Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Strategies to identify Gliotactin protein interactors in Drosophila Browne, Kristen 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_spring_browne_kristen.pdf [ 6.32MB ]
Metadata
JSON: 24-1.0067152.json
JSON-LD: 24-1.0067152-ld.json
RDF/XML (Pretty): 24-1.0067152-rdf.xml
RDF/JSON: 24-1.0067152-rdf.json
Turtle: 24-1.0067152-turtle.txt
N-Triples: 24-1.0067152-rdf-ntriples.txt
Original Record: 24-1.0067152-source.json
Full Text
24-1.0067152-fulltext.txt
Citation
24-1.0067152.ris

Full Text

Strategies to Identify Gliotactin Protein Interactors in Drosophila by KRISTEN BROWNE B. Sc., University of Victoria, 2005  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Zoology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April, 2009 ©Kristen Browne, 2009  Abstract Gliotactin is a transmembrane choline-esterase-like molecule required for the transepithelial and blood-nerve barriers in Drosophila. In epithelia, Gliotactin is the only known marker of cell corners, and is required for both parallel wing hair alignment and septate junction maturation. These functions infer Gliotactin association (direct or indirect) with septate junction components and cytoskeletal factors which, with exception to Discs Large, have yet to be identified. For this reason, a number of strategies were employed to identify protein interactors with Gliotactin, yielding several promising results. Firstly, in immunoprecipitates, Gliotactin was phosphorylated at two conserved tyrosine residues within its C-terminus. One or both of these residues was shown to be phosphorylated in vitro by Src Kinase, a process which could possibly be related to Gliotactin recycling/degradation. In addition, through application of immunoprecipitations in combination with LC-MS/MS analysis, a promising method was developed for future identification of protein interactions. Of the proteins identified in the course of this work, 14-3-3 isoforms and the Na+/K+ ATPase were shown to colocalize with septate junctions, with the Na+/K+ATPase showing strong correlation with both Gliotactin and Discs Large. 14-3-3 also had spot concentrations between dividing cells, possibly reflecting a role in cytokinesis which has been recently described in mammals. This study presents several possible targets for pursuit as both Gliotactin interactors, and as possible modulators of cytokinesis (14-3-3) and Glial adhesion (Magi). The methods described form a model by which future identification of novel interactors and other biochemical studies can be designed.  ii  Table of Contents  Abstract ......................................................................................................................................................... ii Table of Contents ......................................................................................................................................... iii List of Figures ............................................................................................................................................... vi List of Tables .............................................................................................................................................. viii List of Abbreviations .................................................................................................................................... ix Summary of Drivers, Genes and Balancers used in Genetic Experiments ................................................... xi 1. Introduction ............................................................................................................................................. 1 1.1 Intracellular Junctions in Vertebrates and Invertebrates .................................................................. 1 1.1.1 Tight Junctions ............................................................................................................................. 1 1.1.2 Septate Junctions ........................................................................................................................ 2 1.1.3 Paranodal Junctions .................................................................................................................... 3 1.2 TJ and SJ-based Barriers in Vertebrates and Invertebrates ............................................................... 3 1.3 The Tricellular Junction (TCJ) ............................................................................................................. 7 1.4 Gliotactin ............................................................................................................................................ 9 1.5 Gliotactin Structure and Binding Candidates ................................................................................... 14 1.5.1 Choline-Esterase Like Domain.................................................................................................... 15 1.5.2 Phosphotyrosines ...................................................................................................................... 17 1.5.3 PKC Serine Phosphorylation Site ............................................................................................... 20 1.5.4 PDZ Binding Domain.................................................................................................................. 20 1.6 Technical Details .............................................................................................................................. 24 1.6.1 GAL4/UAS system...................................................................................................................... 24 1.6.2 Mass Spectrometry Analysis of Immunoprecipitates/Pull-Downs ............................................ 26 1.7 Hypothesis........................................................................................................................................ 28 2. Materials and Methods .......................................................................................................................... 29 3. Results .................................................................................................................................................... 40 3.1 Identifying Phosphotyrosine Dependent Interactors ...................................................................... 40  iii  3.1.1 Gliotactin is endogenously phosphorylated............................................................................. 40 3.2.2 Motif Scanner Identification of Potential Interactors Based on Gli Primary Structure ........... 43 3.2.3 Src Kinase Phosphorylates Gli Y760/Y799 in vitro .................................................................... 43 3.3 Magi and Vulcan RNAi Phenotypes .................................................................................................. 46 3.4 Mass Spectrometry Analysis of Gliotactin Immunoprecipitates...................................................... 49 3.4.1 14-3-3 ........................................................................................................................................ 56 3.4.2 Na+/K+ ATPase ........................................................................................................................... 60 4. Discussion ............................................................................................................................................... 62 4.1 Candidates for Gli Interaction and/or Regulation............................................................................. 62 4.1.1 Src Kinase ................................................................................................................................... 62 4.1.2 Na+/K+ ATPase ........................................................................................................................... 63 4.1.3 14-3-3ε and 14-3-3ζ .................................................................................................................. 68 4.1.4 Nck/DOCK .................................................................................................................................. 71 4.1.5 SHP/Corkscrew .......................................................................................................................... 71 4.1.6 Protein Phosphatase 2A (PP2A) ................................................................................................ 72 4.1.7 Twinstar (Tsr) ........................................................................................................................... 74 4.2 Possible Association with Lipid Rafts or Lysosomes?....................................................................... 76 4.3 UASMagiRNAi Phenotypes Suggest Possible Role in Glial Cell Adhesion ........................................ 76 4.4 Future Work ..................................................................................................................................... 77 4.4.1 Strategies to Identify Novel Gli Interactors: Abandon or Carry Forward?................................. 77 4.4.2 Gliotactin Dimerization ............................................................................................................. 79 4.4.3 Carrying Forward with Identified Targets ................................................................................. 80 5. Conclusion .............................................................................................................................................. 84 6. References.............................................................................................................................................. 87 Appendix 1 Supplementary Bioinformatic Data ....................................................................................... 97 A1.1 Alignment of Gliotactin C-Terminus Amino Acids 728-956 of D. melanogaster AAC41579 with Arthropod Species using ClustalW (Auld 2008) ..................................................................................... 98 A1.2 MotifScanner Primary Structure Analysis of Gli for Identification of Candidate Interactors ........ 99 A1.3 Alignment of Drosophila melanogaster Src42A, Src64B and Homo sapiens Src using ClustalW 101 Appendix 2 Supplementary Results ........................................................................................................ 102 A2.1 Strategies to Confirm Gliotactin Oligomerization........................................................................ 103 A2.2 Screen of SH2/PTB-GST Library.................................................................................................... 106 iv  A2.3 Protein Kinase C does not appear to interact with Gli in vitro .................................................... 111 A2.4 UASVulcanRNAi and UASMagi RNAi Results Reflecting Change in Phenotype ........................... 112 A2.4.1 UASVulcanRNAi and UASMagiRNAis have no effect on Gli or the SJ in Epithelia ................. 112 A2.4.2 UASVulcanRNAi has no Glial phenotype............................................................................... 117 A2.5 GST-Pull Downs on Membrane Preparations Yield no Novel Interactors ................................... 118 A2.5.1 Expression of GST-Gli Constructs ........................................................................................... 118 A2.5.2 Membrane Preparations....................................................................................................... 121 A2.5.3 Pull-Downs ............................................................................................................................ 121 A2.6 Summary of LC-MS/MS Protein Identifications ........................................................................... 126  v  List of Figures Figure 1: Comparison of Vertebrate and Drosophila Occluding Junctions ................................................... 5 Figure 2: The Tricellular Junction .................................................................................................................. 8 Figure 3: Gliotactin Localization in Epithelia and Glia................................................................................. 11 Figure 4: gliotactin Mutant Phenotypes ..................................................................................................... 12 Figure 5: Gliotactin Primary Structure ........................................................................................................ 14 Figure 6: Homology to the Neuroligin Choline-esterase Domain Presents Possibility of Conserved Intra/Intermolecular Interactions ............................................................................................................... 16 Figure 7: Gli Phosphotyrosines are Associated with Increased Vesicle Association................................... 19 Figure 8: Gli may be Scaffolded to a Number of Cytosolic and Membrane components .......................... 23 Figure 9: GAL4/UAS System ........................................................................................................................ 25 Figure 10: Summary of technique used for LC-MS/MS purification of protein mixtures. .......................... 27 Figure 11: Gliotactin is endogenously phosphorylated .............................................................................. 42 Figure 12: Phosphorylation of the Gliotactin Intracellular Domain by Src Kinase...................................... 45 Figure 13: UASMagiRNAi Expressed in Glia Results in “Baggy” Cell Morphology and Rounded Nuclei ..... 47 Figure 14: Gli Immunoprecipitates from Fly Lysates and Reveals Several Candidate Interactors ............. 51 Figure 15: Mouse anti-Gli antibodies were Cleaned and Crosslinked to IP Gli from Fly Lysates................ 52 Figure 16: Distribution of Protein Types Identified during LC-MS/MS of Gli IPs ........................................ 55 Figure 17: 14-3-3ε-GFP Localization in Peripodial and Columnar Epithelia................................................ 58 Figure 18: 14-3-3ε-GFP Concentrations appear at Presumed Sites of Cytokinesis .................................... 59 Figure 19: Nrv2, Dlg and Gli Show Regions of Colocalization in Columnar and Peripodial Epithelia ......... 61 Figure 20: Proposed Interactions between Gli, the Na+/K+ ATPase, Src and Cor ....................................... 67 Figure 21: 14-3-3ε-GFP at the Cleavage Furrow reflects Anillin and RacGAP staining of dividing Larval Brain Cells.................................................................................................................................................... 70 Figure 22: Gliotactin, Twins and Widerborst Mutants Display Planar Cell Polarity Defects ...................... 73 Figure 23: Twinstar Mutations Reflect Defects in both the Frizzled and Gli Wing Hair Alignment Pathways .................................................................................................................................................................... 75 Figure 24: Potential Gli Protein-Interaction Network ................................................................................. 86 Figure 25: Outline of Gli Dimerization Experiments ................................................................................. 105  vi  Figure 26: Pull-Down Assays to Identify SH2/PTB Domains which may interact with the Intracellular Domain of Gliotactin. ................................................................................................................................ 109 Figure 27: Mating schemes for generation of UASRNAi lines driven by Repo or ApGAL4. ...................... 113 Figure 28: Magi and Vulcan UASRNAis have no effect of SJ or TCJ Development in Epithelia ................. 113 Figure 29: UASVulcanRNAi has no effect on glial morphology. ................................................................ 117 Figure 30: Troubleshooting GST-GliCterm Construct Expression to Minimize Protein Degradation ...... 120 Figure 31: GST-GliCterm Pull Downs on Drosophila Membrane Preparations using Buffers of Increasing Ionic Strength Yield no Specific Bands. ..................................................................................................... 123 Figure 32: GST-Pull Downs on Drosophila Adult Membrane Preparations did Not Pull Out any Novel Interactors................................................................................................................................................. 125  vii  List of Tables Table 1: Drivers used in genetic experiments .......................................................................................... xi Table 2: Genes used in genetic experiments ........................................................................................... xi Table 3: Summary of Balancers and Visible Markers used in genetic experiments ............................... xii Table 4: Progeny Counts from */Y; */bc,gla; */Tm6 x w1118 for determination of w+,UASGliEBFP Location.................................................................................................................................................104 Table 5: GST-SH2/PTB Constructs for use in 6xHisGliCterm Pull-Down Assays ....................................108  viii  List of Abbreviations Full Name Adherens Junctions Adherens Junction(s) Atypical PKC ADP Ribosylation Factor 6 Abnormal Wing Discs Blood Brain Barrier Blood Nerve Barrier Collision Induced Dissociation Coracle Classical PKC Diacylglycerol Drosophila Genome Resource Center Discs Large Dreadlocks Dithiothreitol Enhanced Chemiluminescent Electron Microscopy Ethane Methyl Sulfonate Elixir of Life Electron Transport Chain Guanylate Kinase Anchoring Protein Gliotactin Gliotactin Intracellular Domain Glutathione S Transferase High Pressure Liquid Chromatography Immunohistochemistry Inactivation No After Potential D Immunoprecipitateion Insulin receptor substrate 1 Junctional Adhesion Molecule(s) Luria Broth Liquid Chromatography tandem MS Mass/Charge Membrane Associated Guanylate Kinase Mass Spectrometry Multi-PDZ-Domain-Containing Protein 1  Abbreviation AJ AJ(s) aPKC Arf6 Awd BBB BNB CID Cor cPKC DAG DGRC Dlg DOCK DTT ECL EM EMS EOL ETC GKAP Gli GliCterm GST HPLC IH InaD IP IRS-1 JAM(s) LB LC-MS/MS m/z MAGUK MS MUPP1  ix  Full Name Nucleic Acid Protein Service Unit Non Denaturing Buffer Nervana2 NeurexinIV/Neurexin I Optical Density at 600nm  Abbreviation NAPS ND Buffer Nrv2 NrxIV/NrxI OD600  Phosphate Buffered Salin Planar Cell Polarity Polymerase Chain Reaction Post synaptic density protein (PSD95), Dlg, and Zonula occludens-1 protein (ZO-1) Prickle Protein Kinase C Protein Phosphatase 2A Phosphoserine Phospho-Src Phosphotyrosine Binding Phosphotyrosine Receptor Tyrosine Kinase Synapse-associated protein (SAP) 90/Postsynaptic density (PSD)-95-associated protein Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis SDS-PAGE Loading Buffer Src Homology 2 Src Homology 3 Septate Junction(s) Tricellular Junction Tight Junction(s) Transient Receptor Potential Twinstar Twins Upstream Activating Sequence Vienna Drosophila RNAi Center Widerborst Wild Type Zonula Occludin  PBS PCP PCR PDZ Pk1 PKC PP2A pS pSrc PTB pY RTK SAPAP SDS-PAGE SDS-PAGE LB SH2 SH3 SJ(s) TCJ TJ(s) TRP Tsr Tws UAS VDRC Wdb wt ZO  x  Summary of Drivers, Genes and Balancers used in Genetic Experiments Table 1: Drivers used in genetic experiments Abbreviation Regulatory Element RepoGal4 Repo ApGal4  DauGal4  Comments  Chromosome  Homozygous Viable  3  No  Sepp et al. 2001  2  No  Flybase 2008  3  Yes  Flybase 2008  Glial Driver  Drives expression in majority of wing disc Daughterless Ubiquitous driver  Reference  Apterous  Table 2: Genes used in genetic experiments Abbreviation  Gene  UASGliWT  WT Gliotactin, full length  UASGliFF UASGliDD  Gliotactin; Y760F, Y799F Gliotactin; Y760D, Y799D Gliotactin; EBFP-tag replaces UASGliEBFP intracellular domain mCD8GFP; membrane UASmCD8GFP marker GFP-nervana2; endogenous Nrv2GFP tag 14-3-3εGFP  14-3-3εGFP; endogenous tag  Chromosome Reference X  Forbes 2006  X X  Forbes 2006 Forbes 2006  X  Forbes 2006  2 or 3  Flybase 2008  2 3  Morin et al. 2001 Morin et al. 2001  xi  Table 3: Summary of Balancers and Visible Markers used in genetic experiments Abbreviation  Cy  Bc  Locus name Curly  Black Cells  Gla  Glazed  Tb  Tubby  w1118  white  Comments  Chromosome Balancer  Reference  Dominant wing morphology marker. Heterozygotes have curled wings.  2  CyO  Flybase 2008  Dominant larval marker. Heterozygote larvae are full of black dots visible through the cuticle. Adults have Glazed phenotype.  2  -  Flybase 2008  2  -  Flybase 2008  3  Tm6  Flybase 2008  X  -  Flybase 2008  Dominant eye morphology marker. Heterozygotes have fused ommatidia. Larvae have Bc phenotype. Dominant larval marker. Larvae are shortened relative to wild type. Recessive eye color marker. Homo- and hemizygotes have white eyes.  : xii  1. Introduction 1.1 Intracellular Junctions in Vertebrates and Invertebrates Most cell types are capable of forming physical and ion-selective barriers to maintain homeostasis and delimit compartments within tissues. Such barriers are composed of specialized protein complexes referred to as tight junctions (TJs) in vertebrates, and septate junctions (SJs) in invertebrates. TJs and SJs encircle cells, forming protein strands which interact with similar strands on adjacent cells. When viewed by electron microscopy (EM), these interactions are seen as membrane “kissing points” for TJs, while SJs form a ladder-like structure in which the rungs or “septa” bridge the extracellular space (Figure 1a)(Niessen 2007). Both junctions serve two major roles: cell-cell adhesion and regulating molecule/ion transport between cells (Knust and Bossinger 2002).  1.1.1 Tight Junctions There are three major transmembrane TJ components: Claudins, Junction Adhesional Molecules (JAMs) and Occludins (Figure 1a) (Niessen 2007). Claudins are capable of forming TJ strands in the absence of other TJ components, and are the major structural component of TJs (Furuse et al. 1998). They further define TJ selectivity via tissue-specific expression of isoforms whose primary structures vary within the extracellular loop (Van Itallie et al. 2001; Colegio et al. 2002). Claudin mutations can result in deafness and absence of central nervous system myelin, reflecting the importance of Claudin proteins in barrier formation and function (Furuse and Tsukita 2006). The JAMs and Occludins have lesser known roles in TJ function/assembly. JAMs are Immunoglobulin-like proteins which form homo- or heterodimers at TJs, but are also found in cells lacking TJs (Weber et al. 2007). JAM-1 and JAM-A have been implicated in epithelial barrier regulation and polarity respectively, however the details of said functions are still a mystery (Mandell et al. 2004; Rehder et al. 2006). Similarly, the role of Occludins is unknown, as they are not necessary for TJ function, yet are nonetheless present in the majority of TJs examined (Furuse et al. 1998). Occludin knock-out studies in mice have yielded phenotypes including gastritis and male sterility, which may indicate a minor role in barrier formation/function, the specifics of which are unknown (Saitou et al. 2000). 1  A number of cytosolic TJ proteins are involved in assembling the above-described TJ components and linking them to the cytoskeleton. The Zonula Occludin (ZO) proteins ZO-1 and ZO-2 can both bind Claudins, Occludins and JAM proteins meanwhile also binding actin (Figure 1a) (Gonzalez-Mariscal et al. 2000). ZO proteins can further multimerize via their PDZ (post synaptic density protein (PSD95), Discs Large (Dlg), and ZO-1) protein interaction domains such that ZO-bound transmembrane proteins are clustered at the cell membrane (Figure 1a)(Gonzalez-Mariscal et al. 2000). Other scaffolding-type proteins such as MultiPDZ-Domain-Containing Protein 1 (MUPP1) and Magi can also bind one or more transmembrane components and cluster them at the membrane (Figure 1a) (Hamazaki et al. 2002; Hirabayashi et al. 2003).  1.1.2 Septate Junctions While invertebrate SJs perform analogous functions to TJs, they differ substantially in both their chemical composition and overall structure. SJs are composed of a large protein complex which includes (but is not limited to): Neurexin IV (NrxIV), Neuroglian, Contactin and the Na+/K+ ATPase (Figure 1a) (Hortsch and Margolis 2003). Interaction between the extracellular domains of NrxIV, Neuroglian and Contactin (and possibly others) is thought to result in adhesion between adjacent cells (Figure 1a) (Hortsch and Margolis 2003). Further interactions are thought to link transmembrane components to cytosolic factors such as Dlg, Scribbled and Varicose. These are likely mediated by PDZ-domain-containing scaffolding molecules which can associate with other PDZ-domains (eg. in Dlg, Scribbled or Varicose) and/or with PDZ-recognition motifs (eg. in NrxIV, Megatrachea and Sinuous). In this manner, cytosolic multi-PDZ-domain-containing proteins may form a bridge between transmembrane and cytosolic SJ components in a manner reflective of TJ ZO proteins. Currently, however, the only physical interaction described between SJ components is the PDZ-independent one between Cor and NrxIV (Ward et al. 1998). The Na+/K+ ATPase has a conserved ankyrin binding motif, an interaction which is supported by the mislocalization of Na+/K+ ATPase in β-spectrin mutants (Dubruei et al., 2000). However, a direct association between Spectrin (or any cytoskeletal component) and the SJ has yet to be shown. While many SJ components have vertebrate homologues, few have analogous functions in TJs. Cor is related to the mammalian Protein 4.1 superfamily which is best2  known for linking transmembrane proteins to the cytoskeleton at bicellular junctions (Lamb et al. 1998). Cor, however, lacks the actin/spectrin binding domain and therefore performs an alternate role in Drosophila which is unknown (Fehon et al. 1994). coracle mutants have SJ barrier defects, implying that Cor may be involved in barrier maintenance/formation (Lamb et al. 1998). Sinuous and Megatrachea have recently been identified as two Claudin-like proteins required for SJ formation and transepithelial barrier maintenance (Behr et al. 2003; Wu et al. 2004). Sinuous mutants have missing septa and abnormalities in the apical cuticle, meanwhile, Megatrachea mutants form no septa and have normal cuticle patterning (Behr et al. 2003; Wu et al. 2004a). Furthermore, overexpression of Megatrachea causes mislocalization of NrxIV and Cor which is not seen with Sinuous overexpression (Behr et al. 2003; Wu et al. 2004a). It therefore appears that these Claudin-like proteins may perform independent functions in the formation and maintenance of SJ-based barriers which aren’t necessarily analogous to their vertebrate counterparts.  1.1.3 Paranodal Junctions While TJs are generally considered the functional analog to SJs, vertebrate paranodal junctions, which form between myelinating glial cells and axons, have more structural similarity (Hortsch and Margolis 2003). Paranodal and septate junctions share many homologous components including (Vertebrate/Drosophila): Contactin/dContactin, Caspr/Nrx IV, Neurofascin155/Neuroglian and others (Hortsch and Margolis 2003). Furthermore, when viewed by EM, paranodal junctions form septa similar to SJs (Figure 1a). It is widely believed that the Claudin-based TJs evolved following the transition from invertebrate to vertebrate species, and that the paranodal junction is a specialized and evolved form of SJ (Hortsch and Margolis 2003)  1.2 TJ and SJ-based Barriers in Vertebrates and Invertebrates SJs and TJs perform similar tasks in both the nervous system and in epithelia. Endothelial TJs in blood vessels of the brain form the basis of the vertebrate blood-brainbarrier (BBB) (Figure 1b). There, TJs protect ion-sensitive neural activity from the blood, while blocking blood-borne toxins and pathogens (Daneman and Barres 2005). In contrast, 3  the blood-nerve-barrier (BNB) of invertebrates is formed by several glial wraps which surround individual axons then bundle them together (Figure 1b)(Stork et al. 2008). One such layer, the perineurial glia, separates the open circulatory system from the nerve by forming an SJ (Stork et al. 2008). Failure to form this SJ in nrx IV mutants results in paralysis and embryonic lethality due to BNB disruption (Baumgartner et al. 1996). Similarly, TJ mutations have been related to diseases related to barrier function such as Alzheimer’s and Multiple Sclerosis in vertebrates (Hawkins and Davis 2005). SJs and TJs are also necessary for transepithelial barriers in tissues such as the salivary gland (SJs) and the skin (TJs). The embryonic salivary gland of Drosophila is a cavity surrounded and sealed off by polarized epithelia. Dextran-conjugated dyes can readily permeate into this cavity when SJs are disrupted in mutants such as coracle (Lamb et al. 1998). As TJs perform similar functions, it follows that TJ mutation is related to several barrier-related diseases including psoriasis and colitis (Niessen 2007; Meddings 2008). Such effects are reflective of the importance of barrier function is tissues such as the skin, which provides our primary line of defense against external stresses, while also preventing dehydration (Niessen 2007). In addition limiting bicellular flow of ions/molecules, it is thought that SJs and TJs could maintain epithelial cell polarity by restricting diffusion between apical and basal domains and/or anchoring polarity determinants (Tepass et al. 2001). In polarized epithelia, TJs occur apical to the adherens junctions (AJs) whilst SJs are just below the AJs (Figure 1c). Basal polarity-determining proteins such as Dlg and Scribbled are localized to the SJ following cell polarization, where they antagonize signals from apical determination complexes (Bilder et al. 2000; Tepass et al. 2001). Similarly, apical polarity-determinants co-localize with TJs, however, in both cases it is unclear as to whether co-localization is required for polarity maintenance (Shin et al. 2005). Coracle mutants have disorganized SJs but normal cell polarity which would argue against SJ involvement (Fehon et al. 1994). Whether the SJ may simply restrict movement of a subset of membrane proteins remains a possibility (Tepass et al. 2001).  4  Figure 1: Comparison of Vertebrate and Drosophila Occluding Junctions  a) Structure: Vertebrate TJs are formed by Claudin and Occludin homodimers which are linked to the cytoskeleton via cytosolic factors such as ZO-1.These interactions result in “kissing points” when viewed by EM. Invertebrate SJs are composed of many transmembrane proteins which interact with cytosolic factors such as Dlg and Scribble by unknown mechanisms. By EM, SJs resemble ladder-like strands, much like the vertebrate paranodal junctions which occur between myelin and axons (septa in SJs and paranodal junctions are indicated by yellow arrows).  SJ micrographs TJs and SJs (Alberts 2002). Paranodal Junction adapted from (Daneman and Barres 2005)- no scale provided. b) Function in the Nervous System: The BBB in Drosophila is formed by several layers of glia which surround axons to protect action potentials from the surrounding hemolymph. One layer of glia, the perineurial glia, forms SJs which are essential for BBB integrity during development. The closed circulatory system of vertebrates requires a different BBB structure. Endothelial cells of blood vessels form TJs which prevent efflux of ions, bacteria or toxins from the blood into the brain. Vertebrate BBB adapted from (Daneman and Barres 2005) c) Function in Epithelia: Vertebrate TJs occur apical to AJs, where they limit diffusion of membrane proteins, seal cells together, and regulate paracellular transport. With exception to their debatable role in limiting protein diffusion, analogous functions are served by Drosophila SJs, which occur just below AJs.  5  Figure 1: Comparison of Vertebrate and Drosophila Occluding Junctions  6  1.3 The Tricellular Junction (TCJ) While junctions that occur at bicellular contacts are fairly well described, those which occur at regions of tricellular contact (eg. at epithelial cell corners), have yet to be characterized at the molecular level (Figure 2a). Until recently, the only work which has described the TCJ in invertebrate epithelia used freeze-fracture and EM analysis of Drosophila imaginal discs (from which wings develop). Drosophila imaginal discs are often used for SJ imaging (and will be used in the course of this work) due to the simplicity of the tissue (two layers of epithelia), and the ease with which the relatively large tissue can be manipulated. As illustrated in Figure 2b, Fristrom et al. showed SJ strands surround eptihelia in a belt-like structure, then turn and run perpendicular to the surface at cell corners, resulting in a gap at which no septa form (Fristrom 1982). Instead, a series of lens-shaped discs form the “tricellular plug,” a biochemically undescribed structure which is thought to link SJ strands at the TCJ (Fristrom 1982). A similar structure has not yet been described in the nervous system, however, it could easily be overlooked as the stack of discs closely resembles a SJ when viewed longitudinally (Figure 2c) (Fristrom 1982).  7  Figure 2: The Tricellular Junction  a) EM of the TCJ in Drosophila imaginal discs (Fristrom 1982). Note septa join adjacent cells until they reach the cell corner (100,000x magnification - no scale bar was provided). b) SJ strands (blue) surround epithelia (orange) like a belt. At the cell corner, these strands turn and run perpendicular to the cell surface. A stack of diaphragms (red) are proposed to connect these strands to form a seal at the cell corner. Adapted from (Fristrom 1982)  c) Tricellular plug (tp) formed by stacked diaphragms is viewed longitudinally by EM (Fristrom 1982). SJ strands (SJ) can be seen running perpendicular to the discs. (80,000x magnification)  8  1.4 Gliotactin At this time, Gliotactin (Gli) is the only protein known to localize at TCJs in Drosophila (Figure 3a) (Schulte et al. 2003). Gli was originally described as a glial-specific protein required for neural ensheathment and BNB integrity (Figures 3b and 4a)(Auld et al. 1995) Subcellular localization of Gli within the glia has thus far been difficult to describe. Staining is often somewhat punctate, and does not necessarily line up with the SJ (Figure 3b). Gli may form spots of adhesion at sites where three glial cells come together, however, this hypothesis requires further exploration using ultrastructural analysis (Auld, V, personal communication). It is now known that Gli is also at epithelial TCJs, where it influences barrier integrity and SJ development (Schulte et al. 2003). Gli mutant embryos lack epithelial barrier function as demonstrated using dye-exclusion experiments (Figure 4bi) (Schulte et al. 2003). Furthermore, when stained for SJ components, gli mutants have mislocalized NrxIV, Cor and Dlg, indicating a role for Gli in SJ development (Figure 4bii) (Schulte et al. 2003). Likely related to these mislocalizations is a marked decrease in the number of septa formed and the number of gaps seen between lateral membranes (Schulte et al. 2003). It has been hypothesized that Gli may recruit and anchor SJ strands to the TCJ where it would provide link to the tricellular plug (Schulte et al. 2003). SJ mutants (eg. coracle and nrxIV) show Gli mislocalization, however, this phenotype could just as easily be attributed to the disruption of cell-cell contacts or polarity, as they could be to the loss of a direct Gli interactor (Auld, Vanessa, Personal Communication). Ultrastructural analysis has not been done of these mutants to determine whether there is any disruption of the TCJ itself. At this time, the data supports only that Gli and SJ strands are interdependent for proper apical-basal localization. In order to characterize post-embryonic gli, alleles have been generated via ethane methyl sulfonate (EMS) induced point-mutations (Venema et al. 2004). Such alleles include  gliDV3, gliDV5 and gliRAR77. GliDV3 and gliRAR77 both contain premature stop codons resulting in truncated proteins (Venema et al. 2004). GliDV3 contains only a small portion of the extracellular domain and therefore acts as a null-allele, whereas GliRAR77 is truncated such 9  that the intracellular domain is shortened (Venema et al. 2004). In contrast, gliDV5 is a missense mutation in the extracellular domain, resulting in the only homozygous-viable gli allele (Venema et al. 2004). During analysis of gli alleles, it was found that Gli has a novel role in planar cell polarity (PCP). PCP describes the property of some epithelial tissues to become polarized in a plane perpendicular to the apical-basal axis. Such organization is best illustrated by parallel alignment of feathers, fur, scales, or in this case, wing hairs. The frizzled pathway is perhaps the most well-known governor of tissue polarity. In Drosophila wing development, Frizzled receptors are localized at the distal end of epithelial cells such that prehairs emerge from this site, pointing towards the distal end of the wing (Strutt 2001). In the absence of Frizzled, the hairs emerge from the cell center and, at times, point towards the proximal end of the wing (Strutt 2001). Despite this disruption, hairs remain parallel to one another, indicating an alternate mechanism governing parallel alignment (Strutt 2001). The first such mechanism was suggested from studies in gliDV3/gliDV5 mutant flies, in which adult wings have defects including blistering, abnormally thin hairs, and unusual parallel hair alignment (Figure 4biii) (Venema et al. 2004). Upon closer inspection it was found that Gli and Cor form part of a novel pathway which governs wing hair alignment and stabilization following Frizzledmediated prehair emergence (Venema et al. 2004). At this time, it is unknown how this pathway is regulated, which other SJ components are involved and how this pathway is linked to the cytoskeleton. However, likely candidates include the Na+/K+ ATPase or Neuroglian due to their known interaction with F-Actin/Ankyrin (Hortsch and Margolis 2003; Venema et al. 2004).  10  Figure 3: Gliotactin Localization in Epithelia and Glia  a) Third instar larvae wing imaginal discs were stained for Gli (green) and Dlg (red). Gli localizes exclusively to the TCJ, while Dlg marks the SJs in peripodial cells (left) and columnar epithelia (right) (Schulte et al. 2003). b) Gli (red) in peripheral glia. The extracellular matrix is marked with PerlecanGFP, and SJs are stained with Cor (blue)(Gilbert, Unpublished Work). All units are in microns  a)  b)  11  Figure 4: gliotactin Mutant Phenotypes a) Nervous system phenotypes:  Left) Peripheral nerve in ~Stage 17 embryos. Wild type (wt) glia fully surround axons at this stage. In gliotactin (gli) mutant embryos, glia fail to surround all axons, with several left exposed to the surrounding hemolymph (arrow) (Auld et al. 1995). Right) Ruthenium red staining of wt peripheral nerves shows dye penetration only around the nerve and, to a limited extent, between glial processes. Gli mutants, however, show penetration into the nerve. Adapted from (Auld et al. 1995). b) Epithelial phenotypes: i.  Stage 17 embryos were injected with a 10kD rhodamine-dextran conjugate. After 10min the dye effectively penetrated the epithelial barrier of gliAE2Δ45 (null) mutants (right)(Schulte et al. 2003).  ii.  Abdominal segments from gliAE2Δ45 mutants were stained for the AJ components Armadillo (Arm) or DE-Cadherin (DE-Cad) (Red) and SJ components as indicated (Green). GliAE2Δ45 mutants showed basal spread of all SJ components, while AJ components remained unchanged (Schulte et al. 2003).  iii.  Scanning electron micrographs of wing hairs from wt and gliDV3/gliDV5 flies. In the gliDV3/gliDV5 mutants, wing hairs were misaligned (right) in comparison to wt wing hairs (left). This phenotype was independent of the frizzled pathway, indicating a novel role for Gli in wing hair polarization (Venema et al. 2004).  12  Figure 4: gliotactin Mutant Phenotypes  13  1.5 Gliotactin Structure and Binding Candidates Gli is a single pass transmembrane protein which is homologous to vertebrate Neuroligins (Gilbert et al. 2001). Gli contains several motifs/domains including: an Nterminal choline-esterase-like domain, two potential phosphotyrosine (pY) motifs, a protein kinase C (PKC) phosphoserine motif and a C-terminal PDZ binding motif (Figure 5). All of these domains are well-conserved in arthropods (see C-terminal alignment in Appendix 1.1). This section shall address each, with specific reference to their potential to form complex interactions and their potential binding partners.  Figure 5: Gliotactin Primary Structure  14  1.5.1 Choline-Esterase Like Domain The choline-esterase-like domain shared by the Neuroligin family is catalytically inactive due to a mutation in one of three residues required for enzyme function (Gilbert et al. 2001). These domains share Ca2+-binding sites which are thought to mediate interactions between Neuroligin and Neurexins (Not to be mistaken with the EF-hand domain which has not been shown to bind ions)(Figure 6a) (Levinson and El-Husseini 2007). It is possible that, in Gli, these domains could mediate Ca2+-dependent interactions similar to those seen between Neuroligin and Neurexins. However, Gli has shown no interaction with NrxIV or neuronal specific NrxI and consequently the identity of said interactor(s) is still unknown (Schulte et al. 2006; Niessen 2007; Gilbert 2008). Neuroligins are known to dimerize via their choline-esterase-like domain and it is therefore possible that Gli similarly forms a dimer/oligomer (Figure 6) (Comoletti et al. 2007). GliDV5 mutants are more viable when in trans to gliRAR77, suggesting the intra- and extracellular domains of Gli are capable of acting together when on separate proteins (Venema et al. 2004). Neuroligin clustering is sufficient and necessary to trigger Neurexin clustering and the subsequent nucleation of scaffolding proteins required for exocytic machinery at synapses (Dean et al. 2003). The gliDV5 allele contains a point mutation within the putative Gli dimerization domain (based on homology to Neuroligin and acetyl cholinesterase) (Figures 4biii and 6b) (Venema et al. 2004). This mutation may therefore interfere with Gli dimerization, resulting in a partial loss of Gli function and a tentative explanation for the phenotypes associated with this allele. Oligomer formation may therefore be a critical determinant of Gli function and should be considered for proper interpretation of gli mutant phenotypes and design of in vitro experiments. (Padas  15  Figure 6: Homology to the Neuroligin Choline-esterase Domain Presents Possibility of Conserved Intra/Intermolecular Interactions  a) Dimerization of the Neuroligin choline-esterase like domains (green) allows two Neurexin molecules (orange) to bind, forming an interface where at least one Ca2+ ion (yellow) is associated. Similar types of interactions may be seen for Gli due to the homology described in b). b) Gli choline-esterase-like domain modeled upon acetyl cholinesterase. The dimerization domain consists of two alpha helices (pink, left) which interact with sister helices of associated monomers. The gliDV5 allele contains a mutation (yellow, right) within one of these helices (red, left), possibly explaining its associated phenotypes. (Gilbert and Auld 2005)  a)  bb)  16  1.5.2 Phosphotyrosines There are two predicted pY sites in the Gli intracellular domain. Y760 and Y799, potentially regulate the amount of Gli contained in the cell membrane (Figures 5 and 7) (Padash, M., Unpublished Work). It is possible to mimic a constitutive phosphorylated state via mutation of these residues to aspartic acid, whose R-group resembles both the charge and shape of phosphate (GliDD mutant) (Cuevas et al., 2001, Cantarelli et al., 2007). Similarly, constitutive dephosphorylation can be mimicked using a phenylalanine substitution (GliFF mutant) (Meyer et al., 2002, Guo et al., 2004). When either GliDD or wt Gli (GliWT) are over-expressed in flies, Gli spreads around the SJ and an accumulation of Gli containing vesicles is observed (Figure 7ii-iii) (Padash, M., Unpublished Work). GliFF mutants do not show a high degree of vesicle formation, while still concentrating throughout the SJ (Figure 7iv) (Padash, M., Unpublished Work). The vesicles are thought to be endosomes due to a high correlation between Gli and early endosome associated protein 1 (EEA1), LAMP1 (lysosome) and Hrs (late endosome) immunostaining (Padash, M., Unpublished Work). Gli did not colocalize with golgi-derived vesicles or ER-derived vesicles in similar experiments indicating these were not trafficking vesicles (Padash, M., Unpublished Work). These results would be further supported through immunodetection of Gli in purified endosomes, however, this experiment has not yet been done. Nonetheless, these pY residues appear to be involved in endocytic trafficking of Gli, and are therefore of interest in terms of finding an associated kinase or adaptor protein. There are two major classes of pY binding domains: PhosphoTyrosine Binding (PTB) and Src-homology 2 (SH2) domains. PTB domains are comprised of 100-150 residues that commonly bind Asn-Pro-X-Tyr motifs (Pawson 2008). They are often found in scaffolding proteins which contain additional protein binding domains (eg. PDZ domain) and are therefore associated with the formation of multiprotein complexes (Smith et al. 2006). PTB domain-containing proteins can be divided into three families: insulin receptor substrate 1 (IRS-1)/Dok-like, Shc-like and Dab-like. IRS-1/Dok members are dependent on tyrosine phosphorylation for binding and are therefore implicated in receptor tyrosine kinase (RTK) signaling (Smith et al. 2006). The majority of PTB-containing proteins, however, fall into the other two families which show no preference for phosphorylation. Such proteins are 17  involved in a variety of cell functions, including the trafficking of receptors (Chen et al. 1990), asymmetric cell division (Chien et al. 1998) and integrin-mediated adhesion (Chang et al. 1997). There are no predicted PTB sites in Gli, however, due to their prevalence in multiprotein complexes associated with the membrane, it is possible that one of these proteins may be associated with the Gli complex SH2 domains are comprised of ~100 residues that bind to a variety of pY-containing peptide motifs (Pawson 2008). SH2-domain-containing proteins exhibit broad activities depending on other domains present in the proteins. Grb2, Nck and Crk family members contain both SH2 and proline-binding SH3 domains, allowing them to act as adaptors linking signaling proteins (eg. Sos) to phosphorylated RTKs (Pawson et al. 2001). Other SH2 proteins act as nucleation centers for multiprotein complexes (eg. ShcA/B, IRS-1). These docking proteins often contain a membrane binding domain, a PTB domain, several regulatory pY residues, and SH2 domains which recognize a distinct subset of phosphorylated RTKs (in comparison to the PTB domain) (Pawson et al. 2001). Some proteins couple this scaffoldingtype role with catalytic activity via kinase or phosphatase domains. These proteins often contain SH3 domains as well, allowing them to bring substrates in close proximity to their catalytic site (Pawson et al. 2001). Finally, many SH2-containing proteins act as signaling regulators. Such is the case for Cbl, which can deactivate RTKs via pY binding and recruitment of E2 ubiquitin-ligases using a RING-H2 domain (Pawson et al. 2001). Many of the above mentioned pY-associated proteins could be involved in regulating Gli function and/or localization.  18  Figure 7: Gli Phosphotyrosines are Associated with Increased Vesicle Association  In wt flies (i), Gli is localized exclusively at the TCJ in epithelia (grn) (Schulte et al. 2003). When overexpressed, Gli spreads around the entire cell membrane at the level of SJs (Padash, M., Unpublished Work). In UASGliWT and UASGliDD (Y760D, Y799D) mutants, an accumulation of Gli containing vesicles is also seen (indicated by yellow arrows) (ii-iii) (Padash, M., Unpublished Work). These vesicles are not seen in UASGliFF mutants, despite there being a similar distribution of Gli in the membrane (iv) (Padash, M., Unpublished Work).  19  1.5.3 PKC Serine Phosphorylation Site Members of the PKC family are responsible for a wide array of signal transduction mechanisms. There are six known isoforms in Drosophila which differ in their response to Ca2+ and diacylglycerol (DAG) (Shieh et al. 2002). Two of these, eye-PKC and daPKC, have been characterized thus far. As the name implies, eye-PKC is expressed exclusively in photoreceptor cells where it associates with the scaffolding protein Inactivation No After Potential D (InaD) (Shieh et al. 2002). Association with one of InaD’s five PDZ domains is thought to hold eye-PKC in position to phosphorylate further complex components and thereby regulate phototransduction via the Transient Receptor Potential (TRP) Calcium channel (Shieh et al. 2002). Eye-PKC is a classical PKC (cPKC), meaning it requires both DAG and Ca2+ for activation. Since eye-PKC is photoreceptor-specific, another cPKC, PKC53E, may be of greater interest for interaction with Gli. It is possible that a multi-PDZ scaffolding protein could act as a bridge between Gli and PKC53E (InaD is also eye-specific) in a manner reflective of bridging the TRP channel and eye-PKC (Figure 8, red arrows). DaPKC, which is an atypical PKC (aPKC) (no calcium dependence) is responsible for establishing and maintaining cell polarity in epithelia and for regulating asymmetric cell division in oocytes and neurons (Shieh et al. 2002). In terms of cell division, this effect is thought to result from association with Bazooka (vertebrate homolog Par3) which is responsible for rotation of the mitotic spindle and localization of cell fate determinants (Shieh et al. 2002). This interaction is once again thought to be PDZ domain-dependent, presenting the possibility of association between Dlg or another PDZ domain containing scaffolding protein and daPKC. Preliminary data indicates that Gli mutant cells show plane of division defects (Charish, Unpublished Work), perhaps indicating a relation to daPKC and the Bazooka complex. Little is known regarding the other four isoforms of PKC, any of which could also phosphorylate Gli and thereby regulate its activity. (Charish 2008)  1.5.4 PDZ Binding Domain Finally, the PDZ binding domain of Gli comprises three C-terminal residues which are recognized by PDZ domain-containing scaffolding proteins. Scaffolding proteins often contain multiple PDZ domains which each bind to different members of a signaling complex 20  (Ranganathan and Ross 1997). In this manner they accelerate signaling reactions by bringing components in close proximity. Such an interaction was described above, where eye-PKC was bound to one of InaD’s five PDZ domains such that it had a much higher probability of phosphorylating both InaD and other complex components such as TRP (Shieh et al. 2002). It is possible that a scaffolding protein associates with Gli via PDZ interactions, meanwhile recruiting an associated intracellular signaling complex (Figure 8, green arrows). PDZ domains are among the most common protein domains, resulting in numerous proteins with which Gli may interact (Ranganathan and Ross 1997). PDZ domains were first discovered in Dlg which is part of the membrane associated guanylate kinase (MAGUK) family of proteins (Woods and Bryant 1991).These are characterized by one or more PDZ domains, a guanylate kinase domain, and an SH3 domain. Often found at sites of cell-cell contact, the MAGUKs are an attractive target for Gli interaction. As mentioned earlier, Gli interacts, although indirectly, with Dlg (Schulte et al. 2006) . Dlg contains three PDZ domains, of which two have some known function. PDZ2 is required for Dlg localization to the SJ, a function which can be partially compensated for using PDZ1 (Hough et al. 1997). PDZ3, on the other hand, is not required for Dlg localization but is nonetheless associated with increased fly viability (Hough et al. 1997). Dlg-null mutants have disorganized SJs and tumor-like overgrowth indicating it may localize an essential SJcomponent such as NrxIV (Woods and Bryant 1991). Such an association, however, has failed to be shown. Since a Dlg SJ-binding partner is unknown, finding the scaffold which links Gli to Dlg at the TCJ may also present the connection between Dlg and the entire SJ (Figure 8, orange arrows). PDZ domains normally bind to a C-terminal Ser/Thr-X-Val-COO- motif (Ranganathan and Ross 1997). More recently, however, PDZ domains have been shown to also bind other PDZ domains as well as internal sequences which resemble C-termini (Harris and Lim 2001). These present the possibility that a multi-PDZ domain containing protein, such as a MAGUK, may bind to Dlg using PDZ/PDZ interactions, then interact with Gli using an alternate PDZ domain. MAGI/S-SCAM is a MAGUK which has been shown to bind and cluster Neuroligin at synapses (Hirao et al. 1998; Iida et al. 2004). Due to the homology between Gli and 21  Neuroligin, Magi could be a potential target for Gli PDZ binding. MAGI has five PDZ domains which would permit it to recruit both Gli and Dlg into a scaffolded complex (Figure 8). Lack of MAGI-specific antibodies has flouted efforts to detect colocalization at the SJ/TCJ, or to detect MAGI in Gli immunoprecipitates or other types of Pull-downs. Fortunately, recently available MAGI RNAi fly lines allow for a genetic approach to look at possible effects on Gli localization in response to knock-down of this protein. Gli association with MAGUK proteins is supported by evidence that there is a genetic interaction between Gli and the as yet uncharacterized Vulcan (Venema 2003). Vulcan was identified during a screen for ecdysone inducible genes related to leg morphogenesis (Gates and Thummel 2000). A crooked-leg phenotype was linked to a member of the Synapseassociated protein (SAP) 90/Postsynaptic density (PSD)-95-associated protein (SAPAP) family of proteins. SAPAPs and Vulcan contain guanylate kinase anchoring protein (GKAP) domains. In vertebrates, GKAPs have been shown to bind the GK domain of hDlg (human homolog) and other MAGUKs (Kim et al. 1997; Satoh et al. 1997). The genetic association between Gli and Vulcan could either imply Vulcan binds Drosophila Dlg as part of the Gli complex, or that it associates with another MAGUK protein which scaffolds both Dlg and Gli (Figure 8, turquoise arrows). Again lack of antibodies is an obstacle to studying this interaction, however, RNAi lines have also been generated for Vulcan and therefore possible interactions can be seen by looking for mislocalization of Dlg and Gli.  22  Figure 8: Gli may be Scaffolded to a Number of Cytosolic and Membrane components  The Gli C-terminal PDZ-recognition site (yellow) may interact with a large multi-PDZ-domain containing protein (black arrow), thus facilitating recruitment of any number of cytosolic and transmembrane proteins. In this example, MAGI, a MAGUK containing multiple PDZ domains and a GK domain, is given as an example of such a scaffolding protein. Four possible interactions which are described in the text are illustrated here: Green arrows: The multi-PDZ protein and/or scaffolded Dlg may recruit signaling molecules to phosphorylate Y760, Y799, S838 or other residues within the Gli-C-terminus Orange arrows: Dlg may form PDZ-PDZ interactions with the multi-PDZ domain containing protein which is also associated with Gli and possibly other SJ components Red arrows: The multi-PDZ protein and/or scaffolded Dlg recruit activated PKC to facilitate phosphorylation of S838 Turquoise arrows: Vulcan may be required to interact with the GK domain of either a scaffolding protein or Dlg, thus explaining its genetic interaction with Gli.  23  1.6 Technical Details In the course of this thesis, a number of strategies were employed to identify components of a Gli-containing protein complex. The following section shall describe two techniques which are either Drosophila-specific (GAL4/UAS system) or relatively new (mass spectrometry analysis of complex protein samples).  1.6.1 GAL4/UAS system Targeted gene expression in Drosophila is done using the GAL4/UAS system. GAL4 encodes a yeast regulatory protein which drives expression of GAL10 and GAL1 genes through binding to four related 17 base pair sites (Oshima 1982; Laughon et al. 1984; Giniger et al. 1985). These sites form the Upstream Activating Sequence (UAS), which can respond to GAL4 expression when fused to a coding sequence of interest (Fischer et al. 1988). Advent of enhancer-trap GAL4 constructs further allows for the fusion of Drosophila regulatory sequences to GAL4 such that it can driven in a temporal and tissue specific manner (Brand and Perrimon 1993). An example of the GAL4/UAS system as used with the imaginal wing disc-specific driver Apterous-GAL4 (ApGal4) is described in Figure 9a. In addition to driving protein expression, the UASGAL4 system has also been adapted to express RNAi. To this effect, the UAS element is cloned upstream of a 300-400bp inverted repeat homologous to a sequence of interest (Figure 9b). When transcribed, this will form a hairpin loop structure, which, when processed by Dicer, will form siRNAs which can direct sequence-specific degradation of target mRNAs (VDRC 2008). In this manner, the knockdown of a gene in a specific location can be associated with a resulting phenotype. This is especially powerful when traditional methods to introduce RNAis (eg. microinjection) result in embryonic death due to lack of temporal and tissue-selectivity.  24  Figure 9: GAL4/UAS System  a) When fly lines carrying a UAS responder gene (eg. UASGFP) are mated to a driver line (eg. ApGAL4), the resulting progeny will only have responder gene expression in a tissue and temporal-specific manner if in combination with the GAL4 driver. When the driver is present, it will bind to the UAS element to facilitate expression of the responder gene. Either element on its own should not produce a phenotype, however, some driver lines do show associated phenotypes and should be used as negative controls.  b) The GAL4/UAS system can be used to drive expression of inverted repeats which, when transcribed, will form hairpin loops (hpRNAis). These are processed by Dicer into siRNAs which can direct sequence-specific degradation of target mRNAis (VDRC 2008)  a)  b)  25  1.6.2 Mass Spectrometry Analysis of Immunoprecipitates/Pull-Downs Mass spectrometry (MS) is emerging as powerful technique with the potential to revolutionize protein identification. MS is faster and more sensitive than chemical sequencing methods, while being able to identify hundreds of proteins (and their posttranslational modifications) within a protein mixture (Golemis 2002). Genome sequencing projects have further provided the sequencing data from which proteins can be readily identified based on MS sequenced peptides (Golemis 2002). An outline of the technique used for this work is outlined in Figure 10. Analysis begins with a crude protein sample (eg. immunoprecipitate). Disulphide bonds are reduced and alkylated, then proteins are digested in a sequence-specific manner, in this case with Trypsin. Samples are run through a reverse phase high pressure liquid chromatography (HPLC) system, which is coupled to the Thermo LTQ Orbitrap used for MS/MS analysis. For this reason, the analysis used is termed LC-MS/MS (liquid chromatography tandem MS). The eluent is ionized and the time taken for peptide ions to reach the first detector is used to calculate the m/z ratio, and hence, the mass of individual peptides within the mixture (Golemis 2002). Peptides of a defined m/z ratio are then diverted and fragmented at amide bonds through high speed collision with a gaseous spray (Golemis, 2002). The resulting fragments form a Y- and b- series of complimentary peptides (eg. VWXYZ becomes VW (y-series) and XYZ (b-series)) whose masses can be used to determine the peptide sequence (Golemis, 2002). Identified proteins are given an “ion score” which is calculated using the Mowse algorithm which calculates the probability that the match made between the peptide and the protein could be random (Pappin et al. 1993). The total protein ion score represents the sum of individual peptide matches to a single protein, and thus a higher score reflects higher confidence in the indentification. The method described presents several advantages over traditional MS analyses. Firstly, the HPLC separation step simplifies the sample being analyzed at any given time, making data analysis more straightforward (Golemis 2002). Secondly, the MS/MS data has sequence data from within individual peptides, providing more than a mere “footprint” of 26  the whole protein (Golemis 2002). For this reason MS/MS data can be used to probe expressed sequence tag databases which may not contain sequence information for the entire protein. Finally, since fragment m/z values are directly correlated to their parent peptide m/z values, it is possible to sequence peptides from within a complex mixture of proteins (Golemis 2002). This removes the requirement for prior purification or separation by 2-D SDS-PAGE, techniques which have been commonly used for this purpose in the past.  Figure 10: Summary of technique used for LC-MS/MS purification of protein mixtures. See text for details. Adapted from(Golemis 2002)  (1)  (2)  27  1.7 Hypothesis This thesis will describe a number of approaches used to identify proteins which interact with Gli at the TCJ. Due to the number of conserved interaction domains described above, I hypothesize that Gli forms both intra- and extracellular protein-protein interactions, and that said interactions are necessary for Gli function/localization. To test this hypothesis, the main question will be: What proteins interact with Gliotactin to regulate its function and localization? To address this question, experiments were devised to test the following: 1. Does Gliotactin form any pY-dependent interactions? 2. Does Gliotactin form part of a complex? (experiments with no control for site of protein binding) 3. Does Gliotactin oligomerize via its extracellular domain? 4. Does Gliotactin interact with PKC?  Results for points 1 and 2 will be presented in the Results section, whilst incomplete experiments from points 3 and 4 along with interactor identification strategies/experiments which were found to not be amenable to Gliotactin studies are included in Appendix 2.  28  2. Materials and Methods Miscellaneous Reagents  PhosStop phosphatase and Complete protease inhibitor tablets (Roche) resuspended in 1 mL of dH20 were used as a stock solution for all buffers described. Phosphate buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH7.4). Fly Strains  Fly strains were grown on potato-based media (100 g/L dried potato flakes, 10 g/L agar, 35 g/L white sugar, 35 g/L yeast pellets, 0.011 g/L Sodium Propionate) at 22⁰C with exception to UASRNAi experiments which were conducted at 29 ˚C. Embryos were collected every 24 hrs from room temperature apple juice plates (26 g/L agar, 25 g/L sucrose, 1.5 g/L methylparaben, 25% apple juice (v/v)) for IP experiments. SDS-PAGE and Western Blots  Samples were diluted ½ with 2x SDS loading buffer (125 mM TrisHCl pH 6.8, 4% SDS, 1.7 M β-Mercaptoethanol, 20% glycerol, and 0.01% bromophenol blue) then boiled 5 min. These were run on 10% separating, 5% stacking SDS-PAGE (with exception to GST-SH2/PTB binding experiments which used 15% separating) at 100-120V. Gels which were stained used one of the three described options: 1) Coomassie Stain (0.25% coomassie R-250, 50% methanol, 10% acetic acid) for ~1 hr, then destained in 50% methanol, 10% acetic acid. 2) GelCode Blue (Pierce) stain for 1 hr followed by destain in water. 3) Silver stain using SilverQuest Staining kit (Invitrogen) according to manufacturer’s instructions. Gels used for Westerns were equilibrated in transfer buffer (48 mM Tris, 39 mM Glycine, 0.0375% SDS), then transferred to nitrocellulose membranes using the BioRad Transblot Semi-Dry transfer system (Bio-Rad, Hercules, California) at 20V for 20 min. Membranes were blocked for 1 hr at room temperature in either 5% skim milk in PBS + 0.1% Tween for enhanced chemiluminescent detection (ECL), or 50% Odyssey blocking buffer (LI29  COR) diluted in PBS for LI-COR Odyssey fluorescent detection systems. All wash steps were 3x5 min in PBS + 0.1% Tween. Antibodies  Primary antibodies were incubated either 1 hr at room temperature or overnight at 4˚C using the following dilutions (in blocking buffer): Rabbit anti-Gli 1:5000 (Venema et al. 2004), Mouse anti-Gli 1F6.3 1:5000 (Auld et al, 1995), Mouse anti-pY 4G10 1:5000 (a gift from Michael Gold, UBC), Rabbit anti-phosphoserine 1:1000 (Upstate), Mouse anti-π-GST 1:1000 (Transduction Laboratories). Secondary antibodies were incubated for 1 hr at room temperature at the following dilutions (in blocking buffer): goat anti-rabbit-HRP 1:5000 (Jackson ImmunoResearch Laboratories Inc.), goat anti-mouse-HRP 1:5000 (Jackson ImmunoResearch Laboratories Inc), and goat anti-rabbit IRDye 680 (red), goat anti-mouse IRDye 800 (green), goat anti-mouse IRDye 680, and goat anti-rabbit IRDye 800 were all used at 1:20,000 (All IRDye antibodies from Rockland Inc). Polymerase Chain Reaction (PCR)  All PCRs were run using the following Master Mix: 1x PCR buffer (Promega), 2 mM MgCl2 (Promega), 0.2 mM dNTPs (Roche), 0.025U GoTaq polymerase (Promega), 300 µg template DNA and 0.2 µM construct specific primers (see below)(Invitrogen). Src64B/Src64BAct for pGL2 and pET28a  Src64B and Src42A cDNAs were purchased from the Drosophila Genome Resource Center (DGRC) (LD30429 and RE19378 respectively). Src64B was amplified using 5’ AT AAG CTT GCC ATG GGC AAC AAA TG and 5’ TA GAG CTC TTA GTC TTG CAC CC TCG forward and reverse primers, respectively, for pGL2 cloning. This incorporated a 5’ HindIII and a 3’ SacI restriction site. For pET28 cloning, the forward primer was replaced with 5’ AT GAA TTC GCC ATG GGC AAC AAA TG which incorporates a 5’EcoRI site. For activated Src64B (Src64BAct), the same forward primers were used as for Src64B, however, 5’ TA GAG CTC TTA GAA GGA CTC GAA G containing a SacI site was used as reverse primer. Cycling conditions for all primer sets: 30 sec 95˚C, [30 sec 95˚C, 30 sec 50˚C, 1 min 45 sec 72˚C]x30, 5 min 72˚C, hold at 4˚C. 30  Src42A/Src42AAct for pGL2 and pET28a  A 5’BamHI site and 3’ SacI site were introduced using 5’TA GAA TTC GCC ATG GAC CCC AAG GAT TTC and 5’TA GGA TCC GCC ATG GGT AAC TGC forward and reverse primers, respectively. These sites were used for both pGL2 and pET28 cloning. For Src42AAct, two consecutive PCRs were used to generate a mutation of Y511F (underlined) using the above described forward primer with 5’ CTG CGC CTC TTT GAA GTC GCT CTG as reverse. The resulting PCR product was ligated into pGEMT then used as PCR template using the same primers used for Src42A. Cycling conditions: identical to Src64B. DaPKC and δPKC for pET28a  cDNAs were purchased from the DGRC (RE60936 and RE44754 respectively). DaPKC was amplified using 5’TAGAATTCGCC ATG CAG AAA ATG C and 5’TA GAGCTC TCA GAC GCA ATC C as forward and reverse primers respectively. These introduced a 5’ EcoRI site and a 3’ SacI site. δPKC was amplified using 5’TAGGATCC GCC ATG ATG TTC ACA CGT and 5’ TAGAATTCCTAGTCCAAGGTGATGTG forward and reverse primers respectively. These introduced a 5’ BamHI and a 3’ EcoRI site. Cycling conditions: similar to Src64B outlined above with exception to the extension stage which was 2 min at 72˚C. PCR products were run on 1% agarose gels + 1:10,000 SybrSafe (Invitrogen) in TAE (40 mM Tris base, 1.14% (v/v) glacial acetic acid, 1.3 mM ethylenediaminetetraacetic acid (EDTA)) at 100V. Bands were gel extracted using the Qiagen Gel Extraction kit, then ligated into pGEMT (PROMEGA) for future subcloning into pET28a or pGL2. Cloning  All ligations were done using a 3:1 insert to vector ratio and incubated for 1 hr at room temperature. Transformations into DH5α and BL21DE3pLysS competent cells were conducted as follows: 1 µL of ligation reaction or plasmid DNA was used to inoculate 50µL of competent cells. Cells were kept on ice for 15-30 min, heat shocked for 30 sec at 42˚C, then promptly placed back on ice for 2 min. 250 µL of SOC broth (20 g/L Tryptone, 5 g/Lyeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose) was added, 31  then cultures were grown for 1 hr at 37˚C shaking at 250 rpm. 50-300 µL was plated on Luria broth (LB) agar (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, 15 g/L agar) with the appropriate antibiotic, then grown overnight at 37 ˚C. pGEMT transformations were plated with 40 µl of 0.1M isopropyl thiogalactoside (IPTG) and 40 µl of 20 mg/mL 5-bromo-4-chloro3-indolyl-beta-D-galactopyranoside (X-gal) to facilitate blue-white screening. Transformants were chosen either by blue-white screening or by random selection for Colony PCR confirmation of ligation. Colonies were plucked and sequentially touched to another LB plate with the appropriate antibiotic then used to inoculate 50µL of 10mM TrisHCl pH8. Plates were grown overnight at 37˚C, whilst inoculated samples were boiled for 2 minutes, then briefly spun down using a microcentrifuge. 1 µL of supernatant was used in a standard PCR reaction as described above. Colonies corresponding to lanes containing bands of the appropriate size were plucked and grown overnight, then glycerol stocked for later use in 40% glycerol (fin.). All bacterial cultures were grown overnight at 37˚C in Luria broth (10g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) with the appropriate antibiotic. DNA was prepared by alkaline lysis using the Qiagen miniprep system. All digests were conducted for 2 hrs at 37˚C in 1 x OnePhorAll buffer (Invitrogen) using restriction enzymes purchased from New England Biolabs. Digests were gel excised and ligated into their destination vector as described above. Transformants were screened using Colony PCR, then their purified DNA was sent for sequencing by the Nucleic Acid Protein Service Unit (NAPS) at the University of British Columbia. Following sequence confirmation, constructs were transformed into BL21DE3pLysS for protein expression. Protein Expression  Overnight cultures were used to inoculate expression cultures at a ratio of 1:100 (v/v). These were grown at 37˚C at 250 rpm until they reached an OD600nm between 0.6-0.8 (~4 hrs). Cultures were induced with 0.4-1 mM IPTG (times and concentrations specified in Results). Cultures were promptly moved on ice, then spun down at either 4,000 rpm for 30min using the Sorvall SH3000 rotor (5-30 mL cultures) or at 10,000 rpm for 10 min using the Sorvall GS3 rotor (>30-500 mL cultures). Cell pellets were resuspended in ~1 mL lysis 32  buffer/100 mL culture (see below for purification-specific lysis buffers), then sonicated until no longer viscous. Lysates were spun down at 10,000 rpm for 15 min using either a microcentrifuge (<1 mL) or the Sorvall SA-600 (>1 mL). Supernatants were filtered through a 0.22 µ syringe, then loaded onto an equilibrated purification column. Preliminary expression trials were treated similar to above, however, with some differences: at time points throughout the induction, 1 mL of culture was removed and spun down at 10,000 rpm for 5 min by microcentrifuge. Pellets were resuspended in 50 µL of bacterial resuspension buffer (8 M urea, 100 mM KPO4 pH6.8, 20 mM TrisHCl pH8) + 50 µL of 2xSDS loading buffer. Samples were boiled for 5 min, spun down, then loaded directly onto SDS-PAGE gels. Protein Purification His-tag purification  Unless stated otherwise, lysis was performed in His-Lysis Buffer (40 mM imidazole, 300 mM NaCl, 50 mM TrisHCl pH8, 1/100 PhosStop (Roche), 1/100 Complete (Roche)). A volume of Nickel NTA-agarose (Qiagen) equal to the lysate was pre-equilibrated with HisLysis Buffer in either a 1.5 mL eppendorf tube (<250 µL) or in a disposable column (Biorad). The prepared lysate was then added to the resin and incubated for 30 min-1 hr at room temperature with end-to-end mixing. The flow-through was collected, then the resin washed with >10 column volumes of His-wash buffer (50 mM imidazole, 300 mM NaCl, 50 mM TrisHCl pH8). Should the samples be used immediately for SDS-PAGE, proteins were eluted using 1 column volume of 2xSDS-LB then boiled for 5min. To elute proteins for subsequent experimentation, three fractions were collected using one column volume of elution buffer each (250 mM imidazole, 300 mM NaCl, 50 mM TrisHCl pH8). Purity and general concentration were checked by SDS-PAGE, then fractions of highest concentration were pooled and dialyzed overnight using Slide-A-Lyzer 7000MWCO cassettes (Pierce).  33  Immunoprecipitations Preparation of Cross-Linked Resin  Rabbit-anti-Gli IF6.3 antibody was concentrated ~13X using Centricon-50 kDa 15 mL centrifugal filters (Millipore), then purified using the MelonGel system (Pierce). Antibody concentration was determined using absorbance at 280 nm and Beer’s Law (A280=εCL where A280 is the absorbance at 280 nm, ε is the extinction co-efficient (= 210000M-1cm-1 for IgG), l is the path length (1 cm) and C is the concentration in mg/mL). Purified antibody was crosslinked to ImmunoLink Coupling Gel (Pierce) at a ratio of 0.01 mg Antibody/µL of resin according to manufacturer’s instructions for pH 7.2 (Thermo Fisher Scientific Inc 2008). A similar protocol was followed for cross-linking Rabbit-IgG, however this antibody did not require purification prior to cross-linking. Preparation of Lysates  Embryos were collected into Nytex filters every 24 hrs using a soft brush and PBS + 0.1% Tween-20. They were dechorionated in 50% bleach for 2-5 min then washed thoroughly with PBS + 0.1% Tween-20. Following removal of supernatant, the embryos were weighed, then homogenized in Non-Denaturing (ND) buffer (20 mM TrisHCl pH8, 137 mM NaCl, 10% v/v Glycerol, 1% v/v NP-40, 2 mM EDTA, 1/100 Complete (Roche) and 1/100 PhosStop (Roche)) at a ratio of 1 mL buffer/mg of embryos. Lysates were spun down at 10,000 rpm for 10 min at 4˚C using a microcentrifuge. Supernatants were frozen with liquid nitrogen and stored at -80˚C. Adult flies were homogenized in ND buffer at a ratio of ~5 µL/fly. Lysates were spun down at 10,000 rpm for 10 min at 4˚C using a microcentrifuge. Supernatants were used immediately for IPs. Immunoprecipitations Using Crosslinked Resin  Embryo or adult lysates were applied to antibody-conjugated resin at a ratio of ~3 µL of lysate/µL of resin. Samples were rotated 1 hr at room temperature, then washed with a minimum of 10 column volumes of IP wash buffer (20 mM TrisHCl pH8, 137 mM NaCl, 10% v/v Glycerol, 1% v/v NP-40). Immunoprecipitates were eluted using 3 column volumes of IgG 34  Elution buffer (Pierce), then neutralized with 1.5 M TrisHCl pH 8.8 added to a final concentration of 85 mM. Standard Immunoprecipitations  1 µg of antibody was added to 20 µL of Protein G agarose (Calbiochem) and rotated for 1hr at room temperature. Beads were washed two times with ND buffer, then lysates were added and incubated 1 hr at room temperature. Beads were washed four times with ND buffer, then one time with PBS. Proteins were eluted by addition of 20 µL of 2xSDS LB and boiling for 5 min. Sample Preparation for Mass Spectrometry  Neutralized immunoprecipitates were concentrated by adding four volumes of 100% ethanol and 20 µg of glycogen, then buffering to pH 5 with 50 mM sodium acetate. Samples were incubated overnight at room temperature, then spun down at 4,000 rpm for 20 min at 4˚C using the Sorvall SH3000. Pellets were dried at room temperature for 5-10 min, resuspended in 25 µL digestion buffer (1% sodium deoxycholate, 50 mM Ammonium carbonate) then boiled at 90˚C for 5-10 min. At this point a rough estimate of sample concentration was done using A280 = ~1 mg/mL and Beer’s Law. To reduce disulphide bonds, 1 µg dithiothreitol (DTT) was added per 50 µg immunoprecipitate. Samples were incubated at 37˚C for 30 min, then alkylated for 20 min at 37˚C with 5 µg of iodoacetamide/50 µg of sample. Finally, samples were digested with 1 µg sequence grade Trypsin (Promega) per 50 µg sample, and incubated overnight at 37˚C. Samples were submitted for further processing to the UBC Molecular Biophysics Lab Proteomics Core Facility. Membrane Preparations  ~3 g of flies were collected and homogenized in a minimal volume (~4 mL)of Homogenization Buffer (50 mM TrisHCl pH 7.5, 150 mM KCl, 5 mM KCl, 5 mM MgCl2, 250 mM Sucrose, 0.1 mM DTT, 1 mM PMSF, 2 µg/mL leupeptin, 2 µg/mL pepstatin) using a dounce homogenizer. The homogenate was centrifuged at 3000 rpm for 10 min at 4˚C using the Sorvall SA-600 rotor, then the supernatant was transferred to an SW27 (Beckman) ultracentrifugation tube and gently mixed with 15.2 mL of Homogenization Buffer containing 35  2.5 M sucrose. 0.5 M Sucrose Homogenization Buffer was then added to within 1 cm of the rim (gently such that mixing did not occur). Tubes were spun at 24,000 rpm using the Beckman L8M ultracentrifuge for 1-2.5 hrs at 4˚C. Following centrifugation, membranes were removed from between the sucrose layers using a Pasteur pipette, then two volumes of 250 mM Sucrose Homogenization Buffer were mixed in. Samples were respun at 10,000 rpm for 10 min in a microcentrifuge to pellet the membranes. The supernatant was removed, and the pellets were either frozen with liquid nitrogen or resuspended in lysis buffer for BCA assay protein quantification (Pierce). Pull-Downs GST-Pull Downs  GST- Gliotactin C-terminal constructs were expressed as described above, with cell pellets lysed in 50 mM TrisHCl pH7.5, 150 mM NaCl, 1 mM PMSF, 2 µg/mL leupeptin, 2 µg/mL pepstatin. For Ca2+-titrations, CaCl2 was added such that the free Ca2+concentrations were as described in Results. Concentrations were calculated using WEBMAXC Standard (http://www.stanford.edu/~cpatton/webmaxcS.htm). Lysates were spun down and filtered, then GST-proteins were bound to GST-bind resin (10 µL resin/µL lysate) (Novagen) for 1 hr at room temperature. The resin was washed with a minimum of 10 column volumes of 50 mM TrisHCl pH 7.5, 150 mM NaCl, then membrane preparations (40 µg resuspended in lysis buffer) were added and allowed to bind for 1 hr at room temperature. The resin was washed with a minimum of 10 column volumes of 50 mM TrisHCl pH7.5, 150 mM NaCl, then proteins were eluted with 1 column volume of 2x SDS-Loading buffer and boiled for 5 min. Samples were run by SDS-PAGE, then gels were stained using Coomassie Blue, GelCode Blue or SilverQuest as indicated within the Results. GST-Pull downs using purified GST-δPKC were done similar to above using 1 µg of protein/30 µL of resin to pull down 1 µg of purified 6xHisGliCtermWT. Gels were transferred for Western blot analysis using rabbit anti-Gli primaries then goat anti-rabbit IRDye 800 secondaries.  36  His-Pull Downs  His-tagged proteins were purified as described above up to and including the wash steps. At this point membrane preparations (40 µg resuspended in lysis buffer) were added and incubated for 1hr at room temperature. The resin was washed with >10 column volumes of His-Wash buffer, then proteins were eluted using 1 column volume of 2xSDS-Loading buffer and prepared for SDS-PAGE and staining. Pull downs using previously purified 6xHisGliCterm (His-tagged Gli C-terminal constructs) for GST-δPKC were done in a similar manner using 1 µg of purified protein per 15 µL of resin to pull down 1 µg of GST-δPKC. Gels were transferred for Western blot analysis using mouse anti-π-GST (BD BIOSCIENCES) and rabbit anti-Gli primaries, then goat antimouse IRDye 680 and goat anti-rabbit IRDye 800 secondaries. Kinase Assays  Human GST-Src Kinase (#7775), Human GST-δPKC (#7342), and 10x Kinase Buffer (25 mM Tris-HCl pH7.5, 5 mM β-glycerophosphate, 2 mM DTT, 0.1 mM Sodium Orthovanadate, 10 mM MgCl2; #9802) were purchased from Cell Signaling Technology. GST-GliCtermWT and GST-GliCtermFF were expressed and purified as described above. Eluted proteins were dialyzed overnight into Kinase Buffer using 7000MWCO Slide-A-Lyzer® dialysis cassettes (Pierce) then quantified using Beer’s law with an extinction co-efficient of 9350M-1cm-1. Src Kinase Assay  A 50 µL Kinase Reaction (1 µg GliCterm, 1 µg GST-Src, 1xKinase Buffer, 1 mM ATP) was incubated at 30˚C for 1 hr, then ¼ of the this reaction was loaded for SDS-PAGE and Western blot analysis as described above using mouse anti-pY 4G10 and Rabbit anti-Gli primaries, then goat anti-mouse IRDye 680 and goat anti-rabbit IRDye 800 as secondaries. δPKC Kinase Assay  A 50 µL Kinase reaction (1 µg GliCtermWT, 1 µg GST-δPKC, 1xKinase Buffer, 0.05 mg/mL 1,2-Diacyl-sn-glycero-3-phospho-L-serine, 0.005 mg/mL 1-oleoyl-2-acetyl-sn-glycerol, 37  0.1 mM CaCl2, 1 mM ATP) was incubated at 30˚C for 1 hr, then ¼ of this reaction was loaded for SDS-PAGE and Western blot as described above using rabbit anti-phosphoserine (UPSTATE) and mouse anti-Gli 1F6.3 primaries then goat anti-mouse IRDye 680 and goat antirabbit IRDye 800 as secondaries. Immunohistochemistry  All samples were mounted in Vectashield (Vector Laboratories) for visualization with either Axioscope (whole wing discs; Zeiss) or Deltavision (all other imaging; Applied Precision) microscopes. Deltavision images were deconvolved with 15-20 iterations using a point spread function calculated with 0.2 µm beads conjugated with Alexa Fluor 568 (Molecular Probes). Images were exported for analysis with Adobe Photoshop CS3. Imaginal Wing Discs  Wing discs were dissected from 3rd instar larvae and placed in 4% formaldehyde in PBS for 30 min at room temperature. Samples were washed 3x15 min in IH Wash Buffer (PBS + 0.1% TritonX-100), then incubated for 1 hr with IH Blocking buffer (PBS + 0.1%TritonX-100 + 3% bovine serum albumin (w/v). Primary antibodies (see below) were incubated overnight at 4˚C, then samples were washed 3x15 min and secondaries were added for 1 hr at room temperature. Samples were washed 3x15 min, then placed in 70% glycerol overnight. Nervous System Fillets  Fillets were prepared in Elixir of Life (EOL)(2 mM CaCl2, 15 mM MgCl2, 24.8 mM KCl, 23.7 mM NaCl, 10 mM NaHCO3, 20 mM isethionic acid, 5 mM BES, 80 mM Trehalose) from 3rd instar larvae. Pinned fillets were placed in 4% formaldehyde in EOL for 30 min at room temperature. These were washed 3x5 min with EOL, then unpinned and blocked 1 hr with IH Blocking buffer + 5% Normal Goat Serum (v/v). Primary antibodies (see below for concentrations) were added for overnight incubation at 4 ˚C. Fillets were washed 3x15 min with IH wash buffer, then secondary antibodies were added for 1 hr at room temperature. Following 3x15 min washes, fillets were placed in 70% glycerol overnight at 4˚C. The following day, fillets were transferred to 90% glycerol overnight at 4 ˚C.  38  Antibodies  Primaries: Rabbit anti-Gli was used at 1:300 (Venema et al. 2004) , Mouse anti-Dlg 4F3 (Parnas et al. 2001) was used at 1:100, Mouse anti-Repo (Developmental Studies Hybridoma bank, University of Iowa) was used at 1:50, Rabbit anti-HRP was used at 1:500(Jackson ImmunoResearch Laboratories Inc.). All Secondary antibodies were used at 1:200: Goat anti-rabbit Alexa Fluor® 568 (Molecular Probes), Goat-anti-mouse Alexa Fluor® 647 (Molecular Probes)  39  3. Results 3.1 Identifying Phosphotyrosine Dependent Interactors 3.1.1 Gliotactin is endogenously phosphorylated  Gli’s pY sites at Y760 and/or Y799 appear to regulate a vesicle-mediated trafficking mechanism which is likely related to endocytosis and/or recycling of Gli (Figure 7). Phosphorylation at these sites has been shown using Western blots and ECL detection combined with immunoprecipitations (IPs)(Que, Unpublished Data; Schulte, Unpublished Data). However, these experiments were hindered by the inability to simultaneous detect both Gli and pY, such that stripping was required between probings. These experiments were repeated using immunofluorescent Western blotting for simultaneous detection of pY and Gli in IPs of flies expressing UASGliWT or UASGliFF (Y760F, Y799F) under control of the ubiquitous driver DaughterlessGAL4 (DaGal4). The aim of this experiment was to determine whether Gli is endogenously phosphorylated; thus justifying pursuit of candidate kinases/adaptors associated with these residues. The UAS fly lines were used to increase Gli recovery in IPs, with UASGliFF acting as a negative control for phosphorylation of Y760 and Y799. When imaged using the LI-COR Odyssey system, Western blots of UASGliWT IPs showed a pronounced pY-positive band which corresponded with Gli (Figure 11). Meanwhile, UASGliFF IPs showed no such phosphorylation (Figure 11). There is no band shift seen, however, seeing as a single phosphate group would only add ~80Da to a 125,000Da protein, it is unlikely the shift would be visible at this scale. Making a determination of whether the phosphorylation takes place at Y760/Y799 is difficult due to the relatively low proportion of Gli that was phosphorylated and the relatively low GliFF expression/yield from IPs. It is conceivable that there was a low level of phosphorylation that was not detected in this lane. Nonetheless, due to the strong evidence that Gli is phosphorylated, and the in vivo evidence supporting a function associated specifically with Y760/Y799, it was deemed worthwhile to pursue candidate pY interactors. Other pY bands were detected, of which one appeared to be dependent of UASGliWT overexpression (Figure 11). In the GliWT lane, this 40  band was less intense in comparison to the UASGliFF lane, whilst other pY bands were comparable. Should this experiment be repeated at a later date, it may be worthwhile to excise this band for MS/MS identification.  41  Figure 11: Gliotactin is endogenously phosphorylated  Standard immunoprecipitations (with mouse anti-Gli antibody) from flies expressing UASGliWT or UASGliFF using DaGal4 were Western blotted for Gli using Rabbit anti-Gli, then for pY using mouse anti-4G10 antibodies. The Odyssey Li-Cor system was used such that detection could be simultaneous. While Gli was detected in all IPs (center/green), a corresponding band was only detected with anti-pY for UASGliWT (right/red). This indicates Gli is phosphorylated endogenously, possibly at Y760/Y799. The UASGliFF control was inconclusive due to the relatively low proportion of Gli that is phosphorylated and the relatively low recovery of UASGliFF. Other pY bands are also seen, of which one (orange arrow) may be related to UASGliWT overexpression. This band is weaker than in the UASGliFF lane, while other bands have relatively equal intensities.  42  3.2.2 Motif Scanner Identification of Potential Interactors Based on Gli Primary Structure Due to the high number of possible pY binding/Y-kinase proteins, the Gli sequence was analyzed using Scansite Motif Scanner(Obenauer et al. 2003) to narrow down the list of likely interactors. Y760 was identified as a possible Nck-SH2 binding site, scoring in the best 0.958% of all sites in the vertebrate reference library (Appendix 1.2). Scoring starts at 0.000% and increases as the sequence diverges from the motif of interest (Obenauer et al. 2003). Y799 had multiple possible hits, including: Src Kinase 0.491%, Itk Kinase 0.528%, Src-SH2 binding 0.463%, Lck-SH2 0.542%, Fgr-SH2 0.578%, and Itk-SH2 0.754%. A score of 0.200% or lower is quite good and falls under “high stringency” identification. All values identified for these two residues fell under “medium stringency” which contains hits below 1%. Nonetheless, based on the above results, Nck and Src are the best candidates for Y760 and Y799 binding respectively.  3.2.3 Src Kinase Phosphorylates Gli Y760/Y799 in vitro Src Kinase was first explored as a binding partner for Gli as part of a set of Pull-Down experiments designed to find association between the Gli intracellular domain and a small library of SH2/PTB-GST constructs (including Nck). Described in Appendix 2.2, these experiments did not show Gli to pull-down any constructs, however, there were several caveats to these experiments. Fortuitously, a false-positive result in which Src-SH2-GST bound non-specifically to the pull-down resin, prompted exploration of Src localization using antibodies directed against mammalian phospho-Src (pSrc). This experiment showed a concentration of pSrc at tricellular corners, and increased the likelihood of a Gli-Src interaction (Figure 12a) (Padash, M., Unpublished Work). Seeing as Src kinase activity does not necessarily require SH2 binding, and the possibility that constructs used in the Pull-Down assay did not suitably mimic phosphorylation that may be required for binding, Src was further pursued using in vitro kinase assays. Drosophila Src isoforms, Src42A and Src 64B, were successfully cloned and sequenced, however, they would not express in bacteria. Following extensive troubleshooting, it was deemed more time-effective to use a pre-fabricated human Src-GST 43  available from Cell Signaling Technologies Inc. in lieu of Drosophila Src constructs. There is a high degree of homology between Src42A, Src64B and human Src, especially in the SH2, SH3 and Kinase domains (illustrated in Appendix 1.3). Src42A has the highest homology to Human Src, and is therefore most likely to reflect pSrc localization data (Takahashi et al. 1996). His-GliCtermWT and His-GliCtermFF (negative control) were expressed, purified, and dialyzed into kinase buffer, then mixed with Src-GST and supplemented with 1mM ATP (For generation of His-GliCterm constructs see Appendix 2.2). Following incubation, pY and Gli were detected using the LI-COR Odyssey combined with Western blot. Gli was seen equally in all negative controls and experimental samples, whilst pY was seen only in (+) SrcGST samples (Figure 12b). pY bands corresponding to autophosphorylated GST-Src were in all experimental samples, whilst a pY band correlating with GliCterm was seen only for 6xHisGliCtermWT (Figure 12b). This result indicates that, in vitro, Src can phosphorylate Gli at one or both of Y760 and Y799.  44  Figure 12: Phosphorylation of the Gliotactin Intracellular Domain by Src Kinase  a) pSrc was detected in larval wing discs and found to concentrate at TCJs (Padash, M., Unpublished Work). Controls using UASSrc42ARNAi show a decrease in intensity at these corners. b) Src Kinase Assay Reveals in vitro Phosphorylation of GliCterm. Human GST-Src was incubated with purified 6xHisGliCtermWT and 6xHisGliCtermFF (Y760F, Y799F) in the presence of phosphatase inhibitors and 1mM ATP. pY was detected using monoclonal clone 4G10 primary antibody (green) for detection with the LICOR Odyssey imaging system. When viewed alongside Gli (red), there was pronounced phosphorylation of Gli only for 6xHisGliCtermWT. No corresponding bands were seen in any of the negative controls (no Src added, GliCtermFF), indicating phosphorylation was as a result of Src and at Y760 and/or Y799. Note, bands at ~75kDa correspond to activated Src. a)  b)  45  3.3 Magi and Vulcan RNAi Phenotypes Several biochemical strategies were employed to identify novel interactors in the course of this thesis, the majority of which employed Pull-Down techniques (ie. GST-Pull Down, His-tag Pull-down, IPs). This type of experiment can be useful both for identification of novel interactors and to confirm targets. Confirmation, however, is dependent upon the availability of antibodies which can specifically detect the protein of interest on a Western blot or pull it out with an IP. Lack of appropriate Drosophila specific antibodies has hindered efforts to look at the candidate Gli interactors Magi and Vulcan. Magi is a possible interactor due to its association with the Gli homolog Neuroligin in vertebrates. Vulcan, on the other hand, interacts genetically with Gli, and mutants have a crooked-leg phenotype reminiscent of gli mutants. For this reason, a genetic approach was used to elucidate a possible interaction between these two candidate proteins and Gli. Specifically, UASRNAi constructs directed against Vulcan and Magi were used to specifically knock-down these proteins. While there is no known function for Vulcan, Magi is known to cluster Neuroligins, a process which is required for their association with Neurexins. Should a similar interaction be required for possible Gli clustering, one might predict mislocalization in response to reduced Magi expression. For this reason, RNAi lines were examined for mislocalization of Gli and lost organization of the SJ and the TCJ. In order to take into account both glial and epithelial Gli localization, UASRNAi constructs were driven with RepoGAL4 (glial driver) or ApterousGAL4 (ApGAL4)(wing disc driver). Flies also expressed UASDicer, which catalyzes the first step in the RNA interference pathway and thus may increase pool of activated RNAis (Figure 7). UASmCD8GFP was further used to mark the area in which the driver was expressed. Mating schemes are outlined in Appendix 2.4. It should be noted that UASRNAi lines purchased from VDRC are not guaranteed to have functional RNAis, and therefore lack of phenotype does not necessarily rule out either gene as a candidate interactor. No phenotype was seen in wing discs for both MagiRNAi and VulcanRNAis (See Appendix 2.4). Similarly, no phenotype was seen for Vulcan RNAi in glia (Appendix 2.4). On the other hand, UASDicer/+ ; UASmCD8GFP/UASMagiRNAi; RepoGAL4/+ nerves had very unusual morphology. The outer perineurial glia appear to have lost adhesion with the 46  underlying layers such that they appeared “loose” or “baggy” (Figure 13) In addition, the underlying glia did not form straight nerves, but rather alternated between narrow and thick regions (Figure 13). This may result from fluid entrance between the glial layers, causing compression of the underlying glia. This phenotype appeared in all animals (n=3) and nerves (n>15) examined. Finally, some nerves had unusually small, rounded nuclei in comparison to controls which had longer, oval shaped nuclei (Figure 13). It should be noted, that the incubator used for growth of these animals malfunctioned such that the temperature was raised higher than 29⁰C. Higher temperatures have been related to increased activity of the GAL4/UAS system (Duffy 2002). Repeats of this experiment done at 29 ⁰C did not show such extreme phenotypes. It could be assumed that the first attempt was an abnormality associated with the temperature increase, however, the control lines which were grown at the same temperature showed no unusual phenotype. It is therefore possible that the phenotype seen at >29⁰C was real, and that this RNAi is otherwise weakly expressed and/or not very efficient at <29⁰C. It would be worthwhile to continue these experiments with further MagiRNAis which could be more effective. Repeating at >29˚C is also an option, however, high temperatures often kill the larvae and could introduce phenotypes which aren’t necessarily related to the RNAi. Comparison to controls indicates this wasn’t the case for this particular set of experiments, but it is advisable to minimize the incorporation of error into future experiments. Any determination of effect on Gli and Dlg could not be determined due to high background staining causing failure to distinguish any patterns in both control and experimental samples. Both Gli and Dlg antibodies have been known to cause this effect, and therefore repetition with altered concentrations and perhaps a NrxIVGFP line in lieu of Dlg staining may be a better choice.  Figure 13: UASMagiRNAi Expressed in Glia Results in “Baggy” Cell Morphology and Rounded Nuclei  UASDicer/+ ; UASmCD8GFP/UASMagiRNAi; RepoGAL4/+ larvae were filleted and compared to control lines (UASmCD8GFP shown here). MagiRNAi lines showed unusually “baggy” or “loose” glia which may have resulted from lost adhesion between glial layers or from swelling (red arrows). Perineurial glia further had unusual small, rounded nuclei which are normally longer and oval shaped (indicated by yellow boxes). A schematic representation of the described phenotype has been included. 47  Figure 13: UASMagiRNAi Expressed in Glia Results in “Baggy “Cell Morphology and Rounded Nuclei  48  3.4 Mass Spectrometry Analysis of Gliotactin Immunoprecipitates Up to this point, the strategies described have been largely tailored towards identification of Gliotactin interactors through a screening strategy. Possible interactors identified based on recognition sites (Src), interaction with Gli homologs (Magi), or genetic interaction (Vulcan) were screened using kinase assays, Pull-Down strategies or RNAi approaches. While these approaches are perfectly valid in terms of interactor identification, they are limited in scope to literature available on Gli and Gli homologues and to the known recognition sites which are included in bioinformatic analysis programs. For this reason, the following section shall address the identification of protein interactors using MS in combination with Pull-Down/IP strategies. This type of technique removes the need to have any prior knowledge of the interactor’s identity, providing the means to identify targets which may not have ever been otherwise considered. In order to determine whether Gli and Dlg form parts of the same complex, Schulte et. al. (2006) used GST-GliCtermWT to pull-down complex components from membrane preparations of Drosophila embryos. Due to success identifying Dlg in this manner, it was hypothesized that modification of this method could be used to identify novel interactors. Specifically, pull-downs of membrane proteins could be run on SDS-PAGE gels, stained, then prominent bands could be excised and sent for MS identification. In addition, GSTGliCtermDD, GST-GliCtermFF, and GST-GliCterm∆PDZ (lacks the PDZ binding domain), constructs could be used to select bands which were either phosphorylation- or PDZdependent. This technique was examined thoroughly and found not to be applicable for identifying novel interactors (see Appendix 2.5 for data related to these experiments). For this reason, IPs were examined as an alternate mode of interactor isolation and identification. IPs of HA-tagged Gli have previously been used to show interaction between the Gli complex and Dlg (Schulte et al. 2006). This method was never used to identify novel targets due to the perceived complexity and high background seen in such samples. More recently, advances in MS techniques have made identification of proteins in complex samples  49  commonplace. The identification of novel interactors in this manner is especially powerful due to the sheer number of possible targets which can be identified per sample run. In order to circumvent the endogenously low Gli protein expression, UASGliWT and UASGliFF were driven by the ubiquitous DaGAL4 driver for preliminary experiments. As described in Figure 7, overexpression of GliWT or GliDD results in vesicle accumulation and Gli spreading throughout the cell membrane, whilst GliFF spreads without vesicle accumulation. This mislocalization could potentially result in misidentification of interactors. However, in demonstrating proof of principle for a new technique, it was decided to begin with a high yielding IP, then work back to a more complicated sample which may require concentration or use of membrane preparations. IPs using standard techniques successfully precipitated Gli, as indicated by Western blot (Figure 14a). Furthermore, when silver stained, IPTs run on SDS-PAGE showed several bands which were specific to UASGli flies (Black arrows 14b). These were compared to IPs from the driver line DaGAL4/DaGAL4, which pulled down little very little Gli simply due to its relatively low abundance when not overexpressed. This control allowed for the identification of bands which were pulled down as a result of protein interaction or degradation of Gli. Any bands associated with background binding to the Gli antibody would be seen in the DaGAL4/DaGAL4 control.  50  Figure 14: Gli Immunoprecipitates from Fly Lysates and Reveals Several Candidate Interactors  a) Standard IPs on extracts from adult flies expressing UASGliWT or UASGliFF under control of DaGAL4 were Western blotted for Gli using a mouse anti-Gli monoclonal antibody. Gli was detected in high abundance in comparison to DaGAL4/DaGAL4 control IPs which have endogenous Gli expression (indicated by red arrows). Antibody was also detected due to use of a goat-anti-mouse secondary antibody (blue arrows). b) IPs from a) were also run on SDS-PAGE then Silver Stained. Gli and antibody bands are readily seen at 150kDa and 50kDa respectively. Furthermore, several faint bands can be seen which are specific for the UAS lines (black arrows). a)  b)  Following successful IP from UASGli flies, it was necessary to adapt the standard IP protocol for use with MS. In solution digestion was used in order to identify the largest array of candidate interactors, while also confirming identification of Gli. The alternative would be to run IPs on a gel, then perform in-gel digestion on gel slices. In-gel is powerful, but can only identify proteins within the molecular weight range of the gel slice. This prevents simultaneous identification of both Gli and other protein candidates unless the slice is taken at ~150kDa. With in-solution, a broad range of proteins can be identified, including Gli, making it most useful for preliminary experiments. 51  The only drawback to in-solution digestion of a standard IP sample is the high antibody concentration. Should these samples be analyzed, the vast majority of spectrometer time will be spent sequencing antibody peptides. For this reason, cross-linking the antibody to IP resin was essential for these experiments. To this end, the antibody in use required precleaning to remove a high concentration of serum proteins which could also cross-link to the resin. Serum proteins were successfully removed using the Melongel system (Pierce), and the cleaned antibody was both cross-linked and shown to successfully pulldown Gli (Figure 15).  Figure 15: Mouse anti-Gli antibodies were Cleaned and Crosslinked to IP Gli from Fly Lysates  a) Mouse anti-Gli IF6.3 antibodies were purified using the Melongel antibody purification system. The majority of contaminating serum proteins were successfully removed. b) Cross-linked resin was used to IP Gli from w1118 adult fly lysates. Proteins were eluted with weak acid, neutralized, then concentrated by ethanol precipitation. A high concentration of Gli was detected by Western blot in both the 1st and 2nd eluates with no degradation products.  a)  b)  52  Reduced, alkylated and digested samples were sent for LC-MS/MS analysis at the UBC Proteomics Core Facility using the LTQ-Orbitrap system. An IP done with IgG-conjugated resin was used as a control. The UASGliWT sample yielded 35% coverage of the Gli sequence (ie. 35% of the total Gli protein sequence was represented by peptides identified), and identified Gli with an individual ion score of 2981 (proteins identified are listed in Appendix 2.6). The Mascot proteomics server calculates a “threshold score” for all experiments which is used to determine how significant a score is using a significance level of 5%. For these experiments the threshold score was 22, which indicates that any match with a score of >22 has less than 1/20 chance of being a random event (Pappin et al. 1993). Only scores of 50 or higher were considered for these experiments to both increase confidence and decrease processing time (limited access to the Mascot server necessitated manual matching of assession numbers provided with the protein’s identity and description using Uniprot (Bairoch et al., 2005)). Thus given that a score of 50 is highly likely to provide a correct identification, Gli’s score of 2981 indicates that IPs in conjunction with in-solution digestion were highly successful. Following the UASGliWT run, this experiment was repeated with UASGliFF/+;+/+; DaGAL/+ flies. UASGliWT flies have vesicle accumulation related to Gli overexpression, and may therefore have a high number of identifications related to Gli recycling. In contrast, UASGliFF spreads around the cell membrane without a high degree of vesicle formation. For this reason, it is possible that this strategy would isolate more cell membrane-associated interactors (eg. SJ components). Gli was successfully IP’d from UASGliFF/+; +/+; DaGAL4/+ flies with an individual ion score of 3499. Proteins identified are listed in Appendix 2.6. While UASGliWT and UASGliFF IPs yielded many identifications of interest (discussed below), to ensure meaningful results, IPs had to be done with Gli at endogenous levels and properly localized. As described earlier, Gli has very low endogenous levels in the adult fly. Therefore, in order to maximize recovery, embryos were used. These have been shown to have relatively higher Gli expression than in an adult fly, are easier to homogenize, and have fewer non-Gli expressing tissues which could add background (Schulte, Tepass et al., 2003). The results of this run are summarized in Appendix 2.6. Gli was identified as one of the highest scoring proteins at 268. It should be 53  noted that the overall range of scores was significantly lower than in previous runs (Appendix 2.6), however, this is to be expected from samples in which Gli was not as plentiful to pulldown interactors. It should be noted that relatively lower scores does not indicate poor data, as the threshold score was still 22 for this experiment. Proteins identified in all three MS runs fell largely into biosynthetic, metabolic and transport categories as illustrated in Figure 16a. A general comparison shows a similar distribution of identifications between UASGliWT and UASGliFF runs. These were largely metabolic and transport related proteins. This significantly differed with the w1118 MS/MS which shifted towards a larger proportion of biosynthetic and proteolysis-related proteins. Overlap between identifications is diagrammed in Figure 16b. It can be seen that UASGliFF and UASGliWT runs had 32/57 UASGliFF identifications overlapping with 32/61 UASGliWT identifications. UASGliWT also showed a great deal of similarity with w1118 showing 32/61 and 32/120 overlapping identifications respectively. In contrast, there was very little overlap between w1118 and UASGliFF identifications, which had only 15 identical proteins, 10 of which were shared with the UASGliWT run. There were few proteins identified which could be connected with Gli or SJ function. Of these, two targets were pursued: 14-3-3 and Na+/K+ ATPase. Other targets of interest, including protein phosphatase 2A, Twinstar and Abnormal Wing Discs were not pursued but will be considered in the Discussion section. It should be stated that this data is preliminary, and should be subject to scrutiny (and future re-examination). Further troubleshooting is necessary to remove background and increase recovery from wt samples. Runs must also be repeated several times to ensure that the identifactions pursued are reproducible. The data thus far accumulated nonetheless indicates that this technique should be pursued, and the success identifying Gli from IPs suggests it is promising for the indentification of protein interactors.  54  Figure 16: Distribution of Protein Types Identified during LC-MS/MS of Gli IPs  a) Proteins listed in Appendix 2.6 were categorized based on suggested function (Flybase, 2008) and tabulated (bottom right). Pie charts represent to proportion of protein types identified per run. UASGliWT-DaGAL4 and UASGliFF-DaGAL4 showed similar distributions, with the majority of proteins identified falling into metabolic and transport categories. W1118 IPs yielded largely biosynthetic proteins, and a larger array of proteolytic and trafficking proteins. b) Venn diagrams were generated to illustrate similarities between MS runs on w1118 embryos, and UASGliWT-DaGAL4, and UASGliFF-DaGAL4 flies. There was significant overlap between UASGliWT and w1118 runs and UASGliFF and UASGliWT runs, while there was little between w1118 and UASGliFF runs. The majority of proteins identified in all three runs were eliminated by the IgG control.  a)  b)  55  3.4.1 14-3-3 The signaling proteins 14-3-3ε and 14-3-3ζ were identified from both UASGliWT (enriched for GliWT) and w1118 IPs. The UASGliWT scores were quite high at 204 and 161 respectively, whilst w1118 scores were 133 and 118. It isn’t possible to directly compare scores due to both the difference in quantity and type of input sample (flies vs. embryos). 14-3-3 proteins are ubiquitous signaling molecules which have been associated with cell cycle regulation, cell growth, differentiation, survival, apoptosis, migration and many other activities in mammals (Aitken 2006). In Drosophila, 14-3-3ε and 14-3-3ζ have well established roles in RAS/MAPK signaling and neuronal differentiation (Chang and Rubin 1997; Kockel et al. 1997; Li et al. 1997). Both isoforms have been further associated with distinct roles in cell cycle regulation (Su et al. 2001). Recent studies have identified C-terminal 14-3-3 recognition sites (eg. pS/pT(X1–2)-COOH), which are homologous to the Gli PDZ binding domain (Appendix 1.1), opening the possibility of interaction with Gli (Ganguly et al. 2005). Following MS and in silico inference of association, 14-3-3ε localization was examined for proximity to Gli at the TCJ. To this effect, wing discs were dissected from 3rd instar larvae with endogenously tagged 14-3-3ε-GFP, then stained for Gli and Dlg (mark the TCJ and SJs respectively). Due to the ubiquity of this protein, the GFP signal was strong throughout the cell. For this reason, the contrast has been adjusted to enhance concentrations which were seen in the peripodial cell nuclei, and of particular interest, at the level of SJs in columnar epithelia (Figure 17). As indicated in Figure 17a, peripodial cells had large, round concentrations which were presumably nuclei. This result agrees with literature describing Drosophila 14-3-3ε localization (Tien et al. 1999). Further concentrations seen at the SJ (outlined with yellow in 17b) have not been previously described. It should be noted that these concentrations are weak and very difficult to see above the surrounding cytoplasmic staining without Photoshop enhancement. For this reason, a particular area in which the 143-3ε lined SJs are seen has been highlighted (Figure 17b). Co-localization was seen with Dlg in the view described (Figure 17) and within the apical-basal plane (Data not shown). No concentration could be seen at the TCJ specifically, however, this does not necessarily rule out 14-3-3ε as an interactor, as transient interaction may not be reflected by concentrations at the cell corner, and the staining is quite diffuse and difficult to interpret. 56  Immunprecipitating 14-3-3 followed by detection of Gli may provide more evidence to support a possible interaction, as could pull-downs using Gli-Cterm constructs with and without the putative 14-3-3 binding site (the PDZ domain). In addition to general SJ staining, there were several points of high 14-3-3ε concentration seen in all samples examined. These were at the level of SJs, at the cell membrane, in groups of two or three, where they filled what appeared to be cleavage furrows (Figure 18). These sites also appeared to exclude Dlg staining (Figure 18). Single spots were further seen between smaller cells which could have recently undergone abscission (Figure 18). Results therefore indicate the following: 14-3-3ε is a previously undescribed SJ component and could therefore be associated with Gli; 14-3-3ε appears to localize at the cleavage furrow, indicating an unknown role in cell division.  57  Figure 17: 14-3-3ε-GFP Localization in Peripodial and Columnar Epithelia  14-3-3ε was expressed at endogenous levels with a GFP tag (grn) to track localization. Wing discs were dissected from 3rd instar larvae then stained for Dlg (red). In peripodial cells (top) 14-3-3ε-GFP was highly concentrated in cell nuclei (yellow arrows). Alternatively, in columnar epithelia (bottom), 14-3-3ε-GFP was diffusely spread throughout the cytoplasm, however, the yellow bracketed regions contain the faint outline of several cells which correlate with Dlg staining. Other outlines are seen, but obscured by surrounding GFP signal.  58  Figure 18: 14-3-3ε-GFP Concentrations appear at Presumed Sites of Cytokinesis  A portion of figure 15 was used to demonstrate that concentrations of 14-3-3ε are always seen at the cell membrane (yellow arrows) and often at sites of presumed cytokinesis (orange arrows). All concentrations are seen in a similar location, between Gli-marked TCJs. Concentrations containing multiple points were always seen between enlarged cells (orange arrows) and were further seen to exclude Dlg (pink arrows).  59  3.4.2 Na+/K+ ATPase The SJ component Na+/K+ ATPase subunit α was identified in both the UASGliWT and UASGliFF samples. This component has previously been shown to IP with Gli only when Gli was overexpressed (Schulte 2002). However, seeing as there have been no clear image of its localization and previous IPs were done under differing conditions (required membrane preparations), the Na+/K+ ATPase was re-examined. To this end, 3rd instar larval imaginal discs expressing endogenous levels of GFP-tagged Nrv2 (Na+/K+ ATPase β-subunit Nervana2) were stained for Gli and Dlg to mark the TCJ and SJs respectively. In columnar epithelia, it was difficult to assess colocalization due to the tendency of most membrane proteins to appear concentrated at cell corners in this cell type (Auld, V., Personal Communication). In the peripodial cells, Gli forms a ribbon-like structure which allows for more accurate determination of co-localization. In peripodial cells, co-localized proteins will be arranged in an overlapping ribbon pattern vs. the small dot seen in columnar epithelia. It is less likely that a non-associated protein would mimic this distinctive Gli pattern. As indicated by yellow arrows, there were several areas of colocalization between Nrv2, Gli and Dlg which spanned the entire Gli “ribbon” (Figure 19). There was a degree of background staining related to Gli-containing vesicles, and therefore only highly concentrated areas were examined. In addition, there was extensive overlap between Nrv2 and Dlg in areas beyond the TCJ (examples highlighted in orange Figure 19). Since Nrv2 is an SJ component this is not entirely surprising, however, a direct association between Dlg and Nrv2 has not been previously described. This level of colocalization may indicate that these two proteins are physically associated, and perhaps, are together associated with Gli.  60  Figure 19: Nrv2, Dlg and Gli Show Regions of Colocalization in Columnar and Peripodial Epithelia  Nrv2-GFP wing discs were dissected from 3rd instar larvae and stained for Dlg and Gli. Regions of colocalization between Gli, Dlg, and Nrv2 are indicated by yellow arrows, while areas showing further colocalization between Dlg and Nrv2 are indicated by orange boxes. The Gli ribbon pattern is somewhat difficult to see in the peripodal cells, however, referring to the concentrations of white (indicates Gli, Dlg and Nrv2) on the merged image, there appears to be a high degree of colocalization.  61  4. Discussion 4.1 Candidates for Gli Interaction and/or Regulation In the course of this work a number of possible candidates were identified using a combination of in silico, in vivo and in vitro techniques. The following section shall address several of these targets, with reference to possible association with Gli or SJs.  4.1.1 Src Kinase Src was identified as being a high likelihood bonifide target following in vitro kinase assay verification that it could phosphorylate the Gli intracellular domain at Y760 and/or Y799. This phosphorylation event is supported by preliminary data showing concentrations of activated Src at the TCJ (Figure 17). Both experiments utilized human Src (antibody or GST-Src fusion), suggesting Src42A (the closest homolog) may be the Drosophila isoform of interest. Furthermore, in silico sequence analysis suggests phosphorylation occurs at GliY799. Genetic experiments designed to show interaction in vivo have been largely unsuccessful due to embryonic lethality associated with putting Gli-null in trans to Src mutant alleles (Padash, M., Unpublished Work). Ongoing experiments using temperature sensitive alleles will hopefully overcome this problem and present phenotypes suggesting how Src may regulate Gli function. Src Kinase, Arf6, and Abnormal Wing Discs (Awd): Possible Mediators of Endocytosis and Junction Disassembly Src may regulate Gli endocytosis via phosphorylation of Y799. Src-mediated recycling/degradation via endocytic pathways are not unprecedented. In mammalian epithelial cells, Src mediated phosphorylation of E-Cadherin and β-Catenin precedes Arf-6induced membrane internalization during AJ disassembly (Palacios et al. 2001). This results in AJ disassembly and cell migration (Palacios et al. 2002). These processes are dependent on Arf-6 recruitment of Nm23-H1, a nucleoside diphosphate kinase homologous to Drosophila Awd (Biggs et al. 1990; Palacios et al. 2002). This mechanism is part of an emerging theme in which cell-cell junctions are dismantled via endocytosis and vesicle transport. In addition to adherens junctions, both TJs and gap junctions are dismantled by endocytosis (Segretain et al., 2004, Ivanov et al., 2005, Yu et al., 2008). 62  Endocytosis can also be mediated via pY recognition by the Cbl-like E3 Ubiquitin ligase Hakai (Fujita et al. 2002). Following activation of Src, Hakai ubiquitinates and promotes internalization of E-Cadherin (Fujita et al. 2002). Ubiquitination of E-Cadherin was previously shown to facilitate sorting to lysosomes, presenting Src as a mediator of both recycling and degradation of junctional proteins (Palacios et al. 2005). There are several parallels to be drawn between the described AJ disassembly pathway and existing Gli data. When GliWT or GliDD are overexpressed, vesicles accumulate which are not seen when GliFF is overexpressed (Padash, M., Unpublished Work). Co-Staining for markers suggests these vesicles are endosomes and lysosomes (and not other trafficking vesicles), indicating a phosphorylation-dependent endocytosis mechanism. In addition, Arf6 (Arf51F in Drosophila (Onel et al. 2004)) is the only protein shown to interact with Gli using a Yeast-2-Hybrid method (MacKinnon 2005). Should AJ components and Gli share a common, conserved recycling/degradation mechanism, an increase in Gli recycling might also increase AJ disassembly and result in cell migration. This hypothesis is supported by the appearance of AJ components in Gli-containing vesicles and the migration phenotype which is seen in larval wing discs overexpressing GliWT or GliDD (Padash, M., Unpublished Work). Coendocytosis of SJ components such as Dlg has not been seen, suggesting Gli endocytosis may not be related to SJ component recycling (Padash, M., Unpublished Work). Finally, possible components of the described recycling pathway, including Awd, Clathrin and several ubiquitin receptors/ligases, were identified only during LC-MS/MS analysis of UASWT and WT IPs.  4.1.2 Na+/K+ ATPase The Na+/K+ ATPase α subunit was identified as a Gli-complex member via LC-MS/MS analysis of UASGliWT IPs. The Na+/K+ ATPase has previously been shown to be localized to and required for SJ formation (Genova and Fehon 2003). Nrv2-GFP data confirms these results, while further showing a high degree of Gli/Dlg/Nrv2 colocalization in peripodial cells. IPs have previously shown interaction between Gli and Na+/K+ ATPase when Gli is overexpressed (Schulte 2002). Nrv2 mutants further show nearly identical tracheal morphology defects to Gli and SJ component mutants (Genova and Fehon 2003). Of particular interest, Nrv2-null phenotypes are unaffected by combination with gliotactin or 63  coracle mutants, indicating these work in a linear pathway or as part of a complex (convoluted and varicose SJ mutants worsen the Nrv2-null phenotype) (Genova and Fehon 2003). Gli and Cor are also involved in an interdependent pathway governing parallel winghair alignment in which the Na+/K+ ATPase is a possible link to the F-actin/spectrin cytoskeleton (Venema et al. 2004). In summary, there is evidence of Na+/K+ ATPase association with both Gli and Cor in at least two areas. All of these proteins are known to function both in barrier activity and in tracheal morphology, two processes which are not interdependent (Genova and Fehon 2003). This suggests these components could form multiple protein complexes or all be parts of at least two linear signaling cascades. Nrv2 co-IPs Cor, indicating they do form a complex, however, authors did not have access to a Gli antibody (Genova and Fehon 2003). It thus remains a possibility that Gli, the Na+/K+ ATPase and Cor form a protein complex. Na+/K+ATPase has been shown to sequester inactive Src at the membrane via concurrent binding to the kinase and SH2 domains (Li and Xie 2008). Association between the Na+/K+ ATPase extracellular domain and the cardiotonic steroid Ouabain causes a conformational change which releases only the kinase domain, permitting downstream signaling from a sequestered Src (Li and Xie 2008). Ouabain is one of several cardiotonic steroids which bind to Na+/K+ATPase causing inhibition of pump activity (Li and Xie 2008). Cardiotonic steroids have been associated with cell growth, a process which requires modulation of barrier forming contacts, such as those presumably formed by Gli (Li and Xie 2008). Ouabain activation of the Na+/K+ATPase has been shown to loosen cell-cell contacts in MDCK cells which would support this hypothesis (Contreras et al. 1999). Activation by cardiotonic steroids or through interaction with an alternate ligand could therefore be a means by which Gli recycling is regulated in response to cell growth and/or to Gli accumulation. One could picture a situation in which Na+/K+ATPase-associated Src would associate with Y799 of Gli to phosphorylate Gli and trigger Clathrin-dependent endocytosis via the Arf6 pathway. A similar process has been suggested for epidermal growth factor receptor (EGFR) internalization. Ouabain transactivates EGFR which triggers endocytosis via a mechanism presumably mediated by Na+/K+ ATPase-associated Src (Liu et al., 2004). The 64  alpha subunit of Na+/K+ ATPase directly binds both AP-2 and Clathrin to facilitate said endocytosis (Liu et al., 2004). The Gli-Na+/K+ ATPase complex described may also comprise Cor, which is thought to act in a linear pathway with these components in regulating tracheal tube size, and is also know to act with Gli (and possibly Na+/K+ ATPase) in orienting wing hairs. It is unknown how precisely Cor interacts with the C-terminus its only known binding partner, NrxIV, and therefore predicting a binding site within Gli or the Na+/K+ ATPase isn’t possible (Ward et al., 1998). Cor’s mammalian homolog, band 4.1 recognizes a lysine-rich motif between the SH3 and GK domains of p55 (a mammalian homolog of Dlg). This sequence is conserved in Drosophila Dlg, however, Coracle has never been shown to IPT with Dlg. It is likely that another MAGUK containing this sequence stabilizes the interaction between NrxIV and Cor, and could also be a bridge between Gli and Cor utilizing Gli’s PDZ-recognition motif. For wing hair orientation this complex is likely associated with the cytoskeleton via interaction between Na+/K+ ATPase and the spectrin cytoskeleton. A schematic representation of the described interactions is shown in Figure 20. While the described network is feasible in terms of protein interactions, whether it is necessarily related to Src-mediated endocytosis is difficult to say. The proposed endocytosis mechanism is likely necessary to prevent Gli accumulation once it has been established at the TCJ. There Gli has been implicated in cell division (Charish, unpublished work) and cell-cell adhesion (Schulte et al., 2003) which may be sensitive to Gli accumulation. Overproliferation is seen when Gli is overexpressed in wing discs which would support the need for controlled Gli removal from the membrane (Padash, M., unpublished work). As for tube size and wing hair orientation, however, it is possible these processes require distinct functions of the same protein complex. When the tracheal tubes are being established, Gli is not yet at cell corners, but is rather in the process of gathering SJ components which will later form the mature SJ (Schulte et al., 2003). In gli and nrv2 mutants, the SJs do not form properly, with septae that are fewer and more spread out (Genova and Fehon, 2003, Schulte, 2003). Cor has a more severe phenotype in which no septae form that is likely related to its association with additional SJ components (eg. NeurexinIV)(Lamb et al., 1998). During development of 65  the tracheal tube, this loss of SJ structure and component mislocalization may interfere with cell-cell contact mediated signals which dictate cell size or the amount that cells proliferate, thus resulting in an increase in tracheal tube length. This is but one hypothesis and much work needs to be done relating SJ components to the tracheal tube.  66  Figure 20: Proposed Interactions between Gli, the Na+/K+ ATPase, Src and Cor  The first and second intracellular loops of ATPα interact with the SH2 and Kinase domains of Src respectively. When activated by ouabain (or an alternate unknown antagonist), the kinase domain alone is released to phosphorylate targets such as Gli. Activated Na+/K+ ATPase can further recruit endocytic machinery such as AP-2 and Clathrin (not shown). This complex could associate with a multi-PDZ containing protein via Gli’s PDZ recognition motif. This protein may also bind Coracle via a multi-lysine motif located between an SH3 and GK domain. The complex formed could provide explanation for these three proteins being implicated in a linear pathway required for tracheal tube size control.  67  4.1.3 14-3-3ε and 14-3-3ζ The 14-3-3 family of adaptor proteins is highly conserved in eukaryotes. 14-3-3 dimers normally bind phosphoserine residues within a RSXpSXP or RXXXpSXP motif (Aitken 2006). There are also at least six proteins known to interact with a pS/pTX1-2COOH carboxy terminal motif which reflects the Gli C-terminus (Appendix 1.1) (Aitken 2006). Drosophila has two 14-3-3 isoforms, 14-3-3ε and 14-3-3ζ (Leonardo), both of which were identified in the UASGliWT and WT IPs. 14-3-3ε-GFP was distributed throughout the cytoplasm of columnar epithelia, whilst being concentrated in the nuclei of peripodial cells. Intriguingly, 14-3-3ε-GFP was also seen to concentrate at SJs. Prior reports in which cytoplasmic localization was described could likely have missed these concentrations without having examined samples at a high enough magnification (Benton et al. 2002). Similarly, they would not have seen the spot concentrations between dividing cells. It should be noted that 14-3-3ε was also detected in the LC-MS/MS IgG control, however, while the score was comparable to w1118 samples (110 and 133 respectively), the IgG control was done using twice the amount of embryo lysate, and should therefore had a higher score. While direct comparison of scores in this manner is not generally accepted due to variability in identifications between runs, without quantitative controls 14-3-3ε was deemed worthwhile to pursue further. 14-3-3 isoforms have diverse regulatory activities related to the cell cycle, cellular trafficking/targeting, signal transduction, cytoskeletal structure and transcription (Aitken 2006). It is therefore difficult to hypothesize how it may affect Gli or SJs. UASGli ∆PDZ (lack the PDZ-recognition motif) expression in wing discs shows comparable phenotypes to UASGliWT and UASGliDD lines, indicating the effects are not related to endocytosis (Padash, M., Unpublished Work). 14-3-3 has a defined role in maintaining epithelial cell polarity through association with AJ components (Benton et al. 2002; Benton and St Johnston 2003). While neither Gli nor SJs have been shown to have any effect on cell polarity, it is possible that 14-3-3s may associate with Gli early in SJ development, where they first aid in compaction of SJ strands, then associate with the mature SJ to maintain its position. 14-3-3 mutants have severe polarization defects beyond their association with AJs (Benton and St Johnston 2003) which could result from loss of SJ positioning. This hypothesis is supported by the basal spreading of UASGli∆PDZ constructs (Schulte et al. 2006). 68  14-3-3 localization to presumed sites of abscission is not without precedent. A recent report has shown PKCε binding to 14-3-3β is required for completion of cytokinesis (Saurin et al. 2008). This has not been demonstrated in Drosophila or epithelial tissues, indicating that the 14-3-3ε-GFP localization data may point towards a conserved regulatory pathway. Furthermore, the 14-3-3ε-GFP puncta closely resemble Anillin (actin/myosin binding protein found in contractile ring) and RacGAP (spindle-associated) staining of larval brain cells undergoing cytokinesis (Figure 21)(Gregory et al. 2008). RacGAP specificies the site of cleavage and could therefore be involved in targeting the 14-3-3/PKC complex to the contractile ring. The significance of no Dlg staining at this site is unknown, however, it may indicate regions at which membrane fusion has not been completed and therefore the SJ does not completely encircle the cell.  69  Figure 21: 14-3-3ε-GFP at the Cleavage Furrow reflects Anillin and RacGAP staining of dividing Larval Brain Cells  Anillin and RacGAP stainings of dividing larval brain cells appear as puncta localized to the cleavage furrow during telophase (Gregory et al. 2008). This staining resembles 14-3-3εGFP staining seen in Drosophila epithelia (bottom right), perhaps suggesting an association between Anillin, RacGAP and 14-3-3-mediated cytokinesis. All three proteins show 2-3 spot concentrations immediately between two dividing cells. An outline of the dividing cell has been added to Gregory et al.’s images to better illustrate the similarity with 14-3-3εGFP data.  Gregory et al. 2008  Gregory et al. 2008 14-3-3ε-GFP  Gregory et al. 2008  70  4.1.4 Nck/DOCK The only candidate for Y760 binding based on in silico primary structure analysis was the SH2/SH3 adaptor protein Nck. This protein was identified by the Scansite Motif Scanner with a score of 0.95%; a relatively high score falling within medium stringency parameters. Nck recognizes a pY-aspartic acid–glutamic acid–proline (pYDEP) sequence, which approximates Gli Y760 with exception to the proline residue (Songyang et al. 1993). This is replaced by an aspartic acid in the majority of arthropods, and may not be absolutely necessary for binding (Nishimura et al. 1993). GST pull-downs using the mammalian Nck SH2 domain did not pull-down the Gli intracellular domain, casting some doubt as to whether this is a true interactor. However, these pull downs had several disadvantages: GST-SH2 constructs lacked other Nck domains which may be required for binding; they used the mammalian isoform which may not bind as efficiently; any interaction may have been transient and therefore difficult to isolate in the absence of chemical cross-linking. The Drosophila homolog of Nck is Dreadlocks (DOCK) (Garrity et al. 1996). There is no information specifically relating to DOCK recognition sites, and available alleles have only shown neural phenotypes with no indication of epithelial function (Flybase 2008). Axon guidance problems may indicate glial function.  4.1.5 SHP/Corkscrew Manual primary structure analysis revealed that Y799 is included in a potential SHP1 phosphatase recognition site centered around phosphorylation of Y801 (Appendix 1.1). SHP1 recognizes a consensus sequence of (D/E)X(L/I/V)X1-2pYXX(L/I/V) which is completely conserved in Gli, with exception to the last amino acid (Appendix 1.1)(O'Reilly and Neel 1998). Drosophila Corkscrew shows sequence similarity to both SHP1 and SHP2, but is often considered homologous only to SHP2 due to further similarities in expression pattern (Freeman et al. 1992). There is no information at this time relating to the Corkscrew binding site, however, alleles have been generated which indicate roles in photoreceptor development, embryonic CNS and tracheal development , cell fate determination, and wing development (Simon et al. 1991; Perkins et al. 1996)  71  4.1.6 Protein Phosphatase 2A (PP2A) The PP2A family comprises serine/threonine phosphatases which minimally share a  common catalytic domain (Janssens and Goris 2001). Their activity is highly controlled, with substrate specificities determined by association with a variety of regulatory subunits including (in Drosophila) Twins and Widerborst (Janssens and Goris 2001). The 65kDa regulatory subunit (PP2A at 29B/PR65) was identified in both WT and UASGliWT LC-MS/MS runs. PR65 is a scaffolding molecule which is used to assemble the catalytic PP2A subunit with a variety of regulatory subunits (Janssens and Goris 2001). For this reason any of the known regulatory elements could be involved in Gli activity. In addition, PP2A is known to have low level tyrosine phosphatase (PTP) activity through its association with the PTP activator protein (Janssens and Goris 2001). For this reason, the potential phosphatase target sites are numerous. Both widerborst and twins mutants show parallel wing hair alignment defects reminiscent of gliDV mutants (Figure 22) (Shiomi et al. 1994; Hannus et al. 2002). These further show multiple wing hair phenotypes (2-3 hairs emerge from the same socket or cell) (Shiomi et al. 1994; Hannus et al. 2002) seen in UASGliWT and Gli-null clones (Padash, M., Unpublished Work; Charish, Unpublished Work). Proximal Widerborst activation is thought to mediate polarized dephosphorylation of microtubule assembly proteins, thereby biasing microtubule-based vesicle transport of hair formation machinery (Hannus et al. 2002). In contrast, twins has only been examined for the multiple hair phenotype, which is thought to arise as a result of defects in neural cell fate (Shiomi et al. 1994). Non-innervated bristles were also duplicated which somewhat contradicts this hypothesis (Shiomi et al. 1994). Gli and Twins could work within identical signaling pathways governing both wing hair number and planar cell polarity.  72  Figure 22: Gliotactin, Twins and Widerborst Mutants Display Planar Cell Polarity Defects  In comparison to wt wings (top panel), GliDV5/GliDV5 and GliDV3/GliDV5 mutants have crossed wing hairs indicative of planar cell polarity defects (left, bottom panel). Overexpression of the PP2A regulatory subunit Widerborst (Wdb) using ApGAL4 results in some minor wing crossing, however, is difficult to assess due to duplication of wing hairs (center, bottom panel). Overexpression of a dominant negative (WdbDN) with the wing driver PatchedGAL4, displays obvious parallel alignment defects (center, bottom panel). Similarly, homozygotes of the hypomorphic allele tws55 showed alignment defects in addition to duplication of hairs (right, bottom panel). Duplication of thicker mechanosensory hairs (top right, bottom panel) has been the suggested outcome of defects in neural cell fate. There was, however, duplication of non-innervated hairs (wing edge of bottom right) indicating this phenotype could be related to an alternate mechanism.  73  It should be noted that PP2A and PP1 have both been shown to interact with Occludin and aPKC to negatively regulate the assembly of TJs (Seth et al. 2007). There is therefore precedent for PP2A involvement in junction assembly. Due to the highly speculative nature of PP2A association with Gli function, however, this target would still best be first examined as part of a genetic screen.  4.1.7 Twinstar (Tsr) Twinstar is the Drosophila homolog of mammalian Cofilin, an actin binding protein which twists filamentous actin stands such that they depolymerize at a faster rate (Blair et al. 2006). Tsr was identified during LC-MS/MS analysis of w1118 Gli IPs. Tsr is necessary for Frizzled and Flamingo localization, two proteins required for planar cell polarity (Blair et al. 2006). This data suggested the actin cytoskeleton may translate extracellular cues into PCP by mediating protein localization (Blair et al. 2006). Blair et al. used temperature sensitive Tsr alleles and overexpression of a Cofilin Inhibitor, Lim Kinase (Limk) ,to generate PCP defects (Blair et al. 2006). This strategy produced two phenotypes. The first closely resembled Frizzled pathway mutants, whose wing hairs are parallel, but form a swirling pattern (Figure 23) (Blair et al. 2006). The second showed parallel alignment defects reminiscent of double mutants for GliDV5 and the Frizzled pathway component prickle (pk) (Figure 23). In these wings, both the frizzled swirl phenotype, and the gli crossed hairs phenotypes were seen superimposed on top of each other (Venema et al. 2004; Blair et al. 2006). While the authors addressed Tsr as an upstream regulator of the frizzled alignment pathway, they did not address the cause of the second phenotype (Blair et al. 2006). It is possible that Tsr may be the upstream component linking both wing hair alignment pathways to the cytoskeleton.  74  Figure 23: Twinstar Mutations Reflect Defects in both the Frizzled and Gli Wing Hair Alignment Pathways Twinstar thermolabile mutants (tsr139, tsrV27Q) were generated to rescue the lethality of tsr∆97-null alleles (Blair, 2006). Similarly, an hsp70 inducible inducible form of the tsr gene (P[WHTG]) was also used to rescue this lethality (Blair et al. 2006). Transheterozygotes showed both a frizzled-like phenotype (refer to pk1 mutant) with swirling patterns (top left), while some wings also showed parallel alignment defects (bottom left) and (Venema et al. 2004; Blair et al. 2006). Similarly, overexpression of the Tsr inhibitor Limk resulted in both swirling patterns (center top), and crossed hairs (center bottom) (Blair et al. 2006). The parallel alignment defects in combination with the swirling phenotype are reminiscent of GliDV5, pk1/GliDV5, pk1 mutants (Venema et al. 2004).  75  4.2 Possible Association with Lipid Rafts or Lysosomes? LC-MS/MS analysis of IPs identified a large number of metabolic and transport proteins which were at first disregarded as false positives. Many of these proteins (eg. Electron transport chain components (ETC)) are largely thought to be mitochondrial, and therefore not associated with Gli. Upon review of proteomic literature, however, it was found that a large number of these proteins were also found during proteomic analysis of lipid raft proteins and lysosomal integral membrane proteins (Bae et al. 2004; Bagshaw et al. 2005). ETC components including the ATP synthase subunits and cytochrome proteins were identified in both papers, as were GST, glyceraldehydes-3-phosphate dehydrogenase, and NADH dehydrogenase among other proteins (Bae et al. 2004; Bagshaw et al. 2005). Lipid rafts are defined by their insolubility in the detergents TritonX100 and TrixonX114 as a result of cholesterol and sphingolipid enrichment (Rietveld et al., 1999). These rafts are insoluble even in 2% TritonX100, conditions considerably harsher than those used in Gli LC-MS/MS experiments which used 1% NP-40 (Rietveld et al., 1999). The identification of these components may reflect Gli association with insolubilized lipid rafts. Such an association can readily be tested by isolating detergent-resistant membranes using sucrose fractionation, followed by Western blotting for Gli (Rietveld et al., 1999). The association between Gli and lysosomes has already been shown by co-staining for LAMP1 (Padash, M., unpublished work).  4.3 UASMagiRNAi Phenotypes Suggest Possible Role in Glial Cell Adhesion Knock-down of Magi in glial cells using UASRNAi constructs resulted in unusually “loose” outer glia. This result could only be shown when flies were incubated at temperatures >29⁰C, indicating this may be a particularly weak RNAi. Phenotypes were not seen in negative controls grown at the same temperature suggesting the change in morphology was not a direct result of the temperature increase. The exact cause of the “looseness” is difficult to guess. Adhesion may have been lost between glial layers, causing the perineurial glia to separate from the underlying wrapping glia. Alternatively, loss of adhesion between perineurial glial cells could result in barrier defects permitting influx of fluid from the surrounding hemolymph. While it is tempting to assume that mutations perturbing the outer glial seal would be lethal, there is no evidence at this time that this seal  76  is required following axon ensheathment by the wrapping glia. It thus follows that if Magi is required simply to maintain outer glial adhesion, the larvae may nonetheless survive. In vertebrates, Magi clusters Neuroligins, which form trans-synaptic associations with Neurexins (Hirao et al. 1998; Iida et al. 2004). The phenotype seen reflects disruption of this very type of interaction, and it would therefore be of interest to look for Neuroligin and Neurexin localization in conjunction with UASMagiRNAi. Any interaction with Gli could not be shown due to high background associated with Gli antibodies. This should be reexamined at a later date to improve upon background staining and perhaps in conjunction with Gli alleles.  4.4 Future Work 4.4.1 Strategies to Identify Novel Gli Interactors: Abandon or Carry Forward? A number of approaches have been used to attempt identification of protein-protein interactions with Gli. Prior to this work, GST-Pull Downs and IPs had been used to successfully confirm potential interactions through combination with Western blotting. This technique is limited by guesswork and the availability of antibodies to target proteins. For this reason, the modifications described in this thesis were employed to improve capture of interacting proteins. Pull-Down strategies designed to isolate interaction with SH2-domains or novel proteins from membrane preparations were unsuccessful (Appendix 2.2). For SH2 domains this could be due to transient interaction or inter-species sequence variability. Mimicked phosphorylation using YD mutation may also have been insufficient for SH2recognition. Pull-downs with membrane preparations were likely hampered by the low probability that Gli would associate with any membrane proteins by its intracellular domain. Pull-downs would best be designed using the extracellular domain, which in the case of Neuroligins, is known to form protein-protein interactions with Neurexin (Levinson and ElHusseini 2007). Alternatively, cytoplasmic extracts could be used, as they have a higher likelihood of containing proteins which would interact with the Gli pY, pS or PDZ domains. In addition, fractionation techniques such as size exclusion or ion exchange chromatography  77  could be used to simplify extracts prior to Pull-Down which would minimize background binding and concentrate proteins of interest. When Pull-Downs were found to be not amenable to novel interaction studies, UASRNAi genetic techniques were attempted. UASRNAis did not show any connection with Gli, despite the unusual phenotype seen with MagiRNAi. These experiments were not ideal for identifying novel interactors as they required foreknowledge of potential targets and they relied on observing a Gli mislocalization which may not exist should the protein act downstream of Gli. For these reasons, UASRNAis would best be used in the future as part of confirmation experiments. IPs were ultimately used in conjunction with LC-MS/MS to identify novel interacting proteins. This was the most promising technique as it provides a great deal of versatility and the ability to identify the most interactors in a single experiment. Modification of the described methodology could readily be applied to more complex experiments designed to examine changes in protein expression and identify the presence and position of posttranslational modifications. In combination with the genetic flexibility of Drosophila, this becomes an especially robust technique. For example, an experiment could be designed in which lysates were made of both wt and UASGliWT; DaGAL4 wing discs. One sample could be chemically labeled, mixed with the other lysate, and then analyzed by LC-MS/MS. Chemical labeling will provide a peak shift proportional to the label used and can be used to quantify differences in protein levels between samples. In addition, lysates can be enriched for phosphopeptides, ubiquitinated or glycosylated peptides to look for quantitative differences in post-translational modifications, the identity of modified proteins, and their site of modification. It is thus possible that a set of relatively simple experiments could give a general view of proteins affected by Gli overexpression and the modifications associated with them. The main weakness of the IPs with LC-MS/MS technique is determining which identifications are as a result of background binding to the resin or antibody. This problem can be overcome by increasing the ionic strength of wash buffers, by introducing pre-wash steps with IgG-conjugated resin, and by increasing the number of sample runs to determine 78  reproducibility. This was not done in the above-described experiments as preliminary trials required a more conservative approach until proof of principle was demonstrated. Gli was identified in from both UASGli and w1118 lysates indicating the precipitations and identifications were successful, suggesting this technique should successfully isolate in vivo interactions. For future experiments, preparations should be made for large scale embryo collections such that w1118 IPs can be used to yield more Gli. In addition, In-Gel digestion could be a useful strategy to isolate areas of interest within IPs run on SDS-PAGE.  4.4.2 Gliotactin Dimerization At this time, it remains unknown as to whether Gli can dimerize in vivo or in vitro. In this work, flies overexpressing both GliWT and a Gli mutant in which the C-terminus was replaced with an EBFP-tag, were used in conjunction with IPs to determine whether Gli can oligomerize (Appendix 2.1). This technique is advantageous in that both Gli monomers will exist in their properly folded, membrane-associated states, thus reflecting native binding. Furthermore, since the EBFP mutant lacks the C-terminus, IPs directed at this region will only pull-out the GliWT protein. Thus if EBFP is detected in the IPTs, it can only be as a result of an extracellular interaction between the two Gli constructs. While time did not permit completion of these experiments, the cross outlined in Appendix 2.1 should provide in vivo evidence of oligomerization which can be confirmed using a combination of the following biochemical techniques. Native gel shifts and/or pull down experiments using the Gli extracellular domain could be used to describe oligomerization in vitro. For both experiments, differentially tagged Gli extracellular domains (eg. one GST-tagged, one His-tagged), could be used. When mixed, one construct should be able to pull down the other and be visualized by size difference, using tag-specific Westerns, or with Native gels via band shift. Chemical crosslinking could also be employed is such experiments. A combination of any of the above techniques would be sufficient to confirm Gli oligomerization. Neuroligins exist both as dimers and as tetramers formed by dimer pairs (Dean et al. 2003). Should Gli similarly oligomerize, this may have to be accounted for in biochemical experiments (eg. GST pull downs with the Gli Extracellular domain alone may not pull down 79  Neurexin if dimerization/tetramerization is required for interaction). To this effect, the Gli extracellular domain (His-tagged preferably) could be expressed in bacteria, purified, then analyzed using size exclusion chromatography. The size exclusion elution profile could be used to estimate how many monomers compose each Gli oligomer. HA-tagged Gli (Schulte 2002) purified from adult flies or embryos could also be used for such experiments. Should membrane-association be required for oligomerization, it would be prudent to also conduct crosslinking studies. For example, S2 cells transfected with full length Gli (or a C-terminal deletion mutant) then exposed to a cell-impermeable, irreversible crosslinker (eg. Bis[sulfosuccinimidyl] suberate) could be washed, lysed, then run on SDS-PAGE. Should Gli form monomers, dimers and tetramers, one should see three bands reflecting the size of said oligomers. Size exclusion chromatography of purified cross-linked complexes could provide further evidence as to the stoichiometry. Should there be peaks/bands which do not correlate with the size of a Gli oligomer, it is possible that Gli has been crosslinked to another interacting protein. This obstacle could perhaps be overcome by relipidating Gli into empty vesicles (while perhaps taking time to identify said interacting protein by excising the purified complex from an SDS-PAGE gel then submitting for LC-MS/MS).  4.4.3 Carrying Forward with Identified Targets All proteins identified (Src, 14-3-3, Nck, Corkscrew, PP2A, Awd, Na+/K+ ATPase and Twinstar) should screened for genetic interaction with Gli. As described earlier, for Src this presents problems with viability beyond the embryonic stage, and for this reason temperature sensitive alleles or constructs will be required. This may be the case for other identified proteins as well, seeing as the majority are ubiquitous signaling proteins which are required for diverse cellular activities. Twinstar already has thermolabile alleles available as described in Figure 20 (Blair et al. 2006). These may be suitable for use in a genetic screen with Gli. The following section shall address specific experiments which should be done for higher priority targets:  Src: In addition to genetic interaction studies with Src, further biochemical experiments should be done to pinpoint the residue at which Gli is phosphorylated. To this effect, GST80  GliCtermY760F and GST-GliCtermY799D (no Y799F available) constructs could be used for kinase assays as described in Materials and Methods (MacKinnon 2005). Once identified, UASGli constructs should be generated in which this residue is mutated to either aspartic acid or phenylalanine. These can then be introduced into flies such that phenotypes seen can be separated from those associated with phosphorylation of the second pY residue. Attempts to clone Drosophila Src42A and 64B resulted in perfect, in frame sequence which could not be induced to express protein for unknown reasons. These experiments should be continued such that there can be no question as to whether Drosophila Src can perform the same phosphorylation seen with human Src. Src42A is most homologous to human Src and should thus be the focus of study (Takahashi et al. 1996). The only troubleshooting step which had not been tried was a lower growth temperature which, at times, can be used to increase expression of toxic constructs (Novagen 2005). Should this not work, constructs can be moved to an alternate expression vector (eg. pGEX4T) or perhaps engineered to remove the Kozak sequence Ala residue which was the only difference between this and other successful protein expression experiments. Interaction can further be shown by repeating Westerns for pSrc on Gli IPs (data not shown). A preliminary attempt at this experiment did yield a pSrc band, however, Gli did not IP well, causing worry that this band was not in fact Src, but perhaps recognition of IP antibody which runs at approximately the same size.  Na+/K+ ATPase: There are several experiments which could provide valuable information as to an association between Gli and the Na+/K+ ATPase. Firstly, IPs should be done using the GFP-Nrv2 line. This would permit IP with an anti-GFP antibody which could prove more successful than the Nrv2 antibody in use. IPs directed towards Gli for detection of Nrv2GFP could also be done. Finally, IPs on UASGliEBFP fly lysates (using anti-GFP) could be used to determine whether interaction occurs via the extracellular domain. In addition to biochemical experiments, there are a few genetic experiments which should be performed to look at Na+/K+ATPase association with Gli. Firstly, while similar phenotypes are seen in tracheal morphogenesis for Gli and Na+/K+ATPase null alleles, an up close look at epithelial cell morphology and Gli localization in Na+/K+ATPase mutants has not 81  been done. It would be worthwhile to see if either protein is mislocalized in response to mutation of the other. Doing this both with mutant alleles and temperature-sensitive expression/alleles, could allow for determination of both developmental interactions and those required for maintaining polarity or perhaps in PCP in terms of wing hair orientation. In order to assess whether Na+/K+ ATPase mediates an interaction between Gli and Src, repeating kinase assays in the presence of a peptide which would compete for SH2binding may be useful. Should no reduction in phosphorylation be seen, the suggested SH2independent phosphorylation is more likely. Determining whether Src-TCJ localization decreases in nrv2 mutants, and whether Gli accumulates as a result would also be a valuable experiment. Furthermore, co-staining for Gli, Nrv2 and endosomes would be advantageous to support a mechanism in which Gli and Nrv2 are co-dependent for endocytosis. Finally, treating cultured wing discs from UASGliWT-DauGAL4 larvae with increasing dosages of a Src inhibitor (eg. PP2 [4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine]) could be used to show a decrease in vesicle accumulation as a result of lost downstream signalling. In absence of a direct association between the Na+/K+ ATPase and Src, modulating its expression levels could nonetheless be a useful tool to modulate levels of activated Src, thereby providing an alternate to using Src mutant alleles and UAS constructs. Knock-down of the Na+/K+ATPase has been shown to increase cellular levels of activated Src which in turn increases Caveolin-mediated endocytosis (Contreras et al. 1999). Overexpression of Na+/K+ATPase could alternately be used to sequester active Src and phenocopy a weak Src RNAi. If this is used in combination with Gli alleles, a genetic interaction may be elucidated (ie. If overexpression of Na+/K+ ATPase results in phenotype enhancement when in the presence of a Gli mutation, it may indicate a genetic interaction between Gli, Na+/K+ ATPase and possibly Src).  Protein Kinase C: Experiments designed to find an interaction between PKC and Gli were hampered by difficulties expressing constructs and unsuitable pS antibodies (Appendix 2.3). No phosphorylation of Gli was seen in kinase assays with human δPKC. However, the pS antibody also did not detect any significant phosphorylation in crude lysates. This could indicate that it was not used in sufficient amounts or was not suitable for use with Drosophila 82  samples. These experiments should be repeated either using different pS antibodies or an alternate form of detection (eg. radioassay). Binding experiments were also unsuccessful using human PKCδ. This may be due to a transient interaction, however, there is also the possibility that the S838 site is directed towards an alternate PKC as indicated by in silico primary structure analysis scores of 0.33% for PKCs α,β and γ. S838 could also be the target of another kinase such as Casein Kinase I which recognizes a pSXXS/T motif matching S838-S841 (Roach 1991). Prior to examination of any further pS targeted enzymes, it would be advisable to create GliS838A mutants for transformation into flies under control of the UAS/GAL4 system (and later for negative controls in biochemical experiments). In this manner, it could be determined whether enzymes targeted to this region are worthwhile examining further as one would expect Gli mislocalization or loss of function associated with mutation of a critical residue. In the meantime, addition of PKC isoforms into a genetic screen would provide some answers as to an interaction with Gli.  14-3-3: Future studies into a Gli/SJ association with 14-3-3 should first examine a possible genetic interaction using 14-3-3 temperature sensitive mutants. An examination of early embryonic development would provide evidence as to antagonism or enhancement of Glimediated compaction of SJ components. Furthermore, studies of the larval imaginal discs should provide information as to the maintenance of SJ localization. There are any number of possible 14-3-3-mediated functions at the SJ that could also be identified from these experiments through staining of NeurexinIV, Neuroligin, Dlg etc. Finally, binding studies using GliCterm and GliCterm∆PDZ constructs could be used to determine whether there is an association between Gli and 14-3-3 via the PDZ domain. These studies can be extended in vivo to see whether there is a change/augmentation of phenotype associated a 14-3-3 mutation in trans to UASGli∆PDZ (in comparision to UASGli∆PDZ alone or UASGliWT in trans to 14-3-3 mutation). To find a conserved role in regulating the cell cycle, 14-3-3ε-GFP experiments should be followed up by staining 14-3-3ε mutants for RhoA. The PKCε complex is required for RhoA inactivation and exit from the cleavage furrow at the end of cytokinesis (Saurin et al. 2008). 83  Should this mechanism be conserved in Drosophila, one would expect to see an accumulation of RhoA at cleavage furrows in response to 14-3-3 mutation. In addition to known components of the PKCε cytokinesis mechanism (in mammals), it may be worthwhile to also look at Anillin and RacGAP which showed similar staining to 143-3εGFP (Gregory et al. 2008). Genetic interaction studies should be done, or Western blots on 14-3-3, PKC or Anillin IPs. Gli may also be worthwhile to look at in this context, as preliminary data indicates Gli-null mutant clones may have plane of division defects (Charish, Unpublished Work). Gli staining marks the cell corners between which the cleavage furrow forms. It is possible that Gli forms a boundary which restricts movement of membraneassociated furrow-forming proteins (including the PKCε, 14-3-3 complex), thereby defining their position.  5. Conclusion A summary of the potential Gli protein-interaction network is shown in Figure 24. Src Kinase is the most promising candidate interactor, having been shown to phosphorylate Gli in vitro. Src is known to regulate endocytosis of junction components in mammals, a process which has been related to phosphorylation of the tyrosine residues in question. In addition, 14-3-3 and the Na+/K+ ATPase were identified during LC-MS/MS analysis of immunoprecipitates and found to colocalize with SJs. Na+/K+ ATPase further showed a high degree of colocalization with both Dlg and Gli. Other possible interactors identified by LCMS/MS include Tsr, Awd, and PP2A, all of which should be examined further through use of a genetic screen. Finally, while not necessarily associated with Gli, Magi was found to possibly be required for the outer glial barrier. In addition to identification results, the methods developed in the course of this work can readily be applied to further biochemical experiments designed to describe changes resulting from Gli overexpression, or to identify further novel interactors. At the same time, this work excludes several methods for use in novel interactor strategies, instead setting them aside for use in confirmatory experiments only. To summarize, this work identified  84  several novel candidate interactors, while setting the groundwork for the identification and confirmation of further interactors.  Figure 24: Potential Gli Protein-Interaction Network  Potential Gli Protein interactions described in Figures 8 and 20 are summarized, with addition of sites where Nck and 14-3-3ε may interact (Y760 and PDZ-recognition motif respectively). Additional proteins presented in the course of this work (ie. widerborst, twins, twinstar) do not have any information suggesting where they fit in this network, and have thus not been included.  85  Figure 24: Potential Gli Protein-Interaction Network  86  6. References Aitken, A. (2006) 14-3-3 proteins: a historic overview. Seminars in cancer biology 16, 162-172. Alberts, B. (2002) Molecular Biology of the Cell 4th Edition. New York: Garland Science. AmershamBiosciences GST Gene fusion system handbook: GE Healthcare. Auld, V.J. (2008) Unpublished Work. Vancouver: University of British Columbia. Auld, V.J., Fetter, R.D., Broadie, K. and Goodman, C.S. (1995) Gliotactin, a novel transmembrane protein on peripheral glia, is required to form the blood-nerve barrier in Drosophila. Cell 81, 757-767. Bae, T.J., Kim, M.S., Kim, J.W., Kim, B.W., Choo, H.J., Lee, J.W., Kim, K.B., Lee, C.S., Kim, J.H., Chang, S.Y., Kang, C.Y., Lee, S.W. and Ko, Y.G. (2004) Lipid raft proteome reveals ATP synthase complex in the cell surface. Proteomics 4, 3536-3548. Bagshaw, R.D., Mahuran, D.J. and Callahan, J.W. (2005) A proteomic analysis of lysosomal integral membrane proteins reveals the diverse composition of the organelle. Mol Cell Proteomics 4, 133-143. Bairoch, A., R. Apweiler, C. H. Wu, W. C. Barker, B. Boeckmann, S. Ferro, E. Gasteiger, H. Huang, R. Lopez, M. Magrane, M. J. Martin, D. A. Natale, C. O'Donovan, N. Redaschi and L. S. Yeh (2005). The Universal Protein Resource (UniProt). Nucleic Acids Res 33(Database issue): D154-9. Baumgartner, S., Littleton, J.T., Broadie, K., Bhat, M.A., Harbecke, R., Lengyel, J.A., Chiquet-Ehrismann, R., Prokop, A. and Bellen, H.J. (1996) A Drosophila Neurexin Is Required for Septate Junction and Blood-Nerve Barrier Formation and Function. Cell 87, 1059-1068. Behr, M., Riedel, D. and Schuh, R. (2003) The claudin-like megatrachea is essential in septate junctions for the epithelial barrier function in Drosophila. Dev Cell 5, 611-620. Benton, R., Palacios, I.M. and St Johnston, D. (2002) Drosophila 14-3-3/PAR-5 is an essential mediator of PAR-1 function in axis formation. Dev Cell 3, 659-671. Benton, R. and St Johnston, D. (2003) Drosophila PAR-1 and 14-3-3 inhibit Bazooka/PAR-3 to establish complementary cortical domains in polarized cells. Cell 115, 691-704. Biggs, J., Hersperger, E., Steeg, P.S., Liotta, L.A. and Shearn, A. (1990) A Drosophila gene that is homologous to a mammalian gene associated with tumor metastasis codes for a nucleoside diphosphate kinase. Cell 63, 933-940. Bilder, D., Li, M. and Perrimon, N. (2000) Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289, 113-116.  87  Blair, A., Tomlinson, A., Pham, H., Gunsalus, K.C., Goldberg, M.L. and Laski, F.A. (2006) Twinstar, the Drosophila homolog of cofilin/ADF, is required for planar cell polarity patterning. Development 133, 1789-1797. Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415. Cantarelli, V. V., T. Kodama, N. Nijstad, S. K. Abolghait, S. Nada, M. Okada, T. Iida and T. Honda (2007). Tyrosine phosphorylation controls cortactin binding to two enterohaemorrhagic Escherichia coli effectors: Tir and EspFu/TccP. Cell Microbiol 9(7): 1782-95. Chang, D.D., Wong, C., Smith, H. and Liu, J. (1997) ICAP-1, a novel beta1 integrin cytoplasmic domainassociated protein, binds to a conserved and functionally important NPXY sequence motif of beta1 integrin. J Cell Biol 138, 1149-1157. Chang, H.C. and Rubin, G.M. (1997) 14-3-3 epsilon positively regulates Ras-mediated signaling in Drosophila. Genes & development 11, 1132-1139. Charish, K. (2008) Unpublished Work. Vancouver: University of British Columbia. Chen, W.J., Goldstein, J.L. and Brown, M.S. (1990) NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor. J Biol Chem 265, 3116-3123. Chien, C.T., Wang, S., Rothenberg, M., Jan, L.Y. and Jan, Y.N. (1998) Numb-associated kinase interacts with the phosphotyrosine binding domain of Numb and antagonizes the function of Numb in vivo. Mol Cell Biol 18, 598-607. Colegio, O.R., Van Itallie, C.M., McCrea, H.J., Rahner, C. and Anderson, J.M. (2002) Claudins create charge-selective channels in the paracellular pathway between epithelial cells. Am J Physiol Cell Physiol 283, C142-147. Comoletti, D., Grishaev, A., Whitten, A.E., Tsigelny, I., Taylor, P. and Trewhella, J. (2007) Synaptic arrangement of the neuroligin/beta-neurexin complex revealed by X-ray and neutron scattering. Structure 15, 693-705. Contreras, R.G., Shoshani, L., Flores-Maldonado, C., Lazaro, A. and Cereijido, M. (1999) Relationship between Na(+),K(+)-ATPase and cell attachment. J Cell Sci 112 ( Pt 23), 4223-4232. Cuevas, B. D., Y. Lu, M. Mao, J. Zhang, R. LaPushin, K. Siminovitch and G. B. Mills (2001). Tyrosine phosphorylation of p85 relieves its inhibitory activity on phosphatidylinositol 3-kinase. J Biol Chem 276(29): 27455-61. Daneman, R. and Barres, B.A. (2005) The blood-brain barrier--lessons from moody flies. Cell 123, 9-12.  88  Dean, C., Scholl, F.G., Choih, J., DeMaria, S., Berger, J., Isacoff, E. and Scheiffele, P. (2003) Neurexin mediates the assembly of presynaptic terminals. Nat Neurosci 6, 708-716. Dubreuil, R. R., P. Wang, S. Dahl, J. Lee and L. S. Goldstein (2000). Drosophila beta spectrin functions independently of alpha spectrin to polarize the Na,K ATPase in epithelial cells. J Cell Biol 149(3): 64756. Duffy, J.B. (2002) GAL4 system in Drosophila: a fly geneticist's Swiss army knife. Genesis 34, 1-15. Fehon, R.G., Dawson, I.A. and Artavanis-Tsakonas, S. (1994) A Drosophila homologue of membraneskeleton protein 4.1 is associated with septate junctions and is encoded by the coracle gene. Development 120, 545-557. Fischer, J.A., Giniger, E., Maniatis, T. and Ptashne, M. (1988) GAL4 activates transcription in Drosophila. Nature 332, 853-856. Flybase (2008) Flybase: A database of Drosophila Genes and Genomes. Freeman, R.M., Plutzky, J. and Neel, B.G. (1992) Identification of a human src homology 2-containing protein-tyrosine-phosphatase: a putative homolog of Drosophila corkscrew. Proceedings of the National Academy of Sciences of the United States of America 89, 11239-11243. Fristrom, D.K. (1982) Septate junctions in imaginal disks of Drosophila: a model for the redistribution of septa during cell rearrangement. J Cell Biol 94, 77-87. Fujita, Y., Krause, G., Scheffner, M., Zechner, D., Leddy, H.E., Behrens, J., Sommer, T. and Birchmeier, W. (2002) Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat Cell Biol 4, 222-231. Furuse, M., Sasaki, H., Fujimoto, K. and Tsukita, S. (1998) A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts. J Cell Biol 143, 391-401. Furuse, M. and Tsukita, S. (2006) Claudins in occluding junctions of humans and flies. Trends Cell Biol 16, 181-188. Ganguly, S., Weller, J.L., Ho, A., Chemineau, P., Malpaux, B. and Klein, D.C. (2005) Melatonin synthesis: 14-3-3-dependent activation and inhibition of arylalkylamine N-acetyltransferase mediated by phosphoserine-205. Proceedings of the National Academy of Sciences of the United States of America 102, 1222-1227. Garrity, P.A., Rao, Y., Salecker, I., McGlade, J., Pawson, T. and Zipursky, S.L. (1996) Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein. Cell 85, 639-650. Gates, J. and Thummel, C.S. (2000) An Enhancer Trap Screen for Ecdysone-Inducible Genes Required for Drosophila Adult Leg Morphogenesis. Genetics 156, 1765-1776. 89  Genova, J.L. and Fehon, R.G. (2003) Neuroglian, Gliotactin, and the Na+/K+ ATPase are essential for septate junction function in Drosophila. J Cell Biol 161, 979-989. Gilbert, M. (2008) Unpublished Work. Vancouver: University of British Columbia. Gilbert, M., Smith, J., Roskams, A.J. and Auld, V.J. (2001) Neuroligin 3 is a vertebrate gliotactin expressed in the olfactory ensheathing glia, a growth-promoting class of macroglia. Glia 34, 151-164. Gilbert, M.M. and Auld, V.J. (2005) Evolution of clams (cholinesterase-like adhesion molecules): structure and function during development. Front Biosci 10, 2177-2192. Giniger, E., Varnum, S.M. and Ptashne, M. (1985) Specific DNA binding of GAL4, a positive regulatory protein of yeast. Cell 40, 767-774. Golemis, E. (2002) A Molecular Cloning Manual: Protein-Protein Interactions. Cold Spring Harbor, NY: Cold Spring Harbor Press. Gonzalez-Mariscal, L., Betanzos, A. and Avila-Flores, A. (2000) MAGUK proteins: structure and role in the tight junction. Semin Cell Dev Biol 11, 315-324. Gregory, S.L., Ebrahimi, S., Milverton, J., Jones, W.M., Bejsovec, A. and Saint, R. (2008) Cell division requires a direct link between microtubule-bound RacGAP and Anillin in the contractile ring. Curr Biol 18, 25-29. Guo, S., G. Z. Ferl, R. Deora, M. Riedinger, S. Yin, J. L. Kerwin, J. A. Loo and O. N. Witte (2004). A phosphorylation site in Bruton's tyrosine kinase selectively regulates B cell calcium signaling efficiency by altering phospholipase C-gamma activation. Proc Natl Acad Sci U S A 101(39): 14180-5. Hamazaki, Y., Itoh, M., Sasaki, H., Furuse, M. and Tsukita, S. (2002) Multi-PDZ domain protein 1 (MUPP1) is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule. J Biol Chem 277, 455-461. Hannus, M., Feiguin, F., Heisenberg, C.P. and Eaton, S. (2002) Planar cell polarization requires Widerborst, a B' regulatory subunit of protein phosphatase 2A. Development 129, 3493-3503. Harris, B.Z. and Lim, W.A. (2001) Mechanism and role of PDZ domains in signaling complex assembly. J Cell Sci 114, 3219-3231. Hawkins, B.T. and Davis, T.P. (2005) The Blood-Brain Barrier/Neurovascular Unit in Health and Disease. Pharmacol Rev 57, 173-185. Hirabayashi, S., Tajima, M., Yao, I., Nishimura, W., Mori, H. and Hata, Y. (2003) JAM4, a junctional cell adhesion molecule interacting with a tight junction protein, MAGI-1. Mol Cell Biol 23, 4267-4282.  90  Hirao, K., Hata, Y., Ide, N., Takeuchi, M., Irie, M., Yao, I., Deguchi, M., Toyoda, A., Sudhof, T.C. and Takai, Y. (1998) A Novel Multiple PDZ Domain-containing Molecule Interacting with N-Methyl-Daspartate Receptors and Neuronal Cell Adhesion Proteins. J Biol Chem 273, 21105-21110. Hortsch, M. and Margolis, B. (2003) Septate and paranodal junctions: kissing cousins. Trends Cell Biol 13, 557-561. Hough, C.D., Woods, D.F., Park, S. and Bryant, P.J. (1997) Organizing a functional junctional complex requires specific domains of the Drosophila MAGUK Discs large. Genes & development 11, 3242-3253. Iida, J., Hirabayashi, S., Sato, Y. and Hata, Y. (2004) Synaptic scaffolding molecule is involved in the synaptic clustering of neuroligin. Molecular and Cellular Neuroscience 27, 497-508. Ikenouchi, J., Furuse, M., Furuse, K., Sasaki, H. and Tsukita, S. (2005) Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. J Cell Biol 171, 939-945. Ivanov, A. I., A. Nusrat and C. A. Parkos (2005). Endocytosis of the apical junctional complex: mechanisms and possible roles in regulation of epithelial barriers. Bioessays 27(4): 356-65. Janssens, V. and Goris, J. (2001) Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. The Biochemical journal 353, 417-439. Kim, E., Naisbitt, S., Hsueh, Y.-P., Rao, A., Rothschild, A., Craig, A.M. and Sheng, M. (1997) GKAP, a Novel Synaptic Protein That Interacts with the Guanylate Kinase-like Domain of the PSD-95/SAP90 Family of Channel Clustering Molecules. J Cell Biol 136, 669-678. Knust, E. and Bossinger, O. (2002) Composition and formation of intercellular junctions in epithelial cells. Science 298, 1955-1959. Kockel, L., Vorbruggen, G., Jackle, H., Mlodzik, M. and Bohmann, D. (1997) Requirement for Drosophila 14-3-3 zeta in Raf-dependent photoreceptor development. Genes & development 11, 1140-1147. Lamb, R.S., Ward, R.E., Schweizer, L. and Fehon, R.G. (1998) Drosophila coracle, a member of the protein 4.1 superfamily, has essential structural functions in the septate junctions and developmental functions in embryonic and adult epithelial cells. Mol Biol Cell 9, 3505-3519. Laughon, A., Driscoll, R., Wills, N. and Gesteland, R.F. (1984) Identification of two proteins encoded by the Saccharomyces cerevisiae GAL4 gene. Mol Cell Biol 4, 268-275. Levinson, J.N. and El-Husseini, A. (2007) A crystal-clear interaction: relating neuroligin/neurexin complex structure to function at the synapse. Neuron 56, 937-939. Li, W., Skoulakis, E.M., Davis, R.L. and Perrimon, N. (1997) The Drosophila 14-3-3 protein Leonardo enhances Torso signaling through D-Raf in a Ras 1-dependent manner. Development (Cambridge, England) 124, 4163-4171. 91  Li, Z. and Xie, Z. (2008) The Na/K-ATPase/Src complex and cardiotonic steroid-activated protein kinase cascades. Pflugers Arch. Liu, J., R. Kesiry, S. M. Periyasamy, D. Malhotra, Z. Xie and J. I. Shapiro (2004). Ouabain induces endocytosis of plasmalemmal Na/K-ATPase in LLC-PK1 cells by a clathrin-dependent mechanism. Kidney Int 66(1): 227-41 MacKinnon, C. (2005) The Intracellular Binding Partners of Gliotactin. In Zoology. p.73. Vancouver: University of British Columbia. Mandell, K.J., McCall, I.C. and Parkos, C.A. (2004) Involvement of the Junctional Adhesion Molecule-1 (JAM1) Homodimer Interface in Regulation of Epithelial Barrier Function. J Biol Chem 279, 1625416262. Meddings, J. (2008) The significance of the gut barrier in disease. Gut 57, 438-440. Meyer, R. D., V. Dayanir, F. Majnoun and N. Rahimi (2002). The presence of a single tyrosine residue at the carboxyl domain of vascular endothelial growth factor receptor-2/FLK-1 regulates its autophosphorylation and activation of signaling molecules. J Biol Chem 277(30): 27081-7. Morin, X., Daneman, R., Zavortink, M., Chia, W. (2001). A protein trap strategy to detect GFP-tagged proteins expressed from their endogenous loci in Drosophila. Proc. Natl. Acad. Sci. USA 98(26), 15030-15055. Niessen, C.M. (2007) Tight Junctions//Adherens Junctions: Basic Structure and Function. J Invest Dermatol 127, 2525-2532. Nishimura, R., Li, W., Kashishian, A., Mondino, A., Zhou, M., Cooper, J. and Schlessinger, J. (1993) Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor. Mol Cell Biol 13, 6889-6896. Novagen (2005) pET System Manual 11th Edition: EMD Biosciences. O'Reilly, A.M. and Neel, B.G. (1998) Structural Determinants of SHP-2 Function and Specificity in Xenopus Mesoderm Induction. Mol Cell Biol 18, 161-177. Obenauer, J.C., Cantley, L.C. and Yaffe, M.B. (2003) Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic acids research 31, 3635-3641. Onel, S., Bolke, L. and Klambt, C. (2004) The Drosophila ARF6-GEF Schizo controls commissure formation by regulating Slit. Development 131, 2587-2594. Oshima, Y. (1982) Regulatory circuits for gene expression: the metabolism of galactose and phosphate. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Padash, M., M. (2008) Unpublished Work. Vanoucouver: University of British Columbia. 92  Palacios, F., Price, L., Schweitzer, J., Collard, J.G. and D'Souza-Schorey, C. (2001) An essential role for ARF6-regulated membrane traffic in adherens junction turnover and epithelial cell migration. The EMBO journal 20, 4973-4986. Palacios, F., Schweitzer, J.K., Boshans, R.L. and D'Souza-Schorey, C. (2002) ARF6-GTP recruits Nm23H1 to facilitate dynamin-mediated endocytosis during adherens junctions disassembly. Nat Cell Biol 4, 929-936. Palacios, F., Tushir, J.S., Fujita, Y. and D'Souza-Schorey, C. (2005) Lysosomal targeting of E-cadherin: a unique mechanism for the down-regulation of cell-cell adhesion during epithelial to mesenchymal transitions. Mol Cell Biol 25, 389-402. Pappin, D.J., Hojrup, P. and Bleasby, A.J. (1993) Rapid identification of proteins by peptide-mass fingerprinting. Curr Biol 3, 327-332. Parnas, D., Haghighi, A.P., Fetter, R.D., Kim, S.W. and Goodman, C.S. (2001) Regulation of postsynaptic structure and protein localization by the Rho-type guanine nucleotide exchange factor dPix. Neuron 32, 415-424. Paul, S.M., Palladino, M.J. and Beitel, G.J. (2007) A pump-independent function of the Na,K-ATPase is required for epithelial junction function and tracheal tube-size control. Development 134, 147-155. Pawson, T. (2008) Pawson Lab Webpage-Protein Interaction Domains. Vancouver. Pawson, T., Gish, G.D. and Nash, P. (2001) SH2 domains, interaction modules and cellular wiring. Trends in Cell Biology 11, 504-511. Perkins, L.A., Johnson, M.R., Melnick, M.B. and Perrimon, N. (1996) The nonreceptor protein tyrosine phosphatase corkscrew functions in multiple receptor tyrosine kinase pathways in Drosophila. Dev Biol 180, 63-81. Que, J. (2006a) Biochemical Protein Interactions of Gliotactin at the Tricellular Junction. In Zoology. Vancouver: University of British Columbia. Que, J. (2006b) Unpublished Work. Vancouver: University of British Columbia. Ranganathan, R. and Ross, E.M. (1997) PDZ domain proteins: scaffolds for signaling complexes. Curr Biol 7, R770-773. Rehder, D., Iden, S., Nasdala, I., Wegener, J., Brickwedde, M.-K.M.Z., Vestweber, D. and Ebnet, K. (2006) Junctional adhesion molecule-A participates in the formation of apico-basal polarity through different domains. Experimental Cell Research 312, 3389-3403. Rietveld, A., S. Neutz, K. Simons and S. Eaton (1999). Association of sterol- and glycosylphosphatidylinositol-linked proteins with Drosophila raft lipid microdomains. J Biol Chem 274(17): 12049-54. 93  Roach, P.J. (1991) Multisite and hierarchal protein phosphorylation. J Biol Chem 266, 14139-14142. Saitou, M., Furuse, M., Sasaki, H., Schulzke, J.D., Fromm, M., Takano, H., Noda, T. and Tsukita, S. (2000) Complex phenotype of mice lacking occludin, a component of tight junction strands. Mol Biol Cell 11, 4131-4142. Satoh, K., Yanai, H., Senda, T., Kohu, K., Nakamura, T., Okumura, N., Matsumine, A., Kobayashi, S., Toyoshima, K. and Akiyama, T. (1997) DAP-1, a novel protein that interacts with the guanylate kinaselike domains of hDLG and PSD-95. Genes Cells 2, 415-424. Saurin, A.T., Durgan, J., Cameron, A.J., Faisal, A., Marber, M.S. and Parker, P.J. (2008) The regulated assembly of a PKCepsilon complex controls the completion of cytokinesis. Nat Cell Biol 10, 891-901. Schulte, J. (2002) The Role of Gliotactin in the Formation of Drosophila Septate Junctions. In Zoology. Vancouver: University of British Columbia. Schulte, J., Charish, K., Que, J., Ravn, S., MacKinnon, C. and Auld, V.J. (2006) Gliotactin and Discs large form a protein complex at the tricellular junction of polarized epithelial cells in Drosophila. J Cell Sci 119, 4391-4401. Schulte, J., Tepass, U. and Auld, V.J. (2003) Gliotactin, a novel marker of tricellular junctions, is necessary for septate junction development in Drosophila. J Cell Biol 161, 991-1000. Schulte, J., Unpublished Work. Vancouver: University of British Columbia Segretain, D. and M. M. Falk (2004). Regulation of connexin biosynthesis, assembly,gap junction formation, and removal. Biochim Biophys Acta 1662(1-2): 3-21. Seth, A., Sheth, P., Elias, B.C. and Rao, R. (2007) Protein phosphatases 2A and 1 interact with occludin and negatively regulate the assembly of tight junctions in the CACO-2 cell monolayer. J Biol Chem 282, 11487-11498. Shieh, B.H., Parker, L. and Popescu, D. (2002) Protein kinase C (PKC) isoforms in Drosophila. J Biochem 132, 523-527. Shin, K., Straight, S. and Margolis, B. (2005) PATJ regulates tight junction formation and polarity in mammalian epithelial cells. J Cell Biol 168, 705-711. Shiomi, K., Takeichi, M., Nishida, Y., Nishi, Y. and Uemura, T. (1994) Alternative cell fate choice induced by low-level expression of a regulator of protein phosphatase 2A in the Drosophila peripheral nervous system. Development 120, 1591-1599. Simon, M.A., Bowtell, D.D., Dodson, G.S., Laverty, T.R. and Rubin, G.M. (1991) Ras1 and a putative guanine nucleotide exchange factor perform crucial steps in signaling by the sevenless protein tyrosine kinase. Cell 67, 701-716. 94  Smith, M.J., Hardy, W.R., Murphy, J.M., Jones, N. and Pawson, T. (2006) Screening for PTB domain binding partners and ligand specificity using proteome-derived NPXY peptide arrays. Mol Cell Biol 26, 8461-8474. Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R.J. and et al. (1993) SH2 domains recognize specific phosphopeptide sequences. Cell 72, 767-778. Stork, T., Engelen, D., Krudewig, A., Silies, M., Bainton, R.J. and Klambt, C. (2008) Organization and function of the blood-brain barrier in Drosophila. J Neurosci 28, 587-597. Strutt, D.I. (2001) Asymmetric Localization of Frizzled and the Establishment of Cell Polarity in the Drosophila Wing. Molecular Cell 7, 367-375. Su, T.T., Parry, D.H., Donahoe, B., Chien, C.T., O'Farrell, P.H. and Purdy, A. (2001) Cell cycle roles for two 14-3-3 proteins during Drosophila development. J Cell Sci 114, 3445-3454. Takahashi, F., Endo, S., Kojima, T. and Saigo, K. (1996) Regulation of cell-cell contacts in developing Drosophila eyes by Dsrc41, a new, close relative of vertebrate c-src. Genes & development 10, 16451656. Tepass, U., Tanentzapf, G., Ward, R. and Fehon, R. (2001) Epithelial cell polarity and cell junctions in Drosophila. Annu Rev Genet 35, 747-784. ThermoFisherScientificInc (2008) Instructions for AminoLink Plus Immobilization Kit USA. Tien, A. C., H. Y. Hsei, et al. (1999). Dynamic expression and cellular localization of the drosophila 143-3epsilon during embryonic development. Mech Dev 81(1-2), 209-12. Van Itallie, C., Rahner, C. and Anderson, J.M. (2001) Regulated expression of claudin-4 decreases paracellular conductance through a selective decrease in sodium permeability. J Clin Invest 107, 13191327. VDRC (2008) Vienna Drosophila Research Center Website. Venema, D.R. (2003) The Role of Gliotactin in Planar Cell Polarity. In Zoology. Vancouver: University of British Columbia. Venema, D.R., Zeev-Ben-Mordehai, T. and Auld, V.J. (2004) Transient apical polarization of Gliotactin and Coracle is required for parallel alignment of wing hairs in Drosophila. Dev Biol 275, 301-314. Ward, R.E.t., Lamb, R.S. and Fehon, R.G. (1998) A conserved functional domain of Drosophila coracle is required for localization at the septate junction and has membrane-organizing activity. J Cell Biol 140, 1463-1473.  95  Weber, C., Fraemohs, L. and Dejana, E. (2007) The role of junctional adhesion molecules in vascular inflammation. Nature reviews 7, 467-477. Woods, D.F. and Bryant, P.J. (1991) The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell 66, 451-464. Wu, V.M., Schulte, J., Hirschi, A., Tepass, U. and Beitel, G.J. (2004a) Sinuous is a Drosophila claudin required for septate junction organization and epithelial tube size control. J Cell Biol 164, 313-323. Wu, V. M. and G. J. Beitel (2004b). A junctional problem of apical proportions: epithelial tube-size control by septate junctions in the Drosophila tracheal system. Curr Opin Cell Biol 16(5): 493-9. Yu, D. and J. R. Turner (2008). Stimulus-induced reorganization of tight junction structure: the role of membrane traffic. Biochim Biophys Acta 1778(3): 709-16.  96  Appendix 1 Supplementary Bioinformatic Data  97  98  Casein Kinase II Site  Potential SHP1 Site  A1.1 Alignment of Gliotactin C-Terminus Amino Acids 728-956 of D. melanogaster AAC41579 with Arthropod Species using ClustalW (Auld 2008)  A1.2 MotifScanner Primary Structure Analysis of Gli for Identification of Candidate Interactors  99  A1.2 MotifScanner Primary Structure Analysis of Gli for Identification of Candidate Interactors  100  A1.3 Alignment of Drosophila melanogaster Src42A, Src64B and Homo sapiens Src using ClustalW  101  Appendix 2 Supplementary Results  102  A2.1 Strategies to Confirm Gliotactin Oligomerization Gli dimerization is suggested by its homology to dimer-forming Neuroligins and the increased viability of gliRAR77/gliDV5 flies in comparison to gliDV5/gliGliDV5. In order to isolate this possible interaction, wild-type Gli (UASGliWT) and Gli containing an EBFP tag in place of the intracellular domain (UASGliEBFP), were co-expressed under control of the ubiquitous driver DaGal4. All available Gli antibodies are directed towards the intracellular domain, and thus, the above design allows for selective IP of UASGliWT. When the immunoprecipitate is then analyzed by Western blot, one should only detect EBFP (using anti-GFP antibody) if there is interaction between these Gli monomers. This experiment is outlined in Figure 25a. In co-expressing UASGliWT and UASGliEBFP, it was necessary to circumvent the unknown position of GliEBFP in the genome. To this effect, the crossing scheme in Figure 25b was used such that 100% of EBFP-positive females would be the correct genotype. This strategy was, however, unsuccessful, as the EBFP signal was too low to be used as an effective selection marker. Furthermore, attempts to use all females with the presumption that at least 50% should be the correct genotype proved unsuccessful. In such experiments, neither GliWT nor GliEBFP were detected in Westerns of crude lysates, indicating the absence of driver in these lines. It is possible that either the desired progeny were too sick to reach adulthood or were delayed in development such that the vast majority of females were the healthier flies containing no driver. In order to define a cross which would allow selection of driver, UASGliWT, and UASGliEBFP, it was deemed necessary to map the location of UASGliEBFP in the genome. The UASGliEBFP insertion is accompanied by the white (w+) gene which gives red eye pigment (wgives white eyes), providing an easily detected selection marker. When crossed to the double balanced line w-/w-; bc,gla/cyo; MKRS/Tm6, the resulting UASGliEBFP progeny (of interest) would be */Y; */bc,gla (black cell/glazed eyes); */Tm6 (tubby larvae), where * will be either +,w- or UASGliEBFP,w+. When these progeny are then crossed to w1118 (w-) flies, should UASGliEBFP be on the X chromosome, no males should have red eyes. Similarly, if on the second chromosome, no glazed eye flies should have red eyes, and if on the 3rd, no tubby flies should have red eyes. In this manner it was found that the UASGliEBFP insertion was on the X chromosome (Table 4). 103  The X chromosome is a fortuitous place to find the UASGliEBFP insertion, as a cross between UASGliWT (also on the X) males and UASGliEBFP females will result in 100% of female progeny having both insertions. In order to select for the driver, the simplest strategy would be to incorporate a UASmCD8GFP (membrane marker) into the cross such that all maggots containing driver will be GFP-positive and selectable using a standard fluorescent dissection scope. To this effect, the mating scheme outlined in Figure 25c was devised. This final experiment must be done at a later date.  Table 4: Progeny Counts from */Y; */bc,gla; */Tm6 x w1118 for determination of w+,UASGliEBFP Location (*= w+, UASGliEBFP or w-, wt)in Genome  Marker Tubby Glazed Males  Associated Chromosome 3rd 2nd X  White Eyes 12 6 34  Red Eyes 3 8 0  104  Figure 25: Outline of Gli Dimerization Experiments  a) GliEBFP constructs contain no intracellular domain, and therefore do not IPT with anti-Gli antibodies. Should GliEBFP be detected in anti-Gli IPT from UASGliWT/UASGliEBFP flies, GliEBFP likely forms a multimer with GliWT. b) Initial cross designed to generate flies co-expressing UASGliWT, UASGliEBFP and DaughterlesGal4 when the chromosomal location of UASGliEBFP was unavailable. From this scheme, all EBFP-positive females would be the desired genotype. c) Final cross devised to generate UASGliWT/UASGliEBFP; UASmCD8GFP/+; Da/+ with the knowledge that UASGliEBFP is on the X chromosome (See table 4). UASmCD8GFP was used to detect the presence of driver in the progeny.  a)  b)  c)  105  A2.2 Screen of SH2/PTB-GST Library In order to identify possible pY interactors, a small library of SH2 and PTB domains tagged with glutathione-S-transferase (GST) (including Nck and Src) were used in pull-downs with the Gli-intracellular domain (GliCterm) constructs (SH2/PTB-GSTs are listed in table 5). Originally, several GliCterms were available, including GST-GliCtermWT, GST-GliCtermFF (Y760F, Y799F), and GST-GliCtermDD (Y760D, Y799D)(MacKinnon 2005). As described earlier, the YD mutations were used to mimic phosphorylation, whilst YF were used to mimic the unphosphorylated state. Since both sets of constructs contained GST-tags, it was not possible to do straightforward pull-downs. For this reason, GliCterm constructs were subcloned into pET28 to generate a C-terminal His-tag which could be used for purification and pull-downs. Following GliCterm subcloning and sequence confirmation, expression trials were used to determine optimal expression time. Referring to figure 26ai, expression levels plateaued and showed the least amount of degradation at 30min-1hr with 1mM IPTG. Purification trials that followed showed the constructs purified with minimal background and degradation figure 26ai. Similar trials were done to check expression of the GST-SH2 library using GST-Bind resin (Novagen) (Figure 26aii). Out of the fifteen constructs, only three could not be expressed: SHP2NTerm-SH2, SHP1 N+CTerm-SH2 and p85 N+Cterm-SH2. p85 was found to have a recognition site at Y550 in the above-described Motifscan (Appendix 1.2). However, seeing as this residue is within the extracellular choline-esterase-like domain, this was deemed an unlikely “true” interactor with Gli. SHP2 recognizes a xxpYI/V-nonbasicV/I/L/P-nonbasic-hydrophobic motif which, upon visual inspection, is not in the Gli intracellular domain and it is therefore a less likely candidate (O'Reilly and Neel 1998). Finally, SHP1 has a recognition sequence of (D/E)X(L/I/V)X1–2pYXX(L/I/V), which approximates Gli Y801 with exception to the last amino acid (Appendix 1.1) (O'Reilly and Neel 1998). This sequence is conserved in most arthropods (Appendix 1.1), and it is thus possible that SHP1 could interact with Gli, and should be kept in mind for future experiments. Pull-downs using the remaining 12 constructs were first conducted using the SH2/PTB-GST constructs as prey and NTA-agarose-bound 6xHisGliCtermWT constructs as bait. Interactions could then be confirmed using a reversed pull-down in which the SH2/PTB106  GST constructs were used as bait and the 6xHISGliCtermWT constructs were prey (Experiment outlined in figure 26bi-bii). Referring to figure 26c, SDS-PAGE analysis showed several pulled-down constructs including: Abl-SH2, Grb2-SH2, GapNH2-SH2, IRSI-SH2, CrkSH2, and SrcSH2. There was approximately 8-10x more Src-SH2 bound than 6xHis-GliCterm, causing suspicion that it (and possibly others) may bind non-specifically to the resin. To test this possibility, the pulled-down constructs were incubated with NTA-agarose in the absence of His-GliCterm. All constructs associated with the NTA-agarose, with Src-SH2 showing particularly high affinity (Figure 26d). Due to this background binding, the above-described experiment was repeated using the SH2/PTB-GST constructs as bait and GliCTermWT, GliCermFF, and GliCtermDD as prey. Unfortunately, these repeat experiments failed to show interaction between any of the Gli-Cterm constructs and the SH2/PTB-GST constructs, even when detection sensitivity was increased using Western blot (Data not shown).  107  Table 5: GST-SH2/PTB Constructs for use in 6xHisGliCterm Pull-Down Assays Protein IRS1 GAP SHP2 Abl Nck Vav Crk p85 FynB Grb2 ShcA Lck SHP1 ShcB Src  Domain SH2 N-Terminal SH2 N-Terminal SH2 SH2 SH2 SH2 SH2 N-Terminal SH2 SH2 SH2 PTB SH2 N+Cterm SH2 PTB SH2  Function Adaptor GTPase activator Phosphatase Kinase Adaptor Guanine nucleotide exchange factors Adaptor Kinase Kinase Adaptor Adaptor Kinase Phosphatase Adaptor Kinase  108  Figure 26: Pull-Down Assays to Identify SH2/PTB Domains which may interact with the Intracellular Domain of Gliotactin a) Expression and Purification of 6xHisGliCTerm and GST-SH2/PTB Constructs ii.  6xHisGliCterm Expression and Purification: GliCterm constructs (GliCtermWT shown here), were expressed in BL21DE3 pLys competent cells over a time course of 30min, 1hr, 2hr, 4hrs with 1mM IPTG. Coomassie staining (left) showed a time dependent increase in GliCtermWT expression which was confirmed by Western blot with Rabbit anti-Gli antibodies (center). Western analysis further showed that an expression time between 30min and 1hr would provide maximal expression whilst minimizing protein degradation.  iii.  Puficiation of GST-SH2/PTB Constructs: GST-SH2/PTB constructs were expressed for 1hr with 1mM IPTG then purified using GST-Bind Resin (Novagen). With exception to p85, SHP1 and SHP2, all constructs had robust expression and minimal degradation.  b) Outline of Pull-Down Strategies Left) GliCterm constructs which are His-tagged at their N-termini will bind to NTA-Ni2+ agarose (Qiagen). Should GST-SH2/PTB constructs bind to the Gli intracellular domain, they will be pulled-down with the 6xHisGliCterm constructs. Right) Should an interaction exist, GST-SH2/PTB constructs bound to GST-Bind Resin (Novagen) will pull down 6xHisGliCterm constructs. c) Pull-Downs using 6xHisGliCterm as bait and GST-SH2/PTB constructs as prey GST-SH2/PTB constructs were assayed for pull-down by 6xHisGliCtermWT (similar results seen for 6xHisGliCtermFF and DD). Several constructs were pulled-down including: Src, Abl, Gap, Grb2, Crk and IRSI. d) GST-SH2/PTB Constructs Bind Non-Specifically to NTA-Ni2+ Agarose. Using Vav as a negative control, the GST-SH2/PTB constructs identified in c) were applied to NTA-Ni2+ agarose in the absence of 6xHisGliCterm (only Src shown here). All constructs were found to bind the resin resulting in the strategy described in b)(right) to be employed in lieu of b)(left).  109  Figure 26: Pull-Down Assays to Identify SH2/PTB Domains which may interact with the Intracellular Domain of Gliotactin  110  A2.3 Protein Kinase C does not appear to interact with Gli in vitro Referring to Appendices 1.1 and 1.2, in addition to pY sites, Scansite Motifscan found a conserved PKC recognition site at S838 in the C-terminus of Gli which is highly conserved across arthropods. This site shows highest homology to PKCδ which scores in the top 0.051% of all sites, well within the high stringency parameters (below 0.1%). PKCα/β/γ also potentially recognizes S838, scoring in the medium stringency range (below 1%) at 0.331%. For this reason, while δPKC is the most favorable target, other PKC isoforms were also taken into account for the following experiments. In order to show a possible interaction between PKC and Gli, a similar strategy was employed as was described earlier for Src. PKCδ and DaPKC (equivalent to human PKCι, mouse PKCλ) cDNAs were engineered to contain restriction sites and cloned into pGEMT then pET28. Cloning into pGL2 was not possible due to incompatible restriction sites. Following cloning and sequence confirmation, proteins were expressed using pET28, however, as was seen for the Src constructs, there was little to no expression of the constructs despite extensive troubleshooting for IPTG concentration, time trials and alternate growth media/conditions. For this reason a human GST-PKCδ construct was purchased from Cell Signalling Technologies Inc. for use in kinase and pull-down assays. Kinase assays using PKCδ were conducted in a similar fashion to those done with Src. The main difference was the addition of a lipid activator which consisted of phosphatidylserine, DAG and CaCl2, all of which are required for proper PKC activation. When Western blotted for phosphoserine (pS), no bands were detected following the assay. The anti-pS antibody used, however, did not pick up any pS signal in crude embryo lysates, indicating the possibility this antibody was not effective on this type of sample. Since pS anybodies are known to vary greatly in their effectiveness and this was the only antibody available at the time, these experiments will have to be explored at a later date using different antibodies or an alternate detection method (eg. Radioassays)  111  A2.4 UASVulcanRNAi and UASMagi RNAi Results Reflecting Change in Phenotype UASDicer/UASmCD8GFP; ApGal4/UASRNAi; +/+ lines were generated as discussed in the Results section and as described in Figure 27. While UASMagiRNAi yielded a glial phenotype, the following RNAis did not.  A2.4.1 UASVulcanRNAi and UASMagiRNAis have no effect on Gli or the SJ in Epithelia When UASDicer/UASmCD8GFP; ApGal4/UASRNAi; +/+ mutant discs were compared to control discs, there was no apparent difference in Gli nor Dlg localization (Figure 28). Furthermore, there was no difference in the expression levels of either protein, as indicated by comparison of the ApGAL4 expression zone (marked by mCD8-GFP) to the wt, non-GFP area within mutant discs (Figure 28). It therefore appears that either the UASRNAi insertions were ineffective, or neither gene influences SJ and TCJ development.  112  Figure 27: Mating schemes for generation of UASRNAi lines driven by Repo or ApGAL4  Figure 28: Magi and Vulcan UASRNAis have no effect of SJ or TCJ Development in Epithelia  a) UASDicer/UASmCD8GFP; ApGal4/UASMagiRNAi and UASDicer/UASmCD8GFP; ApGal4/UASVulcanRNAi 3rd instar larval imaginal discs were dissected and stained for Dlg and Gli. There were no obvious morphological defects or changes in protein expression in comparison to controls. b) UASMagiRNAi: When compared to control discs (bottom) and wild-type zones in which no UASRNAi was expressed (indicated absence of mCD8GFP), Gli (blue) concentrated at cell corners as expected, and there was no perceptible difference in Gli nor Dlg (red) expression levels.  c) UASVulcanRNAi: Similar to UASMagiRNAi, no difference was seen between mutant and control discs.  113  Figure 28: Magi and Vulcan UASRNAis have no effect on SJ or TCJ Development in Epithelia a)  114  Figure 28: Magi and Vulcan UASRNAis have no effect on SJ or TCJ Development in Epithelia b)UASMagiRNAi  115  Figure 28: Magi and Vulcan UASRNAis have no effect of SJ or TCJ Development in Epithelia c)UASVulcanRNAi  116  A2.4.2 UASVulcanRNAi has no Glial phenotype UASDicer/+ ; UASmCD8GFP/UASVulcanRNAi; RepoGAL4/+ nerves did not show any obvious morphological defects (Figure 29). Gli and Dlg staining was poor due to background staining of epithelial cells and was therefore omitted. Either way, nerves appeared straight and glia appeared similar to those seen in controls.  Figure 29: UASVulcanRNAi has no effect on glial morphology.  3rd instar larval fillets were compared to control nerves (bottom). UASDicer/+ ; UASmCD8GFP/UASVulcanRNAi; RepoGAL4/+ did not affect nerve morphology. Nerves appear straight and generally uniform with no obvious developmental problems.  117  A2.5 GST-Pull Downs on Membrane Preparations Yield no Novel Interactors In order to determine whether Gli and Dlg form parts of the same complex, Schulte et. al. used GST-GliCtermWT to pull-down complex components from membrane preparations of Drosophila embryos. Due to success identifying Dlg in this manner, it was hypothesized that modification of this method could be used to identify novel interactors. Specifically, pull-downs of membrane proteins could be run on SDS-PAGE gels, stained, then prominent bands could be excised and sent for MS identification. In addition, GSTGliCtermDD, GST-GliCtermFF, and GST-GliCterm∆PDZ (lacks the PDZ binding domain), constructs could be used to select bands which were either phosphorylation- or PDZdependent. The above-described strategy had previously been attempted using GST-GliCtermWT (Que 2006a). These experiments yielded three bands of interest: a doublet at 250kDa, and a single band at 75kDa (Figure 30a)(Que 2006a). The protocol being used at this time required at least three days to complete, and had not yet been optimized. For this reason, there was a great deal of degradation associated with the GST-GliCterm construct resulting in obscuration of all bands below 50kDa. In order to address these issues, preliminary experiments sought to decrease the level of GST-GliCterm degradation through modification of protein expression protocols and reduction of incubation times for both protein expression and pull-down stages. (Que 2006b)  A2.5.1 Expression of GST-Gli Constructs GST-GliCterm constructs were originally being maintained in the E.Coli strain XL-1Blue which is generally used for routine cloning purposes only. For this reason, the constructs were isolated and retransformed into a more appropriate expression strain: BL21DE3pLysS. BL21DE3pLysS is deficient in both the ompT and lon proteases and thus decreases the likelihood of degradation during protein expression. The original protocol for expression of GST-GliCterm used 0.4mM IPTG to induce cultures for 4hrs from an OD600 =0.6-1 (Que, Unpublished Work). In order to refine this procedure, it was first determined whether there was leaky protein expression (prior to IPTG induction) which could be prevented. For Gli, such leakage could cause decreased growth 118  rate due to construct toxicity and accumulation of degradation products resulting from longterm exposure to the bacterial environment. As a preventive measure, 2% glucose is often used to supplement growth media and act as a catabolite repressor. In the absence of glucose, alternate carbon sources (such as glycerol) are used which cause cyclic AMP levels to rise and the subsequent activation of lac promoters (Novagen 2005). The GST-GliCterm constructs are under the control of a tac promoter which is unaffected by catabolite repression, however, the pGEX4T-1 vector also contains a lac promoter upstream of the tac promoter which can affect basal expression levels (AmershamBiosciences). This appeared to be the case with GST-GliCtermWT, as when uninduced cultures were grown overnight in the presence vs absence of 2% glucose, a significant decrease in GliCtermWT basal expression was seen in the presence of glucose(Figure 30b). With growth conditions optimized, it was necessary to determine whether the expression time could be decreased to minimize sustained GST-GliCtermWT exposure to the bacterial environment. To minimize overall experiment time, a minimal cell density (OD600 ~0.6) and a higher amount of IPTG (1mM instead of 0.4mM) was used to induce over a time course of 0, 0.5, 1, 2, and 4hrs. Upon Western blot analysis with anti-Gli antibody, minimal to no leaky expression was seen, confirming the effectiveness of the above described protocol changes (Figure 30c). In addition, it was seen that there was very little increase in protein expression between 0.5-4hrs (Figure 30c). Furthermore, upon probing with anti-GST antibody to detect degradation products which may lack the anti-Gli epitope, it was seen that the majority of degradation products accumulated between 1-4hrs expression time (Figure 30d). For this reason it was determined that 30-45min was optimal for expression of the GSTGliCterm constructs. Overall, the changes made in the bacterial expression stages reduced the overall experiment time by at least 3.5hrs, and likely more due to increased growth speed (less pre-induction toxicity) and induction at lower cell density.  119  Figure 30: Troubleshooting GST-GliCterm Construct Expression to Minimize Protein Degradation  a) Previous Pull-Downs identified bands at 75kDa and 250kDa. There was a high degree of degradation seen associated with GST-GliCtermWT constructs which obscured all bands <50kDa. b) GST-GliCtermWT cultures were grown overnight in the presence or absence of 2% glucose without IPTG induction. As indicated, in the absence of glucose, GliCtermWT constructs were expressed despite lack of inducer. In contrast, in the presence of glucose, there was some expression seen. c) Westerns of GST-GliCtermWT constructs expressed over a time course of 0-4hrs. Anti-Gli antibodies detected very little Gli prior to induction (t=0), while showing no increase in protein expression between 30min-4hrs (top). When detected with antiGST antibodies (bottom) this same lack of increased expression was seen, while also showing minimal degradation between 30min-1hr induction.  a)  b)  c)  120  A2.5.2 Membrane Preparations Prior experiments have struggled to detect Gli in WT fly lysates due to endogenously low protein expression (Schulte 2002). This problem was solved using sucrose gradients to isolate membranes and therefore concentrate Gli and the Gli complex (Schulte 2002). While this method has the advantage of concentrating membrane bound components, it may be disadvantageous for identification of cytosolic complex components which are highly expressed but not necessarily associated with membrane proteins at all times. Crude lysates were tried to overcome this problem, however, their high viscosity resulted in difficulty separating sample from the resin. For this reason, membrane preparations were deemed appropriate for the following experiments.  A2.5.3 Pull-Downs Pull-Downs were conducted as described in the Materials and Methods. Changes made in comparison to previous experiments were as follows. Firstly, the GST-GliCterm constructs were only incubated with the GST-Bind resin for 30min, a reduction from 16hrs (overnight) which was used previously. Secondly, membrane preparations were coincubated with Gli-constructs for 1hr at room temperature instead of for 4hrs at 4degC. This resulted in an overall decrease of 18.5hrs in which degradation could occur. GST-Pull downs were conducted using GST-GliCtermWT, GST-GliCtermDD, GSTGliCtermFF and GST-GliCterm∆PDZ constructs in the presence of 0, 50mM, 150mM, 250mM, 300mM and 500mM NaCl. Lower salt concentrations allow lower affinity interactions to be seen, however, this also results in more non-specific interactions with the resin or GST-tag. Higher salt concentrations remove this background binding, while only leaving the most high affinity interactors in place. Consequently, to identify the largest array of interactors, it is useful to test a range of salt concentrations and compare to a GST control treated in the same manner. Referring to Figure 31, all constructs pulled-down similar bands with similar binding affinities in respect to salt concentration. Unfortunately, all of these bands were seen in the GST control and were therefore judged to be non-specific. As mentioned earlier, previous pull-downs on membrane preparations using GST-GliCtermWT had yielded two potential 121  interactors which were seen as a 70kDa band and a doublet at 250kDa (Figure 30a). As highlighted in Figure 27 (red), a 250kDa doublet was detected in all pull-downs including the GST-control. A 70kDa band (blue) was also seen in all pull-downs which may have been reflective of the 75kDa band previously seen (Figure 31). It should be noted that this band increased in intensity with longer incubation times, perhaps explaining the relative difference in intensity compared to previous data (data not shown). It is mysterious as to why these bands were not seen in previous negative controls. Earlier experiments showed only one band between 37-50kDa in negative controls which was reflected in the more recent pull downs (Que 2006a). Detection previously required transfer by Western blot followed by membrane staining, which may have lost the bands as a result of bubbles etc (Que 2006a). However, with only one blot to refer to and no control for bacterial protein binding, it is difficult to say exactly what caused the differences seen. It is not likely that the protocol changes resulted in more protein binding to controls, as they used far shorter incubation times, warmer temperatures and less GST-GliCterm. Despite the described protocol changes, no novel interactors were found. These changes did not appear to adversely affect protein binding and there was improvement in terms of reduced degradation.  122  Figure 31: GST-GliCterm Pull Downs on Drosophila Membrane Preparations using Buffers of Increasing Ionic Strength Yield no Specific Bands.  GST-Pull Downs were done on adult fly membrane preparations using GST-GliCtermWT, GSTGliCterm∆PDZ, GST-GliCtermDD and GST-GliCtermFF constructs. As indicated in red and blue respectively, a 250kDa doublet and a 70kDa band were seen which are reminiscent of earlier experiments (bottom right). Similar proteins were pulled down for all constructs including the controls when lanes of the same ionic stringency were compared.  123  Association between Gli and Dlg has previously been shown to be Ca2+ dependent, a matter which is largely unexplained at this time (Schulte et al. 2006). Gli may dimerize in a Ca2+-dependent manner similar to Neuroligins, however, this should not affect the ability of a GliCterm construct to bind its partner in GST-pull downs. It is possible, however, that a Ca2+dependent mediator such as activated PKC may facilitate interaction between complex components are therefore require Ca2+ supplementation to maintain these interactions. In order to accommodate this possibility, pull-downs were repeated in 150mM NaCl (medium stringency) and over a range of free Ca2+ concentrations between 0, 0.1µM, 0.5µM, 1µM, 5µM, and 20µM (previous experiments had shown Dlg binding in the presence of 0.1 and 0.2µM free Ca2+)(Schulte et al. 2006). Unfortunately, despite increasing detection limits through silver staining, no bands were seen which could specifically be attributed to the GSTGliCterm constructs (Figure 32). A higher degree of GSTGliCterm degradation was seen than in previous experiments, however, this is likely attributed to the high sensitivity of the silver staining procedure. This experiment was repeated using His-tagged GliCtermWT constructs and yielded similar results (data not shown). It was later found (during PKC pull-downs) that Gli itself sticks to GST resin, possibly explaining the lack of success with GST-constructs, however, continued failure with His-tagged constructs indicates this technique is best used only as a tool to confirm interactions with Western blot, and not to find novel interactors.  124  Figure 32: GST-Pull Downs on Drosophila Adult Membrane Preparations did Not Pull Out any Novel Interactors.  GST-Pull Downs on Drosophila membrane preparations were run on SDS-PAGE gels and Silver Stained for maximal detection. No obvious bands can be seen which could not also been seen in control lanes. The 250kDa doublet is seen again in most lanes, as is the 70kDa band.  125  A2.6 Summary of LC-MS/MS Protein Identifications  Notes: • • •  Protein Functions are all as described in Flybase entry for given FlybaseID (Flybase 2008) Identifications are sorted by both score and category of function Identifications are organized by descending score as follows: o Highlow WT present in WT, UASWT and UASFF samples o Highlow WT present in WT and UASWT samples o Highlow WT present in WT and UASFF samples o Highlow UASWT present in UASWT and UASFF samples o Highlow WT present only in WT samples o Highlow UASWT present only in UASWT samples o Highlow UASFF present only in UASFF samples  126  Flybase ID  FBgn0001987  NAME  Gliotactin Isoform A  Description Establishment of blood‐nerve barrier; Maintenance of imaginal disc‐derived wing hair orientation; Septate junction assembly ; Regulation of tube size, open tracheal system  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  268  2981  3499  42  191  842  301  289  860  207  207  567  73 191 54  161/117 384 192  162 231 93  Metabolism Lipid FBgn0004045 FBgn0004047  Yolk Protein 1 (precursor) Yolk protein 3/Vitellogienin III  FBgn0005391  Yolk protein 2  FBgn0033879 FBgn0028479 FBgn0025352  CG6543 CG4389 Thiolase  sex differentiation; vitellogenesis; lipid 834 metabolic process sex differentiation; vitellogenesis; lipid 504/311 metabolic process sex differentiation; vitellogenesis; oogenesis; 570 lipid metabolic process (putative) fatty acid beta‐oxidation. 267 (putative)fatty acid beta‐oxidation 223 fatty acid beta‐oxidation. 93  FBgn0021765  Scully  acyl‐CoA metabolic process; androgen metabolic process; ecdysone metabolic process; estrogen metabolic process; fatty acid metabolic process; steroid metabolic process  FBgn0010019  Cytochrome P450‐4g1  lipid metabolic process  149  FBgn0043825  CG18284  (putative) lipid metabolic process  81  FBgn0000406  Cytochrome b5‐related fatty acid biosynthetic process  FBgn0035811 TCA Cycle  CG12262  fatty acid beta‐oxidation  FBgn0027291  Probable isocitrate dehydrogenase  (putative) isocitrate dehydrogenase activity  226  596  261  FBgn0038587  CG7998  (putative) L‐malate dehydrogenase activity;  104  146  55  FBgn0000064  Aldolase  66  238  84  FBgn0031912  CG5261  fructose‐bisphosphate aldolase (putative) acetyl‐CoA biosynthetic process from pyruvate  94  82  FBgn0039358  Related to isocitrate dehydrogenase family  FBgn0086133  knockdown  FBgn0038922  CG6439  FBgn0039909  CG1970  FBgn0010100  Aconitase  FBgn0017539  100  69 58  (putative) isocitrate dehydrogenase activity  427  190  citrate (Si)‐synthase activity (putative) isocitrate dehydrogenase (NAD+) activity (putative) NADH dehydrogenase (ubiquinone) activity; aconitate hydratase activity  306  87  265  93  264  196  253  256  Succinyl coenzyme A succinate dehydrogenase (ubiquinone) synthetase flavoprotein activity subunit  221  178  FBgn0010352  Neural conserved at 73EF  67  70  FBgn0037643  CG11963  FBgn0001248  Isocitrate dehydrogenase  oxoglutarate dehydrogenase (succinyl‐ transferring) activity (putative) Succinate‐CoA ligase (ADP‐ forming) activity isocitrate dehydrogenase (NADP+) activity  157  173  117  129  154 81  127 _  Flybase ID FBgn0004888  NAME Succinyl coenzyme A synthetase α subunit  Description ATP citrate synthase activity  Glycolysis/Gluconeogenesis triose‐phosphate FBgn0086355 isomerase FBgn0028325 lethal (1) G0334 Aldehyde FBgn0012036 dehydrogenase Glyceraldehyde 3 FBgn0001092 phosphate dehydrogenase 2 FBgn0000579 Enolase FBgn0039635  (putative) pyruvate metabolic process  FBgn0001091  FBgn0012366  CG11876 Glyceraldehyde 3 phosphate dehydrogenase 1 Glyceraldehyde 3‐ phosphate dehydrogenase 1  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐ 60  triose‐phosphate isomerase activity  100  240  162  pyruvate metabolic process  71  167  106  pyruvate metabolic process  59  176  163  glyceraldehyde‐3‐phosphate dehydrogenase (phosphorylating) activity  101  262  phosphopyruvate hydratase  57  425 327  187  272  119  glyceraldehyde‐3‐phosphate dehydrogenase (phosphorylating) activity  90 143  glucose metabolic process 68 176  FBgn0001128  Glycerol 3 phosphate dehydrogenase  FBgn0037891  CG5214  FBgn0027580  CG1516  FBgn0003178  Pyruvate kinase  FBgn0039737  CG1516  FBgn0003074  Phosphoglucose isomerase  glucose‐6‐phosphate isomerase activity  FBgn0036762  CG7430  (putative) dihydrolipoyl dehydrogenase activity;  FBgn0003071  phosphofructokinase  glycolysis  glycerol‐3‐phosphate metabolic process (putative) dihydrolipoyllysine‐residue succinyltransferase activity (putative) pyruvate metabolic process; gluconeogenesis pyruvate kinase activity (putative) pyruvate metabolic process; gluconeogenesis  162  52  136 133 108 82 69 91  Other  FBgn0000055  ethanol oxidation; behavioral response to ethanol; alcohol metabolic process; SRP‐ Alcohol dehydrogenase dependent cotranslational protein targeting to membrane  FBgn0003462  Superoxide dismutase  FBgn0037607  CG8036  FBgn0023537  CG17896  FBgn0036824  Deoxyuridine triphosphatase CG3902  FBgn0000486  Diphenol oxidase A2  FBgn0052026 FBgn0019960  CG32026 CG6455 Photoreceptor dehydrogenase  FBgn0250837  FBgn0011693  71  removal of superoxide radicals; determination of adult life span; aging; superoxide metabolic process (putative) transketolase activity (putative) pyrimidine base metabolic process; valine metabolic process dUTP metabolic process  285  metabolic process  78  phenol metabolic process; proteolysis; regulation of protein catabolic process  74  metabolic process Unknown phagocytosis, engulfment; metabolic process  233  59  155  159  56  62  50  60  53  57 167 77  128 _  Flybase ID FBgn0023507 Proteolysis Proteasome FBgn0033886 FBgn0028689  NAME CG3835  CG13349 Proteasome p44.5 subunit  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  (putative)FAD binding; oxidoreductase activity  65  proteasome assembly  376  180  endopeptidase activity.  208  59  ATP‐dependent proteolysis; ubiquitin‐ dependent protein catabolic process  118  FBgn0250843  Proteasome 35kD subunit  FBgn0015282  proteolysis; ATP‐dependent proteolysis; ubiquitin‐dependent protein catabolic Proteasome 26S subunit process; cellular process; mitotic spindle subunit 4 ATPase organization and biogenesis; mitotic spindle elongation; cell proliferation; protein catabolic process  116  140  91  100  89  FBgn0250746  Prosβ4  cell proliferation; mitotic spindle elongation; mitotic spindle organization and biogenesis; ATP‐dependent proteolysis; ubiquitin‐ dependent protein catabolic process; cellular process; centrosome organization and biogenesis  FBgn0020369  Pros45  proteolysis; ATP‐dependent proteolysis; ubiquitin‐dependent protein catabolic process; protein catabolic process  FBgn0023175  peripheral nervous system; adult segment; nervous system; organ system; adult; adult Proteasome α7 subunit mesothoracic segment; adult external abdomen; wing hair; metatarsus; thoracic segment  67  67  FBgn0004066  Proteasome 28kD subunit 1  ATP‐dependent proteolysis; ubiquitin‐ dependent protein catabolic process  64  106  67  75  111/106  111 42  Ubiquitin‐Related Activity  FBgn0003943  Ubiquitin‐63E  cellular macromolecule metabolic process; primary metabolic process; biopolymer modification; response to stress; organelle organization and biogenesis; protein modification process; transport; establishment and/or maintenance of chromatin architecture; catabolic process; regulation of metabolic process; cellular process  FBgn0028692  Rpn2  proteolysis  FBgn0028691  Rpn9  proteolysis; regulation of exit from mitosis  93  FBgn0028693  Rpn12  proteolysis; cellular process; mitotic spindle organization and biogenesis; mitotic spindle elongation; cell proliferation  129  FBgn0028688  Rpn7  proteolysis; cellular process  250  75  72 54  129 _  Flybase ID  NAME  FBgn0011230  purity of essence  FBgn0032596  CG17331  FBgn0028690  Rpn5  FBgn0010590  lethal (2) 05070  FBgn0023211  Elongin C  FBgn0000173  Bendless  FBgn0013969 Other  GTP‐Binding‐Protein  Description spermatid development; sperm individualization; perineurial glial growth; ubiquitin cycle cellular process; ubiquitin‐dependent protein catabolic process proteolysis ubiquitin‐dependent protein catabolic process dendrite morphogenesis; ubiquitin‐ dependent protein catabolic process axonogenesis; jump response; axon target recognition; photoreceptor cell morphogenesis; flight behavior; grooming behavior; ubiquitin cycle; protein ubiquitination; regulation of protein metabolic process; post‐translational protein modification protein ubiquitination  FBgn0250814  similar to Cytochrome C mitochondrial electron transport; proteolysis Ubiquinol Reductase (inferred by sequence similarity)  FBgn0250848 FBgn0003357  26‐29kD‐proteinase Jonah 99Ciii  FBgn0020370  tripeptidyl‐peptidase II Proteolysis  FBgn0028684  Tat‐binding protein‐1  FBgn0028687  Rpt  cathepsin K activity serine‐type peptidase activity  proteolysis; cellular process; protein catabolic process proteolysis; cellular process; protein catabolic process  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐ 154 148 143 73 72  68  51  59  265  692  605  228  101  44 78  149 92  159  434/426/ 409 326/80 149  131  FBgn0020381  Death related ced‐ 3/Nedd2‐like protein  apoptotic program; apoptosis; defense response; defense response to Gram‐ negative bacterium; positive regulation of antibacterial peptide biosynthetic process; innate immune response; immune response; sperm individualization; proteolysis  FBgn0028685  Rpt4  proteolysis; protein catabolic process  119  154  FBgn0029093  Cathespin D  autophagic cell death; salivary gland cell autophagic cell death; proteolysis  110  194  FBgn0016983 Smallminded FBgn0039734 Tace Biosynthesis Ribosomal Proteins  proteolysis metalloendopeptidase activity  FBgn0002593  Ribosomal protein LP1  translation; translational elongation.  FBgn0036213  Ribosomal protein L10Ab  FBgn0010411 FBgn0003274  135  71  103 94  278/230  38  108  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis.  238  58  100  166  Ribosomal protein S18  translation; translational initiation; mitotic spindle elongation; mitotic spindle organization and biogenesis  102  84  73  122  Ribosomal protein LP2  translation; translational elongation  915  71  130 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0002622  Ribosomal protein S3  DNA repair; translation; negative regulation of neuron apoptosis  FBgn0032518  Ribosomal protein L24  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  126  FBgn0035422  Ribosomal protein L28  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  228  77  76  FBgn0034138  Ribosomal protein S15  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  62  57  99  FBgn0017579  Ribosomal protein L14  translation; negative regulation of neuron apoptosis; mitotic spindle elongation; mitotic spindle organization and biogenesis  FBgn0003279  Ribosomal protein L4  translation  FBgn0017545  translation; oogenesis; mitotic spindle Ribosomal protein S3A elongation; mitotic spindle organization and biogenesis  FBgn0020910  Ribosomal protein L3  FBgn0011284  177  59 65  195  173  129  225 174/140  88  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  209  103  Ribosomal protein S4  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  186  230  FBgn0014026  Ribosomal protein L7A  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis; ribosome biogenesis and assembly  181  55  FBgn0002607  Ribosomal protein L19  translation; mitotic spindle elongation  166  124  FBgn0039757  Ribosomal protein S7  translation  154  65  FBgn0004922  Ribosomal protein S6  translation; immune response; mitotic spindle elongation; mitotic spindle organization and biogenesis  128  182  FBgn0005593  Ribosomal protein L7  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  118  56  FBgn0026372  Ribosomal protein L23A translation  FBgn0010078  Ribosomal protein L23  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  104  FBgn0000100  Ribosomal protein LP0  translation; DNA repair; translational elongation; ribosome biogenesis and assembly  101  242  FBgn0035753  Ribosomal protein L18  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  97  55  FBgn0028696  Ribosomal protein L37A  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  94  FBgn0024939  Ribosomal protein L8  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  90  108  114  131 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0013325  Ribosomal protein L11  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  86  FBgn0038277  Ribosomal protein S5b  translation  82  FBgn0010412  Ribosomal protein S19a translation  81  75  FBgn0011272  Ribosomal protein L13  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  75  56  FBgn0039359  Ribosomal Protein L27  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  70  FBgn0015756  Ribosomal protein L9  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  69  FBgn0036825  Ribosomal protein L26  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  68  FBgn0028697  Ribosomal protein L15  translation  67  94  FBgn0004403  Ribosomal Protein S14a translation  67  213  translation; protein modification process; ubiquitin‐dependent protein catabolic process; ubiquitin cycle; ATP‐dependent proteolysis; establishment and/or Ribosomal protein S27A maintenance of chromatin architecture; regulation of transcription, DNA‐dependent; response to stress; ribosome biogenesis and assembly  67  FBgn0003942  120  100  FBgn0010265  Ribosomal protein S13  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  64  FBgn0010409  Ribosomal protein L18A  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  58  FBgn0003517  Stubarista  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  56  FBgn0038834  Ribosomal protein S30  mitotic spindle elongation; mitotic spindle organization and biogenesis; translation.  71  FBgn0068078  Dyak\RpL23  structural constituent of ribosome  69  FBgn0005533  Ribosomal Protein S17  translation  59  FBgn0002579  Ribosomal protein L36  translation  57  FBgn0025286  Ribosomal protein L31  translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  53  FBgn0001218  Heat shock 70 kDa protein cognate 3 [Precursor]  sleep; response to heat; RNA interference  270  250  388  450  FBgn0001225  Heat shock protein 26  determination of adult life span; response to heat  167  82  76  367  57  80  76  Heat Shock Proteins  132 _  Flybase ID  NAME  FBgn0001226  Heat shock protein 27  FBgn0015245  Heat shock protein 60  Description determination of adult life span; response to heat; protein refolding response to heat; protein folding; protein refolding; response to stress; 'de novo' protein folding; protein targeting to mitochondrion  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐ 142  211  167  98  Heat shock protein cognate 4  embryonic development via the syncytial blastoderm; axon guidance; axonal fasciculation; nervous system development; neurotransmitter secretion; vesicle‐ mediated transport; protein folding; synaptic vesicle transport; RNA interference  FBgn0001233  Heat shock protein 83  organelle organization and biogenesis; cell cycle; anatomical structure development; cell cycle process; cellular macromolecule metabolic process; response to stress; 282/200/1 transmembrane receptor protein tyrosine 08 kinase signaling pathway; sleep; actin filament‐based process; gamete generation; anterior/posterior axis specification  FBgn0011296  lethal (2) essential for life  embryonic development; response to heat  FBgn0013277  Heat‐shock‐protein‐ 70Ba  heat shock‐mediated polytene chromosome puffing; response to heat  FBgn0001219  FBgn0001216 FBgn0001217 FBgn0001224  Heat shock protein cognate 1 Heat shock protein cognate 2 Heat shock protein 23  538  78  129  304  77  523  604  222  70  123  155/115  protein folding; response to heat  146  protein folding; response to heat  107  response to heat  221  Protein Synthesis FBgn0000556  promotes the GTP‐dependent binding of Elongation factor 1α48D aminoacyl‐tRNA to the A‐site of ribosomes during protein biosynthesis  264  217  FBgn0039562  Glycoprotein 93  protein folding  254  114  FBgn0004432  Cyclophilin 1  protein folding; autophagic cell death; salivary gland cell autophagic cell death.  107  61  FBgn0053303  CG33303  (putative) protein amino acid glycosylation  82  39  FBgn0038145  DnaJ‐like‐2 Glutamyl‐prolyl‐tRNA synthetase CG15100 Aspartyl‐tRNA synthetase  Protein Folding glutamyl‐tRNA aminoacylation; prolyl‐tRNA aminoacylation methionyl‐tRNA aminoacylation  106  FBgn0005674 FBgn0034401 FBgn0002069  117  300 224  66  111  262/222  51  225  137  aspartyl‐tRNA aminoacylation; growth  222  FBgn0028737  Elongation factor 1 β  translational elongation  212  FBgn0023213  eukaryotic translation initiation factor 4G  translational initiation; mitotic spindle elongation; mitotic spindle organization and biogenesis; RNA metabolic process  196  FBgn0015834  Trip1  translational initiation; translation  169  151  133 _  Flybase ID  NAME  Description protein folding; mitotic spindle organization and biogenesis translational elongation protein folding  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0030086  CG7033  FBgn0032198 FBgn0033342  eEF1δ CG8258  FBgn0027093  Arginyl‐tRNA synthetase arginyl‐tRNA aminoacylation  FBgn0037632  Tcp‐1η  protein folding; mitotic spindle organization and biogenesis; protein amino acid phosphorylation  127  FBgn0022023  Eukaryotic initiation factor 3 p40 subunit  translational initiation  120  FBgn0015019  Cctγ  FBgn0031057 FBgn0023212  CG14224 Elongin B Protein disulfide isomerase  FBgn0014002  protein folding; mitotic spindle organization and biogenesis protein modification process protein modification process protein folding; cell redox homeostasis  162  87  140 131  55  128  118 81 80 76  FBgn0013954  FK506‐binding protein 2 protein folding  75  FBgn0037930  CG14715  protein folding  74  FBgn0027084  Lysyl‐tRNA synthetase  lysyl‐tRNA aminoacylation  74  FBgn0025582  Int6 homologue  FBgn0004867 FBgn0010621 FBgn0029176  FBgn0037249  translational initiation; phagocytosis, engulfment String of Pearls translation protein folding; mitotic spindle organization T‐complex Chaperonin 5 and biogenesis translational elongation; autophagic cell Ef1γ death; salivary gland cell autophagic cell death translational initiation; mitotic spindle eIF3‐S10 elongation; mitotic spindle organization and biogenesis  FBgn0021795  Translocon‐associated protein δ  FBgn0038810  Srp72  FBgn0035771  sec63  FBgn0025615  torp4a  protein retention in ER  136  68  155  65  105  63 62  61  60  SRP‐dependent cotranslational protein targeting to membrane protein folding protein folding; chaperone cofactor‐ dependent protein folding  57  55  58  56  FBgn0004925  eIF‐2α  translational initiation; formation of translation initiation ternary complex; mitotic spindle elongation; mitotic spindle organization and biogenesis  FBgn0000559  Elongation factor 2b  translational elongation; translation; mitotic spindle elongation; mitotic spindle organization and biogenesis  104  FBgn0024556  Elongation factor Tu mitochondrial  translational elongation  89  134 _  Flybase ID  FBgn0001942  FBgn0027081 FBgn0015622  NAME  Eukaryotic initiation factor 4a  Threonyl‐tRNA synthetase Calnexin 99A  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  dorsal/ventral axis specification; translational initiation; imaginal disc growth; instar larval development; DNA unwinding during replication; regulation of alternative nuclear mRNA splicing, via spliceosome; mitotic spindle elongation; mitotic spindle organization and biogenesis  63  threonyl‐tRNA aminoacylation  63  protein folding  122  FBgn0086768  Protein‐L‐isoaspartate (D‐aspartate) O‐ methyltransferase  protein repair; protein modification process  84  FBgn0034967  Eukaryotic translation initiation factor 5A  translational initiation; autophagic cell death; salivary gland cell autophagic cell death  80  FBgn0044030  mitochondrial ribosomal translation protein S14  FBgn0022959  ypsilon schachtel  oogenesis; regulation of transcription, DNA‐ dependent  FBgn0040309  Jafrac1/thioredoxin peroxidase 1  cell redox homeostasis  FBgn0027560  Trehalose‐6‐phosphate trehalose biosynthesis synthase 1  75 52  119  Other  FBgn0037146 FBgn0010226  CG7470 Glutathione S transferase S1  FBgn0037245  Growl  FBgn0032393  CG12264  FBgn0019662  qm  FBgn0027571  CG3523  FBgn0020513 ade5 Cytoskeleton/Extracellular Matrix Structural Components FBgn0003887  b‐tubulin (56kDa)  FBgn0003884  Tubulin a‐1 chain  FBgn0003890  β‐Tubulin at 97EF  FBgn0000045  Actin 79B (Larval Muscle)  FBgn0000046  Actin 87E  83  46  51  235  68  proline biosynthetic process  165  67  response to oxidative stress.  122  59  oocyte dorsal/ventral axis determination; folic acid and derivative biosynthetic process iron‐sulfur cluster assembly; alanine biosynthetic process; cysteine metabolic process embryonic heart tube development; germ cell migration; isoprenoid biosynthetic process  188  193  57  55  (putative) fatty‐acid synthase activity  96  'de novo' IMP biosynthetic process  62  Cytoskeleton remodelling; microtubule‐ processes microtubule‐based movement; protein polymerization microtubule‐based movement; protein polymerization  420  629  283  444  344  489  116  224  209  377  Cytoskeleton remodelling  109  540  cytoskeleton organization and biogenesis  325  268  135 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0003888  β‐Tubulin at 60D  axon guidance; axonogenesis; microtubule‐ based process; larval behavior; response to light stimulus; heart development; microtubule‐based movement; protein polymerization  FBgn0000047  Actin 88F  cytoskeleton organization and biogenesis; phagocytosis, engulfment  153  Actin 57B  cytoskeleton organization and biogenesis; cytokinesis; heart development; chondroitin sulfate biosynthetic process; heparan sulfate proteoglycan biosynthetic process; positive regulation of NFAT protein import into nucleus  137  1343  FBgn0250789  α Spectrin  anatomical structure development; synaptic transmission; organelle organization and biogenesis; gamete generation; regulation of cellular component organization and biogenesis; germ‐line cyst formation; regulation of developmental process; cell‐ cell signaling; ovarian follicle cell development; cell adhesion; fusome organization and biogenesis; instar larval development; plasma membrane organization and biogenesis; ovarian nurse cell to oocyte transport  85  2488  FBgn0016404 FBgn0016402 FBgn0000043 Motor Proteins  Actin E2 Actin D1 Actin 42A  Cytoskeleton remodelling Cytoskeleton remodelling Cytoskeleton remodelling  Myosin Heavy Chain (Mhc)  striated muscle contraction; myofibril assembly; muscle cell differentiation; locomotion; muscle contraction; muscle thick filament assembly  zipper (myosin heavy chain‐ non muscle)  anatomical structure development; embryonic development via the syncytial blastoderm; cell motility; muscle cell differentiation; organ morphogenesis; cell division; positive regulation of programmed cell death; gland morphogenesis; epithelial cell differentiation; embryonic development ending in birth or egg hatching; actin filament‐based process; system process  FBgn0000044  FBgn0086783  FBgn0005634  FBgn0004117 FBgn0002772 FBgn0002773  Tropomyosin 2 actin binding; heart development Myosin alkali light chain muscle contraction; mesoderm 1 development; proteolysis Myosin light chain 2  ATPase activity, coupled; microfilament motor activity; calcium ion binding  125/113  570 544 461  2954  193  652  1908  58  107  75  73 107  295  66  56 410  136 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0010349  cell cycle; organelle organization and biogenesis; anatomical structure development; cell cycle process; cellular Dynein heavy chain 64C localization; transport; microtubule‐based movement; fusome organization and biogenesis; RNA localization; gamete generation  FBgn0004687  Myosin light chain cytoplasmic  ATPase activity, coupled; myosin heavy chain binding; myosin binding; cytoskeletal protein binding; calcium ion binding  FBgn0003721  Tropomyosin 1  regulator of motility in muscle and nonmuscle cells  Brahma associated protein 55kD  positive regulation of transcription, DNA‐ dependent; cytokinesis; cytoskeleton organization and biogenesis; dendrite morphogenesis; muscle development; proteolysis  225  FBgn0003514  spaghetti squash  cytokinesis; nuclear axial expansion; ovarian follicle cell development; ovarian nurse cell to oocyte transport; cellularization; border follicle cell migration; establishment of planar polarity; imaginal disc‐derived wing hair organization and biogenesis  110  FBgn0003137  Papilin  extracellular matrix organization and biogenesis  81  Twinstar  anatomical structure development; actin filament‐based process; establishment of planar polarity; cellular macromolecule metabolic process; organelle organization and biogenesis; cell division; organ development; cell motility; cell cycle; cell projection organization and biogenesis  76  Capulet  actin polymerization and/or depolymerization; bristle morphogenesis; regulation of cell shape; actin filament organization; oocyte microtubule cytoskeleton polarization; cell morphogenesis; wing disc dorsal/ventral pattern formation; compound eye development; oogenesis  58  hu li tai shao  organelle organization and biogenesis; gamete generation; fusome organization and biogenesis; anatomical structure development; sexual reproduction; germ‐ line cyst formation; cell proliferation; microtubule cytoskeleton organization and biogenesis; cell division; cell cycle; ovarian nurse cell to oocyte transport; germ cell development  55  202  95  141  566  313  996  Other  FBgn0025716  FBgn0011726  FBgn0028388  FBgn0004873  487  835  137 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  Transport Electron Transport Chain FBgn0010217  proton transport; ATP synthesis coupled ATP‐synthase b‐subunit proton transport (inferred by sequence precursor similarity)  485/414  1336  1088  777  FBgn0003360  Stress‐sensitive B/ADP‐ ATP‐ADP antiporter (inferred by sequence ATP Translocase similarity)  354/304/ 200  911  253  164  FBgn0011211  Bellwether/ ATP‐ synthase a‐subunit  173  1109  728  457  139  170  98  57  71  151  55  145  60  96  111  57  46  FBgn0010516  proton transport; ATP synthesis coupled proton transport (inferred by sequence similarity) (putative) mitochondrial electron transport, CG12079 NADH to ubiquinone proton transport; ATP synthesis coupled ATP synthase, subunit d proton transport (putative) mitochondrial electron transport, CG6020 NADH to ubiquinone walrus electron carrier activity; FAD binding  FBgn0067959  lethal (2) 06225  FBgn0017566  NADH:ubiquinone reductase 75kD subunit ATP synthesis coupled electron transport precursor  FBgn0020235  ATP synthase‐γ chain  FBgn0035032  CG4692  FBgn0038271  CG3731  FBgn0030853  CG5703  FBgn0019644  ATP synthase, subunit b  FBgn0031021  CG12203  FBgn0036568  CG5389  FBgn0032833  CG10664  FBgn0028342  lethal (1) G0230  FBgn0035404 FBgn0016120 FBgn0037001  FBgn0019957 FBgn0031771 FBgn0013675  FBgn0017567  FBgn0035600 FBgn0030718  ATP synthesis coupled proton transport  proton transport; phagocytosis, engulfment; ATP synthesis coupled proton transport proton transport (putative)mitochondrial electron transport, ubiquinol to cytochrome c (putative) mitochondrial electron transport, NADH to ubiquinone  194/184  230  118  174  124  114  66  102  proton transport; phagocytosis, engulfment; ATP synthesis coupled proton transport (putative) NADH dehydrogenase (ubiquinone) activity proton transport; ATP synthesis coupled proton transport mitochondrial electron transport, cytochrome c to oxygen proton transport; ATP synthesis coupled proton transport (inferred from sequence)  NADH:ubiquinone mitochondrial electron transport, NADH to reductase 42kD subunit ubiquinone precursor (putative) mitochondrial electron transport, CG9140 NADH to ubiquinone mitochondrial mitochondrial electron transport, Cytochrome c oxidase cytochrome c to oxygen. subunit II NADH:ubiquinone mitochondrial electron transport, NADH to reductase 23kD subunit ubiquinone. precursor oxidative phosphorylation; mitochondrial CG4769 electron transport, ubiquinol to cytochrome c mitochondrial electron transport, NADH to CG9172 ubiquinone  163  124  89  121  61  89  139  65  56  90 81  94 191  156  169 159 127  98  57  95 76  138 _  Flybase ID  NAME  FBgn0021906  Rieske iron‐sulfur protein  FBgn0034245  CG14482  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  mitochondrial electron transport, ubiquinol to cytochrome c mitochondrial electron transport, ubiquinol to cytochrome c  56 50  65  Nuclear Import/Export  FBgn0000986  FBgn0010332 FBgn0037894  chorion‐containing eggshell formation; protein import into nucleus; NLS‐bearing substrate import into nucleus; protein Female sterile (2) Ketel import into nucleus, docking; actin filament 216 organization; regulation of cell shape; positive regulation of NFAT protein import into nucleus overgrown hematopoietic organs‐ 31 Ranbp9  FBgn0020497  embargoed  FBgn0087013  Karyopherin β 3  FBgn0022213  CAS/CSE1 segregation protein  FBgn0024921  Transportin  FBgn0013756  Megator  protein import into nucleus  165  import into nucleus, docking  133  152  protein export from nucleus; multicellular organismal development; protein transport; 97 nuclear export; protein import into nucleus, docking  97  protein import into nucleus 90/86 protein import into nucleus; protein export from nucleus; apoptosis; phagocytosis, engulfment; positive regulation of NFAT 73 protein import into nucleus; cell proliferation; protein import into nucleus, docking protein import into nucleus; phagocytosis, engulfment; protein import into nucleus, 64 docking spindle assembly; protein import into 59 nucleus  63  88  Other FBgn0087002 FBgn0037913 FBgn0028646 FBgn0037912  transport; Wnt receptor signaling pathway; Retinoid‐ and fatty acid‐ smoothened signaling pathway; lipid binding glycoprotein transport. (putative) fatty acid binding; transporter CG6783 activity aralar1 transport; mitochondrial transport (putative) transmembrane transporter CG6782 activity  437  103  79/77  160  85  43  55  82  82  606  100  FBgn0004551  Calcium‐transporting neuromuscular synaptic transmission; ATPase regulation of sequestering of calcium ion; sarcoplasmic/endoplas calcium ion transport; metabolic process mic reticulum type  398  83  FBgn0031913  CG5958  91  78  FBgn0002564  Larval serum protein 1 γ transport  37  75  FBgn0030672  CG9281  ATPase activity, coupled to transmembrane movement of substances; transporter activity; ATP binding  167  FBgn0015222  Ferritin 1 heavy chain homologue  cellular iron ion homeostasis; iron ion transport  68  (putative) retinal binding; transporter activity  71  139 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0002921  Na pump α subunit  anatomical structure development; open tracheal system development; locomotory behavior; ion transport; transport; behavior; response to abiotic stimulus; regulation of tube architecture, open tracheal system; determination of adult life span; response to mechanical stimulus; embryonic development via the syncytial blastoderm; primary metabolic process; monovalent inorganic cation transport; neuromuscular process; tissue homeostasis; response to temperature stimulus  FBgn0004363  porin  mitochondrial transport; ion transport; anion transport  94  phosphate transport  56  cellular iron ion homeostasis; iron ion transport  50  FBgn0026409 FBgn0015221  Mitochondrial phosphate carrier protein Ferritin 2 light chain homologue  125  202  Signaling kinetochore organization and biogenesis; rhodopsin mediated signaling pathway; metarhodopsin inactivation; protein amino acid phosphorylation; regulation of light‐ activated channel activity; adaptation of rhodopsin mediated signaling; deactivation of rhodopsin mediated signaling; detection of calcium ion; mitotic spindle organization and biogenesis  FBgn0000253  Calmodulin  FBgn0005776  protein amino acid dephosphorylation; Protein phosphatase 2A phagocytosis, engulfment; mitotic spindle at 29B organization and biogenesis  FBgn0020238  14‐3‐3ε  FBgn0004907  FBgn0000116  143  52  160/150  61  Positively regulates Ras‐mediated pathways. Acts downstream or parallel to Raf, but upstream of nuclear factors in Ras signaling.  133  204  14‐3‐3ζ  Required in Raf‐dependent cell proliferation and photoreceptor differentiation during eye development. Acts upstream of Raf and downstream of Ras, and is essential for viability  118  161  Arginine kinase  arginine kinase activity  241  150  205  110  105  140 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0026323  anatomical structure development; immune response; defense response; biopolymer modification; protein modification process; sensory organ development; regulation of TGF‐β activated kinase 1 kinase activity; antibacterial peptide production; programmed cell death; JNK cascade; ommatidial rotation; organ morphogenesis; I‐kappaB kinase/NF‐kappaB cascade  FBgn0010348  protein amino acid ADP‐ribosylation; neurotransmitter secretion; synaptic vesicle ADP ribosylation factor endocytosis; cell adhesion; regulation of cell 79F shape; endosome transport; small GTPase mediated signal transduction  62  FBgn0000150  biopolymer modification; ribonucleoside triphosphate biosynthetic process; protein modification process; phosphorus metabolic process; cellular macromolecule metabolic process; anatomical structure development; pyrimidine ribonucleoside triphosphate biosynthetic process; open tracheal system development; ribonucleotide biosynthetic process; organelle organization and biogenesis; cell cycle; system development; primary metabolic process  53  abnormal wing discs  115  Nucleic Acid Remodelling/Modification synaptic transmission; positive regulation of translation; mRNA metabolic process  FBgn0003031  polyA‐binding protein  FBgn0016687  chromatin remodeling; nucleosome Nucleosome remodeling mobilization; transcription; ecdysone factor ‐ 38kD receptor‐mediated signaling pathway; phosphate metabolic process  68  64  158  49  47  297  FBgn0086897  Squid  gamete generation; anterior/posterior axis specification; anatomical structure development; oocyte axis determination; nucleocytoplasmic transport; mRNA metabolic process; oocyte anterior/posterior axis determination; transport; regulation of metabolic process; intracellular mRNA localization  FBgn0000171  belle  spermatid development; instar larval development; spermatogenesis; RNA interference; oogenesis  149  372  FBgn0011638 FBgn0040075  La autoantigen‐like Reptin  RNA processing Chromatin Silencing  112 105  140  203  141 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0028577  poly U binding factor 68kD  nuclear mRNA splicing, via spliceosome; alternative nuclear mRNA splicing, via spliceosome; cystoblast division; mRNA splice site selection; regulation of alternative nuclear mRNA splicing, via spliceosome; regulation of cell cycle  FBgn0036641  survival motor neuron  spliceosome assembly  98  FBgn0010438  mitochondrial single stranded DNA‐binding protein  mitochondrial genome maintenance; DNA replication  89  FBgn0003607  Suppressor of variegation 205  establishment of chromatin silencing; chromatin silencing; chromatin silencing at centromere; negative regulation of transcription, DNA‐dependent; positive regulation of transcription, DNA‐dependent; telomere maintenance; chromosome organization and biogenesis; regulation of histone methylation; regulation of transcription; regulation of apoptosis  75  FBgn0086904  Nascent polypeptide associated complex protein alpha subunit  regulation of pole plasm oskar mRNA localization; oogenesis  71  FBgn0003261  Rm62  RNA interference; antimicrobial humoral response; regulation of alternative nuclear mRNA splicing, via spliceosome  63  FBgn0010083  nuclear mRNA splicing, via spliceosome; RNA Small ribonucleoprotein metabolic process; mitotic spindle particle protein B organization and biogenesis  60  FBgn0002783  Moira  chromatin remodeling; positive regulation of transcription, DNA‐dependent; oogenesis  59  Nucleosome Assembly Protein 1 CG31938 Nucleoplasmin  nucleosome assembly; regulation of transcription, DNA‐dependent rRNA processing nucleosome positioning  FBgn0040108  La Related protein  centrosome separation; mitotic chromosome condensation; autophagic cell death; salivary gland cell autophagic cell death; spindle assembly  171  FBgn0037025  Spc105‐related  mitotic spindle organization and biogenesis  150  FBgn0039857  Ribosomal protein L6  mitotic spindle elongation; mitotic spindle organization and biogenesis; translation  97  64  γ‐Tubulin at 37C  microtubule‐based process; protein polymerization  90  91  FBgn0015268 FBgn0051938 FBgn0016685 Cell Cycle  FBgn0010097  101  142  56  94  56 72  94  142 _  Flybase ID  NAME  Description  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐  FBgn0026430  gamma‐tubulin ring protein 84  microtubule nucleation; microtubule‐based process; regulation of cell cycle; centrosome organization and biogenesis; mitotic spindle organization and biogenesis  69  FBgn0003268  Rough Deal  mitotic cell cycle spindle assembly checkpoint; mitotic sister chromatid segregation  56  Clathrin Heavy Chain  sperm individualization; neurotransmitter secretion; synaptic vesicle coating; intracellular protein transport; protein complex assembly; vesicle‐mediated transport.  426  61  Clathrin Light Chain  neurotransmitter secretion; neurotransmitter transport; synaptic vesicle coating; intracellular protein transport; protein complex assembly  100  59  FBgn0025725  α‐coatomer protein  retrograde vesicle‐mediated transport, Golgi to ER; vesicle‐mediated transport; phagocytosis, engulfment; intracellular protein transport  141  FBgn0027496  εCOP  vesicle transport golgi to ER  125  FBgn0008635  β‐coatomer protein  retrograde vesicle‐mediated transport, Golgi to ER; phagocytosis, engulfment; intracellular protein transport  73  FBgn0037874  Translationally controlled tumor protein  positive regulation of multicellular organism growth; positive regulation of cell size.  85  103  FBgn0033902  Tango7/Transport and Golgi organization 7 A  Golgi organization and biogenesis  145  53  FBgn0020908  Sarcoplasmic calcium‐ binding protein 1  calcium ion binding  249  114  FBgn0034497  Dsec\GM19795  mitochondrial carrier (inferred by sequence)  203  77  FBgn0000639  Fat body protein 1  storage protein; import into fat body  138  402 (315)  FBgn0029990 FBgn0031098 FBgn0077997 FBgn0037149  CG2233 CG17068 GA17988 CG14561  67  66  FBgn0001090  bangles and beads  FBgn0020279 FBgn0034118 FBgn0051363  lingering Nup62 Jupiter IGF‐II mRNA‐binding protein RfC3 CG2185 CG11999 aluminum tubes  unknown protein binding unknown unknown multicellular organismal development; gliogenesis copulation phagocytosis, engulfment unknown  53  Vesicle Trafficking  FBgn0000319  FBgn0024814  178  67  Other  FBgn0030235 FBgn0032244 FBgn0037358 FBgn0037312 FBgn0038535  145  295 271 218 138/99 134 119 102  119 90  unknown  96  69  DNA replication calcium ion binding unknown unknown  95 91 90 90  143 _  Flybase ID FBgn0259682 FBgn0027568 FBgn0035257 FBgn0030520 FBgn0050185 FBgn0039959  NAME  Description  CG42351 CG5366 CG12011 CG10990 CG30185 CG17514  unknown unknown unknown unknown unknown unknown  FBgn0004169  upheld  mesoderm development; myofibril assembly; sarcomere organization; mitochondrion organization and biogenesis; cellular calcium ion homeostasis; muscle maintenance; muscle thin filament assembly  FBgn0004507  Glycogen phosphorylase glycogen catabolic process  FBgn0003378 FBgn0030307  Salivary gland secretion puparial adhesion 8 CG33235 unknown  FBgn0000261  Catalase  FBgn0052631 FBgn0030105 FBgn0043841  CG32631 CG15369 virus‐induced RNA 1 Signal sequence receptor β Nipsnap CG14500 Putative Achaete Scute Target 1  FBgn0011016 FBgn0030724 FBgn0034318 FBgn0016693  _______Individual Ion Score_______ WT UASWT UASFF IgG ‐‐‐ 82 81 78 65 61 56  133  63  105  85 72 62  response to hydrogen peroxide; aging; determination of adult life span; calcium‐ dependent cell‐cell adhesion; response to oxidative stress  126  Unknown unknown defense response to virus  123 80 63  protein retention in ER  69  unknown unknown  70 73  Endocytosis  56  144 _  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067152/manifest

Comment

Related Items