Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The correlation of evolutionary rate and pathway position in plant terpenoid synthesis Ramsay, Heather 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_spring_ramsay_heather.pdf [ 618.87kB ]
Metadata
JSON: 24-1.0067230.json
JSON-LD: 24-1.0067230-ld.json
RDF/XML (Pretty): 24-1.0067230-rdf.xml
RDF/JSON: 24-1.0067230-rdf.json
Turtle: 24-1.0067230-turtle.txt
N-Triples: 24-1.0067230-rdf-ntriples.txt
Original Record: 24-1.0067230-source.json
Full Text
24-1.0067230-fulltext.txt
Citation
24-1.0067230.ris

Full Text

            THE CORRELATION OF EVOLUTIONARY RATE AND PATHWAY POSITION IN PLANT TERPENOID SYNTHESIS  by  Heather Ramsay  B.Sc., The University of British Columbia, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  Master of Science  in  THE FACULTY OF GRADUATE STUDIES  (Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  December 2008   © Heather Ramsay, 2008  ii Abstract Genes are expected to face stronger selective constraint and to evolve more slowly if they encode enzymes upstream as opposed to downstream in metabolic pathways, since upstream genes are more pleiotropic, being required for a wider range of end-products.  However, few clear examples of this trend in evolutionary rate variation exist.  We examined whether genes involved in plant terpenoid biosynthesis exhibit such a pattern, using data for 45 genes from four fully- sequenced angiosperms, Vitis, Arabidopsis, Populus and Ricinus.  Taking a bioinformatic approach, we used phylogenetic trees of proteins from each genome to determine orthologs and count paralogs in each genome, using proteins from the Oryza genome as an outgroup.  Our results show that dN/dS does in fact correlate with pathway position along pathways converting glucose to the terpenoid phytohormones abscissic acid, gibberellic acid and brassinosteroids. Upstream versus downstream rate variation is particularly strong in the gibberellic acid pathway, but absent in the pathway to lutein, another terpenoid derivative.  In contrast, we found no apparent variation of dN/dS with gene copy number.  We also introduce a new measure of pathway position, the Pathway Pleiotropy Index (PPI), which counts groups of enzymes between pathway branchpoints.  We found that this measure is superior to pathway position in explaining variation in dN/dS along each pathway.  Kendall's τ for the correlation of PPI with dN/dS was 0.24 - 0.54 with a mean of 0.4.  We further show that variation in dN/dS is due to differences in selective constraint, not positive selection.  Therefore, our results are consistent with the prediction that selective constraint is progressively relaxed along metabolic pathways, showing plant terpenoid synthesis to be a robust example of positional rate variation.  iii Table of contents Abstract...................................................................................................................................... ii Table of contents ....................................................................................................................... iii List of tables............................................................................................................................... v List of figures ............................................................................................................................ vi Acknowledgements .................................................................................................................. vii Co-authorship statement ............................................................................................................ ix CHAPTER 1: Introductory remarks on molecular evolution and network biology ....................... 1 Background on molecular evolution ....................................................................................... 1 Review of literature on network structure and evolutionary rate variation ............................... 5 Networks: definition and structure ...................................................................................... 5 Node connectivity and selective constraint.......................................................................... 6 Metabolic flux and selective pressure.................................................................................. 7 Effects of position in metabolic networks ........................................................................... 7 Proposal for further research................................................................................................. 10 Choice of study system..................................................................................................... 10 Improved methods for detecting positional rate variation .................................................. 11 Choice of taxa................................................................................................................... 11 Research objectives .......................................................................................................... 12 References............................................................................................................................ 13 CHAPTER 2: The correlation of evolutionary rate with pathway position in plant terpenoid biosynthesis.............................................................................................................................. 17 Introduction.......................................................................................................................... 17 Methods ............................................................................................................................... 19 Study species .................................................................................................................... 19 Finding orthologs and counting paralogs........................................................................... 20 Measuring evolutionary rates ............................................................................................ 20 Variability of dN/dS ......................................................................................................... 21 Relationship of dN/dS to pathway structure and gene copy number .................................. 21 Tests for selection............................................................................................................. 22 Results.................................................................................................................................. 22 Ortholog availability and rate variation among enzymes ................................................... 22 Variation of dN/dS with pathway position ........................................................................ 23 Variation of dN/dS with the Pathway Pleiotropy Index ..................................................... 23 Gene copy number............................................................................................................ 23 Selection analyses............................................................................................................. 23 Discussion ............................................................................................................................ 24 Gene evolution and metabolic pathways ........................................................................... 25 Pathway-specific patterns ................................................................................................. 26 Lineage-specific patterns .................................................................................................. 26 Gene copy number............................................................................................................ 27 Future directions............................................................................................................... 28 Acknowledgements .............................................................................................................. 29 References............................................................................................................................ 33 CHAPTER 3: Conclusions ........................................................................................................ 37 Summary and evaluation of Ramsay et al. ............................................................................ 37 Comparison of correlations among studies............................................................................ 38 Context and significance of Ramsay et al. ............................................................................ 39  iv Future directions................................................................................................................... 39 References............................................................................................................................ 42 Appendix 1.  Arabidopsis loci used as queries in ortholog determination.................................. 43 Appendix 2.  Orthologs used to estimate dN/dS........................................................................ 44 Appendix 2.1.  Arabidopsis orthologs ................................................................................... 44 Appendix 2.2.  Oryza orthologs ............................................................................................ 45 Appendix 2.3.  Populus orthologs......................................................................................... 46 Appendix 2.4.  Ricinus orthologs .......................................................................................... 47 Appendix 2.5.  Vitis orthologs .............................................................................................. 48 Appendix 3.  Graphs of dN/dS for Ricinus................................................................................ 50 Appendix 4.  Graphs of dN/dS for Arabidopsis......................................................................... 51 Appendix 5.  Graphs of dN/dS for Vitis .................................................................................... 52 Appendix 6.  Alignments used for estimating dN/dS................................................................. 53  v List of tables Table 2.1.  Kendall’s τ and p values for the correlation of dN/dS with pathway position. ……..30 Table 2.2.  Kendall’s τ and p values for the correlation of dN/dS with the Pathway Pleiotropy Index …………………………………………………………………………………………….30 Table 3.1.  Correlation values for measures of evolutionary rate with measures of connectivity, flux and gene expression. ……………………………………………………………………….41  vi List of figures Figure 2.1.  Plant terpenoid synthesis …………………………………………………………...31 Figure 2.2.  The phylogenetic relationships of the taxa …………………………………………31 Figure 2.3.  Graphs of dN/dS for Populus. ……………………………………………………...32   vii Acknowledgements  Science is as much a social process as an intellectual process.  I am very much indebted to my co-supervisors Kermit Ritland and Loren Rieseberg.  Thank you both for giving me free rein and ample time to develop my ideas.  Your feedback throughout this project has been of great value.  Thanks, Kermit, for your generous funding and for giving me the push I needed to finish. Thank you, Loren, for your calm encouragement and for the opportunity to join your lab.  I have benefited greatly from the excellent group of scientists you have gathered around you. Thanks also to Keith Adams, who served on my committee, and to Steven Hallam who supervised my directed studies.  The metagenomics project allowed me to gain skills and write scripts that served me well in my thesis research also. Many thanks to Mike Barker and Nolan Kane, members of the Rieseberg lab, who first suggested the idea of a pleiotropy index.  Mike Barker generously provided a number of perl scripts, as well as much advice on ortholog determination and other issues in bioinformatics. Nolan Kane took part in several key discussions and provided his unpublished work on positional rate variation.  That material provided much food for thought as I developed my plans for the research presented here.  I am also grateful to Matt King, a postdoc in the Rieseberg lab, for his encouragement and his help in exploring an alternative research plan during the early stages of this work.  Though that plan was abandoned, Matt's help allowed me to focus on the direction my research would ultimately take.  Thanks also to Katrina Dlugosch for her help in learning perl. Other members of the UBC evolutionary biology community also provided insightful comments at various stages of this work: Ligia Mateiu, Dilara Ally, Allen Liu, Itay Mayrose, Sally Otto, Brian Ellis, Sean Graham, Anne Dalziel, and Crispin Jordan, as well as Michael Nachman during a visit to UBC.  Not all of your ideas appear in this thesis, but they were nevertheless of great value in bringing my own ideas to maturity. Thanks to Vivienne Lam and Holly Rail who edited my thesis draft.  Any remaining errors are mine. Throughout my graduate studies, NSERC has funded my work through grants to me and Kermit.  I benefited greatly from the freedom to focus on my research, without need to work at the same time. Research, in my experience, is like descending into the earth to bring out some gem of knowledge.  The search for that gem can be dark, lonely and discouraging.  I have been tempted more than once to give up, and I owe many thanks to both Dilara Ally and Moira Scascitelli for their encouragement at key times.  This project may never have come to completion, had I not run into Dilara on the bus one fateful day.  viii Dedication  The world is charged with the grandeur of God. It will flame out, like shining from shook foil; It gathers to a greatness, like the ooze of oil Crushed.   -from "God's Grandeur" by Gerard Manley Hopkins  To the ones who taught me that beauty, science and faith all belong together.   ix Co-authorship statement Chapter 2 resulted from a collaboration among Kermit Ritland (research supervisor), Loren Rieseberg (research supervisor), and me.  Kermit first suggested looking at positional rate variation, and proposed the test for variability of dN/dS among genes.  Loren proposed the comparison of likelihoods to test for selection, and provided insightful comments on the role of gene duplication.  Both Loren and Kermit provided detailed comments on the manuscript.  I designed the experiment, collected and analyzed the data, and wrote the manuscript.  I also wrote several perl scripts used in processing the data, besides those provided by Mike Barker.   1 CHAPTER 1: Introductory remarks on molecular evolution and network biology  Within the diversity of living things, there is yet another diversity: comparisons of gene sequences among species reveal that while some genes are nearly identical, others differ wildly (Nei 1987).  Since all organisms share a common ancestor, we understand that interspecies variation in gene sequences represents mutations accumulated over time.  Yet why, over the same time span, do some genes accumulate more mutations than others?  In other words, why do genes evolve at different rates? The answer lies in the elusive link between phenotype and genotype, between the physical structure and functioning of the organism and the DNA sequence of genes and regulatory regions of the organism's genome.  In short, genes evolve at different rates (in part) because they have different effects on the overall phenotype in the course of natural selection.  When a mutation occurs in a gene, it is initially present in only one individual.  If the mutation is detrimental to the individual's survival and reproduction, it will not be passed on to future generations.  On the other hand, a mutation neutral or beneficial to the individual's reproductive fitness may actually be fixed.  That is, it may become part of the normal sequence of that gene in the population or species.  Thus, genes differ in their freedom to evolve; they differ in the selective pressure they face. While many early studies of evolutionary rate variation focused on a few unrelated genes, research over the last decade has shifted to examining groups of interacting genes.  No gene acts in isolation.  Rather, all participate in networks or pathways of gene interaction that brings about the overall phenotype (Proulx et al. 2005).  The structure of these networks often explains differences in evolutionary rates and selective pressures (Cork and Purugganan 2004).  The question of how network or pathway structure shapes gene evolution remains an active area of research, and Chapter 2 presents a recent advance in this field.  In order to introduce the research presented there, this chapter includes both an overview of how rates of gene evolution are measured and other general concepts in molecular evolution, as well as a literature review on the role of network structure in gene evolution.  Background on molecular evolution Addressing the question of how network structure shapes gene evolution requires a measurement of the rate of gene sequence evolution that reflects the selective pressure shaping  2 DNA sequence variation.  Measuring evolutionary rates begins with comparing gene sequences among related organisms.  Gene sequences can be aligned so that nucleotide bases stack on top of one another, suggesting their correspondence to the probable ancestral sequence.  Some columns may contain all the same nucleotide, while others may vary among the species represented, reflecting the substitution of one nucleotide for another in the course of evolution. Amino acid sequences can be similarly aligned, and used to guide nucleotide alignment.  This protein-guided DNA alignment is more realistic; it is unlikely nucleotides would be inserted or deleted in a protein coding region except in multiples of three.  Indels create a shift in the reading frame for translating nucleotide sequences to protein, causing a change in the entire protein sequence, rather than a single amino acid in the case of a substitution. Nucleotide and amino acid alignments are the basis on which evolutionary rates are estimated.  Within a nucleotide alignment, two types of differences among or between sequences can be observed: those that cause a change in the amino acid product and those that do not. These can be translated into measures of mutation rates: the nonsynonymous and synonymous substitution rates, respectively.  The nonsynonymous substitution rate is the number of nonsynonymous changes per nonsynonymous site (that is, the number of sites in which a synonymous change could occur whether it actually did or not).  The synonymous substitution rate is calculated likewise.  Common abbreviations for the nonsynonymous substitution rate are Ka or dN, while Ks and dS stand for the synonymous substitution rate.  The overall mutation rate can be estimated by dS (Li 1997).  Although synonymous substitutions can in fact affect organism function and therefore can be subject to selective constraint (Lynch 2007), this is not generally the case.  It is the nonsynonymous substitutions that face the test of natural selection, because they affect protein composition and therefore enzyme performance. While dN and dS can be useful alone, it is the ratio of these two that provides an indicator of the selective pressures shaping gene evolution.  The nonsynonymous substitution rate alone does not suffice, because genes could differ in dN simply because mutation rates vary across the genome (Lynch 2007).  The ratio of the nonsynonymous and synonymous substitution rates, however, provides an estimate of how readily amino acid changes are incorporated relative the underlying mutation rate.  The dN/dS ratio can therefore be used to describe how natural selection is acting on a gene. The dN/dS ratio (also denoted ω) is interpreted in terms of selective pressure as follows.  If dN/dS is close to zero, the gene is evidently under strong selective constraint; virtually no amino acid changes are tolerable to organism fitness, though synonymous changes may be retained.  A  3 dN/dS value of 1 suggests the gene is evolving neutrally: mutations are fixed by chance, not as a result of natural selection, and so nonsynonymous and synonymous substitutions are retained with equal frequency.  When the dN/dS value lies between 0 and 1, the gene is under some degree of selective constraint, closer to 0 being stronger constraint and closer to 1 being weaker constraint.  Such a gene is under purifying selection; most mutations are removed as detrimental, but a few remain because they are benign or beneficial.  A dN/dS ratio over 1 suggests that amino acid changes are actually beneficial and that the gene is under strong positive selection, because it is unlikely that more nonsynonymous than synonymous substitutions would be fixed by chance.  In this way, dN/dS can be interpreted in terms of selective pressure. Although dN/dS is a useful indicator of selective pressure, there is some oversimplification here.  It may be that only certain codons in a gene can be changed in a way that enhances fitness whereas all others cannot accept substitutions without a cost to fitness.  Also, the overall selective pressure on a gene is not necessarily constant through time: as various aspects of the organism's environment change, and indeed as the cellular environment changes through alterations to other genes, our gene of interest may actually face greater or weaker selective constraint than before.  A dN/dS ratio measured across a whole gene, then, is a summary statement across all codons (though codons do vary in their dN/dS) over the span of time involved in the evolutionary relationships of the sequences being compared. Problems of rate variation among codons and among lineages or periods in evolutionary history are particularly problematic in early methods of estimating dN/dS, which are based on pairwise comparisons across whole genes.  More recent methods (notably the PAML package; Yang 1997, Goldman and Yang 1998, Yang 1998) use multiple sequence alignments and allow the user to test for selection on specific codons and to measure evolutionary rates along specific branches of a phylogenetic tree representing species relationships.  In this way, rate variation among codons and lineages can be taken into account.  Nevertheless, these more sophisticated methods also use the dN/dS ratio as an indicator of selective pressure, whether on the whole gene or on the individual codon. The use of dN/dS as a gauge of selective pressure touches on two great debates in molecular evolution: the debate over Neutral Theory, and the debate over the importance of mutations in coding sequences (exons) versus those in the adjacent (cis) non-coding regulatory regions as the basis of phenotypic evolution.  Neutral Theory, championed by Motoo Kimura, holds that nucleotide substitutions do not become fixed because they confer improved fitness, but rather that they are fixed by chance because they are neutral with respect to fitness (Kimura 1983,  4 Kimura 1991).  Ample evidence of adaptive gene evolution has called Neutral Theory into question, but it remains the default null model for gene evolution (Hahn 2008).  The second debate flows out of the first: if coding sequences usually evolve neutrally, mutations important to the phenotype may come in the cis regulatory sequences rather than the coding sequences. Others argue that positive selection on coding sequences means phenotypic evolution is based more heavily on mutations in exons, and a great debate between these two sides rages on (e.g., Hoekstra and Coyne 2007).  The focus on coding sequences here is not intended to suppose a position within this debate.  Coding sequences are relevant to phenotype but may or may not be where key evolutionary changes occur. Before returning to the main topic of measuring and explaining variation in evolutionary rates and selective pressures, we must make one additional digression.  It would be wholly misleading to claim that variation in selective pressure on the gene in question is the only influence on a gene's evolution.  One other effect is linkage, the physical connection of a gene to other elements on the same chromosome.  Notably, linkage to another gene that is under strong positive or purifying selection can either force fixation of detrimental mutations at the gene in question, or hamper fixation of beneficial mutations.  The effects of linkage are noticeable only within a certain distance from a strongly selected site (Lynch 2007).  Also, the size and structure of the breeding population can influence gene evolution.  In large populations, the effects of selective pressure are more fully worked out, whereas in a small population the role of mere chance in fixation of a mutation has a greater effect.  This demographic effect influences the whole genome (Lynch 2007). Linkage and demography are both important to gene evolution, but it is nevertheless often possible to discern effects of selective pressure on the gene as such, beyond the noise produced by linkage and demography. Having described measures of evolutionary rates and selective constraint, we can now turn to an earlier question: what is it about the relationship between gene and phenotype that sets up the selective pressures laid on the gene?  One factor is the importance of the gene's role to the overall phenotype.  For example, genes that produce floral pigments face relatively weak selective constraint (Rausher et al. 2008), whereas genes for histones, on which the whole structure of chromosomes rests, barely diverge between distantly related species, showing very strong selective constraint on histone proteins (Li 1997).  Similarly, essential genes, those unlikely to be lost in the course of evolution, tend to evolve slowly (Krylov et al. 2003) and genes that affect multiple cellular processes or multiple aspects of the phenotype (multifunctional or pleiotropic genes, respectively) tend to be under greater selective constraint than those that are  5 not multifunctional or pleiotropic (Waxman and Peck 1998, Otto 2004, Salathé et al. 2006). With this we return to the original suggestion: gene interaction networks, which are the basis of how gene gives rise to phenotype, are expected to shape evolutionary rates and selective pressures.  The position of a gene within an interaction network, for example, may determine how important it is to the overall phenotype, and to what degree it is pleiotropic and/or multifunctional.  Therefore, we expect that network structure (topology) will show noticeable relationships to measures of evolutionary rates and selective constraint.  Review of literature on network structure and evolutionary rate variation Literature published over the last decade demonstrates a growing interest in relationships between network topology and gene evolution (e.g., Cork and Purugganan 2004).  Three advances have enabled a new network-oriented trend in the study of molecular evolution: widely available DNA sequence data, use of the mathematical theory of networks (graph theory), and increased computational power (Lehner et al. 2005, Proulx et al. 2005). Research carried out at the intersection of network biology and molecular evolution has covered a wide variety of network types, most prominently networks of physical protein-protein interactions, but also regulatory pathways, developmental networks, signaling pathways and metabolic pathways/networks.  Work with all types reveals relationships between network structure and gene evolution (Cork and Purugganan 2004).  Metabolic networks, though less studied than protein-protein interaction networks, offer some of the greatest insights. Metabolism is more clearly linked to phenotype than protein-protein interactions are, offering a clearer path to understanding the link between gene/genome and phenotype, a key goal in biology (Vitkup et al. 2006).  Protein-protein interaction networks, though more often studied, offer less insight into critical biological questions because they lump together all physical protein interaction, whether regulatory, metabolic, or structural, thereby obliterating much opportunity to relate network properties to specific aspects of phenotype and fitness (Vitkup et al. 2006). Therefore, I will orient this review to studies of metabolic pathways/networks, but make reference to studies on other systems to demonstrate what is specific to metabolism and what is common to biological networks generally. Networks: definition and structure Before considering how network structure shapes gene evolution, we must begin with a solid definition of networks.  A network is a collection of units or nodes that are connected by  6 directional or non-directional edges (Higgins 2007), a group of actually or potentially interacting elements (Proulx et al. 2005).  In a metabolic network, nodes are enzymes and edges are the metabolites that are the product of one enzyme and the substrate of the next.  In protein-protein interaction networks nodes are simply proteins of any kind, and edges represent physical contact. Cellular networks, whether metabolic, protein-protein interaction or otherwise tend to be small-world (or scale-free) networks (Jeong et al. 2001, Wagner and Fell 2001, Jordan et al. 2004; but see Bader 2006).  These networks have a few highly-connected nodes and many nodes with few connections.  Oddly enough, this is exactly the same structure as many non-biological networks, including the Internet and social connections (Higgins 2007).  These highly connected nodes result in a short average distance between nodes compared to the number of nodes in the network (Proulx et al. 2005).  In metabolic networks, highly connected nodes tend to also be central to the network, having a short average distance to other nodes (Vitkup et al. 2006).  This structure lends a certain degree of robustness.  Most nodes, if disrupted, cause little overall perturbation (though targeted removal of highly connected nodes is more problematic; Albert et al. 2000). This scale-free structure may have evolved through preferential node attachment (Eisenberg and Levanon 2003), with or without selection for robustness as such, around a core metabolism shared by virtually all organisms (Proulx et al. 2005, Prachumwat and Li 2006).  Thus, network structure may have arisen for non-adaptive reasons, or due to selection for some other role than it now plays, as with many major events in evolution (Lynch 2007).  Node connectivity and selective constraint Scale-free network structure results in stronger selective constraint on nodes with greater connectivity.  Highly-connected nodes are vulnerable to attack (Albert et al. 2000), and their loss has effects that reverberate through wide sectors of the overall network, reducing overall fitness. These predictions are borne out quite well in the yeast (Saccharomyces cerviceae) metabolic network; using more than 670 ORFs identified by Forster et al. (2003), Vitkup et al. (2006) show that dN/dS correlates with node degree (connectivity).  This arises from functional constraints, since highly connected enzymes are required for more metabolic processes (Vitkup et al. 2006). Protein-protein interaction networks also show a similar correlation of connectivity and evolutionary rate, but due to structural constraints (Fraser et al. 2002, Fraser et al. 2003, Jordan et al. 2003a, b, Hahn et al. 2004, Makino et al. 2006).  7 Node connectivity is also correlated with retention of gene duplicates.  Vitkup et al. (2006) show that highly connected nodes are more likely to retain duplicates, reminiscent of work showing that genes with critical functions tend to retain duplicates after whole genome duplication (Chapman et al. 2006).  Critical nodes in metabolic networks, therefore, not only evolve slowly but are often protected from failure through gene duplication.  In contrast, Prachumwat and Li (2006) found a negative correlation between protein connectivity and duplicability in the yeast protein-protein interaction network, showing that gene duplication may have a different relationship to connectivity in different network types.  Metabolic flux and selective pressure Besides enzyme connectivity, rates of reaction and flux through the network have also been shown to correlate with evolutionary rates.  Vitkup et al. (2006) show that under normal growth conditions for yeast (aerobic growth on glucose or fructose), enzymes with high metabolic flux have low Ka/Ks and are more likely to retain gene duplicates, suggesting greater selective constraint on these enzymes.  On the other hand, enzymes at pathway branchpoints, which are important for controlling flux, may come under positive selection.  This has been shown in Drosophila glycolysis (Flowers et al. 2007, Eanes 1999) and Zea mays starch synthesis (Whitt et al. 2002).  Selection acts on the total phenotypic outcome of network performance (Proulx et al. 2005); these examples show that critical proteins can both bear the burden of selective constraint and/or evolve adaptively in response to needs for a metabolic shift.  Effects of position in metabolic networks Another feature of metabolic networks relevant to evolutionary rate variation is the position of each enzyme relative other nodes in the network.  One aspect of position is centrality, the average number of nodes that lie between one node and any other in the network.  Vitkup et al. (2006) have shown that highly connected nodes are also central nodes.  This suggests that centrality is related to selective constraint, but this is not formally analyzed (Vitkup et al. 2006). Hahn and Kern (2005) show that in yeast, worm and fly protein-protein interaction networks, central proteins evolve more slowly and are more essential to organism survival, regardless of protein connectivity. While centrality provides one measure of position within a network, another measure is the position along directional paths through the network.  A pathway in the metabolic sense is a  8 series of biochemical reactions that produces a particular end product from a particular substrate; more generally, a biological pathway is an ordered series of reactions or changes (Oxford English Dictionary), which may be metabolic, developmental or involved in signal transduction. In term of network theory, a path is a route traced through the network from any one node to another, traversing any nodes between them via the edges between nodes (Higgins 2007). The order of biochemical steps, or enzymes, along a pathway should influence the evolutionary rates of genes for those enzymes (Rausher et al. 1999).  Arguments for such a hypothesis can be made based on centrality, flux control and pleiotropy.  Central elements in metabolism tend to be those that provide substrates for many other enzymes (Fell and Wagner 2000, Jeong et al. 2000).  Since the more central enzymes lie upstream in metabolic flow, genes for upstream enzymes should evolve more slowly than those for downstream enzymes. Likewise, enzymes controlling the rate of flux are often, roughly speaking, concentrated in the more upstream areas of metabolic pathways (Rausher et al. 2008).  Either of these alone could produce lower evolutionary rates upstream and higher rates downstream, a pattern called positional rate variation (Rausher et al. 1999).  A third and very convincing argument for the positional rate variation hypothesis rests on the relationship between pleiotropy and the structure of metabolic pathways.  Metabolic pathways often branch in such a way that upstream enzymes produce substrates used to synthesize a wide variety of metabolites, whereas enzymes downstream are required for only a few products.  Both pleiotropy (multiple aspects of phenotypic influenced by one gene) and multifunctionality (multiple biochemical processes influenced by one gene) produce selective constraint (Waxman and Peck 1998, Otto 2004, Salathé et al. 2005).  Therefore, upstream enzymes should evolve more slowly than downstream enzymes due to a gradient of selective constraint along the pathway. Positional rate variation was first demonstrated in the anthocyanin biochemical pathway. Nonsynonymous substitution rates (dN) vary with pathway position for pairwise comparisons among Zea, Antirrhinum and Ipomoea for six genes in sequence starting from the first committed step in flavonoid synthesis (Rausher et al. 1999).  This trend holds with dN/dS for the most upstream enzyme, CHS and the two downstream enzymes ANS and UFGT in comparisons among various Ipomoea species (Lu and Rausher 2003, Rausher et al. 2008).  Various tests for positive selection show no evidence of positive selection driving this gradient of evolutionary rates.  Rather, selective constraint is relaxed along the pathway (Lu and Rausher 2003, Rausher et al. 2008).  9 Apart from the anthocyanin pathway, there is little evidence for positional rate variation. Two studies suggest a similar trend but do not rigorously examine it.  First, Sharkey et al. (2005) performed a phylogenetic analysis of three methylerythritol phosphate (MEP) pathway genes (which produce isoprenoid precursors) and isoprene synthase (which produces isoprene, thought to play a role in plant thermotolerance).  Percent amino acid identity and percent nucleotide identity (rough indicators of selective constraint) are both higher in the upstream MEP proteins/genes than in the downstream isoprene synthase protein/gene, with 80-90% amino acid identity for the MEP genes but 57% for isoprene synthase. A second study to suggest further evidence for positional rate variation examines 55 loci involved in sialic acid biology, covering the synthesis, activation and recognition of molecules involved in establishing cell identity (Altheide et al. 2006).  Genes involved in biosynthesis and activation of these recognition molecules had lower pairwise Ka/Ks between human and chimpanzee that those involved in recognition of specific sialic acids (0.465 for average Ka/Ks for recognition proteins, versus 0.293 for biosynthesis).  Altheide et al. (2006) suggest that this an example of Rausher et al.'s (1999) phenomenon, but strictly speaking it is not, because pathways of sialic acid biology include interactions beyond metabolism.  Although Sharkey et al. (2005) and Altheide et al. (2006) suggest evolutionary rate variation along pathways involving metabolism, neither provides a rigorous confirmation of positional rate variation. A recent study of Arabidopsis phenylpropanoid metabolism, however, does rigorously explore the possibility of positional rate variation.  Ramos-Onsins et al. (2008) survey nine phenylpropanoid genes in Arabidopsis thaliana and A. lyrata as candidate genes for adaptive evolution, since the phenylpropanoid pathway produces many metabolites important for adaptation to specific environments.  The study suggests that the loci were all under selective constraint, not positive selection.  While Ramos-Onsins et al. (2008) did not calculate dN/dS, tests for a correlation of pathway position and five other measures of gene sequence divergence revealed no significant correlation.  Ramons-Onsins et al. (2008) conclude that demographic as opposed to selective forces are shaping variation at these loci, but suggest that their use of partial gene sequences may also be at fault. In summary, the literature on positional rate variation is limited to work on four pathways. Only work on the anthocyanin pathway offers strong evidence (Rausher et al. 1999, Lu and Rausher 2003, Rausher et al. 2008), while excellent work on phenylpropanoid metabolism reveals none (Ramos-Onsins et al. 2008).  Research on isoprene synthesis and sialic acid biology each offer anecdotal evidence of positional rate variation, but without the rigor of earlier work by  10 Rausher's group.  The positional rate variation hypothesis offers an intriguing addition to the study of molecular evolution in gene interaction networks, but further evidence is needed to establish positional rate variation as a general phenomenon.  Proposal for further research Further research on positional rate variation is needed to better understand the role of metabolic networks in shaping gene evolution.   In order to carry out a sufficiently rigorous study of positional rate variation, three points need to be carefully considered: choice of metabolic pathway, method for testing for positional rate variation, and species from which to draw gene sequence data.  Choice of study system An effective study of positional rate variation must examine an appropriate metabolic pathway.  Because a pathway is simply a route from a chosen beginning to a chosen end, not all pathways should be expected to show positional rate variation.   The anthocyanin pathway, the only solid example of PRV to date, is highly branched (Winkel 2006) so that each of the six enzymes in series represents a successive decrease in pleiotropy.  Where pathway branchpoints are not so densely packed, pathway position may not correspond to pleiotropy.  In fact, a hypothetical linear pathway with no branchpoints should in fact have no difference in pleiotropy among pathway members, and any rate variation should come from demographic effects or from differences in protein folding constraints among the enzymes, not from pathway structure. Therefore, an appropriate study system will be a long pathway that crosses several pathway branchpoints. Besides choosing a long pathway with many branchpoints, an improved study of positional rate variation must consider not one but many branches of a metabolic system.  If positional rate variation is truly a general effect, then the many downstream branches of the upstream pathway elements should all show the same trend of higher evolutionary rates downstream.  This will prove that any evidence for positional rate variation is not simply the vagaries of one particular pathway branch.  Plant terpenoid synthesis, described in detail in Chapter 2, is ideal for studying positional rate variation because of its length, many branchpoints, and many downstream branches with genetic data available for analysis.   11 Improved methods for detecting positional rate variation In testing for positional rate variation, Ramos-Onsins et al. (2008) examined correlations of nucleotide divergence with pathway position.  Pathway position, however, may not be the optimal metric for detecting positional rate variation.  As described above, pleiotropy should decrease not from enzyme to enzyme, but from one pathway branch point to the next.  Therefore, the order of groups of enzymes between pathway branchpoints should correlate with dN/dS more strongly than pathway position itself, even in cases where pathway position reveals no significant correlation.  I call this metric the Pathway Pleiotropy Index (PPI).  Besides tracking changes in pleiotropy along pathways, I expect the PPI to have a second advantage: some metabolic pathways are cyclical or reticulate, making pathway position difficult to assign.  With the PPI, all enzymes between branchpoints are counted as a single unit regardless of whether they act in a predictable order or not.  Choice of taxa A study of positional rate variation requires study species that have adequate genetic resources and that span diverse lineages.  In terms of genetic resources, species with whole genome sequences are an excellent choice.  Full coding sequences will normally be available for all genes, and the electronic format allows a bioinformatic approach, which is appropriate for a first look at a new pathway.  Also, having a total genome sequence allows more reliable ortholog determination, since the total sequence space can be screened.  Orthologs are genes from different taxa that are similar due to common descent, as opposed to paralogs, which are similar due to a gene duplication shared by those taxa.    Accurate determination of orthology is essential for measuring rates of evolution along the chosen lineages, without unintentionally incorporating divergence of duplicates that occurred before the lineages separated. Choosing several diverse species provides a basis for commenting on the generality of positional rate variation.  Even if positional rate variation is a general phenomenon in genome evolution, not all lineages may exhibit such an effect.  First, as Ramos-Onsins et al. (2008) found, demographic effects can outweigh selection in a species with small population sizes. Second, different lineages have different histories of genome duplication and retention of duplicates.  Additional gene copies could relax the constraining effects of pleiotropy and obscure effects of pathway position if gene copy number is higher upstream than downstream in a particular lineage.  12 Oryza, Vitis, Arabidopsis, Ricinus and Populus are the first five angiosperms to have full genome sequences, and offer an appropriate setting for studying positional rate variation.  First, the whole genome sequences allow for exhaustive searches during ortholog determination.  The whole genome also allows a total count of gene copy number for examining whether this variable can explain cases in which positional rate variation is not found.  Second, these species span a variety of historical effective population sizes (Bergelson et al. 1998, Tuskan et al. 2006) and histories of genome duplication.  Vitis, Arabidopsis, Populus and Oryza all have genome duplication events after their divergence from the other species in this group (Barker et al. 2007).  Research objectives Based on the recommendations above, my collaborators and I have carried out a study of positional rate variation in the plant terpenoid synthesis pathway, addressing the following four objectives:  1. To test the strength of correlation between pathway position and dN/dS and between the Pathway Pleiotropy Index and dN/dS 2. To evaluate the merit of the Pathway Pleiotropy Index over pathway position for detecting positional rate variation 3. To observe whether evolutionary lineages vary in exhibiting positional rate variation among any given pathway of enzymes 4. To consider whether gene copy number can explain why certain lineages do not  show positional rate variation Detailed methods and results of this study are described in chapter 2.   13 References Albert R., Jeong H, Barabasi AL. 2000. Error and attack tolerance of complex networks. Nature. 406: 378-382.  Altheide TK, Hayakawa T, Mikkelsen TS, Diaz S, Varki N, Varki A. 2006. System-wide genomic and biochemical comparisons of sialic acid biology among primates and rodents - evidence for two modes of rapid evolution. J Biol Chem. 281: 25689-25702.  Bader J. 2006. The Drosophila protein interaction network may be neither power-law nor scale- free.  In: Koonin EV, Wolf YI, Karev GP, editors. Power Laws, Scale-Free Networks and Genome Biology. New York: Springer. p. 53-64.   Barker MS, Kane N, Rieseberg L. 2007. Widespread paleopolyploidy across the Viridiplantae [poster].  In: Botany & Plant Biology Joint Congress; 2007 July 7-11; Chicago, IL.  Bergelson J, Stahl E, Dudek S, Kreitman M. 1998. Genetic variation within and among populations of Arabidopsis thaliana. Genetics. 148:1311-1323.  Chapman BA, Bowers JE, Feltus FA, Paterson AH. 2006. Buffering of crucial functions by paleologous duplicated genes may contribute cyclicality to angiosperm genome duplication. P Natl Acad Sci USA. 103: 2730-2735.  Cork J, Purugganan M. 2004. The evolution of molecular genetic pathways and networks. BioEssays. 26: 479-484.  Eanes WF. 1999. Analysis of selection on enzyme polymorphisms. Annu Rev Ecol Syst. 30: 301–326.  Eisenberg E, Levanon EY. 2003. Preferential attachment in the protein network evolution. Phys Rev Lett. 91: 138701.  Fell DA, Wagner A. 2000. The small world of metabolism. Nat Biotech. 18: 1121-1122.  Flowers JM, Sezgin E, Kumegai S, Duvernell DD, Matzkin LM, Schmidt PS, Eanes WF. 2007. Adaptive evolution of metabolic pathways in Drosophila. Mol Biol Evol. 24: 1347-1354.  Forster J, Famili I, Fu P, Palsson BO, Nielsen J. 2006. Genome-scale reconstruction of the Saccharomyces cerevisiae metabolic network. Genome Res. 13: 244-253.  Fraser HB, Hirsh AE, Steinmetz LM, Scharfe C, Feldman MW. 2002. Evolutionary rate in the protein interaction network. Science. 296: 750-752.  Fraser H, Wall D, Hirsh A. 2003. A simple dependence between protein evolution rate and the number of protein-protein interactions. BMC Evol Biol. 3: 11.  Goldman N, Yang Z. 1994. A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol Biol Evol. 11: 725-736.  14  Hahn, MW. 2008. Toward a selection theory of molecular evolution. Evolution. 62: 255-265.  Hahn MW, Conant GC, Wagner A. 2004. Molecular evolution in large genetic networks: does connectivity equal constraint? J Mol Evol. 58: 203-211.  Hahn MW, Kern AD. 2005. Comparative genomics of centrality and essentiality in three eukaryotic protein-interaction networks. Mol Biol Evol. 22: 803-806.  Higgins PM. 2007. Nets, Puzzles and Postmen: an exploration of mathematical connections. Oxford; New York: Oxford University Press.  Hoekstra HE, Coyne JA. 2007. The locus of evolution: evo devo and the genetics of adaptation. Evolution. 61: 995-1016.  Jeong H, Tombor B, Albert R, Oltvai ZN, Barabasi AL. 2000. The large-scale organization of metabolic networks. Nature. 407: 651-654.  Jeong H, Mason SP, Barabasi AL, Oltvai ZN. 2001. Lethality and centrality in protein networks. Nature. 411: 41-42.  Jordan IK, Wolf Y, Koonin E. 2003. No simple dependence between protein evolution rate and the number of protein-protein interactions: only the most prolific interactors tend to evolve slowly. BMC Evol Biol. 3: 1.  Jordan IK, Wolf Y, Koonin E. 2003. Correction: No simple dependence between protein evolution rate and the number of protein-protein interactions: only the most prolific interactors tend to evolve slowly. BMC Evol Biol. 3: 5.  Jordan IK, Marino-Ramirez L, Wolf YI, Koonin EV. 2004. Conservation and coevolution in the scale-free human gene coexpression network. Mol Biol Evol. 21: 2058-2070.  Kimura M. 1983. The neutral theory of molecular evolution. Cambridge; New York: Cambridge University Press.  Kimura M. 1991. The neutral theory of molecular evolution - a review of recent evidence. Jpn J Genet. 66: 367-386.  Krylov DM, Wolf YI, Rogozin IB, Koonin EV. 2003.  Gene loss, protein sequence divergence, gene dispensability, expression level, and interactivity are correlated in eukaryotic evolution. Genome Res. 13: 2229-2235.  Lehner B, Tischler J, Fraser A. 2005. Systems biology: where it's at in 2005. Genome Biol. 6:338.  Li WH.  1997.  Molecular evolution.  Sunderland, Massachusetts: Sinauer.  Lu YQ, Rausher MD. 2003. Evolutionary rate variation in anthocyanin pathway genes. Mol Biol Evol. 20: 1844-1853.  15  Lynch M. 2007. The origins of genome architecture. Sunderland, MA: Sinauer Associates.  Makino T, Suzuki Y, Gojobori T. 2006. Differential evolutionary rates of duplicated genes in protein interaction network. Gene. 385: 57-63.  Nei M.  1987.  Molecular evolutionary genetics.  New York: Columbia University Press.  Otto SP. Two steps forward one step back: the pleiotropic effects of favoured alleles. P Roy Soc B-Biol Sci. 271: 705-714.  Prachumwat A, Li WH. 2006. Protein function, connectivity, and duplicability in yeast. Mol Biol Evol. 23: 30-39.  Proulx SR, Promislow DEL, Phillips PC. 2005. Network thinking in ecology and evolution. Trends Ecol Evol. 20: 345-353.  Ramos-Onsins SE, Puerma E, Balañá-Alcaide, Salguero D, Aguadé M. 2008. Multilocus analysis of variation using a large empirical data set: phenylpropanoid pathway genes in Arabidopsis thaliana. Mol Ecol. 17: 1211-1223.  Rausher M.D, Miller RE, Tiffin P. 1999. Patterns of evolutionary rate variation among genes of the anthocyanin biosynthetic pathway. Mol Biol Evol. 16: 266-274.  Rausher MD, Lu YQ, Meyer K. 2008. Variation in constraint versus positive selection as an explanation for evolutionary rate variation among anthocyanin genes. J Mol Evol. 67: 137-144.  Salathé M, Ackermann M, Bonhoeffer S. 2006. The effect of multifunctionality on the rate of evolution in yeast. Mol Biol Evol. 23: 721-722.  Sharkey TD, Yeh S, Wiberley AE, Falbel TG, Gong DM, Fernandez DE. 2005. Evolution of the isoprene biosynthetic pathway in Kudzu. Plant Physiol. 137: 700-712.  Tuskan GA, DiFazio S, Jansson S, et al. [107 coauthors]. 2006. The genome of Black Cottonwood, Populus trichocarpa (Torr. & Gray). Science. 313: 1596-1604.  Vitkup D, Kharchenko P, Wagner A. 2006. Influence of metabolic network structure and function on enzyme evolution. Genome Biology. 7: R39.  Wagner A, Fell DA. 2001. The small world inside large metabolic networks. P Roy Soc B-Biol Sci. 268: 1803-1810.  Waxman D, Peck JR. 1998. Pleiotropy and the preservation of perfection. Science. 279: 1210- 1213.  Whitt SR, Wilson LM, Tenaillon MI, Gaut BS, Buckler ES. 2002. Genetic diversity and selection in the maize starch pathway. P Natl Acad Sci USA. 99: 12959-12962.   16  Winkel BSJ. 2006. The biosynthesis of flavonoids. In: Grotewold E, editor. The science of flavonoids. Columbus (OH): Springer. p. 71-96.  Yang Z. 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13: 555-556.  Yang Z. 1998. Likelihood ratio tests for detecting positive selection and application to primate lysozyme evolution. Mol Biol Evol. 15: 568-573.  17 CHAPTER 2: The correlation of evolutionary rate with pathway position in plant terpenoid biosynthesis1 Introduction As species diverge through evolution, their genes diverge at unequal rates, and genomes become a mosaic of conservation and divergence.  These differences in divergence can be explained as differential selective forces acting on the various loci, but what sets up these differences in selective pressure among genes? Networks of gene interactions offer an intriguing context for answering this question. Functional genomics and whole-genome sequencing have opened the way to construct accurate representations of cellular networks and to more fully understand interactions among genes. Studies on a variety of network types (metabolic, protein-protein interaction, signaling, development) have shown that network properties such as node connectivity and centrality within the network correlate with evolutionary rate variation in a variety of species (Cork and Purugganan 2004).  For example, highly connected nodes (i.e., enzymes or other proteins) consistently undergo stronger selective constraint than nodes with fewer connections in both metabolic and protein-protein interaction networks (Fraser et al. 2002, Fraser et al. 2003, Jordan et al. 2003a, b, Hahn et al. 2004, Makino et al. 2006, Vitkup et al. 2006). A less explored aspect is the structure of metabolic pathways.  Many known metabolic pathways are structured such that the initial substrates in the pathway are ultimately transformed into several end products, based on the channeling of substrate into various branches of the pathway downstream.  Therefore, upstream genes should be more pleiotropic than those downstream, and so should face greater selective constraint (Waxman and Peck 1998, Otto 2004).  This gradient of selective constraint should then produce low evolutionary rates upstream and high rates downstream, a pattern of evolutionary rate variation that has been termed "positional rate variation" (Rausher et al. 1999). Positional rate variation (PRV) has been rigorously demonstrated in the anthocyanin pathway of higher plants.  Rausher et al. (1999) show that among six enzymes involved in anthocyanin synthesis, the three upstream enzymes evolve more slowly than the three downstream enzymes.  Lu and Rausher (2003) and Rausher et al. (2008) confirm that this is due to a relaxation of selective constraint, not stronger positive selection, on downstream genes.  1 A version of this chapter has been submitted for publication. Ramsay H, Rieseberg L, Ritland K.  2008.  “The correlation of evolutionary rate and pathway position in plant terpenoid biosynthesis.”   18 These studies establish an occurrence of PRV that holds true in three plant lineages and that can be demonstrated over both recent and ancient evolutionary time scales. Yet, is positional rate variation truly a general effect in genome evolution?  A study of four genes involved in plant isoprene synthesis suggests a similar trend of stronger selective constraint on upstream enzymes (Sharkey et al. 2005), but work on nucleotide variation in Arabidopsis thaliana phenylpropanoid metabolism reveals no correlation of pathway position and various measures of nucleotide divergence (Ramos-Onsins et al. 2008).    Clearly, positional rate variation requires further study to be established as a general phenomenon. In this study, we examine whether positional rate variation occurs among 45 genes involved in plant terpenoid synthesis, using data from five fully sequenced angiosperms.  To capture meaningful changes in pleiotropy along the pathway, we trace the flow of metabolites from glycolysis through to the synthesis of four terpenoid derivatives.  As the most upstream portion of this system, glycolysis plays a critical role in producing small precursors that are required for nearly every primary biosynthetic process (Plaxton 1996, Heldt and Heldt 2005). One of these processes is the synthesis of terpenoid precursors such as farnesyl diphosphate, which is also used in the production of a wide range of metabolites needed for growth and plant defense (Cheng et al. 2007, Liu et al. 2005).  These include lutein, a carotenoid important for the assembly and function of the photosynthetic light harvesting complex (Pogson et al. 1996), as well as the phytohormones abscissic acid, gibberellic acid and brassinosteroids (Buchanan et al. 2000).  The enzymes involved in the transformation of glucose to these four end products are therefore less pleiotropic downstream than they are upstream, and offer an ideal setting to study positional rate variation.  The entire pathway is depicted in Figure 2.1 (information derived from Plaxton 1996, Clouse and Sasse 1998, Szekeres and Koncz 1998, Buchanan et al. 2000, Hedden and Phillips 2000, Naik et al. 2003, Sakamoto et al. 2004, Heldt and Heldt 2005, Liu et al. 2005, Nambara and Marion-Poll 2005, Grennan 2006, Cheng et al. 2007, KEGG 2008). To improve detection of positional rate variation, we use a new measure termed the "Pathway Pleiotropy Index."  Rather than counting enzymes in sequence from most upstream to most downstream, the Pathway Pleiotropy Index (PPI) numbers groups of enzymes relative pathway branchpoints.  We compare this measure with the simpler approach of correlating evolutionary rates with pathway positions.  We expect that the PPI will correlate more strongly with evolutionary rates because it tracks changes in pleiotropy along the pathways; enzymes between pathway branchpoints are responsible for the same set of products and therefore do not differ in pleiotropy.  In fact, the anthocyanin pathway may show such strong PRV precisely  19 because virtually every enzyme acts as a pathway branch point and therefore each enzyme is successively less pleiotropic (Harbourne 1988, Winkel 2006). In addition, if dN/dS does not correlate with pathway position, it may be that rate variation is more strongly influenced by another factor that mitigates the role of pathway structure.  For example, after gene duplication, selective constraint is relaxed for a time, ostensively due to redundancy (Lynch and Conery 2000).  Also, gene duplication may offer an escape from the constraining effects of pleiotropy (Hoekstra and Coyne 2007), resulting in a negative correlation of copy number with pathway position, rather than a positive correlation of pathway position and dN/dS.  Therefore, variation in gene copy number may explain instances where PRV is not found. Here, we examine whether plant terpenoid synthesis exhibits positional rate variation by addressing four specific questions.  First, we test whether statistically significant variation in dN/dS exists among enzymes.  Second, we test whether this variability is explained by pathway position and/or by PPI.  Third, we examine whether dN/dS varies with gene copy number, and whether copy number varies with pathway position.  Finally, we use likelihood-based methods (Church et al. 2007) to explore whether differences in dN/dS arise from variation in selective constraint versus positive selection.  Methods Study species We used all angiosperm genomes that were available at the time of study: Oryza sativa, Vitis vinifera, Arabidopsis thaliana, Ricinus communis and Populus trichocarpa.  Protein and coding sequences for each species were downloaded from the following websites on March 27, 2008: http://www.genoscope.cns.fr/externe/Download/Projets/Projet_ML/data/annotation/ ftp://ftp.Arabidopsis.org/home/tair/Genes/TAIR7_genome_release/TAIR7_blastsets http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.download.ftp.html http://castorbean.tigr.org/castorbean_downloads.shtml ftp://ftp.plantbiology.msu.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomol ecules/version_5.0/all.chrs   20 Finding orthologs and counting paralogs Using the KEGG Pathway database (2008), 47 genes involved in the conversion of glucose to lutein, abscissic acid (ABA), gibberellic acid (GA), and brassinosteroids (BR) were selected.  Arabidopsis protein sequences for the enzymes were gathered from the KEGG Pathway database February 27, 2008 (glycolysis enzymes were gathered May 23, 2008).  A list of genes and accession numbers for these queries are provided in Appendix 1.  The Arabidopsis protein queries were BLASTed against all proteins from all five genomes (BLASTP; Altshul et al. 1990).  A multi-sequence query was used if more than one sequence was given in the KEGG Pathway database (2008).  Blast results were parsed for 25% amino acid identity over 50% of the query sequence length (if more than one query was used, this was taken to be 50% of the length of the shortest query).  Parsed hits for all species were aligned using MUSCLE (Edgar 2004).  If the alignment quality was poor, BLAST results were re-parsed by increasing the percent identity cutoff by 5% until the resulting multiple alignment was acceptable.  The initial methionine was deleted before alignment in all cases.  Next, these alignments were used to construct maximum likelihood protein trees with PhyML (Guindon and Gascuel 2003).  For each alignment PhyML was run with the following parameters: JTT with 4 gamma categories; estimated proportion of invariable sites and gamma distribution parameter; 100 bootstrap replicates; neighbor-joining starting tree; and optimized both topology and branch lengths. The resulting trees were visually inspected, and the orthologous group was chosen as that clade with 50% or greater bootstrap support which contained the Arabidopsis query as well as at least one representative of each of the other four taxa.  If no such clade could be found, the gene was not included in any further analysis.  If any taxon had more than one sequence in this clade, the sequence on the shorter branch was chosen.  For Arabidopsis, the chosen ortholog was always one of the query sequences.  Paralogs were counted as the number of sequences for each lineage in the ortholog clade.  Names of orthologs, as used in the genome file for each species, are provided in Appendix 2.  Measuring evolutionary rates After choosing one ortholog from each of the five taxa, protein-guided DNA alignments of coding sequences were constructed using an alignment pipeline provided by Mike Barker. This pipeline was used because not all coding sequences were in frame.  These alignments were visually inspected.  Only four genes contained ambiguously aligned regions; analyses were carried out with both the original alignments and with the ambiguous region were masked in  21 these four genes in order to ensure that alignment ambiguity did not sway results (alignments are provided in Appendix 6). Using this alignment of five orthologs, dN/dS ratios along each lineage were calculated in CODEML (Yang 1997) using the tree (Oryza, Vitis, (Arabidopsis, (Ricinus, Populus))), with model = 1 (free ratios), and getSE = 1 (obtain standard errors of dN/dS estimates).  Five replicate runs were carried out and the run with greatest absolute value of lnL was selected.  From this selected run, dN/dS values for Vitis, Arabidopsis, Ricinus and Populus were estimated (Oryza served as an outgroup; see Figure 2.2; tree topology from Soltis et al. 2005).  Values of dN/dS for which dS was less than 0.005 or more than 2.00 were discarded, as were values for which S*dS was less than 10.  Variability of dN/dS Using standard errors from the CODEML output, we tested whether dN/dS varies among genes of each pathway for each lineage based on the following test statistic, summed over all n genes in a pathway: Σ[ωi-µ2/σi] where ωi is the dN/dS value for gene i, σi is the standard error for ωi (from CODEML), and µ is the mean ω across all genes sampled (calculated separately for each lineage, summed over all genes).  This statistic is distributed as χ2 with n-1 degrees of freedom.  Relationship of dN/dS to pathway structure and gene copy number To determine the relationship of dN/dS to each of two measures of pathway position, Kendall’s τ rank correlation coefficient was calculated using JMP 7.0.  First, Kendall’s τ was calculated using pathway position.  Enzymes were sequentially numbered from the first enzyme involved in the conversion of glucose to pyruvate through to the last enzyme involved in the production of each of the four end products.  Second, Kendall’s τ was calculated using our Pathway Pleiotropy Index (PPI).  Groups of enzymes that act between pathway branchpoints were numbered from most upstream to most downstream (see Figure 2.1).  If an enzyme (such as CrtL-b or CrtR-b; see KEGG Pathway Database 2008) was involved in more than one path downstream of a branch point, it was counted as part of the group above that branch point. (Creating a separate category for such genes made no difference to our results).  Since the synthesis of abscissic acid, gibberellic acid, brassinosteroids and lutein from glucose is a branched pathway, the correlation of dN/dS with pathway position and with the PPI was  22 calculated separately for the path from glucose to each end product.  The robustness of these correlations was tested by removing the highest dN/dS value and recalculating the correlation to ensure that significant results were not driven by such outliers.  The relationship of dN/dS to gene copy number was examined visually, and since no apparent relationship was seen, Kendall's τ was not calculated for this variable.  The relationship of gene copy number and pathway position was also examined visually.  Tests for selection To verify whether any pattern of rate variation is due to relaxation of selective constraint, and not positive selection, we tested for selection using the following comparisons of models in CODEML (Goldman and Yang 1994, Yang 1997, Yang 1998), after Church et al. (2007).  First, we tested for variable rates among codons by comparing likelihood values under M3 and M0. Second, we tested for a class of codons with dN/dS > 1 by comparing likelihood values under M2a and M1a.  Likelihood values were compared between each pair of models, but the dN/dS values for sites were ignored as these may not be reliable (Church et al. 2007, and references therein).  The same alignments as for dN/dS calculation were used to test for selection, except that the outgroup Oryza was omitted.  This test of selection is the only point in the analysis in which lineages were not treated separately.  Results Ortholog availability and rate variation among enzymes Of 47 genes examined, orthologs were found for 45.  After discarding dN/dS values with dS above 2.00 or below 0.005, all 45 genes remained for Ricinus and Populus.  Arabidopsis retained 29 and Vitis 39 dN/dS values.  All four ingroup lineages showed statistically significant variation in dN/dS for enzymes along the abscissic acid, gibberellic acid, and brassinosteroid pathways.  No statistically significant variation was found for the lutein pathway, except in Vitis. In each lineage, dN/dS varied by an order of magnitude (dN/dS ranged from 0.033-0.28 for Arabidopsis, 0.047-0.28 for Populus, 0.031-0.29 for Ricinus, and 0.048-0.59 for Vitis).   23 Variation of dN/dS with pathway position Variability in dN/dS correlated significantly with pathway position for 9 of 12 pathway- lineage combinations (robust to removal of the highest dN/dS value for 5 of 12; Table 2.1).  The strongest correlations are for synthesis of gibberellic acid and abscissic acid (mean Kendall’s τ 0.46 and 0.38, respectively, versus 0.30 for brassinosteroid synthesis).  Scatterplots of data for Populus are given in Figure 2.3(a-d); plots of data from other lineages can be found in Appendices 3-5(a-d).  Variation of dN/dS with the Pathway Pleiotropy Index Variability in dN/dS correlated significantly with PPI for 10 of 12 pathway-lineage combinations (robust to removal of the highest dN/dS value for 9 of 12; Table 2.2).  Here, strong correlations are seen for synthesis of all three phytohormones, though synthesis of gibberellic acid has by far the highest rank correlation coefficients (mean Kendall’s τ of 0.54 for synthesis of gibberellic acid, versus 0.42 and 0.40 for abscissic acid and brassinosteroid synthesis, respectively).  Data for Populus are shown in Figure 2.3(e-h); plots of data from other lineages can be found in Appendices 3-5(e-h).  Gene copy number Gene copy number varied among genes in all four lineages.  Vitis, Arabidopsis, and Ricinus had mostly one copy per gene, while most Populus genes had two copies.  Copy number was 1, 2 or 3 for Vitis; 1, 2, 3, 4, or 11 for Arabidopsis; 1 or 2 for Ricinus; and 1, 2, or 3 for Populus.  Genes with two or more copies appeared to be concentrated in the downstream end of gibberellic acid synthesis (for Vitis and Arabidopsis), brassinosteroid synthesis (for Populus and Ricinus) and abscissic acid synthesis (for Vitis and Ricinus), but in all other cases duplicate and singleton genes were equally distributed along the pathways.  Gene copy number bore no apparent relationship to dN/dS.  Selection analyses All enzymes showed variable dN/dS among codons, but models including a class of codons with dN/dS > 1 were not significantly more likely than models without.  In all the above analyses, results using alignments altered to exclude ambiguously aligned region produced qualitatively similar results.  24  Discussion Positional rate variation (PRV) is a pattern of evolutionary rate variation wherein genes evolve under relaxed selective constraint if they code for enzymes downstream in a metabolic pathway, but face greater selective constraint if the enzyme acts upstream (Rausher et al. 1999). The data from plant terpenoid synthesis presented here clearly demonstrate PRV.  This is the only clear example of PRV to date besides that for anthocyanin synthesis (Rausher et al. 1999, Lu and Rausher 2003, Rausher et al. 2008). The research presented here is so far the most extensive survey of PRV, the only comparable studies being the work of Rausher and colleagues (Rausher et al. 1999, Lu and Rausher 2003, Rausher et al. 2008).  We have incorporated sequence data for enzymes along not one but four branches of a metabolic system, examined 45 genes (more than seven times as many as previous studies) and used explicit ortholog determination by phylogenetic methods (considerably more reliable than reciprocal best hit methods; Poptsova and Gogarten 2007). Because Kendall's τ is a conservative test of correlation, our results are very robust.  This work is made possible by advent of whole genome sequences, and by advances in functional genomic studies that elucidate pathways of gene interactions (e.g., Rodríguez-Conceptión and Boronat 2002). In this study, we expected that (1) longer pathways would show stronger PRV, and that (2) an index that accounts for the position of an enzyme relative pathway branchpoints, "PPI," would better correlate with dN/dS than pathway position as such.  The long pathways in our study do show strong upstream vs. downstream trends in dN/dS, and examination of the graphs reveals that such a relationship is not generally evident in the separate "pathways" (such as glycolysis) that this longer system can be subdivided into.  Notably, the variation in dN/dS in terpenoid synthesis is equivalent to that in the anthocyanin pathway.  In the four lineages studied here, dN/dS varied from 0.04 upstream to 0.30 downstream, an order of magnitude difference. Rausher et al. (2008) found dN/dS to vary from 0.027 upstream to 0.220 downstream in the anthocyanin pathway, also an order of magnitude difference.  This confirms our initial prediction, that the anthocyanin pathway exhibits strong PRV because of the close packing of pathway branchpoints. Our "pathway pleiotropy index" (PPI) offers modest but noticeable improved detection of trends, compared to the method of simply considering the position of enzymes in the pathway.  25 First, the PPI produces values of Kendall's τ that are 0.07 units higher on average than those for pathway position.  Second, PPI identifies statistically significant correlations that pathway position does not, as in the case of the brassinosteroid pathway in the Ricinus lineage.  Third, the significance of correlations between the PPI and dN/dS is robust to removal of high-dN/dS values whereas the significance of correlations with pathway position is often not, as in the case of gibberellic acid synthesis in Vitis, and brassinosteroid synthesis in Arabidopsis, Populus and Vitis.  The PPI may be particularly helpful for regions of the metabolic network that are cyclical or reticulate, such as fatty acid synthesis (Buchanan et al. 2000) or the later stages of brassinosteroid and gibberellic acid synthesis (Szekeres and Koncz 1998, Hedden and Philips 2000). Since glycolytic enzymes are known to be highly conserved, our significant correlations of dN/dS with pathway position and with PPI could be driven solely by the low dN/dS values of the glycolytic genes.  For the relationship of dN/dS and pathway position, only two correlations remain significant if the glycolytic genes are removed from the analysis.  However, all significant correlations of dN/dS and PPI remain significant when glycolytic genes are removed. This demonstrates both that plant terpenoid synthesis is truly a robust example of PRV, and that our Pathway Pleiotropy Index is superior to pathway position for detecting positional rate variation.  Gene evolution and metabolic pathways Both pathway position and PPI indicate that functional constraints are increasingly relaxed along a metabolic pathway.  First, there are significant correlations of both indices with dN/dS values, and dN/dS values are generally higher downstream in these pathways, though always much less than 1.  Second, there is no evidence of positive selection on specific codons. These points together reflect a relaxation of selective constraint on downstream genes. Therefore, our data suggests that the directionality and branching structure of metabolic pathways shape the evolution of genes coding for enzymes in these pathways.  While the current data do not prove that PRV is driven by variation in pleiotropy, or that variation in pleiotropy results from the branching of the pathway, the data presented here certainly fit such a scenario. An alternate hypothesis is that PRV is driven by differences in connectivity rather than pleiotropy along the pathway.  High connectivity also produces selective constraint (Vitkup et al. 2006) and many upstream enzymes used here are highly connected (KEGG Pathway Database  26 2008), but pleiotropy likely still plays a role apart from connectivity.  A hypothetical pathway in which all nodes have four connections (one in, three out) should still show PRV even though all nodes have equal connectivity, since the upstream nodes are more pleiotropic.  Nevertheless, further work is required to disentangle the roles of pathway position, pleiotropy and connectivity in shaping evolutionary rate variation.  Pathway-specific patterns Gibberellic acid synthesis provides a particularly strong example of pathway position- dependent evolution across all four lineages, with high Kendall's τ values and statistical significance generally robust to removal of the highest dN/dS value.  Synthesis of abscissic acid and brassinosteroids also show strong positional rate variation in more than one lineage. Even the lutein pathway, which did not show significant correlations, suggests a positive relationship of PPI and dN/dS.  Nevertheless, these individual pathways cannot be taken as independent examples of PRV, since all share the same upstream components.  Rather, they together form evidence that plant terpenoid synthesis in general is a solid example of PRV. The lack of significant variation in dN/dS among enzymes involved with the lutein pathway may be simply a sampling issue: only one lutein-specific enzyme was available for the correlation analysis; all other enzymes along this path from glucose to lutein are involved in glycolysis, synthesis of terpenoid precursors, and early carotenoid synthesis.  Although this group of enzymes ought to be of unequal pleiotropy, it may be that all these enzymes are so highly pleiotropic that there is little difference in selective constraint among them.  This is particularly obvious in that lutein serves a critical function in the assembly and functioning of the light harvesting complex used in photosynthesis (Pogson et al. 1996).  That being said, Arabidopsis mutants in LUT1 and LUT2, which are required for lutein synthesis, have no visibly aberrant phenotype (Pogson et al. 1996).  Lineage-specific patterns There is some mystery as to why Arabidopsis and Vitis do not show significant PRV as often as Ricinus and Populus do.  One possibility is that since several values were discarded from Arabidopsis and Vitis due to high synonymous substitution rates, little data was left to flesh out PRV in these lineages.  Perhaps these lineages are simply too long.  Hahn et al. (2004) also found that for the correlation of protein connectivity with evolutionary rate in the yeast protein  27 interaction network, results varied with choice of dataset for longer lineages but not for short lineages.  Future studies should include more species in phylogenetic trees with shorter branches, in order to discern whether it is common to find much variability among species in detecting PRV, or whether the better results with Ricinus and Populus are simply due to using lineages of an appropriate age. The role of historical effective population size is also worth considering.  A lineage with low effective population size may not show PRV, as inefficient selection in a small population may cause all genes along the pathway to face essentially the same degree of selective constraint (Lynch 2007).  The role of historic effective population size however is difficult to ascertain; estimates of synonymous site diversity (an indicator of effective population size) are very similar for Arabidopsis and Populus (Lynch 2006) although these species currently have very different effective population sizes.  Perhaps differences in lineage-specific mutation rates results in similar estimates of synonymous site variation, despite different effective population sizes. As with individual pathways, however, the dN/dS values for separate lineages presented here come from the same likelihood analysis and therefore are not truly independent.  Therefore, our results should be taken first as general evidence of PRV in plant terpenoid synthesis, and second as a suggestion of the kinds of lineage-specific effects that can be more fully understood in future studies.  Gene copy number At the outset of this study, we hoped that examining gene copy number could explain why certain lineages show PRV and others do not.  Our observation that high copy genes appear to be concentrated downstream in some cases deserves further attention in future studies.  This trend runs counter to the idea that gene duplication serves to release genes from the selective constraint arising from pleiotropy, since the most pleiotropic genes seem to be retained in duplicate as much as or even less than the less pleiotropic genes at the end of the pathway.  Gene copy number, however, cannot explain why PRV is observed in plant terpenoid synthesis, since many of the strong positive correlations of dN/dS and pathway position correspond to an obvious lack of copy number variation along the pathway. Several factors could explain why gene copy number shows no apparent relationship with dN/dS here.  Duplicate genes experience relaxed selection for only a short period after duplication (Lynch and Connery 2006), and even then purifying selection is not wholly relaxed  28 (Hughes and Hughes 1993).  Also, divergence of paralogs may be asymmetric (Brunet et al. 2006).  Since the longer of two branches for any one species was rejected in the ortholog choice, the dN/dS values presented here are highly conservative and may not capture real variation. These are necessary evils: bioinformatic identification of paralogs, without functional verification, will necessarily miss real copies of some genes while overcounting copy numbers of others. Another issue is that gene duplication represents only one form of redundancy, "homologous redundancy."  Another form, "non-homologous redundancy," is the existence of parallel paths that offer an alternate route through the network.  This latter form of redundancy may actually cause greater relaxation of selective constraint than gene copy number does (Wagner 2000, Kitami and Nadeau 2002).  While gene copy number cannot explain why certain lineages do not exhibit PRV, this network-based non-homologous redundancy strengthens the case for plant terpenoid synthesis as an example of PRV.  Those parts of this system known to have alternate metabolic routes all lie in the upstream part of these pathways (Rodríguez- Conceptión and Boronat 2002, Plaxton 1996), suggesting that the real effect of pathway position is even stronger here than calculated correlations suggest.  Even greater selective constraint would be seen upstream in the absence of these alternate pathways.  Future directions Overall, the structure of metabolic pathways deserves greater consideration as a factor shaping genome evolution.  Ideally, future studies in this area will move towards whole-network analysis.  Studies of gene expression networks have shown that the strength of selective constraint on component genes is shaped by network topology (Jordan et al. 2004), as have studies of enzyme connectivity in metabolic networks (Vitkup et al. 2006).  Evidence for PRV in metabolic pathways presented here and elsewhere (Rausher et al. 1999, Lu and Rausher 2003, Sharkey et al. 2005, Rausher et al. 2008) strongly suggests that pathway branching and direction of flux may also shape the evolution of metabolic gene sequences across the whole network. Network-wide studies of PRV will require an organism for which the total metabolic network is well-understood, plus relatives with full genome sequences. Metabolic networks have been constructed for several organisms (Jeong et al. 2000, Wagner and Fell 2001), but these often consider only a core metabolism, representing a set of genes that may not vary sufficiently in pleiotropy or multifunctionality to produce observable variation in selective constraint.  29 A further challenge for moving to the whole-network level is to find a measure of position within that network that has biological meaning and/or would be expected to correlate with dN/dS.  Plant metabolic networks are ideal in this regard.  Non-photosynthetic organisms can absorb carbon in many forms, and therefore lack a true upstream that applies to the whole metabolic network.  In green plants, however, all carbon flow begins with photosynthesis, which can then offer a reference point for counting global pathway positions or Pathway Pleiotropy Index values.  For non-plants, centrality may offer a proxy to pathway position.  Centrality can be measured as the mean distance of a node to all other nodes in the network (Vitkup et al. 2006).  The tricarboxylic acid cycle is upstream of most metabolism, and is also central to the metabolic network (Fell and Wagner 2000, Jeong et al. 2000), whereas reactions like the glycosylation of an anthocyanin or the final steps in brassinosteroid synthesis would have a much larger average distance to other nodes (enzymes) in the network. As more and more genomes are sequenced, it will be possible to offer increasingly sophisticated answers to questions of how network topology shapes evolutionary rate variation. These answers may address the relative roles of connectivity and pathway position, clarify the effect of pathway position on retention of gene duplicates, or give insight to how the effects of pathway position play out at the population genomic level.  We particularly hope that future studies will harness the power of our Pathway Pleiotropy Index to determine how network structure shapes genome evolution.  Acknowledgements Many thanks to Mike Barker for his advice on ortholog determination, and for providing several perl scripts, including his alignment pipeline.  Many thanks also to Nolan Kane for sharing insightful comments and unpublished work on positional rate variation.  Sally Otto, Dilara Ally, Itay Mayrose and Allen Liu also took part in helpful discussions.  NSERC funded this project through grants to H. Ramsay and K. Ritland.   30 Table 2.1.  Kendall’s τ and p values for the correlation of dN/dS with pathway position.  Abscissic acid Gibberellic acid Brassinosteroid Lutein  τ p τ p τ p τ p Arabidopsis 0.43 0.054 **0.63 0.012 **0.63 0.003 0.21 0.327 Populus **0.41 0.016 *0.45 0.020 0.31 0.060 0.20 0.240 Ricinus **0.48 0.005 0.38 0.053 0.15 0.363 0.31 0.075 Vitis 0.24 0.160 *0.43 0.044 0.25 0.132 0.16 0.364 *p < 0.05.  **p < 0.05 after removal of highest dN/dS value in downstream genes.    Table 2.2.  Kendall’s τ and p values for the correlation of dN/dS with the Pathway Pleiotropy Index.  Abscissic acid Gibberellic acid Brassinosteroid Lutein  τ p τ p τ p τ p Arabidopsis 0.38 0.114 **0.53 0.047 **0.61 0.007 0.11 0.646 Populus **0.45 0.012 **0.50 0.017 *0.37 0.039 0.24 0.214 Ricinus **0.55 0.002 **0.47 0.023 0.21 0.236 *0.39 0.041 Vitis 0.30 0.109 **0.53 0.020 0.32 0.081 0.25 0.207 *p < 0.05.  **p < 0.05 after removal of highest dN/dS value in downstream genes.   31 Figure 2.1.  Plant terpenoid synthesis.  Early enzymes are involved in producing a wider array of metabolites and directly participate in a wider array of phenotypic functions than the downstream enzymes do.  Arrows represent groups of enzymes that convert one metabolite to another (only metabolites that exist at pathway branchpoints or endpoints are noted).  Italics denote some functional roles of the various metabolites.  Numbers indicate values of the Pathway Pleiotropy Index (see Methods).              Figure 2.2.  The phylogenetic relationships of the taxa used in this study.  Bold branches are the lineages along which dN/dS was estimated.      pyruvate glucose farnesyl-PP carotenoids campesterol xanthophyll cycle abscissic acid Ent-Kaur- 16-ene gibberellic acid brassinosteroid 1 2 3 4 3 4 5 3 4 lutein 4 } Synthesis of fatty acids, amino acids, nucleic acids, etc.Precursor for other terpenoid products Fruit/flower pigments, light harvesting Diterpenoid phytoalexins Shoot/internode elongation Cell elongation, vascular differentiation, pollen tube growth, senescence Seed maturation/dormancy, water-stress response Non-essential role in light harvesting… defense Membrane constituent Protection from excess light  VitisOryza Arabidopsis Ricinus Populus  32 Figure 2.3.  Graphs of dN/dS for Populus.  The relationship between dN/dS and pathway position (a-d), and between dN/dS and the Pathway Pleiotropy Index (e-h), for Populus in four branches of terpenoid synthesis.  Trend lines are given as a visual aid, and were not used to assess the strength of these relationships.  **Correlation is significant and robust to removal of the highest dN/dS value.  *Correlation is significant but not robust to removal of the highest dN/dS value.  Kendall’s τ rank correlation coefficients and p-values are given in Tables 2.1 and 2.2.  a) Abscissic Acid** pathway position 0 5 10 15 20 d N / d S 0.00 0.05 0.10 0.15 0.20 b) Gibberellic Acid** pathway position 0 2 4 6 8 10 12 14 16 0.00 0.05 0.10 0.15 0.20 0.25 0.30 e) Abscissic Acid** pathway pleiotropy index 0 1 2 3 4 5 6 d N / d S 0.00 0.05 0.10 0.15 0.20 f) Gibberellic Acid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 0.30 g) Brassinosteroid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 0.30 d) Lutein pathway position 0 2 4 6 8 10 12 14 16 18 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 c) Brassionsteroid* pathway position 0 5 10 15 20 25 0.00 0.05 0.10 0.15 0.20 0.25 0.30 h) Lutein pathway pleiotropy index 0 1 2 3 4 5 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20  33 References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402.  Brunet FG, Crollius HR, Paris M, Aury JM, Gibert P, Jaillon O, Laudet V, Robinson-Rechavi M. 2006. Gene Loss and Evolutionary Rates Following Whole-Genome Duplication in Teleost Fishes. Mol Biol Evol. 23: 1808-1816.  Buchanan BB, Gruissem W, Jones RL. 2000. Biochemistry and molecular biology of plants. Rockville (MD): American Society of Plant Physiologists.  Cheng AX, Lou YG, Mao YB, Lu S, Wang LJ, Chen XY. 2007. Plant terpenoids: biosynthesis and ecological functions. J Integr Plant Biol. 49: 179-186.  Church S, Livingstone K, Lai Z, Kozik A, Knapp S, Michelmore R, Rieseberg L. 2007. Using variable rate models to identify genes under selection in sequence pairs: their validity and limitations for EST sequences. J Mol Evol. 64: 171-180.  Clouse SD, Sasse JM. 1998. Brassionsteroids: essential regulators of plant growth and development. Annu Rev Plant Phys. 49: 427-451.  Cork J, Purugganan M. 2004. The evolution of molecular genetic pathways and networks. BioEssays. 26: 479-484.  Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32: 1792-1797.  Fraser H, Wall D, Hirsh A. 2003. A simple dependence between protein evolution rate and the number of protein-protein interactions. BMC Evol Biol. 3: 11.  Fraser HB, Hirsh AE, Steinmetz LM, Scharfe C, Feldman MW. 2002. Evolutionary rate in the protein interaction network. Science. 296: 750-752.  Goldman N, Yang Z. 1994. A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol Biol Evol. 11: 725-736.  Grennan AK. 2006. Gibberellin metabolism enzymes in rice. Plant Physiol. 141: 524-526.  Guindon S, Gascuel O. 2003. A simple fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 52: 696-704.  Hahn MW, Conant GC, Wagner A. 2004. Molecular evolution in large genetic networks: does connectivity equal constraint? J Mol Evol. 58: 203-211.  Harbourne J. The flavonoids. 1988. London: Chapman and Hall.   34 Hedden P, Phillips AL. 2000. Gibberellin metabolism: new insights revealed by the genes. Trends Plant Sci. 5: 523-530.  Heldt HW, Heldt F. 2005. Plant biochemistry. Boston: Elsevier Academic Press.  Hoekstra HE, Coyne JA. 2007. The locus of evolution: evo devo and the genetics of adaptation. Evolution. 61: 995-1016.  Hughes MK, Hughes AL. 1993. Evolution of duplicate genes in a tetraploid animal Xenopus laevis. Mol Biol Evol. 10: 1360-1369.  Jeong H, Tombor B, Albert R, Oltvai ZN, Barabasi AL. 2000. The large-scale organization of metabolic networks. Nature. 407: 651-654.  Jordan IK, Marino-Ramirez L, Wolf YI, Koonin EV. 2004. Conservation and coevolution in the scale-free human gene coexpression network. Mol Biol Evol. 21: 2058-2070.  Jordan IK, Wolf Y, Koonin E. 2003. Correction: No simple dependence between protein evolution rate and the number of protein-protein interactions: only the most prolific interactors tend to evolve slowly. BMC Evol Biol. 3: 5.  Jordan IK, Wolf Y, Koonin E. 2003. No simple dependence between protein evolution rate and the number of protein-protein interactions: only the most prolific interactors tend to evolve slowly. BMC Evol Biol. 3: 1.  KEGG PATHWAY database [Internet]. 2008. Kyoto: Kyoto University Bioinformatics Centre (Japan); [last updated 2008 Oct 1; cited 2008 Oct 23]. Available from: http://www.genome.jp/kegg/pathway.html.  Kitami T, Nadeau JH. 2002. Biochemical networking contributes more to genetic buffering in human and mouse metabolic pathways than does gene duplication. Nat Genet. 32: 191- 194.  Liu Y, Wang H, Ye, HC, Li GF. 2005. Advances in the plant isoprenoid biosynthesis pathway and its metabolic engineering. J Integr Plant Biol. 47: 769-782.  Lu YQ, Rausher MD. 2003. Evolutionary rate variation in anthocyanin pathway genes. Mol Biol Evol. 20: 1844-1853.  Lynch M, Conery JS. 2000. The evolutionary fate and consequences of duplicate genes. Science. 290: 1151-1155.  Lynch M. 2006. The origins of eukaryotic gene structure. Mol Biol Evol. 23: 450-468.  Lynch M. 2007. The origins of genome architecture. Sunderland, MA: Sinauer Associates.  Makino T, Suzuki Y, Gojobori T. 2006. Differential evolutionary rates of duplicated genes in protein interaction network. Gene. 385: 57-63.   35 Naik PS, Chanemougasoundharam A, Khurana SMP, Kalloo G. 2003. Genetic manipulation of carotenoid pathway in higher plants. Curr Sci India. 85: 1423-1430.  Nambara E, Marion-Poll A. 2005. Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol. 56: 165-185.  Otto SP. Two steps forward one step back: the pleiotropic effects of favoured alleles. P Roy Soc B-Biol Sci. 271: 705-714.  Plaxton WC. 1996. The organization and regulation of plant glycolysis. Annu Rev Plant Phys. 47: 185-214.  Pogson B, McDonald KA, Truong M, Britton G, DellaPenna D. 1996. Arabidopsis carotenoid mutants demonstrate that lutein is not essential for photosynthesis in higher plants. Plant Cell. 8: 1627-1639.  Poptsova M, Gogarten JP. 2007. BranchClust: a phylogenetic algorithm for selecting gene families. BMC Bioinformatics. 8: 120.  Ramos-Onsins SE, Puerma E, Balañá-Alcaide, Salguero D, Aguadé M. 2008. Multilocus analysis of variation using a large empirical data set: phenylpropanoid pathway genes in Arabidopsis thaliana. Mol Ecol. 17: 1211-1223.  Rausher M.D, Miller RE, Tiffin P. 1999. Patterns of evolutionary rate variation among genes of the anthocyanin biosynthetic pathway. Mol Biol Evol. 16: 266-274.  Rausher MD, Lu YQ, Meyer K. 2008. Variation in constraint versus positive selection as an explanation for evolutionary rate variation among anthocyanin genes. J Mol Evol. 67: 137-144.  Rodríguez-Concepción M, Boronat A. 2002. Elucidation of the methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. A metabolic milestone achieved through genomics. Plant Physiol. 130: 1079-1089.  Sakamoto T, Miura K, Itoh H, et al. (9 co-authors). 2004. An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol. 134: 1642- 1653.  Sharkey TD, Yeh S, Wiberley AE, Falbel TG, Gong DM, Fernandez DE. 2005. Evolution of the isoprene biosynthetic pathway in Kudzu. Plant Physiol. 137: 700-712.  Soltis P, Soltis D, Edwards C. 2005. Angiosperms. Flowering Plants [Internet]. The Tree of Life Web Project; [last updated 2005 June 3, cited 2008 Oct 24]. Available from: http://tolweb.org/Angiosperms/20646/2005.06.03.  Szekeres M, Koncz C. 1998. Biochemical and genetic analysis of brassinosteroid metabolism and function in Arabidopsis. Plant Physiol Bioch. 36: 145-155.   36 Vitkup D, Kharchenko P, Wagner A. 2006. Influence of metabolic network structure and function on enzyme evolution. Genome Biology. 7: R39.  Wagner A, Fell DA. 2001. The small world inside large metabolic networks. P Roy Soc B-Biol Sci. 268: 1803-1810.  Waxman D, Peck JR. 1998. Pleiotropy and the preservation of perfection. Science. 279: 1210- 1213.  Winkel BSJ. 2006. The biosynthesis of flavonoids. In: Grotewold E, editor. The science of flavonoids. Columbus (OH): Springer. p. 71-96.  Yang Z. 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci. 13: 555-556.  Yang Z. 1998. Likelihood ratio tests for detecting positive selection and application to primate lysozyme evolution. Mol Biol Evol. 15: 568-573.    37 CHAPTER 3: Conclusions  Summary and evaluation of Ramsay et al. The last decade has seen growing interest in the role of gene interaction networks in determining rates of gene/protein evolution.  An early hypothesis was that evolutionary rates would correlate with the metabolic pathway position of enzymes, due to a relaxation of selective constraint along metabolic pathways (Rausher et al. 1999).  This effect, called positional rate variation, was until recently proven only by studies of three to six enzymes from the anthocyanin pathway in plants (Rausher et al. 1999, Lu and Rausher 2003, Rausher et al. 2008).  Ramsay et al., however, have shown that statistically significant positional rate variation also exists in plant terpenoid synthesis.  This study, presented as Chapter 2 of this thesis, examined dN/dS values for 45 genes along four branches of terpenoid synthesis, based on phylogenetic orthologs of four ingroup and one outgroup species.  Ramsay et al. found that dN/dS was correlated with pathway position, and also with a new metric called the Pathway Pleiotropy Index, which they showed to be superior to pathway position for capturing effects of enzyme order on evolutionary rates. Tests for codon-specific selection did not detect any positive selection, supporting the idea that these trends are in fact driven by relaxation of selective constraint downstream.  Further, gene copy number did not drive results. The research by Ramsay et al. is both creative and methodologically sound.  First, the Pathway Pleiotropy Index is a novel suggestion for understanding evolutionary rate variation in pathways, based on an understanding of the theoretical relationship between pathway structure and pleiotropy, predicted from first principles.  Second, Ramsay et al. practiced sound methodology by their use of phylogenetic ortholog determination, by explicitly testing for significant variation in dN/dS, and by testing the robustness of correlations to the removal of extreme values.  Also, the use of four pathway branches, numerous genes, and five species allows Ramsay et al. to make generalizable statements about positional rate variation.  These strengths all distinguish Ramsay et al. as one of only three independent studies of positional rate variation (others being Rausher et al. 1999, Lu and Rausher 2003, Ramos-Onsins et al. 2008, Rausher et al. 2008). Ramsay et al. is not without faults.  The data set was not large enough to justify a full statistical analysis of the role of gene copy number on evolutionary rates.  Also, two of the species used, Vitis vinifera and Arabidopsis thaliana, lie on very long branches relative the other  38 ingroup species.  Along these long branches, several data points had to be discarded because synonymous substitutions had reached saturation. While Ramsay et al. examine a far larger number of genes than previous studies, not every relevant enzyme was considered.  All heteromeric genes involved in glycolysis were excluded, and of the two parallel paths in terpenoid synthesis (MEP and MVA; see Buchanan et al. 2000) only the MEP pathway was adequately represented.  Since metabolites can be exchanged between these plastidial versus cytosolic compartments (Cheng et al. 2007), I assume that the lack of MVA pathway genes is not a serious problem. One final weakness is that substitution rates are only one aspect of evolutionary lability. This weakness should not be overstated, since studies of molecular evolution commonly focus on substitution rates.  With the advent of new methods that do provide estimates of indel rates (e.g., Lunter 2007), future studies may incorporate this additional aspect of molecular evolution.  I predict that downstream genes will have higher rates of indel incorporation, as well as higher dN/dS.  Comparison of correlations among studies. Ramsay et al. did not assess how strong the effects on pathway position are relative other known effects on evolutionary rates of proteins.  Table 3.1 provides correlation coefficients for evolutionary rate with various variables.  All studies except Ramsay et al. and Ingvarsson 2007 were performed in yeast.  Direct comparison of Kendall's τ values from Ramsay et al. to correlation coefficients from other studies are challenging both because it is difficult to directly compare different measures of correlation, and because the other studies are based on fuller networks and larger numbers of genes.  However, a few comments can be made: first, all correlations except for those of dN/dS with expression level are less than 0.5, suggesting that all three network properties (Pathway Pleiotropy Index, connectivity, and flux) have real but moderate effects on gene evolution, leaving much rate variation unexplained.  The strongest rank correlations for PPI do reach 0.54, but it is unlikely that such a high value would be found over the whole metabolic network.  It can be noted, however, that flux does produce stronger correlations than either metabolic connectivity or number of protein-protein interactors. The relative importance of pathway position for determining evolutionary rate awaits further study.  The analyses published to date do not allow us to discern whether effects of pathway position and connectivity are truly weaker than correlations with expression level, or  39 whether earlier studies did not properly control for confounding variables (e.g., see Bertin et al. 2007 for an attempt to account for different types of highly connected nodes).  Also, none of these studies has analyzed the true total network.  Studies of metabolic networks, for example, often focus on a core metabolism.  Thus, they may be restricted to a set of genes that is too similarly pleiotropic to indicate the true range of rate variation across the whole network.  Context and significance of Ramsay et al. The work of Ramsay et al. joins a growing body of literature on evolutionary systems biology, a recent trend in research.  Like many new fields, there is now enough data to suggest real patterns, but not enough to resolve certain controversies (Koonin 2005).  Current data confirms that gene interaction networks are typically scale-free, with a few highly-connected nodes acting as hubs of the network.  Node connectivity, flux and position all affect evolutionary rate in metabolic networks, as for connectivity in protein-protein interaction and gene coexpression networks (see chapter 1 for a review of this research).  It is yet unresolved how strong these effects are relative one another and relative other known effects on evolutionary rate.  It also remains unknown whether effects such as expression level and dispensability are independent of, or arise from, effects of network structure.  Relatively weak correlations of evolutionary rate with network properties suggest that they may not be the primary effect on evolutionary rate variation (if one primary effect exists), but that they certainly play a role in explaining why genes evolve at different rates. Within the published literature, the role of position within the network is little explored. While a few studies examine centrality, not many address the position of enzymes along pathways through the metabolic network.  If published, the work of Ramsay et al. will be the first study to empirically establish positional rate variation as a plausible reality for the metabolic network as a whole.  (At the time of writing, a manuscript essentially identical to Chapter 2 is in submission to Molecular Biology and Evolution).  Future directions Evolutionary systems biology has been born of the genomic era (Medina 2005) and will continue to grow as more genomic and functional data become available.  I propose four important directions for future research.  First, we need computational studies of the theoretical effects of pathway position, node connectivity and clustering coefficient (a measure of  40 modularity in a network) on evolutionary rates.  I know of no such studies so far, but they would be useful for generating null distributions of results to comparison with empirical studies. Second, future research must include empirical whole-network studies comparing measures of centrality to measures of pathway position (including PPI).  This will help to determine whether these are interchangeable concepts, and whether pathway position effects play out over the whole network.  In order to carry out such studies, there is a need to think about what constitutes upstream and whether there are true endproducts at the network level, since "end products" can be degraded to metabolites used in a broad range of biosynthetic reactions.  At present, Drosophila, bacteria and yeast have the best resources for such studies, with whole genome sequences for many closely related species (Medina 2005), plus well-understood metabolic networks.  However, studies of network effects on evolutionary rate variation have relied almost exclusively on yeast; to make general statements on molecular evolution, research must necessarily move beyond Saccharomyces. Third, future research must include population-level studies, alongside interspecies comparisons.  In the coming age of population genomics, it will be possible to empirically examine the interplay of demographic and network effects on gene evolution.  Finally, future studies must integrate metabolic flux information with measures of connectivity and position to explain rate variation.  Topology is but one aspect of network behavior, and flux through the network is also important for shaping selective pressures (Vitkup et al. 2006, Flowers et al. 2007).  By simultaneously examining several network properties, future research can begin to disentangle the roles of each property in shaping gene evolution.  In closing, Ramsay et al. have put pathway position forward as one of many network properties worthy of future study.  It remains for future researchers to understand the true links of genome, network and phenotype in the course of evolution.   41 Table 3.1.  Correlation values for measures of evolutionary rate with measures of connectivity, flux and gene expression. Variables Correlation Measure Source PPI vs. dN/dS 0.24-0.54 Kendall's τ Ramsay et al. metabolic connectivity vs. Ka/Ks -0.2 Spearman rank correlation r Vitkup et al. 2006 metabolic connectivity vs. Ka/Ks -0.18 Pearson's correlation r Vitkup et al. 2006 metabolic flux vs. Ka/Ks -0.3 Spearman rank correlation r Vitkup et al. 2006 metabolic flux vs. Ka/Ks -0.24 Pearson's correlation r Vitkup et al. 2006 protein-protein interactors vs. protein substitution rate -0.24 Spearman rank correlation r Fraser et al. 2003 expression level vs. dN 0.28 r2 Drummond et al. 2005 expression breadth* vs. dN/dS -0.877 Spearman rank correlation r Ingvarsson 2007 *Number of tissues in which a gene is expressed  42 References Bertin N, Simonis N, Dupuy D, Cusick ME, Han JDJ, Fraser HB, Roth FP, Vidal M. 2007. Confirmation of organized modularity in the yeast interactome. P Roy Soc B-Biol Sci. 5: e153.  Buchanan BB, Gruissem W, Jones RL. 2000. Biochemistry and molecular biology of plants. Rockville (MD): American Society of Plant Physiologists.  Cheng AX, Lou YG, Mao YB, Lu S, Wang LJ, Chen XY. 2007. Plant terpenoids: biosynthesis and ecological functions. J Integr Plant Biol. 49: 179-186.  Drummond DA, Bloom JD, Adami C, Wilke CO, Arnold FH. 2005. Why highly expressed proteins evolve slowly. P Natl Acad Sci USA. 102: 14338-14343.  Flowers JM, Sezgin E, Kumegai S, Duvernell DD, Matzkin LM, Schmidt PS, Eanes WF. 2007. Adaptive evolution of metabolic pathways in Drosophila. Mol Biol Evol. 24: 1347-1354.  Ingvarsson PK. 2007. Gene expression and protein length influence codon usage and rates of sequence evolution in Populus tremula. Mol Biol Evol. 24:836-844.  Koonin EV. 2005. Systemic determinants of gene evolution and function. Mol Syst Biol 1: 2005.0021.  Lu YQ, Rausher MD. 2003. Evolutionary rate variation in anthocyanin pathway genes. Mol Biol Evol. 20: 1844-1853.  Lunter G. 2007. Probabilistic whole-genome alignments reveal high indel rates in the human and mouse genomes. Bioinformatics 23: i289-296.  Medina M. 2005. Genomes, phylogeny, and evolutionary systems biology. P Natl Acad Sci USA. 102: 6630-6635.  Ramos-Onsins SE, Puerma E, Balañá-Alcaide, Salguero D, Aguadé M. 2008. Multilocus analysis of variation using a large empirical data set: phenylpropanoid pathway genes in Arabidopsis thaliana. Mol Ecol. 17: 1211-1223.  Rausher M.D, Miller RE, Tiffin P. 1999. Patterns of evolutionary rate variation among genes of the anthocyanin biosynthetic pathway. Mol Biol Evol. 16: 266-274.  Rausher MD, Lu YQ, Meyer K. 2008. Variation in constraint versus positive selection as an explanation for evolutionary rate variation among anthocyanin genes. J Mol Evol. 67: 137-144.  Vitkup D, Kharchenko P, Wagner A. 2006. Influence of metabolic network structure and function on enzyme evolution. Genome Biology. 7: R39.  43 Appendix 1.  Arabidopsis loci used as queries in ortholog determination (see chapter 2) Name or EC number Query locus Name or EC number Query locus 1.1.1.267 AT5G62790  5.3.3.2 AT3G02780 1.14.11.12 AT4G25420  5.3.3.2 AT3G02780 1.14.11.12 AT5G07200  5.4.99.8 AT1G78960 1.14.11.12 AT5G51810  5.4.99.8 AT2G07050 1.14.11.13 AT1G78440  5.4.99.8 AT3G45130 1.14.11.13 AT2G34555  5.4.99.8 AT4G15340 1.14.11.15 AT1G15550  5.4.99.8 AT5G36150 1.14.13.78 AT5G25900  5.4.99.8 AT5G42600 1.14.13.79 AT2G32440  5.5.1.9 AT5G50375 1.14.13.93 AT2G29090  AAO3 AT2G27150 1.14.13.93 AT3G19270  ABA2 AT1G52340 1.14.13.93 AT4G19230  Br6ox AT3G30180 1.14.13.93 AT5G45340  Br6ox AT5G38970 1.14.99.7 AT1G58440  Cpd AT5G05690 1.14.99.7 AT1G58440  CrtB AT5G17230 1.14.99.7 AT5G24140  CrtISO AT1G06820 1.14.99.7 AT5G24140  CrtL-b AT3G10230 1.14.99.7 AT5G24160  CrtL-e AT5G57030 1.14.99.7 AT5G24160  CrtR-b AT4G25700 1.17.1.2 AT4G34350  CrtR-b AT5G52570 2.2.1.7 AT3G21500  CYP51G1 AT1G11680 2.2.1.7 AT4G15560  Det2 AT2G38050 2.2.1.7 AT5G11380  DWF1 AT3G19820 2.5.1.10 AT2G18620  Dwf4 AT3G50660 2.5.1.10 AT2G18620  DWF5 AT1G50430 2.5.1.10 AT3G14530  FK AT3G52940 2.5.1.10 AT3G14530  HYD1 AT1G20050 2.5.1.10 AT3G14550  LUT1 AT3G53130 2.5.1.10 AT3G14550  NCED AT1G30100 2.5.1.10 AT3G20160  NCED AT1G78390 2.5.1.10 AT3G20160  NCED AT3G14440 2.5.1.10 AT3G29430  NCED AT3G24220 2.5.1.10 AT3G29430  NCED AT4G18350 2.5.1.10 AT3G32040  PDS AT4G14210 2.5.1.10 AT3G32040  SMT1 AT5G13710 2.5.1.10 AT5G47770  STE1 AT3G02580 2.5.1.21 AT4G34650  Vde AT1G08550 2.5.1.21 AT4G34650  ZDS AT3G04870 2.7.1.48 AT2G26930  Zep AT5G67030 4.2.3.19 AT1G79460   44 Appendix 2.  Orthologs used to estimate dN/dS Appendix 2.1.  Arabidopsis orthologs Pathway Segment Gene Name or EC Number Locus Identity glucose – pyuvate 4.1.2.13 AT2G01140.1 glucose – pyuvate 2.7.2.3 AT3G12780.1 glucose – pyuvate 5.3.1.9p AT4G24620.1 glucose – pyuvate 5.3.1.9c AT5G42740.1 glucose – pyuvate 5.4.2.2 AT5G51820.1 pyuvate – fanesyl-PP 2.5.1.10 AT2G18620.1 pyuvate – fanesyl-PP 2.7.1.148 AT2G26930.1 pyuvate – fanesyl-PP 5.3.3.2 AT3G02780.1 pyuvate – fanesyl-PP 2.2.1.7 AT4G15560.1 pyuvate – fanesyl-PP 1.17.1.2 AT4G34350.1 pyuvate – fanesyl-PP 1.1.1.267 AT5G62790.1 fanesyl-PP - campesteol CYP51G1 AT1G11680.1 fanesyl-PP - campesteol HYD1 AT1G20050.1 fanesyl-PP - campesteol DWF5 AT1G50430.1 fanesyl-PP - campesteol 1.14.99.7 AT1G58440.1 fanesyl-PP - campesteol 5.4.99.8 AT2G07050.1 fanesyl-PP - campesteol STE1 AT3G02580.1 fanesyl-PP - campesteol DWF1 AT3G19820.1 fanesyl-PP - campesteol 2.5.1.21 AT4G34640.1 fanesyl-PP - campesteol SMT1 AT5G13710.1 fanesyl-PP - campesteol 5.5.1.9 AT5G50375.1 fanesyl-PP - caotenoids CtISO AT1G06820.1 fanesyl-PP - caotenoids ZDS AT3G04870.1 fanesyl-PP - caotenoids CtL-b AT3G10230.1 fanesyl-PP - caotenoids PDS AT4G14210.2 fanesyl-PP - caotenoids CtB AT5G17230.1 fanesyl-PP - caotenoids Ct-b AT5G52570.1 fanesyl-PP - ent-kau-16-ene 4.2.3.19 AT1G79460.1 fanesyl-PP - ent-kau-16-ene 5.5.1.13 AT4G02780.1 campesteol - steoid Det2 AT2G38050.1 campesteol - steoid Dwf4 AT3G50660.1 campesteol - steoid Cpd AT5G05690.1 campesteol - steoid B6ox AT5G38970.1 caotenoids - xanthophyll cycle Vde AT1G08550.2 caotenoids - xanthophyll cycle Zep AT5G67030.1 caotenoids - lutein LUT1 AT3G53130.1 ent-kau-16-ene - gibbeellic acid 1.14.11.15 AT1G15550.1 ent-kau-16-ene - gibbeellic acid 1.14.13.79 AT2G32440.1 ent-kau-16-ene - gibbeellic acid 1.14.11.13 AT2G34555.1 ent-kau-16-ene - gibbeellic acid 1.14.11.12 AT5G07200.1 ent-kau-16-ene - gibbeellic acid 1.14.13.78 AT5G25900.1 xanthophyll cycle - abscissic ABA2 AT1G52340.1  45 acid xanthophyll cycle - abscissic acid AAO3 AT2G27150.1 xanthophyll cycle - abscissic acid NCED AT3G24220.1 xanthophyll cycle - abscissic acid 1.14.13.93 AT5G45340.1  Appendix 2.2.  Oryza orthologs Pathway Segment Gene Name or EC Number Locus Identity glucose – pyuvate 4.1.2.13 Os01g02880.1|12001.m06927 glucose – pyuvate 2.7.2.3 Os05g41640.2|12005.m08338 glucose – pyuvate 5.3.1.9c Os06g14510.3|12006.m091669 glucose – pyuvate 5.3.1.9p Os09g29070.1|12009.m06058 glucose – pyuvate 5.4.2.2 Os10g11140.1|12010.m04443 pyuvate - fanesyl-PP 1.1.1.267 Os01g01710.1|12001.m06815 pyuvate - fanesyl-PP 2.7.1.148 Os01g58790.1|12001.m12021 pyuvate - fanesyl-PP 1.17.1.2 Os03g52170.1|12003.m10194 pyuvate - fanesyl-PP 2.2.1.7 Os05g33840.1|12005.m07616 pyuvate - fanesyl-PP 5.3.3.2 Os07g36190.1|12007.m07872 pyuvate - fanesyl-PP 2.5.1.10 Os07g39270.1|12007.m08169 fanesyl-PP - campesteol HYD1 Os01g01369.1|12001.m150882 fanesyl-PP - campesteol STE1 Os01g04260.1|12001.m07061 fanesyl-PP - campesteol 5.4.99.8 Os02g04710.2|12002.m33547 fanesyl-PP - campesteol DWF5 Os02g26650.1|12002.m07808 fanesyl-PP - campesteol 1.14.99.7 Os03g12910.1|12003.m06738 fanesyl-PP - campesteol 2.5.1.21 Os03g59040.1|12003.m10805 fanesyl-PP - campesteol SMT1 Os07g10600.2|12007.m28956 fanesyl-PP - campesteol DWF1 Os10g25780.1|12010.m065197 fanesyl-PP - campesteol 5.5.1.9 Os11g19700.1|12011.m06045 fanesyl-PP - campesteol CYP51G1 Os11g32240.1|12011.m07126 fanesyl-PP - caotenoids CtL-b Os02g09750.1|12002.m06272 fanesyl-PP - caotenoids Ct-b Os03g03370.1|12003.m05872 fanesyl-PP - caotenoids PDS Os03g08570.1|12003.m06365 fanesyl-PP - caotenoids CtB Os06g51290.3|12006.m31942 fanesyl-PP - caotenoids ZDS Os07g10490.1|12007.m05504 fanesyl-PP - caotenoids CtISO Os11g36440.1|12011.m07496 fanesyl-PP - ent-kau-16-ene 5.5.1.13 Os02g17780.1|12002.m07022 fanesyl-PP - ent-kau-16-ene 4.2.3.19 Os04g52210.1|12004.m10116 campesteol - steoid Det2 Os01g63260.1|12001.m12442 campesteol - steoid Dwf4 Os03g12660.1|12003.m06715 campesteol - steoid B6ox Os03g40540.1|12003.m09132 campesteol - steoid Cpd Os12g04480.1|12012.m04442 caotenoids - xanthophyll cycle Vde Os04g31040.3|12004.m35285 caotenoids - xanthophyll cycle Zep Os04g37619.1|12004.m08750  46 caotenoids - lutein LUT1 Os10g39930.2|12010.m065331 ent-kau-16-ene - gibbeellic acid 1.14.11.15 Os01g08220.1|12001.m07447 ent-kau-16-ene - gibbeellic acid 1.14.11.13 Os01g55240.1|12001.m11683 ent-kau-16-ene - gibbeellic acid 1.14.11.12 Os03g63970.1|12003.m11264 ent-kau-16-ene - gibbeellic acid 1.14.13.79 Os06g02019.1|12006.m04938 ent-kau-16-ene - gibbeellic acid 1.14.13.78 Os06g37330.1|12006.m08268 xanthophyll cycle - abscissic acid 1.14.13.93 Os02g47470.1|12002.m33831 xanthophyll cycle - abscissic acid NCED Os03g44380.1|12003.m09477 xanthophyll cycle - abscissic acid AAO3 Os03g57680.1|12003.m10682 xanthophyll cycle - abscissic acid ABA2 Os03g59610.1|12003.m10858  Appendix 2.3.  Populus orthologs Pathway Segment Gene Name or EC Number Locus Identity glucose – pyuvate 5.3.1.9p 411695|gw1.II.3030.1 glucose – pyuvate 5.3.1.9c 421146|gw1.VIII.2574.1 glucose – pyuvate 5.4.2.2 824892|estExt_fgenesh4_pg.C_LG_XV1054 glucose – pyuvate 4.1.2.13 832739|estExt_fgenesh4_pm.C_LG_VIII0532 glucose – pyuvate 2.7.2.3 833719|estExt_fgenesh4_pm.C_LG_X0655 pyuvate - fanesyl-PP 2.7.1.148 181114|gw1.I.9714.1 pyuvate - fanesyl-PP 1.17.1.2 557296|eugene3.00090556 pyuvate - fanesyl-PP 1.1.1.267 728585|estExt_Genewise1_v1.C_LG_XII0355 pyuvate - fanesyl-PP 2.5.1.10 741258|estExt_Genewise1_v1.C_570227 pyuvate - fanesyl-PP 2.2.1.7 766757|fgenesh4_pg.C_LG_VIII001771 pyuvate - fanesyl-PP 5.3.3.2 809590|fgenesh4_pm.C_LG_XIX000155 fanesyl-PP – campesteol SMT1 202903|gw1.IX.3368.1 fanesyl-PP – campesteol 5.5.1.9 252617|gw1.XV.2053.1 fanesyl-PP – campesteol HYD1 554665|eugene3.00031298 fanesyl-PP – campesteol CYP51G1 554675|eugene3.00031308 fanesyl-PP – campesteol DWF1 564011|eugene3.00080606 fanesyl-PP – campesteol 5.4.99.8 717351|estExt_Genewise1_v1.C_LG_VI1514 fanesyl-PP – campesteol 2.5.1.21 818128|estExt_fgenesh4_pg.C_LG_IV1345 fanesyl-PP – campesteol STE1 831136|estExt_fgenesh4_pm.C_LG_IV0218 fanesyl-PP – campesteol 1.14.99.7 831444|estExt_fgenesh4_pm.C_LG_V0246 fanesyl-PP – campesteol DWF5 833904|estExt_fgenesh4_pm.C_LG_X0950 fanesyl-PP – caotenoids PDS 246440|gw1.XIV.3183.1 fanesyl-PP – caotenoids CtISO 256155|gw1.XVI.2094.1 fanesyl-PP – caotenoids CtB 289129|gw1.44.342.1 fanesyl-PP – caotenoids CtL-b 652630|grail3.0024027901 fanesyl-PP – caotenoids Ct-b 826998|estExt_fgenesh4_pg.C_440224 fanesyl-PP – caotenoids ZDS 836745|estExt_fgenesh4_pm.C_700037 fanesyl-PP - ent-kau-16-ene 4.2.3.19 564162|eugene3.00080757  47 fanesyl-PP - ent-kau-16-ene 5.5.1.13 761211|fgenesh4_pg.C_LG_V001263 campesteol – steoid Det2 576916|eugene3.00161051 campesteol – steoid B6ox 745693|estExt_Genewise1_v1.C.1|550060 campesteol – steoid Dwf4 820024|estExt_fgenesh4_pg.C_LG_VII1057 campesteol – steoid Cpd 820409|estExt_fgenesh4_pg.C_LG_VIII0571 caotenoids - xanthophyll cycle Vde 729935|estExt_Genewise1_v1.C_LG_XIII1884 caotenoids - xanthophyll cycle Zep 760467|fgenesh4_pg.C_LG_V000519 caotenoids – lutein LUT1 589522|eugene3.00280258 ent-kau-16-ene - gibbeellic acid 1.14.13.78 412545|gw1.II.3|880.1| ent-kau-16-ene - gibbeellic acid 1.14.11.15 756811|fgenesh4_pg.C_LG_III000353 ent-kau-16-ene - gibbeellic acid 1.14.11.13 758699|fgenesh4_pg.C_LG_IV000327 ent-kau-16-ene - gibbeellic acid 1.14.11.12 824891|estExt_fgenesh4_pg.C_LG_XV1053 ent-kau-16-ene - gibbeellic acid 1.14.13.79 835007|estExt_fgenesh4_pm.C_LG_XIV0527 xanthophyll cycle - abscissic acid ABA2 547844|eugene3.00010285 xanthophyll cycle - abscissic acid NCED 757941|fgenesh4_pg.C_LG_III001483 xanthophyll cycle - abscissic acid AAO3 767106|fgenesh4_pg.C_LG_IX000157 xanthophyll cycle - abscissic acid 1.14.13.93 783291|fgenesh4_pg.C_scaffold_86000151  Appendix 2.4.  Ricinus orthologs Pathway Segment Gene Name or EC Number Locus Identity glucose – pyuvate 4.1.2.13 29660.m000779 glucose – pyuvate 5.3.1.9p 29908.m006236 glucose – pyuvate 5.4.2.2 30147.m014138 glucose – pyuvate 2.7.2.3 30169.m006297 glucose – pyuvate 5.3.1.9c 30170.m014025 pyuvate - fanesyl-PP 2.5.1.10 29646.m001058 pyuvate - fanesyl-PP 2.2.1.7 29726.m003963 pyuvate - fanesyl-PP 2.7.1.148 29785.m000940 pyuvate - fanesyl-PP 1.17.1.2 29851.m002455 pyuvate - fanesyl-PP 5.3.3.2 29929.m004583 pyuvate - fanesyl-PP 1.1.1.267 30147.m013949 fanesyl-PP – campesteol 5.4.99.8 29667.m000347 fanesyl-PP – campesteol SMT1 29864.m001470 fanesyl-PP – campesteol DWF1 30100.m000783 fanesyl-PP – campesteol CYP51G1 30128.m008568 fanesyl-PP – campesteol HYD1 30128.m008583 fanesyl-PP – campesteol 2.5.1.21 30131.m007117 fanesyl-PP – campesteol 5.5.1.9 30147.m014529 fanesyl-PP – campesteol DWF5 30169.m006262 fanesyl-PP – campesteol 1.14.99.7 30170.m013663 fanesyl-PP – campesteol STE1 30205.m001612  48 fanesyl-PP – caotenoids CtB 28611.m000105 fanesyl-PP – caotenoids CtISO 29333.m001086 fanesyl-PP – caotenoids CtL-b 29941.m000224 fanesyl-PP – caotenoids PDS 30065.m001161 fanesyl-PP – caotenoids ZDS 30128.m008623 fanesyl-PP – caotenoids Ct-b 30169.m006624 fanesyl-PP - ent-kau-16-ene 4.2.3.19 28670.m000104 fanesyl-PP - ent-kau-16-ene 5.5.1.13 29647.m002075 campesteol – steoid Det2 27798.m000584 campesteol – steoid Cpd 29188.m000051 campesteol – steoid Dwf4 29634.m002158 campesteol – steoid B6ox 29790.m000806 caotenoids - xanthophyll cycle Vde 29950.m001179 caotenoids - xanthophyll cycle Zep 30115.m001209 caotenoids – lutein LUT1 30078.m002224 ent-kau-16-ene - gibbeellic acid 1.14.11.13 29693.m002012 ent-kau-16-ene - gibbeellic acid 1.14.13.79 29709.m001228 ent-kau-16-ene - gibbeellic acid 1.14.11.15 29841.m002759 ent-kau-16-ene - gibbeellic acid 1.14.11.12 30147.m014140 ent-kau-16-ene - gibbeellic acid 1.14.13.78 30170.m013942 xanthophyll cycle - abscissic acid ABA2 29588.m000888 xanthophyll cycle - abscissic acid 1.14.13.93 29801.m003223 xanthophyll cycle - abscissic acid AAO3 29854.m001100 xanthophyll cycle - abscissic acid NCED 29904.m002987  Appendix 2.5.  Vitis orthologs Pathway Segment Gene Name or EC Number Locus Identity glucose – pyuvate 5.4.2.2 GSVIVP00010600001 glucose – pyuvate 5.3.1.9c GSVIVP00014624001 glucose – pyuvate 5.3.1.9p GSVIVP00015125001 glucose – pyuvate 4.1.2.13 GSVIVP00030426001 glucose – pyuvate 2.7.2.3 GSVIVP00035675001 pyuvate - fanesyl-PP 1.1.1.267 GSVIVP00016085001 pyuvate - fanesyl-PP 2.7.1.148 GSVIVP00017298001 pyuvate - fanesyl-PP 2.2.1.7 GSVIVP00019845001 pyuvate - fanesyl-PP 2.5.1.10 GSVIVP00025000001 pyuvate - fanesyl-PP 5.3.3.2 GSVIVP00025071001 pyuvate - fanesyl-PP 1.17.1.2 GSVIVP00036436001 fanesyl-PP - campesteol CYP51G1 GSVIVP00001689001 fanesyl-PP - campesteol 1.14.99.7 GSVIVP00015002001 fanesyl-PP - campesteol 5.4.99.8 GSVIVP00016985001  49 fanesyl-PP - campesteol 5.5.1.9 GSVIVP00017916001 fanesyl-PP - campesteol DWF1 GSVIVP00021217001 fanesyl-PP - campesteol HYD1 GSVIVP00024612001 fanesyl-PP - campesteol SMT1 GSVIVP00028748001 fanesyl-PP - campesteol DWF5 GSVIVP00029627001 fanesyl-PP - campesteol 2.5.1.21 GSVIVP00035946001 fanesyl-PP - campesteol STE1 GSVIVP00038254001 fanesyl-PP - caotenoids CtB GSVIVP00023494001 fanesyl-PP - caotenoids CtL-b GSVIVP00025310001 fanesyl-PP - caotenoids CtISO GSVIVP00027139001 fanesyl-PP - caotenoids ZDS GSVIVP00031131001 fanesyl-PP - caotenoids PDS GSVIVP00033980001 fanesyl-PP - caotenoids Ct-b GSVIVP00037718001 fanesyl-PP - ent-kau-16-ene 4.2.3.19 GSVIVP00002095001 fanesyl-PP - ent-kau-16-ene 5.5.1.13 GSVIVP00023723001 campesteol - steoid Det2 GSVIVP00021458001 campesteol - steoid Dwf4 GSVIVP00024952001 campesteol - steoid Cpd GSVIVP00029273001 campesteol - steoid B6ox GSVIVP00038070001 caotenoids - xanthophyll cycle Vde GSVIVP00007662001 caotenoids - xanthophyll cycle Zep GSVIVP00019494001 caotenoids - lutein LUT1 GSVIVP00000577001 ent-kau-16-ene - gibbeellic acid 1.14.11.12 GSVIVP00010598001 ent-kau-16-ene - gibbeellic acid 1.14.13.78 GSVIVP00014740001 ent-kau-16-ene - gibbeellic acid 1.14.13.79 GSVIVP00018965001 ent-kau-16-ene - gibbeellic acid 1.14.11.13 GSVIVP00028281001 ent-kau-16-ene - gibbeellic acid 1.14.11.15 GSVIVP00034482001 xanthophyll cycle - abscissic acid 1.14.13.93 GSVIVP00001184001 xanthophyll cycle - abscissic acid ABA2 GSVIVP00005501001 xanthophyll cycle - abscissic acid AAO3 GSVIVP00017483001 xanthophyll cycle - abscissic acid NCED GSVIVP00020467001   50 Appendix 3.  Graphs of dN/dS for Ricinus The relationship between dN/dS and pathway position (a-d), and between dN/dS and the Pathway Pleiotropy Index (e-h), for Ricinus in four branches of terpenoid synthesis.  Trend lines are given as a visual aid, and were not used to assess the strength of these relationships. **Correlation is significant and robust to removal of the highest dN/dS value.  *Correlation is significant but not robust to removal of the highest dN/dS value.  Kendall’s τ rank correlation coefficients and p-values are given in Tables 2.1 and 2.2.  a) Abscissic Acid** pathway position 0 5 10 15 20 d N / d S 0.00 0.05 0.10 0.15 0.20 0.25 b) Gibberellic Acid** pathway position 0 2 4 6 8 10 12 14 16 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 e) Abscissic Acid** pathway pleiotropy index 0 1 2 3 4 5 6 d N / d S 0.00 0.05 0.10 0.15 0.20 0.25 f) Gibberellic Acid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 g) Brassinosteroid* pathway pleiotropy index 0 1 2 3 4 5 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 d) Lutein pathway position 0 2 4 6 8 10 12 14 16 18 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 c) Brassionsteroid pathway position 0 5 10 15 20 25 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 h) Lutein* pathway pleiotropy index 0 1 2 3 4 5 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18  51 Appendix 4.  Graphs of dN/dS for Arabidopsis The relationship between dN/dS and pathway position (a-d), and between dN/dS and the Pathway Pleiotropy Index (e-h), for Arabidopsis in four branches of terpenoid synthesis.  Trend lines are given as a visual aid, and were not used to assess the strength of these relationships. **Correlation is significant and robust to removal of the highest dN/dS value.  *Correlation is significant but not robust to removal of the highest dN/dS value.  Kendall’s τ rank correlation coefficients and p-values are given in Tables 2.1 and 2.2.  a) Abscissic Acid pathway position 0 5 10 15 20 d N / d S 0.00 0.05 0.10 0.15 0.20 0.25 0.30 b) Gibberellic Acid** pathway position 0 2 4 6 8 10 12 14 16 0.00 0.05 0.10 0.15 0.20 0.25 e) Abscissic Acid pathway pleiotropy index 0 1 2 3 4 5 6 d N / d S 0.00 0.05 0.10 0.15 0.20 0.25 0.30 f) Gibberellic Acid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 g) Brassinosteroid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 d) Lutein pathway position 0 2 4 6 8 10 12 14 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 c) Brassionsteroid* pathway position 0 5 10 15 20 25 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 h) Lutein pathway pleiotropy index 0 1 2 3 4 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16  52 Appendix 5.  Graphs of dN/dS for Vitis The relationship between dN/dS and pathway position (a-d), and between dN/dS and the Pathway Pleiotropy Index (e-h), for Vitis in four branches of terpenoid synthesis.  Trend lines are given as a visual aid, and were not used to assess the strength of these relationships. **Correlation is significant and robust to removal of the highest dN/dS value.  *Correlation is significant but not robust to removal of the highest dN/dS value.  Kendall’s τ rank correlation coefficients and p-values are given in Tables 2.1 and 2.2.  a) Abscissic Acid pathway position 0 5 10 15 20 d N / d S 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 b) Gibberellic Acid* pathway position 0 2 4 6 8 10 12 14 16 0.0 0.1 0.2 0.3 0.4 0.5 e) Abscissic Acid pathway pleiotropy index 0 1 2 3 4 5 6 d N / d S 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 f) Gibberellic Acid** pathway pleiotropy index 0 1 2 3 4 5 0.0 0.1 0.2 0.3 0.4 0.5 g) Brassinosteroid** pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 d) Lutein pathway position 0 2 4 6 8 10 12 14 16 0.00 0.05 0.10 0.15 0.20 0.25 0.30 c) Brassionsteroid* pathway position 0 5 10 15 20 25 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 h) Lutein pathway pleiotropy index 0 1 2 3 4 5 0.00 0.05 0.10 0.15 0.20 0.25 0.30  53 Appendix 6.  Alignments used for estimating dN/dS The following fasta-format alignments were used for analysis in CODEML (Yang 1997; see Chapter 2).  These can be cut and pasted into separate files for viewing in an alignment editor. Taxa are denoted by the first letter of the genus name.  File names suggested are pathway segment.gene name or EC number.fasta.  Pathway segment names refer to the following enzymatic conversions: ABA = carotenoid – abscissic acid. BR = campesterol – brassinosteroid, GA = farnesyl-PP – gibberellic acid, LUT = carotenoid – lutein, CRT = farnesyl-PP – carotenoid, pre-BR = farnesyl-PP – campesterol, TRP = pyruvate – farnesyl-PP, GLY = glucose – pyruvate  ABA.1.14.13.93.fasta >A -------------------------------------------------- -------------------------------------------------- -----------------------------GATTTCTCCGGTTTGTTTCTC ACTCTCTCC----------------------------------------- ----------------------------------GCGGCGGCTCTGTTTC TCTGT------------------TTACTCCGATTTATCGCCGGAGTCCGC CGTAGCTCCTCCACGAAACTCCCTCTTCCTCCGGGAACAATGGGTTATCC TTACGTCGGCGAAACATTCCAACTTTACTCA---CAAGACCCTAATGTGT TCTTTGCAGCAAAACAGAGAAGATACGGATCGGTGTTCAAGACTCATGTA TTGGGATGTCCATGTGTGATGATCTCGAGCCCTGAAGCAGCGAAATTCGT ATTGGTTACAAAGTCTCATTTGTTTAAACCGACTTTTCCGGCCAGTAAAG AGAGGATGCTTGGAAAACAAGCCATCTTCTTCCATCAAGGAGATTATCAT TCCAAACTTAGAAAGCTTGTTTTAAGAGCTTTCATGCCTGATGCAATCAG AAACATGGTCCCTCACATTGAATCAATTGCTCAAGAATCACTCAATTCTT GGGATGGAACTCAACTCAACACTTACCAGGAAATGAAAACATACACTTTC AATGTTGCGTTAATCTCAATACTCGGCAAAGACGAAGTTTATTACCGAGA AGATCTAAAACGATGCTACTACATTCTAGAGAAAGGTTACAATTCGATGC CGATTAATCTTCCAGGAACATTATTCCACAAAGCCATGAAAGCTCGCAAG GAGCTAGCTCAAATCCTCGCTAACATCTTATCCAAAAGAAGACAAAACCC ATCATCACACACAGATCTCCTCGGATCATTCATGGAAGACAAAGCAGGAT TAACCGACGAACAAATCGCCGATAACATCATCGGAGTAATCTTCGCCGCA AGAGACACGACGGCGAGTGTTCTGACGTGGATCCTCAAGTACTTAGCTGA TAATCCAACTGTTCTAGAAGCTGTCACTGAAGAGCAAATGGCAATAAGGA AAGATAAAAAA------------GAAGGAGAGAGTCTCACTTGGGAAGAT ACAAAGAAGATGCCATTAACTTATAGAGTAATCCAAGAGACATTAAGAGC TGCTACAATCTTATCTTTCACATTTAGAGAAGCTGTCGAAGATGTCGAAT ACGAAGGATATTTGATACCAAAGGGATGGAAAGTACTGCCACTATTCAGA AATATTCATCACAATGCTGATATATTTTCGGATCCGGGGAAATTCGATCC GTCGAGATTCGAAGTTGCGCCGAAACCGAATACATTCATGCCTTTTGGTA GTGGGATTCATTCTTGTCCAGGCAATGAGTTAGCTAAACTTGAAATCTCT GTTCTAATCCATCATCTCACCACTAAGTACAGATGGTCAATCGTAGGGCC TAGCGATGGAATTCAGTATGGGCCGTTCGCTCTTCCTCAGAATGGATTGC CTATTGCCTTGGAACGAAAACCA--------- >P -------------------------------------------------- -------------------------------------------------- -----------------------------GAATTCTCCCCCTCTGTGTTT TTCCTATCA----------------------------------------- ----------------------------TTTGCTTCCATTCTATTGCTTG TAGGAGGACTTCTCTTCAAGTCCCTCCTCAAATTCTTTGCTTCT------ ---GATCGCCCCCAGAGTTTGCCACTCCCTCCCGGCACCATGGGG---CC TTATATGGGTGAAACATTCCAACTCTACTCT---CAAGACCCCAATGTCT TCTTTGCCTCTAAGAGAAAGAGGTATGGCTCTATCTTCAAGACCCACATC TTGGGCTGTCCCTGTGTCATGATATCCAGCCCTGAAGCTGCAAAATTTGT CCTTGTAACCAAATCCCATCTCTTCAAGCCAACATTTCCGGCTAGTAAAG AAAGGATGTTAGGCAAAGAAGCCATATTCTTTCACCAGGGAGCCTACCAC ATGAAATTGAGAAAGCTTGTTCTTCGTGCTTTCTTGCCTGAAGCAATAAA AAACATCGTCCCTGATATTCAAAACATTGCCAAGGACTCTCTTCAATATT GGGAAGGAAGATTAATTAACACTTTCCAAGAAATGAAATCATACACATTC AATGTTGCATTACTTTCAATATTTGGGAAGGATGAAGTTCTATATAGAGA AGATCTTAAGAGGTGCTACTACATTCTCGAGAAGGGATACAATTCAATGC CCATTAACCTCCCAGGAACACTCTTCAACAAATCAATGAAAGCAAGAAAA GAGCTGGCTAGGATCTTGGCTAAAATCTTGTCCACAAGGAGGCAAATGAA GCTTGATCACAATGACTTACTTGGATCTTTCATGGGTGACAAGGAAGGTC TCACTGACGATCAAATTGCCGACAACATCATTGGAGTAATCTTTGCTGCT CGTGACACCACAGCTAGTGTTTTGACATGGATTCTTAAATACCTTGGAGA GAATCCAAGTGTTCTTCAAGCTGTCACTGAAGAGCAGGAGGCCATAATGA  54 GGAGTGAAGAA------AAGGGTGATGAGGAGAAGCTCCTTACGGCAGAT ACCAAGAAGATGCCGATAACTTCAAGGGTCATTCAAGAAACTCTAAGAGT TGCCTCGATTTTATCTTTTACCTTCAGAGAGGCGGTGGAGGATGTTGAAT ATGAAGGATATTTGATCCCTAAGGGTTGGAAAGTCTTGCCACTTTTCAGA AACATTCACCACAGCCCAGAACTGTTTCCAGATCCTGAGAAGTTCGATCC TTCAAGATTTGAGGTTGCACCGAAGCCCAATACATTTATGCCATTTGGGA ATGGGACCCACTCATGTCCTGGGAACGAGCTAGCCAAGGTGGAGATTTTG GTGCTACTCCATCACCTAACCACCAAGTACAGGTGGTCTATTGTGGGTGC AAATAATGGGATTCAGTACGGCCCTTTTGCCCTTCCCCAGAATGGTTTGC CCATCATTTTATCCCACAAGTCA--------- >R -------------------------------------------------- -------------------------------------------------- -----------------------------GATTTCTTCGCCTTCTTCTTT CTATTGTTT----------------------------------------- ----------------------------CTTTCCATTTCCTTCGTCTTCC TTCTC------------ATTTCTCTCCTTAATTTCTTCTTTCCTTCC--- ---AATTCATCCGCCAAATTGCCTCTCCCTCCCGGCTCATTGGGTTGGCC TTACATTGGAGAGACCTTCCAGCTCTACTCC---CAAAACCCGAATGTCT TCTTTGCCTCCAAACAGAAAAGGTATGGCTCCGTCTTCAAGACCCACATC TTGGGTTGCCCTTGTGTCATGATTTCTAGTCCCGAAGCTGCTAGATTCGT ACTTGTGAGCAAAGCTCATCTCTTCAAGCCAACATTCCCGGCGAGCAAAG AAAGGATGTTAGGCAAACAAGCCATCTTTTTTCACCAAGGAGACTACCAC AACAAATTGAGAAAACTCGTTCTTCGCGCTTTTGTACCTGATGCAATCAA AAGTATCGTCTCTGATATCGAGTCCATTGCTAAAGAATCTGTACACTCTT GGGAAGGAAGGGACATTAATACTTTCCAAGAAATGAAAACATATGCATTC AATGTTGCACTGCTCTCAATATTTGGAAAGGACGAATTTCAATATAGAGA AGAACTAAAAAGATGTTACTACATTCTTGAAAAGGGATACAATTCAATGC CCATTAATCTACCAGGGACACTCTTTCACAAAGCAATGAAAGCAAGAAAA GAGCTAGCTCAGATCCTAGCCAAAACTCTGTCGAGCAGGAGACAAATGAA GCTCGACCGAAATGACTTGCTTGGATCTTTCATGGAAGACAAGGAAGGAT TGAGTGATGAACAAATTGCAGATAACATTATTGGAGTGATATTTGCAGCT CGTGATACTACAGCTAGTGTTCTCACATGGATTCTAAAGTATCTTGGAGA AAACCCAAGTGTTCTTCAAGCTGTAACCGAAGAGCAAGAGGAAATAGTAA GAAGTAAAGAG---AAGAGTGGTGAGCAGAAAGTTCTGAGTTGGGCAGAT ACAAAGAAGATGCCAGTAACATCAAGGGTTATTCAAGAAACATTAAGGGT TGCTTCAATTTTGTCTTTTACTTTCAGAGAAGCTGTTGAGGATGTTGAGT ATGAAGGATATCTGATCCCAAAAGGATGGAAAGTCTTGCCACTTTTCAGA AACATTCACCATAGCCCAGAAATCTTTCCAGATCCTGAAAAGTTTGATCC TTCAAGATTTGAGGTTGCACCAAAACCCAATACATTCATGCCATTTGGCA ATGGGACCCATTCATGTCCAGGGAATGAATTAGCTAAGCTGGAAATTCTT GTCCTTCTCCATCACCTGACCACCAAGTACAGATGGACA---GTGAGTAC AGATAATGGGATTCAGTATGGCCCTTTTGCCCTTCCCCAGAATGGTTTGC CCATCAAGTTGTCCCAGAAATCG--------- >O -------------------------------------------------- -------------------------------------------------- --------------------------------------GGTGCTTTTCTT CTGTTCGTG----------------------------------------- -------------------------TGCGTGCTCGCGCCTTTCTTGCTTG TCTGCGCC---------GTCCGCGGCCGCCGCCGGCAGGCGGGCTCGTCG GAAGCGGCGGCGTGCGGCCTGCCGCTGCCGCCGGGGTCGATGGGGTGGCC GTACGTCGGGGAGACGTTCCAGCTGTACTCGTCCAAGAACCCCAACGTGT TCTTCAACAAGAAGCGGAACAAGTACGGTCCCATCTTCAAGACGCACATC CTGGGATGCCCCTGCGTGATGGTGTCCAGCCCGGAGGCGGCGCGGTTCGT GCTGGTGACGCAGGCGCACCTCTTCAAGCCCACCTTCCCGGCGAGCAAGG AGCGGATGCTGGGTCCCCAGGCCATCTTCTTCCAGCAGGGCGACTACCAC GCCCACCTCCGCCGCATCGTCTCCCGCGCCTTCTCCCCCGAGTCCATCCG CGCCTCCGTCCCGGCCATCGAGGCCATCGCGCTCCGCTCCCTCCACTCCT GGGACGGCCAGTTCGTCAACACCTTCCAAGAGATGAAGACTTACGCGCTG AATGTGGCATTGCTGTCCATCTTCGGGGAGGAGGAGATGCGCTACATCGA GGAGCTGAAGCAGTGCTACCTGACGCTGGAGAAGGGGTACAACTCGATGC CGGTGAACCTGCCGGGCACCCTGTTCCACAAGGCCATGAAGGCCCGGAAG AGGCTGGGCGCCATTGTGGCCCACATCATCTCTGCCCGGCGCGAGCGGCA GCGGGGG---AACGACCTGCTAGGGTCGTTCGTGGACGGCCGCGAGGCCC TCACCGACGCCCAGATCGCCGACAACGTCATCGGCGTCATCTTCGCCGCC CGCGACACCACCGCCAGCGTCCTCACCTGGATGGTCAAGTTCCTCGGCGA CCACCCCGCCGTCCTCAAGGCCGTCACCGAAGAGCAGCTGCAGATTGCCA AGGAGAAAGAG---------GCGTCGGGCGAGCCGCTGTCATGGGCGGAC ACGCGGCGGATGAAGATGACGAGCCGGGTCATCCAGGAGACG---AGGGT GGCGTCCATCCTCTCCTTCACCTTCAGGGAGGCCGTGGAGGACGTGGAAT ACCAAGGGTACCTGATCCCCAAGGGCTGGAAAGTGCTACCTCTGTTCCGC AACATCCACCACAACCCCGACCACTTCCCCTGCCCGGAAAAGTTCGACCC GTCCCGGTTCGAGGTGGCGCCCAAGCCCAACACGTTCATGCCGTTCGGGA ACGGGACCCACTCGTGCCCGGGCAACGAGCTCGCCAAGCTGGAGATGCTC  55 GTGCTCTTCCACCACCTCGCAACCAAGTACAGGTGGTCCACGTCCAAGTC CGAGAGCGGCGTCCAGTTCGGCCCCTTCGCGCTGCCGCTCAACGGCCTCC CCAGCTTCACCCGCAAGAACACCGAGCAGGAG >V AGCTGTAGAGAGATTCCATTTGTGGGATTCGAGCTGTATTTTCTGATATT TCATTGCCCCCCATCTCCCTCATATCCCTCCTTTCTTATTATAAATACCC CCCTTTTCTTCTCCACTCCTCACACCCATCCTCCACCTCCTCTCTTCTTC ACTCTCTCCACCATCATCAACCCACAACTATTCAAACCACTACTACTTCT AATGGACTCCTCCTTCACCACCATATGCTTCTCCATTGCTCTCCTCCTCT TTCTCATCCACTTTCTCCTAAAGCTCTTCTCCTTCTTCTCTGCT------ ---TCCACTGCCCGGAAACTCCCTCTCCCACCTGGCTCTCTGGGCTGGCC CTACATAGGAGAAACCTTTCAGCTTTACTCT---CAGAACCCCAATGTCT TCTTTGCCTCCAAGCAAGAGAGGTATGGAACCATATTCAAAACCCACATA TTGGGGTGCCCATGTGTGATGATTTCAAGTCCTGAAGCTGCAAAGCTGGT GCTGGTCACAAAGGCTCCTCTCTTTAAGCCTACATTTCCGGCTAGCAAAG AGAGGATGTTGGGGAAACAAGCAATTTTCTTTCACCAAGGTGACTACCAT GCCAAGTTGAGGAAGCTTGTTCTCCGAGCCTTCATGCCAGGAGCCATCAA AAACATCGTCTCTAACATCGACTCCATCGCCACCCAGACCCTGCAGTCCT GGGAAGGCCGGTCGATCAATACTTTCCAAGAAATGAAGACATACACTTTC AATGTTGCACTGCTGTCCATATTTGGAAAAGATGAAATTCTGTACAGAGA GGAACTCAAGAAATGCTACTACATTCTTGAGAAGGGGTATAATTCAATGC CCATAAACATTCCTGGAACGCTCTTTAACAAATCAATGAAAGCAAGGAAG GAATTGGCTCAGATCTTGGCTAAAATCCTCTCAACAAGGAGGCAGGCGAA CGGTGATCACAACGACTTGTTGGGATCTTTCATGGGAGACAAAGAAGGGC TCACAGATGAACAAATTGCAGACAACATCATAGGCGTCATCTTCGCGGCC CGAGACACTACTGCCAGTGTGCTGACATGGATCCTCAAGTATCTGGGCGA AAACCCGAGTGTTCTGCAAGCTGTCACGGAAGAGCAAGAGTCCATAATGA GGAGTAAAGAAGACAAGTGTGGTGAAGAGAAGTCTCTGACTTGGGAAGAT GCCAAGAAG---CCAATAACTTCAAGGGTGATTCAAGAAACACTTAGAAT TGCTTCAATTTTATCTTTCACCTTTAGAGAGGCTGTTGAAGATGTTGAAT TTGAAGGGTACCTGATTCCAAAAGGGTGGAAAGTTTTACCACTTTTCAGA AACATTCACCACAGTCCAGACATATATCCAGAGCCAGAGAAGTTTGATCC CTCAAGATTTGAGGTTGCTCCAAAGCCCAATACATTTATGCCATTTGGAA ATGGGGTCCACTCATGCCCTGGGAATGAGTTGGCCAAACTAGAGATTTTG GTGCTTCTACATCATCTGACTACAAAGTACAGGTGGTCTATGGTGGGCAC ACAGAATGGTATTCAGTATGGCCCTTTTGCTCTTCCCCAGAATGGTTTGC CCATCACAATCTCCCTCAAGTCA---------    ABA.AAO3.fasta >A ---------------------------------------GATTTGGAGTT TGCAGTTAATGGGGAACGATTCAAGATTGATTCT---GTTGATCCATCAA CGACCTTACTTGAGTTCTTGCGATTGAACACTCCTTTCAAGAGTGTCAAG CTCGGCTGTGGCGAAGGAGGGTGTGGTGCTTGTCTTGTAGTGTTATCTAA ATATGATCCAGAGTTAGATCAAGTGAAGGAATGTTGTATAAACTCTTGTC TCACTCTTCTCTGTAGTGTAAATGGATGTTCCATTACTACATCTGAAGGT CTTGGAAACACGAAGAAAGGATTTCATCCGATTCATAAGCGGTTCGCGGG TTTTCACGCCTCTCAATGCGGGTTTTGTACACCAGGGATGTGTATTTCTC TCTACTCATCTCTTGCAAATGCTGAGAATAACAGC---TCTAAAGAT--- ------------------TTTACGGTTTCTGAAGCTGAGAAATCTGTTTC GGGTAATCTTTGTCGATGTACTGGTTATCGTCCCATTGTCGATGCTTGTA AGAGTTTTGCTTCTGATGTTGATATTGAGGACTTAGGGTTAAATTCCTTT TGGAAAAAAGGA---GAAAGCAAAGAGGTTATGTTTAAGAATTTGCCTCC TTATAACCCCAAAGACCATCTTGTAACATTCCCTGAGTTCTTGAAGAAGA AAGAGAAGGTTGATAATGGTTCGGATCATTTGAAGTATCGT--------- ---------------TGGACCACTCCTTTTAGTGTGGCTGAGCTTCATAA CATAATGGAAGCAGCTAACTCT------GGAGACTCGTTGAAGTTAGTTG TAGGCAACACGGGTACAGGTTACTATAAAGACGAGGAACGGTTT---AGA TATATTGATATCAGTAACATTCCGGAGATGTCAATGATCAAGAAAGATGA GAAAGGAATTGAAATAGGAGCAGCTGTTACTATATCGAATGCTATTGATG CTTTGGAGAAGGAAAGCAAATCTTCTTAT------------------GTT TTCAAGAAAATGGCCACTCATATGGAGAAAATTGGCAACCGTTCTATCCG AAACTCGGGTAGTATTGGTGGTAATCTAGTGATGGCACAGAGCAGAAAGT TTCCTTCTGATGTTACCACTTTGTTGCTCGCTGTAGATGCCTCGGTGTAT ATGTTAAATGGTAGGAAAACCGAGAAGGTTACGCTACAGGAGTTTCTTGA ATTGTCTCCGGTGTTAGACTCCAAACGCGTTCTTTTAAAGGTTGAGATTC CATCATGGACTGCT------------CCTTCTGGTGATGACACTGAATTT CTCTTTGAAAGCTATCGAGCCGCACCTCGTTCTATTGGAAATGCATTGCC TTACTTGAACGCTGCTTTCTTGGCGCTAGTGTCTCGCCAAGAAGCATCAA GAAAAGGTGTAACGGTAGAAAAATGCTTCCTGGCATTTGGTTCTTATGGC GGGGATCATTCGATCAGGGCGATAGAAGTGGAGACTTTCTTGACAGGTAA ATTACTTAGCTACAGTGTTCTATATGAAGCTGTTGGTTTACTTAAAGGAA TCATAGTCCCTGGCAAAGACACCTTGCACTCGGAATATAGAAAAAGCTTG  56 GCTGTTGGATATCTTTTTGAGTTTTTTTACCCACTGATCGAGAGT----- ----------------------------GGCCATAGAATATGTAGTCTTG ATTCAGGGAAT---AAGCATAACAACAGCCATGTTGATACCGTAAAATCT CTTCCCTTCCTCTCATCTTCACAGCAAGTATTAGAG---AGCAATGAATT TAAACCTATTGGTGAAGCAGTTATCAAAGTTGGAGCTGCCTTACAAGCTT CTGGTGAGGCGGTTTTTGTTGAT---ATACCGACTTTACCAGACTGTCTT CATGGAGCATTCATTTATAGCACAGAGCCTTTGGCTAAGATAAAAAGCTT AAGCTTCAGAGAGAATGTAACTCCTACTGGAGTTTTTGCTGTTCTTACTT TCAAGGATATTCCACAACAAGGACAAAACATTGGT---TCCAAGACCCTT TTTGGACCAGGACCTTTATTTGCAGATGAACTAACTCGATGTGCAGGTCA AAGAATTGCTCTTGTGGTTGCAGACACACAGAAACATGCAGACATGGCTG CAAAACTTGCAGTAGTTGAGTATGATACAAAGAATTTAGAACAACCGATA TTAACTGTCGAAGATGCAGTTAAAAGATCTAGCTTTTTCGAGGTTCATCC GATGTTTTACCCCGAACCAGTAGGTGATGTTATAAAAGGAATGGAAGAAG CTGAGCGAAAGATAATCTCCTCTGAGTTGAGGCTAGGGTCACAGTACTTC TTCTATATGGAGCCACAAACAGCACTTGCCTTGCCAGACGAAGACAATTG TGTCAAGGTATTTAGTTCATCTCAAGCACCTGAGTACGTACATTCGGTTA TTGCTACATGTCTTGGCATTCAAGAGCATAACGTGAGAGTCATCACTAGA AGAGTTGGTGGTGGCTTTGGTGGTAAAGCTGTAAAGTCAATGCCTGTTGC AACCGCATGCGCACTAGGCGCATACAAGTTGCAACGTCCTGTTAAGATGT TTTTGAACCGCAAGACGGATATGATAATGGCTGGAGGAAGACATCCGATG AAGATAAATTACAATGTGGGATTTAGATCAGATGGGAAGCTCACAGCACT GGAGCTTACAATGCTTATAGATGCAGGGCTTGAGCCAGACGTAAGTCCAA TCATGCCGCGGAATATAATGGGTCCGCTGAGGAAGTATGACTGGGGAGCT TTGTCATTTGATGTAAAAGTGTGTAAGACGAATTGTCTGAGTAGAACAGC GATGAGAGCTCCCGGGGAAGTTCAAGGTTCTTACATAGCGGAATCCATTA TCGAGAATGTAGCTTCTTCTCTTCAAATGGATGTTGATGCAGTGAGAAAA ATAAACCTTCATACTTATGATAGCCTTAGAAAATTCTACAATCACATTGC TGGTGATCCTGATGAATATACACTGCCTTTATTATGGGAGAAACTTGAGA TATCTTCAAAGTTCAAGGAAAGATCG---ATGGTGAAGGAGTTTAATCTT TGTAATGTATGGCGAAAGAGAGGGATTTCTCGAGTACCTATAGTCCATCA AGTTATGCAGAGACCGACCCCGGGGAAAGTAAGCATACTGAGTGATGGTT CTGTTGTAGTTGAGGTTGGAGGAATTGAGATAGGGCAAGGATTGTGGACT AAAGTACAACAGATGGTTGCTTATGGTCTCGGTATGGTTAAATGCGAAGG AAACGAAAAGCTCTTGGATAGAATACGTGTAGTTCAGTCCGATACACTAG GTATGATCCAAGGAGGTTTCACTGCTGGTAGCACGACATCCGAGAGCAGT TGTGAAGCCGTTAGGCTTTGCTGTGTTATCTTGGTGGAGAGATTGAAACC TATAATGGATCAGATGATGATGGAGAAGTCAGGTTCCGTGACATGGAACA TACTCATTCAACAAGCGTATGGTCAGTATATTAATTTATCGGCGAGTACA ------TTGCCAGAGTATTCTTCCATGGAATATCTCAACTATGGAGTTGG AGTC---AGCGAGGTGGAAGTGGACCTTGTGACAGGAAAAACCGAGATTT TAAGATCCGATATTATTTATGACTGTGGAAAGAGTCTTAATCCTGCAGTT GATTTAGGACAGACCGAAGGAGCATTTGTTCAAGGCATCGGGTTTTTCAT GATGGAAGAGTACACTACTGATGAGAAGGGGCTTGTGGTGCAACAAGGCA CTTGGGACTACAAAATACCGACTGTGGACACAATCCCAAAACACTTCAAC GTTGAGATTGTCAACACTGGTCATCATAAAAACCGCGTTCTCTCCTCCAA AGCGTCGGGTGAGCCGCCATTGCTTTTAGCAGCTTCTGTTCATTGTGCAA CAAGATCAGCCATTAGGGAAGCTCGGAAACATTCCCTTTCATCGAACTTC ATTGATGGGTCTGATTCGGAATTTGAGTTACCTGTTCCAGCGACTATGCC TGTGGTGAAGTCTCTTTGCGGATTGTATAGTGTAGAGAAATACTTACAAG GAAAGATCAAAGGACAA >P GAAGAGAAGCAGAGG---------GAAACAGGCAGAGGGAGTCTAGTTTT TGCCGTCAACGGACAGAGGTTCGAGGTGTCGTCGAGATTAGACCCTTCAA CAACCTTGCTTGAGTTCTTGCGAACCAGGACATCTTTCAAGAGTGTCAAG CTCGGTTGTGGCGAAGGTGGTTGTGGTGCTTGCATTGTTCTACTCTCCAA GTATGATCCTGTGCGTGACCAAGTTGAGGATTTCACAGTCAGTTCATGTC TCACACTGCTTTGCAGTGTGAATGGATGTTCGGTTACAACATCTGAAGGC CTTGGAAATAGCAAAGATGGATTCCATCCGATTCACCAGAGATTCAGTGG TTTCCATGCTTCTCAATGTGGCTTTTGTACTCCTGGAATGTGTGTTTCAC TCTTCGGAGCCCTTGTTAAAGCTGAAAAGAATGAC---CAAAGGGAGCCT TCTCCAGGATTCTCCAAGCTGACAGTCGTTGAAGCTGAAAAGGCTATCTC AGGAAATCTTTGTCGCTGTACTGGATATCGACCCATTGCTGATGCGTGTA AGAGTTTTGCGGGTGATGTTGATATTGAAGATTTGGGATTAAACTCTTTT TGGAAGAAGGAA---GAGAGTCCCGAAGCGAAGATGAGTAGGCTACCTTT ATATGACCATAATCATGAGATATGCACTTTCCCTGAATTTTTGAAAAGGG AAATAAAATCTTCCTTGCTTTTGGATTCTGAAAGATATTCT--------- ---------------TGGTGCACACCTGCTACTGTTGAGGAGCTTCAGAG CTTATTAAAAAGCATTGATGCCGACTGCAAAACCAGGATGAAACTAGTGG TTGGTAACACAGGTATGGGTTATTACAAGGACCTAGACCACCATGACAAG TACATAGATCTCAGATGTGTTCTGGAGCTCTCGAGTATTAGGAGGGAAGA A---GGAATCGAAATCGGGGCAGCTGTCACTATTTCTAAAACTATTGAAG CTCTGAAGGAAGAAATTAACAGCGAGTTTAATTCAGAATGCAAGATTGTG TTTAAAAGAATTGCATTGCACATGGAGAAGATTGCTTCTGAATTTGTTCG AAATACAGGCAGTGTAGGGGGGAATTTGGTGATGGCACAAAGGAAACATT  57 TTCCATCAGATATTGCCACGATACTGCTGGCAGCAGGTGCATTTGTTCAC ATTCTAACTGGTACCTTGCATGAAAAGCTTACTTTAGATGAGTTTCTGGA AAGGCCTCCA---TTGGATTCCAAAAGTGTGCTATTAAATATTAAGATTC CAAATTATGCAGCATCCAAGAACATATCTTCTGAAATGGACAGCAAGTTG TTATTCGAAACTTATCGTGCTGCACCGCGACCCCTTGGAAATGCATTGCC CTATTTAAATGCAGCTTTCTTGTCTGAAGTTTCCTGTTTGAAATCTTCT- --GGTTCAGCCGTGTTAAATAAATGCCGGGTCGTTTTTGGTGCTTATGGA ACCAAACATGCTATCAGAGCAAAGGAAGTTGAGAAATTTTTGTCTGGAAA AATACTAACCATTGGTGTTCTATATGAAGCTGTTAAACTGGTTAAAGCCA ATGTGGTTCCTGAAGATGGCACGCCGAGTCCGGCCTACAGGTCAAGCTTA GCTGCTGGTTATCTCTTTGACTTTCTCTACCCCTTGGTAGACATTAACTC TAAAATTTCTGGTGTTTGGTCGGATGAATATTGTAATACTTCATTGTTCA AGGATGCAAAAATAAAACAGAAGTACAGCCAGCTTGATCATGTGCAATTA CCCACTTTGCTGTCATCATCAGAGCAGGTGCTTGAATTAAACAATGATCA TCATCCTGTTGGTCAGCCTACTAAGAAAGTTGGAGCCGCCCTTCAAGCTT CTGGGGAGGCTGTTTTTGTGGATGACATTCCCTCTCCTACAAATTGTCTA CATGGAGCATTCATTCATAGCATGAAGCCTTATGCAAGGGTCAAGGATAT CAAATTCAAGTCTAAATTACTACCAGATGGAGTTTCTGGGCTGATTTCGG TCAGAGACATTCCAAAAGGTGGGGAGAACAGAGGT---TGTACGACTAGT TTTGGCACTGAATCTTTGTTCGCAGATGAGCTTACGCAGTATGCTGGAGA GCGTCTTGCTTTTGTGGTTGCAGATACACAGAAACATGCTGATATAGCAT CCAACCTTGTTGAAGTTGATTATGACATTGAAAATCTAGAACCACCCATT TTAACTGTAGAAGAGGCCATTAAGAGATCTAGCCTTCTCGAGGTTCCTCT TCTCCTCTACCCCAAACAAGTTGGTGATATATCAAAAGGATTGGCTGAGG CTGATCACAAGATTCTCTCTGCCAAGATAAAACTCGGTTCACAGTACCAT TTCTATATGGAGACTCAAACTGCCCTTGCGCTTCCTGATGAAAACAACTG CATGGTGGTTTACAGTTCAACCCAGTGTCCCGAATATGCACATGTTAACA TTGCAAAATGTCTTGGTATTCCTGAGCATAATGTGCGTGTGATTACAAGG AGAGTCGGAGGAGGCTTTGGTGGAAAGGCCATGAAAGCAATTCCTGTTGC TACAGCATGTGCTCTTGCAGCGCACAAGTTTCGTCGCCCTGTGAGAACGT ATTTGAATCGCAAGACCGATATGATAATGGCAGGAGGAAGGCATCCCATG GAAATAACTTATAATGTAGGATTTAAATCAAATGGGAAAGTTACAGCCTT ACAGCTTGATATATTAATCAATGCTGGAATATCTTTCGATATAAGTCCAC TGATGCCAAAAACCATTCTGAGTGGGCTAAAAAAGTATGACTGGGGTGCT TTATCTTTTGATATAAAGGTATGCAAAACAAATCATTCAAGTAAAACTGC AATGCGAGGCCCTGGGGAGGTACAAGGATCATACATTGCAGAAACCGTAA TCGAACATGTAGCGTCTACCCTTTCCATGGATGTAGATTCTGTGAGAAAC ATAAATTTTCACAGATATGATAGCCTTAAATTATTCTATGATGTTGCCTC AGGTGATTCTGTAGAGTATACTCTAACATCAATATGGAATAAGTTAGCAG AATCTTCAAGCTTCAAACAAAGGGTTGAAATAATAAAGGAGTTCAATAGG TGTAAGGTGTGGAAGAAAAGAGGTATTTCTCGAGTGCCTATTGTGCATCA AGTGTTCGTGGGACCAACTCCGGGGAAAGTAAGCATTCTAAGTGATGGGT CGGTTGTCGTTGAAGTCGGCGGAATAGAGTTGGGTCAAGGGCTCTGGACA AAGGTAAAACAAATGGCTGCATTTGCTCTCAGCTCAATCAAATGTGACGG GGTAGAAAATCTTCTGGACAAAGTAAGGGTAATACAAGCTGATACTCTGA GTTTAACTCAAGGAGGAATGACTGCAGGGAGCACCACATCAGAGTCAAGC TGTGAATCAGTTAGACTTTGCTGTGCAGTCTTGGTTGAGAGACTGGCACC TCTAAAGGAAACGTTG---CAGGGGCAAATGGGTTCCGTAACATGGGATG CGCTCATTTGCAAGGCATATGTGGAATCACTGAATTTATCAGCATCTTCA CATTACATCCCTGACTTTACTTCGATGCACTACTTAAACTATGGCGCTGC AGTA---AGTGAGGTAGAGGTAAACCTTCTGACAGGGGAAACAACTATTT TGAGATCAGATATTATATACGATTGTGGACAAAGTCTCAACCCTGCGGTG GATTTAGGACAGATTGAAGGAGCCTTTGTCCAAGGGATTGGTTTTTTTAT GCTTGAAGAGTACACGACGAATTCTGATGGACTAGTGGTTGCAGACAGCA CATGGACATATAAGATCCCTACAATAGACACCATACCAAAACAATTCAAT GTGGAAATACACAACAGTGGACATCACCAGAAACGTGTTCTCTCTTCAAA AGCTTCCGGGGAGCCACCGCTACTCCTTGCAGCATCAGTTCACTGTGCTG CAAGAGCAGCTATAAGAGATGCTAGACAACAGCTTCATTCATGGGGTTGC ATGGATGAGTCTTACTCAACATTCAACTTGGAGGTCCCTGCCACCATGCC TAAGGTGAAGGAACTTTGTGGGCTGGACAACGTGGAAAGGTACTTAGGGT GGAAAATGGGTAGAAAG >R GAGGATCATGAAAGTACAGCAACAGAAACAGAAAGGAGCAATCTTCTTTT TGCTGTTAATGGGGAGAGGTTTGAGCTCTCAAGT---GTTGACCCTTCTA CTACTTTGCTCGAGTTCTTGCGTACCCAGACACGTTTCAAGAGTGTTAAG CTCAGTTGCGGTGAAGGTGGTTGTGGTGCTTGTATTGCGCTGCTCTCCAA GTATGATCCGTTCAGTGACGAAGTTGAGGATTTTACTGTAAGTTCATGTC TCACATTGCTTTGCAGTATAAATGGATGTTCAATTACAACAAGTGAAGGC CTTGGTAATAGCAAAGATGGCTTCCACTCAATTCACCAGAGGTTCACAGG ATTCCATGCTTCTCAATGCGGCTTTTGTACTCCAGGAATTTGCATCTCAC TCTATGGGGCCCTTGTTAATGCTGAAAAGACAGAT---CGACCAGAGCCC TCACCAGGATTCTCCAAGCTTACAGTGGTTGAAGCTGAGAAAGCTGTTGC AGGAAATCTTTGTCGCTGTACTGGATATAGACCCATTGCCGATGCATGCA AAAGTTTTGCAGCTAATGTTGATATGGAGGACTTAGGATTCAACTCTTTC TGGAAGAAGGAA---GACATTCAGGAAGCAAAGATAAGCAAGTTACCTGT  58 GTATAATCATAATCACAATAGTTGTACTTTCCCTGACTTCTTAAAAAGGG AAGTCAAAGATTCCTTGCTTTTGGATTCTAAAAGATACCAT--------- ---------------TGGTACAAACCTGCTAAAATTGAGGAGCTTCATGA CTTATTAAAATCTAGTGATGCTGAT---GGAGTTCGTAGGAAACTAGTGG TTGGTAATACAGGTGTGAGTTACTATAAGGAAGTAGAGTATTATGACACG TACATAGACCTCAGAAATATTCCTGAGCTCTCAATCATTAGAAGGGAGCA GTCAGGAGTTGAAATTGGGGCTGCTGTCACTATTTCGAAAGCTATTGAAG CTTTGAAGGAGGAAAGTAAAGGTGAGTTTCTCTCAGAATGTAAAATGATA TATGAAAAAATTGCTATTCATATGGAGAAAATTGCTGCTGCATTTGTTAG AAATACAGGTAGTGTTGGGGGAAATTTAGTGATGGCACAGAGGAAACATT TTCCTTCAGATATTGCTACTATACTTCTAGCAGCTGGTTCATCAGTTGAG ATAATGACAGGCATTATTCGTAAAAAGCTTACACTGGAGGAGTTTTTGGG AAGGCCTCCA---TTGGATTCCAAAAGTGTACTTTTAAGTGTTAGGATCC CTAATTGTGAATCAATTAAGAATGTATCTCTTGAAAGAGATAATAAGTTG TTATTTGAAACCTATCGAGCTGCACCGAGGCCCCTTGGAAATGCTTTGTC CTATCTGAATGCTGCTTTCTTGGCTGATGTTGCCTGCTCTAAACAATCG- --GGTGGAATTGTGTTAAATAGCTGTCGGTTGGCTTTTGGTGCTTTTGGA ACCAAACATGCAATTAGGGCGAGGAAAGTTGAGGAATTTTTAGCTGGAAA ATTGTTAACCATTGGTGTTCTTTACGAAGCTATTAAATTGGTTAAATCTA CTGTGATACCTGAAGAAGGGACTCGACATCCTGCATATAGGACAAGCTTA GCTGTTGGTTTTCTTTTTGACTTTCTTGGCCCAGTATCAGTTACT----- ----CTTGGTAGTGGTTGGTTAGATGGAGGTATAAATTCTTCAATATTCA ACGGTGCGATACTAAACCAAAATCAAGCGTGGCTGGACCAAGTCAAATTC CCCACTTTGCTATCTTCATCAAAGCAGGTGGTCCAAATAAACAAAGATTA TCATCCCATTGGCGAGCCAGTTACAAAATCTGGAGCTGCTCTTCAAGCTT CTGGTGAAGCTGTTTATGTGGATGACATTCCCTCTCCCAGAAATTGTCTA CATGGTGCATTCGTTTATAGCAAAAAGCCTTTTGCGAGGGTAAAGGATAT AGAACTCAATTCTAAATTCCATATCAGTGGAGTCACTGCACTTATTACTT TTAGAGACATCCCAAAAGGCGGGGAAAACATAGGT---TCTAAAACTATT TTTGGTTTGGAGCCTCTGTTTGCTGATGAGCTTACTCGATGTTGTGGAGA GCGTCTTGCTCTAGTGGTTGCAGATACACAGAAACATGCAGAATTAGCAT CAAACCTTGCAGTGGTTGACTATGACCTGGAAAATCTAGACTCTCCCATT TTAACTGTAGAGGATGCTATAAAGAGATCTAGCCTTTTTGATGTCCCTCC CTTTCTCTACCCTAAACAAGTTGGTGATATATTAAAGGGAATGGCTCAAG CTGATCACAAGATTCTCTCAGCTGAGATAAAACTTGGGTCACAATACTAT TTCTATATGGAGAATCAAACTGCCCTTGCTGTGCCAGATGAAGACAATTG CATAGTAATTTATAGTTCAATTCAGTGCCCTGAGTTTGCACATGCTGTTA TTTCAAGATGTCTTGGTGTTCCTGAACATAATGTACGTGTGATTACAAGA AGGGTTGGAGGAGGCTTTGGAGGAAAGGCCATAAAAGCCATGCCTGTTGC TACAGCCTGTGCACTAGCAGCATACAAGTTACAGCGCCCTGTCAGATTGT ATCTTAATCGCAAAGTAGATATGATAATGGCAGGAGGAAGGCATCCTATG AAAATAACATACAGTGTAGGGTTCAAATCTAATGGGAAAATTACAGCCTT ACAGCTTGATATATTGATTGATGCTGGCATATTTCCAGACATAAGTCCAA TAATGCCAATAAATATTCTGGGCTCGCTGAAAAAATATGACTGGGGTGCT TTATCTTTTGATATAAAGGTATGCAAAACAAATCTTCCAAGTAGATCAGC TATGCGGGCCCCTGGAGAGGTGCAAGGATCATATATCGCAGAAGCTGTAA TTGAACATGTAGCATCTTCTCTTTCTGTGGATGCAGATTCAGTGAGAGCC ATAAACCTCCACACTTATGATAGCATTAACTTATTCTACGATAATATTGT TGGTGAGCCTCTAGAATACACTTTAACTTCAATATGGGATAAGTTAGTGA CATCTTCAAGTTTTATCCAAAGGACTAAAATGATAAAAGAGTTCAATAAG TGTAATTTGTGGAAAAAAAGAGGTATTTCTCAAATACCTATTGTACATCA AGTTACATTGAGACCAACTCCAGGGAAAGTAAGCATTCTAAGTGATGGGT CTGTTGTTGTCGAAGTTGGAGGAATAGAGCTGGGCCAGGGGCTCTGGACG AAGGTGAAACAGATGGCAGCATTTGCTCTTAGTTCAATCAAGTGTGATGG AGTAGGAGACCTCTTGGATAAAGTAAGAGTCATACAAGGTGACACCTTGA GTTTAATTCAAGGGGGTTTTACTTCTGGGAGCACTACATCCGAGTCAAGC TGTGAAGTAGTTAGACTTTGCTGTAAAGATTTGGTCGACAGACTGACACC TCTGAAAGAAAGGTTA---CAAGGGCAAATGGGTTCTATAAGATGGGAGG TGCTAATTCACCAGGCTTATTTGGAAGCTGTCAACTTATCAGCAAGTTCT TACTTCGTCCCTGACTTTGCTTCTATGCAATACCTAAATTATGGTGTTGC TTCG---AGCGAGGTGGAGATAGACCTTCTGACAGGACAAACAACAATTT TGAGATCAGATATTATATATGACTGTGGACAAAGTCTCAACCCTGCTGTG GATCTAGGCCAGATCGAAGGGGCTTTCGTCCAAGGAATTGGCTTTTTCAT GCTTGAAGAGTACACAACAAACTCGGATGGATTAGTGATTGAGGATGGCA CATGGACATACAAGATCCCTACACTAGACACTATACCAAAACAGTTCAAT GTGGAGATTTTAAACAGTGGCCATCACCAAAAGCGTGTTCTATCATCCAA AGCTTCTGGTGAACCGCCATTGCTCCTAGCAGCCTCAGTTCACTGTGCCA TAAGAGCTGCTATCAGGGATGCCCGACAGCAGCTTCATTTGTGGGGTTGC CTAGATGATAGTCCTACAACGTTCGACTTGGAGGTCCCTGCCACCATGCC TGTTGTAAAAGAGCTCTGCCGGCTGGACATTGTGGAGAGGCACTTGCAGT GGAAAATGAACAGCAAG >O GGGTCAGAGGCGGCG------------GCGGCGGCGAGGGCGGTGGTGGT GGCGGTGAACGGGGAGAGGTACGAGGCGGTGGGG---GTCGACCCGTCGA CGACGCTGCTCGAGTTCCTCCGCACGCGGACCCCCGTCAGGGGCCCCAAG  59 CTCGGCTGCGGCGAAGGTGGATGTGGCGCATGCGTGGTCGTCGTGTCCAA GTACGACGCCGTCGCCGACGAGGTGACCGAGTTCTCGGCGAGCTCCTGCC TGACGCTGCTCGGCAGCCTGCACCACTGCGCGGTCACCACCAGCGAGGGC ATCGGCAACTCCAGGGATGGCTTCCACGCTGTGCAGCGGCGGCTCTCCGG CTTCCACGCCTCACAGTGCGGCTTCTGCACGCCGGGCATGTGCATGTCCA TCTACTCCGCGCTCGCCAAGGCTGACAAGGCATCCGGTCGCCCCGCGCCG CCGACGGGGTTCTCCAAGATCACCGCCGCCGAGGCAGAGAAGGCCGTCTC CGGCAACCTGTGCCGCTGCACTGGCTACAGGCCCATCGTCGACGCCTGCA AGAGCTTCGCCGCGGACGTCGACCTCGAGGATCTTGGCCTCAACGCCTTC TGGAAGAAAGGCGTCGACGACGAGCACGCTGACATCAACAAGCTGCCTGC ATACTCCGGTGGCGCCGCCGTCTGTACGTTCCCGGAGTTCCTCAAGTCGG AGATAAGGTCGTCCATGGGTCAAGCGAATGGTGACACTTCGGCGGTGGTG GTCACCGGCGACGGCTGGTTCCACCCCAAGAGCGTCGAGGAGTTCCACAG GTTGTTTGACTCTAACCTGTTCGAT---GAAAGGTCTGTGAAGATTGTGG CATCGAACACCGGCTCCGGAGTGTACAAGGATCAAGACCTCCATGACAAG TACATCAACATCTCGCAGATTCCGGAACTCTCAGCCATCAATAGAAGCAG CAAGGGCGTAGAGATCGGAGCTGTCGTGTCTATCTCCCAAGCCATCGACA TACTGTCGGATGGAGGCGCG---------------------------GTG TTTAGAAAGATCGCTGATCACCTGAGCAAAGTGGCCTCGCCGTTCGTCCG GAACACGGCGACCATTGGAGGCAACATCATCATGGCGCAGAGGTTGTCTT TCTCGTCGGACATCGCAACTGTTCTTCTCGCTGCAGGATCAACTGTCACC ATCCAGGTGGCCGCCAAGAGGATGTGCATCACTCTGGAGGAGTTCTTGAA GCAGCCTCCA---TGTGATTCCAGGACATTGCTGGTCAGCATCTCTATCC CGGATTGG------------------------GGTTCAGATGATGGCATC ACCTTTCAGACGTTTCGTGCGGCTCCTCGTCCACTTGGCAATGCTGTGTC ATATGTTAATTCTGCATTCTTGGCAAGAAGTTCAGTGGATGGATCATCA- --GGGAGCCATCTCATTGAGGATGTTTGCTTGGCATTCGGCCCCTTTGGG GCCAAGCACGCCATCAGAGCTAGGGAGGTTGAGAAGTTCTTGAAGGGAAA ATTGGTTAGTGCACCAGTGATACTTGAAGCAGTTCGTCTTCTGAAAGGTG TTGTTTCACCAGCTGAAGGCACAACACATCCTGAATACAGAGTCAGCTTG GCCGTCAGTTATCTGTTCAAATTCCTGTCTTCCCTTACTAATGGCTTGGA TGAGCCTGAAAATGCTAATGTTCCCAATGGTTCATTTACTAATGGAACCG CAAATGGTATTGTTGATTCCTCGCCAGAGAAGCACTCAAATGTTGACAGC TCTTATTTGCCAATAAAATCAAGGCAAGAGATGGTTTTCTCTGATGAATA CAGACCTATTGGAAAACCGATCGAGAAAACGGGAGCTGAGCTCCAAGCTT CTGGGGAGGCAGTGTATGTCGATGACATCTCTGCTCCAAAGGATTGCCTC TATGGGGCATTTATCTACAGCACACACCCTCACGCTCACATAAAAGGTGT AAACTTCAGATCATCTTTGGCTTCACAGAAGGTCATCACAGTTATCACTT TAAAGGACATTCCTACCAATGGAAAAAATATTGGATCATGCTCCCCAATG CTAGGAGATGAAGCGCTTTTCGTTGATCCTGTTTCTGAATTTGCTGGACA GAATATTGGTGTTGTGATTGCTGAAACTCAAAAGTATGCCTATATGGCGG CGAAGCAATCTGTGATCGAATATAGTACTGAAAATCTTCAGCCACCAATT CTGACAGTAGAAGACGCTGTCCAGCATAACAGCTACTTCCAAGTTCCCCC ATTTTTAGCTCCTACGCCAATTGGTGAGTTCAACCAAGCCATGTCTGAAG CTGATCACAAGATCATAGATGGGGAGGTGAAACTTGAATCCCAATACTAT TTCTACATGGAGACACAGACGGCCTTAGCTATCCCTGATGAAGATAACTG TATAACCCTCTATGTGTCGGCGCAACTACCTGAGATTACTCAAAATACTG TTGCGAGGTGCCTTGGCATTCCATATCACAACGTCCGTATCATCACGAGA AGAGTTGGAGGAGGTTTTGGTGGAAAGGCAATGAAAGCAATACATGTTGC AACTGCTTGTGCTGTCGCCGCATTCAAGCTGCGGCGTCCGGTTCGAATGT ACCTCGATCGCAAGACAGACATGATCATGGCGGGAGGGCGGCATCCGATG AAGGTAAAGTACTCCGTCGGTTTCAAGTCCGACGGCAAGATCACGGGTCT GCACGTTGATCTCAGAATCAACTGCGGAATATCGCCGGACTGCAGCCCGG CGTTGCCAGTCGCCATTGTCGGGGCTCTGAAGAAGTACAACTGGGGGGCT CTCTCCTTCGACATCAAGCTCTGCAAGACGAACGTCTCGTCGAAGTCGGC GATGCGGGCTCCCGGCGACGCGCAGGGCTCGTTCATCGCCGAGGCCATCG TCGAACACATCGCGTCTACTCTCTCAGTGGACACGAACGCCATCAGGAGG AAGAACCTCCATGACTTCGAGAGCCTCAAGGTGTTTTACGGGAATAGCGC CGGTGATCCTTCGACGTACAGCCTCGTCACCATCTTCGACAAGCTGGCGT CGTCGCCGGAGTACCAGCAGAGGGCCGCCGTGGTCGAGCATTTCAACGCC GGCAGCAGGTGGAAGAAGCGGGGCATTTCTTGCGTGCCGATCACCTACGA CGTGAGGCTCCGGCCATCTCCGGGGAAGGTGTCCATCATGAACGACGGCT CCATCGCCGTCGAGGTCGGCGGCGTCGAGATCGGGCAGGGGCTGTGGACG AAAGTGAAGCAG---ACAGCGTTCGCGCTGGGCCAGCTCTGCGATGATGG CGGCGAGGGCCTCCTCGACAAGGTCCGTGTCATCCAGGCCGACACCCTGA GCATGATCCAGGGAGGCTTCACCGGCGGGAGCACGACCTCCGAGACTAGC TGCGAGGCTGTTCGGAAGTCGTGCGCCGCCCTCGTGGAGAGGTTGAAGCC CATCAAGGAGAAGGCT---------------GGCACGCTACCATGGAAAT CCTTGATTGCCCAGGCAAGCATGGCGAGCGTGAAGCTGACAGAGCACGCG TACTGGACGCCTGACCCCACGTTCACTAGCTACTTGAACTATGGAGCTGC AATT---AGTGAGGTGGAAGTCGATGTGCTGACGGGAGAAACCACCATCC TGAGGAGCGACCTCGTGTACGACTGTGGGCAGAGCCTGAATCCTGCTGTG GACTTGGGCCAGGTGGAAGGCGCATTCGTGCAAGGGATCGGCTTCTTCAC GAACGAGGAGTACACGACCAACTCCGATGGGCTGGTCATCAACGACGGCA CGTGGACGTACAAGATCCCCACCGTGGACACCATCCCCAAGCAGTTCAAC  60 GTCGAGCTCATCAACAGCGCCCGCGATCACAAGCGCGTCCTCTCCTCCAA AGCGTCCGGTGAGCCGCCGCTGCTGCTGGCGTCGTCGGTGCACTGCGCGA TGAGGGAGGCGATCAGGGCGGCCAGGAAGGAG---------TTCGCCGGC GCCGGCGGCTCGTCGCTGACGTTCCAGATGGACGTGCCGGCGACGATGCC GATCGTCAAGGAGCTCTGCGGCCTCGACGTCGTGGAGAGAGATCTCGAGA GCTTTGCTGCCAAAGCC >V GAGCAGTCTGAACCA------------ACTGTCAACGACTGTCTGGTTTT TTCTGTTAATGGGGAGAGGTTTGAGGTCTCCACC---ATCCACCCTTCCA CTACTTTGCTTGAATTCTTGCGTTCTCACACTCCTTTCAAAGGTGCCAAG CTCAGCTGTGGTGAAGGTGGCTGTGGTGCTTGTGTTGTTCTTCTGTCCAA GTATGACCCTGTGCTTGACCAGGTGGATGATTTTGCAGTGAGTTCATGTC TTACACTGCTTTGCAGTATAAATGGATGTTCAATTACTACAACTGAAGGC CTTGGGAACATAAAAAATGGGTTCCACCCAATTCATGAAAGGTTCTCTGG ATTCCATGCTTCTCAGTGTGGCTTTTGTACTCCTGGAATGTGCATGTCAT TCTTCTCGGCTCTT------------------------CGGCCAGAGCCC CCTCTGGGATTCTCCAAGCTTAAA-------------------------- ----GGCTATTGCAGGAAATCT------------------------CTGT CGCTTTTTGCAGCAGATGTTGATATGGAGGATTTGGGGTTTAATTCTTTT TGGAGAAAGGGA---GATAGTAATGAAGTGAAAATAAGCAGCTTACCCTT GTATAACCATAATGATAAGATTTAC------------------------- --------------------------TCTAGAAGATACTCC--------- ---------------TGGAATAATCCTGTTAGCCTTGAGGAACTTCAAAG CTTATTGGAAAGC------------------------------------- -----------------------------------------TATGACAAA TATATTGATCTAAGATATATCCCTGAACTCTCAATGATTAGAAGGGATAA TAATGGGATAAAAATTGGAGCAACTGTAACAATTTCTAAAGCTATTGAAG CTCTAAGGGAATACAGCAAAGGAGAC---------------------GTC TATAAAAAAATTGCTGACCATATGGAAAAAATTGCTTCAGGGTTCATCCG GAACTCAGCTAGTCTAGGTGGAAATCTTGTGATGGCACAAAGGAACCATT TTCCATCTGACATTGCTACAGTACTTCTTGCAGTAGGTTCAACAGTAAAT ATAATGAATGGTCTCAAAAGTGAAGAGCTTACATTGGAGGAATTC----- ----------------------CAAAAGTATACTCTTAAGTGTCAAAATC CT------------ATTACAGGCATTTCTTCCGGGGCCAAGATGAAGTTA CTGTTTGAAACGTATCGAGCTGCACCACGACCCCTAGGAAATGCATTGCC CTATTTAAATGCTGCTTTAATGGCTGAAGTTTTTCATTGTAAAACTTCT- --AATGGGATTATTATAAGTAGCTGCCAGTTTGCTTTTGGTGCTTATGGG ACTAAACATCCAATAAGAGCTGCAAAAGTTGAAGAATTTTTAACTGGAAA AATGCTAAGTGTTGGTGTTCTATATGAAGCTATTAAATTAGTTAGAGGCA TTGTGGTACCTGATGATGGCACTTCAAGTCCAGCTTACAGGGCAAGCTTG GCTGTCAGTTTTCTTTTTGAGTTCTTTAGCCATTTGGTTGAGCCT----- ----------------------------------AATCCTGAATCTCATG ATGCTTCTGAACTAAAAAGAATTAGCAACCAGTTAGATCATGGTAAAATC CCAACCTTGCTATCTCCTGCAAAGCAGGTAGTGGAATTGAATAGACAGTA TCATCCAGTTGGTGAGCCAATTGCAAAATCTGGAGCTGCACTCCAAGCTT CTGGTGAGGCTGTTTATGTGGATGACATTCCTTCTCCAATGAATTGCCTA CACGGGGCTTTCATTTATAGTACGAAGCCTTACGCTCGAGTAAAGGGTAT CAAATTTAAGCCTAAATCACTGCCAGATGGAGTCAGTTCACTTATTTCTT TCAAAGATATCCCA------GGGGAGAACATAGGC---TCTAAAACTATA TTTGGTATTGAGCCTTTATTTGCTGATGATTTTACTCGATGTGCCGGACA GTATATTGCTTTTGTGGTTGCAGACACACAGAAACATGCAGATATGGCTG CAAACCTTGCAGTGGTTGATTATGATGTGGGAAATTTGGAACTGCCCATT TTATCTGTAGAAGAGGCTGTTAGGAGATCTAGCTTTTTTGAGGTTCCTTC TATCTTGAACCCAAAAAAGGTTGGTGATTTCTCGAGAGGAATGGCTGAAG CTGATCACAAGATTCTCTCTGCTGAGATCAAACTTGGGTCACAGTACTAT TTCTATATGGAGACACAAACTGCCCTTGCAATTCCAGATGAAGACAACTG CATTGTGGTTTACAGTTCAATACAATGCCCTGAATATGCACATAGTACTA TTTCGAGATGTCTTGGTATTCCTGAACATAATGTTCGTGTGATCACAAGA AGGGTTGGAGGTGGTTTTGGTGGAAAGGCCATAAGAGCAATGCCTGTTGC TACAGCATGTGCACTTGCAGCATACAAATTACGCCGCCCTGTCCGGATAT ATATGAATCGCAAAACTGATATGATAATAGCAGGAGGAAGACATCCAATG AAAATAACCTATAGTGTAGGATTCAAATCTGATGGCAAGATTACTGCCTT ACACCTTGATATATTAATCAATGCGGGAATAGCTGCAGATATAAGCCCAA TTATGCCTCACAACCTTCTGGGTGCCCTTAAAAAGTATGATTGGGGTGCT TTATCTTTTGATATAAAAGTTTGCAAAACAAACCATTCGACTAAATCAGC AATGCGTGCTCCTGGGGAGGTACAAGCTACATTTATTTCTGAAGCTGTAA TTGAACATGTAGCATCTACTCTTTCCATGGATGTGGACTCTGTGAGAAGC AAAAACCTCCATACTTTCAACAGCCTCAAATTTTTCTATGAGGGCAGTGC AGGTGAACCTGTTGATTACACTTTACCTTCAATCTGGGATAAGTTGGCTA GTTCTTCAAGACTTAAACAAAGAACTGAAATGATAAAGCAGTTTAATATG TGTAATAAATGGCAGAAAAGAGGTATTTCTCAAGTACCGATTGTGCATGA AGTTTCATTGAGGCCAACTCCAGGGAAAGTAAGCATTCTTAGTGATGGAT CTGTTGCTGTTGAAGTTGGAGGGATTGAGCTAGGCCAGGGGCTGTGGACC AAAGTGAAACAGATGGCTGCATTTGCTCTCAGCTCAATTCAGTGTGATGG AATGGGAGACTTCTTGGAGAAAGTAAGGGTCATACAATCAGATACATTAA  61 GCTTAATACAGGGGGGTTTTACTGCTGGAAGCACTACATCAGAGTCCAGC TGTGAAGCTATTAGACTCTGCTGCAATATTTTGGTTGAAAGACTAACTCC TACCAAGGAAAGATTG---CAGGAGCAAATGGGTTCTGTTGAATGGGGCA CACTGATTCTTCAGGCACAAAGTCAAGCTGTGAACTTATCAGCAAGTTCT TACTATGTCCCTGACTTTTCTTCCATGAAATACCTAAACTATGGTGCTGC TGTAATGTCACAGGTGGAGGTAAATCTTCTCACTGGAGAAACCACCATTT TGCAATCTGATATTATATATGACTGTGGGCAGAGCCTCAACCCTGCTGTG GATTTAGGACAGATAGAAGGAGCTTTTGTCCAAGGGATTGGGTTTTTTAT GCTCGAGGAATACACAACTAATTCAGAGGGACTGGTGGTCACTGAAGGCA CATGGACATACAAGATCCCAACAATTGACACCATACCCAAGCAGTTCAAT GTTGAGATACTGAACAGCGGACATCATACAAAACGTGTTCTTTCTTCTAA AGCTTCTGGTGAGCCACCATTACTTCTAGCAGTTTCAGTTCACTGTGCTA CAAGGGCAGCTATTAGAGAAGCCCGACAACAGCTTCTTTCCTGGACTGGG CTATGCAAGTCTGATTTGACATTCCAGTTGGAGGTCCCGGCAACAATGCC TGTTGTGAAGAATTTGTGCGGACTGGAGAATGTGGAGAGCTACTTACAAA GCTTGCTCTCT------    ABA.ABA2.fasta >A TCAACGAACACTGAATCTTCTTCTTATTCTTCTCTTCCTAGTCAAAGGCT TTTGGGTAAAGTGGCATTGATCACTGGAGGAGCCACAGGGATAGGTGAGA GCATTGTTCGTCTGTTCCACAAGCACGGTGCCAAAGTCTGCATTGTTGAT CTGCAAGAT---CTCGGAGGTGAGGTGTGTAAAAGTCTGCTTCGTGGTGA GTCCAAGGAGACGGCTTTTTTCATCCATGGCGATGTTAGAGTGGAAGATG ACATTAGCAATGCGGTTGACTTTGCAGTCAAAAATTTTGGGACGCTTGAT ATACTTATCAACAATGCAGGATTATGTGGAGCACCGTGCCCTGATATTCG TAATTATAGTTTGAGTGAGTTCGAGATGACCTTTGATGTGAAT---GAAG GAGCTTTTCTAAGCATGAAACATGCAGCTCGTGTAATGATACCGGAGAAG AAAGGGTCGATAGTTTCCTTATGTAGTGTGGGAGGTGTTGTGGGAGGCGT TGGTCCACATTCTTATGTTGGTTCCAAGCATGCTGTTCTAGGCTTGACTA GGAGTGTTGCAGCGGAGCTTGGACAGCACGGGATACGTGTGAACTGTGTT TCGCCTTACGCGGTTGCAACTAAACTCGCTTTGGCTCATTTGCCGGAGGA AGAAAGAACGGAGGATGCATTTGTTGGTTTCAGGAATTTTGCTGCTGCAA ACGCGAATCTAAAAGGGGTGGAACTGACGGTTGATGATGTAGCGAACGCT GTTCTGTTTTTGGCTAGCGATGACTCGCGGTACATAAGCGGA---GATTT GATGATTGATGGAGGATTCACTTGCACTAACCACTCCTTTAAAGTCTTCA GA--- >P ------GCCACCGCAAGCTCCACTGACTCATCCCTCTCTCCTCTAAGGTT ATTGGGCAAAGTAGCATTG---GCAGGTGGAGCTACCGGTATTGGGGAGA GCATTGCCCGGCTATTTTGCAGACATGGTGCAAAAGTTTGCATAGCTGAT TTGCAAGACAACCTTGGACAAAATGTTTGCGAGTCGCTT------GGTGG TGAGCCAAAAACTTGTTATATC---CATTGTGATGTCACAATAGAGGATG ATGTTCGCCAAGCTGTTGACTTTACTGTTGATAAATTTGGAACATTGGAT ATTATGGTTAACAATGCTGGGCTGGGAGGTCCCCCCTGTCCAGATATCCG TAAGGTGGCCTTATCAGACTTTGAAAAGGTGTTTGATGTAAATGTGAAGG GTGTTTTTCTTGGAATGAAGCATGCAGCACGGATTATGATCCCCCTAAAT AAGGGTTCAATTGTTTCTCTCTGTAGTGTTGCCAGTGCCATAGGGGGTAG C---CCACATGCTTACACAGGGTCAAAGCATGCTGTATTGGGTCTGACCA GAAGTGTTGCAGCTGAACTAGGAAAACATGGGATACGCGTAAACTGTGTC TCTCCTTATGGAGTTGCGACAAGCTTGGCTGTGGCTCATTTGCCCGAGGA TGAGAGGACTGAGGATGCCTTAATAGGTTTCCGCTCTTTTATTGGGAGGA ATGCTAACTTGCAAGGTGTGGAATTGACAGTTGATGATGTGGCCAATGCC GTGCTCTTCCTAGCAAGTGATGAAGCAAGGTACATAAGTGGGGATAATCT AATGCTTGATGGGGGCTTCACGTGCACAAACCACTCACTCCGTGTCTTCA GA--- >R ------GCCACAACCAGCTCCGTTGCTTCAACTCTCTCTTGCCAAAGGTT ATTGGGGAAAGTAGCTTTGGTAACAGGCGGATCGACTGGAATAGGAGAAA GCATTGTCCGTCTATTTCACAAACATGGTGCAAAAGTCTGCTTAGTTGAT TTGGAGGACAACCTAGGGCAAAATGTCTGCGAATCCCTT------GGTGG TGAACCAAACATTTGCTATTTC---CACTGCGATGTCACAGTAGAAGATG AGGTTCAACGTGCAGTTGAGTTCACTGTTGATAAATTTGGAACACTGGAT ATTATGGTCAATAATGCAGGTTTGTCAGGTCCACCTTGTCCAGACATCCG GTATACGGAATTATCCGACTTTCAGAAGGTATTTGATGTAAATGTGAAGG GCACGTTTATTGGAATGAAGCACGCAGCGAGAATTATGATCCCACTAAAT AAGGGTTCAATTATTTCTCTCTGTAGTGTGGCAAGCACCATTGGAGGCTT AGGCCCTCATGGATATACCGGGTCAAAGCATGCTGTTTTGGGACTGACCA GAAATGTTGCAGCTGAGCTAGGAAAACATGGGATACGTGTGAACTGTGTT TCTCCATATGCAGTTCCAACAAACTTGGCCTTGGCGCACTTGCATGAGGA TGAGAGAACTGAGGATGCCATGGCAGGTTTTAAAGCATTTGCCAGGAAGA ATGCTAATTTACAAGGGGTAGAATTGACAGCTGATGATGTTGCTAATTCT GTTCTCTTCTTGGCGAGTGAAGAATCAAGATACATTAGCGGGGAAAATCT  62 AATGATAGATGGTGGTTTTACTAATTCAAATCACTCGCTCAGAGTGTTCA GA--- >O ------TCCGCCGCCGCCGCCGCCGCCGCATCCTCCCCCGCTCCCCGGTT GGAAAGCAAGGTTGCGCTGGTTACCGGTGGTGCTTCAGGTATTGGTGAAG CAATTGTTCGCCTCTTTAGAGAGCATGGTGCAAAGGTATGTATTGCAGAT ATCCAAGATGAAGCAGGTCAGAAGCTCCGGGACTCCCTT------GGAGG TGACCAAGATGTCTTATTTGTC---CACTGCGATGTTTCGGTGGAAGAGG ATGTAGCCCGAGCGGTCGATGCAACAGCTGAAAAGTTTGGTACTCTTGAC ATCATGGTCAACAATGCTGGCTTTACAGGCCAGAAAATCACAGATATCCG AAACATCGACTTTTCTGAAGTCAGGAAGGTAATCGACATCAATTTAGTTG GTGTATTCCACGGGATGAAACACGCAGCGCGCATCATGATCCCCAATAAG AAGGGGTCCATCATCTCATTGGGAAGTGTTTCTAGTGTCATTGGAGGGTT GGGACCTCATTCATACACAGCAACCAAGCATGCTGTGGTGGGTCTAACCA AGAATGTAGCTGGGGAATTGGGGAAGCATGGGATACGCGTGAACTGCGTA TCTCCCTATGCAGTGCCCACGGCTCTCTCCATGCCGTATCTGCCCCAGGG CGAGCGCAAGGATGATGCCCTGAAAGACTTTTTCGCCTTTGTTGGTGGTG AAGCAAACCTGAAAGGTGTGGATCTGCTACCTAAGGATGTTGCTCAAGCA GTGCTCTACTTGGCAAGCGATGAAGCGAGGTACATCAGCGCGCTCAACCT CATGGTGGATGGTGGCTTTACCTCTGTGAATCACAATTTGAGAGCATTTG AAGAT >V ------------------------------CCTATGCTTAATAGAGTATT ATTAGGGAAAGTGGCGCTGGTCACTGGTGGAGCCACTGGAATTGGAGAGA GTATCGTGCGTCTATTCCTTAAGCAAGGTGCAAAAGTTTGTATTGTTGAT GTGCAAGATGACCTTGGCCAGAAGCTCTGTGACACGCTT------GGCGG TGACCCAAATGTAAGTTTTTTC---CATTGTGATGTCACAATAGAGGATG ATGTTTGCCATGCAGTCGACTTCACAGTTACTAAATTTGGCACACTTGAC ATTATGGTCAACAATGCTGGCATGGCAGGCCCACCTTGTTCTGATATTCG TAACGTGGAAGTATCAATGTTTGAGAAGGTATTTGATGTAAATGTAAAGG GTGTCTTCCTTGGAATGAAGCATGCGGCTCGTATCATGATCCCATTGAAG AAAGGAACAATCATATCCTTATGCAGTGTTTCGAGTGCCATAGCAGGTGT TGGCCCACATGCATACACAGGTTCTAAGTGTGCTGTTGCTGGCCTGACAC AGAGTGTTGCCGCGGAGATGGGGGGACATGGGATACGAGTCAACTGCATT TCACCCTATGCAATTGCTACAGGCTTGGCTTTGGCTCACCTGCCTGAGGA TGAGAGGACGGAGGATGCCATGGCTGGTTTCCGTGCTTTCGTAGGAAAAA ATGCAAACTTGCAGGGGGTGGAATTGACAGTTGATGACGTTGCTCATGCT GCAGTCTTCTTAGCTAGCGACGAGGCGAGGTACATAAGCGGCCTTAATCT CATGCTTGATGGGGGCTTCTCCTGCACAAATCACTCGCTTCGGGTCTTCA GA---    ABA.NCED.fasta >A ---------------------------------CAACACTCTCTTCGT-- -------------TCTGATCTTCTTCCGACGAAGACTTCTCCTCGTTCTC ATTTACTTCCACAACCCAAAAATGCAAATATTTCTCGACGAATTCTCATT AACCCTTTC---AAGATACCGACACTT------------------CCTGA TCTCACTTCTCCGGTTCCGTCACCGGTTAAGCTCAAACCAACGTATCCAA AC---------------------------TTAAACCTTCTTCAGAAGCTA GCGGCTACGATGCTCGACAAGATTGAG---TCCTCTATCGTTATTCCTAT GGAGCAGAATCGCCCGCTTCCTAAACCGACCGACCCGGCGGTTCAATTAT CAGGTAACTTCGCTCCGGTTAATGAATGTCCGGTTCAGAACGGTTTAGAA GTGGTTGGTCAGATTCCTTCTTGTCTAAAAGGAGTTTACATCCGTAACGG TGCAAACCCTATGTTTCCGCCGTTAGCCGGACATCATTTATTTGACGGTG ACGGAATGATTCACGCCGTTAGTATCGGTTTTGATAACCAGGTTAGTTAC AGCTGCCGGTACACTAAAACAAACCGGCTTGTTCAAGAAACCGCGCTTGG ACGATCGGTTTTCCCTAAACCAATCGGCGAGCTTCACGGCCATTCCGGTC TAGCTCGACTCGCTCTCTTCACGGCTCGAGCTGGGATCGGTCTAGTGGAC GGGACACGTGGCATGGGCGTAGCTAACGCCGGTGTGGTTTTCTTTAACGG CAGGTTATTAGCCATGTCAGAAGATGATCTTCCTTACCAAGTGAAGATCG ACGGTCAAGGAGATCTTGAGACGATCGGACGGTTCGGATTCGAC---CAG ATTGACTCTTCAGTGATAGCGCATCCTAAGGTGGACGCGACCACAGGAGA TCTCCATACACTGAGCTACAACGTTTTGAAGAAACCTCATCTCAGGTATC TTAAATTCAACACGTGCGGGAAAAAGACACGTGACGTGGAGATCACGCTC CCTGAACCAACGATGATTCATGATTTCGCGATAACCGAGAATTTTGTCGT TATACCGGATCAGCAAATGGTATTCAAATTATCCGAAATGATTCGGGGCG GGTCACCCGTTATCTACGTTAAAGAAAAAATGGCGAGATTTGGAGTTTTG TCAAAGCAGGATCCCGGG---TCGGATATAAATTGGGTTGATGTACCGGA TTGTTTCTGTTTCCATCTATGGAATGCGTGGGAAGAGAGAACCGAAGAGG GAGACCCAGTTATCGTCGTAATCGGGTCATGTATGAGCCCACCCGACACG ATCTTTAGTGAATCAGGAGAACCAACCCGGGTTGAATTAAGTGAGATCCG GTTAAACATGCGTACAAAAGAATCGAACCGTAAGGTTATCGTA------- --ACCGGAGTGAATTTAGAAGCGGGTCACATAAACCGTAGTTACGTGGGC  63 CGGAAAAGCCAGTTCGTTTACATAGCAATAGCCGATCCTTGGCCCAAATG CAGTGGCATTGCGAAGGTAGATATACAAAACGGCACCGTTTCAGAGTTTA ATTACGGACCGAGCCGGTTCGGTGGAGAACCGTGCTTTGTACCGGAGGGA -------------------------------------------------- ----------GAAGGAGAAGAAGACAAAGGTTATGTAATGGGGTTTGTGA GAGACGAAGAGAAAGACGAGTCGGAGTTTGTGGTGGTCGACGCGACGGAT ATGAAGCAAGTCGCGGCGGTGCGCTTGCCGGAGAGGGTACCTTATGGTTT CCATGGAACGTTCGTGAGCGAGAATCAGTTGAAGGAACAAGTTTTC--- >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------GCTCGAGCTGCAGTCGGCTTTGTTGAT GGGACACGTGGCAGCGGTGTAGCCAATGCCGGGCTTGTCTATTTTAACGG TAGATTACTGGCGATGTCAGAGGATGATCTTCCTTATAATGTTAAGATCA AGAGTGACGGCGATATGGAAACGATCGGACGGTTCAATTTTGATGATCAG CTTGATTGTCCCATGATTGCACACCCTAAGGTGGACCCTGTAACTGGTGA GCTCCATGCACTTAGTTACAACGTTATCAAGAAACCCTATCTAAAGTACT TTAGATTTGATGCATGCGCTAAGAAGTCATGTGACTTGGATGTTACATTG GACCAGCCAACTATGATCCACGACTTTGCAATCACAAAAAATTTTATGGT GATCCCGGATCACCAAGTCGTGTTCAAGTTATCGGAGATGATTCGAGGCG GGTCACCCGTAATTTATGATCAAAGCAAGATTTCACGGTTTGGAGTCTTG TCAAAAAAAGCTGTCGATGATTCAAGAATTCAGTGGATTGACGTTCCGGA TTGCTTTTGTTTCCATTTGTGCAATGCATGGGAAGAGAATTCTAGTGACG GAGACAAGATTATTGTTGTTATCGGGTCGTGCATGGACCCGCCTGATTCC ATCTTCAACCAATCTGAACACCCGCTTCGAAGTGAGTTGTCTGAAATCCG TTTGAATCTGAGGACAGGAGAGTCAACTCGAAGGGTTATTGTC------- --GGGGGTATGAATTTGGAAGCGGGTCAAGTAAACCGAAGGTTTCTAGGT CAAAAAACCCGGTTCGTTTACCTAGCAATTGCAGAGCCTTGGCCAAAGTG TAGTGGAATTGCAAAAGTTGATTTGGAGACTGACGAGGTGACCAAATTTA TTTATGGTGCTGGTAGGTTTGGTGGTGAGCCATGTTACGTGCCCAAAAAT ------------------------------------GGAAATGTTGGCGA TAATGGAAGAAGTGATGATGACGGCGAAGGCTTCATAATGGGTTTCGTGA GAGATGAGGAAAAGGGGAGGTCAGAATTGGTGATAGTGAATTCATCGAGC ATGAGTCAAGTAGCTTCAGTGAAAATGCCCACTAGAGTGCCCTATGGCTT CCATGGTACTTTTGTCAGCGAAGCTGATTTAAAACAACAATCTGTG--- >R ---------------------------------CAAGCCTCTCTTCGCTT CTCTAATAGTTCTTCCTCTTTACTCTCAGACCCTAAAACACAACAAAATT ACACCAAAACACCATCTATAACATGCAAAATCATCATCAATCCTTCAAAG AAAAAATTT---CCTTTGAAAAAGCTGCCACTCTCACTGCCGCCTCCACC ATTATCGGAACCTGCACCACCATCACTAGAACCGGGACCCACGTTCACCA CTCCAAGAGAAACTGACCACCCTATTGCTTTAAACCCACTTCAAAAGCTT GCAGCTTTAGCTTTAGACAAAATAGAA---TCTTCACTGCTTGTACCGTT TGAAAGAAACCATTTATTACCAAGAACCATTGACCCGACAGTTCAAATTT CAGGTAATTTCGCGCCGGTTCTTGAGTGTCCGGTTCATCATGGTCTAGAA GTTGTGGGCCATATTCCGAACAGCTTACGTGGCGTTTACTTACGAAACGG TGCAAATCCTGTGTATGCACCCACAGGCGGCCACCACTTATTTGACGGTG ATGGTATGGTTCATGCAGTTACTTTGGGATATGAAAACCGAGCCAGTTAT AGCTGCAGGTTCACTCGTACGAGCCGGCTCGAGCAAGAAGCCGCATTGGG CAGGTCAGTTTTCCCTAAACCAATTGGTGAGCTGCATGGACACTTAGGTT TTGCTCGGCTTTTAATATTCATGGTTCGAGCCGGTATCGGTCTGGTAGAT GGGTCACGTGGCACAGGCGTAGCAAACGCTGGGTTAGTTTATTTCAACGG TCGATTATTAGCCATGTCAGAGGATGATCTTCCTTATCATGTAAAGATCA AGGGTGATGGTGATCTTGAAACGATCAAACGGTTCAGTTTCGATGATCAA CTTGATTGTCCAATGATTGCACACCCTAAGGTGGACCCTGTAACCGGCGA GCTCCATGCATTAAGTTACAACGTAGTACAAAAGCCTTACTTGAAATACT TCAAGTTTGACAAGTACGGCAAAAAGTCACGTGACTTGGATATAACCTTA CACCAGCCCACAATGATCCATGACTTTGCGGTCACCAGGAATTTCGTAGT AATACCGGATCACCAAGTAGTTTTCAAGTTATCCGAGATGATTCGTGGCG GGTCACCCGTAATTTACGACAAAAACAAGACTTCAAGGTTTGGAATTTTA TCAAAAAATGAAGTGAATGAGTCTGGGATTCAATGGATTGAGGTACCAAA TTGTTTTTGCTTTCATTTGTGGAATTCATGGGAGGAAATTTCTACTAACG GTGATAAAATTATTGTTGTTATCGGGTCATGCATGAACCCACCCGATTCG  64 ATCTTCAATGAATCCGAAACAGCAATTCAAAGTGAACTATCAGAGATTCG CTTAAACATGAGGACCCGAGAGTCAACCCGGAAAGCCATAGTC------- --AGGGGCATGAATTTAGAAGCGGGTCAAGTAAACCGAAAGTTTGTGGGT CAGAAAACCCGGTATGTATACTTGGCAATAGCGGAACCATGGCCGAAGTG TAGTGGTATTGCTAAGGTTGATTTGGAGACTAAGGAAGTGACTAAATTTA TGTATGGTAAAGGAAGGTATGGAGGAGAGCCCTTTTTCGTGGCAAAAAAT AGAGAAGGAGAAGAAGAAGAAGATGATGATGATGATGGTAAGAAAATTGG CAATGTTATTAATGATGAAGAAGGTGAAGGATACATTATGGGTTTTGTAA GAGATGAGATAAAGGAAAGGTCTGAGTTGGTGATAGTGAATGCAACAGGC ATGGAGCAAGTAGCTTCCGTAAGTTTGCCCACTCGAGTGCCTTATGGATT TCATGGTACTTTTGTTAGTGAAGATGAATTAAAAGGACAGGCTTTGTCT >O GCGACGATCACGACGCCAGGATATGCTCACATACAGCGGCAGCACGGCAG GTGCTCGACGACGGCGGGAAGGCGTGGGGCGTCCAATTCGGTGAGATTCT CCGCGCGCGCGGTTAGCTCCGTGCCGCACGCGGCGGCGGCGTCATCGGCG CCGGCGTTCCTGCCGGTGCCGTTCGTG------------------CCTGG GGCCGACGCACCGTCGCCGTCGGGGAAGAGTGCCATTGGCGTCCCGAAGG CGCCGAGGAAGGGGGAGGAGGGGAAGAGGCTCAACTTCTTCCAGCGCGCC GCGGCGATGGCGCTCGACGCGTTCGAGGAGGGGTTTGTGGCGAATGTCCT CGAGCGCCCGCACGGGCTGCCGAGCACGGCCGACCCCGCGGTGCAGATCG CCGGCAACTTCGCGCCGGTCGGTGAGACGCCGCCCGCGCGCGCGCTGCCG GTGTCGGGGCGCATCCCGCCCTTCATCAACGGCGTCTACGCGCGCAACGG CGCCAACCCGCACTTCGACCCCGTCGCCGGGCACCACCTGTTCGACGGCG ATGGC---GTGCACGCCGTCAGGATACGCAACGGCGCCGCCGAGTCGTAC GCGTGCCGGTTCACGGAGACCGCGCGGCTGCGGCAGGAGCGCGCGATGGG GCGGCCCATGTTCCCCAAGGCCATTGGGGAGCTCCATGGCCACTCCGGCA TCGCGCGCCTTGCTCTGTTCTACGCGCGCGCCGCCTGCGGCCTCCTCGAC CCGTCACACGGCACCGGCGTCGCCAACGCCGGCCTCATCTACTTCAACGG CAGGCTCCTCGCCATGTCGGAGGACGACCTCCCCTACCAGGTGCGCGTCA CCGCCGACGGCGACCTCGAGACCGTCGGCCGCTACGACTTCGACGGGCAG CTCGGCTGCGCCATGATCGCGCACCCCAAGCTCGACCCGGCCACCGGAGA GCTCCACGCGCTCAGCTACGACGTGATCAAGAAGCCGTACCTCAAGTACT TCTACTTCGCGCCCGACGGCACCAAGTCGGCCGACGTCGAGATCCCGCTC GACCAGCCCACCATGATCCACGACTTCGCCATCACCGAGAACTACGTGGT GGTACCCGACCACCAGGTGGTGTTCAAGCTCCAGGAGATGCTCCGCGGCG GCTCGCCCGTGGTGCTCGACAAGGAGAAGACGTCGCGGTTCGGGGTGCTC CCCAAGCACGCCGCGGACGCGTCGGAGATGGTGTGGGTGGACGTCCCGGA CTGCTTCTGCTTCCACCTCTGGAACGCGTGGGAGGAGGCGGACACCGACG AG---------GTGGTGGTGATCGGCTCGTGCATGACCCCCGCCGACTCC ATCTTCAACGAGTCCGACGACCGCCTCGAGAGCGTCCTCACCGAGATCCG CCTCAACACCCGCACCGGCGAGTCGACGCGGCGCGCCATCCTGCCGCCGT CGAGCCAGGTCAACCTCGAGGTGGGCATGGTCAACCGCAACCTCCTCGGC CGCAAGACGCGGTACGCCTACCTCGCCGTGGCCGAGCCGTGGCCCAAGGT GTCGGGCTTCGCCAAGGTGGACCTCGCCACGGGTGAGCTCACCAAGTTCG AGTACGGCGAGGGCCGGTTCGGCGGCGAGCCCTGCTTCGTCCCCGACGCC ------------------------------------------------GC CGCCGCCACGCCCCGCGGCGAGGACGACGGCTACATCCTGTCCTTCGTCC ACGACGAGCGCGCCGGGACCTCCGAGCTCCTCGTCGTCAATGCCGCCGAC ATGCGCCTTGAGGCCACCGTGCAGCTGCCGTCCCGCGTGCCGTACGGCTT CCACGGCACGTTCATCACCGGCGACGAGCTCACCACCCAGGCC------ >V ---------------------------------CAAGCTTCTCCTGGCTT CTCCTCCACCGCCATCACCTCTGCTCCTGAATCACCTGCTCCTACTAAAC TTCACCCACCGCCATCC---------AAACTTCTCATCCAAACATCAAAC CCACCACTC---CCCCTCAAACTTATT------------------GCTCC ATTAACCTCTCCCCTTGCAACT---------------------------- --------------AAATGGCCTTCTCACCTCAACCCACTTCAGAAACTC GCTGCCTCTGCCCTAGACATGGTTGAG---TGCTTCCTGATCCACCGATT GGACAACAAACACACCCTCCCCAAGCCCCTCGACCCCGCTGTTCAACTTG TTGGCAACTTCGCCCCAGTTCGGGAGTGTCCTGTTCAGCACGACCTCCAG GTGCTGGGTCAGCTTCCGCCAGCTCTCCGTGGCGTCTACTTGCGAAACGG CGCCAATCCCATGCTCTCTCCAGCCGGTGGTCACCACCTCTTCGACGGTG ACGGCATGATACATGCTGTTACCTTGGGCCCAGGCAACAGAGCCAGCTAC AGCTGCCGGTTCACCCGCACGAGCCGGCTGGTGCAGGAAGCCGCATTAGG AAGGCCGCTGTTTCCCAAACCGATCGGTGAGCTGCATGGCCACTCTGGGA TAGCTCGGCTGGCGCTGTTCTACGCCCGCGCCGCAGTAGGCTTGGTGGAT GGATCACGAGGCACAGGTGTCGCAAATGCTGGCCTCGTCTATTTCAACGG TCGGCTTCTCGCCATGTCAGAGGATGACCTGCCCTACCACGTGAAGATCA AAGGCGATGGAGACCTGGAGACCACCGGACGCTTCGACTTCTCAGGACAG ATGGACCGTCCGATGATAGCGCATCCCAAGGTGGACCCCATAACAGGGGA GCTTTTCTCTCTCAGCTACAACGTGGTGAAGAAGCCCTACCTCAAGTATT ATAAGTTCGGCACGTGCGGAGAAAAGTCACGTGAGGTATCGATTTCCCTC CAACAGCCCACGATCATCCACGACTTCGCTTTAACGGAGACCTCCGTGGT GATCCCAGACCACCAGGTGGTTTTCAAACTATCGGAAATGGTTCGGGGCG GCTCACCTGTTATCCACGACCCGAATAAGATCTCCCGCTTCGGAGTCCTA  65 CCCAGAAACGATCCCGACGAATCCAGAATTCAGTGGATCGACGTCCCCGA CTGCTTCTGTTTCCACCTCTGGAACGCCTGGGACGAGCGCTCCAGCTCCG GTGACAGAATCGTGGTGGTGATTGGGTCGTGCATGAGCCCCGCAGACTCG ATCTTCAAGGAACGGGTCGACCCGCTTCGGAGCGAGTTATCGGAGATCAG ACTGAACTTAACGACGGGAGGGTCAAGCCGGCGGGTAATAGTG------- --GCGGGGATGAATCTGGAAGCGGGGCAAGTGGACAAGCGCCGGCTGGGA AGGAGAACACGGTACATATACCTGGCGATAGCAGAGCCATGGCCCAAATG CTCGGGCATGGCGAAGGTAGATTTGGTGACCGGAGAGGTAACCAAGATGA TGTACGGCGAGGGAAGGTTCGGTGGGGAGGCGTGTTTCGTGGGGGAGGAG -------------------------------------------------- ----------GAAGGAGGAGAAGGAGAAGGGTGGTTGATGAGTATAGTGA GGGACGAGAAGAGGGAGAGGTCAGAGCTAATCGTGGTGGAAGCTGACGAC ATTAAGCAGGTGGCTTCGGTCAGGTTGCCGACCAGGGTTCCCTACGGCTT TCATGGGACTTTTGTTGATTCTCAACAATTGAGGGCACAGCGTGTCTGT    ABA.Vde.fasta >A GCAGTAGCTACACATTGTTTCACTTCACCTTGTCATGACCGTATTCGATT TTTCTCAAGTGATGATGGTATTGGGCTTGGCATTACAAGA---------- --------AAGAGGATCAATGGCACTTTCTTGCTCAAGATTTTACCTCCA ATCCAAAGTGCT------------------------------GATCTCAG AACAACTGGTGGGAGATCCTCACGTCCTTTATCTGCATTCAGGTCAGGAT TCTCT------------------------------------AAGGGGATA TTTGACATTGTGCCATTACCATCAAAGAATGAGCTGAAAGAGCTGACCGC TCCGCTGTTGCTAAAACTCGTGGGTGTTTTAGCTTGCGCGTTCCTTATTG TTCCATCTGCAGATGCAGTTGATGCACTTAAAACTTGTGCATGCTTATTG AAGGGATGCAGGATAGAACTCGCAAAGTGCATTGCCAACCCTGCCTGTGC AGCCAATGTCGCGTGCCTTCAGACCTGCAATAACCGTCCAGATGAAACCG AGTGCCAG---------ATTAAATGTGGGGATCTGTTTGAGAACAGTGTT GTTGATGAGTTCAACGAGTGTGCTGTGTCGAGAAAAAAGTGTGTTCCTAG AAAATCTGATCTCGGAGAATTTCCTGCCCCAGACCCTTCTGTTCTTGTAC AGAACTTCAACATCTCGGACTTTAACGGGAAGTGGTACATTACAAGTGGC TTGAATCCAACCTTTGATGCCTTCGACTGCCAGCTGCATGAGTTCCACAC AGAAGGTGACAACAAGCTTGTTGGAAACATCTCTTGGAGAATAAAGACCC TAGACAGTGGATTCTTTACTAGGTCAGCCGTACAAAAATTCGTGCAAGAT CCTAACCAACCTGGTGTTCTCTACAATCATGACAACGAGTACCTTCACTA TCAAGATGACTGGTATATCCTGTCATCAAAGATAGAGAATAAACCTGAAG ACTATATATTTGTATACTACCGTGGGCGAAACGATGCTTGGGATGGATAT GGTGGTGCAGTTGTATACACGAGAAGTTCTGTATTACCCAATAGCATTAT ACCAGAACTCGAAAAAGCAGCAAAAAGCATAGGCAGAGACTTCAGCACAT TCATTAGAACGGATAACACATGTGGTCCTGAACCTGCGCTCGTGGAGAGA ATTGAGAAGACAGTGGAAGAAGGTGAAAGGATAATCGTAAAAGAGGTTGA AGAGATAGAAGAAGAGGTAGAGAAGGAAGTGGAGAAGGTCGGTAGGACTG AGATGACCTTGTTCCAGAGATTGGCTGAAGGATTTAATGAACTGAAGCAA GACGAGGAGAATTTCGTGAGAGAGTTAAGTAAAGAAGAGATGGAGTTTTT GGATGAGATCAAAATGGAAGCAAGTGAGGTTGAAAAATTGTTTGGGAAAG CTTTGCCAATCAGGAAGGTCAGG >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ----------TTGAAACTGGCTGGCATACTACTATGTGCATTACTGGTCA TTCCATCAGCTGATGCCGTTGATGCTCTCAAAACTTGTACCTGCTTATTG AAGGAGTGCAGGCTAGAATTGGCAAAGTGTATTGCAAACCCATCTTGTGC AGCTAATGTTGCTTGCCTCCAGACATGCAATAACCGGCCTGATGAGACTG AATGCCAGGCAAGTTCTATCAAATGTGGTGACCTATTTGAAAACAGTGTT GTCGATGAATTCAATGAGTGTGCAGTTTCACGAAAGAAGTGTGTACCTCG GAAGTCTGATGTTGGGGAATTCCCTGTCCCTGATCCTGCTGTTCTTGTCG AGAACTTC---ATGGCAGATTTCAGTGGGAAGTGGTTCATCACTAGTGGC CTAAATCCTACTTTTGATACTTTTGACTGCCAATTGCATGAATTCCATAC AGAATCCAAC---AAGCTTGTTGGAAACTTGTCATGGAGGATAAAAACTC CAGATACTGGCTTTTTCACTCGATCAGCTGTGCAGAGGTTTGTGCAAGAT CCAGTGCATCCTGGAATACTCTACAATCACGACAATGAGTATCTTCACTA TCAAGATGACTGGTATATTTTATCATCGAAGATAGAAAATAAACAAGATG ATTATGTATTTGTGTACTACCAAGGCAGAAATGATGCATGGGATGGATAT GGCGGTGCAGTTGTGTACACAAGAAGTGCAGTTCTACCAGAAAGCATTGT TCCTGAACTTGAGAAGGCAGCAAAAAGCGTAGGAAGAGACTTTAGCAAAT TCATCAGAACAGATAATACTTGTGGGCCTGAGCCTCCCCTTGTAGAGAGA CTGGAGAAGACTGTAGAGGAAGGGGAGAAGACTATTATAAAGGAGGTTGA  66 AGAAATAGAAGAGAAGGTAGAG------------AAGGCAGGGAAGACTG AGTTGAGCTTGTTCCAGAGATTGACAGAAGGATTTAAAGAAATACAAAAA GACGAGGAAAATTTCTTAAGAGAATTAAGTAAAGAAGAGACGGATCTATT AAATGATCTGAGAATGGAAGCAGGTGAGGTGGAGAAACTCTTTGGACGAG CACTGCCTATAAGGAAATTAAGA >R GCGTTGGCTGCAAACTCAATCTGTTTATCTCATGAAGAAAGTATTAGTAG TAGTTGCTTCAAATCAGGATTTGCAATAAGTGATGAAAGGTTTCAGTTGA GGAGGGGATCTCATTCTCACAGTGTATTTGTGTTGAGATTTTTCCCCAAA AGCAGAAAGTCAAGATATGTTCAGTTGAAGAGTACTCATAGGAATTATCG TGGGCTTCAGTTAAGATGCTCGCATCGGTTCTCAGGCTGGACTAAGAAGT TGTCCTCATTGTGTAGCACTGGTGCAAGTATAACTAAGGTAAACGAAGCC GTTGATTTCCTGATGATTAATGTGTCAAACAGCCTGAAGGTAAGGAGCCG CTTCCAGCTCTTGAAAGTTGCTGGCATACTGGCATGCGCATTATTAATCA TTCCATCAGCTGATGCTGTTGATGCTCTCAAAACATGTACTTGCTTATTG AAGGAGTGCAGGCTAGAATTGGTCAAGTGCATTGCAAATCCAGCATGTGC TGCCAACGTTGCTTGTCTTCAGACCTGCAATAACCGGCCTGATGAGACTG AATGCCAG---------ATCAAATGCGGAGACTTGTTTCAAAACAGTGTT GTTGACGAATTCAATGAGTGTGCAGTCTCACGAAAGAAGTGTGTACCTCA GAAATCTGATGTTGGTGACTTTCCTGTCCCTGATCCTGCTGTACTTGTCA AAAGCTTTAACATTGCAGATTTCAGTGGGAAGTGGTTTATTACTAGTGGC CTAAATCCTACCTTCGATACTTTTGATTGCCAATTGCATGAATTCCATAC AGAATCTGAC---AAACTTGTGGGAAATCTAACATGGAGAATTCGAACTC TAGATAGTGGCTTTTTCACTCGATCGGCTGTGCAGAGGTTTGTTCAAGAT CCTGTGCAGCCTGGGATACTCTACAATCATGACAATGAGTTTCTTCATTA TCAAGATGATTGGTATATTTTGTCGTCCAAGATAGAAAATAGCAATGATG ATTATGTATTCGTGTACTATCGGGGCAAGAATGATGCATGGGATGGATAT GGTGGTGCTGTTGTATATACAAGAAGTGCAGTTTTGCCAGAAAGCATCAT ACCTGAACTGGAAAGAGCAGCTAAAAGCGTAGGACGAGATTTCAACAAGT TTATTAGAACAGATAATACTTGTGGACCTGAGCCTCCCCTTGTTGAGAGA CTAGAGAAAACAGTAGAGGAAGGGGAGAAGACCATTATACGGGAGGTTGA GGAAATTGAAGGGGAGGTAGAG------------AAGGTTGGGAAGACCG AAATGACCTTGTTGCAGAGATTGGCAGAAGGGCTTAAAGAGCTCCAACAA GATGAGGAATTTTTCCTGAGGGAGCTAAGTAAAGAAGAAAAAGATATATT GAATGGATTGCAAATGGAAGCAACTGAGGTGGAAAAACTCTTTGGGGGAG CATTGCCATTAAGGAAATTAAGA >O -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------ACAGGGCTGGTGGCGTGTGCTGTTCTTGTAG TCCCTTCTGCCGATGCTGTGGATGCTCTCAAGACATGCACTTGCCTTCTC AAGGAGTGCAGAATAGAGCTGGCCAAATGCATAGCAAACCCATCCTGTGC AGCGAATGTAGCATGCTTAAATACATGCAACAATCGCCCTGACGAGACTG AATGCCAG---------ATCAAATGTGGAGATCTGTTTGAGAACACTGTG GTCGATGAGTTCAACGAGTGTGCTGTTTCGCGCAAGAAATGCGTCCCACA AAAGTCCGACGTTGGCGAGTTCCCAGTCCCTGATCCATCCGCCCTTGTCA AGAACTTCAACATGGCTGATTTCAACGGCAAGTGGTATATTTCAAGTGGC CTCAATCCCACTTTCGACACATTCGATTGCCAACTTCACGAGTTCCGTGT CGAGGGAGAC---AAACTTATAGCGAACTTGACATGGAGAATTCGCACCC CCGACTCTGGCTTCTTCACCAGAACAGCCATACAGCGGTTTGTGCAGGAC CCAGCACAACCCGCGATCCTCTATAACCATGACAACGAGTTCCTGCACTA TCAAGATGACTGGTACATTATCTCATCCAAAGTAGAGAACAAGGAAGATG ACTACATTTTCGTGTACTACCGCGGCAGAAATGATGCGTGGGATGGATAT GGAGGTGCTGTTCTGTACACCAGAAGCAAAGTTGTGCCTGAATCAATAGT ACCTGAGCTAGAAAGGGCGGCAAAAAGCGTAGGTCGTGACTTCTCCACAT TCATCAGAACCGACAACACCTGCGGTCCTGAGCCACCTCTTGTGGAGAGA ATAGAGAAGACCGTCGAGCAAGGAGAGAAGACCATCATCAGGGAAGTGCA GGAGATCGAGGGCGAGATCGAGGGAGAGGTGAAGGAGCTGGAGGAGGAGG AGGTCACATTGTTCAAGAGGTTGACAGATGGCCTCATGGAGGTGAAACAG GACTTGATGAACTTCTTTCAGGGGCTAAGCAAGGAGGAGATGGAGCTTTT GGATCAGATGAACATGGAAGCAACTGAGGTTGAGAAGGTCTTCAGCCGCG CCCTGCCAATAAGGAAACTAAGG >V GCATTGGCAGCACATCCAACTTGTTTCTCCCATGATGAAAGTACCAGTTC ATGTTGT------GCATCATGGCTTAAAAGAGGTGAAAGGTTTCTGAGGA AGGGGCCTGTTCATGTTCATGGAGTAGTTATGGTCAAAGTTTCCTCCAAA TGCAGAAGTTCCAGACATTCCAAGCTATTAAGATCTTACAGAAATTGTAT TCAGGTGGAGTCCAAATATCCAAATTTTCTCTCACACAGAACACACAAGA TTTCTCCAATGTGTGGCAGTAATAACATTATACCTGAGGTAGAAGAGGTA TTTGAATTTCCAGTTGCAACTGTATTGAATCTTTTAAAGAAATGGAGCCA  67 GTTGCATTTCATGAAAGTAGTCGGTGTACTAGCTTGCACAATGTTGCTTA TTCCTTCAGCCAATGCTGTTGATGCTCTCAAAACATGTACTTGCTTACTG AAGGAATGCAGGTTGGAACTCGCCAAGTGCATTGCAAACCCATCTTGCGC AGCCAATGTTGCTTGTCTCCAGACCTGCAACAACAGACCTGATGAGACTG AATGCCAG---------ATTAAATGTGGAGACCTTTTTGAAAACAATGTG GTAGATGAATTCAACGAGTGTGCTGTCTCACGAAAGAAATGTGTGCCTAG AAAATCTGATATAGGAGAATTTCCTGTCCCAGACCCAGCTGTTCTTGTTA AGAACTTTAACATTGCAGATTTCAGTGGGAAGTGGTTCATAACTAGTGGC CTAAATCCTACATTTGATACTTTTGATTGCCAATTGCATGAATTCCACAC AGAGTCCAAC---AAACTTGTGGGAAATTTGTCATGGCGAATACGAACTC CAGACGGTGGGTTTTTCACCCGATCAACAATGCAGAGATTTGTACAAGAT CCAAACCAGCCTGGAATACTCTACAATCACGATAATGAGTATCTTCACTA CCAGGATGACTGGTATGTTTTGTCATCCAAGATAGAGAACAAACCAGATG ACTACGTATTTGTATACTATCAGGGAAGGAATGATGCATGGGATGGATAT GGCGGTGCTGTTGTGTACACAAGAAGTGCAACTTTGCCTGAAAGTATTGT ACCAGAACTAGAAAAGGCGGCTAAAAGTGTAGGACGAGACTTCAACAAAT TCATTAGAACAGACAATACTTGTGGGCCTGAGCCTCCTCTTGTTGAGAGA CTTGAAAAGACTGTGGAGGAAGGAGAGAAGACAATTATAAGGGAGGTTGA AGAAATTGAAGGGGAG---------------------TTAGGGAAGACTG AAAAGACCTTTTTTGAAACATTGATGGAAGGATTTAAAGAGCTCAGAAAA GATGAGGAATACTTCTTAAAGGAATTGAGCAAAGAGGAGATGGATCTTTT GAGTGAACTAAAAATGGAAGCAAGCGAGGTAGAAAAGCTCTTTGGACGAG CACTGCCACTGAGGAAGCTAAGA    ABA.Zep.fasta >A ---GGTTCAACTCCGTTTTGCTACTCTATCAATCCATCTCCATCAAAGCT TGATTTCACGAGGACCCATGTGTTTAGTCCTGTTTCTAAACAGTTTTACT TAGATTTATCATCG---------------------TTTTCCGGAAAACCC GGAGGAGTATCTGGGTTTAGGAGCCGTCGAGCTTTGCTCGGAGTAAAGGC GGCGACG------------------GCGTTAGTTGAGAAGGAGGAGAAGA GAGAGGCGGTGACGGAGAAGAAGAAGAAATCGAGGGTTTTAGTTGCCGGA GGTGGAATCGGAGGATTGGTGTTTGCTTTAGCGGCTAAGAAGAAAGGATT CGATGTGTTAGTGTTTGAGAAAGATTTGAGTGCTATAAGAGGAGAAGGAA AATACAGAGGCCCGATTCAAATACAGAGCAACGCT---TCTGCTTTGGAA GCTATTGATATTGAAGTTGCTGAACAAGTTATGGAAGCTGGGTGTATCAC TGGTGATCGGATTAACGGTCTCGTTGATGGTATCTCTGGTACTTGGTATG TAAAGTTTGATACTTTCACTCCTGCGGCGTCACGGGGACTTCCTGTGACT AGAGTAATTAGTAGAATGACTCTGCAGCAGATTCTAGCACGTGCGGTTGG AGAAGATGTGATTAGAAACGAGAGTAATGTTGTTGATTTTGAAGATTCTG GAGATAAGGTTACTGTGGTACTCGAGAATGGTCAACGCTATGAAGGTGAT CTGCTTGTGGGTGCAGATGGCATTTGGTCTAAGGTGAGAAATAATTTGTT TGGCCGTAGTGAAGCTACTTATTCAGGCTACACTTGTTACACGGGGATTG CAGATTTTATACCAGCGGATATCGAGTCTGTTGGCTACCGGGTTTTCTTG GGACACAAACAGTACTTTGTTTCTTCGGATGTTGGTGGTGGAAAAATGCA ATGGTATGCATTTCACGAGGAACCAGCTGGTGGGGCTGATGCTCCAAATG GTATGAAGAAAAGGTTGTTTGAAATATTTGACGGTTGGTGCGACAATGTA CTCGACTTGTTGCATGCGACTGAGGAGGAAGCCATTCTGAGAAGAGATAT TTATGATAGAAGTCCTGGTTTTACTTGGGGTAAAGGGCGTGTTACGCTGC TCGGGGATTCTATCCATGCGATGCAGCCAAATATGGGTCAAGGTGGATGC ATGGCCATTGAGGATAGTTTTCAACTAGCATTGGAGCTTGATGAAGCATG GAAACAGAGTGTTGAAACGACTACACCTGTTGATGTTGTTTCCTCTTTGA AAAGATATGAGGAATCAAGA---CTGAGAGTCGCTATTATCCATGCAATG GCGAGGATGGCTGCAATTATGGCTTCCACTTACAAAGCATACTTAGGTGT TGGGCTTGGTCCTCTGTCTTTCTTGACAAAGTTTAGAGTACCACATCCAG GAAGAGTTGGTGGTAGATTCTTCGTTGACATTGCTATGCCATCGATGCTT GACTGGGTCCTTGGAGGTAACAGTGAAAAACTCCAAGGAAGGCCACCTAG TTGCAGACTCACTGACAAAGCCGATGACCGGCTTCGAGAGTGGTTTGAAG ATGACGATGCTCTTGAACGTACTATAAAGGGAGAATGGTATCTAATTCCA CACGGCGACGATTGTTGCGTTTCGGAAACATTATGTCTAACCAAAGATGA AGATCAACCTTGCATCGTCGGAAGCGAACCAGATCAAGATTTTCCTGGAA TGCGCATTGTGATCCCTTCGTCTCAGGTTTCGAAGATGCATGCTCGTGTG ATTTACAAAGACGGAGCTTTCTTCTTGATGGATCTTCGAAGCGAACACGG AACCTATGTGACCGATAACGAAGGAAGAAGATATAGAGCAACACCGAATT TTCCCGCGCGGTTTAGATCGTCCGACATCATCGAGTTTGGTTCAGATAAG AAG----------------------------------------------- -------------------------------------------GCGGCGT TTAGGGTGAAAGTAATCAGGAAAACTCCGAAATCGACGAGGAAGAATGAG AGTAACAACGATAAATTACTTCAGACAGCT >P GCATCTTCAACTTTGTTTTGCAACACT---------CCAACGGCTGTT-- ----TTCTCAAGAACCCAGTTTCCAGTTCCAATCTTTAGCAACTCATCCG TAGAATTCTCGTCTTCCACGCACTATAACTACAACTTCAAAACCAAGACA  68 GGTAGT------------------GCTAAGAAATTGAAACATGTGAATGC TGTAGTG------------------ACCGAGGCACCTGCTGTGAGTGAAT CAAGAGGGAAACAGTCAGAACAAAGGAAGTTAAAGGTTCTTGTTGCTGGA GGTGGAATTGGAGGGCTGGTTTTTGCGTTGGCAGCAAAAAGGAAAGGGTT TGAGGTGATGGTTTTTGAGAAGGATTTGAGTGCGGTAAGAGGAGAAGGGC AATATAGAGGTCCAATTCAGATACAGAGCAATGCATTAGCTGCTTTGGAA GCTATTGATTTAGAGGTTGCTGAAGAGGTTATGAGAGCTGGCTGTATCAC GGGTGATAGGATTAATGGACTTGTTGATGGGGTTTCTGGTACTTGGTATG TCAAGTTTGATACCTTCACTCCAGCAGCAGAAAGAGGGCTTCCTGTCACG AGAGTTATTAGCCGAATGACTTTGCAACAGATCCTAGCTCGTGCAGTTGG AGATGATGTGATTCTTAATGATAGTAATGTTGTTAGTTTTCAGGATGAAG GGAATAAGATCACTGTGGTGCTCGAGAATGGACAACAATTTGAAGGTGAT CTCCTAGTGGGTGCTGATGGAATATGGTCAAAGGTGAGGAAGAACTTATT TGGACCCAAGGAGGCAGTGTACTCAGGCTATACATGTTATACTGGTATAG CAGATTTTGTGCCTGTCGATATCGAGACTGTTGGGTATCGTGTATTTTTG GGTCACAAACAATACTTCGTGTCTTCAGATGTGGGTGCTGGAAAGATGCA GTGGTATGCATTTCACAAGGAACAACCTGGTGGCATGGATGGCCCCCGTG GTAAAAAGGATCGGTTGTTGAAAATTTTTGAGGGTTGGTGTGATAATGTG ATAGATTTGATACTGGCCACAGATGAAGATGCCATTCTTCGACGTGATAT ATATGACAGGGAACCCATTCTTACTTGGGGAAGGGGTCGTGTGACCTTGC TTGGGGATTCTGTCCATGCCATGCAACCGAATATGGGTCAAGGGGGGTGC ATGGCCATTGAGGATAGCTACCAACTTGCATTGGAGCTTGATAAAGCATG GAAACAAAGTGTTGAATCAGGAACCTCTGTTGACGTTATTTCATCACTAA GGAGCTATGAGAATGCTAGAAGACTTCGAGTTGCCATTATCCATGGAATG GCAAGAATGGCGGCAATTATGGCTTCAACATACAAGGCGTATCTGGGTGT AGGGCTTGGTCCACTGTCGTTCTTGACAAAGTTTCGGATACCTCACCCAG GAAGAGTTGGTGGCAGATTTTTCGTTGACATAGCAATGCCTGTGATGCTC AATTGGGTCTTGGGCGGAAATAGTTCCAAACTTGAAGGCAGGTCTCTAAG TTGCCGACTCTCAGACAAAGCCAGTGACCAGTTGCGAAGATGGTTTGAAG ATGATGATGCTCTAGAGCGTGCTCTTGATGGAGAGTGGTTTCTTTTACCA TGTGGAAATGAGGCTGTTGCTTCACAACCTATTGGTTTAAGTAGGGATGA GAACAAACCCTGTGTGGTTGGGAGTGTGTCACATGATGATTTTCCGGGAA TGTCCATAGTGATACCCGCACCTGAGGTTTCAGAAATGCATGCTCGTATC TCTTGTAAAAATGGTGCATTTTACCTAATTGATTTGCGGAGTGAGCATGG TACCTTTATCACAGAT---GAGGGGAGACGGTATAGGGCAACTCCGAACT TTCCTGCCCGATTCCATCCATCAGATATGATTGAGTTTGGCTCGGACAAG AAGGTGACAAATAATCCCTGCCCTGTTCATAGCTTTTCTTCTGAAATCAG ATTAAATCCATATTCCAAATGCAATCTAGGAATCAGAACCAACGCAACAT TTCGTGTTAAGGTGATGAGGTCTCCTCCGAAGATTTCAGAAAAGAAGGAA GAAAGC------CAAGTTCTTCGTTCGGTA >R GCATCTTCAGCTTTCTTTTGCAACTCAATCAATCCATCAACTTCAGTT-- ----TTTTCAAGAACCCATTTCTCGTTTCCAATTTTTAGTACCTCTACCG TGGAATTCTCATCTTTTGCACAATACAACTTTCATTTCAAAACAAAGAAA AGTGAC------------CACCAAAACAAGAGATTTACACAAGTCAAAGC TGTGGTG------------------ACTGAGTCACCTACTGTGGCCGAGT CAAATGGGAAACTTTCAGAGCAAAAGAAACTCAGGATTCTTGTTGCTGGA GGTGGGATTGGAGGGTTGGTTTTTGCATTAGCAGCTAAAAGGAAGGGCTT TGAAGTATTGGTTTTTGAGAAAGATTTGAGTGCTATAAGAGGAGAAGGAC AGTATAGAGGTCCTATTCAGGTGCAGAGTAATGCATTAGCTGCTCTAGAG GCTATTGATTTAGAGGTTGCTGAAGAGGTTATGAGAGCTGGGTGTATTAC TGGTGATAGAATTAATGGCCTGGTTGATGGTGTTTCTGGTACTTGGTACT GCAAGTTTGATACCTTCACTCCTGCAGCAGAACGGGGGCTTCCAGTCACA AGAGTCATTAGCCGAATGACTTTGCAACAAATCTTAGCGTGTGCAGTTGG AGAAGATGTGATTATGAATGCAAGTAATGTTATTAATTTTCAGGATAATG AGGATAAGGTCACCGTGACGCTTGAGAATGGACAGCAATTCGAAGGTGAT CTCCTAGTTGGTGCTGATGGAATTTGGTCAAAGGTGAGGAAGAACTTATT CGGGCCAAAGGAAGCCACATACTCCGGCTACACTTGTTATACTGGCATTG CAGATTTTGTGCCTGTTGATATTGAGTCTGTTGGGTATCGAGTATTTCTT GGTCATAAACAATACTTTGTTTCTTCGGATGTGGGTGCTGGAAAGATGCA GTGGTATGCATTTCACAATGAACCACCTGGTGGCGTGGATAGCCCCAACG GTAAAAAGGAAAGGTTGCTGAAAATATTTGAGGGTTGGTGTGATAATGTA ATAGATCTGTTGCACGCCACAGACGAAGATGCTATTCTTCGACGTGACAT ATATGACAGAGAACCTGTTTTTACATGGGGAAAGGGTCGCGTGACATTGC TTGGTGATTCAATTCATGCCATGCAGCCTAATATGGGTCAAGGAGGGTGC ATGGCCATTGAGGATAGTTATCAACTCGCATTGGAGCTTGATAAGGCATG GAAACAAAGCATCGAGTCAGGAACCCCCGTTGATGTTGTTTCATCTCTAA AGAGCTATGAGAGAACTAGAAGACTTCGAGTTGCCATCATCCATGGAATG GCAAGAATGGCTGCTATTATGGCTTCGACTTATAAAGCTTATTTGGGTGT AGGCCTTGGTCCTTTGTCGTTCTTGACAAAGTACCGGATACCACATCCAG GAAGAGTCGGTGGGAGATTCTTTATTGACATAGCGATGCCTGTAATGCTC AATTGGGTCTTAGGTGGTAATAGTTCAAAACTTGAAGGAAGACCTCTAAG TTGCAGACTCTCAGACAAAGCTAGTGACCAATTGCAGACGTGGTTTGAAG ATGATAATGCGTTAGAGCGTGCTCTTAATGGAGAATGGTTTCTGTTACCA TTTGGAGATGATGCTGTT---CAGGAACCTATCTGTTTAAGTAGGGATGA  69 GAACATACCTTGTATGGTTGGGAGTGAATCACAGGAAGACTTTCCTGGGA AGTCTATAGTGATTTCCTCACCCCAGGTCTCCAAAATGCATGCGAGAATT AGTTACAAAGATGGTGGTTTTTATGTGATAGATTTGCAGAGCGAACACGG CACCTTTATCACAGATAATGATGGGAGACGATCTAGGGTCCCTCCAAACT TTCCTACCCTATTTCATCCCTCGGAAGCAATAGAGTTTGGCTCTGCTGGG AAG----------------------------------------------- -------------------------------------------GCAAAAT TCCGAGTCAAAGTGATGAAATCTCCTGCAAAGATTAAAGAGAAGGGAGGA AAT---------GAAATTCTCCAATCTGTG >O ---------GCGCTCCTCTCCGCGACC---------GCCCCCGCCAAGAC GCGCTTCTCG---------------------CTCTTCTCCCACGAGGAGG CGCAGCACCCGCAC------------CCGCACGCGCTCTCGGCGTGCTGC GGCGGCGGCGCCAGCGGCAAGAGGCAGCGGGCGCGGGCCAGGGTGGCGGC GGCAATGCGGCCGGCGGACGCGGCCGCCTCCGTCGCGCAGGCGGCGTCGC CGGGCGGCGGCGGCGAGGGCACGCGGAGGCCGCGGGTGCTCGTGGCCGGC GGCGGCATCGGGGGGCTGGTGCTGGCGCTGGCGGCGAGGCGGAAGGGGTA CGAGGTGACGGTGTTCGAGCGCGACATGAGCGCGGTGCGCGGCGAGGGGC AGTACCGCGGGCCGATACAGATCCAGAGCAACGCGCTCGCGGCGCTGGAG GCCATCGACATGTCCGTCGCCGAGGAGGTCATGCGCGAAGGCTGCGTCAC CGGCGACCGCATCAACGGCCTCGTCGACGGCATCTCCGGCTCCTGGTACA TCAAGTTTGATACATTTACTCCTGCAGCTGAGCGAGGTCTCCCAGTTACA AGGGTTATTAGCCGAATGACGCTGCAGCAGATTCTTGCTCGTGCGGTTGG TGATGATGCTATACTGAACGATAGCCATGTTGTTGATTTCATAGATGATG GCAACAAGGTAACTGCAATTTTGGAGGATGGCCGGAAATTTGAAGGTGAC CTTTTGGTTGGTGCTGATGGAATATGGTCAAAGGTGAGGAAGGTGCTTTT CGGGCAATCAGAAGCAACTTATTCAGAATATACTTGCTACACTGGCATTG CAGACTTTGTGCCTCCTGACATTGACACAGTTGGGTACCGTGTATTTCTT GGTCACAAACAATATTTCGTCTCCTCAGATGTCGGTGCTGGAAAAATGCA GTGGTATGCATTTCATAAGGAACCTGCTGGTGGCACTGATCCTGAAAATG GTAAAAATAAAAGATTGCTCGAGATATTTAATGGTTGGTGCGATAACGTC GTTGATCTGATAAATGCAACTGATGAGGAAGCAATTCTTCGCCGGGATAT ATATGACCGACCACCTACTTTTAACTGGGGAAAAGGTCGTGTCACTTTGC TAGGTGACTCTGTACATGCTATGCAGCCAAATCTGGGTCAAGGTGGCTGC ATGGCTATTGAGGATGGTTACCAGCTGGCTGTAGAACTTGAGAAGTCCTG GCAGGAGAGTGCGAAGTCTGGAACTCCTATGGATATAGTTTCCTCCTTGA GGAGATATGAGAAGGAGAGAATACTACGTGTTTCTGTTATACATGGGTTG GCAAGAATGGCAGCAATC---GCTACCACTTATAGACCATACTTGGGTGT GGGTCTGGGACCATTGTCGTTTTTAACGAAGTTGAGGATACCACATCCTG GAAGAGTTGGTGGGAGATTCTTCATCAAGTATGGAATGCCTTTGATGTTG AGCTGGGTTCTAGGAGGAAACAGCACGAAGTTAGAAGGAAGACCGTTAAG CTGTAGGCTTTCTGACAAGGCAAACGACCAGCTTCGTCGATGGTTTGAGG ATGACGATGCATTGGAACAAGCCATGGGTGGAGAGTGGTACCTCCTCCCC ACAAGTTCTGGAGACTCG------CAACCCATTCGATTAATCAGGGATGA AAAAAAGTCACTCTCCATTGGAAGCCGGTCAGATCCCAGCAATTCGACTG CTTCCCTGGCATTGCCCTTGCCACAGATATCAGAAAACCATGCTACTATC ACATGCAAGAATAAGGCCTTTTATGTGACTGATAATGGAAGTGAACATGG TACATGGATTACCGACAACGAAGGTAGACGCTATCGCGTACCTCCGAACT TCCCTGTCCGTTTCCATCCCTCGGATGCCATTGAGTTTGGTTCAGATAAA AAG----------------------------------------------- -------------------------------------------GCCGTGT TCCGTGTGAAGGTGCTGAGCACGCTCCCATATGAATCTGCAAGAGGAGGG CCG---------CAAATCCTGCAGGCAGCA >V GCTTCAGCAGTGTTTTATAGTTCAGTG---------CAGCCTTCGATT-- ----TTCTCAAGAACCCACATCCCAATTCCAATTTCGAAAGACTCCTTTG AAGAGTTCGGCCACTCTATCAACTATAAGCACTACTTCAGAAGCAACCCA TGTGGG---------------CAAAAGAAGAGGGTGGCACAGGTCAAAGC T------------------------ACTTTGGCTGAAGCCACACCAGCGC CGCCGGCGCCGTCGCTGCCGAGTAAGAAGGTTCGGATACTTGTGGCCGGA GGTGGGATTGGTGGGCTGGTTTTGGCGCTGGCAGCGAAGAAGAAGGGTTT TGATGTGGTGGTGTTTGAGAAAGACATGAGTGCAATTAGGGGAGAGGGTC AGTACAGGGGTCCAATTCAGATACAGAGTAATGCATTGGCGGCTTTGGAA GCTGTTGATATGGAGGTTGCTGAGGAGGTTATGAGGGCTGGCTGCATCAC TGGTGACCGGATTAATGGGCTGGTTGATGGGGTTTCTGGTGATTGGTATG TCAAGTTTGATACATTCACTCCTGCGGCAGAACGGGGGCTTCCTGTCACC AGAGTTATTAGCCGAATGACTTTGCAGCAAATCCTGGCTCGTGCAGTAGG GGAAGATATCATTATGAATGGCAGTAATGTTGTTGATTTTGAAGATGATG GAAATAAGGTTACTGTCATCCTTGAGAATGGACAACGTTATGAAGGTGAT CTTCTTATCGGTGCTGATGGAATATGGTCAAAGGTGAGAAAGAGTTTGTT TGGGCCTAAGGAAGCCACATACTCAGGCTACACTTGCTACACTGGCATTG CAGATTTTGTGCCTGCTGATATTGACTCTGTTGGGTACCGGGTATTTTTG GGACACAAACAATACTTCGTGTCTTCAGATGTGGGTGCAGGAAAAATGCA GTGGTATGCATTTTACAATGAACCAGCTGGTGGTGTTGATGGTCCTGAAG GTAAGAAGGAAAGGTTGCTTAAAATATTTGGTGGCTGGTGTGATAATGTA  70 ATTGATCTCATACTTGCCACGGATGAAGAAGCAATTCTTCGACGTGACAT ATATGACCGGACACCCACCTTTACTTGGGGAAGGGGCCGTGTAACCTTGC TTGGGGATTCAGTCCATGCCATGCAACCAAATATGGGTCAAGGGGGATGC ATGGCGATTGAGGATAGCTATCAGCTTGCAATGGAACTTGATAAAGCCTG GGAACAAAGCATCAAATCAGGGACTCCTATTGATGTTGTTTCTTGCCTAA AGAGCTATGAGAAGGCTAGAAGAATACGAGTTGCCGTTATCCATGGAATG GCAAGAATGGCTGCAATTATGGCTTCAACTTACAAGGCTTATTTGGGTGT AGGACTTGGTCCATTGTCGTTTTTGACAAAACTCAGGATCCCACATCCTG GGAGAGTTGGTGGGAGATTTTTTATTGACATAGCAATGCCTTTAATGCTG AGTTGGGTCCTAGGTGGTAACAGTTCAAAACTTGAAGGGAGGCCACCATC TTGCAGACTCTCAGATAAAGCAAGTGATCAATTACGGAGATGGTTTGAAG ATGATGATGCTCTGGAGCGTGCTATTGGTGGAGAGTGGTTCCTTTTGCCA TCAGGAGAGAGTGGATTA------CAACCTATTTGTTTGAGTAAGGATGA GAACAAACCCTGCATAATCGGGAGTGTGTCCCATACGGATTTTCCTGGAA TATCAACAGTCATACCTTCACCCAAGGTTTCCAAAATGCACGCTCGAATT AGTTGTAAGGATGGTGCCTTTTTCCTAACCGATTTGCAGAGTGAACATGG TACCTGGATCACTGATAATGTGGGGAGGCGGCAACGGGTGTCTCCAAATT TTCCTACTCGATTCCATCCATCAGAAGTGATTGATTTTGGTTCTGAAAAG -------------------------------------------------- -------------------------------------------GCTTCAT TTCGAGTCAAGGTGGTGAGGACTCCCCCAGACAATGCAGCTAAGAACGAA GAGAGC------AAGCTCTTCCAGGCGGTT    BR.Br6ox.fasta >A ---GGAGCAATGATGGTGATGATGGGTCTTCTCTTGATCATCGTGTCTCT CTGTTCCGCTCTCCTTCGATGGAATCAGATGCGATAT---ACCAAGAATG GTCTTCCTCCTGGAACCATGGGCTGGCCAATCTTTGGCGAAACCACCGAG TTTCTCAAACAAGGCCCCAACTTCATGAGAAACCAAAGACTCCGATACGG GAGTTTCTTCAAATCTCATCTTCTAGGTTGTCCAACGTTAATCTCAATGG ACTCAGAAGTAAACAGATACATTTTAAAGAACGAATCAAAAGGTTTGGTT CCTGGTTACCCACAATCGATGCTTGATATACTTGGGACTTGTAACATGGC TGCGGTTCACGGTTCGAGCCACCGGCTTATGAGAGGCTCGCTTCTGTCTC TCATAAGCTCGACCATGATGAGAGATCATATCTTGCCTAAAGTTGATCAC TTCATGAGAAGCTATCTTGATCAGTGGAATGAGCTTGAG---------GT TATTGATATCCAAGATAAGACCAAACATATGGCATTTTTATCTTCACTGA CACAAATCGCTGGGAACTTAAGAAAACCATTTGTTGAAGAATTCAAAACT GCATTCTTCAAGCTTGTTGTTGGGACTTTATCCGTTCCGATTGATCTTCC GGGCACAAATTATCGTTGCGGAATCCAAGCAAGAAATAACATTGATAGGT TGCTAAGAGAGCTGATGCAAGAACGTAGAGATTCTGGAGAAACATTCACA GACATGTTAGGTTACTTGATGAAG---AAGGAAGGTAACCGATACCCGTT AACCGATGAAGAGATAAGAGACCAAGTTGTGACGATTTTGTATTCGGGTT ACGAAACTGTCTCTACGACCTCAATGATGGCTCTTAAGTACCTTCAT--- CACCCAAAAGCTCTTCAAGAACTAAGAGCTGAGCATTTGGCATTCAGGGA AAGAAAACGACAGGACGAACCACTCGGTCTTGAGGACGTGAAGTCAATGA AGTTCACTCGAGCTGTGATTTATGAGACATCAAGATTGGCAACGATCGTT AATGGGGTCCTAAGGAAAACTACTCGTGACTTGGAAATCAACGGTTATTT AATCCCAAAAGGATGGAGAATTTATGTATACACGAGGGAAATTAATTACG ATGCAAATCTTTATGAAGACCCATTGATCTTTAATCCATGGAGATGGATG AAGAAGAGCTTGGAGTCACAAAACTCATGCTTTGTGTTTGGAGGTGGGAC AAGGCTTTGTCCTGGTAAGGAACTAGGGATTGTCGAGATCTCGAGCTTTC TCCATTACTTTGTTACGAGATACAGATGGGAGGAAATAGGAGGGGATGAA TTAATGGTGTTTCCGAGAGTTTTTGCACCAAAAGGCTTCCATCTTAGGAT TTCACCCTAC >P ATGGCAGTTCTCTTGATGGTTCTTGTGGCAGTTCTCTTTTTGTTCTGTAT CTCCTCTGCTTTGTTGAGGTTGAACGAGGTGAGATAT---AGGAAGAAAG GGTTGCCTCCAGGTACTATGGGATGGCCAGTCTTTGGAGAGACCACTGAG TTTCTAAAGCAAGGTCCAAACTTCATGAAGAATCAGAGAGCAAGGTATGG GAGTATTTTCAAATCCCACATTCTGGGGTGTCCTACCATTGTGTCCATGG ATCCAGAGCTCAATCGATACATCCTAATGAACGAGGGAAAGGGCCTTGTT CCTGGTTACCCTCAGTCCATGCTGGATATCTTAGGCAATCGCAACATTGC AGCAGTTCATGGCTCCACTCACAAGTACATGAGAGGGGCATTATTATCCC TCATTAGCCCCACCATGATCAGAGAACAACTTTTGCCAACAATTGATGAG TTCATGAGAACCCACCTCAGCTACTGGGATACCAAA------------AT TATTGACATTCAACAAATGACTAAGGAGATGGCACTTCTCTCTGCACTTA AGCAAATTGCTGGCACTGATTCGTGCTCAATATCTCAAGCATTCATGCCT GAGTTTTTCAGGCTGGTTTTAGGCACTTTGTCATTGCCAATTGACCTTCC TGGCACAAATTATCGACAAGGAGTCCAGGCGAGAAAAAATATTGTACGCA TGTTAAGGCAGCTAATAGACGGGAGGAGGGCATCGAAATTATACCACCAG GACATGCTTGGTCGACTTATGAGA---ACTGAAGAAAACAAATTTAAACT AACAGATGAAGAGATAATTGATCAAATAATCACAATTTTGTACTCTGGCT ACGAAACGGTTTCGACCACTTCAATGATGGCAGTCAAGTATCTGCATGAT  71 CACCCAAGAGTTCTTCAGGAGCTAAGAAAAGAGCATTTCGCAATTAGAGA AAAGAAAAGGCCTGAGGATCCAATCGATTTAAATGACCTTAAATCG---C GTTTTACTCGTGCCGTGATTTTTGAGACCTCAAGATTGGCTACAATAGTA AATGGGGTTTTGAGGAAGACTACTAAAGAAATGGAACTAAATAGATTTGT GATTCCAAAAGGATGGAGAATCTACGTTTACACAAGGGAGATAAACTATG ATCCATATTTATATCCTGACCCATTCTCCTTTAACCCATGGAGATGGCTG GACAAAAGTTTGGAGTCTCAAAACTATCTCTTCATTTTTGGAGGAGGTAC CAGGCAGTGTCCAGGAAAGGAG---CGAATAGCTGAGATTTCAACTTTCC TTCATTATTTTGTAACTAGATACAGATGGGAAGAGGTTGGAGGAGACTCA TTAATGAAATTTCCAAGAGTTGAAGCACCAAATGGGCTACACATTAGGGT CTCATCTCAC >R -------------------------------------------------- -------------------------------------------AAGAAGG GTTTGCCTCCTGGCACTATGGGTTGGCCAGTTTTTGGAGAAACTACTGAG TTTCTTAAACAAGGTCCCAACTTCATGAAAAACCAAAGAGCAAGGTATGG TAATTTTTTTAAATCGCACATTCTTGGGTGTCCTACCATTGTTTCAATGG ATCCAGAGGTAAATAGGTACATTCTCATGAATGAGGCAAAAGGGCTTGTT CCTGGTTATCCTCAATCCATGCTGGATATATTAGGCAAATGTAATATTGC AGCAGTTCATGGCTCCACTCACAAGTACATGAGAGGTGCACTATTAAGCC TCATTAGCCCTACCATGATCAGAGAACAACTTTTGCCAACAATCGATGTC TTCATGAGAACCCACCTCAGCAATTGGCATGACAAA------------AT TATTGACATTCAACAGAAAACCAAAGAGATGGCACTTCTCTCATCACTTA AGCAAATTGCTGGCCCTGATTCTAGCTCAATATCTCAAGCATTCATGCCT GAGTTTTTCAAGCTTGTTTTAGGCACCTTGTCGTTGCCAATTGATCTTCC TGGAACAAATTATCGTAACGGATTTCAGGCTAGGCAAAATATTGTGAGCT TATTGAGACAACTTATAGAAGAGAGAAGGGCATCAAAAGAAACCCATAAA GACATGCTTGGTTGCCTCATGAAA---ACTGATGAAAACAGATACAAACT CAATGATGATGAGATAATTGATCAAATCATCACAATTTTATATTCTGGGT ACGAAACAGTCTCAACAACTTCAATGATGGCTATTAAGTATTTGCATGAT CACCCTCAAATCCTTCAAGAACTAAGAAAAGAACATTTAGCAATTAGAGA AAAGAAAATGCCTGAGGATCCAATTAACTTAAACGACCTTAAATCGATGT GTTTTACTCGTGCGGTGATTTTTGAGACCTCAAGATTAGCTACAATAGTT AATGGGGTTCTGAGAAAGACTACTAAAGAAATGGAAATAAATGGATTTGT GATTCCTGAAGGATGGAGAATCTATGTTTATACTAGGGAGATAAACTATG ATCCCTACTTGTACCCAGATCCATTGTCTTTCAACCCATGGAGATGGATG GATAGAAGTTTGGAGTCTCAAAACTATCTCTTCATTTTTGGAGGGGGTAC CAGACAGTGTCCTGGAAAGGAACTAGGAATAGCAGAAATTTCAACTTTCC TTCACTATTTTGTAACCAGATACAGATGGGAAGAAGTTGGTGGAGACACA CTAATGAAATTCCCAAGAGTAGAAGCACCCAATGGACTACACATTAGGGT TTCATCTTAC >O ------GTGTTGGTGGCGATTGGGGTGGTTGTGGCGGCGGCGGTGGTGGT GAGCAGCCTGCTGCTGCGGTGGAACGAGGTGCGGTACAGCCGGAAGCGCG GCCTGCCGCCGGGGACAATGGGGTGGCCGCTCTTCGGCGAGACCACCGAG TTCCTCAAGCAGGGACCCAGTTTCATGAAGGCCCGGAGGCTCAGGTACGG GAGCGTGTTCAGGACGCACATCCTGGGGTGCCCGACGGTGGTGTGTATGG AGGCGGAGCTGAACCGGCGGGCGCTGGCCAGCGAAGGGCGCGGGTTCGTC CCGGGCTACCCGCAGTCGATGCTGGACATCCTGGGGCGGAACAACATCGC CGCCGTGCAGGGCCCCCTCCACCGCGCCATGCGCGGCGCCATGCTCTCCC TCGTCCGCCCCGCCATGATCCGCTCCTCCCTCCTCCCCAAGATCGACGCC TTCATGCGCTCCCACCTCGCCGCCTGGTCCTCCTCCTCCTCCTCCGCCGT CGTCGACATCCAGGCCAAGACCAAGGAGATGGCCTTGCTATCTGCACTCA GGCAGATTGCCGGCGTCTCCGCTGGCCCACTCTCTGACGCTCTCAAGGCA GAGCTCTACACCCTTGTGCTTGGCACCATCTCCCTGCCCATCAACCTTCC TGGAACCAACTACTACCAAGGCTTCAAGGCAAGGAAGAAGCTTGTTGCAA TGCTAGAGCAGATGATCGCGGAACGGCGATCCTCCGGTCAGGTACACGAC GACATGCTGGATGCGCTCTTGACCGGTGTCGAGGGCACCAGGGAGAAGCT CACAGATGAGCAGATCATTGACCTGATCATCACCCTTATATACTCTGGAT ATGAAACCATGTCGACGACCTCGATGATGGCTGTCAAGTACCTGTCAGAC CATCCCAAAGCTCTTGAGCAACTCAGGAAAGAACATTTTGATATCAGGAA AGGTAAAGCGCCCGAAGATGCCATCGACTGGAATGATTTCAAGTCCATGA CCTTCACTCGAGCTGTTATCTTCGAGACATTAAGATTAGCTACAGTTGTG AATGGGCTGCTGAGGAAAACTACCCAAGATGTTGAAATGAATGGGTATGT TATCCCAAAAGGTTGGAGAATATATGTTTACACAAGGGAAATAAATTATG ATCCATTCCTGTACCCTGATCCCATGACATTCAATCCATGGAGGTGGCTG GAGAAGAACATGGAATCACATCCACACTTCATGCTGTTTGGAGGAGGTAG TCGAATGTGCCCGGGGAAGGAAGTAGGCACCGTAGAAATTGCAACATTCC TTCACTATTTCGTGACTCAATACAGATGGGAGGAAGAAGGTAACAACACA ATATTGAAGTTCCCCCGAGTTGAAGCTCCCAACGGGTTACATATCCGCGT TCAAGATTAC >V ---GCTGTTTTCATGGCGGTTTTTGGTGTGGTTCTTATTGGGCTCTGTAT TTGCACTGCTTTGTTGAGATGGAATGAGGTGAGGTAC---AGGAAGAAAG GATTGCCCCCAGGTACAATGGGTTGGCCAGTCTTTGGGGAGACCACTGAG  72 TTTCTTAAGCAAGGCCCAAGCTTCATGAAAAACCAGAGAGCAAGGTATGG AAAATTTTTCAAATCCCATTTATTGGGTTGTCCTACCACAGTCTCCATGG ATCCAGAGCTCAACAGATACATCCTAATGAATGAAGCAAAAGGCCTGGTT CCTGGCTACCCACAGTCCATGTTAGATATCCTGGGAAAATGCAACATTGC AGCTGTCCATGGCTCCACTCACAAGTACATGAGAGGGGCACTTCTAGCTC TCATTAGCCCCACCATGATAAGAGGCCAGCTTTTACCAAAGATAGATGAG TTCATGAGATCCCATCTGAACAAATGGGATACCAAA------------AT CATCAACATCCAGGAGAAAACCAAAGAGATGGCACTTCTCTCTTCTCTCA AGCAGATTGCCGGTATTGAATCCGGCACAATATCTAAGGAGTTTATGCCA GAGTTTTTCAAGCTGGTGTTGGGAACCATTTCTCTGCCTATTGACCTTCC TGGCACAAATTACCGCCGCGGGTTCCAAGCAAGGAAGAATATTGTTGGCA TGTTGAGACAACTCATAGAGGAGAGAAAAGCTTCCCAGGAAACCCACAAT GACATGCTTGGTTGCCTAATGAGA---ACTAATGAAAATCGATATAAACT AAGCGATGAAGAGATAATTGATCTCATAATCACAATTCTGTATTCGGGTT ACGAGACTGTTTCCACCACTTCCATGATGGCTGTCAAGTATCTCCATGAC CACCCAAGAGTTCTTGATGAACTCAGAGTG-------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------------AGTGACAATTTTTTTTTTGTATCT----------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ----------    BR.Cpd.fasta >A GCCTTCACCGCTTTTCTCCTCCTCCTCTCTTCCATCGCCGCCGGCTTCCT CCTCCTACTCCGCCGT---------------------------------A CACGTTACCGTCGGATGGGTCTGCCTCCGGGAAGCCTTGGTCTCCCTCTG ATAGGAGAGACTTTTCAGCTGATCGGAGCTTACAAAACAGAGAACCCTGA GCCTTTCATCGACGAGAGAGTAGCCCGGTACGGTTCGGTTTTCATGACGC ATCTTTTTGGTGAACCGACGATTTTCTCAGCTGACCCGGAAACGAACCGG TTTGTTCTTCAGAACGAAGGGAAGCTTTTTGAGTGTTCTTATCCTGCTTC CATTTGTAACCTTTTGGGGAAACACTCTCTGCTTCTTATGAAAGGTTCTT TGCATAAACGTATGCACTCTCTCACC---AGCTTTGCTAATTCTTCAATC ATTAAAGACCATCTCATGCTTGATATTGACCGGTTAGTCCGGTTTAATCT TGATTCTTGG------TCTTCTCGTGTTCTCCTCATGGAAGAAGCCAAAA AGATAACGTTTGAGCTAACGGTGAAGCAGTTGATGAGCTTTGATCCAGGG GAATGGAGTGAGAGTTTAAGGAAAGAGTATCTTCTTGTCATCGAAGGCTT CTTCTCTCTTCCTCTCCCTCTC---------------TTCTCCACCACTT ACCGCAAAGCCATCCAAGCGCGGAGGAAGGTGGCGGAGGCGTTGACGGTG GTGGTGATGAAAAGGAGGGAGGAGGAG----------------------- ----GAAGAAGGA---GCGGAGAGAAAGAAAGATATGCTTGCGGCGTTGC TTGCGGCGGATGAT------GGATTTTCCGATGAAGAGATTGTTGACTTC TTGGTGGCTTTACTTGTCGCCGGTTATGAAACAACCTCCACGATCATGAC TCTCGCCGTCAAATTTCTCACCGAGACTCCTTTAGCTCTTGCTCAACTCA AGGAAGAGCATGAAAAGATTAGGGCAATGAAGAGTGATTCGTATAGTCTT GAATGGAGTGATTACAAGTCAATGCCATTCACACAATGTGTGGTTAATGA GACGCTACGAGTGGCTAACATCATCGGCGGTGTTTTCAGACGTGCAATGA CGGATGTTGAGATCAAAGGTTATAAAATTCCAAAAGGGTGGAAAGTATTC TCATCGTTTAGAGCGGTTCATTTAGACCCAAACCACTTCAAAGATGCTCG CACTTTCAACCCTTGGAGATGGCAGAGCAACTCGGTAACGACAGGCCCTT CT---------AATGTGTTCACACCGTTTGGTGGAGGGCCAAGGCTATGT CCCGGTTACGAGCTGGCTAGGGTTGCACTCTCTGTTTTCCTTCACCGCCT AGTGACAGGCTTCAGTTGGGTTCCTGCAGAGCAAGACAAGCTGGTTTTCT TTCCAACTACAAGAACGCAGAAACGGTACCCGATCTTCGTGAAGCGCCGT GATTTTGCTACT--------------------- >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------AAGCAGCTAATGAGCTTTGATCCATGT  73 GAATGGACCGAGAGTCTGAGAAGAGAGTACGTGCTTGTTATTGAAGGCTT TTTCAGCGTGCCTCTACCCATC---------------CTTTCCCCCACAT ACCGCAGAGCTATCAAAGCTAGGACTAAGGTGGCAGAGGCTTTGAGTTTG GTAGTGAAGCAAAGGAGGATAGAGAGT----------------------- ----GAGTCAGGA------GAGAAAAAGAAAGACATGCTTGGAGCTCTTT TAGCTTCAGATGATCATGGAGGCTTCTCGGACGAGGAGATAGTAGATTTC TTGGTGGCTCTGCTTGTTGCAGGCTATGAAACTACATCTACAAGCATGAC TCTTGCTGTTAAGTTCCTCACCGAGACACCTCTGGCTCTGGCTCAGATCA AGGAGGAGCATGAACAGATTAGAGGAAAGAAGGGCGAGGAGGGAGCTCTT GAGTGGAGTGATTACAAGTCAATGACCTTCACTCAGTGTGTTGTTAATGA GACT------ATAGCAAACATAATAGGTGGGATATTTAGACGAACAATGA CAGATATAAATGTTAAAGGTTATACAATTCCTAAAGGATGGAAGGTTTTT GCATCCTTTCGTGGTGTACATTTAGACCATGAATACTTCAAAGATGCTCG AACTTTCAATCCGTGGAGATGGCAGGACGACTCGGGGGCAACATGCCCAG CA---------AATGTGTTCACTCCTTTTGGAGGAGGGCAACGGTTATGC CCAGGATATGAACTTGCTAGAGTAGAACTCTCTGTTTTCCTTCACCACCT GGTCACCCGTTTCAGTTGGACCCCAGCTGAACAAGACAAGCTGGTTTTCT TTCCAACTACGCGGACACAAAAGCGATATCCCATCAATGTGCAGCGTCGA AATCGTGTC------------------------ >R -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------AAGCAACTAATGAGCTTTGATCCAGGG GAGTGGACTGAGAGTTTAAGGAAAGAGTACGTTCTTGTTATTGAAGGATT TTTCACTGTGCCTTTGCCTATA---------------TTCTCCACCACAT ACCGAAGAGCTATCAAAGCTAGGACTAAGGTGGCAGAGGCATTAAGCCTG ATAGTGATGCAAAGACGAAGAGAGAGT----------------------- ----GAGTCAGGA------GAAAGAAAGAAAGACATGTTAGGAGCTCTTC TAGCCGCCGATGAT------GGGTTTTCCGATGAGGAAATAGTGGATTTC TTGGTGGCACTACTTGTTGCCGGCTATGAAACTACCTCTACTATTATGAC TCTTGCTGTTAAGTTCCTAACTGAGACACCTCTCGCTCTGGCTCAGCTCA AGGAGGAGCATGAAGGGATTAGGGCAAAGAAAAGTGAAGGAGAAGCTCTA GAGTGGAGTGATTACAAGTCAATGCCTTTCACTCAATGTGTTGTTAATGA GACACTGAGAGTAGCAAACATAATTAGTGGGGTATTTAGACGAGCAATGA CAGACATCAATATAAAAGGTTACACAATCCCTAAGGGATGGAAAGTTTTT GCTTCATTTCGAGCTGTACATTTAGATCATGATCACTTCAAAGATGCTCG ATCTTTCAATCCATGGAGATGGCAGAACAATTCAGGAGTAACATGTCCAG GG---------AATGTGTTCACTCCATTTGGAGGAGGACCAAGACTCTGC CCAGGTTATGAACTAGCTAGAGTAGAACTCTCTGTTTTCCTGCATCATCT AGTCACTCGGTTCAGTTGGGTTCCTGCAGAGGAAGATAAGTTGGTTTTCT TTCCGACGACCAGAACACAGAAACGGTACCCAATCAACGTGCAGCGACGA AGCGATGTAAAGAGT------------------ >O GCCGCGGCCGCGCTGCTCCTCCTCGCCGCGGCCGCCGCCGCCGTCGTGGT TGCCATGGCGCTCAGATGGCTCCTCCTCCTCGGGGGCCCCGCCGCCGGGA GGCTGGGGAAGAGGGCGCGGATGCCGCCGGGGAGCACGGGCCTGCCTCTG ATTGGCGAGACGCTGCGGCTCATCTCGGCGTACAAGACGCCCAACCCGGA GCCGTTCATCGACGAGCGCGTGGCGCGCCACGGCGGCGTGTTCACCACCC ACGTCTTCGGCGAGCGCACCGTGTTCTCCGCCGACCCGGCCTTCAACCGC CTCCTCCTCGCCGCCGAGGGCCGCGCCGTCCACTCCAGCTACCCGTCCTC CATCGCCACGCTCCTCGGCGCGCGCTCCCTGCTCCTCACCCGCGGCGCCG CGCACAAGCGGCTCCACTCCCTCACCCTCACCCGCCTCGGCCGCCCC--- GCGTCGCCGCCCCTCCTCGCGCACATCGACCGCCTCGTGCTCGCCACCAT GCGCCAGTGGGAGCCCGCCGCCACCGTCCGCCTCATGGACGAGGCCAAGA AGATCACCTTCAACCTCACCGTCAAGCAGCTCGTCAGCATCGAGCCGGGA CCGTGGACCGAGAGCCTCCGCCGCGAGTACGTCAAGCTCATCGACGGCTT CTTCTCCATCCCCTTTCCTCTCGCCTACTTCCTCCCTTTTACCACC---T ACGGCCAGGCCCTCAAGGCGAGGAAGAAGGTGGCCGGTGCACTGCGGGAG GTGATAAAGAAGAGGATGGAGGAGAAAGCGGAGAATGGTGGCTCCATTGG GGATGATGAGGGG---AAGAAGGAGAAGAAGGACATGGTGGAGGAGCTTC TTCAGGCGGAGGGT---GGCAGCTTCTCGGAGGAAGAGATGGTGGATTTC TGCCTTTCTCTGCTGGTGGCTGGGTATGAGACTACGTCCGTGCTCATGAC GCTCGCGGTCAAGTTCCTCACTGAGACGCCTGCTGCGCTAGCTGAGCTCA AGGAAGAGCATGCCAATATCAGGGATATGAAAGGGAAAAACCAACCATTA GAGTGGAGCGATTACAAGTCCATGCCATTTACTCAATGTGTGATAAATGA GACACTCCGTGTGGGTAACATTATTAGTGGAGTATTCAGGCGAGCAAACA  74 CTGATATTCATTATAAAGATTACACAATTCCAAAGGGATGCAAGATTTTT GCTTCATTCCGAGCTGTGCACCTTAATAATGAACACTACGAGAATGCTCG GACATTTAACCCTTGGAGATGGCAGATCAACAATAAACTTCAGAATGCGG TA---GGGGCCAATATATTTACTCCATTTGGTGGTGGACCTCGGTTGTGT CCTGGCTATGAGCTTGCCCGGGTTGTCGTTTCTATCTTCCTCCATCATCT TGTAACGCGCTTTAGCTGGGAAGAAACCGAAGAAGATAGACTTGTCTTCT TCCCCACCACACGAACTCTCAAAGGATACCCTATCAATCTTCGGCTGCTT TCAGAATCAATTTGC------------------ >V GACTGGTCTCTGGCCGTTACCATCGGTGCGGCTCTCCTCGCCATCTTCTT CTTGTTCCTGCGCCTC---------------------------------A CTCGCCCCAGGGGCCACCGCCTGCCTCCGGGCAACCTGGGGCTCCCCCTG GTGGGCGAGACTCTGCAGCTCATCTCCGCCTACAAGTCGGCCAACCCTGA ACCCTTCATCGACGAGAGGGTGACTCGGTACGGGCCCTTGTTCACCACCC ATGTGTTCGGCGAGCCCACGGTGTTCTCGGCGGACCCGGAGACGAATCGG TACATATTGCAGAACGAGGGGAAGCTGTTCGAGTGCAGCTACCCTGGCTC CATCTCCAACTTGCTTGGAAGGCATTCCCTGTTGTTAATGAAGGGTAATC TCCACAAAAAAATGCATTCCCTCACCATGAGTTTCGGTAATTCTTCCATC ATCAAGGACCACTTGCTGCTCGACATCGACCGCTTGATCCGCTTCAACAT GGACTCATGG------ACCAGCCGGATCTTACTTATGGAAGAGGCCAAGA AGATAACATTCGATTTGACAGTGAAGCAGCTGATGAGCTTTGATCCAGGG GAGTGGACTGAGTCTCTGAGAAAAGAATATGTGCTTGTGATTGAAGGCTT CTTTACCGTCCCTTTCCCTCTC---------------TTCTCCGCCACCT ACCGCAGAGCCATCCAAGCAAGGACGAAGGTAGCAGAGGCACTGAACTTG GTAGTGAGGGAAAGGAGGAAAGCCAAG----------------------- ----GAAGAAGGAGAAGAGGAGAAGAAGAACGACATGCTGGCCGCCCTCC TCGACAGCGGCGAT------AACTTCTCCGACGAGCAGATCGTGGATTTC ATCCTGGCCCTGCTGGTGGCTGGCTACGAGACCACCTCCACCATCATGAC CCTCGCGATCAAGTTCCTCACAGAGACCCCTCTCGCCTTGGCTCAGCTCA GGGAGGAGCATGACGAGATTAGGGCAAGGATAAGTGACCCTAATGTTCTG GAATGGAGTGATTATAAATCCATGCCTTTCACTCAATGTGTTGTGAATGA GACTTTGAGGGTGGCAAACATAATAGGTGGGATTTTCAGGCGAGTAACCA CTGACATCCATGTCAAAGGTTACACAATTCCTAAGGGATGGAAGGTGTTT GCATCATTTCGAGCTGTACACCTGGACCATGAATACTTCAAGGATGCTCG TACTTTTAATCCCTGGAGATGGCAGAATAATTCTGGACCCACGGTTCCAG GGAGTGGTGTGAATGTGTTCACACCATTTGGAGGAGGGCCGCGCCTGTGC CCTGGCTATGAGCTTGCAAGGGTGGTGCTCTCGGTTTTCCTTCACCGCAT GGTCACTCGATACAGCTGGGCTCCTGCAGAGGAGGATAAGTTGGTGTTCT TTCCAACCACTAGGACTCAGAAGCGATACCCCATCAATGTGGAGAGGCGA AAAGTGTCATCCGCCGCAGAAAAAGGTGAGGGA    BR.Det2.fasta >A ---GAAGAAATCGCCGATAAAACCTTCTTCCGATACTGTCTCCTCACTCT TATTTTCGCCGGCCCACCAACCGCCGTCCTTCTGAAATTCCTCCAAGCTC CTTACGGTAAACACAACCGTACCGGATGGGGTCCCACCGTATCTCCACCG ATTGCTTGGTTCGTCATGGAGAGCCCAACCTTGTGGCTCACTCTCCTCCT CTTCCCCTTTGGTCGTCACGCTCTCAACCCTAAATCTCTACTTCTATTC- -----TCTCCTTATCTCATTCATTACTTCCACCGCACCATCATTTACCCT CTTCGCCTCTTC---------------CGCAGCTCCTTCCCCGCCGGTAA AAACGGATTTCCGATCACCATCGCCGCCTTGGCTTTCACCTTTAATCTCC TCAATGGTTATATCCAGGCGAGG---TGG---------------GTTTCG CATTACAAGGATGACTACGAAGACGGAAACTGGTTCTGGTGGCGGTTTGT TATCGGTATGGTGGTTTTCATAACCGGCATGTATATAAATATCACGTCGG ACCGGACTTTGGTACGATTGAAGAAAGAGAACCGGGGAGGTTATGTGATA CCGAGAGGAGGCTGGTTCGAGTTGGTAAGCTGTCCGAATTATTTTGGAGA GGCGATTGAGTGGTTGGGCTGGGCTGTTATGACTTGGTCTTGGGCCGGTA TTGGATTTTTTCTGTACACGTGTTCCAATTTGTTTCCGCGTGCACGTGCG AGTCACAAGTGGTACATTGCCAAGTTCAAGGAAGAGTATCCCAAGACTCG TAAAGCTGTTATTCCTTTTGTGTAC >P ------GCCCTATTAGATCAGAGCCTCTTTCACTACAGTCTCCTATCCAT TTACCTCATAGGACCCCCTACATTCATTTCCCTGAAATTTCTTCAAGCCC CGTATGGGAAGCACCACCGTCCAGGGTGGGGTCCTACAATCTCTCCACCC TTGGCTTGGATCCTCATGGAAAGCCCCACTCTTTGGCTCACACTCCTCCT CTTCCCCTATGGCCAACACTTCACCAATCCCAAAGCTATCATTCTCATG- -----TCCCCCTTCCTCCTCCACTACTTCCACCGCACCTGCATCTACCCA CTTCGGATTTAT---------------CGGAATTCCAAAACCACT----- -GGTGGTTTCCCGGTGAGTGTGGCTGTTATGGCATTTGGGTTTAATCTGC TGAATGCTTACCTGCAGGCTAGG---TGG---------------GTGTCT CATTACAAGAGTGATTATGAC---GGGGGACTGTTTTGGTGGAAGTTTTT TGGTGGGTTAGTGGTGTTTGTGTGGGGCATGAGGATCAATACGTGGGCCG ATGGGGTTTTGTTAGGTTTGAAGAGGGAAGGT---GGTGGGTATAAGGTG  75 CCGAGAGGAGGGTGGTTTGAGTTGGTGAGCTGCCCCAACTACTTCGGGGA GATTGTGGAGTGGCTTGGATGGGCAGTGATGACTTGGTCTTGGGCTGGGT TTGGTTTTTTACTCTATACATGTGCTAACTTGGTGCCTAGGGCATGTGCC AATCACAAATGGTACCTGGAGAAATTCAAAGAGGATTATCCCAGGAGCAG GAAAGCAGTGATCCCTTTTCTGTGT >R ------GCTTTCTCAGATGGAAGCCTCTTTCATAAAAGCCTCCTAGCTCT CTACCTCATAGGGCCCCCTACCTTCATCTCCCTCAAGTTCCTTCAAGCAC CGTATGGAAAACACAACCGCCCTGGATGGGGCCCCACCATCTCGCCACCT TTGGCCTGGTTCCTCATGGAGAGCCCCACTCTCTGGCTTACATTTTTACT CTTCCCTTTTGGCCAACATGCTTCCAATCCCAAAGCTTGGGTTCTTATG- -----TTCCCTTATCTCTTCCATTATTTCCACCGCACCTGTCTCTACCCT CTACGCCTTTACTGGAATACAAATCAGCGGAATACCAAAATCACT----- -AGCGGTTTTCCTGTGAGCATGGCCCTTCTGGCATTTTTGTTCAACTTCT TGAATGCTTACTTGCAAGCCAGG---TGG---------------GTATCT CATTACAAGGAGGATTATGACCAGGATAGGTGGTTCTGGTGGAGGTTTTG GGGTGGGCTAGTGGTGTTTGCGTGGGGTATGTGGACTAATGTATGGTCGG ACAGGGTTTTGGTTCGGTTAAAGAGAGAAGGT---GATGGGTATAAGGTG CCAAGAGGAGGGTTGTTTGATCTGGTGAGCTGCCCCAACTACTTTGGTGA GATTGTGGAATGGCTTGGTTGGACTCTGATGACATGGTCCTGGGTTGGGT TTGGGTTTTTTCTCTATACATCTGCCAACTTGGTGCCGAGGGCAGTGGCT AACCATAAGTGGTATCTGGACAAGTTTGGAAAGGATTATCCAAGAGGTAG AAAAGCTGTCATCCCTTTCTTGTAT >O GGCGGCGGCGGCGGCGACGACGCGCTGTACGCGCGATGCCTGGTGATCCT GTACCTGATCAGCCCGATCACCGTGTTCCTGCTCCGGTTCGTGTCGGCGC CGTACGGGAAGCTCTCCCGCCCCGGGTGGGGTCCCGCCGTGCCGGCGGCG CTCGCGTGGTTCCTCATGGAGAGCCCCACCATGTGCCTCCCGCCCCTCGT CCTCTCCGCCGCCGCCTCCTCGTCGGCGCTGCGCGCCGCCGCTCTCCTCC CGGCCGCGCTGTACGCGCTCCACTACGTGAACCGCACGCTCGTCCACCCG CTCCGGCTCCTC---------------CGCCTCCGCCGCGCGCCG----- -GCGCCCGTTCCGATCCTCGTCGCCGCCTTCGCCTTCGGCTTCAACCTCC TCAACGCCTACGTCCAGGCGCGCTCCTGGGCGCTCGACGCCGCCGCTCCC CACAGCACCGCCACCGCCACCGCCACGCCCGCGGCCGTCGCCCGCTGCCT CGTCGGGCTAGCCCTCTTCGCGTGGGGGATGCGGACCAACATCGCGGCGG ACAAGGCGCTCCTGAGGCTGAAGGAGGCCGGG---AAAGGGTACCAGATT CCCCGCGGCGGGCTGTTCGACGTGGTCACCTGCCCCAACTACTTCGGCGA GGCCGTGGAGTGGCTCGGCTACGCGCTGGTGGCGTGGACGCCGGCGGCCT GGGCCTTCTTCCTCTACACCTGCTCCAACCTCGGGCCGAGGGCCAGGGAT CACCGCCGGTGGTACGTCGGCAAGTTCGGCGACAAGTACCCGGCGTCGCG CAAGGCGTTCGTCCCGTACATCTAC >V ---------GATTGGGACCGAACCCTGTTCCACAACTCTCTCATCGCCCT CTACCTCATCGCCCCACCCACATTCATCTCCCTTCGTTTCCTCCAAGCCC CCTATGGCAAGCACCACCGATCGGGGTGGGGTCCCACTGTGCCGCCATCC TTGGCATGGTTCCTCATGGAATCTCCTACTGTGTGGTTGACGCTCCTCAT CTACCCCTTGGGTGATCGTTCCTCCAATCCCAGATCCCTAATCCTCATT- -----TCCATCTACCTCTTCCACTACATCCATCGTACTCTCATCTACCCT CTTCACCTC------------------CGCAACTCCACTGCCGCTAAACG GAATGGGTTCCCGGTCAGCGTGGCGCTCATGGCCTTTGGATTCAACCTCC TGAACGCCTACTTGCAAGCCAGA---TGG---------------GTGTCT CATTAT---GCTAATTACGAGGACGATGGGTGGTTCTGGTGGCGGTTCTG GGTGGGACTGGTAATCTTCCTGGATGGGATGTTGGTGAATGTAAGATCGG ATTTGGCGTTGGTGGGTCTGAAAAGCCAGGGC---GGAGGGTACAAGGTG CCGAGAGGAGGGTGGTTCGAGTTAGTGAGCTGTGCCAACTATTTCGGGGA GGTGGTGGAGTGGTTGGGATGGGCGGTGATGACGTGGTCTTGGGTGGGTT TAGGGTTTCTTCTGTACACATGTGCCAATTTGGTGCCAAGGGCACGTGCC AACCACAAGTGGTATTTGGAAAAGTTTGGGGAGGATTATCCCAAGGGGAG AAAAGCTGTTATTCCCTTCCTCTAT    BR.Dwf4.fasta >A ---TTCGAAACAGAGCATCATACTCTCTTACCTCTTCTTCTTCTCCCATC GCTTTTGTCTCTTCTTCTCTTCTTGATTCTCTTGAAG------------- -----------------------------AGAAGAAATAGAAAAACCAGA TTCAATCTACCTCCGGGTAAATCCGGTTGGCCATTTCTTGGTGAAACCAT CGGTTATCTTAAACCGTACACCGCCACAACACTCGGTGACTTCATGCAAC AACATGTCTCCAAGTATGGTAAGATATATAGATCGAACTTGTTTGGAGAA CCAACGATCGTATCAGCTGATGCTGGACTTAATAGATTCATATTACAAAA CGAAGGAAGGCTCTTTGAATGTAGTTATCCTAGAAGTATAGGTGGGATTC TTGGGAAATGGTCGATGCTTGTTCTTGTTGGTGACATGCATAGAGATATG AGAAGTATCTCGCTTAACTTCTTAAGTCACGCACGTCTTAGAACTATTCT ACTTAAAGATGTTGAGAGACATACTTTGTTTGTTCTTGATTCTTGGCAAC  76 AAAACTCTATTTTCTCTGCTCAAGACGAGGCCAAAAAGTTTACGTTTAAT CTAATGGCGAAGCATATAATGAGTATGGATCCTGGAGAAGAAGAAACAGA GCAATTAAAGAAAGAGTATGTAACTTTC---AAAGGAGTTGTCTCTGCTC CTCTAAATCTACCAGGAACTGCTTATCATAAAGCTCTTCAGTCACGAGCA ACGATATTGAAGTTCATTGAGAGGAAAATGGAAGAGAGAAAATTGGATAT CAAGGAAGAAGAT---CAAGAAGAAGAAGAAGTGAAAACAGAGGATGAAG CAGAGATGAGTAAGAGTGATCATGTTAGGAAACAAAGAACAGACGATGAT CTTTTGGGATGGGTTTTGAAACATTCGAATTTATCGACGGAGCAAATTCT CGATCTCATTCTTAGTTTGTTATTTGCCGGACATGAGACTTCTTCTGTAG CCATTGCTCTCGCTATCTTCTTCTTGCAAGCTTGCCCTAAAGCCGTTGAA GAGCTTAGGGAAGAGCATCTTGAGATCGCGAGGGCCAAGAAGGAACTAGG AGAGTCAGAATTAAATTGGGATGATTACAAGAAAATGGACTTTACTCAAT GTGTTATAAATGAAACTCTTCGATTGGGAAATGTAGTTAGGTTTTTGCAT CGCAAAGCACTCAAAGATGTTCGGTACAAAGGATACGATATCCCTAGTGG GTGGAAAGTGTTACCGGTGATCTCAGCCGTACATTTGGATAATTCTCGTT ATGACCAACCTAATCTCTTTAATCCTTGGAGATGGCAACAGCAAAACAAC GGAGCGTCATCCTCAGGAAGTGGTAGTTTTTCGACGTGGGGAAACAACTA CATGCCGTTTGGAGGAGGGCCAAGGCTATGTGCTGGTTCAGAGCTAGCCA AGTTAGAAATGGCAGTGTTTATTCATCATCTAGTTCTTAAATTCAATTGG GAATTAGCAGAAGATGATAAACCATTTGCTTTTCCTTTTGTTGATTTTCC TAACGGTTTGCCTATTAGGGTTTCTCGTATTCTG---------------- ----- >P ------------ATGTCTCACTCAGAGCTTGTTGTCTTTCTCCTTCCATC GATTTTATCACTACTCTTGCTCTTCATTCTCGTGCAA------------- -----------------------------------AGAAAGCAAGTAAGA TTTAATCTCCCACCAGGCAACATGGGGTGGCCATTTCTTGGAGAAACCAT TGGCTAC---CAGCCTTACTCTGCTACTTCAATAGGAGAATTCATGGAAC AGCACATATCAAGGTATGGAAAGATTTACAAGTCCAATTTGTTTGGGGAG CCAACAATAGTATCCGCAGATGCTGGACTTAACAGATTTATACTACAGAA TGAGGGAAGATTATTTGAATGCAGCTATCCAAAAAGTATTGGTGGAATTC TTGGAAAATGGTCCATGTTGGTTCTTGTTGGAGACATGCATAGAGACATG AGGATTATATCTCTTAACTTTTTGAGCCATGCCAGGTTAAGAACTCATCT ATTGAAAGAAGTGGAGAAGCAAACCCTGCTTGTTCTTAGCTCTTGGAAGG AGAATTGTACATTTTCAGCTCAAGATGAAGCAAAGAAGTTTACCTTCAAT TTGATGGCAAAACATATCATGAGCTTGGATCCTGGAAAGCCAGAGACTGA GCAGCTGAAAAAAGAGTATGTTACTTTCATGAAAGGAGTAGTTTCAGCTC CTATAAATTTGCCTGGAACCCCATATAGAAAAGCCTTGAAGTCTCGATCA ATCATCTTGAAATTTATAGAGCGAAAGATGGAGGAGAGAATTGCTGAAAC GAAGGGTGGAGTA---GAAAACTTGGAAGAC------------------- --------------------------------------------GATGAT CTTCTTGGATGGGTCTTGAAGCATTCAAATCTTTCTACGGAGCAAATCCT TGACTTAATCTTAAGCTTGCTCTTTGCTGGCCACGAAACTTCTTCTGTGT CCATAGCTCTAGCCATCTACTTCTTGCAAGCTTGTCCTGGTGCTATTCAA CAGTTAAAAGAAGAACATATTCAAATCTCCAGAGCCAAGAAACGGTCAGG AGAGACGGAATTGAACTGGGATGATTACAAAAAAATGGAATTCACCCAAT GCGTTATAAGCGAGACACTGAGGCTTGGAAACGTAGTCAGGTTTCTTCAC AGAAAAGCTCTAAAAGATGTTCGGTACAAAGGGTACGACATTCCATGTGG ATGGAAAGTGCTACCAGTGATCTCAGCCGTCCATTTAGATTCAACTCTTT TCGACCAACCTCAACACTTCAATCCATGGAGATGGCAGCAGCATAACAAT GCTCGTGGTGCTTCTACAAGTTCGAGTGGGACGACGAGTAGTAATTACTT CATGCCATTTGGGGGAGGACCGCGACTTTGTGCAGGATCGGAATTGGCAA AACTAGAAATGGCCGTGTTCATCCACCATTTGGTCCTCAACTTCCACTGG GAACTGGTTGATACCGATCAAGCCTTTGCCTTTCCTTTTGTCGATTTTCC CAAGGGCTTGCCCATAAGAGTCAAGCACCTACTCACAGTTACA------- ----- >R ---------------TCTGACTCAGAGCTTATTCCTTTTATTCTTCCTTC AATCTTATCTCTAATTTTAGTCTTCATTCTCATATAC------------- -----------------------------------AGAAAGCAAGCAAGA TTCAATCTTCCACCAGGCAACATGGGCTGGCCCTTTCTTGGAGAAACTAT TGGCTACTTGAAGCCTTACTGTGCCACTACAATTGGCGAATTCATGGAAC AACACATCTCAAGGTATGGGAAGATATACAAGTCTAATTTATTTGGGGAG CCAACGATTGTCTCTGCAGATCCTGGACTAAACAAGTTCATACTACAGAA TGAAGGGAGGTTATTTGAATGCAGCTATCCGAGAAGCATAGGTGGAATTC TTGGAAAATGGTCTATGCTTGTTCTAGTTGGAGACATGCATAGAGACATG AGGACTATATCTCTCAATTTTTTAAGCCATGCAAGGCTCAGGACTCATCT ATTGAGAGAGGTAGAGAAGCATACCTTGCTTGTTCTCGACTCTTGGAGTG ACAACTCTACATTTTCAGCTCAACATGAGGCGAAGAAGTTCACCTTCAAT TTGATGGCGAAACATATAATGAGCATGGATCCTGGAAAGCCAGAGACTGA ACAGCTAAAGAAAGAGTATGTTACTTTTATGAAAGGAGTTGTTTCTGCTC CTCTGAATTTTCCTGGAACTGCATACAGAAAGGCTTTGCAGTCTCGATCG AGCATCTTAAAGTTCATAGAGAGGAAAATGGAGGAAAGAGTAGGAAAAAT GGAGGAAGAA---------------------------------------- --------------------------------------------GAGGAT  77 CTTCTTGGATGGGTATTGAAGCATTCTAATCTGTCTAGGGAGCAAATTCT GGATTTAGTACTCAGTTTGCTGTTTGCTGGCCATGAAACTTCCTCGGTAT CCATAGCTTTAGCTATGTATTTCTTGCAAGGTTGTCCCAGGGCTACTCAG CAGTTGAGGGAAGAACACATGGCAATTGCAAGAGCAAAGAATGAATCAAG CCGGAGCGAATTGAACTGGGAAGATTACAAGAAAATGGAATTTACTCAAT GCGTTATTAGTGAGACACTTAGACTTGGAAACGTGGTGAGATTTCTTCAC AGAAAGGCTGTGGAAAATGTTCGATATAAAGGGTATGACATTCCACGTGG ATGGAAAGTGCTCCCAGTGATTGCAGCCGTGCATTTGGATTCTAGTCTGT TTGACCAGCCTCAACTATTCAATCCATGGAGATGGCTGCACCACCACTCG AATAGGGGAGGTTGT------------------------GGAAATTACTT CATGCCGTTTGGTGGAGGACCGCGGGTATGCGCCGGATCGGAGTTGGCAA AATTAGAGATGGCAATATTCATCCACCATTTGGTTCTGAATTTCAGCTGG GAGTTGGCCGATAATGATCAAGCTTTTGCTTTCCCCTTTGTCGACTTTCC TAAAGGCTTACCCATAACTATAAGAGCCAACCACCAAAAGAAACAAGAAA CTTCA >O GCCGCCATGATGGCGTCCATAACCAGCGAGCTGCTCTTCTTTCTCCCCTT CATCCTCCTTGCCCTGCTCACGTTCTACACCACCACCGTGGCCAAATGCC ACGGCGGGCACTGGTGGCGAGGTGGGACGACGCCGGCGAAGAGGAAGCGG ATGAACCTGCCGCCCGGCGCCGCCGGGTGGCCGCTCGTCGGCGAGACGTT CGGCTACCTCCGCGCCCACCCCGCCACCTCCGTCGGCCGCTTCATGGAGC AGCACATCGCACGGTACGGGAAGATATACCGGTCGAGCCTGTTCGGGGAG CGGACGGTGGTGTCGGCGGACGCGGGGCTCAACCGGTACATCCTGCAGAA CGAGGGGAGGCTGTTCGAGTGCAGCTACCCGCGCAGCATCGGCGGCATCC TGGGCAAGTGGTCCATGCTGGTCCTCGTCGGGGACCCGCACCGCGAGATG CGCGCCATCTCCCTCAACTTCCTCTCCTCCGTCCGCCTCCGCGCCGTCCT CCTCCCCGAGGTCGAGCGCCACACCCTCCTCGTCCTCCGCGCCTGGCCCC CTTCCTCCACCTTCTCCGCTCAGCACCAAGCCAAGAAGTTCACGTTCAAC CTGATGGCGAAGAACATAATGAGCATGGACCCGGGGGAGGAAGAGACGGA GCGGCTGCGGCGGGAGTACATCACCTTCATGAAGGGCGTGGTCTCCGCGC CGCTCAACCTGCCCGGGACGCCCTACTGGAAGGCTCTCAAGTCGCGTGCT GCCATTCTCGGAGTAATAGAGAGGAAA---GAAGAGCGGGTTGAGAAGCT GAGCAAGGAGGAT---GCAAGCGTAGAGCAA------------------- --------------------------------------------GACGAT CTTCTCGGATGGGCTCTGAAACAATCTAACCTTTCAAAAGAGCAAATCCT GGACCTCTTGCTGAGCTTGCTCTTCGCCGGGCACGAGACGTCGTCCATGG CGCTCGCCCTCGCCATCTTCTTCCTTGAAGGCTGCCCCAAGGCTGTCCAA GAACTGAGGGAGGAGCATCTTGGGATTGCAAGGAGACAAAGGCTAAGAGG GGAGTGCAAATTGAGCTGGGAAGACTACAAAGAGATGGTTTTCACGCAAT GTGTCATAAACGAGACGTTGCGGCTAGGAAACGTGGTCAGGTTCCTGCAC CGGAAGGTCATCAAGGACGTGCACTACAAGGGTTATGACATTCCAAGCGG ATGGAAGATCCTGCCGGTGTTAGCCGCGGTGCATCTGGACTCGTCCCTGT ACGAGGACCCCCAGCGCTTCAATCCCTGGAGATGGAAGAGTAGCGGATCA TCCGGCGGCTTGGCTCAGAGCAGCAGC---------------------TT CATGCCGTACGGCGGCGGGACGCGGCTGTGCGCCGGGTCGGAGCTCGCGA AGCTGGAGATGGCCGTGTTCTTGCACCACCTGGTGCTCAACTTCAGGTGG GAGCTCGCCGAGCCGGACCAAGCCTTCGTCTTCCCCTTCGTCGACTTCCC CAAGGGCCTTCCCATTAGGGTTCATAGAATTGCACAGGATGATGAGCAGG AG--- >V ---------------TCTGACTTGGAGTTTTTTCTCCTCCTCCTTGCGTC AATCTCAGTTCCCCTTGTGATTCTCAATCTGATCAAA------------- -----------------------------------AGAAAGCAAAGCGGA CTTAATCTACCTCCGGGAAACACGGGTTGGCCTTTTCTGGGTGAAACCAT CGGCTATTTAAAGCCGTACTCGGCCACTTCAATAGGAGACTTCATGGAGC AACACATATCAAGGTTCGGAGAAATCTACAAGTCCAATCTGTTTGGCGAG CCAACCATAGTCTCAGCGGATTCTGGGCTGAACAGATTCATACTACAGAA CGAAGGAAAATTGTTTGAATGCAGCTATCCCAGAAGCATAGGTGGAATTC TTGGGAAATGGTCCATGCTGGTTTTAGTTGGAGACATGCATAGAGACATG AGAACCATCTCCCTCAACTTCTTGAGCCATGGCAGGCTTAGGACTCATCT CCTACCAGAGGTGGTGAAGCACACTTTGCTTGTTCTAAGCTCTTGGAAGG AGAATTGTACATTTTCTGCTCAAGATGAAGCTAAGAAGTTTACCTTCAAT CTGATGGCAAAACATATCATGAGCTTGGATCCCGGAAAGCCGGAGACTGA GCAGCTTAAGAAAGAGTATGTTACTTTCATGAAAGGAGTGGTATCTGCTC CTTTGAATTTCCCTGGAACTGCATACAGAAAAGCCCTACAGTCTCGGTCC ACCATCTTAAAATTTATCGAGCTGAAGATGGAAGAGAGGATTCAGAAACT GAGGGGAGGAGGGTTTGAGAATATGGAGGAT------------------- --------------------------------------------GACGAT CTTCTTGGATGGGTGCTGAAGCATTCCAACCTTTCAACTGAGCAAATCCT GGACTTGGTACTGAGCTTGCTCTTTGCTGGCCATGAAACTTCATCAGTAG CAATAGCTTTAGCTATCTACTTCTTGGAAGGCTGTCCCAACGCCGTTCAA CAGCTAAGAGAAGAACACCTTGAAATTTCCAGGGCCAAGAAGCAATCAGG AGAGTTGGAATTGAGTTGGGAAGACTACAAAAAAATGGAATTCACTCAAT GTGTTATTAGTGAGACACTGAGGCTTGGAAATGTGGTTAGGTTTCTACAC AGAAAGGCCCTGAAAGATGTCCGGTACAAAGGGTATGACATTCCATGTGG  78 GTGGAAAGTGCTTCCGGTGATTGCAGCAGTGCACTTGGATCCTTCCCTTT TCGACCAACCTCAACACTTCAATCCTTGGAGATGGCAGCAGAATAATGGT AACCGAGGAAATTCGACTAGCTGGAGCACAGCCACGAATCAAAAC---TT CATGCCATTTGGGGGAGGACCACGGCTATGTGCGGGCTCTGAATTGGCCA AACTGGAAATGGCGGTGTTCATCCACCATTTGGTTCTCAACTACAACTGG GAGTTGGTTGATAAGGATCAGGCTTTTGCCTTCCCATTCGTCGATTTTCC GAAGGGCCTACCCATCAAGGTCCGACACCACAATTTCACG---------- -----    CRT.CrtB.fasta >A TCTTCTTCTGTAGCAGTGTTATGGGTTGCTACTTCTTCTCTAAATCCAGA CCCAATGAACAATTGTGGGTTGGTA---------------------AGGG TTCTAGAATCTTCTAGACTGTTCTCTCCTTGTCAGAATCAGAGACTAAAC ---AAAGGTAAGAAGAAGCAGATACCAACTTGGAGTTCTTCTTTT----- -------GTAAGGAACCGA------------------------------A GTAGAAGAATTGGTGTTGTGTCTTCAAGCTTAGTAGCAAGTCCTTCTGGA GAGATAGCTCTTTCATCTGAAGAGAAGGTTTACAATGTTGTGTTGAAACA AGCTGCTTTGGTGAACAAACAGCTAAGGTCTTCTTCTTATGACCTTGATG TGAAGAAACCACAAGATGTTGTTCTTCCTGGGAGTTTGAGTTTGTTGGGT GAAGCTTATGATCGATGCGGTGAAGTTTGCGCTGAATATGCTAAGACGTT TTATCTTGGAACTTTGCTTATGACACCCGAAAGGCGAAAGGCGATTTGGG CAATCTACGTTTGGTGTAGAAGAACTGATGAACTTGTGGATGGGCCAAAT GCTTCACATATAACTCCCATGGCTTTAGATAGATGGGAAGCAAGGTTAGA AGATCTTTTCCGTGGTCGTCCTTTCGATATGCTTGATGCTGCTCTCGCTG ATACAGTTGCTAGATACCCGGTCGATATTCAGCCATTTCGAGACATGATC GAAGGAATGAGAATGGACTTGAAGAAATCGAGATACCAGAACTTCGATGA TCTATACCTTTACTGCTACTACGTCGCTGGAACCGTCGGATTGATGAGCG TTCCGGTTATGGGAATCGATCCTAAGTCGAAAGCAACAACCGAAAGTGTT TACAACGCTGCCTTGGCCCTTGGTATAGCCAATCAGCTTACTAACATACT CAGAGACGTAGGCGAAGATGCGAGAAGAGGAAGGGTTTATCTGCCTCAGG ATGAATTGGCTCAGGCTGGTCTTTCAGATGAAGACATATTCGCCGGAAAA GTAACTGATAAATGGAGAAACTTCATGAAAATGCAGCTTAAACGAGCAAG AATGTTCTTCGACGAAGCTGAGAAAGGCGTCACCGAGCTCAGTGCCGCTA GCAGATGGCCTGTATGGGCTTCATTGCTATTGTACAGGAGAATACTGGAC GAGATTGAAGCGAATGATTACAACAATTTTACTAAGAGAGCTTATGTGGG GAAAGTCAAGAAAATTGCAGCTTTGCCATTGGCTTATGCTAAATCAGTAC TAAAGACTTCAAGTTCAAGACTATCGATA------ >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------GTGATATCAAGCATGGTAGCAAGCCATGCTGGA GAAATGGCTGTTTTGTCATCCGAGGAGATGGTTTATATGGTGCTGAAGCA GGCAGCTCTGGTTAAGAAAGAACTGAAGTCCAGAGGT---GATCTGGATG TGAAA---CCA---GATGTTGTTCTTCCAGGGACTTTGAGCTTGTTGAGT GAAGCTTATGATCGGTGTGGAGAAGTTTGTGCTGAGTATGCCAAGACTTT TTACCTGGGAACTCTGCTCATGACCCCTGAACGGAGAAGGGCTATTTGGG CCATATATGTGTGGTGTAGGAGGACCGATGAGCTTGTTGATGGGCCTAAT GCTTCACACATTACACCAACAGCTTTAGATAGGTGGGAGGCAAGGTTGGA AGATCTTTTCCAAGGGCGTCCATTTGATATGATGGATGCTGCTCTAGCAG ACACAGTTGGAAAATTTCCTGTTGATATTCAGCCATTCAAAGATATGATT CAAGGAATGAGGATGGACTTGAGGAAATCAAGATACCAAAACTTTGATGA GCTCTATCTTTACTGTTATTATGTTGCTGGGACTGTTGGACTGATGAGTG TTCCAGTCATGGGCATTGCACCTGAATCACAGGCTTCGACCGAGAGTGTT TATAATGCTGCCTTGGCATTGGGGATAGCCAATCAACTCACTAACATACT CAGGGATGTAGGAGAAGATGCAAGAAGAGGAAGGGTTTATCTACCACAAG ATGAGCTGGCACAGGCAGGGCTTTCAGATGATGACATATTTGCTGGAAAG GTGACAGATAAGTGGAGAAACTTTATGAAGAATCAAATTAAGAGAGCAAG GATGTTCTTTGATGAGGCTGAGAAAGGAGTGACAGAATTGAGTGCTGCAA GTCGATGGCCGGTTTGGGCATCCTTGCTGCTATATCGCCAAATACTAGAC GAGATAGAGGCTAACGATTACAACAGCTTCACAAAGAGGGCATATGTGAG AAAAGCCAAGAAGATAGTTGCTTTGCCAGTTGCGTATGCAAAATCCCTCA TTAGTCCATCATCG--------------------- >R ------ACTGTAGCATTACTATGGATTGCC------AACCCCACTACAGA GGTTTCCAGTTCTTTTGGGTTGCTCCATTCAATC------------AGGG TTTTAGATTCATCAAAATTTGGTTTTATCGATCGAAAT---TTGTTTAAG GGAAGAGAAAAGAAGGATAAGAAGCAGAAATGGAAATCAAGTTCTGTGAA TATTGATTTGAGGAATCATTGCACAGGT---------------------A GTGGAAGCAAATTGCCTCTGATATCTAGCATGGTAGCTAGCTCAGCTGGA  79 GAAATGGCTATTTCTTCTGAGGAGAAGGTATATAATGTGGTGGTGAAGCA AGCAGCTTTGATTAAAAGGCAATTGAGGACTAGCGGT---GATCTTGATG TGAAA---CCA---GATATTGTTCTTCCTGGAACTCTGGGATTGTTGAGT GATGCTTATGACAGATGTGGAGAAGTTTGTGCTGAGTATGCGAAAACATT TTATTTGGGAACTTTGCTAATGACACCGGAAAGGCGAAGAGCTATCTGGG CAATATATGTGTGGTGTAGGAGGACGGATGAGCTTGTCGATGGGCCTAAT GCTTCGCACATAACTCCAACAGCTTTAGATAGGTGGGAGGCACGGTTAGA AGATCTTTTCCAAGGTCGTCCATTTGATATGCTGGATGCTGCTTTGGCAG ATACTGTTGCCAAATTTCCTGTTGACATTCAGCCATTCAAAGATATGATA GAAGGAATGAGGTTGGACCTGAAGAAATCAAGATATAAGAACTTTGATGA GCTTTATCTTTACTGTTATTATGTTGCTGGGACTGTTGGACTAATGAGTG TTCCAGTCATGGGGATTGCACCTGAATCACAAGCAGCAACTGAGAGTGTT TACAATGCTGCCTTGGCATTAGGGATAGCAAACCAGCTCACCAACATACT TAGGGATGTTGGAGAGGATGCAAGAAGAGGAAGGGTGTATTTACCACAGG ATGAGCTAGCGCAGGCAGGGCTTTCAGACGATGACATATTTGCTGGAAGA GTGACAGATAAATGGAGAAATTTCATGAAAAATCAAATAAAGAGAGCACG GATGTTCTTCAATGAGGCGGAGAAAGGAGTGACTGAACTGAGTGCTGAAA GTAGATGGCCGGTCTGGGCGTCCTTACTGCTATACCGGCAAATACTAGAC GAGATCGAAGCAAATGACTATAACAACTTCACAAGGAGAGCTTATGTAGG CAAAGCCAAGAAGCTAGCTTTCTTGCCAATGGCATATGCAAGATCAGCTG TTGGGCCCGCAAGACTGCCTTCTTTGACAAAGGCA >O ---GCGGCCATCACGCTCCTACGTTCAGCGTCTCTTCCGGGCCTCTCCGA CGCCCTCGCCCGG------------------------------------- -----GACGCTGCTGCCGTCCAACATGTCTGCTCCTCCTACCTGCCCAAC AACAAGGAGAAGAAGAGGAGGTGGATCCTCTGCTCG-------------- -------CTCAAGTACGCCTGCCTTGGCGTCGACCCTGCCCCGGGCGAGA TTGCCCGGACCTCGCCGGTGTACTCCAGCCTCACCGTCACCCCTGCTGGA GAGGCCGTCATCTCCTCGGAGCAGAAGGTGTACGACGTCGTCCTCAAGCA GGCAGCATTGCTCAAACGCCACCTGCGCCCACAACCACACACCATTCCCA TCGTT---CCCAAGGACCTGGACCTGCCA------AGAAACGGCCTCAAG CAGGCCTATCATCGCTGCGGAGAGATCTGCGAGGAGTATGCCAAGACCTT TTACCTTGGAACTATGCTCATGACGGAGGACCGACGGCGCGCCATATGGG CCATCTATGTGTGGTGTAGGAGGACAGATGAGCTTGTAGATGGACCAAAT GCCTCGCACATCACACCGTCAGCCCTGGACCGGTGGGAGAAGAGGCTTGA TGATCTCTTCACCGGACGCCCCTACGACATGCTTGATGCTGCACTTTCTG ATACCATCTCCAAGTTTCCTATAGATATTCAGCCTTTCAGGGACATGATA GAAGGGATGCGGTCAGACCTCAGAAAGACTAGATACAAGAACTTCGACGA GCTCTACATGTACTGCTACTATGTTGCTGGAACTGTGGGGCTAATGAGTG TTCCTGTGATGGGTATTGCACCCGAGTCGAAGGCAACAACTGAAAGTGTG TACAGTGCTGCTTTGGCTCTCGGCATTGCAAACCAGCTCACAAATATACT CCGTGACGTTGGAGAGGACGCGAGAAGAGGGAGGATATATTTACCACAAG ATGAACTTGCAGAGGCAGGGCTCTCTGATGAGGACATCTTCAATGGCGTT GTGACTAACAAATGGAGAAGCTTCATGAAGAGACAGATCAAGAGAGCTAG GATGTTTTTTGAGGAGGCAGAGAGAGGGGTGACCGAGCTCAGCCAGGCAA GCCGGTGGCCGGTCTGGGCGTCTCTGTTGTTATACCGGCAAATCCTTGAC GAGATAGAAGCAAACGATTACAACAACTTCACAAAGAGGGCGTACGTTGG GAAGGCGAAGAAATTGCTAGCGCTTCCAGTTGCATATGGTAGATCATTGC TGATGCCCTACTCACTGAGAAATAGCCAGAAG--- >V ------TCTGTTGCTCTGTTGTGGATTGTT------CCCCCCAACAAAGA GGCCTCCAATTCCTTTGGCTTTTTGGAATCAATCCGAGATGGAAACCGGT CTTTAGATTCACCATGGTTCATTCCTAGAGACCAGAATTTGATATTTAAT GACAGACCCAAGAAAGGTAGGAGGCAGAGGTGCAATTCTGGCTCATCTGG GGCAGATTTGAGGTATTCATACTTGGGT------GGATCAGGCATGGAGA GTAGAACCAATTTTCCTATATTTTCAAGTATGGTAGTGAACCCAACTGGA GAAATGGCAGTGTCGTCGGAGCAGAAGGTTTATGATGTGGTGCTGAAGCA GGCAGCCCTTGTTAAGAAGCAATTGAGATCTAGTGAA---GAACTTGATG TGAAA---CCT---GATATTATTCTTCCTGGGACTCAGAGCTTGTTGAGT GAAGCCTATGATCGATGTGGTGAAGTTTGTGCAGAGTATGCCAAGACATT TTACTTGGGAACAATGCTGATGACACCTGAGAGACGAAGAGCTATCTGGG CAATATATGTGTGGTGTCGGAGAACAGATGAGCTTGTTGATGGGCCTAAT GCATCACACATAACCCCAACAGCCTTGGATAGGTGGGAGTCAAGGTTGGA AGATCTTTTTCAGGGCCGCCCTTTTGATATGCTTGATGCTGCTTTATCAG ATACAGTTGCCAAGTTTCCTGTTGACATTCAGCCATTCAAAGAT---ATT GAAGGTATGAGGATGGACCTTAGAAAGTCAAGATACAGAAATTTCGATGA ACTATATCTGTACTGTTACTATGTGGCGGGAACTGTTGGGTTAATGAGCG TTCCAGTTATGGGCATTGCACCTGAATCACAGGCAACCACGGAGAGTGTC TATAAGGCAGCCTTGGCATTAGGGATCGCAAATCAGCTGACTAACATACT CAGGGATGTTGGAGAAGATGCAAGGAGAGGAAGGATTTATTTACCACAGG ATGAGCTGGCACAAGCAGGGCTCTCAGATGAGGACATTTTTATGGGAAGG GTAACAGATAAATGGAGAAGCTTCATGAAAGATCAAATTAAGAGAGCAAG GATGTTCTTCGATGAGGCGGAAAAAGGAATTACGGAGCTCAGCTCAGCTA GTAGATGGCCGGTATGGGCATCTTTTCTGTTGTATCGGCAAATACTGGAT GAGATTGAAGCTAACGATTACAACAACTTCACTAGGAGAGCTTATGTGAG  80 CAAAGCTAAGAAGATAGTTGCTTTGCCACTAGCCTATGCAAGGTCCCTTG TGAGGCCATCAAGAACAACATCTTTAGTCAAGGCA    CRT.CrtISO.fasta >A GATTTGTGTTTTCAAAATCCCGTAAAGTGTGGTGATCGTTTG-------- ----------------------TTCTCCGCATTGAATACCTCTACGTATT ACAAGCTGGGTACTTCGAATTTAGGGTTTAATGGTCCAGTTTTAGAGAAT CGGAAGAAGAAGAAGAAGCTGCCT-------------------------- -------------------CGTATGGTTACAGTGAAATCCGTTTCTTCAA GTGTGGTTGCTAGTACCGTACAAGGGACGAAGAGAGATGGAGGAGAGAGT CTGTACGACGCCATTGTTATCGGTTCTGGGATTGGTGGATTAGTTGCTGC GACTCAGCTAGCTGTGAAAGAAGCTAGGGTTTTAGTTCTG---AAGTATT TGATTCCTGGTGGCAGCTCTGGTTTTTACGAGAGAGATGGATATACTTTT GATGTTGGCTCTTCTGTCATGTTTGGTTTCAGCGATAAGGGGAACCTAAA CTTGATAACTCAGGCATTGAAGGCAGTTGGTCGTAAGATGGAGGTTATAC CTGATCCTACCACTGTCCATTTCCATCTCCCCAATAATCTTTCTGTTCGG ATTCATAGGGAATACGATGATTTCATCGCG---CTTACGAGCAAGTTTCC TCACGAAAAGGAAGGGATCCTTGGATTCTATGGTGACTGTTGGAAGATCT TCAACTCATAC---TCCCTGGAACTAAAGTCACTAGAAGAGCCTATCTAC CTTTTTGGACAGTTCTTTCAGAAGCCGCTTGAATGCTTGACACTCGCTTA TTACTTGCCCCAAAATGCTGGGGCTATAGCTCGGAAGTACATAAAGGATC CTCAATTATTGTCTTTCATT---GCAGAGTGTTTCATTGTGAGCACAGTC AATGCTTTGCAGACGCCAATGATCAATGCAAGTATGGTTTTATGTGACAG GCACTATGGAGGAATTAACTACCCGGTTGGTGGAGTTGGTGGGATTGCCA AGTCTTTGGCAGAAGGGCTTGTTGATCAAGGCAGTGAAATACAATACAAG GCTAATGTAAAAAGTATAATACTTGATCATGGAAAGGCAGTTGGTGTAAG GCTAGCAGATGGAAGAGAATTTTTCGCTAAGACGATAATTTCAAATGCTA CAAGATGGGATACGTTTGGGAAGCTGTTAAAAGGAGAAAAGCTTCCTAAA GAAGAAGAAAATTTCCAGAAAGTGTACGTCAAGGCTCCATCATTTCTTTC AATTCACATGGGTGTTAAAGCAGAGGTTCTCCCTCCAGATACAGATTGCC ATCATTTTGTGCTCGAGGACGATTGGAAGAATCTGGAGGAGCCTTATGGC AGTATTTTCCTCAGCATTCCAACCATTCTTGATTCATCTTTGGCTCCAGA TGGTCGACATATACTTCACATATTTACAACTTCGTCCATTGAGGATTGGG AGGGACTCCCTCCAAAAGAGTATGAGGCGAAAAAGGAAGATGTGGCAGCT AGAATAATCCAGAGACTAGAGAAAAAATTGTTTCCAGGGCTCAGTTCATC TATTACGTTCAAGGAGGTGGGAACACCAAGAACACACAGACGATTTCTTG CGAGGGATAAGGGAACTTATGGGCCAATGCCTAGAGGAACCCCGAAAGGT TTATTAGGCATGCCATTCAATACAACGGCTATAGATGGTCTATACTGCGT GGGGGATAGTTGTTTTCCTGGCCAGGGAGTTATAGCTGTGGCTTTTTCAG GAGTGATGTGTGCTCATCGGGTAGCTGCTGATATTGGGCTTGAGAAGAAA TCACGAGTACTTGATGTTGGCCTTCTTGGTTTACTTGGTTGGCTAAGGAC ACTCGCA >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------------------------------AGC AATTACGATGCAATTGTTATTGGGTCTGGTATCGGTGGGTTGGTTGCTGC TACACAGTTGGCA---GAGGGAGCTAAAGTTTTGGTCTTGGAGAAGTATG TGATTCCTGGTGGGAGTTCTGGGTATTATGAGAGGGATGGATTTACTTTT GATGTTGGCTCTTCTGTTATGTTTGGTTTCAGTGATAAG----------- -------------GCATTGGCAGCAGTTGGCTGTGAAATGGAGGTGATTC CTGACCCAACTACTGTCCATTTTCATCTACCCAATGACCTTTCTGTTCAA GTTCACAGAGAGTACATCGACTTCATCTCAGAACTTGCTGCTAAATTTCC CCATGAAAAGGATGGGATCCTTAAATTCTACGGTGAATGCTGGAAGATAT TCAATGCCTTGAACTCTCTGGAACTGAAGTCACTTGAGGAGCCAATCTAC CTGTTTGGACAATTTTTTCAGAAACCTCTTGAATGCTTGACACTGGCTTA TTATCTACCTCAAAATGCTGGAGATATTGCTCGAAAGTACATAAAGGATC CTCAGTTATTGTCTTTCATTGATGCAGAGTGTTTCATAGTGAGCACAGTC AATGCTTTGCAGACTCCAATGATCAATGCGGCCATGGTTCTATGTGATAG GCATTTTGGAGGGATCAATTACCCTGTTGGTGGGGTTGGTGGAATTGCGA AGTCCTTATCAAAAGGTCTGGTTGATCAGGGCAGTGAAATACTTTACAGG GCAAATGTGACCAACATCATTCTTGAGCATGGAAAGGCTGTAGGAGTAAG GCTTTCAGATGGAAGGGAGTTCTTTGGAAAAACCATAATCTCAAATGCTA CTAGATGGGATACCTTCGGGAAGTTGTTAAAAGGAGAAACCCTTCCAAAA GAAGAAGAAAATTTCCAAAAAGTTTATGTTAAGGCTCCATCTTTTCTTTC CATTCATATGGGTGTTAAAGCTGAGGTTCTACCACCAGATACAGATTGCC ACCACTTTGTGCTTGAGGATGACTGGGCAAGATTAGAGGAGCCTTATGGA AGCATATTTCTAAGCATTCCAACTATTCTTGATTCGTCATTGGCTCCGGA AGGCCATCATATACTTCACATATTTACAACATCTTCCATTGAAGACTGGG  81 AGGGACTCTCGACAAAGGACTATGAGGCCAAGAAGAAGGTTGCGGCTGAT GAGATTATAAGCAGATTGGAGAAGAAACTTTTTCCAGGGATCAGATCATC AATTGCTTTCATGGAGGTGGGTTCACCCAAGACACACAGGCGGTACCTGG CTCGTGATAAGGGTACTTATGGACCCATGCCACGCAGAACTCCTAAAGGT TTATTGGGAATGCCATTCAATACGACAGCTGTAGATGGTCTTTACTGTGT TGGCGATAGCTGCTTTCCAGGACAGGGCGTGATAGCTGTAGCTTTTTCAG GAGTAATGTGTGCTCATCGAGTAGCTGCTGATATTGGCATTGAGAAAAAG TCTCCTGTACTGGATGCTGCTCTCCTTCGGCTTCTTGGCTGGTTAAGGAC CTTGGCA >R AGTTTAGCTTTCAGTAGCACAGTTCAATTTGGTAGTTTTGGACCCAGAAG CCAGAAACATGGATTTTTCTCTTTTGAAACTTCCAAAGTCTCATACCTTT TCAATCTCAGTAACATCAATTCAGGGTGGTTATGCAATTCCACGTCCAGA AATTTAGAATATAGAAGTGCAAGTTTCAATAGTAATAACAAGTTTAGGTC TTGCAAGGTGAAGAGGAACTTGGCTTTGAGGACAAAGTCAGTGTTGAGTG TGAATAAAAAAGTGGATATACAGGGGAATAGA---------GGAGTAAGC AAATTTGATGCTATTGTTATTGGTTCTGGGATTGGTGGTTTGGTTGCTGC TACACAGCTGGCTGTGAAGGGAGCTAGGGTTTTGGTTTTGGAGAAGTATG TGATTCCTGGTGGGAGCTCTGGTTATTATGAGAGGGATGGTTATACTTTT GATGTTGGGTCTTCAGTTATGTTTGGCTTCAGTGATAAGGGCAACCTAAA TTTGATAACCCAAGCATTGGCAGCAGTTGGTCGTAAGATGGAGGTGATTC CTGATCCAAGTACTGTCCATTTCCATCTACCCAATAATCTTTCTGTTCGA GTTCACAGAGAGTACAGTGACTTTGTCTCGGAACTTATTACTAGATTTCC CCATGAAGAGCAAGGGATTCTTAAATTCTATGGTGAATGTTGGAAGATAT TCAATGCCTTAAATTCATTGGAATTGAAGTCACTGGAGGAGCCAATTTAC CTGTTTGGGCAGTTCTTTCAGAAGCCTCTTGAATGCTTGACACTGGCTTA TTACCTGCCGCAAAATGCTGGAGACGTAGCTCGAAAATACATAAAGGACC CTGAGTTATTATCTTTTATTGACGCGGAGTGTTTTATTGTCAGCACAGTT AATGCGTTGCAGACACCAATGATTAATGCAGCCATGGTCCTATGTGATAG GCATTTTGGAGGAATTAACTATCCTGTTGGTGGTGTTGGTGGAATTGCAA AGTCTTTGGTGAACGGTCTGGTTGATCAGGGGAGTGAAATTCTGTACAAG GCAAACGTGACTAACATTATACTGGAGCATGGAAAGGCTGTGGGAGTGAG GCTGTCAGATGGAAGAGAGATCTTTGCCAAAACCATAATATCAAATGCTA CTAGATGGGATACCTTTGGGAAGTTGTTAAAAGGTGAAAAGCTTCCACAA GAAGAAGAGAACTTTCAGAAAGTTTATGTCAAGGCTCCATCCTTTCTTTC CATTCACATGGGTGTTAAAGCTGAGGTTCTGCCTCCAGATACAGATTGCC ATCATTTTGTGCTTGAGAATGACTGGGCGAGATTACAGGAGCCTTATGGC AGTATATTTTTAAGCATTCCAACTGTCCTCGATCCATCGCTAGCCCCTGC AGGGCACCATATTCTTCACATATTCACGACTTCTTCAATTGAAGACTGGG AGGGACTCCCTGTAAAGGATTATGAGGCAAAGAAGCAGCTGGTTGCAGAC AAAATTATAGGCAGATTGGAGAAGGAACTGTTTCCAGGGCTCAGATCATC AATTGCTTTTATGGAGGTGGGGTCACCCAAGACACACAGGCGGTATCTAG CTCGTGATAAAGGTACTTATGGACCA---CCATGCAGAACTCCTAAAGGC TTATTGGGAATGCCATTCAATACAACAGCTATAGATGGTCTTTACTGTGT TGGAGATAGCTGTTTTCCAGGACAGGGTGTAATAGCTGTAGCCTTTTCAG GAGTAATGTGTGCTCATCGTGTAGCTGCTGATATTGGACTGGAGAAAAAG TCCCCTGTAATGGATGCTGCTCTCCTTCGACTTCTTGGCTGGTTAAGGAC ATTGGCA >O CCGCTCCTCCTCCTCGCCGCCGCGCGCCCGTGCGCCCCGCTC-------- -------------------------------------------CTCGCTC CCTCCGCCGCCGGAGCAGTAGTAGGCCGGCCGTCCACCGCCCGCCCACTG GGACGAGGGACCAGGAGAGGCGCG-------------------------- -------------------GGCGCGGCGGCGGCGGCTGCGGTGGCGGCGG AGAAGACGGTGGTGAAGGCGGAGGAGGAGGAGGAGGGTGGGGGAGAG--- ---TACGACGCGATCGTGGTGGGGTCGGGGATCGGGGGG---GTGGCGGC GACGCAGCTGGCGGCGAAGGGGGCGAGGGTGCTGGTGCTGGAGAAGTACG TCATCCCCGGGGGGAGCTCCGGGTACTACCGCCGCGACGGGTTCACCTTC GACGTCGGCTCCTCCGTCATGTTCGGCTTCTCCGACAAGGGGAACTTGAA TTTGATTACACAAGCACTAGAAGCAGTTGGGCATAAGATGGAAGTTATAC CGGATCCTTCTACGGTTCATTTCCACCTACCTGGTGACCTCTCAGTTCTT GTGCATAGAGAGTATGATGACTTCGTCACGGAGCTGGTTAATAAATTTCC TCATGAAAAGGAAGGAATCCTGAAATTCTATGGCACATGTTGGAAGATCT TCAATTCATTAAATTCTTTGGAGCTGAAGTCCCTTGAGGAGCCTCTATAT CTTTTTGGGCAATTTTTTCAAAAGCCTCTGGAATGTTTGACGCTAGCTTA TTATCTGCCACAGAATGCTGGGGATATTGCTCGCAAGTTCATAAAAGATC AGCAGTTACTCTCCTTCATAGATGCTGAGTGCTTTATTGTGAGCACAGTC AATGCCTTGCAAACACCCATGATTAATGCAAGCATGGTCTTGTGCGATAG GCACTTCGGGGGAATTAACTATCCAGTTGGTGGTGTTGGTGGTATTGCT- --TCCTTGGCAGATGGGCTTGTTGACAAAGGCAGTGAAATACGCTACAAG GCTAATGTGACCAATGTAATTTTAGAAAATGGCAAAGCTGTTGGAGTCAG GTTATCAAATGGGAAGGAGTTCTTTGCTAAAACAGTGATATCGAATGCTA CCAGATGGGATACATTTGGTAAACTCTTGAAAGTTGAAGAGCTTCCAGAA GAGGAGAAAAACTTCCAAAAGAATTATGTTAAAGCACCATCATTCCTTTC CATTCATATGGGTGTCAAAGCCTCAGTTTTGCCTGCTGATACTGATTGCC  82 ACCATTTTGTACTTGAGGATGACTGGGCTAATTTGGAGAAGCCTTATGGA AGCATATTTTTAAGTATCCCTACAGTGCTTGACCCATCCTTGGCTCCCGA AGGACACCATATACTTCATATTTTTACAACTGCAGGGATAGAGGATTGGG AAGGTCTGTCCAGGAAGGATTATGAGAAGAAAAAGGAGCTTGTGGCGACA GAGATAATAAAGAGGCTTGAAAAAAAGCTGTTCCCTGGTCTTCAGGATTC AATAGTCCTCAAGGAGGTAGGCTCACCAAAAACACACCGAAGATTTCTTG CGCGAAATGATGGTACATATGGACCCATGCCACGGGGTAAACCAAAGGGA TTGCTAGCA---CCTTTCAATACTACTTCAATAGATGGCTTGTACTGTGT TGGCGACAGCTGTTTTCCTGGGCAAGGTGTAATTGCTGTGGCATTTTCAG GGATCATGTGTGCTCATCGAGTTGCAGCTGATATTGGACTGGAACAAAGA TCTCCTGTACTAGATGCGGGTCTTCTTGGGCTCCTCAGATGGTTGAGAAC GCTTGCT >V ------------------------------GGATTGGAGGGT-------- -------------------------------------------------T ACAAGCATGGTGGTGTTGAATTAGGGGTC--------------------- TATAGGTGGAGTAGGAGTGGAAGC-------------------------- -------------------TGTGTTGTGAGGCCTAGATCAGTGCTGAGTG TGGATGAAGTGGTAGAGAGGGAAGGGAATGGAAGAACAGGAGAGGAAAAG CAATACGATGCCATTGTTATCGGGTCGGGAATTGGAGGGTTGGTTGCGGC AACACAGCTGGCAGTGAAGGGAGCTAGGGTGTTGGTGCTGGAGAAGTATG TGATTCCTGGTGGGAGCTCTGGGTTCTACCAGAGAGATGGGTATACGTTT GATGTTGGGTCTTCTGTGATGTTTGGTTTCAGCGATAAGGGAAATTTAAA TTTAATAACCCAAGCACTGGAAGCAGTTGGATGTAAGATGCAGGTGATAC CTGATCCAACTACTGTCCATTTCCATTTACCCAGTAACCTTTCGGTCCGA GTACATAGACAATACGGTGAATTCATTGCAGAACTTACCAAGAATTTTCC CCATGAAAAGGAAGGGATCCTCAAATTCTACAATGAATGTTGGAAGATCT TCAATGCCCTAAACTCATTGGAATTGAAGTCACTTGAGGAGCCAATCTAC CTTTTCGGACAGTTCTTTCAGAAGCCTCTTGAATGCTTGACACTTGCCTA TTATTTGCCCCAAAATGCTGGAGACATAGCCCGCAAGTACATAAAGGATC CCCAGCTGTTATCTTTCATAGATGCTGAGTGTTTTATAGTGAGCACAGTT AATGCTTTGCAGACACCAATGATCAATGCGAGCATGGTTCTATGTGATAG GCATTTTGGGGGAATTAACTACCCTGTTGGTGGTGTTGGTGGAATTGCTA AGTCCTTGGCAAAAGGTCTAGTTGAAAATGGCAGTGAAATACTTTATAAG GCAAATGTGACTAGCATTATATTGGCGCAGGGAAAGGCCGTGGGAGTGAA GCTTTCAGATGGAAGGGAGTTCTTTGCCAAAACCATAGTATCTAATGCTA CTAGATGGGATACATTTGGAAAGCTTTTAAAGGGTGAAGAACTTCCAAAA GAAGAGGTGAACTTTCAAAAGGTCTATGTTAAGGCCCCATCATTTCTTTC CATTCACATGGGGGTTAAAGCTGAGGTTTTGCCACCTGATACAGATTGCC ACCATTTTGTTCTTGAGAATGACTGGTCAAGGTTAGAGGAGCCATATGGA AGCATATTTTTGAGCATTCCAACTATGCTTGATGCATCATTGGCTCCAGA AGGTCGCCATATTCTTCATATTTTTACAACTTCTCCCATAGAGGACTGGA AGGGACTCCCTCTAAAAGACTATGAGGCAAAGAAAGAACTTGTGGCAGAT GAAATCATAAGCAGATTGGAAAAAAAACTATTTCCGGGGCTCAAATCATC CATTGTTTTTAAGGAGGTAGGGACACCAAAAACACACAGGCGTTATCTTG CTCGAGATAATGGCACGTATGGACCAATGCCTCGCAGAACACCTAAGGGA TTATTGGGAATGCCATTCAATACAACTGCTATACATGGTCTCTACTGTGT TGGGGATAGCTGCTTTCCAGGACAAGGTGTTATAGCTGTAGCCTTTTCAG GTGTAATGTGTGCACACCGAGTGGCTGCAGATATTGGGCTTGAGAAGAAG TCCCCAGTGCTGGATGCTGCCCTTCTTCGACTACTTGGTTGGTTAAGGAC ATTGGCA    CRT.CrtL.b.fasta >A ---------GATACTCTGTTGAAAACACCCAACAAGCTCGATTTTTTCAT CCCTCAGTTTCATGGGTTT---GAGAGA---------------------- --------TTATGCAGCAATCCATAC------------CATTCAAGGGTT AGGCTTGGTGTGAAGAAAAGGGCTATCAAAATTGTC------TCTAGTGT AGTGAGTGGTAGCGCTGCTCTTTTGGATCTTGTTCCTGAAACTAAGAAGG AGAATCTTGACTTTGAGCTTCCTTTGTACGACACTTCCAAGAGTCAAGTT GTTGATTTGGCTATTGTTGGTGGTGGTCCTGCTGGTTTAGCCGTGGCTCA GCAGGTTTCTGAAGCTGGACTCTCTGTTTGTTCCATTGATCCTTCTCCTA AGCTCATATGGCCTAACAATTATGGAGTTTGGGTTGATGAGTTTGAGGCT ATGGATTTACTAGACTGCCTGGATACCACATGGTCTGGTGCTGTTGTCTA TGTC---GATGAAGGTGTCAAGAAGGATTTGAGCCGGCCTTATGGGAGAG TTAACCGGAAACAGCTCAAATCCAAAATGCTTCAGAAATGTATTACCAAC GGTGTTAAATTTCATCAGTCTAAGGTCACTAATGTGGTTCACGAGGAGGC AAACTCCACTGTGGTCTGCAGTGACGGTGTAAAGATTCAGGCTTCCGTGG TTCTTGATGCCACTGGGTTTTCCCGATGCTTGGTTCAGTATGACAAACCT TACAACCCTGGGTACCAAGTAGCTTACGGGATTGTAGCTGAAGTTGATGG TCACCCATTCGATGTAGACAAAATGGTGTTCATGGATTGGAGAGACAAAC ATCTGGACTCATATCCTGAGCTGAAAGAACGGAACAGCAAGATCCCAACG TTCTTGTACGCTATGCCATTTTCTTCCAACCGAATATTTCTTGAAGAAAC  83 TTCTTTAGTTGCTAGACCTGGTCTGAGAATGGAAGATATCCAAGAAAGAA TGGCTGCTAGACTGAAACATCTGGGGATCAATGTGAAGAGGATTGAGGAA GACGAGCGTTGTGTGATCCCGATGGGCGGTCCTTTACCAGTCTTACCTCA ACGGGTTGTGGGGATTGGTGGGACAGCAGGAATGGTTCATCCTTCAACTG GTTACATGGTTGCTAGGACTCTTGCAGCTGCACCAATAGTTGCAAATGCC ATTGTGAGATACCTC------GGTTCACCAAGTAGTAATAGCCTGAGAGG AGATCAACTCTCTGCTGAGGTTTGGAGAGACTTGTGGCCTATCGAACGGC GTAGACAGAGGGAGTTCTTCTGTTTTGGAATGGATATTCTGCTGAAACTC GATTTAGACGCTACTAGAAGGTTCTTTGATGCATTCTTTGATCTGCAACC TCATTACTGGCACGGATTCTTGTCTTCCAGGCTGTTTCTCCCGGAACTGT TGGTCTTCGGGTTGTCGCTCTTCTCACACGCTTCCAATACCTCAAGATTG GAGATCATGACAAAGGGGACTGTTCCTCTTGCTAAGATGATCAACAATTT GGTACAAGATAGAGAC--- >P ------ATGGATACTTTGTTGAAAACACATAACAAGATTGAA---TTTTT GCCTCAATTTCATGGGTTTTCGGAGAAA---------------------- --------GTGAGTAATTCGAGCTCCGTAAAGATTCAAATCCAGGAACTT AGGTTTGGTCCCAAAAAGTTTTTTTCAAAAGTGGGGAGGAATGGTTGTGT TGAGGCTAGTAGTAGTGCACTTTTGGAGCTTGTACCAGAAACCAAGAAGG AAAATCTTGAGTTTGATCTTCCTATGTATGACCCATCGAAAGGCCTTGTA GTTGACCTTGCAGTTGTGGGGGGAGGTCCTGCAGGGCTTGCTGTTGCTCA GCAAGTTTCGGAGGCAGGGCTCTCGGTTTGTTCGATTGATCCATCTCCTC AGTTGATTTGGCCTAATAATTATGGTGTTTGGGTTGATGAATTTGATGCC ATGGGTTTGCTTGACTGCCTTGATACCACTTGGTCTGGTGCTGTTGTCTA TGTT---AATGACAAGACAAAAAAAGATCTTGATAGGCCTTATGGGAGGG TTAATAGGAAGCAGCTGAAGTCCAAAATGTTACAGAAATGCATATCCAAT GGTGTTAAGTTTCACCAAGCTAAAGTTATCAAGGTTATTCATGAGGAGTC CAAATCTCTATTGATTTGCAATGATGGTGTCACAATCCAAGCTGTCGTGG TTCTTGATGCAACTGGTTTTTCTAGATGCCTTGTTCAATATGACAAGCCA TATAATCCAGGTTACCAAGTGGCTTATGGAATTTTGGCAGAGGTAGAAGA GCACCCGTTTGATGTTGATAAGATGGTTTTT---GATTGGAGAGATTCAC ATCTGAACAACAATCTGGAACTAAAAGAGAGAAACAGCAAGACCCCTACT TTCCTCTACGCAATGCCCTTTTCATCGGACAGGATATTTCTGGAAGAAAC TTCCCTCGTAGCTAGGCCTGGAGTACCCATGAAAGATATACAGGAAAGGA TGGTGGCCAGATTAAGGCACCTAGGTATAAAAGTGAAAAGCATAGAGGAA GATGAGCGTTGTGTCATTCCAATGGGGGGACCACTTCCTGTGCTCCCTCA AAGAGTAGTTGGAATTGGTGGTACAGCCGGTATGGTGCACCCTTCAACTG GGTATATGGTAGCAAGAACTCTAGCAGCTGCTCCGATTGTTGCTAATTCT ATCGTTCAGTATCTT------GGTTCT------GATAGAAGCTTTTCAGG AAGTGAGTTATCAGCTAAAGTTTGGAAAGATTTATGGCCCGTCGAGAGGA GGAGACAAAGAGAGTTCTTCTGTTTTGGTATGGATATTTTGCTTAAGCTT GATTTACCTGCCACAAGAAGATTTTTTGATGCATTTTTTGATCTGGAACC TCATTATTGGCACGGATTCCTATCATCTCGACTGTTTCTACCTGAGCTTG TACTTTTTGGGCTTTCACTGTTCTCCCATGCTTCTAATACTTCTAGGTTA GAGATTATGGCAAAGGGAACTCTTCCTTTGGTTAATATGACCAACAATTT AATACAGGACAGAGAA--- >R ---------GATACTTTATTGAGAACGCATAATAAACTTGAA---TTCTT GCCTCAACTTCATGGTTTCTCGGAAAAAGTCAGTATTTTCGAACCAAAAA AAGAGAAAATTAGCAATTCGAATTTTATAAAGTATCAGAACTCTGAGGTT AGGTTTTGTTCCAAGAAAACTTATCCAAAAAGGTGCAGAAATGGATGTGT TAAGGCTAGTAGTGGTGCCCTTTTGGAGCTAGTACCTGAAACCAAGAAGG AAAATCTTGAATTTGAGCTTCCTATGTATGACTCATCAAAAGGTGGTGTT GTTGATCTTGCTGTTGTGGGTGGTGGCCCGGCAGGCCTCGCAGTTGCCCA GCAAGTTTCAGAGGCAGGCCTTTCTGTTTGTTCAATCGACCCATCTCCTA AATTGATTTGGCCAAATAATTATGGTGTTTGGGTGGATGAATTTGAGGCC ATGGATTTGCTTGATTGTCTTGATACCACCTGGTCTGGTGCTGTTGTCTA CATT---GATGATAAATCGAAGAAGGATCTTGGTAGGCCTTATGGGAGGG TTAACAGGAAGCAGCTAAAGTCGAAAATGCTACAAAAATGTATATCCAAT GGTGTTAAGTTTCACCAAGCCAAAGTTATCAAGGTTATTCATGAGGAATC AAAATCCCTATTGATTTGTAATGATGGTGTCACAATCCAGGCTGCTGTGG TTCTTGATGCAACTGGATTTTCTAGATGCCTTGTTCAGTATGATAAGCCA TACAATCCAGGTTACCAAGTGGCTTATGGAATATTGGCTGAGGTAGAAGA TCACCCATTTGATGTAGATAAAATGCTTTTTATGGACTGGAGAGACTCAC ATTTGAAAAATAATCCGGAGCTACAAAAGAGAAATAGTAAGATCCCCACT TTTCTGTATGCA---CCCTTTTCATCAGAGAGGATATTTCTCGAAGAAAC TTCCCTAGTTGCTCGGCCTGGTGTACGTATGGAAGATATCCAGGAAAGAA TGGTAGCTAGGTTGAAGCACTTAGGAATAAAAGTGAAAAGTATTGAAGAA GATGAGCATTGCGTCATCCCAATGGGTGGCCCCCTCCCCGTCCTTCCTCA AAGAGTTGTTGGCATTGGTGGCACAGCTGGCATGGTTCACCCTTCAACTG GGTACATGGTAGCAAGAACTCTAGCGGCAGCTCCAGTTGTTGCCAATTCC ATAGTCCAGTACCTT------GGTTCC------AGTAGAAGTCTTTCAGG AACCGAATTGTCAGCAGAAGTTTGGAAAGATTTATGGCCAATAGAGAGGA GGAGACAAAGAGAGTTCTTCTGTTTTGGCATGGACATTTTGCTCAAGCTT GATTTACAAGCCACACGAAGGTTCTTCGATGCATTTTTTGATCTTGAACC  84 CCATTATTGGCACGGTTTCTTGTCATCTCGTCTATTTCTCCCCGAGCTTA TATTTTTTGGGCTGTCATTGTTTTCCCATGCTTCTAATACTTCCAGGTTA GAGATTATGGCAAAGGGAACGCTTCCTTTGGTTAACATGGTCAACAATTT AATACAAGATAGTGAA--- >O GCCACCACCGCCCTCCTCCTCCGCGCCCACCCCTCCTGCAAG-------- -CCCCCT------------------------------------------- --------CCCCCTCCCTCGCCGTCG------------------------ ---------CCGCGCCCCACGCGCGCGCTCGTCTGCCGC---------GC CGCCGCCGCCGGCGAGGCGCTGCGGTCGCTGGCCCCGCCGTCACGCCCCG AGCTGCTCTCCCTCGACCTCCCCCGCTACGACCCCGCCCGCTCCACCCCC GTCGACCTCGCCGTCGTCGGCGGCGGCCCCGCCGGCCTCGCCGTCGCGCA GCGCGTCGCGGAGGCGGGCCTCTCCGTCTGCGCCATCGACCCCTCCCCCG CCCTCGTCTGGCCCAACAACTACGGCGTCTGGGTCGACGAGTTCGACGCC ATGGGACTCTCCCACTGCCTCGACGCCGTCTGGCCCTCCGCCACCGTCTT CACCCACGACGACGGCGCCGCCAAGTCGCTCCACCGCCCCTACGCCCGCG TCGCCCGCCGCAAGCTCAAGTCCACCATG---GACCGCTGCGTCGCCCAT GGCGTCACGTTCCACAAGGCCAGGGTCGTCAAGGCCGTCCACGGCGAGGC ATCCTCCCTCCTCATCTGCGACGACGGCGTCGCCGTCCCGGCCACCGTCG TGCTCGACGCCACGGGGTTCTCCCGGTGCCTCGTCCAGTACGACAAGCCG TACGACCCGGGGTACCAGGTCGCCTATGGCATCCTCGCCGAGGTGGACGG ACACCCGTTCGACATCGACAAGATGCTGTTCATGGACTGGCGCGACGCGC ACCTCCCCGAGGGGTCCGAGATCAGGGAGCGCAACCGCCGCATCCCGACG TTCCTCTACGCCATGCCCTTCTCCCCGACGAGGATCTTCCTCGAGGAGAC CTCCCTCGTGGCGCGCCCGGGCCTCGCCATGGACGACATCCAGGAGCGC- --GCGGCGAGGCTGCGCCACCTCGGGATACGCGTCCGCGCCGTGGAGGAG GACGAGCGGTGCGTCATCCCCATGGGCGGCCCGCTCCCGGTGCTCCCGCA GCGGGTCGTCGGCATCGGCGGCACCGCCGGGATGGTGCACCCGTCCACGG GCTACATGGTGGCGCGCACCCTCGCCACTGCGCCCATCGTGGCGGACGCC ATCGTGCGCTTCCTCGACACCGGCAGC---GGCGACAGCGCGTTCGCCGG CGACGCGCTGTCGGCGGAGGTGTGGAGGGAGCTGTGGCCGGCGCAGAGGA GGAGGCAGAGGGAGTTCTTCTGCTTCGGCATGGACATCCTCCTCAAGCTC GACCTCGACGGCACGCGGCGATTCTTCGACGCCTTCTTCGACCTGGAGCC GCGCTACTGGCACGGCTTCCTGTCGTCGAGGCTCTTCTTGCCGGAGCTCG CCATGTTCGGCCTCTCCCTCTTCGCCAAGGCCTCCAACACGTCGCGCCTC GAGATCATGGCCAAGGGCACCGCCCCTCTCGCCAAGATGATCGGCAACCT CATCCAGGACAGAGATAGG >V ---------GATACTTTACTCAAGACTCATAATAAGCTTGAA---TTTCT GCACCCACTTCATGGGTTTGCGGAGAAA---------------------- --------CTGGGCAATTTGACCTTTCCAAAGCTCCAAAACCAGGAGTTT AGATTTGGTCCGAAGAAGTCCAATCTGAAATGGGGTAGAAATGGGTGTGT TAAGGCCAGTAGTAGTGCCCTTTTGGAGCTTGTTCCAGAAACTAAGAAGG AGAATCTTGAGTTTGAGCTTCCTATGTATGACCCTTCAAAGGGCCTTGTA GTCGACCTTGCAGTTGTGGGAGGTGGCCCTGCCGGGCTTGCCGTCGCGCA GCAAGTTTCAGAGGCAGGGCTTTCAGTCTGCTCGATTGACCCATCTCCCA AATTGATTTGGCCCAATAACTATGGTGTTTGGGTGGATGAGTTTGAGGCC ATGGATTTGCTTGATTGTCTTGACACTACTTGGTCTGGTGCCGTTGTTTT CATT---GATGATCACTCAAAGAAGGATCTTGGTAGGCCTTATGCAAGGG TTAACAGGAAGCAGCTGAAATCGAAAATGATGCAGAAATGCATATTAAAT GGTGTAAAGTTTCATCAAGCTAAGGTTATAAAGGTTATTCATGAGGAATC CAAATCTCTGTTGATTTGCAATGATGGGGTCACAATTCAGGCTGCTGTAG TTCTTGATGCTACGGGTTTTTCTAGATGTCTTGTTCAGTATGATAAGCCC TATAATCCAGGTTACCAAGTTGCTTATGGGATTTTGGCAGAAGTGGAAGA GCACCCATTTGATGTGGATAAG---GTTTTCATGGACTGGAGAGATTCTC ATCTGAACAACAATATGGAACTGAAAAATAGAAATAGTAGGATCCCCACT TTTCTATATGCAATGCCTTTTTCATCTAACCGGATATTTCTTGAAGAAAC TTCTCTAGTAGCTCGACCAGGAGTGCCTATGGAAGATATTCAGGAAAGGA TGGTAGCTCGGCTGAGGCACTTAGGCATAAAAGTCAAAAGCATTGAAGAG GATGAGCGTTGCATCATTCCAATGGGTGGGCCCCTCCCAGTGCTCCCTCA AAGAGTTGTTGGCATTGGTGGAACAGCTGGAATGGTCCACCCGTCGACTG GGTACATGGTAGCAAGGACTCTAGCAGCAGCTCCAATTGTTGCAAATTCT ATAGTTCAGTACCTT------GGCTCT------GACAGAAGCTTTTTTGG CAATGAATTGTCTTCTGAAGTTTGGAGAGATCTATGGCCAATCGAAAGGA GGCGTCAAAGGGAATTCTTTTGTTTTGGTATGGATATCCTTCTTAAGCTT GATTTACAAGGAACAAGAAGGTTTTTTGATGCATTCTTTGATCTAGAACC TCGTTATTGGCATGGATTCTTGTCATCTCGACTGTTTCTTCCTGAGCTCA TATTTTTTGGGCTTTCCCTGTTCTCTCATGCATCTAATACTTCTAGGATA GAGATTATGGCAAAGGGTACTCTTCCTTTGATAAACATGATCAACAACTT AATACAGGACAAGGAT---    CRT.CrtR.b.fasta >A  85 ---GCAGCAGGACTATCAACAATCGCCGTAACACTCAAACCA---CTCAA CCGCTCTTCTTTCTCCGCAAACCAC---------CCTATA---TCCACCG CAGTTTTCCCTCCATCTCTAAGATTCAACGGCTTCCGA------------ ---------CGTCGAAAGATTCTCACCGTTTGTTTCGTCGTGGAAGAACG GAAACAA------AGCTCTCCCATGGACGATGACAACAAACCAGAAAGCA CGACAAGCTCTTCTGAGATCTTGATGACGTCGCGGCTTCTCAAGAAAGCG GAGAAGAAGAAATCAGAGAGGTTCACTTATTTAATAGCAGCTGTGATGTC GAGCTTTGGTATCACTTCTATGGCTATAATGGCTGTTTATTACCGATTTT CTTGGCAAATGAAGGGA---GGTGAAGTGTCTGTGTTAGAGATGTTTGGT ACATTTGCTCTTTCCGTTGGTGCTGCCGTTGGGATGGAGTTTTGGGCAAG ATGGGCTCATAGAGCTCTTTGGCATGATTCTTTATGGAACATGCATGAGT CACATCACAAACCAAGAGAAGGAGCGTTTGAGTTAAACGATGTGTTTGCT ATAACAAACGCGGTTCCTGCGATTGGTCTACTCTATTATGGATTCTTGAA TAAAGGACTTGTTCCTGGTCTCTGCTTCGGTGCCGGACTGGGAATAACGA TGTTTGGAATGGCTTACATGTTCGTTCACGATGGACTTGTGCACAAGAGA TTCCCTGTAGGTCCCATTGCCAACGTTCCTTACCTTCGAAAGGTCGCCGC CGCTCACCAGCTACACCACACAGACAAATTCAAAGGTGTACCATATGGGC TGTTTCTTGGACCAAAGGAAGTAGAAGAAGTGGGAGGAAAAGAAGAGTTG GAGAAAGAGATAAGCCGGAGAATCAAATTATACAACAAGGGTTCTTCTAC CTCT >P ATCGCGGCAGGACTCACCGCCGCCACTGTACCCAAACCCTTCCGGTACAA CTCTGTCTCTCACCTCCTTCCAAAA---------CCAGTAACAGCAGCCT CACTTTTCTTCCCACCAATTAGACACCAAAGCTTTTTACACTATGGAACA AAAGTTCCAAGAAAAACAAGCCTTGCTGTATGTTTTGTAGTTGAAGATCA AACAAAACCGAGCAGTGCCCATATCGAGAATCAACAAGAAGAGGTGCCTA AAGATGTTAATGAAAATCAGATCTCGACACCTCGCGTGGCAGAAAGATTG GAAAGAAAGAGAAAAGAAAGAGTTACTTATTTGATTGCTGCTGTTATGTC TAGTCTTGGGATTACTTCCATGGCTGTTATGGCTGTTTATTACAGATTTT ATTGG---CTTGAGGGA---GGGGAAGTGCCCTTGTCTGAAATGTTTGGT ACATTTGCTCTTTCAGTAGGTGCTGCTGTGGGGATGGAATTTTGGGCGAG ATGGGCTCATAGAGCACTTTGGCATGCTTCTTTGTGGCATATGCATGAGT CTCACCATAGACCAAGAGATGGGCCGTTTGAGCTAAACGATGTTTTTGCC ATAACCAATGCAGTCCCAGCAATTTCCCTTCTCTCCTATGGTTTCTTCAA CAAGGGCCTTGTACCTGGTCTTTGTTTTGGTGCTGGTCTTGGAATTACAG TGTTTGGCATAGCCTATATGTTTGTCCATGATGGCCTTGTTCACAAGAGA TTCCCAGTGGGGCCCATTGCCGATGTCCCATACTTCAGAAAGGTAGCAGC AGCTCACAAGATCCACCACTCGGACAAATTCAATGGTGTCCCATATGGGT TGTTTCTAGGACCTAGGGAAATTGAGGAAGTTGGAGGCCTTGAAGAATTG GAAAGGGAGATAAGTAGGAGAACCAAATCATACAAGGAGTTG-------- ---- >R ---GCGGCTGGACTATCCGCCGCGCCAGTCTTTAAGCCTTTCCGTTATAT AAACGCCTCCTACATCCTCCCAAAG---------CCTCTG---CCCACTT CACTTGTCCCTCCTTCTACTCGATACAACAGCTTATTTCTTGGCGGTCGA ---------AGAAAAACTGGCTTCGCTATCTGTTTTGTTCTTGAAGATTT GAAACAG------AGCGTCGAAACTGAGAATCCCGTAGAGGAAGAGAATG AGAAAGTAAAC---TACCAGATCTTGACGCCACGAGTAGCTGAGAGATTG GCTAGGAAGAGATCGGAGCGGTTTACTTACTTGGTTGCGGCTGTTATGTC TAGTTTTGGGATTACTTCTATGGCTGTTATGGCTTGTTACTACAGGTTTT ATTGGCAGATGGAGGGT---GGAGAAGTTCCTTTGGCAGAAATGTTTGGT ACATTTTCTCTATCCGTAGGGGCTGCTGTGGGTATGGAGTTTTGGGCAAG ATGGGCTCATAGAGCTCTCTGGCATGCTTCCCTGTGGCATATGCACGAGT CTCACCATCGACCAAGAGAAGGTCCGTTCGAGCTAAACGATGTATTTGCA ATTACAAATGCAGTTCCAGCAATTGGCCTTCTCTACTATGGATTCTTCAA CAAAGGCCTTTTTCCTGGTCTTTGTTTTGGAGCTGGTCTTGGCATTACCG TGTTTGGGATGGCCTACATGTTTGTCCACGATGGTCTTGTTCACAAGAGA TTCCCAGTGGGTCCCATTGCCAACGTGCCCTATTTCAGAAAGGTAGCCGC TGCCCATCAGCTTCATCACTCTGAGAAATTCAATGGCGTCCCATATGGGT TGTTTCTAGGACCAAAGGAAATTGAAGAAGTTGGAGGCCTAGAAGAATTG GAAAAGGAGACAAGTAGGAGAAAAAAATCATACAATGGTAGA-------- ---- >O GCCGTCGCGAGGCTGGTGGCCGCG-------------------------- -CGGGCCCCTCTCCTCTCCCCCGCC---------GCGGTGGCGGCGGCAC ACCGATCGCCCCCGGCGCTGCTGCGGCTGGCGTTCGCGCCGCTCCCGGCG ---------CGGCGGCTGGCCGTCCCCTTGCGCGTGGCGGTGGGTGAGCC GGAGCCG------------------------------GAGGAGGATGCGC GGAGGGCG---------------------------GTGGCGGAGCGCGCG GCGCGGAAGCAGTCGGAGCGGCGGACGTACCTGGTGGCAGCGGTGATGTC CAGCCTCGGGATCACGTCCATGGCCGCCGCCGCCGTCTACTACCGCTTCG CCTGGCAAATGGAGGGCAGCGGCGAGATCCCGGTCACGGAAATGTTCGGC ACCTTCGCGCTATCGGTGGGCGCCGCGGTGGGGATGGAGTTCTGGGCGCG GTGGGCGCACCGGGCGCTGTGGCACGCGTCGCTGTGGCACATGCACGAGT CGCACCACCGCCCGCGAGACGGGCCGTTCGAGCTCAACGACGTCTTCGCC  86 ATCACCAACGCCGTCCCGGCCATGTCCCTCCTCGCCTACGGCTTCTTCAC CCGCGGCCTCGTCCCCGGCCTCTGCTTCGGCGCGGGACTCGGGATCACGC TGTTCGGGATGGCGTACATGTTCGTCCACGACGGCCTGGTCCACCGCCGC TTCCCGGTGGGGCCCATCGCCAACGTGCCCTACTTCCGGCGGGTCGCCGC CGCCCACCAGATACATCAC---GACAAGTTCGAAGGTGTGCCATATGGGC TGTTCCTTGGTCCCAAGGAGCTGGAGGAGGTGGGTGGGATTGAGGAGCTG GAGAAGGAGATCAAGAGGAGGATTAAGAGGAAAGAGACCTTAGATGCGAT CCAA >V ---GCGGTCGAAATCTCGGTTGCCACCTCCTCCCGCTCTCCCCGCTTGGG CCGGAACCCCTTTCTCGGCCCCAAACCCACCTCCCCCTTCACCCCCACTT CTCTCTTCATCCCTTCCATTCGGCGGCACGAAAACATTTTCCGGTGTCGG ---------AAGAAGACAAGACTGACGGTTTGTTTCGTGGTGGAGGAGGA GAAGCTG------AGCACAGAGGTG---------GTGGAGAATCGGAGCG AGGAGACTCTGGCGAGTCAGATCTCCGCCGCCCGGGTGGCGGAGAAGCTC GCCAGGAAGAGATCAGAGCGGCTAACGTACCTTGTTGCGGCTGTGATGTC GAGCTTTGGGATCACTTCCATGGCTGTTATGGCAGTTTACTACCGGTTTT CATGGCAAATGGAGGGC---GGGGAGGTTCCCTTGTCCGAGATGTTCGGG ACATTTGCTCTGTCGGTTGGAGCCGCTGTAGGCATGGAGTTCTGGGCGAG ATGGGCTCACAAAGCTCTCTGGCACGCCTCCTTATGGCACATGCACGAGT CCCACCATAAACCAAGAGAAGGTCCATTCGAGCTCAACGATGTTTTCGCG ATCACAAATGCAGTTCCAGCCATAGCCCTCCTCTCCTATGGCTTCTTCCA CAAAGGCCTCGTCCCTGGTCTATGTTTTGGTGCAGGCCTTGGAATTACCG TGTTTGGAATGGCCTACATGTTTGTCCACGATGGTCTCGTCCACAGGAGA TTTCCAGTGGGGCCCATTGCGAACGTGCCCTATTTCAGACGCGTAGCTGC AGCACACCAACTCCACCACTCAGACAAATTCAATGGGGTCCCATATGGGC TGTTCTTGGGCCCTAAGGAAGTGGAAGAGGTGGGAGGCAAGGATGAGTTG GAGAAAGAGATCAATCGCAGAGCCAGATTATCCAACGGTCCAAGA----- ----    CRT.PDS.fasta >A GTTGTGTTTGGGAATGTTTCTGCGGCGAATTTGCCTTATCAAAACGGGTT TTTGGAG------------------------------------------- -----------------GCACTTTCATCTGGAGGTTGTGAACTAATGGGA CATAGCTTTAGGGTTCCCACTTCTCAAGCGCTTAAGACAAGAACAAGGAG GAGGAGTACTGCTGGTCCTTTGCAGGTAGTTTGTGTGGATATTCCAAGGC CAGAGCTAGAGAACACTGTCAATTTCTTGGAAGCTGCTAGTTTATCTGCA TCCTTCCGTAGTGCTCCTCGTCCTGCTAAGCCTTTGAAAGTTGTAATTGC TGGTGCTGGATTGGCTGGATTGTCAACTGCAAAGTACCTGGCTGATGCAG GCCACAAACCTCTGTTGCTTGAAGCAAGAGATGTTCTTGGTGGAAAGATA GCTGCATGGAAGGATGAAGATGGGGACTGGTATGAGACTGGTTTACATAT TTTCTTCGGTGCTTATCCGAATGTGCAGAATTTATTTGGAGAACTTGGGA TCAATGATCGGTTGCAGTGGAAGGAACACTCCATGATTTTTGCTATGCCA AGTAAACCTGGAGAATTTAGTAGATTTGACTTCCCAGATGTCCTACCAGC ACCCTTAAATGGTATTTGGGCTATTTTGCGGAACAACGAGATG---CCAT GGCCAGAGAAAATAAAGTTTGCTATTGGACTTTTGCCAGCCATGGTCGGC GGTCAGGCTTATGTTGAGGCCCAAGATGGTTTATCAGTCAAAGAATGGAT GGAAAAGCAGGCAATACCTGAGCGCGTGACCGACGAGGTGTTTATTGCCA TGTCAAAGGCGCTAAACTTTATAAACCCTGATGAACTGTCAATGCAATGC ATTTTGATAGCTTTGAACCGGTTTCTTCAGGAAAAACGT---TCCAAGAT GGCATTCTTGGATGGTAATCCTCCGGAAAGGCTTTGTATGCCAGTAGTGG ATCATATTCGATCACTAGGTGGGGAAGTGCAACTTAATTCTAGGATAAAG AAAATTGAGCTCAATGACGATGGCACGGTTAAGAGTTTCTTACTCACTAA TGGAAGCACTGTCGAAGGAGACGCTTATGTGTTTGCCGCTCCAGTCGATA TCCTGAAGCTCCTTTTACCAGATCCCTGGAAAGAAATACCGTACTTCAAG AAATTGGATAAATTAGTTGGAGTACCAGTTATTAATGTTCATATATGGTT TGATCGAAAACTGAAGAACACATATGATCACCTACTCTTTAGCAGAAGTA ACCTTCTGAGCGTGTATGCCGACATGTCCTTAACTTGTAAGGAATATTAC GATCCTAACCGGTCAATGCTGGAGCTAGTATTTGCACCAGCAGAGGAATG GATATCACGGACTGATTCTGACATCATAGATGCAACAATGAAAGAACTTG AGAAACTCTTCCCTGATGAAATCTCAGCTGACCAAAGCAAAGCTAAAATT CTGAAGTACCATGTCGTTAAGACTCCAAGATCTGTGTACAAGACCATCCC AAACTGTGAACCATGTCGTCCTCTACAAAGATCACCTATTGAAGGATTCT ACTTAGCTGGAGATTACACAAAACAGAAGTACTTAGCTTCCATGGAAGGC GCTGTCCTCTCTGGCAAATTCTGCTCTCAGTCTATTGTTCAGGATTACGA GCTACTGGCTGCGTCTGGACCAAGAAAGTTGTCGGAGGCAACAGTATCAT CATCA--------------------------------------------- --- >P -------------------------------------------------- -------------------------------------------------- -----------------GCACTAGCTTTTAGAGGCAGTGAATCAATGGGC  87 CATTCTTTGAAATTCCCATTTGGAAATTCTTCTGCTAAAACAAGACTAAG GAATCATATCCGCCCTCCTTTGCGGGTTGTCTGTGTGGACTATCCAAGAC CGGACCTTGATAACACGGTGAATTTTTTAGAAGCTGCCTTGTTATCTTCA TCCTTTCGTTCTTCTCCGCGTCCAGCTAAACCATTAAATGTTGTCATTGC TGGTGCAGGTTTGGCGGGTTTATCGACTGCAAAATATTTGGCAGATGCAG GCCATAAGCCTATATTGCTTGAAGCAAGAGATGTTTTAGGTGGAAAGGTG GCTGCATGGAAAGAC---GATGGAGACTGGTACGAGACAGGCTTGCATAT ATTCTTTGGGGCATATCCAAATGTGCAGAATCTTTTTGGTGAACTTGGTA TCAATGATAGGTTGCAATGGAAGGAGCATTCTATGATATTTGCAATGCCA AATAAGCCAGGAGAATTCAGTCGATTTGATTTTCCTGAAGTTCTCCCTGC ACCATTAAATGGGATATTAGCCATTTTAAAGAACAATGAAATGCTGACTT GGCCAGAGAAAGTGAAGTTTGCAATTGGGCTACTGCCAGCAATTGTTGGT GGACAAGCTTATGTTGAGGCTCAAGATGGTTTAAGTGTTCAAGAGTGGAT GAGAAAGCAGGGTGTACCTGATAGAGTGACTACTGAGGTGTTTATTGCCA TGTCAAAGGCTCTAAACTTTATTAACCCAGATGAGCTTTCAATGCAATGC ATTTTGATAGCTTTGAACAGATTTCTTCAGGAGAAACATGGTTCAAAGAT GGCTTTCTTGGATGGTAATCCCCCAGAGAGGCTCTGCATGCCAATTGTTG ATCATATTCAGTTGCGTGGTGGTGAAGTCAAGCTTAATTCTCGGATAAAG AAAATTGAGCTAAATGATGATGGAACAGTGAAGAGTTTTTTACTAAATAC CGGGGATGTGATTGAAGGGGATGTTTATGTGTTTGCCACTCCAGTTGATA CCCTGAAGCTTCTTTTGCCTGATAACTGGAAAGAGATTCCTTACTTCAAG AAACTGGAGAAATTAGTTGGAGTTCCTGTTATTAATGTTCACATATGGTT TGACAGGAAACTGAAGAATACATACGATCACCTACTTTTCAGCAGGAGTC CTCTTCTCAGTGTGTATGCTGACATGTCTCTGACATGTAAGGAGTATTAT GACCCAAATAAATCTATGCTGGAGTTAGTTTTTGCCCCTGCTGAAGAATG GATTTCACGCAGTGACTCAGAGATTATTAATGCTACAATGGGGGAACTTG CAAAACTTTTTCCTGATGAAATATCCGCAGATCAAAGCAAAGCAAAAATC GTGAAGTATCATGTTGTTAAAACTCCAAGGTCGGTTTACAAGACTGTCCC AGATTGTGAACCTTGCCGTCCCTTGCAAAGATCTCCGATAGAGGGTTTCT ATTTAGCTGGTGACTACACAAAACAAAAGTACTTGGCTTCAATGGAAGGT GCTGTTCTATCAGGGAAGCTTTGTGCACAGGCAATTGTACAGGATTATGA GTTCCTGGTTGCTCGGGGGCAAGGAAGGTTGACTGAGGCAACCATTACT- -------------------------------------------------- --- >R GCTCTATATGGGGGTGTTTCTGCTTTGAATTTAAGCTGGCATAGTGATGT CTTAGACACTAGAAATCTGCAATCAGCCCTTAGATGTGGTTACGCTACCT GTTCTAATCAAACCAATGTACTAGCTTTTAGAGGCAGTGAATCTATGGGC CATGCTTTGAGA---------------AATTCTTCTAAAACAAGATTTAG GAATACTGGTAGCTGCCCTTTGAAGGTAGTTTGTGTGGACTATCCTAGAC CAGACCTTGATAACACAGTGAATTTCTTGGAAGCTGCCTACTTATCATCA TCTTTTCGATCTTCTTCCCCTCCAGATAAACCATTGAAGGTTGTAATTGC TGGTGCAGGATTGGCTGGTTTATCAACTGCAAAATATTTGGCAGATGCAG GACACAAGCCTTTATTGCTGGAAGCAAGAGATGTTCTAGGTGGAAAGGTG GCTGCATGGAAAGATGATGATGGGGACTGGTACGAGACAGGCTTGCATAT ATTCTTTGGAGCATACCCAAATGTGCAGAACCTGTTTGGAGAACTTGGTA TAAATGATAGATTGCAGTGGAAGGAGCATTCTATGATATTTGCGATGCCA AACAAGCCTGGAGAATTCAGCCGATTTGATTTCCCAGATGTTCTTCCTGC ACCATTAAATGGGATATGGGCAATTCTGAGAAACAATGAGATGCTGACAT GGCCAGAGAAAGTGAAATTTGCAATTGGACTCCTGCCAGCGATGGTTGGT GGACAGGCCTATGTTGAGGCTCAAGATGGTTTAAGTGTTCAAGAGTGGAT GAGAAAGCAGGGCGTACCTGATAGAGTGACTAAGGAGGTTTTTATTGCTA TGTCAAAGGCGCTAAACTTTATTAACCCTGATGAGCTTTCAATGCAATGT ATATTGATAGCATTGAACAGATTTCTTCAGGAGAAACATGGTTCAAAGAT GGCTTTCTTAGATGGAAATCCCCCAGAGAGACTCTGCATGCCAATTGTTG ACCATGTGCAGTCACTTGGTGGTGAAGTCCGGCTAAATTCACGAATAAAG AAAATTGAATTAAATAATGATGGAGCAGTGAAGAACTTTTTACTAAATAA TGGGGAAGTGATTGAAGGAGATGTTTATGTGGTTGCTACTCCAGTTGATA TCCTGAAGCTTCTTTTGCCTGATAACTGGAAAGAGATTCCATACTTCAAG AAGCTGGATAAATTAGTTGGAGTTCCTGTTATTAATGTTCACATATGGTT TGACAGGAAGCTGAAGAATACATATGATCACCTACTTTTCAGCAGAAGTC CCCTTCTTAGTGTTTATGCGGACATGTCTGTAACATGTAAGGAATATTAT AATCCAAATCAGTCTATGCTGGAGTTAGTTTTTGCACCTGCAGAAGAATG GGTATCACGCAGCGATGAAGAAATTATTGAGGCTACAATGATGGAACTAG CAAAACTCTTTCCTGATGAAATATCTGCAGATCAGAGCAAAGCAAAAATT GTTAAATACCATGTTGTCAAAACTCCCAGGTCTGTTTACAAGACTGTCCC AAATTGTGAACCTTGCCGACCCTTGCAAAGATCTCCTATAGAGGGCTTCT ATTTGGCTGGTGACTACACAAAACAAAAATATTTGGCTTCGATGGAGGGT GCTGTTCTATCCGGGAAGTATTGTGCACAAGCCATTGTACAGGATTATGG GTTGCTTATCGCTCGCAAGCAAAAAAAGTTGGCTGAGACTTCTGGTATGC ACATTACTGAGCTTTACTGCAGAAGGCTGAGTTCTGTTGTCTATGGACTT TAT >O ---GATACTGGCTGCCTGTCATCTATGAACATAACTGGAACCAGCCAAGC AAGATCTTTTGCGGGACAACTTCCTACTCATAGGTGC-------------  88 --TTCGCAAGTAGCAGCATCCAAGCACTGAAAAGTAGTCAGCATGTGAGC TTTGGAGTGAAATCTCTTGTCTTAAGGAATAAAGGAAAAAGATTCCGTCG GAGGCTC------GGTGCTCTACAGGTTGTTTGCCAGGACTTTCCAAGAC CTCCACTAGAAAACACAATAAACTTTTTGGAAGCTGGACAACTATCTTCA TTTTTCAGAAACAGTGAACAACCCACTAAACCATTACAGGTCGTGATTGC TGGAGCAGGATTAGCTGGTTTATCAACGGCAAAATATCTGGCAGATGCTG GTCATAAACCCATATTGCTTGAGGCAAGGGATGTTTTGGGTGGAAAGATA GCTGCTTGGAAGGATGAAGATGGAGATTGGTATGAAACTGGGCTTCATAT CTTTTTTGGAGCTTATCCCAACATACAGAACTTGTTTGGCGAGCTTGGTA TTAATGATCGGTTGCAATGGAAGGAACACTCCATGATATTTGCCATGCCA AACAAGCCAGGAGAATTCAGCCGGTTTGATTTTCCTGAAACATTGCCTGC ACCCTTAAATGGAATATGGGCCATACTAAGAAACAATGAAATGCTAACTT GGCCAGAGAAGGTGAAGTTTGCTCTTGGACTTTTGCCAGCA---GTTGGT GGCCAAGCTTATGTTGAAGCTCAAGATGGTTTTACTGTTTCTGAGTGGAT GAAAAAGCAGGGTGTTCCTGATCGAGTGAACGATGAGGTTTTCATTGCAA TGTCAAAGGCACTTAATTTCATAAATCCTGATGAGTTATCCATGCAGTGC ATTCTGATTGCTTTAAACCGATTTCTTCAGGAGAAGCATGGTTCTAAGAT GGCATTCTTGGATGGTAATCCTCCTGAAAGGTTATGCATGCCTATTGTTG ACCATGTTCGCTCTTTGGGTGGTGAGGTTCGGCTGAATTCTCGTATTCAG AAAATAGAACTTAATCCTGATGGAACAGTGAAACACTTTGCACTTACTGA TGGAACTCAAATAACTGGAGATGCTTATGTTTTTGCAACACCAGTTGATA TCTTGAAGCTTCTTGTACCTCAAGAGTGGAAAGAAATATCTTATTTCAAG AAGCTGGAGAAGTTGGTGGGAGTTCCTGTTATAAATGTTCATATATGGTT TGATAGAAAACTGAAGAACACATATGACCACCTTCTTTTCAGCAGGAGTT CACTTTTAAGTGTTTATGCGGACATGTCAGTAACTTGCAAGGAATACTAT GATCCAAACCGTTCAATGCTGGAGTTGGTCTTTGCTCCTGCAGAGGAATG GGTTGGACGGAGTGACACTGAAATCATCGAAGCAACTATGCAAGAGCTAG CCAAGCTATTTCCTGATGAAATTGCTGCTGATCAGAGTAAAGCAAAGATT CTGAAGTATCATGTTGTGAAGACACCAAGATCTGTTTACAAGACTATCCC GGACTGTGAACCTTGCCGACCTCTGCAAAGATCACCGATTGAAGGGTTCT ATCTAGCTGGTGACTACACAAAGCAGAAATATTTGGCTTCG---GAGGGT GCAGTTCTATCTGGGAAGCTTTGTGCTCAGTCTGTAGTGGAGGATTATAA ACTATCTCGTAGGAGCCTGAAAAGTCTGCAGTCTGAAGTTCCTGTTGCCT CC------------------------------------------------ --- >V ACTCAATTCAGATATGTTTCTGCGGTGAACTTGAGCTGCCAAAGTAATAT AATAAACTTTCAGAACTCCCAATGTACCTGGAGACATCTTTATATTGAT- --TCAGATCAGACCAATACACTTCTTTTTGGAGGTGGTGACTCTATGGGT CTCAAGTTGAGAATTCCAAATAAGCATTCTATTGGAACAAGGCGGAGGAA GGATTTC------TGCCCCTTGCAGGTTGTTTGCATGGATTATCCAAGAC CAGAACTTGAGAATACTGTGAATTTCTTAGAAGCTGCATACTTATCCTCA TCCTTTCATACTTCTCCTCGTCCCAGTAAACCATTAGAGGTTGTAATTGC TGGTGCAGGTTTGGCTGGTTTGTCTACTGCAAAATATTTGGCAGATGCAG GTCACAAGCCTATATTGTTGGAAGCAAGAGATGTTTTAGGTGGAAAGGTG GCTGCATGGAAAGATGAGGATGGAGACTGGTATGAGACAGGCCTACATAT ATTCTTTGGGGCTTACCCAAATGTGCAGAACCTGTTTGGAGAACTTGGTA TTAATGATCGGTTGCAGTGGAAGGAACATTCTATGATATTTGCAAAGCCA AGCAAGCCAGGGGAATTCAGCCGATTTGATTTCCCTGAAGTCCTTCCTGC ACCCTTAAATGGGATATGGGCCATCCTGAGGAATAATGAAATGCTGACTT GGCCGGAGAAAATCAAGTTTGCTATTGGACTTGTGCCAGCAATGCTCGGA GGACAGGCTTATGTTGAAGCACAGGATGGTTTAACTGTTAAAGACTGGAT GAGAAAACAAGGTATTCCTGATCGAGTAACAGATGAGGTTTTCATTGCCA TGTCCAAGGCACTGAACTTCATAAATCCGGATGAACTTTCGATGCAGTGT ATATTGATTGCTTTGAACCGATTTCTTCAGGAGAAGAATGGCTCCAAGAT GGCTTTCTTAGATGGTAATCCTCCAGAGAGACTCTGCATGCCCATTGTTG ACCATATTCAGTCACTAGGTGGTCAAGTCCAACTTAATTCACGAATACAA AAGATTGAGCTGAACAAAGACGGAACTGTGAAGAGTTTTGTGCTAAATAA TGGGAATGTAATTAAAGGAGATGCTTATGTAATTGCAACTCCAGTTGATA TCCTGAAGCTTCTTTTGCCGGGAGACTGGAAAGAGATTCCATACTTCAGG AGATTGGATAAATTAGTTGGAGTTCCAGTGATCAATGTTCATATATGGTT TGACAGGAAACTGAAGAACACATACGATCATCTTCTTTTCAGCAGAAGTC CCCTTCTGAGTGTGTATGCTGACATGTCCGTAACATGTAAGGAATATTAC AACCCAAATCAATCTATGCTGGAGTTGGTTTTTGCACCTGCTGAAGAATG GGTCTCACGCAGTGACTCAGAAATCATTGAAGCTACAATGAAGGAACTTG CCAAACTCTTTCCTGATGAAATTTCAGAAGATCAGAGCAAAGCGAAAGTT TTGAAATACCATGTTGTTAAAACACCAAGATCTGTTTACAAAACTGTCCC AAATTGTGAACCTTGCCGTCCCTTACAAAGATCTCCTATAGAGGGCTTTT ATTTAGCTGGGGACTACACAAAACAAAAATACTTAGCTTCAATGGAAGGT GCTGTTCTGTCAGGGAAGCTTTGTGCACAGGCTATTGTAAAGGACTATGA ATTGCTTGTTGCTCAGGGAGAACAAAAGTTGGCCGAGGTCAGCATTCTCA GT------------------------------------------------ ---    89  CRT.ZDS.fasta >A ---------------------GCTTCTTCAGTCGTCTTCGCGGCAACTGG GTCTCTCTCC---------------------------------------- -----------------GTTCCTCCATTGAAGTCTCGGAGA---TTCTAT GTTAATTCTTCACTCGACTCC---------GATGTTTCCGACATGAGTGT TAACGCTCCAAAGGGGTTATTTCCTCCAGAGCCTGTACCATACAAGGGAC CTAAGCTGAAAGTAGCCATTATAGGAGCTGGACTTGCAGGCATGTCGACT GCTGTAGAGCTTCTGGATCAGGGTCACGAGGTGGATATATATGATTCGAG GACATTCATTGGTGGCAAAGTGGGTTCTTTTGTAGATAGACGTGGGAACC ATATA---ATGGGATTACATGTTTTCTTCGGATGCTACAACAATCTCTTC CGTTTGATGAAAAAGGTGGGTGCTGAGAAAAACCTTCTAGTCAAAGACCA TACTCATACATTTATAAACAAAGACGGCACAATTGGAGAGCTTGATTTTC GGTTTCCTGTTGGAGCTCCAATCCATGGTATTCGCGCATTTTTGGTCACA AATCAACTCAAGCCCTATGACAAACTAAGGAATTCACTGGCTCTTGCATT AAGCCCTGTTGTTAAAGCTCTTGTCGACCCCGATGGAGCAATGAGAGACA TTCGCAACCTTGACAGCATAAGTTTCTCGGATTGGTTCCTGTCAAAAGGT GGGACACGGGCAAGTATCCAGAGAATGTGGGATCCTGTTGCTTATGCTCT AGGTTTCATAGACTGCGATAACATGAGTGCGCGATGCATGCTTACAATAT TCTCATTATTCGCTACCAAAACAGAAGCTTCTCTGTTGCGTATGCTCAAG GGCTCTCCTGATGTTTACTTGAGTGGTCCTATCAAACAATATATCACAGA TAGAGGTGGCAGAATCCATCTAAGGTGGGGTTGCAGGGAGATACTTTATG ATAAATCAGCAGATGGAGAAACTTATGTCACTGGACTAGCAATTTCTAAG GCTACGAACAAGAAGATTGTGAAAGCTGATGTATATGTTGCAGCATGTGA TGTGCCGGGAATCAAAAGGTTACTTCCAAAAGAATGGAGGGAATCTCGGT TTTTCAACGATATATATGAACTCGAGGGAGTACCTGTGGTTACAGTACAG CTCAGATACAATGGTTGGGTCACGGAGTTACAAGACATTGAACTTGCTAG GCAGTTGAAACGAGCGGTTGGCTTAGATAATCTTCTCTACACTCCTGATG CTGATTTCTCGTGCTTTGCGGATCTTGCACTAGCTTCGCCTGCAGATTAT TACATCGAAGGACAAGGCACTTTACTTCAGTGCGTTCTAACACCAGGAGA TCCGTATATGCGAATGCCAAATGATAAGATCATAGAGAAAGTAGCGATGC AGGTCACTGAGTTGTTTCCATCGTCACGAGGCCTAGAAGTCACTTGGTCG TCGGTTGTAAAAATCGCTCAGTCTCTGTACCGTGAAGCACCCGGAAAAGA TCCATTCAGACCCGATCAGAAGACGCCCATAAAGAATTTCTTCCTCGCCG GTTCATACACAAAGCAGGATTACATAGATAGTATGGAAGGAGCAACATTA TCAGGGAGACAAGCTTCGTCATACATCTGTGATGCTGGTGAAGAACTAGC AGAGCTAAACAAGAAGCTTTCTTCT---------------------TCTG CAACTGCAGTTCCTGATGAGCTAAGTCTGGTC------------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------- >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------------------------------------------AGTGT TAATGCTCCAAAGGGGTTATTTCCACCAGAACCTGCTCATTATAGGGGAC CAAAACTGAAGGTGGCTATTATTGGAGCTGGGTTGGCAGGCATGTCAACT GCAGTGGAGCTATTGGATCAAGGCCATGAGGTGGATATATACGATTCGAG GTCTTTCATTGGTGGTAAAGTGGGTTCGTTTGTTGATAGACGTGGAAACC ATATTGAAATGGGACTTCACGTTTTCTTTGGTTGCTATAATAATCTTTTC CGTTTGATGAAGAAGGTGGGCGCAGATAAAAATCTTCTTGTGAAGGATCA TACTCACACATTTGTTAACAAGGGAGGTGAAATTGGTGAGCTTGATTTTC GGTTTCTAATTGGAGCTCCGTTGCATGGGATTCGTGCATTTTTGTCGACA  90 AATCAGCTTAAGCCTTATGATAAAGCAAGAAATGCGGTTGCTCTTGCCCT GAGTCCAGTTGTAAAGGCTCTTATTGATCCA---GGAGCATTGAGGGACA TAAGGGATTTAGATAGTATCAGCTTCTCTGATTGGTTTTTGTCCAAAGGT GGCACCCGCATGAGTATCCAAAGAATGTGGGATCCTGTTGCTTATGCCCT TGGGTTTATTGACTGTGATAACATCAGTGCTAGGTGCATGCTGACCATAT TCTCATTGTTTGCCACCAAGACAGAGGCTTCTTTACTTCGCATGCTCAAG GGCTCTCCAGATGCTTACTTGAGTGGTCCCATTAGAAAGTATATCGAAGA TAAAGGAGGCAGGTTTCACTTGAGGTGGGGGTGCAGACAGATACTTTACG ATAGATCTCCTGATGGAGAAATACATGTCACAGGACTTGCCACATCGAAG GCTACGGATAAGAAAGTTGTTAAAGCTGATGCATATGTTGCAGCTTGTGA TGTCCCTGGAATTAAAAGACTACTTCCATCCCAGTGGAGGGAATCAAAGT TCTTCGATAATATTTATGAGCTAGTGGGAGTACCTGTTGTCACAGTACAG CTTAGATACAATGGCTGGGTTACAGAATTGCAGGATCTAGAACGATCAAG GCAGTTGCGGCAAGCTGCTGGCTTAGATAACCTCCTGTATACCCCAGATG CAGATTTTTCTTGTTTTGCTGACCTAGCACTCGCTTCTCCAGAGGATTAC TACATTGAAGGACAAGGTTCATTGCTTCAATGTGTTCTGACACCTGGAGA TCCTTACATGTCCTTGACAAATGATAAAATCATAGAGAGAGTCTCAAAGC AGGTCCTGGCTTTGTTCCCCTCATCCCAAGGTCTAGAAGTTATCTGGTCA TCCGTTGTAAAAATTGCGCAATCTTTATATCGTGAAGGACCTGGCAAAGA TCCTTTCAGACCTGATCAGAAGACACCTGTGAAAAATTTCTTCCTTGCTG GCTCATACACAAAACAGGATTACATAGACAGCATGGAAGGAGCGACTTTG TCCGGCAGACAAGCTTCAGCATACATTTGCGATGCTGGGGAAGAGTTAGT AGCTTTAAGGAAAAAACTTGCAGCTGTCGAATCTCAAGACTGCGCAAATT CTAACACAGTAACTGATGAGCTCAGTCTTGTA------------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------- >R ------------------ATGGCTTCATCGATTCTTCTTCCGGCCAAT-- -TCTGTTGCTGGAACTAGAAGGAGGACTCCAGGATTCTTGCTTTCTGGTG ATCGCCGCTCGTCGACGGCTCAGGTGGTGAGGACTCAGAGGTTGTTCTTT GTTCGCTCTGCTTTGGATTCCCTGGAAACAAAAGTGTCTGATATGAGTGT TAATGCTCCAAAGGGGTTGTTTCCACCTGAACCTGAGCATTATAGAGGAC CAAAACTGAAGGTGGCTATTATTGGAGCTGGGCTTGCAGGGATGTCAACT GCAGTGGAGCTATTGGATCAAGGCCATGAGGTGGACATATATGAATCAAG GACCTTTATTGGTGGTAAAGTGGGTTCATTTGTGGACAGACGTGGAAATC ACATTGAAATGGGACTTCATGTCTTCTTTGGCTGCTATAATAATCTTTTC CGTTTGATGAAGAAGGTGGGTGCAGATAAAAATCTACTTGTGAAGGAGCA TACTCACACATTTGTAAACAAGGGGGGTGATATTGGTGAGCTTGATTTTC GGTTTCCAATAGGAGCTCCCTTGCATGGGATCCAAGCATTTTTGACCACC AATCAACTTAAGACGTATGATAAAGCAAGAAATGCTGTGGCTCTTGCCTT AAGTCCAGTTGTGAAGGCCCTCATTGATCCAGATGGAGCAATGACGGACA TAAGGAATTTAGATAGTATCAGCTTCTCTGATTGGTTTTTGTCTAAAGGT GGCACACGCACAAGTATCCAAAGAATGTGGGATCCTGTTGCATATGCCCT TGGGTTCATTGACTGTGATAACATCAGTGCTCGATGTATGCTCACTATAT TCTCCTTGTTTGCCACTAAAACAGAGGCTTCGCTACTACGCATGCTTAAG GGTTCTCCGGATGTTTATTTAAGCGGTCCCATTAGAAAGTATATTGAAGA TAAAGGAGGCAGGTTTCATTTAAGGTGGGGATGCAGACAGATACTCTATG ATACGTCTGCTGATGGAGAAACATATGTTACAGGGCTTGCCATGTCAAAA TCAACTAACAAGAAAGTTGTGAAAGCTGATGCTTATGTTGCAGCATGTGA TGTCCCTGGAATCAAAAGATTACTTCCATCTCAGTGGAGGGAATCAAAGT TTTTTGATAATATTTATGAGCTAGTTGGAGTACCTGTTGTAACGGTTCAA CTTAGATATGATGGCTGGGTCACGGAGTTACAAGATCTAGAGCGATCAAG GCAATCAAGGCAAGCTGTGGGTTTAGATAACCTTCTGTACACTCCAGATG CAGATTTTTCTTGTTTTGCGGACTTAGCACTCACTTCTCCGGAAGATTAC  91 TACATTGAAGGACAAGGATCATTGCTCCAATGTGTTCTTACACCCGGTGA TCCTTACATGCCCTTGGTAAATGAAGAAATCATAAAGAGAGTATCAAAGC AGGTTTTGACTTTATTTCCGTCATCCCAAGGCTTAGAGGTTATCTGGTCA TCCGTAGTAAAAATTGGGCAATCTTTATATCGCGAAGGACCTGGCAAAGA TCCCTTCAGACCAGATCAAAAGACACCTGTGAAAAATTTCTTCCTTGCTG GTTCTTATACAAAACAGGATTACATAGACAGCATGGAGGGGGCAACTTTA TCCGGAAGACAGGCTTCAGCATATATATGTGAAGCTGGTGAAGAACTAGT TGCATTGAAGAAGAAGCTTGCTGCCGTTGAATCTCCAGAATGCCCACAGT CTGCTGCAGTCGCTGATGAGCTGAGTCTTCTAGAAAGCATTATGGGTTCT GTCATAAAGGATGGTTCTTCTTGTTTTCTGAGTTTCTGCTGTGTTTTCAT CCTTGTTCATCCTTTTTCATGTGATGCACAAGAACTGAAAGCATGTGGAT TGGATGCAATATATCAATTTGGAGATTCAATTTCAGATACAGGCAATGCT GTTCTAGAATTTTCTATCCTTCCTTATGACCAATTTCCCTACGGCATAAC AGTTAACAATGCAACTGGTAGACCTTCAGATGGACTACTTATGGTTGATT ACATTGCACAAGCAGCTGGTCTTCCATTTGTTGAACCATATGAAAACCCA AAATCCAATTTTTCCCATGGAGTAGATTTTGCAGTTGCTGGTGTAACTGT TGTGACAGCAGAAACTCTAGTTAAATGGCATATCCCACCTTTTGTCACTA ACCATTCTCTAACATTGCAACTTGGGTGGTTTGAGAAGCACTTGTCAACT ATCTGCAGTGATCCTAAAGCCTGCCAAGAGAAACTGAAGTCAGCCCTCTT TATGGTTGGGACAATGGGATCTAATGATTATTTCCTTGCATTGAGTCGAA ATAAAACCCTTGAGGAGATCAAGAACACCATGGTGCCTGTAGTGGTGCAG ACCATAACGGAAGTTGCCAAAAAACTTATCGGCCATGGTGCTGTTCGAGT GGTTGTCCCTGGACTTCATCAATTGGGTTGTTCACCAGGCATACTTACAG CATTTGAGACCAATACATCTGTTCATGATGCACAAGGCTGCCTGAAAGAT TTCAACGACATGTTTGTGTATCACAATGATCATCTGAAAACAGCTCTTGA AGGATTGAGAAAAGAATTTCCTAACGTGCATGTCGTATATGCTGATAACT ACAGTGCACTGCAATATATCATAGACAATTTGTCAAAGCTTGGATTTAAA GCATTACGAGAAGCCTGTTGTGGAACCGGAGGAAAATACAATTACAGTGT TGATCAATTAAAGTTTGCCTGTGGACTTCCTGGCATACCATATTGTTCAA ACCCTAGAGAACATGTCTTTTGGGATGGAGGACATTTTTCTCATCAAACA AACAAGTTCTTATCAGATTGGCTACTTAGAGACATGTTACCAAAGCTTCA ATGCGCAGCT >O GCCATGGCTGCCACGTCCCGCGCGCCGTCCACGCTGGCCCCGGCGTCGTT CTCCGCCGCCGGC---------------------------------GGCA GCAGGAGGCGGCGCCGGTGCCCGAATCCCAGGGTGCGGGTGGGGGTGGGG GTGCGGTGCTCGCTCGACAGC---------AACGTCTCCGACATGGCCGT CAACGCTCCGAAAGGATTGTTCCCGCCGGAGCCGGAGCACTACAGGGGGC CGAAGCTGAAGGTGGCCATCATAGGGGCCGGCCTCGCCGGCATGTCCACC GCGGTGGAGCTCTTGGACCAGGGCCATGAGGTTGATCTGTACGAGTCCCG GCCGTTTATCGGCGGCAAAGTCGGTTCTTTTGTGGATAGGAAAGGGAACC ATATCGAGATGGGGCTGCACGTGTTCTTCGGGTGTTACAGCAATCTTTTC CGCCTTATGAAGAAGGTTGGAGCTGATAATAATCTGCTAGTGAAGGAGCA TACCCATACATTTGTAAATAAAGGAGGCACGATTGGTGAACTTGATTTTC GGTTTCCTGTGGGAGCTCCGTTACATGGTATCCAAGCATTCCTACGAACT AACCAACTCAAGGTTTATGATAAAGCAAGAAATGCCGTTGCTCTTGCTCT AAGCCCAGTTGTTCGAGCTCTTGTTGATCCAGATGGTGCATTGCAGCAAG TACGGGATTTGGATGATGTAAGTTTCAGCGATTGGTTCTTGTCGAAAGGT GGTACTCGAGAGAGCATCACAAGGATGTGGGATCCTGTTGCCTATGCTCT TGGTTTCATTGACTGTGATAATATCAGTGCACGTTGCATGCTTACCATTT TCACTCTGTTTGCCACAAAAACAGAGGCATCTTTATTACGCATGCTAAAG GGTTCACCTGATGTTTATCTGAGTGGTCCAATAAAGAAGTACATAACAGA CAGGGGTGGTAGGTTTCACCTGAGGTGGGGATGTAGGGAGGTTCTCTATG ATAAGTCACCTGATGGGGAAACCTATGTTAAAGGCCTTCTCCTATCCAAG GCTACAAGTAGAGAGATAATCAAAGCAGATGCATATGTCGCAGCTTGTGA TGTCCCGGGGATCAAAAGACTTTTACCTTCTGAATGGAGGCAATGGGATA CATTTGACAACATCTACAAGTTAGATGGTGTTCCTGTAGTCACAGTACAG CTTCGTTATAATGGATGGGTTACAGAACTTCAAGATTTGGAGAAATCAAG ACAACTGAAAAAGGCAGTTGGCTTGGATAATCTTCTCTACACTCCAGATG CAGATTTTTCATGTTTTTCAGACCTTGCACTTTCATCTCCTGCTGACTAC TACATTGAAGGACAAGGTTCCTTGATCCAAGCTGTGCTAACCCCTGGCGA TCCTTACATGCCATTGCCGAATGAGGAGATAATTAGCAAGGTTCAAAAGC AGGTCTTAGAATTGTTCCCGTCATCACAAGGCTTGGAACTTACATGGTCG AGTGTGGTGAAAATCGGTCAATCATTGTACCGCGAGTCACCAGGAAATGA TCCATTTAGACCTGATCAAAAGACACCAGTTAAAAACTTCTTCCTGTCTG GCTCTTACACAAAACAGGACTACATTGACAGCATGGAAGGGGCAACTCTC TCAGGCAGGAGAACCGCGGCCTACATCTGTGGTGCAGGAGAGGAGCTGCT CGCCCTCCGAAAGAAGCTCATTGTCGACGACAGCGAG---------AAGG CCAGGGGTAAGGTCGAGGCCCTTCAGACAAGC------------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------------------------------------  92 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------- >V ---------------------TCTTCTTCTATTCTTTTTCCTGCTGCTGG AAGCAGGGCTGGGTTCCGGGGCGACACTGTCGGGCTCTTTTTGTCCGGTG GCCGGCGTCCG------ATGCCGTCTCAGTTGAAGGGTCAGAGGCTTTTT GTTCGGTCTTCTTTGGACTCA---------GACGTGTCTGACATGAGCGT TAATGCTCCAAAAGGGTTGTTTCCACCAGAACCTGAACACTATAGGGGAC CAAAGCTCAAGGTGGCTATCATTGGAGCTGGGCTTGCAGGCATGTCAACT GCAGTGGAGCTTTTGGATCAAGGCCACGAGGTAGATATATATGAGTCAAG GTCTTTCATTGGTGGAAAAGTGGGCTCTTTTGTTGATAGACGTGGAAATC ACATTGAAATGGGACTGCACGTGTTCTTTGGTTGCTACAACAATCTCTTT CGTTTGATGAAAAAGGTGGGTGCAGATAAAAATTTACTTGTGAAGGATCA TACTCACACGTTCGTAAACAAAGGGGGTCAAATTGGTGAGCTTGATTTTC GGTTTCCAGTTGGTGCACCATTACATGGAATTCGTGCATTTTTGGCTACA AATCAGCTTGAGACTTATGATAAGGCAAGAAATGCTTTGGCTCTTGCCCT TAGTCCAGTTGTTCGGGCTCTTATTGATCCAGATGGAGCAATGAGGGACA TACGAAATTTGGATAGTATAAGCTTCTCTGATTGGTTCCTGTCCAAAGGT GGGACACGCATGAGCATCCAGAGAATGTGGGATCCTGTTGCTTATGCCCT CGGGTTTATTGACTGTGATAATATCAGTGCTCGTTGTATGCTCACTATAT TCTCATTGTTTGCCACTAAGACAGAAGCTTCCCTACTGCGCATGCTTAAA GGTTCTCCAGATGTATACTTGAGTGGCCCCATCAGACAGTATATCACAGA TAAAGGGGGCAGGTTCCATCTTAGGTGGGGATGCAGAAAAGTACTTTATG ATAGATCTGCAGATGGAGAAACATATGTCACTGGACTTGCAATGTCTAGG GCTACTAATAAGAAGATTGTGAGAGCAGATGCTTATGTTGCAGCTTGTGA TGTTCCTGGAATCAAAAGATTAGTTCCGGCACAATGGAGGGACTGGGAAT TTTTTGATAATATTTATAAACTAGTTGGGGTGCCAGTTGTCACAGTGCAA CTTAGATACAATGGCTGGGTCACAGAGTTACAGGATCTAGAACGGTCAAG GCAATTGAGAAAAGCTGCAGGGTTGGATAATCTCCTTTACACCCCAGACG CAGACTTCTCTTGCTTTGCCGATCTAGCACTTTCATCTCCAGAAGATTAC TACATTGAGGGACAAGGTTCATTGCTCCAATGTGTGCTTACACCGGGTGA TCCCTACATGCCTTTACCAAATGCTGAAATCATAAACAGAGTTGCAAAGC AGGTTTTGGTTTTATTCCCATCCTCCCAAGGTTTAGAAGTTACTTGGTCA TCTGTTGTCAAAATCGGCCAATCCCTATATCGTGAGGGACCTGGTAAAGA TCCATTTAGACCAGATCAAAAGACACCGGTTAAGAATTTCTTCCTTGCTG GCTCATACACAAAACAGGATTACATTGACAGTATGGAAGGAGCAACCCTG TCAGGCAGGCAAACTTCAGCCTATATTTGCGACGCGGGGGAAGAATTAGC AGCACTGCAGAAAAAGCTTGGTGCCTTGGATTCTCAAGAGTTCACGAATG CTGCTAATACCACAGATGAGTTGAGTCTTGTC------------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------------------------------------  93 -------------------------------------------------- ----------    GA.1.14.11.12.fasta >A ---GCAACGGAATGCATTGCAACGGTCCCTCAAATATTCAGT-------- -------------------GAAAACAAAACCAAAGAGGATTCTTCGATCT TCGATGCAAAGCTCCTTAATCAGCACTCGCACCACATACCTCAACAGTTC GTATGGCCCGACCACGAGAAACCTTCT---ACGGATGTTCAACCTCTCCA AGTCCCACTCATAGACCTAGCCGGTTTCCTCTCCGGCGACTCGTGCTTGG CATCGGAGGCTACTAGACTCGTCTCAAAGGCTGCAACGAAACATGGCTTC TTCCTAATCACTAACCATGGTGTCGATGAGAGCCTCTTGTCTCGTGCCTA TCTGCATATGGACTCTTTCTTTAAGGCCCCGGCTTGTGAGAAGCAGAAGG CTCAGAGGAAGTGGGGTGAGAGCTCCGGTTACGCTAGTAGTTTCGTCGGG AGATTCTCCTCAAAGCTCCCGTGGAAGGAGACTCTGTCGTTTAAGTTCTC TCCCGAG---GAGAAGATCCATTCCCAAACCGTTAAAGACTTTGTTTCTA AGAAAATGGGCGATGGATACGAA---GATTTCGGGAAGGTTTATCAAGAA TACGCGGAGGCCATGAACACTCTCTCACTAAAGATCATGGAGCTTCTTGG AATGAGTCTTGGGGTC------GAGAGGAGATAT---TTTAAAGAGTTTT TCGAAGACAGCGATTCAATATTCCGGTTGAATTACTACCCGCAGTGCAAG CAACCGGAGCTTGCACTAGGGACAGGACCCCACTGCGACCCAACATCTCT AACCATACTTCATCAAGACCAAGTTGGCGGTCTGCAAGTTTTCGTGGACA ACAAATGGCAATCCATTCCTCCTAACCCTCACGCTTTCGTGGTGAACATA GGCGACACCTTCATGGCTCTAACGAGA---AGATACAAGAGTTGTTTGCA TCGGGCGGTGGTGAACAGCGAGAGAGAAAGGAAGACGTTTGCATTCTTCC TATGTCCGAAAGGGGAAAAAGTGGTGAAGCCACCAGAAGAACTAGTAAAC GGAGTGAAGTCTGGTGAAAGAAAGTATCCTGATTTTACGTGGTCTATGTT TCTTGAGTTCACACAGAAGCATTATAGGGCAGACATGAACACTCTTGACG AGTTCTCAATTTGGCTTAAGAACAGAAGAAGTTTC--------------- --- >P ATGGCAATAGATTGCATCAAAACCATGCCATCCATAACCACCCCTCATCA CCACCCAAAAGATCAGGATCAATGCAAAGATGATGGCAAGTCTTTTGTTT TTGATGCACAAGTTCTT---CGACACCAGACAAACATACCCCAGCAGTTC ATTTGGCCTGAC---CAAAAGCCTAAT---ATTAATGCACCTGAACTCCA AGTCCCACTTGTAGACTTGGGTGATTTCCTCTCTGGTAACCCTGTTGCTG CAGTGGAAGCTTCAAGACTTGTTGGTGAAGCATGTCAAAAACATGGTTTC TTTCTAGTTGTTAATCATGGAGTTGATAAAACGCTCATTGCCCATGCTCA TAATTACATGGACACCTTCTTCGAATTGCCACTTTCTGAGAAACAAAAGG CCCAAAGAAAGATTGGCGAGTCTTGTGGATATGCTAGCAGCTTTACTGGC AGGTTTTCCTCTAAACTTCCATGGAAAGAAACGCTTTCTTTTCGCTACAC AGCT------GAGAAGAATTCATCAAAACACATCGAGGAATACTTTCATA ACAGAATGGGGGAAGATTTCGCT---GAATTCGGGAGTGTGTATCAGGAC TACTGTGAGGCCATGAGCACTTTGTCACTAGGGATCATGGAGCTATTAGG CATGAGCCTTGGTGTG------AGCAGAGAACAT---TTCAGGGAATTCT TTGATGAGAATGATTCAATAATGAGGCTCAACTACTACCCTCCATGCCAA AAACCTGACCTTACTTTAGGCACCGGTCCTCATTGTGATCCAACTTCTTT GACCATCCTTCATCAAGACCAAGTGGGTGGTCTTCAAGTGTTTGTGGACA ACGAATGGCGTTCGATTAGCCCCAATTTTGACGCTTTTGTTGTTAACATT GGTGACACCTTCATGGCTCTATCGAATGGTATATACAAGAGCTGTTTGCA CCGAGCAGTGGTGAACAGCCAAACACCAAGAAAATCCCTCGCTTTCTTTT TGTGTCCAAAGAATGACAAGATGGTAACTCCACCACATGAATTAGTGGAC ------ACATGCAATCCGAGAATATATCCAGATTTCACATGGCCTATGTT GCTCGAATTCACACAAAAGCATTACCGAGCTGACATGAAGACACTTGAGG TGTTCACAAACTGGCTTCATCAACAAAGTTTTAGC--------------- --- >R ---GCAATAGAGTGCATCAAAGCCGTGCCATCGTCAGTCCAT-------- -------CAAAAGGAAGAACGTAGCAAAGAAGAGCAGAAATCATTAGTTT TTGATGCCAAATTTTTA---AGATACCAATCAAACATTCCCCAACAATTT GTATGGCCGGATGATGAAAAGCCAATC---GTCAATGCACCAGAACTGGC TGTTCCGCTAATCGACTTAGGTGGGTTCTTGTCTGGTGACCCTGTTTCTG CAACGGAAGCTTCAAAGCTAGTTGGCGAGGCATGTCAAAAGCACGGTTTC TTCCTTGTTGTTAACCACGGTGTTGATCAAAAGCTCATAGCTGATGCGCA CCGTTACATGGACAACTTCTTTGAATTGCCACTCTCCGATAAGCAGAAAG CTCAGAGGAAAGTTGGTGAGCACTGTGGTTATGCTAGTAGCTTTACTGGC AGGTTCTCCACTAAACTTCCTTGGAAAGAAACACTTTCTTTTCGCTATTC TGCC------CAGCAGAACTCACCAAAACTTGTGCAAGACTATTTTCATA ACACAATGGGTGAATCTTTTTTG---GAATTCGGGAAGGTCTACCAGCAG TACTGCGAGGCTATGAGCACTCTTTCATTAGGAATCATGGAACTTTTGGG AATGAGCTTGGGAGTA------AGCAAAGCCCAC---TTCAGGGAATTTT TTGAAGAAAACGATTCAATAATGAGGCTGAACTATTATCCACCGTGTCAA AAACCTGACCTTACTTTAGGAACTGGACCTCATTGCGATCCCACATCATT  94 AACCATCCTTCACCAAGATCAAGTTGGTGGTCTTCAAGTGTATGTAGACA ATGAATGGCGTTCAATCAGCCCCAATTTTCAAGCCTTCGTCGTCAACATT GGAGATACTTTCATGGCACTTTCAAATGGCAAATATAAGAGTTGCTTGCA TAGAGCAGTAGTGAACAGCGAGACAACAAGAAAATCATTGGCTTTCTTTC TATGTCCAAAGAGTGACAAGATGATAACACCACCAACGAAGCTAGTGGAC ------AATTCGAACCCAAGAATATATCCAGATTTTACATGGTCAATGCT TCTTGAATTTACACAGAAGCATTACAGAGCAGACATGAAGACTCTTGAGA TGTTTTCAAATTGGGTTCAACAGAGAAAG--------------------- --- >O ---AGCATGGTGGTG----------------------------------- ----------------------------CAGCAGGAGCAGGAGGTGGTGT TCGACGCGGCGGTGCTG---AGCGGGCAGACGGAGATCCCGTCGCAGTTC ATATGGCCGGCGGAGGAGAGCCCCGGGTCGGTGGCGGTGGAGGAGCTGGA GGTGGCGCTGATCGACGTG---------------GGGGCGGGGGCGGAGA GGTCGTCGGTGGTCCGGCAGGTGGGGGAGGCGTGCGAGAGGCACGGCTTC TTCCTGGTGGTTAACCACGGCATCGAGGCGGCGCTGCTGGAGGAGGCGCA CCGGTGCATGGACGCCTTCTTCACGCTGCCGCTGGGGGAGAAGCAGCGGG CGCAGCGGCGCGCGGGGGAGAGCTGCGGCTACGCCAGCAGCTTCACGGGG CGCTTCGCGTCCAAGCTGCCGTGGAAGGAGACGCTGTCGTTCCGGTACTC ATCGGCTGGAGATGAAGAGGGCGAGGAGGGCGTGGGTGAGTACCTGGTGC GGAAGCTCGGGGCGGAGCACGGGCGGCGGCTGGGCGAGGTGTACTCGCGC TACTGCCACGAGATGAGCCGCCTGTCGCTGGAGCTGATGGAGGTGCTCGG GGAGAGCCTGGGCATCGTCGGAGACCGGCGCCACTACTTCCGGCGATTCT TCCAGCGCAACGACTCCATCATGCGCCTCAACTACTACCCGGCGTGCCAG AGGCCACTCGACACGCTGGGCACCGGTCCGCACTGCGACCCCACCTCGCT CACCATCCTCCACCAGGACCACGTCGGCGGCCTGGAGGTGTGGGCGGAGG GGCGGTGGCGCGCCATCCGCCCTCGCCCCGGGGCGCTCGTCGTCAACGTC GGCGACACCTTCATGGCGCTCTCCAACGCCAGGTACCGCAGCTGCCTGCA CCGGGCGGTCGTCAACAGCACGGCGCCTCGCCGCTCGCTGGCCTTCTTCC TCTGCCCGGAGATGGACACGGTGGTGCGCCCGCCGGAGGAGCTGGTCGAC ------GACCACCACCCGAGGGTGTACCCGGACTTCACGTGGCGGGCGCT GCTGGACTTCACGCAGCGCCACTACAGGGCCGACATGCGCACGCTTCAGG CCTTCTCCGACTGGCTTAATCATCATCGTCACCTGCAACCAACAATATAC TCC >V ---TCTATAGTTTGTGTCGAAGGTAACCCACCATCCATGTTT-------- -------AATCCGCCTACAGACGACCACAAAAACCAGGAACCACTAGTGT TTGATGCCTCGGTTCTT---CGGCACCAATCCAACATTCCCAAGCAGTTC ATATGGCCGGATGCAGAAAAGCCAGGG---GACAAGGCCACAGAGCTGTC TGTTCCACTCATAGACTTGGGAGGCTTCCTCTCTGGAGACCCTGCTGCAG CCATGGAAGCAACTAGGCTTGTGAGGGAGGCATGCCAGAAGCATGGCTTC TTCCTTGTTGTTAACCATGGGGTTGATGATAAACTCATATACAAAGCTCA CCAGTACATGGACAGCTTCTTTGGGTTGCCTTTGGCCAAGAAGCAAAGGG CTCAGAGGAAGCTGGGTGAGCACTGTGGATATGCCAGCAGCTTCATTGGC AGGTTCTCTTCCAAGCTGCCATGGAAAGAGACCCTTTCTTTCAGCTATTC AGCT------GAGAAGAAGTCATCCAATGCTGTGCAGGAGTATTTCCTCA ACAAAATGGGTGAAGATTTCAGT---GAATTCGGGCAAGTGTACCAGGAC TACTGTGAGGCCATGAGCACGCTTTCCCTTGTGATCATGGAGCTGCTGGG GATGAGCCTGGGTATA------GGCGGAGCCCAT---TTCAGGGAATTTT TCGAGGAAAACGATTCGATAATGAGACTCAACTACTACCCCCCATGCCTA AAACCCGACCTCACTTTAGGAACAGGGCCTCATTGTGATCCAACATCTTT AACCATCCTTCATCAGGACCAAGTGGGTGGCCTTCAAGTGTTTGTAGATG ACAAATGGTGGTCCATTAGCCCAAATTTCGATGCCTTTGTTGTTAACATC GGCGACACCTTCATGGCTCTTTCAAATGGAAGGTACAAGAGCTGCTTACA TAGGGCAGTGGTAAACAGCCAAACTCCAAGAAAATCTCTTGCTTTCTTTT TGTGTCCAGAGAAAGATAAGGTGGTGAGGCCACCAACTGAACTGGTGGAC ------ACCAACAGCCCTAGAATATATCCGGATTTCACTTGGTCCAATCT CCTCGAATTCACCCAGAAGCATTACAGGGCTGACATGAAAACACTTGAGG TTTTCTCTAGCTGGCTTCAACAGAAAACAGCTGAAGCGGTG--------- ---    GA.1.14.11.13.fasta >A GTAATTGTGTTACAGCCAGCCAGTTTTGATAGCAACCTCTATGTTAATCC AAAATGCAAACCGCGTCCGGTTTTA---------ATCCCTGTTATAGACT TAACCGACTCAGATGCCAAAACCCAAATCGTCAAGGCATGTGAAGAGTTT GGGTTCTTCAAAGTCATCAACCATGGGGTCCGACCCGATCTTTTGACTCA GTTGGAGCAAGAAGCCATCAACTTCTTTGCTTTGCATCACTCTCTCAAAG ACAAAGCGGGTCCACCTGACCCGTTTGGTTACGGTACTAAAAGGATTGGA CCCAATGGTGACCTTGGCTGGCTG---TACATTCTCCTTAATGCTAATCT TTGCCTTGAGTCTCACAAAACCACCGCCATTTTCCGGCACACCCCTGCAA TTTTCAGAGAGGCAGTGGAAGAGTACATTAAAGAGATGAAGAGAATGTCG  95 AGCAAATTTCTGGAAATGGTAGAGGAAGAGCTAAAGATAGAGCCAAAGGA GAAGCTGAGCCGTTTGGTGAAAGTGAAAGAAAGTGATTCGTGCCTGAGAA TGAACCATTACCCGGAGAAGGAAGAG---------ACTCCGGTCAAGGAA GAG------ATTGGGTTCGGTGAGCACACTGATCCACAGTTGATATCACT GCTCAGATCAAACGACACAGAGGGTTTGCAAATCTGTGTCAAAGATGGAA CATGGGTTGATGTTACACCTGATCACTCCTCTTTCTTCGTTCTTGTCGGA GATACTCTTCAGGTGATGACAAACGGAAGATTCAAGAGTGTGAAACATAG AGTGGTGACAAATACAAAGAGGTCAAGGATATCGATGATCTACTTCGCAG GTCCTCCTTTGAGCGAGAAGATTGCACCATTATCATGCCTTGTGCCAAAG CAAGATGATTGCCTTTATAATGAGTTTACTTGGTCTCAATACAAGTTATC TGCTTACAAAACTAAGCTTGGTGACTATAGGCTTGGTCTCTTTGAGAAAC GACCTCCATTTTCTCTATCCAATGTT >P ---GTAGTACTTTCCCAACTAGCTCTAGAA---CCTTTCTCAGTTATCAA AACATGCAAGCCTATA---GGCTTGTTTTCCGAGATACCCGTTATAGACT TGACAGACCCTCATGCCAAGACTCTCATAATCAAGGCCTGTGAAGAGTTT GGATTCTTCAAGCTGGTAAATCATGGAGTTCCAATGGAAGTCATGACCAA ATTGGAAGCTCTTGCTACCAACTTCTTTAACCTCCCCCAGCCTGAGAAAG ACAAGGCTGGACCTCCTAACCCTTTTGGCTACGGAAACAAGAAAATTGGC CCTAATGGTGATGTTGGTTGGGTTGAATATCTCCTCCTTAACACCAACCC TCAAATCTCCTCCCAAAAA---ACGTCCATTTTTCAGGAAAACCCACAGA TTTTCCGCTCTGCTGTTGAAGATTACATACTGGCAGTGAAGAGAATGGCT TTTGAAGTATTGGAATTGATGGCTGATGGGCTGGAGATTGAGTCAAGG-- -ATGTTCAGTAGGCTGTTGAGGGATGATAAGAGTGATTCATGTTTCAGGC TAAACCACTACCCACCATGCTCAGAG------CTGCAAGCATTGAGTGGT GGAAATTTGATTGGGTTTGGCGAGCACACAGACCCACAGATAATATCTGT TCTAAGATCTAACAACACAAGTGGCCTGCAAATTTGTCTGAAAGAGGGAA CTTGGGTTTCAGTCCCCCCTGATCAGACCTCTTTTTTCATCAATGTTGGT GATGCCTTGCAGGTGATGACAAATGGAAGGTTG---AGTGTCAAGCACAG GGTTTTGGCTGATCCCCTGAAACCAAGGATTTCCATGATTTTCTTCGGTG GTCCACCTTTAAGTGAAAAGATAGCACCTTTACCCTCCTTGATGGCAGAA AGAGGAGGAAGCTTATACAAGGAGTTCACATGGTTTGAATACAAAAGGTC CGCATACAAGTCAAGGCTAGCTGATTACAGACTTGGGCTATTGAAAACTG CAGGCCAA------------------ >R ---GTGGTTCTTTCACAAACAGCATTAGAC---CATTTCTCTTTAATCAA AACATGCAAACCATCTTCAGGTTTGTTTAATGGGATTCCAGTGATAGACT TGACAGACCCTGAAGCCAAAAACCTCTTAGTTCAAGCTTGTCAGGAATTT GGCTTCTTTAAATTAGTCAATCATGGTGTCCCTATTGATTTCATGACTCG ATTAGAGTCTCTTGCTATCAACTTTTTTAACCTTCCTCAATCTGAGAAAG ATAAAGCTGGTCCTCCTGACCCTTTTGGTTATGGCAATAAAAGAATTGGC CCTAATGGTGATATCGGTTGGATTGAGTATCTTCTCCTCAATACCAATCC TCAAATTACTTCTCAAACTACCCTCTCCATTTTCAAAGAAAACCCACAAA TTTTCAGGTCTGCTGTGGAAGATTACATATTGGCAGTGAAGAAAATGGCT TATGAAGTACTGGAACTGATGGCTGATGGATTGGGGATAAAGCCAAGGAA TGTATTGAGTAGGATGTTAAAGGATGATAAGAGTGATTCATGTTTCAGGC TAAATTACTATCCACCATGTCCAGAGCTTCAACTGCAACCATTAAGCGGT AGAAATCTGGTTGGGTTTGGGGAGCATACAGACCCACAGATAATTTCTGT CTTAAGATCTAACAACACAACTGGCCTGCAAATCTGTCTGAGAGATGGGA CTTGGGTTTCAGTCCCACCTGATCAGACCTCCTTTTTCATCAATGTTGGT GATGCCTTACAGGTAATGACAAACGGAAGGTTTAAAAGTGTGAAGCATAG AGTTTTGGCTGACACAATGAGATCAAGGATTTCAATGATATATTTTGGCG GTCCACCTTTGAGTGAAAAGATTGCACCTTTACCTTCTGTGTTGAGAGAA GGCGAAGAAAGCTTATATGAACAGTTCACATGGTGTGAATACAAGAGGTC AGCTTACAAGTCCAGG---------------------------------- -------------------------- >O GTGGTTCTCGCTGGCCCGCCCGCCGTCGAT---CACATCCCGCTGCTGAG GTCGCCGGACCCCGGC---GACGTCTTCTCCGGCGTGCCGGTCGTCGACC TCGGCAGCCCCGGCGCGGCGAGGGCCGTGGTGGACGCCTGCGAGCGGTAC GGGTTCTTCAAGGTCGTCAACCACGGCGTGGCCACGGACACGATGGACAA GGCCGAGTCGGAGGCCGTCAGGTTCTTCTCCCAGACGCAGCCCGACAAGG ACCGCTCCGGCCCGGCCTACCCGTTCGGGTACGGCAGCAAGCGGATCGGG TTCAATGGCGACATGGGGTGGCTCGAGTACCTCCTCCTCGCCCTCGACGA CGCGTCGCTCGCCGACGCCTGCACCGTC---------CCGTCCTGCGCGG TCTTCCGGGCCGCTCTGAACGAGTACATCTCGGGGGTGCGGAAGGTGGCG GTGCGGGTGATGGAGGCGATGTCGGAGGGGCTGGGCATTGCGCAGGCGGA CGCGCTGAGCGCGCTGGTGACGGCGGAAGGGAGCGACCAGGTGTTCCGCG TGAACCACTACCCGCCGTGCCGCGCG------CTGCAGGGGCTC---GGC TGCAGCGTCACCGGCTTCGGCGAGCACACCGACCCGCAGCTCGTCTCCGT GCTCCGCTCAAACGGCACGTCCGGCCTGCAGATCGCGCTCCGCGACGGCC AGTGGGTGTCCGTGCCCTCCGACCGCGACTCCTTCTTCGTCAACGTCGGC GACTCGTTGCAGGTTCTGACCAATGGGAGGTTCAAGAGCGTGAAGCACAG GGTGGTGGCCAACAGCCTAAAGTCTAGGGTTTCCTTCATCTACTTTGGAG GGCCACCGTTAGCACAGAGGATTGCACCATTGCCACAGCTGCTGGGGGAG  96 GGAGAGCAGAGCCTGTACAAGGAGTTCACATGGGATGAGTACAAGAAGGC TGCCTACAAATCAAGGCTTGGAGACAACAGGCTGGCCCAGTTTGAGAAGA AG------------------------ >V ---GTTGTGTTATCGCAGAATGGTCGTCAG---CAGTTGCCTCTGATCAA GGCATGCAAGCCCAATTATGGC---TTCACTGGAATTCCTGTGATTGACA TGACAAGCCCTCACGCCAAGGCTCAC---GTTGAGGCCTGTGAGGAGTTT GGATTCTTCAAGCTGGTCAATCATGGAGTTCCAATGGAGTTCATGTCCAG ATTGGAGGATGAGGGTATCAAGTTCTTTAGCCTGCCTCAGTCTGAGAAGG ACCTGGCTGGTCCTCCTCAGCCTTTTGGGTATGGCAACAGGAGAATTGGC CCCAACGGTGATGTAGGGTGGATTGAGTATCTCCTCCTCTCCACCAATCC GGATTCCATTTCCCAGATATGCTCCTCCATTTCCCCGGAAAACCCTGAAA TTTTCGGGTCTGCAGTGGTTGATTATGTGTCATCCGTGAAGAACATGACA TATGAAGTGCTGGAAATGATAGCTGAAGGGCTGAACATAGAACCAAGGAA TGTGCTGAGCAGGCTTCTCAAGGACGAGGAGAGCGACTCCTGCTTCAGGG TCAACCACTATCCACCATGCCCAGAG------CTTGAAGCATTGCGCGGC CGAGTTTTGGTTGGATTCGGAGAGCACACAGACCCACAGATAATATCTGT GCTCAGGTCCAACAACACCAATGGCCTGGAAATATGTCTCAAGGATGGGA CTTGGGTCTCAGTCCCACCTGACCAGGACTCCTTTTTCATCAATGTTGGT GACTCTCTTCAGGTGATGACCAACGGGAAGTTTAAGAGCGTGAAGCATAG AGTTGTGACAGAGAGCAGGAAGGCCAGAGTGTCAATGATCTACTTTGGAG GGCCACCTTTAACTGAAATCATAGCACCTTTACCCTCACTGGTGAAAGAA GGAGAAGAAACTCTGTACAAGGAGTTCACATGGGCTGACTACAAAAAATC TGTTTATAAATCAAGGCTGGCTGATAACAGGCTTGGGCTCTTTGAGAAAA AAGAGCAGCCA---------------    GA.1.14.11.15.fasta >A ---CCTGCTATG---TTAACAGATGTGTTTAGAGGCCATCCCATTCACCT CCCACACTCTCACATACCTGACTTCACATCTCTCCGGGAGCTCCCGGATT CTTACAAGTGGACCCCTAAAGACGATCTCCTC------TTCTCCGCTGCT CCTTCTCCTCCGGCCACCGGTGAAAACATCCCTCTCATCGACCTCGACCA CCCGGACGCGACTAACCAAATCGGTCATGCATGTAGAACTTGGGGTGCCT TCCAAATCTCAAACCACGGCGTGCCTTTGGGACTTCTCCAAGACATTGAG TTTCTCACCGGTAGTCTCTTCGGGCTACCTGTCCAACGCAAGCTTAAGTC TGCTCGGTCGGAGACAGGTGTGTCCGGCTACGGCGTCGCTCGTATCGCAT CTTTCTTCAATAAGCAAATGTGGTCCGAAGGTTTCACCATCACTGGCTCG CCTCTC---AACGATTTCCGTAAACTTTGGCCC---------CAACATCA CCTCAACTACTGCGATATCGTTGAAGAGTACGAGGAACATATGAAAAAGT TGGCATCGAAATTGATGTGGTTAGCACTAAATTCACTTGGGGTCAGCGAA GAAGACATTGAATGGGCCAGTCTCAGTTCAGATTTAAAC---TGGGCCCA AGCTGCTCTCCAGCTAAATCACTACCCGGTTTGTCCTGAACCGGACCGAG CCATGGGTCTAGCAGCTCATACCGACTCCACCCTCCTAACCATTCTGTAC CAGAACAATACCGCCGGTCTACAAGTATTTCGCGATGATCTTGGT---TG GGTCACCGTGCCACCGTTTCCTGGCTCGCTCGTGGTTAACGTTGGTGACC TCTTCCACATCCTATCCAATGGATTGTTTAAAAGCGTGTTGCACCGCGCT CGGGTTAACCAAACCAGAGCCCGGTTATCTGTAGCATTCCTTTGGGGTCC GCAATCTGATATCAAGATATCACCTGTACCGAAGCTGGTTAGTCCCGTTG AATCGCCTCTATACCAATCGGTGACATGGAAAGAGTATCTTCGAACAAAA GCAACTCACTTCAACAAAGCTCTTTCAATGATTAGA-------------- ----------------AATCACAGAGAAGAA------------------- ----------------------------- >P ---CCTTCAAGATCATTGACAGACGCCTTTAGATCCCACCCCGTCCATCT ACACCAAAAGCACCTT---GACTTTTCCTCTCTTCAAGAAATACCTGACT CACACAAATGGACTCAACTTGATGACATTGAA------CAACAACATCCT TCAGTTGAATCCTTCATCACGGAATCTGTCCCCGTTATCGATCTCTTAGA CCCTAACGTCCTTCAAAACATAGGCAATGCATGCAAAACTTGGGGTGTGC TTCAAGTCACAAACCATGGCATCCCTATTAGCCTTCTTGAGAGCGTTGAG GGTGTTAGTAGGAGCCTTTTCTCTTTACCTGTCCAGCAAAAACTCAAAGC AGCTAGATCACCCGATGGTGTTTCTGGCTATGGTGTGGCTAGGATTTCTT CATTTTTCTCAAAGCTCATGTGGTCAGAGGGATTCACCATAGTTGGTTCT CCACTT---GAGCACTTTCGCCAACTTTGGCCC---------CAAGATTA CACCAAATTCTGCGATGTAATTGAAGAACATGAGAAAGAAATGCAAAAGC TAGCAAGGAGGTTGACATGGTTAATGCTGGGCTCATTGGGCATAACCAAG AAAGATTTAAACTGGGCTGGACCGAAAGGTGAATCCAAA---GAAGGTGG TGCAGCCTTGCAACTGAACTCCTACCCGGCTTGCCCAGATCCAGATCTGG CAATGGGTCTTGCTGCACACACAGACTCCACTCTGCTGACCATTCTTTAC CAGAACAACACAAGTGGATTGCAGGTGCTGAAAGAGGGAATTGGG---TG GGTCACCGTCCCACCAATCCCAGGTGGGCTTGTTGTAAATGTAGGCGACC TACTCCATATCCTATCAAACGGGTTGTACCCGAGTGTGCTCCACAGAGCG GTGGTTAACCGAACCAAACACAGATTATCCATAGCGTACCTCTACGGGCC ACCATCAAGTGTTCAAATATCACCCATACAAAAACTTGTAGGCCCAAATC  97 ATCCTCCTCTCTATCGCCCAATCACTTGGAATGAATACCTTGTCGCTAAA GCTAAGCATTTCAACAAAGCATTATCATCGGTTAGGATTTGTGCTCCTCT AAATGGA---CTAGTTGATGTAAACGATCAT------------------- -----------AATAGTGTAAAAGTTGGT >R GCCCCACAAAGA-------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ----------------------------------AAGATTTGGGGT---- -----------GGCGATGGTATC--------------------------- -------------------------------------------------- -------------------------------------------------- --------------------------------------TACAAAAGAAAT CCAATT-------------------------------------------- -------------GATATAACAGAAGAATACCAAATAGAGATGCAAAAAC TTGCAGTCAGATTGATGTGGTTAATGCTGGGCTCCTTAGGCATAACTAGC GAAGATGTCACCTGGGCTGGCCCAGAAGGTGATTTCGAAGGGGCTTCTGC TGCCGCCTTACAACTGAATTACTACCCGGCTTGCCCTGACCCGGATAAGG CCATGGGTCTTGCTGCCCATACTGACTCAACTCTGCTTACCATCCTACAC CAGAATAGTACCAGTGGATTGCAAGTACAAAAAGAAGGAACCGGG---TG GGTTACCGTTCCGCCTATTCCGGGTGGTCTTGTAGTCCATGTAGGAGACC TCCTTCACATCCTATCCAACGGGTTGTACCCCAGTGTTATTCACCGGGCG GTAGTTAACCGGACCAAGCATAGGCTATCCGTGGCTTATCTGTATGGGCC ACCATCAAGTATCCAAATATCACCCTTATCTAAATTAGTAGGCCCGAGTC AACCACCTCTTTACAAAGCAGTCACTTTCTTTGAGTATCTTGGCACTAAA GCTAAACACTTCAACGAAGCACTATCAAGGGTTAGGGTATGTGCTCCTCT GAGTGGATCATTACTTGATGTAAATGAGCACAGCAACAACAACAACAACA GTAATAATAATAATAGGGTAAAAGTAGGA >O ---CCGACG------------------------------CCGTCGCACTT GAAGAACCCGCTCTGCTTCGACTTCCGGGCGGCGAGGCGGGTGCCGGAGA CGCACGCGTGGCCGGGGCTGGACGACCACCCGGTGGTGGACGGCGGCGGC GGCGGCGGCGAG---------GACGCGGTGCCGGTGGTGGACGTCGGGGC GGGCGACGCGGCGGCGCGGGTGGCGCGGGCGGCGGAGCAGTGGGGCGCGT TCCTTCTGGTCGGGCACGGCGTGCCGGCGGCGCTGCTGTCGCGCGTCGAG GAGCGCGTCGCCCGCGTGTTCTCCCTGCCGGCGTCGGAGAAGATGCGCGC CGTCCGCGGCCCCGGCGAGCCCTGCGGCTACGGCTCGCCGCCCATCTCCT CCTTCTTCTCCAAGCTCATGTGGTCCGAGGGCTACACCTTCTCCCCTTCC TCCCTCCGCTCCGAGCTCCGCCGCCTCTGGCCCAAGTCCGGCGACGACTA CCTCCTCTTCTGTGACGTG---GAGGAGTTTCACAAGGAGATGCGGCGGC TAGCCGACGAGTTGCTGAGGTTGTTCTTGAGGGCGCTGGGGCTCACCGGC GAGGAGGTCGCCGGAGTCGAGGCGGAGAGGAGGATCGGCGAGAGGATGAC GGCGACGGTGCACCTCAACTGGTACCCGAGGTGCCCGGAGCCGCGGCGAG CGCTGGGGCTCATCGCGCACACGGACTCGGGCTTCTTCACCTTCGTGCTC CAGAGCCTCGTCCCGGGGCTGCAGCTGTTCCGTCGAGGGCCCGACCGGTG GGTGGCGGTGCCGGCGGTGGCGGGGGCCTTCGTCGTCAACGTCGGCGACC TCTTCCACATCCTCACCAACGGCCGCTTCCACAGCGTCTACCACCGCGCC GTCGTGAACCGCGACCGCGACCGGGTCTCGCTCGGCTACTTCCTCGGCCC GCCGCCGGACGCCGAGGTGGCGCCGCTGCCGGAGGCCGTGCCGGCCGGCC GGAGCCCCGCCTACCGCGCTGTCACGTGGCCGGAGTACATGGCCGTCCGC AAGAAGGCCTTCGCCACCGGCGGCTCCGCCCTCAAGATGGTCTCCACCGA CGCCGCCGCCGCCGCCGACGAACACGACGACGTCGCCGCCGCCGCCGACG TCCACGCA--------------------- >V ---CCTTCGAGA---ATCTCTGATGCCTTCAAAGCCCACCCTCTCCACCT CAATCACAGACACTTG---GACTTGAACTCAGTACAAGAATTACCCGACT TATATGAATGGCCCGACTTATATGCATGGGCAGGGGTGGACGAGAACCCT TCTGGAGACTCGTTAATCACTGAGTCCGTGCCGGTTATTGATCTCACCGA CCCTAATGCCTCAGAACTCGTGGGTCATGCATGCAAGAGCTGGGGCGTCT TCCAAGTCACCAACCATGGCATCCCCGGCAGCCTCCTCGACGACATTGAG TCTGCTGGCAGGAGCCTTTTCTCTCTACCTGCCCAGCAAAAGCTGAAGGC CGCTCGCTCCCCTGATGGGGTTGCTGGCTATGGCCTCGCCAGGATTTCCT CTTTCTTCAACAAGCTCATGTGGTATGAAGGCTTCACCATCTTCGGATCT CCACTT---GAACACGCTCGCCAACTTTGGCCT---------CAAGACTA CACCAAATTCTGTGATGTCACGGAGGAGTTTGAGAAAGAGATGAACCAAC TTGCAGAGAGGCTCATGTGGCTCATGCTTGGATCACTGGGGATCACTAAA GAAGATCTTAACTGGGCTGGCTCAAAAGGCGACTTCAAA----------- -GCTGCCCTGCAGTTGAACTCTTACCCAGCTTGTCCAGAGCCGGACAGGG CGATGGGTCTCGCTGCCCACACTGACTCTAGCCTCTTCACAATCCTCTAC CAGAACACCGTCAGTGGTCTGCAGGTCCAACGAGAGGGAGCCGGA---TG GATCACAGTTCCTCCACTCCCGGGTGCACTTGTTATCAACGTTGGTGACC TCCTCCACATACTATCCAATGGGGTGTTCCCTAGTGTCGTACACAGGGCC TTGGTTAACCGGACAAAGCATCGACTCTCTGTGGCCTACCTCTACGGACC ACCAGCCGGTGTTCCAATCTCGCCCGTGCCGAAGCTGGTTGACTCGACTC  98 ACCCTCCTCTCTACCGCCCAGTCACATGGAGCGAGTACCTCTGCACCAAG GCAAAGCACTTTGACAAGGCTCTTTCATTAGTTCGGCTGTGTATGCCCAG GAACGGA---TTCATCGATGTAAACGATCAC------------------- -----------AATGGGGTGAAAGTAGGT    GA.1.14.13.78.fasta >A ---------------------------GCCTTCTTCTCCATGATCTCCAT TCTCCTTGGCTTTGTTATCTCCTCCTTCATCTTCATCTTCTTCTTCAAGA AACTTCTCTCCTTCTCCAGAAAGAACATGTCTGAAGTCTCCACTCTCCCC ---TCTGTTCCAGTGGTACCAGGGTTTCCTGTTATTGGGAACTTGCTGCA ACTAAAAGAGAAGAAACCTCACAAGACTTTCACTAGATGGTCAGAGATTT ATGGTCCTATTTACTCTATAAAGATGGGTTCTTCTTCTCTTATTGTCCTC AATTCTACTGAGACTGCCAAAGAGGCCATGGTGACGCGGTTTTCGTCTAT CTCAACGAGGAAGTTGTCAAATGCGTTGACAGTCCTTACTTGTGACAAAT CTATGGTTGCTACTAGTGATTATGATGATTTCCACAAGTTGGTGAAACGG TGTCTCTTGAACGGTCTTTTGGGTGCTAATGCACAGAAACGAAAAAGACA TTACAGAGATGCACTCATTGAAAATGTGTCTTCCAAGTTGCATGCCCATG CTAGGGACCATCCACAA---GAACCTGTAAACTTCAGAGCTATATTTGAG CATGAGCTTTTCGGTGTAGCATTGAAGCAAGCTTTTGGGAAAGATGTGGA ATCCATTTATGTTAAAGAACTCGGTGTGACTTTGTCGAAAGACGAGATCT TCAAGGTTTTAGTACATGACATGATGGAAGGTGCAATTGATGTTGATTGG AGAGACTTCTTCCCATACTTGAAATGGATTCCAAATAAAAGTTTTGAAGC AAGAATCCAGCAAAAGCATAAACGTAGACTCGCAGTGATGAATGCTCTGA TTCAAGATCGACTGAAGCAGAATGGTTCAGAATCGGATGATGATTGCTAT CTCAACTTCTTGATGTCGGAAGCG---AAAACACTAACCAAGGAGCAAAT TGCTATCTTGGTTTGGGAGACGATTATCGAGACAGCTGACACTACTTTGG TTACAACTGAATGGGCCATCTATGAGCTCGCTAAGCATCCAAGTGTCCAA GATCGTCTGTGCAAAGAAATCCAAAATGTCTGCGGAGGAGAAAAGTTCAA AGAAGAGCAATTGTCTCAAGTTCCTTATCTCAATGGAGTCTTTCATGAAA CGCTTAGGAAATACAGTCCTGCTCCTCTAGTTCCCATTCGCTACGCCCAC GAGGATACGCAAATCGGAGGCTATCATGTCCCTGCAGGAAGTGAGATTGC AATAAACATATATGGATGCAACATGGATAAGAAGCGTTGGGAGAGACCAG AGGACTGGTGGCCGGAGCGGTTTCTTGATGATGGCAAATATGAAACGTCA GATCTTCACAAGACAATGGCGTTTGGAGCGGGAAAGAGGGTTTGTGCTGG TGCTCTTCAAGCATCTCTCATGGCAGGCATTGCTATTGGAAGATTAGTGC AAGAATTCGAGTGGAAGCTTAGAGATGGCGAAGAAGAGAATGTGGATACA TATGGCTTGACCTCTCAGAAGCTTTATCCTCTTATGGCTATTATCAATCC AAGG---CGTTCT >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------------GTGCCAGGATGGCCAGTCATAGGGAATTTGCTGCA ACTGAAGGAGAAGAAACCACACAAGACGTTCTTAAGGTGGGCTGAGGCTT ATGGGCCAATCTATTCCATAAAGACCGGTGCTTCTACTGTGATTGTTCTC AATTCAACTGAAGTTGCAAAGGAGGCCATGGTGACTAGATATTCGTCCAT ATCAACAAGAAAACTATCAAAGGCCTTGGAAGTTCTTACAGATAATAAAT CTATGGTTGCAACAAGTGATTATGGCGACTTTCACAAGATGGTGAAGCGG TATATACTTACAAATGTACTCGGAGCTGGTGCTCAGAGACGACACCGGGG TCACAGGGATACCTTGGTAGAAAATGTTTCAAGTCAATTGCTTGATCATA TAAAGACCAATCCTCAATTACAAGCTGTGGATTTCAGGGAAATATTTGAG TCTGAACTTTTTGGATTGTCAATGAAAGAAGCTTTAGGAAAAGATATGGA ATCTCTATATGTAGATGAACTTCAGGCCACTTTATCAAGAGAGGAGATTT TCAATGTTCTGGTGCTTGATCCTATGGAGGGTGCAATTGATGTTGACTGG AGAGATTTCTTTCCATATTTGAGATGGATTCCTAATAAGGGTTTTGAAAT GAAAATCGAGCGAATGAATTTTCGCAGGCAATCGGTGATGAATGCCCTTG TGCAGGAGCAGAAGAAACGAATTGCATCTGGAGAGGAAATAAATTGTTAT ATTGACTACTTATTATCGGAAGGCAAAACTACACTTACGGAGAAGCAAAT TGGTATGCTGGTTTGGGAGACAATTATTGAGACATCAGATACAACTATGG TCACTACAGAATGGGCCATGTATGAACTAGCGAAGAACCCAAAATGCCAG GATCGGCTCTATCATGAAATCCAAAATGTCTGTGGGTCTGAGAAGCTTAA AGAGGAACACCTGTCCCAACTGCCATACTTAAATGCTGTTTTCCATGAAA CTATTAGAAAGTACAGTCCTGCTCCTATTATACCTTTGAGATATGCTCAT GAAGATACACAGATAGGGGGCTACTATGTTCCAGCTGGAAGTGAGATCGC TATTAACATTTATGGATGTAACATGGACAAGAAGCGTTGGGAAAACCCTG AAGAGTGGAAGCCTGAGAGATTCCTTGAC---GGCAAATATGATCCCATG GACTTGCACAAGACAATGGCATTTGGAGCAGGAAAGAGGTCATGCGCAGG TGCTCTTCAAGCGTCCTTGATAGCATCTGCCACGATTGGCAAGGTAGCAC AAGAATTTGAATGGAGACTTAAAGATGGAGAGGAAGAACATGTTGATACT GTTGGACTCACCACTCGCAAGCTTCAGCCGCTGCATGTCATGATAAAAAC AAGA--------- >R  99 GATGCTGTCACCCCTAACATTCTTCTAAACTTTCAGACAATGACTTATGC CACCCCTGCAGCTGTTGGTGGTTTGTTCTTCTCCATGTTCGTTATGAAAA AGCTGATCTCCAATCAAAAGAAAAGACATGCCAGA---------CTTCCT ---CCTGTACCAGAAGTACCAGGGTGGCCAGTGATAGGGAATTTGCTGCA ACTCAAAGAGAAGAAACCCCATAAGACTTTCATGAGATGGGCTGAGACAT ATGGACCTATTTATTCGATTAGAACTGGTGCTTCTACTATTATTGTTCTC AATTCAACTGACGTTGCTAAAGAGGCCATGGTGACTAGATATTCATCCAT TTCAACAAGAAAGCTATCAAAAGCCTTGGTAATCCTTACCCAGGATAAAT GTATGGTTGCAACAAGTGATTATGATGAGTTCCACAAGATGGTGAAACGA TATTTACTTACAAATGTACTGGGAGCCAATGCTCAGAGGCGACATCGGTG CCACAGGGACACCCTGATCAAAAATATTTCGAGCCGGTTTCATGCTCATG TAAAGACCAATCCTGAA---CAAACTGTAAATTTCAGGGATATTTTTGAG TCTGAACTTTTTGGACTATCACTTAAAGAAGCATTGGGAAAGGATGTGCA ATCCATTTATGTTGATGAACTTGGGACCACTCTGTCAAGGAAGGAGATTT TTGAGGTTTTGGTGCTTGACCCAATGGAAGGGGCAATTGATGTGGACTGG AGAGATTTCTTCCCATATTTAAGATGGGTTCCTAATAAGAGCTGGGAAAT GAAAATCCAGCAGATGCATTTTCGTAGGAAGGCAGTGATGGGTGCCCTCA TCAAGGAGCAGAAGAAACGAATTGCTCTAGGGGAGGAGGTAAATTGTTAT CTCGATTTCTTATCATCCGAA------AGCACACTCACGGATGAACAAAT CAGAATGTTGATCTGGGAGACAATTGTTGAGACATCAGATACGACTATGG TCGCTACAGAATGGGCCATCTACGAACTTGCTAAGAATCCCAACTGCCAG GATCTGCTCTATCGCCAAATTCAAAATGTATGTGGGTCTGAGAAGATCAC AGAGGAACACCTGTCTAAACTGCCATACTTGAATGCTGTTTTCCATGAAA CTATTAGAAAGTACAGTCCTGCTCCAGTTATACCTCTGCGTTATGTACAT GAAGATACAGAATTAGGGGGATACTACATTCCTGCAGGAAGTGAGATTGC AATTAATATTTATGGGTGCAACATGGACAAGAATCGATGGGTAAACCCTG AAGAGTGGAATCCTGAGAGATTTCTCAAC---GGAAACTATGATTCCGGG GACTTGCATAAGACAATGGCTTTTGGAGCCGGAAAGAGGGCTTGTGCAGG TGCTCTTCAGGCATCATTAATAGCCAGTACATCAATTGGCAGACTGGTGC AAGAATTTGAATGGGGACTGAAAGCTGGAGAGGAAGAAGATGTTGATATT GTTGGACTGACAACTCGCAAGCTTCATCCATTGCATCTCTCCATAAAGCC AAGA---AGACTG >O ------------------------------------------GAGTCGCT GCTCGCAGCCGGTGCGGGAGGGATCGGTGTGGCGGCGGCGGCCGTCGGGG GGTTTATCGCGGCGGCGACACTCGCCGTGGCACCGCCCAAGAACCGCCGC AACCCGCCTCCAGCTGTTCCTGGTTTACCCATAATCGGAAATCTGCATCA ATTGAAAGAAAAGAAGCCTCATCAGACCTTCACAAAATGGGCTGAAATTT ATGGCCCAATCTACACTATAAGGACCGGGGCTTCTTCCGTAGTTGTGCTC AATTCAACTGAAGTAGCCAAGGAGGCGATGGTTGCAAAATTCTCATCCAT ATCTACCCGAAAGCTATCCAAAGCACTAACAGTGCTTAGTCATGATAAAT CCATGGTTGCTACCAGCGACAGTGGTGATTTCCACAAAATGGGGAAGCGT TATATCATGTTAAGCATGCTGGGTACTTCTGCACAGAAACAATTTCGTGA CACAAGAGATATGATCATCAATAACATGTTAAGCACTTTCCATCAACTGG TGAAAGATGACCCACAT---GCTCCTCTGATATTCAGAGATGTTTTCAAG GATGAGCTATTCCGGTTGTCCATGATCCAGAGCTTAGGAGAGGATGTGAG TTCAGTCTATGTGGATGAATTTGGGAGGGACATTTCGAAGGAAGAAATCT ACAATGCTACTGTGACTGACATGATGATGTGCGCAATTGAGGTCGACTGG AGAGATTTCTTCCCCTACCTCAGCTGGGTTCCAAACAAGAGCTTCGAAAC AAGAGTGTTTACTACAGAATCTAGACGAACTGCGGTGATGCGCGCCTTGA TCAAGCAGCAGAAGGAAAGGATTGTGCGTGGAGAGGCAAGGACATGCTAT CTGGACTTCTTGCTGGCAGAG------AACACACTGACAGATGAGCAACT AATGATGCTAGTGTGGGAGGCACTCATAGAGGCTGCAGATACTACCTTGG TCACCACAGAATGGGCCATGTATGAGCTTGCCAAGAACCCTGACAAACAG GAACGGCTTTACCAAGAGATCCGGGAGGTGTGCGGCGACGAGGCGGTCAC CGAGGAGCACCTGCCGTGGCTGCCGTACCTCAATGCCGTCTTCCAGGAGA CGCTGCGCCGCCACTCCCCTGTCCCGCTCATACCTCCGAGGTTCGTCAAC GAGGACACCATGCTCGCCGGCTACGATGTCCCCGCCGGCACCGAGATGGT GATCAACCTGTATGGGTGCAACATGAACAAGAAGGAGTGGGAGTCGCCGG AGGAGTGGGCGCCGGAGAGGTTCGCCGGT---GGGAGGTTCAAGGTGGCG GACATGTACAAGACGATGGCGTTCGGCGCCGGGAGGAGGGTCTGCGCAGG GAGCCTGCAGGCGACTCACATCGCGTGCGCCGCCATCGCGCGCTTCGTGC AGGAGTTTGGGTGGAGGCTGAGGGAGGGTGACGAGGAGAAGGTGGACACC GTGCAGCTCACCGCCTACAAGCTCCACCCGCTTCATGTCCACCTCACGCC CAGAGGAAGGATG >V -------------------------------------------------- ----------------------------------TTGATGTTGATGAATG GGTATTGGTTGATG------------------------------------ ---GGGGTTGCAGATATCCCAGGGCTGCCGCTGATTGGGAATTTGCTGCA ACTGAAAGAGAAGAAGCCACACAAGACTTTCGCAAGGTGGGCTGAGACTT ATGGCCCAATCTTTTCCATCAGGACCGGAGCTTCTACTATGATCGTTCTG AATTCCTCCGAAGTTGCTAAAGAGGCAATGGTGACCAGGTTCTCATCCAT CTCAACAAGGAAGTTATCAAATGCCTTGAAGATACTTACCTTCGATAAAT GCATGGTTGCCACAAGTGACTACAATGACTTCCACAAGATGGTCAAAGGG  100 TTTATACTCAGAAATGTTTTGGGAGCCCCCGCTCAGAAGCGACACCGATG CCACAGAGACACCTTGATTGAAAATATTTCGAAATACTTGCATGCCCATG TGAAGACCTCTCCTCTT---GAACCAGTGGTTCTCAAAAAAATTTTCGAG TCTGAAATTTTCGGATTAGCGTTGAAACAAGCTTTGGGCAAGGACATTGA ATCCATTTATGTGGAAGAGCTTGGCACCACTTTGTCAAGGGAGGAGATAT TTGCGGTTTTGGTTGTTGATCCG---GCAGGGGCCATTGAGGTGGACTGG AGAGATTTCTTCCCATATCTGAGTTGGATTCCTAATAAGAGCATGGAAAT GAAAATCCAGAGAATGGATTTCCGCAGGGGAGCATTAATGAAGGCCCTTA TCGGGGAGCAGAAGAAAAGGATTGGTTCAGGAGAGGAGAAGAATTGCTAC ATCGATTTCTTATTATCCGAAGCA---ACAACACTCACGGAGAAACAAAT AGCCATGTTGATTTGGGAGACAATCATCGAGATATCAGATACTACTCTGG TCACATCTGAATGGGCCATGTATGAACTTGCTAAGGATCCAAACCGGCAG GAAATTTTATATCGGGAAATCCGCAAATTTTGTGGCTCCAATAAGGTTAC AGAGGAAAACTTGTCTAAGCTTCCGTACTTAAATTCTGTTTTCCATGAGA CTCTTAGGAAGTACAGTCCAGCTCCCATAGTCCCTGTTCGGTATGCGCAT GAAGATACCCAATTGGGGGGATACCATATTCCTGCTGGAAGTCAGATCGC TATAAACATATATGGGTGCAACATGAACAAGAAACAATGGGAAAATCCTG AGGAGTGGAAGCCTGAAAGATTTCTGGAT---GAGAAATACGATCTAATG GATTTGCACAAGACGATGGCCTTTGGAGGAGGAAAGAGGGTGTGTGCAGG CGCTCTTCAGGCAATGCTAATAGCTTGCACATCAATTGGTAGGTTCGTGC AGGAGTTTGAGTGGAAACTGATGGGAGGGGAGGAAGAAAATGTGGATACC GTAGCACTCACCAGTCAGAAACTCCATCCCATGCAAGCGATCATAAAGGC AAGA---GAG---    GA.1.14.13.79.fasta >A ------------------------------ACGGAAACGGGTTTGATTCT CATGTGGTTCCCTTTGATAATATTGGGATTGTTTGTTTTGAAATGGGTGC TGAAGAGAGTGAATGTTTGGATTTATGTGTCCAAACTTGGT---GAGAAA AAACACTATCTGCCACCAGGTGATTTGGGATGGCCAGTCATAGGCAACAT GTGGTCCTTTCTTAGAGCTTTCAAAACATCTGATCCTGAATCCTTCATCC AATCCTACATCACCAGGTATGGGCGTACCGGGATTTATAAAGCACACATG TTTGGGTACCCATGTGTACTAGTAACAACACCAGAGACTTGTAGGCGAGT TCTAACAGATGATGATGCCTTCCACATAGGTTGGCCAAAATCTACCATGA AACTCATTGGCAGGAAGTCCTTTGTTGGTATCTCCTTTGAAGAACACAAG AGGCTCAGGCGTTTGACTTCTGCTCCTGTCAATGGCCCTGAAGCTCTCTC TGTATACATACAGTTCATTGAAGAAACTGTTAATACTGATCTAGAAAAAT GGTCCAAA------ATGGGAGAAATCGAGTTCTTATCTCATTTGCGTAAG CTTACGTTTAAGGTCATTATGTACATATTTCTCAGCAGTGAGAGTGAGCA TGTCATGGATTCATTGGAACGGGAGTATACCAACCTTAACTATGGAGTTC GAGCAATGGGTATTAATCTTCCTGGGTTTGCTTATCATAGAGCTTTGAAG GCAAGGAAAAAACTTGTAGCTGCCTTTCAGTCCATAGTGACTAACCGAAG AAATCAAAGGAAGCAGAATATTTCATCCAAT------AGAAAAGATATGC TGGATAATCTAATAGATGTTAAAGATGAAAACGGAAGAGTCTTAGATGAT GAGGAAATTATTGACCTTTTGTTGATGTATCTTAATGCGGGTCATGAATC TTCTGGACACCTCACTATGTGGGCTACCATTTTGATGCAAGAACACCCTA TGATTCTGCAAAAGGCTAAGGAAGAACAAGAGAGGATCGTAAAAAAGAGA GCACCGGGACAGAAG---TTGACGCTTAAAGAGACACGTGAAATGGTGTA TCTTTCTCAGGTTATTGATGAGACCCTTCGAGTAATTACATTCTCTCTGA CGGCCTTCAGGGAAGCAAAGAGTGATGTCCAAATGGATGGCTATATAATT CCAAAAGGCTGGAAGGTTCTGACTTGGTTTAGGAACGTCCATTTGGACCC TGAAATCTACCCGGATCCAAAGAAATTTGATCCTTCAAGATGGGAGGGAT ACACACCAAAAGCAGGCACATTCCTTCCTTTTGGTTTGGGAAGCCACCTA TGCCCGGGAAACGATCTTGCCAAGCTCGAGATTTCCATTTTTCTTCATCA TTTCCTCCTCAAATACCGGGTGGAAAGGAGCAATCCCGGATGTCCGGTGA TGTTCTTGCCTCACAATCGACCCAAAGATAATTGCCTAGCAAGAATCACC AGAACGATGCCA--------- >P ------------------------------ATGGAGTCGGGATCTATCTG GGTGGTCCTAGCAGTCATATTTGGTGGATTAGGGGTTGGGAAATGGATTC TAAAGAAAGTGAATTGGTGGTTGTATGAAGCCCAACTGGGT---GAAAAG CAGTACTCACTACCTCCAGGGGATTTGGGCTGGCCTTTCATTGGCAATAT GTGGTCCTTTCTCAGAGCTTTCAAATCCAGCGATCCTGATTCTTTCATGC GCACCTTCATCAACAAATATGGAGATAATGGAATCTACAAGGCCTTCATG TTTGGGAACCCGAGTGTATTCGTAACAACACCTGAAGCATGCAGAAGAGT ATTAAGTAACGATGATGCATTTAAGCCTGGATGGCCAATTTCCACACTGA AGCTTATCGGAAGGAAATCCTTCATTGATATTTCTTACGAAGAGCACAAG CGCCTTCGCCGTCTGACGTCCGCTCCTGTCAATGGTCATGAAGCGTTGTC CGTTTACATTCCATATATAGAAGAAAATGTGATAGCTATGTTGGAAAAAT GGACCACA------ATGGGGAAGATCGAGTTCTTGACTCAAGTGAGAAAA CTTACCTTCAAAATAATCATGTATATATTTCTTAGCTCTGAGAGTGAGGT GGTCATGGAGGCTTTGGAGAAGGATTACACCACTCTTAATTATGGAGTCA GAGCCATGGCGATCAATCTTCCTGGATTCGCTTACTATAAAGCATTGAAG  101 GCCCGCAAAAGACTTGTCGCTATATTCCAATCTATAGTGGATGAGCGTAG AAATTTAAGGAAGAACAGTGCTCGTAACGCA---AAGAAGAAAGACATGA TGGACTCTCTGTTGGGTGTTGAAGATGAAAATGGTAGGAAATTGACTGAT GAAGAAATCATAGATGTAATTTTGATGTACTTGAATGCAGGCCATGAATC CTCTGGCCATATCACGACATGGGCTACTATTTTTCTCCAGGAACATCCAG AATTTCTCCAAAAAGCTAAGGAAGAGCAAGAACAGATTGTAAAAAGGAGG CCACCAGCACAAAATGGATTGTCACTTAAGGAAGTTCGAGAAATGGATTA TCTTTCCAAGGTGATTGATGAAACACTTCGTTTGATCACATTCTCGCTTA CTGTTTTCCGAGAAGCAAAAACAGATTTCAGTATAAACGGATACATCATT CCAAAGGGTTGGAAAGTTCTGGTTTGGTTCAGGACAGTTCATTTGGATCC AGAAATCTATCAAAATCCAAAGGAATTTAATCCTTCTAGATGGGATAATT ACACCCCCAAAGCAGGGACTTTCCTTCCTTTTGGAGCTGGAAGCAGGCTG TGCCCTGGAAATGATCTTGCCAAGCTTGAAATATCTATTTTTCTGCATTA TTTTCTTCTTGATTATAGGCTCGAACGTGAAAATCCTGAATGTCGTTGGA TGTTCCTCCCTCATACCAGACCAACAGACAACTGTGTGGCTAGAATCAAG AAAGTTTCATCCACATCTGTA >R ---------------------------------GAGATGGGTTTCGTGTG GGTGGTCCTGATATGGATATCGGGGGGTTTTTGGTGCTTGAAATGGATTC TAAAGAGAGTAAATTGCTGGCTCTATGAAAACCAACTCGGG---GAAATG CAGTATTCCCTGCCTCCAGGCGATTTGGGGTGGCCTTTCATTGGTAATAT GTGGTCCTTTCTTAGAGCTTTCAAGTCCAACGACCCTGATTCTTTCATGC GCAACTTCACTGCCAGATACGGGAGTGGTGGAATATACAAGGCCTTCATG TTTGGGAAGCCCAGTGTGTTGGTAACAACATCAGAAGCATGCAAAAGGGT ATTAACAGATGACGACGCTTTTAAGCCTGGTTGGCCAAGCTCCACCACGG AGCTCATTGGCAAGAAATCATTCATTGGTATTTCGTACGAAGAGCACAAG CGTCTTCGCAGGCTCACAGCCTCTCCTGTCAATGGACATGAAGCTCTTTC CGTCTACATGCACTACATTGAAGATAAAGTCAAATCTGCCTTGGAAAAAT GGTCCACT------ATGGGAGAGATCCAGTTCTTGACTCAACTCAGAAAA CTTACTTTCAGGATCATTATGTATATCTTCCTTAGCTCCGAGAGTCACTC CGTCATGGAGGCTTTGGAGAGGGAATATACCACTCTTAACTATGGGGTCA GAGCCATGGCCATTAATCTTCCTGGATTTGCTTACTATAAAGCGCTCAAG GCGCGCAAAAACCTTGTCGCTGTACTACAATTTGTAGTGGATGCGCGAAG AAATCAGAAGAAGGGCGCAGAGCCTAATTCATCAAAGAAGAAAGACATGA TGGACGCTCTTTTGGATGTTGAAGATGAAAAGGGTAGAAAATTGAGCGAT GAAGAAATCGTTGATGTTCTGTTAATGTACTTGAATGCAGGCCATGAATC TTCTGGCCATATCACTATGTGGGCTACTGTTTTCCTTCAGGAGCACCCTG AATTTCTCCAAAAAGCCAGGCAAGAACAAGAGGAGATCATAAAAAGGAGG CCACCGACGCAAAAAGGATTGACGCTTAAAGAAGTCCGAGACATGGAATA TCTTTCTAAGGTCATTGATGAAACTCTTCGTTTGATAACCTTCTCGCTTG TAGTTTTCCGAGAGGCAAAAACAAATGTCAATATAAGCGGATATGTCATT CCCAAGGGTTGGAAGATTCTAGTCTGGTTCAGAAGTGTTCACTTGGATCC TGAAATATACCCAAATCCAAGGGAATTCAATCCTTCCAGATGGGATAATC ATACAGCAAAGGCAGGAACTTTCCTTCCGTTTGGAGCAGGAAGTAGGATG TGCCCTGGAAATGATCTAGCCAAACTCGAAATTGCTATTTTTCTGCATCA TTTTCTGCTGAATTATGAGCTAGAACGTCTCAATCCTGGAAGCTCAATGA TGTACTTGCCTCATTCAAGACCAAAAGACAACTGCTTGGCAAGAATCAAG AAAATTCCTTCTGCA------ >O GTGATGGAGGGCATGGGCATGGCGGCGGCGTGGGCGGCGGGGGACCTGTG GGTGCTGGCGGCGGCGGTGGTGGCCGGCGTGGTGCTGGTCGACGCGGTGG TGCGGAGGGCGCACGACTGGGTTCGCGTGGCGGCGCTGGGGGCGGAGAGG AGGTCGAGGTTGCCGCCGGGGGAGATGGGGTGGCCGATGGTGGGCAGCAT GTGGGCGTTCCTCCGCGCCTTCAAGTCCGGCAACCCCGACGCCTTCATCG CCTCCTTCATCCGACGGTTTGGGCGGACAGGGGTGTACAGGACGTTC--- TTCAGCAGCCCGACGATCCTGGCGGTGACGCCGGAGGCGTGCAAGCAGGT GCTCATGGACGACGAGGGCTTCGTCACCGGCTGGCCCAAGGCCACCGTCA CCCTCATCGGCCCCAAATCCTTCGTCAACATGTCCTACGACGACCACCGC CGCATCCGCAAGCTCACCGCCGCCCCCATCAACGGCTTCGACGCCCTCAC CACCTACCTCTCCTTCATCGACCAGACCGTCGTCGCCTCCCTCCGCCGCT GGTCCTCGCCGGAGTCCGGCCAGGTCGAGTTCCTCACCGAGCTCAGGCGC ATGACCTTCAAGATCATCGTCCAGATCTTCATGAGCGGCGCCGACGACGC CACCATGGAGGCCCTGGAGCGGAGCTACACCGACCTCAACTACGGCATGC GCGCCATGGCCATCAACCTCCCCGGCTTCGCCTACTACCGCGCGCTCAGG GCTCGCCGGAAGCTCGTGTCCGTGCTGCAGGGTGTGCTCGACGGCCGGAG GGCCGCCGCCGCCAAGGGCTTCAAACGCTCC------GGGGCCGACATGA TGGACCGCCTCATCGAGGCCGAGGACGAACGCGGCCGCCGCCTCGCCGAC GACGAGATCGTCGACGTCCTCATCATGTACCTCAACGCCGGCCACGAGTC CTCCGGCCACATCACCATGTGGGCCACCGTCTTCCTCCAGGAGAACCCCG ACATCTTCGCAAGAGCAAAGGCTGAGCAAGAGGAGATCATGAGAAGCATT CCAGCAACGCAGAACGGATTAACCCTCAGGGACTTCAAGAAGATGCACTT CCTCTCACAGGTTGTCGACGAGACACTTCGCTGCGTCAACATCTCCTTCG TGTCCTTCCGTCAGGCCACAAGAGACATCTTTGTGAACGGTTATCTTATC CCCAAGGGGTGGAAGGTTCAGCTGTGGTACAGAAGTGTGCACATGGATGA CCAAGTTTATCCTGACCCCAAAATGTTCAACCCTTCAAGATGGGAGGGAC  102 CCCCTCCGAAAGCCGGAACATTCCTTCCATTTGGACTGGGAGCAAGACTG TGCCCTGGAAATGATCTTGCAAAGCTGGAGATCTCTGTCTTCCTCCATCA TTTTCTCCTGGGTTACAAGCTGAAGAGGGCAAATCCAAAGTGCAGGGTGA GATATCTGCCTCATCCCCGGCCTGTGGACAACTGCTTGGCGACGATCACC AAAGTTTCCGATGAACAC--- >V ---------------------------------GAGTTGGGTATGATCTG GGTGGCCTTTGGGGCCATTTTGGGAGGTGTATTGGGTGTGAAATGGGTTT TGAGGAGAGCAAATTCATGGGTTTATGAAGTTAAGCTGGGA---GAGAAG AGGTATTCTCTTCCACCAGGTGATCTTGGTTGGCCATTGATTGGTAATAT GTGGTCTTTTCTCAGAGCTTTCAAGTCCACTGATCCTGATTCTTTCATCT CCAGCTTTATCACCAGATTTGGACAAACTGGTATGTACAAGGTGTTAATG TTTGGGAACCCTAGCATCATTGTTACTATACCTGAAGCATGCAAAAGAGT CTTAACAGACGATCAAAATTTCAAGCCGGGCTGGCCTACATCCACCATGG AACTGATTGGAAGGAAATCATTTATTGGCATTACTAATGAGGAGCACAAA CGGCTCCGCCGGTTAACAGCAACTCCAGTCAATGGGCATGAAGCATTGTC CATTTACATGCAATATATTGAAGACAACGTTATATCTGCCTTGAACAAAT GGGCTGCG------ATGGGAGAATTTGAGTTCTTAACTGCACTCCGAAAG CTTACTTTTAAGATAATTATGTACATATTTCTTAGCTCAGAGAGCGAGCA TGTAATGGAAGCTCTGGAGAGGGAATATACTTCACTCAACTATGGAGTTA GGTCCATGGCAATCAATCTCCCGGGTTTTGCTTACCATAAAGCACTCAAG GCTCGGAAAAATCTTGTGAACATTTTTCAATCTATAGTGAATGAGCGAAG GGATAGGAAGAAAGGCAATTCTCAAACAATG------AAAAAAGACATGA TGGATGCTCTGCTGGACATCGAAGATGAAAATGGAAGAAAATTGAGTGAT GAGGAAATCATAGACATTCTTGTAATGTACTTGAATGCCGGTCATGAATC TTCTGCTCACGTCACGATGTGGGCTACTGTCAAGCTACAAGAAAACCCTG AATTTTTCCAAAGAGCCAAGGCAGAGCAAGAGGAGATCATAAGGAAGAGA CCACCTAACCAGAAGAGATTGACGCTCAAGGAAATTCGAGAAATGGAGTA TCTTCCCAAGGTGATCGATGAAACGCTTCGTTGGATTACATTCTCATTTG TGGTATTCCGAGAGGCAAAAGCAGACATCAATATATGTGGTTATACTATT CCCAAGGGATGGAAGGTTCTGGTTTGGTTTAGATCCCTTCACTTTGACCC TGAAACATATCCAGACCCAAAGGAGTTTAATCCTTGCAGATGGGATGATT ATACAGCAAAACCAGGAACTTTCCTTCCCTTTGGATTAGGCAGCAGGCTG TGCCCTGGCAATGATCTTGCCAAGCTTGAAATTTCTGTTTTCCTACACCA CTTTCTCCTTAATTATCAGCTGGAACGGCTGAATCCTGGGTGCCCGCGCA TGTACTTACCACACTCAAGGCCCAGAGACAATTGCTTGGCAATAGTCCGA AAAGTAGCAGCTGAATCAGAA    GA.4.2.3.19.fasta >A TCTATCAACCTTCGCTCCTCCGGTTGTTCGTCTCCGATCTCAGCTACTTT GGAACGGAGATTGGACTCAGAAGTACAGACAAGAGCTAACAATGTGAGCT TTGAGCAAACAAAGGAGAAGATTAGGAAGATGTTGGAGAAAGTGGAGCTT TCTGTTTCGGCCTACGATACTAGTTGGGTAGCAATGGTTCCATCACCG-- -AGCTCCCAAAATGCTCCACTTTTCCCACAGTGTGTGAAATGGTTATTGG ATAATCAACATGAAGATGGATCTTGGGGACTTGATAACCATGACCATCAA TCTCTTAAGAAGGATGTGTTATCATCTACACTGGCTAGTATCCTCGCGTT AAAGAAGTGGGGAATTGGTGAAAGACAAATAAACAAGGGTCTCCAGTTTA TTGAGCTGAATTCTGCATTAGTCACTGATGAAACCATACAGAAACCAACA GGGTTTGATATTATATTTCCTGGGATGATTAAATATGCTAGAGATTTGAA TCTGACGATTCCATTGGGCTCAGAAGTGGTGGATGACATGATACGAAAAA GAGATCTGGATCTTAAATGTGAT---AGTGAAAAGTTTTCAAAGGGAAGA GAAGCATATCTGGCCTATGTTTTAGAGGGGACA---AGAAACCAAGATTG GGATTTGATAGTCAAATATCAAAGGAAAAATGGGTCACTGTTTGATTCTC CAGCCACAACAGCAGCTGCTTTTACTCAGTTTGGGAATGATGGTTGTCTC CGTTATCTCTGTTCTCTCCTTCAGAAATTCGAGGCTGCAGTTCCTTCAGT TTATCCATTTGATCAATATGCACGCCTTAGTATAATTGTCACTCTTGAAA GCTTAGGAATTGATAGAGATTTCAAAACCGAAATCAAAAGCATATTGGAT GAAACCTATAGATATTGGCTTCGTGGGGATGAAGAAATATGTTTGGACTT GGCCACTTGTGCTTTGGCTTTTCGATTATTGCTTGCTCATGGCTATGATG TGTCTTACGATCCGCTAAAACCATTTGCAGAAGAATCTGGTTTCTCTGAT ACTTTGGAAGGATATGTTAAGAATACGTTTTCTGTGTTAGAATTATTTAA GGCTGCTCAA------AGTTATCCACATGAATCAGCTTTGAAGAAGCAGT GTTGTTGGACTAAACAATATCTGGAGATGGAATTGTCCAGCTGGGTTAAG ACCTCTGTTCGA---GATAAATACCTCAAGAAAGAGGTCGAGGATGCTCT TGCTTTTCCCTCCTATGCAAGCCTAGAAAGATCAGATCACAGGAGAAAAA TACTCAATGGTTCTGCTGTGGAAAACACCAGAGTTACAAAAACCTCATAT CGTTTGCACAATATTTGCACCTCTGATATCCTGAAGTTAGCTGTGGATGA CTTCAATTTCTGCCAGTCCATACACCGTGAAGAAATGGAACGTCTTGATA GGTGGATTGTGGAGAATAGATTGCAGGAACTGAAATTTGCCAGACAGAAG CTGGCTTACTGTTATTTCTCTGGGGCTGCAACTTTATTTTCTCCTGAACT ATCTGATGCTCGTATATCGTGGGCCAAAGGTGGAGTACTTACAACGGTTG TAGACGACTTCTTTGATGTTGGAGGGTCCAAAGAAGAACTGGAAAACCTC  103 ATACACTTGGTCGAAAAGTGGGATTTGAACGGTGTTCCTGAGTACAGCTC AGAACATGTTGAGATCATATTCTCAGTTCTAAGGGACACCATTCTCGAAA CAGGAGACAAAGCATTCACCTATCAAGGACGCAATGTGACACACCACATT GTGAAAATTTGGTTGGATCTGCTCAAGTCTATGTTGAGAGAAGCCGAGTG GTCCAGTGACAAGTCAACACCAAGCTTGGAGGATTACATGGAAAATGCGT ACATATCATTTGCATTAGGACCAATTGTCCTCCCAGCTACCTATCTGATC GGACCTCCACTTCCAGAGAAGACAGTCGATAGCCACCAATATAATCAGCT CTACAAGCTCGTGAGCACTATGGGTCGTCTTCTAAATGACATACAAGGTT TTAAGAGAGAAAGCGCGGAAGGGAAGCTGAATGCGGTTTCATTGCACATG AAACACGAGAGAGACAATCGCAGCAAAGAAGTGATCATAGAATCGATGAA AGGTTTAGCAGAGAGAAAGAGGGAAGAATTGCATAAGCTAGTTTTGGAGG AGAAAGGAAGTGTGGTTCCAAGGGAATGCAAAGAAGCGTTCTTGAAAATG AGCAAAGTGTTGAACTTATTTTACAGGAAGGACGATGGATTCACATCAAA TGATCTGATGAGTCTT---GTTAAATCAGTGATCTACGAGCCTGTTAGCT TACAGGAAGAATCTTTAACT------------------------------ -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------- >P -------------------------------------------------- -------------------------------------------CAGAACT TTCATGGAACTAAGGAAAGGATCAAGAAGATGTTTGATAAGATTGAATTG TCAGTGTCTTCATATGACACTGCTTGGGTGGCAATGGTCCCATCTCCA-- -GATTGTCCGGAAACTCCTTGTTTTCCAGAGTGCACAAAATGGATTTTGG AAAATCAACTTGGTGATGGCTCCTGGAGTCTTCCT---CATGGCAATCCA TTATTAGTTAAGGATGCTCTTTCATCTACATTAGCGTGCATCCTTGCATT GAAGCGATGGGGTATCGGTGAAGAACAAATAAATAAAGGCCTTCGATTTA TTGAGTTGAATTCCGCTTCAGTTACGGATAACGAGCAACATAAACCAATT GGATTTGATATAATATTTCCTGGCATGATTGAATATGCCATAGATTTGGA TTTGAACCTCCCTTTGAAGCCGACAGATATAAATTCCATGCTCCACAGGA GGGCTTTGGAGCTTACAAGTGGC---GGTGGCAAGAACTTGGAGGGAAGA AGAGCCTACTTAGCATATGTTTCGGAAGGAATTGGAAAATTACAGGATTG GGAAATGGCCATGAAATATCAAAGAAAGAATGGATCACTGTTCAATTCAC CATCCACCACAGCAGCTGCCTTTATTCATATTCAAGATGCTGAGTGTCTC CATTATATTCGTTCACTCTTACAGAAGTTTGGGAATGCAGTTCCAACCAT TTATCCTTTGGATATATATGCTCGTCTTTCTATGGTTGATGCTCTTGAAA GGTTGGGAATCGATCGGCATTTTAGGAAGGAAAGAAAATTTGTTTTGGAC GAAACATACCGATTTTGGTTGCAGGGGGAGGAAGAGATATTTTCTGATAA TGCCACTTGTGCTTTGGCATTTAGGATATTACGTTTGAACGGATATGATG TCTCTCAAGAT---------------------------CATTTCTCTAAT TCACTGGGAGGATATTTGAAGGATTCGGGAGCTGCCTTAGAGTTGTACAG AGCTCTGCAGCTA---AGTTATCCAGATGAATCACTTCTGGAAAAACAAA ATTCTCGGACAAGCTATTTCCTGAAACAGGGATTATCCAACGTTTCACTT TGTGGAGATAGGCTTCGTAAAAATATTATCGGAGAGGTGCATGATGCTCT CAATTTTTCTGACCATGCAAATTTGCAACGCTTAGCTATCAGAAGAAGAA TTAAACAT---TATGCTACAGATGATACGAGGATTTTGAAAACTTCGTAT CGTTGTTCGACTATTGGTAACCAGGATTTTCTCAAATTGGCTGTAGAAGA CTTCAATATCTGTCAATCAATACAGCGTGAAGAATTTAAACATATCGAGA GGTGGGTTGTAGAGAGGAGACTGGACAAGCTAAAGTTTGCTAGGCAGAAG GAGGCCTACTGTTACTTCTCTGCTGCAGCAACTCTCTTCGCTCCAGAACT ATCTGATGCACGCATGTCATGGGCAAAAAATGGTGTGCTTACTACTGTTG TTGATGACTTCTTTGATGTTGGTGGTTCTGAAGAAGAACTGGTAAACCTT ATTGAATTGATTGAGAGGTGGGATGTCAATGGCAGTGCTGATTTTTGTTC TGAGGAAGTTGAGATCATATATTCGGCAATTCACAGCACTATAAGTGAGA TAGGAGACAAATCTTTCGGATGGCAAGGACGCGATGTGAAAAGTCAGGTT ATCAAGATTTGGTTGGATTTGCTCAAATCCATGTTGACAGAAGCACAATG GTCAAGTAACAAATCAGTGCCGACCCTTGAA---TATATGACAACTGCAC ATGTATCGTTCGCTCTAGGGCCTATTGTTCTTCCAGCTCTGTATTTTGTG GGGCCTAAGCTTTCAGAGGAGGTTGCTGGACATCCTGAATTGCTTAATCT ATACAAGGTTACGAGCACTTGCGGGCGTCTGCTCAATGACTGGAGAAGCT TTAAGAGAGAATCTGAAGAAGGGAAATTGAATGCCATCTCATTGTACATG ATTCACAGCGGTGGTGCTTCAACTGAAGAAGAGACCATCGAACATTTTAA AGGATTGATCGACAGCCAGAGAAGACAATTGCTTCAATTAGTTTTGCAGG AAAAGGATAGTATAATTCCTAGACCCTGCAAGGATTTGTTTTGGAACATG ATAAAATTATTGCACACGTTCTACATGAAGGATGATGGATTCACTTCAAA CGAGATGAGAAATGTT---GTCAAGGCAATAATAAATGAACCCATCTCTC TAGATGAATTA--------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------- >R -------------------------------------------------- --------------------------------------------------  104 --------------------------------TTTGATAAGATTGAACTT TCGGTTTCTCCGTATGACACTGCTTGGGTAGCAATGATCCCATCTTTG-- -AATTCCGTACAAGCTCCTTTCTTTCCTGAGTGCACAAAATGGATAGTTG ATAATCAACTTAGTGATGGTTCTTGGGGTCTTCCT---CATCACCATCCA TTGTTAATAAAGGATACCCTTTCATCCACATTAGCATGCGTCCTTGCATT GAAGAAATGGGGAGTTGGTGAAACCCTGGTTAACAAAGGTCTGCAGTTTA TTGAATTAAATTCAACTTCATTAAATGATGAGAAACAACATACGCCAATT GGATTTGATATAATATTTCCTGCTATGCTTGAGCATGCTAAAGAGTTGGC TTTGAACCTGCCTTTGAAATCAGATGTTATAGATGCAATGCTCCACAGGA GAGATGTGGATCTTAAGAGTGGCTCTGGTGGCAGCAATACAGAGGGAAGA AAAGCCTACTTAGCTTACATTGCAGAAGGGATCGGAAAATTCCAGGATTG GGAAATGGTCATGAAGTATCAACGAAAGAATGGTTCACTGTTCAATTCAC CATCTACCACTGCAGCTGCTTTTAGTCATCTTCGTAATGCTGATTGTCTT CAGTATCTGCAGTCTGTTTTACAGAAATATGGAAATGCAGTTCCAACTAT TTATCCACTAGACGTATATTCTCGTCTTCTTATGGTTGACATTCTTGAAA GGTTGGGAATTGATCGGCATTTCAGGAAGGAAATAAAATTAGTACTGGAA GAAACATACAGATATTGGTTGCAGGGGAATGAAGAAATATTTCTAGATTG TATTACCTGCGCCATGGCATTTCGAATATTACGTGTCAATGGATATGATG TCTCTTCAGATGTATTTACCCAATTTACAGAGGAC---CATTTCTTCGAT TCGCTTGGAGGATATTTGAAGGACACGAGGACTGTGTTAGAGTTATACAG AGCTTCACAAATA---CTTTATCCGGATGAACCACTTTTGGAGAAACAAA ATTCATGGACAAATCATTTCCTGGAGAAGTGTCTATCCAGTGGTTCCAGT TATGCTGACGGACCCAGGGAATGTATTACTGAAGTGGTGCATAATGCTCT CAATTGTCCCTACTATGCAGATTTGGAACGTTTAACTAACAGGAGGAGCA TTGAGAAT---TATAATGTAGATGAAACAAGGATTTTAAAAGCCTCATAT CGTTGTTTGAACACTGGGAACCAACATTTTCTTAAACTGGCGGTGGAAGA CTTCAACCTCTGCCAATTGATACACCAGGAAGAACTTCAACAACTTGGGA GGTGGGTTGTGGAGAAAAGATTGAACAAGCTAAAGTTTGCCAGGCAGAAG CTGGGTTATTGTTACTTCTCTGCTGCAGCTACTCTCTTTGCTCCTGAATT ATCTGATGCTCGCTTATCATGGGCGAAAAACGGTGTGCTTACTACTGTTG TTGACGACTTCTTTGATGTTGGCGGTTCTGTAGAGGAACTGATAAACCTT ATCCAGTTGATTGAGAAGTGGGATGTAGACGAGAGCACTCACTTCTGTTC TGAGCAAGTTGAGATCATATTTTCAGCACTTCGCAGCACCATTTCTGAGA TTGGAGACAAAGCATTCACATGGCAAGGACGTAAAGTCACAAGTCATGTC ATCAAAATTTGGTTGGATTTGCTGAAGTCAATGTTGACGGAAACTCTCTG GACGAAAAGCAAGTCAATACCTACACTTGACGAGTATATGATTAATGGCT ACGTGTCATTTGCTTTAGGACCAATTGTCCTCCCAGCTCTTTTTCTTGTT GGACCTAAACTTACAGAGGAGGATGTTAGGGACCCTGAATTGCATGATCT GTTTAAAGCTATGGGTACCTGTGGGCGTCTCCTCAATGATTGGAGAGGAT TTCAGAGAGAATCCAAAGAAGGGAAATTGAATGCTGTCTCACTGCACATG ATTCAAGGAAACGGTGGTGTAAATGAAGAAGAGGCCATTAGAAAGATAAA GGGTTTAATTAACAGTCAGAGGAGTGAACTGCTGAGACTAGTTTTGCGGG AAAAGAACAGTAATATCCCAAGAGCATGCAAGGATTTGTTTTGGAAAATG ATCAAAGTGTTGCACCTTTTTTACTTGAAGGATGATGGATTCACTTCAAA TGAAATCAGTACTGCA------AATGCAGTGATTACTGAACCTGTCGCAT TCCATGGACCTTTTCTGTCGTGGCTTTTATCTGCCACTATTTATGTGCAT TCTATGCTAGAAAATATCAATCCACTATTTGATGGTTTGTCATATACGGT GTATGATGCTTCCTGGTTTTCACTAATGCAGGGAAAACCCATGGTAAGGG AAACAATGAATGCTGCAACATTGCATGTCTTCATGTCACTAGCAGCGGTG AAAGATACAACTGAGAAAGAT >O -------------------------------------------------- ----TTTCAGTTAGAATTAGTGAACGTCGTCATGCACCAGAGGAAAGCAA TAGAGGATACAAGGAAGAAGAAGAAGCAGCAGCTTCACAAATTCGAGATG TTGCCGTCTCCCTACGACACGGCATGGGTGGCCATGGTGCCTCTGCCCGG ATCATCATCTCAGCTTCCATGCTTCCCACAATGCGTTGAGTGGATACTAC AGAACCAGCAGAGCAATGGTTCTTGGGACCTC------AACCAGCTGGAC TCAATCACCAAGGATGCTCTCTTGTCCACACTGGCTTGTGTTCTTGCACT CAGGAGA------------------------------GGACTGCTTTTTA TTGGAAGGAATTTCTCCATTGCTATGGATGAGCAGCTGGCTGCTCCTATT GGATTCAATATAACTTTTCCTGGTATGCTTAGCTCTGTAATTGAGATGGG TTTGGAGGTTCCTATTGGACAAACCGACGTCGAAAGAGTACTTCATCTCC AGGAAACGGAATTGAAAAGAGAA---TATGAGGAGAACTATCGTGGGAGA AACACATATATGGCATATGTGTCAGAAGGATTAGGGAATGCCCAAGACTG GAATGAAGTTATGAATTTCCAGAGGAAGAACGGATCATTGTTCAACTCCC TTTCCATAACAGCTGCGGTGTTAGTCCATAATTATGATGCTAAAGCTCAC CGATACTTAAATTTGCTTCTGAACAAATTTGGCACTGCAGTG-------- -TATACGAAAAATATACATCGCCAACTTTCCATGCTTGATGCGCTTGAAA ATATGGGAATATCTCGGCATTTTGATGGTGAGATCAAGAGTATACTGGAC ATGACATACAGTTGTTGGTTACAGAGAGATGAGGAAGTTATGCTGGACAT CACAACATGTGCAATGGCATTTCGTATTCTTCGGATGAATGGATATGATG TTTCTTCTGATGACCTGTGTCATATCGCTGAAGTTTCTGATTTCCATAGT TCGCATCAAGGATATTTGAGTGACACAAGAACATTACTAGAACTATACAA GGCTTCAGAAGTCAGTGTTGCAGATAATGAGTTTATTCTAGATAGAATAG GCTCTTGGTCAGGTCGGTTACTGAAGGAACAGCTTAGCTCTGGTGCGTTG  105 CAAAGA---------ACTTCATCAATATTTGAAGAGGTGGAACATGCTCT TGACTGTCCGTTCTACGCAACATTGGATCGTCTAGTCCATAAAAGGAACA TCGAACAT---TTTGCC--------------------------------- ---------------------------------------GCGATGAGCTA TATATCATATGCTCAAAACAACATACCTGATGAACTTGAGCGTATAGACA GTTGGGTGAAAGAGAACAGACTTCATGAGCTGAAGTTTGCACGGCAGAAA TCTGCTTATTTCTATCTCTCTGCTGCTGGAACGGTTTTTGATCCAGAAAT GTCTGATGCTCGCATTTGGTGGGCTATAAACGGGGTGCTTACAACTGTCG TCGACGATTTCTTTGACGTTGGAGGATCAAGAGAAGAATTGGAAAACCTC ATTTCACTAGTAGAGATGTGGGATGAGCATCACAAAGAGGAGCTCTACTC TGAACAAGTAGAGATTGTATTTTTTGCCATCTTCAATTCAGTTAATCAGC TTGGAGCAAAGGTTTCTGCTGTACAAGGCCGTGATGTGACCAAACACCTA ATAGAAATATGGCTAGATTTGCTTAGGTCCATGATGACCGAGGTAGAATG GAGGATCAGCAACTACGTGCCTACACCAGAGGAGTACATGGAAAATGCGG CCATGACATTTGCATTGGGCCCAATTGTGCTCCCAGCTTTGTATCTTGTC GGACCAAAGATCCCTGAATCTGTCGTCAGAGATTCAGAGTACAACGAGTT GTTCAGACTGATGAGCACATGTGGTCGTCTCCTGAATGATGTTCAGACAT ACGAGAGGGAGGATGGCGAGGGCAAGGTGAACAGTGTGTCGCTGCTTGTC ATTCAGAGCGGCGGTTCAGTGTCCATCGAAGAGGCTAGAAGAGAGATCAT GAAGCCGATCGAGAGATGCAGGAGAGAGCTGCTGGGGCTGGTGCTCAGG- --AGAGGCAGCGCCGTCCCCGGGCCGTGCAAGGAGCTGTTCTGGAAGATG TGCAAGGTCTGCTATTTCTTCTACGCCCGTGGCGACGGCTTCAGCTCGCC GACGGCGAAGTCCGCCGCCGTGGACGCGGTGATCCGCGACCCACTCGATC TCGCCGCCGTCGTCGCAAGCCAAGAACCCATATATATCATTCCTGCTTCG -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------- >V -------------------------------------------------- -------------------------------------------------- --------------------------------TTTGACAAGGTTGAGCTT TCGGTATCTTCATATGACACAGCTTGGGTTGCTATGGTCCCTTCTCCA-- -TATTCCTCACAGGCCCCATACTTCCCGGAGTGTGTGAATTGGTTATTGG AAAATCAGTCTCATGATGGCTCATGGGGTCTTCCT---CATCCCCATCCC ATGTTAGTCAAAGATGCTCTTTCATCTACTTTGGCATCTGTCCTTGCACT CAAGCGATGGGGTGTTGGTGAAGAGCAAAGGAACAAGGGGCTCTGGTTTA TTGCATCCAATTTTGCTTCAGTTAGCGATGAGAAACAACATTCTCCAATT GGATTCGATATAATATTTCCTGGTATGATTGAGTATGCCAAAGAATTAGA TTTGAACCTCCCTTTGGGGCAAAGAGATGTAGATGCTATGCTTCAGAAGA GGGATTTGGAGCTCAAAGGAAGC---TTGGGAAGCAACACTAAGAGCAGA GAAGCCTACTTAGCATATATTTCGGAAGGAATGGGAAGGTTACAAGACTG GGAAATGGTTATGAAATATCAGATGAAGAATGGGTCTCTGCTCAATTCAC CTTCTGCCACAGCAGCTGCTCTTTCTCACCTTCAAAATGCGGGTTGTCTG AATTACCTTCGATCTCTTTTAGAGAAGTTTGGGAATGCAGTCCCAACAGT GTATCCTCTAGATTTATATGCTCGTTTATGTTTGGTTGACAATCTTGAAA GGTTGGGAATTGATCGGTATTTTAGGATGGAGATCAGAAGTGTATTGGAT GAAACATACAGATGCTGGCTGCAGAGGGAGGAAGAGATATTTGCAGACAG AGCCACCTGTGCAATCGCATTTCGGATACTACGTTTAAATGGATATGACA TCTCTTCAGTTCCATTAGCTCAATTTGCTGAAGACGATCAGTATTTCAAG ---TTTGGACAAGATTTTAAGGACTTGGGGGCTGCCCTTGAATTATTTAG GGCTTCAGAGATGATTATACACCCAGATGAAGTGGTTCTGGAGAAACAAA ACTCATGGTCAAGTCATTTTCTAAGACAGGGACTATCGAACAGTTCAATT CATGCAGATAGACTCAATAAGTACATTGCCCAAGAGGTGGAGGATGCTCT TAGGTTTCCCTACTACGCAAATTTGGATCGCATAGCAAACAGAAGAAGTA TTGAGCAT---TATAATGTAGATGATACAAGGATATTAAAAACTGCATAT CGCTCTTCACATGTCTGCAACAAAGATTTCCTAAAACTAGCAGTTGAAGA CTTCAATTTCTGTCAATCAATACACCAAAACGAACTCAAACAACTTGAGA GGTGGATTATAGAGAACAGATTAGACAAGCTAAAGTTTGCGAGGCAGAAG CTGGCCTACTGTTACTTCTCTGCTGCAGCAACCATATTCTCTCCTGAACA ATCTGATGCCCGCCTTTCGTGGGCCAAAAACAGTGTTCTCACAACTGTGG TTGATGACTTCTTTGACATTGGAGGCTCTGAAGAGGAGCTCCTAAACCTT ATTCAACTGGTTGAGAAGTGGGATATAGATGTAGCCGTGGATTGTTGTTC TGAACAAGTTGAGATCGTTTTTTCAGCACTCCACAGCACAATATCTGAGA TTGGAGTCAAAGCATCAGCATGGCAAGCCCGTAACGTGACCAGCCATATA ATTGATATCTGGCTGAAGTTGCTAAGATCTATGTTACAAGAAGCTCAGTG GGTGAGTAATAAATCAGCTCCAACAATGGATGAATACATGACAAATGCAT ATGTATCCTTTGCTCTGGGACCAATTGTCCTCCCGGCGCTCTATTTTGTT GGTCCTAAGCTTTCAGAGGAGGTTGTTGAGGGACCTGAGTGCCATAAACT ATATAAGCTTATGAGCACCTGTGGGCGTCTTTTGAATGATATCCACAGCT TTAAGAGGGAGTCCAAGGAAGGGAAAGCGAATGCTCTAGCACTACACATG ATACATGGCAATGGTGTCACTACTGAAGAACAGGCCATCAGAGAGATGAA GGGTTTAGTTAAGAGTCAGAGGAGAGAACTTCAGAGATTAGTTCTACAGG AGAAGGGTAGCACAGTACCAAGAATTTGCAAGGATTTATTTTGGAAAATG AGCAAAGTGTTGCACACATTTTATGAGAAAGACGATGGATTCACTTCACA  106 TGACCTCCGTGCTGTG------AAATCAGTCATTTATGAACCTGTTCTTC TTGCTGAATTC--------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ---------------------    GA.5.5.1.13.fasta >A TCTCTTCAGTATCATGTTCTAAACTCCATTCCAAGTACAACCTTTCTCAG TTCTACTAAAACA---------------------------ACAATATCTT CTTCTTTCCTTACCATCTCAGGATCTCCTCTCAAT--------------- ------------------GTCGCTAGAGACAAATCCAGAAGCGGT----- -------------------------TCCATACATTGTTCAAAGCTT---- -----CGAACTCAAGAATACATTAATTCTCAAGAG---------GTTCAA CATGATTTGCCTCTAATACATGAGTGG---------------------CA ACAGCTTCAAGGAGAAGATGCTCCTCAGATTAGTGTTGGAAGTAATAGTA ATGCATTCAAAGAAGCAGTGAAGAGTGTGAAAACGATCTTGAGAAACCTA ACGGACGGGGAAATTACGATATCGGCTTACGATACAGCTTGGGTTGCATT GATCGAT------GCCGGAGATAAAACTCCGGCGTTTCCCTCCGCCGTGA AATGGATCGCCGAGAACCAACTTTCCGATGGTTCTTGGGGAGATGCGTAT CTCTTCTCTTATCATGATCGTCTCATCAATACCCTTGCATGCGTCGTTGC TCTAAGATCATGGAATCTCTTTCCTCATCAATGCAACAAAGGAATCACGT TTTTCCGGGAAAATATTGGGAAGCTAGAAGACGAAAATGATGAGCATATG CCAATCGGATTCGAAGTAGCATTCCCATCGTTGCTTGAGATAGCTCGAGG AATAAACATTGATGTACCGTACGATTCTCCGGTCTTAAAAGATATATACG CCAAGAAAGAGCTAAAGCTTACAAGGATACCAAAAGAGATAATGCACAAG ATACCAACAACATTGTTGCATAGTTTGGAGGGGATGCGTGATTTAGATTG GGAAAAGCTCTTGAAACTTCAATCTCAAGACGGATCTTTCCTCTTCTCTC CTTCCTCTACCGCTTTTGCATTCATGCAGACCCGAGACAGTAACTGCCTC GAGTATTTGCGAAATGCCGTCAAACGTTTCAATGGAGGAGTTCCCAATGT CTTTCCCGTGGATCTTTTCGAGCACATATGGATAGTGGATCGGTTACAAC GTTTAGGGATATCGAGATACTTTGAAGAAGAGATTAAAGAGTGTCTTGAC TATGTCCACAGATATTGGACCGACAATGGCATATGTTGGGCTAGA---TG TTCCCTCCAAGACATCGATGATACAGCCATGGCATTTAGGCTCTTAAGAC AACATGGATACCAAGTGTCCGCAGATGTATTCAAGAACTTTGAGAAAGAG GGAGAGTTTTTCTGCTTTGTGGGGCAATCAAACCAAGCAGTAACCGGTAT GTTCAACCTATACCGGGCATCACAATTGGCGTTTCCAAGGGAAGAGATAT TGAAAAACGCCAAAGAGTTTTCTTATAATTATCTGCTAGAAAAACGGGAG AGAGAGGAGTTGATTGATAAGTGGATTATAATGAAAGACTTACCTGGCGA GATTGGGTTTGCGTTAGAGATTCCATGGTACGCAAGCTTGCCTCGAGTAG AGACGAGATTCTATATTGATCAATATGGTGGAGAAAACGACGTTTGGATT GGCAAGACTCTTTATAGGATGCCATACGTGAACAATAATGGATATCTGGA ATTAGCAAAACAAGATTACAACAATTGCCAAGCTCAGCATCAGCTCGAAT GGGACATATTCCAAAAGTGGTATGAAGAAAATAGGTTAAGTGAGTGGGGT GTGCGCAGAAGTGAGCTTCTCGAGTGTTACTACTTAGCGGCTGCAACTAT ATTTGAATCAGAAAGGTCACATGAGAGAATGGTTTGGGCG---TCAAGTG TATTGGTTAAAGCCATTTCTTCTTCTTTT------------GGGGAATCC TCTGACTCCAGAAGAAGCTTCTCCGATCAGTTTCAATACATTGCCAATGC TCGACGA---------------------AGTGATCATCACTTTAATGACA GGAACATGAGATTGGACCGACCAGGATCGGTTCAGGCCAGTCGGCTTGCC GGAGTGTTAATCGGGACTTTGAATCAAATGTCTTTTGACCTTTTCATGTC TCATGGC------CGC---GTTAACAATCTCCTCTATCTATCGTGGGGAG ATTGGATGGAAAAATGGAAACTATATGGAGAT------GAAGGAGAAGGA GAG----------------------------------------------- -CTCATGGTGAAGATGATAATTCTAATGAAGAACAATGACCTAACTAACT TCTTCACC------CACACTCACTTCGTTCGTCTCGCGGAAATCATCAAT CGAATCTGTCTTCCTCGC---CAATACTTAAAGGCAAGGAGAAAC---GA TGAGAAG------------------GAGAAG---------ACAATAAAGA GTATGGAGAAGGAGATGGGGAAAATGGTTGAGTTAGCATTGTCGGAGAGT GACACATTT---CGTGACGTCAGCATC------ACGTTTCTTGATGTAGC AAAAGCATTTTACTACTTTGCTTTATGTGGCGATCAT---CTCCAAACTC ACATCTCCAAAGTCTTGTTTCAAAAAGTC--- >P -------------------------------------------------- -------------------------------------------------- -----GTTTCTTTTTCATTAGGTGTTTGGTTGTAT--------------- ------------------GGGGCTAAAGACAAAAAAGATAACATT----- -------------------------CATACAAGGTGCAGTGCTATATCCA AGCCTCGCACTCAAGAATATGCAGATTTGTTTCAA---------CAACAA AATGGTCTGCCATTGATA---AACTGGCCTCACGATATT------GTGGA GGATGACGCAGAAGAAGATGCTGCTAAGGTCTCTGTA---------GCAA AGGAAATAAGCAAGCGCGTCAGAACTATTAAAGCAATGCTGGATATGATG  107 GAGGATGGAGAGATAAGCATCTCAGCTTATGACACCGCATGGGTTGCTCT TGTGGAAGATATTAATGGGAGTGGCCTTCCCCAATTCCCATCTAGCCTTC AGTGGATTGCCAACAATCAGCTTCCAGATGGTTCGTGGGGTGACGCTGGA ATATTTTTGGCGCATGATAGGTTGATTAATACGCTAGCTTGCGTGGTAGC ATTGAAATCTTGGAACTTGCATCAAGATAAATGCGAAAAAGGGATGTTAT TTTTTAGAGACAACTTATGCAAGCTTGAAGATGAAAATGCTGAGCACATG CCTATTGGATTTGAAGTTGCTTTCCCTTCACTTCTTGCGATAGCCAAAGA ATTAGACATCGAAGTTCCGGATGATTCTACTTTCCTTCAAGAGATTTATG CCAGGAGAAATTTAAAGCTGAAAAGGATTTCCAAGGAC---ATGCACAAT GTGCCCACGACCCTACTCCATAGCTTGGAAGGAATGCGAGGTCTGGACTG GAAACAGCTTATAAAATTGCAGTGCCTAGATGGGTCATTCTTATTCTCTC CATCCTCTACTGCCTTCGCACTCAGTCAAACTAAAGATAAAAACTGCTTG GAATATTTGAATAAGGCGGTCCAAAGATTCAAAGGGGGAGTTCCCAATGT CTACCCGGTTGACTTATTTGAGCACATCTGGGTTGTGGATCGCCTGCAGC GTCTTGGAGTCTCAAGATATTTCGTCTCAGAGATCAATGAATGTGTCGAT TATATTCATAGATATTGGACTGAAAATGGCATCTGTTGGGCGAGAAATTC TAATGTCCATGATATTGATGACACGGCCATGGGATTCAGGATACTTAGAT TACATGGGCACCAGGTTTCTGCCGATGTGTTCAAGCATTTTGAGAAAGGC GGTGAATTTTTCTGCTTCGCAGGGCAGTCAACAGGTGCTGTTACGGGAAT TTTCAACCTGTATAGGGCTTCTCAGGTTCTGTTTCCGGGAGAGAAGATAC TTGAGGATGCCAAGGAATATTCATTCGAATTCCTAAGGGAAAAACAAGCT GCTAATGAACTTCTAGATAAATGGATTATAACGAAGGACTTGCCCGGAGA GGTGGGTTTTGCATTGGAGATTCCATGGTATGCGAGCTTGCCTCGAGTGG AGACTAGATTCTTCATAGAACAGTATGGTGGCGAGGACGACGTGTGGATT GGCAAGACCCTTTACAGAATGTCATATATAAACAACAGTGAGTATCTCCA GCTGGCAAAATTAGACTACAACAACTGCCAAGCATTACATCGCATTGAAT GGGAAAATTTTCAAAAGTGGTATGAAGAATGTAATCTAAGAGATTTCGGG ATAAGCAGAAGAACCCTTATCTTTTCTTACTTTTTGGCAGCAGCCAGTAT CTTTGAGCCGGAAAGGTCCAAAGAGCGACTTGCATGGGCTACCACTACAG TCTTGCTCGACATTGTCGGCTCTTATTTCCCTGAGAATCATAACAATTCT AGCGAGCAGAGGAGAGCCTTCATACATGAATTCAGTTACGGTATTAGCAT AAATGGAAGGGAGGAAAATGATTATTTATGTCTGATTCTCGTGTGTTGCA GGAGGTCGGGT------AGAAAGAAGACAAGGCAGGAG------CTCGTT AAGCTGCTGCTTGGAACCCTAAATCAGCTCTCTTTGGGCGCATTAGTGGT TCATGGT------CGAGACATTAGCCACAGTTTACGCCATGCTTGGGAAA AGTGGCTCTTGATCTGGGAATTGGAAGGAGATAGACGCCAAGGGGAAGCA GAA----------------------------------------------- -CTACTAGTGCAAACAATAAATCTCACCGCCGGCTATTTGGTCTCCGAGG AGCTCTTGGCCCATCATCCTCAGTATGAACAACTCGTCGACCTGACAAAC AGAATATGCTATCAACTTGATCATTACAAGAAAAACAAGGTACATTACAA TGGAAGCTACAGCACTATTACCAGTAATACTGACAGAATTACAACCCCAC AAATAGAATCAGACATGCAAGAACTTGTGCAGTTAGTAGTCCAAAATCCC TCAGATGGA---ATAGATTCTAATATCAAGCAAACGTTCCTTCAAGTAGC CAAGAGTTTTTATTATTCTGCAATCTGTGATCCTGGGACTATCAACTATC ACATAGCTAAAGTGCTCTTTGAGAGAGTGCCT >R TCTTCTCAATCCCTTCACTTCCTCTCTACCGCCTCTTCTTTCTCC----- ----------------------------------------ACTCCCAATT CTCGTCCTCTACTCTCCTCTGGTGGTGGGCTTTTC--------------- ------------------GGGGTTAAAGACACAAGAATTACCTTTGAT-- ----------------------GTTCGTCCAAGATGCAGTGCACTATCCA ATCCACCCACTCAGGAATACCCAGATGTCTTTCAA------------AGA AATGGTGTGGCAGTGATA---AAGCGC---CGTGAGGTT------GTGGA AGATGCCATAGAAGAGCAAGTTACTAAGATTTCCGTA---------TCGA ATGAGATCCTTAAACGTGTCCAAAACGTTAAATCGATGTTGGATTCGATG GAAGATGGAGAGATAAGCATATCAGCTTATGATACAGCATGGGTTGCTCT TGTTGAAGATATTAATGGAAGTGGTGCTCCTCAATTCCCGTCCAGTTTGC AATGGATTGCTAATAATCAACTATCTGATGGTTCGTGGGGCGATGGTGAT ATCTTTACTGCGCATGACAGGATTCTCAATACATTAGCTTGTGTTGTTGC CTTGAAATCATGGAACATACATCCTGATAAGTGTGAAAGAGGAATGAAGT ATTTTAAAGAAAACTTATGCAAGCTTGAAGATGAGAATGCTGAGCACATG CCCATTGGTTTTGAAGTTGCTTTCCCTTCACTTCTTGAGTTAGCAAAAAA TTTAGACATTGAAGTTCCCGAGGATTCTCCAGTCTTGAAAGAGATCTATG CCAGCAGAAATATAAAGCTAACAAAGATACCAAAAGACATAATGCACAAA GTGCCCACCACACTACTCCATAGCTTGGAAGGAATGCCAGGTCTGGAGTG GGAAAAGCTTCTGAAATTGCAGTGCCCAGATGGGTCATTCTTGTTCTCTC CATCCTCCACTGCTTTTGCACTCATGCAAACTAAAAATGAAAATTGCTTA GCATATCTAAACAAGATCGTTCAAAGATTTAATGGAGGAGTACCAAACGT CTACCCTGTTGACTTATTCGAACATATCTGGGCTGTTGATCGCGTTCAAC GCCTTGGAATATCGAGATATTTCAGAAAGGAGCTTAAAGAATGTATTGAC TATGTTGCCAGATACTGGGAAGAAGATGGTATTTGCTGGGCAAGAAATTC TGCAGTTCATGATATTGATGACACAGCCATGGGATTCAGGTTGCTTAGAC TATATGGCCACGAAGTTTCTTCTGATGTGTTCAAGCATTTTAAGAAAGGC GATACTTTCTTCTGCTTCGCCGGACAGTCAACGCAGGCTGTTACCGGAAT GTACAACCTGTATAGAGCTTCTCAGGTATTGTTTCCTGGAGAAAAAGTCC  108 TCGAGGAAGCCAAGGAATACTCGTCCAGTTTCCTAAAAGAAAAGCAAGAG GCTAACGAAGTACTTGACAAATGGATTATAACGAAAGACTTGCCGGGAGA GGTTAAGTATGCATTGGATATTCCATGGTACGCGAGCTTGCCTCGGGTGG AGTCGAGATTCTACTTGGAACAGTACGGTGGTGAGGATGATGTCTGGATC GGCAAGACTCTTTATAGGATGCCGTATGTGAACAACAATGAGTATTTGGA CCTTGCAAAGCTTGACTACAACAATTGCCAAGCGTTACATCGCAAGGAGT GGGACAACTTTCAAAAGTGGTACGAAGAATGTGAATTGGGAAACTTTGGG GTAAGCAGAAGAGAACTGCTGTTAGCATATTTTGTAGCGGCGGCCAGCAT TTTTGAGCCAGAAAGGTCAAAAGAGAGACTTGCATGGGCTAAGACCACAA CCTTGCTCCATACAATCGAGTCTTATTTT---GATGCCAGCAACAGTACC TATGAGCAAAGGACGGCTTTTGTCCACGAATTCAAAAACGGTGTCGCA-- ----------------------------TCCATACCCCACTTAAATGCAA GGAAGTTG---------GAAGTAAAGACAAATGAGGAA------CTTGTC AGGATAGCGATTGGAATCCTAAACGATGTCTCTTTGGATACACTACTGGC TCATGGG------AAAGACATTAGCCACGATTTACGTCATGCTTGGGAAA AGTGGCTGTTGAAGTGGGCAGAAGGAGGAGAAATACACCAAGGAACAGGG GAA----------------------------------------------- -TTGCTAGTGAAAACAATAACTCTCACCGCTGGAGGTTCCACACCTGAT- --------------CATCATAAATATGCACAGCTCTTTCAACTGACAGAT AAATTATGCTATCAGCTGGCTCATTACAGAAAAAACAAGGTACAAGGCAA TAAGAAAAGC------------------------------ACAACCCCAG AAATAGAGTCAGACATGCAACAACTTGTGCAGTTAGCAATCCAAAATTCC TCAGATGAA---ATAGATTCCGAGATCAAGCAAACATTTTTCATGGTAGC CAAAAGCTTTTACTACCAAGCCATCTCTGATCCTGGGACTTTGAACTACC ATATTGCTAGAGTACTCTTTGAGAGAGTATAC >O ---ATTCACCTCCACTCCCCGCCGACGGCGCCCGCCGCATTCGGCGGCGC CGGCTCGGCGGACTGGCGGCGGCGGCGGCGGTGGTCATGGTCGTCGTCGT CCCGCGCTCCGGTGGCTAAAGGTGGCCATCTTCGTCCGTGCGTTTGGCGG CGCGGCGGCGACGACGGCGGCGGCGAGGATCATCACGCCGACGGCGGCGG CGGCGGCGGAGGAGGAGCGGCGTGGAGGGCGCGGGCCACCACCGCCGGCG TGTCGAGCTCCAGCAGTACAGCCAAAGGGCTGCAAGCCAACATCATCGAA CATGAGACCCCCCGGATCACGAAATGGCCCAATGAATCACGCGACCTCGA CGATCACCAACAAAACAACGAGGCTGATGAGGAGGCA---------GATG ATGAGCTGCAGCCACTGGTCGAGCAGGTGAGGTCGATGCTGTCGTCCATG GAGGACGGCGCGATCACCGCGTCGGCGTACGACACGGCGTGGGTGGCGCT GGTGCCGCGGCTGGACGGCGAGGGCGGCACGCAGTTCCCGGCCGCCGTGC GGTGGATCGTCGGCAGCCAGCTCGCCGACGGGTCGTGGGGCGACGAGGCG CTCTTCTCCGCCTACGACCGCGTCATCAACACCCTCGCCTGCGTCGTCGC CCTCACCAGATGGTCCCTCCACCATGACCAGTGCAAGCAAGGGCTTCAGT TTCTGAATCTGAACTTGTGGAGGTTAGCAGAGGAGGAGCCGGATACGATG CCGATTGGGTTTGAGATTGCATTCCCTTCTCTTGTGGAGGCAGCTAGGGG TTTGGGTATTGATTTCCCATATGATCACCCTGCTCTCAAGGGCATTTATG CAAACAGAGAACTCAAGCTTAAGAGGATTCCAAAGGACATGATGCATATA GTCCCAACTTCAATTCTGCATAGCCTTGAAGGGATGCCTGGGCTGGATTG GCAGAGGCTTCTGAAGCTCCAATGCAGTGATGGATCCTTCTTGTTCTCCC CTTCAGCTACTGCTTATGCTCTCATGCAGACCGGTGACAAGAAATGCTTC GCGTACATCGACAGGATCATTAAGAAATTCGACGGAGGCGTTCCGAACGT TTACCCGGTCGATCTTTTTGAGCACATATGGGTTGTCGATCGGTTGGAGC GTCTTGGGATATCGCGGTACTTCCAACGAGAGATTGAACAGAACATGGAC TATGTCAACAGGCACTGGACTGAAGATGGGATTTGCTGGGCTAGGAACTC CAATGTAAAAGAAGTGGATGACACCGCTATGGCTTTCCGTCTACTACGCC TCCATGGATACAATGTATCACCAAGTGTGTTCAAGAATTTTGAGAAGGAT GGGGAGTTCTTCTGTTTTGTGGGGCAATCAACTCAAGCAGTCACTGGGAT GTATAACCTGAACAGAGCATCTCAGATAAGTTTTCCAGGAGAAGACATTT TGCAGCGTGCAAGGAATTTCTCATATGAGTTCCTTAGAGAAAGAGAAGCC CAGGGGACACTTCATGATAAATGGATCATCTCCAAGGACCTACCAGGAGA GGTACAATACACACTAGATTTTCCTTGGTATGCGAGCTTGCCACGCGTCG AGGCAAGAACATACATAGGTCAATATGGTGGAAATGATGACGTCTGGATT GGAAAGACACTCTACAGGATGCCAATTGTGAATAACGCTACATATCTCGA GTTGGCGAAACAGGATTTCAACCGTTGTCAAGCTCTACATCAGCATGAGT TGCAGGGTCTACAAAAGTGGTTCATTGAGAATGGCCTGGAAGCTTTTGGG ATGACACCTGAAGATGTTTTGAGAGCTTATTTTTTGGCTGCCGCGTGCAT TTTCGAACCAAACCGTGCCTCTGAGCGACTTGCATGGGCTAGAGTGTCAG TGCTGGCCAACACTATTTCTAGGCATTTT---------TACAGCGATATG TCAAGCATGAAAAGG------ATGGAGCGTTTCATGTGGAGC-------- ----------------------------AGCCTCTATGAAGAAAATGGCA ATGTTTTGGGG------CTAGAAGGATATGCAAAAGATGGAATCCTTGCG AGGACACTTTGTCAACTTATAGATTTGTTGTCTCAAGAGACACCGCCAGT TCGAGAAGGTCAAAAGTGTATTCATAATCTCATAAGATGTGCTTGGATTG AATGGATGATGCAACAAATCAATATGAAGGATGGCAGATATGACAAAGGC AGAGTTATGCATCCAGGGTCATGCACTGTTCATAATAAAGAAACATGTTT ACTTATTGCTCAAATTGTTGAAATTTGTGCTGGACGAATTGAGGAGGCAG CATCTATGATAAATAACACCGAAGGTTCTTGGTTTATTCAACTTGCTTCC TCTATTTGCGATTCTCTT---CATGCCAAGATGTTACTTTCACAG---GA  109 TACCAAGAAAAATGAGACAACAATAAATCAA---------ATTGACAAGG AAATTGAGTTGGGTATGCAAGAACTTGCTCAATATCTTCTTCCAAGAGTT GATGATAGAAGAATTAACAACAAAACCAAGCAGACCTTCTTGAGCATTGT GAAAAGCTGTTACTATGCTGCCAATTGCTCACCACATATGCTTGACCAAC ACATTTCTGAAGTGATTTTTGAGCAAGTTATT >V TCTTCTCAATCCACTATTCTCTTCCGCGCTCTCTCTCCAAAGGGTCCCCT ACCTTCT---------------------------------CCTTCCTCTT CGACACCCAAATATGCTGCTGGTACTGGATGGTGG--------------- ------------------GTGGCTAAAGACAAAAGGGCTCACTTCAAT-- ----------------------TTAAGGAGAGAGTGCAAGGCCTTACCAA AACCCCAAACTCAAGAATACGTGGACGTATTTCAA--------------- AGTGGTCTGCCAGTGATA---AAGTGG---CATGAGATT------GTGGA AGATGATATAGAAGAGGAAGCTTTCCAGAAGGTTTGT------AGGTCAA ATGAGATTAAGGAACGTGTGGATTCCATAAAATCGATGCTGAGTTCAATG GAAGATGGAGAGATCAGCATATCGGCTTATGACACAGCCTGGGTGGCTCT CGCGCAGGACCTCAATGGAGGAGGGACTCCGCAATTCCCATCAAGCCTAG AGTGGATCGCCAACAATCAGCTCATGGACGGGTCATGGGGAGACGACTGC TTATTCTATGCTCACGACCGGATAATCAACACATTGGCGTGTGTGATCGC ATTGAAATCGTGGAAAATTCATCCGAACAAGTGCGAGAAAGGGGTGTCAT TCATCAAAGAAAACATAAGCAAGCTTGAAAAGGAGAAGGCTGAGCACATG CCTATAGGATTCGAAGTAGCTTTCCCTTCTCTCCTCGAGATAGCTTGGAA CTTGGGCATCGAAGTACCCAATGATTCGCCCTTCTTGAAGGAGATCTACG CCCAGAGAAATCTGAAGCTCACAAAGATACCATATGACATAATGCACATA GTGCCCACAACACTACTCCACAGCTTGGAAGGAATGGCAGGTCTAGACTG GGAAAAGCTTCTAAAACTACAGTGTCAAGATGGGTCATTTTTGTTTTCTC CATCGTCCACTGCCTATGCCCTCATGCAGACCCAAGATGAGAATTGCTTT AGATACCTAAACAAAGTGGTTGAGAGATTCAGTGGAGGAGTCCCCAATGT TTACCCTGTCGACTTGTTTGAGCACATATGGGCTGTGGATCGGCTGCAGC GCCTTGGGATATCGCGGTATTTTGAGCCTGAGATTAAAGAATGCATCAAT TATGTTGCCAGATATTGGAAAGAAAATGGAATCTGCTGGGCTAAAAACTC CGAAGTTCACGATATTGATGACACTGCTATGGGGTTTAGGCTCCTTAGGT TACATGGCCATGATGTTTCTGCTGATGTGTTCAAGTATTTTGAGAAAGGT GGTGAGTTCTTCTGCTTTGCTGGGCAGTCATCCCAGGCTGTGTCCGGGAT GTTCAACCTCTACAGAGCTTCCCAGGTGCTGTTCCCTGGAGAAACCATTC TTGAGAATGCCAAGAAGTTCTCTTCCAAGTTTCTAAGGGAAAAACAAGCT TGTGACCAGCTCCTGGATAAGTGGATCATAATGAAGGATTTGCCTGGTGA GATAGGGTATGCGCTGGATGTTCCATGGTATGCAAGCTTGCCTCGTGTGG AGACCAGAATTTATATTGAACAGTACGGTGGAAAAGATGATGTATGGATT GGCAAGACCCTTTACAGGATGCCTTATGTAAACAATAATGATTATCTTGA GCTTGCAAAACTGGACTTCAATAACTGCCAAGCCCTGCATCAGCTTGAAT GGGACAGCATTCAACAGTGGTACACGCAATGCCATCTTGGGGAGTTTGGG GTTAGCAGAAAAGCCTCTCTCTTGGCTTATTTTCTAGCAGCAGCCTGCAT ATTTGAGCCTGAAAGGTCAATTGAGAGGCTTGCTTGGGCGAAAACCGCCA TCTTGGTCTTGGCAGTCCGGTCGTATTTC------AGCAAGGAAACATTT ATTAAGCAGAGGAGAGCCTTCCTTCTTAAATTTGGATACAGCCCAAGTGG AGGAGAC---------------------TACATGAAGAAGATCAATGGAA GGCCTGTGGGATTCCTTAAGAACAAGAGCGGAGAGGAA------CTTGTC GGACTCTTACTCGGAACCTTAAATCAACTCTCATTGGATACACTGGTGGC TCATGGC------AGAGACATACGACACATCTTACGTCAAACTTGGGAG- --TGGCTGATGAAACATTTGGATGAAGGAGATGGGTACCGAGGAGAGGCA GAG----------------------------------------------- -CTCCTGGTGCGGACCATAAATCTCTGTGCTGGTCGGTCTCTCTCAGAGG AGTTGTTGGCT---CATCCTCAGTACAGGCGTCTCTCTCAACTCACTAAC AGAATCTGCAACGATCTTGGTCTCTTTACATTGCACAAGGGTCAC---AA TGGCACCTACAATCCAGAAAATGGCAGCCCT---------ATGAGCCATA GGGTAGAGTCAGACATGCAAGAACTTACGAAGATAGTGCTGGAAAACTAC CCTGATGGC---ATCAACCCAGAAATCAAGAGGACTTTTGAGATGGTGGG CAAGAGTTTCTACTATGCTGCCTACTGTGGACCTGCAACTATCAGTGCTC ATATTGCTAAAGTCCTCTTTGAGAGAGCAGCC    GLY.2.7.2.3.fasta >A ---GCTTCCGCTGCCGCAAGTTCCGCCTTTTCACTCCTTAAGTCCACCGG CGCTGTTGCTTCCTCCGCCGGAACTCGCGCACGTGCCTCCCTTCTGCCAA TTCCCTCTACCTCTGTT---------TCCGCGCGTCCTCTAGGCTTCTCC GCCACTCTAGATTCCCGTCGTTTCTCTCTCCACGTTGCTTCCAAAGTTGA A---------TCGGTGCGTGGGAAGGGAAGCAGAGGAGTGGTTTCTATGG CGAAGAAGAGCGTCGGAGATCTGACCTCAGCTGATTTGAAGGGGAAGAAG GTTTTCGTGAGAGCTGATCTCAATGTACCTCTCGAT---AATCAGACTAT CACTGACGATACCAGAATCCGTGCCGCCATTCCAACGATCAAGTATTTGA TTGAAAATGGTGCTAAAGTTATCCTCTCCACTCATCTGGGAAGGCCAAAG GGAGTCACCCCAAAGTTTAGTTTGGCTCCTCTTGTCCCTAGGCTCTCCGA  110 GCTTCTTGGTATTGAGGTCACGAAAGCTGATGATTGTATTGGCCCAGAAG TGGAAAGCTTGGTGGCTTCTCTACCA---GGTGGAGTTTTGCTTCTTGAG AACGTCAGGTTTTACAAGGAGGAAGAGAAGAACGATCCTGAGTTTGCTAA GAAGCTTGCTTCTCTAGCTGACCTTTATGTCAATGATGCTTTCGGAACTG CTCACAGAGCTCATGCTTCTACCGAAGGAGTCACTAAGTTCTTGAAGCCT TCAGTTGCTGGTTTCCTTTTGCAAAAGGAACTGGACTACCTAGTTGGTGC TGTTTCAAACCCAAAGAGACCATTTGCAGCCATAGTGGGTGGTTCCAAAG TCTCATCCAAGATTGGAGTTATTGAATCGCTTCTGGAGAAGTGTGATATT CTTCTTCTTGGTGGTGGAATGATCTTCACATTCTACAAGGCACAGGGTCT TTCAGTTGGTTCGTCCCTTGTTGAAGAAGACAAGCTTGAATTGGCTACAG AACTCCTTGCCAAAGCTAAGGCCAAAGGAGTCTCTCTTTTGTTGCCAACA GATGTTGTAGTTGCTGACAAGTTTGCTCCTGATGCCAACAGCAAGATTGT GCCTGCATCAGGCATTGAGGACGGATGGATGGGACTGGACATTGGTCCAG ACTCTATCAAAACTTTCAACGAAGCTCTGGACACAACACAAACAGTCATT TGGAATGGACCTATGGGAGTTTTCGAGATGGAAAAGTTTGCGGCTGGAAC AGAGGCGATAGCGAATAAACTAGCAGAGCTAAGTGAAAAAGGAGTGACAA CGATAATAGGAGGAGGAGACTCAGTGGCTGCAGTGGAGAAAGTAGGAGTA GCAGGAGTCATGAGTCACATCTCCACTGGTGGTGGAGCCAGCTTGGAGCT GTTGGAAGGAAAAGTACTTCCCGGTGTGATCGCCCTTGATGAAGCAATCC CAGTCACTGTT >P ATGGCCTCCGCCACAGCACCAACAACTCTCTCTCTCCTTAAAACA----- ----GCCGCCTCCTCCACCTCCACATCTGTCCGGGCCTCCCTACTCCCAG TCTCCACCTCCGGCCTCCGCACAACCAGCCTCCGGGGTCTTGGTTTCTCT GCTGCA---GACACA---TTGTTTAGCTCTCATGTGGTGTCCAAAATACG A---TCTTTCAAGTCAAATGGTAAAGCACCAAGAGCAGTGGTGTCTATGG CAAAGAAGAGTGTTGGTGACTTGACAGCTGCTGATTTGAAAGGGAAGAAA GTCTTCGTTAGAGCTGATTTGAATGTGCCTCTTGATGATAATCAGAATAT TACTGATGATACTAGAATTAGAGCCGCTATCCCTACTATTAAATACTTGA TTTCAAATGGGGCTAAAGTTATTCTTTCTAGTCATCTGGGACGACCAAAA GGTGTTACTCCAAAATTCAGCTTGGCACCTCTTGTACCCCGGTTATCTGA ACTCCTTGGAATTCAGGTTGTGAAAGCTGATGATTGCATTGGCCCAGAGG TAGAAAAATTGGTTGCTTCACTTCCTGATGGTGGTGTTCTTCTTCTTGAG AATGTCAGGTTTTACAAGGAAGAAGAGAAGAATGAACCTGAATTTGCAAA GAAGCTTGCTTCCTTGGCAGATCTTTATGTAAATGATGCATTTGGAACTG CACATAGAGCACATGCCTCCACTGAGGGGGTCACAAAATTCTTGAAACCA TCTGTTTCTGGTTTCCTCTTGCAGAAGGAGCTGGACTACCTTGTTGGGGC AGTTTCAACCCCAAAGAGGCCATTTGCTGCCATTGTGGGTGGTTCCAAGG TCTCATCCAAGATTGGAGTCATTGAGTCACTCCTGGAGAAGTGTGATATC CTTCTTTTGGGTGGAGGTATGATTTTCACATTTTACAAGGCTCAAGGCCT CCCAGTAGGTTCATCCTTGGTTGAGGAAGATAAGCTTGGTTTGGCAACAT CGCTCCTTGAGAAGGCCAAGGCAAAAGGAGTGTCTCTTTTGCTACCCAGT GATGTGATAATTGCAGACAAGTTTGCTCCTGATGCAAATAGCAAGATTGT ACCTGCATCAGCCATCCCAGATGGTTGGATGGGACTGGACATTGGACCAG AATCTGTGAAGACATTCAGTGAAGCTTTGGGAACCACCCAAACTGTCATC TGGAACGGACCCATGGGAGTGTTTGAGTTTGACAAGTTTGCAGTTGGGAC AGAGGCCATTGCAAAGAAGCTTGCTGAGCTTAGCGGCAAGGGAGTTACAA CTATTATTGGAGGTGGAGATTCTGTTGCGGCTGTAGAAAAAGTAGGAGTT GCTGATGTTATGAGCCACATATCAACTGGCGGTGGTGCCAGCTTGGAGTT GTTGGAAGGGAAAGAGCTTCCAGGTGTCCTTGCACTAGATGAAGTCGAAC GAGTTGCTGTG >R ---GCCTCTGCTACAGCACCCACTACCCTTTCTCTTCTCAAGACT----- -ACTGCTTCTTCTTCCTCCACCACCCGGGCCCGCGCTTCCCTTCTCCCTG TTTCTGGCCTCCGCCCC------ACCACTCTTCGCCGTCTCGGCTTCGCT GCTGCT---GACCCT---GCTTTTTCTCACCACGTTGCATCAAAAATCCG T------TCTTTTGGTTCTGGCAAGGCGTCCAGGGCTGTTGTCTCCATGG CTAAGAAGAGCGTTGGTGATCTGACTGCTGCTGATTTAAAAGGGAAGAAG GTTTTTGTAAGGGCTGATTTGAATGTTCCTTTGGATGATAACCAGAAAAT TACTGATGATACTAGAATTAGAGCTGCTATCCCTACTGTTAAGCATTTGA TTCAGAATGGGGCTAAAGTCATTCTTTCCAGTCATTTGGGAAGGCCAAAA GGTGTTACTCCAAAATTCAGCTTGGCACCACTTGTTCCCCGATTATCAGA ACTCCTTGGCATTCAGGTTGTGAAGGCTGATGATTGTATTGGTCCAGAAG TAGAAAAATTGGTGGCTTCACTTCCTGAAGGAGGTGTTCTTCTCCTGGAG AATGTGAGGTTTTACAAGGAGGAGGAAAAGAATGAGCCTGAATTTGCGAA GAAGCTGGCTTCCTTAGCAGATCTCTATGTGAATGATGCATTTGGAACTG CACATAGAGCACATGCCTCAACCGAGGGAGTTACAAAATTCTTAAAGCCT TCTGTTGCTGGCTTCCTCTTGCAGAAGGAGCTGGACTACCTGGTAGGTGC AGTTTCAAGCCCAAAGAGGCCATTTGCTGCCATTGTTGGTGGTTCAAAGG TCTCATCAAAAATTGGAGTTATTGAGTCACTCCTTGAGAAGTGTGATATT CTGCTTTTGGGTGGAGGAATGATTTTCACATTTTACAAGGCACAAGGCCT GTCAGTGGGTTCATCCCTGGTTGAGGAAGATAAGCTTGATTTGGCAACAT CTCTCCTTGCGAAGGCCAAATTGAAAGGAGTGTCTCTTTTGTTACCCACT GATGTGGTAATTGCAGACAAGTTTGCTCCCGATGCAAACAGTAAGGTTGT GGCTGCCTCAGCCATCCCTGATGGCTGGATGGGATTGGATGTCGGCCCAG  111 AATCTGTTAAGACATTCAATGAAGCTTTGGAAACCACTAAAACTGTCATC TGGAATGGACCAATGGGAGTGTTCGAGTTTGACAAGTTTGCAGTTGGAAC AGAGGCTATTGCAAAGAAGCTAGCAGAGCTCAGTGGCAAGGGAGTCACCA CAATTATTGGAGGTGGAGATTCTGTTGCAGCTGTAGAGAAAGTAGGAGTT GCTGAGGTTATGAGCCACATATCAACTGGTGGTGGTGCGAGCTTGGAATT GTTGGAAGGCAAAGAGCTTCCAGGTGTTCTTGCTCTTGATGAAGCTACAC CAGTTGCTGTG >O ---GCGTCCGCGGCCGCGCCGACCACGTCCTCGCTCTCCCTCGCC----- -GCCAGGCGCGCCGCGGCGGTGGGGCCCGCCGCCGCGTCGCCGCTACGGC GCGGGGGGCTGGCGGCCGGGTGCCAGCCGGCGCGGTCGCTGGCGTTCGCG GCGGCCGCGGACCCG---CGGCTGGCGACCCACGTCGCGTCGCGGTGCCG GCAGGCGGCGTCGTCGTCCTCGCGCGGGACGCGCGCCGTCGCCACCATGG CGAAGAAGAGCGTCGGGGACCTCACCGCCGCCGACCTCGAGGGGAAGCGC GTGTTCGTGCGCGCCGACCTCAACGTCCCGCTCGACGACAACCAGAACAT CACCGACGACACCCGTGTCCGCGCCGCCATCCCCACCATCCAGTACCTTA TCAAGAACGGTGCCAAGGTCATCCTCTCCAGCCACCTGGGTCGCCCAAAG GGTGTTACTCCCAAGTTTAGCTTGGCTCCCCTTGTACCGCGATTGTCTGA ACTTCTCGGCATACAGGTGACTAAGGCAGAAGATGTTATTGGACCAGATG TTGAGAAATTGGTATCTGAATTGCCAAATGGTAGTGTTTTGCTCCTTGAA AATGTTAGATTTTACAAGGAAGAGGAGAAGAATGACCCAGAGTTTGCCAA GAAGCTTGCCTCCTTAGCAGATCTCTATGTCAATGATGCATTCGGAACAG CCCACAGAGCACATGCATCAACTGAGGGAGTTACCAAGTTTTTAAAGCCT TCTGTCGCAGGATTCCTTTTGCAGAAGGAGCTTGACTACCTTGTTGGAGC TGTTTCAAGCCCTAAACGCCCATTTGCTGCCATCGTGGGTGGTTCAAAGG TGTCATCCAAGATTGGGGTTATCGAATCCCTTTTGGAGAAATGTGATATC CTTCTTCTAGGTGGTGGTATGATCTTCACATTTTACAAGGCACAAGGACT CTCTGTTGGTTCTTCCTTGGTTGAGGAAGACAAACTTGAGCTTGCAACAT CTCTCCTTGCAAAGGCAAAAGAAAAGGGTGTCTCCCTTCTGTTGCCATCT GACGTTATCATTGCTGATAAGTTTGCTCCTGATGCTAACAGCCAGGTTGT TCCAGCATCTGCTATTCCTGATGGTTGGATGGGTCTGGATATTGGTCCAG ATTCAGTCGCGTCATTCAGCTCTACCCTGGAAACAACACAGACAGTCATT TGGAATGGACCTATGGGTGTCTTCGAATTTGACAAGTTTGCAGTAGGAAC TGAGGCTATTGCAAAGAAGTTGGCAGACCTTAGCGGCAAGGGTGTTACAA CCATTATTGGAGGAGGTGATTCTGTTGCCGCTGTTGAGAAGGTGGGAGTT GCAGATGTTATGAGCCACATTTCAACGGGAGGTGGTGCTAGCTTGGAGCT GTTGGAAGGAAAGGAACTTCCTGGAGTCATTGCACTTGATGAAGCTGTCA CTGTGGCCGTA >V -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------G CCAAGAAGAGCGTGGGTGACCTCACGGGGGCGGATTTGAAGGGGAAGAAG GTGTTTGTGAGGGTGGATTTGAATGTGCCTCTTGATGACAACCAGAAGAT TACTGACGATACCAGGGTTCGAGCTGCCATTCCCACTATCAAGTATTTGA TCGACAATGGTGCTAAAGTCATTCTTTCTAGCCATTTGGGAAGACCAAAG GGAGTAACTCCAAAATTCAGCTTGGCGCCTCTTGTGCCAAGGTTATCTGA GCTTCTTGGCATTCAGATTGTGAAGGCTGATGACTGTATTGGCCCAGAGG TAGAAAAGTTAGTGACTGCACTTCCTGATGGTGGTGTACTCCTTCTCGAG AATGTGAGGTTTTACAAGGAGGAAGAAAAGAATGAACCCGAATTTGCAAA GAAGCTTGCCTCCATAGCTGATCTCTATGTGAATGATGCATTTGGTACTG CACATAGAGCCCATGCCTCAACTGAGGGGGTCACTAAGTTCTTGAAGCCA TCTGTTGCTGGTTTCCTTTTACAGAAGGAACTGGACTATCTCGTTGGGGC AGTTTCAAGCCCAAAGAGGCCATTTGCTGCCATTGTGGGTGGTTCAAAGG TCTCATCCAAGATCGGAGTCATTGAATCTCTCCTCGAAAAGTGTGATATC CTACTTCTAGGTGGAGGAATGATCTTCACATTTTACAAGGCACAGGGTCT CTCAGTGGGTTCATCCCTGGTAGAGGAAGATAAGCTAAGCCTTGCTACAT CACTTCTCGAGAAGGCCAAGGCAAAAGGAGTATCTCTCCTGCTACCCACC GATGTTGTGATTGCTGACAAGTTTGCCCCTGATGCAAACAGCAAGATTGT GCCAGCATCAGCCATTCCTGATGGATGGATGGGATTGGATATTGGACCTG ATTCTATTAAGATATTCAATGAAGCTTTGGAGACCACCAAAACAGTTATC TGGAACGGACCGATGGGAGTGTTTGAGTTTGATAAGTTTGCAGAAGGAAC AGTGGCCGTTGCAAAGAAGCTAGCGGAGCTGAGTGGGAAGGATGTGACAA CAATCATTGGAGGTGGAGATTCTGTTGCAGCTGTGGAGAAAGTAGGAGTC GCTGATGTGATGAGCCACATATCAACGGGTGGAGGTGCCAGTTTGGAGTT GTTGGAAGGGAAAGAACTCCCTGGTGTTGTTGCCCTTGATGAAGCTACTC CAGTTCCAGTG    GLY.4.1.2.13.fasta >A ------GCGTCTGCTAGCTTCGTTAAGCCTAACACCCTCTCTTCTCCATG  112 GATCGGCCAACGC---TCCTTTGCTCACACCTCTGCTTCTTCTTCT---- --------CCTCCTCCTCGAGTCTCCTTCGCGATCCGCGCCGGT------ GCTTACTCCGACGAGCTTGTTAAAACCGCCAAAAGCATTGCATCCCCTGG GAGAGGTATCTTGGCGATCGATGAGTCCAATGCAACCTGTGGGAAGAGGC TTGCTTCTATCGGCTTGGATAACACCGAGGACAACCGTCAGGCCTACAGG CAACTTCTGCTTACCACTCCTGGCCTCGGCGATTACATCTCTGGTTCCAT TCTCTTCGAGGAGACTCTTTACCAGTCCACCAAGGACGGTAAGACCTTTG TCGATTGCTTGCGCGATGCCAACATCGTCCCTGGCATCAAAGTTGACAAG GGCTTGTCTCCCCTAGCCGGTTCCAACGAAGAGTCTTGGTGCCAAGGCTT GGATGGATTGGCCTCACGCTCTGCTGAGTACTACAAGCAAGGCGCTCGTT TTGCCAAGTGGAGGACAGTGGTGAGTGTTCCCTGCGGTCCTTCAGCACTG GCTGTGAAGGAAGCTGCGTGGGGGCTGGCTCGCTATGCAGCCATCTCTCA GGATAATGGTCTTGTCCCCATTGTGGAGCCAGAGATCCTTCTGGACGGGG ACCACCCAATAGAGAGGACTCTGGAGGTGGCAGAGAAAGTGTGGTCAGAG GTGTTCTTCTACTTGGCACAGAACAACGTCATGTTTGAGGGCATTCTGTT GAAGCCGAGCATGGTCACCCCAGGCGCTGAGCACAAGAACAAGGCCTCTC CCGAGACCGTTGCAGATTTCACGCTCACCATGCTGAAAAGGAGGGTTCCT CCGGCTGTCCCAGGGATCATGTTTCTGTCAGGAGGACAATCAGAGGCAGA GGCCACACTGAACCTGAACGCCATGAACCAGAGCCCAAACCCATGGCATG TGTCCTTCTCATACGCACGTGCCCTGCAGAACTCCGTGCTCAGAACATGG CAAGGCAAGCCGGAGAAGATTGAGGCCTCGCAGAAGGCACTGTTGGTGAG GGCAAAGGCCAACTCACTGGCCCAGCTCGGCAAATACTCAGCCGAGGGAG AGAACGAGGATGCCAAGAAAGGAATGTTTGTCAAGGGTTACACCTAC >P ---ATGGCCTGTGCAAGCTTTGTAAAGCTTAACGCAGCGTCGTCTTCATG GACGGGCCAAAAGTCTTCTTTCGGTAAGCGATCTCCGGGATCCTCA---- -----------ACTCGCCGAGTCTCCTTCTCGATCCGCGCCAGC------ TCTTACACTGACGAGCTCGTCCAAACTGCTAAACTCATTGCATCACCTGG TCGTGGTATCCTTGCCATAGATGAATCAAATGCAACTTGTGGGAAGAGGT TGGCATCTATTGGCTTGGATAACACTGAAACCAACCGACAAGCATACAGA CAACTTCTACTGACCACTCCTGGCCTTGGTGAATACATTTCCGGTGCCAT TCTCTTCGAGGAGACACTATACCAGTCTACAACTGATGGAAGGAAGTTCG TGGATTGCCTGCGTGATGAGAACATTGTACCTGGCATCAAAGTTGACAAG GGTTTAGTTCCCCTGCCAGGATCAAACAATGAGTCTTGGTGCCAAGGTTT GGATGGATTGGCCTCAAGGTCTGCTGAATATTACAAGCAAGGCGCACGTT TTGCTAAGTGGAGGACTGTTGTCAGCATTCCATGTGGCCCATCTGCTCTG GCTGTCAAGGAAGCTGCATGGGGACTTGCACGATATGCTGCCATTTCTCA GGATAATGGTCTTGTGCCCATT---GAGCCTGAGATTCTGCTTGATGGGG ACCATCCAATTGACAGGACCCTTGAAGTTGCTGAGAAGGTCTGGGCAGAA GTCTTTTACTACTTGGCTGAAAACAATGTTGTGTTTGAGGGCATCCTACT TAAGCCTAGCATGGTAACGCCAGGGGCGGAACACAAGGAGAAGGCTTCCC CAGATACCATAGCCAAATATACACTCACAATGCTTAAAAGGAGAGTACCT CCTGCAGTTCCTGGCATAATGTTTTTGTCGGGAGGACAATCTGAAGTGCA AGCAACACTCAATCTCAATGCAATGAACCAAAGCCCCAACCCGTGGCATG TTTCCTTCTCATATGCACGTGCACTGCAGAACACCGTGCTCAAGACATGG CAGGGACGCCCTGAGAACGTGGAAGCTGCTCAGAAATCACTTTTGGTGCG TGCCAAGGCTAACTCGCTGGCCCAGCTTGGTAGATATTCCGCTGAGGGTG AAAGCGAGGAAGCTAAGAAGGGAATGTTCGTAAAGGGCTACACCTAC >R ------GCCTGTGCAAGCTTTGCAAAGCTAAACGCAGCTTCTTCTACCTG GATCGGCCAACAG---TCTTTTGGTCAGCGA---CCTGGATCTTCCTCGG CTCGTTTTGCAACTCGCCGAGTCTCCCTACCGATCCGTGCCAGC------ TCTTACAAGGACGAGCTCGTTCAAACAGCTAAAACTGTTGCATCACCTGG ACGTGGAATCCTCGCTATTGATGAATCGAATGCAACTTGTGGGAAGAGGT TGGCATCTATTGGGTTGGACAACAATGAGACTAACCGGCAGGCATATAGA CAACTCTTACTGACCACTCCTGGTCTTGGTGAATATATTTCTGGTGCAAT TCTTTTTGAGGAAACTCTTTACCAGTCCACCACAGATGGAAAGAAGTTTG TGGATTGCTTGCGTGATCAGAACATTGTTCCTGGTATCAAAGTTGACAAG GGTTTGGTGCCTCTTCCAGGATCAAACAATGAGTCTTGGTGCCAAGGTTT GGATGGATTGGCATCAAGATCTGCTGAGTACTACAAGCAAGGTGCTCGTT TTGCTAAGTGGAGAACAGTTGTCAGCATTCCCTGTGGTCCTTCTGCTTTG GCTGTTAAGGAAGCTGCATGGGGACTTGCTCGTTATGCTGCCATTTCTCA GGACAATGGTCTTGTGCCCATTGTTGAACCTGAGATTCTTCTTGATGGAG ACCATGGAATTGAGAGAACACTTGAAGTCGCAGAGAAGGTCTGGGCTGAA GTCTTTTTCTACTTGGCGGAGAACAATGTTGTGTTTGAGGGTATCCTGCT TAAGCCTAGCATGGTAACACCAGGTGCTGAACACAAGGAGAAAGCTTCTC CTGATACCATTGCCAAATACACACTCACAATGCTCAGAAGAAGAGTACCA CCTGCAGTTCCTGGAATCATGTTTTTGTCGGGAGGACAATCTGAAGTTGA AGCGACCCTTAACCTCAATGCAATTAACCAAAGCCCCAACCCCTGGCATG TGTCTTTCTCATATGCACGTGCACTGCAGAATTCTGTGCTTAAGACATGG CAGGGGCATCCAGAGAATGTGGAAGCTGCACAGAAGGCACTTTTGGTACG TGCCAAGGCAAACTCCTTGGCACAGCTTGGAAAGTATTCTGCTGAGGGTG AAAACGAGGAAGCTAAGAAGGGCATGTTCGTCAAGGGCTACACCTAT >O GCGATGCTGACGGCCAAGCTCACCTCCCCCCCCGCCGCCACCACC---TG  113 GCTC------------------------------CCCGGCGGCGGCCGCC GATCCGCGCCGCCCCGCCGTGCTACGGTG---ATCCGCGCCGCCGCCGTC TCCTACGCCGACGAGCTCGTCTCCACCGCGAAATCTGTTGCTTCCCCAGG GCGTGGTATCCTGGCAATTGATGAGTCGAATGCCACATGCGGAAAGAGAT TAGCATCCATTGGTTTGGACAACACAGAAGTTAACCGCCAGGCTTACAGG CAGCTTTTACTGACCACTGCTGGTCTTGGTGAATATATTTCTGGTGCTAT CCTTTTTGAGGAAACTCTTTATCAGTCAACCACTGATGGTAAGAAGTTTG TTGACTGCTTGAAGGATCAGAATATCATGCCCGGTATCAAGGTCGACAAG GGCTTGGTTCCATTGCCTGGGTCCAACAATGAATCTTGGTGCCAAGGCCT AGATGGTTTGGCTTCAAGGTGTGCTGAGTACTACAAGCAGGGGGCACGCT TCGCTAAGTGGCGGACTGTTGTTAGCATCCCTTGTGGTCCCTCAGCATTA GCAGTCAAGGAAGCGGCATGGGGACTTGCTCGATATGCTGCCATTGCTCA GGACAATGGCTTAGTGCCAATTGTTGAGCCAGAGATCCTTCTTGATGGTG ACCATGCGATCGAGAGAACTCTTGAAGTGGCAGAGAAAGTGTGGTCTGAG GTATTCTTCTACCTGGCCCAAAACAATGTTCTTTTTGAGGGTATCCTGCT GAAACCCAGCATGGTGACCCCTGGAGCTGAACACAAGCAGAAGGCCACTC CAGAAGCCATTGCGAAGCACACCCTTACAATGCTGAGGAGGAGAGTGCCG CCTGCTGTCCCTGGAATCATGTTCCTTTCTGGTGGGCAATCTGAGGTGGA GGCAACCCTGAACCTGAACGCGATGAACCAAGAACCAAACCCATGGCATG TGTCCTTCTCATACGCCCGGGCTCTCCAGAACTCGGTGCTGAAGACATGG CAGGGGCGCCCCGAGAACGTGGAGGCAGCGCAGAAGGCACTGCTGGTCCG TGCCAAGGCGAACTCGCTGGCTCAGCTCGGTCGCTACACCGGCGAGGGCG AGAGCGATGAGGCCAAGAAGGGA---TTCCAGAAGGGCTACACTTAC >V ------GCCTCTGTGACCTTTGCGAAGTTTAACGCCTCGTCTTCGCAGTG GATCGGACAACAG---TCCTTCTCTCAACGC---CAGGGATCGTCC---G CTCGCTTCCCGGCACGCAGAGTCTCGGTCCCGATCCGTGCCGGG------ TCGTACTCCGAGGAACTCGTTCAGACTGCTAAAACTGTTGCATCACCTGG CCGTGGTATACTAGCCATTGATGAGTCAAATGCTACCTGCGGGAAGAGGT TGGCATCTATTGGTCTGGACAATACAGAACCCAACCGTCAGGCCTATAGA CAACTTCTACTGACCACTCCTGGCCTTGGTGAATATATTTCTGGGGCCAT CCTTTTTGAGGAAACACTGTACCAGTCAACAACTGATGGAAAGAAGTTTG TGGACTGCTTGCGTGAAAAGAAAATTGTGCCTGGCATCAAAGTTGATAAG GGTTTGGTTCCTCTACCAGGATCAAACAATGAATCTTGGTGCCAAGGCCT GGATGGTTTGGCTTCAAGATCTGCTGAATACTATAAGCAAGGTGCTCGCT TTGCAAAGTGGCGCACTGTTGTTAGCATTCCCTGTGGTCCTTCTGCCTTG GCTGTCAAAGAAGCTGCATGGGGTCTTGCACGCTATGCTGCTATTTCTCA GGACAATGGTCTTGTGCCCATAGTAGAACCTGAGATTCTTCTTGATGGGG ATCACCCAATTGATAGGACACTCGAAGTTGCAGAGAAAGTGTGGTCGGAG GTCTTCTTTTACTTGGCACAAAACAATGTCTTATTTGAAGGAATCCTACT TAAGCCTAGCATGGTAACCCCAGGAGCTGAACACAAGGAGAAGGCTTCTC CAGAGACCATCGCCAAATATACACTAACAATGCTTAGAAGGAGAGTACCT CCTGCAGTTCCTGGAATC---TTTTTGTCTGGAGGGCAATCTGAAGTGGA AGCAACATTAAACCTGAATGCAATGAATCAAAGCCCCAACCCATGGCATG TTTCCTTCTCATATGCTCGTGCACTGCAAAACACTGTCCTAAAGACGTGG CAAGGACATCCTGAGAATGTTGAAGCGGCACAGAAGTCTCTTTTAGTTCG GGCAAAGGCAAACTCCCTGGCTCAGCTTGGAAAGTACTCTGCTGAAGGTG AAAGTGAGGAAGCTAAGAAAGGAATGTTTGTCCAGGGCTATACCTAC    GLY.5.3.1.9c.fasta >A GCGTCATCAACCGCTTTGATTTGTGATACCGAAGCGTGGAAGGATTTGAA GGGACATGTAGAAGATATTAAGAAGACTCATTTGCGTGATTTGATGAGTG ATGCTAATAGATGCCAGTCCATGATGATGGAGTTTGATGGGTTGCTGTTG GATTATTCTCGACAGCGTGCAACTGTTGAGACAATGGACAAGCTTTTGAA CTTGGCAAAGGCTTCTCAATTGACAGAGAAGATCAGCCGCATGTTCAATG GGGAGCATATTAACAGTACAGAGAACAGATCAGTTCTTCATGTTGCGCTC CGTGCTCCAAAGGATGCAGTTATCAAGGCTGATGGAATGAATGTGGTTCC AGAAGTGTGGAACGTTCTAGATAAGATCAAGGAATTTTCTGACAAAATTC GCTCTGGTTCATGGGTTGGAGCCACTGGCAAACCGCTGAAAGATGTCATT GCGATTGGTATTGGTGGTAGCTTCTTAGGTCCACTGTTTGTCCACACGGC TCTCCAAACAGATCCTGAAGCTCTAGAGTCTGCTAAAGGACGCCAGCTGC GATTTCTTGCAAATATTGATCCTGTTGATGTTGCTAGAAATATCAGTGGA CTAAATCCAGAAACTACTCTAGTTGTGGTGGTCTCGAAAACGTTTACAAC AGCTGAAACAATGCTTAACGCCAGAACATTGAGGGAATGGATAACAGCTG CTCTTGGGGCTTCAGCTGTTGCAAAACATATGGTTGCTGTCAGCACTAAT CTTGCGTTAGTAGAGAAGTTTGGTATTGACCCGAACAATGCATTTGCATT TTGGGACTGGGTTGGTGGAAGGTACAGTGTTTGCAGTGCGGTTGGAGTCT TACCTTTGTCTCTGCAGTATGGCTTCTCCATGGTTGAGAAGTTTTTGAAG GGAGCTTCAAGCATTGATCAGCATTTCCAGTCCACACCGTTCGAGAAGAA TATACCTGTGCTTTTAGGGTTGTTGAGTGTATGGAATGTATCATTTCTTG GATATCCTGCTAGGGCCATCTTACCTTATTCGCAAGCCCTTGAGAAATTT GCTCCACACATTCAACAG--------------------------------  114 ----GTTAGTATGGAGAGTAATGGAAAGGGAGTCTCAATTGATGGTCTAC CTCTCCCGTTCGAGACTGGTGAGATTGATTTTGGTGAACCTGGAACAAAT GGTCAACACAGCTTTTACCAACTCATTCACCAGGGACGCGTAATCCCTTG TGATTTCATTGGCATTGTGAAGAGTCAGCAACCTGTGTACCTTAAGGGAG AGGTGGTCAGC---CACGACGAGCTCATGTCAAACTTTTTTGCACAGCCT GATGCTCTTGCATATGGAAAAACTCCTGAACAGCTGCAGAAAGAGAATGT TTCAGAAAATCTCATTCCCCATAAGACATTCTCTGGAAATCGACCTTCTC TTAGCCTTCTACTTCCAGAATTGACTGCTTACAATGTTGGCCAGTTGTTG GCTATCTATGAACACAGAGTAGCAGTTCAAGGCTTTGTGTGGGGTATCAA TTCGTTTGACCAGTGGGGCGTTGAGCTAGGAAAAGTTCTGGCTACTCAGG TCAGGAAACAGCTTCATTCATCACGCACTCAAGGAACCGCTCCCGAGGGA TTCAATTACAGTACCACCACACTTTTGAAACGATATCTCGAGACAAGTTC CGAG---------------------------CCCCAGATG >P ATGGCTTCATCGACTTTAATTTGCGAAACCCAGCCATGGAAGGACTTGAA GTCTCATGTTGAGGACATTAAGAAGACTCATTTACGCGAGTTGTTGAGTG ACACCGACCGATGCAAGTCAATGGTGGTTGATTTTGATGGAATAACGCTT GACTACTCACGCCAACGAGCCACCCCTGGTACCATGGATAACCTTTATAA TCTGGCAGAGGCAGCTCATCTCAAGGAAAAGATTGATCGCATGTTCAATG GGGAGCATATAAACAGCACTGAGAATAGGTCAGTGCTTCATGTAGCTCTT CGTGCTCCAAGGGATGCAGTTATGCAAAGTGATGGCAAGAATGTTGTACC AGATGTCTGGAATGTTCTGGACAAGATCAAGGATTTCTCTGAGAGGGTCC GCAATGGTTCTTGGGTTGGAGCCACAGGAAAAGCACTTACTGATGTTATT TCAGTCGGCATTGGTGGCAGCTTCCTGGGTCCTCTTTTTGTGCATACCGC TCTTCAAACAGATCCAGAGGCCAGCAAATGTGCTACAGGACGCCAATTGC GATTTCTTGCAAATGTAGATCCTATTGATGTTGCTAGAAATATTGCAGGC CTCAAACCTGAGACTACTCTCGTTGTTGTGGTTTCAAAGACTTTTACCAC AGCTGAAACTATGCTGAATGCTCGAACACTAAGGGCATGGATTTCAAAAG AACTCGGACCATCTGCAGTTGCCAAGCATATGGTTGCAGTTAGCACTAAT CTTATGCTTGTGGAAAAGTTTGGCATTGATCCTAACAATGCTTTTGCATT CTGGGACTGGGTTGGTGGAAGATATAGTGTCTGTAGTGCTGTTGGCGTGT TACCTTTGTCTCTCCAATATGGTTTCACAGTTGTTGATAAGTTCTTGAAA GGAGCATCAAGCATTGATCAGCATTTCTATTCTGCACCATTTGAGAAAAA TCTACCTGTACTTCTAGGTATGTTGAGCGTGTGGAATGTTTCATTTTTTG GATATCCTGCAAGAGCCATCTTACCTTATTCTCAAGCCCTGGAGAAATTT GCACCGCACATCCAGCAGGCAAACCTACTTGAGCTCACTTTCCTTTCCCT TTTAGTCAGCATGGAAAGTAATGGCAAGGGGGTATCTATTGATGGTAAAC CACTTCCCTTTGAAACTGGTGAAATTGATTTTGGTGAACCAGGAACAAAT GGTCAGCATAGCTTTTATCAACTAATTCACCAGGGACGTGTGATTCCCTG TGACTTTATTGGTGTTGTGAAGAGTCAGCAACCGGTATACCTAGAAGGAG AGGTTGTAAATAACCATGATGAACTCATGTCCAACTTTTTCGCCCAGCCA GATGCCCTTGCATACGGGAAGACACCAGAAGAGTTGCAAAAAGAGAATGT TCTGCAGCATCTCATACCTCACAAGACCTTCTCTGGCAATAGGCCTTCTC TCAGCCTTCTGCTCTCTTCATTGGATGCTTACAAAATTGGACAGTTGTTG GCGATCTATGAACACAGAGTTGCTGTGCAAGGCTTCATATGGGGCATCAA TTCTTTTGACCAGTGGGGAGTTGAGTTAGGAAAGTCGTTGGCTACTCAAG TTAGAAAGCAACTTCATGCATCTCGTGTGAAGGGAGAACCAGTTGAGGGT TTTAATTTCAGCACTACAACAATGCTAACAAAATATCTGAAGGAAAGTTT GGAAGTTCCAGCCAATCCTCCAACAATTCTTCCTCGGATA >R ---GCTTTATCGGCTCTAATCTGTGATACTCAGCCCTGGAAGGACTTGAA GGCTCATGTTGAGGACATTAAAAAAACTCATTTACGCAATTTGTTGGGCG ACACTGAACGATGCAAGTCCCTG---GTTGAATTTGATGGAATCATGCTT GACTACTCAAGGCAAACAGCCACTATTGACACACTGGATAAGCTCTATAA CTTGGCAGAGGCAGCTCATCTCAAGGAAAAGATTCATCGC---TTTAATG GAGAGCGTATCAACAGCACAGAGAATAGGTCCGTGCTTCATGTTGCTCTT CGTGCTCCACGGGATGCAATTGTAAACAGTGATGGAAAGAATGTTGTACC AGATGTTTGGAATGTTCTTGACAAGATTAAGGAGTTTTCTGAGAGGGTTC GCAATGGTTCTTGGGTTGGAGCTACAGGGAAACCACTGACGGATGTTATT GCCATTGGTATTGGTGGCAGTTTCTTAGGTCCTCTTTTTGTGCACACTGC TCTTCAAACAGATCCAGAGGCTAGCAAATCTGCAAAGGGCCGCCAGCTGC GTTTTCTTGCAAATGTTGATCCAATTGACGTTGCTAGAAATATTGCAGGC CTAAGCCCTGAAACCACCCTCGTTGTTGTGGTATCAAAAACTTTTACTAC TGCTGAAACT---CTGAATGCACGAACTCTAAGGGCATGGATTTCAAGAG AACTTGGGCCTTCTGCAGTTGCAAAGCACATGGTGGCAGTTAGCACAAAT CTTACGCTTGTTGAAAAGTTTGGTATTGATCCTAATAATGCTTTTGCATT CTGGGACTGGGTTGGTGGCAGGTATAGTGTTTGCAGTGCTGTTGGAGTGT TGCCTTTGTCTCTCCAATATGGTTTCTCAATTGTTGAGAAATTCTTGAAA GGAGCATCAAGCATTGATCAGCACTTTTCTTCAGCGCCATTTGAGAAAAA TATTCCTGTACTTCTAGGTTTGTTGAGCGTATGGAATGTTTCAGTTCTTG GATATCCTGCAAGAGCCATCTTACCTTATTCCCAAGCTCTGGAGAAACTT GCCCCACACATCCAACAG-------------------------------- ----GTTAGCATGGAAAGTAATGGCAAAGGGGTATCCATGGATGGTGTGC CACTTCCCTTTGAGACTGGCGAAATTGATTTTGGTGAACCAGGGACAAAT GGACAGCACAGCTTTTATCAACTAATTCACCAGGGACGTGTAATTCCCTG  115 TGATTTTATTGGTGTTGTGAAGAGTCAGCAACCTGTATACCTCGAAGGAG AGGTTGTCAATAACCATGATGAACTCATGTCCAACTTTTTTGCACAACCA GATGCGCTTGCTTATGGGAAGACAGCAGAGCAGTTGCAAAAGGAGAATGT TCCACAGCATCTAATTCCTCACAAGACCTTCTCCGGAAACAGGCCTTCTG TCAGTATTCTGCTTTCGTCACTGGATGCTTACAAAATTGGACAGCTGTTG GCAATCTATGAACACAGAGTAGCAGTGCAAGGCTTCGTTTGGGGAATCAA TTCTTTTGACCAGTGGGGAGTTGAATTAGGGAAGTCACTGGCAACTCAAG TCAGAAAGCAACTCAATGCATCTCGTACAAAGGGAGAACCAGTTGAGGGC TTTAATTTCAGCACTACGACAATGCTAACAAGATACCTTGAGGAAACTTC GGAAGTGCCAGCCAAGCCTCAAACTCTTCTACCTCGGATA >O ---GCGTCGTCGGCGCTAATCTGCGACACCGAGCAGTGGAAGGGCCTCCA GGCGCACGTCGGGGCGATTCAGAAGACGCACCTGCGCGATCTGATGGATG ATGCCGAGCGCTGCAAGGCAACA---GCTGAGTATGAAGGCATATTTCTG GATTACTCGAGGCAGCGTGCAACTGGCGAGACCATGGAGAAGCTGTTTAA ATTGGCAGAGGCGGCAAAGCTCAAGGAGAAGATTGAGAAG---TTTAGTG GTGACAAGATAAATAGCACAGAGAACAGATCTGTGCTTCATGTAGCTCTA AGGGCTCCAAGAGACGAAGTAATAAAAAGTGATGGGGTCAATGTGGTTCC CGAAGTTTGGGGTGTAAAAGATAAAATCAAGCAGTTTTCAGAAACTTTTA GGAGTGGATCATGGGTTGGGGCAACTGGTAAAGCATTGACAAATGTTGTG TCAGTTGGAATAGGTGGTAGCTTTCTTGGTCCTCTGTTCGTGCATGCTGC CCTCCAGACAGATCCAGAAGCTGCAGAATCTGCCAAAGGGCGACAGTTAA GATTCCTTGCAAATGTTGACCCTGTTGATGTTGCACGAAGCATCAAAGAT TTAGATCCTGAAACAACACTTGTTGTGGTTGTCTCAAAGACCTTCACAAC AGCTGAAACA---TTAAATGCTCGAACTCTCAAGGAGTGGATTGTCTCTT CTCTTGGACCTGATGCTGTTGCGAAACATATGATTGCTGTCAGTACCAAT CTTGAGCTTGTGGAGAAGTTTGGAATTGACCCTAAAAATGCTTTTGCATT TTGGGACTGGGTTGGTGGTCGCTATAGTGTTTGCAGTGCTGTTGGTGTCC TGCCCTTATCTCTTCAATATGGTTTTCCGATTGTTCAGAAATTTTTGGAG GGTGCAGCCAGCATCGACAAACACTTCCGTTCATCTTCATTTGAGAAAAA CATACCTGTACTCCTTGGTTTGCTGAGTGTGTGGAATGTTTCCTTTCTTG GATATCCAGCTAGAGCAATATTGCCCTATTCCCAGGCACTTGAGAAATTT GCACCACATATTCAGCAG-------------------------------- ----CTTAGCATGGAGAGTAATGGAAAGGGTGTCTCTATTGATGGCGTTC AATTGTCCTTTGAGACTGGTGAAATTGATTTTGGTGAACCTGGAACCAAT GGGCAACACAGCTTCTATCAATTAATCCATCAGGGAAGAGTTATTCCTTG TGATTTTATCGGCGTCGTGAAAAGCCAGCAACCCGTTTACTTGAAAGGGG AAATTGTGAGCAATCATGACGAATTGATGTCCAATTTCTTTGCTCAGCCT GATGCACTTGCTTATGGAAAGACCCCTGAACAACTGCACAGCGAGAAAGT ACCTGAACATCTTATCTCTCATAAGACTTTTCAGGGCAACCGACCATCAC TTAGTTTATTGCTGCCCTCATTATCTGCTTATGAGATTGGACAGCTTTTA TCCATCTACGAGCACCGGATTGCAGTTCAGGGTTTCCTATGGGGAATAAA CTCATTTGACCAGTGGGGAGTGGAACTGGGAAAGTCTCTGGCTTCTCAAG TGAGAAAATCTCTGCATGCATCCCGCATGGAAGGAAAGCCTGTCCAGGGG TTCAACAGCAGCACTGCAAGTTTGCTGACACGATATCTCGCTGTTGAGCC ATCCACTCCTTACAACACTACAACA---ATGCCGAAAGTT >V ---GCTTCCTCTACTCTAATCTGCGATACTGAGCCATGGAAGAACTTGAG GGCTCACGTTGAGGATATTAAAAAGACTCACTTGCGTGATTTGATGAGTG ACACGAAGAGATGCCAGTCAATG---GTCGAGTTTGACGGGTTGCTGTTG GACTACTCACGGCAGTGTGCCACTCTGGAAACCATGGATAAGCTCTTCAA ATTGGCAGAGGCAGAAAATCTCAAACAAAAAATTGGCAGA---TACAATG GAGAGCGTATAAACAGTACAGAGAATAGGCCGGTACTTCATGTAGCTCTC CGTGCTCCAAGGGATTCTGTTATACAGAGTGATGGCAAAAATGTGGTCCC AGATGTCTGGAAAGTTCTAGACAAGATCCAAGTATTTTCTGAGACAGTCC GCAGTGGTTCCTGGGTTGGAGCCACTGGAAAAGCATTGACAGATGTAATT TCTGTGGGCATTGGTGGCAGCTTCTTAGGCCCTCTTTTTGTGCACACTGC TCTGCAAACAGATCCAGAGGCTAGTAAATTTGCAAAAGGGCGCCAGCTGC GTTTCCTTGCAAATGTTGATCCTGTCGATGTGGCTAGAAATATCACAGGG CTGAACCCTGAAACTACTTTAGTTGTGGTGGTTTCAAAGACTTTTACAAC AGCTGAAACT---TTGAATGCCCGTACTCTAAGGGAATGGATTTCAGCTG CTCTAGGGCCTTCAGCAGTAGCAAAGCATATGGTGGCTGTCAGTACTAAT CTTACGCTTGTAGAACAGTTTGGCATTGATCCTAATAATGCTTTTGCATT CTGGGACTGGGTAGGAGGCCGATATAGTGTTTGCAGTGCTGTTGGTGTGC TGCCTTTATCTCTCCAATATGGTTTCTCAGTTGTTGAGGGTTGG------ -------------------------------------------------- ----------------GGGAGGCTCGCG---------------------- -------------------------------------------------- -------------------------------------------------- ----------------------GCTCGAGGAGCAGCTGCAGAAGGT---- -----------------------------------------GGATGGGAC GCGGAAAGCGACTCATGGGGATTATGCAGA-------------------- -------GTGGGCCTATTGAGA---------------------------- -------------------------------------------------- --------------------------------------------------  116 -------------------------------------------------- -------------------------------------------------- ---------------------------------------TGGGCTTTG-- -------------TGGTGGAGCCTAGTGGGT------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------CTGAGGGTT    GLY.5.3.1.9p.fasta >A GCCTCTCTCTCAGGCCTATACTCTTCTTCTCCATCTCTCAAACCTGCCAA AAACCATTCCTTTAAAGCA---------------------TTGCCGGCGC AATCTCGAGATTCCTTCTCTTTCCCACATACCTCCAAA------CCCACC AATCTACCGTTGACTCTCTCCTCGGCTCGTTCTGTGGCACGCGACATTTC TCATGCGGAT------------------TCGAAGAAAGAGCTTCTTAAGG ATCCGGATGCGTTGTGGAAGCGATACCTCGATTGGTTTTATCAGCAGAAA GAGCTTGGGTTGTATCTGGATATTAGTCGGGTCGGATTTACCGATGAGTT TGTGGCTGAAATGGAGCCAAGGTTTCAAGCTGCGTTTAAGGCTATGGAGG ATCTTGAAAAAGGGTCTATAGCGAATCCTGATGAAGGAAGAATGGTTGGA CATTACTGGCTTAGGAACTCTAAGCTCGCACCTAAGCCTACTTTAAAGAC CTTGATCGAGAACACACTTGATTCTATTTGCGCTTTCTCCGACGACATAA TCTCTGGAAAGATAAAGCCACCATCTTCTCCTGAGGGTCGTTTTACTCAG ATACTTTCTGTTGGCATTGGAGGCTCGGCTCTTGGACCTCAATTTGTCGC TGAGGCCTTGGCTCCTGATAATCCTCCA------ATAAGATTCATTGACA ACACCGACCCTGCTGGAATTGATCATCAGATTGCACAACTTGGGCCAGAG CTGGCCTCGACTTTAGTAGTTGTCATCTCAAAGAGTGGAGGTACTCCTGA AACTAGAAATGGACTACTGGAAGTGCAGAAAGCATTCCGA---GCTGGTC TGAATTTCGCAAAACAGGGTGTTGCAATAACCCAAGAGAACTCATTACTG GATAATACGGCAAGAATTGAAGGTTGGCTAGCTAGATTTCCTATGTACGA CTGGGTGGGTGGAAGAACATCAATAATGTCTGCAGTTGGTCTGCTTCCAG CAGCACTACAGGGGATTAATGTTAGGGAGATGCTTACTGGTGCTGCTTTA ATGGATGAGGCTACTAGGACAACTTCGATCAAGAATAACCCTGCAGCGCT CTTAGCTATGTGTTGGTACTGGGCTTCCAATGGCGTTGGTTCCAAGGATA TGGTTGTCCTTCCTTACAAGGATAGCTTATTGCTATTTAGTCGGTATCTG CAGCAGCTGGTCATGGAATCACTAGGAAAGGAGTTTGATCTTGACGGTAA CACTGTTAATCAAGGGTTAACTGTGTATGGAAATAAGGGAAGCACAGATC AGCACGCCTACATTCAACAGCTGAGAGATGGTGTGCACAATTTCTTTGCA ACCTTCATAGAAGTGTTACGGGACAGACCCCCTGGTCACGATTGGGAGCT TGAGCCAGGTGTCACTTGTGGAGACTATCTCTTTGGGATGCTACAGGGAA CTAGATCTGCTTTATATGCAAACGGTAGAGAATCCATCAGTGTTACAATC CAGGAAGTGACACCAACATCTGTTGGGGCTATTATAGCTCTTTATGAAAG AGCTGTTGGTTTATATGCCTCAATTGTGAACATAAATGCTTACCACCAAC CCGGTGTGGAAGCTGGGAAAAAGGCAGCAGCAGAAGTTCTCGCCCTGCAA AAGCGGGTATTGTCAGTTCTTAATGAAGCCACTTGTAAAGATCCGGTAGA GCCATTGACACTGGAAGAGATAGCTGATCGTTGTCATGCTCCTGAGGAAA TAGAAATGATATACAAGATCATAGCGCACATGTCTGCAAACGACAGAGTT CTGATAGCAGAAGGAAACTGTGGATCGCCACGAAGTATCAAAGTGTATTT GGGCGAGTGCAATGTGGATGAC------CTGTACGCA >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ----------------------------------------CTAGAAAAAG ATCCTAATTCTCTATGGAGGAGATACGTTGACTGGCTCTACCAGCACAAG GAATTAGGGTTGTATTTGGATGTGAGTCGGATCGGTTTCACGGACGAGTT TGTTTCGGAAATGGAGCCCCGATTCCATAAGGCGTTTAAGGACATGGAGG AATTAGAGAAGGGCGCGATTGCCAATCCTGATGAAGGGAGAATGGTTGGG CATTATTGGTTGAGGAATTCAACCTTAGCGCCTAAGTCGTTTTTGAAAAC TCAGATTGATAAGGCTCTTGATGCTGTTTGTGATTTTGCTGATCAAGTCG TCAGTGGTAAGATTAAGACTCCGGACGGG------GGGCGTTTTACTCAA ATACTTTCTGTTGGGATTGGTGGTTCAGCTCTCGGTCCGCAGTTTGTTGC GGAGGCATTGGCGCCCGATAATCCTCCTCTCAAGATAAGGTTCATTGATA ATACAGACCCTGCTGGAATTGATCATCAGATTGCTCAGCTTGGACCCGAG CTGGCTTCTACTCTTGTCATTGTGATTTCAAAGAGTGGAGGAACCCCTGA AACTAGAAATGGTTTGTTGGAAGTACAGCAGGCCTTTCGTGAAGCTGGAC TGGATTTTGCAAAACAGGGTGTCGCTATAACACAAGAAAATTCATTACTA GACAACACTGCAAGAATTGAGGGCTGGTTGGCTAGATTCCCTATGTTTGA TTGGGTGGGTGGTAGGACATCTGAAATGTCTGCAGTTGGCCTGCTTCCAG CAGCGCTTCAGGGGATTGACATCAGAGAAATGCTAGCTGGTGCGGCATTG ATGGATGAGGCAAATAGGACCACAGTGCTTAGGAATAACCCTGCAGCTTT GCTAGCTTTATGTTGGTATTGGGCTTCTGAGGGGGTGGGATCTAAGGACA TGGTTGTGCTTCCATACAAGGACAGCCTATTGCTATTCAGTAGGTATTTG  117 CAACAGCTGGTCATGGAATCACTTGGAAAGGAATTTGATCTTGATGGTAA TCGGGTAAATCAAGGACTTACCGTCTATGGAAATAAAGGGAGCACGGATC AGCATGCTTACATTCAACAACTGAGAGAAGGAGTGCACAATTTCTTTGTA ACGTTCATTGAAGTGCTACGAGATAGACCCCCTGGCCATGATTGGGAGCT TGAACCAGGTGTCACATGTGGTGACTACCTATTTGGAATGTTACAGGGAA CTAGGTCAGCTCTGTATGCCAAGGACAGGGAATCTATAACAGTTACAGTG CAAGAAGTGACCCCCAGATCTGTTGGGGCTCTTATTGGGCTTTATGAGCG GGCAGTTGGGATATATGCCTCACTTGTCAACATCAATGCTTATCATCAAC CTGGTGTGGAAGCAGGGAAGAAAGCAGCAGGAGAAGTTTTAGCTCTTCAG AAGCGGGTTTTGGCAGTGCTCAATGAGGCAAGCTGCAAACAGCCCGTGGA ACCATTGACAATCGAGGAAGTAGCCGATCGTTGCCATGCTACCGAAGATA TTGAAATGATATACAAGATAATTGCACACATGGCTGCTAATGACAGAGCA CTTATAGCTGAAGGCAGCTGTGGTTCACCGCGCAGTCTCAAAGTTTTCCT TGGAGAGTGTAATGTGGATGAG--------------- >R GCCTCACTCTCCGGTCTCTGCTCCTCGTCTCCATCTCTCAAAACAAAAAC TTCTCTTCTTAAAACAGCT------CTCAACTCTGCTCCTCTTAAAACC- -----------TCACTCGCATTTCCACCTCGC------------ACTTCC CGATTTACCCCTGCACAGTCAATCGCGCGCGAGATTTCCGCTGATTTATC CAAAACAAACTATAAATTATCGGTCAAACCGGAGCAAGGACTAGAGAAAG ATCCAAACAGTCTATGGAGAAGATACACGGAGTGGCTGTACCAGCACAAG GAGTTAGGGCTTTATTTGGATGTGAGTCGGATCGGGTTCACGGACAACTT TGTAGAAGAGATGGATCCCCGCTTTCAAAAGGCGTTTAAGGATATGGAAG AACTTGAGAAAGGTGCAATTGCGAATCCTGATGAAGGGAGAATGGTTGGT CATTATTGGTTGAGGAATCCGGGTCTTGCTCCTAAAGCTTTTTTGAAACA ACAGATTGATAAAGCTCTCGACGCCGTTTGTCAGTTTGCTGGCGACGTCG TCAGTGGTAAGATTAAGCCCCCGAATTCACCAGAAGGCCGTTTTACTCAA ATACTTTCTGTAGGTATTGGAGGTTCAGCTCTTGGACCACAATTTGTTGC CGAGGCTCTTGCGCCTGATAATCCTCCTCTCAAGATAAGATTTATTGATA ATACGGATCCAGCTGGAATTGATCATCAGATTGCTCAGCTTGGTCCTGAG CTTTCTTCTACTCTTGTGATAGTGATTTCTAAGAGTGGAGGTACCCCTGA AACTAGAAATGGTTTATTGGAAGTTCAGAAGGCCTTTCGTGAAGCTGGCC TGGAGTTTGCAAAACAGGGAGTTGCTATAACGCAAGAAAATTCATTACTA GACAACACTGCAAGAATTGAAGGATGGTTAGCTAGATTCCCCATGTTTGA CTGGGTTGGTGGGAGGACATCTGAAATGTCTGCAGTGGGCCTTCTTCCAG CAGCACTTCAGGGGATTGACATTAGGGAAATGCTTGCTGGCGCGTCACTG ATGGATGAGGCAAATAGAACCACAGTGCTTAGAAATAATCCTGCAGCTAT GCTAGCTTTATGCTGGTACTGGGCCTCTGATGGGATAGGATCCAAGGACA TGGTCGTCCTTCCTTATAAGGACAGTCTGTTACTATTTAGTAGGTATTTA CAGCAACTAGTCATGGAATCACTTGGGAAGGAGTTTGACCTGGATGGTAA TCGGGTGAATCAGGGACTTACAGTATATGGAAATAAAGGGAGCACAGATC AGCACGCCTACATTCAACAACTAAGAGAGGGTGTACACAATTTCTTTGTG ACGTTCATTGAAGTGCTGCGTGATAGACCTCCTGGTCATGATTGGGAGCT CGAACCAGGTGTCACATGTGGTGACTACCTATTTGGAATGCTACAGGGAA CTAGGTCTGCATTGTATGCTAATGATAGGGAGTCCATAACTGTTACAGTG CAAGAAGTGACACCTAGAACTGTGGGGGCCCTTGTTGCACTTTATGAGCG AGCGGTTGGAATTTATGCATCACTGGTCAATATCAATGCTTATCATCAAC CCGGTGTAGAAGCTGGGAAAAAGGCTGCAGGGGAAGTATTAGCTCTTCAG AAGCGTGTGTTAGCAGTGCTTAATGAGGCAAGTTGTAAAGAGCCTGTTGA ACCTTTGACACTTGAAGAAGTAGCTGAACGTTGCCATGCAGAAGAAGATA TTGAAATGATATACAAGATTATACTGCACATGGCTGCCAATGATAGAGCA CTAATTGCCGAAGGTAATTGTGGTTCACCACGCAGCATCAAAGTGTTCCT TGGGGAGTGTAATGTTGAAGCA------TCATATGCT >O GCGTCCATCTCCGGCGCGGCGGCGCCTCCGTCCTCGTCGGCGGCGTGCAG GCTGCGGCTGCGGCGGCAGCTCCTCCTCCGCCCCTCCCACCTCCGCCTCC GCGCCCCCCACTCCATCGCGGACCTCTCCCGCTCCTCCTCGTCCTCGTCG GAGCAGCAGCCCTCCTCTACCCCGGCGGCGCCGCTCGCCTCCAGGCCGGG GCAGAACGGC---------------AGCACCCGCGGCGCGGTGGAGAAGG ACCCGATCAAGCTGTGGGAGAGGTACGTGGAGTGGCTGTACCAGCACAAG GAGCTCGGCCTGTTCGTGGACGTGAGCCGGATGGGGTTCACGGAGGAGTT CCTCCGCCGGATGGAGCCGCGG---CAGCGCGCCTTCGCGGCGATGCGGG AGCTCGAGAAGGGGGCCATCGCCAACCCCGACGAGGGCCGCATGGTTGGC CATTACTGGCTCCGCGACCCAGGCCTCGCCCCCAACTCCTTCCTCCGCAC CAAGATCGAGACCACCCTCGACCGCATCCTCGCCTTCTCCCAAGACGTCG TCTCCGGCAAGATTAAACCTCCGTCATCTCCAGCTGGCCGATTTACTCAA ATACTCTCAATAGGAATTGGAGGATCAGCTTTGGGGCCTCAATTTGTTTC AGAGGCACTTGCACCTGATAACCCTCCATTGAAGATACGATTTATTGACA ACACTGATCCTGCTGGAATCGACCATCAAATTGCTCAACTAGGACCAGAG CTTGCATCTACTCTTGTAATTGTTATTTCTAAGAGTGGAGGCACACCTGA AACCCGGAATGGTCTGCTTGAAGTGCAAAAAGCCTTCCGAGATGCTGGGC TGGATTTCTCGAAACAGGGAGTTGCAGTTACTCAAGAAAATTCTCTGTTA GACAACACTGCCAGAATAGAGGGATGGTTAGCTAGATTTCCCATGTTTGA CTGGGTTGGTGGAAGAACATCAGAAATGTCAGCTGTCGGATTGCTTCCAG CTGCATTACAGGGTATCGATATCAAAGAAATGTTAGTTGGCGCAGCACTA  118 ATGGATGAGGAAACCAGGAATACTGTGGTTAAGGAAAATCCAGCAGCCTT ACTTGCTTTGTGCTGGTATTGGGCATCGGAAGGAATAGGAAATAAGGATA TGGTTGTACTTCCGTACAAGGATAGTTTGCTACTTTTGAGTAGATATTTG CAACAGCTTGTC---GAATCTCTTGGGAAAGAATTTGACCTTGATGGCAA TCGGGTTAATCAAGGTCTAACTGTGTATGGCAACAAAGGAAGCACCGATC AGCATGCCTACATTCAGCAGCTGAGAGAAGGTGTACACAACTTCTTCGTT ACTTTTATTGAGGTTTTGCGTGATAGGCCTCCTGGTCATGATTGGGAGCT TGAACCTGGAGTTACATGTGGTGACTATTTGTTCGGGATGTTGCAGGGAA CCCGTTCTGCTCTTTATTCTAATGACCGAGAATCCATCTCCGTTACTGTG CAAGAAGTTACTCCTAGGGCTGTTGGAGCGCTGGTTGCTCTATATGAACG TGCTGTGGGGATTTATGCTTCTTTAGTAAATATCAATGCCTATCATCAGC CTGGTGTTGAGGCTGGGAAAAAGGCAGCAGGTGAAGTGTTGGCACTTCAG AAGAGGGTGCTGACTGTTCTGAATGAGGCCAGCTGCAAGGATCCTGCCGA GCCGTTGACGCTGGATCAAATAGCAGAGCGCTGTCATTGCCCTGAAGATA TTGAGATGATATACAAAATAATCCAGCACATGGCAGCAAATGATAGAGCG CTCATAGCAGAAGGCAGCTGCGGTTCTCCTCGAAGCATCAAGGTTTACCT TGGAGAATGCAATGTAGATGAGGATATGCTTGCTGCT >V GCTTCCGTCTCCGGCATCTGCTCTTCCTCATATCCGTTCAAATCCAAGCA CTTCACCGCCAGATCATCG------CCCTCCTCTACAATCATGCCTTCTT TTAGAATAGACTCTCTCACATTCCCCACTCGTCCTAAACTGGACGATCGG ACTCTGGTTCTCACTCCGTCCGTGGCTCGGGAGGTATCGGCGGACTTGTC CAAAAGCGAC---------CCGTCTCCCAAGAAGAAGGGACTAGAGAAGG ACCCGGGAGCTCTGTGGCGCAGATACGTCGACTGGTTGTACCAGCACAAG GAGTTAGGGCTTTTTCTCGATGTGAGTCGGATCGGATTTTCGGAGGAGTT CGTGGAGGAGATGGAGCCCAGGTTCCAGGCGGCTTTTCGCGCGATGCAGG AGCTGGAGAAGGGAGCCATTGCGAATCCCGACGAAGGACGGATGGTTGGT CATTACTGGCTGAGGAGCTCTAAGCTCGCACCCAACCCGTTTCTGAAGTT GCAGATTGAGAATACTCTTGAGGCTGTTTGCAAGTTCGCCGAGGACGTCG TCAGCGGTAAGATTAAACCTCCATCTTCTCCAGAGGGTCGCTTTACACAT GTCCTTTCTGTTGGAATTGGAGGTTCGGCTCTTGGACCTCAGTTTGTTGC AGAGGCATTGGCTCCTGATAATCCTCCTCTCAAGATAAGATTCATTGATA ATACAGATCCAGCTGGAATTGATCACCAGATTGCCCAGCTTGGCCCCGAG CTGGCCTCTACAATAGTAATTGTCATTTCAAAGAGTGGAGGCACTCCTGA AACTAGGAATGGTTTGTTGGAAGTACAGAAGGCCTTTCGTGAAGCTGGTC TGGATTTTGCAAAACAGGGTGTTGCCATTACACAAGAAAATTCATTATTA GACAACACTGCTAGAATTGAGGGTTGGTTAGCTAGATTTCCTATGTTTGA CTGGGTGGGTGGAAGGACATCTGAAATGTCTGCAGTTGGCCTACTTCCTG CTGCACTTCAGGGGATTGATATCAGAGAAATGCTTGCTGGTGCTTCATTG ATGGATGAGGCTAATAGAACCACTGTGGTTAGGAATAACCCTGCAGCATT GCTAGCTTTATGTTGGTATTGGGCTTCTGAGGGAGTAGGATCCAAGGATA TGGTTATTCTTCCTTACAAGGACAGCTTATTATTATTCAGTAGGTATTTG CAGCAACTGGTC---GAATCAATTGGAAAGGAGTTTGACCTGGATGGAAA TCGGGTGAATCAAGGACTTACGGTCTACGGGAATAAAGGCAGCACAGATC AACATGCATACATTCAACAATTGAGAGAGGGTGTGCACAACTTCTTTGTG ACATTCATTGAAGTTCTGCGTGATAGACCCCCTGGTCATGATTGGGAGCT TGAACCAGGTGTCACATGTGGTGACTACCTCTTCGGAATGCTTCAGGGAA CAAGGTCAGCTCTATATGCCAAGGACCGGGAATCAGTTACAGTCACTGTG CAGGAAGTGACGGCTAGATCTGTGGGGGCTATGATAGCATTGTATGAGCG AGCAGTTGGAATATATGCCTCACTAGTCAACATCAATGCTTACCATCAAC CCGGTGTGGAAGCTGGGAAAAAGGCAGCAGGAGAAGTATTAGCTCTTCAG AAGCGGGTTCTGGCAGTTCTGAATGAGGCCAGCTGTAAGGAGCCCGTTGA ACCATTGACACTTGATGAAGTAGCTGAACGCTGCCATGCGCCTGAAGATA TCGAAATGATTTACAAGATTATTGCTCATATGGCCGCCAATGATAGAGCT CTTATTGCTGAAGGCAGTTGCGGTTCACCCCGGAGCATCAAAGTTTTCCT TGGGGAGTGTTATGTCGATGAC------CTGTATGCT    GLY.5.4.2.2.fasta >A ---ACGTCGACCTACACGAGATTCGATACCGTATTTCTCTTTTCTAGGTT CGCCGGCGCTAAGTATTCGCCGTTATTGCCGTCTCCGTCGTTTACTTTAT CTACTTCCGGC------ATTCATATCAGAACCAAACCGAATTCTCGT--- ------------TTTCACTCGATTATAGCATCCTCCTCATCTTCATCTGT AGTCGCCGGAACTGATAGCATTGAGATTAAATCGTTGCCGACGAAGCCTA TTGAAGGACAAAAGACTGGAACTAGCGGACTCCGGAAGAAGGTGAAAGTT TTCATGGAAGATAATTATTTAGCCAACTGGATTCAGGCATTGTTTAATTC ATTGCCACTTGAGGATTATAAGAATGCAACGTTGGTTTTAGGAGGTGATG GTCGTTACTTTAACAAAGAAGCTTCACAGATCATTATCAAAATTGCTGCT GGGAATGGAGTTGGACAAATTTTAGTTGGAAAGGAAGGCATTTTGTCAAC CCCAGCGGTTTCCGCTGTAATCAGGAAAAGAAAG---------------- -----GCAAATGGAGGATTCATTATGAGTGCAAGCCATAATCCTGGTGGA CCTGAATATGACTGGGGTATCAAGTTCAATTACAGCAGTGGTCAGCCTGC TCCTGAAACCATTACTGACAAAATATATGGAAATACACTTTCAATCTCTG  119 AGATTAAGGTGGCAGAGATTCCTGATATTGATCTTTCTCAAGTTGGAGTG ACCAAATATGGGAATTTCAGTGTAGAAGTTATAGATCCTGTTTCCGACTA TTTGGAGCTCATGGAGGATGTTTTCGACTTTGATCTCATCAGAGGTCTTC TTTCAAGATCAGATTTTGGGTTCATGTTTGATGCCATGCATGCTGTTACT GGTGCTTATGCGAAACCAATTTTTGTCGACAATCTTGGAGCCAAACCGGA TTCAATTTCCAACGGAGTTCCCCTGGAAGATTTTGGGCATGGCCATCCTG ATCCTAATTTGACATATGCAAAGGATTTGGTTGATGTCATGTATCGTGAC AATGGACCGGATTTCGGAGCAGCAAGTGATGGTGATGGTGACAGAAATAT GGTTTTAGGAAACAAATTCTTTGTCACTCCTTCAGACTCTGTAGCTATCA TCGCAGCCAATGCACAAGAAGCAATTCCATATTTCCGTGCTGGTCCTAAG GGGCTGGCACGTTCTATGCCGACAAGTGGTGCTCTTGATCGTGTTGCCGA GAAGTTGAAGCTTCCTTTCTTCGAGGTTCCCACTGGATGGAAATTTTTTG GAAATCTTATGGATGCTGGAAAATTGTCAATCTGTGGAGAAGAGAGCTTT GGCACAGGTTCTGATCACATCCGTGAGAAGGATGGAATATGGGCTGTGTT GGCGTGGCTTTCGATCCTTGCTCATCGCAACAAGGACACGAAACCAGGGG ACAAGTTGGTGTCTGTTGCAGATGTTGTGAAAGAGTATTGGGCGACATAC GGAAGGAACTTTTTTTCAAGATACGACTATGAAGAATGTGAATCTGAAGG AGCCAATAAAATGATCGAGTATCTTAGAGAAATCTTGTCTAAGAGCAAGG CCGGTGACGTTTATGGAAACTATGTCCTCCAGTTTGCAGATGACTTCTCA TACACAGACCCTGTTGATGGAAGTGTTGCATCCAAGCAAGGTGTTCGGTT TGTGTTCACGGATGGATCCAGAATCATATTTCGTTTATCCGGAACTGGCT CAGCTGGAGCTACAGTGCGAATATACATTGAACAATTTGAGCCAGACGTT TCAAAACATGATGTGGATGCACAAATAGCTCTTAAACCTTTAATCGATCT TGCATTGTCTGTATCAAAGCTGAAGGACTTCACAGGGAGGGAGAAGCCCA CTGTCATTACA >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ----------------------GCAATTAATTCAGTGCCGACAAAGCCAA TTGAGGGTCAGAAGACAGGGACAAGTGGTCTGCGAAAGAAGGTTAAGGTT TTCACTGAGGAAAACTACCTTGCAAATTGGATTCAGGCATTGTTTAATTC ATTGCCACCAGAGGATTACAAGAATGGAGTGCTGGTCTTGGGAGGGGACG GTCGTTACTTCAATCGAGAAGCTTCACAGACAATCATCAAAATTGCTGCA GGGAATGGTGTTGGCAAAATCCTTGTCGGCAAGGAAGGTATTATGTCCAC GCCAGCTGTTTCTGCC---------------------------------- -----GCCAACGGTGGATTTATAATGAGTGCAAGTCATAATCCTGGAGGG CCTGAATATGATTGGGGTATCAAGTTTAATTACAGCAGTGGGCAACCTGC ACCTGAATCCATCACTGACAAGATATATGGAAACACCCTTTCTATATCTG AGATTAAGATGGCGGACATTCCTGATGTCGACCTTTCTAGCCTCGGAGTC ACAGAATATGGAAACTTCATTGTCGAAGTAGTAGACCCAGTTTCGGATTA TTTGGAACTAATGGAGAATGTATTTGATCTTGAGCTCATCAAAAGTCTCC TTTCACGGTCAGATTTCAGGTTTGTATTCGATGCCATGCATGCTGTTACT GGTGCTTACGCAAAACCCATCTTTGTGGACAAGCTTGGGGCCAGTCCGGA TTCAATTTCAAATGGGGTACCTCTGGAGGATTTTGGTCACGGCCATCCAG ATCCTAATCTTACATATGCCAAGGATTTGGTCAACATCATGTATGGTGAG AATGGACCAGATTTTGGAGCTGCAAGTGATGGAGATGGGGACAGAAAC-- -ATCCTAGGTAGAGGGTTTTTTGTCACTCCTTCAGATTCGGTTGCTATCA TTGCTGCCAATGCACAGGAAGCCATTCCATACTTTATGAGTGGCCCTAAG GGTTTAGCTCGTTCCATGCCGACAAGTGGTGCTCTAGATCGTGTGGCTGA AAAATTGAATCTTCCATTTTTTGAGGTCCCTACTGGTTGGAAATTTTTTG GGAATCTT---GATGCTGGAAAACTGTCAATTTGTGGTGAAGAAAGTTTT GGAACTGGTTCTGATCACATTCGTGAGAAGGATGGCATATGGGCTGTTTT AGCTTGGCTTTCAATTATTGCTTACAGAAACAAAGACAAGAAACCAGGGG AGAAGTTAGTATCTGTTGCTGATGTTGCGAAAGAGCATTGGGAAACCTTT GGAAGAAATTTCTTTTCTAGATATGACTATGAAGAATGTGAATCTGAAGG TGCCAACAAAATGATCCAGAATCTTAGAGATATAGTCTCTAAAAGCAAAC CAGGTGATAAGTATGGAAATTACACCCTTCAGTTTGCTGATGACTTTACG TACACT---CCTGTGGATGGAAGTGTGGTATCAAAGCAAGGTGTCCGGTT TGTTTTCACCGATGGATCAAGGATTATATTCCGTTTATCTGGAACTGGAT CAGCAGGTGCAACTGTCAGAATCTACATCGAACAGTATGAACCAGATGTC TCTAAACATGAGATGGATGCCCAAGTAGCCCTAAAACCACTAATAGATCT GGCATTGTCTGTATCAAAGTTGAAAGACTTCACAGGAAGGGACAAGCCAA CAGTCATCACA >R GCGTCCTCTTCCTGTTTAAGAATAGAAACCATCTTCTCTTCCACATTCTC TAAGCTTAAGCAATCTAATCCAAATCGAAATGCCACTAATATCATTTCTT CTTCTAATTCTTCTCGTCTTTTGTATCCAGAACTTCCTATTTTAAGAACA ACCTCACCTTCTTTTCGCTCCCTCTCTATCAAAGCTTCCTCTTCGACTGC CATCGCTGAACCAGAAGGCATCAAGATTAATTCACTTCCAACTAAGCCTA TTGAAGGTCAGAAGACAGGAACTAGTGGTCTTCGAAAGAAGGTTAAAGTT TTCATGCAAGAAAATTACCTAGCAAATTGGATCCAGGCATTATTTAATTC ATTACCGCCAGAGGATTACAAGAATGGGTTATTGGTCTTAGGAGGAGATG GTCGTTATTTCAACAAAGAAGCTGCACAGATAATCATCAAAATTGCGGCT  120 GGAAATGGTGTTGGTAAAATCTTAGTGGGCAAGGAAGGTATTATATCTAC ACCAGCTGTTTCTGCTATAATCAGAAAGCACAGG---------------- -----GCGAATGGTGGATTTATAATGAGTGCAAGTCATAATCCTGGAGGC CCTGAATATGATTGGGGTATCAAGTTTAATTATAGCAGTGGGCAACCTGC ACCTGAATCAATCACCGACAAGATCTATGGGAATACCCTTTCTATCTCTG AGATTAAAATGGCAGACATTCCTGATGTTGATCTTTCTTCTCTTGGAGTT GCAAAACATGGAAACTTCATTATTGAAGTAGTGGACCCAGTTTCTGATTA TTTGGAGCTAATGGAGAATGTATTTGATTTTGAACTCATCAGAAGTCTTC TTTCACGTTCAGATTTCAGGTTTATATTTGATGCCATGCATGCTGTTACT GGTGCTTATGCAAAGCCCATCTTTGTGGACAAGCTGGGGGCTAGTCCGAA TTCAATTTTAAATGGAAGTCCTTTGGAGGATTTTGGGCATGGTCATCCTG ATCCTAATCTTACATATGCCAAGGATTTGGTGAATATT---TATGGTGAG AATGGGCCTGATTTTGGCGCTGCAAGTGATGGAGATGGTGACAGAAAT-- -ATCCTAGGTAGAGGGTTTTTTGTTACTCCTTCAGATTCTGTTGCTATCA TTGCTGCCAATTCGCAGGGAGCAATTCCATACTTCAAGAATGGCCCTAAG GGTTTAGCTCGGTCCATGCCAACAAGTGGTGCACTGGATCGTGTGGCTGA AAAATTAAATCTACCTTTTTTTGAGGTCCCCACTGGCTGGAAATTTTTTG GAAATCTTATGGATGCTGGAAAGTTGTCAATTTGTGGGGAAGAAAGTTTT GGAACTGGTTCTGATCACATTCGTGAGAAGGATGGCATATGGGCAGTGTT AGCTTGGCTTTCAATTATTGCTCACAGAAATAGGGACAAGAAACCAGGGG AGAAGTTAATATCTGTTTCTGATATTGTGAAAGAATACTGGGCAACATAT GGAAGAAATTTCTTTTCTAGATACGACTATGAAGAATGCAAGTCTGAAGG AGCAAATAAAATGATAGACTATCTTAGAGATTTGATTTCTAAGAGCAAAC CGGGTGAAAAGTATGGAAGTTATGTCCTTCAGTTTGCTGATGACTTCAAG TACACTGATCCTGTCGATGGAAGTGTGGTCTCAAAGCAAGGGGTCCGGTT TGTTTTTACTGATGGGTCAAGGATCATTTTCCGGTTATCTGGAACTGGAT CTGCAGGTGCAACTGTTAGAATGTATATCGAACAGTTTGAACCTGATGTG TCTAAACACGAGATGGATGCCCAAACAGCCTTAAAACCGTTAATAGACCT GGCATTGTCTGTATCAAAGTTGGAGGACTTCACAGGAAGGGAGAAGCCTA CAGTCATCACA >O ---GCCTCGCACGCGCTCCGCCTCCACCCGCTGCTCTTCTCCGCCGCCGC CGCGCGCCCGGCTCCGCTCGCGGCGCGGCCCGGTGGTGGT---------- -----------------------------GCCCGCCGGGTCCACCGC--- ------------CGCCACTCTCTCGCCGTCGTCCGGTGCTCCTCCTCCGC C---------GCCCAGGCGCTCAAGATCAAGTCGATTCCGACCAAGCCCG TTGAGGGGCAGAAGACCGGGACCAGTGGGTTGAGGAAGAAGGTGAAAGTG TTCCAGCAGGAGAATTACCTCGCTAATTGGATTCAGGCTCTGTTCAATTC ATTGCCCCCGGAGGATTATGTTGGTGGAACCCTTGTGCTTGGTGGTGATG GCCGATACTTTAACAAGGATGCTGCTCAGATTATCACTAAAATTGCAGCT GGGAATGGTGTTGGGAAGATCCTAGTTGGCAGGAACGGTCTGCTGTCAAC GCCTGCTGTATCTGCAGTAATTCGTAAAAGACAA---------------- -----GCCAATGGTGGCTTCATCATGAGTGCAAGCCATAATCCAGGTGGG CCAGATAATGATTGGGGTATCAAGTTCAACTATAGCAGTGGGCAGCCAGC ACCAGAGACAATTACCGACCAAATATATGGAAACACACTTTCGATTTCTG AAATAAAAACGGCAGATATTCCTGATGTTGATTTGTCCTCTCTAGGAGTT GTAAGCTATGGTGATTTCACCGTTGAAGTGATAGACCCTGTCTTGGACTA CCTTGAGCTAATGGAGAATGTGTTTGACTTCCAACTTATCAAGGGCTTGT TGTCTCGGCCAGATTTCAGGTTTGTATTTGATGCCATGCATGCTGTGACT GGTGCATATGCGGATCCTATTTTTGTTGAGAAACTTGGAGCTGATCCGGA CTATATATTAAATGGTGTTCCACTTGAAGATTTTGGCAATGGTCACCCTG ATCCTAATTTAACTTATGCCAAAGAGCTTGTGTTTACCATGTTTGGAAGC GGAGCACCTGACTTTGGTGCAGCAAGTGATGGTGATGGTGATCGAAACAT GATTCTTGGAAGAAGGTTCTTTGTTACACCATCAGACTCTGTTGCAATAA TTGCAGCGAATGCACAGGCAGCAATTCCTTATTTCCAATCTGGTCCAAAA GGTCTTGCTAGATCAATGCCAACGAGTGGTGCTCTTGATCGTGTAGCTGA TAAATTGAATGTTCCGTTCTTTGAGGTACCAACAGGATGGAAATTTTTTG GAAACCTAATGGATGCAGGTAAATTGTCTATATGTGGAGAGGAAAGTTTT GGGACAGGATCTGATCACATCAGGGAGAAGGATGGCATATGGGCTGTTCT AGCTTGGCTGTCCATACTTGCACACCGGAACAAGGATAAGAAGGCCGGGG AGAGATTAGTGTCAGTGGAAGATGTAGCTAGGGAACACTGGGCAACCTAT GGAAGGAATTTCTTCTCCAGATATGATTATGAGGAGTGTGAATCTGAGAG TGCAAATAAGATGATGGAGCATCTTAGAGATGTGATCGCAAAAAGCAAGC CTGGAGAGAAATATGGAAACTATACCCTTCAGTTTGCCGATGATTTCAGT TACACTGATCCGGTGGATGGTAGCACTGTATCTAAACAAGGGCTTCGATT TGTATTCACCGATGGATCTAGGATTATCTTCCGCCTTTCGGGAACCGGAT CTGCTGGAGCAACAATCCGTATATACATTGAGCAATTCGAGTCTGATGCC TCAAAGCATGATCTGGATGCACAAATAGCTTTGAAGCCTTTAATAGACCT AGCTCTATCTGTTTCAAAGTTGAAGGACTTCACTGGAAGAGATAAGCCTA CTGTCATAACA >V ------------------------GATAGTGTCTTCTTTTCAACCCTCAA ACTCACTCCACTACCCAATGCCTCTTTCTCCAATCGCCACTTCGCTTCTC TTTCT------------CTTCTCTCTCGCAAGTTCCCTATCAGGAGA--- ------------CTCTCCGTTAAAGCCTCTTCTTCTGCGCCTTCCACCTC  121 CACTGCCAACTCTCAGACCATCAAGATCATATCGATGCCCACAAAGCCGA TTGAAGGCCAAAAGACTGGAACCAGCGGTCTACGAAAGAAGGTTAAAGTT TTTATAGAAGAAAATTACCTTGCGAATTGGATTCAGGCGCTGTTCAATTC ATTGCCACCTGAGGATTACAAGGATGGGGTGTTGGTTTTAGGCGGTGATG GCCGATATTTCAACCGGGAAGCTGCACAGATAATTATCAAAATTGCAGCA GGAAATGGCGTTGGAAAAATATTAGTTGGCAAGGAAGGCATCATGTCAAC TCCAGCTGTTTCTGCTGTAATCCGGAAGCAAAAGGCAAAGCATATTCCTC TCCTTGCCAATGGAGGTTTTATAATGAGTGCAAGCCATAATCCTGGTGGG CCTGAATATGATTGGGGCATCAAGTTTAATTACAGCAGTGGACAACCTGC ACCTGAAACCATCACAGACAAGATTTATGGGAACACTCTTTCGATCTCTG AAATTAAGGTA---GACATCCCAGACATTGATCTTTCTTGTCTTGGAGTC ACAACATATGGGAATTTCAGTGTTGAAGTTGTAGATCCAGTTTCTGATTA TTTGGAGCTACTGGAGAATGTATTTGACTTCCAGCTCATTAAAGGTCTTC TTTCGCGGTCAGATTTCAGGTTTACGTTTGATGCCATGCATGCAGTTACA GGCGCCTATGCAAAACCCATCTTTGTGGACAAGCTAGGAGCCAGTCCAGA TTCAATTTCAAATGGAGTACCTCTGGAAGATTTTGGGCATGGTCATCCAG ATCCTAATCTTACGTATGCTAAGGATTTGGTGAATATTATGTATGGTGTT AATGGACCTGATTTTGGAGCCGCAAGTGATGGAGATGGTGATAGAAACAT GATTCTAGGAAGGAGTTTTTTTGTTACACCTTCAGACTCCGTTGCTATTA TTGCTGCAAATGCTCAAGAAGCCATTCCATATTTTCAGAGTGGCCCCAAG GGTTTAGCTCGATCTATGCCAACGAGTGGTGCTCTTGATCGTGTTGCTGA AAAATTGACTCTTCCATTCTTTGAGGTCCCCACTGGATGGAAATTTTTTG GGAACCTT---GATGCTGGAAAGTTGTCTATTTGTGGGGAAGAAAGTTTT GGAACAGGTTCTGATCACATTCGTGAGAAGGATGGCATATGGGCTGTTCT AGCTTGGCTTTCAATCATTGCATATAGAAACAAGGACAAGAAACCTGGAG AGAAATTGGCATCTGTTGCTGATGTCGTAAAGGAGCACTGGGCAACATAT GGAAGGAACTTCTTTTCTAGATATGACTATGAAGAATGTGAATCTGAAGG TGCCAATAAAATGATAGAATATCTTAGAGATTTGGTCTCTAAGAGCAAGG CAGGTGAAAAGTATGGAAATTATGCACTTCAATTTGCGGATGACTTCTCA TACACTGATCCTGTGGATGGAAGTGTGGCATCAAAGCAAGGTGTTCGATT TGTTTTTACGGATGGATCAAGGATCATATATCGTTTATCAGGAACCGGTT CTGCAGGTGCAACTGTTAGAATTTATATTGAACAGTTTGAGCCAGATGTC TCTAAACATGAAATGGATGCCCAAGCAGCATTGAAGCCATTGATAGATTT GGCGTTATCTTTGTCGAAGCTCAAGGACTTCACAGGAAGGGAGAAACCTA CAGTGATCACA    LUT.LUT1.fasta >A ---GAGTCTTCACTCTTTTCTCCATCTTCCTCTTCTTACTCTTCTCTCTT CACTGCAAAA---CCTACGCGTCTTTTATCACCAAAACCCAAATTCACAT TC---TCCATCAGATCCTCCATTGAGAAACCCAAACCC------------ ------AAACTCGAGACCAATTCATCGAAATCCCAATCATGGGTCAGTCC CGATTGGCTCACAACACTCACTCGTACCCTTTCC------TCAGGA---A AAAACGACGAGTCAGGTATACCAATCGCGAACGCGAAGCTCGACGATGTC GCTGATCTCCTCGGAGGTGCTCTCTTCTTACCTCTCTACAAATGGATGAA G---TACGGACCCATTTACCGTCTCGCTGCTGGTCCTCGTAATTTCGTAA TTGTGAGCGACCCAGCGATAGCTAAACATGTTTTGAGGAATTATCCA--- ---AAGTACGCTAAAGGCTTAGTCGCTGAAGTCTCTGAATTTCTATTTGG TTCGGGTTTCGCTATCGCTGAAGGACCTCTTTGGACAGCGAGGCGTAGAG CGGTGGTTCCATCGCTTCACAGGAGGTATTTGTCTGTGATTGTGGAGAGA GTATTCTGCAAATGTGCAGAGAGGCTTGTTGAGAAGTTGCAGCCTTATGC AGAAGACGGAAGTGCTGTGAATATGGAAGCGAAGTTCTCTCAGATGACAC TTGATGTCATTGGGTTGTCTCTTTTTAACTACAATTTCGATTCTTTGACT ACTGATAGTCCTGTCATTGAAGCTGTTTACACTGCTCTTAAAGAAGCTGA GCTTCGTTCTACTGATCTTCTGCCATATTGGAAG---------------- --------------------ATCGATGCATTGTGTAAGATAGTCCCGAGA CAGGTGAAAGCTGAAAAGGCTGTAACTTTGATAAGGGAAACTGTTGAAGA CCTTATTGCTAAGTGTAAAGAAATTGTCGAAAGAGAAGGCGAAAGAATCA ATGATGAGGAGTATGTAAATGATGCTGACCCAAGTATCCTGCGTTTCTTG CTTGCAAGCAGAGAAGAGGTATCAAGTGTGCAGTTACGGGATGATCTTCT CTCAATGCTCGTAGCGGGTCATGAAACCACTGGATCTGTCCTCACTTGGA CACTTTATCTCCTAAGTAAGAACTCATCTGCATTAAGGAAAGCACAAGAA GAAGTAGACAGAGTGTTAGAAGGAAGAAACCCGGCTTTCGAGGATATAAA GGAGTTGAAGTACATCACTCGTTGTATAAACGAGTCAATGCGTCTCTATC CTCATCCTCCTGTCTTGATAAGAAGAGCTCAAGTTCCTGACATTCTTCCT GGGAACTATAAGGTCAATACCGGACAAGACATTATGATTTCAGTCTATAA CATCCATCGTTCTTCCGAGGTATGGGAAAAAGCTGAGGAATTTCTGCCTG AACGATTCGACATAGATGGCGCAATCCCTAACGAAACAAACACTGATTTC AAATTCATCCCATTCAGTGGAGGGCCTAGAAAATGTGTAGGCGATCAGTT TGCATTGATGGAGGCAATTGTGGCACTCGCGGTGTTTCTTCAGCGGTTAA ACGTTGAGCTGGTTCCTGATCAGACCATTAGCATGACCACAGGAGCAACC ATACACACCACCAATGGATTGTATATGAAGGTGAGCCAAAGG-------- ----------------------------------  122 >P ------TCACTCACCTTCTCCGTCTCCTCTCTTCATCCTCTCTACAAGTA CAAACCCATC---TCCACCACCACTCTCCCTCCAAAACCTCGG------T TTCTGTCCATCAAATCTTCTTTAGACGACGAAACC--------------- ------------------------CAAAAACAAACCTCTTGGGTCAGCCC AGACTGGCTAACGTCCCTCACTCGCTCCTTATCC------TTAGGC---C GAAACGATGATTCAGGGATTCCCATTGCCAGTGCTAAGCTTGAAGATGTG TCTGATCTTTTAGGTGGTGCTTTGTTTCTCCCTTTGTTTAAATGGATGAA TGATTATGGGCCCATTTACCGTCTCGCTGCTGGCCCTAGAAATTTCGTTA TAGTTAGC---CCTGCTATTGCTAAACATGTTTTAAAAAATTATGGTACT ---AAGTATGCCAAAGGCCTTGTTGCTGAAGTCTCTGAGTTTCTCTTCGG CTCCGGTTTTGCTATCGCCGAGGGCCCACTTTGGACTGCAAGGCGCAGGG CAGTGGTGCCTTCACTGCACAGGAAGTATTTGTCAGTGATAGTTGAAAGG GTGTTTTGCAAATGTGCAGAAAGGTTGGTGGAGAAGTTACAAGCTGATGC ATTGAATGGCAATGCTGTAAATATGGAAGAGAAGTTTTCTCAATTGACAC TCGATGTCATTGGTCTTTCAGTATTCAACTACAATTTTGATTCATTAACT ACTGATAGTCCTGTTATTGATGCTGTTTACACTGCATTGAAAGAGGCAGA GGCTCGTGCCACTGACCTTTTGCCATATTGGAAGGCATGCAAATCCATGA GTTTCTTCATTATTCTCCGTATTGATGCTTTGTGTAAGATTATACCGAGG CAAATAAAAGCGGCAAAGGCGGTTATGGTTATTAGGCAAACTGTTGAGGA ACTTATTGAGAAATGCAAAAAGATTGTGGAAATTGAGGGTGAGAAAATAA ATGAGGAGGAATATGTGAACGACAATGATCCGAGCATTCTCCGGTTTTTG CTCGCCAGCAGGGAAGAGGTTTCAAGTGTACAGTTACGAGATGACCTACT GTCAATGTTGGTTGCTGGCCATGAGACAACTGGTTCAGTATTGACTTGGA CTTTGTATCTCCTGAGTAAGGATTCTTCTACATTGATGAAAGCACAAGAA GAGGTTGACCGAGTACTACAGGGAAGGCCTCCTACCTATGATGATATAAA GGATCTAAAGTATTTGACACGCTGCATAAATGAGTCCCTACGTCTCTACC CACATCCTCCGGTCTTGATAAGAAGAGCTCAAGTTGCTGATGTGCTTCCT GGTAATTATAAGGTTAATGCTGGACAAGATATAATGATTTCAGTGTACAA TATTCATCACTCCTCCAAGGTCTGGGAGAGAGCAGAAGAGTTTGTGCCAG AGAGATTTGGCTTGGATGGCCCAGTGCCTAATGAATCAAACACAGATTTT AGGTTCATTCCTTTCAGTGGAGGACCCCGTAAATGCGTTGGTGACCAGTT TGCTTTACTTGAAGCCATTGTTGCACTTGCAATCTTTCTACAGAAAATTA ACTTTGAGCTGGTTCCTGATCAGAACATCCGCATGACTACTGGAGCAACA ATACACACTACAGATGGCCTGTACATGAAACTCAGCCAAAGAGACACT-- ---------------------------------- >R ------CCACTCTCTTATTCTTTCGTATCTTTCTCTCATCTTTCAGTCCC TCTCATCAAG---CCCGCCACAATTCTCACTTCAAAGCCTCAT------T TCATCTCAATCAAATCATCACTGGACAACAAAACACCA------------ ------AAACCCAATTCCAATAATACAAAACCCAGTTCTTGGGTAAGCCC AGATTGGCTAACTTCACTCACTAAAACCCTCACA------TTAAACCAAA AACATGATGACTCTGGTATTCCTATCGCTAGTGCTAAGCTTGAGGATGTG TCTGATCTTTTGGGTGGTGCTTTGTTTCTTCCTTTGTTTAAATGGATGAA TGAGTATGGTCCTATCTATAGGCTTGCTGCTGGTCCTAGAAATTTTGTTG TTGTTAGTGACCCTGCTATTGCTAAACATGTGCTTAGAAATTATGGTGAT GGAAAATATGCTAAAGGTCTTGTTGCTGAAGTTTCTGAGTTTTTGTTTGG GTCTGGTTTTGCTATTGCTGAGGGATCCCTGTGGACGGCAAGGCGCAGGG CTGTTGTTCCATCTCTTCATAAGAAGTATCTGTCAGTTATAGTTGATAGA GTATTTTGCAAGTGTGCTCAGAGATTAGTGGAGAAGCTTCAACCTGATGT GCTTAATGGCACTGCAGTAAATATGGAAGAAAAATTCTCTCAATTAACTC TTGATGTTATTGGTCTTTCAGTATTTAACTACAATTTTGATTCCCTCACC ACTGATAGCCCTGTTATTGGTGCTGTTTATACTGCATTGAAAGAGGCAGA GGCTCGTTCTACAGATCTTTTGCCATATTGGAAG---------------- --------------------GTCAAAGCTTTACGTAAGATAATTCCTAGA CAAATAAAAGCTGAAAAAGCAGTTACAGTAATAAGGCAAACAGTCGAAGA ACTTATTGTAAAATGCAAAGAGATTGTGGACACTGAGGATGAAAGAATAG ATGATGAGGAATATGTAAATGACACTGATCCAAGCATCCTTCGCTTCTTG CTTGCCAGCAGGGAAGAGGTTTCAAGCGTACAATTACGTGATGACCTGTT ATCGATGTTAGTTGCTGGCCATGAGACAACTGGTTCGGTGTTGACTTGGA CATTGTATCTTCTGAGTAAGGATCCTGTCTCACTACTGAAGGCACAAGAA GAGGTTGACCGTGTATTACAAGGAAAGCCTCCATCATATGAAGATATAAA GGATCTGAAGTTTCTGACACGCTGCATAAATGAGTCACTGCGTCTATATC CACATCCTCCTGTCTTGTTGAGAAGAGCTCAGGTTGCTGATGTACTCCCA GGAAATTACAAGGTTAATGCTGGTCAAGACATAATGATTTCTGTATACAA TATCCATCATTCCTCGAAGGTCTGGGATAGAGCAGAAGAGTTTGTGCCAG AAAGATTTGACTTGGAAGGCCCAGTGCCTAATGAAACAAATACAGATTTC AGGTTTATTCCTTTTAGTGGAGGACCCCGTAAATGTGTTGGTGATCAATT TGCTTTACTCGAAGCCATTGTTGCCCTCGCGATCTTTCTACAGAATATGA ACTTTGAACTGGTTCCTGATCAAAAGATTAGC---ACTACTGGGGCAACA ATACATACAACAAATGGCTTGTACATGAAACTCGGCAAAAGGAAAAAAAT CCAGGCA------TTTGCTTTGTCTTCTGCAAGG >O GCCGCCGCCGCCGCCGCCGCCGTCCCGTGCGTACCATTCCTGTGCCCGCC T------------CCTCCGCCATTGGTCTCGCCGCGTCTCCGCCGTGGCC  123 ACGTCCGCCTCCGCCTGCGGCCGCCAAGGAGCAGCGGCGGTGGAGGCGGA GGCGGAGCGGGGGGAGACGAGCCGCCCATCACCACCTCGTGGGTGAGCCC CGACTGGCTCACGGCGCTCTCCCGCTCGGTGGCAACCCGCCTCGGC---G GGGGCGACGACTCGGGGATCCCCGTCGCCTCCGCCAAGCTCGACGACGTG CGGGACCTCCTCGGCGGCGCGCTCTTCCTCCCTCTCTTCAAGTGGTTCCG CGAGGAAGGCCCCGTCTACCGCCTCGCGGCGGGGCCGCGGGATCTCGTCG TCGTCAGCGATCCCGCCGTTGCCAGGCACGTGCTGCGTGGGTACGGTTCG ---AGGTACGAGAAGGGGCTCGTCGCCGAGGTTTCCGAGTTCCTCTTCGG CTCCGGGTTCGCCATCGCCGAGGGCGCTCTCTGGACGGTGAGACGTCGAT CAGTTGTACCATCTCTACACAAACGATTTCTCTCGGTGATGGTTGACAGA GTTTTTTGTAAATGTGCTGAGAGATTAGTGGAGAAGCTTGAGACATCTGC TTTAAGTGGCAAACCTGTAAATATGGAAGCAAGGTTCTCTCAAATGACTT TAGATGTGATTGGTTTGTCCTTGTTCAATTACAATTTTGATTCCCTCACA TCAGATAGCCCTGTTATTGATGCTGTTTACACTGCACTCAAGGAAGCAGA ACTTCGTTCTACAGATCTTTTACCATACTGGAAG---------------- --------------------ATTGATTTGCTGTGCAAGATTGTTCCTAGA CAAATAAAAGCAGAAAAGGCAGTTAACATCATCAGGAATACCGTTGAGGA CCTAATTACCAAATGCAAGAAGATTGTAGATGCTGAGAATGAACAAATTG AGGGTGAGGAATATGTAAATGAGGCAGACCCTAGCATCCTGCGATTCCTA CTTGCTAGCCGTGAAGAGGTAACCAGTGTGCAGTTACGTGATGATCTATT GTCAATGTTAGTTGCTGGTCATGAAACAACAGGCTCTGTACTGACGTGGA CTATTTATCTTCTCAGTAAGGATCCAGCAGCGCTGAGGAGAGCTCAAGCA GAGGTTGACCGTGTTCTACAAGGTAGACTCCCCAGATATGAAGATCTAAA AGAGCTGAAGTACTTGATGCGCTGTATAAATGAGTCTATGCGGCTTTATC CACACCCACCTGTGTTGATACGGCGAGCCATAGTTGATGATGTGCTTCCC GGAAACTATAAGATCAAAGCTGGTCAAGATATTATGATTTCAGTGTACAA TATACACAGGTCACCTGAGGTTTGGGACAGAGCTGATGATTTTATTCCTG AGAGATTTGATTTAGAGGGACCTGTTCCAAATGAGACAAACACTGAATAC AGATTTATCCCATTCAGTGGAGGTCCTCGGAAATGTGTTGGAGATCAGTT TGCTCTCTTGGAAGCAATTGTGGCACTTGCTGTTGTGTTGCAGAAGATGG ACATTGAGCTTGTGCCAGATCAAAAAATTAACATGACTACTGGGGCCACA ATTCATACAACCAATGGCCTGTATATGAATGTAAGTCTGCGTAAAGTTGA CAGGGAACCTGATTTTGCACTCAGTGGGTCCAGA >V ------CCTAGTTTGATGTCTCTCTCTTCTTTCGCACTCCTCACACCCCC TACCTTCAACTTCAAACCCACCACACTCCCTCCTAATCCCTCACTTCCCT ATCTCTCCATAACATGTTCCTCAGACAACAACCCT--------------- ------------------AAACCAACCAGAAGCAGCTCCTGGGTGAGCCC TGACTGGCTGACCTCTCTGAGCCGGTCTCTCACC------ATGGGC---- --CAAGACGACTCCGGTATACCCATGGCCACTGCTAAACTGGATGACGTG TCTGAGCTCCTGGGTGGTGCCCTCTTCCTTCCTTTGTTCAGATGGATGAA TATGTACGGACCCATTTACCGGCTCGCCGCCGGGCCCCGCAATTTTGTGG TTGTCAGTGACCCCGCTATTGCTAAGCATGTTCTGAGGAATTATGGC--- ---AAATACGCCAAGGGTCTCGTGGCCGAGGTTTCGGAGTTTTTGTTCGG ATCGGGTTTTGCCATTGCGGAAGGCGAGCTTTGGACGGTGAGGCGCAGGG CTGTGGTTCCTTCTCTTCACAAGCGATACTTATCCATAATTGTTGATCGG GTGTTTTGCAAATGTGCTGAGAGATTGGTAGAGAATCTTAGAACTGATGC ACTCAATGGCAGTGCTGTAAACATGGAGGAGAAGTTTTCTCAATTGACTC TGGATGTCATCGGTCTATCTGTGTTCAACTACAATTTTGATTCACTTACT GCTGATAGTCCTGTTATTGATGCAGTTTACACTGCATTGAAAGAGGCTGA GGCTCGATCAACTGACCTTTTACCATACTGGAAGGCAATTCCTAACTCAC ACCCT---------------TTCTTACTTTTTTTCTTTATAATCCCTAGA CAAATAAAAGCTGAAGAATCAGTAACAGTGATAAGGAAAACTGTAGAAGA ACTTATTGCTAAGTGCAAAGAAATTGTGGAAAGAGAGGGTGAGAGGATTG ATGAGGATGAATATGTTAATGACTCAGATCCAAGCATCCTTCGTTTCTTG CTTGCTAGCAGAGAAGAGGTTTCAAGTGTGCAATTACGAGATGACCTTTT ATCAATGTTGGTTGCTGGGCATGAGACCACTGGTTCAGTGTTGACTTGGA CATTATATCTTTTAAGTAAGAACTCTTCTTCTCTGATGAAAGCACAAGAA GAGGTCGACAGGGTTTTACAGGGAAGGTCTCCCTCGTATGAAGATATAAA GGATCTCAAGTTCTTAACACGTTGCATAAATGAGTCCATGCGTCTATACC CTCATCCTCCTGTTTTGATAAGAAGAGCTAAAGTCGCTGATGTGCTTCCT GGAAATTACAAGGTCAATGCTGGTCAAGATATAATGATTTCAGTATATAA TATCCATCACTCCTCTCAGGTCTGGGAAAGAGCAGAAGATTTTCTGCCGG AAAGATTCGACTTAGAAGGTCCTGTGCCTAATGAAACAAATACAGATTTC AGATTCATTCCATTTAGTGGGGGCCCACGTAAGTGTGTTGGTGATCAGTT TGCTTTGCTGGAAGCGATTGTTGCACTTGCAATCTTTGTGCAGCACATGA ATTTTGAGCTGGTTCCTGATCAGAATATTAGCATGACTACCGGGGCAACT ATTCATACAACAAATGGCTTGTACATGAAATTGACTCAAAGGCAAATTCC ATCTGCA------TTTGTTCCAACATCTTCTAGG    pre-BR.1.14.99.7.fasta >A --------------------------------------------------  124 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------GAGTCACAATTATGGAATTGGATCTTACCTCTT TTGATCTCTTCTCTCCTCATCTCCTTCGTCGCTTTCTATGGATTCTTCGT CAAACCGAAGCGGAACGGT------------CTCCGTCACGATCGGAAAA CTGTTTCTACCGTCACCTCCGACGTCGGATCTGTTAATATTACCGGAGAT ACTGTC---------GCTGATGTCATTGTTGTTGGAGCTGGTGTTGCTGG TTCTGCTCTTGCTTATACTCTTGGAAAGGATAAACGCCGAGTTCATGTGA TTGAAAGAGATTTATCGGAGCCTGATCGTATTGTTGGGGAGTTGTTACAG CCTGGGGGTTACCTCAAGTTACTGGAGTTGGGAATTGAAGATTGTGTGGA AGAAATAGATGCTCAGCGTGTGTATGGTTATGCACTTTTTAAAAATGGGA AACGCATTCGCTTAGCTTATCCTTTGGAGAAGTTTCACGAAGATGTATCT GGAAGGAGCTTTCACAATGGACGTTTTATTCAAAGAATGCGGGAGAAAGC TGCTTCACTTCCCAATGTTCAGCTAGAGCAAGGAACAGTTCTTTCTCTTC TAGAAGAGAATGGGACTATCAAAGGTGTGAGATATAAGAATAAAGCAGGA GAGGAACAAACCGCATTTGCAGCTTTGACTATAGTTTGTGATGGTTGTTT CTCAAACCTGCGTCGCTCTTTGTGCAATCCTCAGGTCGAGGTGCCTTCTT GTTTTGTCGGGTTGGTCCTAGAGAACTGCAATCTCCCATATGCAAACCAT GGACATGTCGTCTTAGCAGATCCATCACCAATTTTGATGTATCCAATTAG TAGCACAGAGGTGCGGTGCCTAGTTGATGTTCCCGGCCAGAAAGTGCCGT CCATTGCAAATGGTGAAATGAAAAACTATTTGAAGACTGTTGTGGCTCCT CAGATGCCTCATGAGGTCTATGACTCTTTCATTGCTGCGGTTGATAAAGG AAATATTAAGTCCATGCCAAACAGAAGCATGCCAGCTTCTCCTTATCCTA CTCCAGGGGCTCTGTTAATGGGAGATGCATTTAACATGCGTCATCCTTTG ACGGGTGGAGGAATGACGGTTGCATTAGCTGACATTGTTGTCCTGCGTAA TCTCCTTAGACCGCTGCGTGATCTTAGTGACGGCGCTAGTCTCTGCAAAT ATCTTGAATCATTTTACACTCTGCGAAAGCCAGTTGCAGCAACAATCAAC ACCCTTGCGAATGCTCTTTACCAAGTGTTCTGTTCATCAGAAAATGAAGC AAGAAACGAGATGAGGGAAGCTTGCTTCGATTATCTGGGCCTCGGGGGTA TGTGCACAAGTGGACCAGTATCTTTGCTTTCGGGTTTGAACCCTCGACCA TTAACACTTGTCTGCCATTTCTTTGCGGTTGCGGTTTATGGAGTCATACG GTTGTTAATCCCATTCCCTTCCCCAAAACGAATCTGGCTTGGAGCCAAAT TAATCTCGGGAGCATCGGGGATAATATTTCCGATAATAAAAGCGGAAGGA GTG---CAGATGTTTTTCCCAGCAACTGTACCTGCATACTACTACAAAGC TCCT---ACAGTTGGAGAAACCAAATGTTCA >P -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------GCGGATCAGTGCATGCCAGGATGGATCTTAGCTACT CTGTTTGGTCTC------------TCTGCTATCTATTATTTGGTAACCAA GAAAAAGGAACAGAGAGCTAATAAGGATTTGTTGGAGGCGAGAAGCGAGT CCGTTAATAGCATAGCCACCACC------AGTGGAGAATGCAGATCCAGT AATGTTTCCGAT---GTCGACGTTATCATTGTCGGCGCCGGTGTTGCTGG CGCTGCTCTCGCTCATACTCTTGGCAAGGATGGACGTCAAGTGCATGTCA TTGAAAGAGACTTGACTGAGCCTGATAGGATTGTGGGTGAATTTCTACAG CCAGGGGGTTACCTTAAGTTAATTGAATTGGGACTTGAAGATTGTGTGGA GAAAATTGATGCTCAGAGGGTGTTTGGTTATGCACTTTTCAAGGATGGAA AACATACTCGACTCTCTTATCCTTTGGAAAAGTTCCACTCAAATGTAGCT GGAAGGAGCTTTCACAATGGGCGTTTCATACAGAGAATGCGGGACAAAGC TGCGTCCCTCCCCAATGTACAATTGGAGCAAGGAACTGTCATATCTCTAC TTGAAGATAAAGGGACTATTAGAGGCGTGCAGTACAAAACAAAAGATGGG CAAGAGCTGAAGGCATTTGCACCTCTGACAATTGTTTGTGATGGCTGTTT CTCAAACCTGCGCCGCTCCCTTTGCAACCCTAAGGTGGATGTGCCCTCTT GTTTTGTTGGCATGGTCCTGGAGAATTGCCAGCTTCCATGTGCAAATCAT GCTCATGTTATCTTAGGGGATCCGTCTCCGATTTTGATGTATCCTATTAG CAGTACCGAGGTCCGCTGTCTGGTTGATGTACCTGGTCAGAAGGTTCCTT CCATTTCAAGTGGTGAAATGGCAAAATATTTGAAGACTGTGGTGGCACCT CAGCTTCCCCCAGAAGTTTATGATGCCTTTCTAGCTGCTGTTGATAAAGG AAATATAAGGACAATGCCAAACAGAAGCATGCCAGCTGCTCCTTATCCTA CTCCTGGTGCATTGTTGATGGGCGATGCATTCAACATGCGTCATCCTCTT ACCGGGGGAGGAATGACTGTTGCATTGTCTGACATTGTTGTTTTACGGAA TCTTCTCAGGCCTTTGCGCAACCTTAATGATGCACCTACACTCTGCAAAT ATCTTGAATCTTTCTACACCTTGCGCAAGCCTGTAGCATCCACAATCAAT ACACTGGCAGGTGCCCTCTACAAGGTTTTTTGTGCTTCACCTGATCAAGC AATGAAGGAAATGCGTCAGGCGTGCTTTGATTATTTAAGTCTTGGAGGCG TTTTTTCAGCAGGACCCGTGTCTTTGCTCTCAGGCTTAAACCCCCGTCCG TTGAGCTTGGTTGCCCACTTCTTTGCGGTTGCTATATACGGGGTTGGGCG TTTGTTACTGCCATTCCCTTCACCTAAACGCATCTGGATTGGAGCTAGAT TGATTTCAGGTGCATCAGGAATCATCTTCCCCATCATTAGGGCAGAAGGA GTTAGACAGATGTTCTTCCCTGCAACTGTTCCAGCATATTAT---AGAGC  125 TCCT---CCAGTC---------AAG------ >R -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------GCGGATAATTACTTGTTAGGATGGATCTTATGTTCT ATAATAGGACTGTTTGGATTGTATTATATGGTGTATTTGGTGGTCAAAAG AGAAGAAGAAGATAACAACAGAAAAGCTCTGTTACAAGCAAGAAGTGACT CCGCCAAAACTATGTCCGCCGTCAGTCAAAATGGAGAATGCAGATCCGAT AACCCTGCCGAT---GCTGACATCATCATCGTTGGTGCTGGCGTTGCTGG TTCCGCTCTGGCTCATACTCTCGGCAAGGATGGGCGTAGAGTGCATGTTA TTGAAAGAGACTTGACTGAACCTGACAGAATTGTTGGTGAATTGCTACAA CCGGGGGGCTATCTAAAGTTAATTGAGTTAGGACTTGAAGATTGTGTGGA AGAAATTGATGCACAGCGGGTGTTTGGTTATGCACTTTTTATGGATGGGA AACACACCCAACTCTCTTATCCCTTGGAAAAGTTTCACTCTGATGTAGCA GGGCGGAGCTTCCACAATGGGCGTTTTATACAGAGGATGCGGGAGAAAGC TTCATCTATTCCTAATGTACGATTGGAACAAGGAACTGTCACTTCTCTAA TTGAAGAAAAAGGGATAATCCGAGGAGTGGTTTACAAAACGAAAACTGGT GAAGAGCTCACAGCTTTTGCACCACTAACAATTGTTTGCGATGGTTGTTT CTCAAACTTGCGTCGCTCCCTTTGCAACCCCAAGGTGGATGTGCCCTCTT GTTTTGTTGGTTTGGTCTTGGAGGATTGCAAACTTCCATATCAATATCAT GGGCACGTTGTATTGGCAGACCCTTCCCCAATTCTGTTCTATCAGATCAG TAGTACAGAAGTTCGCTGTCTAGTTGATGTACCTGGCCAGAAGGTTCCTT CTATTTCAAATGGGGAGATGGCAAAATATTTGAAGAATGTGGTGGCACCT CAGGTTCCGCCAGAAATATATGATTCCTTTGTAGCTGCAGTTGATAAGGG AAACATTCGGACAATGCCAAACAGAAGCATGCCTGCTTCTCCTTATCCTA CTCCTGGTGCATTATTGATGGGTGATGCATTCAACATGCGCCATCCTCTG ACTGGGGGAGGAATGACTGTGGCACTATCTGACATTGTTGTGTTGCGGGA ACTTCTGAAGCCCTTGCGTGACCTGCATGATGCACCTACTCTCTGCAGAT ATCTTGAATCCTTCTACACCTTGCGAAAGCCTGTGGCATCTACAATCAAT ACGCTTGCAGGTGCCCTCTACAAGGTGTTTTGTGCTTCATCTGATGAAGC AAGGAATGAAATGCGGCAGGCTTGCTTTGATTATTTGAGTCTAGGAGGTG TATTCTCAACTGGACCAATCTCTTTGCTCTCGGGTTTAAATCCTCGTCCA TTGAGCTTGGTTGTCCATTTCTTTGCTGTGGCAATTTATGGTGTTGGCCG TTTGTTACTGCCATTCCCTTCACCTAAGCGCGTCTGGGTTGGAGCTAGGT TGATATCGGGTGCATCAGGAATCATCTTCCCCATTATCAAGGCAGAAGGA GTTAGACAGATGTTCTTCCCCGCAACCGTCCCAGCATATTAT---AGAGC TCCT---CCTGTT---------GAATGCAAT >O AAAACCGGAGGGAGGAGTCCTCCTCTTCTTCCTCCTTCCCCTCCGCTCCC GATAAATCGGAACAATCTCGAAGCATCCGCCCGTCTCCGCCTGCTCCTCC CACCACCACCACCGCTGCTTCCCTTCTCCCCTCTCGCCCGCCGCCGCCTC GCCGCGACGCGCATCGGCGCCGCCCCACGACCGCAGCAGAGAAGCCCACC ACCACGCGCGGAGCGGCCGAGGAGGCCTCACCACTATTGGTGCGGGATGG CGGAGGTCGCCGCCGGCACCGGGCAGCTCATTGGCGTCGCCGTGGCCACG CTCCTCGCG---------------GCGATCTTCCTCGCCGCCGCGCTTCT TGGCAGCCGCCGGCGCCGGCGGCGGGCGCCGTTGGCAGGGAAGCCTGCGG CCGTGGGTGGCTGCGGGGTGGCCGACGGCGAAGGG---TGCGGCGGGGAT GGCCGG---------ACCGACGTCATCGTCGTCGGAGCCGGGGTCGCCGG ATCTGCGCTGGCATACACGCTCGGAAAGGATGGCCGTCGTGTGCATGTTA TAGAGAGAGACCTAACAGAGCCTGATAGAATTGTCGGTGAACTGTTACAA CCTGGTGGCTACCTGAAATTGATCGAGTTGGGTCTCGAGGATTGTGTTCA AGAAATAGATGCTCAGCGTGTCCTTGGTTACGCGTTATTCAAAGATGGGA AAGACACAAAACTCTCCTATCCCTTGGAGAAGTTCCACTCAGATGTTGCT GGTAGGAGCTTTCACAATGGACGGTTTATACAGAGGATGCGCCAGAAAGC TGCATCTTTGCCTAATGTTCAATTGGAGCAAGGAACTGTTACATCATTGG TTGAAGAAGATGGTACAGTTAAGGGTGTTAAATACAAGACCAAGTCAGGT GAAGAATTAAAAGCATATGCACCTCTGACAATTGTATGCGATGGCTGTTT CTCAAACCTTCGCCGCGCCCTTTGCTCTCCAAAGGTTGATGTACCATCTT GTTTTGTTGGGCTGGTCCTGGAGAATTGTCAACTTCCTCATGCAAACCAT GGCCATGTTGTCCTGGCCAATCCTTCACCTATCCTATTTTACCCAATAAG CAGCACTGAAGTTCGCTGTTTGGTTGATGTCCCTGGTCAGAAGGTGCCTT CCATAGCAAACGGTGAAATGGCAAAATATCTCAAAACAGTGGTTGCACCT CAGATTCCTCCAGAAATCTATGATTCATTCATAGCAGCCATTGATAAGGG AAGCATAAGAACAATGCCAAACAGGAGCATGCCGGCTGCTCCACATCCAA CCCCTGGTGCACTTTTGATGGGTGATGCATTCAACATGCGGCATCCTTTG ACTGGTGGCGGAATGACTGTTGCATTATCTGACATTGTTGTGCTACGTAA TCTTCTCAAGCCTCTCCGCAATCTGCATGATGCATCTGCTCTTTGCAAAT ACCTTGAATCATTCTATACACTGCGGAAGCCGGTTGCTTCTACCATAAAC ACATTAGCTGGTGCTCTATACAAGGTTTTCAGTGCCTCACCTGATCAGGC TAGGAATGAGATGCGCCAAGCCTGCTTTGATTACTTGAGCCTTGGAGGTG TCTTTTCAAATGGGCCTATTGCTCTTCTGTCTGGTCTGAATCCTCGACCA TTGAGTTTAGTGGCACATTTCTTTGCTGTCGCTATCTATGGTGTCGGTCG  126 CCTACTT---CCCCTCCCTTCACCTAAACGCATGTGGATCGGCGTAAGAC TGATTTCCAGTGCATGTGGTATAATTTTCCCCATCATCAAAGCTGAAGGT GTGAGGCATATGTTCTTCCCCGCCACTGTCCCTGCCTATTAT---CGTGC TCCTCGTCCAATG---------GAG------ >V -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------GTGGATCAGGGCATCCTGGGATGGATCTTCGCCTCC TTGCTGGGG---------------TTCGTCGTCTTCCGTAGCGTGCTTCT GAAGAACAAGAAGAAGGGC---GGTGCTTCTGTGGAGATCAGGGATGAAT GCGTGAAAAGCACCGCT------------AATGGAGAATGCAGATCGAAG ACCGCTTGCGAGGAGGCTGACGTCATCATCGTCGGGGCCGGCGTCGCGGG CGCCGCTCTGGCTAATACTCTCGGCAAGGATGGGCGTAGGGTACGCGTGA TTGAAAGAGACTTAACTGAGCCTGACCGAATTGTTGGTGAACTGCTACAG CCAGGGGGCTACCTCAAATTGATTGAGTTGGGGCTTCAAGATTGCGTAGA GGAAATTGATGCTCAGCGGGTGTTTGGCTATGCTCTCTTTAAGGATGGAA AGAATACGAAACTCTCTTATCCTCTGGAAAAATTCGATTCAGATGTTGCC GGAAGGAGCTTTCACAACGGCCGCTTCATACAAAGGATGCGAGAGAGAGC TGCAACCCTTCCCAATGTACAGTTGGAGCAAGGAACTGTTACATCTTTAC TTGAAGAAAAGGGGACCATTAGAGGGGTAAATTACAAGACTAAAGATGGT GAAACAATGACAGCATATGCTCCTTTAACCATTGTATGTGATGGTTGTTT CTCAAACTTGCGCCGCTCCCTTTGTACCCCTAAGGTAGATGTGCCCTCAT GTTTTGTCGGTTTGTTGCTGGAAGACTGTGAGCTCCCATTTGCAAATCAT GGGCATGTTGTTTTAGCAGATCCTTCTCCTATCTTGTTTTATCGTATCAG CAGTACAGAGATTCGATGTCTGGTTGATGTACCTGGTCAAAAGGTGCCTT CTATTTCAAATGGTGAAATGGCCAAGTATTTGAAGACTGTGGTGGCTCCC CAAATTCCTCCTGAGCTGTATGATGGGTTTATAGCTGCAATCAATAAAGG AAACATAAGGACGATGCCTAATAGAAGCATGCCAGCTGCTCCACATCCTA CTCCTGGGGCCTTGTTGATGGGGGATGCGTTTAATATGCGCCATCCTTTA ACTGGTGGAGGAATGACCGTGGCACTATCTGATATTGTTGTGCTCCGAGA TCTTCTCAGGCCTCTGCATGATCTGAATGATGCAGCTACACTTTGCAAAT ATCTCGAGTCCTTTTATACCTTGCGAAAGCCTGTGGCATCCACAATAAAT ACATTGGCAGGTGCCCTGTATAGGGTGTTTTGTGCTTCACCAGATCAAGC AAGGAAGGAAATGCGTGATGCGTGCTTTGATTATTTAAGCCTTGGAGGTG TGTGTTCATCAGGGCCAGTGTCTCTACTATCAGGGCTAAATCCTCGTCCA TTGAGCTTGGTTTGTCACTTCTTTGCGGTGGCAATATTTGGTGTTGGTCG TTTATTGCTGCCATTTCCTTCACCAAAACGTGTATGGATTGGAGCTAGAA TAATTTCAGGTGCATCGGGAATCATCTTCCCCATCATAAAGGCAGAGGGA GTTAGACAAATGTTCTTTCCTGCAACAGTTCCAGCATATTAC---AGAGC TCCT---CCTGTT---------AAG------    pre-BR.2.5.1.21.fasta >A ---GGGAGCTTGGGGACGATGCTGAGATATCCGGATGACATATATCCGCT CCTGAAGATGAAACGAGCGATTGAGAAAGCGGAGAAGCAGATCCCTCCTG AGCCACACTGGGGTTTCTGCTATTCGATGCTCCACAAGGTTTCTCGAAGC TTTTCTCTCGTTATTCAGCAACTCAACACCGAGCTCCGTAACGCCGTGTG TGTGTTCTACTTGGTTCTCCGAGCTCTTGATACTGTTGAGGATGATACTA GCATACCAACTGATGAAAAGGTTCCCATCCTGATAGCTTTTCACCGGCAC ATATACGATACTGATTGGCATTATTCATGTGGTACGAAGGAGTACAAGAT TCTAATGGACCAATTTCACCATGTTTCTGCAGCTTTTTTGGAACTTGAAA AAGGGTATCAAGAGGCTATCGAGGAAATTACTAGAAGAATGGGTGCAGGG ATGGCCAAGTTTATCTGCCAAGAGGTAGAAACTGTTGATGACTACGATGA ATACTGCCACTATGTTGCTGGGCTTGTTGGTTTAGGTTTGTCGAAACTCT TCCTCGCTGCAGGATCAGAGGTTTTGACACCAGATTGGGAGGCGATTTCC AATTCAATGGGTTTATTTCTGCAGAAAACAAACATTATCAGAGATTATCT TGAGGACATTAATGAGATACCAAAATCCCGCATGTTTTGGCCTCGCGAGA TTTGGGGCAAATATGCTGACAAGCTTGAGGATTTAAAATACGAGGAGAAC ACAAACAAATCCGTACAGTGCTTAAATGAAATGGTTACCAATGCGTTGAT GCATATTGAAGATTGCCTGAAATACATGGTTTCCTTGCGTGATCCTTCCA TATTTCGGTTCTGTGCCATCCCTCAGATCATGGCGATTGGAACACTTGCA TTATGCTATAACAATGAACAAGTATTCAGAGGCGTTGTGAAACTGAGGCG AGGTCTTACTGCTAAAGTCATTGATCGTACAAAGACAATGGCTGATGTCT ATGGTGCTTTCTATGATTTTTCCTGCATGCTGAAGACAAAGGTTGACAAG AACGATCCAAATGCCAGTAAGACACTAAACCGACTTGAAGCCGTTCAGAA ACTCTGCAGAGACGCTGGAGTTCTTCAAAACAGAAAATCTTATGTT---A ATGACAAAGGACAACCAAACAGTGTCTTTATTATAATGGTTGTGATTCTA CTGGCCATAGTCTTTGCATATCTCAGAGCAAAC------------ >P ATGGGGAGTTTAGGAGCAATTTTGAAACACCCAGTTGACATATACCCATT  127 GCTGAAGCTGAAAATGGCAGCTAAGCATGCTGAAAAACAGATCCCACGTG AACCTCACTGGGCTTTCTGTTATTCTATGCTCCCTAGAGTCTCTCGTAGC TTTGCTCTCGTTATCCAACAACTTGACACAGAACTCCGTAACGCTGTATG CGTATTTTATTTGGTTCTTCGAGCCCTTGACACTGTTGAGGATGATACAA GCATACCTACAGATGTCAAAGTGCCTATCCTGATAGCTTTTCACCGCCAC ATATATGATCATGACTGGCATTTCTCATGTGGTACCAAGGAGTACAAGGT TCTCATGGACCAGTTTCATAATGTTTCAAATGCTTTTCTGGAGCTTGGAA AAGGTTATCAGGAGGCAATCGAGGATATTACCAAAAGAATGGGTGCAGGA ATGGCAAAGTTTATCTTGAAGGAGGTGGAAAGCATTGATGACTATGATGA ATATTGCCACTATGTAGCAGGACTTGTTGGACTGGGCCTGTCCAAACTCT TCCATGCATCTGGATTAGAAGATTTGGCACCAGAT------AGCATCTCC AATTCAATGGGTTTGTTTCTTCAGAAAACAAACATTATTCGTGATTATTT GGAGGACATAAACGAGATACCTAAGTCACGCATGTTTTGGCCTCGCGAGA TTTGGAGCAAATATGTCAACAAACTTGAGGACTTGAAATATGAAGAGAAC TCGGTGAAGGCAGTGCAGTGCTTGAATGATATGGTTACCAATGCCTTGAT ACATATGGATGATTGCTTGAAGTACTTGTCTGAATTGCGGGATCCTGCTA TATTTCGGTTTTGTGCTATTCCTCAGATCATGGCGATTGGAACTCTAGCA CTGTGCTACAACAATGTCAATGTCTTCAGAGGTGTAGTGAAGATGAGGCG AGGTCTTACCGCTCAAGTTATTCATCAAACGAAAACAATGGATGATGTCT ATGGTGCTTTCTTCGACTTCTCTTGTATGCTGAAGTTCAAGGTTGACAAC AGTGATCCTAATGCAATAAAAACCTTGAGCAGGCTGGAAGCAGCACAAAA ATCTTGCAGGGAATCTGGGGCTCTAAACAAAAGGAAATCTTACATAATTA GGAATGAGCCAAAATATAATTCTGTTCTGATCGTCCTACTTTTCATTATA TTGTCTATTATTTTCGCGTATCTCTCTGCCAACAGATCGAGTTAC >R ---GGTAGTGTTGGAGCGATTTTGAGACACCCAGATGATTTTTACCCGTT ATTGAAGTTAAAAATGGCAGCTAGGAATGCAGAGAAGCAGATCCCACCAG AACCTCGCTGGGGTTTCTGTTATTCTATGCTTCATAAGGTTTCTCGTAGC TTTGCTCTTGTTATTCAACAGCTTGGCACTGAGCTCCGTGATGCTGTCTG CATATTCTATTTGGTTCTTCGAGCCCTTGATACTGTTGAGGATGATACAA GCATACCTACAGACGTCAAAGTGCCTATTCTGATAGATTTTCATAAACAC ATATACAATCCTGAATGGCACTTTTCATGTGGCACAAAGGATTATAAAGT TCTCATGGACCAGTTTCATCATGTTTCAACTGCTTTTCTTGAGCTTGGAA AAAGTTATCAGGAGGCGATTGAGGATATTACAAAAAGAATGGGTGCAGGA ATGGCTAAATTCATATGCAAAGAGGTGGAAACAATTGATGACTATGATGA GTACTGCCACTATGTAGCAGGACTTGTTGGACTAGGACTGTCCAAGCTTT TCCATGCCTCTGGAACGGAAGATTTGGCACCAGAT------ACCCTCTCC AACTCA---GGTTTATTTCTTCAGAAAACTAACATTATTCGAGATTATCT GGAGGATATAAATGAGATACCTAAGTCACGCATGTTTTGGCCTCATCAAA TCTGGAGCAAATATGTTACTAAACTCGAGGATTTGAAATATGAAGAGAAC TCGGTCAAGGCAGTGCAATGCTTGAACGATATGGTTACTAATGCTTTGAT CCATATGGATGATTGCTTAAAATACATGTCTGCACTGCGCGATCCTTCTA TATTTCGTTTTTGCGCAATCCCTCAGATCATGGCAATTGGAACCTTAGCA TTGTGCTACAACAACGTTGAAGTATTCAGAGGTGTAGTGAAAATGAGGCG TGGTCTTACTGCGAAGGTCATTGACCGAACAAAGACTATGGCTGATGTAT ATGGTGCTTTTTATGACTTCTCCTGT---CTTAAGTCCAAGGTTGAAATG AATGATCCTAATGCAGAAAAGACATTGAGCCGGTTGGAAGCATTACAGAA ATCTTGCCGGGAATCTGGCCTCCTAAGCAGAAGGAGATCTTACATA---A GGAGTGAGCCAAGAATTAATTCTGTTATTGTTGTCCTACTTTTCATCATA TTGTCCATTATTTTCGCATATCTCTCGGCGAATCGACCAAGTAAC >O ---------------GGGGTGCTGTCGAGGCCGGAGGAGGTGTTGCCGCT GGTGAAGCTGCGGGTGGCGGCGGGGCGGATCAAGCGGCAGATCCCGCCGG AGGAGCACTGGGCCTTCGCCTACACCATGCTGCAGAGGGTCTCCCGGAGC TTCGCGCTCGTCATCCAGCAGCTCGGCCCCGACCTCCGCAATGCCGTGTG CATCTTCTATCTCGTGCTCCGAGCCCTCGACACTGTTGAGGACGACACTA GCATTCCTGCCGCGGTGAAGGTGCCGATCCTTAAGGAATTCCATCGGCAT ATCTACAACCGCGACTGGCATTATTCATGTGGAACAAAAGACTACAAATT ACTGATGGATAAGTTTCGCCTTGTCTCCACGGCTTTCTTGGAGCTTGGTC AAGGTTATCAAGAGGCAATTGAAGAAATCACTAGGCTAATGGGAGCAGGA ATGGCAAAATTTATCTGCAAGGAGGTTGAAACTGTTGATGACTACAATGA GTACTGTCACTATGTAGCAGGGCTAGTGGGGTATGGGCTTTCCAGGCTCT TTCATGCTGGTGGGACGGAAGATCTGGCTTCAGAT------TCACTTTCA AATTCAATGGGCTTGTTTCTGCAGAAAATCAATATAATTAGGGATTATTT GGAGGACATAAACGAGATACCAAAGTCACGTATGTTCTGGCCTCGAGAAA TATGGAGTAAATATGTCAATAAACTCGAGGATTTGAAATACGAGGAAAAT TCAGAAAAGGCAGTTCAGTGTTTGAATGATATGGTGACTAACGCTCTGTC TCATGCTGAAGACTGCCTCCAATACATGTCAGCATTGAAGGATCATGCCA TTTTCCGTTTTTGTGCAATACCTCAGATAATGGCAATTGGGACATGTGCT ATTTGCTACAATAATGTGAATGTCTTTAGAGGAGTTGTTAAGATGAGGCG TGGGCTCACTGCACGAGTAATTGATGAGACAAACACAATGTCAGATGTCT ATACTGCTTTCTATGAGTTCTCTTCGCTGATAGAATCGAAGATTGATAAT AATGATCCAAATGCTTCCCTAACGCGGAAACGTGTTGATGCGATAAAGAG AACCTGCAAGTCATCTTGCTCACTA---AAGAGAAGGGGATACGAT---T TGGAGAAGTCAAAGTACAACTCCATGCTGATAATGGTTGTACTTCTGTTG  128 GTGGCTATTGTTTTGGGCATGATATATGCCAAG------------ >V ---GGCAGTTTGGGAGCGATTTTGACGCATCCGGATGACATATACCCACT GCTGAAGCTGAAAATGGCGGTACGCCACGCCGAGAAGCAGATCCCGCCGG AGCCGCACTGGGCCTTCTGCTACACTCTGCTCCACAAGGTCTCTCGCAGC TTCGGTCTCGTCATTCAACAGCTCGGCACCGAGCTCCGCAACGCCATATG CATTTTCTATTTGGTTCTTCGAGCACTCGACACTGTTGAGGATGATACAA GCATTCGTACAGATGTCAAAGTGCCTATTCTGATAGCTTTTCATCGTCAT ATATATGACCGTGACTGGCATTTTGCATGTGGTACAAAGGACTACAAGGT TCTCATGGACCAATTCCATCATGTTTCAACTGCTTTTCTGGAGCTTGAAA GAGGTTATCAGGAGGCAATTGAAGACATCACCAAACGAATGGGGGCAGGA ATGGCAAAATTTATTTGCAAAGAGGTGGAAACCATTGATGACTATGATGA ATATTGCCACTATGTAGCAGGACTTGTTGGATTAGGATTGTCCAAGCTTT TCCATGCCTCCAAGTTGGAAGATTTGGCTTCTGAT------GAACTCTCC AACTCA---GGTTTATTTCTTCAGAAAACAAATATAATCCGAGATTATCT GGAGGATATAAATGAGATCCCAAAGTCACGCATGTTTTGGCCCCGTGAGA TTTGGAGTAAATATGTTAACAAACTTGAGGACTTGAAAGAGGAGGAAAAC TCAATCAAAGCAGTGCAATGCTTGAATGACATGGTCACTAATGCTTTAAT ACATATGGAAGATTGCCTGACATACATGTCTGCTTTGCAGAGTCCAGCAA TATTTCGATTTTGTGCTATCCCACAGATCATGGCAATCGGGACACTAGCT TTATGCTACAACAATATTGAGGTCTTCAGAGGAGTAGTAAAAATGAGGCG TGGTCTTACTGCCAAAGTTATTGACAGAACAAAAGCGATGTCTGATGTCT ATGGTGCTTTCTTCGATTTTTCTTGT---CTGAAGTCCAAGGTTGACAAG AATGACCCGAATGCTACAAAAGCATTGAGCAGGCTAGAAGCAGTACAGAA AATTTGCAGGGAATCTGGAGCCCTTACCAAAAGGAAATCCTATGTAATCA GGAGCGAACCAAGATATAATTCAGCTCTGATTGTGGCATTCTTCATCATA CTGTCCATCATTTTCGCGTATCTATCTGCCAACCGTCAGAATAAT    pre-BR.5.4.99.8.fasta >A TGGAAACTGAAGATCGCGGAAGGA---GGTAGTCCATGGCTTAGAACCAC CAATAATCACGTCGGAAGACAGTTTTGGGAGTTCGATCCGAATCTCGGT- --ACTCCTGAGGATCTCGCCGCCGTCGAAGAAGCTAGGAAGTCTTTTTCG GATAATCGATTCGTGCAGAAACATAGCGCCGATCTGCTTATGCGCCTTCA GTTTTCAAGAGAAAATTTGATTAGCCCAGTTTTACCTCAAGTCAAAATCG AAGACACTGATGATGTTACAGAGGAGATGGTGGAAACCACGTTAAAGAGG GGTCTAGATTTCTATTCAACTATACAGGCACACGACGGGCACTGGCCAGG TGATTATGGTGGTCCTATGTTTCTTCTCCCAGGACTGATAATTACACTCT CCATAACTGGAGCACTGAATACAGTATTGTCGGAACAACATAAACAAGAA ATGCGCCGTTATCTCTATAATCACCAGAATGAGGAC---GGAGGTTGGGG TTTACATATTGAGGGCCCTAGCACCATGTTTGGGTCTGTGTTGAACTATG TTACTCTAAGGTTGCTTGGAGAAGGACCTAACGATGGAGATGGAGATATG GAGAAAGGACGAGACTGGATACTAAATCATGGTGGTGCTACCAATATTAC ATCTTGGGGGAAAATGTGGCTATCGGTACTTGGAGCTTTTGAATGGTCCG GAAATAACCCACTGCCACCTGAGATATGGCTTCTCCCATATTTCCTGCCA ATACATCCAGGAAGGATGTGGTGCCATTGTCGAATGGTGTACTTGCCGAT GTCGTATTTGTATGGAAAAAGGTTTGTGGGTCCCATAACGTCCACTGTTT TATCACTGAGAAAGGAGCTTTTCACAGTACCATAT---CAAGTCAACTGG AATGAAGCACGCAACCTTTGCGCAAAGGAGGATTTATACTACCCACATCC ACTTGTGCAAGATATTCTTTGGGCATCACTTCATAAGATTGTTGAGCCTG TTCTGATGCGATGGCCTGGTGCAAATTTGAGAGAAAAGGCTATAAGAACC GCAATAGAACATATTCATTATGAAGATGAGAATACTAGGTACATCTGCAT AGGTCCCGTGAACAAGGTATTAAATATGCTTTGCTGTTGGGTAGAAGACC CAAACTCAGAGGCTTTCAAGTTGCACCTACCAAGAATCCATGACTTTCTC TGGTTAGCTGAAGATGGAATGAAGATGCAGGGTTATAACGGAAGCCAGCT ATGGGATACAGGTTTTGCTATTCAAGCGATTTTGGCAACTAACCTCGTCG AAGAATATGGGCCCGTTTTGGAAAAAGCACATTCATTTGTCAAGAATTCC CAGGTGTTAGAAGACTGCCCTGGAGATCTGAATTACTGGTATCGCCACAT TTCTAAAGGGGCTTGGCCTTTCTCAACTGCAGATCACGGTTGGCCCATCT CTGACTGCACCGCAGAAGGACTGAAAGCTGCTCTTTTGCTATCCAAAGTT CCCAAGGCGATTGTTGGTGAACCAATAGATGCAAAACGGTTATATGAAGC TGTTAATGTTATCATTTCTTTACAGAATGCAGATGGAGGCCTCGCAACAT ATGAGCTCACCAGGTCATACCCTTGGTTAGAGCTAATCAACCCAGCAGAA ACCTTTGGCGATATTGTTATTGATTATCCTTACGTGGAATGTACATCAGC TGCTATCCAAGCTTTGATATCATTTCGAAAGCTGTATCCTGGTCATCGAA AGAAGGAAGTAGAG---TGCATTGAGAAGGCGGTTAAGTTCATTGAATCC ATTCAAGCAGCAGATGGCTCATGGTATGGATCATGGGCTGTTTGCTTCAC GTATGGTACGTGGTTTGGAGTGAAAGGGCTGGTAGCTGTTGGAAAAACAT TGAAAAACTCTCCACATGTTGCTAAAGCTTGTGAATTTCTATTGTCGAAA CAACAACCTTCGGGCGGCTGGGGAGAAAGCTATCTTTCATGTCAAGACAA GGTCTATTCAAACCTTGATGGCAACAGATCTCACGTCGTGAATACAGCAT GGGCTATGCTCGCACTCATTGGTGCTGGGCAAGCTGAGGTAGACCGGAAA CCACTACACCGGGCTGCAAGATACTTGATTAATGCTCAAATGGAGAATGG  129 TGATTTTCCACAACAGGAAATAATGGGAGTCTTCAATAGGAACTGCATGA TAACATATGCCGCGTATCGAAACATTTTTCCGATATGGGCTTTGGGGGAG TACCGTTGTCAGGTATTATTGCAACAAGGAGAA--- >P TGGAGGCTAAAGATAGCAGCAGGA---GGAAATCCATGGCTAAGAACAAA TAATGATCATATTGGAAGACAGATTTGGGAATTCGATCCGAAACTAACTC TATCTCCCGAAGAGATCTCAGAGATCGAAAATGCGCGTCAGAACTTTACT AAAAATCGGTTTCAATCCAAGCATAGTGCAGATCTAATCATGCGCATGCA GTTTGAGAAGGAGAATCCGGTGTCGGAAGTGTTGCCGCAGGTGAAATTGA AGGAGAGTGAGAAAGTTACGGAGGAGGCGGTTACTACAACGTTGAAGAGA GGTTTGGATTATTATTCGAGTATTCAAGCTCATGATGGACACTGGCCTGG TGATTATGGTGGTCCTATGTTTCTTATGCCAGGATTGGTGATTACTTTGT CAATTACTGGAGCACTACATGCAGTGTTATCAGATGAACATAAAAAGGAG ATAATTCGGTACCTTTACAATCATCAGGCATGTGATTATGGGGGATGGGG TTTGCATATTGAGGGACCGAGTACGATGTTTGGTTCGGTGTTGAATTATG TTACTTTAAGGTTGCTTGGAGAAGGGCCGAATGATGGAGAAGGTGCGATG GAGAAAGCACGTGATTGGATTTTGAATCATGGTGGTGCGACTATGATAAC ATCATGGGGGAAAATGTGGCTTTCAGTACTTGGAGTGTTTGAGTGGTCTG GAAATAATCCAATGCCCCCTGAGATGTGGCTTCTTCCTTATTTGCTCCCA GTTCATCCAGGAAGGATGTGGTGTCACTGCCGGATGGTCTATCTGCCTAT GTCCTACTTATATGGGAAGCGGTTTGTTGGCCCAATCACACCAACAATTT TATCTTTGCGAAAGGAGCTGTTCACTGTCCCATATCATGAAATAGAATGG AATCAAGCGCGCACCCTATGTGCAAAGGAGGACTTATATTACCCTCACCC TCTGGTGCAAGATGTACTTTGGGCATTGCTTGACAAGGCTGCCGAACCTG TTCTAATGCATTGGCCTGGAAAGAAGTTGAGAGAAAAGGCACTTTGTACT GCAATTGAGCACATACACTATGAAGATGAAAATACTCGTTATCTTTGCAT AGGACCTGTAAATAAGGTGTTAAATATGCTTTGTTGTTGGGTGGAAGACC CTAACTCAGAAGCTTTCAAGTTGCATATTCCTAGAATACAAGATTACCTC TGGCTTGCTGAAGATGGAATGAAAATGCAGGGTTACAATGGAAGTCAATT GTGGGACACTGCTTTTGCCGTTCAAGCAATTATTTCAACTAATCTTGTTG AGGAATACAGTCCAACTTTAAAAAAAGCA---CCATTCGTTAAAAATTCA CAGGTTTTGGAAGATTGCCCTGGAGATCTTCATTTCTGGTATCGCCATAT TTCCAAAGGTGCATGGCCTTTCTCAACTGCAGATCATGGATGGCCCATCT CAGATTGCACAGCAGAGGGACTAAAAGCTGCTCTCTTATTATCAAAAATT CCATCTGAGATTGTTGGGGAACCGTTAGTTGCAAACCGATTTTATGATGC AGTAAATGTCCTCCTCTCATTACAGAATGGGGATGGTGGTTTTGCAACAT ATGAGCTCACGAGATCTTACAGCTGGTTAGAGTTGATCAACCCAGCTGAA ACTTTTGGTGACATTGTTATTGATTACCCATATGTTGAATGTACTTCAGC TGCAATTCAAGCTTTGACATCGTTTAAGAAATTATATCCTGGACACCGGT CAGAAGAAATAGAAAGTTGTATCAGAAAGGCGACTATGTTCATTGAAAGT ATCCAGGAGAAGGATGGCTCG---TATGGCTCATGGGGTGTTTGCTTCAC CTATGGCATATGGTTTGGCATAAAAGGGCTGGTGGCTGCTGGAAAAAACT TCAATAATAGCTCTAGCATTCGTAAAGCCTGTGATTTTCTGCTGTCCAAA CAGTGTTCTTCTGGTGGTTGGGGAGAGAGTTATCTTTCATGTCAAAACAA GACATATTCAAATATTGAAGGGAACAGAGCTCATGTGGTAAATACAGCAT GGGCTATGTTGTCTCTCATTGAAGCTGGGCAGGCTGAGAGAGAGCCAGAA CCATTGCACCGTGCAGCAAGATATTTGATAAATTCCCAGATGGAAAATGG AGACTTTCCGCAGCAGGAAATCATGGGAGTTTTCAATAGGAATTGTATGA TAACATATGCTGCCTACAGGGACATTTTCCCCATTTGGGCATTGGGAGAA TACCGGTGTCGGGTGTTGCAGGCCAAGGCTTCA--- >R TGGAAGCTAAGGATTGCAGAAGGAAGTGGAAATCCATGGCTTAGAACTAC AAACGATCACATTGGGAGACAAGTCTGGGAATTTGATTCATCTAAAATCG GATCTCCAGAAGAGCTCTCACAAATCGAAAATGCTCGTCAAAATTTCACC AAAAACCGCTTTATTCACAAGCATAGTTCAGATCTACTCATGCGCATTCA GTTTTCGAAGGAAAATCCAATATGTGAAGTGTTACCGCAAGTAAAAGTGA AAGAATCAGAACAAGTTACCGAGGAGAAAGTGAAAATTACGTTAAGAAGG GCATTGAATTACTATTCATCTATTCAAGCTGATGATGGACATTGGCCTGG TGATTATGGCGGTCCTATGTTTCTAATGCCTGGCTTGATTATAGCTCTGT CTATCACTGGCGCATTGAATGCAATTTTATCTGAGGAACATAAGCGCGAA ATGTGTCGATATCTATACAACCACCAGAATAGAGAT---GGCGGTTGGGG CTTACACATTGAGGGACCAAGCACAATGTTTGGGAGTGTATTGTGTTATG TTTCGTTAAGGCTGCTTGGTGAAGGTCCCAATGAGGGAGAAGGGGCAGTC GAGAGAGGCCGTAATTGGATTCTCAAACATGGTGGTGCTACTGCAATTAC GTCCTGGGGAAAAATGTGGCTTTCAGTACTTGGAGCATATGAGTGGTCTG GTAATAATCCCTTACCCCCTGAGATGTGGCTTCTCCCTTACATTCTCCCA GTCCATCCAGGTTCTTAT------------------GTATATCTTCCA-- -TGTCATATTTATATGGGAAAAGGTTGTTGGTCCAATCACACCAACAGTT TGTCTTTGAGAAAGGAGCTGTATACTGTCCCATATCATGAAATAGACTGG AATCAAGCACGCAACCAATGTGCAAAGGAAGATTTGTACTATCCACATCC TATGTTGCAAGATGTACTTTGGGCAACTCTTCATAAGTTTGTTGAACCTA TTCTTATGCATTGGCCTGGAAAAAGGTTGAGAGAAAAGGCTATTCAAACT GCGATTGAACACATACACTATGAAGATGAAAATACTCGTTACATATGCAT AGGGCCTGTAAACAAGGTGTTAAATATGCTTTGCTGTTGGGTGGAAGACC CAAACTCAGAAGCTTTTAAGTTGCATCTTCCAAGATTATATGACTACCTC  130 TGGCTTGCTGAAGATGGG---AAAATGCAGGGTTATAATGGAAGTCAACT CTGGGACACAGCATTCGCAGTTCAAGCAATTGTGTCAACTAATCTTATTG AGGAATATGGTCCGACTCTAAAAAAGGCACATTCATTCATTAAAAAAATG CAGGTTTTGGAAAATTGTCCAGGAGATCTTAATTTTTGGTATCGCCACAT TTCAAAAGGTGCATGGCCATTTTCAACTGCTGATCATGGATGGCCCATCT CAGACTGCACAGCAGAGGGAATAAAAGCTCTTATGTTGTTATCAAAGATT CCTTCAGAGATTGTTGGGGAAGGATTAAATGCAAACCGGTTATATGATGC AGTGAATGTTGTTCTCTCATTACAGAATGGTGATGGTGGCTTTCCTACTT ATGAGCTCTCAAGATCTTATAGTTGGTTGGAGTTTATCAACCCTGCTGAA ACTTTTGGTGACATTGTTATTGACTACCCGTACGTTGAGTGTACTTCAGC TGCAATTCAAGCTTTGACATCATTCCGTAAATCATATCCTGAACATCAGC GAGAAGAGATAGAATGTTGTATCAAAAAGGCAGCTAAGTTCATGGAAAAA ATTCAGATATCAGATGGCTCATGGTATGGCTCATGGGGTGTTTGCTTCAC CTATGGTACATGGTTTGGCATAAAAGGTTTGGTGGCTGCCGGAAAAAGCT TTGGTAATTGTTCCAGTATCCGTAAAGCCTGTGATTTTCTGTTGTCTAAA CAGTGTCCTTCTGGTGGCTGGGGAGAGAGTTATCTTTCATGTCAAAAGAA GGTTTATTCCAATCTTGAAGGTGACAGGTCTCATGTGGTAAATACTGCTT GGGCTATGTTGAGTCTGATTGATGCCGGGCAGGCTGAGAGAGACCCAACA CCATTGCATCGTGCAGCAAGATATTTAATAAACGCTCAAATGGAGAATGG AGATTTTCCACAGCAGGAAATCATGGGAGTATTCAATAGGAATTGCATGA TAACATATGCGGCCTACAGAGACATTTTCCCAATTTGGGCATTGGGAGAA TACCGTTGCCGGGTTCTCAAGGCTTCA--------- >O -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------TTCCTTATGCCAGGCTTGATTATAACATTAT ATGTGAGCGGAGCGCTGAACACTGCTTTGTCATCTGAACATCAGAAGGAG ATACGGCGGTATCTCTACAATCATCAGAATGAAGAT---GGAGGATGGGG TTTGCACATTGAGGGCCACAGCACCATGTTTGGCTCAGCGTTGACATATG TTTCTTTGAGATTGCTTGGGGAGGGGCCAGATAGCGGCGATGGAGCTATG GAGAAAGGACGAAAATGGATTTTAGACCATGGGGGAGCAACTTATATTAC ATCATGGGGCAAGTTTTGGCTTTCGGTGCTTGGTGTATTTGACTGGTCTG GCAACAACCCAGTGCCACCAGAAATATGGTTGTTGCCATATTTCCTGCCG ATTCATCCAGGGCGAATGTGGTGTCATTGCCGGATGGTTTATTTGCCTAT GTGTTACATTTATGGAAAGAGGTTTGTGGGCCCAGTTACACCAATTATAT TGGAATTAAGAAAGGAACTCTACGAAGTACCCTACAATGAAGTTGATTGG GACAAGGCTCGCAATCTATGTGCTAAGGAAGATCTGTACTATCCACATCC ATTCGTGCAGGATGTATTATGGGCCACTCTCCACAAATTTGTTGAACCAG CTATGTTGCGTTGGCCTGGGAACAAATTGAGGGAGAAAGCTTTGGACACT GTCATGCAGCATATTCATTATGAAGATGAGAACACCCGATATATTTGCAT TGGTCCAGTAAACAAGGTATTAAATATGCTTGCTTGCTGGATTGAAGATC CAAACTCAGAGGCATTCAAACTCCACATTCCAAGAGTCCACGATTACCTA TGGATTGCAGAAGATGGCATGAAAATGCAGGGTTATAATGGAAGCCAGCT GTGGGACACAGCTTTCACAGTTCAAGCTATAGTGGCTACTGGCCTCATTG AAGAATTTGGTCCTACTCTTAAACTAGCACATGGCTACATAAAGAAAACG CAGGTTATCGATGACTGCCCTGGAGATCTTAGTCAGTGGTACCGCCACAT ATCTAAAGGTGCATGGCCCTTTTCTACTGCTGATCATGGTTGGCCTATAT CAGATTGCACTGCAGAAGGACTTAAGGCGGCATTATTGCTATCGAAGATT TCTCCAGATATTGTTGGCGAAGCAGTGGAAGTTAATAGACTGTATGATTC TGTCAATTGTTTGATGTCATACATGAATGATAATGGTGGATTTGCAACAT ATGAACTCACAAGGTCTTATGCCTGGCTGGAGCTTATCAATCCTGCTGAG ACCTTTGGGGACATTGTGATTGATTATCCTTATGTGGAATGCACTTCAGC AGCAATTCAGGCCCTGACAGCATTTAAAAAGCTCTACCCTGGACACCGCA AGAGTGAAATAGACAACTGTATAAGCAAAGCTGCTAGCTTTATTGAGGGT ATTCAAAAAAGCGATGGTTCATGGTATGGTTCTTGGGCTGTTTGTTTTAC CTATGGCACATGGTTTGGTGTAAAGGGATTAGTTGCTGCTGGTAGGACAT TCAAAAACAGTCCTGCAATCAGAAAGGCATGTGACTTTTTGTTGTCAAAA GAGCTTCCTTCTGGAGGCTGGGGAGAAAGCTATTTGTCATCCCAAGATCA GGTTTATACCAATCTCGAAGGGAAGCGACCTCATGCGGTGAACACTGGTT GGGCCATGCTAGCCCTAATCGATGCAGGGCAGGCTGAGAGAGATCCAATT CCTTTGCATCGAGCAGCGAAGGTTTTGATCAACTTACAATCGGAAGATGG TGAATTTCCCCAGCAAGAGATCATTGGAGTCTTCAACAAAAACTGCATGA TCAGCTACTCCGAGTATAGAAACATCTTCCCTATTTGGGCCCTTGGGGAG TACCGTCGCCGCGTCTTGGCCGCAGACAAG------ >V TGGAAACTGAAGATCGCGGAAGGA---GGAAGTCCCTGGTTGAGGACCAC GAACAATCATGTGGGAAGACAAGTTTGGGAGTTCGATCCCGATCTGGGA- --TCGGCTGAACAGCGTGAGGAGATCGAGAGAGCTCGTGAGACGTTCTCG AAGCATCGATTCGAGAAGAAGCATAGTGCAGATCTAATCATGCGTATTCA GTTTTTGAAGGAGAATGCTGGTACTGTAGTTTTACCCCAAGTCAAAGTGA  131 AAGATACAGAGGATGTTACAGAGGATGCAGTGACAAACACATTAAGAAGG GCTATCAATTTTCATTCAACTCTCCAGGCTCATGATGGACACTGGCCAGG GGATTATGGAGGTCCCATGTTTCTTTTGCCCGGCTTGATCATTACTCTTT CGATTACTGGGGCGCTGAATGCTGTCTTGTCAAAAGAACATAGACAAGAG ATGTGCCGTTATCTCTATAACCATCAGAACAAAGAT---GGTGGGTGGGG TTTACATATCGAGGGCCCAAGCACCATGTTTGGTACTGTCTTGAACTATG TAACTTTAAGGTTGCTTGGTGAAGGAGCTAATGATGCAGATGGGGCAATG GAGAAAGGGCGTGACTGGATTCTGAATCATGGTGGTGCAACTGCAATAAC CTCATGGGGAAAAATGTGGCTTTCAGTACTTGGAGTATTTGAATGGTCTG GCAATAATCCTCTGCCCCCTGAAATATGGCTTCTTCCCTATATCCTACCA GTCCATCCAGGAAGGATGTGGTGTCACTGCAGGATGGTTTATTTGCCTAT GTCATACTTATATGGGAAGAGGTTTGTTGGTCCTCTCACACCTACAGTAT TGTCTTTGAGGAAGGAGCTCTATACTGTTCCATATCATGAAATCGATTGG AATCAAGCACGAAACCTATGTGCCAAGGAAGATCTGTACTACCCACATCC ATTGGTGCAGGATATACTTTGGACATCCCTCGACAAAGTTGTTGAACCTA TTCTAATGCATTGGCCTGGGAAAAAGTTGAGAGAGAAGGCTCTTCGCACT GTCTTGGAGCATGTACACTACGAAGACGAGAACACTCGCTATATATGCAT AGGTCCTGTAAACAAGGTTTTAAATATGCTTTGCTGTTGGGTGGAAGATC CAAACTCAGAGGCTTTCAAGTTACATCTTCCTAGAATTTTTGATTTCCTG TGGCTTGCTGAAGATGGCATGAAAATGCAGGGCTATAATGGAAGTCAATT ATGGGACACAGCCTTTTGTGTTCAAGCAATTATTTCAACCGACCTAGTGG AAGAATATGGTCCAACTCTAAGAAAAGCACATGCATACTTGAAGAAGTCA CAGGTTTTAGAAGATTGTCCAGGCAATCTTGATTATTGGTATCGCCACAT TTCAAAAGGTGCTTGGCCTTTTTCAACCGGTGATCATGGATGGCCCATCT CAGACTGCACTGCGGAAGGATTGAAGGCTATTCTTTTATTATCAAAAATT CCATCAGAAATTGTTGGTGAACCATTAGATGCGAAGCAGTTATACGATGC TGTAAATGTAATTCTTTCCTTACAGAATGGAGATGGCGGCTTTGCAACCT ATGAACTCACTAGATCTTATGCTTGGTTGGAGTTAATCAATCCTGCTGAA ACTTTTGGCGACATTGTTATTGATTATCCTTACGTGGAATGTACATCAGC TGCACTTCAAGCTTTGACATCATTTAATAAATTTTATCCGGGGCATCGGA GAGAAGAAATAGAACATTGTATTAAAAAAGCTACAATGTTCATTGAAAAG ATACAAGCATCAGATGGCTCATGGTATGGCTCTTGGGGAGTATGCTTCAC CTATGCCATATGGTTTGGGATAAAAGGATTAGTGGCTGCTGGAAAGAACT ACAATAATTGCTCTAGCATTTGTAAAGCATGTGATTTTCTGTTGTCCAAG CAGCTTGCTTCTGGTGGTTGGGGCGAGAGTTACCTTTCGTGTCAGAACAA GGTGTATTCAAATCTTGATGGCAACAGATCTCATGTAGTAAATACCGCAT GGGCTATGCTGGCTCTCATTGATGCTGGGCAGGCTGAGAGAGACCCAACA CCATTGCACAGAGCAGCACGAGTATTGATAAATTCCCAAATGGAGAATGG AGATTTTCCACAGGAGGAGATCATGGGGGTCTTCAATAGGAACTGTATGA TCACTTATGCTGCATACAGAAACATCTTCCCCATTTGGGCTCTGGGTGAA TACCGATGTCGGGTTCTACGGGGTCCCTTGACAAAA    pre-BR.5.5.1.9.fasta >A ------------------------------------------TCAGGATC TTCTTCACCGAGCTTGTGGCTGGCACCGAATCCGAGCAAGAGATGGGGAG AGCTCTTCTTCCTCTTCTACACTCCTTTTTGGCTCACTCTCTGTTTAGGC ATCGTTGTTCCTTACAAGCTTTACGAGACATTCACGGAGTTGGAGTATCT GCTTCTAGCTTTGGTTTCAGCTGTTCCTGCTTTCGTTATACCCATGTTAC TCGTTGGAAAGGCCGACAGAAGTTTA------TGTTGGAAGGACCGCTAT TGGGTTAAGGCAAATCTCTGGATAATTGTTTTCAGCTATGTCGGAAACTA CTTTTGGACTCACTATTTCTTTAAAGTTCTTGGAGCGTCCTATACTTTTC CATCATGGAAAATGAATAATGTGCCTCACACAACATTC---TTCCCACAT GTTTGCTTCCTCTTTTACCACGTTGCATCGAACATTACTCTTCGGAGGCT ACGCCATTCCACTGCTGATTTACCAGATTCTCTGAAATGGTGTTTTGAGG CTGCATGGATACTTGCGCTTTCTTATTTCATTGCATACTTGGAGACTATT GCTATCGCAAATTTTCCTTACTATGAGTTTGTGGACCGAAGTGCCATGTA CAGAGTTGGATGTCTTTTCTATGCCATTTACTTCATTGTGAGCTTCCCAA TGTTCTTCAGGATGGATGAGAAATCAACTGATGAATGGGATTTATCTCGA GTGGCTGTTGATGCTTTGGGTGCTGCTATGTTGGTAACAATCATTCTTGA TCTATGGCGTCTCTTCTTGGGACCTATAGTTCCCTTACCGGAGGGACAAA ACTGCCTTCAGTCTGGATTACCATGGTTCTCCAAT--------------- >P ------------------------------------------AGTTCTAG TTCTAGTCCCAGTTTATGGTTGGCTCCAGACCCTAGTAAAAGATGGGGAG AGATTTTCTTTCTTTGTTATACTCCTTTTTGGCTCACTCTTTGTTTGGGA ATTGTGATTCCTTGCAAGCTGTACGAGAGCTTTACAGAATTGGAATACTT GCTCCTGGGTTTGATCTCAGCTGTTCCTTCTTTCTTGATACCAATGATGT TTGTCGGTAAGGCTGATAGCAAATTG------TGTTGGAAGGACTGTTAT TGGGTCAAGGCCAGTCTATGGATAATCATTTTTAGCTATGTTGGAAATTA CTTCTGGACCCACTATTTTTTCACAGTTTTGGGAGCTTCTTATACATTTC CATCTTGGAAGATGAATAATGTACCACATACAACCTTCCTTCTGACACAT GTTTGCTTCCTGTTTTATCACGTCACCTCAAACATGACAATTCGCAGACT  132 ACGGCATGCGGTTGCTGACTTGCCAGATTATCTTCGATGGGCTGCTGAGG GTGCATGGATTTTGGCTCTTTCATACTTCATAGCATACCTGGAGACTTTA GCTGTTTCTAATTTCCCTTACTATGAGTTTGTGGACCGGGCTTCAATGTA CAAAGTAGGTTCCTTGTTTTATGCCATCTACTTCTTTGTAAGCTTCCCAA TGTTTCTGAGGATTGATGAGAAACCTGGTGATCTATGGGAGTTACCAAGA GTGGCTGTTGATTCCCTGGGTGCTGCAATGTTGGTTACAATAATACTTGA CTTGTGGCGAATCTTTTTGGGGCCTATTGTTCCACTTCCAGTAACAAAAC AATGCCTTCAACAGGGACTACCCTGGTTT--------------------- >R ------------------GGCGATGATACTACAAGTAAGGAGTCGGGTTC TTATACTTCGAGTTTATGGTTGGCTCCTAACGAGAGCAAAAGATGGGGCG AACTTTTCTTTCTCTGCTATACTCCTTTCTGGCTTACTCTCTGCTTAGGC ATTGTTGTTCCCTACAAGCTTTATGAGAGCTTTACGGAATTGGAGTATCT GCTTCTAGCTATGGTTTCTGCAGCTCCTTCTTTCTTGATTCCAATGATTT TTGTTGGAAAGGTAAATTATAGGTTATCAACCTCAATTGTGAACTTACTG TTGTGGCAGGCTAGTCTCTGGATAATCATTTTCAGTTACGTTGGCAATTA CTTTTGGACGCATTATTTCTTTACAGTTTTGGGAGCTTCTTATACATTTC CATCATGGAAGATGAATGATGTACCACACACAACGTTCCTTCTGACTCAT GTATGCTTCCTGTTTTATCATGTCACTTCAAATATGACACTTCGTAGACT GCGGCATGCTATTGCTGATTTGCCAGATAAACTTCGGTGGGCTACTGAGG CAGCATGGATCTTGGCTCTTGCATATTTCATAGCATACCTGGAGACCCTG GCCATCTCTAATTTTCCATACTACGAGTTTGTTGATCGGTCTTCCATGTA CAAAGTTGGGTCCTTGTTTTATGCCATCTACTTCATCGTAAGCTTCCCAA TGTTTTTGAGGATTGATGAGAAACCTGGTGACTTATGGGACTTACCGAGA GTGGCTGTAGATGCTCTGGGTGCAGCAATGCTGGTAACGATAATACTCGA CTTGTGGCGCATCTTTCTTGGACCTATTGTTCCACTATCAGATACAAAAC AGTGCCTTCAACCAGGACTGCCCTGGATTCATGCACATGCCAATGAAACT >O GCAGCCCCGCGGCGGCCGGCGGCGGCGAAGGCGAGGAATGGAGGAGGGGC GGGGAGGACGAGCCGGTGGATGGCGGCTGACGGGAGCAAGCGGTGGGGGG AGACGTTCTTCCTGCTCTACACGCCCTTCTGGCTCACGCTCTGCCTCGGC GTCGTCGTCCCCTTCAAGCTCTACGAGAGGTTCACGGAGCTGGAGTACCT AGTTGTTGGGTTGGTGTCCACAGTGCCTGCCTTCGTCATCCCGCTCTTCC TCGTAGGCAAGGCAGATAGTGTTAGA------AGTTTGAAAGATCGGTAT TGGGTTAAGGCTAATATTTGGATTATAATTTTCAGCTATGTTGGTAATTA CTTTTGGACGCATTACTTCTTCACAGTTCTTGGTGCATCATACACTTTCC CATCATGGAGGATGAACAACGTACCCCATACAACATTTCTCCTGACCCAC GCTTGCTTTCTTTTCTATCACATGACATCAAAT---AGCCTTCGCAAATT ACATCATTCTACAGCTCATTTGCCCCAGTTTCTTCGATGGTCATTTGAAG CTGCATGGGTTTTAGCACTCTCATACTTCATAGCTTACCTGGAAACCTTA GCCATTGCAAATTTTCCGTATTATGAATTCATCGACAGGGATATAATGTA CAAAGTAGGCTCACTGTTTTATGCAATATACTTCATCGTCAGCTTCCCAA TGTTTTCAAGGATCGATGAAAATGAA---GAGAAGTGGAGCCTTTCCAGA GTGGCCGTCGACGCCTTGGGTGCAGCTATGCTTGTAACAATAATCCTCGA CCTGTGGCGCATATTCTTGGGGCCAATTGTACCCATCCCTGAATCAAGAC GCTGCGGTCAACCGGGGCTTGCATGGTTCCAGGTGCAGAACGAGAGCGTC >V ------------------------------------GGCGGTACAGGGGC GGCTTCTTCGAGTCTGTGGTTGGCTACGAATCCGAGCAAGAGATGGGGAG AGTTGTTTTTCCTTCTCTACACTCCTTTCTGGCTCACTTTGTGCCTCGGG ATTGTCGTTCCGTACAAGCTATACGAGAACTTTACGGAATTGGAATACTT GCTTCTCGGATTGGTTTCAGCTGTTCCTTCTTTCTTGATACCTATGCAAT TTGCGGGGGAGGTTGATAGGAGCCTG------TGCTTGAAGGACCGTTAT TGGGTAAAGGCCAGTTTGTGGATAGTAATCTTTAGTTATGTTGGGAATTA CTTCTGGACCCATTATTTCTTTACAGTTTTGGGAGCTTCATATACCTTTC CATCATGGAAGATGAATAATGTACCACACACCACTTTCCTTCTCACACAT GTCTGCTTCCTATTCTACCATATGTCGTCAAACATAACGCTTCGTAGACT ACGACATTCTATTGCTGATTTGCCAGAGAAAATTCAGTGGTTTACTGAGG CTGCATGGATTTTAGCTCTTGCCTATTTCATAGCCTATTTAGAGACTATA GCTATTTCTAATTTTCCATATTATCAGTTTGTGGACCGGGCATCCATGTA CAAAGTTGGGTCCTTGTTTTATGCTATTTATTTCATTGTAAGCTTCCCA- --TTTCTGAGGATTGATGAGAAACCTGGGAATACCTGGGACTTGCCCAGG GTGGCTGTAGATGCTCTGGGAGCTGCAATGCTTGTTACAATCATTCTTGA TCTGTGGCGCATCTTTCTGGGACCTATTGTTCTGATCCCAGAATCAAACC AGTGCCATCAGCCAGGACTGCCATGGTTTCCAGGACACGGCCCCAAAGCT    pre-BR.CYO51G1.fasta >A ------GAATTGGATTCGGAGAACAAATTGTTGAAGACGGGTTTGGTTAT AGTGGCGACACTTGTTATAGCCAAACTCATCTTCTCTTTCTTCACTTCTG ATTCTAAGAAGAAGCGTCTTCCTCCTACTCTTAAAGCTTGGCCTCCATTG GTTGGAAGTCTTATCAAATTCTTGAAAGGACCTATTATTATGCTTAGAGA GGAATACCCTAAGCTTGGAAGTGTGTTTACTGTTAATCTTGTTCACAAAA  133 AGATTACTTTTCTTATTGGTCCTGAAGTCTCTGCTCATTTTTTCAAAGCT TCTGAATCTGATCTTAGTCAGCAGGAAGTGTATCAGTTCAATGTCCCTAC TTTTGGTCCTGGAGTTGTTTTCGATGTTGATTATTCTGTTCGTCAGGAGC AGTTTCGGTTCTTCACTGAGGCACTTAGAGTTAACAAGTTGAAGGGTTAT GTGGATATGATGGTTACTGAAGCTGAGGATTACTTCTCTAAATGGGGAGA GAGTGGTGAAGTTGATATTAAGGTTGAGCTAGAGAGGCTCATCATCTTGA CTGCAAGTAGATGTTTACTGGGTCGAGAAGTTCGTGATCAGCTTTTTGAT GATGTCTCTGCTTTGTTCCATGACCTTGACAATGGAATGCTTCCCATCAG TGTTCTCTTCCCATATCTCCCAATTCCAGCTCACCGCCGTCGTGACCGTG CCCGAGAAAAGCTTTCGGAGATTTTCGCAAAAATCATTGGGTCGAGAAAA CGCTCTGGAAAAACAGAGAACGACATGCTGCAGTGTTTCATCGAATCAAA GTACAAAGATGGTAGACAGACAACCGAATCTGAAGTCACTGGTTTGCTCA TTGCTGCTCTGTTTGCAGGACAACACACGAGCTCTATCACTTCCACCTGG ACCGGTGCTTATCTGATGCGATACAAAGAGTACTTCTCAGCTGCTCTTGA TGAGCAGAAGAACCTGATTGCGAAACATGGAGACAAGATCGATCATGATA TCTTATCCGAGATGGATGTTCTCTACCGCTGCATTAAGGAAGCGTTGAGG CTTCACCCTCCACTCATCATGTTAATGAGAGCCTCGCACAGTGATTTCAG CGTGACAGCTCGGGATGGAAAAACTTACGATATCCCAAAGGGTCACATCG TTGCAACCTCCCCTGCATTTGCCAACCGCTTACCGCACATCTTCAAAGAC CCCGACACCTACGACCCAGAAAGATTCTCCCCTGGAAGAGAAGAGGACAA AGCCGCAGGGGCATTCTCGTACATTGCATTCGGAGGGGGAAGGCACGGGT GCCTTGGAGAGCCGTTTGCTTACCTGCAGATCAAAGCCATATGGAGTCAT TTGTTGAGGAACTTCGAGCTTGAGCTAGTTTCACCGTTCCCTGAGATTGA CTGGAACGCTATGGTGGTTGGAGTTAAAGGCAATGTGATGGTGCGTTACA AGAGGCGCCAGCTTTCT--------- >P ---ATGACTAAAGATACGGATAACAAGTTCTTGAACGTGGGTCTGCTCAT TTTGGCCACTCTACTAGTGGCCAAGCTTATCTCTGCACTTATAATGCCTA GATCT---CAAAAGCGGTTGCCTCCGGTTATGAAGGGTTGGCCT---TTG ATAGGAGGGCTCATTCGATTCCTTAAAGGACCCATCGTTATGCTTCGTGA AGAGTACCCAAAACTTGGCAGTGTTTTTACAGTGAACCTAGCTAACTGGA AGATTACTTTCTTGATTGGCCCTGAGGTGTCTGCTCACTTCTTCAAGGCC TCCGAAGCAGATTTGAGCCAGCAGGAGGTGTATCAGTTCAATGTGCCTAC TTTTGGTCCTGGTGTTGTGTTTGATGTGGATTACTCTATAAGGCAAGAGC AATTTCGATTCTTTACAGAGTCTTTAAGAGTGAGCAAACTCAAGGGATAC GTGGATCAGATGGTGGTAGAAGCAGAGGACTACTTCTCAAAATGGGGAGA CAGTGGGGTGGTAGACATAAAGTATGAGCTTGAGCATCTGATCATTTTGA CAGCCAGTAGATGTCTACTTGGACGAGAAGTTCGTGATAAGCTTTTTGAT GATGTGTCTGCTCTATTCCATGACCTTGACAATGGAATGCTCCCAATCAG TGTTTTATTCCCATACTTGCCCATCCCAGCTCATCGCCGCCGTGATCGGG CACGCAAGAAGCTTGCAGAAATCTTTGCAAATATCATAAATTCCCGTAAG CTTGCTGGAAAATCAGAGAATGACATGTTGCAGTGCTTCATTGACTCGAA GTATAAAGATGGTCGCCCAACAACCGAGTCTGAGATCACAGGCTTGCTCA TTGCTGCTCTCTTTGCTGGGCAGCACACCAGTTCCATCACCTCCACTTGG ACAGGAGCCTATCTTCTGCGACATAATGAATACCTATCTGCTGTGTTGGA GGAGCAGAAGAACTTGATGAAAAAGCACGGGAACAAAGTTGATCAAGATA TTTTATCCGAGATGGGTGTCTTGCATCGGTGCATCAAGGAGGCCCTCAGA CTCCATCCTCCACTAATTATGCTTTTACGGAGCTCACATAGTGACTTTAG CGTGACAACACGAGATGGGAAAGAATATGACATCCCAAAGGGCCACATAG TCGCGACATCTCCAGCATTTGCTAACCGTCTTCCTCATGTCTTCAAGGAC CCAGAAAGGTATGATCCTGACAGATTTGCTGCTGGGAGAGAAGAAGACAA AGCGGCAGGGGCATTTTCATATATTTCTTTTGGAGGTGGCAGGCATGGGT GCCTTGGCGAACCATTTGCTTACTTGCAGATAAAGGCTATATGGAGTCAT TTGCTGAGGAATTTTGAATTTGAGCTCATATCTCCTTTCCCTGAGACAGA CTGGAATGCAATGGTCGTTGGTGTGAAGGACAAGGTGATGGTGCGCTACA AGCGGCGTGAGCTTTCAGTTAAT--- >R ------------GATTCCGATAACAACCTAATGAACGTGCTTCTAGTAAT CGCAGCCACACTGTTAGTGGCGAAGCTTATCTCTGCATTTGTATTGCCCA GATCT---AGAAAGCGTCTTCCTCCGGTCGTCAAAGGCTTGCCC---CTG GTCGGAGGGCTCTTCCGGTTCTTGAAAGGACCCATCATTATGCTTCGGGA TGAGTATCCGAAGCTTGGGAGTGTTTTCACTGTCAACCTTGCTCAAAAGA AGATCACCTTCTTTATTGGCCCTGAAGTCTCTGCTCACTTCTTCAAGGCC CCAGAGTCTGACCTCAGCCAGCAGGAGGTTTATCAATTCAATGTTCCTAC TTTCGGACCTGGCGTTGTCTTTGATGTCGATTATTCCATTCGCCAAGAGC AATTCCGCTTCTTTACCGAGGCTCTTAGAGTCCATAAACTTAAGGGCTAT GTCGATCAGATGGTCATGGAAGCCCAGGATTACTTCTCAAAGTGGGGAGA TAGTGGTGAAGTAGACTTAAAGTATGAACTCGAGCATCTGATTATATTGA CAGCCAGTAGATGTCTTCTGGGTCGAGAAGTTCGTGATAAGCTTTTCGAT GATGTGTCTGCTCTATTCCATGATCTGGACAATGGAATGCTCCCCATCAG TGTATTATTCCCATACCTGCCCATTCCAGCTCACCGACGCCGTGACAGAG CCCGCAAGAAGCTGGCAGAAATCTTTGCAAATATCATAGCTTCCCGCAAA CTTGCTGGAAAAACAGAGAATGACATGCTGCAGTGCTTTATTGATTCGAA GTACAAAGATGGTCGCCCAACAACTGAAGCCGAGGTTACTGGTCTGCTTA TTGCTGCACTGTTTGCTGGGCAGCACACCAGTTCCATCACCTCTACTTGG  134 ACCGGGGCCTACCTGCTCCGTTACAAAGAGTATTTATCTGCTGTATTGGA GGAACAGAAAACCCTGATGGAAAAACATGGAAACAAGGTTGATCATGATA TCTTGTCTGAAATGGATGTCCTGTATAGGTGCATTAAGGAAGCCCTAAGG CTCCATCCTCCCCTAATAATGCTGCTGCGAAGCTCCCACAGTGATTTTAG CGTGAAAACCCGAGACGGGAAAGAATATGACATCCCAAAGGGCCACATTG TAGCAACATCACCGGCATTTGCAAACAGGCTTCCTCATATCTATAAGAAT CCAGACAGATATGATCCGGACAGATATTCTGCTGGGAGAGAAGAAGATAA AGTGGCAGGAGCCTTTTCATATATTTCTTTTGGTGGAGGCAGGCATGGCT GCCTCGGTGAACCTTTTGCATTTTTGCAGATAAAGGCTATCTGGAGCCAT TTGCTGAGGAATTTTGAATTTGAGCTAGTATCTCCTTTTCCTGAGACTGA CTGGAATGCAATGGTTGTGGGTGTGAAAGGAAAGGTGATGGTACGCTATA AGCGCAGGGAGCTTTCAGTAAAC--- >O ATGGATCTCGCCGACCCAAACCACCGGCTCATCGCCGGCGCGGCGCTGCT GGTGGCCACCCTCGCCTTCATCAAGCTGCTG------CTGAGCTCCGCCG GCGGCGGCAAGAAGCGCCTCCCGCCGACCATCCCGGCGGCGCCG---CTG GTGGGCGGGCTGCTCCGCTTCATGCGGGGGCCGATCCCGATGATCCGGGA GGAGTACGCCCGCCTCGGCAGCGTCTTCACCGTCCCCATCCTCAGCCGCA AGATCACCTTCCTCATCGGCCCCGAGGTGTCGGCGCACTTCTTCAAGGGG AACGAGGCCGAGATGAGCCAGCAGGAGGTCTACAAGTTCAACGTGCCCAC CTTCGGCCCCGGCGTCGTCTTCGACGTCGACTACTCCGTCAGGCAGGAGC AGTTCAGGTTCTTCACCGAGGCGCTCCGCGCCAACAAGCTCCGCAGCTAT GTCGACCAGATGGTTGTCGAGGCTGAGGAGTACTTCTCTAAGTGGGGAGA AAGTGGAACGGTGGATCTGAAGTATGAGCTGGAGCATCTCATCATTCTGA CTGCTAGTCGGTGCTTGCTCGGGAGGGAGGTGCGAGAAAAGCTCTTTGAT GATGTTTCTTCTCTCTTCCATGATCTGGACAATGGGATGCAGCCAGTCAG TGTCATCTTCCCCTACCTCCCAATTCCTGCACACCGCCGCCGTGACCGGG CACGGCAACGGTTGAAGGAAATCTTCGCCACCATCATCAAGTCCCGCAAG GCCTCTGGACGGGCTGAGGAAGACATGCTGCAGTGCTTCATTGATTCGAA GTACAAGAGTGGACGCTCAACCACAGAAGGTGAAATAACCGGCCTACTTA TTGCAGCACTATTTGCTGGACAGCACACTAGCTCTATCACCTCAACCTGG ACTGGGGCCTACATGCTTCGCTTCAAGCAGTACTTCGCAGCAGCCGAAGA GGAGCAGAAGGAG---GTCAAGCGGCACGGGGACAAGATCGATCATGACA TCTTGGCAGAGATGGATGTCCTCTACAGGTGCATCAAGGAGGCGCTCCGT CTTCACCCACCGCTAATCATGCTGCTCCGCCAGTCACACAACGACTTCTC AGTGACAACGAAGGATGGCAAAGAGTTCGACATCCCGAAGGGCCACATCG TCGCGACATCTCCAGCCTTCGCCAACAGGCTCCCTCACATCTTCAAGAAC CCCGACTCATACGACCCCGACCGCTACGCACCAGGCAGGGAGGAGGACAA GGCAGCGGGCGCCTTCTCGTACATCTCCTTTGGTGGCGGCAGGCACGGTT GCCTCGGTGAGCCCTTCGCCTACCTACAGATCAAGGCCATATGGACTCAC CTGCTGAGGAACTTTGAGTTCGAGCTGGTCTCCCCCTTCCCGGAGACCAA CTGGAAAGCCATGGTCGTCGGCATCAAGGACGAGGTGATGGTCAACTTCA AGCGGCGGAAGCTCGTCGTCGACAAC >V ------------GATGTGGATAACAAGTTCTTCAATGCAGCCTTCCTCCT TGTGGCAACTTTGGTGGTTGCCAAGCTTATATCTGCACTTATAATTCCTA GATCT---AAAAAACGGCTTCCTCCGACTATAAAGGCATTTCCA---TTA ATTGGTGGGCTCATACGGTTCTTGAAAGGCCCAGTTGTCATGCTTAGGGA AGAGTATCCAAAGCTTGGGAGTGTATTTACCTTGAAGCTATTGAACAAGA ACATTTCTTTCTTCATTGGACCTGACGTCTCAGCACATTTCTTCAAGGCT CCAGAGTCTGATCTTAGCCAGCAAGAAGTATACCGGTTCAATGTGCCCAT TTTTGGCCCTGGTGTTGTTTTTGATGTTGACTACTCTGTGCGGCAAGAGC AGTTCCGGTTTTTTACAGAAGCTTTGAGAGTTACTAAATTGAAAGGGTAT GTGGATCAGATGGTTATGGAGGCCGAGGATTACTTCTCCAAGTGGGGAGA TTGTGGAGAGGTAGACCTAAAATATGAGCTAGAGCATCTAATCATTTTGA CAGCCAGTAGATGCCTTTTGGGTCAAGAAATTCGTAATAAGTTGTTTGCT GATGTGTCTGCCCTCTTCCATGATCTTGACAATGGGATGCTTCCTATCAG TGTTATCTTCCCATACCTGCCCATCCCAGCCCACCGCAGGCGTGACCAGG CTCGCAAGAAGCTTGCTGAAATTTTTGCAAATATCATTGCTTCCAGAAAA GAAACTGGTAAGTCAGAAAACGACATGTTGCAATGCTTCATTGCCTCAAA GTACAAAGATGGTCGCCCAACAACTGAATCTGAGGTCACTGGCCTGCTCA TTGCTGCACTCTTTGCTGGACAGCATACTAGTTCCATTACCTCCACCTGG ACTGGGGCTTACCTCCTTCGTCACAAGGAGTACCTTTCTGCTGTGCAGGA TGAGCAGAGGAGCCTGATGAAGAAGTATGGGAGCAAGGTTGATCATGATA TCTTGTCTGAGATGGATGTTCTATATAGGTGCATCAAGGAAGCTCTGAGA CTCCACCCTCCTCTGATCATGCTGCTACGTAGCTCACACACTGATTTCAG TGTGACAACCAGAGATGGGAAAGAATATGACATTCCCAAGGGTCACATTG TTGCCACATCGCCAGCTTTTGCTAATCGGCTCCCACATATATACAAGGAC CCAGACAGATATGATCCAGACAGATTTGCAGTTGGGAGAGAAGAGGACAA GGCTGCAGGGGCATTCTCATATATATCTTTTGGAGGCGGACGACATGGGT GTCTCGGTGAACCCTTTGCATACCTGCAAATAAAGGCCATATGGAGCCAT TTACTTAGAAACTTTGAGTTGGAACTGATCTCACCATTTCCAGAGGTCGA CTGGAATGCCATGGTTGTCGGCGTAAAAGGAAAGGTTATGGTGAGGTACA AGCGCAGAGAGCTTCCTGTTAAC---   135   pre-BR.DWF1.fasta >A -------------------------------------------------- ----------------------------------TCGGATCTTCAGACAC CGCTTGTGAGGCCCAAGAGGAAGAAGACTTGGGTTGATTACTTTGTCAAG TTCAGATGGATCATTGTCATCTTCATCGTCCTTCCATTCTCAGCCACATT CTACTTCCTCATCTACCTCGGGGACATGTGGTCAGAGTCCAAGTCCTTTG AGAAACGTCAGAAGGAACACGACGAGAATGTCAAGAAAGTCATCAAAAGG CTTAAGGGTAGGGATGCTTCCAAGGACGGGCTTGTCTGCACTGCTCGTAA GCCCTGGATCGCTGTTGGAATGAGGAACGTTGACTACAAGAGAGCCCGGC ATTTCGAGGTTGACTTGGGGGAGTTCCGTAACATCCTTGAGATCAACAAG GAGAAGATGACTGCTAGAGTGGAGCCTCTTGTTAACATGGGACAGATTTC CCGTGCTACCGTCCCAATGAACCTGTCTCTCGCTGTTGTTGCTGAGCTTG ATGACCTTACCGTTGGTGGACTTATCAATGGATATGGTATTGAAGGAAGC TCTCACATCTACGGTTTGTTTGCTGATACCGTTGAGGCTTACGAGATTGT TCTTGCGGGTGGAGAGCTTGTCCGCGCCACAAGGGATAATGAGTATTCTG ATCTTTACTACGCAATCCCGTGGTCGCAAGGAACTCTTGGACTCCTTGTA GCTGCTGAGATCAGGCTTATTAAAGTCAAGGAGTACATGAGACTCACTTA CATACCAGTCAAGGGTGATCTTCAAGCCTTAGCTCAAGGTTACATTGATT CTTTTGCTCCCAAAGACGGTGAC---------AAGTCGAAAATCCCGGAT TTCGTCGAAGGCATGGTTTACAATCCAACGGAAGGAGTGATGATGGTTGG AACATATGCATCTAAAGAAGAGGCAAAGAAGAAAGGGAACAAAATCAACA ATGTGGGATGGTGGTTCAAGCCGTGGTTCTACCAGCACGCGCAGACCGCC CTGAAAAAGGGACAGTTTGTTGAGTACATCCCAACTCGTGAATACTACCA CAGGCACACAAGGTGCTTGTACTGGGAAGGGAAGCTTATTCTTCCATTTG GTGATCAGTTCTGGTTTAGGTACCTCTTAGGTTGGTTGATGCCTCCAAAG GTCTCTCTTCTTAAGGCCACTCAAGGTGAAGCTATCAGGAACTATTACCA TGATATGCATGTTATTCAGGATATGCTTGTTCCTCTTTACAAGGTTGGCG ATGCACTCGAATGGGTCCACCGCGAAATGGAGGTGTATCCAATTTGGCTT TGCCCACACAAACTCTTCAAGCAGCCAATCAAAGGCCAAATCTACCCAGA GCCAGGCTTCGAGTACGAAAACAGACAAGGAGACACAGAAGATGCACAGA TGTACACTGATGTTGGAGTCTACTACGCACCTGGCTGTGTCCTAAGAGGT GAAGAGTTTGATGGATCAGAAGCAGTGCGTAGGATGGAGAAATGGCTGAT AGAGAACCATGGATTCCAGCCTCAGTACGCGGTGTCTGAGCTCGACGAGA AGAGCTTCTGGAGAATGTTTAATGGTGAATTGTATGAGGAGTGCCGCAAG AAGTATAGAGCTATTGGAACGTTCATGAGTGTTTACTACAAGTCCAAGAA AGGAAGGAAGACTGAGAAAGAAGTTAGAGAAGCCGAACAAGCTCATCTCG AAACTGCTTATGCCGAGGCAGAT------------ >P -------------------------------------------------- -------------------------------ATGTCCGATCTTGAGGCCC CCTTG---CGCCCGAAGAGGAAGAAGGTGTGGGTAGACTATTTTGTGCAG TTCCGATGGATTTTAGTTATTTTCGTCGTTCTCCCAATCTCCTTCACCCT TTACTTTCTCACTTATCTCGGGGATGTCAAATCAGAGATGAAGTCCTACA AACAGCGTCAAAAGGAACATGATGAAAATGTTAAAAAAGTTGTGAAACGT CTTAAAGAGAGGAATCCGTCAAAGGATGGTCTTGTCTGCACTGCTCGTAA ACCCTGGATTGCTGTTGGAATGCGAAATGTTGACTACAAACGGGCTCGGC ACTTCGAAGTTGATTTATCAGCTTTTCGTAATATCCTTGAAATTGATAAG GAGAGAATGATTGCTAGAGTTGAGCCTCTTGTAAATATGGGTCAGATCAG CAGGGCAAGTGTCCCAATGAATCTTTCTCTTGCAGTCGTTGCAGAACTTG ATGATCTCACTGTTGGTGGGCTCATTAATGGTTATGGGATTGAAGGAAGC TCTCATATCTATGGCTTGTTCTCCGACACTGTTGTGGCATATGAGATTGT TTTGGCAGATGGTCAGGTTGTTAGAGCTACCAAGGACAATGAATACTCTG ATCTTTTCTATGCCATCCCCTGGTCTCAGGGAACACTTGGGCTTCTTGTC TCTGCTGAGATCAAGCTTATTCCTATTAAGGAATACATGAGGCTGACCTA CAAACCTGTAGTGGGTAATCTGAAAGAACTTGCGCAGGCCTATATAGACT CTTTTGCACCCAGAGATGGAGATCAGGATAACCCAGAGAAGGTTCCAGAC TTTGTGGAGACTATGATTTATAACTCTACCGAAGGTGTGATGATGACTGG GAGATATGCCTCCAAAGAAGAGGCCAAGAAGAAGGGAAATGTGATTAACA ATGTTGGTTGGTGGTTTAAACCGTGGTTCTATCAGCATGCGCAGACAGCC CTAAAGAAAGGAGAGTTTGTGGAGTACATTCCAACCAGAGAATATTATCA CAGGCACACAAGGTGTTTGTACTGGGAGGGGAAGCTTATACTTCCATTCG CTGATCAATGGTGGTTTAGATTTCTCTTAGGCTGGATGATGCCTCCAAAG GTTTCTCTTCTCAAGGCCACTCAAGGTGAAGCAATCCGAAACTATTACCA TGAGATGCATGTCATTCAGGACATGCTTGTTCCTCTTTACAAGGTTGGGG ATGCCCTTGAATGGGTCCACCAAGAGATGGAGGTATACCCCCTTTGGCTC TGTCCGCACAGGTTGTTCAAGCTCCCTGTGAAAACTATGGTGTATCCAGA GCCAGGATTCGAGCATCAGCACAAACAGGGAGATACATCCTATGCTCAGA TGTACACTGATGTCGGGGTGTATTATTCGCCCGGACCTGTGCTGAGGGGT GAGGTGTTTGATGGTGCAGATGCTGTTCGTAGAATGGAGGACTGGTTGAT AGAAAACCGTGGCTTCCAGCCACAGTATGCAGTGTCCGAGCTAAGTGAGA AGAAATTCTGGAGGATGTTTGATGGTGACCTCTATGAACACTGCAGGAAG AAATATGGAGCTGTGGGAACCTTCATGAGCGTGTACTACAAATCCAAGAA  136 AGGAAGGAAGACAGAGAAGGAGGTGCAGGAAGCTGAACAAGCCCACCTTG AGACTGCTTATGCAGAGGCTACT------------ >R -------------------------------------------------- ----------------------------------TCAGATCTTGAGGCCC CCCTG---CGTCCAAAGAGGAAAAAGGTGTTGGTGGACTATTTTGTTCAG TTCCGATGGATTTTGGTTATTTTTGTCGTCCTGCCAATCTCCTTTACAAT TTACTTTCTCACTTATCTTGGGGATGTTAAATCCTCAATGAAGTCTTACA AGCAACGCCAGAAGGAACATGATGAAAATGTTAAGAAAGTTGTGAAACGT CTCAAGCAGAGGAATCCATCAAAGGATGGTCTTGTATGCACAGCCCGTAA ACCCTGGATTGCCGTTGGAATGCGGAATGTAGACTATAAGCGGGCTCGGC ACTTTGAAGTTGATTTGTCAGCCTTCCGTCATATTCTTGACATTGATAAA GACAGAATGATTGCAAAAGTGGAGCCCCTTGTCAACATGGGGCAGATCAC TAGGGCCACAGTCCCAATGAATCTTGCCCTTGCAGTGGTTGCTGAGCTTG ATGATCTTACTGTTGGTGGGCTCATCAACGGTTATGGGATTGAAGGAAGC TCTCATATATATGGCTTGTTTTCTGACACTGTCGTAGCTTATGAGATTGT TCTGGCAGATGGTCGAGTTGTTAGGGCTACCAAGGACAATGAATATTCTG ATCTTTTCTATGGCATCCCATGGTCTCAAGGAACACTTGGGCTTCTTGTC TCTGCTGAGATTAAGCTTATACCCATTAAAGAGTATATGAAGCTTACATA CAAACCTGCAGTGGGCAATCTAAAAGATCTTGCACAGGCATATGTGGACT CTTTTGCGCCCAAAGATCTTGACCAGGATAACCCAGACAAGGTTCCTGAT TTTGTAGAGGGCATGATTTATTCCTCAACTGAAGGTGTAATGATGACAGG GAGGTATGCATCTAAAGAAGAAGCCAAGAAGAAGGGCAATGTTATTAACA GTGTTGGTTGGTGGTTTAAACCTTGGTTTTACCAGCATGCACAAACAGCC TTAAAGAAAGGAGAGTTTGTAGAGTACATCCCAACCAGGGAATATTACCA CAGGCACACAAGGTGTTTGTACTGGGAGGGAAAGCTTATTCTTCCATTTG GCGACCAGTGGTGGTTTAGGTTTCTCTTTGGCTGGTTGATGCCTCCCAAG GTTTCACTGCTTAAAGCTACCCAAGGTGAAGCAATCAGAAACTATTACCA TGAGAATCATGTCATTCAGGATATGCTTGTTCCTCTTTACAAGGTTGGAG ATGCCCTATTGTGGGTCCACCGTGAGATGGAGGTATATCCCATTTGGCTC TGTCCACACAGATTGTTCAAGCTGCCCATGAAAACTATGGTGTATCCTGA ACCAGGATTTGAGCATCAGCGCAGACAGGGGGACAGTCCATATGCTCAAA TGTACACAGATATTGGGGTGTATTATGCACCGGGACCTATATTAAGAGGT GAGGTGTTTGATGGTGCTGAGGCAGTTCGTAGTATGGAGAGTTGGTTGAT TGAGAACCATGGATTCCAGCCACAATATGCAGTTTCCGAGCTGAATGAGA AGAATTTCTGGAGAATGTTTGATGCTGGGCTGTACGAGCAGTGCAGAAGG AAATACGGAGCTGTCGGAACCTTCATGAGTGTCTACTACAAGTCCAAGAA AGGAAGGAAGACTGAGAAGGAGGTGCAAGAAGCTGAGCAAGCCCACCTGG AACCTGCTTACGCAGAAGTCGATCAACCAGCAGAC >O GTAAAATGGAAGTGTGATGGATGTAACTGTGTCAATACAGCGGAGAAGAT ATTAATCAATAATCATAGCCGGACTGCAGCCATGGCAGATCTGCAGGAGC CCCTCGTTCGTCCGAAGAGGAAGAAGGTTTTGGTGGACTACTTGGTAAAG TTCCGATGGATTCTGGTGATCTTTGTGGTGCTCCCCATTTCCGCTCTGAT CTACTTCAATATCTATTTGGGCGATGTCTGGTCT---GCCAAATCTGAGA AACGTCGCCAGAAGGAACATGATGACAATGTGCAAAAAGTTGTGAAGCGG CTCAAGCAGAGGAACCCAAAGAAGGATGGCCTTGTTTGCACAGCTAGGAA GCCCTGGATTGCTGTTGGCATGCGCAATGTAGACTACAAGCGTGCTAGGC ATTTTGAGGTTGACCTTTCCGCCTTCAGGAACATTCTTGAGATTGACAGA GAGAGAATGGTTGCCAAGGTTGAGCCTCTTGTCAACATGGGCCAGATAAC CAGAGCTACATGCCCAATGAACCTTGCCCTTGCAGTTGTTGCTGAGCTTG ATGACCTTACTGTTGGGGGACTGATCAATGGGTATGGTATTGAAGGGAGC TCTCACCTCTATGGTCTTTTCTCTGACACTGTTGTCGCCGTGGAAGTTGT TCTTGCAGACGGTCGAGTTGTTAGAGCCACTAAGGATAATGAGTACTCTG ACCTTTTCTATGGCATTCCCTGGTCCCAGGGAACACTTGGGTTTCTTGTT TCCGCTGAGATCAAACTCATTCCCATCAAGGAATACATGAGGCTCACATA TACTCCAGTTAAAGGGTCACTGAAGGAGATAGCACAAGGTTATTGTGATT CGTTTGCACCACGAGATGGTGAT---------CCTGCAAAGGTCCCAGAC TTCGTTGAGGGAATGGTGTACACAGAAAATGAGGGTGTCATGATGACTGG TGTTTATGCTTCCAAAGAAGAGGCAAAGAAGAAGGGCAATAAGATCAACT GTGTCGGGTGGTGGTTCAAGCCTTGGTTTTACCAACATGCTCAGACAGCA CTCAAGAAGGGTGAGTTTGTGGAGTACATTCCAACAAGAGAGTACTACCA CCGTCACACCCGGTGTCTGTACTGGGAGGGGAAGCTGATCTTGCCATTCG GCGACCAATTCTGGTTCAGGTTCCTCTTGGGCTGGCTGATGCCACCAAAG GTGTCTCTGCTCAAGGCCACACAGGGTGAATCTATCAGGAATTACTACCA TGACAACCATGTGATTCAAGACATGCTGGTTCCCTTGTACAAAGTTGGAG ATGCTCTTGAGTTTGTTCACAAGGAA---GAGGTTTATCCACTGTGGCTG TGCCCGCACCGGCTCTACAAGCTCCCTGTGAAAACC---GTGTACCCAGA GCCTGGCTTTGAGCACCACCACAGGCAAGGTGACACTAGCTATGCCCAGA TGTTCACCGATGTTGGTGTGTACTATGCTCCTGGTGCTGTCCTGAGGGGC GAGGAGTTCAATGGCGCTCTAGCTGTCCACAGGCTGGAGCAGTGGCTGAT TGAGAACCACAGCTACCAGCCACAGTACGCTGTATCTGAGCTCAACGAGA AGGACTTCTGGAGGATGTTTGATGCTTCTCACTACGAGCATTGCCGCCAA AAGTATGGTGCCGTCGGTACCTTTATGAGCGTCTACTACAAGTCCAAGAA GGGAAGGAAGACTGAGAAGGAGGTGCAGGAAGCCGAGGCCGCCATCCTCG  137 AGCCAGCCTACGCTGATGAGGCG------------ >V -------------------------------------------------- ----------------------------------TCGGATCTTCAGGCTC CCTTG---CGTCCCAAGAGGAAAAAAATTTGGGTGGACTATTTTGTTCAC TTCCGATGGATTATTGTCATTTTTGTTGTCCTTCCTATCTCCTTCACTTT GTACTTCCTCACATATCTTGGAGATGTCAGATCTGAATCAAAATCTTTCA AGCAGCGTCAGGAGGAACATAATGAAAATGTCAAAAAAGTCATAAAACGT CTCAAAGAGAGGAACCCATCAAGGGATGGCCTTGTCTGCACAGCCCGGAA ACCATGGATTGCTGTTGGAATGAGAAATGTTGACTATAAGCGGGCTCGGC ATTTTGAAGTTGATCTTTCAGCTTTCAGAAATATCCTGGACATTGACAAA GAGAGAATGATTGCCAGATGTGAACCCCTAGTCAACATGGGGCAGATTAG CAGGGTTAGTGTCCCAATGAATCTTGCCCTTGCTGTGGTTGCTGAGCTTG ATGATCTTACAGTTGGTGGCCTCATCAATGGCTATGGAATTGAAGGAAGC TCTCACATTTATGGCCTATTCTCTGACACTGTTGTGGCTTATGAAATCAT TTTGGCTGATGGGCGGCTAGTTAGAGCTACCAAAGACAATGAGTACTCTG ATCTTTTCTATGCTATTCCATGGTCTCAGGGAACACTGGGGCTTCTTGTT GCCGCTGAGATCAAGCTTATACCCATTAAGGAATACATGAAGTTGACTTA CAAACCAGTAGTGGGAAATCTGAAAGACCTTGCGCAG------------- --------------GACGGAGATCAGGATAATCCTGAGAAGGTTCCAGAC TTTGTAGAAACCATGATTTACAATCCTACTGAAGCTGTGTGTATGACAGG GAGATATGCCTCAAAAGAAGAGGCTAAGAAGAAAGGAAATGTGATTAACA GTGTTGGGTGGTGGTACAAGCCCTGGTTCTATCAACATGCACAGACAGCC CTAAAGAAAGGGGAGTTTGTGGAGTACATCCCAACCAGGGAATATTACCA TAGGCACACTAGGTGTCTGTATTGGGAGGGAAAACTTATTCTTCCATTTG CAGATCAATGGTGGTTTAGGTTTTTGTTTGGGTGGTTGATGCCACCAAAG GTTTCTCTCCTCAAGGCTACTCAAGGTGAAGCTATCAGAAACTATTACCA TGAGATGCATGTAATTCAGGACATGCTTGTTCCGCTGTACAAAGTTGGGG ATGCTCTAGAATGGGTACATCATGAGATGGAGGTATACCCAATTTGGCTC TGCCCACACCGATTGTACAAGCTTCCT----------------------- ----------------------------GGTGACACACATTATGCCCAGA TGTACACAGATGTGGGGGTGTACTATGCGCCAGGGCCTGTCTTGAGGGGT GAGCAGTTTGATGGTGCAGAAGCAGTTCGCCGAATGGAGAACTGGTTGAT TGAAAACCATGGATTCCAGCCACAATATGCAGTGTCTGAGCTGACTGAAA AGAACTTCTGGAGGATGTTTGATGCTGGGCTTTATGAGCACTGCAGAAAG AAGTATGGAGCAGTGGGGACTTTTATGAGTGTTTACTACAAATGCAAGAA GGGGAAGAAGACCGAGAAGGAAGTGCAGGAGGCGGAGCAAGCACAACTTG AGACACCTTATGCTGAGGCTGAT------------    pre-BR.DWF5.fasta >A -------------------------------------------------- ----------------------GCGGAGACTGTACATTCTCCGATCGTTA CTTACGCATCGATGTTATCGCTTCTCGCCTTCTGTCCACCTTTCGTCATT CTCCTATGGTACACAATGGTTCATCAGGATGGTTCTGTTACTCAGACCTT TGGCTTCTTTTGGGAGAATGGA---GTTCAAGGACTTATCAACATATGGC CAAGACCCACTTTGATTGCTTGGAAAATTATATTTTGCTATGGAGCATTT GAAGCTATTCTTCAGCTGCTTCTGCCTGGTAAAAGAGTTGAGGGTCCAAT ATCTCCAGCCGGAAACCGACCAGTTTACAAGGCCAATGGTCTGGCTGCTT ACTTTGTGACACTAGCAACCTATCTTGGTCTTTGGTGGTTTGGAATCTTC AACCCTGCAATTGTCTATGATCACTTGGGTGAAATATTTTCGGCACTAAT ATTCGGAAGCTTCATATTTTGTGTTTTGTTGTACATAAAAGGCCATGTTG CACCTTCATCAAGTGACTCTGGTTCATGTGGTAACCTAATAATTGACTTC TATTGGGGCATGGAGTTGTACCCTCGAATTGGTAAGAGCTTTGACATCAA GGTGTTTACTAATTGCAGATTCGGAATGATGTCTTGGGCAGTTCTTGCAG TCACGTACTGCATAAAACAGTATGAAATAAATGGCAAAGTATCTGATTCA ATGCTGGTGAACACCATCCTGATGCTGGTGTATGTCACAAAATTCTTCTG GTGGGAAGCTGGTTATTGGAACACCATGGACATTGCACATGACCGAGCTG GATTCTATATATGCTGGGGTTGTCTAGTGTGGGTGCCTTCTGTCTACACT TCTCCAGGCATGTACCTTGTGAACCACCCCGTCGAACTCGGAACTCAGTT GGCAATATACATTCTCGTTGCAGGAATTCTGTGCATTTACATAAACTATG ACTGTGATAGACAAAGGCAAGAGTTCAGGAGGACAAACGGGAAATGTTTG GTTTGGGGAAGGGCCCCGTCAAAGATTGTGGCGTCGTATACTACAACATC TGGTGAAACA---ACTAGTCTTCTCTTAACGTCTGGATGGTGGGGATTGG CTCGTCATTTCCATTATGTTCCTGAGATCTTAAGTGCTTTCTTCTGGACC GTACCGGCTCTCTTCGATAACTTCTTGGCATACTTCTACGTCATATTTCT CACCCTTCTTCTCTTTGATCGAGCCAAGAGAGACGATGACCGATGCCGAT CAAAGTATGGGAAATATTGGAAGCTGTATTGTGAGAAAGTC--------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --------------------------------------------------  138 --AAATAC------------------------------------------ -------------------------------------------------- -------------------------------AGGATCATTCCGGGAATTT AT >P -------------------------------------------------- -------------ATGGCAGAAACGAAGACTGTGCATTCGCCGCTGGTTA CTTATTTTTCAATGCTTTCACTTCTCACTCTCTGCCCTCCTTTTGTTATT CTACTATGGTATACAATGGTACATGCTGATGGGTCAGTTTGTCAAACTTG GGATTACTTGAAGCAACATGGC---TTGCAAGGATTT---AACATTTGGC CAAGGCCTACTGCAATTGCCTGGAAAATTATTGCTTGTTATGCAGCATTT GAGGCTGCACTGCAGCTTCTTTTACCTGGAAAAAAGGTCGAGGGTCCAAT CTCTCCTGAAGGAAACCGACCTGTTTACAAGGCAAATGGTGTGGCAGCAT ATGTGGTGACTTTAGTTACCTATCTTAGCCTTTGGTGGTTTGGTATATTC AACCCCTCGATTGTTTATGATAATTTGGGAGAAATATTTTCTGCTCTCAT TTTTGGAAGCTTAGTCTTCTGTGTTTTCTTATACATAAAGGGTCATTTGG CTCCATCATCTACTGATTCTGGATCATCTGGGAACATGATAATTGACTTC TATTGGGGTTTGGAGCTGTATCCTCGAATAGGAAAGAACTTCGACATCAA AGTTTTCACAAACTGCAGATTTGGGATGATGTCTTGGGCTGTTCTGGCAT TAACCTATTGCATTAAGCAGTATGAGCAGAATGGGAAAGTAGCTGACTCC ATGCTTGTAAATACAATATTGATGCTGGTGTACGTCACAAAGTTTTTTTG GTGGGAAGCTGGTTACTGGAACACAATGGACATTGCACATGATCGAGCTG GATTTTATATTTGCTGGGGATGCTTGGTATGGGTTCCATCTGTGTATACT TCTCCCGGCATGTACCTTGTAAACCATCCTGTGAACCTTGGACTTCAGCT TGCACTCTATATACTAGCAGCAGGCATTCTCTCCATATATGTCAATTATG ATTGTGACAGGCAAAGGCAAGAATTTCGCAGAACAAATGGCAAATGTTTG GTCTGGGGAAGGGCTCCATCAAAGATTGTGGCCTCATACACTACAACATC TGGGCAAACAAAGATAAGCCTCCTTTTGACATCGGGATGGTGGGGCTTAT CTCGTCATTTCCATTATGTACCTGAAATACTGGCTGCTTTTTTCTGGACT GTCCCGGCTCTTTTTAATCATTTCTTACCCTATTTCTATGTGATATTTCT GACCATCCTTCTGTTTGACCGAGCTAAAAGGGATGATGATCGATGTCGGT CCAAGTATGGGAAGTACTGGAAGTTGTACTGTGAGAAGGTT--------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --CGCTAC------------------------------------------ -------------------------------------------------- -------------------------------AGGATTGTTCCTGGAATCT AC >R -------------------------------------------------- ----------------GGAGAAGAGAAGACAGTGCATTCAGCATTGGTGA CTTATGCTTCAATGCTTTCGCTTCTCACTTTCTGCCCTCCCTTTGTTATT TTGCTATGGTACACAATGGTGCATGCTGATGGATCAGTTTCTCAAACTTG GGATTTCTTCAAGCAACAAGGG---TTGCAGGGATTTATTAACATTTGGC CAAGACCCACTGCTACAGCTTGGAAAATAATTGCTTGTTATGCTGCATTT GAGGCTGCACTTCAGCTTCTTTTACCTGGCAAAAGGGTGGAGGGCCCTAT TTCACCTCAAGGGAACCGACCGATATACAAGGCAAATGGTGTGGCAGCAT ATATAGTAACGCTGGTTACCTATCTGGGCCTTTGGTGGTTTGGGATATTC AACCCCACAATAGTTTATGATCATTTGGGAGAGATATTTTCAGCTCTCAT CTTTGGAAGCTTCTTCTTCTGTGTTTATTTGTACATAAAAGGTCATTTGG CACCATCATCAACAGATTCTGGTTCATGTGGAAACATAATAATGGATTTC TATTGGGGCATGGAGCTGTATCCTCGAATTGGAAAGAACTTTGACATCAA AGTTTTCACAAATTGCAGATTTGGGATGATGTCTTGGGCAGTTCTTGCAT TGACCTACTGCATTAAGCAGTATGAGCAGAATGGAAAAGTGGCAGATTCC ATGCTTGTAAATACAATATTGATGTTGGTGTATGTTACAAAGTTTTTTTG GTGGGAAGCTGGGTACTGGAATACAATGGATATCGCGCATGATCGAGCTG GGTTTTATATTTGCTGGGGATGCTTGGTATGGGTTCCATCCGTATATACT TCTCCTGGCATGTACCTAGTCAACCATCCTTTAAACCTTGGAACTCAGCT TGCAGTTTACATCTTGGTGGCAGGCATTCTCTGCATATTTGTCAACTATG ATTGTGACAGGCAAAGGCAAGAATTTCGGAGAAAAAATGGCAAATGCTTG GTTTGGGGAAAGGCTCCATCAAAAATTGTGGCTTCATACACTACAACATC TGGGGAAACAAAAACCAGCCTTCTTTTAACCTCTGGATGGTGGGGCTTAT CTCGTCATTTCCATTATGTACCTGAAATATTAGCTGCTTTTTTCTGGACT GTCCCAGCTCTATTTAATCATTTTCTACCCTACTTCTATGTGACATTTCT TACCATCCTTCTTTTTGATCGAGCTAAAAGGGATGATGATCGATGCAGAT CCAAGTATGGAAAGTACTGGAAGTTGTACTGCGAGAAGATGTCAGCATAT GAGAATGTCGTTGGTGGAAAGCTGAAGCTGAAGGGGAAAGCCTTGAATGT GAAGGCTGGTGGGATGAAGAAGAAAAAGAAACATAAGCAGCACCAAGATG AAGTTTCTCAAGTCGTCAACAAAGAGCTTTTAGAAGGTCAAAGCACAGAA GAATTAGCTGCACCTAGTGAGGATGGTGTAAATGAAAGTGACAAATTGGG TGAAGAAGGGAAGACTGCTTCTTATGATGATTATATGACACCTGCGGAGA GACGATACATGGAGCAAAGAGAGAAGATTGATATTCATAGGATGGCGAAG  139 GAAGCTAATAAATCTCACCGTGACAGGATTCAAGATTTCAACCAGTACTT GGCCAATATGAGTGAGCATTATGACATTCCTAAAGTTGGTCCTGGC---- -- >O ---------------------GCCAAGCCTAGGGCCTCCGCCGCCGCGGC GAAGGCGCCAGCCTCCACGCCGCCCAAGACGGTGCACTCGGCGCTCGTCA CCTACGCCTCCATGCTCTCCCTCCTCTCCCTCTGCCCGCCCTTCGTCATC CTCCTGTGGTACACGATGGTGCACGCGGACGGATCCGTGGTGCGGGCGTA CGAGCACCTCCGCGAGCACGGGGTGCTGGAGGGGCTCAAGGCCATCTGGC CCATGCCAACCATGGCCGCCTGGAAGATCATCTTCGGCTTCGGCCTCTTC GAGGCCGCGCTGCAGCTTCTCCTCCCCGGGAAGCGCTTCGAGGGCCCCGT CTCCCCCTCGGGCAACGTGCCCGTCTACAAGGCAAATGGCTTACAAGCAT ATGCAGTGACCTTGATAACATACCTGAGCCTGTGGTGGTTTGGAATTTTT AACCCTGCAATAGTATACGATCACTTGGGGGAAATATACTCTGCTCTTGT ATTTGGAAGCTTTGTGTTCTGTATTTTTCTGTACATAAAGGGTCATCTTG CTCCATCTTCATCTGATTCTGGATCCTCAGGGAATGTGATAATTGATTTC TACTGGGGAATGGAACTATATCCTCGCATTGGTAAGCACTTTGATATCAA AGTGTTCACAAACTGCCGTTTTGGG---ATGTCCTGGGCTGTTCTTGCTG TAACCTACTGCATAAAGCAGTATGAAATGAATGGCCGAGTTGCAGATTCA ATGCTTGTGAATACTGCATTGATGTTGATCTATGTCACCAAGTTCTTCTG GTGGGAATCTGGATACTGGTGCACTATGGACATTGCTCATGATAGAGCTG GTTTCTACATTTGCTGGGGATGCTTGGTATGGGTTCCATCAATATACACC TCTCCTGGAATGTACCTTGTCAACCACCCTGTGAATTTGGGTCCCCAGCT AGCACTCTCAATTCTCCTTGCTGGAATATTGTGCATATATATAAACTATG ACTGTGATCGTCAGCGCCAAGAATTCCGTCGGACAAATGGGAAATGCTCA ATATGGGGCAAAGCTCCATCTAAGATTGTTGCTTCCTATCAGACTACAAA TGGAGAAACAAAAAGCAGTCTTCTCTTGACTTCTGGATGGTGGGGCTTGT CTCGTCATTTTCACTATGTTCCAGAGATTCTATCTGCTTTTTTCTGGACA GTTCCAGCTCTTTTTGATCATTTCCTGCCGTACTTCTATGTGATCTTTCT GACCATATTGCTGTTCGACCGAGCTAAAAGGGATGATGACCGATGCTCAT CAAAGTATGGCAAGTATTGGAAGATGTACTGCAACAAAGTA--------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --CCGTGC------------------------------------------ -------------------------------------------------- -------------------------------AGGGTTATTCCTGGCATTT AC >V TCGTGGCTCTGTGTCTCCACTTCCAAGTCAAGCTGTAACAGAGGCACTAC AGAGAGAGGAGAGATGGCGGAGGCGAAGACGGTGCACTCACCGGCGTTGA CGTACTTTTCCATGATATCGCTTCTCACTCTCTGCCCTCCCTTCGTCATT CTACTATGGTATACAATGGTTCATGCTGATGGGTCTGTATTGCAAACTTG GGACTACCTAAAGCAGCATGGG---GTGCAAGGGTTCATAGACATCTGGC CAAGGCCAACTGCGATTGCATGGAAACTAATTGCTTGTTATGCTGCATTT GAAGCTGCACTTCAGCTTTTTCTACCTGGTAAAACAGTTGAGGGCCCGAT ATCTCCTTGTGGGAATCGGCCTGTTTACAAGGCAAATGGCATGCAAGCAT ATGCAGTAACATTGATTACTTATCTGAGTCTGTGGTGGTTTGGCATATTC AACCCTGCAATTGTTTATGATCATCTGGGAGAAATATATTCAGCACTTAT TTTTGGAAGTTTGATCTTTTGTATTTTCTTATACATAAAAGGTCATGTGG CACCATCTTCGACTGATTCTGGTTCATCTGGCAACATAATAATCGATTTC TATTGGGGTATGGAGCTGTATCCCCGAATTGGTAAGAACTTTGACATCAA GGTTTTCACAAACTGCCGATTTGGGATGATGTCTTGGGCAGTTCTTGCTG TGACCTATTGTATAAAGCAGTATGAAGAGAATGGGAAAGTGGCAGATTCC ATGCTTGTAAATACTATATTGATGCTGGTATATGTGACAAAGTTCTTTTG GTGGGAAGCTGGATACTGGAACACAATGGATATTGCACATGATCGAGCTG GCTTTTATATTTGTTGGGGATGCTTGGTATGGGTTCCGTCCATTTACACT TCTCCTGGAATGTACCTGGTCAACCATCCTGTGAACCTTGGAACTCAGCT TGCGATTTATATTCTTGCAGCTGGAATCACATGCATATATATAAACTATG ATTGTGATAGGCAAAGGCAAGAATTCCGTAGAACAAATGGCAAGTGCTTG GTTTGGGGGAAAGCTCCATCAAAGATTGTGGCCTCCTACACCACCACTTC TGGAGAAACAAAGTCCAGTCTTCTTTTGACCTCGGGCTGGTGGGGTTTGT CCCGTCACTTCCATTATGTACCTGAAATTTTGGCTGCATTTTTCTGGACG GTCCCTGCTCTTTTTGGCCATTTTCTGCCTTATTTCTACGTGCTGTTCCT TACTATCCTTCTTTTTGACCGAGCCAAAAGGGATGATGATCGATGTCGGT CCAAGTACGGGAAATACTGGAAAAAATACTGTGAAAAGGTT--------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- --CGATAC------------------------------------------ --------------------------------------------------  140 -------------------------------AGGATTATCCCTGGAATCT AC    pre-BR.HYD1.fasta >A ---GAGGAG------TTGGCGCATCCGTACGTTCCGAGAGATCTGAACCT ACCCGGATACGTACCAATCTCAATGTCAATGTCCTCCATCGTCTCTATCT ACCTCGGTTCTTCCCTCCTTGTTGTCTCCCTCGTCTGGCTTCTCTTCGGG AGG---------AAGAAAGCTAAACTTGATAAGTTGCTTATGTGTTGGTG GACATTCACTGGTCTCACTCATGTTATTCTCGAGGGCTATTTCGTTTTCT CCCCTGAGTTTTTCAAGGACAACACTTCTGCTTATCTTGCTGAAGTTTGG AAAGAATATAGCAAAGGTGATTCGAGATACGTAGGTAGAGATTCTGCAGT TGTATCTGTTGAAGGGATCACTGCTGTTATCGTTGGCCCAGCTTCTCTCC TAGCTATTTATGCCATTGCTAAGGAGAAGTCGTATAGCTACGTGCTTCAG CTTGCGATTTCGGTTTGCCAGCTCTACGGATGTTTGGTTTATTTCATTAC TGCTATCTTGGAAGGAGACAACTTTGCCACAAACTCTTTCTACTATTACT CCTACTACATCGGGGCTAACTGTTGGTGGGTCTTGATACCTTCACTCATT TCTTTCCGTTGCTGGAAAAAGATTTGTGCAGCTGCTGCCATTGCCAACAA CAACGTCGAGACAAAGACGAAGAAGAAAACCCGT >P ATGGAGGGG------CAGCCGCATCCATACGCACCAAGAGATCTGAAACT GCCTGGCTATGTACCTAATTTCCTCACTCAATCCACCATTGTCGGCGTCT ATTTACTCACCTCCCTTCTTGTCGTCTCTCTCATCTGGATCCTCTCTGGA AGG---TCTCGTAAGATAACAAAA---AATAGGTTGCTCATGTGCTGGTG GGCTTTCACTGGTCTCACACACTTGATTCTCGAGGGTTATTTTGCTTTCT CTCCAGAATTTTACAAGGACAAGACTGCTCATTATCTGGCTGAAGTTTGG AAAGAATATAGCAAAGGTGATTCAAGATATGCAGCAAGGGATGCTGCAAC AGTTACTGTTGAAGGATTGACTGCTGTTCTCGAGGGACCAGCTAGCCTCC TGGCAGTGTATGCTATTGCTTCAGGAAAATCGTACAGCTACATACTTCAG TTTGCTGTTTGTTTGGGACAGCTCTATGGAACAGCTGTGTATTTCTTAAC TGCCTACTTGGAAGGTGATCATTTTGCTACCAGTCCGTACCACTATTACG TATACTATATTGGTGCAAATGCCTCCTGGGTTGTAATTCCCTCGCTCATC GCTATGCGTTGTTGGAAAAAGATTTGCTCAGCAGTC-------------- -CAAGTTCATGGCCAGAAAAGGACCAAAACTCGT >R ---GAGGGG------CAAGCGCATCCGTACGTGCCCACAGATCTGAAACT GGAGGACTACGTCCCTGTATTTCTCTCACAGTCGACAATCCTTGCCGTCT TCGGAACCTCGTCCCTTGTCCTCGTCTCCCTCGTCTGGTTCATTTCTGGA AGT---TCGCGTAAAGCAGCTAAAATTGATAGATGGTTG---TGCTGGTG GGCCTTCACTGGTCTCACACACATTATCCTAGAGGGTTATTTTGTTTTCT CCCCTGAGTTTTACAAGGATAAGACTTCTTTTTATCTTGCTGAAGTTTGG AAAGAATACAGTAAAGGTGATTCAAGATATGCTGCAAGAGATTCTGCAGT AGTGGCTGTGGAAGGATTGACCGCAGTTTTAGAGGGTCCAGCAAGTCTTC TGGCAGTCTATGCTATTGCTGCTGGGAAGTCGTATAGCTACATACTTCAG TTTGCCATTTCACTCGGGCAGCTTTATGGAACTGCTGTATATTTCCTAAC TCCCTACTTGGATGGCTATAACTATGCATCGAGTCCATATTACCATTATG CATACTACATCGGTGCTAATGCTTCCTGGGTTGTTATACCATCACTCATT TGTATCCGTAGCTGGAAGAAGATATGTGCAGCATTT-------------- -CAAGTGCAAGGCCAGAGAAAGACCAAAAGTGGT >O ------GGGCACCCCCACCCCCACCCTTACGCGCCGGCGGAGCTTCACCT CCCGGGCTTCGTGCCTCTCCAACTGTCCCAGGCCCAAATCCTCGTGCCCT ACCTCGCCACCTCCCTCTTCCTCCTCCTCGCCGTCTGGCTCATCTCCGGG AGATGCAGTCGTAGGCTTTCCGACACCGACCGCTGGCTCATGTGCTGGTG GGCCTTCACCGGCCTCACCCACATTATCATCGAGGGAACCTTTGTCTTTG CTCCTAATTTCTTCTCCAACCAAAACCCTTCTTACTTCGATGAAGTTTGG AAAGAGTACAGCAAAGGTGACTCCAGATATGTCGCCAGAGACCCTGCTAC TGTTACAGTTGAAGGAATTACAGCTGTCTTGGAAGGCCCTGCTTCACTCC TTGCTGTCTATGCCATCGCATCGGGCAAGTCCTACAGCCATATCCTCCAG TTCACTGTCTGTCTTGGTCAGCTCTATGGATGCCTGGTGTACTTTATTAC AGCCTACTTGGATGGCTTCAACTTCTGGACTAGCCCGTTCTACTTCTGGG CTTATTTCATTGGTGCAAACAGCTCGTGGGTTGTTATACCAACTATGATC GCCATAAGGAGCTGGAAGAAGATTTGTGCAGCATTT-------------- -------CAAGGTGAA---AAGGTGAAGACTAAA >V ---GAGGGAGCGCCTCAAAGCCACCCATATGTGCCAAAAGATCTAAAACT GCCAGGTTATGTGCCAGTTGTCCTCTCACAGTCCACCATTGTCGGAGTTT ATGGCCTCTCTTCTCTGCTTGTTGTATCTGTAATATGGATCATCTCTGGG CGG---TTTCCGAAAACATCTAAGATTGATAGATTGCTCATGTGCTGGTG GGCATTCACGGGTCTAACACATGCAATCCTTGAGGGCTATTTTGTGTTCT CTCCAGAATTCTACAAGGATAAAACTGCTTGTTACCTGGCTGAAGTGTGG AAAGAATACAGCAAAGGTGATTCAAGATATGCAGCCAGAGATGCTGGCGT CATTGCTGTTGAAGGGATTACTGCAGTTTTAGAAGGTCCAGCTAGCCTTC  141 TAGCACTGTATACTATTGCCACAAAAAGGTCATACAGCTACATACTTCAG TTGACCATTTCTCTGGGGCAGCTCTATGGCACTGCTGTATATTTTATAAC ATCTTACTTGGATGGTGACAATTTCGCTGCAAGCGCATATTACTACTATG CATACTACGTTTTTGCAAATGCTTTTTGGGTTGTAATACCCTCACTCATT GTTATCCGTTGTTGGAAGAAAATATGTGCAGCATTC-------------- -CAGGTCCAAGGTCAGCAAAAGACCAAAGTTCGG    pre-BR.SMT1.fasta >A ------------------GATCTCGCGTCGAATCTTGGTGGGAAGATCGA TAAATCCGATGTTCTCACCGCCGTCGAAAAGTATGAGCAATATCATGTCT TCCATGGAGGAAACGAGGAAGAGAGAAAAGCCAATTATACTGACATGGTT AATAAGTACTATGACCTTGCTACTAGCTTTTATGAGTACGGATGGGGAGA ATCCTTCCATTTTGCACAAAGATGGAAAGGAGAATCGCTTCGAGAGAGTA TTAAGCGACACGAGCACTTTCTTGCTCTTCAGCTTGGCATCCAACCAGGA CAAAAGGTACTGGATGTAGGATGTGGAATTGGTGGACCGTTGAGGGAAAT TGCAAGATTCAGCAATTCAGTTGTTACCGGGCTCAACAATAACGAATACC AGATCACCAGAGGCAAGGAACTAAACCGACTTGCAGGTGTCGACAAGACA TGTAACTTTGTCAAGGCTGACTTCATGAAGATGCCATTCCCGGAAAACAG TTTCGATGCAGTTTATGCAATAGAAGCAACTTGCCATGCACCTGATGCGT ATGGATGCTACAAAGAGATCTACAGAGTGCTAAAGCCTGGGCAATGTTTT GCTGCCTATGAGTGGTGTATGACTGATGCATTTGACCCTGATAACGCCGA ACATCAGAAAATAAAGGGAGAGATAGAGATTGGAGATGGTCTTCCTGACA TTAGGCTGACTACAAAATGCCTCGAAGCTCTGAAGCAGGCCGGTTTTGAA GTGATATGGGAAAAGGATCTGGCCAAGGACTCGCCGGTCCCATGGTACTT ACCTCTTGACAAAAATCATTTCTCACTCAGTAGCTTCCGCCTTACAGCTG TTGGACGATTCATAACCAAAAACATGGTCAAGATCCTTGAATACATAAGA CTTGCACCTCAAGGAAGCCAAAGGGTCTCAAATTTCCTGGAGCAGGCTGC GGAAGGATTAGTCGACGGTGGAAGGAGAGAGATTTTCACGCCAATGTATT TCTTCTTGGCCCGGAAGCCAGAG--------------------------- ------ >P ---------------TTGGATCTCGCTACTGGTCTTGGCGGAAAGATCGA TAAAAGTGATGTTCTCTCTGCTGTCGAGAAGTATGAGAAGTATCATGTCT GTTATGGAGGTGATGAGGAAGAGAGAAAAGCCAACTACTCTGACATGGTT ---AAATATTATGATCTTGTTACCAGCTTTTATGAGTTTGGCTGGGGGGA GTCTTTCCATTTTGCTCCTAGATTCAAAGGGGAGTCTCTTCGCGAGAGCA TCAAGCGACATGAACACTTTCTCGCTTTACAACTTGGCCTGAAACCTGGA CAGAAGGTGTTGGATGTAGGATGTGGAATTGGCGGGCCTTTAAGAGAAAT TGCTCGATTCAGCTCAACATCAGTAACAGGGTTGAACAACAATGAGTATC AGATATCAAGGGGAAAGGAACTAAATCGCACTGCAGGAGTTGACAGGACC TGTGATTTTGTGAAGGGTGATTTCATGAAAATGCCATTCCCTGATAACAT TTAT---GCTGTATATGCAATTGAAGCTACCTGCCATGCACCAGATGCAT ATGGATGCTACAGTGAGATTTACAGGGTATTGAAGCCAGGACAATGTTTT GCTGCATATGAGTGGTGCATGACTGATTCTTTCGATCCACATAACCAAGA ACATCAAAAAATTAAGGCAGAAATAGAGATTGGTGATGGCCTTCCAGACA TCAGGTTGACTGGACAATGCATTGATGCTCTAACGAAAGCTGGTTTTGAG GTCATATGGTCAAAAGATCTTGCAGTGGGCTCACCTGTGCCATGGTACTT GCCTTTGGACACAAGTCACTTCTCACTGAGTAGCTTCCGTTTAACAGCTG TTGGGAGATTCTTTACAAAAAATATGGTCAAAGCCCTGGAATTTGTAGGA CTTGCTCCCAAAGGAAGTCAAAGGGTTCAAGATTTTCTTGAGAAGGCTGC AGAGGGATTAGTTGAAGGTGGAAGGAAGGAGATTTTCACCCCGCTGTTTT TCTTCGTGGCTCGGAAGCCA------------------------------ ------ >R TCTAAAGCCGGCGCATTGGATCTCGCCTCCGGTGTTGGTGGTAAGATCGA TAAAAACGAAGTTCTCTCCGCCGTCGAAAAATATGAGAAGTATCATGTCT ATTATGGAGGTGCAGAAGAAGAGAGAAAAGCCAACTACACTGACATGGTC AATAAATACTATGATCTTGTTACTAGCTTTTATGAGTTCGGCTGGGGAGA GTCTTTCCATTTTGCACACAGATTTAAAGGGGAGTCTCTTCGAGAAAGCA TCAAACGACATGAACACTTTCTGGCTTTACAGCTTGGCCTGAAACCTGGA CAGAAGGTTTTGGATGTTGGATGTGGAATTGGTGGACCACTAAGAGAAAT TTCTCGTTTCAGTTTGACATCAGTTACAGGGTTGAACAACAATGAATATC AGATCACAAGAGGAAAGGTACTAAATCGCATAGCAGGAGTGGACAAGACC TGTGATTTTGTAAAGGCCGACTTCATGAAAATGCCATTTCCTGCCAATAG TTTTGATGCAGTGTATGCAATTGAAGCTACTTGCCATGCACCAGATGCAT ACGGATGCTACAGTGAGATTTACAGAGTATTGAAGCCTGGGCAATTTTTT GCCGCATATGAGTGGTGCATGACTGATTCCTTTGATCCCAATAACCAAGA ACATCAGAAAATTAAGGCAGAGATCGAAATTGGCGATGGCCTTCCAGATA TTAGGTTAACTGGGCAATGCATTGAAGCTCTCAAAAAAGCTGGTTTTGAT GTCATATGGTCAGGTGATCTTACAGCAAGCTCACCTGTCCCATGGTACTT GCCTCTGGACAAAAATCAATACTCTCTGACTGGTTTCCGGTTAACAGCTA TTGGAAGATTTTTCACTAGAAACATGATAAAGGCTCTAGAATTTGCAGGA  142 CTTGCTCCGAAGGGAAGTCAAAGGGTTCAAGATTTTCTTGAGAAGGCTGC GGAGGGATTAGTGGAAGGTGGAAGGAAGGAGATTTTCACACCAATGTTCT TCTTCCTGGCTCAGAAACCACATTCAGAGAACCAG--------------- ------ >O TCGAGGTCTGGGGCCATGGATCTTGCATCTGGACTCGGGGGGAAGATCAC CAAGGATGAGGTCAAGTCGGCTGTCGATGAGTATGAGAAATACCATGGAT ACTATGGAGGAAAAGAAGAAGCAAGAAAGTCCAACTACACAGACATGGTT AATAAATACTATGATCTTGCCACCAGCTTCTATGAGTATGGTTGGGGTGA ATCCTTCCACTTTGCTCACAGATGGAATGGAGAATCCCTACGTGAAAGCA TTAAGCGACATGAGCACTTTCTTGCCCTTCAGCTTGGAGTGAAACCAGGA ATGAAGGTTTTGGACGTCGGTTGTGGAATAGGCGGACCACTAAGAGAAAT TGCCAAATTTAGCTTGGCTTCAGTCACTGGATTGAACAACAATGAGTACC AGATAACTAGGGGAAAGGAGCTTAATCGGGTAGCAGGAGTTAGTGGAACT TGCGACTTTGTGAAGGCAGACTTCATGAAGATGCCGTTTTCTGATAACAC TTTTGATGCTGTCTATGCCATTGAGGCAACATGCCACGCACCTGATCCGG TTGGCTGCTATAAGGAGATCTATCGTGTATTGAAGCCTGGCCAGTGTTTT GCTGTGTATGAGTGGTGTATTACTGATCACTATGAACCGAACAATGCAAC ACACAAGAGGATCAAGGATGAAATCGAGCTTGGCAATGGCCTGCCAGATA TCCGAAGCACTCAACAATGTCTTCAAGCTGCAAAAGATGCTGGGTTTGAG GTTATTTGGGATAAAGACCTTGCTGAAGATTCCCCGGTTCCTTGGTACCT GCCCTTGGATCCAAGCCGGTTTTCCTTG