-PA and plasminogen (175). It was shown that the presence of AII enhances the catalytic efficiency of plasmin generation (140). The function of AII is to act as a co-receptor that promotes the interaction of t-PA with plasminogen. Plasmin is a fibrinolytic enzyme that cleaves plasma proteins such as fibrin. We have highlighted the role that the protective 42  protein cap plays with respect to wound repair and the importance of its processing by plasmin (Section 1.3.1). Much like in endothelial cell wound repair, in the airway epithelium the production of plasmin on the surface of migratory cells at the wound edge may be essential. Presentation of AII on migratory cells responsible for repair, those at the wound edge, would facilitate migration following epithelial injury. Tenascin-C has also been identified as a high affinity ligand for cell surface AII (176). The extracellular matrix protein Tenascin-C will be discussed in detail below (Section 1.6).  1.6 Extracellular Matrix and Wound Repair 1.6.1 Reticular Basement Membrane and Extracellular Matrix The basement membrane is a thin layer of specialized extracellular matrix (ECM) between the epithelium and the underlying tissue. It acts to provide mechanical support to attached cells and can also influence cellular functions. The basement membrane of the airway consists of three layers, each with a unique composition: the lamina lucida, lamina densa and the lamina reticularis. It acts to provide mechanical support to attached cells and can also influence cellular functions. The basement membrane is composed primarily of type IV collagen, laminin and proteoglycans (177). As a key interface, the extracellular matrix (ECM) plays an important role in epithelial cell migration and wound repair. The ECM is the foundation that the migrating cells bind and interact with during cellular migration. It also provides important signalling molecules for cell surface receptors called integrins. What was once described as the thickening of the basement membrane is now more commonly described as sub43  epithelial fibrosis, with or without edema, as one of the hallmarks of asthma (178). The pathologic contribution of sub-epithelial fibrosis to asthma is not fully understood, it has been speculated that it contributes to airway narrowing (179). Several other reports suggest that sub-epithelial fibrosis increases airway wall stiffness and has a protective effect against airway narrowing (180, 181).  Remodelling of the reticular basement  membrane has been shown early in disease (182) as well as in cases of mild asthma (183). Changes in the composition of the extracellular matrix observed in asthma include an increase in the deposition of repair-like matrix proteins fibronectin (FN), tenascin, and collagens (36, 184-186). Tenascin-C will be discussed in detail below (Section 1.6.2). Collagen type I and III are present in the lamina reticularis with an over-representation in the asthmatic airway relative to healthy subjects (187). Increased collagen type I and type III are associated with disease severity (188). Remodelling of the ECM can also directly affect the surrounding cells such as the epithelial cell layer. The composition of the extracellular matrix has previously been identified as a regulatory element that contributes to the regulation of airway epithelial wound repair (189). Previous reports have postulated that defective epithelial maintenance or repair could result in uncontrolled ECM deposition in fibroproliferative lung disease such as asthma (60, 190), however, direct supporting evidence was lacking. A recent study has shown that following naphthalene exposure, the ECM is re-organized and these changes are associated with regenerating and injured airway epithelium (191). Completion of epithelial repair resulted in restitution of ECM protein expression to steady-state levels. Furthermore, the authors demonstrate that selective injury to the epithelium and the ablation of epithelial restitution results in persistent matrix deposition 44  and up-regulation of genes whose products participate in remodelling (191). Differences between injury models such as chemical versus mechanical injury were not explored; however, this study highlights the potential contribution of chronic airway epithelial damage to airway remodelling, and more specifically to changes in extracellular matrix. On the surface of airway epithelial cells there is an important group of proteases, called matrix metalloproteinases (MMPs) that are directly involved in the remodelling of the ECM. MMPs are important mediators of airway epithelial wound repair. MMPs are a family of metal-dependant endopeptidases with proteolytic activity towards ECM macromolecules. MMP-9 (gelatinase B) has previsouly been shown to be expressed at the leading edge of wounded respiratory epithelial cells (192). Subsequent work revealed that MMP-9 activity is essential for airway epithelial migration, specifically in the disruption of provisional cellular attachments to the ECM (193). MMP-7 is a small MMP (28kDa) that has broad substrate specificity. MMP-7 is constitutively expressed in intact lung with a marked increased expression in migrating tracheal epithelial cells (194). Inhibition of MMP-7 in trachea from MMP-7-null mice resulted in inhibition of re-epithelialization (194). Cell surface MMP-7 proteolytic activity has been shown to cleave E-cadherin ectodomain and mediates reorganization of cell-cell contacts. Other MMPs such as MMP-3 and MMP-11 have been shown to be expressed in migrating basal epithelial cells and may also play and essential role in epithelial repair (195). These findings highlight the importance of the composition of the ECM, its processing and how these interactions can potentially mediate epithelial wound repair in the airway. Furthermore, recent work supports the hypothesis that defective epithelial repair may contribute to the pathogenesis of asthma as a result of uncontrolled matrix protein deposition. 45  1.6.2 Tenascin-C AII is a cell surface receptor for tenascin-C. AII binds to the FN A-D domains (176, 196). In endothelial cells, binding of the tenascin-C to AII results in disruption of focal adhesions and enhanced cell migration in a wound assay (196). Tenascin-C is a large oligomeric glycoprotein of the extracellular matrix. The expression of tenascin-C is prominent during different stages of development and highly regulated in adult tissues (197). By immunohistochemistry, tenascin-C expression was identified in many areas of interest including around motile cells, at sites of proliferation and sites of branching morphogenesis and during neural development. Tenascin-C is also up-regulated at the margins of healing wounds and at the stroma of many tumors.  Figure 1.14 - An illustration of the structure of tenascin. The tenascin-C molecule is characterized by terminal knobs on each arm, thick distal segments and thin proximal segments. Two trimers are joined together at a central knob. Adapted from Erickson & Iglesiaas 1984 (198). Tenascin-C consists of six long, thin arms that branch out from a central knob. Each arm consists of a thin proximal segment, a thick distal segment and a terminal knob. The molecule itself consists of two trimers joined together at the central knob by disulfide 46  bonds to form the hexabranchion structure (Illustrated in Figure 1.14). Tenascin-C is a highly glycosylated protein (199). Digestion with endoglycosidase F or neuraminidase resulted in an approximate 20 kDa and 10 kDa reduction in molecular weight respectively (200, 201). Furthermore, the observed molecular weights by SDS PAGE are 30% higher than the predicted molecular weights based on the sequence data, consistent with the post translation addition of large carbohydrate content. As an extracellular matrix protein, the specific function of tenascin-C has been difficult to determine. Its restricted expression during development and to areas of injury in adult tissues suggests that it may play a role in cell migration and tissue repair. In culture, several cell types do not adhere to tenascin-C coated surfaces (202). Cells that do attach often retain a rounded morphology and do not flatten out. In cases where cell attachment to tenascin-C was observed, binding is much weaker than to FN (203). Tenascin-C was shown to be an anti-adhesive matrix protein and can inhibit FN induced adhesion (204). Tenascin is a part of a group of adhesion modulatory proteins also called matricellular proteins. This group includes tenascin-C, fibulin-1, thrombospondin-1 (TSP-1) and several others (205-208). Disruption of cellular attachments is required to allow for cellular migration in wound repair. Deposition of matricellular proteins can modulate cellular adhesion (209). The anti-adhesive role of tenascin-C may play a role in cell motility and migration through the disruption of stable membrane-matrix interactions such as the fibronectin-integrin receptor interactions. Tenascin-C molecules are made up of multiple repeats of small segments. The central knob corresponds to the amino terminus where disulphide bonds are responsible from linking two trimers to form the hexabranchion structure. The thin proximal section 47  consists of 13 EGF-like domain repeats that are similar to the EGF-like domains on other ECM proteins. These domains are ligands for the epidermal growth factor receptor (EGFR) (Figure 1.15) (210). Ligand binding to EGFR promotes cell migration, proliferation and differentiation (211). Differentiation between the outcomes of EGFR activation involves the specific activation of one of the myriad of downstream intracellular signalling pathways (Figure 1.16) (212). The activation of migration and proliferation through EGFR are both downstream of extracellular signal-regulated kinase (ERK). However, motility requires ERK to be activated at the plasma membrane (213). Binding of the EGF-like domain of tenascin-C to EGFR results in the cell surface retention of the receptor and activation of the pro-migratory signalling cascade (214).  48  Figure 1.15 -The domain structure of tenascin-C. Each tenascin-C monomer comprises a tenascin-C assembly domain (TA), EGF-like domains, fibronectin type III domains (FNIII) and the fibrinogen globe (FBG). Some of the known ligands for each domain and listed below the tenascin-C structure. Adapted from Trebaul 2007 (215). The thick distal section consists of 8-15 domains similar to Type III domains of FN (FN-III). Differences in the number of FN-III domains are a result of mRNA splice variants. The third FN-III domain has an integrin binding RGD sequence (216).  49  Figure 1.16 -EGFR signalling pathway. An illustration of the EGFR signalling pathways. Ligand binding to EGFR initiates numerous signalling pathways. For many of these pathways, the biological outcomes have yet to be determined. The PLCγ pathway results in positive signalling for cell motility. Image re-printed with permission from Wells, 1999 (212).  Tenascin-C expression has been previously identified in the basement membrane of the airway. Furthermore, tenascin-C production is markedly increased in the subepithelial layer in asthmatic lungs relative to control subjects (185). In the airway, it is believed that the principal source of tenascin-C is the underlying fibroblasts. Subsequent work has shown that epithelial cells can be a source of tenascin-C (217). Ineffective epithelial repair may promote this increase in tenascin-C expression in an effort to promote repair. As has been demonstrated, AII is found on the surface of cells and binds 50  tenascin-C (176, 196). The specific role of AII on the surface of airway epithelial cells and its interaction and role in tenascin-C signalling remains unexplored. A study of rat corneal epithelial repair demonstrated an association between epithelial injury, cell surface AII and tenascin-C (218), however a direct link with potential function was not established. A genetic association has been identified between a single-nucleotide polymorphism (SNP) within the FN D domain of tenascin-C and adult asthma (219). The FN D domain is part of the tenascin-C molecule that interacts with and promotes the downstream changes observed in cells following AII/tenascin-C binding (176, 196). Previous reports demonstrated increased tenascin-C expression in pathological studies of asthma (185). Altered expression of tenascin-C in the asthmatic airway, its genetic association with asthma, and the previous study, together demonstrate how defective epithelial repair can contribute to airway remodelling. Therefore, the AII/tenascin-C interaction is an important one to study with respect to airway epithelial repair. The role of tenascin-C binding cell surface AII in airway epithelial wound repair will be investigated. 1.6.3 Matricellular Protein Signalling Matricellular proteins modulate cell-matrix interactions. The signalling pathways that regulate the de-adhesive affects of matricellular proteins such as tenascin-C and fibulin-1 are now being investigated and characterized (in press (220)). There are similarities such as shared signalling pathways between the signalling pathways of the matricellular family of proteins, and the discussion here will focus on the signalling pathways associated with tenascin-C. FN is a ubiquitously expressed, multifunctional 51  ECM glycoprotein that promotes cell adhesion and plays a role in repair, and remodelling (23, 221, 222). Cell surface receptors for FN include integrin receptors which are tightly linked to intracellular cytoskeleton and signalling (72, 223). Interaction with a matricellular protein results in reduced cellular interaction with the ECM to allow the cell to change shape, migrate and proliferate (209, 224). Tenascin-C disrupts the interaction of syndecan-4 with the HepII domain of FN (209, 225, 226). Syndecan-4 is a transmembrane cell surface heparan sulfate proteoglycan that promotes the formation of focal adhesions and stress fibers (227), and as a result, syndecan-4 is localized at focal adhesions (228). Syndecan has been shown to affect RhoA activity and FAK phosphorylation (229). Tenascin-C competes with syndecan-4 for binding to the HepII domain of FN (209, 225, 226). Disruption in syndecan-4 binding FN suppresses RhoA and FAK activation and ultimately results in disruption in focal adhesion remodelling and stress fiber assembly. These reports demonstrate the inhibitory role of tenascin-C with respect to disruption of cellular adhesions. The contribution of AII to the active downstream signalling following tenascin-C binding is unknown.  52  1.7 Rationale, Hypotheses and Specific Aims Hypothesis Protein glycosylation has been identified as essential in several cellular functions. Previously, our laboratory demonstrated that protein N-glycosylation was essential for airway epithelial cell wound closure (107). Furthermore, by lectin histochemistry, the cell surface glycosylation of human airway epithelial cells has been determined (113). Our central hypothesis is that glycoproteins are positive regulators of airway epithelial repair. Using the lectins Cicer arietinum agglutinin (CPA) and Allomyrina dichotoma agglutinin (AlloA), novel mediators of repair can be identified. The goals of the work presented in this dissertation are to determine the identity of the protein associated with both CPA and AlloA staining of airway epithelial cells. Subsequent to the identification of AII, the goal was to characterize the in vitro role of cell surface AII as a mediator of airway epithelial wound repair. Specific Aim 1. To characterize the presentation and function of the CPA specific carbohydrate ligand and identify associated candidate mediators of airway epithelial wound repair. Several different groups have reported the presence of increased damage to the epithelium in the airways of asthmatics relative to non-asthmatic individuals (22, 34, 37). Following injury, airway epithelial cells are actively involved in the repair process through the production of growth factors and cytokines to promote repair. Previously our laboratory has shown that in human airways, CPA binds to columnar epithelial cells and not to basal cells (113). Furthermore, preliminary lectin cytochemistry of basal cells in 53  vitro showed that positive CPA stained cells were restricted to the leading edge of the wound while intact monolayers remained unstained. The importance of protein and cell surface glycosylation in airway epithelial wound repair has previously been shown (107). The carbohydrate specificity of CPA is complex and efforts to determine the exact structure have been unsuccessful as a result of the difficulty in synthesizing these structures in the laboratory (230). Similar lectin based work has been carried out by other laboratories (115), however the work did not include the identification of the carbohydrate associated proteins, their identity may help in the understanding of this complex cellular process. In this portion of my study, I used a culture model of epithelial injury and repair to investigate the role of the CPA ligand in wound repair and attempt to identify a protein associated with the carbohydrate ligand. Our specific hypothesis is that the presentation of a CPA carbohydrate ligand and its associated protein at the wound edge of basal cells following injury mediates repair.  Specific Aim 2. To characterize the presentation and function of the AlloA specific carbohydrate ligand and identify associated candidate mediators of airway epithelial wound repair. Protein glycosylation has previously been shown to regulate cell adhesion (231), migration (232), proliferation (233) and growth potential (234) in a variety of cell types. Several groups have shown that glycoconjugates play a role in the complex processes of wound repair in airway, skin and corneal wound repair (115, 235-237). Much like the work  done with CPA, similar experiments were carried out with AlloA. 54  The importance of cell surface N-glycosylation has previously been demonstrated (107). In a guinea pig model of wounded airway epithelium, changes in glycosylation patterns were observed following injury. It is unknown whether these changes in glycosylation play a role in mediating epithelial wound repair.  In this portion of my  research, I used the same culture model of epithelial injury and repair as before to investigate the role of the AlloA ligand in wound repair and attempt to identify a protein associated with the carbohydrate ligand. Preliminary experiments with AlloA revealed that following injury of confluent monolayers of basal cells there is an increase in AlloA positivity on the cell surface (117). Our specific hypothesis was that the presentation of an AlloA carbohydrate ligand and its associated protein of epithelial monolayers following injury mediates repair.  Specific Aim 3. To determine the role of cell surface presentation of AII and its association with tenascin-C, and their interaction, in airway epithelial repair. Lectin histochemsitry staining of wounded human airway epithelial cell monolayers for both lectins, CPA and AlloA, resulted in similar staining patterns. There were differences in their ability to disrupt airway epithelial wound closure rates and precipitated protein profiles. However, both lectins precipitated proteins that are either directly (CPA) or indirectly (AlloA) associated with AII. The association of AII with both lectins provided strong support to pursue the investigation into the role of AII as an essential mediator of airway epithelial repair. AII was initially considered a cytoplasmic protein that participates in membrane events such as endo- and exo-cytosis (122, 147). Recently several groups have demonstrated that a fraction of the total AII pool can be 55  presented on the surface of a variety of cell types (134, 147, 168, 176, 196, 238, 239). Cell surface AII has been identified as a receptor for tenascin-C (176, 196), a candidate viral receptor(145) and a co-receptor in the generation of plasmin (140-143, 175, 240). The extracellular matrix provides not only the site of epithelial attachment, but its composition can be actively involved in cell signalling and activation. Tenascin-C expression is restricted in adult tissues and has been described as a repair ECM protein. Our initial studies involved the identification of AII as a cell surface mediator of repair through its association with two lectin carbohydrate ligands. Using siRNA technology, the objective was to confirm the participation of AII in our model of epithelial wound repair. Furthermore, we investigated if the role of cell surface AII in epithelial repair is to act as an ECM protein receptor to facilitate tenascin-C signalling. Our hypothesis was that AII plays an essential role in airway epithelial repair through its interaction with tenascin-C.  56  References  1.  Harkema, J. R., C. G. Plopper, D. M. Hyde, and J. A. St George. 1987. Regional  differences in quantities of histochemically detectable mucosubstances in nasal, paranasal, and nasopharyngeal epithelium of the bonnet monkey. J Histochem Cytochem 35(3):279-86. 2.  Harkema, J. R., C. G. Plopper, D. M. Hyde, J. A. St George, and D. L.  Dungworth. 1987. Effects of an ambient level of ozone on primate nasal epithelial mucosubstances. Quantitative histochemistry. Am J Pathol 127(1):90-6. 3.  Fishman, A. P., and J. A. Elias. 1998. Fishman's pulmonary diseases and  disorders, 3rd ed. McGraw-Hill, Health Professions Division, New York. 4.  Boyd, M. R. 1977. Evidence for the Clara cell as a site of cytochrome P450-  dependent mixed-function oxidase activity in lung. Nature 269(5630):713-5. 5.  Evans, M. J., S. G. Shami, L. J. Cabral-Anderson, and N. P. Dekker. 1986. Role  of nonciliated cells in renewal of the bronchial epithelium of rats exposed to NO2. Am J Pathol 123(1):126-33. 6.  Boers, J. E., A. W. Ambergen, and F. B. Thunnissen. 1998. Number and  proliferation of basal and parabasal cells in normal human airway epithelium. Am J Respir Crit Care Med 157(6 Pt 1):2000-6.  57  7.  Hong, K. U., S. D. Reynolds, S. Watkins, E. Fuchs, and B. R. Stripp. 2004. Basal  cells are a multipotent progenitor capable of renewing the bronchial epithelium. Am J Pathol 164(2):577-88. 8.  Hong, K. U., S. D. Reynolds, S. Watkins, E. Fuchs, and B. R. Stripp. 2004. In  vivo differentiation potential of tracheal basal cells: evidence for multipotent and unipotent subpopulations. Am J Physiol Lung Cell Mol Physiol 286(4):L643-9. 9.  Evans, M. J., R. A. Cox, S. G. Shami, and C. G. Plopper. 1990. Junctional  adhesion mechanisms in airway basal cells. Am J Respir Cell Mol Biol 3(4):341-7. 10.  Evans, M. J., R. A. Cox, S. G. Shami, B. Wilson, and C. G. Plopper. 1989. The  role of basal cells in attachment of columnar cells to the basal lamina of the trachea. Am J Respir Cell Mol Biol 1(6):463-9. 11.  Evans, M. J., L. S. Van Winkle, M. V. Fanucchi, and C. G. Plopper. 2001.  Cellular and molecular characteristics of basal cells in airway epithelium. Exp Lung Res 27(5):401-15. 12.  Erjefalt, J. S., F. Sundler, and C. G. Persson. 1997. Epithelial barrier formation by  airway basal cells. Thorax 52(3):213-7. 13.  Breeze, R. G., and E. B. Wheeldon. 1977. The cells of the pulmonary airways. Am  Rev Respir Dis 116(4):705-77. 14.  Anderson, J. M., and C. M. Van Itallie. 1995. Tight junctions and the molecular  basis for regulation of paracellular permeability. Am J Physiol 269(4 Pt 1):G467-75. 15.  Schneeberger, E. E., and R. D. Lynch. 1992. Structure, function, and regulation of  cellular tight junctions. Am J Physiol 262(6 Pt 1):L647-61.  58  16.  Wanner, A., M. Salathe, and T. G. O'Riordan. 1996. Mucociliary clearance in the  airways. Am J Respir Crit Care Med 154(6 Pt 1):1868-902. 17.  Caci, E., R. Melani, N. Pedemonte, G. Yueksekdag, R. Ravazzolo, J. Rosenecker,  L. J. Galietta, and O. Zegarra-Moran. 2009. Epithelial sodium channel inhibition in primary human bronchial epithelia by transfected siRNA. Am J Respir Cell Mol Biol 40(2):211-6. 18.  Holtzman, M. J. 1992. Arachidonic acid metabolism in airway epithelial cells.  Annu Rev Physiol 54:303-29. 19.  Holtzman, M. J., V. Zhang, H. Hussain, W. T. Roswit, and J. D. Wilson. 1994.  Prostaglandin H synthase and lipoxygenase gene families in the epithelial cell barrier. Ann N Y Acad Sci 744:58-77. 20.  Savla, U., H. J. Appel, P. H. Sporn, and C. M. Waters. 2001. Prostaglandin E(2)  regulates wound closure in airway epithelium. Am J Physiol Lung Cell Mol Physiol 280(3):L421-31. 21.  Raeburn, D., and S. E. Webber. 1994. Proinflammatory potential of the airway  epithelium in bronchial asthma. Eur Respir J 7(12):2226-33. 22.  Knight, D. A., and S. T. Holgate. 2003. The airway epithelium: structural and  functional properties in health and disease. Respirology 8(4):432-46. 23.  Herard, A. L., D. Pierrot, J. Hinnrasky, H. Kaplan, D. Sheppard, E. Puchelle, and  J. M. Zahm. 1996. Fibronectin and its alpha 5 beta 1-integrin receptor are involved in the wound-repair process of airway epithelium. Am J Physiol 271(5 Pt 1):L726-33.  59  24.  Harkonen, E., I. Virtanen, A. Linnala, L. L. Laitinen, and V. L. Kinnula. 1995.  Modulation of fibronectin and tenascin production in human bronchial epithelial cells by inflammatory cytokines in vitro. Am J Respir Cell Mol Biol 13(1):109-15. 25.  Moore, W. C., and S. P. Peters. 2006. Severe asthma: an overview. J Allergy Clin  Immunol 117(3):487-94; quiz 495. 26.  Bousquet, J., P. J. Bousquet, P. Godard, and J. P. Daures. 2005. The public health  implications of asthma. Bull World Health Organ 83(7):548-54. 27.  Aikawa, T., S. Shimura, H. Sasaki, M. Ebina, and T. Takishima. 1992. Marked  goblet cell hyperplasia with mucus accumulation in the airways of patients who died of severe acute asthma attack. Chest 101(4):916-21. 28.  Bourdin, A., D. Neveu, I. Vachier, F. Paganin, P. Godard, and P. Chanez. 2007.  Specificity of basement membrane thickening in severe asthma. J Allergy Clin Immunol 119(6):1367-74. 29.  Shahana, S., E. Bjornsson, D. Ludviksdottir, C. Janson, O. Nettelbladt, P. Venge,  and G. M. Roomans. 2005. Ultrastructure of bronchial biopsies from patients with allergic and non-allergic asthma. Respir Med 99(4):429-43. 30.  Ebina, M., T. Takahashi, T. Chiba, and M. Motomiya. 1993. Cellular hypertrophy  and hyperplasia of airway smooth muscles underlying bronchial asthma. A 3-D morphometric study. Am Rev Respir Dis 148(3):720-6. 31.  Ebina, M., H. Yaegashi, R. Chiba, T. Takahashi, M. Motomiya, and M.  Tanemura. 1990. Hyperreactive site in the airway tree of asthmatic patients revealed by thickening of bronchial muscles. A morphometric study. Am Rev Respir Dis 141(5 Pt 1):1327-32. 60  32.  Jeffery, P. K. 2001. Remodeling in asthma and chronic obstructive lung disease.  Am J Respir Crit Care Med 164(10 Pt 2):S28-38. 33.  Saetta, M., and G. Turato. 2001. Airway pathology in asthma. Eur Respir J Suppl  34:18s-23s. 34.  Laitinen, L. A., M. Heino, A. Laitinen, T. Kava, and T. Haahtela. 1985. Damage  of the airway epithelium and bronchial reactivity in patients with asthma. Am Rev Respir Dis 131(4):599-606. 35.  Beasley, R., W. R. Roche, J. A. Roberts, and S. T. Holgate. 1989. Cellular events  in the bronchi in mild asthma and after bronchial provocation. Am Rev Respir Dis 139(3):806-17. 36.  Chu, H. W., J. L. Halliday, R. J. Martin, D. Y. Leung, S. J. Szefler, and S. E.  Wenzel. 1998. Collagen deposition in large airways may not differentiate severe asthma from milder forms of the disease. Am J Respir Crit Care Med 158(6):1936-44. 37.  Barbato, A., G. Turato, S. Baraldo, E. Bazzan, F. Calabrese, C. Panizzolo, M. E.  Zanin, R. Zuin, P. Maestrelli, L. M. Fabbri, and M. Saetta. 2006. Epithelial damage and angiogenesis in the airways of children with asthma. Am J Respir Crit Care Med 174(9):975-81. 38.  Kim, E. S., S. H. Kim, K. W. Kim, J. W. Park, Y. S. Kim, M. H. Sohn, and K. E.  Kim. 2007. Basement membrane thickening and clinical features of children with asthma. Allergy 62(6):635-40. 39.  Cutz, E., H. Levison, and D. M. Cooper. 1978. Ultrastructure of airways in  children with asthma. Histopathology 2(6):407-21. 40.  Holgate, S. T. 1997. Asthma genetics: waiting to exhale. Nat Genet 15(3):227-9. 61  41.  Holgate, S. T., D. E. Davies, S. Rorke, J. Cakebread, G. Murphy, R. M. Powell,  and J. W. Holloway. 2004. ADAM 33 and its association with airway remodeling and hyperresponsiveness in asthma. Clin Rev Allergy Immunol 27(1):23-34. 42.  Puxeddu, I., Y. Y. Pang, A. Harvey, H. M. Haitchi, B. Nicholas, H. Yoshisue, D.  Ribatti, G. Clough, R. M. Powell, G. Murphy, N. A. Hanley, D. I. Wilson, P. H. Howarth, S. T. Holgate, and D. E. Davies. 2008. The soluble form of a disintegrin and metalloprotease 33 promotes angiogenesis: implications for airway remodeling in asthma. J Allergy Clin Immunol 121(6):1400-6, 1406 e1-4. 43.  Green, R. H., C. E. Brightling, S. McKenna, B. Hargadon, D. Parker, P. Bradding,  A. J. Wardlaw, and I. D. Pavord. 2002. Asthma exacerbations and sputum eosinophil counts: a randomised controlled trial. Lancet 360(9347):1715-21. 44.  Miller, M. K., C. Johnson, D. P. Miller, Y. Deniz, E. R. Bleecker, and S. E.  Wenzel. 2005. Severity assessment in asthma: An evolving concept. J Allergy Clin Immunol 116(5):990-5. 45.  Wenzel, S. E. 2006. Asthma: defining of the persistent adult phenotypes. Lancet  368(9537):804-13. 46.  Adcock, I. M., and K. Ito. 2004. Steroid resistance in asthma: a major problem  requiring novel solutions or a non-issue? Curr Opin Pharmacol 4(3):257-62. 47.  Heaney, L. G., and D. S. Robinson. 2005. Severe asthma treatment: need for  characterising patients. Lancet 365(9463):974-6. 48.  Miranda, C., A. Busacker, S. Balzar, J. Trudeau, and S. E. Wenzel. 2004.  Distinguishing severe asthma phenotypes: role of age at onset and eosinophilic inflammation. J Allergy Clin Immunol 113(1):101-8. 62  49.  Mochizuki, H., M. Mitsuhashi, M. Shigeta, K. Tokuyama, K. Tajima, A.  Morikawa, and T. Kuroume. 1987. Bronchial hyperresponsiveness in children with atopic and nonatopic asthma. J Asthma 24(2):75-80. 50.  Mochizuki, H., M. Shigeta, K. Tokuyama, and A. Morikawa. 1999. Difference in  airway reactivity in children with atopic vs nonatopic asthma. Chest 116(3):619-24. 51.  Simpson, J. L., R. J. Scott, M. J. Boyle, and P. G. Gibson. 2005. Differential  proteolytic enzyme activity in eosinophilic and neutrophilic asthma. Am J Respir Crit Care Med 172(5):559-65. 52.  Balzar, S., H. W. Chu, P. Silkoff, M. Cundall, J. B. Trudeau, M. Strand, and S.  Wenzel. 2005. Increased TGF-beta2 in severe asthma with eosinophilia. J Allergy Clin Immunol 115(1):110-7. 53.  Chu, H. W., S. Balzar, J. Y. Westcott, J. B. Trudeau, Y. Sun, D. J. Conrad, and S.  E. Wenzel. 2002. Expression and activation of 15-lipoxygenase pathway in severe asthma: relationship to eosinophilic phenotype and collagen deposition. Clin Exp Allergy 32(11):1558-65. 54.  Wenzel, S. E., L. B. Schwartz, E. L. Langmack, J. L. Halliday, J. B. Trudeau, R.  L. Gibbs, and H. W. Chu. 1999. Evidence that severe asthma can be divided pathologically into two inflammatory subtypes with distinct physiologic and clinical characteristics. Am J Respir Crit Care Med 160(3):1001-8. 55.  Jeffery, P. K., A. J. Wardlaw, F. C. Nelson, J. V. Collins, and A. B. Kay. 1989.  Bronchial biopsies in asthma. An ultrastructural, quantitative study and correlation with hyperreactivity. Am Rev Respir Dis 140(6):1745-53.  63  56.  Lange, P., J. Parner, J. Vestbo, P. Schnohr, and G. Jensen. 1998. A 15-year  follow-up study of ventilatory function in adults with asthma. N Engl J Med 339(17):1194-200. 57.  Brown, P. J., H. W. Greville, and K. E. Finucane. 1984. Asthma and irreversible  airflow obstruction. Thorax 39(2):131-6. 58.  Bousquet, J., P. K. Jeffery, W. W. Busse, M. Johnson, and A. M. Vignola. 2000.  Asthma. From bronchoconstriction to airways inflammation and remodeling. Am J Respir Crit Care Med 161(5):1720-45. 59.  Lackie, P. M., J. E. Baker, U. Gunthert, and S. T. Holgate. 1997. Expression of  CD44 isoforms is increased in the airway epithelium of asthmatic subjects. Am J Respir Cell Mol Biol 16(1):14-22. 60.  Puddicombe, S. M., R. Polosa, A. Richter, M. T. Krishna, P. H. Howarth, S. T.  Holgate, and D. E. Davies. 2000. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. Faseb J 14(10):1362-74. 61.  Vignola, A. M., P. Chanez, A. M. Campbell, F. Souques, B. Lebel, I. Enander,  and J. Bousquet. 1998. Airway inflammation in mild intermittent and in persistent asthma. Am J Respir Crit Care Med 157(2):403-9. 62.  Laitinen, L. A., A. Laitinen, and T. Haahtela. 1993. Airway mucosal  inflammation even in patients with newly diagnosed asthma. Am Rev Respir Dis 147(3):697-704. 63.  Erjefalt, J. S., I. Erjefalt, F. Sundler, and C. G. Persson. 1994. Microcirculation-  derived factors in airway epithelial repair in vivo. Microvasc Res 48(2):161-78.  64  64.  Erjefalt, J. S., I. Erjefalt, F. Sundler, and C. G. Persson. 1995. In vivo restitution  of airway epithelium. Cell Tissue Res 281(2):305-16. 65.  Allahverdian, S., B. J. Patchell, and D. R. Dorscheid. 2006. Carbohydrates and  epithelial repair - more than just post-translational modification. Curr Drug Targets 7(5):597-606. 66.  Shimizu, T., M. Nishihara, S. Kawaguchi, and Y. Sakakura. 1994. Expression of  phenotypic markers during regeneration of rat tracheal epithelium following mechanical injury. Am J Respir Cell Mol Biol 11(1):85-94. 67.  Drew, A. F., H. Liu, J. M. Davidson, C. C. Daugherty, and J. L. Degen. 2001.  Wound-healing defects in mice lacking fibrinogen. Blood 97(12):3691-8. 68.  Kao, W. W., C. W. Kao, A. H. Kaufman, K. W. Kombrinck, R. L. Converse, W.  V. Good, T. H. Bugge, and J. L. Degen. 1998. Healing of corneal epithelial defects in plasminogen- and fibrinogen-deficient mice. Invest Ophthalmol Vis Sci 39(3):502-8. 69.  Bugge, T. H., K. W. Kombrinck, M. J. Flick, C. C. Daugherty, M. J. Danton, and  J. L. Degen. 1996. Loss of fibrinogen rescues mice from the pleiotropic effects of plasminogen deficiency. Cell 87(4):709-19. 70.  Romer, J., T. H. Bugge, C. Pyke, L. R. Lund, M. J. Flick, J. L. Degen, and K.  Dano. 1996. Impaired wound healing in mice with a disrupted plasminogen gene. Nat Med 2(3):287-92. 71.  Zahm, J. M., M. Chevillard, and E. Puchelle. 1991. Wound repair of human  surface respiratory epithelium. Am J Respir Cell Mol Biol 5(3):242-8.  65  72.  Huveneers, S., H. Truong, R. Fassler, A. Sonnenberg, and E. H. Danen. 2008.  Binding of soluble fibronectin to integrin alpha5 beta1 - link to focal adhesion redistribution and contractile shape. J Cell Sci 121(Pt 15):2452-62. 73.  Filipenko, N. R., S. Attwell, C. Roskelley, and S. Dedhar. 2005. Integrin-linked  kinase activity regulates Rac- and Cdc42-mediated actin cytoskeleton reorganization via alpha-PIX. Oncogene 24(38):5837-49. 74.  Hynes, R. O. 2002. Integrins: bidirectional, allosteric signaling machines. Cell  110(6):673-87. 75.  Humphries, J. D., P. Wang, C. Streuli, B. Geiger, M. J. Humphries, and C.  Ballestrem. 2007. Vinculin controls focal adhesion formation by direct interactions with talin and actin. J Cell Biol 179(5):1043-57. 76.  Zaidel-Bar, R., C. Ballestrem, Z. Kam, and B. Geiger. 2003. Early molecular  events in the assembly of matrix adhesions at the leading edge of migrating cells. J Cell Sci 116(Pt 22):4605-13. 77.  Zhang, X., G. Jiang, Y. Cai, S. J. Monkley, D. R. Critchley, and M. P. Sheetz.  2008. Talin depletion reveals independence of initial cell spreading from integrin activation and traction. Nat Cell Biol 10(9):1062-8. 78.  Franco, S. J., M. A. Rodgers, B. J. Perrin, J. Han, D. A. Bennin, D. R. Critchley,  and A. Huttenlocher. 2004. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol 6(10):977-83. 79.  Xu, W., H. Baribault, and E. D. Adamson. 1998. Vinculin knockout results in  heart and brain defects during embryonic development. Development 125(2):327-37.  66  80.  Ilic, D., Y. Furuta, S. Kanazawa, N. Takeda, K. Sobue, N. Nakatsuji, S. Nomura,  J. Fujimoto, M. Okada, and T. Yamamoto. 1995. Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 377(6549):539-44. 81.  Webb, D. J., K. Donais, L. A. Whitmore, S. M. Thomas, C. E. Turner, J. T.  Parsons, and A. F. Horwitz. 2004. FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol 6(2):154-61. 82.  Cary, L. A., D. C. Han, T. R. Polte, S. K. Hanks, and J. L. Guan. 1998.  Identification of p130Cas as a mediator of focal adhesion kinase-promoted cell migration. J Cell Biol 140(1):211-21. 83.  Schaller, M. D., and J. T. Parsons. 1995. pp125FAK-dependent tyrosine  phosphorylation of paxillin creates a high-affinity binding site for Crk. Mol Cell Biol 15(5):2635-45. 84.  Richardson, A., R. K. Malik, J. D. Hildebrand, and J. T. Parsons. 1997. Inhibition  of cell spreading by expression of the C-terminal domain of focal adhesion kinase (FAK) is rescued by coexpression of Src or catalytically inactive FAK: a role for paxillin tyrosine phosphorylation. Mol Cell Biol 17(12):6906-14. 85.  Manes, S., E. Mira, C. Gomez-Mouton, Z. J. Zhao, R. A. Lacalle, and A. C.  Martinez. 1999. Concerted activity of tyrosine phosphatase SHP-2 and focal adhesion kinase in regulation of cell motility. Mol Cell Biol 19(4):3125-35. 86.  Yu, D. H., C. K. Qu, O. Henegariu, X. Lu, and G. S. Feng. 1998. Protein-tyrosine  phosphatase Shp-2 regulates cell spreading, migration, and focal adhesion. J Biol Chem 273(33):21125-31. 67  87.  Barford, D., and B. G. Neel. 1998. Revealing mechanisms for SH2 domain  mediated regulation of the protein tyrosine phosphatase SHP-2. Structure 6(3):249-54. 88.  Neel, B. G., H. Gu, and L. Pao. 2003. The 'Shp'ing news: SH2 domain-containing  tyrosine phosphatases in cell signaling. Trends Biochem Sci 28(6):284-93. 89.  Feng, G. S. 1999. Shp-2 tyrosine phosphatase: signaling one cell or many. Exp  Cell Res 253(1):47-54. 90.  Van Vactor, D., A. M. O'Reilly, and B. G. Neel. 1998. Genetic analysis of protein  tyrosine phosphatases. Curr Opin Genet Dev 8(1):112-26. 91.  Inagaki, K., T. Noguchi, T. Matozaki, T. Horikawa, K. Fukunaga, M. Tsuda, M.  Ichihashi, and M. Kasuga. 2000. Roles for the protein tyrosine phosphatase SHP-2 in cytoskeletal organization, cell adhesion and cell migration revealed by overexpression of a dominant negative mutant. Oncogene 19(1):75-84. 92.  Oh, E. S., H. Gu, T. M. Saxton, J. F. Timms, S. Hausdorff, E. U. Frevert, B. B.  Kahn, T. Pawson, B. G. Neel, and S. M. Thomas. 1999. Regulation of early events in integrin signaling by protein tyrosine phosphatase SHP-2. Mol Cell Biol 19(4):3205-15. 93.  Schoenwaelder, S. M., L. A. Petch, D. Williamson, R. Shen, G. S. Feng, and K.  Burridge. 2000. The protein tyrosine phosphatase Shp-2 regulates RhoA activity. Curr Biol 10(23):1523-6. 94.  Yoo, J. C., and M. J. Hayman. 2007. Annexin II binds to SHP2 and this  interaction is regulated by HSP70 levels. Biochem Biophys Res Commun 356(4):906-11. 95.  Burkart, A., B. Samii, S. Corvera, and H. S. Shpetner. 2003. Regulation of the  SHP-2 tyrosine phosphatase by a novel cholesterol- and cell confluence-dependent mechanism. J Biol Chem 278(20):18360-7. 68  96.  Farooqui, R., and G. Fenteany. 2005. Multiple rows of cells behind an epithelial  wound edge extend cryptic lamellipodia to collectively drive cell-sheet movement. J Cell Sci 118(Pt 1):51-63. 97.  Sandquist, J. C., K. I. Swenson, K. A. Demali, K. Burridge, and A. R. Means.  2006. Rho kinase differentially regulates phosphorylation of nonmuscle myosin II isoforms A and B during cell rounding and migration. J Biol Chem 281(47):35873-83. 98.  Ho, H. Y., R. Rohatgi, A. M. Lebensohn, M. Le, J. Li, S. P. Gygi, and M. W.  Kirschner. 2004. Toca-1 mediates Cdc42-dependent actin nucleation by activating the NWASP-WIP complex. Cell 118(2):203-16. 99.  Rohatgi, R., L. Ma, H. Miki, M. Lopez, T. Kirchhausen, T. Takenawa, and M. W.  Kirschner. 1999. The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97(2):221-31. 100.  Yamazaki, D., T. Oikawa, and T. Takenawa. 2007. Rac-WAVE-mediated actin  reorganization is required for organization and maintenance of cell-cell adhesion. J Cell Sci 120(Pt 1):86-100. 101.  Applewhite, D. A., M. Barzik, S. Kojima, T. M. Svitkina, F. B. Gertler, and G. G.  Borisy. 2007. Ena/VASP proteins have an anti-capping independent function in filopodia formation. Mol Biol Cell 18(7):2579-91. 102.  Breitsprecher, D., A. K. Kiesewetter, J. Linkner, C. Urbanke, G. P. Resch, J. V.  Small, and J. Faix. 2008. Clustering of VASP actively drives processive, WH2 domainmediated actin filament elongation. Embo J 27(22):2943-54.  69  103.  Thiel, C., M. Osborn, and V. Gerke. 1992. The tight association of the tyrosine  kinase substrate annexin II with the submembranous cytoskeleton depends on intact p11and Ca(2+)-binding sites. J Cell Sci 103 ( Pt 3):733-42. 104.  Rescher, U., D. Ruhe, C. Ludwig, N. Zobiack, and V. Gerke. 2004. Annexin 2 is a  phosphatidylinositol (4,5)-bisphosphate binding protein recruited to actin assembly sites at cellular membranes. J Cell Sci 117(Pt 16):3473-80. 105.  Lis, H., and N. Sharon. 1993. Protein glycosylation. Structural and functional  aspects. Eur J Biochem 218(1):1-27. 106.  Szymanski, C. M., and B. W. Wren. 2005. Protein glycosylation in bacterial  mucosal pathogens. Nat Rev Microbiol 3(3):225-37. 107.  Dorscheid, D. R., K. R. Wojcik, K. Yule, and S. R. White. 2001. Role of cell  surface glycosylation in mediating repair of human airway epithelial cell monolayers. Am J Physiol Lung Cell Mol Physiol 281(4):L982-92. 108.  Schwarz, R. T., and H. D. Klenk. 1974. Inhibition of glycosylation of the  influenza virus hemagglutinin. J Virol 14(5):1023-34. 109.  Bernard, B. A., K. M. Yamada, and K. Olden. 1982. Carbohydrates selectively  protect a specific domain of fibronectin against proteases. J Biol Chem 257(14):8549-54. 110.  Fullekrug, J., and K. Simons. 2004. Lipid rafts and apical membrane traffic. Ann  N Y Acad Sci 1014:164-9. 111.  Brown, D. A., and E. London. 1998. Functions of lipid rafts in biological  membranes. Annu Rev Cell Dev Biol 14:111-36. 112.  Simons, K., and E. Ikonen. 1997. Functional rafts in cell membranes. Nature  387(6633):569-72. 70  113.  Dorscheid, D. R., A. E. Conforti, K. J. Hamann, K. F. Rabe, and S. R. White.  1999. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J 31(3):145-51. 114.  Zheng, T., D. Peelen, and L. M. Smith. 2005. Lectin arrays for profiling cell  surface carbohydrate expression. J Am Chem Soc 127(28):9982-3. 115.  Adam, E., S. Holgate, C. Fildew, and P. Lackie. 2003. Role of carbohydrates in  repair of human respiratory epithelium using an in vitro model. Clin Exp Allergy 33(10):1398-1404. 116.  Sueyoshi, S., K. Yamamoto, and T. Osawa. 1988. Carbohydrate binding  specificity of a beetle (Allomyrina dichotoma) lectin. J Biochem (Tokyo) 103(5):894-9. 117.  Patchell, B. J., and D. R. Dorscheid. 2006. Repair of the injury to respiratory  epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins. Clin Exp Allergy 36(5):585-93. 118.  Patchell, B. J., K. R. Wojcik, T. L. Yang, S. R. White, and D. R. Dorscheid. 2007.  Glycosylation and annexin II cell surface translocation mediate airway epithelial wound repair. Am J Physiol Lung Cell Mol Physiol 293(2):L354-63. 119.  Geisow, M. J. 1986. Common domain structure of Ca2+ and lipid-binding  proteins. FEBS Lett 203(1):99-103. 120.  Rescher, U., and V. Gerke. 2004. Annexins--unique membrane binding proteins  with diverse functions. J Cell Sci 117(Pt 13):2631-9. 121.  Moss, S. E., and R. O. Morgan. 2004. The annexins. Genome Biol 5(4):219.  71  122.  Emans, N., J. P. Gorvel, C. Walter, V. Gerke, R. Kellner, G. Griffiths, and J.  Gruenberg. 1993. Annexin II is a major component of fusogenic endosomal vesicles. J Cell Biol 120(6):1357-69. 123.  Ali, S. M., and R. D. Burgoyne. 1990. The stimulatory effect of calpactin  (annexin II) on calcium-dependent exocytosis in chromaffin cells: requirement for both the N-terminal and core domains of p36 and ATP. Cell Signal 2(3):265-76. 124.  Ali, S. M., M. J. Geisow, and R. D. Burgoyne. 1989. A role for calpactin in  calcium-dependent exocytosis in adrenal chromaffin cells. Nature 340(6231):313-5. 125.  Burgoyne, R. D., A. Morgan, and D. Roth. 1994. Characterization of proteins that  regulate calcium-dependent exocytosis in adrenal chromaffin cells. Ann N Y Acad Sci 710:333-46. 126.  Creutz, C. E. 1992. The annexins and exocytosis. Science 258(5084):924-31.  127.  Morgan, A., D. Roth, H. Martin, A. Aitken, and R. D. Burgoyne. 1993.  Identification of cytosolic protein regulators of exocytosis. Biochem Soc Trans 21(2):401-5. 128.  Bailleux, A., D. Wendum, F. Audubert, A. M. Jouniaux, K. Koumanov, G.  Trugnan, and J. Masliah. 2004. Cytosolic phospholipase A2-p11 interaction controls arachidonic acid release as a function of epithelial cell confluence. Biochem J 378(Pt 2):307-15. 129.  Huang, K. S., B. P. Wallner, R. J. Mattaliano, R. Tizard, C. Burne, A. Frey, C.  Hession, P. McGray, L. K. Sinclair, E. P. Chow, and et al. 1986. Two human 35 kd inhibitors of phospholipase A2 are related to substrates of pp60v-src and of the epidermal growth factor receptor/kinase. Cell 46(2):191-9. 72  130.  Kim, S., J. Ko, J. H. Kim, E. C. Choi, and D. S. Na. 2001. Differential effects of  annexins I, II, III, and V on cytosolic phospholipase A2 activity: specific interaction model. FEBS Lett 489(2-3):243-8. 131.  Genge, B. R., X. Cao, L. N. Wu, W. R. Buzzi, R. W. Showman, A. L. Arsenault,  Y. Ishikawa, and R. E. Wuthier. 1992. Establishment of the primary structure of the major lipid-dependent Ca2+ binding proteins of chicken growth plate cartilage matrix vesicles: identity with anchorin CII (annexin V) and annexin II. J Bone Miner Res 7(7):807-19. 132.  Kirsch, T., and M. Pfaffle. 1992. Selective binding of anchorin CII (annexin V) to  type II and X collagen and to chondrocalcin (C-propeptide of type II collagen). Implications for anchoring function between matrix vesicles and matrix proteins. FEBS Lett 310(2):143-7. 133.  Pfaffle, M., F. Ruggiero, H. Hofmann, M. P. Fernandez, O. Selmin, Y. Yamada,  R. Garrone, and K. von der Mark. 1988. Biosynthesis, secretion and extracellular localization of anchorin CII, a collagen-binding protein of the calpactin family. Embo J 7(8):2335-42. 134.  Tressler, R. J., T. V. Updyke, T. Yeatman, and G. L. Nicolson. 1993.  Extracellular annexin II is associated with divalent cation-dependent tumor cellendothelial cell adhesion of metastatic RAW117 large-cell lymphoma cells. J Cell Biochem 53(3):265-76. 135.  Tressler, R. J., T. Yeatman, and G. L. Nicolson. 1994. Extracellular annexin VI  expression is associated with divalent cation-dependent endothelial cell adhesion of metastatic RAW117 large-cell lymphoma cells. Exp Cell Res 215(2):395-400. 73  136.  Yeatman, T. J., T. V. Updyke, M. A. Kaetzel, J. R. Dedman, and G. L. Nicolson.  1993. Expression of annexins on the surfaces of non-metastatic and metastatic human and rodent tumor cells. Clin Exp Metastasis 11(1):37-44. 137.  Kundranda, M. N., S. Ray, M. Saria, D. Friedman, L. M. Matrisian, P. Lukyanov,  and J. Ochieng. 2004. Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A. Biochim Biophys Acta 1693(2):111-23. 138.  Deora, A. B., G. Kreitzer, A. T. Jacovina, and K. A. Hajjar. 2004. An annexin 2  phosphorylation switch mediates p11-dependent translocation of annexin 2 to the cell surface. J Biol Chem 279(42):43411-8. 139.  Peterson, E. A., M. R. Sutherland, M. E. Nesheim, and E. L. Pryzdial. 2003.  Thrombin induces endothelial cell-surface exposure of the plasminogen receptor annexin 2. J Cell Sci 116(Pt 12):2399-408. 140.  Cesarman, G. M., C. A. Guevara, and K. A. Hajjar. 1994. An endothelial cell  receptor for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated enhancement of t-PA-dependent plasminogen activation. J Biol Chem 269(33):21198203. 141.  Diaz, V. M., M. Hurtado, T. M. Thomson, J. Reventos, and R. Paciucci. 2004.  Specific interaction of tissue-type plasminogen activator (t-PA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro. Gut 53(7):993-1000. 142.  Kim, J., and K. A. Hajjar. 2002. Annexin II: a plasminogen-plasminogen activator  co-receptor. Front Biosci 7:d341-8.  74  143.  Zhang, X., H. Zhou, G. Shen, Z. Liu, Y. Hu, W. Wei, and S. Song. 2002. Study  on the mechanism of the annexin II-mediated co-assembly of t-PA and plasminogen. J Huazhong Univ Sci Technolog Med Sci 22(1):21-3, 76. 144.  Raynor, C. M., J. F. Wright, D. M. Waisman, and E. L. Pryzdial. 1999. Annexin  II enhances cytomegalovirus binding and fusion to phospholipid membranes. Biochemistry 38(16):5089-95. 145.  Malhotra, R., M. Ward, H. Bright, R. Priest, M. R. Foster, M. Hurle, E. Blair, and  M. Bird. 2003. Isolation and characterisation of potential respiratory syncytial virus receptor(s) on epithelial cells. Microbes Infect 5(2):123-33. 146.  Puisieux, A., J. Ji, and M. Ozturk. 1996. Annexin II up-regulates cellular levels of  p11 protein by a post-translational mechanisms. Biochem J 313 ( Pt 1):51-5. 147.  Waisman, D. M. 1995. Annexin II tetramer: structure and function. Mol Cell  Biochem 149-150:301-22. 148.  Glenney, J. 1986. Phospholipid-dependent Ca2+ binding by the 36-kDa tyrosine  kinase substrate (calpactin) and its 33-kDa core. J Biol Chem 261(16):7247-52. 149.  Johnsson, N., J. Vandekerckhove, J. Van Damme, and K. Weber. 1986. Binding  sites for calcium, lipid and p11 on p36, the substrate of retroviral tyrosine-specific protein kinases. FEBS Lett 198(2):361-4. 150.  Glenney, J. R., Jr., B. Tack, and M. A. Powell. 1987. Calpactins: two distinct  Ca++-regulated phospholipid- and actin-binding proteins isolated from lung and placenta. J Cell Biol 104(3):503-11.  75  151.  Jones, P. G., G. J. Moore, and D. M. Waisman. 1992. A nonapeptide to the  putative F-actin binding site of annexin-II tetramer inhibits its calcium-dependent activation of actin filament bundling. J Biol Chem 267(20):13993-7. 152.  Jindal, H. K., and J. K. Vishwanatha. 1990. Purification and characterization of  primer recognition proteins from HeLa cells. Biochemistry 29(20):4767-73. 153.  Gerke, V., C. E. Creutz, and S. E. Moss. 2005. Annexins: linking Ca2+ signalling  to membrane dynamics. Nat Rev Mol Cell Biol 6(6):449-61. 154.  Jost, M., D. Zeuschner, J. Seemann, K. Weber, and V. Gerke. 1997. Identification  and characterization of a novel type of annexin-membrane interaction: Ca2+ is not required for the association of annexin II with early endosomes. J Cell Sci 110 ( Pt 2):221-8. 155.  Nilius, B., V. Gerke, J. Prenen, G. Szucs, S. Heinke, K. Weber, and G.  Droogmans. 1996. Annexin II modulates volume-activated chloride currents in vascular endothelial cells. J Biol Chem 271(48):30631-6. 156.  Simons, K., and D. Toomre. 2000. Lipid rafts and signal transduction. Nat Rev  Mol Cell Biol 1(1):31-9. 157.  Harder, T., and V. Gerke. 1994. The annexin II2p11(2) complex is the major  protein component of the triton X-100-insoluble low-density fraction prepared from MDCK cells in the presence of Ca2+. Biochim Biophys Acta 1223(3):375-82. 158.  Oliferenko, S., K. Paiha, T. Harder, V. Gerke, C. Schwarzler, H. Schwarz, H.  Beug, U. Gunthert, and L. A. Huber. 1999. Analysis of CD44-containing lipid rafts: Recruitment of annexin II and stabilization by the actin cytoskeleton. J Cell Biol 146(4):843-54. 76  159.  Harder, T., R. Kellner, R. G. Parton, and J. Gruenberg. 1997. Specific release of  membrane-bound annexin II and cortical cytoskeletal elements by sequestration of membrane cholesterol. Mol Biol Cell 8(3):533-45. 160.  Gerke, V., and K. Weber. 1984. Identity of p36K phosphorylated upon Rous  sarcoma virus transformation with a protein purified from brush borders; calciumdependent binding to non-erythroid spectrin and F-actin. Embo J 3(1):227-33. 161.  Babiychuk, E. B., and A. Draeger. 2000. Annexins in cell membrane dynamics.  Ca(2+)-regulated association of lipid microdomains. J Cell Biol 150(5):1113-24. 162.  Jacob, R., M. Heine, J. Eikemeyer, N. Frerker, K. P. Zimmer, U. Rescher, V.  Gerke, and H. Y. Naim. 2004. Annexin II is required for apical transport in polarized epithelial cells. J Biol Chem 279(5):3680-4. 163.  Marenholz, I., C. W. Heizmann, and G. Fritz. 2004. S100 proteins in mouse and  man: from evolution to function and pathology (including an update of the nomenclature). Biochem Biophys Res Commun 322(4):1111-22. 164.  Erikson, E., H. G. Tomasiewicz, and R. L. Erikson. 1984. Biochemical  characterization of a 34-kilodalton normal cellular substrate of pp60v-src and an associated 6-kilodalton protein. Mol Cell Biol 4(1):77-85. 165.  Powell, M. A., and J. R. Glenney. 1987. Regulation of calpactin I phospholipid  binding by calpactin I light-chain binding and phosphorylation by p60v-src. Biochem J 247(2):321-8. 166.  Goulet, F., K. G. Moore, and A. C. Sartorelli. 1992. Glycosylation of annexin I  and annexin II. Biochem Biophys Res Commun 188(2):554-8.  77  167.  Roskoski, R., Jr. 2005. Src kinase regulation by phosphorylation and  dephosphorylation. Biochem Biophys Res Commun 331(1):1-14. 168.  Siever, D. A., and H. P. Erickson. 1997. Extracellular annexin II. Int J Biochem  Cell Biol 29(11):1219-23. 169.  Swairjo, M. A., and B. A. Seaton. 1994. Annexin structure and membrane  interactions: a molecular perspective. Annu Rev Biophys Biomol Struct 23:193-213. 170.  Filipenko, N. R., H. M. Kang, and D. M. Waisman. 2000. Characterization of the  Ca2+-binding sites of annexin II tetramer. J Biol Chem 275(49):38877-84. 171.  Shabir, S., and J. Southgate. 2008. Calcium signalling in wound-responsive  normal human urothelial cell monolayers. Cell Calcium 44(5):453-64. 172.  Hughes, R. C. 1999. Secretion of the galectin family of mammalian carbohydrate-  binding proteins. Biochim Biophys Acta 1473(1):172-85. 173.  Nickel, W. 2003. The mystery of nonclassical protein secretion. A current view  on cargo proteins and potential export routes. Eur J Biochem 270(10):2109-19. 174.  Seelenmeyer, C., S. Wegehingel, I. Tews, M. Kunzler, M. Aebi, and W. Nickel.  2005. Cell surface counter receptors are essential components of the unconventional export machinery of galectin-1. J Cell Biol 171(2):373-81. 175.  Hajjar, K. A., A. T. Jacovina, and J. Chacko. 1994. An endothelial cell receptor  for plasminogen/tissue plasminogen activator. I. Identity with annexin II. J Biol Chem 269(33):21191-7. 176.  Chung, C. Y., and H. P. Erickson. 1994. Cell surface annexin II is a high affinity  receptor for the alternatively spliced segment of tenascin-C. J Cell Biol 126(2):539-48.  78  177.  Merker, H. J. 1994. Morphology of the basement membrane. Microsc Res Tech  28(2):95-124. 178.  Jeffery, P. K. 1992. Pathology of asthma. Br Med Bull 48(1):23-39.  179.  Sobonya, R. E. 1984. Quantitative structural alterations in long-standing allergic  asthma. Am Rev Respir Dis 130(2):289-92. 180.  Lambert, R. K., S. L. Codd, M. R. Alley, and R. J. Pack. 1994. Physical  determinants of bronchial mucosal folding. J Appl Physiol 77(3):1206-16. 181.  Okazawa, M., T. R. Bai, B. R. Wiggs, and P. D. Pare. 1993. Airway smooth  muscle shortening in excised canine lung lobes. J Appl Physiol 74(4):1613-21. 182.  Boulet, L. P., H. Turcotte, M. Laviolette, F. Naud, M. C. Bernier, S. Martel, and J.  Chakir. 2000. Airway hyperresponsiveness, inflammation, and subepithelial collagen deposition in recently diagnosed versus long-standing mild asthma. Influence of inhaled corticosteroids. Am J Respir Crit Care Med 162(4 Pt 1):1308-13. 183.  Fabbri, L. M., and S. Stoloff. 2005. Is mild asthma really 'mild'? Int J Clin Pract  59(6):692-703. 184.  Wilson, J. W., and X. Li. 1997. The measurement of reticular basement  membrane and submucosal collagen in the asthmatic airway. Clin Exp Allergy 27(4):36371. 185.  Laitinen, A., A. Altraja, M. Kampe, M. Linden, I. Virtanen, and L. A. Laitinen.  1997. Tenascin is increased in airway basement membrane of asthmatics and decreased by an inhaled steroid. Am J Respir Crit Care Med 156(3 Pt 1):951-8. 186.  Roche, W. R., R. Beasley, J. H. Williams, and S. T. Holgate. 1989. Subepithelial  fibrosis in the bronchi of asthmatics. Lancet 1(8637):520-4. 79  187.  Chakir, J., M. Laviolette, M. Boutet, R. Laliberte, J. Dube, and L. P. Boulet. 1996.  Lower airways remodeling in nonasthmatic subjects with allergic rhinitis. Lab Invest 75(5):735-44. 188.  Minshall, E., J. Chakir, M. Laviolette, S. Molet, Z. Zhu, R. Olivenstein, J. A.  Elias, and Q. Hamid. 2000. IL-11 expression is increased in severe asthma: association with epithelial cells and eosinophils. J Allergy Clin Immunol 105(2 Pt 1):232-8. 189.  White, S. R., K. R. Wojcik, D. Gruenert, S. Sun, and D. R. Dorscheid. 2001.  Airway epithelial cell wound repair mediated by alpha-dystroglycan. Am J Respir Cell Mol Biol 24(2):179-86. 190.  Holgate, S. T., D. E. Davies, P. M. Lackie, S. J. Wilson, S. M. Puddicombe, and J.  L. Lordan. 2000. Epithelial-mesenchymal interactions in the pathogenesis of asthma. J Allergy Clin Immunol 105(2 Pt 1):193-204. 191.  Snyder, J. C., A. C. Zemke, and B. R. Stripp. 2008. Reparative Capacity of  Airway Epithelium Impacts Deposition and Remodeling of Extracellular Matrix. Am J Respir Cell Mol Biol. 192.  Buisson, A. C., J. M. Zahm, M. Polette, D. Pierrot, G. Bellon, E. Puchelle, P.  Birembaut, and J. M. Tournier. 1996. Gelatinase B is involved in the in vitro wound repair of human respiratory epithelium. J Cell Physiol 166(2):413-26. 193.  Legrand, C., C. Gilles, J. M. Zahm, M. Polette, A. C. Buisson, H. Kaplan, P.  Birembaut, and J. M. Tournier. 1999. Airway epithelial cell migration dynamics. MMP-9 role in cell-extracellular matrix remodeling. J Cell Biol 146(2):517-29.  80  194.  Dunsmore, S. E., U. K. Saarialho-Kere, J. D. Roby, C. L. Wilson, L. M.  Matrisian, H. G. Welgus, and W. C. Parks. 1998. Matrilysin expression and function in airway epithelium. J Clin Invest 102(7):1321-31. 195.  Buisson, A. C., C. Gilles, M. Polette, J. M. Zahm, P. Birembaut, and J. M.  Tournier. 1996. Wound repair-induced expression of a stromelysins is associated with the acquisition of a mesenchymal phenotype in human respiratory epithelial cells. Lab Invest 74(3):658-69. 196.  Chung, C. Y., J. E. Murphy-Ullrich, and H. P. Erickson. 1996. Mitogenesis, cell  migration, and loss of focal adhesions induced by tenascin-C interacting with its cell surface receptor, annexin II. Mol Biol Cell 7(6):883-92. 197.  Erickson, H. P., and M. A. Bourdon. 1989. Tenascin: an extracellular matrix  protein prominent in specialized embryonic tissues and tumors. Annu Rev Cell Biol 5:7192. 198.  Erickson, H. P., and J. L. Inglesias. 1984. A six-armed oligomer isolated from cell  surface fibronectin preparations. Nature 311(5983):267-9. 199.  Bourdon, M. A., T. J. Matthews, S. V. Pizzo, and D. D. Bigner. 1985.  Immunochemical and biochemical characterization of a glioma-associated extracellular matrix glycoprotein. J Cell Biochem 28(3):183-95. 200.  Taylor, H. C., V. A. Lightner, W. F. Beyer, Jr., D. McCaslin, G. Briscoe, and H.  P. Erickson. 1989. Biochemical and structural studies of tenascin/hexabrachion proteins. J Cell Biochem 41(2):71-90. 201.  Vaughan, L., S. Huber, M. Chiquet, and K. H. Winterhalter. 1987. A major, six-  armed glycoprotein from embryonic cartilage. Embo J 6(2):349-53. 81  202.  Friedlander, D. R., S. Hoffman, and G. M. Edelman. 1988. Functional mapping of  cytotactin: proteolytic fragments active in cell-substrate adhesion. J Cell Biol 107(6 Pt 1):2329-40. 203.  Lotz, M. M., C. A. Burdsal, H. P. Erickson, and D. R. McClay. 1989. Cell  adhesion to fibronectin and tenascin: quantitative measurements of initial binding and subsequent strengthening response. J Cell Biol 109(4 Pt 1):1795-805. 204.  Chiquet-Ehrismann, R., P. Kalla, C. A. Pearson, K. Beck, and M. Chiquet. 1988.  Tenascin interferes with fibronectin action. Cell 53(3):383-90. 205.  Bornstein, P. 2001. Thrombospondins as matricellular modulators of cell  function. J Clin Invest 107(8):929-34. 206.  Chiquet-Ehrismann, R., and M. Chiquet. 2003. Tenascins: regulation and putative  functions during pathological stress. J Pathol 200(4):488-99. 207.  Fassler, R., T. Sasaki, R. Timpl, M. L. Chu, and S. Werner. 1996. Differential  regulation of fibulin, tenascin-C, and nidogen expression during wound healing of normal and glucocorticoid-treated mice. Exp Cell Res 222(1):111-6. 208.  Midwood, K. S., L. V. Williams, and J. E. Schwarzbauer. 2004. Tissue repair and  the dynamics of the extracellular matrix. Int J Biochem Cell Biol 36(6):1031-7. 209.  Huang, W., R. Chiquet-Ehrismann, J. V. Moyano, A. Garcia-Pardo, and G.  Orend. 2001. Interference of tenascin-C with syndecan-4 binding to fibronectin blocks cell adhesion and stimulates tumor cell proliferation. Cancer Res 61(23):8586-94. 210.  Swindle, C. S., K. T. Tran, T. D. Johnson, P. Banerjee, A. M. Mayes, L. Griffith,  and A. Wells. 2001. Epidermal growth factor (EGF)-like repeats of human tenascin-C as ligands for EGF receptor. J Cell Biol 154(2):459-68. 82  211.  Wells, A. 1999. EGF receptor. Int J Biochem Cell Biol 31(6):637-43.  212.  Bhalla, U. S., and R. Iyengar. 1999. Emergent properties of networks of  biological signaling pathways. Science 283(5400):381-7. 213.  Glading, A., F. Uberall, S. M. Keyse, D. A. Lauffenburger, and A. Wells. 2001.  Membrane proximal ERK signaling is required for M-calpain activation downstream of epidermal growth factor receptor signaling. J Biol Chem 276(26):23341-8. 214.  Iyer, A. K., K. T. Tran, L. Griffith, and A. Wells. 2008. Cell surface restriction of  EGFR by a tenascin cytotactin-encoded EGF-like repeat is preferential for motilityrelated signaling. J Cell Physiol 214(2):504-12. 215.  Trebaul, A., E. K. Chan, and K. S. Midwood. 2007. Regulation of fibroblast  migration by tenascin-C. Biochem Soc Trans 35(Pt 4):695-7. 216.  Gulcher, J. R., D. E. Nies, L. S. Marton, and K. Stefansson. 1989. An  alternatively spliced region of the human hexabrachion contains a repeat of potential Nglycosylation sites. Proc Natl Acad Sci U S A 86(5):1588-92. 217.  Yoshimura, E., A. Majima, Y. Sakakura, T. Sakakura, and T. Yoshida. 1999.  Expression of tenascin-C and the integrin alpha 9 subunit in regeneration of rat nasal mucosa after chemical injury: involvement in migration and proliferation of epithelial cells. Histochem Cell Biol 111(4):259-64. 218.  Matsuda, A., Y. Tagawa, K. Yamamoto, H. Matsuda, and M. Kusakabe. 1999.  Identification and immunohistochemical localization of annexin II in rat cornea. Curr Eye Res 19(4):368-75. 219.  Matsuda, A., T. Hirota, M. Akahoshi, M. Shimizu, M. Tamari, A. Miyatake, A.  Takahashi, K. Nakashima, N. Takahashi, K. Obara, N. Yuyama, S. Doi, Y. Kamogawa, 83  T. Enomoto, K. Ohshima, T. Tsunoda, S. Miyatake, K. Fujita, M. Kusakabe, K. Izuhara, Y. Nakamura, J. Hopkin, and T. Shirakawa. 2005. Coding SNP in tenascin-C Fn-III-D domain associates with adult asthma. Hum Mol Genet 14(19):2779-86. 220.  Williams, S. A., and J. E. Schwarzbauer. 2009. A Shared Mechanism of Adhesion  Modulation for Tenascin-C and Fibulin-1. Mol Biol Cell 20(4):1141-1149. 221.  Limper, A. H., and J. Roman. 1992. Fibronectin. A versatile matrix protein with  roles in thoracic development, repair and infection. Chest 101(6):1663-73. 222.  Roman, J., H. N. Rivera, S. Roser-Page, S. V. Sitaraman, and J. D. Ritzenthaler.  2006. Adenosine induces fibronectin expression in lung epithelial cells: implications for airway remodeling. Am J Physiol Lung Cell Mol Physiol 290(2):L317-25. 223.  Green, J. A., A. L. Berrier, R. Pankov, and K. M. Yamada. 2009. beta 1 integrin  cytoplasmic domain residues selectively modulate fibronectin matrix assembly and cell spreading through talin and AKT-1. J Biol Chem. 224.  Orend, G., and R. Chiquet-Ehrismann. 2000. Adhesion modulation by  antiadhesive molecules of the extracellular matrix. Exp Cell Res 261(1):104-10. 225.  Midwood, K. S., L. V. Valenick, H. C. Hsia, and J. E. Schwarzbauer. 2004.  Coregulation of fibronectin signaling and matrix contraction by tenascin-C and syndecan4. Mol Biol Cell 15(12):5670-7. 226.  Orend, G., W. Huang, M. A. Olayioye, N. E. Hynes, and R. Chiquet-Ehrismann.  2003. Tenascin-C blocks cell-cycle progression of anchorage-dependent fibroblasts on fibronectin through inhibition of syndecan-4. Oncogene 22(25):3917-26.  84  227.  Mostafavi-Pour, Z., J. A. Askari, S. J. Parkinson, P. J. Parker, T. T. Ng, and M. J.  Humphries. 2003. Integrin-specific signaling pathways controlling focal adhesion formation and cell migration. J Cell Biol 161(1):155-67. 228.  Woods, A., R. L. Longley, S. Tumova, and J. R. Couchman. 2000. Syndecan-4  binding to the high affinity heparin-binding domain of fibronectin drives focal adhesion formation in fibroblasts. Arch Biochem Biophys 374(1):66-72. 229.  Wilcox-Adelman, S. A., F. Denhez, and P. F. Goetinck. 2002. Syndecan-4  modulates focal adhesion kinase phosphorylation. J Biol Chem 277(36):32970-7. 230.  Kolberg, J., T. E. Michaelsen, and K. Sletten. 1983. Properties of a lectin purified  from the seeds of Cicer arietinum. Hoppe Seylers Z Physiol Chem 364(6):655-64. 231.  Phillips, M. L., E. Nudelman, F. C. Gaeta, M. Perez, A. K. Singhal, S. Hakomori,  and J. C. Paulson. 1990. ELAM-1 mediates cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science 250(4984):1130-2. 232.  Schnaar, R. L. 1991. Glycosphingolipids in cell surface recognition. Glycobiology  1(5):477-85. 233.  Chammas, R., M. G. Jasiulionis, P. M. Cury, L. R. Travassos, and R. R. Brentani.  1994. Functional hypotheses for aberrant glycosylation in tumor cells. Braz J Med Biol Res 27(2):505-7. 234.  Lowe, J. B., L. M. Stoolman, R. P. Nair, R. D. Larsen, T. L. Berhend, and R. M.  Marks. 1990. ELAM-1--dependent cell adhesion to vascular endothelium determined by a transfected human fucosyltransferase cDNA. Cell 63(3):475-84. 235.  Donaldson, D. J., and J. M. Mason. 1977. Inhibition of epidermal cell migration  by concanavalin A in skin wounds of the adult newt. J Exp Zool 200(1):55-64. 85  236.  Gipson, I. K., and R. A. Anderson. 1980. Effect of lectins on migration of the  corneal epithelium. Invest Ophthalmol Vis Sci 19(4):341-9. 237.  Sweatt, A. J., R. M. Degi, and R. M. Davis. 1999. Corneal wound-associated  glycoconjugates analyzed by lectin histochemistry. Curr Eye Res 19(3):212-8. 238.  Compton, T., D. M. Nowlin, and N. R. Cooper. 1993. Initiation of human  cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193(2):834-41. 239.  Mai, J., D. M. Waisman, and B. F. Sloane. 2000. Cell surface complex of  cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta 1477(12):215-30. 240.  Hajjar, K. A., C. A. Guevara, E. Lev, K. Dowling, and J. Chacko. 1996.  Interaction of the fibrinolytic receptor, annexin II, with the endothelial cell surface. Essential role of endonexin repeat 2. J Biol Chem 271(35):21652-9.  86  Chapter 2 - Identification of Annexin II as a Cicer arietinum agglutinin specific mediator of wound repairi  2.1 Introduction The airway epithelium acts as a protective barrier, preventing the exposure of the underlying tissue to noxious particles. The epithelium is routinely challenged by allergens, pollutants and virus particles, resulting in damage that requires repair to restore barrier integrity. Damage is commonly seen in diseases such as asthma, with the ciliated columnar cells as the most damaged cell type (1). Other studies have shown an increase in the presence of sloughed epithelial cells in the bronchoalveolar lavage fluid isolated from patients with mild asthma (2). Epithelial loss can result in sensory nerve exposure with the release of neuropeptides that may worsen bronchoconstriction (reviewed in Barnes, 1992 (3)). Furthermore, the epithelium is not only a passive barrier, it is also a source of inflammatory cytokines (reviewed in Martin 1997 (4) and Folkerts 1998 (5)). The ability of the epithelium to act as a physical barrier and its involvement in the regulation of airway diameter and inflammatory events highlight the role of an intact epithelium and the importance of epithelial repair. The mechanisms and regulators of epithelial repair are poorly understood. One important modifier of cell function is the glycosylation of cell surface proteins.  i  A version of this chapter has been published. Patchell BJ, Wojcik KR, Yang TL, White SR, Dorscheid DR. Glycosylation and Annexin II cell surface translocation mediate airway epithelial wound repair.Am J Physiol Lung Cell Mol Physiol. 2007 May 18.  87  Carbohydrate structures attached to and presented on the cell surface play a role in several cellular functions. Glycosylated proteins have been shown to participate in cell adhesion (6), proliferation (7) and growth potential (8) and alterations in glycosylation can have profound effects on these functions (9-11). Work by Gipson et al. showed that the inhibition of N-glycosylation by treating the cells with tunicamycin, an Nglycosylation inhibitor, inhibits corneal epithelial wound repair (12). The authors suggested that asparagine-linked glycoproteins required for migration include cell-surface glycoproteins. Our laboratory has demonstrated similar results in airway epithelial cells (13). In both studies the same global inhibitor of N-glycosylation was used but the specific cell surface glycoproteins that were altered by this inhibition were not identified. Further work by Adam et al. has shown that in culture, functional carbohydrate structures can be identified on the surface of cells by lectin histochemistry and wound closure inhibition (14, 15). Lectins are a valuable tool in glycobiology. Like the antibody to protein structure, lectins are carbohydrate binding proteins highly specific to carbohydrate structures. Chick pea agglutinin (CPA) is a lectin with unknown carbohydrate specificity, suggesting its ligand is more complex than a simple monosaccharide. Previously, we have shown CPA binds epithelial cells in human tissue (16). Its complex carbohydrate specificity and binding to the columnar epithelial cells but not basal epithelial cells in intact airway epithelial tissue made CPA a lectin of interest for further study of epithelial repair. The purpose of this study was to use CPA as a lectin marker of basal cells undergoing repair and to identify novel carbohydrate associated structures that participate in the normal processes of repair. Using that same lectin, we purified the protein (s) associated with the 88  carbohydrate structure. We have identified Annexin II (AII) as a protein precipitated by the lectin CPA and we show that AII is presented on the cell surface and may facilitate wound repair. We have also demonstrated that the recovery of AII with CPA and its cell surface presentation is N-glycosylation dependent.  89  2.2 Materials and Methods 2.2.1 Cell Culture Normal human airway epithelial cells (1HAEo-) were a gift from Dr. D. Gruenert, University of Burlington, VT (17). 1HAEo- cells are SV40-transformed normal human airway epithelial cells that have been characterized previously (18, 19) and express multiple surface carbohydrate markers of primary basal airway epithelial cells (16). They were grown in culture for lectin histochemistry, wound repair kinetics and protein extraction as previously described (16). Human primary airway epithelial cells were isolated and cultured following lung resection surgery. 2.2.2 Monolayer Wound Creation and Lectin Cytochemistry Monolayers were grown to confluence and small wounds (approximately 1.0 - 2.0 mm2) were created using a small rubber dental GUM® Stimulator (Sunstar Butler, Guelph, ON). Lectin cytochemistry was carried out as described previously(13). At 0, 6, 12 and 24 h after the creation of the wound, cells were fixed with Clark's solution (95% ethanol5% acetic acid). After quenching endogenous peroxidases with 0.03% H2O2 slides were blocked with Dako Universal Block (Dako Cytomation, Carpinteria, CA), prior to incubation with biotinylated CPA lectin and Vicia villosa agglutinin (VVA; 5 µg/ml and 10 μg/ml respectively; EY Laboratories Inc., San Mateo CA) in HEPES buffer without BSA for 60 min. Following incubation in ABC-HRP complex followed by diaminobenzoic acid (DAB; Dako Cytomation) monolayers were imaged on a Nikon 50i series upright microscope equipped with a digital camera. 90  2.2.3 Monolayer Wound Repair Assay After wounding as described above, cells were washed with DMEM without fetal bovine serum (FBS, Invitrogen, Burlington, ON). Treatment of the cells included an unstimulated control incubated in DMEM without FBS as baseline for wound closure rates. The remaining 5 wells were incubated in DMEM with FBS, each with 15 ng/ml human epidermal growth factor (EGF, Invitrogen) and unconjugated CPA or VVA (EY Laboratories Inc.) at 0, 10, 25, 50 and 100 μg/ml. FBS and EGF were added to maximally stimulate wound closure rates. This allowed the determination of the effect of lectin addition on stimulated wound closure rates. Monolayers were treated with lectin added immediately after wound creation (0 h), 6 h after wounding and added 6 h and replaced at 12 h after wounding. Wounds were imaged at t = 0, 6, 12, 18 and 24 h using a Nikon Eclipse TE200 inverted scope equipped with a Nikon Coolpix E995. Wound area was calculated by manual tracing and area calculation software (ImagePro Plus, Media Cybernetics Inc., Silver Spring, MD). 2.2.4 Lectin Precipitation Assay The 1HAEo- cells were grown to confluence and mechanically wounded using a cell scraper (Sarstdedt, Montreal, PQ). The wound size was large enough such that following 18 h of repair, wounds would not have fully closed. Monolayers were washed with phosphate buffered saline (PBS) followed by the addition of DMEM plus 10 % FBS. After 18 h in culture, protein collection and lectin precipitation was carried out as previously described(15). 20 μg of biotinylated lectin [CPA or VVA (EY Laboratories)] was added to the supernatant and incubated overnight at 4oC. Protein recovery was 91  determined by densitometry. Confirmation of CPA precipitation of the identified protein was carried out by SDS-PAGE separation of the lectin precipitated proteins. Gel contents were transferred to a nitrocellulose membrane for Western blot analysis. Precipitations following tunicamycin treatment were carried out as above, however, following mechanical injury, monolayers were treated with the indicated concentration of tunicamycin (Sigma-Aldrich, Oakville, ON) added to the culture media. DMSO treated monolayers were included as a vehicle control. 2.2.5 Protein Purification and Sequencing Following SDS-PAGE of the precipitated proteins the gel was stained with Coomassie R250 and destained overnight in 30% methanol: 10% acetic acid. The purified 36 kDa band was excised from the gel and sequenced by one-dimensional reversed-phase chromatography with on-line mass spectrometry (Applied Biosystems/MDS Sciex QStar hybrid liquid chromatography/mass spectrometer/mass spectrometer (LC/MS/MS) quadrupole time-of-flight (TOF) system, University of Victoria – Genome British Columbia Proteomics Centre, www.proteincentre.com). Excised protein bands were subjected to tryptic digestion and twenty microlitres of sample was loaded into an auto sampler vial and 5 μl injected onto a 100 μl sample loop with the remainder of the loop filled with 0.1% formic acid in water. The SwitchOS loading pumps were set to 30 μl/min and the sample was pumped onto a 300 μm I.D. X 1 mm PepMap C18, 5 μm, 100A nano precolumn (LCPackings/Dionex) to concentrate and desalt the peptide mixture before MS analysis. The elute from this column was allowed to divert to waste for 4 minutes using the SwitchOSII then the flowpath was diverted to the 92  Ultimate pumps and the sample was eluted onto a 75 um I.D. X 15 cm PepMap C18 3um, 100A nanocolumn (LCPakings/Dionex). The column was sleeved via 20 cm of 20 μm ID fused silica (PolyMicroTechnologies) to a Valco stainless steel zero dead volume fitting which had a high voltage lead (2600V) and a new objective emitter fused silica tip positioned at the orifice of a PE Sciex QStar Pulsar I Quadrupole TOF MS. The pumps were set to deliver a flow rate of 150 nl/min with the following buffers: Solvent A [0.1 % formic acid in water], Solvent B [80 % acetonitrile, 0.1% formic acid in water]. The gradient used to elute the peptides was 5 min at 0 % B and then a 35 min ramp to 80% B, 10 min at 80% B, 5 min to 0% B and then 3 min at 0% B to equilibrate the column. The MS independent data acquisition parameters were as follows: after a 1 second survey scan from 400 -1500 m/z peaks with signal intensity over 10 counts with charge state 2-4 were selected for MS/MS fragmentation using a software determined collision energy and then a 2 second MS/MS from 65-1800 m/z was collected for the four most intense ions in the survey scan. Once an ion was selected for MS/MS fragmentation it was put on an exclusion list for 180 seconds to prevent that ion from being gated again and a 4 atomic mass unit peak window was used to prevent gating of masses from the same isotopic cluster during the survey scan. Keratin and porcine trypsin peak masses were put on an exclusion list to prevent these ions from being selected for MS/MS analysis. Fragment data was submitted to ProID (proprietary Applied Biosystems software) for bioinformatics analysis of public protein databases (NCBI, http://www.ncbi.nlm.nih.gov/) and identification.  93  2.2.6 Annexin II Biotinylation and Detection Prior to protein collection, 1HAEo- cell surface proteins were biotinylated as previously described on endothelial cells (20). Following transfer, the membrane was reacted with mouse anti-AII (BD Pharmingen, Mississauga, ON) or  mouse anti-β-actin (AC-74,  Sigma-Aldrich) followed by horseradish peroxidase-conjugated rabbit anti-mouse (Santa Cruz Biotech, CA), and visualized using chemiluminescence (ECL; Amersham Biosciences, Piscataway, NJ) and quantified using ImageJ version 1.27z software. 2.2.7 Annexin II Elution with EGTA EGTA elution of cell surface AII was carried out as before (21). Briefly 1HAEomonolayers were grown to confluence. Monolayers were mechanically wounded, treated with either tunicamycin (10-6 or 10-7 M) or DMSO and allowed to repair for 18 h. Repairing monolayers were equilibrated on ice for 5 minutes and washed once with ice cold PBS to remove cell debris or non-adherent cells. Monolayers were incubated in equivalent volumes of ice cold HEPES buffered saline (HBS) containing EGTA for 10 minutes at 4oC. The buffer was collected and spun to remove any cells that may have lifted during the incubation. Following centrifugation, equivalent volumes of collected EGTA containing HBS was subjected to standard immunoblot procedures and probed for AII. 2.2.8 Annexin II Immuno-staining The 1HAEo- cells were grown to confluence on collagen IV (Sigma-Aldrich) coated chamber slides and mechanically wounded. Following 18 h of repair, monolayers were fixed for 10 minutes in 4% paraformaldehyde diluted in HBS. Non-specific sites were 94  blocked with a universal serum block (Dako Cytomation). Monolayers were incubated overnight at 4oC in the dark with FITC conjugated primary antibody diluted in HBS. Following several HBS washes, the cells were incubated for 10 minutes in Hoechst 33342 (diluted 1:1000 in dH20; Molecular Probes, Eugene, OR, USA). Monolayers were visualized and imaged using a Nikon TE300 inverted microscope equipped with a spot camera. For double labelling experiments, 1HAEo- monolayers were fixed as above and incubated with FITC conjugated CPA, followed by anti-AII (BD Pharmingen). Alexa 546-conjugated secondary antibody was used and nuclei were counterstained with Hoechst 33342 (Invitrogen) in preparation for confocal image analysis. Images were obtained using a Leica AOBS™ SP2 confocal microscope. Z-plane reconstructions were generated using Volocity™ (Improvisions, Boston, MA, USA) Similarly, monolayers of primary airway epithelial cells were grown to confluence on collagen IV (Sigma-Aldrich) coated chamber slides and mechanically wounded. Following repair, cells were fixed as above. Slides were incubated with the primary antibodies, anti-AII followed by Rabbit Anti-Mouse Immunoglobulins, (Dako Cytomation) and Alkaline Phosphatase-Anti-Alkaline Phosphatase (APAAP) mouse (Dako Cytomation). New fuschin was used as the chromogenic substrate for color development. Slides were counterstained and imaged using a Sony spot camera mounted on a Nikon E600 microscope. Sample handling and processing were carried out simultaneously to maintain experimental conditions for all samples. During image acquisition, image capture settings were preserved throughout each session.  95  2.2.9 Statistics Values are presented as means ± SE. The significance of differences between means was assessed by analysis of variance; when significant differences were found a Student’s T test was used to compare the means, with the level of significance set at p < 0.05.  96  2.3 Results 2.3.1 Lectin Staining of Wounded Airway Epithelial Cell Monolayers. Small circular wounds were generated in 1HAEo- monolayers reliably without cell lifting. These wounds were approximately 1-2 mm2 in all experiments (Figure 2.1-2.3). The inset images in each panel of Figure 2.1- 2.3 represent the intensity of lectin staining in the confluent areas for each wounded monolayer. Note the intensity differences between those areas and the areas in proximity to the wound. Staining for CPA was throughout the confluent areas of monolayers but intensity of CPA staining was markedly greater in areas in proximity to the wound (Figure 2.1). This area of increased staining was either at the perimeter of the wound or in groupings of cells proximal to the wound. Monolayers fixed after 0 h (Figure 2.1 panel A), 6 h (Figure 2.1 panel B), 12 h (Figure 2.1 panel C) and 24 h (Figure 2.1 panel D) of repair each show an increase in CPA staining intensity of cells proximal to the edge of the repairing wound. VVA staining was virtually absent from intact areas of the monolayers (Figure 2.2, insets). Similar to CPA, VVA staining increases at the wound edge after mechanical wounding. Monolayers fixed after 0 h (Figure 2.2 panel A), 6 h (Figure 2.2 panel B), 12 h (Figure 2.2 panel C) and 24 h (Figure 2.2 panel D) of repair demonstrate VVA staining of cells is localized to the edge of the repairing wound with no change at more distal areas. As was noted for both CPA and VVA at time 0 hr, in the absence of lectin (Figure 2.3) there is non-specific staining proximal to the wounds (Figure 2.3 panel A). This artefact staining may be a result of the physical disturbance, cellular debris and compression of cells during the wounding process and may explain the increased lectin binding at 0h. Following 6-24 h of repair, 97  artefact staining is lost (Figure 2.3 panel B; 24 h repair representative of 6 – 24 h time points).  98  Figure 2.1- Cicer arietinum agglutinin (CPA) binding to the surface of 1HAEo- cell monolayers. Biotinylated lectin binding was detected using streptavidin-HRP conjugate followed by DAB to generate a brown precipitate. The inset images in each panel represent the intensity of lectin or control staining in the confluent areas for each wounded monolayer. CPA positive staining increases following mechanical wounding over time and accumulates at and near the site of injury. Baseline CPA staining was initially present at 0h in confluent areas immediately following wound creation (A). Following 6 h repair (B) 12 h repair (C) and 24 h repair (D), CPA staining as described is markedly increased. Original magnification; 200X.  99  Figure 2.2 - Vicia villosa agglutinin (VVA) binding to the surface of 1HAEo- cell monolayers. Biotinylated lectin binding was detected using streptavidin-HRP conjugate followed by DAB to generate a brown precipitate. The inset images in each panel represent the intensity of lectin or control staining in the confluent areas for each wounded monolayer. VVA positive staining was absent at baseline in confluent monolayers (insets) and increases following mechanical wounding over time and accumulates at and near the site of injury. VVA staining is present immediately following wound creation (A). Following 6 h repair (B) 12 h repair (C) and 24 h repair (D). Original magnification; 200X.  100  Figure 2.3 – Negative control staining of the surface of 1HAEo- cell monolayers. Non-specific binding was detected using streptavidin-HRP conjugate followed by DAB to generate a brown precipitate. The inset images in each panel represent the intensity of lectin or control staining in the confluent areas for each wounded monolayer. Staining was absent in intact areas of 1HAEo- monolayers (insets). Immediately following wound creation there is non-specific staining proximal to the wound (A). After 6-24 h of repair, there is no non-specific staining remaining on the repairing 1HAEomonolayers (B, 24 h repair is representative of 6-24 h images). Original magnification; 200X.  101  2.3.2 The Effect of CPA on Wounded Airway Epithelial Monolayer Repair. Mean wound starting areas for each group were not statistically different. Furthermore, experiments where the addition of CPA lectin was delayed 6 h, wound areas were not statistically different at the initial time of lectin incubation. The addition of CPA immediately following wound creation had no effect on wound closure (Figure 2.4 panel A). We have demonstrated that CPA staining is initially weak on the surface of 1HAEocells. As a result, the addition of CPA immediately following mechanical injury would result in little to no lectin binding on the cells participating in repair. A delay of 6 h prior to CPA addition had no significant inhibitory effect on wound closure rates relative to the EGF stimulated control. By 24 h, the wound repair of all the CPA treated monolayers was complete and comparable to EGF stimulated wounds (Figure 2.4 panel B). Treatment of 1HAEo- monolayers with CPA at 6 h and replaced 12 h after wound creation inhibited repair in a dose-dependant manner (Figure 2.4 panel C). Following 24 h of repair, wounds in the presence of 100 μg/ml CPA demonstrated an average of 32 ± 10 % of initial wound area remaining and was significantly different relative to the EGF stimulated closure at 24 h (9 ± 4 %, p < 0.05). At the highest dose of CPA (100 μg/ml), wound repair rates closely resembled those of the negative unstimulated control. Wounds incubated in the absence of lectin, serum and EGF (EGF) demonstrated an average of 42 ± 12 % of initial wound area remaining at 24 h. There was no statistical significant difference observed between the serum free control (Ctl) and the 100 μg/ml CPA at each of the measured time points. The use of the lectin VVA in wound repair experiments similar to those with CPA did not generate significant inhibition of wound closure (data 102  not shown). VVA and CPA generate similar binding patterns with respect to airway epithelial cell wounds but bind to distinct sugar moieties.  103  Figure 2.4 - Wound closure of 1HAEo- monolayers in the presence of CPA. Cells were grown to confluence, mechanically wounded and treated with CPA added at 0 h (panel A), 6 h (panel B) or 6 h and replaced at 12 h (panel C) in increasing doses (10, 25, 50 and 100 μg/ml, CPA 10, CPA 25 CPA 50 and CPA 100 respectively grown in serum + EGF). Controls included negative serum free unstimulated (Ctl) and serum + EGF (EGF) stimulated monolayers without lectin treatment. Wound closure was followed using time-lapse videomicroscopy. Remaining wound area was determined using ImagePro Plus and presented as the percentage of the initial wound remaining. Arrows indicate timepoints of CPA exposure. Error bars were omitted for clarity, * p<0.05 relative to EGF stimulated repair. N ≥ 3 experiments for all groups.  104  2.3.3 The Purification of CPA Specific Glycoprotein Ligands. Cell protein lysates were precipitated with CPA lectin (Figure 2.5 panel A) or VVA lectin (Figure 2.5 panel B) to identify glycoproteins or glycoprotein associated proteins with increased recovery during repair. Selection of the protein band for sequencing was based on the relative increase in protein band intensity in precipitations from wounded monolayers relative to confluent monolayers. Similarities were observed between CPA and VVA precipitations of cell protein lysates after wounding. A protein band of 36 kDa was present in both the CPA (Figure 2.5 panel A) and VVA (Figure 2.5 panel B) lectin precipitations and demonstrated the largest increase as visualized with Coomassie staining. By densitometry this 36 kDa protein band was almost 2-fold greater in precipitations of wounded monolayers relative to confluent monolayer preparations for both lectins. Following protein sequencing of both bands, the protein candidate was identified as Annexin II (AII). Identification of AII as the candidate CPA precipitated protein was based on two peptide fragments of sufficient length to surpass the required threshold for identification. There were no other proteins that surpassed the required threshold to be considered a positive identification based on the Mascot peptide database search. These results will be confirmed by lectin-precipitation followed by AII Western blot and AII expression characterization, as shown below.  105  Figure 2.5 - Lectin precipitation profiles of 1HAEo- monolayer protein extracts. Protein extracts from confluent and wounded monolayers were incubated with biotinylated lectins CPA (panel A) or VVA (panel B) at a concentration of 15 μg/ml and avidin agarose beads as described in Methods. Precipitated proteins were separated by 10% SDS PAGE and the gel was stained with Coomassie R-250. The 36 kDa band (←) had a 2-fold increase in recovery when precipitated from wounded monolayers relative to nonwounded controls and was subsequently identified as Annexin II.  106  2.3.4 Annexin II Expression and Recovery with CPA. Following mechanical wounding, there was no significant change in total expression of AII following normalization to β−actin (Figure 2.6). However, CPA lectin based precipitation of the 36 kDa band changed over the course of wound repair, suggesting that the changes in the glycosylation of AII or its associated proteins result in the greater recovery during repair (Figure 2.5 and 2.7 panel A). CPA precipitation of the 36 kDa band increased by 2 h relative to 0 h and was greatest at 12-18 h after mechanical wounding (Figure 2.7 panel A). The small wounds created during this experiment typically close in approximately 24-30 h. As wound closure neared completion (24 h), the recovery of the 36 kDa band returned to baseline levels (0 h). Sequencing results that identified this 36 kDa protein as AII are based on peptide profiles and database searches, and therefore were confirmed by Western blot (Figure 2.7 panel B). Our results confirmed that AII is precipitated by CPA and demonstrated that its recovery approximated the recovery pattern of the 36 kDa protein, reaching a maximum recovery at 12 h after mechanical injury (Figure 2.7 panel A and B). The 36 kDa band in Figure 2.3 is the result of a carbohydrate dependant recovery with CPA. We have shown that the 2-fold increase in AII recovery with CPA is not a result of an increase in AII expression (Figure 2.6). Changes in the recovery of AII as demonstrated in Figure 2.5 and 2.7 must therefore be a result of protein modification such as the glycosylation of AII with the CPA specific carbohydrate.  107  Figure 2.6 - AII expression in mechanically wounded monolayers of 1HAEo- cells. Total AII expression remains unchanged following mechanical injury. This representative immunoblot demonstrates that when AII levels are normalized to β-actin to account for differences in protein loading, AII expression does not significantly change following mechanical injury. The results of three independent experiments are summarized in the graph. N = 3.  108  Figure 2.7 - CPA precipitation profiles of wounded 1HAEo- monolayers protein extracts collected serially. Protein extracts from wounded monolayers collected over a 24 h period were incubated with biotinylated CPA (15 μg/ml) and avidin-agarose beads as described in Methods. Precipitation of the 36 kDa protein (s) with CPA increases following mechanical injury to 1HAEo- monolayers, reaching a maximum at 12-18 h after wounding (panel A). Precipitations were split such that a duplicate gel could be transferred to a membrane and probed for Annexin II by Western blot (panel B).  109  2.3.5 Cell Surface Presentation of Annexin II. Quantification of cell surface AII was achieved through non-specific membrane protein biotinylation. The presentation of AII on the surface of 1HAEo- cells occurred by 2 h and was maximal 18 h after mechanical injury to confluent monolayers (Figure 2.8). Similarly to the CPA precipitation of AII, the amount of AII on the cell surface began to decrease as wound closure neared completion after 18 h, suggesting a link between glycosylation and AII translocation. Western blots were probed for an intra-cellular negative control protein, β-actin. This protein was undetectable in our avidin-agarose precipitations and present only in the whole protein lysate suggesting that primarily extracellular proteins were recovered (Figure 2.8 B). The amount of AII presented on the cell surface increased approximately 2-fold 6 h after wound creation, reaching a maximum at 18 h where there is a 2.5-fold change in AII on the surface (Figure 2.8 C). By immunocytochemistry on non-permeabilized monolayers we confirmed cell surface translocation of AII during repair (Figure 2.9). Immunofluorescence in regions distal to the wound demonstrated minimal to no AII staining (Figure 2.9 panel A). After mechanical wounding and 18 h of repair, the levels of cell surface AII dramatically increased (Figure 2.9 panel B). AII staining was visible on cells that had migrated into the wounded area as well as those proximal to the wound edge. The findings from 1HAEo- cells were confirmed in primary airway epithelial cells grown in culture (Figure 2.10). No background staining was observed with the isotype control antibody (Figure 2.10 panel A) and monolayers fixed immediately after mechanical wounding (Figure 2.10 panel B). Cell surface AII accumulates proximal to the wound edge following 12 h repair 110  (Figure 2.10 panel C) and 24 h repair (Figure 2.10 panel D). Furthermore, the staining pattern closely resembles that of the original increase in CPA lectin staining (Figure 2.1) and the VVA lectin staining (Figure 2.2).  111  Figure 2.8 - Membrane protein biotinylation of AII on the surface of wounded 1HAEo- monolayers. Biotinylated membrane proteins were collected, separated by SDS-PAGE and transferred to membranes for immunodetection to detect AII on the cell surface of 1HAEo- cells (A). As an intracellular control, membranes were probed for β-actin (B). Quantification of the cell surface AII was done by densitometry and shown (C). * p < 0.05 relative to 0 h, † p < 0.1 relative to 0 h. Representative images shown in A and B, N = 4.  112  Figure 2.9 - Immunofluorescent detection of cell surface AII on 1HAEocells. Following wounding, 1HAEo- cells were fixed in the absence of detergent and stained for AII (green) and nuclei (blue). Confluent monolayer (panel A) and wounded a monolayer 18 h after injury (panel B) are shown. Original magnification 200x. Images were taken with the same exposure settings.  113  Figure 2.10 - Immunohistochemical detection of cell surface AII on primary airway epithelial cells. Following wounding, cells were fixed as before and stained for cell surface AII using standard immunohistochemistry as described in Methods. Staining was absent in both the isotype control (panel A) and monolayers fixed immediately after injury (panel B). Cell surface AII staining accumulated at the wound edge at 12 h (panel C) and 24 h after mechanical wounding (panel D).  114  Figure 2.11 - AII recovery following tunicamycin treatments. Following mechanical injury, 1HAEo- monolayers were treated with increasing doses of tunicamycin. Following 12 h repair monolayers were incubated with EGTA to elute any calcium dependant membrane associated proteins such as AII. In the presence of 10-6 M tunicamycin, AII recovery dropped below 20% that of the DMSO control (panel A). Similarly, protein was isolated from monolayers 12 h after mechanical wounding and subjected to CPA lectin precipitation as before. CPA recovered AII was detected by standard immunoblotting techniques. Following tunicamycin treatment, AII recovery levels dropped to levels approaching the no lectin control (panel B).  115  2.3.6 The Inhibition of Glycosylation. The effect of inhibiting N-glycosylation was observed both quantitatively and qualitatively with respect to AII. Following addition of tunicamycin, a global Nglycosylation inhibitor, the amount of lectin-captured AII was dramatically reduced (Figure 2.11 panel A). Previously, we have shown that wound closure of airway epithelial cells is inhibited by tunicamycin (13). Calcium chelation removes an essential element for the association of AII with the plasma membrane, and therefore can be used to elute and quantify AII on the cell surface as has been previously carried out (21). The addition of tunicamycin at the time of injury resulted in the inhibition of AII translocation to the cell surface as determined by EGTA elution. Tunicamycin treatment also decreased the amount of AII that can be recovered by CPA precipitation to 33% relative to the DMSO treated control (Figure 2.11 panel B). The effect of tunicamycin on AII translocation was visualized by confocal microscopy (Figure 2.12). In the presence of DMSO alone, AII (red) can be easily visualized on the surface of 1HAEo- cells (Figure 2.12 panel A). AII staining is in fact co-localized with the CPA staining (green) as shown in the ZX (above) and ZY (left) plane images. Following tunicamycin treatment, the presence of AII on the cell surface is virtually eliminated (Figure 2.12 panel B), further confirming our quantitative results (Figure 2.11).  116  Figure 2.12 - Annexin II and CPA double staining of mechanically wounded 1HAEo- monolayers. Following injury, wounded monolayers were treated with DMSO (panel A) or 10-6 M tunicamycin (panel B). Monolayers were fixed without permeabilization and stained for CPA (green), AII (red) and nuclei (blue) as described in Methods. In the absence of tunicamycin, cell surface AII is abundantly present, furthermore, colocalization of the CPA and AII is indicated by the presence of yellow staining on cells in proximity to the wound (panel A). Tunicamycin treatment disrupts the translocation of AII to the cell surface such that there are low levels of cell surface AII and no colocalization of the CPA and AII staining (panel B). ZX and ZY plane images are shown, white crosshairs indicate location of Z-plane image acquisition. Scale bar 10 μm.  117  2.4 Discussion Research has suggested that the asthmatic epithelium is defective in mechanisms of repair (22-24). However, this complex pathway in healthy individuals is not fully understood. The identification of proteins that co-ordinate the sub-cellular organization required for cellular migration will complement our current understanding of the regulatory proteins in this process. We have shown that after mechanical injury to airway epithelial cell monolayers, there is an increase in CPA carbohydrate ligand presentation on the surface of epithelial cells proximal to the wound (Figure 2.1). Following lectin precipitation, Annexin II (AII) was identified. Subsequently we have shown a significant increase of AII on the cell surface after mechanical injury (Figure 2.8 A). Cells at and near the site of injury demonstrate the increased cell surface presentation of AII relative to areas of intact epithelium. The increase in AII recovery by lectin precipitation is carbohydrate dependant and occurs temporally prior to AII translocation to the cell surface. This suggests that glycosylation occurs first and may act as a regulatory signal in the AII translocation. Wound repair disruption with CPA and the presentation of AII on the cell surface along with CPA/AII double staining provides some insight into the timing and mechanics of these events. In the absence of AII on the cell surface, CPA would be free to bind other carbohydrate targets as demonstrated by the baseline staining by CPA. Following 6 h of repair, AII is presented on the surface of a subset of cells permitting the binding of CPA at this time. Combined with the affect of CPA replacement at 12 h wound repair was significantly inhibited. CPA staining was abundant proximal to the edge of the wound (Figure 2.1). The leading edge cells are replaced during repair, the 118  high turnover of cells at the wound edge may the requirement for repeated CPA treatments to affect wound closure inhibition. These data support and extend our previous findings that carbohydrates play an essential role in the processes of wound repair (13, 15). Our results confirm the association of AII with the CPA carbohydrate ligand. As we have demonstrated, our recovery of AII by CPA mediated precipitation increases after mechanical injury (Figure 2.7 A). Studies have suggested that AII is a glycosylated protein (25) based on its retention in lectin affinity columns. AII was also purified from human placental cell membrane extracts using concanavalin A, a lectin that binds Dglucose and D-mannose structures (26). AII is a glycoprotein but may also function as a lectin. The ability of AII to bind glycoproteins such as heparin (27, 28) and fucose containing saccharides (29) have been reported. The increased recovery of AII by CPA would be a direct result of a change in glycosylation. This would result from repair associated glycosylation of AII. Alternatively the subsequent increase in the CPA recovery of AII may be indirect. CPA binding of a neo-glycosylated protein that forms a complex with AII during repair through the lectin function of AII would also permit this increased AII recovery. The loss of AII recovery with CPA and from the cell surface following tunicamycin treatment highlights the role N-glycosylation plays in this regulation of AII function. Annexins are a family of Ca2+ dependant lipid binding proteins that bind acidic phospholipids. AII is an abundant member of the annexin family and has been shown to exist as a 36 kDa monomer, a homodimer or a heterotetramer (AIIt) consisting of two AII heavy chain subunits and two 11 kDa AII light chain subunits (p11). The monomer is 119  largely cytosolic while the formation of the AIIt results in association of the protein complex with the plasma membrane. Initially, AII was thought to participate in endocytosis (30), exocytosis (31) and cell-cell adhesion (32). It is unclear if the interaction of AII with biological membranes is solely due to a phospholipid association or if a receptor is required. AII on the extracellular face of the plasma membrane has been demonstrated in endothelium (33), skin keratinocytes (34) and many tumor cells (35). Matsuda et al. (36) have shown that following mechanical injury to rat cornea, AII translocates to the cell surface of epithelial cells and interacts with an extracellular AII ligand, tenascin-C (37-39), to participate in cell-cell and cell-matrix interactions (39). However this work did not investigate the role of glycosylation as a form of regulation. Recent reports have shown that AII plays a role in the regulation of cell migration in other model cell systems (40, 41). Our study is the first demonstration of AII on the surface of airway epithelial cells during repair and the essential involvement of glycosylation to regulate this process. Previous studies have highlighted the potential importance of carbohydrates in epithelial repair after injury (14-16, 42); however, very little is known about the identity or how these glycosylated structures regulate these events. With no known carbohydrate ligand for CPA, it is difficult to infer any structural information of the carbohydrate ligand responsible for the CPA staining of epithelial wounds. The ability of VVA to produce a similar cell surface staining pattern and also to purify AII from mechanically wounded 1HAEo- monolayers suggest the presence of a N-acetyl-galactosamine (GalNAc) residues on the glycosylated protein as an important carbohydrate modification during repair. During rat corneal epithelial repair, the addition of GalNAc slowed 120  epithelial migration highlighting the potential importance of GalNAc containing structures in epithelial wound repair (43). However, the inability of VVA to significantly disrupt wound repair suggests that GalNAc is not critical. The complex carbohydrate recognized by CPA, not GalNAc, is the regulatory structure. Our laboratory has characterized the importance of several carbohydrate structures involved in airway epithelial repair such as galactose containing serum glycoproteins (15) as well as sialyl Lewis X structures (42). As a result of their association with the plasma membrane, annexins are thought to be involved in the regulation of membrane events. The ability of AII to bind a variety of proteins in a regulated manner may help us identify its specific function during airway epithelial repair. AII may act as a scaffold protein that facilitates protein complex assembly that binds the glycoprotein on the cell surface. The carbohydrate binding of AII has been shown to be tightly regulated by phosphorylation (27). Furthermore, changes in glycosylation, as detected by the binding of CPA and VVA during repair would confer specificity of specific cell surface glycoproteins to associate with AII and effect wound repair. Kauffman et al. have demonstrated that the cell surface glycosylation of asthmatics is altered (44). This altered glycosylation could affect protein interactions that would result in the accumulation of epithelial damage as repair would be impaired. During wound repair, there is an increase in tenascin-C expression with the accumulation between the migrating cells and the underlying matrix (45). Our findings may be applied to disease considering there is a marked increase in tenascin-C expression in the basement membrane of asthmatic airways (46) and that the binding of tenascin-C with AII on the surface of endothelial cells results in cellular responses including cell 121  migration and the loss of focal adhesions (38). As a receptor for tenascin, the translocation of AII to the cell surface may facilitate epithelial wound repair through the interaction with the extracellular matrix. A defect in this pathway may result in cellular compensation and the increased deposition of tenascin-C in the basement membrane of the remodelled asthmatic airway. However, whether tenascin-C deposition is an effect of such a defect is not known. Many unknowns remain with regard to AII and the airway epithelium. Our experiments suggest that AII is a mediator of epithelial repair; however, the regulation of this mechanism is unknown. As a lipid associated protein that is translocated to the cell surface, AII lacks a transmembrane and cytoplasmic domain and has no known enzymatic function (47). It is likely that AII facilitates the interaction of the cell with extracellular ligands. This may result from either direct binding of tenascin-C or as a scaffold protein that facilitates complex assembly. By presenting functional proteins on the epithelial cell surface such as its association with t-PA and plasminogen facilitating the generation of plasmin on the cell surface of endothelial cells (48, 49), cell surface AII may be a key regulatory protein in airway epithelial repair. In summary, we demonstrate the identification of AII as a glycoprotein associated mediator of airway epithelial repair and that glycosylation is critical in its regulation and potentially its function on the surface or airway epithelial cells. Identification of how AII interacts with the extracellular environment and other proteins during repair remains to be determined. The carbohydrate modification of AII or AII associated glycoprotein to direct expression at the cell surface, may lead to new insights regarding epithelial cell motility and repair in asthma. The implications of AII and glycosylation as they relate to 122  airway epithelial repair suggest that the chronic damage of the epithelium characteristic of asthma and the treatment of airway remodelling may require a more complete understanding AII with respect to epithelial repair.  123  References  1.  Laitinen, L. A., M. Heino, A. Laitinen, T. Kava, and T. Haahtela. 1985. Damage  of the airway epithelium and bronchial reactivity in patients with asthma. Am Rev Respir Dis 131(4):599-606. 2.  Oddera, S., M. Silvestri, A. Balbo, B. O. Jovovich, R. Penna, E. Crimi, and G. A.  Rossi. 1996. Airway eosinophilic inflammation, epithelial damage, and bronchial hyperresponsiveness in patients with mild-moderate, stable asthma. Allergy 51(2):100-7. 3.  Barnes, P. J. 1992. Neurogenic inflammation and asthma. J Asthma 29(3):165-80.  4.  Martin, L. D., L. G. Rochelle, B. M. Fischer, T. M. Krunkosky, and K. B. Adler.  1997. Airway epithelium as an effector of inflammation: molecular regulation of secondary mediators. Eur Respir J 10(9):2139-46. 5.  Folkerts, G., and F. P. Nijkamp. 1998. Airway epithelium: more than just a  barrier! Trends Pharmacol Sci 19(8):334-41. 6.  Sanmugalingam, D., A. J. Wardlaw, and P. Bradding. 2000. Adhesion of human  lung mast cells to bronchial epithelium: evidence for a novel carbohydrate-mediated mechanism. J Leukoc Biol 68(1):38-46. 7.  Martinez, J. A., I. Torres-Negron, L. A. Amigo, and D. K. Banerjee. 1999.  Expression of Glc3Man9GlcNAc2-PP-Dol is a prerequisite for capillary endothelial cell proliferation. Cell Mol Biol (Noisy-le-grand) 45(1):137-52.  124  8.  Pili, R., J. Chang, R. A. Partis, R. A. Mueller, F. J. Chrest, and A. Passaniti. 1995.  The alpha-glucosidase I inhibitor castanospermine alters endothelial cell glycosylation, prevents angiogenesis, and inhibits tumor growth. Cancer Res 55(13):2920-6. 9.  Dennis, J. W., M. Granovsky, and C. E. Warren. 1999. Protein glycosylation in  development and disease. Bioessays 21(5):412-21. 10.  Gu, J., and N. Taniguchi. 2004. Regulation of integrin functions by N-glycans.  Glycoconj J 21(1-2):9-15. 11.  Kannagi, R., M. Izawa, T. Koike, K. Miyazaki, and N. Kimura. 2004.  Carbohydrate-mediated cell adhesion in cancer metastasis and angiogenesis. Cancer Sci 95(5):377-84. 12.  Gipson, I. K., T. C. Kiorpes, and S. J. Brennan. 1984. Epithelial sheet movement:  effects of tunicamycin on migration and glycoprotein synthesis. Dev Biol 101(1):212-20. 13.  Dorscheid, D. R., K. R. Wojcik, K. Yule, and S. R. White. 2001. Role of cell  surface glycosylation in mediating repair of human airway epithelial cell monolayers. Am J Physiol Lung Cell Mol Physiol 281(4):L982-92. 14.  Adam, E., S. Holgate, C. Fildew, and P. Lackie. 2003. Role of carbohydrates in  repair of human respiratory epithelium using an in vitro model. Clin Exp Allergy 33(10):1398-1404. 15.  Patchell, B. J., and D. R. Dorscheid. 2006. Repair of the injury to respiratory  epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins. Clin Exp Allergy 36(5):585-93.  125  16.  Dorscheid, D. R., A. E. Conforti, K. J. Hamann, K. F. Rabe, and S. R. White.  1999. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J 31(3):145-51. 17.  Cozens, A. L., M. J. Yezzi, K. Kunzelmann, T. Ohrui, L. Chin, K. Eng, W. E.  Finkbeiner, J. H. Widdicombe, and D. C. Gruenert. 1994. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 10(1):38-47. 18.  Gruenert, D. C., W. E. Finkbeiner, and J. H. Widdicombe. 1995. Culture and  transformation of human airway epithelial cells. Am J Physiol 268(3 Pt 1):L347-60. 19.  Cozens, A. L., M. J. Yezzi, M. Yamaya, D. Steiger, J. A. Wagner, S. S. Garber, L.  Chin, E. M. Simon, G. R. Cutting, P. Gardner, and et al. 1992. A transformed human epithelial cell line that retains tight junctions post crisis. In Vitro Cell Dev Biol 28A(1112):735-44. 20.  Peterson, E. A., M. R. Sutherland, M. E. Nesheim, and E. L. Pryzdial. 2003.  Thrombin induces endothelial cell-surface exposure of the plasminogen receptor annexin 2. J Cell Sci 116(Pt 12):2399-408. 21.  Hajjar, K. A., C. A. Guevara, E. Lev, K. Dowling, and J. Chacko. 1996.  Interaction of the fibrinolytic receptor, annexin II, with the endothelial cell surface. Essential role of endonexin repeat 2. J Biol Chem 271(35):21652-9. 22.  Knight, D. A., and S. T. Holgate. 2003. The airway epithelium: structural and  functional properties in health and disease. Respirology 8(4):432-46. 23.  Holgate, S. T. 2002. Airway inflammation and remodeling in asthma: current  concepts. Mol Biotechnol 22(2):179-89. 126  24.  Kicic, A., E. N. Sutanto, P. T. Stevens, D. A. Knight, and S. M. Stick. 2006.  Intrinsic biochemical and functional differences in bronchial epithelial cells of children with asthma. Am J Respir Crit Care Med 174(10):1110-8. 25.  Goulet, F., K. G. Moore, and A. C. Sartorelli. 1992. Glycosylation of annexin I  and annexin II. Biochem Biophys Res Commun 188(2):554-8. 26.  Zieske, J. D., S. C. Higashijima, and I. K. Gipson. 1986. Con A- and WGA-  binding glycoproteins of stationary and migratory corneal epithelium. Invest Ophthalmol Vis Sci 27(8):1205-10. 27.  Hubaishy, I., P. G. Jones, J. Bjorge, C. Bellagamba, S. Fitzpatrick, D. J. Fujita,  and D. M. Waisman. 1995. Modulation of annexin II tetramer by tyrosine phosphorylation. Biochemistry 34(44):14527-34. 28.  Kassam, G., A. Manro, C. E. Braat, P. Louie, S. L. Fitzpatrick, and D. M.  Waisman. 1997. Characterization of the heparin binding properties of annexin II tetramer. J Biol Chem 272(24):15093-100. 29.  Fitzpatrick, S. L., G. Kassam, A. Manro, C. E. Braat, P. Louie, and D. M.  Waisman. 2000. Fucoidan-dependent conformational changes in annexin II tetramer. Biochemistry 39(9):2140-8. 30.  Emans, N., J. P. Gorvel, C. Walter, V. Gerke, R. Kellner, G. Griffiths, and J.  Gruenberg. 1993. Annexin II is a major component of fusogenic endosomal vesicles. J Cell Biol 120(6):1357-69. 31.  Sarafian, T., L. A. Pradel, J. P. Henry, D. Aunis, and M. F. Bader. 1991. The  participation of annexin II (calpactin I) in calcium-evoked exocytosis requires protein kinase C. J Cell Biol 114(6):1135-47. 127  32.  Tressler, R. J., T. V. Updyke, T. Yeatman, and G. L. Nicolson. 1993.  Extracellular annexin II is associated with divalent cation-dependent tumor cellendothelial cell adhesion of metastatic RAW117 large-cell lymphoma cells. J Cell Biochem 53(3):265-76. 33.  Cesarman, G. M., C. A. Guevara, and K. A. Hajjar. 1994. An endothelial cell  receptor for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated enhancement of t-PA-dependent plasminogen activation. J Biol Chem 269(33):21198203. 34.  Ma, A. S., D. J. Bell, A. A. Mittal, and H. H. Harrison. 1994.  Immunocytochemical detection of extracellular annexin II in cultured human skin keratinocytes and isolation of annexin II isoforms enriched in the extracellular pool. J Cell Sci 107 ( Pt 7):1973-84. 35.  Yeatman, T. J., T. V. Updyke, M. A. Kaetzel, J. R. Dedman, and G. L. Nicolson.  1993. Expression of annexins on the surfaces of non-metastatic and metastatic human and rodent tumor cells. Clin Exp Metastasis 11(1):37-44. 36.  Matsuda, A., Y. Tagawa, K. Yamamoto, H. Matsuda, and M. Kusakabe. 1999.  Identification and immunohistochemical localization of annexin II in rat cornea. Curr Eye Res 19(4):368-75. 37.  Chung, C. Y., and H. P. Erickson. 1994. Cell surface annexin II is a high affinity  receptor for the alternatively spliced segment of tenascin-C. J Cell Biol 126(2):539-48. 38.  Chung, C. Y., J. E. Murphy-Ullrich, and H. P. Erickson. 1996. Mitogenesis, cell  migration, and loss of focal adhesions induced by tenascin-C interacting with its cell surface receptor, annexin II. Mol Biol Cell 7(6):883-92. 128  39.  Siever, D. A., and H. P. Erickson. 1997. Extracellular annexin II. Int J Biochem  Cell Biol 29(11):1219-23. 40.  Babbin, B. A., C. A. Parkos, K. J. Mandell, L. M. Winfree, O. Laur, A. I. Ivanov,  and A. Nusrat. 2007. Annexin 2 Regulates Intestinal Epithelial Cell Spreading and Wound Closure through Rho-Related Signaling. Am J Pathol 170(3):951-66. 41.  Balch, C., and J. R. Dedman. 1997. Annexins II and V inhibit cell migration. Exp  Cell Res 237(2):259-63. 42.  Allahverdian, S., K. R. Wojcik, and D. R. Dorscheid. 2006. Airway epithelial  wound repair: role of carbohydrate sialyl Lewisx. Am J Physiol Lung Cell Mol Physiol 291(4):L828-36. 43.  Gipson, I. K., and R. A. Anderson. 1980. Effect of lectins on migration of the  corneal epithelium. Invest Ophthalmol Vis Sci 19(4):341-9. 44.  Kauffmann, F., C. Frette, Q. T. Pham, S. Nafissi, J. P. Bertrand, and R. Oriol.  1996. Associations of blood group-related antigens to FEV1, wheezing, and asthma. Am J Respir Crit Care Med 153(1):76-82. 45.  Mackie, E. J., W. Halfter, and D. Liverani. 1988. Induction of tenascin in healing  wounds. J Cell Biol 107(6 Pt 2):2757-67. 46.  Laitinen, A., A. Altraja, M. Kampe, M. Linden, I. Virtanen, and L. A. Laitinen.  1997. Tenascin is increased in airway basement membrane of asthmatics and decreased by an inhaled steroid. Am J Respir Crit Care Med 156(3 Pt 1):951-8. 47.  Waisman, D. M. 1995. Annexin II tetramer: structure and function. Mol Cell  Biochem 149-150:301-22.  129  48.  Mai, J., D. M. Waisman, and B. F. Sloane. 2000. Cell surface complex of  cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta 1477(12):215-30. 49.  Diaz, V. M., M. Hurtado, T. M. Thomson, J. Reventos, and R. Paciucci. 2004.  Specific interaction of tissue-type plasminogen activator (t-PA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro. Gut 53(7):993-1000.  130  Chapter 3 -  Identification  of  a  candidate  serum  glycoprotein ligand for cell surface annexin II using Allomyrina dichotoma agglutininii 3.1 Introduction As a protective barrier for the underlying tissue the airway epithelium is routinely challenged resulting in loss of its integrity. It is also involved in the regulation of airway diameter (1) and mucociliary clearance (2). Damage to the epithelium is a common pathological finding in asthma (3). Since barrier function is essential for preventing the penetration of noxious particles to the underlying tissue, epithelial repair occurs quickly, restoring the barrier’s integrity (4). Typically, bronchoalveolar lavage (BAL) fluid from asthmatic subjects contains Creola bodies (5) and an increased presence of eosinophils, even when the clinical diagnosis of the disease is mild (6). The accumulation of damage in asthma and the increased sloughing of epithelial cells suggest a defect in the repair mechanism and/or an increased susceptibility to injury. The chronic nature of this damage results in the loss of barrier integrity and epithelial function. As such, remodelling of the airways and airway hyperreactivity as seen in asthma, may be a result of this chronic and excessive damage (7). These findings highlight the importance of efficient and effective repair of the epithelium following injury.  ii  A version of this chapter has been published. Patchell BJ, Dorscheid DR. Repair of the injury to respiratory epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins. Clin Exp Allergy. 2006 May;3 (5):585-93.  131  Following the loss of columnar epithelial cells, the subsequent repair involves the flattening and migration of neighbouring basal cells into the damaged area. This is followed by proliferation and differentiation, to restore the pseudo-stratified epithelium (8). Cell culture models have been developed to study repair in vitro. Mechanically wounded monolayers of airway epithelial cells have been used to follow repair kinetics and to characterize the associated phenotype. Zahm et al. (9) have demonstrated that the cells adjacent to the wound migrated to repopulate the injured site. Increased proliferation was only seen in cells distant from the wound (4). This evidence suggests the initiation of repair is a tightly regulated process involving a specific subset of cells in proximity to the damaged area. Completion of the repair may require migration of cells from locations remote to the initial injury and subsequently replaced by proliferation. Models have demonstrated the kinetics of and some of the molecular elements that contribute to the morphological changes observed during epithelial wound repair (10-12). The importance of carbohydrates in cellular functions has been well documented. Carbohydrate structures attached to the surface of cells via proteins or lipids are critical in the function of many cell types such as cell adhesion (13, 14), proliferation (15), growth potential (16) and migration. In epithelial cells, it has been shown that migratory cells express different cell-surface carbohydrates than stationary cells (17). Cell-surface glycosylation profiles of airway epithelial cells were mapped and different cell types present a unique set of carbohydrates on their surfaces (18). Subsequent work demonstrated that following mechanical injury, airway epithelial cell glycosylation profiles change coordinate with repair (19). An essential role for carbohydrates in repair was identified using an in vitro model. Treatment of wounded monolayers with 132  tunicamycin, an N-glycosylation inhibitor resulted in the loss of wound repair. Furthermore, the removal of terminal fucose prevented wound closure completely (20). Adam et al. demonstrated that the lectin, wheat germ agglutinin, binds the surface of airway epithelial cells and inhibits repair (21). The authors suggest that the lectin ligand plays a significant role in epithelial repair. In both of these studies, the work went no further as to identify to molecule(s) associated with the carbohydrate ligands. Work in vivo has demonstrated the extravasation of bulk plasma into the airway lumen from the underlying microvessels following injury (22). Plasma exudation occurs rapidly following epithelial loss and is coordinate with initial healing. This plasma derived gel provides an immediate protective physical barrier. It is rich in FN and other matrix molecules that may be involved in the stimulation of epithelial repair (23). Plasma contains cytokines serum derived molecules that may exert biological activity in airways flooded with exudates (24). The repair of the damaged epithelium is initiated and proceeds much more promptly in vivo relative to repair described in cell culture experiments (25). This suggests the presence of epithelial repair factors in the microcirculation. The role of serum glycoproteins in epithelial repair has not been described. Our laboratory’s previous findings highlighted Allomyrina dichotoma agglutinin (AlloA) positive staining of basal cells in human airway epithelial tissue sections (18). Using an in vitro model of airway epithelial wound repair, the experiments and results outlined below to identify the protein associated with the AlloA lectin. Using the same modified lectin precipitation procedure described above, we identified the serum protein fetuin as a specific ligand for AlloA. Furthermore, under serum free conditions, fetuin 133  stimulated wound closure in a dose dependant manner. Recently, cell surface annexins have been shown to bind fetuin however the role of this interaction remains unknown (26). The identification of an AII associated protein using a β-galactose specific lectin may provide some insight into the identity of the functional carbohydrate modifications that mediate repair.  134  3.2 Materials and Methods 3.2.1 Cell Culture Normal human airway epithelial cells (1HAEo-) were a gift from Dr. D. Gruenert, University of Burlington, VT (27). 1HAEo- cells are SV40-transformed normal human airway epithelial cells that have been characterized previously (28, 29) and express multiple surface carbohydrate markers of primary basal airway epithelial cells (18). They were grown in culture for lectin histochemistry, wound repair kinetics and protein extraction as previously described (18). 3.2.2 Monolayer Wound Creation and Lectin Cytochemistry Monolayers of 1HAEo- cells were grown to confluence and small circular wounds (approximately 1.0 mm2) were created using a small rubber dental GUM® Stimulator (Sunstar Butler, Guelph, ON). Lectin cytochemistry was carried out as described previously (20). At 0, 6, 12 and 24 h after the creation of the wound, cells were fixed with 4% paraformaldehyde. Slides were incubated for 60 min with biotinylated AlloA lectin or Griffonia simplicifolia (GSα-1) lectin (5 µg/ml; EY Laboratories Inc., San Mateo CA) in HEPES buffer without BSA. Microscope images were photographed with a Sony Iris charge-coupled device camera (Sony, Rolling Meadows, IL) on a Nikon Diaphot inverted stage microscope. Video images were digitized with a Macintosh computer and Apple Video Player software (Apple Computer, Cupertino, CA).  135  3.2.3 Monolayer Wound Repair Assays This assay was carried out as has been described previously (10, 30, 31). Briefly, cells were grown to confluence in six well dishes and circular wounds (~2.0 mm2) were created using a small rubber stylet (4 wounds per well). After wounding, cells were washed with medium (as above) without FBS. Treatment of the cells included an unstimulated control incubated in the medium without FBS. The remaining 5 wells were incubated in medium with 10 % FBS and each with 15ng/ml human EGF (Invitrogen, Burlington, ON) and unconjugated lectins (AlloA, GSα-1, EY Laboratories, San Mateo, CA) at 10 - 100 μg/ml. Wounds were imaged at t = 0, 6, 12, 18 and 24 h after wounding using a Nikon Eclipse TE200 inverted scope equipped with a Nikon Coolpix E995. Wound area was calculated by manual tracing and area calculation software (ImagePro Plus 32, Media Cybernetics Inc., Silver Spring, MD). A similar protocol was performed with serum protein stimulation of wound repair. 1HAEo- cells were grown to confluence and serum starved for 24 h. Fetuin (Sigma-Aldrich, Oakville, ON) was added in increasing doses (0.03 - 1.0 mg/ml) to the serum-free medium. Based on the Sigma product technical data sheet, analysis by agarose electrophoresis purity reveals a minimum purity of 98%. The only impurity listed was free N-acetylneuraminic acid with a concentration below 0.2%. Wounds were imaged at t = 0, 6, 12 and 24 h and closure rates were determined as described above. 3.2.3 Lectin Precipitation Assay 1HAEo- cells were grown to confluence, a wound was created in the monolayer of cells using a cell scraper (Sarstdedt, Montreal, PQ). The wound size was large enough to 136  remain open at 18 h. Wounded monolayers were washed with phosphate buffered saline (PBS). DMEM plus 10 % FBS was added. After 18 h in culture, the growth medium was removed and monolayers were washed with PBS to remove any remaining media. Protein lysis buffer (1% Nonidet P-40 (NP-40), 0.25% sodium deoxycholate (Na-DOC), 150 mM sodium  chloride  (NaCl),  1  mM  ethyleneglycotetraacetic  (EGTA),  1  mM  phenylmethylsulfonyl fluoride (PMSF), 1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 1 mM sodium vanadate (Na3VO4), and 1 mM sodium fluoride) was added to the monolayer, the dish was scraped and the suspension was transferred into 1.5 ml microcentrifuge tube and tumbled for 15 minutes at 4oC prior to centrifugation at 12,000Xg at 4oC for 10 minutes. Protein concentrations were determined for each of the lysates using the BCA protein assay kit (Pierce, Rockford IL). Protein (200 μg) was diluted into 250 μl final volume with lectin buffer (10 mM HEPES, 150 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.2.) with protease inhibitors (Sigma, P-8340). Prior to specific lectin precipitation, the non-specific proteins were cleared from the protein lysates by the addition of 60 μl of avidin-agarose beads (Sigma, S-1638). Following incubation for 1 h at 4oC, the beads were precipitated at 12000Xg and the supernatant was transferred to a 1.5 ml microcentrifuge tube. 20 μg of biotinylated lectin was added to the supernatant and incubated overnight at 4oC. To precipitate the lectin specific proteins, the supernatant was incubated with 60 μl of 60:40 avidin-agarose beads slurry for 1 h. The beads were precipitated and the pellet was washed twice with lectin buffer. Precipitated proteins were denatured in sodium dodecyl sulphate (SDS) buffer.  137  3.2.4 Protein Purification and Sequencing Precipitated proteins were separated by SDS poly acrylamide gel electrophoresis (PAGE). The gel was stained with Coomassie R-250 and destained overnight in 30% methanol, 10% acetic acid. Selection of bands for sequencing was based on visual assessment. The purified band was excised from the gel and sequenced via MALDI-TOF MS analysis (The University of Victoria – Genome British Columbia Proteomics Centre, www.proteincentre.com). Briefly, excised protein was subjected to tryptic digestion and spotted onto MALDI-TOF plates with α-cyno-4-hydroxycinnamic acid (CHCA) matrix using conditioned C18 ZipTips (Millipore, Nepean, ON). ZipTips were conditioned using successive washes of; 100% acetonitrile, 50% acetonitrile 0.1% Trifluoroacetic acid (TFA), and 0.1% TFA. 10 μl of the digested sample was then loaded onto the ZipTip. The bound peptides were then washed 3X with 0.1% TFA. The peptides were then eluted directly onto a MALDI target plate using 1 μl of a 10mg/ml solution CHCA in 50% acetonitrile, 0.1% TFA. Peptide mass fingerprints were obtained using MALDI-TOF mass spectrometry (Applied Biosystems Voyager DE-STR MALDI-TOF). Spectra were acquired in positive ion mode using the ion reflector at an accelerating voltage of 20kV. A total of 100 scans were averaged to create the final spectrum. The grid voltage was set to 65 % of the accelerating voltage and a delay time of 80 nanoseconds was used. Peptide mass data was submitted to MASCOT database for protein identification (http://www.matrixscience.com/).  138  3.2.5 Statistics Values are presented as means ± SE. The significance of differences between means was assessed by analysis of variance followed by the Tukey-HSD test, with the level of significance set at P < 0.05.  139  3.3 Results 3.3.1 Lectin Staining of Wounded Airway Epithelial Cell Monolayers. AlloA staining of 1HAEo- cells accumulates following mechanical injury (Figure 3.1a-d). Prior to mechanical wounding, there is negligible AlloA staining, representing baseline (Figure 3.1a). Monolayers fixed 6 h after wounding demonstrated AlloA positive staining only on cells in proximity to the wounded area (Figure 3.1b) relative to the baseline (Figure 3.1a). Monolayers fixed at 12 and 24 h after wounding had a dramatic accumulation of AlloA positive stained cells inside the wound area (Figures 3.1c, d). Lectin staining with GSα-1, a lectin with similar carbohydrate specificity to AlloA, demonstrated a completely different staining pattern than that observed using AlloA (Figure 3.1e, f). Similarly to AlloA staining, prior to mechanical injury, GSα-1 staining is absent (Figure 3.1e). Following mechanical injury and 24 h repair, there was very little change in GSα-1 positive staining cells relative to the corresponding AlloA staining (Figure 3-1d).  140  Figure 3.1 - AlloA and GSα-1 lectin binding on the surface of 1HAEomonolayers. AlloA positive staining cell numbers increased over time and accumulate in the disrupted site following mechanical injury. (a) No mechanical injury demonstrates the negative baseline pattern of AlloA staining, (b) 6 h repair (c) 12 h repair and (d) 24 h repair demonstrate a pattern of increasing AlloA staining in proximity to the damaged site. GSα-1 lectin staining of 1HAEo- cells results in negative baseline in both (e) confluent and (f) 24 h repair monolayers. Scale bar = 20 μm  141  3.3.2 Effect of AlloA on Wounded Airway Epithelial Monolayer Repair Representative images of wound closure for serum-free (Control) and EGF + serum stimulated monolayers demonstrate closure over time (Figure 3.2). Control serum-free monolayer wounds closed slowly over a 24 h period, while closure in the presence of serum and EGF progressed to near completion after 24 h. Representative images of AlloA treatments highlight the wound closure inhibition capability of AlloA. Low dose AlloA (10 μg/ml) demonstrates very little effect with respect to inhibiting wound closure. Increasing the concentration of AlloA (100 μg/ml) resulted in large wound areas remaining after 24 h of repair. Wounds in the presence of GSα-1 at the same dose (100 μg/ml) closed completely over the same 24 h period. Mean initial wound area for each of the wounds used in this study was 2.38 ± 0.15 mm2. Initial wound areas for monolayers for both AlloA and GSα-1 treatment were equivalent and consistent. Treatment of several wounds each with varying amounts of the AlloA lectin, revealed inhibition of wound closure in a dose dependant manner (Figure 3.3A). Wounds grown in 10% FBS with 15 ng/ml EGF closed substantially over the 24 h period (9.2 ± 1.3% initial wound area remaining) relative to un-stimulated serum-free control wounds (61.4 ± 3.3%). After 24 h, wounds treated with 10 μg/ml AlloA had very little inhibition of wound closure (14.7 ± 3.0%). Increasing the dose of AlloA to 25 μg/ml and 50 μg/ml resulted in increased inhibition of wound closure (24.8 ± 2.9% and 26.9 ± 2.3% respectively). The addition of AlloA at 100 μg/ml produced significant inhibition of serum-stimulated wound closure (53.6 ± 3.4%). There was no statistical difference between repair closure rates for the unstimulated serum-free monolayers and the 100 μg/ml AlloA treated cell monolayers (61.4 142  ± 3.3% vs. 53.6 ± 3.4%). In a dose-dependent manner, the addition of AlloA inhibited stimulated wound closure to rates similar to the un-stimulated control. (n ≥ 4 for all experiments) The lectin GSα-1 was used as a control for the AlloA experiment to demonstrate the inhibition was lectin specific. Despite a similar carbohydrate specificity, GSα-1 lectin does not bind basal cells of the intact epithelium(18) nor does it bind the surface of 1HAEo- cells during wound closure (Figure 3.1). Using GSα-1 at the same doses as AlloA (10 – 100 μg/ml), wound closure was followed for 24 h. (Figure 3.3B, n ≥ 3 for all experiments). GSα-1 demonstrated no inhibition, at any time point, of the serum stimulated control wound closure. The closure rates for the independent controls of the AlloA and GSα-1 were similar. These findings suggest that AlloA is binding a carbohydrate on a structure critical in the effective repair of damaged airway epithelial cells.  143  Figure 3.2 - Representative phase-contrast images of wounded 1HAEoand wound closure inhibition caused by AlloA at the indicated times. Control (serum free), Serum + EGF (10 % FBS, 15 ng/ml EGF), 10 and 100 μg/ml AlloA and 100 μg/ml GSα-1 images are shown. The inhibition of repair after AlloA addition to wounded 1HAEo- monolayers in culture is dose dependant. This effect is not shared with GSα-1, as its addition added to the culture media resulted in no wound closure inhibition. Manual traces are included for illustrative purposes. Original magnification; 40X. 144  Figure 3.3 - Closure of 1HAEo- wounds in the presence of lectins. (A) AlloA in increasing amounts (10 – 100 μg/ml) disrupted the kinetics of wound closure in a dose dependant manner. Controls included negative unstimulated (Control) and stimulated (Serum + EGF) monolayers. After 24 h repair (A) a dose response is shown as a result of the AlloA treatments. A marked reduction in wound repair was demonstrated at the 100 μg/ml level. This effect was lost as the lectin concentration was reduced such that there is no statistical difference in wound closure of the 10 mg/ml AlloA relative to the serum + EGF stimulated control. Treatment with (B) GSα-1 resulted in no wound closure inhibition over the same range of lectin doses. N ≥3 for all experiments, *p<0.05 relative to EGF stimulated repair. 145  3.3.3 Purification of AlloA Specific Glycoproteins Differences were observed in the protein profiles generated by lectin specific precipitations from each of the cell lysates (Figure 3.4). A protein band that was enriched in the AlloA precipitates of wounded monolayers relative to the confluent monolayers and absent from the GSα-1 lectin precipitation was selected for further analysis. The 62 kDa band was present only in the AlloA lectin precipitations (Figure 3.4A) and absent from GSα-1 precipitations (Figure 3.4B). By MALDI-TOF sequencing, this protein band was identified as bovine fetuin. As fetuin is a component of FBS, this bovine protein originated from the culture medium. Fetuin was present in our protein extracts despite a thorough washing of the monolayer prior to protein collection. Considering our AlloA lectin staining of 1HAEo- monolayers and the precipitation of fetuin with AlloA suggested fetuin may bind a cell surface receptor whose presentation on the cell surface increases following mechanical injury. As AlloA specifically bound fetuin, increasing competition for binding by AlloA with the human cellular receptor for fetuin may be responsible for the observed dose-dependent AlloA inhibition of wound closure. Furthermore, the glycosylated structure is a likely and important component of this interaction. Bovine and human fetuin are both highly glycosylated and similar in structure. As such they potentially bind to the same human lectin or receptor.  146  Figure 3.4 - Lectin precipitation profiles of 1HAEo- monolayers protein extracts. Protein extracts from confluent and wounded monolayers were incubated with biotinylated lectins (15 μg/ml) and avidin agarose beads as described in Methods. Precipitated proteins were separated by 10% SDS PAGE and the gel was stained with Coomassie R-250. Lectin controls were included in the gel to identify the lectin. Differences were observed between AlloA (A) and GSα-1 (B) precipitations. One protein band of 62 kDa was present only in the AlloA precipitations and appeared to be enriched in the wounded monolayer preparations. The 62 kDa AlloA specific band (twoheaded black arrow) was identified as bovine fetuin by protein sequencing.  147  3.3.4 Effect of Serum Glycoproteins on Wound Closure Serum glycoproteins may participate in repair by augmenting closure rates. We tested fetuin in our model of monolayer wound repair (Figure 3.5). Fetuin was identified as a protein that AlloA binds to inhibit wound repair. Mean initial wound area for the wounds used in this study was 1.27 ± 0.32 mm2. Initial wound areas for monolayers within each experimental series were equivalent and consistent. Considering the percentage remaining of the initial wound area, control serum-free wounds closed slowly over a 24 h period (65.1 ± 3.3%), whereas wounds grown in 10% FBS closed such that the remaining wound was a fraction of its original size over the same 24 h period (8.9 ± 3.5%). The concentration of fetuin in normal serum is between 0.40-0.85 mg/ml (32). The addition of fetuin (0.03 to 1.0 mg/ml) to the culture media stimulated wound closure in a dose-dependent manner relative to untreated control wounds (Figure 3.5). Following 12 h of repair, the percentage of the initial wound area remaining relative to untreated control monolayers was significant only in those treated with 1.0 mg/ml fetuin (58.6 ± 13.2 % versus 79.1 ± 3.1 % for control, N = 4). Following 24 h of repair, closure of wounds treated with both 0.3 mg/ml and 1.0 mg/ml was significant relative to the untreated serum-free control wounds (37.1 ± 4.7 % and 19.6 ± 4.7 % respectively versus 65.1 ± 6.8 % for control). Despite an additional 10-fold increase in the concentration of fetuin (10 mg/ml), wound closure rates were not equivalent to that affected by 10 % FCS (Data not shown). Fetuin alone may only be one of many required mediators or events of repair.  148  Figure 3.5 - Wound closure stimulation by serum glycoproteins. Cells were grown to confluence and serum starved for 24 h. Small circular wounds were created. Following wounding, the negative control was incubated in serum-free medium and the positive control was incubated in serum containing medium (10% FBS). Treatment monolayers were wounded and incubated in serum free media with the glycoprotein fetuin added. Wound closure was followed using time-lapse videomicroscopy. The serum glycoprotein fetuin stimulates wound closure of serum deprived 1HAEo monolayers. n = 4 for all experiments, *p<0.05 relative to the unstimulated serum free control.  149  3.4 Discussion Asthma is a disease of the lower airways, described as reversible airflow obstruction due to inflammation and airways hyperreactivity. For this reason, most therapeutic and research approaches have focused on the symptomatic control of the disease through anti-inflammatory steroids and bronchodilation. However, pathological studies of patients who died as a result of severe asthma had phenotypic changes in their airways including chronic damage to the airway epithelium (7) suggesting a defect in the mechanism of repair. Using a model of epithelial wound repair, we hoped to identify novel mediators that could be applied to future studies. In this study we have shown that the addition of fetuin, a serum glycoprotein, stimulated 1HAEo- wounds in culture. The data suggests that serum glycoproteins play a role in the stimulation of airway epithelial wound repair. Glycoproteins appear to be an important component in this wound repair model, and may act through a serum protein receptor such as the recently identified cell surface AII (26). The role for serum glycoproteins and human lectins in disease is a growing field that requires further study. Our wound repair model results expand on work done previously that revealed the importance of carbohydrates in airway epithelial repair as well the presence of serum glycoproteins in the airways as a result of damage to the epithelium. Work by White et al. (33) has shown that lectins can be added to the culture media to competitively inhibit the receptor-ligand interaction ultimately inhibiting cellular functions. The authors in this study demonstrated that the addition of wheat germ agglutinin (WGA) following mechanical injury competitively inhibits α-dystroglycan binding of laminin. WGA is a 150  lectin that binds N-actylglucosamine containing oligosaccharides. Conversely, AlloA is a C-type lectin that binds terminal galactose containing oligosaccharides (34) and would therefore associate with a unique group of ligands compared to WGA. In our repair model, the addition of AlloA resulted in the inhibition of wound closure, despite stimulation with EGF and the presence of serum in the culture media. These findings suggest that AlloA affects inhibition of wound closure by two possible mechanisms. AlloA may bind a membrane glycoprotein such as a receptor, inhibiting its critical function. Conversely AlloA in the culture media is binding essential glycoproteins found within the media, blocking the processes of cell surface binding required for the downstream signaling and cellular activation. AlloA has previously been identified as a mitogenic factor of mature T-cells (35). These finding were cell type specific, as the same effect was not seen in B-cells and may explain the differences in effect that we observed in airway epithelial cells. The glycoprotein bound by AlloA was identified by lectin precipitations and protein sequencing as fetuin. Fetuin was present in the AlloA precipitations and absent in the GSα-1 precipitations. As the media was completely removed and the cells were washed prior to protein extraction, the presence of fetuin in the protein extracts, and subsequently the AlloA precipitations, can only be explained if the fetuin is bound by a cell surface receptor on the airway epithelial cells. The binding of fetuin to the cell surface is supported by our AlloA lectin histochemistry results where the AlloA positive staining on the cell surface is attributed to bound fetuin. The presence of serum glycoproteins in the airway was first observed in the work of Ejefalt et al. (22). Almost immediately after the epithelium is damaged, cells in the 151  wound margin phenotypically change to basal-like cells and flatten out to restore the physical barrier lost in the shedding of epithelial columnar cells (8, 36). Following mechanical injury to guinea pig trachea, plasma from the microcirculation exudes into the region of damage and provides an immediate cover of the denuded basement membrane (22). In our culture model, bovine fetuin present in the media is responsible for the initial stimulation of closure. Recently in human lungs, proteomic analysis of oedema fluid and broncho-alveolar lavage fluid from acute lung injury patients had an increase in the α2Heremans-Schmid-glycoprotein (human fetuin)(37). The presence of human fetuin in the luminal space of the lung following injury corresponds with our findings. Damage to the airway epithelium would facilitate the binding of serum glycoproteins to their cellular receptor and signal that migration and repair are needed. The addition of fetuin to the culture media resulted in a stimulation of wound closure in our model. Over the full range of fetuin treatments (0.03 – 1.0 mg/ml), there was a dose-dependent increase in wound closure relative to the un-stimulated control (Figure 4.5). Interestingly, with a 10-fold increase in fetuin (10.0 mg/ml) wound repair was not fully restored to the level of serum stimulated closure (data not shown). We suggest that fetuin plays a role in the complex repair processes; however, it is likely one of several serum factors necessary for repair. The addition of fetuin alone initiates closure in conjunction with physical barrier reestablishment. Subsequent factors present in the plasma that exudes into the airway would be required for complete repair. Its addition alone, in the absence of the additional factors present in serum, is insufficient to restore epithelial repair completely. As a result, dramatically increasing the fetuin concentration had no cumulative effect on wound closure stimulation. 152  Fetuin is a highly glycosylated protein whose function is not well understood. It has been implicated in the deactivation of macrophages through binding to one of its receptors, the ASGPR (38). The ASGPR is a C-type lectin that, similar to AlloA, binds galactose containing glycoproteins. ASGPR has primarily been studied in the liver and is responsible for the clearance and endocytosis of serum glycoproteins (39). It has been detected in non-hepatic tissues, however lung was not included (40). The ASGPR is expressed in our in vitro model of airway epithelial repair and may be one of the potential fetuin receptors responsible for the fetuin stimulation of wound closure. Future studies should also consider the expression and function of ASGPR, other serum protein receptors and human lectins in normal and asthmatic tissue. Fetuin has previously been described as a transforming growth factor β (TGFβ) antagonist (41) and in our model, the stimulation of airway epithelial repair by fetuin may be through its effect on TGFβ. Annexin II has recently been identified as a potential receptor for fetuin(26). As described above, this small and primarily cytoplasmic protein has been described on the surface of a variety of cells. These results suggest that the presentation of AII on the cell surface may allow it to act as a serum protein receptor following airway epithelial injury. Further experimentation is required to show a functional link between AII and fetuin, such as gene silencing techniques followed by exposure to fetuin during wound closure assays. Protein interactions between fetuin and AII can be observed by coimmunoprecipitation and visualized in double labelling followed by confocal microscopy experimentation. Complex interactions and signalling pathways are responsible for the level of organization required to perform repair. In the epithelium, this involves cell migration, 153  proliferation and differentiation. Holgate et al.(42) have suggested that the asthmatic epithelium is locked in a chronically repairing phenotype acting as a continuous source of pro-inflammatory products and growth factors that drive airway remodelling. We have highlighted the importance of serum glycoproteins in the processes of epithelial repair. In other inflammatory conditions, the released cytokines are known to affect the glycosylation phenotype (43). If the inflammatory environment of the asthmatic airway alters glycosylation such that the receptor interaction with serum proteins is affected, this may result in the accumulation of epithelial damage as the initiation of repair would be impaired. Cell surface glycosylation in asthmatics has been demonstrated as abnormal (44). Our results add to the previous findings that serum glycoproteins provide not only a protective barrier to sites of injury on the airway epithelium, but also actively stimulate airway epithelial cells. This study also demonstrates that glycosylated structures are an important part of this repair process and may provide new insight for research and therapeutic approaches in diseases where the presence of damage to the epithelium is a common observation.  154  References  1.  Fedan, J. S., L. X. Yuan, V. C. Chang, J. O. Viola, D. Cutler, and L. L. Pettit.  1999. Osmotic regulation of airway reactivity by epithelium. J Pharmacol Exp Ther 289(2):901-10. 2.  Wanner, A. 1986. Mucociliary clearance in the trachea. Clin Chest Med 7(2):247-  58. 3.  Laitinen, L. A., M. Heino, A. Laitinen, T. Kava, and T. Haahtela. 1985. Damage  of the airway epithelium and bronchial reactivity in patients with asthma. Am Rev Respir Dis 131(4):599-606. 4.  Zahm, J. M., H. Kaplan, A. L. Herard, F. Doriot, D. Pierrot, P. Somelette, and E.  Puchelle. 1997. Cell migration and proliferation during the in vitro wound repair of the respiratory epithelium. Cell Motil Cytoskeleton 37(1):33-43. 5.  Oddera, S., M. Silvestri, A. Balbo, B. O. Jovovich, R. Penna, E. Crimi, and G. A.  Rossi. 1996. Airway eosinophilic inflammation, epithelial damage, and bronchial hyperresponsiveness in patients with mild-moderate, stable asthma. Allergy 51(2):100-7. 6.  Wardlaw, A. J., S. Dunnette, G. J. Gleich, J. V. Collins, and A. B. Kay. 1988.  Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Relationship to bronchial hyperreactivity. Am Rev Respir Dis 137(1):62-9.  155  7.  Beasley, R., W. R. Roche, J. A. Roberts, and S. T. Holgate. 1989. Cellular events  in the bronchi in mild asthma and after bronchial provocation. Am Rev Respir Dis 139(3):806-17. 8.  Erjefalt, J. S., I. Erjefalt, F. Sundler, and C. G. Persson. 1995. In vivo restitution  of airway epithelium. Cell Tissue Res 281(2):305-16. 9.  Zahm, J. M., D. Pierrot, M. Chevillard, and E. Puchelle. 1992. Dynamics of cell  movement during the wound repair of human surface respiratory epithelium. Biorheology 29(5-6):459-65. 10.  Kim, J. S., V. S. McKinnis, A. Nawrocki, and S. R. White. 1998. Stimulation of  migration and wound repair of guinea-pig airway epithelial cells in response to epidermal growth factor. Am J Respir Cell Mol Biol 18(1):66-74. 11.  Puddicombe, S. M., R. Polosa, A. Richter, M. T. Krishna, P. H. Howarth, S. T.  Holgate, and D. E. Davies. 2000. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. Faseb J 14(10):1362-74. 12.  White, S. R., D. R. Dorscheid, K. F. Rabe, K. R. Wojcik, and K. J. Hamann.  1999. Role of very late adhesion integrins in mediating repair of human airway epithelial cell monolayers after mechanical injury. Am J Respir Cell Mol Biol 20(4):787-96. 13.  Takada, A., K. Ohmori, T. Yoneda, K. Tsuyuoka, A. Hasegawa, M. Kiso, and R.  Kannagi. 1993. Contribution of carbohydrate antigens sialyl Lewis A and sialyl Lewis X to adhesion of human cancer cells to vascular endothelium. Cancer Res 53(2):354-61. 14.  Yoshida-Noro, C., J. Heasman, K. Goldstone, L. Vickers, and C. Wylie. 1999.  Expression of the Lewis group carbohydrate antigens during Xenopus development. Glycobiology 9(12):1323-30. 156  15.  Martinez, J. A., I. Torres-Negron, L. A. Amigo, and D. K. Banerjee. 1999.  Expression of Glc3Man9GlcNAc2-PP-Dol is a prerequisite for capillary endothelial cell proliferation. Cell Mol Biol (Noisy-le-grand) 45(1):137-52. 16.  Pili, R., J. Chang, R. A. Partis, R. A. Mueller, F. J. Chrest, and A. Passaniti. 1995.  The alpha-glucosidase I inhibitor castanospermine alters endothelial cell glycosylation, prevents angiogenesis, and inhibits tumor growth. Cancer Res 55(13):2920-6. 17.  Gipson, I. K., C. V. Riddle, T. C. Kiorpes, and S. J. Spurr. 1983. Lectin binding to  cell surfaces: comparisons between normal and migrating corneal epithelium. Dev Biol 96(2):337-45. 18.  Dorscheid, D. R., A. E. Conforti, K. J. Hamann, K. F. Rabe, and S. R. White.  1999. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J 31(3):145-51. 19.  Xiantang, L., D. R. Dorscheid, K. R. Wojcik, and S. R. White. 2000.  Glycosylation profiles of airway epithelium after repair of mechanical injury in guinea pigs. Histochem J 32(4):207-16. 20.  Dorscheid, D. R., K. R. Wojcik, K. Yule, and S. R. White. 2001. Role of cell  surface glycosylation in mediating repair of human airway epithelial cell monolayers. Am J Physiol Lung Cell Mol Physiol 281(4):L982-92. 21.  Adam, E., S. Holgate, C. Fildew, and P. Lackie. 2003. Role of carbohydrates in  repair of human respiratory epithelium using an in vitro model. Clin Exp Allergy 33(10):1398-1404. 22.  Erjefalt, J. S., I. Erjefalt, F. Sundler, and C. G. Persson. 1994. Microcirculation-  derived factors in airway epithelial repair in vivo. Microvasc Res 48(2):161-78. 157  23.  Persson, C. G., J. S. Erjefalt, L. Greiff, M. Andersson, I. Erjefalt, R. W. Godfrey,  M. Korsgren, M. Linden, F. Sundler, and C. Svensson. 1998. Plasma-derived proteins in airway defence, disease and repair of epithelial injury. Eur Respir J 11(4):958-70. 24.  Grainger, D. J., P. R. Kemp, J. C. Metcalfe, A. C. Liu, R. M. Lawn, N. R.  Williams, A. A. Grace, P. M. Schofield, and A. Chauhan. 1995. The serum concentration of active transforming growth factor-beta is severely depressed in advanced atherosclerosis. Nat Med 1(1):74-9. 25.  Zahm, J. M., M. Chevillard, and E. Puchelle. 1991. Wound repair of human  surface respiratory epithelium. Am J Respir Cell Mol Biol 5(3):242-8. 26.  Kundranda, M. N., S. Ray, M. Saria, D. Friedman, L. M. Matrisian, P. Lukyanov,  and J. Ochieng. 2004. Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A. Biochim Biophys Acta 1693(2):111-23. 27.  Cozens, A. L., M. J. Yezzi, K. Kunzelmann, T. Ohrui, L. Chin, K. Eng, W. E.  Finkbeiner, J. H. Widdicombe, and D. C. Gruenert. 1994. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 10(1):38-47. 28.  Gruenert, D. C., W. E. Finkbeiner, and J. H. Widdicombe. 1995. Culture and  transformation of human airway epithelial cells. Am J Physiol 268(3 Pt 1):L347-60. 29.  Cozens, A. L., M. J. Yezzi, M. Yamaya, D. Steiger, J. A. Wagner, S. S. Garber, L.  Chin, E. M. Simon, G. R. Cutting, P. Gardner, and et al. 1992. A transformed human epithelial cell line that retains tight junctions post crisis. In Vitro Cell Dev Biol 28A(1112):735-44.  158  30.  Kim, J. S., K. F. Rabe, H. Magnussen, J. M. Green, and S. R. White. 1995.  Migration and proliferation of guinea pig and human airway epithelial cells in response to tachykinins. Am J Physiol 269(1 Pt 1):L119-26. 31.  Kim, J. S., V. S. McKinnis, and S. R. White. 1997. Migration of guinea pig  airway epithelial cells in response to bombesin analogues. Am J Respir Cell Mol Biol 16(3):259-66. 32.  Lebreton, J. P., F. Joisel, J. P. Raoult, B. Lannuzel, J. P. Rogez, and G. Humbert.  1979. Serum concentration of human alpha 2 HS glycoprotein during the inflammatory process: evidence that alpha 2 HS glycoprotein is a negative acute-phase reactant. J Clin Invest 64(4):1118-29. 33.  White, S. R., K. R. Wojcik, D. Gruenert, S. Sun, and D. R. Dorscheid. 2001.  Airway epithelial cell wound repair mediated by alpha-dystroglycan. Am J Respir Cell Mol Biol 24(2):179-86. 34.  Sueyoshi, S., K. Yamamoto, and T. Osawa. 1988. Carbohydrate binding  specificity of a beetle (Allomyrina dichotoma) lectin. J Biochem (Tokyo) 103(5):894-9. 35.  Kimura, S., K. Umetsu, T. Yamashita, T. Suzuki, S. Arai, and F. Sendo. 1987. T  cell mitogenicity of a novel beta-D-galactoside-specific lectin from the beetle, Allomyrina dichotoma (allo A). Immunopharmacology 13(3):181-8. 36.  Erjefalt, J. S., F. Sundler, and C. G. Persson. 1997. Epithelial barrier formation by  airway basal cells. Thorax 52(3):213-7. 37.  Bowler, R. P., B. Duda, E. D. Chan, J. J. Enghild, L. B. Ware, M. A. Matthay, and  M. W. Duncan. 2004. Proteomic analysis of pulmonary edema fluid and plasma in patients with acute lung injury. Am J Physiol Lung Cell Mol Physiol 286(6):L1095-104. 159  38.  Wang, H., M. Zhang, M. Bianchi, B. Sherry, A. Sama, and K. J. Tracey. 1998.  Fetuin (alpha2-HS-glycoprotein) opsonizes cationic macrophagedeactivating molecules. Proc Natl Acad Sci U S A 95(24):14429-34. 39.  Stockert, R. J. 1995. The asialoglycoprotein receptor: relationships between  structure, function, and expression. Physiol Rev 75(3):591-609. 40.  Park, J. H., E. W. Cho, S. Y. Shin, Y. J. Lee, and K. L. Kim. 1998. Detection of  the asialoglycoprotein receptor on cell lines of extrahepatic origin. Biochem Biophys Res Commun 244(1):304-11. 41.  Demetriou, M., C. Binkert, B. Sukhu, H. C. Tenenbaum, and J. W. Dennis. 1996.  Fetuin/alpha2-HS glycoprotein is a transforming growth factor-beta type II receptor mimic and cytokine antagonist. J Biol Chem 271(22):12755-61. 42.  Holgate, S. T., P. M. Lackie, D. E. Davies, W. R. Roche, and A. F. Walls. 1999.  The bronchial epithelium as a key regulator of airway inflammation and remodelling in asthma. Clin Exp Allergy 29 Suppl 2:90-5. 43.  Yang, X., M. Lehotay, T. Anastassiades, M. Harrison, and I. Brockhausen. 2004.  The effect of TNF-alpha on glycosylation pathways in bovine synoviocytes. Biochem Cell Biol 82(5):559-68. 44.  Kauffmann, F., C. Frette, Q. T. Pham, S. Nafissi, J. P. Bertrand, and R. Oriol.  1996. Associations of blood group-related antigens to FEV1, wheezing, and asthma. Am J Respir Crit Care Med 153(1):76-82.  160  Chapter 4 - Interaction of cell surface annexin II and tenascin-C augments airway epithelial wound repair.iii  4.1 Introduction The airway epithelium is subjected to daily challenges such as allergens, pollutants and virus particles. These challenges can result in damage to epithelial cells that is rapidly and effectively repaired in normal airways. In asthmatic airways, the accumulation of damage to the epithelium suggests either impaired mechanisms of repair or an increased susceptibility to injury. Recent studies in vitro have shown a difference between cells isolated from asthmatics relative to healthy individuals (1). Our objective is to better understand the mechanisms and mediators of airway epithelial repair such that our findings can be applied to the asthmatic airway. Annexin II (AII) is a member of the annexin family of proteins consisting of 12 members in mammalian cells. No clear function of annexins has been described however they appear to participate in a variety of cellular events which may be regulated by their cellular localization and protein complex formation. Research groups have demonstrated AII can be localized to the surface of a variety of cells such as endothelial cells, keratinocytes, neuroglia and smooth muscle cells (2-5). AII participates in cell migration such as corneal or endothelial repair (6, 7) and promoting tumour cell metastasis (8, 9). In chapter II we have shown that AII, an anionic phospholipids binding protein, can be  iii  A version of this chapter will be submitted for publication. Patchell BJ, Dorscheid DR. Cell surface annexin II interaction with tenascin-C stimulates airway epithelial wound closure in vitro.  161  precipitated with Chick pea agglutinin (CPA), a lectin that binds a carbohydrate structure that participates in wound repair (10). Several proteins have been shown to bind AII both on the cell surface and in the intracellular milieu. Furthermore, AII lacks an enzymatic domain and as a result, the function and regulation of AII is largely based on its cellular localization, protein interactions and complex formation. For example, on the surface of endothelial cells AII acts as a co-receptor for tissue specific plasminogen activator (t-PA) and plasminogen to facilitate the generation of plasmin, an important fibrinolytic enzyme (11-14) and initiator of inflammatory processes through the activation of proteaseactivated receptors (PAR) (15). Annexin II and p11 form a heterotetramer consisting of two molecules of AII bridged together by two p11 molecules. As a complex, the AII heterotetramer (AIIt) is thought to be membrane associated, while the AII monomers are found primarily in the cytosol. Much like the other members of the annexin family of proteins, no definitive function of the AIIt in vivo has been identified although they have been implicated in several cellular functions in vitro (16). Their binding and interaction with anionic phospholipids and the plasma membrane has focused much of the research on membrane events such and endo- and exo-cytosis. Our previous findings highlight the potential role glycosylation plays in AII regulation. Glycosylation of AII itself or its association with a glycosylated structure is essential in the cell surface presentation of AII (10). The actin cytoskeleton supports diverse cellular processes such as endocytosis, oriented growth, adhesion and migration. Monomeric AII and the AII heterotetrameric complex is capable of binding to actin filaments in a Ca2+-dependent manner (17, 18). The AII/F-actin interaction is more commonly found in dynamic actin structures, in 162  particular those associated with cellular membranes during phagocytosis, pinocytosis and cell migration, suggesting AII is not a bundling factor but plays a role of the interaction of actin bundles with the plasma membrane. Furthermore, a cellular membrane that contains proteins typically associated with lipid rafts is required for AII F-actin bundling (19-22) . Actin association with cell–cell contact points, focal adhesions and extracellular matrix-binding proteins such as integrins maintains the connectivity of cells with membranes and with neighbouring cells in tissues. The rearrangement of actin is associated with migration, formation of filopods and lamellipods, endocytosis and exocytosis (23). The localization of AII within these structures may facilitate the regulation of cytoskeletal rearrangements required for wound repair. Using two different lectins whose carbohydrate ligands appear to mediate airway epithelial wound repair, CPA and AlloA, we have shown that AII is associated with both (10, 24). Following the identification of AII as a CPA associated protein, our analysis with AlloA resulted in the purification of fetuin. Previous reports show that cell surface AII can act as a receptor for several ligands including tenascin-C, and fetuin (2, 7, 25). Our objective was to confirm the role for and regulation of cell surface AII in mediating airway epithelial wound repair in our model. Using siRNA technology, we have successfully silenced the expression of both AII and the annexin II light chain (p11), the members of the AII heterotetramer (AIIt) complex. The downstream signalling following tenascin-C binding AII is complex. Tenascin-C is an ECM protein that is expressed during development and tissue repair (reviewed in Mackie 1997 (26)). Within the tenascin-C molecule are epidermal growth factor (EGF)-like domains that are ligands for the epidermal growth factor receptor (EGFR)(27), a growth factor receptor previously 163  identified as an essential mediator of epithelial repair (28, 29). Extracellular tenascin-C may also promote cellular migration through disruption of cellular adhesions to fibronectin (30, 31). Our initial identification of AII was as a novel cell surface mediator that is translocated to the cell surface following injury which is the focus of this study. Using siRNA we confirmed that AII and its AIIt associated protein p11, when knocked down, are essential for effective airway epithelial wound repair in our model. We have shown that the stimulation of wound closure seen with tenascin-C can be inhibited by both AII siRNA and an anti-AII antibody. The interaction of cell surface AII with tenascin-C is of particular interest due to its increased expression in the asthmatic airway (32). Our data suggest that cell surface AII stimulates airway epithelial repair through tenascin-C binding.  164  4.2 Materials and Methods 4.2.1 Cell Culture Normal human airway epithelial cells (1HAEo-) were a gift from Dr. D. Gruenert, University of Burlington, VT (33). 1HAEo- cells are SV40-transformed normal human airway epithelial cells that have been characterized previously (34, 35) and express multiple surface carbohydrate markers of primary basal airway epithelial cells (36). They were grown in culture for lectin histochemistry, wound repair kinetics and protein extraction as previously described (36). 4.2.2 Gene silencing 1HAEo- cells were seeded at a density of 1.0 x 105 – 1.2 x 105 cells/ml in 24 well or 12 well dishes. Following 24 h they were transfected with the indicated siRNA oligos. Annexin II siRNA oligos (Dharmacon, Lafayette, CO, sequence custom designed to target nucleotides 94-113 of the AII mRNA. The siRNA target sequences: UGAUCACUCUACACCCCCA) and p11 siRNA oligos (Qiagen, Mississauga, ON, HP Validated  cat  #  SI03246670  Hs_S100A10_6.  Oligo  sequence:  CACCATTGCATGCAATGACTA) were selected based on company validation (p11 siRNA oligos from Qiagen) or previous successful gene silencing (Custom AII siRNA from Dharmacon (37)) Transfection of 1HAEo- was optimized using a FITC conjugated non-specific oligo (Qiagen). A transfection efficiency of >80% was achieved (Fig 5.1). Cells were transfected for 48 h using the HiPerfect lipid mediated delivery (Qiagen), following transfection cells were washed with PBS to remove any un-transfected oligos 165  and lipid vesicles and the cells were incubated in fresh media for 24 h to allow the cells to recover following transfection. Once the cells reached confluence, they were subjected to the indicated treatment or external stimulus. 4.2.3 Western Blot Analysis of Protein Expression and Phosphorylation Following gene silencing, protein extracts were run on standard SDS-PAGE and Western blot to detect the level of protein expression and phosphorylation. Immunoblots were probed for AII, p11 (BD Pharmingen, Mississauga, ON) and β-actin (SigmaAldrich, Oakville, ON), to normalize for variations in protein loading. 4.2.4 Wound Repair Assay Following Gene Silencing Wound closure assays were followed as we have performed before(10, 24). Cells were transfected with the indicated gene specific or scramble siRNA oligos. Gene knockdown effectiveness was validated at the protein level by Western blot. At the indicated time-points, collected protein lysates were analyzed for AII or p11 expression by standard immunoblot techniques as described above. Following exposure of the membranes to the ECL reagents, images were capture using the ChemiGenius (Syngene, Frederick, MD) system and the GeneSnap (Syngene) software. Protein expression results are quantified by densitometry. To account for differences in protein loading, densitometry values are normalized to β-actin expression. Once successful gene silencing was observed throughout the time-course of the experiment wound closure was followed as before. This assay was carried out as has been described previously (38-40). Wells were treated with the indicated siRNA oligos or scramble controls. Cells were grown to confluence and circular wounds (~1.0-2.0 mm2) 166  were created using a small rubber stylet (4 wounds per well). After wounding, cells were washed with medium without FBS and grown in 10% FBS containing media and were imaged at t = 0, 6, 12, 18 and 24 h using a Nikon Eclipse TE200 inverted scope equipped with a Nikon Coolpix E995. Wound area was calculated by manual tracing and area calculation software (ImagePro Plus 32, Media Cybernetics Inc., Silver Spring, MD). 4.2.5 Immunofluorescence and Confocal Microscopy Immunocytochemistry was preformed for several different protein epitopes. These included AII (mouse anti-AII, BD Pharmingen), p11 (mouse anti-AII light chain, BD Pharmingen), tenascin-C (mouse monoclonal anti-tenascin-C antibody (Mouse IgG1) clone BC-24, Sigma-Aldrich) and F-actin (Alexa Fluor® 488 phalloidin, Invitrogen, Burlington, ON). The staining protocol for each epitope was very similar and is outlined below. Cells were grown in collagen coated (Sigma-Aldrich) chamber slides. In preparation for immunofluoresence and confocal microscopy 1HAEo- cells were fixed in 4% paraformaldehyde (PFA) for 20 minutes at room temperature. For intracellular staining, the cells were permeabilized with 0.1% TritonX-100 (TX100) in TBS + 1% BSA for 10 minutes. Non-specific sites were blocked with TBS + 1% BSA + 0.1 % TX100 for 1 h at room temperature. Chambers were incubated with the indicated primary antibodies in TBS + 1% BSA + 0.1 % TX100 overnight at 4oC. Antibodies to human AII, p11, tenascin-C were used. For F-actin staining, cells were incubated in alexa-488 conjugated phalloidin for 20 min at room temperature. Following three washes with TBS, chambers were incubated with the corresponding alexa conjugated secondary antibodies 167  (Alexa Fluor® 594 goat anti–mouse IgG antibody, Invitrogen) in TBS + 1% BSA + 0.1 % TX100 for 1 h at room temperature. Any unbound antibody was washed with TBS and the nuclei were stained with Hoechst 33342 (Invitrogen) in preparation for confocal image analysis. Images were obtained using a Leica AOBS™ SP2 confocal microscope. Z-plane reconstructions were generated using Volocity™ (Improvisions, Boston, MA). Sample handling and processing were carried out simultaneously to maintain experimental conditions for all samples. During image acquisition, image capture settings were preserved throughout each session. 4.2.6 Tenascin-C Stimulation of Airway Epithelial Wound Closure Confluent monolayers of 1HAEo- cells were serum starved for 24 h prior to mechanical wounding. Small circular wounds were created as before. Repairing monolayers were incubated with purified human tenascin-C in PBS solution (Millipore, Nepean, ON) diluted in serum free DMEM at 10 μg/ml concentration. Control wells were incubated with the equivalent volume of PBS diluted in serum free DMEM. Coincubation of tenascin-C with AII antibody (BD Pharmingen) was done simultaneously at an antibody concentration of 1.0 μg/ml. Wounds were imaged at t = 0, 12 and 24 h after wounding using a Nikon Eclipse TE200 inverted scope equipped with a Nikon Coolpix E995. Wound area was calculated by manual tracing and area calculation software (ImagePro Plus 32). 4.2.7 Tenascin-C Exposure to Wounded Monolayers Following Gene Silencing Gene silencing of AII and p11 were carried out as described above. At a concentration of 30 nM, siRNA oligos were transfected into 1HAEo- cells and the cells were grown to 168  confluence. All steps were carried out in media with 10% FBS. We were unable to grow siRNA transfected 1HAEo- cells under serum free conditions. Wells were treated with the indicated siRNA oligos or scramble controls. Cells were grown to confluence and circular wounds (~1.0-2.0 mm2) were created as before. After wounding, cells were washed with medium without FBS and grown in 10% FBS containing media +/- tenascinC and imaged as before. 4.2.8 Statistics Values are presented as means ± SE. The significance of differences between means was assessed by analysis of variance; when significant differences were found a Student’s T test was used to compare the means, with the level of significance set at p < 0.05.  169  4.3 Results 4.3.1 Gene Silencing Optimization and Wound Closure Assays We have previously shown that annexin II participates in airway epithelial wound repair through an association with a Chick pea agglutinin specific carbohydrate ligand (10). We have shown that in our in vitro model of the airway epithelium, we can successfully transfect siRNA oligos into 1HAEo- cells with high efficiency (Figure 4.1). Using nonspecific Alexa-488 tagged siRNA oligos for transfection optimization, we can visualize successful transfections by fluorescent microscopy. Gene silencing efficiency was evaluated by Western blot. Using siRNA oligos specifically targeted to AII, we have successfully knocked down AII protein expression determined by Western blot (Figure 4.2). Our results show AII expression was reduced to 20% of control. This reduction persists throughout the timeframe of our wound repair model (Day 4 post siRNA transfection). In our in vitro model of airway epithelial wound repair, silencing the AII protein expression results in impaired wound closure (Figure 4.3). In the absence of any siRNA oligos or transfection reagent HiPerfect™, wound area remaining at 24 h was 23.8 +/3.4%. Increasing concentration of AII siRNA oligos resulted in a dose-dependant inhibition of wound closure. Transfection of 10 nM and 100 nM AII siRNA resulted in significant inhibition of wound closure at 24 h, wound area remaining was 56.3 +/- 2.9 % and 68.4 +/- 4.8% respectively relative to the media alone and scramble siRNA controls. The scrambled siRNA control at a concentration range from 1 nM – 100 nM inhibits  170  wound closure; however, inhibition was significantly less than inhibition transfection of 10 nM and 100 nM AII specific siRNA oligo. We have shown similar wound closure results with gene silencing of the annexin II light chain, p11. We can successfully knock down p11 expression (Figure 4.4A). Using siRNA oligos targeted to the p11 mRNA, p11 protein expression can be reduced to less than 20% of the untreated controls. Much like we demonstrated with AII, in the presence of p11 siRNA wound closure rates of 1HAEo- cells is significantly reduced relative to media, HiPerfect™ and non-specific siRNA controls (Figure 4.4B). Here we show protein lysates collected from the corresponding samples following the wound repair assay. Protein levels of p11 shown in the Western blot represent protein expression following 24 h of repair and not protein expression at the time of mechanical wounding.  171  Figure 4.1 -Gene silencing (siRNA) optimization of 1HAEo- cells. 1HAEocells were transfected using HiPerfect transfection reagent at a concentration of 100 nM siRNA oligos tagged with Alexa Fluor™ 488 and (A) imaged by fluorescence microscopy and (B) phase-contrast microscopy. (C) 1HAEocells were transfected using HiPerfect transfection reagent alone and imaged by fluorescence microscopy and (D) phase-contrast microscopy.  172  A.  B.  Figure 4.2 - Following gene silencing, AII protein expression is significantly decreased. 1HAEo- cells were seeded at 1.1x105 cells/ml and transfected with 100 nM AII specific siRNA. (A) By Western blot, it is clear that the expression of AII is dramatically reduced. (B) Densitometry results confirm that AII expression is reduced to approx 20% of control. This reduction is preserved throughout the typical wound closure experiment time frame. Densitometry was normalized to b-actin.  173  Figure 4.3 -Wound closure of 1HAEo- cells following AII siRNA at 24 h. Cells were grown to confluence and small circular wounds were created. Following wounding, the control sample was incubated in media, HiPerfect alone, increasing doses of AII siRNA and a non-specific scrambled siRNA. The effect on wound repair was followed using time-lapse videomicroscopy. AII gene silencing (10.0 nM and100.0 nM) results in a significant inhibition of wound closure. N = 4 for all treatment groups. * p<0.05 relative to media and scramble siRNA controls.  174  Figure 4.4 -Silencing of p11 and wound closure rates following siRNA knockdown in 1HAEo- cells A. p11 protein expression is successfully knocked down by siRNA. Increasing doses of p11 siRNA (0.1nM – 100nM) successfully knockdown p11 protein expression following 48 h transfection, 24 h recovery in media alone and 24 h of wound repair. A non-specific (NS) scramble siRNA was used as a control for siRNA. B. Wound closure is inhibited following p11 siRNA at 24 h. Cells were grown to confluence and small circular wounds were created. Following wounding, the control sample was incubated in media, hyperfect alone, increasing doses of p11 siRNA and a non-specific scrambled siRNA (NS). The effect on wound repair was followed using time-lapse videomicroscopy. P11 gene silencing (100.0nM) results in a significant inhibition of wound closure. N = 4 for all treatment groups. * p<0.05 relative to media and scramble siRNA controls. 175  4.3.2 Tenascin-C Confocal Microscopy Tenascin-C, a known ligand for cell surface AII, was investigated by confocal microscopy in our cell culture system (Figure 4.5). Monolayers of 1HAEo- cells were wounded and stained for tenascin-C (Red). Several cells proximal and distal to the wound stain positive for tenascin-C (Figure 4.5A). Furthermore, the Z-plane 3-D reconstructions (above ZX, left ZY) demonstrate that 1HAEo- cells produce an underlying matrix that contains tenascin-C.  176  Figure 4.5 –Tenascin-C staining of mechanically wounded 1HAEo- cells. 1HAEo- cells proximal to the wound stained for Tenascin-C (Red) nuclei were counterstained with Hoechst (Blue). A. Tenascin-C expression shown both within 1HAEo- cells. ZX (above) and ZY (left) images show the deposition of tenascin-C within these cultures. B. Isotype control staining confirms Ten-C staining.  177  4.3.3 Effect of Tenascin-C on Airway Epithelial Cell Wound Closure Rates The effect of exogenous tenascin-C on wound repair was observed using a similar wound closure assay as previous. Unlike previous wound closure assay, prior to mechanical wounding cells were serum starved for 24 h. Following serum starvation for 24 h, the addition of tenascin-C to culture media stimulated wound closure (Figure 4.6). TenascinC at 10 μg/ml significantly stimulate wound closure (p ≤ 0.05 relative to untreated controls). This stimulation is inhibited by the addition of an anti-AII antibody. Following 24 h of repair, wounds in serum free conditions closed such that 58.6 ± 1.3 % of the initial wound area remaining. In the presence of 10 μg/ml tenascin-C closed such that 48.7% ± 4.9 % of the initial wound areas remained. Wounds incubated with 1.0 μg/ml AII antibody and either 10 μg/ml tenascin-C closed such that 57.3 ± 1.9% wound area remaining, comparable to untreated control wounds. The AII antibody alone had no effect on wound closure in the absence of tenascin-C (58.2% ± 1.7 % wound area remaining). Furthermore, the addition of a non-specific isotype control antibody did not inhibit the tenascin-C stimulation of wound closure (47.0% ± 4.7 % wound area remaining). Tenascin-C stimulation of the wounded cell culture model was performed following AII or p11 gene silencing. These experiments were performed using 10% FBS growth conditions as has been previously described for siRNA experiments. Following AII or p11 siRNA transfection, the addition of tenascin-C to the culture media had no effect on wound closure rates (Figure 4.7). Using 10% FBS, control wounds closed such that 22.5 ± 3.5% of the initial wound area remained following 24 h of repair. In the presence of 30 nM AII or p11 siRNA, wounds closed such that 57.6 ± 7.4% and 66.7 ± 178  8.6% of the initial wound areas remained respectively. The addition of 10 μg/ml of tenascin-C did not stimulate wound closure following AII or p11 gene silencing. Wounds in the presence of tenascin-C and AII or p11 siRNA wounds closed such that 70.9 ± 9.4% and 84.4 ± 5.5% of the initial wound areas remained respectively. In the absence of siRNA exposre, tenascin-C alone did not stimulate further the wound closure rate in the presence of serum containing media.  179  Figure 4.6 -Wound closure of 1HAEo- cells following Tenascin-C (TN-C) stimulation at 24 h. Cells were grown to confluence and small circular wounds were created. Following wounding, the control sample was incubated in serum free (SF) media alone, Tenascin-C, Tenascin-C and AII antibody (ab), SF media and AII antibody alone and Tenascin-C and a non-specific isotypy control antibody (NS ab). The effect on wound repair was followed using time-lapse videomicroscopy. N = 4 for all treatment groups. * p<0.05 relative to SF media control.  180  Figure 4.7 - Exogenous tenascin-C (TN-C) does not stimulate wound closure rates following AII or p11 siRNA. 1HAEo- were treated with the indicated siRNA oligos and grown to confluence. Following mechanical injury, wounded monolayers were incubated in media with 10% serum +/soluble TN-C and the indicated siRNA oligos. Wound closure rates were followed by time-lapse videomicroscopy. There was no stimulation of wound closure with TN-C relative to the associated siRNA treated samples. N = 4 for all treatment groups.  181  4.4 Discussion The airway epithelium provides a physical barrier protecting the underlying tissue from the external environment. Exposure of the epithelium to a variety of challenges such as viruses, allergens and pollutants can result in damage. Epithelial injury in healthy individuals is rapidly and effectively repaired, maintaining the integrity of the protective barrier. However, in diseases such as asthma characterized by persistent damage to the airway epithelium, there may be a defect in the mechanisms of epithelial repair. Despite several studies focusing on epithelial repair, the mechanism and mediators of this complex process remain poorly understood. We have previously shown in two separate studies the association of AII with functional carbohydrates ligands on the cell surface that mediate wound repair (10, 24). Using a model of airway epithelial injury and repair, our objective was to confirm the role of AII in airway epithelial wound repair in vitro and begin to characterize this process. Silencing of AII or p11 results in the inhibition of wound closure (Figures 4.3, 4.4B). Subsequent work revealed that tenascin-C stimulates epithelial wound closure (Figure 4.6). The tenascin-C stimulation of wound closure was disrupted following knockdown of AII or p11 (Figure 4.7). These data confirm that AII and the AIIt are important mediators of epithelial repair in vitro. Specifically our investigation has revealed the importance of AII on the surface of epithelial cells. Gene silencing approaches have successfully demonstrated that AII participates in the migration of glioma and intestinal epithelial cells (37, 41). Previously, we suggested that AII on the surface of the cells was relevant to repair (10). AII lacks a signal peptide and is not presented to the cell surface through the classical 182  golgi mediated pathway. Several reports have demonstrated that AII is presented on the cell surface, however the mechanism of translocation has not been characterized (2, 10, 12, 42). There are other proteins such as galectin-1 whose export mechanism similarly does not depend on the classical ER/Golgi apparatus–dependent secretory pathway (43, 44). Extracellular transport of galectin-1 requires the expression and interaction within the cell with counter-receptors prior to translocation (45). The extracellular localization and function of galectin-1 are dependant on its lectin function. The ability of AII to bind carbohydrates may play a similar role in protein localization and function on the cell surface. Future investigations should include indentifying potential counter-receptors for AII. Expression of p11 has previously identified as essential in the cell surface presentation of AII (46). Silencing p11 restricts AII expression to the cytoplasm and inhibits its membrane association. It is believed that the AII monomer is largely cytoplasmic. As a heterotetramer, with two molecules of AII bridged together by two molecules of p11, it has been reported that the AIIt is a membrane associated complex (16). Knockdown of one component would restrict the expressed protein to remain largely cytoplasmic. The disruption of AIIt prevents AII from binding the plasma membrane which includes the cell surface. Despite the presence of AII within the cell, silencing p11 had a significant effect on wound closure (Figure 4.4B). AIIt is essential for effective epithelial wound repair in our in vitro model. Interestingly we show that transfection of 10 nM p11 siRNA oligos resulted in relatively successful gene silencing, however it did not result in a corresponding inhibition of wound closure. Conversely, a concentration of 100 nM p11 siRNA resulted 183  in a significant inhibition in wound closure rates. These results suggest that a more rapid and perhaps more complete silencing of p11 is required to affect wound closure rates. A small pool of residual p11 expressed in cells may be sufficient to generate AIIt complexes that are translocated to the cell surface to mediate repair. Secondly, there is virtually no difference between the 10 nM and 100 nM siRNA concentrations with respect to p11 protein expression levels after 24 h of repair. Our samples were collected at the completion of the wound closure assay, so there may have been differences at the time of injury to account for differences in wound closure rates. To identify the role of the cell surface component of total cellular AII in mediating epithelial repair we investigated its potential role as a cell surface receptor. Several reports have described AII as a cell surface receptor for tenascin-C along with some of the subsequent changes observed following tenascin-C/AII binding (2, 7). The interaction of tenascin-C with cell surface AII results in changes in cell phenotype including increased mitogenesis, cell migration and a loss of focal adhesions (7). The expression of tenascin-C is restricted in adult tissues and induced in healing epidermal wounds (47). By immunocytochemistry, we show that tenascin-C is expressed by 1HAEo- cells in our model of repair (Figure 4.5). The addition of soluble tenascin-C to mechanically injured 1HAEo- monolayers stimulated wound closure relative to our unstimulated controls (Figure 4.6). The effect of tenascin-C on wound closure rates was disrupted by an anti-AII antibody and exposure to a non-specific isotype control antibody had no effect on wound closure (Figures 4.6). Tenascin-C alone did not stimulate wound closure rates of cells repairing in the presence of serum, which may indicate maximal wound closure rates under 10% serum conditions were achieved (Figure 4.7). AII and 184  p11 silencing inhibited wound closure rates relative to the control, exogenous tenascin-C did not stimulate wound closure following AII or p11 silencing (Figure 4.7). Together, these data presented suggest that tenascin-C stimulates wound closure via AII. In the absence of exogenous tenascin-C added to the cell cultures undergoing repair, the endogenous production of tenascin-C may act as an extracellular ligand for AII that is translocated and presented on the cell surface of airway epithelial cells following mechanical wounding (10). The presence of EGF-like domains within tenascin-C and their potential as an EGFR ligand identifies a potential role of tenascin-C binding AII and a resulting stimulation of the EGFR. EGFR has previously been shown to be essential receptor in the signalling involved in epithelial wound repair (29, 48). There are several reports that suggest AII plays a scaffolding role to facilitate protein interactions such as within lipid rafts (21, 49, 50). The activation of EGFR can be regulated by its presence in lipid raft microdomains (51). The role of AII may simply be to facilitate the interaction of the EGF-like domains of tenascin-C to bind EGFR. The focus of future investigations will be to determine if cell surface AII facilitates the activation of EGFR by tenascin-C. Techniques such as gene silencing of AII or p11 may be useful in supporting the conclusion that AII facilitates tenascin-C activation of EGFR. Downstream of EGFR, tenascin-C binding increases extracellularly regulated kinase (ERK) phosphorylation. EGFR signalling is complex due to the number of ligands, multiple EGFR family of receptors and the variety of dimer pairs and receptor downregulation (52). There are also several downstream pathways that can be regulated through EGFR activation including MAPK, PLCγ1 and PI3K (reviewed in Yarden, 185  2001(53)). Binding of the EGF-like domains of tenascin-C to the EGFR has previously been shown to promote cell surface retention of the receptor resulting in prolonged signalling as well as a pro-migratory signalling cascade downstream of EGFR (54). Furthermore, early reports into the functional domains of tenascin-C revealed that exposure of cells to EGF-like domains results in antiadhesive effects (55). One of the key steps in cell migration and repair is the disruption of cell-matrix connections to allow for cell movement (reviewed in Greenwood, 1998(56)). For example in the myocardium, tenascin-C expression is restricted to embryonic development and absent from normal myocardium. Following myocardial injury tenascin-C is re-expressed and may regulate cellular behaviour during tissue remodelling by modulating the attachment of cardiomyocytes to connective tissue, by enhancing migration and differentiation of myofibroblasts, and by inducing matrix metallo-proteinases (57). The complexity of EGFR activation with the diversity of the ErbB family of receptors and diversity of extracellular ligands is the focus of several research groups. The altered signalling generated as a result of this complexity needs to be investigated further with respect to AII and tenascin-C activation. The amount of AII presented on the cell surface has been estimated to be between 2-5% of total AII. AII lacks both a transmembrane and enzymatic domain (16). Studies have shown that AII interacts with F-actin at focal adhesions (21, 58). Through RhoA, AII participates in actin cytoskeleton re-organization, a critical element of cell migration and wound repair (37). The re-organization of focal adhesions is regulated by kinases and phosphatases and plays an essential role in directional cell migration. During wound repair, AII may facilitate the interaction of the focal adhesion complex proteins and act as 186  either a recruiting protein or simply a scaffold for complex assembly. SHP-2 activation of focal adhesions has previously been shown to participate in cellular migration (59-63). Furthermore, the association of SHP-2 with lipid microdomains regulates the activation of focal adhesion kinase (64). Techniques such as siRNA do not discriminate between cell surface and intracellular protein. Therefore the role of intracellular AII should not be ignored. The interaction of AII with adhesion regulatory molecules, F-actin and localization to lipid microdomains provides some clues towards uncovering AII function inside the cell. Live cell imaging could be used to not only visualize these protein interactions but also allow the study of the distinct micro-environments within migrating cells (65). These data expand on our previous identification of AII as a protein associated with epithelial repair. AII has been implicated in several cellular functions such as the generation of plasmin (3, 13, 14, 42, 66-70) and endo- and exocytosis (16, 71-78). Recent reports have shown annexin plays a regulatory role of cellular migration in a variety of normal and abnormal or diseased cells types (7-9, 79). These data highlight the potential role of cell surface AII as an extracellular receptor for tenascin-C and the AII/tenascin-C interaction promotes wound repair. It is unknown how the binding of tenascin-C to AII would transfers a pro migratory signal to the intracellular milieu. AII has previously been shown to act as a scaffold protein or co-receptor on the surface of endothelial cells to facilitate the generation of plasmin (13). The presence of EGF-like ligands within the tenascin-C molecule and the importance of EGFR with respect to cell migration will guide future investigations towards determining the role of AII in tenascin-C activation of EGFR. 187  This work identifies a potentially novel role of cell surface AII. As has been well reported, the expression of tenascin-C in adult tissue is restricted to areas of injury and specifically cells undergoing repair (47, 80-83). During our laboratory’s initial investigation we demonstrated that mechanical injury to airway epithelial cell monolayers resulted in the presentation of AII on the cell surface at the wound edge (10). The extracellular localization of AII on cells at the wound margin would facilitate the interaction with the underlying tenascin-C expression as the cells spread and migrate. Previous reports have described tenascin-C as a “matricellular” protein that promotes disruption of cellular adhesion (84). Cellular de-adhesion is an important response to tissue injury, and involves the reversal of the adhesive process in which a cell moves from a state of stronger adherence to a state of weaker adherence (56). This includes the reorganization of actin stress fibres and disassembly of focal adhesion complexes. A previous report described the loss of focal adhesions and increased cell migration as a result of tenascin-C/AII interaction on the cell surface and the authors suggest that the signal is transmitted into the cell by an AII associated cell surface receptor (7). The data presented here may be the building blocks for a very elegant mechanism of epithelial repair and expands on the work of Chung et al. 1996(7) to identify a possible mechanism for the tenascin-C activation of cell migration. Future work should also focus both the activation of EGFR signalling cascades during epithelial repair and the EGFR family of receptors that are responsible for the tenascin-C binding and activation. The limitations of our model include the fact that the two pools of AII were treated independently. AII protein on the cell surface was initially cytoplasmic and likely played a functional role within the cell. Translocation to the cell surface may not only promote 188  AII activity as a cell surface receptor, it may also act to inhibit the intracellular role of AII within those cells. Furthermore, this work was carried out using a submerged monolayer culture system with a transformed cell line. Improved model systems such as air liquid interface cultures may be more representative to the airway however the experiments such as our wound closure rates are too difficult to reproduce and image in an ALI system. The 1HAEo- has been well characterized and shown to express a similar biomarkers of basal cells, one of the cell types of the airway that are responsible for airway epithelial repair. The use of transformed cell lines in submerged culture is ideal for initial characterization studies such as we have performed, however these findings should be confirmed in other systems such as primary cell culture and ALI. Ultimately, all of this work will need to be studied in human tissue from both healthy and diseased tissue such that potential abnormalities can be identified. The original identification of AII and the subsequent work presented here gives us some insight into the complex mechanism of airway epithelial wound repair and provides a strong base to pursue the study of the AII and tenascin-C contribution to this complex process. Once a more complete mechanism of epithelial repair is generated, differences or deficiencies in the asthmatic airway relative to healthy individuals could be identified and allow research and development into new avenues for potential treatments.  189  References  1.  Kicic, A., E. N. Sutanto, P. T. Stevens, D. A. Knight, and S. M. Stick. 2006.  Intrinsic biochemical and functional differences in bronchial epithelial cells of children with asthma. Am J Respir Crit Care Med 174(10):1110-8. 2.  Chung, C. Y., and H. P. Erickson. 1994. Cell surface annexin II is a high affinity  receptor for the alternatively spliced segment of tenascin-C. J Cell Biol 126(2):539-48. 3.  Hajjar, K. A., A. T. Jacovina, and J. Chacko. 1994. An endothelial cell receptor  for plasminogen/tissue plasminogen activator. I. Identity with annexin II. J Biol Chem 269(33):21191-7. 4.  Ma, A. S., D. J. Bell, A. A. Mittal, and H. H. Harrison. 1994.  Immunocytochemical detection of extracellular annexin II in cultured human skin keratinocytes and isolation of annexin II isoforms enriched in the extracellular pool. J Cell Sci 107 ( Pt 7):1973-84. 5.  Siever, D. A., and H. P. Erickson. 1997. Extracellular annexin II. Int J Biochem  Cell Biol 29(11):1219-23. 6.  Matsuda, A., Y. Tagawa, K. Yamamoto, H. Matsuda, and M. Kusakabe. 1999.  Identification and immunohistochemical localization of annexin II in rat cornea. Curr Eye Res 19(4):368-75.  190  7.  Chung, C. Y., J. E. Murphy-Ullrich, and H. P. Erickson. 1996. Mitogenesis, cell  migration, and loss of focal adhesions induced by tenascin-C interacting with its cell surface receptor, annexin II. Mol Biol Cell 7(6):883-92. 8.  Balch, C., and J. R. Dedman. 1997. Annexins II and V inhibit cell migration. Exp  Cell Res 237(2):259-63. 9.  Liu, J. W., J. J. Shen, A. Tanzillo-Swarts, B. Bhatia, C. M. Maldonado, M. D.  Person, S. S. Lau, and D. G. Tang. 2003. Annexin II expression is reduced or lost in prostate cancer cells and its re-expression inhibits prostate cancer cell migration. Oncogene 22(10):1475-85. 10.  Patchell, B. J., K. R. Wojcik, T. L. Yang, S. R. White, and D. R. Dorscheid. 2007.  Glycosylation and annexin II cell surface translocation mediate airway epithelial wound repair. Am J Physiol Lung Cell Mol Physiol 293(2):L354-63. 11.  Kang, H. M., K. S. Choi, G. Kassam, S. L. Fitzpatrick, M. Kwon, and D. M.  Waisman. 1999. Role of annexin II tetramer in plasminogen activation. Trends Cardiovasc Med 9(3-4):92-102. 12.  Kassam, G., B. H. Le, K. S. Choi, H. M. Kang, S. L. Fitzpatrick, P. Louie, and D.  M. Waisman. 1998. The p11 subunit of the annexin II tetramer plays a key role in the stimulation of t-PA-dependent plasminogen activation. Biochemistry 37(48):16958-66. 13.  Kim, J., and K. A. Hajjar. 2002. Annexin II: a plasminogen-plasminogen activator  co-receptor. Front Biosci 7:d341-8. 14.  Zhang, X., H. Zhou, G. Shen, Z. Liu, Y. Hu, W. Wei, and S. Song. 2002. Study  on the mechanism of the annexin II-mediated co-assembly of t-PA and plasminogen. J Huazhong Univ Sci Technolog Med Sci 22(1):21-3, 76. 191  15.  Kamio, N., H. Hashizume, S. Nakao, K. Matsushima, and H. Sugiya. 2008.  Plasmin is involved in inflammation via protease-activated receptor-1 activation in human dental pulp. Biochem Pharmacol 75(10):1974-80. 16.  Waisman, D. M. 1995. Annexin II tetramer: structure and function. Mol Cell  Biochem 149-150:301-22. 17.  Gerke, V., and K. Weber. 1984. Identity of p36K phosphorylated upon Rous  sarcoma virus transformation with a protein purified from brush borders; calciumdependent binding to non-erythroid spectrin and F-actin. Embo J 3(1):227-33. 18.  Glenney, J. R., Jr. 1987. Calpactins: calcium-regulated membrane-skeletal  proteins. Bioessays 7(4):173-5. 19.  Harder, T., R. Kellner, R. G. Parton, and J. Gruenberg. 1997. Specific release of  membrane-bound annexin II and cortical cytoskeletal elements by sequestration of membrane cholesterol. Mol Biol Cell 8(3):533-45. 20.  Hayes, M. J., C. J. Merrifield, D. Shao, J. Ayala-Sanmartin, C. D. Schorey, T. P.  Levine, J. Proust, J. Curran, M. Bailly, and S. E. Moss. 2004. Annexin 2 binding to phosphatidylinositol 4,5-bisphosphate on endocytic vesicles is regulated by the stress response pathway. J Biol Chem 279(14):14157-64. 21.  Oliferenko, S., K. Paiha, T. Harder, V. Gerke, C. Schwarzler, H. Schwarz, H.  Beug, U. Gunthert, and L. A. Huber. 1999. Analysis of CD44-containing lipid rafts: Recruitment of annexin II and stabilization by the actin cytoskeleton. J Cell Biol 146(4):843-54.  192  22.  Rescher, U., D. Ruhe, C. Ludwig, N. Zobiack, and V. Gerke. 2004. Annexin 2 is a  phosphatidylinositol (4,5)-bisphosphate binding protein recruited to actin assembly sites at cellular membranes. J Cell Sci 117(Pt 16):3473-80. 23.  Hayes, M. J., U. Rescher, V. Gerke, and S. E. Moss. 2004. Annexin-actin  interactions. Traffic 5(8):571-6. 24.  Patchell, B. J., and D. R. Dorscheid. 2006. Repair of the injury to respiratory  epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins. Clin Exp Allergy 36(5):585-93. 25.  Kundranda, M. N., S. Ray, M. Saria, D. Friedman, L. M. Matrisian, P. Lukyanov,  and J. Ochieng. 2004. Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A. Biochim Biophys Acta 1693(2):111-23. 26.  Mackie, E. J. 1997. Molecules in focus: tenascin-C. Int J Biochem Cell Biol  29(10):1133-7. 27.  Swindle, C. S., K. T. Tran, T. D. Johnson, P. Banerjee, A. M. Mayes, L. Griffith,  and A. Wells. 2001. Epidermal growth factor (EGF)-like repeats of human tenascin-C as ligands for EGF receptor. J Cell Biol 154(2):459-68. 28.  Davies, D. E., R. Polosa, S. M. Puddicombe, A. Richter, and S. T. Holgate. 1999.  The epidermal growth factor receptor and its ligand family: their potential role in repair and remodelling in asthma. Allergy 54(8):771-83. 29.  Puddicombe, S. M., R. Polosa, A. Richter, M. T. Krishna, P. H. Howarth, S. T.  Holgate, and D. E. Davies. 2000. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. Faseb J 14(10):1362-74.  193  30.  Midwood, K. S., L. V. Valenick, H. C. Hsia, and J. E. Schwarzbauer. 2004.  Coregulation of fibronectin signaling and matrix contraction by tenascin-C and syndecan4. Mol Biol Cell 15(12):5670-7. 31.  Orend, G., W. Huang, M. A. Olayioye, N. E. Hynes, and R. Chiquet-Ehrismann.  2003. Tenascin-C blocks cell-cycle progression of anchorage-dependent fibroblasts on fibronectin through inhibition of syndecan-4. Oncogene 22(25):3917-26. 32.  Laitinen, A., A. Altraja, M. Kampe, M. Linden, I. Virtanen, and L. A. Laitinen.  1997. Tenascin is increased in airway basement membrane of asthmatics and decreased by an inhaled steroid. Am J Respir Crit Care Med 156(3 Pt 1):951-8. 33.  Cozens, A. L., M. J. Yezzi, K. Kunzelmann, T. Ohrui, L. Chin, K. Eng, W. E.  Finkbeiner, J. H. Widdicombe, and D. C. Gruenert. 1994. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 10(1):38-47. 34.  Gruenert, D. C., W. E. Finkbeiner, and J. H. Widdicombe. 1995. Culture and  transformation of human airway epithelial cells. Am J Physiol 268(3 Pt 1):L347-60. 35.  Cozens, A. L., M. J. Yezzi, M. Yamaya, D. Steiger, J. A. Wagner, S. S. Garber, L.  Chin, E. M. Simon, G. R. Cutting, P. Gardner, and et al. 1992. A transformed human epithelial cell line that retains tight junctions post crisis. In Vitro Cell Dev Biol 28A(1112):735-44. 36.  Dorscheid, D. R., A. E. Conforti, K. J. Hamann, K. F. Rabe, and S. R. White.  1999. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J 31(3):145-51.  194  37.  Babbin, B. A., C. A. Parkos, K. J. Mandell, L. M. Winfree, O. Laur, A. I. Ivanov,  and A. Nusrat. 2007. Annexin 2 Regulates Intestinal Epithelial Cell Spreading and Wound Closure through Rho-Related Signaling. Am J Pathol 170(3):951-66. 38.  Kim, J. S., K. F. Rabe, H. Magnussen, J. M. Green, and S. R. White. 1995.  Migration and proliferation of guinea pig and human airway epithelial cells in response to tachykinins. Am J Physiol 269(1 Pt 1):L119-26. 39.  Kim, J. S., V. S. McKinnis, and S. R. White. 1997. Migration of guinea pig  airway epithelial cells in response to bombesin analogues. Am J Respir Cell Mol Biol 16(3):259-66. 40.  Kim, J. S., V. S. McKinnis, A. Nawrocki, and S. R. White. 1998. Stimulation of  migration and wound repair of guinea-pig airway epithelial cells in response to epidermal growth factor. Am J Respir Cell Mol Biol 18(1):66-74. 41.  Tatenhorst, L., U. Rescher, V. Gerke, and W. Paulus. 2006. Knockdown of  annexin 2 decreases migration of human glioma cells in vitro. Neuropathol Appl Neurobiol 32(3):271-7. 42.  Peterson, E. A., M. R. Sutherland, M. E. Nesheim, and E. L. Pryzdial. 2003.  Thrombin induces endothelial cell-surface exposure of the plasminogen receptor annexin 2. J Cell Sci 116(Pt 12):2399-408. 43.  Hughes, R. C. 1999. Secretion of the galectin family of mammalian carbohydrate-  binding proteins. Biochim Biophys Acta 1473(1):172-85. 44.  Nickel, W. 2003. The mystery of nonclassical protein secretion. A current view  on cargo proteins and potential export routes. Eur J Biochem 270(10):2109-19.  195  45.  Seelenmeyer, C., S. Wegehingel, I. Tews, M. Kunzler, M. Aebi, and W. Nickel.  2005. Cell surface counter receptors are essential components of the unconventional export machinery of galectin-1. J Cell Biol 171(2):373-81. 46.  Deora, A. B., G. Kreitzer, A. T. Jacovina, and K. A. Hajjar. 2004. An annexin 2  phosphorylation switch mediates p11-dependent translocation of annexin 2 to the cell surface. J Biol Chem 279(42):43411-8. 47.  Mackie, E. J., W. Halfter, and D. Liverani. 1988. Induction of tenascin in healing  wounds. J Cell Biol 107(6 Pt 2):2757-67. 48.  Zhuang, S., Y. Dang, and R. G. Schnellmann. 2004. Requirement of the  epidermal growth factor receptor in renal epithelial cell proliferation and migration. Am J Physiol Renal Physiol 287(3):F365-72. 49.  Babiychuk, E. B., and A. Draeger. 2000. Annexins in cell membrane dynamics.  Ca(2+)-regulated association of lipid microdomains. J Cell Biol 150(5):1113-24. 50.  Roshy, S., B. F. Sloane, and K. Moin. 2003. Pericellular cathepsin B and  malignant progression. Cancer Metastasis Rev 22(2-3):271-86. 51.  Lambert, S., D. Vind-Kezunovic, S. Karvinen, and R. Gniadecki. 2006. Ligand-  independent activation of the EGFR by lipid raft disruption. J Invest Dermatol 126(5):954-62. 52.  Roepstorff, K., L. Grovdal, M. Grandal, M. Lerdrup, and B. van Deurs. 2008.  Endocytic downregulation of ErbB receptors: mechanisms and relevance in cancer. Histochem Cell Biol 129(5):563-78. 53.  Yarden, Y., and M. X. Sliwkowski. 2001. Untangling the ErbB signalling  network. Nat Rev Mol Cell Biol 2(2):127-37. 196  54.  Iyer, A. K., K. T. Tran, L. Griffith, and A. Wells. 2008. Cell surface restriction of  EGFR by a tenascin cytotactin-encoded EGF-like repeat is preferential for motilityrelated signaling. J Cell Physiol 214(2):504-12. 55.  Spring, J., K. Beck, and R. Chiquet-Ehrismann. 1989. Two contrary functions of  tenascin: dissection of the active sites by recombinant tenascin fragments. Cell 59(2):32534. 56.  Greenwood, J. A., and J. E. Murphy-Ullrich. 1998. Signaling of de-adhesion in  cellular regulation and motility. Microsc Res Tech 43(5):420-32. 57.  Imanaka-Yoshida, K., M. Hiroe, and T. Yoshida. 2004. Interaction between cell  and extracellular matrix in heart disease: multiple roles of tenascin-C in tissue remodeling. Histol Histopathol 19(2):517-25. 58.  Filipenko, N. R., and D. M. Waisman. 2001. The C terminus of annexin II  mediates binding to F-actin. J Biol Chem 276(7):5310-5. 59.  Schoenwaelder, S. M., L. A. Petch, D. Williamson, R. Shen, G. S. Feng, and K.  Burridge. 2000. The protein tyrosine phosphatase Shp-2 regulates RhoA activity. Curr Biol 10(23):1523-6. 60.  Inagaki, K., T. Noguchi, T. Matozaki, T. Horikawa, K. Fukunaga, M. Tsuda, M.  Ichihashi, and M. Kasuga. 2000. Roles for the protein tyrosine phosphatase SHP-2 in cytoskeletal organization, cell adhesion and cell migration revealed by overexpression of a dominant negative mutant. Oncogene 19(1):75-84. 61.  Qi, J. H., N. Ito, and L. Claesson-Welsh. 1999. Tyrosine phosphatase SHP-2 is  involved in regulation of platelet-derived growth factor-induced migration. J Biol Chem 274(20):14455-63. 197  62.  Manes, S., E. Mira, C. Gomez-Mouton, Z. J. Zhao, R. A. Lacalle, and A. C.  Martinez. 1999. Concerted activity of tyrosine phosphatase SHP-2 and focal adhesion kinase in regulation of cell motility. Mol Cell Biol 19(4):3125-35. 63.  Yu, D. H., C. K. Qu, O. Henegariu, X. Lu, and G. S. Feng. 1998. Protein-tyrosine  phosphatase Shp-2 regulates cell spreading, migration, and focal adhesion. J Biol Chem 273(33):21125-31. 64.  Lacalle, R. A., E. Mira, C. Gomez-Mouton, S. Jimenez-Baranda, A. C. Martinez,  and S. Manes. 2002. Specific SHP-2 partitioning in raft domains triggers integrinmediated signaling via Rho activation. J Cell Biol 157(2):277-89. 65.  Zaidel-Bar, R., C. Ballestrem, Z. Kam, and B. Geiger. 2003. Early molecular  events in the assembly of matrix adhesions at the leading edge of migrating cells. J Cell Sci 116(Pt 22):4605-13. 66.  Cesarman, G. M., C. A. Guevara, and K. A. Hajjar. 1994. An endothelial cell  receptor for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated enhancement of t-PA-dependent plasminogen activation. J Biol Chem 269(33):21198203. 67.  Diaz, V. M., M. Hurtado, T. M. Thomson, J. Reventos, and R. Paciucci. 2004.  Specific interaction of tissue-type plasminogen activator (t-PA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro. Gut 53(7):993-1000. 68.  Mai, J., D. M. Waisman, and B. F. Sloane. 2000. Cell surface complex of  cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta 1477(12):215-30. 198  69.  Hajjar, K. A., C. A. Guevara, E. Lev, K. Dowling, and J. Chacko. 1996.  Interaction of the fibrinolytic receptor, annexin II, with the endothelial cell surface. Essential role of endonexin repeat 2. J Biol Chem 271(35):21652-9. 70.  Ling, Q., A. T. Jacovina, A. Deora, M. Febbraio, R. Simantov, R. L. Silverstein,  B. Hempstead, W. H. Mark, and K. A. Hajjar. 2004. Annexin II regulates fibrin homeostasis and neoangiogenesis in vivo. J Clin Invest 113(1):38-48. 71.  Emans, N., J. P. Gorvel, C. Walter, V. Gerke, R. Kellner, G. Griffiths, and J.  Gruenberg. 1993. Annexin II is a major component of fusogenic endosomal vesicles. J Cell Biol 120(6):1357-69. 72.  Nakata, T., K. Sobue, and N. Hirokawa. 1990. Conformational change and  localization of calpactin I complex involved in exocytosis as revealed by quick-freeze, deep-etch electron microscopy and immunocytochemistry. J Cell Biol 110(1):13-25. 73.  Sarafian, T., L. A. Pradel, J. P. Henry, D. Aunis, and M. F. Bader. 1991. The  participation of annexin II (calpactin I) in calcium-evoked exocytosis requires protein kinase C. J Cell Biol 114(6):1135-47. 74.  Jacob, R., M. Heine, J. Eikemeyer, N. Frerker, K. P. Zimmer, U. Rescher, V.  Gerke, and H. Y. Naim. 2004. Annexin II is required for apical transport in polarized epithelial cells. J Biol Chem 279(5):3680-4. 75.  Ali, S. M., and R. D. Burgoyne. 1990. The stimulatory effect of calpactin  (annexin II) on calcium-dependent exocytosis in chromaffin cells: requirement for both the N-terminal and core domains of p36 and ATP. Cell Signal 2(3):265-76.  199  76.  Burgoyne, R. D., A. Morgan, and D. Roth. 1994. Characterization of proteins that  regulate calcium-dependent exocytosis in adrenal chromaffin cells. Ann N Y Acad Sci 710:333-46. 77.  Creutz, C. E. 1992. The annexins and exocytosis. Science 258(5084):924-31.  78.  Morgan, A., D. Roth, H. Martin, A. Aitken, and R. D. Burgoyne. 1993.  Identification of cytosolic protein regulators of exocytosis. Biochem Soc Trans 21(2):401-5. 79.  Hansen, M. D., J. S. Ehrlich, and W. J. Nelson. 2002. Molecular mechanism for  orienting membrane and actin dynamics to nascent cell-cell contacts in epithelial cells. J Biol Chem 277(47):45371-6. 80.  Betz, P., A. Nerlich, J. Tubel, R. Penning, and W. Eisenmenger. 1993.  Localization of tenascin in human skin wounds--an immunohistochemical study. Int J Legal Med 105(6):325-8. 81.  Latijnhouwers, M. A., M. Bergers, B. H. Van Bergen, K. I. Spruijt, M. P.  Andriessen, and J. Schalkwijk. 1996. Tenascin expression during wound healing in human skin. J Pathol 178(1):30-5. 82.  Ortiz-Rey, J. A., J. M. Suarez-Penaranda, E. A. Da Silva, J. I. Munoz, P. San  Miguel-Fraile,  A.  De  la  Fuente-Buceta,  and  L.  Concheiro-Carro.  2002.  Immunohistochemical detection of fibronectin and tenascin in incised human skin injuries. Forensic Sci Int 126(2):118-22. 83.  Trebaul, A., E. K. Chan, and K. S. Midwood. 2007. Regulation of fibroblast  migration by tenascin-C. Biochem Soc Trans 35(Pt 4):695-7.  200  84.  Murphy-Ullrich, J. E. 2001. The de-adhesive activity of matricellular proteins: is  intermediate cell adhesion an adaptive state? J Clin Invest 107(7):785-90.  201  Chapter 5 - Conclusions and future directions At the outset of the research outlined within this dissertation, the overall objective was to take a carbohydrate based approach to identify novel mediators of airway epithelial wound repair using the lectins CPA and AlloA. Protein glycosylation is a cotranslational or post-translational modification that has been implicated in a multitude of cellular processes including the immune response, intracellular targeting, intercellular recognition, and protein folding and stability (reviewed in Varki A., 1993 (1)). Previously, our laboratory has highlighted the potential role of cell surface Nglycosylation in epithelial wound repair (2). Preliminary work showed that the two lectins, CPA and AlloA, bind human airway epithelial cells in a dynamic fashion with respect to mechanical wounding in culture and may serve as effective biomarkers for epithelial repair. Interestingly both lectins were found to be associated functionally with airway epithelial wound repair and the protein Annexin II (AII). AII is an abundant protein that had not been previously associated with airway epithelial wound repair. Airway epithelial repair is an essential process that is responsible for the maintenance of the epithelial barrier and tissue integrity as a result of daily challenges. Disruption in the mechanisms of epithelial repair would result in the accumulation of damage to the epithelium and contribute to the generation of an airway phenotype seen in disease states such as asthma, where damage to the epithelium is a hallmark finding. An airway epithelium that is unable to repair from even usual insults will contribute to airways remodelling as a result of the chronic activation and production of inflammatory mediators, growth factors and matrix production (3). This highlights the importance of an 202  understanding of airway epithelial repair that will potentially lead to new therapies for diseases where damage to the epithelium contributes to disease pathology. Several groups have investigated the importance of glycosylation and more specifically, unique carbohydrate ligands with the use of lectins (2, 4). Very little work had been carried out to identify the proteins associated with those essential carbohydrate structures. Our initial study identified AII as a protein associated with the lectin CPA. Unfortunately with no specific structural information for the CPA carbohydrate ligand, the potential glycosylation of AII could not be investigated. As this initial work suggested AII was a cell surface receptor for extra-cellular ligands, our focus shifted to the characterization of AII protein expression. We demonstrated that glycosylation is essential in the cell surface presentation of AII and much like the increase in CPA staining, the presentation of AII increases following mechanical wounding of our monolayers. Our findings were the first to take the functional carbohydrate analysis one step further and identify an associated protein. Simultaneous experiments with AlloA resulted in the identification of the serum glycoprotein fetuin as a protein that bound airway epithelial cell surface to augment repair. Fetuin, a serum glycoprotein, was shown to be precipitated with the AlloA lectin from our cell culture lysates. Initially considered a non-specific protein interaction unrelated to AII, it was later revealed that AII on the surface of cells binds fetuin (5). The presence of serum proteins, such as fetuin, in the airway would only occur if injury to the epithelium was severe enough to result in microvascular leakage. Following instances of micro-injury and repair, serum proteins may not be available for AII binding. Further confirmation is required to show a direct link between fetuin mediated stimulation of 203  wound closure cell surface AII expression. We hypothesized that there is additional extracellular ligand(s) for cell surface AII utilized to stimulate repair of small epithelial wounds. The focus shifted to what is known about cell surface AII and its potential interactions with other extra-cellular ligands. Of interest was the finding that on the surface of cells, AII acts as a receptor for tenascin-C (6-8). Tenascin-C is abundantly expressed during embryogenesis and may orchestrate development by determining the fate of surrounding cells. Furthermore, its expression and its effects on cellular behaviour suggests that tenascin-C may affect cells and their ability to adhere to a substratum, to each other, or by providing a provisional matrix that is conducive for cellular migration, division, differentiation or apoptosis. During lung development, tenascin-C is expressed at branching sites and plays a essential role in the development of the bronchial tree (911). In adult tissue, tenascin-C expression is largely restricted to wound healing and tumorigenesis (12) and therefore may play an essential role in wound repair, a process that is similar to development. Not only did the tenascin-C/AII association provide a link to wound repair, it provided a potential link to disease-associated repair abnormalities. Sub-epithelial fibrosis or thickening of the basement membrane is a hallmark phenotypic change in the asthmatic airway. Changes in the composition of the extracellular matrix have been described and are associated with asthma. The composition of the extracellular matrix can participate in cell signalling to mediate a variety of cellular processes. The work of Laitinen et al. described tenascin-C expression as increased in the basement membrane of asthmatics. This highlights its potential for further studies of airway epithelial repair. In Chapter IV we confirm using siRNA that AII and p11 are essential for epithelial repair in 204  our model. We subsequently demonstrated that exogenous tenascin-C stimulated wound closure via AII. As has been well documented, a single cellular function for annexins has not been characterized. Our data focused on the cell surface component of AII and its potential role as a cooperative-receptor for tenascin-C. Others have demonstrated that AII plays a role in cellular functions as a receptor for t-PA and plasminogen (13-16). In this system, AII acts as a scaffold like protein increasing the local concentration of t-Pa and plasminogen and increases the likelihood of their interaction (16, 17). In a similar fashion, future experiments will be carried out to identify a potentially novel co-receptor function of AII facilitating the interaction to tenascin-C with EGFR. The presence of EGF-like domains within the tenascin-C molecule and their activation of EGFR will be explored using techniques following siRNA of AIIt proteins or the expression of AII mutants that are unable to bind tenascin-C. Receptor activation through co-receptor and ligand binding would allow a unique response to a specific activation signal. As has been demonstrated recently, tenascin-C activation and signalling through EGFR results in promigratory signal activation (18). Future experiments should be designed such that the potential role of cell surface AII in this EGFR activation is investigated. The expression of tenascin-C is tightly regulated, and this regulation in epithelial cells, specifically with respect to a damaged epithelium, remains unexplored. Further work could include tenascin-C gene promoter analysis to identify the transcription factors that initiate gene expression, as well as exploration of stimuli that lead to tenascin-C expression and transport. Many of these matrix molecules are presented as complexes on the cell surface including the required receptors, ligands, proteases, and scaffold proteins 205  to coordinate, initiate and regulate the required response. An example of such a complex is CD44 (19). The variant CD44v3 is important in epithelial repair and would serve as a model of investigation to determine the structure and function of AII associated cell surface complexes. Preliminary exploration into the downstream signalling of AII and tenascin-C binding in epithelial repair was limited to EGFR phosphorylation and the activation of ERK1/2. Previous reports highlight the difference between EGF and tenascin-C activation of EGFR. Tenascin-C resulted in retention of the receptor at the cell surface and a shift from a pro-proliferation towards a pro-migratory downstream signalling cascade (18). This includes an increase in phospholipase C γ and m-calpain, associated with lamellipod protrusion and tail retraction. Proliferation signalling activation, such as the activation of ERK/MAPK, p90RSK and Elk1, remained low. Future exploration should also include an in depth characterization of the activation of EGFR signalling following tenascin-C/AII binding. EGFR signalling is complex with several activating ligands and a variety of downstream signalling pathways. There are also several members of the EGFR family receptors, the ErbB receptor family. Studies are currently being carried out to evaluate different ErbB heterodimer pairs, their ligands and the resulting difference in downstream activation. The EGF-like domains of tenascin-C are ligands for EGFR however no work has been done to identify the ErbB dimer pair that binds tenascin-C. The fibrinolytic pathway, including plasmin, is essential in the healing of cutaneous wounds in partnership with matrix metalloproteases (MMP’s) (20). A similar mechanism may be present within the airway epithelium. The association of AII with 206  matrix-degrading proteases may provide a link between cell surface AII and inflammation, an essential step in wound repair. The well characterized role of AIIt as a co-receptor in the generation of plasmin on endothelial cells should also be considered in epithelial repair. Proteases such as plasmin may play an important role in epithelial injury where the underlying matrix is covered by a the protective protein cap from the underlying microcirculation (21). The protein cap needs to be broken down for effective restoration of tissue architecture (22). The role of cell surface AII in the fibrinolytic pathway was not investigated in this study. Much like the work done to show that fibrinogen deficiency restores epithelial repair in Plg(-/-) mice, similar work on a mouse model deficient in AII expression would reveal a potential link between cell surface AII and the generation of plasmin in airway epithelial repair. An AII deficient mouse has previously been used to study angeogenisis and endothelial cell migration (23). Future work should also include the analysis of cytoplasmic AII and its role in airway epithelial repair. Interestingly, most of the expressed AII remains within the cell and may participate in several important functions such as the regulation and organization of focal adhesions, cytoskeletal rearrangements, and cellular migration. Further study of the relationship between intra- and extra-cellular AII and the investigation of differences between the subset of cells that present AII on the cell surface relative to the cells that do not is also an essential topic of future work. The two pools of AII are not independent and eventually the dynamic nature of AII translocation regulation will need to be explored. Our data suggests that presentation of cell surface AII participates in epithelial repair. Preliminary investigations have also shown that disruption of the AIIt results in  207  phenotypic changes of the cells at the wound edge. Cell surface translocation may act to both promote the extracellular role of AII and to disrupt the intracellular function of AII. The identification of AII was based on its association with carbohydrate structures. We focused on the small portion of the total AII pool that, following injury, is translocated to the cell surface. We subsequently demonstrated that N-glycosylation is an important regulatory step in AII translocation. The role of glycosylation in this process also needs further investigation. This includes identifying the carbohydrate structure that CPA binds and the glycosyltransferases and glycosidases involved in its synthesis. Subsequent work should focus on how this glycosylation regulates AII translocation and function. Two possibilities include the direct modification of AII resulting in its targeting to the cell surface. Alternatively, glycosylation of a different protein ligand targeted for translocation to the cell surface may occur and AII binds this structure through its carbohydrate binding ability (24, 25). The galectin-1 model would be a starting point to identify potential glycosylated intracellular AII binding partners. Finally, once a well characterized model of AII and the AIIt with respect to the epithelium and wound repair is established, these findings will need to be applied to disease states such as asthma where a damaged epithelium is a hallmark finding. This will include the characterization of AII mediated airway epithelial wound repair in asthmatic cells. Our data supports the conclusion that AII is an essential mediator of repair. Once these proteins that regulate epithelial repair are well characterized and understood, deficiencies and/or abnormalities in disease can be identified.  208  References  1.  Varki, A. 1993. Biological roles of oligosaccharides: all of the theories are  correct. Glycobiology 3(2):97-130. 2.  Dorscheid, D. R., K. R. Wojcik, K. Yule, and S. R. White. 2001. Role of cell  surface glycosylation in mediating repair of human airway epithelial cell monolayers. Am J Physiol Lung Cell Mol Physiol 281(4):L982-92. 3.  Williams, S. A., and J. E. Schwarzbauer. 2009. A Shared Mechanism of Adhesion  Modulation for Tenascin-C and Fibulin-1. Mol Biol Cell 20(4):1141-1149. 4.  Adam, E., S. Holgate, C. Fildew, and P. Lackie. 2003. Role of carbohydrates in  repair of human respiratory epithelium using an in vitro model. Clin Exp Allergy 33(10):1398-1404. 5.  Kundranda, M. N., S. Ray, M. Saria, D. Friedman, L. M. Matrisian, P. Lukyanov,  and J. Ochieng. 2004. Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A. Biochim Biophys Acta 1693(2):111-23. 6.  Chung, C. Y., and H. P. Erickson. 1994. Cell surface annexin II is a high affinity  receptor for the alternatively spliced segment of tenascin-C. J Cell Biol 126(2):539-48. 7.  Chung, C. Y., J. E. Murphy-Ullrich, and H. P. Erickson. 1996. Mitogenesis, cell  migration, and loss of focal adhesions induced by tenascin-C interacting with its cell surface receptor, annexin II. Mol Biol Cell 7(6):883-92.  209  8.  Matsuda, A., Y. Tagawa, K. Yamamoto, H. Matsuda, and M. Kusakabe. 1999.  Identification and immunohistochemical localization of annexin II in rat cornea. Curr Eye Res 19(4):368-75. 9.  Roth-Kleiner, M., E. Hirsch, and J. C. Schittny. 2004. Fetal lungs of tenascin-C-  deficient mice grow well, but branch poorly in organ culture. Am J Respir Cell Mol Biol 30(3):360-6. 10.  Young, S. L., L. Y. Chang, and H. P. Erickson. 1994. Tenascin-C in rat lung:  distribution, ontogeny and role in branching morphogenesis. Dev Biol 161(2):615-25. 11.  Zhao, Y., and S. L. Young. 1995. Tenascin in rat lung development: in situ  localization and cellular sources. Am J Physiol 269(4 Pt 1):L482-91. 12.  Mackie, E. J. 1994. Tenascin in connective tissue development and pathogenesis.  Perspect Dev Neurobiol 2(1):125-32. 13.  Kim, J., and K. A. Hajjar. 2002. Annexin II: a plasminogen-plasminogen activator  co-receptor. Front Biosci 7:d341-8. 14.  Zhang, X., H. Zhou, G. Shen, Z. Liu, Y. Hu, W. Wei, and S. Song. 2002. Study  on the mechanism of the annexin II-mediated co-assembly of t-PA and plasminogen. J Huazhong Univ Sci Technolog Med Sci 22(1):21-3, 76. 15.  Hajjar, K. A., C. A. Guevara, E. Lev, K. Dowling, and J. Chacko. 1996.  Interaction of the fibrinolytic receptor, annexin II, with the endothelial cell surface. Essential role of endonexin repeat 2. J Biol Chem 271(35):21652-9. 16.  Kassam, G., B. H. Le, K. S. Choi, H. M. Kang, S. L. Fitzpatrick, P. Louie, and D.  M. Waisman. 1998. The p11 subunit of the annexin II tetramer plays a key role in the stimulation of t-PA-dependent plasminogen activation. Biochemistry 37(48):16958-66. 210  17.  Cesarman, G. M., C. A. Guevara, and K. A. Hajjar. 1994. An endothelial cell  receptor for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated enhancement of t-PA-dependent plasminogen activation. J Biol Chem 269(33):21198203. 18.  Iyer, A. K., K. T. Tran, L. Griffith, and A. Wells. 2008. Cell surface restriction of  EGFR by a tenascin cytotactin-encoded EGF-like repeat is preferential for motilityrelated signaling. J Cell Physiol 214(2):504-12. 19.  Yu, W. H., J. F. Woessner, Jr., J. D. McNeish, and I. Stamenkovic. 2002. CD44  anchors the assembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes Dev 16(3):307-23. 20.  Lund, L. R., J. Romer, T. H. Bugge, B. S. Nielsen, T. L. Frandsen, J. L. Degen, R.  W. Stephens, and K. Dano. 1999. Functional overlap between two classes of matrixdegrading proteases in wound healing. Embo J 18(17):4645-56. 21.  Perrio, M. J., D. Ewen, M. A. Trevethick, G. P. Salmon, and J. K. Shute. 2007.  Fibrin formation by wounded bronchial epithelial cell layers in vitro is essential for normal epithelial repair and independent of plasma proteins. Clin Exp Allergy 37(11):1688-700. 22.  Drew, A. F., H. Liu, J. M. Davidson, C. C. Daugherty, and J. L. Degen. 2001.  Wound-healing defects in mice lacking fibrinogen. Blood 97(12):3691-8. 23.  Ling, Q., A. T. Jacovina, A. Deora, M. Febbraio, R. Simantov, R. L. Silverstein,  B. Hempstead, W. H. Mark, and K. A. Hajjar. 2004. Annexin II regulates fibrin homeostasis and neoangiogenesis in vivo. J Clin Invest 113(1):38-48. 211  24.  Fitzpatrick, S. L., G. Kassam, A. Manro, C. E. Braat, P. Louie, and D. M.  Waisman. 2000. Fucoidan-dependent conformational changes in annexin II tetramer. Biochemistry 39(9):2140-8. 25.  Kassam, G., A. Manro, C. E. Braat, P. Louie, S. L. Fitzpatrick, and D. M.  Waisman. 1997. Characterization of the heparin binding properties of annexin II tetramer. J Biol Chem 272(24):15093-100.  212  Appendix – List of Publications 1. Patchell BJ, Wojcik KR, Yang TL, White SR, Dorscheid DR. “Glycosylation and Annexin II cell surface translocation mediate airway epithelial wound repair.”Am J Physiol Lung Cell Mol Physiol. 2007 Aug;293(2):L354-63. 2. Dorscheid DR, Patchell BJ, Estrada O, Marroquin B, Tse R, White SR. “Effects of corticosteroid-induced apoptosis on airway epithelial wound closure in vitro.” Am J Physiol Lung Cell Mol Physiol. 2006 Oct;29 (4):L794-801. 3. Allahverdian S, Patchell BJ, Dorscheid DR. “Carbohydrates and epithelial repair more than just post-translational modification.” Curr Drug Targets. 2006 May; (5):597606. Review. 4. Patchell BJ, Dorscheid DR. “Repair of the injury to respiratory epithelial cells characteristic of asthma is stimulated by Allomyrina dichotoma agglutinin specific serum glycoproteins.” Clin Exp Allergy. 2006 May;3 (5):585-93.  213  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067272/manifest

Comment

Related Items