UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Screening, characterization and inhibition of viral cysteine proteinases Huitema , Carly 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_spring_huitema_carly.pdf [ 4.23MB ]
Metadata
JSON: 24-1.0067069.json
JSON-LD: 24-1.0067069-ld.json
RDF/XML (Pretty): 24-1.0067069-rdf.xml
RDF/JSON: 24-1.0067069-rdf.json
Turtle: 24-1.0067069-turtle.txt
N-Triples: 24-1.0067069-rdf-ntriples.txt
Original Record: 24-1.0067069-source.json
Full Text
24-1.0067069-fulltext.txt
Citation
24-1.0067069.ris

Full Text

 SCREENING, CHARACTERIZATION AND INHIBITION OF VIRAL CYSTEINE PROTEINASES  by  CARLY HUITEMA B.Sc., The University of Guelph, 2002  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) MARCH 2009  © CARLY HUITEMA, 2009  ii Abstract 3C proteinases (3Cpros) are a family of essential cysteine proteinases found in various viruses of medical and agricultural significance.  Three lines of research related to the characterization of 3Cpros were pursued.  In the first, biological selections and screens were developed to evaluate proteinase activity in a high-throughput fashion.  A selection system based on the cleavage of an engineered transcriptional regulator, XylR, by hepatitis A virus (HAV) 3Cpro failed.  However, this strategy facilitated the development of a screen based on the cleavage of fused green fluorescent protein variants, CyPet and YPet.  The screen was used to demonstrate that HAV 3Cpro prefers Ile, Val or Leu at the P4 position of the cleavage sequence, and Gly, Ser or Ala at the P1’ position. In the second project, the 3Cpro from Israeli acute paralysis virus (IAPV), a dicistrovirus, was investigated.  IAPV has been associated with the recent colony collapse disorder afflicting commercial hives.  A portion of the replicase including 3Cpro was heterologously produced.  The resulting autoprocessed fragments were analyzed using mass spectrometry to identify the 3Cpro cleavage sequence PIVIE/AQT.  This cleavage sequence likely occurs between the 3A/3B proteins of the polypeptide and is the first within the replicase to be described in this family of viruses. Thirdly, inhibitors of HAV 3Cpro and SARS 3CLpro were developed.  The keto- glutamine analogue (HIP2-171-2) competitively inhibited SARS 3CLpro with a Kic = 0.17 ± 0.03 µM and is among the most potent peptide inhibitors developed against this proteinase.  The azapeptide epoxide (APE) KAE-3-91 irreversibly inhibited SARS 3CLpro with a kinact/Ki of 1900 ± 400 M−1s−1, which is similar in magnitude to that of the first  iii generation APE’s produced to inhibit caspases.  Finally, both SARS 3CLpro and HAV 3Cpro were screened against a library of inhibitory halopyridinyl esters.  Each of three halopyridinyl esters inhibited 3Cpro with apparent Kic’s of 120-240 nM.  However, further study revealed that the inhibitors were slowly hydrolyzed by both proteinases. Overall, the described screens and inhibitors should facilitate the further characterization of 3C and related proteinases as well as the development of novel antivirals.  iv Table of Contents Abstract ............................................................................................................................... ii Table of Contents............................................................................................................... iv List of Tables ................................................................................................................... viii List of Figures .................................................................................................................... ix Abbreviations.................................................................................................................... xii Preface.............................................................................................................................. xiii Acknowledgements........................................................................................................... xv Dedication ........................................................................................................................ xvi CHAPTER ONE: INTRODUCTION..................................................................................1 1.1 Viruses .......................................................................................................................3 1.1.1 Picornavirales ...................................................................................................4 1.1.1.1 Picornaviridae .........................................................................................4 1.1.1.2 Dicistroviridae .........................................................................................6 1.1.2 Coronaviridae....................................................................................................7 1.2 Viral proteinases ........................................................................................................9 1.2.1 The HAV 3C proteinase ..................................................................................13 1.2.1.1 Structure of HAV 3C .............................................................................13 1.2.1.2 Specificity of HAV 3C ..........................................................................17 1.2.1.3 Substrate binding ...................................................................................18 1.2.1.4 Catalytic mechanism..............................................................................20 1.2.2 The SARS 3CL proteinase ..............................................................................21 1.3 Inhibitors of HAV 3Cpro...........................................................................................22 1.4 Directed evolution, biological screening and selection ...........................................25 1.4.1 The XylR transcription factor..........................................................................28 1.4.2 CFP and YFP FRETing substrates ..................................................................30 1.5 Aims of this study....................................................................................................33 CHAPTER TWO: MATERIALS AND METHODS ........................................................35 2.1 Sequence alignment .................................................................................................35 2.2 Phylogenetic analysis...............................................................................................35 2.3 Chemicals.................................................................................................................36 2.4 Bacterial strains, plasmids and growth conditions...................................................39 2.4.1 Transformation and conjugation......................................................................42 2.5 Protein purification ..................................................................................................43 2.5.1 Production and purification of HAV 3Cpro ......................................................44 2.5.2 Production and purification of SARS 3CLpro ..................................................45 2.5.3 Production of fluorescent proteins expressed from pBAD24..........................46 2.5.4 Production of ht-YPet......................................................................................47 2.5.5 Purification of polyhistadine-tagged fluorescent proteins...............................47 2.5.6 Production and purification of IAPV proteinase and replicase .......................48 2.6 Construction of the biological selection system ......................................................49 2.6.1 Creation of biological selection host ...............................................................49  v 2.6.2 Construction of XylR-based substrates and controls.......................................50 2.6.2.1 Creation of plasmid pBAD24X .............................................................50 2.6.2.2 Cloning the xylR gene ............................................................................50 2.6.2.3 Cloning of the XylR-based substrate mxr1............................................51 2.6.2.4 Creation of truncated XylR controls ......................................................52 2.6.3 Cloning of HAV 3Cpro encoding plasmids used for biological selection........52 2.6.3.1 Cloning of the HAV 3Cpro gene .............................................................52 2.7 Testing the E. coli PuCm biological selection system.............................................53 2.7.1 Confirming XylR inducible survival of a E. coli PuCm selection strain ........53 2.7.2 Testing cleavage of MXR1 substrate in vivo and in vitro by SDS-PAGE. .....54 2.7.3 Tests of biological selection system in E. coli PuCm. ....................................55 2.8 Testing the biological selection system with the PuLacZ screening system. ..........55 2.8.1 Miller (β-galactosidase) assay .........................................................................56 2.9 Construction of fluorescent protein screening system using CFP and YFP ............57 2.9.1 Cloning of yfp, and polyhistadine-tag encoded yfp ........................................57 2.9.2 Cloning of cfp and variants..............................................................................58 2.9.3 Construction linked or co-expressed CPF/YFP substrates..............................58 2.9.4 Construction of polyhistadine-tagged CFP/YFP substrates ............................59 2.10 Construction of fluorescent protein screening system using CyPet and YPet.......59 2.10.1 Cloning genes for polyhistadine-tagged CyPet and Ypet in pBAD24X .......60 2.10.2 Construction of co-expressed CyPet/YPet substrates....................................60 2.10.3 Construction of linked CyPet/YPet substrates. .............................................60 2.11 Testing biological screen based on CFP and YFP or CyPet and YPet ..................61 2.11.1 Native-PAGE of cells expressing fluorescent proteins .................................61 2.11.2 Measuring fluorescent protein cleavage using fluorescent plate reader and fluorimeter.................................................................................................62 2.11.3 Testing in vivo cleavage of CYFP-based substrates......................................63 2.11.4 Time course of cleavage of fusion proteins by co-expressed HAV 3Cpro .....64 2.11.5 Detection of cleavage of CYFP-based substrates in single colonies.............65 2.11.6 In vitro cleavage of purified CYFP-1 ............................................................65 2.11.7 Comparing CFP/YFP based substrates with CyPet/YPet substrates by native-PAGE....................................................................................................65 2.11.8 Culture age dependence of the F477/F527 value ..............................................66 2.11.9 Dependence of fusion protein cleavage on linker length ..............................67 2.11.10 Testing the biological screening system in liquid cultures..........................67 2.11.11 Maintaining the F477/F527 value following overnight expression ................68 2.11.12 Testing the biological screening system in 96-well plates ..........................69 2.11.13 Use of exogenously added proteinase in plate-based assays.......................69 2.12 Screening the specificity of HAV 3Cpro.................................................................70 2.12.1 Calculation of library size .............................................................................70 2.12.2 Construction of library ..................................................................................71 2.12.3 Screening of fusion protein library................................................................71 2.12.4 Kinetic characterization of substrates selected from the P1’ HAV 3Cpro screen ...............................................................................................................72 2.13 The replicase of IAPV ...........................................................................................73  vi 2.13.1 Cloning portions of the IAPV replicase ........................................................73 2.13.2 Characterization of the purified replicase fragment ......................................73 2.14 Inhibitor studies of HAV 3Cpro and SARS 3CLpro.................................................74 2.14.1 Standard reaction conditions for measuring HAV 3Cpro, SARS 3CLpro and IAPV 3Cpro activity ...................................................................................74 2.14.2 Proteinase specificity of SARS 3CLpro inhibitors from the Maybridge library...............................................................................................................75 2.14.3 Competitive inhibitors of SARS 3CLpro (HIP2-171-2 and MAC-5576) .......77 2.14.4 Irreversible aza-peptide epoxide inhibition of SARS 3CLpro ........................78 2.14.5 Pyridinyl inhibitor library screening of HAV 3Cpro ......................................79 2.14.5.1 Pyridinyl ester hydrolysis assay as measured by HPLC......................79 2.14.5.2 Mass spectrometry of HAV 3Cpro: prydinyl-ester enzyme-inhibitor complex...................................................................................................80 CHAPTER THREE: RESULTS ........................................................................................81 3.1 Results of phylogenic analysis.................................................................................81 3.2 XylR-based biological selection and screening systems .........................................81 3.2.1 Creation of selection host E. coli PuCm..........................................................82 3.2.2 Cleavage of MXR1 in whole cells and cell extracts........................................83 3.2.3 Activity of produced substrate and proteinase in E. coli PuCm......................86 3.2.4 Activity of truncated XylR produced from pBAD24 in E.coli PuCm ............87 3.2.5 The role of the xylR promoter in the biological selection...............................90 3.2.6 Evaluation of the biological selection system using pFH2 .............................90 3.2.7 A LacZ-based screen for proteinase activity ...................................................91 3.3 A FRET-based screen for proteinase activity ..........................................................94 3.3.1 In vivo cleavage of CFP - YFP fusion substrates ............................................94 3.3.2 Time-dependence of proteolytic cleavage of fluorescent substrates ...............98 3.3.3 Detection of fusion protein cleavage in single colonies ..................................99 3.3.4 Cleavage of purified ht-CYFP-1. ..................................................................101 3.3.5 Development of the screen using CyPet and YPet ........................................102 3.3.6 Dependence of fusion protein cleavage on linker length ..............................104 3.3.7 Dependence of fluorescent signals on culture age ........................................105 3.3.8 Cleavage of CyPet/YPet fusion proteins in vivo ...........................................107 3.3.9 Maintenance of the fluorescence signal following overnight expression .....108 3.3.10 Adaptation of the CyPet/YPet screen to 96-well plates ..............................111 3.4 Use of exogenously added proteinase in plate-based assays .................................115 3.4.1 Detecting in vitro cleavage of fusion substrate in cell lysates.......................116 3.4.2 Optimizing the concentration of HAV 3Cpro for the in vitro screen..............117 3.5 Screening for the preference of HAV 3Cpro ...........................................................120 3.5.1 Screening of the P4 position library...............................................................120 3.5.2 Screening of the P1’ library...........................................................................123 3.5.3 Kinetic characterization of cleavage of P1’ position substrates.....................124 3.6 The replicase of Israeli acute paralysis virus (IAPV) ............................................125 3.6.1 Expression and solubility of IAPV 3Cpro.......................................................126 3.6.2 Sequence in the IAPV replicase cleaved by the IAPV 3Cpro.........................128  vii 3.7 Inhibitor studies .....................................................................................................132 3.7.1 Proteinase specificity of inhibitors of SARS 3CLpro identified in a high- throughput screen...........................................................................................133 3.7.2 Inhibitors of SARS 3CLpro.............................................................................134 3.7.3 Screening inhibition of HAV 3Cpro with a library of pyridinyl esters...........138 3.7.4 Measuring hydrolysis of pyridinyl ester inhibitors of HAV 3Cpro ................148 3.7.5 MS analyses of a pyridinyl ester inhibitor:HAV 3Cpro complex...................150 CHAPTER FOUR: DISCUSSION..................................................................................151 4.1 XylR-based selection of HAV 3Cpro ......................................................................151 4.2 Screening HAV 3Cpro specificity with fluorescent protein substrate ....................156 4.2.1 HAV 3Cpro specificity....................................................................................160 4.3 Additional insights into 3C proteinase functioning ...............................................163 4.4 The IAPV 3Cpro......................................................................................................165 4.5 Inhibitors of HAV 3Cpro and SARS 3CLpro ...........................................................168 4.6 Concluding remarks ...............................................................................................177 REFERENCES ................................................................................................................180   viii  List of Tables Table 1: IC50’s of potent inhibitors of SARS 3CLpro identified from a 50,000 small molecule library screen against SARS 3CLpro [60, 61]. ........................................... 25 Table 2: Oligonucleotides used in this study. ................................................................... 37 Table 3: Strains used in this study. ................................................................................... 39 Table 4: Plasmids used in this study. ................................................................................ 40 Table 5: Oligonucleotides and templates used to construct cfp-containing plasmids. ..... 58 Table 6: Oligonucleotides used to construct genes encoding linked CyPet-YPet fusion proteins...................................................................................................................... 61 Table 7: Testing growth of pUTel-PuCm exconjugants in developing a biological selection host............................................................................................................. 83 Table 8: Growth of the biological selection straina at various dilutions when transformed with plasmids encoding the cleavable transcriptional activator and the proteinase. ........................................................................................................... 87 Table 9: Performance of the biological selection straina with truncated XylR................. 90 Table 10: Performance of the biological selection straina containing the cleavable transcription activator and the proteinase. ................................................................ 91 Table 11:  Relative cleavage efficiencies of HAV 3Cpro for CyPet-YPet fusion substrates................................................................................................................. 105 Table 12: Relative rates of cleavage of fusion proteins by HAV 3Cpro. ......................... 125 Table 13: Peptides identified in the purified GST-IsReplicase fragment using LCMS/MS............................................................................................................... 131 Table 14:  IC50 values of novel SARS 3CLpro inhibitors. ............................................... 134 Table 15: Percentage of inhibition of HAV 3Cpro for preliminary analysis of inhibitor library at various concentrations of inhibitors. ....................................................... 140 Table 16:  Kinetic parameters of a series of pyridinyl analog inhibitors of HAV 3Cpro and SARS 3CLpro and half-life of pyridinyl analogues in buffer. ........................... 147 Table 17: Cleavage sequences of the IAPV structural proteins (from [21])................... 167 Cleavage sequences ........................................................................................................ 167  ix List of Figures Figure 1: Schematics of genomic organization for a) picornavirus, b) dicistrovirus and c) coronavirus.............................................................................................................. 5 Figure 2: Proposed evolutionary scenario for class I (+)ssRNA viruses .......................... 10 Figure 3: Alignment of 3Cpro and truncated 3CLpro amino acid sequences ...................... 11 Figure 4: Dendrogram of 3Cpro and truncated 3CLpro ....................................................... 12 Figure 5: The HAV 3C proteinase (PDB : 2CXV) ........................................................... 16 Figure 6: Schematic representation of peptide hydrolysis by the cysteine proteinase papain ........................................................................................................................ 20 Figure 7: Various forms of XylR and their ability to activate transcription..................... 29 Figure 8: An engineered polyprotein proteinase substrate whose cleavage can be monitored by FRET .................................................................................................. 32 Figure 9: 3Cpro-dependent cleavage of MXR1 in whole cells .......................................... 85 Figure 10: Time-dependent cleavage of MXR1 in cell extracts with exogenously added HAV 3Cpro. ..................................................................................................... 86 Figure 11: Truncated and full length forms of XylR ........................................................ 89 Figure 12: Performance of biological screening strain containing cleavable transcription activator and proteinase ....................................................................... 93 Figure 13: FRET analysis of 3Cpro-dependent cleavage of the CYFP fusion substrates .. 96 Figure 14: Native gel analysis of 3Cpro-dependent cleavage of CFP-YFP fusion substrates................................................................................................................... 97 Figure 15:  Time-dependent cleavage of CFP-YFP fusion substrates by HAV 3Cpro in vivo ............................................................................................................................ 99 Figure 16:  Single colony analysis of the in vivo cleavage of CFP-YFP fusion substrates by HAV 3Cpro ......................................................................................... 101 Figure 17:  Time-dependent cleavage of a purified CFP-YFP substrate by HAV 3Cpro 102 Figure 18:  Comparison of the fluorescent proteins CFP and YFP vs. ht-CyPet and ht- YPet and their derived fusion substrates by native-PAGE ..................................... 104  x Figure 19:  Culture age dependence of the F477/F527 value for linked and co-expressed ht-CyPet and YPet fluorescent proteins produced .................................................. 106 Figure 20:  Dependence of F477/F527 value on cell density ............................................. 107 Figure 21:  Cleavage of the fluorescent protein substrate by co-expressed HAV 3Cpro. 108 Figure 22:  Time dependence of F477/F527 values of cells expressing cleavable and uncleavable substrates............................................................................................. 110 Figure 23:  Dependence of F477/F527 on cell density ....................................................... 113 Figure 24:  Detection of in vivo cleavage of fusion proteins in 96-well plate grown cells ......................................................................................................................... 114 Figure 25:  Native-PAGE analysis of plate-grown cells containing fluorescent proteins.................................................................................................................... 115 Figure 26:  Progress curves following the addition of purified HAV 3Cpro to cleared lysates of cells expressing fusion proteins .............................................................. 117 Figure 27:  The dependence of cleavage rates of ht-CyY-1 on HAV 3Cpro and substrate concentrations .......................................................................................... 119 Figure 28:  Screening of the P4 library for cleavage by HAV 3Cpro .............................. 122 Figure 29:  Rate of change in FRET signal /YPet signal for selected clones from the HAV 3Cpro screen of cleared lysates of the P4 library............................................ 123 Figure 30:  Rate of FRET signal change/YPet signal for selected clones from the HAV 3Cpro screen of the CyPet-YPet P1’ library................................................... 124 Figure 31: Prediction of IAV 3Cpro termini. ................................................................... 126 Figure 32:  Analysis of IAPV GST-tagged 3Cpro expression ......................................... 128 Figure 33:  SDS-PAGE analysis of purified Frag45....................................................... 130 Figure 34:  Peptides of the purified replicase fragment. ................................................. 130 Figure 35:  Fragmentation spectra of peptides A) TPIVIE and B) VCLVHNDDR from LC-MS/MS analysis of Frag45. ..................................................................... 132 Figure 36:  Dixon-plot of steady-state analysis of reversible inhibitors of SARS 3CLpro ...................................................................................................................... 136  xi Figure 37: The steady-state kinetics of covalent inhibitor KAE-3-91 (structure shown in figure) tested with SARS 3CLpro............................................................................. 138 Figure 38:  Hydrolysis of ZJM-2-172 by HAV 3Cpro.  The reaction mixture contained 50 µM inhibitor and 2 µM 3Cpro ............................................................................. 149 Figure 39: (A) Mass spectrum of wild type HAV 3Cpro (M+ 23875.08 Da). (B) Mass spectrum of the complex of 3Cpro and inhibitor ZJM-2-172 following 2 minutes incubation (M+ 23974.38 Da)................................................................................. 150 Figure 40. Relative specificity of HAV 3Cpro for cleavage sequences differing in the identity of their P1’ residue ..................................................................................... 162 Figure 41: Stereo view of the surface of the S4- and S1’-binding pockets of HAV 3Cpro showing amino acids lining the pockets and the active-site Cys172............. 163 Figure 42: Structure of the most potent halopyridinyl ester inhibitor of SARS 3CLpro identified by Ghosh et al. [147] .............................................................................. 171 Figure 43: Possible prehydrolysis-binding modes of ZJM-2-172 to (a) HAV 3Cpro and (b) SARS 3CLpro ..................................................................................................... 174 Figure 44: Binding of APE (orange) in the substrate-binding regions of SARS 3CLpro 176   xii Abbreviations HIV Human immunodeficiency virus DNA Deoxyribonucleic acid HAV Hepatitis A virus RNA Ribonucleic acid IAPV Israeli acute paralysis virus SARS Severe acute respiratory syndrome VPg Viral protein, genome-linked ssRNA Single stranded RNA Hel Helicase RdRp RNA-dependent RNA-polymerase PV Poliovirus FMDV Foot and mouth disease virus HRV Human rhinovirus TSV Taura syndrome virus CCD Colony collapse disorder ORF Open reading frame IFV Infectious flacherie virus ICTV International Committee on Taxonomy of Viruses NMR Nuclear magnetic resonance TEV Tobacco etch virus PCR Polymerase chain reaction StEP Staggered extension process RACHITT Random chimeragenesis on transient templates CFP Cyan fluorescent protein YFP Yellow fluorescent protein ATP Adenosine triphosphate GFP Green fluorescent protein FRET Föster resonance energy transfer FACS Fluorescence activated cell sorting NS3pro Nonstructural 3 proteinase NAPS Nucleic acid protein service unit UBC University of British Columbia LB Luria Bertani SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis IPTG Isopropyl β-D-1-thiogalactopyranoside EDTA Ethylenediaminetetraacetic acid DTT Dithiothreitol CV Column volumes PBS Phosphate buffered saline 3-MBA 3-methyl-benzyl-alcohol IMAC Immobilized Metal Affinity Chromatography SDS Sodium Dodecyl Sulfate ONPG Ortho-Nitrophenyl-β-galactoside OD Optical density GST Glutathione S-transferase APE Aza-peptide epoxide HPLC High performance liquid chromatography MALDI-TOF Matrix-assisted laser desorption/ionization-time of flight IC50 Inhibitory concentration (50%) t-PA tissue-type plasminogen activator  xiii Preface Parts of this work have been published in refereed journals.  Manuscripts concerning other parts of this thesis are presently in preparation and will be submitted shortly for publication. The screen of the 50 000 compound Maybridge inhibitor library against SARS 3CLpro was performed with collaborators at McMaster University and was published in Chemical Biology (Blanchard, J. E., Elowe, N. H., Huitema, C., Fortin, P. D., Cechetto, J. D., Eltis, L. D. and Brown, E. D. (2004). "High-throughput screening identifies inhibitors of the SARS coronavirus main proteinase." Chem Biol 11(10): 1445-53). Characterization of the APE inhibitor KAE-3-91 against HAV 3Cpro was done with collaborators at the University of Alberta and the Georgia Institute of Technology. Results of this kinetic analysis as well as supporting x-ray crystallographic data was published in the Journal of Molecular Biology (Lee, T. W., Cherney, M. M., Huitema, C., Liu, J., James, K. E., Powers, J. C., Eltis, L. D. and James, M. N. (2005). "Crystal structures of the main peptidase from the SARS coronavirus inhibited by a substrate-like aza-peptide epoxide." J Mol Biol 353(5): 1137-51). The library of 82 pyridinyl esters based on the pyridinyl ester MAC-5576 which resulted in the initial characterization as competitive inhibitors of HAV 3Cpro with Kic’s of 120-240 nM by three inhibitors.  Further study revealed that the inhibitors were slowly hydrolyzed by the proteinase.  These experiments were done with collaborators at the University of Alberta and the results were published in the journal Bioorganic and Medicinal Chemistry (Huitema, C., Zhang, J., Yin, J., James, M. N., Vederas, J. C. and  xiv Eltis, L. D. (2008). "Heteroaromatic ester inhibitors of hepatitis A virus 3C proteinase: Evaluation of mode of action." Bioorg Med Chem 16(10): 5761-77). The fluorescent protein screen which was used to evaluate the specificity of the HAV 3Cpro will be part of a manuscript that will be submitted shortly.  xv Acknowledgements I would like to acknowledge with gratitude the expertise and mentorship of my supervisor Dr. Lindsay Eltis.  I appreciate his vast knowledge and skill and the effort he placed in all the small details that makes good work great.  I would like to thank members of my committe, Dr. Michael Murphy, Dr. François Jean and Dr. Chris Overall, for their time, insight and excellent guidence. I would like to thank all members of the Eltis lab, both past and present, especially Pascal Fortin, Geoff Horsman, Sachi Okamoto, Cheryl Whiting, Jie Liu and Christine Florizone for all their assistance and expertise.  So many techniques and skills are acquired through informal discourse with lab mates and all members of the Eltis lab had much to contribute. I would like to thank other labs for their assistance and contributions, specifically members of the Mohn Lab, Beatty Lab and Davis Lab.  Also, Andy Johnson of the Biomedical Research Centre who provided excellent assistance with FACS – a path of my research that unfortunately did not yield the desired results.  I would like to acknowledge Fred Rossell of the Mauk Lab for his expertise in fluorescence, spectrophotometry, kinetics and those fantastic cream eggs. Finally, I wish to acknowledge the sources of financial assistance that were necessary for this thesis, NSERC and the Department of Microbiology at the University of British Columbia (Teaching Assistantships).  xvi Dedication I would like to dedicate this thesis to my family, for all their support and encouragement and in loving memory of my brother. 1  Chapter One:  Introduction Proteinases catalyze the hydrolytic cleavage of peptide bonds of proteins and peptides.  These enzymes are critical for a variety of normal biological processes across all domains of life.  In prokaryotes and eukaryotes, secreted proteinases are used to acquire nutrients.  Intracellular proteinases are used to degrade damaged or unneeded proteins [1, 2].  Proteinases are also used to process or activate various cellular proteins, such as those that are exported across membranes.  Many viruses also use proteinases to process the polypeptides encoded in their genomes [3].  These viruses are responsible for a variety of diseases of both plants and animals and can have a serious impact on human health and agriculture. In addition to being critical in many biological processes, proteinases have attracted considerable attention for at least two additional reasons: their potential as therapeutic targets [4] and as reagents.  The deficiency or poor regulation of proteinases, resulting in incorrect expression and activation, underlies various diseases including cancer, arthritis and, emphysema [5, 6].  Moreover, proteinases are also important virulence factors of infectious bacteria such as Clostridium sp., Bacillus anthracis and enterohaemorrhagic Escherichia coli, as well as being a major component of many types of venom [6, 7].  Small molecule inhibitors of such proteinases thus have considerable potential as therapeutic agents such as the proteinase inhibitors of HIV that are an important component of drug treatment cocktails. Proteinases are widely used as preparative and analytic reagents in both research laboratories and industrial processes.  Examples of proteinase use include the removal of affinity tags such as the polyhistidine sequences (His 6) and cellulose-binding domains 2  that are added to proteins to aid in their purification [8].  The easy purification of tagged proteins has become very important for high-throughput methods of protein production for structural biology [9] and protein arrays.  Proteolytic enzymes are also important in proteomics to identify proteins separated by one- or two-dimensional gels. Determination of the masses of the set of resulting peptides by mass spectroscopy can be used to identify the protein by a process termed peptide fingerprinting.  In industry, proteinases are widely used in commercial products such as laundry detergents and contact lens cleaning solutions. Six types of proteinases have been classified based on the amino acid residue or functional group which catalyzes the breaking of the amide bond in the substrate: serine and threonine proteinases (e.g. trypsin and chymotrypsin are serine proteinases of the digestive system); cysteine proteinases (e.g. caspases involved in apoptosis); metalloproteinases (e.g. the matrix metalloproteinases involved in many functions including cell proliferation, differentiation, apoptosis and host defence); aspartyl proteinases (e.g. the HIV proteinase) [4]; and the recently described glutamic acid proteinases [10].  MEROPS, a manually curated database, presents information on proteinases and their inhibitors (http://merops.sanger.ac.uk) [11]. A proteinase or family of proteinases that is easily purified and possessing a narrow range of specificity would have applications in research and industry and fill the requirement for a highly specific, financially accessible reagent.  These features would be similar to the restriction endonucleases that are so necessary for working with DNA, but instead they would be restriction proteinases.  The viral proteinase of the hepatitis A virus (HAV) has many of these features and with modification (i.e. to increase its catalytic 3  efficiency or change specificity) could become a very useful proteinase tool. Furthermore, development of the proteinase as a laboratory tool will lead to insight of catalytic mechanism and enzyme specificity.  Indeed, Sellamuthu et al. [12] have altered the substrate specificity of HAV 3C proteinase to that end.  A deeper understanding of these latter two aspects of proteinase function should facilitate the development of better inhibitors of the viral proteinases and thus good lead antiviral drug compounds. 1.1 Viruses Viruses are ubiquitous in nature, infecting almost every organism known.  The most basic virus consists of a genetic element encompassed by a protein coat. Viruses may be relatively simple structurally, but differ widely in size, shape, composition and replicative strategy.  This huge variation in ‘lifestyle’ makes viral taxonomy a challenge. While viruses can be sophisticated in some respects, they are much less complex than self-replicating organisms. Viruses are classified on the basis of the nature of the nucleic acid of the virion, whether it is DNA or RNA, single- or double-stranded.  There exist several large classes of viruses that have a positive single-stranded RNA genome which is directly translated by the host cell machinery into the proteins necessary for viral replication.  The translated product is one or several large polyproteins which are comprised of several concatenated proteins that must be processed by a virally encoded proteinase to yield the structural and non-structural components.  This viral proteinase is usually highly conserved within a given group of viruses and is necessary for viral replication making it an excellent anti- viral drug target.   Two groups of viruses that use a proteinase for polypeptide processing include members of the proposed order Picornavirales and the family Coronaviridae. 4  This thesis focuses on three proteinases: the 3C proteinase (3Cpro) of HAV, the 3Cpro of Isreali acute paralysis virus (IAPV), and the 3C-like proteinase (3CLpro) of severe acute respiratory syndrome (SARS) virus.  The first two viruses are members of Picornavirales, and the third is in the family Coronaviridae. 1.1.1 Picornavirales Picornavirales is a proposed order consisting of the families Picornaviridae, Comoviridae, Dicistroviridae, Marnaviridae, Sequiviridae and the unassigned genera Cheravirus, Iflavirus and Sadwavirus [13].  Members of the order have shared features including a VPg protein which caps the 5’ of the (+)ssRNA genome, direct translation of the genome into a polyprotein, and polyprotein processing by virus-encoded proteinase(s).  Non-structural proteins are conserved in the order Picornavirales and are always present in the sequence of helicase-proteinase-(RNA dependent) RNA polymerase (Hel1-Pro-RdRp).  The proteinase present in all Picornavirales members is the 3Cpro although other proteinases may be present that also process the viral polyprotein.  The 3Cpro processes the majority or all of the polypeptide cleavage sites in Picornavirales viruses characterized to date and is essential for the replication of the virus. 1.1.1.1 Picornaviridae A large family of the proposed order Picornavirales is Picornaviridae which members include HAV, poliovirus (PV), foot-and-mouth disease virus (FMDV) and human rhinovirus (HRV) – a major causative agent of the common cold [14].  The genomes of these viruses are generally small (~7-9 kb [15]), hence ‘pico’, and transcribed as a single polyprotein with the structural proteins encoded on the 3’ end (Figure 1:A) 5  followed by the proteins of the replicase.  The processing of the polyprotein is done mainly by the 3Cpro.  Figure 1: Schematics of genomic organization for a) picornavirus, b) dicistrovirus and c) coronavirus.  After translation of the (+)ssRNA genome, the polypeptide is cleaved by the 3Cpro or 3CLpro.  Red stars indicate the encoded cleavage sites of the encoded polypeptide, yellow spheres represent the VPg protein acting as a 5’ cap.  For picornavirsuses and coronaviruses, these sites have been experimentally determined but are inferred by sequence alignments for the dicistroviruses. The 3Cpro required for viral polyprotein processing cleaves at specific sites and the sequence specificity differs for each member of the virus family [14].  The picornaviral proteinases also cleave specific host cell proteins thereby contributing to the 6  decrease in host cell protein translation.  For example, the 3Cpro of FMDV cleaves the eukaryotic translation initiation factor eIF4AI [16] and the 3Cpro of PV cleaves the TATA-binding protein [17].  It is important to know what sites are recognized and cleaved by the 3Cpro, the specificity for these sites, and the contribution of each amino acid residue of the cleavage sequence to this specificity.  This will assist with understanding the role of the proteinase in the viral life cycle as well as provide insight into viral strategies targeting host cell proteins. 1.1.1.2 Dicistroviridae Members of the family Dicistroviridae resemble members of the family Picornaviridae but infect invertebrates.  Most members characterized to date infect insects, although the taura syndrome virus (TSV) infects shrimp.  Some of these viruses have a large negative impact on agriculture and aquaculture such as TSV, which has a significant effect on the farmed penaeid shrimp industry [18].  More recently, IAPV has been implicated in colony collapse disorder (CCD) [19] in European honeybees. However, members of the family Dicistroviridae are much less studied than members of the family Picornaviridae. Dicistroviruses, like Picornaviruses, have a VPg-bound (+)ssRNA small genome (~9-10 kb [18]) that is directly transcribed, a non-enveloped virion morphology and conserved non-structural proteins (Hel-Pro-RdRp).  However, the dicistroviral genome has two open reading frames, which is the feature that gives the family its name (di- cistronic).  In the intragenic region between the ORF’s is an internal ribosome entry site (IRES) that does not require the initiator fMet-tRNAi.  Genome organization is such that 7  replicase proteins are encoded on the 3’ end followed by structural proteins (Figure 1:B) [18]. The dicistroviral 3Cpro’s have not been well characterized.  The presence of a 3Cpro has only by identified by sequence homology in dicistrovirus genomes that have been sequenced.  However, there has been no identification of exact N- and C-terminals of a dicistroviral 3Cpro and no activity has been demonstrated.  Consequently, no kinetic characterizations of any Dicistroviridae 3Cpro or inhibitors have been reported.  The only data related specifically to the 3Cpro is the identification of cleavage sites in the structural proteins of several dicistroviruses including Israeli Paralysis Virus (IAPV) from N- terminal sequencing data [20-22]. CCD is characterized by the rapid loss of adult bees from a colony.  It was first reported in 2006 but the phenomenon has been observed as early as 2004.  An estimated 23 % of beekeeping operations in the United States was affected by CCD over the winter of 2006-2007 [19].  A metagenomic study of bees comparing affected and unaffected CCD hives in the United States found a correlation between CCD and IAPV [19].  In France, following the winter of 2007-2008 where they experienced a high winter loss due to CCD, a significant number of apiaries (14 %) tested positive for IAPV as determined by PCR [23].  This relationship was not as strong as that established by Cox-Foster et al. [19] and suggests that IAPV is not the causative agent of CCD.  Nevertheless, inoculation of bees with purified IAPV, either by injection or feeding, resulted in high mortality [21]. 1.1.2 Coronaviridae Coronaviruses are also (+)ssRNA viruses.  Their genomes are larger than those of the family Picornaviridae (~27-32 kb (ICTVdB)) and the viruses are enveloped.  These 8  viruses get their name from the corona-solis like appearance when examined using an electron microscope.  This appearance is due to the outward-projecting spike proteins embedded in the envelope [24]. Members of the family Coronaviridae infect vertebrates and can have significant impact on agriculture such as porcine epidemic diarrhea virus and transmissible gastroenteritis virus which causes a high mortality rate in piglets [25].  Other coronaviruses infect a range of birds and mammals.  Until the SARS outbreak in 2003, coronavirus infections of humans were not considered to be severe with symptoms generally described as ‘the common cold’ [26].  In late 2002, a life-threatening form of pneumonia appeared in the Guangdong Province, China and spread to numerous countries around the world including Canada [27] [28].  The causative agent was a previously uncharacterized and genetically distinct coronavirus virus named SARS [27]. The (+)ssRNA genomes of coronaviruses are translated and processed through a variety of mechanisms.  Approximately 75% of the genome from the 5’ end consists of two large replicase ORFs (1a and 1b) which are translated as either the ORF1a polypeptide or the extended ORF1ab polypeptide.  These polyproteins are processed mainly by the encoded 3CLpro to produce 16 non-structural proteins which form the replicase.  In addition to the 3CLpro, a second papain-like cysteine proteinase processes three of the cleavage sites.  Among the coronaviruses, SARS is unique in that it has only one papain-like cysteine proteinase, whereas other coronaviruses have two papain-like cysteine proteinases in addition to the 3CLpro [29].  As well as replicating the genome, the replicase synthesizes a nested set of mRNAs from the RNA following ORF1b which are then translated into the structural proteins (Figure 1:C) [30]. 9  1.2 Viral proteinases Analysis of conserved proteins, especially Hel, Pro and RdRP of the (+)RNA viruses suggests their relatedness and possible evolutionary scenario [31].  All viruses described in Figure 2 contain at least one proteinase, with either a cysteine or serine in the active site.  The three viral proteinases that are the focus of this thesis are all cysteine proteinases.  A sequence alignment of related proteinases (Figure 3) and the phylogenetic tree based on this alignment (Figure 4) reveal the relatedness of the proteinases and support the proposed evolutionary scenario described in Figure 2.  All proteinases in the alignment have a conserved Cys and His which are part of the active site. In addition, the picornaviral and discistroviral 3Cpro’s have a conserved third member of the catalytic triad (either an Asp or Glu) which is not present in the coronavirus enzymes. Finally, the coronaviral 3CLpro’s are further distinguished by the presence of an extra C-terminal domain (not shown in Figure 3). 10   Figure 2: Proposed evolutionary scenario for class I (+)ssRNA viruses.  This scheme shows only the main viral genes.  The abbreviations are: Pol – RdRp; Hel – helicase; Spro – serine chymotrypsin-like proteinase; Cpro – cysteine chymotrypsin-like proteinase; Ppro – papain-like cysteine proteinase, CPFj - icosahedral capsid protein with jelly roll fold; CPf - filamentous capsid protein; CPr – rod-shaped capsid protein; R-thru – domain expressed by translation readthrough; X – conserved domain of unknown function, NCP – nucleocapsid protein; GP – envelope glycoprotein(s); M – membrane protein. Adapted from [31]. 11   Figure 3: Alignment of 3Cpro and truncated 3CLpro amino acid sequences.  Highlights indicate conserved residues, including those involved in catalysis (*) and primary P1 specificity determination ($).  Sequences were aligned using ClustalX as described in Materials and Methods.  GenBank accession numbers for protein sequences are as follows: BQCV (Black queen cell virus), NP_620564.1; IsAPV (Israel acute paralysis virus of bees), YP_001040002.1; CPV (Cricket paralysis virus), NP_647481.1; PSIV (Plautia stali intestine virus), NP_620555.1; 2CXV_HAV_ (Hepatitis A Virus), 2CXV_A; Polio (Human poliovirus), AY238473; FMDV (Foot and Mouth Disease virus o), CAD62373; Mengo (Mengo virus), ABB97066; HPar3C (Human parechovirus), NP_046804; SARS (SARS coronavirus), 30248028 ; HCoV (Human coronavirus 229E), AF304460; BCoV (Bovine coronavirus), NP_742132. 12   Figure 4: Dendrogram of 3Cpro and truncated 3CLpro.  Numbers indicate bootstrap replicates supporting each node. GenBank accession numbers for protein sequences are as follows: Himetobi P Virus (NP_620560.1); Black queen cell virus (NP_620564.1); Triatoma virus (NP_620562.1); Plautia stali intestine virus (NP_620555.1); Cricket paralysis virus (NP_647481.1); Drosophila C virus (NP_044945.1); Acute bee paralysis virus (NP_066241.1); Israel acute paralysis virus of bees (YP_001040002.1); poliovirus (AY238473); coxsackievirus (AAO48526); Human Rhinovirus (330029); Human parechovirus (9630377); Ljungan virus (21326572); Avian encephalomyelitis virus (21389215); Hepatitis A Virus (2CXV_A); Encephalomyocarditis virus (396510); Mengo virus (83033211); Theiler's murine encehalomyelitis virus (62039);Foot and Mouth Disease virus (CAD62373); Equine rhinitis A virus (21328572); Equine rhinitis B virus (21335365); Porcine epidemic diarrhea virus (30138155); Human coronavirus (AF304460); Murine hepatitis virus (25121563); SARS (30248028); Infectious bronchitis virus (25121547); Transmissible gastroenteritis virus(30146762).  This consensus tree was generated using Phylip and the ClustalX alignment with J=3 and N=100 as described in Materials and Methods. 13  1.2.1 The HAV 3C proteinase 1.2.1.1 Structure of HAV 3C Among the picornaviral 3Cpro’s, that of HAV is the best characterized.  As first proposed by Bazan and Fletterick [32] the HAV 3Cpro is structurally related to the cellular serine proteinases and specifically the β-barrel fold of the trypsin family of serine proteinases.  The trypsin family, characterized by the β/β fold, is one of two classes of serine proteinases.  The second, represented by subtilisin possesses an α/β fold. The active site nucleophile of 3Cpro is a conserved residue (Cys172 in HAV 3Cpro).  Initial evidence for the central role of a cysteine was proposed by studies using thiol-specific reagents [33].  Sequence alignments of the picornaviruses show conserved His and Cys residues, providing further evidence for a cysteine in the active site (see Figure 3) [30, 32].  Oligonucleotide directed mutagenesis of these residues (His44 and Cys172 in HAV) support their essential nature for catalysis [33, 34] and confirm that HAV 3Cpro is a cysteine proteinase. Thus HAV 3Cpro, and other 3Cpro are characterized by a cysteine residue in the active site but with an overall fold more similar to the trypsin- like serine proteinases (Figure 5:A). A crystal structure of a double mutant in which both cysteine residues were substituted (C24S and C172A) was determined to a resolution of 2.3 Å by Allaire et al. [35].  The substitution of the two cysteines in the HAV 3Cpro sequence was necessary to prevent precipitation of the proteinase and allow for its purification.  The crystal structure of HAV 3Cpro confirmed that the overall fold of enzyme was similar to that of the chymotrypsin-like serine proteinases with a cysteine in the active site [35].  In this structure, the Asp84 residue, which had been hypothesized to be part of a catalytic triad 14  [30, 32, 36], does not interact with the catalytic His44 of the active site, thus a catalytic Cys-His dyad was instead proposed. The active site conformation of HAV 3Cpro was further characterized by Bergmann et al., [37] who published a refined structure of the 3Cpro single mutant proteinase (C24S).  The active site is located between the two β-barrel domains and consists of the nucleophilic Cys172, the general acid-base catalyst His44.  The active site contains an electrophilic oxyanion hole formed by the amides of Gly170 and Cys172 [37].  These amides form hydrogen bonds to stabilize the tetrahedral intermediate during catalysis.  Pro169 and Met171 orient these amides towards the active site.  This active site architecture is similar to that of the chymotrypsin-like serine proteinases and thus may provide some insight into 3Cpro mechanisms. Sequence alignments initially indicated that 3Cpro’s contain a catalytic triad of Cys-His-Asp, analogous to the Ser-His-Asp catalytic triad of serine proteinases. Surprisingly, the first structural data of HAV 3Cpro showed that Asp84 was instead pointing away from His44 suggesting it did not play a role in catalysis [35].  However, the subsequent structures of three other picornaviral 3Cpro’s (PV, FMDV and HRV) were inconsistent with a catalytic dyad.  Biochemical confirmation of active site residues His44 and Cys172 was done by Gosert et al. [34] where they substituted these catalytic residues with tyrosine and glycine or serine, respectively, and observed loss of function. The importance of Asp84 has not been investigated by mutagenesis.  In 2005, a crystal structure of HAV 3Cpro was determined with a bound serine-derived β-lactone inhibitor [38].  In this structure, the side-chain of Asp84 is in the expected orientation for catalysis and forms a hydrogen bond with the imidazole ring of His44.  Residue Tyr143 also 15  interacts with His44 and presumably stabilizes the charge on His44.  The orientation of Asp84 towards the active site in this structure is evidence of a canonical catalytic triad similar to the chymotrypsin-like proteinases (Figure 5:B). 16   Figure 5: The HAV 3C proteinase (PDB : 2CXV).  A) Ribbon structure depicting the overall fold of the HAV 3Cpro.  Catalytic residues His 44 and Cys 172 are shown in red. B) Active site of the HAV 3Cpro showing hydrogen bonds participating in the stabilization of charge on the His44 residue.  N atoms are blue, C atoms are green, O atoms are red and S atoms are yellow. Figures prepared using PyMOL (http://www.pymol.org/, ver. 1.1) C) The substrate is colored with C atoms in light gray, O atoms in orange, and N atoms in light blue. The C atoms of the active site of HAV 3C are colored as follows: the residues of the oxyanion hole are in black, residues from β- strands bII2, eII, and fII and helix B (His 44) are in dark gray, residues from b-strand aI are in pink, residues from β-strand bI are in lilac, and residues from the turn that connects β-strands aII and bII1 are in cyan. Thicker and thinner broken lines represent hydrogen bonds with main chain and side chain atoms of the substrate sequence, respectively. Figure from [39]. A B C 17  1.2.1.2 Specificity of HAV 3Cpro Studies with peptide substrates indicate that the HAV 3Cpro recognizes a six residue cleavage site [40] and that this specificity is due to the well defined binding pocket of the proteinase.  Different binding pockets account for the difference in specificity between members of the picornavirus family.  Following the nomenclature of Berger and Schechter [41] the amino acid recognition site is designated N - P4 P3 P2 P1 P1’P2’ - C with cleavage occurring between P1 and P1’.  The six residues of the recognition sequence are bound at discrete subsites on the enzyme designated S4 S3 S2 S1 S1` S2` respectively. The HAV 3Cpro is highly specific and the most important residue contributing to cleavage specificity is the glutamine at the P1 position [37].  The 3Cpro cleaves between a glutamine residue and a small residue such as Ala, Ser or Gly although cleavage is not limited to just these small residues.  Using peptides as substrates, Jewell et al. [40] investigated the cleavage recognition sequence of HAV 3Cpro.  The substitution of Gln at the P1 position resulted in a much lower efficiency of cleavage.  Peptide substrates where Glu or Asn replaced Gln at the  P1 position resulted in only 2% of activity indicating that the 3Cpro can distinguish the Glu electrostatically from the Gln and sterically from the Asn [37].  Structural data led to the proposal that His191, situated at the base of the S1 subsite, discriminates glutamine from glutamate at the P1 [35]. The P4 site is a critical determinant of the enzyme’s catalytic abilities as Jewell et al. [40] found no detectable cleavage of peptide when the P4 site was absent. Replacement with hydrophobic amino acids either increased cleavage efficiency (Trp) or 18  remained at a similar efficiency (Val or Ile) while the hydrophilic amino acids Glu and His substituted in the P4 position resulted in no detectable cleavage [40]. 1.2.1.3 Substrate binding Based on the crystal structure of HAV 3Cpro, Bergmann et al. [37] proposed a model that accounts for the substrate specificity of the proteinase and modeled a pentapeptide into the substrate binding pocket (Figure 5:C).  In this model, the S1 subsite is formed in the groove between residues Ala193, Gly194, Gly167 and Leu168.  Residues Leu199 and Met171 contribute to the hydrophobicity of the binding pocket.  The imidazole of His191 is centrally located in the base of the groove and could interact with the carbonyl oxygen of the side chain of glutamine as proposed by Allaire et al., [35].  A second sphere residue, Glu132, is important in maintaining the neutral charge state of the imidazole of His191 based on structural analysis [35, 37]. The S2 subsite, formed by Tyr143, His145 and Ala193, is a smaller pocket, which may explain the preference of HAV 3Cpro for small P2 sidechains.  There is a substrate preference for Ser or Thr residues in the P2 position.  The imidazole of His145 may form a hydrogen bond with the P2 residue, explaining the preference of this subsite [37]. The P3 side chain points away from the active site based on substrate modeling [37], consistent with the relaxed specificity of HAV 3Cpro for this residue [40].  Opposite the P3 site is the flexible anti-parallel β-ribbon (residues 140-160) described by Bergmann et al. which closes like a lid over part of the active site [37].  Residue Lys146 is positioned on the β-ribbon and interacts with the side chain of the P3 residue and may explain the occurrence of aromatic residues in the P3 position.  The interaction of the 19  nucleophilic face of the aromatic ring with positive charges (Lys146) is favourable and may support this interaction [37]. The S4 subsite is formed in the cleft between two β-strands.  Ala141, Val144, Ile198 and Val200 line this cleft, consistent with HAV 3Cpro’s strong preference for large hydrophobic residues in the P4 position [37]. The S1’ and S2’ subsites were not obvious from structural modeling and were thus investigated by incubating HAV 3Cpro with a mixture of dipeptide inhibitors designed to fit these subsites [37].  Not all dipeptide combinations could be tested due to technical limitations.  The proteinase selected the tightest binding inhibitor and the results were analyzed with mass spectroscopy [39].  The crystal structure was determined with the P1’ and P2’ substrate (acetyl-valyl-phenalanyl-amide) covalently bound to the Sγ of the active site Cys172 by Bergmann et al. [39] and provide a rational for selectivity of these residues.  The peptide bond between P1’ and P2’ forms a hydrogen bond with the peptide carbonyl of Val28.  Non specific hydrophobic interactions between the side chains of Val28 and Met29 interact with the Val at position S1 but there is no well defined S1’ pocket which correlates with the lack of specificity at the P1’ position [39]. The S2’ subsite is more defined than the S1’ pocket, but the fit of the Phe of the dipeptidyl inhibitor into the S2’ pocket is imperfect.  This is because the Phe residue in the S2’ pocket of the crystal structure shows distortion of surrounding residues of the pocket [39].  Based on molecular modeling Bergmann et al. [39] propose that asparagine would be the best fit.  The S2’ subsite is lined with potential hydrogen bond donors and/or acceptors (Gln15, Asn30, Thr122, Asp124, Gly170).  The well defined S2’ subsite of 20  HAV 3Cpro makes it unique among picornaviruses and Bergmann et al., [39] suggested this subsite helps determine the substrate specificity of this particular enzyme. 1.2.1.4 Catalytic mechanism Although the enzyme-substrate interactions have been described in some detail for HAV 3Cpro, the precise catalytic mechanism remains uncertain.  The HAV 3Cpro is a cysteine proteinase but with an active site configuration similar to the mammalian serine proteinases [35, 37] and there is uncertainty of the precise nature of the reactive nucleophile.  The general mechanism of papain, another cysteine proteinase, is shown in Figure 6. The elements of this mechanism are expected to be conserved for HAV 3Cpro.  Figure 6: Schematic representation of peptide hydrolysis by the cysteine proteinase papain. The enzyme active site exists as a thiolate-imidazolium ion pair in the free enzyme.  Binding of the free enzyme and substrate forms the Michaelis complex followed by formation of the tetrahedral intermediate and then acylation of the enzyme, formation and release of the first product from the enzyme (R’NH2).  Water reacts with the acyl-enzyme to form the second product (deacylation).  Release of the product regenerates the enzyme. Adapted from [42]. 21  In papain catalysis, the substrate first binds to the enzyme through a number of interactions between various residues and substrate pockets [41].  1H-NMR indicates that the active site Cys-His exists as a thiolate-imidazolium pair in the absence of substrate. This ionization is postulated to be the only form of the enzyme that is active [42].  The carbonyl carbon of the scissile amide bond undergoes nucleophilic attack by the thiolate of the active site cysteine residue, forming the tetrahedral intermediate.  The oxyanion hole facilitates this by binding the carbonyl oxygen [42].  In the next step of the proposed mechanism, the His protonates the amide nitrogen, resulting in a free amine product and the acyl-enzyme intermediate.  Deacylation is proposed to involve attack of the acyl enzyme by a solvent species.  In this process, the active site His is thought to deprotonate a water molecule and the formation of the tetrahedral intermediate occurs with deacylation releasing the product and restoring the enzyme [42]. The catalytic mechanism of the 3C proteinases is less well understood.  Work by Sárkány et al. [43] on PV 3Cpro have ruled out a thiolate-imidazolium ion pair by following spectral changes of the single active-site cysteine residue upon alkylation of PV 3Cpro.  However, these researchers could not find definitive evidence of a general base catalytic mechanism [43, 44]. 1.2.2 The SARS 3CL proteinase The crystal structure of the SARS 3CLpro (also known as the main proteinase or Mpro) was first described by Yang et al. [45] and is similar to other coronavirus 3CLpro structures (transmissible gastroenteritis virus,  human coronavirus, infectious bronchitis virus [46-48]).  The 3CLpro consists of three domains: an N-terminal two-domain anti- parallel β-barrel structure with a fold similar to the 3Cpro, and a C-terminal domain 22  consisting of 5 α-helices [45].  Unlike the picornavirales 3Cpro, the SARS 3CLpro exists as a dimer as determined by crystallography [45] and analytical ultracentrifugation [49]. The C-terminal domain is at least partially responsible for dimerization [50] and deletion of this domain results in a catalytically inactive enzyme [49]. The N-terminal sequence also plays a role in dimerization of the enzyme and deletion of the first 7 residues results in an almost inactive enzyme [51]. Similarities between coronaviral 3CLpro and picornaviral 3Cpro extend to their active sites and substrate-binding clefts with some intriguing differences.  For example, the catalytic Cys145 and His41 are conserved in 3CLpro, but they are arranged in a dyad versus the triad of 3Cpro: the Asp of the 3Cpro triad is replaced in SARS 3CLpro with a water molecule which functions to orientate the active site His [52].  As in picornaviral 3Cpro’s, the substrate binding site of 3CLpro has six subsites.  Moreover, the specificity for P1 is predominantly Gln and this specificity is determined by the His163 residue at the bottom of the S1 subsites [53].  The Nε2 atom of His163 remains protonated over a broad range of pH and this is crucial for substrate recognition of the Gln.  This is accomplished through interactions with Phe140 and Tyr161 [53].  Unlike the 3Cpro’s, contributions from both protomers are required for correct formation of the S1 subsite.  The N-terminal amino acid of one protomer forms part of the S1 subsite of the second protomer as observed in the crystal structure [45].  The Ser1 of one protomer interacts with Glu166 and Phe140 of the second protomer forming the floor of the S1 subsite [53]. 1.3 Inhibitors of HAV 3Cpro The first inhibitors designed to target the 3Cpro’s were based on peptide substrates and such substrate-derived inhibitors developed against HAV 3Cpro; such as peptidyl 23  aldehydes and peptidyl fluoromethyl ketones are good inhibitors.  However, many of the inhibitors of HAV 3Cpro that have been developed to date do not bind to the enzyme particularly strongly.  Peptide aldehyde inhibitors against HAV 3Cpro were first described in 1995 [54].  These inhibitors were shown to be reversible and slow-binding, the best having a Ki* of 4.2 × 10-8 M.  The fluoromethyl ketone peptide molecules are also irreversible inhibitors of HAV 3Cpro with the best having a second order rate constant of 330 M-1s-1.  When this inhibitor was tested ex vivo with cells infected with a cell culture- adapted strain of HAV it suppressed HAV replication with an IC50 < 5 µM [55].  This fluoromethyl ketone inhibitor was later co-crystallized with HAV 3Cpro and the method of inactivation showed an unusual thiiranium ring with the Sγ of the active site Cys172 [56].  Other fluoromethyl ketone peptides have been found to inhibit both serine proteinases (chymotrypsin) and cysteine proteinases (papain). Keto-glutamine analogues have been well studied as potential inhibitors.  Such analogues with a phthalhydrazide moiety display initial competitive (reversible) inhibition of HAV 3Cpro with the best having a Ki of 9 µM [57].  However, over a period of hours, these inhibitors alkylate the active site cysteine thiol with concomitant loss of the phthalhydrazide moiety.  Such compounds were improved through cyclization of the glutamine side chain, resulting in inhibitors with IC50’s in the low micromolar range [58]. Lall et al., [59] investigated β-lactones as inhibitors of HAV 3Cpro and found a reversible inhibitor having a Ki of 1.5 µM.  Interestingly, the enantiomeric compound was an irreversible inhibitor with a kinact/Ki = 63 M-1s-1.  A crystal structure of a β-lactone complexed with HAV 3Cpro showed a complex mode of inhibition [38].  While NMR evidence supported the inhibitor modified the Cys172 of the active site, in the crystal 24  structure the inhibitor was bound on the back side of the enzyme in the RNA binding motif at His102.  Reanalysis of NMR data showed that in solution both sites can be modified but crystallization appeared to select His102 bound form [38]. In theory, a high throughput approach to screening inhibitors allows the discovery of novel classes of compounds.  This is especially useful if the enzymatic mechanism is poorly understood since new inhibitors can provide insight into enzyme catalysis.  Our collaborators used a high throughput screen to evaluate a 50,000-member library of small molecules against SARS 3CLpro which yielded 5 potent inhibitors of the proteinase including compound MAC-0005576, a halopyridinyl ester, which inhibited SARS 3CLpro with an IC50 of 0.5 µM [60] (Table 1). A library of 82 heteroaromatic esters based on this compound was created and screened against SARS 3CLpro where the most potent ester inhibited the SARS 3CLpro with an IC50 of 50 nM [61].  Given the similarity of the active site architectures of 3Cpro and 3CLpro, it is expected that these proteinases will be inhibited by similar classes of compounds and that libraries developed against SARS 3CLpro should be tested against HAV 3Cpro.  Indeed, based on this library it may be possible to generate broad spectrum inhibitors of the 3Cpro and 3CLpro’s. 25  Table 1: IC50’s of potent inhibitors of SARS 3CLpro identified from a 50,000 small molecule library screen against SARS 3CLpro [60, 61]. Compound Structure SARS 3CLpro IC50 (µM) MAC-000576  0.5 ± 0.2 MAC-0008120  4.3 ± 0.5 MAC-0013985  7 ± 2 MAC-0022272  2.6 ± 0.4 MAC-0030731  7 ± 3 ZJM-2-172  0.05  1.4 Directed evolution, biological screening and selection The HAV 3Cpro and other related picornavirus proteinases have potential for use as a reagent or tool as they possess high specificity.  For example, the TEV proteinase is commercially available to cleave recombinant fusion proteins and directed evolution has been used to improve solubility [62].  However, the picornavirus proteinases exhibit slower substrate turnover compared to papain-like cysteine proteinases, chymotrypsin or Factor Xa which is commonly used to remove affinity tags [63-67].  A family of N O O S Cl N S NH2 S O O OH N OH F F F O O O NN S S N NH2 NH2 S O O Cl Cl O Cl 26  proteinases with tailored specificity which are easy to produce would be useful as a preparative or analytical reagent.  Older methods of enzyme engineering use a rational approach involving design and site-directed mutagenesis [68, 69].  However, this approach is limited as it requires a detailed knowledge of the enzyme’s structure and function.  As well, the more subtle effects of amino acid substitutions, especially those remote from the active site, are currently beyond our understanding.  By contrast, methods such as directed evolution do not require detailed knowledge of the enzyme structure and function. Directed evolution is an iterative process whereby a library of variants of the protein of interest is created, screened for desired traits and then used as a basis for the next iteration.  Variants of an enzyme are generated using such techniques as error-prone PCR or oligonucleotide directed mutagenesis [70].  The selected variants can then be recombined using a variety of methods including DNA shuffling, staggered extension process (StEP) or random chimeragenesis on transient templates (RACHITT) to generate hybrid enzymes that are further screened and used for the next round of mutagenesis and recombination [71]. A key element of directed evolution is the screen or selection used to identify variants in a library that possess the desired activity.  Biological screens and selections are related processes for evaluating large numbers of enzyme variants.  Effective screens and selections minimize manipulation of the targeted enzyme (i.e., steps of protein purification) during evaluation of libraries of variants.  Screens involve examining each member of the library and are thus limited in their ability to successfully identify rare beneficial mutations given the large numbers of variants that must be examined.  In 27  contrast to a screen, biological selection is a method of selecting the desired variants from a large library by tying the survival of the host cell to the function of the enzyme being selected.  In this manner, only those variants that pass the biological selection test are considered and therefore many more members of the library can be examined [72]. Proteinases have been used in several biological selection systems to evaluate specificity, to identify inhibitors, and to screen for proteinase activity.  Sices and Kristie [73] developed a biological screen for site-specific proteinases using the bacteriophage λ lytic-lysogenic cycle.  Cleavage of the lytic cycle repressor protein cI, modified to contain a proteinase cleavage site, resulted in the phage entering the lytic replication cycle.  Using this system, phages expressing the HIV proteinase were isolated from a phage library containing random cDNA’s.  Sices and Kristie [73] also demonstrated the system was sensitive to HIV inhibitors and suggested the system could be used to characterize inhibitors and drug resistant proteinases.  Kupiec et al., [74] developed a biological selection for the HIV proteinase using thymidylate synthase.  The latter allows for both positive and negative selection depending on the growth media.  Coexpressed thymidylate synthase and HIV proteinase saw proteinase-dependent growth on negative selection media but suffered from high background.  Kim et al., [75] investigated the substrate specificity of the hepatitis C viruses NS3 proteinase using a yeast system.  A transcription factor was linked to the intracellular domain of an integral membrane protein via a proteinase cleavage site.  Cleavage of this protein releases the transcription factor resulting in activation of a reporter gene in the nucleus which can be screened for. Directed evolution of HAV 3Cpro requires a biological selection or screen to be developed and any screening or selection system developed for this purpose can also be 28  used to screen the specificity of the proteinase.  Two proposed methods of evaluating libraries of proteinases or libraries of proteinase cleavage sites are based on a selection system using the XylR transcriptional regulator or a screen using variants of the green fluorescent protein: CFP and YFP. 1.4.1 The XylR transcription factor Bacterial transcription factors have similar potential to be used in biological selections as yeast/eukaryotic transcription factors.  In addition, a selection system in bacteria such as E. coli has the added benefit of easy genetic manipulation which will allow for large libraries to be generated and tested without the complexities of large shuttle vectors. Bacterial transcription factors most commonly have two domains: a DNA binding domain and a sensing domain which interacts with the environmental signal and modulates the regulatory activity of the transcription factor [76].  This organization if sypified by XylR, which activates the transcription of the xyl genes of the Pseudomonas putida TOL plasmid in the presence of toluenes (effectors).  In the absence of effector, XylR binds to DNA in a non-active form to the PU promoter.  The binding of aromatic hydrocarbons and ATP activates XylR, stimulating transcription [77]. XylR belongs to the NtrC/NifA family of regulators and consist of 4 domains labelled A to D. The carboxy-terminal D domain contains the DNA binding motif.  The C domain is involved in ATP hydrolysis.  The N-terminal A domain binds effectors, including tolune and xylenes.  Between the A and C domain is the B linker domain. Fernández et al. [78] showed that a deletion of the A domain (XylR∆A) resulted in a constitutively active form of XylR.  However, constitutive activity of XylR∆A can be repressed with the addition of isolated A domain indicating that these domains interact 29  through intramolecular contacts and not just through the B domain [79].  Furthermore, Fernández et al. [78] demonstrated that substitution of the A domain for the N-terminal domain of the MS2 phage polymerase resulted in a form of XylR unable to activate transcription (Figure 7).  Figure 7: Various forms of XylR and their ability to activate transcription.  The four domains of XylR are the A domain in red, C and D domains in green and B-linker as a black line. A) Wild Type XylR induced by xylene allows transcription of lacZ from the PU promoter. B) Truncated XylR no longer responds to inducers and constitutively induces expression from the PU promoter. C) XylR with the A domain replaced by the MS2 phage polymerase could no longer be induced by xylene and did not activate transcription. 30  Given that truncated XylR is constitutively active, the engineering of an HAV 3Cpro cleavage site (ELRTQ/AV) in the B-linker region of XylR could, in principle result in a regulator that is active when cleaved by HAV 3Cpro.  To prevent the potential loss of XylR∆A activation through interactions with the truncated A domain the MS2 can replace the A domain in the XylR construct.   It is assumed that in this construct there will be minimal interactions between the MS2 domain and the A domain and so following cleavage of the linker region, the MS2 domain will be released.  By placing an antibiotic resistance gene under control of the cognate promoter of XylR, PU, antibiotic resistance could be induced by the presence of active proteinase. 1.4.2 CFP and YFP FRETing substrates Pairs of fluorescent proteins including green fluorescent protein (GFP) and variants have been used to screen for a variety of biological activities in vitro including proteinase activity and protein-protein interactions.  GFP from the Aequorea jellyfish has a β-barrel structure that is threaded by an α-helix running up the centre.  The fluorophore of GFP is formed by three residues (Thr65-Tyr66-Gly67). In the presence of dioxygen (O2), these three residues form the fluorophore, p-hydroxybenzylideneimidazolinone [80]. Through various protein engineering approaches, many properties of GFP have been changed, including the protein’s colour, stability, rate of maturation and propensity to dimerize [81-83].  The great variation in colour (λex: 399 – 590 nm and λem: 511 – 649 nm [84]) means that pairs of GFP variants with overlapping excitation and emission spectra can undergo Förster resonance energy transfer (FRET).  FRET is the radiationless transfer of energy from an excited donor molecule to an acceptor.  The FRET efficiency 31  (E) depends on several features (equations 1 and 2):  1) the distance between the donor and acceptor dipoles (r), and 2) the Förster distance which is the distance at which FRET efficiency is 50 % (R0) which depends on 1) the degree of overlap between emission spectra of the donor and the excitation spectrum of the acceptor (integral J(λ)), 2) the relative orientations of the donor and acceptor dipoles (κ2), 3) the refractive index of the medium separating donor and acceptor chromophore (η), 4) the quantum yield of the donor (φd), and 5) the extinction coefficient of the acceptor (εa). Equation 1: 6 0 )/(1 1 Rr E + = Equation 2: )(L mol10786.8 42-11160 λεϕηκ JR ad−−×= A FRET capable protein pair is a useful biological tool that can be genetically encoded.  As FRET depends on the sixth power of the distance of separation, the signal is a sensitive marker of the relative proximity of the two flurophores.  Proteinase cleavage can be observed when a proteinase separates two fluorescent proteins thus eliminating FRET (Figure 8). 32   Figure 8: An engineered polyprotein proteinase substrate whose cleavage can be monitored by FRET. The blue rectangle represents CFP and the yellow rectangle represents YFP. Excitation light is in blue and is 434 nm. FRET signal is emission at 527 nm and CFP signal is emission at 477 nm. GFP-based substrates that FRET have been used to study the activation of caspases in mammalian cells [85].  These proteinases are activated during apoptosis resulting in programmed death. A widely used caspase substrate consists of cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) linked together by a flexible peptide linker that is cleavable by the caspase under investigation [85].  With the proteins held together in close proximity, excitation of CFP results in FRET to YFP and subsequent YFP emission.  This is termed the FRET light or signal.  Activation of the caspase results in cleavage of the linker, causing a drop in the FRET signal.  Caspase activity was monitored using fluorescence activated cell sorting (FACS) by sorting FRETing and non-FRETing cells. Fluorescent protein FRET signals have also been used in prokaryotes to monitor protein-protein interactions.  Sourjik and Berg, [86] have used CFP-YFP to monitor real- FRET CFP 33  time interactions between proteins involved in chemotaxis in E. coli.  In this experiment, cells expressing two chemotaxis proteins tagged with CFP or YFP, respectively, were attached to a coverslip in a flow cell.  Fluorescence was monitored when chemo attractant was added or removed.  Transient interactions of chemotaxis proteins were observed by examining the FRET signal. The fluorescent protein pair CFP and YFP and their mammalian codon optimized counterparts (eCFP and eYFP) have been commonly used as a FRET pair but their small dynamic range limits their application [87].  Using CFP and YFP as a starting point, using mutagenesis and screening, Nguyen and Daugherty [87] generated a fluorescent protein pair optimized (CyPet and YPet) for a greater difference between the FRET and nonFRET signal. The FRET optimized CyPet-YPet substrates were used by You et al., [88] to identify protein-protein interactions in E. coli.  FRETing E. coli cells with labelled partners that interacted were selected from a library using fluorescent activated cell sorting (FACS).  This experiment relies on the sorting of bacterial cells.  As the latter are small, sorting is imperfect, and frequently requires several rounds to isolate distinct populations of FRETing and nonFRETing cells.  By contrast, larger eukaryotic cells are much more easily sorted into FRETing and nonFRETing populations using FACS. 1.5 Aims of this study In this thesis, tools to study the specificity of proteinases were developed, these were then used to investigate the specificity of viral cysteine proteinases, and several inhibitors that target these proteinases were developed.  To this end, three related objectives were pursued.  First, biological selection and screening systems to investigate 34  proteinase activities were developed using HAV 3Cpro as the test proteinase.  The selection system was based on an engineered form of XylR which, when cleaved, would activate an antibiotic resistance gene placed under the control of XylR’s cognate promoter PU.  The screening system was based on a cleavable fluorescent protein substrate, cleavage of which could be measured by a change in the emission spectra.  The fluorescent protein screen was tested with two libraries of HAV 3Cpro substrates and the ability of the screen to characterize specificity is discussed. In the second aim, the specificity of an uncharacterized proteinase from a poorly studied family of viruses, the Dicistroviridae, was characterized.  A fragment of the IAPV genome encoding the replicase (including the 3Cpro) was cloned and the resulting protein was purified.  The processing of this polyprotein fragment was investigated to identify the native 3Cpro and a cognate cleavage sequence. In the final aim, inhibitors developed against two proteinases, 3Cpro of HAV and the 3CLpro of SARS were characterized using steady state kinetics.  The mechanisms and kinetics of inhibition of these compounds were determined, and provide insight into enzyme mechanism and specificity. 35   Chapter Two: Materials and Methods 2.1 Sequence alignment The amino acid sequences of various 3C and 3CL proteinases were aligned using CLUSTALX (version 1.83 [89]) with all parameters set at their default values.  As the N and C-termini of 3C proteinases from the family Dicistroviridae have not been experimentally determined, their sequences were derived from alignments of their replicases with that of HAV 3Cpro.  The alignment of the proteinases was built in a stepwise fashion, first aligning groups of similar sequences.  After each round of alignment, the result was evaluated with respect to the crystal structures.  For example, gap positions were analyzed with respect to secondary structure elements and other structural features.  When warranted, indels were shifted to positions between secondary structure elements.  The final alignment was visualized with the program BioEdit (version 7.0.5.3 [90]). 2.2 Phylogenetic analysis Phylogenetic analyses were performed using the neighbor-joining algorithm of PHYLIP (version 3.66 [91]). For the PHYLIP analysis, distance matrices were generated with the PROTDIST program (PAM001 matrix). Neighbor-joining was performed using a random order of sequences on input. For bootstrap analyses, the SEQBOOT program of the PHYLIP package was used to generate 100 data sets, each of which was jumbled three times in calculating the best tree.  The PHYLIP program CONSENSE was used to generate the final tree. The generated trees were visualized using TreeView (version 1.6.6 [92]). 36  2.3 Chemicals HAV 3Cpro and SARS 3Cpro inhibitors were gifts from Dr. J. Vederas (Department of Chemistry, University of Alberta, Edmonton, Alberta).  Factor Xa was purchased from Haematologic Technologies Inc. (Essex Junction, USA), papain and bovine pancreas chymotrypsin from Calbiochem (La Jolla, CA).  The hepatitis C nonstructural 3 proteinase (NS3pro) and the peptide substrate for NS3pro (Abz-DDIVPCSMSY(NO2)T were gifts from Dr. François Jean (Department of Microbiology & Immunology, UBC). Other peptides and oligonucleotides were synthesized at the Nucleic Acid Protein Service Unit of the University of British Columbia.  Peptides were confirmed by mass spectrometry.  The SARS-P2 substrate has sequence Abz-SVTLQSGY(NO2)R where Abz is fluorophore 2-aminobenzoyl and Y(NO)2 is nitrotyrosine.  The HAV peptide substrate has sequence Dabcyl-GLRTQSND(edans)G.  The oligonucleotides used in this study were purchased from Integrated DNA technologies (Coralville, IA), Invitrogen (Burlington, ON) or the Nucleic Acid Protein Service Unit (NAPS) at the University of British Columbia (Table 2).  Restriction enzymes, Antarctic Phosphatase and Taq DNA ligase were purchased from New England Biolabs (Pickering, ON).  T4 DNA ligase from Fermentas (Burlington, ON) and Taq DNA polymerase was from Promega (Madison, WI).  PCR was performed using the expand High FidelityTM DNA polymerase system (Roche Applied Sciences, Laval, P.Q., Canada) according to the manufacturer’s instructions with an annealing temperature of 45 °C (section 2.6) or 46 °C (section 2.9) unless otherwise stated. All other chemicals were of analytical grade and used without further purification.  All sequencing was performed on an ABI 373 Stretch (Applied Biosystems, Foster City, CA) using Big-Dye v3.1 terminators at NAPS. 37  Table 2: Oligonucleotides used in this study. Oligonucleotide Sequencea Restriction Site(s) oBAD(Bam- Not) /5Phos/GCATTTTTATCCATAAGATTAGCGGCCGCTACCTGAC GCTTTTTATCG NotI oXylRdA3 TCGCGGATCCGGTACCGCATGCTATCGGCCCATTGCTTTCAC BamH1, KpnI, SphI oXylRdA5 TCGCGGATCCCTTGCGCACGCAGAGCTTCGTTGCCAACCTGC GCAACC BamHI oXylRdA5- LRTQMF TCGCGGATCCCTTGCGCACGCAGATGTTCGTTGCCAACCTGC GCAACC BamHI oXylRdA5- MSF TCGCGAATTCATGAGCTTCGTTGCCAACCTGCGCAACC EcoRI oXR4-5 TCGCGAATTCATGGGGGATCCCAACCTGCGCAACCGCCTG EcoRI, BamHI oXR-TIR5 GGAATTCAGGAGGGTTTTTACCATGTCGCTTACATACAAACC CAAG EcoR1 oXRdA3 GGAATTCAGGAGGGTTTTTACCATGTCGCTTACATACAAACC CAAG EcoR1 oXRBam5 CGCGGATCCGATGTCGCTTACATACAAACCCAAGATG BamH1 oXylR3 GCTCTAGACTATCGGCCCATTGCTTTCAC XbaI oXylR5 GGGGTACCAGGAGGAATTCATGTCGCTTACATACAAACCCA AG KpnI, EcoRI oH3C-5 GGGGTACCAGGAGGAATTCATGTCAACTTTGGAAATAGCAG GAC KpnI, EcoRI oH3C-3 GCTCTAGAATTACTGACTTTCAATTTTCTTATCAATATTTTG XbaI oCFP-3s CGGCATGGACGAGCTGTACAAGGGATCCTAATTAACTTTAG AGGAGGAACCATGGAGAC BamH1, NcoI oCFP-5 TGGGGAATTCATGGTGAGCAAGGGCGAGG EcoR1 oCFP-3.1 CGGCATGGACGAGCTGTACAAGGGATCCTTGCGCACGCAGA GCTTCTCCATGGAGAC BamH1, NcoI oYFP-for GACAGTCCATGGTGAGCAAGGGCGAGG NcoI oYFP-rev AGTCTCTAGATTACTTGTACAGCTCGTCCATGCC XbaI 38  Oligonucleotide Sequencea Restriction Site(s) oYFP-revhis2 AGTCTCTAGATTAGTGATGGTGATGGTGATGGCCGCTCTTGT ACAGCTCGTCCATGCCG XbaI olink1- NheI/BamHI CTAGCCATATGGGAG NdeI olink2- NheI/BamHI GATCCTCCCATATGG NdeI oCyFor TGGGGAATTCATGGCGACTAGTCATCACCATCACCATCACAT GTCTAAAGGTGAAGAATTATTCGGC EcoR1 oCyRev CGGGGTACCTTCCTCCTCTAAAGTTAAGCTTAGGATCCTTTG TACAATTCATCCATACCATGGG KpnI, HindIII, BamH1 oYFor TGGGGAATTCATGGCGACTAGTCATCACCATCACCATCACG GTACCATGTCTAAAGGTGAAGAATTATTCACTGG EcoR1, KpnI oYRev CCAATGCATTGGTTCTGCAGTTATTTGTACAATTCATTCATA CCCTCGG PstI oCyY-1-a GATCCTTGCGCACGCAGAGCTCCGGTAC oCyY-1-b CGGAGCTCTGCGTGCGCAAG oCyY-1d-a GATCCTTGCGCACGCAGAGCTTCTCCTTGCGCACGCAGAGCT TCTCCGGTAC  oCyY-1d-b CGGAGAAGCTCTGCGTGCGCAAGGAGAAGCTCTGCGTGCGC AAG  oCyY-1-16-a GATCCCGCATGCAATTGCGCACGCAGAGCTTCTCCAACTGGT TGTCCGGTAC  oCyY-1-16-b CGGACAACCAGTTGGAGAAGCTCTGCGTGCGCAATTGCATG CGG  oLinkCY-U1-a GATCCGGCAGCGGCTCGAGCGGTAGTGGTAC XhoI oLinkCY-U1-b CACTACCGCTCGAGCCGCTGCCG XhoI oLinkCY-4-a GATCCTTGCGCACGGAGAGCTTCTCCGGTAC oLinkCY-4-b CGGAGAAGCTCTCGCTGCGCAAG oLRTQXSF- YPet CGGGATCCTTGCGCACGCAGNNKTTCTCCGGTACCATGTCTA AAGGTGAAGAATTATTCACTGG  BamH1, KpnI 39  Oligonucleotide Sequencea Restriction Site(s) oXRTQSFS- YPet CGGGATCCNNKCGCACGCAGAGCTTCTCCGGTACCATGTCT AAAGGTGAAGAATTATTCACTGG BamH1, KpnI oIs3C-Xa-for GACTAGTTCCGCGGGCATCGAAGGTAGGATGTGGAAAGATC AAGTTGCCCAAC SpeI, SacII oIs3C-rev CCCAAGCTTTTACTGCATGCTTACATCTATTTTAATAAATGC HindIII oIs3BCD-for GACTAGTGGATCCATCGAAGGTAGGATGTCTGATGGACAGA AGAAGAAACAG SpeI, BamH1 o-Is3ABCD-rev TTCCAATGCATTGGCTGCAGTTACATATAGTATTCCAGAAAC CGCTC PstI a  The degenerate codons are shown in bold. N= A, T, C or G; K = G or T.  The recognition sequences for the indicated restriction sites are underlined.  2.4 Bacterial strains, plasmids and growth conditions Bacterial strains and plasmids used in this study are described in Table 3 and Table 4.  Unless otherwise stated Escherichia coli was grown at 37 °C in Luria Bertani (LB) broth, shaken at 200 rpm with the appropriate antibiotics (ampicillin – 100 µg/mL, tetracycline – 7.5 µg/mL, chloramphenical – 30 µg/mL, kanamycin - 25 µg/mL unless otherwise noted).  LB (low salt) media was made in a similar manner as LB media but without the addition of NaCl.  Strains used for DNA propagation and cloning were E. coli DH5α [93], CC118λpir [94] and BW27783 [95]. Table 3: Strains used in this study. Eschericia coli strains used in this study Relevant genotype or characteristics Reference/origin DH5α endA1, hsdR17 supE44, thi-1, λ-recA2, gyr A96, relA1, ∆lacU169(Φ80lacZ∆M15) [93] CC118 ∆(ara-leu), araD, ∆lacX74, galE, galK, phoA20, thi-1, rspE, rpoB, argE (am), recA1 [96] CC118Rif Rifr derivative of CC118 CC118λpir ∆(ara-leu), araD, ∆lacX74, galE, galK, phoA20, thi-1, rspE, rpoB, argE (am), recA1, λpir lysogen; recipient of pUTel derivatives (see Table 3). [94] 40  Eschericia coli strains used in this study Relevant genotype or characteristics Reference/origin BW27783 lacIq, rrnB3, ∆lacZ478, hsdR514, DE(araBAD)567, DE(rhaBAD)568, DE(araFGH) Φ(∆araEp PCP8-araE) [95] S17.1λpir RecA, thi, pro, hsdR-M+, RP4::2-Tc::Mu::Km:: Tn7, Tpr, Smr, λpir lysogen; mobilizing strain for pTUel derivatives. [97] BL21(DE3) pLysS Cmr, F-, dcm, ompT, hsdSB(rB-, mB-), gal, λ(DE3), pLysS [98] GJ1158 proUP::T7, RNAP::malQ-lacZ [99] PuCm Rifr, Telr, CC118Rif, mini-TN5: PU-cat This work PuLacZ Rifr, Telr, CC118Rif, mini-TN5: PU-lacZ This work CodonPlus (DE3) RIL Cmr, Tetr, B, F-, dcm, ompT, hsdSB(rB-, mB-), gal, λ(DE3), endA, Hte[argU, ileY, leuW,] Stratagene NovaBlue (DE3) Tetr, endA1, hsdR17 (rK12– mK12+) supE44 thi-1 recA1 gyrA96 relA1 lac λ(DE3) F'[proA+B+ lacI qZ∆M15::Tn10] Novagen Cmr, chloramphenicol resistance, Tetr, tetracycline resistance, Telr, telurite resistence.   Table 4: Plasmids used in this study. Plasmids Relevant genotype, phenotype or characteristics Reference/origin pA-8 Kanr, pDRRIVE derivative containing nucleotides 2612-7755 of the IAPV genome (accession number EF219380). Dr. Ilan Sela (unpublished) pBAD24 Ampr, araC-PBAD promoter. [100] pBAD24X Ampr, pBAD24 with BamHI site behind promoter replaced with a unique NotI site. This work pBDH3C1 Ampr, pBAD24 derivative encoding HAV 3C proteinase. This work pBDH3C2 Ampr, pBAD24 derivative encoding HAV 3C proteinase. This work pBDXCFP Ampr, pBAD24X derivative containing cfp. This work pBDXCFP3.1 Ampr, pBAD24X derivative containing cfp. This work pBDXCFP3.2 Ampr, pBAD24X derivative containing cfp. This work pBDXCFP3.3 Ampr, pBAD24X derivative containing cfp. This work pBDXCYFP Ampr, pBAD24X derivative containing cfp and yfp. This work pBDXCYFP-1 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTQSFS. This work pBDXCYFP-2 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTASFS. This work pBDXCYFP-3 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTQMFS. This work pBDXCYFPh-1 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTQSFS. This work pBDXCYFPh-2 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTASFS. This work pBDXCYFPh-3 Ampr, pBAD24X derivative containing linked cfp/yfp substrate with linker LRTQMFS. This work pBDXMXR1 Ampr, pBAD24 derivative containing XylR based substrate mxr1. This work pBDXR3 Ampr, pBAD24 derivative containing truncated xylR. This work 41  Plasmids Relevant genotype, phenotype or characteristics Reference/origin pBDXXR2 Ampr, pBAD24X derivative containing truncated xylR. This work pBDXXR4 Ampr, pBAD24X derivative containing truncated xylR. This work pBDXYFP Ampr, pBAD24X derivative containing yfp. This work pBDXYFP Ampr, pBAD24X derivative containing yfp. This work. pBDXYFPhis2 Ampr, pBAD24X derivative containing yfp. This work pBDXylR Ampr, pBAD24 derivative containing xylR. This work pBXCy-H Ampr, pBAD24X derivative containing cypet. This work pBXCyY-1 Ampr, pBAD24X derivative containing linked cfpet/yfpet substrate with linker LRTQSFS. This work pBXCyY-1-16 pBAD24X derivative containing linked cfpet/yfpet substrate with linker RMELRTQSFSNWLS. This work pBXCyY-1d Ampr, pBAD24X derivative containing linked cfpet/yfpet substrate with linker LRTQSFSLRTQSFS. This work pBXCyY-4 pBAD24X derivative containing linked cfpet/yfpet substrate with linker LRTESFS. This work pBXCyY-H Ampr, pBAD24X derivative containing cypet and ypet.  This work pBXCyY-U1 pBAD24X derivative containing linked cfpet/yfpet substrate with linker GSGSSGS. This work pBXYP-H Ampr, pBAD24X derivative containing ypet. This work pCyPet-His Cmr, containing cypet. [87] pECFP-N1 Kanr, contains mammalian codon optimized CFP. Clonetech (Mountain View, CA) pECYFP-N1 Kanr, contains mammalian codon optimized CFP and YFP. This work pET41b Kanr, a GST-fusion protein expression plasmid. Novagen pETXIs3BCD Kanr, GST-tagged IAPV replicase portion (amino acid residues 887-1900 of replicase). This work pETXIs3C Kanr, GST-tagged IAPV 3Cpro. This work pEYFP-N1 Kanr, contains mammalian codon optimized YFP. Clonetech (Mountain View, CA) pFH2MS2 Ampr, a pFH2 derivative with the MS2 phage polymerase fragment. [101] pFH2MXR1 Ampr, pFH2 derivative with XylR substrate mxr1. This work pFH2WTXR Ampr, pFH2 derivative containing xylR. This work pFHXRdA Ampr, pFH2 derivative containing truncated xylR. This work pHAV-3CEX Ampr, encodes HAV 3Cpro. [33] pT7-7 Ampr, ori ColE1, T7 inducible promoter. [102] pT7HSP2 Ampr, pT7-7 derivative encoding SARS 3CL proteinase. [60] pU9CXS:Cmr∆P  Ampr, gene for Cmr under control of the Pm promoter. [103] pUC18 Ampr [104] pUC18Not Ampr, pUC18 with MCS flanked by NotI sites. [94]  pUC18XylR∆A5 Ampr, pUC18Not derivative containing truncated xylR. This work pUCCFP Ampr, pUC18 derivative containing cfp. This work pUCH3C1 Ampr, pUC18 derivative encoding HAV 3C protease. This work  pUCm Ampr.. The gene for Cmr under the control of the PU promoter.  This work 42  Plasmids Relevant genotype, phenotype or characteristics Reference/origin pUCP26 Ampr,  [105] pUCP26_XylR Tetr, xylR gene expressed through its native promoter PR cloned into pUC18. This work pUCWTXRTIR Ampr, pUC18 derivative containing xylR. This work pUCXR2 Ampr, pCU18 derivative containing truncated xylR. This work pUCXRdA Ampr, pUC18 derivative containing truncated xylR. This work pUCXylR Ampr, pUC18 derivative containing xylR. This work pUMCS2 Ampr, the MCS site of pUC18Not downstream of the PU promoter and flanked by NotI sites (constructed in pUC18Not). This work pUTel Ampr, mini-TN5 delivery plasmid with two mini-TN5 insertion sequences flanking a NotI site and telurite resistance gene. This work pUTel-pUCm Ampr, deliver plasmid for PU-cmr This work pUT-MAD1 Ampr, delivery plasmid for mini-TN5,  tellurite- resistance selection marker, wildtype xylR gene expressed through its native promoter PR. [101] pVLT31 Tetr, RSF1010-lacIq/PTAC hybrid broad host range expression vector, MCS of pUC18. [101] pVLTH3C1 Tetr, pVLT31 derivative encoding HAV 3C proteinase. This work pVLTMXR1 Tetr, pVLT31 derivative with XylR based substrate mxr1. This work pXylR-pR Ampr, xylR gene expressed through its native promoter PR This work pXylR-pU Ampr, xylR gene expressed through its native promoter PR cloned into pUC18Not. This work pYPet-His Cmr, containing ypet. [87] Ampr, ampicillin resistance, Cmr, chloramphenicol resistance, Kanr, Kanamycin resistance, Tetr, tetracycline resistance. 2.4.1 Transformation and conjugation E. coli strains were transformed with plasmids via electroporation [106]. Conjugation was performed essentially as described by Timmis and DeLorenzo [107]. Briefly, the donor strain, E. coli S17.1λpir, containing the pUTel plasmid carrying the target gene was grown in LB media with ampicillin and 60 µg/mL telurite.  The recipient strain, E. coli CC118 (rifr) was grown with no selection in LB media overnight. Approximately 108 cells of each strain were added to 5 mL of 1% NaCl, mixed, and then transferred to a syringe and filtered onto a 0.45 µm filter.  After filtering, the membrane was placed on an LB agar plate and incubated at 30 °C for 18 hours.  After growth, the mating mixture was resuspended in 5 mL of 1% NaCl and the suspension media was 43  plated on LB agar with 50 µg/mL rifampicin, 60 µg/mL telurite, and 1% citrate and grown overnight  at 37 °C.  Sensitivity of the strain to ampicillin was tested before the final exconjugant was selected. 2.5 Protein purification All proteins were purified from freshly transformed cells grown on LB or LB (low salt) agar media with appropriate antibiotics at 37 °C. A single colony was picked to start an inoculation culture grown at 37 °C or 30 °C in LB or LB (low salt) broth overnight with appropriate antibiotics. After growth of the culture and expression of the protein, cultures were harvested by centrifugation.  Following an optional wash step, cultures were resuspended in the appropriate buffer and lysed by a minimum of three successive passages through a French press (Spectronic Instruments Inc., Rochester, NY) operated at 20,000 p.s.i.  Cell debris was removed by ultracentrifugation at 37,000 rpm for 45 minutes in a 70Ti rotor (DuPont Instruments, Wilmington, DE).  The clear supernatant was decanted and filtered using a 0.45 µm filter. Unless otherwise stated, all chromatography steps were performed on an ÄKTA Explorer (Amersham Biosciences, Baie d’Urfé, P.Q., Canada).  Following purification, protein was concentrated and the buffer was exchanged to the appropriate storage buffer using an Amicon Stirred Cell (Amicon, Etobicoke, ON, Canada).  Purified protein was then flash frozen into beads with liquid nitrogen and stored at -80 °C.  Protein purity was estimated from SDS-PAGE performed in the Bio-Rad Mini PROTEAN II or III apparatus and stained with Coomassie Blue according to established procedures [108]. 44  2.5.1 Production and purification of HAV 3Cpro The HAV proteinase was purified essentially as previously described [33].  A colony from freshly transformed E. coli BL21(DE3) pLysS was grown overnight in 50 mL LB, ampicillin, 25 µg/mL chloramphenicol at 37 °C.  One litre of prewarmed LB was inoculated with 5 mL of overnight culture and grown at 37 °C to OD600 of ~0.6 whereupon it was cooled on the bench briefly and production of the proteinase was induced with the addition of IPTG to a final concentration of 0.25 mM.  The cells were grown for an additional 6 hours at 30 °C and then harvested by centrifugation.  The cells were washed with 20 mM potassium phosphate, 1 mM EDTA, 2 mM DTT, pH 6.5 and frozen at -80 °C. Cells were resuspended in the above buffer, lysed using the French press and the cell debris was removed by ultracentrifugation. The clear supernatant was decanted and filtered through a 45 µm filter and loaded onto a MonoS 10/10 column preequilibrated with 20 mM potassium phosphate, 0.5 mM EDTA, 50 mM NaCl, pH 6.5. The column was then washed with 2 column volumes of the equilibration buffer.  Protein was eluted using a gradient of 80 to 280 mM NaCl in the equilibration buffer.  The fractions were screened for the presence of HAV 3Cpro by SDS-PAGE.  Selected fractions were combined and concentrated using the Amicon Stirred Cell equipped with a YM10 membrane. The protein solution was concentrated to ~3 mg/mL, frozen as beads in liquid nitrogen and stored at -80 °C. Sixty milligrams of 3Cpro was obtained from one litre of cell culture. 45  2.5.2 Production and purification of SARS 3CLpro A colony from freshly transformed E. coli GJ1158 (pT7SARSnoA - [53]) was grown overnight in 50 mL LB (low salt) with ampicillin at 37 °C.  One litre of prewarmed LB (low salt) with ampicillin was then inoculated with 10 mL of overnight culture and grown at 37 °C to OD600 of ~ 0.5 whereupon production of the proteinase was induced with the addition of NaCl to a final concentration of 300 mM. The cells were then grown overnight at 37 °C and harvested by centrifugation. The cells were washed using 20 mM sodium phosphate, pH 7.0 and frozen at -80 °C. Frozen cells from a one liter culture were thawed and resuspended in 10 ml of 20 mM sodium phosphate, 1 mM MgCl2, 1 mM CaCl2, pH 7.0 with 0.1 mg/ml DNase I. The cells were lysed using the French press and cell debris was removed by ultracentrifugation.  The clear supernatant fluid was decanted and filtered through a 45 µm filter and referred to as cleared lysate. The cleared lysate (~20 ml) was loaded onto a 1 cm × 20 cm column of Ni-NTA agarose resin (Qiagen Inc., Mississauga, ON, Canada) preequilibrated with 20 mM sodium phosphate, pH 8.0 containing 10% glycerol.  The column was then washed by the successive passage of 4 column volumes (CV) each of 20 mM sodium phosphate, pH 8.0; 20 mM sodium phosphate, pH 6.3, 300 mM NaCl; and 20 mM sodium phosphate, pH 8.0, 20 mM imidazole, 300 mM NaCl.  The column was then washed with 2 CV of 20 mM sodium phosphate, pH 8.0, 20 mM imidazole.  The proteinase was eluted using 2 CV of 20 mM sodium phosphate, pH 8.0, 150 mM imidazole.  The eluted protein was exchanged into 50 mM Tris-HCl, pH 8.0 by performing three rounds of concentration- dilution using the Amicon Stirred Cell equipped with a YM10 membrane.  The protein 46  solution was concentrated ~10 mg/mL, frozen as beads in liquid nitrogen and stored at - 80 °C. The His tag was removed in buffer 50 mM Tris-Cl pH 8.0, 100 mM NaCl, 1 mM Ca2+ with Factor Xa:3CL (0.002:1, w:w) overnight at 23 °C.  Following overnight digestion, the sample was passed over the above-described Ni-NTA column to remove the cleaved His tags. The column was then washed by the successive passage of: 3 CV 20 mM sodium phosphate, pH 8.0, 1 CV 20 mM sodium phosphate, 1 CV 300 mM NaCl, 20 mM imidazole, pH 8.0; 1 CV 20 mM sodium phosphate, 1 CV 20 mM imidazole, pH 8.0 and 20 mM sodium phosphate, pH 8.0.  The eluted protein from these four washes were combined and exchanged into 20 mM Tris-HCl, pH 7.5 by performing two rounds of concentration-dilution using the Amicon Stirred Cell, equipped with a YM10 membrane and concentrated to ~35 mg/mL.  The concentrated protein was loaded onto a MonoQ 10/10 column preequilibrated with 20 mM Tris-HCl, pH 7.5.  The protein was eluted with a gradient over 20 CV from 0 to 150 mM NaCl in the above buffer.  The fractions containing proteinase were combined, exchanged into 20 mM Tris-HCl, pH 7.5, concentrated to ~ 15 mg/mL, frozen as beads in liquid nitrogen and stored at -80 ºC. Fifty milligrams of 3CLpro was typically obtained from 4 litres of cell culture. 2.5.3 Production of fluorescent proteins expressed from pBAD24 A colony of freshly transformed E. coli BW27783 containing an appropriate plasmid (pBDXCYFPh-1, pBXCyY-1, pBXCyY-4, pBXCyY-1d, pBXCyY-1-16, pBXCy-H or plasmid selected from the libraries (Section 3.5) was grown overnight in 50 mL LB ampicillin at 37 °C.  One litre of prewarmed LB was inoculated with 10 mL of overnight culture and grown at 37 °C.  When the culture attained OD600 of ~ 0.5, it was 47  cooled on the bench briefly and fluorescent protein expression was induced by adding arabinose to a final concentration of 0.2%.  The cells were further incubated overnight at 25 °C, then harvested by centrifugation, and frozen at -80 °C. 2.5.4 Production of ht-YPet A colony from freshly transformed E. coli GJ1158 (p7YP-H) was grown overnight in 50 mL LB (low salt) with ampicillin at 37 °C.  One litre of prewarmed LB (low salt) was inoculated with 10 mL of overnight culture and grown at 37 °C.  When the culture attained OD600 of ~0.5, it was cooled on the bench briefly and fluorescent protein expression was induced by adding NaCl to a final concentration of 300 mM.  The cells were further incubated overnight at 25 °C, harvested by centrifugation, and frozen at -80 °C. 2.5.5 Purification of polyhistadine-tagged fluorescent proteins Polyhistadine-tagged fluorescent proteins were purified using a His GraviTrap (GE Healthcare, Uppsala, Sweden) following the instructions of the manufacturer.  Cells were resuspended in ~35 mL of binding buffer (20 mM sodium phosphate, pH 7.4, 500 mM NaCl, 20 mM imidazole) and lysed using the French press.  Cell debris was removed by ultracentrifugation.  The supernatant fluid was decanted and referred to as cleared lysate. The His GraviTrap Ni Sepharose column was pre-equilibrated using 10 mL of binding buffer.  The cleared lysate was loaded onto the column.  The column was washed with 10 mL of binding buffer and the tagged protein was eluted with 3 mL of elution buffer (20 mM sodium phosphate, 500 mM NaCl, 500 mM imidazole, pH 7.4).  The eluted protein was exchanged into 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 48  by performing three rounds of concentration-dilution using an Amicon Stirred Cell equipped with a YM10 or YM30 membrane.  The protein solution was concentrated to between 5 and 30 mg/mL, flash frozen as beads in liquid nitrogen, and stored at -80 °C. 2.5.6 Production and purification of IAPV proteinase and replicase A colony from freshly transformed E. coli CodonPlus (DE3) RIL (pETXIs3C or pETXIs3BCD) was grown overnight in 50 mL LB kanamycin at 37 °C.  Four litres of prewarmed LB were each inoculated with 10 mL of overnight culture and grown at 37 °C. When the culture attained OD600 of ~ 0.5, it was cooled on the bench briefly and protein expression was induced by adding IPTG to a final concentration of 0.25 mM. The cells were further incubated overnight at 30 °C, harvested by centrifugation, and frozen at -80 °C. Frozen cells from a one liter culture were thawed and resuspended in 10 ml of phosphate buffered saline (PBS) buffer [109], containing 1 mM MgCl2, 1 mM CaCl2, and 0.1 mg/ml DNase I.  The cells were lysed using a French press and cell debris was removed by ultracentrifugation.  The clear supernatant fluid was decanted and filtered through a 45 µm filter and referred to as cleared lysate. The cleared lysate (~20 ml) was loaded onto a 1 cm × 20 cm column of Glutathione Sepharose High Performance resin (Amersham Biosciences) preequilibrated with PBS.  The column was then washed by three successive passages of 10 CV of PBS. The proteinase (IAPV 3Cpro) or replicase fragment (termed IsReplicase) was eluted using 5 CV of 50 mM Tris-HCl, 10 mM reduced glutathione, pH 8.0.  The eluted protein was exchanged into 50 mM Tris-HCl, pH 8.0 by performing three rounds of concentration- dilution using the Amicon Stirred Cell equipped with a YM10 membrane.  The protein 49  solution was concentrated to ~10 mg/mL, frozen as beads in liquid nitrogen and stored at -80 °C. 2.6 Construction of the biological selection system The following section details the construction of the biological selection system. This system consists of a host strain responsive to XylR as well as many variations of XylR and HAV 3Cpro in different plasmids used in combination to test the selection system or to act as appropriate controls. 2.6.1 Creation of biological selection host A biological selection host was generated by creating a strain that was conditionally resistant to chloramphenicol.  As described below, this involved inserting a PU-cat construct into the chromosome of E. coli CC118 rifR.  The cat gene confers resistance to chloramphenicol and is under control of the PU promoter. To generate the conjugation plasmid pUTel, the plasmid pUT-MAD1 (Table 4) was digested with NotI and self-ligated creating pUTel containing two miniTn5 insertion sequences flanking a NotI site and telurite resistance gene. A vector containing the PU promoter with a multiple cloning site downstream was created to facilitate the cloning of selection markers under the control of PU together with flanking NotI cut sites for eventual subcloning into pUTel.  A fragment containing promoters PU and PR together with the xylR gene was released from pUT-MAD1 by digestion with XbaI and BamH1yielding a ~2.5 kb fragment.  This was inserted into pUC18 digested similarly with XbaI and BamH1 to yield pXylR-pR which kept xylR with its cognate PR promoter.  The PU, PR and xylR fragment was subcloned into pUC18Not using the same restriction enzymes to yield pXylR-pU.  This plasmid was then digested 50  with SphI to release the XylR/PR containing fragment.  The ~3.0 kb vector backbone was kept and self ligated to create pUMCS2 which contained the PU promoter followed by a multiple cloning site and flanked by NotI cut sites. The plasmid pU9CXS:Cmr∆P [103] was digested with BamH1 to yield a ~0.8 kb fragment carrying cat.  This fragment was inserted into BamHI digested pUMCS2 to yield pUCm containing the cat gene downstream of the PU promoter and flanked by NotI sites. The plasmid pUCm was digested with NotI to yield a ~1.3 kb fragment containing the PU promoter and cat gene.  This was cloned into NotI-digested pUTel to generate pUTel-pUCm.  E. coli S17.1λ1 was transformed with pUTel-pUCm and conjugated to E. coli CC118 rifr to generate the selection strain E. coli PuCm. 2.6.2 Construction of XylR-based substrates and controls The following section details the construction of plasmids carrying genes encoding XylR, a 3Cpro-cleavable XylR (termed MXR1), or truncated forms of XylR. 2.6.2.1 Creation of plasmid pBAD24X The expression plasmid pBAD24 was altered using oligonucleotide-directed mutagenesis to change the second BamH1 restriction site outside of the multiple cloning site to a unique NotI site.  Mutagenesis was performed using the 5’ phosphorylated primer oBAD(Bam-Not) (Table 2) and yielded plasmid pBAD24X. 2.6.2.2 Cloning the xylR gene The xylR gene from pXylR-pR was subcloned into plasmid pUCP26 as a 2.5 kb BamH1 – XbaI fragment to yield pUCP26XylR.  This construct maintained the xylR gene under control of its cognate PR promoter. 51  The xylR gene was amplified by PCR from pXylR-pR using the primer pair oXR- TIR5 and oXylRdA3.  The resulting ~1.1 kb amplicon was digested with EcoRI and BamHI and inserted into pUC18 to yield pUCWTXRTIR.  The xylR fragment was excised with EcoRI and BamHI and inserted into pFH2 to yield pFH2WTXR, in which xylR is under control of the PT7 promoter. The xylR gene was amplified by PCR using template pXylR-pR and primer pair oXylR3 and oXylR5.  The resulting 1.7 kb amplicon was digested with KpnI and XbaI and inserted into pUC18 to yield pUCXylR. This construct maintained the xylR gene under control of its cognate PR promoter. The xylR gene fragment was excised from plasmid pUCXylR with EcoRI and XbaI and inserted into pBAD24 to yield pBDXylR placing xylR under control of the PBAD promoter. 2.6.2.3 Cloning of the XylR-based substrate mxr1 The gene encoding XylR∆A was amplified by PCR from pXylR-pR using the primer pair XylRdA5 and XylRdA3.  The resulting ~1.1 kb amplicon was digested with BamH1 and inserted into BamH1 site of pUC18Not to yield pUC18XylR∆A5.  The xylR∆A fragment was then subcloned into the BamH1 site of pFH2MS2 to yield pFH2MXR1.  This plasmid contains the gene mxr1 which encodes a cleavable form of XylR with the A domain replaced with the MS2-domain with cleavable linker sequence (LRTQSF). The ~1.4 kb mxr1 DNA fragment of pFH2MXR1 was subcloned into pVLT31 and pBAD24X using EcoR1/KpnI and EcoR1/SphI respectively.  The resulting plasmids, 52  pVLTMXR1 and pBDXMXR1, contain mxr1 under the control of the IPTG inducible PTAC, and arabinose inducible PBAD promoters respectively. 2.6.2.4 Creation of truncated XylR controls The gene encoding XylR∆A was amplified by PCR from pXylR-pR using each of two primer pairs: oXylRdA5-MSF and oXylRdA3; and oXR4-5 and oXylRdA3.  The resulting ~1.1 kb amplicons were digested with EcoRI and SphI and inserted into 1) pBAD24 and 2) pBAD24X to yield pBDXR3 and pBDXXR4, respectively.  In both constructs, the truncated xylR gene is under control of the PBAD promoter. The gene encoding XylR∆A was amplified by PCR from pXylR-pR using the primer pair oXR4-5 and oXylRdA3.  The resulting ~1.1 kb amplicon was digested with BamHI and inserted into BamH1-digested pUC18 to yield pUCXRdA.  This plasmid was then digested with BamHI and the fragment was cloned into BamH1-digested pFH2 to yield pFHXRdA which placed truncated XylR under control of the PT7 promoter. 2.6.3 Cloning of HAV 3Cpro encoding plasmids used for biological selection The following section details the construction of various plasmids containing the HAV 3Cpro for use in the biological selection and biological screening systems. 2.6.3.1 Cloning of the HAV 3Cpro gene The gene encoding HAV 3Cpro was amplified by PCR from pHAV-3CEX using primer pair oH3C-5 and oH3C-3 (Table 2). The reaction was performed using the expand High FidelityTM DNA polymerase system according to the manufacturer’s instructions but with 4 mM MgCl2 and an annealing temperature of 40 °C.  The resulting ~0.7 kb amplicon was digested with KpnI and XbaI and inserted into pUC18not to yield pUCH3C1. 53  The gene encoding HAV 3Cpro was excised from pUCH3C1 using restriction enzymes EcoRI and XbaI and inserted into vector pBAD24 to yield pBDH3C1. This resulting construct contains a single Shine-Delgarno sequence upstream of the start codon engineered for the 3Cpro gene. The HAV 3Cpro gene fragment was also excised from plasmid pUCH3C1 with restriction enzymes KpnI and XbaI and inserted into similarly digested vector pBAD24 yielding plasmid pBDH3C2.  This construct has two Shine-Delgarno sequences upstream of the gene’s start codon. The HAV 3Cpro gene fragment was excised from plasmid pUCH3C1 with restrictions enzymes KpnI and XbaI and inserted into pVLT31 to yield pVLTH3C1. 2.7 Testing the E. coli PuCm biological selection system The biological selection host E. coli PuCm was selected by testing potential exconjugants expressing XylR with its effector 3-methyl-benzyl-alcohol.  The clone with the best growth induced by XylR expression with 3-MBA on chloramphenicol containing plates was labelled selection host E. coli PuCm. 2.7.1 Confirming XylR inducible survival of a E. coli PuCm selection strain During the construction of the biological strain, six independent clones from the pUTel-PuCm mating described in section 2.6.1 were confirmed to be rifampicin- and telurite-resistant but ampicillin-sensitive.  These clones were tested for XylR-dependent survival to select the biological selection strain.  Competent cells of these six clones were transformed with pUCP26XylR and grown on LB containing 50 µg/mL rifampicin, 60 µg/mL telurite and 15 µg/mL tetracycline.  Three colonies from each plate were then grown in 0.5 mL of LB with 15 µg/mL tetracycline at 37 °C and then diluted 1/100 into 54  1% NaCl.  Samples from each dilution were spotted onto plates of LB agar media containing one of the following five sets of supplements: (1) 15 µg/mL tetracycline; (2) 15 µg/mL tetracycline and 10 µg/mL chloramphenicol; (3) 15 µg/mL tetracycline and 20 µg/mL chloramphenicol; (4) 15 µg/mL tetracycline, 10 µg/mL chloramphenicol and 2 mM 3-MBA; and (5) 15 µg/mL tetracycline, 20 µg/mL chloramphenicol and 2 mM 3- MBA.  Appearance of colonies was scored as growth. 2.7.2 Testing cleavage of MXR1 substrate in vivo and in vitro by SDS-PAGE To confirm that substrate MXR1 was cleaved by HAV 3Cpro in vivo, samples co- expressing substrate and proteinase were examined using SDS-PAGE.  Biological selection plasmid pairs pBDMXR1 + pVLTH3C1 and pVLTMXR1 + pBDH3C1 and appropriate empty vector controls were co-transformed into E. coli PuCm and grown on LB agar with the appropriate antibiotics.  Colonies were used to inoculate 50 mL cultures of LB with appropriate antibiotics.  At mid-log phase (OD600 = 0.4 - 0.5), substrate expression was induced with the addition of either arabinose to a final concentration of 0.2% or IPTG to a final concentration of 0.25 mM.  Proteinase expression either remained uninduced or was induced with the addition of either arabinose to a final concentration of 0.2% or IPTG to a final concentration of 0.25 mM.  Samples collected prior to induction and following overnight growth were analysed using SDS-PAGE. To examine in vitro cleavage of MXR1 by addition of purified HAV 3Cpro, cells of E. coli PuCm expressing MXR1 encoded in either pVLTMXR1 or pBDXMXR1 were grown with the appropriate antibiotic following fresh transformation.  At mid-log phase (OD600 = 0.4 - 0.5) substrate expression was induced with the addition of either arabinose to a final concentration of 0.2% or IPTG to a final concentration of 0.25 mM and cells 55  were harvested following overnight growth.  Cells were resuspended in buffer (100 mM potassium phosphate, 2 mM EDTA, pH 7.5) and disrupted using sonication.  The approximate concentration of MXR1 was determined by densitometric analysis of whole cell samples visualized with SDS-PAGE using ImageQuant TL (v2005.04, Amersham Biosciences, Buckinghamshire, UK).  Purified HAV 3Cpro was added in a ratio of 0.5×, 1×, and 2× the estimated concentration of MXR1.  Samples were incubated at 37 °C and aliquots were removed at 0.5, 1, 3, 6 and 16 hours, after addition of proteinase.  Results of digestion were analyzed by SDS-PAGE. 2.7.3 Tests of biological selection system in E. coli PuCm. Testing the biological selection system was done by expressing 1) wild type XylR, 2) cleavable substrate MXR1 with and without proteinase and 3) truncated XylR. Each of these proteins was produced using pVLT31-, pBAD24-, pFH2-, pUC18- and pUCP26-based plasmids.  Combinations of plasmids encoding these proteins, as well as appropriate vector controls were transformed into E. coli PuCm and grown on LB agar with the appropriate antibiotics.  Single colonies were selected and inoculated into 5 mL LB media with appropriate antibiotics and grown overnight.  Then, cultures were diluted to a similar OD600 and equal numbers of cells at various dilutions were plated onto LB agar containing appropriate antibiotics, inducers and 5 – 30 µg/mL chloramphenicol. Growth was judged from the appearance of colonies. 2.8 Testing the biological selection system with the PuLacZ screening system. A screening host, E. coli PuLacZ, was generously donated by Victor de Lorenzo (unpublished).  E. coli PuLacZ resembles E. coli PuCm, except that the lacZ gene was used instead of the cat gene.  An increase in LacZ activity, resulting from induced 56  transcription of lacZ from the PU promoter by XylR and variants in the strain E. coli PuLacZ, can be measured using the Miller assay.  Testing the biological selection system was done by expressing 1) wild type XylR, 2) cleavable substrate MXR1 with and without proteinase and 3) truncated XylR.  Each of these proteins was produced using pVLT31-, pBAD24-, pFH2-, and pUCP26-based plasmids.  Combinations of plasmids encoding these proteins, as well as appropriate vector controls were transformed into E. coli PuLacZ and grown on LB agar with the appropriate antibiotics.  Single colonies were selected and inoculated into 5 mL LB media with appropriate antibiotics and grown overnight at 30 °C.  Cells from this overnight culture were inoculated into a 5 mL culture of LB media with appropriate antibiotics.  At mid-log phase, substrate and proteinase production were induced as appropriate, 3-MBA was added to specific XylR containing cultures, and cultures were grown overnight. The following day, LacZ activity was measured in the cultures using the Miller assay. 2.8.1 Miller (β-galactosidase) assay Following overnight growth, cells were pelleted from 100 µL of culture and resuspended in 100 µL of Z buffer [110].  The cell mixture was added to 900 µL of Z- buffer with β-mercaptoethanol (2.7 mL/L).  One drop (~7 µL) of 0.1% SDS and 2 drops of chloroform (~14 µL) was added, and the samples were vortexed for 10-15 seconds. Tubes containing the samples were left opened stood at room temperature in the fume hood for 15 minutes to allow the chloroform to evaporate.  Then, 200 µL of ONPG (4 mg/mL) was added; samples were vortexed (5 sec) and incubated at room temperature until a yellow colour developed.  The reaction was then quenched with the addition of 500 µL of 1 M NaCO3.  Samples were centrifuged for 5 minutes at maximum speed and 57  the OD420 of the supernatant was measured.  Miller units were calculated using equation 3: Equation 3: 600 420 OD   vt OD  1000  U ×× × = t = time of reaction (min) v = volume of culture used in assay (mL) In this assay, OD600 is a measure of cell density at the start of the assay (following resuspension).  OD420 is a combination of the absorbance of o-nitrophenol and light scattering debris 2.9 Construction of fluorescent protein screening system using CFP and YFP The following section details the construction of HAV 3Cpro-cleavable CFP and YFP-based substrates.  These fluorescent proteins are the mammalian codon optimized eCFP and eYFP proteins available from Clonetech (Mountain View, CA). 2.9.1 Cloning of yfp, and polyhistadine-tag encoded yfp The yfp gene was amplified by PCR from pEYFP-N1 using primer pair oYFP-for and oYFP-rev (Table 2).  The ~0.8 kb amplicon was digested with XbaI and NcoI and cloned into pBAD24X to yield pBDXYFP. To make a polyhistadine-tagged variant of YFP, the yfp gene was amplified by PCR from pBDXYFP using primer pair oYFP-for and oYFP-revhis2.  The ~0.8 kb amplicon was digested with XbaI and NcoI and cloned into pBAD24X to yield pBDXYFPhis2. 58  2.9.2 Cloning of cfp and variants Protein substrates were designed by connecting CFP and YFP with a flexible linker.  This linker was encoded by the PCR primers used to amplify cfp. The reverse primers used in this reaction were designed to remove the stop codon of cfp, to encode the linker sequence, and to contain an NcoI site for in-frame cloning to connect cfp to yfp. Each of four cfp amplicons were generated by PCR using the oligonucleotides and cfp-containing template indicated in Table 5.  The pECYFP-N1, a gift from the Jean lab (Dept. of Microbiology & Immunology, UBC), contained both the cfp and yfp genes. pUCCFP was obtained by cloning the 1.1 kb cfp-containing NdeI-EcoRI fragment of pECYFP-N1 into pUC18.  Amplicons were cloned into pBAD24X and the sequences were confirmed.  Three of these variants were used to generate CFP-YFP concatenated proteins (detailed in 2.9.3) separated by three different linkers.  A fourth construct had a stop codon for CFP followed by a translation enhancing region and ribosome binding site for co-expression of CFP and YFP. Table 5: Oligonucleotides and templates used to construct cfp-containing plasmids. Plasmid Oligonucleotides Template Linker encoded pBDXCFP oCFP-3s/oCFP-5 pECFP-N1 No linker – (CFP and YFP are co-produced). pBDXCFP3.1 oCFP-3.1/oCFP-5 pECFP-N1 LRTQSFS pBDXCFP3.2 oCFP-3.2/oCFP-5 pUCCFP LRTASFS pBDXCFP3.3 oCFP-3.3/oCFP-5 pUCCFP LRTQMFS  2.9.3 Construction linked or co-expressed CPF/YFP substrates The CFP and YFP containing substrates were constructing by cloning cfp and yfp genes encoding the appropriate linkers into the same plasmid such that the genes and linkers were in frame. 59  The ~0.7 kb yfp DNA fragment of pBDXYFP was subcloned into each of pBDXCFP and pBDXCFP3.1 using NcoI and XbaI, yielding pBDXCYFP and pBDXCYFP-1 respectively.  Plasmid pBDXCYFP has genes for both proteins CFP and YFP on a single transcript under the control of the PBAD promoter.  Following the method described by Tan et al. [111] for polycistronic expression, between the cfp and yfp is a translation enhancing region and a second Shine-Delgarno sequence to ensure translation of both genes.  Plasmid pBDXCYFP-1 contains a gene encoding a protein consisting of both CFP and YFP connected by a single cleavable linker with sequence LRTQSFS under control of the PBAD promoter. The ~0.7 kb cfp DNA fragment of pBDXCFP-3.2 and pBDXCFP-3.3 were each subcloned into pBDXYFP using NcoI and EcoR1. The resulting plasmids pBDXCYFP-2 and pBDXCYFP-3 respectively encode the CPF/YFP substrate with flexible linkers LRTASFS and LRTQMFS respectively under control of the PBAD promoter. 2.9.4 Construction of polyhistadine-tagged CFP/YFP substrates The ~0.7 kb fragments of plasmids pBDXCFP3.1, pBDXCFP3.2 and pBDXCFP3.3 digested with EcoR1 and NcoI were cloned into pBDXYFPhis2 to create pBDXCYFPh-1, pBDXCFYPh-2 and pBDXCYFPh-3, respectively. These plasmids encode the N-terminally polyhistadine-tagged CFP/YFP linked substrates under control of the PBAD promoter. 2.10 Construction of fluorescent protein screening system using CyPet and YPet Following the publication of a better FRETing pair of fluorescent proteins (CyPet and YPet) [87], a second fluorescent protein screening system using these proteins was 60  constructed.  Plasmids encoding these fluorescent proteins were a gift from the Daugherty lab [87]. 2.10.1 Cloning genes for polyhistadine-tagged CyPet and Ypet in pBAD24X The cypet gene was amplified by PCR from pCyPet-His using primer pair oCyFor and oCyRev.  The ~0.8 kb amplicon was digested with KpnI and EcoR1 and cloned into pBAD24X to yield pBXCy-H which encoded a polyhistadine-tagged CyPet. The ypet gene was amplified by PCR from pYPet-His using primer pair oYFor and oYRev.  The ~0.8 kb amplicon was digested with PstI and EcoR1 and cloned into pBAD24X to yield pBXYP-H which encoded a polyhistadine-tagged YPet. 2.10.2 Construction of co-expressed CyPet/YPet substrates The ~0.8 kb ypet gene excised from pBXYP-H with enzymes KpnI and PstI and inserted into pBXCy-H to yield pBXCyY-H.  This plasmid has genes for both proteins his-CyPet and YPet on a single transcript under the control of the PBAD promoter.  A consequence of the cloning procedure is that YPet no longer carries a polyhistadine-tag. Between the two genes is a translation-enhancing region and a second Shine-Delgarno sequence to ensure translation of both genes. 2.10.3 Construction of linked CyPet/YPet substrates. Fluorescent fusion proteins for testing as substrates were generated by inserting a short linker consisting of two synthetic semi-complementary oligonucleotides into plasmid pBXCyY-H.  The oligonucleotide duplexes were generated by mixing equal amounts of oligonucleotides, then heating this mixture to 50 ºC and allowing it to cool slowly on the bench.  These oligonucleotide duplexes had 3’ and 5’ overhangs to enable them to anneal to digested vector. 61  Plasmid pBXCyY-H was digested with BamH1 and KpnI and ligated with duplex- forming oligonucleotides oCyY-1-a and oCyY-1-b.  This yielded plasmid pBXCyY-1 which encoded polyhistidine-tagged ht-CyY-1.  Other constructs were generated similarly using the oligonucleotides listed in Table 6. Table 6: Oligonucleotides used to construct genes encoding linked CyPet-YPet fusion proteins. Plasmid Oligonucleotides Protein pBXCyY-1d oCyY-1d-a oCyY-1d-b ht-CyY-1d pBXCyY-1-16 oCyY-1-16a oCyY-1-16b ht-CyY-1-16 pBXCyY-U1 oLinkCY-U1-a oLinkCY-U1-b ht-CyY-U1 pBXCyY-4 oLinkCY-4-a oLinkCY-4-b ht-CyY-4  2.11 Testing biological screen based on CFP and YFP or CyPet and YPet Several methods of measuring and observing substrate cleavage with the biological screening system were developed and cleavage of the substrates by HAV 3Cpro in vivo was replicated with in vitro cleavage experiments. 2.11.1 Native-PAGE of cells expressing fluorescent proteins Native-PAGE gels (i.e. non-denaturing conditions) were made following the method of Park and Raines [112].  For whole cell samples from a liquid culture, the equivalent of 1 mL of cells with an OD600 of 0.85 were harvested, resuspended in 10 µL of BugbusterTM (Novagen, San Diego, CA), and incubated at room temperature for 20 minutes.  Loading buffer and water were then added to a final volume of 50 µL, of which 10 µL was loaded onto the native-PAGE gel.  To analyze colonies, cells were plated onto 62  media containing appropriate antibiotics and 0.2 % arabinose and grown overnight at 37 °C.  A single colony resuspended in 10 µL of BugbusterTM (Novagen, San Diego, CA), and incubated at room temperature for 20 minutes.  After lysis, 2 µL of 6× loading buffer was added and the entire sample loaded onto the native-PAGE gel.  Native-PAGE results were visualized using the Typhoon 9400 (Amersham Biosciences Corp., Sunnyvale CA.) with filter sets CFP/CyPet (λex = 457 nm, λem = 526 nm) and YFP/YPet (λex = 532 nm, λem = 526 nm) according to manufacturer user manual. 2.11.2 Measuring fluorescent protein cleavage using fluorescent plate reader and fluorimeter Fluorescent samples (whole cells, raw extracts or pure proteins) characterized using the Varian Eclipse Fluorescence Spectrophotometer (Varian, Cary, NC) were measured in a 100 µL quartz cuvette and scanned (λex = 434 nm, λem = 446-600 nm).  The F477/F527 value was calculated from λem 477 nm/ λem 527 nm (CyPet and YPet emission maxima, respectively). Fluorescence of whole cells was also measured using the plate-reader.  Cells were resuspended in 100 µL of buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 at 37 °C, transferred to a black clear bottom plate and OD595, YPet (λex = 485 nm, λem = 535 nm), CyPet (λex = 430 nm, λem = 470 nm) and FRET (λex = 430 nm, λem = 535 nm) signals were measured using the Victor2 fluorescence plate reader (PerkinElmer, Woodbridge, ON, Canada). Kinetics of cleavage of the fluorescent protein substrates was measured using two instruments, a fluorimeter (Varian Eclipse Fluorescence Spectrophotometer (Varian, Cary, NC)) and plate-reader (Victor2 fluorescence plate reader (PerkinElmer, 63  Woodbridge, ON, Canada)).  Kinetics of cleavage measured on the fluorimeter was done with a 100 µL quartz cuvette with buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 at 37 °C.  Fluorescence was measured with λex = 434 nm, CFP: λem = 477 nm, FRET: λem 527 nm.  The initial rate was calculated using the first 5 minutes of the progress curve (i.e., the linear portion of the progress curve).  Kinetics of cleavage measured on the plate-reader was done in a 96-well black plate with buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 at 37 °C and a final volume of 100 µL. Fluorescence was monitored with two settings: 1) CyPet (λex = 430 nm, λem = 470 nm) and 2) FRET (λex = 430 nm, λem = 535 nm).  The initial rate was calculated from the first 45 minutes of the progress curve (i.e., the linear portion of the progress curve). 2.11.3 Testing in vivo cleavage of CYFP-based substrates To test in vivo cleavage and stability of the cleavage products of the different CYFP-based substrates, both substrate and proteinase were co-expressed in E. coli BW27783.  Cleavage was measured by examining the fluorescent profile of both whole cells and cleared lysates and by visualizing fluorescent proteins in the cleared lysate using native-PAGE. E. coli BW27783 cells were co-transformed with one of pBDXCFP, pBDXCYFP, pBDCYFP-1, pBDXCYFP-2, pBDXCYFP-3 or pBDXYFP and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  Five millilitres of LB media with ampicillin and tetracycline were inoculated with a fresh colony and grown at 37 °C overnight.  Then, 50 mL of prewarmed LB with ampicillin and tetracycline was innoculated with 250 µL of the overnight culture and grown at 37 °C.  Cultures were grown to an OD600 of ~0.5 and fluorescent protein production was 64  induced with the addition of arabinose to a final concentration of 0.2%.  Following overnight growth, two different samples were collected: whole cells and cleared lysates. Whole cells (100 µL of overnight culture) were scanned using the fluorimeter.  Cleared lysates were collected from the remaining cells of the 50 mL culture and were harvested by centrifugation, resuspended in 20 mM Bis-Tris, 2 mM DTT, pH 7.0 and broken open using a beadbeater (FastPrep120, Thermo Electron Corporation, Waltham, MA) set at power 6.0, for 15 s, × 5 runs with 3 minutes incubation on ice between runs.  The supernatants were then cleared by centrifugation at maximum speed for 20 min at 4 °C. The resulting cleared lysates were scanned in a similar manner and the fluorescent proteins in 30 µg of total cell protein were visualized by native-PAGE. 2.11.4 Time course of cleavage of fusion proteins by co-expressed HAV 3Cpro To further characterize the in vivo cleavage of the three CFP/YFP based substrates by co-expressed HAV 3Cpro, cells expressing both substrate and proteinase were harvested at various times and the fluorescent proteins were visualized using native- PAGE. E. coli BW27783 cells were co-transformed with one of pBDCYFP-1, pBDXCYFP-2 or pBDXCYFP-3 and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  Five millilitres of LB media with ampicillin and tetracycline were inoculated with a fresh colony and grown at 37 °C overnight.  Then 50 mL of prewarmed LB with ampicillin and tetracycline was inoculated with 250 µL of the overnight culture and grown at 37 °C.  Cultures were grown to an OD600 of ~0.5 and fluorescent protein expressed was induced with the addition of arabinose to a final concentration of 0.2%.  After 0, 1, 3, 6 and 16 hours 65  growth following induction, whole cells were collected from the samples and fluorescent proteins were visualized using native-PAGE. 2.11.5 Detection of cleavage of CYFP-based substrates in single colonies A rapid method using minimal resources was developed to examine in vivo cleavage of fluorescent CYFP-based substrates by co-expressed HAV 3Cpro.  E. coli BW27783 cells were co-transformed with one of pBDXCFP, pBDXCYFP, pBDCYFP-1, pBDXCYFP-2 or pBDXCYFP-3 and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin, tetracycline, 0.2 % arabinose and with or without 0.2 % lactose.  Colonies were selected and lysed and the fluorescent proteins were visualized using native-PAGE. 2.11.6 In vitro cleavage of purified CYFP-1 To characterize in vitro cleavage of pure ht-CYFP-1 by HAV 3Cpro, purified ht- CYFP-1 substrate at a concentration of 3.9 mg/mL was mixed with purified HAV 3Cpro in a ratio of 5:1 or 50:1 (w:w) CYFP-1:3Cpro and incubated at 37 °C in 100 mM potassium phosphate, 2 mM EDTA, pH 7.5.  Samples were removed at various times and protein was visualized by SDS-PAGE. 2.11.7 Comparing CFP/YFP based substrates with CyPet/YPet substrates by native- PAGE To compare the original CFP/YFP proteins with the new FRET optimized CyPet/YPet proteins when visualized by native-PAGE, cultures expressing the two sets of proteins were grown under different but optimal condition to allow the best visualization by native-PAGE. 66  E. coli BW27783 cells were transformed with one of pBAD24, pBDXCFP, pBDXCYFP, pBDCYFP-1, pBXCy-H, pBXYP-H, pBXCyY-H or pBXCyY-1 and grown overnight at 37 °C on LB agar media with ampicillin.  Five millilitres of LB media with ampicillin were inoculated with a fresh colony and grown at 30 °C overnight.  Then, 50 mL of prewarmed LB with ampicillin was inoculated with 250 µL of the overnight culture and grown at 37 °C.  Cultures were grown to an OD600 of ~0.4 and fluorescent protein expression was induced with the addition of arabinose to a final concentration of 0.2%.  The CFP/YFP based cultures were sampled following overnight growth at 37 °C. The CyPet/YPet based cultures were sampled following seven hours growth at 25 °C. Fluorescent proteins from the whole cells were visualized using native-PAGE. 2.11.8 Culture age dependence of the F477/F527 value To determine the culture age dependence of the F477/F527 value of cells producing either a) ht-CyPet and YPet (simulating cleaved substrate) or b) the fusion protein substrate ht-CyY-1, cultures expressing these proteins were sampled at various times, fluorescence was measured using the fluorimeter and the F477/F527 values were calculated. E. coli BW27783 cells were transformed with plasmids pBXCyY-H and pBXCyY-1 and grown overnight at 37 °C on LB agar media with ampicillin.  Five millilitres of LB media with ampicillin was inoculated with a fresh colony and grown at 30 °C overnight.  Then, 50 mL of prewarmed LB with ampicillin was inoculated with 250 µL of the overnight culture and grown at 37 °C.  Cultures were grown to an OD600 of ~0.5 and fluorescent protein expression was induced with the addition of arabinose to a final concentration of 0.2%.  Following induction, samples were removed at various times, normalized to OD600 and stored at -80 °C until further analysis. 67  Cells were thawed and resuspended in 50 µL of 100 mM potassium phosphate, 2 mM EDTA pH 7.5 and a 1:10 dilution of each sample was scanned using the fluorimeter. To evaluate the effect of cell concentration on the F477/F527 value, various dilutions of cells harvested 7 and 18 hours following addition of inducer were prepared. The OD600 was measured in a 100 µL quartz cuvet in the Cary 6000 (Varian, Cary, NC) and samples was scanned with the fluorimeter and the F477/F527 value calculated. 2.11.9 Dependence of fusion protein cleavage on linker length The kinetics of cleavage by HAV 3Cpro of three substrates (ht-CyY-1, ht-CyY-1d and ht-CyY-1-16) was measured to determine optimum linker length for the biological screening system.  The concentration of substrate was 25 µM and the concentration of HAV 3Cpro was 1 µM.  The resulting progress curves were recorded using the fluorimeter.  The relative specific activity of the three substrates was ranked. 2.11.10 Testing the biological screening system in liquid cultures The cleavage of ht-CyY-1 by co-expressed HAV 3Cpro as observed by a change in fluorescence was investigated in cells grown in 50 mL liquid culture. E. coli BW27783 cells were co-transformed with one of pBXCy-H, pBXYP-H, pBXCyY-H, pBXCyY-1, pBXCyY-4 or pBXCyY-U1 and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  Five millilitres of LB media with ampicillin and tetracycline were inoculated with a fresh colony and grown at 30 °C overnight.  Then, 50 mL of prewarmed LB with ampicillin and tetracycline was inoculated with 250 µL of the overnight culture and grown at 37 °C. Cultures were grown to an OD600 of ~0.4, briefly cooled and fluorescent protein expression was induced with the addition of arabinose to a final concentration of 0.2% 68  and cells were grown at 25 °C.  Cell samples were harvested at 3, 5 and 7 hours following induction, normalized for OD600 and stored at -20 °C. After thawing, cells were resuspended in 50 µL of buffer 100 mM potassium phosphate, 2 mM EDTA pH 7.5 and a 1:10 dilution was scanned using the fluorimeter. 2.11.11 Maintaining the F477/F527 value following overnight expression Following overnight growth the F477/F527 value of cleaved and uncleaved substrates converged.  The addition of glucose to halt excess fluorescent protein expression was investigated. E. coli BW27783 cells were co-transformed with pBXCyY-1 or pBXCyY-U1 and pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  Five millilitres of LB media with ampicillin and tetracycline were inoculated with a fresh colony and grown at 30 °C overnight.  Then, 50 mL of prewarmed LB with ampicillin and tetracycline was inoculated with 500 µL of the overnight culture and grown at 37 °C.  Cultures were grown to an OD600 of ~0.4 - 0.6, briefly cooled and fluorescent protein expression was induced with the addition of arabinose to a final concentration of 0.2% and cells were grown at 25 °C.  Following 2 or 4 hours growth, cells were harvested by centrifugation and switched to 50 mL of LB media with ampicillin, tetracycline, 0.2% glucose and with and without additional induction with 0.5 mM IPTG and grown again at 25 °C.  Samples were removed at 2, 4, 6 and 16 hours following the media exchange, normalized to OD600 and stored at -20 °C. After thawing, cells were resuspended in 50 µL of buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 and then a 1:10 dilution was scanned using the fluorimeter. 69  2.11.12 Testing the biological screening system in 96-well plates To test if a difference between cleaved and uncleaved fluorescent substrates could be observed in cells grown in a 96-well plate, cleavable and uncleavable substrates were expressed with and without co-expressed proteinase. E. coli BW27783 cells were co-transformed with pBXCyY-1, pBXCyY-H or pBXCyY-U1 and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  A 96-deep well plate containing 1.5 mL of LB with ampicillin, tetracycline and 0.2 % arabinose in each well was inoculated with a picked colony and grown in a sealed Ziplock freezer bag (S. C. Johnson and Sons, Brantford, ON) that had been filled with 100 % oxygen.  Cells were grown overnight at 37 °C, harvested by centrifugation and either frozen at -80 °C or exchanged into 1.5 mL of LB with ampicillin, tetracycline and 0.2 % glucose and grown for an additional 6 hours before being harvested and frozen at -80 °C.   After thawing, cells were resuspended in 100 µL of buffer and fluorescent signal was measured using the plate reader. 2.11.13 Use of exogenously added proteinase in plate-based assays Cleavage of fusion substrate from cells grown in a 96-well plate was tested by addition of purified HAV 3Cpro to both the raw extract and cleared cell lysates . E. coli BW27783 cells were co-transformed with pBXCyY-1, pBXCyY-H or pBXCyY-U1 and pVLT31 or pVLTH3C1 and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  A 96-deep well plate containing 1.5 mL of LB with ampicillin, tetracycline and 0.2 % arabinose in each well was inoculated with a colony, the plate was sealed with breathable sealing tape (Nalge Nunc International, 70  Rochester, NY) and grown in a sealed Ziplock freezer bag (S. C. Johnson and Sons, Brantford, ON) that had been filled with 100 % oxygen.  Cells were grown overnight at 37 °C and harvested by centrifugation the next morning and either frozen at -80 °C or exchanged into 1.5 mL of LB with ampicillin, tetracycline and 0.2 % glucose and grown for an additional 6 hours before being harvested and frozen at -80 °C.  After thawing, cells were resuspended in 50 µL of BugbusterTM (Novagen, San Diego, CA) and incubated on the bench for 20 minutes.  Then, 350 µL of buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 was added and this raw extract, or lysate cleared by centrifugation were tested with HAV 3Cpro. To measure cleavage, 100 µL of either raw extract or cleared lysate were added to a black 96-well plate and prewarmed at 37 °C.  Initial fluorescence of YPet, CyPet and FRET were measured.  The reaction was started with the addition of HAV 3Cpro to a final concentration of 0, 0.25, 0.5 and 1 µM and changes in FRET signals were measured over 2.5 hours.  The initial velocity was calculated from the first 45 min of the progress curve. 2.12 Screening the specificity of HAV 3Cpro The specificity of HAV 3Cpro was screened with two libraries.  These libraries were based on substrate ht-CyY-1 where one position in the linker in each library was randomized. 2.12.1 Calculation of library size The size of the library required to screen the specificity of HAV 3Cpro was determined using Equation 4. Equation 4: f)-ln(1 P)-ln(1 =n 71  In this equation, P is the probability of coverage and f is the frequency of variation [109]. 2.12.2 Construction of library To generate the libraries of plasmids encoding cleavable linkers, the yfp gene was amplified by PCR from pBDXYFP using oligonucleotides oLRTQXSF-YPet, or oXRTQSFS-YPet and oYFP-revhis2.  The sequence NN(G/T) was used to encode each X in the linkers.  This sequence was chosen to minimize the number of stop codons present in the library.  The resulting ~0.8 kb amplicons were digested with BamHI and HindIII and inserted into pBXCy-H to yield libraries P1’ and P4 respectively.  These libraries encoded an N-terminally polyhistadine-tagged linked CyPet and YPet connected by a potentially cleavable linker randomized at the P1’ or P4 positions. 2.12.3 Screening of fusion protein library In a manner similar to that described in section 2.11.13, E. coli BW27783 cells were transformed with pBXCyY-1, pBXCy-H, pBXCyY-U1 and libraries P1' and P4, and grown overnight at 37 °C on LB agar media with ampicillin and tetracycline.  For each library, 96-deep well plates containing 1.5 mL of LB with ampicillin, tetracycline and 0.2 % arabinose in each well were inoculated with a single colony from the transformation plates.  For the P4 library, 176 clones were screened, for the P1’ library, 154 clones were screened.  Using Equation 4, where P is 0.99 and f is 1/32, a total of 145 clones must be screened to ensure 99% coverage of the least represented amino acid in the library (Trp is represented once in a library with sequence NN(G/T)).  Cultures were grown in a sealed Ziplock freezer bag (S. C. Johnson and Sons, Brantford, ON) that had been filled with 100 % oxygen.  Cells were grown overnight at 37 °C and then harvested 72  by centrifugation and stored at -80 °C.  After thawing, cells were resuspended in 50 µL of BugbusterTM (Novagen, San Diego, CA) and incubated on the bench for 20 minutes. Then, 350 µL of buffer 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 was added, the sample was then centrifuged and the clearedy lysate was screened. To measure cleavage, 100 µL of the cleared lysate was added to a black 96-well plate and prewarmed at 37 °C.  Initial fluorescence of YPet, CyPet and FRET was measured.  The reaction was started with the addition of HAV 3Cpro to a final concentration of 1 µM and changes in CyPet and FRET signals were measured over 2.5 hours.  Initial rates of reaction were calculated by finding the fastest rate of FRET signal disappearance over 45 minutes and this rate was plotted against initial YPet signal to account for low fluorescent substrate expressing cultures or those that contained a stop codon in the linker.  Those samples that had a large YPet signal and a high rate normalized to YPet signal were selected for sequencing. 2.12.4 Kinetic characterization of substrates selected from the P1’ HAV 3Cpro screen Three substrates identified from the P1' specificity screen identified as ht-CyY- 1A, -1G and -1V, differed from ht-CyY-1 in having an Ala, Gly and Val, respectively at the P1' position instead of Ser.  These substrates were purified by IMAC and analyzed using steady-state kinetics.  The concentration of substrate was 4.5 µM and the concentration of HAV 3Cpro was 1 µM.  The resulting progress curves were recorded using the fluorimeter.  The relative rates were calculated using the linear fit function of Excel 2003 (Microsoft, Redmond, WA). 73  2.13 The replicase of IAPV Alignments guiding the construction of clones encoding the 3Cpro and a portion of the replicase, respectively, are presented in section 3.6. 2.13.1 Cloning portions of the IAPV replicase A fragment of DNA encoding IAPV 3Cpro was amplified by PCR using the oligonucleotides oIs3C-Xa-for and oIs3C-rev (Table 2) and plasmid pA-8 (Table 4) provided by Ilan Sela (The Hebrew University of Jerusalem).  The resulting ~0.7 kb amplicon was digested using SpeI and HindIII, and inserted into pET41b to yield pETXIs3C.  This plasmid encodes a GST-tagged IAPV 3Cpro with a Factor Xa cleavage sequence for tag removal. A fragment of DNA encoding residues 887-1900 of the IAPV replicase (Rep887- 1900) was amplified by PCR from pA-8 using the oligonucleotides oIs3BCD-for and oIs3ABCD-rev.  The resulting ~3.1 kb amplicon was digested using SpeI and PstI, and inserted into pET41b.  The resulting construct, pETXIs3BCD, encodes a GST-tagged fragment of the replicase that includes the 3Cpro flanked by 3D and a portion of 3B. 2.13.2 Characterization of the purified replicase fragment Following SDS-PAGE analysis of protein purified by affinity chromatography, a 45 kDa protein (labelled Frag45) was excised from the Coomassie stained gel, destained and digested in-gel using trypsin [113].  Samples were submitted to NAPS for LTQ- orbitrap mass analysis of the peptide fragments.  The digested protein was identified using the MASCOT search engine (www.matrixscience.com).  Searches were performed without constraining protein molecular mass or isoelectric point and allowing for the 74  following modifications: carbamidomethylation of cysteine, partial oxidation of methionine residues, and up to one missed trypsin cleavage. 2.14 Inhibitor studies of HAV 3Cpro and SARS 3CLpro With collaborators from McMaster University, University of Alberta and the Georgia Institute of Technology, several inhibitors against HAV 3Cpro and SARS 3CLpro acting through a variety of mechanisms were screened and characterized. 2.14.1 Standard reaction conditions for measuring HAV 3Cpro, SARS 3CLpro and IAPV 3Cpro activity The enzymatic activity of SARS 3CLpro was measured by following the increase in fluorescence due to the cleavage of the SARS-P2 fluorogenic peptide: Abz-Ser-Val- Thr-Leu-Gln-Ser-Gly-(NO2)Tyr-Arg, where Abz is aminobenzoate and (NO2)Tyr is nitrotyrosine.  Fluorescence was measured using a Varian Eclipse Fluorescence spectrophotometer (Varian Canada, Mississauga, Ontario, Canada).  Experiments were performed using a 100 µl quartz cuvette.  The standard assay was with 20 mM Bis–Tris, 2 mM DTT, pH 7.0 and was performed at 37 °C.  The reaction was started with the addition of enzyme and progress curves were monitored (λex = 320 nm and λem = 420 nm).  Initial velocities were determined from a least-squares analysis of the linear portion of the progress curves (~1 min) using Excel 2003 or Excel 2007 (Microsoft, Redmond, WA).  All rates were corrected for the inner filter effect using an empirical correction and peptide Abz-SVTLQ [114]. The steady-state proteolytic activities of HAV 3Cpro was measured using the fluorogenic peptide substrates Dabcyl-GLRTQSND(edans)G.  Standard assays were performed in 0.1 M potassium phosphate, 2 mM EDTA, pH 7.5 at 37 °C.  Progress 75  curves were measured using either the Victor2 fluorescence plate reader (PerkinElmer, Woodbridge, ON, Canada) or Varian Eclipse Fluorescence spectrophotometer (Varian Canada, Mississauga, Ontario, Canada).  For progress curves measured using the fluorescent plate reader, substrate and inhibitor were prewarmed for three minutes in black 96-well microplates in a total volume of 200 µl before the reaction was started with the addition of enzyme (λex = 355 nm, λem = 460 nm).  For progress curves measured using the fluorimeter, the assay was performed using a 100 µL quartz cuvette.  Substrate and inhibitor were prewarmed for 3 minutes before the reaction was started with the addition of proteinase (λex = 340 nm, λem = 490).  In both cases, initial velocities were determined from a least-squares analysis of the linear portion of the progress curves (~3 min) using Excel 2003 or Excel 2007 (Microsoft, Redmond, WA).  All rates were corrected for the inner filter effect using an empirical correction and peptide SND(edans)G [114]. The specific activity of purified IAPV GST-3Cpro was measured using the SARS- P2 fluorogenic peptide. The standard assay was performed in 50 mM Tris-HCl pH 8.0 at 37 °C with 30 µM substrate and 34 µg of protein.  The reaction was started with the addition of enzyme and progress curves were monitored (λex = 320 nm and λem = 420 nm) using the Victor2 fluorescence plate reader (PerkinElmer, Woodbridge, ON, Canada). Initial velocities were determined from a least-squares analysis of the linear portion of the progress curves (~30 min) using Excel 2003. 2.14.2 Proteinase specificity of SARS 3CLpro inhibitors from the Maybridge library With collaborators at McMaster University, the SARS 3CLpro was screened against a library of 50 000 compounds from the Maybridge Plc. library (Cornwall, UK). 76  Compounds that reduced the activity of 3CLpro to half of the average residual activity of the controls were characterized as primary hits.  These were grouped by functionality using ChemTree (v. 3.2.1, Golden Helix, Bozeman, MT) and a total of five representative compounds from each cluster were selected for further characterization [60].  These five inhibitors (secondary hits) were tested against each of HAV 3Cpro, NS3pro, chymotrypsin and papain to evaluate inhibitor specificity.  The work on chymotrypsin and papain was performed by collaborators. The dose-response of the secondary hits was determined with papain (Calbiochem, La Jolla, CA), bovine pancreas chymotrypsin (Calbiochem), HAV 3Cpro and the hepatitis C nonstructural 3 proteinase (NS3pro) (181 amino-terminal portion of the enzyme purified according to [115]; a gift from the Jean lab (Dept. of Microbiology & Immunology, UBC)) in the presence of five to eleven concentrations of each inactivator (5 nM – 500 µM).  Activity assays for papain (5 nM) and chymotrypsin (200 pM) were done at room temperature in a total volume of 50 µl in black 384-well microplates (Corning, Corning, NY).  Activity assays for HAV 3Cpro (0.5 µM) and NS3pro (0.23 µM) were done in black 96-well microplates in a total volume of 200 µl at 37°C and 30°C, respectively.  The substrate for papain and chymotrypsin was a casein derivative extensively labeled with the green-fluorescent BODIPY FL dye (Molecular Probes, Eugene, OR) (50 and 10 nM substrate for papain and chymotrypsin assays, respectively). Substrates for HAV 3Cpro and NS3pro were 10 µM Dabcyl-GLRTQSND(Edans)G and 100 µM Abz-DDIVPCSMSY(NO2)T (a gift from the Jean Lab [116]), respectively. Enzyme activity for all proteinases was determined by continuous monitoring of reactions using either the Analyst HT (Molecular Devices Corp.) or Victor2 fluorescence 77  plate readers.  Excitation and emission wavelengths, respectively, for each proteinase assay were 485 and 530 nm (papain and chymotrypsin), 355 and 460 nm (HAV 3Cpro), and 340 and 430 nm (NS3pro).  Buffer systems for each proteinase were as follows: papain, 10 mM MES (pH 6.2), 200 mM NaCl, 2 mM EDTA, and 1 mM DTT; chymotrypsin, 50 mM Tris/HCl (pH 7.8); HAV 3Cpro, standard buffer conditions; NS3pro, 50 mM HEPES (pH 7.3), 150 mM NaCl, 0.1% Triton X-100, and 1 mM DTT.  For the NS3pro activity assay, the enzyme was incubated with 15 µM 4A activating peptide (acetyl-KKKGSVVIVGRIILSGR-NH2) at 30 °C for 15 min in reaction buffer, and then incubated with inhibitor for an additional 15 min before initiation of the reaction with substrate [116].  Dose-response data for these proteinases with the secondary hits were fit to Equation 5, excluding HAV 3Cpro with MAC-5576, which was fit to Equation 6, Equation 5:    S       + = 50IC [I]1 a v  Equation 6:  c IC [I]1 a v 50 +       + = S where v is the background corrected reaction rate, a is the reaction rate in the absence of inhibitor, [I] is the concentration of inhibitor, s is the slope factor and c is the calculated background as enzyme activity at the highest concentration of inhibitor did not fall to zero [60]. 2.14.3 Competitive inhibitors of SARS 3CLpro (HIP2-171-2 and MAC-5576)  Competitive inhibition of SARS 3CLpro by a keto-glutamine analogue (HIP2- 171-2; (S)-2-((2S,3R)-2-((S)-2-acetamido-3-methylbutanamido)-3-tert- 78  butoxybutanamido)-N-((S)-4-(1,4-dioxo-3,4-dihydrophthalazin-2(1H)-yl)-3-oxo-1-((S)-2- oxopyrrolidin-3-yl)butan-2-yl)-4-methylpentanamide synthesized by collaborators at the University of Alberta) was characterized using steady-state kinetics.  The concentration of SARS 3CLpro was 0.1 µM in standard buffer conditions.  The concentration of inhibitor was varied between 0 and 1800 nM and the concentration of SARS-P2 peptidic substrate was varied from 16 to 160 µM. These substrate and inhibitor concentrations were dictated by solubility limitations and the observed rates of inhibition.  Parameters of competitive inhibition were evaluated by fitting Equation 7 to the data using the least- squares and dynamic weighting options of LEONORA [117]. Equation 7: [s]+)[I]/+(1 [s] icm max KK V =v Competitive inhibition of SARS 3CLpro by the halopyridinyl ester, MAC-5576, was characterized using steady-state kinetics.  The concentration of SARS 3CLpro was 0.1 µM in standard buffer conditions.  The concentration of inhibitor was varied between 0 and 20 µM and the concentration of SARS-P2 peptidic substrate was varied from 7.5 to 60 µM.  Parameters of competitive inhibition were evaluated by fitting Equation 7 to the data using the least-squares and dynamic weighting options of LEONORA [117]. 2.14.4 Irreversible aza-peptide epoxide inhibition of SARS 3CLpro Inhibition of SARS 3CLpro by an aza-peptide epoxide (APE), a class of inhibitors that have been previously shown to be irreversible [118], was characterized using steady- state kinetics. In inhibition studies, the assay contained 25 nM SARS 3CLpro in standard buffer conditions.  The concentration of APE was varied from 0 and 10 µM and the 79  concentration of SARS-P2 peptidic substrate was varied from 16 -to 100 µM. The rate of inactivation at each concentration of substrate and inhibitor, js, was determined by fitting equation (8) [119] to the corresponding progress curve using SCIENTIST version 2.01 (Micromath Scientific Software, Salt Lake City, UT). The parameters of inactivation, kinact and Ki, were evaluated by fitting Equation 9 to the js obtained at each concentration of S and I, [120] using the least-squares and dynamic weighting options of LEONORA [117]. Equation 8: is j t P+)te(P=P −∞ −1 Equation 9: [I]+)K[S]+(K [I]k =j mi inact s /1  2.14.5 Pyridinyl inhibitor library screening of HAV 3Cpro A previously developed library of 82 pyridinyl esters based on MAC-5576 that yielded potent inhibitors of SARS 3CLpro [61] was screened against HAV 3Cpro.  Initial inhibitor screening and IC50 determination for HAV 3Cpro were done using a 96-well plate reader and standard reaction conditions.  Cleavage by 0.1 uM of HAV 3Cpro of substrate (10 µM) with inhibitor (0.25–10 µM) was measured using the fluorescent plate reader. Determination of Ki using Equation 7 was done using the fluorometric assay. Steady-state equations were fitted to the initial-rate data using the least-squares and dynamic weighting options of LEONORA [117]. 2.14.5.1 Pyridinyl ester hydrolysis assay as measured by HPLC Pyridinyl ester hydrolysis was monitored using an HPCL.  Assays were performed at 37 °C in HPLC vials containing 400 µL of standard buffer, 2 µM proteinase, 80  and 10–75 µM pyridinyl ester.  Reactions were initiated with the addition of the ester. Aliquots of 50 µL were withdrawn and analyzed using a Waters 2695 separation module equipped with Phenomenex prodigy 10 µ OD-prep column and a Waters 2996 photodiode array detector.  The column was operated at a flow rate of 1 mL/min and developed using the following three-step profile: 1 mL 5% acetonitrile in 0.05% formic acid/H2O; 10 mL linear gradient of 5–100% acetonitrile in 0.05% formic acid/H2O; and 1 mL 100% acetonitrile.  Rates were calculated over the first hour of the reaction. Enzymatic rates were corrected for non-enzymatic hydrolysis.  Amounts of product were calculated using a standard curve constructed using known amounts of product. 2.14.5.2 Mass spectrometry of HAV 3Cpro: prydinyl-ester enzyme-inhibitor complex Samples of HAV 3Cpro were prepared by reacting 50 µM enzyme with 100 µM pyridinyl ester in 100 mM potassium phosphate buffer, pH 7.5, 2 mM EDTA at 37 °C for 2 or 10 min.  Samples were quenched with 25% acetic acid and submitted to NAPS for MALDI-TOF analysis.  81  Chapter Three:  Results 3.1 Results of phylogenic analysis Alignments of the 3Cpro’s from families Picornaviridae and Dicistroviridae together with the 3CLpro’s from the family Coronaviridae show a conservation of the catalytic Cys and His residues (Figure 3).  The third member of the catalytic triad is either an Asp or Glu in picornaviral and discistroviral 3Cpro’s, but is not present in the coronavirus proteinases.  Further distinguishing the coronaviral proteinases is the additional third dimerization domain not present in picornaviral and discistroviral 3Cpro’s and which was removed for the purpose of the alignments.  A third conserved residue in all sequences is the His corresponding to His 191 of HAV 3Cpro.  This residue is responsible for the Gln specificity at the P1 position. Phylogenetic analysis of alignments of the 30 3Cpro and 3CLpro’s reflects the viral taxonomic divisions.  Indeed, the proteinases clearly group into Picornaviridae, Dicistroviridae and Coronaviridae families.  Picornaviridae and Dicistroviridae are classified together in the order Picornavirales, and this classification is reflected in the phylogenetic tree of the 3Cpro and 3CLpro's (Figure 4). 3.2 XylR-based biological selection and screening systems The biological selection and screening systems were based on cleavage of an engineered transcriptional regulator, XylR, designed to stimulate transcription from its cognate promoter PU.  A selection host was created by inserting the chloramphenicol resistance gene downstream of the PU promoter and then inserting this into the chromosome of E. coli CC118rifR creating strain E. coli PuCm.  The screening host was a previously constructed strain in which the lacZ gene is under the control of the PU 82  promoter and placed on the chromosome of E. coli CC118.  As described below, the functionality of these hosts was tested by transforming them with two plasmids expressing: (1) MXR1, a cleavable form of XylR, and (2) HAV 3Cpro.  Plasmids encoding various forms of the MXR1 substrate were used as controls 3.2.1 Creation of selection host E. coli PuCm The chloramphenicol resistance gene, cat, was chosen for the biological selection system because chloramphenicol resistance is proportional to CAT concentration [121]. This property would allow for a more tunable selection system and may enable the rank ordering of variant proteinases in a selection. The cat gene from pU9CXS:Cmr∆P  [103] was first cloned into pUMCS2 which placed the gene under the control of the PU promoter. The gene and promoter were then cloned into pUTel generating pUTel-PuCm.  The latter was conjugated into E. coli CC118rifR using E. coli S17.1λpir as a donor strain.  Strains that had rifampicin and telurite resistance but ampicillin sensitivity were identified as exconjugants having the PU-Cm construct on the chromosome. To select a biological selection strain, six independent clones from the pUTel- PuCm mating were selected for further testing with XylR.  Each of the six exconjugants was transformed with pUCP26XylR and grown on LB agar with selection for the strain and plasmid.  Next, liquid LB cultures were started with colonies from the plates and grown with the same antibiotic selections but without telurite as cells could not grow in liquid media with telurite even with the appropriate resistance genes.  After overnight growth, a 1/100 dilution of cells from each culture was spotted onto LB agar supplemented with one of the following: (1): 15 µg/mL tetracycline; (2) 15 µg/mL 83  tetracycline and 10 µg/mL chloramphenicol; and (3) 15 µg/mL tetracycline, 10 µg/mL chloramphenicol and 2 mM 3-MBA.  Each of the six exconjugants grew on 15 µg/mL tetracycline confirming maintenance of pUCP26XylR.  Moreover, none grew on 15 µg/mL tetracycline and 10 µg/mL chloramphenicol consistent with the lack of induction of the cat gene in the absence of XylR's effector.  By contrast, five of the six strains grew on the same media supplemented with 2 mM 3-MBA, consistent with induction of cat under the control of promoter PU by activated XylR.  Strain 15, showing the most growth on the selection plates, was chosen as the biological selection strain and named as the E. coli PuCm strain (Table 7). Table 7: Testing growth of pUTel-PuCm exconjugants in developing a biological selection host.   Chloramphenicol 10 µg/mL Chloramphenicol 20 µg/mL  Controlb  - 3-MBA +3-MBA - 3-MBA +3-MBA Excona 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 2 + + + - - - - - - - - - - - - 3 + + + - - - +/- - - - - - - - - 5 + + + - - - + + + - - - - - - 15 + + + - - - + + + - - - + + + 16 + + + - - - + + + - - - +/- + + 17 + + + - - - + + + - - - - - - aEach of the six exconjugants was transformed with pUCP26XylR and then plated in triplicate on LB ampicillin (100 µg/mL) agar.  bGrowth media was supplemented as indicated with chloramphenicol and 2 mM 3-MBA, the XylR effector. 3.2.2 Cleavage of MXR1 in whole cells and cell extracts Truncated XylR, XylR∆A, has been shown to induce transcription from PU [78]. This activity is inhibited by fusion of the N-terminal domain of the MS2 phage 84  polymerase onto XylR∆A.  A cleavable form of this fusion protein was designed by inserting a cleavable linker between the MS2 and XylR∆A domains, creating MXR1 as described in Materials and Methods.  The mxr1 gene was cloned into each of pBAD24 and pVLT31 generating pBDMXR1 and pVLTMXR1.  The cleavage of MXR1 in whole cells by co-expressed HAV 3Cpro was verified using SDS-PAGE (Figure 9).  Plasmid pairs encoding substrate and proteinase in pVLT31 or pBAD24 were transformed into E. coli PuCm.  Cultures were grown and either substrate production was induced or substrate and proteinase production were induced.  Samples were removed before induction and after 18 hours of growth and whole cell extracts were examined using SDS-PAGE (Figure 9).  A band with an Mr of 50.0 kDa was observed in cells containing substrate (expressed from pBDMXR1 or pVLTMXR1) only when proteinase remained uninduced (A: lane 4 and B: lane 3).  This band corresponds to the Mr of MXR1 and was absent when HAV 3Cpro expression was induced.  However, the appearance of truncated XylR of expected size 39.1 kDa was not detectable.  Cleavage of MXR1 was further examined by adding purified HAV 3Cpro to cell extract containing MXR1 Figure 10). Disappearance of the MXR1 band was seen almost immediately but again no product band of Mw 39.1 kDa was detectable (Figure 10).  Following overnight cleavage, the MXR1 band reappeared, possibly resulting from un-lysed cells present in the extract expressing more MXR1 protein.  After centrifugation of this raw extract containing the MXR1 band was no longer observed (data not shown). 85   Figure 9: 3Cpro-dependent cleavage of MXR1 in whole cells.  A) E. coli PuCm cells containing pBDMXR1 and pVLTH3C1. Lanes were loaded with the following samples: M) molecular weight standard (kDa); 2) cells harvested immediately prior to addition of inducer; 3) cells harvested after overnight growth in the presence of 0.2% arabinose and 0.25 mM IPTG; and 4) after overnight growth in the presence of 0.2% arabinose.  Lane 1) was loaded with cells containing pVLTMXR1, grown overnight in the presence of 0.25 mM IPTG.  B) E. coli PuCm cells containing pVLTMXR1 and pBDH3C1.  Lanes were loaded with the following samples: M) molecular weight standard; 1) cells harvested immediately prior to addition of inducer; 2) cells harvested after overnight growth in the presence of 0.2% arabinose and 0.25 mM IPTG; and 3) cells harvested after overnight growth in the presence of 0.25 mM IPTG.  The gel contained 12 % acrylamide and was stained with Coomassie Blue.  Similar results were obtained in two separate experiments using different expression vectors. 86   Figure 10: Time-dependent cleavage of MXR1 in cell extracts with exogenously added HAV 3Cpro.  E. coli PuCm cells producing MXR1 from pVLTMXR1 were grown overnight.  Cells were lysed and ~3 µg proteinase was added to the lysate at time zero. Samples were removed at 0, 0.5, 1, 3, 6, and 16 hours and analyzed using SDS-PAGE. Lanes were loaded with the following samples: M) molecular weight standard (kDa); 1) purified HAV 3Cpro; cells harvested at: 2) 0 hr; 3) 0.5 hr; 4) 1 hr; 5) 3 hr; 6) 6 hr; and 7) 16 hr, following the addition of HAV 3Cpro.  The gel contained 12 % acrylamide and was stained with Coomassie Blue.  Similar results were obtained using each of two different expression vectors to produce MXR1 and different concentrations of 3Cpro. 3.2.3 Activity of produced substrate and proteinase in E. coli PuCm  Biological selection was tested using E. coli PuCm and combinations of the proteinase and substrate produced using pBAD24- and pVLT31-based constructs.  In principle, appropriately cleaved MXR1 should enable growth on chloramphenicol- containing plates. Various combinations of proteinase-encoding, substrate-encoding and empty vectors were transformed into E. coli PuCm, which was then grown on LB agar containing 15 µg/mL tetracycline, 100 µg/mL ampicillin and 10 – 30 µg/mL of chloramphenicol.  Appearance of colonies was counted as growth and the results are summarized in Table 8.  Curiously, pVLTMXR1 supported growth in the presence of 87  chloramphenicol regardless of proteinase activity.  Conversely, pBDMXR1 did not support growth in the presence of chloramphenicol independent of proteinase activity.  In contrast to pVLTMXR1, the empty vector, pVTL31, did not support growth on chloramphenicol indicating survival was MXR1-dependent. Table 8: Growth of the biological selection straina at various dilutions when transformed with plasmids encoding the cleavable transcriptional activator and the proteinase.     10 µg/mLc 20 µg/mL 30 µg/mL MXR1- producing plasmid 3Cpro- producing plasmid 10-1 10-2 10-3 10-1 10-2 10-3 10-1 10-2 10-3 pVLTMXR1 pBDH3C1 + + + + + - + + - pVLTMXR1 pBDH3C2 + + + + + + + + - pVLTMXR1 pBAD24b + + + + + + + + - pVLTMXR1 pUC18notb + + + + + + + + +/- pVLT31b pBDH3C1 - - - - - - - - - pBDXMXR1 pVLTH3C1 - - - - - - - - - pBDXMXR1 pVLT31b - - - - - - - - - pBAD24Xb pVLTH3C1 - - - - - - - - - aE. coli PuCm was used as the host strain.  bEmpty vector used as control.  cCells containing the indicated plasmids were grown overnight, then diluted as indicated and scored for growth on LB agar plates (100 µg/mL ampicillin, 7.5 µg/mL tetracycline) with each of three concentrations of chloramphenicol. 3.2.4 Lack of activity of truncated XylR produced from pBAD24 in E.coli PuCm Due to the unexpected inability of pBDMXR1-containing strains with the proteinase to grow in the presence of chloramphenicol, truncated forms of XylR, expressed from pBAD24 were tested with the selection strain.  Two truncated forms of XylR were generated, one of which corresponded to the cleaved form of MXR1 and the 88  second replicated a published truncated form of XylR [78].  Plasmids carrying genes encoding the different forms of truncated XylR (pBDXR3, pBDXXR4 – Figure 11) were transformed into E. coli PuCm and grown on LB agar containing 100 µg/mL ampicillin. A single colony was picked for each combination and grown in LB broth containing 100 µg/mL ampicillin overnight.  The cultures were diluted to a similar OD600 and equal numbers of cells at various dilutions were plated onto LB agar containing 100 µg/mL ampicillin and 5 -10 µg/mL chloramphenicol with and without 0.2 % arabinose either added to the plates or added to the overnight culture.  None of the strains containing truncated XylR demonstrated growth on chloramphenicol under any of the conditions tested (Table 9). 89   Figure 11: Truncated and full length forms of XylR.  A) The four regions of wild-type XylR and a portion of the sequence of the B-linker.  B) The N-terminal sequences of four truncated forms of XylR.  Boxed sequences correspond to that of the wild-type protein connecting non-native amino acids at residues 219 or 221. XylR∆A is the originally described truncated XylR [78]. XylR∆A1 lacks a start Met and represents an intermediate used in constructing the mxr1 gene and that includes the HAV 3Cpro cleavage sequence. XylR∆A3 resembles the truncated XylR that results for HAV 3Cpro cleavage of MXR1 but with an additional start Met. XylR∆A4 has the same amino acid sequence as the originally described XylR∆A. 90  Table 9: Performance of the biological selection straina with truncated XylR.   5 µg/mLc 7.5 µg/mL 10 µg/mL  plasmidb 10-1 10-3 10-5 10-1 10-3 10-5 10-1 10-3 10-5 pBAD24X - - - - - - - - - pBDXR3 - - - - - - - - - pBDXXR4    - - - aE. coli PuCm, the host strain, was transformed with each of the indicated plasmids. bPlasmids produced the following forms of truncated XylR: pBAD24X, empty vector; pBDXR3, XylR∆A3; and pBDXXR4, XylR∆A4.  cCells were grown overnight, diluted as indicated, and scored for growth on LB agar plates (100 µg/mL ampicillin) supplemented with one of the three indicated concentrations of chloramphenicol. 3.2.5 The role of the xylR promoter in the biological selection To further investigate the unexpected lack of response of the pBAD24-based constructs in the biological selection system, wildtype xylR was cloned into pBAD24 placing xylR under the control of the PBAD promoter (pBDXylR).  E. coli PuCm carrying this plasmid did not grow on chloramphenicol-containing plates even when containing 0.2% arabinose and 2 mM 3-MBA (data not shown).  To confirm XylR activity when expressed from different plasmids, two constructs with xylR under the control of its native promoter, PR, in plasmid pUC18 and in plasmid pUCP26 both showed induction of survival of E. coli PuCm when growing on chloramphenicol-containing plates when 2 mM 3-MBA was added (data not shown). 3.2.6 Evaluation of the biological selection system using pFH2 A final test of the selection system used the pFH2 plasmid [78].  In this plasmid, genes encoding XylR or its truncated derivatives were under control of PT7.  As summarized in Table 10,  E. coli PuCm containing pFH2WTXR was able to grow in the 91  presence of 10 µg/mL of chloramphenicol only when 2 mM of 3-MBA was also present. The truncated form of XylR also allowed selection strain survival, in an 3-MBA independent fashion, as expected.  By contrast, the MXR1 substrate in pFH2MXR1 did not allow survival, even with the production of the proteinase from pVLTH3C1 and with pre-induction of proteinase expression with either IPTG or lactose before plating on selective media (Table 10). Table 10: Performance of the biological selection straina containing the cleavable transcription activator and the proteinase.   3-MBAc tetracycline Plasmidb 10-1 10-2 10-3 10-4 10-1 10-2 10-3 10-4 10-1 10-2 10-3 10-4 pFH2WTXR - - - - + + + +/- N/A pFH2XRdA ++ ++ ++ + ++ ++ + +/- N/A pFH2MXR1         N/A pFH2MXR1 and pVLTH3C1d N/Ae N/A - - - - aE. coli PuCm, the host strain, was transformed with each of the indicated plasmids. bPlasmids produced the following proteins: pFH2WTXylR, XylR; pFH2XRdA, XylR∆A1; pFH2MXR1, MXR1; and pVLTH3C1, HAV 3Cpro.  cCells containing the indicated plasmids were grown overnight, diluted as indicated and scored for growth on LB agar plates supplemented with 100 µg/mL ampicillin, 7.5 µg/mL chloramphenicol and either 5.3 µg/mL tetracycline or 2 mM 3-MBA, as indicated. d HAV 3Cpro expression was uninduced, or induced with 0.5 mM IPTG or 0.2% lactose with similar results. eN/A – Not applicable 3.2.7 A LacZ-based screen for proteinase activity Failure of the biological selection system to function as intended led to the investigation of a LacZ-based screening system.  A screening host was constructed in a manner analogous to the selection host, E. coli PuCm, except that the lacZ gene was used instead of the cat gene and this host was generously donated by de Lorenzo 92  (unpublished).  An increase in LacZ activity, resulting from induced transcription of lacZ from the PU promoter by XylR with its effector 3-MBA, can be measured using the Miller assay. The biological screening strain was evaluated using XylR and its variants produced from each of three vectors: pVLT31, pBAD24 and pFH2 (panels A, B and C, respectively in Figure 12).  Wild type XylR, produced using any of the vectors, induced LacZ expression with the addition of 3-MBA (Figure 12: A; bars 1 and 2, B; bars 4 and 5, and C; bars 2 and 3).  Truncated XylR induced high LacZ activity when in vector pFH2 but this same truncated XylR expressed from pBAD24 (pBDXXR4) did not induce LacZ activity (Figure 12: C; bar 6 vs. B; bar 3).  An alternative form of truncated XylR expressed from pBDXR3 induced LacZ activity to a level that, while comparable to 3- MBA induced XylR (produced from pBDXylR), was significantly lower than LacZ induced activity by substrate MXR1 in the same vector (Figure 12: B; bar 2 vs bar 5). Substrate MXR1 induced LacZ expression in the absence of proteinase when in vectors pVLT31 and pBAD24 but failed to induce expression of LacZ expression when in pFH2, even when co-expressed with HAV 3Cpro (Figure 12: C; bar 5). 93   Figure 12: Performance of biological screening strain containing cleavable transcription activator and proteinase.  E. coli PuLacZ was transformed with plasmids producing the following proteins: pFH2MXR1, MXR1; pFH2XRdA, XylR∆A4; pFH2WTXR, XylR; pUCP26XYLR, XylR; pVLTMXR1, MXR1; pBDXylR, XylR; pBDXR3, XylR∆A3; pBDXXR4, XylR∆A4; pBDMXR1, MXR1; pBDH3C2, HAV 3Cpro; pVLTH3C1, HAV 3Cpro.  pFH2, pUCP26, pBAD24 and pVLT31 were empty vector controls.  Following overnight growth, β-galactosidase activity of cells was measured.  Experiments were performed in triplicate. A B C 0 50 100 150 200 250 300 350 400 450 pU CP 26 Xy lR pU CP 26 Xy lR + 3M BA pU CP 26 pV LT 31 pV LT MX R1 pV LT MX R1  + pB AD 24 pV LT MX R1  + pB DH 3C 2 M ille r Un its 0 10 20 30 40 50 60 70 80 pB AD 24 pB AD XX R2 pB DX R3 pB DX XR 4 pB DX ylR pB DX ylR  + 3M BA pB DM XR 1 pB DM XR 1 +  pV LT 31 pB DM XR 1 +  pv VL TH 3C M ille r Un its 0 20 40 60 80 100 120 140 pFH2 pFH2WTXR pFH2XTXR + 3MBA pFH2MXR1 pFH2MXR1 + pVLT3C1 pFH2XRdA M ille r Un its 94  3.3 A FRET-based screen for proteinase activity Given the difficulties in developing a XylR-based biological selection or screen, we investigated using fluorescent proteins in a biological screen for proteinase activity. Fused pairs of GFP-variants that undergo fluorescence resonance energy transfer (FRET) have been used to study the activation of caspases in mammalian cells [85].  Thus, a biological screen based on two GFP variants (CFP and YFP) was developed. Substrates were constructed by concatenating the genes encoding the two GFP variants and linking them with a nucleotide sequence encoding a cleavage sequence of HAV 3Cpro.  In these fusion substrates, excitation of CFP results in resonance energy transfer to YFP and the resulting YFP emission at 527 nm is referred to as the FRET signal (F527).  Proteolytic cleavage should result in a drop in the FRET signal, an increase in CFP fluorescence emission at 477 nm (F477) and thus a higher value of the F477/F527 ratio. 3.3.1 In vivo cleavage of CFP - YFP fusion substrates Three fusion substrates were constructed, differing in their respective linker sequences: CYFP-1 had linker LRTQ/SFS, designed after the 2B/2C cleavage site of HAV; CYFP-2 had linker LRTA/SFS in which the P1 residue is replaced with Ala, designed to render the sequence uncleavable; and CYFP-3 had linker LRTQ/MFS.  To determine which of these substrates could be cleaved in vivo, each was produced in cells containing either the proteinase-encoding vector (pVLTH3C1) or an empty vector control (pVLT31).  E. coli BW27783 cells were grown in 50 mL of LB with 7.5 µg/mL tetracycline and 100 µg/mL ampicillin.  Expression of CYFP-encoding genes was induced with arabinose at mid-log phase of culture growth.  Following overnight 95  incubation, samples were normalized to cell density (OD600) and fluorescence emission was scanned on the fluorimeter with excitation of CFP at 434 nm.  As noted above, cleavage by the proteinase would result in an increase in the F477/F527 value.  The F477/F527 value for cleared raw extract normalized to protein concentration from the same samples was also determined.  This allowed comparison of any differences in the F477/F527 value between whole cells versus soluble cell contents. Cells producing fluorescent protein emitted less light at both 477 nm and 527 nm when HAV 3Cpro was co-produced.  Nevertheless, as summarized in Figure 13, for cells producing either CYFP-1 or CYFP-3, the F477/F527 value was 3 - 4 fold higher if the cells also produced the HAV 3Cpro, consistent with substrate cleavage.  Cells co-producing CFP and YFP (CYFP) had a high F477/F527 value, indicating low FRET transfer, and the co-production of proteinase did not significantly affect this ratio.  Finally, the F477/F527 value of cells containing the CYFP-2 substrate showed minimal difference with and without proteinase.  However, the low ratio suggests a high degree of FRET transfer and was comparable to that of CYFP-1 and CYFP-3 substrates expressed without proteinase. This result suggests that substrate CYFP-2 remained uncleaved as expected. 96  0 0.5 1 1.5 2 2.5 CY FP /pV LT 31 CY FP /H3 C1 CY FP - 1/p VL T3 1 CY FP - 1/H 3C 1 CY FP - 2/p VL T3 1 CY FP - 2/H 3C 1 CY FP - 3/p VL T3 1 CY FP - 3/H 3C 1 F4 77 /F 52 7 cleared lysate whole cells  Figure 13: FRET analysis of 3Cpro-dependent cleavage of the CYFP fusion substrates.  E. coli BW27783 cells were co-transformed with plasmids producing fluorescent proteins (pBDXCYFP-1, CYFP-1; pBDXCYFP-2, CYFP-2; pBDXCYFP-3, CYFP-3; and pBDXCYFP, co-expressed CFP and YFP), and HAV 3Cpro (from pVLTH3C1; + 3C). pVLT31 was an empty vector control (-3C).  Cells were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline. Fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells were harvested after a further 16 hrs incubation and the ratio of fluorescence due to CFP and FRET, respectively, was measured in both whole cells and cleared cell lysates using a fluorimeter. Fusion proteins and their cleaved products in cell extracts were separated using native-PAGE (i.e. non-denaturing conditions) and visualized using a Typhoon scanner (Figure 14).  Using this method, the native protein fold is maintained allowing GFP’s to be visualized by their fluorescence.  CFP was detected using λex = 457 nm, λex = 526 nm (Short Pass filter) while YFP was detected using λex = 532 nm, λex = 526 nm (Short Pass filter) as specified in the Typhoon user manual.  Lanes 1 and 10 establish the selectivity of these wavelengths for CFP and YFP, respectively.  Under the electrophoresis 97  conditions used, monomeric GFP variants (lanes 1-3 and 10) migrated significantly further than uncleaved fusion proteins (lanes 4, 6 and 8).  The gels further demonstrate the co-production of HAV 3Cpro in these cells led to cleavage of CYFP-1 (lane 5) and CYFP-3 (lane 9) but not CYFP-2 (lane 7).  Overall, the results in Figure 13 and Figure 14 demonstrate that CYFP-1 and CYFP-3 were cleaved in the presence of 3Cpro but CYFP-2 was not.  Figure 14: Native gel analysis of 3Cpro-dependent cleavage of CFP-YFP fusion substrates.  E. coli BW27783 cells were grown in 50 mL of LB with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and fluorescent protein expression was induced at mid- log phase using 0.2% arabinose.  Cells were harvested after a further 16 hrs incubation and analyzed using native-PAGE.  A) CFP and B) YFP proteins were visualized using the Typhoon imager.  Lanes were loaded with cells containing the following recombinant proteins using the plasmids described in Figure 13: 1) CFP, 2) co-expressed CFP and YFP, 3) co-expressed CFP, YFP and HAV 3Cpro, 4) CYFP-1, 5) CYFP-1 and HAV 3Cpro 6) CYFP-2, 7) CYFP-2 and HAV 3Cpro 8) CYFP-3, 9) CYFP-3 and HAV 3Cpro, 10) YFP. Unexpectedly, the native-PAGE gels revealed the presence of a band that migrated similar to the uncleaved fusion protein but which was only detected when the gel was scanned using excitation of 457 nm (CFP excitation).  This band was present when either CYFP-1 or CYFP-3 was co-produced with proteinase (Figure 14: lanes 5 and 98  9).  This band was not detected in either the CFP or YFP control samples (lanes 1 and 10), nor when these monomeric proteins were co-produced with 3Cpro (lane 3). 3.3.2 Time-dependence of proteolytic cleavage of fluorescent substrates The in vivo cleavage of the fusion substrates by co-expressed HAV 3Cpro was characterized in a time course experiment.  E. coli BW27783 cells grown in 50 mL of LB broth with 7.5 µg/mL tetracycline and 100 µg/mL ampicillin were harvested at different times following induction and cell densities were normalized to OD600.  Fusion proteins and their cleavage products were visualized as in the previous experiment.  CYFP-1 and CYFP-3 appeared to be maximally cleaved by 1 hour and 16 hours, respectively (Figure 15).  In both samples, the unexpected band that contained no YFP but migrated similar to the fusion substrate was observed.  Substrate CYFP-2 was also maximally cleaved by 16 hours but at an apparently slower rate than CYFP-1 and CYFP-3.  This is in contrast to the results of section 3.3.1 in which CYFP-2 appeared uncleaved.  In all subsequent experiments, CYFP-2 was cleaved by HAV 3Cpro to a limited extent. In the time course experiment, lanes loaded with samples containing the 3Cpro and either CYFP-2 or CYFP-3 revealed an additional band of higher apparent molecular weight than the substrate.  This band contains both CFP and YFP.  The band was detected only in samples containing 3Cpro and was less intense in samples containing well-cleaved substrates. 99   Figure 15:  Time-dependent cleavage of CFP-YFP fusion substrates by HAV 3Cpro in vivo.  E. coli BW27783 cells were grown in 50 mL of LB with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells were harvested at 0, 1, 3, 6 and 16 hours after induction and analyzed using native-PAGE.  A) CFP and B) YFP proteins were visualized using the Typhoon imager.  Lanes were loaded with cells containing the following recombinant proteins using the plasmids described in Figure 13: CYFP-1, CYFP-2 and CYFP-3 with and without HAV 3Cpro. 3.3.3 Detection of fusion protein cleavage in single colonies A rapid method to screen fluorescent fusion proteins and their cleavage was developed using single colonies picked from an LB agar plate.  By using colonies directly from a plate, the additional step of growing liquid cultures is eliminated.  Cells co- producing substrate and proteinase were grown on LB agar with 7.5 µg/mL tetracycline, 100 µg/mL ampicillin and arabinose to induce CFP-YFP production.  Induction with arabinose was required to detect fluorescent proteins.  As appropriate, proteinase 100  production was induced by adding lactose to a final concentration of 0.2 %.  Colonies were lysed using BugbusterTM, proteins were separated with native-PAGE, and fluorescent proteins were visualized using the Typhoon.  As previously observed, substrates CYFP-1, -2 and -3 were cleaved by co-expressed HAV 3Cpro (Figure 16).  A greater proportion of CYFP-1 was cleaved than CYFP-3.  Moreover, a lower proportion of CYFP-2 was cleaved than either of the other two substrates.  For substrates CYFP-2 and CYFP-3, the third band containing both CFP and YFP and appearing larger than substrate was observed.  The addition of lactose had no discernable effect on substrate cleavage and so proteinase production was not induced in future experiments investigating cleavage of the fluorescent substrates by co-produced HAV 3Cpro. 101   Figure 16:  Single colony analysis of the in vivo cleavage of CFP-YFP fusion substrates by HAV 3Cpro.  E. coli BW27783 cells producing substrate CYFP-1, CYFP-2 or CYFP-3, with and without HAV 3Cpro using the plasmids described in Figure 5 were grown on LB agar supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2% arabinose. Lanes indicated with * were also supplemented with 0.2% lactose.  Colonies were picked from agar plates after 16 hrs growth and analyzed using native-PAGE.  A) CFP and B) YFP proteins were visualized using the Typhoon imager.  Lanes labelled 1-6 were loaded with raw extracts from cells grown in 50 mL LB producing CFP (from pBDXCFP: lanes 1, 3 and 5) and YFP (from pBDXYFP, lanes 2, 4 and 6). 3.3.4 Cleavage of purified ht-CYFP-1. To investigate the nature of the unexpected bands observed using native-PAGE, the cleavage of fusion substrates was investigated using denaturing SDS-PAGE.  It was necessary to first purify the fusion proteins as their levels in whole cells were too low to 102  be detected.  To facilitate purification, CYFP-1 was engineered to carry an N-terminal polyhistadine tag creating ht-CYFP-1.  The latter was purified to >80% using IMAC. The purified substrate contained several impurities (Figure 17, lane 1), including a band of similar Mr as HAV 3Cpro.  Cleavage of substrate ht-CYFP-1 by HAV 3Cpro (purified to >90% as determined by SDS-PAGE) was tested with ratios of 5:1 or 50:1 (w:w) of substrate:proteinase.  Complete cleavage occurred within 1 hour with 5-fold excess of substrate (lane 6) and within 3 hours with a 50-fold excess of substrate (lane 8).  On denaturing gels, no band was observed that was larger than substrate and that would correspond to the unexpected bands seen on the native-PAGE.  Figure 17:  Time-dependent cleavage of a purified CFP-YFP substrate by HAV 3Cpro.  ht- CYFP-1 (3.9 µg/µL) was mixed with 0.8 µg 3Cpro (b), 0.08 µg/µL 3Cpro (a) or no proteinase (0), and incubated at 37 °C in 100 mM potassium phosphate, 2 mM EDTA; pH 7.5.  Samples were removed at time 0, 1 and 3 hours and analyzed using SDS-PAGE. The gel contained 12 % acrylamide and was stained with Coomassie Blue. 3.3.5 Development of the screen using CyPet and YPet During the course of these studies, variant GFP’s with improved FRET properties became available: CyPet and YPet [87].  This pair of fluorescent proteins were produced as polyhistadine-tagged proteins (ht-CyPet and ht-YPet) and their properties were 103  compared using native-PAGE to those of CFP and YFP.  When produced in E. coli BW27783, ht-CyPet and ht-YPet emitted more fluorescence at 477 nm and 527 nm, respectively, and were produced to high levels in cells incubated overnight after addition of inducer (data not shown).  Indeed, cells co-producing both ht-CyPet and YPet (a result of the cloning procedure was the untagged YPet was co-expressed with CyPet), showed significant FRET (data not shown).  To reduce the cellular levels of ht-CyPet and ht- YPet, the cells producing these proteins were only incubated for 7 hours after addition of inducer instead of overnight as for cells producing CFP/YFP.  This ensured that CyPet/ YPet and CFP/YFP samples were of comparable brightness following separation with native-PAGE.  Native-PAGE of whole cells expressing the fluorescent proteins were visualized using the Typhoon and showed differences between the two sets of fluorescent proteins (Figure 18).  ht-CyPet, ht-YPet, and ht-CyY-1 (a fusion protein described in 3.3.6; lanes 6-9) had slower migration as compared CFP, YFP and CYFP-1, respectively (lanes 2-5).  Moreover, ht-CyPet (lane 6) appeared larger than ht-YPet (lane 7). Similarly, ht-YPet appeared larger than YPet (lane 8), presumably due to the poly His- tag.  Denaturing-PAGE analysis of purified ht-CyPet and ht-YPet confirmed that these proteins have very similar molecular weights (data not shown) thus the larger apparent size of ht-CyPet compared to ht-YPet (lane 6 vs. 7) was a function of analysis performed under native conditions. 104   Figure 18:  Comparison of the fluorescent proteins CFP and YFP vs. ht-CyPet and ht- YPet and their derived fusion substrates by native-PAGE.  E. coli BW27783 cells were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells producing CFP/YFP proteins were harvested after a further 16 hrs incubation; cells producing ht- CyPet/ht-Ypet proteins were harvested 7 hours after induction.  Samples were analyzed using native-PAGE and visualized using a Typhoon. A) CFP/ht-CyPet emission and B) YFP/ht-YPet emission using the Typhoon imager.  Lanes were loaded with cells expressing the following proteins produced from plasmids described either in Figure 13 or listed here: 1) pBAD24X, 2) CFP, 3) YFP, 4) co-expressed CFP and YFP, 5) CYFP-1, 6) ht-Cy-Pet produced from pBXCy-H, 7) ht-YPet produced from pBXYP-H, 8) co- expressed ht-CyPet and YPet produced from pBXCyY-H, 9) ht-CyY-1 produced from pBXCyY-1. 3.3.6 Dependence of fusion protein cleavage on linker length Ht-CyPet and YPet were used to generate fusion protein substrates.  To optimize substrate cleavage for use in the biological screen, linkers of different length and composition were compared.  Fusion protein substrates having each of three different cleavable linkers were purified and ranked to determine the best substrate for the fluorescent protein screening system.  Substrate ht-CyY-1 was based on CYFP-1 and had linker LRTQ/SFS.  Substrate ht-CyY-1-16 possessed the same cleavage sequence with additional flanking residues taken from the HAV polyprotein 2A/2B cut site: 105  RMELRTQ/SFSNWLS.  Substrate ht-CyY-1d possessed two successive copies of the cleavage sequence ht-CyY-1: LRTQ/SFSLRTQ/SFS.  Each substrate was purified and used in kinetic analysis to determine the best cleaved substrate.  The relative cleavage efficiencies of each substrate are shown in Table 11. Table 11:  Relative cleavage efficiencies of HAV 3Cpro for CyPet-YPet fusion substrates.   Cleavage efficiency ht-CyY-1 1.0 ht-CyY-1d 1.6 ht-CyY-1-16 1.4 Experiments were performed using 100 mM potassium phosphate, 2 mM EDTA; pH 7.5 at 37 °C with 4.5 µM of substrate.  Relative rates were calculated from progress curves.  Errors were typically less than 5%. 3.3.7 Dependence of fluorescent signals on culture age To investigate how the age of the culture influenced the F477/F527 value of cells producing either a) ht-CyPet and YPet (simulating cleaved substrate) or b) the fusion protein substrate ht-CyY-1, cultures expressing these proteins were sampled at various times after induction.  At each time point fluorescence was measured using the fluorimeter and the F477/F527 values were plotted (Figure 19).  Immediately prior to adding the inductor (t = 0), the fluorescence signals of both samples were low and represented background cell fluorescence.  Furthermore, the F477/F527 values of this low fluorescent signal at t=0 was similar for both co-produced and fusion (CyY-1) samples. By the third hour following addition of the inducer, the signal had increased significantly and there was a ~2-fold difference in the F477/F527 values in co-expressed ht-CyPet and YPet vs. ht-CyY-1.  The ratio in the samples remained almost unchanged for an 106  additional 4 hours.  Following overnight growth, the F477/F527 value for both samples had dropped although there was still a ~2 fold difference in their respective F477/F527 values. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 0 5 10 15 20 Time (hr) F4 77 /F 52 7 CyY-H CyY-1  Figure 19:  Culture age dependence of the F477/F527 value for linked and co-expressed ht- CyPet and YPet fluorescent proteins produced.  E. coli BW27783 cells expressing ht- CyPet and YPet, or ht-CyY-1 were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells were harvested at 0, 2, 5, 7 and 18 hrs after addition of inducer and values of F477/F527 were measured using a fluorimeter. Proteins were produced from plasmids described in Figure 18. To confirm that cell density was not influencing the F477/F527 values, the ratio was determined for various dilutions of cells that were harvested 7 and 18 hours after the addition of inducer (Figure 20).  The F477/F527 value was independent of density and so differences in this ratio reflected in vivo protein interactions, not cell density. 107  0 0.5 1 1.5 2 2.5 0 0.05 0.1 0.15 0.2 0.25 OD 600 F4 77 /F 52 7 CyY-H (7hr) CyY-H (ON) CyY-1 (7hr) CyY-1 (ON)  Figure 20:  Dependence of F477/F527 value on cell density.  E. coli BW27783 cells expressing ht-CyPet and YPet, or ht-CyY-1 were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells were harvested 7 and 18 hrs after addition of inducer. F477/F527 and OD600 values of culture dilutions were measured using the fluorimeter and Cary 6000 respectively.  Proteins were produced from plasmids described in Figure 18. 3.3.8 Cleavage of CyPet/YPet fusion proteins in vivo Cleavage of the fluorescent fusion protein by HAV 3Cpro, as observed by change in F477/F527 value, was tested in LB broth-grown cells co-expressing substrate and proteinase. Fluorescent protein expression was induced using arabinose, samples of whole cells were scanned on the fluorimeter 3, 5 and 7 hrs after induction, and the F477/F527 values were plotted (Figure 21).  For cells expressing either ht-CyPet or co- expressing ht-CyPet and YPet, the F477/F527 value did not change with co-expression of HAV 3Cpro.  Three fusion proteins were tested for cleavage: ht-CyY-1 (with linker LRTQ/SFS); ht-CyY-4 (with linker sequence similar to ht-CyY-1 but with Glu in the P1 position); and ht-CyY-U1 (with linker sequence GSGSSGS, anticipated to be uncleavable).  Of the three, only ht-CyY-1 appeared to be cleaved: the F477/F527 value of 108  cells containing this protein was 2-fold higher when they also produced HAV 3Cpro.  This difference was apparent 5 and 7 hours after induction of fluorescent protein expression suggesting ht-CyY-1 was fully cleaved within 5 hours.  Similar proteinase-specific differences were obtained in replicate experiments with cells coexpressing substrate and proteinase. 0 0 0 1 1 1 1 1 2 2 3 3.5 4 4.5 5 5.5 6 6.5 7 Time past induction (hr) Cy Pe t/F R ET ht-CyY-1 + 3C ht-CyY-1 - 3C ht-CyY-4 + 3C ht-CyY-4 - 3C ht-CyPet and YPet + 3C ht-CyPet and YPet - 3C ht-CyY-U1 + 3C ht-CyY-U1 - 3C  Figure 21:  Cleavage of the fluorescent protein substrate by co-expressed HAV 3Cpro.  E. coli BW27783 cells expressing ht-CyY-1 (with linker LRTQ/SFS), ht-CyY-4 (produced from pBDXCyY-4 with linker LRTE/SFS), ht-CyPet and YPet, or ht-CyY-U1 (produced from pBDXCyY-U1 with linker GSGSSGS), with and without HAV 3Cpro were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin and 7.5 µg/mL tetracycline. Fluorescent protein production was induced at mid-log phase with 0.2% arabinose and cells were harvested at 3, 5 and 7 hrs after induction.  Values of F477/F527 were measured using the Varian Eclipse fluorescence spectrophotometer.  Proteins were produced from plasmids described in Figure 18 unless otherwise indicated. 3.3.9 Maintenance of the fluorescence signal following overnight expression As reported in Figure 19, the F477/F527 values of cells producing fluorescent proteins dropped significantly following overnight incubation.  As this phenomenon could influence the screening procedure, I tested the hypothesis that the drop in F477/F527 values resulted from the accumulation of fluorescent protein leading to intramolecular 109  FRET.  Accordingly, induction of fluorescent protein expression with arabinose was limited to 2 or 4 hours before cultures were exchanged into media without arabinose and grown overnight.  Cultures were grown in 50 mL LB and fluorescent protein expression was induced at mid-log phase with arabinose.  Cultures were grown for an additional two or four hours before cells were harvested and resuspended in fresh growth media containing 0.2% glucose, an indirect repressor of the PBAD promoter.  The cultures were then incubated overnight.  Cells were harvested at 0, 2, 5, 7 and 24 hours after arabinose induction and scanned using the fluorimeter. When fluorescent protein expression was induced for four hours (Figure 22: C), cells emitted more light at both 477 nm and 527 nm than when expression was induced for only two hours (B).  For both samples, the replacement of arabinose with glucose resulted in the maintenance of the F477/F527 value overnight (A) in contrast to results shown in Figure 19.  Induction of proteinase expression with IPTG had no effect on fluorescent signals in any of the samples. 110   Figure 22:  Time dependence of F477/F527 values of cells expressing cleavable and uncleavable substrates.  E. coli BW27783 cells expressing ht-CyY-1 or ht-CyY-U1 and HAV 3Cpro were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin and 7.5 µg/mL tetracycline and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  After induction, samples were grown for an additional 2 or 4 hours, harvested by centrifugation and resuspended in 50 mL of LB supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline with additional (G): 0.2% glucose or (GI): 0.2% glucose and 0.25 mM IPTG.  Cells were harvested at 0, 2, 5, 7 and 24 hrs after arabinose induction.  A) Values of F477/F527 measured using the Varian Eclipse fluorescence spectrophotometer. B) Emission scan (λex = 434 nm) of cells grown with arabinose induction for 2 hours, switched to glucose containing media and grown for an additional 6 hours, measured using the Varian Eclipse fluorescence spectrophotometer. C) Emission scan (λex = 434 nm) of cells grown with arabinose induction for 4 hours, switched to glucose containing media and grown for an additional 6 hours, measured using the Varian Eclipse fluorescence spectrophotometer.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 0 5 10 15 20 25 30 440 490 540 590 Emission R FU ht-CyY-1, (GI) ht-CyY-1, (G) ht-CyY-U1, (GI) ht-CyY-U1, (G) 0 2 4 6 8 10 12 14 440 490 540 590 Emission RF U ht-CyY-1, (GI) ht-CyY-1, (G) ht-CyY-U1, (GI) ht-CyY-U1, (G) 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0 5 10 15 20 25 30 Time after induction (hr) F4 77 /F 52 7    ht-CyY-1, (2 hr), (GI) ht-CyY-1, (2 hr), (G) ht-CyY-U1, (2 hr), (GI) ht-CyY-U1, (2 hr), (G) ht-CyY-1, (4 hr), (GI) ht-CyY-1, (4 hr), (G) ht-CyY-U1, (4 hr), (GI) ht-CyY-U1, (4 hr), (G) A B C 111  3.3.10 Adaptation of the CyPet/YPet screen to 96-well plates Figure 22 demonstrated that it was possible to discern cleaved and uncleaved substrates when co-expressed with HAV 3Cpro and grown in 50 mL of LB broth.  Thus, to facilitate high throughput screening, the in vivo fusion protein cleavage assay was tested in a 96-well black plate.  To test whether detection of fusion protein cleavage was feasible in 96-well plates, cells were grown in 50 mL liquid culture then transferred to the plate in aliquots, diluted to the indicated OD595 and the F477/F527 value was measured.  As summarized in Figure 23, the F477/F527 value strongly depended on OD595, increasing at lower cell densities.  This result is in contrast to similar samples measured using the fluorimeter where F477/F527 values were not greater at similar low OD600 (Figure 20). Using the fluorescent plate reader, significant differences between cleaved and uncleaved fusion substrate were measurable only in samples at the highest measured OD595 (Figure 23).  Consequently, future experiments with plate-grown cultures were designed to ensure a sufficient quantity of cells (i.e., OD595 >1) to distinguish cleaved and uncleaved samples using the plate reader.  Additionally, given this dependency, F477/F527 values determined from 96-well plates were plotted against OD595 to account for this effect. To test detection of in vivo cleavage using the plate assay, E. coli BW27783 cells expressing cleavable substrate (ht-CyY-1), uncleavable fusion protein (ht-CyY-U1) and co-expressed fluorescent proteins (ht-CyPet and YPet), with and without HAV 3Cpro were grown in replicate deep-well plates containing 1.5 mL LB with arabinose.  Cultures were grown overnight in Ziplock bags filled with 100% O2 as previous experiments had shown that cultures reached a higher OD595 when grown under such conditions (results not shown).  Following overnight growth, cells of one plate were harvested by centrifugation 112  and stored at -80 °C while cells of the second plate were exchanged into fresh media containing glucose to repress further fluorescent protein expression.  These cultures were incubated for an additional 6 hours before being harvested by centrifugation.  Cells harvested from the two plates were resuspended in 100 µL of buffer, transferred to a black 96-well plate and scanned using a plate reader.  Results indicated that cleavable and uncleavable substrates could not be distinguished on the basis of F477/F527 values using the expression protocol (Figure 24).  Unsurprisingly, cultures treated with glucose and incubated for a further 6 hours reached higher densities compared to those harvested following the initial overnight growth.  In both sets of samples, the additional co- production of 3Cpro resulted in a slightly lower F477/F527 value.  Moreover, this F477/F527 drop was the same for both cleavable and uncleavable substrates. To verify that ht-CyY-1 was cleaved as expected in the preceding experiments, samples of whole cells were analyzed using native-PAGE.  Native-PAGE of whole cells harvested following overnight growth in plates showed that fluorescent proteins were produced in all samples (Figure 25).  This analysis further established that substrate ht- CyY-1 was completely cleaved when co-produced with proteinase (lanes 5 vs. 6).  By contrast, ht-CyY-U1 was not cleaved (lanes 7 vs. 8).  Thus even though fusion proteins were processed by HAV 3Cpro, this cleavage was not detected as a decrease in F477/F527 when cells were grown in 96-well plates and F477/F527 values were determined using the plate reader.  Moreover, the F477/F527 values of plate grown cultures were similarly uninformative when determined using a fluorimeter (results not shown).  Finally, under native-PAGE analysis , uncleaved ht-CyY-1 and ht-CyY-U1 appeared as double bands when scanned for both CyPet and YPet fluorescence (lanes 5 and 7).  This effect was 113  more pronounced for ht-CyY-U1.  However, the appearance of these extra bands was not limited to cultures grown in plates: it was also observed in cultures grown 50 mL liquid media (results not shown).   Figure 23:  Dependence of F477/F527 on cell density.  E. coli BW27783 cells expressing ht-CyY-1 or ht-CyY-U1 with and without HAV 3Cpro were grown in 50 mL of LB supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and fluorescent protein production was induced at mid-log phase using 0.2% arabinose.  Cells were harvested 6 hours after induction and diluted to the indicated OD595.  F477/F527 values were measured using a fluorescent plate reader and Cary 1E respectively.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 114   Figure 24:  Detection of in vivo cleavage of fusion proteins in 96-well plate grown cells. E. coli BW27783 cells expressing ht-CyPet and YPet, ht-CyY-1 or ht-CyY-U1, with and without HAV 3Cpro were grown in 1.5 mL of LB media supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2 % arabinose in a deep-well 96-well plate at 37 °C in an 100% O2 filled bag.  Following 16 hrs incubation, cultures were harvested by centrifugation and either A) stored at -80 °C or B) resuspended in fresh LB supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2 % glucose and grown for an additional 6 hours.  Cells were harvested by centrifugation.  Cells from both samples were resuspended in 100 µL of 100 mM potassium phosphate, 2 mM EDTA; pH 7.5 and transferred to a black 96-well, clear bottom plate.  Fluorescence and OD595 were measured using the fluorescent plate reader.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 0.5 0.6 0.7 0.8 0.9 1 OD 595 F4 77 /F 52 7 ht-CyY-1, -3C ht-CyY-1, + 3C ht-CyPet and YPet, - 3C ht-CyPet and YPet, + 3C ht-CyY-U1, -3C ht-CyY-U1, + 3C 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 0.9 1 1.1 1.2 1.3 OD 595 F4 77 /F 52 7 ht-CyY-1, -3C ht-CyY-1, + 3C ht-CyPet and YPet, - 3C ht-CyPet and YPet, + 3C ht-CyY-U1, -3C ht-CyY-U1, + 3C A B 115   Figure 25:  Native-PAGE analysis of plate-grown cells containing fluorescent proteins. E. coli BW27783 cells expressing ht-CyPet and YPet, ht-CyY-1 or ht-CyY-U1, with and without HAV 3Cpro were grown in 1.5 mL of LB media supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2 % arabinose in a deep-well 96-well plate at 37 °C in an 100% O2 filled bag.  Following 16 hrs incubation, cultures were harvested by centrifugation, lysed and the raw extracts were analyzed using native-PAGE. A) CyPet and B) YPet proteins were visualized using the Typhoon imager. Lanes containing the following proteins using the plasmids described in Figure 18 and Figure 21: 1) ht-CyPet, 2) ht-YPet, 3) ht-CyPet and YPet, 4) ht-CyPet, YPet and HAV 3Cpro, 5) ht-CyY-1, 6) ht- CyY-1 and HAV 3Cpro, 7) ht-CyY-U1, 8) ht-CyY-U1 and HAV 3Cpro. 3.4 Use of exogenously added proteinase in plate-based assays In plate-grown cells, F477/F527 values could not be used to distinguish cleaved from uncleaved fusion proteins when fusion substrate was co-expressed with proteinase. Thus, an alternative method to screening proteinase specificity was developed in which the substrate-containing cells were first lysed and then purified proteinase was added to 116  the lysate.  While this method required additional sample handling, it could be used to screen a library of substrates grown in plates to evaluate the substrate preference of a proteinase.  Moreover, progress curves of substrate cleavage could be easily generated. 3.4.1 Detecting in vitro cleavage of fusion substrate in cell lysates To test whether cleavage of fusion protein by exogenously added proteinase could be measured, cells producing either ht-CyY-1 or ht-CyY-U1 were grown in a deep-well 96-well plate in O2-filled bag.  Cells harvested from the plate were lysed with BugbusterTM and purified HAV 3Cpro was added to both raw extracts and lysates that had been cleared by centrifugation.  Changes in FRET signal were recorded over 150 min using the plate reader generating the progress curves shown in Figure 26.  Addition of purified HAV 3Cpro (+3C) to cleared lysates resulted in a steady, time-dependent loss of FRET signal for cleavable (ht-CyY-1) compared to uncleavable (ht-CyY-U1) substrates. The progress curves were similar for substrates in both raw extracts and cleared lysates (data not shown). In a second experiment, progress curves were also recorded using cells containing both ht-CyY-1 and the proteinase.  The data showed no further cleavage of ht-CyY-1 suggesting that no substrate remained to be cleaved (results not shown).  This result confirms that no uncleaved substrate remained in the lysate, as suggested by results reported in section 3.3.10. 117  60000 70000 80000 90000 100000 110000 120000 130000 140000 150000 160000 0 20 40 60 80 100 120 140 160 Time(min) F 52 7 (R FU ) ht-CyY-1 + 3C ht-CyY-1 ht-CyY-U1 + 3C ht-CyY-U1  Figure 26:  Progress curves following the addition of purified HAV 3Cpro to cleared lysates of cells expressing fusion proteins.  E. coli BW27783 cells expressing ht-CyY-1 or ht-CyY-U1 were grown in 1.5 mL of LB media supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2% arabinose in a deep-well 96-well plate at 37 °C in an 100% O2 filled bag.  Following 16 hrs incubation, cultures were harvested by centrifugation and lysed in 50 uL of Bugbuster.  Then, 350 µL of 100 mM potassium phosphate, 2 mM EDTA; pH 7.5 was added and 100 µL of this cleared lysate was transferred to a black 96-well plate.  In samples labelled ‘+ 3C’, HAV 3Cpro was added to a final concentration of 1 µM and progress curves were monitored using the fluorescent plate reader.  Proteins were produced from plasmids described in Figure 18 and Figure 21.  This figure is representative of results obtained on two different days. 3.4.2 Optimizing the concentration of HAV 3Cpro for the in vitro screen Given that cleavage of substrates by HAV 3Cpro could be observed in cleared lysates, the concentration of proteinase used in the plate screen was optimized.  Various concentrations (0 – 1 µM) of HAV 3Cpro were added to cleared lysates of cells containing either ht-CyY-1 or ht-CyY-U1, grown as described in section 3.4.2.  Initial rates of the loss of fluorescence at 527 nm were calculated and plotted against the initial F527 signal (Figure 27). The latter was taken as a measure of fusion protein concentration.  For ht- 118  CyY-1, the initial rate of cleavage, as measured by loss of F527, depended on both substrate and proteinase concentrations.  Rates increased with substrate concentration (Figure 27: x-axis) and this dependence was not linear.  Rates also increased with proteinase concentration.  However, at concentrations of proteinase above 1 µM, there was significantly more error in the rate (results not shown).  Unexpectedly, initial velocities were not zero for ht-CyY-1 in the absence of proteinase.  Similarly, loss of FRET was observed with ht-CyY-U1 and was not dependent on proteinase concentration (data not shown).  Interestingly, the rate of this F527 loss was proportional to initial FRET signal.  Finally, the observed proteinase-independent loss of F527 was also observed in individually expressed ht-CyPet or ht-YPet proteins (data not shown).  These results indicate a background loss of fluorescence possibly due to bleaching.  Based on these results, 1 µM of HAV 3Cpro was selected for specificity screens as this concentration yielded a significant difference increase in rate of F527 decline due to cleavage versus cleavage rate over background bleaching for ht-CyY-1. 119  0 20 40 60 80 100 120 140 160 180 200 0 5 10 15 20 25 30 35 40 45 50 Initial F527 (RFU) R a te  o f l o ss  o f F 52 7 (R FU /m in ) 0 uM 3C, ht-CyY-U1 0 uM 3C, ht-CyY-1 0.25 uM 3C, ht-CyY-1 0.5 uM 3C, ht-CyY-1 1uM 3C, ht-CyY-1 3  Figure 27:  The dependence of cleavage rates of ht-CyY-1 on HAV 3Cpro and substrate concentrations.  E. coli BW27783 expressing ht-CyY-1 or ht-CyY-U1 were grown in 1.5 mL of LB media supplemented with 100 µg/mL ampicillin and 0.2 % arabinose in a deep-well 96-well plate at 37 °C in an 100% O2 filled bag.  Following 16 hrs incubation, cultures were harvested by centrifugation and lysed in 50 uL of Bugbuster.  Then, 350 µL of 100 mM potassium phosphate, 2 mM EDTA; pH 7.5 was added and dilutions of this cleared lysate were added to a black 96-well plate (final volume 100 µL).  Proteinase was added to a final concentration of 0, 0.25, 0.5 and 1 µM and progress curves were measured using the fluorescent plate reader.  Initial velocity was plotted against initial FRET signal which is proportional to fluorescent protein concentration.  Proteins were produced from plasmids described in Figure 18 and Figure 21.  Exponential curves were used to highlight trends in the data.  Similar results were obtained in three separate experiments performed using wider ranges of proteinase concentrations. 120  3.5 Screening for the substrate preference of HAV 3Cpro To validate the plate-based assay, it was used to screen the substrate preference of HAV 3Cpro using two libraries.  The P4 and P1’ libraries contained substrates in which either the residue at the P4 position of the cleavage sequence (XRTQ/SFS) or the P1’ position (LRTQ/XFS) was varied.  These libraries of substrates were generated using PCR of the YPet gene and a primer encoding the linker with sequence NN(G/T) used to encode the randomized residue.  The resulting amplicon was then cloned in frame into pBDXCy-H thus concatenating CyPet and YPet with a cleavage sequence randomized in the targeted position.  Completeness of the library was confirmed by randomly sequencing 100 clones (results not shown).  Clones were grown in 96-well plates and initial velocities were calculated from the first 45 minutes of progress curves following addition of proteinase to the cleared lysates as described in section 3.4.2.  Initial velocities were plotted versus initial YPet signal (λex = 485 nm, λem = 535 nm) instead of the initial FRET signal (λex = 430 nm, λem = 535 nm).  First, the YPet signal is likely to be less influenced by changes in linker structure between variants in the library.  Second, by measuring YPet signal directly, clones not expressing YPet because of the presence of a stop codon in the linker should be immediately obvious in plotting the data. 3.5.1 Screening of the P4 position library Cells expressing ht-CyY-1, ht-CyPet, and ht-CyY-U1 as well as 176 randomly chosen clones from the P4 library were grown and screened as described in section 3.4. In plots of rate of loss of FRET signal versus YPet signal (Figure 28), cells expressing CyPet (ht-Cy-H) lie along the y-axis as they had no significant F527 signal.  Cells expressing uncleavable substrate ht-CyY-U1 lay close to the x-axis as ht-CyY-U1 was 121  not cleaved.  The observed low rate of F527 decay in these clones was assumed to be due to bleaching.  Cells containing ht-CyY-1, a well cleaved substrate, were positioned between ht-Cy-H and ht-CyY-U1 clones on the plot.  In screening the library, clones either fell along the y-axis (indicating they produced no YPet, perhaps due to a stop codon in the linker sequence) or between the cleaved and uncleaved controls.  This latter distribution is consistent with a range in the degree of cleavage of various substrates in the library.  Finally, this distribution further indicates that no sequence was better cleaved than the wildtype. In contrast to Figure 27, initial rates for both ht-CyY-1 and ht-CyY-U1 appeared linear in Figure 28.  By taking the ratio of rate/YPet, these initial rates were normalized to fusion protein concentration: clones with higher normalized rates presumably contain better cleavage sequences.  In addition to comparing normalized rates in the P4 screen, direct examination of positions of the clones in the plot was also necessary to guide selection of clones expressing well cleaved substrate.  Based on the normalized rate, as well as the position of the clones in the plot in Figure 28, 14 clones from the results of the P4 library screen were selected for sequencing and the identity of the P4 residue was determined.  Four of these clones had either a normalized rate, or plot positions that were similar to ht-CyY-U1 suggesting they were not cleaved.  The ten other clones were chosen because they had a normalized rate or plot positions similar to ht-CyY-1 suggesting they were well cleaved.  The results of sequencing are summarized in Figure 29.  Highlighted in the rectangle are those clones that were selected for showing poor cleavage, either based on normalized rate or position in the plot of Figure 21.  One of these clones lacked the entire linker sequence. 122  0 100 200 300 400 500 600 0 100 200 300 400 500 600 700 800 900 1000 Initial F527   (mRFU) Ra te  of  lo ss  of  F5 27  (R FU /m in ) ht-Cy-H ht-CyY-1 ht-CyY-U1 Library  Figure 28:  Screening of the P4 library for cleavage by HAV 3Cpro.  E. coli BW27783 expressing the P4 library (a CyPet-YPet linked substrate with linker XRTQ/SFS), ht- CyPet, ht-CyY-1 or ht-CyY-U1 were grown in 1.5 mL of LB media supplemented with 100 µg/mL ampicillin, 7.5 µg/mL tetracycline and 0.2 % arabinose in a deep-well 96-well plate at 37 °C in an 100% O2 filled bag.  Following 16 hrs incubation, cultures were harvested by centrifugation and lysed in 50 uL of Bugbuster.  Then, 350 µL of 100 mM potassium phosphate, 2 mM EDTA; pH 7.5 was added and 100 µL of this cleared lysate was transferred to a black 96-well plate.  Proteinase was added to a final concentration of 1 µM and progress curves were measured using the fluorescent plate reader.  Initial velocity was plotted against initial YPet signal.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 123   Figure 29:  Rate of change in FRET signal /YPet signal for selected clones from the HAV 3Cpro screen of cleared lysates of the P4 library.  Fourteen selected clones from the screen of the ht-P4 library in Figure 20 were sequenced and the identity of the P4 residue was determined.  Clones within the box were selected to be poorly cleaved based on the similarity of the ratio to ht-CyY-U1 and their position in the plot in Figure 20.  The P4 residue labelled as missing was missing the entire linker sequence.  Controls expressing ht-CyY-1 and ht-CyY-U1 are as indicated.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 3.5.2 Screening of the P1’ library A screen of P1’, analogous to the screen described in section 3.5.2, resulted in a similar distribution of clones as shown in Figure 28 (data not shown). Given the success in using the ratio of the normalized rate to guide the selection of clones in the P4 library, the same strategy was used to select eight clones from the P1’ library (LRTQ/XFS) having a normalized rate similar to ht-CyY-1.  The respective rates of FRET loss and P1’ residue identities are shown in Figure 30. 0 2 4 6 8 10 12 ht- Cy Y-U 1 ht- Cy Y-U 1 m iss ing Gly Arg Ly s Glu Glu Il e Ile Le u Le u Va l Va l Va l Va l ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 P4 residue No rm al iz ed  ra te s of  lo ss  of  F5 27  (m in    ) - 1 Poor 124  0 2 4 6 8 10 12 ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 ht- Cy Y-1 Gl y Gly Se r Se r Se r Se r Va l Ala ht- Cy Y-U 1 ht- Cy Y-U 1 ht- Cy Y-U 1 ht- Cy Y-U 1 P1' Residue No rm al iz ed  ra te s of  lo ss  of  F5 27  (m in    )  Figure 30:  Rate of FRET signal change/YPet signal for selected clones from the HAV 3Cpro screen of the CyPet-YPet P1’ library.  Eight selected clones from the screen of the HAV 3Cpro screen of the CyPet-YPet fluorescent substrate based P1’ library were sequenced and the identity of the P1’ residue determined. Controls expressing ht-CyY-1 and ht-CyY-U1 are as indicated.  Proteins were produced from plasmids described in Figure 18 and Figure 21. 3.5.3 Kinetic characterization of cleavage of P1’ position substrates To further validate the plate-based screen, three substrates identified as good substrates of HAV 3Cpro in the P1’ library were purified and kinetically characterized. The three substrates, identified as ht-CyY-1A, -1G and -1V, differed from ht-CyY-1 in having an Ala, Gly, and Val, respectively at the P1' position of the cleavage sequence instead of Ser. Relative to substrate ht-CyY-1, the substrate with Val in the P1’ position was poorly cleaved, which was unexpected based on the rate/YPet value in Figure 30. However, re-examination of the progress curves from the original P1’ library screen revealed that the loss of FRET was incorrectly calculated due to a jump in the progress 125  curve (data not shown).  This result highlights the value of examining progress curves of selected clones from future libraries for similar irregularities. Table 12: Relative rates of cleavage of fusion proteins by HAV 3Cpro. Substrate Relative rate ht-CyY-1 1.0 ht-CyY-1/A 0.31 ht-CyY-1/G 0.28 ht-CyY-1/V 0.03 Experiments were performed using 100 mM potassium phosphate, 2 mM EDTA, pH 7.5 at 37 °C.  Errors were typically less than 5%. 3.6 The replicase of Israeli acute paralysis virus (IAPV) Following the discovery of IAPV associated with colony collapse disorder (CCD) [19], efforts were made to characterize the 3Cpro of this dicistrovirus.  As no dicistroviral 3Cpro has been functionally characterized, the N- and C-termini of the IAPV 3Cpro were tentatively identified by aligning the IAPV sequence with previously characterized 3Cpro and replicase proteins of related picornaviruses (Figure 31).  Several multiple sequence alignments of different segments of the polyproteins were used in an effort to predict the cleavage sites of the proteinase.  The IAPV 3Cpro contains the highly conserved His residue (corresponding to His191 of HAV 3Cpro) which is the key residue for the Gln specificity of characterized 3Cpro's.  Moreover, the divergent picornaviral 3Cpro’s and coronaviral 3CLpro’s show specificity for the Gln at the P1 position.  Therefore, potential sequences were selected assuming that dicistroviral 3Cpro cleavage would also show specificity for Gln at the P1 position.  The top choices of the C- and N- termini of the IAPV 3Cpro marked are with arrows in Figure 31.  Other potential cleavage sequences are 126  indicated by asterisks.  Two fragments of the IAVP genome were cloned into pET41b: one encoded the predicted 3Cpro (amino acid residues 1121-1355 of the replicase) and a second encoding the 3Cpro with an additional ~91 kDa of flanking polyprotein.  This polyprotein included amino acid residues 887-1900 of the IAPV replicase and is referred to here as Rep887-1900.  Figure 31: Prediction of IAV 3Cpro termini.  Highlights indicate conserved residues in 3Cpro’s. Arrows indicate the beginning and end of the IAPV 3C sequence that was produced.  Asterisks (*) show Gln residues of potential alternative cleavage sites. Sequences were aligned using ClustalX as described in Materials and Methods. GenBank accession numbers for protein sequences are as follows: IAPV (Israel acute paralysis virus of bees), YP_001040002.1; AcBPV (Acute bee paralysis virus), NP_066241.1; HAV (Hepatitis A Virus), 2CXV_A. 3.6.1  Expression and solubility of IAPV 3Cpro Expression of untagged and his-tagged IAPV 3Cpro were tested in a variety of E. coli strains, including C43(DE3)), NovaBlue(DE3), GJ1158(DE3) and CodonPlus (DE3) RIL.  Production of the proteinase was only observed as a polyhistidine-tagged proteinase, ht-3Cpro, in E. coli CodonPlus (DE3) RIL using pETXIs3C.  The host strain contains extra copies of the argU, ileY, and leuW tRNA genes which are limiting in E. coli.  SDS-PAGE analysis of whole cell extracts indicated that ht-3Cpro constituted ~ 20% of the total cellular protein (data not shown).  Attempts to purify ht-3Cpro were 127  unsuccessful as the majority of the protein was insoluble.  Ht-3Cpro bound to an IMAC column if the protein was denatured using 8 M urea.  However, the attempts to refold the protein were unsuccessful (data not shown). In a further attempt to obtain soluble IAPV 3Cpro, the protein was expressed with an N-terminal GST-tag in E. coli CodonPlus (DE3) RIL.  Following overnight growth at 30 °C, the protein was produced to ~20% of the total cellular protein (Figure 32). Despite high amounts of the GST-3Cpro, the vast majority was insoluble (lane 3). Attempts to increase the yield of soluble protein, by varying the culture temperature and collection time were unsuccessful. Purification of the GST-tagged 3Cpro yielded very small amounts of proteinase. However, the proteinase efficiently cleaved the SARS-P2 substrate and the best preparation had a specific activity of 1300 µM min-1 mg-1.  The IAPV GST-3Cpro from GST-purification (Section 2.5.6) was estimated to be 30% of total eluted protein when visualized with SDS-PAGE according to densitometric analysis using ImageQuant TL (v2005.04, Amersham Biosciences, Buckinghamshire, UK) 128   Figure 32:  Analysis of IAPV GST-tagged 3Cpro expression. Lanes were loaded with M) molecular weight standard (kDa) and the whole cell extract of E. coli CodonPlus (DE3) RIL (pETXIs3C) 1) at 0 hour and 2) 16 hours following induction of 3Cpro expression. Lane 3) contains cleared lysate of the sample from lane 2.  The gel contained 12% acrylamide and was stained with Coomassie Blue. 3.6.2 Sequence in the IAPV replicase cleaved by the IAPV 3Cpro Rep887-1900, a 116 kDa portion of the IAPV replicase which includes the 3Cpro, was produced as an N-terminal GST-tagged protein.  PAGE analysis of E. coli CodonPlus (DE3) RIL containing pETXIs3BCD revealed that overnight production resulted in the appearance of a new band with Mr of 45 kDa (data not shown).  While this protein is much smaller than the unprocessed GST- Rep887-1900 (expected Mr of 143.6 kDa), it could be purified using affinity chromatography (Figure 33), indicating that it contained a GST tag.  This result suggests that GST-Rep887-1900 was auto-processed by the 3Cpro encoded within the produced replicase fragment and that this proteinase was active. 129  To test the hypothesis that the 45 kDa band was derived from GST-Rep887-1900, the band was excised from the denaturing gel and analyzed using trypsin digest combined with liquid chromatography mass spectrometry/mass spectrometry (LC-MS/MS).  This analysis yielded peptides corresponding to the GST-tag and residues 887-1032 of the replicase (Table 13).  Peptides corresponding to residues 887 - 898 (DGQKKKQAIK) and 1025-1026 (NR) were not detected by MS, presumably because they are too small, Figure 34.  The last contiguous peptide identified from LC-MS/MS analysis was TPIVIE. Identification of this peptide TPIVIE was strongly supported by the fragmentation pattern (Figure 35:A).  Peptide VCLVHNDDR (residues 1142-1150), which occurs outside of the contiguous region (Figure 34), was also identified.  However, the peptide cutoff score was below the 95% confidence limit and the spectrum of this peptide did not meet the criteria for manual validation of a fragment spectrum as there was no consecutive Y-ion series (Figure 35:B).  Overall, this analysis supports the hypothesis that the heterologously produced GST-Rep887-1900 was processed by the 3Cpro and that a potential cleavage sequence for 3Cpro is IVIE/AQT. 130   Figure 33:  SDS-PAGE analysis of purified Frag45.  Lanes were loaded with M) molecular weight standard (kDa), 1) cleared lysate of E. coli CodonPlus (DE3) RIL (pETXIs3BCD), 2) column flow-through, 3) wash 1 flow through, 4) wash 2 flow through, 5) wash 3 flow through, 6) eluted protein.  Frag45 and contaminating GST protein are indicated.  The gel contained 12% acrylamide and was stained with Coomassie Blue.  Figure 34:  Peptides of the purified replicase fragment.  Frag45 (Figure 26) was Rep887- 1900digested using trypsin and subject to LC-MS/MS analysis.  The indicated amino acid sequence is derived from the N-terminus of Rep887-1900.  The residues in red are derived from peptides identified by LC-MS/MS.  131  Table 13: Peptides identified in the purified GST-IsReplicase fragment using LCMS/MS. Start - Enda Mr(expt) Mr(calc) Sequenceb Ions Scorec Confidence Cutoff 898 - 912 1828.995 1828.995 K.RHFINTGYTLIIPER.E 78 2.4e-4 899 - 912 1672.894 1672.894 R.HFINTGYTLIIPER.E 92 4.8e-3 899 - 916 2157.162 2157.158 R.HFINTGYTLIIPERELNK.F 64 1.3e-5 900 - 912 1535.835 1535.835 H.FINTGYTLIIPER.E 74 5.6e-4 901 - 912 1388.769 1388.766 F.INTGYTLIIPER.E 78 3.4e-4 903 - 912 1161.641 1161.639 N.TGYTLIIPER.E 38 3.1 913 - 921 1192.58 1192.576 R.ELNKFWELD.E 31 24 913 - 927 1919.965 1919.963 R.ELNKFWELDETLDLR.G 92 1.6e-5 917 - 927 1435.699 1435.698 K.FWELDETLDLR.G 91 2.1e--5 919 - 927 1102.551 1102.551 W.ELDETLDLR.G 33 17 928 - 945 2057.147 2057.146 R.GMPVNQIEEHLALLLKPR.H 82 5.6e-5 930 - 945 1869.096 1869.084 M.PVNQIEEHLALLLKPR.H 68 5.1e-4 933 - 945 1558.922 1558.92 N.QIEEHLALLLKPR.H 35 1.4 938 - 945 922.6334 922.6327 H.LALLLKPR.H 52 1.3e-3 939 - 945 809.5486 809.5487 L.ALLLKPR.H 37 0.17 940 - 945 738.5108 738.5116 A.LLLKPR.H 32 1 941 - 945 625.428 625.4275 L.LLKPR.H 25 21 946 - 953 946.6072 946.6076 R.HRVVLVPK.A 40 0.038 947 - 953 809.5496 809.5487 H.RVVLVPK.A 34 0.33 948 - 953 653.4475 653.4476 R.VVLVPK.A 45 0.082 948 - 956 953.6276 953.6273 R.VVLVPKATK.Y 29 2.1 949 - 953 554.3795 554.3792 V.VLVPK.A 28 4.9 957 - 964 935.4977 935.4964 K.YIISLVDN.H 38 2.7 957 - 967 1271.689 1271.687 K.YIISLVDNHAK.L 86 6e--5 958 - 967 1108.624 1108.624 Y.IISLVDNHAK.L 39 1.5 959 - 967 995.5467 995.54 I.ISLVDNHAK.L 47 0.29 968 - 979 1369.833 1369.829 K.LTDKIILITANR.Y 60 2.7e-3 971 - 979 1040.671 1040.671 D.KIILITANR.Y 65 5e-4 972 - 977 642.4325 642.4316 K.IILITA.N 44 0.2 972 - 979 912.5762 912.5756 K.IILITANR.Y 57 2.5e-3 974 - 979 686.4079 686.4075 I.LITANR.Y 35 12 980 - 984 718.3692 718.369 R.YVFYK.N 28 55 985 - 1001 2118.019 2118.006 K.NQNYELVFGELNQFFEK.D 124 2.5e-7 985 - 1011 3198.573 3198.551 K.NQNYELVFGELNQFFEKDPESLVNTPK.V 95 5.1e-6 1002 - 1011 1098.556 1098.556 K.DPESLVNTPK.V 60 0.027 1003 - 1011 983.5282 983.5287 D.PESLVNTPK.V 67 2.8e-3 1012 - 1024 1400.683 1400.682 K.VEAFASADLSTYK.N 67 4.6e-3 1027 - 1032 670.3899 670.3901 R.TPIVIE.A 28 11 1142 - 1150 1126.519 1126.519 K.VCLVHNDDR.I 26 42 a  start and end numbers indicate peptide coverage in the IAPV replicase, b peptide fragment that was identified where (.) indicates the cleavage site, c ion scores > confidence cutoff are considered significant (P = 0.05). 132   Figure 35:  Fragmentation spectra of peptides A) TPIVIE and B) VCLVHNDDR from LC-MS/MS analysis of Frag45. 3.7 Inhibitor studies Several compounds were screened against HAV 3Cpro and SARS 3CLpro and characterized with respect to their mechanisms of action in collaboration with researchers 133  at McMaster University, the University of Alberta and the Georgia Institute of Technology. 3.7.1 Proteinase specificity of inhibitors of SARS 3CLpro identified in a high- throughput screen SARS 3CLpro (purified >90% as determined by SDS-PAGE) was screened against a library of 50 000 compounds from the Maybridge plc library (Cornwall, UK) by collaborators at McMaster University.  Five of the best inhibitors identified from this screen were tested against HAV 3Cpro, NS3pro, chymotrypsin and papain to evaluate inhibitor specificity (Table 14).  The proteinases were chosen for this comparison based on structural and mechanistic considerations.  HAV 3Cpro is similar in structure and substrate specificity to 3CLpro.  The hepatitis C nonstructural 3 proteinase (NS3pro) and chymotrypsin are serine proteases possessing the same two β-barrel fold as 3CLpro and 3Cpro.  Finally, papain is a paradigm cysteine proteinase, possessing a Cys-His-Asp catalytic triad but whose structural fold differs from that shared by chymotrypsin, NS3pro, 3CLpro, and 3Cpro.  The dose-response curves for IC50 determination could not be obtained for every inhibitor/proteinase combination due to fluorescence and/or insolubility of some of the compounds.  In these cases, the IC50 is reported as a lower limit. Alternatively, those compounds for which enzyme inhibition was not seen at the highest concentration tested, are indicated accordingly.  Inhibitors MAC-8120 and MAC- 13985 appear to be the most specific inhibitors of SARS 3CLpro as they did not detectably inhibit the other proteinases.  MAC-22272 showed the least selectivity, inhibiting all proteinases to some extent.  MAC-30371 and MAC-5576 appeared to inhibit those enzymes with the chymotrypsin fold regardless if the active site contained a Cys or Ser. 134  However, these two compounds inhibited SARS 3CLpro and HAV 3Cproat lower concentrations than the enzymes with active site serines. Table 14:  IC50 values of novel SARS 3CLpro inhibitors. Table adapted from [60]. IC50 (µM)a Compound Structure 3CLpro b HAV 3C pro NS3pro  c Chymd Papain MAC-5576  0.5 ± 0.3 0.54 ± 0.09† N.I. (500)e 13 ± 5 N.I. (500) MAC-8120  4.3 ± 0.5 N.I. (5) N.I. (5) N.I. (500) N.I. (500) MAC-13985  7 ± 2 N.I. (5) N.I. (5) N.I. (500) N.I. (500) MAC-22272  2.6 ± 0.4 0.9 ± 0.1 >500f 29 ± 12 18 ± 9 MAC-30731  7 ± 3 54 ± 16 71 ± 14 >800 N.I. (500) aAll dose-response data was fit to a 3-parameter equation eq. (5), excluding † which was fit to a 4-parameter equation eq. (6) of materials and methods, to calculate IC50 values.  bSARS 3CLpro.  cHepatitis C NS3/4A proteinase.  dBovine pancreas chymotrypsin.  eNo inhibition seen at the concentrations of compound tested; highest concentration tested in brackets (in µM).  fInhibition was seen, but insufficient data were obtained to calculate an IC50 value. HAV 3Cpro, SARS 3CLpro and NS3pro were screened at UBC.  Chymotrypsin and papain were screened at McMaster University. 3.7.2 Inhibitors of SARS 3CLpro The halopyridinyl ester, MAC-5576, identified as the most potent inhibitor in the McMaster screen (section 3.7.1) was further characterized by steady-state kinetics N S NH2 S O O OH N OH F F F O O O NN S S N NH2 NH2 S O O Cl Cl O Cl N O O S Cl 135  together with two other inhibitors: a ketoglutamine analogue and an azapeptide expoxide (APE).  Ketoglutamine analogues have been shown to be effective inhibitors of 3Cpro’s from human rhinovirus (HRV) and HAV [57, 122].  Accordingly, ketoglutamine inhibitor HIP2-171-2 was designed by collaborators at the University of Alberta to target the SARS 3CLpro.  Similarily, APE’s were originally developed to inhibit clan CD cysteine proteinases (caspases).  In these inhibitors, the aza-peptide component resembles the peptide substrate and covalently modifies the active site cysteine [123]. The halopyridinyl ester MAC-5576 did not appear to act irreversibly as pre- incubation of the compound with proteinase did not affect the observed degree of inhibition.  Inhibition was therefore further characterized using steady-state kinetic experiments.  Each of three models were fit to the data: competitive, uncompetitive and mixed.  The best fit was obtained using the competitive model, with a Kic = 0.64 ± 0.07 µM (Figure 36: A). Keto-glutamine analogues reversibly inhibit viral proteinases [57, 122]. Accordingly, HIP2-171-2 was analyzed with SARS 3CLpro using steady-state kinetics and three different models were fit to the data.  As for the halopyridinyl ester, the best fit was obtained using the equation describing competitive inhibition, and yielded a Kic = 0.17 ± 0.03 µM (Figure 36:B). 136   Figure 36:  Dixon-plot of steady-state analysis of reversible inhibitors of SARS 3CLpro. A) The rate of reaction was determined using 7.5 µM (○), 15 µM (■), 30 µM (▲) and 60 µM (×) peptide substrate (SARS-P2) with inhibitor MAC-5576.  The calculated Kic was 0.64 ± 0.07 µM.  B) The rate of reaction was determined using 7.5 µM (♦), 15 µM (■), 30 µM (▲), 60 µM (×) and 160 µM (○) peptide substrate (SARS-P2) with inhibitor HIP2- 171-2, structure shown in plot).  The calculated Kic was 0.17 ± 0.03 µM.  The concentration of SARS 3CLpro was 0.1 µM in 20 mM Bis–Tris (pH 7.0), 2 mM DTT, and reactions were performed at 37 °C.  Parameters of competitive inhibition were done by fitting eq. (7) of materials and methods using the least-squares and dynamic weighting options of LEONORA (Cornish-Bowden, 1995).  Outliers are not shown for clarity but were including during analysis.  The plotted lines were calculated using the best fit parameters. 137  The APE inhibitor KAE-3-91 (Cbz-Leu-Phe-AGln-(S,S)EPCOOEt) was tested for its ability to inhibit the SARS 3CLpro.  An azaglutamine (AGln) as the P1 residue was expected to mimic the S1 specificity of SARS 3CLpro.  Thus, the inhibitor with sequence Leu-Phe-AGln is expected to specifically target the SARS 3CLpro substrate binding pocket [53].  Progress curves of the steady-state cleavage of peptide substrate Abz- SVTLQSGY(NO2)R by 3CLpro were significantly curvilinear in the presence of KAE-3- 91, consistent with an irreversible mode of action.  To characterize irreversible inhibition, inactivation rates, js, were evaluated from the progress curves and were analyzed as a function of substrate and inhibitor concentrations (Figure 37).  Fit of equation 7 (Section 2.14.3) to the data yielded a kinact/Ki of 1900 ± 400 M−1s−1 (Figure 37).  A crystal structure of inhibitor KAE-3-91 bound to SARS 3CLpro was described by collaborators and results from this structure are consistent with covalent modification [53]. 138   Figure 37: The steady-state kinetics of covalent inhibitor KAE-3-91 (structure shown in figure) tested with SARS 3CLpro.  The rate of SARS 3CLpro inhibition was determined using 16 µM, (○) 32 µM (□), 64 µM (▲) and 100 µM (×) of SARS-P2 peptide.  The rate of proteinase inactivation was determined at several substrate and inhibitor concentrations and fit to Equation 8 (Materials and Methods, section 2.14.4) using SCIENTIST version 2.01 (Micromath Scientific Software, Salt Lake City, UT).  The js values obtained from this analysis was then fit to Equation 9 (Materials and Methods, section 2.14.4) using the least-squares, dynamic weighting options of LEONORA, [117] yielding the following parameters: kinact=35 ± 17×10−3 s−1, Ki = 18 ± 9 µM and Km = 96 ± 31 µM.  The assay contained 25 nM SARS 3CLpro, 20 mM Bis–Tris, 2 mM DTT, pH 7.0, and was performed at 37 °C.  Figure adapted from [53]. 3.7.3 Screening inhibition of HAV 3Cpro with a library of pyridinyl esters A library of 82 pyridinyl esters based on MAC-5576, (see section 3.7.1) was developed and tested by collaborators at the University of Alberta against SARS 3CLpro. From this library, several potent inhibitors were identified [61].  Based on this success, the same library of pyridinyl esters was screened against HAV 3Cpro using a microplate assay.  Of the 82 compounds, 49 completely inhibited (>90%) the proteinase’s activity when tested at 10 µM, seven showed complete inhibition at 1 µM and none showed complete inhibition at 0.25 µM (Table 15).  For six compounds (Table 16) that inhibited 139  the proteinase activity to the greatest extent at 1 µM, IC50 values were evaluated.  The IC50 experiments were performed as described for the initial screening except that 20 µM substrate was used.  As summarized in (Table 16), the six compounds had IC50’s ranging from 50 nM to 1.2 µM.  The most potent of these inhibitors was ZJM-2-172 (5-Bromo- pyridin-3-yl Furan-2-carboxylate).  Indeed, the IC50 for this compound was close to the theoretical minimal value that can be determined in this experiment (i.e., 50% of the concentration of enzyme). 140   Table 15: Percentage of inhibition of HAV 3Cpro for preliminary analysis of inhibitor library at various concentrations of inhibitors. Table adapted from [124]. Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM MAC-5576 N O Cl O S  93 N.D. N.D.  Jian-73  >90 67 23 ZJM-2-69  N O O S  89 8 N.D.  Jian-14 See Table 16. 54 69 53 ZJM-2-70  N O O S  83 21 N.D.  ZJM-1- 188 See Table 16. >90 >90 50 ZJM-2-71  N O O S  <10 10 N.D.  JIAN-75  82 N.D. N.D. ZJM-2-80  N H N O S  <10 N.D. N.D.  JIAN-77  85 57 <10 ZJM-2-73 N H N O S  <10 N.D. N.D.  JIAN-79  >90 59 10 141  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM ZJM-2-74 N H N O S  <10 N.D. N.D.  JIAN-80  >90 11 N.D. ZJM-2-75 N H N O S Cl  <10 N.D. N.D.  JIAN-82  59 N.D. N.D. ZJM-2-76 N H N O S Cl  <10 N.D. N.D.  JIAN-85  >90 26 N.D. ZJM-2-77 N H N O S F  <10 N.D. N.D.  JIAN-86  82 <10 N.D. ZJM-2-78 NO O S Cl  16 N.D. N.D.  JIAN-87  >90 >90 20 ZJM-2-88 NO O S Me  91 <10 N.D.  JIAN-98 N O O O Cl O2N  N.D.a N.D. N.D. Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM 142  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM ZJM-2-87 NO O S Me  12 N.D. N.D.  Jian-64  64 57 <10 ZJM-2-79 NO O S Me  23 N.D. N.D.  Jian-68  39 23 N.D. ZJM-2-85 NO O S Cl  25 N.D. N.D.  Jian-69  29 50 N.D. ZJM-2-84 NO O S Cl  11 N.D. N.D.  Jian-71  63 32 N.D. ZJM-2-86 NO O S Me  <10 <10 N.D.  Jian-34  <10 N.D. N.D. ZJM-2-89 NO O S NO2 Me  14 N.D. N.D.  Jian-41  74 54 27 143  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM ZJM-2-67 N ON H Cl O  92 <10 <10  ZJM-2-90  19 N.D. N.D. ZJM-2-68 See Table 16. >90 >90 49  Jian-16  <10 N.D. <10 ZJM-2-109 N OO Cl O  >90 >90 <10  Jian-18  >90 53 N.D. ZJM-2-102 N O Cl O O  >90 N.D. N.D.  Jian-28  >90 30 N.D. ZJM-2-108 N O Cl O  >90 >90 <10  Jian-37  13 N.D. N.D. ZJM-2-172 See Table 16. N.D. >90 87  Jian-38  82 75 32 144  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM Jian-98 O O O N Br  67 N.D. N.D.  Jian-39  >90 N.D. N.D. JIAN-93 OO Cl O  11 N.D. N.D.  Jian-40  87 60 22 ZJM-2-103 N OO Cl  <10 N.D. N.D.  Jian-42  >90 27 N.D. ZJM-2-168 N OO O  >90 N.D. N.D.  Jian-44  75 N.D. N.D. JIAN-92 N H NSS O O  <10 N.D. N.D.  Jian-53  81 32 N.D. ZJM-3-29 NO S  10 N.D. N.D.  Jian-61  >90 45 N.D. 145  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM JIAN-36 N O O N H Cl  80 58 N.D.  Jian-65  77 70 N.D. JIAN-35 N O O S Cl  >90 47 N.D.  Jian-67  85 N.D. N.D. Jian-94 N O O S N Cl  >90 85 37  Jian-74  >90 24 N.D. JIAN-72 N O O ClMeO  >90 50 N.D.  Jian-88  64 N.D. N.D. JIAN-5 N O O OCl Cl  >90 N.D. 36  Jian-6  40 N.D. N.D. Jian-4 See Table 16. >90 N.D.. 54  Jian-10  76 36 N.D. 146  Comp Structure % 10 µM % 1 µM % 0.25 µM  Comp Structure % 10 µM % 1 µM % 0.25 µM Jian-17 See Table 16. 83 >90 43  Jian-13  56 21 N.D. Jian-1  <10 N.D. N.D.  Jian-21  37 34 N.D. Jian-2  >90 N.D.. 24  Jian-22  22 N.D. N.D. Jian-7  37 N.D. N.D.  Jian-23  44 19 N.D. Jian-11  >90 N.D.. <10  Jian-28  86 81 N.D. Jian-12  33 47 34  Jian-29  23 35 N.D. N.D. – not determined. a – not soluble. 147   Table 16:  Kinetic parameters of a series of pyridinyl analog inhibitors of HAV 3Cpro and SARS 3CLpro and half-life of pyridinyl analogues in buffer.  Table adapted from [124]. Compound Structure IC50 nM Km nM kcat (s-1) × 10-5 kcat/Km (M-1s-1) ×103 Half-life (s-1) ×10-3 HAV 3Cpro ZJM-2-68  338 ± 2 240 ± 30 110 ± 6 4.6 ± 0.6 1.2 ± 0.2 Jian-17  140 ± 20 180 ± 30 25 ± 8 1.4 ± 0.5 4.9 ± 0.6 ZJM-2-172  53 ± 2 120 ± 20 119 ± 8 10 ± 2 1.1 ± 0.3 ZJM-1-188  470 ± 60 N.D. N.D. N.D. N.D. Jian-4  1200 ± 130 N.D. N.D. N.D. N.D. Jian-14  250 ± 50 N.D. N.D. N.D. N.D. SARS 3CLpro ZJM-2-172  N.D. 26 ± 7 17 ± 6 7 ± 3 N.D. – not determined. 148  3.7.4 Measuring hydrolysis of pyridinyl ester inhibitors of HAV 3Cpro In studies using sufficient pyridinyl ester from section 3.7.3 to completely inhibit the initial hydrolysis of the fluorogenic peptide by HAV 3Cpro, recovery of peptide hydrolysis was sometimes observed after incubating the reaction mixture for ~4 min. This suggested that HAV 3Cpro might catalyze the slow hydrolysis of the ester inhibitor. To investigate this possibility, we developed an HPLC-based assay to monitor inhibitor hydrolysis by HAV 3Cpro and SARS 3CLpro.  Reactions were performed using a concentration of pyridinyl ester high enough to ensure enzyme saturation.  HPLC analysis of the reaction mixture demonstrated that the expected hydrolysis products could be observed in a time-dependent manner concomitant with the disappearance of the ester (Figure 38) and that this hydrolysis was dependent on the enzyme.  For each of the tested esters, product identification was confirmed when possible by comparison to known standards.  The assay was performed at several concentrations of ester to confirm saturation of the proteinase with the ester and enzymatic hydrolysis rates were corrected for the non-enzymatic hydrolysis of the inhibitor 149   Figure 38:  Hydrolysis of ZJM-2-172 by HAV 3Cpro.  The reaction mixture contained 50 µM inhibitor and 2 µM 3Cpro. It was analyzed by HPLC after 0, 17, 35 and 52 minutes. Traces were recorded at (A) 252 nm and (B) 287 nm.  Peaks corresponding to each of ZJM-2-172, furoic acid and 3-bromo-5-hydroxypyridine (3B5H) are labelled.  Over the time course of this experiment, non-enzymatic hydrolysis of the ester was negligible (data not shown). Figure adapted from [124]. The calculated and deduced steady-state kinetic parameters for three of the best inhibitors are summarized in (Table 16).  The kcat values were calculated from the hydrolysis rates at saturating ester concentrations.  The Km values were taken to be the equivalent of the determined Kic values, which is the case for substrates that are slowly turned over [125].  Among the three inhibitors tested with HAV 3Cpro, the two with the same acyl group, ZJM-2-172 and ZJM-2-68, had very similar kcat values.  Equivalent studies using SARS 3CLpro and the most potent inhibitor, ZJM-2-172, demonstrated that this proteinase also catalyzed ester hydrolysis with parameters similar to those observed for HAV 3Cpro. 150  3.7.5 MS analyses of a pyridinyl ester inhibitor:HAV 3Cpro complex The kinetic data from section 3.7.4 indicate that HAV 3Cpro catalyzes the slow hydrolysis of the pyridinyl ester inhibitors.  To investigate whether hydrolysis proceeds via an acyl-enzyme intermediate, samples of proteinase were incubated for 10 min with 100 µM ZJM-2-172 and the resulting sample was analyzed by mass spectrometry.  As shown in Figure 39, incubation of HAV 3Cpro resulted in a mass increase of 100 Da ± 2.5. This is consistent with the covalent attachment of the furoyl moiety (MW 95 Da) and the departure of the 3-bromo-5-hydroxypyridine as the leaving group.  In samples that were incubated for either 2 or 10 min, only the acylated form of the proteinase was detected.  Figure 39: (A) Mass spectrum of wild type HAV 3Cpro (M+ 23875.08 Da). (B) Mass spectrum of the complex of 3Cpro and inhibitor ZJM-2-172 following 2 minutes incubation (M+ 23974.38 Da).  Figure adapted from [124].  151  Chapter Four: Discussion 4.1 XylR-based selection of HAV 3Cpro A selection based on the transcriptional regulator XylR was tested to evaluate the activity of HAV 3Cpro.  It had previously been established that in XylR, as in other NtrC/NifA-family regulators, the N-terminal, effector-binding A-domain (Figure 11) inhibits the DNA-binding activity of the D-domain [78].  Moreover, deletion of the A domain (XylR∆A) yielded a constitutively active form of XylR while substitution of the A-domain for the N-terminal domain of the MS2 phage polymerase resulted in a form of XylR unable to activate transcription [78].  It was therefore reasoned that inserting a proteinase cleavage site between the MS2 domain and XylR∆A would yield a regulator that could be activated by the cognate proteinase.  Accordingly, biological selection and screening systems were established in which an HAV 3Cpro cleavage site, LRTQ/SF, was engineered into MS2-XylR∆A.  The selection host, E. coli PuCm, was engineered to have a chloramphenicol acetyl-transferase gene (cat) under control of the cognate promoter of XylR, PU.  Similarly, the screening host E. coli PuLacZ had the lacZ gene placed downstream of the PU promoter.  With a combination of cleavable transcriptional regulator and host, chloramphenicol resistance or LacZ activity could be induced by the presence of active proteinase.  Furthermore, the modularity of the designed selection system means that other hosts can be tested with the cleavable substrate and proteinase combination. Several elements of the system functioned as expected.  For example, the selection host, E. coli PuCm, survived on chloramphenicol-containing plates either in the presence of XylR and its effector 3-MBA, or in the presence of XylR∆A.  The screening 152  host, E. coli PuLacZ, produced β-galactosidase under analogous conditions.  Overall, the correct functioning of the hosts indicates that a selection system is possible with the correct choice transcriptional regulator. Curiously, the response of the hosts appeared to depend on the promoter from which XylR was expressed.  Thus, XylR and XylR∆A induced survival of E. coli PuCm when their respective genes were under control of either the native XylR promoter PR (e.g., pUCP26 and pUC18; section 3.2.5) or PT7 (e.g., pFH2WTXR; Table 10).  In contrast, neither XylR nor XylR∆A induced the strain’s survival when produced using PBAD (e.g., pBDXylR; section 3.2.5).  Moreover, these results were consistent with those obtained using the screening strain E. coli PuLacZ.  That is, XylR produced from PBAD induced lower levels of β-galactosidase activity following addition of the effector 3-MBA than XylR produced using either PR or PT7 (Figure 12).  These results suggest that the levels of XylR produced using pBDXylR were insufficient to enable survival of the selection strain in the presence of chloramphenical.  This is somewhat surprising as in Pseudomonas putida mt-2, the originating strain of XylR, as few as 90 XylR molecules per cell are required to activate transcription from PU [126].  However, one possible explanation is that the PU promoter present in the selection strain is incomplete, and thus may require higher levels of XylR to induce transcription. The principal failing of the selection and screening systems is that the form of XylR designed to be inactive without processing, MXR1, appeared to be constitutively active.  Thus, MXR1 produced using PTAC induced survival of E. coli PuCm on chloramphenicol-containing plates (pVLTMXR1; Table 8) and induced expression of β- galactosidase in E. coli PuLacZ (Figure 12).  The results obtained using MXR1 were 153  consistent with those obtained with XylR and XylR∆A in that expression using PBAD resulted in lower levels of induced of β-galactosidase in E. coli PuLacZ and did not support survival of the selection strain on chloramphenicol-containing plates. The constitutive activity of MXR1 is inconsistent with the inability of MS2- XylR∆A to induce transcription from the PU promoter [78].  The only difference between these two forms of the regulator is the insertion of an 8-residue cleavage sequence between the MS2-domain and the truncated XylR protein (Figure 11).  Although this insertion was engineered into the flexible linker region of XylR, it is possible that it reorients the MS2 domain such that it does not repress the DNA-binding activity of the D-domain of XylR.  In fact, disruption of the B-linker region in XylR leading to constitutive XylR induction of PU has been reported [78, 127].  The inactivity of MS2- XylR∆A was reported using a construct based on pFH2, in which the engineered xylR gene was expressed from the PT7 promoter.  Curiously, when MXR1 was produced using a similar construct, constitutive activity was not observed.  While MXR1 could not be identified in SDS-PAGE analysis of raw extracts from cells containing pFH2MXR1 (data not shown), in contrast to those containing pVLTMXR1 (Figure 9), lack of MXR1 production using PT7 would not appear to explain the inconsistency as an equivalent pFH2 construct (pFHWTXR) produced sufficient XylR to induce responses in both the selection and screening strains. An additional complication with the MXR1 protein is that it was not predictably cleaved into two stable fragments by HAV 3Cpro.  MXR1 was clearly targeted by HAV 3Cpro as SDS-PAGE analyses revealed that levels of MXR1 dropped in cells co- expressing proteinase and substrate (Figure 9).  Furthermore, the same effect was 154  observed when purified 3Cpro was added to the raw extract of cells expressing MXR1 (Figure 10).  However, in neither case was the expected product band of 39.1 kDa, corresponding to XylR∆A, observed.  These results indicate that MXR1 was completely degraded following cleavage by HAV 3Cpro.  It is unclear why the MS2 and XylR∆A fragments are not stable.  Their respective N- and C-terminal amino acids residues are not predicted to target the cleaved proteins for degradation by host cell proteinases. [128]. Furthermore, cleavage of fluorescent proteins fused with a similar sequence (LRTQ/SFS in ht-CyY-1) resulted in stable products.  Finally, XylR∆A produced in cells is apparently stable as it can induce transcription from the PU promoter. Despite the inconsistent behaviour of MXR1, it should still be possible to develop a biological selection for proteinases using an appropriate cleavable transcription factor. Further development of the XylR-based selection system should address a number of points.  First, cleavage products should be stable.  Previous attempts by other researchers to purify XylR have been unsuccessful due to the protein’s low solubility [129].  Thus, the obvious direction of purifying MXR1, adding purified HAV 3Cpro and monitoring cleavage is not without challenges.  The addition of a C-terminal polyhistadine-tag, or other tag detectible by antibodies to MXR1 could allow identification of the C-terminal fragment resulting from cleavage (the fragment corresponding to XylR∆A) by western blot analysis.  More recently, single chain antibodies targeting XylR∆A have been developed which could be used to follow the fate of the cleaved MXR1 substrate [130]. Alternatively, other transcriptional regulators and their cognate promoters could be used in a selection system.  However, each system is likely to have its own challenges, even if they differ from those encountered in engineering XylR. 155  Optimization of the position of the cleavage sequence in the MXR1 substrate is necessary to further develop a biological selection system for screening HAV 3Cpro activity.  The MXR1 substrate, while based on a previously published MS2-linked XylR∆A, differs in eight amino acids in the linker region, which could account for the observed constitutive activity.  The cleavable linker generated for the selection system may have resulted in constitutive XylR∆A activation unhindered by the presence of the MS2 domain, thus changing the location of the cleavable sequence located in the B- linker may give different results.  The selection strain E. coli PuCm could potentially be used to create a cleavable form of MXR1.  Briefly, the selection strain and the proteinase would be used to screen a library of substrates in which the location of the cleavage sequence between the MS2 domain and XylR∆A is varied. Those clones that survive are either a) constitutively active or b) cleaved by the proteinase.  A second screen would be necessary to remove those linkers which induce survival independently of proteinase activity.  Ultimately, the apparent sensitivity of the linker between the MS2 domain and XylR∆A to substitutions may limit the use of this transcriptional regulator for the screening of proteinase activity. Engineering regulatory proteins has been previously used to select for proteinase activity.  Sices and Kristie [73] developed a biological screen based on cleavage of a modified lytic cycle repressor protein cI.  Kim et al., [75] screened the substrate specificity of the Hepatitis C viruses NS3 proteinase with a yeast selection.  In this selection, a yeast transcription factor was linked to the intracellular domain of an integral membrane protein via a proteinase cleavage site.  Cleavage of this protein released the transcription factor allowing it to activate its cognate promoter.  Selection systems based 156  on transcriptional regulators are easily modified merely by changing which gene is placed under control of the transcriptional regulator’s cognate promoter.  It is this feature that makes regulatory proteins an attractive target for screen and selection development. 4.2 Screening HAV 3Cpro specificity with fluorescent protein substrate A proteinase activity screen was developed based on the in vitro cleavage of fused fluorescent proteins.  In this method, E. coli cells producing a library of fluorescent fusion proteins were grown in multiwell plates overnight and lysed to generate the substrates.  Purified proteinase was added to the lysate and cleavage was monitored using a fluorescent plate reader.  The proteinase screen was validated by characterizing the specificity of HAV 3Cpro at two different positions in its cognate cleavage sequence. Overall, the screen represents a new method to characterize proteinase substrate preference in a high-throughput manner. There are numerous high-throughput methods for characterizing proteinase substrate preference including peptide screens, phage display, as well as protein-based screens (such as CLiPS) and selections [131].  Peptide-based screens have been developed to screen large libraries (i.e., microarray screen-based kits produced by Millipore) but can be expensive to develop as peptides must be synthesized.  Moreover, peptide libraries often do not incorporate all amino acids due to the limits of chemical synthesis [131].  For their part, phage display allows screening of large libraries of substrates but requires several rounds of enriching the cleaved sequences [132]. Biological screens, such as that in yeast developed by Kim et al. [75], can also process large libraries.  However, for both phage and biological screening methods, kinetic characterization of substrate cleavage requires additional synthetic or recombinant steps 157  to generate the requisite substrates.  Protein-based screens are exemplified by CLiPS, which uses fluorescent proteins [133].  In this method, a library of E. coli cells expressing peptide substrates on the surface are mixed with purified proteinase and a fluorescent tag which binds to the N-terminus of the peptide.  The screen consists of several rounds of: 1) prescreening to remove cells not expressing substrate; 2) cleavage by incubating cells with purified proteinase; and 3) sorting by fluorescence activated cell sorting (FACS) to enrich for processed substrates (loss of fluorescence).  This screen ultimately identifies well-cleaved substrates in large libraries.  Furthermore, Boulware et al. argue that specificity constants, kcat/Km, can be estimated from progress curves in a secondary screen in which substrate-expressing cells selected from the screen are analyzed by FACS at different times following addition of proteinase to determine the rate of loss of fluoresence. The fluorescent protein screen described in this thesis has several features that make it an effective and easy method to screen substrate libraries.  In contrast to peptide screens, generation of the library is straightforward using basic molecular cloning techniques and the contents of the library are easy to manipulate through the choice of oligonucleotides.  For the fluorescent protein screen, libraries were constructed by PCR amplification of YPet where the 5' primer encoded the linker library.  Alternatively, libraries could be constructed similar to the assembly of the fusion substrates using a linking oligonucleotide (section 2.10.3) for which randomized oligonucleotides were ligated into plasmid pBXCyY-U1.  A similar oligonucleotide-based method of library construction was recently suggested by Fretwell et al. [134] where they created oligonucleotide-based libraries of linked fluorescent proteins, GFP and DsRed. 158  However, with this method, construction of the library required phosphorylation of the oligonucleotides which is unnecessary following the method described in this thesis. Another advantage with the fluorescent protein screen described in this thesis is that substrate cleavage is screened in a continuous manner.  Thus, information from the progress curves can be incorporated into selection of the well cleaved substrates as the normalized initial rates (loss of F527) can be used to approximate relative kcat/Km, similar to CLiPS.  As all fluorescent protein substrates expressed in the library are polyhistidine- tagged they can easily be purified by IMACS, facilitating further kinetic characterization. Both the CLiPS method and the screen described in this thesis use fluorescent proteins and require purified proteinase [133].  However, while CLiPS can screen larger libraries, several rounds of sorting and regrowing the substrate-producing cells are required.  In contrast, the plate assay described in this thesis has only a single growth and cleavage step and following library generation, analysis can be completed within 24 hours.  Furthermore, unlike CLiPS, the plate method is not limited to libraries of substrates but can be expanded to screen libraries of proteinases with the addition of purified substrate to cell lysates.  In comparison to peptide screening, a fluorescent protein library can more easily incorporate all amino acids into a cleavage sequence.  In mixtures of peptides such as that described by Petithory et al. [135], only those residues on the prime-side could be screened as sequencing was by Edman degradation, although sequencing using mass spectrometry would allow all residues to be characterized. Scaling the fluorescent protein screen to evaluate larger libraries faces two difficulties, 1) larger libraries require large amounts of proteinase which may be difficult to obtain and 2) library screening requires considerable liquid handling.  Because the 159  screen uses purified proteinase, this limits the screen to those proteinases that can be cloned, expressed and purified.  To avoid purifying the proteinase, cell lysate from cultures expressing the proteinase could be used instead as long as the proteinase was present in sufficient amounts in the cell lysate and no confounding activities were present.  Large libraries also require considerable handling as cultures must be grown in deep-well 96-well plates, lysed and the lysate cleared before being transferred to plates suitable for analysis using the plate reader.  While the additional step of clearing the lysate could be eliminated, samples still need to be transferred from the deep-well plate. It may be possible to eliminate this liquid handling step, for example, instead of growing cultures in a deep-well 96-well plate and transferring an aliquot of the cell lysate to a black plate for analysis in the plate reader, cells could be grown in the black plate, lysed, and the entire sample analyzed directly.  However, sufficient substrate production would be necessary as cleaved and uncleaved substrates were difficult to distinguish at low concentrations (i.e., low F527; Figure 23). A high-throughput screen where proteinase is co-expressed with substrate would be flexible and allow screening of very large libraries.  Specifically, this method obviates the need to purify either substrate or proteinase.  For reasons that are not apparent, attempts to monitor cleavage using fluorescence were not successful when cells were grown in a 96-well plate.  Notably, cleavage by co-expressed proteinase could be followed by fluorescence in plates when the cultures being assayed were grown in flasks (Figure 21).  Attempts to improve growth in deep-well plates by using a high O2 environment yielded brighter cells and more biomass, on par with flask-grown cultures. Nevertheless, no significant difference in fluorescence was associated with cleavage 160  although this cleavage was confirmed using native-PAGE analysis (Figure 25).  It is possible that the inability to detect in vivo cleavage by fluorescence in plate-grown cells is due to other differences in how the cells were grown.  For examples, plate-grown cultures were grown in the presence of arabinose inducer from a single colony whereas cultures in the flask were first grown to mid-log phase before inducer was added. Another complication with the developed screening method was that prolonged expression (i.e., overnight) of fluorescent proteins resulted in their accumulation with a concomitant inner filter effect.  That the observed drop in F477/F527 was due to intramolecular FRET was confirmed by transiently expressing the fluorescent proteins for 2 or 4 hours by adding glucose to repress further expression of the fluorescent proteins [136].  Under such conditions, the F477/F527 values did not change following further incubation overnight (Figure 22), suggesting that the observed drop in ratio was due to intermolecular FRET resulting from the accumulation of fluorescent proteins. 4.2.1 HAV 3Cpro specificity The preference of HAV 3Cpro for particular residues at P4 and P1’ positions, respectively, of the cleavage sequence as determined using the fluorescent plate screen is consistent with previous studies using peptides.  In the current study, the best cleaved substrates had Ile, Leu or Val at the P4 position and Gly, Ser or Ala at the P1’ position. Poorly cleaved substrates had either charged (Arg or Lys) or small (Gly) residues in the P4 position.  In a peptide specificity study, Jewell et al. [40] synthesized 11 peptides based on the 2B/2C cleavage sequence with different natural and artificial amino acids in the P4 position.  Substrates with Leu, Trp, Val, Ile and D-Leu were well cleaved while norvaline, norleucine, Thr and Ala were poorly cleaved.  Moreover, no cleavage was 161  observed for substrates with either His or Glu in the P4 position [40], as observed in the current screen.  In another study, Petithory et al [135] screened a peptide mixture that also was based on the 2B/2C sequence.  As shown in Figure 40, the relative kcat/Km values demonstrate a clear preference for Ser, Gly and Ala in the P1' position, supporting the relative rates reported in Table 12.  Other substrates identified by Petithory et al. [135] had a relative specificity of less than 20% that of the best substrates, suggesting a lower limit for identifying substrates with the fluorescent protein screen.  While the ranking of relative rates of substrate cleavage reported in this thesis (Table 12) are comparable to the specificity constants reported in Figure 40, it is difficult to draw conclusions due to experimental differences. 162   Figure 40. Relative specificity of HAV 3Cpro for cleavage sequences differing in the identity of their P1’ residue.  The proteinase was reacted with a mixture of peptides.  The rate of cleavage was calculated for each peptide by plotting the amount proteolyzed versus time and correcting for concentration.  Corrected velocities were normalized to that of the peptide containing serine in the P1’ position to give the relative kcat/Km for each peptide in the mixture.  Figure from Petithory et al. [135]. The results of the specificity screens are supported by structural analysis of the HAV 3Cpro subsites.  More particularly, the S4 subsite of HAV 3Cpro is lined with hydrophobic residues (Figure 41) [37], consistent with the poor cleavage of substrates with charged residues in the P4 position.  Similarly, while Gly may not be physically occluded from the S4 subsite, the lack of hydrophobic interactions between this small nonpolar amino acid and the S4 subsite would lower the enzyme’s affinity for substrates with this residue in the P4 position.  The binding pocket for the P1’ residue in HAV 3Cpro is much less well defined (Figure 41) [37, 135], although a small residue at the P1’ 163  position is preferred [135], consistent with results from the screening of the fluorescent substrate library.  Figure 41: Stereo view of the surface of the S4- and S1’-binding pockets of HAV 3Cpro showing amino acids lining the pockets and the active-site Cys172. A) S4 pocket and B) S1’ pocket. The nitrogen, oxygen and sulphur atoms are coloured blue, red and yellow, respectively.  Figures prepared using PyMOL (http://www.pymol.org/, ver. 1.1). 4.3 Additional insights into 3C proteinase functioning An unexpected result in screening the fusion protein libraries was the observation of a likely proteinase:cleavage product complex in native gel analyses of some reaction mixtures.  More particularly, a band comparable in size to the fused substrate was observed in some samples.  This band contained CFP, but not YFP, was only observed in 164  HAV 3Cpro-containing samples, and was most apparent with poorly cleaved substrates (Figure 14, lanes 5 and 9; Figure 15, Figure 16).  Moreover, this band was dependent on the presence of a cleavage sequence as the band was not observed in samples containing 3Cpro and either CFP or YFP (Figure 14, lane 3).  Overall, the observed band appears to consist of 3Cpro and the CFP cleavage product.  Indeed, HAV 3Cpro (24.2 kDa) is similar in size to the fluorescent proteins (28.2 kDa).  Thus, a 3Cpro:cleavage product complex would likely migrate in the gel similar to the CFYP-1 substrate.  Nevertheless, it is less clear whether the 3Cpro:cleavage product complex was covalent.  The band was not observed in denaturing gels.  By contrast, the acyl-enzyme intermediate of the mammalian serine proteinase tissue-type plasminogen activator (t-PA) with neuroserpin, an inhibitor of t-PA, has been observed using denaturing gels [137].  These considerations suggest that the 3Cpro:cleavage product complex is non-covalent, and is perhaps mediated by interactions between the S1-S4 subsites of the former and the P4-P1 residues of the latter.  Observation of a 3Cpro:CFP-cleavage product would suggest that the proteinase has a high affinity for its P-side product.  Observation of a complex with the CFP-cleavage product but not the YFP-cleavage product is consistent with differences in the affinity of the subsites of the proteinase (S-side versus the S'-side subsites).  That is, there are fewer S' subsites than S subsites in HAV 3Cpro and they not as defined as the S subsites [37]. Regardless of whether the complex is covalent or non-covalent, it may represent an intermediate whose breakdown is rate-limiting, further suggesting that substrate turnover is very slow.  Slow rates of cleavage of the fluorescent protein-based substrates were also observed in continuous fluorescence assays performed using purified substrates 165  and proteinase.  In these assays, ~20 minutes were necessary before 1 µM of enzyme had cleaved 1 µM CyY-1 substrate (data not shown).  Importantly, loss of the FRET signal coincides with separation of the two GFP variants within the substrate and provides no information concerning a long-lived complex between the proteinases and one of the cleavage products. Investigating the nature of the 3Cpro:cleavage product interaction may provide insight into the mechanism of this class of proteinases.  For example, a form of CFP could be generated that better replicates the cleavage product with additional linker amino acid residues on the C-terminus.  By titrating the CFP-cleavage product with HAV 3Cpro and separating the resulting samples using native-PAGE, HAV 3Cpro-dependent shifts in gel migration should become apparent if there is a protein:protein interaction. Indeed, this has been used as a method to measure Kd [112].  Furthermore, mass spectrometry studies could be used to investigate the nature of the observed CFP- cleavage product, and could be performed using conditions similar to those used to identify the covalent modification of HAV 3Cpro by inhibitors (Figure 39).  Nevertheless, these results suggest that future inhibitors of the proteinase should continue to target the S-subsites given the affinity of the proteinase for the P-side product. 4.4 The IAPV 3Cpro The IAPV 3Cpro could not be more fully characterized due to its low solubility when produced in E. coli.  While the proteinase was produced to high levels in a host strain containing tRNA genes for rare codons, the majority of the protein was insoluble, even when tagged with GST (Figure 32), a procedure that can improve the solubility of recombinant proteins [138].  It is unclear whether incorrect N- and C-termini of the 166  proteinase exacerbate the insolubility of the heterologously produced 3Cpro.  While some 3Cpro’s are highly soluble [139], several have been modified though mutagenesis to increase their solubility.  In the case of HAV 3Cpro, a surface Cys residue was substituted to prevent dimerization [33].  In the case of FMDV 3Cpro, a biological screen was used to identify variants possessing increased solubility [140].  Before using such an approach to optimize the solubility of IAPV 3Cpro, the correct N- and C-termini should be experimentally determined. Several points suggest the cleavage sequence identified through analysis of the heterologously produced Rep887-1900, PIVIE/AQT, probably corresponds to the 3A/3B cleavage site of the IAPV replicase.  First, based on sequence alignments of 3Cpros, if the identified cleavage sequence was 3B/3C, instead of 3A/3B, the size of 3Cpro would be increased by ~70 residues making it unusually large for this family of enzymes. Secondly, the corresponding 3A/3B sequence in some picornaviruses, including HAV, also contains a Glu at the P1 position although all other sequences processed by this proteinase have a Gln in the P1 position [141].  Thus, cleavage following a Glu at 3A/3B would not be unprecedented. Although the N- and C- termini of the six structural proteins of IAPV have been sequenced [21], it is unclear which of these proteins are processed by the 3Cpro.  In other picornaviruses, some or all of the structural proteins are processed by the 3Cpro, with cleavage occurring at a Gln residue [22, 141, 142].  However, most of the inferred cleavage sequences of IAPV (Table 17) are atypical of 3Cpro’s: only one has a Gln in the P1 position.  Furthermore, alignments of the structural proteins of IAPV with other dicistroviruses did not show conservation of these unusually processed sequences.  The 167  results in Table 17 suggest that either IAPV 3Cpro has an unusually broad specificity compared to other members of the picornavirus family or that at least four of the five sequences are not processed by IAPV 3Cpro.  Importantly, no other proteinase has been identified in a dicistrovirus by sequence analysis.  Nevertheless, processing could proceed by alternate mechanisms involving a host proteinase or autocatalytic sequences, as reported in cardio- and apthoviruses [143, 144]. Table 17: Cleavage sequences of the IAPV structural proteins (from [21]). Cleavage sequences VDTAR / SVLQT PKTKT / SQKST AIFGW / SKPRN KAYDM / SVPLA NVELQ / INIGK  Overall, it is likely that IAPV 3Cpro has the same preference for Gln in the P1 position as in all characterized 3Cpro's despite the lone cleavage sequence identified herein which indicates cleavage after a Glu residue.  Based on alignments of IAPV 3Cpro with other characterized 3Cpro's, the His located in the bottom of the S1 subsite in 3Cpro's that determines the specificity of the enzyme for Gln in position P1 of the substrate is conserved as His204 in IAPV 3Cpro (Figure 31).  This conservation supports the hypothesis that IAPV 3Cpro is specific for Gln in the P1 position.  More importantly, partially purified GST-tagged IAPV 3Cpro efficiently cleaved the SARS-P2 substrate (Abz-SVTLQ/SGY(NO2)R), which has a Gln in the P1 position.  The specific activity of the best preparation of GST-tagged IAPV 3Cpro for SARS-P2 was 1300 µM min-1 mg-1. Given that GST-3Cpro was estimated to be ~30 % of the total protein from the 168  purification, this rate is 1000-fold higher than the kcat (1 min-1 [60]) of SARS 3CLpro for this same substrate and is similar in magnitude to well-cleaved peptides of picornaviruses HAV 3Cpro (1.8 s-1 [33]) and HRV 3Cpro (1.01 s-1 [145]).  Overall, these results indicate that the sequences with Gln in the P1 position are good substrates for IAPV 3Cpro. It is apparent that while the 3Cpro and replicase of IAPV show significant sequence conservation with other picornaviruses, there are some striking differences in the processing of the structural proteins.  Further characterization of the 3Cpro, including determination of the N- and C-termini of the IAPV 3Cpro can give insight into proteinase specificity, and would thus be useful before attempts are made to solubilize the enzyme. Purified proteinase would also enable the characterization of specificity using the screen described in this thesis. 4.5 Inhibitors of HAV 3Cpro and SARS 3CLpro A variety of 3Cpro inhibitors were developed in collaboration with several research groups using both screening and design approaches. These inhibitors worked through a variety of mechanisms.  Thus, halopyridinyl esters developed through screening a small compound library and subsequent refinement, covalently modified the active site Cys of both SARS 3CLpro and HAV 3Cpro.  Two peptide analogues, a ketoglutamine and an aza-peptide (APE) were based on previously developed proteinase inhibitors.  The former inhibited SARS 3CLpro in a reversible fashion while the latter covalently modified HAV 3Cpro. Screening of the 50,000-compound Maybridge library against SARS 3CLpro identified five compounds that showed promise as potent proteinase inhibitors.  The inhibitory properties of these five compounds were tested against each of five different 169  proteinases (Table 14) possessing varying structural and mechanistic relatedness to SARS 3CLpro.  Inhibitors MAC-8120 and MAC-13985 appear to be the most specific inhibitors of SARS 3CLpro as they did not detectably inhibit any of the other proteinases.  By contrast, MAC-22272 showed the least selectivity, inhibiting all proteinases to some extent.  Interestingly, MAC-30371 and MAC-5576 inhibited those enzymes with the chymotrypsin fold regardless if the active site contained a Cys or Ser, though inhibition of SARS 3CLpro and HAV 3Cpro, which both have an active site Cys, was stronger.  The lower IC50 for SARS 3CLpro and HAV 3Cpro may be the result of the covalent nature of the inhibition as later experiments established that halopyridinyl esters derived from MAC-5576 covalently modified the active site Cys of both SARS 3CLpro and HAV 3Cpro. Notably, neither MAC-30371 nor MAC-5576 inhibited papain, a cysteine proteinase having a different fold.  It is likely that these inhibitors target the specificity of the enzymes rather than the fold: the P1 specificity of papain is for basic amino acids in contrast to the other proteinases of Table 14 which have P1 specificity for more polar or hydrophobic amino acids. The potency of the inhibitors isolated by screening the Maybridge library illustrates the tremendous potential of screening small molecule libraries.  First, none of the five characterized compounds had been previously identified as proteinase inhibitors thus introducing new classes of compounds to the future development of proteinase inhibitors.  Second, only 5 of the original 572 hits from the screen were further characterized indicating there remains significant potential in the library.  Third, while the compounds described herein were some of the first identified small molecule inhibitors of the SARS 3CLpro, subsequent screens have identified many others [146, 170  147].  Finally, some of the five characterized inhibitors, such as MAC-30371 and MAC- 5576, were more specific to the 3Cpro and 3CLpro, indicating their potential as lead compounds in the development of broad spectrum inhibitors to viruses possessing these proteinases. Efforts to refine MAC-5576 using a library of pyridinyl esters related compounds resulted in the identification of six pyridinyl esters that more potently inhibited HAV 3Cpro.  This library had previously been screened against SARS 3CLpro and potent inhibitors of this proteinase were also identified.  The best HAV 3Cpro inhibitors all contain an ester bond connecting a halopyridine ring to a 5-membered ring (Table 16). While initial studies suggested that these inhibitors were reversible, HPLC and mass spectrometric analysis demonstrated that the esters are slow substrates of HAV 3Cpro, with hydrolysis proceeding via an acyl-enzyme intermediate (Figure 38, Figure 39). Thus, for Table 16, the kcat values were calculated from the hydrolysis rates at saturating ester concentrations and the Km values were taken to be the equivalent of the determined Kic values, which is the case for substrates that are slowly turned over [125].  The most potent of these, ZJM-2-172, competitively inhibited the hydrolysis of a peptidyl substrate with a measured Kic (120 nM) that is among the lowest of an inhibitor of a 3Cpro enzyme reported to date. Consistent with a mechanism involving rate-limiting deacylation, the two compounds possessing the same acylating group, ZJM-2-68 and ZJM-2-172, had very similar kcat values. Interestingly, Ghosh et al. [148] also sought to characterize and improve the ester- based inhibitors identified by us [124].  Their most potent inhibitor, a 3-chloropyridinyl ester (Figure 42), inhibited SARS 3CLpro with an IC50 of 30 nM.  Importantly, Ghosh et 171  al. [148] also demonstrated SARS antiviral activity in cell culture assays by this inhibitor (EC50 = 6.9 µM).  While Ghosh et al. used mass spectrometry to demonstrate that the ester covalently modified the proteinase, they did not determine whether the acyl intermediate slowly hydrolyzed, restoring enzyme function.  Figure 42: Structure of the most potent halopyridinyl ester inhibitor of SARS 3CLpro identified by Ghosh et al. [148] Interestingly, the halopyridinyl esters characterized in this thesis are better substrates for HAV 3Cpro than the peptide substrates characterized to date.  For example, the kcat/Km value for Jian-17 was 1400 ± 500 M-1s-1 versus 800 ± 100 M-1s-1 for Ac- ELRTQSFS-NH2 [40].  This is due to the enzyme’s exceptionally low Km values for the halopyridinyl esters (e.g., 120 ± 20 nM for ZJM-2-172), that were considerably lower than for good peptide substrates (2.1 ± 0.5 mM for Ac-ELRTQSFS-NH2).  By contrast, the enzyme turns over peptide substrates much more efficiently (kcat = 1.8 ± 0.1 s-1 for Ac-ELRTQSFS-NH2 [33] versus 25 ± 8 × 10-5 s-1 for ZJM-2-172).  The presence of an ester linkage is a critical feature for effective inhibition of 3Cpro by the tested small molecules.  For example, compounds lacking the ester bond, such as Jian-92, ZJM-3-29 and ZJM-2-90, are poor inhibitors suggesting that these compounds do not interact with the proteinase particularly strongly. Comparison of the inhibition characteristics of the esters reveals that there is more flexibility in the cyclic acid moiety of the ester than in the pyridinyl alcohol.  For example, Jian-41, Jian-38, Jian-40 and Jian-10 moderately inhibited HAV 3Cpro at 172  concentrations of 1 µM despite the different sizes of the cyclic acid moiety.  While the cyclic acid moiety is subject to some constraints, as illustrated by compounds Jian-37, Jian-42 and Jian-10 these constraints are difficult to deduce from the current data set. The spacing between the ester and alcohol or acid moiety was also more critical for the alcohol than the acid.  Compound Jian-17 was a good inhibitor despite possessing two additional carbon atoms (-CH=CH-) on the acid side of the ester with respect to ZJM-2- 68.  By contrast, the insertion of a single additional carbon atom (-CH2-) on the alcohol side of the ester of the potent inhibitor ZJM-2-172 yielded Jian-98, a poor inhibitor. Finally, the presence and position of the halogen on the pyridine ring were important determinants of inhibition as was the position of the ring nitrogen with respect to the ester bond.  Thus, compounds containing 2- or 4-pyridyls (ZJM-2-69, ZJM-2-71, ZJM-2-78 and ZJM-2-87) were poor inhibitors.  Similarly, compounds lacking the halogen substituent (ZJM-2-70 vs. ZJM-1-188) or in which this substituent is ortho or para to the ester group (ZJM-2-85 and ZJM-2-84 vs. ZJM-1-188) were also poor inhibitors.  Overall, these results indicate that the halopyridine ring is a particularly important determinant of inhibition. Considering the similarities of picornaviral 3Cpro and coronaviral 3CLpro, it is not surprising that the library of pyridinyl esters yielded similar potent inhibitors of the HAV and SARS proteinases [61].  In particular, both enzymes are catalytically driven by a Cys-His pair and have a high specificity for Gln as the P1 residue.  This specificity reflects their similar S1 pockets, especially the histidine at its base (His163 and His191 of SARS 3CLpro and HAV 3Cpro, respectively) which is an important determinant of P1 specificity in both enzymes [38, 53].  Consistent with these similarities, the predicted 173  binding mode of halopyridinyl esters to SARS 3CLpro [61] is very similar to that predicted for HAV 3Cpro, with the halopyridinyl moiety occupying the S1 pocket and the ring of the acid moiety extending into the S2 pocket. The model of ZJM-2-172 docked to HAV 3Cpro is consistent with the structure– activity relationship of the inhibitors.  In particular, the model indicates that the halopyridinyl ring of ZJM-2-172 essentially fills the S1 pocket of the enzyme with the pyridine nitrogen atom forming a hydrogen bond to Nε2 of His191 in this pocket (Figure 43) in contrast to the considerable space in the enzyme’s active site around the furan ring. The modeled HAV 3Cpro- ZJM-2-172 complex is also consistent with the hydrolysis of these ester compounds via an acyl-enzyme intermediate in two aspects. First, the distance between the Sγ of Cys172 and the carbonyl carbon in is 3.4 Å.  Second, these two atoms are almost coplanar with the imidazole ring of His44.  Therefore, His44 is in an ideal position to have its Nε2 acting as a general base.  During normal enzymatic hydrolysis of peptidyl substrates, the scissile peptide bond is expected to be in line with the spatial orientation between the Cys and His catalytic pair in the active site.  However, the modeled HAV 3Cpro- ZJM-2-172 complex shows a rather different direction for the central scissile ester bond of compound ZJM-2-172, primarily due to the predicted strong propensity of the bromopyridinyl ring to bind inside the S1 pocket.  Interestingly, a similar binding mode was predicted for the complexes between SARS 3CLpro and a group of pyridinyl ester-based inhibitors [149].  As well, the inhibitor designed by Ghosh et al. [148] (Figure 42) based on the pyridnyl esters described here was also reported to bind in a similar manner as in Figure 43. 174   Figure 43: Possible prehydrolysis-binding modes of ZJM-2-172 to (a) HAV 3Cpro and (b) SARS 3CLpro. Protein surfaces are colored according to electrostatic potentials with red and blue indicating negative and positive potentials, respectively. The carbon atoms of ZJM-2-172 and the amino acid residues are gray and purple, respectively. The nitrogen, oxygen and sulfur atoms are colored blue, red, and orange, respectively. Hydrogen bonds are displayed by dashed lines.  The model was generated using AutoDock 3.0.5.  Figure adapted from Huitema et al. [124] and Zhang et al. [61]. The ability of the halopyridinyl esters to inhibit two such divergent 3Cpros strongly suggests that these compounds could be used to inhibit the related proteinases of other coronaviruses, picornaviruses such as FMDV and HRV or dicistroviruses such as IAPV.  These inhibitors might be improved by increasing their specificity, presumably by better targeting the S2 pocket, and further slowing their enzymatic hydrolysis.  Indeed, given the correlation between turnover of the esters (kcat) and non-enzymatic stability (half-life), decreasing enzymatic hydrolysis might improve their stability in aqueous solution.  Finally, given the slightly different substrate-binding pockets of the different 3Cpros, a comparison of the inhibition of related proteinases by a series of these halopyridinyl esters might provide insight into the mode of substrate binding and how the 175  physicochemical properties of the substrate-binding pocket determine the excellent specificity of these enzymes. The aza-peptide epoxide (APE) KAE-3-91 irreversibly inhibited SARS 3CLpro, as observed for the halopyryidinyl esters. However, in the presence of the APE, no recovery of enzymatic activity was observed.  APE inhibitors have an aza-peptide component which resembles the peptide substrate an inhibitor with an azaglutamine (AGln) as the P1 residue was expected to mimic the S1 specificity of SARS 3CLpro.  Kinetic characterization of the inhibitor KAE-3-91 (Cbz-Leu-Phe-AGln-(S,S)EP-COOEt) against SARS 3CLpro supports irreversible binding as there is slow loss of enzyme activity as observed in progress curves.  The degree of curvature of progress curves show that the APE inhibits SARS 3CLpro with a kinact/Ki=1900 ± 400 M−1 s−1 (Figure 37).  This kinetic data indicates that APE inhibitors have great potential as inhibitors of SARS 3CLpro and show potential in the development of lead compounds for anti-SARS agents.  The kinact/Ki of SARS 3CLpro for KAE-3-91 is similar in magnitude to that of the first generation APEs produced to inhibit other cysteine peptidases [123, 150, 151].  Optimization of the latter has yielded inhibitors of caspases with kinact/Ki well over 106 M−1 s−1 [150], suggesting that more potent APE inhibitors of 3Cpro’s could also be developed. Structural analysis by collaborators at the University of Alberta confirmed that APE covalently bound to SARS 3CLpro thus supporting results from kinetic characterization.  Inhibitor was soaked into crystals of both wildtype SARS 3CLpro and the proteinase with an additional N-terminal Ala (3CLpro+Ala). The APE occupied substrates S1-S3 and was bound in a substrate-like manner in the substrate-binding region of the proteinase and results were similar for both wild-type 3CLpro and 3CLpro +Ala. 176  While the inhibitor tightly occupied the substrate binding subsites, the peptide portion of the inhibitor only consisted of three residues.  Thus, one improvement to make would be to extend the inhibitor to occupy more subsites of the enzyme (i.e. S4-S6) which may result in a greater kinact/Ki.  Figure 44: Binding of APE (orange) in the substrate-binding regions of SARS 3CLpro. (a) Stereo view of the outstanding density in the Fo−Fc map for the structures of the 3CLpro+Ala:APE complex, protomer B. (b) The corresponding stereo view for protomer A of the complex.  Figure adapted from Lee et al [53]. A peptide-based inhibitor with a keto-glutamine analogue HIP2-171-2 was characterized as a reversible inhibitor of SARS 3CLpro and had a Kic = 170 ± 30 nM (Figure 36: B).  Previously, this class of peptide-based inhibitors has been identified as effective reversible inhibitors of 3Cpro’s from human rhinovirus (HRV) and HAV [35, 152] with the best having a Ki of 9 µM [57], suggesting that HIP2-171-2 is potent for its 177  class.  Other competitive inhibitors of SARS 3CLpro have been characterized including a phenylmercuric nitrate with Ki 170 nM and a boronic acid inhibitor with Ki of 40 nM. Thus, the keto-glutamine analogue is among the better competitive inhibitors of SARS 3CLpro identified to date. We have described several reversible and irreversible inhibitors against HAV 3Cpro and SARS 3CLpro.  The developed reversible and covalent inhibitors are among the most potent identified to date for these proteinases.  One concern of irreversible inhibitors is that they may also interact with important cellular proteins thus making a toxic drug. However, many of the most widely used drugs, such as penicillins, are irreversible inhibitors.  Indeed, one of the few picornavirus drugs that has reached clinical trials is an irreversible Michael acceptor that targets the HRV 3Cpro [153].  A potential target for inhibitors with moderate side-effects would be honeybees that are currently in crisis. There are many dicistroviruses that infect honeybees and given the sequence homology of the 3Cpro’s, inhibitors developed against picornaviral and coronaviral proteinases are likely to inhibit dicistroviral proteinases. 4.6 Concluding remarks The work presented in this thesis describes the screening, characterization and inhibition of viral cysteine 3C and 3CL proteinases.  Although the biological selection based on XylR failed to link cleavage of the transcriptional regulator to strain survival, I demonstrated the utility of the selection strain E. coli PuCm and screening strain E. coli PuLacZ and that failure of the selection system was due to the degradation of the cleavable transcriptional regulator MXR1.  Furthermore, I showed inconsistencies with previously published work on MS2-domain inhibited truncated XylR when expressed 178  from pFH2: MXR1 was constitutively active except when expressed from pFH2, suggesting a plasmid-specific effect.  While I was unsuccessful in developing a biological selection, further efforts targeted towards the positioning of the cleavable linker in XylR may yet yield results. A high-throughput screen utilizing a new strategy for analyzing the specificity of proteinases was developed using fluorescent proteins.  Features of this screen include progress curve monitoring and the ability to purify the substrates for further kinetic characterization.  Furthermore, in contrast to other specificity screens developed, the described method can be modified to screen libraries of proteinases further extending its utility.  To evaluate the screen, the specificity of HAV 3Cpro was determined for both the P4 and P1’ substrate positions.  The specificity profile of HAV 3Cpro determined for these two positions was well supported by both previous studies of specificity and our understanding of the structure of the HAV 3Cpro substrate pocket. The description of the IAPV 3Cpro reported herein is the first experimental characterization of a dicistroviral proteinase.  A portion of the replicase was expressed in E. coli and we identified a cleavage site processed by the 3Cpro that most probably corresponds to the 3A/3B cleavage site of the IAPV replicase.  While cleavage of 3A/3B occurred after a Glu residue, other data indicate that IAPV 3Cpro has greater specificity for substrates with Gln in the P1 position.  These data include the conservation a His at the base of the S1 pocket that helps determine the specificity of other 3Cpros for Gln at the P1 position.  More importantly, partially purified GST-tagged IAPV 3Cpro efficiently cleaved the SARS-P2 substrate (Abz-SVTLQ/SGY(NO2)R).  Further characterization of IAPV 3Cpro is necessary to experimentally determine the N- and C-termini of 3Cpro with 179  the ultimate goal of characterizing the specificity of the proteinase using the fluorescent protein screen. Finally, inhibitors against HAV 3Cpro and SARS 3CLpro were developed and characterized with collaborators from the University of Alberta, McMaster University and the Georgia Institute of Technology.  These inhibitors worked through a variety of mechanisms and are among the most potent that have been developed against these proteinases.  Given that almost all of these compounds have been shown to inhibit several viral cysteine proteinases, the compounds show clear promise for future development targeting the IAPV 3Cpro and thus could be the basis of potential drugs in the arsenal against colony collapse disorder. 180  References 1. Chen, J.J., F. Lin, and Z.H. Qin, The roles of the proteasome pathway in signal transduction and neurodegenerative diseases. Neurosci Bull, 2008. 24(3): p. 183- 94. 2. Ding, W.X. and X.M. Yin, Sorting, recognition and activation of the misfolded protein degradation pathways through macroautophagy and the proteasome. Autophagy, 2008. 4(2): p. 141-50. 3. Dasmahapatra, B., B. DiDomenico, S. Dwyer, J. Ma, I. Sadowski, and J. Schwartz, A genetic system for studying the activity of a proteolytic enzyme. Proc Natl Acad Sci U S A, 1992. 89(9): p. 4159-62. 4. Wolfe, M.S. and D.J. Selkoe, Intramembrane proteases - mixing oil and water. Science, 2002. 296: p. 2156-2157. 5. Lopez-Otin, C. and C.M. Overall, Protease degradomics: a new challenge for proteomics. Nat Rev Mol Cell Biol, 2002. 3(7): p. 509-19. 6. Barrett, A., N. Rawlings, and J. Woessner, Handbook of Proteolytic Enzymes. 1998: Academic Press. 7. Lu, Q., J.M. Clemetson, and K.J. Clemetson, Snake venoms and hemostasis. J Thromb Haemost, 2005. 3(8): p. 1791-9. 8. Forsberg, G., B. Baastrup, H. Rondahl, E. Holmgren, G. Pohl, M. Hartmanis, and M. Lake, An evaluation of different enzymatic cleavage methods for recombinant fusion proteins, applied on des(1-3) insulin-like growth factor I. Journal of Protein Chemistry, 1992. 11(2): p. 201-211. 9. Stevens, R.C., Design of high-throughput methods of protein production for structural biology. Structure, 2000. 8(9): p. R177-R185. 10. Fujinaga, M., M.M. Cherney, H. Oyama, K. Oda, and M.N. James, The molecular structure and catalytic mechanism of a novel carboxyl peptidase from Scytalidium lignicolum. Proc Natl Acad Sci U S A, 2004. 101(10): p. 3364-9. 11. Rawlings Nd Fau - Morton, F.R., C.Y. Morton Fr Fau - Kok, J. Kok Cy Fau - Kong, A.J. Kong J Fau - Barrett, and A.J. Barrett, MEROPS: the peptidase database. Nucleic Acids Res, 2008. 36(Database issue): p. D320-5. 12. Sellamuthu, S., B.H. Shin, E.S. Lee, S.H. Rho, W. Hwang, Y.J. Lee, H.E. Han, J.I. Kim, and W.J. Park, Engineering of protease variants exhibiting altered substrate specificity. Biochem Biophys Res Commun, 2008. 371(1): p. 122-6. 13. Le Gall, O., P. Christian, C.M. Fauquet, A.M. King, N.J. Knowles, N. Nakashima, G. Stanway, and A.E. Gorbalenya, Picornavirales, a proposed order of positive- sense single-stranded RNA viruses with a pseudo-T = 3 virion architecture. Arch Virol, 2008. 153(4): p. 715-27. 14. Seipelt, J., A. Guarné, E. Bergmann, M. James, W. Sommergruber, I. Fita, and T. Sern, The structure of picornaviral proteinases. Virus Research, 1999. 62: p. 159- 168. 15. Agol, V.I., Picornavirus genome: an overview, in Molecular Biology of Picornaviruses, B.L. Semler and E. Wimmer, Editors. 2002, ASM Press: Washington, DC. p. 127-148. 181  16. Li, W., N. Ross-Smith, C.G. Proud, and G.J. Belsham, Cleavage of translation initiation factor 4AI (eIF4AI) but not eIF4AII by foot-and-mouth disease virus 3C protease: identification of the eIF4AI cleavage site. FEBS Letters, 2001. 507: p. 1-5. 17. Dasgupta, A., P. Yalamanchili, M. Clark, S. Kliewer, L. Fradkin, S. Rubinstein, S. Das, Y. Shen, M.K. Weidman, R. Banerjee, U. Datta, M. Igo, P. Kundu, B. Barat, and A.J. JBerk, Effects of picornavirus proteinases on host cell transcription, in Molecular Biology of Picornaviruses, B.L. Semler and E. Wimmer, Editors. 2002, ASM Press: Washington, D.C. p. 321-335. 18. Jan, E., Divergent IRES elements in invertebrates. Virus Res, 2006. 119(1): p. 16- 28. 19. Cox-Foster, D.L., S. Conlan, E.C. Holmes, G. Palacios, J.D. Evans, N.A. Moran, P.L. Quan, T. Briese, M. Hornig, D.M. Geiser, V. Martinson, D. vanEngelsdorp, A.L. Kalkstein, A. Drysdale, J. Hui, J. Zhai, L. Cui, S.K. Hutchison, J.F. Simons, M. Egholm, J.S. Pettis, and W.I. Lipkin, A metagenomic survey of microbes in honey bee colony collapse disorder. Science, 2007. 318(5848): p. 283-7. 20. Isawa, H., S. Asano, K. Sahara, T. Iizuka, and H. Bando, Analysis of genetic information of an insect picorna-like virus, infectious flacherie virus of silkworm: evidence for evolutionary relationships among insect, mammalian and plant picorna(-like) viruses. Arch Virol, 1998. 143(1): p. 127-43. 21. Maori, E., S. Lavi, R. Mozes-Koch, Y. Gantman, Y. Peretz, O. Edelbaum, E. Tanne, and I. Sela, Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: evidence for diversity due to intra- and inter-species recombination. J Gen Virol, 2007. 88(Pt 12): p. 3428-38. 22. Van Munster, M., A.M. Dullemans, M. Verbeek, J.F. Van Den Heuvel, A. Clerivet, and F. Van Der Wilk, Sequence analysis and genomic organization of Aphid lethal paralysis virus: a new member of the family Dicistroviridae. J Gen Virol, 2002. 83(Pt 12): p. 3131-8. 23. Blanchard, P., F. Schurr, O. Celle, N. Cougoule, P. Drajnudel, R. Thiery, J.P. Faucon, and M. Ribiere, First detection of Israeli acute paralysis virus (IAPV) in France, a dicistrovirus affecting honeybees (Apis mellifera). J Invertebr Pathol, 2008. 24. Stadler, K., V. Masignani, M. Eickmann, S. Becker, S. Abrignani, H.D. Klenk, and R. Rappuoli, SARS--beginning to understand a new virus. Nat Rev Microbiol, 2003. 1(3): p. 209-18. 25. Kim, S.H., I.J. Kim, H.M. Pyo, D.S. Tark, J.Y. Song, and B.H. Hyun, Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J Virol Methods, 2007. 146(1-2): p. 172-7. 26. Ziebuhr, J., G. Heusipp, and S.G. Siddell, Biosynthesis, purification, and characterization of the human coronavirus 229E 3C-like proteinase. J Virol, 1997. 71(5): p. 3992-7. 27. Ksiazek, T.G., D. Erdman, C.S. Goldsmith, S.R. Zaki, T. Peret, S. Emery, S. Tong, C. Urbani, J.A. Comer, W. Lim, P.E. Rollin, S.F. Dowell, A.E. Ling, C.D. Humphrey, W.J. Shieh, J. Guarner, C.D. Paddock, P. Rota, B. Fields, J. DeRisi, 182  J.Y. Yang, N. Cox, J.M. Hughes, J.W. LeDuc, W.J. Bellini, and L.J. Anderson, A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med, 2003. 348(20): p. 1953-66. 28. Thiel, V., K.A. Ivanov, A. Putics, T. Hertzig, B. Schelle, S. Bayer, B. Weissbrich, E.J. Snijder, H. Rabenau, H.W. Doerr, A.E. Gorbalenya, and J. Ziebuhr, Mechanisms and enzymes involved in SARS coronavirus genome expression. J Gen Virol, 2003. 84(Pt 9): p. 2305-15. 29. Snijder, E.J., P.J. Bredenbeek, J.C. Dobbe, V. Thiel, J. Ziebuhr, L.L. Poon, Y. Guan, M. Rozanov, W.J. Spaan, and A.E. Gorbalenya, Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J Mol Biol, 2003. 331(5): p. 991-1004. 30. Gorbalenya, A.E., A.P. Donchnko, V.M. Blinov, and E.V. Koonin, Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases. FEBS Letters, 1989. 243(2): p. 103-114. 31. Koonin, E.V. and V.V. Dolja, Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Crit Rev Biochem Mol Biol, 1993. 28(5): p. 375-430. 32. Bazan, J.F. and R.J. Fletterick, Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Science, 1988. 85: p. 7872-7876. 33. Malcolm, B.A., S.M. Chin, D.A. Jewell, J.R. Stratton-Thomas, K.B. Thudium, R. Ralston, and S. Rosenberg, Expression and characterization of recombinant hepatitis A virus 3C proteinase. Biochemistry, 1992. 31(13): p. 3358-63. 34. Gosert, R., G. Dollenmaier, and M. Weitz, Identification of active-site residues in protease 3C of Hepatitis A Virus by site-directed mutagenesis. Journal of Virology, 1997. 71(4): p. 3062-3068. 35. Allaire, M., M.M. Chernaia, B.A. Malcolm, and M.N. James, Picornaviral 3C cysteine proteinases have a fold similar to chymotrypsin-like serine proteinases. Nature, 1994. 369(6475): p. 72-6. 36. Arad, D., R. Kreisberg, and M. Shokhen, Structural and mechanistic aspects of 3C proteases from the picornavirus family. Journal of chemical information and computer sciences, 1993. 33: p. 345-349. 37. Bergmann, E.M., S.C. Mosimann, M.M. Chernaia, B.A. Malcolm, and M.N. James, The refined crystal structure of the 3C gene product from hepatitis A virus: specific proteinase activity and RNA recognition. J Virol, 1997. 71(3): p. 2436-48. 38. Yin, J., E.M. Bergmann, M.M. Cherney, M.S. Lall, R.P. Jain, J.C. Vederas, and M.N. James, Dual modes of modification of hepatitis A virus 3C protease by a serine-derived beta-lactone: selective crystallization and formation of a functional catalytic triad in the active site. J Mol Biol, 2005. 354(4): p. 854-71. 39. Bergmann, E.M., M.M. Cherney, J. McKendrick, S. Frormann, C. Luo, B.A. Malcolm, J.C. Vederas, and M.N. James, Crystal structure of an inhibitor complex of the 3C proteinase from hepatitis A virus (HAV) and implications for the polyprotein processing in HAV. Virology, 1999. 265(1): p. 153-63. 183  40. Jewell, D.A., W. Swietnicki, B.M. Dunn, and B.A. Malcolm, Hepatitis A virus 3C proteinase substrate specificity. Biochemistry, 1992. 31(34): p. 7862-9. 41. Berger, A. and L. Schechter, Mapping the active site of papain with the aid of peptide substrates and inhibitors. Philosophical transactions of the Royal Society of London. Series B: Biological sciences, 1970. 257(813): p. 249-264. 42. Storer, A.C. and R. Ménard, Catalytic mechanism in papain family of cysteine peptidases. Methods in Enzymology, 1994. 244: p. 486-500. 43. Sarkany, Z., Z. Szeltner, and L. Polgar, Thiolate-imidazolium ion pair is not an obligatory catalytic entity of cysteine peptidases: the active site of picornain 3C. Biochemistry, 2001. 40(35): p. 10601-6. 44. Sarkany, Z. and L. Polgar, The unusual catalytic triad of poliovirus protease 3C. Biochemistry, 2003. 42(2): p. 516-22. 45. Yang, H., M. Yang, Y. Ding, Y. Liu, Z. Lou, Z. Zhou, L. Sun, L. Mo, S. Ye, H. Pang, G.F. Gao, K. Anand, M. Bartlam, R. Hilgenfeld, and Z. Rao, The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. PNAS, 2003. 100(23): p. 13190-13195. 46. Anand, K., G.J. Palm, J.R. Mesters, S.G. Siddell, J. Ziebuhr, and R. Hilgenfeld, Structure of coronavirus main proteinase reveals combination of a chymotrypsin fold with an extra alpha-helical domain. Embo J, 2002. 21(13): p. 3213-24. 47. Xue, X., H. Yu, H. Yang, F. Xue, Z. Wu, W. Shen, J. Li, Z. Zhou, Y. Ding, Q. Zhao, X.C. Zhang, M. Liao, M. Bartlam, and Z. Rao, Structures of two coronavirus main proteases: implications for substrate binding and antiviral drug design. J Virol, 2008. 82(5): p. 2515-27. 48. Anand, K., J. Ziebuhr, P. Wadhwani, J.R. Mesters, and R. Hilgenfeld, Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs. Science, 2003. 300(5626): p. 1763-7. 49. Chou, C.Y., H.C. Chang, W.C. Hsu, T.Z. Lin, C.H. Lin, and G.G. Chang, Quaternary structure of the severe acute respiratory syndrome (SARS) coronavirus main protease. Biochemistry, 2004. 43(47): p. 14958-70. 50. Shi, J., Z. Wei, and J. Song, Dissection study on the severe acute respiratory syndrome 3C-like protease reveals the critical role of the extra domain in dimerization of the enzyme: defining the extra domain as a new target for design of highly specific protease inhibitors. J Biol Chem, 2004. 279(23): p. 24765-73. 51. Zhong, N., S. Zhang, P. Zou, J. Chen, X. Kang, Z. Li, C. Liang, C. Jin, and B. Xia, Without its N-finger, the main protease of severe acute respiratory syndrome coronavirus can form a novel dimer through its C-terminal domain. J Virol, 2008. 82(9): p. 4227-34. 52. Solowiej, J., J.A. Thomson, K. Ryan, C. Luo, M. He, J. Lou, and B.W. Murray, Steady-state and pre-steady-state kinetic evaluation of severe acute respiratory syndrome coronavirus (SARS-CoV) 3CLpro cysteine protease: development of an ion-pair model for catalysis. Biochemistry, 2008. 47(8): p. 2617-30. 53. Lee, T.W., M.M. Cherney, C. Huitema, J. Liu, K.E. James, J.C. Powers, L.D. Eltis, and M.N. James, Crystal structures of the main peptidase from the SARS coronavirus inhibited by a substrate-like aza-peptide epoxide. J Mol Biol, 2005. 353(5): p. 1137-51. 184  54. Malcolm, B.A., C. Lowe, S. Shechosky, R.T. McKay, C.C. Yang, V.J. Shah, R.J. Simon, J.C. Vederas, and D.V. Santi, Peptide aldehyde inhibitors of hepatitis A virus 3C proteinase. Biochemistry, 1995. 34(25): p. 8172-9. 55. Morris, T.S., S. Frormann, S. Shechosky, C. Lowe, M.S. Lall, V. Gauss-Muller, R.H. Purcell, S.U. Emerson, J.C. Vederas, and B.A. Malcolm, In vitro and ex vivo inhibition of hepatitis A virus 3C proteinase by a peptidyl monofluoromethyl ketone. Bioorg Med Chem, 1997. 5(5): p. 797-807. 56. Yin, J., M.M. Cherney, E.M. Bergmann, J. Zhang, C. Huitema, H. Pettersson, L.D. Eltis, J.C. Vederas, and M.N. James, An episulfide cation (thiiranium ring) trapped in the active site of HAV 3C proteinase inactivated by peptide-based ketone inhibitors. J Mol Biol, 2006. 361(4): p. 673-86. 57. Lall, M.S., R.P. Jain, and J.C. Vederas, Inhibitors of 3C cysteine proteinases from Picornaviridae. Curr Top Med Chem, 2004. 4(12): p. 1239-53. 58. Jain, R.P., H.I. Pettersson, J. Zhang, K.D. Aull, P.D. Fortin, C. Huitema, L.D. Eltis, J.C. Parrish, M.N. James, D.S. Wishart, and J.C. Vederas, Synthesis and evaluation of keto-glutamine analogues as potent inhibitors of severe acute respiratory syndrome 3CLpro. J Med Chem, 2004. 47(25): p. 6113-6. 59. Lall, M.S., Y.K. Ramtohul, M.N.G. James, and J.C. Vederas, Serine and Threonine β-Lactones: A New Class of Hepatitis A Virus 3C Cysteine Proteinase Inhibitors. J. Org. Chem., 2002. 67(5): p. 1536-1547. 60. Blanchard, J.E., N.H. Elowe, C. Huitema, P.D. Fortin, J.D. Cechetto, L.D. Eltis, and E.D. Brown, High-throughput screening identifies inhibitors of the SARS coronavirus main proteinase. Chem Biol, 2004. 11(10): p. 1445-53. 61. Zhang, J., H.I. Pettersson, C. Huitema, C. Niu, J. Yin, M.N. James, L.D. Eltis, and J.C. Vederas, Design, synthesis, and evaluation of inhibitors for severe acute respiratory syndrome 3C-like protease based on phthalhydrazide ketones or heteroaromatic esters. J Med Chem, 2007. 50(8): p. 1850-64. 62. van den Berg, S., P.A. Lofdahl, T. Hard, and H. Berglund, Improved solubility of TEV protease by directed evolution. J Biotechnol, 2006. 121(3): p. 291-8. 63. Baumann, W.K., S.A. Bizzozero, and H. Dutler, Kinetic investigation of the alpha-chymotrypsin-catalyzed hydrolysis of peptide substrates. The relationship between peptide-structure N-terminal to the cleaved bond and reactivity. Eur J Biochem, 1973. 39(2): p. 381-91. 64. Choe, Y., F. Leonetti, D.C. Greenbaum, F. Lecaille, M. Bogyo, D. Bromme, J.A. Ellman, and C.S. Craik, Substrate profiling of cysteine proteases using a combinatorial peptide library identifies functionally unique specificities. J Biol Chem, 2006. 281(18): p. 12824-32. 65. Ludeman, J.P., R.N. Pike, K.M. Bromfield, P.J. Duggan, J. Cianci, B. Le Bonniec, J.C. Whisstock, and S.P. Bottomley, Determination of the P1', P2' and P3' subsite-specificity of factor Xa. Int J Biochem Cell Biol, 2003. 35(2): p. 221- 5. 66. Portaro, F.C., A.B. Santos, M.H. Cezari, M.A. Juliano, L. Juliano, and E. Carmona, Probing the specificity of cysteine proteinases at subsites remote from the active site: analysis of P4, P3, P2' and P3' variations in extended substrates. Biochem J, 2000. 347 Pt 1: p. 123-9. 185  67. Schellenberger, V., K. Braune, H.J. Hofmann, and H.D. Jakubke, The specificity of chymotrypsin. A statistical analysis of hydrolysis data. Eur J Biochem, 1991. 199(3): p. 623-36. 68. Bornscheuer, U.T. and M. Pohl, Improved biocatalysts by directed evolution and rational protein design. Current Opinion in Chemical Biology, 2001. 5: p. 137- 143. 69. Dalby, P.A., Optimising enzyme function by directed evolution. Current Opinion in Structural Biology, 2003. 13: p. 500-505. 70. Powell, K.A., S.W. Ramer, S.B. del Cardayré, W.P.C. Stemmer, M.B. Tobin, P.F. Longchamp, and G.W. Huisman, Directed evolution and biocatalysis. Angewandte Chemie (International ed. in English), 2001. 40: p. 3948-3959. 71. Stevenson, J.D. and S.J. Benkovic, Combinatorial approaches to engineering hybrid enzymes. J. Chem. Soc., Perkin Trans. 2, 2002. 2: p. 1483-1493. 72. Soumillion, P. and J. Fastrez, Novel concepts for selection of catalytic activity. Current Opinion in Biotechnology, 2001. 12: p. 387-394. 73. Sices, H.J. and T.M. Kristie, A genetic screen for the isolation and characterization of site-specific proteases. Proceedings of the National Academy of Science, 1998. 95: p. 2828-2933. 74. Kupiec, J.J., S. Hazebrouck, T. Leste-Lasserre, and P. Sonigo, Conversion of thymidylate synthase into an HIV protease substrate. J Biol Chem, 1996. 271(31): p. 18465-70. 75. Kim, S.Y., K.W. Park, Y.J. Lee, S.H. Back, J.H. Goo, O.K. Park, S.K. Jang, and W.J. Park, In vivo determination of substrate specificity of hepatitis C virus NS3 protease: genetic assay for site-specific proteolysis. Anal. Biochem., 2000. 284: p. 42-48. 76. Seshasayee, A.S., P. Bertone, G.M. Fraser, and N.M. Luscombe, Transcriptional regulatory networks in bacteria: from input signals to output responses. Curr Opin Microbiol, 2006. 9(5): p. 511-9. 77. Ramos, J.L., S. Marqués, and K. Timmis, Transcriptional control of the Pseudomonas TOL plasmid catabolic operons is achieved through an interplay of host factors and plasmid-encoded regulators. Annu. Rev. Rev. Microbiol., 1997. 51: p. 341-372. 78. Fernández, S., V. de Lorenzo, and J. Pérez-Martín, Activation of the transcriptional regulator XylR of Pseudomonas putida by release of repression between functional domains. Molecular Microbiology, 1995. 16: p. 205-213. 79. Perez-Martin, J. and V. de Lorenzo, In vitro activities of an N-terminal truncated form of XylR, a sigma 54-dependent transcriptional activator of Pseudomonas putida. J Mol Biol, 1996. 258(4): p. 575-87. 80. Tsien, R.Y., The green fluorescent protein. Annu Rev Biochem, 1998. 67: p. 509- 44. 81. Ai, H.W., N.C. Shaner, Z. Cheng, R.Y. Tsien, and R.E. Campbell, Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry, 2007. 46(20): p. 5904-10. 186  82. Campbell, R.E., O. Tour, A.E. Palmer, P.A. Steinbach, G.S. Baird, D.A. Zacharias, and R.Y. Tsien, A monomeric red fluorescent protein. Proc Natl Acad Sci U S A, 2002. 99(12): p. 7877-82. 83. Andersen, J.B., C. Sternberg, L.K. Poulsen, S.P. Bjorn, M. Givskov, and S. Molin, New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl Environ Microbiol, 1998. 64(6): p. 2240-6. 84. Shaner, N.C., P.A. Steinbach, and R.Y. Tsien, A guide to choosing fluorescent proteins. Nat Methods, 2005. 2(12): p. 905-9. 85. He, L., X. Wu, F. Meylan, D.P. Olson, J. Simone, D. Hewgill, R. Siegel, and P.E. Lipsky, Monitoring caspase activity in living cells using fluorescent proteins and flow cytometry. Am J Pathol, 2004. 164(6): p. 1901-13. 86. Sourjik, V. and H.C. Berg, Binding of the Escherichia coli response regulator CheY to its target measured in vivo by fluorescence resonance energy transfer. Proc Natl Acad Sci U S A, 2002. 99(20): p. 12669-74. 87. Nguyen, A.W. and P.S. Daugherty, Evolutionary optimization of fluorescent proteins for intracellular FRET. Nat Biotechnol, 2005. 23(3): p. 355-60. 88. You, X., A.W. Nguyen, A. Jabaiah, M.A. Sheff, K.S. Thorn, and P.S. Daugherty, Intracellular protein interaction mapping with FRET hybrids. Proc Natl Acad Sci U S A, 2006. 103(49): p. 18458-63. 89. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T.J. Gibson, D.G. Higgins, and J.D. Thompson, Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res, 2003. 31(13): p. 3497-500. 90. Hall, T., Bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt. Nucleic Acids Symposium Series, 1999. 41: p. 95-98. 91. Felsenstein, J., PHYLIP (Phylogeny Inference Package) version 3.66. 2006, Distributed by the author. Department of Genetics, University of Washington, Seattle. 92. Page, R.D., TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci, 1996. 12(4): p. 357-8. 93. Hanahan, D., Studies on transformation of Escherichia coli with plasmids. J Mol Biol, 1983. 166(4): p. 557-80. 94. Herrero, M., V. de Lorenzo, and K.N. Timmis, Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J Bacteriol, 1990. 172(11): p. 6557-67. 95. Khlebnikov, A., K.A. Datsenko, T. Skaug, B.L. Wanner, and J.D. Keasling, Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. Microbiology, 2001. 147(Pt 12): p. 3241-7. 96. Lee, E. and C. Manoil, Mutations eliminating the protein export function of a membrane-spanning sequence. J Biol Chem, 1994. 269(46): p. 28822-8. 97. de Lorenzo, V., S. Fernandez, M. Herrero, U. Jakubzik, and K.N. Timmis, Engineering of alkyl- and haloaromatic-responsive gene expression with mini- 187  transposons containing regulated promoters of biodegradative pathways of Pseudomonas. Gene, 1993. 130(1): p. 41-6. 98. Studier, F.W. and B.A. Moffatt, Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol, 1986. 189(1): p. 113-30. 99. Bhandari, P. and J. Gowrishankar, An Escherichia coli host strain useful for efficient overproduction of cloned gene products with NaCl as the inducer. J Bacteriol, 1997. 179(13): p. 4403-6. 100. Guzman, L.M., D. Belin, M.J. Carson, and J. Beckwith, Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol, 1995. 177(14): p. 4121-30. 101. de Lorenzo, V., L. Eltis, B. Kessler, and K.N. Timmis, Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes. Gene, 1993. 123(1): p. 17-24. 102. Tabor, S. and C.C. Richardson, A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci U S A, 1985. 82(4): p. 1074-8. 103. Bingle, W.H., J.F. Nomellini, and J. Smit, Linker mutagenesis of the Caulobacter crescentus S-layer protein: toward a definition of an N-terminal anchoring region and a C-terminal secretion signal and the potential for heterologous protein secretion. J Bacteriol, 1997. 179(3): p. 601-11. 104. Yanisch-Perron, C., J. Vieira, and J. Messing, Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene, 1985. 33(1): p. 103-19. 105. West, S.E., H.P. Schweizer, C. Dall, A.K. Sample, and L.J. Runyen-Janecky, Construction of improved Escherichia-Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene, 1994. 148(1): p. 81-6. 106. Nickoloff, J.A., Electroporation protocols for microorganisms. 1995, Totowa, N.J.: Humana Press. 372. 107. de Lorenzo, V. and K.N. Timmis, Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol, 1994. 235: p. 386-405. 108. Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, Current protocols in molecular biology. 2000, New York, NY: John Wiley & Sons Inc. 109. Sambrook, J.F., D.W. Russell, and Editors., Molecular cloning: A laboratory manual, third edition. 2000: p. 2300 (approx). 110. Miller, J.H., Experiments in Molecular Genetics. 1972, Cold Spring Habor Laboratory Press: Cold Spring Harbor, NY. p. 352-355. 111. Tan, S., A modular polycistronic expression system for overexpressing protein complexes in Escherichia coli. Protein Expr Purif, 2001. 21(1): p. 224-34. 112. Park, S.H. and R.T. Raines, Fluorescence gel retardation assay to detect protein- protein interactions. Methods Mol Biol, 2004. 261: p. 155-60. 188  113. Kinter, M. and N.E. Sherman, Protein sequencing and identification using tandem mass spectrometry. Wiley-Interscience series on mass spectrometry. 2000, New York: John Wiley. xvi, 301 p. 114. Liu, Y., W. Kati, C.M. Chen, R. Tripathi, A. Molla, and W. Kohlbrenner, Use of a fluorescence plate reader for measuring kinetic parameters with inner filter effect correction. Anal Biochem, 1999. 267(2): p. 331-5. 115. Richer, M.J., L. Juliano, C. Hashimoto, and F. Jean, Serpin mechanism of hepatitis C virus nonstructural 3 (NS3) protease inhibition: induced fit as a mechanism for narrow specificity. J Biol Chem, 2004. 279(11): p. 10222-7. 116. Hamill, P. and F. Jean, Enzymatic characterization of membrane-associated hepatitis C virus NS3-4A heterocomplex serine protease activity expressed in human cells. Biochemistry, 2005. 44(17): p. 6586-96. 117. Cornish-Bowden, A., Analysis of Enzyme Kinetic Data. 1995, Oxford, New York.: Oxford University Press. 118. Ekici, O.D., M.G. Gotz, K.E. James, Z.Z. Li, B.J. Rukamp, J.L. Asgian, C.R. Caffrey, E. Hansell, J. Dvorak, J.H. McKerrow, J. Potempa, J. Travis, J. Mikolajczyk, G.S. Salvesen, and J.C. Powers, Aza-peptide Michael acceptors: a new class of inhibitors specific for caspases and other clan CD cysteine proteases. J Med Chem, 2004. 47(8): p. 1889-92. 119. Tudela, J., F. Garcia Canovas, R. Varon, F. Garcia Carmona, J. Galvez, and J.A. Lozano, Transient-phase kinetics of enzyme inactivation induced by suicide substrates. Biochim Biophys Acta, 1987. 912(3): p. 408-16. 120. Cornish-Bowden, A., Fundamentals of Enzyme Kinetics. 2004, London: Portland Press. 121. Brosius, J., Plasmid vectors for the selection of promoters. Gene, 1984. 27(2): p. 151-60. 122. Jain, R.P. and J.C. Vederas, Structural variations in keto-glutamines for improved inhibition against hepatitis A virus 3C proteinase. Bioorganic & Medicinal Chemistry Letters, 2004. 14(14): p. 3655-3658. 123. Asgian, J.L., K.E. James, Z.Z. Li, W. Carter, A.J. Barrett, J. Mikolajczyk, G.S. Salvesen, and J.C. Powers, Aza-peptide epoxides: a new class of inhibitors selective for clan CD cysteine proteases. J Med Chem, 2002. 45(23): p. 4958-60. 124. Huitema, C., J. Zhang, J. Yin, M.N. James, J.C. Vederas, and L.D. Eltis, Heteroaromatic ester inhibitors of hepatitis A virus 3C proteinase: Evaluation of mode of action. Bioorg Med Chem, 2008. 16(10): p. 5761-77. 125. Seah, S.Y., G. Labbe, S. Nerdinger, M.R. Johnson, V. Snieckus, and L.D. Eltis, Identification of a serine hydrolase as a key determinant in the microbial degradation of polychlorinated biphenyls. J Biol Chem, 2000. 275(21): p. 15701- 8. 126. Fraile, S., F. Roncal, L.A. Fernandez, and V. de Lorenzo, Monitoring intracellular levels of XylR in Pseudomonas putida with a single-chain antibody specific for aromatic-responsive enhancer-binding proteins. J Bacteriol, 2001. 183(19): p. 5571-9. 189  127. Garmendia, J. and V. de Lorenzo, The role of the interdomain B linker in the activation of the XylR protein of Pseudomonas putida. Mol Microbiol, 2000. 38(2): p. 401-10. 128. Rozkov, A. and S.O. Enfors, Analysis and control of proteolysis of recombinant proteins in Escherichia coli. Adv Biochem Eng Biotechnol, 2004. 89: p. 163-95. 129. Devos, D., J. Garmendia, V. de Lorenzo, and A. Valencia, Deciphering the action of aromatic effectors on the prokaryotic enhancer-binding protein XylR: a structural model of its N-terminal domain. Environ Microbiol, 2002. 4(1): p. 29- 41. 130. Jurado, P., L.A. Fernandez, and V. de Lorenzo, In vivo drafting of single-chain antibodies for regulatory duty on the sigma54-promoter Pu of the TOL plasmid. Mol Microbiol, 2006. 60(5): p. 1218-27. 131. Diamond, S.L., Methods for mapping protease specificity. Curr Opin Chem Biol, 2007. 11(1): p. 46-51. 132. Beck Zq Fau - Hervio, L., P.E. Hervio L Fau - Dawson, J.H. Dawson Pe Fau - Elder, E.L. Elder Jh Fau - Madison, and E.L. Madison, Identification of efficiently cleaved substrates for HIV-1 protease using a phage. Virology, 2000. 274(2): p. 391-401. 133. Boulware, K.T. and P.S. Daugherty, Protease specificity determination by using cellular libraries of peptide substrates (CLiPS). Proc Natl Acad Sci U S A, 2006. 103(20): p. 7583-8. 134. Fretwell, J.F., K.I. SM, J.M. Cummings, and T.L. Selby, Characterization of a randomized FRET library for protease specificity determination. Mol Biosyst, 2008. 4(8): p. 862-70. 135. Petithory, J.R., F.R. Masiarz, J.F. Kirsch, D.V. Santi, and B.A. Malcolm, A rapid method for determination of endoproteinase substrate specificity: specificity of the 3C proteinase from hepatitis A virus. Proc Natl Acad Sci U S A, 1991. 88(24): p. 11510-4. 136. Cronan, J.E., A family of arabinose-inducible Escherichia coli expression vectors having pBR322 copy control. Plasmid, 2006. 55(2): p. 152-7. 137. Barker-Carlson K Fau - Lawrence, D.A., B.S. Lawrence Da Fau - Schwartz, and B.S. Schwartz, Acyl-enzyme complexes between tissue-type plasminogen activator and neuroserpin. J Biol Chem, 2002. 277(49): p. 46852-7. 138. Braun, P., Y. Hu, B. Shen, A. Halleck, M. Koundinya, E. Harlow, and J. LaBaer, Proteome-scale purification of human proteins from bacteria. Proc Natl Acad Sci U S A, 2002. 99(5): p. 2654-9. 139. Baum, E.Z., G.A. Bebernitz, O. Palant, T. Mueller, and S.J. Plotch, Purification, properties, and mutagenesis of poliovirus 3C protease. Virology, 1991. 185(1): p. 140-50. 140. Birtley, J.R. and S. Curry, Crystallization of foot-and-mouth disease virus 3C protease: surface mutagenesis and a novel crystal-optimization strategy. Acta Crystallogr D Biol Crystallogr, 2005. 61(Pt 5): p. 646-50. 141. Hall, D.J. and A.C. Palmenberg, Mengo virus 3C proteinase: recombinant expression, intergenus substrate cleavage and localization in vivo. Virus Genes, 1996. 13(2): p. 99-110. 190  142. Nakashima, N. and Y. Nakamura, Cleavage sites of the "P3 region" in the nonstructural polyprotein precursor of a dicistrovirus. Arch Virol, 2008. 153(10): p. 1955-60. 143. Palmenberg, A.C., G.D. Parks, D.J. Hall, R.H. Ingraham, T.W. Seng, P.V. Pallai, M.D. Ryan, G.J. Belsham, and A.M. King, Proteolytic processing of the cardioviral P2 region: primary 2A/2B cleavage in clone-derived precursors Specificity of enzyme-substrate interactions in foot-and-mouth disease virus polyprotein processing. Virology, 1992. 190(2): p. 754-62. 144. Ryan, M.D., G.J. Belsham, and A.M. King, Specificity of enzyme-substrate interactions in foot-and-mouth disease virus polyprotein processing. Virology, 1989. 173(1): p. 35-45. 145. Wang, Q.M. and R.B. Johnson, Activation of human rhinovirus-14 3C protease. Virology, 2001. 280(1): p. 80-6. 146. Hamill, P., D. Hudson, R.Y. Kao, P. Chow, M. Raj, H. Xu, M.J. Richer, and F. Jean, Development of a red-shifted fluorescence-based assay for SARS- coronavirus 3CL protease: identification of a novel class of anti-SARS agents from the tropical marine sponge Axinella corrugata. Biol Chem, 2006. 387(8): p. 1063-74. 147. Goetz Dh Fau - Choe, Y., E. Choe Y Fau - Hansell, Y.T. Hansell E Fau - Chen, M. Chen Yt Fau - McDowell, C.B. McDowell M Fau - Jonsson, W.R. Jonsson Cb Fau - Roush, J. Roush Wr Fau - McKerrow, C.S. McKerrow J Fau - Craik, and C.S. Craik, Substrate specificity profiling and identification of a new class of inhibitor. Biochemistry, 2007. 46(30): p. 8744-52. 148. Ghosh Ak Fau - Gong, G., V. Gong G Fau - Grum-Tokars, D.C. Grum-Tokars V Fau - Mulhearn, S.C. Mulhearn Dc Fau - Baker, M. Baker Sc Fau - Coughlin, B.S. Coughlin M Fau - Prabhakar, K. Prabhakar Bs Fau - Sleeman, M.E. Sleeman K Fau - Johnson, A.D. Johnson Me Fau - Mesecar, and A.D. Mesecar, Design, synthesis and antiviral efficacy of a series of potent chloropyridyl. Bioorg Med Chem Lett, 2008. 18(20): p. 5684-8. 149. Niu, C., J. Yin, J. Zhang, J.C. Vederas, and M.N. James, Molecular docking identifies the binding of 3-chloropyridine moieties specifically to the S1 pocket of SARS-CoV M(pro). Bioorg Med Chem, 2007. 16(1): p. 293-302. 150. James, K.E., J.L. Asgian, Z.Z. Li, O.D. Ekici, J.R. Rubin, J. Mikolajczyk, G.S. Salvesen, and J.C. Powers, Design, synthesis, and evaluation of aza-peptide epoxides as selective and potent inhibitors of caspases-1, -3, -6, and -8. J Med Chem, 2004. 47(6): p. 1553-74. 151. James, K.E., M.G. Gotz, C.R. Caffrey, E. Hansell, W. Carter, A.J. Barrett, J.H. McKerrow, and J.C. Powers, Aza-peptide epoxides: potent and selective inhibitors of Schistosoma mansoni and pig kidney legumains (asparaginyl endopeptidases). Biol Chem, 2003. 384(12): p. 1613-8. 152. Tong, L., Viral proteases. Chem Rev, 2002. 102(12): p. 4609-26. 153. Patick, A.K., S.L. Binford, M.A. Brothers, R.L. Jackson, C.E. Ford, M.D. Diem, F. Maldonado, P.S. Dragovich, R. Zhou, T.J. Prins, S.A. Fuhrman, J.W. Meador, L.S. Zalman, D.A. Matthews, and S.T. Worland, In vitro antiviral activity of 191  AG7088, a potent inhibitor of human rhinovirus 3C protease. Antimicrob Agents Chemother, 1999. 43(10): p. 2444-50.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0067069/manifest

Comment

Related Items