Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Rapid evolutionary divergence in alternative splicing patterns following whole genome duplication in… Zhang, Peter G. Y. 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_zhang_peter_g_y.pdf [ 1.63MB ]
Metadata
JSON: 24-1.0067036.json
JSON-LD: 24-1.0067036-ld.json
RDF/XML (Pretty): 24-1.0067036-rdf.xml
RDF/JSON: 24-1.0067036-rdf.json
Turtle: 24-1.0067036-turtle.txt
N-Triples: 24-1.0067036-rdf-ntriples.txt
Original Record: 24-1.0067036-source.json
Full Text
24-1.0067036-fulltext.txt
Citation
24-1.0067036.ris

Full Text

RAPID EVOLUTIONARY DIVERGENCE IN ALTERNATIVE SPLICING PATTERNS FOLLOWING WHOLE GENOME DUPLICATION IN THE ARABIDOPSIS LINEAGE  by PETER G.Y. ZHANG B.Sc., The University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Botany)  THE UNWERSITY OF BRITISH COLUMBIA (Vancouver)  June 2008 © Peter G.Y. Zhang, 2008  ABSTRACT Gene and genome duplication are major processes that contribute to increasing proteome diversity in eukaroytes, and gene duplications have occurred throughout eukaryotic evolution. Alternative splicing is another process that increases proteome diversity in eukaroytes. Little is known about the conservation of alternative splicing patterns after gene or genome duplication. Here I have studied alternative splicing patterns in a set of about 2,600 gene pairs in Arabidopsis thaliana that have been retained from the most recent paleopolyploidy event that occurred around 30 million years ago. I identified duplicated genes with putative alternative splicing by comparing cDNA and genomic sequences. To evaluate alternative splicing patterns of those genes, RT-PCR was used to examine the differences among cDNAs from eight different organs for both genes of 50 gene pairs. Differences in splicing patterns were found between the genes in most pairs. These differences include presence/absence of particular splicing patterns or distinct organ specificity. Using three different abiotic stress experiments, I found that alternative splicing patterns in the paleologous pairs respond differently to stress. Furthermore, I analyzed alternative splicing in two gene families to identify when alternative splicing originated and to evaluate gain versus loss of alternative splicing after gene duplication. I found alternative splicing form partitioning between the duplicates and possible sub-functionalization between different splicing variants. My results indicate that alternative splicing is a rapidly evolving process after gene duplication that is poorly conserved between genes duplicated by whole genome duplication during the evolutionary history of Arabidopsis.  11  TABLE OF CONTENTS Abstract  ii  .  Table of Contents  iii  List of Tables  v  List of Figures  vi  Aknowledgement  vii  Chapter 1. Introduction  1  Chapter 2. Methods  5  Computational analysis  5  Gene choices and primer design  5  Plant growth and stress treatments  6  Nucleic acid extraction  6  Reverse transcription and polymerase chain reaction  6  DNA sequencing  7  Gene family analysis  8  Chapter 3. Results  9  Computational analysis of alternative splicing in paleologs  9  RT-PCR evaluation of alternative splicing of paleologs in multiple organs  9  Comparison between paleologs  10  Effect of abiotic stress on alternative splicing patterns between paleologs  11  Alternative splicing in the sulfate transporter family  13  Chapter 4. Discussion  15  Alternative splicing is poorly conserved between paleologs  15  Effects of abiotic stress on alternative splicing in paleologs  16  111  Cis-iTrans- regulation of alternative splicing  18  Alternative splicing in serine-arginine-rich proteins  19  Function and evolution of alternative splicing  21  Alternative splicing in a sulfate transporter family  23  Conclusions and future work  24  References  26  iv  List of Tables  Table 1. Computational analysis of alterative splicing between paleologs in A. thaliana Table 2. PCR target regions and primer sequences Table 3. Gene annotation, position/effect of AS and expected/observed AS status in 50 paleologs  41 41 47  Table 4. Alternative splicing in paleologs by organs and developmental stages  52  Table 5. Alternative splicing in paleologs by organs after stress treatments  57  V  List of Figures  Fig 1. Comparison of alternative splicing between paleologs  31  Fig 2. Comparison of alternative splicing events between 50 pairs of paleologs  32  Fig 3. Comparison of alternative splicing in 50 pairs of paleologs by organ  33  Fig 4. Comparison of alternative splicing between paleologs after stress treatment  34  Fig 5. Effects of abiotic stress on alternative splicing  35  Fig 6. Comparison of alternative splicing status between paleologs after stress treatments  36  Fig 7. Alternative splicing changes in paleologs after stress  37  Fig 8. Alternative splicing in the sulfate sransporter samily  38  Fig 9. Effect of the intron retention in Sultr 1;2 (ATIG78000.1)  39  Fig 10. Analysis ofArabidopsis serine/arginine-rich (SR) genes  40  vi  Acknowledgements Thanks to Dr. Keith Adams for constant invaluable supervision and support. Thanks to Anne-Laure Pin for help with experiments during the summer of 2007. Also thanks to Dr. Loren Rieseberg, Dr. Quentin Cronk, Dr. Naomi Fast, and Dr. Xin Li for helpful comments and suggestions. Thanks to Zhenlan Liu, Shao-Lun Liu and other lab members for useful discussions. Finally thanks to my mother for a delicious lunch every day.  vii  CHAPTER 1. INTRODUCTION Polyploidy has been a pervasive force in plant evolution (Otto, 2007). Whole genome doubling can provide the organism with more genes to be selected upon. Furthermore, polyploidy can induce complex epigenetic changes in the genome, such as methylation changes and gene silencing, and result in rapid phenotypic changes (Levy and Feldman, 2004; Liu and Wendel, 2003; Osborn et al., 2003). There are two forms of polyploidy: Autopolyploidy, or whole genome doubling, arises from unreduced gametes; and allopolyploidy, or merger of genomes from different species, arises from hybridization of two species followed by whole genome doubling. Upon polyploidization, every gene gets either an identical (autopolyploidy) or a similar (allopolyploid) copy that are structurally and functionally redundant, and one or both duplicates (referred to as homeologs) could experience positive or purifying selection and/or novel interaction (Dunham et al., 2002; Gerstein et a!., 2006). Thus, polyploids could undergo complex short-term and long-term molecular and physiological adjustments  —  from gene silencing, gene loss, chromosome  rearrangement (Gerstein et al., 2006) to larger cell and organ sizes, habitat expansion and speciation (Hancock and Bringhurst, 1981; Otto and Whitton, 2000). Many important agricultural plants, such as wheat, canola, and cotton, are relatively recent polyploids (Blanc et al., 2003).  Many polyploidy events occurred in the distant past, followed by chromosome rearrangements and losses, so that the organism is no longer cytologically a diploid. Such an ancient polyploidy event is referred to as paleopolyploidy. Most, if not all, flowering plants are paleopolyploicis (Cui et al., 2006). Arabidopsis thaliana, despite its small genome size, had at least two, if not three rounds of paleopolyploidy events during its evolutionary history (Blanc et a!., 2003; Bowers et al., 2003): an ancient event that is shared by all eudicots around 150 million years ago (mya) and a relatively recent event that occurred before the 1  separation of the Arabidopsis and Brassica genera around 25 mya (Blanc et al., 2003). Paleopolyploidy is a recurrent phenomenon in the plant kingdom and perhaps played an important role in plant evolution. Homeologs duplicated by paleopolyploidy have been subject to selection over scale of tens to hundreds of millions of years and usually fall into one of the three different fates: non-functionalization where one homeolog is no longer expressed or more likely, completely lost; neo-functionalization where one copy gains a novel function (Ohno, 1970), and sub-functionalization where the original expression pattern or function is partitioned between the duplicates so that both copies are needed by the organism (Force et al., 1999; Lynch and Force, 2000). Genes duplicated by paleopolyploidy and retained over evolutionary time are referred as paleologs. There are around 2,600 pairs of paleologs from the most recent paleopolyploidy event that are retained in the A. thaliana genome, which was assumed to be highly reduced and compact due to its small size; these paleologs account for more than 20% of the A. thaliana proteome and span over 80% of its chromosomes (Blanc et al., 2003).  Much like gene duplication, which can increase the proteome diversity in plants, alternative splicing (AS) is a process by which a pre-mRNA transcribed from one gene can lead to different mature mRNA molecules and therefore different proteins. Alternatively spliced mRNAs can produce protein products with different biological properties (Brandes et al., 2001; Robinson, 2001; Sesti et al., 2001). AS can therefore increase the diversity of the eukaryotic proteome without requiring additional genomic coding sequences. AS is common in humans, and an earlier estimate suggested that 40% of genes have more than one splicing form (Modrek and Lee, 2002). With greater expressed sequence tags (EST) availability and improved detection methods, more alternatively spliced genes are being discovered. It has been recently suggested that as many as 70% of human genes could be alternatively spliced (Johnson et al., 2003). Plant genomes such as the Arabidopsis thaliana genome, on the other hand, have smaller proportions of alternatively spliced genes. Only approximately 20%-30% 2  Arabidopsis genes have been found to produce multiple mRNA isoforms (Wang and Brendel, 2006). There are various AS patterns which include exon skipping where certain exons are excised from the mature mRNA, intron retention where some introns remain in the transcripts; alternative 5’ end (alternative donor) and 3’ end (alternative acceptor) where exon-intron boundary shifts as a result of two different splicing sites. In A. thaliana, intron retention is the most common AS type, taking up approximately 56% of total AS whereas exon skipping, the least common AS type, occurs in about 8% of all alternatively spliced genes (Ner-Gaon and Fluhr, 2006).  It has been known that alternative splicing and gene duplication both increase proteome diversity and that these processes can be concurrent. AS is common in plants (Wang and Brendel, 2006) where paleopolyploidy events have occurred in different lineages throughout the kingdom (Blanc and Wolfe, 2004; Cui et al., 2006). Even recently duplicated genes, such as serine/arginine rich proteins in maize, zmRSp3 1A and zmRSp3 1B, can have as many as seven splicing isoforms (Gupta et al., 2005). Computational analyses based on mammalian gene families have found that AS and gene family size are inversely correlated (Kopelman et al., 2005; Su et al., 2006); however, previous studies focused on animal genomes (Kopelman et al., 2005; Talavera et al., 2007) and the effect of whole-genome duplication on AS remains unknown.  My goal in this study was to investigate the evolution of alternative splicing in genes duplicated by the most recent paleopolyploidy in A. thaliana, referred to as paleologs. Paleologs are effective for studying the relationship between gene duplication and alternative splicing not only because A. thaliana is a model flowering plant with a sequenced genome, but also because they are believed to be duplicated at the same time, thus allowing the opportunity to examine how AS patterns have changed after a specific time among a large set of genes. Furthermore, since these paleologs are duplicated about 2 5-40 mya, there should 3  have been enough sequence divergence between duplicates to avoid cross amplification during reverse transcription polymerase chain reaction (RT-PCR). I compared the -  presence/absence of alternative splicing between the paleologs in different organs and developmental stages as well as after different stress treatments for 50 pairs of paleologs. I found that alternative splicing is generally poorly conserved between paleologs and that stress conditions have considerable effects on alternative splicing between paleologs in A. thaliana.  4  CHAPTER 2. METHODS  Computational analysis The genes duplicated by paleopolyploidy in Arabidopsis were identified by (Blanc et al., 2003). Expressed Sequence Tags (ESTs) and other eDNA sequences aligned with their corresponding genomic sequences were obtained from the Alternative Splicing in Plants database (available at http://www.plantgdb.org/ASIP/EnterDB.php) (Wang and Brendel, 2006). The alternative splicing (AS) status such as presence/absence of AS and types of AS was compared between paleologs using Perl scripts.  Gene choices and primer design Genes with AS supported by multiple ESTs were chosen to potentially avoid incompletely spliced mRNAs, ESTs that represent genomic contamination, or other artifacts. The alternatively spliced ESTs were further examined for genomic position to avoid mis alignment. In addition, the organs in which the ESTs were derived were selected to match the organ types that are used in this study (flower, silique, lateral leaf, stem, rosette leaf, root and seedlings). Primers were designed spanning putative alternatively spliced regions and usually spanned one or two introns relative to the genomic DNA sequence. Primers were designed so that they would not cross-amplif’ paleologs or other duplicates. Even though alternative splicing can occur in different regions of pre-mRNAs, only one region  —  usually  spanning one, or sometimes two, introns was assayed by RT-PCR in this study (Table 2). However, there could be different types of alternative splicing associated with one intron (for example, pairs 4, 9, and 13; Table 3). In such cases, the expected length of each splicing variant was calculated from EST alignments (NCBI).  5  Plant growth and stress treatments Arabidopsis thaliana (Columbia ecotype) seeds were cold-treated at 4°C for 72 hours after being dispersed on the soil. Pots were wrapped with plastic wrap to help retain moisture for 72 hours. Plants were grown with a photoperiod of 16 hours light / 8 hours dark at room temperature (22°C). Seedlings were collected after seven days and fourteen days. Flowers, lateral leaves, stems, rosette leaves and roots were collected from 3 week old plants. Green siliques were collected from 5 week old plants. Fresh samples were frozen using liquid nitrogen immediately after collection and kept at -80°C. Two biological replicates were collected and the majority of experiments were repeated using two biological replicates. Three stress treatments were performed with 3 week A. thaliana plants: cold stress where plants were grown in a cold room at 4°C for 72 hours (and the cold room was dark most of the time as well); heat stress where plants were grown in a growth chamber at 38°C for 6 hours; and drought stress where plants were not watered for 1 week and then air dried for 24 hours. Organ harvesting was done at the location of stress treatment and immediately frozen with liquid nitrogen.  Nucleic acid extraction Genomic DNA was extracted from seedlings or rosette leaves using the Qiagen DNeasy kit, according to the manufacturer’s instructions. RNA was extracted from tissues with two different methods  —  Trizol (Invitrogen) and hot borate (Wan and Wilkins, 1994). Trizol was  used for small scale extractions, which was used for preliminary studies as well as samples from stressed plants, whereas the hot borate method was used for large scale extractions and all extractions from siliques.  Reverse transcription and polymerase chain reaction Arabidopsis RNA (500 .tg/.tl) was treated with 1 unit of DNase I (New England Biolabs) for 30 minutes according to the manufacturer’s protocol to remove genomic DNA. Then 6  4ig of DNase-treated RNA was used for 20.tl reverse transcription reactions with M-MLV  reverse transcriptase (Invitrogen). Negative controls were made with no reverse transcriptase and with DEPC-treated water to check for contaminating genomic DNA. The RT conditions were: 25°C for 10 mm, 37°C for 60 mm and 70°C for 15 mm. Finally, residual RNA was removed with RNase (Invitrogen) by incubation at 37°C for 20 mm.  The following protocol was used for polymerase chain reaction (PCR): a 10 jil reaction consisted 4.88 j.tl of ddH2O, ijil of template (genomic DNA or cDNA), lj.tl of lox PCR 2 solution, liil of 0.2mM dNTP, and 0.5j.ti of each 0.4jiM buffer, ijil of 2.5mM MgC1 forward and reverse primers, and Taq polymerase. Thirty-five cycles RT-PCR were carried out, with the following conditions in each cycle: 96°C for 10 sec, annealing at the optimal annealing temperature for 30 sec, and 72°C for 30 sec. The annealing temperature for each primer was optimized with genomic DNA beforehand. A negative control with water instead of template was used to ensure all reagents were free of contamination. PCR products were run on 1.5% agarose gels for band separation and stained with ethidium bromide for visualization.  DNA sequencing Putative alternatively spliced bands, as well as un-expected bands, were cut out of the gel. Eighteen genes with non-specific bands or putative alternative splicing variants were sequenced. The Qiagen Gel Extraction Kit was used to extract DNA out of agarose gels. The PCR product was re-amplified with a 20 cycle PCR and subjected to Sanger sequencing on an ABI 3730 with ABI BigDye Version 3.1 (Applied Biosystems) at the Nucleic Acid Protein Service Unit at University of British Columbia. Sequences were checked with the NCBI nucleotide database using Basic Local Alignment and Search Tool (BLAST) and alternatively spliced products were confirmed by aligning to the genomic sequence with ClustalW (Thompson et al., 1994). 7  Gene family analysis For the gene family analysis, TransAlign, an amino-acid based alignment for coding DNA sequences (Bininda-Emonds, 2005), was used to align genes in the family. The aligned sequences were then used for phylogenetic analysis in PHYLIP (Felsenstein, 1993) with the maximum parsimony method. Bootstrapping of 100 replicates was performed using PHYLIP bootstrap with the neighbor-joining algorithm.  8  CHAPTER 3. RESULTS  Computational analysis of alternative splicing in paleologs  A previous study found 2,584 pairs of paleologs duplicated around 25-40 mya (Blanc et al., 2003). Through bioinformatics analysis using genomic information and gene annotation  from the TAIR 7 database (www.arabidopsis.org) and ESTs from the Alternative Splicing in Plants database (ASIP, http://www.plantgdb.org/ASIP/EnterDB.php), I found that 33% of these pairs showed alternative splicing in at least one gene pair (Table 1), with 81% of the gene pairs showing AS in one paleolog and 19% showing AS in both paleologs (Table 1). There are several drawbacks to comparing AS between paleologs using EST and cDNA data from public databases. The expression data are not comprehensive and thus many cases of AS are missed. That complicates comparisons between paleologs because it may lower the percentage of gene pairs that appear to have conserved alternative splicing patterns. Other problems include the potential presence of incompletely spliced transcripts and genomic DNA contamination in the EST sequences that could lead to erroneous inferences of AS. Those problems can be overcome by assaying AS by reverse transcription PCR (RT PCR).  RT-PCR evaluation of alternative splicing of paleologs in multiple organs  I selected a set of 50 paleologous pairs to assay AS in detail in several different organs. Intron-exon structures are mostly conserved between the paleologs (Knowles and McLysaght, 2006). The most common AS type was intron retention, which occurred in more than 40 out of 50 pairs examined. Alternative acceptor and donor (AA and AD) were less common and often co-existed with intron retention (Pair 4, 13, etc). Exon skipping (ES) was the least common and only found in 3 pairs of paleologs (Pair 1, 7, 36; Table 3). The abundance of 9  each AS type is generally consistent with previous AS studies of larger data sets [16]. AS was found in different regions of a gene including the 5’ UTR, the coding sequence and the -  3’ UTR.  I performed RT-PCR to evaluate the alternative splicing events of interest in multiple organs. Primers were designed to span the region where putative AS was detected with ASIP (Table 2). I tried to limit the region spanned by the primers to reduce the probability of detecting multiple instances of AS within a gene, which could be difficult to compare between the paleologs. Examples of RT-PCR gels showing different splicing patterns are shown in figure 1. Sometimes the same AS event was observed in some organs, but not others (Fig 1). For example, both alternative acceptor variants of SF1 are present in most organs except in flowers where only the smaller sized variant is present (Fig 1 a). In inositol polyphosphate kinase 2 alpha (IPK2a), the root only has one of the exon skipping variants whereas other organs have two (Fig. ib). Fig id shows another organ-specific AS case in a BR signal protein where flower, silique and root only has the intron-retained band, and other organs have two splicing variants. Tissue-specific AS is also found in human (Xu et al., 2002), mouse (Nurtdinov et al., 2003) and other genes from Arabidopsis (Lazar and Goodman, 2000; Palusa et al., 2007)  Comparison between paleologs  The presence or absence of the AS event in each organ type was compared between the paleologs (Table 4). Overall in 50 duplicated pairs, 41 pairs (82%) have only one paleolog showing alternative splicing; for 6 pairs (12%) both paleologs showed the same AS event, but had different organ-specificity; only in 1 pair (2%) was the AS event conserved between paleologs in all organs (Fig 2). The AS status was compared between the paleologs in each organ and developmental stage (Fig. 3). There were considerable differences in AS among 10  different organs and developmental stages. For example, 40% of the paleologs showed AS differences in flowers of mature plants while 70% exhibited differences in 14-day seedlings (Fig. 3).  My RT-PCR results did not fully agree with the bioinformatics data (Table 3 and 4): In 5 cases (pairs 2, 5, 6, 15, and 34) AS was observed where there was no such evidence in the EST database. Conversely, in 8 pairs (pairs 4, 9, 12, 13, 19, 34, 36, and 47), I did not find the alternatively spiced form despite the evidence of its presence from ASIP. This could be the result of EST database coverage, in which ESTs containing splicing variants were from organs or stress conditions that were not tested in this study. Some of the ESTs come from libraries that contain a mixture of organs from whole plants. Alternatively, genomic DNA contamination or incomplete splicing of ESTs in the database could account for differences with the RT-PCR data. In addition, some splicing variants could be so rare that they were not detected by my RT-PCR assay.  The effect of AS on the gene product depends on the position and type of AS: AS in UTR regions usually would not result in sequence differences in the protein. AS in the N’ terminal or C’ terminal, as well as AA!AD with bases in multiples of three (such as 9bp or 12 bp), could result in a shorter protein than its normal counterpart. IR in the middle of a gene would most likely result in a premature termination codon in the middle of the transcript, which could cause the mRNA to produce a non-functional protein or to be degraded by nonsense mediated decay (NMD) (Maquat and Carmichael, 2001). The effects of AS on each gene are listed in Table 3.  Effect of abiotic stress on alternative splicing patterns between paleologs  Abiotic stresses are known to affect AS (lida et a!., 2004; Kong et al., 2003). It is possible that pairs of paleologs that did not show conservation of AS patterns under normal conditions 11  could show AS conservation under abiotic stress conditions. To evaluate the effects of abiotic stresses on AS in the paleologs, I assayed AS patterns under three abiotic stresses  —  cold, heat and drought. Each of the three stresses had a large impact on AS in the paleologs. Some splicing variants that were present under normal conditions were lost after stress treatments (Fig. 4a), while in other cases a gene could produce additional splicing variants after stress treatment (Fig. 4b). Overall, over half of the 100 paleologs changed its AS status in at least one examined organ (Fig. 5)  —  17% of them gained AS in at least one organ, 20%  lost AS in at least one organ, and 17% gained and lost AS in different organs or a shifted from one splicing variant to another (such as normal splicing to the intron-retained form). Forty percent of the genes did not change AS in any organs (Fig. 5). Different organs responded to different stresses differently (Fig 6). For example, roots had a greater AS divergence between paleologs under heat stress (66%) than cold stress (42%) (Fig 6).  Not only did the paleologs show dramatic responses to abiotic stresses, but they also responded to stress differently between the duplicates. Only 6% of paleologs responded to a stress in a similar way either gain (1%) or loss (5%) of splicing variants. Other paleolog -  pairs (4%) responded to a stress in the opposite way; that is, one paleolog gained AS, and the other lost a splicing variant. For example, one gene in pair 40 (At3g02900) lost an alternative acceptor variant in siliques after cold stress; its paleolog, At5g16660, gained the intron retention variant in the same region of the gene in roots. In 17% of the cases, the paleologs that had different splicing patterns under normal conditions showed the same splicing pattern after stress treatment (Fig 4b, summarized in Fig 7). Such cases are most commonly found in genes where normally only one of the paleologs is alternative spliced. In the case of pair 13, At5g65430 lost AS after cold stress, thereby resembling its paleolog which does not show AS before or after stress. On the other hand At2g24060 (from pair 3), that was not normally alternatively spliced, gained an intron-retained AS form after cold stress whereas its paleolog has the intron-retained form under all conditions. The former case seemed to be more 12  common than the latter (Table 5). Finally, in about half (51%) of the cases, the paleologs showed AS changes in at least one organ, but with no particular patterns.  Some of the paleologs could have a similar function and respond to a particular stress in a similar pattern. The SHAGGY-like protein kinases (pair6), for example, both lost the same splicing variant after all three stresses in rosette leaves indicating the sensitive nature of these genes in response to abiotic stresses as well as conservation of the splicing sites between the two paleologs. However, paleologs could also respond to a stress independently in a given organ. For example, gene At2g24420 from pair 2 (a DNA-repair ATPase related protein) gained the intron-retained form in the stem after drought stress whereas its paleolog, lost the intron-retained form in the stem under the same stress condition, suggesting possible functional partitioning between the two intron-retained forms, that is, the intron retained form in one paleolog is present under normal conditions and the intron-retained form from the other paleolog is present under drought stress.  Alternative splicing in the sulfate transporter family I found some interesting organ-specific alternative splicing in the sulfate transporter family. Phylogenetic analysis suggests that the two paleologs, Sultr 1 ;2 (Ati g78 000) and Sultr 1;3 (At1g22150) are closely related duplicates. Both genes showed AS (Fig. 9), although AS is more prevalent in Sultr 1 ;2 than in its paleolog. I found that the intron retained form of Sulf 1 ;2 only appeared in seedlings and stems, rosettes and roots from the mature plant. It is absent, or at least undetectable, in flowers, leaves and siliques, all of which are located in the upper part of the plant. More interestingly, there seemed to be a shift of AS in this gene when the plant was subjected to dark stress. After darkness for 72 hours the AS pattern reversed: The top parts of the plant showed both splicing forms (normal and intron retained form) whereas the lower parts of the plant only showed the normal form. This alternative splicing event was also detected in its paleolog, Sultr 1 ;3, but with different organ 13  specificity and no stress responsive nature. However, this AS event was not detected in any other closely related sulfate transporter family genes (Fig 9).  The retained intron in Sultr 1 ;2 is the last intron before the normal stop codon. It has a stop codon around 20 bp from its 5’ end which suggests that the intron-retained form would cause a loss of 39 amino acids at the C’ terminus in Sultr 1 ;2. This structural change, along with a possible functional change, could be the cause of the organ-specific AS and reverse response to stresses.  14  CHAPTER 4. DISCUSSION  Alternative splicing is poorly conserved between paleologs I found that alternative splicing (AS) is poorly conserved between the 50 paleologs evaluated, the majority (82%) of which only showed AS in one of the duplicated pairs. In 6 pairs (12%) AS was found in both paleologs, but in different organs and/or developmental stages. Only in one pair of paleologs from nucleotidyltransferase family, At2g25 850 and At4g32850 (Pair 19), was the same intron retention event found in both paleologs and in all organs and developmental stages (Table 4). At4g32850 is known to be a nuclear poly(A) polymerase that adds poly(A) tails to mRNA transcripts which helps the translation of these transcripts in the cytoplasm (Hunt et al., 2000). Protein families involved in mRNA splicing and processing are often alternatively spliced in plants (Lazar and Goodman, 2000; Palusa et al., 2007). However, the AS between the nucleotidyltransferase genes is only conserved under normal conditions. The genes respond to stress in different ways: At2g25850 had both of its intron-retained forms after all three abiotic stresses; At4g32850, in contrast, lost its intron-retained form under all stress conditions. Thus, none of the 50 paleologs I examined showed complete conservation among all organ types, developmental stages, and abiotic stresses (Table 5). These results indicate that there has been considerable divergence of AS patterns following the paleopolyploidy event during the evolutionary history of the Arabidopsis lineage. It suggests that AS patterns diverge rapidly on an evolutionary time scale following gene duplication. This is the first study of AS patterns in a large number of duplicated genes in plants. Previous studies have examined only individual pairs of duplicates, such as serine/arginine rich proteins in maize (Gupta et al., 2005), and ADP glucose pyrophosphorylases in maize (Rosti and Denyer, 2007) where two genes correspond to a single alternatively spliced gene in other grass species.  15  Computational analyses of mammalian gene families have found that members of large gene families tend to have less AS, and singletons (genes without a close relative) are almost always alternatively spliced (Kopelman et al., 2005; Su et al., 2006). Such an inverse relationship between AS and gene duplication is also observed in C.elegans (Irimia et al., 2008). My study is different from those studies because I focused on precise comparisons of the AS status between duplicated gene pairs using both experimental and computational approaches.  There have been several studies about the evolution of AS in orthologous genes in animals, mainly comparisons between human and mouse (Modrek and Lee, 2003; Nurtdinov et al., 2003; Thanaraj et al., 2003), but also between human and chimpanzee (Preuss and Blencowe). Those studies found varied frequencies of AS conservation in orthologous genes, ranging from a high of 61% to a low of 16% (Nurtdinov, Artamonova et al. 2003; Thanaraj, Clark et al. 2003). Most of those studies were bioinformatics analyses focused on exon skipping, which accounts for around 60% of all AS in mammals (Reddy, 2007). Results from studies on “major exons” and “alternative exons” (Modrek and Lee, 2003) may not be directly applicable to plants where exon skipping is estimated at around 5% of the total AS events (Reddy, 2007). Furthermore, the orthologous genes in mouse and human diverged from each other about 65-85 million years ago (Foote et al., 1999) which is considerably more ancient than the paleologs in Arabidopsis (about 25 million years ago) (Blanc et al., 2003).  Effects of abiotic stress on alternative splicing in paleologs  It is important for plants to cope with environmental stresses such as cold, heat and drought because they can not escape from harsh conditions. Plants have been shown to respond to abiotic stresses by up and down-regulation of gene expression (Thomashow, 1999; (Ulm et al., 2004) as well as altering the splicing pattern of gene transcripts (Palusa et al., 2007; Reddy, 2001; Schindler et al., 2008). My results showed that cold, heat and drought 16  stress can alter the splicing pattern of the paleologs  —  over half of the genes I examined  changed splicing patterns in at least one organ (Fig. 5). In addition, the splicing of many of the paleologs responded to stresses differently, suggesting expression and functional divergence between the paleologs. I analyzed RT-PCR data from 3 abiotic stresses (cold, heat and drought) of the 50 paleologs, for a total of 150 pair/stress combinations. Both paleologs responded to a stress in the same way only 6% of the time. Either both of them gained or both of them lost AS in at least one organ, suggesting that both paleologs could have similar functions needed for the plant to cope with the stresses. On the other hand, 4% of paleologs showed opposite AS response to a particular stress. For example, a DNA-repair ATPase (from pair2) related protein gained the intron-retained form in the stem after drought stress whereas its paleolog lost the intron-retained form in the stem under the same stress (Table 4). Thus there is a “reciprocal” presence of the two intron-retained forms which would introduce a stop codon in the last exon (that is, an alternative stop codon). The truncated proteins produced by alternative splicing could have functional partitioning so that the DNA-repair ATPase has a truncated protein which would work well under drought stress while the truncated version of its paleo log works better under normal conditions.  Under normal conditions, for most genes, the two paleologs showed clear differences in AS. However, under stress conditions the normally-non-AS gene sometimes gained a splicing variant whereas the normally AS gene retained AS. In such cases the two paleologs have the same alternative splicing event after stress. Seventeen percent of the 50 paleologs showed this interesting pattern (Fig 4b). This suggests that the control of AS in such cases could rely on differential expression of trans-acting factors, such as splicing proteins, in response to stress. The serine/arginine-rich proteins (SR proteins) in Arabidopsis are involved in regulation of pre-mRNA splicing and they have different splicing forms in response to abiotic stresses (Palusa et al., 2007). It has also been found that AS of one of these SR proteins autoregulated by itself (Lazar and Goodman, 2000). 17  Cis-/Trans regulation of alternative splicing The recognition of a splicing site is assisted by a combination of cis-acting elements and trans-acting elements. Cis-acting elements consist of the well-characterized sequences on the pre-mRNA including the splicing site as well as splicing enhancers that are located near the primary splicing site (Black, 1995), and trans-factors consist of the components of the spliceosome. One group of such factors are serine/arginine-rich (SR) proteins, belonging to a gene family that has been studied in human, mouse, yeast and plants (Fu, 1995). There are 19  SR proteins in Arabidopsis (Palusa et al., 2007) and they have two major functional domains: one or more amino-proximal RRIVI-type RNA binding motifs and a serine-arginine-rich carboxyl-terminal domain (RS domain) that is involved in protein-protein interactions (Manley and Tacke, 1996).  In the case of alternative splicing, multiple splicing variants are produced by the same pre mRNA, caused by either or both cis-/trans-acting splicing factors. Sequences on the transcript which resemble a normal splicing site (termed cryptic site) could lead to alternative donor or alternative acceptor; a weak splicing site, or an inadequate number of splicing site enhancers, could lead to intron retention (Feener et al., 1989; Maniatis, 1991). Exon skipping is a more active form of alternative splicing that could be formed by splicing site selection by trans-acting splicing factors (Kim et al., 2007; Lopez, 1998; Maniatis, 1991).  The alternative splicing differences between paleologs could be explained by evolution of cis-/trans- acting splicing factors. Since the paleopolyploidy event the duplicated genes have  acquired sequence mutations for more than 25 million years. By using splicing site and splicing enhancer site prediction programs GeneSplicer (Pertea et al., 2001) and SEE ESE (http://www.cbcb.umd.edu/software/SeeEse/), respectively, I found great divergence in the number and strength of cis-acting splicing factors between some of the 50 paleologs in this 18  study (data not shown). However, I did not find any correlation between increase/decrease of cis-elements and gain/loss of alternative splicing. Furthermore, the sequence evolution of the paleologs could lead to the binding of different trans-acting splicing factors to facilitate the splicing of their pre-mRNA5 because trans-acting factors, such as SR proteins, could recognize and bind to specific splicing enhancer or silencer sequences (Graveley, 2000; Maniatis and Tasic, 2002).  Alternative splicing in serine-arginine-rich Proteins Not only do SR proteins bind to cis-acting splicing sites and modulate tissue and developmental stage-specific alternative splicing (Sanford et al., 2003), but also many of them exhibit alternative splicing of their corresponding genes (Gupta et al., 2005; Lazar and Goodman, 2000; Palusa et al., 2007). Palusa et al. (2007) evaluated 19 Arabidopsis SR genes and found 95 splicing variants in 15 genes (Palusa et al., 2007). All the AS events from their work are summarized in Fig 10; gene annotations and group designations are also adopted from their study. I have put their results into an evolutionary context by plotting the AS events on a phylogenetic tree of the 19 genes that I generated by parsimony analysis (Fig 10). Also I found 6 pairs of paleologs among the 19 SR proteins and there were not any subsequent duplications after paleopolyploidy. This interesting observation suggests that paleopolyploidy has been the predominant mode of gene duplication in the SR gene family in the Arabidopsis lineage and there seems to be selection on most of them that caused them to be retained over evolutionary time.  The paleologs in the SR gene family showed both AS conservation and AS divergence. Two pairs, RSp3 1 and RSp3 1 a, 5RZ22 and SRZ22a showed extensive conservation of AS status. R5p3 1 and RSp3 la have 6 alternative splicing events in common, and 4 of them are located in intron 2 (Fig 10). The only AS difference between the pairs is the retention of intron 5 which is unique to RSp3 1 a. R5p3 1 and Rsp3 1 a were included in my study and I 19  confirmed the alternative splicing in intron 2— the intron retention (IR) and alternative acceptor (AA) event (Table 3). However, the two events I observed are not in the same organs  —  I found IR and alternative acceptor in leaf for RSp3 1, and AA in flower, leaf and  rosette for RSp3 1 a. The two AS events I did not see could be caused by different ages (I used 3 week old mature plants, Palusa et al. used 5 week old plants) and organs (I did not examine pollen), insufficient amount of electrophoresis to separate closely sized bands, or failure to detect rare transcript forms. It is also worth noting that the ASIP database only showed I AS event (alternative acceptor) which has been confirmed by both Palusa et al. and my study.  SRi and SRp34b are found to share an alternative exon event in intron 10 (Fig. 10). An alternative exon is an exon that is only present in a minority of transcripts. This kind of AS was not included in this study. Palusa et al. (2007) and I both found an AA in intron 10 for SRi and IR in intron 10 for SRp34b. However, these two events are not conserved and only appear in one of the paleologs, respectively. Indeed, SR 1 and SRp34b only share one out of five AS events (Fig 10). Similarly, SCL33 and SCL3Oa (paleologs not examined in this study) shared only one out of four AS events. These two pairs of paleo logs showed more AS divergence than conservation.  The most interesting case is the paleologs RSp4O and RSp4 1. They showed two conserved AS events (out of four total AS in RSp4O and three in RSp41)  —  an alternative exon in intron  2 and retention of intron 2 (Fig 2). These two events are also found in RSp3 1 and RSp3 la (described previously), suggesting the origin of these AS events is at the root of group C SR proteins and retained for all members in the group. I also confirmed the AS of RSp4O under normal conditions; although I did not see AS in RSp4 1 under normal condition, an intron retained form showed up after all three stresses (Table 5).  20  The most striking observation from the phylogenic analysis of AS in SR proteins would be a clue of differential loss of AS forms in Group C. The alternative acceptor and alternative donor events at Intron 2 are shared by RSp3 1 and RSp3 1 a. However, in the other pair of paleologs in the same group, RSp4O only showed AD, and RSp41 only showed AA at the same position. This result gives parsimony evidence that AD and AA at intron2 were present at the ancestor of Group C members, and both RSp4O and 41 lost an AS form. Partitioning of different AS forms is found between duplicated genes in maize (Rosti and Denyer, 2007), but differential loss of AS in genes duplicated by polyploidy has not yet been reported. The translation of both AD and AA splicing variants would produce polypeptides that are around 50 amino acids that only consist of the RRM domain of the SR protein (Palusa et al., 2007) that could have different functions from the full-length proteins, or the alternative spliced variants could be degraded by the process of nonsense mediated decay (Hentze and Kulozik, 1999).  Function and evolution of alternative splicing Like gene duplication, the gain of alternative splicing in a gene could produce protein isoforms that could have different functions. There are a lot of well-described genes from various organisms in which different AS variants have different functions (Stamm et al., 2005). In addition, different splicing isoforms could direct the protein to function in different cellular compartments (Lainez et al., 2004; Tone et al., 2001). AS can also have a regulatory role. For example, AS in the UTR region could contribute to distinct transcript stability and translational efficiencies (Wickens et al., 2002), or cause the use of alternative cis-regulatory elements. Another regulatory role of AS is non-sense mediated decay (NMD) in which the transcripts with pre-mature termination codons (PTC) are subjected to degradation before they get translated into proteins (Cao and Parker, 2003; Hiliman et al., 2006; Maquat, 2004). Some of the intron retentions in coding regions in the paleologs I examined would produce a  21  transcript containing a PTC, suggesting that they could lower the expression of the gene by the process of NMD.  Given that AS could result in regulatory and functional divergence of a gene, it could be subject to selection. Modrek and Lee proposed the landscape fitness theory (Modrek and Lee, 2003): A new AS event in a gene could be a minor and neutral event, since the normal, major splicing form could produce functional proteins. Thus, mutations that affect only the minor form (for example, in the case of IR, mutation in the intron would only affect the intron-retained variant) could accumulate and eventually grant it a new function (Modrek and Lee, 2003). Upon gene duplication, the duplicates should have identical sequences which would suggest that they have the same cis-/trans- splicing factors, and hence the same AS status. We could predict that all the paleologs would share the same AS events right after the polyploidy event 25-40 mya; however, they show great divergence in AS status at the present time (Fig. 2). There would have been neutral or selective AS gain or loss during evolutionary time.  Do the differences in AS patterns in most of the paleo logs represent gain of the AS event in one copy or loss in the other copy? It is hard to elucidate whether it is a gain of AS in one paleolog or a loss of AS in the other because the AS status at the time of gene duplication is not known. To infer the ancestral AS status, a previous study on AS evolution in orthologous genes used sequences from yeast as an outgroup for comparison between human and mouse (Kondrashov and Koonin, 2003). It is hard to find an outgroup for Arabidopsis with extensive information about AS, since other plants with mostly sequenced genomes and large EST/cDNA data sets, such as Populus and rice, are distantly related and have other paleopolyploidy events during their evolutionary history (Blanc and Wolfe, 2004) and other gene duplications which could complicate determining the ancestral state of AS in paleologs in Arabidopsis. A good candidate species to use would be Carica papaya, whose genome 22  has been mostly sequenced (Ming et al., 2008), but the number of publically available ESTs is relatively low (77,000 as of June 2008) making it unlikely that AS variants of paleolog ancestors would be available for many genes. Even if there were a large number of EST or complete eDNA sequences available, the variation in AS patterns in different organs and developmental stages could make it difficult to make comparisons between species. An alternative approach would be to study AS evolution in the gene family in which the paleolog belongs, using the paleologs as the ingroup and the other genes as the outgroup, and using parsimony criteria to infer an ancestral state. I performed such a gene family analysis on a pair of sulfate transporter genes because they showed interesting organ-specific AS.  Alternative splicing in a sulfate transporter family Sulfate transporters are trans-membrane proteins that import sulfate from outside the cell across the membrane; sulfate is plant’s primary source for sulfur which is essential for cell growth. Sulfate transporter 1 ;2 (Sultr 1 ;2, At1g78000) is a high affinity transporter that was duplicated by paleopolyploidy (paired with Sultr 1;3, At1g22 150) and is responsible for up to 70% of total sulfate uptake in Arabidopsis thaliana (Maruyama-Nakashita et al., 2003). I found an IR event just before the last exon of Sultr 1;2 which has not yet been reported by other studies of these genes (Maruyama-Nakashita et al., 2003; Shibagaki et al., 2002). The AS in Sultr 1 ;2 is highly organ-specific (see Fig 8 and Results section). The intron-retained form appeared in flowers and leaves from mature plants, but not in rosettes and roots. But after 72 hours of dark treatment, the intron-retained form appeared in rosettes and roots, but not in flowers and leaves, showing the exact opposite AS patterns in these organs. While the normal splice form produced a full length functional protein, the intron-retained form introduced an alternative stop codon that results in an isoform with 39 amino acids deleted at the C’ terminus (which includes 3 alpha helices and a tail structure of the transporter, see Fig 9). Mutations in this region have been reported to make a less efficient, but still functional protein (Dunham et al., 2002; Rouached et al., 2005). The AS in the region could produce a 23  protein isoform with a significantly less efficient isoform that could serve as an “off’ switch in the cell for basal sulfate transport. By this hypothesis, under normal conditions, the plant showed growth in its shoot (including leaves and flowers) in which only the full-length active form of Sultr 1 ;2 is expressed, where in the root, a mix of active and inactive forms are present. When the plant is subject to a dark stress, the plant is put into a non-growth phase, where Sultr only 1 ;2 active form is expressed in roots for nutrient uptake from the environment and a mix of isoforms are expressed in the shoot. The same AS events are also found in the paleolog of Sultr 1 ;2  —  Sulf 1 ;3, however, it is only found in 14 day seedlings  and rosettes from mature plants (Fig 8) and it does not seem to have the organ-specific transition of splicing variants after stress. I also examined the homologous region in three other sulfate transporters in the group: Sultr 1; 1 (At4g08620), Sultr 2; 1 (At5glO 180) and Sultr 2;2 (Atl g77990). None of them showed AS in the same region (Fig 8), which strongly suggests (but does not prove) that AS might have originated in the common ancestor of the paleologs, Sultr 1;2 and Sultr 1;3.  Conclusions and future work From RT-PCR experiments, I found that alternative splicing is poorly conserved between paleologs in Arabidopsis thaliana and the AS patterns are heavily influenced by environmental conditions. Thus, AS patterns evolve relatively rapidly after whole genome duplication. Gene family analysis from SR proteins and Sultr genes have provided some insights into the evolution of AS, however it is difficult to determine how AS has evolved after gene duplication (a gain or a loss) as well as how fast AS is evolving. Future work may involve studying AS in plant closely related to Arabidopsis thaliana and more recently duplicated genes, such as some of the tandemly duplicated genes. Recent studies using high throughput methods can also be a good addition to available information: In a recent study the authors sequenced the entire transcriptome ofArabidopsis flowers (Lister et al., 2008). These data provide a wonderful opportunity to examine all 2,600 pairs of paleologs for all 24  possible intron retention events, albeit in just one organ type. Furthermore, different products of AS could be examined for the presence of protein products in the dataset from a large scale proteomics study (Baerenfaller et al., 2008). Such high-throughput transcriptome and proteome studies could lead us to a better understanding of the evolution of alternative splicing after gene duplication.  25  REFERENCES Baerenfaller, K., Grossmann, J., Grobei, M.A., Hull, R., Hirsch-Hoffmann, M., Yalovsky, S., Zimmermann, P., Grossniklaus, U., Gruissem, W., and Baginsky, 5. (2008). Genome-Scale Proteomics Reveals Arabidopsis thaliana Gene Models and Proteome Dynamics. Science 320, 938. Bininda-Emonds, O.R.P. (2005). transAlign: using amino acids to facilitate the multiple alignment of protein-coding DNA sequences. Black, D.L. (1995). Finding splice sites within a wilderness of RNA. RNA 1, 763-771. Blanc, G., Hokamp, K., and Wolfe, K.H. (2003). A Recent Polyploidy Superimposed on Older Large-Scale Duplications in the Arabidopsis Genome. Genome Research. Blanc, G., and Wolfe, K.H. (2004). Widespread Paleopolyploidy in Model Plant Species Inferred from Age Distributions of Duplicate Genes. The Plant Cell Online 16, 1667. Bowers, J.E., Chapman, B.A., Rong, J., and Paterson, A.H. (2003). Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422, 433-438. Brandes, C., Kahr, L., Stockinger, W., Hiesberger, T., Schneider, W.J., and Nimpf, J. (2001). Alternative Splicing in the Ligand Binding Domain of Mouse ApoE Receptor-2 Produces Receptor Variants Binding Reelin but Not a2-Macroglobulin. Journal of Biological Chemistry 276, 22160-22169. Cao, D., and Parker, R. (2003). Computational Modeling and Experimental Analysis of Nonsense-Mediated Decay in Yeast. Cell 113, 533-545. Cui, L., Wall, P.K., Leebens-Mack, J.H., Lindsay, B.G., Soltis, D.E., Doyle, J.J., Soltis, P.S., Carlson, J.E., Arumuganathan, K., and Barakat, A. (2006). Widespread genome duplications throughout the history of flowering plants. Genome Research 16, 73 8-749. Dunham, M.J., Badrane, H., Ferea, T., Adams, J., Brown, P.O., Rosenzweig, F., and Botstein, D. (2002). Characteristic genome rearrangements in experimental evolution of Saccharomycescerevisiae. Proceedings of the National Academy of Sciences 99, 16144. Feener, C.A., Koenig, M., and Kunkel, L.M. (1989). Alternative splicing of human dystrophin mRNA generates isoforms at the carboxy terminus. Nature 338, 509-511. Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package) version 3.6 a3. Distributed by the author Department of Genetics, University of Washington, Seattle. Foote, M., Hunter, J.P., Janis, C.M., and Sepkoski Jr, J.J. (1999). Evolutionary and Preservational Constraints on Origins of Biologic Groups: Divergence Times of Eutherian Mammals. Science 283, 1310. Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y., and Postlethwait, J. (1999). Preservation of Duplicate Genes by Complementary, Degenerative Mutations. Genetics 151, 153 1-1545. 26  Fu, X.D. (1995). The superfamily of arginine/serine-rich splicing factors. RNA 1, 663. Gerstein, A.C., Chun, H.J.E., Grant, A., and Otto, S.P. (2006). Genomic convergence toward diploidy in Saccharomyces cerevisiae. PLoS Genet 2, e145. Graveley, B.R. (2000). Sorting out the complexity of SR protein functions. RNA 6, 11971211. Gupta, S., Wang, B.B., Stryker, G.A., Zanetti, M.E., and Lal, S.K. (2005). Two novel arginine/serine (SR) proteins in maize are differentially spliced and utilize non-canonical splice sites. BBA-Gene Structure and Expression 1728, 105-114. Hancock, J.F., and Bringhurst, R.S. (1981). Evolution in California populations of diploid and octoploid Fragaria (Rosaceae): a comparison. American Journal of Botany 68, 1-5. Hentze, M.W., and Kulozik, A.E. (1999). A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96, 307-3 10. Hillman, R.T., Green, R.E., and Brenner, S.E. (2006). An unappreciated role for RNA surveillance, feedback. Hunt, A.G., Meeks, L.R., Forbes, K.P., Das Gupta, J., and Mogen, B.D. (2000). Nuclear and Chloroplast Poly (A) Polymerases from Plants Share a Novel Biochemical Property. Biochemical and Biophysical Research Communications 272, 174-181. lida, K., Seki, M., Sakurai, T., Satou, M., Akiyama, K., Toyoda, T., Konagaya, A., and Shinozaki, K. (2004). Genome-wide analysis of alternative pre-mRNA splicing in Arabidopsis thaliana based on full-length cDNA sequences. Nucleic Acids Research 32, 5096. Irimia, M., Rukov, J.L., Penny, D., Garcia-Fernandez, J., Vinther, J., and Roy, S.W. (2008). Widespread Evolutionary Conservation of Alternatively Spliced Exons in Caenorhabditis. Molecular Biology and Evolution 25, 375. Johnson, J.M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P.M., Armour, C.D., Santos, R., Schadt, E.E., Stoughton, R., and Shoemaker, D.D. (2003). Genome-Wide Survey of Human Alternative Pre-mRNA Splicing with Exon Junction Microarrays. Science 302, 2141. Kim, B., Magen, A., and Ast, G. (2007). Different levels of alternative splicing among eukaryotes. Nucleic Acids Research 35, 125. Knowles, D.G., and McLysaght, A. (2006). High Rate of Recent Intron Gain and Loss in Simultaneously Duplicated Arabidopsis Genes. Molecular Biology and Evolution 23, 15481557. Kondrashov, F.A., and Koonin, E.V. (2003). Evolution of alternative splicing: deletions, insertions and origin of functional parts of proteins from intron sequences. Trends in Genetics 19, 115-119. Kong, J., Gong, J.M., Zhang, Z.G., Zhang, J.S., and Chen, S.Y. (2003). A new AOX homologous gene OsIM1 from rice (Oryza sativa L.) with an alternative splicing mechanism under salt stress. TAG Theoretical and Applied Genetics 107, 326-331.  27  Kopelman, N.M., Lancet, D., and Yanai, I. (2005). Alternative splicing and gene duplication are inversely correlated evolutionary mechanisms. Nat Genet 37, 588-589. Lainez, B., Fernandez-Real, J.M., Romero, X., Esplugues, E., Canete, J.D., Ricart, W., and Engel, P. (2004). Identification and characterization of a novel spliced variant that encodes human soluble tumor necrosis factor receptor 2. International Immunology 16, 169. Lazar, G., and Goodman, H.M. (2000). The Arabidopsis splicing factor SRi is regulated by alternative splicing. Plant Molecular Biology 42, 571-58 1. Levy, A.A., and Feldman, M. (2004). Genetic and epigenetic reprogramming of the wheat genome upon allopolyploidization. Biological Journal of the Linnean Society 82, 607-6 13. Lister, R., O’Malley, R.C., Tonti-Filippini, J., Gregory, B.D., Berry, C.C., Millar, A.H., and Ecker, J.R. (2008). Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis. Cell 133, 523-536. Liu, B., and Wendel, J.F. (2003). Epigenetic phenomena and the evolution of plant allopolyploids. Molecular Phylogenetics and Evolution 29, 365-379. Lopez, A.J. (1998). ALTERNATIVE SPLICING OF PRE-mRNA: Developmental Consequences and Mechanisms of Regulation. Annual Reviews in Genetics 32, 279-305. Lynch, M., and Force, A. (2000). The Probability of Duplicate Gene Preservation by Subfunctionalization. Genetics 154, 459-473. Maniatis, T. (1991). Mechanisms of alternative pre-mRNA splicing. Science 251, 33-34. Maniatis, T., and Tasic, B. (2002). Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418, 236-243. Manley, J.L., and Tacke, R. (1996). SR proteins and splicing control. Genes & Development 10, 1569. Maquat, L.E. (2004). Nonsense-Mediated mRNA Decay: Splicing, Translation And mRNP Dynamics. Nature Reviews Molecular Cell Biology 5, 89-99. Maquat, L.E., and Carmichael, G.G. (2001). Quality Control of mRNA Function. Cell 104, 173-176. Maruyama-Nakashita, A., Inoue, E., Watanabe-Takahashi, A., Yamaya, T., and Takahashi, H. (2003). Transcriptome Profiling of Sulfur-Responsive Genes in Arabidopsis Reveals Global Effects of Sulfur Nutrition on Multiple Metabolic Pathways. Plant Physiology. Ming, R., Hou, S., Feng, Y., Yu, Q., Dionne-Laporte, A., Saw, J.H., Senin, P., Wang, W., Ly, B.V., and Lewis, K.L. (2008). The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus). Nature 452, 991-996. Modrek, B., and Lee, C. (2002). A genomic view of alternative splicing. Nature Genetics 30, 13-19. Modrek, B., and Lee, C.J. (2003). Alternative splicing in the human, mouse and rat genomes is associated with an increased frequency of exon creation and/or loss. Nature Genetics 34, 177-180. 28  Ner-Gaon, H., and Fluhr, R. (2006). Whole-Genome Microarray in Arabidopsis Facilitates Global Analysis of Retained Introns. DNA Research 13, 111. Nurtdinov, R.N., Artamonova, II, Mironov, A.A., and Gelfand, M.S. (2003). Low conservation of alternative splicing patterns in the human and mouse genomes. Human Molecular Genetics 12, 1313-1320. Ohno, S. (1970). Evolution by Gene Duplication. Osborn, T.C., Chris Pires, J., Birchler, J.A., Auger, D.L., Jeffery Chen, Z., Lee, H.S., Comai, L., Madlung, A., Doerge, R.W., and Colot, V. (2003). Understanding mechanisms of novel gene expression in polyploids. Trends in Genetics 19, 141-147. Otto, S.P. (2007). The Evolutionary Consequences of Polyploidy. Cell 131, 452-462. Otto, S.P., and Whitton, J. (2000). P OLYPLOID I NCIDENCE AND E VOLUTION. Annual Reviews in Genetics 34, 401-437. Palusa, S.G., Ali, G.S., and Reddy, A.S.N. (2007). Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins: regulation by hormones and stresses. The Plant Journal 49, 1091-1107. Pertea, M., Lin, X., and Salzberg, S.L. (2001). GeneSplicer: a new computational method for splice site prediction. Nucleic Acids Research 29, 1185-1190. Preuss, M., and Blencowe, B.J. Global analysis of alternative splicing differences between humans and chimpanzees. Genes & Development. Reddy, A.S. (2007). Alternative splicing of pre-messenger RNAs in plants in the genomic era. Annu Rev Plant Biol 58, 267-294. Reddy, A.S.N. (2001). Nuclear Pre-mRNA Splicing in Plants. Critical Reviews in Plant Sciences 20, 523-571. Robinson, C.J. (2001). The splice variants of vascular endothelial growth factor (VEGF) and their receptors, pp. 853-865. Rosti, S., and Denyer, K. (2007). Two Paralogous Genes Encoding Small Subunits of ADP glucose Pyrophosphorylase in Maize, Bt2 and L2, Replace the Single Alternatively Spliced Gene Found in Other Cereal Species. Journal of Molecular Evolution 65, 316-327. Rouached, H., Berthomieu, P., El Kassis, E., Cathala, N., Catherinot, V., Labesse, G., Davidian, J.C., and Fourcroy, P. (2005). Structural and Functional Analysis of the C-terminal STAS (Sulfate Transporter and Anti-sigma Antagonist) Domain of the Arabidopsis thaliana Sulfate Transporter SULTR1. 2. Journal of Biological Chemistry 280, 15976. Sanford, J.R., Longman, D., and Caceres, J.F. (2003). Multiple roles of the SR protein family in splicing regulation. Prog Mol Subcell Biol 31, 33-58. Schindler, S., Szafranski, K., Hiller, M., Ali, G.S., Palusa, S.G., Backofen, R., Platzer, M., and Reddy, A.S.N. (2008). Alternative splicing at NAGNAG acceptors in Arabidopsis thaliana SR and SR-related protein-coding genes. BMC Genomics 9, 159. 29  Sesti, G., Federici, M., Lauro, D., Sbraccia, P., and Lauro, R. (2001). Molecular mechanism of insulin resistance in type 2 diabetes mellitus: role of the insulin receptor variant forms. Diabetes Metab Res Rev 17, 363-373. Shibagaki, N., Rose, A., McDermott, J.P., Fujiwara, T., Hayashi, H., Yoneyama, T., and Davies, J.P. (2002). Selenate-resistant mutants of Arabidopsis thaliana identif’ Sultri; 2, a sulfate transporter required for efficient transport of sulfate into roots. The Plant Journal 29, 475-486. Stamm, S., Ben-An, S., Rafalska, I., Tang, Y., Zhang, Z., Toiber, D., Thanaraj, T.A., and Soreq, H. (2005). Function of alternative splicing. Gene 344, 1-20. Su, Z., Wang, J., Yu, J., Huang, X., and Gu, X. (2006). Evolution of alternative splicing after gene duplication. Genome Research 16, 182-189. Talavera, D., Vogel, C., Orozco, M., Teichmann, S.A., and de la Cruz, X. (2007). The (In) dependence of Alternative Splicing and Gene Duplication. PLoS Comput Biol 3, e33. Thanaraj, T.A., Clark, F., and Muilu, J. (2003). Conservation of human alternative splice events in mouse. Nucleic Acids Research 31, 2544-2552. Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680. Tone, M., Tone, Y., Fairchild, P.J., Wykes, M., and Waldmann, H. (2001). Regulation of CD4O function by its isoforms generated through alternative splicing. Proceedings of the National Academy of Sciences 98, 1751. Ulm, R., Baumanu, A., Oravecz, A., Mate, Z., Adam, E., Oakeley, E.J., Schafer, E., and Nagy, F. (2004). Genome-wide analysis of gene expression reveals function of the bZIP transcription factor flY 5 in the UV-B response of Arabidopsis. Proceedings of the National Academy of Sciences 101, 1397-1402. Wan, C.Y., and Wilkins, T.A. (1994). Isolation of multiple cDNAs encoding the vacuolar H (+)-ATPase subunit B from developing cotton (Gossypium hirsutum L.) ovules. Plant Physiology 106, 393. Wang, B.B., and Brendel, V. (2006). Genomewide comparative analysis of alternative splicing in plants. Proceedings of the National Academy of Sciences 103, 7175-7180. Wickens, M., Bernstein, D.S., Kimble, J., and Parker, R. (2002). A PUF family portrait: 3’ UTR regulation as a way of life. Trends in Genetics 18, 150-157. Xu, Q., Modrek, B., and Lee, C. (2002). Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Research 30, 3754-3766.  30  M  G F F  F- Si Si Si- L L L-  St M  St st- ‘d 7 ‘4 14 14 14 Rs R.s Rsd 4 4-  w  M  F  Si  L  St  7  -  l4dRsRt  -M  F Si  L  St  L  St7dl4dRsRt  7d  14d Rs Rt  F  Si  L  St  F  Si  L  St 7  MF  Si  j  7  14d  Rs R  b) M  F  Si  c)  14d Rs R  *  M  F  Si  L  S17 d  l4dRsR t  d)  L5t7 d  -  f  14d  Rs  4--  .  Fig 1. Comparison of Alternative Splicing between Paleologs. RT-PCR products are separated by size on 1.5 % agarose gels. Arrows indicate expected splicing variants.  a)  SF1 (At1g02840) vs. SF2 (At4g02430) both paleologs showsd alternative acceptor. Reactions without reverse transcriptase are run along with the experimental sample. Water control shows absence of any contamination.  b)  IPK2a (At5g07370) vs. IPK2b (At5g6 1760); IPK2a showed exon skipping which is absent in IPK2b. Root is missing an altemabve exon which has a pre-makwe op codon.  c)  GRP (At3g23830) vs. GRP2 (At4gl 3850), GRP showed a l2bp alternative acceptor which is absent in GRP2.  d)  BR Signal Protein (At1g19350) vs. BR Signal Protein (At1g75080). At1g19350 showed intronretentioningreentissueswhichisabsentinallorgaus inAtlgl935O.  Labels: (M)Marker, (F)Flower, (S,Silique, (L)Lateral Leaf, (t)tem l7dS) 7 days Seedlings, (T4d) 14 days Seerfhngs, (Rs)Rosette, (Rt)Root(c3)Genomic DNA 31  2% 12%  One of the paleologs had AS, the other did not show the same AS event in any organs Both paleologs showed AS, but in different organs  •  Both paleologs showed AS, but in the same organs  u One of the paleologs had AS, the other showed no expression  Fig 2. Comparison of Alternative Splicing Events between 50 pairs of paleologs. Alternative splicing events are compared between paleologs among different organs and developmental stages.  32  Silique  [  Flower  .  ,  1I.  ‘ZWA.  Leaf  I,  Stem  ‘Zl.  .  Rosette Root  :fh.  I 4d seedllnç  7d seeding I  0%  l M_Ii1  —  I  I  I  10% 20% 30% 40% 50% 60% 70% 80% 90% 100%  • Both paleologs showed the alternative splicing event •1 paleolog has the alternative splicing event, the other does not •Both paleologs did not show the alternative splicing event  At least one gene is not expressed 1  Fig 3. Comparison of Alternative Sphcrng in 50 pairs of paleologs by organ. Status of alternative splicing event are compared for each organ type and life stage.  33  Normal  Cold Stress Ii FSi R Ro  £3  St& Ri  !  a)  SF1  Loss .4  —  Io M  Si  F  I.  be St  7  14d Rs RI  F Si R ko  .4  SF2  Normal Si  F  L  0  7d  Cold Stress 14d  Its  F Si R  Rt  Ro  IF-3 family (At4g30690)  F  Si  L  St  7d  14d  Rs  F  Rt  Ro  R  ÷  IF-3 family  (At2g24060)  Si  Gain .4  Fig 4. Comparison of Alternative Splicing between Paleologs after Stress Treatment RT-PCR products are separated by size on 1.5 % agamse gels. Arrows indicate expected splicing variants. a)  SF1 (At1g02840) vs. SF2 (At4g02430) SF1 lost the alternative acceptor variants after cold stress in silique and rosette. SF2 also lost a splicing variant after cold stress, but it’s the other splicing form.. The extm band in SF2 could be a non-specific band.  b)  IF-3 family At4g30690 showed iniron retention before and after cold stress. At2g24060 did not show alternative splicing before stress and gained intron retention after stress, which results in both paleologs having the same splicing pattern after cold stress. Seedlings, 34  4% 17%  17%  20%  Gain and Loss En different organs I Gain in at least 1 organ and no loss  Loss in at least I organ and no gain • NochangeinAS (3 Not expressed  Fig 5. Effects of Abiotic StEess on Alternative Splicing Over half of all 100 genes changed its alternative splicing or expression in at least one organ examined.  35  Dry Heat •Both paleologs showed the altemtive splicing event  Cold  I ut “  2  L r L  paleolog has the alternative splicing event, theotherdoesnot  II  Cold s  Dry  Dry  • Both paleologs did not show the alterntive splicing event  Heat Cold Dry  At least one gene is not expressed  •  i;.  Heat Cold  0%  I  I  20%  40%  tI’  60%  80%  100%  Fig. 6 Comparison of Alternative Splicing Status between Paleologs after Stress Treatment Alternative splidng patterns between paleotogs are compared for organs under different stresses. Alternative splicing in a particular organ can be different in response to different stresses.  36  • Became Same • Both no chang 15%  51%  o o o  Gain, Gain Gain, Loss Loss, Loss  • Not expressed  o  No pattern  7%  Fig 7. Alternative Splicing Change in Paleologs After Stress Two duplicat.es can respond to the stress in the same way (both gain or both loss), opposit? way (one gains, one loses), or no change at all. Some genes showed chanies sC that AS in the duplicates became the same after sTresses where they are different undbr normal conditions. Became same: Paleologs have different AS status under normal condition, but become the same in all organs after stress. Both no change: Both paleologs did not change in AS in all organs status after stress. Gain, Gain Both paleologs gained AS in at least one organ. Gain, Loss: One of the paleologs gained AS in at least one organ, the other lost AS in at least one organ. Loss, Loss: Both paleologs lost AS in at least one organ. Not Expressed: One or both paleologs lost expression in all organs after stress. No Pattern: One or both paleologs changed its AS stains in at least one organ after stress but there is no paiticular pattern between the two.  37  Organ  flower  Leaf  Stem  Rosette  Root  7day  l4day Seah  Gene  4g08620  IIillih1 dark salt  tli5li  1g22150 cold  I  J  IllIlIllIllIllIll  1g78000  I  I  I  I  1  I  I  I  I  I  I  I  I  I  II  1  I  II  I  I  I  I  I  I  I  I  I  ilNil5  1  1  I  I  ilI  5’  dark salt  I  L  I  I  I  I  I  I  I  I  I  I  1  I  I  Nfl  Nfl  I  Nfl  Nfl  ND.  ND ND. ND. Nfl  ND. ND. ND.  ND. Nfl ND.  ND. ND. ND.  I  pp  cold dark salt 1g77990  ilL$k1li1  I5  ltilt  II  —  fl  dark salt  I  II  I  [51  II  illiiliu4  I  I  I  I  I  I  I  II  I  L  I  1 N D. ND. ND  ND. ND. ND  ND. ND. ND.  1  II  I  5g10180  I  cold  —  PP  salt  lllullIlIlIIIIlI  PP  fl  I  I  flNNN551  I  I  fl  I  Intron Retained fonn  Both foms  Intron spliced-out louis  No expression  ND.  ND. ND. ND.  No data available  Fig 8. Alternative splicing In Sulfate Transporter family  Phylogeny of gene family shown on the left The grey oval indicates alternative splicing is for the gene. The question mark indicates possible origin of alternative splicing.  found  38  1910 1920 1930 4l0620D1 GAATTCkG 12150D1 kCATTCAG 1079000u2 GkT0 PkC? r T’0 C C?T 1G7800001 G.CATTCAG 1G7799001 iG.CATCC6G 5G10180u1 0GPTG  1940  1950  1960  1970  1900  1990  2000  iiaouaoo 167800001 167799001  I0D1 561018001  2020  203I TPGQTCT.  oor  ‘  .  G  .r  i r  rr’  TTG?.C cGPTC  Intron 12 (112  115fl1  2010  xonl3 4 ,v  zz  ;E.CD IRE.-;RE E:E: :E1: JEr? IRDS ;i REiRD TTRD i:3:c Ii1E IN EI7d1IE IRDRIL JEE.E0 VEF.E’ :IDc. Dc E L’i D.11EEKi V NP!1VI  LKCEEIrE  IH F.DP a3  a2  I  -.  a4  aS  B Mutations causes 50%, 35% reduction in sulfate uptake in  yeast, respectively, but does not affect growth of yeast  Crystal structure of STAS domain of Sultr 1;2  Rouached et aL, 2005 PNAS  C-tar  IR form has a PTC which causes the loss of C’ tail (39 a.a. shorter)  Fig 9. Effect of the Intron Retention in Sultr 1;2(ATIGZ8000.1) Intron retention in the last intron causes loss of 39 amino acids at C’ of SuIt 1 ;2. A. DNA sequence of Sultr I ;2 aligned with its gene family members. The second alignment showed amino add translation. (1G78000D1 and D2 are alternative sphced variances) Crstal Struure of STAS domain of Sultr I ;2 (Rouached et aL, 2005 PNAS) B.  Alternative Splidnn Events  I  r_  SRp3O (All g091 40)  IR (13), AA (110), Allernafive Exon (110)  SRI (At1g02840)  ES (ElO), AD (110), AA (110), Alternative Exon (110)  (Pair38)  SRp34h (At4g02430) SRp34A (At3g49430)  ER (12), ES (ES), ES (E9), ER (110), Alternative Exon (110). ES (Eli) Alternative Exon (Ii), AA (Ii), ER (111)  AD (121. Alternative Exon (121. JR (12). AA (12). IR (13). JR RSp3I (At3g61860) (Pair32) (141 RSp3la (At2g46610) AD (12). Alternative ltxon (121. JR (121. AA (12). JR (131. JR (14). ER (15) RSp4O (At4g25500) Alternative Exon (Ii), AD (12), Alternative Exon (12), JR (121 (Pair22) RSp4I (At5g52040) Alternative Earns (121. AA(12), JR (121  ioo 100  SRZ2I (At1g23860) 100  No Alternative SniJd.  SRZ22 (At4g31580)  RSZ22a (At2g24590) 100  L €  1 91  I?ig.  RSZ 32(At3g53500)  Alternative Exon(12), AAQ2), IR(12), JR(13),IR(14), IRQS),IR(16)  RSZ33 (A12q37340)  AD (12), JR (13)  SC 35 (At5g64200)  JR (13), JR (14), JR (IS), JR (16), JR (17), JR (IS)  SC133 (At1g55310)  AA(13), Alternative Exon (13), JR (131. JR (16)  L30a (A13g13570)  Alternative Exon (Ii), JR (13), ES (E4), JR (14)  SCL28 (At5gl 8810)  No Alternative Splicing  SCL3O (At3g55460)  Alternative Exen (13)  SR45(At1g16610)  AA(16)  10 Analysis of Arabidopsis Seiine!arginme-ridi (SR) genes  Boided genes are duplicated genes from a recent paleopolyploidy around 25-4(1 mya (Blanc et aL, 2003) (pair#) are paleologs which had beai esamined in this study (Fable 3). Gene phylogeny shown on the left with bootstrap values. BoUed events indicate conserved alternative splicings with another ‘oup member. Underlined bolded events indicate conserved alternative splicings in paleologs. ER- Intron retention, AA— Alt. accepter, Al) Alt Donor, ES Exon Skipping. Alternative Exon Exon that is part ofintron in majority of transcripts; I#- Intron number, ES Exon number. —  —  -  -  Alternative splicing information, gene annotation, group designation from Palusa et aL, 2007  40  Table 1. Computational Analysis of Alterative Splicing between Paleologs in A. thaliana (Splicing variants data from Alternative Splicing in Plants (Wang and Brendel, 2006) based on TAIR 7 data)  Total data included Pairs/Cluster with AS Difference in AS status Within pairs Both members in pair have AS  Paleologs (pairs) 2,584 (Blanc et al., 2003) 858 (33%) 691 (81%) 167 (19%)  41  Table 2. PCR Target Region and Primer Sequences “E” means Exon, “I” means Intron, Part in parenthesis are where the primers bind. Locus ID  PCR target (partial)  Forward Primer  Reverse Primer  Pain  At5g07370 At5g6 1760  (E i),I 1 ,E2,12,(E3) (El ),I 1,. (E2)  CAAGCGATGAACCAGAAAAGT TTGGTCATCTACGAGTGGAC  GACTTTGAGCTGCATCTTGTT ATAGAACAATCAACAATTACAC  Pair2  At2g24420 At4g3 1340  (E13), 113, E14, 114, (E15) (E14), 114, (E15)  GACGGGTTTTGATGCGTTCT GACAAAGAAACCTGTTAAACAC  CAAGCCCTTAGTAGATTTCCT GCATAAAGATAAGTTGCAAAAG  Pair3  At4g30690 At2g24060  (E6), 16, (E7) (E6), 16, (E7)  CGAATGGACTTGAAGGAGCT AGATACGAACAGCAAAAGAGG  CCTTTCATGTTCACAATCACT GGAAACGTCTGAGGAGTTCA  Pair4  At2g43010 At3g59060  (E6), 16, (E7) (E5), 15, (E6)  ATGATGTTCCCCGGAGTTCA TTATGCTTGCTTAGGCGACC  TCACCAACCTAGTGGTCCAA CCAAATCTTATCGGAGCAGC  Pair5  At5g55550 At4g26650  (El), Ii, (E2) (El), Ii, (E2)  GATGATGTGTTTATCCATGATC AGACAGAGAGAGTGGATGGA  GATGATAACCCAAATTCGCAATT GGATTCATCTTATTGAAAATCA  Pair6  At1g06390 At2g30980  (Eli), Ill, (E12) (ElO), 110, (Eli)  GATGATGTGTTTATCCATGATC GTTTCATTTCAAGGACAAAAAC  GATGATAACCCAAATTCGCAATT GCTTCACCGGAGCTTATCAA  Pair7  Atlg32230 At2g355l0  (E4), 14, (E5) (E4), 14, (E5)  CATATATTCCCGGAATTTGTTG GAGATTGCTTTGAACAGCAG  CTTGAACCAACACTGTTTGC TGCATGGGTTCCTGCGAAGA  Pair8  At3g09770 At5g03200  (E2), 12, (E3) (E2), 12, (E3)  ATTATCCGGGTCGGGTTCAA GAAGGAGACAAGAAGTCGAT  ACATTAGCAGCAGCGGTGGT GTTTGATCTTCTGCTGCGGG  Pair9  At5g18620 At3g06400  (El), Il, (E2) (El), Ii, (E2)  ACTAAAAACGCACTACTAGGA CTGCATGATTCACAAACTTGG  CATCAAAACGACCTTCGGGT TCAAACCAGGACAAACATTCAT  Table 2. (Continued) Locus ID  PCR target (partial)  Forward Primer  Reverse Primer  PairlO  At4g23570 At4gl 1260  (El), Ii, (E2) (El), Ii, (E2)  GCATAAAACGAAGGAACAATC GATGTTGGCCTGAGCACGAT  GCTTTCGAGTTTGATATAGGC GCCTAGAGGAATAGAATCGG  Pairl 1  At1g50630 At3g20300  (E3), 13, (E4) (E3), 13, (E4)  CCAATGGTTTTACCAAGAAGC ATGGTCTTACCAAGTAACCAG  CCACGTTAGAATCCTTTGATC GCGACGATAGAATCCTTTGA  Pairl2  At3g56400 At2g40750  (E2), 12, (E3) (E2), 12, (E3)  GGGAATTTGGCATTAAGAATC CTTGGGAATGTGGTATTAAGA  AGGATCTAGTGGCTAAAATCT TCAGCTTCTCCTTTCTCATCA  Pairl3  At5g10450 At5g65430  (E3), 13, (E4) (E3), 13, (E4)  GAGTAGATAAATCATCAAGCTG CAGAGTTGATACAGAGCAGC  CGGATATGGCACCTACTCAT CAGTTGCTGATCTAGCACCT  Pairl4  At3g23830 At4g13850  (El), Ii, (E2) (El), Ii, (E2)  TGTAACGAAGAGAGCCAAGC CATTTCCTCTGCCTCTTTCT  CCCTAATTTCGCCATTCCCT AGCTTGGTAGACATCAACCG  Pairl5  At2g19620 At5g56750  (E5), 15, (E6) (E5), 15, (E6)  CCAAGGATTGTTTCTATGCCCT ATGTCATGCTTCCAAGGGTTA  AATACTTCAAGAATCTGGTCCGC GTTGAGAACTTCAAGGATCTG  Pairl6  At3g48440 At5g63260  (E2), 12, (E3) (E2), 12, (E3)  GAGAAAAGGAAGATGATGGTGGT GTAGGGAGAGAGTAAGGGAA  AGAGGAAGGCCGAGGAAGTTAA TCTGATAGGAAGGCCAAGGA  Pairl7  At1g76 140 At1g20380  (E6), 16, (E7) (E6), 16, (E7)  AGCTTTACTAGCTTTCTCACTCCTG GAGACCAACTGGTTGTTAGC  ATGCTTGCTAAGCACAATACGG TGGCAAGAGCACCAGATTTAT  Pairl8  At1g28330 At2g33830  (E3), 13, (E4) (E3), 13, (E4)  AAGCTCAAAGGAAGGAACATGTGG AAACAAAGTAAGGTGGCGGAAGA CTTCACACTTGACACAATTCTA AAGACACTGAAGACGCATCG  Pairl9  At2g25850  (Ell), Ill, E12, 112, (E13)  GCTCACGCTACGGACTTCAA  GAAACTTGCATTCAGACGGAT  Table 2. (Continued Locus ID  PCR target (partial)  At4g32850  (El 1), Iii, E12, 112, (El 3)  Pair2O  At3g05640 At5g27930  Pair2l  Forward Primer  Reverse Primer  CCTGCTGCAAATTCAGATCC  CTGTCCAACGCAACAATTTGA  (El), Ii, (E2) (El), Ii, (E2)  ATCTGTGGCTTCCTTAGCGT GATCGAGCTAATCCATTGAAC  TCTCCCTTGGATGGTTACGT TTCTCTCGTCGCTCCATTAG  At1g03457 At4g03 110  (E3), 13, (E4) (E3), 13, (E4)  GCTAGTTTGTAGAGACCCTC CTCGTI’TGTTGAGCACCTCT  CAAGTTAAGTATGCAGATGG GCAAGTAAAGTATGCAGATG  Pair22  At4g25500 At5g52040  (E2), 12, E3, 13, (E4) (E2), 12, E3, 13, (E4)  CCAGTCTTCTGTGGGAACTT GCCTGTCTTTTGCGGAAACT  TTCAACACGAAGTCTGCGTC TCCACTCAACACGGAGTCTG  Pair23  At1g16840 At1g78890  (El), Ii, (E2) (El), Ii, (E2)  GCTACACAAGCCTACAACAC TCAGTTGAGACGGAGATGAC  TTGATGGAGACCAAGACCGA GGTTTGCTTTACTCTACCTTAT  Pair24  At1g73650 At1g18180  (E9), 19, (El 0) (E8), 19, (E9)  CAAAGAGTGTTGTGAAGAACAA TGATTCTCTTACCGCGAGGA  TTCTGTTCCCAAGAGGAGTG CAATGCTTCTCTGGCTCTTC  Pair25  At1g48030 At3g 17240  (E2), 12, (E3) (E2), 12, (E3)  GTATAAAGGACAAATTGAAGGC CAGCTCATCTCATATCCACC  GAGGCTGTTCTTGCGATTAAC CGCAGGAGAATTGATCCATG  Pair26  At2g2 1940 At4g39540  (E9), 19, (El 0) (E9), 19, (El 0)  ACGTCTCTCGGCTATTTGGG CAAAAGAAGGGATCATCGACT  GCAATTTCAGTTGGTGTGAGA AGTTCCCTTCATAGCCTGCT  Pair27  Atlg70790 Atlg23 140  (El), Ii, (E2) (El), Ii, (E2)  GTTTGTTTTTGGAACTCCGC TGGTTACGACGACGAAAGGG  ATAAGGATCACTGGTGGTGG CAAAAGACAAGAGTCCGAGG  Pair28  At3g15980  (E24), 124, E25, 125, (E26)  CTAGGGATGTGGCGTAAGCA  CGGTCATGTAGAGAATGAAGG  Table 2. (Continued) Locus ID  PCR target (partial)  Forward Primer  Reverse Primer  Ati g52360  (E22), 122, E23, 123, (E24)  ATCTTTGGCTGATCCTGAGG  TACAGCTCCATCCGTAGAGT  Pair29  At2g25670 At4g326 10  (El), Ii, (E2) (El), Ii, (E2)  TAGGAGCCCAATAGACCTGA TGTTCCCTGCTCGTGATCTT  ATGATTTCTCATCTGGAACCC GGTCTGGAACCCTAGTAGTT  Pair3O  At1g52730 At3g15610  (El), Ii, (E2) (El), Ii, (E2)  CCACCCAATTCCTACGCTTT GGAAGAAACCATCAGGAGTG  GATGAGGAAGAAACCGTCAG CTGGAGCTGCAAAATCTTCC  Pair3l  At3g61600 At2g46260  (E6), 16, (E7) (E5), 15, (E6)  AGGGATGCAGGAGAAAGGGT TCTTGAAATGGGCAAGGGGA  CAAAGCCAAAAGAGTAAGGGT AACAGTCAGTGCAGGTCTGA  Pair32  At2g46610 At3g61860  (E2), 12, (E3) (E2), 12, (E3)  GTGGTATTGTCAGTCCTACG ACTGATAACCTGCGTTTCTC  TGTGTACGTTGGGAATTTCGA AGATAAAGATGAGGCCAGTG  Pair33  At4g35570 At2g17560  (E3), 13, (E4) (E3), 13, (E4)  GACGGATTTGTTGTCAGGGT GTCATTGCCTTCCATCTAGC  GAGGGAACAAAGTTGGAAAGA ATGAAAGGCGGCGAATCCAA  Pair34  At3g47550  CAACATGGATACACTGCACC  TATACCGATGGCCCATGCCA  CTTAACTTCCACCAGATAAATG  AGAGATGGGAACCGAGGTTT  At4gl 2430  (E4), 14, E5, 15, E6, 16, (E7) (E4), 14, E5, IS, E6, 16, (E7)  Pair35  At2g21660 At4g39260  (El), Ii, (E2) (El), Ii, (E2)  TTCCTCCGTAACCTCCTCCT ATCTTTGATTACCAGCCGCC  ATGGGCCACTGATGACAGAG GGGCCACCAATGATGAAGAT  Pair36  Atlgl9000 At1g74840  (E3), 13, (E4) (E3), 13, (E4)  CTCATAACAGTGTGTGTGACA AGTCCTATCTCCAAACTCTG  TTCAGCGATGGAGATAGCAAT CAACTTCTCTATACATCCGGT  Pair37  At3g45240  (El), Ii, (E2)  CTCCTATTTTCACTCTCCCG  TTTATCGAGGCTACGGGTTG  Table 2. (Continued) Locus ID  PCR target (partial)  At5g60550  (El), Ii, (E2)  Forward Primer  Reverse Primer  ATTAAGGCTAAGGGTGGCAC  TCCTATCTTCACTGTACCGC  GGGGAAGATCCTATTCTAAGA  AGTGTGGATAGGACTCTTGG  AGCCGTGGAAGATCCTATTC  TAGCTGTTTCACCAAGACCC  CCCGTTTGCTTAATGGATAATA AATTCTTCTCCAACTTTGCCC  GATGACAAGACCGATGAAGAT CCGGTTATCGACGAGGTTTT  At4g02430  (E10), 110, El 1, Ill, (El2) (E10), 110, Eli, Ill, (E 12)  Pair39  At4g22590 At4g 12430  (E8), 18, (E9) (El 0), 110, (Eli)  Pair4O  At3g02900 At5g16660  (El), Ii, (E2) (El), Ii, (E2)  CAATGGCGTCCTTGGTAGCA ACAGAAAACTTGCGAGTCCG  ACTGCGGTTTGATTTTGTTTG TTCAGTTCCAATGGCGTCGT  Pair4l  At5g4 1670 At1g64190  (El), Ii, (E2) (El), Ii, (E2)  CTCTCCAGATATCATCAACAG ATCAACTAACTCTCCATCACC  GCAAGTTTAGCGTATTTCGAC GGCCAAAACCTCGCCTTAAA  Pair42  At2g01180 Atlgl5O8O  (El), Ii, (E2) (El), Il, (E2)  GACACCAGTTATCAAGACGG TCCTTTGAAATCTCCCGGAG  CTTTCTGATGACAATAGGGTC GAAAGGAATTGTGTTGTCCTG  Pair43  At1gl5960 At1g80830  (ES), 15, E6, 16, (E7) (E5), 15, E6, 16, (E7)  GAGACCATAGAGGACTTCTT TAAGTTGGGGGCATTACAAA  AGCAGAGCATTGTAGAGCTG CTTTATGTTATGGGTCGTTGC  Pair44  At1g80910 At1g16020  (E9), 19, (ElO) (E9), 19, (ElO)  CGCTCGAAGCAAGAGAAAGA GCTTAGAGAAGAAGTGGATTC  GTTGTGGATACAAAAGTCACC TCCTCTCTGCAATTTCTCAC  Pair45  At1g79650 Atlgl6 190  (E3), 13, E4, 14, (E5) (E3), 13, E4, 14, (E5)  TGAGCAGGAATAGGTGAAGC GAAGAAGAATATTGAAGATTCAC  AGCCTGGTGGAGAACAAAGT GTTGTTCTTGAACGGGAGTA  Pair46  At1g19350 At1g75080  (El), Ii, (E2) (El), Il, (E2)  GTGGCTGGTTTAACTCAAAT CCAGCGAAGGAAAAGCGTAT  TCCGTCTTCTTCAACAACCC CCATCTTCTTCAACAACCCA  Pair38  At1g02840  Table 2. (Continued)  -  Locus ID  PCR target (partial)  Forward Primer  Reverse Primer  Pair47  At1g19400 At1g75 180  (El), Ii, (E2) (El), Ii, (E2)  CTCACTCCAAAAACTATTCGG GAGGCTCATCAGTTTCATAC  CCAGAITI’AGAGGATHGTGG CCTFCTTTCAATCTCTGCGG  Pair48  At1g78000 At1g22150  (E12), 112, (E13) (Eli), Iii, (E12)  CAAGTGGTATfCACGCATTAG CAAAGATGGTTGACAGATGAA  AGGGTCCAAAGAAATACAATC AGCAAGAATCCACGGCCTCA  Pair49  Atlg7O 100 At1g24160  (E6), 16, E7, 17, (E8) (E6), 16, E7, 17, (E8)  AGATGGCACGGAGAGAAAAG GGGTTCTATACACATACATAG  CTCCACAAACGTAATGACTTC AGCATGGAGAAGAGAAGTGG  Pair5O  At2g17320 At4g35360  (El), Il, (E2) (El), Ii, (E2)  AGCAGGAGCATCTGGAACAC GGTTCTCTCACCTCATTTTC  TCCTTATAGATTCCCTTCCG GGAAGAGACAACTAAGCAGA  Table 3. Gene Annotation, Position/Effect of AS and Expected/Observed AS Status in 50 Paleologs N/A means no evidence of AS from EST database, IR Intron Retention, ES Exon Skipping, AA- Alt Acceptor, AD Alt Donor, AP Alt Position PTC stands for Pre-termination Codon, UTR stands for Un-Translated Region means presence/absence of AS in at least one organ type or dev. stage -  Locus ID  -  -  Annotation  Expected AS Type IR and ES N/A  -  Obs. AS Normal  Obs. AS Stresses  Obs. AS Overall  PTC in skipped exon  +  +  +  +  +  +  +  +  +  +  + +  +  -  Longer protein Longer protein  +  +  +  -  +  +  + +  +  +  +  +  + +  + -  + +  AS position/effect  Pairl  At5g07370 At5g6 1760  IPK2cx IPK2  Pair2  At2g24420 At4g3 1340  DNA repair ATPase-related Similar to DNA repair ATPase-related  IR N/A  Alternative Stop  At4g30690 At2g24060  translation initiation factor 3 (IF-3) family protein translation initiation factor 3 (IF3) family protein  IR N/A  PTC in the middle  At2g43010 At3g59060  nuclear localized bHLIi protein Myc-related bHLH transcription factor  At5g55550 At4g26650  RNA recognition motif (RRM)-containing protein RNA recognition motif (RRM)-containing protein  IR N/A  5’UTR  At1g06390 At2g30980  GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1) identical to shaggy-related protein kinase delta (ASK-delta)  IR N/A  YUTR  At1g32230 At2g35510  RCD1 (RADICAL-INDUCED CELL DEATH1) SRO 1 ::Encodes a WWE domain-containing protein with 76% similarity to RCD1  Pair8  At3g09770 At5g03200  zinc ion binding protein binding zinc ion binding::zinc finger  Pair9  At5gl 8620  nucleic acid binding::DNA-dependent ATPase  Pair3  Pair4  Pair5  Pair6  Pair7  IR and AA AA  +  IR  PTC in the middle  +  +  +  ES  PTC in the middle  +  +  +  Alternative Stop  +  -  +  PTCat5’  +  +  +  IR N/A  -  AD and IR  Table 3. (Continued) Locus ID  PairlO  Pairli  Pairl2  Pairl3  Pairl4  PainS  Pairl6  Pairl7  Pairl8 00  Pair 19  Annotation  Expected AS Type IR  AS position/effect  At3g06400  ATP-dependent helicase  At4g23570 At4g11260  SGT1A SGT1B  IR N/A  3’ UTR  At1g50630 At3g20300  unknown protein unknown protein  IR N/A  alternative stop  At3g56400 At2g40750  WRKY7O WRKY 54  At5g10450  GRF6  At5g65430  GRF8  AA and IR AA and JR  At3g23830 At4g13850  similar to Glycine-rich RNA-binding protein 2 ATGRP2  AA and IR N/A  At2g19620 At5g56750  unknown protein::Ndr family protein unknown protein::Ndr family protein  IR N/A  PTC in the middle  At3g48440 At5g63260  nucleic acid binding::zinc finger (CCCH-type) family protein nucleic acid binding::zinc finger (CCCH-type) family protein  JR N/A  PTC  At1g76140 At1g20380  prolyl oligopeptidase prolyl oligopeptidase  IR N/A  PTC  At1g28330 At2g33830  DRM1 dormancy/auxin associated family protein  IR N/A  Alternative Stop  At2g25 850  nucleic acid binding  IR  alternative stop  IR IR  PTC at 5’  Obs. AS Normal  Obs. AS Stresses  Obs. AS Overall  -  +  +  +  +  +  -  -  -  +  +  +  -  PTC PTC  -  +  +  +  -  -  -  -  +  +  Alternative Stop  +  +  +  5’ UTR  +  +  +  -  -  +  +  +  +  +  +  +  +  +  -  +  +  +  +  +  -  +  +  +  +  +  -  -  -  +  +  +  Alternative Stop  -  Table 3. (Continued) Locus ID  Pair2O  Pair2l  Pair22  Pair23  Pair24  Pair2S  Pair26  Pair27  Pair28  •.  Pair29  Pair3O  Annotation  Expected AS Type JR  AS position/effect  At4g32850  nPAP  At3g05640 At5g27930  catalytic! protein phosphatase type 2C::protein phosphatase 2C catalytic! protein phosphatase type 2C  AD N/A  5’UTR  At1g03457 At4g031 10  RNA binding / nucleic acid binding::RNA-binding protein RNA binding / nucleic acid binding::RNA-binding protein  AA N/A  PTC in the middle  At4g25500 At5g52040  ATRSP4O ATRSP41  ES N/A  Alternative Start  At1g16840 At1g78890  unknown protein: :expressed protein unknown protein::expressed protein  AA N/A  alternative stop  At1g73650 At1g18180  unknown protein::expressed protein unknown protein::expressed protein  IR N/A  alternative stop  At1g48030 At3gl 7240  lipoamide dehydrogenase 1 (MTLPD1), LPD2 (LIPOAMIDE DEHYDROGENASE 2)  IR N/A  YUTR  At2g21940 At4g39540  ATP binding! shikimate kinase ATP binding! shikimate kinase  At1g70790 At1g23 140  unknown protein::C2 domain-containing protein unknown protein::C2 domain-containing protein  At3gl 5980 At1g52360  Obs. AS Normal  Obs. AS Stresses  -  -  + -  +  N.E  Obs. AS Overall  + -  +  +  +  -  -  -  +  +  + -  +  N.E  -  +  +  +  +  +  +  +  -  -  -  -  +  +  +  -  +  +  Alternative Stop Alternative Stop  +  +  +  -  +  +  IR N/A  5’UTR  +  -  +  protein transporter::coatomer protein complex protein transporter: :coatomer protein complex  JR N/A  Alternative stop  At2g25670 At4g32610  unknown protein unknown protein::mitochondrial glycoprotein family protein  IR N/A  5’UTR  At1g52730  WD-40 repeat family protein  IR  5’UTR  IR IR  -  +  +  -  -  +  +  +  +  -  -  -  +  +  +  +  Table 3. (Continue Locus ID  Annotation  Obs. AS Normal  Ohs. AS Stresses  Ohs. AS Overall  -  -  -  Alternative Stop  +  +  +  alternative start Longer protein  +  +  +  +  +  ±  -  -  +  + +  +  +  +  PTC in the middle  +  N/A  +  PTC in the middle  +  N/A  +  IR IR  3’UTR 3’UTR  +  +  +  AD N/A  5’UTR  +  -  +  -  +  +  Expected AS Type N/A  AS position/effect  At3gl 5610  WD-40 repeat family protein  Pair3 1  At3g6 1600 At2g46260  ATPOB 1 protein binding::BTB/POZ domain-containing protein  Pair32  At2g46610 At3g6 1860  ATRSP3 la ATRSP31  At4g3 5570 At2gl 7560  HMGB5 (HIGH MOBILITY GROUP B 5) HMGB4 (HIGH MOBILITY GROUP B 4)  IR N/A  PTC in the middle  At3g47550 At4gl 2430  ubiquitin-protein ligase trehalose-phosphatase::trehalose-6-phosphate phosphatase  IR N/A  Alternative Stop  At2g2l660  ATGRP7  At4g39260  ATGRP8  Pair36  Atlgl9000 At1g74840  myb family transcription factor myb family transcription factor  Pair37  At3g45240 At5g60550  ATP binding / kinase ATP binding / kinase  At1g02840  SRi  At4g02430  SRp34b  At4g22590 At4gl 2430  trehalose-6-phosphate phosphatase trehalose-6-phosphate phosphatase  Pair33  Pair34  Pair35  Pair38  Pair39  IR N/A AA and IR • AA  AD and IR AD and IR  -  AA IR and AA  Alternative stop  +  +  +  Alternative stop  +  +  +  IR N/A  Alternative stop  +  + +  + +  Table 3. (Continued) Locus ID  Pair4O  Annotation  Expected AS Type AA N/A  AS position/effect  Obs. AS Normal  Obs. AS Stresses  Obs. AS Overall  Longer protein  +  +  +  -  +  +  +  +  +  -  -  -  +  +  +  -  +  +  +  +  +  -  +  +  +  +  +  -  +  +  At3g02900 At5g16660  unknown protein::expressed protein unknown protein::expressed protein  At5g41 670 At1g64 190  phosphogluconate clehydrogenase (decarboxylating) phosphogluconate dehycirogenase  IR N/A  3’UTR  At2gOl 180 At1g15080  ATPAP1 ATPAP2  IR N/A  Alternatvie start  At1g15960 At1g80830  NRAMP6 NRAMP1  IR, AD N/A  PTC in middle  At1g8091 0 At1g16020  unknown protein::expressed protein unknown protein::expressed protein  IR N/A  alternative stop  At1g79650 At1g16190  RAD23 DNA repair protein RAD23  AP N/A  Longer Protein  Pair46  At1g19350 At1g75080  BES1 (BRI1-EMS-SUPPRESSOR 1) BZR1 (BRASSINAZOLE-RESISTANT 1)  IR, AA N/A  Alternative start  Pair47  At1g19400 At1g75180  unknown protein::expressed protein unknown protein::expressed protein  At1g78000 At1g22150  SULTR1;2 SULTR1;3  Atlg7OlOO At1g24160 At2g17320 At4g35360  Pair4l  Pair42  Pair43  Pair44  Pair45  Pair48  Pair49  -  +  +  +  +  +  +  5’UTR 5’UTR  +  +  +  -  +  +  IR N/A  Alternative Stop  +  +  +  -  +  +  unknown protein::expressed protein unknown protein::expressed protein  IR N/A  Alternative Stop  +  +  +  -  +  +  pantothenate kinase-related pantothenate kinase  IR N/A  PTC at beginning  + +  + +  JR IR  +  “I  Pair5O  + -  Table 4. Alternative Splicing in Paleologs by Organs and Developmental Stages N/A means no evidence of AS from EST database, IR - Intron Retention, ES - Exon Skipping, AA- Alt Acceptor, AD Alt Donor, AP - Alt Position “+“/“-“ means presence/absence of AS in at least one organ type or dev. stage Letters indicate the presence of expected bands (shown on Column 3) -  Locus ID  Expected Size (bp)  Expected AS  Flower  Siligue  Leaf  Stem  Rosette  Root  7-d Seedling  14-d Seeding  AS or not  At5g07370 At5g61760  527(I), 232(E), 145(N) 691(I), 177(N)  IR and ES N/A  E, N X  E, N N  E, N N  E, N N  E, N N  N N  E, N N  E, N N  +  At2g24420 At4g3 1340  228(I), 137(N) 700 (I), 438 (N)  IR N/A  I X  I, N N  I I, N  I, N I, N  I, N I, N  I, N I, N  I, N I, N  1, N I, N  +  At4g30690 At2g24060  311(I), 207(N) 323(I), 226(N)  IR N/A  I, N N  X N  I, N N  I, N N  I, N N  I, N N  1, N N  I, N N  +  Pair4  At2g43010 At3g59060  458(I), 320(Al), 316(A2) 348(I), 271(Al), 265(A2)  IR and AA AA  X Al  Al Al  Al Al  Al Al  I, Al Al  A2 Al  I, Al Al  Al Al  +  PairS  At5g55550 At4g26650  394(I), 3 14(N) 416(I), 235(N)  IR N/A  N N  I, N I, N  N N  I, N N  N N  N I, N  I, N N  N I, N  +  At1g06390 At2g30980  295(I) vs 149(N) 345(I) vs 199(N)  IR N/A  I, N I  I, N I  I, N I  I, N I  I, N I, N  I, N I  I, N I  I, N I  +  At1g32230 At2g35510  597(I) vs 182(N) 1079(I) vs 663(E) vs 318(N)  IR ES  N E, N  I, N E, N  N E, N  N E, N  N E, N  N E, N  N E, N  N E, N  +  At3g09770 At5g03200  446(I) vs 290(N) 400(N)  IR N/A  N N  I N  I, N N  I, N N  I N  I, N X  I, N N  I N  +  At5g18620 At3g06400  465(I) vs 346(Dl) vs 337(D2) 512(I)vs418(N)  AD and IR IR  1, Dl N  I, Dl N  Dl X  Dl X  I, Dl N  I, Dl N  I, Dl N  I, Dl N  +  At4g23570 At4gl 1260  326(I) vs 242(N) 230(N)  IR N/A  I, N N  I, N N  I, N N  I, N N  I, N N  I, N N  I, N N  1, N N  +  Pair 1  Pair2  Pair3  Pair6  Pair7  Pair8  Pair9  PairlO  -  +  -  +  +  +  -  -  -  Table 4. (Continued) Locus ID  Expected Size (bp)  Expected AS  Flower  Siligue  Leaf  Stem  Rosette  Root  7-d Seedling  14-d Seeding  AS or not  At1g50630 At3g20300  439(I) vs 355(N) 425(1) vs 332(N)  JR N/A  I,N X  1,N N  N.D N  I,N N  1,N X.  I,N X  I,N  +  x  I,N N  Pairl2  At3g56400 At2g40750  564(1) vs 307(N) 917(I) vs 429(N)  IR IR  I,N X  I,N N  I,N N  N X  N N  I,N N  I, N N  I,N N  +  Pairl3  At5g10450 At5g65430  1196(I) vs 398(A1) vs 392(A2) 1111(1) vs 425(A1) vs 419(A2)  AA and IR AA and IR  Al A1,A2  Al Al,A2  Al A1,A2  Al A1,A2  Al Al,A2  Al Al,A2  Al Al,A2  Al A1,A2  Pairl4  At3g23830 At4g13850  429(I) vs 147(Al) vs 135(A2) 464(I) vs 171(N)  AAandIR N/A  A1,A2 N  Al,A2 N  Al,A2 N  Al,A2 N  Al,A2 N  A1,A2 N  A1,A2 N  Al,A2 N  +  Pairl5  At2g19620 At5g56750  268(I) vs 161(N) 267(I) vs 177(N)  IR N/A  I, N I, N  I,N N  I,N N  I,N •N  I,N N  I,N N  I,N N  I,N N  +  At3g48440 At5g63260  328(I) vs 159(N) 643(I) vs 178(N)  JR N/A  I,N X  I,N N  1,N X  I,N N  N N  I,N N  I,N N  N N  +  Pairl7  At1g76 140 At1g20380  384(I) vs 294(N) 616(I) vs 527(N)  IR N/A  I, N N  N N  I,N N  I,N N  N N  N X  N N  N N  +  Pairl8  At1g28330 At2g33830  377(I)vs215(N) 772(I) vs 580(N)  IR N/A  N I  I,N I  N  N I  N I  N X  N X  N I  +  x  At2g25850 At4g32850  627(11) vs 250(12) vs 136(N) 734(11) vs 428(12) vs 202(N)  IR IR  12,N 12,N  12,N 12,N  12,N 12,N  12,N 12,N  12,N 12,N  12,N 12,N  x  +  12, N  12, N 12, N  At3g05640 At5g27930  870(I) vs 287(D1) vs 246(D2) 939(I) vs 197(N)  AD N/A  N.D N  D2, Dl X  D2, Dl X  D2, Dl N  D2, Dl N  N.D N  D2 N  D2,D1 N  +  Atlg03457 At4g03 110  297(I) vs 185(A1) vs 158(A2) 246(I) vs 159(N)  AA N/A  A2,A1 N  A2,A1 N  A2,A1 N  A2,A1 N  A2 N  A2,A1 N  A2,A1 N  A2, Al N  +  Pairil  Pairl6  Pairl9  Pair2O  Pair2l  +  +  -  —  -  Table 4. (Continued) Stem  Rosette  Root  7-d Seedling  14-d Seeding  AS or not  E, N N  E N  N.D N  E N  I, E, N N  +  A1,A2 N  X N  A1,A2 N  A1,A2 N  X N  A1,A2 N  +  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  +  Al N  Al N  Al N  X N  I,A1 N  Al X  I,Al N  I,Al N  +  IR IR  N N  N,I N  N,I N  N,I N  N N  X X  N N  N,I N  +  348(I) vs 135(N) 123(N)  IR N/A  N N  N N  N N  N N  N N  X X  N N  N N  +  At3g15980 At1g52360  482(11) vs 236(12) vs 139(N) 621(11) vs 519(12) vs 355(N)  IR N/A  12 N  12,N N  12,N N  X N  12 X  X X  X N  12,N N  +  Pair29  At2g25670 At4g3261 0  459(I) vs 35 1(N) 1054(I) vs 653(N)  IR N/A  I,N X  1,N I  X X  I,N I  I,N I  X X  I,N I  I,N  +  Pair3O  At1g52730 At3gl 5610  411(I) vs 226(N) 368(N)  IR N/A  I,N N  I,N N  I N  I,N N  I,N N  X X  I,N N  I,N N  +  Pair3l  At3g61600 At2g46260  467(I) vs 35 1(N) 736(N)  JR N/A  I,N N  I,N X  I,N N  I,N X  I,N N  X X  I,N N  I,N N  +  Pair32  At2g46610 At3g61860  875(I) vs 726(A1) vs 170(A2) 1011(I) vs 726(A1) vs 213(A2)  AAandIR  A2  A1,A2  A2 A2  I, Al, A2 Al, A2  A2 A2  A2 Al, A2  X A2  A2 A2  A2 A2  +  AA  Locus ID  Expected Size (bp)  Expected AS  Flower  Siligue  Pair22  At4g25500 At5g52040  985(I) vs 203(N) vs 300(E) 1108(I) vs 208(N)  ES N/A  E, N N  E N  Leaf  E, N N  Pair23  At1g16840 At1g78890  367(I) vs 242(A1) vs 235(A2) 431(I) vs 191(N)  AA N/A  A1,A2 N  X N  Pair24  At1g73 650 Atlgl8 180  296(I) vs 189(N) 250(N)  JR N/A  I,N N  Pair2S  At1g48030 At3g17240  350(I) vs 250(Al) vs 246(A2) 369(I) vs 272(N)  IR N/A  Pair26  At2g21940 At4g39540  227(I) vs 128(N) 660(I) vs 273(N)  Pair27  At1g70790 At1g23 140  Pair28  -  -  +  Table 4. (Continued) Locus ID  Expected Size (bp)  Expected AS  Flower  Siligue  Leaf  Stem  Rosette  Root  7-d Seedling  14-d Seeding  AS or not  Pair33  At4g35570 At2g17560  227(I) vs 127(N) 508(I)vs233(N)  IR N/A  I, N N  I N  I,N X  I,N X  I N  I N  I N  I N  +  Pair34  At3g47550 At4g12430  655(I) vs 362(N) 366(I) vs 284(N)  IR N/A  N 1,1  N 1,1  X 1,1  N 1,1  N X  N X  N 1,1  N  x  +  At2g21660 At4g39260  769(I) vs 460(D 1) vs 409(D2) 757(I) vs 474(D1) vs 243(D2)  AD and IR AD and IR  X D2, Dl  D2, Dl D2, Dl  Dl Dl  Dl Dl  Dl Dl  Dl D2, Dl  Dl Dl  I, D2, Dl D2, Dl  +  Pair36  Atlgl9000 At1g74840  357(1) vs 189(N) 385(I) vs 330(N)  IR IR  I,N N  I,N N  I,N N  I,N N  I,N X  I,N X  I,N N  I,N N  +  Pair37  At3g45240 At5g60550  441(I) vs 340(D1) vs 303(D2) 615(I) vs 335(N)  AD N/A  D2 N  D2 N  Dl N  Dl N  Dl N  X X  Dl N  Dl N  +  Pair38  At1g02840 At4g02430  1191(I) vs 730(Al) vs 277(A2) 910(I) vs 532(A1) vs 512(A2)  AA IR and AA  A2 Al  A1,A2 I,Al  A1,A2 I,A1  A1,A2 I,Al  A1,A2 I,A1  A1,A2 Al  Al, A2 1,A1  Al, A2 Al  +  At4g22590 At4g12430  413(I) vs 314(N) 907(1) vs 480(N)  IR N/A  I,N N  I,N N  N N  X N  I,N N  N X  I,N N  I,N N  +  Pair4O  At3g02900 At5g16660  545(I) vs 124(A1) vs 1 77(A2) 586(I) vs N(N)  AA N/A  Al N  A2,A1 N  A2,Al N  A2,Al N  Al N  Al N  Al N  Al N  +  Pair4l  At5g41670 At1g64 190  3 80(I) vs 300(N) 719(N)  IR N/A  X N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  +  Pair42  At2g01180 At1g15080  807(I) vs 417(N) 617(I) vs 368(N)  IR N/A  X X  X X  N N  N N  N N  X X  I,N N  N N  +  Pair43  At1g15960 At1g80830  514(I) vs 352(D1) vs 318(D2) 783(I) vs 532(N)  IR and AD N/A  Dl,D2 X  Dl,D2 N  D1,D2 N  Dl,D2 N  D1,D2 N  X X  Dl,D2 N  D1,D2 N  +  Pair3S  Pair39  +  +  -  dl  ‘-‘i  Table 4. (Continued Locus ID  Expected Size (bp)  Expected AS  Flower  Siligue  Leaf  Stem  Rosette  Root  7-d Seedling  14-d Seeding  AS or not  Pair44  At1g8091 0 At1g16020  429(I) vs 334(N) 444(I) vs 359(N)  JR N/A  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  +  Pair4S  At1g79650 At1g16190  579(1) vs 202(P 1) vs 1 84(P2) 769(I) vs N(N)  AP N/A  I,P1,P2 N  P1,P2 N  P1,P2 N  P1,P2 N  P1,P2 N  I N  P1,P2 N  I,P1,P2 N  +  Pair46  At1g19350 At1g75080  470(1) vs 381(A1) vs 375(A2) 397(N)  IR and AA N/A  I N  I N  I, A2 N  I, A2 N  I, A2 N  I X  I, A2 N  I, A2 N  +  Pair47  At1g19400 At1g75180  494(I) vs 113(N) 1021(I) vs 883(N)  IR IR  X N  X X  I,N N  I,N N  I,N N  X X  I,N N  I,N N  +  Pair48  At1g78000 At1g22150  433(I)vs321(N) 456(I) vs 276(N)  IR N/A  N N  N X  N X  I,N N  I,N I,N  I,N N  I,N N.D.  I,N I,N  +  Pair49  At1g70100 At1g24160  596(I) vs 520(N) 731(I)vs473(N)  IR N/A  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  I,N N  +  Pair5O  At2gl 7320 At4g35360  447(I) vs 13 5(N) 1343(I)vs580(N)  IR N/A  I,N X  I,N N  N N  N N  I,N N  N X  N N  N N  + -  Table 5. Alternative Splicing in Paleologs by Organs after Stress Treatments N/A means no evidence of AS from EST database, IR - Intron Retention ES - EXon Skipping, AA- Alt Acceptor, AD - Alt Donor, AP - Alt Position +“/“-“ means presence/absence of AS in at least one organ type or dev. stage Effect of Stress: Gain- gain of AS in at least 1 organ; Loss loss of AS in at least Gene EXpected EXpected Size At5g07370 527(I) IR and ES vs 232(E) vs 145(N) Pain Cold Heat Dry At5g61760 691(I)vs177(N) N/A Cold Heat Dry -  Pair2 Cold Heat Dry  At2g24420  At4g3 1340  IR  N/A  228(I) vs 137(N)  700(I) vs 438(N)  Cold Heat Dry Pair3 Cold Heat Dry  At4g30690  At2g24060 Cold Heat Dry  IR  N/A  31 1(I) vs 207(N)  497(I) vs 226(N)  1 organ; Change - Some gain/loss or switch of AS form Flower ue Stem Stress_Effect Rosette Root E, N E, N E, N E, N E, N X X I X ND Not Expressed X X I I,N I Change I,N I,N ND X I,N Change X X N N N X N X X ND No Change X I ND N X No Change N X ND X X No Change I,N N I I,N X N N N  I I,N I ND N N N ND  I ND I I,N I,N ND ND N  I,N 1,N I X I,N N N N  I,N N I I,N I,N N I,N N  I, N I,N I,N I,N N I,N I,N I,N  X I,N N ND N I,N N ND  I, N ND I,N I,N N ND ND N  I,N I,N I,N I,N N I,N I,N I,N  I,N I,N  Change Loss Gain Loss Loss Loss  x x  No Change No Change No Change  N I,N I,N N  Gain Gain Gain  Table 5. (Continued Gene  Pair4  At2g43010  EXpected  EXpected Size  JR and AA  Flower  Siligue  Stem  Rosette  Root  458(I) vs 320(Dl) vs 316(D2)  X  Dl  Dl  I, Dl  D2  348(I) vs 271(A1) vs 265(A2)  X X D2 Al Al Al Al  X X ND Al Al I ND  ND D1,D2 D2 Al ND ND X  Dl D1,D2 D2 Al Al Al Al  X X X Al X Al X  N X I,N I,N N X N N  I,N I,N X ND N N N ND  I,N ND I,N I,N N ND ND N  N I,N I,N I,N N N N N  N I,N I I,N N N N N  I,N I I I I I I I  I,N I I ND I I I ND  I,N ND I I I ND ND I  I,N I I I I,N I I I  J,N I I,N I I I I I  Cold Heat Dry At3g59060  AA  Cold Heat Dry Pair5 Cold Heat Dry  At5g55550  At4g26650  JR  N/A  394(I) vs 314(N)  416(I) vs 235(N)  Cold Heat Dry Pair6 Cold Heat Dry  At1g06390  At2g3 0980 Cold Heat Dry 00  IR  N/A  295(I) vs 149(N)  345(I) vs 199(N)  Stress Effect  Not Expressed Change Change NoChange Change No Change  Gain Gain Gain No Change No Change No Change  Loss Loss Loss Loss Loss Loss  Table 5. (Continued Pair7 Cold Heat Dry  Gene At1g32230  At2g35510  EXpected IR  ES  EXpected Size 597(I) vs 182(N)  1079(I)vs663(E)vs318(N)  Cold Heat Dry Pair8 Cold Heat Dry  At3g09770  At5g03200  IR  N/A  446(I) vs 290(N)  400(N)  Cold Heat Dry  Pair9 Cold Heat Dry  At5g18620  At3g06400  AD and IR  IR  465(I) vs 346(D1) vs 337(D2)  512(I)vs418(N)  Cold Heat Dry Pair 10 Cold Heat Dry  At4g23 570  IR  326(I) vs 242(N)  Flower N N I, N I,N E,N X E, N E, N  Siligue I, N 1, N N ND E,N E, N N ND  Stem N ND N N E,N ND ND E, N  Rosette N I, N N N E,N E, N E, N E, N  Root N I, N N N E,N E, N E, N E, N  N X X I N X N N  I I I ND N N N ND  I, N ND I I N ND ND N  I I I I N N N N  I, N I I I X N N N  I, Dl Dl Dl, D2 X N X N N  I, Dl Dl Dl ND N N N ND  Dl ND X I, Dl X ND ND N  I, Dl Dl Dl X N N N N  I, Dl Dl Dl I, Dl N N N N  No Change No Change No Change  1, N X I I  I, N N X ND  I, N ND I I  I, N I, N X X  I, N X I, N I  Loss Loss Loss  Stress Effect  Gain Change Gain No Change Loss No Change  Loss Loss Loss No Change No Change No Change  Loss Loss Gain  Table 5. (Continued) Gene At4gl 1260  EXpected N/A  EXpected Size 23 0(N)  Cold Heat Dry Pair!! Cold Heat Dry  At!g50630  At3g20300  JR  N/A  439(I) vs 355(N)  425(I) vs 332(N)  Cold Heat Dry Pair!2 Cold Heat Dry  At3g56400  At2g40750  IR  IR  564(I) vs 307(N)  9 17(I) vs 429(N)  Cold Heat Dry  Pairl3 Cold Heat Dry  At5g!0450  At5g65430 Cold Heat Dry  AA and JR  AA and JR  1196(I) vs 398(D1) vs 392(D2)  1111(I) vs 419(D1) vs 425(D2)  Flower N X X N  Silique N N N ND  Stem N ND ND N  Rosette N N N N  Root N N N N  No Change No Change No Change  I,N N I,N I,N X N N N  I,N I,N N ND N N X ND  I,N ND I,N I,N N ND ND N  I,N I, N I,N I,N  I,N I, N I,N I,N  No Change Loss No Change  x  x  N N N  N N N  I, N N I,N N X X N N  I, N N I,N ND N X X ND  N ND N N X ND ND N  N N N N N N N X  N N N N N N N N  Dl Dl Dl Dl  Dl Dl Dl ND  Dl ND X Dl  Dl Dl Dl X  Dl Dl Dl Dl  No Change No Change No Change  D1,D2 Dl D1,D2 D1,D2  D1,D2 Dl D1,D2 ND  D1,D2 ND ND D1,D2  D1,D2 Dl D1,D2 Dl,D2  D1,D2 Dl D1,D2 D1,D2  Loss NoChange No Change  Stress Effect  No Change No Change No Change  Loss No Change Loss No Change No Change No Change  Table 5. (Continued) Gene  Pairl4 Cold Heat Dry  At3g23830  At4g13850  EXpected AA and JR  N/A  EXpected Size  Flower  Siligue  Stem  Rosette  Root  429(I) vs 147(A1) vs 135(A2)  Al, A2 A2 Al,A2 Al, A2 N N N N  Al, A2 A2 Al,A2 ND N N N ND  Al, A2 ND Al,A2 Al, A2 N ND ND N  Al, A2 A2 Al,A2 Al, A2 N N N X  Al, A2 A2 Al,A2 Al, A2 N N N N  I, N X N N I, N N I, N N  I, N I, N X ND N N N ND  I, N ND X I,N N ND ND N  I, N I, N I, N N N N N N  I, N X I, N N N N I, N N  328(I) vs 159(N)  I, N  I, N  I, N  N  N  643(I) vs 178(N)  X I, N I, N X X I I, N  X I, N ND N I X ND  X I, N I, N N ND ND I  X I, N X N I I I  X I, N I, N N X I I  I, N I N X  N I X ND  N ND N N  N I I, N N  N I N N  464(1)vsl7l(N)  Cold Heat Dry PainS Cold Heat Dry  At2g19620  At5g56750  IR  N/A  268(I) vs 161(N)  267(I) vs 177(N)  Cold Heat Dry Pairl6  At3g48440  IR  Cold Heat Dry At5g63260  N/A  Cold Heat Dry Pairl7 Cold Heat Dry  At1g76 140  IR  384(I) vs 294(N)  Stress Effect  Loss NoChange No Change No Change No Change No Change  No Change Loss Loss Loss Gain Loss  Not Expressed Gain Gain Change Change Change  Change Change No Change  Table 5. (Continued Gene At1g20380  EXpected N/A  EXpected Size 616(I) vs 527(N)  Cold Heat Dry Pairl8 Cold Heat Dry  At1g28330  At2g33830  IR  N/A  377(I)vs215(N)  772(I) vs 580N  Cold Heat Dry Pairl9 Cold  At2g25850  IR  627(11) vs 250(12) vs 136(N)  Heat Dry At4g32850  IR  734(11) vs 428(12) vs 202(N)  Cold Heat Dry Pair2O Cold Heat Dry  At3g05640  AD  870(I) vs 287(D1) vs 246(D2)  Flower N X X X  Siligue N N X ND  Stem N ND ND X  Rosette N I, N I N  Root X I I, N I,N  Gain Gain Gain  N N I, N I,N I X X N  I,N N I, N ND I N X ND  N ND I, N N I ND ND N  N N I, N N I N X X  N N N N  Loss Gain Gain  N N N  Change Change Change  12,N N  12,N X Ii, 12, N  12,N 12, N Ii, 12, N Ii, 12, N 12, N N N N  12,N 12, N  Loss  12, N  Gain  12,N 12, N N N N  Gain  D2 Dl, D2 D1,D2 Dl, D2  D2 D2 D1,D2 Dl, D2  X Ii, 12, N 12, N X N N  ND 12, N N N ND  12,N ND Ii, 12, N Ii, 12, N 12, N ND ND N  D2 X D1,D2 Dl, D2  Dl, D2 Dl, D2 X ND  Dl, D2 ND D1,D2 Dl, D2  Stress Effect  Loss Loss Loss  Gain Gain Gain  Table 5. (Continued) Gene At5g27930  EXpected N/A  EXpected Size 939(I) vs 197(N)  Flower N  Siligue X  Stem N  Rosette N  Root N  Cold  X  X  ND  X  X  Heat  X  X  ND  X  X  Dry  X  ND  X  X  X  Al,A2 I  Al,A2 X  Al,A2 ND  A2  Al,A2  Pair2l Cold  At1g03457  AA  297(I) vs 185(A1) vs 158(A2)  Heat Dry At4g03110  N/A  246(I) vs 159(N)  Cold Heat Dry Pair22 Cold Heat Dry  At4g25500  At5g52040  ES  N/A  985(I) vs 203(N) vs 300(E)  1108(I) vs 208(N)  Cold Heat Dry Pair23 Cold Heat Dry  At1g16840  AA  367(I) vs 242(Al) vs 235(A2)  Stress Effect Not Expressed Not Expressed Not Expressed  Change  A2 Al,A2 N N N N  X ND N N N ND  Al,A2 Al,A2 N ND ND N  I,Al, A2 A2 N N N N  E,N N N N N I I I  E N N ND N I I I  E,N ND N N N ND ND I  E N N N N I I I  X N N N N I I I  A2 Al I,Al, A2 Al,A2  Al,A2 Al I,Al, A2 ND  Al,A2 ND I,Al, A2 Al,A2  Al,A2 Al I,Al, A2 Al,A2  Al,A2 Al  Loss  Al,A2 Al, A2  Gain No Change  Al,A2 A1,A2 N N N N  Change No Change NoChange NoChange NoChange  Loss Loss Loss  Change Change Change  Table 5. (Continued) Gene At1g78890  EXpected N/A  EXpected Size 431(I)vsl9l(N)  Cold Heat  Flower N I I  Siligue N I I  Stem N ND ND  Rosette N I I  Root N I I  Dry  X  ND  X  X  X  I, N N 1, N I, N N X X N  I, N N I, N ND N X X ND  I, N ND 1, N I, N N ND ND N  I, N N I, N I, N N N N N  I, N N I, N N N N N N  Al I, Al I,Al, A2 I, Al, A2 N X I N  Al I, Al I,Al, A2 ND N I I ND  X ND I,Al, A2 I, Al, A2 N ND ND I  I, Al I, Al I,Al, A2 I, Al, A2 N I, N N I  Al I, Al I,Al, A2 I, Al, A2 X I, N N X  N X X N  I, N I, N X ND  I, N ND I, N N  N I, N I, N N  X I, N I, N I,N  Pair24 Cold Heat Dry  At1g73650  At1g18180  IR  N/A  296(1) vs 189(N)  250(N)  Cold Heat Dry Pair25 Cold  At1g48030  IR  350(I) vs 250(A1) vs 246(A2)  Heat Dry At3g17240  N/A  369(I) vs 272(N)  Cold Heat Dry Pair26 Cold Heat Dry  At2g2 1940  IR  227(I) vs 128(N)  Stress Effect Change Change Not Expressed  Loss No Change Loss No Change No Change No Change  Gain Gain Gain Gain Change Change  Gain Gain Loss  Table 5. (Continued) Gene At4g39540  EXpected IR  EXpected Size 660(I) vs 273(N)  Cold Heat Dry Pair27 Cold Heat Dry  At1g70790  At1g23140  IR  N/A  348(I) vs 135(N)  123(N)  Cold Heat Dry Pair28 Cold Heat Dry  At3g15980  At1g52360  JR  N/A  482(11) vs 236(12) vs 139(N)  621(11) vs 519(12) vs 355(N)  Cold Heat Dry Pair29 Cold Heat Dry  At2g25670  At4g32610 ,  Cold Heat Dry  IR  N/A  459(I) vs 35 1(N)  1054(I) vs 653(N)  Flower N N N N  Siligue N N N ND  Stem N ND ND X  Rosette N N N N  Root X N N N  I, N N N N N N N N  1, N N N ND N N N ND  I ND N N N ND ND N  I,N N N X N N N N  X N N N X N N N  No Change No Change No Change  12 12 11,12 11,12 N N N N  12,N 12 12 ND N N N ND  X ND 12 12 N ND ND N  12 Ii, 12 12 12  X 11, 12 12 12  Change Change Change  x  x  N X N  N N N  I,N I,N I,N I,N  I,N I,N N ND I N N ND  1,N ND I,N I,N I ND ND N  1,N I, N I,N N I N N N  X I, N N N X N N N  x N N N  Stress Effect  No Change No Change No Change  Loss Loss Loss  No Change No Change No Change  No Change No Change Loss Change Change Change  Table 5. (Continued) Pair3O Cold Heat Dry  Gene At1g52730  At3g15610  EXpected IR  N/A  EXpected Size 411(I) vs 226(N)  368(N)  Cold Heat Dry Pair3l Cold Heat Dry  At3g61600  At2g46260  IR  N/A  467(I) vs 35 1(N)  736(N)  Cold Heat Dry Pair32 Cold Heat Dry  At2g46610  At3g61860  IR  N/A  875(I) vs 170(N)  1011(I) vs 726(A1) vs 213(A2)  Cold Heat Dry  °  Pair33 Cold Heat Dry  At4g35570  IR  227(I) vs 127(N)  Flower N X X I, N N N X X  Siligue I, N I, N X ND N N X ND  Stem I, N ND I, N I, N N ND ND N  Rosette I, N I, N I, N I, N N N N N  Root X I, N I I, N X N N X  1, N 1, N I, N I, N N N N N  I, N I, N I, N ND X N X ND  I, N ND I, N I, N X ND ND N  I, N I, N I, N I, N N N N N  X I, N I, N X X N N N  N N N N A1,A2 A2 A2 A1,A2  N N N ND A2 A2 A2 ND  N ND N N A2 ND ND A1,A2  N N N N Al,A2 A2 A1,A2 A1,A2  X N N N A2 A2 A1,A2 A1,A2  I, N N N N  I N N ND  I ND N N  I N N N  I N N N  Stress Effect No Change No Change Gain  No Change No Change No Change  No Change No Change No Change No Change No Change NoChange  No Change No Change NoChange No Change Gain Gain  Change Change Change  Table 5. (Continued) Gene At2g17560  EXpected N/A  EXpected Size 508(I) vs 233(N)  Cold Heat Dry  Pair34 Cold Heat Dry  At3g47550  At4g12430  AD and IR  AD and IR  655(I) vs 362(N)  366(I) vs 284(N)  Cold Heat Dry  Pair3S Cold Heat Dry  Sifigue N N I,N ND  Stem X ND ND X  Rosette N N N N  Root N N N N  NoChange Gain NoChange  N X N N  N N X ND  N ND X N  N N N N  N N N N  No Change NoChange NoChange  I, N I,N l,N N  I, N I,N I,N ND  I, N ND ND I,N  X I,N I,N I,N  X I,N I,N I,N  NoChange NoChange Loss  At2g21660  AD and JR  769(I) vs 460(D1) vs 409(D2)  X ND ND ND  D2, Dl ND ND ND  D2 ND ND ND  D2 ND ND ND  D2 ND ND ND  At4g39260  AD and IR  757(1) vs 632(Dl) vs 354(D2)  D2, Dl ND ND ND  D2, Dl ND ND ND  D2 ND ND ND  D2 ND ND ND  DI ND ND ND  Atlgl9000  IR  357(I)vs 189(N)  I,N I I I,N  I,N I,N I,N ND  I,N ND I,N 1,N  I,N I,N I,N I,N  I,N I,N I,N I,N  Cold Heat Dry Pair36 Cold Heat Dry  Flower N N N N  Stress Effect  Loss Loss NoChange  Table 5. (Continued) Gene At1g74840  EXpected ER  EXpected Size 385(I)vs330(N)  Cold Heat Dry Pair37 Cold Heat Dry  At3g45240  At5g60550  AD  N/A  656(I) vs 355(D1) vs 330(D2)  6l5(I)vs335(N)  Cold Heat Dry Pair38 Cold Heat Dry  At1g02840  At4g02430  AA  ER and AA  1191(I) vs 730(A1) vs 277(A2)  910(I) vs 532(Al) vs 512(A2)  Cold Heat Dry Pa1r39 Cold Heat Dry  At4g22590  At4gl2430 °°  Cold Heat Dry  ER  N/A  4 13(1) vs 314(N)  907(I) vs 480(N)  Flower I X N N  Siligue I N N ND  Stem I ND ND N  Rosette X N N N  Root X N N N  D2 Dl Dl Dl N N N I, N  D2 Dl Dl ND N N N ND  Dl ND Dl Dl N ND ND I, N  Dl Dl Dl Dl N N I, N N  X Dl Dl Dl X I, N I, N N  No Change Gain Gain  A2 A2 A2 Al,A2  Al, A2 A2 A2 ND  Al, A2 ND A2 A1,A2  Al, A2 A2 Al, A2 A1,A2  A2 A2 A2 A1,A2  Loss Loss Gain  Al X Al X  I, Al Al X ND  I, Al ND ND X  I, Al Al Al X  Al X Al Al  Loss Loss No Change  I, N I, N I, N I, N N N N N  I, N N N ND N N X ND  X ND I, N I, N N ND ND N  I, N I, N I, N I, N N N N N  N N I, N N X N N N  Stress Effect Change Change Change  Change Change Change  Loss Change No Change No Change No Change No Change  Table 5. (Continued) Pair4O Cold Heat Dry  Gene At3g02900  At5g16660  EXpected AA  N/A  EXpected Size 545(I) vs 124(Al) vs 177(A2)  586(I) vs 173(N)  Cold Heat Dry Pair4l Cold Heat Dry  At5g41670  At1g64l90  IR  N/A  380(I) vs 300(N)  719(N)  Cold Heat Dry Pair42 Cold Heat Dry  At2gOl 180  At1g15080  IR  N/A  807(I) vs 417(N)  617(I)vs368(N)  Cold Heat Dry  Pair43 Cold Heat Dry  Atlgl 5960  IR and AD  514(11) vs 395(12) vs 352(D1) vs 3l8(D2)  Flower Al X Al Al,A2 N N N N  Siligue Al, A2 Al I, Al ND N N N ND  Stem Al, A2 ND Al, A2 Al,A2 N ND ND N  Rosette Al Al Al, A2 Al,A2 N N N N  Root Al Al Al Al,A2 N I, N N N  X I, N I, N X N X N N  I, N I, N I, N ND N N N ND  I, N ND I, N I, N N ND ND N  I, N I, N I, N I, N N N N N  I, N I, N I, N I, N N N N N  X X N I, N X X X N  X N N ND X I X ND  N ND I,N N N ND ND N  N I, N N N N X N N  X N N N X X I, N X  No Change No Change NoChange  12, D2 X  Dl, D2 Il, 12  Change  X ND  Dl, D2 Ii, 12 Il, 12, Dl X  X Il, 12  12,D1 12  Dl, D2 ND Ii, 12, Dl 12, Dl  11 X  Gain Change  Stress Effect  Loss Change Gain Gain No Change NoChange  No Change No Change No Change No Change No Change No Change  Gain Gain No Change  Table 5. (Continued Gene At1g80830  EXpected N/A  EXpected Size 783(I) vs 532(N)  Cold Heat Dry Pair44 Cold Heat Dry  At1g80910  At1g16020  IR  N/A  429(I) vs 334(N)  444(1) vs 359(N)  Cold Heat Dry Pair45 Cold Heat Dry  At1g79650  At1g16190  AP  N/A  579(I) vs 202(P1) vs 184(P2)  769(I) vs 298(N)  Cold Heat Dry  Pair46 Cold Heat Dry  At1g19350  At1g75080 ©  Cold Heat Dry  IR and AA  N/A  470(I) vs 381(AI) vs 375(A2)  397(N)  Flower X X X N  Siligue N I X ND  Stem N ND ND X  Rosette N N N N  Root X X N N  I,N N N N N N I,N N  N N X ND N I N ND  N ND N N N ND ND N  I,N N N X N X N N  I,N N N N N N N N  Pl,P2 X P2 P2 N X I N  P2 X X ND N N X ND  P2 ND ND P2 N ND ND X  Pl,P2 P2 P2 P2 N I,N I I,N  I P2 P2 P2 N I N N  I I I,A2 I,A2 N N N N  I I I ND N N N ND  I,A2 ND 1, A2 I, A2 N ND ND X  I,A2 I,A2 I I N N N N  I I I I, A2 X N N N  Stress Effect  Change No Change No Change  Loss Loss Loss Change Change NoChange  Change Loss Loss Gain Change Gain  No Change Change Gain NoChange NoChange NoChange  Table 5. (Continued) Pair47 Cold Heat Dry  Gene At1g19400  EXpected Size 494(I) vs 113(N)  IR  1021(I) vs 883(N)  At1g78000  Atlg7OlOO  At1g24160  At2g17320  At4g35360 Cold Heat Dry  Stem I,N ND I,N I,N N ND ND X I,N ND ND J,N N ND ND N  Rosette I, N I, N N I,N N N N N  I, N N N N N  I,N I,N N I,N N N I, N N  I,N N I,N I,N N N N N I,N X X I,N X X X N  I,N N I,N ND N N I,N ND I,N X I ND N N I,N ND  I,N ND ND I,N N ND ND N N ND ND N N ND ND N  I,N I,N I,N N N N N N I, N  I,N I,N I,N I,N N N N N N  N N  x IR  N/A  433(I) vs 321(N)  456(I) vs 276(N)  Cold Heat Dry  Cold Heat Dry Pair5O Cold Heat Dry  N N I,N N N N X X N  Siligue X N N ND X N I ND N I,N I,N ND X N X ND  x x x  Atlg22150  Pair49 Cold Heat Dry  Flower  N  At1g75180 Cold Heat Dry Pair48 Cold Heat Dry  EXpected IR  IR  N/A  IR  N/A  596(I) vs 520(N)  731(I) vs 473(N)  447(I) vs 135(N)  1343(I) vs 580(N)  I,N  Root  Stress Effect  x N N I, N  x x N  x  x  x  N N N  I,N N X  x  x  N N  N N  No Change Loss No Change No Change No Change No Change Gain Change Gain  No Change Gain No Change  Loss No Change Loss No Change Gain No Change  Not Expressed Change Loss No Change No Change No Change  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067036/manifest

Comment

Related Items