UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Comparative genome hybridization reveals widespread genome variation in pathogenic cryptococcus species Liu, Iris 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_liu_iris.pdf [ 8.52MB ]
Metadata
JSON: 24-1.0067034.json
JSON-LD: 24-1.0067034-ld.json
RDF/XML (Pretty): 24-1.0067034-rdf.xml
RDF/JSON: 24-1.0067034-rdf.json
Turtle: 24-1.0067034-turtle.txt
N-Triples: 24-1.0067034-rdf-ntriples.txt
Original Record: 24-1.0067034-source.json
Full Text
24-1.0067034-fulltext.txt
Citation
24-1.0067034.ris

Full Text

Comparative Genome Hybridization Reveals Widespread Genome Variation in Pathogenic Cryptococcus Species by  Iris Liu  B.Sc. University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in  The Faculty of Graduate Studies (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) June 2008 © Iris Liu, 2008  ABSTRACT Genome variability can influence the virulence of pathogenic microbes.  The availability of  genome sequences for strains of the AIDS-associated fungal pathogens Cryptococcus neoformans and C. gattii presented an opportunity to use Comparative Genome Hybridization (CGH) to examine genome variability between strains of different molecular subtypes and ploidy. CGH analysis of 15 strains revealed extensive genomic variation including regions of difference (deletions and amplifications) and chromosome copy number variability. Although no common genomic change was observed for these 15 strains, three key observations came out of these studies. First, CGH identified putative recombination sites and the origins of specific segments of the genome for the common laboratory strain, JEC21.  Second, CGH and  subsequent PCR-RFLP (PCR-Restriction Fragment Length Polymorphism) analysis on 33 clinical, environmental and laboratory-generated AD hybrid strains revealed that chromosome 1 from the serotype A genome is preferentially retained in clinical strains.  Third, CGH and  subsequent qRT-PCR (quantitative real-time PCR) analysis revealed disomy for chromosome 13 in two clinical strains: CBS7779 and WM626. Further qRT-PCR and phenotypic studies on CBS7779 revealed a correlation between variable melanin production and disomy. Specifically, highly melanized strains were mono somic for chromosome 13 and less melanized strains were disomic for this chromosome. This correlation, however, only held for the initial CBS7779 isolates. That is, subsequent screens of highly-melanized and less-melanized isolates derived from the initial CBS7779 strain no longer followed this pattern.  These subsequent screens,  however, did reveal that 1) disomy, once established, was a relatively stable trait and 2) having disomy at chromosome 13 seemed to increase the probability of developing disomy at chromosome 4. Finally, qRT-PCR of 13 additional strains from AIDS patients revealed that disomy of both chromosome 13 and chromosome 4 is common in freshly isolated, clinical strains. Overall, the data presented in this thesis reveal novel aspects of genome variability and lay the foundation for future studies on the relevance of variation in the virulence of C.  neoformans.  11  TABLE OF CONTENTS Abstract Table of Contents  ii iii  List of Tables  v  List of Figures  vii  List of Abbreviations Acknowledgements  viii ix  Dedication  x  1. Introduction  1  1.1 Background information on Cryptococcus neoformans 1.2 Background information on Comparative Genome Hybridization (CGH) 1.3 Karyotype variation, aneuploidy and phenotypic switching in yeast-like fungi 1.4 Research objectives and Hypothesis 2. Materials and Methods  1 6 8 11 12  2.1 DNA isolation 2.2 NimbleGen arrays (CGH Design) 2.3 Creation of a database of genome variation for selected strains of C. neoformans and C. gattii 2.4 Confirmation of selected data documented in the database by PCR-RFLP  12 12  2.5 Isolation of melanin variants of C. neoformans by plating on L-DOPA medium 2.6 Quantitative real-time PCR  17 17  3. Results  3.1 Evaluation of genome variation in serotype A and serotype B strains 3.1.1 Genome variation in serotype A strains 3.1.2 Genome variation in serotype B strains 3.1.3 Confirmation of a selected subset of CGH data 3.1.4 Overall analysis of genome variation in serotype A and serotype B strains 3.2 Examination of a genetic cross and recombination sites for serotype D strains 3.3 Examination of serotype AD strains 3.4 Chromosome Copy Number Variation (CCNV) 3.4.1 Experimental set-up to examine CCNV 3.4.2 CCNV in the serotype A strain CBS7779 3.4.3 CCNV in the serotype A strain WM626 3.4.4 CCNV in selected other strains 4. Discussion and Conclusions 4.1 Analysis of genome variation in pathogenic Cryptococcus species 4.1.1 Annotation of genome variation in C. neoformans and C. gattii  14 14  20  20 21 23 26 27 29 36 45 45 47 57 61 67  67 67 111  4.1.2 Examination of a genetic cross and recombination sites for serotype D strains 4.1.3 Examination of serotype AD strains 4.1.4 Final comments on genome variation 4.2 Chromosome Copy Number Variation in C. neoformans 4.2.1 CCNV in serotype A strains CBS7779 and WM626 4.2.2 CCNV in selected strains of C. neoformans and C. gattii 4.2.3 Final comments on CCNV 4.3 Conclusions References Appendices Appendix A Appendix B Appendix C Appendix D  —  —  —  —  Database of genomic variation observed in serotype A strains via CGH Database of genomic variation observed in serotype B strains via CGH Expanded analysis for section 3.2 (Preferential retention of certain chromosomes by Al) strains) Expanded analysis for section 3.4 and 3.5 (Chromosome Copy Number Variation (CCNV) for the serotype A strains CB7779 and W1v1626 and selected additional strains)  70 71 74 74 74 81 85 85 87 100 100 119 153  163  iv  LIST OF TABLES Table 2.1 Table 2.2 Table 2.3 Table 2.4 Table 2.5 Table 3.1  Table 3.2  List of C. neoformans and C. gattii strains used for CGH List of primers used for confirmation of CGH data  Table 3.4 Table 3.5  Table 3.6 Table 3.7 Table 3.8 Table 3.9 Table 3.10 Table 3.11  Table 3.12  15  List of C. neoformans strains used for PCR-RFLP List of primers used for quantitative real-time PCR (qRT-PCR)  16  List of C. neoformans and C. gattii strains used for qRT-PCR Summary of the total number of deletions (Log Ratio (LR) -0.5) or amplifications (LR 0.5) in four serotype A strains relative to the genome of the strain H99  19  18  21  Comparison of Log Ratios (LR) and Standard Deviation (SD) for all 14 chromosomes of four serotype A strains that were hybridized to an array of the H99 genome  Table 3.3  13  22  Summary of the total number of deletions (LR < -0.5) or amplifications (LR> 0.5) in six serotype B strains relative to the genome of the strain WM276  24  Comparison of LR and SD for all chromosomes of six serotype B strains that were hybridized to an array of the WM276 genome  24  SD was used as a measure of LR (Log Ratio) divergence for each chromosome in the parental strains N111433 and NIH 12 upon hybridization to the JEC21 array  31  Summary of the average LRs and standard deviation between N1F1433 and NIH12 in selected areas across the genome Average LR of each of the chromosomes for the serotype AD strains  32  Summary of the serotype-specificity of CHR 1 in selected strains Quantitative RT-PCR (qRT-PCR) analysis of gene copy number in strains JEC21 and CBS7779 relative to the H99 genome qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock  40 44 49 51  qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from screen #1 (Table 3.10)  54  qRT-PCR analysis of gene copy number in strains JEC21 and WM626 relative to the H99 genome  59  V  Table 3.13 Table 3.14 Table 3.15  Summary of the copy number of CHR 13 and CHR 4 for a select number of WM626 isolates  61  Summary of the copy number at SMG1 (CHR 4) and CNNOO82O (CHR 13) for a set of strains from AIDS patients  63  Average copy number of two loci in strain JEC2 1 relative to the strain H99  65  vi  LIST OF FIGURES Figure 3.1 Figure 3.2 Figure 3.3 Figure 3.4 Figure 3.5 Figure 3.6 Figure 3.7 Figure 3.8 Figure 3.9 Figure 3.10 Figure 3.11 Figure 3.12 Figure 3.13 Figure 3.14  Confirmation of the presence of a deletion in the serotype A strain BT63 An overview of the hybridization ofNIH433 and NIH12 DNA to a  26  JEC21 array  30  Analysis and confirmation of the N1H433 / NIH12 hybridization patterns to the JEC21 array  33  Overview of the CGH data for the serotype AD hybrids strains Analysis of serotype AD strains, with an emphasis on CHR 5  38 41  Analysis of serotype AD strains, with an emphasis on CHR 1 Analysis of serotype AD strains, with an emphasis on CHR 1 of single re-isolated colonies of various strains Testing the efficiency and sensitivity of qRT-PCR for the primer CNA04650  42  inH99  46  CGH data of CHR 10 to CHR 14 of the strain CBS7779 hybridized to the H99 array  48  Photographs of —‘1000 CBS7779 isolates on L-DOPA medium after three days of growth at 30°C  50  Photographs of two colonies (CBS7779 plated on L-DOPA) displaying the sectoring phenotype for melanin Summary of the copy numbers of CHR 4 and CHR 13 in three successive  43  52  screens and its melanin production phenotype in the strain CBS7779 CGH data of CHR 10 to CHR 14 of the strain WM626 hybridized to the H99 array  58  Photographs of —1000 WM626 isolates on L-DOPA medium after three days of growth at 30°C  60  56  vii  LIST OF ABBREVIATIONS AVG LR  Average Log Ratio  CCNV  Chromosome Copy Number Variation  CGH  Comparative Genome Hybridization  CI{R  Chromosome  CSF  Cerebral Spinal Fluid  FACS  Fluorescence Activated Cell Sorting  gDNA  Genomic DNA  GFP  Green Fluorescent Protein  LR  Log Ratio  PCR  Polymerase Chain Reaction  qRT-PCR  Quantitative Real-Time PCR  RFLP  Restriction Fragment Length Polymorphism  SD  Standard Deviation  viii  ACKNOWLEDGEMENTS  First of all, I wish to thank Dr. James Kronstad for his unprecedented patience and guidance throughout the entire process. Not only has he shown me how to think meticulously and design well thought-out experiments, but he has been a wonderful mentor. Moreover, I want to thank my labmates for their thoughtful comments and useful troubleshooting tips. In particular, Dr. Guanggan Hu was especially helpful with teaching me how to do qRT-PCR, virulence assays, biolistic transformation and many more techniques. I also wish to thank Dr. Phil Hieter for letting me use the various microscopes that made this thesis possible. In addition, my committee members, Dr. Erin Gaynor and Dr. Michael Murphy have provided the much needed constructive feedback. My brothers and sisters in Christ (Nouver, Jessica, Meng, Linda and many more) deserve a big hug of thanks. They have prayed for me, listened to my concerns and put up with my ravings on the beauties and wonders of biology. Last, but not least, special thanks are owed to my parents, who have supported me throughout the years and put up with my odd hours at the lab.  ix  He was there since the very beginning. He placed the stars in the sky, Set the planets spinning in motion, Carved out mountains and valleys, And designed the blueprint for life. Yet He knows me by name. He held my hand throughout it all. His nail-pierced hands testify His love for me. He provided me with everything that I needed, And will forever welcome me with open arms. Abba Father, to You, and You alone, I dedicate this thesis.  x  INTRODUCTION 1. INTRODUCTION  1.1 Background information on Cryptococcus neoformans The fungal pathogen Ciyptococcus neoformans is the most common cause of meningitis among patients infected with HIV (Hakim et aL, 2000).  Cryptococcal disease starts as a  respiratory infection (Hull & Heitman, 2002), but it can then lead to either a latent infection or it can spread to other organs with a predilection for the central nervous system (Lin et al., 2007). Symptoms include headache, fever, malaise, altered mental status for several weeks and, in more serious cases, the patient may develop raised intracranial pressure (Bicanic & Harrison, 2004). In some areas of the world such as sub-Saharan Africa, up to 50% of patients with H1V/AIDS may be co-infected with C. neoformans (Schutte et al., 2000). Thus, it is not surprising that in one study, cryptococcal disease was the most common cause of death among patients infected with HIV (Corbertt et al., 2002). Another area of concern is that one variety of C. neoformans, now classified as the separate species C. gattii, has recently been found to be capable of infecting and causing disease in immunocompetent individuals. An outbreak of this pathogen on Vancouver Island that started in 1999 had resulted in at least 59 hospitalizations by 2004 (Hoang et al., 2004). Additional cases continue to occur at a rate of -25 per year and at least eight people have died since the start of the outbreak (MacDougall & Fyfe, 2006). Normally, eliminating the source(s) of infection can be used to combat disease outbreaks. This method, however, is not applicable with C. neoformans and C. gattii because of the prevalence of the fungus in a wide range of environmental niches: pigeon guano, trees, decaying wood and soil (Lin & Heitman, 2006).  1  iNTRODUCTION Because of these characteristics, it is difficult not only to locate the source of the outbreak but also to eliminate the spread of this pathogen. Unfortunately, even if treatment for Cryptococcal meningitis is available, mortality can still be as high as 25% (Horst et al., 1997), and for those patients who do recover, the rate of relapse is 12.8% (Antinori et al., 2001). As a result, most patients require long-term antifungal treatments (Antinori et al., 2001).  However, current drugs such as amphotericin B and  fluconazole have toxic effects including nausea, elevated serum creatine levels, hypokalemia, rash, headache, hemolytic anemia and gastrointestinal hemorrhage (Horst et al., 1997). Meanwhile, various isolates around the world are gaining resistance to commonly used antifungal drugs such as fluconazole and voriconazole (Chandenier et al., 2004). Unfortunately, C. neoformans is also highly mobile across the globe (Kidd et al., 2005), thereby suggesting that localized resistance in specific areas may spread to other parts of the world. Thus, there is a need to develop new drugs to combat this pathogen. One of the reasons for why Cryptococcus species are successful pathogens is because they have developed a number of virulence factors that allow survival and growth while inside the host (Idnurm et al., 2005). First, the fungus has the ability to grow at 37°C, thereby allowing it to proliferate efficiently at host temperature. Second, this pathogen produces a polysaccharide capsule that blocks phagocytosis. And even if it is engulfed, the capsule promotes the survival of the fungus while it is inside phagocytes (e.g. macrophages and neutrophils). This capsule also has the ability to down-regulate the cellular and the humoral immune responses. For example, it has been documented that the capsule can deplete complement proteins in the host (Janbon, 2004), thereby increasing its ability to evade the immune system. Finally, even if C. neoformans and C. gattii are ingested by macrophages, the fungi have the ability to produce melanin, a black  2  INTRODUCTION polymer in the cell wall that provides protection against oxidative killing (Zhong et a!., 2008). Interestingly, the production of melanin may explain why C. neoformans can rapidly proliferate in the central nervous system and cerebral spinal fluid (CSF), which often has a deadly outcome (Clancy et al., 2006). Specifically, melanin can be produced from the precursors dopamine and epinephrine, two neurotransmitters which are found in the brain (Lin & Heitman, 2006). In any case, the end result is that the production of capsule and melanin has given C. neoformans and C. gattii the ability to survive and replicate inside phagolysosomes (Bicanic & Harrison, 2004). Aside from the main three virulence factors (ability to grow at 37°C, capsule and melanin production), another important virulence-associated factor for C. neoformans and C. gattii is the ability to mate. In strains of C. neoformans that have the D capsule serotype, MATa strains are more virulent than MATa strains, and in all serotypes (A, B, C and D), the majority of clinical isolates are MATa (Hull & Heitman, 2002). When MATa and MATcx strains of the A serotype are co-inoculated into mice, MATa strains will outcompete MATa strains for entry into the brain, suggesting that the ability to mate (or mating-type specificity) is an important aspect of virulence (Nielsen et al., 2005a, Nielsen et a!., 2005b). This idea is also supported by the fact that the recent outbreak on Vancouver Island generally involves only MATa strains (Fraser et a!., 2003). Furthennore, some studies have linked fertility to clinical prevalence. For example, one study found that 12 of 16 human clinical isolates were fertile, whereas only 7 of 55 environmental strains were weakly fertile (Campbell et al., 2005). The skewed distribution of fertile isolates in the clinic versus those that are found in the environment further supports the idea that mating is an important component of pathogenesis. This concept can also be seen in other pathogens such as Toxiplasma gondii (Grigg eta!., 2005).  3  INTRODUCTION Although several virulence factors have been discovered and characterized over the past few decades, there is evidence to suggest that there are still many undiscovered factors that contribute to disease (McClelland et al., 2005). Previously, researchers have shown that during the passage of various strains of C. neoformans through mice, the strains became more virulent (McClelland et al., 2004). Later, when the differences between the passaged and non-passaged strains were compared in terms of known virulence factors (McClelland et a!., 2005), it was discovered that these known virulence factors could not fuiiy explain the virulence differences that are observed between the two sets of strains. As a result, the authors concluded that there could be other unknown virulence factors that affect the pathogenicity of C. neoformans. In order to study Cryptococcus more efficiently, a classification system based on serological and molecular methods has been developed.  Isolates of C. neoformans can be  divided into the four serotypes mentioned above (designated as A, B, C, D) and into a fifth hybrid serotype called AD.  These serotypes are identified by antigenic differences in the  capsular polysaccharide that surrounds the fungal cells (Bose et al., 2003). In general, serotype A isolates have a worldwide distribution, serotype D strains are found in Europe and North America, and serotypes B and C strains (now classified as C. gattii) are found in tropical and subtropical regions, although they can also be isolated in temperate climates (Bartlett et al., 2008, Bennett et a!., 1977, Kwon-Chung & Varma, 2006, Mitchell & Perfect, 1995).  PCR  fingerprinting with minisatellite Ml 3- and microsatellite 4 (GACA) specific primers have also been used to group hundreds of isolates into nine major molecular genotypes (Ellis et a!., 2000, Meyer et a!., 1999).  These molecular subtypes are defined such that VNI, VNII and VNB are  for serotype A strains; VNIII is for serotype AD strains (a hybrid, diploid serotype); VNJV is for serotype D strains, and VGI to VGIV are for serotypes B and C strains. Because most strains  4  INTRODUCTION that infect AIDS patients are serotype A strains, it invariably means that most strains that infect AIDS patients are in the categories of VNI and VNII. However, VNB is not usually found among clinical strains and it has only been recently discovered in a clinic in Botswana (Litvintseva et a!., 2005, Litvintseva et a!., 2006, Litvintseva et al., 2003). In studying the role of serotype and virulence of Cryptococcus, the AD hybrid strains of  C. neoformans present an interesting and special case for analysis. C. neoformans is usually haploid and it is only transiently diploid during the sexual cycle.  However, it has been  discovered that some of the strains that infect AIDS patients have the hybrid AD serotype and that many of these strains are aneuploid (Cogliati et a!., 2001). These AD strains, many of which are from Africa, are thought to result from mating interactions between serotype D and serotype A parental strains.  They have a wide range of virulence levels in animal models of  cryptococcosis, as do the serotype A and D strains. More interestingly, these strains may retain chromosomes either from both serotypes or from only one serotype (Lengeler et a!., 2001). Because of the medical importance of these AD strains, deciphering the genomic make-up of the hybrids in comparison with haploid isolates will be important in the battle against C. neoformans and will lead to more information regarding how genomic differences correlate with differences in virulence. To summarize the background information on C. neoformans and C. gaul!, it is clear that these fungi have and will continue to have a devastating impact on patients with AIDS.  In  addition, C. gattii is now being found in temperate regions (such as Vancouver Island) and has become an emerging pathogen. Its ability to cause disease in immunocompetent people indicates that it has unusual virulence properties compared with C. neoformans.  Therefore, a better  understanding of this pathogen is clearly needed.  5  INTRODUCTION 1.2 Background information on Comparative Genome Hybridization (CGH) The goal of the work in this thesis was to use Comparative Genome Hybridization (CGH) to study genomic variation in selected strains representing different serotypes and molecular subtypes of C. neoformans and C. gattii. The CGH technique can rapidly survey an entire genome without the need to sequence the strain of interest. To perform CGH, the DNAs from a reference strain and from the strain of interest are first labeled with different fluorescent dyes. The labeled DNAs are then hybridized to a microarray containing DNA probes from the genome of the reference strain. The competing signals between the labeled DNAs can then be analyzed to reveal areas of conservation, amplification, divergence and deletion.  Although a lot of  information can be gained regarding the genomic variability of the strains, one of the caveats of CGH is that it cannot detect genomic rearrangements, such as translocation events. Also, it cannot it identify genes that are not present in the reference strain. This technology, however, is quite sensitive because it is capable of detecting sequence divergences that are as low as 2% (Taboada et al., 2005).  As a result, CGH is an excellent method for examining genome  variability when reference genomes are available. It can also provide a way to examine sites of sexual recombination on a genomic scale (Gressmann et al., 2005); this information could be important for pathogens such as C. neoformans, in which fertility and mating type are associated with virulence. In the past, CGH has been used to study several different pathogens. For example, in 2005, CGH was used to study the gain and loss of genes in Helicobacter pylon, the pathogen responsible for ulcers (Gressmarm et a!., 2005). In addition, CGH has been used to detect areas of conservation in Campylobacterfejuni, a pathogen that causes severe diarrhea and is the most common cause of acute bacterial enteritis (Taboada et al., 2005). Furthermore, CGH has been  6  INTRODUCTION used to identify genomic regions that are related to virulence. For example, Herbert et a!. (2005) used CGH to identify pathogenicity islands in Group B Streptococcal strains. The ability of CGH to identify evolutionary changes was also used to identify genes that resulted from horizontal gene transfers in a number of Brucella species (Rajashekara et al., 2004). In general, CGH has been successfully used to study genomic variation in a number of bacteria, fungi, parasites and higher eukaryotes. Although CGH is a powerful tool, its novelty means that control experiments must be conducted to determine the sensitivity, reproducibility and the relevance of the CGH data. Fortunately, data from CGH experiments are usually highly reproducible, especially when compared with microarray experiments for gene expression (Watanabe et aL, 2004), and data generated by different laboratories can be pooled together for meta-analyses (Taboada et a!., 2004). As a result, the application of CGH to fungal pathogens such as Candida albicans and C. neoformans can contribute to a detailed understanding of genome variability and this information can potentially contribute to insights into virulence and drug resistance. In general, genomic variation between strains has been a well known predictor for phenotypic differences in a wide range of organisms including bacterial, fungal and viral pathogens (Powell et a!., 2008, Koide et a!., 2004, Ellison et a!., 2008, Harriff et a!., 2008, Jiang et a!., 2006, Allen & Nuss, 2004, Nunes et a!., 2003, Harvala et a!., 2002). In fact, in Xy!ella fastidiosa, genomic variation caused by transposable elements and other mobile elements (which contribute up to 18% of the genome) plays a major role in determining the virulence of this bacterial pathogen (Nunes et a!., 2003). In summary, CGH is a great tool for studying genomic variation. Although it has a few caveats, its many attributes atone for these issues. For example, CGH can rapidly survey an  7  INTRODUCTION entire genome and it is highly reproducible. Thus, CGH was chosen as the tool to study genome variation in Cryptococcus species.  1.3 Karyotype variation, aneuploidy and phenotypic switching in yeast-like fungi. In the study of genomic variation, it is important to remember that dynamic chromosomal rearrangements are common in fungi.  Although the exact purpose of chromosomal  rearrangement in fungi is unknown, it has been speculated that it may be involved in pathogenesis (Brandt et a!., 1996; Fries et a!., 2001). Specifically, it was reported that new patterns in the electrophoretic karyotypes were found in sequential isolates from 8 of 33 patients (Brandt et al., 1996). In this case, one of these patient samples had karyotype changes that correlated with changes in colony morphology (large and small) (Brandt et al., 1996). Yet, both of the karyotypes for these colony size variants were different from the initial karyotype of the isolate (Brandt et a!., 1996). These types of studies illustrate that chromosomal rearrangements (including aneuploidy as found in AD hybrid strains) may be very dynamic in C. neoformans and may affect phenotype. This idea is intriguing because C. neoformans and C. gattii are known to switch phenotypes during the course of an infection (Guerrero et a!., 2006) and it is possible that this phenomenon is mediated by chromosomal rearrangements.  Common phenotypes that may  switch during infection include switching from a mucoid to a smooth or to a serrated colony morphology (Guerrero et a!., 2006, Fries et a!., 2005).  Less common phenotypes that may  switch include differences in growth rate, cell wall composition and capsule size. Presumably, phenotype switching allows the fungi to evade the immune system by making it more difficult for the host to generate antibodies and reactive T-cells (Pietrella et a!., 2003). In any case,  8  INTRODUCTION infections in which phenotype switching has been documented often lead to poorer outcomes (Guerrero et al., 2006). The hypothesis that specific karyotype changes may regulate colony morphology switching is also supported by the fact that this phenomenon has been well-characterized in C. albicans, another fungal pathogen (Rustcheriko-Bulgac et a!., 1990, Suzuki et a!., 1989). In fact, phenotype changes, chromosome copy number polymorphisms and other chromosomal rearrangements have been well documented in C. albicans following passage through an animal host (Rustchenko-Bulgac et al., 1990; Chen et al., 2004). In these studies, changes in the copy number of specific chromosomes have been linked to a number of phenotype changes. For example, the copy number of CHR 3 determines the ability of C. albicans to utilize L-sorbose as a carbon source (Janbon et a!., 1998). More interestingly, it has been recently documented that a specific segmental aneuploidy of CHR 5 results in C. albicans resistance to azole, a drug commonly used to treat fungal infections (Selmecki et al., 2006). In this case, the aneuploidy allows for the up-regulation of efflux pump genes (Selmecki et al., 2006) and various other transcription factors related to azole drug resistance (Coste et a!., 2006). Although it may seem that aneuploidy gives C. albicans an advantage during infection, this is not always the case because trisomy of CHR 1 in C. albicans reduces its virulence (Chen et a!., 2004). As an additional example of the complexity behind aneuploidy and fitness, it is also known that defects in C. albicans genes involved in double-strand break repair will lead to an increase in genomic instability (which should be disadvantageous for the cell). As a result, these defects also make the strain more sensitive to the flucanozole (Legrand et a!., 2007). Also, these mutants are more sensitive to oxidative damage and grow slowly in culture. However, mutations in double-strand break repair also result in a higher frequency of drug-resistant mutants in comparison to wild-  9  iNTRODUCTION type strains (Legrand et a!., 2007), therefore suggesting that these mutations could be advantageous for the species in some situations. Thus, aneuploidy and its role in pathogenicity can be very complicated. CGH has been extensively used to study genomic variation in studies on Saccharomyces cerevisiae, breast cancer cells, Arabidopsis thaliana and C. albicans (Myers et al., 2004, Voullaire & Wilton, 2007, Henry et al., 2006, Selmecki et a!., 2005b). Through the use of CGH and other recently developed techniques, aneuploidy and chromosome instability have been particularly well-characterized in S. cerevisiae. For example, it was discovered that yeast can compensate for a number of laboratory-generated mutations by gaining an extra copy of the chromosome in which the mutation resides (Hughes et al., 2000). In fact, these strains had a selective advantage over the mutants that did not gain an extra chromosome, such as the ability to grow faster in culture (Hughes et a!., 2000). However, this compensation with an extra chromosome results in genome-wide changes in expression profiles. That is, the genes on the disomic chromosome generally produce double the number of transcripts regularly expressed. This suggests that there is no global dosage-compensation to normalize expression for each gene at the transcriptional level (Hughes et a!., 2000, Torres et al., 2007).  In cases where the  aneuploidy was not caused by mutations in other genes, however, strains with extra chromosomes grew slower than wild-type strains in culture (Torres et a!., 2007). Tn any case, changes in chromosome copy number result in altered gene expression profiles for the chromosome in question. Aneuploidy in yeast can also cause an up-regulation of genes involved in ribosomal biogenesis, ribosomal RNA processing, nucleic acid metabolism and carbohydrate metabolism (Torres et a!., 2007).  10  INTRODUCTION In summary, previous studies have shown that chromosomal changes in yeast-like fungi such as S. cerevisiae and C. albicans will result in changes in the phenotypes and gene expression patterns.  In addition, the evidence that chromosomal changes occur in C.  neoformans during infection, in association with phenotypic switching, suggests that genome variability may be important for virulence.  1.4 Research objectives and hypothesis  The main objective of the work in this thesis was to evaluate genome variation in selected strains of C. neoformans representing serotypes A B, D and AD. A major discovery from this work was that some strains of serotype A showed elevated copy number for specific chromosomes. This discovery led to the second objective to investigate Chromosome Copy Number Variation (CCNV).  This work resulted in the discovery and characterization of a  relationship between CHR 13 and formation of the virulence factor melanin. It also laid the foundation for future studies to investigate CCNV in C. neoformans strains during the infection of mammalian hosts, including AIDS patients.’  1  Portions of the work presented in this thesis were performed in collaboration with Dr. Guanggan Hu and appeared in the following publication: *Hu, G., *Liu, I., Sham, A. Stajich, J.E., Dietrich’ F.S., and Kronstad, 3.W. 2008. Comparative hybridization reveals extensive genome variation in the AIDS-associated pathogen Cryptococcus neoformans. Genome Biology 9: R41. * co-first authors  11  MATERIALS AND METHODS 2 MATERIALS AND METHODS  2.1 DNA isolation Genomic DNA (gDNA) isolation was performed with a previously published method (Pitkin et al., 1996). In brief, the method involves vigorous vortexing of cells with glass beads in a phenol:chloroform:isoamyi alcohol solution followed by a series of ethanol (70%) precipitations. The precipitated DNA was resuspended in distilled water.  2.2 NimbleGen arrays (CGH Design) To perform the CGH analysis, gDNA was sent to NimbleGen Systems Inc.  TM  (Madison,  WI, USA) (http://www.nimblegen.com/products/cghJindex.htrnllast accessed: May 2008) for hybridization to high density tiling arrays (Hu et al., 2008). The processing of these arrays was as described by Seizer et a!. (2005). These high-density arrays each contained roughly 386,000 probes; the average length of the probes was 50 bp (range 45  to  85 bp) and the average melting  temperature of the probes was 76°C. The array spanned all 14 chromosomes for each genome; however, regions that were highly repetitive, such as regions in the telomeres and the centromeres, were not represented on the array. The resulting data were viewed either with Microsoft Excel or with NimbleGen’s  TM SignalMap  GFF visualization software.  One  hybridization experiment per genome was performed, followed by confirmation by PCR and sequencing for specific regions. Table 2.1 presents a list of the strains and genomes used for hybridization.  12  MATERIALS AND METHODS  Table 2.1 List of C. neoformans and C. gattii strains used for CGH. The first strain listed for each serotype has a sequenced genome and was used as the reference strain for the hybridization experiment. For the AD strains, two reference strains (H99 and JEC2 1) were used. Strain  Serotype Molecular (Mating type) subtype  Source  Reference  H99  A (a)  VNI (AFLP 1)  3. Heitman; Clinical isolate  CBS7779  A (a)  VNI (AFLP 1)  T. Boekhout; Clinical isolate (Brazil)  (Heitman et al., 1999) (Boekhout & van Belkum, Belkum, 1997)  Bt63  A (a)  VNB  J. Heitman; Clinical isolate (Botswana)  125.91  A (a)  VNI (AFLP 1)  J. Heitman; Clinical isolate (Tanzania)  WM626  A (a)  VNII (AFLP 1A) W. Meyer; Clinical isolate (Australia)  JEC21  D (a)  VNIV (AFLP 2)  SIIH12  D (a)  VNIV (AFLP 2)  4IH433  D (a)  VNIV (AFLP 2)  CDC228 KW5 CDC3O4  A (a), D (a) A (a), D (a) (a), D (a)  VNIII (AFLP 3) VNIII (AFLP 3) VNIII (AFLP 3)  WM276  B (a)  VGI (AFLP 4)  E566  B (a)  VG?  R794  B (a)  VGI  KB3864  B  (?)  VGI  KB7892  B (a)  VGI  RV66095  B (a)  VGI  T. Boekhout; Clinical isolate (Argentina)  WM276 GFP2 B (a)  VGI  Constructed in this lab  (Litvintseva et al., 2006) (Lengeler et aL, 2000) (Meyer & Mitchell, 1995)  J. Kwon-Chung; Laboratory generated, (Heitman et a!., 1999) rogeny ofNIHl2 and N1H433 J. Kwon-Chung; Clinical isolate (United (Heitman et al., 1999) States) J. Kwon-Chung; Environmental isolate (Heitman et al., 1999) (Denmark) J. Heitman; Clinical isolate J. Heitman; Clinical isolate 3. Heitman; Clinical isolate W. Meyers; Environmental isolate (Australia) 3. Heitman; Environmental isolate (Australia) K. Bartlett; Clinical isolate (Vancouver Island) K. Bartlett; Environmental isolate (Vancouver Island) K. Bartlett; Environmental isolate (Vancouver Island)  (Lengeler et a!., 2001) (Lengeler et a!., 2001) (Lengeler et a!., 2001) (Fraser et a!,, 2004) (Fraser et a!., 2004) (Kidd et aL, 2005) K. Bartlett strain collection (Kidd et al., 2005) T. Boekhout strain collection 3. Kronstad strain collection  13  MATERIALS AND METHODS  2.3 Creation of a database of genome variation for selected strains of C. neoformans and C. gattii To characterize regions of difference that were identified by CGH, sequence identities were calculated with the BioEdit program (developed by Tom Hall of Ibis Biosciences), which is available at http://www.mbio.ncsu.edu/BioEdit/bioedit.htrnl (last accessed May 2008).  This  program as been used in a number of previous studies (Hu et a!., 2008; Mao et a!., 2007; Wang et a!., 2007; Wu et a?., 2007) Microsoft Excel was used to calculate the average LR (AVG LR) and the standard deviation (SD) for the CGH hybridization data. Only the following values for regions of difference were recorded in the annotation work: AVG LR ± SD LR ± SD LR  <  0.5 or AVG LR  -0.5. This cutoff was chosen because it corresponds to a sequence identity of  approximately 95% (Hu eta?., 2008). The annotations are summarized in Appendices A and B. Sequence information was retrieved using Duke’s University Resources for Fungal Comparative Genomics, which is available at http://fungal.genome.duke.edu/ (last accessed Dec. 2007).  Using the GLEAN models for genes at this website, sequences were retrieved and  BLASTn was used to determine if there were any orthologous genes or functional information associated with the sequence. When available, GO annotations were also recorded for additional insights into the function of the genes in the regions of difference.  2.4 Confirmation of selected data documented in the database by PCR RFLP -  Specific regions of difference identified by CGH were analyzed by PCR amplification, sequencing and restriction enzyme digestion. Primer design was accomplished with the program Primer3, which is available at http://frodo.wi.rnit.edu/cgi-bin/primer3/primer3 .cgi (last accessed  14  MATERIALS AND METHODS April 2008; Koressaar, T. & M. Remm, 2007) (see Table 2.2 for a list of primers). Taq DNA Polymerase from Invitrogen was used in accordance with the manufacturer’s instructions for all PCR reactions on purified gDNA. The resulting amplicons were then purified with either the Qiagen Gel extraction kit or the Qiagen Nucleotide removal kit depending on whether or not multiple bands were present. TaKaRa Ex Taq from TaKaRa Biotechnology (Dalian) CO., LTD. was used for colony PCR according to the manufacturer’s instructions. Products were sent to NAPS (Nucleic Acid Protein Service Unit) at UBC for sequencing. PCR-RFLP (Restriction Fragment Length Polymorphism) analysis was conducted with various restriction enzymes (listed in the figures legends) according to the manufacturer’s instructions. Designs for the RFLP analysis were made via the Sequence Manipulation Suite, which is available at: http ://www .ualberta.caJ’-stothard1j avascript/index.html (last accessed May 2008). Table 2.2 List of primers used for the confirmation of the CGH data. Table 2.2 A List of primers used for sequencing Primer Name Sequence Forward ino3phos CGCTGACATGGGCTACTACA thiolox CTACCCGCTCCAGGAGAATG acidphos CCAGCTTfACGGCCTCAAC CNIO 1750 TAGATATGAGACACCCACCACACC CNGOO78O TCGCTACCATCGAGAGTGTCATAG  Sequence Reverse AGATGGGCACAAAGACATCC CGCGACTAAGGATGGTAGGG GCCACTTGTCTCCACCATGA AACCTCGGTACTAGTGACCACCAT GTCTGCCTACCCTCCTATCAAG  Table 2.2 B List of primers used for detecting regions of deletion [irimer Name Sequence Forward Sequence Reverse CNC06920_2 GATCCCTTCTCCGCG1TGA CCTYI’ACTCCCATGTCGCTGCT 0423 9H99 GCCGTCATACGCCTGTATC GGGAAGACGATCACCGAAT Table 2.2 C List of primers used for RFLP (AD strain analysis) Primer Name Sequence Forward acidphos CCAGCTTfl’ACGGCCTCAAC CNE04380 GAACGACGCTCCTTTGATACC CNAO 1230 GGTGTCAAGACTGTCACCATCTAC CNBO1 970 GTCATGAGAGACAACGTGCAG  Sequence Reverse GCCACTTGTCTCCACCATGA CTCCTCTTCGATCTCATCTCTTCC AACGACCTGAGTATGGCCTTG CGATATCCTCACTAATGACGAAC  15  MATERIALS AND METHODS  PCR-RFLP was used to confirm the preferential retention of specific chromosomes in the AD strains.  In addition, this method was used to screen 33 strains from clinical, environmental  laboratory-generated sources (Table  2.3)  retention of the serotype A version of  and  to determine whether or not there was preferential  CHR  1 in clinical strains.  Table 2.3 List of C. neoformans strains used for PCR-RFLP. .  Strain MAS920005 MAS920026 MAS920046 MAS920047 MAS920062 MAS920066 TvIAS920074 vIAS92O 174 4AS9201 81 1AS920 190 MAS920280 MAS920283 MAS920328 MAS920354 MAS920355 4AS920383 XL1552 XL1548 XL1462 XL1514 KBL-AD 1 nc5-19 nc6-20 nc42-10 ICB 134 it752 zg287 nc34-21 mrnRLl365 nc35-5 Zg290 it756 iclO-23  Serotype (Mating type) .D (?) .D (?) AD (?) AD (?) AD (?) AD (?) AD (7) \I) (?) .D (7) D (7) AD (7) AD (?) D (7) AD (?) AD (7) AD (?) (a), D (a) (a), D (a) A (a), D (a) A (a), D (a) A (a), D (a) A (a), D (a) (a), D (a) (a), D (a) A (a), D (a) A (a), D (a) A (a), D (a) A (a), D (a) A (a), D (a) AD (7) (a), D (a) A (a), D (a) U) (7) .  .  Source T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate T. Mitchell; Clinical Isolate 3. Heitman; Lab. generated (H99 and JEC21) 3. Heitman; Lab. generated (H99 and JEC2I) 3. Heitman; Lab. generated (H99 and JEC21) J. Heitman; Lab, generated (H99 and JEC21) 3. Heitman; Lab, generated JEC1 71 and H99 3. Heitman; NC (USA), environmental strain J. Heitman; NC (USA), environmental strain 3. Heitman; NC (USA), environmental strain 3. Heitman; Pigeon dropping, Brazil T. Mitchell; Italy, clinical T. Mitchell; China, clinical T. Mitchell; NC (USA), environmental strain T. Mitchell; USA, clinical T. Mitchell; NC (USA), environmental strain T. Mitchell; China, clinical T. Mitchell; Italy, clinical f. Mitchell; NC (USA), environmental strain  {eference Mitchell culture collection Mitchell culture collection Mitchell culture collection Mitchell culture collection Mitchell culture collection Mitchell culture collection Mitchell culture collection Mitchell culture collection r. Mitchell culture collection f. Mitchell culture collection T. Mitchell culture collection T. Mitchell culture collection T. Mitchell culture collection T. Mitchell culture collection T. Mitchell culture collection r. Mitchell culture collection (Lin et at., 2008) (Lin et at., 2008) (Lin et a!., 2008) (Lin et a!., 2008) (Lengeler et at., 2001) (Lin et at., 2007) (Lin et a?., 2007) (Lin et al., 2007) (Barreto de Oliveira et al., 2004) (Litvintseva et al., 2007) (Litvintseva et a?., 2007) (Litvintseva et at., 2007) (Litvintseva et at., 2007) (Litvintseva et at., 2007) (Litvintseva et a?., 2007) (Litvintseva et at., 2007) (Litvintseva et at., 2007) T. C. T. T. T. T. T. T.  16  MATERIALS AND METHODS 2.5 Isolation of melanin variants of C. neoformans by plating on L-DOPA medium In order to screen for strains that had switched phenotypes (i.e. from high melanin production to low melanin production or vice versa), single colonies were first selected and re streaked onto a L-DOPA plate for single colonies.  This colony isolation procedure was  conducted at least three times in each successive screen to ensure the purity of each strain. After isolation, the strains were grown overnight in YPD (Difco) at 3 0°C, cells were washed in water and plated on L-DOPA medium at  500 cells per plate as described previously (D’Souza et a!.,  2001). Changes in melanin production (darker or lighter colony pigmentation) were identified visually.  2.6 Quantitative real-time PCR Quantitative real time PCR was used to determine the copy number of CHRs 4 and 13 in selected strains. An ABI 7500 instrument (Applied Biosystems) was used along with the Power SYBR Green PCR Master Mix from Applied Biosystems according to the manufacturer’s instructions. Each of the amplifications was conducted in triplicate. Primers were designed using the Primer Express program from Applied Biosystems (Table 2.4). In order to ensure the reliability of these primers, they were designed only in highly conserved (100% identity) regions between the genomes of strains H99 and JEC21. In addition, the primers were designed using only exon regions (according to GLEAN models that were available at the Duke’s University Resources for Fungal Comparative Genomics). Also, the primer sequences were used in BLAST searches against the H99 genome (NCBI database) in order to ensure that they would (theoretically) bind to only one region in the genome. That is,  17  MATERIALS AND METHODS only primers whose E-value hit to any off-target sequence was above 0.3 were used (See Appendix D, Table D.1). Two controls were used in the qRT-PCR experiments and these were performed by amplification with primers designed for the actin gene CNA04650 on CHR 1 and the SMGJ gene on CHR 4. The CNA04650 gene (Genbank ID: XP_566591) encoding actin is present in only one copy in the genome of strain H99 (according to BLASTn searches). The SMGJ gene was chosen because it is duplicated in the genome of strain JEC21 (Fraser eta!., 2005b). It therefore represents a useful positive control for identifying two copies of a sequence in a genome. To calculate the normalized cycle number (or iCt) at the regions that were being amplified by qRT-PCR, the following formula was used: zCt  =  I\Ctgene  -  ACtgenome (Livak &  Schmittgen, 2001, Ferreira eta!., 2006), where ACtgene = average cycle of the test gene cycle of actin gene and ACtgo  average cycle of H99 gene  —  —  average  average cycle of the actin gene  (H99). The copy number was then calculated with the following formula: Copy number = 2’ (Fraser et al., 2005b). Only triplicates that gave a SD less than 0.2 were included in the analysis.  Table 2.4 List of primers used for quantitative real-time PCR (qRT-PCR) 1 Name  LesLeu  Sequence Forward  Sequence Reverse  1 CGTCACAAACTGGGACGACAT CNA04650 GCGACACGGAGCTCAYI’GTA 4 CCCCGTAAGGGCCTGAT SMG1 TGGGCCAGAGTCTCGATGAG 13 CTGCTGCAGTCCAAGTTGATG CNNOO82O CCTITGCCACCTrGAGTTTCTI’ 13 TCAGTGGCTCTGGCCTCH CNNOO15O TI’ACGGACCAGGTACCATGGA 13 GCGTCACGAGAGGGAAAATACT TGGTAGTGACATAAGTGTAGTGAGGAA CNNO 1890 13 GGCCCCTACGCCAGCTt CNNO2400 CTGACCm’AGCGAACCAAGATC *13 CGACAAGACCGGCflCCA Neo AAGCGAAACATCGCATCGA 4 GATATCGAGCCCAAGCACAAG 00707 TCGGCTACTGGG1T17CG *For one of the strains, a neomycin marker was inserted into CHR 13.  18  MATERIALS  AND METHODS  A number of strains (in addition to the ones used for CGH) were tested for possible disomy of CHR 4  and CHR  13 by qRT-PCR. These strains  are  listed in Table  2.5.  Table 2.5 List of C. neoformans and C. gattii strains used for qRT-PCR. Serotype Molecular (Mating type) subtype 1FM46084 D (?) IFM5 1645 B (Untypable) IFM5 1621 A (a) IFM5 1627 A (a) IFM5 1636 A (a) ? IFM5 1650 A (Untypable) ? IFM5 1666 \. (a) IFM5 1640-Li (a) FM5 1649-Li A (a) IFM5 1654 B (Untypable) ? 1FM51658-1 A (a) IFM5 1677-Li A (a) 1FM5 1678-Li (a) piO86 A (a) [NI  Source  Reference  E. Tanaka E. Tanaka E. Tanaka E. Tanaka; Clinical strain E. Tanaka; Clinical strain E. Tanaka; Clinical strain E. Tanaka; Clinical strain E. Tanaka E. Tanaka E. Tanaka E. Tanaka E. Tanaka; Clinical strain E. Tanaka; Clinical strain T. Mitchell; Clinical strain (Japan)  (Tanaka et a!., 2005) (Ohkusu et al., 2002) (Obkusu et al., 2002) (Obkusu et a!., 2002) (Ohkusu et a!., 2002) (Ohkusu et a!., 2002) (Ohkusu et a!., 2002) (Ohkusu et al., 2002) (Obkusu et al., 2002) (Obkusu et a!., 2002) (Ohkusu et a!., 2002) (Ohkusu et a!., 2002) (Ohkusu et a!., 2002) Shigefumi Maesaki,  arg1373  A (a)  VNI  r. Mitchell;  arg1366 ig2467 n2637 tn470 )t9 bt68  A (a) A (a) (a) A (a) (a) A (a)  VNI VNI VNI VNI VNI VNI  c8  A (a)  VNI  T. Mitchell; Clinical strain (Argentina) T. Mitchell; Clinical strain (Uganda) T. Mitchell; Clinical strain (India) r. Mitchell; Clinical strain (Thailand) r. Mitchell; Clinical strain (Botswana) T. Mitchell; Clinical strain (Botswana) T. Mitchell; Clinical strain (North . Carolma) Fresh clinical isolate resh clinical isolate resh clinical isolate ‘resh clinical isolate Fresh clinical isolate  .  Strain  .  ?________  .  ?________  .  RTC23 -i TC23 -2 TC23 -3 RTC3 1 Mix A RTC3 1 1 A  .  .  —  —  (?) (?) (?) (?) (?)  ?_________  Clinical strain (Argentina) T. Mitchell Culture Collection T. Mitchell Culture Collection Messer, S. A., Univ. of Iowa Gugnani, H. C., Univ of Delhi (Archibald et aL, 2004) (Litvintseva et a!., 2003) (Litvintseva et al., 2003) (Litvmtseva et a!. 2005) T. Mitchell Culture Collection T. Mitchell Culture Collection r. Mitchell Culture Collection T. Mitchell Culture Collection T. Mitchell Culture Collection  19  RESULTS 3. RESULTS  3.1 Evaluation of genome variation in serotype A and serotype B strains The initial goal of the research in this thesis was to use CGH to characterize genome variation in C. neoformans. The rationale for this work was that the analysis of genome variation has previously provided a way to make detailed comparisons of pathogen isolates, and to potentially identify genomic regions associated with differing levels of virulence (Gressmann et at., 2005, Nash et a!., 2006, Herbert et at., 2005, Rajashekara et at., 2004, Selmecki et at., 2005a, Taboada et a!., 2004, Ellison et a!., 2008). Tn this thesis, the characterization of the genomes of isolates from different serotypes and molecular subtypes of C. neoformans and C. gattii will provide a foundation to understand the background level of variability in these pathogens, and to evaluate genomic differences that might be associated with known and new virulence factors. As mentioned earlier, the three main virulence factors in C. neoformans are the ability to grow at 37°C, the production of melanin to combat the oxidative killing in the host and the production of the polysaccharide capsule (Idnurm et al., 2005). In the context of these main virulence factors, one might expect avirulent strains to have genomic differences in the specific subsets of genes that contribute to these traits.  In addition, an understanding of genome variation might help to  identify genes or gene families that were not previously known to influence virulence. The work presented here illustrates the power of CGH and establishes a database of genomic variation for  C. neoformans and C. gattii.  20  RESULTS 3.1.1 Genome variation in serotype A strains Initially, CGH was used to examine the C. neoformans genomes of selected isolates representing the three molecular subtypes of serotype A strains (called VNI, VNII and VNB). DNA from each of the four serotype A strains (BT63, 125.91, CBS7779, WM626) was NimbleGen arrays containing oligonucleotide probes for the genome of strain m hybridized to T H99, a well-characterized and highly virulent serotype A strain (Giles et a!., 2007, Nazi et a!., 2007, Wright et a!., 2007, Bahn et al., 2005). The genome of H99 was sequenced at the Broad Institute and Duke University, with contributions from the Kronstad Laboratory and the Michael Smith Genome Sciences Centre. The results are summarized in Tables 3.1 and 3.2.  Table 3.1 Summary of the total number of predicted deletions (Log Ratio (LRa) 0.5) or amplifications (LR > 0.5) detected in four serotype A strains relative to the genome of the strain H99. -  # of proposed deletions # of proposed amplifications  BT63 (VND) 193 19  125.91 (VNI) 73 17  CBS7779 (VNI) 10 5  WM626 (VNII) 206 11  The LR cutoff values were chosen based on a dataset that compared sequence identity with the LR for —20 genes at the MAT locus (Hu eta!., 2008). For CBS7779, CHR 13 was excluded from the analysis of the total number of amplifications, because it appears to be disomic.  21  RESULTS  Table 3.2 Comparison of Log Ratios (LR) and standard deviations (SD) for all 14 chromosomes of four serotype A strains that were hybridized to an array of the H99 genome. BT63 VNB) 125.91 (VNI) Average Average SD SD CHR LR LR 0.007 0.674 -0.019 0.438 1 0.013 0.634 0.007 0.312 2 0.034 0.600 0.020 0.272 3 -0.051 0.733 -0.002 0.329 4 -0.093 0.900 -0.097 0.623 5 0.019 0.632 0.023 0.290 6 0.013 0.016 7 0.686 0.338 -0.048 0.773 0.020 0.323 8 0.031 0.625 0.018 0.292 9 0.050 0.612 0.033 0.310 10 0.013 0.653 0.012 0.289 11 0.019 0.668 0.075 0.441 12 0.025 0.627 -0.026 0.345 13 0.026 0.622 -0.006 0.328 14 0.000 0.377 Overall 0.000 0.689 Chromosomes with suspected disomy are highlighted in yellow.  CBS7779 Average ER -0.011 -0.013 -0.018 -0.018 -0.005 -0.035 -0.029 -0.014 -0.036 -0.081 -0.019 0.005 0.562 -0.027 0.000  (VNU SD 0.212 0.159 0.190 0.170 0.212 0.263 0.258 0.183 0.246 0.522 0.212 0.232 0.214 0.232 0.267  WM626 (VNII Average SD ER -0.014 0.634 -0.019 0.637 -0.011 0.660 -0.105 0.778 0.006 0.622 -0.042 0.687 -0.022 0.715 -0.032 0.724 -0.026 0.643 0.034 0.611 -0.047 0.726 -0.085 0.827 0.721 0.884 -0.060 0.685 0.000 0.705  As shown in Table 3.1, the number of regions of difference (e.g. amplifications, deletions, or areas of divergent sequence) was greatest when the VNB and VNII strains were compared with the VNI strains. This was expected because all of these strains were compared to the strain H99, which has the VNI molecular subtype. That is, the amount of variation and deletion corresponds directly with previously known data regarding the molecular subtypes of these strains. Specifically, variation is seen such that VNII>VNB>VNI, relative to the H99 genome (Meyer et al., 1999, Litvintseva et al., 2006, Litvintseva et al., 2003). The specific regions of difference identified in the CGH analysis of all four strain are presented in Appendix A. It is interesting to note that CBS7779 was previously reported to have a small genome of 15 Mb compared to the average size of -49 Mb for C. neoformans (Boekhout et a?., 1997). Based on the CGH data shown in Table 3.2, however, it appears that CBS7779 has all of the sequences found in H99. That is, the results in Table 3.2 suggest that the genome size for  22  RESULTS CBS7779 is at least  19 Mb (the size of the H99 genome) and, contrary to previous reports,  there are no large missing segments of gDNA in this strain (Boekhout et at., 1997). This result probably reflects the fact that electrophoretic karyotyping, which was used by Boekhout et a!. (1997), may not always yield accurate information regarding the genome size of a strain. In fact, contrary to the data of Boekhout et aL,(1997), the results in Table 3.2 revealed that strain CB57779 (and WM626) had an elevated LR for CHR 13 suggesting that the strain may have been disomic for this chromosome. Further analysis of this observation is presented later in this thesis in sections 3.4, 3.5 and 4.3.  3.1.2 Genome variation in serotype B strains CGH was also used to examine genome variability in serotype B strains of C. gattii. DNAs from six serotype B strains (R794, KB3864, KB7892, RV66095, E566, WM276-GFP2) were hybridized to NimbleGenTm arrays prepared with the genome of WM276, an environmental isolate (Hu & Kronstad, 2006, Chaturvedi et at., 2005).  The genome of strain WM276, which  has a VGI molecular subtype, was sequenced by the Michael Smith Genome Sciences Centre. All of the strains which were hybridized to the WM276 array have the VGI molecular subtype (Fraser et a!., 2004, Kidd et a!., 2005). This VGI subtype is the most prevalent subtype in serotype B, it is found worldwide and is one of the three molecular subtypes found on Vancouver Island (Kidd et aL, 2007).  Overall, this specific set of strains was chosen to gain a better  understanding of the genome variation within the VGI subtype, and to make use of the locally generated sequence information (Appendix B, Table B. 1 and Table B.2). A parallel analysis is in progress for strains of the other two molecular subtypes of serotype B strains (VGIIa and VGIIb) found on Vancouver Island.  23  R794 113 9  KB3864 94 12  KB7892 93 5  96 13  E566 69 25  WM276 GFP2 18 40  0.5) in six serotype B strains relative to the  RV66095  -0.5) or amplifications (LR  0.310 0.385 0.359 0.341 0.465 0.343 0.493 0.507 0.458 0.689 0.383 0.423 0.361 0.319 0.319  SD  KB3864 KB7892 RV66095 E566 Average Average Average Average SD SD SD LR ER ER LR 0.053 0.439 0.055 0.316 -0.008 0.456 -0.004 0.000 0.472 0.045 0.383 0.431 0.008 0.014 0.011 0.456 -0.020 0.384 0.417 0.013 0.010 0.013 0.464 0.008 0.346 0.404 0.010 -0.010 -0.029 0.594 -0.018 0.472 0.474 0.004 0.022 0.012 0.493 0.012 0.543 0.350 -0.013 0.025 0.034 0.431 -0.016 0.504 0.006 0.537 0.033 -0.008 0.581 -0.025 0.440 0.513 0.006 0.007 -0.011 0.582 -0.013 0.465 -0.100 0.632 -0.221 -0.171 -0.124 0.900 0.695 -0.031 0.545 0.061 -0.023 0.540 -0.014 0.389 0.390 0.028 0.030 -0.022 0.552 -0.021 0.427 0.591 -0.056 0.000 -0.064 0.666 0.001 0.367 0.592 -0.056 -0.021 0.029 0.440 0.015 0.311 0.018 0.425 0.063 0.000 0.001 0.523 0.415 0.467 0.000 0.000  Chromosomes with suspected deletions or continuous divergences over 50 kb in length are highlighted in yellow.  R794 Average CHR ER 0.025 A -0.002 B 0.011 C 0.015 D -0.012 E 0.018 F -0.011 G -0.017 H -0.005 I -0.116 J -0.006 K -0.015 L 0.009 M 0.020 N 0.001 Overall  WM276 GFP2 Average SD SD LR 0.261 0.017 0.134 0.238 0.010 0.118 0.248 0.015 0.132 0.261 0.010 0.119 0.250 0.012 0.120 0.265 0.017 0.120 0.240 0.020 0.119 0.379 0.015 0.121 0.959 0.010 0.122 0.339 0.018 0.117 0.268 -0.216 1.064 0.417 0.008 0.119 0.510 0.016 0.122 0.238 0.013 0.115 0.365 0.000 0.288  Table 3.4 Comparison of LR and SD for all chromosomes of six serotype B strains that were hybridized to an array of the WM276 genome.  determined by CGH (Hu et al., 2008).  aThe LRs for identifying deletions and amplifications were selected based on comparisons of the sequence identity at the MAT locus with the corresponding LRs  # of deletions #of  Table 3.3 Summary of the total number of deletions (ERa genome of the strain WM276.  RESULTS The results of the CGH analysis with the serotype B strains are summarized in Tables 3.3 and 3.4, and the detailed list of the specific regions of difference between the strains is presented in Appendix B (Tables B.l and B.2).  Three main conclusions can be drawn from these data.  First, there appeared to be extensive sequence variation in these serotype B strains despite the fact that they all have the same molecular subtype (all are VGI). By comparison, the SD of the LR for CBS7779 and WM626 when hybridized to H99 (all three strains are of the molecular subtype VNI from serotype A) were 0.267 and 0.3 77. The SD for the serotype B strains of the VGI subtype, however, ranged from 0.288 (WM276  —  GFP2) to 0.523 (KB3864). Although  more strains need to be screened, the results suggest that there could be a wider degree of sequence polymorphism within the VGI molecular subtype of serotype B strains than in the VNI molecular subtype of serotype A strains. Second, none of the chromosomes in these strains showed the higher LRs indicative of CCNV that was found for the serotype A strains CBS7779 and WM626. Finally, the CGH analysis identified LR differences suggestive of relatively large deletions or areas of divergence (greater than 50 kb) in strains E566 and WM276-GFP2. The latter strain is an avirulent mutant that was serendipitously obtained during a transformation experiment to introduce the gene for green fluorescent protein into the strain WM276 (which is virulent in a mouse model of cryptococcosis). Further analysis of the deletion in WM276-GFP revealed that the 75 kb deletion included the telomeric region at the right end of CHR K. This deleted region contained 25 predicted genes (Appendix B, Table B.2).  The 88 kb region in  E566 with the low LR contains the mating locus and this region is therefore not deleted. Instead it is merely divergent from the reference strain. This result makes sense because E566 is MATa and WM276 is MATa (Appendix B, Table B.l).  25  RESULTS  3.1.3 Confirmation of a selected subset of CGH data In order to confirm the presence of the deletions in the genomes of selected strains, two sets of primers were designed flanking two predicted deletions. The subsequent PCR products were subjected to gel electrophoresis and sequencing. An example of the result for one deletion is shown in Figure 3.1. Similar results were obtained with the other deletion.  Fig. 3.1A  Fig.3.1B c ..  cy .‘.  — ..  .  —  212S  BT63  chr3  2.0  0  16 5S71r (j4  125.91  —  2  bp  3742  TOLaI  —_--------_--  --  —  10 —  04GOLp 3731 Ra., Tot.I Pc  05  Figure 3.1 Confirmation of the presence of a deletion in the serotype A strain BT63. A. Hybridization of DNA from strains BT63 and 125.91 to the H99 array. The array data suggested that there was a deletion on CHR 3. Each probe (black bar) represents 400 bp, thus providing an estimated deletion size of 1200 bp. B. Confirmation of the presence of a deletion by PCR. Subsequent sequencing of the amplified region in BT63 revealed that 1237 bp were deleted. The average LR in that region was -2.868. The deletion was also surrounded by highly repetitive sequences suggesting that it may have been the result of a recombination event between the repeated sequences.  The results shown in Figure 3.1 confirmed the presence of a deletion in strain BT63, as predicted by CGH (see Appendix A).  This deleted region was on CHR 3 (at approximately 1443600  -  1445200) and the deletion removes a gene that was identified by the GLEAN prediction model as glean_04239. Based on the Fungal Genome Database at Duke University and available EST  26  RESULTS sequences, glean_04239 is a transcribed gene. A search with psi—BLAST revealed 41% identity with a gene encoding a putative trypsin  —  a domain.  This domain has been implicated in a  variety of functions including basal membrane formation, cell migration, cell differentiation, adhesion, signaling and chromosomal stability (Marchler-Bauer et al., 2007). Because there is such a wide range of possible functions, it is difficult to predict the exact influence that this gene deletion might have on the phenotype of BT63.  In any case, its deletion and subsequent  identification by CGH illustrated the ability of CGH to find regions of difference in the strains of interest selected in this study.  3.1.4 Overall analysis of genome variation in serotype A and serotype B strains In general, the comparisons of the regions of difference within the serotype A strains and within the serotype B strains did not reveal any clear patterns of genomic variations. That is no specific types of genes or chromosomal regions (e.g., centromeres or telomeres) differed between the strains. Instead, it was found that a wide variety of genes were either amplified or deleted between the different strains. One possible exception was that transport and trafficking functions appeared to be commonly deleted or divergent in some of the serotype A and serotype B strains; these included putative drug transporters (missing in BT63 and WM626), trafficking proteins (missing in 125.91 and WM626), a monosaccharide transporter (missing in 125.91), efflux proteins (missing in WM626), a MFS aipha-glucoside transporter (missing in BT63), and hexose transporters (missing in R794, KB3864, 125.91, BT63 and WM626). One additional difference that could be related to virulence was that the gene for a delayed-type hypersensitivity antigen-related protein was missing in 125.91 and BT63.  27  RESULTS One gene of interest that was deleted in BT63 encoded a phosphatidylinositol transporter (GenBank ID: XP_571089) (see Appendix A). This gene may be related to virulence because inositol has been reported to be important for C. neoformans during pathogenesis (Molina et a!., 1999) and a previous study in our laboratory revealed that the addition of lithium, an inhibitor of inositol monophosphatase, decreased capsule production (Hu et al., 2007). In addition, the idea that inositol may play a role in virulence is supported by the fact that one of the most abundant transcripts produced by the strain H99 during the infection of rabbit CSF is a myo-inositol transporter (Dr. Guanggan Hu, unpublished data). Thus, it was predicted that the deletion of the gene for inositol synthetase (which is upstream of the inositol pathway (Saccharomyces Genome Database available at http://www.yeastgenorne.org/ last accessed May 2008)) might also influence the production of capsule (Dwight S. S., eta!, 2002). However, the deletion mutant for the gene (Broad ID: CNC06440) did not reveal any clear changes in capsule size or melanin production and did not display any attenuation in a mouse model of cryptococcosis (I. Liu, data not shown). The mutant, however, failed to grow in the absence of inositol, as expected from similar mutations in other fungi (Ulaszewski et a!., 1978). In summary for this section, the CGH analysis of different serotype A and B genomes revealed an extensive level of genome variation for these strains (See Appendices A and B). The regions of difference provide a foundation for future investigations to link these genes to any differences in virulence amongst these strains. In addition, the analysis of the serotype A strains resulted in the exciting discovery that strains CBS7779 and WM626 may have an elevated copy number for CHR 13. Further work on this discovery is presented in sections 3.4 and 3.5.  28  RESULTS  3.2 Examination of a genetic cross and recombination sites for serotype D strains It has been shown that CGH can detect variation as low 2% between the genomes of closely-related strains (Taboada et al., 2005). Thus, it was reasoned that CGH would be able to reveal the chromosomal sites of meiotic recombination between strains of the same serotype of C. neoformans. To specifically test this idea, the genomes of serotype D strains of mating types MATa and MATa were examined using N1H433 as a representative MATa strain and Nll112 as a representative MATa strain. These strains were originally used as the parental strains in a backcrossing experiment to generate congenic MATa and MATa strains (Fraser et al., 2005b, Heitman et a!., 1999, Kavanaugh et a!., 2006). One of the progeny, JEC21 (MATcr), has been used extensively as a laboratory strain and its genome has been sequenced (Loftus et a!., 2005). This presented an opportunity to compare the NIH 12 and NJH433 parental genomes to the genome of the progeny strain JEC2 1 on a tiling array. The results (Figure 3.2) revealed regions of alternating patterns of divergence and similarity that likely identify which segments of the JEC21 genome originated from which parent. This idea is supported by the observation that if the hybridization pattern of one parent was divergent, then the hybridization of the other parent was more similar. These patterns were revealed by the extent of noise in the LRs whereby the greater the noise, the greater the divergence. In short, the data suggested that recombination sites due to a meiotic event can be mapped throughout the genome by using the CGH method.  29  (lii’  2  I  -  I__  -4-j_  —-‘-i  -  --  ‘  niw--as-aaj  -.  Chr 6  -we  ChtS  Chr 4  •y-n  t Chf  u•:,i-Lr,rL  -  -  .4frfl4PU*L4441t Chr’S-” ti* *qflu  I  Lqj4  rnc’t-LI, 1 .uJ S4’  cikr  w—  _L”  Ionic  Maling  —  -  i..  tf4  -  ..,  ,  --  —  -  ‘  t ittr_L i.aiju  (‘lu 14  -  r-1pL.  AS44  -.  JItLtIflhtThAbUJr  -.  12  C113  •-  IJIL  iii  hfla.uAnwawa  •  -  Clii’ 1t  ...L.  .o4i.iii  -404 b’ fl  t’ .$4ti4Ltflfl*1IUi.iJpL.fig  C-I  440..  -‘  -  tmSAftSflijflA1rc  (‘luS  w  array  C& 10 chriG r,flp LØfl$4  -A  -  JEC21 (CyS) vs N1H433 or NIH12 (cy3) onJEC21 i//If//f f//f//I/f//I  Figure 3.2 An overview of the hybridization ofNIH433 and NIH 12 DNA to a TEC21 aitay (a strain resulting from a cross of NI11433 and NIH12). Regions with variable ER represent regions of sequence diversity and regions with LRs close to zero represent regions of conformity. Comparing these different regions revealed putative recombination sites (see Table 3.5)  NIH12  N1H433  NIH12  N1H433  NIH12  N1H43 3  NTH12  N1H433  NIH1 2  N1H433  NIH1 2  N1H433  NIH1 2  N1H433  JEC21  C,,  RESULTS  .  Coordinates 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 4 4 4 4 5 5 6 6 6 6 7 7 8 8 8 9 9 9 9 10 11 12 12 13 14  1 -43532 43576-856009 856053-1104183 1104402-1856406 1856450-2299466 1 14866 14910-59776 59820-79744 79788-905375 905419-1023729 1023773 1388827 1388871 1433328 1433372-1632054 1 1218953 1218997-1656795 1656839-2105433 1-381958 382002-943451 943495 1668854 1668898 1782959 1 969309 969423 1507393 1 75987 76020-1291564 1291702-1431588 1431632-1438769 1-230738 230827 1346622 1-318879 318923-529999 530208-1194145 1-300354 300419 487358 487446 954505 954549-1168552 whole chromosome whole chromosome 1 689977 690021 906616 whole chromosome whole chromosome -  -  -  -  -  -  -  -  -  -  -  -  -  -  .  .  Divergent Strain NIH12 N1H433 NIH12 N1H433 Nll{12 N1H433 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 N1H433 NIH12 N1H433 NTH12 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 N1H433 NIH12 N1H433 NIH12 N1H433 NIH12 N1H433 N1H433? NIH12? NIH12 N1H433 NIH12? NIH12?  AVG LR of N1H433 -0.032 0.001 0.073 -0.015 0.040 0.066 -0.110 -0.027 0.051 0.017 0.070 -0.009 0.020 -0.003 0.071 -0.049 -0.156 0.066 -0.281 -0.042 0.059 -0.176 -0.034 0.044 0.006 0.178 0.014 -0.005 0.058 0.045 -0.018 0.033 0.020 0.047 -0.068 -0.014 0.036 0.023 -0.036 0.042 0.055  SD of Nffl433 0.367 0.381 0.176 0.484 0.337 0.504 0.362 0.402 0.190 0.343 0.182 0.356 0.194 0.378 0.257 0.466 0.766 0.178 1.023 0.236 0.179 0.904 0.209 0.288 0.197 0.745 0.199 0.421 0.435 0.175 0.448 0.193 0.456 0.174 0.412 0.397 0.191 0.276 0.322 0.206 0.209  AVG LR of Nffl12 -0.593 0.070 -0.015 0.098 -0.121 -0.205 -0.307 -0.109 -0.01 0.074 -0.021 0.067 -0.219 0.08 -0.037 0.016 0.028 0.015 0.094 -0.4 12 -0.062 0.109 -0.273 0.014 -0.127 0.142 -0.072 0.077 0.024 -0.073 0.043 -0.108 0.097 -0.009 -0.02 0.055 -0.083 0.0 14 -0.076 -0.087 -0.063  SD of N11h12 0.837 0.181 0.420 0.207 0.608 0.386 0.441 0.367 0.412 0.164 0.422 0.208 0.658 0.187 0.652 0.201 0.202 0.414 0.202 0.750 0.489 0.280 0.433 0.382 0.406 0.526 0.403 0.200 0.210 0.420 0.199 0.460 0.209 0.369 0.217 0.200 0.455 0.358 0.360 0.584 0.474  Table 3.5 SD was used as a measure of LR (Log Ratio) divergence for each chromosome in the parent strains N1H433 and NIH12 upon hybridization to the JEC21 array. In each region, the higher SD correlated with the more divergent ER as determined by visual inspection (highlighted by yellow). Regions which contradict this idea were highlighted in blue. 31  RESULTS To confirm the CGH results, regions from four chromosomes were selected, amplified by PCR and sequenced. As shown in Figure 3.3 and Table 3.6, regions with highly divergent LRs (higher SD’ s) were correlated with lower sequence similarities and regions with LRs close to zero (lower SD’ s) were correlated with high sequence similarities. Visual inspection revealed that some of the chromosomes did not display a clear divergence in either N1H433 or NIH 12 (CHRs 10, 11, 13, and 14).  Thus, an attempt was made to quantify this phenomenon by  calculating the average LR and standard deviation (SD) of each of these chromosomes (Table 3.5). Although previous data would suggest that LRs can be used to extrapolate the sequence similarity for a given region (Hu et a!., 2008), in the case of CHRs 10, 11, 13, 14, it was necessary to use SD. The reason behind this is that the average LR for each of these regions was close to zero (Table 3.5), therefore suggesting that there was no sequence divergence. Nevertheless, a visual inspection of the SD data suggested otherwise. That is, it was found that the SD method can be used to reveal the predicted parental origin of each chromosome if a visual inspection of the hybridization data does not reveal any clear information. Overall, the data in Table 3.5 clarified the origin of the gDNA segments in JEC21: in general, regions with LRs close to zero (the parent) correlated with a lower SD.  Table 3.6 Summary of the average LRs and SD between NIH433 and NIH 12 in  Primer Name  Region of Interest  AVG LR of N1H433  SD of LR of NIH4 33  Sequence Identity of N1H433 to JEC21  (%)  selected areas across the genome. AVG LR of Nffl12  SD of LR of Nffl12  Sequence Identity of N1H433 to JEC21  (%)  acidphos CHR3, 1652975- 1654900 0.3 19 0.204 0.686 96.0 0.195 100 0.236 0.110 100 0.026 ino3phos CHR3,1870085-1871085 0.382 96.8 CHR 5, 340983 342137 0.170 98.4 thiolox 0.080 100 0.066 0.685 CNGOO7 CHR. 7, 225200 227200 -0.017 0.130 100 0.234 0.760 97.1 CNIO17 CHR 9, 487200 489600 Did not sequence -1.804 0.950 89.3 Data was generated through PCR, sequencing and aligning the sequence against JEC2 1 via BioEdit. For a pictoriai representation, see Figure 3.3. The more divergent sequence as determined by visual inspection is highlighted in yellow. -  -  -  32  RESULTS  Figure 3.3 A  Chromosome 5  —  0.179  0.213  0.097  0.285  0.258  -0.129  -0.155  0.069  -0.095  Similarity(%)  100  100  57  58  100 45  100  53  100 45  100  #of base pairs  100 45  100 45  100 45  LR  fr  ‘3  e fr  ‘5&  fr  &‘  ‘3  ‘5  a’  er  ‘3  It  P  c  1.  45  N  It  It  ‘t’  It  It  cf’  It  e’3  cc’3  ‘_v  ‘5  chr5  45287 anavg 29145 Rowo Total Pasoons ( 1658-1 -  -  1507304  Data Values -5.55 Ia 3.73  .14:151 rrur.  .::  67662 no,inalizact  -  29145 Rows, Tat  LR Similarity (%) #of base pairs  Figure 3.3 B  —  2617  0.050  10  0.247 100  -0.405 97  53  45  &  It  °‘3  ), Data Values -5.03 to 3.43  -1.014 95 45  0.388 100  0.590 100  0.405 100  0.657  57  58  45  45  -0.734  0.951 97 45  100  97 45  Chromosome 9 cP  ‘3  It  ‘3  Pa Lions) 16684- 1507394  &  It  15  ‘5  N  & 1  ‘3  & &  & &  15  5.  & oP  ‘3  & oP  ‘3  & oP  ‘5  & oP  ‘5  oIt  ‘3  & oP  & ‘3  ‘3  It  & oP N  oP  It  It  N  oP  oP N  chr9  ci t--ritt 45267 anaa9 -23775 Flows. Talal Pustoans (141-1176553 I. Data Values -2 t’ :a2.61  2000  35110 -2041,  .  .  ,  ,  ,  .  ,  .  Wib 61662 naetcatiied-23175 Rows,Tnlal Positions) 141-1175503), Duta/ues\çtu250  LR Similarity (%) # of base pairs  -2.080 96 50  -2.453 82 45  -0.679 91 45  -2.158 77 45  -0.584 97 48  -2.858 93 45  Figure 3.3 Analysis and confirmation of the N1H433 / N11112 hybridization patterns to the JEC21 array. Segments of four different chromosomes are shown in the figure. The resulting PCR and sequencing supported the idea that CGH can be used as a tool to identif3’ recombination sites across the genome. That is, regions that CGH revealed to be more divergent (as shown by the greater range of values for the LR) were confirmed by sequencing.  33  RESULTS  Figure  -4615  3.3 C  —  Chromosome  7  45287 onoog -27474 Rows. This’ Posnrs (78- 1346623): Data Values -462 to 203  2 22  1  o ooo -2 575  61662 no,mai(2e6 -27 74  LR Similarity (%) #ofbasepairs  a. ThtaI Postuor-s) 76- 1246623  -0.048 96 59  -0.168 96 58  Data Votoos -2 56 to 2 22  0.215 96 51  -1.093 97 45  0.921 100 45  1.116 100 57  0.697 95 47  34  LR Similarity (%) # of base pairs  -  2U  ‘I SOf  ..  LR Similarity (%) # of base pairs  61662  0.817 100 53  0.281 100 45  0.189 100 45  -  -0.125 100 53  1406  0.304 100 45  2105434  LR Similarity (%) # of base pairs  ,  LR Similarity (%) # of base pairs  Data Valus-621 1o227  0.217 97 45  ot;7LO77 uw Total Poitloo  / / /  0.610 95 45  1.106 -21054341 Data Vatuo -481 to 205  -  d’  1.092 97 45  ,li.’ai 41077 Ftwt.. Tttl Pno3oes  \  0.696 91 46  Chromosome 3  45287  —  0.370 100 45  Figure 3.3 D  0.111 97 45  -0.079 98 54  0.200 100 54  ,4,  0.367 100 45  -0.550 93 45  /_  0.321 100 45  -0.023 97 46  f/  0.084 100 46  0.638 100 57  0.298 100 57  0.058 96 52  0.147 100 52  H  RESULTS In summary for this section, the calculation of the average LRs and the SDs suggested that CGH is a sensitive technique, capable of tracking the recombination history of a strain. This sensitivity was confirmed by sequencing and subsequent sequence alignments.  3.3 Examination of serotype AD strains CGH was also used to determine the chromosome content of the serotype AD hybrid strains. As mentioned, C. neoformans is normally haploid and a given strain will possess only one capsular serotype (e.g. A, B, C or D) (Idnurm et al., 2005). However, clinical strains have been identified which are diploid, and some of these possess two serotypes (such as the AD strains) (Brandt et al., 1993, Tanaka et al., 1999). In general, they are thought to arise from mating events between parental strains of differing serotype (e.g. serotype A and serotype D) (Lin et al., 2008). Tn the past, there have been multiple attempts to characterize AD strains with respect to specific genes (Lengeler et al., 2000; Cogliati et a!., 2001, Lin & Heitman, 2006), but no comprehensive attempt has been made to identify the exact composition of the genomes of these strains.  Meanwhile, comparisons of serotype A and D isolates generally indicate that  serotype A strains are more virulent than serotype D strains. For example, serotype A isolates predominate in patients with AIDS over serotype D isolates (Ohkusu et al., 2002). Thus, it was hypothesized that clinical serotype AD hybrid strains might preferentially retain the chromosomes from the serotype A parent over those of the serotype D parent. In addition, it was predicted that any serotype A chromosomes that would be preferentially retained may encode functions that would explain the virulence differences between serotype A and serotype D. To test this hypothesis, DNAs from three clinical serotype AD strains (CDC228, KW5 and CDC3O4) were hybridized to arrays for a serotype A genome (strain H99) as well as a  36  RESULTS serotype D genome (strain JEC2 1) to determine chromosome content. An overview of the data is presented in Figure 3.4 and Table 3.7. For comparison, environmental strains were also tested for the predominance for serotype A chromosomes as described below. In this case, PCR-RFLP analysis was used instead of CGH.  37  00  tj  1  t_.Lfl_,  1  Ai ‘J’t  KW5  rinri  4-  -  2  2  4  •1 5  6  7  3  4  5  6  7  --.  891011121314  w,iIaIIouh,r ¼fflIFø1S Mfl190411 I. (44479 04001up) -  891011121314  inhoIooMjMYOMN9VL(44!$Ofi4!Dhp;  3  *k!!”°” (orM)%!IWYN.Mfl!4m9i444fl99_fl4ooIp)  --  H  4--.  4/  4-1  4  1  1  1  2  2  2  4  5  6  7  8  9 1011 121314  3  Sc!mwIIh.IioII  3  5  6  7891011121314  4  5  6  7  891011121314  For M)MIW’1159 S )%iN)115H Fbi 194 O4INJbPF  4  SocnuothrntbrfliWH5S SONIiM)USi%9iO4(Hfl.p)  3  Sgi.icnIatIon!orN.NA(ç&OOhii4OOIp)  Hybridized to 1199 (Serotype A)  Figure 3.4 Overview of the CGH data for the AD hybrid strains. Each colored segment represents a different chromosome and the chromosomal numbers are based on the TIGR annotations used for JEC2 1.  I.  a4  4  CDC 228  Hybildized to Jec 21 (Sei’otype D)  C,,  C  RESULTS Visual inspection of the hybridization data (Figure 3.4 and Table 3.7) suggested that chromosomes of both serotypes were not equally represented in the AD strains. Differences were apparent among the three strains for CHRs 1, 6 and 7 upon hybridization to the JEC21 array, and for CHRs 5 and 8 for the H99 array.  In order to quantify the data shown in Figure 3.4, the  average LR of each chromosome was calculated and any average LR below -0.5 was classified as a deletion. This quantification, shown in Table 3.7, revealed that AD strains do not have equal representations of their genomic content from either the serotype A or serotype D parental strains. In fact, these clinical AD strains seem to preferentially retain the serotype A chromosomes. In the seven instances where only one parental chromosome was retained, five of them retained the serotype A chromosome.  For example, strain KW5 appeared to have only the serotype A  version of CFTRs 6 and 7 and only the serotype D version of CHR 8. Strain CDC3O4, however, had the serotype D version of CHR 5. Most strikingly, all three strains have LRs  <  -0.5 at CHR  1 when hybridized to the serotype D array. This suggests that these strains did not retain the serotype D version of CHR 1. The copy number of the remaining serotype A copy of CHR 1 for these strains is not known. In summary, the AD hybrids chosen in this study were mostly diploid with two copies of each chromosome (Lengeler et al., 2001), but the CGH data indicated that each chromosome may not necessarily be represented by both a serotype D and a serotype A version.  39  RESULTS  Table 3.7 Average LR of each of the chromosomes for the serotype AD strains CDC228 Hybridized to CHR 1 V CHR2 V CHR3 V CHR4 CHR 5 V CHR6 V CHR7 CHR 8 CHR 9V CHR 1OV CHR 11 CHR 12 CHR 13 CHR 14  KW5  CDC3O4  JEC21  H99  JEC21  H99  JEC21  1199  -0.837 0.296 0.120 0.069 0.128 0.113 0.115 0.077 0.108 0.086 0.117 0.087 0.118 0.052  0.388 0.099 -0.034 -0.075 -0.095 -0.057 -0.046 -0.196 -0.03 8 -0.036 0.055 -0.065 -0.097 -0.097  -0.642 0.271 0.281 0.234 0.288 -0.741 -0.752 0.575 0.27 1 -0.076 0.253 0.230 0.285 0.263  0.386 -0.055 -0.085 -0.098 -0.09 1 0.389 0.403 -1.361 0.087 0.321 -0.072 -0.15 1 -0.126 -0.112  -0.888 0.462 0.061 0.033 0.480 0.077 0.079 0.034 0.068 0.052 -0.016 0.039 0.038 0.011  0.171 0.109 0.085 0.088 -0.983 0.083 0.087 -0.073 0.075 0.100 0.022 0.041 0.022 0.020  Serotype D was represented by JEC21 and serotype A was represented by H99. In most cases, each chromosome had both a serotype D copy and a serotype A copy. However, there were some chromosomes where there was only one serotype present. Here, the missing serotype was highlighted in yellow. Red check marks represent chromosomes that have been confirmed by RFLP in this study. Blue check marks represent chromosomes that have been confirmed by PCR in another study (Lengeler et a!., 2001).  In order to test the hypothesis that there is preferential chromosome retention from a particular parent, a series of PCR-RFLP analyses were performed. A representative example of one of these experiments for CHR 5 is shown in Figure 3.5. The rest of the data can be found in Appendix B. The amplification of a PCR product from the gDNA of these AD strains and digestion with a restriction enzyme confirmed that only the serotype D version of CHR 5 is present in CDC3O4.  40  RESULTS  Sizeinkb 2 1.6  1  JEC2 2 13  H99 CDC 228 KW5 4  5  6  7  8  9  CDC 304 10  11  12  — —  Lack serotype A —  1. 2. 3. 4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC21 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. 8. 9. 10. 11. 12.  CDC228 digested KW5 KW5 digested CDC3O4 CDC3O4 digested No template control  Figure 3.5 Analysis of serotype AD strains, with an emphasis on CHR 5 using primer pair CNE04380 FIR. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by 1199. The amplicons were digested by Taq I after purification though the Qiagen Nucleotide removal kit. The resulting patterns support the CGH data (Table 3.7). That is, CHR 5 for CDC3O4 appears to come from only the serotype D parent and not from the serotype A parent, whereas the other AD strains, CDC228 and KW5, have CHR5 copies that originated from both serotype D and serotype A. In total, CHRs 1, 2, 3 and 5 were tested with PCR-RFLP and the results agreed with the CGH data (Table 3.7; the analysis of other chromosomes is presented in Appendix C). In these PCR-RFLP studies, CHRs 1 and 5 were confirmed to show preferential retention, and CHRs 2 and 3 were used as controls for the retention of sequences from both A and D parents. In previous studies reported in the literature, CHR 6 in strain KW5 had both copies from the serotype D parent (Lengeler et al., 2001) and this agrees with the CGH data. In the process of studying the serotype A bias of CHR 1 for the three AD strains, however, a minor discrepancy was observed between the CGH data and the PCR-RFLP data (Figure 3.6).  41  RESULTS  Sizeinkb 2  1  2  3  4  5  6  7  8  9  10  11  — Serotype  1 ii  jj 0.5  —  1. 2. 3. 4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC21 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. 8. 9. 10. 11.  CDC228 digested KW5 KW5 digested CDC3O4 CDC3O4 digested  Figure 3.6 Analysis of serotype AD strains, with an emphasis on CHR 1 using primer pair CNAO 1230 F/R. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by 1199. The amplicons were digested by Aval after purification though the Qiagen Nucleotide removal kit. As shown in Figure 3.6, it is clear that all three strains have the serotype A version for CHR 1, as predicted by CGH. The faint bands seen in lane 11 for CDC3O4, however, suggest that the story is not that simple. There are three possible ways to interpret these data: 1. The original colony that was used for the PCR-RFLP study in Figure 3.6 was not a pure population. That is, some of the cells had both a serotype D and a serotype A version of CHR 1 and some of the cells (majority) had only the serotype A version of CHR 1. 2. There was a translocation event such that the locus in CHR 1 that was used to confirm the CGH data in Figure 3.6 was duplicated, giving the cell both a serotype A and a serotype D version of this locus. 3. The primer bound to another chromosome to give a non-specific amplification product.  42  RESULTS In order to test these possibilities, several single colonies from CDC3O4 were selected and gDNA was extracted. PCR-RFLP analysis was then performed to again assess CHR 1 as shown in Figure 3.7.  3  Size in kb 2 1.6  1. 2. 3. 4. 5. 6. 7. 8.  4  5  6  7  1 kb plus ladder JEC21 JEC2 1 (Ava I digest) H99 H99 (Ava I digest) CDC228 CDC228 original sample (Ava I digest) CDC 228 new single colony (Ava I digest) —  —  8  9  10 11  12 13 14  15  16 17  9. CDC228 original sample (Ava I digest) 1O.KW5 11. KW5 original sample (Ava I digest) l2.CDC3O4 13. CDC3O4 original sample (Ava I digest) 14. CDC3O4 new single colony (Ava I digest) 15. CDC3O4 new single colony (Ava I digest) 16. CDC3O4 new single colony (Ava I digest) 17. 1 kb plus ladder -  —  -  -  -  -  Figure 3.7 Analysis of serotype AD strains, specifically that of CHR 1 through the use of the primer, CNA123O F / R of single, re-isolated colonies of various strains. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by H99. Single colonies were selected for this RFLP analysis.  As shown in Figure 3.7, some of the colonies displayed a different RFLP pattern (lanes 13 to 16) and the results therefore support the first possibility that the original CDC3O4 strain was a mixture of cells with different complements of CHR 1. Also, it appeared that the majority of these cells had only the serotype A version of CHR 1 (based on the RFLP analysis and the CGH data). That is, only a minor population of the cells (seen in lane 15) had both a serotype A  and serotype D version for CHR 1. This is important because it suggests that the strain started  43  RESULTS with both a serotype A and a serotype D copy of CHR 1, but the serotype D version of CHR 1 was lost (perhaps through selective pressure either in the patient or during laboratory passage). This then raised an interesting idea as to whether the prevalence of the serotype A (or AA) pattern for CHR 1 for these clinical AD strains is due to the selective pressure inside the host. That is, it is possible that clinical strains (which may be more virulent than environmental isolates) may have a bias towards serotype A chromosomes. To test this idea further, a number of clinical and environmental isolates were selected and characterized by PCR-RFLP analysis (see Table 2.3 for a list of the isolates).  Table 3.8 Summary of the serotype-specificity of CHR 1 in selected strains.  T  ) Clinical strains Environmental Lab generated  1 1 1  -[ 8 5 3  AA 12 1 1  The data were gathered by performing PCR-RFLP analysis on the CNAO 1230 locus. Restriction enzymes Aval and MspI were used.  As showii in Table 3.8, there appeared to be a bias for clinical strains to have the serotype AA pattern for CHR 1 (12 of 21 strains) compared to the serotype DD pattern (1 of 21 strains). An attempt was made to test whether or not the particular strains which are AA for CHR 1, instead of AD or DD, have commonly enhanced virulence characteristics. However, tests for the three main virulence factors (Idnurm et al., 2005): growth at 37°C, the ability to produce capsule and the production of melanin did not reveal any correlation with chromosome complement at CHR 1 (data not shown). Overall, these results support the idea that there could be preferential retention of specific chromosomes in hybrid strains; this genomic pattern could introduce biases in the molecular  44  RESULTS typing of certain chromosomes in C. neoformans, depending on the chromosomal locations of sequences used for strain identification.  3.4 Chromosome Copy Number Variation (CCNV) 3.4.1 Experimental set-up to examine CCNV During the course of the analysis of genome variation in section 3.1, it was noted that two strains, CBS7779 and WM626, appeared to have an elevated copy number for CUR 13 (Table 3.2). As a result of this observation, it was hypothesized that genome variation in the form of disomy for CHR 13, called chromosome copy number variation (CCNV), might affect the expression of virulence factors such as melanin in these two strains. This hypothesis was developed after Dr. Guanggan Hu found that CBS7779 and WM626 showed reduced melanin production when compared with strain H99 (Hu et al., 2008). If there is a link to melanin production, CCNV could potentially be a mechanism to regulate phenotype switching, and hence control the level of virulence factor production. That is, C. neoformans might alter its virulence through CCNV depending on host conditions (e.g., tissue location, extracellular growth vs. growth inside phagocytes). It is important to remember that Cryptococcus is normally a haploid organism (Idnurm et al., 2005) and that disomy had not been previously characterized in this fungus. Because this is the first time that CGH is being used to study C. neoformans, quantitative Real-Time PCR (qRT PCR) was used to confirm the initial findings with strains CBS7779 and WM626. The qRT-PCR method was also used to further investigate CCNV and its relation to virulence factors (specifically melanin production). As a first experiment to test the sensitivity of the qRT-PCR assay, a serial dilution of template DNA was performed to examine how well copy number  45  RESULTS correlated with the amount of gDNA used in the reactions.  The primer set used for this  experiment (Figure 3.8) was for the gene CNA04650, which encodes actin. This primer set was used as a control for all of the qRT-PCR experiments described below because it is present on CHR 1 as a single copy in both JEC21 and H99.  Sensitivity of qRT-PCR 1.00  — —  z--—-----.---  -----  .-.-----  -  — —  I  0.10  0.01 F-  —  0.00 0.01  J__....,L_..L.1  -  ._  0,1  1  10  I  (If  100  Concentration of gDNA added per well (ng/ul  Figure 3.8 Testing the efficiency and the sensitivity of qRT-PCR for the primer CNA04650 in H99. The R 2 value was 0.9972.  Based on the results shown in Figure 3.8, it appears that qRT-PCR is very sensitive. Consequently, within the concentration range of 0.8 ng/il to 80 ng/p.l, qRT-PCR can be used to accurately detect the copy number of the locus in question, because of the high R 2 value (0.9972). Thus, qRT-PCR can be used to detect changes in copy number of certain genes in gDNA, a 46  RESULTS finding that is supported by previously published data that used qRT-PCR to detennine gene copy number in other fungi (Selmecki et a!., 2006).  Furthermore, the primer efficiency as  calculated by the R 2 value is within the acceptable range seen in most qRT-PCR experiments (Lim eta!., 2008, Ingham et a!., 2001, Ferreira et al., 2006). To examine CHR 13 in more detail, a series of additional primers were designed along the chromosome (CNNOO82O, CNNO189O and CNNO2400) and these were used to test for disomy by qRT-PCR. An addition primer pair (called SMG1) was designed at the SMG1 locus on CHR 4 to serve as a positive control because this gene is duplicated in the strain JEC21 (Fraser et a!., 2005b), but it is not duplicated in H99 (Fraser et a!., 2005b). Unless otherwise indicated, the same gDNA that was used for the CGH experiments was also used for the qRT PCR experiments. In addition, the analysis of CHR 13 was extended to other strains originating from the CSF of AIDS patients, as well as strains which had been identified to have more than the usual amount of DNA via FACS (Fluorescence Activated Cell Sorter) analysis (Ohkusu et a!., 2002) (see Table 2.5 for a list of these strains).  3.4.2 CCNV in the serotype A strain CBS7779 As mentioned, the initial CGH data suggested that CBS7779 may have disomy at CHR 13 (Figure 3.9 and Table 3.2). The analysis of CBS7779 by qRT-PCR is shown in Table 3.9. The first observation was that the SMG1 primers showed the expected normalized copy number (1.85) in JEC21. This positive control indicated that the qRT-PCR approach can detect CCNV in gDNA. Thus, if there was disomy for CBS7779, then the expected normalized copy number would be CNNO2400).  2 for each of the genes of interest on CHR 13 (CNNOO82O, CNNO189O and As seen in Table 3.9, however, the primers gave normalized copies numbers  47  RESULTS ranging from 1.27 to 1.45. Two possible ways to interpret this data is that only a portion of the cells in the population may have an elevated copy number for CHR 13 or that disomy of CHR 13 in CBS7779 is unstable.  4DhrlO  1  V63Tx  chrll 1 ‘?.$rtrsr Li4ii.ii ,j 61655040080- 3693 Rows. Totsi Powttons (800- 1561954  o -rijiir  Oats Values -449 to 114  1.  .1!  3l655_0400p- 1885RosTotlPc&ons(0-773967)DataVa1ues-387to3J5  •chrl3  o  $  .,unurTr%-%  r4Ytj 1 lI  61655040096- 1749 Rows. Total Po&tions (800-755968). Data Values -2.03 to 3.67  2..r14  1  tJ..J.cfT.I7 .  1655_040OOp 2265 Rows. Total PosOons(400- 925192 ). Data Values -332 tot 15 -  Figure 3.9 CGH data of CHR 10 to CHR 14 of the strain CB57779 hybridized to the H99 array. The red arrow highlights the possible disomy of CHR13. The idea that CBS7779 has a disomic chromosome is supported by the fact that in separate experiments, Dr. Guanggan Hu created a knockout of the gene at CNNOO 1890 (in CHR 13) (Hu et a?., 2008). This work involved the use of Southern blot hybridizations (conducted by Dr. Hu) and qRT-PCR experiments on both the knock-out mutant and the original CBS7779 isolate (see Appendix D, Table D.2). In the experiment, the knockout of the gene at CNNO189O in CHR 13 only yielded transformants that were mono somic at CHR 13 even though qRT-PCR experiments on the original isolate suggested that CBS7779 is disomic at CHR 13. One possible way to resolve this issue is if the disomy is actually unstable in CBS7779. For instance, if the disomy is  48  RESULTS unstable, then it is likely that the original gDNA isolation came from a stock of cells that were a mixed population. Thus, the normalized copy number for the loci on CHR 13 will display such a wide range of copy numbers. That is, if the gDNA was from a mixed population of cells, the presence of cells with monosomic and disomic copies of CHR 13 would distort the normalized copy number.  This is exactly what was observed in the data (Table 3.9).  Hence, it was  hypothesized that purer populations (as isolated by re-streaking the cells) should produce normalized copy numbers which are closer to 2.0, and this is what was observed upon retesting single colony isolates (Table 3.10).  In summary, it seems that the original freezer stock of  CBS7779 used for both the CGH experiments and the initial qRT-PCR experiments (Table 3.9) was not a pure population of cells. Regardless, subsequent experiments support the idea that CB57779 is disomic at CHR 13.  Table 3.9 Quantitative RT-PCR analysis of gene copy number in strains JEC2 1 and CBS7779 the H99 genome.  relative to  .  Strain  .  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin .  Act gene  ACtgenome  AACt  Normalized gene copy numner relative to H99 t) 2 (  CNNOO82O  H99 JEC21 CBS7779  18.53 (0.03) 17.65 (0.03) 17.43 (0.04)  19.41 (0.20) 18.49 (0.03) 18.65 (0.02)  -0.88 -0.84 -1.22  -0.88 -0.88 -0.88  0.00 0.04 -0.34  1.00 0.97 1.27  CNNO 1890  H99 IEC21 CBS7779  18.69 (0.06) 18.03 (0.03) 17.50 (0.04)  19.41 (0.20) 18.49 (0.03) 18.65 (0.02)  -0.72 -0.46 -1.15  -0.72 -0.72 -0.72  0.00 0.26 -0.43  1.00 0.84 1.35  SMG1  H99 JEC21 CBS7779  19.05 (0.02) 17.24 (0.19) 18.37 (0.03)  19.41 (0.20) 18.49 (0.03) 18.65 (0.02)  -0.36 -1.25 -0.28  -0.36 -0.36 -0.36  0.00 -0.89 0.08  1.00 1.85 0.95  CNNO2400  H99 JEC21 CBS7779  18.81 (0.04) 19.41 (0.20) -0.60 -0.60 18.28 (0.04) 18.49 (0.03) -0.21 -0.60 17.51 (0.05) 18.65 (0.02) -1.14 -0.60 The three genes tested are all on CHR 13 (CNNOO82O, CNNO 1890 and CNNO2400). To standard deviations will not be included in subsequent qRT-PCR tables.  0.00 1.00 0.39 0.76 -0.54 1.45 simplit the data tables, the  49  RESULTS During the work with CBS7779, it was noted that the strain displayed variable melanin production. That is, approximately 1/1000 colonies were less melanized (white), compared to the normally black or brown colonies formed by C. neoformans on L-DOPA medium (Figure 3.10).  Figure 3.10 Photographs of —1000 CB57779 colonies on L-DOPA medium after three days of growth at 3 0°C. The arrows highlight sample colonies that display the variable melanin production phenotype. The photographs were taken using the HP scanner. As mentioned earlier, it was hypothesized that this phenotypic change might be due to the instability of the disomy found for CHR 13. To test this idea, qRT-PCR was performed on black colonies and white colonies with the result that the black colonies were found to be monosomic for CHR 13 and the white colonies were disomic for CHR 13 (representative isolates are shown in Table 3.10).  50  RESULTS  Table 3.10 qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99  SMG1  19.38  20.07  -0.69  -0.69  0.00  1.00  JEC21 CBS7779B1 CBS7779B2 CBS7779 B3 CBS7779 B4 CBS7779 Wi CBS7779 W2 CBS7779 W3  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  17.33 17.08 17.00 16.05 16.99 17.01 16.69 17.12  19.24 17.91 17.80 16.96 18.08 18.08 17.59 17.95  -1.91 -0.83 -0.80 -0.91 -1.09 -1.07 -0.90 -0.83  -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69  -1.22 -0.14 -0.11 -0.22 -0.40 -0.38 -0.21 -0.14  2.33 1.10 1.08 1.16 1.32 1.30 1.16 1.10  1.00 H99 CNNOO82O 18.71 20.07 -1.36 -1.36 0.00 1.07 JEC21 CNNOO82O 17.78 19.24 -1.46 -1.36 -0.10 CBS7779B1 CNNOO82O 16.42 17.91 -1.49 -1.36 -0.13 1.09 CNNOO82O 16.51 17.80 -1.29 -1.36 0.07 0.95 CBS7779 B2 CNNOO82O 15.49 16.96 -1.47 -1.36 -0.11 1.08 CBS7779B3 CNNOO82O 16.71 18.08 -1.37 -1.36 -0.01 1.01 CBS7779B4 1.84 15.84 18.08 -2.24 -1.36 -0.88 CBS7779W1 CNNOO82O -2.37 -1.36 -1.01 2.01 CBS7779 W2 CNNOO82O 15.22 17.59 1.97 15.61 17.95 -2.34 -1.36 -0.98 CBS7779 W3 CNNOO82O Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The locus SMG1 is on CHR 4 and the locus CNNOO 820 is on CHR 13.  The assays shown in Table 3.10 were repeated and similar data were obtained (see Appendix D, Tables D.3 to D.6). In addition, more variants were screened for a total of 12 white and 12 black strains with the same correlation between disomy and melanin formation (Appendix D, Tables D.3 to D.6). The results in Table 3.10 suggest that white isolates (or those which are less melanized) are disomic for CHR 13 and those that are capable of producing more melanin are monosomic for CHR 13. This is particularly interesting as it suggests that the level of melanin production, which is a virulence factor, can be influenced by chromosome copy number.  This agrees with published literature in the sense that it is well documented that  51  RESULTS changes in chromosome number can affect the gene expression (Hughes et a!., 2000; Torres et a!., 2007) and hence the phenotypes of an organism. It is interesting to note that during the isolation of the black and white colonies for the analysis in Table 3.10, some of the colonies displayed a “sectoring” phenotype as shown in Figure 3.11. Figure 3.11 A  Figure 3.11 B  Figure 3.11 Photographs of two colonies (CB57779 plated on L-DOPA) displaying the sectoring phenotype for melanin. The bar represents 0.5 mm. The photographs were taken was at 50X magnification (a) and 25X magnification (b) using a Wild Heerbrugg microscope. This phenotype is very similar to the sectoring phenotype seen in yeast cells with aneuploidy (James et a?., 1974). Although the sectors have not yet been analyzed for the copy number of CHR 13, the observation supports the correlation between disomy of CHR 13 in CSB7779 and a reduction in melanin production. Later experiments, however, showed that the correlation between disomy and melanin formation for strain CBS7779 was only applicable to the initial set of black and white colonies that were isolated from the freezer stock (Figure 3.12). That is, when white colonies from the 52  RESULTS initial screen were used to isolate subsequent colonies with variable melanin production, it was found that black colonies from this second screen did not show a strict correlation with monosomy (Table 3.11). Instead, it was found that there was no correlation between the copy number of CHR 13 and melanin production.  Interestingly, further analysis revealed that some  of these strains in the second screen were disomic for CFTR 4 (note that disomy of CHR 4 is detected with the SMG1 primers and was not seen in the initial screen). Overall, this analysis led to the generation of a chart that details the state of C}IR 13 and CHR 4 over three successive screens (Figure 3.12). The overall conclusion is that there is chromosome instability for CRR 4 and CHR 13 for strain CBS7779, but that the correlation between melanin and CHR 13 disomy is limited to the first set of strains analyzed. These results suggest that changes in melanin production are not solely dependent on changes in the copy number of CHR 13. Instead, the copy number of other chromosomes or other epigenetic/genetic phenomena may play a role in controlling melanin production. See Appendix D for strain name nomenclature and Tables D.7 to D.16.  53  16.86 19.22 17.35 17.41 17.47 18.39 17.97 18.73 17.90 17.55  15.17 17.86 14.94 14.93 15.00 16.07 15.46 16.33 16.40 15.11  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  H99 JEC21 CBS7779 White 2, CBS7779 White 2, CBS7779 White 2, CBS7779 White 2, CBS7779 White 2, CBS7779 White 2, CBS7779 Black 1 CBS7779White2  -1.69 -1.69 -1.69 -1.69 -1.69 -1.69 -1.69 -1.69 -1.69 -1.69  -1.69 -1.36 -2.41 -2.48 -2.47 -2.32 -2.51 -2.40 -1.50 -2.44  enome  -0.58 -0.58 -0.58 -0.58 -0.58 -0.58 -0.58 -0.58 -0.58 -0.58  Act  -0.58 -1.66 -1.52 -0.59 -1.35 -0.46 -0.40 -0.45 -0.33 -0.48  Act g ene 1.00 2.11 1.92 1.01 1.71 0.92 0.88 0.91 0.84 0.93 1.00 0.80 1.65 1.73 1.72 1.55 1.77 1.64 0.88 1.68 0.00 0.33 -0.72 -0.79 -0.78 -0.63 -0.82 -0.71 0.19 -0.75  .  Normalized gene co y number relative to H99 (2 )  0.00 -1.08 -0.94 -0.01 -0.77 0.12 0.18 0.13 0.25 0.10  AACt  Normalized gene copy number which are higher than 1.5 are highlighted in yellow. The SMG1 locus is on CHR 4 and the CNNOO82O locus is on CHR 13.  Black A Black B Black C White A White B White C  16.86 19.22 17.35 17.41 17.47 18.39 17.97 18.73 17.90 17.55  16.28 17.56 15.83 16.82 16.12 17.93 17.57 18.28 17.57 17.07  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  1199 JEC21 CBS7779 White 2, Black A CBS7779 White 2, Black B CBS7779White2,BlackC CBS7779 White 2, White A CBS7779 White 2, White B CBS7779 White 2, White C CBS7779 Black 1 CBS7779 White 2  .  Ct (Avg.) Actin  Ct(Avg.) test gene  .  Primer  .  Strain  Table 3.11 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from screen #1 (Table 3.10).  RESULTS Two important observations can be made regarding the qRT-PCR analysis of isolates from CBS7779. First, from the analysis summarized in Figure 3.12, once a strain was identified as disomic at CHR 13, subsequent isolates generally retained disomy at CHR 13, regardless of the amount of melanin production. Second, it was noted that some of the strains which had disomy at CHR 13, gained a second disomic chromosome (CHR 4) in conjunction with the change in the melanin phenotype. However, this new disomy of CHR 4 did not correlate with changes in melanin production.  It is interesting, however, that disomy at CHR 4 was only  observed to arise in the screen in which the starting isolate already had CCNV. This could be a chance occurrence that depended on the genotype of the colony selected for subsequent analysis, and more analysis is clearly needed to understand the patterns of changes in chromosome copy number. Conversely, one can also say that once disomy is established in a particular strain, the chance that it will develop a second disomy may be higher (6 of 23 strains screened) compared to strains that were not disomic to begin with (0 of 12 strains screened). The change in CHR 4 copy number was confirmed by qRT-PCR with a new set of primers (designated as 00_707).  The locus was designated as glean_00707 on the Duke  University Fungal Resources for Fungal Comparative Genomics website. The two loci, SMG1 and glean_00707 were chosen because they were present as single copies in both H99 and JEC21, and they are on opposite ends of CHR 4. As a result, the use of the two primer sets, 00_707 and SMG1, provided evidence that the entire sequence of CHR4 is disomic, rather than just a segmental or local duplication.  55  L  I  Monosoniy for CUR 4  •PisomyforCRRl3  12  X  I I I L  Monosomy for CHR4  Disoiny for CUR 13  •  6 Blacks .5 had disomy for CUR 13 • (i.e. one lost its disoiny for CuRl 3) •monosomyforcHR4  --  Picked whiteisolate with disoniy of CHR 13 Scieened- 3 x 1O colonies: Frequency of black colonies: 1 x 1O  •  6 WhItes  Monosowy for CUP. 4  et one black isol Screened-- x colonies: Frequency ofwhitecolonies:-- 5 x 1O  •  •MonosomyforCURl3  B1am  6 Whiles 6 Blacks • Monosoiny for CUR 13 • Monoso*ny for CR_P. 4 • 4 hadinonoscinyfor CUR 13 • Monosomy for CUR4 • 2 had disoniy for CUR 13  -  Figure 3.12 Summary of the copy number of CHR 4 and CHR 13 in 3 successive screens and its melanin production phenotype in the strain CBS7779.  Screen #3  5 WhItes  6 Blacks • Disomy for CUR 13 • Disoiny for CUR 13 Monosomy for CHR4 • 4 had disonly for CHR4 •2 hadmonoscinyfor CKR4  Frequency ofblack colonies: 3  ecIonewhiteisol Screened- 2 x colonies:  Screen #1  eeZi’ 1 x lOcole Frequency ofwliite colonies: 5 x 1 O  CB87779 (from freeze stock)  RESULTS In summary, Figure 3.12 supports the idea that disomy of CRR 13 is a relatively stable trait once it has been established. Moreover, once disomy at CI{R 13 is established, it will increase the probability that the strain would gain disomy at CHR 4. Because only CHR 4 and CHR 13 were tested in this screen, one cannot rule out the possibility that there could be copy number changes in other chromosomes.  Overall, the analysis to date supports the idea that  CCNV in CBS7779, if not in C. neoformans in general, is complicated and will require further analyses.  3.4.3 CCNV in the serotype A strain WM626 The initial CGH data also suggested that strain WM626 showed CCNV; specifically the strain (like CBS7779) may have disomy at CHR 13 (Figure 3.13 and Table 3.2). This disomy was also analyzed by using qRT-PCR. Again, Dr. Guanggan Hu integrated a selectable marker at the CNNOO189O locus (Hu et al., 2008) in WM626. He then confirmed the deletion by PCR and Southern blot hybridization. The resulting mutants were then analyzed by qRT-PCR. In this case, the Southern blot hybridization of the mutants clearly showed that these strains had both an intact copy of CNNTO1 890 and a disrupted copy, thereby supporting the idea that WM626 was disomic at CHR 13. The qRT-PCR experiments on these mutants also support this view (See Appendix D, Table D.2). Also, the fact that WM626 maintained the disomy at CHR 13 even after transformation (unlike CBS7779) may suggest that the CCNV in WM626 is more stable than the CBS7779 strain. This idea is further supported by comparisons of the qRT-PCR results for CB57779 and WM626. Recall that the original qRT-PCR experiments for CB57779 were conducted with gDNA that was isolated fresh from the freezer stock and the results did not show copy numbers  57  RESULTS of 2.0 (Table 3.10). Instead, it was only after restreaking the strain to produce single isolates for gDNA isolation that a higher copy number was achieved (Table 3.11).  As a result, it was  concluded that the disomy of CHR 13 in CB57779 was unstable. Unlike CB57779, the qRT PCR with WM626 gDNA that was isolated fresh from the freezer stock produced copy numbers that were close to 2.0. This result suggested that the disomy of CHR 13 observed in WM626 (Table 3.12), unlike in CB57779, is more stable or that a greater population of cells in the WM626 freezer stock were disomic at CHR 13.  Figure 3.13 CGH data of CHRs 10 14 of the strain WM626 hybridized to the H99 array. The red arrow highlights the possible disomy of CHR 13. -  f f’f(f’ffffi’ff’ 2  frwlO  tflfl  4çnkp 1  i (1600 losgigy,  6162t0i0- 2576 Rows roWPa  -  2  chril  PømYmewwIe$*i4. 1  o 61626 O400bp -3713 Rows Total Positions (800- 1561954). Data Values -4.23 tO 1 62  jM  *%#J  Data Values -424 to 2.64  : 61626 O400bp- 2754 Rows. Total Positions (800-755968). Data Values -4 3Oto 429  Jfl14 2  o  jTØ$jfl  -2-  --*-:  -  ¶FØ -  --  --1--  ijjRÔ. Total Positions) 400- 925192 (‘Data Values 4.06 to 1.63  --  i  58  RESULTS  Table 3.12 Quantitative RT-PCR analysis of gene copy number in strains JEC21 and WM626 the H99 genome.  relative to  Primer  Strain  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 Ct) 2 (  CNNOO82O H99 JEC21 WM626  18.53 17.65 17.57  19.41 18.49 19.28  -0.88 -0.84 -1.71  -0.88 -0.88 -0.88  0.00 0.04 -0.83  1.00 0.97 1.78  CNN01 890 H99 JEC21 WM626  18.69 18.03 17.77  19.41 18.49 19.28  -0.72 -0.46 -L52  -0.72 -0.72 -0.72  0.00 0.26 -0.80  1.00 0.84 1.74  SMG1  H99 JEC21 WM626  19.05 17.24 18.98  19.41 18.49 19.28  -0.36 -1.25 0.30  -0.36 -0.36 -0.36  0.00 -0.89 0.06  1.00 1.85 0.96  CNNO2400 H99 JEC21 WM626  18.81 18.28 17.79  19.41 18.49 19.28  -0.60 -0.21 -1.49  -0.60 -0.60 -0.60  0.00 0.39 -0.89  1.00 0.76 1.85  The three genes tested are all on CHR 13 (CNNOO82O, CNNO189O and CNNO2400). The SMG1 locus is on CHR 4. Normalized gene copy number which are higher than 1.5 are highlighted in yellow.  As described above, highly melanized isolates from the first screen of CBS7779 colonies were monosomic for CHR 13 whereas lighter colonies were disomic for CHR 13 (Table 3.10 and Figure 3.12). Based on that result, it was hypothesized that WM626 (which also displayed variable melanin production among colonies from the original culture), might also potentially show an association between CCNV and the melanin phenotype (Figure 3.14).  59  RESULTS  Figure 3.14 Photographs of —l000 WM626 colonies on L-DOPA medium after three days of growth at 30°C. The arrows highlight sample colonies that display the variable melanin production phenotype. The photographs were taken using the HP scanner.  To test this idea, a series of qRT-PCR amplifications were performed on 12 black and 12 white strains derived from the original stock of WM626. The results, however, proved the contrary in that no association was found between the melanin production of the various WM626 isolates and the copy number of CHR 13. See Table 3.13 and Appendix D (Tables D.17 to D.23) for a summary of the results.  60  RESULTS Table 3.13 Summary of the copy number of CHR 13 and CHR 4 for a select number of WM626 isolates. Strain WM626 WM626 WM626 WM626  B1 B2 B3, B5 B4 Wi W12 —  —  B7  —  Copy number of CHR 13 / CHR 4 Disomic for CHR 13 and CHR 4 Disomic for CHR 13 Monosomic for CHR 13 Disomic for CHR 13  Primer sets for CNNOO82O, CNNO1 890, and CNN02400 were used to confirm the copy number of CHR 13 for WM626 strains Bi B3 and WM626 strains Wi W3. Primer set CNNOO82O was used to confirm the copy number of CHR 13 for the remaining strains. Primer sets SMG1 and 00_707 were used to confirm the copy number of CHR 4 for WM626 strains Bi B3 and WM626 strains WI W3. In order to simplify the data presentation, original copy numbers are not shown because the results were from the compilation of 5 separate experiments, each with its own internal control. (See Appendix D. 15 to D.21 for details.) —  —  —  —  In summary, there was no apparent correlation between the copy number of CHR 13 and the amount of melanin produced (Table 3.13) and disomy of CHR 13 is more common in subcultured isolates of WM626 than in CBS7779. In addition, the finding that CHR 4 is disomic for isolate WM626 B 1 again supports the idea that CCNV in general may be very common in C. neoformans.  3.4.4 CCNV in selected other strains A search of the literature revealed descriptions of C. neoformans strains that show variable melanin production and the frequent occurrence of melanin variants (Tanaka et al., 2005, Ohkusu et al., 2002). A set of these strains was obtained from the 1PM stock centre (Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University). These strains included IFM5 1645 (Serotype B) and 1FM46084 (Serotype D), thus indicating that other serotypes produce colonies with variable melanin production besides serotype A, which is the serotype of both CBS7779 and WM626 (Tanaka et al., 2005). To examine whether disomy occurred in  61  RESULTS these melanin variable strains, qRT-PCR analysis was performed on both white and black isolates of 1FM46084 and IFM5 1645. Strain 1FM46084 produced mainly black isolates and only 1 in 3 l0 c olonies showed a marked decrease in melanin production. Unfortunately, based on the qRT-PCR data, there was no disomy at CHR 13 or CHR 4 for 1FM46084 (See Appendix D, Tables D. 24 and D.25). Strain IFM5 1645 (also known as 484) was found to have mostly white isolates and only  1 in  3 colonies showed a marked increased in melanin production. Unfortunately, the qRT-PCR i0 failed to give amplification. One possible reason for this result is that 1FM5 1645 is a serotype B strain, but the primers were originally designed using only serotype A and D genomes (JEC21 and H99). Subsequent testing of the molecular subtype of this strain, 1FM51645, via PCR-RFLP revealed that did not have a VOl or VGII molecular subtype (data not shown). This was an issue because the only two genome sequences available for serotype B strains were from the VOl and VGII molecular subtypes. Thus, it will be difficult to efficiently design any new set of primers to test the disomy of CHR 13 and CHR 4 in IFM5 1645. An additional 11 strains were also screened to detect disomy at either CHR 4 or CHR 13 (see Appendix D, Table D.26 to D.27). These strains were selected because FACS analysis revealed that they have more than the usual amount of chromosomal DNA (Tanaka et a!., 2005, Obkusu eta!., 2002). Of these 11 strains, one was a serotype B strain (IFM5 1654) and the others were serotype A strains of unknown molecular subtype. Again, qRT-PCR failed to amplify a product for testing IFM5 1654, and thus it is unknown whether or not there is CCNV. In this case, however, IFM5 1654 had the VOlT subtype (discovered by PCR-RFLP, data not shown). Thus, it will be possible to design a set of primers that specifically test CCNV in this strain. For the remaining 10 strains, qRT-PCR revealed that disomy was not present for CHR 4 or CHR 13.  62  RESULTS In brief, the search for CCNV for these strains (i.e. strains that FACS analysis have identified as aneuploids) revealed that there was no disomy at CHR 4 or CHR 13. However other disomic chromosomes remain a possibility. Finally, an additional 13 clinical strains of the serotype A, VNI molecular subtype, were tested. These strains were selected from a wide variety of geographical backgrounds (see Table 2.5), but all of them were of clinical origin.  Clinical strains were chosen because it was  hypothesized that CCNV might arise as a result of selective pressure while the fungus is growing inside the host. Also, only strains which were of the VNI molecular subtype were chosen to maximize the chance of efficient primer binding. See Tables D. 28 to D. 37.  Table 3.14 Summary of the copy number at the SMG1 locus (CHR 4) and at the CNNOO820 locus (CHR 13) for a set of strains from AIDS patients. SMG1 JP1086 Arg1373 Arg1363 Ug2467 1n2637 Tn470 Bt9  1.41 0.03 1.50 0.29 1.77 0.29 1.24 0.05 1.34 0.03 1.65 0.24 1.39  0.11  CNNOO82O 0.57 0.08 1.43  SMG1 Bt68 C8  0.29  1.57 0.23 1.09 0.09 0.45 0.14  RTC23-1  1.39  RTC31-Mix  0.13 0.93 0.52  RTC31-1  RTC23-2 RTC23-3  2.06 0.94 1.39 0.08 1.71 0.26 1.66  CNNOO82O 1.04 0.15 0.83 0.26 1.48 0.12 1.31  0.22  0.13  1.15 0.27 1.72 0.19 2.73 0.84  1.08 0.05 1.37 0.19 1.80 0.16  Each amplification was conducted at least three times (i.e. at least on three separate 96 well plates, with each qRT PCR reaction in triplicate. Cells which have copy numbers higher than 1.3, after the SD was taken into consideration, are highlighted in yellow. The average copy number is always shown in the first row and the SD is shown in the second row.  63  RESULTS The first finding from the results in Table 3.14 was that the copy numbers for this set of experiments were highly variable (i.e. large SDs were observed.). To address this issue, each strain was analyzed by qRT-PCR in at least three separate experiments. Next, the SD was taken into consideration, and if the copy numbers were higher than 1.3, the loci were considered as “disomic.” The rationale for using 1.3 as a cut-off value and the variability are discussed below. Based on the selected cut-off value, it appeared that disomy (more specifically elevated copy number) is widespread amongst clinical strains such that 11 of the 13 strains showed possible duplication at the SMG1 locus (CHR 4) and three of the 13 strains showed possible duplication at the CNNOO82O locus (CHR 13). This supports the idea that CCNV may play an important role in virulence andlor be that it may develop during infection because of two reasons. First, all of these strains (unlike the strain set from Chiba University) are of clinical origin. Second, some of these strains (those with the RTC designation) were freshly collected from the CSF of AIDS patients and only grown in culture twice. The idea that CCNV may play an important role in virulence is further supported by the qRT-PCR data with the “RTC” strains. It is important to note that RTC23-l, RTC23-2 and RTC23-3 came from the same patient, yet all three isolates have a different pattern of copy number at CNNOO82O and SMG1.  When RTC3 1 was isolated from the patient, over 300  colonies were obtained from the CSF pellet. To keep matters simple, a single colony (RTC3 1-1) was chosen for the qRT-PCR experiment and the remaining colonies were scraped and conglomerated into one batch (resulting in RTC3 1-MIX). Again, RTC3 1-Mix and RTC31-1 have different patterns of copy number at CNNOO82O and SMG1. All of this suggests that there could be a wide variety or mixture of CCNV within isolates from the same patient infected with C. neoformans.  64  RESULTS Finally, the data in Table 3.14 support the idea that there could be a wide degree of sequence variation within the same molecular subtype. Specifically, strain 1P1086 has a copy number of 0.57 ± 0.08 at the CNNOO82O locus (Table 3.14).  This suggests that either this  particular locus is deleted in JP1086 or that the primer set for CNNOO82O does not bind well to the DNA of this strain. Given that the melting temperature of the PCR product for 1P1086 gDNA and CNNOO82O was the same as the melting temperature for other PCR products involving the same primer set (data not shown), the results suggest that the relatively low copy number could merely be a result of poor primer binding efficiencies and not because the locus is deleted. This issue of poor primer binding efficiencies and variable copy number resulted in a more detailed analysis regarding the average and SD of the copy number at the SMG1 and CNNOO82O loci (Table 3.15). JEC2 1 was chosen for this detailed analysis because the published sequence indicates that there are two copies of SMG1 and only one copy of CNNOO82O in JEC21 relative to the H99 genome. This analysis was necessary in order to determine the amount of variability one would normally expect to see if the primers were binding efficiently. This kind of analysis was not necessary for CBS7779 or WM626 because the CGH data showed that these genomes did not differ greatly from H99 (one of the reference genomes used to design the qRT PCR primers).  Table 3.15 Average copy number of two loci for the strain JEC21 relative to the strain H99. Average SD  I  SMG1  CNNOO82O 2.11 0.31  1.05 0.15  These data form the basis for the rationale behind using 1.3 as a cut-off value for the 13 clinical strains that were screened. The data represent at least 8 separate amplifications (i.e. 8 separate 96 well plates with each plate having 3 replicates per locus).  65  RESULTS Based on Table 3.15, one can establish the amount of variation expected in the qRT-PCR experiments when using primers that exactly match the target sequences. Based on the genome sequence, it was known that CNNOO82O exists in a single copy in JEC21. As a result of this analysis, a cut-off value of 1.3 was chosen to indicate whether a particular chromosome had an elevated copy number; i.e. copy numbers which were lower than 1.3 were designated as “single copy” for that locus. This number was chosen because the average copy number for JEC21 at CNNOO82O is 1.05 and the SD is 0.15 and the sum of these numbers is 1.20. It is unlikely that this cut-off value is too low because any variation in the target sequence should delay the CT. Consequently, the final calculation would be a lower copy number. Naturally, the genome that the primers were originally designed for would produce the highest binding efficiency. Thus, 1.20 indicates the upper limit that might be expected by variation in the assay and it was therefore assumed that any number higher than 1 .3 would suggest that the locus may be duplicated. This information was used to analyze the data from the qRT-PCR for the additional 13 clinical isolates (Table 3.14). Overall, the qRT-PCR experiments supported the idea that CCNV is common in C. neoformans, and especially in clinical isolates. Furthermore, the presence of chromosome copy  number heterogeneity within the same patient also suggests that CCNV can be very dynamic. It is interesting to speculate that CCNV may be a common feature of fungal cells within the host and that a haploid chromosome complement may be a feature of growth in culture.  66  DISCUSSION AND CONCLUSIONS 4. DISCUSSION AND CONCLUSIONS  4.1 Analysis of genome variation in pathogenic Cryptococcus species 4.1.1 Annotation of genome variation in C. neoformans and C. gattii The data presented in this thesis demonstrate the utility of CGH for identifying regions of difference between strains and lay the groundwork for future studies to examine how genome variation may influence virulence in Cryptococcus species. A number of interesting insights arose from comparing C. neoformans strains of different molecular subtypes, C. gattii strains within one subtype and a set of C. neoformans parental strains used in a genetic cross. For the hybridizations involving the serotype A strains, the level of genomic variation was as expected based on comparisons of strains representing the three molecular subtypes VNI, VNII and VNB (Table 3.2).  That is, larger SDs were observed for strains that had been  previously identified through molecular subtyping to be more divergent from the genome of the reference strain H99. Conversely, serotype A strains of C. neoformans that were within the same molecular subtype (VNI) had a smaller range of SDs. However, the hybridizations involving the serotype B strains of C. gattii of the same molecular subtype (VGI), had a wide range of SDs (Tables 3.2 and 3.4). SD’s did not correlate with geographical origins because the serotype B strain R794, which had a SD of 0.3 19, is from Vancouver Island while strain E566 from Australia had a SD of 0.365. Although these studies employed a relatively small number of strains, it also appears that there was relatively more divergence within the VGI subtype of C. gattii than within the VNI subtype of C. neoformans.  It is possible that the wider range of  genome variation seen in the serotype B (C. gattii) strains reflects environmental influences or differences in evolutionary history (e.g., the level of sexual recombination).  67  DISCUSSION AND CONCLUSIONS This then raises the question as to whether the degree of sequence divergence is related to geographical separation. Previously, when RFLP analysis was used to classify the molecular subtypes of a number of serotype B strains from around the world, it was found that there was no association between geographic location and genotype (Kidd et al., 2005). This is particularly worrisome because it suggests that C. gattii strains are not restricted to specific regions. Thus, it may be possible that drug resistant strains and emerging C. gattii isolates of higher virulence, such as those which are causing disease in immunocompetent patients, are spreading around the world. Another key observation from these hybridization experiments is the possible presence of disomy in two of the serotype A strains (CBS7779 and WM626), but the lack of disomy in any of the serotype B strains that were used in the hybridization experiments. One possible way to interpret these data is that disomy is more common in the serotype A strains than in the serotype B strains. Although this may be valid, it is important to note that the majority of strains chosen for the serotype B hybridizations (five of six) were environmental isolates, whereas all of the four strains chosen for the serotype A hybridizations were clinical isolates. Thus, it may be possible that CCNV is more prevalent in clinical isolates than in environmental isolates. A more detailed discussion of disomy is presented in section 4.2 below. In general, the extensive genomic variations revealed in these hybridization studies lay the groundwork for identifying new candidate genes that may be associated with virulence, and the work also demonstrates the use of CGH for characterizing mutants. During the annotation of the genome variation in both serotype A and the serotype B strains, a number of carbon utilization and sugar transporters were shown to be variable amongst the strains. On the surface, one might not expect differences in carbon-source utilization genes to have an impact on  68  DISCUSSION AND CONCLUSIONS virulence. However, a further examination of the literature involving carbon-source utilization and virulence reveals a different story. Specifically, it was found that in C. albicans, a specific subset of genes (glyoxylate cycle genes) are up-regulated upon phagocytosis, thereby facilitating anabolic metabolism in the absence of fermentable carbon sources (Barelle et al., 2006). In fact, the ability to use alternative carbon sources in C. albicans is an important tool for surviving inside the host (Ramirez & Lorenz, 2007). The idea that alternative carbon-source utilization inside the host is an important aspect of virulence can also be seen in Mycobacterium species which, like the Cryptococcus species, cause granulomas inside the host (Lorenz & Fink, 2002). In fact, Mycobacterium tuberculosis relies on using alternative carbon-sources to survive during the granuloma stage of growth. Thus, it is interesting to speculate that differences in carbonsource utilization and transportation genes may contribute to differences in virulence that have been observed between the serotype A and serotype B strains used in this study. Also, in the annotations of genome variability, one strain of interest is the WM276-GFP strain that was constructed in the Kronstad laboratory. WM276, from which WM276-GFP strain was derived, is a virulent strain, whereas WM276-GFP is avirulent in a mouse model of cryptococcosis (Dr. Guanggan Hu, unpublished data).  The WM276-GFP mutant strain was  constructed by introducing the GFP gene into WM276.  Subsequent PCR and Southern  hybridization analysis in the Kronstad Laboratory (C. D’Souza, unpublished data) revealed that the GFP insertion did not disrupt any known genes. Later, CGH analysis revealed that WM276GFP harbors a 75 kb deletion in CHR K, and it may be possible that the loss of virulence is due to this deletion.  What is exciting is that none of the genes in the deleted region have any  previously known functions in pathogenesis. Instead, they encode a wide range of predicted functions including sugar transporters, glucosidases, enzymes for lipid metabolism and ubiquitin  69  DISCUSSION AND CONCLUSIONS related proteins.  Experiments are currently underway to insert these genes back into the  WM276-GFP strain in the hopes that virulence can be restored. Of course, the difference in virulence between W1v1276-GFP and WM276 may not be related to this 75 kb deletion at all. In fact, it is plausible that during the generation of WM276-GFP, single nucleotide polymorphisms (SNPs) were introduced into the genome, thereby disrupting a gene essential for virulence. This kind of mutation would not be detectable by CGH. The large deletions observed in strain WM276-GFP, and the elevated copy numbers of entire chromosomes in CBS7779 and WM626, suggest that the genomes of C. neoformans can undergo dramatic changes. The idea that C. neoformans may not have a stable genome has been raised before (Fries et al., 1996, Franzot et al., 1998) and a further discussion of how these genomic changes may relate to virulence can be found in section 4.2. The database of genome variation initiated by the work in this thesis illustrates not only the sensitivity of CGH but the wide degree of genome variability. Future experiments could include using CGH to document and annotate genomic changes that might occur during infection of animal hosts andlor in response to drug treatments.  It would also be useful to continue to tabulate the genomic  differences that are observed between clinical and environmental strains.  4.1.2 Examination of a genetic cross and recombination sites for serotype D strains The CGH analysis of the serotype D strains NIH 12 and N111433 putatively identified the recombination sites (as described in section 3.2) throughout the genome of the progeny strain JEC21. This clearly highlights the sensitivity of the CGH method to detect relatively small levels of sequence divergence (--2%). There is precedent for the detection of crossover events by whole genome array analysis in S. cerevisiae. Specifically, Winzeler et al. (1998) observed 97  70  DISCUSSION AND CONCLUSIONS crossovers across the whole genome upon analysis of the four meiotic progeny from a single tetrad. This sensitivity could be quite useful in characterizing the association between mating, sexual recombination and virulence in the Cryptococcus species. For example, MATc strains predominate in the environment and recent evidence suggest that same-sex mating can occur, thereby generating new MATa strains (Fraser et al., 2005a, Hiremath et al., 2008, Nadal & Gold, 2007). In addition, there is growing evidence that sexual recombination occurs in various subpopulations and may contribute to the ability of the fungus to adapt to the host and the environment (Litvintseva et al., 2003). The CGH experiments presented here demonstrate that this technique could potentially be used to characterize the progeny of mating events in the wild. In addition, future experiments could employ CGH to examine the progeny that arise from crossing avirulent strains with virulent strains. The virulence properties of the progeny in a mouse model could be compared with those of the parental strains in order to track the genome segments that could be associated with virulence.  4.1.3 Examination of serotype AD strains The CGH analysis described in this thesis also sheds new light on the genomic makeup of the serotype AD strains, which are thought to arise from mating events between serotype A and serotype D strains. These strains typically have reduced virulence when compared to either parent (Lin et al., 2008). The CGH data for strains KW5, CDC228 and CDC3O4 illustrated that only certain parental chromosomes are retained.  In particular, CHR 1 appeared to be  preferentially retained from the serotype A parent. However, this idea of specific chromosome retention is complicated by the fact that both the average LR for the hybridization of CHR 1 to serotype A in CDC228 and KW5 was double the average LR for the hybridization of CHR 1 to  71  DISCUSSION AND CONCLUSIONS serotype A in CDC3O4 (Table 3.7). This suggested that CDC228 and KW5 have two copies of CHR 1 (from serotype A) and that CDC3O4 may have only one copy of this chromosome. These results agree with a previous report that CDC3O4 is aneuploid (1-2n) (Lengeler et al., 2001). This skewed distribution of CHR 1 in clinical AD strains to favor the serotype A chromosome suggests that there is a selective advantage for this preferential retention during host infection. It is interesting to note that this kind of skewing is only observed for CHR 1, therefore suggesting that there may be a specific subset of genes on CHR 1 which are particularly advantageous for pathogenesis if the cell has the serotype A version over the serotype D version of the chromosome. This is likely because CHR 1 is the largest chromosome and it also contains a number of identified virulence factors such as the LAC1 and LAC2 genes that are responsible for melanin synthesis. Although no virulence attributes (including melanin production) were found to be conmion amongst the AD strains that preferentially retained a serotype A version of CHR 1, it may still be possible that other untested virulence attributes (e.g. the ability to withstand nitrosative or oxidative stress) may be common amongst these unique AD strains. It may be possible to test the hypothesis that the serotype origin of CHR 1 influences virulence by using the strain CDC3O4 because it appears to be in the act of losing its serotype D copy of CHR 1. The experiment would involve assaying the ability of two different isolates of CDC3O4 to infect mice: one isolate would have the serotype AD complement of CHR 1 and the other isolate would only have the A complement.  If the hypothesis is correct, then the isolate  with only the A complement of CHR 1 will be more virulent than the other isolate. Another way to further examine the importance of CHR 1 would be to mark the chromosome with a selectable marker in an AD strain and then to passage the strain through mice.  If the serotype A  72  DISCUSSION AND CONCLUSIONS chromosome does confer a selective advantage for the hybrid strain, then one would expect that the serotype D version of CHR 1 to be more easily lost. If this proves to be correct, it would then be interesting to look at exactly which stressor in the host triggers this change and then to look more specifically at the virulence levels of these strains before and after the loss of the serotype D version of CuR 1. Another important point to consider with regard to the AD strains is the reported virulence differences between the three strains analyzed by CGH. Specifically, strain KW5 is more virulent in a mouse model than either CDC3O4 or CDC228 (Lengeler et al., 2001). Because all three strains were missing a serotype D copy of CHR 1, it is unlikely that this is the reason behind the difference in virulence. The marked difference in the assortment of CHRs 6, 7 and 8 (Figure 3.4 and Table 3.7) may also contribute to virulence differences between these three strains. The idea that the virulence of AD strains is dependent on chromosome assortment is intriguing and may provide a new avenue to explore why the A and D serotypes have differences in virulence. It should be noted that the preferential reassortment of chromosomes in response to environmental conditions has been observed in C. albicans, another fungal pathogen (Forche et a!., 2008). In this case, exposure to antifungal drugs and specific carbon sources can influence the assortment of chromosomes in this fungus. On the other hand, the differing chromosome assortments may not contribute to virulence. Instead, mutations in various other genes involved in virulence, which may not be detectable by CGH, could be the cause of the differences in virulence.  73  DISCUSSION AND CONCLUSIONS 4.1.4 Final comments on genome variation Overall, the genomic variation observed by CGH provides the foundation for future studies. The generation of a database of genomic differences for different serotypes, different molecular subtypes, strains from various geographical regions, and strains representing clinical vs. environmental sources provides a wealth of information for future research. In addition, the discovery that clinical AD strains preferentially retain the serotype A version of CHR 1 provides interesting insights and new potential avenues of pursuit to understand the pathogenesis of the C. neoformans.  4.2 Chromosome Copy Number Variation in C. neoformans 4.2.1 CCNV in serotype A strains CBS7779 and WM626 The CGH data revealed CCNV in strains CBS7779 and WM626 of C. neoformans. In looking at CCNV in the initial screen of CBS7779, there appeared to be a strong correlation between melanin production and the copy number of CHR 13. However, this correlation did not apply to the WM626 strains, nor did it apply to subsequent screenings of the CB57779 strains. This suggests that there could be more than one mechanism for variation in melanin production. Although CCNV for CHR 4 appeared in subsequent screens, it was not correlated with melanin production. The initial observations with CBS7779 might suggest that CCNV is associated with growth inside the host, although it is not known how long the strain has been in culture since its original isolation. One can speculate that specific trigger(s) inside the host that were not present in later screens (cells were grown overnight at 30°C in rich medium) might have caused the cells to gain an extra copy of CHR 13 and thereby influence melanin production.  74  DISCUSSION AND CONCLUSIONS Possible stressful factors inside the host that may trigger CCNV include oxidative and nitrosative stress, growth at host temperature and nutritional conditions. Another possible trigger for CCNV in either CBS7779 or WM626 could be the drug treatments the patient was receiving because both CBS7779 and WM626 are clinical strains. For example, a number of drugs such as fluconazole, which is commonly used to treat fungal infections, have been shown to cause non disjunction events in the fungal pathogen C. albicans (Perepnikhatka et al., 1999). In fact, the trigger to produce varying levels of melanin production for CBS7779 could be in response to antifungal treatments because a high production of melanin is known to provide protection against amphotericin B (Ikeda et al., 2003). Unfortunately, no information is available regarding the drug treatments that the patients were receiving for the infections with either the CBS7779 or WM626 strains. Thus, future experiments should employ a well characterized aneuploid strain such as CBS7779, whose copy number for each chromosome is already known via CGH (Ru et al., 2008), and passage the strain through a mouse with and without drug treatments to look for changes in aneuploidy. In parallel, the strain should also be passaged in culture and its CCNV examined. A comparison of these “passage” models (i.e., “laboratory” passage vs. “mouse” passage, with and without subinhibitory drug treatments) may provide information regarding the mechanism(s) of CCNV.  The information will also be useful for correlating any virulence  phenotype differences among these passaged isolates with CCNV.  The idea that passaging  through a host can promote chromosome copy number polymorphisms (Chen et a!., 2004) as well as other chromosomal rearrangements has also been established in C. albicans (Rustchenko Bulgac eta!., 1990) and it may be possible that C. neoformans uses a similar mechanism.  75  DISCUSSION AND CONCLUSIONS Other possible drugs or chemicals that can be used to study the mechanism of CCNV include sulfacetamide, saccharin and methyl benzimidazole carbamate. These chemicals were chosen because they generally induce chromosomal copy number changes in yeast without causing other kind of mutations (Parry et al., 1979 and Barton & Gull, 1992). These experiments might reveal whether certain chromosomes (e.g. CHRs 4 and 13) are more susceptible than others to copy number changes. These experiments might also provide strains to test whether CCNV can be associated with gains or losses in virulence. If CCNV is relevant to virulence, then it would be logical to systematically tag each chromosome with a gene for drug resistance and to select for strains which are disomic for each chromosome.  These strains could then be used to  examine the phenotypic influence of disomy on a genome-wide scale, as recently described in yeast (Torres et a!., 2007). However, in these experiments it will be important to remember that previous studies with C. albicans have shown that the longer the treatment with fluconazole, the more likely there would be a nondisjunction event for CHR 17, which will in turn, induce drug resistance (Perepnikhatka et al., 1999). In addition, azole resistance in C. albicans has been linked to a specific segmental duplication in CHR 5 (Coste et a!., 2007, Selmecki et a!., 2006). With these issues in mind, it is even more important to consider the relationship between CCNV and drug treatment because cryptococcal infections often require prolonged antifungal therapy (Antinori et a!., 2001). In looking at the changes in aneuploidy for the C. neoformans, it is important to remember that changes in chromosome copy number may have a fitness cost. In S. cerevisiae, aneuploidy results in cells that reach saturation at a smaller population size (as measured by optical density at 600 nm) and these cells will also lose viability upon prolonged growth in media (after 5 days) (Torres et a!., 2007). On the other hand, there are a number of differences between  76  DISCUSSION AND CONCLUSIONS  C. neoformans and S. cerevisiae. For example, the aneuploids observed in this thesis are all clinical strains. That is, they must have arisen and must have been growing successfully at elevated temperatures.  And yet, aneuploid yeast strains grow slowly at high temperatures  (Torres et al., 2007).  This suggests that either the mechanism for the generation and  maintenance of aneuploidy are different between yeast and C. neoformans or that the driving mechanism in CCNV for Cryptococcus inside the host overrides the disadvantages of growing slowly at elevated temperatures. This is possible since stressful environments (such as those inside a host), have been implicated in driving phenotypic variation (Massey & Buckling, 2002). Although gaining a better understanding of the mechanism of CCNV is interesting, what is more important is determining whether or not CCNV causes any phenotype changes. The idea that specific phenotypic changes could be caused by CCNV is supported by the fact that the presence of extra chromosomes in S. cerevisiae is correlated with a variety of changes in gene expression (Torres et a!., 2007).  lii fact, the presence of an extra chromosome in Candida  glabrata, which is another human fungal pathogen, is also correlated with an almost global down-regulation of a number of different proteins (Marichal et a!., 1997).  Perhaps the  mechanism behind the down-regulation of protein production in C. glabrata is similar to the down-regulation of melanin that is seen in the initial CBS7779 strains. Another possible way that CCNV can influence melanin in the initial CBS7779 isolates might be through an indirect influence on the expression of other genes required for the regulation of melanin production. Previously, it was reported that extra copies of chromosomes were linked with the up-regulation of high-affinity glucose transporters (Torres et a!., 2007), suggesting that the state of having extra chromosomes affects the level of glucose inside the cell. In C. neoformans, the presence of elevated glucose in culture medium reduces melanin  77  DISCUSSION AND CONCLUSIONS production (Pukkila-Worley et a!., 2005).  Tn fact, glucose sensing and transport mechanisms  may be advantageous for a pathogen because there are relatively low levels of glucose inside the host (and particularly inside macrophages) (Appelberg, 2006). Thus, it may be possible that CCNV influences the expression of a certain number of genes (such as those involved in sugar transport) and this in turn influences the production of melanin. Another example of the possible downstream gene expression effects of CCNV can be seen in C. albicans. Here, a strain with trisomy for CHR 1 is avirulent compared to euploid cells in mouse models of candidiasis (Chen et a!., 2004). Also, even though the gene responsible for L-sorbose assimilation, SOUl, is not on CHR 3, the copy number of CHR 3 has been demonstrated to regulate the expression of SOUl (Janbon et al., 1998). Thus, in looking at CHR 13 disomy for C. neoformans, it is important to not solely concentrate on the possible changes in expression for genes on CHR 13, but to also look at the expression profile of the entire genome.  Future experiments could employ  microarrays to compare the transcriptomes of monosomic and disomic variants of a strain. It may be possible, however, that there is no link between the copy number of CHR 13 and the production of melanin. Certainly, the lack of correlation between the copy number of CHR 13 and melanin production in WM626 clearly illustrates this point. Previous studies have already identified a number of genes which contribute to melanin production (Panepinto et al., 2005, Walton et a!., 2005) and it may be possible that the initial screening process was selecting for strains with mutations in these melanin production genes and the presence of disomy was merely a by-product of this selection. Although this thesis mainly focused on the production of melanin and its possible correlation to CCNV, it is important to remember that there could be other phenotypic changes in disomic strains.  For example, it was previously reported that specific changes in the  78  DISCUSSION AND CONCLUSIONS electrophoretic karyotypes of certain strains are associated with changes in capsule size, growth rates at 37°C and colony morphologies (smooth vs. mucoid) (Fries & Casadevall, 1998). These ideas reinforce the need to develop an understanding of the mechanism(s) leading to CCNV and the resulting influence of CCNV on gene expression in C. neoformans. On that note, it is interesting that both CBS7779 and WM626 showed disomy at CHR 13. It may be that certain chromosomes more easily become disomic over other chromosomes or conversely, certain chromosomes may be more resistant to duplication.  This idea has been  observed in S. cerevisiae, where losses or gains of CHR 8 are not as well tolerated as other chromosome copy number changes (Waghrnare & Bruschi, 2005). One can easily test this idea by screening a number of clinical strains for CCNV by CGH. In this case, the use of qRT-PCR would not be appropriate because qRT-PCR would only allow one to assay the copy number of a specific loci, but CGH would allow one to survey the entire genome. From these experiments, it may be possible to observe whether other specific changes in chromosome copy number can be correlated to other phenotypes (e.g., colony morphologies). This interplay between CCNV and phenotype becomes even more complicated when one considers the pattern that emerges when one examines results of the second screen with the CBS7779 isolates (Figure 3.12). Although the correlation observed in the first screen regarding CHR 13 copy number and melanin production no longer applied, it appeared that having an extra copy of CHR 13 was a stable trait (all eleven strains). This stability was also seen in the third screen, where eleven of the twelve strains screened maintained the disomy at CHR 13. This is particularly interesting because aneuploidy can be associated with a reduction in fitness (Torres et al., 2007, Birchier et a!., 2007). As mentioned for S. cerevisiae, aneuploidy results in cells which reach saturation at a smaller population size and they lose viability upon prolonged growth  79  DISCUSSION AND CONCLUSIONS in culture (after 5 days) (Torres et at., 2007). This phenotype is also observed in Cryptococcal strains with CCNV, in which strains which have a disomy at CHR 13 grow at 90% of the rate of cells which are monosomic at CHR 13 (I. Liu, unpublished results).  One possible reason for  stability is that the strains were grown in a rich medium (YPD) and previous experiments in C. albicans have shown that aneuploids grown in rich media are more stable than aneuploids grown in nutrient deficient media (Chen et at., 2004, Rustchenko-Bulgac et at., 1990). The stability may also be due to the fact that CBS7779 may have an unidentified mutation which is suppressed by an extra copy of CHR 13, in a similar manner that extra chromosomes in yeast have been found to exist in 8% of a laboratory deletion set in order to offset deleterious mutations (Hughes et at., 2000). If this is the case for the strain CBS7779, then losing the disomy may actually cause a reduction instead of a gain in fitness. In any case, the differences in the stability and prevalence of CHR 13 disomy in CBS7779 and WM626 suggest that the mechanism for the development and maintenance of CCNV can be multi-factorial. The complexities of chromosomal instability are further illustrated by the findings that among the strains that were disomic to begin with, four of the six strains gained a disomy at CHR 4, whereas none of the strains which were monosomic to begin with gained this particular disomy of CHR 4. This disomy of CHR 4 is a completely new development, because subsequent testing of the original strains for CHR 4 failed to show that the parent strain was disomic. This suggests that once a cell is an aneuploid, the subsequent daughter cells can gain extra copies of other chromosomes relatively easily. One possible explanation is that cells which had an extra copy of CHR 13 gained this extra copy because of a mutation in a gene that is important in maintaining genome stability. These could include genes involved in chromatin dynamics, cell cycle control, DNA replication or mitotic chromosome segregation (Ouspenski et at., 1999) as  80  DISCUSSION AND CONCLUSIONS well as genes encoding other DNA binding proteins (de Lahondes et al., 2003). As a result, a mutation in any one of these genes could make it easier for the cell to lose or gain other chromosomes.  4.2.2 CCNV in selected strains of C. neoformans and C. gattii The discovery of CCNV in two clinical strains (CBS7779 and WM626) prompted an investigation of additional strains to establish the prevalence of the phenomenon. Disomy at CHR 4 and CHR 13 was not found among the strains obtained from the 1PM stock center (Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University) suggesting that this kind of CCNV may not be common. It is important to remember, however, that the assay only looked at two of the fourteen chromosomes and there may be disomies at other chromosomes.  Thus, future experiments should include CGH experiments with serotype  specific arrays to rapidly screen clinical and environmental isolates for changes at all chromosomes. Also, the initial screen and subsequent screens for CCNV in CBS7779 produce different results, suggesting that the host may play an important role in the development and maintenance of CCNV in C. neoformans. In relation to the strains from the 1PM stock center, it is not known how many times these strains were passaged in culture. Thus, it is difficult to assess whether the lack of CCNV in the 1PM strains is an indication that CCNV is a rare event in C. neoformans or that CCNV is only more prevalent in freshly isolated clinical strains. In fact, in contrast to the results with the 1PM strains, subsequent qRT-PCR experiments involving strains freshly isolated from patients suggested that CCNV may be very common. Eleven of the thirteen strains showed differences for CHR 4 and three showed differences for CHR 13. These results support the idea that the  81  DISCUSSION AND CONCLUSIONS 1PM strains might have lacked the selective pressure to maintain aneuploidy and therefore have balanced haploid genomes. This idea was supported by the fact that aneuploidy was particularly prevalent for the strains freshly isolated from patients (strains beginning with the designation RTC in Table 3.15). One possible explanation for this phenomenon is that there is selective pressure for aneuploidy in the host. Thus, one would predict that subsequent laboratory passaging of strains isolated from patients would result in the loss of CCNV over time. This idea that laboratory passaging can affect both the phenotype and the genotype of C. neoformans has been previously observed. In fact, in vitro passaging can lead to dramatic changes in virulence.  In one case, strain  ATCC24067 lost virulence completely (Franzot et a!., 1998). Further support for this idea can be found by the fact that in vitro passaging has also been shown to result in karyotyping differences (Franzot et a!., 1998). This piece of evidence, therefore, again illustrates the need to characterize CCNV in a mouse model as mentioned before. Not only does there appear to be more CCNV in freshly isolated clinical strains, but there also appears to be heterogeneity within the same patient in terms of the copy number of CHRs 4 and 13 (Table 3.15, strains RTC23 and RTC31). Although chromosomal heterogeneity within a patient has been previously documented (Fries et a!., 1996 & Almeida et a!., 2007), this is the first time that heterogeneity was linked to a specific chromosome / locus. In one study, eight of the patients tested (24%) showed alterations in electrophoretic karyotyping between relapsing cryptococcal infections (Brandt et a!., 1996).  In another study, it was discovered that the  electrophoretic karyotypes of isolates before and after infection in a mouse model also differed (Fries et a!., 1996). Also, a survey of 32 clinical isolates in two hospitals revealed a wide range of karyotype patterns, with chromosome numbers ranging from 6 to 11 (Fries et a!., 1996). This  82  DISCUSSION AND CONCLUSIONS kind of microevolution on a chromosome scale can become stable if the infection is persistent or chronic (Sukroongreung et a!., 2001). Also, the microevolution may be dependent on where in the host these cells are found because isolates from different body sites have been reported to have different karyotypes (Sukroongreung et al., 2001). All of these results support the idea that microevolution within the patient via changes in chromosome copy number may occur in C. neoformans. Because in vitro passaging could result in a loss of aneuploidy, it will be important to perform CGH on cells directly originating from the patient without any laboratory passage. This kind of experiment is now possible because the technique for performing genome amplification on a single cell and the subsequent use of the gDNA for CGH analysis has been developed (Geigi & Speicher, 2007). If a wide range of CCNV is found within the same patient, then the next logical experiment would be to assess if the strains have any differing phenotypes. The next question that one may then ask is: why does CCNV seem to be more prevalent in clinical strains? As mentioned, C. neoformans can undergo phenotype switching and previous experiments have shown that switching occurs in vivo. This kind of switching is linked with higher virulence levels (especially if the switch involves changing from a mucoid colony to a smooth colony) (Fries et a!., 2001). It has been proposed that switching may cause changes in the capsular polysaccharide which in turn may help the cells evade the immune system (Fries et a!., 2001, Fries et al., 2005, Pietrella et a!., 2003). If CCNV can generate new phenotypes such as those observed in the first screening of CBS7779 (Figure 3.12), then it may be possible that CCNV could be the mechanism responsible for phenotype switching. Thus, a logical experiment would be to characterize the phenotypes such as the capsular components (another common phenotype that switches (Fries et a!., 1999)), and test if CCNV heterogeneity within a patient correlates with phenotypic heterogeneity.  83  DISCUSSION AND CONCLUSIONS Of course, CCNV may contribute to genetic diversity and evolution. That is, CCNV may provide a mechanism for the expansion of gene families or changes in the expression of genes involved with virulence. Previously, it has been reported that extra copies of genes have been associated with enhanced virulence. For example, Magnaporthe grisea has an extra copy of a gene involved in melanin biosynthesis when compared to its non-pathogenic fungal relative, Neurospora crassa (Thompson et a!., 1997). Other examples of pathogenic fungi which have chromosome number aberrations include Candida parapsilosis, a fungal pathogen associated with intravascular catheter infections in which six of the thirteen clinically isolated strains were aneuploids (Fundyga et al., 2004). In addition, aneuploidy has also been found in other yeast species including S. pastorianus (Bond et at., 2004) and Candida parapsilosis (Fundyga et at., 2004). The qRT-PCR experiments, besides revealing information regarding the copy number of CHRs 4 and 13, also provided interesting insights into the sequence variation of the strains. For example, as shown in Table 3.15, there was a low copy number for CHR 13 in strain JP1086 when the primer set CNNOO82O was used. Because the melting temperature of the PCR product was the same as the melting temperatures of PCR products from other strains (with the same primer set), the results suggest that the low copy number is not due to sequence deletion, but due to primer binding inefficiency. This in turn suggests that JP1086 may have a sequence variation at CNNOO82O despite being of the same molecular type (VNI) as the reference genome (H99). In addition, the relatively large SDs observed in Table 3.15, suggest that there could be a wide range of sequence variation within the same molecular subtype, because large SDs are usually observed when there are sequence polymorphisms (Lim et at., 2008).  Given these two  observations, the qRT-PCR results suggest that there could be sequence divergences within the  84  DISCUSSION AND CONCLUSIONS same molecular subtype of VNI, and that strain-specific primers may be needed for accurately assessing CCNV.  4.2.3 Final comments on CCNV A key result in this thesis work is that CCNV appears to be particularly prevalent among clinical strains.  In addition, the data from screening isolates indicate that once CCNV is  established, it is a relatively stable trait and it may lead to the generation of other chromosome copy number changes. Also, the presence of CCNV may affect certain virulence factors such as melanin production.  Interestingly, this work provides evidence that there could be CCNV  heterogeneity within the same patient during the course of an infection. Future experiments need to focus on deciphering the mechanism of CCNV and understanding the effects of CCNV on the phenotypes of the C. neoformans.  4.3 Conclusions Overall, the data presented in this thesis lay the groundwork for future studies into cryptococcal genome variation. The database of genomic variation for serotype A and serotype B strains can be used to generate many hypotheses regarding the roles of specific genes and gene-gene interactions in virulence. This work has also established the methodology for using CGH to identify the recombination history of strains and this may become an important method for mapping segments in the genome that play a role in virulence. In addition, the discovery that there is a bias for CHR 1 in AD strains to retain a serotype A copy strongly suggests that there is a selective advantage to this retention. This paves the way for future experiments involving chromosome tagging and virulence assays to investigate the role of CHR 1 in pathogenesis.  85  DISCUSSION AND CONCLUSIONS Finally, the discovery that there are chromosome copy number changes in C. neoformans is quite exciting because this phenomenon had not been previously characterized.  This will be an  important area for future studies that is justified by the prevalence of CCNV in clinical isolates and the possible link between chromosome copy number and virulence traits such as melanin.  86  REFERENCES REFERENCES Allen, T. D. & D. L. Nuss, (2004) Linkage between mitochondrial hypovirulence and viral hypovirulence in the chestnut blight fungus revealed by cDNA microarray analysis. Eukaiyot Cell 3: 1227-1232. Almeida, A. M., M. T. Matsumoto, L. C. Baeza, E. S. R. B. de Oliveira, A. A. Kleiner, S. Meihem Mde & M. J. Mendes Giannini, (2007) Molecular typing and antifungal susceptibility of clinical sequential isolates of Cryptococcus neoformans from Sao Paulo State, Brazil. FEMS Yeast Res 7: 152-164. Antinori, S., L. Galimberti, C. magni, A. Casella, L. Vago, F. Mainini, M. Piazza, M. Nebuloni, M. Fasan, C. Bonaccorso, G. M. Vigevani, A. Cargnel, M. Moroni & A. Ridolfo, (2001) Ciyptococcus neoformans Infection in a cohort of Italian AJDS patients: Natural history, early prognostic parameters, and autopsy findings. Eur J Clin Microbiol Infect Dis 20: 711 -717. Appelberg, R., (2006) Macrophage nutriprive antimicrobial mechanisms. JLeukoc Biol 79: 1117-1128. Archibald, L. K., M. J. Tuohy, D. A. Wilson, 0. Nwanyanwu, P. N. Kazembe, S. Tansuphasawadikul, B. Eampokalap, A. Chaovavanich, L. B. Reller, W. R. Jarvis, G. S. Hall & G. W. Procop, (2004) Antifungal susceptibilities of Cryptococcus neoformans. EmerglnfectDis 10: 143-145. Balm, Y. S., K. Kojima, G. M. Cox & J. Heitman, (2005) Specialization of the HOG pathway and its impact on differentiation and virulence of Ciyptococcus neoformans. Mo! Biol Cell 16: 2285-2300. Barelle, C. J., C. L. Priest, D. M. MacCallum, N. A. R. Gow, F. C. Odds & A. J. P. Brown, (2006) Niche-specific regulation of central metabolic pathways in a fungal pathogen. Cell Micb 8:961—971. Barreto de Oliveira, M. T., T. Boekhout, B. Theelen, F. Hagen, F. A. Baroni, M. S. Lazera, K. B. Lengeler, J. Heitman, I. N. Rivera & C. R. Paula, (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J Clin Microbiol 42: 13 56-1359. Bartlett, K. H., S. E. Kidd & J. W. Kronstad, (2008) The Emergence of Cryptococcus gattii in British Columbia and the Pacific Northwest. Curr Infect Dis Rep 10: 5 8-65. Barton, R. C. & K. Gull, (1992) Isolation, characterization, and genetic analysis of monosomic, aneuploid mutants of Candida albicans. Mo! Microbiol 6: 171-177. Bennett, J. E., K. J. Kwon-Chung & D. H. Howard, (1977) Epidemiologic differences among serotypes of Cryptococcus neoformans. Am JEpidemiol 105: 582-586. 87  REFERENCES Bicanic, T. & T. S. Harrison, (2004) Cryptococcal meningitis. British medical bulletin 72: 99 118.  -  Birchler, J. A., H. Yao & S. Chudalayandi, (2007) Biological consequences of dosage dependent gene regulatory systems. Biochim Biophys Acta 1769: 422-428. Boekhout, T. & A. van Belkum, (1997) Variability of karyotypes and RAPD types in genetically related strains of Cryptococcus neoformans. Curr Genet 32: 203-208. Boekhout, T., A. van Belkum, A. C. Leenders, H. A. Verbrugh, P. Mukamurangwa, D. Swinne & W. A. Scheffers, (1997) Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects. mt JSyst Bacteriol 47: 432-442. Bond, U., C. Neal, D. Donnelly & T. C. James, (2004) Aneuploidy and copy number breakpoints in the genome of lager yeasts mapped by microarray hybridisation. Curr Genet 45: 360370. Bose, I., A. J. Reese, J. J. Ory, G. Janbon & T. L. Doering, (2003) A yeast under cover: the capsule of Cryptococcus neoformans. Eukaryot Cell 2: 65 5-663. Brandt, M. E., S. L. Bragg & R. W. Pinner, (1993) Multilocus enzyme typing of Cryptococcus neoformans. JClin Microbiol3l: 28 19-2823. Brandt, M. E., M. A. Pfaller, R. A. Hajjeh, B. A. Graviss, J. Rees, E. D. Spitzer, R. W. Pinner & L. W. Mayer, (1996) Molecular subtypes and antifungal susceptibilities of serial Cryptococcus neoformans isolates in human immunodeficiency virus-associated Cryptococcosis. Cryptococcal Disease Active Surveillance Group. Jlnfect Dis 174: 812820. Campbell, L. T., J. A. Fraser, C. B. Nichols, F. S. Dietrich, D. Carter & J. Heitman, (2005) Clinical and environmental isolates of Cryptococcus gattii from Australia that retain sexual fecundity. Eukaryot Cell 4: 1410 1419. -  Chandenier, J., K. D. Adou-Bryn, C. Douchet, B. Sar, M. Kombila, D. Swinne, M. Therizol Ferly, Y. Buisson & D. Richard-Lenoble, (2004) In vitro activity of amphotericin B, fluconazole and voriconazole against 162 Cryptococcus neoformans isolates from Africa and Cambodia. Eur J Clin Microbiol Infect Dis 23: 506 508. -  Chaturvedi, S., P. Ren, S. D. Narasipura & V. Chaturvedi, (2005) Selection of optimal host strain for molecular pathogenesis studies on Cryptococcus gattii. Mycopathologia 160: 207-2 15. Chen, X., B. B. Magee, D. Dawson, P. T. Magee & C. A. Kumamoto, (2004) Chromosome 1 trisomy compromises the virulence of Candida albicans. Mol Microbiol 51: 551-565.  88  REFERENCES Clancy, C. J., M. H. Nguyen, R. Alandoerffer, S. Cheng, K. Iczkowski, M. Richardson & 3. R. Graybill, (2006) Cryptococcus neoformans var grubii isolates recovered from persons with AIDS demonstrate a wide range of virulence during murine meninoencephalitis that correlates with the expression of certain virulence factors. Microbiol 152: 2247 2255. -  Cogliati, M., M. C. Esposto, D. L. Clarke, B. L. Wickes & M. A. Viviani, (2001) Origin of Cryptococcus neoformans var. neoformans diploid strains. J Clin Microbiol 39: 3889 3894.  -  Corbertt, E. L., G. J. Churchyard, S. Charalambos, B. Samb, V. Moloi, T. C. Clayton, A. D. Grant, J. Murray, R. J. Hayes & K. M. d. Cock, (2002) Morbidity and mortality in South African gold miners: impact of untreated disease due to human immunodeficiency virus. ClinlnfectDis34: 1251- 1258. Coste, A., A. Selmecki, A. Forche, D. Diogo, M. E. Bougnoux, C. d’Enfert, J. Berman & D. Sanglard, (2007) Genotypic evolution of azole resistance mechanisms in sequential Candida albicans isolates. Eukaryot Cell 6: 1889-1904. Coste, A., V. Turner, F. Ischer, J. Morschhauser, A. Forche, A. Selmecki, J. Berman, J. Bille & D. Sanglard, (2006) A mutation in Taclp, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics 172: 2139-2156. D’Souza, C. A., J. A. Aispaugh, C. Yue, T. Harashima, G. M. Cox, 3. R. Perfect & J. Heitman, (2001) Cyclic AIVIP-dependent protein kinase controls virulence of the fungal pathogen Cryptococcus neoformans. Mol Cell Biol. 21: 3179-3191. de Lahondes, R., V. Ribes & B. Arcangioli, (2003) Fission yeast Sapl protein is essential for chromosome stability. Eukaiyot Cell 2: 910-921. Dwight, S.S., M.A. Harris, K. Dolinski, C. A. Ball, G. Binkley, K.R. Christie, D.G. Fisk, L. Issel-Tarver, M. Schroeder, G. Sherlock, A. Sethuranian, S. Weng, D. Botsein & J. M. Cherry, (2002). Nucleic Acids Res. 1: 69 72. —  Ellis, D., D. Marriott, R. A. Hajjeh, D. Wamock, W. Meyer & R. Barton, (2000) Epidemiology: surveillance of fungal infections. Med Mycol 38 Suppi 1: 173-182. Ellison, D. W., T. R. Clark, D. E. Sturdevant, K. Virtaneva, S. F. Porcella & T. Hackstadt, (2008) Genomic comparison of virulent Rickettsia rickettsii and avirulent Rickettsia rickettsii. Infect Immun 76: 542-550. Ferreira, I. D., V. E. Rosario & P. V. Cravo, (2006) Real-time quantitative PCR with SYBR Green I detection for estimating copy numbers of nine drug resistance candidate genes in Plasmodium falciparum. MalarJ5: 1.  89  REFERENCES Forche, A., K. Alby, D. Schaefer, A.D. Johnson, J. Berman & R. J. Bennett, (2008) The Parasexual Cycle in Candida albicans provides an alternative pathway to meiosis for the formation of recombinant strains. PLOSBio1 6:el 10. Franzot, S. P., J. Mukherjee, R. Chemiak, L. C. Chen, J. S. Hamdan & A. Casadevall, (1998) Microevolution of a standard strain of Ciyptococcus neoformans resulting in differences in virulence and other phenotypes. Infect Immun 66: 89-97. Fraser, J. A., S. Diezmann, R. L. Subaran, A. Allen, K. B. Lengeler, F. S. Dietrich & J. Heitman, (2004) Convergent evolution of chromosomal sex-determining regions in the animal and fungal kingdoms. PLoSBio1 2: e384. Fraser, J. A., S. S. Giles, E. C. Wenink, S. G. Geunes-Boyer, J. R. Wright, S. Diezmann, A. Allen, J. E. Stajich, F. S. Dietrich, J. R. Perfect & J. Heitman, (2005a) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360 1364.  -  Fraser, J. A., J. C. Huang, R. Pukkila-Worley, J. A. Alspaugh, T. G. Mitchell & J. Heitman, (2005b) Chromosomal translocation and segmental duplication in Cryptococcus neoformans. Euk Cell 4: 401 406. -  Fraser, J. A., R. L. Subarari, C. B. Nichols & J. Heitman, (2003) Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: Implications for an outbreak on Vancouver Island, Canada. Eukaryot Cell 2: 1036 1045. -  Fries, B. C. & A. Casadevall, (1998) Serial isolates of Cryptococcus neoformans from patients with AIDS differ in virulence for mice. JlnfectDis 178: 1761-1766. Fries, B. C., F. Chen, B. P. Currie & A. Casadevall, (1996) Karyotype instability in Cryptococcus neoformans infection. J Clin Microbiol 34: 153 1-1534. Fries, B. C., E. Cook, X. Wang & A. Casadevall, (2005) Effects of antifungal interventions on the outcome of experimental infections with phenotypic switch variants of Ciyptococcus neoformans. Antimicrob Agents Chemother 49: 350-357. Fries, B. C., D. L. Goldman, R. Cherniak, R. Ju & A. Casadevall, (1999) Phenotypic switching in Cryptococcus neoformans results in changes in cellular morphology and glucuronoxylomannan structure. Infect Immun 67: 6076-6083. Fries, B. C., C. P. Taborda, E. Serfass & A. Casadevall, (2001) Phenotypic switching of Ciyptococcus neoformans occurs in vivo and influences the outcome of infection. J Clin Invest 108: 1639-1648. Fundyga, R. E., R. J. Kuykendall, W. Lee-Yang & T. J. Lott, (2004) Evidence for aneuploidy and recombination in the human commensal yeast Candida parapsilosis. Infect Genet Evol4: 37-43. 90  REFERENCES Geigi, J. B. & M. R. Speicher, (2007) Single-cell isolation from cell suspensions and whole genome amplification from single cells to provide templates for CGH analysis. Nat Protoc 2: 3173-3184. Giles, S. S., A. K. Zaas, M. F. Reidy, J. R. Perfect & J. R. Wright, (2007) Cryptococcus neoformans is resistant to surfactant protein A mediated host defense mechanisms. PLoS ONE 2: e1370. Gressmann, H., B. Linz, R. Ghai, K.-P. Pleissner, R. Schlapbach, Y. Yamaoka, C. Kraft, S. Suerbaum, T. F. Meyer & M. Achtman, (2005) Gain and loss of multiple genes during the evolution of Helicobacterpylori. PLoS Genetics 1: e43. Grigg, M. E., S. Bormefoy, A. B. Hehl, Y. Suzuki & J. C. Boothroyd, (2005) Success and virulence in toxoplasma as the result of sexual recombination between two distinct ancestries. Science 294: 161 165. -  Guerrero, A., N. Jam, D. L. Goldman & B. C. Fries, (2006) Phenotypic switching in Cryptococcus neoformans. Microbiol 152: 3 9. -  Hakim, J. G., I. T. Gangaidzo, R. S. Heyderman, J. Mielke, E. Mushangi, A. Taziwa, V. J. Robertson, P. Musvaire & P. R. Mason, (2000) Impact of H1V infection on meningitis in Harare, Zimbabwe: a prospective study of 406 predominantly adult patients. AIDS 14: 1401. Harriff, M. J., M. Wu, M. L. Kent & L. E. Bermudez, (2008) Species of environmental mycobacteria differ in their abilities to grow in human, mouse, and carp macrophages and with regard to the presence of mycobacterial virulence genes, as observed by DNA microarray hybridization. Appl Environ Microbiol 74: 275-285. Harvala, H., H. Kalimo, L. Dahllund, J. Santti, P. Hughes, T. Hyypia & G. Stanway, (2002) Mapping of tissue tropism determinants in coxsackievirus genomes. J Gen Virol 83: 1697-1706. Heitman, J., B. Allen, A. Aispaugh & K. J. Kwon-Chung, (1999) On the origins of congenic MATalpha and MATa strains of the pathogenic yeast Cryptococcus neoformans. Fungal GenetBiol28: 1-5. Henry, I. M., B. P. Dukes & L. Comai, (2006) Molecular karyotyping and aneuploidy detection in Arabidopsis thaliana using quantitative fluorescent polymerase chain reaction. Plant J 48: 307-319. Herbert, M. A., C. J. E. Beveridge, D. McCormick, E. Aten, N. Jones, L. A. S. Snyder & N. J. Saunders, (2005) Genetic islands of Streptococcus agalactiae strains NEM3 16 and 2603VR and their presence in other Group B Streptococcal strains. BMC Microbiol 5: 31.  91  REFERENCES Hiremath, S. S., A. Chowclhary, T. Kowshik, H. S. Randhawa, S. Sun & J. Xu, (2008) Longdistance dispersal and recombination in environmental populations of Ciyptococcus neoformans var. grubii from India. Microbiology 154: 1513-1524. Hoang, L. M. N., J. A. Maguire, P. Doyle, M. Fyfe & D. L. Roscoe, (2004) Ciyptococcus neoformans infections at Vancouver Hospital and Health Science Centre (1997 2002): epidemiology, microbiology and histopathology. JMedMicrobiol 53: 935 940. -  -  Horst, C. M. v. d., M. S. Saag, G. A. Cloud, R. J. Hamill, J. R. Graybill, J. D. Sobel, P. C. Johnson, C. U. Tuazon, T. Kerkering, B. L. Moskovitz, W. G. Powclerly & W. E. Dismukes, (1997) Treatment of cryptococcal meningitis associated with the acquired immunodeficiency syndrome. National Institute of Allergy and Infectious Diseases Mycoses Study Group and AIDS Clinical Trials Group. NEnglJMed 337: 15 -21. Hu, G. & J. W. Kronstad, (2006) Gene disruption in Cryptococcus neoformans and Cryptococcus gattii by in vitro transposition. Curr Genet 49: 341-350. Hu, G., I. Liu, A. Sham, J. E. Stajich, F. S. Dietrich & J. W. Kronstad, (2008) Comparative hybridization reveals extensive genome variation in the AIDS-associated pathogen Cryptococcus neoformans. Genome Rio! 9: R41. Hu, G., B. R. Steen, T. Lian, A. P. Sham, N. Tam, K. L. Tangen & J. W. Kronstad, (2007) Transcriptional regulation by protein kinase A in Cryptococcus neoformans. PLoS Pathog3: e42. Hughes, T. R., C. J. Roberts, H. Dai, A. R. Jones, M. R. Meyer, D. Slade, J. Burchard, S. Dow, T. R. Ward, M. J. Kidd, S. H. Friend & M. J. Marton, (2000) Widespread aneuploidy revealed by DNA microarray expression profiling. Nat Genet 25: 333-337. Hull, C. M. & J. Heitman, (2002) Genetics of Cryptococcus neoformans. Annu Rev Genet 36: 557 615. -  Idnurm, A., Y.-S. Bahn, K. Nielsen, X. Lin, J. A. Fraser & J. Heitman, (2005) Deciphering the model pathogenic fungus Cryptococcus neoformans. Nature Rev Microbiol 3: 753 764. -  Ikeda, R., T. Sugita, E. S. Jacobson & T. Shinoda, (2003) Effects of melanin upon susceptibility of Cryptococcus to antifungals. Microbiol Immunol 47: 27 1-277. Ingham, D. J., S. Beer, S. Money & G. Hansen, (2001) Quantitative real-time PCR assay for determining transgene copy number in transformed plants. Biotechniques 31: 132-134, 136-140. James, A. P., E. R. Inhaber & G. J. Prefontaine, (1974) Lethal sectoring and the delayed induction of aneuploidy in yeast. Genetics 77: 1-9.  92  REFERENCES Janbon, G., (2004) Cryptococcus neoformans capsule biosynthesis and regulation. FEMS Yeast Res 4:765-771. Janbon, G., F. Sherman & E. Rustchenko, (1998) Monosomy of a specific chromosome determines L-sorbose utilization: a novel regulatory mechanism in Candida albicans. Proc NatlAcad Sci USA 95: 5150-5155. Jiang, R. H., R. Weide, P. J. van de Vondervoort & F. Govers, (2006) Amplification generates modular diversity at an avirulence locus in the pathogen Phytophthora. Genome Res 16: 827-840. Kavanaugh, L. A., J. A. Fraser & F. S. Dietrich, (2006) Recent evolution of the human pathogen Cryptococcus neoformans by intervarietal transfer of a 14-gene fragment. Mo! Biol Evol 23: 1879 1890. -  Kidd, S. E., Y. Chow, S. Mak, P. J. Bach, H. Chen, A. 0. Hingston, J. W. Kronstad & K. H. Bartlett, (2007) Characterization of environmental sources of the human and animal pathogen Cryptococcus gattii in British Columbia, Canada, and the Pacific Northwest of the United States. App! Environ Microbiol 73: 143 3-1443. Kidd, S. E., H. Guo, K. H. Bartlett, J. Xu & J. W. Kronstad, (2005) Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot Cell 4: 1629-1638. Koide, T., P. A. Zaini, L. M. Moreira, R. Z. Vencio, A. Y. Matsukuma, A. M. Durham, D. C. Teixeira, H. El-Dorry, P. B. Monteiro, A. C. da Silva, S. Verjovski-Almeida, A. M. da Silva & S. L. Gomes, (2004) DNA microarray-based genome comparison of a pathogenic and a nonpathogenic strain of Xylella fastidiosa delineates genes important for bacterial virulence. J Bacteriol 186: 5442-5449. Koressaar, T & M. Remm, (2007) Enhancements and modifications of primer design program Primer3. Bioinformatics 23: 1289— 1291. Kwon-Chung, K. J. & A. Varma, (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res 6: 574-587. Legrand, M., C. L. Chan, P. A. Jauert & D. T. Kirkpatrick, (2007) Role of DNA Mismatch Repair and Double-Strand Break Repair in Genome Stability and Antifungal Drug Resistance in Candida albicans. Eukaryot Cell 6: 2 194-2205. Lengeler, K. B., G. M. Cox & J. Heitman, (2001) Serotype AD strains of Ciyptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect Immun69: 115-122.  93  REFERENCES Lengeler, K. B., P. Wang, G. M. Cox, J. R. Perfect & J. Heitman, (2000) Identification of the MATa mating-type locus of Cryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct. Proc NatlAcad Sci USA 97: 14455-14460. Lim, J., H. Do, S. G. Shin & S. Hwang, (2008) Primer and probe sets for group-specific quantification of the genera Nitrosomonas and Nitrosospira using real-time PCR. Biotechnol Bioeng 99: 1374-1383. Lin, X. & 3. Heitman, (2006) The biology of Cryptococcus neoformans species complex. Annu Rev Microbiol 60: 69 105. -  Lin, X., A. P. Litvintseva, K. Nielsen, S. Patel, A. Floyd, T. G. Mitchell & J. Heitman, (2007) alpha AD alpha hybrids of Cryptococcus neoformans: evidence of same-sex mating in nature and hybrid fitness. PLoS Genet 3: 1975-1990. Lin, X., K. Nielsen, S. Patel & J. Heitman, (2008) Impact of Mating Type, Serotype, arid Ploidy on Virulence of Cryptococcus neoformans. Infect Immun 21: 21. Litvintseva, A. P., L. Kestenbaum, R. Vilgalys & T. G. Mitchell, (2005) Comparative analysis of environmental and clinical populations of Cryptococcus neoformans. J Clin Microbiol 43: 556-564. Litvintseva, A. P., X. Lin, I. Templeton, J. Heitman & T. G. Mitchell, (2007) Many globally isolated Al) hybrid strains of Cryptococcus neoformans originated in Africa. PLoS Pathog3: e114. Litvintseva, A. P., R. E. Marra, K. Nielsen, 3. Heitman, R. Vilgalys & T. G. Mitchell, (2003) Evidence of sexual recombination among Cryptococcus neoformans Serotype A isolates in Sub-Saharan Africa. Eukaryot Cell 2: 1162 1168. -  Litvintseva, A. P., R. Thakur, R. Vilgalys & T. G. Mitchell, (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (Serotype A), including a unique population in Botswana. Genetics 172: 2223 2238. -  Livak, K. J. & T. D. Schmittgen, (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408. Lorenz, M. C & G. R. Fink, (2002) Life and death in a macrophage: Role of the glyoxylate cycle in virulence. Euk Cell 1: 657— 662. MacDougall, L. & M. Fyfe, (2006) Emergence of Cryptococcus gattii in a novel environment provides clues to its incubation period. J Clin Microbiol 44: 1851 1852. -  94  REFERENCES Mao, Z.Q., Y. Huang, M. Sun, Q. Rua, Y. Qi, R. He, Y. J. Huang, Y. P. Ma, Y.H. Ji, Z. R. Sun, & H. Gao, (2007) Genetic polymorphism of UL144 open reading frame of human cytomegalovirus DNA detected in colon samples from infants with Hirschsprung’s disease. World J Gastroenterol 13: 4350 4354. —  Marchler-Bauer, A., J. B. Anderson, M. K. Derbyshire, C. DeWeese-Scott, N. R. Gonzales, M. Gwadz, L. Hao, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, D. Krylov, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. H. Marchler, M. Mullokandov, J. S. Song, N. Thanki, R. A. Yamashita, J. J. Yin, D. Zhang & S. H. Bryant, (2007) CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res 35: D237-240. Marichal, P., H. Vanden Bossche, F. C. Odds, G. Nobels, D. W. Wamock, V. Timmerman, C. Van Broeckhoven, S. Fay & P. Mose-Larsen, (1997) Molecular biological characterization of an azole-resistant Candida glabrata isolate. Antimicrob Agents Chemother 41: 2229-2237. Massey, R. C. & A. Buckling, (2002) Environmental regulation of mutation rates at specific sites. Trends Microbiol 10: 580-584. McClelland, E. B., F. R. Adler, D. L. Granger & W. K. Potts, (2004) Major histocompatibility complex controls the trajectory but not host-specific adaptation during virulence evolution of the pathogenic fungus Cryptococcus neoformans. Proc Biol Sci 271: 15571564. McClelland, E. E., W. T. Perrine, W. K. Potts & A. Casadevall, (2005) Relationship of virulence factor expression to evolved virulence in mouse-passaged Cryptococcus neoformans lines. Infect Immun. 73: 7047 7050. -  Meyer, W., K. Marszewska, M. Amirmostofian, R. P. Igreja, C. Hardtke, K. Methling, M. A. Viviani, A. Chindampom, S. Sukroongreung, M. A. John, D. H. Ellis & T. C. Sorrell, (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA-a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790-1799. Meyer, W. & T. G. Mitchell, (1995) Polymerase chain reaction fingerprinting in fungi using single primers specific to minisatellites and simple repetitive DNA sequences: strain variation in Cryptococcus neoformans. Electrophoresis 16: 1648-1656. Mitchell, T. G. & J. R. Perfect, (1995) Cryptococcosis in the era of AIDS--100 years after the discovery of Cryptococcus neoformans. C/in Microbiol Rev 8: 515-548. Molina, Y., S. B. Ramos, T. Douglass & L. S. Klig, (1999) Inositol synthesis and catabolism in Cryptococcus neoformans. Yeast 15: 1657-1667.  95  REFERENCES Myers, C. L., M. J. Dunham, S. Y. Kung & 0. G. Troyanskaya, (2004) Accurate detection of aneuploidies in array CGH and gene expression microarray data. Bioinformatics 20: 3533-3543. Nadal, M. & S. E. Gold, (2007) Sex in broad daylight: turning a new leaf-fungal style. Cell Host Microbe 1: 246-248. Nash, J. H. E., W. A. Findlay, C. C. Luebbert, 0. L. Mykytczuk, S. J. Foote, E. N. Taboada, C. D. Carrillo, J. M. Boyd, D. J. Coiquhoun, M. E. Reith & L. L. Brown, (2006) Comparative genomics profiling of clinical isolates of Aeromonas salmonicida using DNA microarrays. BMC Genomics 7: 43. Nazi, I., A. Scott, A. Sham, L. Rossi, P. R. Williamson, J. W. Kronstad & G. D. Wright, (2007) Role of homoserine transacetylase as a new target for antifungal agents. Antimicrob Agents Chemother5l: 1731-1736. Nielsen, K., G. M. Cox, A. P. Litvintseva, E. Mylonakis, S. D. Malliaris, J. Daniel K. Benjamin, S. S. Giles, T. G. Mitchell, A. Casadevall, J. R. Perfect & J. Heitman, (2005a) Cryptococcus neoformans alpha strains preferentially disseminate to the central nervous system during coinfection. Infect Immun 73: 4922 4933. -  Nielsen, K., R. E. Marra, F. Hagen, T. Boekhout, T. G. Mitchell, G. M. Cox & J. Heitman, (2005b) Interaction between genetic background and the mating-type locus in Cryptococcus neoformans virulence potential. Genetics 171: 975 983. -  Niwa, 0., Y. Tange & A. Kurabayashi, (2006) Growth arrest and chromosome instability in aneuploid yeast. Yeast 23: 937-950. Nunes, L. R., Y. B. Rosato, N. H. Muto, G. M. Yanai, V. S. da Silva, D. B. Leite, E. R. Goncalves, A. A. de Souza, H. D. Coletta-Filho, M. A. Machado, S. A. Lopes & R. C. de Oliveira, (2003) Microarray analyses of Xylella fastidiosa provide evidence of coordinated transcription control of laterally transferred elements. Genome Res 13: 570578. Ohkusu, M., N. Tangonan, K. Takeo, E. Kishida, M. Ohkubo, S. Aoki, K. Nakamura, T. Fujii, I. C. Siqueira, E. A. Maciel, S. Sakabe, G. M. Almeida, E. M. Heins-Vaccari & S. Lacaz Cda, (2002) Serotype, mating type and ploidy of Cryptococcus neoformans strains isolated from patients in Brazil. Rev Inst Med Trop Sao Paulo 44: 299-302. Ouspenski, II, S. J. Elledge & B. R. Brinkley, (1999) New yeast genes important for chromosome integrity and segregation identified by dosage effects on genome stability. NucleicAcidsRes 27: 3001-3008. Panepinto, J., L. Liu, J. Ramos, X. Zhu, T. Valyi-Nagy, S. Eksi, J. Fu, H. A. Jaffe, B. Wickes & P. R. Williamson, (2005) The DEAD-box P.NA helicase Vadi regulates multiple virulence-associated genes in Cryptococcus neoformans. J Clin Invest 115: 632-641. 96  REFERENCES  Parry, J. M., D. Sharp & E. M. Parry, (1979) Detection of mitotic and meiotic aneuploidy in the yeast Saccharomyces cerevisiae. Environ Health Perspect 31: 97-ill. Perepnikhatka, V., F. J. Fischer, M. Niimi, R. A. Baker, R. D. Cannon, Y. K. Wang, F. Sherman & E. Rustchenko, (1999) Specific chromosome alterations in fluconazole-resistant mutants of Candida albicans. J Bacteriol 181: 4041-4049. Pietrella, D., B. Fries, P. Lupo, F. Bistoni, A. Casadevall & A. Vecchiarelli, (2003) Phenotypic switching of Cryptococcus neoformans can influence the outcome of the human immune response. Cell Microbiol 5: 513-522. Pitkin, J. W., D. G. Panaccione & J. D. Walton, (1996) A putative cyclic peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungus Cochliobolus carbonum. Microbiology. 142: 1557-1565. Powell, A. J., G. C. Conant, D. E. Brown, I. Carbone & R. A. Dean, (2008) Altered patterns of gene duplication and differential gene gain and loss in fungal pathogens. BMC Genomics 9: 147. Pukkila-Worley, R., Q. D. Gerrald, P. R. Kraus, M. Boily, M. J. Davis, S.S. Giles, G. M. Cox, J. Heitman and J.A. Aispaugh, (2005) Transcriptional network of multiple capsule and melanin genes governed by the Cryptococcus neoformans cyclic AMP cascade. Euk Cell 4:190—201. Rajashekara, G., J. D. Glasner, D. A. Glover & G. A. Splitter, (2004) Comparative Whole Genome Hybridization reveals genomic islands in Bruce/la species. J Bacteriol 186: 5040-505 1. Ramirez, M. A. & M. C. Lorenz, (2007) Mutations in alternative carbon utilization pathways in Candida albicans attenuate virulence and confer pleiotropic phenotypes. Euk Cell 6: 280—290. Rustchenko-Bulgac, E. P., F. Sherman & J. B. Hicks, (1990) Chromosomal rearrangements associated with morphological mutants provide a means for genetic variation of Candida albicans. JBacteriol 172: 1276-1283. Schutte, C. M., C. H. V. d. Meyden & D. S. Magazi, (2000) The impact of HIV on meningitis as seen at a south African academic hospital (1994 to 1998). Infection 28: 3 7. -  Selmecki, A., S. Bergmann & J. Berman, (2005) Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mo! Microbiol 55: 1553 1565.  -  Selmecki, A., A. Forche & J. Berman, (2006) Aneuploidy and isochromosome formation in drug-resistant Candida albicans. Science 313: 367-370. 97  REFERENCES Seizer, R. R., T. A. Richmond, N. J. Pofahi, R. D. Green, P. S. Eis, P. Nair, A. R. Brothman & R. L. Staiiings, (2005) Analysis of chromosome breakpoints in neuroblastoma at sub kilobase resolution using fine-tiling oligonucleotide array CGH. Genes Chromosomes Cancer 44: 305-319. Sukroongreung, S., S. Lim, S. Tantimavanich, B. Eampokalap, D. Carter, C. Nilakul, S. Kulkeratiyut & S. Tansuphaswadikul, (2001) Phenotypic switching and genetic diversity of Cryptococcus neoformans. J Clin Microbiol 39: 2060-2064. Suzuki, T., I. Kobayashi, T. Kanbe & K. Tanaka, (1989) High frequency variation of colony morphology and chromosome reorganization in the pathogenic yeast Candida albicans. J Gen Microbiol 135: 425-434. Taboada, E. N., R. R. Acedillo, C. D. Carrillo, W. A. Findlay, D. T. Medeiros, 0. L. Mykytczuk, M. J. Roberts, C. A. Valencia, J. M. Farber & J. H. Nash, (2004) Large scale comparative genomics meta-analysis of Campylobacterjejuni isolates reveals low level of genome plasticity. J Clin Microbiol 24: 4566 4576. -  Taboada, E. N., R. R. Acedillo, C. C. Luebbert, W. A. Findlay & J. H. E. Nash, (2005) A new approach for the analysis of bacterial microarray-based Comparative Genome Hybridization: insights from an empirical study. BMC Genomics 6: 78. Tanaka, E., S. Ito-Kuwa, K. Nakamura, S. Aoki, V. Vidotto & M. Ito, (2005) Comparisons of the laccase gene among serotypes and melanin-deficient variants of Cryptococcus neoformans. Microbiol Immunol 49: 209-2 17. Tanaka, R., K. Nishimura & M. Miyaji, (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Nzppon Ishinkin Gakkai Zasshi 40: 3 1-34. Thompson, J. E., G. S. Basarab, A. Andersson, Y. Lindqvist & D. B. Jordan, (1997) Trihydroxynaphthalene reductase from Magnaporthe grisea: realization of an active center inhibitor and elucidation of the kinetic mechanism. Biochemistry 36: 1852-1860. Torres, B. M., T. Sokolsky, C. M. Tucker, L. Y. Chan, M. Boselli, M. J. Dunham & A. Amon, (2007) Effects of aneuploidy on cellular physiology and cell division in haploid yeast. Science 317: 9 16-924. Ulaszewski, S., J. R. Woodward & V. P. Cirillo, (1978) Membrane damage associated with inositol-less death in Saccharomyces cerevisiae. JBacteriol 136: 49-54. Voullaire, L. & L. Wilton, (2007) Comparative genomic hybridization on single cells. Methods Mol Med 132: 101-115. Waghmare, S. K. & C. V. Bruschi, (2005) Differential chromosome control of ploidy in the yeast Saccharomyces cerevisiae. Yeast 22: 625-639.  98  REFERENCES Walton, F. J., A. Idnurm & J. Heitman, (2005) Novel gene functions required for melanization of the human pathogen Cryptococcus neoformans. Mo! Microbiol 57: 138 1-1396. Wang, F. X., H. Zhou, H. Ling, H. Z. Zhou, W. H. Liu, Y. M. Shao & J. Zhou, (2007) Subtype and sequence analysis of HIV-1 strains in Heilongjiang Province. Chin Med J22: 2006— 2010. Watanabe, T., Y. Murata, S. Oka & H. Iwahashi, (2004) A new approach to species determination for yeast strains: DNA microarray-based comparative genomic hybridization using yeast DNA microarray with 6000 genes. Yeast 21: 351 365. -  Winzeler, E. A., D. R. Richards, A. R. Conway, A. L. Goldstein, S. Kalman, M. J. McCullough, J.H. McCusker, D.A. Stevens, L. Wodicka, D. J.Lockhart & R. W. Davis, (1998) Direct alleic variation scanning of the yeast genome. Science 281: 1194— 1197. Wright, L. C., R. M. Santangelo, R. Ganendren, 3. Payne, S. T. Djordjevic & T. C. Sorrell, (2007) Cryptococcal lipid metabolism: phospholipase B 1 is implicated in transcellular metabolism of macrophage-derived lipids. Eukaryot Cell 6: 3 7-47. Wu, M. L., T.P. Lin, M. Y. Lin, Y. P. Cheng & S. Y. Hwang, (2007) Divergent evolution of the chloroplast small heat shock protein gene in the genera Rhododendron (Ericaceae) and Machilus (Lauraceae). Ann Bot 99: 461 475. —  Zhong, J., S. Frases, H. Wang, A. Casadevall and P. E. Stark, (2008) Following fungal melanin biosynthesis with solid-state NMR: Biopolymer molecular structures and possible connections to cell-wall polysacchardies. Biochem 47: 4701-4710.  99  Chr  GLEAN_05259  GLEAN_05255  GLEAN_05254  GLEAN_05253  GLEAN_05252  12800-24800  12800-24800  12800. 24800  12800- 24800  12800- 24800  XP 568354  XP 778147  GLEAN 05173  GLEAN_04878  —  GLEAN 04987  —  GLEAN 05460  —  GLEAN 05065  —  GLEAN 05065  —  GLEAN 05066  —  XP_567034  —  XI’ 751881  —  XP 771825  —  XI’ 567971  —  XI’ 567971  —  XI’ 771810  —  EAU93688  GLEAN 05318  —  EAU93688  —  GLEAN 05318  —  EAU93688  —  GLEAN 05190  —  XI’ 568354  XP_777999  XP_00126101 1  BAE57378  XP_567265  XP_747706  XP_001259191  GeoBank u  GLEAN 05318  —  GLEAN 05190  GLEAN_05258  0- 2000  339300350700 339300350700 339600359090 339600350000 344300350200 446300450300 9092001002800 9992001002800 10013001002900 10013001002900 13756001376800 19310001932300  Glean number°  Coord.segment  2.OOE-55  6.OOE-162  3.OOE-85  2.OOE-83  2.OOE.83  9.OOE-08  3.OOE-l79  l.OOE-l8  l.OOE-l8  6.OOE-65  1.OOE-18  6.OOE-65  2.00E-120  2.OOE-177  0.023  6.OOE-58  4.OOE-04  7.OOE-06  ic-value -  1931772  1930978-  -  345835349644 345835 349044 447026. 448723 9997271000137 10002241001851 10002241001851 10019821002620 13548141358607  345835349644 341653-  1283013578 1411516370 1672319388 2090622642 2479026105 341653-  168- 5406  Coord. Gened  Hypothetical protein  Sodium P-type ATPase, putative [Aspergillus frmigatus].  Hypothetical protein  Retrolransposonnucleocapsid protein  Retrotransposon nucleocapsid protein  Hypothetical protein  Hypothetical protein  Predictedprotein[Coprinopsiscinerea].  Predicted protein [Coprinopsis cinerea].  Hypothetical protein  Predictedprotein[Coprinopsiscinerea].  Hypothetical protein  Hypothetical protein  Unnamed protein product [Aspergillus oryzaej. TPR domain protein [Neomrtorya fischeri)  Drugtransporter  Helicase, putatIve [Neosartorya fischeri]. Amidohydrolase, putative [Aspergillus flimigatus]  Predicted function  -2.194  -1.433  -1.433  1.857  1.857  -3.110  -3.110  -3.110  -3.110  -3.110  -2.392  Bt63  functional information is from the C. neoformans annotation ofJEC21 (TIGR).  -3.038  -3.038  .2.890  -2.890  -2.890  -2.890  -2.890  -0.887  125.91  1.000  1.000  1.073  CBS 7779  AVG LR  -1.913  -1.677  -1.677  -2.261  1.027  1.176  WM 626  -4 328  -2440  -2.440  -0.645  -0.645  -4.826  -4.826  -4.826  -4.826  -4.826  -4 326  Bt63  -5.127  -5.127  -5.545  -5.545  -5.545  -5.545  -5.545  -1.689  125.91  -0.094  -0.094  0.752  CBS 7779  Lowest LR for region  -3.979  -3.516  -3.516  .4192  -0.983  0.298  WM 626  -0 621  -0.329  -0.329  3.076  3.076  0.555  0.555  0.555  0.555  0.555  1.389  Bi63  -0.331  -0.331  0.903  0.903  0.903  0.903  0.903  0.534  125.91  1.754  1.754  1.633  CBS 7779  Highest LR for region  -0.285  0.414  0.414  0.82  2.411  2.445  WM 626  Regions of difference in the genomes of four serotype A strains compared with the sequenced genome of strain H99. Regions of difference that overlap are in the same colour. The first column indicates the chromosome (CHR) number. The subsequent columns are labeled as follows: aNucleotide coordinates of the segment identified by CGH. bGlean number for the H99 gene in the region based on the annotation at the Broad Institute. cGer]3fl ID of top BLASTn. The E-value of the BLASTn result is included in the following column. dCoordjnates of the specific gene in the segment identified by CGH. eFnnctional information about the top BLAST hit. Note that if no organism name is given, the  Appendix A. Database of genomic variation observed in serotype A strains via CGH  2  —  Cur  -  —  GLEAN_02791  88400- 89700  -  267000283800 267000 283800  267000283800  -  267000 283800 267000283800  267000283800  219200221000 260600263900 260600263900 267000283800  150400155600  GLEAN_02868  —  GLEAN 02867  —  GLEAN 02866  —  GLEAN 02761  —  GLEAN 02865  —  GLEAN 02864  —  GLEAN 02863  —  GLEAN 02764  —  GLEAN 02661  —  GLEAN 02851  —  GLEAN 02840  —  GLEAN 02839  —  GLEAN 02827  GLEAN_02825  88400- 89700  102000102800 150400155600  GLEAN_02795  —  GLEAN 04816  —  GLEAN 05697  —  GLEAN 05696  —  GLEAN 05695  59000- 60000  2289800 2273900. 2289800 22739002289800 22739002289800  2159000 2273900  GLEAN 04837  —  GLEAN 05617  —  GLEAN 04837  —  GLEAN 05671 0.OOE+00  XP 777765  5.OOE-27  XP 776539  XP_00l2l4108  EAT89175  —  NP 690845  —  XP 001267666  —  Xl’ 001028745  —  XI’ 001275564  —  XP 776539  EAU8IOIS  —  XI’ 772444  AAW41778  —  XP 755620  —  Xi’ 776539  —  XP 777007  XP_568774  XP_568772  XP_776539  —  7.OOE-04  5.OOE-l3  l.OOE-l5  3.OOE-19  4 OOE-65  2,00E-38  1.OOE-31  3.40E-Ot  8.OOE-73  0.OOE+00  8.OOE-82  4.OOE-31  9.OOE-82  7.OOE-25  0.OOE+00  1.OOE-32  4.OOE-84  Xl’ 568729  —  l.OOE-62  XI’ 776317  —  XI’ 001421492  —  —  6.30E-01  0.OOE-I-00  XP 777765  —  0.OOE+00  XP 566908  —  —  6.OOE-60  3.OOE-61  E-value  XP 566921  XP_755943  GLEAN_04838  21507002159600  21507002159600 21507002159600 21526002159000 2152600-  GenBank ID’  COOrd. sgment -  -  276346276498 276583276678  275643 275900 -  272970275425 274227274500  271382272566  219651222324 260648261960 262148263310 268199270025  153876 155916  -  8427988794 89661 90954 98930103013 150656152503  5719659316  -  21469412150760 21525612154878 21551242159016 21525812154878 21551242159016 2275865 2276751 22770322277691 2279601 2282091 22876562288399  Coord. Gene’  -2514  -2.514  -1.683  -1.683  -1.683  WM 626  protein  Hypothetical protein [Aspergillus terreus].  Hypothetical protein [Phaeosphaeria nodorum].  Mitochondrinl protein (Saccharomyces cerevisineJ.  Small nucleolar ribonucleoprotein complexsubunit,putative(Aspergillus clavatset]. Hypothetical protein (Tetrahytnena thermopbila. Hypothetical protein (Neotaitoiya fncheril.  Hypothetical  Predictedprotein[Coprinopsiscinerea].  Hypothetical protein  Chitinsynthaseregulator3  Smallnucleolarribonucleoprotein complex subunit, putative IAopergillus fumigatusi.  Hypothetical protein  Hypothetical protein -1.931  -2,871  -0.987  -0.987  -0.987  -0.987  -0.987  -0987  -0.987  -2.273  -0.692  -0.692  -1.269 -1.269  Gamma DNA-directed DNA polyineraoe  -0.644  AT? oynthase delta chain, mitochondrinl precursor  Hypothetical protein  — — —  -2.514  CBS 7779  Retrotransposable element slacs 132 kda protein  -1.936  -1.936  125.91  -2.514  -2.871  Bt63  Hypothetical protein  Predicted protein lOstreococcus lucimarinus].  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Nuclearcohesincomplexsubunit(Psc3), putative [Aspecgillus fumigatut].  Predicted function’  AVG LR  -4.233  -4.233  Bt63  -4.031  -2.937  -2.937  125.91  -4.268  -4 268  -4266  -4.268  -3.197  .3.197  -3197  WM 626 Bt63  -0.985  -0.985  125.91  CBS 7779  Highest LR for region  —  —  -2.123  -2.123  -2,123  -2.123  -2.123  -2.123  -2.123  -3.834  -1.791  -1.791  -2.638  -2.638  -1.861  -0.744  -0.744  0 659  -0.012  -0.012  -0.012  -0.012  -0,012  -0.012  -0.012  0.068  0.437  0.437  -0.151  -0.151  0.084  -0.021  -0.021  -0.021  -0.021  -0.003  -0.003  -0.003  WM 626  —— — — — —  —  CBS 7779  Lowest LR for region  —  2  Chr  I’-.)  C  654000655000 846400847800 859600863400 12300001230900 12300001230900 13348001340800  448700450300  267000283800 267000283800 398700402800 398700402800 419200420400 14067001408200 14084001409500 15184001529300 15184001529300 15184001529300 15184001529300 15184001529300 15184001529300 15248001529200 15248001529200 15248001529200  267000283800  -  267000283800 267000 283800  Coord. segmen.  GLEAN_04775  —  GLEAN 04757  —  GLEAN 04278  —  GLEAN 04348  —  GLEAN 04350  —  GLEAN 04651  GLEAN_04435  —  GLEAN 02510  —  GLEAN 02311  —  GLEAN 03107  —  GLEAN 02510  —  GLEAN 02511  —  GLEAN 03107  —  GLEAN 03106  —  GLEAN 02512  —  GLEAN 02513  —  GLEAN 03084  —  GLEAN 03083  —  GLEAN 02897  —  GLEAN 02893  —  GLEAN 02737  —  GLEAN 02758  —  GLEAN 02871  —  GLEAN 02759  —  GLEAN 02870  GLEAN_02869  Glean number”  XP_567626  —  NP 758505  —  NP 567785  —  NP 776539  —  NP 570011  YP_95l772  —  NP 775648  —  XI’ 566921  —  NP 566922  —  NP 775648  —  NP 566921  —  NP 566922  —  NP 777460  —  NP 566846  —  NP 268911  —  NP 568991  —  NP 001274539  EAU92024  —  XI’ 568809  —  XP 777205  —  NP 001267666  —  NP 665229  —  NP 013263  —  XP 778898  AAK13589  GenBank fl)  2.OOE-178  2.OOE-25  3.OOE-79  2.OOE-34  4.OOE-51  8.OOE-06  3.OOE-l I  9.OOE-05  2.OOE-l08  3.OOE-ll  9.OOE-05  2.OOE-108  2.OOE-75  4.OOE-89  2.50E-02  6.OOE-50  7.OOE-04  2 OOE-09  5.OOE-65  2.OOE-137  3.OOE-19  2.OOE-38  6.OOE-01  3.10E+00  3.OOE-15  B-value -  -  -  860509862619 12296981230607 12307491233656 13340641335083  -  448806449781 654633 655234  -  281245 281900 282502282775 398261 399525 400430401114 419600420387 14068961407932 14099391410687 15184561518773 15197021521218 15223041523255 15242911525830 15262631526669 15279161528519 15242911525830 15262631526669 15279161528519  280981 281144  277188277878 278649278891  Coord. Gened  Hypothetical protein  Hypothetical protein UM02358. 1 [Ustilago maydis]  Hypothetical protein  Hypothetical protein  Hypothetical protein  UDP-glucose:sterolglucosyltransferase  Carhoxymuconolactone decarboxylase IMycobacteriumvanbaalenii]  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Transposableelement-c,ypton-Cnl  Hypothetical protein [Streptococcus phage 370.1].  Protein-methionine-R-oxide reductase  Stress response protein kdsl, putative [Aspergillus clavatusi.  Predicted protein [Coprinopsis cinerea].  DNA-directed EllA polymerase  Hypothetical protein  Senescence-associated protein ICryptosporidiumhominisl. Hypothetical protein [Neosartorya fischeri].  Putative protein [Saccharomyces cerevisiae).  Hypothetical protein Ioiardia Iambus].  rENA intron-encoded homing endonucleaselOryzasativa]  Predicted function’  -0.775  -1.155  -1.378  -1.378  -1.378  -2.521  -1.564  -0.888  -0.888  B163  1 251  1.251  125.91  -1.136  CBS 7779  AVG LR  -1.688  -2.155  -1.796  -1.796  -1.796  -1.796  -1.796  -1.796  -1.690  -0 987  -0.987  -0.987  -0.987  -0.987  WM 626  -2.276  -2.573  -4.066  -4.066  -4.066  -3.619  -3.411  -3.066  -3.066  Bt63  0 592  0.592  125.91  -4.500  -4.500  -4.500  -4500  -4.500  -4.500  -3.376  -2 123  -2.123  -2.123  -2 123  -2.123  WM 626  -3.704 -3.125  -4.069  ——  CBS 7779  Lowest LR for region  1.294  0.146  1.643  1.643  1.643  -1.262  0.405  0.634  0.634  Bt63  1 886  1.886  125.91  0.156  CBS 7779  Highest LR for region  -0.902  -0.029  —  1.489  1.489  1.489  1.489  1.489  1.489  -0.218  -0 012  -0.012  -0.012  -0.012  -0.012  WM 626  4  —  Chr  -a  142800145200 187200188900 233500240200 233500240200 233500240200  200-1100  13348001340800 13360001340500 13360001340500 14204001422800 14204001422800 14333001446600 14333001446600 14333001446600 14333001446600 14333001446600 14333001446600 14333001446600 14333001446600 14333001446600 14333001434900 14333001434900 15655001571900 1565500. 1571900 15655001571900 15655001571900  13348001340800  Coord. , segmen.  EAU81955  AA.L35341  Xi’ 567607  GLEAN 04244  GLEAN 04242  GLEAN 04241  Xl’ 567607  —  GLEAN_00759  —  GLEAN 00669  —  GLEAN 00670  —  GLEAN 00678  —  GLEAN 00688  NO GENE  —  GLEAN 04214  —  GLEAN 04215  —  GLEAN 04216  —  GLEAN 04217  XP_773471  —  XI’ 001259379  —  XI’ 568131  —  XI’ 773452  —  Xl’ 572600  AAG59831  —  XI’ 001261612  —  Xl’ 748341  —  Xl’ 001258626  —  AAL35341  —  GLEAN 04242  —  Xl’ 567601  —  XP 772605  —  XP 567603  —  XP 567603  —  Xl’ 772605  —  Xl’ 567605  —  NP 595254  GLEAN 04241  —  GLEAN 04236  —  GLEAN 04237  —  GLEAN 04238  —  GLEAN 04239  —  GLEAN 04798  —  GLEAN 04797  —  GLEAN 04240  —  —  —  —  —  EAU92919  GLEAN 04794  —  AAM81269  —  XP 567626  GLEAN 04777  —  GLEAN 04776  —  AAM81269  XP_567626  GLEAN_04776  GLEAN 04777  GenflankiD’  Gknn number  0.OOE+00  4.OOE-06  0.OOE+00  l.OOE-84  4.OOE-l30  3.OOE-84  2.OOE-5t  2.OOE-176  2.OOE-115  1.OOE-l63  0.OOE+00  5.OOE-62  5.00E-136  7.OOE-15  4.OOE-08  5.OOE-136  5.OOE-140  2.OOE-26  1.OOE-163  0.OOE+00  4.OOE-46  8.OOE-58  2.OOE-15  2.OOE-20  2.OOE-15  2.00E-20  E-vahae  -  -  142196144358 186294188701 235727237978 238465 239705 240125242641  -  -  -  13357891336219 1337863 1339910 13357191336219 1337863 1339980 14195211421658 14223541426421 14316701433335 14346281437056 14392041440114 14404271442012 14422381443480 14439321444264 14448871445696 14467371449052 14500561451939 14316701433335 14346281437056 15588461561544 1562223 1564413 1566524 1567137 15684231571892  CoortiGene’  Hypothetical protein  Polyketide synthase, putative LNeosartorya fischerij.  GabA permease  Hypothetical protein  Cytosine-purinepermease  Beta.glucosidase [Volvariellavolvacca].  C6 fmger domain protein, putative (Neosartoryafischerij. Hexose transporter protein [Aspergillus fhmigatus]. Isochorismatase fumily hydrolase, putative [Neosartorya fiscberil.  Membrane transporter  Sodium-hydrogenantiporter  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Autophagy-related protein  Methyltransfurase [Schizosaceharomyces pombe].  Membrane transporter  Sodium-hydrogen antiporter  NADH dehydrogenase subunit 4L ICryptococcus neofomians var. grubii Hypothetical protein [Coprinopsis cinereal. Hypothetical protein [Coprinopsis cinereaj.  Hypothetical protein  NADH dehydrogenase subunit 4L ICryptoccus neoformans var. grubiil.  Hypothetical protein  Predicted function’  -2.737  —  -0.478  -0.478  -0.478  -0.478  -0.478  -0.478  -0.478  -0.478  -0.478  0.751  0751  -0.775  -0.775  Bt63  -2.323  125.91  1.123  CBS 7779  AVG UR  -2.297  -2.297  -2.297  -3.t93  -3.193  -3.193  -3 193  -1.605  -1.605  1 837  -1.837  WM 626  -4.348  -3.916  -3.916  -3.916  -3.916  -3.916  -3.916  -3.916  -3.916  -3.916  0.801  0801  -2.276  -2.276  Bt63  -3.601  125.91  1.697  CBS 7779  -0445  -0.445  -0445  0101  0.101  1054  1.054  WM 626  -4.659  -4.659  -4.659  -0.037  -0.037  -0.037  -0.445  125.91  — — 0.233  2.160  2.160  2.160  2.160  2.160  2.160  2.160  2.160  2.160  1.607  I 607  1.294  1.294  Bt63  -4 823  -4.823  -4.823  -4 823  -3.444  -3444  —  -4503  -4503  WM 626  Highest LR for regioa  — — 0 882  CBS 7779  Lowest LR for region  5  —  Chr  -2.112  -2.004  -4.659  -4.659  WM 626 Bt63  1.OOE-165 3.OOE-73  NOGENE  NOGENE  NP_572149  NP_775060  NP_753692  GLEAN 02155  GLEAN_02155  GLEAN_02156  GLEAN_02l54  GLEAN_02157  50-800  4200-22000  4200- 22000  4200- 22000  4200- 22000  4.OOE-40  1.OOE-51  0.OOE-IO0  5.OOE-61  6.OOE-37  0.OOE+00  5.OOE-6l  6.OOE-37  4.20E+00  9.OOE-tO  3.OOE-04  3.OOE-04  3.OOE-73  1.OOE-68  0.OOE+00  6.OOE-08  NO GENE  —  XP 775062  —  NP 571460  —  NP 001259059  —  NP 772566  —  NP 571460  —  NP 001259059  —  Xl’ 772566  —  XP 001222740  —  Xl’ 567775  —  Xl’ 001274983  —  XI’ 568378  —  XI’ 572526  —  XP 567737  —  XI’ 567968  —  Xl’ 749615  —  GLEAN_02155  —  GLEAN 00926  —  GLEAN 00925  —  GLEAN 00514  —  GLEAN 00924  —  GLEAN 00925  —  GLEAN 00514  —  GLEAN 00924  —  GLEAN 00515  —  GLEAN 00923  —  GLEAN 00516  —  GLEAN 00912  —  GLEAN 00550  —  GLEAN 00560  —  GLEAN 00867  —  GLEAN 00573  —  0.254 -3.865  1.104  MFS allantoate transporter, putative [Aspergillus fumigatus].  1.594  1.594 0.014 1.104  Hypothetical protein  7285- 8614  0.014  1.594 0.014  9145-10906  1.594 0.014 1.104  -0.104  — ———  -0.075  -0.075  -0.075  0.485  -0.075  0.285  0.285  0.285  0 285  0.285  0.285  0.548  0.501  -0.037  -0.037  WM 626  -4.426  -4.426  -4.426  -4.426  -3.889  1 54  -1.479  -4.684  -4.684  -4.684  -4 684  -4.684  -4.684  0.103  -3.538  -0.051  -0.051  -0.750  -2.179  -2.514  -2.514  -2.514  -2.514  -2.776  -1.132  -2.112  1.104  -2.449  -2.449  -2.449  -2 449  -2.449  -2.449  0.599  -0.705  CBS 7779  Hypothetical protein  Hypothetical protein  Trehalose transporter  NAD.binding Rossmann fold oxidoreductase Ilmily protein [Neosartoiya fischeri].  Hypothetical protein  Trehalose transporter  NAO.binding Rossmann fold oxidoreductase thmily protein INeosartorva fiacheril.  Hypothetical protein  Hypothetical protein [Chaetomium globosum].  Beta-fiuctofinanosidase  Allantoate permease (Aspergillus clavatus].  Hypothetical protein  Membrane protein  Hypothetical protein  Protein threonine/tyrosine kinase  BSD domain protein [Aspergillus fumigatus].  125.91  Highest LR for region  6685- 6955  10736211075767 10787971079543  10713781072715  10736211075767 10674071070812  10713781072715  992540993955 10582961059831 10618471063580 1063965 1065856 10674071070812  884707886512  -  647320649005 753095 754838 755150757860 829807830546  -4.537  -0.705  CBS 7779  -2.842  125.91  Xl’ 567996  Bt63  NO GENE -0.716  -2.297  -2.297  WM 626  GLEAN 00841  Hypothetical protein  CBS 7779  NO GENE  125.91  0.728  -  Amine oxidase Mango esterase  Bt63  -0.216  -  Predicted function  -3.502  0-5200  10667001080400 10667001080400  10667001080400  10580001073700 10667001080400  10580001073700  10580001073700 10580001073700  1073700  992300994400 10580001073700 1058000-  884800886200  -  251303253135 253643 254756  Coord. Gene’  -1.899  0.OOE+00  9.OOE-106  O.OOE+00  E-vahie  NO GENE  —  Xl’ 561123  XP_568124  GenBank flY  Lowest LIt for region  NO GENE  —  GLEAN 00665  GLEAN_00762  249200255200  249200255200 382800385200 436000436900 646400647900 754600756000 754600756000 829000831300  Glean numberh  Coord. aegment  AVG LR  GLEAN_02154  GLEAN_02157  GLEAN_02153  GLEAN_02152  GLEAN_02158  GLEAN_021 59  GLEAN_02150  GLEAN_02160  GLEAN_02149  GLEAN_02158  GLEAN 02160  GLEAN_02177  6700-32800  6700-32800  6700-32800  6700-32800  6700-32800  6700- 32800  6700- 32800  6700- 32800  6700- 32800  17700-20800  27400-29500  94100- 96600  5.OOE-23  XP_776197  XP_57069l  XP571053  XP570692  AAS92522  AAK55608  AAS92522  GLEAN_02200  —  —  GLEAN 02119  —  XP 755038  AAY25038  —  XP 773197  GLEAN 02119  —  GLEAN 02124  —  GLEAN 02126  —  GLEAN 02194  —  —  2,00E-03  8.OOE-04  8.OOE-04  1.OOE-152  6.OOE-71  9.OOE-69  7.OOE-170 6,00E-157  AAN75167  —  Xl’ 570106  1.OOE-144  GLEAN 02193  —  GLEAN 02192  —  1.OOE-131  0.OOE+00  0.00E400  5.OOE-130  0.OOE+00  XP_748173  XP_57069t  7.OOE-29  0.OOE+00  3.OOE-163  9.OOE-29  3.OOE-73  1.OOE-165  4.OOE-40  7.OOE-29  0.OOE+00  EAU83894  CAD70763  XP_751307  XP_001264611  XP_753692  XP_775060  XP_572149  EAU83894  XP 570389  GLEAN_02156  6700.32800  GLEAN 02183  GLEAN_02159  4200- 22000  CAD70763  3.OOE-163  XP_751307  NOGENE  GLEAN_02I58  4200-22000  9.OOE-29  E-valne  XP_001264611  GenBank H3  NOGENE  GLEAN 02152  4200- 22000  126800128700 126800128700 184800204000 184800204000 184800204000 184800204000 184800204000 222400238400 222400238400 222400238400  GLEAN_02153  4200-22000  5  Glean numberb  Coord.segment*  Chr  —  128556131058 183859185218 t85988187349 187761188578 189844192096 194439200633 222500222616 222500222616 222931223047  -  -  1182912746 1455416504 1698219485 2t439 24277 248t I 25964 2769629485 3026432039 1698219485 2769629485 9579098444  9145- 10906  7285- 8614  6685- 6955  1182912746 1455416504 1698219485 2143924277  Coord. Gened function’  -3.317 -3.317  ME alpha; hypothetical protein [Cryptococcusgattii].  -3.317  -2.324  -2.324  -2.324  -2.324  -2.324  -3.035  -3.035  -3.035  -3.035  .3.035  -3.035  -3.035  -3.035  -3.035  -3.035  Bt63  Pheromone alpha  Phospholipase Dl (PLDI), putative [Aspergillus fismigatus]. ME alpha; hypothetical protein [Cryptococcusgattii].  CAPI (Cryptococcusgattii].  Hypothetical protein  Sexual development regulator  FAO1 [Cryptococcus neoformans var. grubii].  Glucosidase  Hypothetical protein  Hypothetical protein  5-oxoprolinase  Enolase 1  Hypothetical protein  Hypothetical protein (Coprinopsis cinerea]. DUF1 445 domain protein [Aspergillus fumigates].  5-oxoprolinase  MFS allantoate transporter, putative (Aspergillus firmigatus]. HpcHlHpat aldolase/citrate lyase timily protein [Neosartorya fischeril. 5-oxo-L-prolinase, putative (Aspergillus fumigatus(.  Hypothetical protein  Hypothetical protein  Hypothetical protein (Coprinopsis cinerea].  5.oxoprolinase  HpcH/Hpal aldolase/citrate lyase ffimily protein (Neosartorya fischeril. 5.oxo.L.prolinase, putative (Aspergillus fhmigatus].  Predicted  -3.069  -3.069  -3.069  -2.371  -2.371  -2.371  -2.371  -2.371  125.91  1.104  1.104  1.104  CBS 7779  AVG LR  .2.124  -2.124  -3.135  -2.452  0.696  WM 626  -4.766  .4.766  -4.766  -4.656  -4.656  -4.656  -4.656  -4.656  -4.782  -4.782  -4.782  -4.782  -4.782  -4 782  -4.782  -4.782  -4.782  -4.782  Bt63  -5,517  -5.517  -5 517  -4.865  -4.865  -4.865  -4.865  -4.865  125.91  0014  0.014  0.014  0.014  CBS 7779  Lowest LR for region  -3.576  -3.576  -4.423  -4.320  -1.158  WM 626  0.282  0.282  0.282  1.015  1.015  1.015  1.015  1.015  I. i tO  1.110  1.110  1.110  t.tlO  1.110  1.110  1.110  1.110  1.110  Bt63  -0,060  -0,060  0.693  0.693  0.693  0.693  0.693  0.693  125.91  1594  1.594  1.594  1.594  CBS 7779  HighestLR for region  -0,040  -0.040  -0.445  0.296  1.725  WM 626  Chr  GLEAN_02489  —  GLEAN 01804  —  GLEAN 01806  —  GLEAN 01807  —  IE3W_A  DAAOS9S6  —  XI’ 570359  —  XI’ 001258991  —  AA.Z28943  XI’ 776289  —  GLEAN 02272  —  XI’ 777765  —  XP 566921  —  Xl’ 777765  —  XI’ 566921  —  XI’ 569289  —  XI’ 771818  —  XP 777765  —  XI’ 566921  —  XP 569289  —  XP 771818  —  XI’ 570055  —  XI’ 776063  —  XI’ 570055  —  XP 776063  AAV98454  —  XP 748000  GLEAN 02271  —  GLEAN 02070  —  GLEAN 02252  —  GLEAN 02070  —  GLEAN 02252  —  GLEAN 02071  —  GLEAN 02072  —  GLEAN 02070  —  GLEAN 02252  —  GLEAN 02071  —  GLEAN 02072  —  GLEAN 02228  —  GLEAN 02227  —  GLEAN 02228  —  GLEAN 02227  —  GLEAN 02205  —  GLEAN 02204  —  —  XP 570546  GLEAN 02114  —  EAU87643  —  XP 001265776  AAN75615  XP_001273891  GenBank ID  GLEAN 02115  —  GLEAN 02116  —  GLEAN 02118  GLEAN_02201  222400238400  222400238400 247300288200 247300288200 247300288200 247300288200 247300288200 380400382100 380400382100 380300382300 380300382300 478600488000 478600488000 478600488000 478600488000 478700488500 478700488500 478700488500 478700488500 480500487300 480500487300 589800591500 589800591500 17760001786400 17760001786400 17900001792900 18092001814500  Glean number°  Coord. segmen.  2.OOE-06  8.OOE-98  6.OOE-t65  4.OOE-t53  1.OOE-15  3.OOE-24  0.OOE+00  6.OOE-60  0.OOE+00  6.OOE-60  4.OOE-51  5.OOE-67  0.OOE-fOO  6.OOE-60  4.OOE-51  5.OOE-67  2.OOE-63  5.OOE-88  2.OOE-63  5.OOE-88  6.OOE-164  6.OOE-99  700E-l55  9.OOE-51  2.OOE-143  6.OOE-134  1.OOE-109  E-vahie  -  -  -  -  -  224303 230136 230585232996 245718247860 248166251116 252101255269 256901 262890 263567266323 380101380994 381223382308 380101380994 381223382308 476013478809 479169479992 481074483301 483547 487439 476013478809 479169479992 481074483301 483547487439 481074483301 483547487439 587866588468 588520589247 17755511780923 17822651784468 17907191 791427 1808147 1809297  Coord. Gened  putative 0-acetyl transferase [Cryptococcus neoformans vat. grubii]. Chain A, Rat Brain 3-Hydroxyacyl-CoA Dehydrogenase  Myo-inositol transporter  ATP-bindingcassettetransporter [Neosartoryafischeril.  Hypotheticalprotein  Polyprotein [Phanerochaete chrysosporium].  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  PHD transcription factor (RumI), putative [Aspeegillus flimigatus]. BSPI [Cryptococcus neoformans var. grubiiJ.  Hypotheticalprotein  Dihydrolipoamide dehydrogenase [Neosaotorya fiacheril. Hypothetical protein [Coprinopsis cinerea].  STE2O  Class V myosin (Myo4), putative [Aspergillus clavatusj  Predicted fuuctjon  -2.585  1.025  1.025  1.591  1.591  -2.058  -2.058  -2.167  -2.167  -2.167  -2.167  -2.167  -3.317  -3.317  Bt63  -2.045  -2.045  -1.965  -1.965  -1.880  -1.880  -1.880  -1.880  -1.880  -3.069  -3.069  125.91  0.435  0.435  0.435  0.435  -1.669  -1.669  CBS 7779  AVG LR  -1.541  -1.349  -1.349  -1.349  -1.349  WM 626  -4.050  -0 553  -0.553  0.441  0.441  -3.563  -3 563  -4.607  -4.607  -4.607  -4.607  -4.607  -4.766  -4.766  Bt63  -3.707  -3.707  -4.368  -4.368  -4.973  -4.973  -4.973  -4.973  -4.973  -5.517  -5.517  125.91  0.023  0.023  0.023  0.023  -4.465  -4.465  CBS 7779  Lowest LR for region  -2.701  -3.573  -3.573  -3.573  -3.573  WM 626  0.274  1.952  1.952  3.284  3.284  -0.409  -0.409  1.011  1.011  1.011  1.011  1.011  0.282  0.282  11063  0.092  0.092  0.092  1.447  1.447  1.447  1.447  1 447  1.447  -0.06  -0.06  125.91  1.072  1.072  1.072  1.072  0.027  0.027  CBS 7779  Highest LR for region  0.12  1.139  1.139  1.139  1.139  WM 626  6  —  Chr  446700453700 446700453700 446700453700 446700453700 727800733800  212900224600  10604001062800 11748001179200 11748001179200 11748001179200 13130001315100 13220001326100 13220001326100 13220001326100 109300112200 201200204000 201200204000 212900224600 212900224600 212900224600  10491001051600  499200501200 730000733000 988000991200  GLEAN_05833  -  GLEAN 05894  —  GLEAN 05895  —  GLEAN 06061  —  GLEAN 05896  —  GLEAN 06016  —  GLEAN 05932  —  GLEAN 06015  —  GLEAN 06014  -  GLEAN 060)1  —  GLEAN 060)0  —  GLEAN 05950  —  GLEAN 05716  —  G1.EAN 06221  —  GLEAN 06220  —  GLEAN 06217  —  GLEAN 05746  —  GLEAN 05747  —  GLEAN 06199  —  GLEAN 05771  —  GLEAN 05773  —  GLEAN 05782  AAZ28942  ABA98804  —  NP 566921  —  NP 569289  —  NP 001264569  —  Xl’ 748637  —  NP 570814  —  NP 775360  E0K25849  -  NP 775357  —  NP 570806  —  NP 568595  —  NP 001269413  —  XP 775208  —  XP 775207  —  XP 524999  CAE76225  —  XP 571089  —  XP 001274925  —  XP 753874  —  NP 508554  —  Xl’ 570931  AAZ28942  GLEAN 05833  —  NOGENE  XP_5fl787  XP_776539  GenBank ID  NOGENE  GLEAN_05969  GLEAN_02490  18092001814500  2100-3800  Glean number  Coord. segment  lOGE-OS  4.OOE-36  9.OOE-l6  2.OOE-09  1.OOE-24  7.OOE-80  0.OOE+00  0.OOE+00  2.OOE-07  0.OOE+00  2.OOE-126  3.OOE-08  4.OOE-38  5.OOE-124  9.OOE-145  3.90E+00  9.OOE-05  4.OOE-149  3.OOE-07  1.30E+00  3.IOE+00  4.OOE-06  l.OOE-08  200E-156  2.OOE-31  E-value —  -  -  442072446783 447800448867 450454451207 452045 452669 730825 731331  222190223649  -  -  1061163 1062348 11742001174846 11753321176294 11773081183318 13143491314725 13206891322100 13225421324133 13241931325679 110446111423 19993420)582 203319205522 211750 213126 213646217692 218037220112  10498031050555  -  730825 731331 987694990861  3409-5246  18111191813224  Coord. Gened  Retrotransposon protein, putative, Tyl copia subclass [Oryza sativa] Polyprotein [Phanerochaete chrysosporium.  Hypothetical protein  Hypothetical protein  NA]) binding Rossmann fold oxidoreductase, putative [Aspergillus fumigatus]. SH3domainprotein,putative [Neosartorya fischeril.  Flavin-containing monooxygenase  Hypothetical protein  3-carboxymuconate cyclase [Vibrionales bacteriuml.  Hypothetical protein  Vacuole protein  Hypothetical protein  Dimericdihydrodioldehydrogeaase, putative(Aspergillusclavatus}.  Hypothetical protein  Hypotbetical protein  Related to putative CytOplasmic structural protein[Neurosporaczassal. prostaglandin.endoperoxide synthase 2 [Pantroglodytesl.  Phosphatidylinositoltransporter  Prion-like-(Q/N-rich)-domain-bearing protein family member (pqn-37) ICaenorhabditis eleganal. Inositol 5-phosphatase, putative [Aspergillus fumigatusi. MGMF family protein [Aspergillus clavatus].  Exonucleasell  Polyprotein LPhanerochaete chryosporium1.  Fungalspecifictranscriptionfactor  Hypothetical protein  Predicted function  -1.049  -1.049  -1.049  -2.301  -0.782  -0.782  -0.782  -0.979  -0.979  -0.855  -1.534  -2.189  Bt63  0.566  125.91  CBS 7779  AVG LR  -2.450  -2.345  -2.345  -2.345  -2.345  -0.891  -0.891  -0.891  -0 891  -0.996  -0.996  -1.965  -1.541  WM 626  -2.681  -2.681  -2.681  -4.317  -2599  -2.599  -2.599  -2.474  -2.474  -2.568  -3854  -4.017  Bt63  0.074  125.91  -4.257  -4.752  4.752  4.752  -4.752  -3.347  -3.347  -3.347  -3 347  -2878  -2.878  -4.119  -2.701  WM 626  ——  CBS 7779  Lowest LR for region  1.215  1.215  1.215  0.109  1 233  1.233  1.233  0.867  0.867  1.497  0.779  0.356  Bt63  1.476  125.91  CBS 7779  Highest LR for region  1.308  0.160  0.160  0.160  0.160  1.567  1.567  1.567  1.567  0300  0.300  0.376  0.12  —  WM 626  7  —  6  Cbr  00  142700144900 383600395900 383600395900 383600395900 383600395900 383000395900 383600395900 383600395900 383600395900 384000395400 384000395400 384000395400 384000395400 384000395400 384000395400 384000395400 425600426800 586000586800 673600676000  6600- 10600  727800733800 727800733800 10452001048100 10452001048100 14153001420100 14153001420100  Coord. , segmen.  —  GLEAN_00148  —  GLEAN 00166  —  GLEAN 00192  —  GLEAN 00333  —  GLEAN 00332  —  GLEAN 00198  YP_08l854  BAD23582  —  XP 571429  —  XP 571657  —  VP 833124  —  XP 001260343  —  XI’ 001217242  GLEAN 00331  —  ABF72274  —  XI’ 777454  —  XI’ 571655  —  XI’ 571632  —  3.20E+00  7.OOE-44  2.OOE-17l  5.OOE-78  2.OOE-10  l.OOE-55  8.OOE-86  3.20E+00  3.OOE-31  2.OOE-1l7  5.OOE.175  5.OOE-78  XI’ 571657  —  2.00E-lO  t.OOE-55  4.OOE-57  VP 833t24  —  XP 001260343  GLEAN 00199  —  GLEAN 00200  —  GLEAN 00330  —  GLEAN 00197  —  GLEAN 00333  —  GLEAN 00332  —  GLEAN 00198  —  —  ZP 01509465  —  GLEAN 00331  —  ABF72274  —  GLEAN 00199 3,20E+00  7.OOE-18  XP 001258574  GLEAN 00200  —  XP 571655  —  2.OOE-117  NO GENE  2.OOE-06  GLEAN 00330  XP_001268434  7.OOE-75  5.OOE-76  2.OOE-42  0.OOE+00  5.OOE-64  3.70E+00  E-value  NO GENE  GLEAN_00262  —  —  XI’ 775062  GLEAN 06239  —  CAL55333  -  XP 777918  -  XI’ 570964  GLEAN 05698  -  GLEAN 05774  -  GLEAN 05775  —  XI’ 001274192  GLEAN 06118  —  NP_350221  GenBankID’  GLEAN_05832  Glean numbera  -  -  -  -  -  -  -  382103384126 384584385725 386801387565 388229389873 390974 392935 393793 394439 394832395588 395779397255 382103384126 384584385725 386801 387565 388229 389873 390974392935 393793 394439 394832395588 425706427378 586777588429 672933 673705  7512- 10013  731542732501 733227735245 1041966 1046131 10464651048420 14161431418177 14207951421725  Coon).— Gene’  1  Chaperonin GroEL [Bacillus cereus].  Putative nicotinnamine aminotransfernse A [Oryza sativa]  Hypothetical protein  Hypothetical protein  81EV-I U136-like protein [Gallid herpesvirus 2]. Conserved hypothetical protein [Aspergillusterreua]. MFS allantoate transporter, putative [Neotartorya fischeri). Hypothetical protein [Arthrobacter op. FB24].  Hypothetical protein  Rtfl protein  OPt-anchor Iransamidase  Hypothetical protein  Haloalkanoic acid dehalogenase, putative [Neosartorya ftscheril. HSV-1 UL36-like protein [Gallid herpesvirus 2]. Amidohydrolase [Burkholderia phytofirmans]. MI’S allantoate transporter, putative [Neotartorya fischeri]. Hypothetical protein [Arthrobacter SI) FB241.  Rtfl protein  Ferric-chelate reductase, putative [Aspergillus clavatus).  Hypothetical protein  Myc-regulated DEAD/H box 18 RNA helicase-like (ISS) [Ostreococcus taurij.  Hypothetical protein  Oligopeptide ABC transporter, permease component (Clostridium acetobutylicum] Homoserine 0-acetyltransferase [Aspergillus clavatusi. Actin cytoskeleton ocganization and biogeneass-related protein  Predicted function  -0.920  -3.140  -3.140  -3.140  3 140  -3.140  -3.140  -3.140  Bt63  0.471  -0.716  12591  -2.961  -2.045  -2.450  2450  626  WM Bt63 125.91  -2 778  -2 778  -2 778  -2 778  -2.778  -2 778  -2.778  -2.778  -2.409  -2.724  -1.511  -4.826  -4.826  -4.826  -4826  -4 826  -4826  -4.826  -0.354  -2.739  -4.886  -4.886  CBS 7779  Lowest LR for region  -4.343  -4343  -4257  -4 257  WM 626  -4.832  .4.832  -4 832  -4.832  -4.832  -4 832  -4.832  -4.832  -4.728  -4.379  — — — — ——  -2.961  CBS 7779  AVG LR  0.043  0.907  0.907  0.907  0907  0907  0.907  0.907  B863  0.329  0.166  0.166  CBS 7779  0.108  1.308  1 308  WM 626  —  0 326  0.326  0 326  0.326  —  0.326  0 326  0.326  0.326  0.180  0.093  — — —  125.91  HighestLR for region  8  —  Chr  XP 772401  GLEAN_06517  GLEAN_06516  GLEAN_06515  0- 14000  0- 14000  0- 14000  —  GLEAN 00513  —  GLEAN 00004  —  GLEAN 00491  —  GLEAN 00490  —  GLEAN 00023  —  GLEAN 00024  —  GLEAN 00489  —  GLEAN 00025  —  GLEAN 00026  —  XP_746529  XP_776539  XP_776387  —  XP 383545  BAD31398  —  XI’ 568378  —  XP 001260553  —  XI’ 571067  —  XP 774752  —  XP 772260  —  XP 568378  —  XI’ 715482  —  ABA94155  GLEAN 00040  —  GLEAN 00477  —  XP 772401  GLEAN 00040  —  NO GENE  —  YP 001108517  —  XP 774711  —  XI’ 571251  —  NP 001040379  —  XI’ 571276  —  XI’ 571557  —  XI’ 571582  —  XP 571285  EAU91579  P19711  GenBank w  NO GENE  —  GLEAN 00051  —  GLEAN 00052  —  GLEAN 00467  —  GLEAN 00447  —  GLEAN 00446  —  GLEAN 00444  —  GLEAN 00081  —  GLEAN 00443  —  GLEAN 00441  GLEAN_00399  724700725200  982800983600 10025001012100 10025001012100 10025001012100 10189001020800 10189001020800 11007001102000 11280001131000 11280001131000 11666001167900 11880001196000 11880001196000 11891001192900 12622001280000 12622001280000 12622001280000 12622001280000 12622001280000 12622001280000 12622001280000 13676001369800 13968001399489  Glean numberb  Coord. segment  4.OOE-43  1.OOE-28  8.OOE-59  2.OOE-l46  3.20E+00  3.OOE-l29  4,00E-24  3.OOE-04  1.OOE-37  3.OOE-l4  2.OOE-122  1.OOE-176  3.OOE-138  2.40E+00  3.OOE-138  2.OOE-15  3.OOE-91  5,00E-166  3 OOE-20  0.OOE+00  0,00E+00  5.OOE-40  3,00E-l51  9,00E-121  6.40E-01  E-value  —  -  1004612151 1376914323  4033 -6312  -  11894651193489 11942621195759 11894651193489 1256635 1261872 12625341263576 12652101265557 12669281267252 12687891268917 12733601275465 12763251277391 13677661368428 13951351396994  979312983768 10051351006425 10066731007113 10088501011921 10169981019119 10203001022266 11055731108232 11271891129177 1129581 1130772  724939729221  Coord. Gene  -1,282 -1,212  -1.282  -2.408  L-PSP endoribonuclease family protein, putative [Aspergillus fümigatus].  zeael.  -1.613  -1.613  Bt63  Hypothetical protein  Hypothetical protein  Hypothetical protein [Gibberella  Hypothetical protein [Oryza saliva]  Hypbthetical protein  C2H2 transcription factor (Con7), putative [Neosartorya fischerij.  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  RNA polymerase ifi large subunit ICandidaalbicansl.  Hypothetical protein  Expressed protein [Oryza tativa]  Hypothetical protein  Phosphoglycerate mutate family protein ISaccharopolysporaesythraea].  Hypothetical protein  Glycosyltransferase  mRNAcap-bindingproteinelF4E [Bombyxmori].  CytochromeP45o  GTPase activating protein]  Hypothetical protein  Alpha.16-mannosyltransferase  Hypothetical protern ICoprrnopais cinerea]  Polyproteinproteas&helicase  Predicted function  -0.612  -0.612  -0.612  -0.612  -0.612  -0.612  -0.612  -1.866  -1.866  0 471  0.944  125.91  —  CBS 7779  AVG LR  -1.702  0.868  -1.148  -0 687  -0,687  -1.193  1 044  -1.044  -1.918  -1.918  -1.918  WM 626  -4.162  -4.162  -4.162  -1.985  -4,192  -4.192  Bt63  -2.656  -2.656  -2.656  -2.656  -2.656  -2.656  -2.656  -5.280  -5.280  0 354  0.277  125.91  -3.171  -0.156  -2.874  -I 597  -1.597  -2.231  -2340  -2.340  -3.467  -3467  -3.467  WM 626  — —  CBS 7779  Lowest LR for region  1,267  1.267  1.267  1.701  0,772  0,772  Bt63  1.513  1.513  1.513  1.513  1.513  1.513  0.213  0,213  0,213  1 919  0.939  125.91  0,064  1.852  0.212  0 126  0.126  0.371  0401  0.401  0.417  0.417  0.417  WM 626  — —  CBS 7779  Highest LR for region  8  Oir  XP_569475  XP_777695  XP_777695  XP_773071  XP_773071  GLEAN_06519  GLEAN_06514  GLEAN_06520  GLEAN_06521  GLEAN_06513  GLEAN_06512  GLEAN 06511  GLEAN_06518  GLEAN_06519  GLEAN_06514  GLEAN_06520  GLEAN_06521  GLEAN_06513  GLEAN_06512  GLEAN_0651 1  GLEAN_06522  GLEAN_06522  GLEAN_06510  GLEAN_06510  4000- 33700  4000- 33700  4000- 33700  4000-33700  4000-33700  4000-33700  4000-33700  14000- 36000  14000- 36000  14600- 36000  14000- 36000  14000- 36000  14000-36000  14000-36000  14000-36000  14000- 36000  33700- 37400  33700- 37400  36000-37800  AAG50698  BAD34493  —  GLEAN_06600  ABA98785  —  Xl’ 568316  XP_571050  XP_57l050  XP_681373  XP572141  ZP_01531626  ZP_00767178  XP_751072  XP_001262470  CAM37292  XP_572141  XP_751072  XP_001262470  CAM37292  XP_746529  GLEAN 06599  —  GLEAN 06598  —  GLEAN 06597  ZP_01531626  GLEAN_06518  4000- 33700  453100458500 453100458500 453100458500 453100458500  ZP_00767t78  GLEAN_06515  4000- 33700  XP_776539  GLEAN_06516  4000- 33700  XP_776387  GenBank ID’  GLEAN_06517  Glean numberb  4000- 33700  segment’  Coord.-  l.OOE-32  l.OOE-40  9.OOE-29  5.OOE-36  6.OOE-47  6.OOE-47  4.OOE-173  4.OOE-173  2.OOE-56  2.OOE-07  1.OOE-28  9.OOE-56  l.00E-16  2.OOE-37  1.OOE-1 I  3.IOE+00  2.OOE-56  2.OOE-06  l.OOE-28  9.OOE-56  l.OOE-16  2.OOE-37  1.OOE-11  3.1OE-f00  4.OOE-43  l.OOE-28  8.OOE-59  B-value  -  6312  -  -  -  1004612151 1376914323 1532015848 1636018636 19161 21270 2143621865 2201623958 2451926490 2805229426 3022732238 1532015848 1636018636 19161 21270 2143621865 2201623958 2451926490 2805229426 3022732238 3418935782 3418935782 3746438143 3746438143 453515454111 454935456752 456852457928 458200458805  4033  Coord. Gene’  Gag-Pol[lpomoeabatatas].  Copin-type polyprotein [Arabidopsis thaliana].  Retrotransposonprotein[Oryzasativa].  Hypothetical protein  Hypotheticalprotein  Hypothetical protein  Hypothetical protein  Hypothetical protein  -1.489  -3.562  -3.562  -3 562  Hypothetical protein AN8104.2 [Aspergillus nidulans]. Hypothetical protein  -3.562  -3.562  -3.562  -3.562  -3.562  3 562  Bt63  EffluxproteinEncT  Hypothetical protein, conserved ILeishmania braziliensis]. Fungal specific transcription Ector, putative [Neosartorya fischeri]. MFS aipha-glucoside transporter, putative [Aspergillus fismigatus]. Glycoside hydrolase [Chioroflexus aurantiacus]. Glycoside hydrolase (Roseiflexus castenholzii].  Hypothetical protein  Integral membrane protein  Efflux protein EncT  L-PSP endoribonuclease Emily protein, putative [Aspergillus fismigatus]. Hypothetical protein, conserved [Leishmaniabraziliensisj. Fungal specific transcription Ector, putative INeosartorya fiocheri]. MFS alpha-glucoside transporter, putative [Aspergillus Emigatus]. Glycoside hydrolase [Chloroflexus aurantiacus]. Glycoside hydrolase [Roseiflexus castenholziil.  Hypothetical protein  Hypothetical protein  Predicted function’ 125.91  CBS 7779  AVGLR  -1.301  -l 301  -1.301  -1.301  0.945  0.945  -2.840  -2.840  -2.840  -2.840  -2.840  -2.840  -2 840  -2 840  -2.840  -2.840  -2.840  WM 626  -2.315  -4.852  -4.852  -4.852  -4.852  -4.852  -4.852  -4.852  -4 852  -4 852  Bt63  125.91  CBS 7779  LoweslLR for region  -2.987  -2.987  -2.987  -2.987  -0.982  -0.982  -4.660  -4.660  -4.660  -4.660  -4.660  -4.660  -4 660  -4.660  -4.660  -4.660  -4.660  WM 626  -0.324  -0.243  -0.243  -0.243  -0.243  -0.243  -0.243  -0.243  -0 243  -0 243  Bt63 125.91  CBS 7779  Highest LR for region  0.263  0 263  0.263  0.263  2.333  2.333  0.346  0.346  0.346  0.346  0.346  0.346  0.346  0 346  0.346  0.346  0.346  WM 626  9  —  Chr  XI’ 761106  GLEAN 06637  4.OOE-l67 I .70E+00  XP_747218  ZP_01000094  XP_567067  NO GENE  YP_42l819  XP_573019  EAU86881  GLEAN_03976  GLEAN_03980  GLEAN_03975  NO GENE  GLEAN_03984  GLEAN_03962  GLEAN_0399l  GLEAN_04033  11000- 17700  11000- 17700  11000- 17700  32200-34700  32200 34700  74009- 76000  74009- 76000  299800292600  -a  7.OOE-26  XP_0012l0248  GLEAN 03977  5000-7400  -  6.OOE-30  XP_772644  GLEAN_03978  1300-4400  EAU9IO35 1.OOE-1l3  3.30E-02  3.OOE-87  9.OOE-24  l.OOE-l20  6.OOE-30  XP_001210248  GLEAN_03977  1.OOE-120  XP772644  1300- 8000  9.OOE-136  9.OOE-l36  9.OOE-l36  3.OOE-61  2.OOE-134  3.OOE-l23  GLEAN 03978  —  XP 772401  GLEAN 06712  —  NO GENE  NO GENE  —  Xl’ 772401  GLEAN 06712  —  NO GENE  NO GENE  —  XP 772401  —  GLEAN 06712  —  NO GENE  NO GENE  —  GLEAN 06305  XP 572141  AA092638  GLEAN 06710  —  NO GENE  NO GENE  —  —  NOGENE  NOGENE  —  AAG50698  GLEAN 06599 l.OOE-40  9.OOE-29  ABA98785  —  5.OOE-36  5.OOE-36  E-value  XP 568316  XP_568316  GenBank ID’  1300-8000  -  —  GLEAN 06598  —  GLEAN 06597  GLEAN_06597  453600458400  454000457700 454000457700 454000 457700 521600522400 654200655200 717500718600 10444001045600 10497001051700 10598001066300 10598001066300 10605001066300 10605001066300 10598001066300 10598001066300  Glenn number 5  Coord.segmcnt -  -  -  -  -  -  33861 35408 73847 74740 75333 77198 292512294915  17638 17871  14230 16090  1154913695  5739- 7035  1159- 4637  5739- 7035  1159-4637  10619161065914  10619161065914  10619161065914  10450121046596 10494451051172  651656654505  453515454111 453515454111 454935456752 456852457928  Gene’  Coord.  Hypothetical protein (Coprinopsis cinerea].  Predicted protein [Coprinopsis cinerea].  Hypothetical protein  Aldo/keto reductase (Magnetospirillum mugneticum].  Hypothetical protein  Conserved hypothetical protein [Aspergillus terreus]. DUF895 domain membrane protein EAspergillus fitmigatus]. Mucin-desulfating sulfatase (N acety1glUcoso.fl5inn-6sulthtase) [Ocranicola batsensis].  -1.536  -1.678  Conserved hypothetical protein lAspergillus terreus]. Hypothetical protein  -1.678  -2.218  -2.218  -1.122  -1.287  -1.819  -0.737  0.889  0.889  0.889  Bt63  Hypotheticalprotein  Hypothetical protein  Hypothetical protein  Hypothetical protein  EffluxproteinEncT  Putative transposase  Hypothetical protein [Ustilago maydis].  Retrotransposonprotem,Tyl-copia subclass [Oryza sativa] Copia-type polyprotein [Arabidopsis thalianal  Hypotheticalprotein  Hypothetical protein  Predicted function’  0.385  0.385  1 386  -2.495  -2.495  0.755  0.755  0.755  125.91  -0.970  -0.970  -1.399  CBS 7779  AVG LR  1 232  1.232  -2.825  -2.825  -2 825  -2.576  -2.814  WM 626  -3.050  -4.234  -4.234  -4.349  -4.349  -2.444  -2.397  -3.227  -2.322  -0.697  -0.697  -0.697  Bt63  -0.473  -0.473  -0.710  -5.417  -5.417  -1.178  -1.178  -1.178  125.91  -4.721  WM 626  -0 158  -0.158  -4.456  -4.456  -4 456  -4.139  — —  -2.090  -2.090  -2.987  CBS 7779  Lowest LR for region  0.929  0.523  0.523  0.665  0.665  0.588  -0.132  0.428  0.897  2.459  2.459  2.459  Bt63  1.146  1.146  2.187  0.416  0.416  2.108  2.108  2.108  125.91  0.075  0.075  0.263  CBS 7779  Highest LR for region  3 205  3.205  -0.057  -0.057  -0 057  -0013  —  0.463  WM 626  10  —  Cbr  -  XI’ 567457  GLEAN 06825  10317001048700 10317001048700 10317001048700 10317001048700 10535001059200 10535001059200  GLEAN 06784  10317001048700  GLEAN_07179  —  GLEAN 07178  -  GLEAN 07176  —  GLEAN 06783  —  GLEAN 07174  —  GLEAN 07172  —  NOGENE  NO GENE  —  —  Xt’_772644  —  XP 572474  -  YP 001135576  —  XI’ 572773  —  XI’ 572946  —  XP 772566  —  YP 705633  NOGENE  NO GENE  —  P10978  —  961700963200  -  XP_570319  P10978  GLEAN_06960  83100- 84000  NO GENE  XP_569289  XP_00l260919  —  GLEAN 07088  NO GENE  24800- 26300  4.OOE-49  2.OOE-58  3.OOE-03  3.OOE-05  7.OOE-72  3.OOE-09  4.OOE-66  4.OOE-81  2.005-154  3.OOE-86  3.OOE-86  5.OOE-130  1.005-72  5.OOE-97  4.IOE-02  —  XI’ 775062  2.OOE-42  2.OOE-09  2.005-120  3.30E-01  2.OOE-09  5.OOE-138  1.OOE-34  E-va)ue  XP 571065  —  Xi’ 775062  —  Xl’ 001257273  GLEAN 07088  GLEAN 06972  18800- 20200  581700 587000 581600587000 806800808000 823800-  GLEAN_06977  1700-4000  —  GLEAN 04213  —  GLEAN 04212  —  GLEAN 04211  —  GLEAN 04210  —  XP 772644  GLEAN 04209  —  NOGENE  —  XI’ 964702  —  Xi’ 964702  —  XP 774001  XP_572808  GenBank flY  NOGENE  —  GLEAN 03768  —  GLEAN 03769  —  GLEAN 03774  GLEAN_04123  718000718800  10384001042100 10636001066100 10636001066100 10817001082800 11702001186500 1170200 1186500 11702001186500 11702001186500 11702001186500  Glen. niimi,erb  Coord.segment -  -  10343301037705 10392031039490 10415341043168 1046465 1047590 10530171053523 10545041057596  10297971032095  -  8231084327 582143 586513 582143 586513 808170810351  Hypothetical protein  Hypothetical protein  Short-chain dehydrogenase/reductase SDR[Mycobacteriumgilvum].  Endoplasmic reticulum receptor  Polyadenylation Ihctor 64 kDa subunit  Hypothetical protein  Probable dimethylaniline monooxygenase (N-oxide-forming) [Rhodococcus op. RJIAI].  Hypothetical protein  Retrovirus-related Pol polyprotein from transposon TNT 1-94 Retrovirus-related Pol polyprotein from transposonTNT 1.94  MFS transporter  Hypothetical protein  -  MFS monosaccharide transporter, putative fNeosartoiya fischeri  1908-3411  Hypothetical protein  Hypothetical protein  Hypotheticalprotein  DEAD/DEAlS box helicase, putative [Neosartorya fischeri].  Hypotheticalprotein  Hypothetical protein [Neurospora crassa].  Hypotheticalprotein[Neurosporaceaaaaj.  Hypothetical protein  Trafficking-related protein  Predicted function  1934420375  11730121174844 11755861180935 11823511183092 11840991184272 11845121184954  718424719134 10403891043142 10634081064053 10641051065009  Coord. Gene’  -1.959  -1.958  -2.591  -2.192  -3.267  -3.267  -0.765  Bt63  -0.754  -0.754  -2.201  -2.517  -1.607  125.91  -3 151  -3.151  -3.151  -3.151  -3.151  -3.198  0.531  CBS 7779  AVG LR  -0.691  -2.921  -2.607  -2.607  -2.607  -2.607  -2.607  WM 626  -3.968  -3.366  -3.788  -3.290  -4.397  -4.397  -2.222  Bt63  -2.149  2.149  -3.714  4.695  -3.028  125.91  -4 988  -4.988  4.918  -4.988  -4.988  -4.967  0.030  -1.266  -4.509  -4.127  -4.127  -4.127  -4.127  -4.127  WM 626  ——  CBS 7779  Lowest LR for region  0.221  0.686  0.056  -0.386  -1.626  -1.626  1.052  Bt63  1.178  1.178  -0.244  0717  0. 115  125.91  -0 026  -0.026  -0.026  -0.026  -0.026  -0.110  1.403  CBS 7779  Highest LR for region  -0.237  -0.212  -0.481  —  -0.481  -0.481  -0.481  -0.481  WM 626  11  —  10  Ckr  GLEAN_01509  GLEAN_01508  GLEAN_01 507  GLEAN_01509  GLEAN_01523  3000- 13900  3000- 13900  3000- 13900  3000- 13900  8400- t0000  94700-96600  -  —  —  GLEAN_01240  —  GLEAN 01771  —  GLEAN 01243  —  GLEAN 01244  —  GLEAN 01771  —  GLEAN 01243  —  GLEAN 01244  XP_001344503  —  XI’ 771821  —  XP 771822  —  Xl’ 771822  —  Xl’ 771821  —  XP 771122  —  XP 771822  —  XI’ 771821  GLEAN 01771  —  NOGENE  —  2(9 772756  —  XP 567697  2.90E-01  2.OOE-129  2.OOE-27  4.OOE-21  2.OOE-l29  2.OOE-27  4.OOE-2l  2.OOE-129  l.OOE-45  0.OOE+00  2.OOE-93 7.OOE-166  —  XI’ 569644  2.OOE-69  9.OOE-74  7.OOE-03  9.00E-84  9.OOE-lol  2.OOE-04  5.OOE-24  2.OOE-37  2.OOE-04  2.OOE-42  1.OOE-55  2.OOE-04  2.OOE-42  I.OOE-55  1.OOE-147  E-val.e  XI’ 569994  —  2(9 572149  NOGENE  —  GLEAN 01284  —  GLEAN 01285  —  GLEAN 01706  —  GLEAN 01309  —  GLEAN 01690  —  3(9 568729  GLEAN 01689  —  AA.Z28935  —  XP 569551  ABE73177  3(9776387  XP_74809l  XP_00l261 163  XP_776387  XP_775062  GLEAN 01677  GLEAN 01353  GLEAN_01510  3000- 13900  804000 805900 926800931800 966600968600 966600968600 10408001042400 10408001042400 11693001172500 11693001172500 12817001282500 13866001390000 13866001390000 13866001390000 13878001392200 13878001392200 13878001392200 13879001394200 14052001411700  GLEAN_OlSil  3000- 9900  XP_772644  XP_775062  XP_776387  GLEAN_01 510  GLEAN_01509  3000- 9900  XP772644  GLEAN_0151 I  3000- 9900  GenBaik W  XP_567269  Gle. nu.iber’  GLEAN_07167  10551001059200  seg.Ient  Coord.-  Sodium bile acid transporter emily protein, putative [Neosartorya fischeri]. GARP complex component (Vps54), putative lAspergillus fumigatus].  11099 13034 13611 17959  13871781388221 13884881388664 13890401389583 13871781388221 13884881388664 13890401389583 13871781388221 14048591405737 Hypothetical protein [Danio curio].  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypotheticalprotein  Protein-lysineN-methyltransferase  Long-chain acyl-CoA synthetate  Receptor, putative  Hypothetical protein  Putative 0-acetyl transferase [Cryptococcus neoformans vat. grubii]. Import inner membrane translocase subunit tim22 Polyprotein [Phanerochaete chrysosporium]. Retrotranuposable element slacu 132 kda protein  9520995983 803478804198 926825 927363 966140966876 967322967825 10382601041361 10423671044262 11674261169655 11712471171820 -  Hypotheticalprotein  8577. 9286  -  -  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  rRNA(adenine-N6,N6-)dimethyltransferase  Predicted fnac(io  8577- 9286  6729- 7470  3630- 5205  8577- 9286  6729- 7470  3630- 5205  10048921006231  COord. Gc.e’  -2.858  -2.6t5  -2.615  -2.615  -2.739  -1.076  -1.076  -1.233  -1.233  -1.690  -1.191  —  Bt63  -1.956  -1.956  -1.956  1.538  115.91  -3.086  -3.086  -3.086  CBS 7779  AVG LR  -2.987  -2.221  -2.221  -1.080  -1.995  -2.835  -2.835  -2.835  -2.835  -2.835  WM 626  -4.834  -3.395  -3.395  -3.395  -4.487  -2.515  -2.515  -3.374  -3.374  -3.632  -3.982  Bt63  -2.801  -2.801  -2.801  0.113  125.91  WM 626  —  —  .4.661  -4.668  -4.668  -3.916  -4.159  -4.159  -2.993  -4.198  -4.696  -4.696  -4.696  -4.696  -4.696  — —  CBS 7779  Lowest LR for regioM  1.003  -0.619  -0.619  -0.619  -1.290  0.659  0.659  0.135  0.135  0.724  1.347  Bt63  -0.814  -0.814  -0.814  2.359  125.91  -0.136  -0.136  -0.136  CBS 7779  Highest LR for regiou  -0.509  0.253  0.253  1.315  1.645  0.614  0.614  0614  0.614  0.614  —  WM 626  12  —  Chr  GLEAN_03602  GLEAN_03601  GLEAN_03602  GLEAN_03601  2900- 12500  2900- 12500  7300- 12600  12600  XP_568372  GLEAN_03572  —  GLEAN 03573  —  4.OOE-32  ABE82053  —  0.OOE+00  4OOE-85  0.OOE+00  4.30E+00  7.OOE-64  7.OOE-64  l.OOE-83  8.OOE-36  8.OOE-36  2.OOE-122  8.OOE-36  2.OOE-l22  8.OOE-36  2.OOE-122  2.OOE-32  2.OOE-09  2.OOE-l20  9.OOE-l5  1.OOE-62  5.OOE-66  8.OOE-132  3.OOE-18  2.OOE-24  2.90E-01  2.OOE-24  E-valne  XI’ 567971  —  Xl’ 567971  37000-40900  NP_92327l  GLEAN 03574  GLEAN_03608  15600- 20000  XP_567t48  NO GENE  GLEAN_03604  15600- 20000  Xl’ 567148  XP_7718l8  XP776074  XP_776074  XP_773252  XP_776074  Xl’_773252  Xl’_776074  Xl’ 773252  XP_772644  —  XP 001257273  —  Xl’ 772644  —  Xl’ 771818  —  Xl’ 776387  —  Xl’ 753711  —  XP 568995  —  Xl’ 567753  —  Xl’ 759004  NO GENE  GLEAN_03599  12800- 16300  102600103800 160000165600 160000165600 160000165600  GLEAN_03600  GLEAN_03599  12800-16300  GLEAN 03601  12800- 16300  -  GLEAN03601  0- t2800  7300  GLEAN_03603  GLEAN_03602  0- 12800  —  GLEAN 01801  —  GLEAN 01800  —  GLEAN 01798  —  GLEAN 01797  —  GLEAN 01796  —  GLEAN 01795  —  GLEAN 01219  —  GLEAN 01239  —  XP 001344503  GLEAN 01240  —  XP759004  GeaBank H)’  GLEAN 01239  Glea. numberb  0- 12800  14052001411700 14056001411400 14056001411400 15312001562000 15312001562000 15312001562000 15312001562000 15312001562000 15312001562000 15312001562000  Coord.segment -  -  8494  159542160129 160470161894 163221165320  -  12447(3498 12447 13498 1391715485 1553216tH 1553216111 1714519082 3831841392  -  Integrase [Medicago truncatulaj.  Retrotransposonnucleocapsidprotein  Retrotransposon nucleocapsid protein  -1.032  -1.032  1.290  -2.974  0933  Aminoacidtransporter  Crplhniilytranscriptionalregulatosy protein [Gloeobacterviolaceus]  125.91  -0.933  -1.032  -0.815  -0.815  -0.815  —  -2.858  Bt63  Hypothetical protein  Hypotheticalprotein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  1244713498 7475  Hypothetical protein  Hypothetical prottin  1244713498 7475- 8494  Hypothetical protein  Hypothetical protein  DEAD/DEAN box helicase. putative [Neosaitorya fischeril.  Hypothetical protein  Hypothetical prottin  Hypothetical protein  DUF1479 domain protein [ASpergillus fismigatus].  Xenobiotic.tranoporting ATPase  Hypothetical protein  Hypothetical protein [Ustilago maydioj.  Hypothetical protein [Danio rerio].  Hypothetical protein lUstilago maydio].  Predicted fwnctioei  7475- 8494  962- 2141  1407095 1410234 14048591405737 14070951410234 153(3281531639 15328121535621 15391201541018 15417831546004 15490791549589 15534821555314 15560561561225  Coord. Gene’  0.618  0.618  0.618  -0.563  -0.563  CBS 7779  AVG LR  -3.164  -1.850  -1.850  -2.408  -2.408  -2.408  -2.408  -2 408  -2.408  -2.408  -3.225  -3.225  WM 626  -2.349  -2349  -2.349  -2.207  -2.207  -2.207  -4.834  11(63  0.536  -5.037  -2008  -2.008  125.91  0.175  0,175  0.175  -1,108  -(.108  —  -4.568  -3.817  -3.817  -4.792  -4.792  -4.792  -4.792  -4 792  -4.792  -4.792  -4.700  -4.700  WM 626  — —  CBS 7779  Lowest LR for region  1.079  1.079  1.079  0.978  0,978  0,978  1.003  Bt63  0.375  1.824  1.824  1.824  125.91  1.532  1.532  1.532  0.099  0.099  CBS 7779  Highest LR for region  -0.212  1.791  1.791  1.522  —  1.522  1.522  1.522  1 522  1.522  1.522  0.049  0.049  WM 626  ‘  Chr  160000168300 160000168300 160000168300 160000168300 160000168300 188600189800 196400197800 196400197800 254600256400 254700257300 258700260400 362200365700 403700405100 536700537500 544200546900 544200546909 605600607800 605600607800 757300774000 757300774000 757300774000 757300774000 757300774(109 757300774(109 762100774000 762100774000 762100774000  Cooni. segmen.  XP 569055  GLEAN 03571  GLEAN_03745  —  GLEAN 03468  —  GLEAN 03744  -  GLEAN 03467  -  GLEAN 03745  —  GLEAN 03468  —  GLEAN 03744  —  GLEAN 03742  —  GLEAN 03469  —  GLEAN 03493  —  GLEAN 03711  —  GLEAN 03499  -  GLEAN 03500  —  GLEAN 03699  —  GLEAN 03526  —  GLEAN 03669  —  GLEAN 03552  —  GLEAN 03650  —  GLEAN 03650  —  GLEAN 03640  3.OOE-130  3.OOE-104  XP 568398  XP 568729  —  —  1.OOE-l76  XP_57l045  —  8.OOE-113  XP 571044  —  XP 571043  -  2.OOE-44  5.OOE-53  3(9 572478  -  l.OOE-176  8.OOE-113  1.OOE-43  0.OOE+00  XP 571045  —  XP 571044  —  XP 775243  —  XP 568421  —  XP 001265924  2.OOE-05  4.OOE-71  XP 772030  —  1.OOE-154  0.OOE+00  0.OOE+00  XP 568501  —  XP 568303  -  XP 568304  —  XP 568308 2.OOE-l67  6.OOE-02  XP 001263452  —  3.OOE-56  XP 568435  —  —  —  3.OOE-130  2.OOE-1 16  0.00E-00  4.OOE-12  XP 568398  —  XP 568339  —  XP 568448  GLEAN 03566  —  NOGENE  —  XP 750151  —  NOGENE  —  GLEAN 03570  —  —  5.OOE-109  4.OOE-32  —  ABE82053  GLEAN 03572  —  0.OOE+00  XP 567971  GLEAN 03573  4.OOE-85  E-vahse  XP_567971  GenBank 1W  GLEAN_03574  Glenn numbers -  761411764308 764509768109 768794770908  -  -  194388196624 196765197842 256216257443 256216257443 258356259020 365657 366909 404657405192 535169537300 540944544319 546566549439 604177605546 605702607346 756670757367 757763 759398 761411764308 764509768109 768794770909 773214-  159542160129 160470161894 163221165320 165669166418 167371171903  Coord. Gene’  -  Hexosetransport.reluted protein  Beta.glucosidase  Hypothetical protein  Hypothetical protein  Hexoaetranspoet.rebted protein  Beta-glucosidase  Hypothetical protein  Hypothetical protein  Conservedhypotheticalprotein [Neosaitotya fischeri].  Hypothetical protein  Hypothetical protein  Originrecognitioncomplexsubunit4  DNA unwinding-related protein  Cytoplasmic protein  Cyclin N-temnnal donmin protein. putative [Neonartosya flschmi].  Cardiolipinsynthase  -  Delayed-type hypersensitivity antigen related protein Delayed-type hypersensitivity antigen related protein Retrotransposable element slats 132 kda protein  Cytoplasmic protein  Hypothetical protein  Y1 domamfitmily[Aapagillua fumigatus].  Hypothetical protein  tzuncatu1a.  Retrotransposon nucleocapsid protein  Rotranosonnucotein  Predicted functions  -2.486  -2.486  -1.609  -2.681  -2905  -1.659  B163  -1.022  -1.022  -1.022  -0 716  125.91  -3.177  -3.177  CBS 7779  AVG LR  -2.867  -2.867  -2.867  -2.867  -1867  -2.867  -1.544  0.780  -1.547  -1.547  -0.739  -0.739  -0.739  -0.739  -0.739  WM 626  4.317  -4.317  -2.200  -4.773  4 475  -3.617  Bt63  -3.584  -3.584  -3.584  -2 263  125.91  -4.205  4.205  CBS 7779  Lowest LR for region  -4.753  -4.753  4.753  4.753  4.753  -4.753  -3.064  -0 384  -2.843  -2.843  -2.742  -1742  -2.742  -2.742  -2.742  WM 626  -0.274  .0.274  .0.896  0.304  -0 711  0513  Bt63  0.135  0.135  0.135  0.328  125.91  -2.033  -2.033  CBS 7779  Highest LR for region  0.688  0.688  0.688  0.688  0.688  0.688  0.322  1.953  -0.489  -0.489  1.102  1.102  1.102  1.102  1.102  WM 626  13  NP_l05753  GLEAN_01072  GLEAN_01079  GLEAN_01080  GLEAN_0l081  GLEAN_0l082  GLEAN_0I066  12300- 25300  12300- 25300  12300-25300  12300 -25300  12300-25300  52000-54300  GLEAN_00928  —  GLEAN 01215  —  GLEAN 01000  —  GLEAN 01001  —  GLEAN 01000  —  GLEAN 01001  —  GLEAN 01000  —  GLEAN 01000  —  GLEAN 01000  —  GLEAN 01001  —  GLEAN 01031  -  GLEAN 01098  XP_77l855  GLEAN_01078  12300- 25300  125900128300 239500240800 366400367600 366400367600 367700368800 367200368400 367000368400 367000368400 367600368600 367600368600 742400751800 742400751800  EAU87769  EAU93688  —  XI’ 572246  —  XI’ 568561  —  XI’ 771936  —  XI’ 568561  —  XI’ 771936  —  XP 568561  —  XP 568561  —  XI’ 568561  —  XP 771936  —  XI’ 568604  —  XP 776539  CAB91097  XP_771829  XP_56852t  XP_568522  XP_568523  XP_567l48  GLEAN_01073  XP_569289  GLEAN_01 077  GLEAN_01074  0- 12000  XP772644  0- 12000  GLEAN_0t075  0- 12000  XP_775062  —  XP 572478  0- 12000  GLEAN_0I 076  —  GLEAN 03467  —  XP 571045  GLEAN 03745  —  XP_572478  GenBank ID’  GI.EAIJ_03467  GIe.n numberb  0- 12000  762100774000 770900773900 770900773900  -k  —  12  Oir  Coord.segment’  6e-10  0  2.OOE-14l  2.OOE-67  2.OOE-t41  2.OOE-67  2.OOE-l41  2.00E-14t  2.OOE-14l  2.OOE-67  0  2.OOE-35  7.OOE-18  3.OOE-l4  5.OOE-08  l.OOE-72  2.OOE-17  O.OOE+00  1.OOE-91  2e-l0  2e-65  7e-45  6e-39  Se-68  5.OOE-53  l.OOE-176  $.OOE-53  E-value -  126395128221 234722239916 366611367074 367556361812 367556368812 367556368812 366611367074 367556368812 366611367074 367556368812 740312742468 743693 744577  -  -  -  Predicted protein (Coprinopsis cinerea okayama7#130].  Predicted protein (Coprinopsis cinerea olcayama7#l30].  Galartosetransporter  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  ABC transporter PMR5  Hypotheticalprotein  Arginase (Mesorhizobium loti].  Hypothetical protein  Dextranase (Penicillium fliniculosum].  Hypothetical protein  Hypothetical protein  Hydrolase  Alpha-glucoside:hydrogen symporter  Hypothetical protein CNAOZIZO  -  10061 10883 1254414859 1742019828 2042020693 20791 21291 2l72623579 2466725110 52924  Hypothetical protein CNB05440  Hypothetical protein CNBKOI8O  Hypothetical protein CNBE538O  Hypothetical protein  Hexose transport-related protein  Hypothetical protein  Predicted fanctio.’  8355- 8934  7582- 8308  5154- 6579  -  2118 2973  -  761794 770908 773214773909  773214-  Coord. Gene  2.696  -1.162  -1.162  -1.242  -1.242  Bt63  1.763  -1.022  125.91  3.673  3.673  -0.086  CBS 7779  AVG LR  0 306  -0.306  3.570  3.570  -0.306  -1.319  -2.069  -2.783  -2.783  -2.783  -2783  -2.783  -2.783  -0.208  -0.208  -0.208  -0.208  -0 208  WM 626  -0.072  -3.383  -3.383  -3.364  -3.364  Bt63  WM 626  -0.700  2.239  2.239  -0.011  -1 322  -1.322  0.892  0.892  -1 322  -2.450  -3 824  -4 668  -4661  -4.668  4.668  4.668  -4.668  -2 843  -2 843  -2.843  -2.843  -2.843  — ——  .3584  125.91  CBS 7779  Lowest LR for region  5.158  -0.256  -0.256  0.454  0.454  1lt63  0.570  0.135  125.91  4.863  4.863  0.240  CBS 7779  Highest LR for region  0 925  0.925  5.345  5345  0.925  -0.139  1.794  0.877  0.877  0.877  0.877  0.877  0.877  1 105  1.105  1.105  1 105  1.105  —  WM 626  14  —  Chr  140300149500 202400204500 208500209300 280400286400 280400286400 280400286400 280800286000 280800286000 281000289100 281000289100 281000289100 307500309300 307700309200 351600354800 427300430900 445100460400 445100460400  140300149500  140300149500  2e-79  GLEAN_03380  —  GLEAN 03379  —  GLEAN 03376  —  GLEAN 03364  —  GLEAN 03356  —  GLEAN 03356  —  GLEAN 03353  —  GLEAN 03334  —  GLEAN 03351  —  GLEAN 03351  —  GLEAN 03255  —  GLEAN 03352  —  GLEAN 03351  XP_569289  —  XP 572333  —  XP 774642  —  XI’ 772494  —  XI’ 775020  —  XP 775020  —  XP 572288  —  XP 772566  —  NP 862599  —  NP 862599  —  XP 572287  —  XP 772473  —  NP 862599  —  XP 572287  GLEAN 03255  —  NO GENE  —  XP 572256  —  XP 772566  —  YP 001103866  —  ZP 01225340  —  XP 572237  NO GENE  XP_001271 197  XP_568523  —  XP 773252  2.OOE-75  2.OOE-148  .  7.OOE-05  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  5.OOE+00  5.OOE+00  0.OOE+00  2.OOE-107  5.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  1.OOE-20  2.OOE-10  6.OOE-157  3.OOE-08  5.OOE-64  3.OOE-126  XP 771818  —  9e-51  E-value  XP_567148  GenBank ID’  NO GENE  —  GLEAN 03275  —  GLEAN 03334  —  GLEAN 03333  —  GLEAN 03285  —  GLEAN 03286  GLEAN_03308  500- 3700  112400113300 140300149500  GLEAN_03307  —  GLEAN 01218  —  GLEAN 01217  GLEAN_01216  Glean numbera  500- 3700  742400751800 742400751800 751900755900  Coord. segmen. -  -  -  -  -  -  -  278537280728 283364283840 286201 287028 278537280728 283364283840 283364283840 144801148667 288275291148 307532 308923 307532308923 351626353014 428908 429103 437892441787 442473445023  144801 148667 198991202766  143093 144297  141431 142546  138145140359  2566- 5152  569- 1671  745538749088 746620747691 753303754322  Coord. Gened  Hypothetical protein  MMS2  Hypothetical protein  Hypothetical protein  Hypothetical protein  Hypothetical protein  TranscriptioninitiationfactorTFllD  Hypothetical protein  Mob protein [Sinorhizobium meliloti].  Mob protein [Sinorhizobium meliloti].  Aaparagine synthase  Hypothetical protein  Mob protein [Sinorhizobium meliloti].  Aaparagine aynthase (glutamine hydrolyzing)  Rguynucleotideexchangefactor  Hypothetical protein  3-hydroxyacyl-C0A dehydrogenase, putative [marine gamma proteohacterium HTCC22O7]. Transcriptional regulator, 1cm family/regucalcin ISaccharopolyupora uythraea].  Myo-inositol transporter 1  -2.163  -2.163  -0.783  -1.229  1.293  -0.978  -0.978  -0.978  -2.387  0.351  -0.535  -1.295  -1.295  -1.295  -0.977  -0.977  -0.977  -0.977  -2.199  -2.783  -2.528  -0.306  -0.306  C6 transcription factor (Mut3). putative IAspergillus clavatus].  -0.535  125.91  -2.783  -0.689  Bt63  WM 626  Alpha-glucoside:hydrogen symporter  Hypothetical protein  Hypothetical protein CNBNI96O  Hypothetical protein CNAO2I2O  Predicted function  CBS 7779  AVG LR  -3.852  -3.852  -2.014  -2.176  0.100  -4.071  -4.071  -4.071  -3.881  -2.934  Bt63  -0.313  -2.290  -2.290  125.91  -4.895  -4.895  -4.895  -3.380  -3.380  -3.380  -3.380  -3.685  -4.352  -4.352  -3.838  -1.322  -1.322  WM 626  ——  CBS 7779  Lowest LR for region  -0.138  -0.138  0.844  0.075  1.997  1.304  1.304  1.304  -0.255  0.402  flt63  0.952  0.570  0.570  125.91  CBS 7779  Highest LR ror region  0.906  0.906  0.906  1.044  1.044  1.044  1.044  -0.140  0.012  0.012  —  0.085  0.925  0.925  WM 626  “  Chr  00  445100460400 445100460400 445100460400 445500460500 445500460500 445500460500 445500460500 587300591300 587300591300 833300834900 833300834900 913000925200 913000925200 913000925200  otoo  445100-  Coord. segment  P10978  GLEAN_03466  —  GLEAN 03465  —  GLEAN 03464  —  GLEAN 03450  —  GLEAN 03449  —  GLEAN 03191  —  GLEAN 03404  —  XP_776387  —  XI’ 776539  —  XI’ 001481488  —  XP 001271965  —  XP 572452  —  XI’ 776539  —  XI’ 568361  ABA99612  GLEAN 03383  —  GLEAN 03382  —  —  5.OOE-49  1.OOE-27  3.80E-fOO  J.OOE-19  0.OOE-I00  2.OOE-33  1.OOE-05  3.OOE-57  3.OOE-20  3.OOE-19 3.OOE-113  ABE94506  —  XI’ 567971  3.OOE-57  3.OOE-20  3.OOE-1 13  3.OOE-19  B-value  GLEAN 03381  P10978  ABA99612  —  Xl’ 567971  ABE94506  GenBank ID’  GLEAN 03220  —  GLEAN 03383  —  GLEAN 03382  —  GLEAN 03381  GLEAN_03220  Glean number”  -  -  -  -  447918448957 450536453340 455778457770 458257459256 447918448957 450536453340 455778 457770 458257459256 587004587437 588928 590733 829500833428 834615 837025 913868914840 916876918702 920609923050  Coord. Gened  Hypotheticalprotein  Hypotheticalprotein  Tramporter protein smf2 [Aspergillus clavatus]. Class V chitinase, putative EAspeegillus fumigatun].  Protein tyrosine/threonine phosphatase  Hypothetical protein  Hypothetical protein  Retrotransposon protein, putative, unclassified [Oryza sativa]. Retrovirus-related Pol polyprotein from transposonTNTl-94  Retrotransposon nucleocapsid protein  Retrovirus-related Pol polyprotein from tranaposon TNT 1-94 CENP-B protein; Homeodomain-like EMedicagotruncatulal.  Retrotransposon protein [Oryza sativa].  Retrotransposon nucleocapsid protein  CENP-B protein; Homeodomain-like IMedicagotruncatulal  Predicted function’  -1.616  -1.616  -1.616  -2 163  -2.163  -2.163  -2.163  Bt63  -0.538  0 538  -0.538  -0 538  125.91  CBS 7779  AVG LR  -1.700  -1.700  -1.700  -0.844  -0.844  -0.716  -0.716  WM 626  -4.1t3  -4.113  -4.113  -3.852  -3.852  -3.852  -3.852  Bt63  -2.001  -2.001  -2.001  -2001  125.91  CBS 7779  Lowest LR for region  -4.351  -4.351  -4.351  -2.387  -2.387  -2.475  -2.475  WM 626  0.695  0.695  0.695  -0 138  -0.138  -0.138  -0.138  Bt63  0 072  0 072  0.072  0 072  125.91  CBS 7779  Highest LR for region  1.045  1.045  1.045  0.641  0.641  0.417  0.417  WM 626  B  Database of genomic variation observed in serotype B strains via CGH  A  CHR  Regions  576391581752  269923272627  genomes  -  -  11527  6277  0  5.OOE-20  5’: AAW41609.l; 3’AAW4I61O 1  0.OOE+00  AAW41727.1  AAW4I6IO.1  270553 272031  0  577416578078  576539  575519-  -  268996270005  var.  monomeric GTPase,  var. neoformans  JEC2I]  putative [Cryptococcus neoformans  3” SAR small  neoformansJEC2lj;  neoformans var. neoformans JEC2II 5’: Conserved hypothetical protein [Cryptococcas neoformans var.  monomeric GTPase,  JEC2I],  putative [Cryptococcas  SAR small  neofornians  [Cryptococcas neoformans  Oxidoreductase, putative  5’. Oxidoreductase, putative [Cryptococcus neoformans var. seoformans JEC2I]; 3’: Conserved hypothetical protein [Cryptococcus neoformam seoformans JEC2I]  Oxidoreductase, putative [Crptococcus neoformans var. neoformans JEC21];  270553 272031  0.OOE+00  -  268996270005  0  Glucose 1-dehydrogenase, putative (Cryptococcas neofornians var. neoformans JEC2I] Glucose 1-dehydrogenase, putative (Cryptococcus neoformano var. neoformass IEC2I]  var. neoformans JEC2I I  Xenobiotic-transporting ATPase, putative (Cryptococcus neoformans  Predicted Functiond  (CHR)  number.  aNucleotide  coordinates  COP11  ER to  D  monomeric  SAR small monomeric Golgi transport  vesicle coat; Go_function: activity; Go_process:  5’: no Go terms 3’: Go_component: COPU vesicle coat; Go_function: SAR small GTPase activity; GO_process: ER to Golgi tramport  GTPase  Go_component  oxidorestuctase activity; Go_process: arabinose metabolism; Go_process: xylose metabolism  Go_component: nucleus; Go_component: cytoplasm; Go_function: aldehyde reductaae activity; Go_function: aldo-keto reductase activity; Go_function:  GO_component: peroxisomal matrix; GO_function: 2,4-dienoyl-C0A reductase (NADPH) activity; GO_process: sporulation (sensu Saccharomyces); GO process: fatty acid catabolism GO_component: peroxisomal matrix; GO_function: 2,4-dienoyl-CoA reductase (NADPH) activity; GO_process: sporulation (sensu Saccharomyces); GO_process: fatty acid catabolism 5’: Go_component nucleus; Go_component: cytoplasm; GO_function: aldehyde reductase activity; Go_function: aldo-keto reductase activity; Go_function: oxidoreductase activity; GO_process: arabinose metabolism; GO_process: D-xylose metabolism 3’: Go_component: mitochondrial matrix; Go_function: thiol-disulfide exchange intermediate activity; GO_process: response to osmotic stress; GO_process: response to oxidative stress Go_component: nucleus; GO_component: cytoplasm; Go_function: aldehyde reductase activity; Go_function: aldo-keto reductase activity; Go_function: oxidoreductase activity; GO_process: arabinose metabolism; GO_process: Dxylose metabolism 5’: Go_component: nucleus; Go_component: cytoplasm; Go_function: aldehyde reductase activity; Go_function: aldo-keto reductase activity; Go_function: oxidoreductase activity; Go_process: arabinose metabolism; Go_process: D-xylose metabolism 3’: Go_component: mitochondrial matrix; Go_function: thiol-disulfide exchange intermediate activity; Go_process: response to osmotic otrest; Go process: response to oxidative stress  GO_component, plasma membrane, GO function. xenobiotic-tramportmg ATPase activity; GO_process: drug transport; GO_process: response to drug  Gene Ontology  chromosome  5” Oxidoreductase, putative [Cryptococcus neoformans var neoformons JBC21]; 3’: Conserved hypothetical protein [Cryptococcus neoformam var neoformans JEC21]  10501 -11527  10501  591  Coordinates of Gene  the  5’: AAW41727.1; 3’: AAW41655. 1  AAW41727. 1  -  5’: AAW4I 727.1; 3’: AAW41655. 1  0  AAW42OIO.l  0  0  AAW41688. I  269842 272058  10687  E-value  E-value  AAW42OIO.l  -  Protein IDa  The  in  The  of difference  6776- 10516  4518  Coordinates describing the are?  BLASTn.  B.1  of top  Table  -0.496  -0.496  -0.687  -0.687  -1.539  R794  -1.231  -1.231  KB3864  Average LD  -0.726  -0.726  -1.510  KB7892  0.410  0.410  0.428  0.428  0.671  R794  0.850  0.850  KB3864  0.411  0.411  0.647  KB7892  Standard Deviation of LR  of three serotype B strains compared with the sequenced genome of strain WM276. Regions of difference that overlap are in the same colour. first column indicates the of the segment identified by CGH. bGefl cCoordinates ID of the BLAST result is included in the following column. of the specific gene in the segment identified by CGH. dFunctional information about the top BLAST hit. The GO ontology is included in the following column.  Appendix  B  —  ._______  A  CHR  1656-7735  1656- 6936  19814871984760  19811301984760  839426843911  Coordinates describing the area  0.OOE+00  0.OOE+00  AAW4I4IO. I  AAW40616.l  0.OOE+00  AAW40616.1  000E+00  0.OOE+O0  AAW4I4IO.1  AAW42701.1  0.OOE+00  5.30E-01  XP_7t 8879.1  AAW427OI. I  0.OOE+00  5.30E-01  XP_71 t879. 1  5’:AAW41253. 1; 3’:AAW41254. 1  0.OOE+00  5’.AAW4I2S3.t, 3’: AAW41 254.1  -  -  6353  6832- 8624  5111  933-3973  6832- 8624  5111 -6353  933- 3973  19844131984622  19806691982082  1984413 1984622  19806691982082  -  842958 844970  0.OOE+00  839634839843  -  AAW40952. I  5.OOE-39  5’: AAW40948. 1; 3’: AAW40950. I  578385 580438  -  840230842847  l.OOE-t42  XP_777290.t  Expressed protein lCryptococcus neoformans var. neoformans JEC2I] Expressed protein [Cryptococcus neoformans vat. neoformans JEC2I]  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2IJ  Expressed protein [Cryptococcus neofonaans var. neoformans JEC2I] Expressed protem [Cryptococcus neoformans var. neoformans JEC2I]  Hypothetical protem (Cryptococcus neofornians var. neoformans JEC2II  Hypothetical protein [Cryptococcus neoformans var. neoformans B3501A] 5’: Choline-phosphate cytidylyttransferase, putative [Cryptococcus neoformans var, neoformans JEC2I] 3’: ER organization and biogenesisrelated protein, putative [Csyptococcus neoformans vat, neoformans JEC21I ER organization and biogenesisrelated protein, putative [Cryptococcus neoformans var. neoformans JEC21I Type 2C Protein Phoaphatase, putative [Cryptococcus neoformans var, neoformans JEC2I] 5’. Conserved hypothetical protein [Cryptococcus neoformam var. neoformans JEC2I] 3’: Hexose transport-related protein, putative [Cryptococcus neoformans var neoformans JEC2I] Hypothetical protein ICryptococcus neoformans var neoformaim JEC2I] 5’. Conserved hypothetical protem lCryptococcns neoformans var. neoformans JEC2IJ 3’: Hexose transport-related protein, putative [Ciyptococcus neoformans var. neoformansJEC2l] Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2IJ  no GO terms  noGOterms  GO_component: nucleus; GO_function: transcription Iitctor activity; GO_process: carbohydrate metabolism; GO_process: regulation of transcription, DNA-dependent  no GO terms  noGOterms  GO_component: nuclesis; GO_function: transcription litctor activity; GO_process: carbohydrate metabolism, GO_process regulation of transcription, DNA-dependent  GO te  5’: GO_component: membrane; GO_function transporter activity; GO_lms’ transport GO component plasma membrane; GO_function fructose transporter activity;GO_ction: glucose transporter activity, GO_function’ mannose transporter activity; GO_procesa: hexose transport  GO tanm  5’: GO_component: membrane; GO_function: transporter activity; GO_pros’ transport 3” GO_component: plasma membrane; GO_function fructose transporter activity;GO_function: glucose transporter activity; GO_function: mannose transporter activity; GO_peocess: hexose transport  GO_function: protein phosphatase type 2C activity  GO_component: endoplasmic reticulum membrane; GO_process: ER organization and biogenesis  5’: GO_component: nucleus; GO_component: nuclear membrane; GO_component: Golgi apparatus; GO_function: choline-phosphate cytidylyltransferase activity; GO_process: phospliatidylcholine biosynthesis; GO_process: CDP-choline pathway 3’:GO_component: endoplasmic reticulum membrane; GO_process: ER organization and biogenesis  no GO terms  -1.057  -1.057  -1.057  -0 898  -0 898  -0.496  -0.496  Hypothetical protein ICryptococcus neoformans vat. neoformans JEC2I]  580583 583951  GO_component: SAGA complex; GO_function structural molecule activity; GO_process conjugation with cellular fusion, GO_peocess: protein complex assembly, GO_process: chromatin modification. GO_process histone acetylation  9.OOE-132  5.OOE-t62  AAW4l608.1  -0.496  no GO terms  Hypothetical protein [Cryptococcus neoformansvar. neoformansB3501 Al  -  578385 580438  R794  Gene Ontology  Predicted F..ctiond  Coordinates of Gene’  AAW4O9SO.i  l.OOE-142  E-value  XP_777290.l  Protein 1Db  -0 995  -0 995  -0.808  -0.808  -0.808  KB3864  AverageLR  -l 476  -1.476  -1.476  -0.851  -0.851  KB7892  1.213  1.213  1.213  —  0.406  0.406  0 410  0.410  0.410  0 543  0 543  0.840  0.840  0.840  KB3864  1 355  1.355  1.355  0.395  0.395  KB7892  Sta.”ard Deviatri of LR R794  B  CHR  -  -  962918  931665-  -________  348128 350581  348128 350542  349505  348410-  290630  288584  describing the area  Coordinates  778123.1  —  0.OOE+00  1; 1  5’: 3’:  AAW4O881. AAW40884.  0.OOE+00  0.OOE+00  0.OOE+00  1.OOE-71  5.OOE-65  1.OOE-71  5.OOE-65  1.OOE-71  5.OOE-65  5.OOE-175  8-valne  AAW40881.1  2 AAw41420 1  1: AAW40875.1;  1. AAW40861.l, 2. AAW40863.1  AAN37584.1  —  Xl’ 778123.1  AAN37584.1  XP  AAN37584.1  —  XP 778123.1  AY710429  Protein 113’  -  -  -  943668948168  923016928131  908958 922594  890824908884  349703 349906  347984348208  349906  349703  348208  349703349906  348208  347984  of Gene’  Coordinates Function’  NO  GO  terma  terms  putative [Cryptococcus neoformans var. neoformans JEC2I] 3’:calcium transporting ATPase, putative [Cryptococcus neoformans var. ncoformans JEC2I]  5’: DNA topoisomerase II,  GO_component: synaptonemal complex; GO_component: nucleus; GO_function: DNA topoisomerase (ATP-hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change; GO_process: DNA strand elongation; GO_process: chromatic assembly or disussembly; GO_process: meiotic recombination; 3’: GO_component Golgi membrane; GO_component: plasma membrane; GO_component: trans-Golgi network transport vesicle; GO_function: phospholipid-translocating ATPase activity; GO_function: ATPase activity: GO_process: intracellular protein transport; GO_process: post-Golgi transport; GO_process: processing of 20S pre-rRNA  5’:  GO_component: synaptonemal complex; GO_component: nucleus; GO_function: DNA topsisomerase (ATP-hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change; GO_process: DNA strand elongation; GO_process: chromatic assembly or disassembly; GO process: meiotic recombination  DNA topoisomerase II, putative [Cryptococcus neoformam var. neoformans JEC2I]  GO terms; GO terms  1: GO_component: nucleus; GO_component: nucleolus; GO_component: mitochondrion; GO_component: cytosol; GO_function: tRNA isopentenyltrsnsferase activity; GOprocess: tRNA modification 2: GO_component: cell; GO_function: ribonuclease H activity; GOprocess: DNA replication; GO_process: cell wall organization and biogenesis  no GO terms  no GO terms  no  no  1 no 2: no  -  terms  noGOteimu  no (30  n/a  Gene Ontology  1: Expressed protein ICryptococcus neoforisians var. neoformans JEC2I]; 2: Conserved hypothetical protein ICiyptococcus neoformans var. neofurmansiEC2l]  neoformans JEC21];  var.  putative [Cryptococcus neoformans neoformans JEC2IJ; 2. ribonuclease H, putatIve ICiwtococcus neoformam Vat  neofonnans var.  NADH dehydrogensue  subunit 5 [mitochondrion Cryptococcus gtubii (Filobneidiella neoformans serotype A)] Hypothetical protein [Cryptococcuu neoformans var. neoformana B3501A] NADH dehydrogenaue subunit 5 [mitochondrion Cryptococcus neoflurmam var. grubii (Filobnaidiella neofornians serotype A)] 1: tENA isopentenyltransferase,  3501A]  [mitochondrionCryptococcua neoformans var. grubii (Filobasidiella neoformans serotypc A)1 Hypothetical protein ICryptococcus neoformasu var. neoforniana B-  NADH dehydrogenase subunit S  neoformans var. neoformam B3501A1  Hypothetical protein [Cryptococcus  GENE  Cryptococcus gattii strain E566 MATs locus, complete sequence,  Predicted  -2.412  -2.412  R794  Lit  -1.104  -1.104  -1.t04  -1.104  -3670  -3.670  -1846  KB3864  Average  -1.127  -1.127  -1.127  -1.127  -2 755  -2.755  K.B7892  1.509  1.509  R794  0.930  0.930  0.930  0.930  1.033  1.033  0.921  KB3864  0950  0.950  0.950  0.950  1 369  1.369  KB7892  Standard_Deviation of LR  B  CHR  L’J  -  1198232  1198151 1197909-  1197009-  11318331134857  963047  931878  Coordinates describing the area  0.OOE+00  0.OOE+00  AAW41832.1  AAW41832.1  l.OOE-16l  AAW41700.1  0.OOE+00  5’: AAW40881. 1; 3’: AAW40884. 1  0.OOE+00  0.OOE+00  5’: AAW4O881. 1; 3’: AAW40884. 1  DAA05954.1  0.OOE+00  0.OOE+00  AAW40881. I  2: AAW4I42O. 1  I: AAW40875.l;  2: AAW40863.1  0.OOE+00  0.00E+00  5’: AAW4O881. 1; 3’: AAW40884. 1  1: AAW40861 .1;  E-value  Protein fl)h  1199343  neoformassvar. neoformamJEC2ll  1199343 1197082-  Expressed protein [Cryptococcas neoformans var. neoformans JEC21]  neoformam var. neoformam JEC21] Expressed protein [Cryptococcus  1136054 1197082-  neoformam JEC21I 3’:calcium transporting ATPase, putative [Cryptococcus neofornians var. neoformam JEC21]  CAP4p tCryptococcua neoformans var. grubiij Expressed protein Cryptococcua  -  5’: DNA topoisomerase U,  putative [Cryptococcus neoformans var.  [Cryptococcua neoformans var. neoformans JEC2IJ 3’:calcium transporting ATPase, putative [Cryptococcus neoformana var. neoformans JEC2I]  5’: DNA topoisomerase II, putative  DNA topoisomerase II, putative [Cryptococcus neoformans var. neoformans JEC2II  2:  [Cryptococcus neoformans var. neoformans JEC21]; Conserved hypothetical protein [Cryptococcus neoformans var. neoformansJEC2l]  neoformans JEC2I]; 1: Expresaed protein  2: ribonuclease H, putative [Cryptococcus neofornians  11306951133555 1133875  948235 952735  948168  943668-  928131  923016-  922594  908958-  908884  -  948235952735  no GO  terms  no GO terms  no GO terms  no GO terms  GO_function: DNA topoisomerase (ATP-hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change; GO_process: DNA strand elongation; GO_process: chromatin assembly or disassembly:_GO_process:_meiotic recombination 5’: GO_component: synaptonemal complex; GO_component: nucleus; GO_function: DNA topoisomerase (ATP-hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change: GO_process: DNA strand elongation; GO_process: cbroniatin assembly or disassembly; GO_process: meiotic recombination; 3’: GO_component Golgi membrane; GO_component plasma membrane; GO_component: trans-Golgi network transport vesicle: GO_function: phospholipid-translocating ATPase activity; GO_function: ATPase activity; GO_process: intracellular protein transport; GO_process: poat-Golgi transport; GO_process:_processing of 20S_pre-rRNA 5’: GO_component synaptonemal complex; GO_component: nucleus; GO_function: DNA topoisomerase (ATP-hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change; GO_process: DNA strand elongation; GO_process: chromatin assembly or disassembly; GO_process: meiotic recombination; 3’: GO_component: Golgi membrane; GO_component plasma membrane; GO_component: trans-Golgi network transport vesicle; GO_function: phoapholipid-translocating ATPase activity; GO_function: ATPase activity; GO_procesa: intracellular protein transport; GO_process: post-Golgi transport: GO_process:_processing of 20S_pre-rRNA  GO_component: synaptonemal complex; GO_component: nucleus;  1 no GO terms; GO terms  2 no  2: GO_component cell; GO_function: ribonuclease H activity; GO_process: DNA replication; GO_process: cell wall organization and biogenesis  1: GO_component: nucleus; GO_component: nucleolus; GO_component mitochondrion; GO_component cytosol; GO_function: tRNA isopentenyltransferase activity; GOprocess tRNA modification  5’: DNA topoisomerase II, putative Cryptococcus neoformans var. neoforniam JEC2I1 3’:calcium transporting ATPase, putative [Cryptococcus neoformans var. neoformans JEC2II  890824-  5’: GO_component: synaptonemal complex; GO_component: nucleus; GO_function: DNA topoisomerase (ATP.hydrolyzing) activity; GO_process: regulation of mitotic recombination; GO_process: DNA topological change; GOprocess: DNA strand elongation; GO_process: chromatin assembly or disassembly; GO_process: meiotic recombination; 3’: GO_component: Golgi membrane; GO_component: plasma membrane; GO_component: tsans-Golgi network transport vesicle; GO_function: phospholipid-translocating ATPase activity; GO_function: ATPase activity; GO_process: intracellular protein transport; GO_process: post-Golgi transport; GOprocess:_processing of 20S_pre-rItNA  1: tRNA isopentenyltransferase, putative (Cryptococcus neofornsans var. neoformsns JEC2IJ;  Gene Ontology  Predicted Functiond  Coordinates of Gene  1 051  -0.666  -0 666  -l 141  -1.141  -1.141  -1.141  -l 141  R794  -1.104  KB3864  AverageLR  1 075  -1.127  KB7892  0.709  0.616  0.616  0 949  0.949  0.949  0.949  0 949  R794  0.930  1CB3864  0 716  0.950  KB7892  Stn’4ardDeviat of Uk  B  CUR  area’  AAW41768.l  AAW41767.1;  Gene’  2177513 2186552  -  neoformans  2.OOE-153  0.OOE-I-00  5’: AAW47184.1; 3’: AAW47191.1  AAW4I4IO.l  0.OOE+00  AAW427OI. I  0.OOE-I-00  0.00E4-00  AAW4I4IO.1  5’. AAW40943.1, 3’: AAW40830.1  21842902187330  2.OOE-153  5’: AAW47184.1; 3’: AAW47191.1  0.OOE+00  Hypothetical  21819192183160  0.OOE+00  5’. AAW40943. I, 3’: AAW40830.1  AAW45167.l  Bxprmnedprotein[Cryptococcus neoformain var. neoflsrmans JEC2I]  21810532181765  0.OOEfOO  AAW45167.1  -  2183160  2181919 -  21810532181765  2179351 2180179  21767602178061  -  neoformann  [Cryptococcus  GO  tenets  teems  activator complex; GO_function:  histone acetyltransferaae  -1.873 -1.873  Expressed  protein [Ciyptococcus neofurmans var. neoformsns JEC2II  neoformansJEC2lj  noGOterms  no GO terms  -2.447  -2.447  -2.447  5’: hst3 protein, putative 3’: Transcriptionalactivatorgcns, putative [Cryptococcus neoformans var. neoformans JEC2I] 5’: Expressed protein (Cryptococcus neoforinans var. neoformans JEC2IJ; 3’: Epoxide hydrolane 1, putative [Cryptococcus neoformans var.  -2.447  -2.374  KB7892  5’: GO_component nucleus; GO_function: DNA binding; GO_process: chromatin silencing at telomere; GO_process: short-chain fatty acid metaholsm 3’: GO_component SAGAcomplex; GO_component: Ada2/GcnS/Ada3 transcription activator complex; GO_function: hintone acetyltramferaae activity; GO_process: chromatin modification; GO_process: hintone acetylation  -0.565  -2.179  KB3864  Average LR  noGOtenns  GO_component:  nucleus; GO_function: transcription factor activity; GO_process: carbohydrate metabolism; GO_process: regulation of transcription, DNA-dqeendent  -1.873  -1.873  -1.873  -1.873  -1.873  -2.361  R794  noGOterina  noGOtenns  acetylation  activity; GO_process: chromatin modification, GO_process: histone  transcription  5’: GO_component: nucleus; GO_function: DNA binding; GO_process: chromatin silencing at telomert; GO_process: short-chain fatty acid metabolism 3’: GO_component: SAGA complex; GO_component: Ada2JGcn5/Ada3  no GO  no  no GO teems  GO component: cytoplasm; GO_function: uroporphyrinogen decarboxylase activity; GO_process: home biosynthesis  GO tenets  GO tennn  Ontology  GO_component: nucleus;  no  no  Gene  Hypothetical protein [Cryptococcus neofurmans var. neoformann JEC21I  neofbrinans var neoformans JEC2I]  protein  neoformaaj JEC2IJ  ICryptococcus neofbrmans var.  5’: Expressed protein ICryptococcus neoformans var. neoformans JEC2IJ; 3’: Epoxidehydrolase 1, putative  var.  5’: hst3 protein, putative 3’. Transcriptional activator gcn5, putative [Cryptococcun neofurmann  neoformans var. neoformans JEC2I]  2178061  2179351 2180179  Hypothetical protein [Cryptococcun  -  2176760-  2175261 2176229  0.OOE+00  I  AAW42044.  Cytokine mducing.glyco protein, putative [Ciyptococcus neofonnans var. neoforinansJEC2ll Conserved hypothetical protein [Cryptococcun neoforinans var. neoforinans JEC21]  var. neoformansJtrC2l[  putative [Cryptococcus  Uroporphyrmogen decarboxylase,  neoforneans JBC2I]  [Cryptococcus neoformans var.  0.OOE+00  21727742173476  and  biogenesis-related protein, putative  2. Vacuole organization  5’: Conserved hypothetical protein [Ciyptococcus neofôrmans var. neofonnarn JEC2IJ 3’: MMS2, putative [Cryptococcus neoflsrmans var. neofornaann JEC2IJ 1. Exprtssed protein [Cryptococcus neoformans var. neoformans JEC2II  Predicted Function’  AAW42661. I  21721372186552  2163452-  2149964  1968449-  12389321240917  of  Coordinates  2164705  0.OOE+00  0.00E+00  0.OOE+00  K-value  2165268  AAW41442. I  1.  2.  2127536  2161180-  ID”  5’: AAW45247. 1; 3’: AAW45026.1  Protein  2126334-  12385601242125  the  describing  Coordinates  1.416  1.416  1.416  1.416  1.416  1.416  1.416  1.125  0.535  1.465  KB3864  1.149  1.149  1.149  1.149  1.145  KB7892  Standard Deviation of LR  R794  —  C  —  B  CHIt  105089 106333  0 OOE+00  0.OOE+00  I. AAW46647.l, 2. AAW46648. 1  AAW46728.I  101699105418  -  104942114213  114213  0.OOE+00  104942-  1422587  1422006  101699105171  4.OOE-148  5’: AAW4271 1.1; 3’: AAW42714.1  -  -  14202811421727  1190125  1187084  11152701119115  1114542  1112906 -  1110485-  1111629  1 AAW46647 I; 2. AAW46648. 1  0.OOE+00  AAW427I I I  14215711422475  0.OOE-fOO  0.OOE+00  AAW41856.l  AAW42701 .1  l.OOE-l09  AAW46799.1  11864441190328  1116838  0.OOE+00  I .OOE-109  AAW46799. I  AAW42273.l  11129061114542  0.OOE+00  AAW42273. I  11114951115320  1111495-  11104851111629  0.OOE+00  5’: AAW45165.1; 3’: AAW45164. 1  619942625162  622428624977  79972- 82596  0.OOE+00  AAW4252t.t  2184290. 2187330  77156- 79384  80061  0.OOE+0O  AAW42701.1  Coordinates of Gene’  0 OOE+00  -  E-value  Protein IDh  AAW42549. 1  79215  Coordinates describing the are?  _  ___________  5’: no GO terms 3’: GO_component: nucleus; GO_component: cytoplasm; GO_function:  neoformansJEC2lj  neoformam JEC21( Conserved hypothetical protein [Cryptococcus neoformans var.  [Cryptococcus neofortnans var.  [Cryptococcus neoformans var. neoformans JECZI] 2. Hypothetical protein  neoformans JEC2I) I Conserved hypothetical protein  I. Conserved hypothetical protem (Cryptococcus neoformans var. neoformans JEC2I 2. H’ sotheticaI protein 1 [Cryptococcus neoformans var.  no GO terms  I: GO_component: nucleus; GO_component: cytoplasm; GO_function: protein carrier activity; GO_process: protein-nucleus import 2: GO_component: aclin cap (sensu Saccharomyces); GO_fUnction: SNARE binding; GO_process: exocytosis; GO_process: vesicle docking during exocytosis; GO_process: vesicle fusion  1: GO_component: nucleus; GO_component: cytoplasm; GO_function: protein earner activity; GO_process: protein-nucleus Import 2: GO_component: actin cap (sensu Saccharomyces); GO_function: SNARE binding; GO_process: exocytosis; GO_process: vesicle docking daring exocytosi.s; GO_process. vesicle fusion  3’: GO_component: mitochondrial inner membrane peptidase complex; GO_function: peptidase activity; GO_process: mitochondrial protein processing  5’: no GO terms  no GO terms  GO_component: nucleus; GO_function: transcription factor activity; GO_process carbohydrate metabolism; GO_process: regulation of transcription, DNA-dependent  Hypothetical protein [Cryptococcus neofornssns var. neoformam JEC2IJ Conserved hypothetical protein ICtyptococcus neoformans var. neoformam JEC21I 5’: Conserved hypothetical protein [Cryptococcus neoformans var. neoformam JEC2IJ 3’: Signal peptidase 1, putative ptococcus neoformans var. 3 [Cr neoformans JEC2I]  no GO terms  no GO terms  no GO terms  no GO terms  no GO terms  branched-chain-amino-acid rransaminase activity; GO_process: amino acid catabolism; GO_process: branched chain family amino acid biosynthesis  Transcription factor, putative [Cryptococcus neoformam var. neoformam JEC2I]  [Cryptococcus neoformans var. neoformans SEC2I] Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II  neoformam var. neoformans JEC2lj Conserved hypothetical protein  [Cryptococcus neoformans var. neoformans JEC2I[ Hypothetical protein [Cryptococcus  neoformans JEC21j 3’: Branched-chain-amino-acid transaminase, putative [Cryptococcus neoformans var neoformans JEC2I] Conserved hypothetical protein  GO te  activity; GO_process transport  GO_component: mitochondrial inner membrane; GO_function: transporter  GO_component nucleus; GO_function: transcription factor activity; GO_process: carbohydrate metabolism; GO_process: regulation of transcription, DNA-dependent  Hypothetical protein [Cryptococcus neoformans var. neoformass JEC2IJ  Mitochondrial carrier protein, putative [Cryptococcus neoformans var. neoformans JEC2II Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] 5’: Hypothetical protein [Cryptococcus neoformans var.  Gene Ontology  Predicted Function’  -2.029  -2.029  -0 676  -3 179  -3.179  R794  1.582  1 215  1.215  1CB3864  Average LR  -2.192  -1.051  -1.051  -2.308  -2 308  -2.308  -2.447  KB7892  1 224  1.224  0.531  1 373  1.373  R794  0.430  0 592  0.592  KB38414  1.145  0.689  0.689  1.772  1 772  1.772  1.149  1CB7892  Standard Deviation of LR  E  1’—)  —  CHit  -  no  GO terms  no GO terms  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]  17989-19485 20069- 21989  GO terms  3.OOE-22  XP_660562.1  3’:  5’: no GO terms GO_component: nucleus; GO_component: cytoplasm; GO_function: branched-chain-amino-acid transaminase activity; GO_process: amino acid catabolism; GO_process: branched chain family amino acid biosynthesis  5’: no GO terms 3’: GO_component: nucleus; GO_component: cytoplasm; GO_function: branched-chain-amino-acid transaminase activity; GO_process: amino acid catabolism; GO_process: branched chain family amino acid biosynthesis  terms  2.OOE-04  XP_00l546302.l  16451  var. neoformans JEC21] 3’: Branched-chain-amino-acid transaminase, putative [Cryptococcus neoformam var. neoformans JEC2I] 5’: Hypothetical protein [Ciyptococcus neoformans var. neoformans JEC21] 3’: Branched-chain-amino-acid transaminase, putative (Cryptococcus neoformans var. neoformans JEC2I]  no GO  no  12232-  12232-16451  5’: Hypothetical protein [Cryptococcus neoformans  Hypothetical protein [Paramecium tetraurelia strain d4-2]  L-arabinitol 4-dehydrogenase [Botryotinia fuckeliana B05. 10]  1.60E-01  XP_00l258763.l  5524  Aspartic-type endopeptidase, putative [NeonartoryafischeriNRRL 181]  0.OOE+00  5’: AAW45165.1; 3’: AAW45 164.1  15485  -  6405- 8715  3116  17522-18204  0.OOE+00  5’: AAW45165.1; 3’: AAW45164.l  AAW47006  I .OOE-I5  GO_component. membrane fraction, GO_function. alpha-glucoside.hydrogen symporter activity; GO_process: alpha-glucoside transport  Alpha-glucoside:hydrogen symporter, putative [Cryplococcus neoforinans var. neoformans JEC2I]  509- 2656  I  no GOterins  Hypothetical protein [Cryptococcus neoforinans var. neoformans JEC2I]  6.OOE-l3  no GO terms  Hypothetical protein [Paramecium tetraurelia strain d4-2]  6405- 8715  1.90E+00  XP_00t444420.l  XP_389258.l  GO_component: membrane fraction; GO_function: alpha-glucoside:hydrogen symporter activity; GO_process: alpha-glucoside transport  3116- 5524  OOE-lS  I  AAW47006 I  -3.968  -0 854  -0.854  -0.854  -0.854  -3.619  -3.619  1.067  -3.968  -3.968  -3 465  -3.465  -3.465  Hypothetical protein [Cryptococcus neoformans var. neoformam JEC2I]  -3 619  GO_component: integral to plasma membrane; GO_function: nicotinamide mononucleotide permease activity; GO_process: nicotinamide mononucleotide transport  no GO te  0.717  , GO  Expressed protein [Cryptoeoccus neoformans var. neoformam JEC2I]  Alpha-glucoside.hydrogen symporter, putative [Cryptococcus neoformans var. neoformans JEC2I]  0 717  0.709  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  -2.341  KB7892  0799  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  11411-16648  22697  -  22237992225781  2221211 2222459  -2.656  -2.656  KB3864  GO_component: integral to plasma membrane; GO_function: nicotinamide mononucleotide permease activity; GO_process: nicotinamide mononucleotide transport  -2.356  R794  Average LR  no GO terms  Expressed protein [Cryptococcus neoformans var. neoformam JEC2I]  5’: no GO terms 3’: GO_component: nuclear pore; GO_component: cytoplasm; GO_function: structural constituent of nuclear pore; GO_process: protein-nucleus import  no GO terms  I GO_component: nucleus; GO_component: cytoplasm; GO_function: protern corner activity, GO_process. protein-nucleus import 2. GO_component. actin cap (sensu Saccharomyces); GO_function. SNARE binding; GO_process: exocytosis; GO_process: vesicle docking during exocytosis; GO_process: vesicle fusion  Gene Ontology  509-2656  l.90E+00  -  -  22237992225781  2222459  2221211  [Cryptococcus neoformans var. neoformans JEC21] 3’: MMS2, putative [Cryptococcus neoformans var. neoformans JEC2I]  [Cryptococcus neoformans neoformans JEC2I] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] 5’: Conserved hypothetical protein  2: Hypothetical protein  neoformans JEC2lJ  [Cryptococcus neoformans  I: Conserved hypothetical protein  Predicted Function’ 1  6.OOE-l3  0.OOE+00  AAW44410.1  -  21344502137208  106333  114213  104942-  Coordinates of Gene’  XP_389258.l  0.OOE+00  0.OOE+00  AAW44410. I  AAW45746. I  0.OOE+00  0.OOE+00  AAW45746. I  5’: AAW45247.1; 3’: AAW45026.1  0.OOE+00  0.OOE+00  it-value  XP_00l444420.I  89- 10939  89-9769  22222372223869  2222105 2223869  2137603  2134065-  AAW46728. I  2: AAW46648 I  1 AAW46647 I;  101699-  105219  Protein 1Db  Coordinates describing the_nrea  0 436  0.436  0.436  0.436  0.839  0.839  0 839  0.409  0 409  1.133  R794  0.654  1.188  1.188  1.188  1.282  1.282  KB3864  1.136  1.136  1.136  0.372  0 372  1.197  KD7892  Standard Deviation of Lit  —  F  —  E  CHR  Coordinates  -  0.OOE+00  0.OOE+00  5’: AAW44068.1, 3’: AAW44069.1  5’: AAW44068.l, 3’: AAW44069.1  AAW44228. 1  481302481603  481302502779  757895 759412  0.OOE+00  0.OOE+00  5’: AAW44375.1, 3’: AAW44O5I.1  259428261037  -  0.OOE+00  5’: AAW44375.l; 3’: AAW44051 .1  -  -  749027758643  482098 486220  482098486220  259572261441  259572261441  256640 259339  14289- 18373  0.OOE+00  XP_571629.l  0.OOE+00  10965- 14121  -  4.OOE-l75  t086301 1089504  354970357734  352140354250  -  AAW44147.l  0.OOE+00  0.OOE+00  5’: AAW45247.1; 3’: AAW45026.l  AAW43774.1  0.OOE+00  93790  90521  0.OOE+00  AAW43819.1  AAW43427. I  89048  88149-  0.OOE+00  AAW43789.1  45346  43838  0.OOE+00  AAW43778 I -  43219- 43682  3.OOE-47  AAW43410.1  AAW44051.l  259277261037  10686- 14356  10863871087703  354195 358121  88716- 90611  45130  43595-  E-vahie of Gene’  Protein Wb  describing the area  Coordinates Fwiction’  var.  [Cryptococcus  neoformans JEC2II  5’: Biotin synthase, putative [Cryptococcut neoformans var. neoformam JEC2I] 3’: Vmicle-mediated transport-related protein, putative [Cryptococcus neoformans var. neoformam JEC2I] 5’: Expressed protein (Cryptococcus neoformans var. neoformans JEC2IJ 3’: Hypothetical protein [Cryptococcus neoformans var neoformans JEC2I( 5’: Expressed protein (Cryptococcua neoformans var. neoformans JEC2IJ 3’: Hypothetical protein [Cryptococcus neoformass var neoformans JEC2I] Telomere length control protein, putative [Cryptococcus neoformans var. neoformans JEC2I]  neoformans var. neoformans JEC2II  Conserved hypothetical protein [Cryptooeccusneoformaosvnr. neoformansJEC2ll ATP.dependent permease, putative [Cryptococcusneoformansvar. neoformans)EC211 Vesicle-mediated transport-related 5)tococess 3 protein, putative [Cr neoformans var. neoformans JEC21] 5’: Biotin synthase, putative ICiyptococcus neoformans var. neofisrmacoJEC2ll 3’: Vesicle-mediated transport-related protein, putative [Cryptococcus  Expressed protein ICryptococcus neoformans var. neoformans JEC21] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II Asparagine-tRNA ligase, putative ,t0coedn neoformans var. neoformans JEC2I] 5’: Conserved hypothetical protein [Cryptococcus neofonnaas var. neoformans JEC2IJ 3’: MMS2, putative Cryptococcus neoformans var. neoformans JEC2I] Conserved hypothetical protein [C’,tocorms neoformans var. neoformans JEC21]  neoformans JEC2II  Conserved hypothetical protein [Cryptococcus neoformans var.  neoformans  Hypothetical protein  Predicted  -1.739  GO_component: integral to membrane; GO_process: veaicle-mediated transport  -1.219  GO_component. nucleus; GO_functiotc inositol or phosphatidylinositol kinase activity: GO_process: response to DNA damage stimulus; GO_process: telomerase-dependent telomere maintenance  —  -1.417 no GO terms  noGOterms  5’: GO_component: mitochondrion; GO_function: biotin synthase activity: GO_process: biotin biosynthesis 3’: GO_component: integral to membrane: GO_process: vesicle-mediated transport  transport  -l 739  -1.213  GO_componentcytoplasm; endoplasmic reticulum; integral to membrane; GO_fiinction=’ATP-bindingcassette(ABC)transporleractivity;GOprocess= transport  5’: GO_component: mitochondrion; GO_function: biotin synthase activity: GO_process: biotin biosynthesis 3’: GO_component: integral to membrane; GO_process: vesicle-mediated  -1.213  1.290  GO_component: intracellular; GO_component: cytoplaam; GO_function: peptide alpha-N-acetyltransferase activity; GO_process: protein amino acid acetylation  noGOterms  -2.065  -0.642  -0.642  -0.892  5’: no GO terms 3’: GO_component nuclear pore, GO_component: cytoplasm; GO_function: structural constituent of nuclear pore; GO_process: protein-nucleus import  terms  terms  -2.065  GO  GO  GO  -0.892  R794  GO component: cytoplasm; GO_function: asparagine-tRNA ligase activity; GOfitnction: AT? binding; GO_process: asparaginyl-tRNA aminoacylation  no  no  no  CX)  Gene Onto’ogy  JCB3864  Average LR  -1.215  -1.579  -1 824  -1.220  -1.220  1.239  -2 075  -2.075  KB7&92  1.054  0.984  1 386  1.386  0.412  0.412  —  0.967  1.044  1.044  0.781  0.781  0.795  0.795  R794  KB3864  1.057  0.930  1 415  0.439  0439  0.959  1 097  1097  KB7892  Standard Deviation of LR  (3  t’J  85-1791  CHR  517740533176  27573  516520518010  518493 519670 521220 522363  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  5’. AAW44687.l, 3’: AAW44689.l  AAW44687.1  AAW44683. 1  5’ AAW44680 I; 3’: AAW44682.1  522995 524382  533766  532596  0.OOE+00  AAW44677.l  -  -  -  -  -  529413 532175  0.OOE+00  AAW44883.1  -  -  -  -  0.OOE+00  524382  522995  521220 522363  519670  518493  518010  516520  479593  AAW44680.I  0.OOE+00  -  477638-  25945  319-2006  Coordinates of Gene’  525278527626  3’ AAW44682 1  5 AAW44680 1;  0.OOE+00  AAW44683.1  0.OOE+00  0.00E+00  AAW44689.l  0.OOE+00  0.OOE+0O  7.OOE-112  E-value  AAW44687. I  A.AW44687,1;  5’:  I  3’:  AAW44884  532795  -  AAW47007. 1  AAW44836. I  3’.  5’. AAW47006.l  Protein Wb  517740-  479017  477453  25919- 27980  Coordinates describing the area’ IcrYPtococcus  var.  JEC2I)  hypothetical protein  neoformans  Conserved  neoformans  JEC2IJ  var neofornmns  JEC2IJ 3’: Conserved hypothetical protein [Cryptococcus neoformans var. neoformsns JEC21]  putative [Csyptococcus neoformans  neoformant JEC2I] 5’: Myo-innnitol transporter 2,  [Ccyptococcus aeoformam var.  Conserved hypothetical protein  neoformans JEC2I]  ICryptococcus neoformans var.  Inositol oxygenase, putative  var.  putative  [Cryptococcus neoformans  mitochondrial precursor,  3’: Glutaryl.C0A dehydrogenase,  neoformansJEC2l] 5’: Inositol oxygenase, putative [Cryptococcus neoformans var. neoformans JEC2I]  [Cryptococcasneoformnnsvar.  Myo-inositol transporter  2, putative [Cry’stococcus neoformarn var. neoformana JEC2II Expressed protein [Cryptococcus neofornians var, neoformans JEC2I] Conserved hypothetical protein  neoformans JEC2I)  [Cryptococcus neoformans var.  3’:  var  putative [Cryptococcus neoformans  Inositol oxygenate, putative [Cryptococcus neoforinans var. neoformans JEC21I Conserved hypothetical protein ICIyptococcus neoformans var. neoformam JEC21] 5’: Myo-inosilol transporter 2,  neoformans JEC2t]  [Cryptococcus neoformam  putative  Glutaryl.C0A dehydrogenase,  mitochondrial precursor,  3:  Expressed protein [Cryptococcus neoformans var neoformaim JEC2I] Expressed protein [Cryptococcss neoformans var. neoformans JEC2I] 5’: Inositol oxygenase, putative IClyptococcus neoformans var. neoformansJEC2l]  kmase, putative [Cryptococcus neoformans VaT. neoformans JEC2IJ 3’. Protein-histidine  var. neoformans JEC2II  patative  neoformans  symporter,  5’. Alpha-glucoside.hydrogen  Predicted Functiont  terms  GO_component: membrane; GO_function:  GO terms  GO ternss  GO  myo.inositol transport  aco’  GO_process. myo-inositoltransport 3’: noGOterms  5’:  no  no  no  noGOterms  GO  GO_process:  myo.inositol transponer  GO_component: membrane; GO_function: myo-inositol transporter activity;  3’: noGOterms  transport  GO_component: membrane; GO_function: myo-inositol tramporter  GO terms  terms  activity; GO_process: myo.inoaitol  5’:  no  no GO  no GO terms  no GO teems  no GO  terms  symporter activity; GO_process: alpha.glucoside tramport GO_component: plasma membrane. GO_function: two-component sensor molecule activity; GO_function: protein-histidme kinase activity; GO_function: osmosensor activity; GO_process: protein amino acid phosphorylation; GO_process: osmosensory signaling pathway via two. component system; GO_process: response to hydrogen peroxide  3’:  glacoside hydrogen  5’: GO_component: membrane fraction; GO_function: alpha.  Gene Ontology  -3.327  -3.327  -3.327  -3.327  1.070  1.346  R794  -2 332  KB3864  Average LR  -3.473  -3.473  -3.473  -3.473  -3.473  -3.473  -3.473  8(117892  1.022  1.022  1.022  1.022  0.408  0.671  R794  1.632  1(113864  0.962  0.962  0.962  0.962  0.962  0.962  0.962  1(117892  Standard Deviation of LR  H  [‘3  —  0  CHR  0.OOE+00  5’: AAW44068.t; 3’: AAW44069.1  12434801244775  13- 18859  it It  9203-9962 10430- 11308 11993- 13373 143- 1758  3134-5404  711 t  5931  5931  9203 t0430- 11308 11993- 13373  7.OOE-03  1.805-01  5.90E-02  t.20E+00  2 OOE-106  6.00E-l6  7.OOE-03  I 80E-  5.90E-02  l.20E+00  0.OOE+00  XP_77l 794.1  XP_776333.t  BAC74281.l  XP_749001.1  AAW44147.1  XP_771 794.1  XP776333. I  BAC74281.1  XP_749001.1  5’: AAW41253.1; 3’ AAW41254 1 17470- 19220  -  -  9962  3134- 5404  6.005-I 6  -  143- 1758  12436771244155  12436771244155  533766  2.OOE-106  AAW44147.t  0.005+00  5’: AAW44068.I, 3’: AAW44069.l  12432481244775  13- 13847  0.OOE400  AAW44677. 1  -  532596-  5294t3 532175  O.OOE+00  AAW44883. I  -  of Gene’  525278 527626  E-vahie  0.OOE+0O  Protein 1Db  Coordinates  AAW44680.1  the area’  describing  Coordinates  _________________  var neoformans JEC2I]  putative (Cryptococcus neoformans  Hypothetical protein (Cryptococcus neoformans var. neoformans B3501A] Hypothetical protein [Cryptococcus neofonnans var neoformans B3501A1 Putative membrane protein [Streptomyces avermitilis MA-4680] Conserved hypothetical protem [Aspexgillus fumigatus Af293] 5’ Conserved hypothetical protein [Ctyptococcus neoformana var neoformans JEC2I] 3’ Hexose transport-related protein,  var. neoformans JEC2I]  putative (Cryptococcus neofonnans  Conserved hypothetical protein [Cryptococcus neoformans var neoformans JEC2Ij Hexose transport-related protein, putative [Cryplococcus neoformans var._neoformans JEC2II Hypothetical protein [Cryptococcus neoformana var. neofornians B3501 A] Hypothetical protein [Cryptococcus neoformans var. neoformans B3501A] Putative membrane protem [Streptomyces avtrmitilis MA-4680] Conserved hypothetical protein [Aspergillus_fumigatus Af293] Conserved hypothetical protein [Cryptococcus neoformans vat neofoimansJEC2l] Hexose transport-related protein,  Myo-inositol transporter 2, putative (Cryptococcus neoformans neoforman.s JEC21] Expressed protein [Cryptococcus neoformans var. neoformans JEC2I] Conserved hypothetical protein [Ciyptococcus neoformans var. neofornians JEC2IJ 5’: Expressed protein [Cryptococcus neoformans var. neoformans JEC2IJ 3’: Hypothetical protein [Cryptococcus neoformans var neofomians JEC2I] 5’: Expressed protein ICiyptococcus neoformans var. neoformans JEC2I] 3’: Hypothetical protem [Cryptococcus neoformam vat neoformans JEC2IJ  Predicted Function  GO terms  terms  GO_function transporter activity,  1.007 0.994 -2.795 -2.781  GO terms  1.384 -2.768 GO ms GO_component: membrane;  ,  5’:  activity;  3’: GO_component: plasma membrane; GO_function: fructose transporter GO_function: glucose transporter activity; GO_function: mannose transporter activity; GO_process: hexose transport  GO_process: transport  t.384  1.384 -2768 noGOterms  -2.768  1.384 -2.768 GO terms no  t.384 -2.768  no GO terms  not applicable  no GO tenns  no  1.384  1.007 0.994 -2 795 -2.781  GO terms  no  -2.768  1.007 0.994 -2.795 -2.781  GO terms  1 384  1.007 0.994 -2.795 -2.781  terms  no GO  -2.768  1.007 0.994 -2.795 -2.781  not applicable  no  1.007  0.634  KB7892  0 994  0.553  KB3864  -2.795  —  -0.525  1.022  1.022  -3.327  1CB7892  1.022  -t.012  KB3864  -3.327  -3.327  R794  Standard Deviation of ER  R794  -2.781  terms  GO terms  no GO  no  no GO terms  no  no GO  GO_component membrane; GO_function: myo-inositol transporter activity; GO_process: myo-inositol transport  Gene Ontology  Average LR  H  11206891126939  11206891126255  10396111042677 10398011040501  558942562867  -  15375-21767  CHIt  506615 514012  Coordinates describing the area’  1126049 1127161  2.OOE-173  0.OOE+00  AAW44069.1  5’: AAW47162. 1; 3’: AAW47164.1  1121252 1122902  1123045 1125053  0.OOE+00  5’: AAW47162. 1; 3’: AAW47164.1  -  -  -  tt2l252. 1122902  NO GENE  NO GENE  -  559163561023 562093 563951  513648516907  511431  508402 509555-  507620-  -  20847  0.OOE+00  .  -  500839 507192  20575  19472- 19687  17470- 19220  of Gene’  5’: AAW47162.t; A.AW47164.1  3’:  0.OOE+00  0.OOE-f00  5’: AAW45247.1; 3’: AAW45026.1  AAW45662.1  0.OOE+00  AAW45662.1  0.OOE+00  0.OOE+00  AAW45507. I  AAW45659. I  0.OOE+00  3.OOE-30  5’. AAW41253.1, 3’: AAW41254.1  AAW45487. 1  6.OOE-45  0.OOE+00  £-value  5’: AAW41253.1; 3’: AAW41254.1  3’: AAW41254.l  5’: AAW41253.1;  Protein ID”  Coordinates  5’: Hypothetical protein fCryptocoecusnroformansvar. neoformans JEC2IJ 3’: Amidase, putative [Cryptococcus neoformam var. neoformans JEC21I 5’: Hypothetical protein [Cryptococcus neofonnaivs V& neoformain JEC2IJ 3’: Amidase, putative [Cryptococcus neoformass_var._neoibnnans JEC2I} Hypothetical protein [Cryptococcua neoforinans var. neoformans JEC2I[ 5’: Hypothetical protein [Cryptococcus neoformans var. neofornsans JEC2I] 3’: Amidase, putative [Cryptococcus neofommans var._neoformass JEC21J  Expressed protein [Cryptococcus nrofornsans var. nroformans JEC2I] 5’: Conserved hypothetical protein [Cryptococcus neofornians var. neoformam JEC2I] 3’: MMS2, putative [Cryptococcus neoforsnans var. neofornians JEC2I) Expressed protein [Cryptococcus neoformans var. iseoformans JEC2I] Expressed protein [Cryptococcua neoformans var. nroformans JEC2I]  neoforinans JEC2IJ Sterol-binding protein ICryptococcus neoformans var. neofor,nans JEC2II  5’:  Conserved hypothetical protein [Cryptococcun neoformans var. neofonnant JEC2IJ 3’: Hexote transport-related protein, putative [Cryptocoecus neoforinans JECZI] 5’: Conserved hypothetical protein [Cryptococcss neofonnans ‘a neolbrmanslEC2l] 3’: hexosetransport-relatedpcotein, [Cryptococcus neoformam var. neolitrmans 5’. Conserved hypothetical protein [Cnjptococcus neofornians neofurmanaiEC2ll 3’: Hercone transport-related protein, putative [Cryptococcus neoformans var neofonnans JEC2II RNA helicase, putative ICryptococcus nrofonnans var.  Predicted Function”  RNA helicasr activity; GO_process: regulation of translation  5’: no GO terms 3’: GO_function: amidasr activity  no GO terms  activity  amidase activity  5’ no GO terms 3 GO function: amidase  5’: noGOtrmms 3. GO function:  (10 terms  no GO terms  nuclear port; GO_component. coplasm GO_function: structural constituent of nuclear pore; GO_process: protein-nucleus import  5’: no GO terms 3’: GO_component:  no GO terms  GO fuortin sterol carrier activity  GO_function:  5’: GO_component: membrane; GO_function: transporter activity; GO_process: transport 3’: GO_component:plaamamembrane;GO_fimnction:fructosetransportet activity; GO_function: glucose transporter activity; GO_function: mannose transporter activity; GO_process: hexose transport  membrane; GO_function: fructosetrasnportu activity; GO_function: ghicose transporter activity; GO function: mannose transporter activity; GO_process: hexose transport  GO_process: transport 3’: GO_consponent plasma  5’ GO_component: membrane; GO_function: transporter activity;  ,  GOCoISIPOnent membrane; GO_function: transporter activity; GO_process. transport 3’: GO_component: plasma membrane; GO_function: fructose transporter activity; GO_function: glucose transporter activity; GO_function: mannose transporter activity; GOproccss: hexose transport  Gene Ontology  -2.731  -1.117  -1.519  -1519  -1.519  R794  -1 429  -1 429  -1.273  -t 273  -1 273  -1.273  KE3864  Average LP  -2 912  -2.912  -2.912  -1.375  -1.504  -1.504  -1.504  KB7892  1.290  0.829  1.014  1.014  1.014  R794  1 246  1 246  0.980  0 980  0 980  0.980  KB3864  I 222  1.222  1.222  0.582  1.036  1.036  1.036  KB7892  Str”ard Deviat.” of LR  () C  —  H  CHR  area  5779- 11962  5349- 11018  -  -  -  -  2582  -  2582  5304- 5664  8906- 9456  l.50E+00  7.OOE-34  t.50E+00  XP_001220954.1  5’: AAW43040. 1; 3’: AAW43048. 1  XP_001220954.1  8906- 9456  7.OOE-34  5304-5664  681  5304-5664  681  681 -2582  1260303 1261723  1258495 1260109  12518421253917  1127161  1126049-  11230451125053  11212521122902  1127161  1126049  1125053  1123045-  Coordinates of Gene’  AAW43040. 1; 3’: AAW43048. 1  5’:  BAE55598.1  2440-  4.OOE-40  7.OOE-34  5’: AAW43040. 1; 3’: AAW43048. 1  4824-5732  5331  4.OOE-40  BAE55598.1  4066  85-  BAE55598.l  4.OOE-40  0.OOE-I00  0.OOE+00  85-2369  AAW42044.l  —  XI’ 775020.1  -  1257641 1263547  2.OOE-173  AAW44069.1  0.OOE+00  0.OOE+00  5’: AAW47162.1; 3’: AAW47164.1  AAW45598.l  -  0.OOE+00  2.OOE-l73  0.OOE+00  E-vahie  5’: AAW47162.l; 3’: AAW47164.I  AAW44069.I  3’: AAW47164.1  5’: AAW47162.l;  Protein Wa  1251693 1254172  11207321128027  the  describing  Coordinates  protein  var.  neoformans JEC2I]  neoforinans var.  globosum CBS_148.511  Hypothetical protein [Chaetomium  5’: Myo-inositol transporter, putative ICryptococcus neoformans var. neoformam JEC2I] 3’: Maltose O-acetyltransfernse, putative ICryptococcus neoformans var._neoformans JEC21]  globosum CBS_148.51]  Hypothetical protein (Cliaetomium  Myo-inositol transporter, putative [Cryptococcus neoformsns var. neoformans JEC2I] 3’: Maltose 0-acetyltransferase, putative ICryptococcus neoformans var._neoformans JEC21I  5’:  protein [Aspergillus_oryzae]  kinase activity  no GO terms  5’: GO_component: membrane; GO_function: myo-inositol transporter activity; GO_process: myo-inositol transport 3’: GO_function: maltose 0-acetyltransferase activity; GO_function: acetyltransferase activity  no GO terms  5’: GO_component: membrane; GO_function: myo-inositol transporter activity; GO_process: myo-inositol transport 3’: GO_function: maltose 0-acetyltransferase activity; GO_function: acetyltransferase activity  no GO terms  5’: GO_component: membrane; GO_function: myo-inositol transporter activity; GO_process: myo-inositol transport 3’: GO_function: maltose O-acetyltransferase activity; GO_function: acetyltransferase activity  noGOterms  Unnamed protein product; predicted protein_[Aspergillus_orynse]  terms  no GOternis  noGOterms  no GO  5’: Myo-inositol transporter, putative [Cryptococcus neofortnans var. neoformans JEC21] 3’: Maltose 0-acetyltransferase. putative [Ciyptococcns neoformans var. neoformans JEC21] Unnamed protein product; predicted  amidase activity  amidase activity  amidase activity  GO_component: mitochondrion; GO_function:  GO  5’ no GO terms 3’: GO function:  —  5’: no GO terms 3’: GO function:  noGOterms  —  5’ no GO terms 3’: GO function:  Gene Ontology  Unnamed protein product, predicted protein [Aspergillns oryzae]  neoformans JEC2II  Conserved hypothetical protein [Cryptococcus neoformans var.  Hypothetical protein (CNBFI83O) iiAlCryptococcusneoformans var._neoformans B-3SOlAl  (Cptococcus  Kinase, putative  Hypothetical protein [Cryptococcus neofornsans var. neoformans JEC2I]  3’: Amidase, putative [Cryptococcus neoformans var. neoformans JEC2II  5’: Hypothetical protein [Cryptococcus neoformans neoforinans JEC2I]  [Cryptococcus neoforinans var. neoformans JEC2I]  neoformans JEC21] 3’: Amidase, putative  neoformans JEC2I] 3’: Amidase, putative ICryptococcus neoformans var. neoformans JEC2I] Hypothetical protein ICryptococcus neoforinans var. neoformans JEC2I] 5’: Hypothetical protein (Cryptococcus neoformans var.  [Cryptococcus neofornians var.  5’: Hypothetical  Predicted Function  -0.826  -0.826  1 124  -3.338  —  -2.731  -2.731  R794  -0 855  0 855  0.923  -3.358  -1.89  -1.89  1.492  1.492  1.492  KB3864  Average LR  -3.393  0.855  KB7892  1 062  1.062  0 446  0.801  1.290  1.290  R794  0 784  0 784  0.368  1.190  1.069  1.069  0.392  0.392  0.392  KB3864  0.816  0.346  KB7892  Standard Deviation of LR  J  —  CBR  -  39222  528-  -  2182  166870  159765  159580166739  37071  Coordinates describing the area  3 00E-13  4.OOE-58  0.OOE+00  6.OOE-58  O.OOE-1-00  AAW40990.1; AAW40992.1  5’: AAW45261.1; 3’. AAW45262. 1  5’: AAW45261. 1; 3’ AAW45262. 1  5’: AAW45261. 1; 3’. AAW45262.1  AAW43233. I  AAW47218.  0.OOE+00  6.OOE-58  5’: AAW45261. 1; 3’. AAW45262. 1  I  0.OOE+00  5’: AAW45261. 1; 3’. AAW45262.1  5’: 3’:  4.OOE-58  3 00E43  5’: AAW45261. 1; 3’: AAW45262. 1  3’: AAW40992. 1  5’: AAW4099O.1;  -  -  -  -  1129-2643  166852167453  166108166356  164149165762  162578164069  160095 161212  166108 166356  164149165762  162578 164069  160095 161212  Expressed protein [Cryptococcus neoformans var. neoformans JEC2I]  var. neoformans JEC2I] 3’: Dihydrofolate synthase, putative [Cryptococcus neoformans var. neoformans JEC2IJ 5’: Specific transcriptional repressor, putative [Cryptococcus neoformans var. neoformans JEC2IJ 3’: Dihydrofolate synthase, putative [Cryptococcus neoformans var. neofornsans JEC21] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21I  neoformans JEC21J 5’. Specific transcriptional repressor, putative [Cryptococcus neoformans  var. neoformans JEC2I] 3’: Dihydrofolate synthsse, putative [Cryptococcus neoformans var.  neoformans JEC2I] 5’. Specific transcriptional repressor, putative [Cr ’ptococcus neoformans 3  [Cryptococcus neoformans var.  5’:  Sulfite transporter, putative [Cryptococcus neoforinans var. neoformam JEC2I] 3’: Conserved hypothetical protein  neoformans JEC2I]  ICryptococcus neoformans var.  3’. Dihydrofolate synthase, putative  var. neoformans JEC21J  5’. Specific transcriptional repressor, putative [Cryistococcus neoformano  neoformans JEC21]  [Cryptococcus neofornsans var.  5’: Specific transcriptional repressor. putative [Cryptococcus neoformans var. neoformans JEC2I] 3’. Dihydrofolate synthase, putative  var. neoformans JEC2I] 3’: Dihydrofolate synthase, putative [Cryptococcuo neoformans var. neoformans JEC21I  neoformans JEC2I] 3’: Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] 5’. Specific transcriptional repressor, putative LCr3’l,tococcus neoformano  transporter  GO_function: sulfite transporter  no  GO terms  GO_component cytosolic large ribosomal subunit (semu Eukaryota); GO_function: structural constituent of ribosome; GO_process: protein biosynthesis  promoter; GO_process DNA repair 3’: GO component cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: folic acid and derivative biosynthesis  5’: GO component: nucleus; GO_function: specific transcriptional repressor activity; GO_process: negative regulation of transcription from Pol II  5’: GO component: nucleus; GO_function: specific transcriptional repressor activity; GO_process: negative regulation of transcription from Pol U promoter; GO_process DNA repair 3’: GO component: cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: folic acid and derivative biosynthesis  activity; GO_process: negative regulation of transcription from Pot 11 promoter; GO_process DNA repair 3’ GO component: cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: folic acid and derivative biosynthesis  5’: GO component: nucleus; GO_function: specific transcriptional repressor  5’: GO component: plasma membrane; activity, GO_process: sulfite transport 3’: no GO terms  5’: GO component: nucleus; GO_function: specific transcriptional repressor activity; GO_process: negative regulation of transcription from Pol H promoter; GO_process: DNA repair 3’: GO component: cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: four acid and derivative biosynthesis  5’: GO component: nucleus; GO_function: specific transcriptional repressor activity; GO_process: negative regulation of transcription from Pol II promoter; GO_process DNA repair 3’: GO component: cytoplasm; GO_function: dihydrofolste synthase activity; GO_process: folic acid and derivative biosynthesis  promoter; GO_process DNA repair 3’: GO component: cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: folic acid and derivative biosynthesis  activity; GO_process: negative regulation of transcription from Pol II  5’: GO component nucleus; GO_function: specific transcriptional repressor  5’: GO component: plasma membrane; GO_function: sulfite activity; GO_process sulfite transport 3’ no GO ternis  no GO terms  38090  0.OOE+00 36824-  11802- 13276  0.OOE-I-00  AAW43796.1  AAW43246.l  no GO terms  Hypothetical protein [Cryptococcus neoformans var neoformans JEC2I]  E-value  Protein 1Db  Expressed protein (Cryptococcus neoformans var neoformans JEC2I] 5’: Sulfite transporter, putative [Cr3’Ptococcus neofurmans var.  Gene Ontology  Predicted Function’  Coordinates of Gene’  0.759  -2.433  -2 433  -2 433  -2 433  -2.433  R794  -2.877  -2.877  -2.877  -2.877  -0.912  -0 855  KB3864  Average LR  -2.507  -2.507  -2.507  -2.507  KB7892  0.387  1.421  1 421  1 421  1 421  1.421  R794  1.454  1.454  1.454  1.454  0.537  0 784  KB3864  1.448  1.448  1.448  1.448  KB7892  Standard Deviation of LR  3  CUR  -A  -  -  517602522613  509865514387  500355 522613  508097  500074-  401148  397860-  401148  397931  142501  138612-  25060 -26112  the  area  dtscnbmg  CoordLates  IDh  380563.1  —  I  Coordinates  -  25666  GENE  GENE  519077519265 520975522682  1.OOE-19  1.OOE-60  1.IOE-02  0.OOE+00  AAW44929.1  XP_776871. I  XP_519334.2  AAW43040.I  XP_519334.2  —  XP 569693.1  -  -  -  519077519265  l.IOE-02  -  516283518487  511223 511465  508626509732  511223  1.OOE-60  7.60E+00  516283 518487  9.40E-01  NP_001025060.1  XP_001686663.1  514427 515748  7,60E+00  XP_001686663. I  5.OOE-42  512159512506  5.OOE-42  AAW44931.1  AAW44931.1  508626 509132  3,60E-02  XP_001212098.1 -  503985505818  3,00E-110  AAW44841.1 502885  2,00E-122  502885 503985505818 500748501124 502404-  502404-  500748501724  500127  499384-  NO  NO  j443  141975-  141030  140140-  25421  of Gene’  AAW47211.1  3.60E.02  3.OOE-110  AAW44841.1  XP_001212098.  2.OOE-122  4.OOE-180  0.OOEt00  0.73  0.63  E-value  AAW47211.1  AAW44314.1  AAW46OSLI  XP  XP_820742. 1  Protein surfuce protein strain CLBrener] Conservedhypotheticalprotein [Gibherelh zeae PH-Il Cytoplasm protein, putative [Cryi*ococcus neofocinam var. neofurmaruJEC2II  Conserved hypotheticei protein (Ctyptococcusnroformainvar. neofurmazLtJECZIl Hypothrticalprotnhi[Cuyptococcus neofisrmans var. neoforinans JEC2II Hypotheticalprotein[Cryptococcus neoformans var. neofbrmans JEC2I] Conserved hypothetical protein EAspergillus teirmis N1H26241 Hypothetical protein ICryptococcun neoformain var. oeofornians JEC2I] Hypothetical protein [Cryptococcus neoforniana var. neofitrmans JEC2IJ Conserved hypothetical protein [AspergillusterreusNfll2624] Conserved hypothetical protein [Cuyptococcua neoformans var. neoformamjEC2ll Miiogen.activated protein kitmse-like proteiti[Leishmaniamajorstxain Friedlin] Hypothetical protein L0C207806 [Men musculusj Conserved hypothetical protein [Ciyptococcusneoformansvar. neoformana JEC2I) Protein coding [Cryptococcus neofotmanu var. neoformans B3501A] Inhibitor of growth family, member (Pan troglodytnil Myo-inositol transporter, putative [Cryptococcus neoformam var. neoformam JEC2I] Conserved hypothecical protein [Cryptococcus neofurmam var. neoforniain JEC2II Mitogen-activated protein kinase-like protein [Lcishmanio major strain Friedlin] Monooxygensse protein, putative ICuyptococcus neoformam var. neoformamJEC2lj Inhibitor of growth family, member 3 [Pan troglodytesi  (MASP) [Trypanosoma cruzi  Mucin-associaled  Predicted Function’  Go terms  Go terms  cytoplasm  no Go terms  no Go terms  no Go terms  no Go terms  GO_component: membrane; GO_function: myo-inouitol transporter activity; GQprocess: myo-inositol transport  no Go terms  no Go terms  noGoterms  GO_component=membrane; GO_ftmction=calcium ion binding;mannosyloligosaccharide 1,2-auha-niannosidase activity  noGOternis  no Go tecins  no  no  Go t  noGOternis  noGoteino  noGOteims  noGOterno  GOcomponeu8  no GO terms  Gone Ontology  -3.256  -3.256  -2.939  -2.939  -3 313  -3,313  -3.313  -3.313  -3.313  -3,313  -3.313  0.913  -3.094  0.966  0.966  0.913  1.278  1.278  1.278  1.278  1.278  1.278  1.278  1.278  1.278 -3.313 -3.3 13  1.278  0,767  0.763  0763  KB3864  0.878  0.878  1.317  1.317  1.317  1.317  0.695  K87892  Deviat,o. of LR  -3 313  -3.094  1.278  1.278 -2.153  .2.153 -2,125  -2.125  1.278  0.694  0.689  R794  1.278  -2.153  -1.330  KB7892  -2,153  -1.558  0.965  0.965  KB3864  Standard  -2.125  -2.125  -1.345  -1.002  R794  Average LR  IC  —  J  CHR  701894703601  -  -  981613984146  972369  970308  954099955g49  950788953515  836131  834678  -  0.OOE+00  0.OOE+00  AAW46256.l  0.OOE+00  5.OOE-150  0.000+00  AAW46258.t  AAW46239. I  AAW4607O.l  AAW46213.l  5:AAW46O71.l;  3’:  985684  983787-  979852981630  971244  968524-  955317956391  950942  949533-  GENE  1.000-168  AAW46268. 1  NO  703336704286  -  -  80001  0.OOE+00  631915 634761  78463  80001  80001  AAW46269. I  0.OOE+00  -  78463-  79463  5263-7390  700768 703073  I  AAW46216.  630573 632070  -  -  AAW46247. 1  79677 80970  0.000+00  0.OOE+00  AAW46247.l  80421  79677-  0.000+00  2.OOE-05  XP_383692.l  AAW46247,t  -  3109-4215  0.000+00  7390  AAW45743.1  -  5263  2.OOE-05  3109-4215  XP_383692. 1  0.OOE+00  AAW43040.1  zeae  GO  telms  GO  GO  GO  GO  terms  terms  terms  terms  myo-inositol transporter activity;  transporter activity;  var. neoformans  JEC2I]  Acsenite transporter, putative [Cryptococcus neoformans var neoformans JEC2II  neoformans JEC2I]  [Cryptococcus neofortnans var.  Beta-frtsctofuranosidase, putative  Conserved hypothetical protein ECryptococcus neoformans var. neofominnsJEC2l]  neoformans  Hypotheticalprotein[Cryptococcus  Expressed protein [Cryptococcus neoformans var. neoforniasu JEC21] 3’: Tubulin gamma chain(Gamma tubulin), putative [Cryptococcus neoformans var. neoformans JEC2I] 5’:  teons body; GO_component: outer  GO  terms  GO_component: integral to plasma membrane; GO_function: arsenite transporter activity; GO_process: arsenite transport  GO_component: extracellular region; GO_component: cytoplasm; GO_function: heta-fructofisranosidase activity; GO_process: sucrose catabolism  no  noGOt  plaque of spindle pole body; GO_function structural constituent of cytoskeleton; GO_peocess: mitotic spindle assembly (sensu Saccharomyces); GO_process microtubule nucleation  3’: GO_component: inner plaque of spindle pole  5’: no GO  GO_component: membrane; GO_function: v-SNARE activity; GO_process: intra-Golgi transport; GO_process: vesicle fusion  terms  no  Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  GO  GO_component: nucleus; GO function: transcription factor activity; GO_process: regulation of transcription, DNA-dependent; GO_process: uracil biosynthesis  no  no  no  no  noGOterms  no  noGOtenns  GO_component membrane; GO_function: GO_process: myo-inositol transport  not3Oternis  noGOterms  GO_component: membrane; GO_function: myo-inositol myo-mositol transport  GO_process:  Gene Ontology  Expressed protein [Cryptococcun neofortnans var. neoformans JEC21]  Hypothetical protein [Cryptococcus neofornsnns var. neoformam JEC2I]  neoformsns JEC2I]  (Cryptococcus neoformatis var. neoformans JEC21] Conserved hypotlsutical protein [Cryptococcus neofortnans var. neoformans JEC2I] Conserved hypothetical protein [Cryptococcus neoformans var.  Conserved hypothetical protein  Hypothetical protem (Gibberella PH-I]  hypothetical protein [Cryptococcusneoformansvar. neoformans JEC2I]  Conserved  PH-I]  Conserved hypothetical protein [Cryptococcusneofonstansvar. neofonnans JEC21I Hypothetical protein [Gibberella zeae  IPan troglodytes] Myo-mositol transporter, putative [Cryptococcus neoformam ‘ar neoformans JEC2I]  -  519265 520975 522682  lnltibitorofgrowthfamily,meinber3  [Cryptococcusneoformansvar. neofomsans JEC2I]  Monooxygenase protem, putative  Myo-inositol  transporter, putative [Cryptococcus neoformans neofonnans JEC2I]  Predicted Punctiond  519077-  -  0,000+00  1.IOE-02  XP_519334.2  516283 518487  520975 522682  -  Coordinates of Gene’  AAW45743.1  I.OOE-60  O.OOE+00  AAW43040.1  XP_569693.1  value  Protein 1Db  803t I  79677  2890-7786  2890-6447  5181 14522613  describing the are?  Coordinates  -0.652  0411  -3.161  -2.431  -1289  -1.289  —  -3.256  R794  -2.171  -2.171  -3.393  -0.922  -0.915  -0 915  -1.084  -1.729  -2.650  -2.650  KB3864  Average LR  -3.194  -2.216  .1.681  -1.681  -3.409  .3409  -3.409  KB7892  0.521  0328  0.068  0994  1.333  1.333  0.966  R794  -  Deviation  137  624  0.955  0.955  1.245  0602  0624  0  0.784  1  1.518  1.518  KB3864  Standard  0.995  1.206  1.373  1.373  0.89  089  089  KB7892  of LR  L  —  K  dR  15839- 27285  -  15743 25857  4185- 12121  4185- 12209  995930  995104-  the area  describing  Coordinates  AAW47184.l,  -5300  4.000-16  5’ A.AW47184.l; AAW47191.t  13808 16468 17836- 19747  23929- 25427 13108- 16468 17836- 19747  0.OOE+00  3.OOE-23  3.000-44  0.000+00  2.OOE-04  0.000+00  3.OOE-23  3.OOE-44  AAW43392. I  XP_660562.1  1. AAW46844. 1, 2. AAW46973.l  5’: AAW43751.l; 3’: AAW43753. I  XP_001546302.l  AAW43392.1  XP_660562. 1  1. AAW46844. I; 2. AAW46973. 1 21235- 22150  -  22505 23568  21235-22150  -  13163  12051  0.000+00  AAW43772. I -  9817- 11296  0.OOE+O0  6245- 9139  AAW41727 I  3’:  2421 -5300  0.000-tOO  AAW43794.t  13163  12051  0.OOE+00  AAW43772. I -  9817- 11296  6245- 9139  2421  NO GENE  of Gene’  0.OOE+00  4.OOE-16  0.000+00  I-valne  AAW41727. 1  3’: AAW47191.1  5’:  AAW43794.1  Protein 1Db  Coordinates  teems  fuckelinna B05. 101 neoformam var.  Hypothetical protein [Aspergillus nidulans FGSC A4] 1. Expressed protein [Cryptococcas neoformans var. neoformans JEC2I] 2. Hypothetical protein [Cryptococcus neoformans var. neoformans JEC21]  neoformansjEC2l]  [Cryptococcus  Transketolase, putative  [Botryotinia  L-arabinitol 4_dehydrogeause  Conserved  hypothetical protein [Cryptococcun neoformans var. neoformans JEC2IJ Transketolase, putative [Cryptococcas neoformaas var. neoformam JEC21] Hypothetical protem [Aspergillus nidulans FGSC A41 1. Expressed protein (Cryptococcat neoformans var. neoformsns JEC2IJ 2. Hypothetical protein [Cryptococcus neoformans var. neofornssns JEC2t] 5’: GO_component: mitochondrinl matrix, GO_process. tron ion transport 3’: no GO terms  neoformans JECZJ]  [Cryptococcus neoformans var.  Oxidoreductase, putative  Conserved hypothetical protein [Cryptococcus neoformans var. neoforntans JEC2IJ 5’: Expressed protein [Cryptococcus neoformans var. neoformans JEC2IJ 3’: Epoxide hydrolase I, putative [Cryptococcus neoformans var. neoformans JEC2II  GO_process:  cytoplasm,  no  GOternis  no GO terms  peatose-phosphate shunt  GO_component.  no GO terms GO_function.  transketolase activity; GO_process.  Lii  -1 687  -1.913  -1.913  0 798  0.798  0.798  0.798  0.980  0.980  0.980  0.980  0.899  0.899  0.899  0.975  0.975  0 975  0.975  KB3864  1.000  1.000  1.000  1.000  0.588  KB7892  Standard Deviation of LR  R794  -1.687  -1.809  -1.809  -1.809  -1.809  -1.245  KB7892  0.798  -1.913  -2.223  -2,223  -2.223  -2.223  KB3864  Average  -1.687  -1.687  activity;  5’: Iron ion transport-related protein, putative [Ciyptococcus neofornians var. neoformans JEC2I] 3’: Conserved hypothetical protein [Cryptococcus neoformans vat. neoformans JEC2I]  transketolase  -1.687  GO_function:  -1.801  -1.801  -1.801  -1.801  R794  noGOterms  no GO terms  pentose-phosphete shunt  GO_component: cytoplasm;  nucleus; GO_component: cytoplasm; GO_function: aldehyde reductase activity; GO_function: aldo-keto reductase activity; GO_function oxidoreductase activity; GO_process arabiaose metabolism; GO_process 1)xylose metabolism GO_component: peroxisomal matrix; GO_function: 2,4-dienoyl-C0A reductase (NADPH) activity; GO_process: sporulation (sensu Saccharomyces); GO process: fatty acid catabolism GO_component:  no GO terms  no GO terms  Saccltaromyces); GO process: fatty acid catabolism  neoformans JEC2I]  [Cryptococcus neoformans var. neofonnans JEC2IJ  Oxidoreduciase,  Conserved hypothetical protein ICryptococcus neoformans var.  reductase  no GO  noGOteerns  Gene Ontology  GO_component: nucleus; GO_component. cytoplasm; GO_function: aldehyde activity; GO_function: aldo-keto reductase activity; GO_function: oxidoreductase activity; GO_process: arabinose metabolism; GO_proctss: D xylose metabolism GO_component: peroxisomal matrix; GO function: 2,4-dienoyl-CoA reductase (NADPH) activity; GO_process: sporulation (sensu  Conservtd hypothetical protein [Cryptococcusneoformansvar. neoformans JEC2I] 5’: Expressed protein [Cryptococcus neoformans var. neofonnans JEC2I] 3’: Epoxide hydrolase 1, putative [Cryptococcus neofonnatm var. neoformans JEC2IJ  Predicted Functions  M  —  CUR  -  61838  18324- 36715  59295  37292- 39182  16163- 25857  the_area’  describing  Coordinates  OOE+00  0.OOE+00  0.OOE+00  5’: AAW4S 165.1; 3’: AAW45 164.1  AAW46097.l AAW46098.1  16468  25427  -  -  39905  8.OOE-02  2.OOE-28  ABWIO7O5.l  5’: 3’:  AAW46837.1  8,00E-lll  7.30E-0l  AB381358.l  AAW44720. 1; AAW44723. I  OOE+00  0  AAW43042.l  33617- 34087  29416- 30801  27772-28944  25457  22289- 22869  0.OOE+00  AAW46863.l  24567-  18755- 20636  0.OOE+00 16509-18440  871735  8380t6  38283  34423- 37475  23929- 25427  22505- 23568  21235- 22150  17836- 19747  13808-  23929-  22505 -23568  Coordinates of Gene’  AAW46868.l  I. 2.  0.00E+00  2.OOE-04  0  3.OOE-44  AAW43736.1  XP_00l546302.1  3’: AAW43753.t  5’: AAW43751.1;  2. AAW46973. 1  AAW46844. I;  3.OOE-23  XP_660562. I  1.  0.OOE+00  2.OOE-04  XP_001 546302.1  AAW43392.l  O.OOE+O0  E-valne  AAW43751. 1; 3’: AAW43753. 1  5’:  Protein fl)  L-arabinitol4-dehydrogenase  [Asptrgillus  no  GOtei-ms  GO terms  5’:  var.  neoformans  Hypothetical protein [Cryptococcus var._neoformans JEC2IJ  var. neoformans JEC2IJ 3’: hypothetical protein (Cryptococcus neoformans neoformans JEC21I  terms  GO terms  GO  terms  lENA  (5-methylaminomethyl-  35S  no  GO terms  GO_component, cytoplasm; GO_component: cAMP-dependent protein kinase complex; GO_function: protein serine/threonine kinase nctivlty; GO_function: cAMP-dependent protein kinnse activity; GO_process: protein amino ncid phosphorylation; GO_process: pseudohyphal growth; GO_process: Ras protein signal transduction 3’: no GO terms  no  no  no GO  2-thiouridylate)-methyltransferase activity  5”  cAMP-dependent protein kinase, putative [Cryptococcus neoformans  GO terms  GO_component: mitochondrion; GO_function:  no  1. no GO tenns 2. GO_component: nucleus; GO_component: cytoplasm; GO_process: primary transcript processing  5’: no GO terms 3’: GO_component: nucleus; GO_component: cytoplasm; GO_function: branched-chain-amino-acid transaminase activity; GO_process: amino acid catabolism; GO_process: branched chain fumily amino acid biosynthesis  Putative DNA-binding protein [Frankia ip. EANipec]  E11in6076]  putative [Cryptococcus neoformans var. neoformans JEC2I] Hypothetical protein [Cryptococcus neoformans var._neoformans JEC2I] Gut protein [Solibacter usitatus  thiouridylnte)-methyltransferuse,  Expressed protein [Cryptococcus neoformam var._neoformans JEC2II tRNA (5-methylaminomethyl-2-  [Cryptococcus neoformans var. neoformans JEC2I]  related protein, putative  ICryptococcus neoformatin var. neofonnans JEC21J 2. 35S primary transcript processing-  I. Hypothetical protein  neofonnam JEC2IJ 3’: branched-chain-amino-acid transaminase, putative [Cryptococcus neoformans var. neoformans JEC2I]  L-arabinitol4-dehydrogenase [Botryotinia_fuckelinna B05_10] Expressed protein [Cryptococcus neoformans var. neoforntans )EC2I] 5’: Hypothetical protein [Cryptococcus neoforinans var.  3’: no GO terms  GO te  5’: Iron ion transport-related protein,  iron ion 3’:  matrix;  GO_process: transport  putative [Cryptococcus neoformans var. neofommaasJEC2l] Conserved hypothetical protein [Cryptococcus neoforinans var. neoformans JEC21]  noGOterms  no  pentose-phosphate shunt  GO_com s 1 onent. c’toplasm, GO_function. transketolase activity; GO_process:  5’: GO_component: mitochondrial  neoformans var._neoformans JEC2I]  2. Hypothetical protein [Cryptococcus  1.  Expressed protein [Cryptococcus neoformans var. neoformans JEC21J  nidulans FGSC_A4]  Hypothetical protein  neoformans IEC2I]  [Cryptococcus neofornians var.  IBotryotinia flickeliana BOS. 10] Transketolase, putative  neoformansiEC2l]  neoformans JEC2I] 3’: Conserved hypothetical protein [Cryptococcus neofornians vat.  matrix; GO_process: iron ion transport 3’: noGOttrms  Gene Ontology 5’: Iron ion transport-related protein, putative [Cryptococcus neoformans var.  Pnnction”  5’: GO_component: mitochondrial  Predicted  R794  -2.737  -2.737  -2 737  -2.737  -2.737  -2.737  -2.737  -0.880  0.767  0.767  -1.913  -1913  KB3864  Average LR  -1.726  -1.726  -1.726  -1.726  -1.726  KB7892 R794  1.363  1.363  1 363  1.363  1.363  1.363  1.363  0.436  0.317  0.317  0.899  0.899  KB3864  0.776  0.776  0.776  0.776  0.776  KB7892  Standard Deviation of LR  N  —  M  CUR  -  -  676244678906  674728678906  674609678906  106766109310  299522301468  109185 136312  109185 112141  Co.rdiaates descaibing the area’  0.OOE+00  0.OOE+00  AAW45902.1  AAW43760.1  676799678780  0.OOE+00  AAW43760.l  676799678780  673986676134  673986676134  676799678780  673986676134  0.OOE+00  0.OOE+00  AAW43760.1  -  -  -  109109113874  108148 108690  106413 107313  300993 301982  -  -  -  297357 299686 299979300599  110385 110657  110385 110657  36367- 39520  34680- 36185  AAW45902.l  0.OOE+00  0.OOE+00  AAW47047. I  AAW45902.1  3.OOE-l5  5’: AAW47045.l; 3’: AAW47047. I  0.OOE+00  AAW46764.1  l.00E-55  2.OOE-62  AAW46916.1  5’: AAW47045.l; 3’: AAW47047.1  4.OOE-l67  2.OOE-21  AAW46778.1  5’: AAW42139. I; 3’ AAW42141 1  2.OOE-2l  0.OOE+00  AAW46862.1  5’: AAW42139. I; 3’ AAW42141 I  0.OOE+00  E-value  AAW46864.1  Protein li)  Coordinates of Gene’  5’: Expressed protein [Cryptococcus neoformans var. neoformans JEC2I] 3’. Conserved hypothetical protein (Cryptococcus neoformans var. neoformam_JEC2I) 5’: Expressed protein (Cryptococcus neoformass var. neoformans JEC2I] 3’: Conserved hypothetical protein fCryptococcus neoformans var. ncoformans JEC2II Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] Hexose transport-related protein, putative [Cryptococcus neoformans var. neoformans JEC21( Hypothetical protein [Cryptococcus neofornsana var. neoformans JEC2I] Hexose transport-related protein, putative [Cryptococcus neoformans var. neoformans JEC21I Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] Hexose transport-related protein, putative (Cryptococcus neoformans var. neoformans JEC21] Hypothetical protein [Cryptococeus neoformans var. neoformans JEC2II  Hypothetical protein (Cryptococcus neoformans var. neoformans JEC2I] Hypothetical protein tCryptococcus neoformans var. neoformans JEC2I] 5’: Conserved hypothetical protein (Cryptococcus neoformans var. neoformana JEC2I] 3’ Conserved hypothetical protein [Cryptococcus neoformans neoformnns JEC2I] 5’: Conserved hypothetical protein [Cryptococcus neoformans var. neofornsans JEC2I] 3’ Conserved hypothetical protein [Cryptococcus neofornians var neoformuns JEC2I] Hypothetical protein [Cryptococcus neofonnana var. neoformans JEC2I] Expressed protein [Cryptococcus neoforsnans var. neoformans JEC2I] Sterol metabolism-related protein, putative [Cryptococcus neoformans var. neoformans JEC21]  Predicted Fanctiond  no GO te  GO_component: plasma membrane; GO_function: fructose transporter activity; GO_function: glucose transporter activity; GO_function: mannose transporter activity; GOproceas: hexose traasport  no GO terms  GO_component: plasma membrane; GO_function: fructose transporter activity; GO_function: glucose transporter activity; GO_function: mannoae transporter activity; GO_process: hexose transport  no GO te  -1.568  -1 888  -1.888  GO_component: plasms membrane; GO_function: fructose transporter activity; GO_function: glucose transporter activity; GO_function: msnnose transporter activity: GO process: hexose transport  -0.913  -0.913  -1.568  -0.854  -0.854  GO_component: cytoplasm; GO_function: protein kinase activity  5’: no GO terms 3’: GO_component: cytoplasm; GO_function: protein kinase activity  5’: noGOterms 3’: GO_component: cytoplasm: GO_function: protein kinase activity  GO_component: membrane; GO_process: sterol metabolism  no GO tm-ms  noGOterms  -0.913  -1.410  5’: GO_component: soluble fraction; GO_function: chaperone activity; GO_flsnctlofl. cysteine-type peptidase activity 3’: GO_component: nucleus; GO_component: cytosol; GO_function: protein kinane activity; GO_function: nucleocytoplasmic transporter activity; GO_process: processing of 20S pre-rRNA  -0.854  -2 737  5’: GO_component: soluble fraction; GO_function: chaperone activity; GO_function. cysteme-type peptidase activity 3’: GO_component: nucleus; GO_component: cytonol; GO_function: protein kinase activity; GO_function: nucleocytoplasmic transporter activity: GO_process: processing of 20S pre-rRNA  -2.737  KB3864  GO_component: small nucleolar ribonucleoprotein complex; GO_function: snoRNA binding; GO process: processing of 20S pre-rRNA  -1.411  R794  no GO terms  Gene Ontology  Average LR  -1.875  -1.875  -0.997  -0.997  -0.997  -1 413  KB7892  0.941  0.941  0.484  0.484  0.484  0.896  R794  0 929  0.929  0.632  0.632  0.632  0.962  1 363  1.363  KB3864  1.229  1.229  0.507  0.507  0.507  0.888  KB7892  Standard Deviation of LR  A  10501  0  0  AAW41688. 1  AAW42OIO. 1  -  12772391278637  970602971529  842647 843820  0.OOE+00  0.OOE+00  AAW41O26.1  0,00E+O0  AAW40952. I  AAW41024.1  840230 842847  9.OOE132  AAW40950. I  -  -  NO GENE  -  969970702  842958 844970  578385 580438  1.OOE142  XP_777290.1  -  577416578078  5.OOE-20  5’: AAW4I 609.1; 3’:AAW4I6IO.1  575519 576539  0  AAW4161O.1  577090580492  11527  NO GENE  -  6277  591  E-value  Protein ID  -  Coordinates of Gene  556719557704  10516  455  CHR  -  Coordinates descnbing the area  Actin [Cryptococcus neoformans var. neoformans JEC21]  [Cryptococcusneoformansvar. neoformans JEC21] 5’: Conserved hypothetical protein [Cryptococcus neoformam var. neoformans JEC2I]; 3’: SAR small monomeric GTPase, putative [Cryptococcus neoformans var. neoformans JEC2I] Hypothetical protein ICryptococcus neoformans var. neoformons B-350l A] ER organization and biogenesis-related protein, putative (Cryptococcus neoformam var neoformass JEC2I] Type 2C Protein Phosphatase, putative [Cryptococcus neoformam var. neoformans JEC2I] RPN1O-like protein, putative [Cryptococcus neoformans var. neoformans JEC21I GO_component: proteasome regulatory particle (semu Eukaryota); GO_function: endopeptidase activity; GO_process: ubiquitin.dependent protein catabolism GO_component: histone acetyltransferase complex; GO_component: actin cable (semu Saccharomyces); GO_component: contractile ring (sensu Saccharomyces); GO_component: actin cortical patch (sensu Saccharomyces); GO_component: actin filament; GO_function: structural constituent of cytoskeleton; GO_process: mitochondrion inheritance; GO_process: vacuole inheritance; GO_process: establishment of cell polarity (seusu Saccharomyces); GO_process: cytokinesis; GO_process: regulation of transcription from PolE promoter; GO_process: exocytosis; GO_process: endocytosis; GO_process: response to osmotic stress; GO_process: cell wall organization and biogenesis; GO_process: budding cell apical bud growth; GO_process: budding cell isotropic bud growth; GO_process: sporulation (seusu Saccharomyces); GO_process: protein secretion; GO_process: histone acetylation; GO_process: actin filament reorganization daring cell cycle; GO_process: vesicle transport along actin filament; GO_process: mitotic spindle orientation (semu  -0.938  -0 938  GO_function: protein phosphatase type 2C activity  -0.930  GO_component: endoplasmic reticulum membrane; GO_process: ER organization and biogenesis  -0.930  5’ no GO tenns 3’: GO_component: COPE vesicle coat; GO_function: SAR small monomeric GTPase activity; GO_process: ER to Golgi transport  no GO terms  -0.930  2.179  2.179  rn  0.666  0 666  0.719  0.719  0.719  0.871  -1.275  RV66095  1.224  E566  1.309  1.309  WM276 GFPI  Stans!”rd deviatip of LR  0.871  -2.240  E566  WM276 GFP2  .1.275  RV66095  GO component: COPE vesicle coat; GO_function: SAR small monomeric GTPase activity; GO_process: ER to Golgi transport  GO_component: plasma membrane; GO_function: xenobiotic transporting ATPase activity; GO_process: drug transport; GO_process: response to drug” GO_component: peroxisomal matrix, GO_function: 2,4.dienoyl-C0A reductase (NADPH) activity; GO_process: sporulation (semu Saccharomycea); GO Jirocess: fatty acid catabolism  Xenobiotic-transporting ATPase, putative [Cryptococcus neoformam var. neoformam JEC2I] Glucose 1-dehydrogenase, putative [Cryptococcus neoformam var. neoformam JEC2II  SAR small monomeric GTPase, putative  Gene Ontology  Predicted Function  Average LR  Table B.1 Regions of difference in the genomes of three serotype B strains compared with the sequenced genome of strain WM276. Regions of difference that overlap are in the same colour. The first column indicates the chromosome (CHR) number. aNucleotide coordinates of the segment identified by CGH. bGe ID of top BLASTn. The E-value of the BLAST result is included in the following column. cCoordinates of the specific gene in the segment identified by CGH. dFunctional information about the top BLAST hit. The GO ontology is included in the following column.  B  CHIt  00  21773232186552  -2.451  5’: hst3 protein, putative 3’. Transcriptional activator gunS, putative [Cryptococcus neoformam var. neofonnana JEC2IJ  -  2179351 21 801 79  0,00E+00  ,,  AAW40943.1; 3’: AAW40830.1  1.053  -2.451  21842902187330  1053  GO_component nucleus; GO_flsnctioa transcription factor activity; GO_process: carbohydrate metabolians; GO_process: regulation of transcription, DNA-dependent  1.053  noGOternn  no GO teems  5’: GO_component: nucleus; GO_function: DNA binding; GO_process: chroniatin silencing at telomere; GO_process: short-chain fatty acid metabohem 3’: GO_component: SAGA complex; GO_component: Ada2/Gcn5/Ada3 transcription activator complex; GO_flmctioa histone acetyltransfeeaae activity; GO_process: chromatin modification; GO_process: hntone acetylation  0,00E4’OO  AAW4270t,1  Hypothetical protein [Crypeococcus neofosnians var. neofornians JEC2I)  2183160  2181919-  5’: Expressed protein FCryptococcus neofommant var. neoformans JEC2IJ; 3’: Epoxide hydrolase 1, putative [Cryptococcus neofoemam var. neofoemarnJEC2ll Expreasedprotein[Ciyptoooccua neofoernans var. neofornians JEC2I]  1.053  noGOtenns  0.OOE-I-00  AAW4I4IO.1  21810532181765  5’: bst3 protein, putative 3’: Transcriptional activator gunS, pUtative [Ciyptococcus neoformans var. neoformam JEC2I]  5’: GO_component nucleus; GO_function DNA binding; GO_process: chromatin silencing at telomere; GO_process: abort-chain fatty acid metabolum 3’: GO_component: SAGA complex; GO_component: Ada2/GcnS/Ada3 transcription activator complex; GO_function: histone acetyltransferaae activity; GO_process: rbromatin modification; GO_process: bistone acetylation  Hypotheticalprotein[Cryptococcus neoformacavar. cieoformanaiEC2ll  2.00€153  5’: AAW47I 84. 1; 3’: AAW47I 91.1  21793512180179  1053  noGOterms  21767602178061  0.OOE+00  5’: AAW40943.1; 3’: AAW40830.1  21767602178061  -1.542  Glucose transporter. putative 000cdis njn ‘a neoforsnana JEC2t]  noGOterms  0.758  GO_component: plasma membrane; GO_function: receptor activity; GO_function: glucose transporter activity; GO_function: glucose GO_process: binding; GO_peocess: mpnal transduction; response to glucose stimulus  5’: Conserved hypothetical protein [Cryptococcus neoformans var. neoformsnsiEC2l] 3’: MMS2, putative [Cryptococcus neofonnass var. neoformans JEC2I] Hypotlteticalproeein[Cryptococcus neofhnnain var. neofurmans JEC2I]  -1.092  noGOternis  -1.092  GO_component: nucleus; GO_component: cytoplasm; GO_function: transcription factor activity; GO_process: transcription; GO_process: response to oxidative stress; GO_process: response to drug  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  neoformans var. neoformans JEC2I]  Hypothetical protem [Cryptococcus  -3 t48  no GO  -3.148  -J 938  1.239  1,239  0.708  0.473  0.711  0.711  0 8t7  0.817  0.765  1.704  -2592  GO terms  1.704  0,350  0.350  0.350  0.350  0350  €566  WM276 GFPZ  Stand’d deviativ— of LR RV66095  1.704  WM276 GFP2  -2.592  -2.592  RV66095  €566  Average LR  GO te  no GO tenns  n/a  ,  GO_component: nucleus; GO_flinctioir tla,ncription factor activity; GO_pra’ carbohydrate metabolism; GO_process: regulation of transcription, DNA-dependent  Gene Ontology  0.OOE+00  0,00E4’OO  AAW45167.t  21761402182562  12389321240917  10220941023873  597496  594209-  -  Expressed protein [Cryptococcus neofommans var. neoformana JEC2IJ EXptOS5Cd protein [C000ccus neofoemain var. neoformans JEC2I} CryptococcusgattiistrainE56tiMATa locus, complete sequence, NO GENE Hypothetical protein peococcus neofoenians var. neoformans B-3501A) NADH dehydrogenase subunits [mitochondrion Cryptococcus neolnain var. gzubii (Filobesidiella neoformans serotypeA)  Hypothetical protein [CryptococcUs nirians var. neoformam JEC2IJ  Predicted Function  AAW45167. I  0.OOE+00  5’: AAW45247.1; 3’: AAW45026. 1  12385601242125  t023974  0.OOE+00  0.OOE+00  AAW41330.1  591755 593909  1,00E-7l  0.OOE+00  349703 349906  5,00E-65 -  347984348208  175  AAW40804.1  AAN37584.1  -  XP 778123.1  AY710429  6832- 8624  5.OOE-  0.00E+00  6353  AAW40616.1  -  5111  0.OOE+00  AAW4I4IO. I  -  933 3973  Gene  0.00E400  E-value  Coordinates of  AAW427OL. 1  Protein ID  AAW41548.l  1021522-  593872594393  349505  290365 348410-  288716-  1656- 6936  area  Coordinates describing the  —  C  —  B  CHR  -  19603191961455  AAW44498. I  3.OOE-42  19608761961099  NO GENE  AAW46799.1  1111893 1115462  I .OOE109  930192934166  AAW42287. I  934053934127  0.OOE+00  NO GENE  730860732715  622428624977  540316. 542317  539818540195  37l136 372424  -  -  147225 148515 368514369632 369698 370854  824830825427  0.OOE+00  AAW42213.t  732225 733561  -  0.OOE+00  5’: AAW45165.l; 3’: AAW45164.t  AAW42650. 1  619942625162  6 OOE137  3.OOE-98  0.OOE-t-00  AAW42127. I  5’: AAW42216.l 3” AAW42218 1  0.00E+00  AAW42125.1  1.OOE-38  8.OOE-66  AAW42623.l  Conserved hypothettcal protein [Cryptococcus neoformans var. neoformans JEC2I]  Hypothetical protein ICryptococcus neoformans var neoformass JECZU  All dependent helicase, putative 5 [Cryptococcus neoformana var. neoformans JEC2I]  -  5’: Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] 3’: Branched-chain-amino-acid ttansamsnase, putative [CtyptococcuS neoformans var neoformans JEC2I] Nuclear matrix protein NMP200, putative (Ctyptococcus neoformans var. neoformans JEC2IJ  5’: Hypothetical protein IClyptococcus neoformans var. neoformans JEC2I] 3’: Cdc2 cyclin-dependent kinase, putative (Cryptococeuo neoformans var. neoformans JEC2IJ  5’: Hypothetical protein [Cryptococcus neoformans var. neofornians JEC2II 3’: Cdc2 cyclin-depeodentkinase, putative [Cryptococcus neoforninns var. neoformam JEC2I]  Hypothetical protein [Cryptococcus neoformansvar. neoformansiEC2tl Hypothetical protein [Cryptococous neofornsans var. neoformans JEC2I) Hypothetical protein [Cryptococcus neofotmans var. neoibrmans JEC2I] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  0.OOE+00  AAW42701 .1  Hypothetical protein (Cryptococcus neoformans var neoformans JEC2I]  21842902187330  21810532181765 21819192183160  AAW4I4IO.1  Predicted Function  0.OOE+00  2.OOE153  5’: AAW47184.l; 3’: AAW47191.l  Coordinates of Gene 5’: Expressed protein ICryptococcus neoformans var. neoformans JEC2I); 3. Epoxide hydrolase 1, putative ICryptococcus neoformans var. neoformans JEC2I] Expressed protein [Cryptococcus neoformans var. neoformans JEC2I]  E-value  Protein ID  5’ AAW42216.l 3” AAW4Z2IS 1  539282541643  -  148344 149132 369450372034  Coordinates describing the area  GO_component: nucleus; GO_component: cytoplasm  GO_component: cytoplasm; GO_component: polysome, GO_function nucleic acid binding; GO_function: ATP-dtpendent helicase activity; GO_function: ATPase activity, GO_process: RNA catabolism, nonsense-mediated decay; GO_process: mRNA catabolism; GO_process:_regulation of translational termination 5’: GO_component: cytoplasm; GO_function: formaldehyde dehydrogenase glutathione)activity; GO_process: formaldehyde assimilation  5’: noGOterms 3’: GO_component: nucleus; GO_component: cytoplasm, GO_function: cyclin-dependent protein kinase activity; GO_process: regulation of cell cycle; GO_process: Cit/S transitionof mitoticcell cycle; GO_process: S phase of mitotic cell cycle; GO_process: 02/let transition of mitotic cell cycle; GO_process: protein amino acid phosphorylation; GO_process: regulation of meiosis 5’: noGOtertns 3’: GO_component. nucleus; GO_component: cytoplasm; GO_function: cyclin-dependent protein kinase activity; GO_process: regulation of cell cycle; GO_process: Cit/S transition of mitotic cell cycle; GO_process: S phase of mitotic cell cycle; GO_process: G2/M transition of mitotic cell cycle; GO_process: protein amino acid phosphorylation; GO_process: regulation_of meiosis 5’: no GO terms 3’: GO_component: nucleus, GO_component: cytoplasm; GO_function: branched-chain-amino-acid transaminase activity; GO_process: amino acid catabolism; GO_process: branched chain family amino acid biosynthesis GO_component: nucleus; GO_component: npliceosome complex; GO_component: cytoplasm; GO_function: pee-mRNA splicing factor activity; GO process: nuclear inRNA splicing, yin spliceosome  no GO terms  no GO terms  no GO terms  -3.561  -0.993  -0.924  -0.924  -0.706  -0.706  -0 706  -2.451  no GO terms  -2 451  GO_component: nucleus; GO_function: transcription factor activity; GO_process: carbohydrate metabolism; GO_process: regulation of transcription, DNA-dependent  -2451  RV66095  no 0<) terms  no GO terms  Gene Ontology  1.391  -2.017  0.459  -0.990  £566  Average LR  1.440  WM276 GH’2  1.273  0.584  0.584  0.584  0,554  0.554  0 554  1.239  I 239  1.239  RV66095  0.706  0.777  0.218  0.977  —  £566  0.809  WM276 GFP2  Standard deviation of LR  E  —  D  CHR  -  114872  -  45130  I 13863.  43595  2222351 2223661  2229499  2207190-  2137603  2134065.  576239  574752-  158475158708  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  AAW45747. 1  AAW45746. I  AAW44410.l  AAW42044. 1  AAW43384.  -  1 12805114127 114330116470  0.00E4’VO  0.000+00  AAW43448.1  43838-45346  000E+00  AAW43778.l  AAW43808. I  43219 43682 -  2225781  var. neoformans  JEC2IJ  neoformans JEC21]  Cop9 signalosome complex subunit 1, putative (Cryptococcus neoformans var.  Hypothetical protein [Cryptococcus neoforinans var. neoformann JEC2I] Conserved hypothetical protein [Cryptococcusneoformansvar. neoformans JEC2I] Expeeused protein [Crypeococcas neoformans var. neoformans JEC2II  neoformans  Hypothetical protein (Cryptocorrus  JEC2I]  2223709-  var. neoformans  Expressed protein [Cryptococcus  neoformans  -  [Cryptococcus neoformans var. neofornians JEC2I] Conserved hypothetical protein [Cryptococcus neoformam var. neoformans JEC21]  Conserved hypothetical protein  2222459  2221211  2229082  2228127-  2227099  2226193  neoformans var. neoformans 1]  2225781  [Cryptococcus  Hypothetical protein  2223709-  2222459  GO  GO  terms  terms  mononucleotkje transport  no  no  GO terms  GO terms  noGOterms  noGOterms  nicotiriamide mononucleotide transport  GO_component: integral to plasma membrane; GO_function: nicotinamide mononucleotide permmse activity; GO_process:  no  no  no GO terms  nicotinamicle  GO_component: integral to plasma membrane; GO_function: nicotinumide mononucleotide perinease activity; GO_process:  terms  no  Expressed protein [Cryptococcus neoformam var. neoformans JEC2IJ GO  noGOterma  Hypothetical protein [Cryptococcus neoformnns var. neoformans JEC21I  -  2221211  2219334  drug transport  GO_component: integral to membrane; GO_function: drug transporter activity; GO_process:  2217824-  JEC2II  [Cryptococcus  neoformans  transporter, putative  copper ion  neoformans JEC21I Drug  GO_process: processing of 20S pre-rRNA GO_component: plasma membrane; GO_functiorr ferroxidase activity; GO_process: high affinity iron ion transport; GO_process: response to  snoRNA binding; GO_process: rRNA modification; GO_process: 35S primary transcript processing; GO_process: ribosome biogenesis;  GO_component: small nucleolar ribonucleoprotein complex; GO_component: small nuclear ribonucleoprotein complex; GO_function:  Ferro-02-oxidoreductase, putative [Ciyptococcus neoformans var.  neoformans var. neofornians JEC21]  [Cryptococcus  nucleolar ribonucleoprotein  no GO terms  terms  terms  terms  3’: GO_component: nuclear pore; GO_component: cytoplasm; GO_function: structural constituent of nuclear pore; GO_process: protein-nucleus import  s’  no GO  no GO  no GO  1: GO component: nucleus; GO_component: cytoplasm; GO_function: protein carrier activity; GO_process: protein-nucleus import 2: GO_component: actin cap (sensu Saccharomyces); GO_function SNARE binding; GO_process: exocytosis; GO_process: vesicle docking during exocytosla; GO_process: vesicle fission  Gene Ontology  neoformaes var.  -  small  protein imp3, putative  u3  3’: MMS2, putative  [Cryptococcus neofornsan.s var neoformans JEC2I]  neoformnns JEC2II  neoformans var, neoformans JEC2IJ 5’: Conserved hypothetical protein [Cryptococcus neoformans var.  Expressed protein [Cryptococcus  1: Conserved hypothetical protein [Cryptococcus neoformans var neoformans JEC2I] 2: Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II Conserved hypothetical peotein ICryptococcus neoformam var. neoformam JEC2II Expressed protein [CrYPtOCOCCuS neoformans var. neofurmans JEC2IJ  Predicted Function  2214800  2212432  22095632211813  2208343  2207538.  2137208  2134450-  574477576337  3.OOE-47  0.OOE+00  AAW44410. 1  -  156350159114  105089 106333  114213  104942-  Gene  Coordinates of  A.AW43410. I  0.OOE+00  AAW45746.1  I  0.OOE+00  AAW45748.1  OOE+00  OOE+00  0.OOE+00  0  0  0.OOE+00  0.OOE-fOO  0.OOE+00  0.OOE+00  E-value  AAW45749. I  AAW45750. 1  5’: AAW45247 1; 3’: AAW45026. 1  AAW46491.1  AAW46719.1  AAW46728.l  2:AAW46648.1  1: AAW46647.l;  105171  101878-  II)  Protein  descnbing the area  Coordinates  _______________  -0.753  -0.753  -1,370  -1370  0.878  0 878  -1.519  -2.248  -2,315  -2315  RV66095  0.239  0.239  0.239  0 239  0.239  0 239  0.239  0.239  -0.763  -0241  E566  Average LR  GFP2  WM276  0.622  0.622  0844  0.844  0.477  0 477  0.689  1.243  1,035  1035  0.201  0.201  0.201  0.201  0.201  0 201  0.201  0.201  0.421  0161  E566  GEP2  WM276  Standard deviation of LR  RV66095  F  I-i  —  E  CUR  -  -  -  -  14289- 18373  0.OOE+00  XP_571629.l  0.OOE4stO  0.OOE+00  5’: AAW44032 I 3’: AAW44034. I  AAW44332. 1  AAW44IO5. I  644294645063  108576114737  lOGE114  JEC2I]  var.  JEC2II  Hypothetical protein (Cryptococcus  neoformans  permease,  1091 24 110901  106722 108919 -  -  neoformanovar. neoformansJEC2l]  644380644760  neoformans  var. neoformans  IEC21I  Hypothetical protein [Cryptococcns  [Cryptococcus neoformans var. neoformans JECZI]  Conserved hypothetical protein  3’: Expressed protein(Cryptococcus neoformans var._neoformans JEC2I]  [Cryptococcus neoformam var. neoformanslEC2lj 5’: Hypothetical protein [Cryptococcus  Comerved hypothetical protein  neoformans JEC2I]  [Cryptococcus neoformans var.  Alp-dependent  putative  [Cryptococcusneoformainvar.  Conserved hypothetical protein neofurmanstEC2l]  GO_process:  ATP binding;  GO_process asparaginyl-tRNA  preteinnucleas  constituent of nuclear  protein membrane protein  pore; GO_process:  terms  GO_process: mitochondrial  inner  -0.944  -1.167  no  no  GO ternts  GO terms  GO terms  no  noGOterms  -0 944  -2.840  transporter  -2.853  -0.647  -0.647  -0.420  -0.420  5’: 3’:  (ABC)  700  -0.738  -0  £566  -0.658  GO_procens= transport  -1.167  1.467  1 493  -1.493  -1.797  0.911  RV66095  Average ER  no GO terms  activity;  membrane; GO_fiinction= ATP-binding cassette  GO_component=cytoplasm; endoplasmic reticulum; integral to  noGOterms  noGOterms  noGOterms  no GO  activity;  GO_component: mitochondrial inner membrane; GO_function:  import  GO_function: structural  3’: GO_component: nuclear pore; GO_component: cytoplasm;  5’ no GO te  aminoacylation  activity; GO_function  import  [Cryptococcus neoformam  constituent of nuclear pore;  GO_component: cytoplasm; GO_function: asparagine-IRNA ligase  neoformanslEC2ll Conserved hypothetical protein  structural  poteinnclena import  GO_function:  3’: GO_component: nuclear pore; GO_component: cytoplasm;  5’ no GO terms  aminoacylation  GO_function: asparagine-tRNA ligase ATP binding; GO_process: asparaginyl-tRNA  cytoplasm;  activity; GO_function:  GO_component:  no GO terms  transporter  10965 -14121  14121  10965-  4.0GB175  AAW44147.1  GO terms  Ontology  no GO terms  no  Gene  neoformans_var._neoformnns JEC2I] Conserved hypothetical protein [Ciyptococcas neoformaim var.  3’: MMS2, putative [Cr3ptococcus  Asparagine-tRNA ligase, putative [Cryptococcus neoformans var. neoformans JEC2I] 5’: Conserved hypothetical protein [Cryptococcus neoformans neoformans JEC2II  Conserved hypothetical protein [Cryptococcusneoformansvar. neoformam JEC2I]  3024-4462  175  [Cryptococcus  neoformanu_var._neoformans JEC2I]  3’: MMS2, putative  neoformans JEC2I]  [Cryptococcus neoformam v&  5’: Comerved hypothetical protein  AsparagrnetRNA ligase, putative [Cryptococcus neoformans var. neoformans JEC2I]  [Cryptococcus neoibrmans var. neoformansiEC2lj Conserved hypothetical protein ococcus neofonnans var. neoformain JEC2IJ  Comerved hypothetical protein  putative [Cryptococcus neoformans var. neoformam JEC2I]  neoformam var. neoformnns  0.OOE+00  4.0GB-  Function  CopP signalosome complex subunit 1,  Predicted  1111509  1106694-  700233  699297  699083  697576-  357734  354970-  354250  352140-  357734  354970-  354250  352140  -  NO GENE  182270  179059-  158658  157621  116470  114330  Coordinates of Gene  AAW42044.1  0.OOE+00  0.OOE+00  AAW43681.l  AAW43786.l  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  AAW43905. I  3’: AAW45026. 1  AAW45247. 1.  5’.  AAW43427. I  3’: AAW45026. 1  AAW45247. 1,  5’.  AAW43427.l  0.OOE+00  0.OOE-fO0  0.OOE+00  E-valne  AAW44147.I  14356  I  AAW43488. I  AAW43476.  AAW43448.l  Protein U)  11063- 14014  10686-  2660-4348  1110730  1109975  698468699436  358121  354195  358425  354096-  250026250463  181982  181170-  157951  156646-  116467  115872-  area  describing the  Coordinates GFP2  WM276  0 255  0.255  0.506  0.506  0.611  0643  0.643  1.366  0.398  RV66095  1.210  0.277  0.978  0.326  0 326  0.374  0.374  0.475  0.401  £566  WM276 GFP2  Standard deviation of LR  —  G  —  F  CHR  12434801244775  517988533333  85- 2145  261037  259277-  11667351169604  Coordinates descnbing the area  0.OOE+00  0.OOE+00  AAW44683.1  AAW44680. 1;  5’:  0.OOE+00  AAW44677. I  AAW44068I; 3’: AAW44069.I  0.OOE+00  0.OOE+00  AAW44883. I  .  0.OOE+00  AAW44680. I  3’: AAW44682.1  -  -  12436771244155  532596533766  529413 532175  525278527626  524382  522995  522363  521220-  -  518493 519670  0.OOE+00  3’: AAW44689.1  -  2006  AAW44687.1  319-  516520518010  7.OOE1 12  259572261441  259339  256640-  1169723  1168658  mitochondrial precursor, putative [Cryptococcus neofortnans var. neoformans JEC2I] Inositol oxygenase, putative [Cryptococcus neoformam var. neoformans JEC21] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21] 5’: Myo-inositol transporter 2, putative ICryptococcus neoformans Var. neoformaas JEC21] 3’ Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] Myo-inositol transporter 2, putative [Cryptococcus neoformans Var. neoformans JEC21I Expressed protein [Cryptococcus neoformans var. neoformans JEC21I Conserved hypothetical protein [Cryptococcus ncoformans var. ncoformans JEC2II 5’: Expressed protein [Cryptococcus neofortnans var. neoformans JEC2IJ 3’: Hypothetical protein [Cryptococcus neoformans var. neoforinans JEC2I]  3’: Glutaryl-CoA dehydrogenase,  neoformam JEC21J  5’: Inositol oxygenase, putative [Cryptococcus neoformans var.  5’: Alpha-glucoside:bydrogtn aymporter, putative [Cryptococcus neoformam var. neoformam JEC2I] 3’: Protein-histidine kinase, putative (Cryptococcus neoformam var. neoformans JEC2II  Expreaaedprotein(Cryptococcus neoforinans var. neoformam JEC2I] Expressed protein ICryptococcus neoformans var. neoformans JEC2I] Vesicle-mediated transport-related protein. putative [Cryptococcus neoformans var. neoformans JEC2I] 5’: Biotin synthase, putative ICr’ittococcus neoformans var. neoformans JEC2I] 3’: Vesicle-mediated transport-related protein, putative [Cryptococcus neoformans var. neoformans JEC2I]  Rant-like protein kinase, putative  112460113855 11665571167289  Predicted Function  0.OOE+00  5’: AAW44687.1;  AAW47006.1; 3’: AAW47007.1  .  5’:  0.OOE+00  OOE+OO  AAW44375.1; 3’: AAW44051.1  0  0.OOE+00  I  AAW44051.1  AAW46861.  3.OOE-94  0OOE+00  AAW44103.1  AAW46935.1  E-valne  Protein ID  Coordinates of Geiw Ontology  GO terms  GO terms  noGOterms  no  no GO terms  GO_component: membrane; GO_function: myo-inositol transporter activity; GO_process: myo-inositol transport  306  -0.938  -3.306  -3.306  3  -3.306  5’: GO_component: membrane; GO_function: myo-inositol tramporter activity; GO_procnss: myo-inositol transport 3’: no GO terms  -3.306  -3.306  -3.306  no GO terms  no GO terms  no  sensor molecule activity; GO function: protein-histidine kinase activity; GO_function: osmosensor activity; GO_process: protein amino acid phosphorylation; GO_process: osmoaensory signaling pathway via two component system; GO process: response to hydrogen peroxide  transport 3’: GO_component: plasma membrane; GO_function: two-component  1.772  -1.630  5’: GO_component: mitochondrion; GO_function: biotin synthase activity; GO_process: biotin biosynthesis 3’: GO_component: integral to membrane; GO_process: vesicle mediated transport 5’: GO_component: membrane fraction; GO_function: alphaglucoside:hydrogen symporter activity; GO_process: aipha-glucoside  -1.630  terms  -0.944  RV66095  GO_component: integral to membrane; GO_process: vesicle-mediated transport  no GO  noGOtertns  transcription from Pol 11 promoter  GO_component: cytoplasm; GO_function: protein serine/threonine kinase activity; GO_process: protein amino acid phosphorylation; GO_process: glucose transport; GO_process: positive regulation of  Gene  0 703  0703  E566  Average LR WM276 GFP2  0596  0.948  0 948  0 948  0.948  0.948  0.948  0.948  0.704  1.320  1.320  0.255  RV66095  0  595  0595  E566  WM276 GFP2  Standard deviation of LR  —  13-13847  H  3134- 5404 5931 -7111  6.OOE-16  7.OOE-03  XP_771794.1  143- 1758  3134- 5404 5931-7111  9203-9962  6.OOE-16  7.OOE-03  XP_771794.1  1260465 1265385  -  11207321128027  10897581090328  972990973673  -  AAW42044.I  0.OOE+00  1260303 1261723  11260491127161  2.OOE173  AAW44069.I -  -  1123045 1125053  0.OOE+00  5’: AAW47162.I; 3’: AAW47164.I  11212521122902  NO GENE  970664973167  NO GENE  0.OOE-I00  0.OOE+00  -  500839507192 507620508402  -  5’: AAW47I62.I; 3’: AAW47164.1  AAW45306.1  0.OOE+0O  AAW45507. I  595064 597809  0.OOE+00  AAW45487. 1  507949508952  266633 267396  6.OOE147  5’: AAW4SSO4. I 3’: AAW45455. 1  11993 13373  1.2oE+Oo  XP_749001.1  10430- 11308  1.80E-01  5.90E-02  BAC74281.1  -  XP_776333.1  AAW44147.1  11993 13373  1.20E+00  2.OoE106  XP_749001. 1  -  BAC74281.1  10430- 11308  1.80E-01  5.90E-02  XP_776333. I  9203 9962  -  143 1758  2.OOE106  AAW44147.1  E-value  Protein ID  Coordinates of Gene  266292268219  13- 14735  describing the area  CHR  Coordiaates  5’: Hypothetical protein [Cryptococcus neofbnnansvar.neofbrmansJEC2lj 3’: Amidase, putative ICryptococcus neofo,mans var. neoformans JEC2II 5’: Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II 3’: Amidase, putative [Cryptococcus neofomians var. ntoformana JEC2IJ Hypotheticalprotein[Cryptococcus neoformansvar. neofornsenajEC2ll Conserved hypothetical protem [Cryptococcus neoformam var. neoformans JEC21]  Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I]  RNA helicaae, putative (Cryptococcus neoformans var. neofornian, JEC2IJ Sterol-binding protein (Cryptococcus neoformana var. neoformana JEC2IJ  .  Rab GTPast activator, putative 3’: UI small nuclear ribonucitoprotein, putative  Conserved hypothetical protein ICrypto000cus neofonnana var. neoformanaiEC2ll Rexose transport-related protein, putative [Crypt000ccus neofbnnans var. neolbrmans JEC2I] Hypothetical protein [Cryptococcus neolhrmana var. neoforman, B-3501AJ Hypotscal protein [Ctyptococcus neoformans var. neoformans B-3501A1 Putative membrane protein [Streptomyces avermitilis MA-46801 Consetved hypothetical protein [Aapergillus fismigatus Af293] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II Hexose transport-related protein, putative [Ciyptococws neolbrmans var. neolbrmans JEC2II Hypothetical protein [Cryptococcus neoformaisvar. neoformsnsB-3501A1 Hypotheticalprotein[Cryptococcua ntoformans var. neoformans B-3501A] Putative membrane protein (Streptomyces avermitilis MA-4680J Conserved hypothetical protein [Aspergillus flirnigatus Af2931  Predicted Function  no GO terms  noGOterms  5’: no GO terms 3’: GO_functioer amidase activity  5’: noGOteenis 3’: GO_fimctioir amidase activity  no GO terms  —  GO fisnctioit sterol carrier activity  5’: GO_component soluble fraction; GO_function: Rab GTPase activator activity 3’: GO_component: commitment complex; GO_component snRNP UI; GO function: mRNA binding; GO_process: mitNA splicing GO_fiinctioir RNA helicase activity; GO_process: regulation of translation  no GO terms  GO  noGOtesms  no GO terms  not applicable  no GO terms  no GO terms  GO terms  noGOtenns  no GO terms  notapplitable  no GO ternls  Gene Ontology  0.666  1.874  1.874  1.874  1.392  -1.918  -1.918  -2.673  -2.818  -2.818  -2.818  -2.818  -2.818  -2.818  RV66095  -0.921  1.224  -2.453  -2.453  -2.453  -2.453  -2.453  -2.453  E566  Average LR WM276 GFP2  0.690  0.373  0.373  0.373  0.857  0.955  0 955  1.594  0.930  0.930  0.930  0.930  0.930  0.930  RV66095  —  0.233  0.602  1.384  1.384  1.384  1.384  1.384  1.384  £566  WM276 GFP2  Standard deviation of LR  CUR  -  204343 205431  198414  -  166228-  1 59747 162746  157849  154506-  85-9278  area  describing the  Coord.aates  8906- 9456  7.OOE-34  1.50E+00  AAW43040.1; 3’: AAW43048.t  XP_001220954,I  183808189381 191211 193454 195085 198037  2.OOE-20  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.00E4-00  5’: AAW43235.1 3’: AAW42803.t  AAW43237.1  AAW42803. I  AAW43239. I  AAW43231. 1  AAW43IRO.1  AAW43241. I NO GENE  -  -  175788178530 179410182581  168909174884  168156  neoformans var. neoformans JEC2IJ Conserved hypothetical protein [Cryptococcus neoformans var. neoformana JEC2I]  Capsular associated protein [Cryptococcus  Conserved hypothetical protein ICryptococcuu neoformans vat, neoformans JEC2I]  [Cryptococcus neoformaita var. neoformans JEC21I Expressed protein [Cryptococcus neoformans var. neoformam JEC2II Hypothetical protein [Cryptococcus neoformaus var. neoformans JEC2I]  Conserved hypothetical protein  [Cryptococcus neoformass var. neoformans JEC2I] 3’: Expressed protein (Cryptococcus neoformans var. neoformans JEC21J  5’: Conserved hypothetical protein  0.OOE+00  AAW43233. 1  167492-  Conserved hypothetical protein (Cryptococcus neofonnans var. neoformain )EC2t]  166852167453  7.OOE-58  -  -  neoformans JEC2IJ 5’: Sulfite transporter, putative ICr3’ltococcus neofortoans var. neoformans JEC2I] 3” Conserved hypothetical protein [Cryptococcus neofonnaim var. neoformans JEC2II 5’: Specific transcriptional repressor, putative [Cryptococcus neoformans var neoformam JEC2I 3’. Dihydrofolate synthase, putative [Cryptococcus neoformans var neoformuns JEC2I]  [Cryptococcus neoformans var.  5’: specific transcriptional repressor, putative 3’: diltydrofolate syntitase, putative  164069  162578  161212  160095  predicted  166108166356  4.OOE-58  3.OOE-l3  156937  protein product;  5’: Myo-inositol transporter, putative ICryptococcus neofonuans var. neoformans JEC2I] 3’: Maltose 0-acetyltransferuse, putative [Cryptococcus neoformans var. neoformam JEC2IJ Hypothetical protein [Cbaetomium globosum CBS 148.511 Sexual development regulator  protein [Aspergillus oryzae]  Unnamed  Predicted Frnictiea  5’: AAW45261.1 3” A.AW45262 I  3’ AAW45262 I  AAW4S26I .1,  .  AAW40990.1; 3’: AAW40992.l  5’:  AAW42798.1  155578-  5304-5664  4.OOE-40  BAE55598.1  0.OOE+00  681 -2582  E-vahie  .  Coordmantes of Gene  Protein 11)  _______________  GO terms  GO_function: sulfite  transporter  GO_component: nucleus; GO_function: specific transcriptional  terms  D  activity; GO_process: phospholipid  biogenesis GO_component nucleus; GO_function: DNA-directed DNA polymerase activity; GO_process: DNA topological change3O_peocess: sister chromatid cohesion; GO process’ mitotic chromosome condensation  GO_process: pathogeaesis; GO_process: capsule organization and  Fungi)  metabolism; GO_process: exocytosis; GO_process: sporulation (sensu  GO function: phospholipase  GO_component: prospore membrane; GO_component: endosome;  no GO terms  GO  GO_component: nucleus; GO_component: cytoplasm  5’: no GO ternts 3’: noGOternts  dihydrofolate synthase activity; GO_process:_folic acid and derivative biosynthesis GO_component: cytosolic large ribosomal subunit (sensu Eukaryota); GO_function: structural constituent of ribosome; GO_process: protein biotynthesis  Pol U promoter; GO_process: DNA repair” 3’: GO_component: cytoplasm; GO_function:  repressor activity; GO_process: negative regulation of transcription from  5’:  5’: GO_component: nucleus; GO_function: specific transcriptional repressor activity, GO_process: negative regulation of transcription from Pol U promoter; GO_process: DNA repair 3’: GO_component: cytoplasm; GO_function: dihydrofolate synthase activity; GO_process: folic acid and derivative biosynthesis  5’: GO_component: plasma membrane; activity; GO_process: sulfite transport 3’: noGOternin  GO_process: sex determination  no GO terms  5’: GO component: membrane; GO_function: myo-inoaitol transporter activity; GO_process: myo-inositol transport 3’: GO function: maltose 0-acetyltransferase activity; GO_function. acetyltransferase activity  no  Gene Ontology  RV66095  -2 255  -2.168  -2.168  0.958  1.310  1.310  1 310  1 310 -2 168  -2.168  1 310  1.310  1.310  1 310  1 310  0.461  0.461  1.158  -2 168  -2.168  -2.168  -2.168  -2.168  0.903  0.903  -3.346  0311  0 311  E566  1 140  RV66095  WM276 GFP2  Stanta,-d deviatica of LR  0.311  140  GFP2  WM276  1140  1  E566  Average LR  —  CHR  134780136277  212703267575  Coordinates describing the area  236660 241449 242505 245 167  0.OOE+00  0.00E+00  8.OOE-33  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  5.OOE-42  AAW42813.1  AAW428II.t  AAW44842.1  AAW43187.l  AAW42809.1  AAW43I7I.l  AAW43191.1  I. AAW43382.1 2. AAW433 10.1  AAW42819.l  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] ETFI-related 1C13’l>tococcus neoformans var. neoformans JEC21I Mating-type a-factor pheromone receptor, putative [Cryptococeus neoformans var. neoformans JEC2II Conserved hypothetical protein (Cryptococcus neoformans var. neofonnans JEC21] Conserved hypothetical protein ICryptococcus neofurmans var. neoformans JEC21J I. Conserved hypothetical protein [Cryptococcus neoformaim var. neoformans JEC2I] 2. Conserved hypothetical protein [Cryptococcus neoformans var. neoformam JEC2I] Pheromonealptia[Cryptococcus neoformans var. neoformans JEC2II Pheromonealpha[Cryptococcus neoforinans var. neofornasim JEC2II Expressed protean (Cryptococcus neofurmans var. neofornsstm JEC21I Conserved hypothetical protein [Cryptococcus neoformans var. neoformana JEC21]  229624229921 231562232991  AAW4331 1.1  134234137124  0.OOE+00  AAW43173.1  0.OOE+00  263045266150  2.OOE138  AAW43381.l  AAW46059. I  260448260947  5.OOE-42  0.OOE+00  AAW42819.l -  251812251928 252690252806 257960 259321  240455248824  -  -  Conaceved hypothetical protein [Cryptococcun noofurmanu var. neofosmana JEC2I]  Conserved hypothetical protein [Cryptococcus neoformant var. neoformans JEC2IJ  STE2O ICr3’ptococcut neoformans var. neoformam JEC2IJ  226516228880  234156235474  MYO2-related [Cryptococrus neoformans var. neofointans JEC2I]  220687225917  no GO teems  GO_component: cytosolic large ribosomal subunit (sensu Eukasyota); GO_function: structural constituent of ribosome; GO_process: protein biosynthesis GO_component nucleus; GO_function: transcription factor activity; GO_process: conjugation with cellular fusion; GO_process: invasive growth (seasu Saccharomyces); GO_process: pseudohyphal growth; GO_process: positive regulation of transcription from Pol II promoter by pheromones  noGOterms  noGOterms  noGOterms  -1.035  -3.132  -3.132  -3.132  -3.132  -3 132  3 132  -3.132  I. GO_component: nucleus; GO_component: cytoplasm 2. GO_component nucleus; GO_component: cytoplasm  -3.132  no GO terms  -3.132  GO_component: cytoplasm; GO_component: eukaryotic translation initiation factor 3 complex; GO_function: tranalation initintion factor activity; GO process: translational initiation  -3.132  -3.132  -3.132  -3.132  -3.132  -3.132  E566  GO_component: integral to plasma membrane; GO_function: mating type a-factor pheromone receptor activity; GO_process: signal transduction during conjugation with cellular fusion  RV66095  Average LR  GO_component: mitochondrion; GO_function: electron carrier activity  no GO terms  Stet laipha protein [Cryptococcus neoformans var. neoformans JEC2IJ  -  215098 219064  0.OOE+00  AAW43 189.1  GO_component mitochondrial matrix; GO_function: DNA-directed RNA polyinerase activity; GO_process: mitochondrial genome maintenance; GO process: transcription from mitochondrial promoter GO_component: cytoplasm; GO_function: MAP kinase kinase kinase activity; GO_process: signal transduction during conjugation with cellular fusion; GO_process: protein amino acid phosphorylation; GO_process: pseudohyphal growth GO_component: actin cable (setnu Saccharomyces); GO_component: actin cap (sense Sacclmromyces); GO_fisnction: microfilament motor activity; GO_process: mitochondrion inheritance; GO_process: vacuole inheritance; GO_process: establishment of cell polarity (sensu Saccharomyces); GO_process: endocytosis; GO_process: budding cell apical bud growth; GO_process: budding cell isotropic bud growth; GO_process: vesicle-mediated transport GO_component: antis cap (sensu Saccbrornyces); GO_function: protein serine/threonine kinase activity; GO_process: establishment of cell polarity (sensu Saccharomyces); GO_process: cytokinesis; GO_process: protein amino acid phosphorylation; GO_process: budding cell apical bud growth; GO_process:_Rho protein signal transduction  Conserved hypothetical protein [Cryptococcus neofonnans var. neoformans JEC2I]  210365214372  0.OOE+00  AAW43178. 1  Gene OntoIog’  Predicted Fanction  E-val.e  Protein ID  Coordinates of WM276 GFP2  0.718  —  1.384  1.384  1.384  1.384  1 384  1 384  1.384  1.384  1.384  1.384  1 384  1.384  1.384  I 384  1.384  E566  WM276 GFP2  Standard deviation of LR RV66095  —  K  —  CUR  501263  -  -  m  502404  7.600+00  9.40E-Ol  l.OOE-19  1.000-60  l.tOE-02  0.000+00  XP_001686663. 1  NP_00l025060.l  AAW44929.1  XP_77687t.l  XP_519334.2  AAW43040. I  -  -  -  -  86738  859011. 966888  85921  78463 80001  0.OOE+0O  AAW46247.1  79677 80970  -  78463 80001  0.000100  AAW46247. 1  79677- 80847  860497861278  861803862474  4 000174  0.OOE+00  5’: AAW46099. I 3’. AAW46tOO.l  AAW46099.I  NO GENE  -  -  12199- 12513  4.000-24  8260- 8577  5263.. 7399  520975 522682  520975 522682  -  516283 518487 519077519265  514427 515748  -  AAW46212.1  2.OOE-05  -  511223 511465 512159512506  508626 509732  505818  503985.  -  -  2.000-08  XP_383692. I  0.OOE+00  5.000-42  AAW44931 1  AAW43040. I  3.60E-02  502885  501724  122  3.OOE-  110  500748  NO GENE  NO GENE  186782  185010-  Gene  2.OOE-  0.OOE+00  0-value  XP_0012 12098.1  AAW44841.l  A.AW47211.l  AAW46422. I  Protein  Coordinates of  I_________  AAW4 1986.1  4477- 15514  521263 522613  522613  -  397931 401148 412814413407  185971  164881-  area  Coordinates describing the Function  .  [Cryptococcus neoformam neoformans JEC2I] 3’: Hypothetical protein [Cryptococcus neoformans var. neoformass JEC2I] Mitochondrion protein, putative [Cryptococcus neoformans var. neofornsass JEC2II  5’. Mitochondrion protein, putative  Hypothetical protein IGibberelln zeae PHI] Conserved hypothetical protem [Cryptococcus neoforsnans var. neoformans JEC2IJ Conserved hypothetical protein [Cryptococcas neoformans var. neofornians JEC2t] Conserved hypothetical protein [Cryptoroccus neoformans var. neoformans JEC2I] Conserved hypothetical protein ICryptococcus neoformans var. neoformans JEC2I]  Conserved hypothetical protein [Cryptococcus neoformans var. neoformass JEC2I] Protein coding [Cryptococcus neoformans var. neoformans B-3501A1 Inhibitor of growth family, member 3 [Pan troglodytes] Myo-alostlol transporter, putative [Cryptococcas neoformans var. neoforinans JEC2I] Myo-inositol transporter, putative [Cryptococcus neoubrmans var. neofonnans JEC2I]  musculusl  ICryptococcus neoforinan.s var. neoformans JEC2I] Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] Conserved hypothetical protein [Aspergillus teneus N1H2624] Conserved hypothetical protein ICryptococcus neofotmajis var. neoformans JEC2I] Mitogen-activated protein kiaase-like protein [Leislunania major strain Friedlin[ Hypothetical protein LOC207806 [Mus Hypothetical protein  Chaperone regulator, putative [Cryptococcus neoformans var. neoformans 3EC21]  Predicted  J  terms  terms  GO terms  GO terms  GO_function: myo-inositol transporter GO_process myo-iaositol transport  I  0 538  GO_component: mitochondrion  5’: GO_component: mitochondrion 3’: GO_component: vacuolar membrane; GO_component: plasma membrane, GO_function: spermine transporter activity; GO_process polynm transport  0 538  -1 622 no GO terms  I  -l 622  GO terms  -3 293  I 012  -2 771  no GO terms  1 012  I 227  -2 771  no  1 227  -2 771  GO component: mitochondrion; GO component: mitochonctrial matrix; GO_process: mitochondrial genome maintenance; GO_process: isoleacine biosynthesis  1 227  1.287  no GO te  GO_component: membrane; GO_function: myci-inositol transporter activity; GO_process myo-inositol transport  activity;  -1.688  287 1 -1 688  1 287  1 287  1 287  1 287  1 287  1 287  1 287  0.694  RV66095  GO  -2.637  GFP2  1 287  GO_component: membrane;  no  -2.985  £566  1348  1.250  0.837  £566  0 115  0 115  WM276 GW2  Standiatkr of LR  -l 688  -1.688  -l 688  -I 688  -1 688  -1 688  -l 688  -1 688  -1.442  -1.398  RV66095  WM276  GO ms  no GO terms  GO_component=’memhrane; GO_function=calcium ion bmding;maImonyl-oIigosaccide I 2-alpha-manaosidase activity  no  no GO ms  no OCt  GO  GO_component: cytosol; GO_function: ATPase stimulator activity, GO_function: chaperone regulator activity; GO_function: Hsp7O/HsclO protein regulator activity; GO process: prolein-milocliondriaj targeting  Gene Ontology  AvgeI  K  CHR  —3  Coordiaatea describing the area  877792880902 881945883601  2.OOE-93  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE-I00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  t.OOE-73  O.OOE+00  0.OOE+00  0.OOE+00  0.OOE-fOO  0.OOE+00  0.OOE+00  0.OOE+00  5’: AAW46096. 1 3’: AAW46097. 1  AAW46096 I  AAW46095.1  AAW46094. 1  AAW46092.l  AAW46091.1  AAW46090.1  AAW46089. I  A.AW46088. I  AAW46087. I  AAW46086.1  AAW46085. I  AAW46084. I  AAW46083. I  AAW46082. I  AAW46O8I.1  AAW46080. I  AAW46078. I  -  -  -  925013  919467 -  912531 914329  912229  908150  891194892435 893873 894559 895619897920 899164900921  888159889067  884594 887022  872705 876878  867683869333 869819871996  866322 866714  864394  -  AAW46097. 1  863928  863715  2.OOE168  862707-  Coordiaates of  0.OOE+00  E-vahie  AAW46098. I  Protein ID  var.  GO terms membrane;  targeting;  neoformans van. neoformans JEC2I I  neoformans JEC2I] Hypothetical protein [Cryptococcus  putative [Clyptococcus neoformans var.  neoformans JEC2I) U1)P-N-acetylglucosamine-dolichylphosphate Nacetylglucosammephosphotransferase,  no GO terms  glycosylation  GO_component: endoplasmic reticulum; GO_function: UDP-N acetylglucosamine-dolichyl-phosphate N acetylglucosaminephosphotransferase activity; GO_process: N-linked  GO_function: phosphoglycerate mutest activity; GO_process: glycolysis  protein catabolism  [Cryptococcus neoftirmans var.  GO_function endopeptidase activity; GOprocess: ubiquitin-dependem  GO_component: proteasome regulatory particle (sensu Eukaryota);  (Cryptococcus neoformais var.  Conserved hypothetical protein  neoformans JEC2I I  wall chitin biosynthesis; GO_process: ER toi transport  GO_component: endoplasmic reticulum membrane, GO_process: cell  no GO terms  GO_component cytoplasm  no GO terms  noGOterms  GO_process autophagy  GO_component: cytoplasm; GO_process: protein-vacuolar  dependent methyltransferase activity  GO_component: cytoplasm; GO_function S-adenosylmethionine-  integral to membrane; GO_function: transporter activity; GO_process transport GO_component:  GO_function: sodium:hydrogen antiporter activity; GO_process: sodium ion transport; GO_process: hydrogen transport  GO_component:  no  methylation  0 538  0538  0.538  0.538  0 538  0 538  0 538  0 538  0538  0 538  0.538  0.538  0.538  0 538  0.538  0 538  0.538  0.538  0 538  GFP2  0.538  E566  WM276  GO_component: cytoplasm; GO_function tRNA methyltransferase activity; GO_process: protein biosynthesis; GO_process tRNA  GO terms  35S  RV66095  Average LR  noGOterms  no  5’: no GO terms 3’: no GO terms  noGOteems  GO_component: nucleus; GO_component: cytoplasm; GO_process: primary transcript processing  Gene O.tology  protein, putative (Cryptococcus neoformans var. neoformans SEC2I]  Cell wall chitin biosynthesis-related  Expressedprotein(Crypeococcus neoformans vax. neoformans JEC2I] Hypothetical protein (Cryptococcus neoformans var. neoformans JEC2I] Cytoplasm protein, putative [Cryptococcus neoformans var. neoformans JEC2I] Hypothetical protein [Cryptococcus neofornians var. neoformans JEC2I]  [Cryptococcus neoformans  Autophagy-related protein, putative  35S  primary transcript processmg-related protem, putative ICtyjitococcus neoformans var._neoformans JEC2I] Hypothetical protein (Cryptococcus neoformans var. neoformam JEC2I] 5’: Expressed protein [Cryptococcus neoformans var. neoformaim JEC2I] 3’: Hypothetical protein (Cryptococcus neoformans var. neoforinans SEC2tI Expreated protein [Cryptococcus neoformans var. neoformans JEC2IJ Cytoplasm protein, putative (Ctyptococcus neoformans var. neolbrmans JEC2I] Conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II Cytoplasm protein, putative (Cryptococcus neoformam var. neoformans JEC2I] Sodium-hydrogen antiporter (Cryptococcus neoformam var. neoformansiEC2t] Membrane transporter, putative [Cryptococcus neoformans var. neoformans JEC21J Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2II  Predicted Function RV66095  E566  115  0 115  0.115  0.115  0.115  0 115  0 115  0 115  0 115  OIlS  0 ItS  0  0.115  0.115  0 115  0.115  0.115  0 115  0.115  0.115  0 115  GFP2  WM276  Sta.danl deviation of LR  K  CHR  fr-i  00  953515  950788  area  describing the  Coordinates  944593 945895 946235 948131  960745 961680  962322 963541  963907. 967576  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  0.OOE+00  5.OOE150  0.OOE+00  0 OOE+00  0.OOE+00  0.OOE+00  5’: AAW46074. I 3’: AAW46075.l  AAW46074. 1  AAW46072.l  AAW46213.1  5’: AAW46071.t; 3’: AAW46213. I  AAW46070. I  AAW46069. I  AAW46264 1  AAW46262. I  AAW46261 .1  3’: AAW46213. I  AAW46071 .1;  0.OOE+00  940624941994  0 OOE+00  AAW46075 1  5’:  938567939502  0.OOE+00  -  AAW46076. I  -  949533 950942 -  -  -  -  -  -  -  955317956391 956996 959764  949533 950942  937431  933916935049  932424  929231  928542  0.OOE+00  925625  Gene  AAW46077. I  E-value  0.00E-+-00  H)  AAW46214. I  Protein  Coordinates of  [Cryptococcus neoformans var. neofonnans JEC2IJ 5’: Expressed protein [Cryptococcus neoformans vat. ncofornsans JEC21] 3’: Tubulin gamma chain (Gamma tubulin), putative [Cryptococcus neoformans var. neoformam JEC21]  Ubiquitin-specific protease, putative  neoformans var.  Methyltransferase,  putative [Cryptococcus neoformans JEC21J  5’: Expressed protein (Cryptococcus neoformam var. neoformans JEC2II 3’: Tubulin gamma chain (Gamma tubulin), putative (Cryptococcus neoformam vat. neoformans JEC2I] Hypothetical protein ICryptococcus neoformnnsvar. neoformansiEC2ll Hypothetical protein (Cryptococcus neofbrmans var. neoformans JEC2II Thioredoxin peroxidase, putative [Cryptococcus neoformuns neoformans JEC2II  putative  Tubulin  gamma chain (Gamma tubulm), (Cryptococcus neoformans var. neoformans JEC2I]  Hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] Cytoplasm protein, putative (Cryptococcus neoformans var. neoformans JEC2I] RNA-binding protein sce3, putative [Cryptococcus neoformans neoformans JEC2II 5’: Comerved hypothetical protein [Cryptococcus neoformans var. neoformans JEC2I] 3’: RNA-binding protein sce3, putative (Cryptococcus neoformans var. neoformans JEC2I] Comerved hypothetical protein (Cr’Istococcas neoformans var. neoformans JEC2I] 1.-senine ammonin-lyase, putative (Cryptococcus neoformnns var. neoformans JEC2IJ  Deadenylation.dependent decappingrelated protein, putative [Ciyptococcus neoformans var. neoformans JEC2I]  Predicted Function  GO_process: deadenylylation.dependent decapping;  GO  terms cytoplasm  GO_function: protein  binding; fuctor  GO terms  GO terms  peroxidase  of spindle pole body; GO_component:  Saccbaromyces); GO_process: microtubule nucleation  cytoskeleton; GO_process: mitotic spindle assembly (sensu  outer plaque of spindle pole body; GO_function: structural constituent of  5’: no GO terms 3’: GO_component: inner plaque  activity; GO_process: protein deubiquitination  GO_component: cytoplasm; GO_function: ubiquitin.specific protease  of 20S_pre-rRNA  GO_process: ribosomal lurge subunit assembly and maintenance; GO_process: rENA modification; GO_process: RNA methylation; GO_process: 35S primary transcript processing; GO_process: processing  ribonucleoprotein complex; GO_function: methyltransferase activity;  nibonucleoprotein complex; GO_component: small nuclear  nucleolar  homeostasis  small  cell redox  GO_component: nucleolus; GO_component:  activity; GO_process: regulation of  GO_component: mitochondrion; GO_function: thioredoxin  no  no  activity; GO_function: threonine ammonia.lyase  activity; GO_process: tbreonine catabolism, GO_process: sense family amino acid catabolism GO_component: inner plaque of spindle pole body, GO_component: outer plaque of spindle pole body; GO_function: structural constituent of cytoskeleton; GO_process: mitotic spindle assembly (sensu Snccharomyces);_GO_process:_microlubule_nucleation 5’: no GO terms 3’: GO_component: inner plaque of spindle pole body; GO_component: Outer plaque of spindle pole body; GO_function: structural constituent of cytoskeleton; GO_process: mitotic spindle assembly (sensu Saccharomyces); GO_process: microtubule nucleation  GO_component: mitochondrion, GO_function: L-serine ammonia-lyase  GO_process thinmin biosynthesis  GO_function: protein binding; GO_process: pyridoxine metabolism;  translation initiation  GO_process: pyridoxine metabolism;  3’: GO_component: ribosome; GO_function: activity; GO_process: translational initiation  GO_process: thiamin biosynthesis  5’:  activity; GO_process: translational initiation  GO_component: ribosome; GO_function: translation initiation fuctor  GO_component  no  GO_process: mRNA catabolism  activity;  GO_function: enzyme activator activity; GO_function: hydrolase  GO component: cytoplasmic mRNA processing body; GO_component: nucleus; GO_component: cytoplasm; GO_function: mRNA binding;  Gene Ontology  -2.972  RV66095  E566  Average LR  0 538  0.538  0 538  0.538  0 538  0.538  0 538  0.538  0.538  0 538  0 538  0 538  0 538  0.538  GFP2  WM276  0.994  RV66095  E566  0 115  0.115  0 115  0.115  0115  0.115  0 115  0.115  0.115  0 115  0 115  0 115  0. 115  0. 115  GFP2  WM276  Stan?rrd deviatier of LR  K  CUR  -  984866  984051-  1040449  966926  area  describing the  Coordinates  0.000+00  0.OOE+00  AAW46258. I  AAW46256.t  -  -  996050996601  6.000-  101  4.OOE-2l  3.000-23  6 000-25  0.OOE+00  6.00E-13  2.000-05  l.OOE-08  XP_001258627.1  XP_001258625. 1  5’: AAW44159.l 3’: AAW43966.l  AAW44159 I  XP_00I 560593.1  XP_001 223536.1  XP_001822871.l  0.OOE+00  3.000-30  AAW44922.t  AAW46256. I  2.OOE-51  AAW46252 I  ‘  neoformansjEC2ll  1020438  985684  983787-  10382191040371  -  GO  GO_component: integral to plasma membrane; GO_function: arsenite transporter activity; GO_process: arsenite transport  terms no GO  terms  terms  Arsenite transporter, putative [Cr’ptococcns neoformans var. neoformans JEC21]  no GO  no  carbohydrate transport  GO_component: plasma membrane. GO_function: carbohydrate transporter activity; GO_function: maltose porter activity; GO_process:  Beta-glucosidase-related glycosidases [Aspergillus oiyzae RIB4O genomic DNA, SC166]  globotum CBS 148.51 (strain: CBS 148 51)]  terms  terms  O-glycosyl compounds,  5’: GO_component: plasma membrane; GO_function: carbohydrate transporter activity; GO_function: maltose porter activity; GO_process: carbohydrate transport 3’: GO_component: mitochondrion  GO  GO_function: hydrolase  no GO  no GO teems  noGOtenns  GO_component: cytoplasm; GO_function: chaperone activity; GO_function’ peptidyl.prolyl cia-trans isommase activity; GO_process: protein folding  no  [Cryptococcus neoformans var  activity;  2. GO_component: membrane; GO_function: transporter activity; GO_process: transport  GO_process: transport  1. GO_component: membrane; GO_function: transporter  transporter activity; GO_process: areenite transport  NRRLI8I)1 Sugar transporter (hexose transporter) [Neosartorya fischeri NRRL 181 (strain: NRRLI8I)1 5’: Maltose porter, putative [Cryptococcus neoformans var neoformans JEC2I 3” Mitochondrion protein, putative  metabolism  GO_component: integral to plasma membrane; GO_function: arsenite  (30_component:  transporter (hexose transporter) INeosartorya fischeriNflRL 181 (strain: Sugar  Hypothetical protein [Borryotinia fuckeliana 805.10 (strain: B05.lO)J Hypothetical protein [Chaetomium  1030647 1032640  lipid  activity, hydrolyzing GO_process: carbohydrate metabolism  1019822-  1018575  GO_process:  aldehyde-lyase activity; GO_process: carbohydrate  lipid particle;  extracellular region, GO_component: cytopbsm; GO_function: beta-fructofuranosidase activity; GO_process: sucrose catabolism  GO_function: metabolism  GO_component:  no GO terms  GO_component: cytoplasm; GO_function: ubiquitin-specific protease activity; GO_process: protein deubiquitination  Gene Ontology  neoformans var. neofornians JEC2I] Beta-glucosidase, putative [Cryptococcus neoformans var. neoformans JEC2I]  var. neoformans JEC2I] Hypothetical protein [Cryptococcus neoformam var neoformans JEC2I] Hypothetical protein [Cryptococcus  neoformans JEC2II Peptidyl-prolyl cis-trann isomerase, putative ICiyptococcus neoformans  2. Conserved hypothetical protein [Cryptococcus neoformans var.  neoformansiEC2tj  1.  Conserved hypothetical protein ICryptococcus neoformans var.  Arsenite transporter, putative [Cryptococcus neoformans var. neoformans JEC2I]  [Cryptococcus neofomsans var neoformans JEC2II  Beta-fructofaranosidase, putative  Conserved hypothetical protein ICryptococcus neoformans var. neoformans JEC21I Lipid metabolism-related protein, putative [Cryptococcus neoformans var. neoformansJEC2l] Phosphoketolase, putative (Ciyptococcus neoformans var neoformarm JEC2II  [C’bococeta neoformans neoformans JEC2I]  Ubiquitin-specific protease, putative  Predicted Function  Maltose porter, putative [Cryptococcus neoformans var neoformans WC21J  of  1016698-  1016102  1015920-  101  1462. 1013368  1006239. 1008150  10026861005535  999822  996999-  9901 9923 18  0.000-RN)  AAW46253. I  AAW46252. I  989256  986095.  979463  976729-  975227  2. AAW46254. 1  0.000+00  983787985684  0.000+00  AAW46259, I  I. AAW46255 I  979852 981630  0.000+00  AAW46260.t  968524971244  967576  0.OOE+O0  -  AAW46239. I  963907  Coordinates  0.000+00  E-valne  AAW46261.1  Protein 11) RV66095  1.095  £566  Average LR  -3 810  -3 810  -3 810  -3 810  -3.810  -3.810  -3.810  -3 810  -3 810  -3 810  .3 810  -3.810  -3.810  -3.810  -3.810  -3.8 10  -3.810  3 810  GFP2  WM276 RV66095  Standard  0.309  £566  deviati,n  834  0.834  0.834  0 834  0.834  0.834  0.834  0.834  0  0 834  0834  0.834  0.834  0.834  0.834  0.834  0.834  0.834  0 834  GFP2  WM276  of LR  M  Q  Ut  —  L  —  K  CUR  -  -  18042- 34542  117718118002  11 5522 116228  15933- 27285  4185- 12323  996112 10227621025404  994255  Coordinates describing the area  L-arahinitol 4-dehydrogenase furkeliana B05.10] Rab guanyl-nucleotide exchange factor, putative [Cryptococcus neoformans var. neoformans JEC2II Rah guanyl-nucleotide exchange factor, putative [Cryptococcus neoformans var. neoformans JEC2I  17836-19747  22505 23568  23929- 25427 115049118606  1150491  3.OOE-23  3.00E-44  0.OOE+00  2.OOE-04  3.000133  3.000133  XP_660562.l  1. AAW46844.1; 2. AAW46973. 1  5’. AAW43751. I, 3’: AAW43753.1  XP_001 546302.1  18755 20636  22289- 22869 24567- 25457 27772 28944  0 000+00  0.000+00  7.300-01  8.OOE-02  AAW46863 I  AAW43042. I  ABJ8I 358.1  ABWIO7OS I -  -  16509- 18440  0.000+00  -  21235- 22150  AAW46868.I  A.AW44949. I  AAW44949 I  5’ GO_component mitochondrial matrix; GO_process: iron ion transport 3’: noGOternis  13808- 16468  GO_component: peroxisomal matrix; GO_function: 2,4-dienoyl-C0A  protein  Expressed protein (Cryptococcus neoformans var._neoformass JEC21J tRNA (5-methylaminomethyl-2thiouridylate)-methyhransferase, putative (Cryptococcus neoformuns var. neoformatni JEC2I] Hypothetical protein [Cryptococcus neoformam var._neoformam JEC2II Gid protein [Solibacter usitattis EllinóO76] Putative DNA-binding protein [Frankin sp. EANipec]  [Botryotinia  neoformans JEC2I] Tranaketolase, putative [Cryptococcus neoformsns var. neoformam JEC21J Hypothetical protein [Aspergillus nidulass FGSCA4] 1. Expressed protein ICryptococcut neoformans var. neoformans JEC2II 2. Hypothetical protein [Cryptococcus neoformans var._neoformans JEC21]  (Cryptococcus neoformans var.  095  GO te  I 336 1.336 I 336  -2 476 -2.476 -2 476  no GO terms no GO terms  GO_component:  1.336  1.336  no GO terms  -2.476  0.673  0864  -2.476  GO terms  1.128  -1.897  0.864  0 864  mitochondrion; GO_function: tRNA (5methylaminomethyl-2-thiouridylate)-methyltransferase activity  no  0.910  1.101  1 101  1.101  1 101  0 864  -1.897  GO_component: vacuole (sensu Fungi); GO_component vacuolar membrane; GO function: Rab guanyl-nucleotide exchange factor activity; GO_process vacuole organization and biogenesis; GO_process: homotypic vacuole fusion, non-autophugic GO_component: vacuole (sense Fungi); GO_component: vacuolar membrane; GO_function: Rab guanyl-nucleotide exrhange factor activity; GO_process: vacuole organization and biogenesis; GO_process homotypic vacuole fusion, non-sutophagic  309  —  0  E566  0.377  GFPI  WM276  deviati of LR  0 864  0417  0.723  RV66095  Standard  -1 897  5’: Iron ion transport-related protein, putative [Cryptococcus neoformam var. neoformaus JEC2I] 3’: Conserved hypothetical protein [Cryptococcus neoformans var. neoformam 3EC21] no  GFP2  WM276  -1 897  -2.045  -2.045  -2.045  -2.045  1  -1 897  0.720  -1.055  RV66895  Average LR  no GO terms  no GO terms  Saccharomyces); GO_process: ffitty  reductase (NADPH) activity; GO_process: sporuletion (tenSu acid catabolism GO_component: cytoplasm; GO_function: tramketolase activity; GO_process: pentose-phosphate shunt  aldehyde  Conserved hypothetical  0.OOE+00  13163  AAW43392.1  -  12051  0.000+00  AAW43772 1  no GO terms  GO_component: nucleus; GO_component: cytoplatm; GO_fUnction: reductase activity; GO_fUnction: aldo-keto reductase activity; GO function: oxidoreductase activity; GO_process: arabinose metabolism;_GO_process:_D-xylose_metabolism  9817- 11296  0.000+00  AAW41727.1  terms  GO terms  no GO terms  no  no GO  Gene Ontology  Oxidoreductase, putative [Cryptococcus neoformam var. neoformans JEC2II  6245- 9139  5300  4.000-16  -  5’: AAW47184.1; 3’: AAW47191 .1  2421  0.OOE+00  Conserved hypothetical protein ICryptovoccus neofornians var. neoformaissJEC2l) 5’: Expressed protein (Cryptococcus neoformans var. neoformans JEC2I I 3’: Epoxide hydrolase I, putative (Cryptocorcus neofornians var. neoformansJEC2l]  neoformansvar. neoformassJEC2l]  996601  101 NOGENE  Hypothetical protein ICryptococcus  996050-  JEC2IJ  neofornsans var.  996601 neoformans  Hypothetical protein [Cryptococcus  Predicted Funetioa  101  996050-  Gene  of  6.OOE-  6.OOE-  E-value  Coenhaintes  AAW43794 I  AAW46252. I  AAW46252. I  Protein H)  __________  N  U’  —  M  CHR  1  110385 110657  144848147013  2.OOE-2l  4.OOE174  0.00E400  5’: AAW42139.l; 3’. AAW42I4I.1  l.AAW4693I.l AAW46822.l  AAW46822.l  1091 85 112141  673986 676134 -  AAW45902.I  674609678906  0.OOE+00  27709- 28705  0.OOE+00  AAW4700I .1  28665 28797  -  1833 -4410  0.OOE-fOO  -  AAW43770 I  148279  147224  1706- 2416  147913  2.  70626- 76341  0.OOE+00  AAW46851. I  74382- 75513  146844-  36367- 39520  0.OOE+00  AAW46862.l  -  34680 36185  0.00E+00  AAW46864. I -  33617- 34087  29416- 30801  8.OOE111  AAW44723  2.OOE-28  5’: AAW44720 1;  3’  8.OOE-02  ABWIO7O5.1  28944  24567  7.30F,-0t  ABJ81358. 1  25457  22289- 22869  0.OOEJ-00  AAW43042.1 -  18755- 20636  0.OOE+00  AAW46863.l  27772-  16509-  18440  33617- 34087  29416- 30801  Coordinates o( Gene  0.OOE+00  111  8.OOE-  2.00E-28  E-value  AAW46868.l  AAW46837.1  3’. AAW44723. 1  AAW44720 I;  5’:  Protein ID  AAW46837.l  18324- 36715  area  Coordinates deacnhing the  -  kinase, neofommans var.  var.  neoformans  var.  protein [Solibacter usitatus E11in6076]  JEC2I]  protein kinase,  [Cryptococcus  JEC2I I  Conserved hypothetical protein  5’: GO_component: cytoplasm; GO_component: cAMP-dependent GO_function: protein serine/threonine kinase  ‘in  GO  terms  terms  terms  kinase complex;  protein  [Cryptococcus JEC2II  neoformam var. nesformans  Expressed  Hexose  transport-related protein, (Cryptococcus neoformaas var. neoformam JEC2I]  aeoformaimJEC2lJ potaiive  potative [Cryptococcus neoformans var.  Ribosome biogenesis-related protein,  GO_function:  GO  te  noGOternts  GO  activity; GO_process: processing of 20S  component: cytoplasm  mannose  activity; GO_function: glucose  plasma membrane; GO_function: fructose transporter transporter activity; GO_function: transporter activity; GO process: hexose transport  biogenesis GO_component:  ribosome  GO_component: nucleus; GO_process rENA processing; GO_process  noGOterins  GO  GO_component: cytoplasm  pre-rRNA  GO_component: nucleus; GO_component cytosol; GO_function: protein kinase activity; GO_function: nucleocytoplasmic transporter  GO_function: cysteine-type peptidase activity  3’:  pee-  component: soluble fraction; GO_function: chaperone activity;  GO terms  5’: GO  no  rRNA  GO component small nucleolar ribonucleoprotein complex; GOfijnctioim snoRNA binding; GO_process: processing of 20S  no  no  3’:  GO_process: protem amino acid phosphorylation; GO_process: pseudohyphal growth; GO_process: Ras protein signal transduction  activity; GO_function: cAMP-dependent protein kinase activity;  1.noGOternts  JEC2I]  (5-  cAMP-dependent protein seriaelihreonine kinase  GO_component: cytoplasm; GO_component:  protein  5’:  no GO terms  no GO  no GO  2.  neoformam var. seoformaas  tRNA  Ras protein signal transduction  methylaminomethyl-2-thiouridylate)-methyltransferase activity  neoformainiEC2lj  Cytoplasm protein, putative [Cryptococcus  GO_process:  GO_component: mitochondrion; GO_function:  an  terms  GO  no GO  3  pseudohyplial growth;  activity; GO_function: cAMP-dependent protein kinase activity; GO_process: protein amino acid phonphorylation; GO_process:  protein kinase complex;  Gene Ontology  2. Cytoplasm protein, putaiive (Cryptococcus neoformans var. neoforinam JEC2I]  neoformans JEC21) 3’. Conserved hypothetical protein [Cryptococcus neoformans var. neoformam JEC2I] 1. Conserved hypothetical protein [Cryptococcus neoforinans var.  [Cr3.ptococcus neoformam var.  5’.  neoformam var._neoformans  Hypothetical protein [Cryptococcus  Hypothetical protein [Cr’iitococcus neoformain var. neoformaim JEC2I)  neoformans var. neoformam JEC2I] Hypothetical protein (Cryptococcus neofurmans var. neoformaiw JEC21I  Hypothetical protein [Cryptococcut  putative  neoformans var. neofommans JEC21] 3’ hypothetical protein [cryptococcus neoforinam var neofornsaas WC21  5’. cAMP-dependent  EANlpecI  Putative DNA-binding protein [Frankia sp.  Gid  neoformans var. neoformans  Hypothetical protein [Cryptococcas  neofornians_JEC2I]  [Cryptococcus  thiouridylate)-methyltransferase, putative  tRNA (5-methylaminomethyl-2-  Hypothetical protein  [Cryptococcus neoforinans var. neoformans JEC2I I Expressed protein ICiyptococciis neoformass var._neoformans JEC2I]  neoformans  [Cryptococcus neofommans JEC2I[  neoformans JEC2I] 3’ hypothetical protein  putative [Cryptococcus  5’. cAMP-dependent protein  Predicted Punction  -2.274  -0.990  -0.990  -1.194  -0.785  -2.678  -2.678  -2.678  -2.678  -2 678  -2.678  -2.678  -2 678  -2.678  RV64H195  -0.994  -2524  -2.476  -2.476  E566  Average LR WM276 GFP2  996  0 849  0.685  0685  0.928  0.377  0.996  0.996  0 996  0.996  0  0.996  0.996  0.996  0.996  RV66095  0.130  1.230  1.336  1.336  E566  WM276 GFP2  Sta.dard deviation otLR  APPENDIX B  C  II C  -“ C  ‘E c)C C  152  APPENDIX C  Appendix C  —  Expanded analysis for section 3.2 of the Results (Preferential retention of certain chromosomes by AD strains)  From the CGH analysis (see Figure 3.4 and Table 3.7), it was hypothesized that the AD strains (CDC228, KW5 and CDC3O4) preferentially retained specific chromosomes from only one of their parental strains. In order to test this hypothesis, a series of PCR-RFLP analyses were performed to identify the serotype of origin for CHR 1, CHR 2, CHR 3 and CHR 5. The PCR-RFLP approach involved amplifying a conserved section of DNA from the chromosome of interest and then performing a restriction digest.  These conserved regions were identified by  aligning the locus of interest from H99 (serotype A) to the same locus from JEC2 1 (serotype D). As documented below, the overall result was that the PCR-RFLP patterns of the chromosomes in the three strains (CDC228, KW5 and CDC3O4) were in accordance with the predictions made by the CGH data. CHR 5 was selected for initial testing (see Figure C.l and Figure 3.5). From the CGH data (see Figure 3.4 and Table 3.7), one would predict that strains CDC228 and KW5 retained both a serotype A and a serotype D version of CHR5, but strain CDC3O4 appeared to be missing the serotype A version of this chromosome. As shown in Figure C.1, the PCR-RFLP analysis, in general, supported the hypothesis that strain CDC3O4 had only a serotype D version of CHR5 and was lacking a serotype A version (lanes 10 and 11).  The faint serotype A bands could be  the result of incomplete digestion. More interestingly, the PCR-RFLP revealed an unexpected banding pattern for KW5 (lanes 8 and 9 of Figure C.1).  One possible explanation for this  unexpected pattern is that KW5 has indeed retained both a serotype A version and a serotype D version of CHR 5, but that the serotype A version for CHR 5 has a polymorphism such that it 153  APPENDIX C  gives a different banding pattern. To test this idea and to ensure that the faint serotype A bands seen in lanes 10 and 11 were due to incomplete digestions, another PCR-RFLP was performed with a different restriction enzyme (Figure C.2). JEC21 2 3  Size in kb  H99 4 5  2  —  CDC 228 KW5 6 8 7 9 —  —  CDC 304 10 11 12  Lack serotype A? Or incomplete digestion?  —  1 Polymorphisms?  0.5  1. 2. 3. 4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC21 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. CDC228 digested 8. KW5 9. KW5 digested 10. CDC3O4 11. CDC3O4 digested 12. No template control  Figure C.1 Analysis of three AD strains for the serotype-specificity of CHR 5 with the primer pair CNE04380 F I R. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by H99. The amplicons were digested by Hindlil after purification with the Qiagen Nucleotide removal kit.  1 Sizeinkb  .IEC21 23  4  1199 CDC 228 56 7 8  1.6  KW5 CDC 304 9101112 —  —  1  4  Lack serotype A 0.5  1. 2. 3. 4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC2 1 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. 8. 9. 10. 11. 12.  CDC228 digested KW5 KW5 digested CDC3O4 CDC3O4 digested No template control  Figure C.2 Analysis of three AD strains for CHR 5 with the primer pair CNE04380 F I R. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by H99. The amplicons were digested by Sad after purification with the Qiagen Nucleotide removal kit. 154  APPENDIX C  The resulting restriction digestion patterns for CHR 5 supported the CGH data. That is, CDC3O4 had only a serotype D version for CHR 5, whereas the other two strains, CDC228 and KW5, had both a serotype D and serotype A version for the chromosome. The results shown in Figure C.2 also confinned the hypothesis that was generated based on the results in Figure C. 1. That is, the serotype A version of CHR 5 for strain KW5 had a polymorphism that indicated a sequence difference compared with H99. In order to more thoroughly investigate the idea of preferential retention of certain chromosomes for the three AD strains, additional PCR-RFLP analyses were performed on two chromosomes (CHR 2 and CHR 3) where all of the strains appeared to retain both a serotype A and a serotype D version (Figure C.3, Figure C.4, Figure 3.5 and Table 3.7). As shown in Figures C.3 and C.4, the resulting restriction digestion patterns supported the CGH data. That is, CDC228, KW5 and CDC3O4 appear to retain both a serotype A copy and a serotype D copy for both CHR 2 and CHR 3.  155  APPENDIX C  Size in bp  CDC 228 CDC 304 JEC21 H99 KW5 1 23 4 56 7 891011  500_— 400  • .  300  lb  200  1. 2. 3. 4. 5.  .  JEC2 1 (Serotype D) JEC2 1 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  ,  6. 7. 8. 9. 10. 11.  .  CDC228 digested KW5 KW5 digested CDC3O4 CDC3O4 digested No template control  Figure C.3 Analysis of three AD strains for CUR 3 with the primer pair acidphos F I R. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by H99. The amplicons were digested by TaqI after purification with the Qiagen Nucleotide removal kit.  1  Sizeinkb  2  3  4  5  6  7  8  9  10  11  1  —  — — — — — —  0.5  0.4 1. 2. 3. 4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC2 1 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. 8. 9. 10. 11.  CDC228 digested KW5 KW5 digested CDC3O4 CDC3O4 digested  Figure C.4 Analysis of three AD strains for CUR 2 with the primer pair CNBO 1970 F I R. As in the CGH analysis, serotype D is represented by JEC2 1 and serotype A is represented by 1199. The amplicons were digested by NdeI after purification with the Qiagen Nucleotide removal kit. 156  APPENDIX C  Previously, it was hypothesized that clinical AD strains might preferentially retain a serotype A version because serotype A is the more virulent serotype compared with serotype D (Ohkusu et al., 2002). This hypothesis was supported by the CGH result because all three clinical strains  (CDC228, KW5 and CDC3O4) retained only a serotype A version of CHR 1. As a first step to examine CHR 1 in more detail, a PCR-RFLP analysis was performed to verify the CGH data (Figures C.5 and C.6, Figures 3.6 and 3.7).  Sizeinkb  2  1  3  4  5  6  7  8  — 05  9  10  a  —  11 Lacking serotype A  _*—— 1. 2. 3.  4. 5. 6.  DNA ladder  JEC21 (Serotype D) JEC2 1 (Serotype D) digested H99 (Serotype A) H99 (Serotype A) digested CDC228  7. 8. 9. 10. 11.  CDC228 digested  KW5 KW5 digested CDC3O4 CDC3 04 digested  Figure C.5 Analysis of three AD strains for CHR 1 with the primer pair CNA123O F I R. As in the CGH analysis, serotype D is represented by JEC21 and serotype A is represented by H99. The amplicons were digested by NheI after purification with the Qiagen Nucleotide removal kit. As shown in Figure C.5, it was difficult to conclude whether or not these strains had truly preferentially retained the serotype A copy of CHR 1 because of the presence of faint serotype A band in lanes 5, 7, 9 and 11. These faints bands could result from incomplete digestion of the DNA or from strain polymorphisms such as those seen in Figure C.1, which prevented all of the gDNA from being digested.  Other possibilities include the idea that there was gDNA  contamination or that the strains themselves were not pure clonal populations. As a result, a 157  APPENDIX C  different enzyme was chosen for additional PCR-RFLP analysis of locus CNAO 1230 on CHR 1 (Figure C.6). Sizeinkb  1  2  3  4  5  6  11  2  1.6  Lacking serotype D  1  1. 2. 3.  4. 5. 6.  DNA ladder JEC21 (Serotype D) JEC2 1 (Serotype D) digested 1199 (Serotype A) H99 (Serotype A) digested  7. CDC228 digested 8. KW5 9. KW5 digested 10. CDC3O4  11. CDC3O4 digested  CDC228  Figure C.6 Analysis of three AD strain for CHR 1 with the primer pair, CNA123O F I R. As in the CGH analysis, serotype D is represented by JEC2 1 and serotype A is represented by H99. The amplicons were digested by Stul after purification with the Qiagen Nucleotide removal kit.  As shown in Figure C.6, there were no serotype D bands in lanes 7 and 9, thereby suggesting that the faint bands seen in Figure C.5 for strains CDC228 and KW5 were merely the result of incomplete digestion and not because of contaminating gDNA. The question, however, still remained as to the cause for the faint bands seen in CDC3O4 for Figures C.5 and Figure C.6. As discussed in the main text of the thesis, a further PCR-RFLP analysis (shown in Figure 3.5) was conducted and this experiment verified that strain CDC3O4 was not a pure population. Specifically, some of the cells in the CDC3O4 population had both a serotype A version and a serotype D version of CHR 1, whereas other cells in the population (the majority) had only a serotype A version of CHR 1. 158  APPENDIX C  The idea that clinical AD strains preferentially retain a serotype A version of CHR 1 was more thoroughly investigated in a series of PCR-RFLP studies on 30 additional strains (clinical isolates, environmental isolates and laboratory-generated hybrids). The goal was to test whether or not clinical strains (such as the strains used for the CGH analysis) preferentially retain the serotype A version of CHR 1 (Figure C.7 and Table 2.5). Two different restriction enzymes, Aval and MspI were used for this analysis, as indicated in the legends for the figures.  A  summary of the 30 clinical, environmental and laboratory generated AD strains can be found in Table 3.8; overall, this analysis indicated that the serotype A version of CHR 1 are preferentially retained in clinical isolates or that the serotype D version is preferentially lost.  Figure C.7A PCR-RFLP analysis of CHR 1 in eight clinical strains. The restriction enzyme Aval was used. Size in kb  0.7 0.5  0.1  1. 2. 3. 4. 5. 6.  1 kb plus ladder Jec2 1 (Serotype D) H99 (Serotype A) MAS92-0005 MAS92-0026 MAS92-0046  7. MAS92-0047 8. MAS92-0062 9. MAS92-0066 10. MAS92-0074 11. MAS92-0174 12. 1 kb plus ladder  Figure C.7 PCR-RFLP analysis was performed on a total of 30 strains to test whether AD strains preferentially retain only a serotype A version of CHR 1. The data for the additional strains are presented in Figures C.7B-F. All of the PCR-RFLP’s were performed on the conserved locus CNAO 1230 with restriction enzyme AvaT. 159  APPENDIX C  Fig. C.7 B PCR-RFLP analysis of eight additional clinical strains at CHR 1. The restriction enzyme Aval was used. 123  Size in kb  4  5  6  7  8  9  10  11  12  —I-  1  0.7  — —  —U1 i  0.5  0.1 1. 2. 3. 4. 5. 6.  7. MAS92-0283 8. MAS92-0328 9. MAS92-0354 10. MAS92-0355 11. MAS92-0383 12. 1 kb plus ladder  1 kb plus ladder Jec2l (Serotype D) H99(SerotypeA) MAS92-0181 MAS92-0190 MAS92-0280  Fig. C. 7 C PCR-RFLP analysis of four environmental and two laboratory generated strains at CHR1. The restriction enzyme Aval was used. Because unexpected banding patterns appeared for the strains NC42-10, NC6-20 and XL 1462 (lanes 4, 6, and 9) these strains were analyzed with a different restriction enzyme in Figure C. 7 D. It was suspected that the different banding patterns were the result of strain polymorphisms. Laboratory constructed strains Environmental strams  Size in kb 1.0 0.7  0.5  2  3  —  (4 -  5  6  7’  8  — — ..—  — —  9  10  1. 2. 3. 4. 5.  DNA ladder JEC21 Serotype D 1199— Serotype A NC42-10 NC5-19 —  6. NC6-20  7. ICB 134 8. KBL—AD1 9. XL 1462  0.1  10. DNA ladder 160  APPENDIX C  Fig. C. 7 D PCR-RFLP analysis of four environmental and two laboratory generated strains at CHR1. From Figure C.7 C, unexpected band patterns appear for NC42-lO, NC6-20 and XL 1462. To test the idea that these patterns were the result of sequence polymorphisms, a different restriction enzyme (MspI) was used. Laboratory constructed strains Environmental strams Size in kb  (4  3  8 1. DNA ladder 2. JEC21 Serotype D 3. H99 Serotype A 4. NC42-10 5. NC5-19 6. NC6-20 7. ICB 134 8. KBL-AD1 9. XL 1462  2.0  —  1.6  —  1.0 0.7 0.5  e  Fig. C. 7 E PCR-RFLP analysis of four laboratory generated strains at CHR 1 with the restriction enzyme MspI 2  3  4567  Size in kb 1.0  a. —  0.7  —  ,..  .  .  1. 2. 3. 4. 5. 6. 7.  1 kb plus ladder H99 Jec2l XL1514 XL1548 XL1552 1 kb ladder  v.-...  161  APPENDIX C  Fig. C. 7 F PCR-RFLP analysis of five clinical strains and three environmental strains at CHR 1 with restriction enzyme Aval Environmental strains Clinical strains  Clinical strains 9  10  —  11  —  12 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.  1kb plus ladder JEC21 1199 1t752 clinical: AD 1t756 clinical: AD Nc 10-23 environmental: AD Nc34-21: environmental: AD Nc35-5 environmental: AD mmRLl365 clinical: AA Zg287 clinical: DD Zg290 clinical: AD  162  APPENDIX D Appendix D  Expanded analysis for the Results sections 3.4 and 3.5 (Chromosome Copy Number Variation (CCNV) for the serotype A strains CBS7779 and WM626, and selected additional strains).  D.1 Primer evaluation for qRT-PCR. The CGH data analyzed in this thesis was validated by qRT-PCR experiments.  Initially, there  were considerations regarding the quality of the primers because poorly designed primers can lead to misleading qRT-PCR results or failed amplifications (Lim et a!., 2008). To address this issue, each primer set was designed in a conserved region of the H99 and JEC21 genome. In addition, primers were designed so that they should theoretically only bind to one locus in the genome. To ensure this, each primer set was blasted against the H99 genome (BLASTn) in order to check that there were no secondary binding sites. As shown in Table D. 1, the second E-value from the BLASTn search was above 0.3 for each of the primers, thus indicating specific binding. Also, none of the matches from the second E-value had binding at the 3’end as revealed by the BLASTn sequence alignments (data not shown).  163  APPENDIX D  Table D.1 Evaluation of the primers used for qRT-PCR. Primer sets (and the gene) were blasted against the H99 database. First E-value Primer I Gene 3 x i0 CNA04650 F 1 x i0 CNA04650 R 0 CNA04650 (the gene) 5 3x10 CNNOO82OF 6 8x10 CNNOO82OR 0 CNNOO82O (the gene) 6 8x10 CNNO189OF 9 4x1W CNNO1890R 0 CNNO189O (the gene) 0.004 CNNO2400F 6 2x10 CNNO2400R 0 CNNO2400 (the gene) 0.001 SMG1 F 4 1x10 SMG1R 0 SMG(thegene) 5 3x10 00707F lx 10 00707R 0 00707 (the gene) a Number of sequence mismatches in the sequenced region  Second E-value 1.7 0.42 2 x i0 (88 of 108)a 0.11 0.12 0.033 (20 of 2007)a 0.48 0.85 0.077 (20 of 4749)a 3.8 2.1 0.017 (21 of 4252)a 1.2 0.42 0.12(190f1911)a 1.7 0.42 0.5 (18 of 2022)a  D.2 Additional evidence for disomy in the serotype A strains CBS7779 and WM626. In addition to the support provided by qRT-PCR for the idea that CBS7779 had an extra copy of CHR 13, a gene replacement approach was also used to confirm disomy. Specifically, the APT] gene on CHR 13 was targeted for replacement with a neomycin resistance marker in strains H99, CBS7779 and WM626 with the goal of obtaining a deletion in the single copy in H99 and in one of the (hypothesized) two copies in the other strains. APT] encodes a putative P type ATPase in strain H99 based on the annotation from the Broad database (designated  164  APPENDIX D CNAG06469 in strain H99 and CNNO189O in strain JEC21).  The constructs used for the  deletion were made by a modified overlapping PCR strategy (Hu & Kronstad, 2006).’ Through Southern hybridization analysis, it was observed that the H99 transformants had the genotype expected for replacement of the single copy of the gene to yield a disruption mutant. Meanwhile, WM626 transformants had one wild-type copy of the APT] gene and one copy that was replaced with the neomycin marker, thus supporting the hypothesis that more than one copy of CHR 13 is present in this strain (see Table D.2). For CBS7779, both the colony PCR and hybridization patterns of the transformants with the neomycin marker were identical to those of the H99 mutant. This suggested that APT] was not present in more than one copy in the original strain (see Table D.2). One possible interpretation of this result is that strain CBS7779 was a mixed population in which only some cells had more than one copy of CHR 13. Another possible explanation is that both copies of the APT] gene were replaced in the strain CBS7779. As described below, qRT-PCR of the neomycin marker and three other genes on CHR 13 in selected CBS7779 transformants revealed the presence of a single copy at all of the loci (see Table D.2). It was then hypothesized that copy number instability for CHR 13 resulted in the loss of one copy during the transformation procedure. This idea is supported by the fact that it was later found that the population of cells for strain CBS7779 was heterogeneous in that some cells have one copy and some have two copies of CHR 13 (see 3.4.2).  1  Further details about the construction of these mutants and the subsequent southern hybridization can be found in (Hu et al., 2008).  165  APPENDIX D  Table D.2 qRT-PCR results for a select number of CBS7779 and WM626 mutants (replacement of the CNNO 1890 locus with a neomycin marker). Normalized copy numbers which are higher than 1.5 are highlighted in yellow (representing duplications). Normalized copy numbers which are lower than 0 are highlighted in blue (representing absence of gene / deletion). Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  AACt  ACtgenome  Normalized gene copy number relative to H99 Ct) 2 (  H99 H99 (mutant) CBS7779 CBS7779 (mutant 15) CBS7779 (mutant 16) WM626 WM626 (mutant)  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  19.5 19.0 18.5 18.5 19.5 17.9 17.9  20.2 19.7 20.0 19.5 20.2 19.8 19.8  -0.8 -0.7 -1.6 -0.9 -0.7 -1.9 -1.9  -0.8 -0.8 -0.8 -0.8 -0.8 -0.8 -0.8  0.0 0.1 -0.8 -0.1 0.1 -1.1 -1.1  1.0 0.9 1.7 1.1 0.9 2.2 2.1  H99 H99 (mutant) CBS7779 CBS7779 (mutant 15) CBS7779 (mutant 16) WM626 WM626 (mutant)  CNNO189O CNNO189O CNNO189O CNNO189O CNNO189O CNN01890 CNNO 1890  19.0 34.5 18.1 35.0 40.0 17.3 18.4  20.2 19.7 20.0 19.5 20.2 19.8 19.8  -1.3 14.8 -2.0 15.6 19.8 -2.5 -1.4  -1.3 -1.3 -1.3 -1.3 -1.3 -1.3 -1.3  0.0 16.1 -0.7 16.8 21.1 -1.3 -0.2  1.0  H99 H99 (mutant) * CBS7779 CBS7779 (mutant 15) CBS7779 (mutant 16) WM626 WM626 (mutant) * this strain was  Neomycin 26.0 Neomycin 19.5 Neomycin 30.2 Neomycin 19.1 Neomycin 20.0 Neomycin 30.2 Neomycin 19.4 used as a calibrator in this  -0.2 5.8 -0.2 -0.2 10.1 -0.2 -0.2 -0.3 -0.2 -0.3 10.5 -0.2 -0.4 -0.2 of amplifications  6.0 0.0 10.3 -0.1 -0.1 10.7 -0.2  20.2 19.7 20.0 19.5 20.2 19.8 19.8  group  . 1.6 — — 2.4 1.1  1.0 1.1 1.0 1.2  D.3 Analysis of the relationship between disomy at CHR 13 in strain CBS7779 and melanin formation. As described in section variable melanin production.  3.4.2  of the  main  text, it  That is, approximately  1  was  noted  colony per  that CBS7779 1000  (white) compared to the normally black or brown colonies formed by DOPA medium. Subsequently,  it  displayed  was less melanized  C. neoformans on L  was hypothesized that this phenotypic change might be due to  166  APPENDIX D the instability of the disomy found for CHR 13. To test this idea, qRT-PCR was performed on 12 black colonies and 12 white colonies with the result that the black colonies were monosomic for CHR 13 and the white colonies were disomic for CHR 13 (Table 3.10, Table D.3). Overall, the data supports the idea that highly melanized strains are monosomic for CHR 13 and that lightly melanized strains are disomic for CHR 13. However, in order to further test the idea that the degree of melanization is related to the copy number of CHR 13, single isolates which were either highly melanized or single isolates which were lightly melanized were selected for further analysis (see Figure 3.11). That is, a single highly melanized isolate was grown up overnight in YPD (3 0°C) and then plated on L-DOPA medium, after which single isolates of either highly melanized or lightly melanized isolates were chosen and subjected to further qRT-PCR experiments. This process was repeated for a total of three screens. Tables D.7 to D.14 detail the results from these qRT-PCR experiments and Figure 3.11 summarizes the results. For a further discussion of the data please see sections 3.4 and 4.2 in the main body of the thesis.  D.4 Nomenclature for the CBS7779 isolates For the strains listed in Tables D.7 to D.14, the following nomenclature was developed to keep track of the melanin phenotypes of the isolates and their origin in terms of the screens: 1. The first descriptor (black or white) followed by a number designates the phenotype of the strain during the first screen. 2. The second descriptor (black or white) followed by a letter designates the phenotype of the strain during the second screen.  167  APPENDIX D 3. To simplify matters, letters are used to described isolates from the third screen where “B” stands for highly melanized strains and “W” stands for lightly melanized strains. The following example is provided to illustrate the nomenclature: An isolate that was originally  highly melanized in the first screen was designated CBS7779 Black 1 (B 1). When this isolate (CBS7779 Black 1 (B 1)) was grown on L-DOPA, a white isolate was found (designated CBS7779 Black 1 White C (B1WC). This isolate (CBS7779 Black 1 White C (B1WC)) was then grown on L-DOPA and a highly melanized isolate was found (designated CBS7779 Black 1 White C Black F or CBS7779 B1WC BF).  Table D.3 qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Primer  Strain  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 CBS7779B1 CBS7779 B2 CBS7779 B3 CBS7779 Wi CBS7779 W2  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.98 18.04 16.59 17.18 17.20 17.37 17.50  20.11 19.24 16.90 17.79 17.82 17.87 17.84  -0.13 -1.20 -0.31 -0.61 -0.62 -0.50 -0.34  -0.13 -0.13 -0.13 -0.13 -0.13 -0.13 -0.13  0.00 -1.07 -0.18 -0.48 -0.49 -0.37 -0.21  1.00 2.10 1.13 1.39 1.40 1.29 1.16  H99 JEC21 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  19.81 19.08 16.68 17.34 17.55 16.48 16.55  20.11 19.24 16.90 17.79 17.82 17.87 17.84  -0.30 -0.16 -0.22 -0.45 -0.27 -1.39 -1.29  -0.30 -0.30 -0.30 -0.30 -0.30 -0.30 -0.30  0.00 0.14 0.08 -0.15 0.03 -1.09 -0.99  1.00 0.91 0.95 1.11 0.98 2.13 1.99  Bi B2 B3 Wi W2  168  APPENDIX D  Table D.4 qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13 and the 00 707 locus is on CHR 4. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  Actgenome  AACt  gene  Normalized gene copy number relative to H99 4t) 2 (  H99  SMG1  16.66  17.16  -0.50  -0.50  0.00  1.00  JEC2I  SMO1  17.34  18.99  -1.65  -0.50  -1.15  2.22  CBS7779B4  SMG1  17.71  18.35  -0.64  -0.50  -0.14  1.10  CBS7779 B5  SMG1  17.62  18.43  -0.81  -0.50  -0.31  1.24  CBS7779B6  SMG1  17.60  18.32  -0.72  -0.50  -0.22  1.16  CBS7779 W4  SMG1  17.50  18.30  -0.80  -0.50  -0.30  1.23  CBS7779 W5  SMG1  17.78  18.43  -0.65  -0.50  -0.15  1.11  CBS7779 W6  SMG1  18.00  18.44  -0.44  -0.50  0.06  0.96  H99  CNNOO82O  16.49  17.16  -0.67  -0.67  0.00  1.00  JEC2 1  CNNOO82O  18.27  18.99  -0.72  -0.67  -0.05  1.04  CBS7779 B4  CNNOO82O  17.64  18.35  -0.71  -0.67  -0.04  1.03  CBS7779 B5  CNNOO82O  17.78  18.43  -0.65  -0.67  0.02  0.99  CBS7779 B6  CNNOO82O  17.64  18.32  -0.68  -0.67  -0.01  1.01  CBS7779 W4  CNNOO82O  16.47  18.30  -1.83  -0.67  -1.16  2.23  CBS7779 W5  CNNOO82O  16.87  18.43  -1.56  -0.67  -0.89  1.85  CBS7779 W6  CNNOO82O  16.94  18.44  -1.50  -0.67  -0.83  1.78  1199  00 707  16.00  17.16  -1.16  -1.16  0.00  1.00  JEC21  00 707  17.54  18.99  -1.45  -1.16  -0.29  1.22  CBS7779B4  00_707  17.08  18.35  -1.27  -1.16  -0.11  1.08  CBS7779B5  00 707  16.91  18.43  -1.52  -1.16  -0.36  1.28  CBS7779B6  00_707  16.71  18.32  -1.61  -1.16  -0.45  1.37  CBS7779 W4  00_707  16.70  18.30  -1.60  -1.16  -0.44  1.36  CBS7779 W5  00 707  16.96  18.43  -1.47  -1.16  -0.31  1.24  CBS7779 W6  00 707  17.03  18.44  -1.41  -1.16  -0.25  1.19  169  APPENDIX D  Table D.5 qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 CBS7779 B7 CBS7779B8 CBS7779 B9 CBS7779W7 CBS7779W8 CBS7779 W9  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.89 17.74 17.03 16.83 17.21 17.17 17.16 16.92  20.45 19.65 17.93 17.85 18.29 18.10 17.89 17.80  -0.56 -1.91 -0.90 -1.02 -1.08 -0.93 -0.73 -0.88  -0.56 -0.56 -0.56 -0.56 -0.56 -0.56 -0.56 -0.56  0.00 -1.35 -0.34 -0.46 -0.52 -0.37 -0.17 -0.32  1.00 2.55 1.27 1.38 1.43 1.29 1.13 1.25  H99 JEC21 CBS7779 B7 CBS7779 B8 CBS7779B9 CBS7779 W7 CBS7779 W8 CBS7779 W9  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  19.87 19.07 17.22 17.13 17.57 16.43 16.22 16.07  20.11 19.24 16.90 17.79 17.82 17.52 17.87 17.84  -0.24 -0.17 0.32 -0.66 -0.25 -1.09 -1.65 -1.77  -0.24 -0.24 -0.24 -0.24 -0.24 -0.24 -0.24 -0.24  0.00 0.07 0.56 -0.42 -0.01 -0.85 -1.41 -1.53  1.00 0.95 0.68 1.34 1.01 1.80 2.66 2.89  170  APPENDIX D  Table D.6 qRT-PCR results for a select number of black and white strains derived from the original CBS7779 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 CBS7779B10 CBS7779B11 CBS7779B12 CBS7779 W10 CBS7779 Wil CBS7779 W12  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.98 17.88 16.83 17.15 17.30 17.10 16.93 16.85  20.34 19.59 17.65 17.84 18.10 17.66 17.49 17.39  -0.36 -1.71 -0.82 -0.69 -0.80 -0.56 -0.56 -0.54  -0.36 -0.36 -0.36 -0.36 -0.36 -0.36 -0.36 -0.36  0.00 -1.35 -0.46 -0.33 -0.44 -0.20 -0.20 -0.18  1.00 2.55 1.38 1.26 1.36 1.15 1.15 1.13  H99 JEC21 CBS7779B10 CBS7779 B11 CBS7779B12 CBS7779 W10 CBS7779W11 CBS7779W12  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  18.52 17.86 15.75 16.00 16.25 14.92 14.76 14.62  20.11 19.24 16.90 17.79 17.82 17.52 17.87 17.84  -1.59 -1.38 -1.15 -1.79 -1.57 -2.60 -3.11 -3.22  -1.59 -1.59 -1.59 -1.59 -1.59 -1.59 -1.59 -1.59  0.00 0.21 0.44 -0.20 0.02 -1.01 -1.52 -1.63  1.00 0.86 0.74 1.15 0.99 2.01 2.87 3.10  171  Table D.7 qRT-PCR results for a select number of black and white strains derived from well characterized  -0.98 -0.98 -0.98 -0.98 -0.98  -0.98 -1.02 -1.86 -1.78 -1.03  17.23 19.72 17.80 17.95 18.89  16.25 18.70 15.94 16.17 17.86  00_707 00 707 00_707 00 707 00_707  1199 JEC21 CBS7779 W2 Black A CBS7779 W2 Black C CBS7779 W2 White A  -1.49 -1.49 -1.49 -1.49 -1.49  -1.49 -1.37 -2.46 -2.59 -2.40  17.23 19.72 17.80 17.95 18.89  15.74 18.35 15.34 15.36 16.49  CNNOO 820 CNNOO 820 CNNOO 820 CNNOO82O CNNOO82O  H99 JEC21 CBS7779 W2 Black A CBS7779 W2 Black C CBS7779 W2 White A  -0.88 -0.88 -0.88 -0.88 -0.88  -0.88 -1.79 -1.75 -1.75 -0.84  17.23 19.72 17.80 17.95 18.89  SMG1 SMG1 SMG1 SMG1 SMG1  H99 JEC21 CBS7779W2B1ackA CBS7779W2B1ackC CBS7779 W2 White A  Ct(Avg.) test gene 16.35 17.93 16.05 16.20 18.05  Primer  Strain (Feb 18) ACtgenome  1.00 1.88 1.83 1.83 0.97 1.00 0.92 1.96 2.14 1.88 1.00 1.03 1.84 1.74 1.04  0.00 0.12 -0.97 -1.10 -0.91 0.00 -0.04 -0.88 -0.80 -0.05  t) 2 (  Normalized gene copy number relative to H99  0.00 -0.91 -0.87 -0.87 0.04  AACt  are highlighted in yellow.  Act gene  are higher than 1.5 Ct (Avg.) Actin  Normalized gene copy numbers which  black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates.  APPENDIX D Table D.8 qRT-PCR results for a select number of black and white strains from the first screen (Table 3.10). These are “second screen” isolates. A new primer set (00_707) was added to check for disomy of CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 CBS7779 Black 1 CBS7779B1ack2 CBS7779 Black 3 CBS7779 White 2 CBS7779White3  SMGI SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  16.29 17.76 17.65 17.27 16.82 17.21 17.62  17.35 19.96 18.54 18.56 17.85 18.18 18.49  -1.06 -2.20 -0.89 -1.29 -1.03 -0.97 -0.87  -1.06 -1.06 -1.06 -1.06 -1.06 -1.06 -1.06  0.00 -1.14 0.17 -0.23 0.03 0.09 0.19  1.00 2.20 0.89 1.17 0.98 0.94 0.88  H99 JEC2 1 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  16.66 19.27 17.84 17.74 17.20 16.58 16.96  17.35 19.96 18.54 18.56 17.85 18.18 18.49  -0.69 -0.69 -0.70 -0.82 -0.65 -1.60 -1.53  -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69  0.00 0.00 -0.01 -0.13 0.04 -0.91 -0.84  1.00 1.00 1.01 1.09 0.97 1.88 1.79  00 707 00707 00_707 00_707 00_707 00 707 00 707  14.15 16.51 15.29 15.37 14.43 15.32 15.43  17.35 19.96 18.54 18.56 17.85 18.18 18.49  -3.20 -3.45 -3.25 -3.19 -3.42 -2.86 -3.06  -3.20 -3.20 -3.20 -3.20 -3.20 -3.20 -3.20  0.00 -0.25 -0.05 0.01 -0.22 0.34 0.14  1.00 1.19 1.04 0.99 1.16 0.79 0.91  Black 1 Black 2 Black 3 White 2 White 3  H99 JEC21 CBS7779 Black 1 CBS7779B1ack2 CBS7779 Black 3 CBS7779White2 CBS7779 White 3  173  H99 JEC21 CBS7779 White 2 Black A CBS7779 White 2 Black B CBS7779 White 2 Black C CBS7779White2WhiteA CBS7779White2WhiteB CBS7779 White 2 White C  Black A Black B Black C White A White B White C  1.00 1.08 1.87 0.66 1.96 0.88 1.12 0.78 0.00 -0.11 -0.90 0.59 -0.97 0.19 -0.16 0.35 -1.51 -1.51 -1.51 -1.51 -1.51 -1.51 -1.51 -1.51  -1.51 -1.62 -2.41 -0.92 -2.48 -1.32 -1.67 -1.16  16.66 19.16 17.31 17.34 17.57 18.40 17.88 18.62  15.15 17.54 14.90 16.42 15.09 17.08 16.21 17.46  00 707 00 707 00 707 00 707 00 707 00_707 00_707 00_707  White 2 White 2 White 2 White 2 White 2 White 2  1.00 0.98 1.99 2.01 2.14 1.91 1.40 1.85 0.00 0.03 -0.99 -1.01 -1.10 -0.93 -0.49 -0.89  -1.26 -1.26 -1.26 -1.26 -1.26 -1.26 -1.26 -1.26  -1.26 -1.23 -2.25 -2.27 -2.36 -2.19 -1.75 -2.15  16.66 19.16 7.31 7.34 7.57 18.40 17.88 18.62  15.40 7.93 5.06 5.07 5.21 6.21 16.13 16.47  H99 JEC2 1 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  0.00 -0.96 -0.87 -0.01 -0.84 0.08 0.06 0.17  -0.25 -0.25 -0.25 -0.25 -0.25 -0.25 -0.25 -0.25  Normalized gene copy number relative to H99 (2 t) 1.00 1.95 1.83 1.01 1.79 0.95 0.96 0.89  -0.25 -1.21 -1.12 -0.26 -1.09 -0.17 -0.19 -0.08  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  White 2 White 2 White 2 White 2 White 2 White 2  Black A Black B Black C White A White B White C  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  1199 JEC21 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  AACt  Aetgenome  Act gene  Ct (Avg.) Actin 16.66 19.16 17.31 17.34 17.57 18.40 17.88 18.62  Primer  Strain  Ct(Avg.) test gene 16.41 17.95 16.19 17.08 16.48 18.23 17.69 18.54  Table D.9 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  Black Black Black Black Black Black  1 1 I 1 1 1  Black A Black C White A White B White D  Black A Black C White A White B White D  1199 JEC21 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  1 1 1 1 1 1  Black Black Black Black Black Black  1199 JEC2 1 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 00 707 00 707 00 707 00 707 00_707 00_707 00_707 00_707  CNNOO82O CNNOO 820 CNN00820 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  Black Black Black Black Black Black  Black A Black C White A White B White D  SMG1 SMG1 SMGI SMG1 SMG1 SMG1 SMG1 SMG1  H99 JEC2I CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  1 1 1 1 1 1  Primer  Strain  15.74 18.57 16.84 16.31 16.37 17.01 16.74 16.97  16.84 19.89 17.98 17.61 17.85 18.18 17.19 18.36  Ct(Avg.) test gene 16.81 18.64 17.96 17.41 17.63 18.20 18.02 18.22  17.53 20.58 18.47 18.50 18.51 19.10 18.88 19.02  17.53 20.58 18.47 18.50 18.51 19.10 18.88 19.02  Ct (Avg.) Actin 17.53 20.58 18.47 18.50 18.51 19.10 18.88 19.02  -1.79 -2.01 -1.63 -2.19 -2.14 -2.09 -2.14 -2.05  -0.69 -0.69 -0.49 -0.89 -0.66 -0.92 -1.69 -0.66  -0.72 -1.94 -0.51 -1.09 -0.88 -0.90 -0.86 -0.80  Act gene  -1.79 -1.79 -1.79 -1.79 -1.79 -1.79 -1.79 -1.79  -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69  -0.72 -0.72 -0.72 -0.72 -0.72 -0.72 -0.72 -0.72  ACtgenome  0.00 -0.22 0.16 -0.40 -0.35 -0.30 -0.35 -0.26  0.00 0.00 0.20 -0.20 0.03 -0.23 -1.00 0.03  0.00 -1.22 0.21 -0.37 -0.16 -0.18 -0.14 -0.08  AACt  1.00 1.16 0.90 1.32 1.27 1.23 1.27 1.20  1.00 1.00 0.87 1.15 0.98 1.17 2.00 0.98  Normalized gene copy number t) 2 relative to H99 ( 1.00 2.33 0.86 1.29 1.12 1.13 1.10 1.06  Table D.1O qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  1 1 1 1 1 1  BlackD BlackE Black F White E White G  1.00 1.09 1.06 1.20 1.21 1.15 1.15 1.09 0.00 -0.13 -0.09 -0.26 -0.28 -0.20 -0.20 -0.12 -1.70 -1.70 -1.70 -1.70 -1.70 -1.70 -1.70 -1.70  -1.70 -1.83 -1.79 -1.96 -198 -1.90 -1.90 -1.82 17.60 19.73 18.71 18.47 18.81 18.95 18.55 17.89  15.90 17.90 16.92 16.51 16.83 17.05 16.65 16.07  1199 JEC21 CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black  Black D Black E Black F White E White G 00_707 00_707 00_707 00 707 00 707 00_707 00 707 00_707  1 1 1 1 1 1  Black Black Black Black Black Black  1.00 1.01 1.07 1.13 1.03 1.02 0.99 1.04 0.00 -0.02 -0.10 -0.17 -0.04 -0.03 0.02 -0.05  -0.62 -0.62 -0.62 -0.62 -0.62 -0.62 -0.62 -0.62 -0.62 -0.64 -0.72 -0.79 -0.66 -0.65 -0.60 -0.67  17.60 19.73 18.71 18.47 18.81 18.95 18.55 17.89  H99 JEC21 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  0.00 -1.20 -0.05 -0.17 -0.18 -0.10 -0.16 -0.07  -0.96 -0.96 -0.96 -0.96 -0.96 -0.96 -0.96 -0.96  -0.96 -2.16 -1.01 -1.13 -1.14 -1.06 -1.12 -1.03  Normalized gene copy number .t) 2 relative to H99 ( 1.00 2.30 1.04 1.13 1.13 1.07 1.12 1.05  AACt  Actgenome  Act gene  Ct (Avg.) Actin 17.60 19.73 18.71 18.47 18.81 18.95 18.55 17.89  16.98 19.09 17.99 17.68 18.15 18.30 17.95 17.22  1 1 1 1 1 1  Ct(Avg.) test gene 16.64 17.57 17.70 17.34 17.67 17.89 17.43 16.86  CNNO0 820 CNN00820 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  H99 JEC21 CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black CBS7779 Black  Black D Black E Black F White E White G  Primer  Strain  Table D.11 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  -A  H99 JEC21 CBS7779 White 3 CBS7779 White 3 Black A CBS7779White3BlackB CBS7779 White 3 Black C CBS7779White3WhiteA CBS7779 White 3 White B  Black A Black B Black C White A White B  0.00 -0.03 -1.06 -1.20 -1.14 -1.09 —1.11 -1.07 0.00 -0.14 0.01 -1.05 -1.24 -0.12 -0.20 -0.14  -0.85 -0.85 -0.85 -0.85 -0.85 -0.85 -0.85 -0.85 -2.12 -2.12 -2.12 -2.12 -2.12 -2.12 -2.12 -2.12  -0.85 -0.88 -1.91 -2.05 -1.99 -1.94 -1.96 -1.92 -2.12 -2.26 -2.11 -3.17 -3.36 -2.24 -2.32 -2.26  17.84 19.94 18.83 18.81 18.83 18.47 18.71 18.75 17.84 19.94 18.83 18.81 18.83 18.47 18.71 18.75  16.99 19.06 16.92 16.76 16.84 16.53 16.75 16.83 15.72 17.68 16.72 15.64 15.47 16.23 16.39 16.49  1.00 1.10 0.99 2.07 2.36 1.09 1.15 1.10  1.00 1.02 2.08 2.30 2.20 2.13 2.16 2.10  0.00 -1.24 -0.02 -1.17 -1.26 -0.18 -0.25 -0.16  -0.95 -0.95 -0.95 -0.95 -0.95 -0.95 -0.95 -0.95  -0.95 -2.19 -0.97 -2.12 -2.21 -1.13 -1.20 -1.11  00 707 00 707 00707 00_707 00_707 00 707 00 707 00707  1199 JEC2 1 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779 CBS7779  3 3 3 3 3 3  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  H99 JEC2I CBS7779 White 3 CBS7779 White 3 Black A CBS7779 White 3 Black B CBS7779 White 3 Black C CBS7779White3WhiteA CBS7779 White 3 White B  White White White White White White  Normalized gene copy number relative to H99 (2 t) 1.00 2.36 1.01 2.25 2.39 1.13 1.19 1.12  AACt  ACtgenome  Act gene  CNNOO82O CNNOO82O CNNOO 820 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  Primer  Strain  Ct(Avg.) test gene 16.89 17.75 17.86 16.69 16.62 17.34 17.51 17.64  Ct (Avg.) Actin 17.84 19.94 18.83 18.81 18.83 18.47 18.71 18.75  Table D.12 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  00  Primer SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O 00_707 00 707 00_707 00 707 00_707 00 707 00 707  Strain  H99 JEC21 CBS7779 Black 1 CBS7779 White 1 CBS7779 Black 1 Black C CBS7779 Black 1 White C CBS7779 Black 1 White F  H99 JEC 21 CBS7779 Black 1 CBS7779 White 1 CBS7779 Black 1 Black C CBS7779 Black 1 White C CBS7779 Black 1 White F  1199 JEC21 CBS7779 Black 1 CBS7779 White 1 CBS7779 Black 1 Black C CBS7779 Black 1 White C CBS7779 Black 1 White F  Normalized gene copy number relative to H99 (2 t) 1.00 2.19 1.11 1.01 1.04 1.04 0.76 1.00 1.11 1.04 2.07 0.99 2.03 0.96 1.00 1.24 1.14 1.27 1.27 1.38 1.26  AACt 0.00 -1.13 -0.15 -0.01 -0.05 -0.06 0.40 0.00 -0.15 -0.06 -1.05 0.02 -1.02 0.06 0.00 -0.31 -0.19 -0.35 -0.34 -0.46 -0.33  Actgenome -0.96 -0.96 -0.96 -0.96 -0.96 -0.96 -0.96 -0.23 -0.23 -0.23 -0.23 -0.23 -0.23 -0.23 -2.39 -2.39 -2.39 -2.39 -2.39 -2.39 -2.39  Act gene -0.96 -2.09 -1.11 -0.97 -1.01 -1.02 -0.56 -0.23 -0.38 -0.29 -1.28 -0.21 -1.25 -0.17 -2.39 -2.70 -2.58 -2.74 -2.73 -2.85 -2.72  17.27 18.95 18.25 18.21 18.33 19.39 18.99 17.27 18.95 18.25 18.21 18.33 19.39 18.99  17.04 18.57 17.96 16.93 18.12 18.14 18.82 14.88 16.25 15.67 15.47 15.60 16.54 16.27  Ct(Avg.) test gene 16.31 16.86 17.14 17.24 17.32 18.37 18.43  Ct (Avg.) Actin 17.27 18.95 18.25 18.21 18.33 19.39 18.99  Table D.13 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the first screen (Table 3.10). These are “second screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  1.00 1.27 1.13 1.36 1.39 1.20  0.00 -0.34 -0.18 -0.44 -0.47 -0.26  -0.86 -0.86 -0.86 -0.86 -0.86  -0.86 -1.20 -1.04 -1.30 -1.33 -1.12  17.47 18.98 17.68 17.81 17.96 17.84  16.61 17.78 16.64 16.51 16.63 16.72  00_707 00_707 00_707 00_707 00_707 O0_707  JEC21  CBS7779 B1WCBI  CBS7779 B1WCB2  CBS7779 B1WCWI  CBS7779 B1WCW2  1199  2.08 -1.06 -0.53 -1.59  17.84  16.25  CNNOO82O  CBS7779 B1WCW2  2.20  -1.14 -0.53  -1.67  17.96  16.29  CNNOO82O  CBS7779 B1WCW1  2.11  -1.08  -1.61  17.81  16.20  CNNOO82O  CBS7779 B1WCB2  2.14  -1.10 -0.53  -1.63  17.68  16.05  CNNOO82O  CBS7779 B1WCB1  1.11 -0.15 -0.53  -0.68  18.98  18.30  CNNOO82O  JEC21  1.00  0.00 -0.53  -0.53  17.47  16.94  CNNOO82O  H99  1.08 -0.11  -1.26  17.84  16.58  SMG1  CBS7779 B1WCW2  1.14  -0.86  -0.53  -1.15  -1.15  -0.19  -1.34  17.96  16.62  SMG1  CBS7779 B1WCWI  1.09  -0.13  -1.15  -1.28  17.81  16.53  SMG1  CBS7779 B1WCB2  1.10  -0.14  -1.15  -1.29  17.68  16.39  SMG1  CBS7779 B1WCB1  2.06  -1.04  -1.15  -2.19  18.98  16.79  SMG1  JEC21  Normalized gene copy number t) 2 relative to H99 ( 1.00  AACt 0.00  ACtgenome  -1.15  -1.15  17.47  16.32  SMG1  Act gene  H99  Ct (Avg.) Actin  Primer  Strain  Ct(Avg.) test gene  Table D.14 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the second screen of CBS7779 (Table D.12). These are “third screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  00  -0.08 0.00 -0.05  -1.52  -0.17 -0.17 -0.17 -0.31 -0.31 -0.31  -1.00 -1.00  -0.29 -0.34 -0.25  -0.31  -1.15 -0.82 -1.02  17.87 17.62  17.67 17.31 18.95 18.00 18.14 17.68 17.87 17.62 17.67  17.58 17.28 17.42 17.00 18.59 16.17 17.79 16.33 16.60 16.35 16.43 16.31 17.90 16.51 16.99 16.50 16.72 16.80 16.65  SMG1 SMGI SMG1 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O 00_707 00_707 00_707 00 707 00_707 00 707 00_707 00_707  CBS7779 B1WCW3  CBS7779 B1WCW4  CBS7779 B1WCW5  1199  JEC21  CBS7779 B1WCB3  CBS7779 B1WCB4  CBS7779 B1WCB5  CBS7779 B1WCW3  CBS7779 B1WCW4  CBS7779 B1WCW5  H99  JEC21  CBS7779 B1WCB3  CBS7779 B1WCB4  CBS7779 B1WCB5  CBS7779 BIWCW3  CBS7779 B1WCW4  CBS7779 B1WCW5  0.00  -0.31 -1.00  -1.27 -1.27 -1.24  17.87 17.62  -1.00  -1.18  -1.00  -0.15  -1.00 -1.15  -0.02  0.18  -0.15  -0.18  -0.49 -1.00  -1.49  -0.05  -1.00  -0.96  -0.96  -1.04  -1.05  -1.00  -0.93  -0.31  -1.35  17.68  -0.31  -0.31  -0.35  18.14  -0.04  -0.31  -1.83  -0.12  -0.20  18.00  18.95  17.31  17.67  -0.36  -0.17  -0.17  -0.37  17.68  17.31  SMGI  CBS7779 B1WCB5  -0.34  -0.17  -0.51  18.14  17.63  SMGI  CBS7779 B1WCB4  -0.61  -0.17  -0.78  18.00  17.22  SMG1  CBS7779 B1WCB3  -1.20  -0.17  -1.37  18.95  17.58  SMG1  0.00  -0.17  -0.17  IEC21  17.31  17.14  SMGI  H99  1.01  0.88  1.11  1.13  1.11  1.40  1.04  1.00  1.91  1.95  1.95  2.06  —  2.87  1.04  1.00  1.06  1.13  1.09  1.15  1.27  1.53  2.30  1.00  Table D.15 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the second screen of CBS7779 (Table D.12). These are “third screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow and numbers which were previously higher than 1.5 but are now 1.0 are highlighted in pink. Act gene AACt Normalized gene copy number Primer Ct(Avg.) Ct (Avg.) Actin Strain ACtgenome relative to H99 (2) test gene  00  17.47 18.98 17.68 17.81 17.96 17.84 17.47 18.98 17.68 17.81 17.96 17.84  16.94 18.30 16.05 16.20 16.29 16.25 16.61 17.78 16.64 16.51 16.63 16.72  CNN00820 CNN00820 CNN00820 CNN00820 CNNOO82O CNNOO82O 00_707 00_707 00_707 00_707 00_707 00_707  H99 JEC21 CBS7779 B1WCB1 CBS7779 B1WCB2 CBS7779 B1WCW1 CBS7779 B1WCW2  H99 JEC21 CBS7779B1WCB1 CBS7779 B1WCB2 CBS7779 B1WCW1 CBS7779 B1WCW2  17.47 18.98 17.68 17.81 17.96 17.84  16.32 16.79 16.39 16.53 16.62 16.58  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  1199 JEC21 CBS7779B1WCB1 CBS7779B1WCB2 CBS7779B1WCW1 CBS7779B1WCW2  -  -0.86 -1.20 -1.04 -1.30 -1.33 -1.12  -0.53 -0.68 -1.63 -1.61 -1.67 -1.59  -1.15 -2.19 -1.29 -1.28 -1.34 -1.26  -0.86 -0.86 -0.86 -0.86 -0.86 -0.86  -0.53 -0.53 -0.53 -0.53 -0.53 -0.53  -1.15 -1.15 -1.15 -1.15 -1.15 -1.15  0.00 -0.34 -0.18 -0.44 -0.47 -0.26  0.00 -0.15 -1.10 -1.08 -1.14 -1.06  0.00 -1.04 -0.14 -0.13 -0.19 -0.11  1.00 1.27 1.13 1.36 1.39 1.20  1.00 1.11 2.14 2.11 2.20 2.08  1.00 2.06 1.10 1.09 1.14 1.08  Table D.16 qRT-PCR results for a select number of black and white strains derived from characterized black and white colonies selected from the second screen of CBS7779 (Table D. 12). These are “third screen” isolates. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain Primer Ct(Avg.) Ct (Avg.) Act gene AACt Normalized gene copy Actgenome test gene Actin number relative to H99 (2t)  APPENDIX D D.5 Analysis of disomy in the serotype A strain WM626. During the course of the CGH analysis, it was discovered that WM626 also displayed a possible disomy for CHR 13. Because of the interesting phenotype observed in CBS7779 and the subsequent discovery that (in the first screen) highly melanized strains are monosomic for CHR 13 and lightly melanized strains are disomic for CHR 13, a similar screen was carried out for WM626. The results, however, failed to show a correlation between melanin production and the copy number of CHR 13 for WM626. The results of these screens are shown in Tables D.15 to D.2 1. Because isolates from WM626 did not follow the correlation that was seen in the initial screening and analysis of the CBS7779 derivatives, the interplay between melanin production and the copy number of CHR 13 appeared to be more complicated. For instance, there could be more than one mechanism responsible for the switch in phenotype besides changes in copy number of CHR 13.  182  APPENDIX D  Table D.17 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  H99 JEC21 WM626B4 WM626B5 WM626B6 WM626W4 WM626 W5 WM626 W6  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.67 17.49 16.04 16.24 16.10 16.33 16.21 16.28  20.36 19.29 17.07 17.20 16.97 17.27 17.20 17.22  -0.69 -1.80 -1.03 -0.96 -0.87 -0.94 -0.99 -0.94  -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69 -0.69  0.00 -1.11 -0.34 -0.27 -0.18 -0.25 -0.30 -0.25  1.00 2.16 1.27 1.21 1.13 1.19 1.23 1.19  H99 JEC21 WM626 B4 WM626 B5 WM626 B6 WM626W4 WM626 W5 WM626W6  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  20.19 19.18 16.84 16.05 15.97 16.11 16.12 16.04  20.36 19.29 17.07 17.20 16.97 17.27 17.20 17.22  -0.17 -0.11 -0.23 -1.15 -1.00 -1.16 -1.08 -1.18  -0.17 -0.17 -0.17 -0.17 -0.17 -0.17 -0.17 -0.17  0.00 0.06 -0.06 -0.98 -0.83 -0.99 -0.91 -1.01  1.00 0.96 1.04 1.97 1.78 1.99 1.88 2.01  Ct(Avg.) test gene  Ct (Avg.) Actin  tct  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 (2t)  183  APPENDIX D  Table D.18 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.)  test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 Ct) 2 (  H99 JEC21 WM626B1 WM626B2 WM626 Wi WM626 W2 WM626 W3  SMGI SMGI SMG1 SMG1 SMG1 SMG1 SMG1  19.19 16.80 15.10 16.07 15.07 15.55 15.56  19.20 18.09 16.19 16.46 15.53 16.03 15.94  -0.01 -1.29 -1.09 -0.39 -0.46 -0.48 -0.38  -0.01 -0.01 -0.01 -0.01 -0.01 -0.01 -0.01  0.00 -1.28 -1.08 -0.38 -0.45 -0.47 -0.37  1.00 2.43 2.11 1.30 1.37 1.39 1.29  H99 JEC21 WM626B1 WM626B2 WM626 Wi WM626 W2 WM626 W3  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  19.70 18.65 15.38 16.05 14.93 15.48 15.37  19.20 18.09 16.19 16.46 15.53 16.03 15.94  0.50 0.56 -0.81 -0.41 -0.60 -0.55 -0.57  0.50 0.50 0.50 0.50 0.50 0.50 0.50  0.00 0.06 -1.31 -0.91 -1.10 -1.05 -1.07  1.00 0.96 2.48 1.88 2.14 2.07 2.10  Table D.19 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  Actgenome  AACt  Normalized gene copy number relative to 1199 ( t 2 )  H99 JEC21 WM626 Bi WM626B3 WM626 W7 WM626W8 WM626W9  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.97 17.86 16.00 17.15 17.20 16.26 17.11  20.49 19.68 17.45 18.98 17.94 16.92 17.74  -0.52 -1.82 -1.45 -1.83 -0.74 -0.66 -0.63  -0.52 -0.52 -0.52 -0.52 -0.52 -0.52 -0.52  0.00 -1.30 -0.93 -1.31 -0.22 -0.14 -0.11  1.00 2.46 1.91 2.48 1.16 1.10 1.08  H99 JEC21 WM626B1 WM626B3 WM626W7 WM626 W8 WM626 W9  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  19.45 18.64 15.02 16.08 15.86 14.92 15.68  20.11 19.24 16.90 17.79 17.82 17.52 17.87  -0.66 -0.60 -1.88 -1.71 -1.96 -2.60 -2.19  -0.66 -0.66 -0.66 -0.66 -0.66 -0.66 -0.66  0.00 0.06 -1.22 -1.05 -1.30 -1.94 -1.53  1.00 0.96 2.33 2.07 2.46 3.84 2.89  184  APPENDIX D  Table D.20 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 Ct) 2 (  H99 JEC21 WM626 B4 WM626 B7 WM626 W10 WM626W11 WM626W12  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  19.75 17.66 16.27 16.80 17.53 17.23 16.95  20.37 19.64 17.04 17.68 19.69 18.01 17.60  -0.62 -1.98 -0.77 -0.88 -2.16 -0.78 -0.65  -0.62 -0.62 -0.62 -0.62 -0.62 -0.62 -0.62  0.00 -1.36 -0.15 -0.26 -1.54 -0.16 -0.03  1.00 2.57 1.11 1.20 2.91 1.12 1.02  H99 JEC21 WM626B4 WM626B7 W1v1626W10 WM626W11 WM626 W12  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  18.55 17.82 15.24 14.84 15.53 15.37 14.92  20.11 19.24 16.90 17.79 17.82 17.52 17.87  -1.56 -1.42 -1.66 -2.95 -2.29 -2.15 -2.95  -1.56 -1.56 -1.56 -1.56 -1.56 -1.56 -1.56  0.00 0.14 -0.10 -1.39 -0.73 -0.59 -1.39  1.00 0.91 1.07 2.62 1.66 1.51 2.62  185  APPENDIX D  Table D.21 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13 and the 00 707 locus is on CHR 4. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  Actgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC2I WM626B1 WM626 B3 WM626 W10  SMG1 SMG1 SMG1 SMG1 SMG1  16.35 17.93 16.37 17.49 17.19  17.23 19.72 17.80 18.33 18.02  -0.88 -1.79 -1.43 -0.84 -0.83  -0.88 -0.88 -0.88 -0.88 -0.88  0.00 -0.91 -0.55 0.04 0.05  1.00 1.88 1.46 0.97 0.97  H99 JEC2 1 WM626 Bi WM626 B3 WM626 W10  CNNOO82O CNNOO82O CNNOO 820 CNNOO82O CNNOO82O  15.74 18.35 15.43 16.65 15.57  17.23 19.72 17.80 18.33 18.02  -1.49 -1.37 -2.37 -1.68 -2.45  -1.49 -1.49 -1.49 -1.49 -1.49  0.00 0.12 -0.88 -0.19 -0.96  1.00 0.92 1.84 1.14 1.95  H99 JEC21 WM626 Bi WM626B3 WM626 W10  00 707 00_707 00_707 00 707 00_707  16.25 18.70 16.24 17.50 16.97  17.23 19.72 17.80 18.33 18.02  -0.98 -1.02 -1.56 -0.83 -1.05  -0.98 -0.98 -0.98 -0.98 -0.98  0.00 -0.04 -0.58 0.15 -0.07  1.00 1.03 1.49 0.90 1.05  Table D.22 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13 and the 00_707 locus is on CHR 4. Strain  Primer  H99 JEC21 WM626B1  SMG1 SMG1 SMG1  16.57 17.73 16.65  17.24 19.68 17.74  -0.67 -1.95 -1.09  -0.67 -0.67 -0.67  0.00 -1.28 -0.42  1.00 2.43 1.34  H99 JEC2 1 WM626 Bi  CNNOO82O CNNOO82O CNNOO82O  16.65 19.05 16.20  17.24 19.68 17.74  -0.59 -0.63 -1.54  -0.59 -0.59 -0.59  0.00 -0.04 -0.95  1.00 1.03 1.93  H99 JEC21 WM626B1  00_707 00 707 00_707  15.03 16.91 14.39  17.24 19.68 17.74  -2.21 -2.77 -3.35  -2.21 -2.21 -2.21  0.00 -0.56 -1.14  1.00 1.47 2.20  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  Actome  AACt  Normalized gene copy number relative to H99 (2t)  186  APPENDIX D  Table D.23 qRT-PCR results for a select number of black (B) and white (W) strains derived from the original WM626 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNN00820 locus is on CHR 13 and the 00_707 locus is on CHR 4. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 WM626B1  SMGI SMGI SMG1  16.31 16.86 16.14  17.27 18.95 17.73  -0.96 -2.09 -1.59  -0.96 -0.96 -0.96  0.00 -1.13 -0.63  1.00 2.19 1.55  H99 JEC21 WM626B1  CNNOO82O CNNOO82O CNNOO82O  17.04 18.57 16.38  17.27 18.95 17.73  -0.23 -0.38 -1.35  -0.23 -0.23 -0.23  0.00 -0.15 -1.12  1.00 1.11 2.17  H99 JEC21 WM626B1  00 707 00_707 00 707  14.88 16.25 14.46  17.27 18.95 17.73  -2.39 -2.70 -3.27  -2.39 -2.39 -2.39  0.00 -0.31 -0.88  1.00 1.24 1.84  D.6 Analysis of chromosome copy number variation in two strains showing variable melanin production. To develop a better appreciation of the prevalence of aneuploidy in C. neoformans, a series of qRT-PCR experiments were performed on selected additional strains. Two of these strains were IFM5 1645 and 1FM46084 which display variable melanin production (Tanaka et aL, 2005). Thus, qRT-PCR analyses were performed on a select number of black and white isolates from these two strains (Table D.22 to D.23). From the results in Table D.22, it appeared that there was no disomy of CHR 13 for strain IFM 46084. This result, however, does not discount the possibility that aneuploidy may play a role in melanin production because other chromosomes (which were not tested) may have a role. As for the results in Table D.23, the low copy numbers and the resulting melting curve information (data not shown) suggested that there was no amplification at the CNNOO82O, 00_707 or the SMG1 locus. Subsequent PCR-RFLP analysis (data not shown) suggested that isolate IFM5 1645 is not a VGI or VGII molecular 187  APPENDIX D subtype and, because there is no sequencing information on other molecular subtypes, no further analysis was carried out on this strain.  Table D.24 qRT-PCR results for a select number of black and white strains derived from the original 1FM46084 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 ( t 2 )  H99 JEC21 1FM46084 Bi 1FM46084 B2 1FM46084B3 1FM46084 Wl 1FM46084 W2 1FM46084 W3  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  16.43 16.97 18.45 18.79 17.93 18.14 18.15 21.97  17.15 18.68 19.03 19.61 18.80 18.96 18.83 22.80  -0.72 -1.71 -0.58 -0.82 -0.87 -0.82 -0.68 -0.83  -0.72 -0.72 -0.72 -0.72 -0.72 -0.72 -0.72 -0.72  0.00 -0.99 0.14 -0.10 -0.15 -0.10 0.04 -0.11  1.00 1.99 0.91 1.07 1.11 1.07 0.97 1.08  H99 JEC2I 1FM46084B1 1FM46084B2 1FM46084 B3 1FM46084 Wi 1FM46084 W2 1FM46084 W3  CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  17.23 18.67 18.91 19.47 18.67 18.95 18.89 22.78  17.15 18.68 19.03 19.61 18.80 18.96 18.83 22.80  0.08 -0.01 -0.12 -0.14 -0.13 -0.01 0.06 -0.02  0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.08  0.00 -0.09 -0.20 -0.22 -0.21 -0.09 -0.02 -0.10  1.00 1.06 1.15 1.16 1.16 1.06 1.01 1.07  H99 JEC21 1FM46084 Bi 1FM46084B2 1FM46084B3 1FM46084 Wl 1FM46084W2 1FM46084 W3  00707 00707 00_707 00_707 00 707 00_707 00 707 00 707  16.48 17.65 17.94 18.43 17.55 17.76 17.70 21.68  17.15 18.68 19.03 19.61 18.80 18.96 18.83 22.80  -0.67 -1.03 -1.09 -1.18 -1.25 -1.20 -1.13 -1.12  -0.67 -0.67 -0.67 -0.67 -0.67 -0.67 -0.67 -0.67  0.00 -0.36 -0.42 -0.51 -0.58 -0.53 -0.46 -0.45  1.00 1.28 1.34 1.42 1.49 1.44 1.38 1.37  188  APPENDIX D  Table D.25 qRT-PCR results for a select number of black and white strains derived from the original IFM5 1645 stock. Normalized copy numbers which are higher than 1.5 are highlighted in yellow. The CNNOO82O locus is on CHR 13. Primer  Strain  Ct(Avg.)  test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 Q) 2 (  H99 JEC21 1FM51645 Bi 1FM51645 B2 1FM51645 B3 1FM51645 Wi 1FM51645 W2 1FM51645 W3  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  16.83 17.92 34.56 33.56 33.90 33.49 33.28 34.07  17.27 19.49 18.95 20.92 20.25 19.86 20.08 18.97  -0.44 -1.57 15.61 12.64 13.65 13.63 13.20 15.10  -0.44 -0.44 -0.44 -0.44 -0.44 -0.44 -0.44 -0.44  0.00 -1.13 16.05 13.08 14.09 14.07 13.64 15.54  1.00 2.19 0.00 0.00 0.00 0.00 0.00 0.00  H99 JEC2 1 1FM51645 1FM51645 LFM5 1645 1FM51645 1FM51645 1FM51645  CNNOO82O CNN00820 CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O CNNOO82O  17.19 19.39 32.59 33.84 33.39 33.53 33.40 32.81  17.27 19.49 18.95 20.92 20.25 19.86 20.08 18.97  -0.08 -0.10 13.64 12.92 13.14 13.67 13.32 13.84  -0.08 -0.08 -0.08 -0.08 -0.08 -0.08 -0.08 -0.08  0.00 -0.02 13.72 13.00 13.22 13.75 13.40 13.92  1.00 1.01 0.00 0.00 0.00 0.00 0.00 0.00  00_707 00_707 00_707 00 707 00_707 00 707 00 707 00 707  16.89 18.52 20.52 23.07 24.87 22.32 22.35 20.67  17.27 19.49 18.95 20.92 20.25 19.86 20.08 18.97  -0.38 -0.97 1.57 2.15 4.62 2.46 2.27 1.70  -0.38 -0.38 -0.38 -0.38 -0.38 -0.38 -0.38 -0.38  0.00 -0.59 1.95 2.53 5.00 2.84 2.65 2.08  1.00 1.51 0.26 0.17 0.03 0.14 0.16 0.24  Bi B2 B3 Wi W2 W3  H99 JEC21 IFM5 1645 Bi 1FM51645 B2 IFM5 1645 B3 1FM51645 Wi 1FM51645 W2 1FM51645 W3  D.7 Analysis of chromosome copy number variation in strains showing elevated DNA content. Another subset of strains were selected for  qRT-PCR that showed elevated DNA content  by FACS analysis, suggesting that there may be CCNV (Ohkusu et al., 2002). To test this hypothesis, qRT-PCR was performed on CHR 13 (see Table D. 24 and D.25). The results in  189  APPENDIX D Table D.24 and D.25 indicated that neither CHR 4 nor CHR 13 was disomic in these strains. However, it is still possible that these strains may have extra copies of other chromosomes that were not tested in these qRT-PCR experiments.  Table D.26 qRT-PCR results for a select number of strains which by FACS analysis suggest that they are aneuploids (Ohkusu et a!., 2002). The CNNOO82O locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow.  Strain  Primer  Ct(Avg.)  test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  SMG1  16.69  17.14  -0.45  -0.45  0.00  1.00  JEC21  SMG1  17.31  18.94  -1.63  -0.45  -1.18  2.27  IFM 51612  SMG1  18.12  18.73  -0.61  -0.45  -0.16  1.12  1PM 51627  SMG1  17.48  18.21  -0.73  -0.45  -0.28  1.21  1PM 51636  SMG1  17.48  18.11  -0.63  -0.45  -0.18  1.13  IFM 51640  SMG1  17.80  18.45  -0.65  -0.45  -0.20  1.15  1PM 51650  SMG1  17.97  18.44  -0.47  -0.45  -0.02  1.01  IFM 51654  SMG1  29.98  17.60  12.38  -0.45  12.83  0.00  H99  CNNOO82O  16.81  17.14  -0.33  -0.33  0.00  1.00  JEC2 1  CNNOO82O  18.55  18.94  -0.39  -0.33  -0.06  1.04  IFM 51612  CNNOO82O  18.45  18.73  -0.28  -0.33  0.05  0.97  IFM 51627  CNNOO82O  18.12  18.21  -0.09  -0.33  0.24  0.85  IFM 51636  CNNOO82O  17.63  18.11  -0.48  -0.33  -0.15  1.11  IFM 51640  CNNOO82O  18.00  18.45  -0.45  -0.33  -0.12  1.09  IFM 51650  CNNOO82O  18.45  18.44  0.01  -0.33  0.34  0.79  IFM 51654  CNNOO82O  30.02  17.60  12.42  -0.33  12.75  0.00  H99  00 707  15.78  17.14  -1.36  -1.36  0.00  1.00  JEC21  00 707  17.44  18.94  -1.50  -1.36  -0.14  1.10  IFM 51612  00 707  17.20  18.73  -1.53  -1.36  -0.17  1.13  IFM 51627  00 707  16.60  18.21  -1.61  -1.36  -0.25  1.19  IFM 51636  00_707  16.48  18.11  -1.63  -1.36  -0.27  1.21  IFM 51640  O0_707  16.85  18.45  -1.60  -1.36  -0.24  1.18  IFM 51650  00_707  16.87  18.44  -1.57  -1.36  -0.21  1.16  IFM 51654  00_707  28.75  17.60  11.15  -1.36  12.51  0.00  H99  190  APPENDIX D  Table D.27 qRT-PCR results for a select number of strains which by FACS analysis suggest that they are aneuploids (Ohkusu et a!., 2002). The CNNOO82O locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain  Primer  Ct(Avg.)  Ct (Avg.)  test gene  Actin  ct gene  ACtgenome  AACt  Normalized gene copy number relative to H99 (2t)  H99  SMG1  16.58  16.24  0.34  0.34  0.00  1.00  JEC21  SMG1  17.14  18.06  -0.92  0.34  -1.26  2.39  1FM51658  SMG1  17.12  16.98  0.14  0.34  -0.20  1.15  1FM51666  SMG1  17.85  17.68  0.17  0.34  -0.17  1.13  1FM51677  SMG1  18.06  17.87  0.19  0.34  -0.15  1.11  1FM51678  SMG1  17.69  17.43  0.26  0.34  -0.08  1.06  1FM61649  SMG1  17.78  17.43  0.35  0.34  0.01  0.99  H99  CNNOO82O  16.39  16.24  0.15  0.15  0.00  1.00  JEC21  CNNOO82O  18.15  18.06  0.09  0.15  -0.06  1.04  1FM51658  CNNOO82O  17.68  16.98  0.70  0.15  0.55  0.68  1FM51666  CNNOO82O  17.68  17.68  0.00  0.15  -0.15  1.11  1FM51677  CNNOO82O  17.96  17.87  0.09  0.15  -0.06  1.04  1FM51678  CNNOO82O  17.85  17.43  0.42  0.15  0.27  0.83  1FM61649  CNNOO82O  25.66  17.43  8.23  0.15  8.08  0.00  H99  00_707  16.05  16.24  -0.19  -0.19  0.00  1.00  JEC2I  00 707  17.51  18.06  -0.55  -0.19  -0.36  1.28  1FM51658  00_707  16.69  16.98  -0.29  -0.19  -0.10  1.07  1FM51666  00_707  17.18  17.68  -0.50  -0.19  -0.31  1.24  1FM51677  00 707  17.21  17.87  -0.66  -0.19  -0.47  1.39  1FM51678  00_707  17.01  17.43  -0.42  -0.19  -0.23  1.17  1FM61649  00_707  16.83  17.43  -0.60  -0.19  -0.41  1.33  D.8 Analysis of chromosome copy number variation in additional clinical isolates and strains that were freshly isolated from the cerebral spinal fluid of AIDS patients. The qRT-PCR assay was also used to examine disomy at CHRs 4 and 13 in additional clinical isolates (Tables D.26 to D.35). As discussed in the main body of the thesis (section 3.4.4), these strains showed frequent disomy at CHR 4 and moderate disomy at CHR 13.  It is  interesting to speculate that the frequency of disomy in these strains may reflect the time that 191  APPENDIX D they have been in culture.  However, more comparisons of freshly-isolated and laboratory  passaged strains are needed to test this idea.  Table D.28 qRT-PCR results for a select number of freshly isolated clinical strains. The CNN00820 locus is on CHR 13. The SMG 1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 ACt) 2 (  H99  SMG1  16.24  17.31  -1.07  -1.07  0.00  1.00  JEC21  SMG1  16.98  18.90  -1.92  -1.07  -0.85  1.80  C8  SMG1  17.92  19.56  -1.64  -1.07  -0.57  1.48  -0.91  1.88  RT23-1  SMG1  18.00  19.98  -1.98  -1.07  RT23-2  SMG1  18.03  20.12  -2.09  -1.07  -1.02  2.03  RT23-3  SMG1  17.98  19.47  -1.49  -1.07  -0.42  1.34  RT31-MIX  SMG1  17.41  19.40  -1.99  -1.07  -0.92  1.89  RT31-1  SMG1  18.71  21.21  -2.50  -1.07  -1.43  2.69  H99  CNNOO82O  17.03  17.31  -0.28  -0.28  0.00  1.00  JEC21  CNNOO82O  18.52  18.90  -0.38  -0.28  -0.10  1.07  -0.28  0.82  0.57  C8  CNNOO82O  20.10  19.56  0.54  RT23-1  CNNOO82O  19.08  19.98  -0.90  -0.28  -0.62  1.54  RT23-2  CNNOO82O  19.27  20.12  -0.85  -0.28  -0.57  1.48  RT23-3  CNNOO82O  18.98  19.47  -0.49  -0.28  -0.21  1.16  RT31-MIX  CNNOO82O  18.45  19.40  -0.95  -0.28  -0.67  1.59  RT31-1  CNNOO82O  20.09  21.21  -1.12  -0.28  -0.84  1.79  H99  00 707  16.72  17.31  -0.59  -0.59  0.00  1.00  JEC21  00 707  17.93  18.90  -0.97  -0.59  -0.38  1.30  C8  00 707  17.89  19.56  -1.67  -0.59  -1.08  2.11  RT23-1  00_707  19.18  19.98  -0.80  -0.59  -0.21  1.16  RT23-2  00 707  18.83  20.12  -1.29  -0.59  -0.70  1.62  RT23-3  00_707  18.42  19.47  -1.05  -0.59  -0.46  1.38  RT31-MIX  00 707  18.20  19.40  -1.20  -0.59  -0.61  1.53  RT31-1  00 707  20.45  21.21  -0.76  -0.59  -0.17  1.13  192  APPENDIX D  Table D.29 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO 820 locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain Ct(Avg.) Ct (Avg.) Act gene Primer AACt Normalized gene copy Actgenome test gene Actm number relative to H99 ( t 2 )  H99 JEC21 arg1366 ug2467 in2637 tn470 bt9 bt68  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  16.97 17.33 18.29 18.05 18.57 18.45 18.15 16.91  17.38 18.98 19.84 18.83 19.41 19.62 19.13 18.93  -0.41 -1.65 -1.55 -0.78 -0.84 -1.17 -0.98 -2.02  -0.41 -0.41 -0.41 -0.41 -0.41 -0.41 -0.41 -0.41  0.00 -1.24 -1.14 -0.37 -0.43 -0.76 -0.57 -1.61  1.00 2.36 2.20 1.29 1.35 1.69 1.48 3.05  H99  CNNOO 820 CNNOO 820 CNNOO 820 CNNTOO82O CNNOO82O CNNOO 820 CNNOO 820 CNNOO82O  17.00 18.43 18.55 18.21 19.90 18.83 18.36 18.27  17.38 18.98 19.84 18.83 19.41 19.62 19.13 18.93  -0.38 -0.55 -1.29 -0.62 0.49 -0.79 -0.77 -0.66  -0.38 -0.38 -0.38 -0.38 -0.38 -0.38 -0.38 -0.38  0.00 -0.17 -0.91 -0.24 0.87 -0.41 -0.39 -0.28  1.00 1.13 1.88 1.18 0.55 1.33 1.31 1.21  00_707 00_707 00 707 00_707 00 707 00707 00_707 00_707  16.72 17.95 18.53 17.47 18.19 18.22 17.81 17.37  17.38 18.98 19.84 18.83 19.41 19.62 19.13 18.93  -0.66 -1.03 -1.31 -1.36 -1.22 -1.40 -1.32 -1.56  -0.66 -0.66 -0.66 -0.66 -0.66 -0.66 -0.66 -0.66  0.00 -0.37 -0.65 -0.70 -0.56 -0.74 -0.66 -0.90  1.00 1.29 1.57 1.62 1.47 1.67 1.58 1.87  JEC21 arg1366 ug2467 in2637 tn470  bt9 bt68  H99 IEC21 arg1366 ug2467 in2637 tn470  bt9 bt68  193  APPENDIX D  Table D.30 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO82O locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted  in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  Actgenome  AACt  Normalized gene copy number relative to H99  ( C 2 t)  H99 TEC21 JP1086 arg1373  SMG1 SMG1 SMG1 SMG1  16.32 16.79 17.30 18.22  17.47 18.98 18.93 19.82  -1.15 -2.19 -1.63 -1.60  -1.15 -1.15 -1.15 -1.15  0.00 -1.04 -0.48 -0.45  1.00 2.06 1.39 1.37  H99  16.94 18.30 19.47 19.05  17.47  JEC21 JP1086 argi 373  CNNOO82O CNNOO 820 CNNOO82O CNNOO82O  18.93 19.82  -0.53 -0.68 0.54 -0.77  -0.53 -0.53 -0.53 -0.53  0.00 -0.15 1.07 -0.24  1.00 1.11 0.48  H99 JEC21 JP1086 arg1373  00_707 00_707 00_707 00_707  16.61 17.78 17.64 18.35  17.47 18.98 18.93 19.82  -0.86 -1.20 -1.29 -1.47  -0.86 -0.86 -0.86 -0.86  0.00 -0.34 -0.43 -0.61  1.00 1.27 1.35 1.53  18.98  1.18  194  APPENDIX D  Table D.31 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO82O locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Nonnalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain Primer Ct(Avg.) Ct (Avg.) Act gene AACt Normalized gene copy Actgenome test gene Actin number relative to H99 (2°) H99  SMG1  17.01  JEC21  SMG1  C8  SMG1  RT23-1  17.07  -0.06  -0.06  0.00  1.00  17.58  18.77  -1.19  -0.06  -1.13  2.19  18.78  19.35  -0.57  -0.06  -0.51  1.42  SMG1  18.91  19.99  -1.08  -0.06  -1.02  2.03  RT23-2  SMG1  19.10  19.90  -0.80  -0.06  -0.74  1.67  RT23-3  SMG1  18.95  19.28  -0.33  -0.06  -0.27  1.21  RT31-MIX  SMG1  18.28  19.15  -0.87  -0.06  -0.81  1.75  RT31-1  SMG1  19.68  21.11  -1.43  -0.06  -1.37  2.58  H99  CNNOO82O  17.04  17.07  -0.03  -0.03  0.00  1.00  IEC21  CNNOO82O  18.60  18.77  -0.17  -0.03  -0.14  1.10  C8  CNNOO82O  19.59  19.35  0.24  -0.03  0.27  0.83  RT23-1  CNNOO82O  19.26  19.99  -0.73  -0.03  -0.70  1.62  RT23-2  CNNOO82O  19.59  19.9  -0.31  -0.03  -0.28  1.21  RT23-3  CNNOO82O  19.16  19.28  -0.12  -0.03  -0.09  1.06  RT31-MIX  CNNOO82O  18.69  19.15  -0.46  -0.03  -0.43  1.35  RT31-1  CNNOO82O  20.30  21.11  -0.81  -0.03  -0.78  1.72  H99  00_707  16.06  17.07  -1.01  -1.01  0.00  1.00  JEC21  00 707  17.82  18.77  -0.95  -1.01  0.06  0.96  C8  00_707  17.10  19.35  -2.25  -1.01  -1.24  2.36  RT23-1  00 707  18.47  19.99  -1.52  -1.01  -0.51  1.42  RT23-2  00_707  18.77  19.90  -1.13  -1.01  -0.12  1.09  RT23-3  00 707  18.43  19.28  -0.85  -1.01  0.16  0.90  RT31-MIX  00707  18.32  19.15  -0.83  -1.01  0.18  0.88  RT31-1  00_707  20.56  21.11  -0.55  -1.01  0.46  0.73  195  APPENDIX D  Table D.32 qRT-PCR results for a select number of freshly isolated clinical strains. The CNN00820 locus is on CHR 13. The SMG 1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 ( t 2 )  H99  SMG1  16.70  17.34  -0.64  -0.64  0.00  1.00  JEC21  SMG1  17.21  18.96  -1.75  -0.64  -1.11  2.16  arg1366  SMGI  18.13  19.62  -1.49  -0.64  -0.85  1.80  ug2467  SMG1  17.89  18.81  -0.92  -0.64  -0.28  1.21  in2637  SMGI  18.39  19.44  -1.05  -0.64  -0.41  1.33  tn470  SMG1  18.31  19.78  -1.47  -0.64  -0.83  1.78  bt9  SMG1  18.02  19.18  -1.16  -0.64  -0.52  1.43  bt68  SMG1  18.06  18.93  -0.87  -0.64  -0.23  1.17  H99  CNNOO82O  17.31  17.34  -0.03  -0.03  0.00  1.00  JEC2 1  CNNOO82O  18.99  18.96  0.03  -0.03  0.06  0.96  argl3ó6  CNNOO82O  19.10  19.62  -0.52  -0.03  -0.49  1.40  ug2467  CNNOO82O  18.67  18.81  -0.14  -0.03  -0.11  1.08  1n2637  CNNOO82O  20.43  19.44  0.99  -0.03  1.02  0.49  tn470  CNNOO82O  19.36  19.78  -0.42  -0.03  -0.39  1.31  bt9  CNNOO82O  18.95  19.18  -0.23  -0.03  -0.20  1.15  bt68  CNNOO82O  18.89  18.93  -0.04  -0.03  -0.01  1.01  H99  00_707  16.27  17.34  -1.07  -1.07  0.00  1.00  JEC21  00_707  17.97  18.96  -0.99  -1.07  0.08  0.95  arg1366  00 707  18.47  19.62  -1.15  -1.07  -0.08  1.06  ug2467  00 707  17.61  18.81  -1.20  -1.07  -0.13  1.09  iri2637  00 707  18.08  19.44  -1.36  -1.07  -0.29  1.22  tn470  00 707  18.30  19.78  -1.48  -1.07  -0.41  1.33  bt9  00_707  17.73  19.18  -1.45  -1.07  -0.38  1.30  bt68  00 707  17.41  18.93  -1.52  -1.07  -0.45  1.37  196  APPENDIX D  Table D.33 qRT-PCR results for a select number of freshly isolated clinical strains. The CNN00820 locus is on CHR 13. The SMG1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  AACt  Normalized gene copy number relative to H99 2  Strain  Primer  arg1366  SMG1  18.43  19.3  -0.87  -0.14  -0.73  1.66  arg1366  CNNOO82O  18.71  19.3  -0.59  -0.13  -0.46  1.38  arg1366  CNNO189O  20.38  19.3  1.08  -0.67  1.75  0.30  arg1366  CNNO2400  18.36  19.3  -0.94  -0.62  -0.32  1.25  H99  SMG 1  16.99  17.13  -0.14  -0.14  0.00  1.00  H99  CNNOO82O  17.00  17.13  -0.13  -0.13  0.00  1.00  H99  CNNO189O  16.46  17.13  -0.67  -0.67  0.00  1.00  H99  CNNO2400  16.51  17.13  -0.62  -0.62  0.00  1.00  in2637  SMGI  18.83  19.42  -0.59  -0.14  -0.45  1.37  in2637  CNNOO82O  20.22  19.42  0.80  -0.13  0.93  0.52  in2637  CNNO 1890  18.99  19.42  -0.43  -0.67  0.24  0.85  in2637  CNNO2400  18.27  19.42  -1.15  -0.62  -0.53  1.44  JEC2 1  SMG1  17.52  19.00  -1.48  -0.14  -1.34  2.53  JEC2 1  CNNOO82O  18.70  19.00  -0.30  -0.13  -0.17  1.13  JEC2 1  CNNO189O  18.29  19.00  -0.71  -0.67  -0.04  1.03  IEC2 1  CNNO2400  18.45  19.00  -0.55  -0.62  0.07  0.95  JP1086  SMG1  18.42  19.05  -0.63  -0.14  -0.49  1.40  JP1086  CNNOO82O  19.64  19.05  0.59  -0.13  0.72  0.61  JP1086  CNNO189O  18.74  19.05  -0.31  -0.67  0.36  0.78  JP1086  CNNO2400  18.26  19.05  -0.79  -0.62  -0.17  1.13  RT31-mix  SMG1  18.33  19.01  -0.68  -0.14  -0.54  1.45  RT31-mix  CNNOO82O  18.69  19.01  -0.32  -0.13  -0.19  1.14  1.63  0.32  -0.82  1.77  ACtgenome  RT31-mix  CNNO189O  19.97  19.01  0.96  -0.67  RT31-mix  CNNO2400  17.57  19.01  -1.44  -0.62  197  APPENDIX D  Table D.34 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO82O locus is on CHR 13. The SMG1 locus and 0O_707 locus are located on CHR 4. Nonnalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 .Ct) 2 (  H99  SMG1  17.39  17.25  0.14  0.14  0.00  1.00  H99  CNNOO82O  17.03  17.25  -0.22  -0.22  0.00  1.00  H99  CNNO189O  17.22  17.25  -0.03  -0.03  0.00  1.00  H99  CNNO2400  16.46  17.25  -0.79  -0.79  0.00  1.00  JEC2 1  SMG1  17.96  18.98  -1.02  0.14  -1.16  2.23  JEC2 1  CNNOO82O  18.58  18.98  -0.40  -0.22  -0.18  1.13  JEC2 1  CNNO1 890  18.69  18.98  -0.29  -0.03  -0.26  1.20  JEC2 1  CNNO2400  18.50  18.98  -0.48  -0.79  0.31  0.81  RT23- I  SMG1  19.28  19.72  -0.44  0.14  -0.58  1.49  RT23- 1  CNNOO82O  19.07  19.72  -0.65  -0.22  -0.43  1.35  RT23-1  CNNO189O  22.25  19.72  2.53  -0.03  2.56  0.17  RT23-1  CNNO2400  18.87  19.72  -0.85  -0.79  -0.06  1.04  RT23-2  SMGI  19.30  19.78  -0.48  0.14  -0.62  1.54  RT23-2  CNNOO 820  19.14  19.78  -0.64  -0.22  -0.42  1.34  RT23-2  CNNO189O  21.62  19.78  1.84  -0.03  1.87  0.27  RT23-2  CNNO2400  18.89  19.78  -0.89  -0.79  -0.10  1.07  RT23-3  SMG1  19.21  19.44  -0.23  0.14  -0.37  1.29  RT23-3  CNNOO82O  19.15  19.44  -0.29  -0.22  -0.07  1.05  RT23-3  CNNO 1890  20.02  19.44  0.58  -0.03  0.61  0.66  RT23-3  CNNO2400  18.30  19.44  -1.14  -0.79  -0.35  1.27  RT31-1  SMG1  19.78  20.52  -0.74  0.14  -0.88  1.84  RT31-1  CNNOO82O  19.56  20.52  -0.96  -0.22  -0.74  1.67  RT31-1  CNNO189O  28.24  20.52  7.72  -0.03  7.75  0.00  RT31-1  CNNO2400  19.44  20.52  -1.08  -0.79  -0.29  1.22  198  APPENDIX D  Table D.35 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO82O locus is on CHR 13. The SMG1 locus and OO_707 locus are located on CHR 4. Nonnalized gene copy numbers which are higher than 1.5 are highlighted  in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99 JEC21 arg1366 RT23-1 RT23-2 RT23-3 RT31-MIX RT31-1  SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1 SMG1  16.99 17.49 18.26 18.57 18.78 19.70 17.85 19.43  16.99 18.84 19.10 19.37 19.38 19.13 18.55 20.71  0.00 -1.35 -0.84 -0.80 -0.60 0.57 -0.70 -1.28  0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00  0.00 -1.35 -0.84 -0.80 -0.60 0.57 -0.70 -1.28  1.00 2.55 1.79 1.74 1.52 0.67 1.62 2.43  H99  JEC2 1 argi 366 RT23-1 RT23-2 RT23-3 RT3 1 -MIX RT3 1-1  CNNOO82O CNNOO82O CNNOO82O CNNOO 820 CNNOO82O CNNOO82O CNNOO82O CNNOO82O  17.00 18.64 18.42 18.87 19.13 19.07 18.06 19.70  16.99 18.84 19.10 19.37 19.38 19.13 18.55 20.71  0.01 -0.20 -0.68 -0.50 -0.25 -0.06 -0.49 -1.01  0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01  0.00 -0.21 -0.69 -0.51 -0.26 -0.07 -0.50 -1.02  1.00 1.16 1.61 1.42 1.20 1.05 1.41 2.03  1199 JEC21 arg1366 RT23-1 RT23-2 RT23-3 RT31-MIX RT31-1  CNNO2400 CNNO2400 CNNO2400 CNNO2400 CNNO2400 CNNO2400 CNNO2400 CNNO2400  16.89 18.75 18.61 19.21 19.11 18.91 17.86 20.37  16.99 18.84 19.10 19.37 19.38 19.13 18.55 20.71  -0.10 -0.09 -0.49 -0.16 -0.27 -0.22 -0.69 -0.34  -0.10 -0.10 -0.10 -0.10 -0.10 -0.10 -0.10 -0.10  0.00 0.01 -0.39 -0.06 -0.17 -0.12 -0.59 -0.24  1.00 0.99 1.31 1.04 1.13 1.09 1.51 1.18  199  APPENDIX D  Table D.36 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO 820 locus is on CHR 13. The SMG 1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted  in yellow. Strain  Primer  Ct(Avg.) test gene  Ct (Avg.) Actin  Act  gene  ACtgenome  AACt  Normalized gene copy number relative to H99 t) 2 (  H99  JEC21 arg1366 RT23-1 RT23-2 RT23-3  00_707 00 707  16.53 18.44  00_707  18.19 18.67  00_707 00_707 00_707  18.96 18.67  H99  SMG1  16.94  JEC21  SMG1  17.86  arg1366  SMG1  18.67  RT23-1  SMG1  RT23-2 RT23-3  17.10 18.98 19.32 19.67 19.92  -0.57 -0.54 -1.13  -0.57  -1.00  -0.57 -0.57  0.00 0.03 -0.56  1.00 0.98 1.47  -0.57 -0.57 -0.57  -0.43 -0.39 -0.14  1.35 1.31  1.00 1.95  19.38  -0.96 -0.71  17.10 18.98  -0.16 -1.12  -0.16 -0.16  0.00 -0.96  -0.65  -0.16  -0.49  1.40  19.02  19.32 19.67  -0.65  -0.16  -0.49  SMG1  19.15  19.92  -0.16  SMG1  18.93  19.38  -0.77 -0.45  -0.61 -0.29  1.40 1.53  -0.16  1.10  1.22  Table D.37 qRT-PCR results for a select number of freshly isolated clinical strains. The CNNOO 820 locus is on CHR 13. The SMG 1 locus and 00_707 locus are located on CHR 4. Normalized gene copy numbers which are higher than 1.5 are highlighted in yellow. Primer Ct(Avg.) Ct (Avg.) Act gene Strain AACt Normalized gene copy ACtgenome test gene Actin number relative to H99 t) 2 (  H99  00_707  16.07  17.17  0.00  1.00  0O_707  17.92  18.93  -1.10 -1.01  -1.10  JEC21  -1.10  0.09  0.94  tn470  00707  17.92  19.44  -1.52  -0.42  1.34  C8 RT31-Mix  00 707  17.20  19.19  -1.99  -1.10 -1.10  17.47 20.32  18.87 21.38  -1.40 -1.06  -1.10  1.85 1.23  RT31-1  00_707 00_707  -0.89 -0.30  -1.10  0.04  0.97  H99  SMG1  14.69  17.17  -2.48  -2.48  0.00  1.00  -0.93  1.91  -0.37 -0.42 -0.91 -2.04  1.29 1.33 1.88  SMG1  15.52  18.93  C8 RT31-Mix  SMGI SMGI SMG1  16.59 16.29 15.48  19.44 19.19  -3.41 -2.85 -2.90  -2.48 -2.48 -2.48  RT31-1  SMG1  16.86  18.87 21.38  -3.39 -4.52  -2.48 -2.48  JEC21 tn470  4.11  200  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067034/manifest

Comment

Related Items